









































In this study, a mutation of unknown identity with suspected association with the D. melanogaster gene vestigial 
was examined in order to determine its characteristics, mode of inheritance, and molecular nature and function. 
Flies of this mutation, appropriately named trex, display wings smaller in size with a crumpled appearance. Wild 
type mutant crosses (WTM1 and WTM2) were performed first to determine if the trex phenotype is dominant or 
recessive by crossing wild-type females with trex males, and then to determine whether it is inherited in an autosomal 
or sex-linked manner. Mapping crosses were performed using three marker genes (purple, black, and brown) in 
order to estimate trex’s location within the genome from the resulting recombination frequencies. The association 
of trex with the given marker genes by genetic linkage was analyzed using chi-square analysis and a p-value test 
of significance. After extracting DNA from wild type, trex, and reciprocal cross progeny flies, polymerase chain 
reactions and gel electrophoresis were performed in order to deduce characteristics of the mutation of trex. Further, 
using BLAST bioinformatic analyses, wild-type and trex gene sequences and protein products were compared to 
analyze the molecular nature of trex. trex was found to be inherited in an autosomal recessive pattern as evidenced 
by the results of WTM1 and WTM2, both of which produced an F1 generation that displayed only the wild-type 
presentation of wing morphology. From the mapping crosses’ recombination frequencies and statistical analysis, 
it was estimated that trex is located at 2:68 within the genome. Analysis by PCR and gel electrophoresis revealed 
that the trex mutation is apparent as the addition of genomic material in comparison to the wild-type molecular 
presentation. These findings were further supported by BLAST analysis, which revealed that the trex mutation was 
due to the insertion of retrotransposon 412 within the coding sequence. BLAST also revealed trex to be allelic 
to vestigial, which interacts with a protein produced by scalloped (sd), completing a transcription factor complex 
regulating wing development. When mutated, as in trex flies, vestigial is unable to perform its normal function and 
we see phenotypically abnormal wing formation. 

Aisthesis      Volume 14,  202355

Analysis of Novel Unknown D. melanogaster Mutation 
trex

by Sallianne Roher

Introduction:
 D. melanogaster has long been utilized as a model 
organism in genetic research for its low cost and 
quick life and reproductive cycles. The genome of 
Drosophila has been studied and mapped extensively, 
allowing scientists to further understand mechanisms 
of inheritance. By understanding the function of 
vestigial and other genes in the D. melanogaster 
genome, we may have further understanding of 
their human orthologs like the vestigial-like gene 
family (VGLL)  and the medically relevant effects of 
their mutations. vestigial aids in the specification of 
wing cells and the proliferation of such cells, leading 
to the fully formed wing and halteres observed 
in wild-type D. melanogaster (Simmonds et al. 
1997). vestigial associates using a TDU motif to a 
transcription factor produced by the gene scalloped 

(sd), which has a TEA/ATSS-DNA-binding domain 
(TEAD) (Yamaguchi 2020). As a transcription factor 
complex, the vg-sd complex is then able to regulate the 
binding of RNA polymerase and thus the subsequent 
translation of genes pertaining to the specification of 
wing cells and their proliferation (Yamaguchi 2020). 
For example, the expression of D. melanogaster genes 
cut and Serum Response Factor (SRF) are activated by 
the vg-sd complex and then play integral roles in the 
development of normal wing morphology (Figure 
1A) (Halter et al.1998). A mutation in the vestigial 
gene leads to abnormal wing/haltere development, 
as the DNA required for proper wing development is 
not expressed (Williams et al. 1990). As such, these 
flies have phenotypically smaller wings that have a 
crumpled appearance and lie perpendicular to the 
anteroposterior axis of the fly rather than lying flat. 



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  202356

 In this study, two strains of Drosophila 
melanogaster were studied, one wild-type strain 
and a strain of an unidentified mutation with 
similar morphology to a vestigial mutation, in 
order to understand and explore the nature and 
characteristics of the given mutation. The mutant 
strain was given the name “trex” on account of the 
small and protruding shape of the wings, similar to 
the short, protruding arms of a T. rex (Figure 2B). 
Further, it was hypothesized that the trex mutation 
was associated with the vestigial gene because of the 
vestigial-like presentation of trex flies’ phenotype. 
Each strain of flies was cultured, and their phenotypic 
differences were observed and compared. Reciprocal 
crosses were then performed between the strains 
to determine the mode of inheritance of the trex 
mutation. Mapping crosses were also performed 
to determine the chromosomal location of the trex 
gene. The molecular nature of the trex mutation 
was analyzed after extracting DNA from trex, wild-
type, and reciprocal cross progeny and performing 
polymerase chain reaction on the samples to isolate 
the DNA fragments of interest. Samples were then 
subject to gel electrophoresis and comparison via 
BLAST analysis in order to determine the nature 
of the trex mutation on a molecular level and how 
it might lead to the mutant phenotype and its 
connection with possible human orthologs. 

Materials and Methods:
a. Overview
 True breeding strains of trex and wild-type 
(WT) Drosophila flies were raised and manipulated 
in controlled conditions, and then used in various 
crosses. At all stages of development, the flies were 
observed in order to compare the phenotypic 
differences between wild-type and trex flies. Crosses 
between the two strains were performed in order 
to determine the mode of inheritance of trex and 
the location of the gene within the D. melanogaster 
genome. The offspring of such crosses were analyzed 
using phenotype scoring and statistical analysis in 
order to reach statistical and qualitative conclusions 
about trex. DNA was extracted from WT flies, trex 
flies, and reciprocal cross progeny and then utilized 
in polymerase chain reactions and subsequent gel 
electrophoresis. trex DNA was then sequenced and 
subjected to bioinformatic analysis using nucleotide 
and protein BLAST comparison to the wild-type 

genome. All fly stocks were maintained within vials 
containing a cornmeal-based food source with anti-
microbial factors along with a small amount of yeast 
for its added nutritive properties. Vials were kept 
within a 25-26°C incubator for the duration of the 
study except when stocks were being manipulated. 
Any manipulation of fly stocks occurred under sterile 
conditions, utilizing a CO2 anesthetizing system and 
a stereomicroscope with an illuminator. 

b. Reciprocal crosses performed to determine the mode 
of inheritance of trex
 First, a wild-type marker cross (WTM1) was 
performed between wild-type females and trex males 
to determine the mode of inheritance of trex as it 
relates to its dominance or lack thereof. Five females 
and three males were subcultured together into a vial 
with cornmeal food and incubated at 25°C. Upon 
pupa formation, the parental flies were brooded into 
new vials. Hatched progeny were phenotypically 
scored every 8-10 hours and then removed from the 
sample in order to prevent the formation of an F2 
generation. A virtual version of this cross between 
wild-type females and trex males was also performed 
on FlyLab JS with three batches of parental flies. 
Progeny of the virtual WTM1 crosses were also 
phenotypically scored. 
 A second wild-type marker cross was performed 
(WTM2) using the same method as WTM1, except 
with trex females and wild-type males in order to 
determine the mode of inheritance as it relates to 
whether trex is inherited in an autosomal or sex-
linked manner. Five females and three males were 
similarly subcultured into a vial with a cornmeal 
food source, incubated at 25°C, and were brooded 
into a new vial upon the formation of pupa within 
the original vial. The phenotypes of the progeny of 
this cross were scored every 8-10 hours and also 
removed from the sample in order to prevent the 
formation of an F2 generation. WTM2 was also 
reproduced virtually on FlyLab JS, similarly crossing 
three samples of trex females and wild-type males 
and phenotypically scoring progeny.

c. Mapping crosses performed to determine 
chromosomal location of trex
 Three mapping crosses were performed between 
the trex gene and a marker gene (black (bl), brown 
(bw), and purple (pr)) in order to determine the 



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  202357

location of trex within the D. melanogaster genome. 
Female flies heterozygous for both the trex gene and 
the given marker gene were crossed with male flies 
homozygous for both trex and the marker gene. Each 
mapping cross was repeated three times with three 
separate cultures. Progeny of this cross were scored 
according to what phenotypic class they belonged 
to in order to determine the relative amounts of 
progeny with parental and recombinant phenotypes. 
The recombination frequency between trex and 
each marker gene was found using the equation 

d. Chi-square statistical analysis of significance of 
genetic linkage of trex and marker genes
 Statistical analysis of these progeny ratios was 
performed utilizing R statistical software to determine 
if the marker gene and trex were genetically linked. 
More specifically, a Chi-square test was performed 
utilizing the equation  
The value of this analysis was used for a p-value test 
of significance to evaluate the null hypothesis that 
the given marker gene and trex are not genetically 
linked and thus progeny display a 1:1:1:1 ratio of 
the phenotypic classes. Three degrees of freedom 
were utilized in this analysis, giving a corresponding 
critical value of 7.815 when p=0.05. Any Chi-square 
calculations giving a value larger than 7.815 were 
considered statistically significant and the null 
hypothesis was rejected with 95% confidence. In 
other words, for Chi-square evaluations giving a 
value greater than 7.815, the null hypothesis that the 
marker gene and trex are not genetically linked was 
rejected with 95% confidence, and genetic linkage 
between the genes was reasonably assumed. Based 
on genetic distances from statistically analyzed 
recombination frequencies, a prospective gene map 
was constructed to predict the location of trex. 

e. DNA extraction
 To begin the analysis of the molecular nature of 
the trex mutation, DNA was first extracted from wild-
type flies, trex flies, and progeny from the reciprocal 
crosses (F1 generation flies from WTM1/2) so that 
it could be subjected to subsequent PCR and gel 
electrophoresis. Flies were macerated in a solution 
of 50mM Tris-HCl and 10mM ethylenediamine 
tetra acetic acid (EDTA) in order to disrupt cell 

membranes physically and chemically. Maceration 
physically allowed for the cells to be broken 
open, and EDTA served as a detergent to dissolve 
membrane lipids while Tris-HCl acted as a buffer. 
20mM NaOH, which denatures DNA, and 1% SDS, 
which dissolves lipids and denatures proteins, were 
then added to the sample. This step was vital to 
disrupting the histones and other molecules which 
are bound to and surrounding DNA. 3M potassium 
acetate was added to precipitate excess material like 
lipids and proteins, which were then removed via 
centrifugation and extraction. The isolated solution 
of DNA was then treated with cold 100% isopropanol 
followed by another round of centrifugation to 
precipitate the DNA into a pellet form. 

f. Polymerase chain reaction
 The polymerase chain reaction was used to amplify 
the subsection of DNA where the trex gene is located 
in order to then analyze it via gel electrophoresis. 
A PCR master mix containing Taq polymerase, 
dNTPs, MgCl2 and buffer (containing Tris-HCl and 
potassium chloride) was used. Taq polymerase was 
utilized to construct complementary strands of DNA 
from the template strands, chosen especially for its 
ability to withstand the high temperatures of PCR 
thermocycling, as it comes from the thermostable 
archaebacterium Thermus aquaticus. dNTPs were 
necessary material for Taq polymerase to synthesize 
the new strands of DNA, while MgCl2 and buffer were 
used to stabilize the reaction and provide optimum 
conditions for the functionality of Taq polymerase. 
Forward and reverse primers were utilized to 
bind to the DNA segment of interest, providing a 
locus at which Taq polymerase could bind. These 
primer sequences were gactgcttggcagcaatgt and 
tccttggtttttgcagttcc, respectively. GAPDH primers, 
expressed constitutively in most cells, were also 
utilized to synthesize positive control PCR strands. 
Each sample for PCR contained equal volumes of 
solution composed of PCR master mix, a variable 
volume of DNA according to the concentration of 
the DNA sample, and a variable volume of sterile 
water to equalize PCR solution volume. For each 
DNA type (WT, trex, and WTM F1), a first sample 
was made containing forward and reverse mutant 
primers, a second sample was made containing 
GAPDH forward and reverse primers (positive 
control), and a third sample was made containing no 



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  202358

primers (negative control). From DNA extraction, 
WT DNA was isolated in a concentration of 0.1190 
μg/μL, trex DNA was isolated in a concentration of 
0.0565 μg/μL, and WTM F1 DNA was isolated in a 
concentration of 0.2193 μg/μL. As such, 2 μL of WT 
DNA, 3.5 μL of trex DNA, and 1 μL of WTM F1 were 
added to their respective samples so that there were 
nearly equal amounts of DNA in each PCR solution. 
Once the 9 respective samples of PCR solutions were 
prepared, they were run through PCR thermocycling 
of denaturation at 96ºC, annealing at 57ºC, and 
elongation at 72ºC. This cycle was repeated about 30 
times to exponentially amplify our target sequence. 

g. Gel electrophoresis
 The PCR amplified target sequences of DNA 
were visualized using agarose gel electrophoresis 
in order to make qualitative observations about the 
nature of the trex mutation and confirm the genetic 
identity of WTM F1. The electric field anode draws 
the negatively charged DNA through the gel, with 
smaller fragments traveling faster through the gel. A 
Tris-Acetate-EDTA (TAE) running buffer was used 
in the preparation of two 2% agarose gels in order 
to allow the flow of charge through the gel. Further, 
three dyes (xylene cyanole, bromophenol blue, and 
orange G) were used as indicators. A Ficoll loading 
buffer was utilized to improve the sedimentation of 
DNA samples within the gel. A control ladder and 
the 9 samples made by PCR were loaded into the 10 
wells of the first agarose gel. TAs prepared additional 
trex and wild-type PCR products which were run 
through a second gel for the purpose of a standardized 
comparison. This second gel also contained a ladder 
and positive and negative controls. The prepared gels 
were subjected to 112-125 volts for 45 minutes.

h. Basic local alignment search tool (BLAST) analysis
 The DNA fragments isolated and amplified 
by PCR were sequenced using a dideoxy chain 
termination method in which extracted DNA 
fragments were treated with dideoxynucleotides 
(ddNTPs) tagged with fluorescent labels of differing 
wavelength depending on the nitrogenous base 
identity of the ddNTP. ddNTPs do not contain a 
hydroxyl group and thus terminate the sequence 
at different lengths; then, the fluorescence of the 
different length chains is emitted and visualized using 
a program like FinchTV. Using FinchTV, the WT D. 

melanogaster genome from Flybase was screened for 
the trex primer sequences used in PCR in order to 
find the amplicon segment corresponding to where 
the trex mutation is housed. The WT sequence and 
trex sequence taken from FinchTV were then aligned 
and compared using a BLAST nucleotide analysis in 
order to determine the nature of the trex mutation 
on the genome level and to deduce what gene trex 
is allelic to within the D. melanogaster genome. 
Further, the trex mutation was investigated using a 
protein BLAST on Flybase. The resulting proteins of 
both the wild type and mutant were then compared 
by uploading both the WT and mutant coding 
sequences into Expasy, which configures a peptide 
sequence from a nucleotide sequence. A 3D model 
of the wild-type protein and its human ortholog was 
constructed and observed using Uniprot software.

Results:
a. Phenotypic presentation of WT vs. trex flies
 The phenotypic differences between WT and 
trex flies were observed and recorded in order to 
characterize the nature of the mutation and how it 
affects the phenotype as compared to WT flies. WT 
flies’ wings run parallel to the anteroposterior axis 
and lay flat along the dorsal side of the abdomen of 
the fly (Figure 1). In contrast, trex wings protrude 
perpendicularly to the anteroposterior axis and 
have a crumpled appearance as opposed to lying 
flat (Figure 1). Such differences in wing anatomy are 
visibly present from the emergence of newly-eclosed 
flies from the pupa and remain the same through the 
adulthood of the flies. There are no visible differences 
between WT and trex first, second, or third instar 
larva nor the pupa they form. Further, there is no 
notable difference in the life cycle rate of development 
between WT and trex flies. The visible phenotypic 
difference in wing appearance appears only upon 
eclosion from the pupa. Upon comparison of males 
and females, no difference was observed between the 
manifestation of the wing mutation between males 
and females of the WT and trex strains of flies. The 
appearance of the wing mutation of the trex flies was 
visibly identical between males and females.

b. Reciprocal crosses yielded progeny of all wild-type 
phenotype
 The WTM1 cross was performed in order to 
determine whether the trex mutation is inherited 



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  202359

in a dominant or recessive inheritance pattern as it 
involved crossed true-breeding WT females and trex 
males. The chromosome map of the WTM1 cross can 
be seen in Figure 2. A total of 307 progeny were scored 
for the WTM1 cross. It was observed that all progeny 
of the WTM1 cross displayed a wild-type phenotype 
(Table 1). Among the 307 progeny that were scored, 
163 females and 144 males in total were scored, all of 
which displayed wild-type wing morphology (Table 
1). The virtual WTM1 cross also yielded progeny all 
displaying a wild-type phenotype. There was a total 
of 1,506 female and 1,514 male progenies, for a total 
of 3,020 progeny, all of which were wild type (Table 
2). 
 The WTM2 cross was performed to determine 
the inheritance pattern of trex as it relates to whether 
it is inherited via an autosomal or sex chromosome. 
The chromosome map of this cross can be seen in 
Figure 3. This was made possible by the fact that 
true breeding female trex flies were crossed with true 
breeding wild-type males. By analyzing the results 
of this cross, more specifically as it relates to the 
sex of the progeny, the autosomal versus sex-linked 
nature of this mutation was made apparent. A total 
of 350 progeny, 183 of which were female and 167 
of which were male, were scored for the WTM2 
(Table 3). All progeny of the WTM2 cross displayed 
a wild-type phenotype (Table 3). The virtual WTM2 
cross produced a total of 1,484 female and 1,489 
male progeny, all of which (2,973 total) displayed the 
wild-type phenotype as well (Table 4). 

c. Mapping crosses 
 The mapping crosses were performed to 
deduce the approximate location of the trex gene. 
The frequency of recombination between trex and 
the given marker gene was calculated in order to 
estimate the genetic distance between trex and the 
given marker gene, and the progeny were statistically 
analyzed using a Chi-square test and p-value test 
of significance. The null hypothesis of each cross 
was that the given marker gene and trex were not 
genetically linked and therefore assort independently. 
This hypothesis predicts a 1:1:1:1 ratio of each of 4 
phenotypic classes, two parental phenotypic classes 
and two recombinant phenotypic classes. 
 In Mapping Cross A, females heterozygous 
for both brown (bw) and trex were crossed with 
males homozygous for both bw and trex. 2,902 

progeny were scored, of which 1,489 were female 
and 1,413 were male. Of the progeny scored, 
2,144 displayed a parental phenotype, while 758 
displayed a recombinant phenotype (Table 5). The 
recombination frequency between bw and trex was 
calculated to be 26.1%. The calculated Chi-square 
value for this cross was found to be 663.6, which 
corresponds to a p-value of 2.2e-16 (Table 6).
 In  Mapping Cross B, female flies heterozygous 
for both black (bl) and trex were crossed with male 
flies homozygous for bl and trex. 1,519 female and 
1,501 male flies were scored for this cross for a total 
of 3,020 scored flies (Table 7). 2,590 flies of the 
total displayed a parental phenotype, while only 
430 displayed a recombinant phenotype (Table 7). 
The recombination frequency was calculated to be 
14.2%, and the Chi-square value of this cross was 
1,545.3, which gives a p-value of 2.2e-16 (Table 8). 
 Lastly, Mapping Cross C involved crossing 
female flies heterozygous for purple (pr) and trex 
with male flies homozygous pr and trex. A total 
of 3,024 progeny were collected and scored based 
on the phenotypic presentation, including 1,058 
females and 1,516 males (Table 9). Of the total 
progeny, 2,694 displayed a phenotype of the parents 
and 330 displayed a recombinant phenotype, giving 
a recombination frequency of 10.9% (Table 9). 
The Chi-square value calculated for this cross was 
1,850.4, leading to a p-value of 2.2e-16 (Table 10). 

d. PCR and gel electrophoresis
 DNA segments amplified using PCR 
thermocycling were viewed after being subjected to 
gel electrophoresis size-based separation of DNA. 
Gel electrophoresis allows for the separation of DNA 
fragments based on size, as the positively charged 
anode pulls the negatively charged DNA fragments 
toward it through the gel. Smaller fragments travel 
faster through the agarose gel and are visualized as 
a band that has traveled closer to the anode in the 
given amount of time. Larger fragments move slower 
through the gel and are visible as bands further from 
the anode. Under a UV viewing light, 3 of the 10 wells 
used for the first agarose gel in gel electrophoresis 
produced traveling bands through the agarose 
gel that were visible. The first well containing the 
ladder solution produced the appropriate ladder as 
expected. The third well containing a positive PCR 
control with GAPDH primers produced a band that 



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  202360

traveled to a location corresponding to about 100 
base pairs (Figure 5).  The fifth well containing our 
experimental sample of trex traveled to a location 
corresponding to about 1,000 base pairs (Figure 5). 
No other wells produced visible bands in the gel. 
The second gel prepared using TA samples did not 
produce any results. The negative control lanes in 
wells 8, 9, and 10 rightfully displayed no bands, as 
the samples contained no primers and thus the DNA 
contained was not amplified by PCR. However, it was 
given by TAs that wells 2, 3, and 4 with the positive 
control sample should have all produced bands of 
about 100 bp. Further, wells 6 and 7 containing wild-
type and WTM F1 DNA, respectively, should have 
produced bands traveling significantly farther than 
the band produced from well 6 containing trex DNA. 

e. BLAST analysis
 The bioinformatic BLAST analysis of the trex 
mutation allowed for the understanding of trex on 
a molecular level by revealing the sequence and 
structure-level mutation which forms the basis of 
the trex phenotype. Upon screening the wild-type 
genome for the forward and reverse primer sequences 
in order to locate the wild-type amplicon, the reverse 
primer was not found within the wild-type genome. 
The nucleotide BLAST comparison of the trex 
sequence produced by dideoxy chain termination 
and the wild-type sequence starting with the reverse 
primer gave a 94% agreement in identity of 425 
base pairs, as shown in Figure 6A. The comparison 
of trex and wild-type DNA sequences show an 
insertion of genetic material after the 425 base pair 
alignment (Figure 6C). The inserted DNA in the trex 
sequence was analyzed using a nucleotide BLAST 
on Flybase, aligning with over 25 D. melanogaster 
retrotransposons with an e-value of 0 (Figure 9A). 
The wild-type amplicon segment corresponding to 
trex (Figure 10) was analyzed using a protein BLAST 
and was found to be allelic to the D. melanogaster 
gene vestigial (vg) as hypothesized. Further, when 
the wild-type amino acid sequence retrieved from 
Expasy (Figure 10) was subjected to a protein 
BLAST specifically searching for human orthologs, 
it was found to have a high correspondence with the 
human gene vestigial-like family member 2 (VGLL-2) 
(Figure 11). 

Discussion:
a. trex is inherited in an autosomal recessive pattern
 WTM1 and Virtual WTM1 produced only 
phenotypically wild-type progeny, which points 
toward a recessive pattern of inheritance of trex. 
Because the strains of flies that were crossed were 
true breeding, the results of this cross reveal which 
phenotype exhibits itself as dominant over the other. 
As none of the progeny of this cross displayed a trex 
phenotype, it was concluded that trex is recessive to 
a WT phenotype. On the other hand, the WTM2 
cross and Virtual WTM2 crosses were done to 
determine whether trex is an autosomal or sex-
linked mutation. Similar to WTM1, all progeny for 
both WTM2 and Virtual WTM2 displayed a wild-
type phenotype. If trex was inherited in a sex-linked 
pattern, all males of the F1 generation would display 
a trex phenotype, as the mutation would be carried 
on the X chromosome passed to them by the female 
trex flies of the parental generation. However, no 
such trex male flies appeared in the F1 generation. As 
such, it can be concluded that trex is inherited via an 
autosomal chromosome within the D. melanogaster 
genome. 

b. trex is predicted to be located at 2:68 within the 
Drosophila genome
 Statistical analysis of all three mapping crosses 
(A, B and C) gave Chi-square values much larger 
than the critical value of 7.815. By these values the 
null hypothesis that trex and each marker gene are 
not linked genetically is rejected, as the results show 
a significant deviance from a 1:1:1:1 phenotypic 
ratio. Based on this rejection of the null hypothesis, 
it is feasible that trex and the given marker genes 
are, in fact, genetically linked and can be reasonably 
compared in order to predict a location of trex 
within the Drosophila genome. The recombination 
frequencies may be arranged to predict the location 
of trex within chromosome 2 of the D. melanogaster 
genome. Based on the information that black is 14 
centiMorgans from trex, purple is 11 centiMorgans 
from trex, and brown was found to be approximately 
26 centiMorgans from trex, it was predicted that trex 
is approximately located at 2:68 (Figure 2). 

c. trex contains an insertion of genetic material
 The gel electrophoresis results of a 1000 bp band 
of trex DNA as compared to a positive control band of 
100 base pairs do not lead to conclusive results about 



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

the nature of the trex mutation. However, as given by 
TA information, the wild-type and reciprocal cross 
progeny DNA samples should have traveled much 
farther than the trex band of DNA. Because it traveled 
a shorter distance, it can be concluded that trex is 
much larger than the WT sequence because it was 
pulled slower through the agarose gel as opposed to 
the WT band. As a larger DNA fragment, trex must 
then contain extra inserted DNA as compared to the 
WT sequence.

d. trex contains retrotransposon 412 and is allelic to 
vestigial
 When screening the D. melanogaster genome 
primer sequences in order to determine where the 
wild-type amplicon was located, the reverse primer 
was not found, as indicated in the results. With the 
results of the gel electrophoresis in consideration, 
it was hypothesized that the reverse primer was 
located within an inserted sequence as part of 
the trex mutation. The hypothesis of an insertion 
mutation as the molecular basis of trex was upheld 
by the nucleotide BLAST results, which showed 
an insertion in the trex sequence after the 425 bp 
alignment of the sequences (Figure 6C). The results of 
the nucleotide BLAST on Flybase gave an alignment 
of the insertion sequence with retrotransposon 412. 
As such, it can be concluded that the trex mutation 
arises from a retrotransposon 412 insertion into 
the wild-type sequence. Further, the wild-type 
nucleotide sequence corresponding to the unknown 
mutant gene trex was translated into the amino acid 
sequence via Expasy (Figure 10) and was subjected 
to a protein BLAST analysis and was found to 
correspond to the D. melanogaster gene vestigial. It 
can be concluded then that trex is allelic to vestigial. 
Because of this transposon, which is partially located 
within the coding portion of the wild-type sequence, 
the normal structure of the protein produced by 
vestigial is disrupted. As such, it cannot perform its 
normal function as a co-transcription factor acting 
with scalloped, as described in the introduction. This 
malfunction is visibly apparent in the phenotypic 
presentation of trex flies. Retrotransposon 412 
causes a malfunction of the vg-sd complex, such that 
it is unable to properly regulate wing/haltere genes, 
leading to malformed wing morphology.

f. trex has a human ortholog vestigial-like protein 2
 As indicated in the results, as an allele of the D. 
Melanogaster gene vestigial, trex displays a high level 
of concordance with the human gene VGLL-2. VGLL-
2 can be concluded to be a human ortholog of trex. 
This gene is a member of the vestigial-like family of 
proteins discussed in the introduction, and as such, 
acts as a co-transcription factor to transcription 
factors with a TEAD-binding domain (Yamaguchi 
2020). VGLL-2 specifically may be important in 
regulating the distribution of skeletal muscle fibers 
in humans by regulating myocyte transcription 
factors with TEAD-binding domains (Honda et al. 
2017). This ortholog allows us to understand how 
vestigial also functions regulating gene expression 
through its interactions with TEAD-binding 
domain-containing transcription factors through a 
TDU motif. The mutation of VGLL-2 is associated 
with various disorders of the skeletal muscle and 
associated tissues, such as rhabdomyosarcomas 
(e.g., pleotropic rhabdomyosarcoma and spindle 
cell rhabdomyosarcoma) (Furlong et al. 2001). The 
lack of genetic regulation by VGLL-2 leads to a 
dysregulation in gene expression in skeletal muscle 
development and subsequent malformations and 
irregular development of such tissues (Furlong et al. 
2001). 

g. Conclusions
 Overall, it was found that trex is an allele of 
the well-researched D. melanogaster gene vestigial. 
trex is inherited in an autosomal recessive fashion 
and is located at 2:68 within the D. melanogaster 
genome. The trex phenotype, visible as small, 
crumpled wings that lie perpendicular to the 
anteroposterior axis of the fly, arises as a result of the 
insertion of retrotransposon 412. Otherwise, trex 
has a correspondence of about 425 base pairs with 
94% agreement with the wild-type D. melanogaster 
nucleotide sequence. Further, as an allele of vestigial, 
trex has the human ortholog gene VGLL-2. 
 

 

61



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

References
Baena-Lopez LA, Garcia-Bellido A. 2006. Control 

of growth and positional information by the 
graded vestigial expression pattern in the wing 
of Drosophila melanogaster. Proc. Natl. Acad. 
Sci. U.S.A. 103(37):13734-13739.

Furlong MA, Mentzel T, & Fanburg-Smith JC. 
2001. Pleomorphic rhabdomyosarcoma in 
adults: a clinicopathologic study of 38 cases 
with emphasis on morphologic variants and 
recent skeletal muscle-specific markers. Modern 
Pathology: An Official Journal of the United 
States and Canadian Academy of Pathology, 
Inc.  14(6):595–603. https://doi.org/10.1038/
modpathol.3880357

Halder G, Polaczyk P, Kraus ME, Hudson A, Kim 
J, Laughon A, Carroll S. 1998. The vestigial 
and scalloped proteins act together to directly 
regulate wing-specific gene expression in 
Drosophila. Genes Dev. 12(24):3900-3909.

Honda, M, Hidaka K, Fukada S,  et al.  Vestigial-
like 2 contributes to normal muscle fiber type 
distribution in mice.  2017. Sci Rep  7:7168. 
https://doi.org/10.1038/s41598-017-07149-0

Simmonds A, Hughes S, Tse J, Cocquyt S, Bell, J. 
1997. The effect of dominant vestigial 
alleles upon vestigial-mediated wing 
patterning during development of 
Drosophila melanogaster.  Mechanisms of 
Development. 67(1):17–33.

Tolwinski NS. 2017. Introduction: Drosophila-A 
Model System for Developmental Biology. Journal 
of Developmental Biology,  5(3):9. https://doi.
org/10.3390/jdb5030009

Williams JA, Atkin AL, Bell JB. 1990. The functional 
organization of the vestigial locus in Drosophila 
melanogaster. Mol. Gen. Genet. 221(1):8-16.

Williams JA, Bell JB, Carroll SB. 1991. Control 
of Drosophila wing and haltere development by 
the nuclear vestigial gene product. Genes Dev. 
5(12B):2481-2495.

Yamaguchi N. 2020. Multiple roles of vestigial-Like 
family members in tumor development. Frontiers 
in Oncology. 10:1266. 

62



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

Figures and Tables

Figure 1. Dorsal comparison of female Drosophila 
melanogaster wing morphology in wild-type and 
trex mutant. [A] Depicts a female fly with a wild-type 
phenotype of wings of normal size and shape, flat in 
appearance, allowing view of vein arrangement and 
running parallel to the anteroposterior axis of the fly. 
Wings appear to lie mostly flat along the dorsal side of 
the abdomen of the fly. [B] Depicts a trex mutant female 
fly displaying wings that protrude perpendicular to the 
anteroposterior axis of the fly. Wings are shorter and 
crumpled in appearance, so that wing veins are not easily 
discernible.

Table 1. WTM1 cross phenotype scoring. A total of 307 
progeny were scored, including 163 females and 144 males. 
All progeny displayed a wild-type phenotype, indicating a 
recessive inheritance pattern of the trex mutation. 

Table 2. Virtual WTM1 cross phenotype scoring. A total 
of 3,020 progeny were scored, including 1,506 female and 
1,514 male progenies. All progeny displayed a wild-type 
phenotypic presentation, indicating a recessive pattern of 
inheritance of trex in agreement with the actual WTM1 
cross displayed in Table 1. 

Figure 2. Chromosome map of Wild Type Marker 
Cross 1 (WTM1). The female parental fly displays a 
homozygous genotype for the wild-type genotype, while 
the male parental fly shows a homozygous genotype for 
the trex genotype. When crossed, all progenies display 
a wild-type phenotype, though progeny have inherited 
one trex allele from the male parental genome. As such, 
it can be concluded that trex is recessive to the wild-type 
phenotype. 

Table 3. WTM2 cross phenotype scoring. A total of 
350 progeny were scored, of which 183 were female and 
167 were male. All progenies were of the wild-type class, 
including all male offspring, indicated an autosomal 
inheritance pattern of the trex mutation. 

63



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

Table 4. Virtual WTM2 cross phenotype scoring. A total 
of 2,973 progeny were scored, including 1,484 female and 
1,489 male progenies. All progeny displayed a wild-type 
phenotypic presentation, indicating a recessive pattern of 
inheritance of trex in agreement with the actual WTM2 
cross displayed in Table 3. 

Figure 3. Chromosome map of Wild Type Marker Cross 
2 (WTM2). The female parental fly displays a homozygous 
genotype for the trex genotype while the male parental 
fly shows a homozygous genotype for the wild-type 
genotype. When crossed, all progenies display a wild-
type phenotype, though progeny have inherited one trex 
allele from the female parental genome. As such, it can be 
concluded that trex is inherited in autosomal fashion. If 
trex was a sex-linked mutation, all male progeny would 
display a trex phenotype, as they would all carry the trex 
gene on their only X chromosome inherited from the 
female parental fly.

Table 5. Mapping cross A phenotypic classes. A total 
of 2,902 progeny were scored, 2,144 of which displayed 
a parental phenotype (+/+ or bw/trex) and 758 of which 
displayed a recombinant phenotype (bw/+ or +/trex), 
giving a recombination frequency of 26.1%. 

Table 6. Mapping cross A Chi-square analysis. Due to 
the null hypothesis that trex and bw are not genetically 
linked, a 1:1:1:1 ratio was utilized as the expected value 
of progeny. As such, a Chi-square value of 663.6 was 
calculated with the formula  

With 3 degrees of freedom, this Chi-square value 
coincides with a p-value of less than 2.2e-16 and thus the 
null hypothesis is rejected.  

Table 7. Mapping Cross B phenotypic classes. A total 
of 3,020 progeny were scored, 2,590 of which displayed 
a parental phenotype (+/+ or trex/bl) and 430 of which 
displayed a recombinant phenotype (trex/+ or +/bl), 
giving a recombination frequency of 14.2%.

64



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

Table 8. Mapping cross B Chi-square analysis. Due to 
the null hypothesis that trex and bl are not genetically 
linked, a 1:1:1:1 ratio was utilized as the expected value 
of progeny. As such, a Chi-square value of 1,545.3 was 
calculated with the formula  

With 3 degrees of freedom, this Chi-square value 
coincides with a p-value of less than 2.2e-16 and thus the 
null hypothesis is rejected.

Table 9. Mapping Cross C phenotypic classes. A total 
of 3,024 progeny were scored, 2,694 of which displayed 
a parental phenotype (+/+ or pr/trex) and 330 of which 
displayed a recombinant phenotype (pr/+ or +/trex), 
giving a recombination frequency of 10.9%.

Table 10. Mapping cross C Chi-square analysis. Due 
to the null hypothesis that trex and pr are not genetically 
linked, a 1:1:1:1 ratio was utilized as the expected value 
of progeny. As such, a Chi-square value of 1,850.4 was 
calculated with the formula 

With 3 degrees of freedom, this Chi-square value 
coincides with a p-value of less than 2.2e-16 and thus the 
null hypothesis is rejected.

Figure 4. Chromosome map. Chromosome 2 of D. 
melanogaster is depicted with bl being located at 2-49 
with an estimated genetic distance of 14 cM from trex, pr 
being located at 2-54 with an estimated genetic distance 
of 11 cM from trex, and bw being located at 2-103 with 
an estimated genetic distance of 26 cM from trex. Based 
on these locations and their estimated distances from trex, 
trex is predicted to be located at 2-68. 

Figure 5. Gel electrophoresis under ultraviolet 
viewing light. The lane farthest left displays the control 
ladder allowing the standardization of bp size of genes 
corresponding to the distance that bands travel. The 
second band shown is associated with a positive control 
sample and has traveled a distance associated with a band 
size of 100 bp. The third band, farthest right, is associated 
with the sample with trex and has traveled a distance 
corresponding to 100 base pairs. 

65



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

Figure 6. Comparison of trex and wild-type nucleotide 
sequences. [A] Displays the nucleotide BLAST alignment 
of the wild-type amplicon and trex sequences. The 
alignment includes about 425 base pairs and is in 
94% agreement. This correspondence is illustrated in 
[B], which displays a dot plot graph of the alignment 
between the respective sequences. The sequence in [C] 
is the wild-type sequence retrieved from FinchTV after 
dideoxy chain-termination sequencing. The highlighted 
region shows the 425 bp sequence in agreement with 
the wild-type genome. The sequence that follows and is 
unhighlighted is an inserted sequence not found in the 
wild-type genome. 

Figure 7. Coding sequence of WT. The coding sequence 
of the wild-type genome is included above. This sequence 
contains the mutant forward primer but does not contain 
the reverse primer. As the reverse primer was not found, it 
was hypothesized that the primer may be included in the 
trex mutation as an insertion into the wild-type genome. 

Figure 8. Transposon sequence. The sequence included 
above corresponds to the sequence inserted into the trex 
fly genome after the 425 base pair alignment with the wild-
type sequence. This is the sequence that was subjected to a 
nucleotide BLAST within Flybase.

Figure 9. Nucleotide BLAST of transposon mutation 
sequence. [A] displays the results of the nucleotide BLAST 
results of the inserted sequence found in the sequenced 
trex DNA fragment. There are 25 transposon sequences 
that align with the query search with an e-value of 0. [B] 
displays the correspondence of the inserted sequence with 
retrotransposon 412 found across the D. melanogaster 
genome.

66



Analysis of Novel Unknown D. melanogaster Mutation trex

Aisthesis      Volume 14,  2023

Figure 10. Amino acid sequence of vestigial. The coding 
portion of the nucleotide sequence of the gene vestigial, 
which was found to be allelic to trex, was entered into 
Expasy in order to retrieve the amino acid sequence that 
corresponds. 

Figure 11. Protein structure of vestigial. The structure of 
vestigial, the gene allelic to trex, is included above from a 
Uniprot analysis of the amino acid sequence of the wild-
type genome retrieved from Expasy. 

Figure 12. Human ortholog vestigial-like protein 2. 
[A] shows the protein structure of VGLL-2, the human 
ortholog to vestigial and also trex. The alignment of these 
genes as orthologs is shown in [B] as the protein BLAST 
alignment of vestigial and its orthologs within the human 
genome. 

67


