F:\ALCES\Vol_38\Pagemaker\3812. ALCES VOL. 38, 2002 HUNDERTMARK ET AL. - CYTb VARIATION IN MOOSE 113 GENETIC RELATIONSHIPS DEDUCED FROM CYTOCHROME-b SEQUENCES AMONG MOOSE Kris J. Hundertmark1,2, Gerald F. Shields2,3, R. Terry Bowyer2, and Charles C. Schwartz1,4 1Alaska Department of Fish and Game, Kenai Moose Research Center, 43961 Kalifornsky Beach Road, Suite B, Soldotna, AK 99669, USA; 2Institute of Arctic Biology and Department of Biology and Wildlife, University of Alaska Fairbanks, Fairbanks, AK 99775, USA ABSTRACT: We studied variation in nucleotide sequences of the mitochondrial cytochrome-b gene to assess the phylogeny of moose (Alces alces) in general, and the position of North American moose within that phylogeny in particular. We combined North American, Asian, and European haplotypes generated for this study with 3 Eurasian haplotypes obtained from GenBank. No nucleotide variation occurred within moose from North America, whereas 3 haplotypes were present in European moose and 4 haplotypes in Asian moose. Clade structure was consistent over 6 most-parsimonious trees, with Asian haplotypes composing 1 clade, and North American and European haplotypes composing a second, albeit poorly supported clade. Low diversity of nucleotides in cytochrome-b indicated a recent ancestry among moose worldwide. Existence of 1 North American haplotype is strong evidence of a single, recent entry into the New World via the Bering land bridge, rather than multiple entries through >1 corridors. Furthermore, no phylogenetic support existed for the theory of distinct lineages of European versus Asian-North American moose. ALCES VOL. 38: 113 - 122 (2002) Key words: Alces alces, cytochrome-b, genetic diversity, mitochondrial DNA, moose, phylogeography Moose (Alces alces) arose in Eurasia in the late Pleistocene (Lister 1993), but paleontological (Guthrie 1990) and genetic (Cronin 1992) evidence indicate a recent colonization of North America. Such a recent colonization would result in charac- teristic genetic signatures in mitochondrial DNA (mtDNA), a haploid genome that is transmitted maternally and is informative for constructing population histories of closely related taxa (Avise et al. 1987). Recently colonized areas would be expected to show less genetic diversity than areas with long-established populations, particu- larly if the effective size of the founding population was low. Moreover, haplotype composition of a recently founded popula- tion would be expected to resemble the composition of the population from which the founders originated. Cronin (1992) analyzed restriction fragment length polymorphisms (RFLP) of mtDNA in North American cervids and reported that moose were unique because they exhibited no de- tectable variation. There was no compari- son to Eurasian moose in that study, how- ever, to determine the degree of difference between moose inhabiting different conti- nents. Therefore, the significance of those findings is difficult to assess. 3Present address: Department of Natural Sciences, Carroll College, Helena, MT 59601, USA 4Present address: Forestry Sciences Lab, Montana State University, Bozeman, MT 59717, USA ALCES VOL. 38, 2002 HUNDERTMARK ET AL. - CYTb VARIATION IN MOOSE 115 Cytb evolves at a moderate rate in mam- mals (Irwin et al. 1991, Lopez et al. 1997) and, consequently, often is used in phylogenetic studies of conspecific and con- generic taxa. We used our data to deter- mine if variation within North American moose would be less than variation in Eura- sian moose, and if eastern and western races of moose were represented by differ- ent lineages of mtDNA. METHODS Tissue samples were solicited from moose hunters in Alaska as well as biolo- gists from across North America, Europe, and Asia. Samples were grouped to com- prise > 1 population from the range of each North American subspecies, and those populations were combined into continent- level associations. North American sub- species and sampling locations were: A. a. gigas (n = 34) from across its range in Alaska; A. a. andersoni from central North America (USA: Minnesota, North Dakota, Isle Royale in Michigan; Canada: western Ontario and Manitoba; n = 8); A. a. shirasi from Colorado, USA (n = 2); and A. a. americana from New Hampshire, USA and New Brunswick, Canada (n = 7). The Colorado population originated from 3 translocations of moose from neighboring states: 12 animals (8 females) from the Uinta Mountains, Utah, USA, in 1978, 12 animals (11 females) from Grand Teton National Park, Wyoming, USA, in 1979, and 12 animals (10 females) from Jackson Hole, Wyoming in 1987 (Duvall and Schoonveld 1988). Asian subspecies and sources were: A. a. burturlini (n = 10), which consisted of animals from the Ola Peninsula near Magadan, and the Omolon and Chelomya Rivers, Russia; A. a. cameloides, repre- sented by 1 animal housed at a zoo in Harbin, China, and a sequence from GenBank (accession no. AY035872); and A. a. pfizenmayeri, consisting of a se- quence obtained from GenBank (accession no. AY035873). The European subspecies, A. a. alces, consisted of samples collected in Finland (n = 6) and Sweden (n = 6), as well as a sequence of a moose from Nor- way obtained from GenBank (accession no. AJ000026; Randi et al. 1998). Tissue samples consisted of skeletal muscle, liver, kidney, skin, blood, or hair. Tissues were stored temporarily at -20°C or preserved in 100% ethanol as soon as pos- sible after collection and were archived at -80°C. All tissue types except blood were subjected to salt extraction for isolation of genomic DNA. DNA from blood was extracted with chelex (Walsh et al. 1991). MtDNA was isolated from nuclear DNA and RNA from 1 moose by means of a CsCl 2 density-gradient centrifugation. That sample was used to verify the mitochondrial origin of amplified sequences. We targeted the 5’ region of the cytb gene for analysis. We amplified the se- quence with primers MVZ05 (5’— GCAAGCTTGATATGAAAAACCATCGTTG— 3’) and MVZ04 (5’—GCAGCCCCT- CAGAATGATATTTGTCCTC—3’) first described by Smith and Patton (1993). Double-stranded templates were amplified in a reaction mix containing 10 mM Tris- HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl 2 , 0.2 mM dNTP, 10 mM each primer, and 0.5 units DNA polymerase. Cycling conditions were a 2-min soak at 94°C followed by 30 cycles of 94°C (15 sec) denaturation, 50°C (15 sec) annealing, and 72°C (45 sec) ex- tension, followed by one extension period of 10 min at 72°C. PCR products were visu- alized on a 6% agarose gel with ethidium bromide staining. Cleaned PCR products were cycle sequenced (both directions) with fluorescing ddNTPs. Nucleotide composi- tion of the final products was determined on an automated sequencer (ABI 373, PE Applied Biosystems, Foster City, CA) with standard protocols supplied by the manu- CYTb VARIATION IN MOOSE - HUNDERTMARK ET AL. ALCES VOL. 38, 2002 116 facturer. Sequences were aligned with the CLUSTAL V algorithm (Higgins et al. 1992) and were edited by visual examination of electropherograms with SEQUENCE NAVIGA- TOR software (ABI). We compared nucleotide sequences of individuals and identified sites at which they differed; those data served as the basis for describing individual and population-level variation. Populations also were character- ized by haplotype diversity (H), which is the probability that 2 randomly selected indi- viduals would have different haplotypes (Nei and Kumar 2000). Nucleotide diversity (π; Nei and Li 1979), which is the probability that 2 homologous nucleotides would differ in 2 randomly chosen individuals, and number of pairwise differences, which is the number of nucleotide substitutions observed be- tween 2 haplotypes, also were determined. Those statistics were estimated with ARLEQUIN software (Schneider et al. 2000). Genetic distances between pairs of populations were computed by applying the Kimura 2-parameter model of sequence evolution (Kimura 1980). Differentiation among all populations was assessed via Φ ST , which incorporates differences in nu- cleotide and haplotype diversity within and among populations. We analyzed relation- ships among haplotypes with a maximum parsimony (branch-and-bound search) cladogram, and a neighbor-joining tree (Saitou and Nei 1987) employing 2-param- eter distance estimates. Those analyses were performed with the program MEGA version 2.0 (Kumar et al. 2001). Trees were rooted by a haplotype from fallow Table 1. Nucleotide variation within the first 403 nucleotides of the 5’ end of the mitochondrial cytochrome-b gene in moose. Only variable nucleotide positions are listed, and dots represent identity with the first sequence. All haplotypes were documented in moose from this study with the exception of Europe3, which was reported by Randi et al. (1998) from Norway. Nucleotide positions were numbered according to the bovine mitochondrial genome (Anderson et al. 1982), with the first nucleotide of cytochrome-b numbered 14514. Distributions of haplotypes by sampling location and by subspecies also are indicated. Continent Subspecies Nucleotide position Haplotype North America 55 26 20 2 7 C T T T T T C C Asia1 8 7 1 T C • • • • T • Asia2 3 1 2 T C • • • • • • Asia3 1 1 T C • • • C T • Asia4 1 1 T C • • • C • • Europe1 4 4 • • A • • • • T Europe2 8 8 • • A C • • • • Europe3 1 1 • • A C G • • • N o rt h A m e ri c a A si a E u ro p e A. a . a m er ic an a A. a . a nd er so ni A. a . s hi ra si A. a . g ig as A. a . b ur tu rl in i A. a . c am el oi de s A. a . p fiz en m ay er i A. a . a lc es 1 4 5 2 3 1 4 5 5 9 1 4 5 7 7 1 4 5 9 5 1 4 6 1 3 1 4 6 5 2 1 4 7 3 9 1 4 8 7 2 ALCES VOL. 38, 2002 HUNDERTMARK ET AL. - CYTb VARIATION IN MOOSE 117 deer (Dama dama) obtained from GenBank (accession no. X56290; Irwin et al. 1991), and haplotypes derived for this study from a caribou (Rangifer tarandus granti) col- lected in Alaska (denoted Rangfer1) and a reindeer (R. t. tarandus) collected in the Omolon River drainage of the Russian Far East (denoted Rangifer2). Confidence in the structure of the phylogenies was as- sessed through 1,000 bootstrap replicates (Felsenstein 1985). RESULTS We detected 8 variable sites within the 403 nucleotides of the 5’ end of cytb, defin- ing 8 haplotypes (Table 1). Six of the variable sites were transitions and 2 were transversions; the transversions were re- stricted to European haplotypes. The over- all transition:transversion ratio was 7:1 in- cluding outgroups and 3:1 for moose only. Six variable sites, including 1 transversion, were synonymous substitutions at the third position of codons, resulting in no substitu- tions of amino acids in the gene product. In haplotype Europe3, however, 1 transver- sion occurred at the third position of the thirty-third codon and resulted in the substi- tution of the amino acid phenylalanine with leucine. The remaining substitution was a synonymous, first-position transition in Eu- rope1. All new haplotypes described in this study, including 2 outgroup haplotypes, were submitted to GenBank and were assigned accession numbers AY090099−AY090107. We documented an extreme degree of differentiation among continents (Φ ST = 0.89), with no haplotype occurring on > 1 continent (Table 1). We identified 4 Asian, 3 European, and 1 North American haplotypes. Pairwise differences among haplotypes ranged from 1 to 7 substitutions, and associated estimates of genetic dis- tances ranged from 0.2 to 1.8% (Table 2). Estimates of mean (± SD) haplotype diver- sity for Europe (H = 0.60 ± 0.13) and Asia (H = 0.56 ± 0.11) were similar, as were estimates of nucleotide diversity for haplotypes occurring within those conti- nents (Table 3). The least genetic distance between continents was the comparison between Europe and North America, and the greatest was between Europe and Asia. Europe exhibited the greatest within conti- Table 2. Genetic distances between pairs of haplotypes for a 403-nucleotide segment of the moose cytochrome-b gene. Values above the diagonal are total numbers of substitutions, and those below the diagonal are estimates of substitutions per site using Kimura’s (1980) 2-parameter model. North America Asia1 Asia2 Asia3 Asia4 Europe1 Europe2 Europe3 North America 3 2 4 3 2 2 3 Asia1 0.008 1 1 2 5 5 6 Asia2 0.005 0.002 2 1 4 4 5 Asia3 0.010 0.002 0.005 1 6 6 7 Asia4 0.008 0.005 0.002 0.002 5 5 6 Europe1 0.005 0.013 0.010 0.015 0.013 2 3 Europe2 0.005 0.013 0.010 0.015 0.016 0.005 1 Europe3 0.007 0.015 0.013 0.018 0.015 0.007 0.002 ALCES VOL. 38, 2002 HUNDERTMARK ET AL. - CYTb VARIATION IN MOOSE 119 solved, each with 79 steps (consistency index = 0.91, retention index = 0.90). The strict consensus tree, in which only those clades present in all most-parsimonious trees are displayed, exhibited 2 primary clades of moose haplotypes consisting of a strictly Asian clade and a European-North Ameri- can clade (Fig. 2a). The neighbor-joining tree exhibited an identical structure (Fig. 2b), although bootstrap support for the clades was weak. DISCUSSION Our data are consistent with other stud- ies of genetic variability in cervids that indicate a relative lack of diversity in moose (Wilhelmson et al. 1978, Ryman et al. 1980, Baccus et al. 1983, Cronin 1992), although an instance of high genetic variability in moose has been reported (Hundertmark et al. 1992). Within the same region of cytb that we studied, Kuwayama and Ozawa (2000) reported 32 variable sites among 5 subspecies of North American elk and Euasian red deer (Cervus elaphus), and 13 variable sites within 6 subspecies of sika deer (C. nippon) restricted to the islands of Japan. The maximum number of substitu- tions between North American and Asian haplotypes in moose was 4 (all transitions). Comparatively, the minimum difference between haplotypes of North American elk (C. e. canadensis = C. e. nelsoni) and Asian red deer (C. e. kansuensis) was 5 substitutions, 3 of which were transversions (Kuwayama and Ozawa 2000). The mag- nitude of that difference indicated that, de- spite similar geographic distributions, North American elk and Asian red deer have been separated longer than North American and Asian populations of moose. The fossil record supports that conclusion (Guthrie 1966, 1990). Low levels of variability we measured in cytb within continents and small genetic distances between continents indicate a recent common ancestry for moose world- wide. Also, lack of shared haplotypes be- tween continents suggests a small number of founders or bottlenecks. If the number of founding lineages in a continent had been large, we would have expected more haplo- typic diversity within continents. Patterns of variation we observed in moose from Asia and Europe were consistent, in each instance, with founding by 1 lineage fol- lowed by divergence of 1 or 2 mutations. Parsimony analysis and genetic dis- tances indicated a closer relationship be- tween North American and European moose than between either of those and Asian moose. Thus, our data provide no support for a fundamental division of moose into European and Asian-North American clades. Rather, the Europe-North America clade was split geographically by the Asia clade, indicating that phylogenetic diver- gence was not reflected in geographic rela- tionships. That pattern is consistent with a scenario in which moose populations world- wide trace back to recent population expan- sion combined with small sizes of founding populations (Hundertmark et al. 2002). Absence of variation in cytb in North America is strong evidence for a single colonization characterized by a small effec- tive size. The relatively large haplotype diversity observed in Asian moose likely would have resulted in >1 haplotype in North America if >1 colonization event occurred or if the colonization wave was comprised of many moose. Our data indicate that Eurasian moose exhibited more diversity than moose from North America, and we find that the spatial distribution of diversity within cytb supports the idea of establishment of continental or regional populations of moose via expansion from small numbers of founders. Moreo- ver, the sharing of 1 haplotype between A. a. cameloides and A. a. burtulini indicated either recent divergence of those populations CYTb VARIATION IN MOOSE - HUNDERTMARK ET AL. ALCES VOL. 38, 2002 120 or the presence of female-mediated gene flow and provided no evidence of an ex- treme temporal separation of A. a. cameloides from other Asian subspecies. Finally, our data indicate a single entry of moose into North America from Asia, and do not support a fundamental division of moose into European and Asian-North American clades. ACKNOWLEDGEMENTS Funding for this research was provided by Federal Aid in Wildlife Restoration, The Boone and Crockett Club, and the Institute of Arctic Biology, University of Alaska Fairbanks (UAF). The core DNA sequencing facility at UAF was funded by the National Science Foundation. We thank all the biologists that submitted tissue sam- ples for this research. The manuscript benefited from reviews by M. A. Cronin and an anonymous reviewer. REFERENCES ANDERSON, S., M. S. DE BRUIJN, A. R. COULSON, I. C. EPERON, F. SANGER, and I. G. YOUNG. 1982. Complete sequence of the bovine mitochondrial genome. Journal of Molecular Biology 156:683- 717. AVISE, J. C., J. ARNOLD, R. M. BALL, JR., E. BERMINGHAM, T. LAMB, J. E. NEIGEL, C. A. REEB, and N. C. SAUNDERS. 1987. Intraspecific phylogeography: the mito- chondrial DNA bridge between popula- tion genetics and systematics. Annual Review of Ecology and Systematics 18:489-522. BACCUS, R., N. RYMAN, M. H. SMITH, C. REUTERWALL, and D. CAMERON. 1983. Genetic variability and differentiation in large grazing mammals. Journal of Mammalogy 64:109-120. BOESKOROV, G. G. 1996. Karyotype of moose (Alces alces L.) from north- eastern Asia. Proceedings of the Rus- sian Academy of Sciences 329:506- 508. (In Russian). . 1997. Chromosomal differences in moose. Genetika 33:974-978. (In Russian). CRONIN, M. A. 1992. Intraspecific variation in mitochondrial DNA of North Ameri- can cervids. Journal of Mammalogy 73:70-82. DEMBOSKI, J. R., B. K. JACOBSEN, and J. A. COOK. 1998. Implications of cyto- chrome-b sequence variation for bioge- ography and conservation of the north- ern flying squirrel (Glaucomys sabrinus) of the Alexander Archi- pelago. Canadian Journal of Zoology 76:1771-1777. DUVALL, A. C., and G. S. SCHOONVELD. 1988. Colorado moose: reintroduction and management. Alces 24:188-194. FELSENSTEIN, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791. FLEROV, K. K. 1952. Fauna of USSR: mammals. Volume I Number. 2. Musk deer and deer. The Academy of Sci- ences of the USSR, Leningrad. (Eng- lish translation by The Israel Program for Scientific Translation, 1960, S. Monson, Jerusalem). GEIST, V. 1998. Deer of the world: their evolution, behavior, and ecology. Stackpole Books, Mechanicsburg, Penn- sylvania, USA. GROVES, C. P., and P. GRUBB. 1987. Rela- tionships of living deer. Pages 3-59 in C. M. Wemmer, editor. Biology and management of the Cervidae. Smithsonian Institution Press, Wash- ington, D.C., USA. GUTHRIE, R. D. 1966. The extinct wapiti from Alaska and Yukon Territory. Canadian Journal of Zoology 44:47-57. . 1990. New dates in Alaskan Quaternary moose, Cervalces-Alces — ALCES VOL. 38, 2002 HUNDERTMARK ET AL. - CYTb VARIATION IN MOOSE 121 archaeological, evolutionary and eco- logical implications. Current Research in the Pleistocene 7:111-112. HIGGINS, D.G., A. J. BLEASBY, and R. FUCHS. 1992. CLUSTAL V: improved soft- ware for multiple sequence alignment. Computer Applications in the Biosciences 8:189-191. HILLIS, D. M., and C. MORITZ. 1990. An overview of applications of molecular systematics. Pages 502-515 in D. M. Hillis and C. Moritz, editors. Molecular Systematics. Sinauer, Sunderland, Massachusetts, USA. HUNDERTMARK, K. J., P. E. JOHNS, and M. H. SMITH. 1992. Genetic diversity of moose from the Kenai Peninsula, Alaska. Alces 28:15-20. , G. F. SHIELDS, I. G. UDINA, R. T. BOWYER, A. A. DANILKIN, and C. C. SCHWARTZ. 2002. Mitochondrial phylogeography of moose (Alces alces): late Pleistocene divergence and popu- lation expansion. Molecular Phylogen- etics and Evolution 22:375-387. IRWIN, D. M., T. D. KOCHER, and A. C. WILSON. 1991. Evolution of the cyto- chrome-b gene in mammals. Journal of Molecular Evolution 32:128-144. KIMURA, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative stud- ies of nucleotide sequences. Journal of Molecular Evolution 16:111-120. KUMAR, S., K. TAMURA, I. B. JAKOBSEN, and M. NEI. 2001. MEGA2: Molecular Evolutionary Genetic Analysis software. Bioinformatics 17:1244-1245. KUWAYAMA, R., and T. OZAWA. 2000. Phylogenetic relationships among Eu- ropean red deer, wapiti, and sika deer inferred from mitochondrial DNA se- quences. Molecular Phylogenetics and Evolution 15:115-123. LISTER, A. M. 1993. Evolution of mam- moths and moose: the Holarctic per- spective. Pages 178-204 in A. D. Barnosky, editor. Quaternary mam- mals of North America. Cambridge University Press, Cambridge, U. K. LOPEZ, J. V., M. CULVER, J. C. STEPHENS, W. E. JOHNSON, and S. J. O’BRIEN. 1997. Rates of nuclear and cytoplasmic mito- chondrial DNA sequence divergence in mammals. Molecular Biology and Evo- lution 14:277-286. MIKKO, S., and L. ANDERSSON. 1995. Low major histocompatibility complex class II diversity in European and North American moose. Proceedings of the National Academy of Sciences of the USA 92:4259-4263. NEI, M., and S. KUMAR. 2000. Molecular evolution and phylogenetics. Oxford University Press, New York, New York, USA. , and W.-H. LI. 1979. Mathemati- cal models for studying genetic varia- tion in terms of restriction endonucleases. Proceedings of the National Academy of Sciences of the USA 76:5269-5273. RANDI, E., N. MUCCI, M. PIERPAOLI, and E. DOUZERY. 1998. New phylogenetic perspectives on the Cervidae (Artio- dactyla) are provided by the mitochon- drial cytochrome-b gene. Proceedings of the Royal Society of London, Series B 265:793-801. RYMAN, N., C. REUTERWALL, K. NYGREN, and T. NYGREN. 1980. Genetic variation and differentiation in Scandinavian moose (Alces alces): are large mam- mals monomorphic? Evolution 34:1037- 1049. SAITOU, N., and M. NEI. 1987. The neighbor- joining method: a new method for re- constructing phylogenetic trees. Mo- lecular Biology and Evolution 4:406- 425. SCHNEIDER, S., J.-M. KUEFFER, D. ROESSLI, and L. EXCOFFIER. 2000. ARLEQUIN ver CYTb VARIATION IN MOOSE - HUNDERTMARK ET AL. ALCES VOL. 38, 2002 122 2.000: A software for population ge- netic analysis. Genetics and Biometry Laboratory, University of Geneva, Swit- zerland. SMITH, M. F., and J. L. PATTON. 1993. The diversification of South American murid rodents: evidence from mitochondrial DNA sequence data of the akodontine tribe. Biological Journal of the Linnean Society 50:149-177. TALBOT, S. L., and G. F. SHIELDS. 1996. Phylogeography of brown bears (Ursus arctos) of Alaska and paraphyly within the Ursidae. Molecular Phylogenetics and Evolution 5:477-494. UDINA, I. G., A. A. DANILKIN, and G. G. BOESKOROV. 2002. Genetic diversity of moose (Alces alces L.) in Eurasia. Genetika 38:951-957. (In Russian). WALSH, P.S., D. A. METZGER, and R. HIGUCHI. 1991. Research report: chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 10:506-513. WILHELMSON, M., R. K. JUNEJA, and S. BENGTSSON. 1978. Lack of polymor- phism in certain blood proteins and en- zymes of European and Canadian moose (Alces alces). Naturaliste Canadien 105:445-449.