




































 Agricultural Science; Vol. 1, No. 1; 2019 
ISSN 2690-5396   E-ISSN 2690-4799 

https://doi.org/10.30560/as.v1n1p1 

 1 Published by IDEAS SPREAD 
 

Gamma Radiated Wheat for Combating Devastating Blast Disease 
(Magnaporthe Oryzae Triticum) In Bangladesh 

Md. Harun-Or-Rashid1, M. Bahadur Meah1, Md. Imtiaz Uddin2, Sharif Ahmed3 & Md. Abul Kashem2 

1 Bangladesh Agricultural University, Mymensingh, Bangladesh 
2 Bangladesh Institute of Nuclear Agriculture, Mymensingh, Bangladesh 
3 International Rice Research Institute, Bangladesh office, Bangladesh 
Correspondence: Md. Harun-Or-Rashid, Department of Plant Pathology, Bangladesh Agricultural University, 
Mymensingh-2202, Bangladesh Tel: 880-177-435-5442. E-mail: harun.hmml@gmail.com 
 
Received: October 24, 2019   Accepted: November 25, 2019   Online Published: December 3, 2019 
 
Abstract 
Wheat is a global food security crop, providing 20 percent of protein and calories consumed worldwide and up to 
50 percent in developing countries. It is the second most important cereal next to rice in Bangladesh and playing 
an important role in attaining food security. But wheat is very susceptible to diseases that often place major 
biological constraints on production. In 2016, a new wheat disease called “blast” was identified by wheat scientists 
for the first time in Bangladesh. Wheat blast disease caused by Magnaporthe oryzae triticum is causing enormous 
yield loss worldwide. At present, control of blast disease is a great challenge due to frequently introduction of new 
races of the pathogen. The present investigation focused on screening M2 population of gamma radiated wheat 
where four doses of radiations viz. 150 Gy, 200 Gy, 250 Gy, and 300 Gy were applied to the seeds of three wheat 
varieties viz. BARI Gom-25, BARI Gom-29 and BARI Gom-30 from a Cobalt 60 source (Gamma Chamber 5000). 
The irradiated seeds were sown in farmers’ fields of a wheat blast disease-prone area Chandbil, Meherpur Sadar. 
All the doses of irradiation showed a significant effect on incidence and severity of wheat blast disease in all three 
varieties. Among the treatments 200 Gy and 250 Gy reduced the disease effectively. Molecular detection of 
Magnaporthe oryzae triticum was also done using specific primer. The size of the band (350 bp) confirms the 
infection of M2 families by Magnaporthe oryzae triticum. Development of wheat blast resistant variety through 
irradiation could be a potential substitute to replace the available chemical control methods and it is described as 
eco-friendly, sustainable and nonhazardous strategy to reduce wheat yield loss due to blast disease. 
Keywords: gamma radiation, wheat blast, resistant cultivar, disease incidence, disease severity  
1. Introduction 
Wheat (Triticum aestivum L.), belongs to the family Poaceae, is one of the most important cereals in the world. 
Wheat forms the base of global food security, providing 20% of protein and calories of the majority of the 
population in developing countries (Singh et al., 2016). Almost 50% of the total world production of grain crops 
is occupied by wheat (Banglapedia, 2014). Wheat is cultivated in the world over a large area and under varied 
climatic conditions ranging from sub-tropical to temperate (Singh et al., 2016). Wheat is the second most important 
cereal next to rice in Bangladesh and playing an important role in attaining food security. 
Wheat in Bangladesh usually faces some abiotic (heat, salinity, drought, etc.) and biotic (disease, insect, weeds, 
etc.) stresses (Ahmed et al., 2019). Among the diseases, leaf rust, leaf blight, head blight, etc. are usually prevalent 
in this environment. However, in 2016, a new devastating wheat disease named wheat blast caused by 
Magnaporthe oryzae triticum was identified by wheat scientists for the first time in Bangladesh (FAO Report, 
2016). Wheat blast suddenly appeared in Bangladesh in Kustia, Meherpur, Chuadanga, Jhenaidah, Jashore, 
Barishal, Bhola and some other districts in the South. The affected areas were approximate ~20% of Bangladesh’s 
total wheat producing area in 2015-16, presenting a significant threat to the country’s aggregate wheat production 
(Meah et al., 2016).  
The wheat blast was first reported in 1985 in Paraná, Brazil (Igarashi et al., 1986) and has since spread throughout 
many wheat-producing areas of Brazil and to the neighboring countries such as Bolivia and Paraguay (Goulart et 
al., 2007; Kohli et al., 2011).  



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 2 Published by IDEAS SPREAD 
 

The pathogen of wheat blast disease has the potential to infect all the above-ground parts of wheat plant (Igarashi, 
1991). The most significant symptom of wheat blast in the field is the premature bleaching of spikelets (Igarashi, 
1991; Urashima, 2010). In severe cases, the entire head is damaged. If head infection occurs early grain production 
can be critically lost. Blackening of the rachis, lower nodes, shriveling of grains, low test weight has also been 
observed (Malaker et al., 2016). 
Blast fungus is disseminated by air and seeds (Monsur et al., 2016). Seed transmission is considered to be a feature 
that is significant for its dispersal by humans (Kato, 1994). Besides, there are several strains of M. oryzae which 
tend to display a degree of host specificity and they have been divided into pathotypes based on their host 
preference (Cruz et al., 2016). Based on the molecular characteristics, the pathogen strain of wheat blast found in 
Bangladesh was similar to the strain of Brazil (Malaker et al., 2016). 
The South American countries Brazil and Bolivia tried to develop resistant variety through conventional breeding. 
But the result is not mentionable. The alternative method of developing resistant variety is irradiation (Özge Çelik 
and Çimen Atak., 2017). Radiation usually causes large chromosomal aberration and chemical mutagens cause 
point mutations (Raina et al., 2016; Raina et al., 2017 and Khursheed et al., 2017). Mutation breeding is hugely 
successful. The wide use of mutation induction for crop improvement is documented in the IAEA (2017) mutant 
variety database. Over 3275 mutant varieties in more than 220 plant species have been officially released 
worldwide to date (FAO/IAEA, 2018). 
The main mutagenic crops improved for disease resistance are rice, barley, maize, wheat, bean, green pea. Recently 
in 2017, Niab Kinnow mutant variety of Citrus reticulata has been developed from bud woods of local Kinnow 
irradiated at 20 Gy of gamma rays (IAEA Mutant variety database, 2017). This variety has shown moderate to 
high resistance to Citrus canker, scab, and wither-tip diseases as well as a low incidence to major insect pests 
(IAEA Mutant variety database, 2017). 
Bangladesh Institute of Nuclear Agriculture (BINA) developed some resistant varieties of rice and other cereals 
(BINA, 2018). The rice varieties developed by BINA using irradiation are Binadhan-4, Binadhan-5, Binadhan-6, 
Binadhan-7, Binadhan-9, Binadhan-13, Binadhan-14, Binadhan-18 and Binadhan-19 ( BINA, 2018 and IAEA 
mutant variety database 2017). Binadhan-19 was developed from NERICA-10 through irradiation at 40 Gy of 
gamma rays (BINA, 2018). 
It is reported that Bangladeshi wheat blast pathogen Magnaporthe oryzae triticum strains are more aggressive than 
those reported earlier (CIMMYT, 2017). The conventional methods of gene isolation and transfer have been tried 
for this strain. The approach irradiation of seeds to bring a small change in the genetic makeup has not been tried. 
In the proposed research program, the possibility of creating a mutant resistant to Magnaporthe oryzae triticum 
was found through seed radiation. 
Radiation in wheat seeds has never before been given to obtain a mutant resistant against wheat blast pathogen 
Magnaporthe oryzae triticum. This could be an alternative approach to develop wheat variety resistant to 
Magnaporthe oryzae triticum. 
2. Materials and Methods 
Field experiments were carried out in Bangladesh Institute of Nuclear Agriculture (BINA) farm, Mymensingh and 
farmers’ fields of Chandbil village at Meherpur Sadar during the 2017-2018 season. Laboratory works were 
accomplished in the Integrated Pest Management (IPM) Lab of Bangladesh Agricultural University (BAU) and 
Biotechnology Lab of Bangladesh Institute of Nuclear Agriculture (BINA). The field experiment was laid out in 
a completely randomized design with four doses of gamma ray application, i.e., 150, 200, 250 and 300 Gy on three 
latest developed wheat varieties such as BARI Gom-25, BARI Gom-29 and BARI Gom-30 with replicated thrice. 
The soil of the experimental plot was sandy loam with moderate fertility. Seeds of wheat varieties were irradiated 
using a cobalt source ray @ 150 Gy, 200 Gy, 250 Gy, and 300 Gy. Irradiated seeds were sown in line of 2.5 m 
long with a seed rate of 120 kg ha-1. The non-irradiated seeds of each variety were sown as control.  
The land was prepared following standard procedure of wheat cultivation. Fertilizers and manures were applied as 
per recommendation of BARI (Anonymous, 2012). After sowing the seeds in the plot, the upper portion of the plot 
soil was leveled manually. Continuous supervisions were done to protect the experimental plot from external 
hazards such as birds, fox, animals, etc. M1 (1st year population of irradiated seeds) plants were grown in the field 
of BINA and M2 (2nd year population of irradiated seeds) plants were grown at Chandbil, Meherpur. Both fields 
were irrigated two times and manual hand weeding once for weed control. No pesticides were applied. In both 
fields none of the M1 or M2 plants were inoculated. The plants were kept under continuous observation for the 
expression of wheat blast symptoms. Data on the parameters were recorded: days to symptom expression, disease 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 3 Published by IDEAS SPREAD 
 

incidence, and disease severity. The infected plant samples (spikes) were collected for the determination of 
Magnaporthe oryzae triticum through clinical and molecular assay using specific primer. 
2.1 Sample Collection 
Samples of spikes were collected from both M1 and M2 plants. Blast infected spikes were collected in brown 
paper bags, dried in room temperature and afterward the samples were stored at 4 °C. Spikes from plants were 
used for DNA extraction. Initially, spikes were cut apart with sterilized scissors and washed in distilled water and 
ethanol (70%) and dried on fresh tissue paper to remove spore of microorganisms and any other source of foreign 
DNA. The collected spike samples were then kept in polythene bags and for avoiding any damage of the tissues, 
the bags were placed in an icebox and brought out to the laboratory where the samples were stored in -80 °C 
freezer. 
2.2 Sample Analysis 
The collected samples were analyzed for the presence of MoT following both conventional pathological techniques 
and molecular techniques.  
In conventional techniques, moist chamber and agar plate methods were employed. 
a) Inocula Preparation 
Collected samples of wheat spikes were cut into small parts of 2-3 cm long. For the moist chamber, inocula were 
directly placed on moist blotter. For PDA plates, inocula were surface sterilized with 10% Clorox for 1 min, 
rewashed the inocula three times in sterile water. 
b) Moist Chamber Incubation 
Moist chambers were prepared in plastic Petri dishes (9 cm). 1-2 filter papers/blotter soaked in sterile water were 
placed in the Petri dishes. 3-4 inocula were placed on the moist blotter in equal distance and incubated at room 
temperature (25±1 °C). Observations were made for the growth of MoT out of the inocula. 
c) Preparation of Water Agar Medium 
In the experimental studies, the standard water agar medium was used. Tape water was boiled for 15-20 minutes. 
Then agar (20 g) was dissolved in the water and the volume was made up to 1000 ml by adding distilled water and 
2 ml lactic acid was added to it to avoid bacterial contamination. A known quantity of medium was poured into 
number of conical flasks. The flasks were plugged with nonabsorbent cotton and finally wrapped with brown paper. 
The flasks containing dispensed medium was sterilized at 121 °C with 15 PSI pressure for about 30 minutes 
(Samson et al., 2015). 
d) Preparation of Oat Meal Agar (OMA) Medium 
Fifty grams oat were boiled in 600 ml distilled water for 1 hour and the extract was collected by filtering through 
a muslin cloth. Agar (15 g) was dissolved in the oat extract in a conical flask and the volume was made up to 1000 
ml by adding distilled water. The flask containing the medium was sterilized at 121 °C with 15 PSI pressure for 
about 30 minutes (Siddique, 2014). Then 4-5 tea spoon of Streptophen was added in the flask. Finally, the prepared 
medium was stored in refrigerator with proper labeling. Later the medium was melted and poured in sterile glass 
petri-dishes. 
e) Purification and Multiplication of the Pathogens 
Mycelia of the fungi were transferred from spikelet surface and infected parts of the sample to OMA medium with 
the help of sterile pointed needle. Then, tip of the fungal colony was transferred to PDA plates and incubated at 
25 °C temperature with more than 80% relative humidity for luxuriant growth. Thus, the pure cultures of the 
pathogen were obtained. Then necessary multiplication of the pathogen was done. 
f) Maintenance of Magnaporthe Oryzae Triticum Pathogen 
The pure culture was obtained by transferring young immature whitish mycelia from culture plate to a fresh PDA 
slant and incubated for 10-15 days. From this culture, a young whitish mycelium was again transferred to sterilized 
PDA slant. Thus a pure culture was obtained and maintained by sub culturing (Figure 1). In molecular techniques 
conventional PCR methods were employed. 

 
 
 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 4 Published by IDEAS SPREAD 
 

 
 
 
 
 
 
 
 
 
 

 
 

Figure 1. Pure culture of Magnaporthe oryzae triticum 
 
a) DNA Extraction of Wheat Spikes 
A modified mini-prep DNA extraction method developed by Edwards et al. (1991) was followed in this experiment. 
The simplified mini scale procedure for DNA isolation in PCR analysis of this method was done in the 
Biotechnology Lab, BINA. The quality of the isolated DNA in the protocol was sufficient for PCR analysis. One 
set of 2 mL microfuge tubes were labeled with the sample names for harvesting tissue, and the second set of 1.5 
mL tubes were labeled for the DNA extraction with the same sample names. It is most efficient to work in sets of 
24 tubes at a time. The samples were brought to the DNA extraction lab, the water bath was fixed to 65 °C, water 
level checked, and the extraction buffer was pre-heated before use (30 sec in the microwave). The spike samples 
were cut into 2-3 cm pieces and the sample was crushed in small mortar and pestle. After crushing, the tubes were 
removed to a room temperature tube rack, to let them warm up briefly (2-3 min.) then 800 μl re-heated extraction 
buffer was added and mixed well by vortexing and inverting. The tubes were placed in a 65 °C water bath in a 
tube holder for 20 minutes (after 10 minutes mixed by inverting and return to the water bath). The tubes were 
removed, mixed by inverting, and brought to a chemical fume hood. Then 800 μl L chloroform mix was added 
(24:1 mixture of chloroform and isoamyl alcohol). Tubes were closed tightly, placed in tube rack, covered with 
paper towels and hold a second tube rack against the top of the tubes and inverted repeatedly for 3 minutes. The 
tubes were centrifuged for 8 minutes at 11,000 rpm in a micro centrifuge. 500 μl of the upper aqueous layer was 
removed to a new 1.5 mL tube (already labeled) being careful not to pipette near the "dirty" layer. Later, the 
chloroform and plant tissue were poured into a liquid organic waste container. 1000 μl of cold 100% ethanol was 
added and mixed by inverting. Then Centrifuged for 12 minutes at maximum speed (13,200 rpm). A small pellet 
was visible. The solution was decanted by pouring the solution into a beaker and then touched the tip of the tube 
to a tissue to remove the excess solution (or pipette off excess solution with a P 200). 1000 μl cold 70% ethanol 
was added to all tubes (adding at an angle away from the side of the tube with the DNA pellet) and spinned for 3 
minutes at 13,200 rpm. The pellet was dried by inverting the tubes on a bench top on top of tissue for 30-45 min. 
It was made sure that there is no residual ethanol, but also not dried too long (which makes re-suspending difficult). 
The pellet was re-suspended in 100 μl TE buffer and dissolved pellet by warming in a 65 °C water bath for up to 
1 hr (with frequent mixing or flicking the tube with finger). After the pellet was dissolved, the concentrated DNA 
was stored at -20 °C. 
b) Conventional PCR 
The PCR cocktail including DNA had a total volume of 10 μl/reaction based on a wheat protocol (Pieck et al., 
2013) was placed in the PCR tubes and run in the DNA thermal cycler. For a single reaction 3.5 μL of Green taq 
polymerase, 0.5 μL of dNTPs, 0.25 μL of DNA Polymerase, 1 μL of Primer (forward+reverse) and 3.75 μL of 
ddH2O was required. For 15 reactions, at first 3.75 μl of sterilized ddH2O, 2.5 μl of DNA polymerase, 0.5 μl of 
dNTPs were taken in a 1.5 ml PCR tube. Then 1 μl of primer (forward and reverse) were added. The mixture was 
then vortexed. At last 3.5 μl of Taq DNA polymerase was mixed with it. 1.0 μl of each template DNA samples 
were pipette into the wells of the PCR tubes for PCR amplification with initial denaturation at 94°C for 90 s; 
followed by 30 cycles of 94°C for 30 s, 62°C for 30 s, and 72°Cfor 60 s; and a final extension at 72°C for 2 min. 
Amplified PCR products were analyzed on 2% agarose gels and stained with ethi-dium bromide. About 2 μl of 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 5 Published by IDEAS SPREAD 
 

each PCR product was loaded in each well. DNA size marker like 100 bp DNA ladder was used for size 
determination. After staining, the gel was taken out carefully from the staining tray and placed on high performance 
ultraviolet light box (UV-trans-illuminator) of GEL Doc for checking the DNA bands. 
 
Table 1. The sequence and size of the selected specific primer used in this study 

 
c) Statistical Analysis 
The collected data were analyzed statistically by using Web Agri Stat Package (WASP) program, version 2 
software. The mean of all the treatments was compared by Tukey’s HSD test with a 95% level of significance. 
3. Results and Discussion 
3.1 Symptoms of Wheat Blast 
The infection appeared on the emerging heads at pre-heading stage generally at 46-49 days age of wheat plants. 
The infection appeared as whitening of the spike most commonly from the top. Infection occurred on the emerging 
head in different points i.e. in the middle or near the tip or at the base (Figure 2). The common thing was observed 
that irrespective of the point of infection, whitening commonly called bleaching from the top downward. It means 
if infection occurred at the base, the whole of the spike bleached, infection near the top caused bleaching of the 
spike from top to down the point of infection and an infection in the middle caused bleaching of the half of the 
spike from the top. However, with time the whole of the spike in all cases turned silvery-white i.e. completely 
bleached. 
3.2 Isolation and Characterization of Magnaporthe Oryzae Triticum 
Infected spikes were collected, room dried and stored at 4 °C in brown paper envelopes. Microscopic slides were 
prepared through picking up fungal structures from the infected spikelets and observed under microscope. 
Secondly, infected spikelets were observed directly under stereo binocular microscope and recorded the fungal 
structures on the surface of the grains and prepared slides picking up those structures with needles.  Thirdly, 
infected spikelets were splitted into small parts and incubated in moist chamber and agar plates. The plates were 
observed for fungal growth. Slides were prepared picking up growing fungal structures and observed under a 
microscope. Pyriform 3 celled hyaline conidia with beaks of different length were observed in plenty (Figure 2). 
3.3 Germination of Mot Spores 
Continued observation of the watch glass under microscope revealed MoT started germination producing germ 
tube within 12h. Germ tubes were seen developed from both ends as well as from side cells (Figure 2). The 
germination of the spores confirmed that the infected samples collected from wheat plants of the experimental plot 
were in live condition. 
Screening M1 population  
M1 population in the BINA campus did not find any infection of Magnaporthe oryzae triticum. 
Screening M2 population  
The experiment in farmers field found infection of Magnaporthe oryzae triticum showing different levels of 
disease incidence (DI) and disease severity (DS). Both DI and DS increased with time. At the initial stage infection 
of Magnaporthe oryzae triticum was low which showed a very alarming hike towards the end of the season.   
3.4 Effect of Seed Irradiation on The Incidence and Severity of Blast of Wheat Under Natural Infection 
Seed irradiation at different doses significantly affected the incidence of blast disease of three wheat varieties 
infected at the pre-heading stage (Table 2). 

 

 

Primer 
Name 

Seqa Sequence Annealing 
temperature (°C) 

Target species 

MoT1 WB01 Forward GCTGTTCTGGGCCACCTAC 62 Magnaporthe 
oryzae triticum Reverse ATTCCTCCCCGATTTCCTTT



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 6 Published by IDEAS SPREAD 
 

 

 
Figure 2. A. Typical blast symptoms of bleaching of spikes B. Symptoms on leaf (eye shaped spot) C. Lesion 

photo taken by mobile microscope (60X view) D. Microscopic view of MoT spores (40X view) C. Germinating 
spores 

 
Table 2. Effect of seed irradiation on the incidence and severity of blast of wheat on three wheat varieties under 
natural infection 

Irradiation 

BARI Gom-25 BARI Gom-29 BARI Gom-30 
Disease 

Incidence 
(%) 

Disease 
Severity 

(%) 

Disease 
Incidence 

(%) 

Disease 
Severity 

(%) 

Disease 
Incidence 

(%) 

Disease 
Severity 

(%) 
No Irradiation 56.66 a 87.33 a 48.00 a 94.00 a 34.33 a 85.00 a 

150 Gy 37.33 c 80.00 b 30.00 c 81.66 b 29.33 b 74.33 b 
200 Gy 22.33 d 42.33 d 28.66 c 72.66 b 18.00 c 51.66 e 
250 Gy 32.33 c 52.33 c 17.33 d 60.00 c 25.00 b 57.66 d 
300 Gy 44.00 b 75.00 b 36.00 b 77.66 b 28.66 b 68.33 c 

The letters denote statistical differences at the 95% level using Tukey’s HSD (honestly significant difference) test. 
 
Seed irradiation caused a notable impact on the incidence and severity of blast on wheat varieties. Variation in the 
doses posed a significant difference on both incidence and severity. In all the varieties, wheat plants from non-
radiated seeds carried the maximum wheat blast infection. Within the varieties, difference in radiation doses caused 
significant variation in blast infection (Table 2). Among the treatments, 200 Gy and 250 Gy reduced the disease 
effectively. The maximum disease incidence (56.66%) was found in control of BARI Gom-25 and the maximum 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 7 Published by IDEAS SPREAD 
 

disease severity (94.00%) was found in control of BARI Gom-29. The minimum disease incidence (17.33%) was 
found in 250 Gy treated seed of BARI Gom-29 and the minimum disease severity (42.33%) was found in 200 Gy 
treated seed of BARI Gom-25. In case of BARI Gom-25 and BARI Gom-30, the performance of 200 Gy was 
mentionable for their ability to suppress disease incidence and severity. 
3.5 Quantification of DNA 
The DNA isolated from infected spikes of M2 families of wheat was quantified through NanoDropTM 
spectrophotometer (Table 3). It was found that DNA concentration varied from 250 ngμl-1 to 1942.73 ngμl-1. The 
amount in each M2 family was adjusted to 50 ngμl-1. 
 

Table 3. The concentration of DNA of 15 M2 families of wheat spike sample 

Sl. No. Treatments DNA Concentration  ngμl-

1 
Absorbance Ratio 
A260/280 A260/230 

1. BWM-1 583.80 1.41 0.82 
2. BWM-2 250.08 1.34 0.78 
3. BWM-3 647.10 1.86 0.60 
4. BWM-4 299.64 1.60 0.57 
5. BWM-5 616.24 1.70 0.52 
6. BWM-6 266.02 1.97 0.78 
7. BWM-7 481.57 1.92 1.57 
8. BWM-8 417.83 2.05 1.37 
9. BWM-9 347.89 2.02 1.77 
10. BWM-10 388.13 1.16. 1.64 
11. BWM-11 288.89 1.83 0.64 
12. BWM-12 272.60 2.00 0.93 
13. BWM-13 1942.73 1.54 0.84 
14. BWM-14 1062.43 2.01 0.69 
15. BWM-15 386.48 2.02 1.47 

BWM-1: BARI Gom-25 (150Gy), BWM-2: BARI Gom-25 (200Gy), BWM-3: BARI Gom-25 (250Gy), BWM-4: 
BARI Gom-25 (300Gy), BWM-5: BARI Gom-25 (Control), BWM-6: BARI Gom-29 (150Gy), BWM-7: BARI 
Gom-29 (200Gy), BWM-8: BARI Gom-29 (250Gy), BWM-9: BARI Gom-29 (300Gy), BWM-10: BARI Gom-
29 (Control), BWM-11: BARI Gom-30 (150Gy), BWM-12: BARI Gom-30 (200Gy), BWM-13: BARI Gom-30 
(250Gy), BWM-14: BARI Gom-30 (300Gy), BWM-15: BARI Gom-30 (Control) 
 
3.6 PCR Based Detection of Magnaporthe Oryzae Triticum Using Specific Primer 
Genomic DNA was extracted from 15 infected M2 wheat spike samples. The DNA concentration was found 
between 250.08 ngμl-1 (BWM-2) to 1942.73 ngμl-1 (BWM-13). A working DNA solution of 50 ngμl-1 was 
prepared for each sample. Polymerase Chain Reaction (PCR) of the extracted genomic DNA from the infected 
samples was done using MoT1 primer. The results showed that nine M2 families’ samples (BWM-2, BWM-4, 
BWM-5, BWM-8, BWM-10, BWM-11, BWM-13, BWM-14, and BWM-15) clearly amplified an amplicon of 350 
bp by MoT1 primer. (Figure 3). The other seven M2 families did not show any amplification by this primer. 
 
 
 
 
 
 
 
 
 
 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 8 Published by IDEAS SPREAD 
 

 
 
 
 
 
 
 
 
 
 
 

 
Figure 3. Agarose gel electrophoresis of DNA of wheat blast infected spikes of M2 families amplified with 

primer MoT1. Lane M-100bp DNA ladder; Lane (1-15) contains PCR products of 15 M2 families (BWM-1 to 
BWM-15). An amplicon size of 350 bp found in spikes of nine M2 families. The size of the band confirms the 

infection of M2 families by MoT 
 
In general, disease incidence and severity on the M2 plants were reflected on the presence or absence of banding 
on agarose gel except in few cases. The MoT infection was recorded on all the M2 families while molecular 
detection of disease by MoT1 primer was found in nine M2 families. The primer detected the expression of the 
disease as an amplicon of 350 bp semi-quantitatively. It showed that semi-quantitative detection of disease which 
varied in different M2 families of wheat. The low infection might not be detected by MoT1 primer only. Therefore, 
further analysis should be done using other specific primers like MoT2, MoT3, etc. For the quantitative expression 
of Magnaporthe oryzae triticaum, Real Time PCR study is recommended. 
The research findings of the present investigation have some similarities to the findings of Vishwakarma et al., 
2017 who mutagenized by gamma rays a high yielding wheat variety, DBW-88 (released in 2014) at different 
doses (viz.200, 250, 300 & 350 Gy), raised M2 generation in  Kernel, Indian Institute of Wheat and Barley 
Research (IIWBR), a hot spot for yellow rust.  Variable resistance compared to susceptible parent was observed. 
Continued selection until M5 generation yielded immune mutant wheat against the susceptible parent variety (60-
80S) (Vishwakarma et al., 2017). 
Similarly, in 2004, Wonchu mutant variety of Oryza sativa was developed by irradiating seeds at 250 Gy of gamma 
rays. This variety has been shown to have higher yield and better disease resistance (Raina and Danish, 2018). 
4. Conclusion and Recommendations 
Radiation doses of 200 Gy and 250 Gy performed better in suppressing wheat blast incidence and severity and 
among the evaluated variety BARI Gom-30 performed best followed by BARI Gom-25 and BARI Gom-29. These 
mutant lines need to be advanced to M3 through M5 and artificially inoculated with wheat blast pathogen and 
evaluated for resistance. The findings of the present study enhance the way of more investigation on wheat blast 
disease resistant line screening. Irradiated seeds are not harmful to the ecosystem rather completely safe for human 
health. Therefore, irradiation can be utilized as an alternative approach for combating with wheat blast by 
developing resistant variety which will reduce the use of chemical pesticides as well as farmers additional cost to 
purchase pesticides. 
Acknowledgments 
The authors would like to express their thanks to KGF, Bangladesh for fund support to conduct this research. They 
are grateful to BINA authority, Bangladesh for providing the field and laboratory facilities. Also we extend our 
thanks to the farmers at Mahepur, Bangladesh who helped us during our study. The authors declare no conflicts of 
interest regarding this manuscript. 
References 
Ahmed, S., Alam, M. J., Awan, T. H., & Islam, AKMM. (2019). Herbicidal weed control in drill sown spring wheat 

under Bangladesh condition. Fundamental and Applied Agriculture, 4(2), 839–848. 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 9 Published by IDEAS SPREAD 
 

https://doi.org/10.5455/faa.34774 
Banglapedia. (2014). National Encyclopedia of Bangladesh. Retrieved from http://en.banglapedia.org/in 

dex.php?title=Wheat 
BINA. (2018). Annual report of Bangladesh Institute of Nuclear Agriculture (2017-2018). 
CIMMYT. (2017). Understanding and managing the threat of wheat blast in South Asia, South America, and 

beyond. Retrieved from https://repository.cimmyt.org/xmlui/ha ndle/10883/16947 
Cruz, C. D., Peterson, G. L., Bockus, W. W., Kankanala, P., Dubcovsky, J., Jordan, K.W., Akhunov, E., Chumley, 

F., Baldelomar, F. D., & Valent, B. (2016). The 2NS translocation from Aegilops ventricosa confers resistance 
to the Triticum pathotype of Magnaporthe oryzae. Crop Science Society of America, 56(3), 990-1000. 
https://doi.org/10.2135/cropsci2015.07.0410 

FAO Report. (2016). The Food and Agriculture Organization of the United Nations Rome, Italy. 
www.fao.org/.../2016/160801_BGDSurveyCalendar_Expectations_fromAgCensus 

FAO/IAEA. (2018). Manual on Mutation Breeding Third edition. Spencer-Lopes MM, Forster BP and Jankuloski 
L. Food and Agriculture Organization of the United Nations, Rome, Italy. pp 301. Retrieved from 
http://www.fao.org/3/I9285EN/i9285en.pdf 

Goulart, A.C.P., Sousa, P.G. and Urashima, A.S. (2007). Damages in wheat caused by infection of Pyricularia 
grisea. Summa Phytopathologica, (33), 358–363. http://doi.org/10.1590/1808-1657000952017 

IAEA. (2017). Mutant variety database of International Atomic Energy Agency. Retrieved from https:// 
mvd.iaea.org/#!Variety/4465 

Igarashi, S. (1991). Update on wheat blast (Pyricularia oryzae) in Brazil. In: Proceedings of the international 
conference on wheat for the nontraditional warm areas. Foz do Iguaçu, Brazil. (Saunders D eds.). Mexico DF, 
Mexico. CIMMYT. (3), 480–483. 

Kato, H. (1994). Phylogenetic aspects of Magnaporthe grisea on cereals-Origin and dissemination. Annals of the 
Phytopathological Society of Japan, (60), 266-268. 

Khursheed, S., Raina, A., Parveen, K., & Khan, S. (2017). Induced phenotypic diversity in the mutagenized 
populations of faba bean using physical and chemical mutagenesis. Journal of the Saudi Society of 
Agricultural Sciences. http://doi.org/10.1016/j.jssas.2017.03.001 

Kohli, M. M., Mehta, Y. R., Guzman, E., De Viedma, L., & Cubilla, L. E. (2011). Pyricularia blast a threat to 
wheat cultivation. Journal of Genetics and Plant Breeding, (47), 130-134. http://doi.org/10.17221/3267-
CJGPB 

Malaker, P. K., Barma, N. C. D., Tiwari, T. P., Collis, W. J., Duveiller, E., Singh, P. K., & Joshi, A. K. (2016). First 
Report of Wheat Blast Caused by Magnaporthe Oryzae Pathotype Triticum in Bangladesh. Plant Disease. 
100(11), 2330–2330. https://doi.org/10.1094/PDIS-05-16-0666-PDN 

Meah, M. B., Salam Moin, U., Khan, A. A., & Kabir, W. (2016). Wheat Blast in South Western Region of 
Bangladesh. Report submitted to FAO (BD) on the survey of wheat blast incidence in March 2016. Survey 
period 14-20 March 2016. Pp 7. 

Monsur, M. A., Ahmed, M., Haque, A., Jahan, Q. S. A., Ansari, T. H., Latif, M. A., Borma, N. C. D., Ali, M. A., 
Kabir, M. S., & Banik, B. R. (2016). Research update of cross infection between rice and wheat blast at BRRI. 
Presented on 27 October Bangladesh Agricultural Research Council (BARC), Dhaka, Bangladesh. 

Özge, Ç., & Çimen, A. (2017). Applications of Ionizing Radiation in Mutation Breeding, New Insights on Gamma 
Rays, Ahmed M. Maghraby, Intech Open. Retrieved from https://www.intechopen.com /books/new-insights-
on-gammarays/applications-of-ionizing-radiation-in-mutation-breeding 

Pieck, M. L., Ruck, A., Farman, M. L., Peterson, G. L., Stack, J. P., & Valent, B. (2016). Genomics-based marker 
discovery and diagnostic assay development for wheat blast. Plant Disease, (101), 103–109. 
https://doi.org/10.1094/PDIS-04-16-0500-RE. 

Raina, A., & Danish, M. (2018). Mutagenesis in Plant Breeding for Disease and Pathogen Resistance. Agricultural 
Research & Technology, 13(1), 1–2. https://doi.org/10.19080/ARTOAJ.2018.13.555869 

Raina, A., Laskar, R. A., Khursheed, S., Amin, R., & Tantray, Y. R. (2016). Role of mutation breeding in crop 
improvement-past, present and future. Asian Research Journal of Agriculture, (2), 1-13. 
https://doi.org/10.9734/ARJA/2016/29334 



as.ideasspread.org   Agricultural Science Vol. 1, No. 1; 2019 

 10 Published by IDEAS SPREAD 
 

Raina, A., Laskar, R. A., Khursheed, S., Khan, S., & Parveen, K. (2017). Induce Physical and Chemical 
Mutagenesis for Improvement of Yield Attributing Traits and their Correlation Analysis in Chickpea. 
International Letters of Natural Sciences, (61), 14-22. 
https://doi.org/10.18052/www.scipress.com/ILNS.61.14 

Samson, R. A., Hoekstra, E. S., Lund, F., Filtenborg, O., & Frisvad, J. C. (2015). Methods for the Detection, 
Isolation and Characterization of Food-borne Fungi, Central bureau voor Schimmelcultures, Utrecht, The 
Netherlands and BioCentrum DTU, Technical University of Denmark, DK-2800 Lyngby, Denmark. 

Siddique, S., Syed, Q., Adnan, A., Nadeem, M., Irfan, M., & Ashraf, Q. F. (2014). Production of Avermectin B1b 
from Streptomyces avermitilis 41445 by Batch Submerged Fermentation. Jundishapur J. Microbiology, 6(8). 
https://doi.org/10.5812/jjm.7198 

Singh, R. P., Singh, P. K., Rutkoski, J., Hodson, D. P., He, X., & Jørgensen, L. N. (2016). Disease impact on wheat 
yield potential and prospects of genetic control. Annual Review of Phytopathology, (54), 303–322. 
https://doi.org/10.1146/annurev-phyto-080615-095835 

Singh, S. M., Bhardwaj, S. C., Chatrath, R., Sharma, P., Chaudhary, A. K., & Gupta, R. K. (2016). Wheat Blast 
Disease- An Overview. Journal of Wheat Research, 8(1), 1-5. 

Urashima, A. S., Bockus, W. W., Bowden, R. L., Hunger, R. M., Morrill, W. L., Murray, T. D., & Smiley, R. W. 
(2010). Compendium of wheat diseases and pests (3rd Ed). American Phytopathological Society, 22–23. 

Vishwakarma, G., Das, B. K., Kumar, S., Mishra, C. N., Saharan, M. S., & Saini, A. (2017). Radiation Induced 
Mutations for Developing Enhanced Resistance to Yellow (stripe) Rust of Wheat. BARC Newsletter Nov-
Dec/17. 

 
Copyrights 
Copyright for this article is retained by the author(s), with first publication rights granted to the journal. 
This is an open-access article distributed under the terms and conditions of the Creative Commons Attribution 
license (http://creativecommons.org/licenses/by/4.0/). 
 
















<<
  /ASCII85EncodePages false
  /AllowTransparency false
  /AutoPositionEPSFiles true
  /AutoRotatePages /None
  /Binding /Left
  /CalGrayProfile (Dot Gain 20%)
  /CalRGBProfile (sRGB IEC61966-2.1)
  /CalCMYKProfile (U.S. Web Coated \050SWOP\051 v2)
  /sRGBProfile (sRGB IEC61966-2.1)
  /CannotEmbedFontPolicy /Error
  /CompatibilityLevel 1.4
  /CompressObjects /Tags
  /CompressPages true
  /ConvertImagesToIndexed true
  /PassThroughJPEGImages true
  /CreateJobTicket false
  /DefaultRenderingIntent /Default
  /DetectBlends true
  /DetectCurves 0.0000
  /ColorConversionStrategy /CMYK
  /DoThumbnails false
  /EmbedAllFonts true
  /EmbedOpenType false
  /ParseICCProfilesInComments true
  /EmbedJobOptions true
  /DSCReportingLevel 0
  /EmitDSCWarnings false
  /EndPage -1
  /ImageMemory 1048576
  /LockDistillerParams false
  /MaxSubsetPct 100
  /Optimize true
  /OPM 1
  /ParseDSCComments true
  /ParseDSCCommentsForDocInfo true
  /PreserveCopyPage true
  /PreserveDICMYKValues true
  /PreserveEPSInfo true
  /PreserveFlatness true
  /PreserveHalftoneInfo false
  /PreserveOPIComments true
  /PreserveOverprintSettings true
  /StartPage 1
  /SubsetFonts true
  /TransferFunctionInfo /Apply
  /UCRandBGInfo /Preserve
  /UsePrologue false
  /ColorSettingsFile ()
  /AlwaysEmbed [ true
  ]
  /NeverEmbed [ true
  ]
  /AntiAliasColorImages false
  /CropColorImages true
  /ColorImageMinResolution 300
  /ColorImageMinResolutionPolicy /OK
  /DownsampleColorImages true
  /ColorImageDownsampleType /Bicubic
  /ColorImageResolution 300
  /ColorImageDepth -1
  /ColorImageMinDownsampleDepth 1
  /ColorImageDownsampleThreshold 1.50000
  /EncodeColorImages true
  /ColorImageFilter /DCTEncode
  /AutoFilterColorImages true
  /ColorImageAutoFilterStrategy /JPEG
  /ColorACSImageDict <<
    /QFactor 0.15
    /HSamples [1 1 1 1] /VSamples [1 1 1 1]
  >>
  /ColorImageDict <<
    /QFactor 0.15
    /HSamples [1 1 1 1] /VSamples [1 1 1 1]
  >>
  /JPEG2000ColorACSImageDict <<
    /TileWidth 256
    /TileHeight 256
    /Quality 30
  >>
  /JPEG2000ColorImageDict <<
    /TileWidth 256
    /TileHeight 256
    /Quality 30
  >>
  /AntiAliasGrayImages false
  /CropGrayImages true
  /GrayImageMinResolution 300
  /GrayImageMinResolutionPolicy /OK
  /DownsampleGrayImages true
  /GrayImageDownsampleType /Bicubic
  /GrayImageResolution 300
  /GrayImageDepth -1
  /GrayImageMinDownsampleDepth 2
  /GrayImageDownsampleThreshold 1.50000
  /EncodeGrayImages true
  /GrayImageFilter /DCTEncode
  /AutoFilterGrayImages true
  /GrayImageAutoFilterStrategy /JPEG
  /GrayACSImageDict <<
    /QFactor 0.15
    /HSamples [1 1 1 1] /VSamples [1 1 1 1]
  >>
  /GrayImageDict <<
    /QFactor 0.15
    /HSamples [1 1 1 1] /VSamples [1 1 1 1]
  >>
  /JPEG2000GrayACSImageDict <<
    /TileWidth 256
    /TileHeight 256
    /Quality 30
  >>
  /JPEG2000GrayImageDict <<
    /TileWidth 256
    /TileHeight 256
    /Quality 30
  >>
  /AntiAliasMonoImages false
  /CropMonoImages true
  /MonoImageMinResolution 1200
  /MonoImageMinResolutionPolicy /OK
  /DownsampleMonoImages true
  /MonoImageDownsampleType /Bicubic
  /MonoImageResolution 1200
  /MonoImageDepth -1
  /MonoImageDownsampleThreshold 1.50000
  /EncodeMonoImages true
  /MonoImageFilter /CCITTFaxEncode
  /MonoImageDict <<
    /K -1
  >>
  /AllowPSXObjects false
  /CheckCompliance [
    /None
  ]
  /PDFX1aCheck false
  /PDFX3Check false
  /PDFXCompliantPDFOnly false
  /PDFXNoTrimBoxError true
  /PDFXTrimBoxToMediaBoxOffset [
    0.00000
    0.00000
    0.00000
    0.00000
  ]
  /PDFXSetBleedBoxToMediaBox true
  /PDFXBleedBoxToTrimBoxOffset [
    0.00000
    0.00000
    0.00000
    0.00000
  ]
  /PDFXOutputIntentProfile ()
  /PDFXOutputConditionIdentifier ()
  /PDFXOutputCondition ()
  /PDFXRegistryName ()
  /PDFXTrapped /False

  /CreateJDFFile false
  /Description <<
    /ARA <FEFF06270633062A062E062F0645002006470630064700200627064406250639062F0627062F0627062A002006440625064606340627062100200648062B062706260642002000410064006F00620065002000500044004600200645062A064806270641064206290020064406440637062806270639062900200641064A00200627064406450637062706280639002006300627062A0020062F0631062C0627062A002006270644062C0648062F0629002006270644063906270644064A0629061B0020064A06450643064600200641062A062D00200648062B0627062606420020005000440046002006270644064506460634062306290020062806270633062A062E062F062706450020004100630072006F0062006100740020064800410064006F006200650020005200650061006400650072002006250635062F0627063100200035002E0030002006480627064406250635062F062706310627062A0020062706440623062D062F062B002E0635062F0627063100200035002E0030002006480627064406250635062F062706310627062A0020062706440623062D062F062B002E>
    /BGR <FEFF04180437043f043e043b043704320430043904420435002004420435043704380020043d0430044104420440043e0439043a0438002c00200437043000200434043000200441044a0437043404300432043004420435002000410064006f00620065002000500044004600200434043e043a0443043c0435043d04420438002c0020043c0430043a04410438043c0430043b043d043e0020043f044004380433043e04340435043d04380020043704300020043204380441043e043a043e043a0430044704350441044204320435043d0020043f04350447043004420020043704300020043f044004350434043f0435044704300442043d04300020043f043e04340433043e0442043e0432043a0430002e002000200421044a04370434043004340435043d043804420435002000500044004600200434043e043a0443043c0435043d044204380020043c043e0433043004420020043404300020044104350020043e0442043204300440044f0442002004410020004100630072006f00620061007400200438002000410064006f00620065002000520065006100640065007200200035002e00300020043800200441043b0435043404320430044904380020043204350440044104380438002e>
    /CHS <FEFF4f7f75288fd94e9b8bbe5b9a521b5efa7684002000410064006f006200650020005000440046002065876863900275284e8e9ad88d2891cf76845370524d53705237300260a853ef4ee54f7f75280020004100630072006f0062006100740020548c002000410064006f00620065002000520065006100640065007200200035002e003000204ee553ca66f49ad87248672c676562535f00521b5efa768400200050004400460020658768633002>
    /CHT <FEFF4f7f752890194e9b8a2d7f6e5efa7acb7684002000410064006f006200650020005000440046002065874ef69069752865bc9ad854c18cea76845370524d5370523786557406300260a853ef4ee54f7f75280020004100630072006f0062006100740020548c002000410064006f00620065002000520065006100640065007200200035002e003000204ee553ca66f49ad87248672c4f86958b555f5df25efa7acb76840020005000440046002065874ef63002>
    /CZE <FEFF005400610074006f0020006e006100730074006100760065006e00ed00200070006f0075017e0069006a007400650020006b0020007600790074007600e101590065006e00ed00200064006f006b0075006d0065006e0074016f002000410064006f006200650020005000440046002c0020006b00740065007200e90020007300650020006e0065006a006c00e90070006500200068006f006400ed002000700072006f0020006b00760061006c00690074006e00ed0020007400690073006b00200061002000700072006500700072006500730073002e002000200056007900740076006f01590065006e00e900200064006f006b0075006d0065006e007400790020005000440046002000620075006400650020006d006f017e006e00e90020006f007400650076015900ed007400200076002000700072006f006700720061006d0065006300680020004100630072006f00620061007400200061002000410064006f00620065002000520065006100640065007200200035002e0030002000610020006e006f0076011b006a016100ed00630068002e>
    /DAN <FEFF004200720075006700200069006e0064007300740069006c006c0069006e006700650072006e0065002000740069006c0020006100740020006f007000720065007400740065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e007400650072002c0020006400650072002000620065006400730074002000650067006e006500720020007300690067002000740069006c002000700072006500700072006500730073002d007500640073006b007200690076006e0069006e00670020006100660020006800f8006a0020006b00760061006c0069007400650074002e0020004400650020006f007000720065007400740065006400650020005000440046002d0064006f006b0075006d0065006e0074006500720020006b0061006e002000e50062006e00650073002000690020004100630072006f00620061007400200065006c006c006500720020004100630072006f006200610074002000520065006100640065007200200035002e00300020006f00670020006e0079006500720065002e>
    /DEU <FEFF00560065007200770065006e00640065006e0020005300690065002000640069006500730065002000450069006e007300740065006c006c0075006e00670065006e0020007a0075006d002000450072007300740065006c006c0065006e00200076006f006e002000410064006f006200650020005000440046002d0044006f006b0075006d0065006e00740065006e002c00200076006f006e002000640065006e0065006e002000530069006500200068006f006300680077006500720074006900670065002000500072006500700072006500730073002d0044007200750063006b0065002000650072007a0065007500670065006e0020006d00f60063006800740065006e002e002000450072007300740065006c006c007400650020005000440046002d0044006f006b0075006d0065006e007400650020006b00f6006e006e0065006e0020006d006900740020004100630072006f00620061007400200075006e0064002000410064006f00620065002000520065006100640065007200200035002e00300020006f0064006500720020006800f600680065007200200067006500f600660066006e00650074002000770065007200640065006e002e>
    /ESP <FEFF005500740069006c0069006300650020006500730074006100200063006f006e0066006900670075007200610063006900f3006e0020007000610072006100200063007200650061007200200064006f00630075006d0065006e0074006f00730020005000440046002000640065002000410064006f0062006500200061006400650063007500610064006f00730020007000610072006100200069006d0070007200650073006900f3006e0020007000720065002d0065006400690074006f007200690061006c00200064006500200061006c00740061002000630061006c0069006400610064002e002000530065002000700075006500640065006e00200061006200720069007200200064006f00630075006d0065006e0074006f00730020005000440046002000630072006500610064006f007300200063006f006e0020004100630072006f006200610074002c002000410064006f00620065002000520065006100640065007200200035002e003000200079002000760065007200730069006f006e0065007300200070006f00730074006500720069006f007200650073002e>
    /ETI <FEFF004b00610073007500740061006700650020006e0065006900640020007300e4007400740065006900640020006b00760061006c006900740065006500740073006500200074007200fc006b006900650065006c007300650020007000720069006e00740069006d0069007300650020006a0061006f006b007300200073006f00620069006c0069006b0065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e00740069006400650020006c006f006f006d006900730065006b0073002e00200020004c006f006f0064007500640020005000440046002d0064006f006b0075006d0065006e00740065002000730061006100740065002000610076006100640061002000700072006f006700720061006d006d006900640065006700610020004100630072006f0062006100740020006e0069006e0067002000410064006f00620065002000520065006100640065007200200035002e00300020006a00610020007500750065006d006100740065002000760065007200730069006f006f006e00690064006500670061002e000d000a>
    /FRA <FEFF005500740069006c006900730065007a00200063006500730020006f007000740069006f006e00730020006100660069006e00200064006500200063007200e900650072002000640065007300200064006f00630075006d0065006e00740073002000410064006f00620065002000500044004600200070006f0075007200200075006e00650020007100750061006c0069007400e90020006400270069006d007000720065007300730069006f006e00200070007200e9007000720065007300730065002e0020004c0065007300200064006f00630075006d0065006e00740073002000500044004600200063007200e900e90073002000700065007500760065006e0074002000ea0074007200650020006f007500760065007200740073002000640061006e00730020004100630072006f006200610074002c002000610069006e00730069002000710075002700410064006f00620065002000520065006100640065007200200035002e0030002000650074002000760065007200730069006f006e007300200075006c007400e90072006900650075007200650073002e>
    /GRE <FEFF03a703c103b703c303b903bc03bf03c003bf03b903ae03c303c403b5002003b103c503c403ad03c2002003c403b903c2002003c103c503b803bc03af03c303b503b903c2002003b303b903b1002003bd03b1002003b403b703bc03b903bf03c503c103b303ae03c303b503c403b5002003ad03b303b303c103b103c603b1002000410064006f006200650020005000440046002003c003bf03c5002003b503af03bd03b103b9002003ba03b103c42019002003b503be03bf03c703ae03bd002003ba03b103c403ac03bb03bb03b703bb03b1002003b303b903b1002003c003c103bf002d03b503ba03c403c503c003c903c403b903ba03ad03c2002003b503c103b303b103c303af03b503c2002003c503c803b703bb03ae03c2002003c003bf03b903cc03c403b703c403b103c2002e0020002003a403b10020005000440046002003ad03b303b303c103b103c603b1002003c003bf03c5002003ad03c703b503c403b5002003b403b703bc03b903bf03c503c103b303ae03c303b503b9002003bc03c003bf03c103bf03cd03bd002003bd03b1002003b103bd03bf03b903c703c403bf03cd03bd002003bc03b5002003c403bf0020004100630072006f006200610074002c002003c403bf002000410064006f00620065002000520065006100640065007200200035002e0030002003ba03b103b9002003bc03b503c403b103b303b503bd03ad03c303c403b503c103b503c2002003b503ba03b403cc03c303b503b903c2002e>
    /HEB <FEFF05D405E905EA05DE05E905D5002005D105D405D205D305E805D505EA002005D005DC05D4002005DB05D305D9002005DC05D905E605D505E8002005DE05E105DE05DB05D9002000410064006F006200650020005000440046002005D405DE05D505EA05D005DE05D905DD002005DC05D405D305E405E105EA002005E705D305DD002D05D305E405D505E1002005D005D905DB05D505EA05D905EA002E002005DE05E105DE05DB05D90020005000440046002005E905E005D505E605E805D5002005E005D905EA05E005D905DD002005DC05E405EA05D905D705D4002005D105D005DE05E605E205D505EA0020004100630072006F006200610074002005D5002D00410064006F00620065002000520065006100640065007200200035002E0030002005D505D205E805E105D005D505EA002005DE05EA05E705D305DE05D505EA002005D905D505EA05E8002E05D005DE05D905DD002005DC002D005000440046002F0058002D0033002C002005E205D905D905E005D5002005D105DE05D305E805D905DA002005DC05DE05E905EA05DE05E9002005E905DC0020004100630072006F006200610074002E002005DE05E105DE05DB05D90020005000440046002005E905E005D505E605E805D5002005E005D905EA05E005D905DD002005DC05E405EA05D905D705D4002005D105D005DE05E605E205D505EA0020004100630072006F006200610074002005D5002D00410064006F00620065002000520065006100640065007200200035002E0030002005D505D205E805E105D005D505EA002005DE05EA05E705D305DE05D505EA002005D905D505EA05E8002E>
    /HRV (Za stvaranje Adobe PDF dokumenata najpogodnijih za visokokvalitetni ispis prije tiskanja koristite ove postavke.  Stvoreni PDF dokumenti mogu se otvoriti Acrobat i Adobe Reader 5.0 i kasnijim verzijama.)
    /HUN <FEFF004b0069007600e1006c00f30020006d0069006e0151007300e9006701710020006e0079006f006d00640061006900200065006c0151006b00e90073007a00ed007401510020006e0079006f006d00740061007400e100730068006f007a0020006c006500670069006e006b00e1006200620020006d0065006700660065006c0065006c0151002000410064006f00620065002000500044004600200064006f006b0075006d0065006e00740075006d006f006b0061007400200065007a0065006b006b0065006c0020006100200062006500e1006c006c00ed007400e10073006f006b006b0061006c0020006b00e90073007a00ed0074006800650074002e0020002000410020006c00e90074007200650068006f007a006f00740074002000500044004600200064006f006b0075006d0065006e00740075006d006f006b00200061007a0020004100630072006f006200610074002000e9007300200061007a002000410064006f00620065002000520065006100640065007200200035002e0030002c0020007600610067007900200061007a002000610074007400f3006c0020006b00e9007301510062006200690020007600650072007a006900f3006b006b0061006c0020006e00790069007400680061007400f3006b0020006d00650067002e>
    /ITA <FEFF005500740069006c0069007a007a006100720065002000710075006500730074006500200069006d0070006f007300740061007a0069006f006e00690020007000650072002000630072006500610072006500200064006f00630075006d0065006e00740069002000410064006f00620065002000500044004600200070006900f900200061006400610074007400690020006100200075006e00610020007000720065007300740061006d0070006100200064006900200061006c007400610020007100750061006c0069007400e0002e0020004900200064006f00630075006d0065006e007400690020005000440046002000630072006500610074006900200070006f00730073006f006e006f0020006500730073006500720065002000610070006500720074006900200063006f006e0020004100630072006f00620061007400200065002000410064006f00620065002000520065006100640065007200200035002e003000200065002000760065007200730069006f006e006900200073007500630063006500730073006900760065002e>
    /JPN <FEFF9ad854c18cea306a30d730ea30d730ec30b951fa529b7528002000410064006f0062006500200050004400460020658766f8306e4f5c6210306b4f7f75283057307e305930023053306e8a2d5b9a30674f5c62103055308c305f0020005000440046002030d530a130a430eb306f3001004100630072006f0062006100740020304a30883073002000410064006f00620065002000520065006100640065007200200035002e003000204ee5964d3067958b304f30533068304c3067304d307e305930023053306e8a2d5b9a306b306f30d530a930f330c8306e57cb30818fbc307f304c5fc59808306730593002>
    /KOR <FEFFc7740020c124c815c7440020c0acc6a9d558c5ec0020ace0d488c9c80020c2dcd5d80020c778c1c4c5d00020ac00c7a50020c801d569d55c002000410064006f0062006500200050004400460020bb38c11cb97c0020c791c131d569b2c8b2e4002e0020c774b807ac8c0020c791c131b41c00200050004400460020bb38c11cb2940020004100630072006f0062006100740020bc0f002000410064006f00620065002000520065006100640065007200200035002e00300020c774c0c1c5d0c11c0020c5f40020c2180020c788c2b5b2c8b2e4002e>
    /LTH <FEFF004e006100750064006f006b0069007400650020016100690075006f007300200070006100720061006d006500740072007500730020006e006f0072011700640061006d00690020006b0075007200740069002000410064006f00620065002000500044004600200064006f006b0075006d0065006e007400750073002c0020006b00750072006900650020006c0061006200690061007500730069006100690020007000720069007400610069006b007900740069002000610075006b01610074006f00730020006b006f006b007900620117007300200070006100720065006e006700740069006e00690061006d00200073007000610075007300640069006e0069006d00750069002e0020002000530075006b0075007200740069002000500044004600200064006f006b0075006d0065006e007400610069002000670061006c006900200062016b007400690020006100740069006400610072006f006d00690020004100630072006f006200610074002000690072002000410064006f00620065002000520065006100640065007200200035002e0030002000610072002000760117006c00650073006e0117006d00690073002000760065007200730069006a006f006d00690073002e>
    /LVI <FEFF0049007a006d0061006e0074006f006a00690065007400200161006f00730020006900650073007400610074012b006a0075006d00750073002c0020006c0061006900200076006500690064006f00740075002000410064006f00620065002000500044004600200064006f006b0075006d0065006e007400750073002c0020006b006100730020006900720020012b00700061016100690020007000690065006d01130072006f00740069002000610075006700730074006100730020006b00760061006c0069007401010074006500730020007000690072006d007300690065007300700069006501610061006e006100730020006400720075006b00610069002e00200049007a0076006500690064006f006a006900650074002000500044004600200064006f006b0075006d0065006e007400750073002c0020006b006f002000760061007200200061007400760113007200740020006100720020004100630072006f00620061007400200075006e002000410064006f00620065002000520065006100640065007200200035002e0030002c0020006b0101002000610072012b00200074006f0020006a00610075006e0101006b0101006d002000760065007200730069006a0101006d002e>
    /NLD (Gebruik deze instellingen om Adobe PDF-documenten te maken die zijn geoptimaliseerd voor prepress-afdrukken van hoge kwaliteit. De gemaakte PDF-documenten kunnen worden geopend met Acrobat en Adobe Reader 5.0 en hoger.)
    /NOR <FEFF004200720075006b00200064006900730073006500200069006e006e007300740069006c006c0069006e00670065006e0065002000740069006c002000e50020006f0070007000720065007400740065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e00740065007200200073006f006d00200065007200200062006500730074002000650067006e0065007400200066006f00720020006600f80072007400720079006b006b0073007500740073006b00720069006600740020006100760020006800f800790020006b00760061006c0069007400650074002e0020005000440046002d0064006f006b0075006d0065006e00740065006e00650020006b0061006e002000e50070006e00650073002000690020004100630072006f00620061007400200065006c006c00650072002000410064006f00620065002000520065006100640065007200200035002e003000200065006c006c00650072002000730065006e006500720065002e>
    /POL <FEFF0055007300740061007700690065006e0069006100200064006f002000740077006f0072007a0065006e0069006100200064006f006b0075006d0065006e007400f300770020005000440046002000700072007a0065007a006e00610063007a006f006e00790063006800200064006f002000770079006400720075006b00f30077002000770020007700790073006f006b00690065006a0020006a0061006b006f015b00630069002e002000200044006f006b0075006d0065006e0074007900200050004400460020006d006f017c006e00610020006f007400770069006500720061010700200077002000700072006f006700720061006d006900650020004100630072006f00620061007400200069002000410064006f00620065002000520065006100640065007200200035002e0030002000690020006e006f00770073007a0079006d002e>
    /PTB <FEFF005500740069006c0069007a006500200065007300730061007300200063006f006e00660069006700750072006100e700f50065007300200064006500200066006f0072006d00610020006100200063007200690061007200200064006f00630075006d0065006e0074006f0073002000410064006f0062006500200050004400460020006d00610069007300200061006400650071007500610064006f00730020007000610072006100200070007200e9002d0069006d0070007200650073007300f50065007300200064006500200061006c007400610020007100750061006c00690064006100640065002e0020004f007300200064006f00630075006d0065006e0074006f00730020005000440046002000630072006900610064006f007300200070006f00640065006d0020007300650072002000610062006500720074006f007300200063006f006d0020006f0020004100630072006f006200610074002000650020006f002000410064006f00620065002000520065006100640065007200200035002e0030002000650020007600650072007300f50065007300200070006f00730074006500720069006f007200650073002e>
    /RUM <FEFF005500740069006c0069007a00610163006900200061006300650073007400650020007300650074010300720069002000700065006e007400720075002000610020006300720065006100200064006f00630075006d0065006e00740065002000410064006f006200650020005000440046002000610064006500630076006100740065002000700065006e0074007200750020007400690070010300720069007200650061002000700072006500700072006500730073002000640065002000630061006c006900740061007400650020007300750070006500720069006f006100720103002e002000200044006f00630075006d0065006e00740065006c00650020005000440046002000630072006500610074006500200070006f00740020006600690020006400650073006300680069007300650020006300750020004100630072006f006200610074002c002000410064006f00620065002000520065006100640065007200200035002e00300020015f00690020007600650072007300690075006e0069006c006500200075006c0074006500720069006f006100720065002e>
    /RUS <FEFF04180441043f043e043b044c04370443043904420435002004340430043d043d044b04350020043d0430044104420440043e0439043a043800200434043b044f00200441043e043704340430043d0438044f00200434043e043a0443043c0435043d0442043e0432002000410064006f006200650020005000440046002c0020043c0430043a04410438043c0430043b044c043d043e0020043f043e04340445043e0434044f04490438044500200434043b044f00200432044b0441043e043a043e043a0430044704350441044204320435043d043d043e0433043e00200434043e043f0435044704300442043d043e0433043e00200432044b0432043e04340430002e002000200421043e043704340430043d043d044b04350020005000440046002d0434043e043a0443043c0435043d0442044b0020043c043e0436043d043e0020043e0442043a0440044b043204300442044c002004410020043f043e043c043e0449044c044e0020004100630072006f00620061007400200438002000410064006f00620065002000520065006100640065007200200035002e00300020043800200431043e043b043504350020043f043e04370434043d043804450020043204350440044104380439002e>
    /SKY <FEFF0054006900650074006f0020006e006100730074006100760065006e0069006100200070006f0075017e0069007400650020006e00610020007600790074007600e100720061006e0069006500200064006f006b0075006d0065006e0074006f0076002000410064006f006200650020005000440046002c0020006b0074006f007200e90020007300610020006e0061006a006c0065007001610069006500200068006f0064006900610020006e00610020006b00760061006c00690074006e00fa00200074006c0061010d00200061002000700072006500700072006500730073002e00200056007900740076006f00720065006e00e900200064006f006b0075006d0065006e007400790020005000440046002000620075006400650020006d006f017e006e00e90020006f00740076006f00720069016500200076002000700072006f006700720061006d006f006300680020004100630072006f00620061007400200061002000410064006f00620065002000520065006100640065007200200035002e0030002000610020006e006f0076016100ed00630068002e>
    /SLV <FEFF005400650020006e006100730074006100760069007400760065002000750070006f0072006100620069007400650020007a00610020007500730074007600610072006a0061006e006a006500200064006f006b0075006d0065006e0074006f0076002000410064006f006200650020005000440046002c0020006b006900200073006f0020006e0061006a007000720069006d00650072006e0065006a016100690020007a00610020006b0061006b006f0076006f00730074006e006f0020007400690073006b0061006e006a00650020007300200070007200690070007200610076006f0020006e00610020007400690073006b002e00200020005500730074007600610072006a0065006e006500200064006f006b0075006d0065006e0074006500200050004400460020006a00650020006d006f0067006f010d00650020006f0064007000720065007400690020007a0020004100630072006f00620061007400200069006e002000410064006f00620065002000520065006100640065007200200035002e003000200069006e0020006e006f00760065006a01610069006d002e>
    /SUO <FEFF004b00e40079007400e40020006e00e40069007400e4002000610073006500740075006b007300690061002c0020006b0075006e0020006c0075006f00740020006c00e400680069006e006e00e4002000760061006100740069007600610061006e0020007000610069006e006100740075006b00730065006e002000760061006c006d0069007300740065006c00750074007900f6006800f6006e00200073006f00700069007600690061002000410064006f0062006500200050004400460020002d0064006f006b0075006d0065006e007400740065006a0061002e0020004c0075006f0064007500740020005000440046002d0064006f006b0075006d0065006e00740069007400200076006f0069006400610061006e0020006100760061007400610020004100630072006f0062006100740069006c006c00610020006a0061002000410064006f00620065002000520065006100640065007200200035002e0030003a006c006c00610020006a006100200075007500640065006d006d0069006c006c0061002e>
    /SVE <FEFF0041006e007600e4006e00640020006400650020006800e4007200200069006e0073007400e4006c006c006e0069006e006700610072006e00610020006f006d002000640075002000760069006c006c00200073006b006100700061002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e007400200073006f006d002000e400720020006c00e4006d0070006c0069006700610020006600f60072002000700072006500700072006500730073002d007500740073006b00720069006600740020006d006500640020006800f600670020006b00760061006c0069007400650074002e002000200053006b006100700061006400650020005000440046002d0064006f006b0075006d0065006e00740020006b0061006e002000f600700070006e00610073002000690020004100630072006f0062006100740020006f00630068002000410064006f00620065002000520065006100640065007200200035002e00300020006f00630068002000730065006e006100720065002e>
    /TUR <FEFF005900fc006b00730065006b0020006b0061006c006900740065006c0069002000f6006e002000790061007a006401310072006d00610020006200610073006b013100730131006e006100200065006e0020006900790069002000750079006100620069006c006500630065006b002000410064006f006200650020005000440046002000620065006c00670065006c0065007200690020006f006c0075015f007400750072006d0061006b0020006900e70069006e00200062007500200061007900610072006c0061007201310020006b0075006c006c0061006e0131006e002e00200020004f006c0075015f0074007500720075006c0061006e0020005000440046002000620065006c00670065006c0065007200690020004100630072006f006200610074002000760065002000410064006f00620065002000520065006100640065007200200035002e003000200076006500200073006f006e0072006100730131006e00640061006b00690020007300fc007200fc006d006c00650072006c00650020006100e70131006c006100620069006c00690072002e>
    /UKR <FEFF04120438043a043e0440043804410442043e043204430439044204350020044604560020043f043004400430043c043504420440043800200434043b044f0020044104420432043e04400435043d043d044f00200434043e043a0443043c0435043d044204560432002000410064006f006200650020005000440046002c0020044f043a04560020043d04300439043a04400430044904350020043f045604340445043e0434044f0442044c00200434043b044f0020043204380441043e043a043e044f043a04560441043d043e0433043e0020043f0435044004350434043404400443043a043e0432043e0433043e0020043404400443043a0443002e00200020042104420432043e04400435043d045600200434043e043a0443043c0435043d0442043800200050004400460020043c043e0436043d04300020043204560434043a0440043804420438002004430020004100630072006f006200610074002004420430002000410064006f00620065002000520065006100640065007200200035002e0030002004300431043e0020043f04560437043d04560448043e04570020043204350440044104560457002e>
    /ENU (Use these settings to create Adobe PDF documents best suited for high-quality prepress printing.  Created PDF documents can be opened with Acrobat and Adobe Reader 5.0 and later.)
  >>
  /Namespace [
    (Adobe)
    (Common)
    (1.0)
  ]
  /OtherNamespaces [
    <<
      /AsReaderSpreads false
      /CropImagesToFrames true
      /ErrorControl /WarnAndContinue
      /FlattenerIgnoreSpreadOverrides false
      /IncludeGuidesGrids false
      /IncludeNonPrinting false
      /IncludeSlug false
      /Namespace [
        (Adobe)
        (InDesign)
        (4.0)
      ]
      /OmitPlacedBitmaps false
      /OmitPlacedEPS false
      /OmitPlacedPDF false
      /SimulateOverprint /Legacy
    >>
    <<
      /AddBleedMarks false
      /AddColorBars false
      /AddCropMarks false
      /AddPageInfo false
      /AddRegMarks false
      /ConvertColors /ConvertToCMYK
      /DestinationProfileName ()
      /DestinationProfileSelector /DocumentCMYK
      /Downsample16BitImages true
      /FlattenerPreset <<
        /PresetSelector /MediumResolution
      >>
      /FormElements false
      /GenerateStructure false
      /IncludeBookmarks false
      /IncludeHyperlinks false
      /IncludeInteractive false
      /IncludeLayers false
      /IncludeProfiles false
      /MultimediaHandling /UseObjectSettings
      /Namespace [
        (Adobe)
        (CreativeSuite)
        (2.0)
      ]
      /PDFXOutputIntentProfileSelector /DocumentCMYK
      /PreserveEditing true
      /UntaggedCMYKHandling /LeaveUntagged
      /UntaggedRGBHandling /UseDocumentProfile
      /UseDocumentBleed false
    >>
  ]
>> setdistillerparams
<<
  /HWResolution [2400 2400]
  /PageSize [612.000 792.000]
>> setpagedevice

