id	sid	tid	token	lemma	pos
afs-147802	1	1	agricultural	agricultural	ADJ
afs-147802	1	2	and	and	CCONJ
afs-147802	1	3	food	food	NOUN
afs-147802	1	4	science	science	NOUN
afs-147802	1	5	agricultural	agricultural	ADJ
afs-147802	1	6	and	and	CCONJ
afs-147802	1	7	food	food	NOUN
afs-147802	1	8	science	science	NOUN
afs-147802	1	9	(	(	PUNCT
afs-147802	1	10	2025	2025	NUM
afs-147802	1	11	)	)	PUNCT
afs-147802	1	12	34	34	NUM
afs-147802	1	13	:	:	PUNCT
afs-147802	1	14	51–60	51–60	NUM
afs-147802	1	15	51	51	NUM
afs-147802	1	16	https://doi.org/10.23986/afsci.147802	https://doi.org/10.23986/afsci.147802	NOUN
afs-147802	1	17	the	the	DET
afs-147802	1	18	first	first	ADJ
afs-147802	1	19	recorded	record	VERB
afs-147802	1	20	case	case	NOUN
afs-147802	1	21	of	of	ADP
afs-147802	1	22	herbicide	herbicide	NOUN
afs-147802	1	23	resistance	resistance	NOUN
afs-147802	1	24	in	in	ADP
afs-147802	1	25	estonia	estonia	PROPN
afs-147802	1	26	:	:	PUNCT
afs-147802	1	27	common	common	ADJ
afs-147802	1	28	chickweed	chickweed	NOUN
afs-147802	1	29	(	(	PUNCT
afs-147802	1	30	stellaria	stellaria	NOUN
afs-147802	1	31	media	medium	NOUN
afs-147802	1	32	)	)	PUNCT
afs-147802	1	33	resistant	resistant	ADJ
afs-147802	1	34	to	to	ADP
afs-147802	1	35	sulfonylureas	sulfonylureas	PROPN
afs-147802	1	36	silvia	silvia	PROPN
afs-147802	1	37	pihu1	pihu1	PROPN
afs-147802	1	38	,	,	PUNCT
afs-147802	1	39	andres	andres	PROPN
afs-147802	1	40	mäe1	mäe1	PROPN
afs-147802	1	41	,	,	PUNCT
afs-147802	1	42	hannah	hannah	PROPN
afs-147802	1	43	joy	joy	NOUN
afs-147802	1	44	vivian	vivian	PROPN
afs-147802	1	45	kennedy1	kennedy1	PROPN
afs-147802	1	46	and	and	CCONJ
afs-147802	1	47	katerina	katerina	PROPN
afs-147802	1	48	hamouzova2	hamouzova2	PROPN
afs-147802	1	49	1centre	1centre	NUM
afs-147802	1	50	of	of	ADP
afs-147802	1	51	estonian	estonian	ADJ
afs-147802	1	52	rural	rural	ADJ
afs-147802	1	53	research	research	NOUN
afs-147802	1	54	and	and	CCONJ
afs-147802	1	55	knowledge	knowledge	NOUN
afs-147802	1	56	(	(	PUNCT
afs-147802	1	57	metk	metk	PROPN
afs-147802	1	58	)	)	PUNCT
afs-147802	1	59	,	,	PUNCT
afs-147802	1	60	estonia	estonia	PROPN
afs-147802	1	61	2czech	2czech	PROPN
afs-147802	1	62	university	university	PROPN
afs-147802	1	63	of	of	ADP
afs-147802	1	64	life	life	NOUN
afs-147802	1	65	sciences	sciences	PROPN
afs-147802	1	66	,	,	PUNCT
afs-147802	1	67	czech	czech	PROPN
afs-147802	1	68	republic	republic	NOUN
afs-147802	1	69	e	e	NOUN
afs-147802	1	70	-	-	NOUN
afs-147802	1	71	mail	mail	NOUN
afs-147802	1	72	:	:	PUNCT
afs-147802	1	73	silvia.pihu@metk.agri.ee	silvia.pihu@metk.agri.ee	NOUN
afs-147802	1	74	herbicide	herbicide	NOUN
afs-147802	1	75	resistance	resistance	NOUN
afs-147802	1	76	has	have	AUX
afs-147802	1	77	been	be	AUX
afs-147802	1	78	insufficiently	insufficiently	ADV
afs-147802	1	79	studied	study	VERB
afs-147802	1	80	in	in	ADP
afs-147802	1	81	the	the	DET
afs-147802	1	82	baltic	baltic	ADJ
afs-147802	1	83	countries	country	NOUN
afs-147802	1	84	.	.	PUNCT
afs-147802	2	1	chickweed	chickweed	NOUN
afs-147802	2	2	(	(	PUNCT
afs-147802	2	3	stellaria	stellaria	NOUN
afs-147802	2	4	media	medium	NOUN
afs-147802	2	5	)	)	PUNCT
afs-147802	2	6	,	,	PUNCT
afs-147802	2	7	an	an	DET
afs-147802	2	8	adaptive	adaptive	ADJ
afs-147802	2	9	and	and	CCONJ
afs-147802	2	10	competitive	competitive	ADJ
afs-147802	2	11	annual	annual	ADJ
afs-147802	2	12	weed	weed	NOUN
afs-147802	2	13	,	,	PUNCT
afs-147802	2	14	poses	pose	VERB
afs-147802	2	15	a	a	DET
afs-147802	2	16	significant	significant	ADJ
afs-147802	2	17	agricultural	agricultural	ADJ
afs-147802	2	18	threat	threat	NOUN
afs-147802	2	19	due	due	ADP
afs-147802	2	20	to	to	ADP
afs-147802	2	21	its	its	PRON
afs-147802	2	22	low	low	ADJ
afs-147802	2	23	and	and	CCONJ
afs-147802	2	24	dense	dense	ADJ
afs-147802	2	25	canopy	canopy	NOUN
afs-147802	2	26	.	.	PUNCT
afs-147802	3	1	this	this	DET
afs-147802	3	2	study	study	NOUN
afs-147802	3	3	aimed	aim	VERB
afs-147802	3	4	to	to	PART
afs-147802	3	5	evaluate	evaluate	VERB
afs-147802	3	6	the	the	DET
afs-147802	3	7	level	level	NOUN
afs-147802	3	8	of	of	ADP
afs-147802	3	9	resistance	resistance	NOUN
afs-147802	3	10	to	to	PART
afs-147802	3	11	acetolactate	acetolactate	VERB
afs-147802	3	12	synthase	synthase	NOUN
afs-147802	3	13	(	(	PUNCT
afs-147802	3	14	als	als	NOUN
afs-147802	3	15	)	)	PUNCT
afs-147802	3	16	inhibitors	inhibitor	NOUN
afs-147802	3	17	in	in	ADP
afs-147802	3	18	chickweed	chickweed	NOUN
afs-147802	3	19	populations	population	NOUN
afs-147802	3	20	in	in	ADP
afs-147802	3	21	estonia	estonia	PROPN
afs-147802	3	22	and	and	CCONJ
afs-147802	3	23	identify	identify	VERB
afs-147802	3	24	potential	potential	ADJ
afs-147802	3	25	mechanisms	mechanism	NOUN
afs-147802	3	26	.	.	PUNCT
afs-147802	4	1	in	in	ADP
afs-147802	4	2	the	the	DET
afs-147802	4	3	initial	initial	ADJ
afs-147802	4	4	dose	dose	NOUN
afs-147802	4	5	-	-	PUNCT
afs-147802	4	6	response	response	NOUN
afs-147802	4	7	experiment	experiment	NOUN
afs-147802	4	8	,	,	PUNCT
afs-147802	4	9	a	a	DET
afs-147802	4	10	biotype	biotype	NOUN
afs-147802	4	11	from	from	ADP
afs-147802	4	12	järva	järva	PROPN
afs-147802	4	13	county	county	PROPN
afs-147802	4	14	exhibited	exhibit	VERB
afs-147802	4	15	resistance	resistance	NOUN
afs-147802	4	16	to	to	ADP
afs-147802	4	17	the	the	DET
afs-147802	4	18	als	als	NOUN
afs-147802	4	19	inhibitor	inhibitor	NOUN
afs-147802	4	20	tribenuron	tribenuron	PROPN
afs-147802	4	21	-	-	PUNCT
afs-147802	4	22	methyl	methyl	NOUN
afs-147802	4	23	.	.	PUNCT
afs-147802	5	1	molecular	molecular	ADJ
afs-147802	5	2	analysis	analysis	NOUN
afs-147802	5	3	identified	identify	VERB
afs-147802	5	4	a	a	DET
afs-147802	5	5	mutation	mutation	NOUN
afs-147802	5	6	at	at	ADP
afs-147802	5	7	position	position	NOUN
afs-147802	5	8	574	574	NUM
afs-147802	5	9	in	in	ADP
afs-147802	5	10	the	the	DET
afs-147802	5	11	als	als	NOUN
afs-147802	5	12	gene	gene	NOUN
afs-147802	5	13	,	,	PUNCT
afs-147802	5	14	where	where	SCONJ
afs-147802	5	15	tryptophan	tryptophan	NOUN
afs-147802	5	16	was	be	AUX
afs-147802	5	17	replaced	replace	VERB
afs-147802	5	18	by	by	ADP
afs-147802	5	19	leucine	leucine	NOUN
afs-147802	5	20	.	.	PUNCT
afs-147802	6	1	testing	testing	NOUN
afs-147802	6	2	of	of	ADP
afs-147802	6	3	eight	eight	NUM
afs-147802	6	4	chickweed	chickweed	NOUN
afs-147802	6	5	biotypes	biotype	NOUN
afs-147802	6	6	for	for	ADP
afs-147802	6	7	resistance	resistance	NOUN
afs-147802	6	8	to	to	ADP
afs-147802	6	9	tribenuron	tribenuron	NOUN
afs-147802	6	10	-	-	PUNCT
afs-147802	6	11	methyl	methyl	NOUN
afs-147802	6	12	and	and	CCONJ
afs-147802	6	13	the	the	DET
afs-147802	6	14	combination	combination	NOUN
afs-147802	6	15	herbicide	herbicide	NOUN
afs-147802	6	16	iodosulfuron	iodosulfuron	NOUN
afs-147802	6	17	+	+	CCONJ
afs-147802	6	18	amidosulfuron	amidosulfuron	NOUN
afs-147802	6	19	found	find	VERB
afs-147802	6	20	three	three	NUM
afs-147802	6	21	resistant	resistant	ADJ
afs-147802	6	22	biotypes	biotype	NOUN
afs-147802	6	23	.	.	PUNCT
afs-147802	7	1	the	the	DET
afs-147802	7	2	järva	järva	PROPN
afs-147802	7	3	county	county	PROPN
afs-147802	7	4	biotype	biotype	NOUN
afs-147802	7	5	was	be	AUX
afs-147802	7	6	cross	cross	ADJ
afs-147802	7	7	-	-	ADJ
afs-147802	7	8	resistant	resistant	ADJ
afs-147802	7	9	to	to	ADP
afs-147802	7	10	sulfonylureas	sulfonylurea	NOUN
afs-147802	7	11	,	,	PUNCT
afs-147802	7	12	while	while	SCONJ
afs-147802	7	13	two	two	NUM
afs-147802	7	14	others	other	NOUN
afs-147802	7	15	exhibited	exhibit	VERB
afs-147802	7	16	resistance	resistance	NOUN
afs-147802	7	17	only	only	ADV
afs-147802	7	18	to	to	PART
afs-147802	7	19	iodosulfuron	iodosulfuron	VERB
afs-147802	7	20	+	+	CCONJ
afs-147802	7	21	amidosulfuron	amidosulfuron	NOUN
afs-147802	7	22	.	.	PUNCT
afs-147802	8	1	the	the	DET
afs-147802	8	2	latter	latter	ADJ
afs-147802	8	3	two	two	NUM
afs-147802	8	4	biotypes	biotype	NOUN
afs-147802	8	5	lacked	lack	VERB
afs-147802	8	6	the	the	DET
afs-147802	8	7	als	als	NOUN
afs-147802	8	8	gene	gene	NOUN
afs-147802	8	9	mutation	mutation	NOUN
afs-147802	8	10	,	,	PUNCT
afs-147802	8	11	suggesting	suggest	VERB
afs-147802	8	12	non	non	ADJ
afs-147802	8	13	-	-	ADJ
afs-147802	8	14	target	target	ADJ
afs-147802	8	15	-	-	PUNCT
afs-147802	8	16	site	site	NOUN
afs-147802	8	17	resistance	resistance	NOUN
afs-147802	8	18	mechanisms	mechanism	NOUN
afs-147802	8	19	,	,	PUNCT
afs-147802	8	20	although	although	SCONJ
afs-147802	8	21	these	these	PRON
afs-147802	8	22	were	be	AUX
afs-147802	8	23	not	not	PART
afs-147802	8	24	investigated	investigate	VERB
afs-147802	8	25	further	far	ADV
afs-147802	8	26	.	.	PUNCT
afs-147802	9	1	these	these	DET
afs-147802	9	2	findings	finding	NOUN
afs-147802	9	3	highlight	highlight	VERB
afs-147802	9	4	the	the	DET
afs-147802	9	5	potential	potential	NOUN
afs-147802	9	6	for	for	ADP
afs-147802	9	7	widespread	widespread	ADJ
afs-147802	9	8	herbicide	herbicide	NOUN
afs-147802	9	9	resistance	resistance	NOUN
afs-147802	9	10	in	in	ADP
afs-147802	9	11	estonia	estonia	PROPN
afs-147802	9	12	and	and	CCONJ
afs-147802	9	13	emphasize	emphasize	VERB
afs-147802	9	14	the	the	DET
afs-147802	9	15	need	need	NOUN
afs-147802	9	16	for	for	ADP
afs-147802	9	17	more	more	ADV
afs-147802	9	18	comprehensive	comprehensive	ADJ
afs-147802	9	19	monitoring	monitoring	NOUN
afs-147802	9	20	and	and	CCONJ
afs-147802	9	21	research	research	NOUN
afs-147802	9	22	into	into	ADP
afs-147802	9	23	resistance	resistance	NOUN
afs-147802	9	24	mechanisms	mechanism	NOUN
afs-147802	9	25	.	.	PUNCT
afs-147802	10	1	key	key	ADJ
afs-147802	10	2	words	word	NOUN
afs-147802	10	3	:	:	PUNCT
afs-147802	10	4	als	al	VERB
afs-147802	10	5	inhibitor	inhibitor	NOUN
afs-147802	10	6	,	,	PUNCT
afs-147802	10	7	tribenuron	tribenuron	NOUN
afs-147802	10	8	-	-	PUNCT
afs-147802	10	9	methyl	methyl	NOUN
afs-147802	10	10	,	,	PUNCT
afs-147802	10	11	sulfuron	sulfuron	NOUN
afs-147802	10	12	,	,	PUNCT
afs-147802	10	13	target	target	NOUN
afs-147802	10	14	-	-	PUNCT
afs-147802	10	15	site	site	NOUN
afs-147802	10	16	,	,	PUNCT
afs-147802	10	17	non	non	ADJ
afs-147802	10	18	-	-	ADJ
afs-147802	10	19	target	target	ADJ
afs-147802	10	20	site	site	NOUN
afs-147802	10	21	introduction	introduction	NOUN
afs-147802	10	22	weeds	weed	NOUN
afs-147802	10	23	,	,	PUNCT
afs-147802	10	24	when	when	SCONJ
afs-147802	10	25	present	present	ADJ
afs-147802	10	26	above	above	ADP
afs-147802	10	27	critical	critical	ADJ
afs-147802	10	28	population	population	NOUN
afs-147802	10	29	thresholds	threshold	NOUN
afs-147802	10	30	,	,	PUNCT
afs-147802	10	31	can	can	AUX
afs-147802	10	32	cause	cause	VERB
afs-147802	10	33	crop	crop	NOUN
afs-147802	10	34	yield	yield	NOUN
afs-147802	10	35	losses	loss	NOUN
afs-147802	10	36	of	of	ADP
afs-147802	10	37	up	up	ADP
afs-147802	10	38	to	to	PART
afs-147802	10	39	80	80	NUM
afs-147802	10	40	%	%	NOUN
afs-147802	10	41	and	and	CCONJ
afs-147802	10	42	degrade	degrade	VERB
afs-147802	10	43	crop	crop	NOUN
afs-147802	10	44	quality	quality	NOUN
afs-147802	10	45	(	(	PUNCT
afs-147802	10	46	soltani	soltani	PROPN
afs-147802	10	47	et	et	PROPN
afs-147802	10	48	al	al	PROPN
afs-147802	10	49	.	.	PROPN
afs-147802	10	50	2016	2016	NUM
afs-147802	10	51	,	,	PUNCT
afs-147802	10	52	gerhards	gerhard	NOUN
afs-147802	10	53	et	et	PROPN
afs-147802	10	54	al	al	PROPN
afs-147802	10	55	.	.	PROPN
afs-147802	10	56	2017	2017	NUM
afs-147802	10	57	)	)	PUNCT
afs-147802	10	58	.	.	PUNCT
afs-147802	11	1	effective	effective	ADJ
afs-147802	11	2	crop	crop	NOUN
afs-147802	11	3	production	production	NOUN
afs-147802	11	4	,	,	PUNCT
afs-147802	11	5	leading	lead	VERB
afs-147802	11	6	to	to	ADP
afs-147802	11	7	high	high	ADJ
afs-147802	11	8	yields	yield	NOUN
afs-147802	11	9	of	of	ADP
afs-147802	11	10	quality	quality	NOUN
afs-147802	11	11	products	product	NOUN
afs-147802	11	12	,	,	PUNCT
afs-147802	11	13	relies	rely	VERB
afs-147802	11	14	on	on	ADP
afs-147802	11	15	an	an	DET
afs-147802	11	16	appropriate	appropriate	ADJ
afs-147802	11	17	crop	crop	NOUN
afs-147802	11	18	management	management	NOUN
afs-147802	11	19	system	system	NOUN
afs-147802	11	20	,	,	PUNCT
afs-147802	11	21	which	which	PRON
afs-147802	11	22	includes	include	VERB
afs-147802	11	23	diverse	diverse	ADJ
afs-147802	11	24	and	and	CCONJ
afs-147802	11	25	integrated	integrated	ADJ
afs-147802	11	26	weed	weed	NOUN
afs-147802	11	27	control	control	NOUN
afs-147802	11	28	measures	measure	NOUN
afs-147802	11	29	.	.	PUNCT
afs-147802	12	1	herbicides	herbicide	NOUN
afs-147802	12	2	have	have	AUX
afs-147802	12	3	historically	historically	ADV
afs-147802	12	4	been	be	AUX
afs-147802	12	5	an	an	DET
afs-147802	12	6	efficient	efficient	ADJ
afs-147802	12	7	tool	tool	NOUN
afs-147802	12	8	for	for	ADP
afs-147802	12	9	weed	weed	NOUN
afs-147802	12	10	management	management	NOUN
afs-147802	12	11	in	in	ADP
afs-147802	12	12	agricultural	agricultural	ADJ
afs-147802	12	13	fields	field	NOUN
afs-147802	12	14	(	(	PUNCT
afs-147802	12	15	kraehmer	kraehmer	PROPN
afs-147802	12	16	et	et	PROPN
afs-147802	12	17	al	al	PROPN
afs-147802	12	18	.	.	PROPN
afs-147802	12	19	2014	2014	NUM
afs-147802	12	20	)	)	PUNCT
afs-147802	12	21	.	.	PUNCT
afs-147802	13	1	optimal	optimal	ADJ
afs-147802	13	2	weed	weed	NOUN
afs-147802	13	3	control	control	NOUN
afs-147802	13	4	with	with	ADP
afs-147802	13	5	chemical	chemical	ADJ
afs-147802	13	6	herbicides	herbicide	NOUN
afs-147802	13	7	can	can	AUX
afs-147802	13	8	significantly	significantly	ADV
afs-147802	13	9	increase	increase	VERB
afs-147802	13	10	yields	yield	NOUN
afs-147802	13	11	,	,	PUNCT
afs-147802	13	12	especially	especially	ADV
afs-147802	13	13	under	under	ADP
afs-147802	13	14	high	high	ADJ
afs-147802	13	15	weed	weed	NOUN
afs-147802	13	16	pressure	pressure	NOUN
afs-147802	13	17	.	.	PUNCT
afs-147802	14	1	however	however	ADV
afs-147802	14	2	,	,	PUNCT
afs-147802	14	3	herbicide	herbicide	NOUN
afs-147802	14	4	resistance	resistance	NOUN
afs-147802	14	5	in	in	ADP
afs-147802	14	6	arable	arable	ADJ
afs-147802	14	7	weeds	weed	NOUN
afs-147802	14	8	is	be	AUX
afs-147802	14	9	increasing	increase	VERB
afs-147802	14	10	rapidly	rapidly	ADV
afs-147802	14	11	worldwide	worldwide	ADV
afs-147802	14	12	,	,	PUNCT
afs-147802	14	13	becoming	become	VERB
afs-147802	14	14	one	one	NUM
afs-147802	14	15	of	of	ADP
afs-147802	14	16	the	the	DET
afs-147802	14	17	greatest	great	ADJ
afs-147802	14	18	challenges	challenge	NOUN
afs-147802	14	19	to	to	ADP
afs-147802	14	20	crop	crop	NOUN
afs-147802	14	21	production	production	NOUN
afs-147802	14	22	and	and	CCONJ
afs-147802	14	23	food	food	NOUN
afs-147802	14	24	security	security	NOUN
afs-147802	14	25	(	(	PUNCT
afs-147802	14	26	ziska	ziska	NOUN
afs-147802	14	27	2020	2020	NUM
afs-147802	14	28	)	)	PUNCT
afs-147802	14	29	.	.	PUNCT
afs-147802	15	1	continuous	continuous	ADJ
afs-147802	15	2	herbicide	herbicide	NOUN
afs-147802	15	3	use	use	NOUN
afs-147802	15	4	exerts	exert	VERB
afs-147802	15	5	selective	selective	ADJ
afs-147802	15	6	pressure	pressure	NOUN
afs-147802	15	7	on	on	ADP
afs-147802	15	8	weed	weed	NOUN
afs-147802	15	9	populations	population	NOUN
afs-147802	15	10	,	,	PUNCT
afs-147802	15	11	leading	lead	VERB
afs-147802	15	12	to	to	ADP
afs-147802	15	13	a	a	DET
afs-147802	15	14	decline	decline	NOUN
afs-147802	15	15	in	in	ADP
afs-147802	15	16	herbicide	herbicide	NOUN
afs-147802	15	17	efficacy	efficacy	NOUN
afs-147802	15	18	,	,	PUNCT
afs-147802	15	19	eventually	eventually	ADV
afs-147802	15	20	reaching	reach	VERB
afs-147802	15	21	a	a	DET
afs-147802	15	22	threshold	threshold	NOUN
afs-147802	15	23	where	where	SCONJ
afs-147802	15	24	effective	effective	ADJ
afs-147802	15	25	weed	weed	NOUN
afs-147802	15	26	control	control	NOUN
afs-147802	15	27	becomes	become	VERB
afs-147802	15	28	elusive	elusive	ADJ
afs-147802	15	29	(	(	PUNCT
afs-147802	15	30	gaines	gaine	NOUN
afs-147802	15	31	et	et	PROPN
afs-147802	15	32	al	al	PROPN
afs-147802	15	33	.	.	PROPN
afs-147802	15	34	2020	2020	NUM
afs-147802	15	35	)	)	PUNCT
afs-147802	15	36	leading	lead	VERB
afs-147802	15	37	to	to	ADP
afs-147802	15	38	the	the	DET
afs-147802	15	39	evolution	evolution	NOUN
afs-147802	15	40	of	of	ADP
afs-147802	15	41	herbicide	herbicide	NOUN
afs-147802	15	42	resistance	resistance	NOUN
afs-147802	15	43	in	in	ADP
afs-147802	15	44	hundreds	hundred	NOUN
afs-147802	15	45	of	of	ADP
afs-147802	15	46	weed	weed	NOUN
afs-147802	15	47	species	specie	NOUN
afs-147802	15	48	.	.	PUNCT
afs-147802	16	1	over	over	ADP
afs-147802	16	2	500	500	NUM
afs-147802	16	3	weed	weed	NOUN
afs-147802	16	4	species	specie	NOUN
afs-147802	16	5	have	have	AUX
afs-147802	16	6	developed	develop	VERB
afs-147802	16	7	resistance	resistance	NOUN
afs-147802	16	8	to	to	ADP
afs-147802	16	9	one	one	NUM
afs-147802	16	10	or	or	CCONJ
afs-147802	16	11	more	more	ADJ
afs-147802	16	12	herbicides	herbicide	NOUN
afs-147802	16	13	,	,	PUNCT
afs-147802	16	14	and	and	CCONJ
afs-147802	16	15	this	this	DET
afs-147802	16	16	number	number	NOUN
afs-147802	16	17	continues	continue	VERB
afs-147802	16	18	to	to	PART
afs-147802	16	19	increase	increase	VERB
afs-147802	16	20	(	(	PUNCT
afs-147802	16	21	heap	heap	NOUN
afs-147802	16	22	2024	2024	NUM
afs-147802	16	23	)	)	PUNCT
afs-147802	16	24	.	.	PUNCT
afs-147802	17	1	among	among	ADP
afs-147802	17	2	herbicides	herbicide	NOUN
afs-147802	17	3	,	,	PUNCT
afs-147802	17	4	sulfonylureas	sulfonylureas	PROPN
afs-147802	17	5	,	,	PUNCT
afs-147802	17	6	a	a	DET
afs-147802	17	7	group	group	NOUN
afs-147802	17	8	of	of	ADP
afs-147802	17	9	herbicides	herbicide	NOUN
afs-147802	17	10	within	within	ADP
afs-147802	17	11	acetolactate	acetolactate	NOUN
afs-147802	17	12	synthase	synthase	NOUN
afs-147802	17	13	(	(	PUNCT
afs-147802	17	14	als	als	NOUN
afs-147802	17	15	)	)	PUNCT
afs-147802	17	16	inhibitors	inhibitor	NOUN
afs-147802	17	17	,	,	PUNCT
afs-147802	17	18	classified	classify	VERB
afs-147802	17	19	under	under	ADP
afs-147802	17	20	herbicide	herbicide	NOUN
afs-147802	17	21	resistance	resistance	NOUN
afs-147802	17	22	action	action	NOUN
afs-147802	17	23	committee	committee	NOUN
afs-147802	17	24	(	(	PUNCT
afs-147802	17	25	hrac	hrac	PROPN
afs-147802	17	26	)	)	PUNCT
afs-147802	17	27	group	group	NOUN
afs-147802	17	28	2	2	NUM
afs-147802	17	29	(	(	PUNCT
afs-147802	17	30	beffa	beffa	PROPN
afs-147802	17	31	et	et	PROPN
afs-147802	17	32	al	al	PROPN
afs-147802	17	33	.	.	PROPN
afs-147802	17	34	2019	2019	NUM
afs-147802	17	35	)	)	PUNCT
afs-147802	17	36	,	,	PUNCT
afs-147802	17	37	are	be	AUX
afs-147802	17	38	widely	widely	ADV
afs-147802	17	39	used	use	VERB
afs-147802	17	40	.	.	PUNCT
afs-147802	18	1	resistance	resistance	NOUN
afs-147802	18	2	to	to	PART
afs-147802	18	3	als	als	VERB
afs-147802	18	4	inhibitors	inhibitor	NOUN
afs-147802	18	5	,	,	PUNCT
afs-147802	18	6	a	a	DET
afs-147802	18	7	longstanding	longstanding	ADJ
afs-147802	18	8	issue	issue	NOUN
afs-147802	18	9	,	,	PUNCT
afs-147802	18	10	has	have	AUX
afs-147802	18	11	been	be	AUX
afs-147802	18	12	documented	document	VERB
afs-147802	18	13	globally	globally	ADV
afs-147802	18	14	(	(	PUNCT
afs-147802	18	15	duggleby	duggleby	PROPN
afs-147802	18	16	et	et	PROPN
afs-147802	18	17	al	al	PROPN
afs-147802	18	18	.	.	PROPN
afs-147802	18	19	2008	2008	NUM
afs-147802	18	20	)	)	PUNCT
afs-147802	18	21	.	.	PUNCT
afs-147802	19	1	the	the	DET
afs-147802	19	2	widespread	widespread	ADJ
afs-147802	19	3	reliance	reliance	NOUN
afs-147802	19	4	on	on	ADP
afs-147802	19	5	herbicides	herbicide	NOUN
afs-147802	19	6	presents	present	VERB
afs-147802	19	7	a	a	DET
afs-147802	19	8	growing	grow	VERB
afs-147802	19	9	problem	problem	NOUN
afs-147802	19	10	,	,	PUNCT
afs-147802	19	11	as	as	SCONJ
afs-147802	19	12	the	the	DET
afs-147802	19	13	evolution	evolution	NOUN
afs-147802	19	14	of	of	ADP
afs-147802	19	15	herbicide	herbicide	NOUN
afs-147802	19	16	resistance	resistance	NOUN
afs-147802	19	17	limits	limit	VERB
afs-147802	19	18	effective	effective	ADJ
afs-147802	19	19	weed	weed	NOUN
afs-147802	19	20	control	control	NOUN
afs-147802	19	21	.	.	PUNCT
afs-147802	20	1	resistance	resistance	NOUN
afs-147802	20	2	can	can	AUX
afs-147802	20	3	arise	arise	VERB
afs-147802	20	4	through	through	ADP
afs-147802	20	5	various	various	ADJ
afs-147802	20	6	mechanisms	mechanism	NOUN
afs-147802	20	7	,	,	PUNCT
afs-147802	20	8	such	such	ADJ
afs-147802	20	9	as	as	ADP
afs-147802	20	10	target	target	NOUN
afs-147802	20	11	-	-	PUNCT
afs-147802	20	12	site	site	NOUN
afs-147802	20	13	mutations	mutation	NOUN
afs-147802	20	14	in	in	ADP
afs-147802	20	15	the	the	DET
afs-147802	20	16	herbicide	herbicide	NOUN
afs-147802	20	17	’s	’s	PART
afs-147802	20	18	action	action	NOUN
afs-147802	20	19	site	site	NOUN
afs-147802	20	20	or	or	CCONJ
afs-147802	20	21	non	non	ADJ
afs-147802	20	22	-	-	ADJ
afs-147802	20	23	target	target	ADJ
afs-147802	20	24	-	-	PUNCT
afs-147802	20	25	site	site	NOUN
afs-147802	20	26	mechanisms	mechanism	NOUN
afs-147802	20	27	like	like	ADP
afs-147802	20	28	physiological	physiological	ADJ
afs-147802	20	29	adaptations	adaptation	NOUN
afs-147802	20	30	,	,	PUNCT
afs-147802	20	31	gene	gene	NOUN
afs-147802	20	32	overexpression	overexpression	NOUN
afs-147802	20	33	,	,	PUNCT
afs-147802	20	34	or	or	CCONJ
afs-147802	20	35	enhanced	enhance	VERB
afs-147802	20	36	metabolic	metabolic	NOUN
afs-147802	20	37	processes	process	NOUN
afs-147802	20	38	,	,	PUNCT
afs-147802	20	39	or	or	CCONJ
afs-147802	20	40	other	other	ADJ
afs-147802	20	41	factors	factor	NOUN
afs-147802	20	42	(	(	PUNCT
afs-147802	20	43	gaines	gaine	NOUN
afs-147802	20	44	et	et	PROPN
afs-147802	20	45	al	al	PROPN
afs-147802	20	46	.	.	PROPN
afs-147802	20	47	2020	2020	NUM
afs-147802	20	48	)	)	PUNCT
afs-147802	20	49	.	.	PUNCT
afs-147802	21	1	non	non	ADJ
afs-147802	21	2	-	-	ADJ
afs-147802	21	3	target	target	ADJ
afs-147802	21	4	-	-	PUNCT
afs-147802	21	5	site	site	NOUN
afs-147802	21	6	resistance	resistance	NOUN
afs-147802	21	7	,	,	PUNCT
afs-147802	21	8	challenges	challenge	VERB
afs-147802	21	9	control	control	NOUN
afs-147802	21	10	efforts	effort	NOUN
afs-147802	21	11	because	because	SCONJ
afs-147802	21	12	it	it	PRON
afs-147802	21	13	makes	make	VERB
afs-147802	21	14	many	many	ADJ
afs-147802	21	15	herbicides	herbicide	NOUN
afs-147802	21	16	ineffective	ineffective	ADJ
afs-147802	21	17	,	,	PUNCT
afs-147802	21	18	regardless	regardless	ADV
afs-147802	21	19	of	of	ADP
afs-147802	21	20	their	their	PRON
afs-147802	21	21	mode	mode	NOUN
afs-147802	21	22	of	of	ADP
afs-147802	21	23	action	action	NOUN
afs-147802	21	24	(	(	PUNCT
afs-147802	21	25	preston	preston	PROPN
afs-147802	21	26	2004	2004	NUM
afs-147802	21	27	)	)	PUNCT
afs-147802	21	28	.	.	PUNCT
afs-147802	22	1	while	while	SCONJ
afs-147802	22	2	als	al	NOUN
afs-147802	22	3	-	-	PUNCT
afs-147802	22	4	inhibiting	inhibit	VERB
afs-147802	22	5	herbicides	herbicide	NOUN
afs-147802	22	6	do	do	AUX
afs-147802	22	7	not	not	PART
afs-147802	22	8	directly	directly	ADV
afs-147802	22	9	affect	affect	VERB
afs-147802	22	10	photosynthesis	photosynthesis	NOUN
afs-147802	22	11	,	,	PUNCT
afs-147802	22	12	studies	study	NOUN
afs-147802	22	13	have	have	AUX
afs-147802	22	14	demonstrated	demonstrate	VERB
afs-147802	22	15	that	that	SCONJ
afs-147802	22	16	they	they	PRON
afs-147802	22	17	,	,	PUNCT
afs-147802	22	18	like	like	ADP
afs-147802	22	19	other	other	ADJ
afs-147802	22	20	herbicides	herbicide	NOUN
afs-147802	22	21	,	,	PUNCT
afs-147802	22	22	can	can	AUX
afs-147802	22	23	inhibit	inhibit	VERB
afs-147802	22	24	photosynthesis	photosynthesis	NOUN
afs-147802	22	25	rates	rate	NOUN
afs-147802	22	26	(	(	PUNCT
afs-147802	22	27	e.g.	e.g.	ADV
afs-147802	22	28	,	,	PUNCT
afs-147802	22	29	košnarová	košnarová	PROPN
afs-147802	22	30	et	et	PROPN
afs-147802	22	31	al	al	PROPN
afs-147802	22	32	.	.	PROPN
afs-147802	22	33	2021	2021	NUM
afs-147802	22	34	)	)	PUNCT
afs-147802	22	35	.	.	PUNCT
afs-147802	23	1	common	common	ADJ
afs-147802	23	2	chickweed	chickweed	NOUN
afs-147802	23	3	(	(	PUNCT
afs-147802	23	4	stellaria	stellaria	NOUN
afs-147802	23	5	media	medium	NOUN
afs-147802	23	6	)	)	PUNCT
afs-147802	23	7	,	,	PUNCT
afs-147802	23	8	an	an	DET
afs-147802	23	9	adaptable	adaptable	ADJ
afs-147802	23	10	and	and	CCONJ
afs-147802	23	11	competitive	competitive	ADJ
afs-147802	23	12	annual	annual	ADJ
afs-147802	23	13	weed	weed	NOUN
afs-147802	23	14	,	,	PUNCT
afs-147802	23	15	is	be	AUX
afs-147802	23	16	a	a	DET
afs-147802	23	17	significant	significant	ADJ
afs-147802	23	18	threat	threat	NOUN
afs-147802	23	19	to	to	ADP
afs-147802	23	20	both	both	CCONJ
afs-147802	23	21	agricultural	agricultural	ADJ
afs-147802	23	22	and	and	CCONJ
afs-147802	23	23	horticultural	horticultural	ADJ
afs-147802	23	24	systems	system	NOUN
afs-147802	23	25	due	due	ADP
afs-147802	23	26	to	to	ADP
afs-147802	23	27	its	its	PRON
afs-147802	23	28	dense	dense	ADJ
afs-147802	23	29	,	,	PUNCT
afs-147802	23	30	low	low	ADV
afs-147802	23	31	-	-	PUNCT
afs-147802	23	32	growing	grow	VERB
afs-147802	23	33	canopy	canopy	NOUN
afs-147802	23	34	.	.	PUNCT
afs-147802	24	1	resistance	resistance	NOUN
afs-147802	24	2	to	to	PART
afs-147802	24	3	als	als	VERB
afs-147802	24	4	inhibitors	inhibitor	NOUN
afs-147802	24	5	in	in	ADP
afs-147802	24	6	s.	s.	PROPN
afs-147802	24	7	media	media	PROPN
afs-147802	24	8	was	be	AUX
afs-147802	24	9	first	first	ADV
afs-147802	24	10	reported	report	VERB
afs-147802	24	11	in	in	ADP
afs-147802	24	12	europe	europe	PROPN
afs-147802	24	13	in	in	ADP
afs-147802	24	14	the	the	DET
afs-147802	24	15	1980s	1980	NOUN
afs-147802	24	16	(	(	PUNCT
afs-147802	24	17	barnwell	barnwell	NOUN
afs-147802	24	18	and	and	CCONJ
afs-147802	24	19	cobb	cobb	PROPN
afs-147802	24	20	1989	1989	NUM
afs-147802	24	21	)	)	PUNCT
afs-147802	24	22	and	and	CCONJ
afs-147802	24	23	persists	persist	NOUN
afs-147802	24	24	as	as	ADP
afs-147802	24	25	a	a	DET
afs-147802	24	26	problem	problem	NOUN
afs-147802	24	27	today	today	NOUN
afs-147802	24	28	(	(	PUNCT
afs-147802	24	29	linn	linn	PROPN
afs-147802	24	30	et	et	PROPN
afs-147802	24	31	al	al	PROPN
afs-147802	24	32	.	.	PROPN
afs-147802	24	33	2019	2019	NUM
afs-147802	24	34	)	)	PUNCT
afs-147802	24	35	.	.	PUNCT
afs-147802	25	1	in	in	ADP
afs-147802	25	2	denmark	denmark	PROPN
afs-147802	25	3	,	,	PUNCT
afs-147802	25	4	s.	s.	PROPN
afs-147802	25	5	media	media	PROPN
afs-147802	25	6	was	be	AUX
afs-147802	25	7	the	the	DET
afs-147802	25	8	first	first	ADJ
afs-147802	25	9	weed	weed	NOUN
afs-147802	25	10	species	specie	NOUN
afs-147802	25	11	to	to	PART
afs-147802	25	12	be	be	AUX
afs-147802	25	13	reported	report	VERB
afs-147802	25	14	as	as	ADP
afs-147802	25	15	resistant	resistant	ADJ
afs-147802	25	16	to	to	PART
afs-147802	25	17	als	als	VERB
afs-147802	25	18	inhibitors	inhibitor	NOUN
afs-147802	25	19	in	in	ADP
afs-147802	25	20	1991	1991	NUM
afs-147802	25	21	,	,	PUNCT
afs-147802	25	22	with	with	ADP
afs-147802	25	23	further	further	ADJ
afs-147802	25	24	resistance	resistance	NOUN
afs-147802	25	25	documented	document	VERB
afs-147802	25	26	in	in	ADP
afs-147802	25	27	other	other	ADJ
afs-147802	25	28	species	specie	NOUN
afs-147802	25	29	since	since	SCONJ
afs-147802	25	30	(	(	PUNCT
afs-147802	25	31	heap	heap	NOUN
afs-147802	25	32	2024	2024	NUM
afs-147802	25	33	)	)	PUNCT
afs-147802	25	34	.	.	PUNCT
afs-147802	26	1	in	in	ADP
afs-147802	26	2	norway	norway	PROPN
afs-147802	26	3	and	and	CCONJ
afs-147802	26	4	sweden	sweden	PROPN
afs-147802	26	5	,	,	PUNCT
afs-147802	26	6	resistance	resistance	NOUN
afs-147802	26	7	to	to	PART
afs-147802	26	8	als	als	VERB
afs-147802	26	9	inhibitors	inhibitor	NOUN
afs-147802	26	10	is	be	AUX
afs-147802	26	11	now	now	ADV
afs-147802	26	12	common	common	ADJ
afs-147802	26	13	,	,	PUNCT
afs-147802	26	14	and	and	CCONJ
afs-147802	26	15	in	in	ADP
afs-147802	26	16	s.	s.	PROPN
afs-147802	26	17	media	media	PROPN
afs-147802	26	18	,	,	PUNCT
afs-147802	26	19	it	it	PRON
afs-147802	26	20	has	have	AUX
afs-147802	26	21	been	be	AUX
afs-147802	26	22	linked	link	VERB
afs-147802	26	23	to	to	ADP
afs-147802	26	24	two	two	NUM
afs-147802	26	25	received	receive	VERB
afs-147802	26	26	9	9	NUM
afs-147802	26	27	september	september	PROPN
afs-147802	26	28	2024	2024	NUM
afs-147802	26	29	/	/	PUNCT
afs-147802	26	30	accepted	accept	VERB
afs-147802	26	31	7	7	NUM
afs-147802	26	32	january	january	NOUN
afs-147802	26	33	2025	2025	NUM
afs-147802	26	34	the	the	DET
afs-147802	26	35	scientific	scientific	ADJ
afs-147802	26	36	agricultural	agricultural	ADJ
afs-147802	26	37	society	society	NOUN
afs-147802	26	38	of	of	ADP
afs-147802	26	39	finland	finland	PROPN
afs-147802	27	1	©	©	PROPN
afs-147802	27	2	this	this	PRON
afs-147802	27	3	is	be	AUX
afs-147802	27	4	an	an	DET
afs-147802	27	5	open	open	ADJ
afs-147802	27	6	access	access	NOUN
afs-147802	27	7	article	article	NOUN
afs-147802	27	8	under	under	ADP
afs-147802	27	9	the	the	DET
afs-147802	27	10	cc	cc	NOUN
afs-147802	27	11	by	by	ADP
afs-147802	27	12	4.0	4.0	NUM
afs-147802	27	13	s.	s.	PROPN
afs-147802	27	14	pihu	pihu	PROPN
afs-147802	27	15	et	et	PROPN
afs-147802	27	16	al	al	PROPN
afs-147802	27	17	.	.	PROPN
afs-147802	28	1	52	52	NUM
afs-147802	28	2	specific	specific	ADJ
afs-147802	28	3	mutations	mutation	NOUN
afs-147802	28	4	in	in	ADP
afs-147802	28	5	the	the	DET
afs-147802	28	6	als	als	NOUN
afs-147802	28	7	protein	protein	NOUN
afs-147802	28	8	:	:	PUNCT
afs-147802	28	9	pro	pro	X
afs-147802	28	10	197	197	NUM
afs-147802	28	11	and	and	CCONJ
afs-147802	28	12	trp	trp	PROPN
afs-147802	28	13	574	574	NUM
afs-147802	28	14	(	(	PUNCT
afs-147802	28	15	laforest	laforest	VERB
afs-147802	28	16	and	and	CCONJ
afs-147802	28	17	soufiane	soufiane	NOUN
afs-147802	28	18	2018	2018	NUM
afs-147802	28	19	)	)	PUNCT
afs-147802	28	20	and	and	CCONJ
afs-147802	28	21	two	two	NUM
afs-147802	28	22	mutations	mutation	NOUN
afs-147802	28	23	in	in	ADP
afs-147802	28	24	the	the	DET
afs-147802	28	25	s.	s.	PROPN
afs-147802	28	26	media	media	PROPN
afs-147802	28	27	als	als	VERB
afs-147802	28	28	gene	gene	NOUN
afs-147802	28	29	(	(	PUNCT
afs-147802	28	30	pro-197	pro-197	NOUN
afs-147802	28	31	-	-	PUNCT
afs-147802	28	32	gln	gln	NOUN
afs-147802	28	33	and	and	CCONJ
afs-147802	28	34	trp-574	trp-574	PROPN
afs-147802	28	35	-	-	PUNCT
afs-147802	28	36	leu	leu	PROPN
afs-147802	28	37	)	)	PUNCT
afs-147802	28	38	.	.	PUNCT
afs-147802	29	1	herbicide	herbicide	NOUN
afs-147802	29	2	resistance	resistance	NOUN
afs-147802	29	3	monitoring	monitoring	NOUN
afs-147802	29	4	in	in	ADP
afs-147802	29	5	the	the	DET
afs-147802	29	6	baltic	baltic	ADJ
afs-147802	29	7	countries	country	NOUN
afs-147802	29	8	and	and	CCONJ
afs-147802	29	9	finland	finland	PROPN
afs-147802	29	10	has	have	AUX
afs-147802	29	11	been	be	AUX
afs-147802	29	12	limited	limit	VERB
afs-147802	29	13	.	.	PUNCT
afs-147802	30	1	however	however	ADV
afs-147802	30	2	,	,	PUNCT
afs-147802	30	3	resistance	resistance	NOUN
afs-147802	30	4	has	have	AUX
afs-147802	30	5	been	be	AUX
afs-147802	30	6	confirmed	confirm	VERB
afs-147802	30	7	in	in	ADP
afs-147802	30	8	lithuania	lithuania	PROPN
afs-147802	30	9	in	in	ADP
afs-147802	30	10	silky	silky	ADJ
afs-147802	30	11	windgrass	windgrass	NOUN
afs-147802	30	12	(	(	PUNCT
afs-147802	30	13	apera	apera	NOUN
afs-147802	30	14	spica	spica	NOUN
afs-147802	30	15	-	-	PUNCT
afs-147802	30	16	venti	venti	NOUN
afs-147802	30	17	(	(	PUNCT
afs-147802	30	18	l.	l.	PROPN
afs-147802	30	19	)	)	PUNCT
afs-147802	30	20	p.	p.	NOUN
afs-147802	30	21	beauv	beauv	NOUN
afs-147802	30	22	.	.	PUNCT
afs-147802	30	23	)	)	PUNCT
afs-147802	31	1	(	(	PUNCT
afs-147802	31	2	auškalnienė	auškalnienė	NOUN
afs-147802	31	3	et	et	PROPN
afs-147802	31	4	al	al	PROPN
afs-147802	31	5	.	.	PROPN
afs-147802	31	6	2020	2020	NUM
afs-147802	31	7	)	)	PUNCT
afs-147802	31	8	.	.	PUNCT
afs-147802	32	1	additionally	additionally	ADV
afs-147802	32	2	,	,	PUNCT
afs-147802	32	3	reports	report	NOUN
afs-147802	32	4	of	of	ADP
afs-147802	32	5	herbicide	herbicide	NOUN
afs-147802	32	6	resistance	resistance	NOUN
afs-147802	32	7	in	in	ADP
afs-147802	32	8	s.	s.	PROPN
afs-147802	32	9	media	media	PROPN
afs-147802	32	10	have	have	AUX
afs-147802	32	11	been	be	AUX
afs-147802	32	12	published	publish	VERB
afs-147802	32	13	from	from	ADP
afs-147802	32	14	finland	finland	PROPN
afs-147802	32	15	(	(	PUNCT
afs-147802	32	16	uusitalo	uusitalo	NOUN
afs-147802	32	17	et	et	PROPN
afs-147802	32	18	al	al	PROPN
afs-147802	32	19	.	.	PROPN
afs-147802	32	20	2013	2013	NUM
afs-147802	32	21	)	)	PUNCT
afs-147802	32	22	.	.	PUNCT
afs-147802	33	1	according	accord	VERB
afs-147802	33	2	to	to	ADP
afs-147802	33	3	the	the	DET
afs-147802	33	4	international	international	ADJ
afs-147802	33	5	herbicide	herbicide	NOUN
afs-147802	33	6	-	-	PUNCT
afs-147802	33	7	resistant	resistant	ADJ
afs-147802	33	8	weed	weed	NOUN
afs-147802	33	9	database	database	NOUN
afs-147802	33	10	(	(	PUNCT
afs-147802	33	11	heap	heap	NOUN
afs-147802	33	12	2024	2024	NUM
afs-147802	33	13	)	)	PUNCT
afs-147802	33	14	,	,	PUNCT
afs-147802	33	15	there	there	PRON
afs-147802	33	16	are	be	VERB
afs-147802	33	17	also	also	ADV
afs-147802	33	18	documented	document	VERB
afs-147802	33	19	cases	case	NOUN
afs-147802	33	20	of	of	ADP
afs-147802	33	21	herbicide	herbicide	NOUN
afs-147802	33	22	-resistant	-resistant	ADJ
afs-147802	33	23	common	common	ADJ
afs-147802	33	24	lambsquarters	lambsquarter	NOUN
afs-147802	33	25	(	(	PUNCT
afs-147802	33	26	chenopodium	chenopodium	NOUN
afs-147802	33	27	album	album	NOUN
afs-147802	33	28	l.	l.	PROPN
afs-147802	33	29	)	)	PUNCT
afs-147802	33	30	in	in	ADP
afs-147802	33	31	finland	finland	PROPN
afs-147802	33	32	,	,	PUNCT
afs-147802	33	33	as	as	ADV
afs-147802	33	34	well	well	ADV
afs-147802	33	35	as	as	ADP
afs-147802	33	36	resistance	resistance	NOUN
afs-147802	33	37	in	in	ADP
afs-147802	33	38	silky	silky	ADJ
afs-147802	33	39	windgrass	windgrass	NOUN
afs-147802	33	40	and	and	CCONJ
afs-147802	33	41	s.	s.	PROPN
afs-147802	33	42	media	media	PROPN
afs-147802	33	43	in	in	ADP
afs-147802	33	44	latvia	latvia	PROPN
afs-147802	33	45	.	.	PUNCT
afs-147802	34	1	in	in	ADP
afs-147802	34	2	estonia	estonia	PROPN
afs-147802	34	3	,	,	PUNCT
afs-147802	34	4	herbicides	herbicide	NOUN
afs-147802	34	5	are	be	AUX
afs-147802	34	6	the	the	DET
afs-147802	34	7	most	most	ADV
afs-147802	34	8	widely	widely	ADV
afs-147802	34	9	used	use	VERB
afs-147802	34	10	type	type	NOUN
afs-147802	34	11	of	of	ADP
afs-147802	34	12	pesticide	pesticide	NOUN
afs-147802	34	13	,	,	PUNCT
afs-147802	34	14	accounting	account	VERB
afs-147802	34	15	for	for	ADP
afs-147802	34	16	approximately	approximately	ADV
afs-147802	34	17	79	79	NUM
afs-147802	34	18	%	%	NOUN
afs-147802	34	19	of	of	ADP
afs-147802	34	20	total	total	ADJ
afs-147802	34	21	pesticide	pesticide	NOUN
afs-147802	34	22	sales	sale	NOUN
afs-147802	34	23	over	over	ADP
afs-147802	34	24	the	the	DET
afs-147802	34	25	past	past	ADJ
afs-147802	34	26	decade	decade	NOUN
afs-147802	34	27	(	(	PUNCT
afs-147802	34	28	statistical	statistical	ADJ
afs-147802	34	29	database	database	NOUN
afs-147802	34	30	2023	2023	NUM
afs-147802	34	31	)	)	PUNCT
afs-147802	34	32	.	.	PUNCT
afs-147802	35	1	this	this	DET
afs-147802	35	2	heavy	heavy	ADJ
afs-147802	35	3	reliance	reliance	NOUN
afs-147802	35	4	on	on	ADP
afs-147802	35	5	herbicides	herbicide	NOUN
afs-147802	35	6	makes	make	VERB
afs-147802	35	7	resistance	resistance	NOUN
afs-147802	35	8	development	development	NOUN
afs-147802	35	9	likely	likely	ADV
afs-147802	35	10	,	,	PUNCT
afs-147802	35	11	but	but	CCONJ
afs-147802	35	12	the	the	DET
afs-147802	35	13	potential	potential	NOUN
afs-147802	35	14	for	for	ADP
afs-147802	35	15	herbicide	herbicide	NOUN
afs-147802	35	16	resistance	resistance	NOUN
afs-147802	35	17	in	in	ADP
afs-147802	35	18	estonian	estonian	ADJ
afs-147802	35	19	weed	weed	NOUN
afs-147802	35	20	populations	population	NOUN
afs-147802	35	21	has	have	AUX
afs-147802	35	22	not	not	PART
afs-147802	35	23	been	be	AUX
afs-147802	35	24	thoroughly	thoroughly	ADV
afs-147802	35	25	investigated	investigate	VERB
afs-147802	35	26	.	.	PUNCT
afs-147802	36	1	some	some	DET
afs-147802	36	2	studies	study	NOUN
afs-147802	36	3	have	have	AUX
afs-147802	36	4	explored	explore	VERB
afs-147802	36	5	the	the	DET
afs-147802	36	6	effects	effect	NOUN
afs-147802	36	7	of	of	ADP
afs-147802	36	8	reduced	reduced	ADJ
afs-147802	36	9	herbicide	herbicide	NOUN
afs-147802	36	10	doses	dose	NOUN
afs-147802	36	11	in	in	ADP
afs-147802	36	12	barley	barley	NOUN
afs-147802	36	13	(	(	PUNCT
afs-147802	36	14	talgre	talgre	VERB
afs-147802	36	15	et	et	PROPN
afs-147802	36	16	al	al	PROPN
afs-147802	36	17	.	.	PROPN
afs-147802	36	18	2008	2008	NUM
afs-147802	36	19	)	)	PUNCT
afs-147802	36	20	,	,	PUNCT
afs-147802	36	21	and	and	CCONJ
afs-147802	36	22	recent	recent	ADJ
afs-147802	36	23	research	research	NOUN
afs-147802	36	24	has	have	AUX
afs-147802	36	25	focused	focus	VERB
afs-147802	36	26	on	on	ADP
afs-147802	36	27	long	long	ADJ
afs-147802	36	28	-	-	PUNCT
afs-147802	36	29	term	term	NOUN
afs-147802	36	30	weed	weed	NOUN
afs-147802	36	31	management	management	NOUN
afs-147802	36	32	practices	practice	NOUN
afs-147802	36	33	,	,	PUNCT
afs-147802	36	34	including	include	VERB
afs-147802	36	35	crop	crop	NOUN
afs-147802	36	36	rotation	rotation	NOUN
afs-147802	36	37	and	and	CCONJ
afs-147802	36	38	cover	cover	VERB
afs-147802	36	39	cropping	cropping	NOUN
afs-147802	36	40	(	(	PUNCT
afs-147802	36	41	madsen	madsen	PROPN
afs-147802	36	42	et	et	PROPN
afs-147802	36	43	al	al	PROPN
afs-147802	36	44	.	.	PROPN
afs-147802	36	45	2023	2023	NUM
afs-147802	36	46	)	)	PUNCT
afs-147802	36	47	.	.	PUNCT
afs-147802	37	1	although	although	SCONJ
afs-147802	37	2	commercial	commercial	ADJ
afs-147802	37	3	field	field	NOUN
afs-147802	37	4	trials	trial	NOUN
afs-147802	37	5	on	on	ADP
afs-147802	37	6	herbicide	herbicide	NOUN
afs-147802	37	7	efficacy	efficacy	NOUN
afs-147802	37	8	are	be	AUX
afs-147802	37	9	conducted	conduct	VERB
afs-147802	37	10	,	,	PUNCT
afs-147802	37	11	the	the	DET
afs-147802	37	12	results	result	NOUN
afs-147802	37	13	are	be	AUX
afs-147802	37	14	not	not	PART
afs-147802	37	15	publicly	publicly	ADV
afs-147802	37	16	available	available	ADJ
afs-147802	37	17	.	.	PUNCT
afs-147802	38	1	herbicide	herbicide	NOUN
afs-147802	38	2	resistance	resistance	NOUN
afs-147802	38	3	mechanisms	mechanism	NOUN
afs-147802	38	4	remain	remain	VERB
afs-147802	38	5	largely	largely	ADV
afs-147802	38	6	unexplored	unexplored	ADJ
afs-147802	38	7	in	in	ADP
afs-147802	38	8	the	the	DET
afs-147802	38	9	baltic	baltic	ADJ
afs-147802	38	10	countries	country	NOUN
afs-147802	38	11	.	.	PUNCT
afs-147802	39	1	understanding	understand	VERB
afs-147802	39	2	these	these	DET
afs-147802	39	3	mechanisms	mechanism	NOUN
afs-147802	39	4	is	be	AUX
afs-147802	39	5	crucial	crucial	ADJ
afs-147802	39	6	for	for	ADP
afs-147802	39	7	developing	develop	VERB
afs-147802	39	8	effective	effective	ADJ
afs-147802	39	9	resistance	resistance	NOUN
afs-147802	39	10	management	management	NOUN
afs-147802	39	11	strategies	strategy	NOUN
afs-147802	39	12	.	.	PUNCT
afs-147802	40	1	this	this	DET
afs-147802	40	2	study	study	NOUN
afs-147802	40	3	represents	represent	VERB
afs-147802	40	4	the	the	DET
afs-147802	40	5	first	first	ADJ
afs-147802	40	6	attempt	attempt	NOUN
afs-147802	40	7	to	to	PART
afs-147802	40	8	assess	assess	VERB
afs-147802	40	9	herbicide	herbicide	NOUN
afs-147802	40	10	resistance	resistance	NOUN
afs-147802	40	11	in	in	ADP
afs-147802	40	12	s.	s.	PROPN
afs-147802	40	13	media	media	PROPN
afs-147802	40	14	to	to	ADP
afs-147802	40	15	sulfonylureas	sulfonylureas	PROPN
afs-147802	40	16	in	in	ADP
afs-147802	40	17	estonia	estonia	PROPN
afs-147802	40	18	,	,	PUNCT
afs-147802	40	19	with	with	ADP
afs-147802	40	20	the	the	DET
afs-147802	40	21	primary	primary	ADJ
afs-147802	40	22	objective	objective	NOUN
afs-147802	40	23	of	of	ADP
afs-147802	40	24	evaluating	evaluate	VERB
afs-147802	40	25	the	the	DET
afs-147802	40	26	level	level	NOUN
afs-147802	40	27	of	of	ADP
afs-147802	40	28	resistance	resistance	NOUN
afs-147802	40	29	and	and	CCONJ
afs-147802	40	30	identifying	identify	VERB
afs-147802	40	31	potential	potential	ADJ
afs-147802	40	32	resistance	resistance	NOUN
afs-147802	40	33	mechanisms	mechanism	NOUN
afs-147802	40	34	within	within	ADP
afs-147802	40	35	estonian	estonian	ADJ
afs-147802	40	36	s.	s.	PROPN
afs-147802	40	37	media	medium	NOUN
afs-147802	40	38	populations	population	NOUN
afs-147802	40	39	.	.	PUNCT
afs-147802	41	1	materials	material	NOUN
afs-147802	41	2	and	and	CCONJ
afs-147802	41	3	methods	method	NOUN
afs-147802	41	4	investigation	investigation	NOUN
afs-147802	41	5	of	of	ADP
afs-147802	41	6	possible	possible	ADJ
afs-147802	41	7	resistance	resistance	NOUN
afs-147802	41	8	of	of	ADP
afs-147802	41	9	weeds	weed	NOUN
afs-147802	41	10	to	to	ADP
afs-147802	41	11	different	different	ADJ
afs-147802	41	12	herbicides	herbicide	NOUN
afs-147802	41	13	in	in	ADP
afs-147802	41	14	estonia	estonia	PROPN
afs-147802	41	15	is	be	AUX
afs-147802	41	16	mainly	mainly	ADV
afs-147802	41	17	based	base	VERB
afs-147802	41	18	on	on	ADP
afs-147802	41	19	the	the	DET
afs-147802	41	20	european	european	ADJ
afs-147802	41	21	guidelines	guideline	NOUN
afs-147802	41	22	to	to	PART
afs-147802	41	23	conduct	conduct	VERB
afs-147802	41	24	herbicide	herbicide	NOUN
afs-147802	41	25	resistance	resistance	NOUN
afs-147802	41	26	tests	test	NOUN
afs-147802	41	27	(	(	PUNCT
afs-147802	41	28	2017	2017	NUM
afs-147802	41	29	)	)	PUNCT
afs-147802	41	30	,	,	PUNCT
afs-147802	41	31	this	this	DET
afs-147802	41	32	study	study	NOUN
afs-147802	41	33	as	as	ADV
afs-147802	41	34	well	well	ADV
afs-147802	41	35	.	.	PUNCT
afs-147802	42	1	initially	initially	ADV
afs-147802	42	2	,	,	PUNCT
afs-147802	42	3	two	two	NUM
afs-147802	42	4	estonian	estonian	ADJ
afs-147802	42	5	biotypes	biotype	NOUN
afs-147802	42	6	of	of	ADP
afs-147802	42	7	s.	s.	PROPN
afs-147802	42	8	media	media	PROPN
afs-147802	42	9	were	be	AUX
afs-147802	42	10	selected	select	VERB
afs-147802	42	11	for	for	ADP
afs-147802	42	12	investigation	investigation	NOUN
afs-147802	42	13	as	as	ADP
afs-147802	42	14	part	part	NOUN
afs-147802	42	15	of	of	ADP
afs-147802	42	16	the	the	DET
afs-147802	42	17	routine	routine	ADJ
afs-147802	42	18	monitoring	monitoring	NOUN
afs-147802	42	19	of	of	ADP
afs-147802	42	20	crop	crop	NOUN
afs-147802	42	21	pests	pest	NOUN
afs-147802	42	22	and	and	CCONJ
afs-147802	42	23	diseases	disease	NOUN
afs-147802	42	24	in	in	ADP
afs-147802	42	25	järva	järva	PROPN
afs-147802	42	26	county	county	PROPN
afs-147802	42	27	,	,	PUNCT
afs-147802	42	28	estonia	estonia	PROPN
afs-147802	42	29	during	during	ADP
afs-147802	42	30	the	the	DET
afs-147802	42	31	summer	summer	NOUN
afs-147802	42	32	of	of	ADP
afs-147802	42	33	2021	2021	NUM
afs-147802	42	34	.	.	PUNCT
afs-147802	43	1	these	these	DET
afs-147802	43	2	biotypes	biotype	NOUN
afs-147802	43	3	were	be	AUX
afs-147802	43	4	found	find	VERB
afs-147802	43	5	to	to	PART
afs-147802	43	6	be	be	AUX
afs-147802	43	7	abundant	abundant	ADJ
afs-147802	43	8	in	in	ADP
afs-147802	43	9	cereal	cereal	NOUN
afs-147802	43	10	fields	field	NOUN
afs-147802	43	11	at	at	ADP
afs-147802	43	12	two	two	NUM
afs-147802	43	13	locations	location	NOUN
afs-147802	43	14	,	,	PUNCT
afs-147802	43	15	designated	designate	VERB
afs-147802	43	16	as	as	ADP
afs-147802	43	17	sme14	sme14	ADJ
afs-147802	43	18	(	(	PUNCT
afs-147802	43	19	58.69529n	58.69529n	NUM
afs-147802	43	20	,	,	PUNCT
afs-147802	43	21	25.76610e	25.76610e	NUM
afs-147802	43	22	)	)	PUNCT
afs-147802	43	23	and	and	CCONJ
afs-147802	43	24	sme18	sme18	PROPN
afs-147802	43	25	(	(	PUNCT
afs-147802	43	26	58.65130n	58.65130n	NUM
afs-147802	43	27	,	,	PUNCT
afs-147802	43	28	25.56605e	25.56605e	NUM
afs-147802	43	29	)	)	PUNCT
afs-147802	43	30	.	.	PUNCT
afs-147802	44	1	while	while	SCONJ
afs-147802	44	2	the	the	DET
afs-147802	44	3	precise	precise	ADJ
afs-147802	44	4	herbicide	herbicide	NOUN
afs-147802	44	5	usage	usage	NOUN
afs-147802	44	6	data	datum	NOUN
afs-147802	44	7	for	for	ADP
afs-147802	44	8	these	these	DET
afs-147802	44	9	fields	field	NOUN
afs-147802	44	10	are	be	AUX
afs-147802	44	11	not	not	PART
afs-147802	44	12	available	available	ADJ
afs-147802	44	13	,	,	PUNCT
afs-147802	44	14	the	the	DET
afs-147802	44	15	farmer	farmer	NOUN
afs-147802	44	16	at	at	ADP
afs-147802	44	17	sme14	sme14	NOUN
afs-147802	44	18	indicated	indicate	VERB
afs-147802	44	19	the	the	DET
afs-147802	44	20	application	application	NOUN
afs-147802	44	21	of	of	ADP
afs-147802	44	22	sulfonylurea	sulfonylurea	NOUN
afs-147802	44	23	herbicides	herbicide	NOUN
afs-147802	44	24	,	,	PUNCT
afs-147802	44	25	while	while	SCONJ
afs-147802	44	26	at	at	ADP
afs-147802	44	27	location	location	NOUN
afs-147802	44	28	sme18	sme18	NOUN
afs-147802	44	29	mainly	mainly	ADV
afs-147802	44	30	mcpa	mcpa	ADJ
afs-147802	44	31	has	have	AUX
afs-147802	44	32	been	be	AUX
afs-147802	44	33	used	use	VERB
afs-147802	44	34	.	.	PUNCT
afs-147802	45	1	for	for	ADP
afs-147802	45	2	comparison	comparison	NOUN
afs-147802	45	3	,	,	PUNCT
afs-147802	45	4	seeds	seed	NOUN
afs-147802	45	5	from	from	ADP
afs-147802	45	6	a	a	DET
afs-147802	45	7	previously	previously	ADV
afs-147802	45	8	documented	document	VERB
afs-147802	45	9	herbicide	herbicide	NOUN
afs-147802	45	10	-	-	PUNCT
afs-147802	45	11	sensitive	sensitive	ADJ
afs-147802	45	12	biotype	biotype	NOUN
afs-147802	45	13	from	from	ADP
afs-147802	45	14	the	the	DET
afs-147802	45	15	czech	czech	PROPN
afs-147802	45	16	republic	republic	NOUN
afs-147802	45	17	(	(	PUNCT
afs-147802	45	18	smcz	smcz	PROPN
afs-147802	45	19	)	)	PUNCT
afs-147802	45	20	were	be	AUX
afs-147802	45	21	included	include	VERB
afs-147802	45	22	as	as	ADP
afs-147802	45	23	a	a	DET
afs-147802	45	24	susceptible	susceptible	ADJ
afs-147802	45	25	control	control	NOUN
afs-147802	45	26	.	.	PUNCT
afs-147802	46	1	the	the	DET
afs-147802	46	2	smcz	smcz	NOUN
afs-147802	46	3	seeds	seed	NOUN
afs-147802	46	4	were	be	AUX
afs-147802	46	5	collected	collect	VERB
afs-147802	46	6	from	from	ADP
afs-147802	46	7	a	a	DET
afs-147802	46	8	rural	rural	ADJ
afs-147802	46	9	area	area	NOUN
afs-147802	46	10	near	near	ADP
afs-147802	46	11	the	the	DET
afs-147802	46	12	czech	czech	PROPN
afs-147802	46	13	university	university	PROPN
afs-147802	46	14	of	of	ADP
afs-147802	46	15	life	life	NOUN
afs-147802	46	16	sciences	sciences	PROPN
afs-147802	46	17	in	in	ADP
afs-147802	46	18	prague	prague	PROPN
afs-147802	46	19	,	,	PUNCT
afs-147802	46	20	where	where	SCONJ
afs-147802	46	21	herbicides	herbicide	NOUN
afs-147802	46	22	had	have	AUX
afs-147802	46	23	not	not	PART
afs-147802	46	24	been	be	AUX
afs-147802	46	25	applied	apply	VERB
afs-147802	46	26	for	for	ADP
afs-147802	46	27	an	an	DET
afs-147802	46	28	extended	extended	ADJ
afs-147802	46	29	period	period	NOUN
afs-147802	46	30	.	.	PUNCT
afs-147802	47	1	dose	dose	NOUN
afs-147802	47	2	-	-	PUNCT
afs-147802	47	3	response	response	NOUN
afs-147802	47	4	experiments	experiment	NOUN
afs-147802	47	5	were	be	AUX
afs-147802	47	6	conducted	conduct	VERB
afs-147802	47	7	in	in	ADP
afs-147802	47	8	summer	summer	NOUN
afs-147802	47	9	2022	2022	NUM
afs-147802	47	10	at	at	ADP
afs-147802	47	11	the	the	DET
afs-147802	47	12	czech	czech	PROPN
afs-147802	47	13	university	university	PROPN
afs-147802	47	14	of	of	ADP
afs-147802	47	15	life	life	NOUN
afs-147802	47	16	sciences	sciences	PROPN
afs-147802	47	17	,	,	PUNCT
afs-147802	47	18	prague	prague	NOUN
afs-147802	47	19	.	.	PUNCT
afs-147802	48	1	plants	plant	NOUN
afs-147802	48	2	were	be	AUX
afs-147802	48	3	grown	grow	VERB
afs-147802	48	4	in	in	ADP
afs-147802	48	5	a	a	DET
afs-147802	48	6	semi	semi	ADJ
afs-147802	48	7	-	-	ADJ
afs-147802	48	8	open	open	ADJ
afs-147802	48	9	greenhouse	greenhouse	NOUN
afs-147802	48	10	with	with	ADP
afs-147802	48	11	slightly	slightly	ADV
afs-147802	48	12	shaded	shade	VERB
afs-147802	48	13	light	light	NOUN
afs-147802	48	14	under	under	ADP
afs-147802	48	15	natural	natural	ADJ
afs-147802	48	16	light	light	ADJ
afs-147802	48	17	regime	regime	NOUN
afs-147802	48	18	and	and	CCONJ
afs-147802	48	19	temperature	temperature	NOUN
afs-147802	48	20	conditions	condition	NOUN
afs-147802	48	21	.	.	PUNCT
afs-147802	49	1	the	the	DET
afs-147802	49	2	plants	plant	NOUN
afs-147802	49	3	were	be	AUX
afs-147802	49	4	grown	grow	VERB
afs-147802	49	5	in	in	ADP
afs-147802	49	6	7	7	NUM
afs-147802	49	7	×	×	NOUN
afs-147802	49	8	7	7	NUM
afs-147802	49	9	cm	cm	NOUN
afs-147802	49	10	pots	pot	NOUN
afs-147802	49	11	filled	fill	VERB
afs-147802	49	12	with	with	ADP
afs-147802	49	13	a	a	DET
afs-147802	49	14	commercial	commercial	ADJ
afs-147802	49	15	growing	grow	VERB
afs-147802	49	16	mixture	mixture	NOUN
afs-147802	49	17	combined	combine	VERB
afs-147802	49	18	with	with	ADP
afs-147802	49	19	sand	sand	NOUN
afs-147802	49	20	,	,	PUNCT
afs-147802	49	21	with	with	ADP
afs-147802	49	22	4–5	4–5	NUM
afs-147802	49	23	plants	plant	NOUN
afs-147802	49	24	per	per	ADP
afs-147802	49	25	pot	pot	NOUN
afs-147802	49	26	and	and	CCONJ
afs-147802	49	27	4	4	NUM
afs-147802	49	28	pots	pot	NOUN
afs-147802	49	29	per	per	ADP
afs-147802	49	30	treatment	treatment	NOUN
afs-147802	49	31	.	.	PUNCT
afs-147802	50	1	herbicide	herbicide	NOUN
afs-147802	50	2	treatments	treatment	NOUN
afs-147802	50	3	were	be	AUX
afs-147802	50	4	applied	apply	VERB
afs-147802	50	5	at	at	ADP
afs-147802	50	6	the	the	DET
afs-147802	50	7	2–3	2–3	NUM
afs-147802	50	8	nodes	node	NOUN
afs-147802	50	9	stage	stage	NOUN
afs-147802	50	10	(	(	PUNCT
afs-147802	50	11	bbch	bbch	NOUN
afs-147802	50	12	stage	stage	NOUN
afs-147802	50	13	32–33	32–33	NUM
afs-147802	50	14	,	,	PUNCT
afs-147802	50	15	meier	meier	PROPN
afs-147802	50	16	2001	2001	NUM
afs-147802	50	17	)	)	PUNCT
afs-147802	50	18	using	use	VERB
afs-147802	50	19	a	a	DET
afs-147802	50	20	laboratory	laboratory	NOUN
afs-147802	50	21	spray	spray	NOUN
afs-147802	50	22	chamber	chamber	NOUN
afs-147802	50	23	fited	fit	VERB
afs-147802	50	24	with	with	ADP
afs-147802	50	25	a	a	DET
afs-147802	50	26	lurmark	lurmark	NOUN
afs-147802	50	27	01f80	01f80	NUM
afs-147802	50	28	nozzle	nozzle	NOUN
afs-147802	50	29	,	,	PUNCT
afs-147802	50	30	calibrated	calibrate	VERB
afs-147802	50	31	to	to	ADP
afs-147802	50	32	a	a	DET
afs-147802	50	33	spray	spray	NOUN
afs-147802	50	34	volume	volume	NOUN
afs-147802	50	35	of	of	ADP
afs-147802	50	36	250	250	NUM
afs-147802	50	37	l	l	NOUN
afs-147802	50	38	ha-1	ha-1	NOUN
afs-147802	50	39	and	and	CCONJ
afs-147802	50	40	a	a	DET
afs-147802	50	41	pressure	pressure	NOUN
afs-147802	50	42	of	of	ADP
afs-147802	50	43	250	250	NUM
afs-147802	50	44	kpa	kpa	NOUN
afs-147802	50	45	.	.	PUNCT
afs-147802	51	1	the	the	DET
afs-147802	51	2	herbicide	herbicide	NOUN
afs-147802	51	3	granstar	granstar	NOUN
afs-147802	51	4	50sx	50sx	PROPN
afs-147802	51	5	(	(	PUNCT
afs-147802	51	6	fmc	fmc	NOUN
afs-147802	51	7	-	-	NOUN
afs-147802	51	8	agro	agro	NOUN
afs-147802	51	9	)	)	PUNCT
afs-147802	51	10	,	,	PUNCT
afs-147802	51	11	containing	contain	VERB
afs-147802	51	12	the	the	DET
afs-147802	51	13	active	active	ADJ
afs-147802	51	14	ingredient	ingredient	NOUN
afs-147802	51	15	als	als	VERB
afs-147802	51	16	inhibitor	inhibitor	NOUN
afs-147802	51	17	tribenuron	tribenuron	NOUN
afs-147802	51	18	-	-	PUNCT
afs-147802	51	19	methyl	methyl	NOUN
afs-147802	51	20	(	(	PUNCT
afs-147802	51	21	500	500	NUM
afs-147802	51	22	g	g	NOUN
afs-147802	51	23	kg-1	kg-1	NOUN
afs-147802	51	24	)	)	PUNCT
afs-147802	51	25	,	,	PUNCT
afs-147802	51	26	with	with	ADP
afs-147802	51	27	recommended	recommend	VERB
afs-147802	51	28	dose	dose	VERB
afs-147802	51	29	10–30	10–30	NUM
afs-147802	51	30	g	g	PROPN
afs-147802	51	31	ha-1	ha-1	PROPN
afs-147802	51	32	,	,	PUNCT
afs-147802	51	33	was	be	AUX
afs-147802	51	34	used	use	VERB
afs-147802	51	35	for	for	ADP
afs-147802	51	36	the	the	DET
afs-147802	51	37	experiment	experiment	NOUN
afs-147802	51	38	.	.	PUNCT
afs-147802	52	1	this	this	DET
afs-147802	52	2	study	study	NOUN
afs-147802	52	3	set	set	VERB
afs-147802	52	4	1n	1n	PROPN
afs-147802	52	5	=	=	SYM
afs-147802	52	6	10	10	NUM
afs-147802	52	7	g	g	NOUN
afs-147802	52	8	ha-1	ha-1	NUM
afs-147802	52	9	;	;	PUNCT
afs-147802	52	10	dose	dose	NOUN
afs-147802	52	11	rates	rate	NOUN
afs-147802	52	12	of	of	ADP
afs-147802	52	13	0.1n	0.1n	PROPN
afs-147802	52	14	,	,	PUNCT
afs-147802	52	15	0.3n	0.3n	NOUN
afs-147802	52	16	,	,	PUNCT
afs-147802	52	17	1n	1n	NUM
afs-147802	52	18	,	,	PUNCT
afs-147802	52	19	3n	3n	NUM
afs-147802	52	20	,	,	PUNCT
afs-147802	52	21	6n	6n	NOUN
afs-147802	52	22	and	and	CCONJ
afs-147802	52	23	an	an	DET
afs-147802	52	24	untreated	untreated	ADJ
afs-147802	52	25	control	control	NOUN
afs-147802	52	26	for	for	ADP
afs-147802	52	27	estonian	estonian	ADJ
afs-147802	52	28	biotypes	biotype	NOUN
afs-147802	52	29	were	be	AUX
afs-147802	52	30	used	use	VERB
afs-147802	52	31	.	.	PUNCT
afs-147802	53	1	for	for	ADP
afs-147802	53	2	the	the	DET
afs-147802	53	3	smcz	smcz	PROPN
afs-147802	53	4	control	control	NOUN
afs-147802	53	5	,	,	PUNCT
afs-147802	53	6	doses	dose	NOUN
afs-147802	53	7	of	of	ADP
afs-147802	53	8	0.003n	0.003n	PROPN
afs-147802	53	9	,	,	PUNCT
afs-147802	53	10	0.01n	0.01n	PROPN
afs-147802	53	11	,	,	PUNCT
afs-147802	53	12	0.03n	0.03n	PROPN
afs-147802	53	13	,	,	PUNCT
afs-147802	53	14	0.1n	0.1n	PROPN
afs-147802	53	15	,	,	PUNCT
afs-147802	53	16	1n	1n	NUM
afs-147802	53	17	,	,	PUNCT
afs-147802	53	18	3n	3n	NUM
afs-147802	53	19	and	and	CCONJ
afs-147802	53	20	untreated	untreated	ADJ
afs-147802	53	21	controls	control	NOUN
afs-147802	53	22	were	be	AUX
afs-147802	53	23	used	use	VERB
afs-147802	53	24	.	.	PUNCT
afs-147802	54	1	chlorophyll	chlorophyll	ADJ
afs-147802	54	2	fluorescence	fluorescence	NOUN
afs-147802	54	3	was	be	AUX
afs-147802	54	4	measured	measure	VERB
afs-147802	54	5	in	in	ADP
afs-147802	54	6	both	both	CCONJ
afs-147802	54	7	sme14	sme14	ADJ
afs-147802	54	8	and	and	CCONJ
afs-147802	54	9	sme18	sme18	PROPN
afs-147802	54	10	biotypes	biotype	NOUN
afs-147802	54	11	at	at	ADP
afs-147802	54	12	three	three	NUM
afs-147802	54	13	time	time	NOUN
afs-147802	54	14	points	point	NOUN
afs-147802	54	15	(	(	PUNCT
afs-147802	54	16	2	2	NUM
afs-147802	54	17	,	,	PUNCT
afs-147802	54	18	5	5	NUM
afs-147802	54	19	,	,	PUNCT
afs-147802	54	20	and	and	CCONJ
afs-147802	54	21	13	13	NUM
afs-147802	54	22	days	day	NOUN
afs-147802	54	23	after	after	ADP
afs-147802	54	24	treatment	treatment	NOUN
afs-147802	54	25	)	)	PUNCT
afs-147802	54	26	in	in	ADP
afs-147802	54	27	the	the	DET
afs-147802	54	28	dose	dose	NOUN
afs-147802	54	29	-	-	PUNCT
afs-147802	54	30	response	response	NOUN
afs-147802	54	31	experiment	experiment	NOUN
afs-147802	54	32	.	.	PUNCT
afs-147802	55	1	both	both	DET
afs-147802	55	2	untreated	untreated	ADJ
afs-147802	55	3	controls	control	NOUN
afs-147802	55	4	and	and	CCONJ
afs-147802	55	5	plants	plant	NOUN
afs-147802	55	6	treated	treat	VERB
afs-147802	55	7	with	with	ADP
afs-147802	55	8	the	the	DET
afs-147802	55	9	recommended	recommend	VERB
afs-147802	55	10	herbicide	herbicide	NOUN
afs-147802	55	11	dose	dose	NOUN
afs-147802	55	12	(	(	PUNCT
afs-147802	55	13	1n	1n	NUM
afs-147802	55	14	)	)	PUNCT
afs-147802	55	15	were	be	AUX
afs-147802	55	16	examined	examine	VERB
afs-147802	55	17	.	.	PUNCT
afs-147802	56	1	for	for	ADP
afs-147802	56	2	each	each	DET
afs-147802	56	3	treatment	treatment	NOUN
afs-147802	56	4	,	,	PUNCT
afs-147802	56	5	measurements	measurement	NOUN
afs-147802	56	6	were	be	AUX
afs-147802	56	7	taken	take	VERB
afs-147802	56	8	from	from	ADP
afs-147802	56	9	plants	plant	NOUN
afs-147802	56	10	in	in	ADP
afs-147802	56	11	a	a	DET
afs-147802	56	12	single	single	ADJ
afs-147802	56	13	pot	pot	NOUN
afs-147802	56	14	together	together	ADV
afs-147802	56	15	with	with	ADP
afs-147802	56	16	three	three	NUM
afs-147802	56	17	pots	pot	NOUN
afs-147802	56	18	assessed	assess	VERB
afs-147802	56	19	per	per	ADP
afs-147802	56	20	treatment	treatment	NOUN
afs-147802	56	21	.	.	PUNCT
afs-147802	57	1	prior	prior	ADV
afs-147802	57	2	to	to	ADP
afs-147802	57	3	measurement	measurement	NOUN
afs-147802	57	4	,	,	PUNCT
afs-147802	57	5	plants	plant	NOUN
afs-147802	57	6	were	be	AUX
afs-147802	57	7	dark	dark	ADV
afs-147802	57	8	-	-	PUNCT
afs-147802	57	9	adapted	adapt	VERB
afs-147802	57	10	for	for	ADP
afs-147802	57	11	20	20	NUM
afs-147802	57	12	minutes	minute	NOUN
afs-147802	57	13	.	.	PUNCT
afs-147802	58	1	fluorescence	fluorescence	NOUN
afs-147802	58	2	parameters	parameter	NOUN
afs-147802	58	3	,	,	PUNCT
afs-147802	58	4	including	include	VERB
afs-147802	58	5	baseline	baseline	ADJ
afs-147802	58	6	fluorescence	fluorescence	NOUN
afs-147802	58	7	(	(	PUNCT
afs-147802	58	8	fo	fo	NOUN
afs-147802	58	9	)	)	PUNCT
afs-147802	58	10	and	and	CCONJ
afs-147802	58	11	maximum	maximum	ADJ
afs-147802	58	12	fluorescence	fluorescence	NOUN
afs-147802	58	13	(	(	PUNCT
afs-147802	58	14	fm	fm	NOUN
afs-147802	58	15	)	)	PUNCT
afs-147802	58	16	,	,	PUNCT
afs-147802	58	17	were	be	AUX
afs-147802	58	18	recorded	record	VERB
afs-147802	58	19	from	from	ADP
afs-147802	58	20	three	three	NUM
afs-147802	58	21	leaves	leave	NOUN
afs-147802	58	22	per	per	ADP
afs-147802	58	23	pot	pot	NOUN
afs-147802	58	24	using	use	VERB
afs-147802	58	25	a	a	DET
afs-147802	58	26	pulse	pulse	NOUN
afs-147802	58	27	amplitude	amplitude	NOUN
afs-147802	58	28	modulating	modulate	VERB
afs-147802	58	29	imaging	imaging	NOUN
afs-147802	58	30	fluorimeter	fluorimeter	NOUN
afs-147802	58	31	(	(	PUNCT
afs-147802	58	32	imaging	imaging	NOUN
afs-147802	58	33	-	-	PUNCT
afs-147802	58	34	pam	pam	NOUN
afs-147802	58	35	maxi	maxi	NOUN
afs-147802	58	36	,	,	PUNCT
afs-147802	58	37	heinz	heinz	PROPN
afs-147802	58	38	walz	walz	PROPN
afs-147802	58	39	gmbh	gmbh	PROPN
afs-147802	58	40	)	)	PUNCT
afs-147802	58	41	,	,	PUNCT
afs-147802	58	42	according	accord	VERB
afs-147802	58	43	to	to	ADP
afs-147802	58	44	the	the	DET
afs-147802	58	45	manufacturer	manufacturer	NOUN
afs-147802	58	46	’s	’s	PART
afs-147802	58	47	guidelines	guideline	NOUN
afs-147802	58	48	.	.	PUNCT
afs-147802	59	1	a	a	DET
afs-147802	59	2	saturation	saturation	NOUN
afs-147802	59	3	pulse	pulse	NOUN
afs-147802	59	4	of	of	ADP
afs-147802	59	5	2000	2000	NUM
afs-147802	59	6	μm	μm	NOUN
afs-147802	60	1	s−1	s−1	PROPN
afs-147802	60	2	m−2	m−2	ADV
afs-147802	60	3	of	of	ADP
afs-147802	60	4	photosynthetic	photosynthetic	ADJ
afs-147802	60	5	photon	photon	NOUN
afs-147802	60	6	flux	flux	NOUN
afs-147802	60	7	density	density	NOUN
afs-147802	60	8	,	,	PUNCT
afs-147802	60	9	at	at	ADP
afs-147802	60	10	a	a	DET
afs-147802	60	11	wavelength	wavelength	NOUN
afs-147802	60	12	of	of	ADP
afs-147802	60	13	450	450	NUM
afs-147802	60	14	nm	nm	NOUN
afs-147802	60	15	,	,	PUNCT
afs-147802	60	16	was	be	AUX
afs-147802	60	17	applied	apply	VERB
afs-147802	60	18	.	.	PUNCT
afs-147802	61	1	the	the	DET
afs-147802	61	2	mean	mean	ADJ
afs-147802	61	3	values	value	NOUN
afs-147802	61	4	per	per	ADP
afs-147802	61	5	pot	pot	NOUN
afs-147802	61	6	were	be	AUX
afs-147802	61	7	calculated	calculate	VERB
afs-147802	61	8	,	,	PUNCT
afs-147802	61	9	and	and	CCONJ
afs-147802	61	10	the	the	DET
afs-147802	61	11	chlorophyll	chlorophyll	NOUN
afs-147802	61	12	fluorescence	fluorescence	NOUN
afs-147802	61	13	ratio	ratio	NOUN
afs-147802	61	14	fv	fv	PROPN
afs-147802	61	15	/	/	SYM
afs-147802	61	16	fm	fm	PROPN
afs-147802	61	17	,	,	PUNCT
afs-147802	61	18	which	which	PRON
afs-147802	61	19	represents	represent	VERB
afs-147802	61	20	the	the	DET
afs-147802	61	21	maximum	maximum	ADJ
afs-147802	61	22	quantum	quantum	ADJ
afs-147802	61	23	yield	yield	NOUN
afs-147802	61	24	of	of	ADP
afs-147802	61	25	photosystem	photosystem	NOUN
afs-147802	61	26	ii	ii	NOUN
afs-147802	61	27	(	(	PUNCT
afs-147802	61	28	psii	psii	ADV
afs-147802	61	29	)	)	PUNCT
afs-147802	61	30	,	,	PUNCT
afs-147802	61	31	was	be	AUX
afs-147802	61	32	determined	determine	VERB
afs-147802	61	33	as	as	SCONJ
afs-147802	61	34	described	describe	VERB
afs-147802	61	35	by	by	ADP
afs-147802	61	36	maxwell	maxwell	PROPN
afs-147802	61	37	and	and	CCONJ
afs-147802	61	38	johnson	johnson	PROPN
afs-147802	61	39	(	(	PUNCT
afs-147802	61	40	2000	2000	NUM
afs-147802	61	41	)	)	PUNCT
afs-147802	61	42	.	.	PUNCT
afs-147802	62	1	agricultural	agricultural	ADJ
afs-147802	62	2	and	and	CCONJ
afs-147802	62	3	food	food	NOUN
afs-147802	62	4	science	science	NOUN
afs-147802	62	5	(	(	PUNCT
afs-147802	62	6	2025	2025	NUM
afs-147802	62	7	)	)	PUNCT
afs-147802	62	8	34	34	NUM
afs-147802	62	9	:	:	PUNCT
afs-147802	62	10	51–60	51–60	NUM
afs-147802	62	11	53	53	NUM
afs-147802	62	12	in	in	ADP
afs-147802	62	13	2023	2023	NUM
afs-147802	62	14	,	,	PUNCT
afs-147802	62	15	new	new	ADJ
afs-147802	62	16	seeds	seed	NOUN
afs-147802	62	17	from	from	ADP
afs-147802	62	18	eight	eight	NUM
afs-147802	62	19	additional	additional	ADJ
afs-147802	62	20	estonian	estonian	ADJ
afs-147802	62	21	populations	population	NOUN
afs-147802	62	22	were	be	AUX
afs-147802	62	23	collected	collect	VERB
afs-147802	62	24	during	during	ADP
afs-147802	62	25	pest	pest	NOUN
afs-147802	62	26	monitoring	monitoring	NOUN
afs-147802	62	27	,	,	PUNCT
afs-147802	62	28	including	include	VERB
afs-147802	62	29	one	one	NUM
afs-147802	62	30	sample	sample	NOUN
afs-147802	62	31	from	from	ADP
afs-147802	62	32	a	a	DET
afs-147802	62	33	farmer	farmer	NOUN
afs-147802	62	34	’s	’s	PART
afs-147802	62	35	complaint	complaint	NOUN
afs-147802	62	36	(	(	PUNCT
afs-147802	62	37	sme134	sme134	PROPN
afs-147802	62	38	)	)	PUNCT
afs-147802	62	39	.	.	PUNCT
afs-147802	63	1	preliminary	preliminary	ADJ
afs-147802	63	2	screening	screening	NOUN
afs-147802	63	3	of	of	ADP
afs-147802	63	4	these	these	DET
afs-147802	63	5	biotypes	biotype	NOUN
afs-147802	63	6	was	be	AUX
afs-147802	63	7	conducted	conduct	VERB
afs-147802	63	8	in	in	ADP
afs-147802	63	9	a	a	DET
afs-147802	63	10	glasshouse	glasshouse	NOUN
afs-147802	63	11	at	at	ADP
afs-147802	63	12	the	the	DET
afs-147802	63	13	centre	centre	NOUN
afs-147802	63	14	of	of	ADP
afs-147802	63	15	estonian	estonian	ADJ
afs-147802	63	16	rural	rural	ADJ
afs-147802	63	17	research	research	NOUN
afs-147802	63	18	and	and	CCONJ
afs-147802	63	19	knowledge	knowledge	NOUN
afs-147802	63	20	in	in	ADP
afs-147802	63	21	jõgeva	jõgeva	PROPN
afs-147802	63	22	,	,	PUNCT
afs-147802	63	23	estonia	estonia	PROPN
afs-147802	63	24	.	.	PUNCT
afs-147802	64	1	in	in	ADP
afs-147802	64	2	this	this	DET
afs-147802	64	3	screening	screening	NOUN
afs-147802	64	4	,	,	PUNCT
afs-147802	64	5	plants	plant	NOUN
afs-147802	64	6	were	be	AUX
afs-147802	64	7	treated	treat	VERB
afs-147802	64	8	with	with	ADP
afs-147802	64	9	tribenuron	tribenuron	NOUN
afs-147802	64	10	-	-	PUNCT
afs-147802	64	11	methyl	methyl	NOUN
afs-147802	64	12	(	(	PUNCT
afs-147802	64	13	granstar	granstar	PROPN
afs-147802	64	14	premia	premia	PROPN
afs-147802	64	15	50sx	50sx	NUM
afs-147802	64	16	)	)	PUNCT
afs-147802	64	17	and	and	CCONJ
afs-147802	64	18	sekator	sekator	PROPN
afs-147802	64	19	od	od	PROPN
afs-147802	64	20	(	(	PUNCT
afs-147802	64	21	bayer	bayer	NOUN
afs-147802	64	22	cropscience	cropscience	NOUN
afs-147802	64	23	)	)	PUNCT
afs-147802	64	24	,	,	PUNCT
afs-147802	64	25	the	the	DET
afs-147802	64	26	latter	latter	ADJ
afs-147802	64	27	containing	contain	VERB
afs-147802	64	28	als	als	NOUN
afs-147802	64	29	inhibitors	inhibitor	NOUN
afs-147802	64	30	amidosulfuron	amidosulfuron	PROPN
afs-147802	64	31	100	100	NUM
afs-147802	64	32	g	g	NOUN
afs-147802	64	33	l-1	l-1	NOUN
afs-147802	64	34	and	and	CCONJ
afs-147802	64	35	iodosulfuron	iodosulfuron	NOUN
afs-147802	64	36	-	-	PUNCT
afs-147802	64	37	methyl	methyl	NOUN
afs-147802	64	38	-	-	PUNCT
afs-147802	64	39	na	na	NOUN
afs-147802	64	40	25	25	NUM
afs-147802	64	41	g	g	NOUN
afs-147802	64	42	l-1	l-1	NOUN
afs-147802	64	43	as	as	ADP
afs-147802	64	44	active	active	ADJ
afs-147802	64	45	ingredients	ingredient	NOUN
afs-147802	64	46	.	.	PUNCT
afs-147802	65	1	the	the	DET
afs-147802	65	2	herbicides	herbicide	NOUN
afs-147802	65	3	were	be	AUX
afs-147802	65	4	applied	apply	VERB
afs-147802	65	5	at	at	ADP
afs-147802	65	6	the	the	DET
afs-147802	65	7	recommended	recommend	VERB
afs-147802	65	8	dose	dose	NOUN
afs-147802	65	9	(	(	PUNCT
afs-147802	65	10	granstar	granstar	PROPN
afs-147802	65	11	premia	premia	PROPN
afs-147802	65	12	50sx	50sx	NUM
afs-147802	65	13	:	:	PUNCT
afs-147802	65	14	1n	1n	NUM
afs-147802	65	15	=	=	SYM
afs-147802	65	16	0.15	0.15	NUM
afs-147802	65	17	l	l	NOUN
afs-147802	65	18	ha-1	ha-1	NUM
afs-147802	65	19	;	;	PUNCT
afs-147802	65	20	sekator	sekator	PROPN
afs-147802	65	21	od	od	NOUN
afs-147802	65	22	:	:	PUNCT
afs-147802	65	23	1n	1n	NUM
afs-147802	65	24	=	=	SYM
afs-147802	65	25	0.15	0.15	NUM
afs-147802	65	26	l	l	NOUN
afs-147802	65	27	ha-1	ha-1	NUM
afs-147802	65	28	)	)	PUNCT
afs-147802	65	29	.	.	PUNCT
afs-147802	66	1	in	in	ADP
afs-147802	66	2	2024	2024	NUM
afs-147802	66	3	,	,	PUNCT
afs-147802	66	4	a	a	DET
afs-147802	66	5	dose	dose	NOUN
afs-147802	66	6	-	-	PUNCT
afs-147802	66	7	response	response	NOUN
afs-147802	66	8	experiment	experiment	NOUN
afs-147802	66	9	was	be	AUX
afs-147802	66	10	conducted	conduct	VERB
afs-147802	66	11	using	use	VERB
afs-147802	66	12	sekator	sekator	NOUN
afs-147802	66	13	od	od	NOUN
afs-147802	66	14	on	on	ADP
afs-147802	66	15	four	four	NUM
afs-147802	66	16	biotypes	biotype	NOUN
afs-147802	66	17	selected	select	VERB
afs-147802	66	18	from	from	ADP
afs-147802	66	19	the	the	DET
afs-147802	66	20	screening	screening	NOUN
afs-147802	66	21	(	(	PUNCT
afs-147802	66	22	sme125	sme125	NOUN
afs-147802	66	23	,	,	PUNCT
afs-147802	66	24	sme134	sme134	PROPN
afs-147802	66	25	,	,	PUNCT
afs-147802	66	26	sme155	sme155	PROPN
afs-147802	66	27	,	,	PUNCT
afs-147802	66	28	and	and	CCONJ
afs-147802	66	29	sme14	sme14	ADJ
afs-147802	66	30	)	)	PUNCT
afs-147802	66	31	.	.	PUNCT
afs-147802	67	1	two	two	NUM
afs-147802	67	2	putatively	putatively	ADV
afs-147802	67	3	resistant	resistant	ADJ
afs-147802	67	4	biotypes	biotype	NOUN
afs-147802	67	5	,	,	PUNCT
afs-147802	67	6	sme	sme	NOUN
afs-147802	67	7	125	125	NUM
afs-147802	67	8	and	and	CCONJ
afs-147802	67	9	sme	sme	PROPN
afs-147802	67	10	134	134	NUM
afs-147802	67	11	(	(	PUNCT
afs-147802	67	12	from	from	ADP
afs-147802	67	13	järva	järva	PROPN
afs-147802	67	14	and	and	CCONJ
afs-147802	67	15	lääne	lääne	PROPN
afs-147802	67	16	-	-	PUNCT
afs-147802	67	17	viru	viru	PROPN
afs-147802	67	18	counties	county	NOUN
afs-147802	67	19	,	,	PUNCT
afs-147802	67	20	respectively	respectively	ADV
afs-147802	67	21	)	)	PUNCT
afs-147802	67	22	,	,	PUNCT
afs-147802	67	23	one	one	NUM
afs-147802	67	24	sensitive	sensitive	ADJ
afs-147802	67	25	biotype	biotype	NOUN
afs-147802	67	26	(	(	PUNCT
afs-147802	67	27	sme155	sme155	PROPN
afs-147802	67	28	)	)	PUNCT
afs-147802	67	29	from	from	ADP
afs-147802	67	30	jõgeva	jõgeva	PROPN
afs-147802	67	31	county	county	PROPN
afs-147802	67	32	,	,	PUNCT
afs-147802	67	33	and	and	CCONJ
afs-147802	67	34	sme14	sme14	NOUN
afs-147802	67	35	as	as	ADP
afs-147802	67	36	a	a	DET
afs-147802	67	37	resistant	resistant	ADJ
afs-147802	67	38	standard	standard	NOUN
afs-147802	67	39	.	.	PUNCT
afs-147802	68	1	plants	plant	NOUN
afs-147802	68	2	were	be	AUX
afs-147802	68	3	grown	grow	VERB
afs-147802	68	4	in	in	ADP
afs-147802	68	5	a	a	DET
afs-147802	68	6	greenhouse	greenhouse	NOUN
afs-147802	68	7	under	under	ADP
afs-147802	68	8	artificial	artificial	ADJ
afs-147802	68	9	light	light	NOUN
afs-147802	68	10	(	(	PUNCT
afs-147802	68	11	16	16	NUM
afs-147802	68	12	hours	hour	NOUN
afs-147802	68	13	of	of	ADP
afs-147802	68	14	light	light	NOUN
afs-147802	68	15	,	,	PUNCT
afs-147802	68	16	8	8	NUM
afs-147802	68	17	hours	hour	NOUN
afs-147802	68	18	of	of	ADP
afs-147802	68	19	darkness	darkness	NOUN
afs-147802	68	20	)	)	PUNCT
afs-147802	68	21	and	and	CCONJ
afs-147802	68	22	treated	treat	VERB
afs-147802	68	23	with	with	ADP
afs-147802	68	24	sekator	sekator	NOUN
afs-147802	68	25	od	od	ADV
afs-147802	68	26	at	at	ADP
afs-147802	68	27	doses	dose	NOUN
afs-147802	68	28	of	of	ADP
afs-147802	68	29	0.06n	0.06n	PROPN
afs-147802	68	30	,	,	PUNCT
afs-147802	68	31	0.3n	0.3n	NOUN
afs-147802	68	32	,	,	PUNCT
afs-147802	68	33	1n	1n	NUM
afs-147802	68	34	,	,	PUNCT
afs-147802	68	35	and	and	CCONJ
afs-147802	68	36	3n	3n	NUM
afs-147802	68	37	.	.	PUNCT
afs-147802	69	1	spraying	spray	VERB
afs-147802	69	2	was	be	AUX
afs-147802	69	3	carried	carry	VERB
afs-147802	69	4	out	out	ADP
afs-147802	69	5	manually	manually	ADV
afs-147802	69	6	with	with	ADP
afs-147802	69	7	a	a	DET
afs-147802	69	8	spray	spray	NOUN
afs-147802	69	9	bottle	bottle	NOUN
afs-147802	69	10	,	,	PUNCT
afs-147802	69	11	maintaining	maintain	VERB
afs-147802	69	12	the	the	DET
afs-147802	69	13	spray	spray	NOUN
afs-147802	69	14	volume	volume	NOUN
afs-147802	69	15	at	at	ADP
afs-147802	69	16	250	250	NUM
afs-147802	69	17	l	l	NOUN
afs-147802	69	18	ha-1	ha-1	NUM
afs-147802	69	19	,	,	PUNCT
afs-147802	69	20	with	with	ADP
afs-147802	69	21	treatments	treatment	NOUN
afs-147802	69	22	applied	apply	VERB
afs-147802	69	23	at	at	ADP
afs-147802	69	24	the	the	DET
afs-147802	69	25	2–3	2–3	NUM
afs-147802	69	26	nodes	node	NOUN
afs-147802	69	27	stage	stage	NOUN
afs-147802	69	28	(	(	PUNCT
afs-147802	69	29	bbch	bbch	NOUN
afs-147802	69	30	stage	stage	NOUN
afs-147802	69	31	32–33	32–33	NUM
afs-147802	69	32	,	,	PUNCT
afs-147802	69	33	meier	meier	PROPN
afs-147802	69	34	2001	2001	NUM
afs-147802	69	35	)	)	PUNCT
afs-147802	69	36	.	.	PUNCT
afs-147802	70	1	in	in	ADP
afs-147802	70	2	all	all	DET
afs-147802	70	3	experiments	experiment	NOUN
afs-147802	70	4	,	,	PUNCT
afs-147802	70	5	herbicide	herbicide	NOUN
afs-147802	70	6	efficacy	efficacy	NOUN
afs-147802	70	7	was	be	AUX
afs-147802	70	8	visually	visually	ADV
afs-147802	70	9	assessed	assess	VERB
afs-147802	70	10	and	and	CCONJ
afs-147802	70	11	the	the	DET
afs-147802	70	12	aboveground	aboveground	ADJ
afs-147802	70	13	biomass	biomass	NOUN
afs-147802	70	14	harvested	harvest	VERB
afs-147802	70	15	21	21	NUM
afs-147802	70	16	days	day	NOUN
afs-147802	70	17	after	after	ADP
afs-147802	70	18	treatment	treatment	NOUN
afs-147802	70	19	.	.	PUNCT
afs-147802	71	1	the	the	DET
afs-147802	71	2	biomass	biomass	NOUN
afs-147802	71	3	was	be	AUX
afs-147802	71	4	dried	dry	VERB
afs-147802	71	5	at	at	ADP
afs-147802	71	6	95	95	NUM
afs-147802	71	7	°	°	ADP
afs-147802	71	8	c	c	NOUN
afs-147802	71	9	for	for	ADP
afs-147802	71	10	48	48	NUM
afs-147802	71	11	hours	hour	NOUN
afs-147802	71	12	and	and	CCONJ
afs-147802	71	13	weighed	weigh	VERB
afs-147802	71	14	.	.	PUNCT
afs-147802	72	1	leaf	leaf	NOUN
afs-147802	72	2	samples	sample	NOUN
afs-147802	72	3	were	be	AUX
afs-147802	72	4	collected	collect	VERB
afs-147802	72	5	from	from	ADP
afs-147802	72	6	untreated	untreated	ADJ
afs-147802	72	7	plants	plant	NOUN
afs-147802	72	8	in	in	ADP
afs-147802	72	9	both	both	DET
afs-147802	72	10	dose	dose	NOUN
afs-147802	72	11	-	-	PUNCT
afs-147802	72	12	response	response	NOUN
afs-147802	72	13	experiments	experiment	NOUN
afs-147802	72	14	.	.	PUNCT
afs-147802	73	1	approximately	approximately	ADV
afs-147802	73	2	50	50	NUM
afs-147802	73	3	mg	mg	NOUN
afs-147802	73	4	of	of	ADP
afs-147802	73	5	leaf	leaf	NOUN
afs-147802	73	6	tissue	tissue	NOUN
afs-147802	73	7	from	from	ADP
afs-147802	73	8	each	each	DET
afs-147802	73	9	sample	sample	NOUN
afs-147802	73	10	was	be	AUX
afs-147802	73	11	homogenized	homogenize	VERB
afs-147802	73	12	using	use	VERB
afs-147802	73	13	a	a	DET
afs-147802	73	14	tissuelyzer	tissuelyzer	NOUN
afs-147802	73	15	ii	ii	NOUN
afs-147802	73	16	,	,	PUNCT
afs-147802	73	17	and	and	CCONJ
afs-147802	73	18	genomic	genomic	ADJ
afs-147802	73	19	dna	dna	NOUN
afs-147802	73	20	was	be	AUX
afs-147802	73	21	extracted	extract	VERB
afs-147802	73	22	using	use	VERB
afs-147802	73	23	qiagen	qiagen	NOUN
afs-147802	73	24	dneasy	dneasy	NOUN
afs-147802	73	25	®	®	NOUN
afs-147802	73	26	plant	plant	NOUN
afs-147802	73	27	mini	mini	NOUN
afs-147802	73	28	kit	kit	NOUN
afs-147802	73	29	,	,	PUNCT
afs-147802	73	30	following	follow	VERB
afs-147802	73	31	the	the	DET
afs-147802	73	32	manufacturer	manufacturer	NOUN
afs-147802	73	33	’s	’s	PART
afs-147802	73	34	protocol	protocol	NOUN
afs-147802	73	35	.	.	PUNCT
afs-147802	74	1	the	the	DET
afs-147802	74	2	primers	primer	NOUN
afs-147802	74	3	used	use	VERB
afs-147802	74	4	to	to	PART
afs-147802	74	5	amplify	amplify	VERB
afs-147802	74	6	the	the	DET
afs-147802	74	7	als	als	NOUN
afs-147802	74	8	gene	gene	NOUN
afs-147802	74	9	,	,	PUNCT
afs-147802	74	10	as	as	SCONJ
afs-147802	74	11	described	describe	VERB
afs-147802	74	12	by	by	ADP
afs-147802	74	13	marshall	marshall	PROPN
afs-147802	74	14	et	et	PROPN
afs-147802	74	15	al	al	PROPN
afs-147802	74	16	.	.	PROPN
afs-147802	75	1	(	(	PUNCT
afs-147802	75	2	2010	2010	NUM
afs-147802	75	3	)	)	PUNCT
afs-147802	75	4	and	and	CCONJ
afs-147802	75	5	laforest	laforest	VERB
afs-147802	75	6	and	and	CCONJ
afs-147802	75	7	soufiane	soufiane	PROPN
afs-147802	75	8	(	(	PUNCT
afs-147802	75	9	2018	2018	NUM
afs-147802	75	10	)	)	PUNCT
afs-147802	75	11	are	be	AUX
afs-147802	75	12	listed	list	VERB
afs-147802	75	13	in	in	ADP
afs-147802	75	14	table	table	NOUN
afs-147802	75	15	1	1	NUM
afs-147802	75	16	.	.	PUNCT
afs-147802	75	17	pcr	pcr	ADJ
afs-147802	75	18	amplification	amplification	NOUN
afs-147802	75	19	was	be	AUX
afs-147802	75	20	performed	perform	VERB
afs-147802	75	21	using	use	VERB
afs-147802	75	22	thermo	thermo	NOUN
afs-147802	75	23	scientific	scientific	ADJ
afs-147802	75	24	™	™	ADJ
afs-147802	75	25	dreamtaq	dreamtaq	VERB
afs-147802	75	26	™	™	ADJ
afs-147802	75	27	hot	hot	ADJ
afs-147802	75	28	start	start	NOUN
afs-147802	75	29	green	green	ADJ
afs-147802	75	30	dna	dna	PROPN
afs-147802	75	31	polymerase	polymerase	NOUN
afs-147802	75	32	under	under	ADP
afs-147802	75	33	the	the	DET
afs-147802	75	34	following	follow	VERB
afs-147802	75	35	cycling	cycling	NOUN
afs-147802	75	36	conditions	condition	NOUN
afs-147802	75	37	:	:	PUNCT
afs-147802	75	38	an	an	DET
afs-147802	75	39	initial	initial	ADJ
afs-147802	75	40	denaturation	denaturation	NOUN
afs-147802	75	41	at	at	ADP
afs-147802	75	42	95	95	NUM
afs-147802	75	43	°	°	ADP
afs-147802	75	44	c	c	NOUN
afs-147802	75	45	for	for	ADP
afs-147802	75	46	5	5	NUM
afs-147802	75	47	minutes	minute	NOUN
afs-147802	75	48	,	,	PUNCT
afs-147802	75	49	followed	follow	VERB
afs-147802	75	50	by	by	ADP
afs-147802	75	51	35	35	NUM
afs-147802	75	52	cycles	cycle	NOUN
afs-147802	75	53	of	of	ADP
afs-147802	75	54	95	95	NUM
afs-147802	75	55	°	°	ADP
afs-147802	75	56	c	c	NOUN
afs-147802	75	57	for	for	ADP
afs-147802	75	58	30	30	NUM
afs-147802	75	59	seconds	second	NOUN
afs-147802	75	60	,	,	PUNCT
afs-147802	75	61	annealing	anneal	VERB
afs-147802	75	62	for	for	ADP
afs-147802	75	63	40	40	NUM
afs-147802	75	64	seconds	second	NOUN
afs-147802	75	65	at	at	ADP
afs-147802	75	66	a	a	DET
afs-147802	75	67	temperature	temperature	NOUN
afs-147802	75	68	specific	specific	ADJ
afs-147802	75	69	to	to	ADP
afs-147802	75	70	each	each	DET
afs-147802	75	71	primer	primer	NOUN
afs-147802	75	72	pair	pair	NOUN
afs-147802	75	73	,	,	PUNCT
afs-147802	75	74	72	72	NUM
afs-147802	75	75	°	°	NUM
afs-147802	75	76	c	c	NOUN
afs-147802	75	77	for	for	ADP
afs-147802	75	78	1	1	NUM
afs-147802	75	79	minute	minute	NOUN
afs-147802	75	80	,	,	PUNCT
afs-147802	75	81	and	and	CCONJ
afs-147802	75	82	a	a	DET
afs-147802	75	83	final	final	ADJ
afs-147802	75	84	extension	extension	NOUN
afs-147802	75	85	at	at	ADP
afs-147802	75	86	72	72	NUM
afs-147802	75	87	°	°	ADP
afs-147802	75	88	c	c	NOUN
afs-147802	75	89	for	for	ADP
afs-147802	75	90	5	5	NUM
afs-147802	75	91	minutes	minute	NOUN
afs-147802	75	92	.	.	PUNCT
afs-147802	76	1	the	the	DET
afs-147802	76	2	pcr	pcr	PROPN
afs-147802	76	3	products	product	NOUN
afs-147802	76	4	were	be	AUX
afs-147802	76	5	sequenced	sequence	VERB
afs-147802	76	6	by	by	ADP
afs-147802	76	7	the	the	DET
afs-147802	76	8	dideoxynucleotide	dideoxynucleotide	NOUN
afs-147802	76	9	chain	chain	NOUN
afs-147802	76	10	-	-	PUNCT
afs-147802	76	11	termination	termination	NOUN
afs-147802	76	12	method	method	NOUN
afs-147802	76	13	(	(	PUNCT
afs-147802	76	14	sanger	sanger	PROPN
afs-147802	76	15	et	et	PROPN
afs-147802	76	16	al	al	PROPN
afs-147802	76	17	.	.	PROPN
afs-147802	76	18	1977	1977	NUM
afs-147802	76	19	)	)	PUNCT
afs-147802	76	20	on	on	ADP
afs-147802	76	21	the	the	DET
afs-147802	76	22	applied	apply	VERB
afs-147802	76	23	biosystems	biosystem	NOUN
afs-147802	76	24	capillary	capillary	ADJ
afs-147802	76	25	electrophoresis	electrophoresis	NOUN
afs-147802	76	26	system	system	NOUN
afs-147802	76	27	at	at	ADP
afs-147802	76	28	the	the	DET
afs-147802	76	29	university	university	PROPN
afs-147802	76	30	of	of	ADP
afs-147802	76	31	tartu	tartu	PROPN
afs-147802	76	32	,	,	PUNCT
afs-147802	76	33	institute	institute	NOUN
afs-147802	76	34	of	of	ADP
afs-147802	76	35	genomics	genomics	PROPN
afs-147802	76	36	,	,	PUNCT
afs-147802	76	37	core	core	NOUN
afs-147802	76	38	facility	facility	NOUN
afs-147802	76	39	of	of	ADP
afs-147802	76	40	genomics	genomic	NOUN
afs-147802	76	41	.	.	PUNCT
afs-147802	77	1	the	the	DET
afs-147802	77	2	experimental	experimental	ADJ
afs-147802	77	3	data	datum	NOUN
afs-147802	77	4	were	be	AUX
afs-147802	77	5	analysed	analyse	VERB
afs-147802	77	6	using	use	VERB
afs-147802	77	7	the	the	DET
afs-147802	77	8	tukey	tukey	NOUN
afs-147802	77	9	test	test	NOUN
afs-147802	77	10	,	,	PUNCT
afs-147802	77	11	least	least	ADJ
afs-147802	77	12	squares	square	NOUN
afs-147802	77	13	means	mean	VERB
afs-147802	77	14	(	(	PUNCT
afs-147802	77	15	for	for	ADP
afs-147802	77	16	contrasts	contrast	NOUN
afs-147802	77	17	in	in	ADP
afs-147802	77	18	chlorophyll	chlorophyll	NOUN
afs-147802	77	19	fluorescence	fluorescence	NOUN
afs-147802	77	20	)	)	PUNCT
afs-147802	77	21	,	,	PUNCT
afs-147802	77	22	and	and	CCONJ
afs-147802	77	23	dose	dose	NOUN
afs-147802	77	24	-	-	PUNCT
afs-147802	77	25	response	response	NOUN
afs-147802	77	26	analysis	analysis	NOUN
afs-147802	77	27	in	in	ADP
afs-147802	77	28	r	r	NOUN
afs-147802	77	29	version	version	NOUN
afs-147802	77	30	4.3.1	4.3.1	NUM
afs-147802	77	31	(	(	PUNCT
afs-147802	77	32	r	r	NOUN
afs-147802	77	33	core	core	NOUN
afs-147802	77	34	team	team	NOUN
afs-147802	77	35	2023	2023	NUM
afs-147802	77	36	)	)	PUNCT
afs-147802	77	37	,	,	PUNCT
afs-147802	77	38	utilizing	utilize	VERB
afs-147802	77	39	the	the	DET
afs-147802	77	40	packages	package	NOUN
afs-147802	77	41	‘	'	PUNCT
afs-147802	77	42	agricolae	agricolae	NUM
afs-147802	77	43	’	'	PUNCT
afs-147802	77	44	(	(	PUNCT
afs-147802	77	45	de	de	X
afs-147802	77	46	mendiburu	mendiburu	NOUN
afs-147802	77	47	2023	2023	NUM
afs-147802	77	48	)	)	PUNCT
afs-147802	77	49	and	and	CCONJ
afs-147802	77	50	‘	'	PUNCT
afs-147802	77	51	drc	drc	PROPN
afs-147802	77	52	’	'	PUNCT
afs-147802	77	53	(	(	PUNCT
afs-147802	77	54	ritz	ritz	PROPN
afs-147802	77	55	et	et	PROPN
afs-147802	77	56	al	al	PROPN
afs-147802	77	57	.	.	PROPN
afs-147802	77	58	2015	2015	NUM
afs-147802	77	59	)	)	PUNCT
afs-147802	77	60	.	.	PUNCT
afs-147802	78	1	the	the	DET
afs-147802	78	2	sequence	sequence	NOUN
afs-147802	78	3	data	datum	NOUN
afs-147802	78	4	were	be	AUX
afs-147802	78	5	aligned	align	VERB
afs-147802	78	6	and	and	CCONJ
afs-147802	78	7	analysed	analyse	VERB
afs-147802	78	8	using	use	VERB
afs-147802	78	9	mega	mega	ADJ
afs-147802	78	10	11	11	NUM
afs-147802	78	11	(	(	PUNCT
afs-147802	78	12	tamura	tamura	PROPN
afs-147802	78	13	et	et	PROPN
afs-147802	78	14	al	al	PROPN
afs-147802	78	15	.	.	PROPN
afs-147802	78	16	2021	2021	NUM
afs-147802	78	17	)	)	PUNCT
afs-147802	78	18	and	and	CCONJ
afs-147802	78	19	bioedit	bioedit	NOUN
afs-147802	78	20	(	(	PUNCT
afs-147802	78	21	hall	hall	NOUN
afs-147802	78	22	1999	1999	NUM
afs-147802	78	23	)	)	PUNCT
afs-147802	78	24	.	.	PUNCT
afs-147802	79	1	results	result	VERB
afs-147802	79	2	three	three	NUM
afs-147802	79	3	s.	s.	PROPN
afs-147802	79	4	media	media	PROPN
afs-147802	79	5	biotypes	biotype	NOUN
afs-147802	79	6	were	be	AUX
afs-147802	79	7	initially	initially	ADV
afs-147802	79	8	analyzed	analyze	VERB
afs-147802	79	9	from	from	ADP
afs-147802	79	10	estonia	estonia	PROPN
afs-147802	79	11	(	(	PUNCT
afs-147802	79	12	two	two	NUM
afs-147802	79	13	biotypes	biotype	NOUN
afs-147802	79	14	)	)	PUNCT
afs-147802	79	15	and	and	CCONJ
afs-147802	79	16	the	the	DET
afs-147802	79	17	czech	czech	PROPN
afs-147802	79	18	republic	republic	NOUN
afs-147802	79	19	(	(	PUNCT
afs-147802	79	20	one	one	NUM
afs-147802	79	21	biotype	biotype	NOUN
afs-147802	79	22	)	)	PUNCT
afs-147802	79	23	.	.	PUNCT
afs-147802	80	1	the	the	DET
afs-147802	80	2	sensitivity	sensitivity	NOUN
afs-147802	80	3	of	of	ADP
afs-147802	80	4	the	the	DET
afs-147802	80	5	two	two	NUM
afs-147802	80	6	estonian	estonian	ADJ
afs-147802	80	7	biotypes	biotype	NOUN
afs-147802	80	8	was	be	AUX
afs-147802	80	9	assessed	assess	VERB
afs-147802	80	10	by	by	ADP
afs-147802	80	11	comparing	compare	VERB
afs-147802	80	12	the	the	DET
afs-147802	80	13	reduction	reduction	NOUN
afs-147802	80	14	in	in	ADP
afs-147802	80	15	the	the	DET
afs-147802	80	16	weed	weed	NOUN
afs-147802	80	17	biomass	biomass	NOUN
afs-147802	80	18	relative	relative	ADJ
afs-147802	80	19	to	to	ADP
afs-147802	80	20	the	the	DET
afs-147802	80	21	czech	czech	PROPN
afs-147802	80	22	biotype	biotype	NOUN
afs-147802	80	23	smcz	smcz	PROPN
afs-147802	80	24	.	.	PUNCT
afs-147802	81	1	results	result	NOUN
afs-147802	81	2	from	from	ADP
afs-147802	81	3	the	the	DET
afs-147802	81	4	dose	dose	NOUN
afs-147802	81	5	-	-	PUNCT
afs-147802	81	6	response	response	NOUN
afs-147802	81	7	experiment	experiment	NOUN
afs-147802	81	8	indicated	indicate	VERB
afs-147802	81	9	that	that	SCONJ
afs-147802	81	10	biotype	biotype	NOUN
afs-147802	81	11	sme14	sme14	NOUN
afs-147802	81	12	exhibited	exhibit	VERB
afs-147802	81	13	resistance	resistance	NOUN
afs-147802	81	14	to	to	ADP
afs-147802	81	15	tribenuron	tribenuron	NOUN
afs-147802	81	16	-	-	PUNCT
afs-147802	81	17	methyl	methyl	NOUN
afs-147802	81	18	(	(	PUNCT
afs-147802	81	19	see	see	VERB
afs-147802	81	20	figure	figure	NOUN
afs-147802	81	21	1	1	NUM
afs-147802	81	22	)	)	PUNCT
afs-147802	81	23	.	.	PUNCT
afs-147802	82	1	specifically	specifically	ADV
afs-147802	82	2	,	,	PUNCT
afs-147802	82	3	the	the	DET
afs-147802	82	4	biomass	biomass	NOUN
afs-147802	82	5	of	of	ADP
afs-147802	82	6	sm14	sm14	PROPN
afs-147802	82	7	decreased	decrease	VERB
afs-147802	82	8	to	to	ADP
afs-147802	82	9	less	less	ADJ
afs-147802	82	10	than	than	ADP
afs-147802	82	11	50	50	NUM
afs-147802	82	12	%	%	NOUN
afs-147802	82	13	of	of	ADP
afs-147802	82	14	the	the	DET
afs-147802	82	15	control	control	NOUN
afs-147802	82	16	only	only	ADV
afs-147802	82	17	after	after	ADP
afs-147802	82	18	exposure	exposure	NOUN
afs-147802	82	19	to	to	ADP
afs-147802	82	20	three	three	NUM
afs-147802	82	21	times	time	NOUN
afs-147802	82	22	the	the	DET
afs-147802	82	23	recommended	recommend	VERB
afs-147802	82	24	dose	dose	NOUN
afs-147802	82	25	.	.	PUNCT
afs-147802	83	1	even	even	ADV
afs-147802	83	2	when	when	SCONJ
afs-147802	83	3	exposed	expose	VERB
afs-147802	83	4	to	to	ADP
afs-147802	83	5	six	six	NUM
afs-147802	83	6	times	time	NOUN
afs-147802	83	7	the	the	DET
afs-147802	83	8	recommended	recommend	VERB
afs-147802	83	9	dose	dose	NOUN
afs-147802	83	10	,	,	PUNCT
afs-147802	83	11	the	the	DET
afs-147802	83	12	biomass	biomass	NOUN
afs-147802	83	13	reduction	reduction	NOUN
afs-147802	83	14	was	be	AUX
afs-147802	83	15	less	less	ADV
afs-147802	83	16	pronounced	pronounced	ADJ
afs-147802	83	17	than	than	ADP
afs-147802	83	18	in	in	ADP
afs-147802	83	19	the	the	DET
afs-147802	83	20	sensitive	sensitive	ADJ
afs-147802	83	21	biotypes	biotype	NOUN
afs-147802	83	22	,	,	PUNCT
afs-147802	83	23	and	and	CCONJ
afs-147802	83	24	the	the	DET
afs-147802	83	25	plants	plant	NOUN
afs-147802	83	26	table	table	VERB
afs-147802	83	27	1	1	NUM
afs-147802	83	28	.	.	PUNCT
afs-147802	84	1	the	the	DET
afs-147802	84	2	primers	primer	NOUN
afs-147802	84	3	used	use	VERB
afs-147802	84	4	to	to	PART
afs-147802	84	5	amplify	amplify	VERB
afs-147802	84	6	and	and	CCONJ
afs-147802	84	7	sequence	sequence	NOUN
afs-147802	84	8	stellaria	stellaria	NOUN
afs-147802	84	9	media	media	NOUN
afs-147802	84	10	samples	sample	NOUN
afs-147802	84	11	primer	primer	NOUN
afs-147802	84	12	name	name	NOUN
afs-147802	84	13	sequence	sequence	NOUN
afs-147802	84	14	annealing	anneal	VERB
afs-147802	84	15	temperature	temperature	NOUN
afs-147802	84	16	amplified	amplify	VERB
afs-147802	84	17	nucleotide	nucleotide	ADJ
afs-147802	84	18	positions	position	NOUN
afs-147802	84	19	reference	reference	NOUN
afs-147802	84	20	stf1	stf1	PROPN
afs-147802	84	21	tacccgggtggcgcctctttag	tacccgggtggcgcctctttag	NOUN
afs-147802	84	22	60	60	NUM
afs-147802	84	23	364–965	364–965	NUM
afs-147802	84	24	marshall	marshall	PROPN
afs-147802	84	25	et	et	PROPN
afs-147802	84	26	al	al	PROPN
afs-147802	84	27	.	.	PROPN
afs-147802	84	28	2010	2010	NUM
afs-147802	84	29	str1	str1	PROPN
afs-147802	84	30	atccccgtcaattgaacaaacctcc	atccccgtcaattgaacaaacctcc	PROPN
afs-147802	84	31	stf2	stf2	PROPN
afs-147802	84	32	gctgacctctagtgggcttg	gctgacctctagtgggcttg	PROPN
afs-147802	84	33	60	60	NUM
afs-147802	84	34	1565–1873	1565–1873	NUM
afs-147802	84	35	marshall	marshall	PROPN
afs-147802	84	36	et	et	PROPN
afs-147802	84	37	al	al	PROPN
afs-147802	84	38	.	.	PROPN
afs-147802	84	39	2010	2010	NUM
afs-147802	84	40	str2	str2	PROPN
afs-147802	84	41	gcctccctaagatcggacac	gcctccctaagatcggacac	PROPN
afs-147802	84	42	stf4	stf4	PROPN
afs-147802	84	43	ttagtatcgggactcgctga	ttagtatcgggactcgctga	VERB
afs-147802	84	44	54	54	NUM
afs-147802	84	45	532–1116	532–1116	NUM
afs-147802	84	46	laforest	laforest	ADJ
afs-147802	84	47	and	and	CCONJ
afs-147802	84	48	soufiane	soufiane	PROPN
afs-147802	84	49	2018	2018	NUM
afs-147802	84	50	str4	str4	PROPN
afs-147802	84	51	cccaaacgccaacaacaaa	cccaaacgccaacaacaaa	NOUN
afs-147802	84	52	stf5	stf5	PROPN
afs-147802	84	53	gtatgttggaggagggagtttg	gtatgttggaggagggagtttg	NOUN
afs-147802	84	54	58	58	NUM
afs-147802	84	55	919–1503	919–1503	NUM
afs-147802	84	56	laforest	lafor	ADJ
afs-147802	84	57	and	and	CCONJ
afs-147802	84	58	soufiane	soufiane	PROPN
afs-147802	84	59	2018	2018	NUM
afs-147802	84	60	str5	str5	PROPN
afs-147802	84	61	cagccattgacgagggttatta	cagccattgacgagggttatta	NOUN
afs-147802	84	62	stf6	stf6	PROPN
afs-147802	84	63	gagtggagggatgagttgaatg	gagtggagggatgagttgaatg	PROPN
afs-147802	84	64	58	58	NUM
afs-147802	84	65	1372–1793	1372–1793	NUM
afs-147802	84	66	laforest	laforest	ADJ
afs-147802	84	67	and	and	CCONJ
afs-147802	84	68	soufiane	soufiane	PROPN
afs-147802	84	69	2018	2018	NUM
afs-147802	84	70	str6	str6	PROPN
afs-147802	84	71	atggctgaatcatcggaagg	atggctgaatcatcggaagg	PROPN
afs-147802	84	72	s.	s.	PROPN
afs-147802	84	73	pihu	pihu	PROPN
afs-147802	84	74	et	et	PROPN
afs-147802	84	75	al	al	PROPN
afs-147802	84	76	.	.	PROPN
afs-147802	84	77	54	54	NUM
afs-147802	84	78	remained	remain	VERB
afs-147802	84	79	green	green	ADJ
afs-147802	84	80	and	and	CCONJ
afs-147802	84	81	viable	viable	ADJ
afs-147802	84	82	.	.	PUNCT
afs-147802	85	1	in	in	ADP
afs-147802	85	2	contrast	contrast	NOUN
afs-147802	85	3	,	,	PUNCT
afs-147802	85	4	biotypes	biotype	NOUN
afs-147802	85	5	sme18	sme18	PROPN
afs-147802	85	6	and	and	CCONJ
afs-147802	85	7	smcz	smcz	NOUN
afs-147802	85	8	were	be	AUX
afs-147802	85	9	found	find	VERB
afs-147802	85	10	to	to	PART
afs-147802	85	11	be	be	AUX
afs-147802	85	12	sensitive	sensitive	ADJ
afs-147802	85	13	,	,	PUNCT
afs-147802	85	14	to	to	ADP
afs-147802	85	15	the	the	DET
afs-147802	85	16	herbicide	herbicide	NOUN
afs-147802	85	17	,	,	PUNCT
afs-147802	85	18	displaying	display	VERB
afs-147802	85	19	a	a	DET
afs-147802	85	20	similar	similar	ADJ
afs-147802	85	21	decrease	decrease	NOUN
afs-147802	85	22	in	in	ADP
afs-147802	85	23	biomass	biomass	NOUN
afs-147802	85	24	across	across	ADP
afs-147802	85	25	all	all	DET
afs-147802	85	26	tested	test	VERB
afs-147802	85	27	herbicide	herbicide	NOUN
afs-147802	85	28	concentrations	concentration	NOUN
afs-147802	85	29	,	,	PUNCT
afs-147802	85	30	starting	start	VERB
afs-147802	85	31	from	from	ADP
afs-147802	85	32	0.1	0.1	NUM
afs-147802	85	33	times	time	NOUN
afs-147802	85	34	the	the	DET
afs-147802	85	35	recommended	recommend	VERB
afs-147802	85	36	dose	dose	NOUN
afs-147802	85	37	.	.	PUNCT
afs-147802	86	1	the	the	DET
afs-147802	86	2	dose	dose	NOUN
afs-147802	86	3	-	-	PUNCT
afs-147802	86	4	response	response	NOUN
afs-147802	86	5	relationship	relationship	NOUN
afs-147802	86	6	for	for	ADP
afs-147802	86	7	sme14	sme14	ADJ
afs-147802	86	8	and	and	CCONJ
afs-147802	86	9	smcz	smcz	NOUN
afs-147802	86	10	is	be	AUX
afs-147802	86	11	further	far	ADV
afs-147802	86	12	illustrated	illustrate	VERB
afs-147802	86	13	in	in	ADP
afs-147802	86	14	figure	figure	NOUN
afs-147802	86	15	2	2	NUM
afs-147802	86	16	.	.	PUNCT
afs-147802	87	1	however	however	ADV
afs-147802	87	2	,	,	PUNCT
afs-147802	87	3	since	since	SCONJ
afs-147802	87	4	sme14	sme14	ADJ
afs-147802	87	5	and	and	CCONJ
afs-147802	87	6	sme18	sme18	PROPN
afs-147802	87	7	were	be	AUX
afs-147802	87	8	not	not	PART
afs-147802	87	9	tested	test	VERB
afs-147802	87	10	with	with	ADP
afs-147802	87	11	doses	dose	NOUN
afs-147802	87	12	lower	low	ADJ
afs-147802	87	13	than	than	ADP
afs-147802	87	14	0.1	0.1	NUM
afs-147802	87	15	times	time	NOUN
afs-147802	87	16	the	the	DET
afs-147802	87	17	recommended	recommend	VERB
afs-147802	87	18	dose	dose	NOUN
afs-147802	87	19	,	,	PUNCT
afs-147802	87	20	and	and	CCONJ
afs-147802	87	21	since	since	SCONJ
afs-147802	87	22	the	the	DET
afs-147802	87	23	biomass	biomass	NOUN
afs-147802	87	24	decreased	decrease	VERB
afs-147802	87	25	significantly	significantly	ADV
afs-147802	87	26	even	even	ADV
afs-147802	87	27	at	at	ADP
afs-147802	87	28	concentrations	concentration	NOUN
afs-147802	87	29	as	as	ADV
afs-147802	87	30	low	low	ADJ
afs-147802	87	31	as	as	ADP
afs-147802	87	32	0.1	0.1	NUM
afs-147802	87	33	times	time	NOUN
afs-147802	87	34	the	the	DET
afs-147802	87	35	recommended	recommend	VERB
afs-147802	87	36	dose	dose	NOUN
afs-147802	87	37	,	,	PUNCT
afs-147802	87	38	a	a	DET
afs-147802	87	39	doseresponse	doseresponse	NOUN
afs-147802	87	40	curve	curve	NOUN
afs-147802	87	41	for	for	ADP
afs-147802	87	42	sme18	sme18	NOUN
afs-147802	87	43	could	could	AUX
afs-147802	87	44	not	not	PART
afs-147802	87	45	be	be	AUX
afs-147802	87	46	generated	generate	VERB
afs-147802	87	47	due	due	ADP
afs-147802	87	48	to	to	ADP
afs-147802	87	49	convergence	convergence	NOUN
afs-147802	87	50	issues	issue	NOUN
afs-147802	87	51	in	in	ADP
afs-147802	87	52	the	the	DET
afs-147802	87	53	model	model	NOUN
afs-147802	87	54	.	.	PUNCT
afs-147802	88	1	the	the	DET
afs-147802	88	2	resistance	resistance	NOUN
afs-147802	88	3	index	index	NOUN
afs-147802	88	4	of	of	ADP
afs-147802	88	5	sme14	sme14	ADJ
afs-147802	88	6	relative	relative	ADJ
afs-147802	88	7	to	to	ADP
afs-147802	88	8	smcz	smcz	PROPN
afs-147802	88	9	was	be	AUX
afs-147802	88	10	calculated	calculate	VERB
afs-147802	88	11	as	as	ADP
afs-147802	88	12	32	32	NUM
afs-147802	88	13	460	460	NUM
afs-147802	88	14	.	.	PUNCT
afs-147802	89	1	due	due	ADP
afs-147802	89	2	to	to	ADP
afs-147802	89	3	model	model	NOUN
afs-147802	89	4	convergence	convergence	NOUN
afs-147802	89	5	issues	issue	NOUN
afs-147802	89	6	,	,	PUNCT
afs-147802	89	7	the	the	DET
afs-147802	89	8	resistance	resistance	NOUN
afs-147802	89	9	index	index	NOUN
afs-147802	89	10	for	for	ADP
afs-147802	89	11	sme14	sme14	ADJ
afs-147802	89	12	relative	relative	ADJ
afs-147802	89	13	to	to	ADP
afs-147802	89	14	sme18	sme18	NOUN
afs-147802	89	15	could	could	AUX
afs-147802	89	16	not	not	PART
afs-147802	89	17	be	be	AUX
afs-147802	89	18	determined	determine	VERB
afs-147802	89	19	.	.	PUNCT
afs-147802	90	1	fig	fig	NOUN
afs-147802	90	2	.	.	PUNCT
afs-147802	91	1	1	1	X
afs-147802	91	2	.	.	X
afs-147802	91	3	the	the	DET
afs-147802	91	4	effect	effect	NOUN
afs-147802	91	5	of	of	ADP
afs-147802	91	6	different	different	ADJ
afs-147802	91	7	doses	dose	NOUN
afs-147802	91	8	of	of	ADP
afs-147802	91	9	tribenuron	tribenuron	NOUN
afs-147802	91	10	-	-	PUNCT
afs-147802	91	11	methyl	methyl	NOUN
afs-147802	91	12	on	on	ADP
afs-147802	91	13	the	the	DET
afs-147802	91	14	dry	dry	ADJ
afs-147802	91	15	biomass	biomass	NOUN
afs-147802	91	16	of	of	ADP
afs-147802	91	17	the	the	DET
afs-147802	91	18	s.	s.	PROPN
afs-147802	91	19	media	media	PROPN
afs-147802	91	20	biotypes	biotype	NOUN
afs-147802	91	21	sme14	sme14	NOUN
afs-147802	91	22	(	(	PUNCT
afs-147802	91	23	resistant	resistant	ADJ
afs-147802	91	24	)	)	PUNCT
afs-147802	91	25	,	,	PUNCT
afs-147802	91	26	sme18	sme18	NOUN
afs-147802	91	27	and	and	CCONJ
afs-147802	91	28	smzs	smzs	PROPN
afs-147802	91	29	(	(	PUNCT
afs-147802	91	30	susceptible	susceptible	ADJ
afs-147802	91	31	standard	standard	NOUN
afs-147802	91	32	from	from	ADP
afs-147802	91	33	the	the	DET
afs-147802	91	34	czech	czech	PROPN
afs-147802	91	35	republic	republic	NOUN
afs-147802	91	36	)	)	PUNCT
afs-147802	91	37	.	.	PUNCT
afs-147802	92	1	statistically	statistically	ADV
afs-147802	92	2	significant	significant	ADJ
afs-147802	92	3	differences	difference	NOUN
afs-147802	92	4	in	in	ADP
afs-147802	92	5	biomass	biomass	NOUN
afs-147802	92	6	between	between	ADP
afs-147802	92	7	the	the	DET
afs-147802	92	8	biotypes	biotype	NOUN
afs-147802	92	9	are	be	AUX
afs-147802	92	10	indicated	indicate	VERB
afs-147802	92	11	by	by	ADP
afs-147802	92	12	different	different	ADJ
afs-147802	92	13	letters	letter	NOUN
afs-147802	92	14	,	,	PUNCT
afs-147802	92	15	based	base	VERB
afs-147802	92	16	on	on	ADP
afs-147802	92	17	the	the	DET
afs-147802	92	18	results	result	NOUN
afs-147802	92	19	of	of	ADP
afs-147802	92	20	the	the	DET
afs-147802	92	21	tukey	tukey	PROPN
afs-147802	92	22	test	test	NOUN
afs-147802	92	23	with	with	ADP
afs-147802	92	24	bonferroni	bonferroni	NOUN
afs-147802	92	25	correction	correction	NOUN
afs-147802	92	26	for	for	ADP
afs-147802	92	27	multiple	multiple	ADJ
afs-147802	92	28	comparisons	comparison	NOUN
afs-147802	92	29	.	.	PUNCT
afs-147802	93	1	fig	fig	NOUN
afs-147802	93	2	.	.	PUNCT
afs-147802	94	1	2	2	X
afs-147802	94	2	.	.	X
afs-147802	94	3	the	the	DET
afs-147802	94	4	dose	dose	NOUN
afs-147802	94	5	-	-	PUNCT
afs-147802	94	6	response	response	NOUN
afs-147802	94	7	curves	curve	NOUN
afs-147802	94	8	for	for	SCONJ
afs-147802	94	9	the	the	DET
afs-147802	94	10	biotypes	biotype	NOUN
afs-147802	94	11	sme14	sme14	ADJ
afs-147802	94	12	(	(	PUNCT
afs-147802	94	13	resistant	resistant	ADJ
afs-147802	94	14	)	)	PUNCT
afs-147802	94	15	and	and	CCONJ
afs-147802	94	16	smcz	smcz	NOUN
afs-147802	94	17	(	(	PUNCT
afs-147802	94	18	sensitive	sensitive	ADJ
afs-147802	94	19	)	)	PUNCT
afs-147802	94	20	in	in	ADP
afs-147802	94	21	response	response	NOUN
afs-147802	94	22	to	to	ADP
afs-147802	94	23	tribenuron	tribenuron	NOUN
afs-147802	94	24	-	-	PUNCT
afs-147802	94	25	methyl	methyl	NOUN
afs-147802	94	26	were	be	AUX
afs-147802	94	27	constructed	construct	VERB
afs-147802	94	28	using	use	VERB
afs-147802	94	29	a	a	DET
afs-147802	94	30	fixed	fix	VERB
afs-147802	94	31	four	four	NUM
afs-147802	94	32	-	-	PUNCT
afs-147802	94	33	parameter	parameter	NOUN
afs-147802	94	34	log	log	NOUN
afs-147802	94	35	-	-	PUNCT
afs-147802	94	36	logistic	logistic	NOUN
afs-147802	94	37	model	model	NOUN
afs-147802	94	38	with	with	ADP
afs-147802	94	39	boxcox	boxcox	PROPN
afs-147802	94	40	transformation	transformation	NOUN
afs-147802	94	41	(	(	PUNCT
afs-147802	94	42	model	model	NOUN
afs-147802	94	43	fit	fit	PROPN
afs-147802	94	44	f	f	PROPN
afs-147802	94	45	=	=	SYM
afs-147802	94	46	2.81	2.81	NUM
afs-147802	94	47	,	,	PUNCT
afs-147802	94	48	p	p	X
afs-147802	94	49	=	=	PROPN
afs-147802	94	50	0.029	0.029	NUM
afs-147802	94	51	)	)	PUNCT
afs-147802	94	52	.	.	PUNCT
afs-147802	95	1	the	the	DET
afs-147802	95	2	estimated	estimate	VERB
afs-147802	95	3	effective	effective	ADJ
afs-147802	95	4	dose	dose	NOUN
afs-147802	95	5	(	(	PUNCT
afs-147802	95	6	ed50	ed50	PROPN
afs-147802	95	7	)	)	PUNCT
afs-147802	95	8	for	for	ADP
afs-147802	95	9	sme14	sme14	NOUN
afs-147802	95	10	was	be	AUX
afs-147802	95	11	48.69	48.69	NUM
afs-147802	95	12	g	g	NOUN
afs-147802	95	13	ai	ai	VERB
afs-147802	95	14	ha-1	ha-1	PROPN
afs-147802	95	15	while	while	SCONJ
afs-147802	95	16	for	for	ADP
afs-147802	95	17	smcz	smcz	NOUN
afs-147802	95	18	,	,	PUNCT
afs-147802	95	19	it	it	PRON
afs-147802	95	20	was	be	AUX
afs-147802	95	21	0.0015	0.0015	NUM
afs-147802	95	22	g	g	NOUN
afs-147802	95	23	ai	ai	VERB
afs-147802	95	24	ha-1	ha-1	NUM
afs-147802	95	25	.	.	PUNCT
afs-147802	96	1	agricultural	agricultural	ADJ
afs-147802	96	2	and	and	CCONJ
afs-147802	96	3	food	food	NOUN
afs-147802	96	4	science	science	NOUN
afs-147802	96	5	(	(	PUNCT
afs-147802	96	6	2025	2025	NUM
afs-147802	96	7	)	)	PUNCT
afs-147802	96	8	34	34	NUM
afs-147802	96	9	:	:	PUNCT
afs-147802	96	10	51–60	51–60	NUM
afs-147802	96	11	55	55	NUM
afs-147802	96	12	the	the	DET
afs-147802	96	13	dose	dose	NOUN
afs-147802	96	14	-	-	PUNCT
afs-147802	96	15	response	response	NOUN
afs-147802	96	16	data	datum	NOUN
afs-147802	96	17	from	from	ADP
afs-147802	96	18	the	the	DET
afs-147802	96	19	2022	2022	NUM
afs-147802	96	20	experiment	experiment	NOUN
afs-147802	96	21	were	be	AUX
afs-147802	96	22	additionally	additionally	ADV
afs-147802	96	23	confirmed	confirm	VERB
afs-147802	96	24	through	through	ADP
afs-147802	96	25	the	the	DET
afs-147802	96	26	analysis	analysis	NOUN
afs-147802	96	27	of	of	ADP
afs-147802	96	28	chlorophyll	chlorophyll	NOUN
afs-147802	96	29	fluorescence	fluorescence	NOUN
afs-147802	96	30	,	,	PUNCT
afs-147802	96	31	which	which	PRON
afs-147802	96	32	is	be	AUX
afs-147802	96	33	indirectly	indirectly	ADV
afs-147802	96	34	influenced	influence	VERB
afs-147802	96	35	by	by	ADP
afs-147802	96	36	als	als	NOUN
afs-147802	96	37	inhibitors	inhibitor	NOUN
afs-147802	96	38	.	.	PUNCT
afs-147802	97	1	in	in	ADP
afs-147802	97	2	most	most	ADJ
afs-147802	97	3	cases	case	NOUN
afs-147802	97	4	,	,	PUNCT
afs-147802	97	5	pairwise	pairwise	NOUN
afs-147802	97	6	comparisons	comparison	NOUN
afs-147802	97	7	of	of	ADP
afs-147802	97	8	the	the	DET
afs-147802	97	9	least	least	ADJ
afs-147802	97	10	squares	square	NOUN
afs-147802	97	11	means	mean	NOUN
afs-147802	97	12	of	of	ADP
afs-147802	97	13	the	the	DET
afs-147802	97	14	maximum	maximum	ADJ
afs-147802	97	15	quantum	quantum	ADJ
afs-147802	97	16	yield	yield	NOUN
afs-147802	97	17	of	of	ADP
afs-147802	97	18	photosystem	photosystem	NOUN
afs-147802	97	19	ii	ii	PROPN
afs-147802	97	20	were	be	AUX
afs-147802	97	21	not	not	PART
afs-147802	97	22	statistically	statistically	ADV
afs-147802	97	23	significant	significant	ADJ
afs-147802	97	24	.	.	PUNCT
afs-147802	98	1	however	however	ADV
afs-147802	98	2	,	,	PUNCT
afs-147802	98	3	four	four	NUM
afs-147802	98	4	pairwise	pairwise	NOUN
afs-147802	98	5	contrasts	contrast	NOUN
afs-147802	98	6	were	be	AUX
afs-147802	98	7	statistically	statistically	ADV
afs-147802	98	8	significant	significant	ADJ
afs-147802	98	9	:	:	PUNCT
afs-147802	98	10	sme14treated	sme14treated	ADJ
afs-147802	98	11	13d	13d	NOUN
afs-147802	98	12	vs.	vs.	CCONJ
afs-147802	98	13	sme18treated	sme18treate	VERB
afs-147802	98	14	13d	13d	NOUN
afs-147802	98	15	(	(	PUNCT
afs-147802	98	16	p=	p=	NOUN
afs-147802	98	17	0.022	0.022	NUM
afs-147802	98	18	)	)	PUNCT
afs-147802	98	19	,	,	PUNCT
afs-147802	98	20	sme14	sme14	ADJ
afs-147802	98	21	untreated	untreated	ADJ
afs-147802	98	22	13d	13d	NOUN
afs-147802	98	23	vs.	vs.	CCONJ
afs-147802	98	24	sme18treated	sme18treate	VERB
afs-147802	98	25	13d	13d	NOUN
afs-147802	98	26	(	(	PUNCT
afs-147802	98	27	p=	p=	NOUN
afs-147802	98	28	0.020	0.020	NUM
afs-147802	98	29	)	)	PUNCT
afs-147802	98	30	,	,	PUNCT
afs-147802	98	31	sme18treated	sme18treate	VERB
afs-147802	98	32	5d	5d	PROPN
afs-147802	98	33	vs.	vs.	ADP
afs-147802	98	34	sme18treated	sme18treate	VERB
afs-147802	98	35	13d	13d	NOUN
afs-147802	98	36	(	(	PUNCT
afs-147802	98	37	p=	p=	NOUN
afs-147802	98	38	0.039	0.039	NUM
afs-147802	98	39	)	)	PUNCT
afs-147802	98	40	,	,	PUNCT
afs-147802	98	41	and	and	CCONJ
afs-147802	98	42	sme18treated	sme18treate	VERB
afs-147802	98	43	13d	13d	NOUN
afs-147802	98	44	vs.	vs.	CCONJ
afs-147802	98	45	sme18untreated	sme18untreate	VERB
afs-147802	98	46	13d	13d	NOUN
afs-147802	98	47	(	(	PUNCT
afs-147802	98	48	p=	p=	NOUN
afs-147802	98	49	0.022	0.022	NUM
afs-147802	98	50	)	)	PUNCT
afs-147802	98	51	.	.	PUNCT
afs-147802	99	1	these	these	DET
afs-147802	99	2	results	result	NOUN
afs-147802	99	3	suggest	suggest	VERB
afs-147802	99	4	that	that	SCONJ
afs-147802	99	5	the	the	DET
afs-147802	99	6	fluorescence	fluorescence	NOUN
afs-147802	99	7	of	of	ADP
afs-147802	99	8	the	the	DET
afs-147802	99	9	herbicide	herbicide	NOUN
afs-147802	99	10	treated	treat	VERB
afs-147802	99	11	sensitive	sensitive	ADJ
afs-147802	99	12	biotype	biotype	NOUN
afs-147802	99	13	,	,	PUNCT
afs-147802	99	14	sme18	sme18	PROPN
afs-147802	99	15	,	,	PUNCT
afs-147802	99	16	on	on	ADP
afs-147802	99	17	the	the	DET
afs-147802	99	18	13th	13th	ADJ
afs-147802	99	19	day	day	NOUN
afs-147802	99	20	post	post	ADJ
afs-147802	99	21	-	-	ADJ
afs-147802	99	22	treatment	treatment	NOUN
afs-147802	99	23	differed	differ	VERB
afs-147802	99	24	significantly	significantly	ADV
afs-147802	99	25	from	from	ADP
afs-147802	99	26	that	that	PRON
afs-147802	99	27	of	of	ADP
afs-147802	99	28	sme14	sme14	ADJ
afs-147802	99	29	(	(	PUNCT
afs-147802	99	30	fig	fig	NOUN
afs-147802	99	31	.	.	PUNCT
afs-147802	100	1	3	3	NUM
afs-147802	100	2	)	)	PUNCT
afs-147802	100	3	.	.	PUNCT
afs-147802	101	1	this	this	PRON
afs-147802	101	2	indicates	indicate	VERB
afs-147802	101	3	a	a	DET
afs-147802	101	4	notable	notable	ADJ
afs-147802	101	5	effect	effect	NOUN
afs-147802	101	6	of	of	ADP
afs-147802	101	7	the	the	DET
afs-147802	101	8	treatment	treatment	NOUN
afs-147802	101	9	on	on	ADP
afs-147802	101	10	the	the	DET
afs-147802	101	11	sensitive	sensitive	ADJ
afs-147802	101	12	biotype	biotype	NOUN
afs-147802	101	13	but	but	CCONJ
afs-147802	101	14	not	not	PART
afs-147802	101	15	on	on	ADP
afs-147802	101	16	the	the	DET
afs-147802	101	17	resistant	resistant	ADJ
afs-147802	101	18	one	one	NOUN
afs-147802	101	19	.	.	PUNCT
afs-147802	102	1	the	the	DET
afs-147802	102	2	means	mean	NOUN
afs-147802	102	3	and	and	CCONJ
afs-147802	102	4	standard	standard	ADJ
afs-147802	102	5	deviations	deviation	NOUN
afs-147802	102	6	of	of	ADP
afs-147802	102	7	the	the	DET
afs-147802	102	8	maximum	maximum	ADJ
afs-147802	102	9	quantum	quantum	ADJ
afs-147802	102	10	yield	yield	NOUN
afs-147802	102	11	of	of	ADP
afs-147802	102	12	photosystem	photosystem	NOUN
afs-147802	102	13	ii	ii	NOUN
afs-147802	102	14	for	for	ADP
afs-147802	102	15	both	both	DET
afs-147802	102	16	treated	treat	VERB
afs-147802	102	17	and	and	CCONJ
afs-147802	102	18	untreated	untreated	ADJ
afs-147802	102	19	biotypes	biotype	NOUN
afs-147802	102	20	,	,	PUNCT
afs-147802	102	21	based	base	VERB
afs-147802	102	22	on	on	ADP
afs-147802	102	23	repeated	repeat	VERB
afs-147802	102	24	measurements	measurement	NOUN
afs-147802	102	25	,	,	PUNCT
afs-147802	102	26	are	be	AUX
afs-147802	102	27	given	give	VERB
afs-147802	102	28	in	in	ADP
afs-147802	102	29	table	table	NOUN
afs-147802	102	30	2	2	NUM
afs-147802	102	31	.	.	PUNCT
afs-147802	102	32	due	due	ADP
afs-147802	102	33	to	to	ADP
afs-147802	102	34	the	the	DET
afs-147802	102	35	clear	clear	ADJ
afs-147802	102	36	differences	difference	NOUN
afs-147802	102	37	observed	observe	VERB
afs-147802	102	38	on	on	ADP
afs-147802	102	39	day	day	NOUN
afs-147802	102	40	13	13	NUM
afs-147802	102	41	,	,	PUNCT
afs-147802	102	42	and	and	CCONJ
afs-147802	102	43	the	the	DET
afs-147802	102	44	near	near	ADJ
afs-147802	102	45	desiccation	desiccation	NOUN
afs-147802	102	46	of	of	ADP
afs-147802	102	47	the	the	DET
afs-147802	102	48	sensitive	sensitive	ADJ
afs-147802	102	49	plants	plant	NOUN
afs-147802	102	50	,	,	PUNCT
afs-147802	102	51	measurements	measurement	NOUN
afs-147802	102	52	were	be	AUX
afs-147802	102	53	discontinued	discontinue	VERB
afs-147802	102	54	at	at	ADP
afs-147802	102	55	that	that	DET
afs-147802	102	56	point	point	NOUN
afs-147802	102	57	.	.	PUNCT
afs-147802	103	1	this	this	DET
afs-147802	103	2	observation	observation	NOUN
afs-147802	103	3	highlights	highlight	VERB
afs-147802	103	4	the	the	DET
afs-147802	103	5	delayed	delay	VERB
afs-147802	103	6	response	response	NOUN
afs-147802	103	7	of	of	ADP
afs-147802	103	8	als	als	NOUN
afs-147802	103	9	inhibitors	inhibitor	NOUN
afs-147802	103	10	,	,	PUNCT
afs-147802	103	11	as	as	SCONJ
afs-147802	103	12	evidenced	evidence	VERB
afs-147802	103	13	by	by	ADP
afs-147802	103	14	the	the	DET
afs-147802	103	15	significant	significant	ADJ
afs-147802	103	16	difference	difference	NOUN
afs-147802	103	17	in	in	ADP
afs-147802	103	18	photosynthetic	photosynthetic	ADJ
afs-147802	103	19	activity	activity	NOUN
afs-147802	103	20	of	of	ADP
afs-147802	103	21	the	the	DET
afs-147802	103	22	sensitive	sensitive	ADJ
afs-147802	103	23	biotype	biotype	NOUN
afs-147802	103	24	between	between	ADP
afs-147802	103	25	days	day	NOUN
afs-147802	103	26	5	5	NUM
afs-147802	103	27	and	and	CCONJ
afs-147802	103	28	13	13	NUM
afs-147802	103	29	,	,	PUNCT
afs-147802	103	30	indicating	indicate	VERB
afs-147802	103	31	no	no	DET
afs-147802	103	32	effect	effect	NOUN
afs-147802	103	33	was	be	AUX
afs-147802	103	34	yet	yet	ADV
afs-147802	103	35	detectable	detectable	ADJ
afs-147802	103	36	on	on	ADP
afs-147802	103	37	day	day	NOUN
afs-147802	103	38	five	five	NUM
afs-147802	103	39	.	.	PUNCT
afs-147802	103	40	table	table	NOUN
afs-147802	103	41	2	2	NUM
afs-147802	103	42	.	.	PUNCT
afs-147802	104	1	the	the	DET
afs-147802	104	2	mean	mean	ADJ
afs-147802	104	3	values	value	NOUN
afs-147802	104	4	and	and	CCONJ
afs-147802	104	5	standard	standard	ADJ
afs-147802	104	6	deviations	deviation	NOUN
afs-147802	104	7	of	of	ADP
afs-147802	104	8	the	the	DET
afs-147802	104	9	maximum	maximum	ADJ
afs-147802	104	10	quantum	quantum	ADJ
afs-147802	104	11	yield	yield	NOUN
afs-147802	104	12	of	of	ADP
afs-147802	104	13	photosystem	photosystem	NOUN
afs-147802	104	14	ii	ii	PROPN
afs-147802	104	15	were	be	AUX
afs-147802	104	16	calculated	calculate	VERB
afs-147802	104	17	based	base	VERB
afs-147802	104	18	on	on	ADP
afs-147802	104	19	repeated	repeat	VERB
afs-147802	104	20	measurements	measurement	NOUN
afs-147802	104	21	for	for	ADP
afs-147802	104	22	the	the	DET
afs-147802	104	23	s.	s.	PROPN
afs-147802	104	24	media	media	PROPN
afs-147802	104	25	biotypes	biotype	NOUN
afs-147802	104	26	sme14	sme14	NOUN
afs-147802	104	27	and	and	CCONJ
afs-147802	104	28	sme18	sme18	PROPN
afs-147802	104	29	.	.	PUNCT
afs-147802	105	1	the	the	DET
afs-147802	105	2	treated	treat	VERB
afs-147802	105	3	plants	plant	NOUN
afs-147802	105	4	received	receive	VERB
afs-147802	105	5	the	the	DET
afs-147802	105	6	recommended	recommend	VERB
afs-147802	105	7	dose	dose	NOUN
afs-147802	105	8	of	of	ADP
afs-147802	105	9	tribenuron	tribenuron	NOUN
afs-147802	105	10	-	-	PUNCT
afs-147802	105	11	methyl	methyl	NOUN
afs-147802	105	12	(	(	PUNCT
afs-147802	105	13	10	10	NUM
afs-147802	105	14	g	g	NOUN
afs-147802	105	15	ai	ai	VERB
afs-147802	105	16	ha-1	ha-1	NUM
afs-147802	105	17	)	)	PUNCT
afs-147802	105	18	,	,	PUNCT
afs-147802	105	19	and	and	CCONJ
afs-147802	105	20	both	both	PRON
afs-147802	105	21	treated	treat	VERB
afs-147802	105	22	and	and	CCONJ
afs-147802	105	23	untreated	untreated	ADJ
afs-147802	105	24	plants	plant	NOUN
afs-147802	105	25	were	be	AUX
afs-147802	105	26	measured	measure	VERB
afs-147802	105	27	on	on	ADP
afs-147802	105	28	the	the	DET
afs-147802	105	29	second	second	ADJ
afs-147802	105	30	,	,	PUNCT
afs-147802	105	31	fifth	fifth	ADJ
afs-147802	105	32	,	,	PUNCT
afs-147802	105	33	and	and	CCONJ
afs-147802	105	34	thirteenth	thirteenth	ADJ
afs-147802	105	35	days	day	NOUN
afs-147802	105	36	(	(	PUNCT
afs-147802	105	37	d	d	NOUN
afs-147802	105	38	)	)	PUNCT
afs-147802	105	39	after	after	ADP
afs-147802	105	40	treatment	treatment	NOUN
afs-147802	105	41	.	.	PUNCT
afs-147802	106	1	biotype	biotype	ADJ
afs-147802	106	2	treatment	treatment	NOUN
afs-147802	106	3	time	time	NOUN
afs-147802	106	4	days	day	NOUN
afs-147802	106	5	avg	avg	PROPN
afs-147802	106	6	sd	sd	ADP
afs-147802	106	7	e18untreated	e18untreate	VERB
afs-147802	106	8	control	control	NOUN
afs-147802	106	9	2	2	NUM
afs-147802	106	10	0.686861	0.686861	NUM
afs-147802	106	11	0.02032	0.02032	NUM
afs-147802	106	12	e18treated	e18treate	VERB
afs-147802	106	13	tribenuron	tribenuron	ADJ
afs-147802	106	14	2	2	NUM
afs-147802	106	15	0.572971	0.572971	NUM
afs-147802	106	16	0.180673	0.180673	NUM
afs-147802	106	17	e18untreated	e18untreated	ADJ
afs-147802	106	18	control	control	NOUN
afs-147802	106	19	5	5	NUM
afs-147802	106	20	0.612861	0.612861	NUM
afs-147802	106	21	0.052661	0.052661	NUM
afs-147802	106	22	e18treated	e18treate	VERB
afs-147802	106	23	tribenuron	tribenuron	NOUN
afs-147802	106	24	5	5	NUM
afs-147802	106	25	0.621389	0.621389	NUM
afs-147802	106	26	0.018634	0.018634	NUM
afs-147802	106	27	e18untreated	e18untreate	VERB
afs-147802	106	28	control	control	NOUN
afs-147802	106	29	13	13	NUM
afs-147802	106	30	0.640216	0.640216	NUM
afs-147802	106	31	0.043254	0.043254	NUM
afs-147802	106	32	e18treated	e18treate	VERB
afs-147802	106	33	tribenuron	tribenuron	PROPN
afs-147802	106	34	13	13	NUM
afs-147802	106	35	0.452054	0.452054	NUM
afs-147802	106	36	0.102219	0.102219	NUM
afs-147802	106	37	e14untreated	e14untreate	VERB
afs-147802	106	38	control	control	NOUN
afs-147802	106	39	2	2	NUM
afs-147802	106	40	0.694041	0.694041	NUM
afs-147802	106	41	0.006388	0.006388	NUM
afs-147802	106	42	e14treated	e14treate	VERB
afs-147802	106	43	tribenuron	tribenuron	ADV
afs-147802	106	44	2	2	NUM
afs-147802	106	45	0.682585	0.682585	NUM
afs-147802	106	46	0.01082	0.01082	NUM
afs-147802	106	47	e14untreated	e14untreate	VERB
afs-147802	106	48	control	control	NOUN
afs-147802	106	49	5	5	NUM
afs-147802	106	50	0.657539	0.657539	NUM
afs-147802	106	51	0.001924	0.001924	NUM
afs-147802	106	52	e14treated	e14treate	VERB
afs-147802	106	53	tribenuron	tribenuron	ADV
afs-147802	106	54	5	5	NUM
afs-147802	106	55	0.632312	0.632312	NUM
afs-147802	106	56	0.025729	0.025729	NUM
afs-147802	106	57	e14untreated	e14untreate	VERB
afs-147802	106	58	control	control	NOUN
afs-147802	106	59	13	13	NUM
afs-147802	106	60	0.649511	0.649511	NUM
afs-147802	106	61	0.067532	0.067532	NUM
afs-147802	106	62	e14treated	e14treate	VERB
afs-147802	106	63	tribenuron	tribenuron	NOUN
afs-147802	106	64	13	13	NUM
afs-147802	106	65	0.642839	0.642839	NUM
afs-147802	106	66	0.030618	0.030618	NUM
afs-147802	106	67	fig	fig	NOUN
afs-147802	106	68	.	.	PUNCT
afs-147802	107	1	3	3	X
afs-147802	107	2	.	.	X
afs-147802	108	1	the	the	DET
afs-147802	108	2	mean	mean	ADJ
afs-147802	108	3	psii	psii	ADJ
afs-147802	108	4	values	value	NOUN
afs-147802	108	5	of	of	ADP
afs-147802	108	6	plants	plant	NOUN
afs-147802	108	7	from	from	ADP
afs-147802	108	8	biotypes	biotype	NOUN
afs-147802	108	9	sme14	sme14	ADJ
afs-147802	108	10	and	and	CCONJ
afs-147802	108	11	sme18	sme18	PROPN
afs-147802	108	12	,	,	PUNCT
afs-147802	108	13	treated	treat	VERB
afs-147802	108	14	with	with	ADP
afs-147802	108	15	recommended	recommend	VERB
afs-147802	108	16	dose	dose	NOUN
afs-147802	108	17	of	of	ADP
afs-147802	108	18	tribenuron	tribenuron	NOUN
afs-147802	108	19	-	-	PUNCT
afs-147802	108	20	methyl	methyl	NOUN
afs-147802	108	21	(	(	PUNCT
afs-147802	108	22	10	10	NUM
afs-147802	108	23	g	g	NOUN
afs-147802	108	24	ai	ai	VERB
afs-147802	108	25	ha-1	ha-1	NUM
afs-147802	108	26	)	)	PUNCT
afs-147802	108	27	and	and	CCONJ
afs-147802	108	28	untreated	untreated	ADJ
afs-147802	108	29	controls	control	NOUN
afs-147802	108	30	,	,	PUNCT
afs-147802	108	31	were	be	AUX
afs-147802	108	32	measured	measure	VERB
afs-147802	108	33	on	on	ADP
afs-147802	108	34	the	the	DET
afs-147802	108	35	second	second	ADJ
afs-147802	108	36	,	,	PUNCT
afs-147802	108	37	fifth	fifth	ADJ
afs-147802	108	38	,	,	PUNCT
afs-147802	108	39	and	and	CCONJ
afs-147802	108	40	thirteenth	thirteenth	ADJ
afs-147802	108	41	days	day	NOUN
afs-147802	108	42	after	after	ADP
afs-147802	108	43	treatment	treatment	NOUN
afs-147802	108	44	.	.	PUNCT
afs-147802	109	1	s.	s.	PROPN
afs-147802	109	2	pihu	pihu	PROPN
afs-147802	109	3	et	et	PROPN
afs-147802	109	4	al	al	PROPN
afs-147802	109	5	.	.	PROPN
afs-147802	109	6	56	56	NUM
afs-147802	109	7	in	in	ADP
afs-147802	109	8	2023	2023	NUM
afs-147802	109	9	,	,	PUNCT
afs-147802	109	10	a	a	DET
afs-147802	109	11	screening	screening	NOUN
afs-147802	109	12	of	of	ADP
afs-147802	109	13	eight	eight	NUM
afs-147802	109	14	populations	population	NOUN
afs-147802	109	15	from	from	ADP
afs-147802	109	16	various	various	ADJ
afs-147802	109	17	counties	county	NOUN
afs-147802	109	18	in	in	ADP
afs-147802	109	19	estonia	estonia	PROPN
afs-147802	109	20	indicated	indicate	VERB
afs-147802	109	21	that	that	SCONJ
afs-147802	109	22	tribenuron	tribenuron	NOUN
afs-147802	109	23	-	-	PUNCT
afs-147802	109	24	methyl	methyl	NOUN
afs-147802	109	25	resistance	resistance	NOUN
afs-147802	109	26	is	be	AUX
afs-147802	109	27	not	not	PART
afs-147802	109	28	widely	widely	ADV
afs-147802	109	29	prevalent	prevalent	ADJ
afs-147802	109	30	across	across	ADP
afs-147802	109	31	the	the	DET
afs-147802	109	32	country	country	NOUN
afs-147802	109	33	.	.	PUNCT
afs-147802	110	1	however	however	ADV
afs-147802	110	2	,	,	PUNCT
afs-147802	110	3	the	the	DET
afs-147802	110	4	study	study	NOUN
afs-147802	110	5	suggested	suggest	VERB
afs-147802	110	6	a	a	DET
afs-147802	110	7	potential	potential	ADJ
afs-147802	110	8	resistance	resistance	NOUN
afs-147802	110	9	to	to	ADP
afs-147802	110	10	amidosulfuron	amidosulfuron	NOUN
afs-147802	110	11	+	+	CCONJ
afs-147802	110	12	iodosulfuron	iodosulfuron	NOUN
afs-147802	110	13	in	in	ADP
afs-147802	110	14	biotype	biotype	ADJ
afs-147802	110	15	sme14	sme14	NOUN
afs-147802	110	16	,	,	PUNCT
afs-147802	110	17	as	as	ADV
afs-147802	110	18	well	well	ADV
afs-147802	110	19	as	as	ADP
afs-147802	110	20	two	two	NUM
afs-147802	110	21	other	other	ADJ
afs-147802	110	22	biotypes	biotype	NOUN
afs-147802	110	23	,	,	PUNCT
afs-147802	110	24	sme125	sme125	NOUN
afs-147802	110	25	and	and	CCONJ
afs-147802	110	26	sme134	sme134	PROPN
afs-147802	110	27	,	,	PUNCT
afs-147802	110	28	which	which	PRON
afs-147802	110	29	originated	originate	VERB
afs-147802	110	30	from	from	ADP
afs-147802	110	31	järva	järva	PROPN
afs-147802	110	32	and	and	CCONJ
afs-147802	110	33	lääne	lääne	PROPN
afs-147802	110	34	-	-	PUNCT
afs-147802	110	35	viru	viru	PROPN
afs-147802	110	36	counties	county	NOUN
afs-147802	110	37	,	,	PUNCT
afs-147802	110	38	respectively	respectively	ADV
afs-147802	110	39	(	(	PUNCT
afs-147802	110	40	fig	fig	NOUN
afs-147802	110	41	.	.	PUNCT
afs-147802	110	42	4	4	NUM
afs-147802	110	43	)	)	PUNCT
afs-147802	110	44	.	.	PUNCT
afs-147802	111	1	the	the	DET
afs-147802	111	2	dose	dose	NOUN
afs-147802	111	3	-	-	PUNCT
afs-147802	111	4	response	response	NOUN
afs-147802	111	5	experiment	experiment	NOUN
afs-147802	111	6	involving	involve	VERB
afs-147802	111	7	the	the	DET
afs-147802	111	8	amidosulfuron	amidosulfuron	NOUN
afs-147802	111	9	-	-	PUNCT
afs-147802	111	10	iodosulfuron	iodosulfuron	NOUN
afs-147802	111	11	mixture	mixture	NOUN
afs-147802	111	12	and	and	CCONJ
afs-147802	111	13	these	these	DET
afs-147802	111	14	three	three	NUM
afs-147802	111	15	biotypes	biotype	NOUN
afs-147802	111	16	(	(	PUNCT
afs-147802	111	17	with	with	ADP
afs-147802	111	18	biotype	biotype	NOUN
afs-147802	111	19	sme155	sme155	PROPN
afs-147802	111	20	from	from	ADP
afs-147802	111	21	jõgeva	jõgeva	PROPN
afs-147802	111	22	county	county	PROPN
afs-147802	111	23	serving	serve	VERB
afs-147802	111	24	as	as	ADP
afs-147802	111	25	a	a	DET
afs-147802	111	26	sensitive	sensitive	ADJ
afs-147802	111	27	standard	standard	NOUN
afs-147802	111	28	)	)	PUNCT
afs-147802	111	29	confirmed	confirm	VERB
afs-147802	111	30	resistance	resistance	NOUN
afs-147802	111	31	in	in	ADP
afs-147802	111	32	all	all	DET
afs-147802	111	33	three	three	NUM
afs-147802	111	34	biotypes	biotype	NOUN
afs-147802	111	35	.	.	PUNCT
afs-147802	112	1	resistance	resistance	NOUN
afs-147802	112	2	was	be	AUX
afs-147802	112	3	most	most	ADV
afs-147802	112	4	pronounced	pronounce	VERB
afs-147802	112	5	in	in	ADP
afs-147802	112	6	sme14	sme14	NOUN
afs-147802	112	7	,	,	PUNCT
afs-147802	112	8	while	while	SCONJ
afs-147802	112	9	sme125	sme125	NOUN
afs-147802	112	10	and	and	CCONJ
afs-147802	112	11	sme134	sme134	PROPN
afs-147802	112	12	exhibited	exhibit	VERB
afs-147802	112	13	somewhat	somewhat	ADV
afs-147802	112	14	weaker	weak	ADJ
afs-147802	112	15	resistance	resistance	NOUN
afs-147802	112	16	(	(	PUNCT
afs-147802	112	17	fig	fig	NOUN
afs-147802	112	18	.	.	PUNCT
afs-147802	113	1	5	5	NUM
afs-147802	113	2	)	)	PUNCT
afs-147802	113	3	.	.	PUNCT
afs-147802	114	1	the	the	DET
afs-147802	114	2	ed50	ed50	PROPN
afs-147802	114	3	for	for	ADP
afs-147802	114	4	amidosulfuron	amidosulfuron	NOUN
afs-147802	114	5	+	+	CCONJ
afs-147802	114	6	iodosulfuron	iodosulfuron	NOUN
afs-147802	114	7	was	be	AUX
afs-147802	114	8	90.29	90.29	NUM
afs-147802	114	9	g	g	NOUN
afs-147802	114	10	ai	ai	VERB
afs-147802	114	11	ha-1	ha-1	PROPN
afs-147802	114	12	for	for	ADP
afs-147802	114	13	sme14	sme14	ADJ
afs-147802	114	14	,	,	PUNCT
afs-147802	114	15	41.56	41.56	NUM
afs-147802	114	16	g	g	NOUN
afs-147802	114	17	ai	ai	VERB
afs-147802	114	18	ha-1	ha-1	PROPN
afs-147802	114	19	for	for	ADP
afs-147802	114	20	sme125	sme125	PROPN
afs-147802	114	21	,	,	PUNCT
afs-147802	114	22	and	and	CCONJ
afs-147802	114	23	48.46	48.46	NUM
afs-147802	114	24	g	g	NOUN
afs-147802	114	25	ai	ai	VERB
afs-147802	114	26	ha-1	ha-1	PROPN
afs-147802	114	27	for	for	ADP
afs-147802	114	28	sme134	sme134	PROPN
afs-147802	114	29	,	,	PUNCT
afs-147802	114	30	compared	compare	VERB
afs-147802	114	31	to	to	ADP
afs-147802	114	32	a	a	DET
afs-147802	114	33	recommended	recommend	VERB
afs-147802	114	34	dose	dose	NOUN
afs-147802	114	35	of	of	ADP
afs-147802	114	36	18.75	18.75	NUM
afs-147802	114	37	g	g	NOUN
afs-147802	114	38	ai	ai	VERB
afs-147802	114	39	ha-1	ha-1	NUM
afs-147802	114	40	.	.	PUNCT
afs-147802	115	1	due	due	ADP
afs-147802	115	2	to	to	ADP
afs-147802	115	3	convergance	convergance	NOUN
afs-147802	115	4	issues	issue	NOUN
afs-147802	115	5	in	in	ADP
afs-147802	115	6	the	the	DET
afs-147802	115	7	model	model	NOUN
afs-147802	115	8	,	,	PUNCT
afs-147802	115	9	the	the	DET
afs-147802	115	10	resistance	resistance	NOUN
afs-147802	115	11	index	index	NOUN
afs-147802	115	12	of	of	ADP
afs-147802	115	13	these	these	DET
afs-147802	115	14	biotypes	biotype	NOUN
afs-147802	115	15	relative	relative	ADJ
afs-147802	115	16	to	to	ADP
afs-147802	115	17	the	the	DET
afs-147802	115	18	sensitive	sensitive	ADJ
afs-147802	115	19	sme155	sme155	PROPN
afs-147802	115	20	could	could	AUX
afs-147802	115	21	not	not	PART
afs-147802	115	22	be	be	AUX
afs-147802	115	23	calculated	calculate	VERB
afs-147802	115	24	.	.	PUNCT
afs-147802	116	1	fig	fig	NOUN
afs-147802	116	2	.	.	PUNCT
afs-147802	117	1	4	4	X
afs-147802	117	2	.	.	X
afs-147802	117	3	the	the	DET
afs-147802	117	4	estimated	estimate	VERB
afs-147802	117	5	efficacy	efficacy	NOUN
afs-147802	117	6	of	of	ADP
afs-147802	117	7	als	als	VERB
afs-147802	117	8	inhibitors	inhibitor	NOUN
afs-147802	117	9	in	in	ADP
afs-147802	117	10	eight	eight	NUM
afs-147802	117	11	estonian	estonian	ADJ
afs-147802	117	12	s.	s.	PROPN
afs-147802	117	13	media	media	PROPN
afs-147802	117	14	biotypes	biotype	NOUN
afs-147802	117	15	was	be	AUX
afs-147802	117	16	evaluated	evaluate	VERB
afs-147802	117	17	using	use	VERB
afs-147802	117	18	the	the	DET
afs-147802	117	19	recommended	recommend	VERB
afs-147802	117	20	field	field	NOUN
afs-147802	117	21	doses	dose	NOUN
afs-147802	117	22	of	of	ADP
afs-147802	117	23	two	two	NUM
afs-147802	117	24	als	als	ADV
afs-147802	117	25	-	-	PUNCT
afs-147802	117	26	inhibiting	inhibit	VERB
afs-147802	117	27	herbicides	herbicide	NOUN
afs-147802	117	28	:	:	PUNCT
afs-147802	117	29	tribenuron	tribenuron	NOUN
afs-147802	117	30	-	-	PUNCT
afs-147802	117	31	methyl	methyl	NOUN
afs-147802	117	32	(	(	PUNCT
afs-147802	117	33	with	with	ADP
afs-147802	117	34	a	a	DET
afs-147802	117	35	recommended	recommend	VERB
afs-147802	117	36	dose	dose	NOUN
afs-147802	117	37	of	of	ADP
afs-147802	117	38	12.5	12.5	NUM
afs-147802	117	39	g	g	NOUN
afs-147802	117	40	ai	ai	AUX
afs-147802	117	41	ha-1	ha-1	PROPN
afs-147802	117	42	used	use	VERB
afs-147802	117	43	in	in	ADP
afs-147802	117	44	the	the	DET
afs-147802	117	45	experiment	experiment	NOUN
afs-147802	117	46	)	)	PUNCT
afs-147802	117	47	and	and	CCONJ
afs-147802	117	48	mix	mix	NOUN
afs-147802	117	49	of	of	ADP
afs-147802	117	50	amidosulfuron	amidosulfuron	NOUN
afs-147802	117	51	and	and	CCONJ
afs-147802	117	52	iodosulfuron	iodosulfuron	NOUN
afs-147802	117	53	-	-	PUNCT
afs-147802	117	54	methylna	methylna	NOUN
afs-147802	117	55	(	(	PUNCT
afs-147802	117	56	with	with	ADP
afs-147802	117	57	a	a	DET
afs-147802	117	58	recommended	recommend	VERB
afs-147802	117	59	dose	dose	NOUN
afs-147802	117	60	of	of	ADP
afs-147802	117	61	approximately	approximately	ADV
afs-147802	117	62	18.75	18.75	NUM
afs-147802	117	63	g	g	NOUN
afs-147802	117	64	ai	ai	AUX
afs-147802	117	65	ha-1	ha-1	PROPN
afs-147802	117	66	used	use	VERB
afs-147802	117	67	in	in	ADP
afs-147802	117	68	the	the	DET
afs-147802	117	69	experiment	experiment	NOUN
afs-147802	117	70	)	)	PUNCT
afs-147802	117	71	.	.	PUNCT
afs-147802	118	1	statistically	statistically	ADV
afs-147802	118	2	significant	significant	ADJ
afs-147802	118	3	differences	difference	NOUN
afs-147802	118	4	in	in	ADP
afs-147802	118	5	biomass	biomass	NOUN
afs-147802	118	6	between	between	ADP
afs-147802	118	7	treatments	treatment	NOUN
afs-147802	118	8	were	be	AUX
afs-147802	118	9	determined	determine	VERB
afs-147802	118	10	using	use	VERB
afs-147802	118	11	the	the	DET
afs-147802	118	12	tukey	tukey	NOUN
afs-147802	118	13	test	test	NOUN
afs-147802	118	14	with	with	ADP
afs-147802	118	15	bonferroni	bonferroni	NOUN
afs-147802	118	16	correction	correction	NOUN
afs-147802	118	17	for	for	ADP
afs-147802	118	18	multiple	multiple	ADJ
afs-147802	118	19	comparisons	comparison	NOUN
afs-147802	118	20	(	(	PUNCT
afs-147802	118	21	α	α	NOUN
afs-147802	118	22	=	=	NOUN
afs-147802	118	23	0.05	0.05	NUM
afs-147802	118	24	)	)	PUNCT
afs-147802	118	25	,	,	PUNCT
afs-147802	118	26	with	with	ADP
afs-147802	118	27	different	different	ADJ
afs-147802	118	28	letters	letter	NOUN
afs-147802	118	29	indicating	indicate	VERB
afs-147802	118	30	significant	significant	ADJ
afs-147802	118	31	differences	difference	NOUN
afs-147802	118	32	.	.	PUNCT
afs-147802	119	1	fig	fig	NOUN
afs-147802	119	2	.	.	PUNCT
afs-147802	120	1	5	5	X
afs-147802	120	2	.	.	PUNCT
afs-147802	120	3	the	the	DET
afs-147802	120	4	effect	effect	NOUN
afs-147802	120	5	of	of	ADP
afs-147802	120	6	different	different	ADJ
afs-147802	120	7	rates	rate	NOUN
afs-147802	120	8	of	of	ADP
afs-147802	120	9	amidosulfuron	amidosulfuron	NOUN
afs-147802	120	10	+	+	CCONJ
afs-147802	120	11	iodosulfuron	iodosulfuron	NOUN
afs-147802	120	12	with	with	ADP
afs-147802	120	13	a	a	DET
afs-147802	120	14	recommended	recommend	VERB
afs-147802	120	15	field	field	NOUN
afs-147802	120	16	dose	dose	NOUN
afs-147802	120	17	of	of	ADP
afs-147802	120	18	18.75	18.75	NUM
afs-147802	120	19	g	g	NOUN
afs-147802	121	1	ai	ai	AUX
afs-147802	121	2	ha-1	ha-1	PROPN
afs-147802	121	3	(	(	PUNCT
afs-147802	121	4	denoted	denote	VERB
afs-147802	121	5	as	as	ADP
afs-147802	121	6	1n	1n	NUM
afs-147802	121	7	)	)	PUNCT
afs-147802	121	8	,	,	PUNCT
afs-147802	121	9	on	on	ADP
afs-147802	121	10	the	the	DET
afs-147802	121	11	dry	dry	ADJ
afs-147802	121	12	biomass	biomass	NOUN
afs-147802	121	13	of	of	ADP
afs-147802	121	14	the	the	DET
afs-147802	121	15	s.	s.	PROPN
afs-147802	121	16	media	media	PROPN
afs-147802	121	17	biotypes	biotypes	PROPN
afs-147802	121	18	sme125	sme125	PROPN
afs-147802	121	19	,	,	PUNCT
afs-147802	121	20	sme134	sme134	PROPN
afs-147802	121	21	,	,	PUNCT
afs-147802	121	22	sme14	sme14	ADJ
afs-147802	121	23	(	(	PUNCT
afs-147802	121	24	resistant	resistant	ADJ
afs-147802	121	25	)	)	PUNCT
afs-147802	121	26	and	and	CCONJ
afs-147802	121	27	sme155	sme155	PROPN
afs-147802	121	28	(	(	PUNCT
afs-147802	121	29	susceptible	susceptible	ADJ
afs-147802	121	30	)	)	PUNCT
afs-147802	121	31	was	be	AUX
afs-147802	121	32	assessed	assess	VERB
afs-147802	121	33	.	.	PUNCT
afs-147802	122	1	statistically	statistically	ADV
afs-147802	122	2	significant	significant	ADJ
afs-147802	122	3	differences	difference	NOUN
afs-147802	122	4	in	in	ADP
afs-147802	122	5	biomass	biomass	NOUN
afs-147802	122	6	are	be	AUX
afs-147802	122	7	indicated	indicate	VERB
afs-147802	122	8	by	by	ADP
afs-147802	122	9	different	different	ADJ
afs-147802	122	10	letters	letter	NOUN
afs-147802	122	11	,	,	PUNCT
afs-147802	122	12	based	base	VERB
afs-147802	122	13	on	on	ADP
afs-147802	122	14	the	the	DET
afs-147802	122	15	results	result	NOUN
afs-147802	122	16	of	of	ADP
afs-147802	122	17	the	the	DET
afs-147802	122	18	tukey	tukey	PROPN
afs-147802	122	19	test	test	NOUN
afs-147802	122	20	with	with	ADP
afs-147802	122	21	bonferroni	bonferroni	NOUN
afs-147802	122	22	correction	correction	NOUN
afs-147802	122	23	for	for	ADP
afs-147802	122	24	multiple	multiple	ADJ
afs-147802	122	25	comparisons	comparison	NOUN
afs-147802	122	26	.	.	PUNCT
afs-147802	123	1	agricultural	agricultural	ADJ
afs-147802	123	2	and	and	CCONJ
afs-147802	123	3	food	food	NOUN
afs-147802	123	4	science	science	NOUN
afs-147802	123	5	(	(	PUNCT
afs-147802	123	6	2025	2025	NUM
afs-147802	123	7	)	)	PUNCT
afs-147802	123	8	34	34	NUM
afs-147802	123	9	:	:	PUNCT
afs-147802	123	10	51–60	51–60	NUM
afs-147802	123	11	57	57	NUM
afs-147802	123	12	analysis	analysis	NOUN
afs-147802	123	13	of	of	ADP
afs-147802	123	14	potential	potential	ADJ
afs-147802	123	15	target	target	NOUN
afs-147802	123	16	-	-	PUNCT
afs-147802	123	17	site	site	NOUN
afs-147802	123	18	resistance	resistance	NOUN
afs-147802	123	19	in	in	ADP
afs-147802	123	20	the	the	DET
afs-147802	123	21	als	als	NOUN
afs-147802	123	22	gene	gene	NOUN
afs-147802	123	23	revealed	reveal	VERB
afs-147802	123	24	a	a	DET
afs-147802	123	25	mutation	mutation	NOUN
afs-147802	123	26	at	at	ADP
afs-147802	123	27	position	position	NOUN
afs-147802	123	28	574	574	NUM
afs-147802	123	29	in	in	ADP
afs-147802	123	30	the	the	DET
afs-147802	123	31	als	als	NOUN
afs-147802	123	32	cross	cross	VERB
afs-147802	123	33	resistant	resistant	ADJ
afs-147802	123	34	biotype	biotype	NOUN
afs-147802	123	35	sme14	sme14	NOUN
afs-147802	123	36	,	,	PUNCT
afs-147802	123	37	where	where	SCONJ
afs-147802	123	38	aminoacid	aminoacid	NOUN
afs-147802	123	39	tryptophane	tryptophane	NOUN
afs-147802	123	40	was	be	AUX
afs-147802	123	41	replaced	replace	VERB
afs-147802	123	42	by	by	ADP
afs-147802	123	43	leucine	leucine	NOUN
afs-147802	123	44	.	.	PUNCT
afs-147802	124	1	in	in	ADP
afs-147802	124	2	contrast	contrast	NOUN
afs-147802	124	3	,	,	PUNCT
afs-147802	124	4	this	this	DET
afs-147802	124	5	mutation	mutation	NOUN
afs-147802	124	6	was	be	AUX
afs-147802	124	7	not	not	PART
afs-147802	124	8	present	present	ADJ
afs-147802	124	9	in	in	ADP
afs-147802	124	10	the	the	DET
afs-147802	124	11	partially	partially	ADV
afs-147802	124	12	resistant	resistant	ADJ
afs-147802	124	13	biotypes	biotype	NOUN
afs-147802	124	14	sme125	sme125	NOUN
afs-147802	124	15	and	and	CCONJ
afs-147802	124	16	sme134	sme134	PROPN
afs-147802	124	17	,	,	PUNCT
afs-147802	124	18	nor	nor	CCONJ
afs-147802	124	19	in	in	ADP
afs-147802	124	20	the	the	DET
afs-147802	124	21	sensitive	sensitive	ADJ
afs-147802	124	22	biotypes	biotype	NOUN
afs-147802	124	23	sme18	sme18	PROPN
afs-147802	124	24	and	and	CCONJ
afs-147802	124	25	sme155	sme155	PROPN
afs-147802	124	26	.	.	PUNCT
afs-147802	125	1	the	the	DET
afs-147802	125	2	sequence	sequence	NOUN
afs-147802	125	3	fragments	fragment	NOUN
afs-147802	125	4	of	of	ADP
afs-147802	125	5	these	these	DET
afs-147802	125	6	biotypes	biotype	NOUN
afs-147802	125	7	around	around	ADP
afs-147802	125	8	position	position	NOUN
afs-147802	125	9	574	574	NUM
afs-147802	125	10	are	be	AUX
afs-147802	125	11	presented	present	VERB
afs-147802	125	12	in	in	ADP
afs-147802	125	13	figure	figure	NOUN
afs-147802	125	14	6	6	NUM
afs-147802	125	15	.	.	PUNCT
afs-147802	126	1	discussion	discussion	NOUN
afs-147802	126	2	this	this	DET
afs-147802	126	3	study	study	NOUN
afs-147802	126	4	provides	provide	VERB
afs-147802	126	5	the	the	DET
afs-147802	126	6	initial	initial	ADJ
afs-147802	126	7	characterization	characterization	NOUN
afs-147802	126	8	of	of	ADP
afs-147802	126	9	herbicide	herbicide	NOUN
afs-147802	126	10	resistance	resistance	NOUN
afs-147802	126	11	in	in	ADP
afs-147802	126	12	the	the	DET
afs-147802	126	13	estonian	estonian	ADJ
afs-147802	126	14	s.	s.	PROPN
afs-147802	126	15	media	media	PROPN
afs-147802	126	16	population	population	PROPN
afs-147802	126	17	to	to	ADP
afs-147802	126	18	sulfonylureas	sulfonylureas	PROPN
afs-147802	126	19	.	.	PUNCT
afs-147802	127	1	target	target	NOUN
afs-147802	127	2	-	-	PUNCT
afs-147802	127	3	site	site	NOUN
afs-147802	127	4	resistance	resistance	NOUN
afs-147802	127	5	to	to	ADP
afs-147802	127	6	tribenuron	tribenuron	NOUN
afs-147802	127	7	-	-	PUNCT
afs-147802	127	8	methyl	methyl	NOUN
afs-147802	127	9	and	and	CCONJ
afs-147802	127	10	cross	cross	NOUN
afs-147802	127	11	-	-	NOUN
afs-147802	127	12	resistance	resistance	NOUN
afs-147802	127	13	to	to	ADP
afs-147802	127	14	other	other	ADJ
afs-147802	127	15	sulfonylureas	sulfonylurea	NOUN
afs-147802	127	16	were	be	AUX
afs-147802	127	17	confirmed	confirm	VERB
afs-147802	127	18	in	in	ADP
afs-147802	127	19	the	the	DET
afs-147802	127	20	estonian	estonian	ADJ
afs-147802	127	21	s.	s.	PROPN
afs-147802	127	22	media	media	PROPN
afs-147802	127	23	biotype	biotype	PROPN
afs-147802	127	24	sme14	sme14	NOUN
afs-147802	127	25	from	from	ADP
afs-147802	127	26	järva	järva	PROPN
afs-147802	127	27	county	county	PROPN
afs-147802	127	28	.	.	PUNCT
afs-147802	128	1	in	in	ADP
afs-147802	128	2	contrast	contrast	NOUN
afs-147802	128	3	,	,	PUNCT
afs-147802	128	4	two	two	NUM
afs-147802	128	5	other	other	ADJ
afs-147802	128	6	biotypes	biotype	NOUN
afs-147802	128	7	exhibited	exhibit	VERB
afs-147802	128	8	non	non	ADJ
afs-147802	128	9	-	-	ADJ
afs-147802	128	10	targetsite	targetsite	ADJ
afs-147802	128	11	resistance	resistance	NOUN
afs-147802	128	12	and	and	CCONJ
afs-147802	128	13	weaker	weak	ADJ
afs-147802	128	14	resistance	resistance	NOUN
afs-147802	128	15	to	to	ADP
afs-147802	128	16	the	the	DET
afs-147802	128	17	mix	mix	NOUN
afs-147802	128	18	of	of	ADP
afs-147802	128	19	amidosulfuron	amidosulfuron	NOUN
afs-147802	128	20	and	and	CCONJ
afs-147802	128	21	iodosulfuron	iodosulfuron	NOUN
afs-147802	128	22	.	.	PUNCT
afs-147802	129	1	previous	previous	ADJ
afs-147802	129	2	research	research	NOUN
afs-147802	129	3	has	have	AUX
afs-147802	129	4	shown	show	VERB
afs-147802	129	5	that	that	SCONJ
afs-147802	129	6	s.	s.	PROPN
afs-147802	129	7	media	media	PROPN
afs-147802	129	8	often	often	ADV
afs-147802	129	9	develops	develop	VERB
afs-147802	129	10	cross	cross	ADJ
afs-147802	129	11	-	-	NOUN
afs-147802	129	12	resistance	resistance	NOUN
afs-147802	129	13	(	(	PUNCT
afs-147802	129	14	hall	hall	NOUN
afs-147802	129	15	and	and	CCONJ
afs-147802	129	16	devine	devine	PROPN
afs-147802	129	17	1990	1990	NUM
afs-147802	129	18	)	)	PUNCT
afs-147802	129	19	.	.	PUNCT
afs-147802	130	1	thus	thus	ADV
afs-147802	130	2	far	far	ADV
afs-147802	130	3	,	,	PUNCT
afs-147802	130	4	no	no	DET
afs-147802	130	5	additional	additional	ADJ
afs-147802	130	6	tribenuron	tribenuron	NOUN
afs-147802	130	7	-	-	PUNCT
afs-147802	130	8	methyl	methyl	NOUN
afs-147802	130	9	resistant	resistant	ADJ
afs-147802	130	10	biotypes	biotype	NOUN
afs-147802	130	11	have	have	AUX
afs-147802	130	12	been	be	AUX
afs-147802	130	13	identified	identify	VERB
afs-147802	130	14	,	,	PUNCT
afs-147802	130	15	suggesting	suggest	VERB
afs-147802	130	16	that	that	SCONJ
afs-147802	130	17	such	such	ADJ
afs-147802	130	18	resistance	resistance	NOUN
afs-147802	130	19	is	be	AUX
afs-147802	130	20	not	not	PART
afs-147802	130	21	widespread	widespread	ADJ
afs-147802	130	22	in	in	ADP
afs-147802	130	23	estonia	estonia	PROPN
afs-147802	130	24	.	.	PUNCT
afs-147802	131	1	this	this	PRON
afs-147802	131	2	suggests	suggest	VERB
afs-147802	131	3	that	that	SCONJ
afs-147802	131	4	the	the	DET
afs-147802	131	5	resistant	resistant	ADJ
afs-147802	131	6	biotype	biotype	NOUN
afs-147802	131	7	likely	likely	ADV
afs-147802	131	8	evolved	evolve	VERB
afs-147802	131	9	on	on	ADP
afs-147802	131	10	-	-	PUNCT
afs-147802	131	11	site	site	NOUN
afs-147802	131	12	rather	rather	ADV
afs-147802	131	13	than	than	ADP
afs-147802	131	14	spreading	spread	VERB
afs-147802	131	15	through	through	ADP
afs-147802	131	16	seed	seed	NOUN
afs-147802	131	17	dispersal	dispersal	NOUN
afs-147802	131	18	.	.	PUNCT
afs-147802	132	1	no	no	DET
afs-147802	132	2	precise	precise	ADJ
afs-147802	132	3	data	datum	NOUN
afs-147802	132	4	is	be	AUX
afs-147802	132	5	available	available	ADJ
afs-147802	132	6	about	about	ADP
afs-147802	132	7	the	the	DET
afs-147802	132	8	herbicide	herbicide	NOUN
afs-147802	132	9	usage	usage	NOUN
afs-147802	132	10	of	of	ADP
afs-147802	132	11	these	these	DET
afs-147802	132	12	fields	field	NOUN
afs-147802	132	13	.	.	PUNCT
afs-147802	133	1	however	however	ADV
afs-147802	133	2	,	,	PUNCT
afs-147802	133	3	the	the	DET
afs-147802	133	4	farmers	farmer	NOUN
afs-147802	133	5	indicated	indicate	VERB
afs-147802	133	6	that	that	SCONJ
afs-147802	133	7	sulfonylureas	sulfonylurea	NOUN
afs-147802	133	8	have	have	AUX
afs-147802	133	9	been	be	AUX
afs-147802	133	10	used	use	VERB
afs-147802	133	11	at	at	ADP
afs-147802	133	12	the	the	DET
afs-147802	133	13	field	field	NOUN
afs-147802	133	14	of	of	ADP
afs-147802	133	15	sme14	sme14	NOUN
afs-147802	133	16	,	,	PUNCT
afs-147802	133	17	while	while	SCONJ
afs-147802	133	18	mainly	mainly	ADV
afs-147802	133	19	mcpa	mcpa	ADJ
afs-147802	133	20	at	at	ADP
afs-147802	133	21	the	the	DET
afs-147802	133	22	field	field	NOUN
afs-147802	133	23	of	of	ADP
afs-147802	133	24	sme18	sme18	PROPN
afs-147802	133	25	.	.	PUNCT
afs-147802	134	1	that	that	PRON
afs-147802	134	2	can	can	AUX
afs-147802	134	3	probably	probably	ADV
afs-147802	134	4	explain	explain	VERB
afs-147802	134	5	the	the	DET
afs-147802	134	6	resistance	resistance	NOUN
afs-147802	134	7	of	of	ADP
afs-147802	134	8	sme14	sme14	NOUN
afs-147802	134	9	to	to	PART
afs-147802	134	10	als	als	VERB
afs-147802	134	11	inhibitors	inhibitor	NOUN
afs-147802	134	12	.	.	PUNCT
afs-147802	135	1	on	on	ADP
afs-147802	135	2	the	the	DET
afs-147802	135	3	other	other	ADJ
afs-147802	135	4	hand	hand	NOUN
afs-147802	135	5	,	,	PUNCT
afs-147802	135	6	resistance	resistance	NOUN
afs-147802	135	7	to	to	ADP
afs-147802	135	8	to	to	ADP
afs-147802	135	9	the	the	DET
afs-147802	135	10	mix	mix	NOUN
afs-147802	135	11	of	of	ADP
afs-147802	135	12	amidosulfuron	amidosulfuron	NOUN
afs-147802	135	13	and	and	CCONJ
afs-147802	135	14	iodosulfuron	iodosulfuron	NOUN
afs-147802	135	15	was	be	AUX
afs-147802	135	16	observed	observe	VERB
afs-147802	135	17	in	in	ADP
afs-147802	135	18	three	three	NUM
afs-147802	135	19	out	out	ADP
afs-147802	135	20	of	of	ADP
afs-147802	135	21	eight	eight	NUM
afs-147802	135	22	biotypes	biotype	NOUN
afs-147802	135	23	analyzed	analyze	VERB
afs-147802	135	24	in	in	ADP
afs-147802	135	25	estonia	estonia	PROPN
afs-147802	135	26	.	.	PUNCT
afs-147802	136	1	given	give	VERB
afs-147802	136	2	that	that	SCONJ
afs-147802	136	3	the	the	DET
afs-147802	136	4	mix	mix	NOUN
afs-147802	136	5	of	of	ADP
afs-147802	136	6	amidosulfuron	amidosulfuron	NOUN
afs-147802	136	7	and	and	CCONJ
afs-147802	136	8	iodosulfuron	iodosulfuron	NOUN
afs-147802	136	9	is	be	AUX
afs-147802	136	10	one	one	NUM
afs-147802	136	11	of	of	ADP
afs-147802	136	12	the	the	DET
afs-147802	136	13	most	most	ADV
afs-147802	136	14	commonly	commonly	ADV
afs-147802	136	15	used	use	VERB
afs-147802	136	16	herbicides	herbicide	NOUN
afs-147802	136	17	among	among	ADP
afs-147802	136	18	estonian	estonian	ADJ
afs-147802	136	19	farmers	farmer	NOUN
afs-147802	136	20	for	for	ADP
afs-147802	136	21	controlling	control	VERB
afs-147802	136	22	dicotyledonous	dicotyledonous	ADJ
afs-147802	136	23	weeds	weed	NOUN
afs-147802	136	24	,	,	PUNCT
afs-147802	136	25	this	this	PRON
afs-147802	136	26	may	may	AUX
afs-147802	136	27	help	help	VERB
afs-147802	136	28	explain	explain	VERB
afs-147802	136	29	the	the	DET
afs-147802	136	30	higher	high	ADJ
afs-147802	136	31	prevalence	prevalence	NOUN
afs-147802	136	32	of	of	ADP
afs-147802	136	33	resistance	resistance	NOUN
afs-147802	136	34	to	to	ADP
afs-147802	136	35	these	these	DET
afs-147802	136	36	herbicides	herbicide	NOUN
afs-147802	136	37	.	.	PUNCT
afs-147802	137	1	neighboring	neighboring	NOUN
afs-147802	137	2	countries	country	NOUN
afs-147802	137	3	have	have	AUX
afs-147802	137	4	encountered	encounter	VERB
afs-147802	137	5	issues	issue	NOUN
afs-147802	137	6	with	with	ADP
afs-147802	137	7	s.	s.	PROPN
afs-147802	137	8	media	media	PROPN
afs-147802	137	9	much	much	ADV
afs-147802	137	10	earlier	early	ADV
afs-147802	137	11	than	than	ADP
afs-147802	137	12	estonia	estonia	PROPN
afs-147802	137	13	.	.	PUNCT
afs-147802	138	1	resistance	resistance	NOUN
afs-147802	138	2	to	to	ADP
afs-147802	138	3	sulfonylureas	sulfonylureas	PROPN
afs-147802	138	4	in	in	ADP
afs-147802	138	5	s.	s.	PROPN
afs-147802	138	6	media	media	PROPN
afs-147802	138	7	was	be	AUX
afs-147802	138	8	detected	detect	VERB
afs-147802	138	9	in	in	ADP
afs-147802	138	10	finland	finland	PROPN
afs-147802	138	11	over	over	ADP
afs-147802	138	12	a	a	DET
afs-147802	138	13	decade	decade	NOUN
afs-147802	138	14	ago	ago	ADV
afs-147802	138	15	(	(	PUNCT
afs-147802	138	16	uusitalo	uusitalo	NOUN
afs-147802	138	17	et	et	PROPN
afs-147802	138	18	al	al	PROPN
afs-147802	138	19	.	.	PROPN
afs-147802	138	20	2013	2013	NUM
afs-147802	138	21	)	)	PUNCT
afs-147802	138	22	,	,	PUNCT
afs-147802	138	23	and	and	CCONJ
afs-147802	138	24	resistant	resistant	ADJ
afs-147802	138	25	s.	s.	PROPN
afs-147802	138	26	media	medium	NOUN
afs-147802	138	27	populations	population	NOUN
afs-147802	138	28	have	have	AUX
afs-147802	138	29	also	also	ADV
afs-147802	138	30	been	be	AUX
afs-147802	138	31	identified	identify	VERB
afs-147802	138	32	in	in	ADP
afs-147802	138	33	latvia	latvia	PROPN
afs-147802	138	34	and	and	CCONJ
afs-147802	138	35	sweden	sweden	PROPN
afs-147802	138	36	(	(	PUNCT
afs-147802	138	37	heap	heap	NOUN
afs-147802	138	38	2024	2024	NUM
afs-147802	138	39	)	)	PUNCT
afs-147802	138	40	.	.	PUNCT
afs-147802	139	1	in	in	ADP
afs-147802	139	2	denmark	denmark	PROPN
afs-147802	139	3	,	,	PUNCT
afs-147802	139	4	resistance	resistance	NOUN
afs-147802	139	5	to	to	ADP
afs-147802	139	6	sulfonylureas	sulfonylureas	PROPN
afs-147802	139	7	in	in	ADP
afs-147802	139	8	s.	s.	PROPN
afs-147802	139	9	media	media	PROPN
afs-147802	139	10	was	be	AUX
afs-147802	139	11	observed	observe	VERB
afs-147802	139	12	more	more	ADJ
afs-147802	139	13	than	than	ADP
afs-147802	139	14	30	30	NUM
afs-147802	139	15	years	year	NOUN
afs-147802	139	16	ago	ago	ADV
afs-147802	139	17	(	(	PUNCT
afs-147802	139	18	kudsk	kudsk	NOUN
afs-147802	139	19	et	et	PROPN
afs-147802	139	20	al	al	PROPN
afs-147802	139	21	.	.	PROPN
afs-147802	139	22	1995	1995	NUM
afs-147802	139	23	)	)	PUNCT
afs-147802	139	24	.	.	PUNCT
afs-147802	140	1	in	in	ADP
afs-147802	140	2	addition	addition	NOUN
afs-147802	140	3	to	to	ADP
afs-147802	140	4	s.	s.	PROPN
afs-147802	140	5	media	media	PROPN
afs-147802	140	6	,	,	PUNCT
afs-147802	140	7	several	several	ADJ
afs-147802	140	8	other	other	ADJ
afs-147802	140	9	weed	weed	NOUN
afs-147802	140	10	species	specie	NOUN
afs-147802	140	11	resistant	resistant	ADJ
afs-147802	140	12	to	to	ADP
afs-147802	140	13	als	als	VERB
afs-147802	140	14	-	-	PUNCT
afs-147802	140	15	inhibiting	inhibit	VERB
afs-147802	140	16	herbicides	herbicide	NOUN
afs-147802	140	17	have	have	AUX
afs-147802	140	18	been	be	AUX
afs-147802	140	19	identified	identify	VERB
afs-147802	140	20	globally	globally	ADV
afs-147802	140	21	.	.	PUNCT
afs-147802	141	1	these	these	PRON
afs-147802	141	2	include	include	VERB
afs-147802	141	3	apera	apera	PROPN
afs-147802	141	4	spica	spica	NOUN
afs-147802	141	5	-	-	PUNCT
afs-147802	141	6	venti	venti	NOUN
afs-147802	141	7	in	in	ADP
afs-147802	141	8	the	the	DET
afs-147802	141	9	czech	czech	PROPN
afs-147802	141	10	republic	republic	NOUN
afs-147802	141	11	(	(	PUNCT
afs-147802	141	12	hamouzova	hamouzova	PROPN
afs-147802	141	13	et	et	PROPN
afs-147802	141	14	al	al	PROPN
afs-147802	141	15	.	.	PROPN
afs-147802	141	16	2011	2011	NUM
afs-147802	141	17	)	)	PUNCT
afs-147802	141	18	and	and	CCONJ
afs-147802	141	19	lithuania	lithuania	PROPN
afs-147802	141	20	(	(	PUNCT
afs-147802	141	21	auškalniene	auškalniene	NOUN
afs-147802	141	22	2020	2020	NUM
afs-147802	141	23	)	)	PUNCT
afs-147802	141	24	and	and	CCONJ
afs-147802	141	25	many	many	ADJ
afs-147802	141	26	other	other	ADJ
afs-147802	141	27	countries	country	NOUN
afs-147802	141	28	including	include	VERB
afs-147802	141	29	latvia	latvia	PROPN
afs-147802	141	30	,	,	PUNCT
afs-147802	141	31	denmark	denmark	NOUN
afs-147802	141	32	,	,	PUNCT
afs-147802	141	33	and	and	CCONJ
afs-147802	141	34	sweden	sweden	PROPN
afs-147802	141	35	(	(	PUNCT
afs-147802	141	36	heap	heap	NOUN
afs-147802	141	37	2024	2024	NUM
afs-147802	141	38	)	)	PUNCT
afs-147802	141	39	;	;	PUNCT
afs-147802	141	40	tripleurospermum	tripleurospermum	PROPN
afs-147802	141	41	inodorum	inodorum	ADV
afs-147802	141	42	in	in	ADP
afs-147802	141	43	poland	poland	PROPN
afs-147802	141	44	(	(	PUNCT
afs-147802	141	45	adamczewski	adamczewski	VERB
afs-147802	141	46	et	et	PROPN
afs-147802	141	47	al	al	PROPN
afs-147802	141	48	.	.	PROPN
afs-147802	141	49	2014	2014	NUM
afs-147802	141	50	,	,	PUNCT
afs-147802	141	51	2019	2019	NUM
afs-147802	141	52	)	)	PUNCT
afs-147802	141	53	and	and	CCONJ
afs-147802	141	54	many	many	ADJ
afs-147802	141	55	other	other	ADJ
afs-147802	141	56	countries	country	NOUN
afs-147802	141	57	;	;	PUNCT
afs-147802	141	58	papaver	papaver	X
afs-147802	141	59	rhoeas	rhoea	NOUN
afs-147802	141	60	in	in	ADP
afs-147802	141	61	many	many	ADJ
afs-147802	141	62	european	european	ADJ
afs-147802	141	63	countries	country	NOUN
afs-147802	141	64	,	,	PUNCT
afs-147802	141	65	sweden	sweden	PROPN
afs-147802	141	66	and	and	CCONJ
afs-147802	141	67	denmark	denmark	NOUN
afs-147802	141	68	being	be	AUX
afs-147802	141	69	among	among	ADP
afs-147802	141	70	them	they	PRON
afs-147802	141	71	;	;	PUNCT
afs-147802	141	72	chenopodium	chenopodium	NOUN
afs-147802	141	73	album	album	NOUN
afs-147802	141	74	in	in	ADP
afs-147802	141	75	several	several	ADJ
afs-147802	141	76	european	european	ADJ
afs-147802	141	77	countries	country	NOUN
afs-147802	141	78	,	,	PUNCT
afs-147802	141	79	including	include	VERB
afs-147802	141	80	finland	finland	PROPN
afs-147802	141	81	and	and	CCONJ
afs-147802	141	82	norway	norway	PROPN
afs-147802	141	83	;	;	PUNCT
afs-147802	141	84	and	and	CCONJ
afs-147802	141	85	alopecurus	alopecurus	NOUN
afs-147802	141	86	myosuroides	myosuroide	NOUN
afs-147802	141	87	across	across	ADP
afs-147802	141	88	much	much	ADJ
afs-147802	141	89	of	of	ADP
afs-147802	141	90	europe	europe	PROPN
afs-147802	141	91	,	,	PUNCT
afs-147802	141	92	though	though	SCONJ
afs-147802	141	93	it	it	PRON
afs-147802	141	94	has	have	AUX
afs-147802	141	95	yet	yet	ADV
afs-147802	141	96	not	not	PART
afs-147802	141	97	spread	spread	VERB
afs-147802	141	98	to	to	ADP
afs-147802	141	99	the	the	DET
afs-147802	141	100	northernmost	northernmost	ADJ
afs-147802	141	101	countries	country	NOUN
afs-147802	141	102	,	,	PUNCT
afs-147802	141	103	like	like	ADP
afs-147802	141	104	norway	norway	PROPN
afs-147802	141	105	,	,	PUNCT
afs-147802	141	106	finland	finland	PROPN
afs-147802	141	107	,	,	PUNCT
afs-147802	141	108	and	and	CCONJ
afs-147802	141	109	latvia	latvia	PROPN
afs-147802	141	110	(	(	PUNCT
afs-147802	141	111	heap	heap	NOUN
afs-147802	141	112	2024	2024	NUM
afs-147802	141	113	)	)	PUNCT
afs-147802	141	114	.	.	PUNCT
afs-147802	142	1	it	it	PRON
afs-147802	142	2	is	be	AUX
afs-147802	142	3	possible	possible	ADJ
afs-147802	142	4	that	that	SCONJ
afs-147802	142	5	resistance	resistance	NOUN
afs-147802	142	6	to	to	ADP
afs-147802	142	7	sulfonylureas	sulfonylureas	PROPN
afs-147802	142	8	is	be	AUX
afs-147802	142	9	also	also	ADV
afs-147802	142	10	more	more	ADV
afs-147802	142	11	widespread	widespread	ADJ
afs-147802	142	12	in	in	ADP
afs-147802	142	13	estonia	estonia	PROPN
afs-147802	142	14	,	,	PUNCT
afs-147802	142	15	as	as	SCONJ
afs-147802	142	16	there	there	PRON
afs-147802	142	17	have	have	AUX
afs-147802	142	18	been	be	AUX
afs-147802	142	19	reports	report	NOUN
afs-147802	142	20	from	from	ADP
afs-147802	142	21	farmers	farmer	NOUN
afs-147802	142	22	concerning	concern	VERB
afs-147802	142	23	centaurea	centaurea	NOUN
afs-147802	142	24	cyanus	cyanus	NOUN
afs-147802	142	25	(	(	PUNCT
afs-147802	142	26	cornflower	cornflower	NOUN
afs-147802	142	27	)	)	PUNCT
afs-147802	142	28	and	and	CCONJ
afs-147802	142	29	its	its	PRON
afs-147802	142	30	response	response	NOUN
afs-147802	142	31	to	to	PART
afs-147802	142	32	sulfonylurea	sulfonylurea	VERB
afs-147802	142	33	herbicides	herbicide	NOUN
afs-147802	142	34	.	.	PUNCT
afs-147802	143	1	resistance	resistance	NOUN
afs-147802	143	2	to	to	ADP
afs-147802	143	3	tribenuron	tribenuron	NOUN
afs-147802	143	4	-	-	PUNCT
afs-147802	143	5	methyl	methyl	NOUN
afs-147802	143	6	in	in	ADP
afs-147802	143	7	s.	s.	PROPN
afs-147802	143	8	media	media	PROPN
afs-147802	143	9	is	be	AUX
afs-147802	143	10	attributed	attribute	VERB
afs-147802	143	11	to	to	ADP
afs-147802	143	12	target	target	NOUN
afs-147802	143	13	-	-	PUNCT
afs-147802	143	14	site	site	NOUN
afs-147802	143	15	mutations	mutation	NOUN
afs-147802	143	16	,	,	PUNCT
afs-147802	143	17	such	such	ADJ
afs-147802	143	18	as	as	ADP
afs-147802	143	19	the	the	DET
afs-147802	143	20	trp574leu	trp574leu	NOUN
afs-147802	143	21	mutation	mutation	NOUN
afs-147802	143	22	identified	identify	VERB
afs-147802	143	23	in	in	ADP
afs-147802	143	24	resistant	resistant	ADJ
afs-147802	143	25	biotypes	biotype	NOUN
afs-147802	143	26	.	.	PUNCT
afs-147802	144	1	this	this	DET
afs-147802	144	2	mutation	mutation	NOUN
afs-147802	144	3	has	have	AUX
afs-147802	144	4	previously	previously	ADV
afs-147802	144	5	been	be	AUX
afs-147802	144	6	associated	associate	VERB
afs-147802	144	7	with	with	ADP
afs-147802	144	8	resistance	resistance	NOUN
afs-147802	144	9	to	to	ADP
afs-147802	144	10	various	various	ADJ
afs-147802	144	11	als	al	NOUN
afs-147802	144	12	-	-	PUNCT
afs-147802	144	13	inhibiting	inhibit	VERB
afs-147802	144	14	herbicides	herbicide	NOUN
afs-147802	144	15	in	in	ADP
afs-147802	144	16	the	the	DET
afs-147802	144	17	uk	uk	PROPN
afs-147802	144	18	(	(	PUNCT
afs-147802	144	19	marshall	marshall	PROPN
afs-147802	144	20	et	et	PROPN
afs-147802	144	21	al	al	PROPN
afs-147802	144	22	.	.	PROPN
afs-147802	144	23	2010	2010	NUM
afs-147802	144	24	)	)	PUNCT
afs-147802	144	25	.	.	PUNCT
afs-147802	145	1	the	the	DET
afs-147802	145	2	pro-197	pro-197	NOUN
afs-147802	145	3	-	-	PUNCT
afs-147802	145	4	gln	gln	NOUN
afs-147802	145	5	mutation	mutation	NOUN
afs-147802	145	6	is	be	AUX
afs-147802	145	7	known	know	VERB
afs-147802	145	8	to	to	PART
afs-147802	145	9	confer	confer	VERB
afs-147802	145	10	resistance	resistance	NOUN
afs-147802	145	11	to	to	ADP
afs-147802	145	12	sulfonylureas	sulfonylurea	NOUN
afs-147802	145	13	,	,	PUNCT
afs-147802	145	14	while	while	SCONJ
afs-147802	145	15	the	the	DET
afs-147802	145	16	trp-574	trp-574	PROPN
afs-147802	145	17	-	-	PUNCT
afs-147802	145	18	leu	leu	PROPN
afs-147802	145	19	mutation	mutation	NOUN
afs-147802	145	20	confers	confer	NOUN
afs-147802	145	21	resistance	resistance	NOUN
afs-147802	145	22	to	to	ADP
afs-147802	145	23	both	both	CCONJ
afs-147802	145	24	sulfonylureas	sulfonylurea	NOUN
afs-147802	145	25	and	and	CCONJ
afs-147802	145	26	triazolopyrimidines	triazolopyrimidine	NOUN
afs-147802	145	27	(	(	PUNCT
afs-147802	145	28	marshall	marshall	PROPN
afs-147802	145	29	et	et	PROPN
afs-147802	145	30	al	al	PROPN
afs-147802	145	31	.	.	PROPN
afs-147802	145	32	2010	2010	NUM
afs-147802	145	33	,	,	PUNCT
afs-147802	145	34	laforest	laforest	VERB
afs-147802	145	35	and	and	CCONJ
afs-147802	145	36	soufiane	soufiane	NOUN
afs-147802	145	37	2018	2018	NUM
afs-147802	145	38	)	)	PUNCT
afs-147802	145	39	.	.	PUNCT
afs-147802	146	1	in	in	ADP
afs-147802	146	2	addition	addition	NOUN
afs-147802	146	3	to	to	ADP
afs-147802	146	4	target	target	NOUN
afs-147802	146	5	-	-	PUNCT
afs-147802	146	6	site	site	NOUN
afs-147802	146	7	resistance	resistance	NOUN
afs-147802	146	8	,	,	PUNCT
afs-147802	146	9	effective	effective	ADJ
afs-147802	146	10	non	non	ADJ
afs-147802	146	11	-	-	ADJ
afs-147802	146	12	target	target	ADJ
afs-147802	146	13	site	site	NOUN
afs-147802	146	14	resistance	resistance	NOUN
afs-147802	146	15	mechanisms	mechanism	NOUN
afs-147802	146	16	appear	appear	VERB
afs-147802	146	17	to	to	PART
afs-147802	146	18	be	be	AUX
afs-147802	146	19	present	present	ADJ
afs-147802	146	20	in	in	ADP
afs-147802	146	21	the	the	DET
afs-147802	146	22	estonian	estonian	ADJ
afs-147802	146	23	population	population	NOUN
afs-147802	146	24	.	.	PUNCT
afs-147802	147	1	while	while	SCONJ
afs-147802	147	2	non	non	ADJ
afs-147802	147	3	target	target	NOUN
afs-147802	147	4	-	-	PUNCT
afs-147802	147	5	site	site	NOUN
afs-147802	147	6	resistance	resistance	NOUN
afs-147802	147	7	in	in	ADP
afs-147802	147	8	s.	s.	PROPN
afs-147802	147	9	media	media	PROPN
afs-147802	147	10	has	have	AUX
afs-147802	147	11	not	not	PART
afs-147802	147	12	been	be	AUX
afs-147802	147	13	documented	document	VERB
afs-147802	147	14	,	,	PUNCT
afs-147802	147	15	such	such	ADJ
afs-147802	147	16	mechanisms	mechanism	NOUN
afs-147802	147	17	have	have	AUX
afs-147802	147	18	been	be	AUX
afs-147802	147	19	observed	observe	VERB
afs-147802	147	20	in	in	ADP
afs-147802	147	21	closely	closely	ADV
afs-147802	147	22	related	relate	VERB
afs-147802	147	23	species	specie	NOUN
afs-147802	147	24	such	such	ADJ
afs-147802	147	25	as	as	ADP
afs-147802	147	26	myosoton	myosoton	PROPN
afs-147802	147	27	aquaticum	aquaticum	PROPN
afs-147802	147	28	(	(	PUNCT
afs-147802	147	29	bai	bai	PROPN
afs-147802	147	30	et	et	PROPN
afs-147802	147	31	al	al	PROPN
afs-147802	147	32	.	.	PROPN
afs-147802	147	33	2019	2019	NUM
afs-147802	147	34	)	)	PUNCT
afs-147802	147	35	a	a	DET
afs-147802	147	36	widespread	widespread	ADJ
afs-147802	147	37	and	and	CCONJ
afs-147802	147	38	competitive	competitive	ADJ
afs-147802	147	39	winter	winter	NOUN
afs-147802	147	40	weed	weed	NOUN
afs-147802	147	41	of	of	ADP
afs-147802	147	42	wheat	wheat	NOUN
afs-147802	147	43	in	in	ADP
afs-147802	147	44	china	china	PROPN
afs-147802	147	45	,	,	PUNCT
afs-147802	147	46	has	have	AUX
afs-147802	147	47	evolved	evolve	VERB
afs-147802	147	48	resistance	resistance	NOUN
afs-147802	147	49	to	to	ADP
afs-147802	147	50	many	many	ADJ
afs-147802	147	51	classes	class	NOUN
afs-147802	147	52	of	of	ADP
afs-147802	147	53	herbicides	herbicide	NOUN
afs-147802	147	54	.	.	PUNCT
afs-147802	148	1	bai	bai	PROPN
afs-147802	148	2	et	et	PROPN
afs-147802	148	3	al	al	PROPN
afs-147802	148	4	.	.	PROPN
afs-147802	149	1	(	(	PUNCT
afs-147802	149	2	2019	2019	NUM
afs-147802	149	3	)	)	PUNCT
afs-147802	149	4	suggested	suggest	VERB
afs-147802	149	5	that	that	SCONJ
afs-147802	149	6	these	these	DET
afs-147802	149	7	mechanisms	mechanism	NOUN
afs-147802	149	8	could	could	AUX
afs-147802	149	9	be	be	AUX
afs-147802	149	10	related	relate	VERB
afs-147802	149	11	to	to	PART
afs-147802	149	12	enhanced	enhance	VERB
afs-147802	149	13	p450	p450	NUM
afs-147802	149	14	-	-	PUNCT
afs-147802	149	15	mediated	mediate	VERB
afs-147802	149	16	metabolism	metabolism	NOUN
afs-147802	149	17	,	,	PUNCT
afs-147802	149	18	based	base	VERB
afs-147802	149	19	on	on	ADP
afs-147802	149	20	experiments	experiment	NOUN
afs-147802	149	21	with	with	ADP
afs-147802	149	22	malathion	malathion	NOUN
afs-147802	149	23	.	.	PUNCT
afs-147802	150	1	they	they	PRON
afs-147802	150	2	also	also	ADV
afs-147802	150	3	noted	note	VERB
afs-147802	150	4	that	that	SCONJ
afs-147802	150	5	target	target	NOUN
afs-147802	150	6	-	-	PUNCT
afs-147802	150	7	site	site	NOUN
afs-147802	150	8	and	and	CCONJ
afs-147802	150	9	non	non	ADJ
afs-147802	150	10	-	-	ADJ
afs-147802	150	11	target	target	ADJ
afs-147802	150	12	-	-	PUNCT
afs-147802	150	13	site	site	NOUN
afs-147802	150	14	mechanisms	mechanism	NOUN
afs-147802	150	15	can	can	AUX
afs-147802	150	16	co	co	VERB
afs-147802	150	17	-	-	VERB
afs-147802	150	18	occur	occur	VERB
afs-147802	150	19	,	,	PUNCT
afs-147802	150	20	a	a	DET
afs-147802	150	21	possibility	possibility	NOUN
afs-147802	150	22	that	that	PRON
afs-147802	150	23	may	may	AUX
afs-147802	150	24	apply	apply	VERB
afs-147802	150	25	to	to	ADP
afs-147802	150	26	the	the	DET
afs-147802	150	27	estonian	estonian	ADJ
afs-147802	150	28	biotype	biotype	NOUN
afs-147802	150	29	sme14	sme14	NOUN
afs-147802	150	30	.	.	PUNCT
afs-147802	151	1	however	however	ADV
afs-147802	151	2	,	,	PUNCT
afs-147802	151	3	the	the	DET
afs-147802	151	4	specific	specific	ADJ
afs-147802	151	5	resistance	resistance	NOUN
afs-147802	151	6	mechanisms	mechanism	NOUN
afs-147802	151	7	of	of	ADP
afs-147802	151	8	s.	s.	PROPN
afs-147802	151	9	media	media	PROPN
afs-147802	151	10	to	to	ADP
afs-147802	151	11	the	the	DET
afs-147802	151	12	mix	mix	NOUN
afs-147802	151	13	of	of	ADP
afs-147802	151	14	amidosulfuron	amidosulfuron	NOUN
afs-147802	151	15	,	,	PUNCT
afs-147802	151	16	and	and	CCONJ
afs-147802	151	17	iodosulfuron	iodosulfuron	PROPN
afs-147802	151	18	have	have	AUX
afs-147802	151	19	not	not	PART
afs-147802	151	20	been	be	AUX
afs-147802	151	21	studied	study	VERB
afs-147802	151	22	nor	nor	CCONJ
afs-147802	151	23	were	be	AUX
afs-147802	151	24	they	they	PRON
afs-147802	151	25	analysed	analyse	VERB
afs-147802	151	26	in	in	ADP
afs-147802	151	27	the	the	DET
afs-147802	151	28	present	present	ADJ
afs-147802	151	29	study	study	NOUN
afs-147802	151	30	.	.	PUNCT
afs-147802	152	1	it	it	PRON
afs-147802	152	2	is	be	AUX
afs-147802	152	3	also	also	ADV
afs-147802	152	4	plausible	plausible	ADJ
afs-147802	152	5	that	that	DET
afs-147802	152	6	fig	fig	NOUN
afs-147802	152	7	.	.	PUNCT
afs-147802	153	1	6	6	NUM
afs-147802	153	2	.	.	PUNCT
afs-147802	153	3	the	the	DET
afs-147802	153	4	fragments	fragment	NOUN
afs-147802	153	5	of	of	ADP
afs-147802	153	6	aligned	aligned	ADJ
afs-147802	153	7	als	als	NOUN
afs-147802	153	8	protein	protein	NOUN
afs-147802	153	9	sequences	sequence	NOUN
afs-147802	153	10	translated	translate	VERB
afs-147802	153	11	from	from	ADP
afs-147802	153	12	dna	dna	PROPN
afs-147802	153	13	sequences	sequence	NOUN
afs-147802	153	14	sequenced	sequence	VERB
afs-147802	153	15	in	in	ADP
afs-147802	153	16	this	this	DET
afs-147802	153	17	study	study	NOUN
afs-147802	153	18	(	(	PUNCT
afs-147802	153	19	sme18	sme18	NOUN
afs-147802	153	20	,	,	PUNCT
afs-147802	153	21	sme14	sme14	NOUN
afs-147802	153	22	,	,	PUNCT
afs-147802	153	23	sme125	sme125	NOUN
afs-147802	153	24	and	and	CCONJ
afs-147802	153	25	sme134	sme134	PROPN
afs-147802	153	26	)	)	PUNCT
afs-147802	153	27	and	and	CCONJ
afs-147802	153	28	reference	reference	NOUN
afs-147802	153	29	sequences	sequence	NOUN
afs-147802	153	30	of	of	ADP
afs-147802	153	31	arabidopsis	arabidopsis	NOUN
afs-147802	153	32	thaliana	thaliana	NOUN
afs-147802	153	33	and	and	CCONJ
afs-147802	153	34	stellaria	stellaria	NOUN
afs-147802	153	35	media	medium	NOUN
afs-147802	153	36	from	from	ADP
afs-147802	153	37	ncbi	ncbi	PROPN
afs-147802	153	38	nucleotide	nucleotide	PROPN
afs-147802	153	39	database	database	PROPN
afs-147802	153	40	.	.	PUNCT
afs-147802	154	1	the	the	DET
afs-147802	154	2	position	position	NOUN
afs-147802	154	3	574	574	NUM
afs-147802	154	4	is	be	AUX
afs-147802	154	5	marked	mark	VERB
afs-147802	154	6	and	and	CCONJ
afs-147802	154	7	the	the	DET
afs-147802	154	8	replacement	replacement	NOUN
afs-147802	154	9	of	of	ADP
afs-147802	154	10	tryptophane	tryptophane	NOUN
afs-147802	154	11	with	with	ADP
afs-147802	154	12	leucine	leucine	NOUN
afs-147802	154	13	can	can	AUX
afs-147802	154	14	be	be	AUX
afs-147802	154	15	seen	see	VERB
afs-147802	154	16	.	.	PUNCT
afs-147802	155	1	s.	s.	PROPN
afs-147802	155	2	pihu	pihu	PROPN
afs-147802	155	3	et	et	PROPN
afs-147802	155	4	al	al	PROPN
afs-147802	155	5	.	.	PROPN
afs-147802	156	1	58	58	NUM
afs-147802	156	2	multiple	multiple	ADJ
afs-147802	156	3	non	non	ADJ
afs-147802	156	4	-	-	ADJ
afs-147802	156	5	target	target	ADJ
afs-147802	156	6	-	-	PUNCT
afs-147802	156	7	site	site	NOUN
afs-147802	156	8	resistance	resistance	NOUN
afs-147802	156	9	mechanisms	mechanism	NOUN
afs-147802	156	10	are	be	AUX
afs-147802	156	11	involved	involve	VERB
afs-147802	156	12	,	,	PUNCT
afs-147802	156	13	as	as	ADP
afs-147802	156	14	loubet	loubet	PROPN
afs-147802	156	15	et	et	PROPN
afs-147802	156	16	al	al	PROPN
afs-147802	156	17	.	.	PROPN
afs-147802	157	1	(	(	PUNCT
afs-147802	157	2	2023	2023	NUM
afs-147802	157	3	)	)	PUNCT
afs-147802	157	4	but	but	CCONJ
afs-147802	157	5	its	its	PRON
afs-147802	157	6	precise	precise	ADJ
afs-147802	157	7	genetic	genetic	ADJ
afs-147802	157	8	determinisms	determinism	NOUN
afs-147802	157	9	remain	remain	VERB
afs-147802	157	10	fairly	fairly	ADV
afs-147802	157	11	unclear	unclear	ADJ
afs-147802	157	12	.	.	PUNCT
afs-147802	158	1	full	full	ADJ
afs-147802	158	2	-	-	PUNCT
afs-147802	158	3	transcriptome	transcriptome	NOUN
afs-147802	158	4	sequencing	sequencing	NOUN
afs-147802	158	5	had	have	AUX
afs-147802	158	6	previously	previously	ADV
afs-147802	158	7	been	be	AUX
afs-147802	158	8	implemented	implement	VERB
afs-147802	158	9	to	to	PART
afs-147802	158	10	identify	identify	VERB
afs-147802	158	11	ntsr	ntsr	ADJ
afs-147802	158	12	genes	gene	NOUN
afs-147802	158	13	.	.	PUNCT
afs-147802	159	1	however	however	ADV
afs-147802	159	2	,	,	PUNCT
afs-147802	159	3	this	this	DET
afs-147802	159	4	approach	approach	NOUN
afs-147802	159	5	had	have	AUX
afs-147802	159	6	generally	generally	ADV
afs-147802	159	7	been	be	AUX
afs-147802	159	8	applied	apply	VERB
afs-147802	159	9	to	to	ADP
afs-147802	159	10	a	a	DET
afs-147802	159	11	single	single	ADJ
afs-147802	159	12	weed	weed	NOUN
afs-147802	159	13	population	population	NOUN
afs-147802	159	14	,	,	PUNCT
afs-147802	159	15	limiting	limit	VERB
afs-147802	159	16	our	our	PRON
afs-147802	159	17	insight	insight	NOUN
afs-147802	159	18	into	into	ADP
afs-147802	159	19	the	the	DET
afs-147802	159	20	diversity	diversity	NOUN
afs-147802	159	21	of	of	ADP
afs-147802	159	22	ntsr	ntsr	ADJ
afs-147802	159	23	mechanisms	mechanism	NOUN
afs-147802	159	24	.	.	PUNCT
afs-147802	160	1	here	here	ADV
afs-147802	160	2	,	,	PUNCT
afs-147802	160	3	we	we	PRON
afs-147802	160	4	sought	seek	VERB
afs-147802	160	5	to	to	PART
afs-147802	160	6	explore	explore	VERB
afs-147802	160	7	the	the	DET
afs-147802	160	8	diversity	diversity	NOUN
afs-147802	160	9	of	of	ADP
afs-147802	160	10	ntsr	ntsr	ADJ
afs-147802	160	11	mechanisms	mechanism	NOUN
afs-147802	160	12	in	in	ADP
afs-147802	160	13	common	common	ADJ
afs-147802	160	14	ragweed	ragweed	NOUN
afs-147802	160	15	(	(	PUNCT
afs-147802	160	16	ambrosia	ambrosia	PROPN
afs-147802	160	17	artemisiifolia	artemisiifolia	PROPN
afs-147802	160	18	l.	l.	PROPN
afs-147802	160	19	)	)	PUNCT
afs-147802	160	20	demonstrated	demonstrate	VERB
afs-147802	160	21	that	that	SCONJ
afs-147802	160	22	multiple	multiple	ADJ
afs-147802	160	23	non	non	ADJ
afs-147802	160	24	-	-	ADJ
afs-147802	160	25	target	target	ADJ
afs-147802	160	26	site	site	NOUN
afs-147802	160	27	resistance	resistance	NOUN
afs-147802	160	28	mechanisms	mechanism	NOUN
afs-147802	160	29	can	can	AUX
afs-147802	160	30	evolve	evolve	VERB
afs-147802	160	31	within	within	ADP
afs-147802	160	32	a	a	DET
afs-147802	160	33	single	single	ADJ
afs-147802	160	34	species	specie	NOUN
afs-147802	160	35	(	(	PUNCT
afs-147802	160	36	in	in	ADP
afs-147802	160	37	their	their	PRON
afs-147802	160	38	case	case	NOUN
afs-147802	160	39	,	,	PUNCT
afs-147802	160	40	ambrosia	ambrosia	PROPN
afs-147802	160	41	)	)	PUNCT
afs-147802	160	42	.	.	PUNCT
afs-147802	161	1	the	the	DET
afs-147802	161	2	combination	combination	NOUN
afs-147802	161	3	of	of	ADP
afs-147802	161	4	target	target	NOUN
afs-147802	161	5	-	-	PUNCT
afs-147802	161	6	site	site	NOUN
afs-147802	161	7	and	and	CCONJ
afs-147802	161	8	non	non	ADJ
afs-147802	161	9	-	-	ADJ
afs-147802	161	10	target	target	ADJ
afs-147802	161	11	-	-	PUNCT
afs-147802	161	12	site	site	NOUN
afs-147802	161	13	resistance	resistance	NOUN
afs-147802	161	14	mechanisms	mechanism	NOUN
afs-147802	161	15	in	in	ADP
afs-147802	161	16	s.	s.	PROPN
afs-147802	161	17	media	media	PROPN
afs-147802	161	18	could	could	AUX
afs-147802	161	19	accelerate	accelerate	VERB
afs-147802	161	20	the	the	DET
afs-147802	161	21	spread	spread	NOUN
afs-147802	161	22	of	of	ADP
afs-147802	161	23	resistance	resistance	NOUN
afs-147802	161	24	across	across	ADP
afs-147802	161	25	fields	field	NOUN
afs-147802	161	26	,	,	PUNCT
afs-147802	161	27	especially	especially	ADV
afs-147802	161	28	considering	consider	VERB
afs-147802	161	29	that	that	SCONJ
afs-147802	161	30	sulfonylureas	sulfonylurea	NOUN
afs-147802	161	31	,	,	PUNCT
afs-147802	161	32	particularly	particularly	ADV
afs-147802	161	33	amidosulfuron+iodosulfuron	amidosulfuron+iodosulfuron	PROPN
afs-147802	161	34	,	,	PUNCT
afs-147802	161	35	are	be	AUX
afs-147802	161	36	among	among	ADP
afs-147802	161	37	the	the	DET
afs-147802	161	38	most	most	ADV
afs-147802	161	39	commonly	commonly	ADV
afs-147802	161	40	used	use	VERB
afs-147802	161	41	herbicides	herbicide	NOUN
afs-147802	161	42	for	for	ADP
afs-147802	161	43	controlling	control	VERB
afs-147802	161	44	dicotyledonous	dicotyledonous	ADJ
afs-147802	161	45	weeds	weed	NOUN
afs-147802	161	46	in	in	ADP
afs-147802	161	47	estonia	estonia	PROPN
afs-147802	161	48	.	.	PUNCT
afs-147802	162	1	although	although	SCONJ
afs-147802	162	2	s.	s.	PROPN
afs-147802	162	3	media	media	PROPN
afs-147802	162	4	is	be	AUX
afs-147802	162	5	not	not	PART
afs-147802	162	6	a	a	DET
afs-147802	162	7	tall	tall	ADJ
afs-147802	162	8	plant	plant	NOUN
afs-147802	162	9	and	and	CCONJ
afs-147802	162	10	may	may	AUX
afs-147802	162	11	not	not	PART
afs-147802	162	12	pose	pose	VERB
afs-147802	162	13	a	a	DET
afs-147802	162	14	significant	significant	ADJ
afs-147802	162	15	problem	problem	NOUN
afs-147802	162	16	in	in	ADP
afs-147802	162	17	terms	term	NOUN
afs-147802	162	18	of	of	ADP
afs-147802	162	19	light	light	ADJ
afs-147802	162	20	competition	competition	NOUN
afs-147802	162	21	,	,	PUNCT
afs-147802	162	22	it	it	PRON
afs-147802	162	23	can	can	AUX
afs-147802	162	24	form	form	VERB
afs-147802	162	25	dense	dense	ADJ
afs-147802	162	26	canopies	canopy	NOUN
afs-147802	162	27	that	that	PRON
afs-147802	162	28	strongly	strongly	ADV
afs-147802	162	29	compete	compete	VERB
afs-147802	162	30	for	for	ADP
afs-147802	162	31	water	water	NOUN
afs-147802	162	32	and	and	CCONJ
afs-147802	162	33	nutrients	nutrient	NOUN
afs-147802	162	34	.	.	PUNCT
afs-147802	163	1	in	in	ADP
afs-147802	163	2	fact	fact	NOUN
afs-147802	163	3	,	,	PUNCT
afs-147802	163	4	s.	s.	PROPN
afs-147802	163	5	media	media	PROPN
afs-147802	163	6	was	be	AUX
afs-147802	163	7	considered	consider	VERB
afs-147802	163	8	one	one	NUM
afs-147802	163	9	of	of	ADP
afs-147802	163	10	the	the	DET
afs-147802	163	11	most	most	ADV
afs-147802	163	12	agriculturally	agriculturally	ADV
afs-147802	163	13	significant	significant	ADJ
afs-147802	163	14	weeds	weed	NOUN
afs-147802	163	15	in	in	ADP
afs-147802	163	16	europe	europe	PROPN
afs-147802	163	17	as	as	ADP
afs-147802	163	18	of	of	ADP
afs-147802	163	19	2010	2010	NUM
afs-147802	163	20	(	(	PUNCT
afs-147802	163	21	marshall	marshall	PROPN
afs-147802	163	22	et	et	PROPN
afs-147802	163	23	al	al	PROPN
afs-147802	163	24	.	.	PROPN
afs-147802	163	25	2010	2010	NUM
afs-147802	163	26	)	)	PUNCT
afs-147802	163	27	.	.	PUNCT
afs-147802	164	1	consequently	consequently	ADV
afs-147802	164	2	,	,	PUNCT
afs-147802	164	3	the	the	DET
afs-147802	164	4	issue	issue	NOUN
afs-147802	164	5	of	of	ADP
afs-147802	164	6	resistance	resistance	NOUN
afs-147802	164	7	may	may	AUX
afs-147802	164	8	be	be	AUX
afs-147802	164	9	more	more	ADV
afs-147802	164	10	widespread	widespread	ADJ
afs-147802	164	11	in	in	ADP
afs-147802	164	12	estonia	estonia	PROPN
afs-147802	164	13	and	and	CCONJ
afs-147802	164	14	neighboring	neighboring	NOUN
afs-147802	164	15	countries	country	NOUN
afs-147802	164	16	than	than	SCONJ
afs-147802	164	17	currently	currently	ADV
afs-147802	164	18	recognized	recognize	VERB
afs-147802	164	19	.	.	PUNCT
afs-147802	165	1	although	although	SCONJ
afs-147802	165	2	herbicide	herbicide	NOUN
afs-147802	165	3	resistance	resistance	NOUN
afs-147802	165	4	has	have	AUX
afs-147802	165	5	only	only	ADV
afs-147802	165	6	recently	recently	ADV
afs-147802	165	7	been	be	AUX
afs-147802	165	8	recognized	recognize	VERB
afs-147802	165	9	in	in	ADP
afs-147802	165	10	estonia	estonia	PROPN
afs-147802	165	11	,	,	PUNCT
afs-147802	165	12	farmers	farmer	NOUN
afs-147802	165	13	have	have	AUX
afs-147802	165	14	reported	report	VERB
afs-147802	165	15	numerous	numerous	ADJ
afs-147802	165	16	cases	case	NOUN
afs-147802	165	17	involving	involve	VERB
afs-147802	165	18	various	various	ADJ
afs-147802	165	19	species	specie	NOUN
afs-147802	165	20	,	,	PUNCT
afs-147802	165	21	particularly	particularly	ADV
afs-147802	165	22	s.	s.	PROPN
afs-147802	165	23	media	media	PROPN
afs-147802	165	24	,	,	PUNCT
afs-147802	165	25	with	with	ADP
afs-147802	165	26	a	a	DET
afs-147802	165	27	focus	focus	NOUN
afs-147802	165	28	on	on	ADP
afs-147802	165	29	sulfonylurea	sulfonylurea	NOUN
afs-147802	165	30	herbicides	herbicide	NOUN
afs-147802	165	31	.	.	PUNCT
afs-147802	166	1	als	al	NOUN
afs-147802	166	2	-	-	PUNCT
afs-147802	166	3	inhibiting	inhibit	VERB
afs-147802	166	4	herbicides	herbicide	NOUN
afs-147802	166	5	,	,	PUNCT
afs-147802	166	6	especially	especially	ADV
afs-147802	166	7	sulfonylureas	sulfonylureas	ADJ
afs-147802	166	8	,	,	PUNCT
afs-147802	166	9	are	be	AUX
afs-147802	166	10	commonly	commonly	ADV
afs-147802	166	11	used	use	VERB
afs-147802	166	12	in	in	ADP
afs-147802	166	13	estonia	estonia	PROPN
afs-147802	166	14	for	for	ADP
afs-147802	166	15	controlling	control	VERB
afs-147802	166	16	dicotyledonous	dicotyledonous	ADJ
afs-147802	166	17	weeds	weed	NOUN
afs-147802	166	18	.	.	PUNCT
afs-147802	167	1	the	the	DET
afs-147802	167	2	future	future	ADJ
afs-147802	167	3	significance	significance	NOUN
afs-147802	167	4	of	of	ADP
afs-147802	167	5	s.	s.	PROPN
afs-147802	167	6	media	media	PROPN
afs-147802	167	7	as	as	ADP
afs-147802	167	8	a	a	DET
afs-147802	167	9	weed	weed	NOUN
afs-147802	167	10	remains	remain	VERB
afs-147802	167	11	uncertain	uncertain	ADJ
afs-147802	167	12	,	,	PUNCT
afs-147802	167	13	thought	think	VERB
afs-147802	167	14	climate	climate	NOUN
afs-147802	167	15	change	change	NOUN
afs-147802	167	16	and	and	CCONJ
afs-147802	167	17	minimal	minimal	ADJ
afs-147802	167	18	tillage	tillage	NOUN
afs-147802	167	19	practices	practice	NOUN
afs-147802	167	20	could	could	AUX
afs-147802	167	21	potentially	potentially	ADV
afs-147802	167	22	contribute	contribute	VERB
afs-147802	167	23	to	to	ADP
afs-147802	167	24	its	its	PRON
afs-147802	167	25	broader	broad	ADJ
afs-147802	167	26	and	and	CCONJ
afs-147802	167	27	faster	fast	ADJ
afs-147802	167	28	spread	spread	NOUN
afs-147802	167	29	.	.	PUNCT
afs-147802	168	1	given	give	VERB
afs-147802	168	2	the	the	DET
afs-147802	168	3	high	high	ADJ
afs-147802	168	4	genetic	genetic	ADJ
afs-147802	168	5	diversity	diversity	NOUN
afs-147802	168	6	within	within	ADP
afs-147802	168	7	the	the	DET
afs-147802	168	8	genus	genus	NOUN
afs-147802	168	9	and	and	CCONJ
afs-147802	168	10	the	the	DET
afs-147802	168	11	limited	limited	ADJ
afs-147802	168	12	number	number	NOUN
afs-147802	168	13	of	of	ADP
afs-147802	168	14	herbicides	herbicide	NOUN
afs-147802	168	15	available	available	ADJ
afs-147802	168	16	for	for	ADP
afs-147802	168	17	selective	selective	ADJ
afs-147802	168	18	control	control	NOUN
afs-147802	168	19	,	,	PUNCT
afs-147802	168	20	the	the	DET
afs-147802	168	21	rapid	rapid	ADJ
afs-147802	168	22	development	development	NOUN
afs-147802	168	23	of	of	ADP
afs-147802	168	24	resistance	resistance	NOUN
afs-147802	168	25	a	a	DET
afs-147802	168	26	real	real	ADJ
afs-147802	168	27	concern	concern	NOUN
afs-147802	168	28	.	.	PUNCT
afs-147802	169	1	to	to	PART
afs-147802	169	2	better	well	ADV
afs-147802	169	3	understand	understand	VERB
afs-147802	169	4	the	the	DET
afs-147802	169	5	extent	extent	NOUN
afs-147802	169	6	of	of	ADP
afs-147802	169	7	herbicide	herbicide	NOUN
afs-147802	169	8	resistance	resistance	NOUN
afs-147802	169	9	in	in	ADP
afs-147802	169	10	s.	s.	PROPN
afs-147802	169	11	media	media	PROPN
afs-147802	169	12	in	in	ADP
afs-147802	169	13	estonia	estonia	PROPN
afs-147802	169	14	,	,	PUNCT
afs-147802	169	15	further	further	ADJ
afs-147802	169	16	research	research	NOUN
afs-147802	169	17	is	be	AUX
afs-147802	169	18	needed	need	VERB
afs-147802	169	19	to	to	PART
afs-147802	169	20	elucidate	elucidate	VERB
afs-147802	169	21	the	the	DET
afs-147802	169	22	distribution	distribution	NOUN
afs-147802	169	23	and	and	CCONJ
afs-147802	169	24	underlying	underlying	ADJ
afs-147802	169	25	mechanisms	mechanism	NOUN
afs-147802	169	26	of	of	ADP
afs-147802	169	27	resistance	resistance	NOUN
afs-147802	169	28	.	.	PUNCT
afs-147802	170	1	more	more	ADV
afs-147802	170	2	extensive	extensive	ADJ
afs-147802	170	3	investigation	investigation	NOUN
afs-147802	170	4	of	of	ADP
afs-147802	170	5	potentially	potentially	ADV
afs-147802	170	6	resistant	resistant	ADJ
afs-147802	170	7	biotypes	biotype	NOUN
afs-147802	170	8	,	,	PUNCT
afs-147802	170	9	along	along	ADP
afs-147802	170	10	with	with	ADP
afs-147802	170	11	broader	broad	ADJ
afs-147802	170	12	monitoring	monitoring	NOUN
afs-147802	170	13	efforts	effort	NOUN
afs-147802	170	14	,	,	PUNCT
afs-147802	170	15	are	be	AUX
afs-147802	170	16	planned	plan	VERB
afs-147802	170	17	for	for	ADP
afs-147802	170	18	2025	2025	NUM
afs-147802	170	19	.	.	PUNCT
afs-147802	171	1	however	however	ADV
afs-147802	171	2	,	,	PUNCT
afs-147802	171	3	s.	s.	PROPN
afs-147802	171	4	media	media	PROPN
afs-147802	171	5	is	be	AUX
afs-147802	171	6	not	not	PART
afs-147802	171	7	the	the	DET
afs-147802	171	8	only	only	ADJ
afs-147802	171	9	problematic	problematic	ADJ
afs-147802	171	10	weed	weed	NOUN
afs-147802	171	11	species	specie	NOUN
afs-147802	171	12	in	in	ADP
afs-147802	171	13	the	the	DET
afs-147802	171	14	region	region	NOUN
afs-147802	171	15	.	.	PUNCT
afs-147802	172	1	therefore	therefore	ADV
afs-147802	172	2	,	,	PUNCT
afs-147802	172	3	it	it	PRON
afs-147802	172	4	is	be	AUX
afs-147802	172	5	imperative	imperative	ADJ
afs-147802	172	6	to	to	PART
afs-147802	172	7	expand	expand	VERB
afs-147802	172	8	monitoring	monitoring	NOUN
afs-147802	172	9	and	and	CCONJ
afs-147802	172	10	research	research	NOUN
afs-147802	172	11	efforts	effort	NOUN
afs-147802	172	12	on	on	ADP
afs-147802	172	13	herbicide	herbicide	NOUN
afs-147802	172	14	resistance	resistance	NOUN
afs-147802	172	15	in	in	ADP
afs-147802	172	16	estonia	estonia	PROPN
afs-147802	172	17	in	in	ADP
afs-147802	172	18	the	the	DET
afs-147802	172	19	coming	coming	ADJ
afs-147802	172	20	years	year	NOUN
afs-147802	172	21	,	,	PUNCT
afs-147802	172	22	including	include	VERB
afs-147802	172	23	the	the	DET
afs-147802	172	24	exploration	exploration	NOUN
afs-147802	172	25	of	of	ADP
afs-147802	172	26	resistance	resistance	NOUN
afs-147802	172	27	mechanisms	mechanism	NOUN
afs-147802	172	28	.	.	PUNCT
afs-147802	173	1	to	to	PART
afs-147802	173	2	prolong	prolong	VERB
afs-147802	173	3	the	the	DET
afs-147802	173	4	effective	effective	ADJ
afs-147802	173	5	use	use	NOUN
afs-147802	173	6	of	of	ADP
afs-147802	173	7	herbicides	herbicide	NOUN
afs-147802	173	8	,	,	PUNCT
afs-147802	173	9	it	it	PRON
afs-147802	173	10	is	be	AUX
afs-147802	173	11	essential	essential	ADJ
afs-147802	173	12	to	to	PART
afs-147802	173	13	rotate	rotate	VERB
afs-147802	173	14	herbicide	herbicide	NOUN
afs-147802	173	15	products	product	NOUN
afs-147802	173	16	and	and	CCONJ
afs-147802	173	17	use	use	VERB
afs-147802	173	18	them	they	PRON
afs-147802	173	19	in	in	ADP
afs-147802	173	20	mixtures	mixture	NOUN
afs-147802	173	21	whenever	whenever	SCONJ
afs-147802	173	22	possible	possible	ADJ
afs-147802	173	23	,	,	PUNCT
afs-147802	173	24	ideally	ideally	ADV
afs-147802	173	25	incorporating	incorporate	VERB
afs-147802	173	26	different	different	ADJ
afs-147802	173	27	modes	mode	NOUN
afs-147802	173	28	of	of	ADP
afs-147802	173	29	action	action	NOUN
afs-147802	173	30	.	.	PUNCT
afs-147802	174	1	however	however	ADV
afs-147802	174	2	,	,	PUNCT
afs-147802	174	3	the	the	DET
afs-147802	174	4	selection	selection	NOUN
afs-147802	174	5	of	of	ADP
afs-147802	174	6	herbicide	herbicide	NOUN
afs-147802	174	7	products	product	NOUN
afs-147802	174	8	is	be	AUX
afs-147802	174	9	often	often	ADV
afs-147802	174	10	limited	limit	VERB
afs-147802	174	11	,	,	PUNCT
afs-147802	174	12	and	and	CCONJ
afs-147802	174	13	estonian	estonian	ADJ
afs-147802	174	14	commercial	commercial	ADJ
afs-147802	174	15	farms	farm	NOUN
afs-147802	174	16	typically	typically	ADV
afs-147802	174	17	rely	rely	VERB
afs-147802	174	18	on	on	ADP
afs-147802	174	19	the	the	DET
afs-147802	174	20	same	same	ADJ
afs-147802	174	21	products	product	NOUN
afs-147802	174	22	for	for	ADP
afs-147802	174	23	weed	weed	NOUN
afs-147802	174	24	control	control	NOUN
afs-147802	174	25	.	.	PUNCT
afs-147802	175	1	monitoring	monitor	VERB
afs-147802	175	2	herbicide	herbicide	NOUN
afs-147802	175	3	resistance	resistance	NOUN
afs-147802	175	4	can	can	AUX
afs-147802	175	5	help	help	VERB
afs-147802	175	6	minimize	minimize	VERB
afs-147802	175	7	the	the	DET
afs-147802	175	8	use	use	NOUN
afs-147802	175	9	of	of	ADP
afs-147802	175	10	herbicides	herbicide	NOUN
afs-147802	175	11	that	that	PRON
afs-147802	175	12	are	be	AUX
afs-147802	175	13	at	at	ADP
afs-147802	175	14	risk	risk	NOUN
afs-147802	175	15	of	of	ADP
afs-147802	175	16	resistance	resistance	NOUN
afs-147802	175	17	development	development	NOUN
afs-147802	175	18	without	without	ADP
afs-147802	175	19	compromising	compromise	VERB
afs-147802	175	20	weed	weed	NOUN
afs-147802	175	21	control	control	NOUN
afs-147802	175	22	in	in	ADP
afs-147802	175	23	the	the	DET
afs-147802	175	24	fields	field	NOUN
afs-147802	175	25	.	.	PUNCT
afs-147802	176	1	this	this	DET
afs-147802	176	2	strategy	strategy	NOUN
afs-147802	176	3	would	would	AUX
afs-147802	176	4	enable	enable	VERB
afs-147802	176	5	farmers	farmer	NOUN
afs-147802	176	6	to	to	PART
afs-147802	176	7	adjust	adjust	VERB
afs-147802	176	8	their	their	PRON
afs-147802	176	9	spraying	spray	VERB
afs-147802	176	10	programs	program	NOUN
afs-147802	176	11	and	and	CCONJ
afs-147802	176	12	adopt	adopt	VERB
afs-147802	176	13	sustainable	sustainable	ADJ
afs-147802	176	14	,	,	PUNCT
afs-147802	176	15	localized	localized	ADJ
afs-147802	176	16	management	management	NOUN
afs-147802	176	17	practices	practice	NOUN
afs-147802	176	18	before	before	SCONJ
afs-147802	176	19	herbicide	herbicide	NOUN
afs-147802	176	20	resistance	resistance	NOUN
afs-147802	176	21	becomes	becomes	AUX
afs-147802	176	22	entrenched	entrench	VERB
afs-147802	176	23	,	,	PUNCT
afs-147802	176	24	which	which	PRON
afs-147802	176	25	could	could	AUX
afs-147802	176	26	lead	lead	VERB
afs-147802	176	27	to	to	ADP
afs-147802	176	28	a	a	DET
afs-147802	176	29	decline	decline	NOUN
afs-147802	176	30	in	in	ADP
afs-147802	176	31	field	field	NOUN
afs-147802	176	32	performance	performance	NOUN
afs-147802	176	33	.	.	PUNCT
afs-147802	177	1	additionally	additionally	ADV
afs-147802	177	2	,	,	PUNCT
afs-147802	177	3	monitoring	monitor	VERB
afs-147802	177	4	herbicide	herbicide	NOUN
afs-147802	177	5	resistance	resistance	NOUN
afs-147802	177	6	is	be	AUX
afs-147802	177	7	essential	essential	ADJ
afs-147802	177	8	to	to	PART
afs-147802	177	9	prevent	prevent	VERB
afs-147802	177	10	the	the	DET
afs-147802	177	11	use	use	NOUN
afs-147802	177	12	of	of	ADP
afs-147802	177	13	ineffective	ineffective	ADJ
afs-147802	177	14	products	product	NOUN
afs-147802	177	15	and	and	CCONJ
afs-147802	177	16	help	help	AUX
afs-147802	177	17	identify	identify	VERB
afs-147802	177	18	alternative	alternative	ADJ
afs-147802	177	19	strategies	strategy	NOUN
afs-147802	177	20	to	to	PART
afs-147802	177	21	reduce	reduce	VERB
afs-147802	177	22	weed	weed	NOUN
afs-147802	177	23	infestations	infestation	NOUN
afs-147802	177	24	.	.	PUNCT
afs-147802	178	1	alternative	alternative	ADJ
afs-147802	178	2	methods	method	NOUN
afs-147802	178	3	for	for	ADP
afs-147802	178	4	controlling	control	VERB
afs-147802	178	5	weeds	weed	NOUN
afs-147802	178	6	,	,	PUNCT
afs-147802	178	7	such	such	ADJ
afs-147802	178	8	as	as	ADP
afs-147802	178	9	improving	improve	VERB
afs-147802	178	10	crop	crop	NOUN
afs-147802	178	11	competitiveness	competitiveness	NOUN
afs-147802	178	12	and	and	CCONJ
afs-147802	178	13	integrated	integrate	VERB
afs-147802	178	14	weed	weed	NOUN
afs-147802	178	15	management	management	NOUN
afs-147802	178	16	solutions	solution	NOUN
afs-147802	178	17	,	,	PUNCT
afs-147802	178	18	should	should	AUX
afs-147802	178	19	be	be	AUX
afs-147802	178	20	further	far	ADV
afs-147802	178	21	explored	explore	VERB
afs-147802	178	22	.	.	PUNCT
afs-147802	179	1	current	current	ADJ
afs-147802	179	2	recommendations	recommendation	NOUN
afs-147802	179	3	for	for	ADP
afs-147802	179	4	managing	manage	VERB
afs-147802	179	5	herbicide	herbicide	NOUN
afs-147802	179	6	resistance	resistance	NOUN
afs-147802	179	7	include	include	VERB
afs-147802	179	8	using	use	VERB
afs-147802	179	9	herbicide	herbicide	NOUN
afs-147802	179	10	mixtures	mixture	NOUN
afs-147802	179	11	and	and	CCONJ
afs-147802	179	12	rotating	rotate	VERB
afs-147802	179	13	active	active	ADJ
afs-147802	179	14	ingredients	ingredient	NOUN
afs-147802	179	15	,	,	PUNCT
afs-147802	179	16	prioritizing	prioritize	VERB
afs-147802	179	17	preemergence	preemergence	NOUN
afs-147802	179	18	over	over	ADP
afs-147802	179	19	postemergence	postemergence	NOUN
afs-147802	179	20	herbicides	herbicide	NOUN
afs-147802	179	21	,	,	PUNCT
afs-147802	179	22	developing	develop	VERB
afs-147802	179	23	crop	crop	NOUN
afs-147802	179	24	cultivars	cultivar	NOUN
afs-147802	179	25	with	with	ADP
afs-147802	179	26	enhanced	enhanced	ADJ
afs-147802	179	27	weed	weed	NOUN
afs-147802	179	28	competitiveness	competitiveness	NOUN
afs-147802	179	29	,	,	PUNCT
afs-147802	179	30	expanding	expand	VERB
afs-147802	179	31	harvest	harvest	NOUN
afs-147802	179	32	weed	weed	NOUN
afs-147802	179	33	seed	seed	NOUN
afs-147802	179	34	control	control	NOUN
afs-147802	179	35	practices	practice	NOUN
afs-147802	179	36	,	,	PUNCT
afs-147802	179	37	and	and	CCONJ
afs-147802	179	38	advancing	advance	VERB
afs-147802	179	39	site	site	NOUN
afs-147802	179	40	-	-	PUNCT
afs-147802	179	41	specific	specific	ADJ
afs-147802	179	42	or	or	CCONJ
afs-147802	179	43	precision	precision	NOUN
afs-147802	179	44	weed	weed	NOUN
afs-147802	179	45	management	management	NOUN
afs-147802	179	46	techniques	technique	NOUN
afs-147802	179	47	(	(	PUNCT
afs-147802	179	48	beckie	beckie	PROPN
afs-147802	179	49	et	et	PROPN
afs-147802	179	50	al	al	PROPN
afs-147802	179	51	.	.	PROPN
afs-147802	179	52	2019	2019	NUM
afs-147802	179	53	)	)	PUNCT
afs-147802	179	54	.	.	PUNCT
afs-147802	180	1	conclusions	conclusion	NOUN
afs-147802	180	2	resistance	resistance	NOUN
afs-147802	180	3	to	to	ADP
afs-147802	180	4	the	the	DET
afs-147802	180	5	als	als	NOUN
afs-147802	180	6	inhibitors	inhibitor	NOUN
afs-147802	180	7	has	have	AUX
afs-147802	180	8	been	be	AUX
afs-147802	180	9	identified	identify	VERB
afs-147802	180	10	in	in	ADP
afs-147802	180	11	several	several	ADJ
afs-147802	180	12	s.	s.	PROPN
afs-147802	180	13	media	media	PROPN
afs-147802	180	14	biotypes	biotype	NOUN
afs-147802	180	15	in	in	ADP
afs-147802	180	16	estonia	estonia	PROPN
afs-147802	180	17	.	.	PUNCT
afs-147802	181	1	both	both	DET
afs-147802	181	2	target	target	NOUN
afs-147802	181	3	-	-	PUNCT
afs-147802	181	4	site	site	NOUN
afs-147802	181	5	and	and	CCONJ
afs-147802	181	6	non	non	ADJ
afs-147802	181	7	-	-	ADJ
afs-147802	181	8	target	target	ADJ
afs-147802	181	9	-	-	PUNCT
afs-147802	181	10	site	site	NOUN
afs-147802	181	11	resistance	resistance	NOUN
afs-147802	181	12	mechanisms	mechanism	NOUN
afs-147802	181	13	are	be	AUX
afs-147802	181	14	involved	involve	VERB
afs-147802	181	15	in	in	ADP
afs-147802	181	16	this	this	DET
afs-147802	181	17	resistance	resistance	NOUN
afs-147802	181	18	.	.	PUNCT
afs-147802	182	1	sulfonylureas	sulfonylureas	PROPN
afs-147802	182	2	are	be	AUX
afs-147802	182	3	one	one	NUM
afs-147802	182	4	of	of	ADP
afs-147802	182	5	the	the	DET
afs-147802	182	6	most	most	ADV
afs-147802	182	7	problematic	problematic	ADJ
afs-147802	182	8	herbicide	herbicide	NOUN
afs-147802	182	9	groups	group	NOUN
afs-147802	182	10	for	for	ADP
afs-147802	182	11	controlling	control	VERB
afs-147802	182	12	dicotyledonous	dicotyledonous	ADJ
afs-147802	182	13	weeds	weed	NOUN
afs-147802	182	14	in	in	ADP
afs-147802	182	15	estonia	estonia	PROPN
afs-147802	182	16	.	.	PUNCT
afs-147802	183	1	herbicide	herbicide	NOUN
afs-147802	183	2	resistance	resistance	NOUN
afs-147802	183	3	in	in	ADP
afs-147802	183	4	estonia	estonia	PROPN
afs-147802	183	5	is	be	AUX
afs-147802	183	6	likely	likely	ADV
afs-147802	183	7	more	more	ADV
afs-147802	183	8	widespread	widespread	ADJ
afs-147802	183	9	,	,	PUNCT
afs-147802	183	10	affecting	affect	VERB
afs-147802	183	11	a	a	DET
afs-147802	183	12	greater	great	ADJ
afs-147802	183	13	range	range	NOUN
afs-147802	183	14	of	of	ADP
afs-147802	183	15	species	specie	NOUN
afs-147802	183	16	and	and	CCONJ
afs-147802	183	17	herbicide	herbicide	NOUN
afs-147802	183	18	modes	mode	NOUN
afs-147802	183	19	of	of	ADP
afs-147802	183	20	action	action	NOUN
afs-147802	183	21	.	.	PUNCT
afs-147802	184	1	there	there	PRON
afs-147802	184	2	is	be	VERB
afs-147802	184	3	a	a	DET
afs-147802	184	4	need	need	NOUN
afs-147802	184	5	for	for	ADP
afs-147802	184	6	more	more	ADV
afs-147802	184	7	extensive	extensive	ADJ
afs-147802	184	8	herbicide	herbicide	NOUN
afs-147802	184	9	resistance	resistance	NOUN
afs-147802	184	10	monitoring	monitoring	NOUN
afs-147802	184	11	and	and	CCONJ
afs-147802	184	12	research	research	NOUN
afs-147802	184	13	in	in	ADP
afs-147802	184	14	estonia	estonia	PROPN
afs-147802	184	15	.	.	PUNCT
afs-147802	185	1	acknowledgements	acknowledgement	VERB
afs-147802	185	2	the	the	DET
afs-147802	185	3	research	research	NOUN
afs-147802	185	4	was	be	AUX
afs-147802	185	5	financed	finance	VERB
afs-147802	185	6	by	by	ADP
afs-147802	185	7	the	the	DET
afs-147802	185	8	project	project	NOUN
afs-147802	185	9	umbrohi	umbrohi	NOUN
afs-147802	185	10	by	by	ADP
afs-147802	185	11	archimedes	archimede	NOUN
afs-147802	185	12	(	(	PUNCT
afs-147802	185	13	2014	2014	NUM
afs-147802	185	14	-	-	PUNCT
afs-147802	185	15	2020.4.01.20	2020.4.01.20	NUM
afs-147802	185	16	-	-	PUNCT
afs-147802	185	17	0297	0297	NUM
afs-147802	185	18	)	)	PUNCT
afs-147802	185	19	and	and	CCONJ
afs-147802	185	20	by	by	ADP
afs-147802	185	21	the	the	DET
afs-147802	185	22	ministry	ministry	PROPN
afs-147802	185	23	of	of	ADP
afs-147802	185	24	regional	regional	PROPN
afs-147802	185	25	affairs	affairs	PROPN
afs-147802	185	26	and	and	CCONJ
afs-147802	185	27	agriculture	agriculture	NOUN
afs-147802	185	28	(	(	PUNCT
afs-147802	185	29	pa1	pa1	NOUN
afs-147802	185	30	-	-	PUNCT
afs-147802	185	31	rup	rup	NOUN
afs-147802	185	32	-	-	PUNCT
afs-147802	185	33	respest	respest	NOUN
afs-147802	185	34	)	)	PUNCT
afs-147802	185	35	.	.	PUNCT
afs-147802	186	1	we	we	PRON
afs-147802	186	2	thank	thank	VERB
afs-147802	186	3	colleagues	colleague	NOUN
afs-147802	186	4	in	in	ADP
afs-147802	186	5	metk	metk	PROPN
afs-147802	186	6	,	,	PUNCT
afs-147802	186	7	czech	czech	PROPN
afs-147802	186	8	university	university	PROPN
afs-147802	186	9	of	of	ADP
afs-147802	186	10	life	life	NOUN
afs-147802	186	11	sciences	science	NOUN
afs-147802	186	12	and	and	CCONJ
afs-147802	186	13	the	the	DET
afs-147802	186	14	farmers	farmer	NOUN
afs-147802	186	15	society	society	PROPN
afs-147802	186	16	kevili	kevili	VERB
afs-147802	186	17	for	for	ADP
afs-147802	186	18	their	their	PRON
afs-147802	186	19	help	help	NOUN
afs-147802	186	20	.	.	PUNCT
afs-147802	187	1	agricultural	agricultural	ADJ
afs-147802	187	2	and	and	CCONJ
afs-147802	187	3	food	food	NOUN
afs-147802	187	4	science	science	NOUN
afs-147802	187	5	(	(	PUNCT
afs-147802	187	6	2025	2025	NUM
afs-147802	187	7	)	)	PUNCT
afs-147802	187	8	34	34	NUM
afs-147802	187	9	:	:	PUNCT
afs-147802	187	10	51–60	51–60	NUM
afs-147802	187	11	59	59	NUM
afs-147802	187	12	references	reference	NOUN
afs-147802	187	13	adamczewski	adamczewski	VERB
afs-147802	187	14	,	,	PUNCT
afs-147802	187	15	k.	k.	PROPN
afs-147802	187	16	,	,	PUNCT
afs-147802	187	17	kierzek	kierzek	PROPN
afs-147802	187	18	,	,	PUNCT
afs-147802	187	19	r.	r.	PROPN
afs-147802	187	20	&	&	CCONJ
afs-147802	187	21	matysiak	matysiak	PROPN
afs-147802	187	22	,	,	PUNCT
afs-147802	187	23	k.	k.	PROPN
afs-147802	187	24	2014	2014	NUM
afs-147802	187	25	.	.	PUNCT
afs-147802	188	1	biotypes	biotype	NOUN
afs-147802	188	2	of	of	ADP
afs-147802	188	3	scentless	scentless	NOUN
afs-147802	188	4	chamomile	chamomile	NOUN
afs-147802	188	5	matricaria	matricaria	NOUN
afs-147802	188	6	maritima	maritima	NOUN
afs-147802	188	7	(	(	PUNCT
afs-147802	188	8	l	l	NOUN
afs-147802	188	9	)	)	PUNCT
afs-147802	188	10	ssp	ssp	NOUN
afs-147802	188	11	.	.	PUNCT
afs-147802	189	1	inodora	inodora	NOUN
afs-147802	189	2	(	(	PUNCT
afs-147802	189	3	l	l	NOUN
afs-147802	189	4	)	)	PUNCT
afs-147802	189	5	dostal	dostal	NOUN
afs-147802	189	6	and	and	CCONJ
afs-147802	189	7	common	common	ADJ
afs-147802	189	8	poppy	poppy	NOUN
afs-147802	189	9	papaver	papaver	PROPN
afs-147802	189	10	rhoeas	rhoea	NOUN
afs-147802	189	11	(	(	PUNCT
afs-147802	189	12	l	l	NOUN
afs-147802	189	13	)	)	PUNCT
afs-147802	189	14	resistant	resistant	ADJ
afs-147802	189	15	to	to	ADP
afs-147802	189	16	tribenuron	tribenuron	PROPN
afs-147802	189	17	methyl	methyl	NOUN
afs-147802	189	18	,	,	PUNCT
afs-147802	189	19	in	in	ADP
afs-147802	189	20	poland	poland	PROPN
afs-147802	189	21	.	.	PUNCT
afs-147802	190	1	journal	journal	PROPN
afs-147802	190	2	of	of	ADP
afs-147802	190	3	plant	plant	NOUN
afs-147802	190	4	protection	protection	NOUN
afs-147802	190	5	research	research	NOUN
afs-147802	190	6	54	54	NUM
afs-147802	190	7	:	:	PUNCT
afs-147802	190	8	401	401	NUM
afs-147802	190	9	–	–	PUNCT
afs-147802	190	10	406	406	NUM
afs-147802	190	11	.	.	PUNCT
afs-147802	191	1	https://doi.org/10.2478/jppr-2014-0060	https://doi.org/10.2478/jppr-2014-0060	NOUN
afs-147802	191	2	adamczewski	adamczewski	PROPN
afs-147802	191	3	,	,	PUNCT
afs-147802	191	4	k.	k.	PROPN
afs-147802	191	5	,	,	PUNCT
afs-147802	191	6	matysiak	matysiak	PROPN
afs-147802	191	7	,	,	PUNCT
afs-147802	191	8	k.	k.	PROPN
afs-147802	191	9	,	,	PUNCT
afs-147802	191	10	kierzek	kierzek	PROPN
afs-147802	191	11	,	,	PUNCT
afs-147802	191	12	r.	r.	PROPN
afs-147802	191	13	&	&	CCONJ
afs-147802	191	14	kaczmarek	kaczmarek	PROPN
afs-147802	191	15	,	,	PUNCT
afs-147802	191	16	s.	s.	PROPN
afs-147802	191	17	2019	2019	NUM
afs-147802	191	18	.	.	PUNCT
afs-147802	192	1	significant	significant	ADJ
afs-147802	192	2	increase	increase	NOUN
afs-147802	192	3	of	of	ADP
afs-147802	192	4	weed	weed	NOUN
afs-147802	192	5	resistance	resistance	NOUN
afs-147802	192	6	to	to	ADP
afs-147802	192	7	herbicides	herbicide	NOUN
afs-147802	192	8	in	in	ADP
afs-147802	192	9	poland	poland	PROPN
afs-147802	192	10	.	.	PUNCT
afs-147802	193	1	journal	journal	PROPN
afs-147802	193	2	of	of	ADP
afs-147802	193	3	plant	plant	NOUN
afs-147802	193	4	protection	protection	NOUN
afs-147802	193	5	research	research	NOUN
afs-147802	193	6	59	59	NUM
afs-147802	193	7	:	:	PUNCT
afs-147802	193	8	139–150	139–150	NUM
afs-147802	193	9	.	.	PUNCT
afs-147802	194	1	https://doi.org/10.24425/jppr.2019.129293	https://doi.org/10.24425/jppr.2019.129293	PROPN
afs-147802	194	2	auškalnienė	auškalnienė	NOUN
afs-147802	194	3	,	,	PUNCT
afs-147802	194	4	o.	o.	PROPN
afs-147802	194	5	,	,	PUNCT
afs-147802	194	6	kadžienė	kadžienė	PROPN
afs-147802	194	7	,	,	PUNCT
afs-147802	194	8	g.	g.	PROPN
afs-147802	194	9	,	,	PUNCT
afs-147802	194	10	stefanovičienė	stefanovičienė	PROPN
afs-147802	194	11	,	,	PUNCT
afs-147802	194	12	r.	r.	PROPN
afs-147802	194	13	&	&	CCONJ
afs-147802	194	14	jomantaitė	jomantaitė	PROPN
afs-147802	194	15	,	,	PUNCT
afs-147802	194	16	b.	b.	PROPN
afs-147802	194	17	2020	2020	NUM
afs-147802	194	18	.	.	PUNCT
afs-147802	195	1	development	development	NOUN
afs-147802	195	2	of	of	ADP
afs-147802	195	3	herbicides	herbicide	NOUN
afs-147802	195	4	resistance	resistance	NOUN
afs-147802	195	5	in	in	ADP
afs-147802	195	6	apera	apera	PROPN
afs-147802	195	7	spica	spica	NOUN
afs-147802	195	8	-	-	PUNCT
afs-147802	195	9	venti	venti	NOUN
afs-147802	195	10	in	in	ADP
afs-147802	195	11	lithuania	lithuania	PROPN
afs-147802	195	12	.	.	PUNCT
afs-147802	196	1	zemdirbyste	zemdirbyste	PROPN
afs-147802	196	2	107	107	NUM
afs-147802	196	3	:	:	PUNCT
afs-147802	196	4	99–104	99–104	PROPN
afs-147802	196	5	.	.	PUNCT
afs-147802	197	1	https://doi.org/10.13080/z-a.2020.107.013	https://doi.org/10.13080/z-a.2020.107.013	PROPN
afs-147802	197	2	bai	bai	PROPN
afs-147802	197	3	,	,	PUNCT
afs-147802	197	4	s.	s.	PROPN
afs-147802	197	5	,	,	PUNCT
afs-147802	197	6	zhang	zhang	PROPN
afs-147802	197	7	,	,	PUNCT
afs-147802	197	8	f.	f.	PROPN
afs-147802	197	9	,	,	PUNCT
afs-147802	197	10	li	li	PROPN
afs-147802	197	11	,	,	PUNCT
afs-147802	197	12	z.	z.	PROPN
afs-147802	197	13	,	,	PUNCT
afs-147802	197	14	wang	wang	PROPN
afs-147802	197	15	,	,	PUNCT
afs-147802	197	16	h.	h.	PROPN
afs-147802	197	17	,	,	PUNCT
afs-147802	197	18	wang	wang	PROPN
afs-147802	197	19	,	,	PUNCT
afs-147802	197	20	q.	q.	PROPN
afs-147802	197	21	,	,	PUNCT
afs-147802	197	22	wang	wang	PROPN
afs-147802	197	23	,	,	PUNCT
afs-147802	197	24	j.	j.	PROPN
afs-147802	197	25	,	,	PUNCT
afs-147802	197	26	liu	liu	PROPN
afs-147802	197	27	,	,	PUNCT
afs-147802	197	28	w.	w.	PROPN
afs-147802	197	29	&	&	CCONJ
afs-147802	197	30	bai	bai	PROPN
afs-147802	197	31	,	,	PUNCT
afs-147802	197	32	l.	l.	PROPN
afs-147802	197	33	2019	2019	NUM
afs-147802	197	34	.	.	PUNCT
afs-147802	198	1	target	target	NOUN
afs-147802	198	2	-	-	PUNCT
afs-147802	198	3	site	site	NOUN
afs-147802	198	4	and	and	CCONJ
afs-147802	198	5	non	non	ADJ
afs-147802	198	6	-	-	ADJ
afs-147802	198	7	target	target	ADJ
afs-147802	198	8	-	-	PUNCT
afs-147802	198	9	site	site	NOUN
afs-147802	198	10	-	-	PUNCT
afs-147802	198	11	based	base	VERB
afs-147802	198	12	resistance	resistance	NOUN
afs-147802	198	13	to	to	ADP
afs-147802	198	14	tribenuron	tribenuron	NOUN
afs-147802	198	15	-	-	PUNCT
afs-147802	198	16	methyl	methyl	NOUN
afs-147802	198	17	in	in	ADP
afs-147802	198	18	multiply	multiply	NOUN
afs-147802	198	19	-	-	PUNCT
afs-147802	198	20	resistant	resistant	ADJ
afs-147802	198	21	myosoton	myosoton	NOUN
afs-147802	198	22	aquaticum	aquaticum	PROPN
afs-147802	198	23	l.	l.	PROPN
afs-147802	198	24	pesticide	pesticide	PROPN
afs-147802	198	25	biochemistry	biochemistry	NOUN
afs-147802	198	26	and	and	CCONJ
afs-147802	198	27	physiology	physiology	NOUN
afs-147802	198	28	155	155	NUM
afs-147802	198	29	:	:	PUNCT
afs-147802	198	30	8–14	8–14	NOUN
afs-147802	198	31	.	.	PUNCT
afs-147802	199	1	https://doi.org/10.1016/j.pestbp.2018.12.004	https://doi.org/10.1016/j.pestbp.2018.12.004	VERB
afs-147802	199	2	barnwell	barnwell	INTJ
afs-147802	199	3	,	,	PUNCT
afs-147802	199	4	p.	p.	PROPN
afs-147802	199	5	&	&	CCONJ
afs-147802	199	6	cobb	cobb	PROPN
afs-147802	199	7	,	,	PUNCT
afs-147802	199	8	a.h	a.h	PROPN
afs-147802	199	9	.	.	PROPN
afs-147802	199	10	1989	1989	NUM
afs-147802	199	11	.	.	PUNCT
afs-147802	200	1	physiological	physiological	ADJ
afs-147802	200	2	studies	study	NOUN
afs-147802	200	3	of	of	ADP
afs-147802	200	4	mecoprop	mecoprop	NOUN
afs-147802	200	5	-	-	PUNCT
afs-147802	200	6	resistance	resistance	NOUN
afs-147802	200	7	in	in	ADP
afs-147802	200	8	chickweed	chickweed	NOUN
afs-147802	200	9	{	{	PUNCT
afs-147802	200	10	stellaria	stellaria	PROPN
afs-147802	200	11	media	media	PROPN
afs-147802	200	12	l.	l.	PROPN
afs-147802	200	13	)	)	PUNCT
afs-147802	200	14	.	.	PUNCT
afs-147802	201	1	weed	weed	VERB
afs-147802	201	2	research	research	NOUN
afs-147802	201	3	29	29	NUM
afs-147802	201	4	:	:	PUNCT
afs-147802	201	5	135–140	135–140	NUM
afs-147802	201	6	.	.	PUNCT
afs-147802	202	1	https://doi.org/10.1111/j.1365-3180.1989.tb00851.x	https://doi.org/10.1111/j.1365-3180.1989.tb00851.x	PROPN
afs-147802	202	2	beckie	beckie	PROPN
afs-147802	202	3	,	,	PUNCT
afs-147802	202	4	h.j	h.j	PROPN
afs-147802	202	5	.	.	PROPN
afs-147802	202	6	,	,	PUNCT
afs-147802	202	7	ashworth	ashworth	PROPN
afs-147802	202	8	,	,	PUNCT
afs-147802	202	9	m.b	m.b	PROPN
afs-147802	202	10	.	.	PROPN
afs-147802	202	11	&	&	CCONJ
afs-147802	202	12	flower	flower	PROPN
afs-147802	202	13	,	,	PUNCT
afs-147802	202	14	k.c	k.c	PROPN
afs-147802	202	15	.	.	PROPN
afs-147802	202	16	2019	2019	NUM
afs-147802	202	17	.	.	PUNCT
afs-147802	203	1	herbicide	herbicide	NOUN
afs-147802	203	2	resistance	resistance	NOUN
afs-147802	203	3	management	management	NOUN
afs-147802	203	4	:	:	PUNCT
afs-147802	203	5	recent	recent	ADJ
afs-147802	203	6	developments	development	NOUN
afs-147802	203	7	and	and	CCONJ
afs-147802	203	8	trends	trend	NOUN
afs-147802	203	9	.	.	PUNCT
afs-147802	204	1	plants	plant	NOUN
afs-147802	204	2	8	8	NUM
afs-147802	204	3	.	.	PUNCT
afs-147802	205	1	https://doi.org/10.3390/plants8060161	https://doi.org/10.3390/plants8060161	PROPN
afs-147802	205	2	beffa	beffa	PROPN
afs-147802	205	3	,	,	PUNCT
afs-147802	205	4	r.	r.	PROPN
afs-147802	205	5	,	,	PUNCT
afs-147802	205	6	menne	menne	PROPN
afs-147802	205	7	,	,	PUNCT
afs-147802	205	8	h.	h.	PROPN
afs-147802	205	9	&	&	CCONJ
afs-147802	205	10	köcher	köcher	PROPN
afs-147802	205	11	,	,	PUNCT
afs-147802	205	12	h.	h.	PROPN
afs-147802	205	13	2019	2019	NUM
afs-147802	205	14	.	.	PUNCT
afs-147802	206	1	herbicide	herbicide	NOUN
afs-147802	206	2	resistance	resistance	NOUN
afs-147802	206	3	action	action	NOUN
afs-147802	206	4	committee	committee	NOUN
afs-147802	206	5	(	(	PUNCT
afs-147802	206	6	hrac	hrac	NOUN
afs-147802	206	7	):	):	PUNCT
afs-147802	206	8	herbicide	herbicide	NOUN
afs-147802	206	9	classification	classification	NOUN
afs-147802	206	10	,	,	PUNCT
afs-147802	206	11	resistance	resistance	NOUN
afs-147802	206	12	evolution	evolution	NOUN
afs-147802	206	13	,	,	PUNCT
afs-147802	206	14	survey	survey	NOUN
afs-147802	206	15	,	,	PUNCT
afs-147802	206	16	and	and	CCONJ
afs-147802	206	17	resistance	resistance	NOUN
afs-147802	206	18	mitigation	mitigation	NOUN
afs-147802	206	19	activities	activity	NOUN
afs-147802	206	20	.	.	PUNCT
afs-147802	207	1	https://doi.org/10.1002/9783527699261.ch1	https://doi.org/10.1002/9783527699261.ch1	PROPN
afs-147802	207	2	de	de	PROPN
afs-147802	207	3	mendiburu	mendiburu	PROPN
afs-147802	207	4	,	,	PUNCT
afs-147802	207	5	f.	f.	PROPN
afs-147802	207	6	2023	2023	NUM
afs-147802	207	7	.	.	PUNCT
afs-147802	208	1	agricolae	agricolae	PROPN
afs-147802	208	2	:	:	PUNCT
afs-147802	208	3	statistical	statistical	ADJ
afs-147802	208	4	procedures	procedure	NOUN
afs-147802	208	5	for	for	ADP
afs-147802	208	6	agricultural	agricultural	ADJ
afs-147802	208	7	research	research	NOUN
afs-147802	208	8	.	.	PUNCT
afs-147802	209	1	r	r	NOUN
afs-147802	209	2	package	package	NOUN
afs-147802	209	3	version	version	NOUN
afs-147802	209	4	1.3	1.3	NUM
afs-147802	209	5	-	-	SYM
afs-147802	209	6	7	7	NUM
afs-147802	209	7	.	.	PUNCT
afs-147802	210	1	https://cran.r-project.org/package=agricolae	https://cran.r-project.org/package=agricolae	PROPN
afs-147802	210	2	deng	deng	PROPN
afs-147802	210	3	,	,	PUNCT
afs-147802	210	4	w.	w.	PROPN
afs-147802	210	5	,	,	PUNCT
afs-147802	210	6	di	di	PROPN
afs-147802	210	7	,	,	PUNCT
afs-147802	210	8	y.	y.	PROPN
afs-147802	210	9	,	,	PUNCT
afs-147802	210	10	cai	cai	PROPN
afs-147802	210	11	,	,	PUNCT
afs-147802	210	12	j.	j.	PROPN
afs-147802	210	13	,	,	PUNCT
afs-147802	210	14	chen	chen	PROPN
afs-147802	210	15	,	,	PUNCT
afs-147802	210	16	y.	y.	PROPN
afs-147802	210	17	&	&	CCONJ
afs-147802	210	18	yuan	yuan	PROPN
afs-147802	210	19	,	,	PUNCT
afs-147802	210	20	s.	s.	PROPN
afs-147802	210	21	2019	2019	NUM
afs-147802	210	22	.	.	PUNCT
afs-147802	211	1	target	target	NOUN
afs-147802	211	2	-	-	PUNCT
afs-147802	211	3	site	site	NOUN
afs-147802	211	4	resistance	resistance	NOUN
afs-147802	211	5	mechanisms	mechanism	NOUN
afs-147802	211	6	to	to	ADP
afs-147802	211	7	tribenuron	tribenuron	NOUN
afs-147802	211	8	-	-	PUNCT
afs-147802	211	9	methyl	methyl	NOUN
afs-147802	211	10	and	and	CCONJ
afs-147802	211	11	cross	cross	ADJ
afs-147802	211	12	-	-	ADJ
afs-147802	211	13	resistance	resistance	ADJ
afs-147802	211	14	patterns	pattern	NOUN
afs-147802	211	15	to	to	ADP
afs-147802	211	16	als	als	VERB
afs-147802	211	17	-	-	PUNCT
afs-147802	211	18	inhibiting	inhibit	VERB
afs-147802	211	19	herbicides	herbicide	NOUN
afs-147802	211	20	of	of	ADP
afs-147802	211	21	catchweed	catchweed	ADJ
afs-147802	211	22	bedstraw	bedstraw	NOUN
afs-147802	211	23	(	(	PUNCT
afs-147802	211	24	galium	galium	NOUN
afs-147802	211	25	aparine	aparine	NOUN
afs-147802	211	26	)	)	PUNCT
afs-147802	211	27	with	with	ADP
afs-147802	211	28	different	different	ADJ
afs-147802	211	29	als	als	NOUN
afs-147802	211	30	mutations	mutation	NOUN
afs-147802	211	31	.	.	PUNCT
afs-147802	212	1	weed	weed	VERB
afs-147802	212	2	science	science	NOUN
afs-147802	212	3	67	67	NUM
afs-147802	212	4	:	:	PUNCT
afs-147802	213	1	183–188	183–188	NUM
afs-147802	213	2	.	.	PUNCT
afs-147802	214	1	https://doi.org/10.1017/wsc.2018.70	https://doi.org/10.1017/wsc.2018.70	DET
afs-147802	214	2	duggleby	duggleby	PROPN
afs-147802	214	3	,	,	PUNCT
afs-147802	214	4	r.g.r	r.g.r	PROPN
afs-147802	214	5	.	.	PROPN
afs-147802	214	6	,	,	PUNCT
afs-147802	214	7	mccourt	mccourt	PROPN
afs-147802	214	8	,	,	PUNCT
afs-147802	214	9	j.a.j	j.a.j	PROPN
afs-147802	214	10	.	.	PUNCT
afs-147802	214	11	&	&	CCONJ
afs-147802	214	12	guddat	guddat	PROPN
afs-147802	214	13	,	,	PUNCT
afs-147802	214	14	l.l.w	l.l.w	PROPN
afs-147802	214	15	.	.	PROPN
afs-147802	214	16	2008	2008	NUM
afs-147802	214	17	.	.	PUNCT
afs-147802	214	18	structure	structure	NOUN
afs-147802	214	19	and	and	CCONJ
afs-147802	214	20	mechanism	mechanism	NOUN
afs-147802	214	21	of	of	ADP
afs-147802	214	22	inhibition	inhibition	NOUN
afs-147802	214	23	of	of	ADP
afs-147802	214	24	plant	plant	NOUN
afs-147802	214	25	acetohydroxyacid	acetohydroxyacid	ADJ
afs-147802	214	26	synthase	synthase	NOUN
afs-147802	214	27	.	.	PUNCT
afs-147802	215	1	plant	plant	NOUN
afs-147802	215	2	physiology	physiology	NOUN
afs-147802	215	3	and	and	CCONJ
afs-147802	215	4	biochemistry	biochemistry	NOUN
afs-147802	215	5	46	46	NUM
afs-147802	215	6	:	:	PUNCT
afs-147802	215	7	309–324	309–324	NUM
afs-147802	215	8	.	.	X
afs-147802	216	1	https://doi.org/10.1016/j.plaphy.2007.12.004	https://doi.org/10.1016/j.plaphy.2007.12.004	NUM
afs-147802	216	2	european	european	ADJ
afs-147802	216	3	herbicide	herbicide	PROPN
afs-147802	216	4	resistance	resistance	PROPN
afs-147802	216	5	committee	committee	PROPN
afs-147802	216	6	2017	2017	NUM
afs-147802	216	7	.	.	PUNCT
afs-147802	217	1	european	european	ADJ
afs-147802	217	2	guidelines	guideline	NOUN
afs-147802	217	3	to	to	PART
afs-147802	217	4	conduct	conduct	VERB
afs-147802	217	5	herbicide	herbicide	NOUN
afs-147802	217	6	resistance	resistance	NOUN
afs-147802	217	7	tests	test	NOUN
afs-147802	217	8	.	.	PUNCT
afs-147802	218	1	15	15	NUM
afs-147802	218	2	p.	p.	NOUN
afs-147802	218	3	gaines	gaines	PROPN
afs-147802	218	4	,	,	PUNCT
afs-147802	218	5	t.a	t.a	PROPN
afs-147802	218	6	.	.	PROPN
afs-147802	218	7	,	,	PUNCT
afs-147802	218	8	duke	duke	PROPN
afs-147802	218	9	,	,	PUNCT
afs-147802	218	10	s.o	s.o	PROPN
afs-147802	218	11	.	.	PROPN
afs-147802	218	12	,	,	PUNCT
afs-147802	218	13	morran	morran	PROPN
afs-147802	218	14	,	,	PUNCT
afs-147802	218	15	s.	s.	PROPN
afs-147802	218	16	,	,	PUNCT
afs-147802	218	17	rigon	rigon	NOUN
afs-147802	218	18	,	,	PUNCT
afs-147802	218	19	c.a.g	c.a.g	PROPN
afs-147802	218	20	.	.	PROPN
afs-147802	218	21	,	,	PUNCT
afs-147802	218	22	tranel	tranel	PROPN
afs-147802	218	23	,	,	PUNCT
afs-147802	218	24	p.j	p.j	PROPN
afs-147802	218	25	.	.	PROPN
afs-147802	218	26	,	,	PUNCT
afs-147802	218	27	küpper	küpper	NOUN
afs-147802	218	28	,	,	PUNCT
afs-147802	218	29	a.	a.	PROPN
afs-147802	218	30	&	&	CCONJ
afs-147802	218	31	dayan	dayan	PROPN
afs-147802	218	32	,	,	PUNCT
afs-147802	218	33	f.e	f.e	PROPN
afs-147802	218	34	.	.	PROPN
afs-147802	218	35	2020	2020	NUM
afs-147802	218	36	.	.	PUNCT
afs-147802	219	1	mechanisms	mechanism	NOUN
afs-147802	219	2	of	of	ADP
afs-147802	219	3	evolved	evolve	VERB
afs-147802	219	4	herbicide	herbicide	NOUN
afs-147802	219	5	resistance	resistance	NOUN
afs-147802	219	6	.	.	PUNCT
afs-147802	220	1	the	the	DET
afs-147802	220	2	journal	journal	NOUN
afs-147802	220	3	of	of	ADP
afs-147802	220	4	biological	biological	ADJ
afs-147802	220	5	chemistry	chemistry	NOUN
afs-147802	220	6	295	295	NUM
afs-147802	220	7	:	:	SYM
afs-147802	220	8	10307–10330	10307–10330	NUM
afs-147802	220	9	.	.	PUNCT
afs-147802	220	10	https://doi.org/10.1074/jbc.rev120.013572	https://doi.org/10.1074/jbc.rev120.013572	NOUN
afs-147802	220	11	gerhards	gerhard	NOUN
afs-147802	220	12	,	,	PUNCT
afs-147802	220	13	r.	r.	PROPN
afs-147802	220	14	,	,	PUNCT
afs-147802	220	15	bezhin	bezhin	PROPN
afs-147802	220	16	,	,	PUNCT
afs-147802	220	17	k.	k.	PROPN
afs-147802	220	18	&	&	CCONJ
afs-147802	220	19	santel	santel	PROPN
afs-147802	220	20	,	,	PUNCT
afs-147802	220	21	h.-j	h.-j	PROPN
afs-147802	220	22	.	.	PROPN
afs-147802	220	23	2017	2017	NUM
afs-147802	220	24	.	.	PUNCT
afs-147802	221	1	sugar	sugar	NOUN
afs-147802	221	2	beet	beet	PROPN
afs-147802	221	3	yield	yield	NOUN
afs-147802	221	4	loss	loss	NOUN
afs-147802	221	5	predicted	predict	VERB
afs-147802	221	6	by	by	ADP
afs-147802	221	7	relative	relative	ADJ
afs-147802	221	8	weed	weed	NOUN
afs-147802	221	9	cover	cover	NOUN
afs-147802	221	10	,	,	PUNCT
afs-147802	221	11	weed	weed	VERB
afs-147802	221	12	biomass	biomass	NOUN
afs-147802	221	13	and	and	CCONJ
afs-147802	221	14	weed	weed	VERB
afs-147802	221	15	density	density	NOUN
afs-147802	221	16	.	.	PUNCT
afs-147802	222	1	plant	plant	NOUN
afs-147802	222	2	protection	protection	NOUN
afs-147802	222	3	science	science	NOUN
afs-147802	222	4	53	53	NUM
afs-147802	222	5	:	:	PUNCT
afs-147802	222	6	118–125	118–125	NUM
afs-147802	222	7	.	.	PUNCT
afs-147802	223	1	https://doi.org/10.17221/57/2016-pps	https://doi.org/10.17221/57/2016-pps	ADJ
afs-147802	223	2	hall	hall	NOUN
afs-147802	223	3	,	,	PUNCT
afs-147802	223	4	t.a	t.a	PROPN
afs-147802	223	5	.	.	PROPN
afs-147802	223	6	1999	1999	NUM
afs-147802	223	7	.	.	PUNCT
afs-147802	224	1	bioedit	bioedit	NOUN
afs-147802	224	2	:	:	PUNCT
afs-147802	224	3	a	a	DET
afs-147802	224	4	user	user	NOUN
afs-147802	224	5	-	-	PUNCT
afs-147802	224	6	friendly	friendly	ADJ
afs-147802	224	7	biological	biological	ADJ
afs-147802	224	8	sequence	sequence	NOUN
afs-147802	224	9	alignment	alignment	NOUN
afs-147802	224	10	editor	editor	NOUN
afs-147802	224	11	and	and	CCONJ
afs-147802	224	12	analysis	analysis	NOUN
afs-147802	224	13	program	program	NOUN
afs-147802	224	14	for	for	ADP
afs-147802	224	15	windows	window	NOUN
afs-147802	224	16	95/98	95/98	NUM
afs-147802	224	17	/	/	SYM
afs-147802	224	18	nt	nt	NOUN
afs-147802	224	19	.	.	PUNCT
afs-147802	225	1	nucleic	nucleic	ADJ
afs-147802	225	2	acids	acid	NOUN
afs-147802	225	3	symposium	symposium	NOUN
afs-147802	225	4	series	series	NOUN
afs-147802	225	5	41	41	NUM
afs-147802	225	6	:	:	PUNCT
afs-147802	225	7	95–98	95–98	NUM
afs-147802	225	8	.	.	PUNCT
afs-147802	226	1	hall	hall	PROPN
afs-147802	226	2	,	,	PUNCT
afs-147802	226	3	l.m	l.m	PROPN
afs-147802	226	4	.	.	PROPN
afs-147802	226	5	&	&	CCONJ
afs-147802	226	6	devine	devine	PROPN
afs-147802	226	7	,	,	PUNCT
afs-147802	226	8	m.d	m.d	PROPN
afs-147802	226	9	.	.	PROPN
afs-147802	226	10	1990	1990	NUM
afs-147802	226	11	.	.	PUNCT
afs-147802	227	1	cross	cross	NOUN
afs-147802	227	2	-	-	NOUN
afs-147802	227	3	resistance	resistance	NOUN
afs-147802	227	4	of	of	ADP
afs-147802	227	5	a	a	DET
afs-147802	227	6	chlorsulfuron	chlorsulfuron	NOUN
afs-147802	227	7	-	-	PUNCT
afs-147802	227	8	resistant	resistant	ADJ
afs-147802	227	9	biotype	biotype	NOUN
afs-147802	227	10	of	of	ADP
afs-147802	227	11	stellaria	stellaria	PROPN
afs-147802	227	12	media	medium	NOUN
afs-147802	227	13	to	to	ADP
afs-147802	227	14	a	a	DET
afs-147802	227	15	triazolopyrimidine	triazolopyrimidine	NOUN
afs-147802	227	16	herbicide	herbicide	NOUN
afs-147802	227	17	.	.	PUNCT
afs-147802	228	1	plant	plant	NOUN
afs-147802	228	2	physiology	physiology	NOUN
afs-147802	228	3	93	93	NUM
afs-147802	228	4	:	:	PUNCT
afs-147802	228	5	962–966	962–966	NUM
afs-147802	228	6	.	.	PUNCT
afs-147802	229	1	https://doi.org/10.1104/pp.93.3.962	https://doi.org/10.1104/pp.93.3.962	PROPN
afs-147802	229	2	hamouzova	hamouzova	PROPN
afs-147802	229	3	,	,	PUNCT
afs-147802	229	4	k.	k.	PROPN
afs-147802	229	5	,	,	PUNCT
afs-147802	229	6	soukup	soukup	PROPN
afs-147802	229	7	,	,	PUNCT
afs-147802	229	8	j.	j.	PROPN
afs-147802	229	9	,	,	PUNCT
afs-147802	229	10	jursik	jursik	PROPN
afs-147802	229	11	,	,	PUNCT
afs-147802	229	12	m.	m.	NOUN
afs-147802	229	13	,	,	PUNCT
afs-147802	229	14	hamouz	hamouz	NOUN
afs-147802	229	15	,	,	PUNCT
afs-147802	229	16	p.	p.	PROPN
afs-147802	229	17	,	,	PUNCT
afs-147802	229	18	venclova	venclova	PROPN
afs-147802	229	19	,	,	PUNCT
afs-147802	229	20	v.	v.	PROPN
afs-147802	229	21	&	&	CCONJ
afs-147802	229	22	tumova	tumova	PROPN
afs-147802	229	23	,	,	PUNCT
afs-147802	229	24	p.	p.	NOUN
afs-147802	229	25	2011	2011	NUM
afs-147802	229	26	.	.	PUNCT
afs-147802	230	1	cross	cross	NOUN
afs-147802	230	2	-	-	NOUN
afs-147802	230	3	resistance	resistance	NOUN
afs-147802	230	4	to	to	ADP
afs-147802	230	5	three	three	NUM
afs-147802	230	6	frequently	frequently	ADV
afs-147802	230	7	used	use	VERB
afs-147802	230	8	sulfonylurea	sulfonylurea	NOUN
afs-147802	230	9	herbicides	herbicide	NOUN
afs-147802	230	10	in	in	ADP
afs-147802	230	11	populations	population	NOUN
afs-147802	230	12	of	of	ADP
afs-147802	230	13	apera	apera	PROPN
afs-147802	230	14	spica	spica	NOUN
afs-147802	230	15	-	-	PUNCT
afs-147802	230	16	venti	venti	NOUN
afs-147802	230	17	from	from	ADP
afs-147802	230	18	the	the	DET
afs-147802	230	19	czech	czech	PROPN
afs-147802	230	20	republic	republic	NOUN
afs-147802	230	21	.	.	PUNCT
afs-147802	231	1	weed	weed	VERB
afs-147802	231	2	research	research	NOUN
afs-147802	231	3	51	51	NUM
afs-147802	231	4	:	:	PUNCT
afs-147802	231	5	113–122	113–122	NUM
afs-147802	231	6	.	.	PUNCT
afs-147802	232	1	https://doi.org/10.1111/j.1365-3180.2010.00828.x	https://doi.org/10.1111/j.1365-3180.2010.00828.x	PROPN
afs-147802	232	2	heap	heap	PROPN
afs-147802	232	3	,	,	PUNCT
afs-147802	232	4	i.	i.	PROPN
afs-147802	232	5	2024	2024	NUM
afs-147802	232	6	.	.	PUNCT
afs-147802	233	1	the	the	DET
afs-147802	233	2	international	international	ADJ
afs-147802	233	3	herbicide	herbicide	NOUN
afs-147802	233	4	-	-	PUNCT
afs-147802	233	5	resistant	resistant	ADJ
afs-147802	233	6	weed	weed	NOUN
afs-147802	233	7	database	database	NOUN
afs-147802	233	8	.	.	PUNCT
afs-147802	234	1	www.weedscience.org	www.weedscience.org	PROPN
afs-147802	234	2	košnarová	košnarová	NOUN
afs-147802	234	3	,	,	PUNCT
afs-147802	234	4	p.	p.	NOUN
afs-147802	234	5	,	,	PUNCT
afs-147802	234	6	hamouz	hamouz	ADJ
afs-147802	234	7	,	,	PUNCT
afs-147802	234	8	p.	p.	PROPN
afs-147802	234	9	,	,	PUNCT
afs-147802	234	10	hamouzová	hamouzová	PROPN
afs-147802	234	11	,	,	PUNCT
afs-147802	234	12	k.	k.	PROPN
afs-147802	234	13	,	,	PUNCT
afs-147802	234	14	linn	linn	PROPN
afs-147802	234	15	,	,	PUNCT
afs-147802	234	16	a.	a.	PROPN
afs-147802	234	17	,	,	PUNCT
afs-147802	234	18	sen	sen	PROPN
afs-147802	234	19	,	,	PUNCT
afs-147802	234	20	m.k	m.k	PROPN
afs-147802	234	21	.	.	PROPN
afs-147802	234	22	,	,	PUNCT
afs-147802	234	23	mikulka	mikulka	PROPN
afs-147802	234	24	,	,	PUNCT
afs-147802	234	25	j.	j.	PROPN
afs-147802	234	26	,	,	PUNCT
afs-147802	234	27	šuk	šuk	PROPN
afs-147802	234	28	,	,	PUNCT
afs-147802	234	29	j.	j.	PROPN
afs-147802	234	30	&	&	CCONJ
afs-147802	234	31	soukup	soukup	PROPN
afs-147802	234	32	,	,	PUNCT
afs-147802	234	33	j.	j.	PROPN
afs-147802	234	34	2021	2021	NUM
afs-147802	234	35	.	.	PUNCT
afs-147802	235	1	apera	apera	PROPN
afs-147802	235	2	spica	spica	PROPN
afs-147802	235	3	-	-	PUNCT
afs-147802	235	4	venti	venti	NOUN
afs-147802	235	5	in	in	ADP
afs-147802	235	6	the	the	DET
afs-147802	235	7	czech	czech	PROPN
afs-147802	235	8	republic	republic	NOUN
afs-147802	235	9	develops	develop	VERB
afs-147802	235	10	resistance	resistance	NOUN
afs-147802	235	11	to	to	ADP
afs-147802	235	12	three	three	NUM
afs-147802	235	13	herbicide	herbicide	NOUN
afs-147802	235	14	modes	mode	NOUN
afs-147802	235	15	of	of	ADP
afs-147802	235	16	action	action	NOUN
afs-147802	235	17	.	.	PUNCT
afs-147802	236	1	weed	weed	VERB
afs-147802	236	2	research	research	NOUN
afs-147802	236	3	61	61	NUM
afs-147802	236	4	:	:	PUNCT
afs-147802	236	5	420–429	420–429	NUM
afs-147802	236	6	.	.	PUNCT
afs-147802	237	1	https://doi.org/10.1111/wre.12500	https://doi.org/10.1111/wre.12500	PROPN
afs-147802	237	2	kraehmer	kraehmer	PROPN
afs-147802	237	3	,	,	PUNCT
afs-147802	237	4	h.	h.	PROPN
afs-147802	237	5	,	,	PUNCT
afs-147802	237	6	laber	laber	PROPN
afs-147802	237	7	,	,	PUNCT
afs-147802	237	8	b.	b.	PROPN
afs-147802	237	9	,	,	PUNCT
afs-147802	237	10	rosinger	rosinger	NOUN
afs-147802	237	11	,	,	PUNCT
afs-147802	237	12	c.	c.	PROPN
afs-147802	237	13	&	&	CCONJ
afs-147802	237	14	schulz	schulz	PROPN
afs-147802	237	15	,	,	PUNCT
afs-147802	237	16	a.	a.	NOUN
afs-147802	237	17	2014	2014	NUM
afs-147802	237	18	.	.	PUNCT
afs-147802	238	1	herbicides	herbicide	NOUN
afs-147802	238	2	as	as	ADP
afs-147802	238	3	weed	weed	NOUN
afs-147802	238	4	control	control	NOUN
afs-147802	238	5	agents	agent	NOUN
afs-147802	238	6	:	:	PUNCT
afs-147802	238	7	state	state	NOUN
afs-147802	238	8	of	of	ADP
afs-147802	238	9	the	the	DET
afs-147802	238	10	art	art	NOUN
afs-147802	238	11	:	:	PUNCT
afs-147802	238	12	i.	i.	NOUN
afs-147802	238	13	weed	weed	PROPN
afs-147802	238	14	control	control	NOUN
afs-147802	238	15	research	research	NOUN
afs-147802	238	16	and	and	CCONJ
afs-147802	238	17	safener	safener	NOUN
afs-147802	238	18	technology	technology	PROPN
afs-147802	238	19	:	:	PUNCT
afs-147802	238	20	the	the	DET
afs-147802	238	21	path	path	NOUN
afs-147802	238	22	to	to	ADP
afs-147802	238	23	modern	modern	ADJ
afs-147802	238	24	agriculture	agriculture	NOUN
afs-147802	238	25	.	.	PUNCT
afs-147802	239	1	plant	plant	NOUN
afs-147802	239	2	physiology	physiology	NOUN
afs-147802	239	3	166	166	NUM
afs-147802	239	4	:	:	PUNCT
afs-147802	239	5	1119–1131	1119–1131	NUM
afs-147802	239	6	.	.	PUNCT
afs-147802	240	1	https://doi.org/10.1104/pp.114.241901	https://doi.org/10.1104/pp.114.241901	PROPN
afs-147802	240	2	kudsk	kudsk	PROPN
afs-147802	240	3	,	,	PUNCT
afs-147802	240	4	p.	p.	NOUN
afs-147802	240	5	,	,	PUNCT
afs-147802	240	6	mathiassen	mathiassen	PROPN
afs-147802	240	7	,	,	PUNCT
afs-147802	240	8	s.k	s.k	PROPN
afs-147802	240	9	.	.	PROPN
afs-147802	240	10	&	&	CCONJ
afs-147802	240	11	cotterman	cotterman	PROPN
afs-147802	240	12	,	,	PUNCT
afs-147802	240	13	j.c	j.c	PROPN
afs-147802	240	14	.	.	PROPN
afs-147802	240	15	1995	1995	NUM
afs-147802	240	16	.	.	PUNCT
afs-147802	241	1	sulfonylurea	sulfonylurea	PROPN
afs-147802	241	2	resistance	resistance	NOUN
afs-147802	241	3	in	in	ADP
afs-147802	241	4	stellaria	stellaria	NOUN
afs-147802	241	5	media	medium	NOUN
afs-147802	241	6	[	[	X
afs-147802	241	7	l.	l.	X
afs-147802	241	8	]	]	PUNCT
afs-147802	241	9	vill	vill	NOUN
afs-147802	241	10	.	.	PUNCT
afs-147802	242	1	weed	weed	VERB
afs-147802	242	2	research	research	NOUN
afs-147802	242	3	35	35	NUM
afs-147802	242	4	:	:	PUNCT
afs-147802	242	5	19–24	19–24	NUM
afs-147802	242	6	.	.	PUNCT
afs-147802	243	1	https://doi.org/10.1111/j.1365-3180.1995.tb02012.x	https://doi.org/10.1111/j.1365-3180.1995.tb02012.x	PROPN
afs-147802	243	2	laforest	lafor	ADJ
afs-147802	243	3	,	,	PUNCT
afs-147802	243	4	m.	m.	NOUN
afs-147802	243	5	&	&	CCONJ
afs-147802	243	6	soufiane	soufiane	PROPN
afs-147802	243	7	,	,	PUNCT
afs-147802	243	8	b.	b.	PROPN
afs-147802	243	9	2018	2018	NUM
afs-147802	243	10	.	.	PUNCT
afs-147802	244	1	coevolution	coevolution	NOUN
afs-147802	244	2	of	of	ADP
afs-147802	244	3	two	two	NUM
afs-147802	244	4	sulfonylurea	sulfonylurea	NOUN
afs-147802	244	5	-	-	PUNCT
afs-147802	244	6	resistant	resistant	ADJ
afs-147802	244	7	common	common	ADJ
afs-147802	244	8	chickweed	chickweed	NOUN
afs-147802	244	9	(	(	PUNCT
afs-147802	244	10	stellaria	stellaria	NOUN
afs-147802	244	11	media	medium	NOUN
afs-147802	244	12	)	)	PUNCT
afs-147802	244	13	biotypes	biotype	NOUN
afs-147802	244	14	with	with	ADP
afs-147802	244	15	different	different	ADJ
afs-147802	244	16	mutations	mutation	NOUN
afs-147802	244	17	in	in	ADP
afs-147802	244	18	the	the	DET
afs-147802	244	19	acetolactate	acetolactate	NOUN
afs-147802	244	20	synthase	synthase	NOUN
afs-147802	244	21	gene	gene	NOUN
afs-147802	244	22	.	.	PUNCT
afs-147802	245	1	weed	weed	VERB
afs-147802	245	2	science	science	NOUN
afs-147802	245	3	66	66	NUM
afs-147802	245	4	:	:	PUNCT
afs-147802	245	5	439–445	439–445	NUM
afs-147802	245	6	.	.	PUNCT
afs-147802	246	1	https://doi.org/10.1017/wsc.2018.26	https://doi.org/10.1017/wsc.2018.26	X
afs-147802	246	2	linn	linn	PROPN
afs-147802	246	3	,	,	PUNCT
afs-147802	246	4	a.i	a.i	PROPN
afs-147802	246	5	.	.	PROPN
afs-147802	246	6	,	,	PUNCT
afs-147802	246	7	mink	mink	PROPN
afs-147802	246	8	,	,	PUNCT
afs-147802	246	9	r.	r.	PROPN
afs-147802	246	10	,	,	PUNCT
afs-147802	246	11	peteinatos	peteinato	NOUN
afs-147802	246	12	,	,	PUNCT
afs-147802	246	13	g.g	g.g	PROPN
afs-147802	246	14	.	.	PROPN
afs-147802	246	15	&	&	CCONJ
afs-147802	246	16	gerhards	gerhard	NOUN
afs-147802	246	17	,	,	PUNCT
afs-147802	246	18	r.	r.	PROPN
afs-147802	246	19	2019	2019	NUM
afs-147802	246	20	.	.	PUNCT
afs-147802	247	1	in	in	ADP
afs-147802	247	2	-	-	PUNCT
afs-147802	247	3	field	field	NOUN
afs-147802	247	4	classification	classification	NOUN
afs-147802	247	5	of	of	ADP
afs-147802	247	6	herbicide	herbicide	NOUN
afs-147802	247	7	-	-	PUNCT
afs-147802	247	8	resistant	resistant	ADJ
afs-147802	247	9	papaver	papaver	NOUN
afs-147802	247	10	rhoeas	rhoea	NOUN
afs-147802	247	11	and	and	CCONJ
afs-147802	247	12	stellaria	stellaria	NOUN
afs-147802	247	13	media	medium	NOUN
afs-147802	247	14	using	use	VERB
afs-147802	247	15	an	an	DET
afs-147802	247	16	imaging	imaging	NOUN
afs-147802	247	17	sensor	sensor	NOUN
afs-147802	247	18	of	of	ADP
afs-147802	247	19	the	the	DET
afs-147802	247	20	maximum	maximum	ADJ
afs-147802	247	21	quantum	quantum	ADJ
afs-147802	247	22	efficiency	efficiency	NOUN
afs-147802	247	23	of	of	ADP
afs-147802	247	24	photosystem	photosystem	PROPN
afs-147802	247	25	ii	ii	PROPN
afs-147802	247	26	.	.	PUNCT
afs-147802	247	27	weed	weed	VERB
afs-147802	247	28	research	research	NOUN
afs-147802	247	29	59	59	NUM
afs-147802	247	30	:	:	PUNCT
afs-147802	247	31	357–366	357–366	NUM
afs-147802	247	32	.	.	PUNCT
afs-147802	248	1	https://doi.org/10.1111/wre.12374	https://doi.org/10.1111/wre.12374	PROPN
afs-147802	248	2	loubet	loubet	PROPN
afs-147802	248	3	,	,	PUNCT
afs-147802	248	4	i.	i.	PROPN
afs-147802	248	5	,	,	PUNCT
afs-147802	248	6	meyer	meyer	PROPN
afs-147802	248	7	,	,	PUNCT
afs-147802	248	8	l.	l.	PROPN
afs-147802	248	9	,	,	PUNCT
afs-147802	248	10	michel	michel	PROPN
afs-147802	248	11	,	,	PUNCT
afs-147802	248	12	s.	s.	PROPN
afs-147802	248	13	,	,	PUNCT
afs-147802	248	14	pernin	pernin	PROPN
afs-147802	248	15	,	,	PUNCT
afs-147802	248	16	f.	f.	PROPN
afs-147802	248	17	,	,	PUNCT
afs-147802	248	18	carrère	carrère	PROPN
afs-147802	248	19	,	,	PUNCT
afs-147802	248	20	s.	s.	PROPN
afs-147802	248	21	,	,	PUNCT
afs-147802	248	22	barrès	barrès	PROPN
afs-147802	248	23	,	,	PUNCT
afs-147802	248	24	b.	b.	PROPN
afs-147802	248	25	,	,	PUNCT
afs-147802	248	26	le	le	X
afs-147802	248	27	corre	corre	X
afs-147802	248	28	,	,	PUNCT
afs-147802	248	29	v.	v.	PROPN
afs-147802	248	30	&	&	CCONJ
afs-147802	248	31	délye	délye	PROPN
afs-147802	248	32	,	,	PUNCT
afs-147802	248	33	c.	c.	PROPN
afs-147802	248	34	2023	2023	NUM
afs-147802	248	35	.	.	PUNCT
afs-147802	249	1	a	a	DET
afs-147802	249	2	high	high	ADJ
afs-147802	249	3	diversity	diversity	NOUN
afs-147802	249	4	of	of	ADP
afs-147802	249	5	non	non	ADJ
afs-147802	249	6	-	-	ADJ
afs-147802	249	7	target	target	ADJ
afs-147802	249	8	site	site	NOUN
afs-147802	249	9	resistance	resistance	NOUN
afs-147802	249	10	mechanisms	mechanism	NOUN
afs-147802	249	11	to	to	PART
afs-147802	249	12	acetolactate	acetolactate	VERB
afs-147802	249	13	-	-	PUNCT
afs-147802	249	14	synthase	synthase	NOUN
afs-147802	249	15	(	(	PUNCT
afs-147802	249	16	als	als	NOUN
afs-147802	249	17	)	)	PUNCT
afs-147802	249	18	inhibiting	inhibit	VERB
afs-147802	249	19	herbicides	herbicide	NOUN
afs-147802	249	20	has	have	AUX
afs-147802	249	21	evolved	evolve	VERB
afs-147802	249	22	within	within	ADP
afs-147802	249	23	and	and	CCONJ
afs-147802	249	24	among	among	ADP
afs-147802	249	25	field	field	NOUN
afs-147802	249	26	populations	population	NOUN
afs-147802	249	27	of	of	ADP
afs-147802	249	28	common	common	ADJ
afs-147802	249	29	ragweed	ragweed	NOUN
afs-147802	249	30	(	(	PUNCT
afs-147802	249	31	ambrosia	ambrosia	PROPN
afs-147802	249	32	artemisiifolia	artemisiifolia	PROPN
afs-147802	249	33	l.	l.	PROPN
afs-147802	249	34	)	)	PUNCT
afs-147802	249	35	.	.	PUNCT
afs-147802	250	1	bmc	bmc	ADJ
afs-147802	250	2	plant	plant	NOUN
afs-147802	250	3	biology	biology	NOUN
afs-147802	250	4	23	23	NUM
afs-147802	250	5	:	:	SYM
afs-147802	250	6	510	510	NUM
afs-147802	250	7	.	.	PUNCT
afs-147802	250	8	https://doi.org/10.1186/s12870-023-04524-0	https://doi.org/10.1186/s12870-023-04524-0	NUM
afs-147802	250	9	madsen	madsen	PROPN
afs-147802	250	10	,	,	PUNCT
afs-147802	250	11	h.	h.	PROPN
afs-147802	250	12	,	,	PUNCT
afs-147802	250	13	luik	luik	PROPN
afs-147802	250	14	,	,	PUNCT
afs-147802	250	15	a.	a.	NOUN
afs-147802	250	16	,	,	PUNCT
afs-147802	250	17	eremeev	eremeev	PROPN
afs-147802	250	18	,	,	PUNCT
afs-147802	250	19	v.	v.	ADV
afs-147802	250	20	,	,	PUNCT
afs-147802	250	21	mäeorg	mäeorg	PROPN
afs-147802	250	22	,	,	PUNCT
afs-147802	250	23	e.	e.	PROPN
afs-147802	250	24	&	&	CCONJ
afs-147802	250	25	talgre	talgre	PROPN
afs-147802	250	26	,	,	PUNCT
afs-147802	250	27	l.	l.	PROPN
afs-147802	250	28	2023	2023	NUM
afs-147802	250	29	.	.	PUNCT
afs-147802	251	1	umbrohtude	umbrohtude	PROPN
afs-147802	251	2	biomassi	biomassi	PROPN
afs-147802	251	3	,	,	PUNCT
afs-147802	251	4	arvukuse	arvukuse	PROPN
afs-147802	251	5	ja	ja	PROPN
afs-147802	251	6	mitmekesisuse	mitmekesisuse	PROPN
afs-147802	251	7	muutused	muutuse	VERB
afs-147802	251	8	pikaajalise	pikaajalise	PROPN
afs-147802	251	9	külvikorra	külvikorra	PROPN
afs-147802	251	10	katse	katse	VERB
afs-147802	251	11	teises	teise	VERB
afs-147802	251	12	rotatsioonis	rotatsioonis	PROPN
afs-147802	251	13	.	.	PROPN
afs-147802	252	1	agraarteadus	agraarteadus	PROPN
afs-147802	253	1	xxxiv	xxxiv	PROPN
afs-147802	254	1	:	:	PUNCT
afs-147802	255	1	18–30	18–30	NUM
afs-147802	255	2	.	.	PUNCT
afs-147802	256	1	(	(	PUNCT
afs-147802	256	2	in	in	ADP
afs-147802	256	3	estonian	estonian	ADJ
afs-147802	256	4	)	)	PUNCT
afs-147802	256	5	.	.	PUNCT
afs-147802	257	1	marshall	marshall	PROPN
afs-147802	257	2	,	,	PUNCT
afs-147802	257	3	r.	r.	PROPN
afs-147802	257	4	,	,	PUNCT
afs-147802	257	5	hull	hull	NOUN
afs-147802	257	6	,	,	PUNCT
afs-147802	257	7	r.	r.	PROPN
afs-147802	257	8	&	&	CCONJ
afs-147802	257	9	moss	moss	PROPN
afs-147802	257	10	,	,	PUNCT
afs-147802	257	11	s.r	s.r	PROPN
afs-147802	257	12	.	.	PROPN
afs-147802	257	13	2010	2010	NUM
afs-147802	257	14	.	.	PUNCT
afs-147802	258	1	target	target	NOUN
afs-147802	258	2	site	site	NOUN
afs-147802	258	3	resistance	resistance	NOUN
afs-147802	258	4	to	to	PART
afs-147802	258	5	als	als	VERB
afs-147802	258	6	inhibiting	inhibit	VERB
afs-147802	258	7	herbicides	herbicide	NOUN
afs-147802	258	8	in	in	ADP
afs-147802	258	9	papaver	papaver	PROPN
afs-147802	258	10	rhoeas	rhoea	NOUN
afs-147802	258	11	and	and	CCONJ
afs-147802	258	12	stellaria	stellaria	NOUN
afs-147802	258	13	media	medium	NOUN
afs-147802	258	14	biotypes	biotype	NOUN
afs-147802	258	15	from	from	ADP
afs-147802	258	16	the	the	DET
afs-147802	258	17	uk	uk	PROPN
afs-147802	258	18	.	.	PROPN
afs-147802	258	19	weed	weed	VERB
afs-147802	258	20	research	research	NOUN
afs-147802	258	21	50	50	NUM
afs-147802	258	22	:	:	PUNCT
afs-147802	258	23	621–630	621–630	NUM
afs-147802	258	24	.	.	PUNCT
afs-147802	259	1	https://doi.org/10.1111/j.1365-3180.2010.00813.x	https://doi.org/10.1111/j.1365-3180.2010.00813.x	PROPN
afs-147802	259	2	maxwell	maxwell	PROPN
afs-147802	259	3	,	,	PUNCT
afs-147802	259	4	k.	k.	PROPN
afs-147802	259	5	&	&	CCONJ
afs-147802	259	6	johnson	johnson	PROPN
afs-147802	259	7	,	,	PUNCT
afs-147802	259	8	g.n	g.n	PROPN
afs-147802	259	9	.	.	PROPN
afs-147802	259	10	2000	2000	NUM
afs-147802	259	11	.	.	PUNCT
afs-147802	260	1	chlorophyll	chlorophyll	NOUN
afs-147802	260	2	fluorescence	fluorescence	NOUN
afs-147802	260	3	-	-	PUNCT
afs-147802	260	4	a	a	DET
afs-147802	260	5	practical	practical	ADJ
afs-147802	260	6	guide	guide	NOUN
afs-147802	260	7	.	.	PUNCT
afs-147802	261	1	journal	journal	NOUN
afs-147802	261	2	of	of	ADP
afs-147802	261	3	experimental	experimental	ADJ
afs-147802	261	4	botany	botany	NOUN
afs-147802	261	5	51	51	NUM
afs-147802	261	6	:	:	PUNCT
afs-147802	261	7	659–668	659–668	NUM
afs-147802	261	8	.	.	PUNCT
afs-147802	262	1	https://doi.org/10.1093/jexbot/51.345.659	https://doi.org/10.1093/jexbot/51.345.659	PROPN
afs-147802	262	2	meier	meier	PROPN
afs-147802	262	3	,	,	PUNCT
afs-147802	262	4	u.	u.	PROPN
afs-147802	262	5	2001	2001	NUM
afs-147802	262	6	.	.	PUNCT
afs-147802	263	1	growth	growth	NOUN
afs-147802	263	2	stages	stage	NOUN
afs-147802	263	3	of	of	ADP
afs-147802	263	4	monoand	monoand	ADJ
afs-147802	263	5	dicotyledonous	dicotyledonous	ADJ
afs-147802	263	6	plants	plant	NOUN
afs-147802	263	7	.	.	PUNCT
afs-147802	264	1	bbch	bbch	NOUN
afs-147802	264	2	monograph	monograph	PROPN
afs-147802	264	3	,	,	PUNCT
afs-147802	264	4	2nd	2nd	PROPN
afs-147802	264	5	ed	ed	NOUN
afs-147802	264	6	.	.	PUNCT
afs-147802	265	1	federal	federal	ADJ
afs-147802	265	2	biological	biological	ADJ
afs-147802	265	3	research	research	NOUN
afs-147802	265	4	centre	centre	NOUN
afs-147802	265	5	for	for	ADP
afs-147802	265	6	agriculture	agriculture	NOUN
afs-147802	265	7	and	and	CCONJ
afs-147802	265	8	forestry	forestry	NOUN
afs-147802	265	9	,	,	PUNCT
afs-147802	265	10	bonn	bonn	PROPN
afs-147802	265	11	.	.	PUNCT
afs-147802	265	12	doi:10.5073	doi:10.5073	PROPN
afs-147802	265	13	/	/	PUNCT
afs-147802	265	14	bbch0515	bbch0515	PROPN
afs-147802	265	15	s.	s.	PROPN
afs-147802	265	16	pihu	pihu	PROPN
afs-147802	265	17	et	et	PROPN
afs-147802	265	18	al	al	PROPN
afs-147802	265	19	.	.	PROPN
afs-147802	266	1	60	60	NUM
afs-147802	266	2	preston	preston	PROPN
afs-147802	266	3	,	,	PUNCT
afs-147802	266	4	c.	c.	PROPN
afs-147802	266	5	2004	2004	NUM
afs-147802	266	6	.	.	PUNCT
afs-147802	267	1	herbicide	herbicide	NOUN
afs-147802	267	2	resistance	resistance	NOUN
afs-147802	267	3	in	in	ADP
afs-147802	267	4	weeds	weed	NOUN
afs-147802	267	5	endowed	endow	VERB
afs-147802	267	6	by	by	ADP
afs-147802	267	7	enhanced	enhanced	ADJ
afs-147802	267	8	detoxification	detoxification	NOUN
afs-147802	267	9	:	:	PUNCT
afs-147802	267	10	complications	complication	NOUN
afs-147802	267	11	for	for	ADP
afs-147802	267	12	management	management	NOUN
afs-147802	267	13	.	.	PUNCT
afs-147802	268	1	weed	weed	VERB
afs-147802	268	2	science	science	NOUN
afs-147802	268	3	52:448–453	52:448–453	NUM
afs-147802	268	4	.	.	PUNCT
afs-147802	269	1	https://doi.org/10.1614/p2002-168b	https://doi.org/10.1614/p2002-168b	NOUN
afs-147802	269	2	r	r	NOUN
afs-147802	269	3	core	core	NOUN
afs-147802	269	4	team	team	NOUN
afs-147802	269	5	2023	2023	NUM
afs-147802	269	6	.	.	PUNCT
afs-147802	270	1	r	r	X
afs-147802	270	2	:	:	PUNCT
afs-147802	270	3	a	a	DET
afs-147802	270	4	language	language	NOUN
afs-147802	270	5	and	and	CCONJ
afs-147802	270	6	environment	environment	NOUN
afs-147802	270	7	for	for	ADP
afs-147802	270	8	statistical	statistical	ADJ
afs-147802	270	9	computing	computing	NOUN
afs-147802	270	10	.	.	PUNCT
afs-147802	271	1	ritz	ritz	PROPN
afs-147802	271	2	,	,	PUNCT
afs-147802	271	3	c.	c.	PROPN
afs-147802	271	4	,	,	PUNCT
afs-147802	271	5	baty	baty	PROPN
afs-147802	271	6	,	,	PUNCT
afs-147802	271	7	f.	f.	PROPN
afs-147802	271	8	,	,	PUNCT
afs-147802	271	9	streibig	streibig	PROPN
afs-147802	271	10	,	,	PUNCT
afs-147802	271	11	j.c	j.c	PROPN
afs-147802	271	12	.	.	PROPN
afs-147802	271	13	&	&	CCONJ
afs-147802	271	14	gerhard	gerhard	PROPN
afs-147802	271	15	,	,	PUNCT
afs-147802	271	16	d.	d.	PROPN
afs-147802	271	17	2015	2015	NUM
afs-147802	271	18	.	.	PUNCT
afs-147802	272	1	dose	dose	NOUN
afs-147802	272	2	-	-	PUNCT
afs-147802	272	3	response	response	NOUN
afs-147802	272	4	analysis	analysis	NOUN
afs-147802	272	5	using	use	VERB
afs-147802	272	6	r.	r.	PROPN
afs-147802	272	7	plos	plos	PROPN
afs-147802	273	1	one	one	NUM
afs-147802	273	2	10	10	NUM
afs-147802	273	3	:	:	PUNCT
afs-147802	273	4	e0146021	e0146021	NOUN
afs-147802	273	5	.	.	PUNCT
afs-147802	274	1	https://doi.org/10.1371/	https://doi.org/10.1371/	PROPN
afs-147802	274	2	journal.pone.0146021	journal.pone.0146021	PROPN
afs-147802	274	3	ritz	ritz	PROPN
afs-147802	274	4	,	,	PUNCT
afs-147802	274	5	c.	c.	PROPN
afs-147802	274	6	&	&	CCONJ
afs-147802	274	7	streibig	streibig	PROPN
afs-147802	274	8	,	,	PUNCT
afs-147802	274	9	j.c	j.c	PROPN
afs-147802	274	10	.	.	PROPN
afs-147802	274	11	2022	2022	NUM
afs-147802	274	12	.	.	PUNCT
afs-147802	275	1	package	package	NOUN
afs-147802	275	2	‘	'	PUNCT
afs-147802	275	3	drc	drc	PROPN
afs-147802	275	4	’	'	PUNCT
afs-147802	275	5	.	.	PUNCT
afs-147802	276	1	analysis	analysis	NOUN
afs-147802	276	2	of	of	ADP
afs-147802	276	3	dose	dose	NOUN
afs-147802	276	4	-	-	PUNCT
afs-147802	276	5	response	response	NOUN
afs-147802	276	6	curves	curve	NOUN
afs-147802	276	7	.	.	PUNCT
afs-147802	277	1	sanger	sanger	PROPN
afs-147802	277	2	,	,	PUNCT
afs-147802	277	3	f.	f.	PROPN
afs-147802	277	4	,	,	PUNCT
afs-147802	277	5	nicklen	nicklen	PROPN
afs-147802	277	6	,	,	PUNCT
afs-147802	277	7	s.	s.	PROPN
afs-147802	277	8	&	&	CCONJ
afs-147802	277	9	coulson	coulson	PROPN
afs-147802	277	10	,	,	PUNCT
afs-147802	277	11	a.r	a.r	PROPN
afs-147802	277	12	.	.	PROPN
afs-147802	277	13	1977	1977	NUM
afs-147802	277	14	.	.	PUNCT
afs-147802	278	1	dna	dna	PROPN
afs-147802	278	2	sequencing	sequence	VERB
afs-147802	278	3	with	with	ADP
afs-147802	278	4	chain	chain	NOUN
afs-147802	278	5	-	-	PUNCT
afs-147802	278	6	terminating	terminate	VERB
afs-147802	278	7	inhibitors	inhibitor	NOUN
afs-147802	278	8	.	.	PUNCT
afs-147802	279	1	proceedings	proceeding	NOUN
afs-147802	279	2	of	of	ADP
afs-147802	279	3	the	the	DET
afs-147802	279	4	national	national	PROPN
afs-147802	279	5	academy	academy	PROPN
afs-147802	279	6	of	of	ADP
afs-147802	279	7	sciences	science	NOUN
afs-147802	279	8	74	74	NUM
afs-147802	279	9	:	:	SYM
afs-147802	279	10	5463–5467	5463–5467	NUM
afs-147802	279	11	.	.	PUNCT
afs-147802	280	1	https://doi.org/10.1073/pnas.74.12.5463	https://doi.org/10.1073/pnas.74.12.5463	PROPN
afs-147802	280	2	sibony	sibony	NOUN
afs-147802	280	3	,	,	PUNCT
afs-147802	280	4	m.	m.	NOUN
afs-147802	280	5	,	,	PUNCT
afs-147802	280	6	michel	michel	PROPN
afs-147802	280	7	,	,	PUNCT
afs-147802	280	8	a.	a.	PROPN
afs-147802	280	9	,	,	PUNCT
afs-147802	280	10	haas	haas	PROPN
afs-147802	280	11	,	,	PUNCT
afs-147802	280	12	h.u	h.u	PROPN
afs-147802	280	13	.	.	PROPN
afs-147802	280	14	,	,	PUNCT
afs-147802	280	15	rubin	rubin	PROPN
afs-147802	280	16	,	,	PUNCT
afs-147802	280	17	b.	b.	PROPN
afs-147802	280	18	&	&	CCONJ
afs-147802	280	19	hurle	hurle	PROPN
afs-147802	280	20	,	,	PUNCT
afs-147802	280	21	k.	k.	PROPN
afs-147802	280	22	2001	2001	NUM
afs-147802	280	23	.	.	PUNCT
afs-147802	281	1	sulfometuron	sulfometuron	NOUN
afs-147802	281	2	-	-	PUNCT
afs-147802	281	3	resistant	resistant	ADJ
afs-147802	281	4	amaranthus	amaranthus	NOUN
afs-147802	281	5	retroflexus	retroflexus	NOUN
afs-147802	281	6	:	:	PUNCT
afs-147802	281	7	cross	cross	NOUN
afs-147802	281	8	-	-	NOUN
afs-147802	281	9	resistance	resistance	NOUN
afs-147802	281	10	and	and	CCONJ
afs-147802	281	11	molecular	molecular	ADJ
afs-147802	281	12	basis	basis	NOUN
afs-147802	281	13	for	for	SCONJ
afs-147802	281	14	resistance	resistance	NOUN
afs-147802	281	15	to	to	PART
afs-147802	281	16	acetolactate	acetolactate	VERB
afs-147802	281	17	synthase	synthase	NOUN
afs-147802	281	18	-	-	PUNCT
afs-147802	281	19	inhibiting	inhibit	VERB
afs-147802	281	20	herbicides	herbicide	NOUN
afs-147802	281	21	.	.	PUNCT
afs-147802	282	1	weed	weed	NOUN
afs-147802	282	2	research	research	NOUN
afs-147802	282	3	41	41	NUM
afs-147802	282	4	:	:	PUNCT
afs-147802	282	5	509–522	509–522	NUM
afs-147802	282	6	.	.	PUNCT
afs-147802	283	1	https://doi.org/10.1046/j.1365-3180.2001.00254.x	https://doi.org/10.1046/j.1365-3180.2001.00254.x	PROPN
afs-147802	283	2	soltani	soltani	PROPN
afs-147802	283	3	,	,	PUNCT
afs-147802	283	4	n.	n.	NOUN
afs-147802	283	5	,	,	PUNCT
afs-147802	283	6	dille	dille	NOUN
afs-147802	283	7	,	,	PUNCT
afs-147802	283	8	j.a	j.a	PROPN
afs-147802	283	9	.	.	PROPN
afs-147802	283	10	,	,	PUNCT
afs-147802	283	11	burke	burke	PROPN
afs-147802	283	12	,	,	PUNCT
afs-147802	283	13	i.c	i.c	PROPN
afs-147802	283	14	.	.	PROPN
afs-147802	283	15	,	,	PUNCT
afs-147802	283	16	everman	everman	NOUN
afs-147802	283	17	,	,	PUNCT
afs-147802	283	18	w.j	w.j	PROPN
afs-147802	283	19	.	.	PROPN
afs-147802	283	20	,	,	PUNCT
afs-147802	283	21	vangessel	vangessel	PROPN
afs-147802	283	22	,	,	PUNCT
afs-147802	283	23	m.j	m.j	PROPN
afs-147802	283	24	.	.	PROPN
afs-147802	283	25	,	,	PUNCT
afs-147802	283	26	davis	davis	PROPN
afs-147802	283	27	,	,	PUNCT
afs-147802	283	28	v.m	v.m	PROPN
afs-147802	283	29	.	.	PROPN
afs-147802	283	30	&	&	CCONJ
afs-147802	283	31	sikkema	sikkema	PROPN
afs-147802	283	32	,	,	PUNCT
afs-147802	283	33	p.h	p.h	PROPN
afs-147802	283	34	.	.	PROPN
afs-147802	283	35	2016	2016	NUM
afs-147802	283	36	.	.	PUNCT
afs-147802	284	1	potential	potential	ADJ
afs-147802	284	2	corn	corn	NOUN
afs-147802	284	3	yield	yield	NOUN
afs-147802	284	4	losses	loss	NOUN
afs-147802	284	5	from	from	ADP
afs-147802	284	6	weeds	weed	NOUN
afs-147802	284	7	in	in	ADP
afs-147802	284	8	north	north	PROPN
afs-147802	284	9	america	america	PROPN
afs-147802	284	10	.	.	PUNCT
afs-147802	285	1	weed	weed	VERB
afs-147802	285	2	technology	technology	NOUN
afs-147802	285	3	30	30	NUM
afs-147802	285	4	:	:	PUNCT
afs-147802	286	1	979–984	979–984	NUM
afs-147802	286	2	.	.	PUNCT
afs-147802	286	3	https://doi.org/10.1614/wt-d-16-00046.1	https://doi.org/10.1614/wt-d-16-00046.1	ADJ
afs-147802	286	4	statistical	statistical	ADJ
afs-147802	286	5	database	database	NOUN
afs-147802	286	6	2023	2023	NUM
afs-147802	286	7	.	.	PUNCT
afs-147802	287	1	statistics	statistics	PROPN
afs-147802	287	2	estonia	estonia	PROPN
afs-147802	287	3	.	.	PUNCT
afs-147802	288	1	https://andmed.stat.ee/en/stat	https://andmed.stat.ee/en/stat	PROPN
afs-147802	288	2	talgre	talgre	PROPN
afs-147802	288	3	,	,	PUNCT
afs-147802	288	4	l.	l.	PROPN
afs-147802	288	5	,	,	PUNCT
afs-147802	288	6	lauringson	lauringson	PROPN
afs-147802	288	7	,	,	PUNCT
afs-147802	288	8	e.	e.	PROPN
afs-147802	288	9	&	&	CCONJ
afs-147802	288	10	koppel	koppel	PROPN
afs-147802	288	11	,	,	PUNCT
afs-147802	288	12	m.	m.	NOUN
afs-147802	288	13	2008	2008	NUM
afs-147802	288	14	.	.	PUNCT
afs-147802	289	1	effect	effect	NOUN
afs-147802	289	2	of	of	ADP
afs-147802	289	3	reduced	reduce	VERB
afs-147802	289	4	herbicide	herbicide	NOUN
afs-147802	289	5	dosages	dosage	NOUN
afs-147802	289	6	on	on	ADP
afs-147802	289	7	weed	weed	NOUN
afs-147802	289	8	infestation	infestation	NOUN
afs-147802	289	9	in	in	ADP
afs-147802	289	10	spring	spring	NOUN
afs-147802	289	11	barley	barley	NOUN
afs-147802	289	12	.	.	PUNCT
afs-147802	290	1	zemdirbyste	zemdirbyste	NOUN
afs-147802	290	2	-	-	PUNCT
afs-147802	290	3	agriculture	agriculture	NOUN
afs-147802	290	4	95	95	NUM
afs-147802	290	5	:	:	PUNCT
afs-147802	291	1	194–201	194–201	NUM
afs-147802	291	2	.	.	PUNCT
afs-147802	292	1	tamura	tamura	PROPN
afs-147802	292	2	,	,	PUNCT
afs-147802	292	3	k.	k.	PROPN
afs-147802	292	4	,	,	PUNCT
afs-147802	292	5	stecher	stecher	PROPN
afs-147802	292	6	,	,	PUNCT
afs-147802	292	7	g.	g.	PROPN
afs-147802	292	8	&	&	CCONJ
afs-147802	292	9	kumar	kumar	PROPN
afs-147802	292	10	,	,	PUNCT
afs-147802	292	11	s.	s.	PROPN
afs-147802	292	12	2021	2021	NUM
afs-147802	292	13	.	.	PUNCT
afs-147802	293	1	mega11	mega11	NOUN
afs-147802	293	2	:	:	PUNCT
afs-147802	293	3	molecular	molecular	ADJ
afs-147802	293	4	evolutionary	evolutionary	ADJ
afs-147802	293	5	genetics	genetic	NOUN
afs-147802	293	6	analysis	analysis	NOUN
afs-147802	293	7	version	version	NOUN
afs-147802	293	8	11	11	NUM
afs-147802	293	9	.	.	PUNCT
afs-147802	294	1	molecular	molecular	ADJ
afs-147802	294	2	biology	biology	NOUN
afs-147802	294	3	and	and	CCONJ
afs-147802	294	4	evolution	evolution	NOUN
afs-147802	294	5	38	38	NUM
afs-147802	294	6	:	:	PUNCT
afs-147802	294	7	3022–3027	3022–3027	NUM
afs-147802	294	8	.	.	PUNCT
afs-147802	295	1	https://doi.org/10.1093/molbev/msab120	https://doi.org/10.1093/molbev/msab120	PROPN
afs-147802	295	2	uusitalo	uusitalo	PROPN
afs-147802	295	3	,	,	PUNCT
afs-147802	295	4	t.	t.	PROPN
afs-147802	295	5	,	,	PUNCT
afs-147802	295	6	saarinen	saarinen	PROPN
afs-147802	295	7	,	,	PUNCT
afs-147802	295	8	a.	a.	PROPN
afs-147802	295	9	&	&	CCONJ
afs-147802	295	10	mäkelä	mäkelä	PROPN
afs-147802	295	11	,	,	PUNCT
afs-147802	295	12	p.s.a	p.s.a	NOUN
afs-147802	295	13	.	.	PUNCT
afs-147802	295	14	2013	2013	NUM
afs-147802	295	15	.	.	PUNCT
afs-147802	296	1	effect	effect	NOUN
afs-147802	296	2	of	of	ADP
afs-147802	296	3	management	management	NOUN
afs-147802	296	4	of	of	ADP
afs-147802	296	5	sulfonylurea	sulfonylurea	NOUN
afs-147802	296	6	resistant	resistant	ADJ
afs-147802	296	7	stellaria	stellaria	NOUN
afs-147802	296	8	media	medium	NOUN
afs-147802	296	9	on	on	ADP
afs-147802	296	10	barley	barley	NOUN
afs-147802	296	11	yield	yield	NOUN
afs-147802	296	12	.	.	PUNCT
afs-147802	297	1	isrn	isrn	PROPN
afs-147802	297	2	agronomy2013	agronomy2013	PROPN
afs-147802	297	3	:	:	PUNCT
afs-147802	298	1	1–5	1–5	X
afs-147802	298	2	.	.	PUNCT
afs-147802	298	3	https://doi.org/10.1155/2013/310764	https://doi.org/10.1155/2013/310764	PROPN
afs-147802	298	4	ziska	ziska	PROPN
afs-147802	298	5	,	,	PUNCT
afs-147802	298	6	l.h	l.h	PROPN
afs-147802	298	7	.	.	PROPN
afs-147802	298	8	2020	2020	NUM
afs-147802	298	9	.	.	PUNCT
afs-147802	299	1	climate	climate	NOUN
afs-147802	299	2	change	change	NOUN
afs-147802	299	3	and	and	CCONJ
afs-147802	299	4	the	the	DET
afs-147802	299	5	herbicide	herbicide	NOUN
afs-147802	299	6	paradigm	paradigm	NOUN
afs-147802	299	7	:	:	PUNCT
afs-147802	299	8	visiting	visit	VERB
afs-147802	299	9	the	the	DET
afs-147802	299	10	future	future	NOUN
afs-147802	299	11	.	.	PUNCT
afs-147802	300	1	agronomy	agronomy	NOUN
afs-147802	300	2	10	10	NUM
afs-147802	300	3	:	:	SYM
afs-147802	300	4	1953	1953	NUM
afs-147802	300	5	.	.	PUNCT
afs-147802	301	1	https://doi.org/10.3390/agronomy10121953	https://doi.org/10.3390/agronomy10121953	VERB
afs-147802	301	2	the	the	DET
afs-147802	301	3	first	first	ADJ
afs-147802	301	4	recorded	record	VERB
afs-147802	301	5	case	case	NOUN
afs-147802	301	6	of	of	ADP
afs-147802	301	7	herbicide	herbicide	NOUN
afs-147802	301	8	resistance	resistance	NOUN
afs-147802	301	9	in	in	ADP
afs-147802	301	10	estonia	estonia	PROPN
afs-147802	301	11	:	:	PUNCT
afs-147802	301	12	common	common	ADJ
afs-147802	301	13	chickweed	chickweed	NOUN
afs-147802	301	14	(	(	PUNCT
afs-147802	301	15	stellaria	stellaria	NOUN
afs-147802	301	16	media	medium	NOUN
afs-147802	301	17	)	)	PUNCT
afs-147802	301	18	resistant	resistant	ADJ
afs-147802	301	19	to	to	ADP
afs-147802	301	20	sulfonylureas	sulfonylureas	ADJ
afs-147802	301	21	introduction	introduction	NOUN
afs-147802	301	22	materials	material	NOUN
afs-147802	301	23	and	and	CCONJ
afs-147802	301	24	methods	method	NOUN
afs-147802	301	25	results	result	VERB
afs-147802	301	26	discussion	discussion	NOUN
afs-147802	301	27	conclusions	conclusion	NOUN
afs-147802	301	28	acknowledgements	acknowledgement	NOUN
afs-147802	301	29	references	reference	NOUN