id	sid	tid	token	lemma	pos
aisthesis-5428	1	1	in	in	ADP
aisthesis-5428	1	2	this	this	DET
aisthesis-5428	1	3	study	study	NOUN
aisthesis-5428	1	4	,	,	PUNCT
aisthesis-5428	1	5	a	a	DET
aisthesis-5428	1	6	mutation	mutation	NOUN
aisthesis-5428	1	7	of	of	ADP
aisthesis-5428	1	8	unknown	unknown	ADJ
aisthesis-5428	1	9	identity	identity	NOUN
aisthesis-5428	1	10	with	with	ADP
aisthesis-5428	1	11	suspected	suspect	VERB
aisthesis-5428	1	12	association	association	NOUN
aisthesis-5428	1	13	with	with	ADP
aisthesis-5428	1	14	the	the	DET
aisthesis-5428	1	15	d.	d.	NOUN
aisthesis-5428	1	16	melanogaster	melanogaster	NOUN
aisthesis-5428	1	17	gene	gene	NOUN
aisthesis-5428	1	18	vestigial	vestigial	NOUN
aisthesis-5428	1	19	was	be	AUX
aisthesis-5428	1	20	examined	examine	VERB
aisthesis-5428	1	21	in	in	ADP
aisthesis-5428	1	22	order	order	NOUN
aisthesis-5428	1	23	to	to	PART
aisthesis-5428	1	24	determine	determine	VERB
aisthesis-5428	1	25	its	its	PRON
aisthesis-5428	1	26	characteristics	characteristic	NOUN
aisthesis-5428	1	27	,	,	PUNCT
aisthesis-5428	1	28	mode	mode	NOUN
aisthesis-5428	1	29	of	of	ADP
aisthesis-5428	1	30	inheritance	inheritance	NOUN
aisthesis-5428	1	31	,	,	PUNCT
aisthesis-5428	1	32	and	and	CCONJ
aisthesis-5428	1	33	molecular	molecular	ADJ
aisthesis-5428	1	34	nature	nature	NOUN
aisthesis-5428	1	35	and	and	CCONJ
aisthesis-5428	1	36	function	function	NOUN
aisthesis-5428	1	37	.	.	PUNCT
aisthesis-5428	2	1	flies	fly	NOUN
aisthesis-5428	2	2	of	of	ADP
aisthesis-5428	2	3	this	this	DET
aisthesis-5428	2	4	mutation	mutation	NOUN
aisthesis-5428	2	5	,	,	PUNCT
aisthesis-5428	2	6	appropriately	appropriately	ADV
aisthesis-5428	2	7	named	name	VERB
aisthesis-5428	2	8	trex	trex	PROPN
aisthesis-5428	2	9	,	,	PUNCT
aisthesis-5428	2	10	display	display	NOUN
aisthesis-5428	2	11	wings	wing	NOUN
aisthesis-5428	2	12	smaller	small	ADJ
aisthesis-5428	2	13	in	in	ADP
aisthesis-5428	2	14	size	size	NOUN
aisthesis-5428	2	15	with	with	ADP
aisthesis-5428	2	16	a	a	DET
aisthesis-5428	2	17	crumpled	crumpled	ADJ
aisthesis-5428	2	18	appearance	appearance	NOUN
aisthesis-5428	2	19	.	.	PUNCT
aisthesis-5428	3	1	wild	wild	ADJ
aisthesis-5428	3	2	type	type	NOUN
aisthesis-5428	3	3	mutant	mutant	ADJ
aisthesis-5428	3	4	crosses	crosse	NOUN
aisthesis-5428	3	5	(	(	PUNCT
aisthesis-5428	3	6	wtm1	wtm1	NOUN
aisthesis-5428	3	7	and	and	CCONJ
aisthesis-5428	3	8	wtm2	wtm2	NOUN
aisthesis-5428	3	9	)	)	PUNCT
aisthesis-5428	3	10	were	be	AUX
aisthesis-5428	3	11	performed	perform	VERB
aisthesis-5428	3	12	first	first	ADV
aisthesis-5428	3	13	to	to	PART
aisthesis-5428	3	14	determine	determine	VERB
aisthesis-5428	3	15	if	if	SCONJ
aisthesis-5428	3	16	the	the	DET
aisthesis-5428	3	17	trex	trex	PROPN
aisthesis-5428	3	18	phenotype	phenotype	NOUN
aisthesis-5428	3	19	is	be	AUX
aisthesis-5428	3	20	dominant	dominant	ADJ
aisthesis-5428	3	21	or	or	CCONJ
aisthesis-5428	3	22	recessive	recessive	ADJ
aisthesis-5428	3	23	by	by	ADP
aisthesis-5428	3	24	crossing	cross	VERB
aisthesis-5428	3	25	wild	wild	ADJ
aisthesis-5428	3	26	-	-	PUNCT
aisthesis-5428	3	27	type	type	NOUN
aisthesis-5428	3	28	females	female	NOUN
aisthesis-5428	3	29	with	with	ADP
aisthesis-5428	3	30	trex	trex	PROPN
aisthesis-5428	3	31	males	male	NOUN
aisthesis-5428	3	32	,	,	PUNCT
aisthesis-5428	3	33	and	and	CCONJ
aisthesis-5428	3	34	then	then	ADV
aisthesis-5428	3	35	to	to	PART
aisthesis-5428	3	36	determine	determine	VERB
aisthesis-5428	3	37	whether	whether	SCONJ
aisthesis-5428	3	38	it	it	PRON
aisthesis-5428	3	39	is	be	AUX
aisthesis-5428	3	40	inherited	inherit	VERB
aisthesis-5428	3	41	in	in	ADP
aisthesis-5428	3	42	an	an	DET
aisthesis-5428	3	43	autosomal	autosomal	ADJ
aisthesis-5428	3	44	or	or	CCONJ
aisthesis-5428	3	45	sex	sex	NOUN
aisthesis-5428	3	46	-	-	PUNCT
aisthesis-5428	3	47	linked	link	VERB
aisthesis-5428	3	48	manner	manner	NOUN
aisthesis-5428	3	49	.	.	PUNCT
aisthesis-5428	4	1	mapping	mapping	NOUN
aisthesis-5428	4	2	crosses	crosse	NOUN
aisthesis-5428	4	3	were	be	AUX
aisthesis-5428	4	4	performed	perform	VERB
aisthesis-5428	4	5	using	use	VERB
aisthesis-5428	4	6	three	three	NUM
aisthesis-5428	4	7	marker	marker	NOUN
aisthesis-5428	4	8	genes	gene	NOUN
aisthesis-5428	4	9	(	(	PUNCT
aisthesis-5428	4	10	purple	purple	ADJ
aisthesis-5428	4	11	,	,	PUNCT
aisthesis-5428	4	12	black	black	ADJ
aisthesis-5428	4	13	,	,	PUNCT
aisthesis-5428	4	14	and	and	CCONJ
aisthesis-5428	4	15	brown	brown	ADJ
aisthesis-5428	4	16	)	)	PUNCT
aisthesis-5428	4	17	in	in	ADP
aisthesis-5428	4	18	order	order	NOUN
aisthesis-5428	4	19	to	to	PART
aisthesis-5428	4	20	estimate	estimate	VERB
aisthesis-5428	4	21	trex	trex	PROPN
aisthesis-5428	4	22	’s	’s	PART
aisthesis-5428	4	23	location	location	NOUN
aisthesis-5428	4	24	within	within	ADP
aisthesis-5428	4	25	the	the	DET
aisthesis-5428	4	26	genome	genome	NOUN
aisthesis-5428	4	27	from	from	ADP
aisthesis-5428	4	28	the	the	DET
aisthesis-5428	4	29	resulting	result	VERB
aisthesis-5428	4	30	recombination	recombination	NOUN
aisthesis-5428	4	31	frequencies	frequency	NOUN
aisthesis-5428	4	32	.	.	PUNCT
aisthesis-5428	5	1	the	the	DET
aisthesis-5428	5	2	association	association	PROPN
aisthesis-5428	5	3	of	of	ADP
aisthesis-5428	5	4	trex	trex	PROPN
aisthesis-5428	5	5	with	with	ADP
aisthesis-5428	5	6	the	the	DET
aisthesis-5428	5	7	given	give	VERB
aisthesis-5428	5	8	marker	marker	NOUN
aisthesis-5428	5	9	genes	gene	NOUN
aisthesis-5428	5	10	by	by	ADP
aisthesis-5428	5	11	genetic	genetic	ADJ
aisthesis-5428	5	12	linkage	linkage	NOUN
aisthesis-5428	5	13	was	be	AUX
aisthesis-5428	5	14	analyzed	analyze	VERB
aisthesis-5428	5	15	using	use	VERB
aisthesis-5428	5	16	chi	chi	ADJ
aisthesis-5428	5	17	-	-	PUNCT
aisthesis-5428	5	18	square	square	NOUN
aisthesis-5428	5	19	analysis	analysis	NOUN
aisthesis-5428	5	20	and	and	CCONJ
aisthesis-5428	5	21	a	a	DET
aisthesis-5428	5	22	p	p	ADJ
aisthesis-5428	5	23	-	-	PUNCT
aisthesis-5428	5	24	value	value	NOUN
aisthesis-5428	5	25	test	test	NOUN
aisthesis-5428	5	26	of	of	ADP
aisthesis-5428	5	27	significance	significance	NOUN
aisthesis-5428	5	28	.	.	PUNCT
aisthesis-5428	6	1	after	after	ADP
aisthesis-5428	6	2	extracting	extract	VERB
aisthesis-5428	6	3	dna	dna	NOUN
aisthesis-5428	6	4	from	from	ADP
aisthesis-5428	6	5	wild	wild	ADJ
aisthesis-5428	6	6	type	type	NOUN
aisthesis-5428	6	7	,	,	PUNCT
aisthesis-5428	6	8	trex	trex	NOUN
aisthesis-5428	6	9	,	,	PUNCT
aisthesis-5428	6	10	and	and	CCONJ
aisthesis-5428	6	11	reciprocal	reciprocal	PROPN
aisthesis-5428	6	12	cross	cross	PROPN
aisthesis-5428	6	13	progeny	progeny	PROPN
aisthesis-5428	6	14	flies	fly	NOUN
aisthesis-5428	6	15	,	,	PUNCT
aisthesis-5428	6	16	polymerase	polymerase	NOUN
aisthesis-5428	6	17	chain	chain	NOUN
aisthesis-5428	6	18	reactions	reaction	NOUN
aisthesis-5428	6	19	and	and	CCONJ
aisthesis-5428	6	20	gel	gel	NOUN
aisthesis-5428	6	21	electrophoresis	electrophoresis	NOUN
aisthesis-5428	6	22	were	be	AUX
aisthesis-5428	6	23	performed	perform	VERB
aisthesis-5428	6	24	in	in	ADP
aisthesis-5428	6	25	order	order	NOUN
aisthesis-5428	6	26	to	to	PART
aisthesis-5428	6	27	deduce	deduce	VERB
aisthesis-5428	6	28	characteristics	characteristic	NOUN
aisthesis-5428	6	29	of	of	ADP
aisthesis-5428	6	30	the	the	DET
aisthesis-5428	6	31	mutation	mutation	NOUN
aisthesis-5428	6	32	of	of	ADP
aisthesis-5428	6	33	trex	trex	PROPN
aisthesis-5428	6	34	.	.	PUNCT
aisthesis-5428	6	35	further	far	ADV
aisthesis-5428	6	36	,	,	PUNCT
aisthesis-5428	6	37	using	use	VERB
aisthesis-5428	6	38	blast	blast	NOUN
aisthesis-5428	6	39	bioinformatic	bioinformatic	ADJ
aisthesis-5428	6	40	analyses	analysis	NOUN
aisthesis-5428	6	41	,	,	PUNCT
aisthesis-5428	6	42	wild	wild	ADJ
aisthesis-5428	6	43	-	-	PUNCT
aisthesis-5428	6	44	type	type	NOUN
aisthesis-5428	6	45	and	and	CCONJ
aisthesis-5428	6	46	trex	trex	ADJ
aisthesis-5428	6	47	gene	gene	NOUN
aisthesis-5428	6	48	sequences	sequence	NOUN
aisthesis-5428	6	49	and	and	CCONJ
aisthesis-5428	6	50	protein	protein	NOUN
aisthesis-5428	6	51	products	product	NOUN
aisthesis-5428	6	52	were	be	AUX
aisthesis-5428	6	53	compared	compare	VERB
aisthesis-5428	6	54	to	to	PART
aisthesis-5428	6	55	analyze	analyze	VERB
aisthesis-5428	6	56	the	the	DET
aisthesis-5428	6	57	molecular	molecular	ADJ
aisthesis-5428	6	58	nature	nature	NOUN
aisthesis-5428	6	59	of	of	ADP
aisthesis-5428	6	60	trex	trex	PROPN
aisthesis-5428	6	61	.	.	PROPN
aisthesis-5428	6	62	trex	trex	PROPN
aisthesis-5428	6	63	was	be	AUX
aisthesis-5428	6	64	found	find	VERB
aisthesis-5428	6	65	to	to	PART
aisthesis-5428	6	66	be	be	AUX
aisthesis-5428	6	67	inherited	inherit	VERB
aisthesis-5428	6	68	in	in	ADP
aisthesis-5428	6	69	an	an	DET
aisthesis-5428	6	70	autosomal	autosomal	ADJ
aisthesis-5428	6	71	recessive	recessive	ADJ
aisthesis-5428	6	72	pattern	pattern	NOUN
aisthesis-5428	6	73	as	as	SCONJ
aisthesis-5428	6	74	evidenced	evidence	VERB
aisthesis-5428	6	75	by	by	ADP
aisthesis-5428	6	76	the	the	DET
aisthesis-5428	6	77	results	result	NOUN
aisthesis-5428	6	78	of	of	ADP
aisthesis-5428	6	79	wtm1	wtm1	NOUN
aisthesis-5428	6	80	and	and	CCONJ
aisthesis-5428	6	81	wtm2	wtm2	NOUN
aisthesis-5428	6	82	,	,	PUNCT
aisthesis-5428	6	83	both	both	PRON
aisthesis-5428	6	84	of	of	ADP
aisthesis-5428	6	85	which	which	PRON
aisthesis-5428	6	86	produced	produce	VERB
aisthesis-5428	6	87	an	an	DET
aisthesis-5428	6	88	f1	f1	ADJ
aisthesis-5428	6	89	generation	generation	NOUN
aisthesis-5428	6	90	that	that	PRON
aisthesis-5428	6	91	displayed	display	VERB
aisthesis-5428	6	92	only	only	ADV
aisthesis-5428	6	93	the	the	DET
aisthesis-5428	6	94	wild	wild	ADJ
aisthesis-5428	6	95	-	-	PUNCT
aisthesis-5428	6	96	type	type	NOUN
aisthesis-5428	6	97	presentation	presentation	NOUN
aisthesis-5428	6	98	of	of	ADP
aisthesis-5428	6	99	wing	wing	NOUN
aisthesis-5428	6	100	morphology	morphology	NOUN
aisthesis-5428	6	101	.	.	PUNCT
aisthesis-5428	7	1	from	from	ADP
aisthesis-5428	7	2	the	the	DET
aisthesis-5428	7	3	mapping	mapping	NOUN
aisthesis-5428	7	4	crosses	crosse	NOUN
aisthesis-5428	7	5	’	'	PUNCT
aisthesis-5428	7	6	recombination	recombination	NOUN
aisthesis-5428	7	7	frequencies	frequency	NOUN
aisthesis-5428	7	8	and	and	CCONJ
aisthesis-5428	7	9	statistical	statistical	ADJ
aisthesis-5428	7	10	analysis	analysis	NOUN
aisthesis-5428	7	11	,	,	PUNCT
aisthesis-5428	7	12	it	it	PRON
aisthesis-5428	7	13	was	be	AUX
aisthesis-5428	7	14	estimated	estimate	VERB
aisthesis-5428	7	15	that	that	SCONJ
aisthesis-5428	7	16	trex	trex	PROPN
aisthesis-5428	7	17	is	be	AUX
aisthesis-5428	7	18	located	locate	VERB
aisthesis-5428	7	19	at	at	ADP
aisthesis-5428	7	20	2:68	2:68	NUM
aisthesis-5428	7	21	within	within	ADP
aisthesis-5428	7	22	the	the	DET
aisthesis-5428	7	23	genome	genome	NOUN
aisthesis-5428	7	24	.	.	PUNCT
aisthesis-5428	8	1	analysis	analysis	NOUN
aisthesis-5428	8	2	by	by	ADP
aisthesis-5428	8	3	pcr	pcr	PROPN
aisthesis-5428	8	4	and	and	CCONJ
aisthesis-5428	8	5	gel	gel	NOUN
aisthesis-5428	8	6	electrophoresis	electrophoresis	NOUN
aisthesis-5428	8	7	revealed	reveal	VERB
aisthesis-5428	8	8	that	that	SCONJ
aisthesis-5428	8	9	the	the	DET
aisthesis-5428	8	10	trex	trex	PROPN
aisthesis-5428	8	11	mutation	mutation	NOUN
aisthesis-5428	8	12	is	be	AUX
aisthesis-5428	8	13	apparent	apparent	ADJ
aisthesis-5428	8	14	as	as	ADP
aisthesis-5428	8	15	the	the	DET
aisthesis-5428	8	16	addition	addition	NOUN
aisthesis-5428	8	17	of	of	ADP
aisthesis-5428	8	18	genomic	genomic	ADJ
aisthesis-5428	8	19	material	material	NOUN
aisthesis-5428	8	20	in	in	ADP
aisthesis-5428	8	21	comparison	comparison	NOUN
aisthesis-5428	8	22	to	to	ADP
aisthesis-5428	8	23	the	the	DET
aisthesis-5428	8	24	wild	wild	ADJ
aisthesis-5428	8	25	-	-	PUNCT
aisthesis-5428	8	26	type	type	NOUN
aisthesis-5428	8	27	molecular	molecular	ADJ
aisthesis-5428	8	28	presentation	presentation	NOUN
aisthesis-5428	8	29	.	.	PUNCT
aisthesis-5428	9	1	these	these	DET
aisthesis-5428	9	2	findings	finding	NOUN
aisthesis-5428	9	3	were	be	AUX
aisthesis-5428	9	4	further	far	ADV
aisthesis-5428	9	5	supported	support	VERB
aisthesis-5428	9	6	by	by	ADP
aisthesis-5428	9	7	blast	blast	NOUN
aisthesis-5428	9	8	analysis	analysis	NOUN
aisthesis-5428	9	9	,	,	PUNCT
aisthesis-5428	9	10	which	which	PRON
aisthesis-5428	9	11	revealed	reveal	VERB
aisthesis-5428	9	12	that	that	SCONJ
aisthesis-5428	9	13	the	the	DET
aisthesis-5428	9	14	trex	trex	PROPN
aisthesis-5428	9	15	mutation	mutation	NOUN
aisthesis-5428	9	16	was	be	AUX
aisthesis-5428	9	17	due	due	ADJ
aisthesis-5428	9	18	to	to	ADP
aisthesis-5428	9	19	the	the	DET
aisthesis-5428	9	20	insertion	insertion	NOUN
aisthesis-5428	9	21	of	of	ADP
aisthesis-5428	9	22	retrotransposon	retrotransposon	NOUN
aisthesis-5428	9	23	412	412	NUM
aisthesis-5428	9	24	within	within	ADP
aisthesis-5428	9	25	the	the	DET
aisthesis-5428	9	26	coding	code	VERB
aisthesis-5428	9	27	sequence	sequence	NOUN
aisthesis-5428	9	28	.	.	PUNCT
aisthesis-5428	10	1	blast	blast	NOUN
aisthesis-5428	10	2	also	also	ADV
aisthesis-5428	10	3	revealed	reveal	VERB
aisthesis-5428	10	4	trex	trex	PROPN
aisthesis-5428	10	5	to	to	PART
aisthesis-5428	10	6	be	be	AUX
aisthesis-5428	10	7	allelic	allelic	ADJ
aisthesis-5428	10	8	to	to	ADP
aisthesis-5428	10	9	vestigial	vestigial	NOUN
aisthesis-5428	10	10	,	,	PUNCT
aisthesis-5428	10	11	which	which	PRON
aisthesis-5428	10	12	interacts	interact	VERB
aisthesis-5428	10	13	with	with	ADP
aisthesis-5428	10	14	a	a	DET
aisthesis-5428	10	15	protein	protein	NOUN
aisthesis-5428	10	16	produced	produce	VERB
aisthesis-5428	10	17	by	by	ADP
aisthesis-5428	10	18	scalloped	scalloped	ADJ
aisthesis-5428	10	19	(	(	PUNCT
aisthesis-5428	10	20	sd	sd	NOUN
aisthesis-5428	10	21	)	)	PUNCT
aisthesis-5428	10	22	,	,	PUNCT
aisthesis-5428	10	23	completing	complete	VERB
aisthesis-5428	10	24	a	a	DET
aisthesis-5428	10	25	transcription	transcription	NOUN
aisthesis-5428	10	26	factor	factor	NOUN
aisthesis-5428	10	27	complex	complex	ADJ
aisthesis-5428	10	28	regulating	regulating	ADJ
aisthesis-5428	10	29	wing	wing	NOUN
aisthesis-5428	10	30	development	development	NOUN
aisthesis-5428	10	31	.	.	PUNCT
aisthesis-5428	11	1	when	when	SCONJ
aisthesis-5428	11	2	mutated	mutate	VERB
aisthesis-5428	11	3	,	,	PUNCT
aisthesis-5428	11	4	as	as	ADP
aisthesis-5428	11	5	in	in	ADP
aisthesis-5428	11	6	trex	trex	PROPN
aisthesis-5428	11	7	flies	fly	NOUN
aisthesis-5428	11	8	,	,	PUNCT
aisthesis-5428	11	9	vestigial	vestigial	NOUN
aisthesis-5428	11	10	is	be	AUX
aisthesis-5428	11	11	unable	unable	ADJ
aisthesis-5428	11	12	to	to	PART
aisthesis-5428	11	13	perform	perform	VERB
aisthesis-5428	11	14	its	its	PRON
aisthesis-5428	11	15	normal	normal	ADJ
aisthesis-5428	11	16	function	function	NOUN
aisthesis-5428	11	17	and	and	CCONJ
aisthesis-5428	11	18	we	we	PRON
aisthesis-5428	11	19	see	see	VERB
aisthesis-5428	11	20	phenotypically	phenotypically	ADV
aisthesis-5428	11	21	abnormal	abnormal	ADJ
aisthesis-5428	11	22	wing	wing	NOUN
aisthesis-5428	11	23	formation	formation	NOUN
aisthesis-5428	11	24	.	.	PUNCT
aisthesis-5428	12	1	aisthesis	aisthesis	NOUN
aisthesis-5428	12	2	volume	volume	NOUN
aisthesis-5428	12	3	14	14	NUM
aisthesis-5428	12	4	,	,	PUNCT
aisthesis-5428	12	5	202355	202355	NUM
aisthesis-5428	12	6	analysis	analysis	NOUN
aisthesis-5428	12	7	of	of	ADP
aisthesis-5428	12	8	novel	novel	ADJ
aisthesis-5428	12	9	unknown	unknown	ADJ
aisthesis-5428	12	10	d.	d.	NOUN
aisthesis-5428	12	11	melanogaster	melanogaster	NOUN
aisthesis-5428	12	12	mutation	mutation	NOUN
aisthesis-5428	12	13	trex	trex	PROPN
aisthesis-5428	12	14	by	by	ADP
aisthesis-5428	12	15	sallianne	sallianne	PROPN
aisthesis-5428	12	16	roher	roher	PROPN
aisthesis-5428	12	17	introduction	introduction	NOUN
aisthesis-5428	12	18	:	:	PUNCT
aisthesis-5428	12	19	d.	d.	NOUN
aisthesis-5428	12	20	melanogaster	melanogaster	NOUN
aisthesis-5428	12	21	has	have	AUX
aisthesis-5428	12	22	long	long	ADV
aisthesis-5428	12	23	been	be	AUX
aisthesis-5428	12	24	utilized	utilize	VERB
aisthesis-5428	12	25	as	as	ADP
aisthesis-5428	12	26	a	a	DET
aisthesis-5428	12	27	model	model	NOUN
aisthesis-5428	12	28	organism	organism	NOUN
aisthesis-5428	12	29	in	in	ADP
aisthesis-5428	12	30	genetic	genetic	ADJ
aisthesis-5428	12	31	research	research	NOUN
aisthesis-5428	12	32	for	for	ADP
aisthesis-5428	12	33	its	its	PRON
aisthesis-5428	12	34	low	low	ADJ
aisthesis-5428	12	35	cost	cost	NOUN
aisthesis-5428	12	36	and	and	CCONJ
aisthesis-5428	12	37	quick	quick	ADJ
aisthesis-5428	12	38	life	life	NOUN
aisthesis-5428	12	39	and	and	CCONJ
aisthesis-5428	12	40	reproductive	reproductive	ADJ
aisthesis-5428	12	41	cycles	cycle	NOUN
aisthesis-5428	12	42	.	.	PUNCT
aisthesis-5428	13	1	the	the	DET
aisthesis-5428	13	2	genome	genome	NOUN
aisthesis-5428	13	3	of	of	ADP
aisthesis-5428	13	4	drosophila	drosophila	NOUN
aisthesis-5428	13	5	has	have	AUX
aisthesis-5428	13	6	been	be	AUX
aisthesis-5428	13	7	studied	study	VERB
aisthesis-5428	13	8	and	and	CCONJ
aisthesis-5428	13	9	mapped	map	VERB
aisthesis-5428	13	10	extensively	extensively	ADV
aisthesis-5428	13	11	,	,	PUNCT
aisthesis-5428	13	12	allowing	allow	VERB
aisthesis-5428	13	13	scientists	scientist	NOUN
aisthesis-5428	13	14	to	to	PART
aisthesis-5428	13	15	further	far	ADV
aisthesis-5428	13	16	understand	understand	VERB
aisthesis-5428	13	17	mechanisms	mechanism	NOUN
aisthesis-5428	13	18	of	of	ADP
aisthesis-5428	13	19	inheritance	inheritance	NOUN
aisthesis-5428	13	20	.	.	PUNCT
aisthesis-5428	14	1	by	by	ADP
aisthesis-5428	14	2	understanding	understand	VERB
aisthesis-5428	14	3	the	the	DET
aisthesis-5428	14	4	function	function	NOUN
aisthesis-5428	14	5	of	of	ADP
aisthesis-5428	14	6	vestigial	vestigial	NOUN
aisthesis-5428	14	7	and	and	CCONJ
aisthesis-5428	14	8	other	other	ADJ
aisthesis-5428	14	9	genes	gene	NOUN
aisthesis-5428	14	10	in	in	ADP
aisthesis-5428	14	11	the	the	DET
aisthesis-5428	14	12	d.	d.	NOUN
aisthesis-5428	14	13	melanogaster	melanogaster	NOUN
aisthesis-5428	14	14	genome	genome	NOUN
aisthesis-5428	14	15	,	,	PUNCT
aisthesis-5428	14	16	we	we	PRON
aisthesis-5428	14	17	may	may	AUX
aisthesis-5428	14	18	have	have	VERB
aisthesis-5428	14	19	further	further	ADJ
aisthesis-5428	14	20	understanding	understanding	NOUN
aisthesis-5428	14	21	of	of	ADP
aisthesis-5428	14	22	their	their	PRON
aisthesis-5428	14	23	human	human	ADJ
aisthesis-5428	14	24	orthologs	ortholog	NOUN
aisthesis-5428	14	25	like	like	ADP
aisthesis-5428	14	26	the	the	DET
aisthesis-5428	14	27	vestigial	vestigial	ADJ
aisthesis-5428	14	28	-	-	PUNCT
aisthesis-5428	14	29	like	like	ADJ
aisthesis-5428	14	30	gene	gene	NOUN
aisthesis-5428	14	31	family	family	NOUN
aisthesis-5428	14	32	(	(	PUNCT
aisthesis-5428	14	33	vgll	vgll	PROPN
aisthesis-5428	14	34	)	)	PUNCT
aisthesis-5428	14	35	and	and	CCONJ
aisthesis-5428	14	36	the	the	DET
aisthesis-5428	14	37	medically	medically	ADV
aisthesis-5428	14	38	relevant	relevant	ADJ
aisthesis-5428	14	39	effects	effect	NOUN
aisthesis-5428	14	40	of	of	ADP
aisthesis-5428	14	41	their	their	PRON
aisthesis-5428	14	42	mutations	mutation	NOUN
aisthesis-5428	14	43	.	.	PUNCT
aisthesis-5428	15	1	vestigial	vestigial	ADJ
aisthesis-5428	15	2	aids	aid	NOUN
aisthesis-5428	15	3	in	in	ADP
aisthesis-5428	15	4	the	the	DET
aisthesis-5428	15	5	specification	specification	NOUN
aisthesis-5428	15	6	of	of	ADP
aisthesis-5428	15	7	wing	wing	NOUN
aisthesis-5428	15	8	cells	cell	NOUN
aisthesis-5428	15	9	and	and	CCONJ
aisthesis-5428	15	10	the	the	DET
aisthesis-5428	15	11	proliferation	proliferation	NOUN
aisthesis-5428	15	12	of	of	ADP
aisthesis-5428	15	13	such	such	ADJ
aisthesis-5428	15	14	cells	cell	NOUN
aisthesis-5428	15	15	,	,	PUNCT
aisthesis-5428	15	16	leading	lead	VERB
aisthesis-5428	15	17	to	to	ADP
aisthesis-5428	15	18	the	the	DET
aisthesis-5428	15	19	fully	fully	ADV
aisthesis-5428	15	20	formed	form	VERB
aisthesis-5428	15	21	wing	wing	NOUN
aisthesis-5428	15	22	and	and	CCONJ
aisthesis-5428	15	23	halteres	halter	NOUN
aisthesis-5428	15	24	observed	observe	VERB
aisthesis-5428	15	25	in	in	ADP
aisthesis-5428	15	26	wild	wild	ADJ
aisthesis-5428	15	27	-	-	PUNCT
aisthesis-5428	15	28	type	type	NOUN
aisthesis-5428	15	29	d.	d.	NOUN
aisthesis-5428	15	30	melanogaster	melanogaster	NOUN
aisthesis-5428	15	31	(	(	PUNCT
aisthesis-5428	15	32	simmonds	simmond	NOUN
aisthesis-5428	15	33	et	et	PROPN
aisthesis-5428	15	34	al	al	PROPN
aisthesis-5428	15	35	.	.	PROPN
aisthesis-5428	15	36	1997	1997	NUM
aisthesis-5428	15	37	)	)	PUNCT
aisthesis-5428	15	38	.	.	PUNCT
aisthesis-5428	16	1	vestigial	vestigial	ADJ
aisthesis-5428	16	2	associates	associate	NOUN
aisthesis-5428	16	3	using	use	VERB
aisthesis-5428	16	4	a	a	DET
aisthesis-5428	16	5	tdu	tdu	NOUN
aisthesis-5428	16	6	motif	motif	NOUN
aisthesis-5428	16	7	to	to	ADP
aisthesis-5428	16	8	a	a	DET
aisthesis-5428	16	9	transcription	transcription	NOUN
aisthesis-5428	16	10	factor	factor	NOUN
aisthesis-5428	16	11	produced	produce	VERB
aisthesis-5428	16	12	by	by	ADP
aisthesis-5428	16	13	the	the	DET
aisthesis-5428	16	14	gene	gene	NOUN
aisthesis-5428	16	15	scalloped	scallop	VERB
aisthesis-5428	16	16	(	(	PUNCT
aisthesis-5428	16	17	sd	sd	NOUN
aisthesis-5428	16	18	)	)	PUNCT
aisthesis-5428	16	19	,	,	PUNCT
aisthesis-5428	16	20	which	which	PRON
aisthesis-5428	16	21	has	have	VERB
aisthesis-5428	16	22	a	a	DET
aisthesis-5428	16	23	tea	tea	NOUN
aisthesis-5428	16	24	/	/	SYM
aisthesis-5428	16	25	atss	atss	NOUN
aisthesis-5428	16	26	-	-	PUNCT
aisthesis-5428	16	27	dna	dna	NOUN
aisthesis-5428	16	28	-	-	PUNCT
aisthesis-5428	16	29	binding	bind	VERB
aisthesis-5428	16	30	domain	domain	NOUN
aisthesis-5428	16	31	(	(	PUNCT
aisthesis-5428	16	32	tead	tead	PROPN
aisthesis-5428	16	33	)	)	PUNCT
aisthesis-5428	16	34	(	(	PUNCT
aisthesis-5428	16	35	yamaguchi	yamaguchi	PROPN
aisthesis-5428	16	36	2020	2020	NUM
aisthesis-5428	16	37	)	)	PUNCT
aisthesis-5428	16	38	.	.	PUNCT
aisthesis-5428	17	1	as	as	ADP
aisthesis-5428	17	2	a	a	DET
aisthesis-5428	17	3	transcription	transcription	NOUN
aisthesis-5428	17	4	factor	factor	NOUN
aisthesis-5428	17	5	complex	complex	NOUN
aisthesis-5428	17	6	,	,	PUNCT
aisthesis-5428	17	7	the	the	DET
aisthesis-5428	17	8	vg	vg	NOUN
aisthesis-5428	17	9	-	-	PUNCT
aisthesis-5428	17	10	sd	sd	NOUN
aisthesis-5428	17	11	complex	complex	NOUN
aisthesis-5428	17	12	is	be	AUX
aisthesis-5428	17	13	then	then	ADV
aisthesis-5428	17	14	able	able	ADJ
aisthesis-5428	17	15	to	to	PART
aisthesis-5428	17	16	regulate	regulate	VERB
aisthesis-5428	17	17	the	the	DET
aisthesis-5428	17	18	binding	binding	NOUN
aisthesis-5428	17	19	of	of	ADP
aisthesis-5428	17	20	rna	rna	NOUN
aisthesis-5428	17	21	polymerase	polymerase	NOUN
aisthesis-5428	17	22	and	and	CCONJ
aisthesis-5428	17	23	thus	thus	ADV
aisthesis-5428	17	24	the	the	DET
aisthesis-5428	17	25	subsequent	subsequent	ADJ
aisthesis-5428	17	26	translation	translation	NOUN
aisthesis-5428	17	27	of	of	ADP
aisthesis-5428	17	28	genes	gene	NOUN
aisthesis-5428	17	29	pertaining	pertain	VERB
aisthesis-5428	17	30	to	to	ADP
aisthesis-5428	17	31	the	the	DET
aisthesis-5428	17	32	specification	specification	NOUN
aisthesis-5428	17	33	of	of	ADP
aisthesis-5428	17	34	wing	wing	NOUN
aisthesis-5428	17	35	cells	cell	NOUN
aisthesis-5428	17	36	and	and	CCONJ
aisthesis-5428	17	37	their	their	PRON
aisthesis-5428	17	38	proliferation	proliferation	NOUN
aisthesis-5428	17	39	(	(	PUNCT
aisthesis-5428	17	40	yamaguchi	yamaguchi	PROPN
aisthesis-5428	17	41	2020	2020	NUM
aisthesis-5428	17	42	)	)	PUNCT
aisthesis-5428	17	43	.	.	PUNCT
aisthesis-5428	18	1	for	for	ADP
aisthesis-5428	18	2	example	example	NOUN
aisthesis-5428	18	3	,	,	PUNCT
aisthesis-5428	18	4	the	the	DET
aisthesis-5428	18	5	expression	expression	NOUN
aisthesis-5428	18	6	of	of	ADP
aisthesis-5428	18	7	d.	d.	NOUN
aisthesis-5428	18	8	melanogaster	melanogaster	NOUN
aisthesis-5428	18	9	genes	gene	NOUN
aisthesis-5428	18	10	cut	cut	VERB
aisthesis-5428	18	11	and	and	CCONJ
aisthesis-5428	18	12	serum	serum	NOUN
aisthesis-5428	18	13	response	response	NOUN
aisthesis-5428	18	14	factor	factor	NOUN
aisthesis-5428	18	15	(	(	PUNCT
aisthesis-5428	18	16	srf	srf	PROPN
aisthesis-5428	18	17	)	)	PUNCT
aisthesis-5428	18	18	are	be	AUX
aisthesis-5428	18	19	activated	activate	VERB
aisthesis-5428	18	20	by	by	ADP
aisthesis-5428	18	21	the	the	DET
aisthesis-5428	18	22	vg	vg	ADJ
aisthesis-5428	18	23	-	-	PUNCT
aisthesis-5428	18	24	sd	sd	NOUN
aisthesis-5428	18	25	complex	complex	NOUN
aisthesis-5428	18	26	and	and	CCONJ
aisthesis-5428	18	27	then	then	ADV
aisthesis-5428	18	28	play	play	VERB
aisthesis-5428	18	29	integral	integral	ADJ
aisthesis-5428	18	30	roles	role	NOUN
aisthesis-5428	18	31	in	in	ADP
aisthesis-5428	18	32	the	the	DET
aisthesis-5428	18	33	development	development	NOUN
aisthesis-5428	18	34	of	of	ADP
aisthesis-5428	18	35	normal	normal	ADJ
aisthesis-5428	18	36	wing	wing	NOUN
aisthesis-5428	18	37	morphology	morphology	NOUN
aisthesis-5428	18	38	(	(	PUNCT
aisthesis-5428	18	39	figure	figure	NOUN
aisthesis-5428	18	40	1a	1a	NOUN
aisthesis-5428	18	41	)	)	PUNCT
aisthesis-5428	18	42	(	(	PUNCT
aisthesis-5428	18	43	halter	halter	NOUN
aisthesis-5428	18	44	et	et	NOUN
aisthesis-5428	18	45	al.1998	al.1998	PROPN
aisthesis-5428	18	46	)	)	PUNCT
aisthesis-5428	18	47	.	.	PUNCT
aisthesis-5428	19	1	a	a	DET
aisthesis-5428	19	2	mutation	mutation	NOUN
aisthesis-5428	19	3	in	in	ADP
aisthesis-5428	19	4	the	the	DET
aisthesis-5428	19	5	vestigial	vestigial	ADJ
aisthesis-5428	19	6	gene	gene	NOUN
aisthesis-5428	19	7	leads	lead	VERB
aisthesis-5428	19	8	to	to	ADP
aisthesis-5428	19	9	abnormal	abnormal	ADJ
aisthesis-5428	19	10	wing	wing	NOUN
aisthesis-5428	19	11	/	/	SYM
aisthesis-5428	19	12	haltere	haltere	NOUN
aisthesis-5428	19	13	development	development	NOUN
aisthesis-5428	19	14	,	,	PUNCT
aisthesis-5428	19	15	as	as	SCONJ
aisthesis-5428	19	16	the	the	DET
aisthesis-5428	19	17	dna	dna	NOUN
aisthesis-5428	19	18	required	require	VERB
aisthesis-5428	19	19	for	for	ADP
aisthesis-5428	19	20	proper	proper	ADJ
aisthesis-5428	19	21	wing	wing	NOUN
aisthesis-5428	19	22	development	development	NOUN
aisthesis-5428	19	23	is	be	AUX
aisthesis-5428	19	24	not	not	PART
aisthesis-5428	19	25	expressed	express	VERB
aisthesis-5428	19	26	(	(	PUNCT
aisthesis-5428	19	27	williams	williams	PROPN
aisthesis-5428	19	28	et	et	PROPN
aisthesis-5428	19	29	al	al	PROPN
aisthesis-5428	19	30	.	.	PROPN
aisthesis-5428	19	31	1990	1990	NUM
aisthesis-5428	19	32	)	)	PUNCT
aisthesis-5428	19	33	.	.	PUNCT
aisthesis-5428	20	1	as	as	ADP
aisthesis-5428	20	2	such	such	ADJ
aisthesis-5428	20	3	,	,	PUNCT
aisthesis-5428	20	4	these	these	DET
aisthesis-5428	20	5	flies	fly	NOUN
aisthesis-5428	20	6	have	have	VERB
aisthesis-5428	20	7	phenotypically	phenotypically	ADV
aisthesis-5428	20	8	smaller	small	ADJ
aisthesis-5428	20	9	wings	wing	NOUN
aisthesis-5428	20	10	that	that	PRON
aisthesis-5428	20	11	have	have	VERB
aisthesis-5428	20	12	a	a	DET
aisthesis-5428	20	13	crumpled	crumpled	ADJ
aisthesis-5428	20	14	appearance	appearance	NOUN
aisthesis-5428	20	15	and	and	CCONJ
aisthesis-5428	20	16	lie	lie	VERB
aisthesis-5428	20	17	perpendicular	perpendicular	NOUN
aisthesis-5428	20	18	to	to	ADP
aisthesis-5428	20	19	the	the	DET
aisthesis-5428	20	20	anteroposterior	anteroposterior	ADJ
aisthesis-5428	20	21	axis	axis	NOUN
aisthesis-5428	20	22	of	of	ADP
aisthesis-5428	20	23	the	the	DET
aisthesis-5428	20	24	fly	fly	NOUN
aisthesis-5428	20	25	rather	rather	ADV
aisthesis-5428	20	26	than	than	ADP
aisthesis-5428	20	27	lying	lie	VERB
aisthesis-5428	20	28	flat	flat	ADJ
aisthesis-5428	20	29	.	.	PUNCT
aisthesis-5428	21	1	analysis	analysis	NOUN
aisthesis-5428	21	2	of	of	ADP
aisthesis-5428	21	3	novel	novel	ADJ
aisthesis-5428	21	4	unknown	unknown	ADJ
aisthesis-5428	21	5	d.	d.	NOUN
aisthesis-5428	21	6	melanogaster	melanogaster	NOUN
aisthesis-5428	21	7	mutation	mutation	NOUN
aisthesis-5428	21	8	trex	trex	PROPN
aisthesis-5428	21	9	aisthesis	aisthesis	NOUN
aisthesis-5428	21	10	volume	volume	NOUN
aisthesis-5428	21	11	14	14	NUM
aisthesis-5428	21	12	,	,	PUNCT
aisthesis-5428	21	13	202356	202356	NUM
aisthesis-5428	21	14	in	in	ADP
aisthesis-5428	21	15	this	this	DET
aisthesis-5428	21	16	study	study	NOUN
aisthesis-5428	21	17	,	,	PUNCT
aisthesis-5428	21	18	two	two	NUM
aisthesis-5428	21	19	strains	strain	NOUN
aisthesis-5428	21	20	of	of	ADP
aisthesis-5428	21	21	drosophila	drosophila	NOUN
aisthesis-5428	21	22	melanogaster	melanogaster	NOUN
aisthesis-5428	21	23	were	be	AUX
aisthesis-5428	21	24	studied	study	VERB
aisthesis-5428	21	25	,	,	PUNCT
aisthesis-5428	21	26	one	one	NUM
aisthesis-5428	21	27	wild	wild	ADJ
aisthesis-5428	21	28	-	-	PUNCT
aisthesis-5428	21	29	type	type	NOUN
aisthesis-5428	21	30	strain	strain	NOUN
aisthesis-5428	21	31	and	and	CCONJ
aisthesis-5428	21	32	a	a	DET
aisthesis-5428	21	33	strain	strain	NOUN
aisthesis-5428	21	34	of	of	ADP
aisthesis-5428	21	35	an	an	DET
aisthesis-5428	21	36	unidentified	unidentified	ADJ
aisthesis-5428	21	37	mutation	mutation	NOUN
aisthesis-5428	21	38	with	with	ADP
aisthesis-5428	21	39	similar	similar	ADJ
aisthesis-5428	21	40	morphology	morphology	NOUN
aisthesis-5428	21	41	to	to	ADP
aisthesis-5428	21	42	a	a	DET
aisthesis-5428	21	43	vestigial	vestigial	ADJ
aisthesis-5428	21	44	mutation	mutation	NOUN
aisthesis-5428	21	45	,	,	PUNCT
aisthesis-5428	21	46	in	in	ADP
aisthesis-5428	21	47	order	order	NOUN
aisthesis-5428	21	48	to	to	PART
aisthesis-5428	21	49	understand	understand	VERB
aisthesis-5428	21	50	and	and	CCONJ
aisthesis-5428	21	51	explore	explore	VERB
aisthesis-5428	21	52	the	the	DET
aisthesis-5428	21	53	nature	nature	NOUN
aisthesis-5428	21	54	and	and	CCONJ
aisthesis-5428	21	55	characteristics	characteristic	NOUN
aisthesis-5428	21	56	of	of	ADP
aisthesis-5428	21	57	the	the	DET
aisthesis-5428	21	58	given	give	VERB
aisthesis-5428	21	59	mutation	mutation	NOUN
aisthesis-5428	21	60	.	.	PUNCT
aisthesis-5428	22	1	the	the	DET
aisthesis-5428	22	2	mutant	mutant	ADJ
aisthesis-5428	22	3	strain	strain	NOUN
aisthesis-5428	22	4	was	be	AUX
aisthesis-5428	22	5	given	give	VERB
aisthesis-5428	22	6	the	the	DET
aisthesis-5428	22	7	name	name	NOUN
aisthesis-5428	22	8	“	"	PUNCT
aisthesis-5428	22	9	trex	trex	PROPN
aisthesis-5428	22	10	”	"	PUNCT
aisthesis-5428	22	11	on	on	ADP
aisthesis-5428	22	12	account	account	NOUN
aisthesis-5428	22	13	of	of	ADP
aisthesis-5428	22	14	the	the	DET
aisthesis-5428	22	15	small	small	ADJ
aisthesis-5428	22	16	and	and	CCONJ
aisthesis-5428	22	17	protruding	protruding	ADJ
aisthesis-5428	22	18	shape	shape	NOUN
aisthesis-5428	22	19	of	of	ADP
aisthesis-5428	22	20	the	the	DET
aisthesis-5428	22	21	wings	wing	NOUN
aisthesis-5428	22	22	,	,	PUNCT
aisthesis-5428	22	23	similar	similar	ADJ
aisthesis-5428	22	24	to	to	ADP
aisthesis-5428	22	25	the	the	DET
aisthesis-5428	22	26	short	short	ADJ
aisthesis-5428	22	27	,	,	PUNCT
aisthesis-5428	22	28	protruding	protrude	VERB
aisthesis-5428	22	29	arms	arm	NOUN
aisthesis-5428	22	30	of	of	ADP
aisthesis-5428	22	31	a	a	DET
aisthesis-5428	22	32	t.	t.	PROPN
aisthesis-5428	22	33	rex	rex	PROPN
aisthesis-5428	22	34	(	(	PUNCT
aisthesis-5428	22	35	figure	figure	NOUN
aisthesis-5428	22	36	2b	2b	NOUN
aisthesis-5428	22	37	)	)	PUNCT
aisthesis-5428	22	38	.	.	PUNCT
aisthesis-5428	23	1	further	far	ADV
aisthesis-5428	23	2	,	,	PUNCT
aisthesis-5428	23	3	it	it	PRON
aisthesis-5428	23	4	was	be	AUX
aisthesis-5428	23	5	hypothesized	hypothesize	VERB
aisthesis-5428	23	6	that	that	SCONJ
aisthesis-5428	23	7	the	the	DET
aisthesis-5428	23	8	trex	trex	PROPN
aisthesis-5428	23	9	mutation	mutation	NOUN
aisthesis-5428	23	10	was	be	AUX
aisthesis-5428	23	11	associated	associate	VERB
aisthesis-5428	23	12	with	with	ADP
aisthesis-5428	23	13	the	the	DET
aisthesis-5428	23	14	vestigial	vestigial	ADJ
aisthesis-5428	23	15	gene	gene	NOUN
aisthesis-5428	23	16	because	because	SCONJ
aisthesis-5428	23	17	of	of	ADP
aisthesis-5428	23	18	the	the	DET
aisthesis-5428	23	19	vestigial	vestigial	ADJ
aisthesis-5428	23	20	-	-	PUNCT
aisthesis-5428	23	21	like	like	ADJ
aisthesis-5428	23	22	presentation	presentation	NOUN
aisthesis-5428	23	23	of	of	ADP
aisthesis-5428	23	24	trex	trex	PROPN
aisthesis-5428	23	25	flies	fly	NOUN
aisthesis-5428	23	26	’	'	PUNCT
aisthesis-5428	23	27	phenotype	phenotype	NOUN
aisthesis-5428	23	28	.	.	PUNCT
aisthesis-5428	24	1	each	each	DET
aisthesis-5428	24	2	strain	strain	NOUN
aisthesis-5428	24	3	of	of	ADP
aisthesis-5428	24	4	flies	fly	NOUN
aisthesis-5428	24	5	was	be	AUX
aisthesis-5428	24	6	cultured	cultured	ADJ
aisthesis-5428	24	7	,	,	PUNCT
aisthesis-5428	24	8	and	and	CCONJ
aisthesis-5428	24	9	their	their	PRON
aisthesis-5428	24	10	phenotypic	phenotypic	ADJ
aisthesis-5428	24	11	differences	difference	NOUN
aisthesis-5428	24	12	were	be	AUX
aisthesis-5428	24	13	observed	observe	VERB
aisthesis-5428	24	14	and	and	CCONJ
aisthesis-5428	24	15	compared	compare	VERB
aisthesis-5428	24	16	.	.	PUNCT
aisthesis-5428	25	1	reciprocal	reciprocal	ADJ
aisthesis-5428	25	2	crosses	crosse	NOUN
aisthesis-5428	25	3	were	be	AUX
aisthesis-5428	25	4	then	then	ADV
aisthesis-5428	25	5	performed	perform	VERB
aisthesis-5428	25	6	between	between	ADP
aisthesis-5428	25	7	the	the	DET
aisthesis-5428	25	8	strains	strain	NOUN
aisthesis-5428	25	9	to	to	PART
aisthesis-5428	25	10	determine	determine	VERB
aisthesis-5428	25	11	the	the	DET
aisthesis-5428	25	12	mode	mode	NOUN
aisthesis-5428	25	13	of	of	ADP
aisthesis-5428	25	14	inheritance	inheritance	NOUN
aisthesis-5428	25	15	of	of	ADP
aisthesis-5428	25	16	the	the	DET
aisthesis-5428	25	17	trex	trex	PROPN
aisthesis-5428	25	18	mutation	mutation	NOUN
aisthesis-5428	25	19	.	.	PUNCT
aisthesis-5428	26	1	mapping	mapping	NOUN
aisthesis-5428	26	2	crosses	crosse	NOUN
aisthesis-5428	26	3	were	be	AUX
aisthesis-5428	26	4	also	also	ADV
aisthesis-5428	26	5	performed	perform	VERB
aisthesis-5428	26	6	to	to	PART
aisthesis-5428	26	7	determine	determine	VERB
aisthesis-5428	26	8	the	the	DET
aisthesis-5428	26	9	chromosomal	chromosomal	ADJ
aisthesis-5428	26	10	location	location	NOUN
aisthesis-5428	26	11	of	of	ADP
aisthesis-5428	26	12	the	the	DET
aisthesis-5428	26	13	trex	trex	PROPN
aisthesis-5428	26	14	gene	gene	NOUN
aisthesis-5428	26	15	.	.	PUNCT
aisthesis-5428	27	1	the	the	DET
aisthesis-5428	27	2	molecular	molecular	ADJ
aisthesis-5428	27	3	nature	nature	NOUN
aisthesis-5428	27	4	of	of	ADP
aisthesis-5428	27	5	the	the	DET
aisthesis-5428	27	6	trex	trex	PROPN
aisthesis-5428	27	7	mutation	mutation	NOUN
aisthesis-5428	27	8	was	be	AUX
aisthesis-5428	27	9	analyzed	analyze	VERB
aisthesis-5428	27	10	after	after	ADP
aisthesis-5428	27	11	extracting	extract	VERB
aisthesis-5428	27	12	dna	dna	PROPN
aisthesis-5428	27	13	from	from	ADP
aisthesis-5428	27	14	trex	trex	PROPN
aisthesis-5428	27	15	,	,	PUNCT
aisthesis-5428	27	16	wildtype	wildtype	NOUN
aisthesis-5428	27	17	,	,	PUNCT
aisthesis-5428	27	18	and	and	CCONJ
aisthesis-5428	27	19	reciprocal	reciprocal	PROPN
aisthesis-5428	27	20	cross	cross	NOUN
aisthesis-5428	27	21	progeny	progeny	NOUN
aisthesis-5428	27	22	and	and	CCONJ
aisthesis-5428	27	23	performing	perform	VERB
aisthesis-5428	27	24	polymerase	polymerase	NOUN
aisthesis-5428	27	25	chain	chain	NOUN
aisthesis-5428	27	26	reaction	reaction	NOUN
aisthesis-5428	27	27	on	on	ADP
aisthesis-5428	27	28	the	the	DET
aisthesis-5428	27	29	samples	sample	NOUN
aisthesis-5428	27	30	to	to	PART
aisthesis-5428	27	31	isolate	isolate	VERB
aisthesis-5428	27	32	the	the	DET
aisthesis-5428	27	33	dna	dna	PROPN
aisthesis-5428	27	34	fragments	fragment	NOUN
aisthesis-5428	27	35	of	of	ADP
aisthesis-5428	27	36	interest	interest	NOUN
aisthesis-5428	27	37	.	.	PUNCT
aisthesis-5428	28	1	samples	sample	NOUN
aisthesis-5428	28	2	were	be	AUX
aisthesis-5428	28	3	then	then	ADV
aisthesis-5428	28	4	subject	subject	ADJ
aisthesis-5428	28	5	to	to	ADP
aisthesis-5428	28	6	gel	gel	NOUN
aisthesis-5428	28	7	electrophoresis	electrophoresis	NOUN
aisthesis-5428	28	8	and	and	CCONJ
aisthesis-5428	28	9	comparison	comparison	NOUN
aisthesis-5428	28	10	via	via	ADP
aisthesis-5428	28	11	blast	blast	NOUN
aisthesis-5428	28	12	analysis	analysis	NOUN
aisthesis-5428	28	13	in	in	ADP
aisthesis-5428	28	14	order	order	NOUN
aisthesis-5428	28	15	to	to	PART
aisthesis-5428	28	16	determine	determine	VERB
aisthesis-5428	28	17	the	the	DET
aisthesis-5428	28	18	nature	nature	NOUN
aisthesis-5428	28	19	of	of	ADP
aisthesis-5428	28	20	the	the	DET
aisthesis-5428	28	21	trex	trex	PROPN
aisthesis-5428	28	22	mutation	mutation	NOUN
aisthesis-5428	28	23	on	on	ADP
aisthesis-5428	28	24	a	a	DET
aisthesis-5428	28	25	molecular	molecular	ADJ
aisthesis-5428	28	26	level	level	NOUN
aisthesis-5428	28	27	and	and	CCONJ
aisthesis-5428	28	28	how	how	SCONJ
aisthesis-5428	28	29	it	it	PRON
aisthesis-5428	28	30	might	might	AUX
aisthesis-5428	28	31	lead	lead	VERB
aisthesis-5428	28	32	to	to	ADP
aisthesis-5428	28	33	the	the	DET
aisthesis-5428	28	34	mutant	mutant	ADJ
aisthesis-5428	28	35	phenotype	phenotype	NOUN
aisthesis-5428	28	36	and	and	CCONJ
aisthesis-5428	28	37	its	its	PRON
aisthesis-5428	28	38	connection	connection	NOUN
aisthesis-5428	28	39	with	with	ADP
aisthesis-5428	28	40	possible	possible	ADJ
aisthesis-5428	28	41	human	human	ADJ
aisthesis-5428	28	42	orthologs	ortholog	NOUN
aisthesis-5428	28	43	.	.	PUNCT
aisthesis-5428	29	1	materials	material	NOUN
aisthesis-5428	29	2	and	and	CCONJ
aisthesis-5428	29	3	methods	method	NOUN
aisthesis-5428	29	4	:	:	PUNCT
aisthesis-5428	29	5	a.	a.	NOUN
aisthesis-5428	29	6	overview	overview	VERB
aisthesis-5428	29	7	true	true	ADJ
aisthesis-5428	29	8	breeding	breeding	NOUN
aisthesis-5428	29	9	strains	strain	NOUN
aisthesis-5428	29	10	of	of	ADP
aisthesis-5428	29	11	trex	trex	ADJ
aisthesis-5428	29	12	and	and	CCONJ
aisthesis-5428	29	13	wild	wild	ADJ
aisthesis-5428	29	14	-	-	PUNCT
aisthesis-5428	29	15	type	type	NOUN
aisthesis-5428	29	16	(	(	PUNCT
aisthesis-5428	29	17	wt	wt	NOUN
aisthesis-5428	29	18	)	)	PUNCT
aisthesis-5428	29	19	drosophila	drosophila	NOUN
aisthesis-5428	29	20	flies	fly	NOUN
aisthesis-5428	29	21	were	be	AUX
aisthesis-5428	29	22	raised	raise	VERB
aisthesis-5428	29	23	and	and	CCONJ
aisthesis-5428	29	24	manipulated	manipulate	VERB
aisthesis-5428	29	25	in	in	ADP
aisthesis-5428	29	26	controlled	control	VERB
aisthesis-5428	29	27	conditions	condition	NOUN
aisthesis-5428	29	28	,	,	PUNCT
aisthesis-5428	29	29	and	and	CCONJ
aisthesis-5428	29	30	then	then	ADV
aisthesis-5428	29	31	used	use	VERB
aisthesis-5428	29	32	in	in	ADP
aisthesis-5428	29	33	various	various	ADJ
aisthesis-5428	29	34	crosses	crosse	NOUN
aisthesis-5428	29	35	.	.	PUNCT
aisthesis-5428	30	1	at	at	ADP
aisthesis-5428	30	2	all	all	DET
aisthesis-5428	30	3	stages	stage	NOUN
aisthesis-5428	30	4	of	of	ADP
aisthesis-5428	30	5	development	development	NOUN
aisthesis-5428	30	6	,	,	PUNCT
aisthesis-5428	30	7	the	the	DET
aisthesis-5428	30	8	flies	fly	NOUN
aisthesis-5428	30	9	were	be	AUX
aisthesis-5428	30	10	observed	observe	VERB
aisthesis-5428	30	11	in	in	ADP
aisthesis-5428	30	12	order	order	NOUN
aisthesis-5428	30	13	to	to	PART
aisthesis-5428	30	14	compare	compare	VERB
aisthesis-5428	30	15	the	the	DET
aisthesis-5428	30	16	phenotypic	phenotypic	ADJ
aisthesis-5428	30	17	differences	difference	NOUN
aisthesis-5428	30	18	between	between	ADP
aisthesis-5428	30	19	wild	wild	ADJ
aisthesis-5428	30	20	-	-	PUNCT
aisthesis-5428	30	21	type	type	NOUN
aisthesis-5428	30	22	and	and	CCONJ
aisthesis-5428	30	23	trex	trex	NOUN
aisthesis-5428	30	24	flies	fly	NOUN
aisthesis-5428	30	25	.	.	PUNCT
aisthesis-5428	31	1	crosses	crosse	NOUN
aisthesis-5428	31	2	between	between	ADP
aisthesis-5428	31	3	the	the	DET
aisthesis-5428	31	4	two	two	NUM
aisthesis-5428	31	5	strains	strain	NOUN
aisthesis-5428	31	6	were	be	AUX
aisthesis-5428	31	7	performed	perform	VERB
aisthesis-5428	31	8	in	in	ADP
aisthesis-5428	31	9	order	order	NOUN
aisthesis-5428	31	10	to	to	PART
aisthesis-5428	31	11	determine	determine	VERB
aisthesis-5428	31	12	the	the	DET
aisthesis-5428	31	13	mode	mode	NOUN
aisthesis-5428	31	14	of	of	ADP
aisthesis-5428	31	15	inheritance	inheritance	NOUN
aisthesis-5428	31	16	of	of	ADP
aisthesis-5428	31	17	trex	trex	PROPN
aisthesis-5428	31	18	and	and	CCONJ
aisthesis-5428	31	19	the	the	DET
aisthesis-5428	31	20	location	location	NOUN
aisthesis-5428	31	21	of	of	ADP
aisthesis-5428	31	22	the	the	DET
aisthesis-5428	31	23	gene	gene	NOUN
aisthesis-5428	31	24	within	within	ADP
aisthesis-5428	31	25	the	the	DET
aisthesis-5428	31	26	d.	d.	NOUN
aisthesis-5428	31	27	melanogaster	melanogaster	NOUN
aisthesis-5428	31	28	genome	genome	NOUN
aisthesis-5428	31	29	.	.	PUNCT
aisthesis-5428	32	1	the	the	DET
aisthesis-5428	32	2	offspring	offspring	NOUN
aisthesis-5428	32	3	of	of	ADP
aisthesis-5428	32	4	such	such	ADJ
aisthesis-5428	32	5	crosses	crosse	NOUN
aisthesis-5428	32	6	were	be	AUX
aisthesis-5428	32	7	analyzed	analyze	VERB
aisthesis-5428	32	8	using	use	VERB
aisthesis-5428	32	9	phenotype	phenotype	NOUN
aisthesis-5428	32	10	scoring	scoring	NOUN
aisthesis-5428	32	11	and	and	CCONJ
aisthesis-5428	32	12	statistical	statistical	ADJ
aisthesis-5428	32	13	analysis	analysis	NOUN
aisthesis-5428	32	14	in	in	SCONJ
aisthesis-5428	32	15	order	order	NOUN
aisthesis-5428	32	16	to	to	PART
aisthesis-5428	32	17	reach	reach	VERB
aisthesis-5428	32	18	statistical	statistical	ADJ
aisthesis-5428	32	19	and	and	CCONJ
aisthesis-5428	32	20	qualitative	qualitative	ADJ
aisthesis-5428	32	21	conclusions	conclusion	NOUN
aisthesis-5428	32	22	about	about	ADP
aisthesis-5428	32	23	trex	trex	PROPN
aisthesis-5428	32	24	.	.	PROPN
aisthesis-5428	32	25	dna	dna	PROPN
aisthesis-5428	32	26	was	be	AUX
aisthesis-5428	32	27	extracted	extract	VERB
aisthesis-5428	32	28	from	from	ADP
aisthesis-5428	32	29	wt	wt	PROPN
aisthesis-5428	32	30	flies	fly	NOUN
aisthesis-5428	32	31	,	,	PUNCT
aisthesis-5428	32	32	trex	trex	PROPN
aisthesis-5428	32	33	flies	fly	NOUN
aisthesis-5428	32	34	,	,	PUNCT
aisthesis-5428	32	35	and	and	CCONJ
aisthesis-5428	32	36	reciprocal	reciprocal	PROPN
aisthesis-5428	32	37	cross	cross	NOUN
aisthesis-5428	32	38	progeny	progeny	NOUN
aisthesis-5428	32	39	and	and	CCONJ
aisthesis-5428	32	40	then	then	ADV
aisthesis-5428	32	41	utilized	utilize	VERB
aisthesis-5428	32	42	in	in	ADP
aisthesis-5428	32	43	polymerase	polymerase	NOUN
aisthesis-5428	32	44	chain	chain	NOUN
aisthesis-5428	32	45	reactions	reaction	NOUN
aisthesis-5428	32	46	and	and	CCONJ
aisthesis-5428	32	47	subsequent	subsequent	ADJ
aisthesis-5428	32	48	gel	gel	NOUN
aisthesis-5428	32	49	electrophoresis	electrophoresis	NOUN
aisthesis-5428	32	50	.	.	PUNCT
aisthesis-5428	33	1	trex	trex	PROPN
aisthesis-5428	33	2	dna	dna	PROPN
aisthesis-5428	33	3	was	be	AUX
aisthesis-5428	33	4	then	then	ADV
aisthesis-5428	33	5	sequenced	sequence	VERB
aisthesis-5428	33	6	and	and	CCONJ
aisthesis-5428	33	7	subjected	subject	VERB
aisthesis-5428	33	8	to	to	ADP
aisthesis-5428	33	9	bioinformatic	bioinformatic	ADJ
aisthesis-5428	33	10	analysis	analysis	NOUN
aisthesis-5428	33	11	using	use	VERB
aisthesis-5428	33	12	nucleotide	nucleotide	NOUN
aisthesis-5428	33	13	and	and	CCONJ
aisthesis-5428	33	14	protein	protein	NOUN
aisthesis-5428	33	15	blast	blast	NOUN
aisthesis-5428	33	16	comparison	comparison	NOUN
aisthesis-5428	33	17	to	to	ADP
aisthesis-5428	33	18	the	the	DET
aisthesis-5428	33	19	wild	wild	ADJ
aisthesis-5428	33	20	-	-	PUNCT
aisthesis-5428	33	21	type	type	NOUN
aisthesis-5428	33	22	genome	genome	NOUN
aisthesis-5428	33	23	.	.	PUNCT
aisthesis-5428	34	1	all	all	PRON
aisthesis-5428	34	2	fly	fly	VERB
aisthesis-5428	34	3	stocks	stock	NOUN
aisthesis-5428	34	4	were	be	AUX
aisthesis-5428	34	5	maintained	maintain	VERB
aisthesis-5428	34	6	within	within	ADP
aisthesis-5428	34	7	vials	vial	NOUN
aisthesis-5428	34	8	containing	contain	VERB
aisthesis-5428	34	9	a	a	DET
aisthesis-5428	34	10	cornmeal	cornmeal	NOUN
aisthesis-5428	34	11	-	-	PUNCT
aisthesis-5428	34	12	based	base	VERB
aisthesis-5428	34	13	food	food	NOUN
aisthesis-5428	34	14	source	source	NOUN
aisthesis-5428	34	15	with	with	ADP
aisthesis-5428	34	16	antimicrobial	antimicrobial	ADJ
aisthesis-5428	34	17	factors	factor	NOUN
aisthesis-5428	34	18	along	along	ADP
aisthesis-5428	34	19	with	with	ADP
aisthesis-5428	34	20	a	a	DET
aisthesis-5428	34	21	small	small	ADJ
aisthesis-5428	34	22	amount	amount	NOUN
aisthesis-5428	34	23	of	of	ADP
aisthesis-5428	34	24	yeast	yeast	NOUN
aisthesis-5428	34	25	for	for	ADP
aisthesis-5428	34	26	its	its	PRON
aisthesis-5428	34	27	added	add	VERB
aisthesis-5428	34	28	nutritive	nutritive	ADJ
aisthesis-5428	34	29	properties	property	NOUN
aisthesis-5428	34	30	.	.	PUNCT
aisthesis-5428	35	1	vials	vial	NOUN
aisthesis-5428	35	2	were	be	AUX
aisthesis-5428	35	3	kept	keep	VERB
aisthesis-5428	35	4	within	within	ADP
aisthesis-5428	35	5	a	a	DET
aisthesis-5428	35	6	25	25	NUM
aisthesis-5428	35	7	-	-	SYM
aisthesis-5428	35	8	26	26	NUM
aisthesis-5428	35	9	°	°	PROPN
aisthesis-5428	35	10	c	c	NOUN
aisthesis-5428	35	11	incubator	incubator	NOUN
aisthesis-5428	35	12	for	for	ADP
aisthesis-5428	35	13	the	the	DET
aisthesis-5428	35	14	duration	duration	NOUN
aisthesis-5428	35	15	of	of	ADP
aisthesis-5428	35	16	the	the	DET
aisthesis-5428	35	17	study	study	NOUN
aisthesis-5428	35	18	except	except	SCONJ
aisthesis-5428	35	19	when	when	SCONJ
aisthesis-5428	35	20	stocks	stock	NOUN
aisthesis-5428	35	21	were	be	AUX
aisthesis-5428	35	22	being	be	AUX
aisthesis-5428	35	23	manipulated	manipulate	VERB
aisthesis-5428	35	24	.	.	PUNCT
aisthesis-5428	36	1	any	any	DET
aisthesis-5428	36	2	manipulation	manipulation	NOUN
aisthesis-5428	36	3	of	of	ADP
aisthesis-5428	36	4	fly	fly	NOUN
aisthesis-5428	36	5	stocks	stock	NOUN
aisthesis-5428	36	6	occurred	occur	VERB
aisthesis-5428	36	7	under	under	ADP
aisthesis-5428	36	8	sterile	sterile	ADJ
aisthesis-5428	36	9	conditions	condition	NOUN
aisthesis-5428	36	10	,	,	PUNCT
aisthesis-5428	36	11	utilizing	utilize	VERB
aisthesis-5428	36	12	a	a	DET
aisthesis-5428	36	13	co2	co2	NOUN
aisthesis-5428	36	14	anesthetizing	anesthetizing	NOUN
aisthesis-5428	36	15	system	system	NOUN
aisthesis-5428	36	16	and	and	CCONJ
aisthesis-5428	36	17	a	a	DET
aisthesis-5428	36	18	stereomicroscope	stereomicroscope	NOUN
aisthesis-5428	36	19	with	with	ADP
aisthesis-5428	36	20	an	an	DET
aisthesis-5428	36	21	illuminator	illuminator	NOUN
aisthesis-5428	36	22	.	.	PUNCT
aisthesis-5428	37	1	b.	b.	PROPN
aisthesis-5428	37	2	reciprocal	reciprocal	ADJ
aisthesis-5428	37	3	crosses	crosse	NOUN
aisthesis-5428	37	4	performed	perform	VERB
aisthesis-5428	37	5	to	to	PART
aisthesis-5428	37	6	determine	determine	VERB
aisthesis-5428	37	7	the	the	DET
aisthesis-5428	37	8	mode	mode	NOUN
aisthesis-5428	37	9	of	of	ADP
aisthesis-5428	37	10	inheritance	inheritance	NOUN
aisthesis-5428	37	11	of	of	ADP
aisthesis-5428	37	12	trex	trex	PROPN
aisthesis-5428	37	13	first	first	ADV
aisthesis-5428	37	14	,	,	PUNCT
aisthesis-5428	37	15	a	a	DET
aisthesis-5428	37	16	wild	wild	ADJ
aisthesis-5428	37	17	-	-	PUNCT
aisthesis-5428	37	18	type	type	NOUN
aisthesis-5428	37	19	marker	marker	NOUN
aisthesis-5428	37	20	cross	cross	NOUN
aisthesis-5428	37	21	(	(	PUNCT
aisthesis-5428	37	22	wtm1	wtm1	PROPN
aisthesis-5428	37	23	)	)	PUNCT
aisthesis-5428	37	24	was	be	AUX
aisthesis-5428	37	25	performed	perform	VERB
aisthesis-5428	37	26	between	between	ADP
aisthesis-5428	37	27	wild	wild	ADJ
aisthesis-5428	37	28	-	-	PUNCT
aisthesis-5428	37	29	type	type	NOUN
aisthesis-5428	37	30	females	female	NOUN
aisthesis-5428	37	31	and	and	CCONJ
aisthesis-5428	37	32	trex	trex	ADJ
aisthesis-5428	37	33	males	male	NOUN
aisthesis-5428	37	34	to	to	PART
aisthesis-5428	37	35	determine	determine	VERB
aisthesis-5428	37	36	the	the	DET
aisthesis-5428	37	37	mode	mode	NOUN
aisthesis-5428	37	38	of	of	ADP
aisthesis-5428	37	39	inheritance	inheritance	NOUN
aisthesis-5428	37	40	of	of	ADP
aisthesis-5428	37	41	trex	trex	PROPN
aisthesis-5428	37	42	as	as	SCONJ
aisthesis-5428	37	43	it	it	PRON
aisthesis-5428	37	44	relates	relate	VERB
aisthesis-5428	37	45	to	to	ADP
aisthesis-5428	37	46	its	its	PRON
aisthesis-5428	37	47	dominance	dominance	NOUN
aisthesis-5428	37	48	or	or	CCONJ
aisthesis-5428	37	49	lack	lack	NOUN
aisthesis-5428	37	50	thereof	thereof	ADV
aisthesis-5428	37	51	.	.	PUNCT
aisthesis-5428	38	1	five	five	NUM
aisthesis-5428	38	2	females	female	NOUN
aisthesis-5428	38	3	and	and	CCONJ
aisthesis-5428	38	4	three	three	NUM
aisthesis-5428	38	5	males	male	NOUN
aisthesis-5428	38	6	were	be	AUX
aisthesis-5428	38	7	subcultured	subculture	VERB
aisthesis-5428	38	8	together	together	ADV
aisthesis-5428	38	9	into	into	ADP
aisthesis-5428	38	10	a	a	DET
aisthesis-5428	38	11	vial	vial	NOUN
aisthesis-5428	38	12	with	with	ADP
aisthesis-5428	38	13	cornmeal	cornmeal	NOUN
aisthesis-5428	38	14	food	food	NOUN
aisthesis-5428	38	15	and	and	CCONJ
aisthesis-5428	38	16	incubated	incubate	VERB
aisthesis-5428	38	17	at	at	ADP
aisthesis-5428	38	18	25	25	NUM
aisthesis-5428	38	19	°	°	NOUN
aisthesis-5428	38	20	c	c	NOUN
aisthesis-5428	38	21	.	.	PUNCT
aisthesis-5428	39	1	upon	upon	SCONJ
aisthesis-5428	39	2	pupa	pupa	ADJ
aisthesis-5428	39	3	formation	formation	NOUN
aisthesis-5428	39	4	,	,	PUNCT
aisthesis-5428	39	5	the	the	DET
aisthesis-5428	39	6	parental	parental	ADJ
aisthesis-5428	39	7	flies	fly	NOUN
aisthesis-5428	39	8	were	be	AUX
aisthesis-5428	39	9	brooded	brood	VERB
aisthesis-5428	39	10	into	into	ADP
aisthesis-5428	39	11	new	new	ADJ
aisthesis-5428	39	12	vials	vial	NOUN
aisthesis-5428	39	13	.	.	PUNCT
aisthesis-5428	40	1	hatched	hatch	VERB
aisthesis-5428	40	2	progeny	progeny	NOUN
aisthesis-5428	40	3	were	be	AUX
aisthesis-5428	40	4	phenotypically	phenotypically	ADV
aisthesis-5428	40	5	scored	score	VERB
aisthesis-5428	40	6	every	every	DET
aisthesis-5428	40	7	8	8	NUM
aisthesis-5428	40	8	-	-	SYM
aisthesis-5428	40	9	10	10	NUM
aisthesis-5428	40	10	hours	hour	NOUN
aisthesis-5428	40	11	and	and	CCONJ
aisthesis-5428	40	12	then	then	ADV
aisthesis-5428	40	13	removed	remove	VERB
aisthesis-5428	40	14	from	from	ADP
aisthesis-5428	40	15	the	the	DET
aisthesis-5428	40	16	sample	sample	NOUN
aisthesis-5428	40	17	in	in	ADP
aisthesis-5428	40	18	order	order	NOUN
aisthesis-5428	40	19	to	to	PART
aisthesis-5428	40	20	prevent	prevent	VERB
aisthesis-5428	40	21	the	the	DET
aisthesis-5428	40	22	formation	formation	NOUN
aisthesis-5428	40	23	of	of	ADP
aisthesis-5428	40	24	an	an	DET
aisthesis-5428	40	25	f2	f2	ADJ
aisthesis-5428	40	26	generation	generation	NOUN
aisthesis-5428	40	27	.	.	PUNCT
aisthesis-5428	41	1	a	a	DET
aisthesis-5428	41	2	virtual	virtual	ADJ
aisthesis-5428	41	3	version	version	NOUN
aisthesis-5428	41	4	of	of	ADP
aisthesis-5428	41	5	this	this	DET
aisthesis-5428	41	6	cross	cross	NOUN
aisthesis-5428	41	7	between	between	ADP
aisthesis-5428	41	8	wild	wild	ADJ
aisthesis-5428	41	9	-	-	PUNCT
aisthesis-5428	41	10	type	type	NOUN
aisthesis-5428	41	11	females	female	NOUN
aisthesis-5428	41	12	and	and	CCONJ
aisthesis-5428	41	13	trex	trex	PROPN
aisthesis-5428	41	14	males	male	NOUN
aisthesis-5428	41	15	was	be	AUX
aisthesis-5428	41	16	also	also	ADV
aisthesis-5428	41	17	performed	perform	VERB
aisthesis-5428	41	18	on	on	ADP
aisthesis-5428	41	19	flylab	flylab	PROPN
aisthesis-5428	41	20	js	js	PROPN
aisthesis-5428	41	21	with	with	ADP
aisthesis-5428	41	22	three	three	NUM
aisthesis-5428	41	23	batches	batch	NOUN
aisthesis-5428	41	24	of	of	ADP
aisthesis-5428	41	25	parental	parental	ADJ
aisthesis-5428	41	26	flies	fly	NOUN
aisthesis-5428	41	27	.	.	PUNCT
aisthesis-5428	42	1	progeny	progeny	NOUN
aisthesis-5428	42	2	of	of	ADP
aisthesis-5428	42	3	the	the	DET
aisthesis-5428	42	4	virtual	virtual	ADJ
aisthesis-5428	42	5	wtm1	wtm1	NOUN
aisthesis-5428	42	6	crosses	crosse	NOUN
aisthesis-5428	42	7	were	be	AUX
aisthesis-5428	42	8	also	also	ADV
aisthesis-5428	42	9	phenotypically	phenotypically	ADV
aisthesis-5428	42	10	scored	score	VERB
aisthesis-5428	42	11	.	.	PUNCT
aisthesis-5428	43	1	a	a	DET
aisthesis-5428	43	2	second	second	ADJ
aisthesis-5428	43	3	wild	wild	ADJ
aisthesis-5428	43	4	-	-	PUNCT
aisthesis-5428	43	5	type	type	NOUN
aisthesis-5428	43	6	marker	marker	NOUN
aisthesis-5428	43	7	cross	cross	NOUN
aisthesis-5428	43	8	was	be	AUX
aisthesis-5428	43	9	performed	perform	VERB
aisthesis-5428	43	10	(	(	PUNCT
aisthesis-5428	43	11	wtm2	wtm2	NOUN
aisthesis-5428	43	12	)	)	PUNCT
aisthesis-5428	43	13	using	use	VERB
aisthesis-5428	43	14	the	the	DET
aisthesis-5428	43	15	same	same	ADJ
aisthesis-5428	43	16	method	method	NOUN
aisthesis-5428	43	17	as	as	ADP
aisthesis-5428	43	18	wtm1	wtm1	PROPN
aisthesis-5428	43	19	,	,	PUNCT
aisthesis-5428	43	20	except	except	SCONJ
aisthesis-5428	43	21	with	with	ADP
aisthesis-5428	43	22	trex	trex	PROPN
aisthesis-5428	43	23	females	female	NOUN
aisthesis-5428	43	24	and	and	CCONJ
aisthesis-5428	43	25	wild	wild	ADJ
aisthesis-5428	43	26	-	-	PUNCT
aisthesis-5428	43	27	type	type	NOUN
aisthesis-5428	43	28	males	male	NOUN
aisthesis-5428	43	29	in	in	ADP
aisthesis-5428	43	30	order	order	NOUN
aisthesis-5428	43	31	to	to	PART
aisthesis-5428	43	32	determine	determine	VERB
aisthesis-5428	43	33	the	the	DET
aisthesis-5428	43	34	mode	mode	NOUN
aisthesis-5428	43	35	of	of	ADP
aisthesis-5428	43	36	inheritance	inheritance	NOUN
aisthesis-5428	43	37	as	as	SCONJ
aisthesis-5428	43	38	it	it	PRON
aisthesis-5428	43	39	relates	relate	VERB
aisthesis-5428	43	40	to	to	ADP
aisthesis-5428	43	41	whether	whether	SCONJ
aisthesis-5428	43	42	trex	trex	PROPN
aisthesis-5428	43	43	is	be	AUX
aisthesis-5428	43	44	inherited	inherit	VERB
aisthesis-5428	43	45	in	in	ADP
aisthesis-5428	43	46	an	an	DET
aisthesis-5428	43	47	autosomal	autosomal	ADJ
aisthesis-5428	43	48	or	or	CCONJ
aisthesis-5428	43	49	sexlinked	sexlinke	VERB
aisthesis-5428	43	50	manner	manner	NOUN
aisthesis-5428	43	51	.	.	PUNCT
aisthesis-5428	44	1	five	five	NUM
aisthesis-5428	44	2	females	female	NOUN
aisthesis-5428	44	3	and	and	CCONJ
aisthesis-5428	44	4	three	three	NUM
aisthesis-5428	44	5	males	male	NOUN
aisthesis-5428	44	6	were	be	AUX
aisthesis-5428	44	7	similarly	similarly	ADV
aisthesis-5428	44	8	subcultured	subculture	VERB
aisthesis-5428	44	9	into	into	ADP
aisthesis-5428	44	10	a	a	DET
aisthesis-5428	44	11	vial	vial	NOUN
aisthesis-5428	44	12	with	with	ADP
aisthesis-5428	44	13	a	a	DET
aisthesis-5428	44	14	cornmeal	cornmeal	NOUN
aisthesis-5428	44	15	food	food	NOUN
aisthesis-5428	44	16	source	source	NOUN
aisthesis-5428	44	17	,	,	PUNCT
aisthesis-5428	44	18	incubated	incubate	VERB
aisthesis-5428	44	19	at	at	ADP
aisthesis-5428	44	20	25	25	NUM
aisthesis-5428	44	21	°	°	NOUN
aisthesis-5428	44	22	c	c	NOUN
aisthesis-5428	44	23	,	,	PUNCT
aisthesis-5428	44	24	and	and	CCONJ
aisthesis-5428	44	25	were	be	AUX
aisthesis-5428	44	26	brooded	brood	VERB
aisthesis-5428	44	27	into	into	ADP
aisthesis-5428	44	28	a	a	DET
aisthesis-5428	44	29	new	new	ADJ
aisthesis-5428	44	30	vial	vial	NOUN
aisthesis-5428	44	31	upon	upon	SCONJ
aisthesis-5428	44	32	the	the	DET
aisthesis-5428	44	33	formation	formation	NOUN
aisthesis-5428	44	34	of	of	ADP
aisthesis-5428	44	35	pupa	pupa	ADJ
aisthesis-5428	44	36	within	within	ADP
aisthesis-5428	44	37	the	the	DET
aisthesis-5428	44	38	original	original	ADJ
aisthesis-5428	44	39	vial	vial	NOUN
aisthesis-5428	44	40	.	.	PUNCT
aisthesis-5428	45	1	the	the	DET
aisthesis-5428	45	2	phenotypes	phenotype	NOUN
aisthesis-5428	45	3	of	of	ADP
aisthesis-5428	45	4	the	the	DET
aisthesis-5428	45	5	progeny	progeny	NOUN
aisthesis-5428	45	6	of	of	ADP
aisthesis-5428	45	7	this	this	DET
aisthesis-5428	45	8	cross	cross	NOUN
aisthesis-5428	45	9	were	be	AUX
aisthesis-5428	45	10	scored	score	VERB
aisthesis-5428	45	11	every	every	DET
aisthesis-5428	45	12	8	8	NUM
aisthesis-5428	45	13	-	-	SYM
aisthesis-5428	45	14	10	10	NUM
aisthesis-5428	45	15	hours	hour	NOUN
aisthesis-5428	45	16	and	and	CCONJ
aisthesis-5428	45	17	also	also	ADV
aisthesis-5428	45	18	removed	remove	VERB
aisthesis-5428	45	19	from	from	ADP
aisthesis-5428	45	20	the	the	DET
aisthesis-5428	45	21	sample	sample	NOUN
aisthesis-5428	45	22	in	in	ADP
aisthesis-5428	45	23	order	order	NOUN
aisthesis-5428	45	24	to	to	PART
aisthesis-5428	45	25	prevent	prevent	VERB
aisthesis-5428	45	26	the	the	DET
aisthesis-5428	45	27	formation	formation	NOUN
aisthesis-5428	45	28	of	of	ADP
aisthesis-5428	45	29	an	an	DET
aisthesis-5428	45	30	f2	f2	ADJ
aisthesis-5428	45	31	generation	generation	NOUN
aisthesis-5428	45	32	.	.	PUNCT
aisthesis-5428	46	1	wtm2	wtm2	NOUN
aisthesis-5428	46	2	was	be	AUX
aisthesis-5428	46	3	also	also	ADV
aisthesis-5428	46	4	reproduced	reproduce	VERB
aisthesis-5428	46	5	virtually	virtually	ADV
aisthesis-5428	46	6	on	on	ADP
aisthesis-5428	46	7	flylab	flylab	PROPN
aisthesis-5428	46	8	js	js	PROPN
aisthesis-5428	46	9	,	,	PUNCT
aisthesis-5428	46	10	similarly	similarly	ADV
aisthesis-5428	46	11	crossing	cross	VERB
aisthesis-5428	46	12	three	three	NUM
aisthesis-5428	46	13	samples	sample	NOUN
aisthesis-5428	46	14	of	of	ADP
aisthesis-5428	46	15	trex	trex	ADJ
aisthesis-5428	46	16	females	female	NOUN
aisthesis-5428	46	17	and	and	CCONJ
aisthesis-5428	46	18	wild	wild	ADJ
aisthesis-5428	46	19	-	-	PUNCT
aisthesis-5428	46	20	type	type	NOUN
aisthesis-5428	46	21	males	male	NOUN
aisthesis-5428	46	22	and	and	CCONJ
aisthesis-5428	46	23	phenotypically	phenotypically	ADV
aisthesis-5428	46	24	scoring	scoring	NOUN
aisthesis-5428	46	25	progeny	progeny	NOUN
aisthesis-5428	46	26	.	.	PUNCT
aisthesis-5428	47	1	c.	c.	NOUN
aisthesis-5428	47	2	mapping	mapping	NOUN
aisthesis-5428	47	3	crosses	crosse	NOUN
aisthesis-5428	47	4	performed	perform	VERB
aisthesis-5428	47	5	to	to	PART
aisthesis-5428	47	6	determine	determine	VERB
aisthesis-5428	47	7	chromosomal	chromosomal	ADJ
aisthesis-5428	47	8	location	location	NOUN
aisthesis-5428	47	9	of	of	ADP
aisthesis-5428	47	10	trex	trex	PROPN
aisthesis-5428	47	11	three	three	NUM
aisthesis-5428	47	12	mapping	mapping	NOUN
aisthesis-5428	47	13	crosses	crosse	NOUN
aisthesis-5428	47	14	were	be	AUX
aisthesis-5428	47	15	performed	perform	VERB
aisthesis-5428	47	16	between	between	ADP
aisthesis-5428	47	17	the	the	DET
aisthesis-5428	47	18	trex	trex	PROPN
aisthesis-5428	47	19	gene	gene	NOUN
aisthesis-5428	47	20	and	and	CCONJ
aisthesis-5428	47	21	a	a	DET
aisthesis-5428	47	22	marker	marker	NOUN
aisthesis-5428	47	23	gene	gene	NOUN
aisthesis-5428	47	24	(	(	PUNCT
aisthesis-5428	47	25	black	black	ADJ
aisthesis-5428	47	26	(	(	PUNCT
aisthesis-5428	47	27	bl	bl	PROPN
aisthesis-5428	47	28	)	)	PUNCT
aisthesis-5428	47	29	,	,	PUNCT
aisthesis-5428	47	30	brown	brown	ADJ
aisthesis-5428	47	31	(	(	PUNCT
aisthesis-5428	47	32	bw	bw	NOUN
aisthesis-5428	47	33	)	)	PUNCT
aisthesis-5428	47	34	,	,	PUNCT
aisthesis-5428	47	35	and	and	CCONJ
aisthesis-5428	47	36	purple	purple	ADJ
aisthesis-5428	47	37	(	(	PUNCT
aisthesis-5428	47	38	pr	pr	NOUN
aisthesis-5428	47	39	)	)	PUNCT
aisthesis-5428	47	40	)	)	PUNCT
aisthesis-5428	48	1	in	in	ADP
aisthesis-5428	48	2	order	order	NOUN
aisthesis-5428	48	3	to	to	PART
aisthesis-5428	48	4	determine	determine	VERB
aisthesis-5428	48	5	the	the	DET
aisthesis-5428	48	6	analysis	analysis	NOUN
aisthesis-5428	48	7	of	of	ADP
aisthesis-5428	48	8	novel	novel	ADJ
aisthesis-5428	48	9	unknown	unknown	ADJ
aisthesis-5428	48	10	d.	d.	NOUN
aisthesis-5428	48	11	melanogaster	melanogaster	NOUN
aisthesis-5428	48	12	mutation	mutation	NOUN
aisthesis-5428	48	13	trex	trex	PROPN
aisthesis-5428	48	14	aisthesis	aisthesis	NOUN
aisthesis-5428	48	15	volume	volume	NOUN
aisthesis-5428	48	16	14	14	NUM
aisthesis-5428	48	17	,	,	PUNCT
aisthesis-5428	48	18	202357	202357	NUM
aisthesis-5428	48	19	location	location	NOUN
aisthesis-5428	48	20	of	of	ADP
aisthesis-5428	48	21	trex	trex	PROPN
aisthesis-5428	48	22	within	within	ADP
aisthesis-5428	48	23	the	the	DET
aisthesis-5428	48	24	d.	d.	NOUN
aisthesis-5428	48	25	melanogaster	melanogaster	NOUN
aisthesis-5428	48	26	genome	genome	NOUN
aisthesis-5428	48	27	.	.	PUNCT
aisthesis-5428	49	1	female	female	ADJ
aisthesis-5428	49	2	flies	fly	NOUN
aisthesis-5428	49	3	heterozygous	heterozygous	ADJ
aisthesis-5428	49	4	for	for	SCONJ
aisthesis-5428	49	5	both	both	CCONJ
aisthesis-5428	49	6	the	the	DET
aisthesis-5428	49	7	trex	trex	PROPN
aisthesis-5428	49	8	gene	gene	NOUN
aisthesis-5428	49	9	and	and	CCONJ
aisthesis-5428	49	10	the	the	DET
aisthesis-5428	49	11	given	give	VERB
aisthesis-5428	49	12	marker	marker	NOUN
aisthesis-5428	49	13	gene	gene	NOUN
aisthesis-5428	49	14	were	be	AUX
aisthesis-5428	49	15	crossed	cross	VERB
aisthesis-5428	49	16	with	with	ADP
aisthesis-5428	49	17	male	male	ADJ
aisthesis-5428	49	18	flies	fly	NOUN
aisthesis-5428	49	19	homozygous	homozygous	ADJ
aisthesis-5428	49	20	for	for	ADP
aisthesis-5428	49	21	both	both	DET
aisthesis-5428	49	22	trex	trex	PROPN
aisthesis-5428	49	23	and	and	CCONJ
aisthesis-5428	49	24	the	the	DET
aisthesis-5428	49	25	marker	marker	NOUN
aisthesis-5428	49	26	gene	gene	NOUN
aisthesis-5428	49	27	.	.	PUNCT
aisthesis-5428	50	1	each	each	DET
aisthesis-5428	50	2	mapping	mapping	NOUN
aisthesis-5428	50	3	cross	cross	NOUN
aisthesis-5428	50	4	was	be	AUX
aisthesis-5428	50	5	repeated	repeat	VERB
aisthesis-5428	50	6	three	three	NUM
aisthesis-5428	50	7	times	time	NOUN
aisthesis-5428	50	8	with	with	ADP
aisthesis-5428	50	9	three	three	NUM
aisthesis-5428	50	10	separate	separate	ADJ
aisthesis-5428	50	11	cultures	culture	NOUN
aisthesis-5428	50	12	.	.	PUNCT
aisthesis-5428	51	1	progeny	progeny	NOUN
aisthesis-5428	51	2	of	of	ADP
aisthesis-5428	51	3	this	this	DET
aisthesis-5428	51	4	cross	cross	NOUN
aisthesis-5428	51	5	were	be	AUX
aisthesis-5428	51	6	scored	score	VERB
aisthesis-5428	51	7	according	accord	VERB
aisthesis-5428	51	8	to	to	ADP
aisthesis-5428	51	9	what	what	PRON
aisthesis-5428	51	10	phenotypic	phenotypic	ADJ
aisthesis-5428	51	11	class	class	NOUN
aisthesis-5428	51	12	they	they	PRON
aisthesis-5428	51	13	belonged	belong	VERB
aisthesis-5428	51	14	to	to	ADP
aisthesis-5428	51	15	in	in	ADP
aisthesis-5428	51	16	order	order	NOUN
aisthesis-5428	51	17	to	to	PART
aisthesis-5428	51	18	determine	determine	VERB
aisthesis-5428	51	19	the	the	DET
aisthesis-5428	51	20	relative	relative	ADJ
aisthesis-5428	51	21	amounts	amount	NOUN
aisthesis-5428	51	22	of	of	ADP
aisthesis-5428	51	23	progeny	progeny	NOUN
aisthesis-5428	51	24	with	with	ADP
aisthesis-5428	51	25	parental	parental	ADJ
aisthesis-5428	51	26	and	and	CCONJ
aisthesis-5428	51	27	recombinant	recombinant	ADJ
aisthesis-5428	51	28	phenotypes	phenotype	NOUN
aisthesis-5428	51	29	.	.	PUNCT
aisthesis-5428	52	1	the	the	DET
aisthesis-5428	52	2	recombination	recombination	NOUN
aisthesis-5428	52	3	frequency	frequency	NOUN
aisthesis-5428	52	4	between	between	ADP
aisthesis-5428	52	5	trex	trex	PROPN
aisthesis-5428	52	6	and	and	CCONJ
aisthesis-5428	52	7	each	each	DET
aisthesis-5428	52	8	marker	marker	NOUN
aisthesis-5428	52	9	gene	gene	NOUN
aisthesis-5428	52	10	was	be	AUX
aisthesis-5428	52	11	found	find	VERB
aisthesis-5428	52	12	using	use	VERB
aisthesis-5428	52	13	the	the	DET
aisthesis-5428	52	14	equation	equation	NOUN
aisthesis-5428	52	15	d.	d.	PROPN
aisthesis-5428	52	16	chi	chi	PROPN
aisthesis-5428	52	17	-	-	PUNCT
aisthesis-5428	52	18	square	square	ADJ
aisthesis-5428	52	19	statistical	statistical	ADJ
aisthesis-5428	52	20	analysis	analysis	NOUN
aisthesis-5428	52	21	of	of	ADP
aisthesis-5428	52	22	significance	significance	NOUN
aisthesis-5428	52	23	of	of	ADP
aisthesis-5428	52	24	genetic	genetic	ADJ
aisthesis-5428	52	25	linkage	linkage	NOUN
aisthesis-5428	52	26	of	of	ADP
aisthesis-5428	52	27	trex	trex	PROPN
aisthesis-5428	52	28	and	and	CCONJ
aisthesis-5428	52	29	marker	marker	NOUN
aisthesis-5428	52	30	genes	gene	NOUN
aisthesis-5428	52	31	statistical	statistical	ADJ
aisthesis-5428	52	32	analysis	analysis	NOUN
aisthesis-5428	52	33	of	of	ADP
aisthesis-5428	52	34	these	these	DET
aisthesis-5428	52	35	progeny	progeny	NOUN
aisthesis-5428	52	36	ratios	ratio	NOUN
aisthesis-5428	52	37	was	be	AUX
aisthesis-5428	52	38	performed	perform	VERB
aisthesis-5428	52	39	utilizing	utilize	VERB
aisthesis-5428	52	40	r	r	NOUN
aisthesis-5428	52	41	statistical	statistical	ADJ
aisthesis-5428	52	42	software	software	NOUN
aisthesis-5428	52	43	to	to	PART
aisthesis-5428	52	44	determine	determine	VERB
aisthesis-5428	52	45	if	if	SCONJ
aisthesis-5428	52	46	the	the	DET
aisthesis-5428	52	47	marker	marker	NOUN
aisthesis-5428	52	48	gene	gene	NOUN
aisthesis-5428	52	49	and	and	CCONJ
aisthesis-5428	52	50	trex	trex	PROPN
aisthesis-5428	52	51	were	be	AUX
aisthesis-5428	52	52	genetically	genetically	ADV
aisthesis-5428	52	53	linked	link	VERB
aisthesis-5428	52	54	.	.	PUNCT
aisthesis-5428	53	1	more	more	ADV
aisthesis-5428	53	2	specifically	specifically	ADV
aisthesis-5428	53	3	,	,	PUNCT
aisthesis-5428	53	4	a	a	DET
aisthesis-5428	53	5	chi	chi	ADJ
aisthesis-5428	53	6	-	-	PUNCT
aisthesis-5428	53	7	square	square	ADJ
aisthesis-5428	53	8	test	test	NOUN
aisthesis-5428	53	9	was	be	AUX
aisthesis-5428	53	10	performed	perform	VERB
aisthesis-5428	53	11	utilizing	utilize	VERB
aisthesis-5428	53	12	the	the	DET
aisthesis-5428	53	13	equation	equation	NOUN
aisthesis-5428	53	14	the	the	DET
aisthesis-5428	53	15	value	value	NOUN
aisthesis-5428	53	16	of	of	ADP
aisthesis-5428	53	17	this	this	DET
aisthesis-5428	53	18	analysis	analysis	NOUN
aisthesis-5428	53	19	was	be	AUX
aisthesis-5428	53	20	used	use	VERB
aisthesis-5428	53	21	for	for	ADP
aisthesis-5428	53	22	a	a	DET
aisthesis-5428	53	23	p	p	ADJ
aisthesis-5428	53	24	-	-	PUNCT
aisthesis-5428	53	25	value	value	NOUN
aisthesis-5428	53	26	test	test	NOUN
aisthesis-5428	53	27	of	of	ADP
aisthesis-5428	53	28	significance	significance	NOUN
aisthesis-5428	53	29	to	to	PART
aisthesis-5428	53	30	evaluate	evaluate	VERB
aisthesis-5428	53	31	the	the	DET
aisthesis-5428	53	32	null	null	ADJ
aisthesis-5428	53	33	hypothesis	hypothesis	NOUN
aisthesis-5428	53	34	that	that	SCONJ
aisthesis-5428	53	35	the	the	DET
aisthesis-5428	53	36	given	give	VERB
aisthesis-5428	53	37	marker	marker	NOUN
aisthesis-5428	53	38	gene	gene	NOUN
aisthesis-5428	53	39	and	and	CCONJ
aisthesis-5428	53	40	trex	trex	PROPN
aisthesis-5428	53	41	are	be	AUX
aisthesis-5428	53	42	not	not	PART
aisthesis-5428	53	43	genetically	genetically	ADV
aisthesis-5428	53	44	linked	link	VERB
aisthesis-5428	53	45	and	and	CCONJ
aisthesis-5428	53	46	thus	thus	ADV
aisthesis-5428	53	47	progeny	progeny	VERB
aisthesis-5428	53	48	display	display	VERB
aisthesis-5428	53	49	a	a	DET
aisthesis-5428	53	50	1:1:1:1	1:1:1:1	NUM
aisthesis-5428	53	51	ratio	ratio	NOUN
aisthesis-5428	53	52	of	of	ADP
aisthesis-5428	53	53	the	the	DET
aisthesis-5428	53	54	phenotypic	phenotypic	ADJ
aisthesis-5428	53	55	classes	class	NOUN
aisthesis-5428	53	56	.	.	PUNCT
aisthesis-5428	54	1	three	three	NUM
aisthesis-5428	54	2	degrees	degree	NOUN
aisthesis-5428	54	3	of	of	ADP
aisthesis-5428	54	4	freedom	freedom	NOUN
aisthesis-5428	54	5	were	be	AUX
aisthesis-5428	54	6	utilized	utilize	VERB
aisthesis-5428	54	7	in	in	ADP
aisthesis-5428	54	8	this	this	DET
aisthesis-5428	54	9	analysis	analysis	NOUN
aisthesis-5428	54	10	,	,	PUNCT
aisthesis-5428	54	11	giving	give	VERB
aisthesis-5428	54	12	a	a	DET
aisthesis-5428	54	13	corresponding	correspond	VERB
aisthesis-5428	54	14	critical	critical	ADJ
aisthesis-5428	54	15	value	value	NOUN
aisthesis-5428	54	16	of	of	ADP
aisthesis-5428	54	17	7.815	7.815	NUM
aisthesis-5428	54	18	when	when	SCONJ
aisthesis-5428	54	19	p=0.05	p=0.05	NOUN
aisthesis-5428	54	20	.	.	PUNCT
aisthesis-5428	55	1	any	any	DET
aisthesis-5428	55	2	chi	chi	ADJ
aisthesis-5428	55	3	-	-	PUNCT
aisthesis-5428	55	4	square	square	ADJ
aisthesis-5428	55	5	calculations	calculation	NOUN
aisthesis-5428	55	6	giving	give	VERB
aisthesis-5428	55	7	a	a	DET
aisthesis-5428	55	8	value	value	NOUN
aisthesis-5428	55	9	larger	large	ADJ
aisthesis-5428	55	10	than	than	ADP
aisthesis-5428	55	11	7.815	7.815	NUM
aisthesis-5428	55	12	were	be	AUX
aisthesis-5428	55	13	considered	consider	VERB
aisthesis-5428	55	14	statistically	statistically	ADV
aisthesis-5428	55	15	significant	significant	ADJ
aisthesis-5428	55	16	and	and	CCONJ
aisthesis-5428	55	17	the	the	DET
aisthesis-5428	55	18	null	null	ADJ
aisthesis-5428	55	19	hypothesis	hypothesis	NOUN
aisthesis-5428	55	20	was	be	AUX
aisthesis-5428	55	21	rejected	reject	VERB
aisthesis-5428	55	22	with	with	ADP
aisthesis-5428	55	23	95	95	NUM
aisthesis-5428	55	24	%	%	NOUN
aisthesis-5428	55	25	confidence	confidence	NOUN
aisthesis-5428	55	26	.	.	PUNCT
aisthesis-5428	56	1	in	in	ADP
aisthesis-5428	56	2	other	other	ADJ
aisthesis-5428	56	3	words	word	NOUN
aisthesis-5428	56	4	,	,	PUNCT
aisthesis-5428	56	5	for	for	ADP
aisthesis-5428	56	6	chi	chi	ADJ
aisthesis-5428	56	7	-	-	PUNCT
aisthesis-5428	56	8	square	square	ADJ
aisthesis-5428	56	9	evaluations	evaluation	NOUN
aisthesis-5428	56	10	giving	give	VERB
aisthesis-5428	56	11	a	a	DET
aisthesis-5428	56	12	value	value	NOUN
aisthesis-5428	56	13	greater	great	ADJ
aisthesis-5428	56	14	than	than	ADP
aisthesis-5428	56	15	7.815	7.815	NUM
aisthesis-5428	56	16	,	,	PUNCT
aisthesis-5428	56	17	the	the	DET
aisthesis-5428	56	18	null	null	ADJ
aisthesis-5428	56	19	hypothesis	hypothesis	NOUN
aisthesis-5428	56	20	that	that	PRON
aisthesis-5428	56	21	the	the	DET
aisthesis-5428	56	22	marker	marker	NOUN
aisthesis-5428	56	23	gene	gene	NOUN
aisthesis-5428	56	24	and	and	CCONJ
aisthesis-5428	56	25	trex	trex	PROPN
aisthesis-5428	56	26	are	be	AUX
aisthesis-5428	56	27	not	not	PART
aisthesis-5428	56	28	genetically	genetically	ADV
aisthesis-5428	56	29	linked	link	VERB
aisthesis-5428	56	30	was	be	AUX
aisthesis-5428	56	31	rejected	reject	VERB
aisthesis-5428	56	32	with	with	ADP
aisthesis-5428	56	33	95	95	NUM
aisthesis-5428	56	34	%	%	NOUN
aisthesis-5428	56	35	confidence	confidence	NOUN
aisthesis-5428	56	36	,	,	PUNCT
aisthesis-5428	56	37	and	and	CCONJ
aisthesis-5428	56	38	genetic	genetic	ADJ
aisthesis-5428	56	39	linkage	linkage	NOUN
aisthesis-5428	56	40	between	between	ADP
aisthesis-5428	56	41	the	the	DET
aisthesis-5428	56	42	genes	gene	NOUN
aisthesis-5428	56	43	was	be	AUX
aisthesis-5428	56	44	reasonably	reasonably	ADV
aisthesis-5428	56	45	assumed	assume	VERB
aisthesis-5428	56	46	.	.	PUNCT
aisthesis-5428	57	1	based	base	VERB
aisthesis-5428	57	2	on	on	ADP
aisthesis-5428	57	3	genetic	genetic	ADJ
aisthesis-5428	57	4	distances	distance	NOUN
aisthesis-5428	57	5	from	from	ADP
aisthesis-5428	57	6	statistically	statistically	ADV
aisthesis-5428	57	7	analyzed	analyze	VERB
aisthesis-5428	57	8	recombination	recombination	NOUN
aisthesis-5428	57	9	frequencies	frequency	NOUN
aisthesis-5428	57	10	,	,	PUNCT
aisthesis-5428	57	11	a	a	DET
aisthesis-5428	57	12	prospective	prospective	ADJ
aisthesis-5428	57	13	gene	gene	NOUN
aisthesis-5428	57	14	map	map	NOUN
aisthesis-5428	57	15	was	be	AUX
aisthesis-5428	57	16	constructed	construct	VERB
aisthesis-5428	57	17	to	to	PART
aisthesis-5428	57	18	predict	predict	VERB
aisthesis-5428	57	19	the	the	DET
aisthesis-5428	57	20	location	location	NOUN
aisthesis-5428	57	21	of	of	ADP
aisthesis-5428	57	22	trex	trex	PROPN
aisthesis-5428	57	23	.	.	PUNCT
aisthesis-5428	58	1	e.	e.	PROPN
aisthesis-5428	58	2	dna	dna	PROPN
aisthesis-5428	58	3	extraction	extraction	NOUN
aisthesis-5428	58	4	to	to	PART
aisthesis-5428	58	5	begin	begin	VERB
aisthesis-5428	58	6	the	the	DET
aisthesis-5428	58	7	analysis	analysis	NOUN
aisthesis-5428	58	8	of	of	ADP
aisthesis-5428	58	9	the	the	DET
aisthesis-5428	58	10	molecular	molecular	ADJ
aisthesis-5428	58	11	nature	nature	NOUN
aisthesis-5428	58	12	of	of	ADP
aisthesis-5428	58	13	the	the	DET
aisthesis-5428	58	14	trex	trex	PROPN
aisthesis-5428	58	15	mutation	mutation	NOUN
aisthesis-5428	58	16	,	,	PUNCT
aisthesis-5428	58	17	dna	dna	PROPN
aisthesis-5428	58	18	was	be	AUX
aisthesis-5428	58	19	first	first	ADV
aisthesis-5428	58	20	extracted	extract	VERB
aisthesis-5428	58	21	from	from	ADP
aisthesis-5428	58	22	wildtype	wildtype	NOUN
aisthesis-5428	58	23	flies	fly	NOUN
aisthesis-5428	58	24	,	,	PUNCT
aisthesis-5428	58	25	trex	trex	PROPN
aisthesis-5428	58	26	flies	fly	NOUN
aisthesis-5428	58	27	,	,	PUNCT
aisthesis-5428	58	28	and	and	CCONJ
aisthesis-5428	58	29	progeny	progeny	VERB
aisthesis-5428	58	30	from	from	ADP
aisthesis-5428	58	31	the	the	DET
aisthesis-5428	58	32	reciprocal	reciprocal	ADJ
aisthesis-5428	58	33	crosses	crosse	NOUN
aisthesis-5428	58	34	(	(	PUNCT
aisthesis-5428	58	35	f1	f1	NOUN
aisthesis-5428	58	36	generation	generation	NOUN
aisthesis-5428	58	37	flies	fly	VERB
aisthesis-5428	58	38	from	from	ADP
aisthesis-5428	58	39	wtm1/2	wtm1/2	PROPN
aisthesis-5428	58	40	)	)	PUNCT
aisthesis-5428	58	41	so	so	SCONJ
aisthesis-5428	58	42	that	that	SCONJ
aisthesis-5428	58	43	it	it	PRON
aisthesis-5428	58	44	could	could	AUX
aisthesis-5428	58	45	be	be	AUX
aisthesis-5428	58	46	subjected	subject	VERB
aisthesis-5428	58	47	to	to	ADP
aisthesis-5428	58	48	subsequent	subsequent	ADJ
aisthesis-5428	58	49	pcr	pcr	PROPN
aisthesis-5428	58	50	and	and	CCONJ
aisthesis-5428	58	51	gel	gel	NOUN
aisthesis-5428	58	52	electrophoresis	electrophoresis	NOUN
aisthesis-5428	58	53	.	.	PUNCT
aisthesis-5428	59	1	flies	fly	NOUN
aisthesis-5428	59	2	were	be	AUX
aisthesis-5428	59	3	macerated	macerate	VERB
aisthesis-5428	59	4	in	in	ADP
aisthesis-5428	59	5	a	a	DET
aisthesis-5428	59	6	solution	solution	NOUN
aisthesis-5428	59	7	of	of	ADP
aisthesis-5428	59	8	50	50	NUM
aisthesis-5428	59	9	mm	mm	NOUN
aisthesis-5428	59	10	tris	tris	NOUN
aisthesis-5428	59	11	-	-	PUNCT
aisthesis-5428	59	12	hcl	hcl	PROPN
aisthesis-5428	59	13	and	and	CCONJ
aisthesis-5428	59	14	10	10	NUM
aisthesis-5428	59	15	mm	mm	PROPN
aisthesis-5428	59	16	ethylenediamine	ethylenediamine	NOUN
aisthesis-5428	59	17	tetra	tetra	NOUN
aisthesis-5428	59	18	acetic	acetic	ADJ
aisthesis-5428	59	19	acid	acid	NOUN
aisthesis-5428	59	20	(	(	PUNCT
aisthesis-5428	59	21	edta	edta	NOUN
aisthesis-5428	59	22	)	)	PUNCT
aisthesis-5428	59	23	in	in	ADP
aisthesis-5428	59	24	order	order	NOUN
aisthesis-5428	59	25	to	to	PART
aisthesis-5428	59	26	disrupt	disrupt	VERB
aisthesis-5428	59	27	cell	cell	NOUN
aisthesis-5428	59	28	membranes	membrane	NOUN
aisthesis-5428	59	29	physically	physically	ADV
aisthesis-5428	59	30	and	and	CCONJ
aisthesis-5428	59	31	chemically	chemically	ADV
aisthesis-5428	59	32	.	.	PUNCT
aisthesis-5428	60	1	maceration	maceration	NOUN
aisthesis-5428	60	2	physically	physically	ADV
aisthesis-5428	60	3	allowed	allow	VERB
aisthesis-5428	60	4	for	for	SCONJ
aisthesis-5428	60	5	the	the	DET
aisthesis-5428	60	6	cells	cell	NOUN
aisthesis-5428	60	7	to	to	PART
aisthesis-5428	60	8	be	be	AUX
aisthesis-5428	60	9	broken	break	VERB
aisthesis-5428	60	10	open	open	ADJ
aisthesis-5428	60	11	,	,	PUNCT
aisthesis-5428	60	12	and	and	CCONJ
aisthesis-5428	60	13	edta	edta	NOUN
aisthesis-5428	60	14	served	serve	VERB
aisthesis-5428	60	15	as	as	ADP
aisthesis-5428	60	16	a	a	DET
aisthesis-5428	60	17	detergent	detergent	NOUN
aisthesis-5428	60	18	to	to	PART
aisthesis-5428	60	19	dissolve	dissolve	VERB
aisthesis-5428	60	20	membrane	membrane	NOUN
aisthesis-5428	60	21	lipids	lipid	NOUN
aisthesis-5428	60	22	while	while	SCONJ
aisthesis-5428	60	23	tris	tris	NOUN
aisthesis-5428	60	24	-	-	PUNCT
aisthesis-5428	60	25	hcl	hcl	PROPN
aisthesis-5428	60	26	acted	act	VERB
aisthesis-5428	60	27	as	as	ADP
aisthesis-5428	60	28	a	a	DET
aisthesis-5428	60	29	buffer	buffer	NOUN
aisthesis-5428	60	30	.	.	PUNCT
aisthesis-5428	61	1	20	20	NUM
aisthesis-5428	61	2	mm	mm	NOUN
aisthesis-5428	61	3	naoh	naoh	NOUN
aisthesis-5428	61	4	,	,	PUNCT
aisthesis-5428	61	5	which	which	PRON
aisthesis-5428	61	6	denatures	denature	VERB
aisthesis-5428	61	7	dna	dna	PROPN
aisthesis-5428	61	8	,	,	PUNCT
aisthesis-5428	61	9	and	and	CCONJ
aisthesis-5428	61	10	1	1	NUM
aisthesis-5428	61	11	%	%	NOUN
aisthesis-5428	61	12	sds	sds	NOUN
aisthesis-5428	61	13	,	,	PUNCT
aisthesis-5428	61	14	which	which	PRON
aisthesis-5428	61	15	dissolves	dissolve	VERB
aisthesis-5428	61	16	lipids	lipid	NOUN
aisthesis-5428	61	17	and	and	CCONJ
aisthesis-5428	61	18	denatures	denature	NOUN
aisthesis-5428	61	19	proteins	protein	NOUN
aisthesis-5428	61	20	,	,	PUNCT
aisthesis-5428	61	21	were	be	AUX
aisthesis-5428	61	22	then	then	ADV
aisthesis-5428	61	23	added	add	VERB
aisthesis-5428	61	24	to	to	ADP
aisthesis-5428	61	25	the	the	DET
aisthesis-5428	61	26	sample	sample	NOUN
aisthesis-5428	61	27	.	.	PUNCT
aisthesis-5428	62	1	this	this	DET
aisthesis-5428	62	2	step	step	NOUN
aisthesis-5428	62	3	was	be	AUX
aisthesis-5428	62	4	vital	vital	ADJ
aisthesis-5428	62	5	to	to	ADP
aisthesis-5428	62	6	disrupting	disrupt	VERB
aisthesis-5428	62	7	the	the	DET
aisthesis-5428	62	8	histones	histone	NOUN
aisthesis-5428	62	9	and	and	CCONJ
aisthesis-5428	62	10	other	other	ADJ
aisthesis-5428	62	11	molecules	molecule	NOUN
aisthesis-5428	62	12	which	which	PRON
aisthesis-5428	62	13	are	be	AUX
aisthesis-5428	62	14	bound	bind	VERB
aisthesis-5428	62	15	to	to	ADP
aisthesis-5428	62	16	and	and	CCONJ
aisthesis-5428	62	17	surrounding	surround	VERB
aisthesis-5428	62	18	dna	dna	NOUN
aisthesis-5428	62	19	.	.	PUNCT
aisthesis-5428	63	1	3	3	NUM
aisthesis-5428	63	2	m	m	NOUN
aisthesis-5428	63	3	potassium	potassium	NOUN
aisthesis-5428	63	4	acetate	acetate	NOUN
aisthesis-5428	63	5	was	be	AUX
aisthesis-5428	63	6	added	add	VERB
aisthesis-5428	63	7	to	to	PART
aisthesis-5428	63	8	precipitate	precipitate	VERB
aisthesis-5428	63	9	excess	excess	ADJ
aisthesis-5428	63	10	material	material	NOUN
aisthesis-5428	63	11	like	like	ADP
aisthesis-5428	63	12	lipids	lipid	NOUN
aisthesis-5428	63	13	and	and	CCONJ
aisthesis-5428	63	14	proteins	protein	NOUN
aisthesis-5428	63	15	,	,	PUNCT
aisthesis-5428	63	16	which	which	PRON
aisthesis-5428	63	17	were	be	AUX
aisthesis-5428	63	18	then	then	ADV
aisthesis-5428	63	19	removed	remove	VERB
aisthesis-5428	63	20	via	via	ADP
aisthesis-5428	63	21	centrifugation	centrifugation	NOUN
aisthesis-5428	63	22	and	and	CCONJ
aisthesis-5428	63	23	extraction	extraction	NOUN
aisthesis-5428	63	24	.	.	PUNCT
aisthesis-5428	64	1	the	the	DET
aisthesis-5428	64	2	isolated	isolated	ADJ
aisthesis-5428	64	3	solution	solution	NOUN
aisthesis-5428	64	4	of	of	ADP
aisthesis-5428	64	5	dna	dna	PROPN
aisthesis-5428	64	6	was	be	AUX
aisthesis-5428	64	7	then	then	ADV
aisthesis-5428	64	8	treated	treat	VERB
aisthesis-5428	64	9	with	with	ADP
aisthesis-5428	64	10	cold	cold	ADJ
aisthesis-5428	64	11	100	100	NUM
aisthesis-5428	64	12	%	%	NOUN
aisthesis-5428	64	13	isopropanol	isopropanol	NOUN
aisthesis-5428	64	14	followed	follow	VERB
aisthesis-5428	64	15	by	by	ADP
aisthesis-5428	64	16	another	another	DET
aisthesis-5428	64	17	round	round	NOUN
aisthesis-5428	64	18	of	of	ADP
aisthesis-5428	64	19	centrifugation	centrifugation	NOUN
aisthesis-5428	64	20	to	to	PART
aisthesis-5428	64	21	precipitate	precipitate	VERB
aisthesis-5428	64	22	the	the	DET
aisthesis-5428	64	23	dna	dna	NOUN
aisthesis-5428	64	24	into	into	ADP
aisthesis-5428	64	25	a	a	DET
aisthesis-5428	64	26	pellet	pellet	NOUN
aisthesis-5428	64	27	form	form	NOUN
aisthesis-5428	64	28	.	.	PUNCT
aisthesis-5428	65	1	f.	f.	PROPN
aisthesis-5428	65	2	polymerase	polymerase	PROPN
aisthesis-5428	65	3	chain	chain	NOUN
aisthesis-5428	65	4	reaction	reaction	NOUN
aisthesis-5428	65	5	the	the	DET
aisthesis-5428	65	6	polymerase	polymerase	NOUN
aisthesis-5428	65	7	chain	chain	NOUN
aisthesis-5428	65	8	reaction	reaction	NOUN
aisthesis-5428	65	9	was	be	AUX
aisthesis-5428	65	10	used	use	VERB
aisthesis-5428	65	11	to	to	PART
aisthesis-5428	65	12	amplify	amplify	VERB
aisthesis-5428	65	13	the	the	DET
aisthesis-5428	65	14	subsection	subsection	NOUN
aisthesis-5428	65	15	of	of	ADP
aisthesis-5428	65	16	dna	dna	PROPN
aisthesis-5428	65	17	where	where	SCONJ
aisthesis-5428	65	18	the	the	DET
aisthesis-5428	65	19	trex	trex	PROPN
aisthesis-5428	65	20	gene	gene	NOUN
aisthesis-5428	65	21	is	be	AUX
aisthesis-5428	65	22	located	locate	VERB
aisthesis-5428	65	23	in	in	ADP
aisthesis-5428	65	24	order	order	NOUN
aisthesis-5428	65	25	to	to	PART
aisthesis-5428	65	26	then	then	ADV
aisthesis-5428	65	27	analyze	analyze	VERB
aisthesis-5428	65	28	it	it	PRON
aisthesis-5428	65	29	via	via	ADP
aisthesis-5428	65	30	gel	gel	NOUN
aisthesis-5428	65	31	electrophoresis	electrophoresis	NOUN
aisthesis-5428	65	32	.	.	PUNCT
aisthesis-5428	66	1	a	a	DET
aisthesis-5428	66	2	pcr	pcr	NOUN
aisthesis-5428	66	3	master	master	NOUN
aisthesis-5428	66	4	mix	mix	NOUN
aisthesis-5428	66	5	containing	contain	VERB
aisthesis-5428	66	6	taq	taq	NOUN
aisthesis-5428	66	7	polymerase	polymerase	NOUN
aisthesis-5428	66	8	,	,	PUNCT
aisthesis-5428	66	9	dntps	dntps	NOUN
aisthesis-5428	66	10	,	,	PUNCT
aisthesis-5428	66	11	mgcl2	mgcl2	NOUN
aisthesis-5428	66	12	and	and	CCONJ
aisthesis-5428	66	13	buffer	buffer	NOUN
aisthesis-5428	66	14	(	(	PUNCT
aisthesis-5428	66	15	containing	contain	VERB
aisthesis-5428	66	16	tris	tris	NOUN
aisthesis-5428	66	17	-	-	PUNCT
aisthesis-5428	66	18	hcl	hcl	NOUN
aisthesis-5428	66	19	and	and	CCONJ
aisthesis-5428	66	20	potassium	potassium	NOUN
aisthesis-5428	66	21	chloride	chloride	NOUN
aisthesis-5428	66	22	)	)	PUNCT
aisthesis-5428	66	23	was	be	AUX
aisthesis-5428	66	24	used	use	VERB
aisthesis-5428	66	25	.	.	PUNCT
aisthesis-5428	67	1	taq	taq	NOUN
aisthesis-5428	67	2	polymerase	polymerase	NOUN
aisthesis-5428	67	3	was	be	AUX
aisthesis-5428	67	4	utilized	utilize	VERB
aisthesis-5428	67	5	to	to	PART
aisthesis-5428	67	6	construct	construct	VERB
aisthesis-5428	67	7	complementary	complementary	ADJ
aisthesis-5428	67	8	strands	strand	NOUN
aisthesis-5428	67	9	of	of	ADP
aisthesis-5428	67	10	dna	dna	NOUN
aisthesis-5428	67	11	from	from	ADP
aisthesis-5428	67	12	the	the	DET
aisthesis-5428	67	13	template	template	NOUN
aisthesis-5428	67	14	strands	strand	NOUN
aisthesis-5428	67	15	,	,	PUNCT
aisthesis-5428	67	16	chosen	choose	VERB
aisthesis-5428	67	17	especially	especially	ADV
aisthesis-5428	67	18	for	for	ADP
aisthesis-5428	67	19	its	its	PRON
aisthesis-5428	67	20	ability	ability	NOUN
aisthesis-5428	67	21	to	to	PART
aisthesis-5428	67	22	withstand	withstand	VERB
aisthesis-5428	67	23	the	the	DET
aisthesis-5428	67	24	high	high	ADJ
aisthesis-5428	67	25	temperatures	temperature	NOUN
aisthesis-5428	67	26	of	of	ADP
aisthesis-5428	67	27	pcr	pcr	PROPN
aisthesis-5428	67	28	thermocycling	thermocycling	NOUN
aisthesis-5428	67	29	,	,	PUNCT
aisthesis-5428	67	30	as	as	SCONJ
aisthesis-5428	67	31	it	it	PRON
aisthesis-5428	67	32	comes	come	VERB
aisthesis-5428	67	33	from	from	ADP
aisthesis-5428	67	34	the	the	DET
aisthesis-5428	67	35	thermostable	thermostable	NOUN
aisthesis-5428	67	36	archaebacterium	archaebacterium	NOUN
aisthesis-5428	67	37	thermus	thermus	NOUN
aisthesis-5428	67	38	aquaticus	aquaticus	PROPN
aisthesis-5428	67	39	.	.	PUNCT
aisthesis-5428	68	1	dntps	dntps	PROPN
aisthesis-5428	68	2	were	be	AUX
aisthesis-5428	68	3	necessary	necessary	ADJ
aisthesis-5428	68	4	material	material	NOUN
aisthesis-5428	68	5	for	for	ADP
aisthesis-5428	68	6	taq	taq	NOUN
aisthesis-5428	68	7	polymerase	polymerase	NOUN
aisthesis-5428	68	8	to	to	PART
aisthesis-5428	68	9	synthesize	synthesize	VERB
aisthesis-5428	68	10	the	the	DET
aisthesis-5428	68	11	new	new	ADJ
aisthesis-5428	68	12	strands	strand	NOUN
aisthesis-5428	68	13	of	of	ADP
aisthesis-5428	68	14	dna	dna	NOUN
aisthesis-5428	68	15	,	,	PUNCT
aisthesis-5428	68	16	while	while	SCONJ
aisthesis-5428	68	17	mgcl2	mgcl2	NOUN
aisthesis-5428	68	18	and	and	CCONJ
aisthesis-5428	68	19	buffer	buffer	NOUN
aisthesis-5428	68	20	were	be	AUX
aisthesis-5428	68	21	used	use	VERB
aisthesis-5428	68	22	to	to	PART
aisthesis-5428	68	23	stabilize	stabilize	VERB
aisthesis-5428	68	24	the	the	DET
aisthesis-5428	68	25	reaction	reaction	NOUN
aisthesis-5428	68	26	and	and	CCONJ
aisthesis-5428	68	27	provide	provide	VERB
aisthesis-5428	68	28	optimum	optimum	ADJ
aisthesis-5428	68	29	conditions	condition	NOUN
aisthesis-5428	68	30	for	for	ADP
aisthesis-5428	68	31	the	the	DET
aisthesis-5428	68	32	functionality	functionality	NOUN
aisthesis-5428	68	33	of	of	ADP
aisthesis-5428	68	34	taq	taq	NOUN
aisthesis-5428	68	35	polymerase	polymerase	NOUN
aisthesis-5428	68	36	.	.	PUNCT
aisthesis-5428	69	1	forward	forward	ADV
aisthesis-5428	69	2	and	and	CCONJ
aisthesis-5428	69	3	reverse	reverse	ADJ
aisthesis-5428	69	4	primers	primer	NOUN
aisthesis-5428	69	5	were	be	AUX
aisthesis-5428	69	6	utilized	utilize	VERB
aisthesis-5428	69	7	to	to	PART
aisthesis-5428	69	8	bind	bind	VERB
aisthesis-5428	69	9	to	to	ADP
aisthesis-5428	69	10	the	the	DET
aisthesis-5428	69	11	dna	dna	PROPN
aisthesis-5428	69	12	segment	segment	NOUN
aisthesis-5428	69	13	of	of	ADP
aisthesis-5428	69	14	interest	interest	NOUN
aisthesis-5428	69	15	,	,	PUNCT
aisthesis-5428	69	16	providing	provide	VERB
aisthesis-5428	69	17	a	a	DET
aisthesis-5428	69	18	locus	locus	NOUN
aisthesis-5428	69	19	at	at	ADP
aisthesis-5428	69	20	which	which	PRON
aisthesis-5428	69	21	taq	taq	NOUN
aisthesis-5428	69	22	polymerase	polymerase	NOUN
aisthesis-5428	69	23	could	could	AUX
aisthesis-5428	69	24	bind	bind	VERB
aisthesis-5428	69	25	.	.	PUNCT
aisthesis-5428	70	1	these	these	DET
aisthesis-5428	70	2	primer	primer	NOUN
aisthesis-5428	70	3	sequences	sequence	NOUN
aisthesis-5428	70	4	were	be	AUX
aisthesis-5428	70	5	gactgcttggcagcaatgt	gactgcttggcagcaatgt	ADJ
aisthesis-5428	70	6	and	and	CCONJ
aisthesis-5428	70	7	tccttggtttttgcagttcc	tccttggtttttgcagttcc	ADJ
aisthesis-5428	70	8	,	,	PUNCT
aisthesis-5428	70	9	respectively	respectively	ADV
aisthesis-5428	70	10	.	.	PUNCT
aisthesis-5428	71	1	gapdh	gapdh	NOUN
aisthesis-5428	71	2	primers	primer	NOUN
aisthesis-5428	71	3	,	,	PUNCT
aisthesis-5428	71	4	expressed	express	VERB
aisthesis-5428	71	5	constitutively	constitutively	ADV
aisthesis-5428	71	6	in	in	ADP
aisthesis-5428	71	7	most	most	ADJ
aisthesis-5428	71	8	cells	cell	NOUN
aisthesis-5428	71	9	,	,	PUNCT
aisthesis-5428	71	10	were	be	AUX
aisthesis-5428	71	11	also	also	ADV
aisthesis-5428	71	12	utilized	utilize	VERB
aisthesis-5428	71	13	to	to	PART
aisthesis-5428	71	14	synthesize	synthesize	VERB
aisthesis-5428	71	15	positive	positive	ADJ
aisthesis-5428	71	16	control	control	NOUN
aisthesis-5428	71	17	pcr	pcr	ADJ
aisthesis-5428	71	18	strands	strand	NOUN
aisthesis-5428	71	19	.	.	PUNCT
aisthesis-5428	72	1	each	each	DET
aisthesis-5428	72	2	sample	sample	NOUN
aisthesis-5428	72	3	for	for	ADP
aisthesis-5428	72	4	pcr	pcr	NOUN
aisthesis-5428	72	5	contained	contain	VERB
aisthesis-5428	72	6	equal	equal	ADJ
aisthesis-5428	72	7	volumes	volume	NOUN
aisthesis-5428	72	8	of	of	ADP
aisthesis-5428	72	9	solution	solution	NOUN
aisthesis-5428	72	10	composed	compose	VERB
aisthesis-5428	72	11	of	of	ADP
aisthesis-5428	72	12	pcr	pcr	ADJ
aisthesis-5428	72	13	master	master	NOUN
aisthesis-5428	72	14	mix	mix	NOUN
aisthesis-5428	72	15	,	,	PUNCT
aisthesis-5428	72	16	a	a	DET
aisthesis-5428	72	17	variable	variable	ADJ
aisthesis-5428	72	18	volume	volume	NOUN
aisthesis-5428	72	19	of	of	ADP
aisthesis-5428	72	20	dna	dna	PROPN
aisthesis-5428	72	21	according	accord	VERB
aisthesis-5428	72	22	to	to	ADP
aisthesis-5428	72	23	the	the	DET
aisthesis-5428	72	24	concentration	concentration	NOUN
aisthesis-5428	72	25	of	of	ADP
aisthesis-5428	72	26	the	the	DET
aisthesis-5428	72	27	dna	dna	PROPN
aisthesis-5428	72	28	sample	sample	NOUN
aisthesis-5428	72	29	,	,	PUNCT
aisthesis-5428	72	30	and	and	CCONJ
aisthesis-5428	72	31	a	a	DET
aisthesis-5428	72	32	variable	variable	ADJ
aisthesis-5428	72	33	volume	volume	NOUN
aisthesis-5428	72	34	of	of	ADP
aisthesis-5428	72	35	sterile	sterile	ADJ
aisthesis-5428	72	36	water	water	NOUN
aisthesis-5428	72	37	to	to	PART
aisthesis-5428	72	38	equalize	equalize	VERB
aisthesis-5428	72	39	pcr	pcr	ADJ
aisthesis-5428	72	40	solution	solution	NOUN
aisthesis-5428	72	41	volume	volume	NOUN
aisthesis-5428	72	42	.	.	PUNCT
aisthesis-5428	73	1	for	for	ADP
aisthesis-5428	73	2	each	each	DET
aisthesis-5428	73	3	dna	dna	PROPN
aisthesis-5428	73	4	type	type	NOUN
aisthesis-5428	73	5	(	(	PUNCT
aisthesis-5428	73	6	wt	wt	NOUN
aisthesis-5428	73	7	,	,	PUNCT
aisthesis-5428	73	8	trex	trex	PROPN
aisthesis-5428	73	9	,	,	PUNCT
aisthesis-5428	73	10	and	and	CCONJ
aisthesis-5428	73	11	wtm	wtm	PROPN
aisthesis-5428	73	12	f1	f1	PROPN
aisthesis-5428	73	13	)	)	PUNCT
aisthesis-5428	73	14	,	,	PUNCT
aisthesis-5428	73	15	a	a	DET
aisthesis-5428	73	16	first	first	ADJ
aisthesis-5428	73	17	sample	sample	NOUN
aisthesis-5428	73	18	was	be	AUX
aisthesis-5428	73	19	made	make	VERB
aisthesis-5428	73	20	containing	contain	VERB
aisthesis-5428	73	21	forward	forward	ADV
aisthesis-5428	73	22	and	and	CCONJ
aisthesis-5428	73	23	reverse	reverse	VERB
aisthesis-5428	73	24	mutant	mutant	ADJ
aisthesis-5428	73	25	primers	primer	NOUN
aisthesis-5428	73	26	,	,	PUNCT
aisthesis-5428	73	27	a	a	DET
aisthesis-5428	73	28	second	second	ADJ
aisthesis-5428	73	29	sample	sample	NOUN
aisthesis-5428	73	30	was	be	AUX
aisthesis-5428	73	31	made	make	VERB
aisthesis-5428	73	32	containing	contain	VERB
aisthesis-5428	73	33	gapdh	gapdh	NOUN
aisthesis-5428	73	34	forward	forward	ADV
aisthesis-5428	73	35	and	and	CCONJ
aisthesis-5428	73	36	reverse	reverse	VERB
aisthesis-5428	73	37	primers	primer	NOUN
aisthesis-5428	73	38	(	(	PUNCT
aisthesis-5428	73	39	positive	positive	ADJ
aisthesis-5428	73	40	control	control	NOUN
aisthesis-5428	73	41	)	)	PUNCT
aisthesis-5428	73	42	,	,	PUNCT
aisthesis-5428	73	43	and	and	CCONJ
aisthesis-5428	73	44	a	a	DET
aisthesis-5428	73	45	third	third	ADJ
aisthesis-5428	73	46	sample	sample	NOUN
aisthesis-5428	73	47	was	be	AUX
aisthesis-5428	73	48	made	make	VERB
aisthesis-5428	73	49	containing	contain	VERB
aisthesis-5428	73	50	no	no	DET
aisthesis-5428	73	51	analysis	analysis	NOUN
aisthesis-5428	73	52	of	of	ADP
aisthesis-5428	73	53	novel	novel	ADJ
aisthesis-5428	73	54	unknown	unknown	ADJ
aisthesis-5428	73	55	d.	d.	NOUN
aisthesis-5428	73	56	melanogaster	melanogaster	NOUN
aisthesis-5428	73	57	mutation	mutation	NOUN
aisthesis-5428	73	58	trex	trex	PROPN
aisthesis-5428	73	59	aisthesis	aisthesis	NOUN
aisthesis-5428	73	60	volume	volume	NOUN
aisthesis-5428	73	61	14	14	NUM
aisthesis-5428	73	62	,	,	PUNCT
aisthesis-5428	73	63	202358	202358	NUM
aisthesis-5428	73	64	primers	primer	NOUN
aisthesis-5428	73	65	(	(	PUNCT
aisthesis-5428	73	66	negative	negative	ADJ
aisthesis-5428	73	67	control	control	NOUN
aisthesis-5428	73	68	)	)	PUNCT
aisthesis-5428	73	69	.	.	PUNCT
aisthesis-5428	74	1	from	from	ADP
aisthesis-5428	74	2	dna	dna	PROPN
aisthesis-5428	74	3	extraction	extraction	NOUN
aisthesis-5428	74	4	,	,	PUNCT
aisthesis-5428	74	5	wt	wt	PROPN
aisthesis-5428	74	6	dna	dna	PROPN
aisthesis-5428	74	7	was	be	AUX
aisthesis-5428	74	8	isolated	isolate	VERB
aisthesis-5428	74	9	in	in	ADP
aisthesis-5428	74	10	a	a	DET
aisthesis-5428	74	11	concentration	concentration	NOUN
aisthesis-5428	74	12	of	of	ADP
aisthesis-5428	74	13	0.1190	0.1190	NUM
aisthesis-5428	74	14	μg	μg	PROPN
aisthesis-5428	74	15	/	/	SYM
aisthesis-5428	74	16	μl	μl	PROPN
aisthesis-5428	74	17	,	,	PUNCT
aisthesis-5428	74	18	trex	trex	PROPN
aisthesis-5428	74	19	dna	dna	PROPN
aisthesis-5428	74	20	was	be	AUX
aisthesis-5428	74	21	isolated	isolate	VERB
aisthesis-5428	74	22	in	in	ADP
aisthesis-5428	74	23	a	a	DET
aisthesis-5428	74	24	concentration	concentration	NOUN
aisthesis-5428	74	25	of	of	ADP
aisthesis-5428	74	26	0.0565	0.0565	NUM
aisthesis-5428	74	27	μg	μg	PROPN
aisthesis-5428	74	28	/	/	SYM
aisthesis-5428	74	29	μl	μl	PROPN
aisthesis-5428	74	30	,	,	PUNCT
aisthesis-5428	74	31	and	and	CCONJ
aisthesis-5428	74	32	wtm	wtm	PROPN
aisthesis-5428	74	33	f1	f1	PROPN
aisthesis-5428	74	34	dna	dna	PROPN
aisthesis-5428	74	35	was	be	AUX
aisthesis-5428	74	36	isolated	isolate	VERB
aisthesis-5428	74	37	in	in	ADP
aisthesis-5428	74	38	a	a	DET
aisthesis-5428	74	39	concentration	concentration	NOUN
aisthesis-5428	74	40	of	of	ADP
aisthesis-5428	74	41	0.2193	0.2193	NUM
aisthesis-5428	74	42	μg	μg	PROPN
aisthesis-5428	74	43	/	/	SYM
aisthesis-5428	74	44	μl	μl	PROPN
aisthesis-5428	74	45	.	.	PUNCT
aisthesis-5428	75	1	as	as	ADP
aisthesis-5428	75	2	such	such	ADJ
aisthesis-5428	75	3	,	,	PUNCT
aisthesis-5428	75	4	2	2	NUM
aisthesis-5428	75	5	μl	μl	ADP
aisthesis-5428	75	6	of	of	ADP
aisthesis-5428	75	7	wt	wt	PROPN
aisthesis-5428	75	8	dna	dna	PROPN
aisthesis-5428	75	9	,	,	PUNCT
aisthesis-5428	75	10	3.5	3.5	NUM
aisthesis-5428	75	11	μl	μl	NOUN
aisthesis-5428	75	12	of	of	ADP
aisthesis-5428	75	13	trex	trex	PROPN
aisthesis-5428	75	14	dna	dna	PROPN
aisthesis-5428	75	15	,	,	PUNCT
aisthesis-5428	75	16	and	and	CCONJ
aisthesis-5428	75	17	1	1	NUM
aisthesis-5428	75	18	μl	μl	NOUN
aisthesis-5428	75	19	of	of	ADP
aisthesis-5428	75	20	wtm	wtm	PROPN
aisthesis-5428	75	21	f1	f1	PROPN
aisthesis-5428	75	22	were	be	AUX
aisthesis-5428	75	23	added	add	VERB
aisthesis-5428	75	24	to	to	ADP
aisthesis-5428	75	25	their	their	PRON
aisthesis-5428	75	26	respective	respective	ADJ
aisthesis-5428	75	27	samples	sample	NOUN
aisthesis-5428	75	28	so	so	SCONJ
aisthesis-5428	75	29	that	that	SCONJ
aisthesis-5428	75	30	there	there	PRON
aisthesis-5428	75	31	were	be	VERB
aisthesis-5428	75	32	nearly	nearly	ADV
aisthesis-5428	75	33	equal	equal	ADJ
aisthesis-5428	75	34	amounts	amount	NOUN
aisthesis-5428	75	35	of	of	ADP
aisthesis-5428	75	36	dna	dna	NOUN
aisthesis-5428	75	37	in	in	ADP
aisthesis-5428	75	38	each	each	DET
aisthesis-5428	75	39	pcr	pcr	ADJ
aisthesis-5428	75	40	solution	solution	NOUN
aisthesis-5428	75	41	.	.	PUNCT
aisthesis-5428	76	1	once	once	SCONJ
aisthesis-5428	76	2	the	the	DET
aisthesis-5428	76	3	9	9	NUM
aisthesis-5428	76	4	respective	respective	ADJ
aisthesis-5428	76	5	samples	sample	NOUN
aisthesis-5428	76	6	of	of	ADP
aisthesis-5428	76	7	pcr	pcr	ADJ
aisthesis-5428	76	8	solutions	solution	NOUN
aisthesis-5428	76	9	were	be	AUX
aisthesis-5428	76	10	prepared	prepare	VERB
aisthesis-5428	76	11	,	,	PUNCT
aisthesis-5428	76	12	they	they	PRON
aisthesis-5428	76	13	were	be	AUX
aisthesis-5428	76	14	run	run	VERB
aisthesis-5428	76	15	through	through	ADP
aisthesis-5428	76	16	pcr	pcr	ADJ
aisthesis-5428	76	17	thermocycling	thermocycling	NOUN
aisthesis-5428	76	18	of	of	ADP
aisthesis-5428	76	19	denaturation	denaturation	NOUN
aisthesis-5428	76	20	at	at	ADP
aisthesis-5428	76	21	96ºc	96ºc	ADV
aisthesis-5428	76	22	,	,	PUNCT
aisthesis-5428	76	23	annealing	anneal	VERB
aisthesis-5428	76	24	at	at	ADP
aisthesis-5428	76	25	57ºc	57ºc	NOUN
aisthesis-5428	76	26	,	,	PUNCT
aisthesis-5428	76	27	and	and	CCONJ
aisthesis-5428	76	28	elongation	elongation	NOUN
aisthesis-5428	76	29	at	at	ADP
aisthesis-5428	76	30	72ºc	72ºc	ADJ
aisthesis-5428	76	31	.	.	PUNCT
aisthesis-5428	77	1	this	this	DET
aisthesis-5428	77	2	cycle	cycle	NOUN
aisthesis-5428	77	3	was	be	AUX
aisthesis-5428	77	4	repeated	repeat	VERB
aisthesis-5428	77	5	about	about	ADP
aisthesis-5428	77	6	30	30	NUM
aisthesis-5428	77	7	times	time	NOUN
aisthesis-5428	77	8	to	to	PART
aisthesis-5428	77	9	exponentially	exponentially	ADV
aisthesis-5428	77	10	amplify	amplify	VERB
aisthesis-5428	77	11	our	our	PRON
aisthesis-5428	77	12	target	target	NOUN
aisthesis-5428	77	13	sequence	sequence	NOUN
aisthesis-5428	77	14	.	.	PUNCT
aisthesis-5428	78	1	g.	g.	PROPN
aisthesis-5428	78	2	gel	gel	PROPN
aisthesis-5428	78	3	electrophoresis	electrophoresis	NOUN
aisthesis-5428	78	4	the	the	DET
aisthesis-5428	78	5	pcr	pcr	NOUN
aisthesis-5428	78	6	amplified	amplify	VERB
aisthesis-5428	78	7	target	target	NOUN
aisthesis-5428	78	8	sequences	sequence	NOUN
aisthesis-5428	78	9	of	of	ADP
aisthesis-5428	78	10	dna	dna	PROPN
aisthesis-5428	78	11	were	be	AUX
aisthesis-5428	78	12	visualized	visualize	VERB
aisthesis-5428	78	13	using	use	VERB
aisthesis-5428	78	14	agarose	agarose	NOUN
aisthesis-5428	78	15	gel	gel	NOUN
aisthesis-5428	78	16	electrophoresis	electrophoresis	NOUN
aisthesis-5428	78	17	in	in	ADP
aisthesis-5428	78	18	order	order	NOUN
aisthesis-5428	78	19	to	to	PART
aisthesis-5428	78	20	make	make	VERB
aisthesis-5428	78	21	qualitative	qualitative	ADJ
aisthesis-5428	78	22	observations	observation	NOUN
aisthesis-5428	78	23	about	about	ADP
aisthesis-5428	78	24	the	the	DET
aisthesis-5428	78	25	nature	nature	NOUN
aisthesis-5428	78	26	of	of	ADP
aisthesis-5428	78	27	the	the	DET
aisthesis-5428	78	28	trex	trex	PROPN
aisthesis-5428	78	29	mutation	mutation	NOUN
aisthesis-5428	78	30	and	and	CCONJ
aisthesis-5428	78	31	confirm	confirm	VERB
aisthesis-5428	78	32	the	the	DET
aisthesis-5428	78	33	genetic	genetic	ADJ
aisthesis-5428	78	34	identity	identity	NOUN
aisthesis-5428	78	35	of	of	ADP
aisthesis-5428	78	36	wtm	wtm	PROPN
aisthesis-5428	78	37	f1	f1	PROPN
aisthesis-5428	78	38	.	.	PUNCT
aisthesis-5428	79	1	the	the	DET
aisthesis-5428	79	2	electric	electric	ADJ
aisthesis-5428	79	3	field	field	NOUN
aisthesis-5428	79	4	anode	anode	NOUN
aisthesis-5428	79	5	draws	draw	VERB
aisthesis-5428	79	6	the	the	DET
aisthesis-5428	79	7	negatively	negatively	ADV
aisthesis-5428	79	8	charged	charge	VERB
aisthesis-5428	79	9	dna	dna	NOUN
aisthesis-5428	79	10	through	through	ADP
aisthesis-5428	79	11	the	the	DET
aisthesis-5428	79	12	gel	gel	NOUN
aisthesis-5428	79	13	,	,	PUNCT
aisthesis-5428	79	14	with	with	ADP
aisthesis-5428	79	15	smaller	small	ADJ
aisthesis-5428	79	16	fragments	fragment	NOUN
aisthesis-5428	79	17	traveling	travel	VERB
aisthesis-5428	79	18	faster	fast	ADV
aisthesis-5428	79	19	through	through	ADP
aisthesis-5428	79	20	the	the	DET
aisthesis-5428	79	21	gel	gel	NOUN
aisthesis-5428	79	22	.	.	PUNCT
aisthesis-5428	80	1	a	a	DET
aisthesis-5428	80	2	tris	tris	ADJ
aisthesis-5428	80	3	-	-	PUNCT
aisthesis-5428	80	4	acetate	acetate	NOUN
aisthesis-5428	80	5	-	-	PUNCT
aisthesis-5428	80	6	edta	edta	NOUN
aisthesis-5428	80	7	(	(	PUNCT
aisthesis-5428	80	8	tae	tae	NOUN
aisthesis-5428	80	9	)	)	PUNCT
aisthesis-5428	80	10	running	running	NOUN
aisthesis-5428	80	11	buffer	buffer	NOUN
aisthesis-5428	80	12	was	be	AUX
aisthesis-5428	80	13	used	use	VERB
aisthesis-5428	80	14	in	in	ADP
aisthesis-5428	80	15	the	the	DET
aisthesis-5428	80	16	preparation	preparation	NOUN
aisthesis-5428	80	17	of	of	ADP
aisthesis-5428	80	18	two	two	NUM
aisthesis-5428	80	19	2	2	NUM
aisthesis-5428	80	20	%	%	NOUN
aisthesis-5428	80	21	agarose	agarose	NOUN
aisthesis-5428	80	22	gels	gel	NOUN
aisthesis-5428	80	23	in	in	ADP
aisthesis-5428	80	24	order	order	NOUN
aisthesis-5428	80	25	to	to	PART
aisthesis-5428	80	26	allow	allow	VERB
aisthesis-5428	80	27	the	the	DET
aisthesis-5428	80	28	flow	flow	NOUN
aisthesis-5428	80	29	of	of	ADP
aisthesis-5428	80	30	charge	charge	NOUN
aisthesis-5428	80	31	through	through	ADP
aisthesis-5428	80	32	the	the	DET
aisthesis-5428	80	33	gel	gel	NOUN
aisthesis-5428	80	34	.	.	PUNCT
aisthesis-5428	81	1	further	far	ADV
aisthesis-5428	81	2	,	,	PUNCT
aisthesis-5428	81	3	three	three	NUM
aisthesis-5428	81	4	dyes	dye	NOUN
aisthesis-5428	81	5	(	(	PUNCT
aisthesis-5428	81	6	xylene	xylene	NOUN
aisthesis-5428	81	7	cyanole	cyanole	NOUN
aisthesis-5428	81	8	,	,	PUNCT
aisthesis-5428	81	9	bromophenol	bromophenol	NOUN
aisthesis-5428	81	10	blue	blue	NOUN
aisthesis-5428	81	11	,	,	PUNCT
aisthesis-5428	81	12	and	and	CCONJ
aisthesis-5428	81	13	orange	orange	PROPN
aisthesis-5428	81	14	g	g	NOUN
aisthesis-5428	81	15	)	)	PUNCT
aisthesis-5428	81	16	were	be	AUX
aisthesis-5428	81	17	used	use	VERB
aisthesis-5428	81	18	as	as	ADP
aisthesis-5428	81	19	indicators	indicator	NOUN
aisthesis-5428	81	20	.	.	PUNCT
aisthesis-5428	82	1	a	a	DET
aisthesis-5428	82	2	ficoll	ficoll	NOUN
aisthesis-5428	82	3	loading	loading	NOUN
aisthesis-5428	82	4	buffer	buffer	NOUN
aisthesis-5428	82	5	was	be	AUX
aisthesis-5428	82	6	utilized	utilize	VERB
aisthesis-5428	82	7	to	to	PART
aisthesis-5428	82	8	improve	improve	VERB
aisthesis-5428	82	9	the	the	DET
aisthesis-5428	82	10	sedimentation	sedimentation	NOUN
aisthesis-5428	82	11	of	of	ADP
aisthesis-5428	82	12	dna	dna	PROPN
aisthesis-5428	82	13	samples	sample	NOUN
aisthesis-5428	82	14	within	within	ADP
aisthesis-5428	82	15	the	the	DET
aisthesis-5428	82	16	gel	gel	NOUN
aisthesis-5428	82	17	.	.	PUNCT
aisthesis-5428	83	1	a	a	DET
aisthesis-5428	83	2	control	control	NOUN
aisthesis-5428	83	3	ladder	ladder	NOUN
aisthesis-5428	83	4	and	and	CCONJ
aisthesis-5428	83	5	the	the	DET
aisthesis-5428	83	6	9	9	NUM
aisthesis-5428	83	7	samples	sample	NOUN
aisthesis-5428	83	8	made	make	VERB
aisthesis-5428	83	9	by	by	ADP
aisthesis-5428	83	10	pcr	pcr	NOUN
aisthesis-5428	83	11	were	be	AUX
aisthesis-5428	83	12	loaded	load	VERB
aisthesis-5428	83	13	into	into	ADP
aisthesis-5428	83	14	the	the	DET
aisthesis-5428	83	15	10	10	NUM
aisthesis-5428	83	16	wells	well	NOUN
aisthesis-5428	83	17	of	of	ADP
aisthesis-5428	83	18	the	the	DET
aisthesis-5428	83	19	first	first	ADJ
aisthesis-5428	83	20	agarose	agarose	NOUN
aisthesis-5428	83	21	gel	gel	NOUN
aisthesis-5428	83	22	.	.	PUNCT
aisthesis-5428	84	1	tas	tas	PROPN
aisthesis-5428	84	2	prepared	prepare	VERB
aisthesis-5428	84	3	additional	additional	ADJ
aisthesis-5428	84	4	trex	trex	ADJ
aisthesis-5428	84	5	and	and	CCONJ
aisthesis-5428	84	6	wild	wild	ADJ
aisthesis-5428	84	7	-	-	PUNCT
aisthesis-5428	84	8	type	type	NOUN
aisthesis-5428	84	9	pcr	pcr	ADJ
aisthesis-5428	84	10	products	product	NOUN
aisthesis-5428	84	11	which	which	PRON
aisthesis-5428	84	12	were	be	AUX
aisthesis-5428	84	13	run	run	VERB
aisthesis-5428	84	14	through	through	ADP
aisthesis-5428	84	15	a	a	DET
aisthesis-5428	84	16	second	second	ADJ
aisthesis-5428	84	17	gel	gel	NOUN
aisthesis-5428	84	18	for	for	ADP
aisthesis-5428	84	19	the	the	DET
aisthesis-5428	84	20	purpose	purpose	NOUN
aisthesis-5428	84	21	of	of	ADP
aisthesis-5428	84	22	a	a	DET
aisthesis-5428	84	23	standardized	standardized	ADJ
aisthesis-5428	84	24	comparison	comparison	NOUN
aisthesis-5428	84	25	.	.	PUNCT
aisthesis-5428	85	1	this	this	DET
aisthesis-5428	85	2	second	second	ADJ
aisthesis-5428	85	3	gel	gel	NOUN
aisthesis-5428	85	4	also	also	ADV
aisthesis-5428	85	5	contained	contain	VERB
aisthesis-5428	85	6	a	a	DET
aisthesis-5428	85	7	ladder	ladder	NOUN
aisthesis-5428	85	8	and	and	CCONJ
aisthesis-5428	85	9	positive	positive	ADJ
aisthesis-5428	85	10	and	and	CCONJ
aisthesis-5428	85	11	negative	negative	ADJ
aisthesis-5428	85	12	controls	control	NOUN
aisthesis-5428	85	13	.	.	PUNCT
aisthesis-5428	86	1	the	the	DET
aisthesis-5428	86	2	prepared	prepare	VERB
aisthesis-5428	86	3	gels	gel	NOUN
aisthesis-5428	86	4	were	be	AUX
aisthesis-5428	86	5	subjected	subject	VERB
aisthesis-5428	86	6	to	to	ADP
aisthesis-5428	86	7	112	112	NUM
aisthesis-5428	86	8	-	-	SYM
aisthesis-5428	86	9	125	125	NUM
aisthesis-5428	86	10	volts	volt	NOUN
aisthesis-5428	86	11	for	for	ADP
aisthesis-5428	86	12	45	45	NUM
aisthesis-5428	86	13	minutes	minute	NOUN
aisthesis-5428	86	14	.	.	PUNCT
aisthesis-5428	87	1	h.	h.	PROPN
aisthesis-5428	87	2	basic	basic	ADJ
aisthesis-5428	87	3	local	local	ADJ
aisthesis-5428	87	4	alignment	alignment	NOUN
aisthesis-5428	87	5	search	search	NOUN
aisthesis-5428	87	6	tool	tool	NOUN
aisthesis-5428	87	7	(	(	PUNCT
aisthesis-5428	87	8	blast	blast	NOUN
aisthesis-5428	87	9	)	)	PUNCT
aisthesis-5428	87	10	analysis	analysis	NOUN
aisthesis-5428	87	11	the	the	DET
aisthesis-5428	87	12	dna	dna	PROPN
aisthesis-5428	87	13	fragments	fragment	NOUN
aisthesis-5428	87	14	isolated	isolate	VERB
aisthesis-5428	87	15	and	and	CCONJ
aisthesis-5428	87	16	amplified	amplify	VERB
aisthesis-5428	87	17	by	by	ADP
aisthesis-5428	87	18	pcr	pcr	PROPN
aisthesis-5428	87	19	were	be	AUX
aisthesis-5428	87	20	sequenced	sequence	VERB
aisthesis-5428	87	21	using	use	VERB
aisthesis-5428	87	22	a	a	DET
aisthesis-5428	87	23	dideoxy	dideoxy	ADJ
aisthesis-5428	87	24	chain	chain	NOUN
aisthesis-5428	87	25	termination	termination	NOUN
aisthesis-5428	87	26	method	method	NOUN
aisthesis-5428	87	27	in	in	ADP
aisthesis-5428	87	28	which	which	PRON
aisthesis-5428	87	29	extracted	extract	VERB
aisthesis-5428	87	30	dna	dna	NOUN
aisthesis-5428	87	31	fragments	fragment	NOUN
aisthesis-5428	87	32	were	be	AUX
aisthesis-5428	87	33	treated	treat	VERB
aisthesis-5428	87	34	with	with	ADP
aisthesis-5428	87	35	dideoxynucleotides	dideoxynucleotide	NOUN
aisthesis-5428	87	36	(	(	PUNCT
aisthesis-5428	87	37	ddntps	ddntps	NOUN
aisthesis-5428	87	38	)	)	PUNCT
aisthesis-5428	87	39	tagged	tag	VERB
aisthesis-5428	87	40	with	with	ADP
aisthesis-5428	87	41	fluorescent	fluorescent	ADJ
aisthesis-5428	87	42	labels	label	NOUN
aisthesis-5428	87	43	of	of	ADP
aisthesis-5428	87	44	differing	differ	VERB
aisthesis-5428	87	45	wavelength	wavelength	NOUN
aisthesis-5428	87	46	depending	depend	VERB
aisthesis-5428	87	47	on	on	ADP
aisthesis-5428	87	48	the	the	DET
aisthesis-5428	87	49	nitrogenous	nitrogenous	ADJ
aisthesis-5428	87	50	base	base	NOUN
aisthesis-5428	87	51	identity	identity	NOUN
aisthesis-5428	87	52	of	of	ADP
aisthesis-5428	87	53	the	the	DET
aisthesis-5428	87	54	ddntp	ddntp	NOUN
aisthesis-5428	87	55	.	.	PUNCT
aisthesis-5428	88	1	ddntps	ddntp	NOUN
aisthesis-5428	88	2	do	do	AUX
aisthesis-5428	88	3	not	not	PART
aisthesis-5428	88	4	contain	contain	VERB
aisthesis-5428	88	5	a	a	DET
aisthesis-5428	88	6	hydroxyl	hydroxyl	NOUN
aisthesis-5428	88	7	group	group	NOUN
aisthesis-5428	88	8	and	and	CCONJ
aisthesis-5428	88	9	thus	thus	ADV
aisthesis-5428	88	10	terminate	terminate	VERB
aisthesis-5428	88	11	the	the	DET
aisthesis-5428	88	12	sequence	sequence	NOUN
aisthesis-5428	88	13	at	at	ADP
aisthesis-5428	88	14	different	different	ADJ
aisthesis-5428	88	15	lengths	length	NOUN
aisthesis-5428	88	16	;	;	PUNCT
aisthesis-5428	88	17	then	then	ADV
aisthesis-5428	88	18	,	,	PUNCT
aisthesis-5428	88	19	the	the	DET
aisthesis-5428	88	20	fluorescence	fluorescence	NOUN
aisthesis-5428	88	21	of	of	ADP
aisthesis-5428	88	22	the	the	DET
aisthesis-5428	88	23	different	different	ADJ
aisthesis-5428	88	24	length	length	NOUN
aisthesis-5428	88	25	chains	chain	NOUN
aisthesis-5428	88	26	is	be	AUX
aisthesis-5428	88	27	emitted	emit	VERB
aisthesis-5428	88	28	and	and	CCONJ
aisthesis-5428	88	29	visualized	visualize	VERB
aisthesis-5428	88	30	using	use	VERB
aisthesis-5428	88	31	a	a	DET
aisthesis-5428	88	32	program	program	NOUN
aisthesis-5428	88	33	like	like	ADP
aisthesis-5428	88	34	finchtv	finchtv	NOUN
aisthesis-5428	88	35	.	.	PUNCT
aisthesis-5428	89	1	using	use	VERB
aisthesis-5428	89	2	finchtv	finchtv	NOUN
aisthesis-5428	89	3	,	,	PUNCT
aisthesis-5428	89	4	the	the	DET
aisthesis-5428	89	5	wt	wt	PROPN
aisthesis-5428	89	6	d.	d.	NOUN
aisthesis-5428	89	7	melanogaster	melanogaster	NOUN
aisthesis-5428	89	8	genome	genome	NOUN
aisthesis-5428	89	9	from	from	ADP
aisthesis-5428	89	10	flybase	flybase	NOUN
aisthesis-5428	89	11	was	be	AUX
aisthesis-5428	89	12	screened	screen	VERB
aisthesis-5428	89	13	for	for	ADP
aisthesis-5428	89	14	the	the	DET
aisthesis-5428	89	15	trex	trex	PROPN
aisthesis-5428	89	16	primer	primer	NOUN
aisthesis-5428	89	17	sequences	sequence	NOUN
aisthesis-5428	89	18	used	use	VERB
aisthesis-5428	89	19	in	in	ADP
aisthesis-5428	89	20	pcr	pcr	NOUN
aisthesis-5428	89	21	in	in	ADP
aisthesis-5428	89	22	order	order	NOUN
aisthesis-5428	89	23	to	to	PART
aisthesis-5428	89	24	find	find	VERB
aisthesis-5428	89	25	the	the	DET
aisthesis-5428	89	26	amplicon	amplicon	NOUN
aisthesis-5428	89	27	segment	segment	NOUN
aisthesis-5428	89	28	corresponding	correspond	VERB
aisthesis-5428	89	29	to	to	ADP
aisthesis-5428	89	30	where	where	SCONJ
aisthesis-5428	89	31	the	the	DET
aisthesis-5428	89	32	trex	trex	PROPN
aisthesis-5428	89	33	mutation	mutation	NOUN
aisthesis-5428	89	34	is	be	AUX
aisthesis-5428	89	35	housed	house	VERB
aisthesis-5428	89	36	.	.	PUNCT
aisthesis-5428	90	1	the	the	DET
aisthesis-5428	90	2	wt	wt	PROPN
aisthesis-5428	90	3	sequence	sequence	NOUN
aisthesis-5428	90	4	and	and	CCONJ
aisthesis-5428	90	5	trex	trex	NOUN
aisthesis-5428	90	6	sequence	sequence	NOUN
aisthesis-5428	90	7	taken	take	VERB
aisthesis-5428	90	8	from	from	ADP
aisthesis-5428	90	9	finchtv	finchtv	ADJ
aisthesis-5428	90	10	were	be	AUX
aisthesis-5428	90	11	then	then	ADV
aisthesis-5428	90	12	aligned	align	VERB
aisthesis-5428	90	13	and	and	CCONJ
aisthesis-5428	90	14	compared	compare	VERB
aisthesis-5428	90	15	using	use	VERB
aisthesis-5428	90	16	a	a	DET
aisthesis-5428	90	17	blast	blast	NOUN
aisthesis-5428	90	18	nucleotide	nucleotide	NOUN
aisthesis-5428	90	19	analysis	analysis	NOUN
aisthesis-5428	90	20	in	in	ADP
aisthesis-5428	90	21	order	order	NOUN
aisthesis-5428	90	22	to	to	PART
aisthesis-5428	90	23	determine	determine	VERB
aisthesis-5428	90	24	the	the	DET
aisthesis-5428	90	25	nature	nature	NOUN
aisthesis-5428	90	26	of	of	ADP
aisthesis-5428	90	27	the	the	DET
aisthesis-5428	90	28	trex	trex	PROPN
aisthesis-5428	90	29	mutation	mutation	NOUN
aisthesis-5428	90	30	on	on	ADP
aisthesis-5428	90	31	the	the	DET
aisthesis-5428	90	32	genome	genome	NOUN
aisthesis-5428	90	33	level	level	NOUN
aisthesis-5428	90	34	and	and	CCONJ
aisthesis-5428	90	35	to	to	PART
aisthesis-5428	90	36	deduce	deduce	VERB
aisthesis-5428	90	37	what	what	PRON
aisthesis-5428	90	38	gene	gene	NOUN
aisthesis-5428	90	39	trex	trex	PROPN
aisthesis-5428	90	40	is	be	AUX
aisthesis-5428	90	41	allelic	allelic	ADJ
aisthesis-5428	90	42	to	to	ADP
aisthesis-5428	90	43	within	within	ADP
aisthesis-5428	90	44	the	the	DET
aisthesis-5428	90	45	d.	d.	NOUN
aisthesis-5428	90	46	melanogaster	melanogaster	NOUN
aisthesis-5428	90	47	genome	genome	NOUN
aisthesis-5428	90	48	.	.	PUNCT
aisthesis-5428	91	1	further	far	ADV
aisthesis-5428	91	2	,	,	PUNCT
aisthesis-5428	91	3	the	the	DET
aisthesis-5428	91	4	trex	trex	PROPN
aisthesis-5428	91	5	mutation	mutation	NOUN
aisthesis-5428	91	6	was	be	AUX
aisthesis-5428	91	7	investigated	investigate	VERB
aisthesis-5428	91	8	using	use	VERB
aisthesis-5428	91	9	a	a	DET
aisthesis-5428	91	10	protein	protein	NOUN
aisthesis-5428	91	11	blast	blast	NOUN
aisthesis-5428	91	12	on	on	ADP
aisthesis-5428	91	13	flybase	flybase	NOUN
aisthesis-5428	91	14	.	.	PUNCT
aisthesis-5428	92	1	the	the	DET
aisthesis-5428	92	2	resulting	result	VERB
aisthesis-5428	92	3	proteins	protein	NOUN
aisthesis-5428	92	4	of	of	ADP
aisthesis-5428	92	5	both	both	CCONJ
aisthesis-5428	92	6	the	the	DET
aisthesis-5428	92	7	wild	wild	ADJ
aisthesis-5428	92	8	type	type	NOUN
aisthesis-5428	92	9	and	and	CCONJ
aisthesis-5428	92	10	mutant	mutant	NOUN
aisthesis-5428	92	11	were	be	AUX
aisthesis-5428	92	12	then	then	ADV
aisthesis-5428	92	13	compared	compare	VERB
aisthesis-5428	92	14	by	by	ADP
aisthesis-5428	92	15	uploading	upload	VERB
aisthesis-5428	92	16	both	both	CCONJ
aisthesis-5428	92	17	the	the	DET
aisthesis-5428	92	18	wt	wt	NOUN
aisthesis-5428	92	19	and	and	CCONJ
aisthesis-5428	92	20	mutant	mutant	ADJ
aisthesis-5428	92	21	coding	code	VERB
aisthesis-5428	92	22	sequences	sequence	NOUN
aisthesis-5428	92	23	into	into	ADP
aisthesis-5428	92	24	expasy	expasy	NOUN
aisthesis-5428	92	25	,	,	PUNCT
aisthesis-5428	92	26	which	which	PRON
aisthesis-5428	92	27	configures	configure	VERB
aisthesis-5428	92	28	a	a	DET
aisthesis-5428	92	29	peptide	peptide	ADJ
aisthesis-5428	92	30	sequence	sequence	NOUN
aisthesis-5428	92	31	from	from	ADP
aisthesis-5428	92	32	a	a	DET
aisthesis-5428	92	33	nucleotide	nucleotide	ADJ
aisthesis-5428	92	34	sequence	sequence	NOUN
aisthesis-5428	92	35	.	.	PUNCT
aisthesis-5428	93	1	a	a	DET
aisthesis-5428	93	2	3d	3d	NUM
aisthesis-5428	93	3	model	model	NOUN
aisthesis-5428	93	4	of	of	ADP
aisthesis-5428	93	5	the	the	DET
aisthesis-5428	93	6	wild	wild	ADJ
aisthesis-5428	93	7	-	-	PUNCT
aisthesis-5428	93	8	type	type	NOUN
aisthesis-5428	93	9	protein	protein	NOUN
aisthesis-5428	93	10	and	and	CCONJ
aisthesis-5428	93	11	its	its	PRON
aisthesis-5428	93	12	human	human	ADJ
aisthesis-5428	93	13	ortholog	ortholog	NOUN
aisthesis-5428	93	14	was	be	AUX
aisthesis-5428	93	15	constructed	construct	VERB
aisthesis-5428	93	16	and	and	CCONJ
aisthesis-5428	93	17	observed	observe	VERB
aisthesis-5428	93	18	using	use	VERB
aisthesis-5428	93	19	uniprot	uniprot	ADJ
aisthesis-5428	93	20	software	software	NOUN
aisthesis-5428	93	21	.	.	PUNCT
aisthesis-5428	94	1	results	result	NOUN
aisthesis-5428	94	2	:	:	PUNCT
aisthesis-5428	94	3	a.	a.	NOUN
aisthesis-5428	94	4	phenotypic	phenotypic	ADJ
aisthesis-5428	94	5	presentation	presentation	NOUN
aisthesis-5428	94	6	of	of	ADP
aisthesis-5428	94	7	wt	wt	PROPN
aisthesis-5428	94	8	vs.	vs.	X
aisthesis-5428	94	9	trex	trex	PROPN
aisthesis-5428	94	10	flies	fly	VERB
aisthesis-5428	94	11	the	the	DET
aisthesis-5428	94	12	phenotypic	phenotypic	ADJ
aisthesis-5428	94	13	differences	difference	NOUN
aisthesis-5428	94	14	between	between	ADP
aisthesis-5428	94	15	wt	wt	NOUN
aisthesis-5428	94	16	and	and	CCONJ
aisthesis-5428	94	17	trex	trex	PROPN
aisthesis-5428	94	18	flies	fly	NOUN
aisthesis-5428	94	19	were	be	AUX
aisthesis-5428	94	20	observed	observe	VERB
aisthesis-5428	94	21	and	and	CCONJ
aisthesis-5428	94	22	recorded	record	VERB
aisthesis-5428	94	23	in	in	ADP
aisthesis-5428	94	24	order	order	NOUN
aisthesis-5428	94	25	to	to	PART
aisthesis-5428	94	26	characterize	characterize	VERB
aisthesis-5428	94	27	the	the	DET
aisthesis-5428	94	28	nature	nature	NOUN
aisthesis-5428	94	29	of	of	ADP
aisthesis-5428	94	30	the	the	DET
aisthesis-5428	94	31	mutation	mutation	NOUN
aisthesis-5428	94	32	and	and	CCONJ
aisthesis-5428	94	33	how	how	SCONJ
aisthesis-5428	94	34	it	it	PRON
aisthesis-5428	94	35	affects	affect	VERB
aisthesis-5428	94	36	the	the	DET
aisthesis-5428	94	37	phenotype	phenotype	NOUN
aisthesis-5428	94	38	as	as	SCONJ
aisthesis-5428	94	39	compared	compare	VERB
aisthesis-5428	94	40	to	to	ADP
aisthesis-5428	94	41	wt	wt	NUM
aisthesis-5428	94	42	flies	fly	NOUN
aisthesis-5428	94	43	.	.	PUNCT
aisthesis-5428	95	1	wt	wt	NOUN
aisthesis-5428	95	2	flies	fly	NOUN
aisthesis-5428	95	3	’	'	PUNCT
aisthesis-5428	95	4	wings	wing	NOUN
aisthesis-5428	95	5	run	run	VERB
aisthesis-5428	95	6	parallel	parallel	ADJ
aisthesis-5428	95	7	to	to	ADP
aisthesis-5428	95	8	the	the	DET
aisthesis-5428	95	9	anteroposterior	anteroposterior	ADJ
aisthesis-5428	95	10	axis	axis	NOUN
aisthesis-5428	95	11	and	and	CCONJ
aisthesis-5428	95	12	lay	lie	VERB
aisthesis-5428	95	13	flat	flat	ADJ
aisthesis-5428	95	14	along	along	ADP
aisthesis-5428	95	15	the	the	DET
aisthesis-5428	95	16	dorsal	dorsal	NOUN
aisthesis-5428	95	17	side	side	NOUN
aisthesis-5428	95	18	of	of	ADP
aisthesis-5428	95	19	the	the	DET
aisthesis-5428	95	20	abdomen	abdomen	NOUN
aisthesis-5428	95	21	of	of	ADP
aisthesis-5428	95	22	the	the	DET
aisthesis-5428	95	23	fly	fly	NOUN
aisthesis-5428	95	24	(	(	PUNCT
aisthesis-5428	95	25	figure	figure	NOUN
aisthesis-5428	95	26	1	1	NUM
aisthesis-5428	95	27	)	)	PUNCT
aisthesis-5428	95	28	.	.	PUNCT
aisthesis-5428	96	1	in	in	ADP
aisthesis-5428	96	2	contrast	contrast	NOUN
aisthesis-5428	96	3	,	,	PUNCT
aisthesis-5428	96	4	trex	trex	PROPN
aisthesis-5428	96	5	wings	wing	NOUN
aisthesis-5428	96	6	protrude	protrude	VERB
aisthesis-5428	96	7	perpendicularly	perpendicularly	ADV
aisthesis-5428	96	8	to	to	ADP
aisthesis-5428	96	9	the	the	DET
aisthesis-5428	96	10	anteroposterior	anteroposterior	ADJ
aisthesis-5428	96	11	axis	axis	NOUN
aisthesis-5428	96	12	and	and	CCONJ
aisthesis-5428	96	13	have	have	VERB
aisthesis-5428	96	14	a	a	DET
aisthesis-5428	96	15	crumpled	crumpled	ADJ
aisthesis-5428	96	16	appearance	appearance	NOUN
aisthesis-5428	96	17	as	as	SCONJ
aisthesis-5428	96	18	opposed	oppose	VERB
aisthesis-5428	96	19	to	to	ADP
aisthesis-5428	96	20	lying	lie	VERB
aisthesis-5428	96	21	flat	flat	ADJ
aisthesis-5428	96	22	(	(	PUNCT
aisthesis-5428	96	23	figure	figure	NOUN
aisthesis-5428	96	24	1	1	NUM
aisthesis-5428	96	25	)	)	PUNCT
aisthesis-5428	96	26	.	.	PUNCT
aisthesis-5428	97	1	such	such	ADJ
aisthesis-5428	97	2	differences	difference	NOUN
aisthesis-5428	97	3	in	in	ADP
aisthesis-5428	97	4	wing	wing	NOUN
aisthesis-5428	97	5	anatomy	anatomy	NOUN
aisthesis-5428	97	6	are	be	AUX
aisthesis-5428	97	7	visibly	visibly	ADV
aisthesis-5428	97	8	present	present	ADJ
aisthesis-5428	97	9	from	from	ADP
aisthesis-5428	97	10	the	the	DET
aisthesis-5428	97	11	emergence	emergence	NOUN
aisthesis-5428	97	12	of	of	ADP
aisthesis-5428	97	13	newly	newly	ADV
aisthesis-5428	97	14	-	-	PUNCT
aisthesis-5428	97	15	eclosed	eclosed	ADJ
aisthesis-5428	97	16	flies	fly	NOUN
aisthesis-5428	97	17	from	from	ADP
aisthesis-5428	97	18	the	the	DET
aisthesis-5428	97	19	pupa	pupa	NOUN
aisthesis-5428	97	20	and	and	CCONJ
aisthesis-5428	97	21	remain	remain	VERB
aisthesis-5428	97	22	the	the	DET
aisthesis-5428	97	23	same	same	ADJ
aisthesis-5428	97	24	through	through	ADP
aisthesis-5428	97	25	the	the	DET
aisthesis-5428	97	26	adulthood	adulthood	NOUN
aisthesis-5428	97	27	of	of	ADP
aisthesis-5428	97	28	the	the	DET
aisthesis-5428	97	29	flies	fly	NOUN
aisthesis-5428	97	30	.	.	PUNCT
aisthesis-5428	98	1	there	there	PRON
aisthesis-5428	98	2	are	be	VERB
aisthesis-5428	98	3	no	no	DET
aisthesis-5428	98	4	visible	visible	ADJ
aisthesis-5428	98	5	differences	difference	NOUN
aisthesis-5428	98	6	between	between	ADP
aisthesis-5428	98	7	wt	wt	NOUN
aisthesis-5428	98	8	and	and	CCONJ
aisthesis-5428	98	9	trex	trex	PROPN
aisthesis-5428	98	10	first	first	ADJ
aisthesis-5428	98	11	,	,	PUNCT
aisthesis-5428	98	12	second	second	ADJ
aisthesis-5428	98	13	,	,	PUNCT
aisthesis-5428	98	14	or	or	CCONJ
aisthesis-5428	98	15	third	third	ADJ
aisthesis-5428	98	16	instar	instar	ADJ
aisthesis-5428	98	17	larva	larva	NOUN
aisthesis-5428	98	18	nor	nor	CCONJ
aisthesis-5428	98	19	the	the	DET
aisthesis-5428	98	20	pupa	pupa	ADJ
aisthesis-5428	98	21	they	they	PRON
aisthesis-5428	98	22	form	form	VERB
aisthesis-5428	98	23	.	.	PUNCT
aisthesis-5428	99	1	further	far	ADV
aisthesis-5428	99	2	,	,	PUNCT
aisthesis-5428	99	3	there	there	PRON
aisthesis-5428	99	4	is	be	VERB
aisthesis-5428	99	5	no	no	DET
aisthesis-5428	99	6	notable	notable	ADJ
aisthesis-5428	99	7	difference	difference	NOUN
aisthesis-5428	99	8	in	in	ADP
aisthesis-5428	99	9	the	the	DET
aisthesis-5428	99	10	life	life	NOUN
aisthesis-5428	99	11	cycle	cycle	NOUN
aisthesis-5428	99	12	rate	rate	NOUN
aisthesis-5428	99	13	of	of	ADP
aisthesis-5428	99	14	development	development	NOUN
aisthesis-5428	99	15	between	between	ADP
aisthesis-5428	99	16	wt	wt	PROPN
aisthesis-5428	99	17	and	and	CCONJ
aisthesis-5428	99	18	trex	trex	PROPN
aisthesis-5428	99	19	flies	fly	NOUN
aisthesis-5428	99	20	.	.	PUNCT
aisthesis-5428	100	1	the	the	DET
aisthesis-5428	100	2	visible	visible	ADJ
aisthesis-5428	100	3	phenotypic	phenotypic	ADJ
aisthesis-5428	100	4	difference	difference	NOUN
aisthesis-5428	100	5	in	in	ADP
aisthesis-5428	100	6	wing	wing	NOUN
aisthesis-5428	100	7	appearance	appearance	NOUN
aisthesis-5428	100	8	appears	appear	VERB
aisthesis-5428	100	9	only	only	ADV
aisthesis-5428	100	10	upon	upon	SCONJ
aisthesis-5428	100	11	eclosion	eclosion	NOUN
aisthesis-5428	100	12	from	from	ADP
aisthesis-5428	100	13	the	the	DET
aisthesis-5428	100	14	pupa	pupa	NOUN
aisthesis-5428	100	15	.	.	PUNCT
aisthesis-5428	101	1	upon	upon	SCONJ
aisthesis-5428	101	2	comparison	comparison	NOUN
aisthesis-5428	101	3	of	of	ADP
aisthesis-5428	101	4	males	male	NOUN
aisthesis-5428	101	5	and	and	CCONJ
aisthesis-5428	101	6	females	female	NOUN
aisthesis-5428	101	7	,	,	PUNCT
aisthesis-5428	101	8	no	no	DET
aisthesis-5428	101	9	difference	difference	NOUN
aisthesis-5428	101	10	was	be	AUX
aisthesis-5428	101	11	observed	observe	VERB
aisthesis-5428	101	12	between	between	ADP
aisthesis-5428	101	13	the	the	DET
aisthesis-5428	101	14	manifestation	manifestation	NOUN
aisthesis-5428	101	15	of	of	ADP
aisthesis-5428	101	16	the	the	DET
aisthesis-5428	101	17	wing	wing	NOUN
aisthesis-5428	101	18	mutation	mutation	NOUN
aisthesis-5428	101	19	between	between	ADP
aisthesis-5428	101	20	males	male	NOUN
aisthesis-5428	101	21	and	and	CCONJ
aisthesis-5428	101	22	females	female	NOUN
aisthesis-5428	101	23	of	of	ADP
aisthesis-5428	101	24	the	the	DET
aisthesis-5428	101	25	wt	wt	NOUN
aisthesis-5428	101	26	and	and	CCONJ
aisthesis-5428	101	27	trex	trex	ADJ
aisthesis-5428	101	28	strains	strain	NOUN
aisthesis-5428	101	29	of	of	ADP
aisthesis-5428	101	30	flies	fly	NOUN
aisthesis-5428	101	31	.	.	PUNCT
aisthesis-5428	102	1	the	the	DET
aisthesis-5428	102	2	appearance	appearance	NOUN
aisthesis-5428	102	3	of	of	ADP
aisthesis-5428	102	4	the	the	DET
aisthesis-5428	102	5	wing	wing	NOUN
aisthesis-5428	102	6	mutation	mutation	NOUN
aisthesis-5428	102	7	of	of	ADP
aisthesis-5428	102	8	the	the	DET
aisthesis-5428	102	9	trex	trex	PROPN
aisthesis-5428	102	10	flies	fly	NOUN
aisthesis-5428	102	11	was	be	AUX
aisthesis-5428	102	12	visibly	visibly	ADV
aisthesis-5428	102	13	identical	identical	ADJ
aisthesis-5428	102	14	between	between	ADP
aisthesis-5428	102	15	males	male	NOUN
aisthesis-5428	102	16	and	and	CCONJ
aisthesis-5428	102	17	females	female	NOUN
aisthesis-5428	102	18	.	.	PUNCT
aisthesis-5428	103	1	b.	b.	PROPN
aisthesis-5428	103	2	reciprocal	reciprocal	ADJ
aisthesis-5428	103	3	crosses	crosse	NOUN
aisthesis-5428	103	4	yielded	yield	VERB
aisthesis-5428	103	5	progeny	progeny	NOUN
aisthesis-5428	103	6	of	of	ADP
aisthesis-5428	103	7	all	all	DET
aisthesis-5428	103	8	wild	wild	ADJ
aisthesis-5428	103	9	-	-	PUNCT
aisthesis-5428	103	10	type	type	NOUN
aisthesis-5428	103	11	phenotype	phenotype	NOUN
aisthesis-5428	103	12	the	the	DET
aisthesis-5428	103	13	wtm1	wtm1	PROPN
aisthesis-5428	103	14	cross	cross	PROPN
aisthesis-5428	103	15	was	be	AUX
aisthesis-5428	103	16	performed	perform	VERB
aisthesis-5428	103	17	in	in	ADP
aisthesis-5428	103	18	order	order	NOUN
aisthesis-5428	103	19	to	to	PART
aisthesis-5428	103	20	determine	determine	VERB
aisthesis-5428	103	21	whether	whether	SCONJ
aisthesis-5428	103	22	the	the	DET
aisthesis-5428	103	23	trex	trex	PROPN
aisthesis-5428	103	24	mutation	mutation	NOUN
aisthesis-5428	103	25	is	be	AUX
aisthesis-5428	103	26	inherited	inherit	VERB
aisthesis-5428	103	27	analysis	analysis	NOUN
aisthesis-5428	103	28	of	of	ADP
aisthesis-5428	103	29	novel	novel	ADJ
aisthesis-5428	103	30	unknown	unknown	ADJ
aisthesis-5428	103	31	d.	d.	NOUN
aisthesis-5428	103	32	melanogaster	melanogaster	NOUN
aisthesis-5428	103	33	mutation	mutation	NOUN
aisthesis-5428	103	34	trex	trex	PROPN
aisthesis-5428	103	35	aisthesis	aisthesis	NOUN
aisthesis-5428	103	36	volume	volume	NOUN
aisthesis-5428	103	37	14	14	NUM
aisthesis-5428	103	38	,	,	PUNCT
aisthesis-5428	103	39	202359	202359	NUM
aisthesis-5428	103	40	in	in	ADP
aisthesis-5428	103	41	a	a	DET
aisthesis-5428	103	42	dominant	dominant	ADJ
aisthesis-5428	103	43	or	or	CCONJ
aisthesis-5428	103	44	recessive	recessive	ADJ
aisthesis-5428	103	45	inheritance	inheritance	NOUN
aisthesis-5428	103	46	pattern	pattern	NOUN
aisthesis-5428	103	47	as	as	SCONJ
aisthesis-5428	103	48	it	it	PRON
aisthesis-5428	103	49	involved	involve	VERB
aisthesis-5428	103	50	crossed	cross	VERB
aisthesis-5428	103	51	true	true	ADJ
aisthesis-5428	103	52	-	-	PUNCT
aisthesis-5428	103	53	breeding	breed	VERB
aisthesis-5428	103	54	wt	wt	NOUN
aisthesis-5428	103	55	females	female	NOUN
aisthesis-5428	103	56	and	and	CCONJ
aisthesis-5428	103	57	trex	trex	PROPN
aisthesis-5428	103	58	males	male	NOUN
aisthesis-5428	103	59	.	.	PUNCT
aisthesis-5428	104	1	the	the	DET
aisthesis-5428	104	2	chromosome	chromosome	NOUN
aisthesis-5428	104	3	map	map	NOUN
aisthesis-5428	104	4	of	of	ADP
aisthesis-5428	104	5	the	the	DET
aisthesis-5428	104	6	wtm1	wtm1	PROPN
aisthesis-5428	104	7	cross	cross	PROPN
aisthesis-5428	104	8	can	can	AUX
aisthesis-5428	104	9	be	be	AUX
aisthesis-5428	104	10	seen	see	VERB
aisthesis-5428	104	11	in	in	ADP
aisthesis-5428	104	12	figure	figure	NOUN
aisthesis-5428	104	13	2	2	NUM
aisthesis-5428	104	14	.	.	PUNCT
aisthesis-5428	105	1	a	a	DET
aisthesis-5428	105	2	total	total	NOUN
aisthesis-5428	105	3	of	of	ADP
aisthesis-5428	105	4	307	307	NUM
aisthesis-5428	105	5	progeny	progeny	NOUN
aisthesis-5428	105	6	were	be	AUX
aisthesis-5428	105	7	scored	score	VERB
aisthesis-5428	105	8	for	for	ADP
aisthesis-5428	105	9	the	the	DET
aisthesis-5428	105	10	wtm1	wtm1	PROPN
aisthesis-5428	105	11	cross	cross	PROPN
aisthesis-5428	105	12	.	.	PUNCT
aisthesis-5428	106	1	it	it	PRON
aisthesis-5428	106	2	was	be	AUX
aisthesis-5428	106	3	observed	observe	VERB
aisthesis-5428	106	4	that	that	SCONJ
aisthesis-5428	106	5	all	all	DET
aisthesis-5428	106	6	progeny	progeny	NOUN
aisthesis-5428	106	7	of	of	ADP
aisthesis-5428	106	8	the	the	DET
aisthesis-5428	106	9	wtm1	wtm1	PROPN
aisthesis-5428	106	10	cross	cross	PROPN
aisthesis-5428	106	11	displayed	display	VERB
aisthesis-5428	106	12	a	a	DET
aisthesis-5428	106	13	wild	wild	ADJ
aisthesis-5428	106	14	-	-	PUNCT
aisthesis-5428	106	15	type	type	NOUN
aisthesis-5428	106	16	phenotype	phenotype	NOUN
aisthesis-5428	106	17	(	(	PUNCT
aisthesis-5428	106	18	table	table	NOUN
aisthesis-5428	106	19	1	1	NUM
aisthesis-5428	106	20	)	)	PUNCT
aisthesis-5428	106	21	.	.	PUNCT
aisthesis-5428	107	1	among	among	ADP
aisthesis-5428	107	2	the	the	DET
aisthesis-5428	107	3	307	307	NUM
aisthesis-5428	107	4	progeny	progeny	NOUN
aisthesis-5428	107	5	that	that	PRON
aisthesis-5428	107	6	were	be	AUX
aisthesis-5428	107	7	scored	score	VERB
aisthesis-5428	107	8	,	,	PUNCT
aisthesis-5428	107	9	163	163	NUM
aisthesis-5428	107	10	females	female	NOUN
aisthesis-5428	107	11	and	and	CCONJ
aisthesis-5428	107	12	144	144	NUM
aisthesis-5428	107	13	males	male	NOUN
aisthesis-5428	107	14	in	in	ADP
aisthesis-5428	107	15	total	total	NOUN
aisthesis-5428	107	16	were	be	AUX
aisthesis-5428	107	17	scored	score	VERB
aisthesis-5428	107	18	,	,	PUNCT
aisthesis-5428	107	19	all	all	PRON
aisthesis-5428	107	20	of	of	ADP
aisthesis-5428	107	21	which	which	PRON
aisthesis-5428	107	22	displayed	display	VERB
aisthesis-5428	107	23	wild	wild	ADJ
aisthesis-5428	107	24	-	-	PUNCT
aisthesis-5428	107	25	type	type	NOUN
aisthesis-5428	107	26	wing	wing	NOUN
aisthesis-5428	107	27	morphology	morphology	NOUN
aisthesis-5428	107	28	(	(	PUNCT
aisthesis-5428	107	29	table	table	NOUN
aisthesis-5428	107	30	1	1	NUM
aisthesis-5428	107	31	)	)	PUNCT
aisthesis-5428	107	32	.	.	PUNCT
aisthesis-5428	108	1	the	the	DET
aisthesis-5428	108	2	virtual	virtual	ADJ
aisthesis-5428	108	3	wtm1	wtm1	PROPN
aisthesis-5428	108	4	cross	cross	PROPN
aisthesis-5428	108	5	also	also	ADV
aisthesis-5428	108	6	yielded	yield	VERB
aisthesis-5428	108	7	progeny	progeny	NOUN
aisthesis-5428	108	8	all	all	PRON
aisthesis-5428	108	9	displaying	display	VERB
aisthesis-5428	108	10	a	a	DET
aisthesis-5428	108	11	wild	wild	ADJ
aisthesis-5428	108	12	-	-	PUNCT
aisthesis-5428	108	13	type	type	NOUN
aisthesis-5428	108	14	phenotype	phenotype	NOUN
aisthesis-5428	108	15	.	.	PUNCT
aisthesis-5428	109	1	there	there	PRON
aisthesis-5428	109	2	was	be	VERB
aisthesis-5428	109	3	a	a	DET
aisthesis-5428	109	4	total	total	NOUN
aisthesis-5428	109	5	of	of	ADP
aisthesis-5428	109	6	1,506	1,506	NUM
aisthesis-5428	109	7	female	female	ADJ
aisthesis-5428	109	8	and	and	CCONJ
aisthesis-5428	109	9	1,514	1,514	NUM
aisthesis-5428	109	10	male	male	ADJ
aisthesis-5428	109	11	progenies	progeny	NOUN
aisthesis-5428	109	12	,	,	PUNCT
aisthesis-5428	109	13	for	for	ADP
aisthesis-5428	109	14	a	a	DET
aisthesis-5428	109	15	total	total	NOUN
aisthesis-5428	109	16	of	of	ADP
aisthesis-5428	109	17	3,020	3,020	NUM
aisthesis-5428	109	18	progeny	progeny	NOUN
aisthesis-5428	109	19	,	,	PUNCT
aisthesis-5428	109	20	all	all	PRON
aisthesis-5428	109	21	of	of	ADP
aisthesis-5428	109	22	which	which	PRON
aisthesis-5428	109	23	were	be	AUX
aisthesis-5428	109	24	wild	wild	ADJ
aisthesis-5428	109	25	type	type	NOUN
aisthesis-5428	109	26	(	(	PUNCT
aisthesis-5428	109	27	table	table	NOUN
aisthesis-5428	109	28	2	2	NUM
aisthesis-5428	109	29	)	)	PUNCT
aisthesis-5428	109	30	.	.	PUNCT
aisthesis-5428	110	1	the	the	DET
aisthesis-5428	110	2	wtm2	wtm2	NOUN
aisthesis-5428	110	3	cross	cross	NOUN
aisthesis-5428	110	4	was	be	AUX
aisthesis-5428	110	5	performed	perform	VERB
aisthesis-5428	110	6	to	to	PART
aisthesis-5428	110	7	determine	determine	VERB
aisthesis-5428	110	8	the	the	DET
aisthesis-5428	110	9	inheritance	inheritance	NOUN
aisthesis-5428	110	10	pattern	pattern	NOUN
aisthesis-5428	110	11	of	of	ADP
aisthesis-5428	110	12	trex	trex	PROPN
aisthesis-5428	110	13	as	as	SCONJ
aisthesis-5428	110	14	it	it	PRON
aisthesis-5428	110	15	relates	relate	VERB
aisthesis-5428	110	16	to	to	ADP
aisthesis-5428	110	17	whether	whether	SCONJ
aisthesis-5428	110	18	it	it	PRON
aisthesis-5428	110	19	is	be	AUX
aisthesis-5428	110	20	inherited	inherit	VERB
aisthesis-5428	110	21	via	via	ADP
aisthesis-5428	110	22	an	an	DET
aisthesis-5428	110	23	autosomal	autosomal	ADJ
aisthesis-5428	110	24	or	or	CCONJ
aisthesis-5428	110	25	sex	sex	NOUN
aisthesis-5428	110	26	chromosome	chromosome	NOUN
aisthesis-5428	110	27	.	.	PUNCT
aisthesis-5428	111	1	the	the	DET
aisthesis-5428	111	2	chromosome	chromosome	NOUN
aisthesis-5428	111	3	map	map	NOUN
aisthesis-5428	111	4	of	of	ADP
aisthesis-5428	111	5	this	this	DET
aisthesis-5428	111	6	cross	cross	NOUN
aisthesis-5428	111	7	can	can	AUX
aisthesis-5428	111	8	be	be	AUX
aisthesis-5428	111	9	seen	see	VERB
aisthesis-5428	111	10	in	in	ADP
aisthesis-5428	111	11	figure	figure	NOUN
aisthesis-5428	111	12	3	3	NUM
aisthesis-5428	111	13	.	.	PUNCT
aisthesis-5428	112	1	this	this	PRON
aisthesis-5428	112	2	was	be	AUX
aisthesis-5428	112	3	made	make	VERB
aisthesis-5428	112	4	possible	possible	ADJ
aisthesis-5428	112	5	by	by	ADP
aisthesis-5428	112	6	the	the	DET
aisthesis-5428	112	7	fact	fact	NOUN
aisthesis-5428	112	8	that	that	SCONJ
aisthesis-5428	112	9	true	true	ADJ
aisthesis-5428	112	10	breeding	breed	VERB
aisthesis-5428	112	11	female	female	ADJ
aisthesis-5428	112	12	trex	trex	PROPN
aisthesis-5428	112	13	flies	fly	NOUN
aisthesis-5428	112	14	were	be	AUX
aisthesis-5428	112	15	crossed	cross	VERB
aisthesis-5428	112	16	with	with	ADP
aisthesis-5428	112	17	true	true	ADJ
aisthesis-5428	112	18	breeding	breed	VERB
aisthesis-5428	112	19	wild	wild	ADJ
aisthesis-5428	112	20	-	-	PUNCT
aisthesis-5428	112	21	type	type	NOUN
aisthesis-5428	112	22	males	male	NOUN
aisthesis-5428	112	23	.	.	PUNCT
aisthesis-5428	113	1	by	by	ADP
aisthesis-5428	113	2	analyzing	analyze	VERB
aisthesis-5428	113	3	the	the	DET
aisthesis-5428	113	4	results	result	NOUN
aisthesis-5428	113	5	of	of	ADP
aisthesis-5428	113	6	this	this	DET
aisthesis-5428	113	7	cross	cross	NOUN
aisthesis-5428	113	8	,	,	PUNCT
aisthesis-5428	113	9	more	more	ADV
aisthesis-5428	113	10	specifically	specifically	ADV
aisthesis-5428	113	11	as	as	SCONJ
aisthesis-5428	113	12	it	it	PRON
aisthesis-5428	113	13	relates	relate	VERB
aisthesis-5428	113	14	to	to	ADP
aisthesis-5428	113	15	the	the	DET
aisthesis-5428	113	16	sex	sex	NOUN
aisthesis-5428	113	17	of	of	ADP
aisthesis-5428	113	18	the	the	DET
aisthesis-5428	113	19	progeny	progeny	NOUN
aisthesis-5428	113	20	,	,	PUNCT
aisthesis-5428	113	21	the	the	DET
aisthesis-5428	113	22	autosomal	autosomal	ADJ
aisthesis-5428	113	23	versus	versus	ADP
aisthesis-5428	113	24	sex	sex	NOUN
aisthesis-5428	113	25	-	-	PUNCT
aisthesis-5428	113	26	linked	link	VERB
aisthesis-5428	113	27	nature	nature	NOUN
aisthesis-5428	113	28	of	of	ADP
aisthesis-5428	113	29	this	this	DET
aisthesis-5428	113	30	mutation	mutation	NOUN
aisthesis-5428	113	31	was	be	AUX
aisthesis-5428	113	32	made	make	VERB
aisthesis-5428	113	33	apparent	apparent	ADJ
aisthesis-5428	113	34	.	.	PUNCT
aisthesis-5428	114	1	a	a	DET
aisthesis-5428	114	2	total	total	NOUN
aisthesis-5428	114	3	of	of	ADP
aisthesis-5428	114	4	350	350	NUM
aisthesis-5428	114	5	progeny	progeny	NOUN
aisthesis-5428	114	6	,	,	PUNCT
aisthesis-5428	114	7	183	183	NUM
aisthesis-5428	114	8	of	of	ADP
aisthesis-5428	114	9	which	which	PRON
aisthesis-5428	114	10	were	be	AUX
aisthesis-5428	114	11	female	female	ADJ
aisthesis-5428	114	12	and	and	CCONJ
aisthesis-5428	114	13	167	167	NUM
aisthesis-5428	114	14	of	of	ADP
aisthesis-5428	114	15	which	which	PRON
aisthesis-5428	114	16	were	be	AUX
aisthesis-5428	114	17	male	male	ADJ
aisthesis-5428	114	18	,	,	PUNCT
aisthesis-5428	114	19	were	be	AUX
aisthesis-5428	114	20	scored	score	VERB
aisthesis-5428	114	21	for	for	ADP
aisthesis-5428	114	22	the	the	DET
aisthesis-5428	114	23	wtm2	wtm2	NOUN
aisthesis-5428	114	24	(	(	PUNCT
aisthesis-5428	114	25	table	table	NOUN
aisthesis-5428	114	26	3	3	NUM
aisthesis-5428	114	27	)	)	PUNCT
aisthesis-5428	114	28	.	.	PUNCT
aisthesis-5428	115	1	all	all	DET
aisthesis-5428	115	2	progeny	progeny	NOUN
aisthesis-5428	115	3	of	of	ADP
aisthesis-5428	115	4	the	the	DET
aisthesis-5428	115	5	wtm2	wtm2	NOUN
aisthesis-5428	115	6	cross	cross	NOUN
aisthesis-5428	115	7	displayed	display	VERB
aisthesis-5428	115	8	a	a	DET
aisthesis-5428	115	9	wild	wild	ADJ
aisthesis-5428	115	10	-	-	PUNCT
aisthesis-5428	115	11	type	type	NOUN
aisthesis-5428	115	12	phenotype	phenotype	NOUN
aisthesis-5428	115	13	(	(	PUNCT
aisthesis-5428	115	14	table	table	NOUN
aisthesis-5428	115	15	3	3	NUM
aisthesis-5428	115	16	)	)	PUNCT
aisthesis-5428	115	17	.	.	PUNCT
aisthesis-5428	116	1	the	the	DET
aisthesis-5428	116	2	virtual	virtual	ADJ
aisthesis-5428	116	3	wtm2	wtm2	NOUN
aisthesis-5428	116	4	cross	cross	NOUN
aisthesis-5428	116	5	produced	produce	VERB
aisthesis-5428	116	6	a	a	DET
aisthesis-5428	116	7	total	total	NOUN
aisthesis-5428	116	8	of	of	ADP
aisthesis-5428	116	9	1,484	1,484	NUM
aisthesis-5428	116	10	female	female	ADJ
aisthesis-5428	116	11	and	and	CCONJ
aisthesis-5428	116	12	1,489	1,489	NUM
aisthesis-5428	116	13	male	male	NOUN
aisthesis-5428	116	14	progeny	progeny	NOUN
aisthesis-5428	116	15	,	,	PUNCT
aisthesis-5428	116	16	all	all	PRON
aisthesis-5428	116	17	of	of	ADP
aisthesis-5428	116	18	which	which	PRON
aisthesis-5428	116	19	(	(	PUNCT
aisthesis-5428	116	20	2,973	2,973	NUM
aisthesis-5428	116	21	total	total	NOUN
aisthesis-5428	116	22	)	)	PUNCT
aisthesis-5428	116	23	displayed	display	VERB
aisthesis-5428	116	24	the	the	DET
aisthesis-5428	116	25	wild	wild	ADJ
aisthesis-5428	116	26	-	-	PUNCT
aisthesis-5428	116	27	type	type	NOUN
aisthesis-5428	116	28	phenotype	phenotype	NOUN
aisthesis-5428	116	29	as	as	ADV
aisthesis-5428	116	30	well	well	ADV
aisthesis-5428	116	31	(	(	PUNCT
aisthesis-5428	116	32	table	table	NOUN
aisthesis-5428	116	33	4	4	NUM
aisthesis-5428	116	34	)	)	PUNCT
aisthesis-5428	116	35	.	.	PUNCT
aisthesis-5428	117	1	c.	c.	NOUN
aisthesis-5428	117	2	mapping	mapping	NOUN
aisthesis-5428	117	3	crosses	cross	VERB
aisthesis-5428	117	4	the	the	DET
aisthesis-5428	117	5	mapping	mapping	NOUN
aisthesis-5428	117	6	crosses	crosse	NOUN
aisthesis-5428	117	7	were	be	AUX
aisthesis-5428	117	8	performed	perform	VERB
aisthesis-5428	117	9	to	to	PART
aisthesis-5428	117	10	deduce	deduce	VERB
aisthesis-5428	117	11	the	the	DET
aisthesis-5428	117	12	approximate	approximate	ADJ
aisthesis-5428	117	13	location	location	NOUN
aisthesis-5428	117	14	of	of	ADP
aisthesis-5428	117	15	the	the	DET
aisthesis-5428	117	16	trex	trex	PROPN
aisthesis-5428	117	17	gene	gene	NOUN
aisthesis-5428	117	18	.	.	PUNCT
aisthesis-5428	118	1	the	the	DET
aisthesis-5428	118	2	frequency	frequency	NOUN
aisthesis-5428	118	3	of	of	ADP
aisthesis-5428	118	4	recombination	recombination	NOUN
aisthesis-5428	118	5	between	between	ADP
aisthesis-5428	118	6	trex	trex	PROPN
aisthesis-5428	118	7	and	and	CCONJ
aisthesis-5428	118	8	the	the	DET
aisthesis-5428	118	9	given	give	VERB
aisthesis-5428	118	10	marker	marker	NOUN
aisthesis-5428	118	11	gene	gene	NOUN
aisthesis-5428	118	12	was	be	AUX
aisthesis-5428	118	13	calculated	calculate	VERB
aisthesis-5428	118	14	in	in	ADP
aisthesis-5428	118	15	order	order	NOUN
aisthesis-5428	118	16	to	to	PART
aisthesis-5428	118	17	estimate	estimate	VERB
aisthesis-5428	118	18	the	the	DET
aisthesis-5428	118	19	genetic	genetic	ADJ
aisthesis-5428	118	20	distance	distance	NOUN
aisthesis-5428	118	21	between	between	ADP
aisthesis-5428	118	22	trex	trex	PROPN
aisthesis-5428	118	23	and	and	CCONJ
aisthesis-5428	118	24	the	the	DET
aisthesis-5428	118	25	given	give	VERB
aisthesis-5428	118	26	marker	marker	NOUN
aisthesis-5428	118	27	gene	gene	NOUN
aisthesis-5428	118	28	,	,	PUNCT
aisthesis-5428	118	29	and	and	CCONJ
aisthesis-5428	118	30	the	the	DET
aisthesis-5428	118	31	progeny	progeny	NOUN
aisthesis-5428	118	32	were	be	AUX
aisthesis-5428	118	33	statistically	statistically	ADV
aisthesis-5428	118	34	analyzed	analyze	VERB
aisthesis-5428	118	35	using	use	VERB
aisthesis-5428	118	36	a	a	DET
aisthesis-5428	118	37	chi	chi	ADJ
aisthesis-5428	118	38	-	-	PUNCT
aisthesis-5428	118	39	square	square	ADJ
aisthesis-5428	118	40	test	test	NOUN
aisthesis-5428	118	41	and	and	CCONJ
aisthesis-5428	118	42	p	p	ADJ
aisthesis-5428	118	43	-	-	PUNCT
aisthesis-5428	118	44	value	value	NOUN
aisthesis-5428	118	45	test	test	NOUN
aisthesis-5428	118	46	of	of	ADP
aisthesis-5428	118	47	significance	significance	NOUN
aisthesis-5428	118	48	.	.	PUNCT
aisthesis-5428	119	1	the	the	DET
aisthesis-5428	119	2	null	null	ADJ
aisthesis-5428	119	3	hypothesis	hypothesis	NOUN
aisthesis-5428	119	4	of	of	ADP
aisthesis-5428	119	5	each	each	DET
aisthesis-5428	119	6	cross	cross	NOUN
aisthesis-5428	119	7	was	be	AUX
aisthesis-5428	119	8	that	that	SCONJ
aisthesis-5428	119	9	the	the	DET
aisthesis-5428	119	10	given	give	VERB
aisthesis-5428	119	11	marker	marker	NOUN
aisthesis-5428	119	12	gene	gene	NOUN
aisthesis-5428	119	13	and	and	CCONJ
aisthesis-5428	119	14	trex	trex	PROPN
aisthesis-5428	119	15	were	be	AUX
aisthesis-5428	119	16	not	not	PART
aisthesis-5428	119	17	genetically	genetically	ADV
aisthesis-5428	119	18	linked	link	VERB
aisthesis-5428	119	19	and	and	CCONJ
aisthesis-5428	119	20	therefore	therefore	ADV
aisthesis-5428	119	21	assort	assort	NOUN
aisthesis-5428	119	22	independently	independently	ADV
aisthesis-5428	119	23	.	.	PUNCT
aisthesis-5428	120	1	this	this	DET
aisthesis-5428	120	2	hypothesis	hypothesis	NOUN
aisthesis-5428	120	3	predicts	predict	VERB
aisthesis-5428	120	4	a	a	DET
aisthesis-5428	120	5	1:1:1:1	1:1:1:1	NUM
aisthesis-5428	120	6	ratio	ratio	NOUN
aisthesis-5428	120	7	of	of	ADP
aisthesis-5428	120	8	each	each	PRON
aisthesis-5428	120	9	of	of	ADP
aisthesis-5428	120	10	4	4	NUM
aisthesis-5428	120	11	phenotypic	phenotypic	ADJ
aisthesis-5428	120	12	classes	class	NOUN
aisthesis-5428	120	13	,	,	PUNCT
aisthesis-5428	120	14	two	two	NUM
aisthesis-5428	120	15	parental	parental	ADJ
aisthesis-5428	120	16	phenotypic	phenotypic	ADJ
aisthesis-5428	120	17	classes	class	NOUN
aisthesis-5428	120	18	and	and	CCONJ
aisthesis-5428	120	19	two	two	NUM
aisthesis-5428	120	20	recombinant	recombinant	ADJ
aisthesis-5428	120	21	phenotypic	phenotypic	ADJ
aisthesis-5428	120	22	classes	class	NOUN
aisthesis-5428	120	23	.	.	PUNCT
aisthesis-5428	121	1	in	in	ADP
aisthesis-5428	121	2	mapping	mapping	NOUN
aisthesis-5428	121	3	cross	cross	VERB
aisthesis-5428	121	4	a	a	PRON
aisthesis-5428	121	5	,	,	PUNCT
aisthesis-5428	121	6	females	female	NOUN
aisthesis-5428	121	7	heterozygous	heterozygous	ADJ
aisthesis-5428	121	8	for	for	ADP
aisthesis-5428	121	9	both	both	PRON
aisthesis-5428	121	10	brown	brown	ADJ
aisthesis-5428	121	11	(	(	PUNCT
aisthesis-5428	121	12	bw	bw	NOUN
aisthesis-5428	121	13	)	)	PUNCT
aisthesis-5428	121	14	and	and	CCONJ
aisthesis-5428	121	15	trex	trex	PROPN
aisthesis-5428	121	16	were	be	AUX
aisthesis-5428	121	17	crossed	cross	VERB
aisthesis-5428	121	18	with	with	ADP
aisthesis-5428	121	19	males	male	NOUN
aisthesis-5428	121	20	homozygous	homozygous	ADJ
aisthesis-5428	121	21	for	for	ADP
aisthesis-5428	121	22	both	both	PRON
aisthesis-5428	121	23	bw	bw	NOUN
aisthesis-5428	121	24	and	and	CCONJ
aisthesis-5428	121	25	trex	trex	PROPN
aisthesis-5428	121	26	.	.	PROPN
aisthesis-5428	121	27	2,902	2,902	NUM
aisthesis-5428	121	28	progeny	progeny	NOUN
aisthesis-5428	121	29	were	be	AUX
aisthesis-5428	121	30	scored	score	VERB
aisthesis-5428	121	31	,	,	PUNCT
aisthesis-5428	121	32	of	of	ADP
aisthesis-5428	121	33	which	which	PRON
aisthesis-5428	121	34	1,489	1,489	NUM
aisthesis-5428	121	35	were	be	AUX
aisthesis-5428	121	36	female	female	ADJ
aisthesis-5428	121	37	and	and	CCONJ
aisthesis-5428	121	38	1,413	1,413	NUM
aisthesis-5428	121	39	were	be	AUX
aisthesis-5428	121	40	male	male	ADJ
aisthesis-5428	121	41	.	.	PUNCT
aisthesis-5428	122	1	of	of	ADP
aisthesis-5428	122	2	the	the	DET
aisthesis-5428	122	3	progeny	progeny	NOUN
aisthesis-5428	122	4	scored	score	VERB
aisthesis-5428	122	5	,	,	PUNCT
aisthesis-5428	122	6	2,144	2,144	NUM
aisthesis-5428	122	7	displayed	display	VERB
aisthesis-5428	122	8	a	a	DET
aisthesis-5428	122	9	parental	parental	ADJ
aisthesis-5428	122	10	phenotype	phenotype	NOUN
aisthesis-5428	122	11	,	,	PUNCT
aisthesis-5428	122	12	while	while	SCONJ
aisthesis-5428	122	13	758	758	NUM
aisthesis-5428	122	14	displayed	display	VERB
aisthesis-5428	122	15	a	a	DET
aisthesis-5428	122	16	recombinant	recombinant	ADJ
aisthesis-5428	122	17	phenotype	phenotype	NOUN
aisthesis-5428	122	18	(	(	PUNCT
aisthesis-5428	122	19	table	table	NOUN
aisthesis-5428	122	20	5	5	NUM
aisthesis-5428	122	21	)	)	PUNCT
aisthesis-5428	122	22	.	.	PUNCT
aisthesis-5428	123	1	the	the	DET
aisthesis-5428	123	2	recombination	recombination	NOUN
aisthesis-5428	123	3	frequency	frequency	NOUN
aisthesis-5428	123	4	between	between	ADP
aisthesis-5428	123	5	bw	bw	PROPN
aisthesis-5428	123	6	and	and	CCONJ
aisthesis-5428	123	7	trex	trex	PROPN
aisthesis-5428	123	8	was	be	AUX
aisthesis-5428	123	9	calculated	calculate	VERB
aisthesis-5428	123	10	to	to	PART
aisthesis-5428	123	11	be	be	AUX
aisthesis-5428	123	12	26.1	26.1	NUM
aisthesis-5428	123	13	%	%	NOUN
aisthesis-5428	123	14	.	.	PUNCT
aisthesis-5428	124	1	the	the	DET
aisthesis-5428	124	2	calculated	calculated	ADJ
aisthesis-5428	124	3	chi	chi	ADJ
aisthesis-5428	124	4	-	-	PUNCT
aisthesis-5428	124	5	square	square	ADJ
aisthesis-5428	124	6	value	value	NOUN
aisthesis-5428	124	7	for	for	ADP
aisthesis-5428	124	8	this	this	DET
aisthesis-5428	124	9	cross	cross	NOUN
aisthesis-5428	124	10	was	be	AUX
aisthesis-5428	124	11	found	find	VERB
aisthesis-5428	124	12	to	to	PART
aisthesis-5428	124	13	be	be	AUX
aisthesis-5428	124	14	663.6	663.6	NUM
aisthesis-5428	124	15	,	,	PUNCT
aisthesis-5428	124	16	which	which	PRON
aisthesis-5428	124	17	corresponds	correspond	VERB
aisthesis-5428	124	18	to	to	ADP
aisthesis-5428	124	19	a	a	DET
aisthesis-5428	124	20	p	p	NOUN
aisthesis-5428	124	21	-	-	PUNCT
aisthesis-5428	124	22	value	value	NOUN
aisthesis-5428	124	23	of	of	ADP
aisthesis-5428	124	24	2.2e-16	2.2e-16	PROPN
aisthesis-5428	124	25	(	(	PUNCT
aisthesis-5428	124	26	table	table	NOUN
aisthesis-5428	124	27	6	6	NUM
aisthesis-5428	124	28	)	)	PUNCT
aisthesis-5428	124	29	.	.	PUNCT
aisthesis-5428	125	1	in	in	ADP
aisthesis-5428	125	2	mapping	map	VERB
aisthesis-5428	125	3	cross	cross	PROPN
aisthesis-5428	125	4	b	b	NOUN
aisthesis-5428	125	5	,	,	PUNCT
aisthesis-5428	125	6	female	female	ADJ
aisthesis-5428	125	7	flies	fly	NOUN
aisthesis-5428	125	8	heterozygous	heterozygous	ADJ
aisthesis-5428	125	9	for	for	ADP
aisthesis-5428	125	10	both	both	PRON
aisthesis-5428	125	11	black	black	ADJ
aisthesis-5428	125	12	(	(	PUNCT
aisthesis-5428	125	13	bl	bl	INTJ
aisthesis-5428	125	14	)	)	PUNCT
aisthesis-5428	125	15	and	and	CCONJ
aisthesis-5428	125	16	trex	trex	PROPN
aisthesis-5428	125	17	were	be	AUX
aisthesis-5428	125	18	crossed	cross	VERB
aisthesis-5428	125	19	with	with	ADP
aisthesis-5428	125	20	male	male	ADJ
aisthesis-5428	125	21	flies	fly	NOUN
aisthesis-5428	125	22	homozygous	homozygous	ADJ
aisthesis-5428	125	23	for	for	ADP
aisthesis-5428	125	24	bl	bl	PROPN
aisthesis-5428	125	25	and	and	CCONJ
aisthesis-5428	125	26	trex	trex	PROPN
aisthesis-5428	125	27	.	.	PROPN
aisthesis-5428	125	28	1,519	1,519	NUM
aisthesis-5428	125	29	female	female	ADJ
aisthesis-5428	125	30	and	and	CCONJ
aisthesis-5428	125	31	1,501	1,501	NUM
aisthesis-5428	125	32	male	male	NOUN
aisthesis-5428	125	33	flies	fly	NOUN
aisthesis-5428	125	34	were	be	AUX
aisthesis-5428	125	35	scored	score	VERB
aisthesis-5428	125	36	for	for	ADP
aisthesis-5428	125	37	this	this	DET
aisthesis-5428	125	38	cross	cross	NOUN
aisthesis-5428	125	39	for	for	ADP
aisthesis-5428	125	40	a	a	DET
aisthesis-5428	125	41	total	total	NOUN
aisthesis-5428	125	42	of	of	ADP
aisthesis-5428	125	43	3,020	3,020	NUM
aisthesis-5428	125	44	scored	score	VERB
aisthesis-5428	125	45	flies	fly	NOUN
aisthesis-5428	125	46	(	(	PUNCT
aisthesis-5428	125	47	table	table	NOUN
aisthesis-5428	125	48	7	7	NUM
aisthesis-5428	125	49	)	)	PUNCT
aisthesis-5428	125	50	.	.	PUNCT
aisthesis-5428	126	1	2,590	2,590	NUM
aisthesis-5428	126	2	flies	fly	NOUN
aisthesis-5428	126	3	of	of	ADP
aisthesis-5428	126	4	the	the	DET
aisthesis-5428	126	5	total	total	NOUN
aisthesis-5428	126	6	displayed	display	VERB
aisthesis-5428	126	7	a	a	DET
aisthesis-5428	126	8	parental	parental	ADJ
aisthesis-5428	126	9	phenotype	phenotype	NOUN
aisthesis-5428	126	10	,	,	PUNCT
aisthesis-5428	126	11	while	while	SCONJ
aisthesis-5428	126	12	only	only	ADV
aisthesis-5428	126	13	430	430	NUM
aisthesis-5428	126	14	displayed	display	VERB
aisthesis-5428	126	15	a	a	DET
aisthesis-5428	126	16	recombinant	recombinant	ADJ
aisthesis-5428	126	17	phenotype	phenotype	NOUN
aisthesis-5428	126	18	(	(	PUNCT
aisthesis-5428	126	19	table	table	NOUN
aisthesis-5428	126	20	7	7	NUM
aisthesis-5428	126	21	)	)	PUNCT
aisthesis-5428	126	22	.	.	PUNCT
aisthesis-5428	127	1	the	the	DET
aisthesis-5428	127	2	recombination	recombination	NOUN
aisthesis-5428	127	3	frequency	frequency	NOUN
aisthesis-5428	127	4	was	be	AUX
aisthesis-5428	127	5	calculated	calculate	VERB
aisthesis-5428	127	6	to	to	PART
aisthesis-5428	127	7	be	be	AUX
aisthesis-5428	127	8	14.2	14.2	NUM
aisthesis-5428	127	9	%	%	NOUN
aisthesis-5428	127	10	,	,	PUNCT
aisthesis-5428	127	11	and	and	CCONJ
aisthesis-5428	127	12	the	the	DET
aisthesis-5428	127	13	chi	chi	ADJ
aisthesis-5428	127	14	-	-	PUNCT
aisthesis-5428	127	15	square	square	ADJ
aisthesis-5428	127	16	value	value	NOUN
aisthesis-5428	127	17	of	of	ADP
aisthesis-5428	127	18	this	this	DET
aisthesis-5428	127	19	cross	cross	NOUN
aisthesis-5428	127	20	was	be	AUX
aisthesis-5428	127	21	1,545.3	1,545.3	NUM
aisthesis-5428	127	22	,	,	PUNCT
aisthesis-5428	127	23	which	which	PRON
aisthesis-5428	127	24	gives	give	VERB
aisthesis-5428	127	25	a	a	DET
aisthesis-5428	127	26	p	p	NOUN
aisthesis-5428	127	27	-	-	PUNCT
aisthesis-5428	127	28	value	value	NOUN
aisthesis-5428	127	29	of	of	ADP
aisthesis-5428	127	30	2.2e-16	2.2e-16	PROPN
aisthesis-5428	127	31	(	(	PUNCT
aisthesis-5428	127	32	table	table	NOUN
aisthesis-5428	127	33	8)	8)	NUM
aisthesis-5428	127	34	.	.	PUNCT
aisthesis-5428	128	1	lastly	lastly	ADV
aisthesis-5428	128	2	,	,	PUNCT
aisthesis-5428	128	3	mapping	mapping	NOUN
aisthesis-5428	128	4	cross	cross	NOUN
aisthesis-5428	128	5	c	c	PROPN
aisthesis-5428	128	6	involved	involve	VERB
aisthesis-5428	128	7	crossing	cross	VERB
aisthesis-5428	128	8	female	female	ADJ
aisthesis-5428	128	9	flies	fly	NOUN
aisthesis-5428	128	10	heterozygous	heterozygous	ADJ
aisthesis-5428	128	11	for	for	ADP
aisthesis-5428	128	12	purple	purple	ADJ
aisthesis-5428	128	13	(	(	PUNCT
aisthesis-5428	128	14	pr	pr	NOUN
aisthesis-5428	128	15	)	)	PUNCT
aisthesis-5428	128	16	and	and	CCONJ
aisthesis-5428	128	17	trex	trex	PROPN
aisthesis-5428	128	18	with	with	ADP
aisthesis-5428	128	19	male	male	NOUN
aisthesis-5428	128	20	flies	fly	VERB
aisthesis-5428	128	21	homozygous	homozygous	ADJ
aisthesis-5428	128	22	pr	pr	NOUN
aisthesis-5428	128	23	and	and	CCONJ
aisthesis-5428	128	24	trex	trex	PROPN
aisthesis-5428	128	25	.	.	PUNCT
aisthesis-5428	129	1	a	a	DET
aisthesis-5428	129	2	total	total	NOUN
aisthesis-5428	129	3	of	of	ADP
aisthesis-5428	129	4	3,024	3,024	NUM
aisthesis-5428	129	5	progeny	progeny	NOUN
aisthesis-5428	129	6	were	be	AUX
aisthesis-5428	129	7	collected	collect	VERB
aisthesis-5428	129	8	and	and	CCONJ
aisthesis-5428	129	9	scored	score	VERB
aisthesis-5428	129	10	based	base	VERB
aisthesis-5428	129	11	on	on	ADP
aisthesis-5428	129	12	the	the	DET
aisthesis-5428	129	13	phenotypic	phenotypic	ADJ
aisthesis-5428	129	14	presentation	presentation	NOUN
aisthesis-5428	129	15	,	,	PUNCT
aisthesis-5428	129	16	including	include	VERB
aisthesis-5428	129	17	1,058	1,058	NUM
aisthesis-5428	129	18	females	female	NOUN
aisthesis-5428	129	19	and	and	CCONJ
aisthesis-5428	129	20	1,516	1,516	NUM
aisthesis-5428	129	21	males	male	NOUN
aisthesis-5428	129	22	(	(	PUNCT
aisthesis-5428	129	23	table	table	NOUN
aisthesis-5428	129	24	9	9	NUM
aisthesis-5428	129	25	)	)	PUNCT
aisthesis-5428	129	26	.	.	PUNCT
aisthesis-5428	130	1	of	of	ADP
aisthesis-5428	130	2	the	the	DET
aisthesis-5428	130	3	total	total	ADJ
aisthesis-5428	130	4	progeny	progeny	NOUN
aisthesis-5428	130	5	,	,	PUNCT
aisthesis-5428	130	6	2,694	2,694	NUM
aisthesis-5428	130	7	displayed	display	VERB
aisthesis-5428	130	8	a	a	DET
aisthesis-5428	130	9	phenotype	phenotype	NOUN
aisthesis-5428	130	10	of	of	ADP
aisthesis-5428	130	11	the	the	DET
aisthesis-5428	130	12	parents	parent	NOUN
aisthesis-5428	130	13	and	and	CCONJ
aisthesis-5428	130	14	330	330	NUM
aisthesis-5428	130	15	displayed	display	VERB
aisthesis-5428	130	16	a	a	DET
aisthesis-5428	130	17	recombinant	recombinant	ADJ
aisthesis-5428	130	18	phenotype	phenotype	NOUN
aisthesis-5428	130	19	,	,	PUNCT
aisthesis-5428	130	20	giving	give	VERB
aisthesis-5428	130	21	a	a	DET
aisthesis-5428	130	22	recombination	recombination	NOUN
aisthesis-5428	130	23	frequency	frequency	NOUN
aisthesis-5428	130	24	of	of	ADP
aisthesis-5428	130	25	10.9	10.9	NUM
aisthesis-5428	130	26	%	%	NOUN
aisthesis-5428	130	27	(	(	PUNCT
aisthesis-5428	130	28	table	table	NOUN
aisthesis-5428	130	29	9	9	NUM
aisthesis-5428	130	30	)	)	PUNCT
aisthesis-5428	130	31	.	.	PUNCT
aisthesis-5428	131	1	the	the	DET
aisthesis-5428	131	2	chi	chi	ADJ
aisthesis-5428	131	3	-	-	PUNCT
aisthesis-5428	131	4	square	square	ADJ
aisthesis-5428	131	5	value	value	NOUN
aisthesis-5428	131	6	calculated	calculate	VERB
aisthesis-5428	131	7	for	for	ADP
aisthesis-5428	131	8	this	this	DET
aisthesis-5428	131	9	cross	cross	NOUN
aisthesis-5428	131	10	was	be	AUX
aisthesis-5428	131	11	1,850.4	1,850.4	NUM
aisthesis-5428	131	12	,	,	PUNCT
aisthesis-5428	131	13	leading	lead	VERB
aisthesis-5428	131	14	to	to	ADP
aisthesis-5428	131	15	a	a	DET
aisthesis-5428	131	16	p	p	NOUN
aisthesis-5428	131	17	-	-	PUNCT
aisthesis-5428	131	18	value	value	NOUN
aisthesis-5428	131	19	of	of	ADP
aisthesis-5428	131	20	2.2e-16	2.2e-16	PROPN
aisthesis-5428	131	21	(	(	PUNCT
aisthesis-5428	131	22	table	table	NOUN
aisthesis-5428	131	23	10	10	NUM
aisthesis-5428	131	24	)	)	PUNCT
aisthesis-5428	131	25	.	.	PUNCT
aisthesis-5428	132	1	d.	d.	PROPN
aisthesis-5428	132	2	pcr	pcr	PROPN
aisthesis-5428	132	3	and	and	CCONJ
aisthesis-5428	132	4	gel	gel	NOUN
aisthesis-5428	132	5	electrophoresis	electrophoresis	NOUN
aisthesis-5428	132	6	dna	dna	NOUN
aisthesis-5428	132	7	segments	segment	NOUN
aisthesis-5428	132	8	amplified	amplify	VERB
aisthesis-5428	132	9	using	use	VERB
aisthesis-5428	132	10	pcr	pcr	ADJ
aisthesis-5428	132	11	thermocycling	thermocycling	NOUN
aisthesis-5428	132	12	were	be	AUX
aisthesis-5428	132	13	viewed	view	VERB
aisthesis-5428	132	14	after	after	ADP
aisthesis-5428	132	15	being	be	AUX
aisthesis-5428	132	16	subjected	subject	VERB
aisthesis-5428	132	17	to	to	ADP
aisthesis-5428	132	18	gel	gel	NOUN
aisthesis-5428	132	19	electrophoresis	electrophoresis	NOUN
aisthesis-5428	132	20	size	size	NOUN
aisthesis-5428	132	21	-	-	PUNCT
aisthesis-5428	132	22	based	base	VERB
aisthesis-5428	132	23	separation	separation	NOUN
aisthesis-5428	132	24	of	of	ADP
aisthesis-5428	132	25	dna	dna	PROPN
aisthesis-5428	132	26	.	.	PUNCT
aisthesis-5428	133	1	gel	gel	NOUN
aisthesis-5428	133	2	electrophoresis	electrophoresis	NOUN
aisthesis-5428	133	3	allows	allow	VERB
aisthesis-5428	133	4	for	for	ADP
aisthesis-5428	133	5	the	the	DET
aisthesis-5428	133	6	separation	separation	NOUN
aisthesis-5428	133	7	of	of	ADP
aisthesis-5428	133	8	dna	dna	PROPN
aisthesis-5428	133	9	fragments	fragment	NOUN
aisthesis-5428	133	10	based	base	VERB
aisthesis-5428	133	11	on	on	ADP
aisthesis-5428	133	12	size	size	NOUN
aisthesis-5428	133	13	,	,	PUNCT
aisthesis-5428	133	14	as	as	SCONJ
aisthesis-5428	133	15	the	the	DET
aisthesis-5428	133	16	positively	positively	ADV
aisthesis-5428	133	17	charged	charge	VERB
aisthesis-5428	133	18	anode	anode	NOUN
aisthesis-5428	133	19	pulls	pull	VERB
aisthesis-5428	133	20	the	the	DET
aisthesis-5428	133	21	negatively	negatively	ADV
aisthesis-5428	133	22	charged	charge	VERB
aisthesis-5428	133	23	dna	dna	NOUN
aisthesis-5428	133	24	fragments	fragment	NOUN
aisthesis-5428	133	25	toward	toward	ADP
aisthesis-5428	133	26	it	it	PRON
aisthesis-5428	133	27	through	through	ADP
aisthesis-5428	133	28	the	the	DET
aisthesis-5428	133	29	gel	gel	NOUN
aisthesis-5428	133	30	.	.	PUNCT
aisthesis-5428	134	1	smaller	small	ADJ
aisthesis-5428	134	2	fragments	fragment	NOUN
aisthesis-5428	134	3	travel	travel	VERB
aisthesis-5428	134	4	faster	fast	ADV
aisthesis-5428	134	5	through	through	ADP
aisthesis-5428	134	6	the	the	DET
aisthesis-5428	134	7	agarose	agarose	NOUN
aisthesis-5428	134	8	gel	gel	NOUN
aisthesis-5428	134	9	and	and	CCONJ
aisthesis-5428	134	10	are	be	AUX
aisthesis-5428	134	11	visualized	visualize	VERB
aisthesis-5428	134	12	as	as	ADP
aisthesis-5428	134	13	a	a	DET
aisthesis-5428	134	14	band	band	NOUN
aisthesis-5428	134	15	that	that	PRON
aisthesis-5428	134	16	has	have	AUX
aisthesis-5428	134	17	traveled	travel	VERB
aisthesis-5428	134	18	closer	close	ADV
aisthesis-5428	134	19	to	to	ADP
aisthesis-5428	134	20	the	the	DET
aisthesis-5428	134	21	anode	anode	NOUN
aisthesis-5428	134	22	in	in	ADP
aisthesis-5428	134	23	the	the	DET
aisthesis-5428	134	24	given	give	VERB
aisthesis-5428	134	25	amount	amount	NOUN
aisthesis-5428	134	26	of	of	ADP
aisthesis-5428	134	27	time	time	NOUN
aisthesis-5428	134	28	.	.	PUNCT
aisthesis-5428	135	1	larger	large	ADJ
aisthesis-5428	135	2	fragments	fragment	NOUN
aisthesis-5428	135	3	move	move	VERB
aisthesis-5428	135	4	slower	slow	ADV
aisthesis-5428	135	5	through	through	ADP
aisthesis-5428	135	6	the	the	DET
aisthesis-5428	135	7	gel	gel	NOUN
aisthesis-5428	135	8	and	and	CCONJ
aisthesis-5428	135	9	are	be	AUX
aisthesis-5428	135	10	visible	visible	ADJ
aisthesis-5428	135	11	as	as	ADP
aisthesis-5428	135	12	bands	band	NOUN
aisthesis-5428	135	13	further	far	ADV
aisthesis-5428	135	14	from	from	ADP
aisthesis-5428	135	15	the	the	DET
aisthesis-5428	135	16	anode	anode	NOUN
aisthesis-5428	135	17	.	.	PUNCT
aisthesis-5428	136	1	under	under	ADP
aisthesis-5428	136	2	a	a	DET
aisthesis-5428	136	3	uv	uv	NOUN
aisthesis-5428	136	4	viewing	view	VERB
aisthesis-5428	136	5	light	light	NOUN
aisthesis-5428	136	6	,	,	PUNCT
aisthesis-5428	136	7	3	3	NUM
aisthesis-5428	136	8	of	of	ADP
aisthesis-5428	136	9	the	the	DET
aisthesis-5428	136	10	10	10	NUM
aisthesis-5428	136	11	wells	well	NOUN
aisthesis-5428	136	12	used	use	VERB
aisthesis-5428	136	13	for	for	ADP
aisthesis-5428	136	14	the	the	DET
aisthesis-5428	136	15	first	first	ADJ
aisthesis-5428	136	16	agarose	agarose	NOUN
aisthesis-5428	136	17	gel	gel	NOUN
aisthesis-5428	136	18	in	in	ADP
aisthesis-5428	136	19	gel	gel	NOUN
aisthesis-5428	136	20	electrophoresis	electrophoresis	NOUN
aisthesis-5428	136	21	produced	produce	VERB
aisthesis-5428	136	22	traveling	travel	VERB
aisthesis-5428	136	23	bands	band	NOUN
aisthesis-5428	136	24	through	through	ADP
aisthesis-5428	136	25	the	the	DET
aisthesis-5428	136	26	agarose	agarose	NOUN
aisthesis-5428	136	27	gel	gel	NOUN
aisthesis-5428	136	28	that	that	PRON
aisthesis-5428	136	29	were	be	AUX
aisthesis-5428	136	30	visible	visible	ADJ
aisthesis-5428	136	31	.	.	PUNCT
aisthesis-5428	137	1	the	the	DET
aisthesis-5428	137	2	first	first	ADJ
aisthesis-5428	137	3	well	well	NOUN
aisthesis-5428	137	4	containing	contain	VERB
aisthesis-5428	137	5	the	the	DET
aisthesis-5428	137	6	ladder	ladder	NOUN
aisthesis-5428	137	7	solution	solution	NOUN
aisthesis-5428	137	8	produced	produce	VERB
aisthesis-5428	137	9	the	the	DET
aisthesis-5428	137	10	appropriate	appropriate	ADJ
aisthesis-5428	137	11	ladder	ladder	NOUN
aisthesis-5428	137	12	as	as	SCONJ
aisthesis-5428	137	13	expected	expect	VERB
aisthesis-5428	137	14	.	.	PUNCT
aisthesis-5428	138	1	the	the	DET
aisthesis-5428	138	2	third	third	ADJ
aisthesis-5428	138	3	well	well	NOUN
aisthesis-5428	138	4	containing	contain	VERB
aisthesis-5428	138	5	a	a	DET
aisthesis-5428	138	6	positive	positive	ADJ
aisthesis-5428	138	7	pcr	pcr	NOUN
aisthesis-5428	138	8	control	control	NOUN
aisthesis-5428	138	9	with	with	ADP
aisthesis-5428	138	10	gapdh	gapdh	NOUN
aisthesis-5428	138	11	primers	primer	NOUN
aisthesis-5428	138	12	produced	produce	VERB
aisthesis-5428	138	13	a	a	DET
aisthesis-5428	138	14	band	band	NOUN
aisthesis-5428	138	15	that	that	SCONJ
aisthesis-5428	138	16	analysis	analysis	NOUN
aisthesis-5428	138	17	of	of	ADP
aisthesis-5428	138	18	novel	novel	ADJ
aisthesis-5428	138	19	unknown	unknown	ADJ
aisthesis-5428	138	20	d.	d.	NOUN
aisthesis-5428	138	21	melanogaster	melanogaster	NOUN
aisthesis-5428	138	22	mutation	mutation	NOUN
aisthesis-5428	138	23	trex	trex	PROPN
aisthesis-5428	138	24	aisthesis	aisthesis	NOUN
aisthesis-5428	138	25	volume	volume	NOUN
aisthesis-5428	138	26	14	14	NUM
aisthesis-5428	138	27	,	,	PUNCT
aisthesis-5428	138	28	202360	202360	NUM
aisthesis-5428	138	29	traveled	travel	VERB
aisthesis-5428	138	30	to	to	ADP
aisthesis-5428	138	31	a	a	DET
aisthesis-5428	138	32	location	location	NOUN
aisthesis-5428	138	33	corresponding	correspond	VERB
aisthesis-5428	138	34	to	to	ADP
aisthesis-5428	138	35	about	about	ADV
aisthesis-5428	138	36	100	100	NUM
aisthesis-5428	138	37	base	base	NOUN
aisthesis-5428	138	38	pairs	pair	NOUN
aisthesis-5428	138	39	(	(	PUNCT
aisthesis-5428	138	40	figure	figure	NOUN
aisthesis-5428	138	41	5	5	NUM
aisthesis-5428	138	42	)	)	PUNCT
aisthesis-5428	138	43	.	.	PUNCT
aisthesis-5428	139	1	the	the	DET
aisthesis-5428	139	2	fifth	fifth	ADJ
aisthesis-5428	139	3	well	well	NOUN
aisthesis-5428	139	4	containing	contain	VERB
aisthesis-5428	139	5	our	our	PRON
aisthesis-5428	139	6	experimental	experimental	ADJ
aisthesis-5428	139	7	sample	sample	NOUN
aisthesis-5428	139	8	of	of	ADP
aisthesis-5428	139	9	trex	trex	PROPN
aisthesis-5428	139	10	traveled	travel	VERB
aisthesis-5428	139	11	to	to	ADP
aisthesis-5428	139	12	a	a	DET
aisthesis-5428	139	13	location	location	NOUN
aisthesis-5428	139	14	corresponding	correspond	VERB
aisthesis-5428	139	15	to	to	ADP
aisthesis-5428	139	16	about	about	ADV
aisthesis-5428	139	17	1,000	1,000	NUM
aisthesis-5428	139	18	base	base	NOUN
aisthesis-5428	139	19	pairs	pair	NOUN
aisthesis-5428	139	20	(	(	PUNCT
aisthesis-5428	139	21	figure	figure	NOUN
aisthesis-5428	139	22	5	5	NUM
aisthesis-5428	139	23	)	)	PUNCT
aisthesis-5428	139	24	.	.	PUNCT
aisthesis-5428	140	1	no	no	DET
aisthesis-5428	140	2	other	other	ADJ
aisthesis-5428	140	3	wells	well	NOUN
aisthesis-5428	140	4	produced	produce	VERB
aisthesis-5428	140	5	visible	visible	ADJ
aisthesis-5428	140	6	bands	band	NOUN
aisthesis-5428	140	7	in	in	ADP
aisthesis-5428	140	8	the	the	DET
aisthesis-5428	140	9	gel	gel	NOUN
aisthesis-5428	140	10	.	.	PUNCT
aisthesis-5428	141	1	the	the	DET
aisthesis-5428	141	2	second	second	ADJ
aisthesis-5428	141	3	gel	gel	NOUN
aisthesis-5428	141	4	prepared	prepare	VERB
aisthesis-5428	141	5	using	use	VERB
aisthesis-5428	141	6	ta	ta	ADP
aisthesis-5428	141	7	samples	sample	NOUN
aisthesis-5428	141	8	did	do	AUX
aisthesis-5428	141	9	not	not	PART
aisthesis-5428	141	10	produce	produce	VERB
aisthesis-5428	141	11	any	any	DET
aisthesis-5428	141	12	results	result	NOUN
aisthesis-5428	141	13	.	.	PUNCT
aisthesis-5428	142	1	the	the	DET
aisthesis-5428	142	2	negative	negative	ADJ
aisthesis-5428	142	3	control	control	NOUN
aisthesis-5428	142	4	lanes	lane	NOUN
aisthesis-5428	142	5	in	in	ADP
aisthesis-5428	142	6	wells	wells	PROPN
aisthesis-5428	142	7	8	8	NUM
aisthesis-5428	142	8	,	,	PUNCT
aisthesis-5428	142	9	9	9	NUM
aisthesis-5428	142	10	,	,	PUNCT
aisthesis-5428	142	11	and	and	CCONJ
aisthesis-5428	142	12	10	10	NUM
aisthesis-5428	142	13	rightfully	rightfully	ADV
aisthesis-5428	142	14	displayed	display	VERB
aisthesis-5428	142	15	no	no	DET
aisthesis-5428	142	16	bands	band	NOUN
aisthesis-5428	142	17	,	,	PUNCT
aisthesis-5428	142	18	as	as	SCONJ
aisthesis-5428	142	19	the	the	DET
aisthesis-5428	142	20	samples	sample	NOUN
aisthesis-5428	142	21	contained	contain	VERB
aisthesis-5428	142	22	no	no	DET
aisthesis-5428	142	23	primers	primer	NOUN
aisthesis-5428	142	24	and	and	CCONJ
aisthesis-5428	142	25	thus	thus	ADV
aisthesis-5428	142	26	the	the	DET
aisthesis-5428	142	27	dna	dna	PROPN
aisthesis-5428	142	28	contained	contain	VERB
aisthesis-5428	142	29	was	be	AUX
aisthesis-5428	142	30	not	not	PART
aisthesis-5428	142	31	amplified	amplify	VERB
aisthesis-5428	142	32	by	by	ADP
aisthesis-5428	142	33	pcr	pcr	PROPN
aisthesis-5428	142	34	.	.	PUNCT
aisthesis-5428	143	1	however	however	ADV
aisthesis-5428	143	2	,	,	PUNCT
aisthesis-5428	143	3	it	it	PRON
aisthesis-5428	143	4	was	be	AUX
aisthesis-5428	143	5	given	give	VERB
aisthesis-5428	143	6	by	by	ADP
aisthesis-5428	143	7	tas	ta	NOUN
aisthesis-5428	143	8	that	that	PRON
aisthesis-5428	143	9	wells	wells	PROPN
aisthesis-5428	143	10	2	2	NUM
aisthesis-5428	143	11	,	,	PUNCT
aisthesis-5428	143	12	3	3	NUM
aisthesis-5428	143	13	,	,	PUNCT
aisthesis-5428	143	14	and	and	CCONJ
aisthesis-5428	143	15	4	4	NUM
aisthesis-5428	143	16	with	with	ADP
aisthesis-5428	143	17	the	the	DET
aisthesis-5428	143	18	positive	positive	ADJ
aisthesis-5428	143	19	control	control	NOUN
aisthesis-5428	143	20	sample	sample	NOUN
aisthesis-5428	143	21	should	should	AUX
aisthesis-5428	143	22	have	have	VERB
aisthesis-5428	143	23	all	all	PRON
aisthesis-5428	143	24	produced	produce	VERB
aisthesis-5428	143	25	bands	band	NOUN
aisthesis-5428	143	26	of	of	ADP
aisthesis-5428	143	27	about	about	ADV
aisthesis-5428	143	28	100	100	NUM
aisthesis-5428	143	29	bp	bp	NOUN
aisthesis-5428	143	30	.	.	PUNCT
aisthesis-5428	144	1	further	far	ADV
aisthesis-5428	144	2	,	,	PUNCT
aisthesis-5428	144	3	wells	well	NOUN
aisthesis-5428	144	4	6	6	NUM
aisthesis-5428	144	5	and	and	CCONJ
aisthesis-5428	144	6	7	7	NUM
aisthesis-5428	144	7	containing	contain	VERB
aisthesis-5428	144	8	wildtype	wildtype	NOUN
aisthesis-5428	144	9	and	and	CCONJ
aisthesis-5428	144	10	wtm	wtm	PROPN
aisthesis-5428	144	11	f1	f1	PROPN
aisthesis-5428	144	12	dna	dna	PROPN
aisthesis-5428	144	13	,	,	PUNCT
aisthesis-5428	144	14	respectively	respectively	ADV
aisthesis-5428	144	15	,	,	PUNCT
aisthesis-5428	144	16	should	should	AUX
aisthesis-5428	144	17	have	have	AUX
aisthesis-5428	144	18	produced	produce	VERB
aisthesis-5428	144	19	bands	band	NOUN
aisthesis-5428	144	20	traveling	travel	VERB
aisthesis-5428	144	21	significantly	significantly	ADV
aisthesis-5428	144	22	farther	far	ADV
aisthesis-5428	144	23	than	than	ADP
aisthesis-5428	144	24	the	the	DET
aisthesis-5428	144	25	band	band	NOUN
aisthesis-5428	144	26	produced	produce	VERB
aisthesis-5428	144	27	from	from	ADP
aisthesis-5428	144	28	well	well	ADV
aisthesis-5428	144	29	6	6	NUM
aisthesis-5428	144	30	containing	contain	VERB
aisthesis-5428	144	31	trex	trex	PROPN
aisthesis-5428	144	32	dna	dna	PROPN
aisthesis-5428	144	33	.	.	PUNCT
aisthesis-5428	145	1	e.	e.	PROPN
aisthesis-5428	145	2	blast	blast	PROPN
aisthesis-5428	145	3	analysis	analysis	NOUN
aisthesis-5428	145	4	the	the	DET
aisthesis-5428	145	5	bioinformatic	bioinformatic	ADJ
aisthesis-5428	145	6	blast	blast	NOUN
aisthesis-5428	145	7	analysis	analysis	NOUN
aisthesis-5428	145	8	of	of	ADP
aisthesis-5428	145	9	the	the	DET
aisthesis-5428	145	10	trex	trex	PROPN
aisthesis-5428	145	11	mutation	mutation	NOUN
aisthesis-5428	145	12	allowed	allow	VERB
aisthesis-5428	145	13	for	for	ADP
aisthesis-5428	145	14	the	the	DET
aisthesis-5428	145	15	understanding	understanding	NOUN
aisthesis-5428	145	16	of	of	ADP
aisthesis-5428	145	17	trex	trex	PROPN
aisthesis-5428	145	18	on	on	ADP
aisthesis-5428	145	19	a	a	DET
aisthesis-5428	145	20	molecular	molecular	ADJ
aisthesis-5428	145	21	level	level	NOUN
aisthesis-5428	145	22	by	by	ADP
aisthesis-5428	145	23	revealing	reveal	VERB
aisthesis-5428	145	24	the	the	DET
aisthesis-5428	145	25	sequence	sequence	NOUN
aisthesis-5428	145	26	and	and	CCONJ
aisthesis-5428	145	27	structure	structure	NOUN
aisthesis-5428	145	28	-	-	PUNCT
aisthesis-5428	145	29	level	level	NOUN
aisthesis-5428	145	30	mutation	mutation	NOUN
aisthesis-5428	145	31	which	which	PRON
aisthesis-5428	145	32	forms	form	VERB
aisthesis-5428	145	33	the	the	DET
aisthesis-5428	145	34	basis	basis	NOUN
aisthesis-5428	145	35	of	of	ADP
aisthesis-5428	145	36	the	the	DET
aisthesis-5428	145	37	trex	trex	PROPN
aisthesis-5428	145	38	phenotype	phenotype	NOUN
aisthesis-5428	145	39	.	.	PUNCT
aisthesis-5428	146	1	upon	upon	SCONJ
aisthesis-5428	146	2	screening	screen	VERB
aisthesis-5428	146	3	the	the	DET
aisthesis-5428	146	4	wild	wild	ADJ
aisthesis-5428	146	5	-	-	PUNCT
aisthesis-5428	146	6	type	type	NOUN
aisthesis-5428	146	7	genome	genome	NOUN
aisthesis-5428	146	8	for	for	ADP
aisthesis-5428	146	9	the	the	DET
aisthesis-5428	146	10	forward	forward	ADJ
aisthesis-5428	146	11	and	and	CCONJ
aisthesis-5428	146	12	reverse	reverse	ADJ
aisthesis-5428	146	13	primer	primer	NOUN
aisthesis-5428	146	14	sequences	sequence	NOUN
aisthesis-5428	146	15	in	in	ADP
aisthesis-5428	146	16	order	order	NOUN
aisthesis-5428	146	17	to	to	PART
aisthesis-5428	146	18	locate	locate	VERB
aisthesis-5428	146	19	the	the	DET
aisthesis-5428	146	20	wild	wild	ADJ
aisthesis-5428	146	21	-	-	PUNCT
aisthesis-5428	146	22	type	type	NOUN
aisthesis-5428	146	23	amplicon	amplicon	NOUN
aisthesis-5428	146	24	,	,	PUNCT
aisthesis-5428	146	25	the	the	DET
aisthesis-5428	146	26	reverse	reverse	ADJ
aisthesis-5428	146	27	primer	primer	NOUN
aisthesis-5428	146	28	was	be	AUX
aisthesis-5428	146	29	not	not	PART
aisthesis-5428	146	30	found	find	VERB
aisthesis-5428	146	31	within	within	ADP
aisthesis-5428	146	32	the	the	DET
aisthesis-5428	146	33	wild	wild	ADJ
aisthesis-5428	146	34	-	-	PUNCT
aisthesis-5428	146	35	type	type	NOUN
aisthesis-5428	146	36	genome	genome	NOUN
aisthesis-5428	146	37	.	.	PUNCT
aisthesis-5428	147	1	the	the	DET
aisthesis-5428	147	2	nucleotide	nucleotide	NOUN
aisthesis-5428	147	3	blast	blast	NOUN
aisthesis-5428	147	4	comparison	comparison	NOUN
aisthesis-5428	147	5	of	of	ADP
aisthesis-5428	147	6	the	the	DET
aisthesis-5428	147	7	trex	trex	PROPN
aisthesis-5428	147	8	sequence	sequence	NOUN
aisthesis-5428	147	9	produced	produce	VERB
aisthesis-5428	147	10	by	by	ADP
aisthesis-5428	147	11	dideoxy	dideoxy	ADJ
aisthesis-5428	147	12	chain	chain	NOUN
aisthesis-5428	147	13	termination	termination	NOUN
aisthesis-5428	147	14	and	and	CCONJ
aisthesis-5428	147	15	the	the	DET
aisthesis-5428	147	16	wild	wild	ADJ
aisthesis-5428	147	17	-	-	PUNCT
aisthesis-5428	147	18	type	type	NOUN
aisthesis-5428	147	19	sequence	sequence	NOUN
aisthesis-5428	147	20	starting	start	VERB
aisthesis-5428	147	21	with	with	ADP
aisthesis-5428	147	22	the	the	DET
aisthesis-5428	147	23	reverse	reverse	ADJ
aisthesis-5428	147	24	primer	primer	NOUN
aisthesis-5428	147	25	gave	give	VERB
aisthesis-5428	147	26	a	a	DET
aisthesis-5428	147	27	94	94	NUM
aisthesis-5428	147	28	%	%	NOUN
aisthesis-5428	147	29	agreement	agreement	NOUN
aisthesis-5428	147	30	in	in	ADP
aisthesis-5428	147	31	identity	identity	NOUN
aisthesis-5428	147	32	of	of	ADP
aisthesis-5428	147	33	425	425	NUM
aisthesis-5428	147	34	base	base	NOUN
aisthesis-5428	147	35	pairs	pair	NOUN
aisthesis-5428	147	36	,	,	PUNCT
aisthesis-5428	147	37	as	as	SCONJ
aisthesis-5428	147	38	shown	show	VERB
aisthesis-5428	147	39	in	in	ADP
aisthesis-5428	147	40	figure	figure	NOUN
aisthesis-5428	147	41	6a	6a	NOUN
aisthesis-5428	147	42	.	.	PUNCT
aisthesis-5428	148	1	the	the	DET
aisthesis-5428	148	2	comparison	comparison	NOUN
aisthesis-5428	148	3	of	of	ADP
aisthesis-5428	148	4	trex	trex	PROPN
aisthesis-5428	148	5	and	and	CCONJ
aisthesis-5428	148	6	wild	wild	ADJ
aisthesis-5428	148	7	-	-	PUNCT
aisthesis-5428	148	8	type	type	NOUN
aisthesis-5428	148	9	dna	dna	NOUN
aisthesis-5428	148	10	sequences	sequence	NOUN
aisthesis-5428	148	11	show	show	VERB
aisthesis-5428	148	12	an	an	DET
aisthesis-5428	148	13	insertion	insertion	NOUN
aisthesis-5428	148	14	of	of	ADP
aisthesis-5428	148	15	genetic	genetic	ADJ
aisthesis-5428	148	16	material	material	NOUN
aisthesis-5428	148	17	after	after	ADP
aisthesis-5428	148	18	the	the	DET
aisthesis-5428	148	19	425	425	NUM
aisthesis-5428	148	20	base	base	NOUN
aisthesis-5428	148	21	pair	pair	NOUN
aisthesis-5428	148	22	alignment	alignment	NOUN
aisthesis-5428	148	23	(	(	PUNCT
aisthesis-5428	148	24	figure	figure	NOUN
aisthesis-5428	148	25	6c	6c	PROPN
aisthesis-5428	148	26	)	)	PUNCT
aisthesis-5428	148	27	.	.	PUNCT
aisthesis-5428	149	1	the	the	DET
aisthesis-5428	149	2	inserted	insert	VERB
aisthesis-5428	149	3	dna	dna	NOUN
aisthesis-5428	149	4	in	in	ADP
aisthesis-5428	149	5	the	the	DET
aisthesis-5428	149	6	trex	trex	PROPN
aisthesis-5428	149	7	sequence	sequence	NOUN
aisthesis-5428	149	8	was	be	AUX
aisthesis-5428	149	9	analyzed	analyze	VERB
aisthesis-5428	149	10	using	use	VERB
aisthesis-5428	149	11	a	a	DET
aisthesis-5428	149	12	nucleotide	nucleotide	ADJ
aisthesis-5428	149	13	blast	blast	NOUN
aisthesis-5428	149	14	on	on	ADP
aisthesis-5428	149	15	flybase	flybase	NOUN
aisthesis-5428	149	16	,	,	PUNCT
aisthesis-5428	149	17	aligning	align	VERB
aisthesis-5428	149	18	with	with	ADP
aisthesis-5428	149	19	over	over	ADP
aisthesis-5428	149	20	25	25	NUM
aisthesis-5428	149	21	d.	d.	NOUN
aisthesis-5428	149	22	melanogaster	melanogaster	NOUN
aisthesis-5428	149	23	retrotransposons	retrotransposon	NOUN
aisthesis-5428	149	24	with	with	ADP
aisthesis-5428	149	25	an	an	DET
aisthesis-5428	149	26	e	e	NOUN
aisthesis-5428	149	27	-	-	NOUN
aisthesis-5428	149	28	value	value	NOUN
aisthesis-5428	149	29	of	of	ADP
aisthesis-5428	149	30	0	0	NUM
aisthesis-5428	149	31	(	(	PUNCT
aisthesis-5428	149	32	figure	figure	NOUN
aisthesis-5428	149	33	9a	9a	NOUN
aisthesis-5428	149	34	)	)	PUNCT
aisthesis-5428	149	35	.	.	PUNCT
aisthesis-5428	150	1	the	the	DET
aisthesis-5428	150	2	wild	wild	ADJ
aisthesis-5428	150	3	-	-	PUNCT
aisthesis-5428	150	4	type	type	NOUN
aisthesis-5428	150	5	amplicon	amplicon	NOUN
aisthesis-5428	150	6	segment	segment	NOUN
aisthesis-5428	150	7	corresponding	correspond	VERB
aisthesis-5428	150	8	to	to	ADP
aisthesis-5428	150	9	trex	trex	PROPN
aisthesis-5428	150	10	(	(	PUNCT
aisthesis-5428	150	11	figure	figure	NOUN
aisthesis-5428	150	12	10	10	NUM
aisthesis-5428	150	13	)	)	PUNCT
aisthesis-5428	150	14	was	be	AUX
aisthesis-5428	150	15	analyzed	analyze	VERB
aisthesis-5428	150	16	using	use	VERB
aisthesis-5428	150	17	a	a	DET
aisthesis-5428	150	18	protein	protein	NOUN
aisthesis-5428	150	19	blast	blast	NOUN
aisthesis-5428	150	20	and	and	CCONJ
aisthesis-5428	150	21	was	be	AUX
aisthesis-5428	150	22	found	find	VERB
aisthesis-5428	150	23	to	to	PART
aisthesis-5428	150	24	be	be	AUX
aisthesis-5428	150	25	allelic	allelic	ADJ
aisthesis-5428	150	26	to	to	ADP
aisthesis-5428	150	27	the	the	DET
aisthesis-5428	150	28	d.	d.	NOUN
aisthesis-5428	150	29	melanogaster	melanogaster	NOUN
aisthesis-5428	150	30	gene	gene	NOUN
aisthesis-5428	150	31	vestigial	vestigial	NOUN
aisthesis-5428	150	32	(	(	PUNCT
aisthesis-5428	150	33	vg	vg	NOUN
aisthesis-5428	150	34	)	)	PUNCT
aisthesis-5428	150	35	as	as	SCONJ
aisthesis-5428	150	36	hypothesized	hypothesize	VERB
aisthesis-5428	150	37	.	.	PUNCT
aisthesis-5428	151	1	further	far	ADV
aisthesis-5428	151	2	,	,	PUNCT
aisthesis-5428	151	3	when	when	SCONJ
aisthesis-5428	151	4	the	the	DET
aisthesis-5428	151	5	wild	wild	ADJ
aisthesis-5428	151	6	-	-	PUNCT
aisthesis-5428	151	7	type	type	NOUN
aisthesis-5428	151	8	amino	amino	NOUN
aisthesis-5428	151	9	acid	acid	NOUN
aisthesis-5428	151	10	sequence	sequence	NOUN
aisthesis-5428	151	11	retrieved	retrieve	VERB
aisthesis-5428	151	12	from	from	ADP
aisthesis-5428	151	13	expasy	expasy	NOUN
aisthesis-5428	151	14	(	(	PUNCT
aisthesis-5428	151	15	figure	figure	NOUN
aisthesis-5428	151	16	10	10	NUM
aisthesis-5428	151	17	)	)	PUNCT
aisthesis-5428	151	18	was	be	AUX
aisthesis-5428	151	19	subjected	subject	VERB
aisthesis-5428	151	20	to	to	ADP
aisthesis-5428	151	21	a	a	DET
aisthesis-5428	151	22	protein	protein	NOUN
aisthesis-5428	151	23	blast	blast	NOUN
aisthesis-5428	151	24	specifically	specifically	ADV
aisthesis-5428	151	25	searching	search	VERB
aisthesis-5428	151	26	for	for	ADP
aisthesis-5428	151	27	human	human	ADJ
aisthesis-5428	151	28	orthologs	ortholog	NOUN
aisthesis-5428	151	29	,	,	PUNCT
aisthesis-5428	151	30	it	it	PRON
aisthesis-5428	151	31	was	be	AUX
aisthesis-5428	151	32	found	find	VERB
aisthesis-5428	151	33	to	to	PART
aisthesis-5428	151	34	have	have	VERB
aisthesis-5428	151	35	a	a	DET
aisthesis-5428	151	36	high	high	ADJ
aisthesis-5428	151	37	correspondence	correspondence	NOUN
aisthesis-5428	151	38	with	with	ADP
aisthesis-5428	151	39	the	the	DET
aisthesis-5428	151	40	human	human	ADJ
aisthesis-5428	151	41	gene	gene	NOUN
aisthesis-5428	151	42	vestigial	vestigial	ADJ
aisthesis-5428	151	43	-	-	PUNCT
aisthesis-5428	151	44	like	like	ADJ
aisthesis-5428	151	45	family	family	NOUN
aisthesis-5428	151	46	member	member	NOUN
aisthesis-5428	151	47	2	2	NUM
aisthesis-5428	151	48	(	(	PUNCT
aisthesis-5428	151	49	vgll-2	vgll-2	NUM
aisthesis-5428	151	50	)	)	PUNCT
aisthesis-5428	151	51	(	(	PUNCT
aisthesis-5428	151	52	figure	figure	NOUN
aisthesis-5428	151	53	11	11	NUM
aisthesis-5428	151	54	)	)	PUNCT
aisthesis-5428	151	55	.	.	PUNCT
aisthesis-5428	152	1	discussion	discussion	NOUN
aisthesis-5428	152	2	:	:	PUNCT
aisthesis-5428	152	3	a.	a.	PROPN
aisthesis-5428	152	4	trex	trex	PROPN
aisthesis-5428	152	5	is	be	AUX
aisthesis-5428	152	6	inherited	inherit	VERB
aisthesis-5428	152	7	in	in	ADP
aisthesis-5428	152	8	an	an	DET
aisthesis-5428	152	9	autosomal	autosomal	ADJ
aisthesis-5428	152	10	recessive	recessive	ADJ
aisthesis-5428	152	11	pattern	pattern	NOUN
aisthesis-5428	152	12	wtm1	wtm1	NOUN
aisthesis-5428	152	13	and	and	CCONJ
aisthesis-5428	152	14	virtual	virtual	ADJ
aisthesis-5428	152	15	wtm1	wtm1	PROPN
aisthesis-5428	152	16	produced	produce	VERB
aisthesis-5428	152	17	only	only	ADV
aisthesis-5428	152	18	phenotypically	phenotypically	ADV
aisthesis-5428	152	19	wild	wild	ADJ
aisthesis-5428	152	20	-	-	PUNCT
aisthesis-5428	152	21	type	type	NOUN
aisthesis-5428	152	22	progeny	progeny	NOUN
aisthesis-5428	152	23	,	,	PUNCT
aisthesis-5428	152	24	which	which	PRON
aisthesis-5428	152	25	points	point	VERB
aisthesis-5428	152	26	toward	toward	ADP
aisthesis-5428	152	27	a	a	DET
aisthesis-5428	152	28	recessive	recessive	ADJ
aisthesis-5428	152	29	pattern	pattern	NOUN
aisthesis-5428	152	30	of	of	ADP
aisthesis-5428	152	31	inheritance	inheritance	NOUN
aisthesis-5428	152	32	of	of	ADP
aisthesis-5428	152	33	trex	trex	PROPN
aisthesis-5428	152	34	.	.	PUNCT
aisthesis-5428	153	1	because	because	SCONJ
aisthesis-5428	153	2	the	the	DET
aisthesis-5428	153	3	strains	strain	NOUN
aisthesis-5428	153	4	of	of	ADP
aisthesis-5428	153	5	flies	fly	NOUN
aisthesis-5428	153	6	that	that	PRON
aisthesis-5428	153	7	were	be	AUX
aisthesis-5428	153	8	crossed	cross	VERB
aisthesis-5428	153	9	were	be	AUX
aisthesis-5428	153	10	true	true	ADJ
aisthesis-5428	153	11	breeding	breeding	NOUN
aisthesis-5428	153	12	,	,	PUNCT
aisthesis-5428	153	13	the	the	DET
aisthesis-5428	153	14	results	result	NOUN
aisthesis-5428	153	15	of	of	ADP
aisthesis-5428	153	16	this	this	DET
aisthesis-5428	153	17	cross	cross	NOUN
aisthesis-5428	153	18	reveal	reveal	VERB
aisthesis-5428	153	19	which	which	DET
aisthesis-5428	153	20	phenotype	phenotype	NOUN
aisthesis-5428	153	21	exhibits	exhibit	VERB
aisthesis-5428	153	22	itself	itself	PRON
aisthesis-5428	153	23	as	as	ADP
aisthesis-5428	153	24	dominant	dominant	ADJ
aisthesis-5428	153	25	over	over	ADP
aisthesis-5428	153	26	the	the	DET
aisthesis-5428	153	27	other	other	ADJ
aisthesis-5428	153	28	.	.	PUNCT
aisthesis-5428	154	1	as	as	SCONJ
aisthesis-5428	154	2	none	none	NOUN
aisthesis-5428	154	3	of	of	ADP
aisthesis-5428	154	4	the	the	DET
aisthesis-5428	154	5	progeny	progeny	NOUN
aisthesis-5428	154	6	of	of	ADP
aisthesis-5428	154	7	this	this	DET
aisthesis-5428	154	8	cross	cross	NOUN
aisthesis-5428	154	9	displayed	display	VERB
aisthesis-5428	154	10	a	a	DET
aisthesis-5428	154	11	trex	trex	ADJ
aisthesis-5428	154	12	phenotype	phenotype	NOUN
aisthesis-5428	154	13	,	,	PUNCT
aisthesis-5428	154	14	it	it	PRON
aisthesis-5428	154	15	was	be	AUX
aisthesis-5428	154	16	concluded	conclude	VERB
aisthesis-5428	154	17	that	that	SCONJ
aisthesis-5428	154	18	trex	trex	PROPN
aisthesis-5428	154	19	is	be	AUX
aisthesis-5428	154	20	recessive	recessive	ADJ
aisthesis-5428	154	21	to	to	ADP
aisthesis-5428	154	22	a	a	DET
aisthesis-5428	154	23	wt	wt	NOUN
aisthesis-5428	154	24	phenotype	phenotype	NOUN
aisthesis-5428	154	25	.	.	PUNCT
aisthesis-5428	155	1	on	on	ADP
aisthesis-5428	155	2	the	the	DET
aisthesis-5428	155	3	other	other	ADJ
aisthesis-5428	155	4	hand	hand	NOUN
aisthesis-5428	155	5	,	,	PUNCT
aisthesis-5428	155	6	the	the	DET
aisthesis-5428	155	7	wtm2	wtm2	NOUN
aisthesis-5428	155	8	cross	cross	NOUN
aisthesis-5428	155	9	and	and	CCONJ
aisthesis-5428	155	10	virtual	virtual	ADJ
aisthesis-5428	155	11	wtm2	wtm2	NOUN
aisthesis-5428	155	12	crosses	crosse	NOUN
aisthesis-5428	155	13	were	be	AUX
aisthesis-5428	155	14	done	do	VERB
aisthesis-5428	155	15	to	to	PART
aisthesis-5428	155	16	determine	determine	VERB
aisthesis-5428	155	17	whether	whether	SCONJ
aisthesis-5428	155	18	trex	trex	PROPN
aisthesis-5428	155	19	is	be	AUX
aisthesis-5428	155	20	an	an	DET
aisthesis-5428	155	21	autosomal	autosomal	ADJ
aisthesis-5428	155	22	or	or	CCONJ
aisthesis-5428	155	23	sexlinked	sexlinked	ADJ
aisthesis-5428	155	24	mutation	mutation	NOUN
aisthesis-5428	155	25	.	.	PUNCT
aisthesis-5428	156	1	similar	similar	ADJ
aisthesis-5428	156	2	to	to	ADP
aisthesis-5428	156	3	wtm1	wtm1	PROPN
aisthesis-5428	156	4	,	,	PUNCT
aisthesis-5428	156	5	all	all	PRON
aisthesis-5428	156	6	progeny	progeny	VERB
aisthesis-5428	156	7	for	for	ADP
aisthesis-5428	156	8	both	both	CCONJ
aisthesis-5428	156	9	wtm2	wtm2	NOUN
aisthesis-5428	156	10	and	and	CCONJ
aisthesis-5428	156	11	virtual	virtual	ADJ
aisthesis-5428	156	12	wtm2	wtm2	NOUN
aisthesis-5428	156	13	displayed	display	VERB
aisthesis-5428	156	14	a	a	DET
aisthesis-5428	156	15	wildtype	wildtype	NOUN
aisthesis-5428	156	16	phenotype	phenotype	NOUN
aisthesis-5428	156	17	.	.	PUNCT
aisthesis-5428	157	1	if	if	SCONJ
aisthesis-5428	157	2	trex	trex	PROPN
aisthesis-5428	157	3	was	be	AUX
aisthesis-5428	157	4	inherited	inherit	VERB
aisthesis-5428	157	5	in	in	ADP
aisthesis-5428	157	6	a	a	DET
aisthesis-5428	157	7	sex	sex	NOUN
aisthesis-5428	157	8	-	-	PUNCT
aisthesis-5428	157	9	linked	link	VERB
aisthesis-5428	157	10	pattern	pattern	NOUN
aisthesis-5428	157	11	,	,	PUNCT
aisthesis-5428	157	12	all	all	DET
aisthesis-5428	157	13	males	male	NOUN
aisthesis-5428	157	14	of	of	ADP
aisthesis-5428	157	15	the	the	DET
aisthesis-5428	157	16	f1	f1	NOUN
aisthesis-5428	157	17	generation	generation	NOUN
aisthesis-5428	157	18	would	would	AUX
aisthesis-5428	157	19	display	display	VERB
aisthesis-5428	157	20	a	a	DET
aisthesis-5428	157	21	trex	trex	ADJ
aisthesis-5428	157	22	phenotype	phenotype	NOUN
aisthesis-5428	157	23	,	,	PUNCT
aisthesis-5428	157	24	as	as	SCONJ
aisthesis-5428	157	25	the	the	DET
aisthesis-5428	157	26	mutation	mutation	NOUN
aisthesis-5428	157	27	would	would	AUX
aisthesis-5428	157	28	be	be	AUX
aisthesis-5428	157	29	carried	carry	VERB
aisthesis-5428	157	30	on	on	ADP
aisthesis-5428	157	31	the	the	DET
aisthesis-5428	157	32	x	x	PUNCT
aisthesis-5428	157	33	chromosome	chromosome	NOUN
aisthesis-5428	157	34	passed	pass	VERB
aisthesis-5428	157	35	to	to	ADP
aisthesis-5428	157	36	them	they	PRON
aisthesis-5428	157	37	by	by	ADP
aisthesis-5428	157	38	the	the	DET
aisthesis-5428	157	39	female	female	ADJ
aisthesis-5428	157	40	trex	trex	ADJ
aisthesis-5428	157	41	flies	fly	NOUN
aisthesis-5428	157	42	of	of	ADP
aisthesis-5428	157	43	the	the	DET
aisthesis-5428	157	44	parental	parental	ADJ
aisthesis-5428	157	45	generation	generation	NOUN
aisthesis-5428	157	46	.	.	PUNCT
aisthesis-5428	158	1	however	however	ADV
aisthesis-5428	158	2	,	,	PUNCT
aisthesis-5428	158	3	no	no	DET
aisthesis-5428	158	4	such	such	ADJ
aisthesis-5428	158	5	trex	trex	ADJ
aisthesis-5428	158	6	male	male	ADJ
aisthesis-5428	158	7	flies	fly	NOUN
aisthesis-5428	158	8	appeared	appear	VERB
aisthesis-5428	158	9	in	in	ADP
aisthesis-5428	158	10	the	the	DET
aisthesis-5428	158	11	f1	f1	NOUN
aisthesis-5428	158	12	generation	generation	NOUN
aisthesis-5428	158	13	.	.	PUNCT
aisthesis-5428	159	1	as	as	ADP
aisthesis-5428	159	2	such	such	ADJ
aisthesis-5428	159	3	,	,	PUNCT
aisthesis-5428	159	4	it	it	PRON
aisthesis-5428	159	5	can	can	AUX
aisthesis-5428	159	6	be	be	AUX
aisthesis-5428	159	7	concluded	conclude	VERB
aisthesis-5428	159	8	that	that	SCONJ
aisthesis-5428	159	9	trex	trex	PROPN
aisthesis-5428	159	10	is	be	AUX
aisthesis-5428	159	11	inherited	inherit	VERB
aisthesis-5428	159	12	via	via	ADP
aisthesis-5428	159	13	an	an	DET
aisthesis-5428	159	14	autosomal	autosomal	ADJ
aisthesis-5428	159	15	chromosome	chromosome	NOUN
aisthesis-5428	159	16	within	within	ADP
aisthesis-5428	159	17	the	the	DET
aisthesis-5428	159	18	d.	d.	NOUN
aisthesis-5428	159	19	melanogaster	melanogaster	NOUN
aisthesis-5428	159	20	genome	genome	NOUN
aisthesis-5428	159	21	.	.	PUNCT
aisthesis-5428	160	1	b.	b.	PROPN
aisthesis-5428	160	2	trex	trex	PROPN
aisthesis-5428	160	3	is	be	AUX
aisthesis-5428	160	4	predicted	predict	VERB
aisthesis-5428	160	5	to	to	PART
aisthesis-5428	160	6	be	be	AUX
aisthesis-5428	160	7	located	locate	VERB
aisthesis-5428	160	8	at	at	ADP
aisthesis-5428	160	9	2:68	2:68	NUM
aisthesis-5428	160	10	within	within	ADP
aisthesis-5428	160	11	the	the	DET
aisthesis-5428	160	12	drosophila	drosophila	NOUN
aisthesis-5428	160	13	genome	genome	NOUN
aisthesis-5428	160	14	statistical	statistical	ADJ
aisthesis-5428	160	15	analysis	analysis	NOUN
aisthesis-5428	160	16	of	of	ADP
aisthesis-5428	160	17	all	all	DET
aisthesis-5428	160	18	three	three	NUM
aisthesis-5428	160	19	mapping	mapping	NOUN
aisthesis-5428	160	20	crosses	crosse	NOUN
aisthesis-5428	160	21	(	(	PUNCT
aisthesis-5428	160	22	a	a	PRON
aisthesis-5428	160	23	,	,	PUNCT
aisthesis-5428	160	24	b	b	PROPN
aisthesis-5428	160	25	and	and	CCONJ
aisthesis-5428	160	26	c	c	X
aisthesis-5428	160	27	)	)	PUNCT
aisthesis-5428	160	28	gave	give	VERB
aisthesis-5428	160	29	chi	chi	ADJ
aisthesis-5428	160	30	-	-	PUNCT
aisthesis-5428	160	31	square	square	ADJ
aisthesis-5428	160	32	values	value	NOUN
aisthesis-5428	160	33	much	much	ADV
aisthesis-5428	160	34	larger	large	ADJ
aisthesis-5428	160	35	than	than	ADP
aisthesis-5428	160	36	the	the	DET
aisthesis-5428	160	37	critical	critical	ADJ
aisthesis-5428	160	38	value	value	NOUN
aisthesis-5428	160	39	of	of	ADP
aisthesis-5428	160	40	7.815	7.815	NUM
aisthesis-5428	160	41	.	.	PUNCT
aisthesis-5428	161	1	by	by	ADP
aisthesis-5428	161	2	these	these	DET
aisthesis-5428	161	3	values	value	NOUN
aisthesis-5428	161	4	the	the	DET
aisthesis-5428	161	5	null	null	ADJ
aisthesis-5428	161	6	hypothesis	hypothesis	NOUN
aisthesis-5428	161	7	that	that	PRON
aisthesis-5428	161	8	trex	trex	PROPN
aisthesis-5428	161	9	and	and	CCONJ
aisthesis-5428	161	10	each	each	DET
aisthesis-5428	161	11	marker	marker	NOUN
aisthesis-5428	161	12	gene	gene	NOUN
aisthesis-5428	161	13	are	be	AUX
aisthesis-5428	161	14	not	not	PART
aisthesis-5428	161	15	linked	link	VERB
aisthesis-5428	161	16	genetically	genetically	ADV
aisthesis-5428	161	17	is	be	AUX
aisthesis-5428	161	18	rejected	reject	VERB
aisthesis-5428	161	19	,	,	PUNCT
aisthesis-5428	161	20	as	as	SCONJ
aisthesis-5428	161	21	the	the	DET
aisthesis-5428	161	22	results	result	NOUN
aisthesis-5428	161	23	show	show	VERB
aisthesis-5428	161	24	a	a	DET
aisthesis-5428	161	25	significant	significant	ADJ
aisthesis-5428	161	26	deviance	deviance	NOUN
aisthesis-5428	161	27	from	from	ADP
aisthesis-5428	161	28	a	a	DET
aisthesis-5428	161	29	1:1:1:1	1:1:1:1	NUM
aisthesis-5428	161	30	phenotypic	phenotypic	ADJ
aisthesis-5428	161	31	ratio	ratio	NOUN
aisthesis-5428	161	32	.	.	PUNCT
aisthesis-5428	162	1	based	base	VERB
aisthesis-5428	162	2	on	on	ADP
aisthesis-5428	162	3	this	this	DET
aisthesis-5428	162	4	rejection	rejection	NOUN
aisthesis-5428	162	5	of	of	ADP
aisthesis-5428	162	6	the	the	DET
aisthesis-5428	162	7	null	null	ADJ
aisthesis-5428	162	8	hypothesis	hypothesis	NOUN
aisthesis-5428	162	9	,	,	PUNCT
aisthesis-5428	162	10	it	it	PRON
aisthesis-5428	162	11	is	be	AUX
aisthesis-5428	162	12	feasible	feasible	ADJ
aisthesis-5428	162	13	that	that	SCONJ
aisthesis-5428	162	14	trex	trex	PROPN
aisthesis-5428	162	15	and	and	CCONJ
aisthesis-5428	162	16	the	the	DET
aisthesis-5428	162	17	given	give	VERB
aisthesis-5428	162	18	marker	marker	NOUN
aisthesis-5428	162	19	genes	gene	NOUN
aisthesis-5428	162	20	are	be	AUX
aisthesis-5428	162	21	,	,	PUNCT
aisthesis-5428	162	22	in	in	ADP
aisthesis-5428	162	23	fact	fact	NOUN
aisthesis-5428	162	24	,	,	PUNCT
aisthesis-5428	162	25	genetically	genetically	ADV
aisthesis-5428	162	26	linked	link	VERB
aisthesis-5428	162	27	and	and	CCONJ
aisthesis-5428	162	28	can	can	AUX
aisthesis-5428	162	29	be	be	AUX
aisthesis-5428	162	30	reasonably	reasonably	ADV
aisthesis-5428	162	31	compared	compare	VERB
aisthesis-5428	162	32	in	in	ADP
aisthesis-5428	162	33	order	order	NOUN
aisthesis-5428	162	34	to	to	PART
aisthesis-5428	162	35	predict	predict	VERB
aisthesis-5428	162	36	a	a	DET
aisthesis-5428	162	37	location	location	NOUN
aisthesis-5428	162	38	of	of	ADP
aisthesis-5428	162	39	trex	trex	PROPN
aisthesis-5428	162	40	within	within	ADP
aisthesis-5428	162	41	the	the	DET
aisthesis-5428	162	42	drosophila	drosophila	NOUN
aisthesis-5428	162	43	genome	genome	NOUN
aisthesis-5428	162	44	.	.	PUNCT
aisthesis-5428	163	1	the	the	DET
aisthesis-5428	163	2	recombination	recombination	NOUN
aisthesis-5428	163	3	frequencies	frequency	NOUN
aisthesis-5428	163	4	may	may	AUX
aisthesis-5428	163	5	be	be	AUX
aisthesis-5428	163	6	arranged	arrange	VERB
aisthesis-5428	163	7	to	to	PART
aisthesis-5428	163	8	predict	predict	VERB
aisthesis-5428	163	9	the	the	DET
aisthesis-5428	163	10	location	location	NOUN
aisthesis-5428	163	11	of	of	ADP
aisthesis-5428	163	12	trex	trex	PROPN
aisthesis-5428	163	13	within	within	ADP
aisthesis-5428	163	14	chromosome	chromosome	NOUN
aisthesis-5428	163	15	2	2	NUM
aisthesis-5428	163	16	of	of	ADP
aisthesis-5428	163	17	the	the	DET
aisthesis-5428	163	18	d.	d.	NOUN
aisthesis-5428	163	19	melanogaster	melanogaster	NOUN
aisthesis-5428	163	20	genome	genome	NOUN
aisthesis-5428	163	21	.	.	PUNCT
aisthesis-5428	164	1	based	base	VERB
aisthesis-5428	164	2	on	on	ADP
aisthesis-5428	164	3	the	the	DET
aisthesis-5428	164	4	information	information	NOUN
aisthesis-5428	164	5	that	that	PRON
aisthesis-5428	164	6	black	black	ADJ
aisthesis-5428	164	7	is	be	AUX
aisthesis-5428	164	8	14	14	NUM
aisthesis-5428	164	9	centimorgans	centimorgan	NOUN
aisthesis-5428	164	10	from	from	ADP
aisthesis-5428	164	11	trex	trex	PROPN
aisthesis-5428	164	12	,	,	PUNCT
aisthesis-5428	164	13	purple	purple	NOUN
aisthesis-5428	164	14	is	be	AUX
aisthesis-5428	164	15	11	11	NUM
aisthesis-5428	164	16	centimorgans	centimorgan	NOUN
aisthesis-5428	164	17	from	from	ADP
aisthesis-5428	164	18	trex	trex	PROPN
aisthesis-5428	164	19	,	,	PUNCT
aisthesis-5428	164	20	and	and	CCONJ
aisthesis-5428	164	21	brown	brown	NOUN
aisthesis-5428	164	22	was	be	AUX
aisthesis-5428	164	23	found	find	VERB
aisthesis-5428	164	24	to	to	PART
aisthesis-5428	164	25	be	be	AUX
aisthesis-5428	164	26	approximately	approximately	ADV
aisthesis-5428	164	27	26	26	NUM
aisthesis-5428	164	28	centimorgans	centimorgan	NOUN
aisthesis-5428	164	29	from	from	ADP
aisthesis-5428	164	30	trex	trex	PROPN
aisthesis-5428	164	31	,	,	PUNCT
aisthesis-5428	164	32	it	it	PRON
aisthesis-5428	164	33	was	be	AUX
aisthesis-5428	164	34	predicted	predict	VERB
aisthesis-5428	164	35	that	that	SCONJ
aisthesis-5428	164	36	trex	trex	PROPN
aisthesis-5428	164	37	is	be	AUX
aisthesis-5428	164	38	approximately	approximately	ADV
aisthesis-5428	164	39	located	locate	VERB
aisthesis-5428	164	40	at	at	ADP
aisthesis-5428	164	41	2:68	2:68	PROPN
aisthesis-5428	164	42	(	(	PUNCT
aisthesis-5428	164	43	figure	figure	NOUN
aisthesis-5428	164	44	2	2	NUM
aisthesis-5428	164	45	)	)	PUNCT
aisthesis-5428	164	46	.	.	PUNCT
aisthesis-5428	165	1	c.	c.	PROPN
aisthesis-5428	165	2	trex	trex	PROPN
aisthesis-5428	165	3	contains	contain	VERB
aisthesis-5428	165	4	an	an	DET
aisthesis-5428	165	5	insertion	insertion	NOUN
aisthesis-5428	165	6	of	of	ADP
aisthesis-5428	165	7	genetic	genetic	ADJ
aisthesis-5428	165	8	material	material	NOUN
aisthesis-5428	165	9	the	the	DET
aisthesis-5428	165	10	gel	gel	NOUN
aisthesis-5428	165	11	electrophoresis	electrophoresis	NOUN
aisthesis-5428	165	12	results	result	NOUN
aisthesis-5428	165	13	of	of	ADP
aisthesis-5428	165	14	a	a	DET
aisthesis-5428	165	15	1000	1000	NUM
aisthesis-5428	165	16	bp	bp	NOUN
aisthesis-5428	165	17	band	band	NOUN
aisthesis-5428	165	18	of	of	ADP
aisthesis-5428	165	19	trex	trex	PROPN
aisthesis-5428	165	20	dna	dna	PROPN
aisthesis-5428	165	21	as	as	SCONJ
aisthesis-5428	165	22	compared	compare	VERB
aisthesis-5428	165	23	to	to	ADP
aisthesis-5428	165	24	a	a	DET
aisthesis-5428	165	25	positive	positive	ADJ
aisthesis-5428	165	26	control	control	NOUN
aisthesis-5428	165	27	band	band	NOUN
aisthesis-5428	165	28	of	of	ADP
aisthesis-5428	165	29	100	100	NUM
aisthesis-5428	165	30	base	base	NOUN
aisthesis-5428	165	31	pairs	pair	NOUN
aisthesis-5428	165	32	do	do	AUX
aisthesis-5428	165	33	not	not	PART
aisthesis-5428	165	34	lead	lead	VERB
aisthesis-5428	165	35	to	to	ADP
aisthesis-5428	165	36	conclusive	conclusive	ADJ
aisthesis-5428	165	37	results	result	NOUN
aisthesis-5428	165	38	about	about	ADP
aisthesis-5428	165	39	analysis	analysis	NOUN
aisthesis-5428	165	40	of	of	ADP
aisthesis-5428	165	41	novel	novel	ADJ
aisthesis-5428	165	42	unknown	unknown	ADJ
aisthesis-5428	165	43	d.	d.	NOUN
aisthesis-5428	165	44	melanogaster	melanogaster	NOUN
aisthesis-5428	165	45	mutation	mutation	NOUN
aisthesis-5428	165	46	trex	trex	PROPN
aisthesis-5428	165	47	aisthesis	aisthesis	NOUN
aisthesis-5428	165	48	volume	volume	NOUN
aisthesis-5428	165	49	14	14	NUM
aisthesis-5428	165	50	,	,	PUNCT
aisthesis-5428	165	51	2023	2023	NUM
aisthesis-5428	165	52	the	the	DET
aisthesis-5428	165	53	nature	nature	NOUN
aisthesis-5428	165	54	of	of	ADP
aisthesis-5428	165	55	the	the	DET
aisthesis-5428	165	56	trex	trex	PROPN
aisthesis-5428	165	57	mutation	mutation	NOUN
aisthesis-5428	165	58	.	.	PUNCT
aisthesis-5428	166	1	however	however	ADV
aisthesis-5428	166	2	,	,	PUNCT
aisthesis-5428	166	3	as	as	SCONJ
aisthesis-5428	166	4	given	give	VERB
aisthesis-5428	166	5	by	by	ADP
aisthesis-5428	166	6	ta	ta	ADP
aisthesis-5428	166	7	information	information	NOUN
aisthesis-5428	166	8	,	,	PUNCT
aisthesis-5428	166	9	the	the	DET
aisthesis-5428	166	10	wild	wild	ADJ
aisthesis-5428	166	11	-	-	PUNCT
aisthesis-5428	166	12	type	type	NOUN
aisthesis-5428	166	13	and	and	CCONJ
aisthesis-5428	166	14	reciprocal	reciprocal	ADJ
aisthesis-5428	166	15	cross	cross	NOUN
aisthesis-5428	166	16	progeny	progeny	VERB
aisthesis-5428	166	17	dna	dna	PROPN
aisthesis-5428	166	18	samples	sample	NOUN
aisthesis-5428	166	19	should	should	AUX
aisthesis-5428	166	20	have	have	AUX
aisthesis-5428	166	21	traveled	travel	VERB
aisthesis-5428	166	22	much	much	ADV
aisthesis-5428	166	23	farther	far	ADV
aisthesis-5428	166	24	than	than	ADP
aisthesis-5428	166	25	the	the	DET
aisthesis-5428	166	26	trex	trex	PROPN
aisthesis-5428	166	27	band	band	NOUN
aisthesis-5428	166	28	of	of	ADP
aisthesis-5428	166	29	dna	dna	PROPN
aisthesis-5428	166	30	.	.	PUNCT
aisthesis-5428	167	1	because	because	SCONJ
aisthesis-5428	167	2	it	it	PRON
aisthesis-5428	167	3	traveled	travel	VERB
aisthesis-5428	167	4	a	a	DET
aisthesis-5428	167	5	shorter	short	ADJ
aisthesis-5428	167	6	distance	distance	NOUN
aisthesis-5428	167	7	,	,	PUNCT
aisthesis-5428	167	8	it	it	PRON
aisthesis-5428	167	9	can	can	AUX
aisthesis-5428	167	10	be	be	AUX
aisthesis-5428	167	11	concluded	conclude	VERB
aisthesis-5428	167	12	that	that	SCONJ
aisthesis-5428	167	13	trex	trex	PROPN
aisthesis-5428	167	14	is	be	AUX
aisthesis-5428	167	15	much	much	ADV
aisthesis-5428	167	16	larger	large	ADJ
aisthesis-5428	167	17	than	than	ADP
aisthesis-5428	167	18	the	the	DET
aisthesis-5428	167	19	wt	wt	NOUN
aisthesis-5428	167	20	sequence	sequence	NOUN
aisthesis-5428	167	21	because	because	SCONJ
aisthesis-5428	167	22	it	it	PRON
aisthesis-5428	167	23	was	be	AUX
aisthesis-5428	167	24	pulled	pull	VERB
aisthesis-5428	167	25	slower	slow	ADV
aisthesis-5428	167	26	through	through	ADP
aisthesis-5428	167	27	the	the	DET
aisthesis-5428	167	28	agarose	agarose	NOUN
aisthesis-5428	167	29	gel	gel	NOUN
aisthesis-5428	167	30	as	as	SCONJ
aisthesis-5428	167	31	opposed	oppose	VERB
aisthesis-5428	167	32	to	to	ADP
aisthesis-5428	167	33	the	the	DET
aisthesis-5428	167	34	wt	wt	PROPN
aisthesis-5428	167	35	band	band	NOUN
aisthesis-5428	167	36	.	.	PUNCT
aisthesis-5428	168	1	as	as	ADP
aisthesis-5428	168	2	a	a	DET
aisthesis-5428	168	3	larger	large	ADJ
aisthesis-5428	168	4	dna	dna	NOUN
aisthesis-5428	168	5	fragment	fragment	NOUN
aisthesis-5428	168	6	,	,	PUNCT
aisthesis-5428	168	7	trex	trex	PROPN
aisthesis-5428	168	8	must	must	AUX
aisthesis-5428	168	9	then	then	ADV
aisthesis-5428	168	10	contain	contain	VERB
aisthesis-5428	168	11	extra	extra	ADV
aisthesis-5428	168	12	inserted	insert	VERB
aisthesis-5428	168	13	dna	dna	NOUN
aisthesis-5428	168	14	as	as	ADP
aisthesis-5428	168	15	compared	compare	VERB
aisthesis-5428	168	16	to	to	ADP
aisthesis-5428	168	17	the	the	DET
aisthesis-5428	168	18	wt	wt	NOUN
aisthesis-5428	168	19	sequence	sequence	NOUN
aisthesis-5428	168	20	.	.	PUNCT
aisthesis-5428	169	1	d.	d.	PROPN
aisthesis-5428	169	2	trex	trex	PROPN
aisthesis-5428	169	3	contains	contain	VERB
aisthesis-5428	169	4	retrotransposon	retrotransposon	NOUN
aisthesis-5428	169	5	412	412	NUM
aisthesis-5428	169	6	and	and	CCONJ
aisthesis-5428	169	7	is	be	AUX
aisthesis-5428	169	8	allelic	allelic	ADJ
aisthesis-5428	169	9	to	to	ADP
aisthesis-5428	169	10	vestigial	vestigial	NOUN
aisthesis-5428	169	11	when	when	SCONJ
aisthesis-5428	169	12	screening	screen	VERB
aisthesis-5428	169	13	the	the	DET
aisthesis-5428	169	14	d.	d.	NOUN
aisthesis-5428	169	15	melanogaster	melanogaster	NOUN
aisthesis-5428	169	16	genome	genome	NOUN
aisthesis-5428	169	17	primer	primer	NOUN
aisthesis-5428	169	18	sequences	sequence	NOUN
aisthesis-5428	169	19	in	in	ADP
aisthesis-5428	169	20	order	order	NOUN
aisthesis-5428	169	21	to	to	PART
aisthesis-5428	169	22	determine	determine	VERB
aisthesis-5428	169	23	where	where	SCONJ
aisthesis-5428	169	24	the	the	DET
aisthesis-5428	169	25	wild	wild	ADJ
aisthesis-5428	169	26	-	-	PUNCT
aisthesis-5428	169	27	type	type	NOUN
aisthesis-5428	169	28	amplicon	amplicon	NOUN
aisthesis-5428	169	29	was	be	AUX
aisthesis-5428	169	30	located	locate	VERB
aisthesis-5428	169	31	,	,	PUNCT
aisthesis-5428	169	32	the	the	DET
aisthesis-5428	169	33	reverse	reverse	ADJ
aisthesis-5428	169	34	primer	primer	NOUN
aisthesis-5428	169	35	was	be	AUX
aisthesis-5428	169	36	not	not	PART
aisthesis-5428	169	37	found	find	VERB
aisthesis-5428	169	38	,	,	PUNCT
aisthesis-5428	169	39	as	as	SCONJ
aisthesis-5428	169	40	indicated	indicate	VERB
aisthesis-5428	169	41	in	in	ADP
aisthesis-5428	169	42	the	the	DET
aisthesis-5428	169	43	results	result	NOUN
aisthesis-5428	169	44	.	.	PUNCT
aisthesis-5428	170	1	with	with	ADP
aisthesis-5428	170	2	the	the	DET
aisthesis-5428	170	3	results	result	NOUN
aisthesis-5428	170	4	of	of	ADP
aisthesis-5428	170	5	the	the	DET
aisthesis-5428	170	6	gel	gel	NOUN
aisthesis-5428	170	7	electrophoresis	electrophoresis	NOUN
aisthesis-5428	170	8	in	in	ADP
aisthesis-5428	170	9	consideration	consideration	NOUN
aisthesis-5428	170	10	,	,	PUNCT
aisthesis-5428	170	11	it	it	PRON
aisthesis-5428	170	12	was	be	AUX
aisthesis-5428	170	13	hypothesized	hypothesize	VERB
aisthesis-5428	170	14	that	that	SCONJ
aisthesis-5428	170	15	the	the	DET
aisthesis-5428	170	16	reverse	reverse	ADJ
aisthesis-5428	170	17	primer	primer	NOUN
aisthesis-5428	170	18	was	be	AUX
aisthesis-5428	170	19	located	locate	VERB
aisthesis-5428	170	20	within	within	ADP
aisthesis-5428	170	21	an	an	DET
aisthesis-5428	170	22	inserted	insert	VERB
aisthesis-5428	170	23	sequence	sequence	NOUN
aisthesis-5428	170	24	as	as	ADP
aisthesis-5428	170	25	part	part	NOUN
aisthesis-5428	170	26	of	of	ADP
aisthesis-5428	170	27	the	the	DET
aisthesis-5428	170	28	trex	trex	PROPN
aisthesis-5428	170	29	mutation	mutation	NOUN
aisthesis-5428	170	30	.	.	PUNCT
aisthesis-5428	171	1	the	the	DET
aisthesis-5428	171	2	hypothesis	hypothesis	NOUN
aisthesis-5428	171	3	of	of	ADP
aisthesis-5428	171	4	an	an	DET
aisthesis-5428	171	5	insertion	insertion	NOUN
aisthesis-5428	171	6	mutation	mutation	NOUN
aisthesis-5428	171	7	as	as	ADP
aisthesis-5428	171	8	the	the	DET
aisthesis-5428	171	9	molecular	molecular	ADJ
aisthesis-5428	171	10	basis	basis	NOUN
aisthesis-5428	171	11	of	of	ADP
aisthesis-5428	171	12	trex	trex	PROPN
aisthesis-5428	171	13	was	be	AUX
aisthesis-5428	171	14	upheld	uphold	VERB
aisthesis-5428	171	15	by	by	ADP
aisthesis-5428	171	16	the	the	DET
aisthesis-5428	171	17	nucleotide	nucleotide	NOUN
aisthesis-5428	171	18	blast	blast	NOUN
aisthesis-5428	171	19	results	result	NOUN
aisthesis-5428	171	20	,	,	PUNCT
aisthesis-5428	171	21	which	which	PRON
aisthesis-5428	171	22	showed	show	VERB
aisthesis-5428	171	23	an	an	DET
aisthesis-5428	171	24	insertion	insertion	NOUN
aisthesis-5428	171	25	in	in	ADP
aisthesis-5428	171	26	the	the	DET
aisthesis-5428	171	27	trex	trex	ADJ
aisthesis-5428	171	28	sequence	sequence	NOUN
aisthesis-5428	171	29	after	after	ADP
aisthesis-5428	171	30	the	the	DET
aisthesis-5428	171	31	425	425	NUM
aisthesis-5428	171	32	bp	bp	PROPN
aisthesis-5428	171	33	alignment	alignment	NOUN
aisthesis-5428	171	34	of	of	ADP
aisthesis-5428	171	35	the	the	DET
aisthesis-5428	171	36	sequences	sequence	NOUN
aisthesis-5428	171	37	(	(	PUNCT
aisthesis-5428	171	38	figure	figure	NOUN
aisthesis-5428	171	39	6c	6c	PROPN
aisthesis-5428	171	40	)	)	PUNCT
aisthesis-5428	171	41	.	.	PUNCT
aisthesis-5428	172	1	the	the	DET
aisthesis-5428	172	2	results	result	NOUN
aisthesis-5428	172	3	of	of	ADP
aisthesis-5428	172	4	the	the	DET
aisthesis-5428	172	5	nucleotide	nucleotide	NOUN
aisthesis-5428	172	6	blast	blast	NOUN
aisthesis-5428	172	7	on	on	ADP
aisthesis-5428	172	8	flybase	flybase	NOUN
aisthesis-5428	172	9	gave	give	VERB
aisthesis-5428	172	10	an	an	DET
aisthesis-5428	172	11	alignment	alignment	NOUN
aisthesis-5428	172	12	of	of	ADP
aisthesis-5428	172	13	the	the	DET
aisthesis-5428	172	14	insertion	insertion	NOUN
aisthesis-5428	172	15	sequence	sequence	NOUN
aisthesis-5428	172	16	with	with	ADP
aisthesis-5428	172	17	retrotransposon	retrotransposon	NOUN
aisthesis-5428	172	18	412	412	NUM
aisthesis-5428	172	19	.	.	PUNCT
aisthesis-5428	173	1	as	as	ADP
aisthesis-5428	173	2	such	such	ADJ
aisthesis-5428	173	3	,	,	PUNCT
aisthesis-5428	173	4	it	it	PRON
aisthesis-5428	173	5	can	can	AUX
aisthesis-5428	173	6	be	be	AUX
aisthesis-5428	173	7	concluded	conclude	VERB
aisthesis-5428	173	8	that	that	SCONJ
aisthesis-5428	173	9	the	the	DET
aisthesis-5428	173	10	trex	trex	PROPN
aisthesis-5428	173	11	mutation	mutation	NOUN
aisthesis-5428	173	12	arises	arise	VERB
aisthesis-5428	173	13	from	from	ADP
aisthesis-5428	173	14	a	a	DET
aisthesis-5428	173	15	retrotransposon	retrotransposon	NOUN
aisthesis-5428	173	16	412	412	NUM
aisthesis-5428	173	17	insertion	insertion	NOUN
aisthesis-5428	173	18	into	into	ADP
aisthesis-5428	173	19	the	the	DET
aisthesis-5428	173	20	wild	wild	ADJ
aisthesis-5428	173	21	-	-	PUNCT
aisthesis-5428	173	22	type	type	NOUN
aisthesis-5428	173	23	sequence	sequence	NOUN
aisthesis-5428	173	24	.	.	PUNCT
aisthesis-5428	174	1	further	far	ADV
aisthesis-5428	174	2	,	,	PUNCT
aisthesis-5428	174	3	the	the	DET
aisthesis-5428	174	4	wild	wild	ADJ
aisthesis-5428	174	5	-	-	PUNCT
aisthesis-5428	174	6	type	type	NOUN
aisthesis-5428	174	7	nucleotide	nucleotide	NOUN
aisthesis-5428	174	8	sequence	sequence	NOUN
aisthesis-5428	174	9	corresponding	correspond	VERB
aisthesis-5428	174	10	to	to	ADP
aisthesis-5428	174	11	the	the	DET
aisthesis-5428	174	12	unknown	unknown	ADJ
aisthesis-5428	174	13	mutant	mutant	ADJ
aisthesis-5428	174	14	gene	gene	NOUN
aisthesis-5428	174	15	trex	trex	PROPN
aisthesis-5428	174	16	was	be	AUX
aisthesis-5428	174	17	translated	translate	VERB
aisthesis-5428	174	18	into	into	ADP
aisthesis-5428	174	19	the	the	DET
aisthesis-5428	174	20	amino	amino	NOUN
aisthesis-5428	174	21	acid	acid	NOUN
aisthesis-5428	174	22	sequence	sequence	NOUN
aisthesis-5428	174	23	via	via	ADP
aisthesis-5428	174	24	expasy	expasy	NOUN
aisthesis-5428	174	25	(	(	PUNCT
aisthesis-5428	174	26	figure	figure	NOUN
aisthesis-5428	174	27	10	10	NUM
aisthesis-5428	174	28	)	)	PUNCT
aisthesis-5428	174	29	and	and	CCONJ
aisthesis-5428	174	30	was	be	AUX
aisthesis-5428	174	31	subjected	subject	VERB
aisthesis-5428	174	32	to	to	ADP
aisthesis-5428	174	33	a	a	DET
aisthesis-5428	174	34	protein	protein	NOUN
aisthesis-5428	174	35	blast	blast	NOUN
aisthesis-5428	174	36	analysis	analysis	NOUN
aisthesis-5428	174	37	and	and	CCONJ
aisthesis-5428	174	38	was	be	AUX
aisthesis-5428	174	39	found	find	VERB
aisthesis-5428	174	40	to	to	PART
aisthesis-5428	174	41	correspond	correspond	VERB
aisthesis-5428	174	42	to	to	ADP
aisthesis-5428	174	43	the	the	DET
aisthesis-5428	174	44	d.	d.	NOUN
aisthesis-5428	174	45	melanogaster	melanogaster	NOUN
aisthesis-5428	174	46	gene	gene	NOUN
aisthesis-5428	174	47	vestigial	vestigial	NOUN
aisthesis-5428	174	48	.	.	PUNCT
aisthesis-5428	175	1	it	it	PRON
aisthesis-5428	175	2	can	can	AUX
aisthesis-5428	175	3	be	be	AUX
aisthesis-5428	175	4	concluded	conclude	VERB
aisthesis-5428	175	5	then	then	ADV
aisthesis-5428	175	6	that	that	SCONJ
aisthesis-5428	175	7	trex	trex	PROPN
aisthesis-5428	175	8	is	be	AUX
aisthesis-5428	175	9	allelic	allelic	ADJ
aisthesis-5428	175	10	to	to	ADP
aisthesis-5428	175	11	vestigial	vestigial	NOUN
aisthesis-5428	175	12	.	.	PUNCT
aisthesis-5428	176	1	because	because	SCONJ
aisthesis-5428	176	2	of	of	ADP
aisthesis-5428	176	3	this	this	DET
aisthesis-5428	176	4	transposon	transposon	NOUN
aisthesis-5428	176	5	,	,	PUNCT
aisthesis-5428	176	6	which	which	PRON
aisthesis-5428	176	7	is	be	AUX
aisthesis-5428	176	8	partially	partially	ADV
aisthesis-5428	176	9	located	locate	VERB
aisthesis-5428	176	10	within	within	ADP
aisthesis-5428	176	11	the	the	DET
aisthesis-5428	176	12	coding	code	VERB
aisthesis-5428	176	13	portion	portion	NOUN
aisthesis-5428	176	14	of	of	ADP
aisthesis-5428	176	15	the	the	DET
aisthesis-5428	176	16	wild	wild	ADJ
aisthesis-5428	176	17	-	-	PUNCT
aisthesis-5428	176	18	type	type	NOUN
aisthesis-5428	176	19	sequence	sequence	NOUN
aisthesis-5428	176	20	,	,	PUNCT
aisthesis-5428	176	21	the	the	DET
aisthesis-5428	176	22	normal	normal	ADJ
aisthesis-5428	176	23	structure	structure	NOUN
aisthesis-5428	176	24	of	of	ADP
aisthesis-5428	176	25	the	the	DET
aisthesis-5428	176	26	protein	protein	NOUN
aisthesis-5428	176	27	produced	produce	VERB
aisthesis-5428	176	28	by	by	ADP
aisthesis-5428	176	29	vestigial	vestigial	NOUN
aisthesis-5428	176	30	is	be	AUX
aisthesis-5428	176	31	disrupted	disrupt	VERB
aisthesis-5428	176	32	.	.	PUNCT
aisthesis-5428	177	1	as	as	ADP
aisthesis-5428	177	2	such	such	ADJ
aisthesis-5428	177	3	,	,	PUNCT
aisthesis-5428	177	4	it	it	PRON
aisthesis-5428	177	5	can	can	AUX
aisthesis-5428	177	6	not	not	PART
aisthesis-5428	177	7	perform	perform	VERB
aisthesis-5428	177	8	its	its	PRON
aisthesis-5428	177	9	normal	normal	ADJ
aisthesis-5428	177	10	function	function	NOUN
aisthesis-5428	177	11	as	as	ADP
aisthesis-5428	177	12	a	a	DET
aisthesis-5428	177	13	co	co	NOUN
aisthesis-5428	177	14	-	-	NOUN
aisthesis-5428	177	15	transcription	transcription	NOUN
aisthesis-5428	177	16	factor	factor	NOUN
aisthesis-5428	177	17	acting	act	VERB
aisthesis-5428	177	18	with	with	ADP
aisthesis-5428	177	19	scalloped	scallop	VERB
aisthesis-5428	177	20	,	,	PUNCT
aisthesis-5428	177	21	as	as	SCONJ
aisthesis-5428	177	22	described	describe	VERB
aisthesis-5428	177	23	in	in	ADP
aisthesis-5428	177	24	the	the	DET
aisthesis-5428	177	25	introduction	introduction	NOUN
aisthesis-5428	177	26	.	.	PUNCT
aisthesis-5428	178	1	this	this	DET
aisthesis-5428	178	2	malfunction	malfunction	NOUN
aisthesis-5428	178	3	is	be	AUX
aisthesis-5428	178	4	visibly	visibly	ADV
aisthesis-5428	178	5	apparent	apparent	ADJ
aisthesis-5428	178	6	in	in	ADP
aisthesis-5428	178	7	the	the	DET
aisthesis-5428	178	8	phenotypic	phenotypic	ADJ
aisthesis-5428	178	9	presentation	presentation	NOUN
aisthesis-5428	178	10	of	of	ADP
aisthesis-5428	178	11	trex	trex	PROPN
aisthesis-5428	178	12	flies	fly	NOUN
aisthesis-5428	178	13	.	.	PUNCT
aisthesis-5428	179	1	retrotransposon	retrotransposon	NOUN
aisthesis-5428	179	2	412	412	NUM
aisthesis-5428	179	3	causes	cause	VERB
aisthesis-5428	179	4	a	a	DET
aisthesis-5428	179	5	malfunction	malfunction	NOUN
aisthesis-5428	179	6	of	of	ADP
aisthesis-5428	179	7	the	the	DET
aisthesis-5428	179	8	vg	vg	ADJ
aisthesis-5428	179	9	-	-	PUNCT
aisthesis-5428	179	10	sd	sd	NOUN
aisthesis-5428	179	11	complex	complex	NOUN
aisthesis-5428	179	12	,	,	PUNCT
aisthesis-5428	179	13	such	such	ADJ
aisthesis-5428	179	14	that	that	SCONJ
aisthesis-5428	179	15	it	it	PRON
aisthesis-5428	179	16	is	be	AUX
aisthesis-5428	179	17	unable	unable	ADJ
aisthesis-5428	179	18	to	to	PART
aisthesis-5428	179	19	properly	properly	ADV
aisthesis-5428	179	20	regulate	regulate	VERB
aisthesis-5428	179	21	wing	wing	NOUN
aisthesis-5428	179	22	/	/	SYM
aisthesis-5428	179	23	haltere	haltere	NOUN
aisthesis-5428	179	24	genes	gene	NOUN
aisthesis-5428	179	25	,	,	PUNCT
aisthesis-5428	179	26	leading	lead	VERB
aisthesis-5428	179	27	to	to	ADP
aisthesis-5428	179	28	malformed	malformed	ADJ
aisthesis-5428	179	29	wing	wing	NOUN
aisthesis-5428	179	30	morphology	morphology	NOUN
aisthesis-5428	179	31	.	.	PUNCT
aisthesis-5428	180	1	f.	f.	PROPN
aisthesis-5428	180	2	trex	trex	PROPN
aisthesis-5428	180	3	has	have	VERB
aisthesis-5428	180	4	a	a	DET
aisthesis-5428	180	5	human	human	ADJ
aisthesis-5428	180	6	ortholog	ortholog	NOUN
aisthesis-5428	180	7	vestigial	vestigial	ADJ
aisthesis-5428	180	8	-	-	PUNCT
aisthesis-5428	180	9	like	like	ADJ
aisthesis-5428	180	10	protein	protein	NOUN
aisthesis-5428	180	11	2	2	NUM
aisthesis-5428	180	12	as	as	SCONJ
aisthesis-5428	180	13	indicated	indicate	VERB
aisthesis-5428	180	14	in	in	ADP
aisthesis-5428	180	15	the	the	DET
aisthesis-5428	180	16	results	result	NOUN
aisthesis-5428	180	17	,	,	PUNCT
aisthesis-5428	180	18	as	as	ADP
aisthesis-5428	180	19	an	an	DET
aisthesis-5428	180	20	allele	allele	NOUN
aisthesis-5428	180	21	of	of	ADP
aisthesis-5428	180	22	the	the	DET
aisthesis-5428	180	23	d.	d.	PROPN
aisthesis-5428	180	24	melanogaster	melanogaster	NOUN
aisthesis-5428	180	25	gene	gene	NOUN
aisthesis-5428	180	26	vestigial	vestigial	NOUN
aisthesis-5428	180	27	,	,	PUNCT
aisthesis-5428	180	28	trex	trex	PROPN
aisthesis-5428	180	29	displays	display	VERB
aisthesis-5428	180	30	a	a	DET
aisthesis-5428	180	31	high	high	ADJ
aisthesis-5428	180	32	level	level	NOUN
aisthesis-5428	180	33	of	of	ADP
aisthesis-5428	180	34	concordance	concordance	NOUN
aisthesis-5428	180	35	with	with	ADP
aisthesis-5428	180	36	the	the	DET
aisthesis-5428	180	37	human	human	ADJ
aisthesis-5428	180	38	gene	gene	NOUN
aisthesis-5428	180	39	vgll-2	vgll-2	PROPN
aisthesis-5428	180	40	.	.	PUNCT
aisthesis-5428	181	1	vgll2	vgll2	PROPN
aisthesis-5428	181	2	can	can	AUX
aisthesis-5428	181	3	be	be	AUX
aisthesis-5428	181	4	concluded	conclude	VERB
aisthesis-5428	181	5	to	to	PART
aisthesis-5428	181	6	be	be	AUX
aisthesis-5428	181	7	a	a	DET
aisthesis-5428	181	8	human	human	ADJ
aisthesis-5428	181	9	ortholog	ortholog	NOUN
aisthesis-5428	181	10	of	of	ADP
aisthesis-5428	181	11	trex	trex	PROPN
aisthesis-5428	181	12	.	.	PUNCT
aisthesis-5428	182	1	this	this	DET
aisthesis-5428	182	2	gene	gene	NOUN
aisthesis-5428	182	3	is	be	AUX
aisthesis-5428	182	4	a	a	DET
aisthesis-5428	182	5	member	member	NOUN
aisthesis-5428	182	6	of	of	ADP
aisthesis-5428	182	7	the	the	DET
aisthesis-5428	182	8	vestigial	vestigial	ADJ
aisthesis-5428	182	9	-	-	PUNCT
aisthesis-5428	182	10	like	like	ADJ
aisthesis-5428	182	11	family	family	NOUN
aisthesis-5428	182	12	of	of	ADP
aisthesis-5428	182	13	proteins	protein	NOUN
aisthesis-5428	182	14	discussed	discuss	VERB
aisthesis-5428	182	15	in	in	ADP
aisthesis-5428	182	16	the	the	DET
aisthesis-5428	182	17	introduction	introduction	NOUN
aisthesis-5428	182	18	,	,	PUNCT
aisthesis-5428	182	19	and	and	CCONJ
aisthesis-5428	182	20	as	as	ADP
aisthesis-5428	182	21	such	such	ADJ
aisthesis-5428	182	22	,	,	PUNCT
aisthesis-5428	182	23	acts	act	VERB
aisthesis-5428	182	24	as	as	ADP
aisthesis-5428	182	25	a	a	DET
aisthesis-5428	182	26	co	co	NOUN
aisthesis-5428	182	27	-	-	NOUN
aisthesis-5428	182	28	transcription	transcription	ADJ
aisthesis-5428	182	29	factor	factor	NOUN
aisthesis-5428	182	30	to	to	ADP
aisthesis-5428	182	31	transcription	transcription	NOUN
aisthesis-5428	182	32	factors	factor	NOUN
aisthesis-5428	182	33	with	with	ADP
aisthesis-5428	182	34	a	a	DET
aisthesis-5428	182	35	tead	tead	ADJ
aisthesis-5428	182	36	-	-	PUNCT
aisthesis-5428	182	37	binding	bind	VERB
aisthesis-5428	182	38	domain	domain	NOUN
aisthesis-5428	182	39	(	(	PUNCT
aisthesis-5428	182	40	yamaguchi	yamaguchi	PROPN
aisthesis-5428	182	41	2020	2020	NUM
aisthesis-5428	182	42	)	)	PUNCT
aisthesis-5428	182	43	.	.	PUNCT
aisthesis-5428	183	1	vgll-2	vgll-2	NUM
aisthesis-5428	183	2	specifically	specifically	ADV
aisthesis-5428	183	3	may	may	AUX
aisthesis-5428	183	4	be	be	AUX
aisthesis-5428	183	5	important	important	ADJ
aisthesis-5428	183	6	in	in	ADP
aisthesis-5428	183	7	regulating	regulate	VERB
aisthesis-5428	183	8	the	the	DET
aisthesis-5428	183	9	distribution	distribution	NOUN
aisthesis-5428	183	10	of	of	ADP
aisthesis-5428	183	11	skeletal	skeletal	ADJ
aisthesis-5428	183	12	muscle	muscle	NOUN
aisthesis-5428	183	13	fibers	fiber	NOUN
aisthesis-5428	183	14	in	in	ADP
aisthesis-5428	183	15	humans	human	NOUN
aisthesis-5428	183	16	by	by	ADP
aisthesis-5428	183	17	regulating	regulate	VERB
aisthesis-5428	183	18	myocyte	myocyte	NOUN
aisthesis-5428	183	19	transcription	transcription	NOUN
aisthesis-5428	183	20	factors	factor	NOUN
aisthesis-5428	183	21	with	with	ADP
aisthesis-5428	183	22	tead	tead	ADJ
aisthesis-5428	183	23	-	-	PUNCT
aisthesis-5428	183	24	binding	bind	VERB
aisthesis-5428	183	25	domains	domain	NOUN
aisthesis-5428	183	26	(	(	PUNCT
aisthesis-5428	183	27	honda	honda	X
aisthesis-5428	183	28	et	et	PROPN
aisthesis-5428	183	29	al	al	PROPN
aisthesis-5428	183	30	.	.	PROPN
aisthesis-5428	183	31	2017	2017	NUM
aisthesis-5428	183	32	)	)	PUNCT
aisthesis-5428	183	33	.	.	PUNCT
aisthesis-5428	184	1	this	this	DET
aisthesis-5428	184	2	ortholog	ortholog	NOUN
aisthesis-5428	184	3	allows	allow	VERB
aisthesis-5428	184	4	us	we	PRON
aisthesis-5428	184	5	to	to	PART
aisthesis-5428	184	6	understand	understand	VERB
aisthesis-5428	184	7	how	how	SCONJ
aisthesis-5428	184	8	vestigial	vestigial	NOUN
aisthesis-5428	184	9	also	also	ADV
aisthesis-5428	184	10	functions	function	VERB
aisthesis-5428	184	11	regulating	regulate	VERB
aisthesis-5428	184	12	gene	gene	NOUN
aisthesis-5428	184	13	expression	expression	NOUN
aisthesis-5428	184	14	through	through	ADP
aisthesis-5428	184	15	its	its	PRON
aisthesis-5428	184	16	interactions	interaction	NOUN
aisthesis-5428	184	17	with	with	ADP
aisthesis-5428	184	18	tead	tead	ADJ
aisthesis-5428	184	19	-	-	PUNCT
aisthesis-5428	184	20	binding	bind	VERB
aisthesis-5428	184	21	domain	domain	NOUN
aisthesis-5428	184	22	-	-	PUNCT
aisthesis-5428	184	23	containing	contain	VERB
aisthesis-5428	184	24	transcription	transcription	NOUN
aisthesis-5428	184	25	factors	factor	NOUN
aisthesis-5428	184	26	through	through	ADP
aisthesis-5428	184	27	a	a	DET
aisthesis-5428	184	28	tdu	tdu	NOUN
aisthesis-5428	184	29	motif	motif	NOUN
aisthesis-5428	184	30	.	.	PUNCT
aisthesis-5428	185	1	the	the	DET
aisthesis-5428	185	2	mutation	mutation	NOUN
aisthesis-5428	185	3	of	of	ADP
aisthesis-5428	185	4	vgll-2	vgll-2	NUM
aisthesis-5428	185	5	is	be	AUX
aisthesis-5428	185	6	associated	associate	VERB
aisthesis-5428	185	7	with	with	ADP
aisthesis-5428	185	8	various	various	ADJ
aisthesis-5428	185	9	disorders	disorder	NOUN
aisthesis-5428	185	10	of	of	ADP
aisthesis-5428	185	11	the	the	DET
aisthesis-5428	185	12	skeletal	skeletal	ADJ
aisthesis-5428	185	13	muscle	muscle	NOUN
aisthesis-5428	185	14	and	and	CCONJ
aisthesis-5428	185	15	associated	associated	ADJ
aisthesis-5428	185	16	tissues	tissue	NOUN
aisthesis-5428	185	17	,	,	PUNCT
aisthesis-5428	185	18	such	such	ADJ
aisthesis-5428	185	19	as	as	ADP
aisthesis-5428	185	20	rhabdomyosarcomas	rhabdomyosarcoma	NOUN
aisthesis-5428	185	21	(	(	PUNCT
aisthesis-5428	185	22	e.g.	e.g.	ADV
aisthesis-5428	185	23	,	,	PUNCT
aisthesis-5428	185	24	pleotropic	pleotropic	ADJ
aisthesis-5428	185	25	rhabdomyosarcoma	rhabdomyosarcoma	NOUN
aisthesis-5428	185	26	and	and	CCONJ
aisthesis-5428	185	27	spindle	spindle	NOUN
aisthesis-5428	185	28	cell	cell	NOUN
aisthesis-5428	185	29	rhabdomyosarcoma	rhabdomyosarcoma	NOUN
aisthesis-5428	185	30	)	)	PUNCT
aisthesis-5428	185	31	(	(	PUNCT
aisthesis-5428	185	32	furlong	furlong	NOUN
aisthesis-5428	185	33	et	et	PROPN
aisthesis-5428	185	34	al	al	PROPN
aisthesis-5428	185	35	.	.	PROPN
aisthesis-5428	185	36	2001	2001	NUM
aisthesis-5428	185	37	)	)	PUNCT
aisthesis-5428	185	38	.	.	PUNCT
aisthesis-5428	186	1	the	the	DET
aisthesis-5428	186	2	lack	lack	NOUN
aisthesis-5428	186	3	of	of	ADP
aisthesis-5428	186	4	genetic	genetic	ADJ
aisthesis-5428	186	5	regulation	regulation	NOUN
aisthesis-5428	186	6	by	by	ADP
aisthesis-5428	186	7	vgll-2	vgll-2	NUM
aisthesis-5428	186	8	leads	lead	NOUN
aisthesis-5428	186	9	to	to	ADP
aisthesis-5428	186	10	a	a	DET
aisthesis-5428	186	11	dysregulation	dysregulation	NOUN
aisthesis-5428	186	12	in	in	ADP
aisthesis-5428	186	13	gene	gene	NOUN
aisthesis-5428	186	14	expression	expression	NOUN
aisthesis-5428	186	15	in	in	ADP
aisthesis-5428	186	16	skeletal	skeletal	ADJ
aisthesis-5428	186	17	muscle	muscle	NOUN
aisthesis-5428	186	18	development	development	NOUN
aisthesis-5428	186	19	and	and	CCONJ
aisthesis-5428	186	20	subsequent	subsequent	ADJ
aisthesis-5428	186	21	malformations	malformation	NOUN
aisthesis-5428	186	22	and	and	CCONJ
aisthesis-5428	186	23	irregular	irregular	ADJ
aisthesis-5428	186	24	development	development	NOUN
aisthesis-5428	186	25	of	of	ADP
aisthesis-5428	186	26	such	such	ADJ
aisthesis-5428	186	27	tissues	tissue	NOUN
aisthesis-5428	186	28	(	(	PUNCT
aisthesis-5428	186	29	furlong	furlong	NOUN
aisthesis-5428	186	30	et	et	PROPN
aisthesis-5428	186	31	al	al	PROPN
aisthesis-5428	186	32	.	.	PROPN
aisthesis-5428	186	33	2001	2001	NUM
aisthesis-5428	186	34	)	)	PUNCT
aisthesis-5428	186	35	.	.	PUNCT
aisthesis-5428	187	1	g.	g.	PROPN
aisthesis-5428	187	2	conclusions	conclusion	NOUN
aisthesis-5428	187	3	overall	overall	ADV
aisthesis-5428	187	4	,	,	PUNCT
aisthesis-5428	187	5	it	it	PRON
aisthesis-5428	187	6	was	be	AUX
aisthesis-5428	187	7	found	find	VERB
aisthesis-5428	187	8	that	that	SCONJ
aisthesis-5428	187	9	trex	trex	PROPN
aisthesis-5428	187	10	is	be	AUX
aisthesis-5428	187	11	an	an	DET
aisthesis-5428	187	12	allele	allele	NOUN
aisthesis-5428	187	13	of	of	ADP
aisthesis-5428	187	14	the	the	DET
aisthesis-5428	187	15	well	well	ADV
aisthesis-5428	187	16	-	-	PUNCT
aisthesis-5428	187	17	researched	research	VERB
aisthesis-5428	187	18	d.	d.	NOUN
aisthesis-5428	187	19	melanogaster	melanogaster	NOUN
aisthesis-5428	187	20	gene	gene	NOUN
aisthesis-5428	187	21	vestigial	vestigial	NOUN
aisthesis-5428	187	22	.	.	PUNCT
aisthesis-5428	188	1	trex	trex	PROPN
aisthesis-5428	188	2	is	be	AUX
aisthesis-5428	188	3	inherited	inherit	VERB
aisthesis-5428	188	4	in	in	ADP
aisthesis-5428	188	5	an	an	DET
aisthesis-5428	188	6	autosomal	autosomal	ADJ
aisthesis-5428	188	7	recessive	recessive	ADJ
aisthesis-5428	188	8	fashion	fashion	NOUN
aisthesis-5428	188	9	and	and	CCONJ
aisthesis-5428	188	10	is	be	AUX
aisthesis-5428	188	11	located	locate	VERB
aisthesis-5428	188	12	at	at	ADP
aisthesis-5428	188	13	2:68	2:68	NUM
aisthesis-5428	188	14	within	within	ADP
aisthesis-5428	188	15	the	the	DET
aisthesis-5428	188	16	d.	d.	NOUN
aisthesis-5428	188	17	melanogaster	melanogaster	NOUN
aisthesis-5428	188	18	genome	genome	NOUN
aisthesis-5428	188	19	.	.	PUNCT
aisthesis-5428	189	1	the	the	DET
aisthesis-5428	189	2	trex	trex	PROPN
aisthesis-5428	189	3	phenotype	phenotype	NOUN
aisthesis-5428	189	4	,	,	PUNCT
aisthesis-5428	189	5	visible	visible	ADJ
aisthesis-5428	189	6	as	as	ADP
aisthesis-5428	189	7	small	small	ADJ
aisthesis-5428	189	8	,	,	PUNCT
aisthesis-5428	189	9	crumpled	crumpled	ADJ
aisthesis-5428	189	10	wings	wing	NOUN
aisthesis-5428	189	11	that	that	PRON
aisthesis-5428	189	12	lie	lie	VERB
aisthesis-5428	189	13	perpendicular	perpendicular	ADJ
aisthesis-5428	189	14	to	to	ADP
aisthesis-5428	189	15	the	the	DET
aisthesis-5428	189	16	anteroposterior	anteroposterior	ADJ
aisthesis-5428	189	17	axis	axis	NOUN
aisthesis-5428	189	18	of	of	ADP
aisthesis-5428	189	19	the	the	DET
aisthesis-5428	189	20	fly	fly	NOUN
aisthesis-5428	189	21	,	,	PUNCT
aisthesis-5428	189	22	arises	arise	VERB
aisthesis-5428	189	23	as	as	ADP
aisthesis-5428	189	24	a	a	DET
aisthesis-5428	189	25	result	result	NOUN
aisthesis-5428	189	26	of	of	ADP
aisthesis-5428	189	27	the	the	DET
aisthesis-5428	189	28	insertion	insertion	NOUN
aisthesis-5428	189	29	of	of	ADP
aisthesis-5428	189	30	retrotransposon	retrotransposon	NOUN
aisthesis-5428	189	31	412	412	NUM
aisthesis-5428	189	32	.	.	PUNCT
aisthesis-5428	190	1	otherwise	otherwise	ADV
aisthesis-5428	190	2	,	,	PUNCT
aisthesis-5428	190	3	trex	trex	PROPN
aisthesis-5428	190	4	has	have	VERB
aisthesis-5428	190	5	a	a	DET
aisthesis-5428	190	6	correspondence	correspondence	NOUN
aisthesis-5428	190	7	of	of	ADP
aisthesis-5428	190	8	about	about	ADV
aisthesis-5428	190	9	425	425	NUM
aisthesis-5428	190	10	base	base	NOUN
aisthesis-5428	190	11	pairs	pair	NOUN
aisthesis-5428	190	12	with	with	ADP
aisthesis-5428	190	13	94	94	NUM
aisthesis-5428	190	14	%	%	NOUN
aisthesis-5428	190	15	agreement	agreement	NOUN
aisthesis-5428	190	16	with	with	ADP
aisthesis-5428	190	17	the	the	DET
aisthesis-5428	190	18	wild	wild	ADJ
aisthesis-5428	190	19	-	-	PUNCT
aisthesis-5428	190	20	type	type	NOUN
aisthesis-5428	190	21	d.	d.	NOUN
aisthesis-5428	190	22	melanogaster	melanogaster	NOUN
aisthesis-5428	190	23	nucleotide	nucleotide	NOUN
aisthesis-5428	190	24	sequence	sequence	NOUN
aisthesis-5428	190	25	.	.	PUNCT
aisthesis-5428	191	1	further	far	ADV
aisthesis-5428	191	2	,	,	PUNCT
aisthesis-5428	191	3	as	as	ADP
aisthesis-5428	191	4	an	an	DET
aisthesis-5428	191	5	allele	allele	NOUN
aisthesis-5428	191	6	of	of	ADP
aisthesis-5428	191	7	vestigial	vestigial	NOUN
aisthesis-5428	191	8	,	,	PUNCT
aisthesis-5428	191	9	trex	trex	PROPN
aisthesis-5428	191	10	has	have	VERB
aisthesis-5428	191	11	the	the	DET
aisthesis-5428	191	12	human	human	ADJ
aisthesis-5428	191	13	ortholog	ortholog	NOUN
aisthesis-5428	191	14	gene	gene	NOUN
aisthesis-5428	191	15	vgll-2	vgll-2	PROPN
aisthesis-5428	191	16	.	.	NOUN
aisthesis-5428	191	17	61	61	NUM
aisthesis-5428	191	18	analysis	analysis	NOUN
aisthesis-5428	191	19	of	of	ADP
aisthesis-5428	191	20	novel	novel	ADJ
aisthesis-5428	191	21	unknown	unknown	ADJ
aisthesis-5428	191	22	d.	d.	NOUN
aisthesis-5428	191	23	melanogaster	melanogaster	NOUN
aisthesis-5428	191	24	mutation	mutation	NOUN
aisthesis-5428	191	25	trex	trex	PROPN
aisthesis-5428	191	26	aisthesis	aisthesis	NOUN
aisthesis-5428	191	27	volume	volume	NOUN
aisthesis-5428	191	28	14	14	NUM
aisthesis-5428	191	29	,	,	PUNCT
aisthesis-5428	191	30	2023	2023	NUM
aisthesis-5428	191	31	references	reference	NOUN
aisthesis-5428	191	32	baena	baena	ADJ
aisthesis-5428	191	33	-	-	PUNCT
aisthesis-5428	191	34	lopez	lopez	PROPN
aisthesis-5428	191	35	la	la	PROPN
aisthesis-5428	191	36	,	,	PUNCT
aisthesis-5428	191	37	garcia	garcia	PROPN
aisthesis-5428	191	38	-	-	PUNCT
aisthesis-5428	191	39	bellido	bellido	PROPN
aisthesis-5428	191	40	a.	a.	PROPN
aisthesis-5428	191	41	2006	2006	NUM
aisthesis-5428	191	42	.	.	PUNCT
aisthesis-5428	192	1	control	control	NOUN
aisthesis-5428	192	2	of	of	ADP
aisthesis-5428	192	3	growth	growth	NOUN
aisthesis-5428	192	4	and	and	CCONJ
aisthesis-5428	192	5	positional	positional	ADJ
aisthesis-5428	192	6	information	information	NOUN
aisthesis-5428	192	7	by	by	ADP
aisthesis-5428	192	8	the	the	DET
aisthesis-5428	192	9	graded	grade	VERB
aisthesis-5428	192	10	vestigial	vestigial	ADJ
aisthesis-5428	192	11	expression	expression	NOUN
aisthesis-5428	192	12	pattern	pattern	NOUN
aisthesis-5428	192	13	in	in	ADP
aisthesis-5428	192	14	the	the	DET
aisthesis-5428	192	15	wing	wing	NOUN
aisthesis-5428	192	16	of	of	ADP
aisthesis-5428	192	17	drosophila	drosophila	NOUN
aisthesis-5428	192	18	melanogaster	melanogaster	NOUN
aisthesis-5428	192	19	.	.	PUNCT
aisthesis-5428	193	1	proc	proc	PROPN
aisthesis-5428	193	2	.	.	PUNCT
aisthesis-5428	194	1	natl	natl	PROPN
aisthesis-5428	194	2	.	.	PUNCT
aisthesis-5428	195	1	acad	acad	PROPN
aisthesis-5428	195	2	.	.	PUNCT
aisthesis-5428	196	1	sci	sci	PROPN
aisthesis-5428	196	2	.	.	PROPN
aisthesis-5428	196	3	u.s.a	u.s.a	PROPN
aisthesis-5428	196	4	.	.	PUNCT
aisthesis-5428	197	1	103(37):13734	103(37):13734	NUM
aisthesis-5428	197	2	-	-	PUNCT
aisthesis-5428	197	3	13739	13739	NUM
aisthesis-5428	197	4	.	.	PUNCT
aisthesis-5428	198	1	furlong	furlong	PROPN
aisthesis-5428	198	2	ma	ma	PROPN
aisthesis-5428	198	3	,	,	PUNCT
aisthesis-5428	198	4	mentzel	mentzel	PROPN
aisthesis-5428	198	5	t	t	PROPN
aisthesis-5428	198	6	,	,	PUNCT
aisthesis-5428	198	7	&	&	CCONJ
aisthesis-5428	198	8	fanburg	fanburg	PROPN
aisthesis-5428	198	9	-	-	PUNCT
aisthesis-5428	198	10	smith	smith	PROPN
aisthesis-5428	198	11	jc	jc	PROPN
aisthesis-5428	198	12	.	.	PROPN
aisthesis-5428	198	13	2001	2001	NUM
aisthesis-5428	198	14	.	.	PUNCT
aisthesis-5428	199	1	pleomorphic	pleomorphic	ADJ
aisthesis-5428	199	2	rhabdomyosarcoma	rhabdomyosarcoma	NOUN
aisthesis-5428	199	3	in	in	ADP
aisthesis-5428	199	4	adults	adult	NOUN
aisthesis-5428	199	5	:	:	PUNCT
aisthesis-5428	199	6	a	a	DET
aisthesis-5428	199	7	clinicopathologic	clinicopathologic	ADJ
aisthesis-5428	199	8	study	study	NOUN
aisthesis-5428	199	9	of	of	ADP
aisthesis-5428	199	10	38	38	NUM
aisthesis-5428	199	11	cases	case	NOUN
aisthesis-5428	199	12	with	with	ADP
aisthesis-5428	199	13	emphasis	emphasis	NOUN
aisthesis-5428	199	14	on	on	ADP
aisthesis-5428	199	15	morphologic	morphologic	ADJ
aisthesis-5428	199	16	variants	variant	NOUN
aisthesis-5428	199	17	and	and	CCONJ
aisthesis-5428	199	18	recent	recent	ADJ
aisthesis-5428	199	19	skeletal	skeletal	ADJ
aisthesis-5428	199	20	muscle	muscle	NOUN
aisthesis-5428	199	21	-	-	PUNCT
aisthesis-5428	199	22	specific	specific	ADJ
aisthesis-5428	199	23	markers	marker	NOUN
aisthesis-5428	199	24	.	.	PUNCT
aisthesis-5428	199	25	 	 	SPACE
aisthesis-5428	200	1	modern	modern	ADJ
aisthesis-5428	200	2	pathology	pathology	NOUN
aisthesis-5428	200	3	:	:	PUNCT
aisthesis-5428	200	4	an	an	DET
aisthesis-5428	200	5	official	official	ADJ
aisthesis-5428	200	6	journal	journal	NOUN
aisthesis-5428	200	7	of	of	ADP
aisthesis-5428	200	8	the	the	DET
aisthesis-5428	200	9	united	united	PROPN
aisthesis-5428	200	10	states	states	PROPN
aisthesis-5428	200	11	and	and	CCONJ
aisthesis-5428	200	12	canadian	canadian	PROPN
aisthesis-5428	200	13	academy	academy	PROPN
aisthesis-5428	200	14	of	of	ADP
aisthesis-5428	200	15	pathology	pathology	PROPN
aisthesis-5428	200	16	,	,	PUNCT
aisthesis-5428	200	17	inc	inc	PROPN
aisthesis-5428	200	18	.	.	PROPN
aisthesis-5428	200	19	  	  	SPACE
aisthesis-5428	200	20	14(6):595–603	14(6):595–603	PROPN
aisthesis-5428	200	21	.	.	PUNCT
aisthesis-5428	201	1	https://doi.org/10.1038/	https://doi.org/10.1038/	PROPN
aisthesis-5428	201	2	modpathol.3880357	modpathol.3880357	PROPN
aisthesis-5428	201	3	halder	halder	PROPN
aisthesis-5428	201	4	g	g	NOUN
aisthesis-5428	201	5	,	,	PUNCT
aisthesis-5428	201	6	polaczyk	polaczyk	VERB
aisthesis-5428	201	7	p	p	PROPN
aisthesis-5428	201	8	,	,	PUNCT
aisthesis-5428	201	9	kraus	kraus	PROPN
aisthesis-5428	201	10	me	me	PROPN
aisthesis-5428	201	11	,	,	PUNCT
aisthesis-5428	201	12	hudson	hudson	PROPN
aisthesis-5428	201	13	a	a	PROPN
aisthesis-5428	201	14	,	,	PUNCT
aisthesis-5428	201	15	kim	kim	PROPN
aisthesis-5428	201	16	j	j	PROPN
aisthesis-5428	201	17	,	,	PUNCT
aisthesis-5428	201	18	laughon	laughon	PROPN
aisthesis-5428	201	19	a	a	PRON
aisthesis-5428	201	20	,	,	PUNCT
aisthesis-5428	201	21	carroll	carroll	PROPN
aisthesis-5428	201	22	s.	s.	PROPN
aisthesis-5428	201	23	1998	1998	NUM
aisthesis-5428	201	24	.	.	PUNCT
aisthesis-5428	202	1	the	the	DET
aisthesis-5428	202	2	vestigial	vestigial	ADJ
aisthesis-5428	202	3	and	and	CCONJ
aisthesis-5428	202	4	scalloped	scalloped	ADJ
aisthesis-5428	202	5	proteins	protein	NOUN
aisthesis-5428	202	6	act	act	VERB
aisthesis-5428	202	7	together	together	ADV
aisthesis-5428	202	8	to	to	PART
aisthesis-5428	202	9	directly	directly	ADV
aisthesis-5428	202	10	regulate	regulate	VERB
aisthesis-5428	202	11	wing	wing	NOUN
aisthesis-5428	202	12	-	-	PUNCT
aisthesis-5428	202	13	specific	specific	ADJ
aisthesis-5428	202	14	gene	gene	NOUN
aisthesis-5428	202	15	expression	expression	NOUN
aisthesis-5428	202	16	in	in	ADP
aisthesis-5428	202	17	drosophila	drosophila	PROPN
aisthesis-5428	202	18	.	.	PUNCT
aisthesis-5428	203	1	genes	gene	NOUN
aisthesis-5428	203	2	dev	dev	PROPN
aisthesis-5428	203	3	.	.	PUNCT
aisthesis-5428	204	1	12(24):3900	12(24):3900	NUM
aisthesis-5428	204	2	-	-	SYM
aisthesis-5428	204	3	3909	3909	NUM
aisthesis-5428	204	4	.	.	PUNCT
aisthesis-5428	205	1	honda	honda	PROPN
aisthesis-5428	205	2	,	,	PUNCT
aisthesis-5428	205	3	m	m	PROPN
aisthesis-5428	205	4	,	,	PUNCT
aisthesis-5428	205	5	hidaka	hidaka	PROPN
aisthesis-5428	205	6	k	k	X
aisthesis-5428	205	7	,	,	PUNCT
aisthesis-5428	205	8	fukada	fukada	PROPN
aisthesis-5428	205	9	s	s	PART
aisthesis-5428	205	10	,	,	PUNCT
aisthesis-5428	205	11	  	  	SPACE
aisthesis-5428	205	12	et	et	PROPN
aisthesis-5428	205	13	al	al	PROPN
aisthesis-5428	205	14	.	.	PROPN
aisthesis-5428	205	15	  	  	SPACE
aisthesis-5428	205	16	vestigiallike	vestigiallike	NOUN
aisthesis-5428	205	17	2	2	NUM
aisthesis-5428	205	18	contributes	contribute	VERB
aisthesis-5428	205	19	to	to	ADP
aisthesis-5428	205	20	normal	normal	ADJ
aisthesis-5428	205	21	muscle	muscle	NOUN
aisthesis-5428	205	22	fiber	fiber	NOUN
aisthesis-5428	205	23	type	type	NOUN
aisthesis-5428	205	24	distribution	distribution	NOUN
aisthesis-5428	205	25	in	in	ADP
aisthesis-5428	205	26	mice	mouse	NOUN
aisthesis-5428	205	27	.	.	PUNCT
aisthesis-5428	205	28	  	  	SPACE
aisthesis-5428	205	29	2017	2017	NUM
aisthesis-5428	205	30	.	.	PUNCT
aisthesis-5428	206	1	sci	sci	PROPN
aisthesis-5428	206	2	rep	rep	PROPN
aisthesis-5428	206	3	  	  	SPACE
aisthesis-5428	206	4	7:7168	7:7168	PROPN
aisthesis-5428	206	5	.	.	PUNCT
aisthesis-5428	207	1	https://doi.org/10.1038/s41598-017-07149-0	https://doi.org/10.1038/s41598-017-07149-0	NUM
aisthesis-5428	207	2	simmonds	simmond	VERB
aisthesis-5428	207	3	a	a	PRON
aisthesis-5428	207	4	,	,	PUNCT
aisthesis-5428	207	5	hughes	hughes	PROPN
aisthesis-5428	207	6	s	s	PROPN
aisthesis-5428	207	7	,	,	PUNCT
aisthesis-5428	207	8	tse	tse	PROPN
aisthesis-5428	207	9	j	j	PROPN
aisthesis-5428	207	10	,	,	PUNCT
aisthesis-5428	207	11	cocquyt	cocquyt	NOUN
aisthesis-5428	207	12	s	s	PROPN
aisthesis-5428	207	13	,	,	PUNCT
aisthesis-5428	207	14	bell	bell	PROPN
aisthesis-5428	207	15	,	,	PUNCT
aisthesis-5428	207	16	j.	j.	PROPN
aisthesis-5428	207	17	1997	1997	NUM
aisthesis-5428	207	18	.	.	PUNCT
aisthesis-5428	208	1	the	the	DET
aisthesis-5428	208	2	effect	effect	NOUN
aisthesis-5428	208	3	of	of	ADP
aisthesis-5428	208	4	dominant	dominant	ADJ
aisthesis-5428	208	5	vestigial	vestigial	ADJ
aisthesis-5428	208	6	alleles	allele	NOUN
aisthesis-5428	208	7	upon	upon	SCONJ
aisthesis-5428	208	8	vestigial	vestigial	ADJ
aisthesis-5428	208	9	-	-	PUNCT
aisthesis-5428	208	10	mediated	mediate	VERB
aisthesis-5428	208	11	wing	wing	NOUN
aisthesis-5428	208	12	patterning	patterning	NOUN
aisthesis-5428	208	13	during	during	ADP
aisthesis-5428	208	14	development	development	NOUN
aisthesis-5428	208	15	of	of	ADP
aisthesis-5428	208	16	drosophila	drosophila	NOUN
aisthesis-5428	208	17	melanogaster	melanogaster	NOUN
aisthesis-5428	208	18	.	.	PUNCT
aisthesis-5428	208	19	  	  	SPACE
aisthesis-5428	208	20	mechanisms	mechanism	NOUN
aisthesis-5428	208	21	of	of	ADP
aisthesis-5428	208	22	development	development	NOUN
aisthesis-5428	208	23	.	.	PUNCT
aisthesis-5428	208	24	 	 	SPACE
aisthesis-5428	209	1	67(1):17–33	67(1):17–33	X
aisthesis-5428	209	2	.	.	PUNCT
aisthesis-5428	210	1	tolwinski	tolwinski	PROPN
aisthesis-5428	210	2	ns	ns	NUM
aisthesis-5428	210	3	.	.	PROPN
aisthesis-5428	210	4	2017	2017	NUM
aisthesis-5428	210	5	.	.	PUNCT
aisthesis-5428	211	1	introduction	introduction	NOUN
aisthesis-5428	211	2	:	:	PUNCT
aisthesis-5428	211	3	drosophila	drosophila	NOUN
aisthesis-5428	211	4	-	-	PUNCT
aisthesis-5428	211	5	a	a	DET
aisthesis-5428	211	6	model	model	NOUN
aisthesis-5428	211	7	system	system	NOUN
aisthesis-5428	211	8	for	for	ADP
aisthesis-5428	211	9	developmental	developmental	ADJ
aisthesis-5428	211	10	biology	biology	NOUN
aisthesis-5428	211	11	.	.	PUNCT
aisthesis-5428	211	12	 	 	SPACE
aisthesis-5428	212	1	journal	journal	NOUN
aisthesis-5428	212	2	of	of	ADP
aisthesis-5428	212	3	developmental	developmental	ADJ
aisthesis-5428	212	4	biology	biology	NOUN
aisthesis-5428	212	5	,	,	PUNCT
aisthesis-5428	212	6	  	  	SPACE
aisthesis-5428	212	7	5(3):9	5(3):9	PROPN
aisthesis-5428	212	8	.	.	PUNCT
aisthesis-5428	213	1	https://doi	https://doi	NOUN
aisthesis-5428	213	2	.	.	PUNCT
aisthesis-5428	213	3	org/10.3390	org/10.3390	PROPN
aisthesis-5428	213	4	/	/	SYM
aisthesis-5428	213	5	jdb5030009	jdb5030009	PROPN
aisthesis-5428	213	6	williams	williams	PROPN
aisthesis-5428	213	7	ja	ja	PROPN
aisthesis-5428	213	8	,	,	PUNCT
aisthesis-5428	213	9	atkin	atkin	PROPN
aisthesis-5428	213	10	al	al	PROPN
aisthesis-5428	213	11	,	,	PUNCT
aisthesis-5428	213	12	bell	bell	PROPN
aisthesis-5428	213	13	jb	jb	PROPN
aisthesis-5428	213	14	.	.	PROPN
aisthesis-5428	213	15	1990	1990	NUM
aisthesis-5428	213	16	.	.	PUNCT
aisthesis-5428	214	1	the	the	DET
aisthesis-5428	214	2	functional	functional	ADJ
aisthesis-5428	214	3	organization	organization	NOUN
aisthesis-5428	214	4	of	of	ADP
aisthesis-5428	214	5	the	the	DET
aisthesis-5428	214	6	vestigial	vestigial	ADJ
aisthesis-5428	214	7	locus	locus	NOUN
aisthesis-5428	214	8	in	in	ADP
aisthesis-5428	214	9	drosophila	drosophila	NOUN
aisthesis-5428	214	10	melanogaster	melanogaster	NOUN
aisthesis-5428	214	11	.	.	PUNCT
aisthesis-5428	215	1	mol	mol	PROPN
aisthesis-5428	215	2	.	.	PUNCT
aisthesis-5428	216	1	gen	gen	PROPN
aisthesis-5428	216	2	.	.	PROPN
aisthesis-5428	216	3	genet	genet	PROPN
aisthesis-5428	216	4	.	.	PUNCT
aisthesis-5428	217	1	221(1):8	221(1):8	NUM
aisthesis-5428	217	2	-	-	SYM
aisthesis-5428	217	3	16	16	NUM
aisthesis-5428	217	4	.	.	PUNCT
aisthesis-5428	218	1	williams	williams	PROPN
aisthesis-5428	218	2	ja	ja	PROPN
aisthesis-5428	218	3	,	,	PUNCT
aisthesis-5428	218	4	bell	bell	PROPN
aisthesis-5428	218	5	jb	jb	PROPN
aisthesis-5428	218	6	,	,	PUNCT
aisthesis-5428	218	7	carroll	carroll	PROPN
aisthesis-5428	218	8	sb	sb	PROPN
aisthesis-5428	218	9	.	.	PROPN
aisthesis-5428	218	10	1991	1991	NUM
aisthesis-5428	218	11	.	.	PUNCT
aisthesis-5428	219	1	control	control	NOUN
aisthesis-5428	219	2	of	of	ADP
aisthesis-5428	219	3	drosophila	drosophila	NOUN
aisthesis-5428	219	4	wing	wing	NOUN
aisthesis-5428	219	5	and	and	CCONJ
aisthesis-5428	219	6	haltere	haltere	VERB
aisthesis-5428	219	7	development	development	NOUN
aisthesis-5428	219	8	by	by	ADP
aisthesis-5428	219	9	the	the	DET
aisthesis-5428	219	10	nuclear	nuclear	ADJ
aisthesis-5428	219	11	vestigial	vestigial	ADJ
aisthesis-5428	219	12	gene	gene	NOUN
aisthesis-5428	219	13	product	product	NOUN
aisthesis-5428	219	14	.	.	PUNCT
aisthesis-5428	220	1	genes	gene	NOUN
aisthesis-5428	220	2	dev	dev	PROPN
aisthesis-5428	220	3	.	.	PUNCT
aisthesis-5428	221	1	5(12b):2481	5(12b):2481	NUM
aisthesis-5428	221	2	-	-	SYM
aisthesis-5428	221	3	2495	2495	NUM
aisthesis-5428	221	4	.	.	PUNCT
aisthesis-5428	222	1	yamaguchi	yamaguchi	PROPN
aisthesis-5428	222	2	n.	n.	PROPN
aisthesis-5428	222	3	2020	2020	PROPN
aisthesis-5428	222	4	.	.	PUNCT
aisthesis-5428	223	1	multiple	multiple	ADJ
aisthesis-5428	223	2	roles	role	NOUN
aisthesis-5428	223	3	of	of	ADP
aisthesis-5428	223	4	vestigial	vestigial	ADJ
aisthesis-5428	223	5	-	-	PUNCT
aisthesis-5428	223	6	like	like	ADJ
aisthesis-5428	223	7	family	family	NOUN
aisthesis-5428	223	8	members	member	NOUN
aisthesis-5428	223	9	in	in	ADP
aisthesis-5428	223	10	tumor	tumor	NOUN
aisthesis-5428	223	11	development	development	NOUN
aisthesis-5428	223	12	.	.	PUNCT
aisthesis-5428	223	13	 	 	SPACE
aisthesis-5428	224	1	frontiers	frontier	NOUN
aisthesis-5428	224	2	in	in	ADP
aisthesis-5428	224	3	oncology	oncology	NOUN
aisthesis-5428	224	4	.	.	PUNCT
aisthesis-5428	224	5	 	 	SPACE
aisthesis-5428	225	1	10:1266	10:1266	NOUN
aisthesis-5428	225	2	.	.	PUNCT
aisthesis-5428	225	3	  	  	SPACE
aisthesis-5428	225	4	62	62	NUM
aisthesis-5428	225	5	analysis	analysis	NOUN
aisthesis-5428	225	6	of	of	ADP
aisthesis-5428	225	7	novel	novel	ADJ
aisthesis-5428	225	8	unknown	unknown	ADJ
aisthesis-5428	225	9	d.	d.	NOUN
aisthesis-5428	225	10	melanogaster	melanogaster	NOUN
aisthesis-5428	225	11	mutation	mutation	NOUN
aisthesis-5428	225	12	trex	trex	PROPN
aisthesis-5428	225	13	aisthesis	aisthesis	NOUN
aisthesis-5428	225	14	volume	volume	NOUN
aisthesis-5428	225	15	14	14	NUM
aisthesis-5428	225	16	,	,	PUNCT
aisthesis-5428	225	17	2023	2023	NUM
aisthesis-5428	225	18	figures	figure	NOUN
aisthesis-5428	225	19	and	and	CCONJ
aisthesis-5428	225	20	tables	table	NOUN
aisthesis-5428	225	21	figure	figure	VERB
aisthesis-5428	225	22	1	1	NUM
aisthesis-5428	225	23	.	.	PUNCT
aisthesis-5428	225	24	dorsal	dorsal	ADJ
aisthesis-5428	225	25	comparison	comparison	NOUN
aisthesis-5428	225	26	of	of	ADP
aisthesis-5428	225	27	female	female	ADJ
aisthesis-5428	225	28	drosophila	drosophila	NOUN
aisthesis-5428	225	29	melanogaster	melanogaster	NOUN
aisthesis-5428	225	30	wing	wing	NOUN
aisthesis-5428	225	31	morphology	morphology	NOUN
aisthesis-5428	225	32	in	in	ADP
aisthesis-5428	225	33	wild	wild	ADJ
aisthesis-5428	225	34	-	-	PUNCT
aisthesis-5428	225	35	type	type	NOUN
aisthesis-5428	225	36	and	and	CCONJ
aisthesis-5428	225	37	trex	trex	NOUN
aisthesis-5428	225	38	mutant	mutant	NOUN
aisthesis-5428	225	39	.	.	PUNCT
aisthesis-5428	226	1	[	[	X
aisthesis-5428	226	2	a	a	X
aisthesis-5428	226	3	]	]	PUNCT
aisthesis-5428	226	4	depicts	depict	VERB
aisthesis-5428	226	5	a	a	DET
aisthesis-5428	226	6	female	female	ADJ
aisthesis-5428	226	7	fly	fly	NOUN
aisthesis-5428	226	8	with	with	ADP
aisthesis-5428	226	9	a	a	DET
aisthesis-5428	226	10	wild	wild	ADJ
aisthesis-5428	226	11	-	-	PUNCT
aisthesis-5428	226	12	type	type	NOUN
aisthesis-5428	226	13	phenotype	phenotype	NOUN
aisthesis-5428	226	14	of	of	ADP
aisthesis-5428	226	15	wings	wing	NOUN
aisthesis-5428	226	16	of	of	ADP
aisthesis-5428	226	17	normal	normal	ADJ
aisthesis-5428	226	18	size	size	NOUN
aisthesis-5428	226	19	and	and	CCONJ
aisthesis-5428	226	20	shape	shape	NOUN
aisthesis-5428	226	21	,	,	PUNCT
aisthesis-5428	226	22	flat	flat	ADJ
aisthesis-5428	226	23	in	in	ADP
aisthesis-5428	226	24	appearance	appearance	NOUN
aisthesis-5428	226	25	,	,	PUNCT
aisthesis-5428	226	26	allowing	allow	VERB
aisthesis-5428	226	27	view	view	NOUN
aisthesis-5428	226	28	of	of	ADP
aisthesis-5428	226	29	vein	vein	ADJ
aisthesis-5428	226	30	arrangement	arrangement	NOUN
aisthesis-5428	226	31	and	and	CCONJ
aisthesis-5428	226	32	running	run	VERB
aisthesis-5428	226	33	parallel	parallel	NOUN
aisthesis-5428	226	34	to	to	ADP
aisthesis-5428	226	35	the	the	DET
aisthesis-5428	226	36	anteroposterior	anteroposterior	ADJ
aisthesis-5428	226	37	axis	axis	NOUN
aisthesis-5428	226	38	of	of	ADP
aisthesis-5428	226	39	the	the	DET
aisthesis-5428	226	40	fly	fly	NOUN
aisthesis-5428	226	41	.	.	PUNCT
aisthesis-5428	227	1	wings	wing	NOUN
aisthesis-5428	227	2	appear	appear	VERB
aisthesis-5428	227	3	to	to	PART
aisthesis-5428	227	4	lie	lie	VERB
aisthesis-5428	227	5	mostly	mostly	ADV
aisthesis-5428	227	6	flat	flat	ADJ
aisthesis-5428	227	7	along	along	ADP
aisthesis-5428	227	8	the	the	DET
aisthesis-5428	227	9	dorsal	dorsal	NOUN
aisthesis-5428	227	10	side	side	NOUN
aisthesis-5428	227	11	of	of	ADP
aisthesis-5428	227	12	the	the	DET
aisthesis-5428	227	13	abdomen	abdomen	NOUN
aisthesis-5428	227	14	of	of	ADP
aisthesis-5428	227	15	the	the	DET
aisthesis-5428	227	16	fly	fly	NOUN
aisthesis-5428	227	17	.	.	PUNCT
aisthesis-5428	228	1	[	[	X
aisthesis-5428	228	2	b	b	X
aisthesis-5428	228	3	]	]	X
aisthesis-5428	228	4	depicts	depict	VERB
aisthesis-5428	228	5	a	a	DET
aisthesis-5428	228	6	trex	trex	ADJ
aisthesis-5428	228	7	mutant	mutant	ADJ
aisthesis-5428	228	8	female	female	ADJ
aisthesis-5428	228	9	fly	fly	NOUN
aisthesis-5428	228	10	displaying	display	VERB
aisthesis-5428	228	11	wings	wing	NOUN
aisthesis-5428	228	12	that	that	PRON
aisthesis-5428	228	13	protrude	protrude	VERB
aisthesis-5428	228	14	perpendicular	perpendicular	NOUN
aisthesis-5428	228	15	to	to	ADP
aisthesis-5428	228	16	the	the	DET
aisthesis-5428	228	17	anteroposterior	anteroposterior	ADJ
aisthesis-5428	228	18	axis	axis	NOUN
aisthesis-5428	228	19	of	of	ADP
aisthesis-5428	228	20	the	the	DET
aisthesis-5428	228	21	fly	fly	NOUN
aisthesis-5428	228	22	.	.	PUNCT
aisthesis-5428	229	1	wings	wing	NOUN
aisthesis-5428	229	2	are	be	AUX
aisthesis-5428	229	3	shorter	short	ADJ
aisthesis-5428	229	4	and	and	CCONJ
aisthesis-5428	229	5	crumpled	crumple	VERB
aisthesis-5428	229	6	in	in	ADP
aisthesis-5428	229	7	appearance	appearance	NOUN
aisthesis-5428	229	8	,	,	PUNCT
aisthesis-5428	229	9	so	so	SCONJ
aisthesis-5428	229	10	that	that	PRON
aisthesis-5428	229	11	wing	wing	NOUN
aisthesis-5428	229	12	veins	vein	NOUN
aisthesis-5428	229	13	are	be	AUX
aisthesis-5428	229	14	not	not	PART
aisthesis-5428	229	15	easily	easily	ADV
aisthesis-5428	229	16	discernible	discernible	ADJ
aisthesis-5428	229	17	.	.	PUNCT
aisthesis-5428	230	1	table	table	NOUN
aisthesis-5428	230	2	1	1	NUM
aisthesis-5428	230	3	.	.	PUNCT
aisthesis-5428	230	4	wtm1	wtm1	PROPN
aisthesis-5428	230	5	cross	cross	VERB
aisthesis-5428	230	6	phenotype	phenotype	NOUN
aisthesis-5428	230	7	scoring	scoring	NOUN
aisthesis-5428	230	8	.	.	PUNCT
aisthesis-5428	231	1	a	a	DET
aisthesis-5428	231	2	total	total	NOUN
aisthesis-5428	231	3	of	of	ADP
aisthesis-5428	231	4	307	307	NUM
aisthesis-5428	231	5	progeny	progeny	NOUN
aisthesis-5428	231	6	were	be	AUX
aisthesis-5428	231	7	scored	score	VERB
aisthesis-5428	231	8	,	,	PUNCT
aisthesis-5428	231	9	including	include	VERB
aisthesis-5428	231	10	163	163	NUM
aisthesis-5428	231	11	females	female	NOUN
aisthesis-5428	231	12	and	and	CCONJ
aisthesis-5428	231	13	144	144	NUM
aisthesis-5428	231	14	males	male	NOUN
aisthesis-5428	231	15	.	.	PUNCT
aisthesis-5428	232	1	all	all	DET
aisthesis-5428	232	2	progeny	progeny	NOUN
aisthesis-5428	232	3	displayed	display	VERB
aisthesis-5428	232	4	a	a	DET
aisthesis-5428	232	5	wild	wild	ADJ
aisthesis-5428	232	6	-	-	PUNCT
aisthesis-5428	232	7	type	type	NOUN
aisthesis-5428	232	8	phenotype	phenotype	NOUN
aisthesis-5428	232	9	,	,	PUNCT
aisthesis-5428	232	10	indicating	indicate	VERB
aisthesis-5428	232	11	a	a	DET
aisthesis-5428	232	12	recessive	recessive	ADJ
aisthesis-5428	232	13	inheritance	inheritance	NOUN
aisthesis-5428	232	14	pattern	pattern	NOUN
aisthesis-5428	232	15	of	of	ADP
aisthesis-5428	232	16	the	the	DET
aisthesis-5428	232	17	trex	trex	PROPN
aisthesis-5428	232	18	mutation	mutation	NOUN
aisthesis-5428	232	19	.	.	PUNCT
aisthesis-5428	233	1	table	table	NOUN
aisthesis-5428	233	2	2	2	NUM
aisthesis-5428	233	3	.	.	X
aisthesis-5428	233	4	virtual	virtual	ADJ
aisthesis-5428	233	5	wtm1	wtm1	PROPN
aisthesis-5428	233	6	cross	cross	VERB
aisthesis-5428	233	7	phenotype	phenotype	NOUN
aisthesis-5428	233	8	scoring	scoring	NOUN
aisthesis-5428	233	9	.	.	PUNCT
aisthesis-5428	234	1	a	a	DET
aisthesis-5428	234	2	total	total	NOUN
aisthesis-5428	234	3	of	of	ADP
aisthesis-5428	234	4	3,020	3,020	NUM
aisthesis-5428	234	5	progeny	progeny	NOUN
aisthesis-5428	234	6	were	be	AUX
aisthesis-5428	234	7	scored	score	VERB
aisthesis-5428	234	8	,	,	PUNCT
aisthesis-5428	234	9	including	include	VERB
aisthesis-5428	234	10	1,506	1,506	NUM
aisthesis-5428	234	11	female	female	ADJ
aisthesis-5428	234	12	and	and	CCONJ
aisthesis-5428	234	13	1,514	1,514	NUM
aisthesis-5428	234	14	male	male	ADJ
aisthesis-5428	234	15	progenies	progeny	NOUN
aisthesis-5428	234	16	.	.	PUNCT
aisthesis-5428	235	1	all	all	DET
aisthesis-5428	235	2	progeny	progeny	NOUN
aisthesis-5428	235	3	displayed	display	VERB
aisthesis-5428	235	4	a	a	DET
aisthesis-5428	235	5	wild	wild	ADJ
aisthesis-5428	235	6	-	-	PUNCT
aisthesis-5428	235	7	type	type	NOUN
aisthesis-5428	235	8	phenotypic	phenotypic	ADJ
aisthesis-5428	235	9	presentation	presentation	NOUN
aisthesis-5428	235	10	,	,	PUNCT
aisthesis-5428	235	11	indicating	indicate	VERB
aisthesis-5428	235	12	a	a	DET
aisthesis-5428	235	13	recessive	recessive	ADJ
aisthesis-5428	235	14	pattern	pattern	NOUN
aisthesis-5428	235	15	of	of	ADP
aisthesis-5428	235	16	inheritance	inheritance	NOUN
aisthesis-5428	235	17	of	of	ADP
aisthesis-5428	235	18	trex	trex	PROPN
aisthesis-5428	235	19	in	in	ADP
aisthesis-5428	235	20	agreement	agreement	NOUN
aisthesis-5428	235	21	with	with	ADP
aisthesis-5428	235	22	the	the	DET
aisthesis-5428	235	23	actual	actual	ADJ
aisthesis-5428	235	24	wtm1	wtm1	PROPN
aisthesis-5428	235	25	cross	cross	PROPN
aisthesis-5428	235	26	displayed	display	VERB
aisthesis-5428	235	27	in	in	ADP
aisthesis-5428	235	28	table	table	NOUN
aisthesis-5428	235	29	1	1	NUM
aisthesis-5428	235	30	.	.	PUNCT
aisthesis-5428	235	31	figure	figure	NOUN
aisthesis-5428	235	32	2	2	NUM
aisthesis-5428	235	33	.	.	PUNCT
aisthesis-5428	235	34	chromosome	chromosome	NOUN
aisthesis-5428	235	35	map	map	NOUN
aisthesis-5428	235	36	of	of	ADP
aisthesis-5428	235	37	wild	wild	ADJ
aisthesis-5428	235	38	type	type	NOUN
aisthesis-5428	235	39	marker	marker	NOUN
aisthesis-5428	235	40	cross	cross	NOUN
aisthesis-5428	235	41	1	1	NUM
aisthesis-5428	235	42	(	(	PUNCT
aisthesis-5428	235	43	wtm1	wtm1	PROPN
aisthesis-5428	235	44	)	)	PUNCT
aisthesis-5428	235	45	.	.	PUNCT
aisthesis-5428	236	1	the	the	DET
aisthesis-5428	236	2	female	female	ADJ
aisthesis-5428	236	3	parental	parental	ADJ
aisthesis-5428	236	4	fly	fly	NOUN
aisthesis-5428	236	5	displays	display	VERB
aisthesis-5428	236	6	a	a	DET
aisthesis-5428	236	7	homozygous	homozygous	ADJ
aisthesis-5428	236	8	genotype	genotype	NOUN
aisthesis-5428	236	9	for	for	ADP
aisthesis-5428	236	10	the	the	DET
aisthesis-5428	236	11	wild	wild	ADJ
aisthesis-5428	236	12	-	-	PUNCT
aisthesis-5428	236	13	type	type	NOUN
aisthesis-5428	236	14	genotype	genotype	NOUN
aisthesis-5428	236	15	,	,	PUNCT
aisthesis-5428	236	16	while	while	SCONJ
aisthesis-5428	236	17	the	the	DET
aisthesis-5428	236	18	male	male	ADJ
aisthesis-5428	236	19	parental	parental	ADJ
aisthesis-5428	236	20	fly	fly	NOUN
aisthesis-5428	236	21	shows	show	VERB
aisthesis-5428	236	22	a	a	DET
aisthesis-5428	236	23	homozygous	homozygous	ADJ
aisthesis-5428	236	24	genotype	genotype	NOUN
aisthesis-5428	236	25	for	for	ADP
aisthesis-5428	236	26	the	the	DET
aisthesis-5428	236	27	trex	trex	PROPN
aisthesis-5428	236	28	genotype	genotype	NOUN
aisthesis-5428	236	29	.	.	PUNCT
aisthesis-5428	237	1	when	when	SCONJ
aisthesis-5428	237	2	crossed	cross	VERB
aisthesis-5428	237	3	,	,	PUNCT
aisthesis-5428	237	4	all	all	DET
aisthesis-5428	237	5	progenies	progeny	NOUN
aisthesis-5428	237	6	display	display	VERB
aisthesis-5428	237	7	a	a	DET
aisthesis-5428	237	8	wild	wild	ADJ
aisthesis-5428	237	9	-	-	PUNCT
aisthesis-5428	237	10	type	type	NOUN
aisthesis-5428	237	11	phenotype	phenotype	NOUN
aisthesis-5428	237	12	,	,	PUNCT
aisthesis-5428	237	13	though	though	SCONJ
aisthesis-5428	237	14	progeny	progeny	NOUN
aisthesis-5428	237	15	have	have	AUX
aisthesis-5428	237	16	inherited	inherit	VERB
aisthesis-5428	237	17	one	one	NUM
aisthesis-5428	237	18	trex	trex	NOUN
aisthesis-5428	237	19	allele	allele	NOUN
aisthesis-5428	237	20	from	from	ADP
aisthesis-5428	237	21	the	the	DET
aisthesis-5428	237	22	male	male	ADJ
aisthesis-5428	237	23	parental	parental	ADJ
aisthesis-5428	237	24	genome	genome	NOUN
aisthesis-5428	237	25	.	.	PUNCT
aisthesis-5428	238	1	as	as	ADP
aisthesis-5428	238	2	such	such	ADJ
aisthesis-5428	238	3	,	,	PUNCT
aisthesis-5428	238	4	it	it	PRON
aisthesis-5428	238	5	can	can	AUX
aisthesis-5428	238	6	be	be	AUX
aisthesis-5428	238	7	concluded	conclude	VERB
aisthesis-5428	238	8	that	that	SCONJ
aisthesis-5428	238	9	trex	trex	PROPN
aisthesis-5428	238	10	is	be	AUX
aisthesis-5428	238	11	recessive	recessive	ADJ
aisthesis-5428	238	12	to	to	ADP
aisthesis-5428	238	13	the	the	DET
aisthesis-5428	238	14	wild	wild	ADJ
aisthesis-5428	238	15	-	-	PUNCT
aisthesis-5428	238	16	type	type	NOUN
aisthesis-5428	238	17	phenotype	phenotype	NOUN
aisthesis-5428	238	18	.	.	PUNCT
aisthesis-5428	239	1	table	table	NOUN
aisthesis-5428	239	2	3	3	NUM
aisthesis-5428	239	3	.	.	X
aisthesis-5428	240	1	wtm2	wtm2	NOUN
aisthesis-5428	240	2	cross	cross	NOUN
aisthesis-5428	240	3	phenotype	phenotype	NOUN
aisthesis-5428	240	4	scoring	scoring	NOUN
aisthesis-5428	240	5	.	.	PUNCT
aisthesis-5428	241	1	a	a	DET
aisthesis-5428	241	2	total	total	NOUN
aisthesis-5428	241	3	of	of	ADP
aisthesis-5428	241	4	350	350	NUM
aisthesis-5428	241	5	progeny	progeny	NOUN
aisthesis-5428	241	6	were	be	AUX
aisthesis-5428	241	7	scored	score	VERB
aisthesis-5428	241	8	,	,	PUNCT
aisthesis-5428	241	9	of	of	ADP
aisthesis-5428	241	10	which	which	PRON
aisthesis-5428	241	11	183	183	NUM
aisthesis-5428	241	12	were	be	AUX
aisthesis-5428	241	13	female	female	ADJ
aisthesis-5428	241	14	and	and	CCONJ
aisthesis-5428	241	15	167	167	NUM
aisthesis-5428	241	16	were	be	AUX
aisthesis-5428	241	17	male	male	ADJ
aisthesis-5428	241	18	.	.	PUNCT
aisthesis-5428	242	1	all	all	DET
aisthesis-5428	242	2	progenies	progeny	NOUN
aisthesis-5428	242	3	were	be	AUX
aisthesis-5428	242	4	of	of	ADP
aisthesis-5428	242	5	the	the	DET
aisthesis-5428	242	6	wild	wild	ADJ
aisthesis-5428	242	7	-	-	PUNCT
aisthesis-5428	242	8	type	type	NOUN
aisthesis-5428	242	9	class	class	NOUN
aisthesis-5428	242	10	,	,	PUNCT
aisthesis-5428	242	11	including	include	VERB
aisthesis-5428	242	12	all	all	DET
aisthesis-5428	242	13	male	male	ADJ
aisthesis-5428	242	14	offspring	offspring	NOUN
aisthesis-5428	242	15	,	,	PUNCT
aisthesis-5428	242	16	indicated	indicate	VERB
aisthesis-5428	242	17	an	an	DET
aisthesis-5428	242	18	autosomal	autosomal	ADJ
aisthesis-5428	242	19	inheritance	inheritance	NOUN
aisthesis-5428	242	20	pattern	pattern	NOUN
aisthesis-5428	242	21	of	of	ADP
aisthesis-5428	242	22	the	the	DET
aisthesis-5428	242	23	trex	trex	PROPN
aisthesis-5428	242	24	mutation	mutation	NOUN
aisthesis-5428	242	25	.	.	PUNCT
aisthesis-5428	243	1	63	63	NUM
aisthesis-5428	243	2	analysis	analysis	NOUN
aisthesis-5428	243	3	of	of	ADP
aisthesis-5428	243	4	novel	novel	ADJ
aisthesis-5428	243	5	unknown	unknown	ADJ
aisthesis-5428	243	6	d.	d.	NOUN
aisthesis-5428	243	7	melanogaster	melanogaster	NOUN
aisthesis-5428	243	8	mutation	mutation	NOUN
aisthesis-5428	243	9	trex	trex	PROPN
aisthesis-5428	243	10	aisthesis	aisthesis	NOUN
aisthesis-5428	243	11	volume	volume	NOUN
aisthesis-5428	243	12	14	14	NUM
aisthesis-5428	243	13	,	,	PUNCT
aisthesis-5428	243	14	2023	2023	NUM
aisthesis-5428	243	15	table	table	NOUN
aisthesis-5428	243	16	4	4	NUM
aisthesis-5428	243	17	.	.	X
aisthesis-5428	243	18	virtual	virtual	ADJ
aisthesis-5428	243	19	wtm2	wtm2	NOUN
aisthesis-5428	243	20	cross	cross	NOUN
aisthesis-5428	243	21	phenotype	phenotype	NOUN
aisthesis-5428	243	22	scoring	scoring	NOUN
aisthesis-5428	243	23	.	.	PUNCT
aisthesis-5428	244	1	a	a	DET
aisthesis-5428	244	2	total	total	NOUN
aisthesis-5428	244	3	of	of	ADP
aisthesis-5428	244	4	2,973	2,973	NUM
aisthesis-5428	244	5	progeny	progeny	NOUN
aisthesis-5428	244	6	were	be	AUX
aisthesis-5428	244	7	scored	score	VERB
aisthesis-5428	244	8	,	,	PUNCT
aisthesis-5428	244	9	including	include	VERB
aisthesis-5428	244	10	1,484	1,484	NUM
aisthesis-5428	244	11	female	female	ADJ
aisthesis-5428	244	12	and	and	CCONJ
aisthesis-5428	244	13	1,489	1,489	NUM
aisthesis-5428	244	14	male	male	ADJ
aisthesis-5428	244	15	progenies	progeny	NOUN
aisthesis-5428	244	16	.	.	PUNCT
aisthesis-5428	245	1	all	all	DET
aisthesis-5428	245	2	progeny	progeny	NOUN
aisthesis-5428	245	3	displayed	display	VERB
aisthesis-5428	245	4	a	a	DET
aisthesis-5428	245	5	wild	wild	ADJ
aisthesis-5428	245	6	-	-	PUNCT
aisthesis-5428	245	7	type	type	NOUN
aisthesis-5428	245	8	phenotypic	phenotypic	ADJ
aisthesis-5428	245	9	presentation	presentation	NOUN
aisthesis-5428	245	10	,	,	PUNCT
aisthesis-5428	245	11	indicating	indicate	VERB
aisthesis-5428	245	12	a	a	DET
aisthesis-5428	245	13	recessive	recessive	ADJ
aisthesis-5428	245	14	pattern	pattern	NOUN
aisthesis-5428	245	15	of	of	ADP
aisthesis-5428	245	16	inheritance	inheritance	NOUN
aisthesis-5428	245	17	of	of	ADP
aisthesis-5428	245	18	trex	trex	PROPN
aisthesis-5428	245	19	in	in	ADP
aisthesis-5428	245	20	agreement	agreement	NOUN
aisthesis-5428	245	21	with	with	ADP
aisthesis-5428	245	22	the	the	DET
aisthesis-5428	245	23	actual	actual	ADJ
aisthesis-5428	245	24	wtm2	wtm2	NOUN
aisthesis-5428	245	25	cross	cross	NOUN
aisthesis-5428	245	26	displayed	display	VERB
aisthesis-5428	245	27	in	in	ADP
aisthesis-5428	245	28	table	table	NOUN
aisthesis-5428	245	29	3	3	NUM
aisthesis-5428	245	30	.	.	PUNCT
aisthesis-5428	245	31	figure	figure	NOUN
aisthesis-5428	245	32	3	3	NUM
aisthesis-5428	245	33	.	.	PUNCT
aisthesis-5428	245	34	chromosome	chromosome	NOUN
aisthesis-5428	245	35	map	map	NOUN
aisthesis-5428	245	36	of	of	ADP
aisthesis-5428	245	37	wild	wild	ADJ
aisthesis-5428	245	38	type	type	NOUN
aisthesis-5428	245	39	marker	marker	NOUN
aisthesis-5428	245	40	cross	cross	NOUN
aisthesis-5428	245	41	2	2	NUM
aisthesis-5428	245	42	(	(	PUNCT
aisthesis-5428	245	43	wtm2	wtm2	NOUN
aisthesis-5428	245	44	)	)	PUNCT
aisthesis-5428	245	45	.	.	PUNCT
aisthesis-5428	246	1	the	the	DET
aisthesis-5428	246	2	female	female	ADJ
aisthesis-5428	246	3	parental	parental	ADJ
aisthesis-5428	246	4	fly	fly	NOUN
aisthesis-5428	246	5	displays	display	VERB
aisthesis-5428	246	6	a	a	DET
aisthesis-5428	246	7	homozygous	homozygous	ADJ
aisthesis-5428	246	8	genotype	genotype	NOUN
aisthesis-5428	246	9	for	for	ADP
aisthesis-5428	246	10	the	the	DET
aisthesis-5428	246	11	trex	trex	PROPN
aisthesis-5428	246	12	genotype	genotype	NOUN
aisthesis-5428	246	13	while	while	SCONJ
aisthesis-5428	246	14	the	the	DET
aisthesis-5428	246	15	male	male	ADJ
aisthesis-5428	246	16	parental	parental	ADJ
aisthesis-5428	246	17	fly	fly	NOUN
aisthesis-5428	246	18	shows	show	VERB
aisthesis-5428	246	19	a	a	DET
aisthesis-5428	246	20	homozygous	homozygous	ADJ
aisthesis-5428	246	21	genotype	genotype	NOUN
aisthesis-5428	246	22	for	for	ADP
aisthesis-5428	246	23	the	the	DET
aisthesis-5428	246	24	wild	wild	ADJ
aisthesis-5428	246	25	-	-	PUNCT
aisthesis-5428	246	26	type	type	NOUN
aisthesis-5428	246	27	genotype	genotype	NOUN
aisthesis-5428	246	28	.	.	PUNCT
aisthesis-5428	247	1	when	when	SCONJ
aisthesis-5428	247	2	crossed	cross	VERB
aisthesis-5428	247	3	,	,	PUNCT
aisthesis-5428	247	4	all	all	DET
aisthesis-5428	247	5	progenies	progeny	NOUN
aisthesis-5428	247	6	display	display	VERB
aisthesis-5428	247	7	a	a	DET
aisthesis-5428	247	8	wildtype	wildtype	NOUN
aisthesis-5428	247	9	phenotype	phenotype	NOUN
aisthesis-5428	247	10	,	,	PUNCT
aisthesis-5428	247	11	though	though	SCONJ
aisthesis-5428	247	12	progeny	progeny	NOUN
aisthesis-5428	247	13	have	have	AUX
aisthesis-5428	247	14	inherited	inherit	VERB
aisthesis-5428	247	15	one	one	NUM
aisthesis-5428	247	16	trex	trex	NOUN
aisthesis-5428	247	17	allele	allele	NOUN
aisthesis-5428	247	18	from	from	ADP
aisthesis-5428	247	19	the	the	DET
aisthesis-5428	247	20	female	female	ADJ
aisthesis-5428	247	21	parental	parental	ADJ
aisthesis-5428	247	22	genome	genome	NOUN
aisthesis-5428	247	23	.	.	PUNCT
aisthesis-5428	248	1	as	as	ADP
aisthesis-5428	248	2	such	such	ADJ
aisthesis-5428	248	3	,	,	PUNCT
aisthesis-5428	248	4	it	it	PRON
aisthesis-5428	248	5	can	can	AUX
aisthesis-5428	248	6	be	be	AUX
aisthesis-5428	248	7	concluded	conclude	VERB
aisthesis-5428	248	8	that	that	SCONJ
aisthesis-5428	248	9	trex	trex	PROPN
aisthesis-5428	248	10	is	be	AUX
aisthesis-5428	248	11	inherited	inherit	VERB
aisthesis-5428	248	12	in	in	ADP
aisthesis-5428	248	13	autosomal	autosomal	ADJ
aisthesis-5428	248	14	fashion	fashion	NOUN
aisthesis-5428	248	15	.	.	PUNCT
aisthesis-5428	249	1	if	if	SCONJ
aisthesis-5428	249	2	trex	trex	PROPN
aisthesis-5428	249	3	was	be	AUX
aisthesis-5428	249	4	a	a	DET
aisthesis-5428	249	5	sex	sex	NOUN
aisthesis-5428	249	6	-	-	PUNCT
aisthesis-5428	249	7	linked	link	VERB
aisthesis-5428	249	8	mutation	mutation	NOUN
aisthesis-5428	249	9	,	,	PUNCT
aisthesis-5428	249	10	all	all	DET
aisthesis-5428	249	11	male	male	ADJ
aisthesis-5428	249	12	progeny	progeny	NOUN
aisthesis-5428	249	13	would	would	AUX
aisthesis-5428	249	14	display	display	VERB
aisthesis-5428	249	15	a	a	DET
aisthesis-5428	249	16	trex	trex	ADJ
aisthesis-5428	249	17	phenotype	phenotype	NOUN
aisthesis-5428	249	18	,	,	PUNCT
aisthesis-5428	249	19	as	as	SCONJ
aisthesis-5428	249	20	they	they	PRON
aisthesis-5428	249	21	would	would	AUX
aisthesis-5428	249	22	all	all	ADV
aisthesis-5428	249	23	carry	carry	VERB
aisthesis-5428	249	24	the	the	DET
aisthesis-5428	249	25	trex	trex	ADJ
aisthesis-5428	249	26	gene	gene	NOUN
aisthesis-5428	249	27	on	on	ADP
aisthesis-5428	249	28	their	their	PRON
aisthesis-5428	249	29	only	only	ADJ
aisthesis-5428	249	30	x	x	SYM
aisthesis-5428	249	31	chromosome	chromosome	NOUN
aisthesis-5428	249	32	inherited	inherit	VERB
aisthesis-5428	249	33	from	from	ADP
aisthesis-5428	249	34	the	the	DET
aisthesis-5428	249	35	female	female	ADJ
aisthesis-5428	249	36	parental	parental	ADJ
aisthesis-5428	249	37	fly	fly	NOUN
aisthesis-5428	249	38	.	.	PUNCT
aisthesis-5428	249	39	table	table	NOUN
aisthesis-5428	249	40	5	5	NUM
aisthesis-5428	249	41	.	.	PUNCT
aisthesis-5428	250	1	mapping	mapping	NOUN
aisthesis-5428	250	2	cross	cross	VERB
aisthesis-5428	250	3	a	a	DET
aisthesis-5428	250	4	phenotypic	phenotypic	ADJ
aisthesis-5428	250	5	classes	class	NOUN
aisthesis-5428	250	6	.	.	PUNCT
aisthesis-5428	251	1	a	a	DET
aisthesis-5428	251	2	total	total	NOUN
aisthesis-5428	251	3	of	of	ADP
aisthesis-5428	251	4	2,902	2,902	NUM
aisthesis-5428	251	5	progeny	progeny	NOUN
aisthesis-5428	251	6	were	be	AUX
aisthesis-5428	251	7	scored	score	VERB
aisthesis-5428	251	8	,	,	PUNCT
aisthesis-5428	251	9	2,144	2,144	NUM
aisthesis-5428	251	10	of	of	ADP
aisthesis-5428	251	11	which	which	PRON
aisthesis-5428	251	12	displayed	display	VERB
aisthesis-5428	251	13	a	a	DET
aisthesis-5428	251	14	parental	parental	ADJ
aisthesis-5428	251	15	phenotype	phenotype	NOUN
aisthesis-5428	251	16	(	(	PUNCT
aisthesis-5428	251	17	+	+	ADV
aisthesis-5428	251	18	/+	/+	X
aisthesis-5428	251	19	or	or	CCONJ
aisthesis-5428	251	20	bw	bw	NOUN
aisthesis-5428	251	21	/	/	SYM
aisthesis-5428	251	22	trex	trex	NOUN
aisthesis-5428	251	23	)	)	PUNCT
aisthesis-5428	251	24	and	and	CCONJ
aisthesis-5428	251	25	758	758	NUM
aisthesis-5428	251	26	of	of	ADP
aisthesis-5428	251	27	which	which	PRON
aisthesis-5428	251	28	displayed	display	VERB
aisthesis-5428	251	29	a	a	DET
aisthesis-5428	251	30	recombinant	recombinant	ADJ
aisthesis-5428	251	31	phenotype	phenotype	NOUN
aisthesis-5428	251	32	(	(	PUNCT
aisthesis-5428	251	33	bw/+	bw/+	PROPN
aisthesis-5428	251	34	or	or	CCONJ
aisthesis-5428	251	35	+	+	PROPN
aisthesis-5428	251	36	/trex	/trex	NOUN
aisthesis-5428	251	37	)	)	PUNCT
aisthesis-5428	251	38	,	,	PUNCT
aisthesis-5428	251	39	giving	give	VERB
aisthesis-5428	251	40	a	a	DET
aisthesis-5428	251	41	recombination	recombination	NOUN
aisthesis-5428	251	42	frequency	frequency	NOUN
aisthesis-5428	251	43	of	of	ADP
aisthesis-5428	251	44	26.1	26.1	NUM
aisthesis-5428	251	45	%	%	NOUN
aisthesis-5428	251	46	.	.	PUNCT
aisthesis-5428	252	1	table	table	NOUN
aisthesis-5428	252	2	6	6	NUM
aisthesis-5428	252	3	.	.	PUNCT
aisthesis-5428	253	1	mapping	mapping	NOUN
aisthesis-5428	253	2	cross	cross	VERB
aisthesis-5428	253	3	a	a	DET
aisthesis-5428	253	4	chi	chi	ADJ
aisthesis-5428	253	5	-	-	PUNCT
aisthesis-5428	253	6	square	square	NOUN
aisthesis-5428	253	7	analysis	analysis	NOUN
aisthesis-5428	253	8	.	.	PUNCT
aisthesis-5428	254	1	due	due	ADP
aisthesis-5428	254	2	to	to	ADP
aisthesis-5428	254	3	the	the	DET
aisthesis-5428	254	4	null	null	ADJ
aisthesis-5428	254	5	hypothesis	hypothesis	NOUN
aisthesis-5428	254	6	that	that	PRON
aisthesis-5428	254	7	trex	trex	PROPN
aisthesis-5428	254	8	and	and	CCONJ
aisthesis-5428	254	9	bw	bw	PROPN
aisthesis-5428	254	10	are	be	AUX
aisthesis-5428	254	11	not	not	PART
aisthesis-5428	254	12	genetically	genetically	ADV
aisthesis-5428	254	13	linked	link	VERB
aisthesis-5428	254	14	,	,	PUNCT
aisthesis-5428	254	15	a	a	DET
aisthesis-5428	254	16	1:1:1:1	1:1:1:1	NUM
aisthesis-5428	254	17	ratio	ratio	NOUN
aisthesis-5428	254	18	was	be	AUX
aisthesis-5428	254	19	utilized	utilize	VERB
aisthesis-5428	254	20	as	as	ADP
aisthesis-5428	254	21	the	the	DET
aisthesis-5428	254	22	expected	expect	VERB
aisthesis-5428	254	23	value	value	NOUN
aisthesis-5428	254	24	of	of	ADP
aisthesis-5428	254	25	progeny	progeny	NOUN
aisthesis-5428	254	26	.	.	PUNCT
aisthesis-5428	255	1	as	as	SCONJ
aisthesis-5428	255	2	such	such	ADJ
aisthesis-5428	255	3	,	,	PUNCT
aisthesis-5428	255	4	a	a	DET
aisthesis-5428	255	5	chi	chi	ADJ
aisthesis-5428	255	6	-	-	PUNCT
aisthesis-5428	255	7	square	square	ADJ
aisthesis-5428	255	8	value	value	NOUN
aisthesis-5428	255	9	of	of	ADP
aisthesis-5428	255	10	663.6	663.6	NUM
aisthesis-5428	255	11	was	be	AUX
aisthesis-5428	255	12	calculated	calculate	VERB
aisthesis-5428	255	13	with	with	ADP
aisthesis-5428	255	14	the	the	DET
aisthesis-5428	255	15	formula	formula	NOUN
aisthesis-5428	255	16	with	with	ADP
aisthesis-5428	255	17	3	3	NUM
aisthesis-5428	255	18	degrees	degree	NOUN
aisthesis-5428	255	19	of	of	ADP
aisthesis-5428	255	20	freedom	freedom	NOUN
aisthesis-5428	255	21	,	,	PUNCT
aisthesis-5428	255	22	this	this	DET
aisthesis-5428	255	23	chi	chi	ADJ
aisthesis-5428	255	24	-	-	PUNCT
aisthesis-5428	255	25	square	square	ADJ
aisthesis-5428	255	26	value	value	NOUN
aisthesis-5428	255	27	coincides	coincide	VERB
aisthesis-5428	255	28	with	with	ADP
aisthesis-5428	255	29	a	a	DET
aisthesis-5428	255	30	p	p	NOUN
aisthesis-5428	255	31	-	-	PUNCT
aisthesis-5428	255	32	value	value	NOUN
aisthesis-5428	255	33	of	of	ADP
aisthesis-5428	255	34	less	less	ADJ
aisthesis-5428	255	35	than	than	ADP
aisthesis-5428	255	36	2.2e-16	2.2e-16	PROPN
aisthesis-5428	255	37	and	and	CCONJ
aisthesis-5428	255	38	thus	thus	ADV
aisthesis-5428	255	39	the	the	DET
aisthesis-5428	255	40	null	null	ADJ
aisthesis-5428	255	41	hypothesis	hypothesis	NOUN
aisthesis-5428	255	42	is	be	AUX
aisthesis-5428	255	43	rejected	reject	VERB
aisthesis-5428	255	44	.	.	PUNCT
aisthesis-5428	256	1	table	table	NOUN
aisthesis-5428	256	2	7	7	NUM
aisthesis-5428	256	3	.	.	PUNCT
aisthesis-5428	257	1	mapping	map	VERB
aisthesis-5428	257	2	cross	cross	PROPN
aisthesis-5428	257	3	b	b	PROPN
aisthesis-5428	257	4	phenotypic	phenotypic	ADJ
aisthesis-5428	257	5	classes	class	NOUN
aisthesis-5428	257	6	.	.	PUNCT
aisthesis-5428	258	1	a	a	DET
aisthesis-5428	258	2	total	total	NOUN
aisthesis-5428	258	3	of	of	ADP
aisthesis-5428	258	4	3,020	3,020	NUM
aisthesis-5428	258	5	progeny	progeny	NOUN
aisthesis-5428	258	6	were	be	AUX
aisthesis-5428	258	7	scored	score	VERB
aisthesis-5428	258	8	,	,	PUNCT
aisthesis-5428	258	9	2,590	2,590	NUM
aisthesis-5428	258	10	of	of	ADP
aisthesis-5428	258	11	which	which	PRON
aisthesis-5428	258	12	displayed	display	VERB
aisthesis-5428	258	13	a	a	DET
aisthesis-5428	258	14	parental	parental	ADJ
aisthesis-5428	258	15	phenotype	phenotype	NOUN
aisthesis-5428	258	16	(	(	PUNCT
aisthesis-5428	258	17	+	+	ADV
aisthesis-5428	258	18	/+	/+	X
aisthesis-5428	258	19	or	or	CCONJ
aisthesis-5428	258	20	trex	trex	PROPN
aisthesis-5428	258	21	/	/	SYM
aisthesis-5428	258	22	bl	bl	PROPN
aisthesis-5428	258	23	)	)	PUNCT
aisthesis-5428	258	24	and	and	CCONJ
aisthesis-5428	258	25	430	430	NUM
aisthesis-5428	258	26	of	of	ADP
aisthesis-5428	258	27	which	which	PRON
aisthesis-5428	258	28	displayed	display	VERB
aisthesis-5428	258	29	a	a	DET
aisthesis-5428	258	30	recombinant	recombinant	ADJ
aisthesis-5428	258	31	phenotype	phenotype	NOUN
aisthesis-5428	258	32	(	(	PUNCT
aisthesis-5428	258	33	trex/+	trex/+	X
aisthesis-5428	258	34	or	or	CCONJ
aisthesis-5428	258	35	+	+	NOUN
aisthesis-5428	258	36	/bl	/bl	NOUN
aisthesis-5428	258	37	)	)	PUNCT
aisthesis-5428	258	38	,	,	PUNCT
aisthesis-5428	258	39	giving	give	VERB
aisthesis-5428	258	40	a	a	DET
aisthesis-5428	258	41	recombination	recombination	NOUN
aisthesis-5428	258	42	frequency	frequency	NOUN
aisthesis-5428	258	43	of	of	ADP
aisthesis-5428	258	44	14.2	14.2	NUM
aisthesis-5428	258	45	%	%	NOUN
aisthesis-5428	258	46	.	.	PUNCT
aisthesis-5428	259	1	64	64	NUM
aisthesis-5428	259	2	analysis	analysis	NOUN
aisthesis-5428	259	3	of	of	ADP
aisthesis-5428	259	4	novel	novel	ADJ
aisthesis-5428	259	5	unknown	unknown	ADJ
aisthesis-5428	259	6	d.	d.	NOUN
aisthesis-5428	259	7	melanogaster	melanogaster	NOUN
aisthesis-5428	259	8	mutation	mutation	NOUN
aisthesis-5428	259	9	trex	trex	PROPN
aisthesis-5428	259	10	aisthesis	aisthesis	NOUN
aisthesis-5428	259	11	volume	volume	NOUN
aisthesis-5428	259	12	14	14	NUM
aisthesis-5428	259	13	,	,	PUNCT
aisthesis-5428	259	14	2023	2023	NUM
aisthesis-5428	259	15	table	table	NOUN
aisthesis-5428	259	16	8	8	NUM
aisthesis-5428	259	17	.	.	PUNCT
aisthesis-5428	260	1	mapping	mapping	NOUN
aisthesis-5428	260	2	cross	cross	PROPN
aisthesis-5428	260	3	b	b	PROPN
aisthesis-5428	260	4	chi	chi	ADJ
aisthesis-5428	260	5	-	-	PUNCT
aisthesis-5428	260	6	square	square	NOUN
aisthesis-5428	260	7	analysis	analysis	NOUN
aisthesis-5428	260	8	.	.	PUNCT
aisthesis-5428	261	1	due	due	ADP
aisthesis-5428	261	2	to	to	ADP
aisthesis-5428	261	3	the	the	DET
aisthesis-5428	261	4	null	null	ADJ
aisthesis-5428	261	5	hypothesis	hypothesis	NOUN
aisthesis-5428	261	6	that	that	PRON
aisthesis-5428	261	7	trex	trex	PROPN
aisthesis-5428	261	8	and	and	CCONJ
aisthesis-5428	261	9	bl	bl	PROPN
aisthesis-5428	261	10	are	be	AUX
aisthesis-5428	261	11	not	not	PART
aisthesis-5428	261	12	genetically	genetically	ADV
aisthesis-5428	261	13	linked	link	VERB
aisthesis-5428	261	14	,	,	PUNCT
aisthesis-5428	261	15	a	a	DET
aisthesis-5428	261	16	1:1:1:1	1:1:1:1	NUM
aisthesis-5428	261	17	ratio	ratio	NOUN
aisthesis-5428	261	18	was	be	AUX
aisthesis-5428	261	19	utilized	utilize	VERB
aisthesis-5428	261	20	as	as	ADP
aisthesis-5428	261	21	the	the	DET
aisthesis-5428	261	22	expected	expect	VERB
aisthesis-5428	261	23	value	value	NOUN
aisthesis-5428	261	24	of	of	ADP
aisthesis-5428	261	25	progeny	progeny	NOUN
aisthesis-5428	261	26	.	.	PUNCT
aisthesis-5428	262	1	as	as	SCONJ
aisthesis-5428	262	2	such	such	ADJ
aisthesis-5428	262	3	,	,	PUNCT
aisthesis-5428	262	4	a	a	DET
aisthesis-5428	262	5	chi	chi	ADJ
aisthesis-5428	262	6	-	-	PUNCT
aisthesis-5428	262	7	square	square	ADJ
aisthesis-5428	262	8	value	value	NOUN
aisthesis-5428	262	9	of	of	ADP
aisthesis-5428	262	10	1,545.3	1,545.3	NUM
aisthesis-5428	262	11	was	be	AUX
aisthesis-5428	262	12	calculated	calculate	VERB
aisthesis-5428	262	13	with	with	ADP
aisthesis-5428	262	14	the	the	DET
aisthesis-5428	262	15	formula	formula	NOUN
aisthesis-5428	262	16	with	with	ADP
aisthesis-5428	262	17	3	3	NUM
aisthesis-5428	262	18	degrees	degree	NOUN
aisthesis-5428	262	19	of	of	ADP
aisthesis-5428	262	20	freedom	freedom	NOUN
aisthesis-5428	262	21	,	,	PUNCT
aisthesis-5428	262	22	this	this	DET
aisthesis-5428	262	23	chi	chi	ADJ
aisthesis-5428	262	24	-	-	PUNCT
aisthesis-5428	262	25	square	square	ADJ
aisthesis-5428	262	26	value	value	NOUN
aisthesis-5428	262	27	coincides	coincide	VERB
aisthesis-5428	262	28	with	with	ADP
aisthesis-5428	262	29	a	a	DET
aisthesis-5428	262	30	p	p	NOUN
aisthesis-5428	262	31	-	-	PUNCT
aisthesis-5428	262	32	value	value	NOUN
aisthesis-5428	262	33	of	of	ADP
aisthesis-5428	262	34	less	less	ADJ
aisthesis-5428	262	35	than	than	ADP
aisthesis-5428	262	36	2.2e-16	2.2e-16	PROPN
aisthesis-5428	262	37	and	and	CCONJ
aisthesis-5428	262	38	thus	thus	ADV
aisthesis-5428	262	39	the	the	DET
aisthesis-5428	262	40	null	null	ADJ
aisthesis-5428	262	41	hypothesis	hypothesis	NOUN
aisthesis-5428	262	42	is	be	AUX
aisthesis-5428	262	43	rejected	reject	VERB
aisthesis-5428	262	44	.	.	PUNCT
aisthesis-5428	263	1	table	table	NOUN
aisthesis-5428	263	2	9	9	NUM
aisthesis-5428	263	3	.	.	PUNCT
aisthesis-5428	264	1	mapping	mapping	NOUN
aisthesis-5428	264	2	cross	cross	NOUN
aisthesis-5428	264	3	c	c	PROPN
aisthesis-5428	264	4	phenotypic	phenotypic	ADJ
aisthesis-5428	264	5	classes	class	NOUN
aisthesis-5428	264	6	.	.	PUNCT
aisthesis-5428	265	1	a	a	DET
aisthesis-5428	265	2	total	total	NOUN
aisthesis-5428	265	3	of	of	ADP
aisthesis-5428	265	4	3,024	3,024	NUM
aisthesis-5428	265	5	progeny	progeny	NOUN
aisthesis-5428	265	6	were	be	AUX
aisthesis-5428	265	7	scored	score	VERB
aisthesis-5428	265	8	,	,	PUNCT
aisthesis-5428	265	9	2,694	2,694	NUM
aisthesis-5428	265	10	of	of	ADP
aisthesis-5428	265	11	which	which	PRON
aisthesis-5428	265	12	displayed	display	VERB
aisthesis-5428	265	13	a	a	DET
aisthesis-5428	265	14	parental	parental	ADJ
aisthesis-5428	265	15	phenotype	phenotype	NOUN
aisthesis-5428	265	16	(	(	PUNCT
aisthesis-5428	265	17	+	+	ADV
aisthesis-5428	265	18	/+	/+	X
aisthesis-5428	265	19	or	or	CCONJ
aisthesis-5428	265	20	pr	pr	NOUN
aisthesis-5428	265	21	/	/	SYM
aisthesis-5428	265	22	trex	trex	NOUN
aisthesis-5428	265	23	)	)	PUNCT
aisthesis-5428	265	24	and	and	CCONJ
aisthesis-5428	265	25	330	330	NUM
aisthesis-5428	265	26	of	of	ADP
aisthesis-5428	265	27	which	which	PRON
aisthesis-5428	265	28	displayed	display	VERB
aisthesis-5428	265	29	a	a	DET
aisthesis-5428	265	30	recombinant	recombinant	ADJ
aisthesis-5428	265	31	phenotype	phenotype	NOUN
aisthesis-5428	265	32	(	(	PUNCT
aisthesis-5428	265	33	pr/+	pr/+	NOUN
aisthesis-5428	265	34	or	or	CCONJ
aisthesis-5428	265	35	+	+	NOUN
aisthesis-5428	265	36	/trex	/trex	ADJ
aisthesis-5428	265	37	)	)	PUNCT
aisthesis-5428	265	38	,	,	PUNCT
aisthesis-5428	265	39	giving	give	VERB
aisthesis-5428	265	40	a	a	DET
aisthesis-5428	265	41	recombination	recombination	NOUN
aisthesis-5428	265	42	frequency	frequency	NOUN
aisthesis-5428	265	43	of	of	ADP
aisthesis-5428	265	44	10.9	10.9	NUM
aisthesis-5428	265	45	%	%	NOUN
aisthesis-5428	265	46	.	.	PUNCT
aisthesis-5428	266	1	table	table	NOUN
aisthesis-5428	266	2	10	10	NUM
aisthesis-5428	266	3	.	.	PUNCT
aisthesis-5428	267	1	mapping	mapping	NOUN
aisthesis-5428	267	2	cross	cross	NOUN
aisthesis-5428	267	3	c	c	PROPN
aisthesis-5428	267	4	chi	chi	ADJ
aisthesis-5428	267	5	-	-	PUNCT
aisthesis-5428	267	6	square	square	NOUN
aisthesis-5428	267	7	analysis	analysis	NOUN
aisthesis-5428	267	8	.	.	PUNCT
aisthesis-5428	268	1	due	due	ADP
aisthesis-5428	268	2	to	to	ADP
aisthesis-5428	268	3	the	the	DET
aisthesis-5428	268	4	null	null	ADJ
aisthesis-5428	268	5	hypothesis	hypothesis	NOUN
aisthesis-5428	268	6	that	that	PRON
aisthesis-5428	268	7	trex	trex	PROPN
aisthesis-5428	268	8	and	and	CCONJ
aisthesis-5428	268	9	pr	pr	NOUN
aisthesis-5428	268	10	are	be	AUX
aisthesis-5428	268	11	not	not	PART
aisthesis-5428	268	12	genetically	genetically	ADV
aisthesis-5428	268	13	linked	link	VERB
aisthesis-5428	268	14	,	,	PUNCT
aisthesis-5428	268	15	a	a	DET
aisthesis-5428	268	16	1:1:1:1	1:1:1:1	NUM
aisthesis-5428	268	17	ratio	ratio	NOUN
aisthesis-5428	268	18	was	be	AUX
aisthesis-5428	268	19	utilized	utilize	VERB
aisthesis-5428	268	20	as	as	ADP
aisthesis-5428	268	21	the	the	DET
aisthesis-5428	268	22	expected	expect	VERB
aisthesis-5428	268	23	value	value	NOUN
aisthesis-5428	268	24	of	of	ADP
aisthesis-5428	268	25	progeny	progeny	NOUN
aisthesis-5428	268	26	.	.	PUNCT
aisthesis-5428	269	1	as	as	ADP
aisthesis-5428	269	2	such	such	ADJ
aisthesis-5428	269	3	,	,	PUNCT
aisthesis-5428	269	4	a	a	DET
aisthesis-5428	269	5	chi	chi	ADJ
aisthesis-5428	269	6	-	-	PUNCT
aisthesis-5428	269	7	square	square	ADJ
aisthesis-5428	269	8	value	value	NOUN
aisthesis-5428	269	9	of	of	ADP
aisthesis-5428	269	10	1,850.4	1,850.4	NUM
aisthesis-5428	269	11	was	be	AUX
aisthesis-5428	269	12	calculated	calculate	VERB
aisthesis-5428	269	13	with	with	ADP
aisthesis-5428	269	14	the	the	DET
aisthesis-5428	269	15	formula	formula	NOUN
aisthesis-5428	269	16	with	with	ADP
aisthesis-5428	269	17	3	3	NUM
aisthesis-5428	269	18	degrees	degree	NOUN
aisthesis-5428	269	19	of	of	ADP
aisthesis-5428	269	20	freedom	freedom	NOUN
aisthesis-5428	269	21	,	,	PUNCT
aisthesis-5428	269	22	this	this	DET
aisthesis-5428	269	23	chi	chi	ADJ
aisthesis-5428	269	24	-	-	PUNCT
aisthesis-5428	269	25	square	square	ADJ
aisthesis-5428	269	26	value	value	NOUN
aisthesis-5428	269	27	coincides	coincide	VERB
aisthesis-5428	269	28	with	with	ADP
aisthesis-5428	269	29	a	a	DET
aisthesis-5428	269	30	p	p	NOUN
aisthesis-5428	269	31	-	-	PUNCT
aisthesis-5428	269	32	value	value	NOUN
aisthesis-5428	269	33	of	of	ADP
aisthesis-5428	269	34	less	less	ADJ
aisthesis-5428	269	35	than	than	ADP
aisthesis-5428	269	36	2.2e-16	2.2e-16	PROPN
aisthesis-5428	269	37	and	and	CCONJ
aisthesis-5428	269	38	thus	thus	ADV
aisthesis-5428	269	39	the	the	DET
aisthesis-5428	269	40	null	null	ADJ
aisthesis-5428	269	41	hypothesis	hypothesis	NOUN
aisthesis-5428	269	42	is	be	AUX
aisthesis-5428	269	43	rejected	reject	VERB
aisthesis-5428	269	44	.	.	PUNCT
aisthesis-5428	270	1	figure	figure	NOUN
aisthesis-5428	270	2	4	4	NUM
aisthesis-5428	270	3	.	.	PUNCT
aisthesis-5428	270	4	chromosome	chromosome	NOUN
aisthesis-5428	270	5	map	map	NOUN
aisthesis-5428	270	6	.	.	PUNCT
aisthesis-5428	271	1	chromosome	chromosome	NOUN
aisthesis-5428	271	2	2	2	NUM
aisthesis-5428	271	3	of	of	ADP
aisthesis-5428	271	4	d.	d.	NOUN
aisthesis-5428	271	5	melanogaster	melanogaster	NOUN
aisthesis-5428	271	6	is	be	AUX
aisthesis-5428	271	7	depicted	depict	VERB
aisthesis-5428	271	8	with	with	ADP
aisthesis-5428	271	9	bl	bl	INTJ
aisthesis-5428	271	10	being	be	AUX
aisthesis-5428	271	11	located	locate	VERB
aisthesis-5428	271	12	at	at	ADP
aisthesis-5428	271	13	2	2	NUM
aisthesis-5428	271	14	-	-	SYM
aisthesis-5428	271	15	49	49	NUM
aisthesis-5428	271	16	with	with	ADP
aisthesis-5428	271	17	an	an	DET
aisthesis-5428	271	18	estimated	estimate	VERB
aisthesis-5428	271	19	genetic	genetic	ADJ
aisthesis-5428	271	20	distance	distance	NOUN
aisthesis-5428	271	21	of	of	ADP
aisthesis-5428	271	22	14	14	NUM
aisthesis-5428	271	23	cm	cm	NOUN
aisthesis-5428	271	24	from	from	ADP
aisthesis-5428	271	25	trex	trex	PROPN
aisthesis-5428	271	26	,	,	PUNCT
aisthesis-5428	271	27	pr	pr	VERB
aisthesis-5428	271	28	being	be	AUX
aisthesis-5428	271	29	located	locate	VERB
aisthesis-5428	271	30	at	at	ADP
aisthesis-5428	271	31	2	2	NUM
aisthesis-5428	271	32	-	-	SYM
aisthesis-5428	271	33	54	54	NUM
aisthesis-5428	271	34	with	with	ADP
aisthesis-5428	271	35	an	an	DET
aisthesis-5428	271	36	estimated	estimate	VERB
aisthesis-5428	271	37	genetic	genetic	ADJ
aisthesis-5428	271	38	distance	distance	NOUN
aisthesis-5428	271	39	of	of	ADP
aisthesis-5428	271	40	11	11	NUM
aisthesis-5428	271	41	cm	cm	NOUN
aisthesis-5428	271	42	from	from	ADP
aisthesis-5428	271	43	trex	trex	PROPN
aisthesis-5428	271	44	,	,	PUNCT
aisthesis-5428	271	45	and	and	CCONJ
aisthesis-5428	271	46	bw	bw	ADP
aisthesis-5428	271	47	being	be	AUX
aisthesis-5428	271	48	located	locate	VERB
aisthesis-5428	271	49	at	at	ADP
aisthesis-5428	271	50	2	2	NUM
aisthesis-5428	271	51	-	-	SYM
aisthesis-5428	271	52	103	103	NUM
aisthesis-5428	271	53	with	with	ADP
aisthesis-5428	271	54	an	an	DET
aisthesis-5428	271	55	estimated	estimate	VERB
aisthesis-5428	271	56	genetic	genetic	ADJ
aisthesis-5428	271	57	distance	distance	NOUN
aisthesis-5428	271	58	of	of	ADP
aisthesis-5428	271	59	26	26	NUM
aisthesis-5428	271	60	cm	cm	NOUN
aisthesis-5428	271	61	from	from	ADP
aisthesis-5428	271	62	trex	trex	PROPN
aisthesis-5428	271	63	.	.	PROPN
aisthesis-5428	272	1	based	base	VERB
aisthesis-5428	272	2	on	on	ADP
aisthesis-5428	272	3	these	these	DET
aisthesis-5428	272	4	locations	location	NOUN
aisthesis-5428	272	5	and	and	CCONJ
aisthesis-5428	272	6	their	their	PRON
aisthesis-5428	272	7	estimated	estimate	VERB
aisthesis-5428	272	8	distances	distance	NOUN
aisthesis-5428	272	9	from	from	ADP
aisthesis-5428	272	10	trex	trex	PROPN
aisthesis-5428	272	11	,	,	PUNCT
aisthesis-5428	272	12	trex	trex	PROPN
aisthesis-5428	272	13	is	be	AUX
aisthesis-5428	272	14	predicted	predict	VERB
aisthesis-5428	272	15	to	to	PART
aisthesis-5428	272	16	be	be	AUX
aisthesis-5428	272	17	located	locate	VERB
aisthesis-5428	272	18	at	at	ADP
aisthesis-5428	272	19	2	2	NUM
aisthesis-5428	272	20	-	-	SYM
aisthesis-5428	272	21	68	68	NUM
aisthesis-5428	272	22	.	.	PUNCT
aisthesis-5428	273	1	figure	figure	NOUN
aisthesis-5428	273	2	5	5	NUM
aisthesis-5428	273	3	.	.	PUNCT
aisthesis-5428	273	4	gel	gel	NOUN
aisthesis-5428	273	5	electrophoresis	electrophoresis	NOUN
aisthesis-5428	273	6	under	under	ADP
aisthesis-5428	273	7	ultraviolet	ultraviolet	NOUN
aisthesis-5428	273	8	viewing	view	VERB
aisthesis-5428	273	9	light	light	NOUN
aisthesis-5428	273	10	.	.	PUNCT
aisthesis-5428	274	1	the	the	DET
aisthesis-5428	274	2	lane	lane	PROPN
aisthesis-5428	274	3	farthest	farth	ADJ
aisthesis-5428	274	4	left	leave	VERB
aisthesis-5428	274	5	displays	display	VERB
aisthesis-5428	274	6	the	the	DET
aisthesis-5428	274	7	control	control	NOUN
aisthesis-5428	274	8	ladder	ladder	NOUN
aisthesis-5428	274	9	allowing	allow	VERB
aisthesis-5428	274	10	the	the	DET
aisthesis-5428	274	11	standardization	standardization	NOUN
aisthesis-5428	274	12	of	of	ADP
aisthesis-5428	274	13	bp	bp	PROPN
aisthesis-5428	274	14	size	size	NOUN
aisthesis-5428	274	15	of	of	ADP
aisthesis-5428	274	16	genes	gene	NOUN
aisthesis-5428	274	17	corresponding	correspond	VERB
aisthesis-5428	274	18	to	to	ADP
aisthesis-5428	274	19	the	the	DET
aisthesis-5428	274	20	distance	distance	NOUN
aisthesis-5428	274	21	that	that	PRON
aisthesis-5428	274	22	bands	band	NOUN
aisthesis-5428	274	23	travel	travel	VERB
aisthesis-5428	274	24	.	.	PUNCT
aisthesis-5428	275	1	the	the	DET
aisthesis-5428	275	2	second	second	ADJ
aisthesis-5428	275	3	band	band	NOUN
aisthesis-5428	275	4	shown	show	VERB
aisthesis-5428	275	5	is	be	AUX
aisthesis-5428	275	6	associated	associate	VERB
aisthesis-5428	275	7	with	with	ADP
aisthesis-5428	275	8	a	a	DET
aisthesis-5428	275	9	positive	positive	ADJ
aisthesis-5428	275	10	control	control	NOUN
aisthesis-5428	275	11	sample	sample	NOUN
aisthesis-5428	275	12	and	and	CCONJ
aisthesis-5428	275	13	has	have	AUX
aisthesis-5428	275	14	traveled	travel	VERB
aisthesis-5428	275	15	a	a	DET
aisthesis-5428	275	16	distance	distance	NOUN
aisthesis-5428	275	17	associated	associate	VERB
aisthesis-5428	275	18	with	with	ADP
aisthesis-5428	275	19	a	a	DET
aisthesis-5428	275	20	band	band	NOUN
aisthesis-5428	275	21	size	size	NOUN
aisthesis-5428	275	22	of	of	ADP
aisthesis-5428	275	23	100	100	NUM
aisthesis-5428	275	24	bp	bp	NOUN
aisthesis-5428	275	25	.	.	PUNCT
aisthesis-5428	276	1	the	the	DET
aisthesis-5428	276	2	third	third	ADJ
aisthesis-5428	276	3	band	band	NOUN
aisthesis-5428	276	4	,	,	PUNCT
aisthesis-5428	276	5	farthest	farth	ADJ
aisthesis-5428	276	6	right	right	ADJ
aisthesis-5428	276	7	,	,	PUNCT
aisthesis-5428	276	8	is	be	AUX
aisthesis-5428	276	9	associated	associate	VERB
aisthesis-5428	276	10	with	with	ADP
aisthesis-5428	276	11	the	the	DET
aisthesis-5428	276	12	sample	sample	NOUN
aisthesis-5428	276	13	with	with	ADP
aisthesis-5428	276	14	trex	trex	PROPN
aisthesis-5428	276	15	and	and	CCONJ
aisthesis-5428	276	16	has	have	AUX
aisthesis-5428	276	17	traveled	travel	VERB
aisthesis-5428	276	18	a	a	DET
aisthesis-5428	276	19	distance	distance	NOUN
aisthesis-5428	276	20	corresponding	correspond	VERB
aisthesis-5428	276	21	to	to	ADP
aisthesis-5428	276	22	100	100	NUM
aisthesis-5428	276	23	base	base	NOUN
aisthesis-5428	276	24	pairs	pair	NOUN
aisthesis-5428	276	25	.	.	PUNCT
aisthesis-5428	277	1	65	65	NUM
aisthesis-5428	277	2	analysis	analysis	NOUN
aisthesis-5428	277	3	of	of	ADP
aisthesis-5428	277	4	novel	novel	ADJ
aisthesis-5428	277	5	unknown	unknown	ADJ
aisthesis-5428	277	6	d.	d.	NOUN
aisthesis-5428	277	7	melanogaster	melanogaster	NOUN
aisthesis-5428	277	8	mutation	mutation	NOUN
aisthesis-5428	277	9	trex	trex	PROPN
aisthesis-5428	277	10	aisthesis	aisthesis	NOUN
aisthesis-5428	277	11	volume	volume	NOUN
aisthesis-5428	277	12	14	14	NUM
aisthesis-5428	277	13	,	,	PUNCT
aisthesis-5428	277	14	2023	2023	NUM
aisthesis-5428	277	15	figure	figure	NOUN
aisthesis-5428	277	16	6	6	NUM
aisthesis-5428	277	17	.	.	PUNCT
aisthesis-5428	277	18	comparison	comparison	NOUN
aisthesis-5428	277	19	of	of	ADP
aisthesis-5428	277	20	trex	trex	PROPN
aisthesis-5428	277	21	and	and	CCONJ
aisthesis-5428	277	22	wild	wild	ADJ
aisthesis-5428	277	23	-	-	PUNCT
aisthesis-5428	277	24	type	type	NOUN
aisthesis-5428	277	25	nucleotide	nucleotide	NOUN
aisthesis-5428	277	26	sequences	sequence	NOUN
aisthesis-5428	277	27	.	.	PUNCT
aisthesis-5428	278	1	[	[	X
aisthesis-5428	278	2	a	a	X
aisthesis-5428	278	3	]	]	PUNCT
aisthesis-5428	278	4	displays	display	VERB
aisthesis-5428	278	5	the	the	DET
aisthesis-5428	278	6	nucleotide	nucleotide	NOUN
aisthesis-5428	278	7	blast	blast	NOUN
aisthesis-5428	278	8	alignment	alignment	NOUN
aisthesis-5428	278	9	of	of	ADP
aisthesis-5428	278	10	the	the	DET
aisthesis-5428	278	11	wild	wild	ADJ
aisthesis-5428	278	12	-	-	PUNCT
aisthesis-5428	278	13	type	type	NOUN
aisthesis-5428	278	14	amplicon	amplicon	NOUN
aisthesis-5428	278	15	and	and	CCONJ
aisthesis-5428	278	16	trex	trex	PROPN
aisthesis-5428	278	17	sequences	sequence	NOUN
aisthesis-5428	278	18	.	.	PUNCT
aisthesis-5428	279	1	the	the	DET
aisthesis-5428	279	2	alignment	alignment	NOUN
aisthesis-5428	279	3	includes	include	VERB
aisthesis-5428	279	4	about	about	ADP
aisthesis-5428	279	5	425	425	NUM
aisthesis-5428	279	6	base	base	NOUN
aisthesis-5428	279	7	pairs	pair	NOUN
aisthesis-5428	279	8	and	and	CCONJ
aisthesis-5428	279	9	is	be	AUX
aisthesis-5428	279	10	in	in	ADP
aisthesis-5428	279	11	94	94	NUM
aisthesis-5428	279	12	%	%	NOUN
aisthesis-5428	279	13	agreement	agreement	NOUN
aisthesis-5428	279	14	.	.	PUNCT
aisthesis-5428	280	1	this	this	DET
aisthesis-5428	280	2	correspondence	correspondence	NOUN
aisthesis-5428	280	3	is	be	AUX
aisthesis-5428	280	4	illustrated	illustrate	VERB
aisthesis-5428	280	5	in	in	ADP
aisthesis-5428	280	6	[	[	X
aisthesis-5428	280	7	b	b	X
aisthesis-5428	280	8	]	]	X
aisthesis-5428	280	9	,	,	PUNCT
aisthesis-5428	280	10	which	which	PRON
aisthesis-5428	280	11	displays	display	VERB
aisthesis-5428	280	12	a	a	DET
aisthesis-5428	280	13	dot	dot	NOUN
aisthesis-5428	280	14	plot	plot	NOUN
aisthesis-5428	280	15	graph	graph	NOUN
aisthesis-5428	280	16	of	of	ADP
aisthesis-5428	280	17	the	the	DET
aisthesis-5428	280	18	alignment	alignment	NOUN
aisthesis-5428	280	19	between	between	ADP
aisthesis-5428	280	20	the	the	DET
aisthesis-5428	280	21	respective	respective	ADJ
aisthesis-5428	280	22	sequences	sequence	NOUN
aisthesis-5428	280	23	.	.	PUNCT
aisthesis-5428	281	1	the	the	DET
aisthesis-5428	281	2	sequence	sequence	NOUN
aisthesis-5428	281	3	in	in	ADP
aisthesis-5428	281	4	[	[	X
aisthesis-5428	281	5	c	c	X
aisthesis-5428	281	6	]	]	X
aisthesis-5428	281	7	is	be	AUX
aisthesis-5428	281	8	the	the	DET
aisthesis-5428	281	9	wild	wild	ADJ
aisthesis-5428	281	10	-	-	PUNCT
aisthesis-5428	281	11	type	type	NOUN
aisthesis-5428	281	12	sequence	sequence	NOUN
aisthesis-5428	281	13	retrieved	retrieve	VERB
aisthesis-5428	281	14	from	from	ADP
aisthesis-5428	281	15	finchtv	finchtv	ADJ
aisthesis-5428	281	16	after	after	ADP
aisthesis-5428	281	17	dideoxy	dideoxy	ADJ
aisthesis-5428	281	18	chain	chain	NOUN
aisthesis-5428	281	19	-	-	PUNCT
aisthesis-5428	281	20	termination	termination	NOUN
aisthesis-5428	281	21	sequencing	sequencing	NOUN
aisthesis-5428	281	22	.	.	PUNCT
aisthesis-5428	282	1	the	the	DET
aisthesis-5428	282	2	highlighted	highlight	VERB
aisthesis-5428	282	3	region	region	NOUN
aisthesis-5428	282	4	shows	show	VERB
aisthesis-5428	282	5	the	the	DET
aisthesis-5428	282	6	425	425	NUM
aisthesis-5428	282	7	bp	bp	NOUN
aisthesis-5428	282	8	sequence	sequence	NOUN
aisthesis-5428	282	9	in	in	ADP
aisthesis-5428	282	10	agreement	agreement	NOUN
aisthesis-5428	282	11	with	with	ADP
aisthesis-5428	282	12	the	the	DET
aisthesis-5428	282	13	wild	wild	ADJ
aisthesis-5428	282	14	-	-	PUNCT
aisthesis-5428	282	15	type	type	NOUN
aisthesis-5428	282	16	genome	genome	NOUN
aisthesis-5428	282	17	.	.	PUNCT
aisthesis-5428	283	1	the	the	DET
aisthesis-5428	283	2	sequence	sequence	NOUN
aisthesis-5428	283	3	that	that	PRON
aisthesis-5428	283	4	follows	follow	VERB
aisthesis-5428	283	5	and	and	CCONJ
aisthesis-5428	283	6	is	be	AUX
aisthesis-5428	283	7	unhighlighted	unhighlighted	ADJ
aisthesis-5428	283	8	is	be	AUX
aisthesis-5428	283	9	an	an	DET
aisthesis-5428	283	10	inserted	insert	VERB
aisthesis-5428	283	11	sequence	sequence	NOUN
aisthesis-5428	283	12	not	not	PART
aisthesis-5428	283	13	found	find	VERB
aisthesis-5428	283	14	in	in	ADP
aisthesis-5428	283	15	the	the	DET
aisthesis-5428	283	16	wild	wild	ADJ
aisthesis-5428	283	17	-	-	PUNCT
aisthesis-5428	283	18	type	type	NOUN
aisthesis-5428	283	19	genome	genome	NOUN
aisthesis-5428	283	20	.	.	PUNCT
aisthesis-5428	284	1	figure	figure	NOUN
aisthesis-5428	284	2	7	7	NUM
aisthesis-5428	284	3	.	.	PUNCT
aisthesis-5428	284	4	coding	code	VERB
aisthesis-5428	284	5	sequence	sequence	NOUN
aisthesis-5428	284	6	of	of	ADP
aisthesis-5428	284	7	wt	wt	PROPN
aisthesis-5428	284	8	.	.	PUNCT
aisthesis-5428	285	1	the	the	DET
aisthesis-5428	285	2	coding	code	VERB
aisthesis-5428	285	3	sequence	sequence	NOUN
aisthesis-5428	285	4	of	of	ADP
aisthesis-5428	285	5	the	the	DET
aisthesis-5428	285	6	wild	wild	ADJ
aisthesis-5428	285	7	-	-	PUNCT
aisthesis-5428	285	8	type	type	NOUN
aisthesis-5428	285	9	genome	genome	NOUN
aisthesis-5428	285	10	is	be	AUX
aisthesis-5428	285	11	included	include	VERB
aisthesis-5428	285	12	above	above	ADV
aisthesis-5428	285	13	.	.	PUNCT
aisthesis-5428	286	1	this	this	DET
aisthesis-5428	286	2	sequence	sequence	NOUN
aisthesis-5428	286	3	contains	contain	VERB
aisthesis-5428	286	4	the	the	DET
aisthesis-5428	286	5	mutant	mutant	ADJ
aisthesis-5428	286	6	forward	forward	NOUN
aisthesis-5428	286	7	primer	primer	NOUN
aisthesis-5428	286	8	but	but	CCONJ
aisthesis-5428	286	9	does	do	AUX
aisthesis-5428	286	10	not	not	PART
aisthesis-5428	286	11	contain	contain	VERB
aisthesis-5428	286	12	the	the	DET
aisthesis-5428	286	13	reverse	reverse	ADJ
aisthesis-5428	286	14	primer	primer	NOUN
aisthesis-5428	286	15	.	.	PUNCT
aisthesis-5428	287	1	as	as	SCONJ
aisthesis-5428	287	2	the	the	DET
aisthesis-5428	287	3	reverse	reverse	ADJ
aisthesis-5428	287	4	primer	primer	NOUN
aisthesis-5428	287	5	was	be	AUX
aisthesis-5428	287	6	not	not	PART
aisthesis-5428	287	7	found	find	VERB
aisthesis-5428	287	8	,	,	PUNCT
aisthesis-5428	287	9	it	it	PRON
aisthesis-5428	287	10	was	be	AUX
aisthesis-5428	287	11	hypothesized	hypothesize	VERB
aisthesis-5428	287	12	that	that	SCONJ
aisthesis-5428	287	13	the	the	DET
aisthesis-5428	287	14	primer	primer	NOUN
aisthesis-5428	287	15	may	may	AUX
aisthesis-5428	287	16	be	be	AUX
aisthesis-5428	287	17	included	include	VERB
aisthesis-5428	287	18	in	in	ADP
aisthesis-5428	287	19	the	the	DET
aisthesis-5428	287	20	trex	trex	PROPN
aisthesis-5428	287	21	mutation	mutation	NOUN
aisthesis-5428	287	22	as	as	ADP
aisthesis-5428	287	23	an	an	DET
aisthesis-5428	287	24	insertion	insertion	NOUN
aisthesis-5428	287	25	into	into	ADP
aisthesis-5428	287	26	the	the	DET
aisthesis-5428	287	27	wild	wild	ADJ
aisthesis-5428	287	28	-	-	PUNCT
aisthesis-5428	287	29	type	type	NOUN
aisthesis-5428	287	30	genome	genome	NOUN
aisthesis-5428	287	31	.	.	PUNCT
aisthesis-5428	288	1	figure	figure	NOUN
aisthesis-5428	288	2	8	8	NUM
aisthesis-5428	288	3	.	.	PUNCT
aisthesis-5428	288	4	transposon	transposon	NOUN
aisthesis-5428	288	5	sequence	sequence	NOUN
aisthesis-5428	288	6	.	.	PUNCT
aisthesis-5428	289	1	the	the	DET
aisthesis-5428	289	2	sequence	sequence	NOUN
aisthesis-5428	289	3	included	include	VERB
aisthesis-5428	289	4	above	above	ADP
aisthesis-5428	289	5	corresponds	correspond	NOUN
aisthesis-5428	289	6	to	to	ADP
aisthesis-5428	289	7	the	the	DET
aisthesis-5428	289	8	sequence	sequence	NOUN
aisthesis-5428	289	9	inserted	insert	VERB
aisthesis-5428	289	10	into	into	ADP
aisthesis-5428	289	11	the	the	DET
aisthesis-5428	289	12	trex	trex	ADJ
aisthesis-5428	289	13	fly	fly	NOUN
aisthesis-5428	289	14	genome	genome	NOUN
aisthesis-5428	289	15	after	after	ADP
aisthesis-5428	289	16	the	the	DET
aisthesis-5428	289	17	425	425	NUM
aisthesis-5428	289	18	base	base	NOUN
aisthesis-5428	289	19	pair	pair	NOUN
aisthesis-5428	289	20	alignment	alignment	NOUN
aisthesis-5428	289	21	with	with	ADP
aisthesis-5428	289	22	the	the	DET
aisthesis-5428	289	23	wildtype	wildtype	NOUN
aisthesis-5428	289	24	sequence	sequence	NOUN
aisthesis-5428	289	25	.	.	PUNCT
aisthesis-5428	290	1	this	this	PRON
aisthesis-5428	290	2	is	be	AUX
aisthesis-5428	290	3	the	the	DET
aisthesis-5428	290	4	sequence	sequence	NOUN
aisthesis-5428	290	5	that	that	PRON
aisthesis-5428	290	6	was	be	AUX
aisthesis-5428	290	7	subjected	subject	VERB
aisthesis-5428	290	8	to	to	ADP
aisthesis-5428	290	9	a	a	DET
aisthesis-5428	290	10	nucleotide	nucleotide	ADJ
aisthesis-5428	290	11	blast	blast	NOUN
aisthesis-5428	290	12	within	within	ADP
aisthesis-5428	290	13	flybase	flybase	PROPN
aisthesis-5428	290	14	.	.	PUNCT
aisthesis-5428	291	1	figure	figure	NOUN
aisthesis-5428	291	2	9	9	NUM
aisthesis-5428	291	3	.	.	PUNCT
aisthesis-5428	291	4	nucleotide	nucleotide	NOUN
aisthesis-5428	291	5	blast	blast	NOUN
aisthesis-5428	291	6	of	of	ADP
aisthesis-5428	291	7	transposon	transposon	NOUN
aisthesis-5428	291	8	mutation	mutation	NOUN
aisthesis-5428	291	9	sequence	sequence	NOUN
aisthesis-5428	291	10	.	.	PUNCT
aisthesis-5428	292	1	[	[	X
aisthesis-5428	292	2	a	a	X
aisthesis-5428	292	3	]	]	PUNCT
aisthesis-5428	292	4	displays	display	VERB
aisthesis-5428	292	5	the	the	DET
aisthesis-5428	292	6	results	result	NOUN
aisthesis-5428	292	7	of	of	ADP
aisthesis-5428	292	8	the	the	DET
aisthesis-5428	292	9	nucleotide	nucleotide	NOUN
aisthesis-5428	292	10	blast	blast	NOUN
aisthesis-5428	292	11	results	result	NOUN
aisthesis-5428	292	12	of	of	ADP
aisthesis-5428	292	13	the	the	DET
aisthesis-5428	292	14	inserted	insert	VERB
aisthesis-5428	292	15	sequence	sequence	NOUN
aisthesis-5428	292	16	found	find	VERB
aisthesis-5428	292	17	in	in	ADP
aisthesis-5428	292	18	the	the	DET
aisthesis-5428	292	19	sequenced	sequence	VERB
aisthesis-5428	292	20	trex	trex	PROPN
aisthesis-5428	292	21	dna	dna	PROPN
aisthesis-5428	292	22	fragment	fragment	NOUN
aisthesis-5428	292	23	.	.	PUNCT
aisthesis-5428	293	1	there	there	PRON
aisthesis-5428	293	2	are	be	VERB
aisthesis-5428	293	3	25	25	NUM
aisthesis-5428	293	4	transposon	transposon	NOUN
aisthesis-5428	293	5	sequences	sequence	NOUN
aisthesis-5428	293	6	that	that	PRON
aisthesis-5428	293	7	align	align	VERB
aisthesis-5428	293	8	with	with	ADP
aisthesis-5428	293	9	the	the	DET
aisthesis-5428	293	10	query	query	NOUN
aisthesis-5428	293	11	search	search	NOUN
aisthesis-5428	293	12	with	with	ADP
aisthesis-5428	293	13	an	an	DET
aisthesis-5428	293	14	e	e	NOUN
aisthesis-5428	293	15	-	-	NOUN
aisthesis-5428	293	16	value	value	NOUN
aisthesis-5428	293	17	of	of	ADP
aisthesis-5428	293	18	0	0	NUM
aisthesis-5428	293	19	.	.	PUNCT
aisthesis-5428	294	1	[	[	X
aisthesis-5428	294	2	b	b	X
aisthesis-5428	294	3	]	]	PUNCT
aisthesis-5428	294	4	displays	display	VERB
aisthesis-5428	294	5	the	the	DET
aisthesis-5428	294	6	correspondence	correspondence	NOUN
aisthesis-5428	294	7	of	of	ADP
aisthesis-5428	294	8	the	the	DET
aisthesis-5428	294	9	inserted	insert	VERB
aisthesis-5428	294	10	sequence	sequence	NOUN
aisthesis-5428	294	11	with	with	ADP
aisthesis-5428	294	12	retrotransposon	retrotransposon	PROPN
aisthesis-5428	294	13	412	412	NUM
aisthesis-5428	294	14	found	find	VERB
aisthesis-5428	294	15	across	across	ADP
aisthesis-5428	294	16	the	the	DET
aisthesis-5428	294	17	d.	d.	NOUN
aisthesis-5428	294	18	melanogaster	melanogaster	NOUN
aisthesis-5428	294	19	genome	genome	NOUN
aisthesis-5428	294	20	.	.	PUNCT
aisthesis-5428	295	1	66	66	NUM
aisthesis-5428	295	2	analysis	analysis	NOUN
aisthesis-5428	295	3	of	of	ADP
aisthesis-5428	295	4	novel	novel	ADJ
aisthesis-5428	295	5	unknown	unknown	ADJ
aisthesis-5428	295	6	d.	d.	NOUN
aisthesis-5428	295	7	melanogaster	melanogaster	NOUN
aisthesis-5428	295	8	mutation	mutation	NOUN
aisthesis-5428	295	9	trex	trex	PROPN
aisthesis-5428	295	10	aisthesis	aisthesis	NOUN
aisthesis-5428	295	11	volume	volume	NOUN
aisthesis-5428	295	12	14	14	NUM
aisthesis-5428	295	13	,	,	PUNCT
aisthesis-5428	295	14	2023	2023	NUM
aisthesis-5428	295	15	figure	figure	NOUN
aisthesis-5428	295	16	10	10	NUM
aisthesis-5428	295	17	.	.	PUNCT
aisthesis-5428	295	18	amino	amino	NOUN
aisthesis-5428	295	19	acid	acid	NOUN
aisthesis-5428	295	20	sequence	sequence	NOUN
aisthesis-5428	295	21	of	of	ADP
aisthesis-5428	295	22	vestigial	vestigial	NOUN
aisthesis-5428	295	23	.	.	PUNCT
aisthesis-5428	296	1	the	the	DET
aisthesis-5428	296	2	coding	code	VERB
aisthesis-5428	296	3	portion	portion	NOUN
aisthesis-5428	296	4	of	of	ADP
aisthesis-5428	296	5	the	the	DET
aisthesis-5428	296	6	nucleotide	nucleotide	ADJ
aisthesis-5428	296	7	sequence	sequence	NOUN
aisthesis-5428	296	8	of	of	ADP
aisthesis-5428	296	9	the	the	DET
aisthesis-5428	296	10	gene	gene	NOUN
aisthesis-5428	296	11	vestigial	vestigial	NOUN
aisthesis-5428	296	12	,	,	PUNCT
aisthesis-5428	296	13	which	which	PRON
aisthesis-5428	296	14	was	be	AUX
aisthesis-5428	296	15	found	find	VERB
aisthesis-5428	296	16	to	to	PART
aisthesis-5428	296	17	be	be	AUX
aisthesis-5428	296	18	allelic	allelic	ADJ
aisthesis-5428	296	19	to	to	ADP
aisthesis-5428	296	20	trex	trex	PROPN
aisthesis-5428	296	21	,	,	PUNCT
aisthesis-5428	296	22	was	be	AUX
aisthesis-5428	296	23	entered	enter	VERB
aisthesis-5428	296	24	into	into	ADP
aisthesis-5428	296	25	expasy	expasy	NOUN
aisthesis-5428	296	26	in	in	ADP
aisthesis-5428	296	27	order	order	NOUN
aisthesis-5428	296	28	to	to	PART
aisthesis-5428	296	29	retrieve	retrieve	VERB
aisthesis-5428	296	30	the	the	DET
aisthesis-5428	296	31	amino	amino	NOUN
aisthesis-5428	296	32	acid	acid	NOUN
aisthesis-5428	296	33	sequence	sequence	NOUN
aisthesis-5428	296	34	that	that	PRON
aisthesis-5428	296	35	corresponds	correspond	VERB
aisthesis-5428	296	36	.	.	PUNCT
aisthesis-5428	297	1	figure	figure	NOUN
aisthesis-5428	297	2	11	11	NUM
aisthesis-5428	297	3	.	.	PUNCT
aisthesis-5428	298	1	protein	protein	NOUN
aisthesis-5428	298	2	structure	structure	NOUN
aisthesis-5428	298	3	of	of	ADP
aisthesis-5428	298	4	vestigial	vestigial	NOUN
aisthesis-5428	298	5	.	.	PUNCT
aisthesis-5428	299	1	the	the	DET
aisthesis-5428	299	2	structure	structure	NOUN
aisthesis-5428	299	3	of	of	ADP
aisthesis-5428	299	4	vestigial	vestigial	NOUN
aisthesis-5428	299	5	,	,	PUNCT
aisthesis-5428	299	6	the	the	DET
aisthesis-5428	299	7	gene	gene	NOUN
aisthesis-5428	299	8	allelic	allelic	ADJ
aisthesis-5428	299	9	to	to	ADP
aisthesis-5428	299	10	trex	trex	PROPN
aisthesis-5428	299	11	,	,	PUNCT
aisthesis-5428	299	12	is	be	AUX
aisthesis-5428	299	13	included	include	VERB
aisthesis-5428	299	14	above	above	ADV
aisthesis-5428	299	15	from	from	ADP
aisthesis-5428	299	16	a	a	DET
aisthesis-5428	299	17	uniprot	uniprot	ADJ
aisthesis-5428	299	18	analysis	analysis	NOUN
aisthesis-5428	299	19	of	of	ADP
aisthesis-5428	299	20	the	the	DET
aisthesis-5428	299	21	amino	amino	NOUN
aisthesis-5428	299	22	acid	acid	NOUN
aisthesis-5428	299	23	sequence	sequence	NOUN
aisthesis-5428	299	24	of	of	ADP
aisthesis-5428	299	25	the	the	DET
aisthesis-5428	299	26	wildtype	wildtype	NOUN
aisthesis-5428	299	27	genome	genome	NOUN
aisthesis-5428	299	28	retrieved	retrieve	VERB
aisthesis-5428	299	29	from	from	ADP
aisthesis-5428	299	30	expasy	expasy	NOUN
aisthesis-5428	299	31	.	.	PUNCT
aisthesis-5428	300	1	figure	figure	NOUN
aisthesis-5428	300	2	12	12	NUM
aisthesis-5428	300	3	.	.	PUNCT
aisthesis-5428	301	1	human	human	ADJ
aisthesis-5428	301	2	ortholog	ortholog	NOUN
aisthesis-5428	301	3	vestigial	vestigial	ADJ
aisthesis-5428	301	4	-	-	PUNCT
aisthesis-5428	301	5	like	like	ADJ
aisthesis-5428	301	6	protein	protein	NOUN
aisthesis-5428	301	7	2	2	NUM
aisthesis-5428	301	8	.	.	PUNCT
aisthesis-5428	302	1	[	[	X
aisthesis-5428	302	2	a	a	X
aisthesis-5428	302	3	]	]	PUNCT
aisthesis-5428	302	4	shows	show	VERB
aisthesis-5428	302	5	the	the	DET
aisthesis-5428	302	6	protein	protein	NOUN
aisthesis-5428	302	7	structure	structure	NOUN
aisthesis-5428	302	8	of	of	ADP
aisthesis-5428	302	9	vgll-2	vgll-2	NUM
aisthesis-5428	302	10	,	,	PUNCT
aisthesis-5428	302	11	the	the	DET
aisthesis-5428	302	12	human	human	ADJ
aisthesis-5428	302	13	ortholog	ortholog	NOUN
aisthesis-5428	302	14	to	to	PART
aisthesis-5428	302	15	vestigial	vestigial	VERB
aisthesis-5428	302	16	and	and	CCONJ
aisthesis-5428	302	17	also	also	ADV
aisthesis-5428	302	18	trex	trex	PROPN
aisthesis-5428	302	19	.	.	PUNCT
aisthesis-5428	303	1	the	the	DET
aisthesis-5428	303	2	alignment	alignment	NOUN
aisthesis-5428	303	3	of	of	ADP
aisthesis-5428	303	4	these	these	DET
aisthesis-5428	303	5	genes	gene	NOUN
aisthesis-5428	303	6	as	as	ADP
aisthesis-5428	303	7	orthologs	ortholog	NOUN
aisthesis-5428	303	8	is	be	AUX
aisthesis-5428	303	9	shown	show	VERB
aisthesis-5428	303	10	in	in	ADP
aisthesis-5428	303	11	[	[	X
aisthesis-5428	303	12	b	b	X
aisthesis-5428	303	13	]	]	X
aisthesis-5428	303	14	as	as	ADP
aisthesis-5428	303	15	the	the	DET
aisthesis-5428	303	16	protein	protein	NOUN
aisthesis-5428	303	17	blast	blast	NOUN
aisthesis-5428	303	18	alignment	alignment	NOUN
aisthesis-5428	303	19	of	of	ADP
aisthesis-5428	303	20	vestigial	vestigial	NOUN
aisthesis-5428	303	21	and	and	CCONJ
aisthesis-5428	303	22	its	its	PRON
aisthesis-5428	303	23	orthologs	ortholog	NOUN
aisthesis-5428	303	24	within	within	ADP
aisthesis-5428	303	25	the	the	DET
aisthesis-5428	303	26	human	human	ADJ
aisthesis-5428	303	27	genome	genome	NOUN
aisthesis-5428	303	28	.	.	PUNCT
aisthesis-5428	304	1	67	67	NUM