id	sid	tid	token	lemma	pos
afs-6014	1	1	agricultural	agricultural	ADJ
afs-6014	1	2	and	and	CCONJ
afs-6014	1	3	food	food	NOUN
afs-6014	1	4	science	science	NOUN
afs-6014	1	5	,	,	PUNCT
afs-6014	1	6	vol	vol	NOUN
afs-6014	1	7	20	20	NUM
afs-6014	1	8	(	(	PUNCT
afs-6014	1	9	2011	2011	NUM
afs-6014	1	10	):	):	PUNCT
afs-6014	1	11	143	143	NUM
afs-6014	1	12	-	-	SYM
afs-6014	1	13	150	150	NUM
afs-6014	2	1	a	a	DET
afs-6014	2	2	g	g	NOUN
afs-6014	2	3	r	r	NOUN
afs-6014	3	1	i	i	NOUN
afs-6014	3	2	c	c	NOUN
afs-6014	3	3	u	u	NOUN
afs-6014	3	4	l	l	NOUN
afs-6014	3	5	t	t	NOUN
afs-6014	3	6	u	u	X
afs-6014	3	7	r	r	NOUN
afs-6014	3	8	a	a	PROPN
afs-6014	3	9	l	l	NOUN
afs-6014	3	10	a	a	DET
afs-6014	3	11	n	n	NOUN
afs-6014	4	1	d	d	NOUN
afs-6014	4	2	f	f	X
afs-6014	5	1	o	o	NOUN
afs-6014	5	2	o	o	X
afs-6014	6	1	d	d	X
afs-6014	6	2	s	s	X
afs-6014	6	3	c	c	NOUN
afs-6014	7	1	i	i	NOUN
afs-6014	7	2	e	e	PROPN
afs-6014	7	3	n	n	PROPN
afs-6014	7	4	c	c	NOUN
afs-6014	7	5	e	e	NOUN
afs-6014	7	6	vol	vol	NOUN
afs-6014	7	7	.	.	PUNCT
afs-6014	8	1	20(2011	20(2011	NUM
afs-6014	8	2	):	):	PUNCT
afs-6014	9	1	143–150	143–150	NUM
afs-6014	9	2	.	.	PUNCT
afs-6014	10	1	143	143	NUM
afs-6014	10	2	©	©	PROPN
afs-6014	10	3	agricultural	agricultural	ADJ
afs-6014	10	4	and	and	CCONJ
afs-6014	10	5	food	food	NOUN
afs-6014	10	6	science	science	NOUN
afs-6014	10	7	manuscript	manuscript	NOUN
afs-6014	10	8	received	receive	VERB
afs-6014	10	9	august	august	PROPN
afs-6014	10	10	2010	2010	NUM
afs-6014	10	11	comparison	comparison	NOUN
afs-6014	10	12	of	of	ADP
afs-6014	10	13	different	different	ADJ
afs-6014	10	14	dna	dna	NOUN
afs-6014	10	15	extraction	extraction	NOUN
afs-6014	10	16	methods	method	NOUN
afs-6014	10	17	from	from	ADP
afs-6014	10	18	hair	hair	NOUN
afs-6014	10	19	root	root	NOUN
afs-6014	10	20	follicles	follicle	NOUN
afs-6014	10	21	to	to	PART
afs-6014	10	22	genotype	genotype	VERB
afs-6014	10	23	finnish	finnish	ADJ
afs-6014	10	24	landrace	landrace	NOUN
afs-6014	10	25	boars	boar	NOUN
afs-6014	10	26	with	with	ADP
afs-6014	10	27	the	the	DET
afs-6014	10	28	illumina	illumina	PROPN
afs-6014	10	29	porcinesnp60	porcinesnp60	PROPN
afs-6014	10	30	beadchip	beadchip	PROPN
afs-6014	10	31	anu	anu	PROPN
afs-6014	10	32	sironen	sironen	PROPN
afs-6014	10	33	*	*	PROPN
afs-6014	10	34	,	,	PUNCT
afs-6014	10	35	pekka	pekka	PROPN
afs-6014	10	36	uimari	uimari	PROPN
afs-6014	10	37	,	,	PUNCT
afs-6014	10	38	johanna	johanna	PROPN
afs-6014	10	39	vilkki	vilkki	PROPN
afs-6014	10	40	mtt	mtt	PROPN
afs-6014	10	41	agrifood	agrifood	PROPN
afs-6014	10	42	research	research	PROPN
afs-6014	10	43	finland	finland	PROPN
afs-6014	10	44	,	,	PUNCT
afs-6014	10	45	biotechnology	biotechnology	NOUN
afs-6014	10	46	and	and	CCONJ
afs-6014	10	47	food	food	NOUN
afs-6014	10	48	research	research	NOUN
afs-6014	10	49	,	,	PUNCT
afs-6014	10	50	fi-36100	fi-36100	PROPN
afs-6014	10	51	jokioinen	jokioinen	PROPN
afs-6014	10	52	,	,	PUNCT
afs-6014	10	53	finland	finland	PROPN
afs-6014	10	54	*	*	NOUN
afs-6014	10	55	email	email	NOUN
afs-6014	10	56	:	:	PUNCT
afs-6014	10	57	anu.sironen@mtt.fi	anu.sironen@mtt.fi	ADJ
afs-6014	10	58	recent	recent	ADJ
afs-6014	10	59	developments	development	NOUN
afs-6014	10	60	in	in	ADP
afs-6014	10	61	sequencing	sequence	VERB
afs-6014	10	62	methods	method	NOUN
afs-6014	10	63	have	have	AUX
afs-6014	10	64	enabled	enable	VERB
afs-6014	10	65	whole	whole	ADJ
afs-6014	10	66	genome	genome	NOUN
afs-6014	10	67	sequencing	sequencing	NOUN
afs-6014	10	68	of	of	ADP
afs-6014	10	69	several	several	ADJ
afs-6014	10	70	species	specie	NOUN
afs-6014	10	71	and	and	CCONJ
afs-6014	10	72	the	the	DET
afs-6014	10	73	available	available	ADJ
afs-6014	10	74	sequence	sequence	NOUN
afs-6014	10	75	information	information	NOUN
afs-6014	10	76	has	have	AUX
afs-6014	10	77	allowed	allow	VERB
afs-6014	10	78	the	the	DET
afs-6014	10	79	development	development	NOUN
afs-6014	10	80	of	of	ADP
afs-6014	10	81	high	high	ADJ
afs-6014	10	82	throughput	throughput	NOUN
afs-6014	10	83	genotyping	genotype	VERB
afs-6014	10	84	chips	chip	NOUN
afs-6014	10	85	.	.	PUNCT
afs-6014	11	1	however	however	ADV
afs-6014	11	2	,	,	PUNCT
afs-6014	11	3	these	these	DET
afs-6014	11	4	genotyping	genotyping	NOUN
afs-6014	11	5	methods	method	NOUN
afs-6014	11	6	require	require	VERB
afs-6014	11	7	high	high	ADJ
afs-6014	11	8	quality	quality	NOUN
afs-6014	11	9	dna	dna	NOUN
afs-6014	11	10	.	.	PUNCT
afs-6014	12	1	the	the	DET
afs-6014	12	2	possibility	possibility	NOUN
afs-6014	12	3	to	to	PART
afs-6014	12	4	genotype	genotype	VERB
afs-6014	12	5	samples	sample	NOUN
afs-6014	12	6	based	base	VERB
afs-6014	12	7	on	on	ADP
afs-6014	12	8	dna	dna	PROPN
afs-6014	12	9	from	from	ADP
afs-6014	12	10	non	non	ADJ
afs-6014	12	11	-	-	ADJ
afs-6014	12	12	invasive	invasive	ADJ
afs-6014	12	13	sources	source	NOUN
afs-6014	12	14	would	would	AUX
afs-6014	12	15	permit	permit	VERB
afs-6014	12	16	retrospective	retrospective	ADJ
afs-6014	12	17	genotyping	genotyping	NOUN
afs-6014	12	18	of	of	ADP
afs-6014	12	19	previously	previously	ADV
afs-6014	12	20	collected	collect	VERB
afs-6014	12	21	samples	sample	NOUN
afs-6014	12	22	and	and	CCONJ
afs-6014	12	23	also	also	ADV
afs-6014	12	24	facilitate	facilitate	VERB
afs-6014	12	25	the	the	DET
afs-6014	12	26	analysis	analysis	NOUN
afs-6014	12	27	of	of	ADP
afs-6014	12	28	large	large	ADJ
afs-6014	12	29	populations	population	NOUN
afs-6014	12	30	e.g.	e.g.	ADV
afs-6014	12	31	for	for	ADP
afs-6014	12	32	genomic	genomic	ADJ
afs-6014	12	33	selection	selection	NOUN
afs-6014	12	34	.	.	PUNCT
afs-6014	13	1	in	in	ADP
afs-6014	13	2	this	this	DET
afs-6014	13	3	study	study	NOUN
afs-6014	13	4	we	we	PRON
afs-6014	13	5	have	have	AUX
afs-6014	13	6	developed	develop	VERB
afs-6014	13	7	and	and	CCONJ
afs-6014	13	8	evaluated	evaluate	VERB
afs-6014	13	9	different	different	ADJ
afs-6014	13	10	dna	dna	NOUN
afs-6014	13	11	preparation	preparation	NOUN
afs-6014	13	12	methods	method	NOUN
afs-6014	13	13	from	from	ADP
afs-6014	13	14	porcine	porcine	NOUN
afs-6014	13	15	hair	hair	NOUN
afs-6014	13	16	root	root	NOUN
afs-6014	13	17	follicles	follicle	NOUN
afs-6014	13	18	for	for	ADP
afs-6014	13	19	high	high	ADJ
afs-6014	13	20	throughput	throughput	NOUN
afs-6014	13	21	genotyping	genotype	VERB
afs-6014	13	22	with	with	ADP
afs-6014	13	23	the	the	DET
afs-6014	13	24	porcinesnp60	porcinesnp60	NOUN
afs-6014	13	25	genotyping	genotyping	NOUN
afs-6014	13	26	beadchip	beadchip	NOUN
afs-6014	13	27	(	(	PUNCT
afs-6014	13	28	illumina	illumina	PROPN
afs-6014	13	29	)	)	PUNCT
afs-6014	13	30	.	.	PUNCT
afs-6014	14	1	we	we	PRON
afs-6014	14	2	describe	describe	VERB
afs-6014	14	3	a	a	DET
afs-6014	14	4	method	method	NOUN
afs-6014	14	5	for	for	ADP
afs-6014	14	6	dna	dna	NOUN
afs-6014	14	7	extraction	extraction	NOUN
afs-6014	14	8	from	from	ADP
afs-6014	14	9	porcine	porcine	NOUN
afs-6014	14	10	hair	hair	NOUN
afs-6014	14	11	root	root	NOUN
afs-6014	14	12	samples	sample	NOUN
afs-6014	14	13	,	,	PUNCT
afs-6014	14	14	which	which	PRON
afs-6014	14	15	produces	produce	VERB
afs-6014	14	16	results	result	NOUN
afs-6014	14	17	from	from	ADP
afs-6014	14	18	high	high	ADJ
afs-6014	14	19	throughput	throughput	NOUN
afs-6014	14	20	genotyping	genotype	VERB
afs-6014	14	21	with	with	ADP
afs-6014	14	22	the	the	DET
afs-6014	14	23	same	same	ADJ
afs-6014	14	24	high	high	ADJ
afs-6014	14	25	degree	degree	NOUN
afs-6014	14	26	of	of	ADP
afs-6014	14	27	accuracy	accuracy	NOUN
afs-6014	14	28	as	as	SCONJ
afs-6014	14	29	previously	previously	ADV
afs-6014	14	30	reported	report	VERB
afs-6014	14	31	for	for	ADP
afs-6014	14	32	dna	dna	PROPN
afs-6014	14	33	extracted	extract	VERB
afs-6014	14	34	from	from	ADP
afs-6014	14	35	sperm	sperm	NOUN
afs-6014	14	36	,	,	PUNCT
afs-6014	14	37	blood	blood	NOUN
afs-6014	14	38	or	or	CCONJ
afs-6014	14	39	tissue	tissue	NOUN
afs-6014	14	40	samples	sample	NOUN
afs-6014	14	41	.	.	PUNCT
afs-6014	15	1	this	this	DET
afs-6014	15	2	method	method	NOUN
afs-6014	15	3	was	be	AUX
afs-6014	15	4	used	use	VERB
afs-6014	15	5	for	for	ADP
afs-6014	15	6	the	the	DET
afs-6014	15	7	genotyping	genotyping	NOUN
afs-6014	15	8	of	of	ADP
afs-6014	15	9	273	273	NUM
afs-6014	15	10	hair	hair	NOUN
afs-6014	15	11	follicle	follicle	NOUN
afs-6014	15	12	samples	sample	NOUN
afs-6014	15	13	.	.	PUNCT
afs-6014	16	1	when	when	SCONJ
afs-6014	16	2	the	the	DET
afs-6014	16	3	dna	dna	PROPN
afs-6014	16	4	concentration	concentration	NOUN
afs-6014	16	5	was	be	AUX
afs-6014	16	6	>	>	X
afs-6014	16	7	30	30	NUM
afs-6014	16	8	ng/µl	ng/µl	NUM
afs-6014	16	9	all	all	DET
afs-6014	16	10	samples	sample	NOUN
afs-6014	16	11	had	have	VERB
afs-6014	16	12	the	the	DET
afs-6014	16	13	same	same	ADJ
afs-6014	16	14	high	high	ADJ
afs-6014	16	15	call	call	NOUN
afs-6014	16	16	rate	rate	NOUN
afs-6014	16	17	(	(	PUNCT
afs-6014	16	18	>	>	X
afs-6014	16	19	99	99	NUM
afs-6014	16	20	%	%	NOUN
afs-6014	16	21	)	)	PUNCT
afs-6014	16	22	as	as	ADP
afs-6014	16	23	sperm	sperm	NOUN
afs-6014	16	24	samples	sample	NOUN
afs-6014	16	25	confirming	confirm	VERB
afs-6014	16	26	the	the	DET
afs-6014	16	27	robustness	robustness	NOUN
afs-6014	16	28	of	of	ADP
afs-6014	16	29	this	this	DET
afs-6014	16	30	dna	dna	NOUN
afs-6014	16	31	extraction	extraction	NOUN
afs-6014	16	32	method	method	NOUN
afs-6014	16	33	for	for	ADP
afs-6014	16	34	high	high	ADJ
afs-6014	16	35	throughput	throughput	NOUN
afs-6014	16	36	genotyping	genotyping	NOUN
afs-6014	16	37	.	.	PUNCT
afs-6014	17	1	our	our	PRON
afs-6014	17	2	data	datum	NOUN
afs-6014	17	3	also	also	ADV
afs-6014	17	4	establishes	establish	VERB
afs-6014	17	5	the	the	DET
afs-6014	17	6	suitability	suitability	NOUN
afs-6014	17	7	of	of	ADP
afs-6014	17	8	the	the	DET
afs-6014	17	9	porcinesnp60	porcinesnp60	NOUN
afs-6014	17	10	beadchip	beadchip	NOUN
afs-6014	17	11	for	for	ADP
afs-6014	17	12	genotyping	genotype	VERB
afs-6014	17	13	the	the	DET
afs-6014	17	14	finnish	finnish	ADJ
afs-6014	17	15	landrace	landrace	NOUN
afs-6014	17	16	population	population	NOUN
afs-6014	17	17	.	.	PUNCT
afs-6014	18	1	key	key	ADJ
afs-6014	18	2	-	-	PUNCT
afs-6014	18	3	words	word	NOUN
afs-6014	18	4	:	:	PUNCT
afs-6014	18	5	dna	dna	PROPN
afs-6014	18	6	extraction	extraction	NOUN
afs-6014	18	7	,	,	PUNCT
afs-6014	18	8	finnish	finnish	ADJ
afs-6014	18	9	landrace	landrace	NOUN
afs-6014	18	10	,	,	PUNCT
afs-6014	18	11	genotyping	genotyping	NOUN
afs-6014	18	12	,	,	PUNCT
afs-6014	18	13	hair	hair	NOUN
afs-6014	18	14	follicles	follicle	NOUN
afs-6014	18	15	,	,	PUNCT
afs-6014	18	16	pig	pig	NOUN
afs-6014	18	17	,	,	PUNCT
afs-6014	18	18	snp	snp	VERB
afs-6014	18	19	a	a	DET
afs-6014	18	20	g	g	NOUN
afs-6014	18	21	r	r	NOUN
afs-6014	19	1	i	i	NOUN
afs-6014	19	2	c	c	NOUN
afs-6014	19	3	u	u	NOUN
afs-6014	19	4	l	l	NOUN
afs-6014	19	5	t	t	NOUN
afs-6014	19	6	u	u	X
afs-6014	19	7	r	r	NOUN
afs-6014	19	8	a	a	PROPN
afs-6014	19	9	l	l	NOUN
afs-6014	19	10	a	a	DET
afs-6014	19	11	n	n	NOUN
afs-6014	20	1	d	d	NOUN
afs-6014	20	2	f	f	X
afs-6014	21	1	o	o	NOUN
afs-6014	21	2	o	o	X
afs-6014	22	1	d	d	X
afs-6014	22	2	s	s	X
afs-6014	22	3	c	c	NOUN
afs-6014	23	1	i	i	NOUN
afs-6014	23	2	e	e	PROPN
afs-6014	23	3	n	n	PROPN
afs-6014	23	4	c	c	NOUN
afs-6014	23	5	e	e	X
afs-6014	23	6	sironen	sironen	PROPN
afs-6014	23	7	,	,	PUNCT
afs-6014	23	8	a.	a.	PROPN
afs-6014	23	9	et	et	PROPN
afs-6014	23	10	al	al	PROPN
afs-6014	23	11	.	.	PROPN
afs-6014	23	12	high	high	ADJ
afs-6014	23	13	throughput	throughput	NOUN
afs-6014	23	14	genotyping	genotype	VERB
afs-6014	23	15	from	from	ADP
afs-6014	23	16	porcine	porcine	NOUN
afs-6014	23	17	hair	hair	NOUN
afs-6014	23	18	follicles	follicle	VERB
afs-6014	23	19	144	144	NUM
afs-6014	23	20	a	a	DET
afs-6014	23	21	g	g	NOUN
afs-6014	24	1	r	r	NOUN
afs-6014	25	1	i	i	NOUN
afs-6014	25	2	c	c	NOUN
afs-6014	25	3	u	u	NOUN
afs-6014	25	4	l	l	NOUN
afs-6014	25	5	t	t	NOUN
afs-6014	25	6	u	u	X
afs-6014	25	7	r	r	NOUN
afs-6014	25	8	a	a	PROPN
afs-6014	25	9	l	l	NOUN
afs-6014	25	10	a	a	DET
afs-6014	25	11	n	n	NOUN
afs-6014	26	1	d	d	NOUN
afs-6014	26	2	f	f	X
afs-6014	27	1	o	o	NOUN
afs-6014	27	2	o	o	X
afs-6014	28	1	d	d	X
afs-6014	28	2	s	s	X
afs-6014	28	3	c	c	NOUN
afs-6014	29	1	i	i	NOUN
afs-6014	29	2	e	e	PROPN
afs-6014	29	3	n	n	PROPN
afs-6014	29	4	c	c	NOUN
afs-6014	29	5	e	e	NOUN
afs-6014	29	6	vol	vol	NOUN
afs-6014	29	7	.	.	PUNCT
afs-6014	30	1	20(2011	20(2011	NUM
afs-6014	30	2	):	):	PUNCT
afs-6014	30	3	143–150	143–150	NUM
afs-6014	30	4	.	.	NOUN
afs-6014	30	5	145	145	NUM
afs-6014	30	6	introduction	introduction	NOUN
afs-6014	30	7	high	high	ADJ
afs-6014	30	8	throughput	throughput	NOUN
afs-6014	30	9	single	single	ADJ
afs-6014	30	10	-	-	PUNCT
afs-6014	30	11	nucleotide	nucleotide	NOUN
afs-6014	30	12	polymorphism	polymorphism	NOUN
afs-6014	30	13	(	(	PUNCT
afs-6014	30	14	snp	snp	ADJ
afs-6014	30	15	)	)	PUNCT
afs-6014	30	16	genotyping	genotype	VERB
afs-6014	30	17	methods	method	NOUN
afs-6014	30	18	are	be	AUX
afs-6014	30	19	becoming	become	VERB
afs-6014	30	20	increasingly	increasingly	ADV
afs-6014	30	21	important	important	ADJ
afs-6014	30	22	in	in	ADP
afs-6014	30	23	population	population	NOUN
afs-6014	30	24	(	(	PUNCT
afs-6014	30	25	decker	decker	PROPN
afs-6014	30	26	et	et	PROPN
afs-6014	30	27	al	al	PROPN
afs-6014	30	28	.	.	PROPN
afs-6014	30	29	2009	2009	NUM
afs-6014	30	30	,	,	PUNCT
afs-6014	30	31	vonholdt	vonholdt	PROPN
afs-6014	30	32	et	et	PROPN
afs-6014	30	33	al	al	PROPN
afs-6014	30	34	.	.	PROPN
afs-6014	30	35	2010	2010	NUM
afs-6014	30	36	)	)	PUNCT
afs-6014	30	37	and	and	CCONJ
afs-6014	30	38	association	association	NOUN
afs-6014	30	39	studies	study	NOUN
afs-6014	30	40	(	(	PUNCT
afs-6014	30	41	goddard	goddard	NOUN
afs-6014	30	42	and	and	CCONJ
afs-6014	30	43	hayes	hayes	PROPN
afs-6014	30	44	2009	2009	NUM
afs-6014	30	45	)	)	PUNCT
afs-6014	30	46	and	and	CCONJ
afs-6014	30	47	also	also	ADV
afs-6014	30	48	for	for	ADP
afs-6014	30	49	genomic	genomic	ADJ
afs-6014	30	50	selection	selection	NOUN
afs-6014	30	51	(	(	PUNCT
afs-6014	30	52	meuwissen	meuwissen	NOUN
afs-6014	30	53	et	et	PROPN
afs-6014	30	54	al	al	PROPN
afs-6014	30	55	.	.	PROPN
afs-6014	30	56	2001	2001	NUM
afs-6014	30	57	)	)	PUNCT
afs-6014	30	58	.	.	PUNCT
afs-6014	31	1	high	high	ADJ
afs-6014	31	2	throughput	throughput	NOUN
afs-6014	31	3	genotyping	genotyping	NOUN
afs-6014	31	4	is	be	AUX
afs-6014	31	5	now	now	ADV
afs-6014	31	6	feasible	feasible	ADJ
afs-6014	31	7	due	due	ADP
afs-6014	31	8	to	to	ADP
afs-6014	31	9	the	the	DET
afs-6014	31	10	large	large	ADJ
afs-6014	31	11	number	number	NOUN
afs-6014	31	12	of	of	ADP
afs-6014	31	13	snp	snp	NOUN
afs-6014	31	14	discovered	discover	VERB
afs-6014	31	15	by	by	ADP
afs-6014	31	16	genome	genome	NOUN
afs-6014	31	17	sequencing	sequencing	NOUN
afs-6014	31	18	of	of	ADP
afs-6014	31	19	various	various	ADJ
afs-6014	31	20	species	specie	NOUN
afs-6014	31	21	and	and	CCONJ
afs-6014	31	22	the	the	DET
afs-6014	31	23	development	development	NOUN
afs-6014	31	24	of	of	ADP
afs-6014	31	25	new	new	ADJ
afs-6014	31	26	methods	method	NOUN
afs-6014	31	27	to	to	PART
afs-6014	31	28	efficiently	efficiently	ADV
afs-6014	31	29	genotype	genotype	VERB
afs-6014	31	30	a	a	DET
afs-6014	31	31	large	large	ADJ
afs-6014	31	32	numbers	number	NOUN
afs-6014	31	33	of	of	ADP
afs-6014	31	34	snps	snps	PROPN
afs-6014	31	35	(	(	PUNCT
afs-6014	31	36	hayes	hayes	PROPN
afs-6014	31	37	et	et	PROPN
afs-6014	31	38	al	al	PROPN
afs-6014	31	39	.	.	PROPN
afs-6014	31	40	2009	2009	NUM
afs-6014	31	41	)	)	PUNCT
afs-6014	31	42	.	.	PUNCT
afs-6014	32	1	genomic	genomic	ADJ
afs-6014	32	2	selection	selection	NOUN
afs-6014	32	3	is	be	AUX
afs-6014	32	4	based	base	VERB
afs-6014	32	5	on	on	ADP
afs-6014	32	6	a	a	DET
afs-6014	32	7	large	large	ADJ
afs-6014	32	8	reference	reference	NOUN
afs-6014	32	9	population	population	NOUN
afs-6014	32	10	,	,	PUNCT
afs-6014	32	11	in	in	ADP
afs-6014	32	12	which	which	PRON
afs-6014	32	13	animals	animal	NOUN
afs-6014	32	14	are	be	AUX
afs-6014	32	15	both	both	PRON
afs-6014	32	16	phenotyped	phenotype	VERB
afs-6014	32	17	and	and	CCONJ
afs-6014	32	18	genotyped	genotype	VERB
afs-6014	32	19	.	.	PUNCT
afs-6014	33	1	previously	previously	ADV
afs-6014	33	2	collected	collect	VERB
afs-6014	33	3	samples	sample	NOUN
afs-6014	33	4	from	from	ADP
afs-6014	33	5	a	a	DET
afs-6014	33	6	reference	reference	NOUN
afs-6014	33	7	population	population	NOUN
afs-6014	33	8	with	with	ADP
afs-6014	33	9	reliable	reliable	ADJ
afs-6014	33	10	breeding	breeding	NOUN
afs-6014	33	11	values	value	NOUN
afs-6014	33	12	are	be	AUX
afs-6014	33	13	required	require	VERB
afs-6014	33	14	to	to	PART
afs-6014	33	15	predict	predict	VERB
afs-6014	33	16	genomic	genomic	ADJ
afs-6014	33	17	breeding	breeding	NOUN
afs-6014	33	18	values	value	NOUN
afs-6014	33	19	(	(	PUNCT
afs-6014	33	20	gebv	gebv	NOUN
afs-6014	33	21	)	)	PUNCT
afs-6014	33	22	in	in	ADP
afs-6014	33	23	subsequent	subsequent	ADJ
afs-6014	33	24	generations	generation	NOUN
afs-6014	33	25	.	.	PUNCT
afs-6014	34	1	similarly	similarly	ADV
afs-6014	34	2	,	,	PUNCT
afs-6014	34	3	existing	exist	VERB
afs-6014	34	4	samples	sample	NOUN
afs-6014	34	5	can	can	AUX
afs-6014	34	6	be	be	AUX
afs-6014	34	7	used	use	VERB
afs-6014	34	8	for	for	ADP
afs-6014	34	9	the	the	DET
afs-6014	34	10	analysis	analysis	NOUN
afs-6014	34	11	of	of	ADP
afs-6014	34	12	population	population	NOUN
afs-6014	34	13	diversity	diversity	NOUN
afs-6014	34	14	and	and	CCONJ
afs-6014	34	15	identification	identification	NOUN
afs-6014	34	16	of	of	ADP
afs-6014	34	17	disease	disease	NOUN
afs-6014	34	18	associated	associate	VERB
afs-6014	34	19	genomic	genomic	ADJ
afs-6014	34	20	regions	region	NOUN
afs-6014	34	21	by	by	ADP
afs-6014	34	22	high	high	ADJ
afs-6014	34	23	throughput	throughput	NOUN
afs-6014	34	24	genotyping	genotyping	NOUN
afs-6014	34	25	.	.	PUNCT
afs-6014	35	1	dna	dna	PROPN
afs-6014	35	2	extracted	extract	VERB
afs-6014	35	3	from	from	ADP
afs-6014	35	4	sperm	sperm	NOUN
afs-6014	35	5	,	,	PUNCT
afs-6014	35	6	blood	blood	NOUN
afs-6014	35	7	or	or	CCONJ
afs-6014	35	8	tissue	tissue	NOUN
afs-6014	35	9	samples	sample	NOUN
afs-6014	35	10	can	can	AUX
afs-6014	35	11	be	be	AUX
afs-6014	35	12	used	use	VERB
afs-6014	35	13	for	for	ADP
afs-6014	35	14	high	high	ADJ
afs-6014	35	15	quality	quality	NOUN
afs-6014	35	16	genotyping	genotyping	NOUN
afs-6014	35	17	using	use	VERB
afs-6014	35	18	chip	chip	NOUN
afs-6014	35	19	technology	technology	NOUN
afs-6014	35	20	(	(	PUNCT
afs-6014	35	21	li	li	PROPN
afs-6014	35	22	et	et	PROPN
afs-6014	35	23	al	al	PROPN
afs-6014	35	24	.	.	PROPN
afs-6014	35	25	2008	2008	NUM
afs-6014	35	26	,	,	PUNCT
afs-6014	36	1	jiang	jiang	PROPN
afs-6014	36	2	et	et	PROPN
afs-6014	36	3	al	al	PROPN
afs-6014	36	4	.	.	PROPN
afs-6014	36	5	2010	2010	NUM
afs-6014	36	6	)	)	PUNCT
afs-6014	36	7	,	,	PUNCT
afs-6014	36	8	but	but	CCONJ
afs-6014	36	9	invasive	invasive	ADJ
afs-6014	36	10	procedures	procedure	NOUN
afs-6014	36	11	are	be	AUX
afs-6014	36	12	required	require	VERB
afs-6014	36	13	to	to	PART
afs-6014	36	14	collect	collect	VERB
afs-6014	36	15	such	such	ADJ
afs-6014	36	16	samples	sample	NOUN
afs-6014	36	17	causing	cause	VERB
afs-6014	36	18	unnecessary	unnecessary	ADJ
afs-6014	36	19	pain	pain	NOUN
afs-6014	36	20	and	and	CCONJ
afs-6014	36	21	distress	distress	NOUN
afs-6014	36	22	for	for	ADP
afs-6014	36	23	sampled	sample	VERB
afs-6014	36	24	animals	animal	NOUN
afs-6014	36	25	.	.	PUNCT
afs-6014	37	1	furthermore	furthermore	ADV
afs-6014	37	2	,	,	PUNCT
afs-6014	37	3	these	these	DET
afs-6014	37	4	samples	sample	NOUN
afs-6014	37	5	are	be	AUX
afs-6014	37	6	also	also	ADV
afs-6014	37	7	expensive	expensive	ADJ
afs-6014	37	8	and	and	CCONJ
afs-6014	37	9	time	time	NOUN
afs-6014	37	10	consuming	consume	VERB
afs-6014	37	11	to	to	PART
afs-6014	37	12	collect	collect	VERB
afs-6014	37	13	.	.	PUNCT
afs-6014	38	1	the	the	DET
afs-6014	38	2	hair	hair	NOUN
afs-6014	38	3	root	root	NOUN
afs-6014	38	4	is	be	AUX
afs-6014	38	5	known	know	VERB
afs-6014	38	6	to	to	PART
afs-6014	38	7	contain	contain	VERB
afs-6014	38	8	dna	dna	NOUN
afs-6014	38	9	and	and	CCONJ
afs-6014	38	10	therefore	therefore	ADV
afs-6014	38	11	represents	represent	VERB
afs-6014	38	12	a	a	DET
afs-6014	38	13	non	non	ADJ
afs-6014	38	14	-	-	ADJ
afs-6014	38	15	invasive	invasive	ADJ
afs-6014	38	16	source	source	NOUN
afs-6014	38	17	of	of	ADP
afs-6014	38	18	dna	dna	PROPN
afs-6014	38	19	.	.	PUNCT
afs-6014	39	1	the	the	PRON
afs-6014	39	2	collection	collection	NOUN
afs-6014	39	3	,	,	PUNCT
afs-6014	39	4	transportation	transportation	NOUN
afs-6014	39	5	and	and	CCONJ
afs-6014	39	6	storage	storage	NOUN
afs-6014	39	7	of	of	ADP
afs-6014	39	8	hair	hair	NOUN
afs-6014	39	9	samples	sample	NOUN
afs-6014	39	10	do	do	AUX
afs-6014	39	11	not	not	PART
afs-6014	39	12	require	require	VERB
afs-6014	39	13	any	any	DET
afs-6014	39	14	special	special	ADJ
afs-6014	39	15	procedures	procedure	NOUN
afs-6014	39	16	and	and	CCONJ
afs-6014	39	17	as	as	ADP
afs-6014	39	18	a	a	DET
afs-6014	39	19	result	result	NOUN
afs-6014	39	20	offers	offer	VERB
afs-6014	39	21	a	a	DET
afs-6014	39	22	painless	painless	ADJ
afs-6014	39	23	and	and	CCONJ
afs-6014	39	24	inexpensive	inexpensive	ADJ
afs-6014	39	25	alternative	alternative	NOUN
afs-6014	39	26	to	to	ADP
afs-6014	39	27	the	the	DET
afs-6014	39	28	sampling	sampling	NOUN
afs-6014	39	29	of	of	ADP
afs-6014	39	30	other	other	ADJ
afs-6014	39	31	tissues	tissue	NOUN
afs-6014	39	32	.	.	PUNCT
afs-6014	40	1	several	several	ADJ
afs-6014	40	2	methods	method	NOUN
afs-6014	40	3	have	have	AUX
afs-6014	40	4	been	be	AUX
afs-6014	40	5	described	describe	VERB
afs-6014	40	6	for	for	ADP
afs-6014	40	7	polymerase	polymerase	NOUN
afs-6014	40	8	chain	chain	NOUN
afs-6014	40	9	reaction	reaction	NOUN
afs-6014	40	10	(	(	PUNCT
afs-6014	40	11	pcr	pcr	NOUN
afs-6014	40	12	)	)	PUNCT
afs-6014	40	13	amplification	amplification	NOUN
afs-6014	40	14	of	of	ADP
afs-6014	40	15	single	single	ADJ
afs-6014	40	16	markers	marker	NOUN
afs-6014	40	17	from	from	ADP
afs-6014	40	18	hair	hair	NOUN
afs-6014	40	19	samples	sample	NOUN
afs-6014	40	20	(	(	PUNCT
afs-6014	40	21	amendola	amendola	PROPN
afs-6014	40	22	-	-	PUNCT
afs-6014	40	23	pimenta	pimenta	PROPN
afs-6014	40	24	et	et	PROPN
afs-6014	40	25	al	al	PROPN
afs-6014	40	26	.	.	PROPN
afs-6014	40	27	2009	2009	NUM
afs-6014	40	28	,	,	PUNCT
afs-6014	40	29	hayashida	hayashida	NOUN
afs-6014	40	30	et	et	PROPN
afs-6014	40	31	al	al	PROPN
afs-6014	40	32	.	.	PROPN
afs-6014	40	33	2009	2009	NUM
afs-6014	40	34	,	,	PUNCT
afs-6014	40	35	sironen	sironen	PROPN
afs-6014	40	36	et	et	PROPN
afs-6014	40	37	al	al	PROPN
afs-6014	40	38	.	.	PROPN
afs-6014	40	39	2010	2010	NUM
afs-6014	40	40	)	)	PUNCT
afs-6014	40	41	.	.	PUNCT
afs-6014	41	1	however	however	ADV
afs-6014	41	2	,	,	PUNCT
afs-6014	41	3	the	the	DET
afs-6014	41	4	low	low	ADJ
afs-6014	41	5	quality	quality	NOUN
afs-6014	41	6	of	of	ADP
afs-6014	41	7	dna	dna	PROPN
afs-6014	41	8	obtained	obtain	VERB
afs-6014	41	9	has	have	AUX
afs-6014	41	10	prevented	prevent	VERB
afs-6014	41	11	the	the	DET
afs-6014	41	12	use	use	NOUN
afs-6014	41	13	of	of	ADP
afs-6014	41	14	these	these	DET
afs-6014	41	15	samples	sample	NOUN
afs-6014	41	16	for	for	ADP
afs-6014	41	17	high	high	ADJ
afs-6014	41	18	throughput	throughput	NOUN
afs-6014	41	19	genotyping	genotyping	NOUN
afs-6014	41	20	.	.	PUNCT
afs-6014	42	1	in	in	ADP
afs-6014	42	2	this	this	DET
afs-6014	42	3	study	study	NOUN
afs-6014	42	4	,	,	PUNCT
afs-6014	42	5	we	we	PRON
afs-6014	42	6	have	have	AUX
afs-6014	42	7	assessed	assess	VERB
afs-6014	42	8	several	several	ADJ
afs-6014	42	9	possible	possible	ADJ
afs-6014	42	10	methods	method	NOUN
afs-6014	42	11	for	for	ADP
afs-6014	42	12	dna	dna	PROPN
afs-6014	42	13	preparation	preparation	NOUN
afs-6014	42	14	from	from	ADP
afs-6014	42	15	porcine	porcine	NOUN
afs-6014	42	16	(	(	PUNCT
afs-6014	42	17	sus	sus	PROPN
afs-6014	42	18	scrofa	scrofa	NOUN
afs-6014	42	19	)	)	PUNCT
afs-6014	42	20	hair	hair	NOUN
afs-6014	42	21	roots	root	NOUN
afs-6014	42	22	for	for	ADP
afs-6014	42	23	genotyping	genotype	VERB
afs-6014	42	24	with	with	ADP
afs-6014	42	25	the	the	DET
afs-6014	42	26	chip	chip	NOUN
afs-6014	42	27	technology	technology	NOUN
afs-6014	42	28	.	.	PUNCT
afs-6014	43	1	based	base	VERB
afs-6014	43	2	on	on	ADP
afs-6014	43	3	our	our	PRON
afs-6014	43	4	analysis	analysis	NOUN
afs-6014	43	5	we	we	PRON
afs-6014	43	6	have	have	AUX
afs-6014	43	7	developed	develop	VERB
afs-6014	43	8	a	a	DET
afs-6014	43	9	reliable	reliable	ADJ
afs-6014	43	10	method	method	NOUN
afs-6014	43	11	for	for	ADP
afs-6014	43	12	the	the	DET
afs-6014	43	13	preparation	preparation	NOUN
afs-6014	43	14	of	of	ADP
afs-6014	43	15	dna	dna	PROPN
afs-6014	43	16	from	from	ADP
afs-6014	43	17	the	the	DET
afs-6014	43	18	hair	hair	NOUN
afs-6014	43	19	root	root	NOUN
afs-6014	43	20	for	for	ADP
afs-6014	43	21	genotyping	genotype	VERB
afs-6014	43	22	with	with	ADP
afs-6014	43	23	the	the	DET
afs-6014	43	24	porcinesnp60	porcinesnp60	NOUN
afs-6014	43	25	genotyping	genotyping	NOUN
afs-6014	43	26	beadchip	beadchip	NOUN
afs-6014	43	27	(	(	PUNCT
afs-6014	43	28	illumina	illumina	PROPN
afs-6014	43	29	)	)	PUNCT
afs-6014	43	30	.	.	PUNCT
afs-6014	44	1	material	material	NOUN
afs-6014	44	2	and	and	CCONJ
afs-6014	44	3	methods	method	NOUN
afs-6014	44	4	dna	dna	PROPN
afs-6014	44	5	samples	sample	NOUN
afs-6014	44	6	genomic	genomic	ADJ
afs-6014	44	7	dna	dna	NOUN
afs-6014	44	8	was	be	AUX
afs-6014	44	9	prepared	prepare	VERB
afs-6014	44	10	from	from	ADP
afs-6014	44	11	porcine	porcine	NOUN
afs-6014	44	12	(	(	PUNCT
afs-6014	44	13	finnish	finnish	ADJ
afs-6014	44	14	landrace	landrace	NOUN
afs-6014	44	15	)	)	PUNCT
afs-6014	44	16	hair	hair	NOUN
afs-6014	44	17	roots	root	NOUN
afs-6014	44	18	collected	collect	VERB
afs-6014	44	19	during	during	ADP
afs-6014	44	20	years	year	NOUN
afs-6014	44	21	2000–2006	2000–2006	NUM
afs-6014	44	22	(	(	PUNCT
afs-6014	44	23	samples	sample	NOUN
afs-6014	44	24	of	of	ADP
afs-6014	44	25	273	273	NUM
afs-6014	44	26	boars	boar	NOUN
afs-6014	44	27	were	be	AUX
afs-6014	44	28	used	use	VERB
afs-6014	44	29	for	for	ADP
afs-6014	44	30	this	this	DET
afs-6014	44	31	study	study	NOUN
afs-6014	44	32	)	)	PUNCT
afs-6014	44	33	and	and	CCONJ
afs-6014	44	34	stored	store	VERB
afs-6014	44	35	at	at	ADP
afs-6014	44	36	room	room	NOUN
afs-6014	44	37	temperature	temperature	NOUN
afs-6014	44	38	.	.	PUNCT
afs-6014	45	1	control	control	PROPN
afs-6014	45	2	dna	dna	PROPN
afs-6014	45	3	was	be	AUX
afs-6014	45	4	extracted	extract	VERB
afs-6014	45	5	from	from	ADP
afs-6014	45	6	sperm	sperm	NOUN
afs-6014	45	7	samples	sample	NOUN
afs-6014	45	8	using	use	VERB
afs-6014	45	9	a	a	DET
afs-6014	45	10	phenol/	phenol/	NUM
afs-6014	45	11	chloroform	chloroform	NOUN
afs-6014	45	12	extraction	extraction	NOUN
afs-6014	45	13	protocol	protocol	NOUN
afs-6014	45	14	.	.	PUNCT
afs-6014	46	1	for	for	SCONJ
afs-6014	46	2	the	the	DET
afs-6014	46	3	assessment	assessment	NOUN
afs-6014	46	4	of	of	ADP
afs-6014	46	5	various	various	ADJ
afs-6014	46	6	dna	dna	NOUN
afs-6014	46	7	preparation	preparation	NOUN
afs-6014	46	8	methods	method	NOUN
afs-6014	46	9	replicate	replicate	VERB
afs-6014	46	10	of	of	ADP
afs-6014	46	11	samples	sample	NOUN
afs-6014	46	12	(	(	PUNCT
afs-6014	46	13	n	n	X
afs-6014	46	14	>	>	X
afs-6014	46	15	4	4	NUM
afs-6014	46	16	)	)	PUNCT
afs-6014	46	17	including	include	VERB
afs-6014	46	18	the	the	DET
afs-6014	46	19	hair	hair	NOUN
afs-6014	46	20	follicle	follicle	NOUN
afs-6014	46	21	of	of	ADP
afs-6014	46	22	5–15	5–15	ADJ
afs-6014	46	23	hairs	hair	NOUN
afs-6014	46	24	were	be	AUX
afs-6014	46	25	used	use	VERB
afs-6014	46	26	:	:	PUNCT
afs-6014	47	1	1	1	X
afs-6014	47	2	.	.	X
afs-6014	47	3	the	the	DET
afs-6014	47	4	hair	hair	NOUN
afs-6014	47	5	roots	root	NOUN
afs-6014	47	6	were	be	AUX
afs-6014	47	7	lysed	lyse	VERB
afs-6014	47	8	in	in	ADP
afs-6014	47	9	lysis	lysis	NOUN
afs-6014	47	10	buffer	buffer	NOUN
afs-6014	47	11	[	[	X
afs-6014	47	12	proteinase	proteinase	NOUN
afs-6014	47	13	k	k	PROPN
afs-6014	47	14	0.5	0.5	NUM
afs-6014	47	15	mg	mg	PROPN
afs-6014	47	16	/	/	SYM
afs-6014	47	17	ml	ml	NOUN
afs-6014	47	18	and	and	CCONJ
afs-6014	47	19	2	2	NUM
afs-6014	47	20	µl	µl	ADP
afs-6014	47	21	mg	mg	ADV
afs-6014	47	22	-	-	PUNCT
afs-6014	47	23	free	free	ADJ
afs-6014	47	24	pcr	pcr	ADJ
afs-6014	47	25	buffer	buffer	NOUN
afs-6014	47	26	(	(	PUNCT
afs-6014	47	27	dynazyme	dynazyme	VERB
afs-6014	47	28	dna	dna	PROPN
afs-6014	47	29	polymerase	polymerase	NOUN
afs-6014	47	30	,	,	PUNCT
afs-6014	47	31	finnzymes	finnzyme	NOUN
afs-6014	47	32	)	)	PUNCT
afs-6014	47	33	in	in	ADP
afs-6014	47	34	dh2o	dh2o	NOUN
afs-6014	47	35	]	]	PUNCT
afs-6014	47	36	at	at	ADP
afs-6014	47	37	55	55	NUM
afs-6014	47	38	ºc	ºc	NOUN
afs-6014	47	39	for	for	ADP
afs-6014	47	40	60	60	NUM
afs-6014	47	41	min	min	NOUN
afs-6014	47	42	following	follow	VERB
afs-6014	47	43	proteinase	proteinase	NOUN
afs-6014	47	44	k	k	PROPN
afs-6014	47	45	inactivation	inactivation	NOUN
afs-6014	47	46	at	at	ADP
afs-6014	47	47	98	98	NUM
afs-6014	47	48	ºc	ºc	NOUN
afs-6014	47	49	for	for	ADP
afs-6014	47	50	10	10	NUM
afs-6014	47	51	min	min	NOUN
afs-6014	47	52	.	.	PROPN
afs-6014	47	53	2	2	NUM
afs-6014	47	54	.	.	X
afs-6014	47	55	dna	dna	PROPN
afs-6014	47	56	purification	purification	NOUN
afs-6014	47	57	from	from	ADP
afs-6014	47	58	the	the	DET
afs-6014	47	59	lysed	lyse	VERB
afs-6014	47	60	samples	sample	NOUN
afs-6014	47	61	(	(	PUNCT
afs-6014	47	62	first	first	ADJ
afs-6014	47	63	preparation	preparation	NOUN
afs-6014	47	64	method	method	NOUN
afs-6014	47	65	)	)	PUNCT
afs-6014	47	66	by	by	ADP
afs-6014	47	67	ethanol	ethanol	NOUN
afs-6014	47	68	(	(	PUNCT
afs-6014	47	69	etoh	etoh	NOUN
afs-6014	47	70	)	)	PUNCT
afs-6014	47	71	precipitation	precipitation	NOUN
afs-6014	47	72	with	with	ADP
afs-6014	47	73	100	100	NUM
afs-6014	47	74	%	%	NOUN
afs-6014	47	75	ethanol	ethanol	NOUN
afs-6014	47	76	and	and	CCONJ
afs-6014	47	77	sodium	sodium	NOUN
afs-6014	47	78	acetate	acetate	NOUN
afs-6014	47	79	(	(	PUNCT
afs-6014	47	80	0.3	0.3	NUM
afs-6014	47	81	m	m	NOUN
afs-6014	47	82	,	,	PUNCT
afs-6014	47	83	ph	ph	X
afs-6014	47	84	5.2	5.2	NUM
afs-6014	47	85	)	)	PUNCT
afs-6014	47	86	at	at	ADP
afs-6014	47	87	-20	-20	PROPN
afs-6014	47	88	°	°	ADP
afs-6014	47	89	c	c	NOUN
afs-6014	47	90	for	for	ADP
afs-6014	47	91	30	30	NUM
afs-6014	47	92	min	min	NOUN
afs-6014	47	93	following	follow	VERB
afs-6014	47	94	centrifugation	centrifugation	NOUN
afs-6014	47	95	at	at	ADP
afs-6014	47	96	13000	13000	NUM
afs-6014	47	97	rpm	rpm	NOUN
afs-6014	47	98	for	for	ADP
afs-6014	47	99	10	10	NUM
afs-6014	47	100	min	min	NOUN
afs-6014	47	101	.	.	PUNCT
afs-6014	48	1	any	any	DET
afs-6014	48	2	residual	residual	ADJ
afs-6014	48	3	salt	salt	NOUN
afs-6014	48	4	was	be	AUX
afs-6014	48	5	washed	wash	VERB
afs-6014	48	6	with	with	ADP
afs-6014	48	7	70	70	NUM
afs-6014	48	8	%	%	NOUN
afs-6014	48	9	ethanol	ethanol	NOUN
afs-6014	48	10	and	and	CCONJ
afs-6014	48	11	centrifuged	centrifuge	VERB
afs-6014	48	12	at	at	ADP
afs-6014	48	13	13000rpm	13000rpm	NUM
afs-6014	48	14	for	for	ADP
afs-6014	48	15	10min	10min	NOUN
afs-6014	48	16	.	.	PUNCT
afs-6014	49	1	precipitated	precipitate	VERB
afs-6014	49	2	dna	dna	PROPN
afs-6014	49	3	was	be	AUX
afs-6014	49	4	air	air	NOUN
afs-6014	49	5	dried	dry	VERB
afs-6014	49	6	and	and	CCONJ
afs-6014	49	7	dissolved	dissolve	VERB
afs-6014	49	8	in	in	ADP
afs-6014	49	9	20	20	NUM
afs-6014	49	10	µl	µl	NOUN
afs-6014	49	11	of	of	ADP
afs-6014	49	12	distilled	distil	VERB
afs-6014	49	13	h2o	h2o	NOUN
afs-6014	49	14	.	.	PUNCT
afs-6014	50	1	3	3	X
afs-6014	50	2	.	.	X
afs-6014	50	3	dna	dna	PROPN
afs-6014	50	4	extraction	extraction	NOUN
afs-6014	50	5	from	from	ADP
afs-6014	50	6	the	the	DET
afs-6014	50	7	lysed	lyse	VERB
afs-6014	50	8	samples	sample	NOUN
afs-6014	50	9	(	(	PUNCT
afs-6014	50	10	first	first	ADJ
afs-6014	50	11	preparation	preparation	NOUN
afs-6014	50	12	method	method	NOUN
afs-6014	50	13	)	)	PUNCT
afs-6014	50	14	by	by	ADP
afs-6014	50	15	phenol	phenol	NOUN
afs-6014	50	16	/	/	SYM
afs-6014	50	17	chloroform	chloroform	NOUN
afs-6014	50	18	.	.	PUNCT
afs-6014	51	1	4	4	X
afs-6014	51	2	.	.	X
afs-6014	51	3	dna	dna	PROPN
afs-6014	51	4	purification	purification	NOUN
afs-6014	51	5	from	from	ADP
afs-6014	51	6	the	the	DET
afs-6014	51	7	lysed	lyse	VERB
afs-6014	51	8	samples	sample	NOUN
afs-6014	51	9	(	(	PUNCT
afs-6014	51	10	first	first	ADJ
afs-6014	51	11	preparation	preparation	NOUN
afs-6014	51	12	method	method	NOUN
afs-6014	51	13	)	)	PUNCT
afs-6014	51	14	by	by	ADP
afs-6014	51	15	instagene	instagene	NOUN
afs-6014	51	16	matrix	matrix	NOUN
afs-6014	51	17	(	(	PUNCT
afs-6014	51	18	biorad	biorad	NOUN
afs-6014	51	19	)	)	PUNCT
afs-6014	51	20	following	follow	VERB
afs-6014	51	21	the	the	DET
afs-6014	51	22	protocol	protocol	NOUN
afs-6014	51	23	supplied	supply	VERB
afs-6014	51	24	by	by	ADP
afs-6014	51	25	the	the	DET
afs-6014	51	26	manufacture	manufacture	NOUN
afs-6014	51	27	.	.	PUNCT
afs-6014	52	1	5	5	X
afs-6014	52	2	.	.	X
afs-6014	52	3	hair	hair	NOUN
afs-6014	52	4	roots	root	NOUN
afs-6014	52	5	were	be	AUX
afs-6014	52	6	lysed	lyse	VERB
afs-6014	52	7	in	in	ADP
afs-6014	52	8	atl	atl	PROPN
afs-6014	52	9	lysis	lysis	NOUN
afs-6014	52	10	buffer	buffer	NOUN
afs-6014	52	11	(	(	PUNCT
afs-6014	52	12	qiagen	qiagen	NOUN
afs-6014	52	13	)	)	PUNCT
afs-6014	52	14	with	with	ADP
afs-6014	52	15	proteinase	proteinase	PROPN
afs-6014	52	16	k	k	PROPN
afs-6014	52	17	(	(	PUNCT
afs-6014	52	18	10	10	NUM
afs-6014	52	19	mg	mg	NUM
afs-6014	52	20	/	/	SYM
afs-6014	52	21	ml	ml	NOUN
afs-6014	52	22	)	)	PUNCT
afs-6014	52	23	at	at	ADP
afs-6014	52	24	55	55	NUM
afs-6014	52	25	ºc	ºc	NOUN
afs-6014	52	26	for	for	ADP
afs-6014	52	27	60	60	NUM
afs-6014	52	28	min	min	NOUN
afs-6014	52	29	following	follow	VERB
afs-6014	52	30	proteinase	proteinase	NOUN
afs-6014	52	31	k	k	PROPN
afs-6014	52	32	inactivation	inactivation	NOUN
afs-6014	52	33	at	at	ADP
afs-6014	52	34	98	98	NUM
afs-6014	52	35	ºc	ºc	NOUN
afs-6014	52	36	for	for	ADP
afs-6014	52	37	10	10	NUM
afs-6014	52	38	min	min	NOUN
afs-6014	52	39	.	.	PUNCT
afs-6014	53	1	thereafter	thereafter	ADV
afs-6014	53	2	the	the	DET
afs-6014	53	3	dna	dna	PROPN
afs-6014	53	4	was	be	AUX
afs-6014	53	5	purified	purify	VERB
afs-6014	53	6	with	with	ADP
afs-6014	53	7	ethanol	ethanol	NOUN
afs-6014	53	8	precipitation	precipitation	NOUN
afs-6014	53	9	.	.	PUNCT
afs-6014	54	1	6	6	X
afs-6014	54	2	.	.	X
afs-6014	54	3	hair	hair	NOUN
afs-6014	54	4	roots	root	NOUN
afs-6014	54	5	were	be	AUX
afs-6014	54	6	lysed	lyse	VERB
afs-6014	54	7	in	in	ADP
afs-6014	54	8	lysis	lysis	NOUN
afs-6014	54	9	buffer	buffer	NOUN
afs-6014	54	10	(	(	PUNCT
afs-6014	54	11	10	10	NUM
afs-6014	54	12	mm	mm	PROPN
afs-6014	54	13	tris	tris	NOUN
afs-6014	54	14	hcl	hcl	PROPN
afs-6014	54	15	,	,	PUNCT
afs-6014	54	16	ph	ph	PROPN
afs-6014	54	17	8.0	8.0	NUM
afs-6014	54	18	,	,	PUNCT
afs-6014	54	19	100	100	NUM
afs-6014	54	20	mm	mm	NOUN
afs-6014	54	21	nacl	nacl	NOUN
afs-6014	54	22	,	,	PUNCT
afs-6014	54	23	1	1	NUM
afs-6014	54	24	mm	mm	NUM
afs-6014	54	25	edta	edta	NOUN
afs-6014	54	26	,	,	PUNCT
afs-6014	54	27	0.5	0.5	NUM
afs-6014	54	28	%	%	NOUN
afs-6014	54	29	sds	sds	NOUN
afs-6014	54	30	)	)	PUNCT
afs-6014	54	31	with	with	ADP
afs-6014	54	32	proteinase	proteinase	PROPN
afs-6014	54	33	k	k	PROPN
afs-6014	54	34	(	(	PUNCT
afs-6014	54	35	10	10	NUM
afs-6014	54	36	mg	mg	NUM
afs-6014	54	37	/	/	SYM
afs-6014	54	38	ml	ml	NOUN
afs-6014	54	39	)	)	PUNCT
afs-6014	54	40	at	at	ADP
afs-6014	54	41	55	55	NUM
afs-6014	54	42	ºc	ºc	NOUN
afs-6014	54	43	for	for	ADP
afs-6014	54	44	60	60	NUM
afs-6014	54	45	min	min	NOUN
afs-6014	54	46	following	follow	VERB
afs-6014	54	47	proteinase	proteinase	NOUN
afs-6014	54	48	k	k	PROPN
afs-6014	54	49	inactivation	inactivation	NOUN
afs-6014	54	50	at	at	ADP
afs-6014	54	51	a	a	DET
afs-6014	54	52	g	g	NOUN
afs-6014	54	53	r	r	NOUN
afs-6014	55	1	i	i	NOUN
afs-6014	55	2	c	c	NOUN
afs-6014	55	3	u	u	NOUN
afs-6014	55	4	l	l	NOUN
afs-6014	55	5	t	t	NOUN
afs-6014	55	6	u	u	X
afs-6014	55	7	r	r	NOUN
afs-6014	55	8	a	a	PROPN
afs-6014	55	9	l	l	NOUN
afs-6014	55	10	a	a	DET
afs-6014	55	11	n	n	NOUN
afs-6014	56	1	d	d	NOUN
afs-6014	56	2	f	f	X
afs-6014	57	1	o	o	NOUN
afs-6014	57	2	o	o	X
afs-6014	58	1	d	d	X
afs-6014	58	2	s	s	X
afs-6014	58	3	c	c	NOUN
afs-6014	59	1	i	i	NOUN
afs-6014	59	2	e	e	PROPN
afs-6014	59	3	n	n	PROPN
afs-6014	59	4	c	c	NOUN
afs-6014	59	5	e	e	X
afs-6014	59	6	sironen	sironen	PROPN
afs-6014	59	7	,	,	PUNCT
afs-6014	59	8	a.	a.	PROPN
afs-6014	59	9	et	et	PROPN
afs-6014	59	10	al	al	PROPN
afs-6014	59	11	.	.	PROPN
afs-6014	59	12	high	high	ADJ
afs-6014	59	13	throughput	throughput	NOUN
afs-6014	59	14	genotyping	genotype	VERB
afs-6014	59	15	from	from	ADP
afs-6014	59	16	porcine	porcine	NOUN
afs-6014	59	17	hair	hair	NOUN
afs-6014	59	18	follicles	follicle	VERB
afs-6014	59	19	144	144	NUM
afs-6014	59	20	a	a	DET
afs-6014	59	21	g	g	NOUN
afs-6014	60	1	r	r	NOUN
afs-6014	61	1	i	i	NOUN
afs-6014	61	2	c	c	NOUN
afs-6014	61	3	u	u	NOUN
afs-6014	61	4	l	l	NOUN
afs-6014	61	5	t	t	NOUN
afs-6014	61	6	u	u	X
afs-6014	61	7	r	r	NOUN
afs-6014	61	8	a	a	PROPN
afs-6014	61	9	l	l	NOUN
afs-6014	61	10	a	a	DET
afs-6014	61	11	n	n	NOUN
afs-6014	62	1	d	d	NOUN
afs-6014	62	2	f	f	X
afs-6014	63	1	o	o	NOUN
afs-6014	63	2	o	o	X
afs-6014	64	1	d	d	X
afs-6014	64	2	s	s	X
afs-6014	64	3	c	c	NOUN
afs-6014	65	1	i	i	NOUN
afs-6014	65	2	e	e	PROPN
afs-6014	65	3	n	n	PROPN
afs-6014	65	4	c	c	NOUN
afs-6014	65	5	e	e	NOUN
afs-6014	65	6	vol	vol	NOUN
afs-6014	65	7	.	.	PUNCT
afs-6014	66	1	20(2011	20(2011	NUM
afs-6014	66	2	):	):	PUNCT
afs-6014	66	3	143–150	143–150	NUM
afs-6014	66	4	.	.	PUNCT
afs-6014	66	5	145	145	NUM
afs-6014	66	6	98	98	NUM
afs-6014	66	7	ºc	ºc	NOUN
afs-6014	66	8	for	for	ADP
afs-6014	66	9	10	10	NUM
afs-6014	66	10	min	min	NOUN
afs-6014	66	11	.	.	PROPN
afs-6014	67	1	thereafter	thereafter	ADV
afs-6014	67	2	,	,	PUNCT
afs-6014	67	3	dna	dna	PROPN
afs-6014	67	4	was	be	AUX
afs-6014	67	5	purified	purify	VERB
afs-6014	67	6	by	by	ADP
afs-6014	67	7	precipitation	precipitation	NOUN
afs-6014	67	8	with	with	ADP
afs-6014	67	9	ethanol	ethanol	NOUN
afs-6014	67	10	.	.	PUNCT
afs-6014	68	1	7	7	X
afs-6014	68	2	.	.	X
afs-6014	68	3	extraction	extraction	NOUN
afs-6014	68	4	of	of	ADP
afs-6014	68	5	dna	dna	NOUN
afs-6014	68	6	with	with	ADP
afs-6014	68	7	dneasy	dneasy	NOUN
afs-6014	68	8	blood	blood	NOUN
afs-6014	68	9	&	&	CCONJ
afs-6014	68	10	tissue	tissue	NOUN
afs-6014	68	11	kit	kit	NOUN
afs-6014	68	12	(	(	PUNCT
afs-6014	68	13	qiagen	qiagen	PROPN
afs-6014	68	14	)	)	PUNCT
afs-6014	68	15	according	accord	VERB
afs-6014	68	16	to	to	ADP
afs-6014	68	17	the	the	DET
afs-6014	68	18	instructions	instruction	NOUN
afs-6014	68	19	supplied	supply	VERB
afs-6014	68	20	by	by	ADP
afs-6014	68	21	the	the	DET
afs-6014	68	22	manufacturer	manufacturer	NOUN
afs-6014	68	23	.	.	PUNCT
afs-6014	69	1	for	for	ADP
afs-6014	69	2	the	the	DET
afs-6014	69	3	lysis	lysis	NOUN
afs-6014	69	4	protocols	protocol	NOUN
afs-6014	69	5	(	(	PUNCT
afs-6014	69	6	1	1	NUM
afs-6014	69	7	,	,	PUNCT
afs-6014	69	8	5–6	5–6	NUM
afs-6014	69	9	)	)	PUNCT
afs-6014	69	10	the	the	DET
afs-6014	69	11	effect	effect	NOUN
afs-6014	69	12	of	of	ADP
afs-6014	69	13	addition	addition	NOUN
afs-6014	69	14	of	of	ADP
afs-6014	69	15	mgcl2	mgcl2	PROPN
afs-6014	69	16	(	(	PUNCT
afs-6014	69	17	2	2	NUM
afs-6014	69	18	mm	mm	NOUN
afs-6014	69	19	)	)	PUNCT
afs-6014	69	20	and	and	CCONJ
afs-6014	69	21	dtt	dtt	X
afs-6014	69	22	(	(	PUNCT
afs-6014	69	23	100	100	NUM
afs-6014	69	24	µm	µm	NOUN
afs-6014	69	25	)	)	PUNCT
afs-6014	69	26	and	and	CCONJ
afs-6014	69	27	dissolution	dissolution	NOUN
afs-6014	69	28	of	of	ADP
afs-6014	69	29	the	the	DET
afs-6014	69	30	hair	hair	NOUN
afs-6014	69	31	root	root	NOUN
afs-6014	69	32	by	by	ADP
afs-6014	69	33	mechanical	mechanical	ADJ
afs-6014	69	34	force	force	NOUN
afs-6014	69	35	(	(	PUNCT
afs-6014	69	36	with	with	ADP
afs-6014	69	37	a	a	DET
afs-6014	69	38	rod	rod	NOUN
afs-6014	69	39	or	or	CCONJ
afs-6014	69	40	fastprep	fastprep	ADJ
afs-6014	69	41	homogenization	homogenization	NOUN
afs-6014	69	42	system	system	NOUN
afs-6014	69	43	)	)	PUNCT
afs-6014	69	44	were	be	AUX
afs-6014	69	45	also	also	ADV
afs-6014	69	46	tested	test	VERB
afs-6014	69	47	.	.	PUNCT
afs-6014	70	1	the	the	DET
afs-6014	70	2	concentration	concentration	NOUN
afs-6014	70	3	of	of	ADP
afs-6014	70	4	extracted	extract	VERB
afs-6014	70	5	dna	dna	NOUN
afs-6014	70	6	was	be	AUX
afs-6014	70	7	measured	measure	VERB
afs-6014	70	8	with	with	ADP
afs-6014	70	9	a	a	DET
afs-6014	70	10	nanodrop	nanodrop	NOUN
afs-6014	70	11	spectrophotometer	spectrophotometer	NOUN
afs-6014	70	12	(	(	PUNCT
afs-6014	70	13	nanodrop	nanodrop	NOUN
afs-6014	70	14	technologies	technology	NOUN
afs-6014	70	15	)	)	PUNCT
afs-6014	70	16	and	and	CCONJ
afs-6014	70	17	a	a	DET
afs-6014	70	18	qubit	qubit	NOUN
afs-6014	70	19	quantitation	quantitation	NOUN
afs-6014	70	20	platform	platform	NOUN
afs-6014	70	21	(	(	PUNCT
afs-6014	70	22	invitrogen	invitrogen	PROPN
afs-6014	70	23	)	)	PUNCT
afs-6014	70	24	.	.	PUNCT
afs-6014	71	1	nanodrop	nanodrop	PROPN
afs-6014	71	2	was	be	AUX
afs-6014	71	3	also	also	ADV
afs-6014	71	4	used	use	VERB
afs-6014	71	5	for	for	ADP
afs-6014	71	6	analysing	analyse	VERB
afs-6014	71	7	the	the	DET
afs-6014	71	8	purity	purity	NOUN
afs-6014	71	9	of	of	ADP
afs-6014	71	10	extracted	extract	VERB
afs-6014	71	11	dna	dna	PROPN
afs-6014	71	12	.	.	PUNCT
afs-6014	72	1	absorbance	absorbance	NOUN
afs-6014	72	2	at	at	ADP
afs-6014	72	3	260	260	NUM
afs-6014	72	4	nm	nm	PRON
afs-6014	72	5	quantified	quantify	VERB
afs-6014	72	6	the	the	DET
afs-6014	72	7	amount	amount	NOUN
afs-6014	72	8	of	of	ADP
afs-6014	72	9	dna	dna	NOUN
afs-6014	72	10	and	and	CCONJ
afs-6014	72	11	protein	protein	NOUN
afs-6014	72	12	contamination	contamination	NOUN
afs-6014	72	13	was	be	AUX
afs-6014	72	14	detected	detect	VERB
afs-6014	72	15	at	at	ADP
afs-6014	72	16	280	280	NUM
afs-6014	72	17	nm	nm	NOUN
afs-6014	72	18	.	.	PUNCT
afs-6014	73	1	the	the	DET
afs-6014	73	2	ratio	ratio	NOUN
afs-6014	73	3	of	of	ADP
afs-6014	73	4	absorbance	absorbance	NOUN
afs-6014	73	5	at	at	ADP
afs-6014	73	6	a260/280	a260/280	NOUN
afs-6014	73	7	and	and	CCONJ
afs-6014	73	8	a230/260	a230/260	NOUN
afs-6014	73	9	was	be	AUX
afs-6014	73	10	used	use	VERB
afs-6014	73	11	to	to	PART
afs-6014	73	12	determine	determine	VERB
afs-6014	73	13	the	the	DET
afs-6014	73	14	purity	purity	NOUN
afs-6014	73	15	of	of	ADP
afs-6014	73	16	dna	dna	PROPN
afs-6014	73	17	samples	sample	NOUN
afs-6014	73	18	.	.	PUNCT
afs-6014	74	1	the	the	DET
afs-6014	74	2	qubit	qubit	NOUN
afs-6014	74	3	platform	platform	NOUN
afs-6014	74	4	uses	use	VERB
afs-6014	74	5	fluorescence	fluorescence	NOUN
afs-6014	74	6	-	-	PUNCT
afs-6014	74	7	based	base	VERB
afs-6014	74	8	quantit	quantit	NOUN
afs-6014	74	9	™	™	ADJ
afs-6014	74	10	assays	assay	NOUN
afs-6014	74	11	,	,	PUNCT
afs-6014	74	12	where	where	SCONJ
afs-6014	74	13	fluorescence	fluorescence	NOUN
afs-6014	74	14	label	label	NOUN
afs-6014	74	15	binds	bind	VERB
afs-6014	74	16	specifically	specifically	ADV
afs-6014	74	17	to	to	ADP
afs-6014	74	18	dna	dna	PROPN
afs-6014	74	19	.	.	PUNCT
afs-6014	75	1	although	although	SCONJ
afs-6014	75	2	the	the	DET
afs-6014	75	3	specificity	specificity	NOUN
afs-6014	75	4	to	to	PART
afs-6014	75	5	dsdna	dsdna	VERB
afs-6014	75	6	increases	increase	VERB
afs-6014	75	7	the	the	DET
afs-6014	75	8	accuracy	accuracy	NOUN
afs-6014	75	9	of	of	ADP
afs-6014	75	10	the	the	DET
afs-6014	75	11	dna	dna	PROPN
afs-6014	75	12	concentration	concentration	NOUN
afs-6014	75	13	,	,	PUNCT
afs-6014	75	14	this	this	DET
afs-6014	75	15	detection	detection	NOUN
afs-6014	75	16	system	system	NOUN
afs-6014	75	17	does	do	AUX
afs-6014	75	18	not	not	PART
afs-6014	75	19	give	give	VERB
afs-6014	75	20	any	any	DET
afs-6014	75	21	information	information	NOUN
afs-6014	75	22	about	about	ADP
afs-6014	75	23	the	the	DET
afs-6014	75	24	purity	purity	NOUN
afs-6014	75	25	of	of	ADP
afs-6014	75	26	the	the	DET
afs-6014	75	27	sample	sample	NOUN
afs-6014	75	28	.	.	PUNCT
afs-6014	76	1	the	the	DET
afs-6014	76	2	accuracy	accuracy	NOUN
afs-6014	76	3	of	of	ADP
afs-6014	76	4	these	these	DET
afs-6014	76	5	concentration	concentration	NOUN
afs-6014	76	6	measurements	measurement	NOUN
afs-6014	76	7	were	be	AUX
afs-6014	76	8	also	also	ADV
afs-6014	76	9	confirmed	confirm	VERB
afs-6014	76	10	by	by	ADP
afs-6014	76	11	quantitative	quantitative	ADJ
afs-6014	76	12	pcr	pcr	NOUN
afs-6014	76	13	(	(	PUNCT
afs-6014	76	14	qpcr	qpcr	ADJ
afs-6014	76	15	)	)	PUNCT
afs-6014	76	16	.	.	PUNCT
afs-6014	77	1	the	the	DET
afs-6014	77	2	qpcr	qpcr	ADJ
afs-6014	77	3	was	be	AUX
afs-6014	77	4	performed	perform	VERB
afs-6014	77	5	with	with	ADP
afs-6014	77	6	an	an	DET
afs-6014	77	7	abi	abi	NOUN
afs-6014	77	8	7000	7000	NUM
afs-6014	77	9	sequence	sequence	NOUN
afs-6014	77	10	detection	detection	NOUN
afs-6014	77	11	system	system	NOUN
afs-6014	77	12	in	in	ADP
afs-6014	77	13	96	96	NUM
afs-6014	77	14	-	-	PUNCT
afs-6014	77	15	well	well	NOUN
afs-6014	77	16	microtiter	microtiter	ADJ
afs-6014	77	17	plates	plate	NOUN
afs-6014	77	18	using	use	VERB
afs-6014	77	19	absolute	absolute	ADJ
afs-6014	77	20	qpcr	qpcr	ADJ
afs-6014	77	21	sybr	sybr	NOUN
afs-6014	77	22	green	green	ADJ
afs-6014	77	23	rox	rox	PROPN
afs-6014	77	24	mix	mix	NOUN
afs-6014	77	25	(	(	PUNCT
afs-6014	77	26	vwr	vwr	PROPN
afs-6014	77	27	)	)	PUNCT
afs-6014	77	28	.	.	PUNCT
afs-6014	78	1	dna	dna	PROPN
afs-6014	78	2	was	be	AUX
afs-6014	78	3	amplified	amplify	VERB
afs-6014	78	4	using	use	VERB
afs-6014	78	5	primers	primer	NOUN
afs-6014	78	6	for	for	ADP
afs-6014	78	7	the	the	DET
afs-6014	78	8	microsatellite	microsatellite	ADJ
afs-6014	78	9	marker	marker	NOUN
afs-6014	78	10	sw2411	sw2411	NOUN
afs-6014	78	11	(	(	PUNCT
afs-6014	78	12	forward	forward	ADJ
afs-6014	78	13	cctggactcattcttgctttg	cctggactcattcttgctttg	NOUN
afs-6014	78	14	,	,	PUNCT
afs-6014	78	15	reverse	reverse	ADJ
afs-6014	78	16	ttcctattctgtcctgccttg	ttcctattctgtcctgccttg	PROPN
afs-6014	78	17	)	)	PUNCT
afs-6014	78	18	.	.	PUNCT
afs-6014	79	1	amplification	amplification	NOUN
afs-6014	79	2	by	by	ADP
afs-6014	79	3	qpcr	qpcr	ADV
afs-6014	79	4	contained	contain	VERB
afs-6014	79	5	12.5	12.5	NUM
afs-6014	79	6	μl	μl	ADP
afs-6014	79	7	of	of	ADP
afs-6014	79	8	absolute	absolute	ADJ
afs-6014	79	9	qpcr	qpcr	ADV
afs-6014	79	10	sybr	sybr	ADJ
afs-6014	79	11	green	green	ADJ
afs-6014	79	12	mix	mix	NOUN
afs-6014	79	13	,	,	PUNCT
afs-6014	79	14	20	20	NUM
afs-6014	79	15	ng	ng	PROPN
afs-6014	79	16	of	of	ADP
afs-6014	79	17	dna	dna	PROPN
afs-6014	79	18	,	,	PUNCT
afs-6014	79	19	and	and	CCONJ
afs-6014	79	20	70	70	NUM
afs-6014	79	21	nm	nm	NOUN
afs-6014	79	22	of	of	ADP
afs-6014	79	23	each	each	DET
afs-6014	79	24	primer	primer	NOUN
afs-6014	79	25	in	in	ADP
afs-6014	79	26	a	a	DET
afs-6014	79	27	final	final	ADJ
afs-6014	79	28	volume	volume	NOUN
afs-6014	79	29	of	of	ADP
afs-6014	79	30	25	25	NUM
afs-6014	79	31	μl	μl	NOUN
afs-6014	79	32	.	.	PUNCT
afs-6014	80	1	amplifications	amplification	NOUN
afs-6014	80	2	were	be	AUX
afs-6014	80	3	initiated	initiate	VERB
afs-6014	80	4	with	with	ADP
afs-6014	80	5	15	15	NUM
afs-6014	80	6	min	min	NOUN
afs-6014	80	7	enzyme	enzyme	NOUN
afs-6014	80	8	activation	activation	NOUN
afs-6014	80	9	at	at	ADP
afs-6014	80	10	95	95	NUM
afs-6014	80	11	°	°	NOUN
afs-6014	80	12	c	c	NOUN
afs-6014	80	13	followed	follow	VERB
afs-6014	80	14	by	by	ADP
afs-6014	80	15	40	40	NUM
afs-6014	80	16	cycles	cycle	NOUN
afs-6014	80	17	of	of	ADP
afs-6014	80	18	denaturation	denaturation	NOUN
afs-6014	80	19	at	at	ADP
afs-6014	80	20	95	95	NUM
afs-6014	80	21	°	°	ADP
afs-6014	80	22	c	c	NOUN
afs-6014	80	23	for	for	ADP
afs-6014	80	24	15	15	NUM
afs-6014	80	25	s	s	NOUN
afs-6014	80	26	,	,	PUNCT
afs-6014	80	27	primer	primer	NOUN
afs-6014	80	28	annealing	annealing	NOUN
afs-6014	80	29	at	at	ADP
afs-6014	80	30	60	60	NUM
afs-6014	80	31	°	°	ADP
afs-6014	80	32	c	c	NOUN
afs-6014	80	33	for	for	ADP
afs-6014	80	34	30	30	NUM
afs-6014	80	35	s	s	NOUN
afs-6014	80	36	,	,	PUNCT
afs-6014	80	37	and	and	CCONJ
afs-6014	80	38	extension	extension	NOUN
afs-6014	80	39	at	at	ADP
afs-6014	80	40	72	72	NUM
afs-6014	80	41	°	°	ADP
afs-6014	80	42	c	c	NOUN
afs-6014	80	43	for	for	ADP
afs-6014	80	44	30	30	NUM
afs-6014	80	45	s.	s.	NOUN
afs-6014	80	46	all	all	DET
afs-6014	80	47	samples	sample	NOUN
afs-6014	80	48	were	be	AUX
afs-6014	80	49	amplified	amplify	VERB
afs-6014	80	50	in	in	ADP
afs-6014	80	51	duplicate	duplicate	NOUN
afs-6014	80	52	and	and	CCONJ
afs-6014	80	53	a	a	DET
afs-6014	80	54	water	water	NOUN
afs-6014	80	55	sample	sample	NOUN
afs-6014	80	56	was	be	AUX
afs-6014	80	57	used	use	VERB
afs-6014	80	58	as	as	ADP
afs-6014	80	59	a	a	DET
afs-6014	80	60	negative	negative	ADJ
afs-6014	80	61	control	control	NOUN
afs-6014	80	62	.	.	PUNCT
afs-6014	81	1	a	a	DET
afs-6014	81	2	standard	standard	ADJ
afs-6014	81	3	curve	curve	NOUN
afs-6014	81	4	was	be	AUX
afs-6014	81	5	produced	produce	VERB
afs-6014	81	6	by	by	ADP
afs-6014	81	7	serial	serial	ADJ
afs-6014	81	8	dilutions	dilution	NOUN
afs-6014	81	9	of	of	ADP
afs-6014	81	10	dna	dna	PROPN
afs-6014	81	11	extracted	extract	VERB
afs-6014	81	12	from	from	ADP
afs-6014	81	13	boar	boar	NOUN
afs-6014	81	14	sperm	sperm	NOUN
afs-6014	81	15	(	(	PUNCT
afs-6014	81	16	quantified	quantify	VERB
afs-6014	81	17	with	with	ADP
afs-6014	81	18	nanodrop	nanodrop	NOUN
afs-6014	81	19	spectrophotometer	spectrophotometer	NOUN
afs-6014	81	20	)	)	PUNCT
afs-6014	81	21	.	.	PUNCT
afs-6014	82	1	quantities	quantity	NOUN
afs-6014	82	2	of	of	ADP
afs-6014	82	3	dna	dna	PROPN
afs-6014	82	4	in	in	ADP
afs-6014	82	5	the	the	DET
afs-6014	82	6	sample	sample	NOUN
afs-6014	82	7	were	be	AUX
afs-6014	82	8	estimated	estimate	VERB
afs-6014	82	9	from	from	ADP
afs-6014	82	10	the	the	DET
afs-6014	82	11	standard	standard	ADJ
afs-6014	82	12	curve	curve	NOUN
afs-6014	82	13	.	.	PUNCT
afs-6014	83	1	raw	raw	ADJ
afs-6014	83	2	data	datum	NOUN
afs-6014	83	3	were	be	AUX
afs-6014	83	4	analyzed	analyze	VERB
afs-6014	83	5	with	with	ADP
afs-6014	83	6	the	the	DET
afs-6014	83	7	sequence	sequence	NOUN
afs-6014	83	8	detection	detection	NOUN
afs-6014	83	9	software	software	NOUN
afs-6014	83	10	(	(	PUNCT
afs-6014	83	11	applied	apply	VERB
afs-6014	83	12	biosystems	biosystem	NOUN
afs-6014	83	13	)	)	PUNCT
afs-6014	83	14	.	.	PUNCT
afs-6014	84	1	genotyping	genotype	VERB
afs-6014	84	2	for	for	ADP
afs-6014	84	3	high	high	ADJ
afs-6014	84	4	throughput	throughput	NOUN
afs-6014	84	5	genotyping	genotype	VERB
afs-6014	84	6	selected	select	VERB
afs-6014	84	7	samples	sample	NOUN
afs-6014	84	8	were	be	AUX
afs-6014	84	9	analyzed	analyze	VERB
afs-6014	84	10	on	on	ADP
afs-6014	84	11	the	the	DET
afs-6014	84	12	porcinesnp60	porcinesnp60	NOUN
afs-6014	84	13	genotyping	genotyping	NOUN
afs-6014	84	14	beadchip	beadchip	NOUN
afs-6014	84	15	(	(	PUNCT
afs-6014	84	16	illumina	illumina	PROPN
afs-6014	84	17	ltd	ltd	PROPN
afs-6014	84	18	)	)	PUNCT
afs-6014	84	19	in	in	ADP
afs-6014	84	20	the	the	DET
afs-6014	84	21	institute	institute	NOUN
afs-6014	84	22	for	for	ADP
afs-6014	84	23	molecular	molecular	ADJ
afs-6014	84	24	medicine	medicine	NOUN
afs-6014	84	25	finland	finland	PROPN
afs-6014	84	26	(	(	PUNCT
afs-6014	84	27	fimm	fimm	NOUN
afs-6014	84	28	)	)	PUNCT
afs-6014	84	29	.	.	PUNCT
afs-6014	85	1	the	the	DET
afs-6014	85	2	porcinesnp60	porcinesnp60	PROPN
afs-6014	85	3	beadchip	beadchip	NOUN
afs-6014	85	4	has	have	AUX
afs-6014	85	5	recently	recently	ADV
afs-6014	85	6	been	be	AUX
afs-6014	85	7	developed	develop	VERB
afs-6014	85	8	as	as	ADP
afs-6014	85	9	an	an	DET
afs-6014	85	10	outcome	outcome	NOUN
afs-6014	85	11	from	from	ADP
afs-6014	85	12	the	the	DET
afs-6014	85	13	porcine	porcine	NOUN
afs-6014	85	14	whole	whole	ADJ
afs-6014	85	15	genome	genome	NOUN
afs-6014	85	16	sequencing	sequence	VERB
afs-6014	85	17	project	project	NOUN
afs-6014	85	18	(	(	PUNCT
afs-6014	85	19	ramos	ramos	PROPN
afs-6014	85	20	et	et	PROPN
afs-6014	85	21	al	al	PROPN
afs-6014	85	22	.	.	PROPN
afs-6014	85	23	2009	2009	NUM
afs-6014	85	24	)	)	PUNCT
afs-6014	85	25	.	.	PUNCT
afs-6014	86	1	the	the	DET
afs-6014	86	2	concentration	concentration	NOUN
afs-6014	86	3	of	of	ADP
afs-6014	86	4	samples	sample	NOUN
afs-6014	86	5	analyzed	analyze	VERB
afs-6014	86	6	by	by	ADP
afs-6014	86	7	the	the	DET
afs-6014	86	8	beadchip	beadchip	NOUN
afs-6014	86	9	was	be	AUX
afs-6014	86	10	estimated	estimate	VERB
afs-6014	86	11	by	by	ADP
afs-6014	86	12	qubit	qubit	NOUN
afs-6014	86	13	measurements	measurement	NOUN
afs-6014	86	14	and	and	CCONJ
afs-6014	86	15	the	the	DET
afs-6014	86	16	purity	purity	NOUN
afs-6014	86	17	was	be	AUX
afs-6014	86	18	confirmed	confirm	VERB
afs-6014	86	19	by	by	ADP
afs-6014	86	20	nanodrop	nanodrop	NOUN
afs-6014	86	21	.	.	PUNCT
afs-6014	87	1	the	the	DET
afs-6014	87	2	concentration	concentration	NOUN
afs-6014	87	3	varied	varied	ADJ
afs-6014	87	4	between	between	ADP
afs-6014	87	5	2–100	2–100	NUM
afs-6014	87	6	ng/µl	ng/µl	NUM
afs-6014	87	7	.	.	PUNCT
afs-6014	88	1	dna	dna	PROPN
afs-6014	88	2	samples	sample	NOUN
afs-6014	88	3	of	of	ADP
afs-6014	88	4	three	three	NUM
afs-6014	88	5	boars	boar	NOUN
afs-6014	88	6	with	with	ADP
afs-6014	88	7	three	three	NUM
afs-6014	88	8	different	different	ADJ
afs-6014	88	9	dna	dna	NOUN
afs-6014	88	10	preparation	preparation	NOUN
afs-6014	88	11	methods	method	NOUN
afs-6014	88	12	(	(	PUNCT
afs-6014	88	13	1	1	NUM
afs-6014	88	14	,	,	PUNCT
afs-6014	88	15	2	2	NUM
afs-6014	88	16	and	and	CCONJ
afs-6014	88	17	7	7	NUM
afs-6014	88	18	)	)	PUNCT
afs-6014	88	19	from	from	ADP
afs-6014	88	20	hair	hair	NOUN
afs-6014	88	21	roots	root	NOUN
afs-6014	88	22	and	and	CCONJ
afs-6014	88	23	a	a	DET
afs-6014	88	24	reference	reference	NOUN
afs-6014	88	25	sample	sample	NOUN
afs-6014	88	26	extracted	extract	VERB
afs-6014	88	27	from	from	ADP
afs-6014	88	28	sperm	sperm	NOUN
afs-6014	88	29	were	be	AUX
afs-6014	88	30	selected	select	VERB
afs-6014	88	31	for	for	ADP
afs-6014	88	32	genotyping	genotype	VERB
afs-6014	88	33	with	with	ADP
afs-6014	88	34	the	the	DET
afs-6014	88	35	porcinesnp60	porcinesnp60	NOUN
afs-6014	88	36	beadchip	beadchip	NOUN
afs-6014	88	37	.	.	PUNCT
afs-6014	89	1	furthermore	furthermore	ADV
afs-6014	89	2	,	,	PUNCT
afs-6014	89	3	a	a	DET
afs-6014	89	4	duplicate	duplicate	ADJ
afs-6014	89	5	sample	sample	NOUN
afs-6014	89	6	of	of	ADP
afs-6014	89	7	dna	dna	PROPN
afs-6014	89	8	from	from	ADP
afs-6014	89	9	boar	boar	NOUN
afs-6014	89	10	sperm	sperm	NOUN
afs-6014	89	11	was	be	AUX
afs-6014	89	12	included	include	VERB
afs-6014	89	13	on	on	ADP
afs-6014	89	14	the	the	DET
afs-6014	89	15	chip	chip	NOUN
afs-6014	89	16	in	in	ADP
afs-6014	89	17	order	order	NOUN
afs-6014	89	18	to	to	PART
afs-6014	89	19	compare	compare	VERB
afs-6014	89	20	the	the	DET
afs-6014	89	21	differences	difference	NOUN
afs-6014	89	22	amongst	amongst	ADP
afs-6014	89	23	identical	identical	ADJ
afs-6014	89	24	sperm	sperm	NOUN
afs-6014	89	25	samples	sample	NOUN
afs-6014	89	26	and	and	CCONJ
afs-6014	89	27	variation	variation	NOUN
afs-6014	89	28	between	between	ADP
afs-6014	89	29	dna	dna	PROPN
afs-6014	89	30	preparation	preparation	NOUN
afs-6014	89	31	methods	method	NOUN
afs-6014	89	32	and	and	CCONJ
afs-6014	89	33	sperm	sperm	NOUN
afs-6014	89	34	samples	sample	NOUN
afs-6014	89	35	.	.	PUNCT
afs-6014	90	1	based	base	VERB
afs-6014	90	2	on	on	ADP
afs-6014	90	3	these	these	DET
afs-6014	90	4	analyses	analysis	NOUN
afs-6014	90	5	the	the	DET
afs-6014	90	6	most	most	ADV
afs-6014	90	7	reliable	reliable	ADJ
afs-6014	90	8	dna	dna	NOUN
afs-6014	90	9	extraction	extraction	NOUN
afs-6014	90	10	method	method	NOUN
afs-6014	90	11	for	for	ADP
afs-6014	90	12	hair	hair	NOUN
afs-6014	90	13	samples	sample	NOUN
afs-6014	90	14	was	be	AUX
afs-6014	90	15	selected	select	VERB
afs-6014	90	16	and	and	CCONJ
afs-6014	90	17	an	an	DET
afs-6014	90	18	additional	additional	ADJ
afs-6014	90	19	280	280	NUM
afs-6014	90	20	samples	sample	NOUN
afs-6014	90	21	were	be	AUX
afs-6014	90	22	analyzed	analyze	VERB
afs-6014	90	23	with	with	ADP
afs-6014	90	24	the	the	DET
afs-6014	90	25	porcinesnp60	porcinesnp60	NOUN
afs-6014	90	26	beadchip	beadchip	NOUN
afs-6014	90	27	.	.	PUNCT
afs-6014	91	1	statistical	statistical	ADJ
afs-6014	91	2	analysis	analysis	NOUN
afs-6014	91	3	the	the	DET
afs-6014	91	4	effect	effect	NOUN
afs-6014	91	5	of	of	ADP
afs-6014	91	6	dna	dna	PROPN
afs-6014	91	7	concentration	concentration	NOUN
afs-6014	91	8	and	and	CCONJ
afs-6014	91	9	genotyping	genotyping	NOUN
afs-6014	91	10	batch	batch	NOUN
afs-6014	91	11	on	on	ADP
afs-6014	91	12	call	call	NOUN
afs-6014	91	13	rate	rate	NOUN
afs-6014	91	14	was	be	AUX
afs-6014	91	15	evaluated	evaluate	VERB
afs-6014	91	16	by	by	ADP
afs-6014	91	17	multivariate	multivariate	NOUN
afs-6014	91	18	anova	anova	PROPN
afs-6014	91	19	-	-	NOUN
afs-6014	91	20	method	method	NOUN
afs-6014	91	21	(	(	PUNCT
afs-6014	91	22	sas	sas	PROPN
afs-6014	91	23	enterprise	enterprise	NOUN
afs-6014	91	24	guide	guide	NOUN
afs-6014	91	25	4.3	4.3	NUM
afs-6014	91	26	,	,	PUNCT
afs-6014	91	27	sas	sas	PROPN
afs-6014	91	28	institute	institute	PROPN
afs-6014	91	29	inc	inc	PROPN
afs-6014	91	30	.	.	PROPN
afs-6014	91	31	)	)	PUNCT
afs-6014	91	32	.	.	PUNCT
afs-6014	92	1	results	result	NOUN
afs-6014	92	2	and	and	CCONJ
afs-6014	92	3	discussion	discussion	NOUN
afs-6014	92	4	evaluation	evaluation	NOUN
afs-6014	92	5	of	of	ADP
afs-6014	92	6	dna	dna	PROPN
afs-6014	92	7	preparation	preparation	NOUN
afs-6014	92	8	methods	method	NOUN
afs-6014	92	9	a	a	DET
afs-6014	92	10	wide	wide	ADJ
afs-6014	92	11	range	range	NOUN
afs-6014	92	12	of	of	ADP
afs-6014	92	13	dna	dna	PROPN
afs-6014	92	14	preparation	preparation	NOUN
afs-6014	92	15	methods	method	NOUN
afs-6014	92	16	were	be	AUX
afs-6014	92	17	tested	test	VERB
afs-6014	92	18	including	include	VERB
afs-6014	92	19	a	a	DET
afs-6014	92	20	basic	basic	ADJ
afs-6014	92	21	lysis	lysis	NOUN
afs-6014	92	22	protocol	protocol	NOUN
afs-6014	92	23	with	with	ADP
afs-6014	92	24	different	different	ADJ
afs-6014	92	25	lysis	lysis	NOUN
afs-6014	92	26	buffers	buffer	NOUN
afs-6014	92	27	.	.	PUNCT
afs-6014	93	1	the	the	DET
afs-6014	93	2	hair	hair	NOUN
afs-6014	93	3	root	root	NOUN
afs-6014	93	4	lysis	lysis	NOUN
afs-6014	93	5	has	have	AUX
afs-6014	93	6	been	be	AUX
afs-6014	93	7	successfully	successfully	ADV
afs-6014	93	8	implemented	implement	VERB
afs-6014	93	9	in	in	ADP
afs-6014	93	10	single	single	ADJ
afs-6014	93	11	marker	marker	NOUN
afs-6014	93	12	analysis	analysis	NOUN
afs-6014	93	13	(	(	PUNCT
afs-6014	93	14	sironen	sironen	NOUN
afs-6014	93	15	a	a	DET
afs-6014	93	16	g	g	NOUN
afs-6014	93	17	r	r	NOUN
afs-6014	94	1	i	i	NOUN
afs-6014	94	2	c	c	NOUN
afs-6014	94	3	u	u	NOUN
afs-6014	94	4	l	l	NOUN
afs-6014	94	5	t	t	NOUN
afs-6014	94	6	u	u	X
afs-6014	94	7	r	r	NOUN
afs-6014	94	8	a	a	PROPN
afs-6014	94	9	l	l	NOUN
afs-6014	94	10	a	a	DET
afs-6014	94	11	n	n	NOUN
afs-6014	95	1	d	d	NOUN
afs-6014	95	2	f	f	X
afs-6014	96	1	o	o	NOUN
afs-6014	96	2	o	o	X
afs-6014	97	1	d	d	X
afs-6014	97	2	s	s	X
afs-6014	97	3	c	c	NOUN
afs-6014	98	1	i	i	NOUN
afs-6014	98	2	e	e	PROPN
afs-6014	98	3	n	n	PROPN
afs-6014	98	4	c	c	NOUN
afs-6014	98	5	e	e	X
afs-6014	98	6	sironen	sironen	PROPN
afs-6014	98	7	,	,	PUNCT
afs-6014	98	8	a.	a.	PROPN
afs-6014	98	9	et	et	PROPN
afs-6014	98	10	al	al	PROPN
afs-6014	98	11	.	.	PROPN
afs-6014	98	12	high	high	ADJ
afs-6014	98	13	throughput	throughput	NOUN
afs-6014	98	14	genotyping	genotype	VERB
afs-6014	98	15	from	from	ADP
afs-6014	98	16	porcine	porcine	NOUN
afs-6014	98	17	hair	hair	NOUN
afs-6014	98	18	follicles	follicle	VERB
afs-6014	98	19	146	146	NUM
afs-6014	98	20	a	a	DET
afs-6014	98	21	g	g	NOUN
afs-6014	99	1	r	r	NOUN
afs-6014	100	1	i	i	NOUN
afs-6014	100	2	c	c	NOUN
afs-6014	100	3	u	u	NOUN
afs-6014	100	4	l	l	NOUN
afs-6014	100	5	t	t	NOUN
afs-6014	100	6	u	u	X
afs-6014	100	7	r	r	NOUN
afs-6014	100	8	a	a	PROPN
afs-6014	100	9	l	l	NOUN
afs-6014	100	10	a	a	DET
afs-6014	100	11	n	n	NOUN
afs-6014	101	1	d	d	NOUN
afs-6014	101	2	f	f	X
afs-6014	102	1	o	o	NOUN
afs-6014	102	2	o	o	X
afs-6014	103	1	d	d	X
afs-6014	103	2	s	s	X
afs-6014	103	3	c	c	NOUN
afs-6014	104	1	i	i	NOUN
afs-6014	104	2	e	e	PROPN
afs-6014	104	3	n	n	PROPN
afs-6014	104	4	c	c	NOUN
afs-6014	104	5	e	e	NOUN
afs-6014	104	6	vol	vol	NOUN
afs-6014	104	7	.	.	PUNCT
afs-6014	105	1	20(2011	20(2011	NUM
afs-6014	105	2	):	):	PUNCT
afs-6014	106	1	143–150	143–150	NUM
afs-6014	106	2	.	.	PUNCT
afs-6014	107	1	147	147	NUM
afs-6014	107	2	et	et	NOUN
afs-6014	107	3	al	al	PROPN
afs-6014	107	4	.	.	PROPN
afs-6014	107	5	2010	2010	NUM
afs-6014	107	6	)	)	PUNCT
afs-6014	107	7	,	,	PUNCT
afs-6014	107	8	however	however	ADV
afs-6014	107	9	the	the	DET
afs-6014	107	10	purity	purity	NOUN
afs-6014	107	11	is	be	AUX
afs-6014	107	12	extremely	extremely	ADV
afs-6014	107	13	low	low	ADJ
afs-6014	107	14	in	in	ADP
afs-6014	107	15	these	these	DET
afs-6014	107	16	samples	sample	NOUN
afs-6014	107	17	.	.	PUNCT
afs-6014	108	1	no	no	DET
afs-6014	108	2	clear	clear	ADJ
afs-6014	108	3	differences	difference	NOUN
afs-6014	108	4	in	in	ADP
afs-6014	108	5	dna	dna	PROPN
afs-6014	108	6	yield	yield	NOUN
afs-6014	108	7	or	or	CCONJ
afs-6014	108	8	purity	purity	NOUN
afs-6014	108	9	were	be	AUX
afs-6014	108	10	detected	detect	VERB
afs-6014	108	11	between	between	ADP
afs-6014	108	12	lysis	lysis	NOUN
afs-6014	108	13	buffers	buffer	NOUN
afs-6014	108	14	(	(	PUNCT
afs-6014	108	15	methods	method	NOUN
afs-6014	108	16	2	2	NUM
afs-6014	108	17	,	,	PUNCT
afs-6014	108	18	5	5	NUM
afs-6014	108	19	and	and	CCONJ
afs-6014	108	20	6	6	NUM
afs-6014	108	21	)	)	PUNCT
afs-6014	108	22	or	or	CCONJ
afs-6014	108	23	following	follow	VERB
afs-6014	108	24	modification	modification	NOUN
afs-6014	108	25	of	of	ADP
afs-6014	108	26	the	the	DET
afs-6014	108	27	lysis	lysis	NOUN
afs-6014	108	28	protocol	protocol	NOUN
afs-6014	108	29	(	(	PUNCT
afs-6014	108	30	addition	addition	NOUN
afs-6014	108	31	of	of	ADP
afs-6014	108	32	dtt	dtt	NOUN
afs-6014	108	33	/	/	SYM
afs-6014	108	34	mgcl2	mgcl2	PROPN
afs-6014	108	35	or	or	CCONJ
afs-6014	108	36	dissolution	dissolution	NOUN
afs-6014	108	37	,	,	PUNCT
afs-6014	108	38	table	table	NOUN
afs-6014	108	39	1	1	NUM
afs-6014	108	40	)	)	PUNCT
afs-6014	108	41	.	.	PUNCT
afs-6014	109	1	the	the	DET
afs-6014	109	2	most	most	ADV
afs-6014	109	3	consistent	consistent	ADJ
afs-6014	109	4	results	result	NOUN
afs-6014	109	5	were	be	AUX
afs-6014	109	6	produced	produce	VERB
afs-6014	109	7	using	use	VERB
afs-6014	109	8	15	15	NUM
afs-6014	109	9	hair	hair	NOUN
afs-6014	109	10	roots	root	NOUN
afs-6014	109	11	,	,	PUNCT
afs-6014	109	12	even	even	ADV
afs-6014	109	13	though	though	SCONJ
afs-6014	109	14	10	10	NUM
afs-6014	109	15	or	or	CCONJ
afs-6014	109	16	even	even	ADV
afs-6014	109	17	5	5	NUM
afs-6014	109	18	hair	hair	NOUN
afs-6014	109	19	roots	root	NOUN
afs-6014	109	20	yielded	yield	VERB
afs-6014	109	21	adequate	adequate	ADJ
afs-6014	109	22	amounts	amount	NOUN
afs-6014	109	23	of	of	ADP
afs-6014	109	24	dna	dna	NOUN
afs-6014	109	25	depending	depend	VERB
afs-6014	109	26	on	on	ADP
afs-6014	109	27	the	the	DET
afs-6014	109	28	sample	sample	NOUN
afs-6014	109	29	(	(	PUNCT
afs-6014	109	30	data	datum	NOUN
afs-6014	109	31	not	not	PART
afs-6014	109	32	shown	show	VERB
afs-6014	109	33	)	)	PUNCT
afs-6014	109	34	.	.	PUNCT
afs-6014	110	1	therefore	therefore	ADV
afs-6014	110	2	the	the	DET
afs-6014	110	3	lysis	lysis	NOUN
afs-6014	110	4	buffer	buffer	NOUN
afs-6014	110	5	(	(	PUNCT
afs-6014	110	6	method	method	NOUN
afs-6014	110	7	1	1	NUM
afs-6014	110	8	)	)	PUNCT
afs-6014	110	9	used	use	VERB
afs-6014	110	10	in	in	ADP
afs-6014	110	11	our	our	PRON
afs-6014	110	12	previous	previous	ADJ
afs-6014	110	13	studies	study	NOUN
afs-6014	110	14	(	(	PUNCT
afs-6014	110	15	sironen	sironen	PROPN
afs-6014	110	16	et	et	PROPN
afs-6014	110	17	al	al	PROPN
afs-6014	110	18	.	.	PROPN
afs-6014	110	19	2010	2010	NUM
afs-6014	110	20	)	)	PUNCT
afs-6014	110	21	with	with	ADP
afs-6014	110	22	15	15	NUM
afs-6014	110	23	hair	hair	NOUN
afs-6014	110	24	roots	root	NOUN
afs-6014	110	25	was	be	AUX
afs-6014	110	26	selected	select	VERB
afs-6014	110	27	for	for	ADP
afs-6014	110	28	further	further	ADJ
afs-6014	110	29	purification	purification	NOUN
afs-6014	110	30	.	.	PUNCT
afs-6014	111	1	dna	dna	PROPN
afs-6014	111	2	extraction	extraction	NOUN
afs-6014	111	3	with	with	ADP
afs-6014	111	4	the	the	DET
afs-6014	111	5	instagene	instagene	NOUN
afs-6014	111	6	matrix	matrix	NOUN
afs-6014	111	7	(	(	PUNCT
afs-6014	111	8	method	method	NOUN
afs-6014	111	9	4	4	NUM
afs-6014	111	10	)	)	PUNCT
afs-6014	111	11	and	and	CCONJ
afs-6014	111	12	by	by	ADP
afs-6014	111	13	chloroform	chloroform	NOUN
afs-6014	111	14	/	/	SYM
afs-6014	111	15	phenol	phenol	NOUN
afs-6014	111	16	(	(	PUNCT
afs-6014	111	17	method	method	NOUN
afs-6014	111	18	3	3	NUM
afs-6014	111	19	)	)	PUNCT
afs-6014	111	20	resulted	result	VERB
afs-6014	111	21	in	in	ADP
afs-6014	111	22	low	low	ADJ
afs-6014	111	23	dna	dna	NOUN
afs-6014	111	24	concentrations	concentration	NOUN
afs-6014	111	25	(	(	PUNCT
afs-6014	111	26	table	table	NOUN
afs-6014	111	27	1	1	NUM
afs-6014	111	28	)	)	PUNCT
afs-6014	111	29	.	.	PUNCT
afs-6014	112	1	ethanol	ethanol	NOUN
afs-6014	112	2	precipitation	precipitation	NOUN
afs-6014	112	3	(	(	PUNCT
afs-6014	112	4	method	method	NOUN
afs-6014	112	5	2	2	NUM
afs-6014	112	6	)	)	PUNCT
afs-6014	112	7	and	and	CCONJ
afs-6014	112	8	a	a	DET
afs-6014	112	9	commercial	commercial	ADJ
afs-6014	112	10	extraction	extraction	NOUN
afs-6014	112	11	kit	kit	NOUN
afs-6014	112	12	(	(	PUNCT
afs-6014	112	13	method	method	NOUN
afs-6014	112	14	7	7	NUM
afs-6014	112	15	)	)	PUNCT
afs-6014	112	16	yielded	yield	VERB
afs-6014	112	17	relatively	relatively	ADV
afs-6014	112	18	high	high	ADJ
afs-6014	112	19	amounts	amount	NOUN
afs-6014	112	20	of	of	ADP
afs-6014	112	21	good	good	ADJ
afs-6014	112	22	quality	quality	NOUN
afs-6014	112	23	dna	dna	NOUN
afs-6014	112	24	(	(	PUNCT
afs-6014	112	25	table	table	NOUN
afs-6014	112	26	1	1	NUM
afs-6014	112	27	)	)	PUNCT
afs-6014	112	28	.	.	PUNCT
afs-6014	113	1	thus	thus	ADV
afs-6014	113	2	,	,	PUNCT
afs-6014	113	3	for	for	ADP
afs-6014	113	4	high	high	ADJ
afs-6014	113	5	throughput	throughput	NOUN
afs-6014	113	6	genotyping	genotyping	NOUN
afs-6014	113	7	,	,	PUNCT
afs-6014	113	8	dna	dna	PROPN
afs-6014	113	9	extracted	extract	VERB
afs-6014	113	10	from	from	ADP
afs-6014	113	11	samples	sample	NOUN
afs-6014	113	12	using	use	VERB
afs-6014	113	13	methods	method	NOUN
afs-6014	113	14	2	2	NUM
afs-6014	113	15	and	and	CCONJ
afs-6014	113	16	7	7	NUM
afs-6014	113	17	were	be	AUX
afs-6014	113	18	selected	select	VERB
afs-6014	113	19	.	.	PUNCT
afs-6014	114	1	in	in	ADP
afs-6014	114	2	addition	addition	NOUN
afs-6014	114	3	,	,	PUNCT
afs-6014	114	4	samples	sample	NOUN
afs-6014	114	5	prepared	prepare	VERB
afs-6014	114	6	by	by	ADP
afs-6014	114	7	lysis	lysis	NOUN
afs-6014	114	8	(	(	PUNCT
afs-6014	114	9	method	method	NOUN
afs-6014	114	10	1	1	NUM
afs-6014	114	11	)	)	PUNCT
afs-6014	114	12	were	be	AUX
afs-6014	114	13	also	also	ADV
afs-6014	114	14	genotyped	genotype	VERB
afs-6014	114	15	,	,	PUNCT
afs-6014	114	16	since	since	SCONJ
afs-6014	114	17	the	the	DET
afs-6014	114	18	concentration	concentration	NOUN
afs-6014	114	19	of	of	ADP
afs-6014	114	20	dna	dna	PROPN
afs-6014	114	21	was	be	AUX
afs-6014	114	22	assumed	assume	VERB
afs-6014	114	23	to	to	PART
afs-6014	114	24	be	be	AUX
afs-6014	114	25	highest	high	ADJ
afs-6014	114	26	in	in	ADP
afs-6014	114	27	these	these	DET
afs-6014	114	28	samples	sample	NOUN
afs-6014	114	29	although	although	SCONJ
afs-6014	114	30	the	the	DET
afs-6014	114	31	purity	purity	NOUN
afs-6014	114	32	was	be	AUX
afs-6014	114	33	low	low	ADJ
afs-6014	114	34	and	and	CCONJ
afs-6014	114	35	interfered	interfere	VERB
afs-6014	114	36	with	with	ADP
afs-6014	114	37	the	the	DET
afs-6014	114	38	determination	determination	NOUN
afs-6014	114	39	of	of	ADP
afs-6014	114	40	dna	dna	PROPN
afs-6014	114	41	concentration	concentration	NOUN
afs-6014	114	42	by	by	ADP
afs-6014	114	43	qubit	qubit	NOUN
afs-6014	114	44	and	and	CCONJ
afs-6014	114	45	nanodrop	nanodrop	NOUN
afs-6014	114	46	.	.	PUNCT
afs-6014	115	1	comparison	comparison	NOUN
afs-6014	115	2	of	of	ADP
afs-6014	115	3	different	different	ADJ
afs-6014	115	4	concentration	concentration	NOUN
afs-6014	115	5	assays	assay	VERB
afs-6014	115	6	the	the	DET
afs-6014	115	7	concentration	concentration	NOUN
afs-6014	115	8	of	of	ADP
afs-6014	115	9	dna	dna	NOUN
afs-6014	115	10	in	in	ADP
afs-6014	115	11	various	various	ADJ
afs-6014	115	12	preparations	preparation	NOUN
afs-6014	115	13	was	be	AUX
afs-6014	115	14	evaluated	evaluate	VERB
afs-6014	115	15	with	with	ADP
afs-6014	115	16	the	the	DET
afs-6014	115	17	nanodrop	nanodrop	NOUN
afs-6014	115	18	spectrophotometer	spectrophotometer	NOUN
afs-6014	115	19	and	and	CCONJ
afs-6014	115	20	qubit	qubit	NOUN
afs-6014	115	21	platform	platform	NOUN
afs-6014	115	22	.	.	PUNCT
afs-6014	116	1	concentrations	concentration	NOUN
afs-6014	116	2	of	of	ADP
afs-6014	116	3	dna	dna	PROPN
afs-6014	116	4	were	be	AUX
afs-6014	116	5	found	find	VERB
afs-6014	116	6	to	to	PART
afs-6014	116	7	be	be	AUX
afs-6014	116	8	approximately	approximately	ADV
afs-6014	116	9	10	10	NUM
afs-6014	116	10	times	time	NOUN
afs-6014	116	11	higher	high	ADJ
afs-6014	116	12	based	base	VERB
afs-6014	116	13	on	on	ADP
afs-6014	116	14	the	the	DET
afs-6014	116	15	nanodrop	nanodrop	NOUN
afs-6014	116	16	than	than	SCONJ
afs-6014	116	17	qubit	qubit	VERB
afs-6014	116	18	analysis	analysis	NOUN
afs-6014	116	19	(	(	PUNCT
afs-6014	116	20	table	table	NOUN
afs-6014	116	21	1	1	NUM
afs-6014	116	22	)	)	PUNCT
afs-6014	116	23	.	.	PUNCT
afs-6014	117	1	therefore	therefore	ADV
afs-6014	117	2	,	,	PUNCT
afs-6014	117	3	the	the	DET
afs-6014	117	4	determination	determination	NOUN
afs-6014	117	5	of	of	ADP
afs-6014	117	6	dna	dna	PROPN
afs-6014	117	7	concentration	concentration	NOUN
afs-6014	117	8	was	be	AUX
afs-6014	117	9	evaluated	evaluate	VERB
afs-6014	117	10	further	far	ADV
afs-6014	117	11	by	by	ADP
afs-6014	117	12	qpcr	qpcr	ADV
afs-6014	117	13	and	and	CCONJ
afs-6014	117	14	a	a	DET
afs-6014	117	15	standard	standard	ADJ
afs-6014	117	16	curve	curve	NOUN
afs-6014	117	17	prepared	prepare	VERB
afs-6014	117	18	from	from	ADP
afs-6014	117	19	dna	dna	PROPN
afs-6014	117	20	extracted	extract	VERB
afs-6014	117	21	from	from	ADP
afs-6014	117	22	boar	boar	NOUN
afs-6014	117	23	sperm	sperm	NOUN
afs-6014	117	24	(	(	PUNCT
afs-6014	117	25	quantified	quantify	VERB
afs-6014	117	26	with	with	ADP
afs-6014	117	27	nanodrop	nanodrop	NOUN
afs-6014	117	28	spectrophotometer	spectrophotometer	NOUN
afs-6014	117	29	)	)	PUNCT
afs-6014	117	30	.	.	PUNCT
afs-6014	118	1	the	the	DET
afs-6014	118	2	same	same	ADJ
afs-6014	118	3	amount	amount	NOUN
afs-6014	118	4	(	(	PUNCT
afs-6014	118	5	20	20	NUM
afs-6014	118	6	ng	ng	NOUN
afs-6014	118	7	)	)	PUNCT
afs-6014	118	8	of	of	ADP
afs-6014	118	9	dna	dna	PROPN
afs-6014	118	10	based	base	VERB
afs-6014	118	11	on	on	ADP
afs-6014	118	12	each	each	DET
afs-6014	118	13	concentration	concentration	NOUN
afs-6014	118	14	assay	assay	NOUN
afs-6014	118	15	was	be	AUX
afs-6014	118	16	added	add	VERB
afs-6014	118	17	to	to	ADP
afs-6014	118	18	the	the	DET
afs-6014	118	19	qpcr	qpcr	ADJ
afs-6014	118	20	amplification	amplification	NOUN
afs-6014	118	21	and	and	CCONJ
afs-6014	118	22	the	the	DET
afs-6014	118	23	concentration	concentration	NOUN
afs-6014	118	24	was	be	AUX
afs-6014	118	25	compared	compare	VERB
afs-6014	118	26	to	to	ADP
afs-6014	118	27	the	the	DET
afs-6014	118	28	standard	standard	ADJ
afs-6014	118	29	curve	curve	NOUN
afs-6014	118	30	.	.	PUNCT
afs-6014	119	1	qubit	qubit	NOUN
afs-6014	119	2	measurements	measurement	NOUN
afs-6014	119	3	appeared	appear	VERB
afs-6014	119	4	to	to	PART
afs-6014	119	5	be	be	AUX
afs-6014	119	6	consistent	consistent	ADJ
afs-6014	119	7	with	with	ADP
afs-6014	119	8	the	the	DET
afs-6014	119	9	results	result	NOUN
afs-6014	119	10	from	from	ADP
afs-6014	119	11	qpcr	qpcr	ADV
afs-6014	119	12	and	and	CCONJ
afs-6014	119	13	were	be	AUX
afs-6014	119	14	therefore	therefore	ADV
afs-6014	119	15	used	use	VERB
afs-6014	119	16	to	to	PART
afs-6014	119	17	evaluate	evaluate	VERB
afs-6014	119	18	the	the	DET
afs-6014	119	19	concentration	concentration	NOUN
afs-6014	119	20	of	of	ADP
afs-6014	119	21	dna	dna	NOUN
afs-6014	119	22	for	for	ADP
afs-6014	119	23	chip	chip	NOUN
afs-6014	119	24	genotyping	genotyping	NOUN
afs-6014	119	25	.	.	PUNCT
afs-6014	120	1	table	table	NOUN
afs-6014	120	2	1	1	NUM
afs-6014	120	3	.	.	PUNCT
afs-6014	121	1	protocols	protocol	NOUN
afs-6014	121	2	tested	test	VERB
afs-6014	121	3	for	for	ADP
afs-6014	121	4	the	the	DET
afs-6014	121	5	preparation	preparation	NOUN
afs-6014	121	6	of	of	ADP
afs-6014	121	7	total	total	ADJ
afs-6014	121	8	dna	dna	NOUN
afs-6014	121	9	from	from	ADP
afs-6014	121	10	porcine	porcine	NOUN
afs-6014	121	11	hair	hair	NOUN
afs-6014	121	12	roots	root	NOUN
afs-6014	121	13	.	.	PUNCT
afs-6014	122	1	results	result	NOUN
afs-6014	122	2	from	from	ADP
afs-6014	122	3	two	two	NUM
afs-6014	122	4	different	different	ADJ
afs-6014	122	5	concentration	concentration	NOUN
afs-6014	122	6	measurement	measurement	NOUN
afs-6014	122	7	methods	method	NOUN
afs-6014	122	8	are	be	AUX
afs-6014	122	9	presented	present	VERB
afs-6014	122	10	.	.	PUNCT
afs-6014	123	1	sample	sample	NOUN
afs-6014	123	2	purity	purity	NOUN
afs-6014	123	3	(	(	PUNCT
afs-6014	123	4	260/280	260/280	PROPN
afs-6014	123	5	and	and	CCONJ
afs-6014	123	6	260/230	260/230	NUM
afs-6014	123	7	ratios	ratio	NOUN
afs-6014	123	8	)	)	PUNCT
afs-6014	123	9	was	be	AUX
afs-6014	123	10	assessed	assess	VERB
afs-6014	123	11	by	by	ADP
afs-6014	123	12	nanodrop	nanodrop	NOUN
afs-6014	123	13	.	.	PUNCT
afs-6014	124	1	protocol	protocol	PROPN
afs-6014	124	2	(	(	PUNCT
afs-6014	124	3	n	n	CCONJ
afs-6014	124	4	)	)	PUNCT
afs-6014	124	5	nanodrop	nanodrop	NOUN
afs-6014	124	6	ng/µl	ng/µl	NUM
afs-6014	124	7	(	(	PUNCT
afs-6014	124	8	mean	mean	VERB
afs-6014	124	9	,	,	PUNCT
afs-6014	124	10	sd	sd	NOUN
afs-6014	124	11	)	)	PUNCT
afs-6014	124	12	260/280	260/280	NUM
afs-6014	124	13	ratio	ratio	NOUN
afs-6014	124	14	260/230	260/230	NUM
afs-6014	124	15	ratio	ratio	NOUN
afs-6014	124	16	qubit	qubit	NOUN
afs-6014	124	17	ng/µl	ng/µl	PRON
afs-6014	124	18	(	(	PUNCT
afs-6014	124	19	mean	mean	VERB
afs-6014	124	20	,	,	PUNCT
afs-6014	124	21	sd	sd	NOUN
afs-6014	124	22	)	)	PUNCT
afs-6014	124	23	1	1	NUM
afs-6014	124	24	.	.	X
afs-6014	124	25	lysis	lysis	NOUN
afs-6014	124	26	(	(	PUNCT
afs-6014	124	27	10	10	NUM
afs-6014	124	28	)	)	PUNCT
afs-6014	124	29	58–500	58–500	NOUN
afs-6014	124	30	(	(	PUNCT
afs-6014	124	31	202	202	NUM
afs-6014	124	32	,	,	PUNCT
afs-6014	124	33	157	157	NUM
afs-6014	124	34	)	)	PUNCT
afs-6014	124	35	<	<	X
afs-6014	124	36	1	1	NUM
afs-6014	124	37	<	<	SYM
afs-6014	124	38	0.5	0.5	NUM
afs-6014	124	39	0.9–29	0.9–29	NOUN
afs-6014	124	40	(	(	PUNCT
afs-6014	124	41	12	12	NUM
afs-6014	124	42	,	,	PUNCT
afs-6014	124	43	11.7	11.7	NUM
afs-6014	124	44	)	)	PUNCT
afs-6014	124	45	2.lysis+etoh	2.lysis+etoh	NUM
afs-6014	124	46	precipitation	precipitation	NOUN
afs-6014	124	47	(	(	PUNCT
afs-6014	124	48	36	36	NUM
afs-6014	124	49	)	)	PUNCT
afs-6014	124	50	15–500	15–500	PROPN
afs-6014	124	51	(	(	PUNCT
afs-6014	124	52	168	168	NUM
afs-6014	124	53	,	,	PUNCT
afs-6014	124	54	137	137	NUM
afs-6014	124	55	)	)	PUNCT
afs-6014	124	56	1.8–2	1.8–2	NUM
afs-6014	124	57	0.9–1.5	0.9–1.5	NOUN
afs-6014	124	58	1.5–100	1.5–100	NUM
afs-6014	124	59	(	(	PUNCT
afs-6014	124	60	21	21	NUM
afs-6014	124	61	,	,	PUNCT
afs-6014	124	62	17	17	NUM
afs-6014	124	63	)	)	PUNCT
afs-6014	124	64	3.lysis+phenol	3.lysis+phenol	NUM
afs-6014	124	65	/	/	SYM
afs-6014	124	66	chloroform	chloroform	NOUN
afs-6014	124	67	(	(	PUNCT
afs-6014	124	68	3	3	NUM
afs-6014	124	69	)	)	PUNCT
afs-6014	124	70	22–47	22–47	NUM
afs-6014	124	71	(	(	PUNCT
afs-6014	124	72	36	36	NUM
afs-6014	124	73	,	,	PUNCT
afs-6014	124	74	12.5	12.5	NUM
afs-6014	124	75	)	)	PUNCT
afs-6014	124	76	1.8–1.9	1.8–1.9	NUM
afs-6014	124	77	2	2	NUM
afs-6014	124	78	–	–	PUNCT
afs-6014	124	79	4	4	NUM
afs-6014	124	80	.	.	X
afs-6014	125	1	lysis+biorad	lysis+biorad	PROPN
afs-6014	125	2	matrix	matrix	NOUN
afs-6014	125	3	(	(	PUNCT
afs-6014	125	4	5	5	NUM
afs-6014	125	5	)	)	PUNCT
afs-6014	125	6	35–83	35–83	NUM
afs-6014	125	7	(	(	PUNCT
afs-6014	125	8	58	58	NUM
afs-6014	125	9	,	,	PUNCT
afs-6014	125	10	24	24	NUM
afs-6014	125	11	)	)	PUNCT
afs-6014	125	12	1.3–1.7	1.3–1.7	NUM
afs-6014	125	13	0.8	0.8	NUM
afs-6014	125	14	0.5–3	0.5–3	NOUN
afs-6014	125	15	(	(	PUNCT
afs-6014	125	16	1.8	1.8	NUM
afs-6014	125	17	,	,	PUNCT
afs-6014	125	18	1.2	1.2	NUM
afs-6014	125	19	)	)	PUNCT
afs-6014	125	20	5	5	NUM
afs-6014	125	21	.	.	PUNCT
afs-6014	126	1	atl	atl	PROPN
afs-6014	126	2	qiagen	qiagen	PROPN
afs-6014	126	3	lysis	lysis	NOUN
afs-6014	126	4	(	(	PUNCT
afs-6014	126	5	5	5	X
afs-6014	126	6	)	)	PUNCT
afs-6014	126	7	2.5–21.7	2.5–21.7	PROPN
afs-6014	126	8	(	(	PUNCT
afs-6014	126	9	11	11	NUM
afs-6014	126	10	,	,	PUNCT
afs-6014	126	11	8)	8)	NUM
afs-6014	126	12	<	<	X
afs-6014	126	13	1	1	NUM
afs-6014	126	14	<	<	X
afs-6014	126	15	0.6	0.6	NUM
afs-6014	126	16	0.2–0.5	0.2–0.5	PUNCT
afs-6014	126	17	(	(	PUNCT
afs-6014	126	18	0.35	0.35	NUM
afs-6014	126	19	,	,	PUNCT
afs-6014	126	20	0.12	0.12	NUM
afs-6014	126	21	)	)	PUNCT
afs-6014	126	22	6	6	NUM
afs-6014	126	23	.	.	PUNCT
afs-6014	127	1	sds+edta	sds+edta	PROPN
afs-6014	127	2	lysis	lysis	NOUN
afs-6014	127	3	(	(	PUNCT
afs-6014	127	4	5	5	X
afs-6014	127	5	)	)	PUNCT
afs-6014	127	6	2–22	2–22	NOUN
afs-6014	127	7	(	(	PUNCT
afs-6014	127	8	12	12	NUM
afs-6014	127	9	,	,	PUNCT
afs-6014	127	10	8.5	8.5	NUM
afs-6014	127	11	)	)	PUNCT
afs-6014	127	12	<	<	X
afs-6014	127	13	1	1	NUM
afs-6014	127	14	<	<	X
afs-6014	127	15	0.5	0.5	NUM
afs-6014	127	16	0.14–0.5	0.14–0.5	NUM
afs-6014	127	17	(	(	PUNCT
afs-6014	127	18	0.3	0.3	NUM
afs-6014	127	19	,	,	PUNCT
afs-6014	127	20	0.15	0.15	NUM
afs-6014	127	21	)	)	PUNCT
afs-6014	127	22	7	7	NUM
afs-6014	127	23	.	.	PUNCT
afs-6014	127	24	qiagen	qiagen	NOUN
afs-6014	127	25	kit	kit	NOUN
afs-6014	127	26	extraction	extraction	NOUN
afs-6014	127	27	(	(	PUNCT
afs-6014	127	28	28	28	NUM
afs-6014	127	29	)	)	PUNCT
afs-6014	127	30	32–450	32–450	NUM
afs-6014	127	31	(	(	PUNCT
afs-6014	127	32	144	144	NUM
afs-6014	127	33	,	,	PUNCT
afs-6014	127	34	139	139	NUM
afs-6014	127	35	)	)	PUNCT
afs-6014	127	36	1.8–2	1.8–2	NOUN
afs-6014	127	37	0.5–1.8	0.5–1.8	ADJ
afs-6014	127	38	2–100	2–100	NUM
afs-6014	127	39	(	(	PUNCT
afs-6014	127	40	38	38	NUM
afs-6014	127	41	,	,	PUNCT
afs-6014	127	42	26	26	NUM
afs-6014	127	43	)	)	PUNCT
afs-6014	127	44	n	n	NOUN
afs-6014	127	45	=	=	NOUN
afs-6014	127	46	number	number	NOUN
afs-6014	127	47	of	of	ADP
afs-6014	127	48	samples	sample	NOUN
afs-6014	127	49	a	a	DET
afs-6014	127	50	g	g	NOUN
afs-6014	127	51	r	r	NOUN
afs-6014	127	52	i	i	NOUN
afs-6014	127	53	c	c	NOUN
afs-6014	127	54	u	u	NOUN
afs-6014	127	55	l	l	NOUN
afs-6014	127	56	t	t	NOUN
afs-6014	127	57	u	u	X
afs-6014	127	58	r	r	NOUN
afs-6014	127	59	a	a	PROPN
afs-6014	127	60	l	l	NOUN
afs-6014	127	61	a	a	DET
afs-6014	127	62	n	n	NOUN
afs-6014	128	1	d	d	NOUN
afs-6014	128	2	f	f	X
afs-6014	129	1	o	o	NOUN
afs-6014	129	2	o	o	X
afs-6014	130	1	d	d	X
afs-6014	130	2	s	s	X
afs-6014	130	3	c	c	NOUN
afs-6014	131	1	i	i	NOUN
afs-6014	131	2	e	e	PROPN
afs-6014	131	3	n	n	PROPN
afs-6014	131	4	c	c	NOUN
afs-6014	131	5	e	e	X
afs-6014	131	6	sironen	sironen	PROPN
afs-6014	131	7	,	,	PUNCT
afs-6014	131	8	a.	a.	PROPN
afs-6014	131	9	et	et	PROPN
afs-6014	131	10	al	al	PROPN
afs-6014	131	11	.	.	PROPN
afs-6014	131	12	high	high	ADJ
afs-6014	131	13	throughput	throughput	NOUN
afs-6014	131	14	genotyping	genotype	VERB
afs-6014	131	15	from	from	ADP
afs-6014	131	16	porcine	porcine	NOUN
afs-6014	131	17	hair	hair	NOUN
afs-6014	131	18	follicles	follicle	VERB
afs-6014	131	19	146	146	NUM
afs-6014	131	20	a	a	DET
afs-6014	131	21	g	g	NOUN
afs-6014	132	1	r	r	NOUN
afs-6014	133	1	i	i	NOUN
afs-6014	133	2	c	c	NOUN
afs-6014	133	3	u	u	NOUN
afs-6014	133	4	l	l	NOUN
afs-6014	133	5	t	t	NOUN
afs-6014	133	6	u	u	X
afs-6014	133	7	r	r	NOUN
afs-6014	133	8	a	a	PROPN
afs-6014	133	9	l	l	NOUN
afs-6014	133	10	a	a	DET
afs-6014	133	11	n	n	NOUN
afs-6014	134	1	d	d	NOUN
afs-6014	134	2	f	f	X
afs-6014	135	1	o	o	NOUN
afs-6014	135	2	o	o	X
afs-6014	136	1	d	d	X
afs-6014	136	2	s	s	X
afs-6014	136	3	c	c	NOUN
afs-6014	137	1	i	i	NOUN
afs-6014	137	2	e	e	PROPN
afs-6014	137	3	n	n	PROPN
afs-6014	137	4	c	c	NOUN
afs-6014	137	5	e	e	NOUN
afs-6014	137	6	vol	vol	NOUN
afs-6014	137	7	.	.	PUNCT
afs-6014	138	1	20(2011	20(2011	NUM
afs-6014	138	2	):	):	PUNCT
afs-6014	138	3	143–150	143–150	NUM
afs-6014	138	4	.	.	PUNCT
afs-6014	139	1	147	147	NUM
afs-6014	139	2	snp	snp	ADJ
afs-6014	139	3	quality	quality	NOUN
afs-6014	139	4	measures	measure	NOUN
afs-6014	139	5	of	of	ADP
afs-6014	139	6	the	the	DET
afs-6014	139	7	porcinesnp60	porcinesnp60	NOUN
afs-6014	139	8	genotyping	genotype	VERB
afs-6014	139	9	beadchip	beadchip	NOUN
afs-6014	139	10	the	the	DET
afs-6014	139	11	total	total	ADJ
afs-6014	139	12	number	number	NOUN
afs-6014	139	13	of	of	ADP
afs-6014	139	14	snps	snps	PROPN
afs-6014	139	15	in	in	ADP
afs-6014	139	16	the	the	DET
afs-6014	139	17	porcinesnp60	porcinesnp60	NOUN
afs-6014	139	18	beadchip	beadchip	NOUN
afs-6014	139	19	is	be	AUX
afs-6014	139	20	62163	62163	NUM
afs-6014	139	21	.	.	PUNCT
afs-6014	140	1	however	however	ADV
afs-6014	140	2	,	,	PUNCT
afs-6014	140	3	2815	2815	NUM
afs-6014	140	4	snps	snps	PROPN
afs-6014	140	5	did	do	AUX
afs-6014	140	6	not	not	PART
afs-6014	140	7	work	work	VERB
afs-6014	140	8	for	for	ADP
afs-6014	140	9	any	any	PRON
afs-6014	140	10	of	of	ADP
afs-6014	140	11	the	the	DET
afs-6014	140	12	genotyped	genotype	VERB
afs-6014	140	13	samples	sample	NOUN
afs-6014	140	14	and	and	CCONJ
afs-6014	140	15	9216	9216	NUM
afs-6014	140	16	snps	snp	NOUN
afs-6014	140	17	were	be	AUX
afs-6014	140	18	monomorphic	monomorphic	ADJ
afs-6014	140	19	in	in	ADP
afs-6014	140	20	the	the	DET
afs-6014	140	21	data	datum	NOUN
afs-6014	140	22	set	set	VERB
afs-6014	140	23	of	of	ADP
afs-6014	140	24	finnish	finnish	ADJ
afs-6014	140	25	landrace	landrace	NOUN
afs-6014	140	26	pigs	pig	NOUN
afs-6014	140	27	.	.	PUNCT
afs-6014	141	1	excluding	exclude	VERB
afs-6014	141	2	those	those	DET
afs-6014	141	3	snps	snps	NOUN
afs-6014	141	4	,	,	PUNCT
afs-6014	141	5	the	the	DET
afs-6014	141	6	average	average	ADJ
afs-6014	141	7	minor	minor	ADJ
afs-6014	141	8	allele	allele	NOUN
afs-6014	141	9	frequency	frequency	NOUN
afs-6014	141	10	was	be	AUX
afs-6014	141	11	0.25	0.25	NUM
afs-6014	141	12	(	(	PUNCT
afs-6014	141	13	sd	sd	NOUN
afs-6014	141	14	=	=	SYM
afs-6014	141	15	0.14	0.14	NUM
afs-6014	141	16	)	)	PUNCT
afs-6014	141	17	.	.	PUNCT
afs-6014	142	1	furthermore	furthermore	ADV
afs-6014	142	2	,	,	PUNCT
afs-6014	142	3	the	the	DET
afs-6014	142	4	observed	observed	ADJ
afs-6014	142	5	distribution	distribution	NOUN
afs-6014	142	6	of	of	ADP
afs-6014	142	7	p	p	NOUN
afs-6014	142	8	-	-	PUNCT
afs-6014	142	9	values	value	NOUN
afs-6014	142	10	of	of	ADP
afs-6014	142	11	the	the	DET
afs-6014	142	12	hardy	hardy	ADJ
afs-6014	142	13	-	-	PUNCT
afs-6014	142	14	weinberg	weinberg	PROPN
afs-6014	142	15	equilibrium	equilibrium	PROPN
afs-6014	142	16	test	test	NOUN
afs-6014	142	17	statistic	statistic	NOUN
afs-6014	142	18	did	do	AUX
afs-6014	142	19	not	not	PART
afs-6014	142	20	differ	differ	VERB
afs-6014	142	21	from	from	ADP
afs-6014	142	22	expectations	expectation	NOUN
afs-6014	142	23	;	;	PUNCT
afs-6014	142	24	183	183	NUM
afs-6014	142	25	snps	snps	NOUN
afs-6014	142	26	(	(	PUNCT
afs-6014	142	27	excluding	exclude	VERB
afs-6014	142	28	the	the	DET
afs-6014	142	29	snps	snps	PROPN
afs-6014	142	30	on	on	ADP
afs-6014	142	31	the	the	DET
afs-6014	142	32	x	x	NOUN
afs-6014	142	33	-	-	NOUN
afs-6014	142	34	chromosome	chromosome	NOUN
afs-6014	142	35	)	)	PUNCT
afs-6014	142	36	had	have	VERB
afs-6014	142	37	p	p	NOUN
afs-6014	142	38	-	-	PUNCT
afs-6014	142	39	values	value	NOUN
afs-6014	142	40	lower	low	ADJ
afs-6014	142	41	than	than	ADP
afs-6014	142	42	1.0e-06	1.0e-06	NUM
afs-6014	142	43	which	which	PRON
afs-6014	142	44	is	be	AUX
afs-6014	142	45	much	much	ADV
afs-6014	142	46	less	less	ADJ
afs-6014	142	47	than	than	SCONJ
afs-6014	142	48	could	could	AUX
afs-6014	142	49	be	be	AUX
afs-6014	142	50	expected	expect	VERB
afs-6014	142	51	by	by	ADP
afs-6014	142	52	chance	chance	NOUN
afs-6014	142	53	.	.	PUNCT
afs-6014	143	1	thus	thus	ADV
afs-6014	143	2	,	,	PUNCT
afs-6014	143	3	the	the	DET
afs-6014	143	4	porcinesnp60	porcinesnp60	NOUN
afs-6014	143	5	beadchip	beadchip	NOUN
afs-6014	143	6	appears	appear	VERB
afs-6014	143	7	to	to	PART
afs-6014	143	8	be	be	AUX
afs-6014	143	9	a	a	DET
afs-6014	143	10	robust	robust	ADJ
afs-6014	143	11	and	and	CCONJ
afs-6014	143	12	reliable	reliable	ADJ
afs-6014	143	13	method	method	NOUN
afs-6014	143	14	for	for	ADP
afs-6014	143	15	genotyping	genotyping	NOUN
afs-6014	143	16	of	of	ADP
afs-6014	143	17	finnish	finnish	ADJ
afs-6014	143	18	landrace	landrace	NOUN
afs-6014	143	19	pigs	pig	NOUN
afs-6014	143	20	.	.	PUNCT
afs-6014	144	1	quality	quality	NOUN
afs-6014	144	2	of	of	ADP
afs-6014	144	3	the	the	DET
afs-6014	144	4	porcinesnp60	porcinesnp60	NOUN
afs-6014	144	5	beadchip	beadchip	NOUN
afs-6014	144	6	genotyping	genotyping	NOUN
afs-6014	144	7	results	result	NOUN
afs-6014	144	8	with	with	ADP
afs-6014	144	9	hair	hair	NOUN
afs-6014	144	10	root	root	NOUN
afs-6014	144	11	samples	sample	NOUN
afs-6014	144	12	the	the	DET
afs-6014	144	13	comparison	comparison	NOUN
afs-6014	144	14	of	of	ADP
afs-6014	144	15	the	the	DET
afs-6014	144	16	genotyping	genotyping	NOUN
afs-6014	144	17	results	result	NOUN
afs-6014	144	18	from	from	ADP
afs-6014	144	19	three	three	NUM
afs-6014	144	20	different	different	ADJ
afs-6014	144	21	dna	dna	NOUN
afs-6014	144	22	preparation	preparation	NOUN
afs-6014	144	23	methods	method	NOUN
afs-6014	144	24	illustrated	illustrate	VERB
afs-6014	144	25	the	the	DET
afs-6014	144	26	importance	importance	NOUN
afs-6014	144	27	of	of	ADP
afs-6014	144	28	the	the	DET
afs-6014	144	29	quality	quality	NOUN
afs-6014	144	30	of	of	ADP
afs-6014	144	31	analysed	analyse	VERB
afs-6014	144	32	dna	dna	NOUN
afs-6014	144	33	samples	sample	NOUN
afs-6014	144	34	.	.	PUNCT
afs-6014	145	1	the	the	DET
afs-6014	145	2	lowest	low	ADJ
afs-6014	145	3	call	call	NOUN
afs-6014	145	4	rate	rate	NOUN
afs-6014	145	5	(	(	PUNCT
afs-6014	145	6	cr	cr	X
afs-6014	145	7	,	,	PUNCT
afs-6014	145	8	90–93	90–93	NUM
afs-6014	145	9	%	%	NOUN
afs-6014	145	10	,	,	PUNCT
afs-6014	145	11	table	table	NOUN
afs-6014	145	12	2	2	NUM
afs-6014	145	13	)	)	PUNCT
afs-6014	145	14	was	be	AUX
afs-6014	145	15	detected	detect	VERB
afs-6014	145	16	with	with	ADP
afs-6014	145	17	the	the	DET
afs-6014	145	18	unpurified	unpurifie	VERB
afs-6014	145	19	lysis	lysis	NOUN
afs-6014	145	20	samples	sample	NOUN
afs-6014	145	21	(	(	PUNCT
afs-6014	145	22	method	method	NOUN
afs-6014	145	23	1	1	NUM
afs-6014	145	24	)	)	PUNCT
afs-6014	145	25	.	.	PUNCT
afs-6014	146	1	when	when	SCONJ
afs-6014	146	2	compared	compare	VERB
afs-6014	146	3	with	with	ADP
afs-6014	146	4	the	the	DET
afs-6014	146	5	sperm	sperm	NOUN
afs-6014	146	6	sample	sample	NOUN
afs-6014	146	7	,	,	PUNCT
afs-6014	146	8	the	the	DET
afs-6014	146	9	percentage	percentage	NOUN
afs-6014	146	10	of	of	ADP
afs-6014	146	11	missing	miss	VERB
afs-6014	146	12	alleles	allele	NOUN
afs-6014	146	13	was	be	AUX
afs-6014	146	14	2–5	2–5	NUM
afs-6014	146	15	%	%	NOUN
afs-6014	146	16	and	and	CCONJ
afs-6014	146	17	the	the	DET
afs-6014	146	18	percentage	percentage	NOUN
afs-6014	146	19	of	of	ADP
afs-6014	146	20	different	different	ADJ
afs-6014	146	21	allele	allele	NOUN
afs-6014	146	22	calls	call	NOUN
afs-6014	146	23	(	(	PUNCT
afs-6014	146	24	e.g.	e.g.	ADV
afs-6014	146	25	a	a	PRON
afs-6014	146	26	in	in	ADP
afs-6014	146	27	one	one	NUM
afs-6014	146	28	sample	sample	NOUN
afs-6014	146	29	and	and	CCONJ
afs-6014	146	30	g	g	NOUN
afs-6014	146	31	in	in	ADP
afs-6014	146	32	the	the	DET
afs-6014	146	33	other	other	ADJ
afs-6014	146	34	)	)	PUNCT
afs-6014	146	35	was	be	AUX
afs-6014	146	36	0.09–0.31	0.09–0.31	NUM
afs-6014	146	37	%	%	NOUN
afs-6014	146	38	(	(	PUNCT
afs-6014	146	39	table	table	NOUN
afs-6014	146	40	3	3	NUM
afs-6014	146	41	)	)	PUNCT
afs-6014	146	42	.	.	PUNCT
afs-6014	147	1	these	these	DET
afs-6014	147	2	differences	difference	NOUN
afs-6014	147	3	substantially	substantially	ADV
afs-6014	147	4	reduce	reduce	VERB
afs-6014	147	5	the	the	DET
afs-6014	147	6	reliability	reliability	NOUN
afs-6014	147	7	of	of	ADP
afs-6014	147	8	genotypes	genotype	NOUN
afs-6014	147	9	produced	produce	VERB
afs-6014	147	10	from	from	ADP
afs-6014	147	11	lysed	lyse	VERB
afs-6014	147	12	hair	hair	NOUN
afs-6014	147	13	root	root	NOUN
afs-6014	147	14	samples	sample	NOUN
afs-6014	147	15	.	.	PUNCT
afs-6014	148	1	samples	sample	NOUN
afs-6014	148	2	of	of	ADP
afs-6014	148	3	dna	dna	PROPN
afs-6014	148	4	extracted	extract	VERB
afs-6014	148	5	by	by	ADP
afs-6014	148	6	the	the	DET
afs-6014	148	7	ethanol	ethanol	NOUN
afs-6014	148	8	precipitation	precipitation	NOUN
afs-6014	148	9	(	(	PUNCT
afs-6014	148	10	method	method	NOUN
afs-6014	148	11	2	2	NUM
afs-6014	148	12	)	)	PUNCT
afs-6014	148	13	and	and	CCONJ
afs-6014	148	14	qiagen	qiagen	NOUN
afs-6014	148	15	purification	purification	NOUN
afs-6014	148	16	(	(	PUNCT
afs-6014	148	17	method	method	NOUN
afs-6014	148	18	7	7	NUM
afs-6014	148	19	)	)	PUNCT
afs-6014	148	20	methods	method	NOUN
afs-6014	148	21	showed	show	VERB
afs-6014	148	22	high	high	ADJ
afs-6014	148	23	call	call	NOUN
afs-6014	148	24	rates	rate	NOUN
afs-6014	148	25	;	;	PUNCT
afs-6014	148	26	94–95	94–95	NUM
afs-6014	148	27	%	%	NOUN
afs-6014	148	28	and	and	CCONJ
afs-6014	148	29	95	95	NUM
afs-6014	148	30	%	%	NOUN
afs-6014	148	31	for	for	ADP
afs-6014	148	32	methods	method	NOUN
afs-6014	148	33	2	2	NUM
afs-6014	148	34	and	and	CCONJ
afs-6014	148	35	7	7	NUM
afs-6014	148	36	,	,	PUNCT
afs-6014	148	37	respectively	respectively	ADV
afs-6014	148	38	(	(	PUNCT
afs-6014	148	39	table	table	NOUN
afs-6014	148	40	2	2	NUM
afs-6014	148	41	)	)	PUNCT
afs-6014	148	42	and	and	CCONJ
afs-6014	148	43	very	very	ADV
afs-6014	148	44	low	low	ADJ
afs-6014	148	45	percentage	percentage	NOUN
afs-6014	148	46	of	of	ADP
afs-6014	148	47	differences	difference	NOUN
afs-6014	148	48	when	when	SCONJ
afs-6014	148	49	compared	compare	VERB
afs-6014	148	50	with	with	ADP
afs-6014	148	51	sperm	sperm	NOUN
afs-6014	148	52	samples	sample	NOUN
afs-6014	148	53	(	(	PUNCT
afs-6014	148	54	table	table	NOUN
afs-6014	148	55	3	3	NUM
afs-6014	148	56	)	)	PUNCT
afs-6014	148	57	.	.	PUNCT
afs-6014	149	1	these	these	DET
afs-6014	149	2	values	value	NOUN
afs-6014	149	3	are	be	AUX
afs-6014	149	4	consistent	consistent	ADJ
afs-6014	149	5	with	with	ADP
afs-6014	149	6	the	the	DET
afs-6014	149	7	differences	difference	NOUN
afs-6014	149	8	seen	see	VERB
afs-6014	149	9	in	in	ADP
afs-6014	149	10	duplicate	duplicate	ADJ
afs-6014	149	11	dna	dna	NOUN
afs-6014	149	12	samples	sample	NOUN
afs-6014	149	13	extracted	extract	VERB
afs-6014	149	14	from	from	ADP
afs-6014	149	15	sperm	sperm	NOUN
afs-6014	149	16	(	(	PUNCT
afs-6014	149	17	table	table	NOUN
afs-6014	149	18	3	3	NUM
afs-6014	149	19	)	)	PUNCT
afs-6014	149	20	.	.	PUNCT
afs-6014	150	1	excluding	exclude	VERB
afs-6014	150	2	the	the	DET
afs-6014	150	3	2815	2815	NUM
afs-6014	150	4	snps	snps	NOUN
afs-6014	150	5	,	,	PUNCT
afs-6014	150	6	that	that	PRON
afs-6014	150	7	did	do	AUX
afs-6014	150	8	not	not	PART
afs-6014	150	9	work	work	VERB
afs-6014	150	10	for	for	ADP
afs-6014	150	11	any	any	PRON
afs-6014	150	12	of	of	ADP
afs-6014	150	13	the	the	DET
afs-6014	150	14	genotyped	genotype	VERB
afs-6014	150	15	samples	sample	NOUN
afs-6014	150	16	,	,	PUNCT
afs-6014	150	17	the	the	DET
afs-6014	150	18	average	average	ADJ
afs-6014	150	19	cr	cr	NOUN
afs-6014	150	20	table	table	NOUN
afs-6014	150	21	2	2	NUM
afs-6014	150	22	.	.	PUNCT
afs-6014	151	1	the	the	DET
afs-6014	151	2	overall	overall	ADJ
afs-6014	151	3	call	call	NOUN
afs-6014	151	4	rate	rate	NOUN
afs-6014	151	5	(	(	PUNCT
afs-6014	151	6	cr	cr	NOUN
afs-6014	151	7	)	)	PUNCT
afs-6014	151	8	for	for	ADP
afs-6014	151	9	three	three	NUM
afs-6014	151	10	samples	sample	NOUN
afs-6014	151	11	(	(	PUNCT
afs-6014	151	12	13	13	NUM
afs-6014	151	13	)	)	PUNCT
afs-6014	151	14	prepared	prepare	VERB
afs-6014	151	15	by	by	ADP
afs-6014	151	16	different	different	ADJ
afs-6014	151	17	dna	dna	NOUN
afs-6014	151	18	extraction	extraction	NOUN
afs-6014	151	19	methods	method	NOUN
afs-6014	151	20	and	and	CCONJ
afs-6014	151	21	a	a	DET
afs-6014	151	22	control	control	NOUN
afs-6014	151	23	sample	sample	NOUN
afs-6014	151	24	(	(	PUNCT
afs-6014	151	25	4a	4a	NUM
afs-6014	151	26	and	and	CCONJ
afs-6014	151	27	4b	4b	NUM
afs-6014	151	28	)	)	PUNCT
afs-6014	151	29	after	after	ADP
afs-6014	151	30	illumina	illumina	PROPN
afs-6014	151	31	beadchip	beadchip	NOUN
afs-6014	151	32	genotyping	genotyping	NOUN
afs-6014	151	33	.	.	PUNCT
afs-6014	152	1	the	the	DET
afs-6014	152	2	corrected	correct	VERB
afs-6014	152	3	cr	cr	NOUN
afs-6014	152	4	indicates	indicate	VERB
afs-6014	152	5	the	the	DET
afs-6014	152	6	cr	cr	NOUN
afs-6014	152	7	after	after	ADP
afs-6014	152	8	excluding	exclude	VERB
afs-6014	152	9	snps	snps	PROPN
afs-6014	152	10	that	that	PRON
afs-6014	152	11	did	do	AUX
afs-6014	152	12	not	not	PART
afs-6014	152	13	work	work	VERB
afs-6014	152	14	for	for	ADP
afs-6014	152	15	any	any	PRON
afs-6014	152	16	of	of	ADP
afs-6014	152	17	the	the	DET
afs-6014	152	18	samples	sample	NOUN
afs-6014	152	19	analyzed	analyze	VERB
afs-6014	152	20	.	.	PUNCT
afs-6014	153	1	the	the	DET
afs-6014	153	2	number	number	NOUN
afs-6014	153	3	or	or	CCONJ
afs-6014	153	4	letter	letter	NOUN
afs-6014	153	5	listed	list	VERB
afs-6014	153	6	in	in	ADP
afs-6014	153	7	the	the	DET
afs-6014	153	8	method	method	NOUN
afs-6014	153	9	column	column	NOUN
afs-6014	153	10	indicates	indicate	VERB
afs-6014	153	11	the	the	DET
afs-6014	153	12	dna	dna	PROPN
afs-6014	153	13	preparation	preparation	NOUN
afs-6014	153	14	method	method	NOUN
afs-6014	153	15	:	:	PUNCT
afs-6014	153	16	s	s	X
afs-6014	153	17	=	=	NOUN
afs-6014	153	18	dna	dna	PROPN
afs-6014	153	19	extracted	extract	VERB
afs-6014	153	20	from	from	ADP
afs-6014	153	21	sperm	sperm	NOUN
afs-6014	153	22	,	,	PUNCT
afs-6014	153	23	1	1	NUM
afs-6014	153	24	=	=	NOUN
afs-6014	153	25	lysis	lysis	NOUN
afs-6014	153	26	,	,	PUNCT
afs-6014	153	27	2	2	NUM
afs-6014	153	28	=	=	ADJ
afs-6014	153	29	lysis+etoh	lysis+etoh	ADJ
afs-6014	153	30	precipitation	precipitation	NOUN
afs-6014	153	31	and	and	CCONJ
afs-6014	153	32	7	7	NUM
afs-6014	153	33	=	=	PROPN
afs-6014	153	34	qiagen	qiagen	PROPN
afs-6014	153	35	kit	kit	NOUN
afs-6014	153	36	.	.	PUNCT
afs-6014	154	1	sample	sample	NOUN
afs-6014	154	2	method	method	PROPN
afs-6014	154	3	cr	cr	PROPN
afs-6014	154	4	cr	cr	PROPN
afs-6014	154	5	corrected	correct	VERB
afs-6014	154	6	1	1	NUM
afs-6014	154	7	s	s	ADP
afs-6014	154	8	0.950	0.950	NUM
afs-6014	154	9	0.995	0.995	NUM
afs-6014	154	10	1	1	NUM
afs-6014	154	11	1	1	NUM
afs-6014	154	12	0.901	0.901	NUM
afs-6014	154	13	0.944	0.944	NUM
afs-6014	154	14	1	1	NUM
afs-6014	154	15	7	7	NUM
afs-6014	154	16	0.950	0.950	NUM
afs-6014	154	17	0.995	0.995	NUM
afs-6014	154	18	1	1	NUM
afs-6014	154	19	2	2	NUM
afs-6014	154	20	0.940	0.940	NUM
afs-6014	154	21	0.985	0.985	NUM
afs-6014	154	22	2	2	NUM
afs-6014	154	23	s	s	PART
afs-6014	154	24	0.950	0.950	NUM
afs-6014	154	25	0.995	0.995	NUM
afs-6014	154	26	2	2	NUM
afs-6014	154	27	1	1	NUM
afs-6014	154	28	0.931	0.931	NUM
afs-6014	154	29	0.975	0.975	NUM
afs-6014	154	30	2	2	NUM
afs-6014	154	31	7	7	NUM
afs-6014	154	32	0.950	0.950	NUM
afs-6014	154	33	0.995	0.995	NUM
afs-6014	154	34	2	2	NUM
afs-6014	154	35	2	2	NUM
afs-6014	154	36	0.950	0.950	NUM
afs-6014	154	37	0.994	0.994	NUM
afs-6014	154	38	3	3	NUM
afs-6014	154	39	s	s	NOUN
afs-6014	154	40	0.950	0.950	NUM
afs-6014	154	41	0.995	0.995	NUM
afs-6014	154	42	3	3	NUM
afs-6014	154	43	1	1	NUM
afs-6014	154	44	0.913	0.913	NUM
afs-6014	154	45	0.956	0.956	NUM
afs-6014	154	46	3	3	NUM
afs-6014	154	47	7	7	NUM
afs-6014	154	48	0.950	0.950	NUM
afs-6014	154	49	0.995	0.995	NUM
afs-6014	154	50	3	3	NUM
afs-6014	154	51	2	2	NUM
afs-6014	154	52	0.937	0.937	NUM
afs-6014	154	53	0.981	0.981	NUM
afs-6014	154	54	4a	4a	NOUN
afs-6014	154	55	s	s	PART
afs-6014	154	56	0.950	0.950	NUM
afs-6014	154	57	0.994	0.994	NUM
afs-6014	154	58	4b	4b	PROPN
afs-6014	154	59	s	s	PROPN
afs-6014	154	60	0.950	0.950	NUM
afs-6014	154	61	0.994	0.994	NUM
afs-6014	154	62	for	for	ADP
afs-6014	154	63	all	all	DET
afs-6014	154	64	qiagen	qiagen	NOUN
afs-6014	154	65	and	and	CCONJ
afs-6014	154	66	etoh	etoh	NOUN
afs-6014	154	67	precipitated	precipitate	VERB
afs-6014	154	68	samples	sample	NOUN
afs-6014	154	69	was	be	AUX
afs-6014	154	70	0.9982	0.9982	NUM
afs-6014	154	71	(	(	PUNCT
afs-6014	154	72	sd	sd	NOUN
afs-6014	154	73	=	=	NOUN
afs-6014	154	74	0.007	0.007	NUM
afs-6014	154	75	)	)	PUNCT
afs-6014	154	76	.	.	PUNCT
afs-6014	155	1	additional	additional	ADJ
afs-6014	155	2	extractions	extraction	NOUN
afs-6014	155	3	of	of	ADP
afs-6014	155	4	dna	dna	PROPN
afs-6014	155	5	were	be	AUX
afs-6014	155	6	performed	perform	VERB
afs-6014	155	7	using	use	VERB
afs-6014	155	8	the	the	DET
afs-6014	155	9	qiagen	qiagen	NOUN
afs-6014	155	10	blood	blood	NOUN
afs-6014	155	11	and	and	CCONJ
afs-6014	155	12	tissue	tissue	NOUN
afs-6014	155	13	kit	kit	NOUN
afs-6014	155	14	(	(	PUNCT
afs-6014	155	15	method	method	NOUN
afs-6014	155	16	7	7	NUM
afs-6014	155	17	)	)	PUNCT
afs-6014	155	18	,	,	PUNCT
afs-6014	155	19	since	since	SCONJ
afs-6014	155	20	the	the	DET
afs-6014	155	21	overall	overall	ADJ
afs-6014	155	22	call	call	NOUN
afs-6014	155	23	rates	rate	NOUN
afs-6014	155	24	were	be	AUX
afs-6014	155	25	slightly	slightly	ADV
afs-6014	155	26	higher	high	ADJ
afs-6014	155	27	in	in	ADP
afs-6014	155	28	these	these	DET
afs-6014	155	29	samples	sample	NOUN
afs-6014	155	30	compared	compare	VERB
afs-6014	155	31	with	with	ADP
afs-6014	155	32	etoh	etoh	NOUN
afs-6014	155	33	precipitated	precipitate	VERB
afs-6014	155	34	samples	sample	NOUN
afs-6014	155	35	.	.	PUNCT
afs-6014	156	1	however	however	ADV
afs-6014	156	2	,	,	PUNCT
afs-6014	156	3	the	the	DET
afs-6014	156	4	etoh	etoh	ADJ
afs-6014	156	5	precipitation	precipitation	NOUN
afs-6014	156	6	from	from	ADP
afs-6014	156	7	hair	hair	NOUN
afs-6014	156	8	root	root	NOUN
afs-6014	156	9	lyses	lyses	PROPN
afs-6014	156	10	appears	appear	VERB
afs-6014	156	11	to	to	PART
afs-6014	156	12	be	be	AUX
afs-6014	156	13	a	a	DET
afs-6014	156	14	feasible	feasible	ADJ
afs-6014	156	15	method	method	NOUN
afs-6014	156	16	for	for	ADP
afs-6014	156	17	dna	dna	NOUN
afs-6014	156	18	preparation	preparation	NOUN
afs-6014	156	19	for	for	ADP
afs-6014	156	20	high	high	ADJ
afs-6014	156	21	throughput	throughput	NOUN
afs-6014	156	22	genotyping	genotyping	NOUN
afs-6014	156	23	.	.	PUNCT
afs-6014	157	1	the	the	DET
afs-6014	157	2	cr	cr	PROPN
afs-6014	157	3	for	for	ADP
afs-6014	157	4	231/270	231/270	PROPN
afs-6014	157	5	(	(	PUNCT
afs-6014	157	6	86	86	NUM
afs-6014	157	7	%	%	NOUN
afs-6014	157	8	)	)	PUNCT
afs-6014	157	9	additional	additional	ADJ
afs-6014	157	10	hair	hair	NOUN
afs-6014	157	11	root	root	NOUN
afs-6014	157	12	samples	sample	NOUN
afs-6014	157	13	was	be	AUX
afs-6014	157	14	>	>	X
afs-6014	157	15	99	99	NUM
afs-6014	157	16	%	%	NOUN
afs-6014	157	17	(	(	PUNCT
afs-6014	157	18	after	after	ADP
afs-6014	157	19	exclusion	exclusion	NOUN
afs-6014	157	20	of	of	ADP
afs-6014	157	21	snps	snps	PROPN
afs-6014	157	22	that	that	PRON
afs-6014	157	23	did	do	AUX
afs-6014	157	24	not	not	PART
afs-6014	157	25	work	work	VERB
afs-6014	157	26	in	in	ADP
afs-6014	157	27	any	any	DET
afs-6014	157	28	samples	sample	NOUN
afs-6014	157	29	)	)	PUNCT
afs-6014	157	30	.	.	PUNCT
afs-6014	158	1	for	for	ADP
afs-6014	158	2	28	28	NUM
afs-6014	158	3	samples	sample	NOUN
afs-6014	158	4	the	the	DET
afs-6014	158	5	call	call	NOUN
afs-6014	158	6	rate	rate	NOUN
afs-6014	158	7	was	be	AUX
afs-6014	158	8	>	>	X
afs-6014	158	9	90	90	NUM
afs-6014	158	10	%	%	NOUN
afs-6014	158	11	,	,	PUNCT
afs-6014	158	12	for	for	ADP
afs-6014	158	13	18	18	NUM
afs-6014	158	14	samples	sample	NOUN
afs-6014	158	15	>	>	X
afs-6014	158	16	72	72	NUM
afs-6014	158	17	%	%	NOUN
afs-6014	158	18	and	and	CCONJ
afs-6014	158	19	three	three	NUM
afs-6014	158	20	samples	sample	NOUN
afs-6014	158	21	did	do	AUX
afs-6014	158	22	not	not	PART
afs-6014	158	23	work	work	VERB
afs-6014	158	24	.	.	PUNCT
afs-6014	159	1	the	the	DET
afs-6014	159	2	purity	purity	NOUN
afs-6014	159	3	(	(	PUNCT
afs-6014	159	4	260/280	260/280	NUM
afs-6014	159	5	ratio	ratio	NOUN
afs-6014	159	6	)	)	PUNCT
afs-6014	159	7	was	be	AUX
afs-6014	159	8	>	>	X
afs-6014	159	9	1.7	1.7	NUM
afs-6014	159	10	for	for	ADP
afs-6014	159	11	all	all	DET
afs-6014	159	12	genotyped	genotype	VERB
afs-6014	159	13	samples	sample	NOUN
afs-6014	159	14	and	and	CCONJ
afs-6014	159	15	did	do	AUX
afs-6014	159	16	not	not	PART
afs-6014	159	17	explain	explain	VERB
afs-6014	159	18	the	the	DET
afs-6014	159	19	lower	low	ADJ
afs-6014	159	20	call	call	NOUN
afs-6014	159	21	rates	rate	NOUN
afs-6014	159	22	,	,	PUNCT
afs-6014	159	23	but	but	CCONJ
afs-6014	159	24	the	the	DET
afs-6014	159	25	dna	dna	PROPN
afs-6014	159	26	concentration	concentration	NOUN
afs-6014	159	27	of	of	ADP
afs-6014	159	28	the	the	DET
afs-6014	159	29	samples	sample	NOUN
afs-6014	159	30	varied	vary	VERB
afs-6014	159	31	between	between	ADP
afs-6014	159	32	2–100	2–100	NUM
afs-6014	159	33	ng/µl	ng/µl	NUM
afs-6014	159	34	.	.	PUNCT
afs-6014	160	1	samples	sample	NOUN
afs-6014	160	2	with	with	ADP
afs-6014	160	3	a	a	DET
afs-6014	160	4	lower	low	ADJ
afs-6014	160	5	dna	dna	PROPN
afs-6014	160	6	concentration	concentration	NOUN
afs-6014	160	7	were	be	AUX
afs-6014	160	8	also	also	ADV
afs-6014	160	9	genotyped	genotype	VERB
afs-6014	160	10	,	,	PUNCT
afs-6014	160	11	because	because	SCONJ
afs-6014	160	12	for	for	ADP
afs-6014	160	13	some	some	DET
afs-6014	160	14	hair	hair	NOUN
afs-6014	160	15	root	root	NOUN
afs-6014	160	16	samples	sample	NOUN
afs-6014	160	17	it	it	PRON
afs-6014	160	18	was	be	AUX
afs-6014	160	19	extremely	extremely	ADV
afs-6014	160	20	difficult	difficult	ADJ
afs-6014	160	21	or	or	CCONJ
afs-6014	160	22	even	even	ADV
afs-6014	160	23	impossible	impossible	ADJ
afs-6014	160	24	to	to	PART
afs-6014	160	25	obtain	obtain	VERB
afs-6014	160	26	a	a	DET
afs-6014	160	27	sufficiently	sufficiently	ADV
afs-6014	160	28	high	high	ADJ
afs-6014	160	29	dna	dna	NOUN
afs-6014	160	30	concentraa	concentraa	NOUN
afs-6014	161	1	g	g	PROPN
afs-6014	161	2	r	r	NOUN
afs-6014	161	3	i	i	NOUN
afs-6014	161	4	c	c	NOUN
afs-6014	161	5	u	u	NOUN
afs-6014	161	6	l	l	NOUN
afs-6014	161	7	t	t	NOUN
afs-6014	162	1	u	u	X
afs-6014	162	2	r	r	NOUN
afs-6014	162	3	a	a	PROPN
afs-6014	162	4	l	l	NOUN
afs-6014	162	5	a	a	DET
afs-6014	162	6	n	n	NOUN
afs-6014	163	1	d	d	NOUN
afs-6014	163	2	f	f	X
afs-6014	164	1	o	o	NOUN
afs-6014	164	2	o	o	X
afs-6014	165	1	d	d	X
afs-6014	165	2	s	s	X
afs-6014	165	3	c	c	NOUN
afs-6014	166	1	i	i	NOUN
afs-6014	166	2	e	e	PROPN
afs-6014	166	3	n	n	PROPN
afs-6014	166	4	c	c	NOUN
afs-6014	166	5	e	e	X
afs-6014	166	6	sironen	sironen	PROPN
afs-6014	166	7	,	,	PUNCT
afs-6014	166	8	a.	a.	PROPN
afs-6014	166	9	et	et	PROPN
afs-6014	166	10	al	al	PROPN
afs-6014	166	11	.	.	PROPN
afs-6014	166	12	high	high	ADJ
afs-6014	166	13	throughput	throughput	NOUN
afs-6014	166	14	genotyping	genotype	VERB
afs-6014	166	15	from	from	ADP
afs-6014	166	16	porcine	porcine	NOUN
afs-6014	166	17	hair	hair	NOUN
afs-6014	166	18	follicles	follicle	VERB
afs-6014	166	19	148	148	NUM
afs-6014	166	20	a	a	DET
afs-6014	166	21	g	g	NOUN
afs-6014	166	22	r	r	NOUN
afs-6014	167	1	i	i	NOUN
afs-6014	167	2	c	c	NOUN
afs-6014	167	3	u	u	NOUN
afs-6014	167	4	l	l	NOUN
afs-6014	167	5	t	t	NOUN
afs-6014	167	6	u	u	X
afs-6014	167	7	r	r	NOUN
afs-6014	167	8	a	a	PROPN
afs-6014	167	9	l	l	NOUN
afs-6014	167	10	a	a	DET
afs-6014	167	11	n	n	NOUN
afs-6014	168	1	d	d	NOUN
afs-6014	168	2	f	f	X
afs-6014	169	1	o	o	NOUN
afs-6014	169	2	o	o	X
afs-6014	170	1	d	d	X
afs-6014	170	2	s	s	X
afs-6014	170	3	c	c	NOUN
afs-6014	171	1	i	i	NOUN
afs-6014	171	2	e	e	PROPN
afs-6014	171	3	n	n	PROPN
afs-6014	171	4	c	c	NOUN
afs-6014	171	5	e	e	NOUN
afs-6014	171	6	vol	vol	NOUN
afs-6014	171	7	.	.	PUNCT
afs-6014	172	1	20(2011	20(2011	NUM
afs-6014	172	2	):	):	PUNCT
afs-6014	173	1	143–150	143–150	NUM
afs-6014	173	2	.	.	NOUN
afs-6014	173	3	149	149	NUM
afs-6014	173	4	table	table	NOUN
afs-6014	173	5	3	3	NUM
afs-6014	173	6	.	.	PUNCT
afs-6014	173	7	differences	difference	NOUN
afs-6014	173	8	in	in	ADP
afs-6014	173	9	allele	allele	NOUN
afs-6014	173	10	calls	call	NOUN
afs-6014	173	11	after	after	ADP
afs-6014	173	12	beadchip	beadchip	NOUN
afs-6014	173	13	genotyping	genotyping	NOUN
afs-6014	173	14	of	of	ADP
afs-6014	173	15	hair	hair	NOUN
afs-6014	173	16	root	root	NOUN
afs-6014	173	17	samples	sample	NOUN
afs-6014	173	18	prepared	prepare	VERB
afs-6014	173	19	by	by	ADP
afs-6014	173	20	various	various	ADJ
afs-6014	173	21	dna	dna	PROPN
afs-6014	173	22	extraction	extraction	NOUN
afs-6014	173	23	methods	method	NOUN
afs-6014	173	24	.	.	PUNCT
afs-6014	174	1	missing	miss	VERB
afs-6014	174	2	genotypes	genotype	NOUN
afs-6014	174	3	:	:	PUNCT
afs-6014	174	4	number	number	NOUN
afs-6014	174	5	of	of	ADP
afs-6014	174	6	genotypes	genotype	NOUN
afs-6014	174	7	that	that	PRON
afs-6014	174	8	are	be	AUX
afs-6014	174	9	missing	miss	VERB
afs-6014	174	10	in	in	ADP
afs-6014	174	11	the	the	DET
afs-6014	174	12	comparison	comparison	NOUN
afs-6014	174	13	between	between	ADP
afs-6014	174	14	hair	hair	NOUN
afs-6014	174	15	and	and	CCONJ
afs-6014	174	16	sperm	sperm	NOUN
afs-6014	174	17	samples	sample	NOUN
afs-6014	174	18	.	.	PUNCT
afs-6014	175	1	different	different	ADJ
afs-6014	175	2	genotypes	genotype	NOUN
afs-6014	175	3	:	:	PUNCT
afs-6014	175	4	number	number	NOUN
afs-6014	175	5	of	of	ADP
afs-6014	175	6	genotypes	genotype	NOUN
afs-6014	175	7	that	that	PRON
afs-6014	175	8	are	be	AUX
afs-6014	175	9	different	different	ADJ
afs-6014	175	10	in	in	ADP
afs-6014	175	11	the	the	DET
afs-6014	175	12	comparison	comparison	NOUN
afs-6014	175	13	between	between	ADP
afs-6014	175	14	hair	hair	NOUN
afs-6014	175	15	and	and	CCONJ
afs-6014	175	16	sperm	sperm	NOUN
afs-6014	175	17	samples	sample	NOUN
afs-6014	175	18	.	.	PUNCT
afs-6014	176	1	the	the	DET
afs-6014	176	2	letter	letter	NOUN
afs-6014	176	3	or	or	CCONJ
afs-6014	176	4	number	number	NOUN
afs-6014	176	5	after	after	SCONJ
afs-6014	176	6	the	the	DET
afs-6014	176	7	identification	identification	NOUN
afs-6014	176	8	number	number	NOUN
afs-6014	176	9	indicates	indicate	VERB
afs-6014	176	10	the	the	DET
afs-6014	176	11	dna	dna	PROPN
afs-6014	176	12	preparation	preparation	NOUN
afs-6014	176	13	method	method	NOUN
afs-6014	176	14	:	:	PUNCT
afs-6014	176	15	s	s	X
afs-6014	176	16	=	=	NOUN
afs-6014	176	17	dna	dna	PROPN
afs-6014	176	18	extracted	extract	VERB
afs-6014	176	19	from	from	ADP
afs-6014	176	20	sperm	sperm	NOUN
afs-6014	176	21	,	,	PUNCT
afs-6014	176	22	1	1	NUM
afs-6014	176	23	=	=	NOUN
afs-6014	176	24	lysis	lysis	NOUN
afs-6014	176	25	,	,	PUNCT
afs-6014	176	26	2	2	NUM
afs-6014	176	27	=	=	ADJ
afs-6014	176	28	lysis+etoh	lysis+etoh	ADJ
afs-6014	176	29	precipitation	precipitation	NOUN
afs-6014	176	30	and	and	CCONJ
afs-6014	176	31	7	7	NUM
afs-6014	176	32	=	=	PROPN
afs-6014	176	33	qiagen	qiagen	PROPN
afs-6014	176	34	kit	kit	NOUN
afs-6014	176	35	.	.	PUNCT
afs-6014	177	1	missing	miss	VERB
afs-6014	177	2	genotypes	genotype	NOUN
afs-6014	177	3	%	%	VERB
afs-6014	177	4	different	different	ADJ
afs-6014	177	5	genotypes	genotype	NOUN
afs-6014	177	6	%	%	NOUN
afs-6014	177	7	pig.1s	pig.1s	NOUN
afs-6014	177	8	pig.1_1	pig.1_1	PROPN
afs-6014	178	1	3068	3068	NUM
afs-6014	178	2	4.94	4.94	NUM
afs-6014	178	3	193	193	NUM
afs-6014	178	4	0.31	0.31	NUM
afs-6014	178	5	pig.1s	pig.1s	NOUN
afs-6014	178	6	pig.1_7	pig.1_7	PRON
afs-6014	178	7	48	48	NUM
afs-6014	178	8	0.08	0.08	NUM
afs-6014	178	9	32	32	NUM
afs-6014	178	10	0.05	0.05	NUM
afs-6014	178	11	pig.1s	pig.1s	NOUN
afs-6014	178	12	pig.1_2	pig.1_2	PROPN
afs-6014	179	1	618	618	NUM
afs-6014	179	2	0.99	0.99	NUM
afs-6014	179	3	38	38	NUM
afs-6014	179	4	0.06	0.06	NUM
afs-6014	179	5	pig.1_7	pig.1_7	PRON
afs-6014	179	6	pig.1_2	pig.1_2	PROPN
afs-6014	180	1	604	604	NUM
afs-6014	180	2	0.97	0.97	NUM
afs-6014	180	3	71	71	NUM
afs-6014	180	4	0.11	0.11	NUM
afs-6014	180	5	pig.2s	pig.2s	PROPN
afs-6014	180	6	pig.2_1	pig.2_1	NOUN
afs-6014	180	7	1197	1197	NUM
afs-6014	180	8	1.93	1.93	NUM
afs-6014	180	9	53	53	NUM
afs-6014	180	10	0.09	0.09	NUM
afs-6014	180	11	pig.2s	pig.2s	PROPN
afs-6014	180	12	pig.2_7	pig.2_7	NOUN
afs-6014	180	13	18	18	NUM
afs-6014	180	14	0.03	0.03	NUM
afs-6014	180	15	19	19	NUM
afs-6014	180	16	0.03	0.03	NUM
afs-6014	180	17	pig.2s	pig.2s	NOUN
afs-6014	180	18	pig.2_2	pig.2_2	PROPN
afs-6014	180	19	69	69	NUM
afs-6014	180	20	0.11	0.11	NUM
afs-6014	180	21	18	18	NUM
afs-6014	180	22	0.03	0.03	NUM
afs-6014	180	23	pig.2_7	pig.2_7	NOUN
afs-6014	180	24	pig.2_2	pig.2_2	PROPN
afs-6014	180	25	63	63	NUM
afs-6014	180	26	0.10	0.10	NUM
afs-6014	180	27	25	25	NUM
afs-6014	180	28	0.04	0.04	NUM
afs-6014	180	29	pig.3s	pig.3s	NOUN
afs-6014	180	30	pig.3_1	pig.3_1	PROPN
afs-6014	180	31	2301	2301	NUM
afs-6014	180	32	3.70	3.70	NUM
afs-6014	180	33	157	157	NUM
afs-6014	180	34	0.25	0.25	NUM
afs-6014	180	35	pig.3s	pig.3s	NOUN
afs-6014	180	36	pig.3_7	pig.3_7	NOUN
afs-6014	180	37	18	18	NUM
afs-6014	180	38	0.03	0.03	NUM
afs-6014	180	39	37	37	NUM
afs-6014	180	40	0.06	0.06	NUM
afs-6014	180	41	pig.3s	pig.3s	NOUN
afs-6014	180	42	pig.3_2	pig.3_2	ADP
afs-6014	181	1	822	822	NUM
afs-6014	181	2	1.32	1.32	NUM
afs-6014	181	3	57	57	NUM
afs-6014	181	4	0.09	0.09	NUM
afs-6014	181	5	pig.3_7	pig.3_7	NOUN
afs-6014	181	6	pig.3_2	pig.3_2	ADJ
afs-6014	181	7	816	816	NUM
afs-6014	181	8	1.31	1.31	NUM
afs-6014	181	9	44	44	NUM
afs-6014	181	10	0.07	0.07	NUM
afs-6014	181	11	pig.4as	pig.4a	VERB
afs-6014	181	12	pig.4bs	pig.4bs	PROPN
afs-6014	181	13	64	64	NUM
afs-6014	181	14	0.10	0.10	NUM
afs-6014	181	15	52	52	NUM
afs-6014	181	16	0.08	0.08	NUM
afs-6014	181	17	tion	tion	NOUN
afs-6014	181	18	(	(	PUNCT
afs-6014	181	19	>	>	X
afs-6014	181	20	50	50	NUM
afs-6014	181	21	ng/µl	ng/µl	NUM
afs-6014	181	22	)	)	PUNCT
afs-6014	181	23	.	.	PUNCT
afs-6014	182	1	thus	thus	ADV
afs-6014	182	2	,	,	PUNCT
afs-6014	182	3	with	with	ADP
afs-6014	182	4	the	the	DET
afs-6014	182	5	aim	aim	NOUN
afs-6014	182	6	of	of	ADP
afs-6014	182	7	genotyping	genotype	VERB
afs-6014	182	8	a	a	DET
afs-6014	182	9	large	large	ADJ
afs-6014	182	10	population	population	NOUN
afs-6014	182	11	of	of	ADP
afs-6014	182	12	animals	animal	NOUN
afs-6014	182	13	with	with	ADP
afs-6014	182	14	minimal	minimal	ADJ
afs-6014	182	15	effort	effort	NOUN
afs-6014	182	16	the	the	DET
afs-6014	182	17	range	range	NOUN
afs-6014	182	18	in	in	ADP
afs-6014	182	19	dna	dna	PROPN
afs-6014	182	20	concentration	concentration	NOUN
afs-6014	182	21	was	be	AUX
afs-6014	182	22	considered	consider	VERB
afs-6014	182	23	acceptable	acceptable	ADJ
afs-6014	182	24	.	.	PUNCT
afs-6014	183	1	when	when	SCONJ
afs-6014	183	2	the	the	DET
afs-6014	183	3	call	call	NOUN
afs-6014	183	4	rates	rate	NOUN
afs-6014	183	5	were	be	AUX
afs-6014	183	6	analysed	analyse	VERB
afs-6014	183	7	in	in	ADP
afs-6014	183	8	groups	group	NOUN
afs-6014	183	9	based	base	VERB
afs-6014	183	10	on	on	ADP
afs-6014	183	11	the	the	DET
afs-6014	183	12	dna	dna	PROPN
afs-6014	183	13	concentration	concentration	NOUN
afs-6014	183	14	,	,	PUNCT
afs-6014	183	15	a	a	DET
afs-6014	183	16	clear	clear	ADJ
afs-6014	183	17	association	association	NOUN
afs-6014	183	18	between	between	ADP
afs-6014	183	19	concentration	concentration	NOUN
afs-6014	183	20	and	and	CCONJ
afs-6014	183	21	cr	cr	PROPN
afs-6014	183	22	was	be	AUX
afs-6014	183	23	identified	identify	VERB
afs-6014	183	24	(	(	PUNCT
afs-6014	183	25	fig	fig	NOUN
afs-6014	183	26	.	.	PUNCT
afs-6014	183	27	1	1	NUM
afs-6014	183	28	)	)	PUNCT
afs-6014	183	29	.	.	PUNCT
afs-6014	184	1	with	with	ADP
afs-6014	184	2	low	low	ADJ
afs-6014	184	3	dna	dna	PROPN
afs-6014	184	4	concentrations	concentration	NOUN
afs-6014	184	5	(	(	PUNCT
afs-6014	184	6	<	<	X
afs-6014	184	7	30	30	NUM
afs-6014	184	8	ng/µl	ng/µl	NUM
afs-6014	184	9	)	)	PUNCT
afs-6014	184	10	the	the	DET
afs-6014	184	11	proportion	proportion	NOUN
afs-6014	184	12	of	of	ADP
afs-6014	184	13	samples	sample	NOUN
afs-6014	184	14	with	with	ADP
afs-6014	184	15	adequate	adequate	ADJ
afs-6014	184	16	call	call	NOUN
afs-6014	184	17	rates	rate	NOUN
afs-6014	184	18	was	be	AUX
afs-6014	184	19	lower	low	ADJ
afs-6014	184	20	than	than	ADP
afs-6014	184	21	when	when	SCONJ
afs-6014	184	22	the	the	DET
afs-6014	184	23	concentration	concentration	NOUN
afs-6014	184	24	exceeded	exceed	VERB
afs-6014	184	25	30	30	NUM
afs-6014	184	26	ng/µl	ng/µl	NUM
afs-6014	184	27	.	.	PUNCT
afs-6014	185	1	based	base	VERB
afs-6014	185	2	on	on	ADP
afs-6014	185	3	pair	pair	NOUN
afs-6014	185	4	-	-	PUNCT
afs-6014	185	5	wise	wise	ADJ
afs-6014	185	6	comparisons	comparison	NOUN
afs-6014	185	7	using	use	VERB
afs-6014	185	8	the	the	DET
afs-6014	185	9	tukey	tukey	NOUN
afs-6014	185	10	’s	’s	PART
afs-6014	185	11	test	test	NOUN
afs-6014	185	12	there	there	PRON
afs-6014	185	13	was	be	VERB
afs-6014	185	14	a	a	DET
afs-6014	185	15	significant	significant	ADJ
afs-6014	185	16	difference	difference	NOUN
afs-6014	185	17	between	between	ADP
afs-6014	185	18	sperm	sperm	NOUN
afs-6014	185	19	samples	sample	NOUN
afs-6014	185	20	and	and	CCONJ
afs-6014	185	21	hair	hair	NOUN
afs-6014	185	22	samples	sample	NOUN
afs-6014	185	23	when	when	SCONJ
afs-6014	185	24	dna	dna	PROPN
afs-6014	185	25	concentration	concentration	NOUN
afs-6014	185	26	fell	fall	VERB
afs-6014	185	27	below	below	ADP
afs-6014	185	28	30	30	NUM
afs-6014	185	29	ng/	ng/	VERB
afs-6014	185	30	µl	µl	ADP
afs-6014	185	31	,	,	PUNCT
afs-6014	185	32	but	but	CCONJ
afs-6014	185	33	no	no	DET
afs-6014	185	34	difference	difference	NOUN
afs-6014	185	35	when	when	SCONJ
afs-6014	185	36	the	the	DET
afs-6014	185	37	concentration	concentration	NOUN
afs-6014	185	38	was	be	AUX
afs-6014	185	39	higher	high	ADJ
afs-6014	185	40	than	than	ADP
afs-6014	185	41	30	30	NUM
afs-6014	185	42	ng/µl	ng/µl	NUM
afs-6014	185	43	(	(	PUNCT
afs-6014	185	44	table	table	NOUN
afs-6014	185	45	4	4	NUM
afs-6014	185	46	)	)	PUNCT
afs-6014	185	47	.	.	PUNCT
afs-6014	186	1	significant	significant	ADJ
afs-6014	186	2	differences	difference	NOUN
afs-6014	186	3	were	be	AUX
afs-6014	186	4	also	also	ADV
afs-6014	186	5	found	find	VERB
afs-6014	186	6	between	between	ADP
afs-6014	186	7	batch	batch	NOUN
afs-6014	186	8	number	number	NOUN
afs-6014	186	9	four	four	NUM
afs-6014	186	10	and	and	CCONJ
afs-6014	186	11	batch	batch	VERB
afs-6014	186	12	number	number	NOUN
afs-6014	186	13	three	three	NUM
afs-6014	186	14	(	(	PUNCT
afs-6014	186	15	table	table	NOUN
afs-6014	186	16	4	4	NUM
afs-6014	186	17	)	)	PUNCT
afs-6014	186	18	.	.	PUNCT
afs-6014	187	1	part	part	NOUN
afs-6014	187	2	of	of	ADP
afs-6014	187	3	this	this	PRON
afs-6014	187	4	may	may	AUX
afs-6014	187	5	be	be	AUX
afs-6014	187	6	due	due	ADJ
afs-6014	187	7	to	to	ADP
afs-6014	187	8	the	the	DET
afs-6014	187	9	age	age	NOUN
afs-6014	187	10	and	and	CCONJ
afs-6014	187	11	storage	storage	NOUN
afs-6014	187	12	conditions	condition	NOUN
afs-6014	187	13	of	of	ADP
afs-6014	187	14	the	the	DET
afs-6014	187	15	hair	hair	NOUN
afs-6014	187	16	samples	sample	NOUN
afs-6014	187	17	,	,	PUNCT
afs-6014	187	18	but	but	CCONJ
afs-6014	187	19	some	some	DET
afs-6014	187	20	variation	variation	NOUN
afs-6014	187	21	may	may	AUX
afs-6014	187	22	also	also	ADV
afs-6014	187	23	arise	arise	VERB
afs-6014	187	24	from	from	ADP
afs-6014	187	25	handling	handling	NOUN
afs-6014	187	26	of	of	ADP
afs-6014	187	27	the	the	DET
afs-6014	187	28	sample	sample	NOUN
afs-6014	187	29	during	during	ADP
afs-6014	187	30	dna	dna	PROPN
afs-6014	187	31	extraction	extraction	NOUN
afs-6014	187	32	protocol	protocol	NOUN
afs-6014	187	33	.	.	PUNCT
afs-6014	188	1	the	the	DET
afs-6014	188	2	acceptable	acceptable	ADJ
afs-6014	188	3	limit	limit	NOUN
afs-6014	188	4	for	for	ADP
afs-6014	188	5	dna	dna	PROPN
afs-6014	188	6	concenfig	concenfig	NOUN
afs-6014	188	7	.	.	PUNCT
afs-6014	189	1	1	1	X
afs-6014	189	2	.	.	X
afs-6014	189	3	distribution	distribution	NOUN
afs-6014	189	4	plot	plot	NOUN
afs-6014	189	5	of	of	ADP
afs-6014	189	6	call	call	NOUN
afs-6014	189	7	rates	rate	NOUN
afs-6014	189	8	against	against	ADP
afs-6014	189	9	dna	dna	PROPN
afs-6014	189	10	concentration	concentration	NOUN
afs-6014	189	11	of	of	ADP
afs-6014	189	12	hair	hair	NOUN
afs-6014	189	13	root	root	NOUN
afs-6014	189	14	samples	sample	NOUN
afs-6014	189	15	.	.	PUNCT
afs-6014	190	1	at	at	ADP
afs-6014	190	2	low	low	ADJ
afs-6014	190	3	concentrations	concentration	NOUN
afs-6014	190	4	the	the	DET
afs-6014	190	5	proportion	proportion	NOUN
afs-6014	190	6	of	of	ADP
afs-6014	190	7	samples	sample	NOUN
afs-6014	190	8	with	with	ADP
afs-6014	190	9	an	an	DET
afs-6014	190	10	adequate	adequate	ADJ
afs-6014	190	11	call	call	NOUN
afs-6014	190	12	rate	rate	NOUN
afs-6014	190	13	is	be	AUX
afs-6014	190	14	lower	low	ADJ
afs-6014	190	15	than	than	ADP
afs-6014	190	16	with	with	ADP
afs-6014	190	17	samples	sample	NOUN
afs-6014	190	18	containing	contain	VERB
afs-6014	190	19	dna	dna	PROPN
afs-6014	190	20	concentration	concentration	NOUN
afs-6014	190	21	above	above	ADP
afs-6014	190	22	30	30	NUM
afs-6014	190	23	ng/µl	ng/µl	NUM
afs-6014	190	24	.	.	NOUN
afs-6014	191	1	0.6	0.6	NUM
afs-6014	191	2	0.7	0.7	NUM
afs-6014	191	3	0.8	0.8	NUM
afs-6014	191	4	0.9	0.9	NUM
afs-6014	191	5	1	1	NUM
afs-6014	191	6	0	0	NUM
afs-6014	191	7	20	20	NUM
afs-6014	191	8	40	40	NUM
afs-6014	191	9	60	60	NUM
afs-6014	191	10	80	80	NUM
afs-6014	191	11	100	100	NUM
afs-6014	191	12	call	call	NOUN
afs-6014	191	13	rate	rate	NOUN
afs-6014	191	14	qubit	qubit	NOUN
afs-6014	191	15	ng/µl	ng/µl	NUM
afs-6014	191	16	a	a	DET
afs-6014	191	17	g	g	NOUN
afs-6014	191	18	r	r	NOUN
afs-6014	192	1	i	i	NOUN
afs-6014	192	2	c	c	NOUN
afs-6014	192	3	u	u	NOUN
afs-6014	192	4	l	l	NOUN
afs-6014	192	5	t	t	NOUN
afs-6014	192	6	u	u	X
afs-6014	192	7	r	r	NOUN
afs-6014	192	8	a	a	PROPN
afs-6014	192	9	l	l	NOUN
afs-6014	192	10	a	a	DET
afs-6014	192	11	n	n	NOUN
afs-6014	193	1	d	d	NOUN
afs-6014	193	2	f	f	X
afs-6014	194	1	o	o	NOUN
afs-6014	194	2	o	o	X
afs-6014	195	1	d	d	X
afs-6014	195	2	s	s	X
afs-6014	195	3	c	c	NOUN
afs-6014	196	1	i	i	NOUN
afs-6014	196	2	e	e	PROPN
afs-6014	196	3	n	n	PROPN
afs-6014	196	4	c	c	NOUN
afs-6014	196	5	e	e	X
afs-6014	196	6	sironen	sironen	PROPN
afs-6014	196	7	,	,	PUNCT
afs-6014	196	8	a.	a.	PROPN
afs-6014	196	9	et	et	PROPN
afs-6014	196	10	al	al	PROPN
afs-6014	196	11	.	.	PROPN
afs-6014	196	12	high	high	ADJ
afs-6014	196	13	throughput	throughput	NOUN
afs-6014	196	14	genotyping	genotype	VERB
afs-6014	196	15	from	from	ADP
afs-6014	196	16	porcine	porcine	NOUN
afs-6014	196	17	hair	hair	NOUN
afs-6014	196	18	follicles	follicle	VERB
afs-6014	196	19	148	148	NUM
afs-6014	196	20	a	a	DET
afs-6014	196	21	g	g	NOUN
afs-6014	196	22	r	r	NOUN
afs-6014	197	1	i	i	NOUN
afs-6014	197	2	c	c	NOUN
afs-6014	197	3	u	u	NOUN
afs-6014	197	4	l	l	NOUN
afs-6014	197	5	t	t	NOUN
afs-6014	197	6	u	u	X
afs-6014	197	7	r	r	NOUN
afs-6014	197	8	a	a	PROPN
afs-6014	197	9	l	l	NOUN
afs-6014	197	10	a	a	DET
afs-6014	197	11	n	n	NOUN
afs-6014	198	1	d	d	NOUN
afs-6014	198	2	f	f	X
afs-6014	199	1	o	o	NOUN
afs-6014	199	2	o	o	X
afs-6014	200	1	d	d	X
afs-6014	200	2	s	s	X
afs-6014	200	3	c	c	NOUN
afs-6014	201	1	i	i	NOUN
afs-6014	201	2	e	e	PROPN
afs-6014	201	3	n	n	PROPN
afs-6014	201	4	c	c	NOUN
afs-6014	201	5	e	e	NOUN
afs-6014	201	6	vol	vol	NOUN
afs-6014	201	7	.	.	PUNCT
afs-6014	202	1	20(2011	20(2011	NUM
afs-6014	202	2	):	):	PUNCT
afs-6014	202	3	143–150	143–150	NUM
afs-6014	202	4	.	.	NOUN
afs-6014	202	5	149	149	NUM
afs-6014	202	6	tration	tration	NOUN
afs-6014	202	7	appeared	appear	VERB
afs-6014	202	8	to	to	PART
afs-6014	202	9	be	be	AUX
afs-6014	202	10	30	30	NUM
afs-6014	202	11	ng/µl	ng/µl	NUM
afs-6014	202	12	producing	produce	VERB
afs-6014	202	13	cr	cr	X
afs-6014	202	14	>	>	SYM
afs-6014	202	15	99	99	NUM
afs-6014	202	16	%	%	NOUN
afs-6014	202	17	corresponding	correspond	VERB
afs-6014	202	18	to	to	ADP
afs-6014	202	19	the	the	DET
afs-6014	202	20	cr	cr	PROPN
afs-6014	202	21	with	with	ADP
afs-6014	202	22	dna	dna	PROPN
afs-6014	202	23	extracted	extract	VERB
afs-6014	202	24	from	from	ADP
afs-6014	202	25	sperm	sperm	NOUN
afs-6014	202	26	or	or	CCONJ
afs-6014	202	27	blood	blood	NOUN
afs-6014	202	28	.	.	PUNCT
afs-6014	203	1	however	however	ADV
afs-6014	203	2	,	,	PUNCT
afs-6014	203	3	samples	sample	NOUN
afs-6014	203	4	with	with	ADP
afs-6014	203	5	lower	low	ADJ
afs-6014	203	6	concentration	concentration	NOUN
afs-6014	203	7	of	of	ADP
afs-6014	203	8	dna	dna	PROPN
afs-6014	203	9	also	also	ADV
afs-6014	203	10	exhibited	exhibit	VERB
afs-6014	203	11	high	high	ADJ
afs-6014	203	12	call	call	NOUN
afs-6014	203	13	rates	rate	NOUN
afs-6014	203	14	indicating	indicate	VERB
afs-6014	203	15	that	that	SCONJ
afs-6014	203	16	some	some	DET
afs-6014	203	17	deviation	deviation	NOUN
afs-6014	203	18	can	can	AUX
afs-6014	203	19	be	be	AUX
afs-6014	203	20	tolerated	tolerate	VERB
afs-6014	203	21	for	for	ADP
afs-6014	203	22	successful	successful	ADJ
afs-6014	203	23	genotyping	genotyping	NOUN
afs-6014	203	24	.	.	PUNCT
afs-6014	204	1	therefore	therefore	ADV
afs-6014	204	2	,	,	PUNCT
afs-6014	204	3	depending	depend	VERB
afs-6014	204	4	on	on	ADP
afs-6014	204	5	the	the	DET
afs-6014	204	6	experimental	experimental	ADJ
afs-6014	204	7	design	design	NOUN
afs-6014	204	8	,	,	PUNCT
afs-6014	204	9	it	it	PRON
afs-6014	204	10	may	may	AUX
afs-6014	204	11	be	be	AUX
afs-6014	204	12	necessary	necessary	ADJ
afs-6014	204	13	to	to	PART
afs-6014	204	14	increase	increase	VERB
afs-6014	204	15	sample	sample	NOUN
afs-6014	204	16	numbers	number	NOUN
afs-6014	204	17	by	by	ADP
afs-6014	204	18	decreasing	decrease	VERB
afs-6014	204	19	the	the	DET
afs-6014	204	20	dna	dna	PROPN
afs-6014	204	21	concentration	concentration	NOUN
afs-6014	204	22	streshold	streshold	ADJ
afs-6014	204	23	.	.	PUNCT
afs-6014	205	1	conclusion	conclusion	NOUN
afs-6014	205	2	our	our	PRON
afs-6014	205	3	results	result	NOUN
afs-6014	205	4	show	show	VERB
afs-6014	205	5	that	that	SCONJ
afs-6014	205	6	dna	dna	NOUN
afs-6014	205	7	from	from	ADP
afs-6014	205	8	porcine	porcine	NOUN
afs-6014	205	9	hair	hair	NOUN
afs-6014	205	10	roots	root	NOUN
afs-6014	205	11	using	use	VERB
afs-6014	205	12	an	an	DET
afs-6014	205	13	appropriate	appropriate	ADJ
afs-6014	205	14	extraction	extraction	NOUN
afs-6014	205	15	method	method	NOUN
afs-6014	205	16	generates	generate	VERB
afs-6014	205	17	reliable	reliable	ADJ
afs-6014	205	18	genotyping	genotyping	NOUN
afs-6014	205	19	results	result	NOUN
afs-6014	205	20	with	with	ADP
afs-6014	205	21	the	the	DET
afs-6014	205	22	illumina	illumina	PROPN
afs-6014	205	23	porcinesnp60	porcinesnp60	PROPN
afs-6014	205	24	genotyping	genotyping	NOUN
afs-6014	205	25	beadchip	beadchip	NOUN
afs-6014	205	26	.	.	PUNCT
afs-6014	206	1	these	these	DET
afs-6014	206	2	data	datum	NOUN
afs-6014	206	3	allow	allow	VERB
afs-6014	206	4	a	a	DET
afs-6014	206	5	straightforward	straightforward	ADJ
afs-6014	206	6	and	and	CCONJ
afs-6014	206	7	inexpensive	inexpensive	ADJ
afs-6014	206	8	means	mean	NOUN
afs-6014	206	9	of	of	ADP
afs-6014	206	10	genotyping	genotype	VERB
afs-6014	206	11	previously	previously	ADV
afs-6014	206	12	collected	collect	VERB
afs-6014	206	13	samples	sample	NOUN
afs-6014	206	14	and/or	and/or	CCONJ
afs-6014	206	15	large	large	ADJ
afs-6014	206	16	animal	animal	NOUN
afs-6014	206	17	populations	population	NOUN
afs-6014	206	18	.	.	PUNCT
afs-6014	207	1	the	the	DET
afs-6014	207	2	concentration	concentration	NOUN
afs-6014	207	3	of	of	ADP
afs-6014	207	4	dna	dna	PROPN
afs-6014	207	5	appears	appear	VERB
afs-6014	207	6	to	to	PART
afs-6014	207	7	be	be	AUX
afs-6014	207	8	the	the	DET
afs-6014	207	9	limiting	limit	VERB
afs-6014	207	10	factor	factor	NOUN
afs-6014	207	11	in	in	ADP
afs-6014	207	12	genotyping	genotype	VERB
afs-6014	207	13	dna	dna	NOUN
afs-6014	207	14	from	from	ADP
afs-6014	207	15	hair	hair	NOUN
afs-6014	207	16	roots	root	NOUN
afs-6014	207	17	and	and	CCONJ
afs-6014	207	18	can	can	AUX
afs-6014	207	19	be	be	AUX
afs-6014	207	20	used	use	VERB
afs-6014	207	21	to	to	PART
afs-6014	207	22	confirm	confirm	VERB
afs-6014	207	23	the	the	DET
afs-6014	207	24	high	high	ADJ
afs-6014	207	25	crs	crs	PROPN
afs-6014	207	26	.	.	PUNCT
afs-6014	208	1	however	however	ADV
afs-6014	208	2	,	,	PUNCT
afs-6014	208	3	if	if	SCONJ
afs-6014	208	4	the	the	DET
afs-6014	208	5	genotyping	genotyping	NOUN
afs-6014	208	6	of	of	ADP
afs-6014	208	7	large	large	ADJ
afs-6014	208	8	populations	population	NOUN
afs-6014	208	9	is	be	AUX
afs-6014	208	10	required	require	VERB
afs-6014	208	11	analysis	analysis	NOUN
afs-6014	208	12	of	of	ADP
afs-6014	208	13	samples	sample	NOUN
afs-6014	208	14	containing	contain	VERB
afs-6014	208	15	lower	low	ADJ
afs-6014	208	16	dna	dna	PROPN
afs-6014	208	17	concentrations	concentration	NOUN
afs-6014	208	18	may	may	AUX
afs-6014	208	19	remain	remain	VERB
afs-6014	208	20	viable	viable	ADJ
afs-6014	208	21	.	.	PUNCT
afs-6014	209	1	the	the	DET
afs-6014	209	2	qubit	qubit	NOUN
afs-6014	209	3	platform	platform	NOUN
afs-6014	209	4	appeared	appear	VERB
afs-6014	209	5	to	to	PART
afs-6014	209	6	be	be	AUX
afs-6014	209	7	a	a	DET
afs-6014	209	8	valid	valid	ADJ
afs-6014	209	9	method	method	NOUN
afs-6014	209	10	for	for	ADP
afs-6014	209	11	the	the	DET
afs-6014	209	12	measurement	measurement	NOUN
afs-6014	209	13	of	of	ADP
afs-6014	209	14	dna	dna	PROPN
afs-6014	209	15	concentration	concentration	NOUN
afs-6014	209	16	.	.	PUNCT
afs-6014	210	1	furthermore	furthermore	ADV
afs-6014	210	2	,	,	PUNCT
afs-6014	210	3	the	the	DET
afs-6014	210	4	snps	snps	PROPN
afs-6014	210	5	on	on	ADP
afs-6014	210	6	porcinesnp60	porcinesnp60	NOUN
afs-6014	210	7	beadchip	beadchip	NOUN
afs-6014	210	8	were	be	AUX
afs-6014	210	9	highly	highly	ADV
afs-6014	210	10	polymorphic	polymorphic	ADJ
afs-6014	210	11	in	in	ADP
afs-6014	210	12	the	the	DET
afs-6014	210	13	finnish	finnish	ADJ
afs-6014	210	14	landrace	landrace	NOUN
afs-6014	210	15	population	population	NOUN
afs-6014	210	16	highlighting	highlight	VERB
afs-6014	210	17	the	the	DET
afs-6014	210	18	feasibility	feasibility	NOUN
afs-6014	210	19	of	of	ADP
afs-6014	210	20	this	this	DET
afs-6014	210	21	technology	technology	NOUN
afs-6014	210	22	for	for	ADP
afs-6014	210	23	genotyping	genotyping	NOUN
afs-6014	210	24	of	of	ADP
afs-6014	210	25	finnish	finnish	ADJ
afs-6014	210	26	landrace	landrace	NOUN
afs-6014	210	27	pigs	pig	NOUN
afs-6014	210	28	.	.	PUNCT
afs-6014	211	1	acknowledgements	acknowledgement	NOUN
afs-6014	211	2	.	.	PUNCT
afs-6014	212	1	funding	fund	VERB
afs-6014	212	2	for	for	ADP
afs-6014	212	3	this	this	DET
afs-6014	212	4	study	study	NOUN
afs-6014	212	5	was	be	AUX
afs-6014	212	6	provided	provide	VERB
afs-6014	212	7	by	by	ADP
afs-6014	212	8	the	the	DET
afs-6014	212	9	finnish	finnish	PROPN
afs-6014	212	10	ministry	ministry	PROPN
afs-6014	212	11	of	of	ADP
afs-6014	212	12	agriculture	agriculture	PROPN
afs-6014	212	13	and	and	CCONJ
afs-6014	212	14	forestry	forestry	NOUN
afs-6014	212	15	(	(	PUNCT
afs-6014	212	16	makera	makera	NOUN
afs-6014	212	17	)	)	PUNCT
afs-6014	212	18	.	.	PUNCT
afs-6014	213	1	the	the	DET
afs-6014	213	2	assistance	assistance	NOUN
afs-6014	213	3	of	of	ADP
afs-6014	213	4	tiina	tiina	PROPN
afs-6014	213	5	jaakkola	jaakkola	PROPN
afs-6014	213	6	and	and	CCONJ
afs-6014	213	7	tarja	tarja	PROPN
afs-6014	213	8	hovivuori	hovivuori	NOUN
afs-6014	213	9	in	in	ADP
afs-6014	213	10	dna	dna	PROPN
afs-6014	213	11	extraction	extraction	NOUN
afs-6014	213	12	and	and	CCONJ
afs-6014	213	13	päivi	päivi	NOUN
afs-6014	213	14	lahermo	lahermo	NOUN
afs-6014	213	15	(	(	PUNCT
afs-6014	213	16	institute	institute	NOUN
afs-6014	213	17	for	for	ADP
afs-6014	213	18	molecular	molecular	ADJ
afs-6014	213	19	medicine	medicine	NOUN
afs-6014	213	20	finland	finland	PROPN
afs-6014	213	21	,	,	PUNCT
afs-6014	213	22	fimm	fimm	NOUN
afs-6014	213	23	)	)	PUNCT
afs-6014	213	24	in	in	ADP
afs-6014	213	25	genotyping	genotype	VERB
afs-6014	213	26	with	with	ADP
afs-6014	213	27	porcinesnp60	porcinesnp60	NOUN
afs-6014	213	28	genotyping	genotyping	NOUN
afs-6014	213	29	beadchip	beadchip	NOUN
afs-6014	213	30	(	(	PUNCT
afs-6014	213	31	illumina	illumina	PROPN
afs-6014	213	32	)	)	PUNCT
afs-6014	213	33	is	be	AUX
afs-6014	213	34	greatly	greatly	ADV
afs-6014	213	35	appreciated	appreciated	ADJ
afs-6014	213	36	.	.	PUNCT
afs-6014	214	1	table	table	NOUN
afs-6014	214	2	4	4	NUM
afs-6014	214	3	.	.	PUNCT
afs-6014	214	4	descriptive	descriptive	ADJ
afs-6014	214	5	statistics	statistic	NOUN
afs-6014	214	6	of	of	ADP
afs-6014	214	7	call	call	NOUN
afs-6014	214	8	rates	rate	NOUN
afs-6014	214	9	(	(	PUNCT
afs-6014	214	10	cr	cr	NOUN
afs-6014	214	11	)	)	PUNCT
afs-6014	214	12	for	for	ADP
afs-6014	214	13	hair	hair	NOUN
afs-6014	214	14	samples	sample	NOUN
afs-6014	214	15	containing	contain	VERB
afs-6014	214	16	different	different	ADJ
afs-6014	214	17	dna	dna	NOUN
afs-6014	214	18	concentrations	concentration	NOUN
afs-6014	214	19	(	(	PUNCT
afs-6014	214	20	ng/µl	ng/µl	NUM
afs-6014	214	21	qubit	qubit	NOUN
afs-6014	214	22	)	)	PUNCT
afs-6014	214	23	and	and	CCONJ
afs-6014	214	24	between	between	ADP
afs-6014	214	25	different	different	ADJ
afs-6014	214	26	extraction	extraction	NOUN
afs-6014	214	27	batches	batch	NOUN
afs-6014	214	28	.	.	PUNCT
afs-6014	215	1	the	the	DET
afs-6014	215	2	cr	cr	PROPN
afs-6014	215	3	for	for	ADP
afs-6014	215	4	samples	sample	NOUN
afs-6014	215	5	extracted	extract	VERB
afs-6014	215	6	from	from	ADP
afs-6014	215	7	hair	hair	NOUN
afs-6014	215	8	root	root	NOUN
afs-6014	215	9	follicles	follicle	NOUN
afs-6014	215	10	with	with	ADP
afs-6014	215	11	a	a	DET
afs-6014	215	12	low	low	ADJ
afs-6014	215	13	dna	dna	NOUN
afs-6014	215	14	concentration	concentration	NOUN
afs-6014	215	15	(	(	PUNCT
afs-6014	215	16	<	<	X
afs-6014	215	17	30	30	NUM
afs-6014	215	18	ng/µl	ng/µl	NUM
afs-6014	215	19	)	)	PUNCT
afs-6014	215	20	was	be	AUX
afs-6014	215	21	significantly	significantly	ADV
afs-6014	215	22	different	different	ADJ
afs-6014	215	23	from	from	ADP
afs-6014	215	24	cr	cr	NOUN
afs-6014	215	25	for	for	ADP
afs-6014	215	26	dna	dna	PROPN
afs-6014	215	27	samples	sample	NOUN
afs-6014	215	28	extracted	extract	VERB
afs-6014	215	29	from	from	ADP
afs-6014	215	30	sperm	sperm	NOUN
afs-6014	215	31	.	.	PUNCT
afs-6014	216	1	the	the	DET
afs-6014	216	2	ls	ls	ADJ
afs-6014	216	3	mean	mean	NOUN
afs-6014	216	4	corresponds	correspond	VERB
afs-6014	216	5	to	to	PART
afs-6014	216	6	multivariate	multivariate	VERB
afs-6014	216	7	anova	anova	PROPN
afs-6014	216	8	least	least	ADV
afs-6014	216	9	square	square	ADJ
afs-6014	216	10	mean	mean	ADJ
afs-6014	216	11	estimate	estimate	NOUN
afs-6014	216	12	.	.	PUNCT
afs-6014	217	1	p	p	X
afs-6014	217	2	–	–	PUNCT
afs-6014	217	3	value	value	NOUN
afs-6014	217	4	refers	refer	VERB
afs-6014	217	5	to	to	ADP
afs-6014	217	6	the	the	DET
afs-6014	217	7	significance	significance	NOUN
afs-6014	217	8	of	of	ADP
afs-6014	217	9	differences	difference	NOUN
afs-6014	217	10	between	between	ADP
afs-6014	217	11	sperm	sperm	NOUN
afs-6014	217	12	samples	sample	NOUN
afs-6014	217	13	and	and	CCONJ
afs-6014	217	14	different	different	ADJ
afs-6014	217	15	dna	dna	PROPN
afs-6014	217	16	concentrations	concentration	NOUN
afs-6014	217	17	extracted	extract	VERB
afs-6014	217	18	from	from	ADP
afs-6014	217	19	hair	hair	NOUN
afs-6014	217	20	roots	root	NOUN
afs-6014	217	21	and	and	CCONJ
afs-6014	217	22	between	between	ADP
afs-6014	217	23	batch	batch	NOUN
afs-6014	217	24	4	4	NUM
afs-6014	217	25	and	and	CCONJ
afs-6014	217	26	other	other	ADJ
afs-6014	217	27	batches	batch	NOUN
afs-6014	217	28	based	base	VERB
afs-6014	217	29	on	on	ADP
afs-6014	217	30	tukey	tukey	PROPN
afs-6014	217	31	’s	’s	PART
afs-6014	217	32	test	test	NOUN
afs-6014	217	33	statistics	statistic	NOUN
afs-6014	217	34	.	.	PUNCT
afs-6014	218	1	dna	dna	PROPN
afs-6014	218	2	source	source	NOUN
afs-6014	218	3	class	class	NOUN
afs-6014	219	1	n	n	NOUN
afs-6014	219	2	mean	mean	VERB
afs-6014	219	3	sd	sd	ADP
afs-6014	219	4	ls	ls	ADJ
afs-6014	219	5	mean	mean	NOUN
afs-6014	219	6	p	p	ADJ
afs-6014	219	7	–	–	PUNCT
afs-6014	219	8	value	value	NOUN
afs-6014	219	9	hair	hair	NOUN
afs-6014	219	10	root	root	NOUN
afs-6014	219	11	<	<	X
afs-6014	219	12	10	10	NUM
afs-6014	219	13	24	24	NUM
afs-6014	219	14	0.885	0.885	NUM
afs-6014	219	15	0.084	0.084	NUM
afs-6014	219	16	0.900	0.900	NUM
afs-6014	219	17	<	<	X
afs-6014	219	18	.0001	.0001	PROPN
afs-6014	219	19	hair	hair	NOUN
afs-6014	219	20	root	root	NOUN
afs-6014	219	21	10	10	NUM
afs-6014	219	22	–	–	PUNCT
afs-6014	219	23	30	30	NUM
afs-6014	219	24	80	80	NUM
afs-6014	219	25	0.953	0.953	NUM
afs-6014	219	26	0.052	0.052	NUM
afs-6014	219	27	0.969	0.969	NUM
afs-6014	219	28	0.005	0.005	NUM
afs-6014	219	29	hair	hair	NOUN
afs-6014	219	30	root	root	NOUN
afs-6014	219	31	30	30	NUM
afs-6014	219	32	–	–	PUNCT
afs-6014	219	33	50	50	NUM
afs-6014	219	34	71	71	NUM
afs-6014	219	35	0.979	0.979	NUM
afs-6014	219	36	0.004	0.004	NUM
afs-6014	219	37	0.994	0.994	NUM
afs-6014	219	38	1	1	NUM
afs-6014	219	39	hair	hair	NOUN
afs-6014	219	40	root	root	VERB
afs-6014	219	41	50	50	NUM
afs-6014	219	42	–	–	PUNCT
afs-6014	219	43	100	100	NUM
afs-6014	219	44	98	98	NUM
afs-6014	219	45	0.980	0.980	NUM
afs-6014	219	46	0.005	0.005	NUM
afs-6014	219	47	0.994	0.994	NUM
afs-6014	219	48	1	1	NUM
afs-6014	219	49	sperm	sperm	NOUN
afs-6014	219	50	130	130	NUM
afs-6014	219	51	0.993	0.993	NUM
afs-6014	219	52	0.007	0.007	NUM
afs-6014	219	53	0.995	0.995	NUM
afs-6014	219	54	dna	dna	PROPN
afs-6014	219	55	batch	batch	NOUN
afs-6014	219	56	1	1	NUM
afs-6014	219	57	21	21	NUM
afs-6014	219	58	1.000	1.000	NUM
afs-6014	219	59	0.0002	0.0002	NUM
afs-6014	219	60	0.975	0.975	NUM
afs-6014	219	61	0.099	0.099	NUM
afs-6014	219	62	2	2	NUM
afs-6014	219	63	87	87	NUM
afs-6014	219	64	0.995	0.995	NUM
afs-6014	219	65	0.0003	0.0003	NUM
afs-6014	219	66	0.970	0.970	NUM
afs-6014	219	67	0.103	0.103	NUM
afs-6014	219	68	3	3	NUM
afs-6014	219	69	16	16	NUM
afs-6014	219	70	0.990	0.990	NUM
afs-6014	219	71	0.0139	0.0139	NUM
afs-6014	219	72	0.981	0.981	NUM
afs-6014	219	73	0.003	0.003	NUM
afs-6014	219	74	4	4	NUM
afs-6014	219	75	279	279	NUM
afs-6014	219	76	0.963	0.963	NUM
afs-6014	219	77	0.0453	0.0453	NUM
afs-6014	219	78	0.954	0.954	NUM
afs-6014	219	79	overall	overall	ADJ
afs-6014	219	80	403	403	NUM
afs-6014	219	81	0.973	0.973	NUM
afs-6014	219	82	0.041	0.041	NUM
afs-6014	219	83	a	a	DET
afs-6014	219	84	g	g	NOUN
afs-6014	219	85	r	r	NOUN
afs-6014	220	1	i	i	NOUN
afs-6014	220	2	c	c	NOUN
afs-6014	220	3	u	u	NOUN
afs-6014	220	4	l	l	NOUN
afs-6014	220	5	t	t	NOUN
afs-6014	220	6	u	u	X
afs-6014	220	7	r	r	NOUN
afs-6014	220	8	a	a	PROPN
afs-6014	220	9	l	l	NOUN
afs-6014	220	10	a	a	DET
afs-6014	220	11	n	n	NOUN
afs-6014	221	1	d	d	NOUN
afs-6014	221	2	f	f	X
afs-6014	222	1	o	o	NOUN
afs-6014	222	2	o	o	X
afs-6014	223	1	d	d	X
afs-6014	223	2	s	s	X
afs-6014	223	3	c	c	NOUN
afs-6014	224	1	i	i	NOUN
afs-6014	224	2	e	e	PROPN
afs-6014	224	3	n	n	PROPN
afs-6014	224	4	c	c	NOUN
afs-6014	224	5	e	e	X
afs-6014	224	6	sironen	sironen	PROPN
afs-6014	224	7	,	,	PUNCT
afs-6014	224	8	a.	a.	PROPN
afs-6014	224	9	et	et	PROPN
afs-6014	224	10	al	al	PROPN
afs-6014	224	11	.	.	PROPN
afs-6014	224	12	high	high	ADJ
afs-6014	224	13	throughput	throughput	NOUN
afs-6014	224	14	genotyping	genotype	VERB
afs-6014	224	15	from	from	ADP
afs-6014	224	16	porcine	porcine	NOUN
afs-6014	224	17	hair	hair	NOUN
afs-6014	224	18	follicles	follicle	VERB
afs-6014	224	19	150	150	NUM
afs-6014	224	20	references	reference	NOUN
afs-6014	224	21	amendola	amendola	PROPN
afs-6014	224	22	-	-	PUNCT
afs-6014	224	23	pimenta	pimenta	PROPN
afs-6014	224	24	,	,	PUNCT
afs-6014	224	25	m.	m.	NOUN
afs-6014	224	26	,	,	PUNCT
afs-6014	224	27	garcia	garcia	PROPN
afs-6014	224	28	-	-	PUNCT
afs-6014	224	29	feria	feria	PROPN
afs-6014	224	30	,	,	PUNCT
afs-6014	224	31	l.	l.	PROPN
afs-6014	224	32	,	,	PUNCT
afs-6014	224	33	serio	serio	PROPN
afs-6014	224	34	-	-	PUNCT
afs-6014	224	35	silva	silva	PROPN
afs-6014	224	36	,	,	PUNCT
afs-6014	224	37	j.c	j.c	PROPN
afs-6014	224	38	.	.	PROPN
afs-6014	224	39	&	&	CCONJ
afs-6014	224	40	rico	rico	PROPN
afs-6014	224	41	-	-	PUNCT
afs-6014	224	42	gray	gray	NOUN
afs-6014	224	43	,	,	PUNCT
afs-6014	224	44	v.	v.	ADP
afs-6014	224	45	2009	2009	NUM
afs-6014	224	46	.	.	PUNCT
afs-6014	225	1	noninvasive	noninvasive	ADJ
afs-6014	225	2	collection	collection	NOUN
afs-6014	225	3	of	of	ADP
afs-6014	225	4	fresh	fresh	ADJ
afs-6014	225	5	hairs	hair	NOUN
afs-6014	225	6	from	from	ADP
afs-6014	225	7	free	free	ADJ
afs-6014	225	8	-	-	PUNCT
afs-6014	225	9	ranging	range	VERB
afs-6014	225	10	howler	howler	NOUN
afs-6014	225	11	monkeys	monkey	NOUN
afs-6014	225	12	for	for	ADP
afs-6014	225	13	dna	dna	PROPN
afs-6014	225	14	extraction	extraction	NOUN
afs-6014	225	15	.	.	PUNCT
afs-6014	226	1	american	american	ADJ
afs-6014	226	2	journal	journal	PROPN
afs-6014	226	3	of	of	ADP
afs-6014	226	4	primatology	primatology	NOUN
afs-6014	226	5	71	71	NUM
afs-6014	226	6	:	:	PUNCT
afs-6014	226	7	359–363	359–363	NUM
afs-6014	226	8	.	.	PUNCT
afs-6014	227	1	decker	decker	PROPN
afs-6014	227	2	,	,	PUNCT
afs-6014	227	3	j.e	j.e	PROPN
afs-6014	227	4	.	.	PROPN
afs-6014	227	5	,	,	PUNCT
afs-6014	227	6	pires	pire	NOUN
afs-6014	227	7	,	,	PUNCT
afs-6014	227	8	j.c	j.c	PROPN
afs-6014	227	9	.	.	PROPN
afs-6014	227	10	,	,	PUNCT
afs-6014	227	11	conant	conant	PROPN
afs-6014	227	12	,	,	PUNCT
afs-6014	227	13	g.c	g.c	PROPN
afs-6014	227	14	.	.	PROPN
afs-6014	227	15	,	,	PUNCT
afs-6014	227	16	mckay	mckay	PROPN
afs-6014	227	17	,	,	PUNCT
afs-6014	227	18	s.d	s.d	PROPN
afs-6014	227	19	.	.	PROPN
afs-6014	227	20	,	,	PUNCT
afs-6014	227	21	heaton	heaton	PROPN
afs-6014	227	22	,	,	PUNCT
afs-6014	227	23	m.p	m.p	PROPN
afs-6014	227	24	.	.	PROPN
afs-6014	227	25	,	,	PUNCT
afs-6014	227	26	chen	chen	PROPN
afs-6014	227	27	,	,	PUNCT
afs-6014	227	28	k.	k.	PROPN
afs-6014	227	29	,	,	PUNCT
afs-6014	227	30	cooper	cooper	PROPN
afs-6014	227	31	,	,	PUNCT
afs-6014	227	32	a.	a.	PROPN
afs-6014	227	33	,	,	PUNCT
afs-6014	227	34	vilkki	vilkki	PROPN
afs-6014	227	35	,	,	PUNCT
afs-6014	227	36	j.	j.	PROPN
afs-6014	227	37	,	,	PUNCT
afs-6014	227	38	seabury	seabury	PROPN
afs-6014	227	39	,	,	PUNCT
afs-6014	227	40	c.m	c.m	PROPN
afs-6014	227	41	.	.	PROPN
afs-6014	227	42	,	,	PUNCT
afs-6014	227	43	caetano	caetano	PROPN
afs-6014	227	44	,	,	PUNCT
afs-6014	227	45	a.r	a.r	PROPN
afs-6014	227	46	.	.	PROPN
afs-6014	227	47	,	,	PUNCT
afs-6014	227	48	johnson	johnson	PROPN
afs-6014	227	49	,	,	PUNCT
afs-6014	227	50	g.s	g.s	PROPN
afs-6014	227	51	.	.	PROPN
afs-6014	227	52	,	,	PUNCT
afs-6014	227	53	brenneman	brenneman	PROPN
afs-6014	227	54	,	,	PUNCT
afs-6014	227	55	r.a	r.a	PROPN
afs-6014	227	56	.	.	PROPN
afs-6014	227	57	,	,	PUNCT
afs-6014	227	58	hanotte	hanotte	PROPN
afs-6014	227	59	,	,	PUNCT
afs-6014	227	60	o.	o.	PROPN
afs-6014	227	61	,	,	PUNCT
afs-6014	227	62	eggert	eggert	PROPN
afs-6014	227	63	,	,	PUNCT
afs-6014	227	64	l.s	l.s	PROPN
afs-6014	227	65	.	.	PROPN
afs-6014	227	66	,	,	PUNCT
afs-6014	227	67	wiener	wiener	NOUN
afs-6014	227	68	,	,	PUNCT
afs-6014	227	69	p.	p.	PROPN
afs-6014	227	70	,	,	PUNCT
afs-6014	227	71	kim	kim	PROPN
afs-6014	227	72	,	,	PUNCT
afs-6014	227	73	j.j	j.j	PROPN
afs-6014	227	74	.	.	PROPN
afs-6014	227	75	,	,	PUNCT
afs-6014	227	76	kim	kim	PROPN
afs-6014	227	77	,	,	PUNCT
afs-6014	227	78	k.s	k.s	PROPN
afs-6014	227	79	.	.	PROPN
afs-6014	227	80	,	,	PUNCT
afs-6014	227	81	sonstegard	sonstegard	NOUN
afs-6014	227	82	,	,	PUNCT
afs-6014	227	83	t.s	t.s	PROPN
afs-6014	227	84	.	.	PROPN
afs-6014	227	85	,	,	PUNCT
afs-6014	227	86	van	van	PROPN
afs-6014	227	87	tassell	tassell	PROPN
afs-6014	227	88	,	,	PUNCT
afs-6014	227	89	c.p	c.p	PROPN
afs-6014	227	90	.	.	PROPN
afs-6014	227	91	,	,	PUNCT
afs-6014	227	92	neibergs	neibergs	PROPN
afs-6014	227	93	,	,	PUNCT
afs-6014	227	94	h.l	h.l	PROPN
afs-6014	227	95	.	.	PROPN
afs-6014	227	96	,	,	PUNCT
afs-6014	227	97	mcewan	mcewan	PROPN
afs-6014	227	98	,	,	PUNCT
afs-6014	227	99	j.c	j.c	PROPN
afs-6014	227	100	.	.	PROPN
afs-6014	227	101	,	,	PUNCT
afs-6014	227	102	brauning	brauning	PROPN
afs-6014	227	103	,	,	PUNCT
afs-6014	227	104	r.	r.	PROPN
afs-6014	227	105	,	,	PUNCT
afs-6014	227	106	coutinho	coutinho	PROPN
afs-6014	227	107	,	,	PUNCT
afs-6014	227	108	l.l	l.l	PROPN
afs-6014	227	109	.	.	PROPN
afs-6014	227	110	,	,	PUNCT
afs-6014	227	111	babar	babar	PROPN
afs-6014	227	112	,	,	PUNCT
afs-6014	227	113	m.e	m.e	PROPN
afs-6014	227	114	.	.	PROPN
afs-6014	227	115	,	,	PUNCT
afs-6014	227	116	wilson	wilson	PROPN
afs-6014	227	117	,	,	PUNCT
afs-6014	227	118	g.a	g.a	PROPN
afs-6014	227	119	.	.	PROPN
afs-6014	227	120	,	,	PUNCT
afs-6014	227	121	mcclure	mcclure	PROPN
afs-6014	227	122	,	,	PUNCT
afs-6014	227	123	m.c	m.c	PROPN
afs-6014	227	124	.	.	PROPN
afs-6014	227	125	,	,	PUNCT
afs-6014	227	126	rolf	rolf	PROPN
afs-6014	227	127	,	,	PUNCT
afs-6014	227	128	m.m	m.m	PROPN
afs-6014	227	129	.	.	PROPN
afs-6014	227	130	,	,	PUNCT
afs-6014	227	131	kim	kim	PROPN
afs-6014	227	132	,	,	PUNCT
afs-6014	227	133	j.	j.	PROPN
afs-6014	227	134	,	,	PUNCT
afs-6014	227	135	schnabel	schnabel	PROPN
afs-6014	227	136	,	,	PUNCT
afs-6014	227	137	r.d	r.d	PROPN
afs-6014	227	138	.	.	PROPN
afs-6014	227	139	&	&	CCONJ
afs-6014	227	140	taylor	taylor	PROPN
afs-6014	227	141	,	,	PUNCT
afs-6014	227	142	j.f	j.f	PROPN
afs-6014	227	143	.	.	PROPN
afs-6014	227	144	2009	2009	NUM
afs-6014	227	145	.	.	PUNCT
afs-6014	228	1	resolving	resolve	VERB
afs-6014	228	2	the	the	DET
afs-6014	228	3	evolution	evolution	NOUN
afs-6014	228	4	of	of	ADP
afs-6014	228	5	extant	extant	ADJ
afs-6014	228	6	and	and	CCONJ
afs-6014	228	7	extinct	extinct	ADJ
afs-6014	228	8	ruminants	ruminant	NOUN
afs-6014	228	9	with	with	ADP
afs-6014	228	10	high	high	ADJ
afs-6014	228	11	-	-	PUNCT
afs-6014	228	12	throughput	throughput	NOUN
afs-6014	228	13	phylogenomics	phylogenomic	NOUN
afs-6014	228	14	.	.	PUNCT
afs-6014	229	1	proceedings	proceeding	NOUN
afs-6014	229	2	of	of	ADP
afs-6014	229	3	the	the	DET
afs-6014	229	4	national	national	PROPN
afs-6014	229	5	academy	academy	PROPN
afs-6014	229	6	of	of	ADP
afs-6014	229	7	sciences	sciences	PROPN
afs-6014	229	8	of	of	ADP
afs-6014	229	9	the	the	DET
afs-6014	229	10	united	united	PROPN
afs-6014	229	11	states	states	PROPN
afs-6014	229	12	of	of	ADP
afs-6014	229	13	america	america	PROPN
afs-6014	229	14	106	106	NUM
afs-6014	229	15	:	:	PUNCT
afs-6014	229	16	18644–18649	18644–18649	NUM
afs-6014	229	17	.	.	PUNCT
afs-6014	229	18	goddard	goddard	PROPN
afs-6014	229	19	,	,	PUNCT
afs-6014	229	20	m.e	m.e	PROPN
afs-6014	229	21	.	.	PROPN
afs-6014	229	22	&	&	CCONJ
afs-6014	229	23	hayes	hayes	PROPN
afs-6014	229	24	,	,	PUNCT
afs-6014	229	25	b.j	b.j	PROPN
afs-6014	229	26	.	.	PROPN
afs-6014	229	27	2009	2009	NUM
afs-6014	229	28	.	.	PUNCT
afs-6014	230	1	mapping	mapping	NOUN
afs-6014	230	2	genes	gene	NOUN
afs-6014	230	3	for	for	ADP
afs-6014	230	4	complex	complex	ADJ
afs-6014	230	5	traits	trait	NOUN
afs-6014	230	6	in	in	ADP
afs-6014	230	7	domestic	domestic	ADJ
afs-6014	230	8	animals	animal	NOUN
afs-6014	230	9	and	and	CCONJ
afs-6014	230	10	their	their	PRON
afs-6014	230	11	use	use	NOUN
afs-6014	230	12	in	in	ADP
afs-6014	230	13	breeding	breeding	NOUN
afs-6014	230	14	programmes	programme	NOUN
afs-6014	230	15	.	.	PUNCT
afs-6014	231	1	nature	nature	NOUN
afs-6014	231	2	reviews.genetics	reviews.genetic	NOUN
afs-6014	231	3	10	10	NUM
afs-6014	231	4	:	:	PUNCT
afs-6014	231	5	381–391	381–391	NUM
afs-6014	231	6	.	.	PUNCT
afs-6014	232	1	hayashida	hayashida	PROPN
afs-6014	232	2	,	,	PUNCT
afs-6014	232	3	m.	m.	NOUN
afs-6014	232	4	,	,	PUNCT
afs-6014	232	5	iwao	iwao	PROPN
afs-6014	232	6	-	-	PUNCT
afs-6014	232	7	koizumi	koizumi	PROPN
afs-6014	232	8	,	,	PUNCT
afs-6014	232	9	k.	k.	PROPN
afs-6014	232	10	,	,	PUNCT
afs-6014	232	11	murata	murata	PROPN
afs-6014	232	12	,	,	PUNCT
afs-6014	232	13	s.	s.	PROPN
afs-6014	232	14	&	&	CCONJ
afs-6014	232	15	kinoshita	kinoshita	PROPN
afs-6014	232	16	,	,	PUNCT
afs-6014	232	17	k.	k.	PROPN
afs-6014	232	18	2009	2009	NUM
afs-6014	232	19	.	.	PUNCT
afs-6014	233	1	single	single	ADJ
afs-6014	233	2	-	-	PUNCT
afs-6014	233	3	tube	tube	NOUN
afs-6014	233	4	genotyping	genotyping	NOUN
afs-6014	233	5	from	from	ADP
afs-6014	233	6	a	a	DET
afs-6014	233	7	human	human	ADJ
afs-6014	233	8	hair	hair	NOUN
afs-6014	233	9	root	root	NOUN
afs-6014	233	10	by	by	ADP
afs-6014	233	11	direct	direct	ADJ
afs-6014	233	12	pcr	pcr	NOUN
afs-6014	233	13	.	.	PUNCT
afs-6014	234	1	analytical	analytical	ADJ
afs-6014	234	2	sciences	science	NOUN
afs-6014	234	3	:	:	PUNCT
afs-6014	234	4	the	the	DET
afs-6014	234	5	international	international	ADJ
afs-6014	234	6	journal	journal	NOUN
afs-6014	234	7	of	of	ADP
afs-6014	234	8	the	the	DET
afs-6014	234	9	japan	japan	PROPN
afs-6014	234	10	society	society	PROPN
afs-6014	234	11	for	for	ADP
afs-6014	234	12	analytical	analytical	ADJ
afs-6014	234	13	chemistry	chemistry	NOUN
afs-6014	234	14	25	25	NUM
afs-6014	234	15	:	:	SYM
afs-6014	234	16	1487–1489	1487–1489	NUM
afs-6014	234	17	.	.	PUNCT
afs-6014	235	1	hayes	hayes	PROPN
afs-6014	235	2	,	,	PUNCT
afs-6014	235	3	b.j	b.j	PROPN
afs-6014	235	4	.	.	PROPN
afs-6014	235	5	,	,	PUNCT
afs-6014	235	6	bowman	bowman	PROPN
afs-6014	235	7	,	,	PUNCT
afs-6014	235	8	p.j	p.j	PROPN
afs-6014	235	9	.	.	PROPN
afs-6014	235	10	,	,	PUNCT
afs-6014	235	11	chamberlain	chamberlain	PROPN
afs-6014	235	12	,	,	PUNCT
afs-6014	235	13	a.j	a.j	PROPN
afs-6014	235	14	.	.	PROPN
afs-6014	235	15	&	&	CCONJ
afs-6014	235	16	goddard	goddard	PROPN
afs-6014	235	17	,	,	PUNCT
afs-6014	235	18	m.e	m.e	PROPN
afs-6014	235	19	.	.	PROPN
afs-6014	235	20	2009	2009	NUM
afs-6014	235	21	.	.	PUNCT
afs-6014	235	22	invited	invite	VERB
afs-6014	235	23	review	review	NOUN
afs-6014	235	24	:	:	PUNCT
afs-6014	235	25	genomic	genomic	ADJ
afs-6014	235	26	selection	selection	NOUN
afs-6014	235	27	in	in	ADP
afs-6014	235	28	dairy	dairy	NOUN
afs-6014	235	29	cattle	cattle	NOUN
afs-6014	235	30	:	:	PUNCT
afs-6014	235	31	progress	progress	NOUN
afs-6014	235	32	and	and	CCONJ
afs-6014	235	33	challenges	challenge	NOUN
afs-6014	235	34	.	.	PUNCT
afs-6014	236	1	journal	journal	NOUN
afs-6014	236	2	of	of	ADP
afs-6014	236	3	dairy	dairy	NOUN
afs-6014	236	4	science	science	NOUN
afs-6014	236	5	92	92	NUM
afs-6014	236	6	:	:	SYM
afs-6014	236	7	433–443	433–443	NUM
afs-6014	236	8	.	.	PUNCT
afs-6014	237	1	jiang	jiang	PROPN
afs-6014	237	2	,	,	PUNCT
afs-6014	237	3	l.	l.	PROPN
afs-6014	237	4	,	,	PUNCT
afs-6014	237	5	liu	liu	PROPN
afs-6014	237	6	,	,	PUNCT
afs-6014	237	7	j.	j.	PROPN
afs-6014	237	8	,	,	PUNCT
afs-6014	237	9	sun	sun	PROPN
afs-6014	237	10	,	,	PUNCT
afs-6014	237	11	d.	d.	PROPN
afs-6014	237	12	,	,	PUNCT
afs-6014	237	13	ma	ma	PROPN
afs-6014	237	14	,	,	PUNCT
afs-6014	237	15	p.	p.	NOUN
afs-6014	237	16	,	,	PUNCT
afs-6014	237	17	ding	ding	NOUN
afs-6014	237	18	,	,	PUNCT
afs-6014	237	19	x.	x.	PROPN
afs-6014	237	20	,	,	PUNCT
afs-6014	237	21	yu	yu	PROPN
afs-6014	237	22	,	,	PUNCT
afs-6014	237	23	y.	y.	PROPN
afs-6014	237	24	&	&	CCONJ
afs-6014	237	25	zhang	zhang	PROPN
afs-6014	237	26	,	,	PUNCT
afs-6014	237	27	q.	q.	PROPN
afs-6014	237	28	2010	2010	NUM
afs-6014	237	29	.	.	PUNCT
afs-6014	238	1	genome	genome	NOUN
afs-6014	238	2	wide	wide	ADJ
afs-6014	238	3	association	association	NOUN
afs-6014	238	4	studies	study	NOUN
afs-6014	238	5	for	for	ADP
afs-6014	238	6	milk	milk	NOUN
afs-6014	238	7	production	production	NOUN
afs-6014	238	8	traits	trait	NOUN
afs-6014	238	9	in	in	ADP
afs-6014	238	10	chinese	chinese	ADJ
afs-6014	238	11	holstein	holstein	PROPN
afs-6014	238	12	population	population	NOUN
afs-6014	238	13	.	.	PUNCT
afs-6014	239	1	plos	plos	PROPN
afs-6014	239	2	one	one	NUM
afs-6014	239	3	5	5	NUM
afs-6014	239	4	:	:	PUNCT
afs-6014	239	5	e13661	e13661	ADJ
afs-6014	239	6	.	.	PUNCT
afs-6014	240	1	li	li	PROPN
afs-6014	240	2	,	,	PUNCT
afs-6014	240	3	j.z	j.z	PROPN
afs-6014	240	4	.	.	PROPN
afs-6014	240	5	,	,	PUNCT
afs-6014	240	6	absher	absher	PROPN
afs-6014	240	7	,	,	PUNCT
afs-6014	240	8	d.m	d.m	PROPN
afs-6014	240	9	.	.	PROPN
afs-6014	240	10	,	,	PUNCT
afs-6014	240	11	tang	tang	PROPN
afs-6014	240	12	,	,	PUNCT
afs-6014	240	13	h.	h.	PROPN
afs-6014	240	14	,	,	PUNCT
afs-6014	240	15	southwick	southwick	PROPN
afs-6014	240	16	,	,	PUNCT
afs-6014	240	17	a.m.	a.m.	ADV
afs-6014	240	18	,	,	PUNCT
afs-6014	240	19	casto	casto	PROPN
afs-6014	240	20	,	,	PUNCT
afs-6014	240	21	a.m.	a.m.	ADV
afs-6014	240	22	,	,	PUNCT
afs-6014	240	23	ramachandran	ramachandran	PROPN
afs-6014	240	24	,	,	PUNCT
afs-6014	240	25	s.	s.	PROPN
afs-6014	240	26	,	,	PUNCT
afs-6014	240	27	cann	cann	PROPN
afs-6014	240	28	,	,	PUNCT
afs-6014	240	29	h.m	h.m	PROPN
afs-6014	240	30	.	.	PROPN
afs-6014	240	31	,	,	PUNCT
afs-6014	240	32	barsh	barsh	PROPN
afs-6014	240	33	,	,	PUNCT
afs-6014	240	34	g.s	g.s	PROPN
afs-6014	240	35	.	.	PROPN
afs-6014	240	36	,	,	PUNCT
afs-6014	240	37	feldman	feldman	PROPN
afs-6014	240	38	,	,	PUNCT
afs-6014	240	39	m.	m.	NOUN
afs-6014	240	40	,	,	PUNCT
afs-6014	240	41	cavalli	cavalli	NOUN
afs-6014	240	42	-	-	PUNCT
afs-6014	240	43	sforza	sforza	NOUN
afs-6014	240	44	,	,	PUNCT
afs-6014	240	45	l.l	l.l	PROPN
afs-6014	240	46	.	.	PROPN
afs-6014	240	47	&	&	CCONJ
afs-6014	240	48	myers	myers	PROPN
afs-6014	240	49	,	,	PUNCT
afs-6014	240	50	r.m	r.m	PROPN
afs-6014	240	51	.	.	PROPN
afs-6014	240	52	2008	2008	NUM
afs-6014	240	53	.	.	PUNCT
afs-6014	241	1	worldwide	worldwide	ADJ
afs-6014	241	2	human	human	ADJ
afs-6014	241	3	relationships	relationship	NOUN
afs-6014	241	4	inferred	infer	VERB
afs-6014	241	5	from	from	ADP
afs-6014	241	6	genomewide	genomewide	ADJ
afs-6014	241	7	patterns	pattern	NOUN
afs-6014	241	8	of	of	ADP
afs-6014	241	9	variation	variation	NOUN
afs-6014	241	10	.	.	PUNCT
afs-6014	242	1	science	science	NOUN
afs-6014	242	2	(	(	PUNCT
afs-6014	242	3	new	new	PROPN
afs-6014	242	4	york	york	PROPN
afs-6014	242	5	,	,	PUNCT
afs-6014	242	6	n.y	n.y	PROPN
afs-6014	242	7	.	.	PROPN
afs-6014	242	8	)	)	PUNCT
afs-6014	243	1	319	319	NUM
afs-6014	243	2	:	:	PUNCT
afs-6014	243	3	1100–1104	1100–1104	NUM
afs-6014	243	4	.	.	PUNCT
afs-6014	244	1	meuwissen	meuwissen	PROPN
afs-6014	244	2	,	,	PUNCT
afs-6014	244	3	t.h	t.h	PROPN
afs-6014	244	4	.	.	PROPN
afs-6014	244	5	,	,	PUNCT
afs-6014	244	6	hayes	hayes	PROPN
afs-6014	244	7	,	,	PUNCT
afs-6014	244	8	b.j	b.j	PROPN
afs-6014	244	9	.	.	PROPN
afs-6014	244	10	&	&	CCONJ
afs-6014	244	11	goddard	goddard	PROPN
afs-6014	244	12	,	,	PUNCT
afs-6014	244	13	m.e	m.e	PROPN
afs-6014	244	14	.	.	PROPN
afs-6014	244	15	2001	2001	NUM
afs-6014	244	16	.	.	PUNCT
afs-6014	245	1	prediction	prediction	NOUN
afs-6014	245	2	of	of	ADP
afs-6014	245	3	total	total	ADJ
afs-6014	245	4	genetic	genetic	ADJ
afs-6014	245	5	value	value	NOUN
afs-6014	245	6	using	use	VERB
afs-6014	245	7	genome	genome	NOUN
afs-6014	245	8	-	-	PUNCT
afs-6014	245	9	wide	wide	ADJ
afs-6014	245	10	dense	dense	ADJ
afs-6014	245	11	marker	marker	NOUN
afs-6014	245	12	maps	map	NOUN
afs-6014	245	13	.	.	PUNCT
afs-6014	246	1	genetics	genetic	NOUN
afs-6014	246	2	157	157	NUM
afs-6014	246	3	:	:	PUNCT
afs-6014	246	4	1819–1829	1819–1829	NUM
afs-6014	246	5	.	.	X
afs-6014	247	1	ramos	ramos	PROPN
afs-6014	247	2	,	,	PUNCT
afs-6014	247	3	a.m.	a.m.	ADV
afs-6014	247	4	,	,	PUNCT
afs-6014	247	5	crooijmans	crooijman	NOUN
afs-6014	247	6	,	,	PUNCT
afs-6014	247	7	r.p	r.p	PROPN
afs-6014	247	8	.	.	PROPN
afs-6014	247	9	,	,	PUNCT
afs-6014	247	10	affara	affara	PROPN
afs-6014	247	11	,	,	PUNCT
afs-6014	247	12	n.a	n.a	PROPN
afs-6014	247	13	.	.	PROPN
afs-6014	247	14	,	,	PUNCT
afs-6014	247	15	amaral	amaral	PROPN
afs-6014	247	16	,	,	PUNCT
afs-6014	247	17	a.j	a.j	PROPN
afs-6014	247	18	.	.	PROPN
afs-6014	247	19	,	,	PUNCT
afs-6014	247	20	archibald	archibald	PROPN
afs-6014	247	21	,	,	PUNCT
afs-6014	247	22	a.l	a.l	PROPN
afs-6014	247	23	.	.	PROPN
afs-6014	247	24	,	,	PUNCT
afs-6014	247	25	beever	beever	PROPN
afs-6014	247	26	,	,	PUNCT
afs-6014	247	27	j.e	j.e	PROPN
afs-6014	247	28	.	.	PROPN
afs-6014	247	29	,	,	PUNCT
afs-6014	247	30	bendixen	bendixen	PROPN
afs-6014	247	31	,	,	PUNCT
afs-6014	247	32	c.	c.	PROPN
afs-6014	247	33	,	,	PUNCT
afs-6014	247	34	churcher	churcher	PROPN
afs-6014	247	35	,	,	PUNCT
afs-6014	247	36	c.	c.	PROPN
afs-6014	247	37	,	,	PUNCT
afs-6014	247	38	clark	clark	PROPN
afs-6014	247	39	,	,	PUNCT
afs-6014	247	40	r.	r.	PROPN
afs-6014	247	41	,	,	PUNCT
afs-6014	247	42	dehais	dehais	PROPN
afs-6014	247	43	,	,	PUNCT
afs-6014	247	44	p.	p.	PROPN
afs-6014	247	45	,	,	PUNCT
afs-6014	247	46	hansen	hansen	PROPN
afs-6014	247	47	,	,	PUNCT
afs-6014	247	48	m.s	m.s	PROPN
afs-6014	247	49	.	.	PROPN
afs-6014	247	50	,	,	PUNCT
afs-6014	247	51	hedegaard	hedegaard	PROPN
afs-6014	247	52	,	,	PUNCT
afs-6014	247	53	j.	j.	PROPN
afs-6014	247	54	,	,	PUNCT
afs-6014	247	55	hu	hu	PROPN
afs-6014	247	56	,	,	PUNCT
afs-6014	247	57	z.l	z.l	PROPN
afs-6014	247	58	.	.	PROPN
afs-6014	247	59	,	,	PUNCT
afs-6014	247	60	kerstens	kerstens	PROPN
afs-6014	247	61	,	,	PUNCT
afs-6014	247	62	h.h	h.h	PROPN
afs-6014	247	63	.	.	PROPN
afs-6014	247	64	,	,	PUNCT
afs-6014	247	65	law	law	NOUN
afs-6014	247	66	,	,	PUNCT
afs-6014	247	67	a.s	a.s	PROPN
afs-6014	247	68	.	.	PROPN
afs-6014	247	69	,	,	PUNCT
afs-6014	247	70	megens	megen	NOUN
afs-6014	247	71	,	,	PUNCT
afs-6014	247	72	h.j	h.j	PROPN
afs-6014	247	73	.	.	PROPN
afs-6014	247	74	,	,	PUNCT
afs-6014	247	75	milan	milan	PROPN
afs-6014	247	76	,	,	PUNCT
afs-6014	247	77	d.	d.	PROPN
afs-6014	247	78	,	,	PUNCT
afs-6014	247	79	nonneman	nonneman	PROPN
afs-6014	247	80	,	,	PUNCT
afs-6014	247	81	d.j	d.j	PROPN
afs-6014	247	82	.	.	PROPN
afs-6014	247	83	,	,	PUNCT
afs-6014	247	84	rohrer	rohrer	PROPN
afs-6014	247	85	,	,	PUNCT
afs-6014	247	86	g.a	g.a	PROPN
afs-6014	247	87	.	.	PROPN
afs-6014	247	88	,	,	PUNCT
afs-6014	247	89	rothschild	rothschild	PROPN
afs-6014	247	90	,	,	PUNCT
afs-6014	247	91	m.f	m.f	PROPN
afs-6014	247	92	.	.	PROPN
afs-6014	247	93	,	,	PUNCT
afs-6014	247	94	smith	smith	PROPN
afs-6014	247	95	,	,	PUNCT
afs-6014	247	96	t.p	t.p	PROPN
afs-6014	247	97	.	.	PROPN
afs-6014	247	98	,	,	PUNCT
afs-6014	247	99	schnabel	schnabel	PROPN
afs-6014	247	100	,	,	PUNCT
afs-6014	247	101	r.d	r.d	PROPN
afs-6014	247	102	.	.	PROPN
afs-6014	247	103	,	,	PUNCT
afs-6014	247	104	van	van	PROPN
afs-6014	247	105	tassell	tassell	PROPN
afs-6014	247	106	,	,	PUNCT
afs-6014	247	107	c.p	c.p	PROPN
afs-6014	247	108	.	.	PROPN
afs-6014	247	109	,	,	PUNCT
afs-6014	247	110	taylor	taylor	PROPN
afs-6014	247	111	,	,	PUNCT
afs-6014	247	112	j.f	j.f	PROPN
afs-6014	247	113	.	.	PROPN
afs-6014	247	114	,	,	PUNCT
afs-6014	247	115	wiedmann	wiedmann	PROPN
afs-6014	247	116	,	,	PUNCT
afs-6014	247	117	r.t	r.t	PROPN
afs-6014	247	118	.	.	PROPN
afs-6014	247	119	,	,	PUNCT
afs-6014	247	120	schook	schook	NOUN
afs-6014	247	121	,	,	PUNCT
afs-6014	247	122	l.b	l.b	PROPN
afs-6014	247	123	.	.	PROPN
afs-6014	247	124	&	&	CCONJ
afs-6014	247	125	groenen	groenen	PROPN
afs-6014	247	126	,	,	PUNCT
afs-6014	247	127	m.a	m.a	PROPN
afs-6014	247	128	.	.	PROPN
afs-6014	247	129	2009	2009	NUM
afs-6014	247	130	.	.	PUNCT
afs-6014	248	1	design	design	NOUN
afs-6014	248	2	of	of	ADP
afs-6014	248	3	a	a	DET
afs-6014	248	4	high	high	ADJ
afs-6014	248	5	density	density	NOUN
afs-6014	248	6	snp	snp	ADJ
afs-6014	248	7	genotyping	genotype	VERB
afs-6014	248	8	assay	assay	ADV
afs-6014	248	9	in	in	ADP
afs-6014	248	10	the	the	DET
afs-6014	248	11	pig	pig	NOUN
afs-6014	248	12	using	use	VERB
afs-6014	248	13	snps	snps	PROPN
afs-6014	248	14	identified	identify	VERB
afs-6014	248	15	and	and	CCONJ
afs-6014	248	16	characterized	characterize	VERB
afs-6014	248	17	by	by	ADP
afs-6014	248	18	next	next	ADJ
afs-6014	248	19	generation	generation	NOUN
afs-6014	248	20	sequencing	sequence	VERB
afs-6014	248	21	technology	technology	NOUN
afs-6014	248	22	.	.	PUNCT
afs-6014	249	1	plos	plos	PROPN
afs-6014	249	2	one	one	NUM
afs-6014	249	3	4	4	NUM
afs-6014	249	4	:	:	PUNCT
afs-6014	249	5	e6524	e6524	PROPN
afs-6014	249	6	.	.	PROPN
afs-6014	249	7	sironen	sironen	PROPN
afs-6014	249	8	,	,	PUNCT
afs-6014	249	9	a.i	a.i	PROPN
afs-6014	249	10	.	.	PROPN
afs-6014	249	11	,	,	PUNCT
afs-6014	249	12	uimari	uimari	PROPN
afs-6014	249	13	,	,	PUNCT
afs-6014	249	14	p.	p.	NOUN
afs-6014	249	15	,	,	PUNCT
afs-6014	249	16	serenius	serenius	NOUN
afs-6014	249	17	,	,	PUNCT
afs-6014	249	18	t.	t.	PROPN
afs-6014	249	19	,	,	PUNCT
afs-6014	249	20	mote	mote	PROPN
afs-6014	249	21	,	,	PUNCT
afs-6014	249	22	b.	b.	PROPN
afs-6014	249	23	,	,	PUNCT
afs-6014	249	24	rothschild	rothschild	PROPN
afs-6014	249	25	,	,	PUNCT
afs-6014	249	26	m.	m.	NOUN
afs-6014	249	27	&	&	CCONJ
afs-6014	249	28	vilkki	vilkki	PROPN
afs-6014	249	29	,	,	PUNCT
afs-6014	249	30	j.	j.	PROPN
afs-6014	249	31	2010	2010	NUM
afs-6014	249	32	.	.	PUNCT
afs-6014	250	1	effect	effect	NOUN
afs-6014	250	2	of	of	ADP
afs-6014	250	3	polymorphisms	polymorphism	NOUN
afs-6014	250	4	in	in	ADP
afs-6014	250	5	candidate	candidate	NOUN
afs-6014	250	6	genes	gene	NOUN
afs-6014	250	7	on	on	ADP
afs-6014	250	8	reproduction	reproduction	NOUN
afs-6014	250	9	traits	trait	NOUN
afs-6014	250	10	in	in	ADP
afs-6014	250	11	finnish	finnish	ADJ
afs-6014	250	12	pig	pig	NOUN
afs-6014	250	13	populations	population	NOUN
afs-6014	250	14	.	.	PUNCT
afs-6014	251	1	journal	journal	NOUN
afs-6014	251	2	of	of	ADP
afs-6014	251	3	animal	animal	NOUN
afs-6014	251	4	science	science	NOUN
afs-6014	251	5	88	88	NUM
afs-6014	251	6	:	:	PUNCT
afs-6014	251	7	821–827	821–827	NUM
afs-6014	251	8	.	.	PUNCT
afs-6014	252	1	vonholdt	vonholdt	ADJ
afs-6014	252	2	,	,	PUNCT
afs-6014	252	3	b.m	b.m	PROPN
afs-6014	252	4	.	.	PROPN
afs-6014	252	5	,	,	PUNCT
afs-6014	252	6	pollinger	pollinger	PROPN
afs-6014	252	7	,	,	PUNCT
afs-6014	252	8	j.p	j.p	PROPN
afs-6014	252	9	.	.	PROPN
afs-6014	252	10	,	,	PUNCT
afs-6014	252	11	lohmueller	lohmueller	PROPN
afs-6014	252	12	,	,	PUNCT
afs-6014	252	13	k.e	k.e	PROPN
afs-6014	252	14	.	.	PROPN
afs-6014	252	15	,	,	PUNCT
afs-6014	252	16	han	han	PROPN
afs-6014	252	17	,	,	PUNCT
afs-6014	252	18	e.	e.	PROPN
afs-6014	252	19	,	,	PUNCT
afs-6014	252	20	parker	parker	PROPN
afs-6014	252	21	,	,	PUNCT
afs-6014	252	22	h.g	h.g	PROPN
afs-6014	252	23	.	.	PROPN
afs-6014	252	24	,	,	PUNCT
afs-6014	252	25	quignon	quignon	NOUN
afs-6014	252	26	,	,	PUNCT
afs-6014	252	27	p.	p.	NOUN
afs-6014	252	28	,	,	PUNCT
afs-6014	252	29	degenhardt	degenhardt	ADJ
afs-6014	252	30	,	,	PUNCT
afs-6014	252	31	j.d	j.d	PROPN
afs-6014	252	32	.	.	PROPN
afs-6014	252	33	,	,	PUNCT
afs-6014	252	34	boyko	boyko	NOUN
afs-6014	252	35	,	,	PUNCT
afs-6014	252	36	a.r	a.r	PROPN
afs-6014	252	37	.	.	PROPN
afs-6014	252	38	,	,	PUNCT
afs-6014	252	39	earl	earl	PROPN
afs-6014	252	40	,	,	PUNCT
afs-6014	252	41	d.a	d.a	PROPN
afs-6014	252	42	.	.	PROPN
afs-6014	252	43	,	,	PUNCT
afs-6014	252	44	auton	auton	PROPN
afs-6014	252	45	,	,	PUNCT
afs-6014	252	46	a.	a.	PROPN
afs-6014	252	47	,	,	PUNCT
afs-6014	252	48	reynolds	reynolds	PROPN
afs-6014	252	49	,	,	PUNCT
afs-6014	252	50	a.	a.	NOUN
afs-6014	252	51	,	,	PUNCT
afs-6014	252	52	bryc	bryc	PROPN
afs-6014	252	53	,	,	PUNCT
afs-6014	252	54	k.	k.	PROPN
afs-6014	252	55	,	,	PUNCT
afs-6014	252	56	brisbin	brisbin	PROPN
afs-6014	252	57	,	,	PUNCT
afs-6014	252	58	a.	a.	NOUN
afs-6014	252	59	,	,	PUNCT
afs-6014	252	60	knowles	knowles	PROPN
afs-6014	252	61	,	,	PUNCT
afs-6014	252	62	j.c	j.c	PROPN
afs-6014	252	63	.	.	PROPN
afs-6014	252	64	,	,	PUNCT
afs-6014	252	65	mosher	mosher	PROPN
afs-6014	252	66	,	,	PUNCT
afs-6014	252	67	d.s	d.s	PROPN
afs-6014	252	68	.	.	PROPN
afs-6014	252	69	,	,	PUNCT
afs-6014	252	70	spady	spady	PROPN
afs-6014	252	71	,	,	PUNCT
afs-6014	252	72	t.c	t.c	PROPN
afs-6014	252	73	.	.	PROPN
afs-6014	252	74	,	,	PUNCT
afs-6014	252	75	elkahloun	elkahloun	PROPN
afs-6014	252	76	,	,	PUNCT
afs-6014	252	77	a.	a.	NOUN
afs-6014	252	78	,	,	PUNCT
afs-6014	252	79	geffen	geffen	NOUN
afs-6014	252	80	,	,	PUNCT
afs-6014	252	81	e.	e.	PROPN
afs-6014	252	82	,	,	PUNCT
afs-6014	252	83	pilot	pilot	PROPN
afs-6014	252	84	,	,	PUNCT
afs-6014	252	85	m.	m.	NOUN
afs-6014	252	86	,	,	PUNCT
afs-6014	252	87	jedrzejewski	jedrzejewski	PROPN
afs-6014	252	88	,	,	PUNCT
afs-6014	252	89	w.	w.	PROPN
afs-6014	252	90	,	,	PUNCT
afs-6014	252	91	greco	greco	PROPN
afs-6014	252	92	,	,	PUNCT
afs-6014	252	93	c.	c.	PROPN
afs-6014	252	94	,	,	PUNCT
afs-6014	252	95	randi	randi	PROPN
afs-6014	252	96	,	,	PUNCT
afs-6014	252	97	e.	e.	PROPN
afs-6014	252	98	,	,	PUNCT
afs-6014	252	99	bannasch	bannasch	PROPN
afs-6014	252	100	,	,	PUNCT
afs-6014	252	101	d.	d.	PROPN
afs-6014	252	102	,	,	PUNCT
afs-6014	252	103	wilton	wilton	PROPN
afs-6014	252	104	,	,	PUNCT
afs-6014	252	105	a.	a.	PROPN
afs-6014	252	106	,	,	PUNCT
afs-6014	252	107	shearman	shearman	NOUN
afs-6014	252	108	,	,	PUNCT
afs-6014	252	109	j.	j.	PROPN
afs-6014	252	110	,	,	PUNCT
afs-6014	252	111	musiani	musiani	PROPN
afs-6014	252	112	,	,	PUNCT
afs-6014	252	113	m.	m.	NOUN
afs-6014	252	114	,	,	PUNCT
afs-6014	252	115	cargill	cargill	PROPN
afs-6014	252	116	,	,	PUNCT
afs-6014	252	117	m.	m.	NOUN
afs-6014	252	118	,	,	PUNCT
afs-6014	252	119	jones	jones	PROPN
afs-6014	252	120	,	,	PUNCT
afs-6014	252	121	p.g	p.g	PROPN
afs-6014	252	122	.	.	PROPN
afs-6014	252	123	,	,	PUNCT
afs-6014	252	124	qian	qian	PROPN
afs-6014	252	125	,	,	PUNCT
afs-6014	252	126	z.	z.	PROPN
afs-6014	252	127	,	,	PUNCT
afs-6014	252	128	huang	huang	PROPN
afs-6014	252	129	,	,	PUNCT
afs-6014	252	130	w.	w.	PROPN
afs-6014	252	131	,	,	PUNCT
afs-6014	252	132	ding	ding	NOUN
afs-6014	252	133	,	,	PUNCT
afs-6014	252	134	z.l	z.l	PROPN
afs-6014	252	135	.	.	PROPN
afs-6014	252	136	,	,	PUNCT
afs-6014	252	137	zhang	zhang	PROPN
afs-6014	252	138	,	,	PUNCT
afs-6014	252	139	y.p	y.p	PROPN
afs-6014	252	140	.	.	PROPN
afs-6014	252	141	,	,	PUNCT
afs-6014	252	142	bustamante	bustamante	PROPN
afs-6014	252	143	,	,	PUNCT
afs-6014	252	144	c.d	c.d	PROPN
afs-6014	252	145	.	.	PROPN
afs-6014	252	146	,	,	PUNCT
afs-6014	252	147	ostrander	ostrander	PROPN
afs-6014	252	148	,	,	PUNCT
afs-6014	252	149	e.a	e.a	PROPN
afs-6014	252	150	.	.	PROPN
afs-6014	252	151	,	,	PUNCT
afs-6014	252	152	novembre	novembre	PROPN
afs-6014	252	153	,	,	PUNCT
afs-6014	252	154	j.	j.	PROPN
afs-6014	252	155	&	&	CCONJ
afs-6014	252	156	wayne	wayne	PROPN
afs-6014	252	157	,	,	PUNCT
afs-6014	252	158	r.k	r.k	PROPN
afs-6014	252	159	.	.	PROPN
afs-6014	252	160	2010	2010	NUM
afs-6014	252	161	.	.	PUNCT
afs-6014	253	1	genomewide	genomewide	NOUN
afs-6014	253	2	snp	snp	ADJ
afs-6014	253	3	and	and	CCONJ
afs-6014	253	4	haplotype	haplotype	NOUN
afs-6014	253	5	analyses	analysis	NOUN
afs-6014	253	6	reveal	reveal	VERB
afs-6014	253	7	a	a	DET
afs-6014	253	8	rich	rich	ADJ
afs-6014	253	9	history	history	NOUN
afs-6014	253	10	underlying	underlie	VERB
afs-6014	253	11	dog	dog	NOUN
afs-6014	253	12	domestication	domestication	NOUN
afs-6014	253	13	.	.	PUNCT
afs-6014	254	1	nature	nature	NOUN
afs-6014	254	2	8	8	NUM
afs-6014	254	3	:	:	PUNCT
afs-6014	254	4	98–899–902	98–899–902	NUM
afs-6014	254	5	.	.	PUNCT
afs-6014	255	1	comparison	comparison	NOUN
afs-6014	255	2	of	of	ADP
afs-6014	255	3	different	different	ADJ
afs-6014	255	4	dna	dna	NOUN
afs-6014	255	5	extraction	extraction	NOUN
afs-6014	255	6	methods	method	NOUN
afs-6014	255	7	from	from	ADP
afs-6014	255	8	hair	hair	NOUN
afs-6014	255	9	root	root	NOUN
afs-6014	255	10	follicles	follicle	NOUN
afs-6014	255	11	to	to	PART
afs-6014	255	12	genotype	genotype	VERB
afs-6014	255	13	finnish	finnish	ADJ
afs-6014	255	14	landrace	landrace	NOUN
afs-6014	255	15	boars	boar	NOUN
afs-6014	255	16	with	with	ADP
afs-6014	255	17	the	the	DET
afs-6014	255	18	illumina	illumina	PROPN
afs-6014	255	19	porcinesnp60	porcinesnp60	PROPN
afs-6014	255	20	beadchip	beadchip	PROPN
afs-6014	255	21	introduction	introduction	NOUN
afs-6014	255	22	material	material	NOUN
afs-6014	255	23	and	and	CCONJ
afs-6014	255	24	methods	method	NOUN
afs-6014	255	25	dna	dna	PROPN
afs-6014	255	26	samples	sample	NOUN
afs-6014	255	27	genotyping	genotype	VERB
afs-6014	255	28	statistical	statistical	ADJ
afs-6014	255	29	analysis	analysis	NOUN
afs-6014	255	30	results	result	NOUN
afs-6014	255	31	and	and	CCONJ
afs-6014	255	32	discussion	discussion	NOUN
afs-6014	255	33	evaluation	evaluation	NOUN
afs-6014	255	34	of	of	ADP
afs-6014	255	35	dna	dna	PROPN
afs-6014	255	36	preparation	preparation	NOUN
afs-6014	255	37	methods	method	NOUN
afs-6014	255	38	comparison	comparison	NOUN
afs-6014	255	39	of	of	ADP
afs-6014	255	40	different	different	ADJ
afs-6014	255	41	concentration	concentration	NOUN
afs-6014	255	42	assays	assay	VERB
afs-6014	255	43	snp	snp	ADJ
afs-6014	255	44	quality	quality	NOUN
afs-6014	255	45	measures	measure	NOUN
afs-6014	255	46	of	of	ADP
afs-6014	255	47	the	the	DET
afs-6014	255	48	porcine	porcine	NOUN
afs-6014	255	49	-	-	ADJ
afs-6014	255	50	snp60	snp60	ADJ
afs-6014	255	51	genotyping	genotyping	NOUN
afs-6014	255	52	beadchip	beadchip	NOUN
afs-6014	255	53	quality	quality	NOUN
afs-6014	255	54	of	of	ADP
afs-6014	255	55	the	the	DET
afs-6014	255	56	porcinesnp60	porcinesnp60	NOUN
afs-6014	255	57	beadchip	beadchip	NOUN
afs-6014	255	58	genotyping	genotyping	NOUN
afs-6014	255	59	results	result	NOUN
afs-6014	255	60	with	with	ADP
afs-6014	255	61	hair	hair	NOUN
afs-6014	255	62	root	root	NOUN
afs-6014	255	63	samples	sample	NOUN
afs-6014	255	64	conclusion	conclusion	NOUN
afs-6014	255	65	references	reference	NOUN