Microsoft Word - 137-797-1-LE.docx

Identification of Endogenous Bacteria in
Micropropagated Helleborus ×nigercors

Lindsay Caesar, M. Melissa Hayes, and Jeffrey
Adelberg
All Res. J. Biol., 2016, 7, 41-46

The publication cost of this article might be covered by external sponsors. More info for
sponsors at: sponsors@arjournals.com

ARTICLE

Issue 4, Vol 7, 2016, 41-46

Identification of Endogenous Bacteria in Micropropagated
Helleborus ×nigercors

Lindsay Caesar a,*, M. Melissa Hayes b, and Jeffrey Adelberg a
a Department of Plant and Environmental Sciences, Clemson University, Clemson SC
b Department of Animal and Veterinary Sciences, Clemson University, Clemson, SC

2332 Hiawatha Drive, Greensboro NC 27408, *Corresponding author email: lindsaycaesar@gmail.com

Graphical Abstract:

Abstract: During micropropagation of Helleborus ×nigercors, plantlets were observed to be bacterially
contaminated. To determine the identity of contaminants, bacteria resistant to surface sterilization were isolated
and Gram stained. Polymerase Chain Reaction (PCR) and 16S rRNA sequencing were used to identify bacterial
isolates H7G and H7S as belonging to the Paenibacillus and Luteibacteri genera, respectively. Strain H7R had
highest sequence similarity to the Pseudomonas, Stenotrophomonas, and Lysobacter genera. Strains H7R and
H7S were unable to grow in the absence of plant tissue and other bacterial species. Paenibacillus sp. H7G was
screened using combinations of antibiotics including streptomycin sulfate, gentamicin sulfate, and cefotaxime,
and was only eradicated by concentrations of gentamicin sulfate above phytotoxic levels. This is the first
documented exploration of bacterial endophytes associated with Helleborus species.

Keywords: Endophytes; Helleborus ×nigercors; Micropropagation; Antibiotics

Introduction

An endophyte is an organism living within plant tissue. The
term is associated with microbial organisms that are
symbionts, often mutualists, which provide plants with a
benefit of some kind, such as protection against pathogens or
aid in rooting (Wilson 1995). Endophytic organisms are of
special interest to the scientific community due to the close
biological complexes they develop with their hosts. Because
of these close interactions, they may possess a range of
biological activities that contribute to the plant’s success in
nature (Strobel 2003).

Endophytes found in micropropagated plantlets have in some
cases been shown to lower plant quality due to the lack of
competition that the ‘biological vacuum’ within sterile,
carbohydrate-rich vessels promotes (Cassells 1997).
However, in other cases, bacterial endophytes have
contributed to plant growth by promoting hormone
production and aiding in rooting (Dias et al. 2009; Lata et al.
2006).

During the multiplication stage, micropropagated plantlets of
Helleborus ×nigercors were observed to be visibly
contaminated with bacteria as indicated by the presence of a
gray halo around the base of plantlets. Following sterilization
with sodium hypochlorite, three bacteria remained prevalent

All Res. J. Biol, 2016, 7, 41-46

in culture. These three bacteria were likely harbored within
the plant tissue, allowing them to survive surface
sterilization. To better understand the biological complex
found in hellebore cultures, putative endophytic bacteria
were isolated and characterized. Although fungal endophytes
have been isolated from other members of the Helleborus
genus (Spadaro et al. 2014), this is the first study in which
bacterial endophytes have been identified.

Materials and Methods

Plant Material and Reinitiation Procedure. Plant material
for micropropagation was obtained from Pine Knot Farms in
Clarksville, Virginia, where the original cross was
completed. Parent plants were grown in containers with a
combination of native soil characterized by silt loam on top
of fine, kaolinitic red clay, PermaTill® (Arden, NC), and
Metro Mix® 852 heavyweight bark mix (BFG Supply Co.;
Burton, OH). Shoot tips were initially sterilized at the
Institute for Sustainable and Renewable Resources© (ISRR;
Danville, Virginia), following which they were transferred to
Clemson University for propagation.

Initiated plantlets were multiplied for several cycles before
contamination was evident by clouding of the media. Thirty-
two contaminated plantlets were disinfested using four
possible treatment combinations: high or low bleach
concentrations (0.83% and 0.41% sodium hypochlorite,
respectively), and short and long time intervals (1 and 4 min).
After soaking in the bleach solution, plantlets were rinsed
twice with sterile deionized water and placed into Smithers-
Oasis flexible Tissue Culture Vessels (Smither-Oasis, Kent,
OH). Vessels contained 25 mL of liquid WPM salts (Lloyd
and McCown 1980) at pH 5.7, 3% sucrose, and 9 µM TDZ.
Plants were placed under 28 µmol m-2 s-1 delivered from
monochromatic LED lights (33.3% blue, 66.7% red) at 10-13
°C on a rocker shaker (EW-51301-00, Cole-Parmer® Portable
Rocker Shaker, Vernon Hills, IL) set to 3 rpm.

Isolation and Characterization of Endogenous Bacteria.
Slices of callus from reinitiated plantlets were streaked onto
Petri plates containing tryptic soy agar (TSA) (470193-226,
VWR Scientific Products, Suwanee, GA) and incubated for
24 h at 30 °C to detect contamination. To establish purity of
culture, individual colonies were subcultured, incubated for
24 h, and stored in a refrigerator at 10 °C in darkness.
Individual colonies from subcultured plates were restreaked
to maintain vigor. Individual colonies were selected at
random from the agar plates for genetic analysis. Gram
reactions and colony and cell morphological characteristics
were repeated in triplicate.

Polymerase chain reaction (PCR) was conducted on culture
isolates using a transfer loop to inoculate each culture into a
sterile Eppendorf tube (20901-547, VWR Scientific Products,
Suwanee, GA) containing 50 µL of Promega nuclease free
water (PAP1195, VWR Scientific Products, West Chester,
PA). Tubes containing the culture and water mixtures were
placed into boiling water for 10 min. After boiling, 12.5 µL
of the mixture was transferred to a sterile PCR tube to be
used as a DNA template. Two primers were added to the

tube: 1 µL of the forward oligonucleotide primer (16S rRNA
For, 5’AGAGTTTGATCCTGGCTCAG 3’, ReadyMadeTM
Primers, Integrated DNA Technologies, Coralville, IA), and
1 µL of the reverse oligonucleotide primer (16S rRNA
Rev,5’ACGGCTACCTTGTTACGACTT 3’, ReadyMadeTM
Primers, Integrated DNA Technologies, Coralville, IA), as
well as 10.5 µL of Promega GoTaq® Green Master Mix
(PAM7122, VWR Scientific Products, West Chester PA).

Each PCR reaction tube containing the DNA template,
primers, and GoTaq® Green Master Mix was placed in a
thermocycler (iCycler iO, BioRad Laboratories, Inc.,
Richmond, CA). The thermal cycle program consisted of 1
cycle of 95 °C for 2 min, followed by 30 repeating cycles of
94 °C for 30 s, 50.6 °C for 30 s, 72 °C for 1 min, and a final
extension at 72° C for 5 min. The cycling program ended by
holding the tubes at 4 °C until removal from the thermocycler
(Hayes et al. 2012; Promega Corporation 2012). Prior to
sequencing, the concentration and 260:280 ratio of the PCR-
amplified products was measured using a NanoDrop 2000
spectrophotometer (ND-2000, Thermo Fischer Scientific,
Pittsburg, PA).

The PCR-amplified products were observed by gel
electrophoresis in 1.5% agarose gels. Ten µL of each PCR
product and the HyLadderTM molecular mass marker
(Denville Scientific Inc., CB4225-2, Metuchen, NJ) were
examined using agarose gel electrophoresis with subsequent
ethidium bromide staining (97064-970, VWR Scientific
Products, Suwanee, GA). The amplified DNA fragments
were visualized by UV illumination.

Purification of PCR products was completed with Promega
Wizard® SV Gel and PCR Clean-Up System (PAA9281,
VWR Scientific Products, Suwanee, GA). The 16S rRNA
sequencing was completed through the Clemson University
Genomic Institute© (CUGI). BioEdit (Version 7.2.5) was
used to align sequences and to compile consensus sequences
from forward and reverse primers. Sequences were
examined using the National Center for Biotechnology
Information (NCBI) BLAST database (Altschul et al. 1997).
The top BLAST nucleotide/16S rRNA database results with
maximum identity greater than 97% were reported.

Choice of Antibiotics and Susceptibility Tests. Minimal
bactericidal concentrations of single antibiotics and antibiotic
combinations were determined using a tube dilution method.
Original bacterial isolates were transferred into broth cultures
containing 3% sucrose and ½ strength MS medium
(Murashige and Skoog 1962). Following clouding of
medium, Gram stains were done to confirm the presence of
original strains. Twelve single antibiotic treatments were
tested in triplicate: streptomycin sulfate (S; 1000, 500, 250,
or 125 µg mL⁻1), cefotaxime (C; 500, 250, 125, or 62.5 µg
mL⁻1), and gentamicin sulfate (G; 50, 25, 12.5 or 6.25 µg
mL⁻1). In addition, twelve combination treatments were
prepared: streptomycin sulfate + cefotaxime (250 + 125, 250
+ 62.5, 125 + 125, and 125 + 62.5 µg mL⁻1), streptomycin
sulfate + gentamicin sulfate (250 + 12.5, 250 + 6.25, 125 +
12.5, and 125 + 6.25 µg mL⁻1), and cefotaxime + gentamicin
sulfate (125 + 12.5, 125 + 6.25, 62.5 + 12.5, and 62.5 + 6.25

All Res. J. Biol, 2016, 7, 41-46

µg mL⁻1). Antibiotics were diluted in 5 mL of deionized
water containing 3% sucrose and ½ strength MS liquid
medium (Murashige and Skoog 1962). Following
preparation of media, 1 mL of broth cultures containing
bacterial isolates were added to each treatment and
inoculated in flat-bottomed vials (O.D. x H.: 29x94 mm;
Fisher glass shell vials, Thermo Fisher Scientific Inc.,
Pittsburg, PA) for 7 days at 25 °C.

After 7 days, 1 mL of the inoculated antibiotic cultures was
transferred into flat-bottomed vials containing the same
media formulation without antibiotics. These tubes were
inoculated at 25 or 35 °C for an additional 7 days. Following
inoculation, growth was assessed. Tubes showing no growth
were designated as bactericidal. The lowest concentration in
each treatment showing no growth was termed the minimal
bactericidal concentration (MBC).

Phytotoxicity tests and antibiotic treatment of plantlets. H.
×nigercors plantlets were treated with single antibiotics (ug
mL-1): 12.5 (G) and 50 (G), and combinations of two
antibiotics: 125 (S) + 12.5 (G), 250 (S) and 25 (G), 62.5 (C)
+ 12.5 (G), and 125 (C) + 25 (G). Plantlets of H. ×nigercors
known to be contaminated with three endogenous bacteria
were totally submerged in ½ strength liquid MS medium with
and without the aforementioned antibiotic treatments in
Magenta™ GA7 boxes (Magenta® Corp., Chicago, IL) and
placed at 10-12 °C under 28 µmol m⁻2 s⁻1 monochromatic
LED lights (33.3% blue, 66.7% red) for 12 days on a rocker
(EW-51301-00, Cole-Parmer® Portable Rocker Shaker,
Vernon Hills, IL) set to 3 rpm. Each of the four treatments
contained three boxes, with three plantlets per box.

Following antibiotic treatment, bases of plants were streaked
onto TSA medium and plantlets were transferred to a
multiplication medium. Phytotoxicity was ranked on a
subjective numerical scale from 0-4, with a score of 0
indicating no phytotoxicity symptoms and a score of 4
indicating severe phytotoxicity or death. Plantlets showing
phytotoxicity symptoms were judged on the presence of
chlorosis, tissue browning, softening of tissue, and
morphological changes. Plantlets were subcultured in four-
week cycles, and plant condition and bacterial contaminants
recorded during transfer.

Results and Discussion

Genetic Identification and Morphological Characteristics
of Bacterial Isolates. After plantlet reinitiation and
subsequent streaking of Helleborus ×nigercors callus on
TSA plates, bacterial colonies were visible after three days.
All bacterial isolates were Gram-negative and individual cells
were rod-shaped. Using 16S rRNA sequence analysis, Gram
stain results, and colony morphology, isolates were identified
to the genus level (Table 1).

Strain H7G (GenBank accession no. KU721939) was
identified as a member of the Paenibacillus genus and was
characterized by colonies that were grey, round, and opaque.
Members of this genus have been found as endophytes in

plant species including pine, coffee, poplar (Ulrich et al.
2008), and barley (Rasimus et al. 2012). Many endophytic
Paenibacilli produce compounds that aid in plant growth,
such as auxins, cytokinins, and antibiotics (Ulrich et al. 2008;
McSpadden Gardener 2004). Most Paenibacilli grow in cool
temperatures (Rasimus et al. 2012), and some have been
isolated from Alaskan tundra (Nelson et al. 2009). The cold-
loving tendencies of this genus are consistent with their
growth and persistence within tissues of the frost-tolerant and
winter-flowering Helleborus ×nigercors.

Strain H7S (GenBank accession no. KU721940), with small,
light yellow colonies, was identified as a member of the
Luteibacter genus. This genus was discovered in 2005 from
the rhizosphere of spring barley (Johansen et al. 2005). All
members of this genus are yellow-pigmented, aerobic, Gram-
negative rods (Kämpfer et al. 2009), which is consistent with
the morphological characteristics of strain H7R. Luteibacter
rhizovicinus, the first species discovered from the genus, has
been isolated from micropropagated Malus domestica
“Golden Delicious” plantlets (Guglielmetti et al. 2013),
where it lowered shoot regeneration abilities (Piagnani et al.
2007), and from micropropagated barley plantlets, where
rooting was stimulated (Guglielmetti et al. 2013).

Strain H7R (GenBank accession no. KU729138) had high
sequence similarity (> 97%) with three genera ubiquitous in
soils: Stenotrophomonas, Pseudomonas, and Lysobacter
(Table 1). Because these genera also share many genotypic
and phenotypic similarities, 16S rRNA is often inadequate to
differentiate between members of these genera (Svensson-
Stadler et al. 2012; Hayward et al. 2010). The genus
Stenotrophomonas is comprised of several species of bacteria
that show a range of activities including plant-growth
promotion (Zhu et al. 2012), antibiotic production (Hayward
et al. 2010), and pathogenicity (Ryan et al. 2009; Nyč and
Matĕjková 2010). Endophytic strains of Stenotrophomonas
maltophilia have been isolated from cucumber, oilseed rape,
potato, strawberry, alfalfa, maize, sunflower, rice, wheat,
willow, and poplar (Ryan et al. 2009), but some have
developed antibiotic resistance to chloramphenicol and
quinolone antibiotics (Nyč and Matĕjková 2010; Alonso and
Martinez 1997). Members of the Pseudomonas genus
include endophytic species such as those isolated from tulip
poplar trees (Liriodendron spp.) and willows (Salix
gooddingii), where they may produce rooting hormones
through multiple pathways (Taghavi et al. 2009). Lysobacter
species have been isolated from the rhizosphere of rice
(Aslam et al. 2009) and ginseng (Srinivasan et al. 2010).
Lysobacter spp. are often studied as biological control agents
due to their predatory activity against Gram-negative and
Gram-positive bacteria, blue-green algae, yeasts, fungi, and
nematodes (Hayward et al. 2010; Sullivan et al. 2003).

Choice of Antibiotics and Susceptibility Tests. Streptomycin
sulfate and gentamicin sulfate are aminoglycoside antibiotics
that show effectiveness in controlling Gram-negative
bacteria. Cefotaxime, a beta-lactam antibiotic, was chosen in
addition to these two aminoglycosides due to the
effectiveness of beta-lactams against resistant strains of

All Res. J. Biol, 2016, 7, 41-46

Table 1. Endophytic bacteria isolates identified using Gram reaction and cell morphology and 16S rRNA sequencing analysis.

a Bacterial candidates not fitting the Gram reaction and morphology observed were not included in the top identity matches
b Percentages from 16S rRNA database listed first, followed by percent matches from the nucleotide database, if applicable

Stenotrophomonas maltophilia, a candidate genus for strain
H7R (Alonso and Martinez 1997). Before antibiotic
treatment, however, broth cultures containing bacteria were
Gram stained to confirm monocultures. Luteibacter H7S and
strain H7R were not included in the remainder of the
experiments due to lack of growth in control tubes after three
weeks. Possibly, these strains showed initial growth in
culture due to storage of a vital nutrient obtained directly
from the plant tissue. Following isolation and initial
proliferation, the amount stored may have become inadequate
for growth.

Initial experiments indicated that Paenibacillus sp. H7G was
not affected by streptomycin sulfate, cefotaxime, or
combinations of the two. Gentamicin sulfate was most
effective, with an MBC of 12.5 µg mL⁻1. MBCs were used to
determine plant treatments. Since only treatments containing
at least 12.5 µg mL⁻1 of gentamicin sulfate were bactericidal,

only these treatments were were evaluated for phytotoxicity
and effective elimination of bacteria from plant material.

Shoot tips of H. ×nigercors showed some symptoms of
phytotoxicity (browning of outer leaves and minor chlorosis)
immediately after treatment with single treatments and
combinational treatments containing 12.5 µg mL⁻1
gentamicin sulfate. Interestingly, control plants often had
minor symptoms, indicating that submersion in media, even
without antibiotics, causes some stress to plantlets. Plantlets
treated with 25 µg mL⁻1 gentamicin sulfate and 125 µg mL⁻1
cefotaxime or 25 µg mL⁻1 gentamicin sulfate and 250 µg
mL⁻1 streptomycin sulfate showed more severe phytotoxicity,
with shoots showing tissue browning and tissue softening.
Plantlets in the 50 µg mL⁻1 gentamicin treatment were
affected most severely, and 22% of the plantlets did not
survive the treatment. After a month of growth in non-
antibiotic containing media, plantlets remained low quality.
All plantlets from the 50 µg mL⁻1 treatment and 33% of

Isolate

Gram Reaction
and Cell
Morphology

Colony color
(on tryptic soy
agar)

16S Bacteria Identification (>97% top
identity matches) a

16S rRNA/ nucleotide
database % match b

Isolate 1
(H7G)

Negative rod

Grey

Paenibacillus xylanexedens
Paenibacillus tundrae
Paenibacillus amylolyticus
Paenibacillus taichungensis

98%, 99%
99%, 99
98%, 98%
98%, N/A

Isolate 2
(H7S)

Negative rod

Yellow

Luteibacter rhizovicinus
Luteibacter anthropi
Luteibacter yeojuensis

98%, 98%
98%, 98%
97%, N/A

Isolate 3
(H7R)

Negative rod

Beige

Stenotrophomonas maltophilia
Stenotrophomonas pavanii
Stenotrophomonas chelatinphaga
Stenotrophomonas humi
Stenotrophomonas terrae
Stenotrophomonas nitritireducens
Stenotrophomonas panacihumi
Stenotrophomonas ginsengisoli
Stenotrophomonas rhizophila
Stenotrophomonas daejeonensis
Stenotrophomonas acidiminiphilia
Stenotrophomonas koreensis
Pseudomonas geniculata
Pseudomonas hibiscicola
Pseudomonas pictorum
Lysobacter enzymogens
Lysobacter soli
Lysobacter rushenii
Lysobacter oryzae
Lysobacter yangpyeongensis

100%,100%
100%, N/A
100%, N/A
100%, N/A
99%, N/A
99%, N/A
99%, N/A
99%, N/A
99%, N/A
99%, N/A
99%, N/A
98%, N/A
100%, 100%
99%, 100%
99%, 100%
99%, N/A
98%, N/A
98%, N/A
98%, N/A
98%, N/A

All Res. J. Biol, 2016, 7, 41-46

plantlets from the 25 µg mL⁻1 gentamicin sulfate and 250 µg
mL⁻1 streptomycin sulfate died, showing a failure to re-
acclimate after antibiotic treatment. Surviving plantlets were
very low quality, showing tissue blackening, shoot tip
necrosis, and tissue softening (Table 2).

Table 2. Phytotoxicity rankings and survival percentages of H.
×nigercors plantlets treated with two single treatments of
gentamicin sulfate (G), two combination treatments of gentamicin
sulfate (G) and cefotaxime (C), and two combination treatments of
gentamicin sulfate (G) and streptomycin sulfate (S) for 12 days.

Antibiotic
Treatment
(µg mL⁻1)

Average
Phytotoxicity
Ranking a

Survival
Percentage b

Control 1.00 100%
G(12.5) 1.67 100%
G(50) 3.67 0%
G(12.5) +
C(62.5)

1.67 100%

G(25) + C(125) 2.00 100%
G(12.5) +
S(125)

1.67 100%

G(25) + S(250) 3.00 67%
a Phytotoxicity scores were subjectively determined from 0-4, with a
score of 0 indicating no phytotoxicity symptoms and a score of 4
indicating extremely severe symptoms, including blackening of
plant tissue and death.
b Results taken after the second cycle as a percentage of the original
number of plantlets placed in treatment. Original treatments used 3
Magenta GA7 boxes with 3 plantlets/box.

Antibiotic Effectiveness on Plant Tissue. Initial experiments
indicated that the 12-day antibiotic treatments of all single
and combinational treatments containing 12.5 µg mL⁻1
gentamicin were ineffective for eliminating bacteria from
culture, with all treatments showing the growth of at least one
species. MBCs are used as starting points for determining
effective treatments, and treatment concentrations required to
penetrate plant tissues and maintain bactericidal effects are
often two to four times higher than the MBCs (Leifert et al.
1991). When concentrations of gentamicin sulfate were
quadrupled (50 µg mL⁻1), up to 44% of plantlets showed no
bacterial growth after the first 4-week cycle of treatment.
After the second cycle, bacterial growth resumed completely,
indicating that initial success was due to a slowing of
bacterial growth rather than colony death (Table 3).

Table 3. Ratio of bacteria-free hellebore shoots to contaminated
shoots in plantlets treated with two single treatments of gentamicin
sulfate (G), two combination treatments of gentamicin sulfate (G)
and cefotaxime (C), and two combination treatments of gentamicin
sulfate (G) and streptomycin sulfate (S) for 12 days.

Treatment
(µg mL⁻1)

Cycle 1 Cycle 2
Bacteria-free plants/treated plants

G(12.5) 0/9 --
G(50) 0/9 --
G(12.5) + C(62.5) 0/9 --
G(25) + C(125) 4/9 0/9
G(12.5) + S(125) 0/9 --
G(25) + S(250) 3/9 0/9

Conclusions

The establishment of aseptic culture is one of the major
challenges associated with micropropagation of H.
×nigercors. Antibiotic treatments were unsuccessful at
eliminating these endogenous bacteria due to the severe
phytotoxicity associated with high antibiotic concentrations.
Combinational treatments showed initial success, but proved
to have bacteriostatic properties rather than bactericidal
properties when penetrating plant tissues.

This is the first study in which endophytic bacteria have been
characterized from members of the Helleborus genus. While
the evidence points to internal habitation by these strains,
further studies are necessary to determine if these bacteria
have beneficial, neutral, or negative effects on the growth of
H. ×nigercors. Since antibiotic treatment was unsuccessful,
plants containing endogenous bacteria could not be compared
to aseptic plants. As such, additional studies are necessary to
define protocols to eliminate internal contaminants in order
to characterize these organisms and assess their impact on
performance of micropropagated plantlets of H. ×nigercors.

Acknowledgements: The authors would like to thank the
Institute of Advanced Learning and Research (IALR) in
Danville, Virginia, for their funding of this project.
Acknowledgements are also given to Dr. Huzefa Raja for his
assistance with GenBank submissions and data analysis.

References

Alonso A., and Martínez J.L. (1997). Multiple antibiotic
resistance in Stenotrophomonas maltophilia. Antimicrob.
Agents and Chemother. 41, 1140-1142.

Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang
Z., Miller W., and Lipman D.J. (1997). Gapped BLAST and
PSI-BLAST: A new Generation of protein database search
programs. Nucleic Acids Res. 25, 3389-3402.

Aslam Z., Yasir M., Jeon C.O., and Chung Y.R. (2009).
Lysobacter oryzae sp. nov., isolated from the rhizosphere of
rice (Oryza sativa L.). Int. J. Syst. Evol. Microbiol. 59, 675-
680.

Cassells A.C. (1997). Pathogen and Microbial Contamination
Management in Micropropagation—An Overview. In
Pathogen and Microbial Contamination Management in
Micropropagation, A.C. Cassells, ed. (Kluwer Academic
Publishers, Netherlands), pp. 1-13.

Dias, A.C., Costa, F.E., Andreote, F.D., Lacava, P.T.,
Teixeira, M.A., Assumpção, Araújo, W.L., Azevedo, J.L.,
and Melo, I.S. (2009). Isolation of micropropagated
strawberry endophytic bacteria and assessment of their
potential for plant growth promotion. World J. Microbiol.
Biotechnol. 25, 189-195.

Guglielmetti S., Basilico R., Taverniti V., Arioli S., Piagnani
C., and Bernacchi A. (2013). Luteibacter rhizovicinus
MIMR1 promotes root development in barley (Hordeum

All Res. J. Biol, 2016, 7, 41-46

vulgare L.) under laboratory conditions. World J. Microbiol.
Biotechnol. 29, 2025-2032.

Hayes M.M., Hughes T.A., and Greene A.K. (2012).
Bacterial Diversity in Dried Colostrum and Whey Sold as
Nutraceutical Products. J. Food Sci. 77, M359-M363.

Hayward A.C., Fegan N., Fegan M., and Stirling G.R.
(2010). Stenotrophomonas and Lysobacter: ubiquitous plant-
associated gamma-proteobacteria of developing significance
in applied microbiology. J. Appl. Microbiol. 108, 756-770.

Johansen J.E., Binnerup S.J., Kroer N., and Mølback L.
(2005). Luteibacter rhizovicinus gen. nov., sp. nov., a yellow-
pigmented gammaproteobacterium isolated from the
rhizosphere of barley (Hordeum vulgare L.). Int. J. Syst.
Evol. Microbiol. 55, 2285-2291.

Kämpfer P., Lodders N., and Falsen E. (2009). Luteibacter
anthropi sp. nov., isolated from human blood, and
reclassification of Dyella yeojuensisis. Int. J. Syst. Evol.
Microbiol. 59(11), 2884-2887.

Lata, H., Li, X.C., Silva, B., Moraes, R.M., and Halda-Alija,
L. (2006). Identification of IAA-producing endophytic
bacteria from micropropagated Echinacea plants using 16S
rRNA sequencing. Plant Cell Tissue Organ. Cult. 85, 353-
359.

Leifert C., Camotta H., Wright S.M., Waites B., Cheyne
V.A., and Waites W.M. (1991). Elimination of Lactobacillus
plantarum, Corynebacterium spp., Staphylococcus
saprophyticus and Pseudomonas paucimobilis from
micropropagated Hemerocallis, Choisya and Delphinium
cultures using antibiotics. J. Appl. Bacteriol. 71, 307-330.

Lloyd G., and McCown B. (1980). Commercially-feasible
micropropagation of mountain laurel, Kalmia latifolia, by use
of shoot-tip culture. Proc. Int. Plant Prop. Soc. 30, 421-427.

McSpadden Gardener, B.B. (2004). Ecology of Bacillus and
Paenibacillus spp. in Agriculture. Phytopathology 94, 1252-
1258.

Murashige T., and Skoog F. (1962). A Revised Medium for
Rapid Growth and Bioassays with Tobacco Tissue Cultures.
Physiol. Plant 15, 473-497.

Nelson D.M., Glawe A.J., Labeda D.P., Cann I.K., and
Mackie R.I. (2009). Paenibacillus tundrae sp. nov. and
Paenibacillus xylanexedens sp. nov., psychrotolerant, xylan-
degrading bacteria from Alaskan tundra. Int. J. Syst. Evol.
Microbiol. 59, 1708-1714.

Nyč O., and Matĕjková J. (2010). Stenotrophomonas
maltophilia: Significant Contemporary Hospital Pathogen—
review. Folia Microbiol. 55, 286-294.

Piagnani M.C., Guglielmetti S., and Parini C. (2007).
Identification and effect of two bacterial contaminants on
apple organogenesis. Acta Hortic. 738, 335-339.

Promega Corporation. (2012). GoTaq ® Green Master Mix
Usage Information. Madison, WI www.promega.com.

Rasimus S., Mikkola R., Andersson M.A., Teplova V.V.,
Venediktova N., Ek-Kommonen C., and Salkinoja-Salonen
M. (2012). Psychrotolerant Paenibacillus tundrae isolates
from barley grains produce new cereulide-like depsipeptides
(paenilide and homopaenilide) that are highly toxic to
mammalian cells. Appl. Environ. Microbiol. 78(10), 3732-
3743.

Ryan R.P., Monchy S., Cardinale M., Taghavi S., Crossman
L., Avison M.B., Berg G., van der Lelie D., and Dow J.M.
(2009). The versatility and adaptation of bacteria from the
genus Stenotrophomonas. Nat. Rev. Microbiol. 7, 514-525.

Spadaro, V., Raimondo, F.M., and Pasqualetti, M. (2014).
Molecular and taxonomic characterization of an endophytic
fungus isolated from Helleborus bocconei subsp. intermedius
(Ranunculaceae). Fl. Medit. 24, 71-78.

Srinivasan S., Kim M.K., Sathiyaraj G., Kim H., Kim Y., and
Yang D. (2010). Lysobacter soli sp.nov., isolated from soil of
a ginseng field. Int. J. Syst. Evol. Microbiol. 60, 1543-1547.

Strobel, G.A. (2003). Endophytes as sources of bioactive
products. Microbes Infect. 5(6), 535-544.

Sullivan R.F., Holtman M.A., Zylstra G.J., White J.F., and
Kobayashi D.Y. (2003). Taxonomic positioning of two
biological control agents for plant diseases as Lysobacter
enzymogenes based on phylogenetic analysis of 16S rDNA,
fatty acid composition and phenotypic characteristics. J.
Appl. Microbiol. 94, 1079-1086.

Svensson-Stadler L.A., Mihaylova S.A., and Moore E.R.
(2012). Stenotrophomonas interspecies differentiation and
identification by gyrB sequence analysis. FEMS Microbiol.
Lett. 327, 15-24.

Taghavi S., Garafola C., Monchy S., Newman L., Hoffman
A., Weyens N., Barac T., Vangronsveld J., van der Lelie D.
(2009). Genome Survey and Characterization of Endophytic
Bacteria Exhibiting a Beneficial Effect on Growth and
Development of Poplar Trees. Appl. Environ. Microbiol. 75,
748-757.

Ulrich K., Stauber T., and Ewald D. (2008). Paenibacillus—a
predominant endophytic bacteria colonizing tissue cultures of
woody plants. Plant Cell Tissue Organ Cult. 93, 347-351.

Wilson D. (1995). Endophyte: The Evolution of a Term, and
Clarification of its Use and Definition. Oikos. 73, 274-276.
Zhu B., Liu H., Tian W., Fan X., Li B., Zhou X., Jin G., and
Xie G. (2012). Genome Sequence of Stenotrophomonas
maltophilia RR-10, Isolated as an Endophyte from Rice
Root. J. Bacteriol. 194, 1280-1281.