AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 111 Genetic background of resistance to gall mite in Ribes species Ingrida Mazeikiene, Vidmantas Bendokas, Danas Baniulis, Grazina Staniene, Dovile Ana Juskyte, Audrius Sasnauskas, Vidmantas Stanys, Tadeusas Siksnianas Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry, Kauno 30, LT-54333 Babtai., Kaunas distr., Lithuania e-mail: i.mazeikiene@lsdi.lt Resistance to gall mite is an important genetic trait of Ribes. P and Ce genes, responsible for gall mite resistance, were established in Ribes species and interspecific hybrids using molecular markers. Resistance in R. americanum is determined by P gene and in R. sanguineum by Ce gene. Both molecular markers were absent in R. dikuscha ge- nome. Molecular markers related to P and Ce genes were identified in the genome of R. aureum. Resistance to gall mite in the field conditions in R. nigrum x R. americanum, R. nigrum x R. aureum and R. nigrum x R. sanguineum F3 hybrids fitted an expected Mendelian segregation ratio of 1:1, 3:1 and 1:1, respectively. 75.0% of hybrids with a pyramidal resistance to gall mite carrying markers related to Ce and P genes were obtained in the cross combina- tion R. nigrum x R. aureum and will be included in the future breeding programs. Key words: Cecidophyopsis ribis, Ce gene, P gene, resistance. Introduction Blackcurrant (Ribes nigrum L.) is one of the most important fruit crops in Europe, including Lithuania. Blackcurrant gall mite (Cecidophyopsis ribis Westw.) damages floral buds and is a vector of blackcurrant reversion virus (BRV) (Jones 2000). Gall mite infection causes heavy losses in blackcurrant production (Šutic et al. 1999). Several sources of resistance to gall mite have been identified in genus Ribes. The most studied gall mite resist- ance gene, designated Ce, has been identified in gooseberry (R. uva-crispa) (Knight et al. 1974, Keep et al. 1982, Brennan et al. 1993). The resistance determined by this gene is monogenic and ensures effective protection against gall mite and BRV. However, application of the gene in the development of black currants resistant to gall mite is limited. F1 hybrids of interspecific crosses of gooseberry and blackcurrant are weakly developed and have low agronomic value. Their further use in breeding programmes is limited due to low viability and sterility (Stanys et al. 1994). As a consequence, the Ce gene is not common in economically important blackcurrant cultivars. P is another gene responsible for blackcurrant resistance to gall mite. It was identified in R. nigrum ssp. sibiri- cum (Anderson 1971, Jones et al. 1998, Kniazev and Ogolcova 2004). This resistance gene was determined in the cultivar ‘Dainiai’ bred at the Institute of Horticulture, Lithuanian Research Centre for Agriculture and Forestry (Sasnauskas et al. 2009). Molecular markers for Ce gene, governing gall mite resistance, were developed using interspecific hybrids of gooseberry and blackcurrant by Brennan and colleagues (2009). We have identified a molecular marker related to P gene in blackcurrant hybrids derived from cultivars with R. nigrum ssp. sibiricum (Mazeikiene et al. 2012). Interspecific hybridisation resulting in black currant cultivars with natural resistance to gall mite could be one of the most effective tools to solve the problem of gall mite infection in black currant plantations. Species from ge- nus Ribes - R. americanum, R. nigrum spp. sibiricum, R. uva-crispa, R. aureum, R. sanguineum, have been used as donors of resistance to various R. nigrum diseases and pests (Stanys et al. 2004, Siksnianas et al. 2005, Rubauskis et al. 2006, Brennan et al. 2009). However, genetic background of resistance to gall mite in species R. america- num, R. aureum, R. dikusha and R. sanguineum still remains unknown. Therefore, the current study was focused on the application of molecular markers related to P and Ce genes to define the origin of resistance to gall mite in R. americanum, R. aureum, R. dikusha and R. sanguineum species and to assess inheritance of gall mite resistance in the genotypes obtained by interspecific hybridization. Manuscript received October 2016 AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 112 Materials and methods Plant material Plants of different Ribes species maintained at a collection of Institute of Horticulture, LRCAF (55°60ʹ N, 23°48ʹ E) - R. americanum, R. sanguineum, R. dikuscha, R. aureum ‘Corona’; R. nigrum ssp. sibiricum as P gene donor, R. uva-crispa ‘Bedford Yellow’ as Ce gene donor, interspecific F3 hybrids of R. nigrum x R. americanum, R. nigrum x R. aureum, R. nigrum x R. sanguineum; were used in the study. Fertility of interspecific F1 hybrids was weak, a small number of F2 hybrids were planted in the field. Fertile interspecific F3 hybrids, obtained after open pollination in the field conditions, with economically important traits were chosen for analysis of molecular markers of gall mite resistance. In 2014 and 2015, the extent of bush damage caused by C. ribis was evaluated on 5–6-year-old plants in points using 0 to 3 scale, with score 0 indicating only undamaged buds per bush, score 1 indicating one to three damaged buds, score 2 indicating four to ten damaged buds, score 3 indicating more than ten damaged buds. Genomic DNA was extracted from 0.2 mg of fresh leaf tissue using the CTAB-based extraction protocol by Doyle and Doyle (1990). Gene identification Ce gene Ce gene was identified using a molecular marker based on sequence of AFLP fragment (Brennan et al. 2009). Primer set 5’TTGAGACCTCCAAGTCCTGCT3’ and 5’CTTGGCTTCGTTGTTAGATGC3’ for PCR fragment in 180 bp length was used. PCR was performed in a 20 μl reaction volume containing 50 ng of total DNA, 1U Taq DNA polymerase (ThermoScientific Ltd.), 1 Taq DNA polymerase reaction buffer, 2.5 mM MgCl2, 0.2 mM dNTP mix, 0.5 μM each of forward and reverse primers. DNA amplification reactions were performed under the following conditions: initiali- zation step of 5 min at 94 oC, 30 cycles of 30 s at 94 oC, 30 s at 55 oC, 30 s at 72 oC and final elongation step of 10 min at 72 oC. The amplification products were separated on 1.5% agarose gel and stained with ethidium bromide. GeneRulerTM DNA Ladder Mix (Thermo Scientific Ltd.) was used as size standard. Fragments in the length of 180 bp of Ce gene were sequenced. These 180 bp fragments were extracted from agarose gel using a NucleoSpin Extract II kit (Macherey–Nagel Ltd.), according to the manufacturer’s protocol and sequenced at the DNA Sequenc- ing Centre (Institute of Biotechnology, Vilnius University). Genamics Expression software was used for multiple sequence alignment (Corpet 1988, Thompson et al. 1994). P gene AFLP analysis was performed according to Vos et al. (1995) method. AFLP Plant Fingerprinting Kit (Applied Bio- systems Ltd.) was used for sample preparation; all procedures were performed according to the manufacturer’s protocol. Two hundred ng of genomic DNA was digested with restriction endonucleases EcoRI and Tru1I (MseI) (Thermo Scientific Ltd.) and corresponding adaptors were ligated. Preamplification was carried out with standard primers EcoRI A and MseI C (205 nM each) in a 20 μl reaction volume containing 4 μl of diluted restriction-ligation mix and 15 μl of AFLP Amplification Core Mix (Applied Biosystems Ltd.). Preamplification conditions were as fol- lows: 94 °C hold for 2 min followed by 20 cycles of 20 s at 94 °C, 30 s at 56 °C and 120 s at 72 °C, followed by final steps of 2 min at 72 °C and 30 min at 60 °C. PCR Selective PCR amplification was carried out under the same reaction conditions. The difference was that 2 μl of diluted pre-amplification template was added and EcoRI and MseI primers were used at 50 nM and 250 nM con- centration, respectively. Selective amplification was performed using the following programme: an initial cycle of 30 s at 94 °C, 30 s at 65 °C and 80 s at 72 °C, followed by 10 cycles of 30 s at 94 °C 30 s at 65 to 56 °C, 1 °C per cycle, 80 s at 72 °C; followed by 23 cycles of 30 s at 94 °C, 30 s at 55 °C and 80 s at 72 °C, final step of 5 min at 72 °C. Samples were prepared for capillary electrophoresis by mixing 1 μl of the PCR product with 8.88 μl of Hi-Di formamide and 0.12μl of Gene Scan 500 LIZ ladder (Applied Biosystems, Ltd.), and analysed using a 3130 Genetic Analyzer (Applied Biosystems Ltd.). Heterogeneity between recombination frequencies (AFLP marker and resist- ance to gall mite in the field condition) in the four populations was examined using the chi-squared test in Join- Map 4 (Van Ooijen 2011). AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 113 Results We analysed the presence of Ce gene in plants of 5 Ribes species (Fig. 1 A), using a molecular marker developed by Brennan et al. (2009). The analysis established that PCR product of expected size was identified in gooseberry ‘Bedford Yellow’ characteristic of the marker of gene Ce. R. aureum ‘Corona’ and R. sanguineum plants had mark- er of the gene Ce that was at the identical position as in the case of R. uva-crispa plants (Fig. 1 A, lane 2, 5 and 6). Ce marker was absent in genomes of R. americanum and R. dikuscha and in R. nigrum ssp. sibiricum (Fig.1 A, lane 1, 3 and 4). Identification of molecular marker related to the Ce gene in wild type R. sanguineum and R. aureum enabled us to assume the presence of similar genomic region including resistance gene homologous to Ce gene of R. uva-crispa. Homology of molecular marker sequence was verified by sequencing the specific 180 bp size fragments, similar to molecular marker for Ce gene in R. sanguineum, R. aureum and R. uva-crispa ‘Bedford Yel- low’ (Fig. 1 B). Nucleotide sequences of R. uva-crispa ‘Bedford Yellow’ from our collection were 100% identical, indicating the inheritance of the marker specific to gooseberry Ce gene by the interspecific F1 hybrid. In addition, strong nucleotide sequence homology 90.0% and 88.3% was found between the sequences of the Ce molecular marker of gooseberry and R. sanguineum or gooseberry and R. aureum, respectively (Fig. 1 B). Therefore, it is pos- sible that resistance to gall mite in R. aureum and R. sanguineum is determined by the Ce gene like in gooseberry. Electropherograms of the AFLP fragments with the marker related to P gene are shown in Fig. 2. This marker was developed at our laboratory (Mazeikiene et al. 2012). The fragment 107 bp in length demonstrates that the marker was present in R. nigrum spp. sibiricum, R. americanum and R. aureum ‘Corona’. The molecular marker for gene P was not identified in species of R. sanguineum, R. dikuscha and R. uva-crispa ‘Bedford Yellow’ (Fig. 2). Fig. 1. Molecular marker for gene Ce in different Ribes species. A. Amplified PCR fragment in 180 bp length; B. Ce molecular marker sequences in Ribes species, compared to Brennan et al. 2009. PC = positive gene control (PCR with DNA of plasmids with insert of Ce marker sequence), NC = negative control (PCR mix without DNA template), M = size standard 100–500 bp (O’GeneRuler SM1173, Thermo Scientific Ltd.), 1 = R. americanum, 2 = R. aureum, 3 = R. dikuscha 4 = R. nigrum ssp. sibiricum, 5 = R. sanguineum, 6 = R. uva- crispa ‘Bedford Yellow’ AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 114 Interspecific F3 hybrids were obtained after open pollination of F1 and F2 hybrids in the field conditions. Field re- sistance to gall mite of interspecific F3 hybrids from families R. nigrum x R. sanguineum, R. nigrum x R. aureum and R. nigrum x R. americanum was evaluated. Hybrids with score 0 were considered as resistant, and those with scores 1, 2 or 3 were considered as susceptible. Hybrids resistant to gall mite segregated at 1:1 ratio in F3 genera- tion of R. nigrum x R. americanum and R. nigrum x R. sanguineum. Interspecific F3 hybrids obtained from the cross R. nigrum x R. aureum segregated at 3:1 ratio (Table 1). Table 1. Resistance of interspecific F3 hybrids of Ribes genus to gall mite in the field conditions Cross combination* Number of hybrids Resistance to gall mite in field condition Resistant, no. Susceptible, no. χ2 (expected segregation ratio) p R. nigrum x R. sanguineum 45 26 19 1.09 (1:1) >0.25 R. nigrum x R. aureum 40 27 13 1.20 (3:1) >0.25 R. nigrum x R. americanum 33 15 18 0.27 (1:1) >0.50 The results of genetic analysis of gall mite resistance in R. nigrum x R. americanum, R. nigrum x R. aureum and R. nigrum x R. sanguineum interspecific hybrids based on the presence of the 107 bp AFLP and of the 180 bp PCR molecular markers are shown in the Fig. 3. Fig. 2. Electropherogram of 107 bp AFLP marker related to dominant P gene in different Ribes species. * = location of molecular marker, related to P gene * F3 progenies obtained after open pollination AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 115 Molecular marker of P gene was found in the genome of interspecific F3 hybrids obtained after open pollination of R. nigrum x R. americanum and R. nigrum x R. aureum. The presence of the molecular marker of Ce gene in R. nigrum x R. sanguineum and R. nigrum x R. aureum F3 hybrids was confirmed in the field conditions. Resistance to gall mite was determined by Ce gene in 48.9% hybrids in R. nigrum x R. sanguineum family. The molecular marker of P gene was present in 40.5% genotypes of R. nigrum x R. americanum. Molecular markers of P and Ce genes were present in R. nigrum x R. aureum hybrids (77.5 and 85.0%, respectively). 75.0% promising hybrids with a pyramidal resistance to gall mite obtained in cross combination R. nigrum x R. aureum are a valuable source of resistance for future breeding. Discussion Two genes responsible for resistance to C. ribis have been known to date: P gene has been identified in R. nigrum spp. sibiricum (Anderson 1971) and Ce gene is characteristic of R. uva-crispa (Knight et al. 1974). Resistance of R. sanguineum to gall mite and mildew has been reported by Keep (1986). This species was used as a donor of resistance in heredity research (Keep 1981, Goodman et al. 1987, Siksnianas et al. 2008). However, genetic background of the resistance of R. sanguineum has not been assessed previously. Identification of mo- lecular marker for the Ce gene in wild type R. sanguineum and R. aureum in our analysis enabled us to assume the presence of similar genomic region including resistance gene homologous to Ce gene of R. uva-crispa. It was shown earlier, that R. dikuscha is immune to reversion virus (Adams and Tresh 1987); however, we did not es- tablish Ce marker in its genome. P resistance is specific to R. nigrum ssp. sibiricum and R. nigrum cultivars ‘Rus’, ‘Dainiai’, ‘Ben Lomond’ and ‘Titania’ (Anderson 1971, Mazeikiene et al. 2012), therefore marker for Ce gene was not established in these plants. In gooseberry, the resistance to gall mite is controlled by a single Ce gene (Knight et al. 1974). Interspecific R. nigrum x R. uva-crispa hybrids inherit Ce gene at a 1:1 ratio in F1. The main problem is that hybrids are mostly infertile and the majority of the R. uva-crispa, R. sanguineum or R. aureum genome is lost during the earliest stages of backcrossing (Keep 1986, Siksnianas et al. 2008). F1 hybrids of interspecific crosses of gooseberry and blackcurrant are weakly developed and have low agronomic value. Their further use in breeding programmes is limited due to infertility and low viability (Stanys et al. 1994). Interspecific hybrids can improve fertility after open pollination in the field conditions in F2 generation, and economically important traits improve in F3. As a result, we used promising F3 hybrids in our study. Early diagnostics of valuable traits in F1 progeny is crucial in the breeding process. In this study, the presence of the molecular marker for dominant P gene was assessed in Ribes species and F3 in- terspecific hybrids. Previously, traits of resistance to gall mite were identified in R. nigrum spp. sibiricum (Ander- son 1971, Jones et al. 1998), R. americanum and R. aureum (Barney and Hummer 2005, Rubauskis et al. 2006); however, genetic background of the resistance was unknown. Our results suggest that resistance to gall mite in R. nigrum spp. sibiricum, R. americanum and R. aureum is determined by the dominant P gene. Molecular markers Fig. 3. Molecular markers related to resistance to gall mite in interspecific F3 Ribes hybrids AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 116 linked to both P and Ce genes are found in the genome of R. aureum. The molecular marker for P gene was not ob- served in R. dikuscha, R. sanguineum and R. uva-crispa. Plants of R. dikuscha are resistant to gall mite in the field conditions (Trajkovski and Pääsuke 1976); however, in our study molecular markers for Ce and P genes were absent. It was established that P gene, derived from R. nigrum spp. sibiricum, responsible for blackcurrant resistance to gall mite was dominant (Anderson 1971) and 1:1 segregation ratio of resistance to gall mite in hybrids was observed (Mazeikiene et al. 2012). In our study, inheritance of gall mite resistance trait derived from R. americanum fitted the expected 1:1 ratio in F3 hybrids R. nigrum x R. americanum, as well. Therefore, we may conclude that P gene is in homozygous state in R. americanum. R. americanum is resistant to diseases and it flowers later compared to other Ribes species. In temperate climate zone, late flowering reduces the risk of currant flower damage during spring frosts. It was shown that early flowering and adaptivity in Ribes species are determined by cytoplasm, and therefore interspecific R. nigrum x R. americanum F1 hybrids and their progeny were open pollinated in the field conditions with pollen from R. nigrum cultivars with low frequency of P gene (Keep 1986, Siksnianas et al. 2005). Inheritance of resistance to gall mite remained at 1:1 ratio in F3 generation derived from this cross combination. Similar data were observed while studying inheritance of Ce gene. Inheritance of resistance to gall mite derived from R. sanguineum fitted the expected 1:1 ratio in R. nigrum x R. sanguineum F3 hybrids. Blackcurrant hybrids with R. nigrum cytoplasm flowered earlier, and their progeny was open pollinated by R. nigrum hybrids or species. In our research, R. aureum species is characterized by the pyramidal (P and Ce genes) resistance to gall mite. In R. nigrum x R. aureum cross combination, gall mite resistance genes P and Ce remained in heterozygous state in F3 progeny. Gall mite resistance ratio remained at 3:1 in R. nigrum x R. aureum F3 hybrids, such ratio is favourable for the creation of resistant cultivars with other economically important traits. Gall mite resistance remains a high priority for most currant breeding programmes. Distant hybridisation between different species provides qualitatively new material for currant breeding. R. uva-crispa, R. sanguineum and R. aureum as donors of Ce gene and R. sibiricum, R. americanum and R. aureum as donors of P gene may be effec- tively used as source material for gall mite resistance in the future breeding programmes. Early diagnosis of these genes allows selecting promising hybrids, and enables creating novel varieties with complex resistance to gall mite. Our results suggest that resistance to gall mite in R. sanguineum is determined by Ce gene. Resistance to gall mite in R. americanum is determined by the dominant P gene as in R. nigrum spp. sibiricum. Resistance to gall mite in R. aureum is controlled by two genes Ce and P. The presence of molecular markers and resistance to gall mite in R. nigrum x R. americanum and R. nigrum x R. sanguineum F3 hybrids, obtained after open pollination in the field conditions of F1 and F2 hybrids, fitted the expected segregation ratio 1:1. R. americanum x R. aureum F3 hy- brids, obtained after open pollination in the field conditions of F1 and F2 hybrids, fitted 3:1 ratio. Pyramiding of the Ce and P genes in breeding programs will produce hybrids with natural resistance to gall mite, thus resulting in unique breeding material. References Adams, N.A. & Tresh, J.M. 1987. Virus and viruslike diseases of Ribes (gooseberry and black and red currant). In: Converse R.H. (ed.). Virus disease of small fruits and grapevines. Berkeley: University of California. p. 127–162. Anderson, M.M. 1971. Resistance to gall mite (Phytoptus ribis Nal.) in the Eucoreosma section of Ribes. Euphytica 20: 422–426. https://doi.org/10.1007/BF00035668 Barney, D.L. & Hummer, K.E. 2005. Currant, goosberries and jostaberries – a guide for growers, marceters and researchers in North America. NY Binghamptom: Haworth Press. 266 p. Brennan, R., Jorgensen, L., Gordon, S., Loades, K., Hackett, C. & Russell, J. 2009. The development of a PCR-based marker linked to resistance to the blackcurrant gall mite (Cecidophyopsis ribis Acari: Eriophyidae). Theoretical and Applied Genetics 118: 205– 211. https://doi.org/10.1007/s00122-008-0889-x Brennan, R.M., Lanham, P.G. & McNicol, R.J. 1993. Ribes breeding and research in the UK. Acta Horticulturae 352: 267–275. https://doi.org/10.17660/ActaHortic.1993.352.38 Corpet, F. 1998. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16: 10881-10890. https://doi.org/10.1093/nar/16.22.10881 Doyle, J.J. & Doyle, J.L. 1990. A rapid total DNA preparation procedure for fresh plant tissue. Focus 12: 13–15. Goodman, F.L., Hauptli, H., Crossway, E., & Knauf, V.C. 1987. Gene transfer in crop improvement. Science 236: 48–54. https://doi.org/10.1126/science.236.4797.48 Jones, A.T., Brennan, R.M., McGavin, W.J. & Lemmetty, A. 1998. Galling and reversion disease incidence in a range of blackcurrant genotypes, differing in resistance to the blackcurrant gall mite (Cecidophyopsis ribis) and blackcurrant reversion disease. Annals of Applied Biology 133: 375–384. https://doi.org/10.1111/j.1744-7348.1998.tb05837.x AGRICULTURAL AND FOOD SCIENCE I. Mazeikiene et al. (2017) 26: 111–117 117 Jones, A.T. 2000. Black currant reversion disease — the probable causal agent, eriophyid mite vectors, epidemiology and pros- pects for control. Virus Research 71: 71–84. https://doi.org/10.1016/S0168-1702(00)00189-1 Keep, E. 1981. Ribes glutinosum and Ribes sanguineum as donors of resistance to American gooseberry mildew in black currants breeding. Euphytica 30: 197–202. https://doi.org/10.1007/BF00033678 Keep, E. 1986. Cytoplasmic male sterility, resistance to gall mite and mildew, and season of leafing out in black currants. Euphytica 35: 843–855. https://doi.org/10.1007/BF00028592 Keep, E., Knight, V.H. & Parker, J.H. 1982. Progress in the integration of characters in gall mite resistant black currants. Journal of Horticultural Science 57: 189–196. http://dx.doi.org/10.1080/00221589.1982.11515039 Kniazev, S.D. & Ogolcova, T.P. 2004. Inheritance of resistance to gall mite evaluation of different cross combination. In: Kniazev S.D. & Ogolcova, T.P. (eds.). Black currant breeding at present. Orel: OrelGAU. 238 p. (in Russian). Knight, R.L., Keep, E., Briggs, J.B. & Parker, J. 1974. Transference of resistance to black currant gall mite Cecidophyopsis ribis, from goosebery to black currant. Annals of Applied Biology 76: 123–130. https://doi.org/10.1111/j.1744-7348.1974.tb01362.x Mazeikiene, I., Bendokas, V., Stanys, V. & Siksnianas, T. 2012. Molecular markers linked to resistance to the gall mite in blackcur- rant. Plant Breeding 131: 762–766. http://dx.doi.org/10.1111/j.1439-0523.2012.01995.x Rubauskis, E., Strautina, S. & Surikova, V. 2006. Importance of cultivar choise in preventing infestacion by the black currant gall mite (Cecidophyopsis ribis WESTW.) on black currant plantations. Journal of Fruit and Ornamental Plant Research 14: 209–215. Sasnauskas, A., Trajkovski, V., Strautina, S., Tikhonova, O., Šikšnianas, T., Rubinskiene, M., Viškelis, P., Lanauskas, J., Valiuškaitė, A., Rugienius, R. & Bobinas, Č. 2009. Evaluation of blackcurrant cultivars and perspective hybrids in Lithuania. Agronomy Research 7: 737–743. Siksnianas, T., Stanys, V., Staniene, G., Sasnauskas, A. & Rugienius, R. 2005. American black currant as donor of leaf disease resis- tance in black currant breeding. Biologija 3: 65–68. Siksnianas, T., Staniene, G., Stanys, V. & Sasnauskas, A. 2008. Ribes sanguineum Pursh. as donor of leaf fungal disease resistance in blackcurrant breeding. Biologija 54: 79–82. https://doi.org/10.2478/v10054-008-0015-7 Stanys, V., Shikshnianas, T. & Staniene, G. 1994. Embryo development and embryo rescue within the genus Ribes. Norwegian Journal of Agricultural Sciences 9: 95–104. Stanys, V., Staniene, G., Shikshnianas, T. & Bobinas, C. 2004. Interspecific Hybridisation in Ribes Genus. Proceedings of the XIth Eucarpia Symposium on Fruit Breeding and Genetics. Acta Horticulturae 663: 861–864. https://doi.org/10.17660/ActaHortic.2004.663.155 Šutic, D.D., Ford, R.E. & Tošic, M.T. 1999. Virus Diseases of Ribes spp. In: Šutic, D.D., Ford, R.E. & Tošic, M.T. (eds.). Handbook of plant virus diseases. CRC Press, Boca Raton, FL. p. 457–475. Thompson, J.D., Higgins, D.G. & Gibson, T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence align- ment through sequence weighting, positions-specific gap penalties and weight matrix choices. Nucleic Acids Research 22: 4673– 4680. https://doi.org/10.1093/nar/22.22.4673 Trajkovski, V. & Pääsuke, R. 1976. Resistance to Sphaerotheca mors-uvae (Schw.) Berk. in Ribes nigrum L. 5. studies on breed- ing black currants for resistance to Sphaerotheca mors uvae (Schw.) Berk. Swedish Journal of Agricultural Research 6: 201–214. Van Ooijen, J.W. 2011. Multipoint maximum likelihood mapping in a full-sib family of an out breeding species. Genetical Research 93: 343–349. http://dx.doi.org/10.1017/S0016672311000279 Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. & Zabeaum, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23: 4407–4414. https://doi.org/10.1093/nar/23.21.4407 Genetic background of resistance to gall mite in Ribes species Introduction Materials and methods Plant material Gene identification Ce gene P gene PCR Results Discussion References