In ternationa l Scholars Journa ls African Journal of Pig Farming ISSN 2375-0731 Vol. 3 (4), pp. 001-005, April, 2015. Available online at www.internationalscholarsjournals.org © International Scholars Journals Author(s) retain the copyright of this article. Full Length Research Paper Prevalence and antimicrobial susceptibility of bacterial pathogens isolates from diseased swine in southwest, China Xu-Ting Li*, Bin Wang, Jin-Liang Li, Fu-Qiang Zeng and Xue Gong Sichuan Animal Science Academy, Chengdu, China, 610066, China. Accepted 22 September, 2014 The purpose of this study was to investigate the prevalence of antimicrobial resistance in the clinical bacterial isolates from diseased swine in southwest, China during 2009-2010. A total of 504 bacterial isolates (19 species) were collected from the 364 clinical samples. The activity of 6-14 antibiotics to each bacterial species was examined. The sensitivity was tested by the disk diffusion method and performed according to CLSI guidelines in Mueller-Hinton agar. The most common pathogens were Escherichia coli (n=154; 30.56%), Staphylococcus spp. (n=110; 21.83%), Enterococcus faecalis (n=58; 11.51%), Klebsiella pneumoniae (n=44; 8.73%), Proteus mirabilis (n=43; 8.53%) and Streptococcus suis (n=30; 5.93%). All isolates revealed high level of resistance to ampicillin (47.6-100%), amoxicillin (52.6-100%), cephalothin (29-100%), norfloxacin (52.6-83.3%), gentamicin (45.1-83.3%) and terramycin (61.9-100%). Moreover, 93% of the isolates exhibited multiple drug resistance (MDR; resistance ≥ 3 antimicrobials). Only ticarcillin/clavulanate exhibited very high activity against E. coli (98.1%), Staphylococcus spp. (91.9%), K. pneumaniae (92.3%) and P. mirabilis (97.2%), respectively. These findings suggest that antimicrobial resistance of bacterial pathogens isolates is commonly present among diseased swine in Southwest, China, and they also suggest the need for more prudent use of antibiotics by farmers and veterinarians. Key words: Identification, antimicrobial susceptibility, pathogen, swine. INTRODUCTION As acute infections and outbreaks of infectious diseases in groups or herds become more common, use of an effective antimicrobial treatment as early as possible is critically important. The empirical treatment is generally based on knowledge of the resistance patterns of the different bacterial pathogens toward antimicrobial agents used in the particular animal species. Uncontrolled usage of antimicrobial agents is recognized as the most important factor that favors the development and spread of resistant microorganisms (Van den Bogaard and Stobberingh, 1999; White, 2002). The digestive tracts of *Corresponding author. E-mail: lixutingzy@163.com. pigs can harbor antimicrobial-resistant bacteria among the commensal flora, which contain a reservoir of antibiotic- resistance genes potentially transmissible to humans through the food chain and environment (Caprioli et al., 2000). In addition to the human health concerns, antimicrobial-resistant pathogens also pose a severe and costly health problem in that they may prolong illness and decrease productivity through higher morbidity and mortality (Yang, 2004). However, data on the prevalence of antimicrobial-resistant veterinary pathogens are sparse, particularly in Southwest, where animal husbandry was more developed than other area. Therefore, the purpose of this study was to investigate the prevalence of bacterial infection and resistance to antimicrobial agents in the clinical isolates obtained from diseased swine in Southwest, China. MATERIALS AND METHODS Clinical samples 364 Samples, including lungs, lymph nodes, livers, hearts, spleens, kidneys, and blood (obtained between May 2009 and July 2010) were collected from 72 pig farms in southwestern China. All the samples were obtained from diseased pigs which had at least one of the following symptoms: septicemia, arthritis, enteritis, meningitis, pneumonia, pleuritis, diarrhea, edema, fever, pneumonia, endocarditis, and dysentery. Before sampling, all samples surface were being asepsis by burning of ethanol. Aseptically collected samples were appropriately processed and seeded in chocolate agar and blood agar. All of the samples were transported to the laboratory of Sichuan Animal Science Academy for bacterial counts and isolation within 6 h. Bacteria isolation The strains were incubated at 37°C for 18-24 h. One loo p-full from each enrichment were streaked on tryptic soy agar, blood agar (5% fresh rabbit blood), MacConkey agar (Tianhe Microorganism Reagent Co., Ltd.) and Salmonella-Shigella agar respectively. All plates were incubated at 37°C in air for 24 h and pur ified by standard methods (Murray et al., 2003). Single colony was obtained from the isolates and stored in Luria-Bertani containing 20% glycerol, at –80°C until use. No replicate isolates f rom the same samples were used. All media agar were purchased from Tianhe Microorganism Reagent Co., Ltd. Bacteria identification Identification was based on colony type and morphology, Gram staining characteristics, and standard biochemical tests. All isolates were identified at species level by VITEK (Vitek System, bioMerieux).They were also confirmed using primers 27F (5' AGA GTT TGA TCC TGG CTC AG 3’) and 1492R (5' TAC GGC TAC CTT GTT ACG ACT T 3’) by the polymerase chain reaction (PCR) assay (Wilson, 1990). The template DNA was prepared by suspending an overnight cultured of bacteria in 400 µL Milli-Q water. The suspensions were heated at 95°C for 5 mi n and centrifuged at 13,000 rpm for 5 min. Each 50 µL of PCR mixture consisted of 4 µL of template, 5 µL 10×PCR Buffer, 1.5 mM MgCl 2, 200 µM dNTP, 0.4 µM each of the seven primers and 2.5 U Taq DNA polymerase. PCR was performed in a DNA thermal cycler (Bio-Rad, Hercules, CA) using the following program: an initial denaturation step at 94°C for 5 min, 30 cycles of den aturation at 94°C for 1 min, annealing at 50°C for 1 min and exte nsion at 72°C for 1.5 min, followed by a final elongation at 72°C for 10 min. The amplified PCR products were analyzed on 0.8% (w/v) agarose gels. Subsequently, the PCR product was sequenced by Shanghai Sangon Bioengineering Co., Ltd. The nucleotide sequences were analyzed with software (BLAST) available from the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov). Antimicrobial susceptibility Susceptibility to 15 antimicrobial agents, ampicillin (AMP; 10 µg), ampicillin/sulbactam (SAM; 10/10 µg), ticarcillin (TIC; 75 µg), amoxicillin (AMO; 10 µg), amoxicillin/clavulanate (AMC; 20/10µg), ticarcillin/clavulanate (TIM; 75/10 µg), cephalothin (KF; 30 µg), ceftiofur (EFT;30 µg), gentamicin (CN; 10 µg), amikacin (AMK; 30 µg), terramycin (OT; 30 µg), erythromycin (E; 15 µg), clindamycin (DA; 2 µg), norfloxacin (NOR; 10 µg) and ciprofloxacin (CIP; 5 µg), were tested by the disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI, 2009). The control strains used for all susceptibility tests were E. coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853 and Staphylococcus aureus ATCC 29213. Detection of blaTEM resistance genes The template DNA was prepared as described above. The forward primer ATGAGTATTCAACATTTCCGTG and the reverse primer TTACCA ATGCTTA ATCAGTGAG were used to amplify the blaTEM gene by following procedure: an initial denaturation step of 94°C for 5 min, 30 cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min and extension at 72°C for 1 min, foll owed by a final elongation at 72°C for 10 min. Amplified PCR products were analyzed on 0.8% (w/v) agarose gels. The PCR product was sequenced and analyzed as above. RESULTS Bacterial isolates 504 bacterial isolates (which belong to19 difference species) were collected from the 364 clinical samples. The isolates were all obtained between May 2009 and July 2010 from diseased pigs, including suckling pigs, nursery pigs, grower pigs and grower-finisher pigs. The results revealed that E. coli (n=154; 30.56%) was the most widespread bacterial isolates, followed by Staphylococcus spp. (n=110; 21.83%), E. faecalis (n=58; 11.51%), K. pneumoniae (n=44; 8.73%), P. mirabilis (n=43; 8.53%) and S. suis (n=30; 5.93%). Only 7 H. parasuis (1.39%) and 6 P. multocida (1.19%) isolates were obtained from all clinical samples. Antimicrobial susceptibility The majority of enterobacteria, including E. coli, K. pneumoniae and P. mirabilis, were resistant to ampicillin (88.4 to 100%), amoxicillin (92.3 to 100%), ticarcillin (50 to 76.9%), norfloxacin (61.5 to 83.3%), ciprofloxacin (67.3 to 83.3%) and terramycin (98 to 100%), and they were susceptibility to ticarcillin/clavulanate, ampicillin/sulbactam and amoxicillin/clavulanate. The Gram-positive bacteria showed resistance to erythromycin (57.1 to 71.4%), clindamycin (79.6 to 85.7%), ampicillin (47.6 to 52.6%), amoxicillin (52.6 to 76.2%) and terramycin (61.9 to 84.2%) and were susceptibility to ceftiofur, ticarcillin/clavulanate, ampicillin/sulbactam and amoxicillin/clavulanate (Table 1). In addition, most isolates from the swine were resistant to multiple classes of antimicrobial agents. Four hundred and seventy (93.25%) isolates from diseased swine were resistant to at least 3 of the 15 antimicrobial agents. 50 (9.92%), 83 (16.47%), 133 (26.39%), 144 (30.56%) and 50 (9.92%) isolates were resistant to 3, 4, 5, 6 and 7 antimicrobial agents, respectively. blaTEM resistance genes detection Based on the results of the susceptibility tests, 154 E. coli, 44 K. pneumoniae and 43 P. mirabilis were selected to amplify the blaTEM genes. The PCR analysis and sequencing showed that 140 (92.1%) E. coli, 44 (100%) K. pneumoniae and 42 (97.67%) P. mirabilis isolates harbored a blaTEM1 gene. DISCUSSION To investigate the prevalence of bacterial infections in swine in southwest, China, a total of 504 bacterial isolates (19 species) were collected and identified from the 364 clinical samples. The results revealed that E. coli and the Staphylococcus spp. were the most widespread bacterial isolates. In swine, E. coli is an important pathogenic bacteria including enterotoxigenic (ETEC) and extracellular pathogenic E. coli (ExPEC) strains which are common causes of a variety of clinical syndromes, including urinary tract infections, abdominal infections, pneumonia, neonatal meningitis, sepsis, neonatal and post weaning diarrhea and edema (Yang, 2004; Wada et al., 2004; Nazareth et al., 2007; Boerlin et al., 2005). E. faecalis (n=58; 11.51%), K. pneumoniae (n=44; 8.73%), P. mirabilis (n=43; 8.53%) and S. suis (n=30; 5.93%) were the another four frequent isolates. E. faecalis is intrinsical not as virulent as other Gram-positive organisms, such as S. aureus, S. pneumoniae and S. suis Type 2 (Bittencourt, 2004; Gaspar et al., 2009). It emerges as an opportunistic pathogen, nevertheless, it is known to cause serious infections such as bacteraemia, septicaemia, urinary tract infections, wound infections, meningitis and endocarditis (Giacometti et al., 2000; Hershberger et al., 2005; Hällgren et al., 2003; Hébert et al., 2007). K. pneumoniae is also an opportunistic pathogen that responsible for a wide range of infection in humans and animals, such as urinary tract infections, pneumonia, wound infections and septicemia (Podschun and Ullmann, 1998; Brisse and Duijkeren, 2005). P. mirabilis is also often found in human as opportunistic pathogens (Zych et al., 2001). S. suis, especially the serotype 2, is an important swine pathogen causing meningitis, septicemia, endocarditis, and arthritis (Marie et al., 2002; Lun et al., 2007; Domínguez-Punaro et al., 2007; Ma et al., 2009). In 2005, an Streptococcal Toxic Shock Syndrome (STSS) human outbreak caused by S. suis serotype 2 was found in Sichuan province with 38 human deaths and over 200 human infections, and more than 640 pigs were found to be severely infected (Yu et al., 2006). Although other zoonotic bacterial such as Salmonella spp., H. parasuis, P. multocida and Actinobacillus spp. were lesser, they showed higher mortality and morbidity. The traditional zoonotic E. coli, Staphylococcus spp., S. suis and opportunistic E. faecalis, K. pneumoniae, P. mirabilis were the main pathogens in swine in Southwest, China. The enterobacteria were resistant to β-lactams, tetracyclines and aminoglycosides as previously described in China (Chang et al., 2002; Yang et al., 2004; Liu et al., 2007; Tian et al., 2009). The E. coli isolates assessed in this study displayed similar levels of resistance to tetracyclines, ampicillin, gentamicin and fluoroquinolones as were previously reported for E. coli strains isolated from diseased swine in China by Tian et al. (2009). High levels of resistance to tetracycline (~60-95%) have also been detected in E. coli isolates recovered from apparently healthy swine on-farm or at slaughter in other countries (Kozak et al., 2003; Kijima-Tanaka et al., 2003; Teshager et al., 2000; Blake et al., 2003). Most of E. coli isolates (67.3%) from swine were resistant to fluoroquinolones (e.g. norfloxacin and ciprofloxacin). Somewhat similar findings have been reported in a recent study of clinical E. coli isolates from swine by Wang et al., 2010. Resistance to amoxicillin-clavulanic acid does not occur frequently in E. coli isolates from diseased swine in China before 2004 (Yang et al., 2004), but 21.1% of our swine isolates were resistant to this antibiotic-inhibitor combination. In the present study, amikacin exhibited moderate activity against all strains tested. Interestingly, fewer reports of antimicrobial resistance in K. pneumoniae isolated from swine have been published in China. In the present study, K. pneumoniae was the sixth most frequently encountered pathogen in swine and showed high resistance to antimicrobial. K. pneumoniae isolates may be naturally resistant to ampicillin, amoxicillin, carbenicillin, and ticarcillin, but not to extended-spectrum β-lactam antibiotics due to a constitutively expressed chromosomal class A β-lactamase (Haeggman et al., 2004). In the present study, the degree of resistance to cephalothin and ceftiofur was 100 and 48.2%, respectively. The antibiotic-inhibitor combination revealed actively to K. pneumoniae. This could be due to the wide use of these classes of cephalosporins in husbandry activities and the considerable increase in prevalence of ESBL-producing and multiple-antimicrobial-resistant isolates from pig farms (Yang et al., 2004; Tian et al., 2009). Another important observation in this study is that the ceftiofur resistance has increased. Ceftiofur is the only extended-spectrum cephalosporin approved for veterinary use in many countries (Salmon et al., 1995). Because ceftiofur-resistant organisms are cross resistant to ceftriaxone, the use of this antimicrobial agent in food animals has come under increasing scrutiny as a selective agent potentially responsible for the emergence and dissemination of ceftriaxone resistance in Salmonella and other enteric pathogens (Alcaine et al., 2005). The rate of resistance to ceftiofur were (9.6%) E. coli, (48.2%) K. pneumoniae, (30.1%) P. mirabilis and (23.8%) S. suis isolates in this study, respectively. These findings are Table 1. Antibiotic resistance in the clinical bacterial isolates. Antimicrobial Resistance(%) a agent E. coli K. pneumoniae P. mirabilis Staphylococcus S. suis E. faecalis d Others AMP 88.4 100.0 100.0 51.0 47.6 52.6 67.7 AML 92.3 100.0 100.0 61.2 76.2 52.6 80.6 TIC 73.0 76.9 50.0 - - - 61.2 SAM 19.2 15.3 16.6 10.2 - - 9.6 AMC 21.1 15.3 16.6 10.2 - - 12.9 TIM 1.9 7.7 2.8 8.1 - - 6.4 KF 40.3 100.0 35.2 40.8 52.3 - 29.0 EFT b 9.6 48.2 30.1 12.2 23.8 - 16.1 E - - - 65.3 57.1 71.4 - DA - - - 79.6 85.7 - - NOR 67.3 61.5 83.3 59.1 - 52.6 54.8 CIP 67.3 69.2 83.3 51.0 - 36.8 45.1 CN 55.7 46.1 83.3 44.9 - - 45.1 AMK 44.2 46.1 16.6 30.6 - - 51.6 OT c 98.0 100.0 100.0 83.6 61.9 84.2 87.1 a Breakpoints are those recommended by the Clinical and Laboratory Standards Institute (CLSI);. –, no CLSI breakpoints were available, b According to cefotaxime, c According to tetracycline, d including Shigella spp.,Salmonella spp., H. parasuis, A. lwoffii, P. multocida (Aarestrup, 2004). AMP, ampicillin; AML, amoxicillin; TIC, ticarcillin; TIM, ticarcillin/clavulanate; SAM, ampicillin/sulbactam; AMC, amoxicillin/clavulanate; KF, cephalothin; EFT, ceftiofur; E, erythromycin; DA, clindamycin; NOR, norfloxacin; CIP, ciprofloxacin; CN, gentamicin; AMK, amikacin; OT, terramycin. very significant difference to the previous reports which displayed high actively to ceftiofur (Marie et al., 2002; Yang et al., 2004; Morioka et al., 2005; Zhou et al., 2010: Wang et al., 2010). The high incidence of ceftiofur resistance in the K.pneumoniae, P. mirabilis and S. suis isolates tested herein was somewhat unexpected, as this drug was introduce into veterinary clinics for use in China only 2 to 3 years ago. Of all the 154 E. coli, 44 K. pneumoniae and 43 P. mirabilis, 140 (92.1%), 44 (100%) and 42 (97.67%) isolates harboured a blaTEM1 gene. The results of the study indicated that TEM-1 was the most common β-lactamase gene among the K. pneumoniae and E. coli isolates, in agreement with previous studies that reported a high prevalence of the blaTEM-1 gene among animal E. coli isolates (Liu et al., 2007; Rayamajhi et al., 2008; Li et al., 2007; Chander et al., 2011). In conclusion, our results confirmed a different prevalence of bacterial infection in swine during 2009- 2010, in Southwest, China. The E. coli, Staphylococcus spp., S. suis , E. faecalis, K. pneumoniae and P. mirabilis isolates are commonly present among diseased swine. Here we have shown that bacterial pathogens from diseased swine exhibited high level resistance to a large number of antimicrobial agents. If this situation continues, there will be no effective antibiotic therapeutic reserve for some bacterial infections. In the future, the data from monitoring programs and resistance studies should be taken into account for the usage of antimicrobials in veterinary medicine. ACKNOWLEDGEMENT This work was supported by the Sichuan Animal Science Academy. REFERENCES Alcaine SD, Sukhnanand SS, Warnick LD, Su WL, Mcgann P, McDonough P, Wiedmann M (2005). Ceftiofur-resistant Salmonella strains isolated from dairy farms represent multiple widely distributed subtypes that evolved by independent horizontal gene transfer. Antimicrob. Agents Chemother. 49: 4061-4067. Blake DP, Humphry RW, Scott KP, Hillman K, Fenlon DR, Low JC (2003). Influence of tetracycline exposure on tetracycline resistance and the carriage of tetracycline resistance genes within commensal Escherichia coli populations. J. Appl. Microbiol. 94: 1087–1097. Bittencourt de Marques E, Suzart S (2004). Occurrence of virulence- associated genes in clinical Enterococcus faecalis strains isolated in Londrina, Brazil. J. Med. Microbiol. 53: 1069–1073. Boerlin P, Travis R, Gyles CL, Reid-Smith R, Janecko N, Lim H, Nicholson V, McEwen SA, Friendship R, Archambault M (2005). Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario. Appl. Environ. Microbiol. 71: 6753– 6761. Brisse S, Duijkeren E (2005). Identification and antimicrobial susceptibility of 100 Klebsiella animal clinical isolates. Vet. Microbiol. 105: 307-312. Caprioli A, Busani L, Martel JL, Helmuth R (2000). Monitoring of antibiotic resistance in bacteria of animal origin: epidemiological and microbiological methodologies. Int. J. Antimicrob. Agents. 14: 295– 301. Chander Y, Oliveira S, Goyal SM (2011). Characterization of ceftiofur resistance in swine bacterial pathogens. Vet. J. 187: 139-141. Chang CF, Chang LC, Chang YF, Chen M, Chiang TS (2002). Antimicrobial susceptibility of Actinobacillus pleuropneumoniae, Escherichia coli, and Salmonella choleraesuis recovered from Taiwanese swine. J. Vet. Diagn. Invest. 14: 153–157. Clinical and Laboratory Standards Institute (CLSI) (2009). Performance standards for antimicrobial susceptibility testing: 19th informational supplement M100-S19. Wayne, PA, USA. Domínguez-Punaro MC, Segura M, Plante MM, Lacouture S, Rivest S, Gottschalk M (2007). Streptococcus suis Serotype 2, an important swine and human pathogen, induces strong systemic and cerebral inflammatory responses in a mouse model of infection. J. Immunol. 179: 1842-1854. Gaspar F, Teixeira N, Rigottier-Gois L, Marujo P, Nielsen-LeRoux C, Crespo MT, Lopes Mde F, Serror P (2009). Virulence of Enterococcus faecalis dairy strains in an insect model: the role of fsrB and gelE. Microbiology, 155: 3564-3571. Giacometti A, Cirioni O, Schimizzi AM, Del Prete MS, Barchiesi F, D'Errico MM, Petrelli E, Scalise G (2000). Epidemiology and microbiology of surgical wound infections. J. Clin. Microbiol. 38: 918– 922. Haeggman S, Löfdahl S, Paauw A, Verhoef J, Brisse S (2004). Diversity and evolution of the class A chromosomal beta-lactamase gene in Klebsiella pneumoniae. Antimicrob Agents Chemother. 48: 2400-2408. Hällgren A, Saeedi B, Nilsson M, Monstein HJ, Isakson B, Hanberger H, Nilsson LE (2003). Genetic relatedness among Enterococcus faecalis with transposon-mediated high-level gentamicin resistance in Swedish intensive care units. J. Antimicrob. Chemother. 52: 162– 167. Hébert L, Courtin P, Torelli R, Sanguinetti M, Chapot-Chartier MP, Auffray Y, Benachour A (2007). Enterococcus faecalis constitutes an unusual bacterial model in lysozyme resistance. Infect. Immun. 75: 5390–5398. Hershberger E, Oprea SF, Donabedian SM, Perri M, Bozigar P, Bartlett P, Zervos MJ (2005). Epidemiology of antimicrobial resistance in enterococci of animal origin. J. Antimicrob. Chemother. 55: 127-130. Kijima-Tanaka M, Ishihara K, Morioka A, Kojima A, Ohzono T, Ogikubo K, Takahashi T, Tamura Y (2003). A national surveillance of antimicrobial resistance in Escherichia coli isolated from food-producing animals in Japan. J. Antimicrob. Chemother. 51: 447-451. Kozak GK, Boerlin P, Janecko N, Reid-Smith RJ, Jardine C (2009). Antimicrobial Resistance in Escherichia coli Isolates from Swine and Wild Small Mammals in the Proximity of Swine Farms and in Natural Environments in Ontario, Canada. Appl. Environ. Microbiol., 75: 559– 566. Li XZ, Mehrotra M, Ghimire S, Adewoye L (2007). β-Lactam resistance and b-lactamases in bacteria of animal origin. Vet. Microbiol., 121: 197–214. Liu JH, Wei SY, Ma JY, Zeng ZL, Lü DH, Yang GX, Che n ZL (2007). Detection and characterisation of CTX-M and CMY-2 beta- lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China. Int. J. Antimicrob. Agents, 29: 576– 581. Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ (2007). Streptococcus suis: An emerging zoonotic pathogen. Lancet. Infect. Dis., 7: 201- 209. Ma Y, Feng Y, Liu D, Gao GF (2009). Avian influenza virus, Streptococcus suis serotype 2, severe acute respiratory syndrome- coronavirus and beyond: molecular epidemiology, ecology and the situation in China. Philos. Trans. R. Soc. Lond B. Biol. Sci., 364: 2725–2737. Marie J, Morvan H, Berthelot-Hérault F, Sanders P, Kempf I, Gautier- Bouchardon AV, Jouy E, Kobisch M (2002). Antimicrobial susceptibility of Streptococcus suis isolated from swine in France and from humans in different countries between 1996 and 2000. J. Antimicrob. Chemother. 50: 201–209. Morioka A, Asai T, Ishihara K, Kojima A, Tamura Y, Takahashi T (2005). In vitro activity of 24 antimicrobial agents against Staphylococcus and Streptococcus isolated from diseased animals in Japan. Vet. Med. Sci. 67(2): 207-210. Nazareth H, Genagon SA, Russo TA (2007). Extra intestinal pathogenic Escherichia coli survive within neutrophils. Infect. Immun., 75: 2776– 2785. Podschun R, Ullmann U (1998). Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev., 11: 589–603. Rayamajhi N, Kang SG, Lee DY, Kang ML, Lee SI, Park KY, Lee HS, Yoo HS (2008). Characterization of TEM-, SHV- and AmpC-type beta-lactamases from cephalosporin-resistant Enterobacteriaceae isolated from swine. Int. J. Food. Microbiol., 124: 183–187. Salmon SA, Watts JL, Case CA, Hoffman LJ, Wegener HC, Yancey Jr. RJ (1995). Comparison of MICs of ceftiofur and other antimicrobial agents against bacterial pathogens of swine from the United States, Canada, and Denmark. J. Clin. Microbiol., 33: 2435-2444. Teshager T, Herrero IA, Porrero MC, Garde J, Moreno MA, Domínguez L (2000). Surveillance of antimicrobial resistance in Escherichia coli strains isolated from pigs at Spanish slaughterhouses. Int. J. Antimicrob. Agents, 15: 137-142. Tian GB, Wang HN, Zou LK, Tang JN, Zhao YW, Ye MY, Tang JY, Zhang Y, Zhang AY, Yang X, Xu CW, Fu YJ (2009). Detection of CTX-M-15, CTX-M-22, and SHV-2 extended-spectrum β- lactamases (ESBLs) in Escherichia coli fecal-sample isolates from pig farms in China. Food borne. Pathog. Dis. 6: 297-304. Van Den Bogaard AE, Stobberingh EE (1999). Antibiotic usage in animals: impact on bacterial resistance and public health. Drugs, 58: 589–607. Wada Y, Kato M, Yamamoto S, Shibahara T, Ishikawa Y, Kadota K (2004). Invasive Aability of Escherichia coli O18 isolated from swine neonatal diarrhea. Vet. Pathol., 41: 433–437. Wang XM, Liao XP, Zhang WJ, Jiang HX, Sun J, Zhang MJ, He XF, Lao DX, Liu YH (2010). Prevalence of serogroups, virulence genotypes, antimicrobial resistance, and phylogenetic background of avian pathogenic Escherichia coli in south of China. Foodborne Pathog. Dis., 7: 1099-1106. White DG, Zhao S, Simjee S, Wagner DD, McDermott PF (2002). Antimicrobial resistance of foodborne pathogens. Microbes. Infect., 4: 405–412. Wilson KH, Blitchington RB, Greene RC (1990). Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. J. Clin. Microbiol., 28: 1942-1946. Yang H, Chen S, White DG, Zhao S, McDermott P, Walker R, Meng J (2004). Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. J. Clin. Microbiol., 42: 3483–3489. Yu H, Jing H, Chen Z, Zheng H, Zhu X, Wang H, Wang S, Liu L, Zu R, Luo L, Xiang N, Liu H, Liu X, Shu Y, Lee SS, Chuang SK, Wang Y, Xu J, Yang W (2006). Streptococcus suis study groups: Human Streptococcus suis outbreak, Sichuan, China. Emerg. Infect. Dis., 12: 914-920. Zhou X, Xu X, Zhao Y, Chen P, Zhang X, Chen H, Cai X (2010). Distribution of antimicrobial resistance among different serovars of Haemophilus parasuis isolates. Vet. Microbiol., 141: 168-173. Zych K, Toukach FV, Arbatsky NP, Kolodziejska K, Senchenkova SN, Shashkov AS, Knirel YA, Sidorczyk Z (2001). Structure of the O- specific polysaccharide of Proteus mirabilis D52 and typing of this strain to proteus serogroup O33. Eur. J. Biochem., 268: 4346-4351.