In ternationa l Scholars Journa ls African Journal of Pig Farming ISSN 2375-0731 Vol. 8 (3), pp. 001-007, March, 2020. Available online at www.internationalscholarsjournals.org © International Scholars Journals Author(s) retain the copyright of this article. Full Length Research Paper Tetracycline resistance genes in Pasteurella multocida isolates from bovine, ovine, caprine and swine pneumonic lungs originated from different Greek prefectures Maria Babetsa1,2, Vassilios Sandalakis4,5, Christina Vougidou3, Antonios Zdragas1, Afroditi Sivropoulou2, Anna Psaroulaki4,5 and Loukia V. Ekateriniadou1* 1 National Agricultural Research Foundation, N.AG.RE.F., Veterinary Research Institute of Thessaloniki, N.AG.RE.F Campus of Thermi, 57001, Thermi, Thessalonki, Greece. 2 Department of Biology, Aristotle University of Thessaloniki, Campus of Thessaloniki 54124, Thessaloniki, Greece. 3 Institute of Infectious and Parasitic Diseases of Thessaloniki, Ministry of Rural Development and Food, 54627, Thessaloniki, Greece. 4 Regional Laboratory of Public Health of Crete, 71110, Heraklion, Crete, Greece. 5 Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, WHOcc, University of Crete, 71110, Heraklion, Crete, Greece. Accepted 13 October, 2019 The aim of the present work was to analyze the antibiotic resistance of Pasteurella multocida isolates from sheep, goats, cattle and pigs originated from eight different Greek prefectures, to determine the class(es) of the tet genes, to investigate any possible association with plasmids or/and chromosomes and to study the geographical distribution of the resistant isolates. Eighteen out to one hundred isolates were resistant to tetracycline with a minimal inhibitory concentration (MIC) higher than 128 μg/ml. The tetH gene was found in thirteen (72.2%) and the tetB gene was found in four isolates (22.2%). After treatment with the restriction enzymes EcoRV, EcoRI, PstI and BspHI, the tetB gene showed a new polymorphism. Partial sequencing of the tetH and tetB genes revealed five polymorphisms in the tetB gene and two polymorphisms in the tetH gene; phylogenetic and molecular evolutionary analyses were also conducted. Both tetB and tetH genes revealed patterns clearly differentiated from the rest of Pasteurella species meaning that the genes could be transferred from a non Pasteurella species. The results presented provide further knowledge and evidence of the role played by commensals as of resistance determinants. Key words: Pasteurella multocida, tet genes, multiple sequence analysis. INTRODUCTION Pasteurella multocida causes economically important diseases in food-producing animals and exhibits *Corresponding author. E-mail: ekateriniadou@vri.gr. Tel: +302310365392. Fax: +302310365371. resistance to a large number of antimicrobial agents; as a result a limited number of antimicrobial agents is available for treatment including, sulphonamides, tetracycline and streptomycin. The use of tetracycline, for both the treatment and the prevention of diseases in which P. multocida is involved, results in high percentages of tetracycline-resistant strains (Kehrenberg and Schwarz, 2000). Resistance to antimicrobial agents, including tetracycline depends on the host, the geographical origin and the antimicrobial pre-treatment. Antimicrobial resistance has been reported in a wide variety of animal pathogens for example P. multocida from cattle; (McEwen and Fedorka-Cray, 2002). Data collected from 13 European countries showed that isolates of P. multocida were resistant to different anti- microbial agents in eight countries. From 1987 to 2004, the percentage of tetracycline resistant isolates from cattle in different European countries ranged between 1% in England and 24% in Italy (Lizarazo et al., 2006; Kaspar et al., 2007; Wallmann et al., 2007; Hendriksen et al., 2008). In Greece, all P. multocida strains isolated from pigs and rabbits in 1984 to 1987 were susceptible to tetracycline (Ekateriniadou, 1989). In the present study, the tetB, tetA, tetM and tetH genes were studied. The tetB gene which is part of the non-conjugative transposon Tn10, has been found in genus Pasteurella (Kehrenberg et al., 2001) and it is the most frequently isolated tet gene in Enterobacteriaceae. The tetA gene, encoded also by the transposon Tn10, is one of the most widespread tet genes in Enterobacteriaceae (Kehrenberg et al., 2001, 2005; Millan et al., 2009) found in a variety of ecosystems including estuarine waters (Henriques et al., 2008). The tetM gene is the most prevalent determinant in Listeria species (Chen et al., 2010) and common gene conferring tetracycline resistance in Staphylococcus aureus http://jac.oxfordjournals.org/contnent/64/3/490.full and widely distributed among both Gram-positive and Gram- negative bacteria; this is probably due to the association of tetM gene with integrative and conjugative transposons as Tn916 which can be expressed both in Gram-positive and Gram-negative bacteria (de Vriest et al., 2009). The tetM gene has been detected in the chromosomal deoxyribonucleic acid (DNA) of P. multocida isolates. The tetH gene which seems to be indigenous to Pasteurellae was detected on plasmids pVM111, pMHT1, pPMT1 and pPAT1 and on the transposon Tn5706 (Hansen et al., 1993; Kehrenberg et al., 1998, 2001). The aim of our study was to determine the class(es) of the tet genes present in P. multocida isolates, to identify their association with plasmid or/and chromosome and to investigate the geographical distribution of the resistant isolates in Greece. MATERIALS AND METHODS Bacterial isolates and antimicrobial susceptibility testing One hundred P. multocida strains were isolated from pneumonic tissue samples that originated from sheep, goats, cattle and pigs originated from eight different Greek prefectures. The samples were inoculated on blood agar plates (5% v/v sheep blood) and were aerobically incubated at 37°C for 18 to 24 h. After isolation, microscopic examination and biochemical testing (oxidase, catalase and indole production) were used for the final identification of the strains (Garity et al., 2004). The determination of tetracycline resistance was performed by the agar diffusion method using disks of tetracycline (30 μg/ml) and the phenotypic resistance of tetracycline was further analyzed by determining the MIC according to the CLSI’ broth micro dilution procedure, using two-fold dilution series in the range of 8 to 128 μg/ml. Identification of the tet gene classes Both genomic and plasmid DNA extractions were carried out: genomic DNA extraction was performed in the tetracycline resistance isolates using the PureLink TM Genomic DNA Kit (Invitrogen) while plasmid DNA extraction was performed using the PureLink TM HiPure Plasmid DNA Purification Kit (Invitrogen). For the evaluation of the method applied in this study concerning the accuracy of the plasmid DNA isolation and particularly whether fragments of chromosomal DNA might be isolated with plasmids, closed circular plasmid DNA from the tetracycline-resistant P. multocida strains was purified also by equilibrium centrifugation in CsCI-ethidium bromide gradients (Sambrook et al., 2001). The purified plasmids were used to transform competent Escherichia coli (XL1-Blue) cells, which subsequently were plated in LB agar containing 50 μg/ml of tetracycline. The appearance of tetracycline- resistant strains in all cases, confirms the presence of tetracycline- resistant genes in the examined plasmids. Further, in the above plasmids derived from the P. multocida strains were detected with Polymerase chain reaction (PCR) the tetB, tetH and tetH genes, respectively, as in the method applied in the present study. Additionally, for the evaluation of chromosomal DNA isolation and particularly whether large plasmids might be segregated with chromosomal DNA, plasmid curing was applied in two tetracycline- resistant P. multocida strains (706/14 and 806/8 p) by growing the bacteria on Brain Heart infusion agar in the presence of 0.002% sodium dodecyl sulphate (SDS) and incubation for 24 h, at 42°C (Sivropoulou et al., 2000). Plasmid isolation from totally 30 colonies of P. multocida 706/14 p, revealed that two were free from plasmids, and from 45 colonies from P. multocida 806/8 p, five were free from plasmids. Since the above colonies were remained resistant to tetracycline, the tetracycline resistant genes are located in the chromosome as detected with the method applied in the present study. For PCR analysis six class-specific primmer sets were used to amplify the tetA, tetB, tetH and tetM genes in all the resistant isolates (Table 1). In order to optimize the methodology, three different PCR protocols were used: (a) a short protocol (SP) described by Koike et al. (2007), (b) a two-temperature step-down protocol (TSP) characterized by a higher sensitivity described by Aminov et al. (2002) and (c) a long time protocol (LTP) carried out to enhance a longer part of the tetB and tetH genes (Hansen et al., 1993; Kehrenberg and Schwarz, 2000). Amplicons of the tetB and tetH genes were of 1170 and 1076 bp, respectively. DNA amplifications using the LTP protocol were carried out for DNA analysis by the restriction fragment length polymorphism (RFLP) method as well as by sequencing (Fluit et al., 2001). DNA amplification was performed in a PTC-200 Peltier Thermal Cycler (MJ Research). Non-amplified isolates by the SP protocol were further analyzed by the TSP protocol. Analysis of the tetB and tetH classes The isolates carrying the tetB and the tetH genes were treated with the restriction enzymes EcorV, EcorI, PstI, BspHI to detect possible polymorphisms. Reactions were performed in a total volume of 15 μl according to the manufacturer’s instructions. The resulting fragments were separated by 3% low melt agarose gel Table 1. Primers used for the identification of tetA, tetB, tetH, tetM genes of P. multocida isolates. Primer set Sequence (5'→3') Annealing temperature (°C) Protocol Fragment size (bp) tetA F΄ GCGCGATCTGGTTCACTCG 61 SP-STP 164 R΄ AGTCGACAGYRGCGCCGGC tetB F΄ TACGTGAATTTATTGCTTCGG 61 SP-STP 206 R΄ ATACAGCATCCAAAGCGCAC tetM F΄ ACAGAAAGCTTATTATATAAC 58 SP-STP 170 R΄ TGGCGTGTCTATGATGTTCAC tetH F΄ CAGTGAAAATTCACTGGCAAC 61 SP-STP 185 R΄ ATCCAAAGTGTGGTTGAGAAT tetB F΄ ACGTTACTCGATGCCAT 55 LTP 1170 R΄ AGCACTTGTCTCCTGTT tetH F΄ ATACTGCTGATCACCCGT 55 LTP 1076 R΄ TCCCAATAAGCGACGCT The tetB gene of this study is enclosed within the box. The gene from the Greek isolate is clustered separately from other species of the Pasteurella genus Figure 2. Phylogenetic tree of tetB gene. electrophoresis (UltraPure TM LMP Agarose, Invitrogen). Sequencing analysis of the tetB and tetH genes The tetB and tetH genes were partially amplified using the LTP protocol and the primers tetHLTPF, tetHLTPR and tetBLTPF, tetBLTPR. Sequencing analysis was performed on a Sequence Scanner version 1.0 (Applied Biosystems) and EditSeq, MegAlign modules of the Lasergene Ver.7.1 software (DNASTAR Inc., Madison, WI, USA). Complementary alignments were also performed using ClustalW2 multiple sequence alignment software (http://www.ebi.ac.uk/Tools/msa/clustalw2). Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 (Tamura et al., 2007). The tetB gene was aligned with the corresponding sequences from the bacteria Haemophilus parainfluenzae, Haemophilus influenzae, Pasteurella aerogenes, Pasteurella multocida and from plasmid R100. The sequence of the tetB gene in the Tn10 transposon element (J01830.1, Genbank) was used as reference sequence (Figure 2). The tetH gene was aligned with the corresponding sequences from two different strains of P. multocida, P. haemolitica, Actinobacillus pleuropneumoniae, The tetH gene of this study is enclosed within the box. The gene from the Greek isolate is clearly separated from other species of the Pasteurella genus Figure 3. Phylogenetic tree of tetH gene. Table 2. Polymorphisms in tetB gene. Accession number Nucleotide position 511b 842b 902b 988b 1014b 1060b J01830.1 nt ACT GAA GAT GAG TTG ACT aa T E D E L T 706/p14tetB nt GCT GGA GTT CAG TTG GCT aa A G V Q L A FQ312002.1 nt GCT GGA GTT CAG TTG GCT aa A G V Q L A AJ627386.1 nt GCT GGA GTT CAG TTG GCT aa A G V Q L A AJ278685.1 nt GCT GGA GTT CAG TTT GCT aa A G V Q F A AP000342.1 nt ACT GGA GTT CAG TTG GCT aa T G V Q L A EU252517.1 nt ACT GGA GTT CAG TTG GCT aa T G V Q L A *Numbering is according to the highlighted is the reference sequence, nt-nucleotide sequence, aa-amino acid sequence. and P. aerogenes. Plasmid PVM111 was used as reference sequence (Figure 3). Both amino acid sequences were aligned with the corresponding sequences (Tables 2 and 3). The amino acid sequence of the tetB gene in the Tn10 transposon element was used as reference sequence. Nucleotide sequence accession numbers The nucleotide sequence of the 1069 bp segment of the tetB gene and the 987 bp segment of the tetH gene were deposited in the EMBL database (accession no FR872822 and FR872823, respectively). RESULTS From the one hundred P. multocida isolates, eighteen showed resistance to tetracycline with MIC higher than 128 μg/ml. The origin of the isolates is showed in Figure 1. The size of the amplicons for each of the three PCR protocols used in the study is shown in Table 1. The tetH gene was found in thirteen (72,2%) and the tetB gene in four isolates (22,2%). In one isolate (5,5%) none of the four tet genes was detected. Both genes were found in chromosomal as well as in plasmid DNA. Only one Table 3. Polymorphisms in tetH gene. Accession number Nucleotide position 410b 755b 765b AJ514834.1 nt GTT GCG GGT aa V A G 706/p8 tetH nt GCT GCG GGG aa A A G U00792.1 nt GTT GCG GGT aa V A G Y16103.1 nt GCT GGG GGT aa A G G Y15510.1 nt GCT GCG GGT aa A A G AY987962.1 nt GCT GCG GGT aa A A G AJ245947.1 nt GCT GCG GGT aa A A G 1K 1T 1X 1C 10V isolates from pigs in the 1L prefectureofVoiotia (5 tetH/4tetB/ not identified) 2I isolates tetH from sheep in the prefecture of Ilia 10V 1X isolate tetH from pig in the 1A prefecture of Xanthi 1C isolate tetH from sheep in 2I the prefecture of Chalkidiki ep 1A isolate tetH from sheep in the prefecture of Achaia 1K isolate tetH from sheep in the prefecture of Kilkis 1L isolate tetH from sheep in the prefecture of Larisa 1T isolate tetH from sheep in the prefecture of Thessaloniki Figure 1. Geographical distribution of the local isolates. isolate was found carrying the tetH gene in plasmid but not in chromosomal DNA. Amplified tetB and tetH genes were analyzed by the RFLP method. Digestion was performed with EcoRV, EcoRI, PstI and BspHI restriction enzymes. The amplicons of tetB gene resulted to the same RFLPs patterns as the reference sequence of Transposon Tn10 (J01830, Genbank). Only treatment with BspHI resulted in a different profile: in contrast to the local isolates, the reference strain showed a recognition site for the enzyme BspHI in position 951/955. No polymorphisms were identified in the amplicons of the tetH gene. Amplicons of the tetB and tetH genes were partially (1060 bp and 987, respectively) sequenced. Unique tetB and tetH sequences were identified. Analysis of the tetB gene and comparison with the corresponding sequences (Table 2), revealed five Single Nucleotide Polymorphisms (SNPs) (A538G, A892G, A929T, G1038C, A1087G). Polymorphism A538G could be detected after digestion with the restriction enzyme Tsp45I (GTSAC). From the analysis of the tetH gene two polymorphisms were found (C460T, G815T). Polymorphism C460T was common (Table 3) while polymorphism G815T was found for the first time. Both amino acid sequences were aligned with the corresponding sequences. Comparison between the tetB and transposon Tn10, revealed five SNPs (T171A, E281G, D301V, E330Q, T354A). Polymorphism T171A was common among the tetB amino acid sequences of H. parainfluenzae, H. influenzae, and P. aerogenes. The other four polymorphisms (E281G, D301V, E330Q and T354A) were common not only among H. parainfluenzae, H. influenzae and P. aerogenes but also among Plasmid R100 and P. multocida. These four polymorphisms have not been found in Tn10 transposon element. One polymorphism (V137A) was found in the tetH aminoacid sequence. Polymorphism V137A was common among strains of P. haemolytica, P. multocida, A. pleuropneumoniae and P. aerogenes. The phylogenetic trees for both genes were created using the Neighbor- Joining method with bootstrap test (500 replicates). The evolutionary distances were computed using the Kimura 2-parameter method (Kimura, 1980). All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). Based on the tetB dendrogram (Figure 2) we can observe the close clustering of the Greek P. multocida isolates with species of Shigella, Salmonella, Haemophilus and Escerichia. The Greek P. multocida isolates of the tetB gene were less homologous to those of P. aerogenes plasmid pPAT2 and also clustered separately from the tetB of P. multocida plasmid pB1001. As shown in the dendrogram (Figure 3), the tetH gene of the Greek P. multocida isolates has evolved and separated from the cluster of P. multocida pPMT1 plasmid (Y15510.1), P. aerogenes plasmid pPAT1, Acinetobacter sp. and Haemophilus somnus. Furthermore, the tetH gene of P. haemolytica plasmid pPHT1 has followed an evolutionary process that differentiated it from the cluster forming a distinct branch. P. multocida U00792.1 and P. multocida partial plasmid pVM111, depicted in a common branch, also evolved separately from the rest of the entries. DISCUSSION Antimicrobial resistance is a concern for animal health but little is known about the magnitude of this problem as the surveillance of resistance in exclusive animal pathogens (for example, Moraxella bovis, Actinobacillus pleuropneumoniae and Pasteurella multocida) is poor compared with surveillance of enteric bacteria. Knowledge and control of resistance in commensals is important as they can act as reservoirs of resistance determinants. The flora of the upper respiratory system of animals that have been treated with antimicrobial agents can also serve as a reservoir of resistance factors. Tetracycline is the most frequently used antimicrobial agents in veterinary medicine. Antimicrobial resistance of P. multocida strains has been reported in a wide variety of animal pathogens (McEwen and Fedorka-Cray, 2002; Milan et al., 2009). Data collected from 13 European countries showed that isolates of P. multocida from eight countries were resistant to different antimicrobial agents including tetracycline (Kaspar et al., 2007; Hendriksen et al., 2008). It is important that 18% of the strains isolated from clinically healthy animals in Greece showed resistance to tetracycline higher than 128 μg/ml. The significant increase of the tetracycline resistant isolates contributes to the selection and spread of resistance in animals not only by the movement of carrier animals between herds but also by the assembly of susceptible animals in close confinement, and the movement of resistance determinants throughout the ecosystem (McEwen and Fedorka-Cray, 2002; Adelowo and Fagade, 2009). Moreover, the spread of tet genes is often facilitated by their location on mobile genetic elements, such as plasmids and transposons. For the first time in Greece, tet genes were investigated. The presence of the tetH and tetB genes in both genomic and plasmid DNA, suggests that they are carried on transposable elements as previous studies have shown for example, tetB gene with the transposon element Tn10 (Kehrenberg et al., 2001) and tetH gene with the transposon element Tn5706 (Kehrenberg et al., 1998). The tetH gene was found in the majority of the tetracycline resistant P. multocida isolates, which is not surprising as it is considered to be indigenous for the genus Pasteurella (Hansen et al., 1993) and it has been detected on plasmids pVM111, pMHT1, pPMT1 and pPAT1 and on the transposon Tn5706 (Hansen et al., 1993; Kehrenberg et al., 1998, 2001). Similarly, the tetB gene is the most frequently observed tet gene among Enterobacteriaceae, as part of the non- conjugative transposon Tn10 (Chalmers et al., 2000). The wide distribution of the tetB across Gram–negative genera, including Escherichia, Enterobacter, Proteus, Salmonella, Actinobacillus, Haemophilus, Moraxella, and Treponema indicates a great likelihood of horizontal gene transfer occurrence of tetracycline resistance (Speer et al., 1992; Roberts, 1996). Moreover, the tetB gene was first detected in H. influenzae, a member of the Pasteurelllaceae commonly isolated from the lungs. Most of the polymorphisms can be detected in other strains or species (Tables 1 and 2). Glycine (255G) of the tetH gene might have a substantial role in the functionality of the protein, thus, the observed mutation was synonymous. Perhaps, this is why no mutations have been previously described at this site. Based on the dendrogram, the tetB gene in the Greek isolates of P. multocida is more homologous to species other than Pasteurellae leading us in two explanations: the gene could probably has been transferred to the isolates from a non Pasteurella species or it is still in an ancestral form which has not been altered as it has in other species of its genus, thus clustering separately from them. The local (Greek) P. multocida tetH gene revealed a different pattern of clustering. Nevertheless, as in the case of tetB, the local isolates tetH gene are clearly differentiated from the rest of Pasteurella species. Finally, the absence of tetA and tetM genes suggests that a wide spectrum of tet genes should be used in future studies. Although our results are similar to those of other researchers (Claudio et al., 2003), further research on other genes involved in tetracycline resistance, such as tetD, tetG, tetL and tetO, would provide a more com- prehensive view of the tetracycline resistance scheme among Greek P. multocida isolates. Moreover, recent data support the premise that the treatment of infected animals has to be based on local knowledge and the observed resistance patterns. In the future, data on the prevalence of resistance should be used to develop guidelines for appropriate antimicrobial use in veterinary medicine. REFERENCES Adelowo OO, Fagade OE (2009). The tetracycline resistance gene tet39 is present in both Gram-negative and Gram-positive bacteria from a polluted river, Southwestern Nigeria. Lett. Appl. Microbiol., 48:167– 172 Aminov RI, Chee-Sandford C, Garrigues N, Teferedegne B, Krapac IJ, White BA, Mackie RI (2002). Development, validation, and application of PCR primers for detection of tetracycline efflux genes of Gram- negative bacteria. Appl. Environ. Microb., 68: 1786-1793. Chalmers R, Sewitz S, Lipkow K, Crellin P (2000). Complete nucleotide sequence of Tn10. J. Bacteriol., 182:2970-2972. Chaslus-Dancla E, Lesage-Descauses MC, Leroy-Sétrin S, Martel JL, Lafont JP (1995). Tetracycline resistant determinants, TetB and TetM, detected in Pasteurella Haemoyitica and Pasteurella multocida from bovine herd. J. Antimicrob. Chemoth., 36: 815-819. Chen BY, Pyla R, Kim TJ, Silva JL, Jung YS (2010). Antibiotic resistance in Listeria species isolated from catfish fillets and processing environment. Lett. Appl. Microbiol., 50: 626–632 Claudio D, Miranda CD, Kehrenberg C, Ulep C, Schwa S (2003). Diversity of Tetracycline Resistance Genes in Bacteria from Chilean Salmon Farms. Antimicrob. Agents Ch., 47(3): 883-888. De Vriest LE, Christensen H, Skov RL, Aarestrup FM, Agerso Y (2009). Diversity of the tetracycline resistance gene tet(M) and identification of Tn916- and Tn5801-like (Tn6014) transposons in Staphylococcus aureus from humans and animals. J. Antimicrob. Chem., 64 (490- 500). Ekateriniadou LV (1989). Study of genus Pasteurella isolates in antimicrobial agents. PhD Thesis, Aristotle University of Thessaloniki, Greece. McEwen SA, Fedorka-Cray PJ (2002). Antimicrobial Use and resistance in Animals”, Clin. Infect. Dis., 34 (3): 93–106 Fluit AC, Visser MR, Schmitz FJ (2001). Molecular detection of antimicrobial resistance. Clin. Microbiol. Rev., 14:836-871. Hansen LM, McMurry LM, Levy SB, Hirsh DC (1993). A new tetracycline resistance determinant, tetH, from Pasteurella multocida specifying active efflux of tetracycline. Antimicrob. Agents Ch., 37: 2699–2705. Hendriksen RS, Mevius DJ, Schroeter A, Teale C, Meunier D, Butaye P, Franco A, Utinane A, Amado A, Moreno M, Greko C, Stärk K, Berghold C, Myllyniemi AL, Wasyl D, Sunde M, Aarestrup FM (2008). Prevalence of antimicrobial resistance among bacterial pathogens strains from cattle in different European countries: 2002-2004. Acta Vet. Scand., 50: 28. Henriques IS, Fonseca F, Alves A1, Saavedra MJ, Correia A (2008). Tetracycline-resistance genes in Gram-negative isolates from estuarine waters. Lett. Appl. Microbiol., 47: 526–533 Kaspar H, Schröer U, Wallmann J (2007). Quantitative resistance level (MIC) of Pasteurella multocida isolated from pigs between 2004 and 2006: national resistance monitoring by the BVL. Berl. Munch. Tierarztl., 120(9-10): 442-51 Kehrenberg C (2000). Molecular basis of teracycline resistance among strains of the genera Pasteurella and Manchemia: identification of novel plasmids and transposons. PhD thesis, Hannover School of Veterinary Medicine, pp. 1-265. Kehrenberg C, Catry B, Haesebrouck F, de Kruif A, Schwarz S (2005). tet(L)-mediated tetracycline resistance in bovine Mannheimia and Pasteurella strains. J. Antimicrob/ Chemoth., 56: 403-406. Kehrenberg C, Salmon SA, Watts JL, Schwarz S (2001). Tetracycline resistance genes in strains of Pasteurella multocida, Mannheimia haemolytica, Mannheimia glucosida and Mannheimia varigena from bovine and swine respiratory disease: intergeneric spread of the tet(H) plasmid pMHT1. J. Antimicrob. Chemoth., 48: 31-640. Kehrenberg C, Schulze-Tanzil G, Martel JL, Chaslus-Dancla E, Schwarz S (2001). Antimicrobial resistance in Pasteurella andMannheimia: epidemiology and genetic basis. Vet. Res., 32: 323- 340. Kehrenberg C, Werckenthin C, Schwarz S (1998). Tn5706, a transposon-like element from Pasteurella multocida mediating tetracycline resistance. Antimicrob. Agents Ch., 42: 2116-2118. Kehrenberg CR, Schwarz ST (2000). Identification of a truncated, but functionally active Tet(H) tetracycline resistance gene in Pasteurella aerogenes and Pasteurella multocida. FEMS Microbiol. Lett., 188: 91-195. Koike S, Krapac IG, Oliver HD, Yannarell AC, Chee-Sanford JC, Aminov RI, Mackie RI (2007). Monitoring and source tracking of tetracycline resistance genes in lagoons and groundwater adjacent to swine production facilities over a 3-year period. Appl. Environ. Microb., 73: 4813-4823. Lizarazo YA, Ferri EF, de la Fuente AJ, Martin CB (2006). Evaluation of changes in antimicrobial susceptibility patterns of Pasteurella multocida subsp. multocida isolates from pigs in Spain in 1987–1988 and 2003–2004. Am. J. Vet. Res., 67: 663–668. Millan AS, Escudero JA, Gutierrez B, Hidalgo L (2009). Multiresistance in Pasteurella multocida is mediated by coexistence of small Plasmids. Antimicrob. Agents Ch., 53: 3399–3404. Roberts MC (1996). Tetracycline-resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol. Rev., 19: 1–24. Sambrook J, Russell DW (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, 3 rd ed. (1):1.69- 1.71. Sivropoulou A, Haritidou L, Vasara E, Aptosoglou S, Koliais S (2000). Correlation of the insecticidal activity of the Bacillus thurigensis A4 strain against Bactrocera oleae (Diptera) with the 140-kDa crystal polypeptide. Curr. Microbiol., 41(4): 262-266. Speer BS, Shoemaker NB, Salyers AA (1992). Bacterial resistance to tetracycline: mechanisms, transfer, and clinical significance. Clin. Microbiol. Rev., 5: 387–399. Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24: 1596-1599. Wallmann J, Schröer U, Kaspar H (2007). Quantitative resistance level (MIC) of bacterial pathogens (Escherichia coli, Pasteurella multocida, Pseudomonas aeruginosa, Salmonella sp., Staphylococcus aureus) isolated from chickens and turkeys: national resistance monitoring by the BVL 2004/2005. Berl. Munch Tierarztl., 120(9-10): 452-463.