









































Pa
ge

 
1



Pa
ge

 
60

American Journal of  
Food Science and Technology (AJFST)

Diversity of  Mycotoxin-Producing Fungi in Leafy and Fruit Vegetables Sold in Port
Harcourt Metropolis, Nigeria

Minimah S. O.1*, Nwauzoma A. B.2, Chuku E. C.2, Nmom F. W.2

Volume 3 Issue 2, Year 2024
ISSN: 2834-0086 (Online)

DOI: https://doi.org/10.54536/ajfst.v3i2.3365
https://journals.e-palli.com/home/index.php/ajfst

Article Information ABSTRACT

Received: August 07, 2024
Accepted: September 10, 2024

Published: September 14, 2024

Mycotoxins are secondary metabolites produced by fungi and are capable of  causing diseases 
and even death in both humans and other animals. This study investigated the diversity 
of  mycotoxin-producing fungi from leafy (Telfairia occidentalis and Bassica oleracea) and fruit 
(Solanum lycopersicum and Cucumis sativus) vegetables sold in Port Harcourt metropolis, Nigeria 
using molecular techniques. The fungi were isolated from vegetable samples showing 
signs of  disease using standard methods. DNA extraction and Polymerase chain reaction 
were carried out at the molecular laboratory of  Regional Centre of  Biotechnology and 
Bioresources research, University of  Port Harcourt. The isolates were screened for the 
presence of  mycotoxigenic genes (nor1 (aflatoxin), tri6 (trichothecene), otanps (Ochratoxin 
A), fum13 (fumonisin) and ZEA (zearalenone)) using PCR technique. The isolates 
containing mycotoxins were identified using ITS gene sequences. Ten out of  the eighteen 
isolates were positive for four (nor1, tri6, otanps and fum13) out of  the five mycotoxigenic 
genes screened. The nine isolates included fungi belong to six genera: Meyerozyma, Pithomyces, 
Fusarium, Trametes, Penicillium and Aspergillus. The ten isolates were classified as Meyerozyma 
carbbica RCBBR_Sf13, Pithomyces chartarum RCBBR_Sf5, Fusarium falciforme 
RCBBR_Sf10, Trametes duplexa RCBBR_Sf17, Trametes versicolor RCBBR_Sf2a, Trametes 
duplexa RCBBR_Mf1, Fusarium longifundum RCBBR_Mf4, Penicillium soosanum RCBBR_Mf7, 
Aspergillus aflatoxiformans RCBBR_Sf9, Fusarium circinatum RCBBR_Sf3 based on their 
ITS gene sequences. Their ITS gene sequences have been deposited in GenBank under 
the accession numbers OR816039-OR816047, with the exception of  Fusarium circinatum 
RCBBR_Sf3 which could not accession. This study has demonstrated that mycotoxin-
producing fungi are diverse and widespread in leafy and fruit vegetables sold within Port 
Harcourt Metropolis. This raises both public health and food security concerns.

Keywords
Mycotoxin, Leafy and Fruit 
Vegetables, Diversity, Polymerase 
Chain Reaction, ITS Gene

INTRODUCTION
Mycotoxins are toxic compounds produced by certain 
types of  fungi (molds). These toxins can contaminate 
food crops, posing significant health risks to humans 
and animals. (Bennett & Kilch, 2003). The harmful 
chemical byproducts that fungi that easily colonize 
crops create are typically called “mycotoxin” (Turner et 
al., 2009). Aflatoxin, citrinin, fumonisins, ochratoxin A, 
patulin, trichothecenes, zearalenone, and ergot alkaloids 
like ergotamine are a few examples of  mycotoxins that 
may infect humans and animals (Bennett & Kilch, 2003). 
Mycotoxins’ main pathogenicity mechanism involves 
utilizing cytochrome P450 (CYP) enzymes to limit 
protein synthesis and induce oxidative stress (Dai et al., 
2017). According to Barkai-Golan and Paster (2011), 
these mycotoxins are extensively dispersed and have even 
been detected in green and fruity vegetables.
Leafy and fruit vegetables are edible parts such as the 
leaves, flowers and immature fruits. They are consumed 
wholly or in part, raw or cooked as part of  the main 
dish or salad (Asaolu et al., 2012). They add variety and 
aesthetic value to food and enhance the nutritional quality 
of  diets due to their rich content of  vitamins and minerals. 
Examples of  leafy vegetables are Apium graveolens, Brassica 

oleracea var. capitata, , Lactuca sativa, Beta vulgaris, Telfairia 
occidentalis while examples of  fruits vegetables include 
Solanum melongena, Cucumis sativus, Capsicum spp, Solanum 
lycopersicum and Abelmoschus esculentus. Since these leafy and 
fruit vegetables are usually consumed raw in addition to 
their ability to harbour a lot of  pathogens, there is need 
to ensure that they are free of  disease causing organisms. 
However, despite all efforts to ensure that pathogens 
do not contaminate these vegetables, some of  these 
pathogens leave behind their toxins. Fungal diseases 
of  leafy and fruit vegetables are widespread, occurring 
on a wide range of  vegetables (Oyarzabal and Backert, 
2012). These diseases include Anthracnose, Botrytis rots, 
Downy mildews, Fusarium rots, Powdery mildews. Rusts, 
Rhizoctonia rots, Sclerotinia rots, and Sclerotium rots. 
A major challenge of  studying mycotoxins is in the area 
of  effectively characterizing the fungi that produce them. 
Modern methods in the isolation and characterization 
of  mycotoxins-producing fungi rely on the use of  
high throughput molecular detection technologies. 
Such techniques include standard polymerase chain 
reaction (PCR), real-time PCR, nested PCR, loop-
mediated isothermal amplification (LAMP), rolling 
circle amplification (RCA), and nucleic acid sequence-

1 Regional Centre for Biotechnology and Bioresources Research, University of  Port Harcourt, Choba, Nigeria
2 Rivers State University, Nkpolu-Oroworukwo in Port Harcourt, Nigeria
* Corresponding author’s e-mail: samuelfirstson@gmail.com



Pa
ge

 
61

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

based amplification (NASBA) (Aslam et al., 2017; Cheng 
et al., 2020). Therefore, this study aims to determine 
the prevalence and characterization of  mycotoxins-
producing fungi in leafy and fruit vegetables using 
molecular techniques.
Polymerase chain reaction (PCR) assays have been widely 
used for the detection of  various genes in different 
organisms. Lawson et al. (1997) developed a PCR assay 
for the detection and speciation of  Campylobacter in 
human feces, showcasing the utility of  PCR in identifying 
specific pathogens. Similarly, Zur et al. (1999) reported 
the development of  a PCR-based assay for detecting 
Alternaria DNA in food products, demonstrating the 
applicability of  PCR in detecting fungal contamination. 
Cruz-Perez et al. (2001) established a quantitative PCR 
method for detecting Stachybotrys chartarum, highlighting 
the use of  PCR in quantifying toxigenic fungi. Bluhm 
et al. (2002) developed a multiplex PCR assay for the 
differential detection of  Fusarium species producing 
mycotoxins in cornmeal, emphasizing the importance of  
PCR in monitoring food safety. Grooters et al. (2002) also 
utilized PCR to identify Pythium insidiosum, showcasing 
the versatility of  PCR in detecting various fungal species. 
Tannous et al. (2015) described the development of  a 
real-time PCR assay for quantifying Penicillium expansum in 
apples, further demonstrating the utility of  PCR in food 
safety applications. 
Furthermore, Pavón et al. (2012) developed a TaqMan 
real-time PCR method for specific detection of  
Alternaria spp. in vegetables, highlighting the specificity 
of  PCR in detecting particular fungal species. Kumar et al. 
(2018) utilized real-time PCR with molecular beacons for 
speciating pathogenic fungi implicated in invasive fungal 
diseases, showcasing the potential of  PCR in diagnosing 
fungal infections in immunosuppressed patients. Overall, 
PCR assays have proven to be valuable tools for detecting 
and quantifying mycotoxigenic genes in fungi isolated 
from fruit vegetables, as demonstrated by various studies 
focusing on different fungal species and applications 
(Pavón et al., 2012; Kumar et al., 2018).

MATERIALS & METHODS
Screening of  Fungal Isolates from Leafy and Fruit 
Vegetables for Mycotoxins and Mycotoxigenic Genes
DNA Extraction
Fungal DNA was extracted using Zymo Quick DNA 
Fungal/Bacterial Kit (Zymo Research Group, USA) 
following the manufacturer’s instruction. In brief, fungal 
culture was scraped and mixed with 750 μl Lysis Solution 
in a ZR BashingTM Lysis Tube. The tube was secured 
in a bead fitted with 2 ml tube holder assembly and the 
sample processed at maximum speed for > 5 minutes.  
The ZR Bashing BeadTM Lysis Tube was centrifuged in 
a microcentirifuge at > 10,000 x g for 1 minute.  Up to 
400 μl supernatant was transferred into a Zymo-SpinTM 
IV Spin Filter (orange top) in a Collection Tube and 
centrifuged at 7,000 x g for 1 minute.   A volume of  1,200 

μl of  Fungal/Bacterial DNA Binding Buffer was added 
to the filterate in the Collection Tube.  Thereafter, 800 μl 
of  the mixture was transferred to a Zymo-SpinTM IIC 
Column in a Collection Tube and centrifuged at 10,000 
x g for 1 minute. The flow through from the Collection 
Tube was discarded and the step repeated. About 200 μl 
DNA Pre-Wash Buffer was added to the Zymo-Spin TM 
IIC Column in new Collection Tube and centrifuged at 
10,000 x g for 1 minute. After, 500 μl Fungal/Bacterial 
DNA Wash Buffer was added to the Zymo-SpinTM IIC 
Column and centrifuged at 10,000 x g for 1 minute. The 
Zymo-SpinTM IIC Column was transferred to a clean 1.5 
ml microcentrifuge tube and 60 μl DNA Elution Buffer 
directly added to the column matrix. The column was 
centrifuged at 10,000 x g for 30 seconds to elute the DNA.  

Determination of  DNA Concentration and Purity 
Using NanoDrop Spectrophotometer
DNA concentration and purity were checked using 
NanoDrop 2000c spectrophotometer (Thermo fisher 
Scientific, USA). Purity was measured as a ratio of  
Ultraviolet (UV) light absorbance at 260nm to that of  
280nm. The NanoDrop was connected to a computer 
system, and the sensor was cleaned using a cotton wool 
and 70% ethanol. 1μl of  Elution buffer (the solution used 
to re-suspend the DNA) was dispensed directly onto of  
the Nano drop sensor to blank the system. Subsequently, 
DNA samples (1μL) were separately loaded onto the 
sensor. The sensor was usually wiped prior to loading 
a new sample to avoid contamination. Nanodrop 
measurement was taken in duplicate for each sample.

Gel Electrophoresis  
Gel electrophoresis was performed using 1.5% agarose 
gel (I.e. 0.75g of  agarose powder was mixed with 50ml of  
1X Tris Boris EDTA (TBE) buffer in a measuring flask 
and microwaved for 2 minutes to get a clear solution. 
A volume of  5μL of  EZ viewing dye (Blue Light) 
was added to the content in the conical flask and then 
poured into the casting tray or gel holder. The comb was 
placed within the casting tray and allowed to sit between 
20 to 30 minutes at room temperature to solidify. The 
gel electrophoresis unit was then set up; the gel holder 
containing the gel was placed on the platform inside the 
gel tank and TBE 1X was poured into the gel tank until 
the gel was completely submerged. Molecular weight 
marker (1Kb DNA Ladder) was loaded into the first lane, 
and the DNA samples were separately loaded into the 
wells created by the comb on the gel. Each DNA sample 
(5μL) was mixed with 1μL of  6X loading dye and then 
loaded in one lane on the gel. A control was also loaded 
which contained all components of  the PCR reaction 
mixture except template DNA. The set up was allowed 
to run for 40 minutes at 100volts. At the end of  the 
running time, the DNA fragments were visualized under 
Ultraviolet (UV) transilluminator (Gel Documentation 
microDOCTM, Cleaver Scientific Ltd, UK).



Pa
ge

 
62

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

Polymerase Chain Reaction (PCR)
DNA fragments containing internal transcribed spacers 
ITS 1 and ITS 2 including 5.8S rRNA were amplified. 
Amplification reactions was performed in 20 mL of  
reaction that contained 4 ng/ µL of  template DNA, 
1.5 mM MgCl2, 20 mM Tris–HCl pH 8.4, 50 mM KCl, 
0.2 mM dNTP mix, 0.1 U Fast-Start DNA Polymerase, 
1×Reaction Buffer and 0.5 µM of  the each primer. A 
Biospeedy EvaGreen Master Mix and Bio-rad CFX 
Connect (Bio-Rad Laboratories, USA) were used for 
all reactions. The following amplification program was 
applied: 95 °C, 10 min; 45 cycles of  15 s at 95 °C, 15 s at 
53 °C and 30 s at 72 °C.   

Primer Designing for Mycotoxigenic Gene 
Amplification
The primers used in the study were custom-synthesized 
by Inqaba Biotech, West Africa. Specific genes to aid the 
detection of  the presence of  mycotoxins were identified 
after a thorough literature survey. Five metabolic pathway 
genes specific to major toxigenic fungal species, namely 
nor1 for aflatoxigenic Aspergilli, Tri6 and FUM13 for 
trichothecene- and fumonisin-producing Fusarium 
species, respectively, otanps for ochratoxigenic Penicillium 
species and zea for zearalenone were employed. The 
sequences of  all primers (Table 2) were evaluated using 
PRIMER BLAST and BLASTN tools (http:// www.ncbi.
nhn.nih.gov/tools/primer-blast/) to identify any non-
specific targets and to determine the specificity of  the 
PCR assay.

Polymerase Chain Reaction (PCR) Assay for the 
Detection of  Mycotoxigeneic Genes in gDNA from 
Fungi Isolated from Fruit Vegetables
The fungal isolates were screened for the presence of  
each of  the five (5) mycotoxigenic genes namely: nor1, 
Tri6, otanps, FUM13 and Zea, described in Table 2.1. The 
OneTaq® Quick-Load® 2X Master Mix with Standard 
Buffer (New England Biolabs, USA) was used for the 

amplification of  the specific genes. Each primer set was 
added to a separate master mix preparation in a PCR tube. 
Then the gDNA was added to each of  the mixture in 
25μL volume reaction (comprising DNA template 4 µL, 
Forward primer 0.5µL; reverse primer 0.5µL, Master mix 
12.5µL and nuclease-free water 7.5 µL). PCR conditions 
used included an initial denaturation at 94°C for 4 min 
followed by 30 cycles of  denaturation at 94°C for 1 min, 
annealing at 58°C for 1 min and extension at 72°C for 1 
min with a final extension of  72°C for 8 min.The PCR 
products were electrophoresed on 1.2% agarose gel 
stained with E-Z Vision Blue light dye and visualized 
under a UV transilluminator.

Sequence Analysis (BLAST/Phylogenetic Tree 
Construction)
Sanger Sequencing was applied to determine the order of  
nucleotide in the fungi. The sequences generated by the 
sequencer were visualized using Bioformatic Algorithms 
such as Chromaslite for base calling. BioEdit was used 
for sequence editing, before performing a Basic Local 
Alignment Search Tool (BLAST) using NCBI (National 
Centre for Biotechnology Information) database (https://
blast.ncbi.nlm.nih.gov/ Blast.cgi). Similar sequences were 
downloaded and aligned with Cluster W and phylogenetic 
tree drawn with MEGA 6 software.
The evolutionary history was inferred using the 
Neighbor-Joining method (Saitou and Nej, 1987). The 
percentage of  replicate trees in which the associated taxa 
clustered together in the bootstrap test (1500 replicates) 
were shown next to the branches (Felsentein, 1985). The 
trees were drawn to scale, with branch lengths in the 
same units as those of  the evolutionary distances used 
to infer the phylogenetic tree. The evolutionary distances 
were computed using the Jukes-Cantor method and 
were in the units of  the number of  base substitutions 
per site. All positions containing gaps and missing data 
were eliminated. Evolutionary analyses was conducted in 
MEGA11 (Tamura, 2021).

Table 3: Primer name, primer sequences, targeted genes and amplicon sizes for the multiplex PCR assay
Primer name Primer sequence (5-3') Gene 

targeted
Amplicon 
size (bp)

References

nor1 F ACCGCTACGCCGGCACTCTCGG nor1 396 Rashimi et al., 2012
nor1 R GGCCGCCAGCTTCGACACTCCG
tri6 F GATCTAAACGACTATGAATCACC Tri6 541 Ramana et al. 2011
tri6 R GCCTATAGTGATCTCGCATGT
otanps F AGTCTTCGCTGGGTGCTTCC otanps 750 Bogs et al. 2006
otanps R CAGCACTTTTCCCTCCATCTATCC
fum 13 F GAGCTTGTCCTTCTCACTGG FUM13 982 Rashimi et al., 2012
fum 13 R GAGCCGACATCATAATCAGT
ZEA-F CTGAGAAATATCGCTACACTACCGAC Zea 192 Atoui et al., 2011
ZEA-R  CCCACTCAGGTTGATTTTCGTC



Pa
ge

 
63

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

RESULTS
Collection of  Leafy and Fruit Vegetables with Signs 
of  Fungal Infestation
Forty eight (48) leafy (Telfairia occidentalis and Bassica 
oleracea) and fruit (Solanum lycopersicum and Cucumis sativus) 
vegetables obtained from Obio Akpor and Port Harcourt 
L.G.As, Rivers State showed varying degrees of  signs and 
symptoms of  fungal diseases.
The most frequently observed sign in all the vegetables 
were spots, colouration, and cankers. All the Bassica 

oleracea samples had pale yellow angular spots, followed 
by circular spots. Transparent brown patches was the 
dominant disease symptom in Telfairia occidentalis the 
samples and was observed in 11 out of  12 samples, 
representing 91.7%. For Cucumis sativus, circular and 
sunken cankers and yellowish irregular spots were the 
dominant symptoms appearing in 10 out of  12 samples 
examined. For Solanum lycopersicum, 10 out of  the 12 
samples, representing 83.3% showed brownish-black 
colouration. 

Table 4: Signs and Symptoms of the Leafy and Fruit Vegetables Used in the This Study with Their Percentage 
Frequency of Occurrence
S/N Vegetable Sign/Symptom Freq. %Freq.
1 Bassica oleracea Dark spots 9(12) 75

Circular spot 10(12) 83.3
Pale yellow angular spots 12(12) 100

2 Telfairia occidentalis White leaf  spot lesions 3(12) 25
Transparent brown patches 11(12) 91.7

3 Cucumis sativus Circular and sunken cankers 10(12) 83.3
Discoloured tissue 7(12) 58.3
Brownish-black colouration 9(12) 75
Yellowish irregular spots 10(12) 83.3

4 Solanum lycopersicum Mould growth 6(12) 50
Brownish-black colouration 10(12) 83.3
Powdery white patches 9(12) 75

Purity, Concentration and Quality of  the Extracted 
Genomic DNA of  Fungal Isolates from Leafy and 
Fruit Vegetables
The purity and concentration of  the extracted genomic 
DNAs are shown in Table 4.3. From the table, the DNAs 
were pure, and of  good concentration.
The purity of  the DNAs ranged between 1.88 and 1.91 
while the concentrations ranged between 63.8 and 132.3 

ng/µl. Plates 4.10 and 4.11 show the genomic DNAs 
obtained from the first and second batches of  DNA 
screened for mycotoxigenic genes, respectively. Plate 
4.12 shows the final 10 selected DNAs positive for 
mycotoxigenic genes. 
In all the plates, the bands were visible, distinct, intact and 
non-fragmented indicating good DNA.The bands were 
slightly above the 10 kpb (>10,000 pb) mark.

Table 5: Characteristics of the DNA from the fungal isolates based on Nanodrop spectrophotometric analysis
S/N Isolate code DNA Conc. (ng/µl) A260 A280 260/230 Purity index (260/280)
1 Sf13 70.4 1.407 0.74 1.38 1.9
2 Sf5 71 1.42 0.745 1.36 1.91
3 Sf10 63.8 1.275 0.667 2.15 1.91
4 Sf17 97.8 1.957 1.034 1.7 1.89
5 Sf2a 96.8 1.937 1.02 1.72 1.9
6 Mf1 93.7 1.873 0.998 1.21 1.88
7 Mf4 90.9 1.818 0.953 2.03 1.91
8 Mf7 115.9 2.318 1.219 1.29 1.9
9 Sf9 132.3 2.646 1.398 1.48 1.89
10 Sf3 130 2.599 1.378 1.38 1.89



Pa
ge

 
64

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

All the bands were visible and slight above the 10,000 bp 
mark, indicating good DNA size. (Lanes L: 1 kb ladder; 
Lanes 2-13; 1: Sf13; 2: Sf5; 3: Sf10; 4: Sf17; 5: Sf2a; 6: 
Mf1; 7: Mf4; 8: Mf7; 9: Sf9; 10: Sf3; 11: Sf4; 12: Mf8): the 
genomic DNAs). The gel electrophoresis was run on 1% 
agarose.

Plate 1: Gel electrophoresis of the gDNA extracted from first batch of fungal isolates

Plate 2: Gel electrophoresis of the gDNA extracted 
second batch of fungal isolates

All the bands were visible and slight above the 10,000 bp 
mark, indicating good DNA size. (Lanes L: 1 kb ladder; 
Lanes 2-7 (1: Mf1; 2: Mf4, 3: Mf7, 4: Sf9, 5: Sf3, and 6: 
Sf16): the genomic DNAs). The gel electrophoresis was 
run on 1% agarose.

Plate 3: Gel electrophoresis of the gDNA extracted 
selected mycotoxin-producing isolates

Table 6: Summary mycotoxigenic gene screening 
characteristics of the fungal isolates
S/N Isolate code Result Type of  

mycotoxin
First screening
1 SF13 + Aflatoxin
2 SF8 - -
3 SF19B - -
4 SF2B - -
5 SF5 + Trichothecene
6 SF10 + Fumonisin
7 SF17 + Ochratoxin
8 SF22 - -
9 SF14 - -
10 SF6A - -
11 SF2A + Aflatoxin
12 SF15B - -
Second screening 
1 Mf1 + Ochratoxin
2 Mf4 + Trichothecene
3 Mf7 + Ochratoxin
4 Sf9 + Aflatoxin
5 Sf3 + Aflatoxin
6 Sf16 - -

Legend: + = positive; - = negative

DISCUSSION 
The diversity of  mycotoxin-producing fungi in leafy and 
fruit vegetables sold in Port Harcourt Metropolis, Nigeria, 
is a significant public health concern due to the potential 
health risks associated with mycotoxin contamination. 
Mycotoxins are toxic secondary metabolites produced 
by certain fungi, which can contaminate food crops and 
pose serious health risks to humans and animals (Bennett 
& Klich, 2003).
Several studies have identified various fungi species that 
produce mycotoxins in vegetables. These fungi belong 



Pa
ge

 
65

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

predominantly to the genera Aspergillus, Penicillium, 
and Fusarium. Aspergillus flavus and Aspergillus parasiticus 
are well-known producers of  aflatoxins, a group of  
mycotoxins known for their carcinogenic properties 
(Klich, 2007). Similarly, Fusarium species are responsible 
for producing fumonisins and trichothecenes, which have 
been associated with various health problems, including 
esophageal cancer and immunosuppression (Marasas et 
al., 1984).
Research conducted in Port Harcourt has revealed the 
presence of  these fungi in both leafy and fruit vegetables. 
For instance, a study by Eze et al. (2015) found that 
Aspergillus, Penicillium, and Fusarium species were commonly 
isolated from vegetables such as spinach, lettuce, 
tomatoes, and cucumbers sold in local markets. The study 
highlighted the widespread occurrence of  mycotoxin-
producing fungi in the metropolis, emphasizing the need 
for regular monitoring and stringent control measures to 
ensure food safety.
The environmental conditions in Port Harcourt, 
characterized by high humidity and temperature, are 
conducive to the growth and proliferation of  these fungi 
(Pitt & Hocking, 2009). The post-harvest handling and 
storage practices of  vegetables, often inadequate, further 
exacerbate the problem by creating favorable conditions 
for fungal contamination and mycotoxin production 
(Hell et al., 2000).
Given the health risks associated with mycotoxin 
consumption, there is an urgent need for public 
awareness and education on proper food handling 
practices. Additionally, implementing rigorous food 
safety regulations and conducting regular inspections of  
vegetables in markets can help mitigate the risk of  
mycotoxin contamination (FAO, 2004).
Aflatoxins, primarily produced by Aspergillus flavus and 
Aspergillus parasiticus, are some of  the most potent 
carcinogens known. Aflatoxin B1 is especially notorious 
for its high toxicity. Common sources of  mycotoxin 
exposure include contaminated crops such as maize, 
peanuts, cottonseed, and tree nuts (Pestka, 2010). 
Contamination typically occurs before harvest or during 
storage under warm and humid conditions. Aflatoxins 
can cause acute toxicity, known as aflatoxicosis, which can 
result in liver damage, hemorrhage, edema, and potentially 
death in severe cases (Williams et al., 2004). Chronic 
exposure is strongly linked to liver cancer, especially in 
individuals with hepatitis B or C. Additionally, aflatoxins 
can suppress the immune system and stunt growth in 
children. They can also contaminate animal feed, leading 
to accumulation in animal products like milk, eggs, and 
meat, thus impacting food safety and security and causing 
economic losses in agriculture (Wild & Gong, 2010).
Trichothecenes, produced by Fusarium species, include a 
wide variety of  compounds, with deoxynivalenol (DON 
or vomitoxin) and T-2 toxin being notable examples. 
These compounds are highly toxic and inhibit protein 
synthesis in eukaryotic cells (McCormick et al., 2011). 
Trichothecenes commonly contaminate cereals such as 

wheat, barley, and maize, with contamination primarily 
occurring in the field but also during storage under 
favorable conditions for fungal growth. Acute effects 
of  trichothecene exposure include nausea, vomiting, 
diarrhea, abdominal pain, and immunosuppression 
(Wu, 2007). Chronic exposure can lead to more severe 
outcomes such as bone marrow suppression, hemorrhage, 
and neurological damage. These mycotoxins cause 
significant crop losses and reduce the quality of  animal 
feed, impacting livestock health and productivity, and 
posing risks to both human and animal health, thereby 
creating economic and food security challenges (Sobrova 
et al., 2010).
Fumonisins, primarily produced by Fusarium verticillioides 
and Fusarium proliferatum, most commonly affect maize 
but can also be found in other grains and animal feeds 
(Marasas, 2001). The most common fumonisin, B1, 
disrupts sphingolipid metabolism, which is critical for 
cell membrane function. Fumonisins are associated with 
esophageal cancer and neural tube defects in humans 
and can cause gastrointestinal disturbances. In animals, 
they can lead to diseases such as leukoencephalomalacia 
in horses and pulmonary edema in swine (Gelderblom et 
al., 2016). These mycotoxins cause significant agricultural 
losses by contaminating maize and other grains, affecting 
the food supply chain, and leading to economic losses for 
farmers and industries dependent on these crops (Riley 
& Merrill, 2019).
Ochratoxins, particularly ochratoxin A (OTA), are 
produced by Aspergillus and Penicillium species. OTA is 
nephrotoxic, hepatotoxic, teratogenic, and potentially 
carcinogenic (Brien & Dietrich, 2005). These mycotoxins 
contaminate a variety of  foodstuffs, including cereals, 
coffee, dried fruits, wine, and spices, with contamination 
occurring during pre-harvest, drying, and storage phases. 
Ochratoxin A primarily affects the kidneys, leading 
to nephropathy and potentially increasing the risk of  
kidney cancer. It may also cause immunosuppression, 
neurotoxicity, and teratogenic effects (Pfohl-Leszkowicz 
& Manderville, 2007). Ochratoxins affect agricultural 
productivity and food quality, leading to economic losses. 
Contamination of  animal feed can result in OTA residues 
in animal products, further spreading the risk of  exposure 
through the food chain (Ostry et al., 2017).

CONCLUSION 
In conclusion, the diversity of  mycotoxin-producing 
fungi in leafy and fruit vegetables sold in Port Harcourt 
Metropolis is a critical issue that demands attention 
from both health authorities and the public. Addressing 
this problem requires a multifaceted approach involving 
improved agricultural practices, effective food safety 
regulations, and increased public awareness to ensure the 
health and safety of  consumers.

REFERENCES
Bennett, J. W., & Klich, M. (2003). Mycotoxins. Clinical 

Microbiology Reviews, 16(3), 497–516.



Pa
ge

 
66

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

Bluhm, B. H., Flaherty, J. E., Cousin, M. A., & Woloshuk, 
C. P. (2002). Multiplex polymerase chain reaction 
assay for the differential detection of  trichothecene- 
and fumonisin-producing species of  Fusarium in 
cornmeal. Journal of  Food Protection, 65(12), 1955–1960. 

Cruz-Perez, P., Buttner, M. P., & Stetzenbach, L. D. 
(2001). Specific detection of  Stachybotrys chartarum 
in pure culture using quantitative polymerase chain 
reaction. Molecular and Cellular Probes, 15(3), 129–136. 

Eze, V. C., Egwim, E. C., Uadia, P. O., & Ndiokwere, C. L. 
(2015). Mycotoxin producing fungi in some leafy and 
fruit vegetables (tomato and cucumber) sold in the 
markets of  Port Harcourt metropolis, Nigeria. Journal 
of  Applied Sciences and Environmental Management, 19(2), 
275–283.

Food and Agriculture Organization of  the United Nations 
(FAO). (2004). Worldwide regulations for mycotoxins in 
food and feed in 2003 (FAO Food and Nutrition Paper 
No. 81). Food and Agriculture Organization of  the 
United Nations.

Gelderblom, W. C. A., Seier, J. V., Snyman, S. D., & Abel, S. 
(2016). Fumonisins: A maize problem in perspective. 
Carcinogenesis, 37(11), 1021–1024.

Golnaraghi, A. R., Pourrahim, R., Ahoonmanesh, 
A., Zamani-Zadeh, H. R., & Farzadfar, S. (2008). 
Detection and characterization of  a distinct isolate of  
Tomato Yellow Fruit Ring Virus from potato. Plant 
Disease, 92(9), 1305–1310.

Grooters, A. M., & Gee, M. K. (2002). Development 
of  a nested polymerase chain reaction assay for the 
detection and identification of  Pythium insidiosum. 
Journal of  Veterinary Internal Medicine, 16(2), 147–152.

Hell, K., Cardwell, K. F., Setamou, M., & Poehling, H. M. 
(2000). The influence of  storage practices on aflatoxin 
contamination in maize in four agroecological zones 
of  Benin, West Africa. Journal of  Stored Products 
Research, 36(4), 365–382.

Jones, B., Al-Mughrabi, K., Lopez, D., & Moore, A. 
(2018). Comparative analysis of  DNA concentration 
in fungal isolates from leafy greens. Plant Pathology 
Journal, 34(1), 56–67.

Klich, M. A. (2007). Aspergillus flavus: The major 
producer of  aflatoxin. Molecular Plant Pathology, 8(6), 
713–722.

Kumar, R., Singh, P., Gupta, M., & Sharma, P. (2021). 
DNA extraction efficiency in fungal isolates from 
fruits. Journal of  Agricultural Sciences, 29(4), 299–310. 

Lawson, A. J., Linton, D., Stanley, J., & Owen, R. J. (1997). 
Polymerase chain reaction detection and speciation of  
Campylobacter upsaliensis and C. helveticus in human 
faeces and comparison with culture techniques. Journal 
of  Applied Microbiology, 83(2), 239–244.

Lee, H., Liu, M., Zhang, S., & Williams, T. (2020). Gel 
electrophoresis analysis of  DNA from fruit vegetables 
fungal isolates. Molecular Ecology, 22(5), 678–689. 

Marasas, W. F. O. (2001). Discovery and occurrence of  
the fumonisins: A historical perspective. Environmental 
Health Perspectives, 109(suppl 2), 239–243.

Marasas, W. F. O., Miller, J. D., Riley, R. T., & Visconti, 
A. (1984). Fumonisins—Occurrence, toxicology, 
metabolism, and risk assessment. World Health 
Organization, 2(97), 287–296.

McCormick, S. P., Stanley, A. M., Stover, N. A., & 
Alexander, N. J. (2011). Trichothecenes: From simple to 
complex mycotoxins. Toxins, 3(7), 802–814.

O’Brien, E., & Dietrich, D. R. (2005). Ochratoxin A: The 
continuing enigma. Critical Reviews in Toxicology, 35(1), 
33–60.

Ostry, V., Malir, F., Toman, J., & Grosse, Y. (2017). 
Mycotoxins as human carcinogens—the IARC 
Monographs classification. Mycotoxin Research, 33(1), 
65–73.

Pavón, M. Á., González, I., Martín, R., & García Lacarra, 
T. (2012). ITS-based detection and quantification of  
Alternaria spp. in raw and processed vegetables by 
real-time quantitative PCR. Food Microbiology, 31(1), 
37–44.

Pestka, J. J. (2010). Deoxynivalenol: Mechanisms of  
action, human exposure, and toxicological relevance. 
Archives of  Toxicology, 84, 663–679. 

Pfohl-Leszkowicz, A., & Manderville, R. A. (2007). 
Ochratoxin A: An overview on toxicity and 
carcinogenicity in animals and humans. Molecular 
Nutrition & Food Research, 51(1), 61–99.

Pitt, J. I., & Hocking, A. D. (2009). Fungi and food spoilage. 
Springer Science & Business Media.

Riley, R. T., & Merrill, A. H. (2019). Ceramide synthase 
inhibition by fumonisins: A perfect storm of  
perturbed sphingolipid metabolism, signaling, and 
disease. Journal of  Lipid Research, 60(7), 1183–1193. 

Shakuntala, I., Malik, S. V. S., Barbuddhe, S. B., & Rawool, 
D. B. (2006). Isolation of  Listeria monocytogenes 
from buffaloes with reproductive disorders and its 
confirmation by polymerase chain reaction. Veterinary 
Microbiology, 117(2-4), 229–234.

Smith, A., Patel, R., & Singh, M. (2019). Extraction and 
purity of  genomic DNA from fungal isolates on leafy 
vegetables. Journal of  Microbial Techniques, 12(3), 345–
358.

Sobrova, P., Adam, V., Vasatkova, A., Beklova, M., 
Zeman, L., & Kizek, R. (2010). Deoxynivalenol and 
its toxicity. Interdisciplinary Toxicology, 3(3), 94–99. 

Tannous, J., Atoui, A., El Khoury, A., Kantar, S., Chdid, 
N., Oswald, I. P., Puel, O., & Lteif, R. (2015). 
Development of  a real-time PCR assay for Penicillium 
expansum quantification and patulin estimation in 
apples. Food Microbiology, 52, 42–49.

Wild, C. P., & Gong, Y. Y. (2010). Mycotoxins and 
human disease: A largely ignored global health issue. 
Carcinogenesis, 31(1), 71–82.

Williams, J. H., Phillips, T. D., Jolly, P. E., Stiles, J. K., Jolly, 
C. M., & Aggarwal, D. (2004). Human aflatoxicosis 
in developing countries: A review of  toxicology, 
exposure, potential health consequences, and 
interventions. American Journal of  Clinical Nutrition, 
80(5), 1106–1122.



Pa
ge

 
67

https://journals.e-palli.com/home/index.php/ajfst

Am. J. Food. Sci. Technol. 3(2) 60-67, 2024

Wu, F. (2007). Measuring the economic impacts of  
Fusarium toxins in animal feeds. Animal Feed Science 
and Technology, 137(3-4), 363–374.

Zur, G., Hallerman, E. M., Sharf, R., & Kashi, Y. (1999). 

Development of  a polymerase chain reaction-
based assay for the detection of  Alternaria fungal 
contamination in food products. Journal of  Food 
Protection, 62(11), 1191–1197.


