60 American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) ISSN (Print) 2313-4410, ISSN (Online) 2313-4402 © Global Society of Scientific Research and Researchers http://asrjetsjournal.org/ Application of DNA Barcoding to Authentic Panax Vietnamensis Nguyen T. P. Tranga*, Nguyen T. H. Maib, Yuri N. Zhuravlevc aInstitute of Ecology and Biological Resources, Vietnam academy of Science and Technology, 18 Hoang Quoc Viet road, Ha Noi city, Vietnam bInstitute of Biology and Soil Science, Far Eastern Branch Russian Academy of Sciences aEmail: nptrang@gmail.com bEmail: zhuravlev@biosoil.ru Abstract Panax L. genus consists of 11 species and sub- species. It distribute in North America and in eastern Asia (mostly northeast China, Korea, Bhutan, eastern Siberia), typically in cooler climates. In Vietnam, up to now, currently five species of the genus Panax and one sub-species have been identified including Panax bipinnatifidus Seem., P. stipuleanatus Feng Tsai et, P. vietnamensis Ha et Grushv., P. pseudoginseng Wall., P. ginseng Meyer. and Panax vietnamensis var. fuscidiscus. Panax vietnamensis is endemic species in Vietnam that only distribute around Ngoc Linh mountain with the altitude from 1500m to 2400m, in limited geograpgical coordinates from 14055’ to 15007’ north latitude and from 107051’ to 108005’ east longitude. This species is unique Panax species that distributes to 150 north latitude and it is considered as the most valuable medicinal plants in Vietnam. But Panax vietnamensis and Panax vietnamensis var. fuscidiscus share many similar characteristics and make people often confused. In this research, we used of DNA barcoding to authentic Panax vietnamensis. We sequenced 4 chloroplast DNA regions includes MatK, rbcL, rpoB and 1 nuclear DNA regions ITS for comparison and choose the best one for identification of the Panax species. Our result showed that ITS- rDNA is the best marker for authentic Panax species. MatK is good for identify at species level but rpoB good for identify at subspecies level. The sequence of MatK, rbcL, rpoB, rpoC, ITS of Panax vietnamensis and Panax vietnamensis var. fuscidiscus were submitted to Genebank with accessory number as KJ 418201, KJ 418206, KT 154685, KT 194325, KT154583, KT 194326, KJ 418194, KJ 418193 respectively. Key words: Panax vietnamensis ; ginseng ; DNA barcoding ; Panax vietnamensis var fuscidiscus. ------------------------------------------------------------------------ * Corresponding author. http://asrjetsjournal.org/ American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 61 1. Introduction Panax L. is a small genus that belongs to Ariliaceae family. The genus Panax L. is known to be distributed in the northern hemisphere, extending from the mountain area bordering the east coast of North America including the northern United States and southwestern Canada (there are 2 species: P. quinquefolius (American ginseng) and P. trifolius) [10]. There are two species including P. ginseng and P. japonica distribute in Northeast Asia (including far eastern Russia, northeastern China, Korean Peninsula and Japan). The central distribution of the genus Panax L. may begin from southwestern China and spread to the north of Vietnam [9]. In fact, this area includes two adjacent border provinces; these are Yunnan (China) and Lao Cai (Vietnam). Here, there are seven species and subspecies growing completely naturally. Two cultivated species are P. notoginseng, which is imported from North America, and P. pseudoginseng (which is not found in the wild but it is assumed to have originated from nearby Himalayas as a result of a natural hybrid between two closely related species). This area can be reputed as the central distribution of the genus Panax L. in the world [5]. There are three species (P. notoginseng; P. quinquefolius and P. trifoliatus) in North America. At the end of the southern limit of the genus Panax L. is Panax vietnamensis (Vietnamese people refer to it as Ngoc Linh ginseng), which grows in central Vietnam, at 14015' north latitude. Therefore the Vietnamese ginseng is considered a narrow endemic of central Vietnam. The Ngoc Linh Ginseng is a narrow endemic of central Vietnam with native distribution in Tu Mo Rong district, Dak Glei district (Kon Tum province), Nam Tra My district, Phuoc Son district, Hien district (Quang Nam province), on the Ngoc Linh Mountain, altitudes above 1.500m [5]. However, at present, this species is thought to be extinct in the wild because of exhaustive exploitation for many years and the slash and burn agriculture therefore narrowing their natural habitats. Panax vietnamensis has been put into red list of IUCN and red book in Vietnam [7, 8]. Up to now, this species is only cultivated in two conservation areas , one of which is Ginseng conservation place (Mang Ri commune, Tu Mo Rong district, Kon Tum Province) and the other one is Tra Linh medicine station (Tra Linh commune, Nam Tra My district, Quang Nam province) [10]. All species of the genus Panax.L have medicinal value [14]. In Vietnam, Panax vietnamensis is considered as the most value medicinal plant [12]. Panax vietnamensis var. fuscidicus is found first time in Phong Tho commune, Lai Chau province in Vietnam since 2012. This species has been found in southern Yunnan, China before and was named as Panax vietnamensis var. fuscidicus K.Komatsu, S.Zhu & S.Q. Cai in 2002. Panax vietnamensis var. fuscidicus share many similar characteristics with Panax vietnamensis such as leaves verticillate (3)-4 (5) at apex of stem, palmately compound, with 5 – (6-7) leaflets, membranous, petioles 7-12 cm, at base without stipule of stipule-like appendages petiolule 0.3-1 cm, at base with uncinate hairs, ca. 2mm long. The main and lateral veins of both surfaces sparsely bear incinate hair around 2mm long. Flowers greenish-yellowish, 3-4 mm in diam, pentamcrous, rarely hexamerous [10]…So, it is very difficult to authentic them based on morphology. One possible means to overcome this difficulty would be to establish a reliable DNA barcode. DNA barcodes have been developed using the sequences of specific regions of chloroplast DNA, and they have rapidly become an important tool for species identification. CBOL (2009) recommend 7 candidate plastid DNA regions include atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer [1]. Conrad and his colleagues (2012) using 6 Nuclear DNA regions to test the ability of their identification and recommended ITS is the universal region DNA barcode marker for identification of Fungi [3], Chen (2010) also recommened ITS as DNA barcode for medicinal plant [2]. American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 62 In this research, we used MatK rbcL, rpoB chloroplast DNA regions and ITS nuclear DNA regions to authentic Panax species. 2. Materials and Methods 2.1. Plant materials The leaves of P. Vietnamensis were collectes at Tra Linh commune, Nam Tra My district, Quang nam province at the coordinates 15o08N-108o09E, altitude 1400m. The leaves of P. vietnamensis var. Fuscidiscus were collected at Phong Tho commune, Lai Chau province at the coordinates 22o20N, 102o32E, and altitude 1500m. Collected leaves are stocked in silicagen until used. The voucher specimens were stored in the Department of Molecular systematics and conservation genetics (IEBR-VAST). 2.2. DNA extraction Total DNA was extracted from the samples using the modified CTAB method of Doyle and Doyle (1987) [4]. Liquid nitrogen was added to each sample (about 100 mg), which was then ground by hand. Total DNA yield and purity were assessed using a spectrophotometer and were then visualized on 1% agarose gels. Stock DNA was diluted to a concentration of 10 ng/μL. 2.3. DNA amplification and sequencing PCR was performed in a 40-μL reaction volume containing 4 μL PCR 10X buffer, 1 μL 25 mM dNTP, 1 μL 20 μM of each primer, 1 μL 25 mM MgCl2, 1 μL BSA, 1 μL 2.5 U Taq DNA polymerase and approximately 50 ng genomic DNA. The rbcL, matK, rpoB, rpoC, ITS genes from both Panax species samples were amplified using a standard protocol with universal primers (Table 1). The amplification conditions were 95°C for 5 min; followed by 30 cycles of denaturation at 95°C for 30s, annealing at 58°C for 30s, 54o for 30s, 56o for 1 min and 63o for 30s of rbcL, rpoB, ITS and MatK respectively and extension at 72°C for 1 min. The reaction was completed by a 10-min extension and hold at 4°C. The identities of the PCR products were verified by electrophoresis on 0.8% agarose gels. All PCR products were purified using a QIA quick PCR purification kit (Qiagen, Germany). The purified PCR products were sequenced in both directions with the same amplification primers as for PCR using a Bigdye terminator v3.1 cycle sequencing kit (Applied Biosystems) on an ABI 3100 capillary sequencer following the manufacturer instructions. 2.4. DNA analysis Bidirectional DNA sequences of each fragment were assembled using the ChromasPro software (Technelysium) and then aligned by Mega 6.0 (Tamura and his colleagues 2013) [13]. The p-distance of rbcL, rpoB, matK and ITS was calculated using MEGA 6.0 in order to evaluate intra-specific and inter-specific divergence. Neighbor- American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 63 joining (NJ) trees based on p-distance were constructed using MEGA 6.0 to provide a graphical representation of genetic divergence among species. Table 1: Sequence information of four used primers DNA region name Forward primer Reverse primer Tm (°C) PCR product length Reference rbcL TCTAGCACACGAAAGTCGA AGT TTCGGCACAAAATACGA AACGATCTCTCCA 58 700 Hasebe and his colleagues (1994) [6] rpoB GCC ACC ATC GAA TAT CTG GT ACA CGA TCT CGT CGC TAA CC 54 500 CBOL, 2009 [1] MatK CGATCTATTCATTCAATATT TC TCTAGCACACGAAAGTCGA AGT 56 1500 Shaw and his colleagues (2005) [11] ITS TCC GTA GGT GAA CCT GCG G GCT GCG TTC TTC ATC GAT GC 63 600 Conrad and his colleagues 2012 [3] 3. Results 3.1. PCR and sequencing efficiency The efficiency of PCR amplification for matK, rbcL, rpoB and ITS was 96, 97,5, 89 and 95%, respectively for Panax vietnamensis, 99; 97; 90 and 92% for Panax vietnamensis var. fuscidicus. Bidirectional DNA sequences of each fragment were sequenced, their sequences then submit to the Genbank with the accession numbers KJ 418201.1, KT 154685, KT 154867 and KJ 418194.1 respectuvely for Panax vietnamensis, KJ 418206.1, KT 194325, KT 194323 and KJ 418193.1 respectively for Panax vietnamensis var. fuscidicus (Table 2). Table 2 : The accession number of submitted sequences Species Genbank accession numbers MatK rbcL rpoB ITS Panax vietnamensis KJ418201.1 KT154685 KT154687 KJ418194.1 Panax vietnamensis var. fuscidicus KJ418206.1 KT194325 KT194323 KJ418193.1 American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 64 3.2. Alignment and variability For the Panax vietnamensis and Panax vietnamensis var. fuscidicus, an aligned matK sequence of 1495 bp was obtained; this sequence contained 33 variable sites, of which 16 were informative parsimony sites. The aligned rbcL sequence was 640 bp with 26 variable sites, of which 7 showed informative parsimony. The aligned sequence of rpoB was 493 bp long with 12 variable sites, showed 6 informative parsimony sites. Specially, aligned ITS sequence of 588 bp contained 97 variable sites, in which 28 showed informative parsimony sites. 3.3. Comparison of identification ability of each DNA markers Using p-distances value, we make the comparison of each DNA marker for identification ability for Panax vietnamensis with Panax vietnamensis var. fuscidicus and 7 other Panax species (data from Genbank)(Fig. 1). According that, ITS always give P-disdance value higher than matK, rbcL, rpoB between each species (Table 3). For 3 candidate chloroplast regions, rpoB region with 500 bp in length, showed 12 variable sites, 6 informative parsimony sites, is become more sensitive for identification Panax species than matK and rbcL. Our result also confirmed that Panax vietnamensis var. fuscidicus is variety of Panax vietnamensis with genetic distance value is 0.001 (in matK), 0.005 (in rpoB), 0.007 (in rbcL) and 0.008 (in ITS) while average genetic distance of Panax vietnamensis with other Panax species is 0.014 (in MatK), 0.0139 (in rbcL), 0.015 (in rpoB) and 0.027 (in ITS) (Table 3). MatK region give the genetic distance value between Panax vietnamensis and Panax vietnamensis var. fuscidicus is only 0.001 but for other Panax spceis, it give genetic distance value quite good with the value always difference in each species, so the MatK region maybe good for identify in the species level but it is not really good for identify at sub-species level. Table 3: Genetic distance value of each DNA markers for Panax vietnamensis compare with Panax vietnamensis var. fuscidicus and 7 other Panax species Species matK rbcL rpoB ITS P.vietnamensis 0 0 0 0 P.vietnamensis var. fuscidicus 0.001 0.007 0.005 0.008 P.japonicus 0.012 0.012 0.012 0.015 P.notoginseng 0.013 0.012 0.012 0.024 P.pseudoginseng 0.014 0.015 0.019 0.019 P.quinquefolius 0.015 0.013 0.014 0.015 P.ginseng 0.016 0.014 0.012 0.016 P.stipuleannatus 0.019 0.015 0.021 0.037 P.trifolius 0.017 0.016 0.018 0.063 3.4. Phylogeny Based on ITS and ropB sequences, 9 Panax species divided into 2 group, Panax ginseng, Panax japonicas, American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 65 Panax notoginseng that distribute in the east were in 1 group, Panax quinquefolius, Panax pseudoginseng that distribute in the North America were in other group and more closer. Our NJ phylogeny tree also confirmed that Panax vietnamensis var. fuscidicus closest with is Panax vietnamensis (Fig.2) Figure 1: Comparison the identification ability of each DNA marker for Panax species NJ tree based on rpoB sequence (A) NJ tree based on ITS sequence (B) Figure 2: Phylogentic trees for 9 Panax species based on rpoB and ITS sequences 0 0.01 0.02 0.03 0.04 0.05 0.06 0.07 matK rbcL rpoB ITS American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 66 4. Discussion All species of the genus Panax.L are available as medicinal resource in traditional medicine. Panax vietnamensis was found in the Ngoc Linh Mountain in Vietnam and considered as an endemic species. This species also was defined as a precious medicinal plant of Vietnam, listed to one of the four most valuable ginseng species in the world because their’s saponin, acid amin and mineral quality much higher than other Panax species, it was high evaluated on economic value, on health improvement and healing by specialized organizations [12]… but it was absent in the natural environment. Moreover, due to limited distribution and overexploited made Panax vietnamensis fall into the threatened group. At present, this species is only cultivated in several conservation areas on Ngoc Linh Mountain where belong to Quang Nam and Kontum provinces, Vietnam. Panax vietnamensis has been listed into red list of IUCN and red book in Vietnam. Panax vietnamensis var. fuscidicus ís a new medicinal plant that found in Lai Chau province, Vietnam since 2012 [10]. This species share many similar with Panax vietnamensis and make people often confused. We used three chloroplast DNAs include MatK, rbcL, rpoB and one nuclear ITS-rDNA to identify of Panax species as well as recognize the Panax vietnamensis and Panax vietnamensis var. fuscidicus. Our result showed that ITS-rDNA is the best marker to authentic Panax species. For chloroplast DNA markers, rpoB is useful to identify in the sub species level. MatK is the marker that useful for identification at species level Panax genus. Acknowledgements This research was funded by the Vietnam Academy of Science and technology (Grant: VAST.HTQT.Nga 10/15-16). References [1]. CBOL Plant Working Group, (2009). “A DNA barcode for land plants”. Proc. Natl. Acad. Sci. U. S. A. vol.106, pp: 12794-12797. [2]. Chen S., Yao H., Han J., Liu C., Song J., Shi L., Zhu Y., Ma X., gao T., Pang X., (2010). « Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plants species”. PloS One, vol 5, pp: 8613. [3]. Conrad L. Schoch, Keith A. Seifert, Sabine Huhndorf, Vincent Robert, John L. Spouge, C. André Levesque, Wen Chen, and Fungal Barcoding Consortium, (2012). “Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi”, Proc. Natl. Acad. Sci. U. S. A. vol 109, No. 16, pp. 6241-6246 [4]. Doyle, J.J., Doyle, J.L., (1987). “A rapid DNA isolation procedure from small quantities of fresh leaf tissue”. Phytochemistry Bulletin vol. 19; pp. 11-15. [5]. Ha, T. D. and Grushvitzky, I.V.,(1985). “New species in Panax (Araliaceae) in Việt Nam”, J. Botany, vol.70, pp. 518 – 522. [6]. Hasebe M, Omori T, Nakazawa M, Sano T, et al. (1994). “rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns”. Proc. Natl. Acad. Sci. U. S. A. vol. 91, pp. 5730- 5734. http://www.pnas.org/search?author1=Conrad+L.+Schoch&sortspec=date&submit=Submit http://www.pnas.org/search?author1=Keith+A.+Seifert&sortspec=date&submit=Submit http://www.pnas.org/search?author1=Sabine+Huhndorf&sortspec=date&submit=Submit http://www.pnas.org/search?author1=Vincent+Robert&sortspec=date&submit=Submit http://www.pnas.org/search?author1=John+L.+Spouge&sortspec=date&submit=Submit http://www.pnas.org/search?author1=C.+Andr%C3%A9+Levesque&sortspec=date&submit=Submit http://www.pnas.org/search?author1=C.+Andr%C3%A9+Levesque&sortspec=date&submit=Submit http://www.pnas.org/search?author1=Wen+Chen&sortspec=date&submit=Submit American Scientific Research Journal for Engineering, Technology, and Sciences (ASRJETS) (2017) Volume 29, No 1, pp 60-67 67 [7]. IUCN (2015), “The IUCN Red List of Threatened species”, IUCN.SSC. Available: WWW.Redlist.org [8]. Ministry of Science and Technology, Vietnam, (2007). “Vietnam Red list”. [9]. Nguyen Thi Phuong Trang, Nguyen Giang Son, Le Thanh Son, Phan Ke Long, (2011). “Genetic relationship between Panax vietnamensis with other species in Panax genus”. Proceed of 4th International meeting of Ecology and Biological resources, pp: 955-959. [10]. Phan Ke Long, Le Thanh Son, Phan Ke Loc, Vu Dinh Duy, Pham Van The, (2013). “Lai Chau ginseng Panax vietnamensis var. fuscidicus K. Komatsu, S. Zhu & S.Q.Cai.I. morphology, ecology, distribution and conservation status”. Proceedings of the 2nd VAST-KAST workshop on Biodiversity and Bio- active compounds. [11]. Shaw J, Lickey EB, Beck JT, Farmer SB, et al. (2005). “The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis”. Am. J. Bot. vol. 92: pp. 142-166. [12]. Tran Le Quan, Adnyana I.K., Tezuka Y., Harimaya Y., Saiki I., Kurashige Y., Tran Kim Quy, Kadota S., (2002). “Hepatoprotective effect of majonoside R2, the major saponin from Vietnamese ginseng (Panax vietnamensis)”. Planta medica, vol.68, pp. 402-406. [13]. Tamura K., Stecher G., Peterson D., Filipski A., Kumar S., (2013). MEGA 6: “Molecular evolutionary genetics analysis version 6.0”, Mol Biol Evol. Vol. 30 (12), pp. 2725-2729. [14]. Wu, Z. Y., P. H. Raven & D. Y. Hong, (2011), “Flora of China”, Missouri Botanical Garden Press, St. Louis. Vol. 19, pp. 714-800. http://www.redlist.org/