1 © 2019 conscientia beam. all rights reserved. gross morphology and morphometric studies of digestive tract of barn owl (tyto alba) umar, a.a1 atabo, s.m2+ 1department of veterinary anatomy, usmanu danfodiyo university, nigeria 2department of animal health and production technology, college of agriculture and animal science bakura, zamfara state, nigeria (+ corresponding author) abstract article history received: 15 october 2018 revised: 19 november 2018 accepted: 24 december 2018 published: 22 january 2019 keywords barn owl crop digestive tract duodenum jejunum ileum large intestine. four (4) adult barn owls were captured from gamji village of bakura local government and transported in a cage to the college of agriculture and animal science bakura, zamfara state, nigeria, for morphology and morphometry of the digestive tracts. all the segments of the digestive tract (esophagus, liver, crop, duodenum, jejunum, ileum, colon, caecum, colorectum, and cloaca) were present, however the crop was found to be absent. this studies will provide valuable information for anatomist and other scientist working in the management and nutrition of this species, which will further help in the maintenance of this important bird in captivity or free life. further investigation in the histology of these segments is recommended. contribution/originality: this study contributes in the existing literature, the gross features of the gastrointestinal tract of the barn owl, which will further assist in the feeding and management of this bird in captivity or free life. 1. introduction owls are birds from the order strigiformes, which includes about 200 species. they hunt mostly small mammals, insects and other birds, and they are found in all regions of the earth except antarctica and some remote islands (forshaw, 1998). owls that feed in agricultural areas provide benefits to humans by killing large numbers of small rodents which might otherwise eat crops in field or in storage (burton, 1992). in recent studies on owls, aspects such as behavior, reproduction, feeding habits and habitat have been discussed (long, 1998; könig et al., 1999). however, morphological data regarding the digestive system of this bird are still scarce. it is believed that studies on the digestive tract of barn owl could provide valuable information that can be used by other professionals such as wild-lifers, anatomist and other scientist working in the management and nutrition of this species. in this view, the present study will describe in detail, gross features of the gastrointestinal tract of the barn owl, in order to supply data regarding the morphology of this species, which will further assist in the maintenance of this important bird in captivity or free life animal review 2019 vol. 6, no. 1, pp. 1-4 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2019.61.1.4 © 2019 conscientia beam. all rights reserved. https://orcid.org/0000-0002-7020-8355 https/orcid.org/0000-0002-9811-4457 https://www.doi.org/10.18488/journal.ar.2019.61.1.4 animal review, 2019, 6(1): 1-4 2 © 2019 conscientia beam. all rights reserved. 2. materials and methods four (4) adult barn owls were captured from gamji village of bakura local government and transported in a cage to the college of agriculture and animal science bakura, zamfara state, nigeria. after cervical (plate 1) subluxation, the digestive tracts were collected for morphology and morphometry (location, shape, size, length, breadth and weight of the segments of digestive tract were considered) (oyelowo et al., 2017). plate-1. a photograph of the barn owl captured 3. result the digestive tract comprised of proventriculus, gizzard, duodenum, jejunum, ileum, caeca, colorectum and cloaca respectively. the esophagus was a long, narrow and straight tube which extends from the glottis at the posterior end of the pharynx, through the neck and thorax to join with the glandular stomach. the average length and weight of esophagus were 5.2±0.278 cm and 4.02±0.23gm respectively (plate 2). the proventriculus was relatively small and tubular. it was located caudal to the esophagus. the average length and weight of the proventriculus were 2.80±0.12 cm and 2.98±0.28 gm (plate 2). the gizzard (muscular stomach) was located immediately succeeding the proventriculus. it was placed between the lobes and partly behind the left lobe of the liver. it was made up of thick strong muscles with longitudinal grooves on the inner wall (rugae). the average length and weight of the gizzard was 6.2±0.128 cm and 15.5±0.52 gm (plate 2 and 3). the duodenum started at the proximal part of the gizzard and formed an elongated loop with a pancreas within the loop. after the duodenum, the small intestine formed a coil and was suspended from the dorsal abdominal wall the by a mesentery. the average length and weight of the duodenum were 18.50±0.478 cm and 1.5±0.029 gm respectively (plate 2). there was definite demarcation between the jejunum and ileum. the average length and weight of the jejunum were 35.25±0.29 cm and 2.3±0.12 gm (plate 2) respectively. the average length and weight of the ileum were 5.6±0.25 cm and 0.20±0.03 gm (plate 2). the caecum was the first part of the large intestine, the left and right caeca starts from the ileum and terminates in blind pouches and were closely attached to the small intestine by the mesentery. the average length and weight of the caeca were 5.4±0.45 cm and 0.25±0.035 gm (plate 2). finally, the colorectum was seen at the terminal segment of the intestine, between the ileo-cecal junction and the cloaca. it was short, straight and had thick muscular walls. the average length and weight of the colorectum was 3.925±0.19cm and 0.13±0.022gm respectively (plate 2). o animal review, 2019, 6(1): 1-4 3 © 2019 conscientia beam. all rights reserved. plate-2. a photograph of the digestive tract of barn owl, showing the esophagus (e), liver (l), crop (c), duodenum (d), jejunum (j) ileum (i), colon (c), caecum (c) colorectum (cr) and cloaca (cl) . plate-3. a photograph of the internal surface of gizzard in the barn owl, showing the smooth glandular portion (g) and muscular portion with rugae (m). 4. discussion owls cannot chew their food like other birds, however, they are carnivorous and small prey items are swallowed whole, while larger prey are torn into smaller pieces before being swallowed (könig et al., 1999). unlike other birds, owls have no crop, which is a loose sac in the throat that serves as storage for food for later consumption. as such, in an owl, food is passed directly into their digestive system. the owl’s stomach like other birds has two parts, the glandular stomach (proventriculus) is the first part, which produces enzymes, acids, and mucus that begin the process of digestion and the second part is the ventriculus (gizzard) which is muscular in shape and has no digestive glands. in owl, the gizzard serves as a filter, holding back insoluble items such as bones, fur, teeth and feathers, which are compressed into pellets with the help of the rugae in the inner walls of the gizzard. the rugae are the extensive folds in the stomach lining, which are capable of stretching to accommodate an increase in stomach volume with consumption of a meal and they also help direct the food downward towards the pylorus as a result of stomach motility (dyce et al., 2002). this pellet will later be regurgitated up from the gizzard back to the proventriculus. regurgitation often signifies that an owl is ready to eat again. when the owl eats more than one prey item within several hours, the various remains are consolidated into one pellet (marti, 1974). the observations in the caeca as reported in this study were similar to the reports of hassouna (2001) and nasrin et al. (2012) where, the authors proved that caeca were long cylindrical expansions in chickens. further investigation in the histology of these segments is recommended. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: both authors contributed equally to the conception and design of the study. references burton, j.a., 1992. owls of the world. their evolution, structure, and ecology. 3rd edn., new york, london: peter lowe. pp: 40. dyce, k.m., w.o. sack and c.j.g. wensing, 2002. text book of veterinary anatomy. 3rd edn., philadelphia, u.s.: saunders company. pp: 55. forshaw, j., 1998. encyclopedia of birds. new york, u.s.: academics press. pp: 101. d g animal review, 2019, 6(1): 1-4 4 © 2019 conscientia beam. all rights reserved. hassouna, e., 2001. some anatomical and morphometrical studies on the intestinal tract of chicken, duck, goose, turkey, pigeon, dove, quail, sparrow, heron, jackdaw, hoopoe, kestrel and owl. assiut veterinary medical journal, 44(88): 47-78. könig, c., w. friedhelm and b. jan-hendrik, 1999. owls: a guide to the owls of the world. 1st edn., new haven, connecticut u.s.: yale university press. pp: 24. long, k., 1998. owls: a wildlife handbook. dallas, texas u.s: johnson books. pp: 35. marti, c.d., 1974. feeding ecology of four sympatric owls. the condor, 76(1): 45-61. available at: https://doi.org/10.2307/1365983. nasrin, m., m. siddiqi, m. masum and m. wares, 2012. gross and histological studies of digestive tract of broilers during postnatal growth and development. journal of the bangladesh agricultural university, 10(1): 69-77. available at: https://doi.org/10.3329/jbau.v10i1.12096. oyelowo, f., i. usende, e. abiyere, a. adikpe and a. ghaji, 2017. comparative gross morphology and morphometric investigations on the alimentary tract of three age groups of barn owl (tyto alba) found in north-central nigeria. international journal of veterinary science, 6(1): 7-12. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 8 © 2018 conscientia beam. all rights reserved. macroscopic and microscopic studies on sarcocystis infection in buffaloes public health alert s.sivajothi1+ b.sudhakara reddy2 1department of veterinary parasitology, college of veterinary science, proddatur516 360, sri venkateswara veterinary university, andhra pradesh, india. 2faculty of veterinary medicine, department of veterinary clinical complex. college of veterinary science, proddatur516 360 sri venkateswara veterinary university, andhra pradesh, india (+ corresponding author) abstract article history received: 16 july 2018 revised: 28 august 2018 accepted: 31 august 2018 published: 3 september 2018 keywords buffalo sarcocystis macroscopic microscopic zoonoses. sarcocystosis is one of the important zoonotic parasitic diseases and commonly reported in buffaloes, cattle and pigs. meat and meat products are the main sources of infection in human beings. the present study aimed to record the prevalence of sarcocystosis in buffaloes during the time of slaughter. out of 61 buffaloes slaughter for meat purpose, 38 showed the presence of macroscopic sarcocysts in different organs and they were in creamy colour lying parallel in between the muscle bundles. distribution of the sarcocysts was noticed in the muscles of oesophagus, diaphragm, heart and base of the tongue. microscopic examination of the stained impression smears collected from the mixed meat which is ready for sale from the 61 buffaloes, 52 were found positive for microscopic bradyzoites. in conclusion, sarcocystis is more prevalent in buffaloes and diagnosis of the disease can be done by microscopic examination of the stained slide impression smears from the suspected meat along with the macroscopic examination of the muscles. contribution/originality: this study is one of the very few studies which have investigated the diagnosis of zoonotic disease in veterinary sciences. this study contributes in the existing literature on diagnosis of the sarcocystosis in the mixed meat which is readily available for sale to the public and caution as a public health alert. 1. introduction most of the parasites in livestock reduce the body growth and economy for the farmers. sarcocystis is a cyst forming coccidian parasite and it requires two hosts i.e. carnivores which will act as definitive host; herbivores and humans act as intermediate host. it is transmitted by the ingestion of the bradyzoites contaminated and undercooked meat and by accidental ingestion of the oocysts excreted by definitive hosts. during the disease process chronic pyrexia, emaciation, neurological signs, debility and death are noticed [1]. however, most of the animals infected with sarcocystosis appear to be normal and healthy at the time of clinical examination and found positive while conducting the post-mortem. routinely it was diagnosed by the direct visualization of the cysts, examination of the impression smears, histopathology, digestion methods and serological methods. in humans, sarcocystosis caused by intake of the raw or undercooked beef containing the larval stages of sarocystis hominis [2]. throughout the world, different literature and information was available on sarcocystis diagnosis during the time of slaughter and examination of the minced meat of animals [3, 4]. but literature was very limited on the examination of sarcocystis in the impression smears collected from the meat. hence the present study was started animal review 2018 vol. 5, no.1, pp. 8-11 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2018.51.8.11 © 2018 conscientia beam. all rights reserved. https://orcid.org/0000-0002-1720-9308 https://orcid.org/0000-0003-1002-3778 https://www.doi.org/10.18488/journal.ar.2018.51.8.11 animal review, 2017, 5(1): 8-11 9 © 2018 conscientia beam. all rights reserved. to record the incidence of sarcocystis in buffaloes during the time of slaughter and analysis of the slide impression smears collected from the mixed meat which is ready for sale for human consumption. 2. materials and methods the present study was carried out at proddatur of ysr kadapa district, andhra pradesh, india, from august 2015 to february 2016. during the study period, the slaughter of the 61 buffaloes for meat purpose was screened for sarcocystis. at the time of slaughter visual inspection of the meat samples were carried out for the presence of macroscopic sarcocysts and their anatomical distribution. few macro sarcocysts were isolated from the muscles, placed in separate vials for the assessment of the gross morphology. slide impression smears were collected randomly from all the animals’ meat which is ready for sale. this meat consists of muscles of the different parts of the body. microscopic examination of the slide impression smears was done to record the incidence of sarcocystis in mixed meat samples which are ready for sale [5]. 3. results and discussion at the time of slaughter out of 61 buffaloes, 38 showed the presence of macroscopic sarcocysts in different organs and it was in creamy colour lying between in parallel to the muscle bundles (fig.1). microscopic examination of the stained impression smears collected from the mixed meat of 61 buffaloes, 52 buffaloes were found positive for microscopic bradyzoites (fig.2). distribution of the sarcocysts was noticed in the muscles of oesophagus, diaphragm, heart and base of the tongue. sarcocystis is one of the obligatory intercellular parasites in mammals. most of the large ruminants show the subclinical infection and presence of macro or micro cyst formation in the muscles [6]. in bovines, it causes the huge reduction in the production by reducing the body eight, low feed conversion ratio, abnormal clinical changes, susceptibility for other disease conditions and death [3]. in humans, it is caused by consumption raw and undercooked meat which containing bradyzoites of sarcocystis. li, et al. [7] was recorded the clinical disease in humans with clinical diseases abdominal distension, watery diarrhoea, vomiting, chilling and fever, dizziness, pain and anorexia [7]. clinical disease in humans was noticed by the ingestion of oocysts from the dogs and after 10 days and 12 days of post-infection, sporocysts forms were detected in faeces of humans [2]. muscle wise prevalence of infection was also reported and it is high in the tongue, oesophagus and cardiac muscles and the study findings were in association with the previous literature [1, 8]. most of the buffaloes in the present study were used to go for grazing over the open areas where more population of pet dogs is there and buffaloes used to intake the water and feed contaminated with the sporocysts voided by the infected dogs. voided sporocysts are in huge in number and they can survive in the external environment for several months which results in higher prevalence of infection. it is very essential to educate the public about the zoonotic aspect of this disease and its transmission. it had zoonotic significance, it is essential to formulate the appropriate control strategy. 4. conclusion the results of the present study indicated a high incidence of sarcocystis spp. infection in buffaloes. it is recommended that microscopic examination of slide impression smears collected from the meat is essential to diagnose the sarcocystosis for screening of the disease. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: the authors are thankful to the authorities of sri venkateswara veterinary university, tirupati for providing the facilities to carry out the research work and a great respect to everyone who gave help in performing this study. animal review, 2017, 5(1): 8-11 10 © 2018 conscientia beam. all rights reserved. references [1] a. oryan, n. ahmadi, and s. m. m. mousavi, "prevalence, biology, and distribution pattern of sarcocystis infection in water buffalo (bubalus bubalis) in iran," tropical animal health and production, vol. 42, pp. 1513-1518, 2010. view at google scholar | view at publisher [2] r. fayer, d. h. esposito, and j. p. dubey, "human infections with sarcocystis species," clinical microbiology reviews, vol. 28, pp. 295-311, 2015. view at google scholar | view at publisher [3] a. m. ahmed, n. t. elshraway, and a. i. youssef, "survey on sarcocystis in bovine carcasses slaughtered at the municipal abattoir of el-kharga, egypt," veterinary world, vol. 9, pp. 1461-1465, 2016. view at google scholar | view at publisher [4] k. h. dar, m. m. bhat, and m. shafi, "prevalence and organwise distribution of sarcocystiosis in buffaloes of mohali, punjab," journal of parasitic diseases, vol. 41, pp. 318-321, 2017. view at google scholar | view at publisher [5] s. meistro, s. peletto, m. pezzolato, k. varello, m. botta, g. richelmi, c. biglia, e. baioni, p. modesto, and p. acutis, "sarcocystis spp. prevalence in bovine minced meat: a histological and molecular study," italian journal of food safety, vol. 4, pp. 4626-4626, 2015. view at google scholar | view at publisher [6] l. khalil, e. kennany, and n. al-hyali, "fate of macrosarcocyst of sarcocystis gigantea in sheep," iraqi journal of veterinary sciences, vol. 25, pp. 87-91, 2011. view at google scholar [7] j. li, z. lin, j. du, and y. qin, "experimental infection of sarcocystis suihominis in pig and human volunteer in guangxi," chinese journal of parasitology and parasitic diseases, vol. 25, pp. 466-468, 2007. view at google scholar [8] k. m. el-dakhly, a. khaled, e.-s. el-nahass, a. hirata, h. sakai, and t. yanai, "prevalence and distribution patterns of sarcocystis spp. in buffaloes in beni-suef, egypt," tropical animal health and production, vol. 43, pp. 1549-1554, 2011. view at google scholar | view at publisher fig-1. recovered macroscopic sarcocysts from the diaphragm source: figure was constituted from the inspection of meat of current study https://scholar.google.com/scholar?hl=en&q=prevalence,%20biology,%20and%20distribution%20pattern%20of%20sarcocystis%20infection%20in%20water%20buffalo%20(bubalus%20bubalis)%20in%20iran https://scholar.google.com/scholar?hl=en&q=prevalence,%20biology,%20and%20distribution%20pattern%20of%20sarcocystis%20infection%20in%20water%20buffalo%20(bubalus%20bubalis)%20in%20iran http://dx.doi.org/10.1007/s11250-010-9601-7 https://scholar.google.com/scholar?hl=en&q=human%20infections%20with%20sarcocystis%20species http://dx.doi.org/10.1128/cmr.00113-14 https://scholar.google.com/scholar?hl=en&q=survey%20on%20sarcocystis%20in%20bovine%20carcasses%20slaughtered%20at%20the%20municipal%20abattoir%20of%20el-kharga,%20egypt http://dx.doi.org/10.14202/vetworld.2016.1461-1465 http://dx.doi.org/10.14202/vetworld.2016.1461-1465 https://scholar.google.com/scholar?hl=en&q=prevalence%20and%20organwise%20distribution%20of%20sarcocystiosis%20in%20buffaloes%20of%20mohali,%20punjab http://dx.doi.org/10.1007/s12639-016-0796-z https://scholar.google.com/scholar?hl=en&q=sarcocystis%20spp.%20prevalence%20in%20bovine%20minced%20meat:%20a%20histological%20and%20molecular%20study http://dx.doi.org/10.4081/ijfs.2015.4626 https://scholar.google.com/scholar?hl=en&q=fate%20of%20macrosarcocyst%20of%20sarcocystis%20gigantea%20in%20sheep https://scholar.google.com/scholar?hl=en&q=experimental%20infection%20of%20sarcocystis%20suihominis%20in%20pig%20and%20human%20volunteer%20in%20guangxi https://scholar.google.com/scholar?hl=en&q=prevalence%20and%20distribution%20patterns%20of%20sarcocystis%20spp.%20in%20buffaloes%20in%20beni-suef,%20egypt http://dx.doi.org/10.1007/s11250-011-9840-2 animal review, 2017, 5(1): 8-11 11 © 2018 conscientia beam. all rights reserved. fig-2. presence of the microscopic bradyzoites in the stained impression smears (1000x) source: figure was constituted from the microscopic view of samples of current study views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 24 © 2019 conscientia beam. all rights reserved. effects of segregated early weaning at 7 days on dams’ body condition, parturition interval and offspring birth weight and litter size in the agouti (dasyprocta leporina) for intensive production riyadh mohammed1+ kavita kemeela sant2 gary wayne garcia3 1,2,3university of the west indies, st. augustine, trinidad and tobago. (+ corresponding author) abstract article history received: 13 june 2019 revised: 19 july 2019 accepted: 26 august 2019 published: 10 october 2019 keywords sex ratio growth rate average daily gain successive parturition offspring reproduction. there has been limited information reported on the impacts of segregated early weaning on agouti (dasyprocta leporina) dams. the study lasted 485 days where 4 parturitions were recorded from 12 (2 year old) multiparous dams, hence there were 48 (12 x 4) parturitions in total with 100 offspring being born. data was collected on 1) the live weight gain of dams (+/g), 2) re-conception time and parturition interval (through theoretical calculations assuming that the gestation period was 104 days), 3) litter size at each parturition 4) weight of each individual offspring born per litter as a % of dams’ live weight and 5) the ratio of offspring sex at each parturition. results showed that dams can reconceive and have a successive parturition as early as 119 days after the day of her previous parturition. average live weight gain after 4 consecutive parturitions for dams were 276g. average offspring weights increased by approximately 23 g (193 g to 216g) after 4 parturitions when weaned at 7 days. average litter size per dam increased by 33% (1.75 to 2.33) after 4 parturitions when weaned at 7 days. litter size as a percentage of dam’s body weight increased by 0.11% (5.47 to 5.58) after 4 parturitions when weaned at 7 days. this study concludes that weaning at 7 days post-partum is very beneficial for dams’ body condition and re conception, offspring growth and development and for continuous reproduction in an intensive production unit. contribution/originality: this study is one of very few studies which have investigated the impacts of segregated early weaning on agouti (dasyprocta leporina). weaning at 7 days post-partum is very beneficial for dams’ body condition and re conception, offspring growth and development and for continuous reproduction in an intensive production unit. 1. introduction gestation periods for the agouti were recorded to be from as early as 97 days [1] to 104 days [2] to 105 days [3] to 104120 days [4-6]. the length of the oestrus cycle was 34 +/2.1 days with a range of 12-59 days weir [7]. weir [4] also stated that agouti female ovulation may be spontaneous and that postpartum estrus may exist. in an experiment with 18 agouti females, guimarães, et al. [8] found that the estrus cycle (proestrus, estrus, metestrus and diestrus) was 32.05 +/4.17 days (25 to 40 days) with an estrus period of 24 hours. singh, et al. [9] reported an oestrus cycle of 31 days (+/4 days) with 17 days (+/2 days) being estrus using the vaginal cytology animal review 2019 vol. 6, no. 2, pp. 24-31 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2019.62.24.31 © 2019 conscientia beam. all rights reserved. https://orcid.org/0000-0002-9639-1397 https://orcid.org/0000-0002-5055-1965 https://www.doi.org/10.18488/journal.ar.2019.62.24.31 animal review, 2019, 6(2): 24-31 25 © 2019 conscientia beam. all rights reserved. method of detection. guimarães, et al. [10] reported postpartum estrus to be 12.04 days (7-24 days). the length of time between parturitions were 126.03 days (109-184 days) in the study carried out by guimarães, et al. [10]. during the postpartum estrus period, 80.95% of copulations (from 18 females) were fertile and ended in successful pregnancy guimarães, et al. [10]. korz [11] reported that 2-3 parturitions per year is possible with the agouti. brown-uddenberg [12] reported new born agouti females weighing between 210g-355g while male offspring weighed 225g308g. at 8 weeks of age, female offspring weighed 1088.9g1306.6 g and males at 8 weeks old were 723.5g1298.8g brown-uddenberg [12]; brown-uddenberg, et al. [13]. asibey [1] suggested a weaning age of 8 weeks old while smythe [14] recommended 12 weeks old. mohammed [15] reported on 10 dams with 22 offspring experiencing weaning periods of 1, 2, 3 and 6 weeks where dams did not re conceive immediately when enduring extended weaning periods of 1 week. mohammed, et al. [16] reported on 80 parturitions where dams lost -1.5 g/d, 1.6 g/d, 1.6 g/d and – 4.7 g/d after experiencing the weaning periods of 1, 2, 3 and 6 weeks respectively. the weaning periods of 1, 2, 3 and 6 weeks were applied and dams had successive parturitions of 15.9, 17.9, 20.4 and 23.9 weeks mohammed, et al. [16]. mohammed, et al. [16] concluded that weaning offspring at 7 days old allowed dams to: 1. loose less body condition. 2. reconceive faster. 3. have a shorter parturition interval. 2. methodology (this methodology was adopted and modified from mohammed [15]; mohammed, et al. [16]; mohammed and garcia [17] (unpublished); mohammed and garcia [18] (unpublished)). 2.1. location, climate and time frame the data collection took place at the university of the west indies field station (intensive agouti production unit), located at mt. hope (latitude 10.6468 and longitude -61.4228), trinidad. the temperatures within the unit ranged from 22.40c to 33.50c. the unit was established on july 31st, 1986 and had a total head count of approximately 147 agouti of different physiological states between 2015 to present. the observations were carried out from december 2016 to april 2018. 2.2. animal housing and management the animals were housed in an intensive type system (similar to the battery cage system of rabbits). animals were housed individually in steel cages (15’’ length, 18’’ width and 15’’ high) and supplied with water and food on a daily basis [13]. pens were cleaned and washed while animals were fed, watered and observed daily. 2.3. gestation, parturition and weighing of dams data was collected from dams which started by the recognition of pregnancy. this was done by visual observation and experience of the technical staff of the unit. recognition of pregnancy was usually confirmed by an increase in abdominal size (round and swings when walking) and the protrusion of teats (8) from the chest to abdominal area. when females were observed and confirmed to be pregnant, they were gently isolated and were placed into bigger cages (24’’ length, 18’’ width and 15’’ high). a red brick with two distinct holes was placed into each pregnant dam’s cage as well as fresh cut forages (grasses and tropical legumes) was used as bedding and for inoculation of the gut microflora. pregnant dams were weighed daily (with extreme care) from the day of isolation until the day of parturition and 3 parturitions after (during pre-wean and post wean periods). hence the study has data on 12 (2) year old females for 4 parturitions (total 48 parturitions). this experiment lasted approximately 485 days. this detailed animal review, 2019, 6(2): 24-31 26 © 2019 conscientia beam. all rights reserved. weighing process enabled us to get a long term understanding of how much weight (g) was added by conception and pregnancy and how much weight (g) was lost due to parturition and a 7 day weaning period [16]. it was confirmed in the study by mohammed, et al. [16] that weaning at 1 week was beneficial for the 1) good growth of offspring 2) earlier time of conception for females and 3) body condition was least affected by the earliest weaning period of week. females were caught using the “bag method” of catching and restraining. this method facilitated that both the animal and the handler had a barrier between them for their protection. the bag was folded down to half its length, with both hands controlling the entry point. the female was scooped into the bag gently (with experience) and then weighed. the weighing process was done by taring the bag (app. 102.5g) and then weighing the females individually (amir digital kitchen scale, 5000g, in increments of 1g). dams’ weights were recorded and stored on a spread sheet from the time of observed pregnancy until 4 parturitions were recorded. data such as total litter size at parturition, individual weight of litter mates and sex within litters were also recorded. 2.4. pre parturition feeding management dams were fed 1000g of fresh fruit per day, usually the fruit in season or abundance (farm grown). the fruits fed were mangoes (mangifera indica), pumpkin (cucurbita), cucumbers (cucumis sativus) and papaya (carica papaya). tropical forages such as trichanthera (trichanthera gigantea) and leucaena (leucaena leucocephala) were also fed (no more than 50% of the total dm diet). dams were also allowed 100g of concentrate per day (ration a 17% min. cp) during the conception and early gestation period. during the gestation period dams were also allowed mineral and vitamin supplements twice per week. 2.5. post parturition feeding management dams were fed 1000g (+ 100g extra per offspring) of fresh fruit per day for the 7 days pre weaning period, usually the fruit in season or abundance (farm grown). the fruits fed were mangoes (mangifera indica), pumpkin (cucurbita), cucumbers (cucumis sativus) and papaya (carica papaya). corn (zea mays), cassava (manihot esculenta) and coconuts (cocos nucifera) were added to the post parturition diet. tropical forages such as trichanthera (trichanthera gigantea) and leucaena (leucaena leucocephala) were also fed but in very limited amounts (<20% of the total dm diet). dams were also allowed 100g of concentrate per day (ration b 18% min. cp) during the late gestation (3rd trimester) and early parturition (7 days postpartum) period. dams were also allowed vitamin and mineral supplements. 2.6. analysis of data the data was collected from 12 (2 year) old multiparous dams. the length of the study was approximately 485 days where 4 parturitions were recorded for each dam. hence there were 48 parturitions in total with 100 offspring being born. 1. live weight was judged by weighing animals (g) from a) recognition of pregnancy b) through parturition and c) post parturition to conception to successive parturition. 2. parturition interval was calculated by the time in days between both parturitions minus the 104 days for gestation. 3. litter size for 4 parturitions from 12 dams were recorded and compared. 4. average offspring birth weight and total litter weight were recorded and compared. 5. sex ratio within each litter born per parturition were recorded and compared. animal review, 2019, 6(2): 24-31 27 © 2019 conscientia beam. all rights reserved. 3. results table-1. average amount of days to conception after 7 day weaning for 4 consecutive parturitions. dam id days to 1st part days from p1 to p2 days from p2 to p 3 days from p3 to p 4 1 123 123 120 115 2 122 118 111 113 3 123 120 118 111 4 121 122 125 109 5 126 124 116 110 6 111 110 121 116 7 122 120 118 114 8 119 120 121 113 9 115 120 121 114 10 122 116 110 119 11 109 110 109 115 12 117 113 109 109 average days/part. 119 118 117 113 st. dev. 5.18 4.77 5.52 3.01 st.err 1.50 1.38 1.59 0.87 assumed gestation 104 104 104 104 days postpartum 15.2 14 12.6 9.17 weaning @ 7 days 7 7 7 7 days to conceive 8.17 7.00 5.58 2.17 table-2. final body condition of dams after 4 parturitions with a 7 day weaning period. dam id p 1 (g) p 2 (g) p 3 (g) p 4 (g) after 4 part. (g) post: body cond. (g) 1 3301 3399 3504 3566 3443 265 2 3104 3213 3335 3397 3262 293 3 2857 2949 3060 3122 2997 265 4 2906 3015 3117 3179 3054 273 5 3034 3123 3235 3297 3172 263 6 3222 3322 3422 3484 3363 262 7 3043 3138 3238 3300 3180 257 8 2933 3037 3159 3221 3088 288 9 2948 3057 3169 3231 3101 283 10 2778 2874 3007 3069 2932 291 11 3044 3168 3279 3341 3208 297 12 3205 3286 3419 3481 3348 276 average wt. of dams 3031 3132 3245 3307 3179 276 std. dev. 157 156 153 153 155 13.9 std. err 45.4 45 44.3 44.3 44.7 4.01 table-3. average individual birth weight for all 4 parturitions with a 7 day weaning period. dam id ind. off (g) wt p1 ind. off (g) wt p2 ind. off (g) wt p3 ind. off (g) wt p4 1 208 217 225 230 2 197 207 216 221 3 184 192 201 205 4 186 196 204 209 5 193 202 210 215 6 204 213 221 226 7 194 202 211 215 8 188 197 206 211 9 189 198 207 212 10 179 188 198 203 11 194 204 213 218 12 203 211 221 225 avg. offspring wt. 193 202 211 216 std.dev. 8.60 8.59 8.52 8.55 std.err 2.48 2.48 2.46 2.47 animal review, 2019, 6(2): 24-31 28 © 2019 conscientia beam. all rights reserved. table-4. average litter size over the 4 parturitions with a 7 day weaning period. dam id litter size p1 litter size p2 litter size p3 litter size p4 avg. lit size/dam 1 2 2 2 3 2.25 2 1 2 2 3 2 3 2 2 2 2 2 4 3 2 1 2 2 5 2 2 3 2 2.25 6 1 2 2 3 2 7 2 1 2 1 1.5 8 1 2 2 2 1.75 9 2 2 3 3 2.5 10 2 3 2 2 2.25 11 2 2 2 3 2.25 12 1 3 3 2 2.25 avg. lt. size 1.75 2.08 2.17 2.33 2.08 std. dev. 0.62 0.51 0.58 0.65 0.59 std. err 0.18 0.15 0.17 0.19 0.17 4. discussion table 1 showed that weaning at 7 days [16] had a positive impact on the length of time it takes for dams to give birth and reconceive for a successive parturition. intervals ranged from as long as 119 days to as short as 113 days ([10] reported 126.03 days). hence it is possible to get 3 parturitions per year (113 x 3= 339 days) while enforcing the 7 day weaning period as a reproductive management tool. using a gestation period of 104 days, theoretically the days “open” ranged from 9 to 15 days ([10] reported postpartum estrus of 12.04 days). having offspring for 7 days (pre weaning period) of the open period, dams (12) had short intervals to conceive, which ranged from 2.17 to 8.17 days. table 2 showed that dams increased their live body weight from parturition to parturition and had a final total gain of approximately 276g after 4 parturitions. as concluded from mohammed, et al. [16], dams lost body condition (from 1.5g to 4.7 g per parturition) after enduring weaning periods of over 7 days. weaning period length, lactation performance and litter size had severe impacts on dams’ body condition [16]. table 4 showed that average litter size increased from 1.75 offspring/dam to 2.33 offspring/dam., which was a 33.14% increase in litter size per dam. mohammed, et al. [16] found the average litter size per dam was 1.7 offspring per litter (136 offspring/ 80 parturitions). table 5 showed the average offspring weight as a percentage of dam’s normal live weight increased from 5.47 % to 5.58 %. mohammed et al 2018 reported offspring birth weight as a percentage of dam’s normal weight to be 5.35%. table 3 showed that average offspring birth weight increased from 193g to 216g, which was an 11.72 % increase in average birth weight resulting in heavier offspring. table 6 showed male to female ratios from 66.6% m: 33.3% f in parturition (1) to 50 % m: 50% f in parturition 4 which indicated an increase in the number of females being born. table 7 showed an increase in triple born litters being 8.33% (1 of 12) of the total births in parturition (1) to 41.66 % (5 of 12) of the total births in parturition 4. 5. conclusion weaning at 7 days allowed dams to: 1. reconceive in a shorter period. 2. allow 3 parturitions per year. 3. loose less body condition postpartum. 4. have larger litter sizes. 5. have more females being born than male offspring per litter. 6. to have heavier offspring at birth. animal review, 2019, 6(2): 24-31 29 © 2019 conscientia beam. all rights reserved. table-5. average litter weight at birth as a percentage (%) of the dams’ live weight over 4 parturitions. dam id parturition 1 weights total litter wt @ p1 parturition 2 weights total litter wt @ p2 parturition 3 weights total litter wt @ p3 parturition 4 weights total litter wt @ p4 1 3801 416 3936 434 4053 451 4126 691 2 3604 197 3750 413 3884 432 3957 662 3 3357 367 3486 384 3609 401 3682 411 4 3406 559 3552 391 3666 204 3739 417 5 3534 387 3660 403 3784 631 3857 430 6 3722 204 3859 425 3971 442 4044 677 7 3543 388 3675 202 3787 421 3860 215 8 3433 188 3574 394 3708 412 3781 422 9 3448 377 3594 396 3718 620 3791 635 10 3278 359 3411 564 3556 395 3629 405 11 3544 388 3705 408 3828 426 3901 653 12 3705 203 3823 632 3968 662 4041 451 individual lt. size as a % mbw 5.47 5.51 5.56 5.58 animal review, 2019, 6(2): 24-31 30 © 2019 conscientia beam. all rights reserved. table-6. sex ratio of offspring at birth for all 4 parturitions. dam id litter size p1 litter size p2 litter size p3 litter size p4 1 2 2 2 3 2 1 2 2 3 3 2 2 2 2 4 3 2 1 2 5 2 2 3 2 6 1 2 2 3 7 2 1 2 1 8 1 2 2 2 9 2 2 3 3 10 2 3 2 2 11 2 2 2 3 12 1 3 3 2 total offspring 21 25 26 28 males 14 14 13 13 females 7 11 13 15 % females 33 44 50 50 table-7. birth type of offspring over 4 parturitions litter sizes birth type of p1 birth type of p2 birth type of p3 birth type of p4 single 4 1 1 1 twins 7 9 8 6 triplets 1 2 3 5 total litters 12 12 12 12 % single 33% 8% 8% 8% % double 58% 75% 67% 50% % triple 8% 17% 25% 42% total offspring 21 25 26 28 6. recommendations for future work 1) measuring the rate of growth (by sex and litter size) of offspring until adulthood (360 days) by allometric measurements using gompertz, logistic and von bertanlaffy equations. 2) creating a diet for each physiological state (focusing on dams and offspring) of the production cycle. 3) defining the age at slaughter, dressing percentage and carcass quality of male agouti. 4) re-defining target performance coefficients for intensive production and creating new criteria for phenotypic selection for intensive breeding. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: authors would like to thank the staff of the department of food production in the faculty of agriculture at the university of the west indies for their support and encouragement. they would also like to thank the staff at the agouti unit of the university field station for their assistance in keen animal management practices and great considerations for animal welfare. references [1] e. o. a. asibey, "evaluation and development of wildlife resources in trinidad and tobago. the economic role of wildlife in trinidad and tobago," united nations development programme food and agriculture organisation of the united nations, trinidad & tobago office, trinidad & tobago, wi (unpublished), 1984. [2] c. e. brown, "rearing wild animals in captivity, and gestation periods," journal of mammalogy, vol. 17, pp. 10-13, 1936. available at: https://doi.org/10.2307/1374541. [3] h. roth-kolar, "contribution to an action system of the aguti (dasyprocta aguti l.). z," animal psychol, vol. 14, pp. 362-375, 1957. [4] b. j. weir, reproductive characteristics of hystricomorph rodents. the biology of hystricomorph rodents. i. w. and weir, b vol. 34. rowlands: academia press, 1974. [5] d. j. clark and e. d. olfert, zoo and wild animal medicine. london: saunders company w.b, 1986. animal review, 2019, 6(2): 24-31 31 © 2019 conscientia beam. all rights reserved. [6] nrc, nutrient requirements of laboratory animals. the national research council. washington, dc: national academy press, 1995. [7] b. j. weir, "some observations on reproduction in the female agouti, dasyprocta aguti," journal of reproduction and fertility, vol. 24, pp. 205-211, 1971. available at: https://doi.org/10.1530/jrf.0.0240203. [8] d. a. guimarães, r. l. ramos, o. m. ohashi, g. w. garcia, and v. w. gomes, "plasma concentration of progesterone and 17ß-estradiol of black-rumped agouti (dasyprocta prymnolopha) during the estrous cycle," tropical biology magazine, vol. 59, pp. 29-35, 2011. available at: https://doi.org/10.15517/rbt.v59i1.3176. [9] m. singh, g. w. garcia, a. o. adogwa, and g. bourne, "vaginal cytology as a method of estrous determination in the female agouti (dasyprocta leporina)," advances in animal biosciences, vol. 1, pp. 417-418, 2010. available at: https://doi.org/10.1017/s2040470010000440. [10] d. a. guimarães, o. m. ohashi, m. singh, and w. vale, "profile of plasmatic progesterone on pregnancy, and the postpartum estrus of dasyprocta prymnolopha (rodentia: dasyproctidae)," tropical biology magazine, vol. 64, pp. 1519-1526, 2016. available at: https://doi.org/10.15517/rbt.v64i4.21798. [11] v. korz, "social relations and individual coping reactions in a captive group of central american agoutis (dasyprocta punctata). z," saugetierkunde, vol. 56, pp. 207-218, 1991. [12] r. c. l. brown-uddenberg, "the conceptualization of an intensive production model for the agouti (dasyprocta leporina) a neotropical rodent in trinidad, west indies," m.phil. thesis in livestock science, the university of the west indies, trinidad, trinidad and tobago, w.i, 2001. [13] r. brown-uddenberg, w. g. garcia, q. s. baptiste, t. counand, a. adogwa, and t. sampson, the agouti (dasyprocta leporina, d. agouti) booklet and production manual. st. augustine, trinidad: gwg publications, 24 sagan drive, champs fleur. website: the open school of tropical animal science and production, 2004. [14] n. smythe, the natural history of the central american agouti (dsayprocta punctata). washington, dc: smithsonian contribution to zoology. smithsonian insinuation, 1970. [15] r. mohammed, "pre and post-weaned growth of the agouti (dasyprocta leporina), a neo-tropical rodent with rhe potential for domestication: a case study at the uwi field station," university of the west indies, trinidad and tobago master’s thesis, 2016. [16] r. mohammed, g. legall, and g. garcia, "towards the determination of a “weaning age” for the intensive production of the agouti (dasyprocta leporina)." livestock research for rural development. available: http://www.lrrd.org/public-lrrd/proofs/lrrd3010/riyad30173.html, 2018a. [17] r. mohammed and g. garcia, "growth and development of the offspring of the neo-tropical rodent, agouti (dasyprocta leporina)," 2018b. [18] r. mohammed and g. garcia, "effect of dams’ age and live weight on agouti (dasyprocta leporina) offspring birth weight, litter size, sex and early postpartum growth," 2018c. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 1 © 2018 conscientia beam. all rights reserved. the simulation of egg hatching trend of aedes aegypti associated with rainfall distribution najir tokachil1+ nuraini yusoff2 1faculty of computer and mathematical sciences universiti teknologi mara cawangan negeri sembilan kampus seremban, 70300, negeri sembilan, malaysia 2faculty of computer and mathematical sciences universiti teknologi mara, 40450 shah alam, malaysia (+ corresponding author) abstract article history received: 4 april 2018 revised: 15 may 2018 accepted: 18 may 2018 published: 21 may 2018 keywords aedes aegypti, lefkovitch matrix dengue,stage-structured population dynamics aedes aegypti is primary vector of zika virus, dengue, and chikungunya which go through four different stages of life cycle: egg, larva, pupa, and adult. the mosquito might be able to lay 100 eggs at a time. the eggs can hatch when there is water and submerged in the water, but it can survive without water almost to 8 months by sticking to the walls of a container. in this research, the trend of egg hatching was simulated by using a stage-structured lefkovitch matrix model. the matrix model consists of a function of egg hatching which associated and depends on rainfall distribution. the purpose of the function is to identify the relationship between egg hatching and rainfall which provide water to egg. using the same mathematical model, the population of adult aedes aegypti has also simulated which the population related to egg simulation and rainfall. the graphical results were shown to illustrate the relationship between the rainfall, egg number and adult aedes aegypti. we found that there was a significant relationship between the rainfall and these two stages of mosquito life cycle which are egg hatching number and adult aedes aegypti. however, it is recommended to look for more possible factors such as the size of an opening container and humidity which possible to contribute to the development of mosquito to acquire more accurate results. contribution/originality: the study contributes in the existing literature which stated that both factor rainfall and temperature involved in the development of mosquito life cycle. we found that, the rainfall distribution factor is the most significant to identify the trend of development of mosquitos’ population and meanwhile the factor of temperature influences more on the increase of dengue virus transmission. 1. introduction dengue fever is a contagious tropical or a mosquito-borne viral disease which transmitted by female aedes aegypti mosquito. the dengue can be spread into two forms which are dengue fever (df) and dengue hemorrhagic fever (dhf). patients with df might go to develop dhf which can evolve to severe form or death known as dengue shock syndrome (dss) [1]. dhf and dss can occur in both children and adults. the aedes aegypti originates from africa and now exist globally in tropical and subtropical region. the distribution of this mosquito might through global trade and shipping activities. these mosquitoes usually breed around the human habitat and bite during the day. they are easily recognizable by their peculiar white spotted body and legs. the infected female aedes aegypti can spread dengue virus mainly through the bites [2]. the transmission occurs when the mosquito bites a person who already gets infected by dengue fever and the virus will animal review 2018 vol. 5, no. 1, pp. 1-7 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2018.51.1.7 © 2018 conscientia beam. all rights reserved. https://orcid.org/0000-0002-3378-8805 https://orcid.org/0000-0003-3675-8019 http://crossmark.crossref.org/dialog/?doi=10.18488/journal.92.2018.51.1.7&domain=pdf&date_stamp=2017-01-14 animal review, 2018, 5(1): 1-7 2 © 2018 conscientia beam. all rights reserved. enter the mosquito. the mosquito bites a susceptible person, and then dengue virus will spread in that person [3]. besides, the infected female mosquitos also can spread the virus to their eggs [4]. to produce their eggs, the female mosquitoes require a protein which can be obtained from human blood. however, adult male mosquitoes feed on nectar, and they do not involve both transmitting virus and reproducing. there are four main stages of the life cycle which are eggs, larvae, pupae and adult. many articles have stated that the factors of temperature and rainfall contribute to the increase of number of mosquito which the main vector of spreading dengue virus [5]. however, in malaysia the temperature was recorded as almost unchanged compared than rainfall distribution. therefore, the purpose of this study is to simulate the first stage of mosquito which is egg stage associated with rainfall distribution using lefkovitch matrix model. using the same mathematical model, the population of adult aedes aegypti was also simulated because the adult is the main life stage of mosquito which involved in both transmitting virus and reproducing egg. a model proposed in previous research [6]; [7]; [8] will be considered and discussed in order to achieve the objectives of this research. we focused on shah alam city since the reported cases of dengue are always high and only first three months in 2016 was considered because these months have high dengue cases compared to others period. 2. method the projection matrix of aedes aegypti life cycle was considered to forecast the population of mosquito based on distribution of rainfall. in this section, all the methods used to achieve the objectives of this research will be clearly explained. generally, the population model is described in matrix algebra with consist of transaction rate of aedes aegypti life cycle. 2.1. population projection matrix in this research, a lefkovitch matrix model was used to simulate each stage in the life cycle of aedes aegypti mosquitoes. the mosquitoes have gone through four life cycle stages: egg, larva, pupa, and adult. however, in this research, the adult stages are divided into two stages namely adult 1 and adult 2. the adult 1 was described as a mosquito that can produce and lay the first eggs to convert into adult 2. the stage of adult 2 is an adult has been laying egg more than one time and gone through several egg laying processes. the lefkovitch matrix model was used to simulate the population number of aedes aegypti because it is one of the best stage-structured matrix models [9]. only female mosquitoes are considered because they directly involved in egg laying process. 2.2. lefkovitch matrix model the population sizes with respect to age are difficult to determine precisely rather than considering the stages of population life cycle. therefore, the stage-structured matrix model was constructed by considering the growth of mosquito life cycle stages and breeding maturity [10]. the population of aedes aegypti mosquito is easier to identify based on their life cycle than its age because each life stage can be differently classified based on the growth of physical size. in this section, the simulation number of mosquito population at any time t will be assigned as ( )n t and the transition matrix a is the transformation based on mosquito life cycle. the simulation of population at time 1t  can calculate by multiply matrix a and ( )n t .                   1 4 5 1 2 2 3 3 4 4 5 0 0 ( ) 0 0 0 0 0 0( 1) ( ) (1) 0 0 0 0 0 0 p f f e t p g pn t n t g p g p animal review, 2018, 5(1): 1-7 3 © 2018 conscientia beam. all rights reserved. the transition matrix a consist of five elements which completely depending on stage of mosquito life cycle, i from egg, larva, pupa, adult 1 and adult 2. the element i p is referred as the proposition of aedes aegypti survive and stay in the same stage i . the i g is the proposition of surviving and growing of the mosquito from stage i into the next stage ( 1)i  . the parameter i f is described as the fertility of mosquito in stage i . the fertility rates are set only for adult stages which the mating process and producing eggs occurred during this stage. 2.3. transition rate of aedes aegypti life cycle we let that the survival rate and the duration rate for stage i respectively denoted as i s and i d . the transition rate, i p can be computed using the formula as follows.    1(1 ) (2) 1 i i d i i i d i s s p s since the plus of proportion, i g and i p is equal to the total population of stage i survive, then transition rate, i g can be obtained by using the formula as follows.    (1 ) (3) 1 i i d i i i d i s s g s the fecundity rate of f2 and f3 are equal to 0 since only adult 1 and adult 2 could produce eggs. therefore, only the transaction rate 4 f and 5 f are considered for the transaction matrix a . since, the time duration required by each stage to survive and grow might be different then the time estimation must be assumed based on environmental and biological factors. 2.4. transition rate of egg hatching water is the main source in the process of egg hatching. therefore, we assumed that only uncovered and opening containers can be filled with amount of water caused by rainfall. the amount of water stagnated in the container will be a breeding site for the mosquito. in this situation, we considered that the heavy rainfall distribution possibly influences the egg hatching process by overflowing the water in containers. the egg hatching process was directly associated with rainfall distribution can be described as a function of water depth with respect to time t (days).        2 1 1 1 max ( 1) ( ) (4) c wd t e t s c wd the parameter 1s is the proportion of the aedes aegypti in egg stage will survive and move to the larva stage,  1twd was taken as the amount of rainfall or stagnant water in a container at time t disregarding the shape of the container. the maxwd is the average depth of the container. meanwhile, 1c is probability of egg hatching and 2c is the pattern of egg hatching [6];[7];[8]. 2.5. simulation of egg hatching and adult stage associated with rainfall the proportion of ig , i p and  1 e t can be calculated by using the information in table 1 obtained from our previous studies(referred [7];[8]). animal review, 2018, 5(1): 1-7 4 © 2018 conscientia beam. all rights reserved. table-1. the survival rate and duration of each stage in mosquito life cycle i stage survival rate, i s age (days), i d 1 egg 0.9890 < 4 2 larvae 0.9898 4 – 8 3 pupae 0.9898 9 – 10 4 adult 1 0.9100 11 – 14 5 adult 2 0.9100 15 24 the daily rainfall of january, february and march in year 2016 were considered because the monthly cases of dengue fever are reported higher than other months in the city of shah alam. the data of rainfall obtained from meteorology department, malaysia. the measurement of rainfall is in millimeter (mm). 2.6. implementation in this section, the simulation is obtained where the matrix a is multiplied by the initial population of mosquito, ( )n t . we set the initial number of eggs in the container is 1000 eggs. the information in table 1 will be used to obtain each rate in matrix a using the formula i g , i p and  1 e t . the values of  1 e t will change depend on rainfall distribution. the value of 1 c and 2 c are 0.27901 and 5 respectively.                                  1 0.74622 0 0 8 16 1000 (1) 0.79588 0 0 0 0 0 0.19392 0.49744 0 0 0(1) 0 0 0.49240 0.71360 0 0 0 0 0 0.19640 0.85260 0 e n the simulation of mosquito population for the following days, ( 1)n t  were obtained by using maple where the population of each stage in the mosquito life cycle change exactly depend on daily rainfall distribution. 3. result and discussion the simulation of the mosquito population obtained from model, ( )n t are illustrated graphically into figure 1, figure 2 and figure 3 to observe the trend between simulation of egg number associated with rainfall and the influences on the number of adult population. in the previous section, we mentioned that month january, february and march in 2016 were considering since the dengue cases were reported high in these months. the observation on the trend of egg number is important because it influences the adult population. the further explanations will discuss in this section. in figure 1, we found that the trend of egg number during the month was very significant starting in the week 10. the rainfall received consecutively between week 11 to 18 allowing adult mosquitoes to produce eggs because the rainfall might provide the breeding sites [8]. although, the frequency of receiving rain in the next week is low but the number of eggs continue to increase. this could be occurred due to receiving rain between the week 11 to week 18 provided enough breeding site for adult mosquito to lay their eggs. this situation, it also affects the number of adult mosquitoes that increase gradually based on the number of eggs. animal review, 2018, 5(1): 1-7 5 © 2018 conscientia beam. all rights reserved. figure-1. the relationship of egg number, adult and rainfall distribution on january 2016 at the beginning of february (refer figure 2), the number of eggs was high but the number goes down suddenly starting from week 8 to 25. we noticed that the frequency of receiving rainfall in this month is less than january. we could say that the rainfall distribution received in this month might affect the existence of mosquitoes breeding site where there might be none and lack of stagnant water in opening containers. however, this number increased drastically starting from the week 25 onwards. hence, the adult mosquitoes also have the same trends as eggs. figure-2. the relationship of egg number, adult and rainfall distribution on february 2016 referring to figure 3, the number of eggs keeps increasing from the last month. this situation persists until week 10 in march and suddenly, the trend of eggs number goes down in the following weeks. we can observe there are five consecutive weeks received high rainfall starting from week 10 until week 14. the high rainfall might cause the stagnant water in the containers overflow and if there are eggs in the container, the abundant water will wash out the eggs from the container. the egg number will decrease, and the process of egg hatching almost does not occur. this situation also influences the development of adult mosquitoes and production of egg as well [11]. the fluctuation of egg number trend continued to decline until the end of the month which throughout the weeks the receiving rains were very low, and the weather become dry. however, the adult mosquitos that have arisen from the weeks before are very active because this period is most appropriate for mosquitoes to spread the virus to humans. it is advisable to keep people cautious if this trend of rain happen. eliminate mosquito breeding site is one of the best methods that can help reduce the development of mosquitoes. animal review, 2018, 5(1): 1-7 6 © 2018 conscientia beam. all rights reserved. figure-3. the relationship of egg number and rainfall distribution on march 2016 4. conclusion using the stage-structured matrix model for mosquito simulations gives some insight into the development of the life cycle of mosquitoes. this simulation is an alternative method to reduce dengue disease by studying the life cycle of mosquitoes. in this study, the factor of rainfall is the main role because it is seen that rain can provide breeding sites for the mosquitoes. based on the results we get from this study, we found that the number of eggs will increase if there is a moderate rainfall distribution that provides enough water in the container. however, high rainfall can affect the amount of eggs which the heavy rains cause water in containers to overflow and carry eggs out from the water and containers. this situation causes the hatching process to almost do not occur and then affects the number of adult mosquitoes. the spread of dengue virus also decreases but the dry or moderate weather will make the adult mosquito active in the spread of the dengue virus. however, future studies are recommended to consider other factors such as humidity and mosquito habitat areas. funding: this research was supported by universiti teknologi mara (uitm) under geran dana pembudayaan penyelidikan (irags),600-rmi/dana 5/3/irags (6/2015). competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: the author(s) would like to thank to institute of research management and innovation (irmi) uitm as a management center of this grant. references [1] j. g. rigau, g. g. clark, d. j. gubler, p. reiter, e. j. sanders, and a. v. vorndam, "dengue and dengue haemorrhagic fever," lancet, vol. 352, pp. 971–977, 1998. view at google scholar [2] world health organization (who), "vector-borne viral infections. initiative for vaccine research." retrieved http://www.who.int/vaccine_research/diseases/vector/en. [accessed retrieved april 5, 2013], n.d. [3] b. f. eldridge, biology and control of mosquitoes. california: university california davis, 2008. [4] j. v. murray, c. c. jansen, and p. d. baro, "risk associated with the release of wolbachia-infected aedes aegypti mosquitoes into the environment in an effort to control dengue," frontiers in public health, vol. 4, pp. 43, 2016. view at google scholar | view at publisher [5] l. c. chien and h. l. yu, "impact of meteorological factors on the spatiotemporal patterns of dengue fever incidence," environment international, vol. 73, pp. 46-56, 2014. view at google scholar | view at publisher [6] n. yusoff, h. budin, and s. ismail, "simulation of population dynamics of aedes aegypti using climate dependent model," world academy of science, engineering and technology, vol. 6, pp. 136-144, 2012. [7] n. tokachil and n. yusoff, "effect of rainfall on population dynamic," mathematics and statistics journal, vol. 1, pp. 1723, 2015. https://scholar.google.com/scholar?hl=en&q=dengue%20and%20dengue%20haemorrhagic%20fever http://www.who.int/vaccine_research/diseases/vector/en https://scholar.google.com/scholar?hl=en&q=risk%20associated%20with%20the%20release%20of%20wolbachia-infected%20aedes%20aegypti%20mosquitoes%20into%20the%20environment%20in%20an%20effort%20to%20control%20dengue https://scholar.google.com/scholar?hl=en&q=risk%20associated%20with%20the%20release%20of%20wolbachia-infected%20aedes%20aegypti%20mosquitoes%20into%20the%20environment%20in%20an%20effort%20to%20control%20dengue http://dx.doi.org/10.3389/fpubh.2016.00043 https://scholar.google.com/scholar?hl=en&q=impact%20of%20meteorological%20factors%20on%20the%20spatiotemporal%20patterns%20of%20dengue%20fever%20incidence http://dx.doi.org/10.1016/j.envint.2014.06.018 animal review, 2018, 5(1): 1-7 7 © 2018 conscientia beam. all rights reserved. [8] n. tokachil, n. yusoff, a. saaid, n. appandi, and f. harun, "effect of water availability in opening containers of breeding site on aedes aegypti life cycle," aip publishing, vol. 5, pp. 1-6, 2015. [9] j. boardman, d. hrozencik, m. kwon, u. irfan, and z. aklilu, "using population models in the teaching of eigenvalues. rutgers university, center for discrete mathematics & theoretical computer science." retrieved from http://dimacs.rutgers.edu/. [accessed september 3, 2016], 2007. [10] t. takenori and n. hisao, "an analysis of life history evolution in terms of the density-dependent lefkovitch matrix model," mathematical biosciences, vol. 112, pp. 155-176, 1992. view at google scholar | view at publisher [11] n. tokachil and n. yusoff, "the simulation of egg number of aedes aegypti using stage-structured matrix model," journal of technology management and business, vol. 5, pp. 8-14, 2018. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://dimacs.rutgers.edu/ https://scholar.google.com/scholar?hl=en&q=an%20analysis%20of%20life%20history%20evolution%20in%20terms%20of%20the%20density-dependent%20lefkovitch%20matrix%20model http://dx.doi.org/10.1016/0025-5564(92)90091-a 1 † corresponding author © 2016 conscientia beam. all rights reserved. hydrostatic and hydrodynamic characteristics of swimming animals-an inspiration for hybrid buoyant aircraft anwar ul haque1† --waqar asrar2 --ashraf ali omar3 --erwin sulaeman4 --jaffar syed mohamed ali5 1,2,4,5department of mechanical engineering, international islamic university malaysia (iium), kuala lumpur, malaysia 3department of aeronautical engineering, university of tripoli, tripoli, libya abstract in today’s world, the biological sciences are mostly considered separate from the existing modern knowledge of various other fields of sciences and engineering; however, there are many properties of nature and known facts of biological sciences that can be proved in the other domains of science and technology as well. correlation of the geometric and buoyant properties of the swimming animals with the hybrid buoyant aerial vehicles is an example of this hypothesis. in the present work, some experiments related to the geometric parameters of a california sea lion were carried out. it was found that the fineness ratio of this animal is of the same order as the optimum value of that for the condition of minimum drag and power required for the buoyant aerial vehicle. the role of multiple fins on the elongated bodies of shark is also discussed in its application for yaw stability as well as to shroud the antennas that are used in the aircraft for various communication systems. keywords: fineness ratio, california sea lion, dorsal fin, minimum drag, aerodynamic lift, hybrid buoyant aircraft, minimum drag, buoyant independent drag. received: 23 november 2015/ revised: 23 december 2015/ accepted: 29 december 2015/ published: 4 january 2016 contribution/ originality the paper's primary contribution is to show that the hydrodynamic and a few geometric parameters of a california sea lion resemble to that of the well-known facts of buoyant and hybrid buoyant aerial vehicles. animal review 2016 vol. 3, no. 1, pp. 1-9 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.1/101.1.1.9 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.1/101.1.1.9 animal review, 2016, 3(1):1-9 2 © 2016 conscientia beam. all rights reserved. 1. introduction research in the area of biological sciences being carried out in this era is as promising as in the other fields of science and engineering. research in this area when coupled with that of other fields can do wonders and can make a significant contribution to the advancement of technology. hydrodynamic characteristics of swimming animals are one such area that has recently been explored for its application in aviation industry i.e. for hybrid buoyant (hb) aircraft. it is a type of aircraft in which partial weight is balanced by the buoyant lift; similar to a swimming animal like steller sea lion, haque et al. (2015a). for example, the body of california sea lion has a cambered profile because of having flippers attached at an anhedral angle to it; where this geometric feature is perhaps to decrease the coefficient of pitching moment and to increase the roll stability. similar findings are there from the static longitudinal stability analysis of hb aircraft (haque et al., 2015b). in the present work, hydrodynamic and geometric variables of california sea lion are explored in comparison with the known knowledge of the same for hybrid aerial vehicles. in this regard, a series of experiments were conducted on a 16 years old california sea lion present at the zoo negara, kula lumpur. the geometric parameters so obtained were further utilized for the purpose of comparison with what is known in the field of hybrid buoyant aerial vehicles. moreover, the dorsal fin of shark is discussed regarding biological sciences and its further application for hb aircraft. 2. resemblance of california sea lion with buoyant and hybrid buoyant vehicles some experiments were conducted recently on california sea lion, fig. 1. these tests include the flow visualization on these animals while swimming in water. also, major geometric parameters were estimated with the help of four trainers; that took them a week to train the animal for these measurements. the maximum length (including the rear flippers), maximum width, span of the front flippers was 116 inch (2.93 m), 10.5 inch (0.266 m) and 21.0 inch(0.53 m), respectively. to be able to find the correlation of this marine animal in the water to a flying buoyant vehicle in the air, the fluid dynamic conditions, as well as the geometrical shape, have to be similar. but the body of the animal is quite flexible, and it is quite hard to take measurements while the animal is inside the water. therefore, all the measurements are done on the ground and hence are approximate values. animal review, 2016, 3(1):1-9 3 © 2016 conscientia beam. all rights reserved. fig-1. measurements for the geometric parameters of california sea lion 2.1. buoyant lift sea animals utilize buoyant lift to stay uplift to balance the effect of gravity. this buoyant lift is independent of the drag force exerted on the body of a sea lion (suzuki et al., 2014). buoyant lift is independent of the surface/wetted area of the marine animal. but, similar to any aerodynamic and hydrodynamic coefficient, the drag coefficient is dependent on the reference area of the body immersed in the fluid. in 1990, alexander (1990) carried out a study related to the effect of different reference areas for estimation of the drag coefficient of swimming animals. he found that there was a drastic reversal in the drag coefficient data obtained by using the wetted area as a reference area for two species of idotea; genus of isopod crustaceans. he mentioned that that there is no powerful hydrodynamic basis for the selection of reference area for the estimation of drag coefficient and the same holds good for hybrid aerial vehicles as well. as far as buoyant lift is concerned, it is mainly linked with the criterion of good performance for an animal that takes into account that how much energy it can process and store (guts, so to speak) and how many offspring it can produce (gonads, loosely put). in the case of sealion, the maximum available buoyant lift is 50% of the gross weight (suzuki et al., 2014). this digit is consistent with the recent findings related to the optimum buoyancy ratio for hybrid airship (raymer, 2006). 2.2. lifting profile of california sea loin marine animal's body can generate additional lift; hydrodynamic profile of california sea lion is one of the examples of it. this marine animal has big guts and gonads to utilize the buoyant lift animal review, 2016, 3(1):1-9 4 © 2016 conscientia beam. all rights reserved. to stay uplift to balance the effect of gravity; maximum value of which is of the same order as recommended for hybrid buoyant aircraft; an airplane that specialized as a volume maximizer. based on our predicted similarity between california sea lion and man-made buoyant aerial vehicles, we have proposed that california sea lion’s body “can be tailored for aeronautical applications such as the lifting fuselage of a hybrid buoyant aircraft” (haque et al., 2015c). complete geometric details of the outer contour of the california sea lion are not yet available. perhaps, due to the flexible body of sea lions, it is nearly impossible to measure the same; the only information available is the location of maximum thickness, which is about 34 % of body length (suzuki et al., 2014). in one of our studies related to the hybrid lifting hull, we selected eppler-1200 airfoil for the hybrid hull, based on the visual judgment of geometric profile of california sea lion and requirement of takeoff ground roll angle to fulfill future certification requirement (haque et al., 2014). 2.3. the position of maximum thickness of body the position of the maximum thickness is an important aerodynamic as well as hydrodynamic parameter to define the point where the transition of the boundary layer occurs. it’s position further aft is desirable to have more laminar flow as well as less drag. during the measurements of california sea lion on a flat surface, it has been observed that the position of maximum thickness is about 36 percent of the length of the body. this value is slightly lower than that observed by feldkamp (1987). interestingly, this is the location of the shoulders and flippers of this animal as well. eppler -1200 is one of the airfoils with the location of its maximum thickness close to that measured earlier for sea lion (haque et al., 2015b). this airfoil has recently been used for the design of a hybrid lifting hull. the selection of this airfoil was based on the location of maximum thickness, visual judgment of geometric profile of california sea lion and requirement of takeoff ground roll angle to fulfill future certification requirement (haque et al., 2015c). 2.4. optimum fineness ratio it is well known that conventional non-rigid airships usually have fineness ratio value of about 2.3-2.8. however, a fineness ratio between 5 and 6 was found to be optimal for maximum propulsion efficiency of a fixed maximum diameter buoyant vehicle (ilieva et al., 2014). interestingly, as per the findings of suzuki et al. (2014) this range of fineness ratio is found comparable to the california sea lion. this marine animal has a fineness ratio of 5.55 and location of maximum thickness of outer profile is at 34% of the overall length (cheneval, 2005). this fineness ratio is also common with other marine mammals like dolphins, fishes, and whales (fish, 1994). to have optimum drag and the propulsion power, a fineness ratio between 5 and 6 can be used for the design of hybrid lifting hull animal review, 2016, 3(1):1-9 5 © 2016 conscientia beam. all rights reserved. 3. biological science of dorsal fin and its potential applications for hb aircraft in the field of aerospace, the dorsal fin is usually referred as the extension of the vertical tail area at the leading edge. it is unlike of a dorsal fin that sticks up by itself (nakamura et al., 2015) such as one can see on a dolphin or shark; located forward of the vertical tail, but not connected to it. the dorsal fin is one of the potential solutions to increase the yaw stability as the moment arm between the aerodynamic center of the dorsal fin and center of gravity is enough for an elongated shaped fuselage to generate the additional yawing moment. when an hb aircraft is subjected to side-slip angle, then it should exhibit static directional stability to return the nose of the aircraft into the wind. an h-tail empennage arrangement has been used earlier in the conceptual design phase for the said purpose (haque et al., 2015b). the analytical results have shown earlier that this configuration is marginally stable in the yaw, and any further increase in the size of a twin tail will make the weight of the tail heavy. similar to a shark fish, use of multiple dorsal fins was earlier proposed for hb aircraft. however, such fins should be placed away from the center of gravity, fig. 2(a), and should not be located at the attachment points of the bulkheads, fig. 2(b). the body of marine animals is quite flexible, but a flying machine should be rigid enough to bear the flight loads. such a structural rigidity can be reinforced by the use of bulkheads and additional frames in the lateral direction. now let’s discuss the anatomy and the biological science of dorsal fin in the swimming animals. (a) side view (b) isometric view fig-2. extruded view of different components of a hybrid buoyant aircraft model 3.1. biological science a lot of research has been carried out earlier on the role of dorsal fin towards stability and turning (harris, 1937; harris, 1938; harris, 1953; webb, 1975; webb, 1977; webb and keyes, 1982; webb, 1988; webb, 2002). for example, drucker and lauder (webb and keyes, 1982) carried out a thorough study about the understanding of the design and function of dorsal fin for different types of fishes. they found that the dorsal fin produced a pair of counter-rotating vortices during turning. during steady swimming, these vortices interact with the caudal fins that animal review, 2016, 3(1):1-9 6 © 2016 conscientia beam. all rights reserved. are located downstream for wake energy augmentation and also increase the thrust. such fins are located close to the center of the mass and produce about one-third of the required lateral force for turning (standen, 2008). it was observed by the scientists mentioned earlier that irrespective of the fineness ratio of the body, the location of the paired pectoral fins (a lift producing component, marked with red colour) is always ahead of the cg. interestingly, it can be observed from fig. 1 (standen, 2008) that percoid has small fineness ratio and also it has a big dorsal fin as compared with salmonid. but as the fineness ratio increases, the location of dorsal fin moves downstream for sturgeon to fulfill the requirement of the long moment arm. among all, shark has the highest fineness ratio and has multiple dorsal fins, with the first fin of big size as compared to the secondary dorsal fin, located downstream of the center of the mass. fig-3. an evolutionary transformation: paired fin position throughout fish evolution source: standen, e.m., 2008. pelvic fin locomotor function in fishes: three-dimensional kinematics in rainbow trout oncorhynchus mykiss. journal of experimental biology, 211(18): 2931–2942. maia and wilga (2013) has recently conducted experiments to evaluate the functionality of dorsal fin in bamboo shark for the steady condition. their experimental data indicated a continuous oscillation in the lateral position. they also estimated the thrust produced by such an oscillation motion and found a loss in lateral stability due to the different orientation of dorsal fin. moreover, deflection in the tip of the dorsal fin was found. though, the major contribution towards longitudinal stability is due to the tail, but such a deflection can be related to longitudinal stability as well. deflection of the complete dorsal fin is also observed in other aquatic animals, having more than one dorsal fin. harris (harris, 1937; harris, 1938; harris, 1953) found that the first dorsal fin of spiny dogfish behaves like a stabilizer, and it moves independently. but the second dorsal fin moves with the body and also acts as a thruster for forward motion. based on his experiments, he concludes that “vertical lift force at the posterior end produces a negative pitching moment that neutralizes the positive moment of the trailing pectoral fins.” animal review, 2016, 3(1):1-9 7 © 2016 conscientia beam. all rights reserved. 3.2. application for all wireless communication systems, one important factor is the design of the antennas at low frequencies with desired compact size and enhanced performance characteristics such as matched impedance bandwidth, better efficiency, and good gain. in an aircraft communication system, antennas are used for various operations such as for direction finding (df), vhf communications, distance measuring system (dme), global positioning system (gps), microwave landing system (mls) and radar altimeter (radalt), etc., covering the frequency range from 30mhz up to 4ghz and more (macnamara, 2010). it has been studied in the past that wrong placement of antennas and any additional weight and size on the aircraft increases the aerodynamic drag that negatively affects the flying ability of an aircraft, for example, an increase in the fuel consumption and puts a limitation on the speed of aircraft (jahoda, 2006). they introduce the noise and increase the parasitic drag. by making the antenna low profile, it comes very close to the metal body of an aircraft which degrades its performance (josephson, 1957; sievenpiper, 1999). such antennas can be housed inside the dorsal fin as well. 4. conclusion fineness ratio, the location of maximum width and buoyant independent drag of a california sea lion are the three quantities, which are common with hybrid buoyant aircraft. hence, the known knowledge of hydrodynamic characteristics of swimming animals is adjoined with the aerospace application so that aerospace when dealt in line with biology, can provide inspiration for the design of hb aircraft. in aircraft, antennas are used for communication as well as for various navigation systems of aircraft, which can be shrouded by a dorsal fin. however with a slight yaw, dorsal fin causes a lot of drag, and it can produce a restoring yawing moment but not that enough such as a rudder produces. funding: the support of the ministry of science, technology and innovation (mosti), malaysia, under the grant 06-01-08-sf0189 and of the ministry of education, malaysia under the grant frgs 13-020-0261 are gratefully acknowledged. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: authors are thankful to the management of zoo negara, kuala lumpur for providing assistance in taking measurements of the california sea lion. references alexander, d.e., 1990. drag coefficients of swimming animals: effects of using different reference areas. biological bulletin, 179(2): 186-190. cheneval, o., 2005. biomechanics of turning manoeuvers in steller sea lions. doctoral dissertation, university of british columbia. feldkamp, s.d., 1987. swimming in the california sea lion: morphometrics, drag and energetics. journal of experimental biolog, 131(1): 117–135. animal review, 2016, 3(1):1-9 8 © 2016 conscientia beam. all rights reserved. fish, f., 1994. influence of hydrodynamic-design and propulsive mode on mammalian swimming energetics. australian journal of zoology, 42(1): 79-101. haque, a.u., w. asrar, a.a. omar, e. sulaeman and j.s.m. ali, 2014. stability and takeoff ground roll issues of hybrid buoyant aircraft. advanced material research, 66(1): 503–507. haque, a.u., w. asrar, a.a. omar, e. sulaeman and m.j.s. ali, 2015a. a novel design of a hybrid buoyant aircrafta potential greener solution for inter-connectivity of malaysian islands. 62nd casi aeronautics conference and agm 3rd gardn conference, 19-21 april, 2015, montreal canada. haque, a.u., w. asrar, a.a. omar, e. sulaeman and m.j.s. ali, 2015c. cambered profile of a california sea lion's body. journal of experimental biology, 218(8): 1270-1271. haque, a.u., w. asrar, a.a. omar, e. sulaeman and j.s. mohamed, 2015b. power-off static stability analysis of a clean configuration of a hybrid buoyant aircraft. 8th ankara international aerospace conference, 10-12 september 2015 metu, ankara, turkey. harris, j.e., 1937. the mechanical significance of the position and movements of the paired fins in the teleostei. washington, dc: carnegie institution of washington. harris, j.e., 1938. the role of the fins in the equilibrium of the swimming fish. ii. the role of the pelvic fins. journal of experimental biology, 15(1): 32-47. harris, j.e., 1953. fin patterns and mode of life in fishes. in s. m. marshall and p. orr (eds). essays in marine biology. edinburgh, scotland: oliver & boyd. pp: 17-28. ilieva, g., j. páscoa, a. dumas and m. trancossi, 2014. maat – promising innovative design and green propulsive concept for future airship’s transport. aerosp. sci. technol, 35: 1–14. jahoda, j.r., 2006. jtrs/sincgars ultrabroad band airborne blade antenna for subsonic aircraft and helicopters. defense electron: 20–22. josephson, b., 1957. the quarter-wave dipole. wescon/57 conference record, 21(part. 1): 77 – 90. macnamara, t., 2010. introduction to antenna placement and installation. 1st edn., usa: john wiley & sons. maia, a. and c.a. wilga, 2013. function of dorsal fins in bamboo shark during steady swimming. zoology, 116(4): 224–231. nakamura, i., c.g. meyer and k. sato, 2015. unexpected positive buoyancy in deep sea sharks, hexanchus griseus, and a echinorhinus cookei. plos one, 10(6): e0127667. raymer, d.p., 2006. aircraft design: a conceptual approach and rds-student, software for aircraft design, sizing, and performance set (aiaa education). aiaa (american institute of aeronautics & ast. sievenpiper, d.f., 1999. high-impedance surfaces. phd thesis, university of california at los angeles. standen, e.m., 2008. pelvic fin locomotor function in fishes: three-dimensional kinematics in rainbow trout oncorhynchus mykiss. j. exp. biol, 211(18): 2931–2942. suzuki, i., k. sato, a. fahlman, y. naito, n. miyazaki and a.w. trites, 2014. drag, but not buoyancy, affects swim speed in captive steller sea lions. biol. open, 3(5): 379–386. webb, p.w., 1975. hydrodynamics and energetics of fish propulsion. bulletin of the fisheries research board of canada, 190(1): 1-158. animal review, 2016, 3(1):1-9 9 © 2016 conscientia beam. all rights reserved. webb, p.w., 1977. designs for stability and maneuverability in aquatic vertebrates: what can we learn. in: tenth international. symp. unmanned untethered submersible tech: proc. sp. ses. bio-eng res. related to autonomous underwater vehicles, durham, nh. pp: 85-108. webb, p.w., 1988. simple physical principles and vertebrate aquatic locomotion. american zoologist, 28(2): 709-725. webb, p.w., 2002. control of posture, depth, and swimming trajectories of fishes. integrative and comparative biology, 42(1): 94-101. webb, p.w. and r. keyes, 1982. swimming kinematics of sharks. fish. bull, 80(4): 803-812. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 34 © 2018 conscientia beam. all rights reserved. a pictorial guidebook on poultry diseases; diagnostic techniques and their effective treatment aamir nawab1 yasir nawab2 shuyan tang3 jiang wu4 wenchao liu5 guanghui li6 mei xiao7 lilong an8+ 1post-mortem lab, diseases diagnostic section, poultry research institute (pri), rawalpindi; faculty of veterinary medicine, pmas-arid agriculture university, murree road, rawalpindi, pakistan; department of livestock productions and management, agricultural college, guangdong ocean university, zhanjiang 524088, guangdong, china, haida road, mazhang district, zhanjiang 524088, guangdong, china 2faculty of veterinary medicine, pmas-arid agriculture university, murree road, rawalpindi, pakistan 3,4,5,6,7,8department of animal science, agricultural college, guangdong ocean university, zhanjiang 524088, guangdong, china (+ corresponding author) abstract article history received: 13 september 2018 revised: 19 october 2018 accepted: 21 november 2018 published: 12 december 2018 keywords poultry production poultry diseases economic losses diagnosis treatment the poultry industry has gained significance all over the world due to providing economical, healthier food than red meat and other protein sources. food and agriculture organization (fao) estimated 103.5 million tons of global chicken meat production annually in 2012, which contributed about 34.3% to global meat production. generally, poultry farming has performed a leading role in the livestock sector in some others regions of the world. but poultry farming system is affected by both environmental and disease stress. various viral, bacterial, parasitic and fungal diseases affect the production performance of birds by affecting respiratory system, reproductive system, immune system, gut system and central nervous system which, in turn, cause loss of appetite, reduction of body weight, drop in egg production, air sac infection, coughing, sneezing, difficulty in breathing, septicemia (blood stream infection), paralysis of neck, wings and legs, enteritis (intestinal infection), bloody diarrhea, immunosuppression and higher mortality which cause huge economic losses in poultry industry. therefore, there is need to control poultry diseases. our aim was to provide a pictorial guidebook on poultry disease; diagnostic techniques and their effective treatment which may help to diagnose the viral, bacterial, parasitic and fungal infection. this may provide an important guideline to identify and minimize diseases before their incidence. contribution/originality: our main objective was to provide a pictorial guidebook on poultry disease to avoid the production losses facing the global poultry industry. several reports have theoretically addressed on poultry diseases but there is lack of sufficient data related to pictorial guidebook on avian diseases. therefore, this study is one of very few studies which have documented on poultry diseases as a pictorial guideline; diagnostic techniques and their potential treatment. animal review 2018 vol. 5, no. 2, pp. 34-50 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2018.52.34.50 © 2018 conscientia beam. all rights reserved. https://orcid.org/0000-0003-3420-7547 https://www.doi.org/10.18488/journal.ar.2018.52.34.50 animal review, 2018, 5(2): 34-50 35 © 2018 conscientia beam. all rights reserved. 1. introduction poultry plays a key role in the livelihood of millions of poor rural households associated with poultry industry in many developing countries [1]. but as the global population is increasing day by day this will require 70-100% increase in food production by 2050 [2]. food and agriculture organization (fao) has estimated that this increased urbanization may demand an increase in consumption of chicken meat, eggs and animal protein which should grow at the highest rate [3]. poultry can efficiently converters feed into egg and meat within a short period of time [4]. poultry eggs are ranked second after cow milk in terms of nutritive value [5]. nutritionists and agriculturists have decided that by developing the poultry industry we can fulfill the world population requirement in the incoming days [6, 7]. on the other side, poultry birds are susceptible to several types of infectious and/or non-infectious diseases [8]. these diseases affect the fast growing broiler birds and laying chickens performances via decreasing feed intake, growth rate, weight gain, survival rate, egg production (impairment in nutrition digestion and absorption), higher mortality due to respiratory infection (plaques in trachea), enteritis (inflammation of intestine), bloody diarrhea, paralysis and prostration of the head and the neck and suppression of immune responses [5, 9, 10]. the above mention clinical sign cause huge production losses and enhance the production cost [11, 12]. therefore, there exists a need to provide a pictorial guidebook on poultry diseases; diagnostic techniques and their effective treatment to avoid the production losses facing the global poultry industry. several authors have discussed the theoretical knowledge on poultry diseases but there is lack of sufficient data on poultry diseases as a pictorial guideline; diagnostic techniques and their potential treatment. therefore, this manual may provide the helpful information of diagnostic techniques to diagnose the diseases at their initial phases which can reduce the disease risk and improve the immune status of birds by using disease specific vaccination. 2. material and methods 2.1. viral disease 2.1.1. avian influenza (ai) it is caused by infection with avian influenza type a viruses. clinical sign; fig-1. free egg yolk in the body (egg yolk break brown and mix in the abdomen) animal review, 2018, 5(2): 34-50 36 © 2018 conscientia beam. all rights reserved. fig-2. plaques in the trachea treatment: no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water. syp lysovit 120mg/400 l d w (liter drinking water) aminox (immunostimulent) or soluvit e plus layers; 150-250 gm/tonne of feed or 5 gm/200 birds through drinking water broilers; 5 gm/50 birds through drinking water tlydox; 1-2 g/4l d w especially in h9 case all the flock should be buried to avoid the spreading of disease. 2.2. infectious bronchitis (i b) ib is a coronavirus that causes disease in various others birds especially in chickens. clinical sign; 3 forms 1) reproductive, 2) respiratory, 3) renal form fig-1. reproductive form salpingitis spleen and liver enlarged animal review, 2018, 5(2): 34-50 37 © 2018 conscientia beam. all rights reserved. fig-2. salpingitis plaques in trachea fig-3. plaques in trachea (respiratory) inflamed kidney (renal form) treatment: no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water tylodox (tylosin and doxycycline) 1-2 g/4 l d w aminox layer; 150-250 gm/tonne of feed or 5 gm/200 birds through drinking water broilers; 5 gm/50 birds through drinking water tlydox; 1-2 g/4l d w 2.3. chicken infectious anemia (cia) cia is caused by the chicken anemia virus belong to the circoviridae family which is found worldwide. https://cn.bing.com/search?q=chicken+anaemia+virus&filters=sid%3a6b49564b-34e2-4734-6e14-0dc5e500ee75&form=entlnk animal review, 2018, 5(2): 34-50 38 © 2018 conscientia beam. all rights reserved. clinical sign; fig-1. haemorrhages on proventriculus haemorrhages on thigh muscle fig-2. haemorrhages on heart pale color bone marrow fig-3. hemorrhages on thigh hemorrhages between proventriculus and gizzards treatment: no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water vit adek animal review, 2018, 5(2): 34-50 39 © 2018 conscientia beam. all rights reserved. broilers; 5 gm/50 birds through drinking water syp folad (herbal product) 120mg/400 l d w 2.4. fowl or chicken pox chicken pox (sorehead) is caused by a virus of the family poxviridae and the genus avipoxvirus. this is a woldwide disease that can be transmitted by direct or indirect contact, as well as through biting insects clinical sign; fig-1. diphtheritic form (plaques in trachea) fig-2. dry form: wart –like nodules on the skin (combs face and wattles) treatment: no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water. oxytetracycline 300mg/gallon d w or teramycin 5g iodine/ gallon d w (drinking water) 2.5. newcastle disease (nd) ndv is caused by avian paramyxovirus serotype 1 (pmv-1). animal review, 2018, 5(2): 34-50 40 © 2018 conscientia beam. all rights reserved. clinical sign; fig-1. haemorrhages on proventriculus trccheitis fig-2. caecal tonsilitis petechial haemorrhages and ulcer on intestine treatment : no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water. electrovit c plus broilers: 5 gm/50 birds through drinking water syp brofin (ibuprofin) 120 mg/400 litter water enrofloxacin 10g/100 ml dw 2.6. infectious bursal disease (ibd or gumboro) ibd is caused by a birnavirus (infectious bursal disease virus; ibdv) that is most readily isolated from the bursa of fabricius but may be isolated from other organs. it is shed in the feces and transferred from house to house by fomites. it is very stable and difficult to eradicate from premises. animal review, 2018, 5(2): 34-50 41 © 2018 conscientia beam. all rights reserved. clinical sign; fig-1. hemorrhages on thigh region bursa inflamed and reddish fig-2. cheasy material in bursa haemorrhages on thigh region treatment: no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water. electrovit c plus or soluvit e plus syp brofin (ibuprofin) 120mg/400 l d w tylodox (tylosin + doxycycline) 1-2 g/4l d w 2.7. lymphoid leucosis lymphoid leukosis is caused by certain group of avian retroviruses. it can induce lymphoid leukosis in chickens are commonly called avian leukosis viruses. clinical sign; fig-1. white nodules on liver surface animal review, 2018, 5(2): 34-50 42 © 2018 conscientia beam. all rights reserved. fig-2. white nodules on liver surface necrotic lesion on kidney treatment: no treatment due to viral disease, but to avoid the secondary infection, we recommend the supportive therapy in drinking water. t.s.o (trimethoprim+sulphadiazine) liquid 1-2 g/ 4l d w syrup hepacon-b12 (vitamin-12) 1-2g/4l d w oral rehydration solution (ors) 1-2g/4l d w dextrolyte or electrovit c plus (260,00mg sodium chloride, 150,00mg potassium chloride, 290,00mg trisodium citrate, 1350,00mg dextrose (glucose) anhydrous) 2.8. inclusion body hepatitis (ibh) it is a disease of chickens characterized by acute mortality, often with severe anemia, caused by an adenovirus. clinical sign; fig-1. liver pale colored fig-2. hydropericardium kidneys are enlarged with hemorrhages animal review, 2018, 5(2): 34-50 43 © 2018 conscientia beam. all rights reserved. treatment: to avoid the secondary infection, we recommend the supportive therapy in drinking water. syrup hepacon-b12 (vitamin-12) 1-2g/4l d w dextrolyte or electrovit c plus amoxi (amoxycycline) 50% 1g/1l d w 3. bacterial diseases 3.1. salmonellosis it is caused by salmonells (salmonella enteritidis and s.typhimurium ). clinical sign; fig-1. egg yolk hyperemic and abnormal ovum inflammation of the intestine fig-2. spleen enlarged enlarged liver is mottled with milliary necroses symptoms: lethargy, diarrhea, conjunctivitis, liver, spleen, and kidney enlarged. treatment; to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. gentamycin: dosage: .01 mg to one gram of body weight intramuscularly once daily. or 25 mg in 120 ml of drinking water. trimethoprim/sulfamethoxazole suspension: dosage .002 ml to one gram of body weight orally twice daily. sodium sulfachiorpridazine powder: dosage ¼ tea spoon in 120 ml drinking water. animal review, 2018, 5(2): 34-50 44 © 2018 conscientia beam. all rights reserved. 3.2. chronic respiratory disease (crd) this infection is caused by mycoplasma gallisepticum is associated with slow onset, chronic respiratory disease in chickens and others birds. clinical sign; fig-1. cloudy air sac cloudy air sac fig-2. cloudy air sac tracheitis treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. t.s.o (trimethoprim+sulphadiazine) liquid 1-2 g/ 4l d w oral rehydration solution (ors) 1-2g/4l d w dextrolyte 1g/2l d w 3.3. colibacillosis (e-coli) colibacillosis is an infectious disease caused by the bacterium escherichia coli (also known simply as e. coli), and is seen in poultry flocks worldwide. e. coli can cause an infection under the skin, known as cellulitis, and is commonly associated with respiratory disease in birds, which in severe cases leads to septicemia and death. animal review, 2018, 5(2): 34-50 45 © 2018 conscientia beam. all rights reserved. clinical sign; fig-1. serous coats (peritoneum) serofibrinous polyserositis on liver fig-2. serous coats on pericardium tracheitis treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. hepasil or soluvit e plus layer; 5 gm/200 birds through drinking water broilers; 5 gm/50 birds through drinking water doxycol (doxycycline) 100 g powder per 25-50 litres drinking water. 3.4. spirochetosis avian intestinal spirochetosis (ais) is an enteric disease that affects all bird species. ais is a potentially zoonotic disease that is caused by infection with spirochete bacteria of the genus brachyspira. the bacteria colonize in the chicken's intestines (specifically in the cecum and rectum) and disturb the digestion. animal review, 2018, 5(2): 34-50 46 © 2018 conscientia beam. all rights reserved. clinical sign; fig-1. inflamed liver and spleen inflamed caeca treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. oxytetracycline 1g/4l d w t.s.o (trimethoprim+sulphadiazine) liquid 1-2 g/ 4l d w 4. parasitic and parasitic diseases 4.1. coccidiosis coccidiosis is caused by protozoa of the phylum apicomplexa, family eimeriidae. in poultry, most species belong to the genus eimeria and infect various sites in the intestine clinical sign; fig-1. dark and blood mixed feces fig-2. dark and blood mixed feces animal review, 2018, 5(2): 34-50 47 © 2018 conscientia beam. all rights reserved. treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. doxycel 1g/2l d w dextrolyte 1g/1l d w t.s.o (trimethoprim+sulphadiazine) liquid 1-2 g/ 4l d w 4.2. nematode (round worm) roundworms (nematodes) are a type of parasite that lives freely in the chicken's intestine, feeding off of the partially digested intestinal contents. ascaridia galli is an important species of roundworms found in chickens. clinical sign; fig-1. round worm in intestine treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. albendazole (dewormer) or systamix in drinking water 5. fungal diseases 5.1. aspergillosis aspergillosis is caused by aspergillus, a common mold (a type of fungus). it is an infectious fungal disease in poultry which affect the birds respiratory system. the disease is contracted by inhalation when there is a high spore count in the air. clinical sign; fig-1. lesions (yellow or gray nodules and/or plaques in the lungs and on air sac. animal review, 2018, 5(2): 34-50 48 © 2018 conscientia beam. all rights reserved. symptoms: respiratory distress, gasping, breathing. prevention: minimize stress and overcrowding. provide proper ventilation treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. nilstate (nystatin) powder 1ml/2l d w (drinking water) soluvit e plus layer; 5 gm/200 birds through drinking water broilers; 5 gm/50 birds through drinking water tlydox; 1-2 g/4l d w 6. environmental stress problems 6.1. ascites ascites is a disease of broiler chickens occurring worldwide but especially at high altitude. the disease has a complex etiology and is predisposed by reduced ventilation, high altitude, and respiratory disease. clinical sign; fig-1. fluid in the abdomin treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. bio-bantox plus or oligotox or a t b ( authentic toxin binder) 1 kg/ton of feed. improve ventilation 6.2. heat stress and/or toxicity there is no specific etiology. but samples should be collected for potential analysis in cases of suspected toxicities include dead or recently euthanized birds that showed clinical signs, 2 lb (1 kg) of the feed available when the birds were showing clinical signs, and 500 ml of drinking water. for the safety of workers as well as poultry, the grower should have access to material safety data sheets for each chemical used on the premises. carcasses should be refrigerated as soon as possible for examination by the veterinarian or laboratory diagnostician. animal review, 2018, 5(2): 34-50 49 © 2018 conscientia beam. all rights reserved. clinical sign; fig-1. kidney enlarged and emaciated and pale color muscle. treatment: to avoid the secondary infection, we recommend the specific and supportive therapy in drinking water. glucose+ tab disperin+ tylodox 1-2g/4l d w 7. conclusion the poultry industry provides healthier food than red meat and other protein sources. food and agriculture organization (fao) has estimated that chicken meat contribute about 34.3% to global meat production. but several common and important diseases are threat to poultry industry which can affect the respiratory, reproductive, gut and immune systems of birds and cause huge production losses. therefore, this picture guidebook on poultry diseases has been assembled for veterinary medical students, extension workers and farmers to diagnose the diseases correctly and to minimize them by using specific disease vaccination. this manual may provide important clinical information to diagnose the diseases depending on their specific sign that can reduce the economic losses in the poultry industry. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] f. k. r. stino and f. s. nassar, poultry production in the middle east and african states: situation, future and strategies. giza 21613, egypt: department of animal production, faculty of agriculture, cairo university, 2012. [2] a. nawab, i. fahar, l. guanghui, k. barbara, w. jiang, and l. wenchao, "heat stress in poultry production: mitigation strategies to overcome the future challenges facing the global poultry industry," journal of thermal biology vol. 78, pp. 131–39, 2018.available at: https://doi.org/10.1016/j.jtherbio.2018.08.010. [3] fao, fao statistical pocketbook world food and agriculture. rome: food and agriculture organization of the united nations, 2015. [4] i. leinonen, a. williams, and i. kyriazakis, "the effects of welfare-enhancing system changes on the environmental impacts of broiler and egg production," poultry science, vol. 93, pp. 256-266, 2014.available at: https://doi.org/10.3382/ps.2013-03252. [5] g. b. adesiji and s. t. baba, "effects of climate change on poultry production in ondo state, nigeria," russian journal of agricultural and socio-economic sciences, vol. 2, pp. 55–60, 2010. animal review, 2018, 5(2): 34-50 50 © 2018 conscientia beam. all rights reserved. [6] fao, "livestock country reviews, poultry sector mozambique. fao animal production and health livestock country reviews. no. 5. rome," 2013. [7] h. k. sebho, "exotic chicken status, production performance and constraints in ethiopia: a review," asian journal of poultry science, vol. 10, pp. 30-39, 2016.available at: https://doi.org/10.3923/ajpsaj.2016.30.39. [8] j. roberts, r. souillard, and j. bertin, "avian diseases which affect egg production and quality," ed: in book of improving the safety and quality of eggs and egg products: egg chemistry, production and consumption, woodhead publishing series in food science, technology and nutrition, 2011, pp. 376–393. [9] h. guis, c. caminade, c. calvete, a. p. morse, a. tran, and m. baylis, "modelling the effects of past and future climate on the risk of bluetongue emergence in europe," journal of the royal society interface, vol. 9, pp. 339-350, 2012.available at: https://doi.org/10.1098/rsif.2011.0255. [10] é. gocsik, h. kortes, a. o. lansink, and h. saatkamp, "effects of different broiler production systems on health care costs in the netherlands," poultry science, vol. 93, pp. 1301-1317, 2014.available at: https://doi.org/10.3382/ps.201303614. [11] t. e. abbas, "poultry welfare in developed and developing countries," animal and veterinarysciences, vol. 2, pp. 1–4, 2014.available at: 10.11648/j.avs.20140201.11. [12] m. pattison, p. f. mcmullin, j. m. bradbury, and d. j. alexander, poultry diseases, 6th ed. philadelphia: pennsylvania, usa, 2008. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 45 © 2017 conscientia beam. all rights reserved. forecasting goat milk production in turkey using artificial neural networks and box-jenkins models ferhan kaygisiz1+ funda hatice sezgi̇n2 1istanbul university, faculty of veterinary medicine, department of animal breeding and husbandry, avcılar, istanbul, turkey 2istanbul university, faculty of engineering, department of industrial engineering, avcılar, istanbul, turkey (+ corresponding author) abstract article history received: 9 october 2017 revised: 20 december 2017 accepted: 26 december 2017 published: 29 december 2017 keywords artificial neural networks model box jenkins model forecasting goat milk. time series milk production the demand for goat milk has gradually increased in turkey in recent years and dairy goat breeding began to be seen as an alternative investment area. the aim of the study is to create the data that will contribute to policy formulation in the stockbreeding industry by making a 10-year forecast of output pertaining to the goat milk production in turkey. in the study, the annual data of the goat milk production in turkey during the time period 1961 and 2016 obtained from turkish statistical institute and food and agriculture organization was utilized. box-jenkins estimation models and artificial neural networks model were used to forecast the production of goat milk. it was identified that artificial neural networks model gave the best result and prospective estimations were made through this model. as a result of the study, the projected value of milk production for 2026 was found to be 495,536.1 tons. following the forecasts, it was calculated that the average rate of increase in the goat milk production will be 0.12%. contribution/originality: the study was conducted to estimate the amount of goat milk production in turkey until 2026. box-jenkins and artificial neural networks models were used as prediction models. the results of this study contribute in the literature about the goat breeding production policies. 1. introduction goat breeding is a traditional animal production branch usually practiced in underdeveloped and developing countries. aforementioned production branch constitutes a significant source of living and nutrition for the families with low income living in rural and forested lands [1]. goat breeding has made a significant progress in the world since the late 20th century in consequence of the development in agriculture, consumer demands related to social and economic indicators, the need for quality and healthy food products [2, 3]. goat breeding is maintained as either in an agricultural enterprise or as village herds, transhumance or migratory herds. however, intensive businesses making cheese or providing milk for cheese making dairies have also been operating in western anatolia in recent years [4]. the amount of goat milk production which was 192,210 tons in turkey in 2009 increased to 479,401 tons in 2016 by rising 2,5 times and the share of goat milk in the total milk production in turkey was 2.59% [5]. in turkey, goat milk and products have economically gained importance by means of their taste, aroma, and quality, and goat cheese has begun to be demanded more and more with the urban growth and the development of tourism [1]. goat plays a significant part in the domestic and foreign trades as well as contributing to the animal review 2017 vol. 4, no. 3, pp. 45-52 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2017.43.45.52 © 2017 conscientia beam. all rights reserved. https://orcid.org/0000-0003-4939-7849 https://orcid.org/orcid-search/quick-search?searchquery=funda%20hatice%20sezgi̇n http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2017.43.45.52&domain=pdf&date_stamp=2017-01-14 animal review, 2017, 4(3): 45-52 46 © 2017 conscientia beam. all rights reserved. nurturing of people, textile industry, and employment. especially, the fact that eu (european union) has not reached sufficiency in sheep-goat products creates a potential market for turkey [1]. therefore, it is important to promote goat breeding by implementing economic policies. the significance of consistent estimations for creating realistic prospective policies regarding livestock sector is a fact. while forming consistent estimations, a sound data system and time series analysis methods modeling this data are necessary [6]. researchers used box-jenkins [7-10] models successfully in analyses made with time series in agricultural output. it is observed that artificial intelligence methods have an increasing usage rate in recent years. around the world and in turkey, there is research that artificial neural networks method was used in the studies of estimating milk yield in livestock [11-13]. however, a limited number of studies [14] using artificial neural networks method in the estimation analyses of the amount of agricultural production were found in turkey. this study was conducted to guide the policies which will be implemented in the field of livestock production by estimating the amount of goat milk production for the period of 2016-2026. 2. material and methods 2.1. material the material of the study consists of the goat milk production data between 1961 and 2016. the statistical data used in the study were obtained from tsi (turkish statistical institute) and fao (food and agriculture organization) [5, 15]. 2.2. statistical analysis in this study, future forecasts for goat milk production data were made and their compatibility was assessed by arma (autoregressive moving average) which is one of the box-jenkins models frequently used in time series analyses and applied to level data, and arima (autoregressive integrated moving average) methods applied to differentiated data along with ann (artificial neural networks models). box-jenkins which is an analysis and estimation method in time series is based on discrete, linear stochastic processes. ar (autoregressive), ma (moving average), arma and arima are box-jenkins estimation models. while ar (p), ma (q) and their combination arma (p, q) models are applied to stationary processes, arima (p, d, q) models are applied to non-stationary processes [16]. arma (p, q) models are the most general stationary stochastic process models and are a linear function of past observations and past error terms [17]. arma (p, q) models are usually as demonstrated below: (1) in the equation above; yt-p : is the past observation values, ф1, ф2,…, фp : is the coefficient for past observation values, δ : is the constant value, at, at-1, at-p : is the error term, θ1, θ2,…,θq : is the coefficients regarding error terms [16]. in situations where time series is stationary, namely in situations where the average, variance, and covariance of the process is not changing depending on time and therefore series does not fluctuate, arma (p, q) or ar (p) or ma (q) models which are particular states of arma (p, q) can be used. however, the fluctuation of the average and variance of time series depending on time is frequently observed in reality. this situation is referred to as the nonstationary situation. this kind of time series can only be appropriate for the use of arma (p, q) models when they are made stationary. animal review, 2017, 4(3): 45-52 47 © 2017 conscientia beam. all rights reserved. the process of stabilizing can be done with differencing processes and differencing the time series which has a linear trend at first degree makes the time series stationary. however, the time series which demonstrate curvilinear trend can be stationary with the process of second differencing [16-18]. the models applied to the new series resulting from the process of stabilizing the non-stationary series by differencing is called “non-stationary linear stochastic models” or “integrated models”. in this situation, the model is denoted as arima (p, d, q). where “d” is the stabilizing parameter of the series [19]. namely, it states in which degree the series was differenced. ann was developed as a result of the studies of modeling the biological neural system mathematically. ann (artificial neural networks) produced by being inspired by the functions of the human brain is a method which provides learning and generalization by testing. the aforesaid method is used to make estimations as a result of its constant output production [20]. anns produce quite successful results in complicated estimations for the fact that it is a technique which has a high power of calculation and the ability to generalize. ann consists of stratified, feed-forward and interrelated artificial neural networks or nodes. hence the network is feed-forward, unidirectional flow is provided and loop or return is not allowed. ann model formed by the connection of numerous cells in various forms has a parallel distributed structure and the information which the network obtains is scattered on all the connections in the network. therefore, the fact that some of the connections and cells of a trained ann model become neutralized does not affect the accuracy of the information that the network produces significantly [21]. 3. results and discussion various models were tested to determine the most appropriate model for a ten-year prospective estimation using goat milk production data between 1961 and 2016 and an estimation method was developed by comparing them. first, correlogram test was applied to the data and it was observed that the result showed a slow decline indicating the unit root. adf (augmented dickey-fuller) test validated that the level data includes unit root, that it's non-stationary. while estimating the goat milk data which was observed to become stationary by first differencing, difference data was used firstly. notation for arima (p, d, q) model is as follows: p: standard autoregressive level of the model; d: the degree of the difference that will make the series stationary; q: standard moving average degree. in this study, d=1 was used because it was differentiated from the first degree in order to make the series stationary. while choosing the most appropriate model among the calculated potential estimation models, the model having a lower sc (schwarz criterion) value (sc = n log (see) + k log (n)), a lower see (sum squared of regression) value and a higher r2 (rsquared) value was determined to be more suitable and meaningful compared to other models. table-1. estimation criteria of arima models arima model sc r2 see (1, 1, 0) 22.939 0.178 21933.62 (2, 1, 0) 23.054 0.090 23214.14 (1, 1, 1) 23.011 0.179 22131.10 (1, 1, 2) 22.991 0.196 21911.41 (0, 1, 1) 23.258 0.164 25749.31 (0, 1, 2) 23.331 0.101 26707.91 (2, 1, 1) 22.913 0.205 21908.42 (2, 1, 2) 23.124 0.094 23395.55 source: table was constitute from analyzed data of current study with reference to table 1, considering sc, r2, see values; the model of (2, 1, 1) which was differentiated from first degree and with ar (2) and ma (1) added was decided to be the most appropriate arima model. estimation was tried to be made with arima models on goat milk production data which was made stationary by differentiating from the first degree. estimation results on the data which was not differentiated (level) were added animal review, 2017, 4(3): 45-52 48 © 2017 conscientia beam. all rights reserved. to the study to make a comparison. arma models and ar and ma models which are specific versions of arma models were used on level data and their tests were carried out. table-2. examination criteria of arma models arma model sc r2 see (1, 0) 23.340 0.935 26824.74 (2, 0) 24.227 0.840 41774.48 (1, 1) 23.221 0.945 24600.48 (1, 2) 23.294 0.941 25516.06 (0, 1) 24.893 0.722 58352.38 (0, 2) 25.122 0.651 65419.26 (2, 1) 23.145 0.948 23663.21 (2, 2) 24.088 0.868 37916.80 source: table was constitute from analyzed data of current study the subjects to be considered while choosing the most appropriate model among the potential estimation models calculated for arma models are similar to the ones with arima models. arma (2, 1) model which has the lowest sc and see values and the highest r2 value among the given models was decided to be the most appropriate model (table 2). the ann model set up in this study serve as a non-linear regression model. minimum-maximum (min-max) normalization which is frequently used in literature for data normalization was made and input vector was the years between 1961 and 2016 and the output vector was annual goat milk production. lm (levenberg marquardt) model was chosen as the training method for the ann model which was set as feed-forward, back-propagated and 70% was used in training, 15% used in validation and 15% in the testing stage. the interlayer number was taken as 10 and delay number was taken 2. these values were kept stabilized for the performance of the model was at the desired level. goat milk estimation performance of the network trained with lm method can be seen in figure 1. performance graph, input, and target data consist of three lines as they are divided into three sets. as seen in the figure, it declined to nearly zero error in 12th iteration. mse (mean squared error) represents the proportional value of the difference between the values in the artificial neural network and estimated values. in this study, the training stops when the mse value drops below 0.01. this value represents that the difference between the actual values and the estimated values will be 1% maximum. 0.05 and 0.01 values are frequently used in the literature [22]. for the reason that the error dropped below 0.01 in the training set, it can be said that the results are at an acceptable level. the training stopped when the verification error started to increase, at 100th iteration. a remarkable sign of memorization is not observed until the 12th iteration where the best verification performance is present because the error rate in the verification and test set does not increase as of this iteration. as verification error and test set error show similar characteristics and a significant memorization has not occurred, the performance of the network is at an acceptable level. in addition to this, mse result of the goat milk production of the model is 0.0075064. as a result, error rate acquired and predetermined and acceptable performance target has been achieved. r correlation coefficient indicates how good the variations in outputs are explained by targets. the fact that the r-value approaches 1 signifies that the relationship strengthens and that it approaches zero signifies that the relation weakens [22]. figure 2 shows the correlation between outputs and targets. it represents a good compatibility that r-value is quite close to 1. training data shows a quite good harmony. while r correlation coefficient is 0.99 for training data, r correlation coefficient values which are above 0.97 are acquired for test and verification data. scatter graph is important in that the particular data points show a weak harmony. when training, verification and test graphs are examined; it can be observed that there is no significant inconsistency between the actual value and network inputs. 20-years of the output of ann, arima and arma models used for estimation and the actual output of last 10 years are as given in table 3. animal review, 2017, 4(3): 45-52 49 © 2017 conscientia beam. all rights reserved. table-3. values of 2007-2016 and estimation results for 2007-2026 date actual ysa arima arma 2007 237487 220867.1 223829.0 348809.0 2008 209570 216894.4 202292.4 348265.9 2009 192210 235414.8 188506.3 347764.5 2010 272811 282890.3 270884.3 347301.6 2011 320588 335389.6 320005.4 346874.2 2012 369429 377973.5 371207.2 346479.7 2013 415743 420999.0 419396.1 346115.4 2014 463270 460443.2 468105.2 345779.2 2015 481174 484143.5 487482.0 345468.7 2016 479401 494410.3 486374.4 345182.1 2017 443125.0 485491.5 344917.5 2018 446462.5 485484.6 344673.2 2019 472664.7 485493.9 344447.6 2020 466844.8 485481.3 344239.4 2021 455216.3 485498.3 344047.2 2022 474135.0 485475.5 343869.7 2023 485646.4 485506.1 343705.9 2024 495665.7 485464.9 343554.6 2025 490479.1 485520.3 343415.0 2026 495536.1 485445.9 343286.0 source: table was constitute from analyzed data of current study figure-1. performance graph of the network source: figure was constitute from analyzed data of current study mse and mape (mean absolute percentage error) methods were applied to choose the estimation method which gives the best result among the models and the results were given in table 4. table-4. error results for the estimation models mse mape arma 6028086102 0,21251266 arima 274473715 0,028086212 ysa 209308290 0,028060791 source: table was constitute from analyzed data of current study while mape values of which estimation values below 10% were regarded to be at high accuracy degree, models between 10% and 20% were classified as accurate estimation model [23, 24]. as a result of the error tests demonstrated in table 4, mape value of the arma model was found as 0.212, mape value of the arima model animal review, 2017, 4(3): 45-52 50 © 2017 conscientia beam. all rights reserved. and ann model which were quite close to each other was found as 0.028. when mse values, another comparison measure, were examined, the model with the least error rate was found to be the model established by ann. it is indicated that it is necessary to work with over 70 data for box-jenkins methods which include arima and arma models subject to this study [19]. ann is a method used frequently in time series estimations and it produces quite successful results. it allows working with less data by nature. however, despite the number of the data is not sufficient in this study, it is observed that arima model resulted well with a close degree to ann. estimation model made with ann was the model which gave the most accurate result among examined time series estimation methods. when regression outputs of the model were examined, it was observed that it showed good compatibility and mape value was found at an accurate estimation level. figure-2. regression output of the network source: figure was constitute from analyzed data of current study in this study, various estimation models with box-jenkins and ann were tested by using the data of the goat milk produced between the years 1961-2016 and the models built were compared to each other. according to ann results, forecasted value of the milk production belonging to 2026 is 495,536.1 tons. according to the forecast values in table 4, it was forecasted that a fair amount of milk decrease will be observed in goat milk amount starting from 2017 when compared to the production amount of 2016; however, it was forecasted that the production will increase as of 2023. following the forecasts, it was calculated that annual average rate of increase in the goat milk production will be 0.12%. animal review, 2017, 4(3): 45-52 51 © 2017 conscientia beam. all rights reserved. 4. conclusion the aim of the study is to obtain the data that will contribute to forming a policy in the field of animal production by making a 10-year forecast of output belonging to the goat milk production in turkey. as a result of the estimation, it was concluded that ann models are more successful and goat milk production will follow an upward trend in 10 years. in recent years both around the world and in turkey, the demand for goat products have increased gradually with the rising significance of the goat milk with regards to nutrition. it is necessary to take a number of measures in terms of increasing the production of goat products and its sustainability in line with this development. direct and indirect government interventions with technical measures will play an important role in production policies in improving goat breeding. subventions and regulations regarding the price formation of meat, milk, and mohair are compulsory within production policies. on the other hand, legal regulations which will promote breeder to organize under cooperatives must be implemented and measures protecting goat health must be taken for turkey to compete with other countries in exportation [4]. when the measures are taken regarding the technical and economic problems that producers encounter, goat breeding will contribute greatly to the national economy. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: both authors contributed equally to the conception and design of the study. references [1] m. kaymakçı and s. engindeniz, "goat breeding in turkey: problems and solutions." retrieved: http://www.akademik.adu.edu.tr/myo/cine/webfolders/file/yeni%20klasor/kav%c5%9fit%20k%c3%b6y%c3%b c%20ve%20y%c3%b6resi%20ke%c3%a7icilik%20projesi%20geli%c5%9fmeler.pdf. [accested 01.06.2017], 2017. [2] a. günlü and s. alașahan, "evaluations on the future of goat breeding in turkey," journal turkish veterinary medicine association, vol. 81, pp. 15-20, 2010. view at google scholar [3] k. ş. uzun and ş. ö. altınçekiç, "situation of products obtained from goats in turkey and in the world." retrieved: http://www.akademik.adu.edu.tr/myo/cine/webfolders/file/yeni%20klasor/kav%c5%9fit%20k%c3%b6y%c3%b c%20ve%20y%c3%b6resi%20ke%c3%a7icilik%20projesi%20geli%c5%9fmeler.pdf. [accested 01.06.2017], 2017. [4] s. engindeniz and k. uçar, "alternative investment opportunities for rural area: dairy goat farming." retrieved: http://www.tarekoder.org/wp-content/uploads/2014/12/samsuncilt_i.pdf. [accested 03.06.2017], 2017. [5] tsi turkish statistical institute, retrieved from http://tuikapp.tuik.gov.tr/hayvancilikapp/hayvancilik.zul. [accested 14.06.2017], 2017. [6] n. cenan, "the research of the amount of the livestock (cow, buffalo, sheep, goat) and the meat production from these animals according to the methods of time series analysis," ph.d. thesis ankara university, ankara, turkey, 2011. [7] f. yavuz, a. bilgiç, m. terin, and i. o. güler, "policy implications of trends in turkey's meat sector with respect to 2023 vision," meat science, vol. 95, pp. 798-804, 2013. view at google scholar | view at publisher [8] ş. çelik, "the modeling of annual red meat production of turkey by using box-jenkins method and projection of production," journal of animal production, vol. 53, pp. 32-39, 2012. [9] n. cenan and i̇. s. gürcan, "forward projection of the number of farm animals of turkey: arima modeling," veteriner hekimler derneği dergisi, vol. 82, pp. 35-42, 2011. view at google scholar [10] n. iqbal, k. bakhsh, a. maqbool, and a. s. ahmad, "use of the arima model for forecasting wheat area and production in pakistan," journal of agricultural and social sciences, vol. 1, pp. 120-122, 2005. view at google scholar [11] ç. takma, h. atıl, and v. aksakal, "comparison of multiple linear regression and artificial neural network models goodness of fit to lactation milk yields," journal of the faculty of veterinary medicine, vol. 18, pp. 941-944, 2012. view at google scholar | view at publisher http://www.akademik.adu.edu.tr/myo/cine/webfolders/file/yeni%20klasor/kav%c5%9fit%20k%c3%b6y%c3%bc%20ve%20y%c3%b6resi%20ke%c3%a7icilik%20projesi%20geli%c5%9fmeler.pdf http://www.akademik.adu.edu.tr/myo/cine/webfolders/file/yeni%20klasor/kav%c5%9fit%20k%c3%b6y%c3%bc%20ve%20y%c3%b6resi%20ke%c3%a7icilik%20projesi%20geli%c5%9fmeler.pdf https://scholar.google.com/scholar?hl=en&q=evaluations%20on%20the%20future%20of%20goat%20breeding%20in%20turkey http://www.akademik.adu.edu.tr/myo/cine/webfolders/file/yeni%20klasor/kav%c5%9fit%20k%c3%b6y%c3%bc%20ve%20y%c3%b6resi%20ke%c3%a7icilik%20projesi%20geli%c5%9fmeler.pdf http://www.akademik.adu.edu.tr/myo/cine/webfolders/file/yeni%20klasor/kav%c5%9fit%20k%c3%b6y%c3%bc%20ve%20y%c3%b6resi%20ke%c3%a7icilik%20projesi%20geli%c5%9fmeler.pdf http://www.tarekoder.org/wp-content/uploads/2014/12/samsuncilt_i.pdf http://tuikapp.tuik.gov.tr/hayvancilikapp/hayvancilik.zul https://scholar.google.com/scholar?hl=en&q=policy%20implications%20of%20trends%20in%20turkey's%20meat%20sector%20with%20respect%20to%202023%20vision http://dx.doi.org/10.1016/j.meatsci.2013.03.024 https://scholar.google.com/scholar?hl=en&q=forward%20projection%20of%20the%20number%20of%20farm%20animals%20of%20turkey:%20arima%20modeling https://scholar.google.com/scholar?hl=en&q=use%20of%20the%20arima%20model%20for%20forecasting%20wheat%20area%20and%20production%20in%20pakistan https://scholar.google.com/scholar?hl=en&q= https://scholar.google.com/scholar?hl=en&q= http://dx.doi.org/10.1016/j.sbspro.2013.06.643 animal review, 2017, 4(3): 45-52 52 © 2017 conscientia beam. all rights reserved. [12] p. hosseinia, m. edrisi, m. a. edriss, and m. a. nilforooshan, "prediction of second parity milk yield and fat percentage of dairy cows based on first parity in formation using neural networks system," journal of applied sciences, vol. 7, pp. 3274-3279, 2007. view at google scholar | view at publisher [13] a. k. sharma, r. k. sharma, and h. s. kasana, "prediction of first lactation 305-day milk yield in karan fries dairy cattle using ann modeling," applied soft computing, vol. 7, pp. 1112-1120, 2007. view at google scholar | view at publisher [14] m. karahan, "statistical demand forecasting methods: an application of product demand forecast with artificial neural networks method," ph.d. thesis, selçuk university, konya, turkey, 2011. [15] fao food and agriculture organization of the united nations, retrieved from http://www.fao.org/faostat/en/#data/ql. [accested 14.06.2017], 2017. [16] c. hamzaçebi and f. kutay, "electric consumption forecasting of turkey using artificial neural networks up to year, 2010," journal of the faculty of engineering and architecture of gazi university, vol. 19, pp. 227-233, 2004. view at google scholar [17] h. kayım, statistical forecasting methods. ankara: hacettepe university faculty of economics and administrative sciences publications, 1985. [18] m. hibon and s. makrıdakis, "arma models and the box–jenkins methodology," journal of forecasting, vol. 16, pp. 147163, 1997. view at google scholar | view at publisher [19] g. e. p. box and g. m. jenkins, time series of analysis, forecasting and control. california: holden day, 1976. [20] d. t. larose, discovering knowledge in data: an ıntroductionto data mining. new jersey: john wiley and sons inc, 2005. [21] h. ergezer, m. dikmen, and e. özdemir, "artificial neural networks and recognition systems," pivolka, vol. 2, pp. 1417, 2003. view at google scholar [22] s. kalaycı, spss applied multivariate statistical techniques. ankara: asil publications, 2010. [23] s. f. wıtt and c. wıtt, modeling and forecasting demand in tourism. london: academic press, 1992. [24] c. d. lewıs, industrial and business forecasting methods. london: butterworhts publishing, 1982. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://scholar.google.com/scholar?hl=en&q=prediction%20of%20second%20parity%20milk%20yield%20and%20fat%20percentage%20of%20dairy%20cows%20based%20on%20first%20parity%20in%20formation%20using%20neural%20networks%20system http://dx.doi.org/10.3923/jas.2007.3274.3279 https://scholar.google.com/scholar?hl=en&q=prediction%20of%20first%20lactation%20305-day%20milk%20yield%20in%20karan%20fries%20dairy%20cattle%20using%20ann%20modeling http://dx.doi.org/10.1016/j.asoc.2006.07.002 http://www.fao.org/faostat/en/#data/ql https://scholar.google.com/scholar?hl=en&q=electric%20consumption%20forecasting%20of%20turkey%20using%20artificial%20neural%20networks%20up%20to%20year,%202010 https://scholar.google.com/scholar?hl=en&q=electric%20consumption%20forecasting%20of%20turkey%20using%20artificial%20neural%20networks%20up%20to%20year,%202010 https://scholar.google.com/scholar?hl=en&q=arma%20models%20and%20the%20box–jenkins%20methodology http://dx.doi.org/10.1002/(sici)1099-131x(199705)16:3%3c147::aid-for652%3e3.0.co;2-x https://scholar.google.com/scholar?hl=en&q=artificial%20neural%20networks%20and%20recognition%20systems 1 © 2017 conscientia beam. all rights reserved. mechatronics and precision livestock farming in mexican animal production jaime cuauhtemoc negrete1 1independent researcher on issues of agricultural mechatronics .graduate in agrarian autonomous antonio narro university. postgraduate in faculty of agronomy eliseu maciel of ufpel, brazil. abstract article history received: 16 february 2017 revised: 4 april 2017 accepted: 10 may 2017 published: 7 june 2017 keywords mechatronics precision livestock farming mexico animal production breeding-mechatronization breedtronics. for méxico, the base projection shows that the demand for this meat grows at rates faster than the production, reason why an increase in the imports in the long term is expected. the base projection shows that purchases abroad will reach a level close to 390 thousand tons in 2018.in mexico, the deficit in the milk market is complemented by imports. for 2009, an import of 1.0 billion liters is estimated and in 2018 these are hoped to fall to 946 million liters [1]. according to these projections makes it necessary to analyze the pressure for increased food production of animal origin, leading to review technologies applied in the rest of the world to carry out such an increase, a technology is the application of mechatronics to animal production, which is also known as livestock farming precision. being the objective of the present article the revision of the state of the art in the world and in mexico of this technology. in mexico it is possible to increase the productivity of livestock farming, if the decision to guide and formed human capital and training are taken at all three levels ; bachelor , masters and ph d , to the research and application of livestock mechatronics, results in developed countries so it evidence mexico cannot be left behind in this regard , besides that is the only way to increase food production, applying mechatronics in animal production .so previously treated the perspectives for the precision animal production in the country are very big. contribution/ originality: the precision livestock farming is important in the social and economic environments of mexican animal production and has been kept in oblivion for many years . being that at present, as verified by the mentioned references is the only way to alleviate the needs of animal food in the country. this paper provides the first overview of the precision livestock farming and the application of mechatronics to animal production in mexico. 1. introduction mexico covers some 2 million square kilometers of territory, 11% of which is used for agriculture, 57% for pasture and fallow land, 26% for forestry use and the halting 6% for other uses .some 58% of the territory‟s approximate 19 million hectares (47.5 million acres) is dedicated to mexico‟s primary economic activity: cattle ranching, in its different modalities.. livestock is domesticated animals embossed to produce aliment for person consumption. different foods elaborate from cattle provide essential nutrients, contributing 15% of the total dietary animal review 2017 vol. 4, no. 1, pp. 1-7 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2017.41.1.7 © 2017 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2017.41.1.7&domain=pdf&date_stamp=2017-01-14 animal review, 2017, 4(1): 1-7 2 © 2017 conscientia beam. all rights reserved. energy and 25% of all proteins in the human diet.mareover, the cattle ranching sector is one of the rapid increasing constituent of the universe‟s agriculture and livestock sector. in mexico, the major livestock production enterprise comprise beef and dairy, hogs, sheep, goats, poultry, horse and mule ranching. beef and dairy ranching was popularize into mexico during the colonial era, limited pre-hispanic animal husbandry being spotlight on turkey and xoloitzcuintle (mexican hairless dog) breeding and the cultivation of the cochineal (an insect producing a crimson-colored natural dye) and some beekeeping activities [2]. in 2008 a request for meat of 1.9 mtons is forecast, while for 2018 an estimated demand of 2.1 mtons is estimated. likewise, there was a slowdown in imports from 2007 to 2009, from 302 to 290 thousand tons of meat, respectively. however, the base projection shows that the demand for this meat grows at rates faster than the production, reason why a growth in the imports in the whole is expected. the base projection shows that purchases abroad will reach a level close to 390 thousand tons in 2018 [3]. in mexico, the deficit in the milk market is complemented by imports. for 2009, an import of 1.0 billion liters is estimated and in 2018 these are perspective for drecrease to 946 million liters. this is in replay to an growth in domestic production that is motivated by the recovery of the cost of this food at the end of 2018 [3]. according to these projections makes it necessary to analyze the pressure for increased food production of animal origin, leading to review technologies applied in the rest of the universe to carry out such an increase, a technology is the application of mechatronics to animal production, which is also known as livestock farming precision.application of automatic technologies is a growing trend in the cattle industry and plays an sustantial part in the forthcoming prospects [4]. being the objective of the present article the revision of the state of the art in the world and in mexico of this technology. 2. materials and methods for data collection searched in printed data bases, internet, magazines scientific, professional and postgraduate university thesis, newspaper articles, etc. 2.1. state of the art precision livestock production (plp) is the augmentation of precision agriculture (pa) notions to include all components of agro ecosystems, particularly animals and plant-animal interactions. soil, plants and soil-plant interactions are the subjects of pa or site-specific farming, where the main principle is to exploit natural spatial heterogeneity to increase efficiency and reduce environmental impacts. for the most part, pa has been studied and developed for intensive cropping systems with little attention devoted to pastoral and agro pastoral systems. plp focuses on the animal component and exploits heterogeneity in space and among individual animals towards more efficient and environmentally friendly production. within plp, precision grazing consists of the integration of information and communication technologies with knowledge about animal behavior and physiology to improve production of meat, milk and wool in grazing conditions [5]. the aim of precision cattle production is to manage individual animals by continuous real-time monitoring of health, welfare, production/reproduction, and environmental impact [6]. precision cattle production involves the measurements, predictions and data-analyses of animal variables. offers totally new possibilities to collect and analyze data from farm animals in a continuous and fully automatic way. we cannot only replace the farmers “eyes and ears” to each individual animal as in the past, but several other variables (infections, physiological variables, stress, etc.) will soon be measurable in practice. the bottleneck to apply this technique is in the opportunity of accurate sensors and sensing systems, since it has been shown that the required mathematical algorithms can be exposed. the application of this scientific knowledge offers new possibilities to realize nutriment safety and quality, competent and feasible animal production, fine animals, guaranteed animal well-being and acceptable environmental impact of livestock production. animal review, 2017, 4(1): 1-7 3 © 2017 conscientia beam. all rights reserved. therefore, efforts should be increased for bringing this challenging approach of precision cattle ranching to practice. this is only possible when teams from different research disciplines, such as physiology, ethology, nutrition, hygiene, engineering, etc. join their research efforts [7]. some elements of accuracy cattle ranching are already not unusual on livestock farms, i.e. sensing systems for milk yield in dairying, and their use should be part of livestock production heedless of the greater potential to manage livestock automatically. if the assurance of plf is to be realized then three barriers need to be overcome before commercial uptake occurs: i) plf technology needs to be advanced that is based upon robust, low cost sensing systems and data-based models with consequential parameters that enable control of two or more collaborating physical and/or biological processes; ii) appropriate implementations must be identified with purpose and trajectories specified for the main candidate processes; and iii) development and demonstration must be completed at a commercial scale to demonstrate that any asset will have a reasonable return and that the technology is reliable. given the scale of these challenges and the timescale needed to overthrown them, then current effort should focus on the evolution of monitoring systems for livestock that satisfy the request of purchasers and buffers for safe, healthy food produced from cattle ranch‟s of secured standard of health within acceptable limits of environmental emissions [8]. accuracy livestock farming is an embryonic technology with great potential to convert intensive livestock production by efficient utilization of nutrients, early warning of ill health, reduction in pollutant emissions and arrangement of useful information to skilled stockmen. however , in our opinion a careful procedure is needed to research & developed if the promise of the technology is not to be scamper against the rocks of poor product design and marketing [9]. in order to be able to produce secure, uniform, cheap, environmentallyand welfare-friendly food products and market these products in an increasingly complicate world agricultural market, cattle producers must have entry to timely production related information. especially the information related to feeding/nutritional issues is relevant , as feeding related costs are constantly significant part of variables costs for all types of cattle production. in consequence, automating the collection, analysis and use of production related information on cattle ranches will be imperative for improving livestock productivity in the forthcoming. electronically-controlled livestock production systems with an information and communication technology (ict) focal point are required to guarantee that information is collected in a cost effective and timely appearance and readily acted upon on farms. new electronic and ict related technologies insert on ranch‟s as part of precision livestock farming (plf) systems will facilitate cattle management methods that are more tender to market signals. the plf technologies circumscribe methods for electronically measuring the critical components of the production system that indicate the performance of resource use, interpreting the information captured and controlling processes to ensure optimum efficiency of both resource use and livestock productivity [10]. precision livestock farming (plf) is potentially one of the most powerful developments amongst a number of interesting new and approaching technologies that have the potential to revolutionize the cattle ranching industry. if properly accomplished, plf or smart farming could (1) enhance or at least objectively document animal welfare on farms; (2) decrease greenhouse gas (ghg) emission and improve environmental performance of farms; (3) supply product segmentation and better marketing of livestock products; (4) reduce illegal trading of livestock products; and (5) enhance the economic stability of rural areas. however, there are just a few examples of effective commercialization of plf technologies insert by a small number of commercial companies, which are actively involved in the plf commercialization methods. to guarantee that the potential of plf is taken to the industry, we need to: (1) create a new service industry; (2) check, display and divulge the benefits of plf; (3) better arrange the efforts of different industry and academic organizations interested in the development and promotion of plf technologies on farms; and (4) encourage commercial sector to assist with professionally managed product development [11]. animal review, 2017, 4(1): 1-7 4 © 2017 conscientia beam. all rights reserved. „precision livestock farming‟ (plf) technology is an arise research field that develops management tools aimed at continuous automatic monitoring of animal production, which includes real-time monitoring of growth, health and welfare. plf intends to support farmers in making daily management decisions with extra „senses‟, and to make farmers less dependent on human labor. many plf concepts have been emerged in recent years, but the uptake of most of these technologies on commercial ranches has been slow. reasons for this slow uptake include that these plf technologies generate considerable amounts of data but that this data is not converted into profitable information for decision administration. a further reason is that investments in plf technologies can be significant, while the economic benefits of the inversion are unknown. the application of mechatronics in cattle farming is found through the use of biosensors and miniaturized electronic mechanics , developing data collection and allowing more precise decision making actions. nääs [12] presents some cases of the use of this technique in particular areas related to livestock farming. the approach of biosensors technology applied to cattle ranch, mainly based on the miniaturized electronic mechanics has being used from the mid 70s into several stages of production, such as feeding, detection of metabolic testing in animal husbandry, as well as to individual identification and monitoring, which is an important step towards tracking of actions and application of traceability of episode and processes in the animal protein production chain . the precision breeding involves the technological innovations that monitor the animal and its environment where it pastures. the knowledge of the digestive behavior of the animal in milk or meat production is fundamental to perform grazing management actions of the production system, nowadays as information will be used by modern technologies is still a unknown. being that these new technologies applied to the cattle industry can help to integrate the heterogeneity in the pastures, and it is proposed to the bit as the basic unit of the process to be monitored, concluding that creating environments with precision bites is like constructing grass structures to designate bits [13]. the benefits of using precision dairy technologies include increased system efficiency, reduced costs, improved end product, minimizing negative environmental impacts, and improved animal health and welfare. such technologies have a greater impact in the areas of health, reproduction and quality of milk. technologies have modified milk production systems and are generally variations of those already used in industries such as automotive or electronics. precision livestock technologies enable farmers to make informed decisions quickly and based on better information, resulting in increased productivity and profitability . precision livestock technologies enable farmers to make informed decisions quickly and based on better information, resulting in increased productivity and profitability [14]. the livestock sector faces the challenge of optimizing natural resources and those applied to the environment for animal production, such as agricultural inputs and pesticides, for example. for if it is produced with quantity and quality, the productive chain of ruminant livestock must be efficient within a restricted area of action. in this scenario, precision farming tools combined with animal production were developed from the advent of microcomputers, robotics and microelectronics. measurements began to be carried out with the minimum of human intervention. the researcher is currently concerned not only with the field measurements, but with the planning, design and interpretation of the analyzes. today's farmer is an information manager, who comes to him in countless digital forms and with speed in real time. through applications, smartphones, tablets and ultra books, all this in the face of increasingly fast internet connections, there is a range numerical and computationally intensive methods that facilitate the accuracy of multifactorial responses. applied to animals and agro ecosystems are a wide range of wireless sensors, actuators and controllers capable of recording signals, storing and interpreting them. from there, it aims to allow automated and accurate decisions to improve the use of environments and provide the balance between the sustainability and profitability of agricultural activities [15]. and thus, the traditional problem of mechanization of agriculture can be solved by the agriculturalmechatronization or agrotronics. similarly, problem solving of the breeding science passes through mechatronics animal review, 2017, 4(1): 1-7 5 © 2017 conscientia beam. all rights reserved. technology forward breeding-mechatronization or breedtronics, and the fisheries difficulty may be overcome through this emerging engineering technology, forward fishery-mechatronization or fishtronics [16]. 2.2. precision animal production in mexico in mexico the pressure for food is increasing, as in other countries, so there is no way to make use of mmodern technologies for providing food for the growing population, these technologies are precision breeding , automation and robotics, which were based on mechatronics, which is an integrative discipline in the areas of mechanics, electronics and computer science which aims to provide better products, processes and systems [17]. the country needs these technologies to rapidly increase food production. this is possible because it has the infrastructure and human capital in sufficient quantity, one study estimates that in mexico every year around 2,500 students graduate mechatronics of more than 150 schools that offer this specialty, at all three levels (bachelor's, master and ph.d.) [1] which have the capacity to investigate on subjects de precision animal production. guerrero, et al. [18] conducted a review to determine the image processing importance as an automation tool for assigning a body condition score (bcs) of dairy cattle, this factor is one of the most important criteria for dairy farmers, with his knowledge they can prevent health problems, feeding, breeding and production. the use of new technology in the milk industry has given rise to a new era of automated and non-invasive production systems giving the main result a greater production the majority of studies acquire the images in weighing aisles. in these corridors, although the animals are enclosed, they tend to remain in motion, making it difficult to acquire the images. the time of milking, since it has been observed that it is when they remain longer. as the processing of images is applied to other industries, the costs of these technologies will continue to decline; on the other hand the limitations of computer storage for the data collected are no longer a major concern. once the technical difficulties mentioned above have been overcome, the assignment of an automated qc rating can become an integral part of modern dairy farms. dorantes [19] conducted an investigation with the objective was to design an automatic quick assessment system of mastitis that applying fuzzy logic relates electrical conductivity and volume to determine and prevent mastitis in dairy cattle. it was implemented an animal identification system using radio frequency boluses with a reading frequency of 134.2 khz, also we designed the system that is implemented in the milking, with this system we can analyze the electrical conductivity and the milk production per cow. to determine the presence of mastitis cases, we implemented a fuzzy logic model having as input the parameters of electrical conductivity, production, standard deviation of electrical conductivity and standard deviation of production, both deviation as the result of moving average from ten previous data and the actual measurement. galicia, et al. [20] carry out an investigation that promotes a system of remote monitoring of the temperature and heart rhythm of a sow, that allows to predict the moment of the birth, and with this: to help reduce the mortality rate of piglets, to improve the welfare of the bristles in childbirth when the delivery is attended individually and in a timely manner; as well as helping to increase the profitability of the pig production system. a diadem-type device was designed to always position and maintain contact with the skin of the sow to two noninvasive sensors, on the back of the ear of the sow; generating the minimum of discomfort for its easy adaptation and acceptance. the headband is made of flexible and soft leather that provides resistance to rough use and rigidity to keep in contact with the skin of the sow to the sensors, has two adjustment systems for different sizes of the head of the sow and not to generate discomfort. the test animals were six bristles. two in their second delivery, two in their fourth delivery and two in their sixth delivery. race, physical dimensions and temperament at the time of delivery are aspects that were not considered in the present study. sensors record changes in body temperature and heart rate hours before delivery. the temperature sensor was placed behind the right ear and the heart rate on the left. the device or headband is installed without sensors to the sow in turn, when it is taken from the gestation area to the maternity area and a period of adaptation of 24 h is given, to minimize the effect of the stress generated by the change of room and use device. subsequently, the sensors are installed in the device, taking care of the animal review, 2017, 4(1): 1-7 6 © 2017 conscientia beam. all rights reserved. continuous contact of the sensor with the surface of the sow and starts recording the behavior of temperature and heart rate. records are analyzed and searched for behavior patterns that can be used as benchmarks in decision making to help predict the time of delivery. 1. placing non-invasive sensors in the transition of the ear pavilion and dorsal on the head of a sow, allows the identification of behavioral patterns of their temperature and heart rate, characteristic of the proximity of labor. 2. introducing electronic devices or gadgets, which facilitate everyday work and enhance the livestock production sector, is the contemporary challenge of livestock engineering. 3. the application of the device or headband allows management personnel to remotely consult the body condition of the sow, temperature and heart rate, predict the time of delivery and make necessary decisions to reduce the mortality rate of piglets, improve the welfare of the bristles in the childbirth when being attended individually and at the appropriate time 3. disscusion the situation despairs in the country as far as the animal production in mexico obliges to explore all the possibilities to remedy that situation, at the moment one has an abundant skilled workmanship in as much as mechatronics technology alone must guide its application of its investigation to the country's primary needs, such as the primary sector of providing animal products, thus avoiding that the leakage of foreign exchange increases by having to import these in a recurring manner, the review reveals really incredible data that only queretaro autonomous university and chapingo autonomous university, and only some research applying mechatronics to livestock . this situation must change, being this work a call of attention in this respect so that researchers in the area are willing to change that situation. 4. conclusions in mexico it is possible to increase the productivity of livestock farming, if the decision to guide and formed human capital and training are taken at all three levels ; bachelor , masters and phd , to the research and application of livestock mechatronics, results in developed countries so it evidence mexico can not be left behind in this regard , besides that is the only way to increase food production, applying mechatronics in animal production .so previously treated the perspectives for the precision livestock farming in the country are very big. funding: this study received no specific financial support. competing interests: the author declares that there are no conflicts of interests regarding the publication of this paper. references [1] anonymous, "diagnosis and prospects of mechatronics in mexico." retrieved: http://www.economia.gob.mx/files/comunidad_negocios/industria_comercio/estudios/diagnostico_prospectiva_me catronica_mexico.pdf, 2015. [2] gbcbiotech, "the cattle industry in mexico." retrieved http://www.gbcbiotech.com/bovinos/english/bovinos.html, 2017. [3] sagarpa, "proyecciones para el sector agropecuario de méxico." retrieved: http://www.sagarpa.gob.mx/agronegocios/documents/ebespa%c3%b1ol300909.pdf, 2009. [4] h. hamadani and k. a. alam, "automation in livestock farming a technological revolution," international journal of advanced research, vol. 3, pp. 1335-1344, 2015. view at google scholar [5] e. a. laca, "precision livestock production: tools and concepts," revista brasileira de zootecnia, vol. 38, pp. 123-132, 2009. view at google scholar | view at publisher http://www.economia.gob.mx/files/comunidad_negocios/industria_comercio/estudios/diagnostico_prospectiva_mecatronica_mexico.pdf, http://www.economia.gob.mx/files/comunidad_negocios/industria_comercio/estudios/diagnostico_prospectiva_mecatronica_mexico.pdf, http://www.gbcbiotech.com/bovinos/english/bovinos.html, http://www.sagarpa.gob.mx/agronegocios/documents/ebespa%c3%b1ol300909.pdf, https://scholar.google.com/scholar?hl=en&q=automation%20in%20livestock%20farming%20-%20a%20technological%20revolution https://scholar.google.com/scholar?hl=en&q=precision%20livestock%20production:%20tools%20and%20concepts http://dx.doi.org/10.1590/s1516-35982009001300014 animal review, 2017, 4(1): 1-7 7 © 2017 conscientia beam. all rights reserved. [6] berckmans, "general introduction to precision livestock farming," animal frontiers, vol. 7, pp. 6-11, 2017. view at google scholar | view at publisher [7] d. berckmans, "automatic on-line monitoring of animals by precision livestock farming." retrieved: http://www.isahsoc.org/userfiles/downloads/symposiums/2004/berckmans.pdf, 2004. [8] c. wathes, "precision livestock farming for anima health, welfare and production isah-2007 tartu, estonia." retrieved: http://www.isah-soc.org/userfiles/downloads/proceedings/proc_isah_2007_volume_i/70_wathes.pdf, 2007. [9] c. m. wathesa, h. h. kristensenb, j. m. aertsc, and d. berckmansc, "is precision livestock farming an engineer's daydream or nightmare, an animal's friend or foe, and a farmer's panacea or pitfall?," computers and electronics in agriculture, vol. 6, pp. 2–10, 2008. view at google scholar | view at publisher [10] t. m. banhazi, l. babinszky, v. halas, and m. tscharke, "precision livestock farming: precision feeding technologies and sustainable livestock production " international journal of agricultural and biological engineering, vol. 5, 2012a. [11] t. m. banhazi, "precision livestock farming: an international review of scientific and commercial aspects," international journal of agricultural and biological engineering, vol. 5, p. 1, 2012b. [12] d. a. i. nääs, "applications of mechatronics to animal production," in proc. club of bologna 13th annual meeting (part 1), chicago, il, 2002. [13] p. c. f. calvalho, "from the bite to precision grazing: understanding the plant-animal interface to exploit the multifuncionality of grasslands," revista bras.zootecnia, vol. 38, pp. 109-122, 2009. view at google scholar [14] f. c. ferreira, k. b. siqueira, and l. g. r. pereira, "a pecuária leiteira de precisão sob a ótica económica. cadernos técnicos de veterinária e zootecnia, nº 79," 2015. [15] c. f. m. vieira, tecnologia de precisão para a produção de pastagens. in simposio de producción animal a pasto.2015.anais de iii simposio de producao animal a pasto.editores wagner paris et.al. maringa: sthampa, 2015. [16] l. d. c. akonde, "mechatronics engineering education in republic of benin: opportunities and challenges," international journal of research in engineering and technology, vol. 03, pp. 585-593 2014. view at google scholar | view at publisher [17] negrete, "mechatronics in mexican agriculture current status and perspectives," international journal of agriculture & environmental science (ssrg-ijaes), vol. 2, 2015. view at google scholar [18] a. e. i. guerrero, g. m. soto zarazúa, m. toledano ayala, and c. a. e. rico garcía, "image processing to autamate the body condition score assessment of dairy cattle: a review," cienci@uaq, vol. 5, p. 19, 2012. [19] a. t. dorantes, "sistema automático para valoración rápida de mastitis mediante conductividad eléctrica en leche de ganado bovino," m.sc thesis autonomous university of queretaro, 2012. [20] r. m. galicia, r. a. a. abraham, and m. r. salazar, "dispositivo para dar seguimiento al comportamiento de la temperatura corporal de una cerda durante el parto en desarrollos de ingeniería agrícola en américa latina editores – compiladores: eugenio romantchik kriuchkova ,gilberto de jesús lópez canteñs ,efren fitz rodríguez.dima,uach.méxico," presented at the xi congreso latinoamericano y del caribe de ingeniería agrícola y xxiii congreso nacional de ingeniería agrícola méxico, 2014. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://scholar.google.com/scholar?hl=en&q=general%20introduction%20to%20precision%20livestock%20farming https://scholar.google.com/scholar?hl=en&q=general%20introduction%20to%20precision%20livestock%20farming http://dx.doi.org/10.2527/af.2017.0102 http://www.isah-soc.org/userfiles/downloads/symposiums/2004/berckmans.pdf, http://www.isah-soc.org/userfiles/downloads/symposiums/2004/berckmans.pdf, http://www.isah-soc.org/userfiles/downloads/proceedings/proc_isah_2007_volume_i/70_wathes.pdf, https://scholar.google.com/scholar?hl=en&q=is%20precision%20livestock%20farming%20an%20engineer's%20daydream%20or%20nightmare,%20an%20animal's%20friend%20or%20foe,%20and%20a%20farmer's%20panacea%20or%20pitfall? http://dx.doi.org/10.1016/j.compag.2008.05.005 https://scholar.google.com/scholar?hl=en&q=from%20the%20bite%20to%20precision%20grazing:%20understanding%20the%20plant-animal%20interface%20to%20exploit%20the%20multi-funcionality%20of%20grasslands https://scholar.google.com/scholar?hl=en&q=mechatronics%20engineering%20education%20in%20republic%20of%20benin:%20opportunities%20and%20challenges http://dx.doi.org/10.15623/ijret.2014.0303109 http://dx.doi.org/10.15623/ijret.2014.0303109 https://scholar.google.com/scholar?hl=en&q=mechatronics%20in%20mexican%20agriculture%20current%20status%20and%20perspectives 1 © 2021 conscientia beam. all rights reserved. effect of time of feeding on body temperature of wad bucks and pregnant does in tropical environment m.j. adegbeye1+ s.o. aro2 a.n. fajemisin3 p. ravi kanth reddy4 1,2,3department of animal production and health, federal university of technology, akure, nigeria. 4veterinary dispensary, animal husbandry department, taticherla, andhra pradesh, india. (+ corresponding author) abstract article history received: 27 january 2021 revised: 24 february 2021 accepted: 22 march 2021 published: 13 april 2021 keywords body temperature diet-induced thermogenesis time of feeding pregnant does bucks tropics. this study aims to assess the impact of time of feeding on the body temperature of west african dwarf (wad) goats. twenty-seven goats (15 buck and 12 pregnant does) were used in this experiment. the bucks and gravid does were fed same experimental diet once daily at either, 06:00h, 12:00h or 18:00h in the morning, afternoon or evening, respectively. rectal temperature (p<0.001) of bucks fed at 18:00h was higher than 12:00h fed bucks which was higher than 06:00h fed bucks. in contrast, pregnant does fed in the evening had lowest (p=0.009) axillary and rectal temperature while afternoon-fed does had the highest. time of feeding induced increase (p<0.001) in axillary and rectal temperature of the bucks and pregnant does. the excursion ranges of temperature of morning, afternoon and evening-fed bucks was 0.42-0.79, 1.11-1.25, 1.15-1.19oc, respectively, while the excursion range of temperature of morning, afternoon and evening fed bucks was 0.17-0.19, 0.55-0.72, 0.45-0.47oc respectively. this study shows that time of feeding can entrain body temperature and animal physiological state can affect the temperature rhythm of animals. in conclusion, feeding bucks or pregnant does in the morning or evening may be an effective strategy to manage heat stress in the tropics. feeding livestock in the afternoon should be avoided. feeding in the evening may be adopted in the future due to the changing climate that will be accomplished by increased ambient temperature. contribution/originality: this study is one of the very few studies that has investigated the impact of time of feeding on the body temperature of livestock specie fed once daily. feeding in the evening is a good management strategy to reduce body temperature in bucks and pregnant does. 1. introduction many factors influence the body temperature including food availability and ambient temperature [1, 2]. naturally, in diurnal animals, body temperature rises from dawn to dusk which coincide with the increase in ambient temperature. yet, time of feeding has been shown to affect the rhythmicity of expression of body temperature in mammals [3-5]. the rhythm of core body temperature was entrained by feeding time where temperature was phase shifted and amplitude decreased by night feeding in the summer, indicating alteration of the central clock [6]. similarly, salfer and harvatine [5] reported that night feeding also phase delayed the rhythm of core body temperature, while day-restricted feeding increased its amplitude. the above scenario suggest that time of feeding can be used to manage the time of body temperature peaks. animal review 2021 vol. 8, no. 1, pp. 1-9. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2021.81.1.9 © 2021 conscientia beam. all rights reserved. https://orcid.org/0000-0001-6485-2489 https://orcid.org/0000-0003-2451-2783 https://www.doi.org/10.18488/journal.ar.2021.81.1.9 animal review, 2021, 8(1): 1-9 2 © 2021 conscientia beam. all rights reserved. the climate is continually changing and there is little to nothing farmers can do to put a stop to it. this climate change will induce increases in ambient temperature and humidity, which may result in increased heat-stress in the tropics. already, climatic conditions are one of the main factors limiting the development of animal production in tropical regions [7] with an ambient temperature as high as (22-32 °c or higher) [8]. this increase in global temperatures is an unsettling factor in livestock production, and elevations of 3-5°c are expected during this century [9]. feeding cattle at night in hot weather reduced metabolic heat load during daytime when ambient temperature is high while more heat production will be shift to night when the ambient temperature is low [10]. since farmers cannot stop the climate change-induced increases in temperature, it is plausible to find adaptive techniques to manage it. this study is meant to investigate the impact of time of feeding livestock on the body temperature because it can advance our knowledge of how diet influences thermogenesis in ruminant. furthermore, it also aims to examine the best time to feed animals in order to reduce the coincidence of high temperature and metabolic heat. 2. material and methods 2.1. experimental procedure the experiment was carried out at the goat unit, teaching and research farm of the federal university of technology, akure. twenty-seven goats were used in this study. experiment 1 consist of fifteen bucks randomly distributed into three treatments of five replicates while in experiment 2, twelve pregnant does were randomly distributed into three treatments of four replicates. the experiment on bucks and pregnant does were carried out concurrently. the buck and gravid does were fed guinea grass (panicum maximum) and concentrate table 1 at ratio 50:50 dry matter and fed once daily at 06:00h, 12:00h and 18:00h in the morning, afternoon, and evening, respectively. fresh water was offered ad libitum. table-1. gross composition (g/100g) of the concentrate diet. ingredient diet cassava peel 40.00 palm kernel cake 26.00 wheat offals 14.00 brewer dried grains 15.00 bone meal 2.0 urea 1.0 premix 1.0 salt 1.00 total 100 calculated crude protein (%) 10.73 calculated crude fibre (%) 9.82 2.2. body temperature measurement the axillary and rectal temperature of the bucks and pregnant does was carried out for 8 weeks between march and may 2020. the pregnant does were in mid-gestation stage. the temperature reading for all morning, afternoon and evening-fed goats were carried out three time daily between 06:00-07:00h, 12:00-13:00h and 18:00-19:00h and three times in a week. the readings were taken using a clinical digital thermometer (sku:wa904se1icxf2nafamz and bio-check). for the rectum, the thermometer was inserted 2cm deep into the rectum and the reading were taken once the thermometer beeps. the skin temperature was taken through the axillary point. the ambient temperature and relative humidity records were taken between 06:00-06:15h, 12:0012:15h, and 18:00-18:15h, respectively, using a digital hygro-thermometer (thermopro tp50). the average of the recordings taken three times a week were used as weekly value. the temperature humidity index (thi) was calculated from the recorded daily relative humidity and ambient temperature according to marai, et al. [11]; animal review, 2021, 8(1): 1-9 3 © 2021 conscientia beam. all rights reserved. thi = dboc {(0.31 0.31 rh) (dboc – 14.4) where: thi = temperature – humidity index dboc = dry bulb temperature oc rh = relative humidity (rh %)/100 thi was rated as follows: ahs = absence of heat stress (values < 22.2). mhs = moderate heat stress (values between 22.2 to < 23.3). shs = severe heat stress (values between 23.3 to < 25.6). ehs = extreme heat stress (values from 25.6 and more). 2.3. statistical analysis a factorial design with the following model: yijk = µ + ai + bk + abik + eijk was used. where yij= any of the response variables; µ = the overall mean; ai= effect of the ith time of feeding, bk= effect of time of measurement, abik= interaction of time of feeding and time of measurement and eij= random error due to experimentation. all data collected were subjected to analysis of variance (anova) using spss version 23.0 [12]. the differences between treatment means were examined by duncan multiple range test of the same package. 3. results 3.1. overall axillary and rectal temperature of bucks trends of overall axillary and rectal temperature of bucks animal fed under different feeding regime and at different time are shown in figure 1, figure 2. time of feeding had no impact (p>0.05) on the axillary temperature of bucks fed in the morning, afternoon or evening table 2. rectal temperature of bucks fed in the evening was higher (p<0.001) than those fed afternoon, while morning-fed bucks had the lowest rectal temperature. regardless of feeding time, axillary and rectal temperature (p<0.001) increased from dawn to dusk. time of feeding and time of measurement interaction, showed that irrespective of feeding time, buck axillary and rectal temperature increased (p<0.001) from dawn to dusk. furthermore, for axillary temperature, at 06:00h, the temperature of bucks fed in the morning was similar to bucks fed in the evening but higher (p<0.001) than those fed in the afternoon. at 12:00h, axillary temperature of bucks fed in the afternoon was higher (p<0.001) than bucks fed in the morning while the evening-fed bucks had the lowest axillary temperature. table-2. body temperature (oc) of wad bucks under different feeding regimes. note: abc= means within the same column but with different superscripts are statistically (p<0.05) significant. abc= means along the same row but with different superscripts are statistically (p<0.05) significant; tof: time of feeding; tom: time of temperature measurement; thi: temperature humidity index; at: ambient temperature; rh: relative humidity. tof axillary rectal tom axillary rectal thi at (oc) rh (%) morning 38.41 38.24c 6:00 37.96c 38.05c 24.72c 24.99c 91.63a afternoon 38.47 38.44b 12:00 38.54b 38.44b 30.02a 31.93a 65.83b evening 38.50 38.56a 18:00 38.87a 39.20a 28.88b 30.60b 66.25b sem 0.040 0.041 sem 0.040 0.041 0.319 0.415 1.649 p-value 0.243 <0.001 p-value <0.001 <0.001 <0.001 <0.001 <0.001 tof x tom 6:00 12:00 18:00 sem p-value excursion axillary morning 38.13ab 38.55ba 38.54ca 0.047 <0.001 0.42 afternoon 37.77bb 38.78aa 38.88ba 0.079 1.11 evening 38.00ac 38.30cb 39.19aa 0.076 1.19 rectal morning 37.72bb 38.48ba 38.51ca 0.062 <0.001 0.79 afternoon 37.71bc 38.64ab 38.96ba 0.078 1.25 evening 38.05ac 38.44bb 39.20aa 0.070 1.15 animal review, 2021, 8(1): 1-9 4 © 2021 conscientia beam. all rights reserved. at 18:00h, evening-fed bucks (p<0.001) had the highest body temperature, followed by afternoon-fed bucks while morning-fed bucks had the lowest. at 06:00h, rectal temperature of evening-fed bucks was higher than morning and afternoon-fed bucks which were similar. at 12:00h, rectal temperature of afternoon-fed bucks was the higher than morning and evening-fed bucks which were similar. furthermore, rectal temperature (p<0.001) in evening-fed bucks at 18:00h was higher than afternoon-fed bucks while the rectal temperature of morning-fed bucks was the lowest. ambient temperature and thi at 12:00h, was higher (p<0.001) than 18:00 and 06:00h, while rh was higher at 06:00h than at 12:00h and 18:00h table 2. figure-1. overall axillary temperature for bucks under different feeding regimes. the m depicts 06:00h measuring time, the a depicts 12:00h measuring time while the e represents 18:00h measuring time. this shows the rhythm of axillary temperature at each measuring time for the three times measurement per week. it shows that the time bucks were fed actually entrained the pattern of distribution of their temperature. the axillary temperature of morning fed bucks was controlled in a tight excursion range resulting in less fluctuation compared to other feeding time. figure-2. overall rectal temperature for bucks under different feeding regimes. the m depicts 06:00h measuring time, the a depicts 12:00h measuring time while the e represents 18:00h measuring time. this shows the rhythm of rectal temperature at each measuring time for the three times measurement per week. it shows that the time bucks were fed actually entrained the pattern of distribution of their temperature. animal review, 2021, 8(1): 1-9 5 © 2021 conscientia beam. all rights reserved. 3.2. overall axillary and rectal temperature of gravid wad does figure 3, figure 4 shows the overall axillary and rectal temperature of pregnant does fed at different times of the day. axillary and rectal temperature of gravid does fed in the morning and afternoon were similar but higher (p=0.009) than does fed in evening table 3. axillary (p<0.001) and rectal (p<0.002) temperature at each time of measurement simultaneously increased from dawn to dusk table 3. interaction between the period of feeding and time of measurement of axillary and rectal temperature of gravid does in all feeding regimes increased from dawn to dusk. at 06:00h, axillary temperature (p<0.001) in morning-fed does was higher than evening-fed does while axillary temperature in afternoon-fed does was the lowest. at 12:00h, axillary temperature (p<0.001) of afternoonfed gravid does was higher than temperature of morning-fed does while evening-fed does have the lowest temperature. axillary temperature of afternoon and evening-fed gravid does were similar but higher than in morning-fed does at 18:00h. rectal temperature (p<0.001) of morning-fed does increased compared to afternoon and evening-fed does at 06:00h. at 12:00h, rectal temperature (p<0.001) of does fed in the afternoon increased compared to morning and evening-fed does which were similar. at 18:00h, rectal temperature (p<0.001) of afternoon-fed does was higher than morning-fed does while the temperature of evening-fed does was. table-3. body temperature of gravid wad under different feeding regimes. note: abc= means within the same column but with different superscripts are statistically (p<0.05) significant. abc= means along the same row but with different superscripts are statistically (p<0.05) significant; tof: time of feeding; tom: time of temperature measurement; thi: temperature humidity index; at: ambient temperature; rh: relative humidity. tof axillary rectal tom axillary rectal thi at (oc) rh (%) morning 38.51ab 38.80a 6:00 38.26c 38.57c 24.72c 24.99c 91.63a afternoon 38.56a 38.82a 12:00 38.56b 38.81b 30.02a 31.93a 65.83b evening 38.45b 38.60b 18:00 38.72a 38.96a 28.88b 30.60b 66.25b sem 0.023 0.018 sem 0.023 0.018 0.319 0.415 1.649 p-value 0.009 0.009 p-value <0.001 <0.002 <0.001 <0.001 <0.001 tof x tom 6:00 12:00 18:00 sem p-value excursion axillary morning 38.41ab 38.54ba 38.60ba 0.026 <0.001 0.19 afternoon 38.08cb 38.81aa 38.80aa 0.022 0.72 evening 38.28bb 38.33cb 38.75aa 0.049 0.47 rectal morning 38.74ab 38.75bb 38.91ba 0.038 <0.001 0.17 afternoon 38.46bb 38.99aa 39.01aa 0.038 0.55 evening 38.52bc 38.70bb 38.97aba 0.030 0.45 figure-3. overall axillary temperature for gravid wad does under different feeding regimes. the m depicts 06:00h measuring time, the a depicts 12:00h measuring time while the e represents 18:00h measuring time. this showed the rhythm of axillary temperature at each measuring time for the three times measurement per week. it shows that the time does were fed actually entrained the pattern of distribution of their temperature. in the morning-fed does, the temperature rhythms were fairly consistent throughout the day for each week. in evening and afternoon-fed does, the temperature rhythms greatly fluctuate. animal review, 2021, 8(1): 1-9 6 © 2021 conscientia beam. all rights reserved. figure-4. overall rectal temperature for gravid wad does under different feeding regimes. the m depicts 06:00h measuring time, the a depicts 12:00h measuring time while the e represents 18:00h measuring time. this showed the rhythm of axillary temperature at each measuring time for the three times measurement per week. it showed that the time pregnant does were fed actually entrained the pattern of distribution of their temperature. in the morning-fed does, the temperature rhythms were fairly consistent throughout the day for each week. in evening and afternoon-fed does, the temperature rhythms greatly fluctuate. 4. discussion 4.1. axillary and rectal temperature of wad bucks the physiological state of domestic livestock is key to their productivity [13]. west african dwarf does are adapted to the tropical humid condition, but could be stressed by the high ambient temperature [14]. heat stress as a prevailing challenge in the tropics compromises livestock welfare. consumption of nutrient at inappropriate time has the potential to cause misalignment of thermoregulatory mechanism in the body [5]. diet-induced thermogenesis is associated with food ingestion which causes acute rise in body temperature in various species due to increase energy expenditures [4]. food anticipatory behavior is often accompanied by increases in body temperature [15]. the increase in temperature in evening-fed bucks may be due to the additive effects of rhythmically increasing body temperature, increased activity due to food anticipation behavior and diet-induced metabolic heat. in morning-fed bucks, the lower rectal temperature despite metabolic heat may be due to lower morning ambient temperature. body temperature is usually low in the morning and high in the evening [16]. thus, lower rectal temperature in afternoon-fed bucks compared to evening-fed bucks might be because the core body temperature had not peaked at the time of feeding. the rise in both axillary and rectal temperature from dawn to dusk in bucks fed at the different times of the day shows that body temperature exists in circadian rhythm with lower temperature in the morning and high temperature in the evening. this is because body temperature rises with increasing environmental temperature [17] . interaction of time of feeding and time of measurement showed that feeding time induced body temperature changes. this agrees with salfer and harvatine [5] who reported that body temperature can be entrained by feeding time, resulting in a shift in the rhythm of core body temperature. the high rectal temperature in evening-fed bucks and its similarity with axillary temperature in morning-fed buck at 06:00h suggests that the rate of elimination of metabolic heat overnight was slower due to high relative humidity. high relative humidity reduces the rate of dissipation of body heat due to decline in efficiency of evaporative cooling [18]. feeding cattle at night in hot weather reduced metabolic heat during daytime when ambient temperature is high, while more heat production will be shifted to night when the ambient temperature is low [10]. temperature animal review, 2021, 8(1): 1-9 7 © 2021 conscientia beam. all rights reserved. range in this study for axillary and rectal temperature was 37.77-39.19oc and 37.71-39.20oc, respectively. this is lower than the skin and rectal temperatures range reported as 37.52-39.76oc and 38.13-40.88oc, respectively [19]. this excursing range in this study falls between 0.4-1.90oc reported by ayo, et al. [20]; piccione, et al. [21]. the at in this study was similar to 25.50-37.75oc reported by minka and ayo [22]; aro, et al. [23]. the thi in this study shows that the bucks were heat stressed. the range observed in morning-fed bucks was tightly regulated by the scn, whereas the feeding of other bucks at “wrong time” of the day disrupted the temperature rhythm, causing fluctuations in the body temperature figure 1, figure 2. this depicts that feeding time can entrain body temperature rhythms. thus, to manage heat stress in bucks fed once a day, feeding in the morning or evening could be the best strategy. 4.2. axillary and rectal temperature of gravid does average axillary and rectal temperature of gravid does fed in the evening was lower than wad does fed in the morning and afternoon. this may be due to increased ability of evening-fed does to transfer heat load from the visceral part to the skin surface area resulting in increased level of heat dissipation. this result is similar to niu and harvatine [6] that reported decreased temperature in evening-fed cattle which is an indication of alteration in central clock. the result of this study agrees with the report that the thermal effect from food during the morning was higher than in the evening [3]. increasing temperature from dawn to dusk throughout the measuring time shows that body temperature exists in a rhythm which occur repeatedly. interaction of time of feeding and time of measurement showed that axillary and rectal temperature progressively increases in all feeding regimes. meal timing is an important factor affecting the thermal effect of foods [4]. the increased axillary and rectal temperature at 06:00h and 12:00h in gravid does fed at this time compared to 18:00h is an indication of diet-induced thermogenesis. this increase is a result of the feed consumed, increasing ambient temperature and increased food anticipatory activity around the usual time of feeding. feeding in the morning increased the heat load during the late morning to early afternoon while feeding in the afternoon increased heat load in the cooler hours of the day when heat losses from the animal through conduction and radiation were more efficient [24]. at 18:00h, similarity between the axillary and rectal temperature of afternoon and evening-fed pregnant does indicate that the heat load in afternoon-fed does was not quickly dissipated. the axillary and rectal temperature range was 38.08-38.80oc and 38.46-39.01oc respectively with an excursion range of 0.17-0.72 oc. the morning-fed does had a tight excursion in axillary and rectal temperature compared other feeding time. this indicate the regulatory mechanism of morningfed does has not be disrupted compared to pregnant does in other feeding regimes which fluctuated greatly figure 3, figure 4. the temperature in this study is in the range reported for skin temperature and rectal temperature as 37.52-39.76oc and 38.13-40.88oc respectively [19]. the excursion range in our study is lower than 0.4-1.90oc reported in ayo, et al. [20]; piccione, et al. [21]. this may be due to the different physiological state of the goats used. the goats in our study were pregnant. circulating hormone during pregnancy can influence the body temperature of animals causing 0.5–1°c reduction in maternal temperature during pregnancy [25, 26]. however, the rectal temperature in our study is similar to 38.80-39.28oc reported by shittu, et al. [8] for wad does from the third to fifth month of pregnancy. in contrast, it is lower than the 40.84-41.22oc reported for rectal temperature in wad does at 3-5 months of gestation [27]. thus, feeding does in the evening can be a feeding strategy to manage heat stress in pregnant goat. 5. conclusion the time of feeding of a goat can affect the daily average axillary and rectal body temperature range of the goat. feeding bucks or pregnant goat does once daily in the afternoon or evening, causes change in the rhythm of body temperature compared to those fed in the morning. farmers should avoid feeding their goats in the afternoon period. this study shows that feeding goat early in the morning or late in the evening is a good adaptive strategy to animal review, 2021, 8(1): 1-9 8 © 2021 conscientia beam. all rights reserved. manage heat stress in bucks. feeding in the evening is a good adaptive strategy to manage heat stress in pregnant does. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. acknowledgement: all authors contributed equally to the conception and design of the study. reference [1] s. masri and p. sassone-corsi, "the emerging link between cancer, metabolism, and circadian rhythms," nature medicine, vol. 24, pp. 1795-1803, 2018.available at: https://doi.org/10.1038/s41591-018-0271-8. [2] d. j. stenvers, f. a. scheer, p. schrauwen, s. e. la fleur, and a. kalsbeek, "circadian clocks and insulin resistance," nature reviews endocrinology, vol. 15, pp. 75-89, 2019. [3] c. j. morris, j. i. garcia, s. myers, j. n. yang, n. trienekens, and f. a. scheer, "the human circadian system has a dominating role in causing the morning/evening difference in diet-induced thermogenesis," obesity, vol. 23, pp. 20532058, 2015.available at: https://doi.org/10.1002/oby.21189. [4] y. serin and n. a. tek, "effect of circadian rhythm on metabolic processes and the regulation of energy balance," annals of nutrition and metabolism, vol. 74, pp. 322-330, 2019.available at: https://doi.org/10.1159/000500071. [5] i. j. salfer and k. j. harvatine, "night-restricted feeding of dairy cows modifies daily rhythms of feed intake, milk synthesis and plasma metabolites compared with day-restricted feeding," the british journal of nutrition, vol. 123, pp. 849-858, 2020.available at: https://doi.org/10.1017/s0007114520000057. [6] m. niu and k. harvatine, "the effects of morning compared with evening feed delivery in lactating dairy cows during the summer," journal of nairy science, vol. 101, pp. 396-400, 2018.available at: https://doi.org/10.3168/jds.201713635. [7] p. bv., s. nb., l. sb., n. ja., and p. cc., "differential expression of heat shock protein genes associated with heat stress in nelore and caracu beef cattle," livest. science, vol. 230, p. 103839, 2019.available at: https://doi.org/10.1016/j.livsci.2019.103839. [8] o. shittu, n. okwelum, s. famakinde, j. odeyemi, d. toviesi, m. yussuff, and o. oluwatosin, "original research article physiological changes at different stages of gestation in west african dwarf goats in the humid tropics," journal of agriculture and food environment, vol. 5, pp. 32-39, 2018. [9] wmo, "world meteorology organization. world meteorological day. retrieved from: https://worldmetday.wmo.int/en/secretary-generals-message. [accessed 2 may 2019]," 2019. [10] y. aharoni, a. brosh, and y. harari, "night feeding for high-yielding dairy cows in hot weather: effects on intake, milk yield and energy expenditure," livestock production science, vol. 92, pp. 207-219, 2005. [11] i. marai, m. ayyat, and u. abd el-monem, "growth performance and reproductive traits at first parity of new zealand white female rabbits as affected by heat stress and its alleviation under egyptian conditions," tropical animal health and production, vol. 33, pp. 451-462, 2001. [12] spss, ibm spss scientist statistics for windows, version 23.0. usa armonk: ibm spss corp, 2015. [13] b. fuchs, k. m. sørheim, m. chincarini, e. brunberg, s. m. stubsjøen, k. bratbergsengen, s. o. hvasshov, b. zimmermann, u. s. land, and l. grøv, "heart rate sensor validation and seasonal and diurnal variation of body temperature and heart rate in domestic sheep," veterinary and animal science, vol. 8, p. 100075, 2019. [14] l. jaber, a. habre, n. rawda, m. abi said, e. barbour, and s. hamadeh, "the effect of water restriction on certain physiological parameters in awassi sheep," small ruminant research, vol. 54, pp. 115-120, 2004. [15] j. bass and j. s. takahashi, "circadian integration of metabolism and energetics," science, vol. 330, pp. 1349-1354, 2010. [16] r. refinetti, "entrainment of circadian rhythm by ambient temperature cycles in mice," journal of biological rhythms, vol. 25, pp. 247-256, 2010. animal review, 2021, 8(1): 1-9 9 © 2021 conscientia beam. all rights reserved. [17] b. scharf, j. carroll, d. riley, c. chase jr, s. coleman, d. keisler, r. weaber, and d. spiers, "evaluation of physiological and blood serum differences in heat-tolerant (romosinuano) and heat-susceptible (angus) bos taurus cattle during controlled heat challenge," journal of animal science, vol. 88, pp. 2321-2336, 2010.available at: https://doi.org/10.2527/jas.2009-2551. [18] s. indu and a. pareek, "a review: growth and physiological adaptability of sheep to heat stress under semi–arid environment," international journal of emerging trends in science and technology, vol. 2, pp. 3188-3198, 2015. [19] m. alam, m. hashem, m. rahman, m. hossain, m. haque, z. sobhan, and m. islam, "effect of heat stress on behavior, physiological and blood parameters of goat," progressive agriculture, vol. 22, pp. 37-45, 2011. [20] j. ayo, s. oladese, s. ngam, a. fayomi, and s. afolayan, "diurnal fluctuations in rectal temperature of the red sokoto goat during the harmattan season," res. vet. science, vol. 66, pp. 7-9, 1998.available at: https://doi.org/10.1053/rvsc.1998.0231. [21] g. piccione, g. caola, and r. refinetti, "circadian rhythms of body temperature and liver function in fed and fooddeprived goats," comparative biochemistry and physiology part a: molecular & integrative physiology, vol. 134, pp. 563-572, 2003. [22] n. minka and j. ayo, "effects of cold-dry (harmattan) and hot-dry seasons on daily rhythms of rectal and body surface temperatures in sheep goats in a natural tropical environment," j. circa. rhy, vol. 14, pp. 1-11, 2016. [23] s. o. aro, i. b. osho, and o. o. awoneye, "comparison of rectal and axillary temperatures of isa brown and harco black layers fed different levels of dietary acetylsalicylic acid," animal research international, vol. 14, pp. 2691-2696, 2017. [24] a. brosh, y. aharoni, a. degen, d. wright, and b. young, "effects of solar radiation, dietary energy, and time of feeding on thermoregulatory responses and energy balance in cattle in a hot environment," journal of animal science, vol. 76, pp. 2671-2677, 1998.available at: https://doi.org/10.2527/1998.76102671x. [25] h. p. laburn, d. mitchell, and k. goelst, "fetal and maternal body temperatures measured by radiotelemetry in nearterm sheep during thermal stress," journal of applied physiology, vol. 72, pp. 894-900, 1992.available at: https://doi.org/10.1152/jappl.1992.72.3.894. [26] j. e. fewell, "body temperature regulation in rats near term of pregnancy," canadian journal of physiology and pharmacology, vol. 73, pp. 364-368, 1995. [27] j. imasuen and c. aloamaka, "an assessment of pregnancy induced physiological changes in west african dwarf (wad) does at different stages of gestation," annual review & research in biology, vol. 2, pp. 53-57, 2012. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 22 © 2018 conscientia beam. all rights reserved. study of factors linked to the variation in rentability in the farming of broiler chickens in northeast algeria a berghiche1+ t khenenou2 i m boualleg3 a bouacida4 i labiad5 1 laboratory of life sciences and technologies, institute of agricultural and veterinary sciences. cherif messaadia university, souk ahras, algeria; laboratory of animal productions, biotechnologies and health, institute of agronomic and veterinary sciences. cherif messaadia university, souk ahras, algeria 2 laboratory of life sciences and technologies, institute of agronomic and veterinary sciences. cherif messaadia university, souk ahras, algeria; institute of agricultural and veterinary sciences, cherif messaadia university, souk ahras, algeria 3.4 chadli ben djedid eltaref university, algeria 5laboratory of animal productions, biotechnologies and health, institute of agronomic and veterinary sciences. cherif messaadia university, souk ahras, algeria (+ corresponding author) abstract article history received: 4 september 2018 revised: 8 october 2018 accepted: 12 november 2018 published: 3 december 2018 keywords broiler chicken weight mortality performance zootechnical rentability. obtaining good zootechnical performance in broiler chicken farming requires continuous and regular zootechnical and sanitary monitoring throughout the breeding period to increase its rentability. our work carried out at the level of private broiler chicken farming in eastern algeria with the objective of comparing zootechnical performance during the breeding period with that obtained under the optimal conditions of strain isa 15. whose controlled and compared parameters show: a very high mortality ratea very low weight evolutiona higher consumption index. 1. introduction 1. poultry have acquired their economic importance as suppliers of eggs and meat, whose principle of broiler farming is essentially the production of a large quantity of meat in the shortest possible time with low feed consumption [1, 2]. 2. this is achieved through a data recording system in which parameters such as feed quantity, mortality rate and body weight play a very important role [3]. 3. in recent decades, the increase in the zootechnical performance of broilers and their productivity has been considerable. thanks to concomitant advances in breeding methods, nutrition, genetics and veterinary medicine. this progress is reflected in a significant reduction in the age at slaughter, the main determinant of the sensory quality of the meat [4]. 4. in all livestock production and particularly in poultry, productivity, livestock profitability and product quality are determined by the health and well-being of birds during the farming cycle [5]. animal review 2018 vol. 5, no. 2, pp. 22-33 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2018.52.22.33 © 2018 conscientia beam. all rights reserved. https://orcid.org/0000-0001-6355-3591 https://www.doi.org/10.18488/journal.ar.2018.52.22.33 animal review, 2018, 5(2): 22-33 23 © 2018 conscientia beam. all rights reserved. 5. farming management depends on several parameters (environmental conditions), which act directly or indirectly, alone or in combination, on the state of health and zootechnical performance of birds.  study objectives our present study will focus on the following points:  assess the actual level of zootechnical performance recorded in the farming of broilers in the el tarf region against the standard values provided by breeders.  identify the factors which determine the level of technical performance. 2. materials and methods a. presentation of the study region the region of el taref is bordering tunisia (120 km of border), it extends over an area of 300,000 ha, bordered to the north by the mediterranean sea, to the east by tunisia, to the west by the wilaya of annaba and to the south by the wilaya of souk-ahras and guelma, it includes 07 daïras and 24 municipalities (according to the agricultural services department, 2009). the study is being conducted in the municipality of el besbes. figure-1. geographical location of the wilaya of el tarf source: the agricultural services department ( wilaya d’el taref), 2009 2.1. farming duration the breeding period is 08 weeks, divided into three periods:  the start-up period: from 1 to 10 days.  the growth period: from 11 to 40 days.  the finishing period: from 41 days to slaughter. 3. materiels 3.1. livestock buildings the animals are raised in closed or obscure rearing buildings located among a group of 4 buildings that make up the broiler rearing centre. they are designed away from the wind and oriented parallel to the north-south axis. animal review, 2018, 5(2): 22-33 24 © 2018 conscientia beam. all rights reserved. the total surface area of each building is 1380m2 (115m x 12m) (figure 2). figure-2. livestock buildings. source: figure taken from the study site the ground of the buildings is cemented or concreted. the walls are made of double-walled aluminium foil whose interior is filled with glass wool which is used to insulate the buildings. as for the roof, it is of the double slope type, made of corrugated zinc and having a projecting part on each side used to clear rainwater. the buildings have 4 doors, one at the entrance to the building, a large one downstream in the width direction, a small one that communicates between the sas and the living area and another one next to it in the length direction of the henhouse. they are equipped with lateral ventilation trapdoor-type openings that extend along the length of the buildings (108m on one side and 68m on the other side where the pad coolling is located), 26 extractors, including 10 lateral extractors distributed evenly on both sides along the length of the building and 16 others installed on the ceiling and two humidifiers (pad-coolling) distributed on both sides. the livestock buildings are equipped with a diesel boiler with thermostat for the room heating system (figure 3), a water system for automatic watering (siphoid drinking troughs) connected to two tanks with an individual capacity of 50 litres, installed in the sas. each of the two tanks supplies 2 rows of water troughs located inside the building and each consisting of 50 siphoid water troughs (a total of 4 rows for 200 water troughs/building). figure-3. gasoil heater with thermostat. source: figure taken from the study site animal review, 2018, 5(2): 22-33 25 © 2018 conscientia beam. all rights reserved. the livestock buildings are equipped with an electrical power supply system for lighting, i.e. a number of 108 homogeneous 75-watt lamps distributed over 4 electrical supply lines over the entire living area. its light intensity is automatically adjustable (1 to 5 watts/m2) from a control cabinet installed on the sas. finally, for hygienic reasons, all buildings are equipped with foot bath installed at their entrances. in addition, it should be noted that there is an autoluve and a manoluve at the main entrance to the breeding centre. 3.1.1. farming equipment the equipment used per building during the period of our work is made up of: a diesel oil boiler for room heating. 180 1st age circular type feeders (plates). 180 plastic siphoid-type 1st age drinking troughs, with a capacity of 3 litres. 2nd age feeder of the 4 linear distribution chains type, each 108m long, arranged in parallel in the longitudinal direction of the building and connected to a 10kg capacity hopper or scale. the latter is fed directly from the feed storage silo by means of a worm screw. each of the supply chains has 144 plates with an individual capacity of 5kg and dosing units, for a total equivalent number per building of 576 plates. 200 2nd stage siphoid-type drinking troughs with a capacity of 1.5 litres, distributed over 4 rows of 50 water troughs each. 1 mercury thermometer placed in the environment (at the height of the chickens' backs). an electrical mechanism that automatically stops the distribution of the food. the distribution of livestock equipment as a whole is well done (figure 4). figure-4. farming equipment in the building source: figure taken from the study site 3.1.2. animals a total of 36,000 chickens (18,000 subjects for each building) were involved in our monitoring. these animals are of hubbard-isa15 strain, received and placed on the same day they are born (d1). they are delivered by the hatchery of the annaba saltworks and come from breeding stock originating from france but bred in algeria. 3.1.3. lighting and temperature program lighting program: as demonstrated in table 1, only one lighting program was applied to the two buildings (no. 1 and 2). animal review, 2018, 5(2): 22-33 26 © 2018 conscientia beam. all rights reserved. table-1. enlightenment and luminous program age (day) lighting duration length and time of darkness day night 1-8 24 9-10 22 12h-13h 00h-01h 11-15 20 11h-13h 23h-01h 16-21 18 11h-14h 23h-02h 22-26 16 11h-15h 23h-03h 27-35 18 11h-14h 23h-02h 36-40 20 11h-13h 23h-01h 41-45 22 12h-13h 00h-01h 46slaughter 24 source: table was constitute from program applied in the study sites table-2. the light intensity of the different breeding periods. breeding period intensity (watt/m2) start-up 5 watt/m2 growth 2 watt/m2 finition 1watt/m2 source: table was constitute from program applied in the study sites -the temperature also a thermometer located at the height of the chickens' backs records the temperatures listed in table 3, and applied in both buildings. table-3. ambient parameter (temperature). age (day) ambient heating temperature in the living area 1-3 31-33°c 4-7 31-32°c 8-14 29-31°c 15-21 27-29°c 22-24 24-26°c 25-28 22-24°c 29-34 19-22°c 35slaughter 17-19°c source: table was constitute from program applied in the study sites 3.1.4. the nutrition food is manufactured at the unit level the feed used consists of: corn, soybean meal, soybean meal, from flour mills, and dietary supplements such as: limestone, phosphates, salt, amino acid, trace elements, poly vitamins, antioxidants, anticoccidants, growth factor (antibiotics). table-4. la composition des aliments. composition of starter feed: % by weight composition of growth feeds: % by weight composition of finishing feeds: % by weight corn 61% soybean meal 29.7% from flour mills 5%. limestone 0.6%. phosphate 1.67% d.l. methionine 0.03% mineral vitamin complex -antistress 1% mineral vitamin complex -dc 1%. corn 62% soybean meal 26% from flour mills 8.5%. limestone 0.90%. phosphate 1.60% mineral-vitamin complex d.c 1%. corn67% soybean meal 18%. from flour mills 12%. 1% limestone 1% phosphate 1% finish mineral-vitamin complex source: table was constitute from program applied in the study sites animal review, 2018, 5(2): 22-33 27 © 2018 conscientia beam. all rights reserved. 3.1.5. the prophylaxis program prophylactic measures taken are based on cleaning premises, using preventive products and following a rigorous vaccination schedule. as a preventive measure, the use of vitamins and antibiotics in drinking water is recommended. a vaccination schedule was established by the administration and followed by the centre's veterinarian. table-5. le programme de vaccination du poulet de chair utilisé age (days) pathological affection vaccine administration mode 1sr day new castle poulvac hb1 nebulization infectious bronchitis h 120 nebulization 7th day gumboro gumbol drinking water 14th day gumboro ibdl drinking water 18 th day new castle sota drinking water 23 th day infectious bronchitis h 120 drinking water 34 th day new castle sota drinking water source: table was constitute from program applied in the study sites aexperimental protocol the experimental scheme adopted is simple and organized as follows: two batches of flesh day-old chick animals are kept separately in two different rearing buildings. each building contains 18,000 subjects, and the same programs usually used by the meat production unit of the former oravia have been applied to these batches. the two farms were monitored weekly: almost all the parameters characterising the farm and its management were recorded thanks to direct observations. for this study, we will select the main parameters that have a direct impact on the profitability of a broiler farm:  the mortality rate.  food consumption.  average live weight and gmq (average daily gain).  the feed conversion rate (consumption index). amortality rate the mortality rate is an important factor in profitability since it influences both the consumption index and the cost price. it reflects the decline in the workforce over time and its resistance to aggression. the mortality rate expressed as a percentage (%) is calculated from the following formula: mr (%) = number of dead animals / number of animals set up x 100. the calculation of the number of employees present was followed by daily records of the deaths recorded. bdensity (subject /m2) the population density has been calculated, it also has a direct influence on the space available to poultry. cthe average body weight weighing is carried out at the end of each week on a scale, on a sample of 30 subjects, and is given by the following formula: average body weight = net weight of a sample / total sample size. dweight gain it is the difference between the final weight (w1) and the initial weight (w0) at a given period of the breeding phase. calculated by the following formula: animal review, 2018, 5(2): 22-33 28 © 2018 conscientia beam. all rights reserved. w1: final body weight of the chicken. w0: initial body weight of the chicken. efood consumption the amount of food consumed will be calculated by the following formula: amount of food consumed (g / subject / day) = consumption total food/residual staff. the quantities consumed after the reduction of the rejected feed quantities at the end of each day were calculated in comparison to those initially distributed, knowing that the quantities distributed are calculated in advance. feed refusals were calculated from a weighing of a sample of 20 hoppers taken at random from different locations throughout the building. fthe consomption index this index is the ratio used to evaluate feed efficiency; it corresponds to the quantity of feed made available to the animal on the quantity of the product obtained... the feed consumption index is calculated from the following formula: ic = amount of food consumed in a week (kg) / weight gain per subject in the same week (kg). 4. results and discussion 4.1. the mortality rate the mortality rates recorded at the level of broiler farms 1 and 2 are illustrated by the following figure-6. daily mortality rate in building 1. source: figure was constitute from analyzed data of current study figure-7. daily mortality rate in building 2. source: figure was constitute from analyzed data of current study weight gain (g) = w1 w0 animal review, 2018, 5(2): 22-33 29 © 2018 conscientia beam. all rights reserved. during the first week, chick mortality in both farms was high: 741 subjects (4.11%) in the building (1) and 388 (2.15%) subjects in the building (2). the mortality rate considered acceptable for batches of broilers is 0.5% per week. over the entire cycle, the mortality rate is set at 4% for an 8-week breeding cycle, and 4.5% for a 9-week cycle (and this rate should not exceed 1% over the entire first week) [6]. this mortality can be explained by: stress of transporting from hatchery to breeding complex (poor condition of transport trucks) [7]. the handling of chicks during unloading and placement is also an additional source of very high stress, especially on the weakest subjects [8].  poor healing of the umbilicus, complicated by omphalitis despite the treatment introduced [9].  under normal conditions, the morality peak for the isa strain is observed during the first week of life when the mechanism of thermoregulation of chicks is not yet developed [4].  during the 2nd week, mortality was remarkably low after the chicks had adapted to the rearing conditions.  on the other hand, from the 3rd week onwards, there will be a sudden increase in mortality in building 2, which will decrease but with a considerable rate of increase from the 7th week onwards, similar to that of the 3rd week. ; the same results are observed but to a lesser degree in building 1 following:  the appearance of caecal coccidiosis, mycoplasmosis and colibacillosis.  in addition to boiler breakdowns during this period, which results in the accumulation of subjects, especially at night.  the appearance of abdominal ascites, which was favoured by the high density of the batches.  recommended mortality rates should not exceed 5-6% over the entire band cycle [10]; while the mortality rate in building 1 is 10.77% and 8.91% in building 2. despite the measures taken in terms of: staff organisation, control of environmental conditions and livestock management, these results can be explained by: the poor bacteriological quality of the chicks received (chicks carrying mycoplasma) and which sometimes become stunted or poorly formed. pathologies (mycoplasmosis, colibacillosis, coccidiosis) [11]. figure-8. mortality of chicks during transport. source: figure taken from the study site animal review, 2018, 5(2): 22-33 30 © 2018 conscientia beam. all rights reserved. 4.2. livestock variables the zootechnical balance of the 2 farms is presented in the following table: table-9. presentation of equipment ratios at the level of the 02 farms farming (1) farming (2) mean norm standard deviation slaughter age (day) 56 58 57 49 8 chicken/feeder space (cm) 0.94 1.06 1.00 7.5 6.5 chicken/flush space (cm) 1.1 0.9 1 1.22 0.2 density (subject / m2) 13.39 13.39 13.39 10 -3.39 litter (cm) 10 10 10 10 0 source: table was constitute from analyzed data of current study the analysis of the reduced data in table 09 shows that the average slaughter age of broilers in the range of 56 to 58 days. these averages, however, remain higher than the breeding time of "standard" broilers. the animals' access to the feeders is 0.94cm and 1.06cm respectively in farm 1 and 2. access to water troughs is 1.1cm and 0.9cm in farm 1 and 2 is very limited compared to the standards of 7.5cm/chicken for feeders and 1.2cm/chicken for water troughs. the density in breeding 1 and 2 is very high (13.39 subjects/m2) compared to the breeding standards (10 subjects/m2). this is a favourable factor for the development of coccidian [12]. figure-9. very high density in building 1. source: figure taken from the study site figure-10. the access of animals to water troughs is very limited at building level 2. source: figure taken from the study site animal review, 2018, 5(2): 22-33 31 © 2018 conscientia beam. all rights reserved. 4.3. evolution of live weight as a function of age table-10. evolution of the weight of chickens in the farm (1) in relation to the standards of the strain. age (week) average body weight (g) breeding (1) strain standards 01 120 170 02 240 447 03 515 871 04 840 1375 05 1200 1918 06 1555 2480 07 1900 3020 08 2250 3504 source: table was constitute from analyzed data of current study 0 500 1000 1500 2000 2500 3000 3500 4000 1 2 3 4 5 6 7 8 age (semaine) p oi ds v if m oy en (g ) elevage (1) normes de la souche figure-11. evolution of the weight of chickens in the farm (1) compared to the standards of the strain source: figure was constitute from analyzed data of current study table-11. evolution du poids des poulets dans l’élevage (2) par apport aux normes de la souche. age (week) average body weight (g) breeding (2) strain standards 01 95 170 02 241 447 03 488 871 04 820 1375 05 1170 1918 06 1500 2480 07 1880 3020 08 2120 3504 source: table was constitute from analyzed data of current study 0 500 1000 1500 2000 2500 3000 3500 4000 1 2 3 4 5 6 7 8 age (semaine) p o id s v if m o y e n ( g ) elevage (2) norme de la souche figure-12. evolution of the weight of chickens in the farm (2) in relation to the standards of the strain. source: figure was constitute from analyzed data of current study animal review, 2018, 5(2): 22-33 32 © 2018 conscientia beam. all rights reserved. at the beginning the average weight of the chicks is 37g / chick in the breeding 1 and 40g / chick, a little low compared to the standard of the strain which is 42g. it can be seen that the evolution of weight in the two farms between the 1st and 8th week was very low compared to the standards of the isa 15 strain. chickens in both farms (1) and (2) have: very slow growth, characterised by significant heterogeneity during the rearing cycle, with an average live weight on delivery (56 days) of 2250g for the farm (1) and 2120g for the farm (2). according to the technical standards of the farm concerned, at 49 days the live weight reaches 3020g. the technical performance goals are not achieved. this is due to the low quality of the chicks, the weight of the chicks received, the heterogeneity of the batch received and throughout the cycle, and health problems (colibacillosis, mycoplasmosis, coccidiosis) [13]. 4.4. food consumption and consumption index feed consumption during the rearing cycle within the farm has been subject to a more detailed analysis. reading the table, it highlights a trend towards under-consumption, during the growth phase of chickens; offset, however, by over-consumption of food in finishing, correlated with the lengthening of the breeding cycle and the waste induced by the inconsistency in the conduct of feedin g programmes. table-12. feed consumption and chicken consumption index age (week) food consumption consumption index (i.c) breeding (1) (g/ subject /d) breeding (2) (g/subject/d) standard of the strain breeding (1) breeding (2) standard of the strain 01 16 16 22.57 1.4 1.37 1.21 02 32 33 57.00 1.86 1.82 1.44 03 63 66 93.43 2.62 2.62 1.54 04 74 73 119.57 2.41 2.13 1.66 05 108 105 153.71 2.90 2.70 1.98 06 155 150 177.85 3.62 3.84 2.21 07 214 205 197.28 4.73 4.46 2.56 08 235 225 210.85 4.80 4.45 3.05 source: table was constitute from analyzed data of current study at the level of, the i.c. are higher, because they fluctuate in a value going to 4.45 and show, in addition, a significant variability (the normal average consumption index must be 1.95 on the 56th day according to the standards of the strain [14]). these relatively high averages are to be compared with: extension of the breeding cycle beyond the required economic threshold (49 days) [15]. the significant waste of food. the excessive mortality rate during the finishing phase, which strongly affects consumption (overestimation of the remaining workforce) [16]. in fact, it should be noted that, given the difficulties in estimating actual food consumption, consumption index are overestimated since they incorporate waste losses and errors in estimating the actual weight of feed bags used by farmers [17]. 5. conclusion et perspectives the livestock buildings in the study area are characterized by:  poor environmental conditions, particularly the neglect of hygiene rules.  stress of animals, especially during transport.  food distribution is irregular. the solutions that can be considered to reduce these welfare problems are as follows:  encourage farms with average stocking densities. animal review, 2018, 5(2): 22-33 33 © 2018 conscientia beam. all rights reserved.  control ambient conditions such as ambient temperature, ventilation, humidity, toxic gases, litter quality. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] m. o. north, commercial chicken meat and egg production: springer science & business media, 2002. [2] a. berghiche, t. khenenou, a. kouzi, and i. labiad, "importance of antibiotic residues in foodstuffs of avian origin marketed in souk ahras (algerian republic)," international journal of veterinary sciences and animal husbandry, vol. 3, pp. 5-10, 2018. [3] b. amine, k. tarek, b.-a. farida, and l. ibtissem, "detection of the antibiotic residues in broiler chickens by microbiological screening test in algeria," global veterinaria, vol. 19, pp. 504-508, 2017. [4] z. djerou, "influence of rearing conditions on performance in broiler chickens," presented at the brief presented for graduation from magister in veterinary medicine. option: pathology 2006. university of constantine, 2006. [5] m. m. aung and y. s. chang, "traceability in a food supply chain: safety and quality perspectives," food control, vol. 39, pp. 172-184, 2014. [6] f. grosjean, b. barrier-guillot, j. metayer, a. bourdillon, f. rudeaux, a. huart, p. leroy, a. thewis, j. bindell, m. muland, and d. kibargo, "flocks and cultures of the tropics. special file: poultry. review of the tropical agronomic and veterinary center of kinshasa. n 02," p. 96, 2003. [7] p. kettlewell and m. turner, "a review of broiler chicken catching and transport systems," journal of agricultural engineering research, vol. 31, pp. 93-114, 1985. [8] d. broom, "the welfare of livestock during road transport," long distance transport and welfare of farm animals, pp. 157-181, 2008. [9] g. fasenko and e. o’dea, "evaluating broiler growth and mortality in chicks with minor navel conditions at hatching," poultry science, vol. 87, pp. 594-597, 2008. [10] a. buldgen, r. parent, p. steyaert, and d. legrand, "semi-industrial poultry farming in tropical climate a practical guide gembloux: gembloux agronomic presses," p. 122, 1996. [11] a. berghiche, t. khenenou, a. kouzi, and i. labiad, "an investigation on the predominant diseases, its diagnosis, and commonly used drugs in the poultry farms in the north-eastern regions of algeria," veterinary world, vol. 11, pp. 986-989, 2018. [12] m. r. shirzad, s. seifi, h. r. gheisari, b. a. hachesoo, h. habibi, and h. bujmehrani, "prevalence and risk factors for subclinical coccidiosis in broiler chicken farms in mazandaran province, iran," tropical animal health and production, vol. 43, pp. 1601-1604, 2011. [13] a. mutasa, "effect of parental flock age on the performance of broilers reared in environmentally controlled houses," (doctoral dissertation), 2015. [14] k. j. raphaël, k. f. i. hermann, n. t. ruben, p. patrice, m. k. hervé, and t. alexis, "effect of incorporation rate of remoulding and natron in the feed on the growth performance of finished-stage broiler [the effect of graded level of wheat bran and natron on the growth of finisher broiler chickens]," 2015. [15] m. l. scott and m. c. nesheim, "nutrition of chicken (no. 636.5084 s2)," 1969. [16] national research council subcommittee on poultry nutrition, nutrient requirements of poultry (no. 1): national academies, 1984. [17] c. beaumant, "productivity and quality of broilers, inra edition," prod. anim, vol. 17, pp. 265-273, 2004. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 35 © 2017 conscientia beam. all rights reserved. growth and survival parameters and blood igg and total protein levels of calves born in the first production year of brown swiss and simmental cows zeynep küçük baykan1+ mustafa özcan2 1ministry of food, agriculture and livestock, saruhanlı district agriculture directorate, manisa, turkey 2istanbul university, veterinary faculty, department of animal breeding and husbandry, istanbul, turkey (+ corresponding author) abstract article history received: 7 july 2017 revised: 3 august 2017 accepted: 17 august 2017 published: 21 august 2017 keywords simmental brown swiss calf survival growth adaptation igg cattle. the objectives of this study were to determine the growth and survival parameters and blood igg and total protein levels of calves born in the first production year of brown swiss and simmental cows imported from austria to a newly-established dairy cattle enterprise in manisa, turkey. the study material consisted of 62 brown swiss and 266 simmental calves. calves were separated from their mothers after birth and put into individual sections and subjected to colostrum feeding. at the end of three days, calf grower feed was given. calves were weaned around 60-days of age unless there was an abnormality with their development. birth weights, weaning weights on the 65th day, and daily weight gains of calves were 40.31 kg and 41.76 kg, 77.16 kg and 83.9 kg, 0.56 kg and 0.64 kg for brown swiss and simmental breeds respectively. simmental calves were born heavier and had more weight gain until weaning. we determined that breed and sex affected calves’ growth while delivery method only affected birth weight. calves with high birth weights caused difficult birth, but this effect disappeared until weaning. survival rates of calves until weaning were 98.39% for brown swiss and 95.49% for simmental. the survival and mortality rates of brown swiss and simmental calves at weaning were at normal levels, while the calves with difficult birth had losses around 10%. contribution/originality: this study is one of the very few studies which have investigated the performance and adaptation levels of imported breeds in turkey. it contributes in the existing literature by producing information on the growth, survival, immunity levels and locality adaptations of calves born in turkey after heifers’ importation. 1. introduction there are 13.994.071 recorded cattle in turkey. 6.385.343 of them are culture cattle breeds (45.6%), 5.733.803 (41.0%) are culture cross breeds and 1.874.925 (13.4%) are native cattle breeds. while the ratio of culture breeds and culture cross breeds was 44.1% in 1991, it rose to 86.60% in 2014 [1]. the main reasons of this increase might be livestock imports and artificial insemination practices. cattle presence in turkey has become controversial particularly since the 2000s. it was claimed that as a result of the fluctuations in raw milk prices in the country, breeding animals with high genetic value were animal review 2017 vol. 4, no. 2, pp. 35-44 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2017.42.35.44 © 2017 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2017.42.35.44&domain=pdf&date_stamp=2017-01-14 animal review, 2017, 4(2): 35-44 36 © 2017 conscientia beam. all rights reserved. slaughtered, thus the number of newborn calves and cattle decreased due to uncontrollable reasons. as a solution to this, breeding and slaughtered animal imports were made possible, cattle carcass slaughtered abroad were imported as an urgent solution to the momentary problems in meat supply in domestic markets, and this had both positive and negative impacts on national economy [2-4]. the adaptation mechanisms of cattle imported to a new location develop in time. adaptation problems of cattle might result in low performance, increase morbidity and mortality rates, and cause monetary losses for the enterprises. this study focused on the calves born from pregnant brown swiss and simmental heifers imported from austria to a newly-established dairy cattle enterprise in manisa, turkey. its objective was to identify their blood igg (immunoglobulin g) and total protein levels, and compare their adaptation abilities in order to determine their growth and survival parameters and natural immunity levels. 2. material and methods the research protocol of our study was approved by the ethics committee of istanbul university (approval number: 2012/31) 2.1. material definition this study was conducted in a newly-established private dairy cattle enterprise in manisa. manisa is located in western anatolia region between 27 08' and 29 05' eastern longitudes and 38 04' and 39 58' northern latitudes. it has mediterranean/continental climate. precipitation generally occurs in winter, and summer is dry. the bare and steep side of the spil mountain in manisa faces the city and creates a scorching climate in summer and a freezing one in winter. the temperature is below zero for an average of 26 days per year [5]. the first animal material of the enterprise comprised of 70 brown swiss and 282 simmental (fleckvieh) pregnant heifers imported from innsbruck/austria. the heifers had their first births between june and december and had 328 (62 brown swiss, 266 simmental) live calves. 2.2. management and feeding of calves calves were separated from their mothers’ right after birth and put into individual sections where they were fed with colostrum via feeding bottles. colostrum quality was measured by colostrometer, and only the colostrum with high specific weight (1035>mg/ml) was given. calves consumed 10 liters of colostrum in the first 24 hours, and they were fed with milk two times a day in the following days. they were given calf grower feed and water when milk feeding started. calves’ appetites, body temperatures and stools were checked every day. healthy calves were taken into wider individual calf cabins in the open, and fed with calf grower feed. calf grower feed was composed of a premix, which included 2600 kcal/kg metabolic energy and enriched with a, d, e vitamins and various minerals. they were weaned around 60-days of age. dry alfalfa was started one week before weaning. after weaning, calves were grouped according to sex, age and weight. they were taken into semi-open young animal barn and raised in groups of 15. after 60 days, calves were introduced to forage and also given young animal ration which had: net energy maintenance-nem: 1.57 mcal/kg, net energy gain-neg: 0.96 mcal/kg, crude protein-cp: 21%dm (dry matter), acid detergent fiber-adf: 24%dm, neutral detergent fiber-ndf: 36%dm, starch 24%dm. silage feeding started 6 months later. 2.3. data collection and statistical analysis 321 of the pregnant heifers had live births and delivered 328 live calves in the enterprise. 313 calves were single born, and 15 calves were twinborn (one of the twins was stillborn). all twinborn calves were from the animal review, 2017, 4(2): 35-44 37 © 2017 conscientia beam. all rights reserved. simmental heifers. in the period until weaning, 13 single born calves died while all twinborn calves survived. we analyzed the data of 15 twinborn simmental calves separately. we examined the survival rates of calves until weaning according to breed, sex, birth type (single or twin) and delivery method. we calculated the calf deaths in the first 180 days cumulatively in periods of 15-days while we calculated the survival and periodical mortality numbers and rates separately. we divided the birth weights, 60th and 65th day weaning weights, and daily weight gains into sub-groups according to breed, sex and delivery method. we applied “glm (general linear models)” procedure in the withingroup significance controls. since we did not find any interaction between the factors addressed for growth parameters, we did not add interaction to the equations as an impact factor. we used “duncan multiple range test” for within-group significance controls. since twin births occurred only in simmental breeds, we did not add birth type to the equation as a factor in overall evaluation; we presented it as a separate table. we used t-test for the significance controls between twin male and female calves. we applied the following model for calculating the growth parameters with glm procedure: yijkl = µ + ai + bj + ck + eijkl in this model, yijkl : yield/production parameter of an individual µ : overall mean value ai : effect of breed (i = simmental, brown swiss) bj : effect of sex (j = male, female) ck : effect of birth type (k = spontaneous, with assistance, difficult) eijkl : random error we randomly selected 18 simmental (9 female, 9 male) and 17 brown swiss (10 female, 7 male) calves, which were born in the same period, to identify blood igg and total protein levels. we took blood samples with vacuum tubes of 10 ml in the first 24 hours, 7th day and 30th day (after colostrum intake). the samples were centrifuged in 5000 rpm for 10 min., and blood serums were stored at -18. we sent the serums to a private lab where bovine immunoglobulin g elisa test was used to identify the blood igg and total protein levels. we used spss (statistical package for the social sciences) program package [6] to make a statistical analysis of the parameters in this study. 3. results 3.1. growth performances table 1 and table 2 indicate the birth weights, 60th day weights, weaning weights (65.06 day) and daily weight gains for calves. table 1 shows the growth performance results of the single born calves while table 2 shows the same for twinborn simmental calves. average birth weights were 40.31 kg and 41.76 kg; 60th day weights were 74.03 kg and 80.15 kg; weaning weights (65.06 day) were 77.16 kg and 83.59 kg; and daily weight gains were 0.56 kg and 0.64 kg for brown swiss and simmental calves respectively. we found that simmental calves had higher 60th and 65th day weights and more daily weight gains than brown swiss. breed’s impact on those parameters was statistically significant (p<0.001). male calves had higher weights than female calves in all parameters except for daily weight gains. the impact of delivery method was significant only in birth weight. the birth weights of twinborn male and female simmental calves were 34.43 kg and 31.06 kg; 60th day weights were 74.81 kg and 66.09 kg; weaning weights were 78.00 kg and 69.37 kg; and daily weight gains were 0.67 kg and 0.58 kg. the twinborn simmental calves had lower birth and weaning weights compared to the single born calves of the same breed. animal review, 2017, 4(2): 35-44 38 © 2017 conscientia beam. all rights reserved. 3.2. survival and mortality rates table 3 indicates the survival rates of brown swiss and simmental calves until weaning while table 4 shows the mortality rates in 15-days periods. table 3 covers the period from birth to weaning while table 4 covers the period from birth to their 6th month. the survival rates of brown swiss and simmental calves until weaning were 98.39% and 95.49% respectively. the survival rate was 95.85% for single born and 100% for twinborn calves. the rates of male and female calves were 95.81% and 96.27%. the survival rates of calves with spontaneous birth were higher than other birth forms. the lowest survival rate was in the calves with difficult birth. the survival rates of all calves were 96.03% at weaning. the impact of breed, birth type, sex and birth form on the survival rates at weaning was not statistically significant (p>0.05). out of 328 calves born alive15 died in the first 6 months due to various reasons. mortality rate for 0-180th day was 4.57%. the highest amount of deaths occurred in the first 15 days with 8 calves (2.44%). the impact of breed, birth type, sex and delivery method on mortality rates in 15-day periods was not statistically significant (p>0.05). 3.3. igg and total protein levels we took blood samples (in 3 different periods) from 35 calves of both breeds that were born in the same month to investigate their natural immunity levels (blood igg and total protein levels). table 5 indicates the mean values and statistical significance controls identified according to breed, sex and measurement time. we found a statistically significant difference between brown swiss and simmental calves on the 7th day in terms of igg levels and on the 1st day in terms of total protein levels (p<0.05). breed x sex interaction was significant in terms of the 1st day igg levels (p<0.05). 4. discussion 4.1. growth performance average birth weights, 60th day weights, weaning weights and daily weight gains were higher in simmental calves than brown swiss calves, and this difference was statistically significant. the main reason for this difference might be the fact that simmental is a combined breed. the values we found for birth weight were lower than the values found by schnitzenlehner, et al. [7] and köpf, et al. [8] for simmental; higher than the values reported by özlütürk, et al. [9] and koçak, et al. [10] for simmental, and by uğur, et al. [11] for brown swiss; and consistent with the values reported by koçyiğit, et al. [12] and koçak, et al. [10] for brown swiss. the weaning weight was similar to the one reported by sağsöz, et al. [13] for brown swiss calves; and higher than the one reported by koçyiğit, et al. [12] for brown hybrid calves. the daily weight gains were similar to those reported by sağsöz, et al. [13] and koçyiğit, et al. [12] for brown swiss; and higher than those reported by uğur, et al. [11] for brown and holstein calves. the differences between the growth values found in our study and the ones reported in literature might derive from the differences in calves’ origins, local raising conditions, breeding care, calves’ care, feeding and ration contents. while daily weight gains were similar in male and female calves, weight difference at birth between sexes continued until weaning. the weights of male calves were higher than those of female calves, and this might be associated with the hormonal structure in intra and post uterine growth phases. in our study, calves’ birth weights were 39.78 kg, 40.53 kg and 42.79 kg; weaning weights were 79.36 kg, 80.66 kg and 81.11 kg; daily weight gains were 0.60 kg, 0.62 kg and 0.58 kg according to birth forms (namely: spontaneously/without help, easily/with help, and with difficulty/c-section) respectively. the higher birth weights of calves with difficult birth might be a result of intra uterine growth mechanisms. however, we found that birth form had neither positive nor negative impact on growth until weaning, and the calves with difficult birth compensated their weight losses in the following periods. animal review, 2017, 4(2): 35-44 39 © 2017 conscientia beam. all rights reserved. the birth weight of twinborn simmental calves was lower than single born calves, which was expected. however, in the weaning period, particularly the male calves reached the same weights with the single born calves, so our study found that the negative impact of being twinborn disappeared. the weaning weights of twinborn simmental calves were lower than the values reported by wyatt, et al. [14] for the twin calves weaned at 240 days, by shimada, et al. [15] for the twin calves weaned at 26 weeks, and by echternkamp, et al. [16] for the twin calves weaned at 172 days. those differences occurred due to the weaning times of calves. considering the overall growth performance of calves until weaning, our study found that simmental and male calves were born heavier, reached the 60th day with higher weight, birth form was effective on calves’ birth weight, but this effect disappeared until weaning. 4.2. survival and mortality rates calves’ survival rates until weaning, which do not go below 95%, are generally considered normal in dairy cattle enterprises. in our study, first 60-day survival rates of brown swiss and simmental calves were between 98.39% and 95.49%. survival rates at weaning were higher than the survival rate found by koçak, et al. [10] for brown swiss and simmental breeds, and similar to the survival rate found by özlütürk, et al. [9] for simmental calves. survival rates of single and twinborn calves at weaning were higher than the survival rates found by echternkamp, et al. [16] for single and twinborn calves. the suitability of first period care, feeding and health programs implemented in the enterprise were reflected on survival and 1st period mortality rates, and resulted in achieving the rates targeted by cattle enterprises for the 1st year. 4.3. igg and total protein levels blood samples from randomly-selected calves indicated that igg levels were between 19.48–38.45 mg/ml, and total protein levels were between 5.38–6.54 g/dl in different periods. igg (which occurs in blood and colostrum in the highest concentration and which is the immunoglobulin with the longest half-life) was 20mg/ml or higher in calves, and total protein level was 5g/dl or higher. these results showed that immunity was at normal levels. the igg levels found in this study were similar to the levels reported by yüceer and özbeyaz [17] for holstein, by uzlu, et al. [18] for brown swiss at 30-days, by yüceer and özbeyaz [17] for brown swiss at 30days, by akbulut, et al. [19] for holstein in the first 24-48 hours, and by akbulut, et al. [19] for brown swiss and holstein friesian calves at 30-days. however, they were higher than the levels reported by genç [20] for brown swiss in 24 hours, by akbulut, et al. [19] for brown swiss in 24 hours, by genç [20] for brown swiss in 24 hours, and by akbulut, et al. [19] for brown swiss and holstein friesian at 2 days. total serum protein levels were similar to the levels reported by yüceer and özbeyaz [17] for holstein and by uzlu, et al. [18] for 30-day; and lower than the levels reported by yüceer and özbeyaz [17] for holstein in the first 24-48 hours. in general, we think that igg absorption might vary depending on calves’ body size, breed, dry periods feeding, spaciousness of shelters, feeding types (bucket, feeding bottle, mother), morbidity rate while total serum protein level might vary depending on calves’ body weight, breed, and igg rate. 5. conclusion simmental calves were born heavier and gained more weight until weaning. we found that breed and sex affected growth parameters; birth form (single or twin) only affected birth weight and calves with high birth weight caused difficult birth but this effect disappeared until weaning. similarly, being twinborn had a negative effect on birth weight but twinborn calves reached the same daily weight gain levels with single born calves until weaning. survival and mortality rates for brown swiss and simmental calves at weaning were at normal and ideal levels while there were 10% losses in calves with difficult birth. natural immunity levels of calves born in the enterprise were seen at normal levels due to the care and feeding standards implemented there. animal review, 2017, 4(2): 35-44 40 © 2017 conscientia beam. all rights reserved. funding: this work was supported by scientific research projects coordination unit of istanbul university (project number: 23141). competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: this study was arranged from a part of the first author’s phd thesis. references [1] türkiye i̇statistik kurumu, "(tui̇k biruni). (erişim tarihi)." retrieved: https://biruni.tuik.gov.tr/hayvancilikapp/hayvancilik.zul. [accessed 01.02.2016], 2016. [2] e. aydın, y. aral, m. f. can, y. cevger, e. sakarya, and s. i̇şbilir, "türkiye’de son 25 yılda kırmızı et fiyatlarındaki değişimler ve ithalat kararlarının etkilerinin analizi," veteriner hekim dergisi, vol. 82, pp. 3-13, 2011. [3] g. dünya, retrieved: http://www.dunya.com/hayvancilik-politikasi-155266yy.htm, 2015. [4] g. dünya, retrieved: http://www.dunya.com/hayvan-ithalatinin-durdurulmasini-istiyorlar-156737h.htm, 2016. [5] municipality of manisa, retrieved: http://www.manisa.bel.tr/s23_manisa-cografyasi.aspx. [accessed 20.05.2015], 2017. [6] spss, statistical package for the social sciences, release 10.0. chicago, usa: spss inc. il, 1999. [7] s. schnitzenlehner, a. essi, and j. solkner, "retained placenta: estimation of nongenetic effects, heritability and correlations to important traits in cattle," journal of animal breeding and genetics, vol. 115, pp. 467-478, 1998. view at google scholar | view at publisher [8] m. köpf, k. gellrich, h. küchenhoff, h. h. d. meyer, and h. kliem, "effects of continuous milking during a field trial on productivity, milk protein yield and health in dairy cows," animal, vol. 8, pp. 1130-1138, 2014. view at google scholar | view at publisher [9] a. özlütürk, m. yanar, n. tüzemen, and s. kopuzlu, "calving and preweaning growth performance traits of calves sired by charolais, simmental and eastern anatolian red bulls," turkish journal of veterinary and animal sciences, vol. 30, pp. 257-263, 2006. view at google scholar [10] s. koçak, m. tekerli, c. özbeyaz, and i̇. demirhan, "some production traits of holstein, brown-swiss and simmental cattle reared in lalahan livestock research institute," journal of lalahan livestock research institute, vol. 48, pp. 51-57, 2008. view at google scholar [11] f. uğur, m. yanar, and n. tüzemen, "weight and weight gains of early weaned female brown swiss and female holstein friesian cattle," tarım bilimleri dergisi, vol. 5, pp. 100-103, 1999. view at google scholar [12] r. koçyiğit, r. aydın, m. yanar, o. güler, a. diler, m. avcı, s. özyürek, d. kabakcı, and e. n. hirik, "effects of weaning ages on the growth, feed conversion efficiency and some behavioral traits of brown swiss x eastern anatolian red f1 calves," tarım bilimleri dergisi, vol. 21, pp. 492-499, 2014. [13] y. sağsöz, a. yıldız, n. sabuncuoğlu, ö. çoban, and e. laçin, "growth characteristics and feed efficiency of brown swiss and charolais x brown swiss calves," ataturk üniversitesi ziraat fakültesi dergisi, vol. 36, pp. 53-58, 2005. [14] r. d. wyatt, r. p. wettemann, m. b. gould, l. knori, and r. b. e. totusek, "effects of single vs twin rearing on cow and calf performance." retrieved: http://beefextension.com/research_reports/research_56_94/rr76/rr76_7.pdf. [accessed 26.06.2016], 2016. [15] k. shimada, y. i̇zaike, o. suzuki, m. kosugiyama, n. takenouchi, k. ohshima, and m. takahashi, "effect of milk yield on growth of multiple calves ın japanese black cattle," asian-australasian of animal sciences, vol. 5, pp. 717-722, 1992. view at google scholar | view at publisher [16] s. e. echternkamp, r. m. thallman, r. a. cushman, m. f. allan, and k. e. gregory, "increased calf production in cattle selected for twin ovulations," journal of animal science, vol. 85, pp. 3239-3248, 2007. view at google scholar | view at publisher [17] b. yüceer and c. özbeyaz, "effect of immunity on growth, disease incidence and livability in calves after colostrum consuming," veterinary journal of ankara university, vol. 57, pp. 185-190, 2010. view at google scholar http://www.dunya.com/hayvancilik-politikasi-155266yy.htm, http://www.dunya.com/hayvan-ithalatinin-durdurulmasini-istiyorlar-156737h.htm, http://www.manisa.bel.tr/s23_manisa-cografyasi.aspx https://scholar.google.com/scholar?hl=en&q=retained%20placenta:%20estimation%20of%20nongenetic%20effects,%20heritability%20and%20correlations%20to%20important%20traits%20in%20cattle https://scholar.google.com/scholar?hl=en&q=retained%20placenta:%20estimation%20of%20nongenetic%20effects,%20heritability%20and%20correlations%20to%20important%20traits%20in%20cattle http://dx.doi.org/10.1111/j.1439-0388.1998.tb00368.x https://scholar.google.com/scholar?hl=en&q=effects%20of%20continuous%20milking%20during%20a%20field%20trial%20on%20productivity,%20milk%20protein%20yield%20and%20health%20in%20dairy%20cows http://dx.doi.org/10.1017/s1751731114001062 https://scholar.google.com/scholar?hl=en&q=calving%20and%20preweaning%20growth%20performance%20traits%20of%20calves%20sired%20by%20charolais,%20simmental%20and%20eastern%20anatolian%20red%20bulls https://scholar.google.com/scholar?hl=en&q=some%20production%20traits%20of%20holstein,%20brown-swiss%20and%20simmental%20cattle%20reared%20in%20lalahan%20livestock%20research%20institute https://scholar.google.com/scholar?hl=en&q=weight%20and%20weight%20gains%20of%20early%20weaned%20female%20brown%20swiss%20and%20female%20holstein%20friesian%20cattle http://beefextension.com/research_reports/research_56_94/rr76/rr76_7.pdf https://scholar.google.com/scholar?hl=en&q=effect%20of%20milk%20yield%20on%20growth%20of%20multiple%20calves%20ın%20japanese%20black%20cattle http://dx.doi.org/10.5713/ajas.1992.717 https://scholar.google.com/scholar?hl=en&q=increased%20calf%20production%20in%20cattle%20selected%20for%20twin%20ovulations http://dx.doi.org/10.2527/jas.2007-0210 http://dx.doi.org/10.2527/jas.2007-0210 https://scholar.google.com/scholar?hl=en&q=effect%20of%20immunity%20on%20growth,%20disease%20incidence%20and%20livability%20in%20calves%20after%20colostrum%20consuming animal review, 2017, 4(2): 35-44 41 © 2017 conscientia beam. all rights reserved. [18] e. uzlu, m. karapehlivan, m. çitil, e. gökçe, and h. m. erdoğan, "investigation of serum sialic acid and some biochemical parameters in calf with diarrhea symptoms," yüzüncü yıl üniversitesi veteriner fakültesi dergisi, vol. 21, pp. 83-86, 2010. view at google scholar [19] ö. akbulut, b. bayram, and m. yanar, "serum immunoglobulin concentrations of brown swiss and holstein friesian calves and their relationship with growth characteristics," journal of the faculty of agriculture, vol. 34, pp. 157-159, 2003. view at google scholar [20] m. genç, "i̇sviçre esmeri ve siyah alaca sığırlarda bazı çevresel faktörlerin kolostrum kalitesi ve pasif immunite üzerine etkileri. atatürk ünv. zootekni anabilim dalı, 379341 nolu doktora tezi." retrieved: http://www.atauni.edu.tr/yuklemeler/1207c36a8768816c61206f3851328453.pdf, 2015. https://scholar.google.com/scholar?hl=en&q=investigation%20of%20serum%20sialic%20acid%20and%20some%20biochemical%20parameters%20in%20calf%20with%20diarrhea%20symptoms https://scholar.google.com/scholar?hl=en&q=serum%20immunoglobulin%20concentrations%20of%20brown%20swiss%20and%20holstein%20friesian%20calves%20and%20their%20relationship%20with%20growth%20characteristics http://www.atauni.edu.tr/yuklemeler/1207c36a8768816c61206f3851328453.pdf, 42 © 2017 conscientia beam. all rights reserved. table-1. mean values and significance controls for the birth, 60th-day and weaning weights and daily weight gains of single born brown swiss and simmental calves (kg) parameters breed sex birth type general significance brown swiss simmental male female spontaneous with assistance difficult breed sex birth type birth weight n 62 251 160 153 105 144 64 313 * *** ** x±sx 40,31±0,68b 41,76±0,35a 42,56±0,47a 39,51±0,5 1b 39,78±0,55 b 40,53±0,50 b 42,79±0,70 a 41,03±0,3 9 60th-day weight n 61 239 153 147 102 139 59 300 *** ** n.s. x±sx 74,03±1,06b 80,14±0,55a 78,45±0,74a 75,72±0,8 1b 76,17±0,86 77,31±0,78 77,78±1,14 77,09±0,6 1 weaning weight (65,06 days)1 n 61 239 153 147 102 139 59 300 *** ** n.s. x±sx 77,16±1,10b 83,59±0,57a 81,67±0,77a 79,08±0,8 3b 79,36±0,89 80,66±0,81 81,11±1,17 80,38±0,6 3 daily weight gain (kg)2 n 61 239 153 147 102 139 59 300 *** n.s. n.s. x±sx 0,56±0,01b 0,64±0,01a 0,60±0,01 0,60±0,01 0,60±0,01 0,62±0,01 0,58±0,01 0,60±0,01 1 mean weaning age was calculated as 65.06 days. 2 it was calculated for the period between birth and 60th day. n.s.: not significant, * p<0.05; ** p<0.01; *** p<0.001. table-2. mean values for the birth, 60th-day and weaning weights and daily weight gains of twinborn simmental calves (kg) parameters male female birth weight n 7 8 x±sx 34,43±2,37 31,06±2,24 s 6,26 6,34 60th-day weight n 7 8 x±sx 74,81±4,07 66,09±3,49 s 10,76 9,87 weaning weight (65,06 days) 1 n 7 8 x±sx 78,00±4,57 69,37±3,81 s 12,1 10,78 daily weight gain 2 n 7 8 x±sx 0,673±0,04 0,584±0,02 s 0,11 0,07 1 mean weaning age was calculated as 65.06 days. 2 it was calculated for the period between birth and 60th day. s: standard deviation animal review, 2017, 4(2): 35-44 43 © 2017 conscientia beam. all rights reserved. table-3. survival rates and significance controls of brown swiss and simmental calves until weaning (%) parameters birth weaning significance brown swiss simmental general brown swiss simmental general n n n n % n % n % general 62 266 328 61 98,39 254 95,49 315 96,03 n.s. single born 62 251 313 61 98,39 239 95,22 300 95,85 n.s. twinborn 0 15 15 0 0 15 100,00 15 100,00 n.s. male 36 131 167 35 97,22 125 95,42 160 95,81 n.s. female 26 135 161 26 100,00 129 95,56 155 96,27 n.s. spontaneous birth 25 80 105 25 100,00 77 96,25 102 97,14 n.s. birth with assistance 26 133 159 26 100,00 128 96,24 154 96,85 n.s. difficult birth 11 53 64 10 90,91 49 92,45 59 92,19 n.s. n.s.: not significant table-4. mortality rates and significance controls of brown swiss and simmental calves between 0-180 days* (%) day intervals breed sex birth form birth type general brown swiss simmental male female single twin spontaneous with assistance difficult 0-15 n 1 7 3 5 8 0 2 2 4 8 % 1,61 2,63 1,80 3,11 2,56 0 1,90 1,26 6,25 2,44 16-30 n 0 2 1 1 2 0 1 1 0 2 % 0 0,75 0,60 0,62 0,64 0 0,95 0,63 0 0,61 31-45 n 0 1 1 0 1 0 0 1 0 1 % 0 0,38 0,60 0 0,32 0 0 0,63 0 0,30 46-60 n 0 0 0 0 0 0 0 0 0 0 % 0 0 0 0 0 0 0 0 0 0 61-75 n 0 1 1 0 1 0 0 0 1 1 % 0 0,38 0,60 0 0,32 0 0 0 1,56 0,30 76-90 n 0 0 0 0 0 0 0 0 0 0 % 0 0 0 0 0 0 0 0 0 0 91-105 n 0 2 2 0 2 0 1 1 0 2 % 0 0,75 1,20 0 0,64 0 0,95 0,63 0 0,61 106-180 n 1 0 1 0 1 0 0 0 1 1 % 1,61 0 0,60 0 0,32 0 0 0 1,56 0,30 general n 2 13 9 6 15 0 4 5 6 15 % 3,23 4,89 5,39 3,73 4,79 0 3,81 3,14 9,38 4,57 calves born n 62 266 167 161 313 15 105 159 64 328 * the effect of breed, sex, birth type and delivery method on mortality rates in 15-day periods was not significant (p>0.05) animal review, 2017, 4(2): 35-44 44 © 2017 conscientia beam. all rights reserved. table-5. mean values for igg and total protein levels and significance controls of brown swiss and simmental calves parame ters measurement time breed sex sem significance brown swiss simmental male female breed sex breed x sex (n:17) (n:18) (n:16) (n:19) igg (mg/ml) 1.day 28,48±4,29 19,48±4,10 22,61±4,39 25,35±4,00 2,97 n.s. n.s. * 7. day 38,45±5,54 22,04±5,30 31,17±5,66 29,32±5,16 3,83 * n.s. n.s. 30. day 27,11±5,23 18,24±5,00 22,29±5,35 23,06±4,88 3,62 n.s. n.s. n.s. n.s. n.s. n.s. n.s. total protein (g/dl) 1.day 5,45±0,34 6,49a±0,33 5,77ab±0,35 6,17ab±0,32 0,24 * n.s. n.s. 7. day 6,08±0,23 6,54a±0,22 6,05a±0,24 6,58a±0,22 0,16 n.s. n.s. n.s. 30. day 5,38±0,13 5,50b±0,13 5,38b±0,13 5,51b±0,12 0,09 n.s. n.s. n.s. n.s. ** * ** n.s.: not significant, * p<0.05; ** p<0.01. a, b: differences between the means of the measurement times marked with different letters in the same column are significant (p<0.05). views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 1 © 2014 conscientia beam. all rights reserved. the effect of steaming process on fat soluble vitamins' content and fatty acid profile in bluefish and rainbow trout fillets stancheva m.1 --merdzhanova a.2 --galunska b.3 --dobreva a.d.4 1,2,3,4department of chemistry, faculty of pharmacy, medical university of varna, varna, bulgaria abstract fatty acid composition and all-trans-retinol, alpha-tocopherol, and cholecalciferol content was determined and compared in raw and steamed bluefish and rainbow trout. total lipids were extracted by bligh and dyer method followed by gc-ms. all-trans-retinol, cholecalciferol and alpha-tocopherol were analyzed simultaneously using hplc. in comparison with raw fish fillets, analyzed fat soluble vitamin’s content in steamed fish filletsfor the trout and bluefish decreased significantly to about 54.2% and 49.8% for retinol and 32.6% and 43.5% for alpha-tocopherol, respectively. after steaming, the cholecalciferol amounts in processed fillets decreased significantly only in rainbow trout (23.5%), whereas in bluefish the losses were non-significant. after cooking, the polyunsaturated fatty acid content changed significantly in the rainbow trout (45.8%), whereas the variations in the bluefish were minor. the major pufa in all samples were linoleic acid (la) and docosahexaenoic acid (dha). pufa/sfa ratios were between 1.01 and 1.68 for both species. steaming increases pufa/sfa ratio by 8.33% in rainbow trout, but does not affect this ratio in bluefish. keywords: black sea, fish nutrition, human health, oncorhynchus mykiss, pomatomus saltatrix, thermal processing. 1. introduction the rainbow trout and bluefish are commercially important fish species in bulgaria. the rainbow trout (oncorhynchus mykiss) is one of the most widely farmed fishes in our country. it is a predator which inhabits cold and clear freshwater ponds. because of its rapid growth and rich and diverse composition of meat, the trout is preferred fish for breeding and consumption [1]. the bluefish (pomatomus saltatrix) is important pelagic fish for the black sea fish markets. this species feeds primarily on fish (anchovy, horse mackerel) and on crustaceans (shrimps) [2]. on the other hand, the distinctive flavor of rainbow trout and bluefish makes them favorite dishes. fish is a rich source for essential nutrients such as fat soluble vitamins and polyunsaturated fatty acids (pufa) [3-5]. fatty fish is the most important source of vitamin d and long-chain omega-3 (n3) pufas, and is favorable with respect to both cardiovascular disease and fetal animal review 2014 vol. 1, no. 1, pp. 1-10 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(1): 1-10 2 © 2014 conscientia beam. all rights reserved. development. it is well known that fat soluble vitamins control the diversity of biologically important processes in the human body. all-trans-retinol (vitamin a) play role in photoreception, bone growth, reproduction etc. alpha-tocopherol (vitamin e) acts as an antioxidant, protecting membrane structures, essential fatty acids, and vitamin a from oxidation. cholecalciferol (vitamin d3) plays a crucial role in the regulation of the calcium-phosphate balance stimulating calcium absorption and thus regulating bone metabolism. the majority of researches on fish and human health have focused on the link between cardiovascular diseases and the consumption of fish or long chain n3 pufas as eicosapentaenoic acid (c20:5, epa) and docosahexaenoic acid (c22:6, dha) [6]. consumption of at least two fish servings per week is recommended by the american heart association and fao/who [3, 5]. in bulgaria the consumption of fish is very low (4.5kg annual per capita) compared to the average european levels (23 kg annual per capita) [7]. meanwhile, in the western society and bulgaria consumption of raw fish is rare. temperature processing of fish tissue enhances its taste, inactivates pathogenic microorganisms and increases its shelf life. during cooking, chemical and physical reactions occur and the content of thermo labile compounds as fat-soluble vitamins and pufa in fish tissue is reduced. steaming is known as a mild and often recommended cooking method used in healthy diets. there are no research data in bulgaria on the effect of steaming on fat soluble vitamins' content, total lipids and fatty acids (fa) composition of these fish species. the aim of the present study is to evaluate the effect of the steaming process on the total lipids, the fat soluble vitamins' content and the fatty acid composition in these two traditionally consumed in bulgaria fish species – the rainbow trout and the bluefish. 2. materials and methods 2.1. sample collection and cooking method a total of twelve fresh rainbow trout (fish farm, plovdiv region) and bluefish specimens were purchased from varna local fish market during the autumn season. biological and biometrical characteristics of the species were determined and noted (table 1). table-1. biometric and biologic characteristics of studied fishes (mean ± sd) fish species mean total weight [g] mean total length [cm] habitat food habits bluefish (n=6) 60.5 ± 2.3 16.0 ± 2.1 pelagic carnivorous rainbow trout(n=6) 325.0 ± 15.0 28.0 ± 3.4 pelagic omnivorous all fishes were immediately frozen and stored at -20oc. prior to analysis the frozen samples were thawed at 4oc, for 12 hours. the edible tissue was filleted with the skin. the fillets were totally randomized and then divided in two batches: first group of fillets (n=6 for each fish species) were analyzed in raw state, a second group was analyzed after steaming (n=6 for each fish species). the fish fillets from the first group were homogenized at 800 rpm for 3 minutes using moulinex blender. the homogenized tissue was used to prepare the parallel samples. the animal review, 2014, 1(1): 1-10 3 © 2014 conscientia beam. all rights reserved. second group was placed in a steamer above a glass pot of boiling water (500 ml) and cooked for 10 minutes. the steamed fillets were placed for 5 minutes on absorbent papers and then processed as described for group one. the steamed samples were weighed and the observed losses were noted. 2.2. moisture analysis test portions of homogenized fish tissue (2.000±0.005g) were dried at 105±2oc in an air oven, to constant weight for 16-18 hours [8]. all samples were cooled in desiccator and weighted. the change in the moisture [%] was calculated as weight loss. 2.3. extraction of fat soluble vitamins and hplc analysis the sample preparation was performed using the method of dobreva, et al. [9]. an aliquot of the homogenized sample (1.000±0.005 g) was weighed into a glass tube with a screw cap and 1% of methanolic l-ascorbic acid and 1m methanolic potassium hydroxide was added. six parallel samples of edible fish tissue were prepared and subjected to saponification at 80oc for 20 min. the components of interest were extracted with n-hexane and the extract was evaporated under nitrogen. the dry residue was dissolved in methanol and injected (20μl) into the liquid chromatography system. the three fat soluble vitamins were analyzed simultaneously using hplc system (thermo scientific spectra system) equipped with rp analytical column ods2 hypersil™ 250х 4,6mm, 5um. all-trans retinol and cholecalciferol were detected by uv, alphatocopherol by fluorescence detection. the mobile phase composition was 97:3 = meoh:h2o and the flow rate was 1ml/min. the qualitative analysis was performed by comparing the retention times of pure substances: at λmax = 325nm for retinol; λmax = 265nm for cholecalciferol and alphatocopherol fluorescence at λex = 288nm and λem = 332nm. the quantitation was done by the method of external calibration comparing the chromatographic peak areas of the corresponding standards (retinol solution, fluka; dl-alpha tocopherol, supelco; cholecalciferol, supelco). the results are expressed as µg per 100 g wet weight (µg.100g-1ww). 2.4. lipid extraction and fatty acid analysis portions of freshly prepared homogenate (5.000±0.001g) were extracted in triplicate with chloroform: methanol (1:2 v/v) according to bligh and dyer procedure [10]. bht (2-terthbutyl-4-hydroxyanisole) was added to all samples as antioxidant. after phase separation the chloroform layers were evaporated on a rotary vacuum evaporator (bushi 5200) until dryness and quantified gravimetrically. the total lipid (tl) content of edible tissue was determined for each group (n=6) and the results are presented as g per 100g wet weight (g.100g-1ww). the dry residue of the chloroform fraction was methylated by base-catalyzed transmethylation using 2m koh in methanol and n-hexane [11]. the hexane layer was separated and analyzed by gc-ms. gas chromatography was performed by a model focus gas chromatograph with auto sampler a3000, equipped with polaris q ms detector (thermo scientific, usa). the capillary column animal review, 2014, 1(1): 1-10 4 © 2014 conscientia beam. all rights reserved. used was a tr-5 ms, 30m length, 0.25mm i.d. helium was used as a carrier gas at a flow rate 1 ml/min. peaks were identified according to two parameters: retention time (rt) based on available fame mix standard (supelco 37 f.a.m.e. mix c4 c24) and mass spectra (ratio m/z) – compared to internal data base (thermo sciences mass library, usa). results are expressed as the percentage of each fatty acid with respect to the total fatty acids [12]. 2.5. statistical analysis the obtained data were analyzed using graph pad prism 5 software. column statistics were used for calculation of means and standard deviations and results are presented as average ± sd. to estimate the differences between two groups raw and steamed samples unpairedt-test statistical analysis was applied. thus the comparison was made between moisture, total lipids, fat soluble vitamins and individual fa and fa groups. the differences were considered significant at p<0.05. 3. results and discussion 3.1. moisture content the raw samples of rainbow trout fillets showed high moisture content (78.5%) followed by the bluefish (62.6%). during the process of steaming a significant decrease in moisture, compared to raw tissue was revealed (16.2%) for rainbow trout (65.8%, p<0.001) and 5.6% for bluefish fillets (59.1%, p<0.001). these results are consistent with sikorski and kolakowska for trout, and possibly due to the fact that the fish food experienced water loss in its tissues during the cooking process [13]. larsen et al. presented a similar result for moisture content of steamed king salmon [14]. 3.2. fat soluble vitamins' content all-trans-retinol and alpha-tp are known to be unstable when heated in the presence of air. the steaming method of cooking affects strongly the content of these vitamins. retinol and alpha-tp contents in steamed fish fillets for both rainbow trout and bluefish decrease significantly p<0.001, compared to their content in the raw fish samples by about 54.2% and 49.8% for retinol and 32.6% and 43.5% for alpha-tp, respectively (table 2). table-2.vitamin contents in raw and steamed fish fillets, µg.100g-1ww, (mean ± sd) fish species all-trans-retinol alpha-tocopherol cholecalciferol raw steamed raw steamed raw steamed rainbow trout 58.95±2.6 26.99±1.4*** 1648.90±68.8 1112.17±40.3*** 14.92±1.1 11.42±0.6** bluefish 38.48±2.4 19.35±1.7*** 427.08±37.1 241.38±24.7*** 11.18±1.2 10.40±0.5 *** p<0.001 steamed vs raw; ** p<0.01 steamed vs raw animal review, 2014, 1(1): 1-10 5 © 2014 conscientia beam. all rights reserved. rainbow trout and bluefish are amongst the fishes comprising highest amounts of cholecalciferol. our data for cholecalciferol content in raw fish tissue (table 2) are in accordance with the data given by mattila et al. for vitamin d3 content (0.28 47.7 µg.100g-1 raw tissue) in fishes [15]. the amount of cholecalciferol decreased significantly (p<0.01) by 23.5% only in rainbow trout, whereas in bluefish fillet the losses were non-significant, after steaming (table 2). there is a discrepancy in the literature regarding the effect of various types of cooking on the fat soluble vitamin contents in fish tissue [16-18]. erkan et al. found out losses of about 75% for retinol and 55% for alpha-tocopherol in steamed horse mackerel [18]. our results, regarding retinol and alpha-tp changes after steaming, are comparable with those of erkan, et al. [18]. mattila et al. reported losses below 10% for cholecalciferol in fish samples undergoing a baking process [16]. we also established slight non-significant losses (6.9%) for cholecalciferol in bluefish fillets after steaming. in contrast ersoy and ozeren reported no significant differences in fat soluble vitamins a and e in edible tissue of african catfish after various types of cooking baking, grilling, microwaving and frying [17]. 3.3. total lipid content the tl content in raw rainbow trout was 11.50 g.100g-1ww and 15.54 g.100g-1ww for bluefish. after steaming a significant (p<0.001) decrease in tl content was observed for both species 9.02 g.100g-1ww for rainbow trout and 13.34 g.100g-1ww for bluefish. according to other authors, changes in the lipid amounts after steaming depend on fish species, temperature treatment, portion size and heatable surface area [13, 19]. the obtained results are consistent with those quoted by other authors, who observed loss of fat due to spreading during heat treatment in rainbow trout and steamed king salmon fillets [14, 20]. to provide more useful and precise information of the actual lipid losses after steaming in the samples it was necessary to calculate the true retention factor (%tr). %tr is based on the measuring of weight change and proportion of tl in steamed and raw fish samples. this factor is calculated by the true retention method as follows: %tr = (nutrient content per g of cooked food x g of food after cooking) / (nutrient content per g of cooked food x g of food before cooking) x 100 [21]. in this study the observed weight changes for bluefish after heat treatment were higher (from 100 g raw sample to 87 g after steaming) in comparison to these for rainbow trout (from 100 g raw sample to 90 g after steaming). on this basis %tr were calculated 72.1% for rainbow trout and 71.1% for bluefish. these results are in good agreement with the data for average retention factor for fat in steamed carp (70%) presented by kalyoncu, et al. [22]. 3.4. fatty acid composition twenty-eight fa (from c12:0 to c 24:1) were identified and compared among the different species. there was a wide variation and significant differences (p<0.05) among the fa profiles of fish species and after steaming in terms of total and individual saturated and unsaturated fas. the fa pattern in raw trout followed the order: pufa>sfa>mufa. statistically compared to animal review, 2014, 1(1): 1-10 6 © 2014 conscientia beam. all rights reserved. the raw trout, steamed fillets showed significant increase in the values of total pufa and mufa (p<0.001), whereas the sfa amounts decreased slightly (p<0.05). the fa pattern has changed in the following way pufa>mufa>sfa after steaming. only minor increase in mufas (p<0.05) was observed in bluefish and pufa>sfa>mufa pattern did not change after steaming. therefore we may assume that the bluefish fas content is more stable after steaming than the rainbow trout fas content. gladishev et al. reported increased pufa levels after heat treatment in four fish species and suggested that this may be due to the higher degree of hydrolysis of fish tissue lipids [19]. the fa profiles of analyzed fish species before and after steaming are shown in table 3. as a result the steaming leads to significant changes in the levels of the individual fas within the fa groups. table-3. fa profiles (% total fa) of raw and steamed rainbow trout and bluefish (mean ± sd) fatty acid rainbow trout bluefish raw steamed raw steamed c 12:01 0.40±0.02 1.92±0.12*** 0.42±0.03 0.51±0.02 c 14:0 3.35±0.65 4.13±0.75*** 4.17±0.36 4.47±0.34** c 16:0 12.95±1.23 14.09±1.34*** 22.65±1.57 23.00±1.55** c 17:0 0.51±0.01 0.35±0.04 0.47±0.05 0.43±0.03 c 18:0 3.35±0.51 2.24±0.12*** 3.46±0.55 3.40±0.15 c 20:0 2.68±0.35 2.00±0.10 0.54±0.02 0.46±0.02 c 21:0 nd nd 0.33±0.01 0.27±0.01 c 22:0 1.95±0.40 0.75±0.05*** 0.57±0.02 0.47±0.03 c 23:0 0.00 0.28±0.02 0.30±0.01 0.25±0.01 c 24:0 3.20±0.60 1.50±0.33*** 0.54±0.03 0.45±0.04 σ sfa 28.90 27.28* 33.73 33.93 c 14:1 3.16±0.52 3.40±0.51 0.33±0.02 0.27±0.01 c 16:1 4.15±0.45 5.57±0.84*** 6.92±0.54 7.01±0.45 c 17:1 0.50±0.03 0.35±0.05 0.47±0.02 0.42±0.02 c 18:1 n 9 11.50±1.22 13.62±1.06*** 15.45±1.35 16.15±1.25*** c 20:1 2.03±0.67 2.68±0.54 2.81± 0.55 2.71±0.20 c 22:1 n 9 2.74±0.53 2.69±0.50 3.70±0.41 3.71±0.61 c 24:1 1.30±0.37 0.51±0.04 0.91±0.06 0.83±0.04 σ mufa 25.39 28.82*** 30.59 31.04* c 18:3 n6 3.19±0.64 0.56±0.03*** 0.40±0.01 0.30±0.01 c 18:2 n6 13.56±1.15 21.66±1.67*** 16.60±1.15 16.10±1.05 c 18:3 n3 6.16±0.80 1.22±0.31*** 1.50±0.20 1.78±0.21 c 20:5 n3 1.56±0.10 0.60±0.02*** 0.43±0.02 0.35±0.04 c 20:4 n6 3.73±0.22 5.33±0.54*** 2.82±0.34 2.82±0.35 c 20:2 1.46±0.14 0.45±0.01 0.40±0.02 0.35±0.01 c 20:3 n3 nd 0.41±0.02 0.38±0.01 0.45±0.01 c 20:3 n6 1.98±0.51 0.45±0.01 0.35±0.01 0.25±0.01 c 22:6 n3 11.23±1.05 14.45±0.98*** 11.30±1.12 11.60±1.26 c 22:2 1.90±0.08 0.70±0.05 0.50±0.03 0.40±0.02 σ pufa 44.47 45.82*** 34.60 34.23 σ n3 18.95±1.53 16.68±1.34*** 13.96±1.25 14.10±1.23 σ n6 22.46±1.67 28.00±1.84*** 20.04±1.71 19.45±1.64 epa+dha 12.79±0.92 15.05±0.85*** 11.73±1.03 11.95±1.10 σ n3/ σ n6 0.84±0.06 0.60±0.05*** 0.70±0.06 0.73±0.05 pufa/sfa 1.54±0.05 1.68±0.07 1.03±0.08 1.01±0.04 *** p<0.001 steamed vs raw; ** p<0.01 steamed vs raw; * p<0.05 steamed vs raw animal review, 2014, 1(1): 1-10 7 © 2014 conscientia beam. all rights reserved. 3.4.1. saturated fatty acids the sfa group of steamed rainbow trout shows increased levels of palmitic c16:0, myristic c14:0 and lauric acid c12:0 (p<0.001), whereas the levels of stearic acid c18:0 and the very longchain fas – lignoceric acid c24:0 and behenic acid c22:0 were significantly reduced (p<0.001). these changes reflect the overall reduction of sfas in the steamed trout. a similar trend was observed in the bluefish sfa levels after steaming, but the differences were very small. 3.4.2. monounsaturated fatty acids the amounts of unsaturated fa as mufas vary especially in wild fish [18, 23, 24]. oleic acid (c18:1 n9) is the main mufa in both species fish are able to biosynthesize this fa, but the oleic acid also has an exogenous origin and usually its content reflects the type of fish diet. [23, 24] in our study the levels of c18:1 n9 were increased significantly (p<0.001) after steaming in both species. the second abundant mufa was palmitoleic acid c16:1 n7. steaming results in significant increase in the levels of c16:1 n7 only for trout (p<0.001). the increase of both c18:1 n9 and c16:1 n7 acid levels after steaming contributed to higher extent to the elevation of total mufa content in the rainbow trout. larsen et al. reported insignificant effect of the steaming on king salmon mufa contents, while su and babb found significant changes in mufa levels in steamed scallops [14, 25]. there are several possible reasons for the discrepancies and differences among the reported results, but one of the most important is the lack of standardized times and temperatures for any cooking method. 3.4.3. polyunsaturated fatty acids in this study pufa in both fish species were dominated by linoleic acid c18:2 (la) from n6 and dha from n3 series. in the steamed rainbow trout la content increases up to 47.30 % of total pufas (p<0.001), whereas in bluefish its value was unchanged epa and dhan3 are highly polyunsaturated and more vulnerable to the oxidation even at ambient temperature compared to la n6 and their contents strongly depend on the storage conditions. conversely, the levels of the second abundant n6 fa arahidonic acid (aa) were constant in raw and steamed bluefish (8.15 % of total pufas), whereas the rainbow trout showed slight increase by 3.22 % (p<0.01) compared to raw samples. su and babb reported increase in dha and aa contents and decrease of epa content in steamed scallops [25]. some discrepancies were found when comparing the obtained results with the results involving amounts of epa and dha quoted by other authors. in the present study the sum of epa plus dha in raw trout and bluefish accounted to 28.8 % and 34.0% of total pufa respectively (table 3). the results obtained by kalyoncu et al. and steffens and wirth for these fas in trout were lower (with 10%) [22, 26]. the feeding habits, the method of fish farming and the different locations are probably the main reasons for the discrepancies in the results. significant changes in epa and dha levels were observed in the steamed trout (32.8 % of total pufa) due to the increase of dha value (p<0.001), while no differences were found for the bluefish (table 3). the lack of negative animal review, 2014, 1(1): 1-10 8 © 2014 conscientia beam. all rights reserved. influence of the cooking procedure on the dha levels of trout fillets has high practical importance. due to this fact, compared with bluefish, the steamed trout is a better source of these n3 pufas. kolakowska et al. suggested that the different heat treatment procedures had no substantial influence on the percentage of epa and dha in baltic herring [20]. in other researches the same authors reported that heating for 20 min at 160oc could reduce dha and epa contents in the rainbow trout [13]. the reported changes in epa + dha levels for both species could be caused by the changes in their lipid extractability. other important results in this study showed that the total sum of n6 pufas was elevated in steamed rainbow trout (up to 61.00 % of total pufa) in comparison with the raw one (50.5% of total pufa, p<0.001), whereas the opposite trend was observed in bluefish (p<0.001) after steaming (table 3). the n3 series showed significantly decreasing (below 6.0%, p<0.001) in steamed rainbow trout, while in bluefish this series remains unaffected. as a result, steaming can be preferred without significant loss of n3 pufas in bluefish. the n3/n6 pufa ratio is a key factor for balanced synthesis of eicosanoids in the organism [27]. previous studies revealed that n3/n6 ratio in freshwater fishes varies between 0.5 and 5.6, whereas in marine fishes it is between 0.7 and 14.4 [26, 28]. the obtained results in this study for raw species (from 0.7 up to 0.84) are in agreement with the above mentioned results. the observed differences in omega pufa levels result in a decrease of n3/n6 ratio only in rainbow trout, while it remains stable in bluefish after steaming (table 3). gladishev et al. and su and babb reported a decrease in n3/n6 ratio in steamed and boiled fish species and thus support our results [19, 25]. according to the current who recommendations, n3/n6 pufa should not be lower than 0.2 [2, 27]. in both analyzed fish species before and after steaming this ratio remains significantly above the cut-of value. the department of health recommended pufa/sfa ratios greater than 0.45 [29]. simopoulos and cleland [27] reported that several studies had found inverse association of the pufa/sfa ratios with cardiovascular diseases [27]. in our study, the most balanced pufa/sfa ratio was obtained for bluefish (table 3). we found that the steaming increases pufa/sfa ratio by 8.33 % in the rainbow trout, whereas this parameter remains unchanged in the bluefish. our results reveal that steaming does not induce a reduction of pufa/sfa ratio below 0.45 in both species. 4. conclusions the nutritional quality of the rainbow trout and the bluefish are fairly similar, with relatively high levels of unsaturated fas and fat-soluble vitamins. no significant changes in pufa amounts, fa distribution and cholecalciferol content for the bluefish compared to the rainbow trout were observed after steaming. the positive beneficial effect of fish lipids based on epa and dha n3 pufa, n3/n6 and pufa/sfa ratios, and fat soluble vitamins content are preserved after that treatment. the steaming method can be recommended as a mild and less aggressive cooking method suitable for healthy dietetic regimes. since fa composition and fat soluble vitamins' content are important components of the nutritional value of fishes, their animal review, 2014, 1(1): 1-10 9 © 2014 conscientia beam. all rights reserved. changes during the various regimens of processing need special interest and further investigations. references [1] м. karapetkova and м. jivkov, fishes in bulgaria. bulgaria: geya-libris, sofia, 2006. [2] e. o. elvevoll and d. g. james, "scientific and ethical challenges in agriculture to meet human needs. fao's fishery industries division, fao/who." available http://www.fao.org/docrep/003/x8576m/x8576m05.htm, 1994. [3] r. krauss, r. j. deckelbaum, e. fisher, b. v. howard, and r. h. knopp, "dietary guidelines for health american adults-a statement for health professionals from the nutrition committee," am. heart ass., vol. 94, pp. 1795-1800, 1996. [4] c. cahu, p. salen, and m. d. lorgeril, "farmed and wild fish in the prevention of cardiovascular diseases: assessing possible differences in lipid nutritional values," nutr. metabolism and cardiovascular diseases, vol. 14, pp. 34–41, 2004. [5] report of the joint fao/who expert consultation on the risks and benefits of fish consumption. [6] d. mozaffarian and e. rimm, "fish intake, contaminants, and human health evaluating the risks and the benefits," j. am. med. ass., vol. 296, pp. 1885-1899, 2006. [7] national center of public health and analyses (ncpha), available http://ncphp.government.bg, 2011. [8] aoac, "moisture in meat. official method of analysis 950.46 of aoac international," 1991. [9] d. a. dobreva, b. galunska, and m. stancheva, "liquid chromatography method for the simultaneous quantification of fat soluble vitamins in fish tissue," scr. sci. med., varna medical university, vol. 43, pp. 276-279, 2011. [10] e. bligh and w. j. dyer, "a rapid method of total lipid extraction and purification," can. j. biochem. phys., vol. 37, pp. 913–917, 1959. [11] en iso 5509, animal and vegetable fats and oils preparation of methyl esters of fatty acids. geneva: international organization for standartization, 2001. [12] en iso 5508, animal and vegetable fats and oils analysis by gas chromatography of methyl esters of fatty acids. geneva: international organization for standartization, 2000. [13] z. e. sikorski and e. k. olakowska, chemical and functional properties of food lipids. boca raton: crc press, 2002. [14] d. larsen, s. y. quek, and l. eyres, "effect of cooking method on the fatty acid profile of new zealand king salmon (oncorhychustshawytscha)," food chem., vol. 119, pp. 785-790, 2010. [15] p. mattila, v. piironen, e. uusi-rauva, and p. koivistoinen, "cholecalciferol and 25-hydroxycholecalciferol contents in fish and fish products," j. food comp. anal., vol. 8, pp. 232-243, 1995. [16] p. mattila, r. ronkainen, k. lehikoinenand, and v. piironen, "effect of household cooking on the vitamin d content in fish, eggs and wild mushrooms," j. food comp. anal., vol. 12, pp. 153-160, 1999. [17] b. ersoy and a. ozeren, "the effect of cooking methods on mineral and vitamin contents of african catfish," food chem., vol. 115, pp. 419-422, 2009. http://www.fao.org/docrep/003/x8576m/x8576m05.htm, http://ncphp.government.bg,/ animal review, 2014, 1(1): 1-10 10 © 2014 conscientia beam. all rights reserved. [18] n. erkan, a. selcuk, and o. ozden, "amino acid and vitamin composition of raw and cooked horse mackerel," food anal. meth., vol. 3, pp. 269-275, 2010. [19] m. gladyshev, n. sushnichk, g. gubabenko, s. demircheva, and g. kalachova, "effect of boiling and frying on the content of essential polyunsaturated fatty acid in muscle tissue of four fish species," food sci., vol. 101, pp. 1694-1700, 2007. [20] a. kolakowska, z. domiszewski, and g. bienkiewicz, "effects of biological and technological factors on the utility of fish as a source of n3 pufa, omega 3 fatty acid research," nova sc. publ., pp. 83-107, 2006. [21] e. w. murphy, p. e. criner, and b. c. gray, "comparison of methods for determining retentions of nutrients in cooked foods," j.agr.food chem., vol. 23, pp. 1153-1157, 1975. [22] l. kalyoncu, yaman.y.a., and d. aktumsek, "determination of the seasonal changes on total fatty acid composition of rainbow trout, oncorhynchusmykiss in ivriz dam lake, turkey," afr. j. biot., vol. 9, pp. 47834787, 2010. [23] s. saglik and s. imre, "ω3–fatty acids in some fish species from turkey," j. food sci., vol. 66, pp. 210-212, 2001. [24] y. özogul, f. özogul, and s. alagoz, "fatty acid profile and fat content of commercially important seawater and freshwater fish species of turkey: a comparative study," food chem., vol. 103, pp. 217-223, 2007. [25] x. su and j. r. babb, "the effect of cooking process on the total lipid and n-3 lc-pufa content of australian bass strait scallops, pectenfumatus," as. pac. j. cl.nutr., vol. 16, pp. 407-411, 2007. [26] w. steffens and m. wirth, "freshwater fish an important source of n-3 polyunsaturated fatty acids: a review," arch. pol. fish, vol. 13, pp. 5-16, 2005. [27] a. simopoulos and l. cleland, "importance of the ratio of omega-6/omega-3 essential fatty acids: evolutionary aspects. omega-6/omega-3 essential fatty acid ratio: the scientific evidence," world rev. nutr. diet., vol. 92, pp. 1-22, 2003. [28] r. j. henderson and d. r. tocher, "the lipid composition and biochemistry of freshwater fish," prog. lip. res., vol. 26, pp. 281-347, 1987. [29] department of health, nutritional aspects of cardiovascular disease: health and social subjects. london, uk: hmso, 1994. bibliography [1] issfal, "recommendations for intake of polyunsaturated fatty acids in healthy adults," international society for the study of fatty acids and lipids, 2014. [2] c. h. s. ruxton, "the benefits of fish consumption," nutr.bull., vol. 36, pp. 6-19, 2011. [3] h. haliloğlu, n. aras, and h. yetim, "comparison of muscle fatty acids of three trout species (salvelinusalpinus, salmotruttafario, oncorhynchusmykiss) raised under the same conditions," tur. j. vet. an. sci., vol. 26, pp. 1097-1102, 2002. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 10 © 2021 conscientia beam. all rights reserved. dietary inclusion of scent leaf meal (ocimum gratissimum) affects immune genes expression in chicken spleen at 28 and 56days ufuoma g. sorhue1+ emenim r. onainor2 adimabua m. moemeka3 irikefe-ekeke e. peterson4 1,2,3department of agricultural education, delta state college of education mosogar, sapele, nigeria. 1email: gtsorhue@yahoo.com tel: +2347036311884 4department of agricultural education, college of education warri, nigeria. (+ corresponding author) abstract article history received: 2 august 2021 revised: 30 august 2021 accepted: 21 september 2021 published: 11 october 2021 keywords inflammation gene expression interleukin1β scent leaf cytokine spleen phytochemicals. this study was conducted to examine the effects of scent leaf meal (ocimum gratissimum) on expression of inflammatory cytokines in the spleen of two chicken strains. a total of 150birds (75 of each strain) were randomly allotted into five dietary treatments at fifteen birds per treatment. birds were fed diet containing varying levels of ocimum gratissimum leaf meal. treatment one (t1) had 0% og, while treatment two (t2), treatment three (t3), treatment four (t4) and treatment five (t5) had 0.5% og, 1.00% og, 1.5% og and 2% og respectively. feed and water was provided adlibitum throughout the feeding trial. three birds were slaughtered from each treatment at day 28 and day 56, spleen samples were collected and stored using rnalater in a -20oc freezer prior to rna extraction. real-time qpcr was performed in 40cycles using the powerup sybr green reagent and analyzed with the 2-∆∆ct method. gene expression data were subjected to two-way analysis of variance. strain effect was significantly different (p<0.05) at both time points. all the genes studied significantly differed (p<0.05) in their expression patterns at 28 and 56days of age. increased inclusion rate of the test ingredients significantly (p<0.05) reduced il1β and nf-kb1, while increasing il10 and nf-kb2. ocimim gratissimum leaf meal shows promise in the regulation of inflammation in chickens and can be used to efficiently replace antibiotics in broiler production. contribution/originality: this work is one of very few studies that have unraveled expression patterns of inflammatory cytokines in chickens subjected to dietary inclusion of scent leaf meal as replacement for in-feed antibiotic, and contributes to existing literature on the role of phytochemical containing plants in immunomodulation in chickens. 1. introduction any direct or indirect damage of intestinal epithelial cells may cause a breakdown in gut barrier and consequentially disruption of normal mucosal immune balance that can potentially lead to uncontrolled chronic intestinal and systemic inflammation [1]. inflammation necessitates cells to hire more cells to the centre of activity by the way of secreting inflammatory cytokines and chemokines, however, delayed inflammation can cause the animal review 2021 vol. 8, no. 1, pp. 10-19. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2021.81.10.19 © 2021 conscientia beam. all rights reserved. https://orcid.org/0000-0001-8061-6662 https://orcid.org/0000-0001-9039-2404 https://orcid.org/0000-0003-2956-0987 https://orcid.org/0000-0001-6986-9060 mailto:gtsorhue@yahoo.com https://www.doi.org/10.18488/journal.ar.2021.81.10.19 https://www.doi.org/10.18488/journal.ar.2021.81.10.19 animal review, 2021, 8(1): 10-19 11 © 2021 conscientia beam. all rights reserved. animals to lose weight due to high energy expended in the process [2]. phytochemicals have been reported to reduce cytokine gene expression il1β, il6 and tnf (pro-inflammatory cytokines) and increase il-10 (antiinflammatory cytokines) in lps-activated cells [3]. phytochemicals also induced molecular changes in nf-kb pathways [4], therefore, applying materials possessing the ability to suppress nf-kb signaling would be promising diet supplements in poultry husbandry since nf-kb supports the expression of different inflammatory cytokines and chemokines, inclusive of genes related to cellular transformation, inflammation, invasion, and metatastasis [5]. the expression of genes related to tissue repair and inflammation is dependent on the time, strength and the site of stimulation, hence when birds are infected, it generates pro-inflammatory cytokines and mitogen that activate the expression of nfkb which is quickly followed by inflammatory cytokines [6].the nf-kb mediated pathways involves many physical reactions and is extremely important in the modulation of immunity, inflammation and apoptosis [7]. interlukin1 (il1β), interleukin 6 (il6) and tumor necreotic factor alpha are three known proinflammatory cytokines expressed in monocytes and macrophages after invasion of pathogens are identified [2, 3]. these cytokines mediates metabolic changes that end up boosting immune response and resistance to diseases, thereby stunting growth and performance [2, 3]. reports indicated a strong relationship between the levels of il1β and the amount of intestinal inflammation in chickens, making il1β the chief cytokine responsible for the initiation and multiplication of the inflammatory responses [8]. on the other hand, il-10 helps in promoting the development of t2 responses which makes it inhibits the synthesis of pro-inflammatory cytokines inclusive of il1β both at the level of transcription and post-transcriptionally, thereby down regulating inflammatory t1 responses and boosting erythrocyte immunity capacity [9]. il-10 is been regarded as the signature member of the cytokines because it modifies immune response through direct effects on many cell types, hence low level of il10 increases resistance in chickens while high levels increases susceptibility to intracellular pathogens since the level of pathogen correlates with the magnitude of tcell response [10, 11]. in chickens, the spleen act as both reservoir and activation site for leukocytes and therefore an analysis of the mrna levels in the spleen should be reliable in ascertaining systemic immune function [12]. there have been great breakthroughs in the past using various techniques and feed additives to achieve more cost effective and higher genetic potentials in poultry production. antibiotics have been in livestock feed including poultry diets for a long period of time to prevent diseases, promote growth and improve feed conversion efficiency [13]. antibiotics have also been known to have antibacterial effect and improved digestibility and performance of birds [14, 15]. the continuous and prolonged use of antibiotics has resulted to deposition of residues in animal products including milk and meat [16] and the resistance among enteric bacteria as well as the transference of antibiotic resistance from livestock to man [17, 18]. these health hazards [19] have led to discontinued use of antibiotics and in some countries, and europe total ban, and this has resulted to a new search for natural alternatives [16]. plant derived products have been reported to contain less toxic substances than antibiotics, and scent leaf (ocimum gratissimum l) is a good example of herbs and spices that possess antimicrobial, antioxidative, anti-inflammatory, as well as immuno-modulatory properties [20]. scent leaf is a leafy vegetable, and good source of dietary fibre, carotenoids, vitamin c, foliate, phytochemicals and certain minerals [21]. phytochemical analysis of the leaf extract shows the availability of steroids, flavonoids, alkaloids, saponins, tannins, terpenoids, cardiac glycosides and anthraquinone [22-24]. there is however, inadequate research information on the effect of ocimum gratissimum on the immunomodulation in the chicken. this study was therefore designed to examine the role of scent leaf meal in the expression of immune genes in chicken spleen. 2. materials and methods 2.1. experimental site, animals and diets the study was carried out at the poultry unit of the teaching and research farms of delta state college of education mosogar. one hundred and fifty (150) day old unsexed and healthy commercial broiler chicks, including 75 cobb 500 and 75 arbor acre strains were sourced from zartech farms, ibadan, nigeria. the birds animal review, 2021, 8(1): 10-19 12 © 2021 conscientia beam. all rights reserved. were raised on deep-litter system, and fed for a period of eight weeks (56 days). feed and water were provided adlibitum throughout the experimental period. scent leaves were harvested from a farm at oki, agbor, in ika south local government area, delta state, nigeria. the leaves were air dried while still showing greenish coloration. the dried scent leaves were hammer milled to obtain a final leaf meal. five (5) experimental broiler starter and finisher diets were formulated, and scent leaf meal was incorporated at the rate of 0.00%, 0.50%, 1.00%, 1.50% and 2.00% dietary levels in five (5) treatments as treatment 1, treatment 2, treatment 3, treatment 4 and treatment 5 respectively. 2.2. experimental design the 150birds were randomly allotted into five dietary treatment groups of 75birds per strain. each strain had 15 birds per treatment. the birds in group i (t1) were given normal medications for broilers [25], while birds in groups ii (t2), iii (t3), iv (t4) and v (t5) had scent leaf meal included in their feed at the rate of 0.50%, 1.00%, 1.50% and 2.00% respectively. 2.3. sample collection three birds from each of the treatment groups were slaughtered at 4weeks (28days) and at the end of the feeding trial 8weeks (56 days) to examine the mrna expression patterns of genes regulating immune responses in chicken. the spleen was collected from the experimental birds and stored in eppendorf tubes with the aid of rnalater solution and stored in a freezer prior to rna extraction. 2.4. rna concentration and reverse transcription rna was extracted from a 25mg tissue in a mixture of 400ul rb buffer and β-mertacaptoethanol. the total rna extraction protocol as contained in geneaid was then followed. the concentration and purity of the isolated rna were assessed by a spectrophotometer (nanodrop) followed by reverse transcription. the 20μl reverse transcription reaction system was comprised of the following: 10 μl of rna, 0.5μl of oligo dt, 0.5μl of random primers, 5 μl of nuclease-free water, 1μl of firescript reverse transcriptase, 0.5μl ribogrip rnas inhibotor, 2μl 10x rt reaction buffer with dtt and 0.5μl of dntp mix. the reaction procedure was performed under the following conditions: denaturation for 5 min at 70°c, primer annealing for 5min at 25°c, reverse transcription at 40oc for 20mins followed by enzyme inactivation at 85oc for 5mins and then storage at 4°c. table-1. primer sequence for real-time pcr. s/n genes f/r primer sequences for chicken ncbi accession number %gc 1 il1b f 5’gtcaacatcgccacctacaa3’ nm_204524.1 50 r 5’cggtacatacgagatggaaacc3’ 50 2 il10 f 5’agctgagggtgaagtttgag3’ nm_001004414.2 48 r 5’aactcatccagcagttcagag3’ 50 3 nfkb1 f 5’cctcaacctcacttccttact c3’ nm_205134.1 48 r 5’cttcagtgtccagtcctttgt3’ 50 4 nfkb2 f 5’gacattgaggtgcggttctat3’ nm_204413.1 50 r 5’gatggcgtactgcttgtgta3’ 50 5 gapdh f 5’cctctctggcaaagtccaag3’ nm_204305.1 45 r 5’catctgcccatttgatgttg3’ 55 note: il1b: interleukin1beta; il10: interleukin 10; nf-kb1: nuclear factor kappa b1; nf-kb2: nuclear factor kappa b2; f: forward, r: reverse; gc: guanine-cytosine content 2.5. real-time polymerase chain reaction table 1 shows the genes, sequences (forward and reverse), guanine-cytocine content, and gene bank accession numbers of the primers used for the study. the mrna expression level of interleukin 1-beta, interleukin 10, nfkb1, and nf-kb2 were measured using a 7500 real-time pcr system with a 20 μl reaction system containing the https://www.ncbi.nlm.nih.gov/nuccore/nm_204524.1 https://www.ncbi.nlm.nih.gov/nuccore/nm_001004414.2 https://www.ncbi.nlm.nih.gov/nuccore/nm_205134.1 https://www.ncbi.nlm.nih.gov/nuccore/nm_204413.1 https://www.ncbi.nlm.nih.gov/nuccore/nm_204305.1 animal review, 2021, 8(1): 10-19 13 © 2021 conscientia beam. all rights reserved. following: 1 μl of cdna, 10 μl of 2× sybr premix dimer eraser, 0.6 μl of each gene specific primer (100 nm) and 7.8μl nuclease free water. the reaction procedure were performed as follows: 1 cycle of 95°c for 30secs followed by 39 cycles of 95°c for 5secs, 60°c for 30secs, and 72°c for 60secs; and 1 cycle of 95°c for 15secs, 60°c for 60secs, 95°c for 30secs, and 60°c for 15secs. 2.6. statistical analysis all data collected were subjected to ordinary two-way analysis of variance (anova) with the prism 7.0 software (graphpad software inc, san diego, california). multiple comparisons were corrected using the bonferroni’s method. 3. results and discussion figure 1 and figure 2, shows the expression patterns of interleukin1β in the spleen of chickens fed varying levels of ocimim gratissimum leaf meal at 28days and 56days in two chicken strains. interleukin1β expression patterns decreased with increased inclusion rate of the test ingredients at 28 and 56 days in both chicken strains. the expression of il1β in the arbor-acre strain was significantly different (p<0.05) for the control and treated groups, but treated groups did not differ significantly (p<0.05) at 56days, while t1 and t2 significantly differed (p<0.05) from t5; t3, t4 and t5 did not significantly differ (p>0.05) from each other at 28days. however, in cobb500, t1 significantly differed (p<0.05) from t1, but not t3, t4 and t5 at 28days and 56days respectively. at 56days, il1β was expressed in 1.5folds and 2.19folds at 0.5% inclusion rate compared to 2% and down-regulated by 0.67folds and 0.46 folds at 2% inclusion rate compared to 0.5% inclusion in the abor-acre and cobb 500 strain. in figures 3, and 4, the relative expression of interleukin10 shows significant differences (p<0.05) for the two strains at both time point, however, expression patterns were inconsistent at all ages in the two strains, while increased inclusion rate increased fold change in abor-acre at 28days and 56days, in cobb500, increased inclusion reduced expression of il10 at 56days, but increased il10 expression at 28days. il10 was expressed in 0.05folds and 5.71folds at 0.5% inclusion rate compared to 2% and up-regulated by 19.43folds and 0.17 folds at 2% inclusion rate compared to 0.5% inclusion in the abor-acre and cobb 500 strain at 56days respectively. figures 5, and 6, shows the expression patterns of nuclear factor kappa b (nf-kb1) in two chicken strains at different time point. the control (t1) was significantly different (p<0.05) from other groups at 28days and 56days in the arbor-acre, while t1 and t2 differed significantly from other groups at 56days in cobb500; t1 and t4, as well as t2 and t3, were not significantly different (p>0.05), but other groups showed significant differences (p<0.05) at 28days. nf-kb1 was expressed in 58.41folds and 2.24folds at 0.5% inclusion rate compared to 2% and down-regulated by 0.02 folds and 0.45 folds at 2% inclusion rate compared to 0.5% inclusion in the abor-acre and cobb 500 strain at 56days. the effect of dietary inclusion of ocimum graticimum leaf meal on expression of nf-kb1 and il10 was not consistent in the experimental birds at both ages, since results shows that increased inclusion did not constantly reduce or increase expression patterns of the gene for the two strains studied. figures 7, and 8, shows the expression patterns of nf-kb2 in two chicken strains at 28 and 56days of age. nf-kb2 was differentially expressed in both time points in the strains studied. non-significant difference (p>0.05) was recorded for t1, t3 and t4, while significant differences (p<0.05) were obtained at 56days, while t1 was not significantly different (p>0.05) from t2 and t3. t3 and t4 followed the same trend, while significant differences (p<0.05) were recorded for other groups at 28days. nf-kb2 expression was not significant for t2 and t3, while other groups reported significant differences (p<0.05) at 56days in the cobb500 strain, but at 28days, t1 and t4, t2 and t3 were not significant (p>0.05), while significant differences (p<0.05) were obtained for other groups. nf-kb2 was expressed in 0.12 folds and 2.44 folds at 0.5% inclusion rate compared to 2% and up-regulated by 8.31folds and 0.14 folds at 2% inclusion rate compared to 0.5% inclusion in the abor-acre and cobb 500 strain respectively. animal review, 2021, 8(1): 10-19 14 © 2021 conscientia beam. all rights reserved. figure-1 & figure-2. relative expression pattern of interleukin 1-beta (il 1b) in the spleen of arbor-acre (a) and cobb500 (c) strains at 28 days and 56 days. abcdebars with different superscript between time points were significantly different (p<0.05), while bars carrying different subscript within same time points were significantly different (p<0.05). 2-way anova test was done with multiple comparisons corrected using bonferroni’s method. figure-3 & figure-4. relative expression pattern of interleukin10 (il 10) in the spleen of arbor-acre (a) and cobb500 (c) strains at 28 days and 56 days. abcdebars with different superscript between time points were significantly different (p<0.05), while bars carrying different subscript within same time points were significantly different (p<0.05). 2-way anova test was done with multiple comparisons corrected using bonferroni’s method. animal review, 2021, 8(1): 10-19 15 © 2021 conscientia beam. all rights reserved. figure-5 & figure-6. relative expression pattern of nuclear factor kappa b1 (nf-kb1) in the spleen of arbor-acre (a) and cobb500 (c) strains at 28 days and 56 days. abcdebars with different superscript between time points were significantly different (p<0.05), while bars carrying different subscript within same time points were significantly different (p<0.05). 2-way anova test was done with multiple comparisons corrected using bonferroni’s method. figure-7 & figure-8. relative expression pattern of nuclear factor kappa b2 (nf-kb2) in the spleen of arbor-acre (a) and cobb500 (c) strains at 28 days and 56 days. abcdebars with different superscript between time points were significantly different (p<0.05), while bars carrying different subscript within same time points were significantly different (p<0.05). 2-way anova test was done with multiple comparisons corrected using bonferroni’s method. animal review, 2021, 8(1): 10-19 16 © 2021 conscientia beam. all rights reserved. 4. discussions knowing full well that birds can ingest feeds that may contain both nutrients and non-nutrient that can pose positive or negative effects, the intestinal wall becomes the first barrier to entertaining such effects. these consumed feeds can cause stress to birds that will trigger immune responses that are caused by the release of pro and anti-inflammatory cytokines. inflammation necessitates cells to hire more cells to the centre of activity by the way of secreting inflammatory cytokines and chemokines, however, delayed inflammation can cause the animals to lose weight due to high energy expended in the process. therefore, to ease and obstruct too much inflammation while bringing the immune system to standard state is vital to livestock production (2). phytochemicals have been reported to decrease the expression of pro-inflammatory cytokines il1β, il6 and tnf and increase antiinflammatory cytokines il-10 in lps-activated cells (3), which is in tandem with the present study as increased inclusion of dietary ocimum gratissimum consistently reduced expression of interleukin1β in the spleen of the two chicken strains studied. the effect of strains in response to dietary levels were significant (p<0.05) at both time points. this is in line with previous studies that cytokine expression differs with type of bird as reported for layers and broilers [26, 27]. this could be attributed to the different responses in the immune systems of the chicken strains to the test ingredients. although lack of sufficient antioxidants to eliminate reactive oxygen species can also trigger inflammation due to oxidative damage [2, 9, 28], hence, while including ingredients that improves antiinflammatory responses in chicken diets, the antioxidant capacity needs to be put into consideration in other to avoid oxidative damages. as a compliment and justification that the test ingredients covers this aspects, earlier reports indicated that compounds from medicinal plants reduced small intestine legions, reduced oxidative stress and improved body weight in chickens challenged with coccidial infection [20, 29]. this study is also in agreement with reports that scent leaf (ocimum gratissimum l) possesses antimicrobial, antioxidative, anti-inflammatory, as well as immuno-modulatory properties [20]. the anti-inflammatory role of scent leaf was evident, as increased inclusion rate consistently down regulated il1β, which is known to be the chief pro-inflammatory cytokine in cells. lactobacillus species was also found to differentially induced il-10 and il1β in spleen cells (8). since one of the biological effects of il-1β is to stimulate inflammation by activating the immune system in an acute phase response [30], dietary inclusion of scent leaf can be used in place of antibiotics to reduce inflammation in chickens thereby curbing stunted growth, excessive energy expenditure, and weight loss in birds. il-10 together with 1l4 helps in promoting the development of t2 responses which makes it inhibits the synthesis of pro-inflammatory cytokines inclusive of il1β, tnf and il12 both at the level of transcription and post-transcriptionally, thereby down regulating inflammatory t1 responses and boosting erythrocyte immunity capacity (9). il-10 is been regarded as the signature member of the cytokines because it modifies immune response through direct effects on many cell types; this corresponds with the present study as results indicated a decrease in the expression of il1β, as il10 levels increased in chicken spleen at 28 and 56days in the experimental birds in both strains studied. ocimum gratissimum increased il10 expression while simultaneously decreasing il1β as observed in the current study. the anti-inflammatory response of the test ingredient is vital for averting weight loss and stabilizing growth rate in chickens if they are eventually faced with pathogen invasion. bearing in mind that il10 is the signature member of anti-inflammatory cytokines, higher amount of inclusion of the test ingredients in the diets of chickens may further strengthen the fight against inflammation in chicken, which invariably will result in body weight and growth stability. the differential expression of cytokines is not new as non antibiotic alternatives have previously been reported to significantly affect cytokine gene expression in coccidia challenged chickens [31]. while nf-kb2 consistently increased with increased inclusion rate of the test ingredient, nf-kb1 expression was affected in no specific direction. reports indicate that phytochemicals have induced molecular changes in nf-kb pathways (4), but the directions and dimensions were unstable in this study. carvacoal, cinnamaldehyde, curcumin and thymol were reported to surpress nf-kb expression [32-35], while our study shows nf-kb1 and nf-kb2 did not progress in the same manner with respect to the test ingredient. earlier studies indicates that nf-kb can be induced and animal review, 2021, 8(1): 10-19 17 © 2021 conscientia beam. all rights reserved. activated by pro-inflammatory cytokines, it has also been shown that nf-kb activation increased production of proinflammatory cytokines that eventually resulted to systemic inflammation during stress period among birds [36]. eimeria tenella challenged birds increased expression of nf-kb together with other pro-inflammatory cytokines in chickens [37]. therefore, reduced il1β and nf-kb1 expression with increased levels of ocimum gratissimum in the diet of the experimental birds is expected to down-regulate the expression of nf-kb2 in this study, but the reverse was the case in the expression of nf-kb2 at 28 and 56 days. more so, applying materials possessing the ability to suppress nf-kb signaling would be promising diet supplements in poultry husbandry since nf-kb supports the expression of different inflammatory cytokines and chemokines, inclusive of genes related to cellular transformation, inflammation, invasion, and metatastasis (5). since the expression of genes related to tissue repair and inflammation is dependent on the time, strength and the site of stimulation (6), the expression of nf-kb1 and nf-kb2 in the current study could have been modulated by the test ingredient in different directions with respect to the nf-kb pathways. 5. conclusion this study further provides information on the anti-inflammatory roles of phytochemical containing plants in the immune system of chickens. it reveals that ocimum graticimum can be used in place of antibiotics in broiler diet, which can reduce the negative effects occasioned by the use synthetic antibiotics. funding: this research work was funded by the tertiary education trust fund grant reference number: tetfund/dess/coe/mosogar/ibr/2015/vol.1 competing interests: the authors declare that they have no competing interests. acknowledgement: all authors appreciate the delta state college of education mosogar, and the management, and staff of african biosciences limited ibadan, for providing them with lab space and reagents. references [1] j. schulzke, s. ploeger, m. amasheh, a. fromm, s. zeissig, and h. troeger, "epithelial tight junctions in intestinal inflammation," annals of the new york academy of sciences, vol. 1165, pp. 294–300, 2009. [2] c. m. huang and t. t. lee, "immunomodulatory effects of phytogenics in chickens and pigs — a review," asianaustralasian journal of animal sciences, vol. 31, pp. 617-627, 2018.available at: https://doi.org/10.5713/ajas.17.0657. [3] k. ghareeb, w. a. awad, c. soodoi, s. sasgary, a. strasser, and j. böhm, "effects of feed contaminant deoxynivalenol on plasma cytokines and mrna expression of immune genes in the intestine of broiler chickens," plos one, vol. 8, p. e71492, 2013.available at: https://doi.org/10.1371/journal.pone.0100051. [4] m. lee, w. lin, s. wang, l. lin, b. yu, and t. lee, "evaluation of potential antioxidant and anti-inflammatory effects of antrodia cinnamomea powder and the underlying molecular mechanisms via nrf2-and nf-κb-dominated pathways in broiler chickens," poultry science, vol. 97, pp. 2419-2434, 2018.available at: https://doi.org/10.3382/ps/pey076. [5] s. c. gupta, c. sundaram, s. reuter, and b. b. aggarwal, "inhibiting nf-κb activation by small molecules as a therapeutic strategy," biochimica et biophysica acta (bba)-gene regulatory mechanisms, vol. 1799, pp. 775-787, 2010.available at: https://doi.org/10.1016/j.bbagrm.2010.05.004. [6] r. ravi, g. c. bedi, l. w. engstrom, q. zeng, b. mookerjee, c. gélinas, e. j. fuchs, and a. bedi, "regulation of death receptor expression and trail/apo2l-induced apoptosis by nf-κb," nature cell biology, vol. 3, pp. 409-416, 2001.available at: https://doi.org/10.1038/35070096. [7] s. e. byeon, y.-s. yi, j. oh, b. c. yoo, s. hong, and j. y. cho, "the role of src kinase in macrophage-mediated inflammatory responses," mediators of inflammation, vol. 2012, pp. 1-18, 2012.available at: https://doi.org/10.1155/2012/512926. animal review, 2021, 8(1): 10-19 18 © 2021 conscientia beam. all rights reserved. [8] b. t. jennifer, j. gong, p. parvizi, and s. sharif, "effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells," clinical and vaccine immunology, vol. 17, pp. 1337-1343, 2010.available at: https://doi.org/10.1128/cvi.00143-10. [9] s.-c. fang, c.-l. hsu, and g.-c. yen, "anti-inflammatory effects of phenolic compounds isolated from the fruits of artocarpus heterophyllus," journal of agricultural and food chemistry, vol. 56, pp. 4463-4468, 2008. [10] k. w. moore, r. de waal malefyt, r. l. coffman, and a. o'garra, "interleukin-10 and the interleukin-10 receptor," annual review of immunology, vol. 19, pp. 683-765, 2001. [11] j. bumstead, n. bumstead, l. rothwell, and f. tomley, "comparison of immune responses in inbred lines of chickens to eimeria maxima and eimeria tenella," parasitology, vol. 111, pp. 143-151, 1995. [12] s. redmond, r. tell, d. coble, c. mueller, d. palić, c. b. andreasen, and s. j. lamont, "differential splenic cytokine responses to dietary immune modulation by diverse chicken lines," poultry science, vol. 89, pp. 1635-1641, 2010.available at: https://doi.org/10.3382/ps.2010-00846. [13] r. engberg, m. hedemann, t. leser, and b. jensen, "effect of zinc bacitracin and salinomycin on intestinal microflora and performance of broilers," poultry science, vol. 79, pp. 1311-1319, 2000.available at: https://doi.org/10.1093/ps/79.9.1311. [14] j. dibner and p. buttin, "use of organic acids as a model to study the impact of gut microflora on nutrition and metabolism," journal of applied poultry research, vol. 11, pp. 453-463, 2002.available at: https://doi.org/10.1093/japr/11.4.453. [15] i. aroniyo, "dietary supplementation of probiotics and symbiotics on intestinal microbial populations and gut morphology of turkey poults," msc. thesis, department of animal science, university of ibadan, 2014. [16] c. t. kamel, tracing modes of action and the role of plant extracts in non-ruminants. in garnsworthy, p. c. and wiseman, j. (eds). recent advances in animal nutrition. nottingham, uk: nottingham university press, 2001. [17] f. onwurah, g. ojewola, and s. akomas, "effect of basil (ocimum basilicum l.) on coccidial infection in broiler chicks," academic research international, vol. 1, pp. 432-442, 2011. [18] s. mathur and r. singh, "antibiotic resistance in food lactic acid bacteria—a review," international journal of food microbiology, vol. 105, pp. 281-295, 2005. [19] b. o. nweze and a. e. nwankwagu, "effects of tetrapleuratetraptera under different feeding regimes on growth performance and gut microbes of broiler chicken," in proc. 35th conf. nig. soc. anim. prod. 14-17 march, 2010. univ. of ibadan, nigeria, 2010, p. 299. [20] a. sofowora, medicinal plants and traditional medicine africa. ibadan. nigeria: spectrum books ltd, 1993. [21] r. b. m. wills, d. graham, and d. joyce, "postharvest: an introduction to the physiology and handling of fruit vegetables and ornamentals," 4th ed australia: cab international, 1998, pp. 15-32. [22] i. i. ijeh, o. u. njoku, and e. c. ekenze, "medical evaluation of xylopiaaethiopica and osimumgratissimum," journal of medical aromatics science, vol. 26, pp. 44-47, 2004. [23] k. o. akinyemi, o. oladapo, c. e. okwara, c. c. ibe, and k. a. fasure, "screening of crude extracts of six medicinal plants used in south-west nigerian unorthodox medicine for anti-methicillin resistant staphylococcus aureus activity," bmc complementary and alternative medicine, vol. 5, pp. 1-7, 2005.available at: https://doi.org/10.1186/1472-6882-5-6. [24] a. c. akinmoladun, e. ibukun, e. afor, e. m. obuotor, and e. farombi, "phytochemical constituent and antioxidant activity of extract from the leaves of ocimum gratissimum," scientific research and essays, vol. 2, pp. 163-166, 2007. [25] ogbongenet, "retrieved from https://www.nairaland.com/2513166/medication-vaccination-time-table-poultry [accessed 6th september 2020]," 2015. [26] o. nielsen, p. sørensen, j. hedemand, s. laursen, and p. h. jørgensen, "inflammatory response of different chicken lines and b haplotypes to infection with infectious bursal disease virus," avian pathology, vol. 27, pp. 181-189, 1998.available at: https://doi.org/10.1080/03079459808419321. http://www.nairaland.com/2513166/medication-vaccination-time-table-poultry animal review, 2021, 8(1): 10-19 19 © 2021 conscientia beam. all rights reserved. [27] l. v. tatiana and k. c. klasing, "divergence of the inflammatory response in two types of chickens," developmental & comparative immunology, vol. 25, pp. 629-638, 2001.available at: https://doi.org/10.1016/s0145-305x(01)00023-4. [28] a. c. siani, m. c. souza, m. g. henriques, and m. f. ramos, "anti-inflammatory activity of essential oils from syzygium cumini and psidium guajava," pharmaceutical biology, vol. 51, pp. 881-887, 2013.available at: https://doi.org/10.3109/13880209.2013.768675. [29] r. wallace, w. oleszek, c. franz, i. hahn, k. baser, a. mathe, and k. teichmann, "dietary plant bioactives for poultry health and productivity," british poultry science, vol. 51, pp. 461-487, 2010.available at: https://doi.org/10.1080/00071668.2010.506908. [30] p. wigley and p. kaiser, "avian cytokines in health and disease," brazilian journal of poultry science, vol. 5, pp. 1-14, 2003.available at: https://doi.org/10.1590/s1516-635x2003000100001. [31] l. hang, s. a. adedokun, l. adeola, and k. m. ajuwon, "anti-inflammatory effects of non-antibiotic alternatives in coccidia challenged broiler chickens," the journal of poultry science, vol. 51, pp. 14-21, 2014.available at: https://doi.org/10.2141/jpsa.0120176. [32] y. zou, q. xiang, j. wang, j. peng, and h. wei, "oregano essential oil improves intestinal morphology and expression of tight junction proteins associated with modulation of selected intestinal bacteria and immune status in a pig model," biomed research international, vol. 2016, pp. 1-11, 2016.available at: https://doi.org/10.1155/2016/5436738. [33] f. roth-walter, a. moskovskich, c. gomez-casado, a. diaz-perales, k. oida, j. singer, t. kinaciyan, h. c. fuchs, and e. jensen-jarolim, "immune suppressive effect of cinnamaldehyde due to inhibition of proliferation and induction of apoptosis in immune cells: implications in cancer," plos one, vol. 9, p. e108402, 2014.available at: https://doi.org/10.1371/journal.pone.0108402. [34] a. lubbad, m. oriowo, and i. khan, "curcumin attenuates inflammation through inhibition of tlr-4 receptor in experimental colitis," molecular and cellular biochemistry, vol. 322, pp. 127-135, 2009.available at: https://doi.org/10.1007/s11010-008-9949-4. [35] g. kavoosi, j. a. teixeira da silva, and m. j. saharkhiz, "inhibitory effects of zataria multiflora essential oil and its main components on nitric oxide and hydrogen peroxide production in lipopolysaccharide-stimulated macrophages," journal of pharmacy and pharmacology, vol. 64, pp. 1491-1500, 2012.available at: https://doi.org/10.1111/j.20427158.2012.01510.x. [36] p. f. surai, i. i. kochish, and m. t. kidd, "redox homeostasis in poultry: regulatory roles of nf-κb," antioxidants, vol. 10, p. 186, 2021.available at: https://doi.org/10.3390/antiox10020186. [37] h. jin, y. haicheng, z. caiyun, z. yong, and w. jinrong, "the expression of nf-kb signaling pathway was inhibited by silencing tgf-b4 in chicken iecs infected with e. tenella," brazilian journal of poultry science, vol. 22, pp. 1-8, 2020.available at: http://dx.doi.org/10.1590/1806-9061-2020-1338. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://dx.doi.org/10.1590/1806-9061-2020-1338 11 † corresponding author © 2014 conscientia beam. all rights reserved. effects of cotton gin trash level on the performance of desert lambs in new halfa area, kassala state, sudan asma h.m.hamed1† --amani a. b. osman2 --mohmed e. elimam3 1department of animal production, faculty of agricultural and environmental sciences, university of gadarif, gadarif, sudan 2department of animal production, faculty of agriculture and natural resources, kassala university, halfaelgadida, sudan 3goat research centre, faculty of agricultural sciences, university of gezira, wad medani, sudan abstract an experiment was conducted to evaluate cotton gin trash(cgt) as a feed for shugor desert lambs in new halfa area in the butana plain, kassala state, sudan. cotton gin trash has high ee and cp and the proximate analysis (%) is 98.67, 18.25, 22.70, 38.35, 8.20 and 12.50 for dm, ee, cf, cp, ash and nfe, respectively. these residues cause environmental problem when it is not well exploited. fifteen shugor desert lambs about 8-10 month old weighing 26.5 kg in average were divided to three groups and fed isocaloric and isonitrogenous rations with 0, 10% and 20% cgt for 6 weeks. daily feed intake increased significantly (p≤0.05) with increasing cgt in rations (1.12, 1.30 and 1.37 kg at 0, 10 and 20% cgt, respectively).final body weight increased with cgt in rations, but not significantly (p≥ 0.05) and were 34.66,34.76 and 36.90 kg , respectively. weight gain increased with increasing cgt in rations, but not significantly(p≥ 0.05).they were 7.72, 7.78 and 9.98 kg at 0,10 and 20%cgt, respectively. feed conversion ratio improved with increasing cgt in rations and were 7.80, 6.54 and 6.03 at 0,10 and 20%cgt, respectively. the results showed that cgt had good nutritive value and improved sheep feed intake, performance and feed conversion ratio and should be promoted. keywords: cotton gin trash, residues, desert lambs, performance, nutritive value, sudan. contribution/ originality this study is one of very few studies which have investigated the effect of different levels of cotton gin trash on the performance of sudanese desert lambs.the papers primary contribution is finding that cotton cotton gin trash had good nutritive value and improved sheep feed intake, performance and feed conversion ratio. animal review 2014 vol. 1, no. 1, pp. 11-16 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(1): 11-16 12 © 2014 conscientia beam. all rights reserved. 1. introduction the demand for sheep meat increases substantially in the sudan due to increased local consumption because of urbanization and improved living standards. in addition it was increased due to increased exports due to superior meat quality, reputed breeds and animals rely mainly on rangelands. furthermore, no growth promoters or feed additives, especially of animal origin, are used as they affect human and animal health. sheep production is very important in new halfa area in the butana plain in kassala state, sudan due to high population, reputed breeds and socioeconomic contribution [1]. new halfa scheme is 68880 ha in area where cotton, wheat, sorghum and sugar cane are grown with abundant crop residues for animal feedings. nutrition is among the main constraints for sheep production in new halfa area which is located in the poor savanna because of rangeland deterioration for many reasons [1, 2]. furthermore, seasonal rainfall led to seasonal variations in feeds quantity and quality with serious shortages in the dry season and serious effects on animals health and performance [3]. agroindustrial by products, especially crop residues, are used to fill the nutritional gap, but generally have low nutritive value due to low cp and high cf limiting animals intake and performance. furthermore, concentrates are not generally fed to improve sheep performance [3]. high costs of high quality conventional feeds are limiting factors to improve sheep production in new halfa area and it is vital to exploit low cost unconventional feeds to reduce costs and enhance profits and market competition. recently mesquite(prosopis juliflora) pods were fed to desert sheep in new halfa area [1].cotton is an important crop in new halfa area, and cotton gin trash (cgt) is a byproduct of cotton ginning. cotton gin trashes composed of fragments of burs and stems, immature cotton seed, lint, leaf fragments and dirt [4]. it has serious environmental impacts such as setting fires [5] and is used for energy, soap, plastics and pesticides [6] and as animal feed [4]. it is palatable as sorghum silage for feedlot cattle [7]. cotton gin trash composition varies greatly [4] and the nutritive value is affected with many factors including variety, region and harvest methods bader, et al. [8]. whole cotton seed is a good source for protein and energy and may reach 25.4% cp and 90% tdn [9]. the proximate analysis in the sudan was 29.9% cp, 15.6% ee, 24.9% cf, 22.7% ash and 21.8% lignin [5]. it had 12.4 cp, 60.8 adf and 69.2 % ndf in usa [10]. myer [4] stated that cgt low feed value was due to high lignin and ash and low cp and energy (tdn) and the feeding value was similar relative to low quality bahia grass or bermuda grass hay. some trials showed that rations with 70% cgt had accepted gains in lambs and steers [11]. it improved weight gain in grazing steers, but the performance was lower than a commercial supplement [12]. in steers, dmi and weight gain were significantly higher when fed cgt compared to groundnut hulls [10]. it was considered best for mature and pregnant beef cows [4]. residues in cgt are not likely to affect animals health or products [13]. cotton gin trash is used traditionally in feeding ruminants in the sudan with limited available information [5]. this worker used different levels of cgt in fattening desert lambs (0, 25, 40 and 55%) for 10 weeks and found that feed intake, weight gain and feed conversion ratio were improved up to feeding 40% cgt with no negative effects. it is important to exploit the animal review, 2014, 1(1): 11-16 13 © 2014 conscientia beam. all rights reserved. huge amounts of cgt in new halfa area in sheep feeding to avoid environmental hazards and improve animals nutrition and performance. however, there is no available information on using cgt in fattening shugor desert lambs in new halfa area, and consequently this experiment was launched to furnish this vital information. 2. materials and methods the experiment described below was conducted in the animal production farm, faculty of agriculture and natural resources, kassala university in new halfa, kassala state, sudan from may to july2011. it is located at latitude 15° 19'n and longitude 35°36'e and is about 560km from khartoum. the mean temperature and annual rainfall was 30◦ and 250-300mm, respectively. 2.1. animals fifteen shugor desert lambs of about 8-10 month old and weighing 26.5 kg in average were bought from new halfa livestock market and used to study the effects of different levels of cgt in rations on their performance. they were transported by car to the farm in new halfa. the animals were rested, watered, ear tagged and housed in individual pens with water and feed troughs. they were vaccinated against prevalent diseases and treated with bendazol against internal parasites and gamatox against external parasites. they were injected with oxyteracyline20%. the animals were weighed using a 100kg weighing machine and divided according to body weight into three groups. the range of body weights was 24.6-28.4kg and its average was 26.5kg.the animals groups were allocated at random to the three experimental rations. 2.2. feeds and feeding the animals were fed dried abu sabeen (sorghum bicolor) ad libitum and changed gradually to the experimental rations in 15 days. they were then fed rations a, b and c with different levels of cgt (0, 10 and 20%, respectively). table1 shows the ingredients of the isocaloric and isonitrogenous rations fed to lambs with different levels of cgt. preweighed amounts of the rations (2kg/animal/day) were offered in one meal at 8.00am for 6 weeks. in addition they were offered fresh green barseem once weekly as a source of vitamin a. the refusals were collected for each animal before the morning meal and weighed. samples of cgt were collected, stored in polyethylene bags and used for proximate analysis. the animals were weighed weekly early in the morning after 12 hrs fasting to reduce the variations in gutfill. daily feed intake and feed conversion ratio were calculated. 2.3. laboratory analysis samples of cgt were grinded and analyzed in triplicates for dry matter (dm), ether extract (ee), crude fibres (cf), crude protein (cp) and ash as described by aoac [14]. animal review, 2014, 1(1): 11-16 14 © 2014 conscientia beam. all rights reserved. 2.4. statistical analysis the data was statistically analyzed using completely randomized design and duncan’s multiple range test was used to test differences among means as described by snedecor and cochran [15]. 3. results and discussion table 2 shows the proximate analysis of cgt in new halfa area. it had high ee and cp and moderate cf and was similarly a good source for protein and energy [9]. ether extract, cp and ash were higher and cf was lower than that reported in the sudan by khalafalla [5]. it had higher cp, ee and ash and lower cf than that in usa [4]. crude protein was higher than that in usa [9, 10]. the high variations in cgt proximate analysis among workers were also reported by myer [4] and could be due to variations in cotton varieties, soils and soil and leaves contamination. in addition bader, et al. [8] stated variety, region and harvest methods as reasons for the variations in cgt composition. feed intake varied significantly (p≤0.05) among rations and was highest in diet c (table 3). the increased feed intake with increasing cgt level in feeds was also found up to 40% cgt in desert sheep in the sudan [5] and may be due to cgt palatability. weight gain tended to increase with increasing cgt in rations, but not significantly (p≥0.05). this may be attributed to increased feed intake with increasing cgt level. similar results were found by khalafalla [5]. feed conversion ratio was improved with increasing cgt in rations, but not significantly (p≥0.05). this could be attributed to increased feed intake and weight gain with increasing cgt level. similar results were reported in desert sheep [5]. the results showed that cgt up to 20% in rations had good nutritive value and improved lambs performance and should be promoted in new halfa area. references [1] a. a. b. osman and m. e. elimam, "the effects of different levels of mesquite (prosopischilensis) pods on the performance of shugor lambs in halfa elgadeda, kassala state, sudan," gezira journal of agricultural sciences, vol. 10, pp. 95-101, 2012. [2] a. h. mohamed, "evaluation of some range plants for goats in the rahad area, butana plain, sudan," m.sc. thesis, department of animal science, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2001. [3] h. m. h. asma, "upgrading and the utilization by nubian goats of some crop residues in the sudan," ph. d thesis, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2007. [4] r. o. myer, cotton gin trash: alternative roughage feed for beef cattle. document an177, animal sciences department, florida cooperative extension service: institute of food and agricultural sciences, university of florida. avialable: http://edis.ifas.ufl.edu, 2007. http://edis.ifas.ufl.edu/ animal review, 2014, 1(1): 11-16 15 © 2014 conscientia beam. all rights reserved. [5] m. k. khalafalla, "effect of dietary level of cotton gin trash on nutrients utilization and performance of sudan desert lambs," m.sc. thesis. (anim. prod.), university of khartoum, khartoum north, sudan, 1988. [6] h. a. tayfour and z. h. rashid, oilseed crops, 1st ed. iraq: maousil, 1990. [7] e. s. erwin and c. b. roubicek, "utilization of cotton gin trash by growing and fattening steers," j. anim. sci., vol. 17, pp. 133-139, 1958. [8] m. j. bader, r. k. bramwell, r. l. stewart, and g. m. hill, "gin trash studies conducted in georgia," beltwide cotton production research proceedings, vol. 2, pp. 1698-1699, 1998. [9] nrc, nutrient requirements of beef cattle. washington, dc, usa: national academy of science, national research council, 2000. [10] j. b. kennedy, "evaluation of cotton gin trash as a roughage source for stocker cattle," m. sc thesis, auburn university, alabama, usa, 2006. [11] d. l. arndt, c. r. richardson, r. c. albin, and l. b. sherrod, "digestibility of chemically treated cotton plant by-product and effect on mineral balance, urine volume and ph," j. anim. sci., vol. 51, pp. 215-223, 1980. [12] c. villalobos, c. m. britton, m. avila, r. richardson, g. holt, and g. bezanilla, "cotton byproducts supplementation for steers grazing tobosa grass (hilariamutica[buckl.] benth.) rangeland," the texas journal of agriculture and natural resource, vol. 22, pp. 7-16, 2009. [13] r. l. stewart, m. j. bader, and g. h. harris, "the evaluation of cotton gin trash as a cattle feed," university of georgia, animal & dairy science annual report, 1998. [14] aoac, official methods of analysis, 15th ed. arlington, virginia,usa: association of official analytical chemist, inc, 1990. [15] g. snedecor and w. g. cochran, statistical methods. ames, iowa, u.s.a.: iowa state university press, 1980. table-1. the ingredients and calculated energy and crude protein of rations with different levels of cotton gin trash (cgt)fed to shugor desert lambs in new halfa, kassala state, sudan. rations ingredients c 20 b 10 a 0 cgt (%) 20.5 24 25 sorghum grains 03.5 11 18 groundnut cakes 25 25 25 molasses 13 13 16 wheat bran 16 15 14 groundnut shells 10 01 01 salt 01 01 01 lime stone 11.40 11.43 11.34 metabolizable energy (mj\ kg dm) 16.50 16.50 16.48 cp (%) animal review, 2014, 1(1): 11-16 16 © 2014 conscientia beam. all rights reserved. table-2.the proximate analysis (%) of cotton gin trash in new halfa area, kassala state, sudan. 98.67 dry matter 18.25 ether extract 22.70 crude fibres 38.35 crude protein 08.20 ash 12.50 nitrogen free extract table-3. the performance of shugor desert sheep fed ratios with different levels of cotton gin trash in new halfa, kassala state, sudan rations parameters significance se c b a 20 10 0 cgt (%) ns 1.20 26.92 26.98 4926. initial bw (kg) ns 1.73 36.90 34.76 34.66 final bw (kg) * 0.06 1.37c 1.30b 1.12a feed intake (kg|day) ns 0.94 9.98 7.78 7.72 weight gain (kg\head) ns 1.12 6.03 6.54 7.80 fcr cgt= cotton gin trash; bw= body weight;fcr= feed conversion ratio (kg feed|kg weight gain);ns= non significant differences at p>0.5; *= significant differences at p<0.05; different letters denote significant differences among means at p<0.05. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 12 © 2018 conscientia beam. all rights reserved. the potential effect of zinc deficiency on reproductive profile of male rat and its possible consequences aamir nawab1 yi zhao2 fahar ibtisham3 guanghui li4 mei xiao5 jiang wu6 wenchao liu7 shuyan tang8 lilong an9+ 1department of veterinary medicine, agricultural college, guangdong ocean university, zhanjiang 524088, guangdong, china; faculty of veterinary medicine, pmas_arid agriculture university rawalpindi, pakistan 2,3,5,6,7,8,9department of veterinary medicine, agricultural college, guangdong ocean university, zhanjiang 524088, guangdong, china 4department of animal science, agricultural college, guangdong ocean university, zhanjiang 524088, guangdong, china (+ corresponding author) abstract article history received: 9 august 2018 revised: 13 september 2018 accepted: 17 october 2018 published: 19 november 2018 keywords zn deficiency testes spermatogenesis luteinizing hormone sperm physiology male rats zinc (zn) has antibacterial and antifungal properties, so, it is being widely used in food and pharmaceutical industries. transition metal especially zn deficiency has deleterious effects all over the world due to wide consumption of zn deficient food byproduct. several studies have reported that transition elements especially zinc deficiency affects the endocrine and reproductive system. this overview comprises the information about negative effects of zn deficiency on reproductive system of male rat and their possible outcomes. scientific studies indicated that zn deficiency severely affects the reproductive physiology of male rats. zn deficiency suppresses the function of male rat testes inclosing spermatogenesis and steroidogenesis by reducing the production of androgen hormone. in addition, zn deficient rats also indicated testicular atrophy, primary and secondary spermatogonial stem cells disruption, lower number of sperm cells count, sperm quality, motility, viability, enhance in oxidative stress, inhibition of testosterone (t) level which, in turn may cause infertility. the different consequences in animal models by zinc application are dose and duration dependent. several studies propose that both higher and lower zn concentration can effects the rat reproductive function. therefore, the available outcomes revealed that zn deficiency might have significant influence on luteinizing hormone and follicle stimulating hormone affecting the sperm physiology and histology in certain tissues. contribution/originality: this recent study has contributed significant scientific information on a particular subject area ―zinc deficiency‖. a lot of reports have discussed the zinc and its effects on human but there is lack of sufficient data related to zn deficiency on reproductive profile of male rats. therefore, this study is one of very few studies which have documented that zinc is necessary in male reproductive system of human and animals. on the other side, it is recommended that optimum amount of zinc supplementation should be used to avoid the deleterious effects on male reproductive physiology. animal review 2018 vol. 5, no. 2, pp. 12-21 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2018.52.12.21 © 2018 conscientia beam. all rights reserved. https://www.doi.org/10.18488/journal.ar.2018.52.12.21 animal review, 2018, 5(2): 12-21 13 © 2018 conscientia beam. all rights reserved. 1. introduction human, animal and aquatic lives are exposed to certain metals, through different sources. some of these metals and their oxide are lethal to health inclosing reproductive health and few are important in trace quantity for numerous physiological functions of the body. in 1746, zinc (zn) was discovered by german chemist and it is reported as the second most abundant transition metal in the animal body and it is the only element which seems in all enzyme classes [1]. it cannot be synthesis in the body [2] and needs daily dietary intake to meet the physiological requirements. zn importance has been recognized many years ago. in biological system, it plays structural, regulatory or catalytic roles in more than 200 enzymes [3]. zn is an essential element of unique biologic and public health significance [4]. zn as an important mineral is essential for animals [5] plants [6] and microorganisms [7]. it is reported that zn is necessary for immune function, dna replication, rna polymerases and some other metabolic processes [4]. another structural role of zn is in protein synthesis, cell replication and growth processes. zn is necessary for testicular maturation, wound healing, immunocompetence and neurological function [8]. it is also required for reproduction [9] gene expression [10] ossification [10] photochemical procedures of vision [11] and antibody production [12]. in addition, zn is counted in many nutritional supplements [13]. studies reported that zn is also required for normal condition of epidermis, epithelium, skin and hooves [14]. another study reported that in mammalian genomes about 3 to 10 % of all proteins are considered to bind zinc for holding, activity and conformational changes [15]. in 1934, first time it was reported that zn was essential for normal growth in rats [16]. after 25 year, some authors reported that zn deficiency were detected in chicks hatched from hens, fed zn-deficient (zd) diets and were died 4 days after birth [17]. the chicks were described by various skeletal defects and structural abnormalities of brain [18]. several authors [19] stated that rats fed a zn-deficient (zd) feed had a fewer live fetuses/litter, and were low body weight, and several skeletal and soft tissues anomalies [19]. there were common abnormalities of development, deformities of the brain, lungs, heart, and urogenital system. in addition, it comprised the misshaped heads and fused or misplaced digits of the feet. zn deficiency has been recognized in small laboratory animals, domestic animals, minks, and monkeys. zn deficiency in mammals reported reduced food intake, growth retardation, testicular atrophy, swelling of feet, skin lesions, hair loss and hindered reproduction [18, 20]. another study in human reported that chronic zn deficiency is connected with immature testes, delayed sexual maturity, lack of appetite, immunosuppression, dwarfism, night blindness, spleen and liver abnormalities, reduced secretion of luteinizing hormone (lh) and folate deficiency [14, 21, 22]. on the other hand, zn is thought to be an important ingredient in male reproductive system of the human and animals. therefore, the aim of this review was to analyze the effect of zn deficiency on reproductive profile of male rat and their promising consequences. 1.1. zn deficiency and its adverse effects the surprising increase in the demand of zn is mostly ascribed due to its superior antibacterial properties [22]. it has been reported that due to antimicrobial properties zn is being utilized in the food industry as packaging and additives agent [23]. on the other hand, zn deficiency has been documented in humans and a wide range of animals (table 1). it shows severe effects on all phases of growth and male reproductive system in an adult. in marine invertebrates, zn plays a significant role in ph regulation of sperm. a report of semen examination described that zn deficiency less than 6.5 µg/l badly affected sperm motility and ph in horseshoe crab (limulus polyphemus), sea urchins (strongylocentrotus purpuratus), and starfish [7]. zn deficiency causes injurious effects on esophagus, kidney, bone and testes of rats, and it is reported that in bone and plasma, alkaline phosphatase (alp) activity is reduced in zd pigs, cows and rats [22, 24]. animal review, 2018, 5(2): 12-21 14 © 2018 conscientia beam. all rights reserved. table-1. effects of zn deficiency on different species species organs dose toxicity reference mouse reproduction 1.5 and 2.5 g/100 ml zinc sulfate (znso4) reduced sperm count and motility, spermatic arrest. affect the seminiferous tubules and fibrosis in interstitial tissue nicholas and caldart [22] rat reproduction 7.50-15 and 30 mg/kg bw daily zinc chloride (zncl2) decreased sperm count and viability dissanayake, et al. [25] human reproduction 0.5 mg/kg bw daily zn have inverse relationship with testosterone (t) production manzoor, et al. [26] source: kumari, et al. [27] zn deficiency is associated with abnormal testicular function in humans and animals and appears to be necessary for spermatogenesis and sperm production [27]. an adult male fed zd diet, reported testicular lesions and decreased weight of male accessory sex gland [18]. hypogonadism and testicular atrophy is reported in zd rats and it causes the spermatic arrest, atrophy of seminiferous tubules and interstitial cells, decreased testosterone (t) levels and serum testicular zn concentrations [28]. in leydig cells, zn is necessary for normal testosterone metabolism. calcitonin hinders flow of zn in the isolated rat leydig cell, but these sound effects take more than 2 days and are reported only in zn deficiency [6]. during maturity of rats, zn deficiency reduces the action of dipeptidyl carboxypeptidase (dcp) enzyme in the testes and epididymis; this dcp is essential for maturation of sperm cells and decreased activity of dcp may cause delay in sexual maturity [29]. the literature findings demonstrated that both zn higher and lower concentration may act as testicular toxicant in mice [30]. but, it also has been observed that excess dietary zn may cause subnormal growth, anemia and reproductive failure in rats. 1.2. effect on male reproductive system nutritional status plays an energetic role in human and animal reproduction (table 2). there are some trace elements especially zn is considered an essential ingredients for the optimal performance and normal productivity in male reproductive system. hypogonadism is noticeable characteristic of severe zn deficiency detected in the young and growing male rats [5]. in 1961 and 1963, prasad reported the first case of zn deficiency in humans [22, 31]. hypogonadic dwarfism was recorded in iranian and egyptian children. prasad proved that this was due to zn deficiency. another study reported that mild zn deficiency causes the oligospermic sterility and inability in rats and men. these effects have been observed in subjects with drepanocytosis [32] and dialyzed uremia [5]. several authors examined that oligospermia was observed in 4/5 men on a limited 30-week diet containing only 4 mg of zn [24]. in all these anomalies, it is detected that zd diet below the average supplementation has deleterious effects on reproductive profile of human and male rats. table-2. role of zn in spermatogenesis phase of spermatogenesis role of zn reference initial phase of spermatogenesis role in ribonuclease (rnase) reaction cuevas and koyanagi [5] medium phase of spermatogenesis spermatozoa development and role in preservation of germinal epithelium and seminiferous tubule cuevas and koyanagi [5] final phase of spermatogenesis increase sperm motility cuevas and koyanagi [5] source: cuevas and koyanagi [5] animal review, 2018, 5(2): 12-21 15 © 2018 conscientia beam. all rights reserved. 1.3. effect on testicular growth the testicles have main role in sperm production (table 3). the seminiferous tubules are considered as the structural and functional unit of testicles and weight of testes depends on the number of seminiferous tubules. fertility is highly associated with testicles size and poor fertility often being linked with small testicles, because the process of spermatogenesis take place in the seminiferous tubules and less testicles weight is considered due to lower number or length of seminiferous tubules [33]. table-3. function of male reproductive system male reproductive organs function reference testes testosterone (t) production ibtisham, et al. [21] epididymis (caput, corpus and cauda) sperm development, storage and motility ibtisham, et al. [21] vas deferens, accessory sex glands and penis sperm ejaculation into vagina (female reproductive tract) ibtisham, et al. [21] source: ibtisham, et al. [21] it is reported that in rats zn deficiency decreases the diameter of seminiferous tubules and also both the basal and luminal areas. severe atrophic variations in spermatogenic cells has been described in zd animal and deterioration of the cellular layer of the seminiferous tubules [13]. according to previous literature, zd rats may cause the decrease in tubular diameter and decrease in the number of germinal cells and sertoli cells. in rats [26] and men [5] zn deficiency has been found to be associated with low testosterone (t) levels. in rats, testicular atrophy was recorded due to zn deficiency [5]. in rats and boars, zn deficiency may involve in decreasing the growth and development of accessory sex glands. scrotal size has been shown to be correlated to testicular weight and testicular weight has also been associated to sperm production [23]. taken together, in zd rats, it has been found that there is an obvious decrease in testosterone (t) levels, seminiferous tubular diameter and in the weight of male sex organs. 1.4. effect on spermatogenesis previous studies in hypophysectomized rats clearly explained that follicle stimulating hormone (fsh) and t are main factors for the regulation of spermatogenesis [34]. fsh requires for the development of the undeveloped testes by proliferation of sertoli cells and later development of a and b spermatogonial stem cells [6]. t alone can play an important role in spermatogenesis, but the synergistic role of fsh is essential to stabilize the characteristics of spermatogenesis [34]. zn deficiency impairs the process of spermatogenesis by different pathways. it has been reported that in testes of rats, zn deficiency has been linked with testicular atrophy, destruction of testicular cells and testicular function of steroidogenesis [4]. zn deficiency also has been associated with low t level, which provides a strong proof that zn plays a key role in the production of t, because t is produced and secreted from leydig cells, so zn deficiency may be involve in apoptosis of the leydig cells. t is considered an important hormone for spermatogenesis. as a result, in primary stages of spermatogenesis, zn deficiency may be linked with apoptosis of testicular cells, as well as spermotocyte maturation phase, causing impairment in the late phase of spermatogenesis [33]. another study reported that increased oxidative stress, high serum malondialdehyde (mda) and high tumor necrosis factor-alpha (tnf-α) and low levels of total antioxidant activity, serum superoxide dismutase (sod) and alpha-tocopherol was associated in zd animals. some factors that incidentally increase the oxidative stress by reducing the capacity of cells to resist oxidation will also causes the apoptosis [35]. in light microscopy, zn deficiency has described the spermatogenic arrest at the phase of round and elongated spermatids. this displays that high lipid peroxidation hinder the consequence of spermatogenesis, as confirmed by microscopic examination of apoptosis in the sertoli cell linked with oxidative stress and zn deficiency. animal review, 2018, 5(2): 12-21 16 © 2018 conscientia beam. all rights reserved. it has been reported in rat study, that zn deficiency is associated with stress and elevated cortisol levels. stress can affect the spermatogenesis due to variable t secretion. a new invented gonadotropin-inhibitory hormone has an inhibitory effect on the hypothalamic–pituitary gonadal axis (fig. 1). decrease in t levels has been reported due to inhibition of the hypothalamic–pituitary gonadal axis, which may causes the variations in sertoli cells and tightest barrier (blood-testis barrier), as a result which may affects the spermatogenesis. therefore, due to zn deficiency, oxidative stress, apoptosis and reduced t production is connected with impaired process of spermatogenesis. these outcomes propose that zn deficiency influence the reproductive system of male rats. 1.5. effect on sperm morphology the main factor in the semen examination is the sperm morphology. sperm motility plays a fundamental role in the fertilization, because abnormal sperm impaired the fertility and leading conception more difficult. zn is considered an important ingredient in the quality; quantity and growth of sperm, but their deficiency produce several sperm morphological abnormalities. zn deficiency causes the reduction of t [5] and may also involve in the degenerative variations. a recent study reported that abnormal morphology is due to proliferation of the axonemedense fibre-mitochondria complexes. in rats, the same variation was found after fe treatment [13]. in rats testes, high fe content and lipid peroxidation was recorded due to zn deficiency [36]. hence, this structural variation can be described by high oxygen free radicals formation, which is induced by fe [7]. another study detected that structural abnormalities are due to irregular arrangement of outer dense fibres (odf) like uncoiling and flattening shape (fig 2). these abnormalities were not present in fe-treated rats testes. 90% of the sperm zn is attach to sh-groups of odf [37]. thus, due to zn deficiency, zn may be detached from sh-groups of odf followed by their structural alteration leading to uncoiling and flattening. in addition, odf consist of two [37] or more than two proteins [36] with diverse molecular mass and amino acid composition. the proteins are connected by ss-bond and display a keratin-like structure [37]. odf may provide elasticity in sperm circulation [37] and may provide safety in mammalian sperm against impairment [38]. the uncoiled and flattened dense fibres in zn deficiency may also considered as functionally damaged. from clinical point of view, these results have more importance. infertile men show a high quantity of sperm with abnormally developed odf [36] and orally zn intake has enhanced sperm motility in infertile men with astenospermia and oligospermia [39]. but, in another research this outcome of zn treatment was not observed [20]. in male, sperm morphology exhibited a minor increase in round sperm head due to zn deficiency [23]. sperm with increased axonemedense fibre-mitochondria complexes were not explained. but, it is detected that it may be due to mild zn deficiency [23] or abnormal sperm which were reduced during maturation and so could not be seen. a similar study showed that essential fatty acid composition is influenced by zn deficiency in rats testes. this altered fatty acid may involve in reduction of testicular function, spermatogenesis and androgenesis. these results suggest that zn deficiency linked with abnormal testicular function is followed by alterations in membrane fatty acid composition, and thus affects the sperm integrity. however, the specific function of this process is remained unclear. it is thought that it can be due to arrested spermatogenesis or testicular necrosis. additionally, abnormal sperm motility was found in the japanese eel and goat due to decreased zn concentration in feed [11, 40]. sertoli and leydig cells showed insignificant morphological changes. in control study, rats testes did not show any morphological changes. 1.6. effect on histopathology the testes are the main organs of the male reproductive system. they consist of seminiferous tubules, sertoli cells and leydig cells [41]. in the presence of luteinizing hormone (lh), leydig cells are responsible for production figure.1; near here https://en.wikipedia.org/wiki/luteinizing_hormone animal review, 2018, 5(2): 12-21 17 © 2018 conscientia beam. all rights reserved. of androgen, like testosterone (t). fsh involves in the development of the immature testis by proliferation of sertoli cell and later spermatogonial stem cells [7]. t alone can play an important role in spermatogenesis, but the synergistic role of fsh is essential to normalize the process of spermatogenesis [35, 42]. deficiency of zn has negative effect on the reproductive profile of humans and animals and it is an enormous problem to nutritionist. normal histology of testes depends on normal testicular functions (spermatogenesis and steroidogenesis). in histopathological examination, it has been reported that zd rat presented a number of abnormalities, compared to control group [41] which may affect sperm physiology. a study on zd rat showed cytological degenerative changes in germ cells of seminiferous tubules, leading to less number of germ cell, sertoli cells, interstitial cells, primary and secondary spermatogonia, and spermatocytes (sperm cells). histological study carried by ashrafi, et al. [3] reported that zn deficiency in rats, explained the atrophy of seminiferous tubules in some zd rats. an 8-week feeding trials have been conducted, containing a total of 22 zd (zn-deficient) and 19 zc (zn-control) male rats. in histological examination, the testes of rats after 8-weeks on zd diet again verified the previous results of several authors [3]. complete or partial degeneration of the germ cells epithelium had examined in 17/22 rats. it was clear that the matured testes composed of healthy tubule and consists of a less number of sperms in the epididymis. apparently healthy but immature testicular tissue was present in 3 zd rats and the remaining 2 exposed all degenerative phases of spermatogenesis. however, one of these, which was recently matured were examined no sperms in the epididymis. the other numerous sperms were present in the epididymis were less than the controls group. normal mature testes including the large numbers of sperms in the epididymis was recorded in control rats. in all zd rats, the interstitial cells were detected in the testes, except for reduced size, but looked normal. in zd rats, decreased size of epithelial layer, small acini, less secretion were observed in all accessory sex organs but no additional pathological variations were detected in these tissues. in zd rats, the dorsolateral prostate glands associated to znspecific stain were negative or slightly positive. in the control groups, the lateral edges of the glands revealed a clear positive reaction. in zd rats, gonadotrophs and thyrotrophs were characterized in pituitary glands stained with a glycoprotein stain compared with the control groups. in zd rats, testes demonstrated atrophy of the tubular epithelium. taken together, zd group influence the male reproductive system of the rats and cause the reduction in all sex organs, testicular atrophy, clear atrophy of the tubular epithelium, and reduced zn concentrations in testes, epididymis, and dorsolateral prostate glands. 2. conclusion the overall consequences of this overview provide a confirmation that certain essential elements especially zn deficiency may affect the male rat reproductive system inclosing the function of spermatogenesis, sperm motility, secretion of accessory glands, fertility, t-level and antioxidant defense system. experimental studies on rats explained that zn deficiency depends on dose and time duration and their effects are also variable. the available data reported that 5 mg/day per rat zn supplementation is considered as optimum level without causing any harmful effects on libido and sexual ability of male rats. therefore, it is recommended that optimum amount of zinc supplementation should be used to avoid the deleterious effects on male reproductive physiology. abbreviation zn; zinc, t; testosterone, fsh; follicle stimulating hormone, lh; luteinizing hormone, zd; zinc deficient, zc; zinc control , alt; alanine aminotransferase, alp; alkaline phosphatase , ldh; lactate dehydrogenase, zno np; zinc oxide nanoparticle, zno mp; zinc oxide microparticle, mda; malondialdehyde , tnf-α; tumor necrosis factor-alpha, sod; serum superoxide dismutase , gnih; gonadotropin-inhibitory hormone , hpg; hypothalamic– animal review, 2018, 5(2): 12-21 18 © 2018 conscientia beam. all rights reserved. pituitary gonadal, odf; outer dense fibres, zncl2; zinc chloride, znso4; zinc sulfate, fe; iron, sh; sulfhydral, s-s bond; disulfide bond, dcp; dipeptidyl carboxypeptidase funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: special thanks to animal review journal for giving an opportunity to share knowledge on zinc deficiency and its possible consequences on male rats reproductive system and strategies to overcome this problem. the author wish to thank beloved parents (rana nawab ahmad and mrs. sultana), grandparents (saith bachal din), uncle (rana maqbool ahmad) and brother (rana kashif nawab) for continued support and excellent mentorship. references [1] m. r. shahraki, t. forghani, m. mohammadi, and a. khazaei-feizalabad, "the effect of intraventricular administration of zinc on serum lh, fsh, prolactin and testosterone in male rats," zahedan journal of research in medical sciences, vol. 17, pp. 29–32, 2015.available at: https://doi.org/10.17795/zjrms-1059. [2] m. i. yatoo, a. saxena, p. m. deepa, b. p. habeab, s. devi, r. s. jatav, and u. dimri, "role of trace elements in animals : a review," veterinary world, vol. 6, pp. 963–967, 2013. [3] s. h. ashrafi, j. meyer, and c. a. squier, "effects of zinc deficiency on the distribution of membrane-coating granules in rat buccal epithelium," journal of investigative dermatology, vol. 74, pp. 425–432, 1980.available at: https://doi.org/10.1111/1523-1747.ep12544599. [4] b. halliwell and j. m. c. gutteridge, "role of free radicals and catalytic metal ions in human diseases: an overview," methods in enzymology, vol. 186, pp. 1-85, 1990.available at: https://doi.org/10.1016/0076-6879(90)86093-b. [5] l. e. cuevas and a. koyanagi, "zinc and infection: a review," annals of tropical paediatrics, vol. 25, pp. 149-160, 2005. [6] c. j. biochem, p. downloaded, and s. diego, "the effects of dietary zinc deficiency on the reproductive system of male rats1 preparation of diet," journal of biochemistry and physiology, vol. 36, 1958. [7] c. y. cheng and d. d. mruk, "the blood-testis barrier and its implications for male contraception," pharmacological reviews, vol. 64, pp. 16-64, 2011.available at: https://doi.org/10.1124/pr.110.002790. [8] l. m. plum, l. rink, and h. haase, "the essential toxin: impact of zinc on human health," international journal of environmental research and public health, vol. 7, pp. 1342-1365, 2010.available at: https://doi.org/10.3390/ijerph7041342. [9] h. takihara, m. j. cosentino, and a. cockett, "zinc sulfate therapy for infertile male with or without varicocelectomy," urology, vol. 29, pp. 638-641, 1987.available at: https://doi.org/10.1016/0090-4295(87)90111-7. [10] a. omu, m. al-azemi, m. al-maghrebi, c. mathew, f. omu, e. kehinde, j. anim, m. oriowo, and a. memon, "molecular basis for the effects of zinc deficiency on spermatogenesis: an experimental study in the sprague-dawley rat model," indian journal of urology, vol. 31, pp. 57-57, 2015.available at: https://doi.org/10.4103/0970-1591.139570. [11] b. l. vallee and a. galdes, the metallobiochemistry of zinc enzymes. in advances in enzymology and related areas of molecular biology: john wiley & sons, inc, 2006. [12] r. k. sharma, f. f. pasqualotto, d. r. nelson, j. a. j. thomas, and a. agarwal, "the reactive oxygen species — total antioxidant capacity score is a new measure of oxidative stress to predict male infertility," human reproduction, vol. 14, pp. 2801–2807, 1999.available at: https://doi.org/10.1093/humrep/14.11.2801. [13] s. a. hamdi, o. i. nassif, and m. s. m. ardawi, "effect of marginal or severe dietary zinc deficiency on testicular development and functions of the rat," archives of andrology, vol. 38, pp. 243–253, 1997.available at: https://doi.org/10.3109/01485019708994883. [14] a. t. khan, t. c. graham, l. ogden, s. ali, salwa, s. j. thompson, k. f. shireen, and m. mahboob, "a twogenerational reproductive toxicity study of zinc in rats," journal of environmental science and health part b, vol. 42, pp. 403-415, 2007.available at: https://doi.org/10.1080/03601230701312795. animal review, 2018, 5(2): 12-21 19 © 2018 conscientia beam. all rights reserved. [15] s. h. lee, j. e. pie, y. r. kim, h. r. lee, s. w. son, and m. k. kim, "effects of zinc oxide nanoparticles on gene expression profile in human keratinocytes," molecular {&} cellular toxicology, vol. 8, pp. 113–118, 2012.available at: http://dx.doi.org/10.1007/s13273-012-0014-8. [16] p. l. kimmel, d. w. watkins, e. b. teller, r. khanna, s. dosa, and t. m. phillips, "zinc balance in combined zinc deficiency and uremia," kidney international, vol. 33, pp. 1091-1099, 1988.available at: https://doi.org/10.1038/ki.1988.116. [17] d. i. thurnham, "micronutrients and immune function: some recent developments," journal of clinical pathology, vol. 50, pp. 887-891, 1997.available at: https://doi.org/10.1136/jcp.50.11.887. [18] c. d. hunt, p. e. johnson, j. herbel, and l. k. mullen, "effects of dietary zinc depletion on seminal volume and zinc loss, serum testosterone concentrations, and sperm morphology in young men," the american journal of clinical nutrition, vol. 56, pp. 148-157, 1992.available at: https://doi.org/10.1093/ajcn/56.1.148. [19] n. roohani, r. hurrell, r. kelishadi, and r. schulin, "zinc and its importance for human health: an integrative review," journal of research in medical sciences : the official journal of isfahan university of medical sciences, vol. 18, pp. 144–157, 2013. [20] m. hidiroglou and j. e. knipfel, "zinc in mammalian sperm: a review," journal of dairy science, vol. 67, pp. 1147–1156, 1984.available at: https://doi.org/10.3168/jds.s0022-0302(84)81416-2. [21] f. ibtisham, a. nawab, y. zhao, g. li, m. xiao, and l. an, "pharmaceutica analytica acta effect of antimicrobial triclosan on reproductive system of male rat," pharmaceutica analytica acta, vol. 7, pp. 7-12, 2016.available at: https://doi:10.4172/2153-2435.1000516. [22] a. a. nicholas and c. c. caldart, "the control of reproductive hazards in the workplace: a prescription for prevention," berkeley journal of employment & labor law, vol. 7, pp. 523-563, 1983. [23] s. das and a. green, "zinc in crops and human health," biofortification of food crops, vol. 11, pp. 31–40, 2016. [24] n. m. rabeh and h. a. el-ghandour, "effect of iron, zinc, vitamin e and vitamin c supplementation on thyroid hormones in rats with hypothyroidism," international journal of nutrition and food sciences, vol. 5, pp. 201-210, 2016.available at: https://doi.org/10.11648/j.ijnfs.20160503.18. [25] d. dissanayake, p. wijesinghe, w. ratnasooriya, and s. wimalasena, "relationship between seminal plasma zinc and semen quality in a subfertile population," journal of human reproductive sciences, vol. 3, pp. 124-128, 2010.available at: https://doi.org/10.4103/0974-1208.74153. [26] u. manzoor, s. siddique, r. ahmed, z. noreen, h. bokhari, and i. ahmad, "antibacterial, structural and optical characterization of mechano-chemically prepared zno nanoparticles," plos one, vol. 11, p. e0154704, 2016.available at: https://doi.org/10.1371/journal.pone.0154704. [27] d. kumari, n. nair, and r. s. bedwal, "journal of trace elements in medicine and biology effect of dietary zinc deficiency on testes of wistar rats: morphometric and cell quantification studies," journal of trace elements in medicine and biology, vol. 25, pp. 47–53, 2011.available at: http://dx.doi.org/10.1016/j.jtemb.2010.11.002. [28] w. m. elsaed and h. a. mohamed, "dietary zinc modifies diabetic-induced renal pathology in rats," renal failure, vol. 39, pp. 246–257, 2017.available at: https://doi.org/10.1080/0886022x.2016.1256321. [29] l. b. smith and w. h. walker, "the regulation of spermatogenesis by androgens," seminars in cell & developmental biology, vol. 30, pp. 2–13, 2014.available at: https://doi.org/10.1016/j.semcdb.2014.02.012. [30] p. i. oteiza, m. s. clegg, and c. l. keen, "short-term zinc deficiency affects nuclear factor-κb nuclear binding activity in rat testes," the journal of nutrition, vol. 131, pp. 21-26, 2001.available at: https://doi.org/10.1093/jn/131.1.21. [31] g. e. olson and d. w. sammons, "structural chemistry of outer densefibersof rat sperm’ proteins," biology of reproduction, vol. 22, pp. 319–332, 1980.available at: https://doi.org/10.1095/biolreprod22.2.319. [32] h. najafzadeh, s. ghoreishi, b. mohammadian, e. rahimi, m. afzalzadeh, m. kazemivarnamkhasti, and h. ganjealidarani, "serum biochemical and histopathological changes in liver and kidney in lambs after zinc oxide http://dx.doi.org/10.1007/s13273-012-0014-8 http://dx.doi.org/10.1016/j.jtemb.2010.11.002 animal review, 2018, 5(2): 12-21 20 © 2018 conscientia beam. all rights reserved. nanoparticles administration," vet world, vol. 6, pp. 534-537, 2013.available at: https://doi.org/10.5455/vetworld.2013.534-537. [33] a. a. hafiez, z. h. m. el-kirdassy, n. m. el-malkh, and e. m. i. el-zayat, "role of zinc in regulating the testicular function part 3. histopathological changes induced by dietary zinc deficiency in testes of male albino rats," food / nahrung, vol. 34, pp. 65–73, 1990.available at: https://doi.org/10.1002/food.19900340114. [34] d. k. schamphelaere, m. canli, v. van lierde, i. forrez, f. vanhaecke, and c. janssen, "reproductive toxicity of dietary zinc to daphnia magna," aquatic toxicology, vol. 70, pp. 233-244, 2004.available at: https://doi.org/10.1016/j.aquatox.2004.09.008. [35] a. sharma, b. patni, d. shankhdhar, and s. c. shankhdhar, "zinc–an indispensable micronutrient," physiology and molecular biology of plants, vol. 19, pp. 11-20, 2013.available at: https://doi.org/10.1007/s12298-012-0139-1. [36] e. gilabert, e. ruiz, c. osorio, and e. ortega, "effect of dietary zinc deficiency on reproductive function in male rats: biochemical and morphometric parameters," the journal of nutritional biochemistry, vol. 7, pp. 403-407, 1996.available at: https://doi.org/10.1016/s0955-2863(96)00063-0. [37] b. baccetti, v. pallini, and a. g. burrini, "the accessory fibers of the sperm tail," journal of ultrastructure research, vol. 54, pp. 261–275, 1976.available at: https://doi.org/10.1016/s0022-5320(76)80118-9. [38] a. ashrafzadeh, s. a. karsani, and s. nathan, "mammalian sperm fertility related proteins," international journal of medical sciences, vol. 10, pp. 1649-1657, 2013.available at: https://doi.org/10.7150/ijms.6395. [39] s. murarka, v. mishra, and p. joshi, "role of zinc in reproductive biology an overview," molecular medicine, vol. 2, pp. 1–8, 2015. [40] h. a. vergnes, m. k. courdouhji, j. f. guelfi, j. g. grozdea, and m. lamand, "effect of zinc deficiency in lambs on plasma and neutrophil alkaline phosphatase," small ruminant research, vol. 3, pp. 167-177, 1990.available at: https://doi.org/10.1016/0921-4488(90)90090-s. [41] b. t. akingbemi, "estrogen regulation of testicular function," reproductive biology and endocrinology, vol. 3, pp. 1–13, 2005. [42] m. k. sankako, p. c. garcia, r. c. piffer, b. dallaqua, d. c. damasceno, and o. c. pereira, "possible mechanism by which zinc protects the testicular function of rats exposed to cigarette smoke," pharmacological reports, vol. 64, pp. 1537-1546, 2012.available at: https://doi.org/10.1016/s1734-1140(12)70951-9. fig-1. fsh and lh plays a key role in sperm production and in the process of spermatogenesis. but, various studies reported that gonadotropininhibitory hormone (gnih) negatively affects the hypothalamic–pituitary gonadal axis (hpg axis) and disturb the testosterone level and ultimately hinder the spermatogenesis. source: shahraki, et al. [1] animal review, 2018, 5(2): 12-21 21 © 2018 conscientia beam. all rights reserved. fig-2. sperm morphology plays an important role in ova fertilization. healthy sperm consists of normal head, middle and tail piece. by electron microscopic examination of rat sperm, it is reported that zn deficiency affects the middle piece (odf) of sperm and produce the sperm structural abnormalities. as consequences it may lead to infertility. source: yatoo, et al. [2] views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 1 © 2020 conscientia beam. all rights reserved. growth performance of kit rabbits fed concentrate diet supplemented with varying foliage leaf meals falemara, b.c.1+ aina o.o.2 shittu, s.3 usman, h.s.4 1research coordinating unit, forestry research institute of nigeria, ibadan, oyo state, nigeria. 2department of forest conservation and preservation, forestry research institute of nigeria, forest hills, jericho, ibadan, oyo state, nigeria. 3,4department of agricultural technology, federal college of forestry, plateau state, nigeria. (+ corresponding author) abstract article history received: 16 april 2020 revised: 18 may 2020 accepted: 23 june 2020 published: 21 july 2020 keywords conversion ratio feed formulation growth rate leafy meal moringa rabbits. the study investigated the effects of supplementing concentrate diets of rabbits with gmelina, neem, leucaena combined w/w with moringa leaf meals on their growth performance. four dietary treatments consisting of forage and concentrate were formulated alongside with the control diet (without supplement). twenty-four weaner rabbits of both sexes equal in numbers of males and females were used for the experiment for a period of 12 weeks. the growth experiment was subjected to 4 x 2 factorial experiment in completely randomized design consisting of four experimental diets and two (2) sexes. proximate composition of the experimental diets, weekly weight gain, feed intake, feed consumption and feed conversion ratio of the rabbits were assessed. as revealed from the findings, the crude protein, crude fat and crude fiber ranged from 9.36% to 36.73%; 6.75% to 11.58%; and 20.12% to 30.24% respectively, while the carbohydrate, ash and moisture content ranged between 57.90% and 73.27%; 6.20% and 17.75%; and 7.76% and 8.20% respectively. the statistical analysis revealed that the experimental treatments had significant effects on the growth rate, feed consumption and feed conversion ratio of the rabbits (p≤0.05). a strong positive and significant relationship (0.01 level) was observed between feed consumption and growth rate of the rabbit. the results of the finding suggest that the inclusion of the moringa forage leaves in the experimental diets favoured the growth performance of the rabbits in terms of growth rate, feed consumption and feed conversion ratio of rabbits. contribution/originality: this study is one of very few studies which have investigated, the effects of supplementing concentrate diets of rabbits with mixed foliage augmented moringa leaf meal and other foliage leafy meals including gmelina, neem, leucaena on optimum growth performance within the shortest possible time. 1. introduction rabbits have been discovered to be a very good source of animal protein in nigeria, particularly in the rural and urban areas. they possess some unique qualities that makes them suitable as meat-producing animals, as well as smallholder subsistence integrated farming and business, when compared with other herbivorous animals. some of these qualities include prolific breeders, rapid growth rate and fecundity, short generational interval, genetic diversity, high nutritional meat quality (including exceptional protein value, low cholesterol content and sodium levels), high efficiency in converting forage to meat, low cost management requirements, ability to utilize wide animal review 2020 vol. 7, no. 1, pp. 1-13. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2020.71.1.13 © 2020 conscientia beam. all rights reserved. https://orcid.org/0000-0001-7663-9116 https://orcid.org/0000-0002-9439-6389 https://orcid.org/0000-0002-3857-4304 http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2020.71.1.13&domain=pdf&date_stamp=2017-01-14 https://www.doi.org/10.18488/journal.ar.2020.71.1.13 animal review, 2020, 7(1): 1-13 2 © 2020 conscientia beam. all rights reserved. arrays of feedstuffs and forages, ability to adapt to different ecological environment and consumption bereft of cultural and religious biases [1-7]. however, feeding of rabbits just like other monogastric animals accounts for about 70 and 80% of its production [8]. the high cost of feed coupled with the ignorance of possible alternative and cheap feed ingredients are among important factors militating against increased commercial rabbit production in nigeria. as opined by ahaotu, et al. [9] the high cost of feed ingredients in most tropical countries clearly indicates that the production of feeds for livestock business is grossly inadequate. this major constraint has brought about the search for alternative feed resources that are readily available, inexpensive and less competed for by humans. they can serve as nonconventional replacement or supplements of the conventional feed stuffs in rabbits and other livestock diets. although rabbits can survive on most foliage diet, there is the need to explore mixed varying feeding regime that will enhance optimum performance. one priority area of research now is the production of rich nutrient forage based diets alongside concentrates [10]. the inclusion of tree foliage in animal nutrition tends to serve as rich source of protein, minerals, vitamins [11] and important phytochemicals with enhanced anti-microbial, antioxidant and palatability [12]. thus, providing sustainable, locally available and perennial feeding system for rabbits and other livestock [13, 14]. local farmers, usually in less developed countries adopt the use of several forages to feed rabbits for cheaper feeding cost kimsé, et al. [15]. bamikole and ezenwa [16] reported that feeding rabbits solely on forages in the tropics has resulted in negative effect of weight loss and in some cases positive effects have been reported. the sole use of compounded concentrates has also not given optimum results [17]. however, previous research studies have been reported on the use of tropical forages (leucaena leucocephala, morus alba, gmelina arborea, gliricidia sepium, tridax procumbens, bambusa arundinancea, erythrina poeppigiana, tithonia diversifolia and azadirachta indica) as supplements with rabbit concentrate diets [3, 10, 18-22]. in view of the aforementioned, the quest to search for an alternative feed source that can produce an economically viable end results in a relatively short period becomes expedient. the current study is therefore aimed to investigate the effects of supplementing concentrate diets of rabbits with forage leaf meals on their growth performance. 2. materials and methods 2.1. experimental site, preparation of experimental diets and feed formulation the experiment was carried out in the animal farm at the federal college of forestry, jos, plateau state, nigeria. fresh foliage leaves of gmelina arborea, azadirachata indica, leucaena leucocephala and moringa oleifera trees were harvested from the mother tree and air dried under shed until they were crispy to touch. the leaves were then pulverized and stored prior to use. the milled leaves (g. arborea (g), a. indica (a), and l. leucocephala (l)) were proportionally mixed at a ratio of 1:1 (dm basis) with the milled leaf of m. oleifera using pearson’s square method of ration formulation [23] as shown in table 1. 2.2. experimental animal and housing management twenty-four weaner rabbits of both sexes equal in numbers of males and females were used for the experiment. the rabbits were housed in cages (25cm × 40cm × 30cm) partitioned with wire mesh figure 1 and equipped with drinkers and feeders. the rabbits were randomly allocated to the four dietary treatment groups with three (3) rabbit per treatment [24]. prior to the commencement of the experiment the rabbits were prophylactically treated against internal and external parasites by subcutaneous injection of ivomec (0.2 ml/rabbit). broad spectrum antibiotics (oxytetracycline l.a) were given subcutaneously at the rate of 0.2 ml/rabbit [25]. animal review, 2020, 7(1): 1-13 3 © 2020 conscientia beam. all rights reserved. table-1. composition of experimental diets. ingredients diet 1 (t1) diet 2 (t2) diet 3 (t3) diet 4 (t4) diet 5 (t5) concentrate (g+m) (b+m) (a+m) (l+m) maize 19.5 9.5 9.5 9.5 9.5 corn bran 37 37 37 37 37 g+m 20 b+m 20 a+m 20 l+m 20 groundnut cake 16 6 6 6 6 palm kernel cake 20 20 20 20 20 fish meal 2 2 2 2 2 bone meal 3 3 3 3 3 premix 2 2 2 2 2 salt 0.5 0.5 0.5 0.5 0.5 total 100 100 100 100 100 note: *vitamin/mineral premix content per kilogram ration: vit. a 1251 iu, vit. d3 2750 iu, vit. e 151 iu, vit. k 0.002 g, vit. b2 0.006 g, nicotinic acid 0.035, calcium d-pantothenate 0.01 mg, vit. b6 0.0035 g, vit. b12 0.02 g, folic acid 0.001 g, biotin 0.0005 g, vit. c 0.025 g, cholin chloride 0.39 g, zinc bacitracin 0.02 g, methionine 0.2 g, avatec (lasolocid) 0.09 g, manganese 0.1 g, iron 0.05 g, zinc 0.04 g, copper 0.002 g, iodine 0.00153 g, cobalt 0.000225 g, selenium 0.0001 g. figure-1. housing system of the rabbits. 2.3. experimental design and data collection the growth experiment was 4 x 2 factorial experiment in completely randomized design with two (2) factors of four (4) types of experimental diets and two (2) sexes. the experiment was composed of 8 treatment combinations and 3 replications. the rabbits were weighed at the start of the experiment and subsequently on a weekly basis. variables measured include weight gain, feed intake, feed consumption and feed conversion ratio. growth rate represents the ratio between weight gained and growth period, the feed consumption was determined by finding the difference between the remaining and the distributed feed, while the feed conversion ratio was calculated as the quantity of feed that produce 1kg weight gain. animal review, 2020, 7(1): 1-13 4 © 2020 conscientia beam. all rights reserved. the proximate composition of the experimental diets was carried out as outline by aoac [26]. these include test on crude protein (%), crude fibre (%), ether extract (%), ash (%) and nfe (%) on dry matter (dm) basis. 2.4. statistical analysis all data collected were subjected to analysis of variance (anova). differences between the treatment means were separated using duncan's new multiple range test (dmrt) at 5% level of significance. 3. results 3.1. proximate composition the results of the proximate analyses of the experimental diets are presented in table 2. the crude protein, crude fat and crude fiber ranged from 9.36% to 36.73%; 6.75% to 11.58%; and 20.12% to 30.24% respectively. the carbohydrate, ash and moisture content ranged between 57.90% and 73.27%; 6.20% and 17.75%; and 7.76% and 8.20% respectively. as revealed from the result, the proximate constituents of the experimental diets increased with inclusion of moringa oleifera leaves. gmelina+moringa diet had the highest crude protein content (36.73%) and crude fat content (11.58%). leuceana+moringa experiment diet had the highest crude fibre content (30.24%), ash content (17.75%) and moisture content of 8.20%. carbohydrate content was highest in neem+moringa experimental diet (73.27%). table-2. proximate composition of the experimental diets. proximate composition control neem + moringa leuceana + moringa gmelina + moringa crude protein % 9.36 27.66 30.42 36.73 crude fat % 6.75 7.24 8.12 11.58 crude fibre % 20.12 21.72 30.24 27.43 carbohydrate % 57.90 73.27 72.38 68.47 ash % 6.20 14.40 17.75 16.93 moisture % 7.76 7.84 8.20 7.54 3.2. growth rate (%) the result of the effects of the experimental treatments on the growth rate (g/week) of the rabbits after 12 weeks figure 2 showed that gmelina (gmelina arborea) and moringa (moringa oleifera) experimental diet had the highest effect (121.38g/week) on the growth rate of the rabbits. this is followed by neem (azadirachta indica) and moringa (moringa oleifera) experimental diet indicating 92.30g/week growth rate of the rabbits. the fourth (leuceana and moringa) and control diet (with no incorporation of forage leaves) experimental diets had the lowest effects of 71.05g/week and 74.48g/week on the growth rate of the rabbits respectively. further analysis by through mean separation and comparison figure 2 showed that there were significant differences (p≤0.05) in the effects of experimental diets of control and gmelina + moringa; control and neem + moringa; gmelina + moringa and neem + moringa; gmelina + moringa and leuceana + moringa; and neem + moringa and leuceana + moringa. conversely, there was no significant difference (p≥0.05) in experimental diets between control and leuceana + moringa. in general the combination of gmelina + moringa experimental diets had the highest (121.38g/week) significant effect (p≤0.05) on growth rate of the rabbits, while leuceana + moringa experimental diet recorded the lowest (71.05g/week) significant effect on the growth rate of the rabbits which is not significantly different from that of the control diet. animal review, 2020, 7(1): 1-13 5 © 2020 conscientia beam. all rights reserved. figure-2. effects of the treatments on the growth rate (g/week) of the rabbits. note: bars having the same letters are not significantly different (p≤0.05). 3.3. feed consumption (g) the findings on the effects of the treatments on the feed consumption (g) of the rabbits after 12 weeks figure 3 indicated that the second experimental diet composed of gmelina+moringa forage leaves resulted into the highest (5327.08g) feed consumption level of the rabbits. this is closely followed by the neem and moringa experimental diet (5031.50g) and control diet (4452.42g). the lowest feed consumption level by the rabbits after eight weeks was observed in the leuceana + moringa experimental diets which recorded a value of 4057.50g. the analysis for mean comparison figure 3, further revealed that there was no significant differences (p≥0.05) between gmelina + moringa and neem + moringa on feed consumption level of the rabbits. in comparison, significant differences (p≤0.05) were observed between control diet and gmelina + moringa; control and neem + moringa; control and leuceana + moringa; gmelina + moringa and leuceana + moringa; and neem + moringa and leuceana + moringa experimental diets on feed consumption level of the rabbits. figure-3. effects of the treatments on the feed consumption (g) of the rabbits. note: bars having the same letters are not significantly different (p≤0.05). animal review, 2020, 7(1): 1-13 6 © 2020 conscientia beam. all rights reserved. 3.4. feed conversion ratio/efficiency the result of the effects of the treatments on the feed conversion efficiency/ratio of the rabbits figure 4 after eight weeks showed that neem and moringa experimental forage leaves gave the highest feed conversion ratio (8.66). this observed occurrence is closely followed by gmelina + moringa (7.06) and control (feed concentrate with no forage leaves) diets. (5.12). leuceana + moringa (4.65) experimental diet recorded the lowest feed conversion efficiency. further analysis for mean comparison figure 4 showed that there were no significant differences (p≥0.05) were observed between control and leuceana + moringa; gmelina + moringa and neem + moringa; and gmelina + moringa and leuceana + moringa experimental treatments on feed conversion ratio/efficiency of the rabbits after eight weeks of experimental subjection. significant difference (p≤0.05) were observed between the control and gmelina + moringa; control and neem + moringa; and neem + moringa and leuceana + moringa experimental diets on feed conversion efficiency of the rabbits after eight weeks of experimental subjection. figure-4. effects of the treatments on the feed conversion ratio of the rabbits. note: bars having the same letters are not significantly different (p≤0.05). 3.5. correlation analysis between feed and growth parameters of the rabbits the correlation analysis between the feed and growth parameters table 3 revealed that a strong positive and significant relationship (0.01 level) exist between feed consumption and growth rate of the rabbit twelve weeks after experimental subjection. the implication of this is that increase in the feed consumption of the rabbits brought about an increase in the growth rate of the rabbits. a weak and significant relationship was found between feed consumption and feed conversion efficiency while the relationship between growth rate and feed conversion efficiency 8weeks after the experiment was weak and not significant. 4. discussion 4.1. proximate composition of the experimental diets the study investigated the growth performance of rabbits fed concentrate diet supplemented with different forage leaf meals. the proximate composition of the experimental diets ranged from 9.36% to 36.73% for crude protein, 6.75% to 11.58% for crude fat and 20.12% to 30.24% for crude fiber, 57.90% to 73.27% for carbohydrate, 6.20% to 17.75% for ash and 7.76% to 8.20% for moisture content table 2. the proximate analysis further revealed that there was increase in the proximate constituents of the experimental diets with inclusion of moringa oleifera leaves. this is corroborated by jiwuba and ogbuewu [6] who discovered abundant essential nutrients in moringa animal review, 2020, 7(1): 1-13 7 © 2020 conscientia beam. all rights reserved. oleifera leaf meal (molm) diet. this according to them could improve productivity and enhance performance of rabbit. table-3. correlation analysis between feed and growth parameters of the rabbits. parameters growth rate feed consumption growth rate 1 feed consumption 0.731** 1 feed conversion ratio/efficiency 0.287 0.448* note: **. correlation is significant at the 0.01 level (2-tailed). *. correlation is significant at the 0.05 level (2-tailed). as posited by ajayi, et al. [25] the variations in crude fiber value may be due to the stage of growth of the plant at harvest as well as the method used in the processing of the meal, while the differences in the values of protein obtained may be attributed to the differences in soil nutrients in the soils on which the plants were grown. fuglie [26] attributed these observed variations in the nutrients to the age of cutting or harvesting, climatic conditions, edaphic factors, agronomic practices as well as methods of processing and analysis. the range of values obtained in this study is significantly higher than range of values reported by previous researchers. makinde [24] determined the proximate constituents of rabbits fed concentrate diet supplemented with white lead tree (leucaena leucocephala) or siratro (macroptilium atropurpureum) leaves as 15.75 – 18.72% for crude protein, 4.75 – 11.42% for crude fiber and 10.30 – 14.90% for ash content. ajayi, et al. [25] reported crude protein as 15.95-78.35%, crude fiber as 1.46-16.64% and ash content as 3.96-14.0%. grubben and denton [27] reported that the leafy tips of moringa oleifera contain per 100 g edible portion: water 78.7 g, protein 9.4 g, fat 1.4 g, carbohydrates 8.3g, oduro, et al. [28] reported that moringa oleifera leaves contained crude protein 27.51%, crude fiber 19.25%, crude fat 2.23%, ash 7.13%, moisture 76.53% and carbohydrates 43.88%. the effect of feed on the growth performance of rabbits showed that the moringa supplemented feed is better in terms of growth rate, feed consumption and feed conversion ratio. this could be explained by the presence of moringa in the feed. improved proficiency of protein utilization in moringa supplemented experimental diets might be attributed to its high protein and low fiber and lignin contents [29, 30]. it has strengthened the content of the feed protein and fiber. proteins of moringa have very high biological values. all essential amino acids present in moringa are in a concentration greater than the one recommended by fao and who as posited by zarkadas, et al. [31]. 4.2. growth rate (g/week) the result of the findings of this study revealed that homogenous mixture of the forage leaves with moringa forage leave gave a better growth performance on the rabbits after 12 weeks figure 2, 3 and 4. experimental diet mixture of gmelina and moringa as well as neem and moringa experimental diets had the highest significant effects of 121.38g/week and 92.30g/week respectively on the growth rate of the rabbits. the homogenous combination of leuceana and moringa gave a poor significant performance compared to the control diet (with no incorporation of forage leaves) experimental diet. the results obtained in this study is in agreement with the findings of ojewola, et al. [32] and adeyemo, et al. [19] that rabbit perform better when fed mixture of forage and concentrate. growing rabbits on concentrate recorded the lowest final weight and this could be attributed to concentrate feeding only without inclusion of forage in their diet. also, this is in accordance with the works of adeyemo, et al. [19] and kishawy, et al. [33] who both reported lower live weight in rabbit fed concentrate alone without supplementation with forage. although the combination of leuceana and moringa contradicted this assertion by recording a lower growth rate than the control. this observed occurrence can be attributed to the fact that improved efficiency of protein utilization in moringa animal review, 2020, 7(1): 1-13 8 © 2020 conscientia beam. all rights reserved. experimental diet fed rabbits might be due to the presence of high protein and low fiber and lignin contents in the foliage of this plant species. the high content of moringa fibers facilitates the digestive transit of the rabbits djakalia, et al. [29] thus enhancing the growth performance of the rabbits. the high content of crude protein supplemented by the inclusion of moringa forage leaves apparently enhanced digestibility of the diets by the rabbits. uko, et al. [34] in their study affirmed that as dietary fiber or cell wall material levels increased, apparent digestibility of dry matter declined. this finding corroborates with the observed reduced apparent dry matter digestibility of abegunde, et al. [35] when garcinia kola leaf meal was fed to rabbits and oloruntola, et al. [20] when rabbits were fed with gliricidia leaf meal. the initial increase in digestibility observed in rabbits fed the control diet might be attributed to better utilization of the feed by the animal which triggered better movement in the tract and improved digestion [36]. in line with the above, pius, et al. [22] submitted that the consumption of gmelina arborea foliage supplemented with concentrated fodder has not adverse effect on rabbit growth performance. abu, et al. [30] reported that leucaena leucocephala is composed of considerable amounts of mimosine (a toxic, non-protein amino acid) which could be responsible for growth depression and increased mortality. sugur, et al. [37] reported that 20-25% l. leucocephala forage leaves inclusion in the rabbit’s diet may have deleterious effect on mortality as observed in this study. like protein, fat is an intra-cellular component which is readily degraded having therefore a good digestibility. moringa leaves being poor in fat have no effect on the fat digestibility [29]. vitamin a is important in rabbit growth. moringa is reported to have a high vitamin a [27]. the control diet (with no inclusion of forage leaves) might have provided insufficient vitamin a for the rabbits, hence resulting in poor growth, since vitamin a aids in promoting growth in rabbits. pond, et al. [38] stated that vitamin a deficiency in the diets of rabbits makes the rabbits to exhibit poor growth. the low growth rates observed in the leuceana+moringa experimental fed rabbits figure 2 could be explained by the fact that the rabbits did not consume a lot of the feeds to ensure higher growth because of poor palatability of the experimental diet. this might also be attributed to subclinical infections which adversely affected their growth rate resulting in some degree of mortality in the number of rabbits assigned in this experiment diet treatment as revealed in this present study. ajayi, et al. [25] opined that, another possible reason may be linked to poor genetic constitution of the rabbits used. 4.3. feed consumption (g) the result of the findings showed that the range of 4057.50g and 5327.08g feed consumption or feed intake (g) by the rabbits obtained in this study is significantly higher than amount of feed intake or consumption recorded in previous research findings. this can be attributed to the inclusion of moringa forage leaves in the experimental diet with contributed significantly to the growth performance of the rabbits after eight (8) weeks. the experimental combination of gmelina+moringa and neem and moringa resulted into better and significant growth performance of the rabbits figure 3. this occurrence is evident in the correlation relationship in which strong positive and significant relationship (0.01 level) exist between feed consumption and growth rate of the rabbit eight weeks after experimental subjection. implying that increased feed consumption of the rabbits brought about an increased growth rate. makinde et al. [24] reported feed consumption ranging between 2664.46g and 3185.51g, while ajayi, et al. [25] recorded feed intake ranging between 3450g and 3710g. abubakar and bello [39] reported that weaned rabbits can utilize varying levels of m. oleifera leaf meal at up to 45% level in diets without adverse effects on growth performance, carcass yield, organ and gut characteristics. adedeji, et al. [40] reported that the inclusion of increasing levels of l. leucocephala leaf meal (from 5 to 15%) improved rabbit performance and daily weight gain compared with the control diet (without supplement), although feed intake was decreased. previous studies have indicated that the presence of some anti-nutritional factors like tannins in the diets results in poor palatability and animal review, 2020, 7(1): 1-13 9 © 2020 conscientia beam. all rights reserved. consequent decrease in feed intake due to its astringent property as a result of its ability to bind with protein of saliva and mucous membrane [41]. 4.4. feed conversion ratio/efficiency the feed conversion ratio (fcr) values of 4.65, 5.12, 7.06, and 8.66 obtained in this study were higher than the range of 2.63 to 4.00 reported by earlier researchers in the tropics [42]; 5.32 to 5.63 reported by eustace, et al. [43] 4.09 – 6.33 reported by makinde [24] and feed conversion ratio ranging from 5.30 to 6.03 reported by ajayi, et al. [25]. however, the values obtained in this study are within the range and in line with the findings of adu, et al. [44] and ladipo, et al. [45] who reported 3.32 to 16.76 and 5.92 to 8.66 feed conversion ratio in rabbits fed dietary. according to adejinmi, et al. [46] several factors including the nature of the feed and age of the animal are known to affect feed conversion ratio (fcr) of rabbits. iyeghe-erakpotobor [47] in her study on utilization of arachis hypogea (groundnut) and lablab purpureus (lablab) forage meal fed sole or mixed by growing rabbits reported a maximum feed conversion ratio of 13 which is higher than maximum feed conversion ratio of 8.66 reported in this study. 5. conclusion the results of the finding suggest that the inclusion of the moringa forage leaves in the experimental diets favoured the growth performance of the rabbits. gmelina and moringa diet had the highest crude protein content and crude fat content. leuceana and moringa experiment diet had the highest crude fiber content, ash content and moisture content, while neem and moringa experimental diet had the highest carbohydrate content. in view of the result of the findings of these study, moringa oleifera supplements in the diets of rabbit will help in enhancing the growth and development of the rabbits as well as saving cost of production in terms of rabbit farming enterprise. there is need to encourage massive afforestation of moringa plant so as to enable farmers to produce the rabbit diets at a lower cost for economic use in animal feed formulation. in addition, further studies can be carried out to determine the phytochemical constituents of the forage leaves so as to investigate the presence of any anti nutritional constituents of the plant species. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. acknowledgement: f.b.c. conceived the research idea, wrote the original draft manuscript, analysed the data, reviewed and edited the manuscript; a.o.o participated in the review and editing of the manuscript as well as the supervision of the research survey; s.s. and u.h.s. conducted the research, collected the research data and contributed to the writing of the manuscript. references [1] s. mailafia, m. onakpa, and o. owoleke, "problems and prospects of rabbit production in nigeria-a review," bayero journal of pure and applied sciences, vol. 3, pp. 20-25, 2010. available at: https://doi.org/10.4314/bajopas.v3i2.63213. [2] j. j. pascual, d. savietto, c. cervera, and m. baselga, "resources allocation in reproductive rabbit does: a review of feeding and genetic strategies for suitable performance," world rabbit science, vol. 21, pp. 123-144, 2013. available at: https://doi.org/10.4995/wrs.2013.1236. [3] g. nkwocha, l. agbabiaka, t. beketin, and k. anukam, "effect of graded levels of gmelina arborea leaf meal on the performance of grower rabbits," international journal of agriscience, vol. 4, pp. 370-373, 2014. [4] o. i. ogbonna, "role of households in rabbit production in enugu-north agricultural zone of enugu state," journal of agricultural extension, vol. 19, pp. 49-56, 2015. [5] a. blasco, m. martínez-álvaro, m.-l. garcía, n. ibáñez-escriche, and m.-j. argente, "selection for environmental variance of litter size in rabbits," genetics selection evolution, vol. 49, pp. 1-8, 2017. available at: https://doi.org/10.1186/s12711-017-0323-4. animal review, 2020, 7(1): 1-13 10 © 2020 conscientia beam. all rights reserved. [6] p. c. jiwuba and i. p. ogbuewu, "potential of moringa oleifera leaf meal to replace soybean meal in rabbit diets and its influence on production parameters," asian journal of biological sciences, vol. 12, pp. 656-663, 2019. [7] m. abubakar, a. u. yusuf, u. d. doma, u. ibrahim, and a. s. muhammad, "growth performance, carcass and organ characteristics of growing rabbits fed graded levels of moringa oleifera leaf meal diets," in in proceedings of the 16th annual conference of animal science association of nigeria (asan), sept., 12th–15th 2011. kogi state university, anyigba, nigeria, 2011, pp. 365–368. [8] s. arijeniwa, o. otaikhian, and j. a. imaseum, "performance of weaner rabbits fed: poultry grower mash supplemented with different grass legume rations," in in proceedings of 5th annual conference of animal sci. ass. nig. (asan) sept. 19-22, 2000, pp. 103-105. [9] e. ahaotu, b. ekenyem, e. agiang, v. balakrishnan, and f. madubuike, "effects of dietary substitution of rubber seed cake for groundnut cake on the body conformations of finisher broilers," animal production research advances, vol. 6, pp. 49-52, 2010. [10] o. f. akinmoladun, v. adejoro, and a. jimoh, "performance and carcass characteristics of rabbits fed diets with total or partial replacement of tridax procumbens by bamboo (bambusa arundinancea) leaves," journal of experimental agriculture international, vol. 27, pp. 1-10, 2018. available at: https://doi.org/10.9734/jeai/2018/34863. [11] p. jiwuba, f. ahamefule, i. ogbuewu, and k. ikwunze, "blood chemistry and haematology of west african dwarf goats fed moringa oleifera leaf meal (molm) in their diet," comparative clinical pathology, vol. 26, pp. 621-624, 2017. [12] n. v. valenzuela-grijalva, a. pinelli-saavedra, a. muhlia-almazan, d. dominguezdiaz, and h. gonzalez-rios, "dietary inclusion effects of phytochemicals as growth promoters in animal production," journal of animal science and technology, vol. 59, pp. 1-17, 2017. available at: https://doi.org/10.1186/s40781-017-0133-9. [13] o. oloruntola, o. daramola, and s. omoniyi, "effect of forages on performance, carcass cuts and haematological profile of weaner rabbits," animal husbandry archives, vol. 64, pp. 87-92, 2015. [14] m. f. dida, d. g. challi, and k. y. gangasahay, "effect of feeding different proportions of pigeon pea (cajanus cajan) and neem (azadirachta indica) leaves on feed intake, digestibility, body weight gain and carcass characteristics of goats," veterinary and animal science, vol. 8, pp. 1-8, 2019. available at: https://doi.org/10.1016/j.vas.2019.100079. [15] m. kimsé, m. yapi, m. karamoko, t. gidenne, m. zongo, b. gnanda, a. akoutey, n. bodji, a. fantodji, and a. otchoumou, "effect of tropical green forage pueraria phaseoloides addition to a pelleted complete feed on rabbit growth performance and digestion," world rabbit science, vol. 25, pp. 225-231, 2017. available at: https://doi.org/10.4995/wrs.2017.5126. [16] m. bamikole and i. ezenwa, "performance of rabbits on guinea grass and verano stylo hays in the dry season and effect of concentrate supplementation," animal feed science and technology, vol. 80, pp. 67-74, 1999. available at: https://doi.org/10.1016/s0377-8401(99)00038-3. [17] h. t. khuc and t. r. preston, "effect of different sources of supplementary fibre on growth of rabbits fed a basal diet of fresh water spinach (ipomoea aquatica)," livestock research for rural development, vol. 18, p. 58, 2006. [18] j. ondiek, j. tuitoek, s. abdulrazak, f. bareeba, and t. fujihara, "use of leucaena leucocephala and gliricidia sepium as nitrogen sources in supplementary concentrates for dairy goats offered rhodes grass hay," asian-australasian journal of animal sciences, vol. 13, pp. 1249-1254, 2000. available at: https://doi.org/10.5713/ajas.2000.1249. [19] a. adeyemo, o. s. taiwo, and o. a. adeyemi, "performance and carcass characteristics of growing rabbits fed concentrate to forage ratio," international journal of modern plant and animal sciences, vol. 2, pp. 33-41, 2014. [20] o. d. oloruntola, j. o. agbede, s. o. ayodele, e. s. ayedun, o. t. daramola, and d. a. oloruntola, "gliricidia leaf meal and multi-enzyme in rabbits diet: effect on performance, blood indices, serum metabolites and antioxidant status," journal of animal science and technology, vol. 60, pp. 1-8, 2018. available at: https://doi.org/10.1186/s40781018-0182-8. animal review, 2020, 7(1): 1-13 11 © 2020 conscientia beam. all rights reserved. [21] a. sánchez-laiño, e. d. torres-navarrete, f. buste-castro, a. barrera-álvarez, and j. sánchez-torres, "tropical forages as a dietary alternative in fattening rabbits (oryctolagus cuniculus l.)," agronomic act, vol. 67, pp. 333-338, 2018. available at: https://doi.org/10.15446/acag.v67n2.59220. [22] o. pius, t. ahemen, and p. addass, "effect of rations with fresh leaves of gmelina arborea on growth performance and organ weights of rabbit bucks," agricultural science and technology, vol. 11, pp. 317-322, 2019. available at: https://doi.org/10.15547/ast.2019.04.053. [23] j. wagner and t. stanton, "formulating ration with pearson's square, retrieved from: http://www.ext.colostate.edu/pubs/livestock/01618.html," 2014. [24] o. j. makinde, "growth performance, carcass yield and blood profiles of growing rabbits fed concentrate diet supplemented with white lead tree (leucaena leucocephala) or siratro (macroptilium atropurpureum) leaves in north central nigeria," trakia journal of sciences, vol. 14, pp. 80-86, 2016. [25] a. ajayi, g. farinu, o. ojebiyi, and t. olayeni, "performance evaluation of male weaner rabbits fed diets containing graded levels of blood-wild sunflower leaf meal mixture," world journal of agricultural sciences, vol. 3, pp. 250-255, 2007. [26] l. fuglie, producing food without pesticides: local solution to crop pest control in west africa. the netherlands: cta. wageningen, 1999. [27] g. j. h. grubben and o. a. denton, plant resources of tropical africa 2. vegetables. prota foundation. netherlands: wageningen, netherlands/ backhuys publishers, leiden, netherlands/ cta, wageningen, 2004. [28] i. oduro, w. ellis, and d. owusu, "nutritional potential of two leafy vegetables: moringa oleifera and ipomoea batatas leaves," scientific research and essays, vol. 3, pp. 057-060, 2008. [29] b. djakalia, b. l. guichard, and d. soumaila, "effect of moringa oleifera on growth performance and health status of young post-weaning rabbits," research journal of poultry science, vol. 4, pp. 7-13, 2011. available at: https://doi.org/10.3923/rjpscience.2011.7.13. [30] s. h. abu, a. z. m. salem, a. a. hassan, a. e. kholif, m. m. y. elghandour, a. barbabosa, and s. lopez, "digestion, growth performance and caecal fermentation in growing rabbits fed diets containing foliage of browse trees," world rabbit science, vol. 24, pp. 283-293, 2016. available at: https://doi.org/10.4995/wrs.2016.4359. [31] c. g. zarkadas, z. yu, and v. d. burrows, "protein quality of three new canadian-developed naked oat cultivars using amino acid compositional data," journal of agricultural and food chemistry, vol. 43, pp. 415-421, 1995. available at: https://doi.org/10.1021/jf00050a030. [32] g. ojewola, f. okoye, and o. ukoha, "comparative utilization of three animal protein sources by broiler chickens," international journal of poultry science, vol. 4, pp. 462-467, 2005. available at: https://doi.org/10.3923/ijps.2005.462.467. [33] a. t. kishawy, s. a. amer, a. osman, s. a. elsayed, m. e. abd el-hack, a. a. swelum, h. ba-awadh, and i. m. saadeldin, "impacts of supplementing growing rabbit diets with whey powder and citric acid on growth performance, nutrient digestibility, meat and bone analysis, and gut health," amb express, vol. 8, pp. 1-10, 2018. available at: https://doi.org/10.1186/s13568-018-0617-0. [34] o. uko, a. ataja, and h. tanko, "performance of rabbits fed cereal offals as replacement for maize," tropical animal production investigation, vol. 4, pp. 67-76, 2001. [35] t. o. abegunde, o. a. adedeji, e. k. asaniyan, r. olajide, e. o. ewuola, f. o. sowole, a. a. mako, and m. a. ogunsegun, "effect of replacing maize with garcinia kola leaf meal on performance, haematology, organ and carcass characteristics of rabbits," world journal of life sciences and medical research, vol. 3, pp. 67–74, 2014. [36] s. m. yashim, i. u. gadzama, and d. o. anene, "nutrients utilization and carcass characteristics of weaner rabbits as influenced by differently processed rattle box (crotolaria retusa) leaf meal," journal of animal production research, vol. 29, pp. 210-218, 2017. http://www.ext.colostate.edu/pubs/livestock/01618.html, animal review, 2020, 7(1): 1-13 12 © 2020 conscientia beam. all rights reserved. [37] m. sugur, k. v. jamuna, t. k. das, k. n. c. mouly, and k. c. singh, "histological changes in muscles of broiler rabbits fed. leucaena leucocephala," indian journal of veterinary anatomy, vol. 13, pp. 83-84, 2001. [38] w. h. pond, d. c. church, and k. r. pond, "basic animal nutrition and feeding," 4th ed new york: john and sons publication, 1995. [39] s. a. abubakar and a. bello, "rabbit production in semi arid zone of sokoto state," american journal of biomedical science & research, vol. 7, pp. 224-232, 2020. available at: https://doi.org/10.34297/ajbsr.2020.07.001147. [40] o. adedeji, s. amao, s. ameen, t. adedeji, and t. ayandiran, "effects of varying levels of leucaena leucocephala leaf meal diet on the growth performance of weaner rabbit," journal of environmental issues and agriculture in developing countries, vol. 5, pp. 5-9, 2013. [41] o. makinde, p. enyigwe, s. babajide, j. atsumbe, e. ibe, and i. samuel, "growth performance and carcass characteristics of finisher broilers fed rice offal based diets supplemented with exogenous enzyme," greener journal of agricultural sciences, vol. 4, pp. 144-149, 2014. available at: https://doi.org/10.15580/gjas.2014.4.041814191. [42] k. c. okorie, "the effect of palmitic acid fortified maize wet milling by-product on the performance of weaner rabbits," czech journal of animal science, vol. 48, pp. 365-370, 2003. [43] o. i. eustace, o. oluwakemi, and m. odueso, "response of some metabolic and biochemical indices in rabbits fed varying levels of dietary cyanide," african journal of biomedical research, vol. 6, pp. 43-47, 2003. available at: https://doi.org/10.4314/ajbr.v6i1.54022. [44] o. adu, m. ladipo, o. adebiyi, a. akinfemi, and f. igbasan, "performance and blood characteristics of pre-pubertal rabbits fed varied levels of dietary rare earth element (ree)," world applied sciences journal, vol. 6, pp. 1489-1494, 2009. [45] m. k. ladipo, o. a. adu, s. d. oyefeso, and i. w. akinmuyisitan, "growth performance and blood profile of male rabbits fed dietary cerium oxide," international journal of agriculture, forestry and fisheries, vol. 3, pp. 87-92, 2015. available at: https://doi.org/10.3329/jbs.v21i0.22521. [46] o. o. adejinmi, o. m. odetola, and j. a. omole, "performance and carcass characteristics of growing rabbits fed diets containing different fibrous ingredients," journal of agricultural science, vol. 5, pp. 198-203, 2013. available at: https://doi.org/10.5539/jas.v5n9p198. [47] g. t. iyeghe-erakpotobor, "utilization of arachis hypogea (groundnut) and lablab purpureus (lablab) forage meal fed sole or mixed by growing rabbits," tropicultura, vol. 30, pp. 199-203, 2012. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 17 © 2019 conscientia beam. all rights reserved. supernumerary teats in kalahari red goats in the humid tropics famakinde, s.a.1+ okwelum n.2 leigh, o.o.3 1,2institute of food security environmental resources and agricultural research, federal university of agriculture, abeokuta, nigeria. 3department of veterinary surgery and reproduction, faculty of veterinary medicine, university of ibadan, nigeria. (+ corresponding author) abstract article history received: 10 june 2019 revised: 17 july 2019 accepted: 20 august 2019 published: 7 october 2019 keywords supernumerary teat kalahari reproductive goats udder neonate mastitis. supernumerary teats (snt) are additional to the usual number of teats found on a cow (four), goat or sheep (two). information has been provided on the occurrence of teat abnormalities in the indigenous goat breeds in nigeria but there remains a dearth of information on the incidence of teat abnormalities in the kalahari red goats (krg). fifty two female lactating krg aged between 2-5 years were classified on the basis of the number of snt by visual appraisal. data was analyzed using descriptive statistics and independent sample t-test. 76.1% of the population possesses snt, 10.9% had one, 43.5% had two, 10.9% had three while 10.9% had four snt. 60% of the population of krg with snt had none of such teats functional/patent. 11.4% had one patent snt, 25.7% had two patent snt, 2.9% had four patent snt. the location of the snt in relation to the primary teat reveals that 86.3% of the snt are cranial, 1.3% of the snt are caudal, 10.0% of the snt are medial while 2.5% of the snt are lateral. 74.36% of krg studied had symmetrical udders while 25.45% had asymmetrical udder. the study concluded that possible reproductive implications of high percentage of snt in krg may include neonatal death of kids especially in multiple births and higher risk of mastitis in does. reproductive veterinarians and breeders should watch out for goats with snt when carrying out breeding soundness examination. contribution/originality: this study is one of the few studies which have investigated the occurrence of supernumerary teats in the kalahari red goats with its reproductive implications. the study also provides one of the earliest reports of supernumerary teats that are positioned lateral and medial to the primary teat in the goat. 1. introduction supernumerary teat (snt) have been described as teats that are additional to the usual number of teats found on a cow (four), goat (two), or sheep (two). such snt’s can most of the times be nonfunctional and rudimentary although sometimes they may produce milk [1]. snt’s that have no duct connecting them to the main gland cistern are usually non-functional irrespective of their sizes while snt’s that are functional may be connected to small gland or the main gland cistern thereby possessing the ability to produce milk. the primary teat is a functional teat properly connected to the gland cistern with external orifice. it is usually larger and easily distinguishable from the snt. presence of supernumerary teat also known as hyperthelia, is a common teat abnormality in certain species of livestock which has been reported to have detrimental effects on milking functionality especially with the milking machine. it reduces the machine milking efficiency thereby increasing animal review 2019 vol. 6, no. 2, pp. 17-23 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2019.62.17.23 © 2019 conscientia beam. all rights reserved. https://orcid.org/0000-0002-7467-5487 https://orcid.org/0000-0002-9510-558x https://orcid.org/0000-0001-7806-837x https://www.doi.org/10.18488/journal.ar.2019.62.17.23 animal review, 2019, 6(2): 17-23 18 © 2019 conscientia beam. all rights reserved. milking time and potential injury to the teat. such injury can be sources of infection and can predispose the animal to mastitis [2]. snt has been reported as a congenital condition resulting from combination of some recessive homozygous genes [3]. presence of snt may not affect milk yield and kids suckling [4] except when snt’s are large in size and non-functional where it potent a danger of emaciation and death to kids that holds on to such teats for suckling. frequency of snt varies between species, breeds and geographical location. seventeen percent (17%) of animals out of 398 turkish saanen goats from the same herd were discovered to have snt [5]. 1.65% of the population of goats examined in bihar, indian were found to possess snt among other udder abnormality [6]. several studies have reported the presence of snt as a major udder abnormality in both wad and rs goat [7, 8] which are our indigenous breeds in nigeria. ozoje [8] also reported the occurrence of snt in 44% of the population of goat he studied. in a survey of 589 wad goats, bemji and popoola [9] reported an incidence of 7.3% of snt. the result of oseni, et al. [10] revealed that 64.3% of goats in the southern part of nigeria possess extra teat. adebayo and chineke [11] in a similar work discovered the presence of extra teat in 5% of goats sampled in the south western part of nigeria. the kalahari red goat is a newly introduced breed of goat into nigeria few years ago with certain unique features such as ability to adapt easily to the arid and semi-arid savannah, high-quality foraging tendency and excellent mothering aptitude [12] consequently it is popularly known as a “minimum care/maximum profit” breed [13]. the kalahari red goat has been found to have coat colours similar to the indigenous red sokoto goats but tending more towards the reddish brown colour. this breed is being kept for both meat and milk purposes. baseline information has been provided on the occurrence of teat abnormalities in the indigenous breeds of goat (west african dwarf and red sokoto) in nigeria over the years. however there is dearth of information on the incidence of teat abnormalities in the kalahari red goats following its introduction into south western nigeria. this study was therefore designed to evaluate the frequency of occurrence of some teat abnormalities in the kalahari red goat adapted to south western nigeria and the possible reproductive implication. 2. materials and methods 2.1. experimental location the study was carried out at the kalahari red goat unit domiciled in the institute of food security, environmental resources and agricultural research of the federal university of agriculture abeokuta. abeokuta, capital city of ogun state in south-west nigeria is situated at longitude709’39” n and latitude 3020’54”w and it is 76m above sea level. it falls within the rainforest vegetation zone of south-western nigeria [14]. it has a relative humidity averaged of 82%; mean annual precipitation of 1037mm, and a mean annual temperature of 33.70c, [14]. experimental animals and management: fifty two female lactating kalahari red goats were randomly sampled. the goats were reared semi-intensively. they were housed from the evening to early morning in the goat pens and were allowed to graze for about six hours daily on pasture paddocks sown with chloris gayana and stylosanthes hammata. supplementary concentrate was made available for the animals in the morning offered at 4% body weight dry matter while fresh water was provided ad-libitum. 2.2. data collection and analysis the goats were classified on the basis of the number of snt (0, 1, 2, 3, and 4) by visual appraisal. special notice was taken of the location of snt to the primary teat, distance between snt and the primary teat, length of snt, percentage of fused teat and percentage of functional snt. a teat was considered functional/patent if it oozes out milk when digital pressure is applied on the udder. the primary teat is always conspicuously bigger than the snt and always connected to the gland cistern, hence always produces milk during lactation. distance and length was determined using measuring tape. all parameters were taken with the animal being properly restrained with the hindquarters of the animal slightly raised up to allow for proper visual appraisal and accurate measurement of the animal review, 2019, 6(2): 17-23 19 © 2019 conscientia beam. all rights reserved. length and distance of each snt. data was analyzed using descriptive statistics and independent sample t-test. results were presented in frequencies, percentages, mean and standard error as appropriate. 3. results table-1. occurrence of snt and fused snt in percentages. occurrence of snt yes no presence of snt % 76.1 23.9 presence of fused snt% 8.6 91.4 table 1 shows the incidence of snt and the incidence of fused snt in the population studied. 76.1% of the population of kalahari red does possess supernumerary teats while only about 23.9% of the population does not possess snt. about 8.6% of the snt observed were fused. table-2. number of snt per animal and number of patent snt in percentages. number 0 1 2 3 4 no. of snt per animal (%) 23.9 10.9 43.5 10.9 10.9 no. of patent snt (%) 60 11.4 25.7 0 2.9 table 2 presents the number of snt per animal in the population studied. 23.9% had no snt, 10.9% had one, 43.5% had two, 10.9% had three while 10.9% had four snt. 60% of the population of krg with snt had none of such teats functional/patent. 11.4% had one patent snt, 25.7% had two patent snt, 2.9% had four patent snt. table-3. occurrence of snt in relation to either side of the animal’s udder and udder symmetry in percentages. position both side right left asymmetrical symmetry snt % 83.87 9.68 6.45 25.64 74.36 the occurrence of snt in relation to either side of the animal’s udder and udder symmetry is presented in table 3. 83.87% of the snt observed were on both sides of the udder, 9.68% of the snt were only on the right udder and 6.45% were only on the left udder. 74.36% of krg studied had symmetrical udders while 25.45% had asymmetrical udder. table-4. snt location in relation to the primary teat in percentages. location percentages cranial 86.3 caudal 1.3 medial 10.0 lateral 2.5 figure-1. length of snt on each side of the udder presented in percentages. the location of snt in relation to the primary teat is presented in table 4. 86.3% of the snt are cranial, 1.3% of the snt are caudal, 10.0% of the snt are medial while 2.5% of the snt are lateral. animal review, 2019, 6(2): 17-23 20 © 2019 conscientia beam. all rights reserved. figure-2. distance between snt and primary teat presented in percentages. figure-3. right mastitic udder of a krg with two snt. 4. discussions 23.9% of the population studied had normal two teats. this compares favorably with 18.2% previously reported in the krg [15]. this difference in the occurrence of snt might be due to the difference in the number of animals investigated. furthermore, 76.1% of the krg goat population studied had the presence of supernumerary teats. this incidence is higher compare to other breeds of goats such as 12% in barbari goats [16] 1.65% in goats in india [6] 0.00% in wad and yankasa breed of sheep in southern part of nigeria [17]. 17% in wad goats in raheem and leigh [18] 5% in wad goats in south western nigeria (11), 7.3% in wad in south western nigeria [9] 30% in wad goats in ghana [19] and 11% reported in red sokoto goat in kano, northern nigeria [10]. this high incidence of snt observed in the krg may be due to breed specification and possible genetic involvement. the occurrence of fused teat is also known as synthelia. fused teat may also be called bifid teat or fork teat or bifurcal teat. fused teats are usually found to split for a short distance near the tip while the remaining parts shares the same shaft which may sometimes be wider than normal. occasionally a flap of skin is left in the teat canal thereby allowing milk to ooze out of two different orifices [20]. 8.6% of the snt observed in this study were fused, this similar to the report of raheem and leigh [18] in which one out of the eighteen animals studied had a fork teat. generally occurrence of fused teats is not a predominant teat abnormality in the krg. kids usually find it very difficult to suckle from fused teats because they are usually close to each other and therefore too big for the kid to latch on properly. authors suggest that the population of goats with fused teat may influence pre-weaning kid survival. animal review, 2019, 6(2): 17-23 21 © 2019 conscientia beam. all rights reserved. in addition, the present study reveals that 10.9% had one snt, 43.5% had two, 10.9% had three while 10.9% had four snt. these values are higher compared to the values in the wad goats which had 5.43%, 1.19% and 0.68% of one, two and four snt respectively [9]. the values are however similar to previous reports in kalahari in nigeria [15]. occurrence of two extra teats was found to have the highest incidence (43.5%) in this present study. this is similar but slightly lower to previous reports in krg in which 57.6% of the animals with snt had two extra teats [15]. the study reports the presence of 6 teats in 10.9% of the population of animals with snt. this is one of the earliest reports of presence of 4 snt in the kalahari red goat. 25.7% of the population with extra teats had two patent/functional snt. this is lower than the 100% functional two extra teats reported in sirohi breed in india [21] and lower than 36% functional snt in cattle [22]. the 100% functional snt in the sirohi goats may be due to the fact that the teats were almost as long as the primary teats in which case in the kalahari goats, the extra teats had varying lengths (0.1 – 4.0cm). moreover, percentage of individual animal with symmetrical udder in this study (74.36) is slightly lower than reports of bemji, et al. [15] on kalahari red goats (87.4%). on the contrary, the percentage of does with asymmetrical udder was higher (25.64) than previous reports in wad 4.92% (9), 5.7% [7]. this higher percentage of asymmetrical udder may be influence by the high occurrence of snt in the krg. the predominant location of snt in the krg is cranial to the primary teat. this is similar to previous reports in wad [18, 19]. there were also 1.3% of snt caudal to the primary/main teat. however, the occurrences of snt lateral (2.5%) and medial (10%) to the primary teats seem to be a peculiar traits in the krg. the length of the snt in this study varies between 0.1cm and 4.0cm. this is higher than earlier values in wad in which the length of snt observed varied between 0.2cm and 1.6cm [18]. evidently 0.1cm -2.0cm constitutes the major length of the snt in krg observed in this study as about 75.61% and 79.48% of extra teats on both right and left udder respectively falls within this range of length. 26.8% and 26.8% of the population studied had snt on the right udder with length varying from 0.1cm to 0.5cm and 0.6cm to 1.0cm respectively figure 1. the longest snt which was about 3.5-4.0 cm was found on the right udder with 2.44% of the population possessing such a long snt figure 1. the distance between the snt and primary teat in this study varies on both sides of the udder. this result is at variance with the report of raheem and leigh [18] in which the distance between the snt on both sides of the udder was equidistant to the primary teat. the reason for the wide variation (0-5cm) in the distance between the primary teat and snt in the krg figure 2 may not be well understood, the authors suggest that it may be due to certain inherent traits and gene expressions peculiar to the kalahari red goat. 73.7% on the left and 62.5% on the right has the distance between the primary teat and snt to fall in the range of 0-1cm length. this reflects that predominantly in the krg, the primary teat and the snt may be less than or equal to 1cm apart figure 2. 4.1. reproductive implications of supernumerary teats 1. if new born attach to non-functional teats, they will be unable to access colostrums through which passive immunity should be transferred to the kid thereby making the kid susceptible to diseases which may lead to neonatal death. 2. continuous attempts by kids to suckle from non-functional teats may result to death, since the kids will not have access to milk. this is more likely to occur in cases of multiple births (twinning and triplets). 3. occurrence of snt usually predisposes such animal to ascending infections through the external orifice of the extra teat thereby resulting into udder affections such as mastitis figure 3. mastitis will usually affect either one or the two side of the udder such that milk from that side of the udder is unfit for kid consumption. when kids are not having adequate milk daily, it can make them vulnerable to other opportunistic infection and ultimately death of the kid. the cost of treatment and control of mastitis will result into economic loss for the farmer. animal review, 2019, 6(2): 17-23 22 © 2019 conscientia beam. all rights reserved. 4. since the occurrence of snt has been linked with some recessive homozygous genes that can be passed down from one generation to another, reproductive veterinarians and breeders should watch out for goats with snt when carrying out breeding soundness examination. such animals should be screened out and not to be selected for breeding purposes. 4.2. suggested interventions 1. early diagnosis of this congenital abnormality is important for prompt interventions. diagnosis is best carried out by routine examination of the animal starting from three [3] to four [4] months of life. 2. surgical removal of snt can best be carried out at about 4 months of life, at which time its connectivity with the gland cistern is not necessarily considered [2]. surgical excision at later age especially post pubertal or after lactation potent a more complex procedure. 3. however, snts can be of advantage when there is damage to the primary teat structure, thereby requiring a teat grafting. a snt can therefore be used to replace the primary teat [23]. 5. conclusion occurrence of snt constitutes a major teat abnormality in the kalahari red goat. prevalence of hyperthelia in the krg should be considered as a marker when seeking for milk improvement breeds. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: authors appreciate the staffs and management of the kalahari red project of the institute of food security, environmental resources and agricultural research for providing the animals used for this study. special thanks go to mr. joshua akapo and mr idowu dende for support and assistance rendered in the course of this work. references [1] animal welfare approved, "animal welfare approved program." available: http://www.animalwelfareapproved.org, 2013. [2] m. brka, n. reinsch, and e. kalm, "determination of the inheritance pattern of hyperthelia in cattle by maximum likelihood analysis," journal of animal breeding and genetics, vol. 117, pp. 425-431, 2000. available at: https://doi.org/10.1046/j.1439-0388.2000.00273.x. [3] m. brka, n. reinsch, and e. kalm, "is there linkage between supernumerary teats in cattle and bta3 markers?," archives animal breeding, vol. 45, pp. 429-432, 2002. available at: https://doi.org/10.5194/aab-45-429-2002. [4] a. i. a. osuagwuh, "incidence and control of pre-weaning mortality and abortion in small ruminants," in proceedings of national conf. on small ruminant production in nigeria. october 6-10, zaria, nigeria, 1985, pp. 239-252. [5] m. n. brka, e. k. reinsch, c. tolu, and t. savas, "heritability of supernumerary teats in turkish saanen goats," presented at the 58th annual meeting of eaap. dublin, ireland, 2007. poster 50, 2007. [6] a. chakrabarti, p. chandran, p. kumar, and a. dey, "teat and udder disorders in goats (capra hircus) in bihar, india," asian journal of life sciences, vol. 2, pp. 20-22, 2014. available at: https://doi.org/10.14737/journal.sajls/2014/2.2.20.22. [7] o. amao, o. osinowo, c. lakpini, m. dipeolu, s. abiola, and c. onwuka, "types and frequency of udder shapes and abnormalities in west african dwarf and red sokoto goats," nigerian journal of animal production, vol. 30, pp. 253258, 2003. available at: https://doi.org/10.4314/njap.v30i2.3303. [8] m. ozoje, "incidence and relative effects of qualitative traits in west african dwarf goat," small ruminant research, vol. 43, pp. 97-100, 2002. available at: https://doi.org/10.1016/s0921-4488(01)00264-4. [9] m. bemji and s. popoola, "a note on the incidence of udder abnormalities in west african dwarf goat in south western nigeria," livestock research for rural development, vol. 23, p. 49, 2011. animal review, 2019, 6(2): 17-23 23 © 2019 conscientia beam. all rights reserved. [10] s. b. oseni, g. sonaiya, a. omitogun, and i. m. ajayi, "west african dwarf goat production under village condition: characterization and the establishment of breed standards," in conference on international agricultural research for development. october, 11-13, university of bonn, tropentag. germany, 2006, pp. 5-10. [11] j. adebayo and c. chineke, "evaluation of west african dwarf goat for some qualitative traits in southwestern nigeria," african journal of agricultural research, vol. 6, pp. 6204-6207, 2011. [12] s. a. famakinde, o. o. leigh, a. j. odeyemi, and b. o. oluwatosin, "reproductive parameters of prostaglandin-treated female kalahari red goats in abeokuta, ogun state, nigeria," alexandria journal for veterinary sciences, vol. 53, pp. 180186, 2017. [13] k. ramsay, l. harris, and a. kotze, landrace breeds: south africa’s indigenous and locally developed farm animals. south africa: farm animal conservation trust, 2001. [14] google earth, available: https://www.google.com › earth, 2006. [15] m. n. bemji, h. a. tukur, and s. i. umejesi, "incidence of udder abnormalities in west african dwarf and kalahari red goats: influence of teat number on milk production," bulletin of animal health and production in africa, vol. 64, pp. 21-31, 2016. [16] c. s. mary and m. s. david, goat medicine. iowa usa: wiley blackwell publishers, 2011. [17] a. e. salako, international journal of biodiversity and conservation, vol. 5, pp. 47-53, 2013. [18] k. a. raheem and o. o. leigh, "supernumenary teat in west africa dwarf goat in ibadan, southwest nigeria," iosr journal of agriculture and veterinary science, vol. 7, pp. 60-63, 2014. available at: https://doi.org/10.9790/238007816063. [19] e. oppong and j. gumedze, "supernumerary teats in ghanaian livestock. i. sheep and goats," contributions to tropical agriculture and veterinary medicine, vol. 20, pp. 63-67, 1982. [20] b. lorrie, "more on teats." national pigmy goat association. available: http;//www.npga.com/resources, 2017. [21] s. l. choubisa and s. zulfiya, "hyperthelia in goats of sirohi breed, rajasthan, india cib tech journal of zoology," an online international journal, vol. 2, pp. 47-48, 2013. [22] s. r. nouh, a. s. korittum, m. h. elkammar, and w. m. barakat, "retrospective study of teat surgical affections in dairy farms of armed forces and their treatment," alexandria journal of veterinary sciences, vol. 40, pp. 65-76, 2014. available at: https://doi.org/10.5455/ajvs.45201. [23] s. saifzadeh, f. f. ardebili, r. hobbenaghi, and j. farid, "teat tip reconstruction by supernumerary teat autotransplantation in cattle," veterinary surgery, vol. 34, pp. 366-371, 2005. available at: https://doi.org/10.1111/j.1532-950x.2005.00056.x. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 5 © 2019 conscientia beam. all rights reserved. probiotic supplementation in poultry production as an alternative to antibiotic feed additive muhammad waseem birmani1 aamir nawab2 muhammad waseem ghani3 guanghui li4 jiang wu5 wenchao liu6 lilong an7+ 1,2,3,4,5,6,7department of livestock productions and management, agricultural college, guangdong ocean university, guangdong, china. (+ corresponding author) abstract article history received: 6 march 2019 revised: 8 april 2019 accepted: 14 may 2019 published: 2 july 2019 keywords antibiotics resistant growth promoters probiotics poultry production. provision of safe and healthy poultry products to the human being is the prime objective of the poultry industry, but one should keep in mind the welfare of animals and reverence for the environment. meat and eggs demand also increasing with the increase in world human population. to meet this increasing demand for meat and eggs, antibiotics growth promoters were used world widely. after the ban on antibiotics growth promoters due to its residual effects on human health, nutritionists are focusing on novel growth promoters those without causing productivity loss, or product quality has augmented. therefore, probiotics are a safe alternative to antibiotics and its beneficial effects proven from many decades. live microorganisms are used to deliver health benefits to chicken, usually by reestablishing or improving the intestinal microbiota. probiotics have a beneficial effect on weight gain, immunity, meat traits and somewhat impact on gut health of poultry. the subject of review paper will be worthwhile meant for researchers and poultry nutritionists to advance their understanding of alternatives to antibiotics in poultry production without affecting performance and the welfare of chicken. contribution/originality: this study is important in regards to antibiotic resistance in human being coming from animal products. antibiotic resistance is one of the biggest public health challenges of our time. each year so many people get an antibiotic-resistant infection, and many people die. fighting this threat is a public health priority that requires a collaborative global approach across sectors. so, this study will give direction to researchers and food producers to avoid from antibiotics harmful effects to animals and as well as human being. 1. introduction poultry business recognized as one of the rapidly growing section among different agriculture sectors. consumption of meat and eggs is increasing due to easy availability, comparatively reasonable price and also rich in entire important nutrients which could cover the deficiencies of essential food amino acids, minerals, and vitamins dhama, et al. [1]; ajit, et al. [2]. rinttilä and apajalahti [3] reported that poultry intestinal health has been investigated and studied extensively for the higher production performance of chicken, as the intestine is an important site where nutrient absorption takes place. while the gut is the main organ which exposed more to pathogens microorganisms after skin [4]. for this purpose, since 1940 antibiotics were used in animal feed as animal review 2019 vol. 6, no. 1, pp. 5-16 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2019.61.5.16 © 2019 conscientia beam. all rights reserved. https://orcid.org/0000-0001-8018-0133 https://www.doi.org/10.18488/journal.ar.2019.61.5.16 animal review, 2019, 6(1): 5-16 6 © 2019 conscientia beam. all rights reserved. growth promoters and for gut health maintenance [5-8]. antibiotics can improve growth rate [9] but on the other hand, resistance to antimicrobial agents is increasing between foodborne microbes that can make difficulties in public health remedies [10, 11]. also, antibiotics also destroy some beneficial microflora of gut which may help in feed digestion. furthermore, antibiotics reduced the growth rate by escalating dysbacteriosis and subclinical necrotic enteritis [12]. started from sweden in the year 1986, antibiotics were taken out from the diet of poultry, and pig world widely [6]. since 2006, antibiotics usage as an animal feed additive is banned by the european union. therefore, a need for the development of novel interventions that only target pathogenic microorganisms whereas safe for beneficial organisms [13]. recently nutritionists put their efforts on given that a unique and different growth promoter and therapeutic agents for disease prevention as well as for the enhancement of chicken immune status to avoid antibiotics harmful residual influences on meat and eggs products [14, 15]. manufacturing probiotic feed and food is a crucial progress area for future practical feed and food industry. currently, the use of probiotics is generating a great deal of interest for improvement in poultry production [16]. probiotics have been used for health benefits in animal feed as well as in human diet for several years as antibiotics alternative [17]. both fao, as well as who in 2002, has well accepted that probiotics are viable microorganisms those must be safe and sufficient for body function that gives benefit to the health status of both animals and humans [18]. moreover, hill, et al. [19] also gave statement same as fao and who for probiotics definition, but he opined simple grammatical correction that probiotics are living microorganisms when consumed by animals in sufficient quantities, will improve animals health and productivity. probiotics when added into feed the gut microflora can also be balanced. probiotics microorganisms provide benefits to the animals through improving intestinal microbial balance and as a result enhancing absorption of nutrients, feed efficiency, the growth rate of chicken and economic output of birds [20]. there are so many beneficial and protective effects of probiotics such as removing pathogenic bacteria by competitive exclusion. furthermore, the positive use of live microorganisms helps in increasing growth and productive performance, egg quality, and composition in layers chicken, improve nutrients digestion and absorption and also maintain the chicken health [21-23]. the ultimate noteworthy advantage of probiotics is that in animal products, which consumed by humans have no residues and it does not exert any resistance in the human while consuming animals products. also, they have a beneficial impact on the production performance of chicken [24, 25]. many studies told us that probiotics have immunomodulatory effects [26, 27]. probiotics as an alternative to antibiotics growth promoters have become prevalent in the poultry industry because consumers demand meat from animals without antibiotics residues [28]. probiotic species used in chicken were streptococcus, bifidobacterium, lactobacillus, bacillus, candida, enterococcus, saccharomyces, and aspergillus have a beneficial influence on the weight gain of broilers [29, 30]. the principal objective of our review paper is to describe the positive effects of probiotics in poultry production as an alternative to antimicrobial growth promoters, their mechanism of action, and impact on immunity, meat traits, and their selection criteria and also to review their uses in the poultry production. 2. why we need an alternative to antibiotics? when the ban on antibiotics growth promoter agents in animals in 2006 by the european union due to the following possible risks to animals as well as to human. 1. antimicrobial resistance develops and threatens the actual prevention and treatment of an ever-increasing range of infections produced by microorganisms. 2. antimicrobial resistance is a serious increasing risk for global public health that necessitates action across all societies worldwide. 3. if antibiotics lose their effectiveness due to resistance come from animal meat consumption, the success in the treatment of major diseases would be compromised. animal review, 2019, 6(1): 5-16 7 © 2019 conscientia beam. all rights reserved. 4. treatment cost of the antimicrobial resistant patient may increase to longer illness duration, extra tests and more expensive drugs use [31]. due to the above possible threats to human health from antibiotics, we need an alternative growth promoter for poultry production. 3. what is probiotic? probiotic is single or multi-cultured alive microorganisms which improve the beneficial indigenous microflora of host [32]. probiotics were first used in 1954 to indicate substances that were required for a healthy life. rather, et al. [33] included the bacterial metabolites and dead bacterial culture in the probiotics definition. they are applied in farm animal nutrition to increase weight gains and for the improvement of feed conversion. microorganisms such as mix cultures of different microbes, fungi especially mushroom and yeast and bacteria have been previously used as probiotics. willis, et al. [34] constantly used fungi myceliated grains colonized as probiotic for broiler chicken by the eatable mushrooms shiitake (lentinula edodes). for the treatment of eimeria tenella infection in chickens, wild mushroom ganoderma lucidum used ogbe, et al. [35]. lee, et al. [36] reported that saccharomyces boulardii yeast also used as a treatment of eimeria infection in poultry. in poultry for the control of pathogenic bacterial infection, yeast (saccharomyces cerevisiae) and aspergillus oryzae (fungi) also were used as probiotics [37]. while bacterial species are more frequently used as probiotic than fungal probiotic species. probiotics also have the ability to eliminate many pathogenic bacteria such as escherichia coli, staphylococcus aureus, salmonella typhimurium, clostridium perfringens, and so on iannitti and palmieri [38]. kabir [39] reported, commonly used probiotics microbes are intestinal strains mostly, e.coli, lactobacillus casei, l.helveticus, l.plantarum, l.acidophilus, l.lactis, l.salivarius, enterococcus faecium, e.faecalis, and bifidobacterium species. 4. selection criteria of probiotics the probiotics strains selection is based mainly on its potential to confer a health benefit for poultry. for achieving beneficial results from the use of probiotics must fulfill the following requirements. should be nonpathogenic and nontoxic to poultry. exact taxonomic identification of probiotic species must consider. a typical inhabitant of the directed species that can survive, colonization and must be resistant to bile, enzymes and other gastric juice of host and metabolically active in the targeted site [40]. bile tolerance in the small intestine is important for the survival of lactic acid producing bacteria and also for the functionally active in the intestine [41, 42]. can compete with pathogenic microflora of gut for adhesion to the intestinal epithelium. genetically stable that can produce antimicrobial substances to antagonize the pathogenic flora and to regulate the host immune response. when added in the poultry feed it must show there required organoleptic and technological properties. a concerned strain of probiotic must have stability during manufacturing, storage, and during delivery. it should have maximum sustainability at higher populations [40]. 5. forms of probiotics probiotics are presented in different forms for example in liquid, powder, sachets, paste, tablets, gel, and granules or capsules and many other different forms [38]. dry forms of probiotics showed enhanced tolerance power to gut environment and higher shelf life during storage. good viability of probiotic in poultry is available with the use of hydroxypropyl methylcellulose phthalate-55 as a tablet matrix [38]. 6. mechanisms of action of probiotics probiotics have a number of the mode of actions based on the competitive exclusion of pathogenic bacteria, production of antibacterial substances and organic acids production for inhibition of all pathogens mazmanian, et al. [43]; tiwari, et al. [44]. roselli, et al. [45] proposed that probiotics can moreover govern the anti-inflammatory animal review, 2019, 6(1): 5-16 8 © 2019 conscientia beam. all rights reserved. cytokines production. probiotics have the ability to regulate and maintain the intestinal barrier functions and gut microbiota homeostasis, salminen, et al. [46] regulate the gut enzymatic activity and absorption of essential nutrients hooper, et al. [47]; timmerman, et al. [48] also gill [49] studied that it prevents procarcinogenic enzymes activity and also interfere with pathogens to inhabit and infect the gut mucosa. furthermore, probiotics have the ability to improve the protein as well as some minerals like calcium, iron, manganese, and copper absorption from the gut by making acidic ph of the intestine; regulate the production of mucous, regulate epithelial functions and increase intestinal motility [50]. also act as an immunomodulator [51] as probiotics exert effects on host antigen presenting cells, regulatory t cells, effector b and t cells, and enterocytes as well [52]. probiotic can activate various immune cells and exert immunomodulatory effect by affecting the t-helper cells in a specific manner [53]. probiotic bacteria can also lessen the cardiovascular diseases risk by lowering blood cholesterol levels of the host animal [54]. unraveled antiviral potential of probiotic bacteria (lactobacillus plantarum yml009) against h1n1 influenza virus was demonstrated by rather, et al. [33]. hydrogen peroxide and lactic acid production increased in the gut when fed probiotics, as probiotics have the ability to enhance the growth of beneficial gram-positive bacteria, lower the number of intestinal pathogenic microbes [14]. 7. advantages of probiotic for poultry there are so many beneficial properties of probiotics for poultry proposed by piva [55]; jenkins, et al. [56]; simmering and blaut [57]. 1. have the ability to modify intestinal microbiota of chicken 2. the stimulatory effect on the immune system of chicken 3. reduce inflammatory reactions in the host 4. prevent pathogen colonization in the intestine 5. enhance the performance of animal 6. have the ability to lessening the carcass contamination 7. lower the blood cholesterol level observed beneficial for chicken 8. it decreases the ammonia and urea excretion from the chicken 8. effect of probiotics on weight gain many studies revealed that probiotics supplementation to poultry has a constructive influence on chicken health and performance. improved performance of broiler and reduced level of blood cholesterol were seen with the supplementation of the probiotic (pediococcus acidilactici). significant improvement in daily weight gain and in carcass yield was observed in experimental birds than control during all study periods of 6 weeks in both vaccinated and non-vaccinated birds [30, 58, 59]. the addition of milk kefir about 2% as prebiotics in meat-type chickens drinking water would increase growth performance of broilers, and it may also be supplemented in the chicken feed. for achieving the best performance of poultry, only optimum probiotics level was better than an increase in doses (quantity) of probiotics [60]. reduction in the requirements of protein as well as essential amino acids was observed when spores of bacillus subtilis used as probiotics feed additive and as a result, the cost of production for per kilogram weight gain can be decreased mojtaba, et al. [61]. rajput, et al. [62] reported that the addition of saccharomyces boulardii and bacillus subtilis as probiotics bring improvement in chicken to live body weight, increases bursa of fabricius, as well as thymus weight. also, it was reported that a significant improvement observed in weight gain and the weight of thymus and bursa of fabricius in probiotics fed groups [60]. 9. effect of probiotics in immunomodulation in addition on the way to the improvement in production performance, probiotics also enhance immunity against salmonella challenge without adverse effects on kidney functions in broiler chicks observed by dina, et al. animal review, 2019, 6(1): 5-16 9 © 2019 conscientia beam. all rights reserved. [27]. newcastle antibody titers were significantly higher in broiler chicken fed probiotics as a supplement in the diet as compared to control group rowghani, et al. [63]. alkhalf, et al. [60] investigate that at 28 and 42 days of age the thymus relative weight was greater in all supplemented groups than the control group which leads to an increase in lymphocytes numbers in the primary lymphoid organs of the chicken. spleen weight was observed greater for the probiotics fed chickens than the control group [64]. moreover, the relative weight of bursa was improved and increased number of medullar follicles found in the probiotics fed groups as compared to control groups of animals [65]. increase in the bursal relative weight could be a primary positive indication for immunity improvement in meat-type chickens [66]. clostredium butyricum when given as a supplement in the feed as probiotics produce large amounts of short-chain fatty acids, such as butyrate and acetate [67] which are an energy resource for animals and exert proliferative effects on colonocytes [68]. in broiler chickens improved immunity and balance in intestinal microbiota was observed when chicken fed with c. butyricum as a probiotic yang, et al. [69]. midilli, et al. [70] investigated that the antibody-mediated immune response was higher in probiotic-fed animals group. moreover, presentation of immune-related t helper cells was higher due to probiotic supplementation in diet [71]. these above findings were confirmed and elaborated by koenen, et al. [24] when they use probiotics and investigated that these special effects were mediated by cytokines which secreted by immune cells and this process were stimulated by probiotics. 10. effect of probiotics on gut health we find after a brief review of the literature that probiotics have very limited effects on the core physiological functions (digestion, absorption, and propulsion) of the digestive tract of poultry. the strengthening of the intestinal mucosal barrier against harmful agents is the major function of probiotics. however, the increase in jejunal goblet cells, jejunal and ileal villus height and width were improved when giving saccharomyces boulardii and bacillus subtilis in the diet. the findings of rajput, et al. [62] revealed that, an increase in jejunal immunoglobulins (iga-positive) cell numbers in probiotic fed animal groups. it has been stated that probiotics species those have more influence on the modulation of gut microbes and the inhibition of pathogenic microbiome are saccharomyces, aspergillus, bacillus, candida, streptococcus, bifidobacterium, enterococcus, and lactobacillus [25, 72]. the pathogenic microbes inhibition could be somewhat because of the acidic ph of the gut. the decrease in ph is due to the breakdown of carbohydrates by probiotics bacteria in the gut which consequently produces volatile fatty acids as well as lactic acid and succinic acid some time, and these acids production in gut ultimately reduces the ph of the intestine [73]. it is recommended that probiotics supplementation in poultry make a valuable contribution as they do not require a withdrawal period. 11. probiotics effects on chicken meat traits for meat processing and storage physicochemical properties (ph, color, texture, etc.) are much important. as these physicochemical properties are interconnected and could affect the meat quality. for processing and storage of meat, meat color and ph of meat is an important trait of meat quality, and these both traits together should be considered for meat quality evaluation [74]. above mention traits are closely linked to water holding capacity of meat, it is another significant characteristic of meat. when bacillus subtilis fed to broiler chickens and meat from these chickens was stored for 7 days, during storage the significant decreased in ph was observed and this lower ph is beneficial for meat storage [75]. significantly increase in the breast meat redness was observed when lactobacillus fermentum was added in broiler drinking water as probiotics [76]. and the redness in meat is most favored by consumers [77]. however, the other experiment of haščík, et al. [78] revealed the significant increases in the lightness of thigh and breast meat cuts and also increased in yellowness and redness in thighs cuts when supplementation of probiotic used in mixture with bee pollen in the broiler. overall meat sensory attributes were evaluated and described that supplementation of probiotics in broiler chicken diet enhanced the meat quality and animal review, 2019, 6(1): 5-16 10 © 2019 conscientia beam. all rights reserved. microbiological values through the pre-freezing as well as post freezing meat storage [79]. the total viable bacterial count was lower for meat obtained from probiotic fed chickens as compared to the meat of control birds. also, quality traits of the meatballs appearance, juiciness, texture, and wholesome acceptability were significantly higher in probiotic fed birds while for flavor were lower in probiotics fed birds [80]. on the other hand, improved tenderness and overall quality of meat reported when fed cell components of saccharomyces cerevisiae as probiotics by [81]. tenderness of poultry, as well as other livestock meat, might be made better by supplementing the whole yeast or yeast extract from saccharomyces cerevisiae. 12. effect of probiotics on the oxidation of lipid in meat lipid oxidation is a very important deteriorating factor of meat quality and also for other food quality. lipid oxidation commonly complemented via the development of negative changes in odors and flavors. fatty acids composition of meat, linked with the nutritional value of meat is a key component of meat quality. different studies revealed that the fatty acids profile of meat positively affected by probiotics feeding, a major positive effect was the reduction of saturated fatty acids contents and an increase in polyunsaturated fatty acids in meat. when aspergillus awamori and saccharomyces cerevisiae used separately or in a combination in broiler diet, the significant reduction in saturated fatty acids profile and increase in polyunsaturated fatty acid in meat was observed [82]. the thiobarbituric acid reactive substances (tbars-test) profile is usually a measure of oxidation in food and also in meat. significantly decreased content of tbars in breast broiler was observed those fed probiotic (aspergillus awamori and aspergillus niger). also increased tocopherol level in muscle was observed and led to low lipid oxidation in the experimental groups saleh, et al. [83]. abdurrahman, et al. [84] studied that probiotics showed significant antioxidant activity observed in both in-vitro as well as in-vivo trials. 13. conclusion the demand for antibiotics free residues meat and eggs are probably increasing with the increase in world population and advancement in technology. therefore, to cope with the increasing meat and food demands we need more proficient and fast methods. even though still probiotics are not well established in animal diet, but probiotics are a much better alternative to antibiotics in poultry production as probiotics have ability to improving poultry intestinal microflora, nutrients utilization, immune response and so on. with the advancement in research and technology, we have a list of probiotics species that have a beneficial impact on the animal as well as on a human. while the implementation of probiotics as an alternative growth promoter is not well developed in poultry production, with research advancement, probiotics will grow into an effective means for the antibiotics free residues meat and eggs production. further research on the beneficial impact of probiotics as antibiotics alternative will definitely advantage for all poultry producers countries. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] k. dhama, r. tiwari, r. u. khan, s. chakraborty, m. gopi, k. karthik, m. saminathan, p. a. desingu, and l. t. sunkara, "growth promoters and novel feed additives improving poultry production and health, bioactive principles and beneficial applications: the trends and advancesa review," international journal of pharmacology, vol. 10, pp. 129159, 2014. available at: https://doi.org/10.3923/ijp.2014.129.159. animal review, 2019, 6(1): 5-16 11 © 2019 conscientia beam. all rights reserved. [2] s. y. ajit, k. gautham, g. marappan, k. kumaragurubaran, s. m. yashpal, and k. d., "exploring alternatives to antibiotics as health-promoting agents in poultrya review," journal of experimental biology and agricultural sciences, vol. 4, pp. 368-383, 2016. available at: https://doi.org/10.18006/2016.4(3s).368.383. [3] t. rinttilä and j. apajalahti, "intestinal microbiota and metabolites—implications for broiler chicken health and performance," journal of applied poultry research, vol. 22, pp. 647-658, 2013. available at: https://doi.org/10.3382/japr.2013-00742. [4] m. yegani and d. korver, "factors affecting intestinal health in poultry," poultry science, vol. 87, pp. 2052-2063, 2008. available at: https://doi.org/10.3382/ps.2008-00091. [5] h. gaskins, c. collier, and d. anderson, "antibiotics as growth promotants: mode of action," animal biotechnology, vol. 13, pp. 29-42, 2002. [6] j. dibner and j. richards, "antibiotic growth promoters in agriculture: history and mode of action," poultry science, vol. 84, pp. 634-643, 2005. available at: https://doi.org/10.1093/ps/84.4.634. [7] t. niewold, "the nonantibiotic anti-inflammatory effect of antimicrobial growth promoters, the real mode of action? a hypothesis," poultry science, vol. 86, pp. 605-609, 2007. available at: https://doi.org/10.1093/ps/86.4.605. [8] n. eckert, j. lee, d. hyatt, s. stevens, s. anderson, p. anderson, r. beltran, g. schatzmayr, m. mohnl, and d. caldwell, "influence of probiotic administration by feed or water on growth parameters of broilers reared on medicated and nonmedicated diets," journal of applied poultry research, vol. 19, pp. 59-67, 2010. available at: https://doi.org/10.3382/japr.2009-00084. [9] a. nisha, "antibiotic residues-a global health hazard," veterinary world, vol. 2, pp. 375-377, 2008. available at: https://doi.org/10.5455/vetworld.2008.375-377. [10] h. l. dupont, "the growing threat of foodborne bacterial enteropathogens of animal origin," clinical infectious diseases, vol. 45, pp. 1353-1361, 2007. available at: https://doi.org/10.1086/522662. [11] b. s. seal, h. s. lillehoj, d. m. donovan, and c. g. gay, "alternatives to antibiotics: a symposium on the challenges and solutions for animal production," animal health research reviews, vol. 14, pp. 78-87, 2013. available at: https://doi.org/10.1017/s1466252313000030. [12] i. palamidi, k. fegeros, m. mohnl, w. abdelrahman, g. schatzmayr, g. theodoropoulos, and k. mountzouris, "probiotic form effects on growth performance, digestive function, and immune related biomarkers in broilers," poultry science, vol. 95, pp. 1598-1608, 2016. available at: https://doi.org/10.3382/ps/pew052. [13] national academy of sciences, "treating infectious diseases in a microbial world: report of two workshops on novel antimicrobial therapeutics. washington, d.c.," p. 10. available: https://www.nap.edu/read/11471/chapter/1, 2006. [14] y. yang, p. iji, and m. choct, "dietary modulation of gut microflora in broiler chickens: a review of the role of six kinds of alternatives to in-feed antibiotics," world's poultry science journal, vol. 65, pp. 97-114, 2009. available at: https://doi.org/10.1017/s0043933909000008. [15] a. s. yadav, g. kolluri, m. gopi, k. karthik, y. s. malik, and k. dhama, "exploring alternatives to antibiotics as health promoting agents in poultry—a review," journal of experimental biology and agriculture sciences, vol. 4, pp. 368– 383, 2016. available at: https://doi.org/10.18006/2016.4(3s).368.383. [16] h. shweta and i. d. sanjida, "production of the best natural health supplements using fruit waste materials," international journal of innovativerresearch & development, vol. 3, pp. 131-133, 2014. [17] m. j. zorriehzahra, s. t. delshad, m. adel, r. tiwari, k. karthik, k. dhama, and c. c. lazado, "probiotics as beneficial microbes in aquaculture: an update on their multiple modes of action: a review," veterinary quarterly, vol. 36, pp. 228-241, 2016. available at: https://doi.org/10.1080/01652176.2016.1172132. [18] fao/who, "guidelines for the evaluation of probiotics in food," london, ontario, canada: food and agriculture organization of the united nations and world health organization working group report; 20022002. [19] c. hill, f. guarner, g. reid, g. r. gibson, d. j. merenstein, b. pot, l. morelli, r. b. canani, h. j. flint, and s. salminen, "expert consensus document: the international scientific association for probiotics and prebiotics consensus http://www.nap.edu/read/11471/chapter/1 animal review, 2019, 6(1): 5-16 12 © 2019 conscientia beam. all rights reserved. statement on the scope and appropriate use of the term probiotic," nature reviews gastroenterology & hepatology, vol. 11, pp. 506-514, 2014. available at: https://doi.org/10.1038/nrgastro.2014.66. [20] m. abd el-hack, s. mahgoub, m. alagawany, and e. ashour, "improving productive performance and mitigating harmful emissions from laying hen excreta via feeding on graded levels of corn ddgs with or without bacillus subtilis probiotic," journal of animal physiology and animal nutrition, vol. 101, pp. 904-913, 2017. available at: https://doi.org/10.1111/jpn.12522. [21] m. m. ritzi, w. abdelrahman, m. mohnl, and r. a. dalloul, "effects of probiotics and application methods on performance and response of broiler chickens to an eimeria challenge," poultry science, vol. 93, pp. 2772-2778, 2014. available at: https://doi.org/10.3382/ps.2014-04207. [22] m. alagawany, m. e. a. el-hack, m. arif, and e. a. ashour, "individual and combined effects of crude protein, methionine, and probiotic levels on laying hen productive performance and nitrogen pollution in the manure," environmental science and pollution research, vol. 23, pp. 22906-22913, 2016. available at: https://doi.org/10.1007/s11356-016-7511-6. [23] t. popova, "effect of probiotics in poultry for improving meat quality," current opinion in food science, vol. 14, pp. 7277, 2017. available at: https://doi.org/10.1016/j.cofs.2017.01.008. [24] m. e. koenen, j. kramer, r. van der hulst, l. heres, s. h. m. jeurissen, and w. j. a. boersma, "immunomodulation by probiotic lactobacilli in layerand meat-type chickens," british poultry science, vol. 45, pp. 355-366, 2004. available at: https://doi.org/10.1080/00071660410001730851. [25] k. mountzouris, p. tsirtsikos, e. kalamara, s. nitsch, g. schatzmayr, and k. fegeros, "evaluation of the efficacy of a probiotic containing lactobacillus, bifidobacterium, enterococcus, and pediococcus strains in promoting broiler performance and modulating cecal microflora composition and metabolic activities," poultry science, vol. 86, pp. 309317, 2007. available at: https://doi.org/10.1093/ps/86.2.309. [26] y. yurong, s. ruiping, z. shimin, and j. yibao, "effect of probiotics on intestinal mucosal immunity and ultrastructure of cecal tonsils of chickens," archives of animal nutrition, vol. 59, pp. 237–246, 2005. available at: https://doi.org/10.1080/17450390500216928. [27] m. w. dina, s. el-hamd., and m. a. hams, "effect of probiotic on salmonella enteritidis infection on broiler chickens," egypt.j chem environ health, vol. 2, pp. 298-314, 2016. [28] n. v. christine, c. wen-ko, m. h. billy, r. b. luc, and r. b. lisa, . , "role of probiotics on immune function and their relationship to antibiotic growth promoters in poultry. a brief review," international journal of probiotics and prebiotics, vol. 11, pp. 1-6, 2016. [29] k. s. m. lutful, "the role of probiotics in the poultry industry," international journal of molecular science, vol. 10, pp. 3531-3546, 2009. [30] a. ashayerizadeh, n. dabiri, o. ashayerizadeh, k. h. mirzadeh, h. roshanfekr, and m. mamooee, "effect of dietary antibiotic, probiotic and prebiotic as growth promoters, on growth performance, carcass characteristics and hematological indices of broiler chickens," pakistan journal of biological sciences, vol. 12, pp. 52-57, 2009. available at: https://doi.org/10.3923/pjbs.2009.52.57. [31] a. awad, n. arafat, and m. elhadidy, "genetic elements associated with antimicrobial resistance among avian pathogenic escherichia coli," annals of clinical microbiology and antimicrobials, vol. 15, pp. 1-8, 2018. available at: https://doi.org/:10.1186/s12941-016-0174-9. [32] g. s. ghadban, "probiotics in broiler production-a review," arch. for poultry science, vol. 66, pp. 49-58, 2002. [33] i. a. rather, k. h. choi, v. k. bajpai, and y. h. park, "antiviral mode of action of lactobacillus plantarum yml009 on influenza virus h1n1," bangladesh journal of pharmacology, vol. 10, pp. 475–482, 2015. available at: https://doi.org/10.3329/bjp.v10i2.23068. animal review, 2019, 6(1): 5-16 13 © 2019 conscientia beam. all rights reserved. [34] w. l. willis, o. s. isikhuemhen, s. hurley, and e. i. ohimain, "effect of phase feeding of fungus myceliated grain on oocyst excretion and performance of boiler chicken," international journal of poultry science, vol. 10, pp. 1-3, 2011. available at: https://doi.org/10.3923/ijps.2011.1.3. [35] a. o. ogbe, s. e. atwod, p. a. abdu, a. sannusi, and a. e. itodo, "changes in weight gain, facal oocyst count and packed cell volume of eimereria tenella infected broiler treated with a wild mushroom (gahoderma lucidum) aqueous extract," journal of the south african veterinary association, vol. 80, pp. 97-102, 2009. available at: https://doi.org/10.4102/jsava.v80i2.179. [36] s. h. lee, h. s. lillehoj, r. a. dalloul, d. w. park, y. h. hong, and j. j. lin, "effects of pediococcus-based probiotic on coccidiosis in broiler chickens," poultry science, vol. 86, pp. 63-66, 2007. [37] k. c. woo, b. y. jung, m. k. lee, and i. k. paik, "effects of supplementary safmannan (beta glucan and mos) and world-las (multiple probiotics) on the performance, nutrient availability, small intestinal microflora and immune response in broiler chicks," korean journal of poultry science, vol. 33, pp. 151-158, 2006. [38] t. iannitti and b. palmieri, "therapeutical use of probiotic formulations in clinical practice," clinical nutrition, vol. 29, pp. 701-725, 2010. available at: https://doi.org/10.1016/j.clnu.2010.05.004. [39] s. kabir, "the role of probiotics in the poultry industry," international journal of molecular sciences, vol. 10, pp. 35313546, 2009. available at: https://doi.org/10.3390/ijms10083531. [40] g. francesca, p. mattarelli, and b. biavati, "probiotics and prebiotics in animal feeding for safe food production," international journal of food microbiology, vol. 141, pp. s15-s28, 2010. available at: https://doi.org/10.1016/j.ijfoodmicro.2010.02.031. [41] s. a. ibrahim and a. benzkorovainy, "survival of bifidobacterial in the presence of bile salts," journal of the science of food and agriculturec, vol. 62, pp. 351-354, 1993. [42] h. s. park, s. h. lee, and t. b. uhm, "selection of microorganism for probiotics and their characterization," the korean journal of food and nutrition, vol. 27, pp. 433-440, 1998. [43] s. k. mazmanian, j. l. round, and d. l. kasper, "a microbial symbiosis factor prevents intestinal inflammatory disease," nature, vol. 453, pp. 620-625, 2008. available at: https://doi.org/10.1038/nature07008. [44] g. tiwari, r. tiwari, s. pandey, and p. pandey, "promising future of probiotics for human health: current scenario," chronicles of young scientists, vol. 3, pp. 17-28, 2012. available at: https://doi.org/10.4103/2229-5186.94308. [45] m. roselli, a. finamore, m. s. britti, p. bosi, i. oswald, and e. mengheri, "alternatives to in-feed antibiotics in pigs: evaluation of probiotics, zinc or organic acids as protective agents for the intestinal mucosa. a comparison of in vitro and in vivo results," animal research, vol. 54, pp. 203-218, 2005. available at: https://doi.org/10.1051/animres:2005012. [46] s. salminen, e. isolauri, and e. salminen, "clinical uses of probiotics for stabilizing the gut mucosal barrier: successful strains and future challenges," antonie van leeuwenhoek, vol. 70, pp. 347-358, 1996. available at: https://doi.org/10.1007/bf00395941. [47] l. v. hooper, t. midtvedt, and j. i. gordon, "how host-microbial interactions shape the nutrient environment of the mammalian intestine," annual review of nutrition, vol. 22, pp. 283-307, 2002. [48] h. timmerman, l. mulder, h. everts, d. van espen, e. van der wal, g. klaassen, s. rouwers, r. hartemink, f. rombouts, and a. beynen, "health and growth of veal calves fed milk replacers with or without probiotics," journal of dairy science, vol. 88, pp. 2154-2165, 2005. available at: https://doi.org/10.3168/jds.s0022-0302(05)72891-5. [49] h. s. gill, "probiotics to enhance anti-infective defences in the gastrointestinal tract," best practice & research clinical gastroenterology, vol. 17, pp. 755-773, 2003. available at: https://doi.org/10.1016/s1521-6918(03)00074-x. [50] s. raghuwanshi, s. misra, and p. s. bisen, "indian perspective for probiotics: a review," indian ournal of dairy science, vol. 68, pp. 195-205, 2015. animal review, 2019, 6(1): 5-16 14 © 2019 conscientia beam. all rights reserved. [51] n. h. salzman, d. ghosh, k. m. huttner, y. paterson, and c. l. bevins, "protection against enteric salmonellosis in transgenic mice expressing a human intestinal defensin," nature, vol. 422, pp. 522-526, 2003. available at: https://doi.org/10.1038/nature01520. [52] t. a. oelschlaeger, "mechanisms of probiotic actions–a review," international journal of medical microbiology, vol. 300, pp. 57-62, 2010. available at: https://doi.org/10.1016/j.ijmm.2009.08.005. [53] f. l. y. fong, n. p. shah, p. kirjavainen, and h. el-nezami, "mechanism of action of probiotic bacteria on intestinal and systemic immunities and antigen-presenting cells," international reviews of immunology, vol. 35, pp. 179-188, 2016. available at: https://doi.org/10.3109/08830185.2015.1096937. [54] m. l. jones, c. tomaro-duchesneau, c. j. martoni, and s. prakash, "cholesterol lowering with bile salt hydrolaseactive probiotic bacteria, mechanism of action, clinical evidence, and future direction for heart health applications," expert opinion on biological therapy, vol. 13, pp. 631-642, 2013. available at: https://doi.org/10.1517/14712598.2013.758706. [55] a. piva, "non-conventional feed additives," journal of animal and feed sciences, vol. 7, pp. 143–154, 1998. available at: https://doi.org/10.22358/jafs/69962/1998. [56] d. j. a. jenkins, c. w. c. kendall, and v. vuksan, "inulin oligofructose and intestinal function," the journal of nutrition, vol. 129, pp. 1431–1433, 1999. available at: https://doi.org/10.1093/jn/129.7.1431s. [57] r. simmering and m. blaut, "pro-and prebiotics–the tasty guardian angels?," applied microbiology and biotechnology, vol. 55, pp. 19-28, 2001. available at: https://doi.org/10.1007/s002530000512. [58] r. kalavathy, n. abdullah, s. jalaludin, and y. ho, "effects of lactobacillus cultures on growth performance, abdominal fat deposition, serum lipids and weight of organs of broiler chickens," british poultry science, vol. 44, pp. 139144, 2003. available at: https://doi.org/10.1080/0007166031000085445. [59] s. kabir, m. m. rahman, m. rahman, m. rahman, and s. ahmed, "the dynamics of probiotics on growth performance and immune response in broilers," international journal of poultry science, vol. 3, pp. 361-364, 2004. available at: https://doi.org/10.3923/ijps.2004.361.364. [60] a. alkhalf, m. alhaj, and i. al-homidan, "influence of probiotic supplementation on blood parameters and growth performance in broiler chickens," saudi journal of biological sciences, vol. 17, pp. 219-225, 2010. available at: https://doi.org/10.1016/j.sjbs.2010.04.005. [61] z. mojtaba, z. nahid, r. mohammad, and p. sudabeh, "effect of bacillus? subtilis spore (gallipro ® ) nutrients equivalency value on broiler chicken performance," italian journal of animal science, vol. 14, pp. 94-98, 2015. [62] i. rajput, l. li, x. xin, b. wu, z. juan, z. cui, d. yu, and w. li, "effect of saccharomyces boulardii and bacillus subtilis b10 on intestinal ultrastructure modulation and mucosal immunity development mechanism in broiler chickens," poultry science, vol. 92, pp. 956-965, 2013. available at: https://doi.org/10.3382/ps.2012-02845. [63] e. rowghani, m. arab, and a. akbarian, "effects of a probiotic and other feed additives on performance and immune response of broiler chicks," international journal of poultry science, vol. 6, pp. 261-265, 2007. available at: https://doi.org/10.3923/ijps.2007.261.265. [64] b. r. dizaji, a. zakeri, a. golbazfarsad, s. faramarzy, and o. ranjbari, "influences of different growth promoters on intestinal morphology of broiler chickens," european journal of experimental biology, vol. 3, pp. 32-37, 2013. [65] h. shoeib, "response of broiler chicks to probiotic (pronifer) supplementation," assiut veterinary medical journal, vol. 36, pp. 103-116, 1997. [66] c. s. potten, "stem cells in gastrointestinal epithelium: numbers, characteristics and death," philosophical transactions of the royal society of london. series b: biological sciences, vol. 353, pp. 821-830, 1998. available at: https://doi.org/10.1098/rstb.1998.0246. [67] s. nakanishi, k. kataoka, t. kuwahara, and y. ohnishi, "effects of high amylose maize starch and clostridium butyricum on metabolism in colonic microbiota and formation of azoxymethane-induced aberrant crypt foci in the rat animal review, 2019, 6(1): 5-16 15 © 2019 conscientia beam. all rights reserved. colon," microbiology and immunology, vol. 47, pp. 951-958, 2003. available at: https://doi.org/10.1111/j.13480421.2003.tb03469.x. [68] d. l. topping and p. m. clifton, "short-chain fatty acids and human colonic function: roles of resistant starch and nonstarch polysaccharides," physiological reviews, vol. 81, pp. 1031-1064, 2001. available at: https://doi.org/10.1152/physrev.2001.81.3.1031. [69] c. yang, g. cao, p. ferket, t. liu, l. zhou, l. zhang, y. xiao, and a. chen, "effects of probiotic, clostridium butyricum, on growth performance, immune function, and cecal microflora in broiler chickens," poultry science, vol. 91, pp. 2121-2129, 2012. available at: https://doi.org/10.3382/ps.2011-02131. [70] m. midilli, m. alp, n. kocabach, o. muglah, n. turan, h. yilmaz, and s. cakir, "effects of dietary probiotic and prebiotic supplementation on growth performance and serum igg concentration of broilers," south african journal of animal science, vol. 38, pp. 21-27, 2008. available at: https://doi.org/10.4314/sajas.v38i1.4104. [71] b.-l. chiang, y. sheih, l. wang, c. liao, and h. gill, "enhancing immunity by dietary consumption of a probiotic lactic acid bacterium (bifidobacterium lactis hn019): optimization and definition of cellular immune responses," european journal of clinical nutrition, vol. 54, pp. 849-855, 2000. available at: https://doi.org/10.1038/sj.ejcn.1601093. [72] h. yaman, z. ulukanli, m. elmali, and y. unal, "the effect of a fermented probiotic, the kefir, on intestinal flora of poultry domesticated geese (anser anser)," journal of veterinary medicine, vol. 157, pp. 379-386, 2006. [73] t. sakata, t. kojima, m. fujieda, m. takahashi, and t. michibata, "influences of probiotic bacteria on organic acid production by pig caecal bacteria in vitro," proceedings of the nutrition society, vol. 62, pp. 73-80, 2003. available at: https://doi.org/10.1079/pns2002211. [74] a. węglarz, "meat quality defined based on ph and colour depending on cattle category and slaughter season," czech journal of animal science, vol. 55, pp. 548-556, 2010. available at: https://doi.org/10.17221/2520-cjas. [75] n. r. abdulla, a. n. mohd zamri, a. b. sabow, k. y. kareem, s. nurhazirah, f. h. ling, a. q. sazili, and t. c. loh, "physico-chemical properties of breast muscle in broiler chickens fed probiotics, antibiotics or antibiotic–probiotic mix," journal of applied animal research, vol. 45, pp. 64-70, 2017. available at: https://doi.org/10.1080/09712119.2015.1124330. [76] p. haščík, l. trembecká, m. bobko, j. čuboň, o. bučko, and j. tkáčová, "evaluation of meat quality after application of different feed additives in diet of broiler chickens," potravinarstvo slovak journal of food sciences, vol. 9, pp. 174-182, 2015. available at: https://doi.org/10.5219/429. [77] s. jiang, z. jiang, g. zhou, y. lin, and c. zheng, "effects of dietary isoflavone supplementation on meat quality and oxidative stability during storage in lingnan yellow broilers," journal of integrative agriculture, vol. 13, pp. 387-393, 2014. available at: https://doi.org/10.1016/s2095-3119(13)60386-x. [78] p. haščík, l. trembecká, m. bobko, m. kačániová, o. bučko, j. tkáčová, and s. kunová, "effect of different feed supplements on selected quality indicators of chicken meat," potravinarstvo slovak journal of food sciences, vol. 9, pp. 427-434, 2015. available at: https://doi.org/10.5219/517. [79] s. kabir, m. rahman, and m. rahman, "potentiation of probiotics in promoting microbiological meat quality of broilers," bangladesh journal of agricultural research, vol. 2, pp. 93-96, 2005. [80] p. mahajan, j. sahoo, and p. panda, "effect of probiotic (lacto-sacc) feeding, packaging methods and seasons on the microbial and organoleptic qualities of chicken meat balls during refrigerated storage," journal of food science and technology (mysore), vol. 37, pp. 67-71, 2000. [81] a. zhang, b. lee, s. lee, k. lee, g. an, k. song, and c. lee, "effects of yeast (saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks," poultry science, vol. 84, pp. 1015-1021, 2005. available at: https://doi.org/10.1093/ps/84.7.1015. [82] a. a. saleh, k. hayashi, and a. ohtsuka, "synergistic effect of feeding aspergillus awamori and saccharomyces cerevisiae on growth performance in broiler chickens; promotion of protein metabolism and modification of fatty acid animal review, 2019, 6(1): 5-16 16 © 2019 conscientia beam. all rights reserved. profile in the muscle," the journal of poultry science, vol. 50, pp. 242-250, 2013. available at: https://doi.org/10.2141/jpsa.0120153. [83] a. a. saleh, y. z. eid, t. a. ebeid, t. kamizono, a. ohtsuka, and k. hayashi, "effects of feeding aspergillus awamori and aspergillus niger on growth performance and meat quality in broiler chickens," the journal of poultry science, vol. 48, pp. 201-206, 2011. available at: https://doi.org/10.2141/jpsa.011019. [84] z. h. abdurrahman, y. b. pramono, and n. suthama, "feeding effect of inulin derived from dahlia tuber combined with lactobacillus sp. on meat protein mass of crossbred kampong chicken," j indonesian trop anim agric, vol. 41, pp. 37-44, 2016. available at: https://doi.org/10.14710/jitaa.41.1.37-44. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 53 © 2017 conscientia beam. all rights reserved. competency assessment of veterinary medicine students who are trained in basra veterinary hospital 2017 mudhar a. s. abu tabeekh1 1basra veterinary hospital, basra, iraq abstract article history received: 1 january 2018 revised: 16 january 2018 accepted: 19 january 2018 published: 22 january 2018 keywords basra hospital competency assessment veterinary students. this study designated to evaluate the competency of veterinary students who are trained in basra veterinary hospital-basra governorateiraq. in the student life, performance evaluations should revealed areas of excellence. very little research has considered in training evaluation in a veterinary sciences. the test was carried out by the students of the veterinary medicine collegebasra university from the third and fourth stages who succeeded to the fourth and fifth stages. one hundred and two students participated in the performance evaluation, 47 students from the fourth stage and 55 from the third stage. totally, there were 100 multiple questions presented to the participants. the questions included 13 aspects of veterinary sciences disciplines. the results of this study revealed that the evaluation of the competency of veterinary students in the fourth stage was higher compared to the third stage by comparing the percentage of correct answers for both groups (65.86 and 60.95) respectively. in addition, the two groups recorded high percentage in physiology correct answers and low percentage in animal hygiene for the fourth year students and infectious diseases for the third year. contribution/originality: very little research has considered in training evaluation in a veterinary sciences. this study contributes to the educational literature by assessing the level of the trainee students using the method of direct questioning, which represents a good method in evaluating the veterinary performance to improve skills of veterinary undergraduates. 1. introduction the word competence be used to describe the attribute and ability of the person and competency as the skill itself [1]. in-training evaluations are a common but highly criticized method of assessing the competency of veterinary students completing training. they involve assessment of on-going performance in the workplace, performed by the supervisor. they are highly feasible and one of the few ways that a student’s performance in an authentic context can be evaluated [2]. however, veterinary competency is not easy to assess. it is complex, context dependent, and partly involves skills and attitudes that are not observable. it is also not well defined. frequently definitions are locally created, and are supported more often by expert and stakeholder opinion than empirical research [3]. veterinary competency encompasses cognitive aspects of formal and tacit discipline knowledge, problem solving abilities, and clinical judgment; functional aspects of veterinary-specific technical skills and generic skills such as record keeping; and social aspects such as communication, interpersonal skills, and animal review 2017 vol. 4, no. 4, pp. 53-57 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2017.44.53.57 © 2017 conscientia beam. all rights reserved. https://orcid.org/0000-0002-2513-0499 http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2017.44.53.57&domain=pdf&date_stamp=2017-01-14 animal review, 2017, 4(4): 53-57 54 © 2017 conscientia beam. all rights reserved. personal and professional behaviours and attitudes. overarching these are metacompetencies that enable students to acquire and grow in competency and to mobilise and combine different dimensions of competency in a way appropriate for the context [4]. assessing learners in natural settings offers the opportunity to see beyond what they know and into what they actually do, which is fundamentally essential to training qualified physicians. residents and students report rarely being observed during their educational process, even though they value the experience. reasons for this include a lack of faculty time, a lack of faculty skills, a potential stressful effect on the learner, and a perceived lack of validation of the assessment [5]. during 2017, the veterinary hospital in basra provided many veterinary services. developing the scientific and practical skills of the students is of great importance so that future veterinarians can perform their duties through implementing the treatment and vaccination plan. competency is thus of central importance to both the education of veterinarians and their initial and continued certification to practice [2]. the study aimed to investigate the development of veterinary skills of veterinary undergraduates and describes the evaluation of summer training intended to enhance students' performance on their veterinary knowledge. 2. materials and methods this study was conducted in the veterinary hospital headquarter in basra governorate. the study reported here investigates the reliability and validity of a standardized evaluation form used to assess students' knowledge, clinical skills and professionalism during the summer training for fourth and third stage students of veterinary medicine collegebasra university who succeeded to the fourth and fifth stages. one hundred and two students participated in the veterinary competence test, 47 students from the fourth stage and 55 from the third stage. the assessment of veterinary competence was conducted through direct questions to all students. totally, there were 100 multiple questions presented to the participants as powerpoint presentation. the participants allowed to answer these questions within a period of 30 seconds on paper prepared for this purpose. the participants names were recorded and the test papers were collected and corrected. the questions included 13 aspects of veterinary sciences disciplines such as: infectious disease, animal hygiene, internal medicine, anatomy, physiology, nutrition, surgery, pharmacology, parasitology, fertility and parturition, microbiology, histology and poultry diseases. the marks of the test papers after corrections have been analyzed in charts. the percentages of true answers were classified according to participants categories, as well as according to different veterinary sciences. 3. results and discussion one of the main strategic objectives of the world organization for animal health (oie) is the continual development of up-to-date standards and guidelines for the management of veterinary services and their components [6]. monitoring a student’s progress towards achieving the necessary knowledge, skills, and attitudes for day one competency, and then certifying their achievement of it, is important to the student, so their learning is appropriately directed, but also important to ensure the safety of the public, the welfare of animals [2]. workplacebased assessment is often used as a general term describing a variety of methods of assessment that use ratings, including in-training evaluation [7, 8]. however, some authors do not include in-training evaluation as a type of workplace-based assessment [9]. the results of the veterinary competence assessment 2017 as showed in fig 1, reported that the results of the fourth stage were higher than the third (65.86 and 60.95) respectively. in a simple comparison of the results of this study with the results recorded in previous year, we note that the results recorded in 2016 for the fourth and third stage students according to abu [10] in the test of performance appraisal of veterinarians, were higher than the results of the current year (71.03 and 62.46) respectively. on the other hand, the results of 2017 were higher than those recorded in 2015 by abu [11] which were (62.26 and 56.80) respectively. animal review, 2017, 4(4): 53-57 55 © 2017 conscientia beam. all rights reserved. fig-1. the percentage of correct answers according to participants categories source: table was constitute from analyzed data of current study the students of forth stage were become more familiar in veterinary sciences and practice through their exercise in the hospital, where they came in contact with field work in animal husbandry and treatment. the low percentage of correct answers of 3rd year students referred to the lack of knowledge in the diagnosis of microbial agents and the treatment of diseases and this result may be due to inadequate field experiences. the findings of the current study as in fig. 2, showed that the percentage of correct answers of 4th year veterinary students was higher in compare to 3rd year students. the best results of the 4th year and 3rd students were recorded in physiology (80.39 and 78.18) respectively, while low percentages of correct answers was recorded for the 4th year students in animal hygiene 47.44 and for the 3rd students in infectious diseases 44.65. according to fig. 2, the percentage of correct answers of 4th year students in the other veterinary sciences were: internal medicine 68.23, histology 68.08, poultry diseases 59.84, surgery 70.97, fertility and parturition 56.11, pharmacology 67.62, microbiology 65.95, parasitology 66.22, nutrition 72.60, anatomy 71.40 and infectious diseases 54.25. for the 3rd year students, the percentage of correct answers were: internal medicine 57.01, histology 62.84, poultry diseases 51.47, surgery 58.83, fertility and parturition 52.61, pharmacology 61.03, microbiology 62.84, parasitology 66.13, nutrition 75.11, anatomy 66.81 and in animal hygiene 56.25. the 4th students were more superior students from the third year which might be due to the progression of the knowledge in the veterinary disciplines gained via their study and experiences. in addition 4th student gained a good experiences through the summer training when practiced at the veterinary hospital. fig-2. the percentage of correct answers of 4th and 3rdyear students according to the veterinary sciences source: table was constitute from analyzed data of current study animal review, 2017, 4(4): 53-57 56 © 2017 conscientia beam. all rights reserved. the competence evaluation revealed a clear idea to the deanship of the college of veterinary medicine to know the ability of their students in different veterinary disciplines and trying to improve the weakness in the educational curriculum. recent studies of veterinary practices and services have suggested that more attention must be focused on business practices and on the skills, knowledge, and abilities of veterinarians related to veterinary practice management [12]. so, there is a need for more research on assessment of veterinary competence in veterinary medical education. an example from a medical school, henry and mavis [13] discussed how their institution’s evaluations were insufficient for answering new and important questions that go beyond traditional cognitive measures: specifically, no data set was available that allowed the institution to answer questions about practice environment and curricular innovations. more recently, institutions have become interested in learning to what extent their broad missions are accomplished or not. similarly, academic leaders are not simply interested in performance of learners on tests of competence; they want to know more about how their graduates are doing in the practice setting. to answer questions such as these, educators must expand their systems of evaluations to address these broader themes. 4. conclusion the findings give insights into the process of judgment of competency by veterinary supervisors that will inform further research. one of the most desired purpose of this is to argue why educators should design more effective systems of evaluation that are responsive to the needs of educational program planning. the evaluation, encourage the academic staff of the college of veterinary medicine to recognized the strength and the weakness in the veterinary medical education and trying to improve the learning of veterinary curriculum. funding: this study received no specific financial support. competing interests: the author declares that there are no conflicts of interests regarding the publication of this paper. contributors/acknowledgement: the author would like to thank and appreciate the veterinary directorate represented by its general manager because of the continuous support and encourages in the development of skills of veterinary staff. many thanks and respect to the director of veterinary hospital in basra, enable us to conduct the evaluation, and finally a great respect to everyone who gave a help in performing this study especially all the participants categories. references [1] k. khan and s. ramachandran, "conceptual framework for performance assessment: competency, competence and performance in the context of assessments in healthcare--deciphering the terminology," medical teacher, vol. 34, pp. 920-928, 2012. view at google scholar | view at publisher [2] e. j. norman, "judging competency a study of in-training evaluation of veterinary students," phd thesis, massey university, manawatu, new zealand, 2016. [3] m. a. cake, m. a. bell, j. williams, f. brown, m. dozier, s. m. rhind, and s. baillie, "which professional (nontechnical) competencies are most important to the success of graduate veterinarians? a best evidence medical education (beme) systematic review: beme guide no. 38," medical teacher, vol. 38, pp. 550-563, 2016. view at google scholar | view at publisher [4] n. fernandez, v. dory, l. g. ste-marie, m. chaput, b. charlin, and a. boucher, "varying conceptions of competence: an analysis of how health sciences educators define competence," medical education, vol. 46, pp. 357-365, 2012. view at google scholar | view at publisher [5] h. b. fromme, r. karani, and s. m. downing, "direct observation in medical education: a review of the literature and evidence for validity," mount sinai journal of medicine, vol. 76, pp. 365-371, 2009. view at google scholar | view at publisher [6] oie, "oie’s sixth strategic plan for the period 2016 – 2020," presented at the 83rd general session world assembly, paris, 24-29 may, 2015. https://scholar.google.com/scholar?hl=en&q=conceptual%20framework%20for%20performance%20assessment:%20competency,%20competence%20and%20performance%20in%20the%20context%20of%20assessments%20in%20healthcare--deciphering%20the%20terminology http://dx.doi.org/10.3109/0142159x.2012.722707 https://scholar.google.com/scholar?hl=en&q=which%20professional%20(non-technical)%20competencies%20are%20most%20important%20to%20the%20success%20of%20graduate%20veterinarians?%20a%20best%20evidence%20medical%20education%20(beme)%20systematic%20review:%20beme%20guide%20no.%2038 https://scholar.google.com/scholar?hl=en&q=which%20professional%20(non-technical)%20competencies%20are%20most%20important%20to%20the%20success%20of%20graduate%20veterinarians?%20a%20best%20evidence%20medical%20education%20(beme)%20systematic%20review:%20beme%20guide%20no.%2038 http://dx.doi.org/10.3109/0142159x.2016.1173662 https://scholar.google.com/scholar?hl=en&q=varying%20conceptions%20of%20competence:%20an%20analysis%20of%20how%20health%20sciences%20educators%20define%20competence https://scholar.google.com/scholar?hl=en&q=varying%20conceptions%20of%20competence:%20an%20analysis%20of%20how%20health%20sciences%20educators%20define%20competence http://dx.doi.org/10.1111/j.1365-2923.2011.04183.x https://scholar.google.com/scholar?hl=en&q=direct%20observation%20in%20medical%20education:%20a%20review%20of%20the%20literature%20and%20evidence%20for%20validity http://dx.doi.org/10.1002/msj.20123 animal review, 2017, 4(4): 53-57 57 © 2017 conscientia beam. all rights reserved. [7] k. w. eva, g. bordage, c. campbell, r. galbraith, s. ginsburg, e. holmboe, and g. regehr, "towards a program of assessment for health professionals: from training into practice," advances in health sciences education, vol. 21, pp. 897913, 2016. view at google scholar | view at publisher [8] c. a. weijs, j. b. coe, and k. g. hecker, "final-year students' and clinical instructors' experience of workplace-based assessments used in a small-animal primary-veterinary-care clinical rotation," journal of veterinary medical education, vol. 42, pp. 382-392, 2016. view at google scholar | view at publisher [9] j. massie and j. m. ali, "workplace-based assessment: a review of user perceptions and strategies to address the identified shortcomings," advances in health sciences education, vol. 21, pp. 455-473, 2016. view at google scholar | view at publisher [10] t. m. a. s. abu, "the performance appraisal of veterinarians in basra veterinary hospitalbasra governorate/ iraq," international journal of information research and review, vol. 03, pp. 2960-2962, 2016. [11] t. m. a. s. abu, "the performance appraisal of veterinarians in different veterinary clinics in basra governorate/iraq," mirror of research in veterinary sciences and animals, vol. 4, pp. 17-24, 2015. [12] d. r. ilgen, "skills, knowledge, aptitudes, and interests for veterinary practice management: fitting personal characteristics to situational demands," journal of veterinary medical education, vol. 29, pp. 153-156, 2002. view at google scholar | view at publisher [13] r. c. henry and b. e. mavis, "a strategy for developing educational evaluations for learner, course, and institutional goals," journal of veterinary medical education, vol. 29, pp. 147-152, 2002. view at google scholar | view at publisher views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://scholar.google.com/scholar?hl=en&q=towards%20a%20program%20of%20assessment%20for%20health%20professionals:%20from%20training%20into%20practice http://dx.doi.org/10.1007/s10459-015-9653-6 https://scholar.google.com/scholar?hl=en&q=final-year%20students'%20and%20clinical%20instructors'%20experience%20of%20workplace-based%20assessments%20used%20in%20a%20small-animal%20primary-veterinary-care%20clinical%20rotation http://dx.doi.org/10.3138/jvme.1214-123r1 https://scholar.google.com/scholar?hl=en&q=workplace-based%20assessment:%20a%20review%20of%20user%20perceptions%20and%20strategies%20to%20address%20the%20identified%20shortcomings http://dx.doi.org/10.1007/s10459-015-9614-0 http://dx.doi.org/10.1007/s10459-015-9614-0 https://scholar.google.com/scholar?hl=en&q=skills,%20knowledge,%20aptitudes,%20and%20interests%20for%20veterinary%20practice%20management:%20fitting%20personal%20characteristics%20to%20situational%20demands https://scholar.google.com/scholar?hl=en&q=skills,%20knowledge,%20aptitudes,%20and%20interests%20for%20veterinary%20practice%20management:%20fitting%20personal%20characteristics%20to%20situational%20demands http://dx.doi.org/10.3138/jvme.29.3.153 https://scholar.google.com/scholar?hl=en&q=a%20strategy%20for%20developing%20educational%20evaluations%20for%20learner,%20course,%20and%20institutional%20goals http://dx.doi.org/10.3138/jvme.29.3.147 14 © 2020 conscientia beam. all rights reserved. essential and toxic metals determination in imported and fresh beef cattle meat sold in erbil markets azad b. sabow1+ nithal y. yakub2 shawnm j. saleh3 1,2,3department of animal sciences, college of agriculture engineering sciences, salahaddin university-erbil, kurdistan region, iraq. (+ corresponding author) abstract article history received: 20 may 2020 revised: 29 june 2020 accepted: 31 july 2020 published: 26 august 2020 keywords beef cattle meat contamination essential metals erbil city spectrometer toxic metals. meat of cattle (beef) constitutes a greater percentage of red meat in human diets because of its nutritive value and palatability. however, it can be contaminated with heavy metals just like other food materials. heavy metals are very harmful due to their ability to accumulate in human body. thus, this examination is completed to decide the heavy metals levels in frozen beef cattle meat obtained from different markets and fresh meat collected randomly from local beef cattle (iraqi) and imported beef cattle (brahman) at slaughterhouse in erbil city. the result showed that the concentrations of most studied heavy metals were found to be significantly higher in imported frozen boneless beef cattle meat than those of fresh boneless meat obtained from local and imported cattle. the results also reveal that the concentrations nickel and lead metals in imported frozen cattle beef meat surpassed as far as possible set by food and agricultural organization. the burden of the body with these components is extremely reliant on the concentration of the different components in main sources of animal protein, namely meat obtained from cattle. therefore, people that consume imported beef cattle meat are probably going to be presented to higher nickel and lead concentrations and might be harmful to the health. contribution/originality: this study is one of the very few studies which have investigated the concentration of some essential and toxic metals in imported and local cattle meat sold in the markets of erbil city, with emphasis on hygienic and toxicological aspects. 1. introduction meat from beef cattle is one of the essential sources of red meat in human food that is perceived as lean meat with high biological value (al-zuhairi, farhan, & ahemd, 2015). beef cattle meat is gaining preference by many meat consumers, thanks to its low intramuscular fat, mainly saturated fatty acid, and cholesterol level when contrasted with comparative cuts of mutton (pighin et al., 2016). regardless of its low in fats content when contrasted with meat from different ruminants, beef cattle meat has a high extent of unsaturated fatty acids notwithstanding being a source of conjugated linoleic corrosive, which have such useful consequences for human wellbeing as mitigating, hostile to thrombotic and atherosclerotic deterrents (daley, amber, patrick, glenn, & stephanie, 2010). moreover, beef cattle meat is likewise a source of niacin, vitamins b6 and b12, phosphorous, zinc, and iron. aside from meat framing an essential portion of the food we eat, it may carry certain toxic substance which is one of the sources of heavy metals for humans (fathy, ali, schwagele, & abd-el-wahab, 2011). in meat, toxic substances are caused by a number of sources including veterinary medicines, animal feed or drinking water, animal review 2020 vol. 7, no. 1, pp. 14-18. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2020.71.14.18 © 2020 conscientia beam. all rights reserved. https://orcid.org/0000-0003-2920-5811 https://orcid.org/0000-0002-5176-8592 https://orcid.org/0000-0002-5420-3159 https://www.doi.org/10.18488/journal.ar.2020.71.14.18 animal review, 2020, 7(1): 14-18 15 © 2020 conscientia beam. all rights reserved. agricultural chemicals and industrial chemicals (fathy et al., 2011). the occurrence of contamination of meat and its products with heavy metals during processing have additionally been informed (harlia & balia, 2010). since the contamination with heavy metals is poisonous quality, bio-magnification, and bioaccumulation in the evolved way of life, it is a serious risk to human health (demirezen & uruç, 2006). besides, meat tainting with heavy metals is worry for both human wellbeing and food security since these metals at minute levels are natural toxicity (santhi, balakrishnan, kalaikannan, & radhakrishnan, 2008). in the last few years, much attention has been focused on the concentration’s heavy metals of chicken meat as well as processed product of chicken meat with little information regarding the content of metals in meat of beef cattle. in the erbil governorate, meat of beef cattle is a main source of protein to the population and is largely consumed. to the best of our knowledge, there is a dearth of information regarding the content of metals in meat tissues of beef cattle in erbil city. hence, study was conducted in order to determine the concentration of some essential and toxic metals in imported and local cattle meat, with emphasis on hygienic and toxicological aspects. 2. material and methods 2.1. sample collection the current study was carried out between the periods of september 2017 to december 2017. meat samples of different types of beef cattle were collected and divided into imported frozen boneless beef meat of ukraine origin were bought from different markets, fresh boneless meat was collected randomly from local beef (iraqi cattle) and imported beef (brahman cattle) at slaughterhouse in erbil governorate, iraq. all samples were collected in polyethylene bags as per their category, transported to the lab and stored at -20 ºc until subsequent analyses. 2.2. samples treatment and analysis from each collected meat sample, ten grams were dried in an oven at 100 ºc and ground into a fine powder using a ceramic mortar for heavy metals evaluation. the amounts of essential (fe, co, cu and zn) and toxic metals (hg, ni, pb and as) were determined using x-ray fluorescence spectrometer (genius 9000 xrf, usa) according to procedure described by chelebi, bazzaz, yakub, bazzaz, and hammad (2015). the final results were expressed in milligram of metal per kilogram of dry meat 2.3. statistical analysis one way analysis of variance (anova) was applied to analysis data using the general liner model procedure of statistical analysis system (sas institute inc., cary, nc, usa) package version 9.2 software. significant levels at p<0.05 were carried out to assess whether means of the studied heavy metals varied significantly between frozen boneless beef cattle meat groups using duncan’s multiple range test. data obtained for essential and toxic metals were presented as mean ± standard error. 3. results and discussion the concentrations of essential metals in the different cattle meat samples are presented in table 1. iron (fe) and zinc (zn) have the highest concentration in the three meat samples as compared to the other elements. the imported frozen boneless beef meat contained significantly high concentration of fe (131.210 mg/kg meat) than fresh boneless meat from imported cattle (120.500 mg/kg meat) and local cattle (120.400 mg/kg meat). the high value of iron could be due to the amount of blood retained in meat which is determined by the slaughter method. blood contains a high amount of hemoglobin. hemoglobin is comprised of four polypeptide chains with each chain containing one haem group; gathering; every haem comprises of an iron iota composed inside the porphyrin ring (sabow et al., 2016). the poisonous quality of iron is represented by retention. the more you take in the more you are in danger. the iron is caught up in the ferrous state by cells of the intestinal mucous. gastric and intestinal animal review, 2020, 7(1): 14-18 16 © 2020 conscientia beam. all rights reserved. emissions can diminish ferric particles (the unusable type of the iron) to the ferrous (absorbable) state. ferritin is a one of a kind iron stockpiling protein containing 24 stockpiling proteins. at the point when overabundance dietary iron is assimilated, the body delivers more ferritin. ferritin is significantly inexhaustible in the heart and liver, consequently there is an expansive sum in these organs, and iron hurries to these organs for capacity. the body can just deliver such an extensive amount these proteins; notwithstanding, so abundance press develops in these organs and causes tissue devastation (aljaff, rasheed, & salh, 2014). in current study, iron in all samples fell within the recommended tolerable levels by fao/who (2011). significant differences were observed in the concentration of zn and the imported frozen boneless cattle meat and fresh boneless meat from imported cattle had the highest values (47.100 and 48.825 mg/kg meat) than the fresh boneless meat from local cattle (31.942 mg/kg meat). the values of zinc in all investigated samples were lower than the maximum zinc level allowed by fao/who (2011) for red meat (50 mg/kg). zinc element plays a vital role in human diet. taking excessively zinc is destructive to human wellbeing. according to badis, rachid, and esma (2014) ordinary groupings of zinc in meat samples was 35 45 mg/day, so it gives the idea that most researched tests in the present examination contained elevated amounts of zinc. nonetheless, our outcome for zinc was like those recorded by lópez alonso et al. (2000) and miranda, lópez-alonso, castillo, hernádez, and benedito (2005). these authors stated that muscles of cattle are the tissues where zinc is most likely to accumulate. the values of cobalt (co) in all samples of meat were not as much as allowable point of confinement (3 mg/kg). cobalt is an essential trace mineral for human body because it is an essential component of vitamin b12. this vitamin is important for making red blood cells (akan, abdulrahman, sodipo, & chiroma, 2010). copper is an essential nutrient for the human body as it helps maintain healthy bones, blood vessels, nerves and immune function as well as it contributes to iron absorption (lee & stuebing, 1990). in this study, the imported frozen boneless beef cattle meat had significantly higher copper concentration (15.416 mg/kg meat) compared with fresh boneless beef cattle meat from imported cattle (3.068 mg/kg meat) and the fresh boneless beef cattle meat from local cattle (1.502 mg/kg meat). however, the concentration of copper in studied meat samples was below the permissible limit of 40 mg/kg (fao/who, 2011). table-1. concentrations of essential metals in various meat samples sold in erbil markets. metal concentration (mg/kg dry weight) samples fresh boneless fresh boneless imported frozen boneless beef meat (ukraine) ipl beef meat beef meat (iraqi cattle/local) (brahman cattle/imported) iron 120.400 ± 0.300b 120.500 ± 0.386b 131.210 ± 0.0250a 140 cobalt 1.063 ± 0.025 1.089 ± 0.022 1.082 ± 0.006 1 copper 1.502 ± 0.087b 3.068 ± 1.040b 15.416 ± 0.960a 40 zinc 31.942 ± 2.546b 48.825 ± 7.208a 47.100 ± 3.397a 50 note: a,b means in the same row with different letters are significantly different at p<0.05. ipl international permissible limits. values are means ± standard error. concentration of toxic metals in various cattle meat samples available in markets of erbil city are shown in table 2. the concentration of nickel (ni) in the imported frozen boneless cattle meat, fresh boneless meat from local and imported cattle ranged between 6.191, 0.204, and 0.276 mg/kg meat, the highest ni concentration was observed in the imported frozen boneless beef cattle meat. the appropriate amount of nickel in human body is responsible for regulation of prolactin and stabilization of rna and dna structures, but at very high concentrations it can be negatively effect on human health (chowdhury et al., 2011). ni concentrations obtained from imported frozen and fresh beef cattle meat in this study were higher than the permitted mercury limit of 0.2 mg/kg (fao/who, 2011). the high concentrations of nickel could be due to the increased use of nickel in industrial and agricultural activities in the areas that meat or animals were imported from them. mercury was animal review, 2020, 7(1): 14-18 17 © 2020 conscientia beam. all rights reserved. detected at concentrations ranging between 0.014 and 0.019 mg/kg meat for the three studied samples and none of the samples exceeded the recommended limit of 1.0 mg/kg (fao/who, 2011). the level of lead in studied meat samples was present in the range of 0.486 to 0.723 mg/kg. the highest value of lead was detected in imported frozen boneless beef cattle meat while the lowest concentration was detected in local and imported fresh beef cattle meat. additionally, this study indicated that lead concentrations for imported frozen meat were above the recommended limits of 0.5 mg/kg set by fao/who (2011). lead is one of the major toxic heavy metals and can be affected children's brain development resulting in reduced intelligence performance as well as increased blood pressure and cardiovascular disease in adults (yakupa, sabowa, saleh, & mohammed, 2018). the obtained results showed that the arsenic (as) contents of meat samples ranged between 1.498 and 1.763 mg/kg. the lowest arsenic value recorded in local fresh beef cattle meat, while the highest concentrations were found in imported fresh boneless beef cattle meat. however, the obtained results for arsenic were lower than the standard permissible levels, 2.0 mg/kg (fao/who, 2011). the international agency for research on cancer has classified arsenic and arsenic compounds as carcinogenic to humans (nkansah & ansah, 2014). table-2. concentrations of toxic metals in various meat samples sold in erbil markets. metal concentration (mg/kg dry weight) samples fresh boneless beef meat (iraqi cattle/local) fresh boneless beef meat (brahman cattle/imported) imported frozen boneless beef meat (ukraine) ipl nickel 0.204 ± 0.095b 0.276 ± 0.017b 6.191 ± 0.117a 0.2 mercury 0.014 ± 0.004 0.019 ± 0.004 0.017 ± 0.001 1.0 lead 0.486 ± 0.008b 0.496 ± 0.064b 0.723 ± 0.030a 0.5 arsenic 1.498 ± 0.052 1.763 ± 0.076 1.623 ± 0.045 2.0 note: a,b means in the same row with different letters are significantly different at p<0.05. ipl international permissible limits. values are means ± standard error. 4. conclusion the present findings indicate that heavy metals namely, iron, cobalt, copper, zinc, nickel, mercury, lead and arsenic were detected in all the samples analyzed. among the eight heavy metals measured, the value of nickel and lead was observed in significantly high levels in imported frozen boneless cattle beef meat that exceeded the tolerance limit. therefore, the utilization of meat in which metal levels beyond the tolerated dose were detected may be hurtful to the consumers’ health, measurements beneath as far as possible, however not destructive, might posture health hazard when eaten in huge amounts because of bioaccumulation. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. acknowledgement: authors special thanks and much appreciation goes to the workers in slaughterhouse, erbil-iraq for their kindness and cooperation. references akan, j., abdulrahman, f., sodipo, o., & chiroma, y. (2010). distribution of heavy metals in the liver, kidney and meat of beef, mutton, caprine and chicken from kasuwan shanu market in maiduguri metropolis, borno state, nigeria. research journal of applied sciences, engineering and technology, 2(8), 743-748. al-zuhairi, w. s., farhan, m. a., & ahemd, m. a. (2015). determine of heavy metals in the heart, kidney and meat of beef, mutton and chicken from baquba and howaydir market in baquba, diyala province, iraq. international journal of recent scientific research, 6(8), 5965-5967. aljaff, p., rasheed, b. o., & salh, d. m. (2014). assessment of heavy metals in livers of cattle and chicken by spectroscopic method. iosr journal of applied physics, 6, 23-26. available at: https://doi.org/10.9790/4861-06122326. animal review, 2020, 7(1): 14-18 18 © 2020 conscientia beam. all rights reserved. badis, b., rachid, z., & esma, b. (2014). levels of selected heavy metals in fresh meat from cattle, sheep, chicken and camel produced in algeria. annual research & review in biology, 1260-1267. available at: https://doi.org/10.9734/arrb/2014/7430. chelebi, n. a., bazzaz, j. n. a., yakub, n. y., bazzaz, a. a., & hammad, g. r. (2015). heavy metal residues in frozen chicken meat consumed within erbil province. merit research journal of medicine and medical sciences, 3(11), 517-520. chowdhury, m. z. a., siddique, z. a., hossain, s. a., kazi, a. i., ahsan, a. a., ahmed, s., & zaman, m. m. (2011). determination of essential and toxic metals in meats, meat products and eggs by spectrophotometric method. journal of the bangladesh chemical society, 24(2), 165-172. available at: https://doi.org/10.3329/jbcs.v24i2.9705. daley, c. a., amber, a., patrick, s. d., glenn, a. n., & stephanie, l. (2010). a review of fatty acid profiles and antioxidant content in grass-fed and grain-fed beef. nutrition journal, 9(1), 10-24. available at: https://doi.org/10.1186/14752891-9-10. demirezen, d., & uruç, k. (2006). comparative study of trace elements in certain fish, meat and meat products. meat science, 74(2), 255-260. available at: https://doi.org/10.1016/j.meatsci.2006.03.012. fao/who. (2011). joint fao/who food standards programme codex committee on contaminants in foods. food, 2011, 1-89. fathy, a. k., ali, f. h., schwagele, f., & abd-el-wahab, m. a. (2011). heavy metal residues in beef carcasses in beni-suef abattoir, egypt. veterinaria italiana, 47(3), 351-361. harlia, e., & balia, r. l. (2010). the food safety of livestock products meatball, corned beef, beef burger and sausage studied from heavy metal residues contamination. animal production, 12(1), 50-54. lee, y. h., & stuebing, r. b. (1990). heavy metal contamination in the river toad, bufo juxtasper (inger), near a copper mine in east malaysia. bulletin of environmental contamination and toxicology, 45(2), 272-279. available at: https://doi.org/10.1007/bf01700195 lópez alonso, m., benedito, j., miranda, m., castillo, c., hernandez, j., & shore, r. (2000). toxic and trace elements in liver, kidney and meat from cattle slaughtered in galicia (nw spain). food additives & contaminants, 17(6), 447-457. available at: https://doi.org/10.1080/02652030050034028. miranda, m., lópez-alonso, m., castillo, c., hernádez, j., & benedito, j. l. (2005). effect of moderate pollution on toxic and trace metal levels in calves from a polluted area of northern spain. environment international journal, 31(34), 543–548. available at: https://doi.org/10.1016/j.envint.2004.09.025. nkansah, m. a., & ansah, j. k. (2014). determination of cd, hg, as, cr and pb levels in meat from the kumasi central abattoir. international journal of scientific and research publications, 4(8), 1-4. pighin, d., pazos, a., chamorro, v., paschetta, f., cunzolo, s., godoy, f., . . . grigioni, g. (2016). a contribution of beef to human health: a review of the role of the animal production systems. the scientific world journal, 2016, 1-10. available at: https://doi.org/10.1155/2016/8681491. sabow, a. b., zulkifli, i., goh, y. m., ab kadir, m. z. a., kaka, u., imlan, j. c., . . . sazili, a. q. (2016). bleeding efficiency, microbiological quality and oxidative stability of meat from goats subjected to slaughter without stunning in comparison with different methods of pre-slaughter electrical stunning. plos one, 11(4), e0152661. available at: https://doi.org/10.1371/journal.pone.0152661. santhi, d., balakrishnan, v., kalaikannan, a., & radhakrishnan, k. t. (2008). presence of heavy metals in pork products in chennai india. american journal of food technology, 3, 192-199. available at: https://doi.org/10.3923/ajft.2008.192.199. yakupa, n. y., sabowa, a. b., saleh, s. j., & mohammed, g. r. (2018). assessment of heavy metal in imported red meat available in the markets of erbil city. journal of university of babylon, 26(6), 177-183. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 21 © 2017 conscientia beam. all rights reserved. helminths and protozoa of the gastrointestinal tract of ruminants in tanzania emmanuel s swai1 r trevor wilson2+ 1directorate of veterinary services, dar-es-salaam, tanzania 2bartridge partners, bartridge house, umberleigh, uk (+ corresponding author) abstract article history received: 31 may 2017 revised: 12 july 2017 accepted: 4 august 2017 published: 21 august 2017 keywords nematodes trematodes cestodes coccidia disease resistance. tanzania has one of the largest populations of domestic ruminants in africa. their performance is less than their potential. health, particularly disease due to gastrointestinal parasites, is a major constraint to improved productivity. internal parasites also affect the country’s very diverse and huge array of wild ruminants. this review is based on a thorough search of the formal and informal literature pertaining to gastrointestinal parasites of ruminants in tanzania. the occurrence and geographical distribution of helminth (nematodes, trematodes and cestodes) and protozoan parasites are presented. cattle, goat and sheep nematodirus (roundworm) infection usually comprises mixed infections of several taxa of which 13 species in nine genera have been recorded. a total of seven species of trematodes (flukes) in six genera have been found. some six species of cestodes (flatworms) have been recorded, three being in the genus taenia. the most prevalent species of protozoan parasites, of which seven have been identified in cattle and 18 in sheep and goats, belong to the genus eimeria: four other species of protozoan parasites are also recorded. a general overview of the epidemiology of gastrointestinal parasites is provided and the main methods of control are discussed. contribution/originality: domestic ruminants are an important part of the tanzania economy. they contribute to food security, biodiversity, household income and human welfare. this paper reviews with the aid of 74 published references the status and distribution of the main internal parasites of domestic ruminants in tanzania. 1. introduction livestock production is a major agricultural activity in tanzania and provides livelihood support to 1 745 776 (or 37 per cent) of the 4 901 837 agricultural households in the country [1]. domestic animals contribute to national food supply, convert rangeland resources into products suitable for human consumption, are a source of cash income and are an inflation proof store of value. livestock production is predicated on a large resource base comprising various species, breeds and types and whose ownership and distribution differ from region to region. commercial ranching, pastoralism and agropastoralism are the commonly distinguished systems in the rangeland areas. the first of these systems is very minor (2 per cent of the national cattle stock); the second -pastoralism in which the main roles of livestock are subsistence, a store of wealth and a source of cash income -is concentrated in the northern plains and is practised in traditional grazing areas where climate and soil conditions do not favour crop production; the third, agropastoralism comprises a range of combinations of crop cultivation with livestock animal review 2017 vol. 4, no. 2, pp. 21-34 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2017.42.21.34 © 2017 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2017.42.21.34&domain=pdf&date_stamp=2017-01-14 animal review, 2017, 4(2): 21-34 22 © 2017 conscientia beam. all rights reserved. keeping. there are also many animals in urban and periurban locations. livestock numbers are considered to have increased steadily for many years in line with human population growth. the country’s ruminant livestock wealth in 2007/2008 – the third largest in africa after ethiopia and sudan – comprised 21.3 million cattle, 13.1 million goats and 3.6 million sheep of which a massive 99 per cent were in the ownership of the traditional sector [1]. the livestock subsector contributes about 30 per cent of agricultural gross domestic product (gdp) of which about 40 per cent derives from beef production, 30 per cent from milk and 30 per cent from small ruminant and poultry production. in spite of these impressive figures, however, the subsector contributes far less than its underlying potential. major constraints to improved productivity are related to management, nutrition and health. parasitic diseases have major adverse effects on productivity and performance of farm animals worldwide [2, 3]. they lower production efficiency, result in heavy mortality and are a potential danger to human health. gastrointestinal helminth parasites (including nematodes, trematodes, and cestodes) together with protozoans in particular negatively affect animal productivity primarily through impairing nutritional efficiency [4]. this review presents information on the presence, epidemiology and control of gastrointestinal helminths and protozoans of ruminants reported in tanzania. the various options recommended for their control are discussed. the studies reviewed in this paper, which is complementary to an earlier paper on pig pathology [5] are of great significance in the assessment of the gastrointestinal parasitic fauna of large and small ruminants in tanzania. 2. materials and methods this review focuses on the literature on gastrointestinal parasites of ruminants in tanzania. systematic searches were made in electronic and non-electronic databases. the electronic databases were cab abstracts, pubmed, science direct and web of science. firstly, titles and abstracts of all retrieved articles were searched to identify articles that were missed by electronic search. secondly, references of all relevant articles were searched to identify articles that were missed by electronic search. thirdly, all relevant articles were reviewed and pertinent information extracted and compiled in a searchable data base. a relevant article was defined as one that contained information on the subject of interest – meaning endo-parasites of large and small ruminants. types of documents included in the search were research articles, review articles, short surveys, short communications, correspondences, letters and book reviews. different search terms were used for different search engines. cab abstracts -(indigenous cattle, goats, sheep* or small scale* or large scale*) and (gastro-intestinal* or endo* or parasites*) and (tanzania*); pubmed – (small scale*or large scale*, indigenous cattle* or goats* or sheep*) and (gastro-intestinal * or endo* and (tanzania*); science direct – ( small scale* or indigenous cattle*) or (gastro-intestinal*, or endo* and ( tanzania*). an iterative process combining different key words was used to arrive at the final search terms. specific search engines for journals such as livestock research for rural development were used to retrieve information relevant to tanzania and to other areas with similar environmental conditions. unpublished records and reports from government and non government bodies and dissertations and theses from sokoine university of agriculture were retrieved and reviewed for additional information. 3. results 3.1. nematodes gastrointestinal nematodes or roundworms exert different pathogenic effects [6]. it is therefore important to establish the broad groups that are present in an animal unit, area, country or region. knowledge of the different development times and stages outside and inside the definitive host is also important for implementation of effective control measures. most nematodes, often considered as the primary pathogens, are found in the abomasum, with those in the intestine playing a lesser but synergistic role. parasitic gastroenteritis in tanzanian cattle, goats and animal review, 2017, 4(2): 21-34 23 © 2017 conscientia beam. all rights reserved. sheep is caused by mixed infections of several nematode species of which 13 species in nine genera have been recorded (table 1). table-1. nematode species infecting large and small ruminants in tanzania genus and species host distribution reference strongyles goat, (pig) [7, 8] trichuris ovis goat, sheep less prevalent [9] oesophagostomum columbianum goat, sheep, cattle most prevalent [8-11] oesophagostomum. radiatum traditional, small and large scale dairy; slaughter cattle, sheep, goat most prevalent; iringa, mwanza, morogoro [8, 12-14] bunostomum trigonocephalum dairy goat, sheep most prevalent; morogoro [9-11] strongyloides papillosus dairy goat most prevalent; morogoro [9, 11] cooperia pectinata traditional, small and large scale dairy; dairy goat prevalent; iringa, morogoro [11, 12] cooperia punctata traditional, small and large scale dairy; dairy goat prevalent; iringa, morogoro [11, 12] trichostrongylus colubriformis traditional, small and large scale dairy; dairy goat prevalent; iringa, morogoro [12] haemonchus contortus sheep, goat intensive and extensive systems; slaughter stock [8-11]; [1517] haemonchus placei traditional, small and large scale dairy cattle, sheep, goat most prevalent [12] haemonchus similis traditional, small and large scale dairy, sheep, goat prevalent [12] dictyocaulus. viviparus cattle all highland areas [18] nematode infections in cattle in tanzania have been reported in the formal literature by various authors [12, 15, 19-25] and there are many unpublished records from the national state central veterinary laboratory at temeke, tanzania. the most important and widely prevalent nematodes belong to the family trichostrongylidae comprising the genera cooperia, haemonchus, trichostrongylus and ostertagia and to the family chabertiidae comprising the single genus oesophagostomum. the genera bunostomum (ancylostomatidae), nematodirus (trychostrongylidae), strongyloides (strongyloididae), toxocara (toxocaridae) and trichuris (trichuridae) are of lesser frequency [20, 21]. dictyocaulus viviparus (dictyocaulidae), a nematode of the trachea and larger bronchi is responsible for parasitic bronchitis in cattle and has been recorded from iringa district in the southern highlands and lushoto district in the northeast of the country [18]. most of the foregoing genera including trichostrongylus, oesophagostomum, strongyloides, bunostomum, ostertagia and toxocara have been shown to be present at various levels of prevalence in wild african buffalo syncerus caffer in ngorongoro and arusha national parks [26]. the nematode genera found in tanzania have been reported in previous studies in neighbouring countries including haemonchus, trichostrongylus, cooperia and oesophagostomum in small ruminants in kenya [27, 28]. 3.1.1. cooperia spp cooperia spatulata is the most common species in cattle in the tropics [29] but it is unexpectedly absent in tanzania [12, 30]. cooperia pectinata and c. punctata are usually less prevalent but they have been found in cattle in the lower areas of the southern highlands and in the eastern region at morogoro [11, 12]: although they occur in animal review, 2017, 4(2): 21-34 24 © 2017 conscientia beam. all rights reserved. the small intestines of a wide range of ruminant species world-wide they seem to be more important in cattle. unless infected by massive doses (300 000 l3 or more during a 10-day period) clinical signs are seldom seen. in severe infestations there is a fluid foetid diarrhoea, selective anorexia, bottle jaw and eventually death which results from starvation, dehydration and exhaustion [4]. there are no documented reports of any cooperia spp. in sheep and goats in tanzania. 3.1.2. haemonchus spp the most prevalent of the three haemonchus species found in tanzania is h. placei which has been recorded in the lower areas of the southern highlands and in the eastern region [12]. both h. placei and h. similis are more adapted to cattle whereas h. contortus is more adapted to sheep and goats [31]. the heaviest burdens in tanzania occur at the end of the rainy and the beginning of the dry season whereas the lowest burdens are seen at the end of the dry and at the beginning of the rainy season [12]. worm burdens are more pronounced in immature (<3 years) than mature animals. h. contortus is widely distributed in tanzania and is reported in sheep and goats from mtwara region in the south, mwanza and kigoma regions in the west, morogoro and coast regions in the east, dodoma region in the centre and arusha and kilimanjaro regions in the north [8, 10, 11, 13-30, 32]. cross-infection of h. contortus between cattle, goats and sheep has not been investigated in tanzania although studies from other countries have shown cross-infection between domestic stock and wildlife [33]. 3.1.3. trichostrongylus spp the most frequent species is trichostrongylus colubriformis but there are some reports of t. axei [12]. t. colubriformis is a parasite of sheep and its presence in cattle is likely to be due to cross-infection [29]. with the exception of t. axei, however, this genus is not considered to be important in cattle [29]. t. colubriformis was the predominant species in traditionally managed cattle in the southern highlands of tanzania but the genus is also prevalent in dairy goats and their crosses reared in intensive and semi-intensive systems in tanzania [11]. trichostrongylus spp. have also been recorded in african buffalo in ngorongoro and arusha national parks [26]. t. colubriformis, with a direct life cycle and a developmental period of 18-20 days, tends to occur in the first 7 metres of the small intestine and is found less often in the abomasum. manifestation of infestation occurs from acute (rarely seen) to chronic (when 100 000 larvae are ingested) forms. in acute cases the pain caused by the parasite results in anorexia, closure of the pyloric sphincter and retention of food in the abomasum and rumen. sheep become listless, signs of sub-mandibular oedema develop and there is yellow foetid diarrhoea followed by death 16-17 days after infection. 3.1.4. oesophagostomum radiatum oesophagostomum radiatum, the nodular worm of cattle, occurs in the colon. it is distributed world-wide from temperate to tropical climes. it is reported in traditional herds in tanzania’s southern highlands which has a relatively cool climate [12] but does not occur in arid, non-seasonal rainfall areas. the direct life cycle has a developmental period of 32-34 days. wet, warm weather, overgrazed rangelands and unhygienic pens are risk factors for calves which are the main class of stock affected. clinical signs of affected animals are pain, anorexia, loss of body mass, hypoproteinaemia, anaemia and diarrhoea that is often foetid and blood-stained. cattle constantly exposed tend to develop a strong immunity from 8-12 months of age. studies in the higher rainfall areas of the southern highlands around iringa showed low numbers of oesophagostomum radiatum and trichuris globulosa [12]. this contrasts with bunostomum trigonocephalum which was found to be prevalent with occurrence being relatively high in goats and sheep [9]. animal review, 2017, 4(2): 21-34 25 © 2017 conscientia beam. all rights reserved. 3.1.5. strongyloididae and trichuridae documented species in the families strongyloididae and trichuridae in tanzania are strongyloides papillosus and trichuris ovis. s. papillosus is reported in goats in extensive and semi-intensive production systems around morogoro [9, 11] with kids being more susceptible than adults. the source of infection for very young kids is the reservoir of larvae in the tissues of their dams. adult worms cause anorexia, diarrhoea or constipation, sunken eyes with a purulent discharge, a frothy mucous discharge from the nose, muscular atrophy and paresis just before death. warm moist weather favours worm development and survival and allows the accumulation of large numbers of infective larvae. trichuris ovis which is commonly found in the caecum and colon is less prevalent but has been detected in tanzanian goats [9]. t. ovis eggs are resistant to desiccation and survive in a temperature range of – 20° c to 50° c. the larval stages cause haemorrhages and local oedema when they penetrate the intestinal wall and these injuries can result in secondary bacterial infection. the adult worms are not pathogenic unless present in large numbers when they may cause abdominal pains, mucoid diarrhoea, anaemia, loss of body mass and, rarely, death. 3.2. trematodes there are an estimated 18 000 to 24 000 species of trematodes or flukes in the world. these include fasciola hepatica, f. gigantica and species of dicrocoelium, schistosoma and paramphistomum among others (table 2). the most significant trematodes from a clinical point of view are the blood flukes, schistosoma mansoni, s. japonicum and s. hematobium. other trematodes of significance are the intestinal fluke fasciolopsis buski, liver fluke clonorchis sinensis and lung fluke paragonimus westermani. trematodes often live in the bile ducts or small intestine and may also affect the lungs. some are ingested but some burrow into the skin to gain access to their host [18]. their eggs are passed with the faeces of the host. trematodes usually require an intermediate host in their life cycle with vertebrates being the definitive host. larval stages may occur in either invertebrate or vertebrate hosts [34, 35]. table-2. trematode species infecting large and small ruminants in tanzania genus and species host distribution reference fasciola gigantica cattle, goat country wide, mwanza, arusha [7, 8, 19, 23, 24, 36-39] fasciola hepatica cattle [35] paramphistomum species cattle, goat iringa, mwanza, arusha [7, 23, 40] schistosoma bovis cattle iringa/meru [20, 39, 41] dicrocoelium hospes cattle iringa [40] calicophoron microbothrium cattle iringa [22] cotylophoron jacksoni cattle iringa [22] symptoms of trematode infestation include watery diarrhoea, weakness, weight loss, decreased milk production, reduced product quality, mortality and secondary infections [2]. fasciolosis is now recognized as an emerging human disease [42]. trematode infections of cattle and small ruminants in tanzania are widespread and severe. they cause significant economic losses due to reduction in production efficiency by 5 per cent in mild infestations to 10 per cent in more severe ones and in weight loss and abattoir condemnations [21, 41, 43-48]. the most prevalent species in tanzania are fasciola gigantica and f. hepatica [35, 39, 41]. several researchers using slaughterhouse surveys have studied the infection rates of trematodes in domestic animals [19, 36, 38, 48]. slaughter house surveys carried out from 1965-1984 covering different eco-climatic regions in the lake zone (mwanza), northern zone (arusha), the southern highlands (iringa and mbeya) and the usambara mountains (lushoto) showed variable rates of infestation ranging from 6.5-71.0 per cent in cattle, 8-26 per cent in sheep and 12-23 per cent in goats [49, 50]. the stomach flukes calicophoron microbothrium and cotylophoron jacksoni have been reported from iringa [22]. other trematode parasites include schistosoma bovis from iringa and meru [20, 39, 41, 51] amphistomes [37] animal review, 2017, 4(2): 21-34 26 © 2017 conscientia beam. all rights reserved. paramphistomum species and dicrocoelium hospes in iringa [40]. trematodes reported in african buffalo include fasciola, paramphistomum, gastrothylax, ornithobilharzia and fischoederius [26]. 3.3. cestodes cestodes or tapeworms (also sometimes known as flatworms) that mature and live in the gut are acquired by ingesting contaminated food or water and have major negative effects on the health and well-being of the animal. these tapeworms have an indirect life cycle and require pasture mites to complete it. eggs and larvae are often excreted in the faeces and live in the soil [52]. in almost all cases there are separate sexes with sexual reproduction occurring in the definitive host in parasitic species. the most common symptoms are gastrointestinal but cestodes may also cause allergic reactions, lung and heart symptoms. large clumps of worms cause intestinal blockage followed by distention and abdominal pains similar to food poisoning. this group (table 3) includes species of the cosmopolitan moniezia and stilesia [8, 19] which are commonly found in ruminants [29]. table-3. cestode species infecting large and small ruminants in tanzania genus and species host distribution reference moniezia expansa goat, sheep less prevalent; morogoro [9, 14] stilesia hepatica cattle, sheep, goat country wide, slaughter stock; mwanza, arusha [8, 24, 38] echinococcus granulosus cattle, sheep, goat slaughter stock most prevalent; mwanza, mbeya, ngorongoro [8, 53, 54] taenia multiceps (coenurus cerebralist)a sheep, goat wildlife/livestock interface area (arusha) [55] taenia hydatigenea (cysticercus tenuicollis) sheep, goat most prevalent, slaughter stock; mbeya, arusha, dodoma [8, 24, 25, 38] taenia ovis (cysticercus ovis) sheep prevalent [8] note: a) names in brackets refer to metacestode stage, commonly known as hydatid cysts the presence of other cestodes such as echinococcus granulosus, taenia multiceps (whose metacestode stage is coenorus cerebralis) and taenia hydatigena (metacestode, cysticercus tenuicollis) and taenia ovis (metacestode c. ovis) in tissues or organs leads to them being condemned as unfit for human consumption. the migration of c. cerabralis through the brain can cause meningo-encephalitis and the presence of many hydatid cysts in the lungs may be associated with respiratory problems. c. cerebralis was found to be the most prevalent metacestode in the livestockwildlife interface ecosystem of ngorongoro and serengeti [55]. lack of knowledge in the community on how coenurosis occurs, free access of dogs to carcasses and offal of small ruminants and inadequate animal health services for dogs especially worm control were speculated to be major factors in the continuance of coenurosis [55] . the prevalence of echinococcosis (hydatidosis) reported in ngorongoro district in cattle was 48.7 per cent, for goats was 34.7 per cent and for sheep was 63.8 per cent [53]. in an earlier study in a masai community in northern tanzania a prevalence of 1.4 per cent was found [56]. recent postmortem slaughter slab surveys in mbeya region indicated prevalences of41.7 per cent in goats and 51.9 per cent in sheep [54]. 3.4. protozoa 3.4.1. eimeria spp eimeria species are single-cell protozoa that cause coccidiosis in animals and damage the lining of the small intestine. species are host-specific. transmission of coccidiosis is facilitated by warm and wet environmental conditions. research has shown that cattle, sheep and goats in intensive grazing areas and feedlots are at greatest risk [57]. stress from weaning often induces outbreaks of coccidiosis. clinical signs include diarrhoea (sometimes containing blood or mucous), dehydration, fever, weight loss, inappetance, anaemia, and death. research in various animal review, 2017, 4(2): 21-34 27 © 2017 conscientia beam. all rights reserved. agroecological zones of tanzania has demonstrated the presence of at least seven species of eimeria in cattle [14, 58] and 18 species in sheep and goats [59] (table 4). the most prevalent species in cattle are eimeria zuernii and e. bovis whereas in goats and sheep the main species is e. arloingi. the presence of pathogenic species including e. alijevi, e. arloingi, e. ninakohlyakimovae and e. christenseni in goats e. ovinoidalis and e. ahsata in sheep is a clear indication that coccidiosis is a major contributor to the enteric syndromes affecting small ruminants in tanzania [59, 60]. 3.4.2. protozoan species other than eimeria other protozoan species found in ruminants in tanzania include species of cryptosporidium, giardia [30, 59-61] balantidium and entamoebae [7]. cryptosporidium oocysts are often detected in animals suffering or not from diarrhoea. bovine faecal samples screened in villages in dodoma rural and bagamoyo districts showed 0.5 per cent infection with cryptosporidium parvum in 942 cattle examined in three villages in dodoma and 1.5 per cent of 202 cattle infected with giardia lamblia in one village in bagamoyo [61]. other studies in the highland and semiarid areas of iringa, morogoro, dodoma and coastal tanga have shown varied levels of prevalence of cryptosporidium in both dairy and traditional cattle [63-67]. in all these studies young stock were more affected than adults. these results highlight the possible public health risks associated with the keeping of livestock and the shared use of water sources by humans and animals. other cryptosporidium spp oocysts have been reported in wildlife including african buffalo, zebra and wildebeest [64]. the ciliate protozoa balantidium coli was detected in slaughtered small ruminants in mwanza [68]. the parasite lives in the caecum and colon of goats and sheep where it is asymptomatic. it is, however, associated with the zoonotic disease balantidiasis which is acquired by people via the faeco-oral route from the normal goat or sheep host. the parasite is not readily transmissible from one species to another because it requires a period of time to adjust to the symbiotic flora of the new host. frequently existing as commensal parasite in pigs, entamoebae coli has been reported in slaughtered goats and sheep in mwanza [68]. its pathogenic role in tanzania is not clearly known. 4. epidemiology of gastrointestinal parasite infections the epidemiology of gastrointestinal parasites is influenced by predisposing factors. these include those related to the host and to the parasite, climate, management system, pasture management, grazing habits, nutritional status, immunological status, vector, presence of intermediate host and the number of infective larvae and eggs in the environment [4]. cestodes have indirect life cycles, the intermediate hosts being soil-inhabiting oribatid mites [69]. birds may also be involved in the dissemination of tapeworm eggs. the effect of helminth infections is determined by a combination of factors, of which the varying susceptibility of the host species, the pathogenicity of the parasite species, the host/parasite interaction, and the infective dose are the most important [4]. 4.1. host factors age, breed, nutrition, physiological status and presence or absence of intercurrent infection are known to influence the rate and severity of infection. the number of infective stages present in the host environment at any time is related to the number of worm eggs excreted. this largely determines the number of parasites potentially capable of being established in a susceptible host [70]. calves, kids and lambs are relatively more susceptible than mature stock. some breeds, such as the galla and small east african goats [71] and the red masai sheep [72] are known to have greater resistant to haemonchus contortus than other types. poor nutrition, hormonal change during late pregnancy and lactation lower the resistance of the host to nematodes and consequently result in the establishment of higher worm burdens. animal review, 2017, 4(2): 21-34 28 © 2017 conscientia beam. all rights reserved. table-4. protozoan species infecting large and small ruminants in tanzania genus host distribution reference eimeria zuernii large and small scale dairy, cattle country wide [58] eimeria bovis large and small scale dairy, cattle country wide [58] eimeria ellipsoidalis large and small scale dairy, cattle country wide [58] eimeria cylindrica large and small scale dairy, cattle country wide [58] eimeria aubernensis large and small scale dairy, cattle country wide [58] eimeria alabamensis large and small scale dairy, cattle country wide [58] eimeria subspherica large and small scale dairy, cattle country wide, [58] eimeria arloingi small scale dairy, dairy goat, sheep tropical highland and semiarid areas of morogoro [14, 59, 60, 62] eimeria alijavi small scale dairy, dairy goat tropical highland and semiarid areas of morogoro [59, 60, 62] eimeria ninkohlyakimovae small scale dairy, dairy goat tropical highland and semiarid areas of morogoro [59, 60] eimeria christenseni small scale dairy, dairy goat, sheep tropical highland and semiarid areas of morogoro [14, 59, 60] eimeria caprovina small scale dairy, dairy goat tropical highland and semiarid areas of morogoro [59, 60] eimeria hirci small scale dairy, dairy goat tropical highland and semiarid areas of morogoro [59, 60] eimeria pallida small scale dairy, dairy goat tropical highland and semiarid areas of morogoro [60] eimeria caprina smallscale traditional, dairy goat, sheep morogoro [14, 59] eimeria crandallis smallscale traditional, dairy goat morogoro [59] eimeria parva smallscale traditional, dairy goat, sheep morogoro [14, 59] eimeria ovinoidalis smallscale traditional, dairy goat, sheep morogoro [14, 59] eimeria bakuensis smallscale traditional, dairy goat morogoro [59] eimeria faurei smallscale traditional, dairy goat morogoro [59] eimeria ahsata smallscale traditional, dairy goat morogoro [59] eimeria granulosa smallscale traditional, dairy goat, sheep morogoro [59] eimeria marsica smallscale traditional, dairy goat, sheep morogoro [14] eimeria jolchijevi smallscale dairy, dairy goat tropical highland and semiarid areas of morogoro [59] eimeria aspheronika smallscale dairy; dairy goat tropical highland and semiarid areas of morogoro [59] cryptosporidium parvum extensive traditional cattle, dairy; wildlife (zebra, buffalo, wildebeest) central and coastal tanzania and southern highlands [61, 63-67] giardia lamblia extensive traditional cattle central and coastal tanzania [61] balantidium coli goat urban mwanza [68] entamoebae coli goat urban mwanza [68] animal review, 2017, 4(2): 21-34 29 © 2017 conscientia beam. all rights reserved. 4.2 parasite factors the factors that determine the rate of establishment and size of the nematode burden in the host are the fecundity of the adult worms, the pre-patent period and the survival and development rate of the parasite in the environment. 4.3 climate factors most studies on gastrointestinal nematode ecology in cattle have concluded that climatic conditions are extremely important in the survival and transmission of parasite eggs and larvae [73]. epidemiological studies in tanzania showed seasonal differences with respect to helminth infections. liver fluke transmission is dependent on the presence of its snail intermediate host so distribution of the parasite is limited to geographic areas where the appropriate snail species is present [39]. a high prevalence of fasciolosis has been shown towards the end of the dry season and the early part of the rainy season [21, 41]. this seasonality is in agreement with other investigators who suggested that heavy mortality as a result of fasciolosis occurred during the dry season [49, 51]. cattle grazing in irrigation areas are most susceptible to infection [39]. temperature influences the development of nematode larvae: the optimal temperature for development of most trichostrongylid larvae is 22-30 c. some trichstrongylid larvae such as t. colubriformis and o. columbianum are known to be resistant to desiccation, an ability that enables them to survive under extremely low or high temperatures [27, 28]. temperature and moisture are the main environmental variables that determine survival and development of coccidial oocyst to the infective stage. 4.4. management factors management systems also influence egg developments and the free living stages of helminth larvae. heavy stocking densities increase the contamination of the environment with nematode eggs or larvae and thus render the infective stages more accessible to susceptible animals. concentration of animals at watering points, particularly during the dry season may result in massive contamination of pastures with eggs or larvae leading to outbreaks of parasitic gastroenteritis. tethering of goats and sheep during the wet season, which is common in many agropastoral parts of the country, is reported to result in increased environmental contamination with infective larvae and the incidence of clinical disease [59, 61]. anthelmintic treatment may reduce the worm load but indiscriminate use of helminthic preparations of unproven quality and undefined doses may result in development of resistant strains of nematodes – a problem of increasing importance in tanzania [10]. over stocking and poor hygiene favour rapid transmission and build-up of coccidial infections whereas stress factors, confinement, weaning, inclement weather and inter-current disease precipitate the occurrence of clinical disease. animals acquire cryptosporidium infection by ingestion of contaminated feed and water. 5. control of infections effective control of gastrointestinal parasite infections is dependent on a comprehensive understanding of the epidemiology of the disease in both the host and the environment [73]. control should be designed to, at best, eliminate or, at worst, reduce the prevalence of the parasites. eradication of helminth diseases is not, however, a simple matter and it is important to make a correct assessment of the costs and the associated benefits of any control method. control by the use of anthelmintics depends to a large extent on their proven quality under field conditions, the frequency of treatment and the correct dosage. it should be determined by the epidemiology and biology of the dominant parasite, the stocking rates of the particular area and the benefit accrued from the adopted control regime. control through management should aim at reducing the contact of susceptible animals with infective larvae. control of helminth diseases by good management is likely to be more sustainable than the use of anthelmintics. animal review, 2017, 4(2): 21-34 30 © 2017 conscientia beam. all rights reserved. this method may be the most practical one in smallholder production systems when drugs are expensive (and in many cases may be of dubious efficacy). rotational grazing, separation of animals according to age group, alternate grazing by different host species, adjusting stocking rates, improved nutrition and better housing systems are the common management practices employed as control measures against helminthosis in most countries. control by breeding resistant stocks and control by immunization has been applied in some countries although progress has been slow and variable although there are some encouraging prospects. in general, however, the ideal approach towards effective control of helminths is the integration of several methods because each method has its own advantages and disadvantages [4, 74]. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: both authors have undertaken fieldwork in tanzania, contributed to the literature view and worked together on a first draft of the paper. the second author was responsible for final editing of this version of the paper for technical content, presentation and language. both authors agree to the presentation of the paper. references [1] art, "national sample census of agriculture 2007/2008 small solder agriculture," livestock sector national report. dar es salaam: prime minister’s office, 2012. [2] e. j. l. souls, helminths, arthropods and protozoa of domesticated animals, 7th ed. philadelphia: lea & febiger, 1982. [3] l. c. gasbarre, e. a. leighton, and c. j. davies, "genetic control of immunity to gastrointestinal nematodes of cattle," veterinary parasitology, vol. 37, pp. 257-272, 1990. view at google scholar | view at publisher [4] j. w. hansen and b. d. perry, the epidemiology, diagnosis and control of helminth parasites of ruminants: a handbook ( ed.), 2nd ed. nairobi: international laboratory for research on animal diseases, 1994. [5] r. t. wilson and e. s. swai, "a review of pig pathology in tanzania," tropical animal health and production, vol. 45, pp. 1269-1275, 2013. view at google scholar | view at publisher [6] j. charlier, j. höglund, g. samson-himmelstjerna, and v. p. j. dorny, "gastrointestinal nematode infections in adult dairy cattle: impact on production, diagnosis and control," veterinary parasitology, vol. 164, pp. 70-79, 2009. view at google scholar | view at publisher [7] j. r. l. mhoma, p. w. n. kanyari, and j. m. kagira, "the prevalence of gastrointestinal parasites in goats in urban and peri-urban areas of mwanza city, tanzania," scientia parasitologica, vol. 12, pp. 191-196, 2011. view at google scholar [8] j. r. l. mhoma, p. w. n. kanyari, and j. m. kagira, "an abattoir study on the prevalence of some helminths among slaughtered cattle, sheep and goats from mwanza city. lake victoria basin, tanzania," bulletin of animal health and production in africa, vol. 62, pp. 111-120, 2014. view at google scholar [9] j. c. davies, "the productivity of tethered goats in tanzania, vetaid, centre for tropical veterinary medicine, edinburgh." retrived from http://www.vet.ed.ac.uk/ctvm/ahp/ahp/finalahpelectronic/015.pdf, 1996. [10] k. agillah, g. c. kifaro, a. a. kassuku, and s. w. chenyambuga, "resistance of three strains of small east african goats to artificial infection with mixed gastrointestinal nematode parasites in tanzania," journal of agricultural science, vol. 5, pp. 1-10, 2002. view at google scholar [11] s. w. chenyambuga, s. h. mbaga, and v. r. m. muhikambele, "seasonal variations of nematodes infection in small east african goats and their crosses with boer and saanen reared under extensive and semi intensive system," tanzania veterinary journal, vol. 26, pp. 82-91, 2009. view at google scholar | view at publisher [12] j. d. keyyu, a. a. kassuku, n. c. kyvsgaard, and a. l. willingham, "gastrointestinal nematodes in indigenous zebu cattle under pastoral and nomadic management systems in the lower plain of the southern highlands of tanzania," veterinary research communications, vol. 27, pp. 371-380, 2007. [13] e. n. kimbita, a. a. kassuku, a. d. maeda-machang’u, u. m. minga, j. safari, and h. m. msami, "a survey of diseases of small ruminants in the eastern zone of tanzania," tanzania veterinary journal, vol. 23, pp. 125-134, 2006. https://scholar.google.com/scholar?hl=en&q=genetic%20control%20of%20immunity%20to%20gastrointestinal%20nematodes%20of%20cattle http://dx.doi.org/10.1016/0304-4017(90)90009-z https://scholar.google.com/scholar?hl=en&q=a%20review%20of%20pig%20pathology%20in%20tanzania http://dx.doi.org/10.1007/s11250-013-0426-z https://scholar.google.com/scholar?hl=en&q=gastrointestinal%20nematode%20infections%20in%20adult%20dairy%20cattle:%20impact%20on%20production,%20diagnosis%20and%20control https://scholar.google.com/scholar?hl=en&q=gastrointestinal%20nematode%20infections%20in%20adult%20dairy%20cattle:%20impact%20on%20production,%20diagnosis%20and%20control http://dx.doi.org/10.1016/j.vetpar.2009.04.012 https://scholar.google.com/scholar?hl=en&q=the%20prevalence%20of%20gastrointestinal%20parasites%20in%20goats%20in%20urban%20and%20peri-urban%20areas%20of%20mwanza%20city,%20tanzania https://scholar.google.com/scholar?hl=en&q=an%20abattoir%20study%20on%20the%20prevalence%20of%20some%20helminths%20among%20slaughtered%20cattle,%20sheep%20and%20goats%20from%20mwanza%20city.%20lake%20victoria%20basin,%20tanzania http://www.vet.ed.ac.uk/ctvm/ahp/ahp/finalahpelectronic/015.pdf https://scholar.google.com/scholar?hl=en&q=resistance%20of%20three%20strains%20of%20small%20east%20african%20goats%20to%20artificial%20infection%20with%20mixed%20gastrointestinal%20nematode%20parasites%20in%20tanzania https://scholar.google.com/scholar?hl=en&q=seasonal%20variations%20of%20nematodes%20infection%20in%20small%20east%20african%20goats%20and%20their%20crosses%20with%20boer%20and%20saanen%20reared%20under%20extensive%20and%20semi%20intensive%20system http://dx.doi.org/10.4314/tvj.v26i2.53806 animal review, 2017, 4(2): 21-34 31 © 2017 conscientia beam. all rights reserved. [14] n. h. ng’umbi, a. a. kassuku, d. smith, e. d. karimuribo, d. m. kambarage, m. k. matiko, and j. fitzpatrick, "descriptive study on status of helminth and coccidian infection in meela, morogoro region," presented at the 32nd tva scientific conference, arusha, tanzania, 25-27 nov 2014 arusha international conference centre, arusha, tanzania, 2014. [15] b. c. njau, "gastrointestinal nematodes of small ruminants of “kingori” in northern tanzania," bulletin of animal health and production in africa, vol. 35, pp. 298-303, 1987. [16] r. j. connor, a. p. munyuku, e. mackyao, and r. w. halliwell, "helminthosis in goats in southern tanzania. investigations on epidemiology and control," tropical animal health and production, vol. 22, pp. 1-6, 1990. view at google scholar | view at publisher [17] j. s. chang’a and a. a. kassuku, "efficacy of commonly used anthelmintics in selected farms in arusha," tanzania veterinary journal, vol. 23, pp. 115-124, 2006. [18] s. m. thamsborg, m. e. boa, a. e. makundi, and a. a. kassuku, "lungworm infection (dictyocaulus viviparus) on dairy cattle farms in tropical highlands of tanzania," tropical animal health and production, vol. 30, pp. 93-96, 1998. view at google scholar [19] j. e. msanga, "prevalence and economic importance of fasciola gigantica and stilesia hepatica in sukumaland, tanzania," tanzania veterinary bulletin, vol. 7, pp. 9-16, 1987. [20] a. kassuku, n. o. christensen, j. monrad, p. nansen, and j. knudsen, "epidemiological studies on schistosoma bovis in iringa region, tanzania," acta tropica, vol. 43, pp. 153-163, 1983. [21] j. d. keyyu, n. c. kyvsgaard, j. monrad, and a. a. kassuku, "epidemiology of gastrointestinal nematodes in cattle on traditional, small-scale dairy and large-scale dairy farms in iringa district, tanzania," veterinary parasitology, vol. 127, pp. 285-294, 2005. view at google scholar | view at publisher [22] j. d. keyyu, a. a. kassuku, l. p. msalilwa, j. monrad, and n. c. kyvsgaard, "cross-sectional prevalence of helminth infections in cattle on traditional, small-scale and large-scale dairy farms in iringa district, tanzania," veterinary research communications, vol. 30, pp. 45-55, 2005. [23] e. s. swai, p. f. mtui, a. n. mbise, e. kaaya, p. sanka, and p. m. loomu, "prevalence of gastrointestinal parasite infections in maasai cattle in ngorongoro district, tanzania. livestock research for rural development." retrived from http://www.lrrd.org/lrrd18/8/swai18107.htm. accessed 3 november 2015, 2013. [24] l. s. b. mellau, h. e. nonga, and e. d. karimuribo, "a slaughter house survey of liver lesions in slaughtered cattle, sheep and goats at arusha, tanzania," research journal of veterinary sciences, vol. 3, pp. 179-188, 2010. view at google scholar | view at publisher [25] e. v. g. komba, e. v. komba, e. m. mkupasi, a. o. mbyuzi, s. s. mshamu, and d. luwumba, "sanitary practices and occurrence of zoonotic conditions in cattle at slaughter in morogoro municipality, tanzania: implications for public health," tanzania journal of health research, vol. 4, 2014. view at google scholar | view at publisher [26] e. s. swai, d. mshanga, r. fyumagwa, d. mpanduji, i. chuma, and s. kuya, "prevalence and spectrum of helminths in free ranging african buffaloes (syncerus caffer) in wildlife protected areas, tanzania," journal of coastal life medicine, vol. 1, pp. 145-150, 2013. view at google scholar [27] c. j. ng'ang'a, n. maingi, p. w. n. kanyari, and w. k. munyua, "development, survival and availability of gastrointestinal nematodes of sheep on pastures in a semi-arid area of kajiado district of kenya," veterinary research communications, vol. 28, pp. 491-501, 2014. view at publisher [28] a. odoi, j. m. gathuma, c. k. gachuiri, and a. omore, "risk factors of gastrointestinal nematode parasite infections in small ruminants kept in smallholder mixed farms in kenya," bmc veterinary research, vol. 3, p. 6, 2007. view at google scholar | view at publisher [29] i. g. horak, m. m. knight, and e. j. williams, "parasites of domestic and wild animals in south africa. xviii. helminth and arthropod parasites of angora goats and kids in valley bushveld," onderstepoort journal of veterinary research, vol. 58, pp. 253-260, 1991. https://scholar.google.com/scholar?hl=en&q=helminthosis%20in%20goats%20in%20southern%20tanzania.%20investigations%20on%20epidemiology%20and%20control https://scholar.google.com/scholar?hl=en&q=helminthosis%20in%20goats%20in%20southern%20tanzania.%20investigations%20on%20epidemiology%20and%20control http://dx.doi.org/10.1007/bf02243487 https://scholar.google.com/scholar?hl=en&q=lungworm%20infection%20(dictyocaulus%20viviparus)%20on%20dairy%20cattle%20farms%20in%20tropical%20highlands%20of%20tanzania https://scholar.google.com/scholar?hl=en&q=epidemiology%20of%20gastrointestinal%20nematodes%20in%20cattle%20on%20traditional,%20small-scale%20dairy%20and%20large-scale%20dairy%20farms%20in%20iringa%20district,%20tanzania http://dx.doi.org/10.1016/j.vetpar.2004.10.014 http://www.lrrd.org/lrrd18/8/swai18107.htm https://scholar.google.com/scholar?hl=en&q=a%20slaughter%20house%20survey%20of%20liver%20lesions%20in%20slaughtered%20cattle,%20sheep%20and%20goats%20at%20arusha,%20tanzania https://scholar.google.com/scholar?hl=en&q=a%20slaughter%20house%20survey%20of%20liver%20lesions%20in%20slaughtered%20cattle,%20sheep%20and%20goats%20at%20arusha,%20tanzania http://dx.doi.org/10.3923/rjvs.2010.179.188 https://scholar.google.com/scholar?hl=en&q=sanitary%20practices%20and%20occurrence%20of%20zoonotic%20conditions%20in%20cattle%20at%20slaughter%20in%20morogoro%20municipality,%20tanzania:%20implications%20for%20public%20health http://dx.doi.org/10.4314/thrb.v14i2.6 https://scholar.google.com/scholar?hl=en&q=prevalence%20and%20spectrum%20of%20helminths%20in%20free%20ranging%20african%20buffaloes%20(syncerus%20caffer)%20in%20wildlife%20protected%20areas,%20tanzania http://dx.doi.org/10.1023/b:verc.0000040246.22919.cd https://scholar.google.com/scholar?hl=en&q=risk%20factors%20of%20gastrointestinal%20nematode%20parasite%20infections%20in%20small%20ruminants%20kept%20in%20smallholder%20mixed%20farms%20in%20kenya https://scholar.google.com/scholar?hl=en&q=risk%20factors%20of%20gastrointestinal%20nematode%20parasite%20infections%20in%20small%20ruminants%20kept%20in%20smallholder%20mixed%20farms%20in%20kenya http://dx.doi.org/10.1186/1746-6148-3-6 animal review, 2017, 4(2): 21-34 32 © 2017 conscientia beam. all rights reserved. [30] l. j. m. kusiluka, d. m. kambarage, l. j. s. harrison, c. j. daborn, and r. w. matthewman, "causes of morbidity and mortality in goats in morogoro district, tanzania: the influence of management," small ruminant research, vol. 29, pp. 167-172, 1998. view at google scholar | view at publisher [31] a. f. t. amarante, j. r. bagnola, m. r. v. amarante, and m. a. barbosa, "host specificity of sheep and cattle nematodes in sao paulo state, brazil," veterinary parasitology, vol. 73, pp. 89-104, 1997. view at google scholar | view at publisher [32] d. s. shija, l. j. m. kusiluka, s. w. chenyambuga, d. shayo, and f. p. lekule, "animal health constraints in dairy goats kept under smallholder farming systems in kongwa and mvomero districts, tanzania," journal of veterinary medicine and animal health, vol. 6, pp. 268-279, 2007. [33] o. madzingira, s. mukaratirwa, v. s. pandey, and p. dorny, "a questionnaire survey of the management and use of anthelmintics in cattle and antelope in mixed farming systems in zimbabwe," journal of the south african veterinary association, vol. 73, pp. 70-73, 2002. view at google scholar | view at publisher [34] r. a. max, a. f. vatta, m. l. jayaswal, a. e. kimambo, a. a. kassuku, and l. a. mtenga, technical manual for worm management in small ruminants. morogoro: sokoine university of agriculture, 2006. [35] s. m. walker, a. e. makundi, f. v. namuba, a. a. kassuku, j. keyyu, and e. m. hoey, "the distribution of fasciola hepatica and fasciola gigantica within southern tanzania – constraints associated with the intermediate host," parasitology, vol. 135, pp. 495-503, 2008. view at google scholar | view at publisher [36] m. f. mwabonimana, "cattle liver condemnation at arusha meat company ltd, tanzania: causes and its financial implication," ph.d. thesis, sokoine university of agriculture, morogoro, 2008. [37] j. d. keyyu, j. monrad, n. c. kyvsgaard, and a. a. kassuku, "epidemiology of fasciola gigantica and amphistomes in cattle on traditional, smallscale dairy and large scale dairy farms in the southern highlands of tanzania," tropical animal health and production, vol. 37, pp. 303-314, 2005. view at google scholar | view at publisher [38] h. e. nonga, m. f. mwabonimana, h. a. ngowi, l. s. b. mellau, and e. d. karimuribo, "a retrospective survey of liver fasciolosis and stilesiosis in livestock based on abattoir data in arusha, tanzania," tropical animal health and production, vol. 41, pp. 1377-1380, 2009. view at google scholar | view at publisher [39] j. nzalawahe, a. a. kassuku, j. r. stothard, g. c. coles, and m. misler, "trematode infections in cattle in arumeru district, tanzania are associated with irrigation," parasites and vectors, vol. 7, p. 107, 2013. [40] e. a. mahlau, "liver fluke survey in zebu cattle of iringa region, tanzania and first finding of the small fluke dicrocoelium hospes loos," bulletin of epizootic diseases of africa, vol. 18, pp. 21-28, 1997. [41] a. e. makundi, a. kassuku, r. m. maselle, and m. e. boa, "distribution, prevalence and intensity of schistosoma bovis in cattle in iringa district, tanzania," veterinary parasitology, vol. 75, pp. 59-69, 1998. view at google scholar | view at publisher [42] who, control of foodborne trematode infections (who technical series no 849). geneva: world health organization, 1995. [43] l. w. wamae and m. k. ihiga, "fascioliasis as a limiting factor in livestock productivity," bulletin of animal health and production in africa, vol. 39, pp. 257-269, 1991. view at google scholar [44] l. w. wamae, j. h. hammond, l. j. s. harrison, and j. a. onyango-abuje, "comparison of production loss caused by chronic fasciola gigantica infection in yearling friesian and boran cattle," tropical animal health and production, vol. 30, pp. 23-30, 1998. view at google scholar [45] n. maingi and s. n. mathenge, "acute fascioliasis in sheep in kinangop district, nyandarua district of kenya," bulletin of animal health and production in africa, vol. 43, pp. 21-27, 1995. view at google scholar [46] j. m. kithuka, n. maingi, and f. m. njeruh, "the prevalence and economic importance of bovine fascioliasis in kenya: an analysis of abattoir data," onderstepoort journal of veterinary research, vol. 69, pp. 255-262, 2002. view at google scholar [47] e. o. mungube, s. m. bauni, b. a. tenhagen, l. w. wamae, j. m. nginyi, and j. m. mugambi, "the prevalence and economic significance of fasciola gigantica and stilesia hepatica in slaughtered animals in semi-arid coastal kenya," tropical animal health and production, vol. 38, pp. 475-483, 2006. view at google scholar | view at publisher https://scholar.google.com/scholar?hl=en&q=causes%20of%20morbidity%20and%20mortality%20in%20goats%20in%20morogoro%20district,%20tanzania:%20the%20influence%20of%20management http://dx.doi.org/10.1016/s0921-4488(97)00110-7 https://scholar.google.com/scholar?hl=en&q=host%20specificity%20of%20sheep%20and%20cattle%20nematodes%20in%20sao%20paulo%20state,%20brazil http://dx.doi.org/10.1016/s0304-4017(97)00036-8 http://dx.doi.org/10.1016/s0304-4017(97)00036-8 https://scholar.google.com/scholar?hl=en&q=a%20questionnaire%20survey%20of%20the%20management%20and%20use%20of%20anthelmintics%20in%20cattle%20and%20antelope%20in%20mixed%20farming%20systems%20in%20zimbabwe http://dx.doi.org/10.4102/jsava.v73i2.559 https://scholar.google.com/scholar?hl=en&q=the%20distribution%20of%20fasciola%20hepatica%20and%20fasciola%20gigantica%20within%20southern%20tanzania%20–%20constraints%20associated%20with%20the%20intermediate%20host http://dx.doi.org/10.1017/s0031182007004076 https://scholar.google.com/scholar?hl=en&q=epidemiology%20of%20fasciola%20gigantica%20and%20amphistomes%20in%20cattle%20on%20traditional,%20smallscale%20dairy%20and%20large%20scale%20dairy%20farms%20in%20the%20southern%20highlands%20of%20tanzania http://dx.doi.org/10.1007/s11250-005-5688-7 https://scholar.google.com/scholar?hl=en&q=a%20retrospective%20survey%20of%20liver%20fasciolosis%20and%20stilesiosis%20in%20livestock%20based%20on%20abattoir%20data%20in%20arusha,%20tanzania http://dx.doi.org/10.1007/s11250-009-9325-8 https://scholar.google.com/scholar?hl=en&q=distribution,%20prevalence%20and%20intensity%20of%20schistosoma%20bovis%20in%20cattle%20in%20iringa%20district,%20tanzania http://dx.doi.org/10.1016/s0304-4017(97)00179-9 https://scholar.google.com/scholar?hl=en&q=fascioliasis%20as%20a%20limiting%20factor%20in%20livestock%20productivity https://scholar.google.com/scholar?hl=en&q=comparison%20of%20production%20loss%20caused%20by%20chronic%20fasciola%20gigantica%20infection%20in%20yearling%20friesian%20and%20boran%20cattle https://scholar.google.com/scholar?hl=en&q=acute%20fascioliasis%20in%20sheep%20in%20kinangop%20district,%20nyandarua%20district%20of%20kenya https://scholar.google.com/scholar?hl=en&q=the%20prevalence%20and%20economic%20importance%20of%20bovine%20fascioliasis%20in%20kenya:%20an%20analysis%20of%20abattoir%20data https://scholar.google.com/scholar?hl=en&q=the%20prevalence%20and%20economic%20significance%20of%20fasciola%20gigantica%20and%20stilesia%20hepatica%20in%20slaughtered%20animals%20in%20semi-arid%20coastal%20kenya http://dx.doi.org/10.1007/s11250-006-4394-4 animal review, 2017, 4(2): 21-34 33 © 2017 conscientia beam. all rights reserved. [48] e. s. swai and e. ulicky, "an evaluation of the economic losses resulting from condemnation of cattle livers and loss of carcass weight due to fasciolosis: a case study from hai town abattoir, kilimanjaro region, tanzania." livestock research for rural development, vol. 21, p. 186, 2009. [49] j. m. k. hyera, "prevalence, seasonal variation and economic significance of fascioliasis in cattle as observed at iringa abattoir between 1976-1980," bulletin of animal health and production in africa, vol. 32, pp. 356-359, 1984. [50] e. s. swai, "prevalence of fascioliasis, cysticercus’s bovis and hydatidosis based on abattoir data 1974-1984 in arusha municipality," b.sc. dissertation, sokoine university of agriculture, morogoro, 1985. [51] a. e. makundi, "epidemiology and control of bovine fascioliasis and schistosomosis in tanzania," ph.d. thesis, sokoine university of agriculture, morogoro, 2001. [52] k. matsudo, t. inaba, and h. kamiya, "detection of echinococcus multilocularis eggs by centrifugal flotation technique: preliminary survey of soil left in the ferryboats commuting between hokkaido island, where e. multilocularis is endemic, and mainland japan," japanese journal of infectious diseases, vol. 56, pp. 118-119, 2003. view at google scholar [53] e. ernest, h. e. nonga, r. r. kazwala, and a. a. kassuku, "hydatidosis of slaughtered animals in ngorongoro district of arusha region, tanzania," tropical animal health and production, vol. 47, pp. 179-1185, 2007. [54] u. c. braee, m. kabululu, m. e. nørmark, p. nejsum, h. a. ngowi, and m. v. johansen, "taenia hydatigena cysticercosis in slaughtered pigs, goats, and sheep in tanzania," tropical animal health and production, vol. 47, pp. 1523-1530, 2015. view at google scholar | view at publisher [55] s. m. miran, j. nzalawahe, j. kassuku, and e. s. swai, "prevalence of coenurosis at three slaughter slabs in ngorongoro district, tanzania," tropical animal health and production, vol. 47, pp. 1591-1597, 2015. view at google scholar | view at publisher [56] c. n. l. macpherson, p. s. craig, t. romig, e. zeyhle, and h. watshinger, "observation on human echinococcosis (hydatidosis) and evaluation of transmission factors in the maasai of northern tanzania," annals of tropical medicine and parasitology, vol. 83, pp. 489-497, 1989. view at google scholar | view at publisher [57] c. k. harper and b. l. penzhorn, "occurrence and diversity of coccidia in indigenous, saanen and crossbred goats in south africa," veterinary parasitology, vol. 82, pp. 1-9, 1999. view at google scholar | view at publisher [58] r. chibunda, a. p. muhairwa, d. m. kambarage, m. m. a. mtambo, l. j. m. kusiluka, and r. r. kazwala, "eimeriosis in dairy cattle farms in morogoro municipality of tanzania," preventive veterinary medicine, vol. 31, pp. 191-197, 1997. view at google scholar | view at publisher [59] l. j. m. kusiluka, d. m. kambarage, r. w. matthewman, l. j. s. harrison, and c. j. daborn, "coccidiosis of small ruminants in tanzania," small ruminant research, vol. 21, pp. 127-131, 1996. view at google scholar | view at publisher [60] l. j. m. kusiluka, d. m. kambarage, l. j. s. harrison, c. j. daborn, and r. w. matthewman, "prevalence and seasonal patterns of coccidial infections in goats in two ecoclimatic areas in morogoro, tanzania," small ruminant research, vol. 30, pp. 85-91, 1998. view at google scholar | view at publisher [61] l. j. m. kusiluka, e. d. karimuribo, r. h. mdegela, e. j. luoga, p. k. t. munishi, m. r. s. mlozi, and d. m. kambarage, "prevalence and impact of water-borne zoonotic pathogens in water, cattle and humans in selected villages in dodoma rural and bagamoyo districts. tanzania," physics and chemistry of the earth, parts a/b/c., vol. 30, pp. 818825, 2005. view at google scholar | view at publisher [62] e. n. kimbita, r. s. silayo, e. d. mwega, a. t. mtau, and j. b. mroso, "studies on the eimeria of goats at magadu dairy farm sua, morogoro, tanzania," tropical animal health and production, vol. 41, pp. 1263-1265, 2009. view at google scholar | view at publisher [63] b. lema, "studies of aetiologies of neaonatal diarrhoea in selected farms in tanzania," ph.d. thesis, university of giessen, geissen, 1990. https://scholar.google.com/scholar?hl=en&q=detection%20of%20echinococcus%20multilocularis%20eggs%20by%20centrifugal%20flotation%20technique:%20preliminary%20survey%20of%20soil%20left%20in%20the%20ferryboats%20commuting%20between%20hokkaido%20island,%20where%20e.%20multilocularis%20is%20endemic,%20and%20mainland%20japan https://scholar.google.com/scholar?hl=en&q=detection%20of%20echinococcus%20multilocularis%20eggs%20by%20centrifugal%20flotation%20technique:%20preliminary%20survey%20of%20soil%20left%20in%20the%20ferryboats%20commuting%20between%20hokkaido%20island,%20where%20e.%20multilocularis%20is%20endemic,%20and%20mainland%20japan https://scholar.google.com/scholar?hl=en&q=taenia%20hydatigena%20cysticercosis%20in%20slaughtered%20pigs,%20goats,%20and%20sheep%20in%20tanzania http://dx.doi.org/10.1007/s11250-015-0892-6 https://scholar.google.com/scholar?hl=en&q=prevalence%20of%20coenurosis%20at%20three%20slaughter%20slabs%20in%20ngorongoro%20district,%20tanzania https://scholar.google.com/scholar?hl=en&q=prevalence%20of%20coenurosis%20at%20three%20slaughter%20slabs%20in%20ngorongoro%20district,%20tanzania http://dx.doi.org/10.1007/s11250-015-0903-7 https://scholar.google.com/scholar?hl=en&q=observation%20on%20human%20echinococcosis%20(hydatidosis)%20and%20evaluation%20of%20transmission%20factors%20in%20the%20maasai%20of%20northern%20tanzania http://dx.doi.org/10.1080/00034983.1989.11812377 https://scholar.google.com/scholar?hl=en&q=occurrence%20and%20diversity%20of%20coccidia%20in%20indigenous,%20saanen%20and%20crossbred%20goats%20in%20south%20africa http://dx.doi.org/10.1016/s0304-4017(98)00266-0 https://scholar.google.com/scholar?hl=en&q=eimeriosis%20in%20dairy%20cattle%20farms%20in%20morogoro%20municipality%20of%20tanzania http://dx.doi.org/10.1016/s0167-5877(96)01131-2 https://scholar.google.com/scholar?hl=en&q=coccidiosis%20of%20small%20ruminants%20in%20tanzania http://dx.doi.org/10.1016/0921-4488(96)00860-7 https://scholar.google.com/scholar?hl=en&q=prevalence%20and%20seasonal%20patterns%20of%20coccidial%20infections%20in%20goats%20in%20two%20ecoclimatic%20areas%20in%20morogoro,%20tanzania http://dx.doi.org/10.1016/s0921-4488(98)00092-3 https://scholar.google.com/scholar?hl=en&q=prevalence%20and%20impact%20of%20water-borne%20zoonotic%20pathogens%20in%20water,%20cattle%20and%20humans%20in%20selected%20villages%20in%20dodoma%20rural%20and%20bagamoyo%20districts.%20tanzania http://dx.doi.org/10.1016/j.pce.2005.08.025 https://scholar.google.com/scholar?hl=en&q=studies%20on%20the%20eimeria%20of%20goats%20at%20magadu%20dairy%20farm%20sua,%20morogoro,%20tanzania https://scholar.google.com/scholar?hl=en&q=studies%20on%20the%20eimeria%20of%20goats%20at%20magadu%20dairy%20farm%20sua,%20morogoro,%20tanzania http://dx.doi.org/10.1007/s11250-009-9310-2 animal review, 2017, 4(2): 21-34 34 © 2017 conscientia beam. all rights reserved. [64] m. m. mtambo, j. b. sebatwale, d. m. kambarage, a. p. muhairwa, g. e. maeda, l. j. kusiluka, and r. r. kazwala, "prevalence of cryptosporidium spp. oocysts in cattle and wildlife in morogoro region, tanzania," preventive veterinary medicine, vol. 31, pp. 185-190, 1997. view at google scholar | view at publisher [65] e. s. swai, e. d. karimuribo, n. p. french, j. l. fitzpatrick, m. j. bryant, d. m. kambarage, and n. h. ogden, "prevalence and determinants of cryptosporidium spp. infection in smallholder dairy cattle in iringa and tanga regions of tanzania," onderstepoort journal of veterinary research, vol. 74, pp. 23-29, 2007. view at google scholar | view at publisher [66] e. s. swai and l. schoonman, "investigation into the prevalence of cryptosporidium infection in calves among smallholder dairy and traditional herds in tanzania," veterinary medicine international 676451, 2010. [67] j. s. chang'a, l. j. robertson, m. m. mtambo, r. h. mdegela, t. løken, and o. reksen, "unexpected results from large-scale cryptosporidiosis screening study in calves in tanzania," annals of tropical medicine & parasitology, vol. 105, pp. 513-519, 2011. view at google scholar | view at publisher [68] j. r. l. mhoma, p. w. n. kanyari, and j. m. kagira, "the prevalence of helminths, haemoparasites and ectoparasites in cattle in urban and peri-urban areas of mwanza city, tanzania," bulletin of animal health and production in africa, vol. 58, pp. 155-163, 2010. view at google scholar | view at publisher [69] r. schuster, l. coetzee, and j. f. putterill, "oribatid mites (acari, oribatida) as intermediate hosts of tapeworms of the family anoplocephalidae (cestoda) and the transmission of moniezia expansa cysticercoids in south africa," onderstepoort journal of veterinary research, vol. 67, pp. 49-55, 2000. view at google scholar [70] s. n. chiejina, epidemiology of some helminth infections of domesticated animals in the tropics with emphasis on fasciolosis and parasitic gastroenteritis. in: n. chowdhury and i. tada i (eds), helminthology. new delhi: narosa publishing house, 1994. [71] r. l. baker, j. o. audho, e. o. aduda, and w. thorpe, "genetic resistance to gastro-intestinal nematode parasites in galla and small east african goats in the sub-humid tropics," animal science journal, vol. 73, pp. 61-70, 2001. view at google scholar | view at publisher [72] r. l. baker, d. m. mwamachi, j. o. audho, e. o. aduda, and w. thorpe, "genetic resistance to gastro-intestinal nematode parasites in red maasai, dorper and maasai x dorper ewes in the sub-humid tropics," animal science journal, vol. 69, pp. 335-344, 1999. view at google scholar | view at publisher [73] b. rivera, d. parra, o. garcia, and e. aycardi, "gastro-intestinal parasites in calves in columbia," tropical animal health and production, vol. 15, pp. 107-114, 1983. view at google scholar | view at publisher [74] r. c. krecek and p. j. waller, "towards the implementation of the “basket of options” approach to helminth parasite control of livestock: emphasis on the tropics/subtropics," veterinary parasitology, vol. 139, pp. 270-282, 2006. view at google scholar | view at publisher views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://scholar.google.com/scholar?hl=en&q=prevalence%20of%20cryptosporidium%20spp.%20oocysts%20in%20cattle%20and%20wildlife%20in%20morogoro%20region,%20tanzania http://dx.doi.org/10.1016/s0167-5877(96)01130-0 https://scholar.google.com/scholar?hl=en&q=prevalence%20and%20determinants%20of%20cryptosporidium%20spp.%20infection%20in%20smallholder%20dairy%20cattle%20in%20iringa%20and%20tanga%20regions%20of%20tanzania http://dx.doi.org/10.4102/ojvr.v74i1.136 http://dx.doi.org/10.4102/ojvr.v74i1.136 https://scholar.google.com/scholar?hl=en&q=unexpected%20results%20from%20large-scale%20cryptosporidiosis%20screening%20study%20in%20calves%20in%20tanzania http://dx.doi.org/10.1179/2047773211y.0000000007 https://scholar.google.com/scholar?hl=en&q=the%20prevalence%20of%20helminths,%20haemoparasites%20and%20ectoparasites%20in%20cattle%20in%20urban%20and%20peri-urban%20areas%20of%20mwanza%20city,%20tanzania http://dx.doi.org/10.4314/bahpa.v58i2.63086 https://scholar.google.com/scholar?hl=en&q=oribatid%20mites%20(acari,%20oribatida)%20as%20intermediate%20hosts%20of%20tapeworms%20of%20the%20family%20anoplocephalidae%20(cestoda)%20and%20the%20transmission%20of%20moniezia%20expansa%20cysticercoids%20in%20south%20africa https://scholar.google.com/scholar?hl=en&q=genetic%20resistance%20to%20gastro-intestinal%20nematode%20parasites%20in%20galla%20and%20small%20east%20african%20goats%20in%20the%20sub-humid%20tropics https://scholar.google.com/scholar?hl=en&q=genetic%20resistance%20to%20gastro-intestinal%20nematode%20parasites%20in%20galla%20and%20small%20east%20african%20goats%20in%20the%20sub-humid%20tropics http://dx.doi.org/10.1017/s1357729800058057 https://scholar.google.com/scholar?hl=en&q=genetic%20resistance%20to%20gastro-intestinal%20nematode%20parasites%20in%20red%20maasai,%20dorper%20and%20maasai%20x%20dorper%20ewes%20in%20the%20sub-humid%20tropics http://dx.doi.org/10.1017/s1357729800050906 https://scholar.google.com/scholar?hl=en&q=gastro-intestinal%20parasites%20in%20calves%20in%20columbia http://dx.doi.org/10.1007/bf02239806 https://scholar.google.com/scholar?hl=en&q=towards%20the%20implementation%20of%20the%20“basket%20of%20options”%20approach%20to%20helminth%20parasite%20control%20of%20livestock:%20emphasis%20on%20the%20tropics/subtropics https://scholar.google.com/scholar?hl=en&q=towards%20the%20implementation%20of%20the%20“basket%20of%20options”%20approach%20to%20helminth%20parasite%20control%20of%20livestock:%20emphasis%20on%20the%20tropics/subtropics http://dx.doi.org/10.1016/j.vetpar.2006.04.018 8 © 2017 conscientia beam. all rights reserved. role of probiotics in animal nutrition h.m. gado1 a. khusro2 a.z.m. salem3+ 1department of animal production, faculty of agriculture, ain shams university, cairo, egypt 2research department of plant biology and biotechnology, loyola college, nungambakkam, chennai, india 3facultad de medicina veterinaria y zootecnia, universidad autónoma del estado de méxico, toluca, méxico (+ corresponding author) abstract article history received: 6 june 2017 revised: 4 july 2017 accepted: 18 july 2017 published: 27 july 2017 keywords probiotics domestic animals. poultry rabbits fish animal performance nutrition. the anaerobic probiotic technology (zad) is a patented technique. the products are in two forms either liquid or powder. the powder products are coated so it can handle the pressure and the temperature of the extruders. they are fed as follows; 10 gm/head /day for large animals or 1 kg/ tone of fed (for zado). in case of liquid (zad); it is fed 10 ml/head/day for large animals and 1.5 ml liter for poultry and rabbits. it decreases the aflatoxins less than 11% by inclusion rate of 7% of zad in 7 hours. they are helping the animals to cope with heat stress. their ability to decrease the cholesterol and triglycerides are noticed by 21 and 19%, respectively. the birds and animal immunity is elevated too. animal performances are improved in animals fed either form. milk production increased in dairy cattle (1.5 kg/animal/day) and dairy buffaloes (1kg/head/day). the same trend was recorded for meat production in cattle, buffaloes, and sheep (220, 180 and 90 gm/head/day, respectively as an average daily gain). for poultry, it helped in decreasing the fattening period by 5 days. in fish, the final weight increased by 18%. for rabbits, it increased the milk production, decreased the mortality rate, increased the average daily gain, and improved all over physiological aspects of rabbits. contribution/originality: this study documents the impact of probiotics on the growth performances and nutritional aspects of dairy animals, poultry, rabbit, fish, and beef. the primary contribution of this review article is to analyze the influence of anaerobic probiotic technology on the performances and other physiological aspects of ruminant and non-ruminant animals. 1. introduction probiotics are live microorganisms that confer health benefits to the host, and are generally regarded as safe. the fungal source probiotics had been known for long time, but now it has been shifted towards the bacterial side, particularly the anaerobic ones. in fact, the anaerobic bacteria sources associated probiotics have better performance with animals. in terms of their nutrition, fungi are saprophytes, and are commonly found in soil or water constituting organic wastes. digestive enzymes of fungi play a pivotal role in breaking down food outside their bodies, and help them absorb the degraded foods through cell walls, thereby considering them heterotrophic organisms. in contrary to this, bacteria belong to either heterotrophs or autotrophs. enzymes are known as biological catalysts that consist of diversified types of bioactive proteins that drive the chemical reaction by acting upon substrates through specific mode of action. catalysis is the process in which enzymes produced by all living organisms trigger the chemical reactions. substrates bind to the active site of the animal review 2017 vol. 4, no. 1, pp. 8-20 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2017.41.8.20 © 2017 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar.2017.41.8.20&domain=pdf&date_stamp=2017-01-14 animal review, 2017, 4(1): 8-20 9 © 2017 conscientia beam. all rights reserved. enzyme and form products. according to lock and key model, each active site on the enzyme is unique for specific substrate. however, active sites have the tendency to change their shape in order to bind with substrate through the induced fit model, which moves entire protein domains. several parameters viz. ph, temperature, substrate concentration, allosteric inhibitors and activators, and cofactors influence the activity of enzymes. an elevation in temperature (either below or above the optimum) causes the denaturation of active site, thereby avoiding the binding of substrate. on the other hand, at low temperature, enzymes lacks flexibility in order to allow induce fit. substrate concentration is another crucial factor that affects the enzyme yield. if the concentration of substrate is gradually increased, the reaction velocity will increase until it reaches a maximum. after this point, there will not be any increment in the rate of reaction. allosteric inhibitors are substances that decrease the activity of enzyme through two ways; competitive inhibitors and noncompetitive inhibitors. allosteric activators enhance the enzyme activity, and bid to allosteric sites in order to maintain the active configuration of enzyme. cofactors are another important factor that affects the enzyme activity and it can be a coenzyme, a prosthetic group or a metal ion activator. enzymes have broad-spectrum functions in the living organisms, contributing from signal transduction to generation of muscle contraction. they also catalyze the starch molecules into easily absorbed monomer unit by mammals called as maltose. 2. effect of anaerobic probiotics on fiber structure since the fibre fraction obtained from feces is fermentable, the degradation of fibre inside the rumen is not fully efficient [1]. in the last few years, researches focused on the supplementation of exogenous enzymes during in vitro rumen fermentation for fibre digestibility [2, 3]. however, the investigations still lack the positive influence of exogenous enzymes products on fibre digestibility. the zad® (a patented product manufactured by the academy of scientific research and technology, egypt), a biotechnical product made from anaerobic bacteria converts the polysaccharide into monomers by the enzyme catalytic process. gado, et al. [4] revealed that zad® improved nutrients digestibility, body weight gain and feed conversion of wheat straw in sheep. in fact, zad® is a mixture of enzymes obtained from anaerobic bacteria that had a beneficial impact on the digestibility of low quality roughages. according to kingsly, et al. [5] ddgs are highly nutritious and valuable feed for animals due to the presence of high protein and energy content ingredient. however, variation in composition affects the nutritional quality and market value of the product [6]. based on the findings, the rice straw (rs) depicted the highest (p<0.05) ndf and adf contents with respect to the ddgs, while the cp content was the highest in ddgs. the inclusion of anaerobic enzyme (enz) at 3 l enhanced quadratically (p<0.01) the degradation of ndf and adf of rs, and ddgs as well as their mixture (table 1). increasing the dose of enz from 0-3 l before ensiling rs, ddgs, and their mixture were known to improve quadratically (p<0.01) some of the degradation fractions of nutrients. in general, the inclusion of enz enhanced the degradable fractions of ndf and adf of ddgs by 11%, the degradation fraction of ndf and adf of rs plus ddgs by 6 and 8%, and the degradation rate of ndf and adf of rs by 24% (table 1) gado, et al. [7]. 3. effect of anaerobic probiotics on dairy animals recently, researchers have demonstrated that the supplementation of fiber degrading enzymes into the feeding diets of dairy cows and feedlot cattle can improve feed utilization and animal performance by enhancing fiber degradation in vitro [8-11] in situ [12-15], and in vivo [9, 16-18]. there is often an increased feed intake due to the feeding of enzymes, which may partly be because of the increased palatability of the diet due to sugars released by pre-ingestive fiber hydrolysis. however, post-ingestive enzyme activities, such as increased digestion rate and/or extent of digestion [12, 15, 18, 19] may improve hydrolytic activity in the rumen in order to reduce gut fill and to enhance feed intake [20]. animal review, 2017, 4(1): 8-20 10 © 2017 conscientia beam. all rights reserved. several mechanism of action of direct-fed enzymes had been proposed such as dietary fiber solubilization before ingestion, provision of readily fermentable substrate for ruminants, and/or improvement of microbial enzyme activity in the rumen [21]. the enzyme efficacy is influenced by the specific activity of enzymes, their mode of application, type of animal, and feeding diet. direct-fed enzymes can also improve the microbial colonization of feed by increasing total counts of ruminal microorganisms [22, 23] in order to increase fiber degradation rate [14, 16, 24] and protein synthesis of rumen microbes [16, 25]. table-1. effect of enz levels on in vitro degradation† of dm and fibre fractions of rs, ddgs, and their mixture in sheep (adapted from gado, et al. [7]) enz, l ton-1 sem‡ contrast§ 0 1 3 l q rs dm a (%) 11.0 17.3 22.6 4.66 0.006 0.024 b (%) 33.4 39.2 44.7 3.12 0.009 0.035 a+b (%) 44.4 56.5 67.3 2.88 0.006 0.041 c (%/h) 2.3 3.4 4.6 0.68 0.008 0.021 ndf b (%) 41.5 44.6 48.6 1.45 0.009 0.016 c (%/h) 2.1 2.4 2.7 0.42 0.240 0.340 adf b (%) 38.2 41.1 44.7 1.44 0.008 0.019 c (%/h) 2.4 2.6 2.8 0.61 0.190 0.048 ddgs dm a (%) 28.7 29.4 31.4 1.44 0.005 0.036 b (%) 46.1 49.8 53.4 2.62 0.009 0.042 a+b (%) 74.8 79.2 84.8 1.89 0.007 0.026 c (%/h) 3.8 4.0 4.9 0.79 0.007 0.042 ndf b (%) 45.4 47.4 51.5 1.93 0.008 0.035 c (%/h) 3.2 3.5 3.9 0.53 0.008 0.012 adf b (%) 49.9 50.6 55.6 1.99 0.009 0.043 c (%/h) 3.4 3.5 3.9 0.29 0.006 0.051 rs with 10% ddgs dm a (%) 15.6 26.4 33.8 3.73 0.009 0.043 b (%) 34.2 46.3 55.1 2.47 0.008 0.031 a+b (%) 49.8 72.7 88.9 4.83 0.008 0.026 c (%/h) 3.2 4.3 5.4 0.29 0.006 0.04 ndf b (%) 42.5 48.6 53.6 3.81 0.007 0.042 c (%/h) 2.8 3.1 3.6 0.33 0.006 0.043 adf b (%) 41.8 42.2 45.8 1.69 0.008 0.036 c (%/h) 2.6 3.1 3.4 0.29 0.006 0.046 †a, soluble fraction; b, potentially degradable fraction; a+b, total degradation; c, degradation rate. ‡sem, standard error of the mean, §probability of a linear (l) or quadratic (q) effect of enz level. the supplementation of exogenous enzymes to feeding diets has been known to exhibit positive influence on lactating dairy cows and growing cattle. dairy cows fed with fibrolytic enzyme treated forage produced 5–25% more milk [14, 26, 27], increased the energy balance of transition dairy cows [28], and increased the production of milk in small ruminants [27, 29]. the treatment of fibrolytic enzymes improved live weight (lw) gain and feed conversion ratio by up to 35% and 10% respectively in feedlot cattle [30]. the ruminal fermentation, nitrogen balance, nutrient digestibility, and milk production of cows have been improved due to the addition of commercially available zado® [9, 31]. further, the lw gain and feed conversion animal review, 2017, 4(1): 8-20 11 © 2017 conscientia beam. all rights reserved. of wheat straw in sheep and goats were also observed to be improved [17, 18]. intake of dm and om was positively affected by the supplementation of enzyme (table 2). the digestibility of dm, om, andfom and adfom was higher (p<0.05) in the zado® enzyme supplemented cows. table-2. intake, whole tract nutrients digestibility, and nitrogen balance of the tmra fed to dairy cows supplemented with (zado®) or without (ctrl) the exogenous enzymes mixture ctrl zado® sem significance (p) intake (kg/d) dm 16.1 18.2 0.21 0.049 om 14.1 16.4 0.14 0.048 andfom 7.1 7.4 0.23 0.192 adfom 4.04 4.57 0.11 0.087 digestibility (g/kg) dm 663 743 2.1 0.045 om 667 741 2.9 0.047 andfom 418 584 2.8 0.049 adfom 401 532 2.3 0.046 nitrogen balance n intake (g/d) 1654 1870 54 0.07 urinary n (g/d) 509 542 12.6 0.11 fecal n (g/d) 659 711 14.3 0.17 n balance (g/d) 486 617 11.9 0.06 dm, dry matter; om, organic matter; adfom, acid detergent fiber; andfom, neutral detergent fiber. tmr: total mixed ration without (ctrl) or with (zado® ) enzyme supplemented cows showed higher (p<0.05) scfa and ammonia n concentrations (table 3) prefeeding (122 versus 111 mmol/100 ml; 126 versus 110 mg/l respectively) and at 3 h post-feeding (128 versus 119 mmol/100 ml; 67 versus 55 mg/l respectively). further, the addition of enzyme caused increased acetate and propionate 3 h post-feeding. an increase in n was also observed due to the zado supplementation, whereas the increment in excretion of n in urine and feces in the zado group was observed non-significant. the n balance in the zado group was higher than that of control group, while microbial n synthesis was increased in the enzyme supplemented cows (220 versus 190 g/d; p<0.05). table-3. ruminal ph, short chain fatty acids (scfas, total and individual), ammonia n concentrations (after 0 and 3 h of feeding); microbial nitrogen synthesis of the tmra fed to dairy cows supplemented with (zado® ) or without (ctrl) the exogenous enzymes mixture ctrl zado® sem significance (p) ph 6.1 5.9 0.24 0.41 before feeding (0 h) total scfa (mmol/l) 111 122 2.1 0.34 individual scfa (mol/100 mol) acetate (a) 61.0 64.8 1.30 0.05 propionate (p) 17.8 18.1 0.83 0.13 butyrate 11.3 11.9 0.81 0.24 a:p ratio 3.43 3.85 1.162 0.14 ammonia n (mg/l) 55 67 0.37 0.04 post-feeding (3 h) total scfa (mmol/l) 119.2 128 3.6 0.04 individual scfa (mol/100 mol) acetate (a) 60.0 64.0 1.2 0.04 propionate (p) 18.3 20.8 0.87 0.01 butyrate 10.9 11.0 0.96 0.31 a:p ratio 3.28 3.08 0.070 0.01 ammonia n (mg/l) 110 126 2.3 0.05 microbial n (g/d) 190 220 9.6 0.04 uric acid (mmol/d) 22.4 24.6 0.67 0.16 allantoin (mmol/d) 308 304 10.4 0.26 tmr: total mixed ration without (ctrl) or with (zado® ) the commercial exogenous enzyme mixture animal review, 2017, 4(1): 8-20 12 © 2017 conscientia beam. all rights reserved. in the recent years, researchers have demonstrated that the supplementation of fiber degrading enzymes into the feeding diets of cattle enhanced the degradation of fibers effectively, thereby improving the feed utilization as well as animal performance [9, 17, 18]. the solubilization of dietary fiber before ingestion, and provision of readily fermentable substrate for ruminal microorganisms and for improvement of microbial enzyme activity in the rumen are considered the most common modes of action of direct-fed enzymes [21]. the enzyme yield is known to be influenced by diversified factors viz. the specific activity of the enzymes, their mode and level of application, and type of animal and its diet. direct-fed enzymes can also improve the microbial colonization of feed by increasing total counts of ruminal fibrolytic microorganisms [22, 23] by enhancing fiber degradation rate in the rumen [14, 24], microbial protein synthesis in rumen [16, 25], and forestomach digestibility. the addition of exogenous enzymes to ruminant feeds has shown positive impact on feedlot cattle. further, the fibrolytic enzymes have improved the live weight gain by 35%, and feed conversion ratio by 10% [30]. 4. effect of anaerobic probiotic on rabbit rabbits play a crucial role in the supply of animal proteins for humans and occupy a pivotal position among non-ruminants. it can effectively utilize cellulose-rich feed in rations constituting less than 20% of grain [32] because of the suitability of its digestive system for high cellulose rich diets [33, 34]. rabbit are categorized just below poultry in term of feed efficiency due to their simple biological properties, short breeding cycle, and high feed conversion efficiency rate [35]. a variety of enzymes have been used as potent additives in the feeding diets of nonruminants, and they are well-known to improve the rate of absorption of nutrients in the intestines [33, 34, 36]. the beneficial impacts of the supplementation of enzymes attribute to a significant reduction in the viscosity of digesta in the intestine and the non starch polysaccharides present in the endosperm cell walls [37]. additionally, the supplementation of cellulolytic enzymes to the diet of rabbits has a pronounced positive influence on the weight gain [38]. since, the rate of digestion of fibre and starch in young rabbits is limited [33, 34, 39], the supplementation of enzymes increased the dietary digestion as well as performance of young rabbits on starter diets [33, 34, 40]. similar observation was also reported in 30 d old rabbits weaned at 25 d [41]. previously, researchers had demonstrated the mechanism of action of exogenous enzymes on various segments of the rabbit gut. sequeira, et al. [42] showed a significant reduction in the gastric ph due to the addition of enzymes, while enzymes showed non-significant affect on the gastric, intestinal, and caecal contents, even in the period following early weaning [43]. artificial insemination or natural mating helps to achieve the improved productivity in rabbits [32, 44]. previously, the ez0 rabbit bucks showed a lower sexual drive than the ez-supplemented rabbit bucks, coincident with a linear increase in blood testosterone levels with ascending levels of the diet ez additive. the reaction time of rabbit bucks was found to be much longer than 4.2s with new zealand white×chinchilla rabbit bucks [45] and 1421s in black baladi and white new zealand rabbit bucks [46] due to the testosterone and estradiol, which synergistically stimulates male sexual behaviour [47]. however, chemo investigation, frequency of mountings, and reduced mount latency may stimulate estradiol. the slightly higher blood levels of testosterone in ezsupplemented rabbit bucks apparently enhanced reaction time, thereby confirming the low sexual drive due to decreased testosterone concentration [48]. the blood testosterone concentration in ez -supplemented groups was higher than in the ez0 rabbit bucks. the positive influence of the supplementation of exogenous ez might be because of a stimulatory role of nutrients made available to the animal on testicular steroidogenesis, as improved nutrition enhances testicular functions, thereby stimulating the synthesis of testosterone [49]. the incorporation of ez to rabbit buck diets remarkably increased sperm concentrations and total sperm counts, indicating that diets constituting the enzymatic complex had impact on the spermatogenesis. however, the addition of exogenous fibrolytic enzymes in the diets has improved the fibre digestion due to the growth and bioactive proteins of animal review, 2017, 4(1): 8-20 13 © 2017 conscientia beam. all rights reserved. cellulolytic ruminal bacteria [50, 51]. moreover, the enzyme preparation in the feeding diets could have improved intestinal mucosal development, which increases nutrient digestibility, which in turn would promote nourishment of the sertoli cells and seminal fluid. other researchers had documented a remarkable improvement in semen volume, and total sperm cells were observed after the ejaculation of rabbit bucks [52, 53]. there is a strong correlation between animal nutrition and spermatogenesis, sperm maturation, and male reproductive system development [54]. the availability of macronutrients and micronutrients for spermatogenesis was found to be improved due to the supplementation of ez. this might be because of the enhanced endocrine activity of rabbit buck gonads, which created a favourable environment for spermatogenesis process. the beneficial impact of the ez complex dietary addition on semen characteristics was expressed in the long term because the spermatogenesis process in rabbit bucks takes approximately 47 d [55]. the ejaculate volume observed in the rabbit bucks that received the highest ez level was comparatively higher than the previous reports [56]. the supplementation of ez showed not only improvement in the sperm motility but also reduction in the abnormal sperm and dead spermatozoa, thereby suggested that dietary manipulation using an ez additive improved the proliferation of sperm cells. this response could be due to the effect of nutritional components on neuroendocrine pathways that controls reproduction [57]. a valid assessment for fertility of rabbit bucks was obtained through in vitro oestrus cervical mucus penetration test. previous studies revealed a significant correlation between several sperm quality parameters in farm animals [58, 59]. the study showed that the sperm migration through cervical mucus was increased due to the ez complex additives. semen preservation is still a limiting parameter for the extensive commercial application programs in rabbits [60]. the survival rate of rabbit sperm drastically decreased after 36 h, and its fertilizing potentiality diminished after 16 h of storage [61]. further, the study revealed that the semen from rabbit bucks receiving the maximal level of the ez preparation showed increased motility than semen from other ez groups, after 3 d of refrigeration, which is against the finding of carluccio, et al. [61]. this could be due to a greater nutrient availability for rabbit bucks, thereby presenting increased sperm cells vitality. the positive effect of improved nutrition of sperm motility in other mammals was also documented [62]. this is undoubtedly a pivotal step for the breeding management of rabbit bucks. decrease in the mean got and gpt activity in the seminal plasma of ez supplemented rabbit groups was observed. this could be mainly due to a membrane stabilizing property of nutrients made available by the ez complex, causing lesser release of these enzymes in seminal plasma. the leakage of these enzymes proved to be an indicator of semen quality [63]. testes and epididymides are considered to be the possible sources of these enzymes [64]. 5. effect of anaerobic probiotic on poultry exogenous enzymes are well known for improving the feeding values of feedstuffs [65, 66]. however, it has also been documented that enzyme cocktail (carbohydrase and protease) enhanced the productivity [67] and digestibility of corn and soybean meal, which induces less viscosity for broilers [68, 69]. the utilization of exogenous enzymes as additives in the diets of broiler chicken has gained immense attention because of both environmental and economical concern [70]. the efficiency of several commercial enzyme products has been well stated, but there is still some vagueness in their mode of action [71]. moreover, a number of findings reported that the digestibility of nutrients in broilers improved due to the supplementation of dietary enzymes [69, 70, 72]. additionally, the incorporation of enzymes accelerated the development of the immune organs [73]. authors hypothesized that the improvement of the nutrient digestibility might be reflected in enhancing immunity [74]. zado®), a commercial exogenous enzyme mixture product has been shown to improve ruminal fermentation, n balance and nutrient digestibility, milk yield [9, 50] live body weight gain (bwg), and feed conversion ratio [4, 18, 75]. additionally, the dietary serine protease showed improved bw feed efficiency and digestibility of fat, protein [76], and amino acids [77]. animal review, 2017, 4(1): 8-20 14 © 2017 conscientia beam. all rights reserved. in another report, total number of 225 one d-old hubbard broiler chicks were given the basal diet supplemented with 0.1, 0.3, 0.5 and 0.7 kg zado®. zado® constitutes a mix of anaerobic bacteria as well as xylanases (2.3 u/g), cellulases (7.1 u/g), alpha-amylase (61.5 u/g), and protease (29.2 u/g) in a powder form, obtained through an anaerobic fermentation process [4, 50]. the supplementation of 0.5 kg zado® in the diets of broiler displayed positive impact on the body weight and the liveability of the broilers at the growing period than that of fed control diets. further, the results showed a significant (p≤ 0.05) increment in the body weight at 21 day of age for the group supplemented with z3 than other groups and the same trend was recorded at 35 day of age. the z3 group showed better lbw (p≤ 0.01) than control, z2, and z4 groups. the groups supplemented with z3, z4, and z2 showed improved daily weight gain than control group. according to the report of kocher, et al. [78], the improved performance was observed due to the inclusion of enzyme cocktail (pectinase, amylase and protease) in corn-sbm-based diets for chicks. cowieson, et al. [79] indicated that exogenous xylanase, amylase, protease, and phytase (avizyme) can be used to maintain the performance of birds fed on a nutritionally rich feeding diet. additionally, cowieson and ravindran [69] demonstrated that the supplementation of enzyme product (xylanase, amylase, and protease) into corn-sbm based broiler diets improved bwg and feed efficiency, without affecting the feed intake values. further, authors also reported that the supplementation of enzyme cocktail can improve the energy and amino acid values of corn-sbm-based diets, thereby offering economic values to producers. the incorporation of enzymes in corn-sbm-based diets improved starch digestibility, improved access to cell contents, modified the intestinal microbiota, and improved protein solubility. in another report, saleh, et al. [67] demonstrated that the commercial enzymes constituting carbohydrases and protease (energex) improved the productivity (bwg and fcr) of broilers fed corn-sbm-based diets, without influencing the feed intake values. zanella, et al. [80] demonstrated that the supplementation of xylanase, amylase, and protease improved the energy and amino acid digestibility of a corn-sbm-based diet for broilers. additionally, kalmendal and tauson [70] reported the improved fcr due to the supplementation of the combination of xylanase and serine protease. moreover, gracia, et al. [72] demonstrated improved bwg and fcr by 4 to 9% in amylase-supplemented diet compared to the control diet. remus, et al. [81] summarized the influence of a combination of xylanase, amylase, and protease on ileal digestibility of amino acids for 5 broiler trials and recorded a mean response value of about 2%. the plasma protein profile of broilers was affected due to the dose dependent supplementation of zado® in feeding diets. significant increment in the total protein and globulin content was estimated, while no significant differences were observed in the albumin content. these findings had influenced the a/g ratio, thereby reflecting improvement in broilers immunity. further, the study showed significant improvement in the relative weight of the spleen and bursa due to the supplementation of 0.5kg zado® into corn-based diets, suggesting that the addition of enzyme stimulated the development of the immune organ. no significant differences in calcium and phosphorus levels were noticed. the concentration of plasma thyroid hormones differed significantly among various treatments. additionally, zado® supplementation reduced the cholesterol level in plasma, indicating that the enzyme additives may contribute a decisive role in the lipid metabolisms of broiler. 6. effect of anaerobic probiotic on fish certain enzymes are known to deactivate the anti-nutritional components, and improve the nutritive value of plant-associated proteins in the feeding diets of fish. previous report demonstrated the feeding trial strategy in order to evaluate the impact of zado® (containing amylases, proteases, cellulases, and xylanases) supplementation on the survival, growth, and carcass characteristics in rabbitfish. the additives caused enhancement in the total weight gain, body weight gain, and specific growth rate of rabbitfish, thereby stimulating the growth performance as well as nutrient utilization. animal review, 2017, 4(1): 8-20 15 © 2017 conscientia beam. all rights reserved. 7. effect of anaerobic probiotic on beef the zado® treatment has been known to improve the daily voluntary dm intakes, rumen microbial n synthesis, and digestibility of all nutrients in beef. further, the additive increased the (p<0.05) the rumen ammonia n and total volatile fatty acids (tvfa's) concentrations before and 3 h post-feeding. a significant increase in the daily gain due to zado® supplementation was due to the positive impact on the nutrient intake and digestibility, ruminal fermentation, and microbial protein synthesis. increased ammonia n concentration in cows may probably be due to the presence of protease. previous reports demonstrated that the supplementation of enzyme to diets increased gain probably because of the improved digestibility as well as energy available for the growth [15, 16, 30]. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] d. o. krause, s. e. denman, r. i. mackie, m. morrison, a. l. rae, g. t. attwood, and c. s. mcsweeney, "opportunities to improve fiber degradation in the rumen: microbiology, ecology, and genomics," fems microbiology reviews, vol. 27, pp. 663-693, 2003. view at google scholar | view at publisher [2] a. n. hristov, a. n. hristov, c. e. basel, a. melgar, a. e. foley, j. k. ropp, c. w. hunt, and j. m. tricarico, "effect of exogenous polysaccharide-degrading enzyme preparations on ruminal fermentation and digestibility of nutrients in dairy cows," animal feed science and technology, vol. 145, pp. 182-193, 2008. view at google scholar | view at publisher [3] a. z. m. salem, a. a. hassan, m. s. khalil, h. m. gado, h. alsersy, and j. simbaya, "effects of sun-drying and exogenous enzymes on nutrients intake, digestibility and nitrogen utilization in sheep fed atriplex halimus foliages," animal feed science and technology, vol. 171, pp. 128-135, 2012. view at google scholar | view at publisher [4] h. m. gado, a. z. m. salem, n. e. odongo, and b. e. borhami, "influence of exogenous enzymes ensiled with orange pulp on digestion and growth performance in lambs," animal feed science and technology, vol. 165, pp. 131-136, 2011. view at google scholar | view at publisher [5] a. r. p. kingsly, k. e. ileleji, c. l. clementson, a. garcia, d. e. maier, r. l. stroshine, and s. radcliff, "the effect of process variables during drying on the physical and chemical characteristics of corn dried distillers grains with solubles (ddgs) plant scale experiments," bioresource technology, vol. 101, pp. 193-199, 2010. view at google scholar | view at publisher [6] r. l. belyea, k. d. rausch, t. e. clevenger, v. singh, d. b. johnston, and m. e. tumbleson, "sources of variation in composition of ddgs," animal feed science and technology, vol. 159, pp. 122-130, 2010. view at google scholar | view at publisher [7] h. m. gado, a. z. m. salem, l. m. camacho, and m. m. y. elghandour, "influence of exogenous enzymes of zad on in vitro ruminal degradation of ensiled rice straw with ddgs," animal feed science and technology, vol. 13, pp. 303308, 2013. [8] a. n. hristov, l. m. rode, k. a. beauchemin, and r. l. wuerfel, "effect of a commercial enzyme preparation on barley silage in vitro and in sacco dry matter degradability," proceedings western section american society of animal science, vol. 47, pp. 282–284, 1996. [9] h. m. gado, h. m. metwally, h. soliman, a. z. l. basiony, and e. r. el galil, "enzymatic treatments of bagasse by different sources of cellulase enzymes," presented at the 11th conference animal nutrition, al-aqsor aswan, egypt on 2 november, 13–18, 2007. https://scholar.google.com/scholar?hl=en&q=opportunities%20to%20improve%20fiber%20degradation%20in%20the%20rumen:%20microbiology,%20ecology,%20and%20genomics http://dx.doi.org/10.1016/s0168-6445(03)00072-x https://scholar.google.com/scholar?hl=en&q=effect%20of%20exogenous%20%20polysaccharide-degrading%20enzyme%20preparations%20on%20ruminal%20fermentation%20and%20digestibility%20of%20nutrients%20in%20dairy%20cows http://dx.doi.org/10.1016/j.anifeedsci.2007.05.051 https://scholar.google.com/scholar?hl=en&q=effects%20of%20sun-drying%20and%20exogenous%20enzymes%20on%20nutrients%20intake,%20digestibility%20and%20nitrogen%20utilization%20in%20sheep%20fed%20atriplex%20halimus%20foliages http://dx.doi.org/10.1016/j.anifeedsci.2011.10.011 https://scholar.google.com/scholar?hl=en&q=influence%20of%20exogenous%20enzymes%20ensiled%20with%20orange%20pulp%20on%20digestion%20and%20growth%20performance%20in%20lambs http://dx.doi.org/10.1016/j.anifeedsci.2011.02.016 https://scholar.google.com/scholar?hl=en&q=the%20effect%20of%20process%20variables%20during%20%20drying%20on%20the%20physical%20and%20chemical%20characteristics%20of%20corn%20dried%20distillers%20grains%20with%20solubles%20(ddgs)%20-%20plant%20scale%20experiments http://dx.doi.org/10.1016/j.biortech.2009.07.070 http://dx.doi.org/10.1016/j.biortech.2009.07.070 https://scholar.google.com/scholar?hl=en&q=sources%20of%20variation%20in%20composition%20of%20ddgs http://dx.doi.org/10.1016/j.anifeedsci.2010.06.005 http://dx.doi.org/10.1016/j.anifeedsci.2010.06.005 animal review, 2017, 4(1): 8-20 16 © 2017 conscientia beam. all rights reserved. [10] m. m. el-adawy, a. z. m. salem, b. e. borhami, h. m. gado, m. s. khalil, and a. abo-zeid, "in vitro cecal gas production and dry matter degradability of some browse leaves in presence of enzymes from anaerobic bacterium in nzw rabbit," presented at the the 9th wrsa world rabbit congress, verona, italy, june 10–13, 2008. [11] m. a. m. rodrigues, p. pinto, r. m. f. bezerra, a. a. dias, c. v. m. guedes, v. m. g. cardoso, j. w. cone, l. m. m. ferreira, j. colaco, and c. a. sequeira, "effect of enzyme extracts isolated from white-rot fungi on chemical composition and in vitro digestibility of wheat straw," animal feed science and technology, vol. 141, pp. 326–338, 2008. view at google scholar | view at publisher [12] p. feng, c. w. hunt, g. t. pritchard, and w. e. julien, "effect of enzyme preparations on in situ and in vitro degradation and in vivo digestive characteristics of mature cool-season grass forage in beef steers," journal of animal science, vol. 74, pp. 1349–1357, 1996. view at google scholar | view at publisher [13] g. e. lewis, c. w. hunt, w. k. sanchez, r. treacher, g. t. pritchard, and p. feng, "effect of direct-fed fibrolytic enzymes on the digestive characteristics of a forage-based diet fed to beef steers," journal of animal science, vol. 74, pp. 3020–3028, 1996. view at google scholar | view at publisher [14] j. m. tricarico, j. d. johnston, k. a. dawson, k. c. hanson, k. r. mcleod, and d. l. harmon, "the effects of an aspergillus oryzae extract containing alpha-amylase activity on ruminal fermentation and milk production in lactating holstein cows," animal science, vol. 81, pp. 365–374, 2005. view at google scholar | view at publisher [15] n. a. krueger, a. t. adesogan, c. r. staples, w. k. krueger, s. c. kim, r. c. littell, and l. e. sollenberger, "effect of method of applying fibrolytic enzymes or ammonia to bermuda grass hay on feed intake, digestion, and growth of beef steers," journal of animal science, vol. 86, pp. 882–889, 2008. view at google scholar | view at publisher [16] w. z. yang, k. a. beauchemin, and l. m. rode, "effects of an enzyme feed additive on extent of digestion and milk production of lactating dairy cows," journal of dairy science, vol. 82, pp. 391–403, 1999. view at google scholar | view at publisher [17] a. z. m. salem, m. m. el-adawy, h. gado, and m. s. m. khalil, "feed intake, nutrient digestibility and animal growth performance in sheep and goats fed wheat straw," adsa psa ampa asas joint annual meeting, san antonio, tx, usa, july 8–12. journal of animal science, vol. 85, p. 107, 2007. [18] h. m. gado and a. z. m. salem, "influence of exogenous enzymes from anaerobic source on growth performance, digestibility, ruminal fermentation and blood metabolites in lambs fed of orange pulp silage in total mixed ration," presented at the 59th annual meeting of the european association for animal production, vilnius, lithuania, august 24–27, 2008. [19] k. a. beauchemin and l. m. rode, "use of feed enzymes in ruminant nutrition. in: rode, l.m. (ed.)," in proceedings canadian society of animal science lethbridge, ab, canada, 1996, pp. 103–130. [20] a. t. adesogan, "improving forage quality and animal performance with fibrolytic enzymes," presented at the in: florida ruminant nutrition symposium, 2005. [21] t. a. mcallister, a. n. hristov, k. a. beauchemin, l. m. rode, and k. j. cheng, "enzymes in ruminant diets. in: bedford, m., partridge, g. (eds.), enzymes in farm animal nutrition," presented at the cabi publishing, oxon, uk, 2001. [22] d. p. morgavi, k. a. beauchemin, v. l. nsereko, l. m. rode, m. mcallister, and y. wang, "a trichoderma feed enzyme preparation enhances adhesion of fibrobacter succinogenes to complex substrates but not to pure cellulose," presented at the 25th conf. rumen function, chicago, il, usa, 2000. [23] v. l. nsereko, d. p. morgavi, l. m. rode, k. a. beauchemin, and t. a. mcallister, "effects of fungal enzyme preparations on hydrolysis and subsequent degradation of alfalfa hay fiber by mixed rumen microorganisms in vitro," animal feed science and technology, vol. 88, pp. 153–170, 2000. view at google scholar | view at publisher [24] l. a. giraldo, m. l. tejido, m. j. ranilla, and m. d. carro, "effects of exogenous fibrolytic enzymes on in vitro ruminal fermentation of substrates with different forage:concentrate ratios," animal feed science and technology, vol. 141, pp. 306–325, 2008. view at google scholar | view at publisher https://scholar.google.com/scholar?hl=en&q=effect%20of%20enzyme%20extracts%20isolated%20from%20white-rot%20fungi%20on%20chemical%20composition%20and%20in%20vitro%20digestibility%20of%20wheat%20straw http://dx.doi.org/10.1016/j.anifeedsci.2007.06.015 https://scholar.google.com/scholar?hl=en&q=effect%20of%20enzyme%20preparations%20on%20in%20situ%20and%20in%20vitro%20degradation%20and%20in%20vivo%20digestive%20characteristics%20of%20mature%20cool-season%20grass%20forage%20in%20beef%20steers http://dx.doi.org/10.2527/1996.7461349x https://scholar.google.com/scholar?hl=en&q=effect%20of%20direct-fed%20fibrolytic%20enzymes%20on%20the%20digestive%20characteristics%20of%20a%20forage-based%20diet%20fed%20to%20beef%20steers http://dx.doi.org/10.2527/1996.74123020x https://scholar.google.com/scholar?hl=en&q=the%20effects%20of%20an%20aspergillus%20oryzae%20extract%20containing%20alpha-amylase%20activity%20on%20ruminal%20fermentation%20and%20milk%20production%20in%20lactating%20holstein%20cows http://dx.doi.org/10.1079/asc50410365 https://scholar.google.com/scholar?hl=en&q=effect%20of%20method%20of%20applying%20fibrolytic%20enzymes%20or%20ammonia%20to%20bermuda%20grass%20hay%20on%20feed%20intake,%20digestion,%20and%20growth%20of%20beef%20steers http://dx.doi.org/10.2527/jas.2006-717 https://scholar.google.com/scholar?hl=en&q=effects%20of%20an%20enzyme%20feed%20additive%20on%20extent%20of%20digestion%20and%20milk%20production%20of%20lactating%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(99)75245-8 http://dx.doi.org/10.3168/jds.s0022-0302(99)75245-8 https://scholar.google.com/scholar?hl=en&q=effects%20of%20fungal%20enzyme%20preparations%20on%20hydrolysis%20and%20subsequent%20degradation%20of%20alfalfa%20hay%20fiber%20by%20mixed%20rumen%20microorganisms%20in%20vitro http://dx.doi.org/10.1016/s0377-8401(00)00225-x https://scholar.google.com/scholar?hl=en&q=effects%20of%20exogenous%20fibrolytic%20enzymes%20on%20in%20vitro%20ruminal%20fermentation%20of%20substrates%20with%20different%20forage:concentrate%20ratios http://dx.doi.org/10.1016/j.anifeedsci.2007.06.013 animal review, 2017, 4(1): 8-20 17 © 2017 conscientia beam. all rights reserved. [25] v. l. nsereko, k. a. beauchemin, d. p. morgavi, l. m. rode, a. f. furtado, t. a. mcallister, a. d. iwaasa, w. z. yang, and y. wang, "effect of a fibrolytic enzyme preparation from trichoderma longibrachiatum on the rumen microbial population of dairy cows," canadian journal of microbiology, vol. 48, pp. 14-20, 2002. view at google scholar | view at publisher [26] g. e. lewis, w. k. sanchez, r. c. treacher, w. hunt, and g. t. pritchard, "effect of direct-fed fibrolytic enzymes on lactational performance of midlactation holstein cows," proceedings, western section, american society of animal science and canadian society of animal science, vol. 46, pp. 310–313, 1995. [27] a. v. stella, r. paratte, l. valnegri, g. cigalino, g. soncini, e. chevaux, v. dell’orto, and g. savoini, "effect of administration of live saccharomyces cerevisiae on milk production, milk composition, blood metabolites, and faecal flora in early lactating dairy goats," small ruminant research, vol. 67, pp. 7–13, 2007. view at google scholar | view at publisher [28] j. m. defrain, a. r. hippen, k. f. kalscheur, and j. m. tricarico, " effects of dietary α-amylase on metabolism and performance of transition dairy cows," journal of dairy science, vol. 88, pp. 4405–4413, 2005. view at google scholar | view at publisher [29] h. titi and w. f. lubbadeh, "effect of feeding cellulase enzyme on productive responses of pregnant and lactating ewes and goats," small ruminant research, vol. 52, pp. 137–143, 2004. view at google scholar [30] k. a. beauchemin, l. m. rode, and v. j. h. sewaltm, "fibrolytic enzymes increase fiber digestibility and growth rate of steers fed dry forages," canadian journal of animal science, vol. 75, pp. 641–644, 1995. view at google scholar | view at publisher [31] m. s. soliman, "utilization of peanut hay in ruminant feeding," ph.d. thesis, alexandria university, alexandria, egypt, 2006. [32] s. y. saleh, k. a. attia, m. fouad, and m. m. nassar, "effects of multi-enzyme feed additive “kemzyme” or/and sodium bentonite “as a feed binder”on sexual activity and some fertility parameters of rabbit bucks," journal of agricultural science, vol. 2, pp. 89-99, 2010. view at google scholar | view at publisher [33] n. abdel-aziz, m. el-adawy, a. z. m. salem, m. a. cerrillo-soto, l. m. camacho, and b. e. borhami, "effects of exogenous enzymes, lactobacillus acidophilus or their combination on feed intake, digestibility and performance of rabbits fed sugarcane bagasse," animal feed science and technology, vol. 14, pp. 137-145, 2014. view at google scholar | view at publisher [34] n. abdel-aziz, m. el-adawy, m. a. mariezcurrena-berasain, a. z. m. salem, j. olivares-pérez, a. e. kholif, and b. e. borhami, "effects of exogenous enzymes, lactobacillus acidophilus or their combination on feed performance response and carcass characteristics of rabbits fed sugarcane bagasse," journal of integrative agriculture, vol. 14, pp. 544-549, 2015. view at google scholar | view at publisher [35] m. s. hasanat, m. e. hossain, m. p. mostari, and m. a. hossain, "effect of concentrate supplementation on growth and reproductive performance of rabbit under rural condition," bangladesh journal of veterinary medicine, vol. 4, p. 129 132, 2006. view at google scholar | view at publisher [36] m. r. bedford and a. j. morgan, "the use of enzymes in poultry diets," world's poultry science journal, vol. 52, pp. 6168, 1996. view at google scholar | view at publisher [37] r. t. zijstra, c. f. m. de lange, and j. f. patience, "nutritional value of wheat for growing pigs: chemical composition and digestible energy content," canadian journal of animal science, vol. 79, pp. 187-194, 1999. view at google scholar | view at publisher [38] s. chandra, m. mahender, m. g. prakash, t. raghunandan, and k. k. reddy, "productive performance of broiler rabbits fed diets supplemented with probiotic and enzymes under two systems of housing," indian journal of animal research, vol. 48, pp. 355-361, 2014. view at google scholar | view at publisher [39] m. marounek, s. j. vovk, and v. skřivanová, "distribution of activity of hydrolytic enzymes in the digestive tract of rabbits," british journal of nutrition, vol. 73, pp. 463-469, 1995. view at google scholar | view at publisher https://scholar.google.com/scholar?hl=en&q=effect%20of%20a%20fibrolytic%20enzyme%20preparation%20from%20trichoderma%20longibrachiatum%20on%20the%20rumen%20microbial%20population%20of%20dairy%20cows http://dx.doi.org/10.1139/w01-131 http://dx.doi.org/10.1139/w01-131 https://scholar.google.com/scholar?hl=en&q=effect%20of%20administration%20of%20live%20saccharomyces%20cerevisiae%20on%20milk%20production,%20milk%20composition,%20blood%20metabolites,%20and%20faecal%20flora%20in%20early%20lactating%20dairy%20goats http://dx.doi.org/10.1016/j.smallrumres.2005.08.024 https://scholar.google.com/scholar?hl=en&q=effects%20of%20dietary%20α-amylase%20on%20metabolism%20and%20performance%20of%20transition%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(05)73127-1 http://dx.doi.org/10.3168/jds.s0022-0302(05)73127-1 https://scholar.google.com/scholar?hl=en&q=effect%20of%20feeding%20cellulase%20enzyme%20on%20productive%20responses%20of%20pregnant%20and%20lactating%20ewes%20and%20goats https://scholar.google.com/scholar?hl=en&q=fibrolytic%20enzymes%20increase%20fiber%20digestibility%20and%20growth%20rate%20of%20steers%20fed%20dry%20forages http://dx.doi.org/10.4141/cjas95-096 http://dx.doi.org/10.4141/cjas95-096 https://scholar.google.com/scholar?hl=en&q=effects%20of%20multi-enzyme%20feed%20additive%20“kemzyme”%20or/and%20sodium%20bentonite%20“as%20a%20feed%20binder”on%20sexual%20activity%20and%20some%20fertility%20parameters%20of%20rabbit%20bucks http://dx.doi.org/10.5539/jas.v2n4p89 https://scholar.google.com/scholar?hl=en&q=effects%20of%20exogenous%20enzymes,%20lactobacillus%20acidophilus%20or%20their%20combination%20on%20feed%20intake,%20digestibility%20and%20performance%20of%20rabbits%20fed%20sugarcane%20bagasse http://dx.doi.org/10.1016/s2095-3119(14)60827-3 http://dx.doi.org/10.1016/s2095-3119(14)60827-3 https://scholar.google.com/scholar?hl=en&q=effects%20of%20exogenous%20enzymes,%20lactobacillus%20acidophilus%20or%20their%20combination%20on%20feed%20performance%20response%20and%20carcass%20characteristics%20of%20rabbits%20fed%20sugarcane%20bagasse http://dx.doi.org/10.1016/s2095-3119(14)60827-3 https://scholar.google.com/scholar?hl=en&q=effect%20of%20concentrate%20supplementation%20on%20growth%20and%20reproductive%20performance%20of%20rabbit%20under%20rural%20condition http://dx.doi.org/10.3329/bjvm.v4i2.1296 https://scholar.google.com/scholar?hl=en&q=the%20use%20of%20enzymes%20in%20poultry%20diets http://dx.doi.org/10.1079/wps19960007 https://scholar.google.com/scholar?hl=en&q=nutritional%20value%20of%20wheat%20for%20growing%20pigs:%20chemical%20composition%20and%20digestible%20energy%20content https://scholar.google.com/scholar?hl=en&q=nutritional%20value%20of%20wheat%20for%20growing%20pigs:%20chemical%20composition%20and%20digestible%20energy%20content http://dx.doi.org/10.4141/a98-103 https://scholar.google.com/scholar?hl=en&q=productive%20performance%20of%20broiler%20rabbits%20fed%20diets%20supplemented%20with%20probiotic%20and%20enzymes%20under%20two%20systems%20of%20housing http://dx.doi.org/10.5958/0976-0555.2014.00455.5 https://scholar.google.com/scholar?hl=en&q=distribution%20of%20activity%20of%20hydrolytic%20enzymes%20in%20the%20digestive%20tract%20of%20rabbits http://dx.doi.org/10.1079/bjn19950048 animal review, 2017, 4(1): 8-20 18 © 2017 conscientia beam. all rights reserved. [40] i. gutiérrez, a. espinosa, j. garcía, r. carabaño, and c. de blas, "effect of levels of starch, fiber and lactose on digestion and growth performance of early-weaned rabbits," journal of animal science, vol. 80, pp. 1029-1037, 2002. view at google scholar | view at publisher [41] c. fernández, j. m. merino, and r. carabaño, "effect of enzyme complex supplementation on diet digestibility and growth performance in growing rabbits," in proceedings of the sixth world rabbit congress, 9-12 july, 1996, toulouse, france, 1996, pp. 163-166. [42] j. sequeira, n. nicodemus, r. carabaño, and m. j. villamide, "effect of type of wheat and addition of enzymes on some digestive parameters at different sampling time," in proc.: 7th world rabbit congress. 4-7 july, 2000, valencia, spain, 2000, pp. 437-444. [43] l. falcão-e-cunha, l. castro-solla, l. maertens, m. marounek, v. pinheiro, j. freire, and j. l. mourao, "alternatives to antibiotics growth promoters in rabbit feeding: a review," world rabbit science, vol. 15, pp. 127-140, 2007. view at google scholar | view at publisher [44] l. r. rodríguez-de, m. fallas-lópez, r. rangel-santos, v. mariscal-aguayo, p. a. martínez-hernández, and m. j. g. garcía, "influence of doe exposure and season on reaction time and semen quality of male rabbits," in proc.: 9th world rabbit congress, june 10-13, 2008, verona, italy, 2008. [45] i. p. ogbuewu, i. c. okoli, and m. u. iloeje, "semen quality characteristics, reaction time, testis weight and seminiferous tubule diameter of buck rabbits fed neem (azadirachta indica a. juss) leaf meal based diets," iranian journal of reproductive medicine, vol. 7, pp. 23-28, 2009. view at google scholar [46] h. m. safaa, m. e. emarah, and n. f. a. saleh, "seasonal effects on semen quality in black baladi and white new zealand rabbit bucks," world rabbit science, vol. 16, pp. 13-20, 2008. view at google scholar | view at publisher [47] e. cross and c. e. roselli, "17 beta-estradiol rapidly facilitates chemo investigation and mounting in castrated male rats," american journal of physiology, vol. 226, pp. 497-509, 1999. [48] a. e. b. zeidan, i. f. m. marai, and z. a. abd el-kariem, "effects of intratesticular injection of gonadotropin-releasing hormone on reproductive performance of low fertile male rabbits under egyptian summer conditions," in proc.: 1st international conference on animal production and health, 2-4 september, 1997, dokki, egypt, 1997, pp. 557-566. [49] y. a. attia and k. i. kamel, "semen quality, testosterone, seminal plasma biochemical and antioxidant profiles of rabbit bucks fed diets supplemented with different concentrations of soybean lecithin," animal, vol. 6, pp. 824-833, 2012. view at google scholar [50] h. m. gado, a. z. m. salem, p. h. robinson, and m. hassan, "influence of exogenous enzymes on nutrient digestibility, extent of ruminal fermentation as well as milk production and composition in dairy cows," animal feed science and technology, vol. 154, pp. 36-46, 2009. view at google scholar | view at publisher [51] y. wang, j. e. ramirez-bribiesca, l. j. yanke, a. tsang, and t. a. mcallister, "effect of exogenous fibrolytic enzyme application on the microbial attachment and digestion of barley straw in vitro," asian-australasian journal of animal sciences, vol. 25, pp. 66-74, 2012. view at google scholar | view at publisher [52] c. castellini, p. lattaioli, a. d. bosco, a. minelli, and c. mugnai, "oxidative status and semen characteristics of rabbit buck as affected by dietary vitamin e, c and n-3 fatty acids," reproduction nutrition development, vol. 43, pp. 91-103, 2003. view at google scholar | view at publisher [53] e. o. ewuola, "daily sperm production, gonadal and extra-gonadal sperm reserves of rabbits fed prebiotic and probiotic supplemented diets," international journal of applied agriculture and apiculture research, vol. 9, pp. 48-53, 2013. view at google scholar [54] y. cheah and w. yang, "functions of essential nutrition for high quality spermatogenesis," advances in bioscience and biotechnology, vol. 2, pp. 182-197, 2011. view at google scholar | view at publisher [55] c. boiti, c. castellini, u. besenfelder, m. theau-clément, l. liguori, t. renieri, and f. pizzi, "guidelines for the handling of rabbit bucks and semen," world rabbit science, vol. 13, pp. 71-91, 2005. view at google scholar https://scholar.google.com/scholar?hl=en&q=effect%20of%20levels%20of%20starch,%20fiber%20and%20lactose%20on%20digestion%20and%20growth%20performance%20of%20early-weaned%20rabbits http://dx.doi.org/10.2527/2002.8041029x https://scholar.google.com/scholar?hl=en&q=alternatives%20to%20antibiotics%20growth%20promoters%20in%20rabbit%20feeding:%20a%20review https://scholar.google.com/scholar?hl=en&q=alternatives%20to%20antibiotics%20growth%20promoters%20in%20rabbit%20feeding:%20a%20review http://dx.doi.org/10.4995/wrs.2007.597 https://scholar.google.com/scholar?hl=en&q=semen%20quality%20characteristics,%20reaction%20time,%20testis%20weight%20and%20seminiferous%20tubule%20diameter%20of%20buck%20rabbits%20fed%20neem%20(azadirachta%20indica%20a.%20juss)%20leaf%20meal%20based%20diets https://scholar.google.com/scholar?hl=en&q=seasonal%20effects%20on%20semen%20quality%20in%20black%20baladi%20and%20white%20new%20zealand%20rabbit%20bucks http://dx.doi.org/10.4995/wrs.2008.640 https://scholar.google.com/scholar?hl=en&q=semen%20quality,%20testosterone,%20seminal%20plasma%20biochemical%20and%20antioxidant%20profiles%20of%20rabbit%20bucks%20fed%20diets%20supplemented%20with%20different%20concentrations%20of%20soybean%20lecithin https://scholar.google.com/scholar?hl=en&q=semen%20quality,%20testosterone,%20seminal%20plasma%20biochemical%20and%20antioxidant%20profiles%20of%20rabbit%20bucks%20fed%20diets%20supplemented%20with%20different%20concentrations%20of%20soybean%20lecithin https://scholar.google.com/scholar?hl=en&q=influence%20of%20exogenous%20enzymes%20on%20nutrient%20digestibility,%20extent%20of%20ruminal%20fermentation%20as%20well%20as%20milk%20production%20and%20composition%20in%20dairy%20cows http://dx.doi.org/10.1016/j.anifeedsci.2009.07.006 https://scholar.google.com/scholar?hl=en&q=effect%20of%20exogenous%20fibrolytic%20enzyme%20application%20on%20the%20microbial%20attachment%20and%20digestion%20of%20barley%20straw%20in%20vitro http://dx.doi.org/10.5713/ajas.2011.11158 https://scholar.google.com/scholar?hl=en&q=oxidative%20status%20and%20semen%20characteristics%20of%20rabbit%20buck%20as%20affected%20by%20dietary%20vitamin%20e,%20c%20and%20n-3%20fatty%20acids http://dx.doi.org/10.1051/rnd:2003008 https://scholar.google.com/scholar?hl=en&q=daily%20sperm%20production,%20gonadal%20and%20extra-gonadal%20sperm%20reserves%20of%20rabbits%20fed%20prebiotic%20and%20probiotic%20supplemented%20diets https://scholar.google.com/scholar?hl=en&q=functions%20of%20essential%20nutrition%20for%20high%20quality%20spermatogenesis http://dx.doi.org/10.4236/abb.2011.24029 https://scholar.google.com/scholar?hl=en&q=guidelines%20for%20the%20handling%20of%20rabbit%20bucks%20and%20semen animal review, 2017, 4(1): 8-20 19 © 2017 conscientia beam. all rights reserved. [56] d. paál, j. kročková, ľ. ondruška, t. slanina, f. strejček, and p. massányi, "effect of semen collection frequency on the progress in the motility of rabbit spermatozoa," slovak journal of animal science, vol. 47, pp. 61-67, 2014. view at google scholar [57] g. b. martin, j. rodger, and d. blache, "nutritional and environmental effects on reproduction in small ruminants," reproduction fertility and development, vol. 16, pp. 491-501, 2004. view at google scholar [58] l. richardson, j. p. hanrahan, l. o’hara, a. donovan, s. fair, m. o’sullivan, s. d. carrington, p. lonergan, and a. c. evans, "ewe breeds differences in fertility after cervical ai with frozen-thawed semen and associated differences in sperm penetration and physicochemical properties of cervical mucus," animal reproduction science, vol. 129, pp. 37-43, 2011. view at google scholar | view at publisher [59] c. martínez-rodríguez, m. alvarez, l. ordás, c. a. chamorro, f. martinez-pastor, l. anel, and p. de paz, "evaluation of ram semen quality using polyacrylamide gel instead of cervical mucus in the sperm penetration test," theriogenology, vol. 77, pp. 1575-1586, 2012. view at google scholar | view at publisher [60] f. lópez-gatius, g. sances, m. sancho, j. yaniz, p. santolaria, r. gutiérrez, m. núñez, j. núñez, and c. soler, "effect of solid storage at 15°c on the subsequent motility and fertility of rabbit semen," theriogenology, vol. 64, pp. 252-260, 2005. view at google scholar | view at publisher [61] a. carluccio, d. robbe, i. de amicis, a. contri, u. tosi, f. russo, and m. paoletti, "artificial insemination in rabbits: laboratory and field trial with three different semen extenders," world rabbit science, vol. 12, pp. 65-79, 2004. view at google scholar | view at publisher [62] a. contri, i. de amicis, a. molinari, m. faustini, a. gramenzi, d. robbe, and a. carluccio, " effect of dietary antioxidant supplementation on fresh semen quality in stallion," theriogenology, vol. 75, pp. 1319-1326, 2011. view at google scholar | view at publisher [63] n. s. juyena and c. stelletta, "seminal plasma: an essential attribute to spermatozoa," journal of andrology, vol. 33, pp. 536-551, 2012. view at google scholar [64] m. kareskoski and t. katila, "components of stallion seminal plasma and the effects of seminal plasma on sperm longevity," in proc.: 5th international symposium on stallion reproduction, 2008, pp. 249-256. [65] n. mathlouthi, s. mallet, l. saulnier, b. quemener, and m. larbier, "effect of xylanase and alpha-glucanase addition on performance, nutrient digestibility and physico-chemical conditions in the small intestine contents and caecal microflora of broiler chickens fed a wheat and barley-based diet," animal research, vol. 51, pp. 395-406, 2002. view at publisher [66] r. lázaro, m. garcía, m. j. araníbar, and g. g. mateos, "effect of enzyme addition to wheat-, barleyand rye-based diets on nutrient digestibility and performance of laying hens," british poultry science, vol. 44, pp. 256-265, 2003. view at google scholar | view at publisher [67] f. saleh, m. tahir, a. ohtsuka, and k. hayashi, "a mixture of pure cellulase, hemicellulase and pectinase improves broiler performance," british poultry science, vol. 46, pp. 602-606, 2005. view at google scholar | view at publisher [68] o. a. olukosi, a. j. cowieson, and o. adeola, "age-related influence of a cocktail of xylanase, amylase and protease or phytase individually or in combination in broilers," poultry science, vol. 86, pp. 77-86, 2007. view at google scholar [69] a. j. cowieson and v. ravindran, "effect of exogenous enzymes in maize-based diets varying in nutrient density for young broilers: growth performance and digestibility of energy, minerals and amino acids," british poultry science, vol. 49, pp. 37-44, 2008. view at google scholar | view at publisher [70] r. kalmendal and r. tauson, "effects of a xylanase and protease, individually or in combination and an ionophore coccidiostat on performance, nutrient utilization and intestinal morphology in broiler chickens fed a wheat-soybean meal-based diet," poultry science, vol. 91, pp. 1387-1393, 2012. view at google scholar | view at publisher [71] m. r. bedford, "the role of carbohydrases in feed stuff digestion," presented at the poultry feed stuffs: supply, composition and nutritive value. j. macnab and n. boorman, ed. cab international, wallingford, uk, 2002. https://scholar.google.com/scholar?hl=en&q=effect%20of%20semen%20collection%20frequency%20on%20the%20progress%20in%20the%20motility%20of%20rabbit%20spermatozoa https://scholar.google.com/scholar?hl=en&q=effect%20of%20semen%20collection%20frequency%20on%20the%20progress%20in%20the%20motility%20of%20rabbit%20spermatozoa https://scholar.google.com/scholar?hl=en&q=nutritional%20and%20environmental%20effects%20on%20reproduction%20in%20small%20ruminants https://scholar.google.com/scholar?hl=en&q=ewe%20breeds%20differences%20in%20fertility%20after%20cervical%20ai%20with%20frozen-thawed%20semen%20and%20associated%20differences%20in%20sperm%20penetration%20and%20physicochemical%20properties%20of%20cervical%20mucus http://dx.doi.org/10.1016/j.anireprosci.2011.10.012 https://scholar.google.com/scholar?hl=en&q=evaluation%20of%20ram%20semen%20quality%20using%20polyacrylamide%20gel%20instead%20of%20cervical%20mucus%20in%20the%20sperm%20penetration%20test http://dx.doi.org/10.1016/j.theriogenology.2011.11.026 https://scholar.google.com/scholar?hl=en&q=effect%20of%20solid%20storage%20at%2015°c%20on%20the%20subsequent%20motility%20and%20fertility%20of%20rabbit%20semen http://dx.doi.org/10.1016/j.theriogenology.2004.11.015 https://scholar.google.com/scholar?hl=en&q=artificial%20insemination%20in%20rabbits:%20laboratory%20and%20field%20trial%20with%20three%20different%20semen%20extenders https://scholar.google.com/scholar?hl=en&q=artificial%20insemination%20in%20rabbits:%20laboratory%20and%20field%20trial%20with%20three%20different%20semen%20extenders http://dx.doi.org/10.4995/wrs.2004.580 https://scholar.google.com/scholar?hl=en&q=effect%20of%20dietary%20antioxidant%20supplementation%20on%20fresh%20semen%20quality%20in%20stallion https://scholar.google.com/scholar?hl=en&q=effect%20of%20dietary%20antioxidant%20supplementation%20on%20fresh%20semen%20quality%20in%20stallion http://dx.doi.org/10.1016/j.theriogenology.2010.12.003 https://scholar.google.com/scholar?hl=en&q=seminal%20plasma:%20an%20essential%20attribute%20to%20spermatozoa http://dx.doi.org/10.1051/animres:2002034 http://dx.doi.org/10.1051/animres:2002034 https://scholar.google.com/scholar?hl=en&q=effect%20of%20enzyme%20addition%20to%20wheat-,%20barley-%20and%20rye-based%20diets%20on%20nutrient%20digestibility%20and%20performance%20of%20laying%20hens https://scholar.google.com/scholar?hl=en&q=effect%20of%20enzyme%20addition%20to%20wheat-,%20barley-%20and%20rye-based%20diets%20on%20nutrient%20digestibility%20and%20performance%20of%20laying%20hens http://dx.doi.org/10.1080/00071660301951 https://scholar.google.com/scholar?hl=en&q=a%20mixture%20of%20pure%20cellulase,%20hemicellulase%20and%20pectinase%20improves%20broiler%20performance http://dx.doi.org/10.1080/00071660500255661 https://scholar.google.com/scholar?hl=en&q=age-related%20influence%20of%20a%20cocktail%20of%20xylanase,%20amylase%20and%20protease%20or%20phytase%20individually%20or%20in%20combination%20in%20broilers https://scholar.google.com/scholar?hl=en&q=effect%20of%20exogenous%20enzymes%20in%20maize-based%20diets%20varying%20in%20nutrient%20density%20for%20young%20broilers:%20growth%20performance%20and%20digestibility%20of%20energy,%20minerals%20and%20amino%20acids http://dx.doi.org/10.1080/00071660701812989 https://scholar.google.com/scholar?hl=en&q=effects%20of%20a%20xylanase%20and%20protease,%20individually%20or%20in%20combination%20and%20an%20ionophore%20coccidiostat%20on%20performance,%20nutrient%20utilization%20and%20intestinal%20morphology%20in%20broiler%20chickens%20fed%20a%20wheat-soybean%20meal-based%20diet http://dx.doi.org/10.3382/ps.2011-02064 animal review, 2017, 4(1): 8-20 20 © 2017 conscientia beam. all rights reserved. [72] m. i. gracia, m. j. aranibar, r. lázaro, p. medel, and g. g. mateos, "alpha-amylase supplementation of broiler diets based on corn," poultry science, vol. 82, pp. 436-442, 2003. view at google scholar | view at publisher [73] f. gao, y. jiang, g. h. zhou, and z. k. han, "the effects of xylanase supplementation on growth, digestion, circulating hormone and metabolite levels, immunity and gut microflora in cockerels fed on wheat-based diets," british poultry science, vol. 48, pp. 480-488, 2007. view at google scholar | view at publisher [74] h. m. safaa, s. a. riad, f. r. mohamed, s. s. siam, and h. a. el-minshawy, "probiotic, prebiotic and yeast supplementation in broiler diets from 1 to 42 days of age: 2. immune response and slaughter traits," poultry science, vol. 89, pp. 546-547, 2010. [75] h. m. gado, "effect of enzymatic treatments for poor quality roughages on fiber digestibility and nitrogen metabolism in baladi goats," egyptian journal of nutrition and feeds, vol. 1, pp. 50-56, 1997. view at google scholar [76] d. m. freitas, s. l. vieira, c. r. angel, a. favero, and a. maiorka, "performance and nutrient utilization of broilers fed diets supplemented with a novel mono-component protease," journal of applied poultry research, vol. 20, pp. 322334, 2011. view at google scholar | view at publisher [77] c. r. angel, w. saylor, s. l. vieira, and n. ward, "effects of a mono-component protease on perfromance and protein utilization in 7to 22-day-old broiler chickens," poultry science, vol. 90, pp. 2281-2286, 2011. view at google scholar | view at publisher [78] a. kocher, m. choct, g. ross, j. broz, and t. k. chung, "effects of enzyme combinations on ame of corn-sbm based diet in broilers," journal of applied poultry research, vol. 12, pp. 275-283, 2003. view at google scholar | view at publisher [79] a. j. cowieson, d. n. singh, and o. adeola, "prediction of ingredient quality and the effect of a combination of xylanase, amylase, protease and phytase in the diets of broiler chicks. 1. growth performance and digestible nutrient intake," british poultry science, vol. 47, pp. 477-489, 2006. view at google scholar | view at publisher [80] i. zanella, n. k. sakomura, f. g. silversides, a. fiqueirdo, and m. pack, "effect of enzyme supplementation of broiler diets based on maize and soybeans," poultry science, vol. 78, pp. 561-568, 1999. view at google scholar | view at publisher [81] j. remus, m. hruby, and e. e. m. pierson, "impact of the avizyme 1500 series on apparent ileal amino acid digestibility in poultry," poultry science, vol. 84, p. 11, 2005. view at google scholar views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://scholar.google.com/scholar?hl=en&q=alpha-amylase%20supplementation%20of%20broiler%20diets%20based%20on%20corn http://dx.doi.org/10.1093/ps/82.3.436 https://scholar.google.com/scholar?hl=en&q=the%20effects%20of%20xylanase%20supplementation%20on%20growth,%20digestion,%20circulating%20hormone%20and%20metabolite%20levels,%20immunity%20and%20gut%20microflora%20in%20cockerels%20fed%20on%20wheat-based%20diets http://dx.doi.org/10.1080/00071660701477320 https://scholar.google.com/scholar?hl=en&q=effect%20of%20enzymatic%20treatments%20for%20poor%20quality%20roughages%20on%20fiber%20digestibility%20and%20nitrogen%20metabolism%20in%20baladi%20goats https://scholar.google.com/scholar?hl=en&q=performance%20and%20nutrient%20utilization%20of%20broilers%20fed%20diets%20supplemented%20with%20a%20novel%20mono-component%20protease http://dx.doi.org/10.3382/japr.2010-00295 https://scholar.google.com/scholar?hl=en&q=effects%20of%20a%20mono-component%20protease%20on%20perfromance%20and%20protein%20utilization%20in%207-%20to%2022-day-old%20broiler%20chickens http://dx.doi.org/10.3382/ps.2011-01482 http://dx.doi.org/10.3382/ps.2011-01482 https://scholar.google.com/scholar?hl=en&q=effects%20of%20enzyme%20combinations%20on%20ame%20of%20corn-sbm%20based%20diet%20in%20broilers http://dx.doi.org/10.1093/japr/12.3.275 https://scholar.google.com/scholar?hl=en&q=prediction%20of%20ingredient%20quality%20and%20the%20effect%20of%20a%20combination%20of%20xylanase,%20amylase,%20protease%20and%20phytase%20in%20the%20diets%20of%20broiler%20chicks.%201.%20growth%20performance%20and%20digestible%20nutrient%20intake http://dx.doi.org/10.1080/00071660600830603 https://scholar.google.com/scholar?hl=en&q=effect%20of%20enzyme%20supplementation%20of%20broiler%20diets%20based%20on%20maize%20and%20soybeans http://dx.doi.org/10.1093/ps/78.4.561 https://scholar.google.com/scholar?hl=en&q=impact%20of%20the%20avizyme%201500%20%20series%20on%20apparent%20ileal%20amino%20acid%20digestibility%20in%20poultry 81 † corresponding author © 2015 conscientia beam. all rights reserved. effects of dried rumen contents level in rations on the performance of shugor desert sheep in halfa elgadeda, kassala state, sudan amani a. b. osman1 --asma h.m. hamed2† --mohmed e. elimam3 1department of animal production, faculty of agriculture and natural resources, kassala university, halfa elgadeda, sudan 2 department of animal productions, faculty of agricultural and environmental sciences, university of gadarif, sudan 3goat research centre, faculty of agriculture, university of gezira abstract twelve shugor desert lambs at 9-12 month old and weighing about 25kg were used to study effects of different levels of dried rumen contents in rations on lamb’s performance in halfa elgadeda, kassala state, sudan. the animals were divided into three groups according to body weight and allocated at random to isonitrogenous and isocaloric rations with 0, 5 or 10% dried rumen contents. they were offered the rations ad lib. in one meal at 8 am. they were allowed a 15 days preliminary period and fattened for 49 days. barseem (medicago sativa) was fed once weekly. the data was statistically analyzed according to the completely randomized design. final bw, daily feed intake, total weight gain and daily weight gain varied among different levels of dried rumen contents in rations, but not significantly (p>0.05). they were highest in animals fed 10% dried rumen contents and least in animals fed no dried rumen contents. final bw (kg) was 30.27, 31.25 and 31.75 in animals fed 0, 5 and 10% dried rumen contents, respectively. daily feed intake (kg/day) was 01.20, 01.27 and 01.28, respectively. total weight gain (kg) was 4.25, 4.63 and 5.75, respectively. daily weight gain (g) was 150, 165 and 207, respectively. feed conversion ratio varied among levels of dried rumen contents in rations, but not significantly (p>0.05). it was 8.81, 7.87 and 7.61 in animals fed 0, 5 and 10% dried rumen contents, respectively. keywords: rumen contents, performance, desert sheep, feed conversion ratio, sudan. received: 14 february 2015/ revised: 30 june 2015/ accepted: 4 july 2015/ published: 9 july 2015 animal review 2015 vol. 2, no. 4, pp. 81-86 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.4/101.4.81.86 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.4/101.4.81.86 animal review, 2015, 2(4): 81-86 82 © 2015 conscientia beam. all rights reserved. contribution/ originality this study is one of very few studies which have investigated the effect of dried rumen content on the performance of shugor lambs. its primary contribution is finding that dried rumen contents had no negative effects on lambs’ performance and it can be added up to 10% in the rations. 1. introduction sheep production is very important in the sudan including halfa elgadida area in the butana plain, kassala state, sudan due to high population, wide distribution, reputed breeds and contribution to meat self-sufficiency and exports [1]. sudanese sheep meat is highly demanded since they depend on rangeland and no feed additives or growth promoters are used which affect humans and animals health. nutrition is a major obstacle for sheep production due to rangeland deterioration for many reasons [2, 3]. in addition there are seasonal variations in rangeland plants types, biomass and quality with serious impacts on animal’s health and performance, especially in the dry season [4]. it was concluded that desert sheep production systems are determined by nutritional seasonality [5]. the deficit in animal feeds was 23.689 million tones dm. agroindustrial by products are important in filling the nutritional deficit, especially in the dry season [6]. however, crop residues generally have low nutritive value due to low cp and high fibres and hence low digestibility, feed intake and animals’ performance [7]. concentrates are not commonly used in traditional systems due to high cost. it is important to exploit cheap feeds including animal wastes to reduce cost and improve nutritive value, performance and profits and avoid pollution. slaughter houses by products including blood, bone and meat meals and rumen contents are used as animal feeds. rumen contents alone or mixed partially replaced protein or energy in ruminants feeds [8, 9]. rumen contents result mainly from anaerobic fermentation and production of high quality microbial protein and volatile fatty acids and significant amounts of microbial storage carbohydrates, lipids and minerals [10]. the proximate analysis of rumen contents in the sudan was 95.54% dm, 18.83% cf, 13.21% cp, 0.62 ee, 39.57% ash and 27.77% nfe and gross energy was 4186 kcal [11]. it also had 14.4%, 4.2%, 41.1% and 9.7% cp, ee, adf and ash, respectively in feedlot steers [9] rumen contents composition in cattle was 12%, .16.2, 25.4%, 2.3, 13.5, 0.21 and 0.62 for dm, cp, cf, ee, ash, ca and p, respectively and calculated me was 17.3mj/kg dm [12]. in holstein steers fed diets with 30% alfalfa hay (alf) or dried rumen contents (drc) the latter decreased om and adf rumen digestion, om postruminal digestion and om, adf , n and de total tract digestion [13]. it increased ruminal microbial and n efficiency. estimated de was 1.21 mcal/ kg for drc and approximately 51% of medium-quality alfalfa hay. dried rumen contents had no negative effects on diets acceptability. there is no available information on using rumen contents in sheep rations in halfa elgadida. consequently, shugor animal review, 2015, 2(4): 81-86 83 © 2015 conscientia beam. all rights reserved. sheep were fed rations with different levels of rumen contents to determine the effects on sheep performance. 2. materials and methods 2.1. study area the study described below was conducted in the goat pens in the animal production farm in the faculty of agriculture and environmental sciences, kassala university in halfa elgadida, kassala state in june and july 2013. 2.2. animals twelve shugor desert male lambs at 9-12 month old and weighing about 25.kg were used in this study. they were bought from halfa elgadida livestock market and transported by car to the animal production farm. they were rested, ear tagged and housed in individual pens shaded with corrugated iron sheets and feed and water troughs were provided. the animals were treated against external and internal parasites and injected with oxytetracycline for optimum health during the experiment. they were weighed and divided into three groups according to body weight and the groups were then allocated at random to the three experimental rations. 2.3. feeds and feeding cattle rumen contents were collected from halfa elgadida slaughter house and transported by car to the animal production farm. the rumen contents were spread on plastic sacks and sun dried for one week. it was then stored in plastic sacks. three isonitrogenous and isocaloric rations containing 0, 5 or 10% dried rumen contents were used in this experiment. table 1 shows the ingredients and calculated cp and me of the rations fed to shugor desert lambs in halfa elgadida. the animals were fed groundnut haulm ad lib. and were changed gradually to the experimental rations to avoid digestive disturbances. the animals were fed green barseem ( medicago sativa) once weekly to maintain normal gut functions and a source of vitamins. the animals were fed the experimental rations ad lib. for 15 days as a preliminary period. they were then fed the experimental rations for 49 days. the rations were fed in one meal in the morning at 8 am. clean water was available all time. the animals were weighed before the morning meal at the beginning of the experiment and then weekly to the end of the experiment. they were fastened for 12 hrs. before weighing to avoid the variations in gut contents. daily feed intake was determined by offering preweighed rations and collecting and weighing the refusals before the morning meal in the following day. 2.4. calculations and statistical analysis feed intake was calculated as the difference in weight between offered rations and the refusals. total weight gain was calculated as the difference between initial and final body weights. animal review, 2015, 2(4): 81-86 84 © 2015 conscientia beam. all rights reserved. daily weight gain was calculated by dividing the weight gain by the day between them. feed conversion ratio was calculated by dividing the feed intake by total weight gain. the data was statistically analyzed according to snedecor and cochran [14] using the completely randomized design. 3. results and discussion table 2 shows the effects of different levels of rumen contents in rations on the performance of shugor lambs. final bw, daily feed intake, total weight gain and daily weight gain varied among different levels of rumen contents in rations, but not significantly (p>0.05). they were highest in animals fed 10% rumen contents and least in animals fed no rumen contents. feed conversion ratio varied among different levels of rumen contents in rations, but not significantly (p>0.05). it was highest in animals fed no rumen contents in rations and least in animals fed 10% rumen contents in rations.the increased shugor sheep final bw was mainly due to increased weight gain associated with increased daily feed intake in this study. the improved feed intake with increasing rumen content in rations was mainly due to its palatability. this was supported by the evidence that dried rumen contents had no negative effects on diets acceptability [13]. shugor lambs dmi was within the range for lambs fed different levels of mesquite pods in halfa elgadeda [1]. shugor lambs daily dmi was higher than in desert sheep fed rabaa ash alkali treated sorghum stover supplemented with 300 and 600g concentrates and within the range in animals fed 900g in the gezira state, sudan [15].shugor lambs daily weight gain was within the range for lambs fed different levels of mesquite pods in halfa elgadida. daily weight gain in shugor lambs fed rumen contents in rations was higher than in animals fed 300 g concentrates and rabaa ash alkali treated sorghum stover [15]. it was generally within the range in animals fed 600 and 900g.the improved shugor feed conversion ratio with increased levels of rumen contents in rations was mainly due to rumen contents high nutritive value [10, 12]. this boosted feeds nutritive value and exploitation. the improved fcr in shugor sheep with increasing rumen contents in rations was also found when rations with different mesquite levels [1]. 4. conclusion the results suggested that 10% rumen contents in rations were adequate for optimum shugor sheep performance in this study. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. animal review, 2015, 2(4): 81-86 85 © 2015 conscientia beam. all rights reserved. references [1] a. a. b. osman and m. e. elimam, "the effects of different levels of mesquite (prosopis chilensis) pods on the performance of shugor lambs in halfa elgadida, kassala state, sudan," gezira journal of agricultural sciences, vol. 10, pp. 95-101, 2012. [2] a. m. yagoub, "environmental consideration for sustainable development in greater darfur state," msc. thesis, institute of environmental studies, university of khartoum, khartoum, sudan, 1998. [3] a. o. abusuwar and a. darrag, pan arab integration in forage production and processing. case study. khartoum, sudan: sudan. arab organization for agricultural development (aoad), 2002. [4] f. m. elhag, "effect of chopping and wilting on tropical grass land silage quality in south kordofan, sudan," african livestock research, vol. 2, pp. 11-14, 1992. [5] a. m. a. elhag, "effects of rangeland protection and forage growth stage on vegetation attributes and sheep and goat selection at north kordofan, sudan," sudan journal of agricultural research, vol. 17, pp. 29-38, 2011. [6] a. h. mohmed, "evaluation of some range plants for goats in rahad area, butana plain, sudan," m.sc. thesis, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2001. [7] h. m. asma, "utilization of upgrading straws of sorghum, pearl millet and sesame by nubian goat in the sudan," ph.d. thesis, department of animal science, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2007. [8] m. j. prokop, j. j. klopfenstein, and t. messersmith, "blood and paunch meal in ruminant rations," journal of animal science, vol. 39, pp. 250-250, 1974. [9] f. a. el-yassin, j. p. fontenot, and h. chesterjones, "fermentation characteristics and nutritional value of rumenal contents and blood ensiled with untreated or sodium hydroxidetreated wheat straw," journal of animal science, vol. 69, pp. 1751-1759, 1991. [10] p. j. van soest, nutritional ecology of the ruminant. ithaca and london: comstock publishing associates, a division of cornell university press, 1982. [11] maw, "ministry of animal wealth, sudan," anuual report, 2006. [12] feedipedia, "rumen contents, cattle, fresh." animal feed resources information systeminra, cirad, afz and fao. available from www.feedipedia.org, 2012. [13] f. g. rios rincon, r. m. bermudez-hurtado, a. estrada-angulo, a. s. juarez-reyes, and c. pujolmanriquez, "dried ruminal contents as a substitute for alfalfa hay in growing-finishing diets for feedlot cattle," journal of animal and veterinary advances, vol. 9, pp. 1526-1530, 2010. [14] g. w. snedecor and w. g. cochran, statistical methods. ames, iowa, usa: iowa state university press, 1980. [15] a. s. m. eltayeb, "performance and carcass characteristics of desert sheep fed rabaa (trianthema pentandra l) ash alkali treated sorghum stover and concentrates," m. sc thesis, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2010. http://www.feedipedia.org,/ animal review, 2015, 2(4): 81-86 86 © 2015 conscientia beam. all rights reserved. table-1. the ingredients of rations fed to shugor desert lambs in halfa elgadida, kassala state, sudan. rations ingredients c (10% rumen contents) b (5% rumen contents) a (0% rumen contents) 20 19 19 groundnut cakes 34 30 25 sorghum grains 25 24 24 molasses 5 13 20 wheat bran 4 7 10 groundnut shells 10 5 0 rumen contents 1 1 1 salt 1 1 1 lime stone 17.36 17.26 17.25 calculated cp (%) 11.48 11.47 11.48 calculated me (mj/kg dm) table-2. effects of different levels of rumen contents in rations on the performance of shugor desert lambs in halfa elgadida, kassala state, sudan. significance se rations parameters c b a ns 2.96 26.0 26.5 26.0 initial bw (kg) ns 3.11 31.75 31.25 30.27 final bw (kg) ns 16.0 01.28 01.27 01.20 daily feed intake (kg/day) ns 65.0 05.75 04.63 04.25 total weight gain (kg) ns 1.52 207 165 150 daily weight gain (g) ns 3.77 7.61 7.87 8.81 fcr a= a ration with 0% dried rumen contents; b= a ration with 5% dried rumen contents; c= a ration with 10% dried rumen contents; fcr= feed conversion ratio (kg feed intake/kg weight gain). ns= not significantly different at p≥ 0.05 views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 10 † corresponding author © 2016 conscientia beam. all rights reserved. characteristic of swamp buffalo (bubalus bubalis) pampangan at ogan komering ilir, south sumatera, indonesia yuanita windusari1† --laila hanum2 --erwin nofyan3 --mustafa kamal4 --adri amsar5 1,2,3,4,5 biology department, faculty of mathematics and natural sciences, sriwijaya university, south sumatera, indonesia abstract the aim of research to study the character and analyze the phenotypic diversity among variants swamp buffalo (bubalus bubalis) pampangan at ogan komering ilir, south sumatera. quantitative data are determined by the circumference of the chest (li da), body length (pa ba), tail length (pa ek), the length of the head (pa ke), head width (le ke) and hip height (ti pi). qualitative data is determined based on the character of each variant shown through the hair color, the shape and direction of growth of the horn. characteristics that indicate of genetic relationship between the variant of swamp buffalo. methods of observations carried out directly on the morphology and methods ntsys ver. 2.1 to the analysis of kinship and then presented in the form of a dendrogram. results showed that there are four variants of buffalo pampangan namely red buffalo, black buffalo, buffalo striped and lampung buffalo. morphology of buffalo such as body size, hair color, shape and direction of growth of the horns is different. genetic relationship shown with value of correlation coefficient 0.57 was found in group a (otu-1) and group b (otu-2, otu-3 and otu-4), and value of correlation coefficient 0.612 found in group a (otu-2 and otu-4) and group b (otu-3). the correlation coefficient of more than 0.57 indicates a kinship between the variance of the swamp buffalo pampangan relatively close. it is suspected inbreeding between variants tends to be high. the analysis also showed that the closest genetic relationships found in otu-2 (black buffalo) and otu-4 (buffalo lampung) with a correlation coefficient 0.85. this condition is believed that the otu-2 and otu-4 derived from the same lineage. keywords: swamp buffalo (bubalus bubalis) pampangan, characteristic, phenotypic, diversity, dendrogram, genetic relationships. received: 7 december 2015/ revised: 6 january 2016/ accepted: 12 january 2016/ published: 16 january 2016 animal review 2016 vol. 3, no. 1, pp. 10-21 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.1/101.1.10.21 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.1/101.1.10.21 animal review, 2016, 3(1): 10-21 11 © 2016 conscientia beam. all rights reserved. contribution/ originality this study is one of very few studied which have investigated about the characteristics of local endemic animals that have the potential to be developed or preserved. swamp buffalo in south sumatra is the local animal with the potential to be cultivated and become a major food source. 1. introduction swamp buffalo found in indonesian is expected to come from mainland china (murti, 2002). swamp buffalo (bubalus bubalis) in district rambutan, banyuasin regency of south sumatra province is one of the varieties of buffalo native south sumatra. spread covering sub rambutan pampangan banyuasin district and sub-district, so it is often referred to as a buffalo buffalo pampangan. characteristics of buffalo pampangan located in district rambutan or residing in district pampangan or other areas surrounding that has a body shape tall and big, black leather, head and ears with long hair, short horns circular toward the back down, then towards the circular shape spirals, elbow-shaped body, a slim lead as the type of albino cows, the udder well developed and symmetrical, and calm temperament. swamp buffalo pampangan located in district rambutan spend their lives and live in swamps in the area of indigenous land area of ± 1,200 hectares (windusari et al., 2014). storer et al. (1971 in kanpas (2008) classifies the swamp buffalo as the family of bovidae, genus bubalus and including the species bubalus bubalis. windusari et al. (2014) stated that the swamp buffalo potential as workers and the animals can be developed as a source of food for human needs. kampas (2008) explains that the buffaloes has three functions as albino cattle, meat and labor. information directorate general of livestock south sumatra (2010 in windusari et al. (2014) states buffalo population in south sumatra decreased approximately 50% in a period of 6 years, or approximately 3.97% per year (± totaled 2,403,298 head in 2004 to ± 1,932,927 head in 2010) decrease in swamp buffalo populations associated with low reproductive rate (anggraeni et al., 2007). the existence of swamp buffalo is very important for people, especially people in sub rambutan where the majority of the population worked as farmers buffalo. reproduction low and high inbreeding among species of buffalo in the area pambangan decrease the quality of the puppies and potential. environmental conditions also affect reproductive rate swamp buffalo (windusari et al., 2014). therefore, this study was conducted to look at the genetic diversity of the swamp buffalo (bubalus bubalis) found in south sumatra, especially in banyuasin as a basis for conservation. 2. methods the research method is through direct observation of the morphology of each variant were found to swamp buffalo and then calculate kinship use ntsys software ver. 2.1. animal review, 2016, 3(1): 10-21 12 © 2016 conscientia beam. all rights reserved. 2.1. data collection a. quantitative according to abdullah et al. (2006) to determine the morphology of the buffalo fourth variation is to measure several variables of limbs buffalo (fig. 1). measured variables are: (1) bust, (2) high-shoulder, (3) the length of the body, (4) long tail, (5) the length of the head, (6) the width of the head and (7) high hips. figure-1. sketch body buffalo swamp to see quantitative data (abdullah et al., 2006). the size of the body calculating by average value (x), standard deviation (s) and the coefficient of variance (kk). the formulas is : description: x : the average value s : standard deviation kk : coefficient diversity xi : the size of the i-th of nature x n : number of samples obtained from population b. qualitative qualitative data were obtained in the form of a fourth color variant swamp buffalo hair and the shape and direction of growth of the four variants of buffalo horn is presented in tabular form. animal review, 2016, 3(1): 10-21 13 © 2016 conscientia beam. all rights reserved. 2.2. relationship observations conducted descriptive morphological characters that include the characters starting at the head, neck, body, tail and legs. furthermore, the character gained will be given scale comparison of the numbers 0, 1, 2 and 3 in accordance with the character possessed of individual variants swamp buffalo. then the morphological characters of each buffalo variation is presented in the tables for kinship analysis. data obtained from morphological characters of each buffalo analyzed using ntsys ver. 2.1 and presented in the dendogram. cluster analysis is done by using the unweighted pair-group method with arithmetic averaging (upgma) with similarity coefisient. morphological characters on the table to strengthen dendrogram grouping patterns and characters that play a role in the separation otu. 3. results and discussion 3.1. morphology morphology each swamp buffalo (red buffalo, black buffalo, striped buffalo and lampung buffalo) were observed in the form circumference chest (li da), long board (pa ba), long tail (pa ek), long head (pa ke) , width head (le ke) and high hips (ti pi) in the four variants swamp buffalo pampangan (table 1). table-1. the average value (x) and a diversity coefficient (kk) fourth morphological variation swamp buffalo no. variable observation variations swamp buffalo red kk black kk mottle kk lampung kk 1. chest size (li da) 183±11 6,01 181±11 6,08 173±1 0,58 176±0 0 2. body length (pa ba) 117,5±8,5 7,23 129±7 5,43 121±0 0 118±0 0 3. tail length (pa ek) 72±4 5,6 85±4 4,70 79±3 7,8 69±0 0 4. head length (pa ke) 48±1 2,03 51,5±2,5 4,85 45,5±0,5 1,01 42±0 0 5. head width (le ke) 25,5±0,5 197 25±1 4,0 25,5±0,5 1,17 24±0 0 6. high hips (ti pi) 125±5 4,0 126,5±1,5 1,19 130±2 1,54 125±0 0 chest circumference of each buffalo is different and has variations. chest circumference mean value (li da) contained in the red ox is 183 cm, to black buffalo is 181 cm, at striped buffalo is 173 cm, while the lampung buffalo is 176 cm. the chest circumference shown in red buffaloes while the value shown on the chest circumference striped buffalo. in figure 1 shows that the red and black buffalo buffalo have large flats chest circumference is nearly equal and the spotted buffalo and buffalo lampung also has a chest circumference values were nearly equal as well. factors that can affect the body size of the buffalo that age, gender and heredity or genetic factors. the buffalo body length varies even there is one variation of buffalo which was far above the other three variations. red buffalo has a body length of 117.5 cm, the black buffalo body length of animal review, 2016, 3(1): 10-21 14 © 2016 conscientia beam. all rights reserved. 129 cm and for striped buffalo body length of 121 cm, while the lampung buffalo has a body length of 118 cm. the results ranged from 117.5 to 129 cm, based on research results dudi et al. (2011) pandegelang male buffalo, serang and lebak has a body length range of between 121.86 to 122.25. as for the female buffalo pandegelang, serang and lebak ranged from 119.59 to 120.22 cm. comparison between chest circumference and body length in red buffalo, has a big difference. red buffalo has a chest circumference greatest variation compared with the three other buffalo. as for the length of the body, red buffalo has a body length shorter than the black buffalo, striped buffalo and lampung buffalo. the most influential factor in the growth of that genetic factors and environmental factors. long tail between the average value of albino buffalo, black buffalo, striped buffalo and lampung buffalo. based on the results in can length red buffaloes which is 72 cm, while the black buffalo is 85 cm and for buffalo stripes have panajng tail is 79 cm while the lampung buffalo tail length is 69 cm. when viewed from the long tail of the fourth variation of buffalo can be seen that the black buffalo tails are longer than the other buffalo variations. while buffalo lampung which has a shorter tail length. red buffalo head length is 48 cm, while for black buffalo is 51.5 cm, for striped buffalo is 45.5 and for lampung buffalo has a length of 42 cm head. these results are almost the same possibility in the long head of research dudi et al. (2011) namely buffalo lampung. based on his research buffalo head length contained in serang, namely 42.21 cm to 41.63 cm in pandegelang namely in the valley and for the length of his head reaches 42.14 cm long while for the measurement results for buffalo head lampung is 42 cm. while the others are variations buffalo head that much different length da tone is also nearing similarities with studies in serang, pandegelang and lebak. the width of the head of the albino buffalo, black buffalo, striped buffalo and lampung buffalo. where the value of the average width of the head between the four variations of the water buffalo that for red buffalo is 25.5 cm, for black buffalo head width of 25 cm and a width which is owned by a buffalo head stripe is 25.5 cm while the width of the head of a buffalo owned by lampung ie 24 cm. research dudi et al. (2011) show different figures with the results obtained. penelitiaanya where the head width is 19.41 cm serang buffalo, pandegelang buffalo is 20.53 cm and 20.68 cm lebak buffalo namely, so buffalo that have a superior head width ranging number 20.68 cm whereas the results obtained indicate the width buffalo head is superior numbers ranging from 25.5 cm. high hips highest buffalo found in streaks, reaching 130 cm, while the most hip height indicated on the red buffalo and lampung buffalo which has a hip height is 125 cm. black buffalo hip height is 126.5 cm. the results obtained in this study is smaller than the research of kanpas (2008) in sibuhuan is to have a male buffalo 135.82 cm whereas for females the same as male buffalo hip height is 135.82 cm. the content of the feed given to cattle have a close relationship with the decrease and increase the size of the animal's body. the content of the feed which has a animal review, 2016, 3(1): 10-21 15 © 2016 conscientia beam. all rights reserved. high nutritional will impact both on animal and vice versa. according ariko et al. (2015) the content of volatile fatty acids (vfa) which can increase the body size of the animal and at the lower vfa in the rumen can reduce the size of the animal's body. 3.2. characteristics characteristics of hair color from four variants swamp buffalo pampangan showns in table 2. table-2. characteristics of albino buffalo hair color, black buffalo, striped buffalo and buffalo lampung no. buffalo variations hair color black red mottle gray 1. albino buffalo + 2. black buffalo + 3. striped buffalo + 4. lampung buffalo + table 2 shows that red buffalo has a hair color that corresponds to the name that is red, black buffalo also has a hair color that corresponds to the name that is black. as for the buffalo striped hair consisting of two colors, black and red colors and for buffalo lampung have the same hair color hair color possessed by the black buffalo is black. according to azmi and suharnas (2007) is generally white buffalo coat color red and black with sparse and coarse body hair. one cause of this hair color diversity that genetic factors are derived by the parent buffalo earlier. research ssitorus (2008) explains that the frequency of cross pollination shows color variations of murrah buffaloes and swamp buffalo. according to o'rahilly (1995) among other hair function to protect the body, regulate body temperature and facilitate evaporation of sweat. hair can also serve as a tool flavorings. colored hair contain pigment in the cortex and medulla, but the sheath surrounding there is no pigment. hair color depends mainly on the pattern and the amount of pigment in the cortex, and sometimes on the air cavity inside the hair. white pigment in the hair that is not there, and putiihnya caused by air content in the hair (as well as the water foaming); "gray" (canities) is usually a mixture of white hair and colored hair. oxidation of melanin causing compounds that are colorless, so the hair is dark to be white because of the presence of hydrogen peroxide. 3.3. the shape and direction of growth horn bred buffalo horn shape that is like a crescent moon. shape black buffalo and striped buffalo also has the same shape with a red buffalo is like a crescent moon. while the shape of buffalo horn lampung buffalo different from the other three, which is like a half circle. according to research erdiansyah and anggraeni (2008) the type of normal buffalo horn is mowing backward. in his research gained 98% back shape, circular shape down 1%, 0.5% and 0.5% laterally straight circular animal review, 2016, 3(1): 10-21 16 © 2016 conscientia beam. all rights reserved. backward.the direction of growth of buffalo horn red, black buffalo, striped buffalo and lampung buffalo have similarities and differences. red buffalo have horns growing direction is directed perpendicular and curved inward. black buffalo have horns backward direction and edges curved inward. the direction of growth together with a buffalo horn striped red buffalo is upright and curved edges to the inside. as for the lampung buffalo growth is downward and curved edges to the inside. according kanpas (2008) the swamp buffalo in general have this kind of horns curved upwards, straight to the side, and curved down and very rarely have any kind of swamp buffalo tandung with arched back. comparison of the shape and growth the horn in the four variants swamp buffalo pampangan has been found in the research shown in figure 1 : figure-1. the shape and direction of growth of albino buffalo horn, black buffalo, striped belang lampung buffalo and buffalo animal review, 2016, 3(1): 10-21 17 © 2016 conscientia beam. all rights reserved. albino buffalo, black buffalo and lampung buffalo horn have a more flattened surface and has a pointed end and sharp. as for the stripes buffalo have a more rounded surface and the horns are more tumpul.perbedaan form of four variaasi buffalo horn can be caused by factors as sex, age and status factors or position of the buffalo in their environment. 3.4. relationship analysis of swamp buffalo relationship analysis of albino buffalo, black buffalo, striped buffalo and lampung buffalo based on morphological characters possessed of the four variants of the buffalo. in correlation coefficient of 0.57, there are two groupings uatam namely group a and group b. in a correlation coefficient of 0.57, the group a which comprises only one otu otu-1 (red buffalo) and in group b, which consists of three otu, otu -2 (black buffalo), otu-3 (striped buffalo) and otu-4 (lampung buffalo) .at koefisisen correlation of 0.612, in group b again divided into two groups, namely group a and group b. a group that is composed of two otu otu-2 (black buffalo) and otu-4 (lampung buffalo). whereas in group b, which comprises only a single otu otu-3 (striped buffalo) .according cabezas et al. (2010) the index value above 50% similarity (correlation coefficient 0.50) indicates that the animal is still in one species , so between the four variants of the swamp buffalo still belong to the species. fenetic kinship analysis results of the four variants of the buffalo is presented in the figure 2 below dendrogram. figure-2. dendogram kinship swamp buffalo pampangan (albino buffalo , black buffalo, striped buffalo and buffalo lampung). description: otu-1: red buffalo, otu2:black buffalo , itu-3: striped buffalo , otu-4: lampung buffalo the similarity of character possessed between group a and group b with 24 of the 54 characters that dimlikinya among others, the texture base of the horn, the texture of the fence, forms the base of the horn, ear shape, accessories on the nose, the shape of the sclera eyes, accessories on the eyelids, tip shape and the base of the eyelid, the shape of the eyelashes, the shape of the tip and base of the brow, accessories and forms of accessories, accessories on the neck, the direction of hair growth and shape umu body, arahpertumbuhan leg hair and accessories on foot, arahpertumbuhan tail hair, accessories tail, color cambukekor, shape common tail whip and animal review, 2016, 3(1): 10-21 18 © 2016 conscientia beam. all rights reserved. whip tail tip shape. while distinguishing antarakelompok a and group b were 7 characters include the color and shape of the iris, pupil shape, the color of the eyelids, the eyelashes, the color of shoes and hair color on the tail. similarities in character between group a and group b contained 31 characters, among others, the texture of the base and the tip of the horn, forms the base of the horn, ear shape, accessories on the nose, the shape of the sclera, the shape and color of the iris, the shape of the pupil, colors and accessories on the eyelid, tip shape and the base of the eyelid, color and shape of the eyelashes, the shape of the tip and base of the brow, accessories and shape of accessories on the eyebrows, accessories on the neck, the direction of hair growth, a common form of the body, the color of the shoes, the direction of the growth of leg hair, accessories feet, hair color body tail, direction pertumbuhan rambut body tail, tail accessories, colors and textures whip tail, as well as the shape of the tip of the tail whip. while the difference between group a and group b contained 15 characters, among others colors horn, forms the tip of the horn, ring horn, the color of the base and the tip of the horn, the color of the ears, accessories ear, the color of the nose, the color of the sclera, color accessories brow, the color of the neck, where collar and color, the body color, and hair color foot. similarities and differences in the four variants swamp buffalo pampangan can be seen in the figure below: figure-3. variation of morphological variants swamp buffalo horn (bubalus bubalis). description: a; red buffalo horns, b; black buffalo horn, c; buffalo horn striped, d; lampung buffalo horn. figure-4. variation ear morphology of variants swamp buffalo (bubalus bubalis). description: e; buffalo ears red, f; black buffalo ears, g; buffalo ears striped, h; buffalo ears lampung animal review, 2016, 3(1): 10-21 19 © 2016 conscientia beam. all rights reserved. figure-5. variation of morphological variants nose of swamp buffalo (bubalus bubalis). description: i; red bull nose, j; nose of black buffalo, k; buffalo nose stripe, l; lampung buffalo nose. figure-6. variation of morphological variants eye of swamp buffalo (bubalus bubalis). description: m; eyes red buffalo, n; eye black buffalo, o; buffalo eye stripe, p; lampung buffalo eye. figure-11e. general morphological variation (neck, body, legs and tail) of a variant of the swamp buffalo (bubalus bubalis). description: (a) the general morphology of red buffalo, (b) general morphology of balck buffalo, (c) the general morphology of striped buffalo, (d) the general morphology of lampung buffalo. relationship between the fourth variation of the closest swamp buffalo found in a black buffalo and lampung buffalo. based on morphological character data obtained, the two variations are significant similarities in both the hair color of black, while red buffalo and buffalo different stripes. the observed data showed that of 54 morphological characters were observed, there are 45 characters in common between the two variations of the water buffalo. the same fundamental morphological characters of black buffalo and lampung buffalo include: hair color, the color and shape of a horn. while the difference between the two most visible is in the direction of the growth of the horn. near and away kinship of the fourth variation swamp buffalo can be influenced by several factors, including internal factors are genetic factors and external factors which include the animal review, 2016, 3(1): 10-21 20 © 2016 conscientia beam. all rights reserved. environment and lifestyle of the fourth variation of the swamp buffalo. according tarwinangsih et al. (2011) states that an animal kinship pattern is thought to occur because of the deployment and migration (gene flow). one reason is also that inbreeding, according hastono (2008) a male which has a small body and is young and marrying a female will produce smaller offspring as well. according to hart (2012) nearby population geofrafis an individual basis can improve the process of interaction of the individual. so the higher the level of interaction both individuals can trigger more occurrence of inbreeding and the higher the degree of similarity in the behavior of each individual. 4. conclusion they are 4 variants found in the swamp buffalo pampangan, south sumatra. the fourth variant is the buffalo red, black, striped and lampung. morphological differences in the four variants are body size, hair color and the shape and direction of growth of the horn. the differences shown in the dendrogram with the range of the correlation coefficient is 0.57 to 0.85 and the highest correlation values found in lampung variants buffalo and black variants. this suggests that the two variants is thought to originate from the same parent. funding: this study was also conducted with a competitive grant funds on behalf of sriwijaya university palembang indonesia with the contract number 215/un9.3/1/lp/2014. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references abdullah, m.e.n., r.r. noor, martojo, e.d. solihin and handiwirawan, 2006. phenotypic diversity aceh cattle in nanggroe aceh darussalam. center for research and development of animal husbandry. bogor. j. indon.trop.anim.agric., 32(1): 11-21. anggraeni, a., c. sumantri, l. praharani, dudi and e. andrew, 2007. estimation of genetic local buffalo swamp through morphological analysis approach. livestock research institute. jitv, 16(3): 99210. ariko, t., m. kass, m. henno, v. fievez, o. kart, t. kaart and m. ost, 2015. the effect of replacing barey with glycerol in the diet of albino cows on rumen parameters and milk fatty acid profile. journal animal feed science and technology, 209: 69-78. azmi, g. and e. suharnas, 2007. morphology and genetic characteristics study of buffalo benuang in bengkulu. national seminar and workshop livestock business buffalo. institute for agricultural technology bengkulu. university of bengkulu. cabezas, p.m., g.-g.m. jose, b.-r. elena, r.-g. susana, f.m. enrique, l. teresa and g.-g.j. carloz, 2010. exploring molecular variation in the cosmopolitan caprella penantis (crustacea: amphipoda): animal review, 2016, 3(1): 10-21 21 © 2016 conscientia beam. all rights reserved. result from rapd analysis. journal of the marine biological association of the united kingdom, 90(3): 617-622. dudi, c., m. sumantri and a. sam, 2011. quantitative and qualitative nature diversity local buffalo in banten province. terbak the journal science, 2: 61-67. erdiansyah, e. and a. anggraeni, 2008. diversity phenotype and genetic distance estimation between subpopulations local swamp buffaloes in dompu, west nusa tenggara. national seminar and workshop enterprises slag buffalo. department of animal production and technology husbandry ipb, bogor. hart, j.p., 2012. the effects of geographical distances on pottery assemblage similarities: a case study of northern iroquoia. journal of archaeological science, 39(1): 128-134. hastono, 2008. improving reproductive efficiency in buffalo livestock efficiency through the use of penjantan. national workshop livestock business buffalo. livestock research institute, bogor. kampas, r., 2008. phenotype diversity of body morphometric and genetic distance estimation of swamp buffalo in southerntapanuli district at north sumatra. thesis. study program of livestock production technology, farms faculty, bogor agricultural institute. kanpas, r., 2008. body morphometrics diversity and genetic distance estimation swamp buffalo in south tapanuli province of north sumatra. essay. animal production technology studies program, faculty of animal husbandry. murti, t.w., 2002. buffalo animal science. yogyakarta: canisius. o'rahilly, r., 1995. anatomy. 5th edn., jakarta: ui-press. ssitorus, a.j., 2008. characterization of morphological and genetic distance estimation buffalo swamp, river (murrah) and silanagan in north sumatra. journal of the national seminar and workshop on livestock business buffalo. department of animal production and technology, faculty of husbandry ipb, livestock research institute, bogor. tarwinangsih, w., a. farajallah, c. sumantri and e. andrew, 2011. analysis of genetic diversity of local buffalo (bubalus bubalis), based on mitochondrial dna halotipe. national seminar on animal husbandry and veterinary technology. department of animal production and technology, faculty of animal husbandry, bogor agricultural university. windusari, y.,erwin n, and mustafa k. 2014. study of the genetic diversity of the swamp buffalo (bubalus bubalis) pampangan based blood protein profile in the conservation of germplasm endemic south sumatra (report unplished) windusari, y., erwin n, mustafa k, laila h, and rahmat p. 2014. biophysics environmental conditions of swamp buffalo bubalus bubalis pampangan in district rambutan south sumatera. journal of biological resourche. formerly berkala penelitian hayati, 19(2): 78-81. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 59 † corresponding author © 2016 conscientia beam. all rights reserved. evaluation of chemical-nutritional characteristics of rainbow trout samples affected by the “red-mouth disease” compared to healthy trout samples lisa grotta1† --sonia marchetti2 --flavia buccella3 --federica castellani4 --giovanni zitti5 -- giuseppe martino6 1,2,3,4,6faculty of biosciences and technologies for agriculture food and environment, university of teramo, via balzarini 1, 64100 teramo, (te) italy 5asl teramochemical and microbiological analysis laboratory, hospital “maria s.s. splendore”, via a. gramsci, 64021 giulianova, (te) italy abstract enteric redmouth (erm) disease is a serious systemic infection due to a gram-negative bacterium (yersinia ruckeri) which causes significant economic losses in salmonid aquaculture all over the world. this disease is called “red-mouth” for the reddening of the mouth. other clinical manifestations of this disease are: exophthalmia, ascites and haemorrhage with ulceration of palate, gill and operculum resulting in anorexia. although this disease has been reported in other fish species, rainbow trout (oncorhynchus mykiss) are particularly susceptible to erm. rainbow trout is one of the most popular fish species in nature and in many countries it is also recognized as cultivated/farmed fish species, due to its fast growth and excellent nutritional quality. the target of this research being undertaken is to analyze the chemical-nutritional characteristics and evaluation of the oxidative processes in samples of rainbow trout fish affected by erm compared to the healthy group. the results of analysis show significant differences concerning the contents of some qualitative and chemical-nutritional parameters in fish-meat samples belonging to animals that have recovered from the “red-mouth” disease and healthy ones. despite this, the unhealthy rainbow trouts are good source of nutrition, similar than healthy trouts. keywords: enteric redmouth disease, rainbow trout, fatty acids, lipid oxidation, malondialdehyde, histamine. received: 20 september 2016/ revised: 13 october 2016/ accepted: 8 november 2016/ published: 26 november 2016 contribution/ originality this study is one of the very few studies evaluating nutritional characteristics of rainbow trout samples affected by the "red-mouth disease" compared to healthy trout samples 1. introduction enteric redmouth disease (erm) is one of the most important diseases of salmonids [1]. the illness is caused by yersinia ruckeri, a gram negative rod-shaped enterobacterium [2] which was first isolated from rainbow trout (oncorhynchus mykiss) in the hagerman valley of idaho, usa [3, 4] and it is currently found throughout north and south america, europe, australia, south africa, the middle east and china [5, 6]. rainbow trout is a member of salmonidae family, one of the most popular fish species in nature and it is also recognized as farmed intensively fish species for consumption, because of its fast growth and exceptional meat nutritive quality [7] rich in polyunsaturated acids. animal review 2016 vol. 3, no. 3, pp. 59-65 issn(e): 2409-649 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.3/101.3.59.65 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.3/101.3.59.65 animal review, 2016, 3(3): 59-65 60 © 2016 conscientia beam. all rights reserved. from a nutritional point of view, the trout’s lipids contain an amount of dha acid and polyunsaturated acids which is larger than in other farmed fishes, such as the sea bass and bream [8] and their composition is affected by the environment where they live, by their diet, by the fishing practice and preservation, as well as their health status during the fish farming operations. the polyunsaturated fatty acids, even if considered essential in the human diet, are susceptible to oxidation processes that lead to formation of aldehydes, ketones and alcohols, which are compounds associated with fish flavor. lipid oxidation in food is the greater non microbiological factor that can adversely affect the quality of the fish flesh . in addition, it depends both on the content of polyunsatured acids and on the camunt of lipid-soluble antioxidants (such as vitamin e, coenzyme q10, carotenoids etc.) and on water-soluble antioxidants (such as anserine, carnosine, vitamin c, etc.) which can be found in the fish itself. some of these compounds derive from the fishes’ diet, while others are directly contained in their muscle fibers, such as coenzyme q10, anserine and carnosine [9-12]. the amount of antioxidants which can be found in the fish flesh depends on their diet and on their intramuscular fat accumulation. in addition to lipid oxidation, histamine is another component responsible of qualitative decay of fish flesh. histamine concentration is considered an indicator of the freshness of fish. it is produced by the bacterial enzymatic decarboxylation catalyzed by histidine decarboxylase enzyme and l-histidine amino acid and is considered the most important biogenic amine in fish and the most toxic of the amines detected in food [13, 14]. the present study aims to assess meat quality of rainbow trout fishes affected by “red-mouth” disease compared to healthy fishes evaluating lipids, fatty acids, malondialdehyde (mda) and histamine values. 2. material and methods 2.1. experimental design and sampling forty-eight rainbow trouts (oncorhynchus mykiss) (i.e., 24 healthy and 24 unhealthy) were sampled from an italian trout farm, located in abruzzo, in province of pescara. the trouts came from the same farm, they had been fed with the same diet and raised under the same conditions. these fishes received the same commercial feed, with a known fatty acids profile (tab.1). according to the manufacturer, fishes received an amount of feed equal to 1.5-1.8% of their live weight, taking into account the environmental conditions (such as water temperature and dissolved).) the fishes were randomly removed from the water when they reached a body weight of 300-350 g. among them, 24 exhibited signs of the disease, like the reddening of the mouth (unhealthy group) and the other 24 were picked from a healthy group (control group). the trouts, after the electrical stunning, as required by the law concerning animal protection during the slaughter, were cool to refrigeration temperature (under ice) and immediately dissected. the flesh sections of the farmed rainbow trouts were stored at -20°c until the analysis. before the analysis, these samples were homogenized separately in order to obtain homogeneous specimens. the homogenate fishes were used for the analysis of intramuscular fat and fatty acids. in order to evaluate the amount of histamine and oxidation processes of lipids using the tbars test, the animals were kept for 5 days at 0-4 ° c and subsequently fish fillet samples, taken from the muscle (fillet) after having removed the skin, were analyzed. animal review, 2016, 3(3): 59-65 61 © 2016 conscientia beam. all rights reserved. table-1. chemical and fatty acid composition of the commercial diets fed to white trout chimical composition dry matter % 90,50 crude protein % dm 46,41 crude fats “ 24,31 crude fiber “ 3,10 ash “ 6,30 calcium 0,88 posphorus 0,83 sodium 0,33 fatty acid (%) c14:0 3,44 c16:0 16,24 c18:0 3,87 c20:0 1,01 sfa 24,56 c14:1 0,20 c16:1 n7 3,45 c18:1 n9 19,89 c18:1 n7 1,95 c20:1 1,01 c22:1 0,20 mufa 26,70 c18:2 n6 31,30 c18:3 n3 4,27 c22:6 n3 2,86 pufa 38,43 source: results obtained in the laboratory by the authors 2.2. reagents all the chemicals used were reagent grade commercial products and were used without any further purification. 2-thiobarbituric acid (tba) (sigma-aldrich, italy) in acetic acid 90% (carlo erba, italy); trichloroacetic acid (tca) (carlo erba, italy) in distilled water; perchloric acid (hclo4) (carlo erba, italy) in distilled water; butylated hydroxytoluene (bht) (sigma-aldrich, italy) in methanol (carlo erba, italy); sodium hydroxide (naoh) (carlo erba italy); fatty acid methyl ester (fame) (sigma–aldrich, italy). 2.3. lipid extraction and fatty acid analysis total lipids were extracted with a mixture of chloroform/methanol (2/1, v/v) from fishes using the method of folch, et al. [15]. in order to go on with the analysis of fatty acids,, the total lipids extracted through the method of folch were transmethylated into methyl esters (fames) at room temperature by using potassium hydroxide (koh) 2 m in methanol. fame composition was determined by gas chromatography using gas chromatograph perkin elmer auto system xl with flame ionisation detection (fid) equipped with a varian column cp-sil 88 of 100m (chrompack capillary column). the carrier gas was hydrogen. oven temperature programming was as follows: 160°c held for 3 min; 175°c at 3°c/min, held for 25 min; 220°c at 3°c/min, held for 40 min, 160°c at 10°c/min. fatty acid identification was carried out with standard mixture and fatty acid values were expressed in percentage. 2.4. histamine analysis histamine analysis was carried out in rp-hplc. 5g of fish were weighted and homogenized in perchloric acid (hclo4) 0,4 m with ultra-turrax t25 at 10000 rpm for 1 min and centrifuged at 3000rpm for 10 min. 10 ml of supernatant were filtered with filters of cellulose acetate 0,45 µm. histamine was derivatized with dansil-cloride in basic ambient: 0,5 ml of perchloric extracted were added with 0,5 ml hclo4, 200 µl of sodium hydroxide (naoh) animal review, 2016, 3(3): 59-65 62 © 2016 conscientia beam. all rights reserved. 2m and 300 µl of saturated solution of sodium bicarbonate. after homogenization, 1ml of dansil-cloride 1% in acetone was added. the mixture was heated at 40°c for 50 min. after having added 150 µl of naoh 30%, the sample was left in a dark place for 1 h. chromatographic separation was performed with a rp-18 column at 40°c. mobile phase was constituted by methanol-water (80:20 v/v) and the flux was 1 ml/min. uv detection was performed at 254 nm. limit of detection was 4mg/kg (ratio s/n ≥3). histamine concentration was calculated from external standard curves. 2.5. determination of muscle fatty acid oxidation (tbars test) oxidation of samples was carried out with the 2-thiobarbituric acid (tba) distillation method. the tbars test was performed as described by tarladgis, et al. [16] except for he butylated hydroxytoluene (bht) that was added before homogenization. fish (6-6,5 g) was added with 500 μl of bht (0,01%) dissolved in methanol and homogenized with 50 ml of aqueous trichloroacetic acid (tca) 5%, with ultraturrax t25 at 4000 rpm for 5 min. homogenate was distilled and two ml of distilled were supplemented with two ml of 0,02 m tba in acetic acid (90%). this mixture was heated in a water bath at 80°c for 1 hour and then cooled for 10 min with cold tap water. the absorbance was determined by jenway 6305 uv/vis spectrophotometer at 534 nm against a blank containing 2 ml of distilled tca (with 500 μl of bht) and 2 ml of 0,02 m tba solution. the tba number was calculated from standard curves. 3. statistical analysis the mean value and standard deviation were established using one way anova test. differences were significant for p≤0,05 and highly significant for p≤0,01. all statistics were performed using spss for windows. 4. results and discussion 4.1. total fat and fatty acid profile total fat data were reported in tab.2. the obtained results demonstrated a quantity of lipids in meat statistically significantly lower (p≤0,05) in the group of animals affected by disease. this can probably be justified by a lower food consumption caused by the lesions present in the mouth’s mucosa in the phases of the disease. the fatty acid composition of the rainbow trout is presented in table 2. the fatty acids analyzed were grouped in saturated fatty acids (sfas), monounsaturated fatty acids (mufas) and polyunsaturated fatty acids (pufas). palmitic acid (c16:0) was the main fatty acid in both groups (healthy and unhealthy) of the rainbow trouts. furthermore, among saturated fatty acids (sfa), except for the palmitic acid, the most abundant fatty acids were myristic acid (c14:0) and stearic acid (c18:0), according to tkaczewska, et al. [17]. no differences have been observed concerning saturated fatty acids between the two groups. among monounsaturated fatty acids (mufa), oleic acid (c18:1n-9), palmitoleic acids (c16:1n-7) and erucic acid (c22:1) were the predominant fatty acids. these fatty acids showed significant differences within the two examined groups (p≤0,01). linoleic acid (c18:2 n-6) and docosahexaenoic acid (dha) (c22:6 n-3) were the most abundant polyunsaturated fatty acids (pufa). similar results have been reported by ehsani, et al. [18] and by zakipourm, et al. [19]. linoleic acid is more present in the healthy group, while the docosahexaenoic acid (dha) (c22:6 n-3) in the unhealthy one, showing statistically significant differences (p≤0,01). animal review, 2016, 3(3): 59-65 63 © 2016 conscientia beam. all rights reserved. table-2. total fat percentage and intramuscular fatty acid composition in healthy and unhealthy groups (% of total fatty acid methyl esters). trouts healthy unhealthy total fat % a2.65 b2.18 fatty acids % c14:0 3.82 4.57 c16:0 22.54 22.07 c18:0 4.54 4.46 c20:0 0.69 0.68 sfa 31.59 31.78 c14:1 0.31 0.35 c16:1 n7 a3.71 b4.46 c18:1 n9 a20.95 b19.21 c18:1 n7 a2.24 b2.65 c20:1 a0.58 b0.71 c22:1 a3.30 b3.89 mufa 31.09 30.92 c18:2 n6 a20.01 b17.40 c18:3 n3 2.41 2.26 c22:5 n3 1.02 1.43 c22:6 n3 a13.88 b16.21 pufa 37.32 37.30 a,b = (p≤0,01); a,b = (p≤0,05). the ratio between polyunsaturated (pufa) and saturated (sfa) fatty acids as well as the p/s index are among the most reliable indicators of nutritional values. in particular, normal nutritional value for p/s index should be above 0,5 [20]. a p/s index below 0.45 is considered inadequate because it can lead to hypercholesterolemia [21]. in our study p/s index resulted to be 1,18 and 1,17 in healthy and unhealthy trouts, respectively. our results, according with vranić and đinović-stojanović [22] show that the ratio between unsaturated (ufa) and saturated fatty acids (sfa) in unhealthy rainbow trout is 2,15, while it is 2,17 in the healthy group (tab. 3). tab-3. contents of sfa, mufa, pufa (% of total fatty acids), n–3, n–6, n–3/ n–6, p/s, ufa/ sfa ratios sfa mufa pufa n-3 n-6 n-3/n-6 p/s ufa/sfa healthy trouts 31,59 31,09 37,32 2,41 20,01 0,12 1,18 2,17 unhealthy trouts 31,76 30,94 37,30 2,26 17,4 0,13 1,17 2,14 source: results obtained in the laboratory by the authors 4.2. histamine analysis in this study, histamine level is one of the quality parameters examined because it is an important index of fish freshness and an indicator of its edibility and this amine as well as other present in the muscle tissue of chickens are also produced due to tissue enzymes. meat is very susceptible to chemical and physical changes and to biological agents; among them, microorganisms and endogenous or microbial enzymes can make the meat unsuitable for consumption. in fact, fishes containing high levels of histamine cause an acute illness called scombroid fish poisoning in human beings [23]. in relation to the content of histamine (tab.4), the results suggest a significant difference (p≤0,01) between the two groups with higher values in the unhealthy group compared to healthy one. this is probably due to deterioration of the meat, which is faster in the unhealthy fishes infected by the pathogenic bacterium yersinia ruckeri, that is able to synthesize histamine from the amino acid histidine. nevertheless, both groups present histamine levels below the recommended limit, required to prevent toxic effects [24, 25]. animal review, 2016, 3(3): 59-65 64 © 2016 conscientia beam. all rights reserved. table-4. content of histamine (mg/kg) in the two groups trouts healthy unhealthy histamine (ppm) a5.35 0,55 b6.60 0,63 a,b = (p≤0,01); a,b = (≤0,05). 4.3. lipid oxidation determination the determination of the oxidants was performed on muscle samples collected after 3 days of storage at 0-4 ° c. the oxidation of fats depends on a number of factors, apart from the level of polyunsaturated fatty acids, among which the pro-oxidant and anti-oxidant concentrations. oxidation of polyunsaturated fatty acids (pufa) leads to the formation of hydroand endo-peroxides, which undergo fragmentation in order to yield a wide range of reactive intermediates, including alkanals, alkenals, hydroxyalkenals and mda. the obtained results of this do not show significant differences between the two groups although in the “healthy” group the mean value average value is slightly lower (tab.5). higher mda values in muscle of affected trouts may depend on the minor amount of lipidsoluble antioxidants accumulated in the tissues and on the ones introduced by the diet. tab-5. content of mda (mg mda/ kg fillet) in healthy and unhealthy experimental groups a,b = (p≤0,01); a,b = (p≤0,05). 5. conclusion the results show that trouts affected by the "red mouth" disease have a lower amount of fat than the healthy ones and a greater production of histamine during the storage, showing tendency to an easy deterioration and a difficult preservation. among unsaturated fatty acids, linoleic acid (c18:2 n-6) and oleic acid (c18:1 n-9) are more present in the healthy group compared to the unhealthy one, but it is important to underline that the ratio between polyunsaturated (pufa) and saturated (sfa) is adequate in both groups.. finally, results regarding lipid oxidation show no significant variation between the two groups. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] m. t. horne and a. c. barnes, enteric redmouth disease (yersinia ruckeri). in: woo ptk, bruno dw, (eds). fish diseases and disorders. viral, bacterial and fungal infections. wallingford: cabi publishing, 1999. [2] e. tobback, a. decostere, k. hermans, f. haesebrouck, and k. chiers, "yersinia ruckeri infections in salmonid fish," journal of fish diseases, vol. 30, pp. 257-68, 2007. [3] m. d. furones, c. j. rodgers, and c. b. munn, "yersinia ruckeri, the causal agent of enteric redmouth disease (erm) in fish," annual review of fish diseases, vol. 3, pp. 105-125, 1993. [4] a. j. ross, r. r. rucker, and w. h. ewing, "description of a bacterium associated with redmouth disease of rainbow trout (salmo gairdneri)," canadian journal of microbiology, vol. 12, pp. 763–770, 1966. [5] s. karatas, a. candan, and d. demircan, "enteric red mouth disease in cultured rainbow trout (oncorhynchus mykiss) on the black sea coast of turkey," israeli journal of aquaculturebamidgeh, vol. 56, pp. 226-231, 2004. trouts healthy unhealthy mda (ppm) 0.51  0,048 0.60  0,053 animal review, 2016, 3(3): 59-65 65 © 2016 conscientia beam. all rights reserved. [6] w. d. shaowu, l. hongbai, and l. tongyan, "isolation of yersinia ruckeri strain h01 from farm-raised amur sturgeon acipenser schrencki in china," journal of aquatic animal health, vol. 25, pp. 9–14, 2013. [7] simonović, ribe srbije. nnk international, zavod za zaštitu prirode srbije. beograd: biološki fakultet, 2001. [8] s. testi, a. bonaldo, p. p. gatta, and a. badiani, "nutritional traits of dorsal and ventral fillets from three farmed fish species," food chemistry, vol. 98, pp. 104–111, 2006. [9] g. martino, l. grotta, and v. ponzielli, "influence of dehydrated medicago sativa on quality characteristics of marchigiana beef," animal review, vol. 1, pp. 37-44, 2014. [10] g. martino, c. mugnai, d. compagnone, l. grotta, m. del carlo, and f. sarti, "comparison of performance, meat lipids and oxidative status of pigs from commercial breed and organic crossbreed," animals, vol. 4, pp. 348-360, 2014. [11] g. martino, m. n. haouet, c. reali, o. olivieri, and f. valfre, "coenzyme q10 and its relationship to other nutritional components of animal products," italian journal of food science, vol. 7, pp. 19-26, 1995. [12] g. martino, h. m. naucer, s. marchetti, l. grotta, and v. ponzielli, "effect of vitamine e supplementation on egg yolk quality and oxidative stability," asian journal of agriculture and food science, vol. 02, pp. 248-255, 2014. [13] p. izquierdo, m. allara, g. torres, m. sánchez, g. peña, and m. sangronis, "aminas biógenas y crecimiento bacteriano en carne de hamburguesas," revista científica, vol. 14, pp. 7-12, 2004. [14] g. martino, s. marchetti, l. grotta, and v. ponzielli, "biogenic amines content f poultry breast stored under different conditions at 4°c from two different industrial genotype chickens slaughtered at 3,5-4,0 kg of live weight," agriculture & food, vol. 3, pp. 12-20, 2015. [15] j. folch, m. lees, and s. g. h. sloane, "a simple method for the isolation and purification of lipids from animal tissues," journal of biological chemistry, vol. 226, pp. 497-509, 1957. [16] b. g. tarladgis, b. m. watts, m. t. younathan, and l. dugan, "a distillation method for the quantitative determination of malonaldehyde in foods," journal of the american oil chemists society, vol. 37, pp. 44-50, 1960. [17] j. tkaczewska, p. kulawik, and w. migdał, "the quality of rainbow trout (oncorhynchus mykiss) cultured in various polish regions," annals of animal science, vol. 15, pp. 527–539, 2015. [18] a. ehsani, m. s. jasour, and m. khodayari, "differentiation of common marketable-size rainbow trouts (oncorhynchus mykiss) based on nutritional and dietetic traits: a comparative study," journal of applied animal research vol. 41, pp. 1–5, 2013. [19] r. i. e. zakipourm, m. jasour, a. ehsani, m. a. rahnama, and a. arshadi, "dietary supplementation versus direct postmortem addition of α-tocopherol acetate on fatty acid composition of rainbow trout (oncorhynchus mykiss) fillets during refrigerated storage," international food research journal, vol. 19, pp. 1145–1151, 2012. [20] b. žlender and l. gašperlin, "značaj i uloga lipida mesa u bezbednoj i balansiranoj ishrani," tehnologija mesa, vol. 46, pp. 11–21, 2005. [21] j. santos-silva, r. j. b. bessa, and f. santos-silva, "effect of genotype, feeding system and slaughter weight on the quality of light lambs. ii. fatty acid composition of meat," livest production science, vol. 77, pp. 187–194, 2002. [22] d. vranić and j. đinović-stojanović, rainbow trout (oncorhynchus mykiss) from aquaculture– meat quality and importance in the diet, spirić aurelija1 tehnologija mesa. osnivač i izdavač: institut za higijenu i tehnologiju mesa, 2011. [23] l. auerswald, c. morrom, and a. lopata, "histamine levels in seventeen species of fresh and processed south african seafood," food chemistry, vol. 98, pp. 231-239, 2006. [24] a. önal, "a review: current analytical methods for the determination of biogenic amines in foods," food chemistry, vol. 103, pp. 14751486, 2007. [25] s. pons-sànchez-cascado, m. t. veciana-nogués, s. bover-cid, a. mariné-font, and m. c. vidal-carou, "use of volatile and nonvolatile amines to evaluate the freshness of anchovies stored in ice," journal of the science of food and agriculture, vol. 86, pp. 699-705, 2006. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 73 † corresponding author © 2016 conscientia beam. all rights reserved. technical-economic efficiencies of snakehead seed production under impacts of climate change in the mekong delta, vietnam nguyen thi kim quyen1† --truong hoang minh2 --tran ngoc hai3 --tran thi thanh hien4 --tran dac dinh5 1,2,3,4,5college of aquaculture and fisheries, cantho university, vietnam abstract this study was carried out from february to december 2014 by interviewing 75 farmers who operate snakehead seed production in an giang, dong thap and hau giang provinces, vietnam. the results showed that the total area for production was 629.01±756.77 m2, whereas the volume for nursing was 582.10±119.81 m3 for pond system and 1,019.56±736.66 m3 for combining pond – hapa system). each hatchery used 44.26±22.63 pairs of broodstock/breeding cycle and produced whole year. the quantity of seed per cycle of pond system was a half of that figure of other system while seed productivity per m3 was much lower. snakehead seed was mainly sold to seed traders in the delta (82.3%). with average production cost of 47.81±16.23 thousand vietnam dong (vnd)/m3, each farm in pond system could reach the total net profit of 49.83±18.74 thousand vnd/m3, equivalent to 328 million vnd/year. these corresponding numbers of pond – hapa system were 106.98±86.25; 196.12±87.45 thousand vnd/m3, equal to 1.75 billion vnd/year. factors of climate change affecting snakehead seed production involved rainfall change, droughts, water and air temperature increase, salinity intrusion which caused diseases easier (36%), affected seed production in general (31%), bad water quality (10%), .... to reduce the impacts of climate change to production, the farmer in snakehead seed production often changed selling market, suspended production of seeds, used better brookstocks by choosing them more carefully and a number of other measures. keywords: climate change, efficiencies, seed production, snakehead, technical-economic. received: 12 november 2016/ revised: 19 december 2016/ accepted: 28 december 2016/ published: 7 january 2017 contribution/ originality this study is one of very few studies, which have investigated the impact of climate change on snakehead seed production. the paper's primary contribution is finding that which and how climate phenomenon has effected on seed production as well as suggesting some adaptive methods for them. 1. introduction snakehead production has developed rapidly in the recent years, total production increased from 5,300 ton to 40,000 tons during a 2002-2009 period [1]. some provinces dominate in snakehead culture by volume and value, consisting of an giang, dong thap, hau giang, vinh long, tra vinh (belong to the mekong river delta (mrd), vietnam) [2]. snakehead is a species that can reach high productivity in farming practice. this species also is an easy species that can culture with different systems, including earthen pond, cage, ditch and field culture systems [3]. animal review 2016 vol. 3, no. 4, pp. 73-82 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.4/101.4.73.82 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.4/101.4.73.82 animal review, 2016, 3(4): 73-82 74 © 2016 conscientia beam. all rights reserved. because of dramatically development of snakehead culture, a high demand of seeds has appeared in the mrd. previously, snakehead farmers mainly collected natural seeds; and cambodia was a crucial source of seeds [4]. currently, many hatcheries and nurseries of snakehead are operated to supply for the culture. however, they are facing not only difficulties in production but also climate changes. especially, salinization, high fluctuation in temperature between day and night, earlier flood season have created low growth rate, easier disease and low survival rate in fish [5]. therefore, climate change has been one of the greatest challenges for the humankind, which has affected seriously to the production, livelihoods and environment all over the world [6]. up to now, however, a few researches related to impacts of climate change on snakehead seed production have been done. hence, evaluation of efficiency and impacts of climate changes on snakehead seed production is necessary to conduct in this study. 2. methodology researched period: this study was carried out from february to december 2014. three provinces where represents for snakehead culture in the mrd were selected for survey, including an giang, dong thap and hau giang (figure 1). figure-1. map of the mekong river delta shows the study sites (source: real24h [7]) 2.1. some terminology on climate change weather is atmospheric conditions at a current time that is determined by a combination of factors: temperature, pressure, humidity, wind speed, rain, ... [8]. climate is usually is defined as a timely average of weather [8]. animal review, 2016, 3(4): 73-82 75 © 2016 conscientia beam. all rights reserved. ability to vulnerability due to impact of climate changes is a level that a system (nature, society, economy) could be vulnerable because of climate change or unable to adapt with negative impact of climate change [8]. response to climate change is human activities in order to adapt and mitigate climate change [8]. adaptability to climate change is the adjustment of natural or human system to the circumstances or environment changed, aimed to reduce ability to vulnerability due to current or potential fluctuation and changes of climate as well as taking advantages opportunities that they bring to ministry of natural resources and environment [8]. impact assessment of climate change is a research that identity effects of climate change on environment and socio-economic activities of the local provinces. apart from negative effects, it also resulted in positive effects. impact assessment of climate change also includes reorganization and evaluation adaptation solutions to climate change [9]. 2.2. data collecting method secondary data: was synthesized from related scientific reports and articles, annual statistical yearbooks from researched provinces, research result from previous studied and information from specialized organizations and websites as well. primary data: was collected by interviewing directly 65 snakehead production hatcheries and nurseries in an giang, dong thap and hau giang by prepared questionnaire which was piloted first, then edited before coming to mass survey. a random method was applied to pick out typical samples from the list that was provided by authorities. acording to tuan, et al. [10] the majority of snakehead seeds in an giang province were bought in the province whereas 93.7% and 6.3% snakehead farmers in tra vinh province bought seeds from an giang and dong thap. moreover, based on annual reports and field work observation in hau giang province, snakehead farmers there purchased seeds in hau giang. there are two models of snakehead seed production, including pond an combining pond-hapa hatcheries and nurseries. therefore samples were distributed as follow: table-1. distribution of samples in the research provinces province pond combining pond-hapa number of samples an giang 20 13 33 dong thap 8 14 22 hau giang 4 6 10 total 32 33 65 source: survey data 2.3. data processing method raw data after collected was refined and coded before entering to the computer. using excel and spss for windows to input, check and refined data before processing and analyzing. several processing methods were applied as below: a. descriptive statistics: using statistical indicators such as mean, std, min, max, percentage, frequency in order to describe current status of snakehead seed production. b. statistical comparison (independent sample t-test): aimed to test the differences between tow means of the population. c. vulnerability index: according to intergovernmental panel on climate change [11] three components that contribute to the vulnerable capacity include “exposure”, “sensitivity” and “adaptive capacity”. this study, therefore, using these index to assess the impact of climate change to the snakehead seed production, especially farmers who are operating these industry. animal review, 2016, 3(4): 73-82 76 © 2016 conscientia beam. all rights reserved. 3. results and discussion 3.1. owner’s profile generally, famers in seed production households was in laboring age and mainly taking advantage of family labors to reduce production cost (table 2). the number of women participated in pond-hapa system were 41%, higher than that of pond system due to high capacity to join in of this system [12]. it means that hapas usually were put in the ponds nearby which are easy to take care. whereas pond production system mainly use ponds as places for hatching of brookstocks with a numerous outdoor activities, which are only appropriate for female labors. number of production experience years was 8.56 years, and there was no statistically significant difference between two systems. educational level of the farmers was relative low, with secondary school and lower level constituting more than 94.7% in pond system and 88.9% in combining pond-hapa system, respectively. no one reached the higher education or had the specialization in aquaculture and fisheries. table-2. profile of farmers who operated snakehead seed production indicators pond (n=48) hapa in pond (n = 27) experience on snakehead seed production (years) 8.57±4.83a 9.26±3,376 number of family labors (people) 4.58±1.18a 4.33±1.57a average age of farmers (years old) 45.5±7.72a 43.0±8.06a ratio of female labors (%) 28.7 41 education level (%) primary school secondary school high school 100 50 44.7 5.3 100 37 51.9 11.1 source:survey data 3.2. technical efficiency in snakehead seed production both two seed production system applied no any hormones to the broodstocks in order to encourage hatching. long and hieu [13] inferred that natural breeding is more effective than artificial one. the differences were shown in nursing the fingerlings, while pond system takes advantages of tank-ponds that were used for breeding to nursing fingerlings, the other one picked up and put fingerlings into a separate hapa to nursing after broodstock spawning. table-3. technical efficiency indicators of snakehead seed production indicators pond (n=48) hapa in pond (n = 27) total area (m2) 1,177±1,304a 1,635±1,862a total area for seed production (m2) 425.00±56.77a 744.01±526.23b total volume for nursing (m3) 582.10±119.81a 1,019.56±736.66b number of ponds for hatching (pond) 36.00±21.50a 61.10±44.00a number of hapas for nursing (unit) 36.00±21.50a 11.80±10.70b number of broodstocks/cycle (pairs) 27.40±1.16a 61.1±44.0b number of production cycles/year (cycles) 11.30±1.17a 8.74±1.87a fertility (larvae/kg of female fish) 8,375.00±1,033,5a 7,954.56±1,279.56b fcr 12.20±1.57a 14.43±1.05b total quantity of seed/cycle (1,000 individuals) 295.55±160.34a 499.13±373.66b nursing density (ind./m3) 553.00±165.02a 2,108.45±767.65b survival rate (%) 56.21±2.55a 61.93±5.31b seed productivity (ind./m3) 311.36±94.36a 1,299.82±476.59b source: survey data animal review, 2016, 3(4): 73-82 77 © 2016 conscientia beam. all rights reserved. generally, the total production area was relative large that was higher than that result of chung [14]. the majority of farms used own land for production with the proportion of farmers who hired land for farming was 44% for pond system and 48% for combining pond-hapa system, respectively. the breeding area of the latter was much higher than that of the former (744.01 m2 in comparison to 425.00 m2), and depended much to the personal conditions of each household. most farms excavated small pond with the average area of 9 – 15 m2 to leave a pair of broodstock. each farm, which belongs to pond system, operated 36 ponds for breeding with 1 pair of broodstock per pond, lower than that figure in combining pond – hapa system (61.10 ponds). in general, there were insignificant differences between two systems in terms of breeding pond structure (table 3). in nursing activities, the area in pond system was twofold larger than that of the other one. in contrast, nursing volume of combining pond – hapa system was much higher than that figure of pond system because the farm owners in pond system mainly conducted breeding and nursing activities at the same place. almost farmers selected natural process of seed production without any hormone application on broodstocks. after breeding 2 to 3 days, fries were picked out and reared in hapa in the system of combining pond hapa, while in system of pond, broodstocks were picked out of the pond and the fries were kept for rearing in the ponds. there were 2 production crops, including main crop (in rainy season – from april to october of lunar calendar) and secondary crop (the rest months of lunar calendar). following long and hieu [13] rainy season facilitated high fertility of snakehead thanks to it’s favorable conditions. there were about 8 – 12 cycles per year, with the number of pair of broodstocks in combining pond – hapa being double of pond system. feed used for broodstocks was trash fish that was evaluated as a good source to rear parent fish. total feed quantity accounted for 5 – 10% of the body weight with the fluctuated price from 7 – 9,000 vnd/kg. artemia and trash fish were two main sources of feed for nursing fingerlings. fcr in combining pond – hapa system was slightly higher than that of pond system due to the higher use of trash fish in this system. the total fingerlings produced per cycle was relative high, of which, the figure of combining pond – hapa system was nearly double that of other system. the study result shows that nursing density was significant different between two systems, and lower that the result of chung and sinh [1]. nursing density had influenced sharply to the survival rate and productivity of further fingerlings [12] which were characterized by 56.21% and 311.36 individuals/m3 for the pond system and 61.93% and 1,299.82 individuals/m3 for the pond – hapa system, respectively (table 3). 3.3. economic efficiency in snakehead seed production figure-2. structure of fix cost (a) and variable cost (b) of pond system of seed production source: survey data animal review, 2016, 3(4): 73-82 78 © 2016 conscientia beam. all rights reserved. the research result shows that the total production cost per cycle was high with 47.81 thousand vnd for pond system (table 4). in which, the fix cost accounted for 5% of the total cost with key proportions being depreciation of tools (63%) and construction (20%) (figure 2a). variable cost shared more than 95% of the total cost, of which three types of cost were feed for fingerlings, drug/chemicals and feed for broodstocks (57%, 28% and 7%, respectively) (figure 2b.). similarly, the structure of cost illustrated the same pattern in pond – hapa production system with proportions of tool depreciation and construction depreciation being 48% and 40% of the total fix cost, respectively. ratios of feed cost for fingerlings and drug/chemicals cost were 61% and 27%, respectively (figure 3). figure-3. structure of fix cost (a) and variable cost (b) in seed production of combining pond – hapa system source: survey data the fingerlings after nursing were usually sold to snakehead grow-out farms of the province. a small proportion of them was kept at the farm for commercial rearing. the revenue of seed production could reach high achievement, with the higher amount belonging to combining pond – hapa system. after deducting production cost, each farm could gain from 50 to nearly 200 thousand vnd per m3 (table 4). however, marginal ratio illustrates that the use of financial capital in pond system was more effective that of other system due to lower production cost in pond system [12]. table-4. economic efficiency in snakehead seed production indicators pond pond hapa fix cost (1,000 vnd/m3/cycle) 3.45±1.02a 5.51±2.54b variable cost (1,000 vnd/m3/cycle) 44.45±15.62a 201.35±85.26b total cost (1,000 vnd/m3/cycle) 47.81±16.23a 106.98±86.25b selling price (vnd/fingerling) 237.00±16.21a 230.23±17.26a sources of selling product (%) 100 100 keeping for grow-out 7.89 17.6 selling in the province 78.9 74.6 selling out of province 13.2 8.8 total revenue (1,000 vnd/m3) 97.78±22.74a 404.55±133.69b net profit (1,000 vnd/m3) 49.83±18.74a 196.12±87.45b margin rate 1.16±0.54a 1.09±0.52a source: survey data 3.4. people awareness about impact of climate change on snakehead seed production some climate change phenomenon were awared by farmers including changes in rain level, drought, water temperature, air temperature, flood level, wind and storm (figure 4). climate change is considered as a key origin that causes extreme weather phenomena and early coming rainy season [15]. research result shows that the late rainy season and less precipitation occurred most popular which may influenced negatively on snakehead seed animal review, 2016, 3(4): 73-82 79 © 2016 conscientia beam. all rights reserved. production. moreover, drought phenomenon was stimulated that sunny was tougher and last longer. the temperature of water and air increased in sunny season, decreased in rainy season that could cause temperature stratification evident in the water body, affect the life processes of fish [9]. following fourier [16] the temperature of the earth could rise due to the changes of composition of the atmosphere. during converting heat process, the atmosphere absorbs more solar heat than reflecting it back to space. hence, the majority of farmers thought that the temperature has been increasingly hot in the recent years. flood, wind and storm were seen as the natural disasters, which damaged seriously on human and economic properties [17]. climate change will increase the frequency of these climate phenomenon that might result more harm such as rising flooding in the coastal and riverside areas, rising risk of infrastructure devastation [9]. recently, most farmers have aware that flooding season would come earlier and uncertainly, similar to the result from some researches on climate change of jorn, et al. [5]. figure-4. some key climate change phenomena aware by famrers source: survey data the research result shows that climate change might affect much on snakehead production technique (figure 5). the impacts of climate change on aquaculture included direct effects on fish growth, fecundity, survival rate and indirect effects on the vitality of ecosystems, pollution ratio and eutrophication in environment and pathogens [18]. more specifically, the ratio of disease outbreak would be higher (36% of the respondents). when the water temperature increase, fish have to move to deeper layer where concentrate pathogens and toxic gases [19]. moreover, snakehead seed production in general could be influenced because of climate changes due to the continuously impacts from input to output that could not be measured exactly by the respondents (31% of the respondents). additionally, lower quality of snakehead seed was a significant impact of climate change, which made up 13% of the total. it was closely followed by bad water quality because of water stratification, which created many toxins in the bottom and lack of oxygen at night time [19]. considerably, climate change could affect to the hatching of egg as well as the quality of parent fish (figure 5). animal review, 2016, 3(4): 73-82 80 © 2016 conscientia beam. all rights reserved. figure-5. impacts of climate change on snakehead seed production source: survey data using the scale of 3 (1 = low, 2 = medium, 3 = high) to calculate the vulnerability of seed production farmers under different climate expressions, the result show that the increase in water temperature caused the maximum vulnerability of the community (figure 6). based on huong and trinh [20] primary cause that affected to fish aquaculture was high increase of water temperature. air temperature, drought, flooding, wind change and rainfall change shared the same ratios of people vulnerability (medium rate) while community were at least vulnerable by storms (figure 6). figure-6. spider diagram of vulnerable level of farmers due to climate change source: survey data in order to adapt with climate change, seed production farmers tend to narrow down their production scale that allow them to monitor farms more effectively (45% of respondents). when climate change impacted seriously on their production which could cause heavy losses or lack of capital for reproduction, the farmer could stop production temporarily. to deal with low broodstock quality, the farmers would try to choose better parent fish by finding out other source of broodstocks or paying more money for purchasing good quality one. this adaptive method together with culture pond and material improvement to adapt with climate change could increase the input cost which was selected by 30% of respondents. other adaptive measures, including changing selling market, changing to produce other species or other business were chosen by 15 – 22% of respondents. animal review, 2016, 3(4): 73-82 81 © 2016 conscientia beam. all rights reserved. figure-7. adaptive methods to climate change of snakehead seed production farmers source: survey data 4. conclusion and recommendations there were 2 production systems of snakehead seed: pond and combining pond – hapa which were both natural reproduction without using any hormone. pond – hapa system used larger area, higher nursing density, higher survival rate and productivity than the other one. net profit of pond – hapa system was also higher than pond; effectiveness of using capital in pond system, however, higher than that of pond – hapa system. some key climate change phenomenon that affected fish seed production were (1) rain, (2) drought, (3) temperature and (4) flood. they affected directly to the seed production in general, easier diseases and quality of seed. in which water temperature might create the highest level of vulnerability. adaptation measures were (1) changing production scale, (2) temporarily stop production and (3) selecting better broodstocks. recommendations: (1) should conduct more trainings on technique climate changes in seed production; (2) building linkages; (3) improving process of artificial breeding; (4) improving quality of broodstocks and seeds with capacity in tolerance with climate change; and (5) financial support for seed production farmers to reduce effects of climate changes. funding: the authors sincerely thank to the project of aquafish innovation lab for budget supporting; officers from department of fisheries in an giang, dong thap, hau giang for their kindly supports in surveys and field trip at the research areas. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] d. m. chung and l. x. sinh, "an analysis of snakehead value chain (channa sp.) cultured in the mekong delta," in the national conference proceedings on aquaculture and fisheries no. 4 – cantho university, 2011, pp. 512 – 523. [2] d. n. long, textbook of freshwater aquaculture technique: bookcase of cantho university: publisher of cantho university, 2010. [3] l. x. sinh and d. m. chung, "a survey of snakehead culture models in the mekong delta," in the national conference proceeding on aquaculture and fisheries. ho chi minh city university of agriculture and forestry, 2009, pp. 436 – 447. [4] n. a. tuan, d. n. long, t. t. t. hien, n. v. kiem, n. v. thuong, n. b. loan, and b. t. b. hang, "research on biological characteristics of giant snakehead (channa micropeltes cuvier, 1831)," science journal of cantho university, vol. 2008, pp. 76 – 81, 2004. [5] b. jorn, g. matthias, v. v. tuan, and n. t. binh, vulnerability, coping and adaptation to water related hazards in the vietnamese mekong delta. chapter 10, book of the mekong delta system. netherlands: publisher of springer, 2012. [6] t. v. viet, "vietnam acts to adapt with global clime change." retrieved from http://dantri.com.vn. [accessed march, 10, 2014], 2014. http://dantri.com.vn/ animal review, 2016, 3(4): 73-82 82 © 2016 conscientia beam. all rights reserved. [7] real24h, "map of the mekong delta." retrieved from https://real24h.wordpress.com/. [accessed december 10, 2016], 2016. [8] ministry of natural resources and environment, "national target program to respond to climate change." retrieved from http://www.ngocentre.org.vn/files/docs/ntp_vietnamese.pdf. [accessed february 12, 2016], 2008. [9] vietnam institute of meteorology hydrology and climate change, "climate change and impacts in vietnam," 2011. [10] t. h. tuan, n. t. loc, h. v. hien, t. h. minh, t. n. hai, and s. p. robert, "assessment of production efficiency and impact of climate change on snakehead aquaculture (channa striata) in earthen pond in an giang and tra vinh provinces," science journal of cantho university, vol. 2, pp. 141 149, 2014. [11] intergovernmental panel on climate change, "climate change 2007: synthesis report," contribution of working groups i, ii, iii to the fourth assessment report of the intergovernmental panel on climate change. ipcc, geneva, switzerland2007. [12] h. v. trong, "assessment of current status of snakehead seed production in the mekong delta, vietnam," master thesis in aquaculture field of study. cantho university, 2015. [13] d. n. long and t. t. hieu, "experiment production and culture snakehead in the moc hoa district, long an province," report of university project: publisher of cantho university, 2010. [14] d. m. chung, "an analysis of snakehead value chain (channa sp.) cultured in the mekong delta," cantho university, master thesis in aquaculture field of study, 2010. [15] s. s. de silva and d. soto, climate change and aquaculture: potential impacts, adaptation and mitigation – climate chngae implication for fisheries and aquaculture: overview of current scientific knowledge. fao fisheries and aquaculture technical paper no. 530. rome: fao, 2009. [16] j. fourier, "the greenhouse effect, and the quest for a universal theory of terrestrial temperature," endeavour, vol. 23, pp. 72 -75, 1824. [17] institute for climate change – cantho university, "institute for climate change – cantho university sign the memory with hanns seidel foundation, germeny (hsf)." retrieved from http://dragon.ctu.edu.vn. [accessed april, 4, 2014], 2014. [18] b. keith, "impacts of climate change on fisheries," journal of marine systems, vol. 79, pp. 389 – 402, 2010. view at google scholar [19] n. t. loc, "assessment of impacts of climate change and adaptive methods of snakehead culture in the mekong delta," cantho university, master thesis of aquaculture field of study, 2015. [20] d. t. t. huong and n. t. trinh, "effects of different salinities on osmotic regulation and growth of snake head fish (channa striata)," science journal of cantho university, vol. 25, pp. 247 – 254, 2013. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://www.ngocentre.org.vn/files/docs/ntp_vietnamese.pdf http://dragon.ctu.edu.vn/ https://scholar.google.com/scholar?hl=en&q=impacts%20of%20climate%20change%20on%20fisheries https://scholar.google.com/scholar?hl=en&q=impacts%20of%20climate%20change%20on%20fisheries 68 † corresponding author © 2015 conscientia beam. all rights reserved. stover yield and chemical composition in some sorghum varieties in gadarif state, sudan asma h. m. hamed1* --selma o. abbas2 --khalafalla a. ali3 --mohmed e. elimam4 1department of animal production, faculty of agricultural and environmental sciences, university of gadarif, gadarif, sudan 2ministry of animal resources and fisheries, gadarif state, sudan 3gadarif research station, agricultural research corporation, gadarif state, sudan 4goat research centre, faculty of agricultural sciences, university of gezira, wad medani, sudan abstract an experiment was conducted at the faculty of agricultural and environmental sciences farm, university of gadarif, gadarif state, sudan to evaluate dry matter yield and nutritive value of the stover of four local sorghum varieties (bashier, zahratelgadambalia, butana and arfagadamac). dry matter yield, morphological traits and chemical composition were determined. there were significant (p<0.05) differences in dry matter yield and other morphological traits among varieties. zahratelgadambalia had the highest dry matter yield (2520 kg/fed) and was 100%, 31% and 19% higher than bashier, butana and arfagadamac varieties, respectively. it also had the highest stem height, stem weight and least in stem thickness. arfagadamac was next to zahratelgadambalia in dry matter yield and had the highest stem thickness. butana was less productive than zahratelgadambalia and arfagadamac, but not significantly. bashier was inferior to all varieties in dry matter yield and had the highest leaf: stem. dry matter yield had a highly significant positive correlation with plant height (0.999) and positive correlation with stem weight (0.553), number of leaves/ plant and leaves weight. there were significant variations in chemical composition among sorghum varieties. acid detergent fibre (adf) was 46.470.0%, neutral detergent fibre (ndf) was 59.9 79.3% and lignin was 9.2-13.5%. butana variety stover had the least ndf and adf among the four varieties. this indicated it was better in chemical composition and expected to be better in nutritive value unless other factors were not involved like anti nutritional factors. keywords: sorghum varieties, stover, dry matter yield, morphological traits, fibre fraction, sudan. received: 30 january 2015/ revised: 6 april 2015/ accepted: 11 april 2015/ published: 15 april 2016 animal review 2015 vol. 2, no. 3, pp. 68-75 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.3/101.3.68.75 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.3/101.3.68.75 animal review, 2015, 2(3): 68-75 69 © 2015 conscientia beam. all rights reserved. contribution/ originality this study is one of very few studies which have investigated the nutritive value and dry matter yield of local sorghum varieties in gadarif state, the most important region for sorghum production in sudan. it contributes to the existing literature in the analysis of correlation between morphological traits and dry matter yield. 1. introduction gadarif state is in the butana plain in eastern sudan and is one of the main rain fed agriculture areas in the country. sorghum, millet and sesame are important crops in the state. crops and animal production are very important in the state and are generally integrated. animal production role is increasing in the state due to high livestock population, reputed breeds and closeness to main markets in the country and abroad. adequate nutrition is essential for optimum animal production [1]. nutrition is one of the main constraints for animal production in gadarif state as animals are mainly reared in traditional systems based on rangeland which deteriorated for many factors including reduced area due to haphazard agricultural expansion [2, 3], reduced rainfall, successive droughts and poor management. in addition seasonal variations in rainfall were associated with seasonal variations in feeds quantity and quality and serious feeds shortages and effects on animals’ health and performance, especially in the dry season [4] as in the tropics [5, 6]. crop residues are cheap and abundant in the state and used to fill the nutritional gap in the dry season [4]. however, they generally have low nutritive value due to high cf and low cp, digestibility and feed intake and hence animals performance. sorghum (sorghum bicolor(l.)moench) is an important crop in sudan and the country ranked 8th in world sorghum grain production producing 3.5 million metric tons [7]. it is the main crop in the state and about 5-6 million feddans (2.1-2.52 ha) are cultivated annually. grain and stover yield are important traits for improving rabi sorghum varieties and hybrids in india [8]. it is claimed that limited adoption of improved sorghum varieties was mainly due to crop residues lower nutritive value and farmers believe that improved cultivars stover yield and quality are lower than local cultivars [9]. grain yield was higher in improved cultivars and stover yield was similar or higher than local cultivars [10]. in addition in vitro digestibility was higher in improved cultivars than the local ones. there were significant differences among cultivars in grain and stover yield, digestibility, cp and minerals in botswana [11]. sorghum varieties varied significantly (p<0.01) in fresh and dm yields [12]. highly significant genotype-dependent variation was found in sorghum grain and stover yield and fodder value [13]. grain yield and stover quality were not inversely related and high grain and stover yields seem to be compatible traits. there were variations in cellulose, lignin and ndf, rumen degradation, digestibility and feed intake among sorghum stover whole plant, stem and leaves and were different from lablab in nigeria [14]. there may be significant differences among sorghum cultivars in the stover concentration of structural and nonstructural carbohydrates and relative proportions of cellulose, hemicellulose and lignin [15]. in addition there is increasing interest in bioenergy and converting lignocellulosic biomass to energy products via enzymatic or thermochemical animal review, 2015, 2(3): 68-75 70 © 2015 conscientia beam. all rights reserved. conversion [16]. many sorghum varieties are used in gadarif state and the main ones in traditional feterita are arfagadmac, abdalla mustafa and korkol. some sorghum varieties such as bashier, butana, zahratelgdambalia and arfagadamac produce huge amounts of residues. it is important to conduct comparative studies to evaluate different cultivars. asma hamed [4] studied arfagadamac stover nutritive value and effects on goat performance in gadarif state. there is no available information on many sorghum varieties stover yield, nutritive value, fibre fraction, plants morphological characteristics and their correlation with dry matter yield in gadarif state, consequently, this study was conducted to determine sorghum varieties stover yield, fibre fraction, morphological traits and their correlations in four sorghum varieties in gadarif state. 2. materials and methods 2.1. study area the experiment was conducted in the animal production farm, faculty of agricultural and environmental sciences, gadarif university in gadarif, gadarif state, sudan. gadarif lies in the eastern part of sudan at latitudes 12o 40'-15o 45' n and longitudes 33o 34'-37o1' e. mean maximum temperature is 40.7 o c in april. autumn extends from july to october and average annual rainfall is 602 mm. many crops are cultivated in the area including sorghum, sesame and millet. 2.1.1. stover sampling, yield and morphological traits sorghum stover was collected from four sorghum varieties grown in the farm in 2010 autumn including bashier, zahratelgadambalia, butana and arfagadamac. they were laid in a completely randomized design (crd) with three replicates. the field was divided into three plots for each variety and ten samples were collected at random from each plot using a 1m2 sampler for dry mater yield estimation. sorghum stover was cut at the ground level. three plants were selected at random from each plot to collect data on plant height (cm), number of leaves, stem thickness (cm), stem dry weight, leaves weight and leaf: stem. 2.2. laboratory analysis samples of sorghum stover were prepared for laboratory analysis by milling through 2mm screen. neutral detergent fibre (ndf), acid detergent fibre (adf) and lignin were determined according to goering and van soest [17]. 2.3. statistical analysis data were analyzed by analysis of variance for a completely randomized design using mstat procedure [18]. the means were compared using least significant differences (lsd). simple correlation coefficients were estimated. animal review, 2015, 2(3): 68-75 71 © 2015 conscientia beam. all rights reserved. 3. results 3.1. morphological traits and dm yield table 1 shows sorghum varieties stover morphological traits and dm yield in gadarif state. plants height, stem thickness, leaves weight, stem weight, number of leaves /plant, leaf stem and dm yield varied significantly (p<0.05) among sorghum varieties. zahratelgadambalia was significantly (p < 0.001) the highest plant and butana was the shortest one. stem thickness was highest in arfagadamac and was significantly (p<0.01) lowest in zahratelgadambalia. leaves weight was significantly (p< 0.05) higher in bashier and lowest in arfagadamac with no significant differences between bashier and zahratelgadambalia. stem weight was significantly (p<0.001) higher in zahratelgadambalia and lowest in butana. number of leaves/plant was significantly (p<0.05) higher in arfagadamac than butana and bashier, but not significantly different from zahratelgadambalia. leaf: stem varied significantly (p<0.001) among varieties. and was highest in bashier and least in zahratelgadambalia. sorghum varieties varied significantly (p<0.05) in dm yield and was highest in zahratelgadambalia and lowest in bashier. zahratelgadambalia dm yield was 100%, 31% and 19% higher than bashier, butana and arfagadamac varieties, respectively. 3.2. correlations between morphological traits and dry matter yield the correlation coefficients between morphological traits and dry matter yield are shown in table 2. dry matter yield had highly significant positive correlation with plant height and positive correlation with stem weight, number of leaves/ plant and leaves weight. highly significant negative correlation was observed between dm yield and leaf: stem. there was a negative and non significant correlation between dm yield and stem thickness among the varieties under study. 3.3. fibre fractions table 3 shows fibre fractions in sorghum varieties stover in gadarif state.: there were significant (p<0.05) variations among sorghum varieties in stover adf, ndf, lignin, cellulose and hemicelluloses. acid detergent fibre and ndf were highest in arfagadamac and lowest in butana. lignin was highest in zahratelgadambalia and lowest in arfagadamac. cellulose was highest in arfagadamac and lowest in butana. hemicellulose was highest in bashier and lowest in zahratelgadambalia. 4. discussion 4.1. morphological traits and dm yield the significant differences among sorghum varieties in stover morphological traits including plant height, stem thickness, leaves weight, stem weight, number of leaves/plant and leaf: stem were mainly genetical. similar results were found by many workers [10, 19]. the variations among sorghum varieties in dm yield were mainly genetical. similar variations in sorghum varieties stover yield were reported by many workers [11, 12, 20]. animal review, 2015, 2(3): 68-75 72 © 2015 conscientia beam. all rights reserved. 4.2. correlations between morphological traits and dry matter yield the significant positive correlations between dm yield and plant height, stem weight, number of leaves/ plant and weight of leaves were similar to that reported in napier grass [21]. dry matter yield was also highly positively correlated with stem fresh weight, number of leaves, plant height and stem thickness [21]. significant correlations between plant height and green fodder yield and indirect effect on dry fodder yield were also reported by lyanar vijyakumar and fazllullahkhan [22]. significant correlations were also found among sorghum morphological traits with stover yield in nigeria [23] the positive correlation between plant height in green fodder and dm yield and positive correlation between green fodder yield and dm yield was also reported for pearl millet [24]. leaf number had significant positive correlation with plant height and stover weight [23]. plant height had significant positive correlation with leaf number and stover weight and negatively correlated with total grain yield. stover weight had significant positive correlation with leaf number, leaf length and plant height. 4.3. fibre fractions the significant variations among sorghum varieties stover in adf, ndf, lignin, cellulose and hemicelluloses were mainly genetical. similar variations in stover structural carbohydrates were reported in sorghum varieties in texas, usa [20]. neutral detergent fibre, adf and lignin in sorghum stover were within the range reported by many authors [4, 25, 26]. butana variety stover had the least ndf and adf and was expected to have better nutritive value. sorghum stover in nigeria had higher ndf than the varieties in gadarif state, except arfagadamac. lignin was higher than zahratelgadambalia and butana varieties [14]. cellulose was higher than zahratelgadambalia and bashier. 5. conclusions sorghum varieties differed in dm yield and fibre fractions. dry matter yield was highest in zahratelgadambalia and lowest in basheir. dry matter yield had highly significant positive correlation with plant height and positive correlations with stem weight, number of leaves/plant and weight of leaves. butana had the highest cp (6%) and lowest crude fibre (25.0%) and arfagadamac had the highest cf (37.0%). funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] m. h. n. tahir and h. a. a. sadaqat, "genetic potential of high forage yield sorghum x sudan grass for resistance to stem borer and shoot fly pak," etomal., vol. 27, pp. 57-62, 2005. [2] m. g. elhag, "use of agro industrial by products and crop residues in the sudan," in proceeding of fao/ilca expert consultation, march 5-9, addis ababa, ethiopia, 1984, pp. 5-9. animal review, 2015, 2(3): 68-75 73 © 2015 conscientia beam. all rights reserved. [3] h. m. asma and m. e. elimam, "performance and digestibility in nubian goats fed steam treated sorghum stover," pakistan journal of nutrition, vol. 9, pp. 298-301, 2010. [4] h. m. asma hamed, "utilization of upgraded straws of sorghum, pearl millet and sesame by nubian goats in the sudan," ph.d. thesis, department of animal science, faculty of agricultural sciences, .university of gezira, wad medani, sudan, 2007. [5] f. hernandez, j. madrid, j. j. ceron, m. a. pulgar, and j. m. cid, "utilization of lemon (citrus limon ) and loquat (eribotrya japonica) tree leaves alone or with nh3treated straw for goats," journal of the science of food and agriculture, vol. 77, pp. 133-139, 1998. [6] m. o. isaac, c. w. carolyne, a. a. shaukat, i. toshiyoshi, and f. tsutomu, "evaluation of nutritive value and palatability by goats and sheep of selected browse foliages from semiarid area of kenya," animal science journal, vol. 79, pp. 582–589, 2008. [7] world sorghum production com, "world sorghum production 2014/2015." available: file://localhost/c:/users/ala%20soft/desktop/sorghum%20_%20world%20sorghum%20pr oduction%202014_2015.mht, 2013. [8] i. h. delacy, s. kaul, b. s. rana, and m. cooper, "genotypic variation for grain and stover yield of dryland (rabi) sorghum in india: 1. magnitude of genotype x environment interactions," field crops research, vol. 118, pp. 228-235, 2010. [9] t. g. kelley and p. p. rao, "yield and quality characteristics of improved and traditional sorghum cultivars: farmers’perceptions and preferences. in: variation in quantity and quality of fibrous crop residues," in proceedings of national seminar, 8-9 feb 2004, (joshi al, doyle pt and oosting sj. eds). bharatiya agro-industrial foundation (baif), pune, maharashtra, india, 1994, pp. 130-135. [10] k. gurava reddy, m. blummel, b. p. p. rao, v. s. reddy, s. ramesh, and k. m. v. prasada reddy, "evaluation of farmer-grown improved sorghum cultivars for stover quality traits," an open access journal published by icrisat, vol. 1, pp. 1-3. available: http://ejournal.icrisat.org/cropimprovement/v1i1/ismn46/v1i1evaluation.pdf, 2005. [11] j. b. youngquista1, d. c. cartera1, and m. d. clegg, "grain and forage yield and stover quality of sorghum and millet in low rainfall environments," experimental agriculture, vol. 26, pp. 279-286, 1990. [12] a. m. assaeed, "evaluation of some forage sorghum varieties under the condition of central region," saudi arabia. annals agric. sci. ain. shams univ. cairo, vol. 39, pp. 649-654, 1994. [13] m. blümmel, e. zerbini, b. v. s. reddy, c. t. hash, f. bidinger, and a. a. khan, "improving the production and utilization of sorghum and pearl millet as livestock feed: progress towards dualpurpose genotypes," field crops research, vol. 84, pp. 143-158, 2003. [14] i. f. adu, b. a. fajemisin, and a. m. adamu, "the utilization of sorghum fed to sheep as influenced by urea or graded levels of lablab supplementation. in small ruminant research and development in africa," in proceedings of the first biennial conference of the african small ruminant research network, ilrad, nairobi, kenya, 10-14 december 1990, 1989, pp. 365374. [15] g. g. mcbee and f. r. miller, "carbohydarates and lignin partitioning in sorghum stems and blades," agrono. j., vol. 82, pp. 687-690, 1990. http://ejournal.icrisat.org/cropimprovement/v1i1/ismn46/v1i1evaluation.pdf animal review, 2015, 2(3): 68-75 74 © 2015 conscientia beam. all rights reserved. [16] p. tanger, j. l. field, c. e. jahn, m. w. defoort, and j. e. leach, "biomass for thermochemical conversion: targets and challenges," plant. sci. vol. 4, article 218, doi: 10.3389/fpls.2013.00218. [accessed 01 july 2013 ]. available: www.frontiersin.org, 2013. [17] h. k. goering and p. j. van soest, forage fibre analyses. (apparatus, reagents, procedures and some applications). agriculture handbook no. 379. washington, d.c: agricultural research service. usda, 1970. [18] p. mstat-c, a soft ware program for the design management and analysis and agronomic research experiment: michigan state university, 1991. [19] k. mohanraj, a. gopalan, and m. shanmuganathan, "genotypic parameters for hydrocyanic acid contents in sorghum (sorghum bicolor l)," j. agric. sci., vol. 2, pp. 59-62, 2006. [20] j. m. powell, f. m. hons, and g. g. mcbee, "nutrients and carbohydrates partitioning in sorghum stover," agronomy journal, vol. 83, pp. 933937, 1991. [21] e. prabhakar and d. c. s. reddy, "characterization and evaluation of sorghum (sorghum bicolor l.moench) germplasm from karuataka ,india," karnalak j. agric. sci., vol. 20, pp. 840-842, 2007. [22] k. g. lyanar vijyakumar and a. k. fazllullahkhan, "correlation and path analysis in mnlticat fodder sorghum," electronic journal of plant breeding, vol. 1, pp. 1006-1009, 2010. [23] l. abubakar and t. s. bubuche, "correlation analysis of some agronomic traits for biomass improvement in sorghum (sorghum bicolor l. moench) genotypes in north-western nigeria," african journal of agricultural research, vol. 8, pp. 3750-3756, 2013. [24] m. imran, h. ashiq, k. rizwan, k. sartaj, m. s. zahid, g. zulfiqar ali, b. allah, and b. daulat, "study of correlation among yield contributing and quality parameters in different millet varieties grown under and hwar conditions," sahrad j. agric., vol. 26, pp. 365-368, 2010. [25] o. b. smith, "utilization of crop residues in the nutrition of sheep and goats in the humid tropics of west africa," fao, animal production and heath paper, vol. 70, pp. 92-113, 1989. [26] s. bogale, s. melaku, and a. yami, "potential use of crop residues as livestock feed resources under conditions of small holder farmers in bale highlands of ethiopia," tropical and subtropical agroecosystems, vol. 8, pp. 107–114, 2008. table-1. different sorghum varieties stover morphological traits and dry matter yield in gadarif state, sudan. dm yield (kg/fed) leaf:stem leaves / plant stem weight(g) leaves weight (g) stem thickness(cm) height (cm) varieties/ parameters 1260b 0.504a 3.33c 22.17b 11.13a 4.30b 84.78c bashier 2520a 0.254d 4.33ab 40.1a 10.17ab 3.28c 136.7a zahratelgadambalia 1918ab 0.459b 4.10bc 21.3b 9.63b 4.67b 70.7c butana 2114a 0.403c 5.05a 21.9b 8.77b 5.63a 095.0b arfagadamac 22.44 5.01 11.83 3.52 7.97 10.42 8.17 c.v 174.6 0.03 0.22 2.40 0.23 0.28 7.67 s.e. means with different superscripts in the same column are significantly (p < 0.05) different. se= standard error of the mean; c.v= coefficient of variation. feddan=0.42 ha http://www.frontiersin.org/ animal review, 2015, 2(3): 68-75 75 © 2015 conscientia beam. all rights reserved. table-2. the correlation coefficients among stover morphological traits and with dry matter yield in different sorghum varieties in gadarif state, sudan. dmy lsr wl nl/p sw st ph parameters 0.999** -0.995* 0.087 0.94 0.512 -0.70 ph -0.734 0.771 0.650 -0.902 -0.972* st 0.553 -0.599 -0.811 0.774 sw 0.955 -0.97* -0.258 nl/p 0.039 0.017 wl -0.998** lsr dmy *= significant at p<0.05; **= highly significant at p<0.01 ph= plant height; st= stem thickness; sw= stem weight; nl/p= number of leaves / plant, wl = weight of leaves; lsr= leaf: stem; dmy= dry matter yield table-3. fibre fractions in different sorghum varieties stover in gadarif state, sudan. c.v s.e. arfagadamac butana sorghum varieties zahratelgadambalia bashier parameter 0.02 3.07 70.0a 46.4d 67.4b 51.0c adf 0.02 2.32 79.3a 59.9d 74.6b 64.8c ndf 0.08 0.46 9.2d 11.3b 13.5a 10.9c lignin 0.01 3.11 60.7a 35.1d 53.9b 40.2c cellulose 0.15 0.84 09.3c 13.5b 07.2d 13.8a hemicellulose ndf= neutral detergent fibre ; adf= acid detergent fibre; s.e.= standard error of mean; c.v= coefficient of variation. means with different superscripts in the same row are significantly different at p<0.05; views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 1 † corresponding author © 2015 conscientia beam. all rights reserved. ingessana goats phenotype, carcass and wholesale cuts characteristics in fadamia, bao locality, blue nile state, sudan mohmed e. elimam1 --asma h.m.hamed2* --amer a. y. abdalla3 1goat research centre, faculty of agricultural sciences, university of gezira, wad medani, sudan 2department of animal production, faculty of agricultural and environmental sciences, university of gadarif, gadarif, sudan abstract two studies were conducted to characterize the phenotype, carcass and wholesale cuts in ingessana goats in fadamia, bao province, blue nile state, sudan which is about 521km south east of khartoum. in the first study 250 animals were used to study body weight and measurements and colours at different ages in villages in the area. in the second study 6 males at <1 and 1 year old (three in each age group) were used to study body components and carcass and wholesale characteristics. the data was statistically analyzed according to mstat. body weight (bw) and measurements, except horns and tail length, were increased with age. the correlations between bw and measurements were calculated and different regression equations were used to predict bw from some body weight at different ages with no significant (p>0.05) differences between measured and predicted bw. animals’ colours varied greatly and were mainly black and white (35%). all body components percentages, except skin and small intestines, were higher at <1 year old with no significant difference between the two age groups. slaughter weight, empty bw (ebw) and hot carcass weight were significantly (p <0.05) higher at1 year old. dressing percentages were higher on ebw than lbw and were not significantly (p>0.05) different between the two age groups. carcass muscle, bone, fat and muscle: fat were not significantly (p>0.05) different between the two age groups. muscle: fat was significantly higher at 1 year old (p<0.05). there were no significant (p>0.05) differences in all wholesale cuts percentages between the two age groups. the percentages of leg and chump, single short forequarter and loin were higher at 1 year old and breast and neck percentages were higher at <1 year old. keywords: phenotype, carcass characteristics, wholesale cuts, goats, body weight correlation, sudan. received: 5 november 2014/ revised: 13 january 2015/ accepted: 17 january 2015/ published: 21 january 2015 animal review 2015 vol. 2, no. 1, pp. 1-8 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.1/101.1.1.8 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.1/101.1.1.8 animal review, 2015, 2(1): 1-8 2 © 2015 conscientia beam. all rights reserved. contribution/ originality the paper contributes the first logical analysis of phenotype, carcass and wholesale cuts characteristics of ingessana goats in blue nile state, sudan. the study also predicted equation for measuring body weight which contributes to the existing literature. 1. introduction meat demand and prices increased substantially in the sudan due to increased human population, urbanization and improved nutritional awareness and living standards. it is important to exploit less exploited meat producing animal in the country to reduce the prices. goats are very important in the sudan due to high population and production of high quality milk, meat and skin [1]. goat meat has high nutritive value and low fat [2, 3]. the disputed correlations between cardiovascular diseases, cholesterol and saturated fatty acids increased the demand for low fat meat including goat meat. however, goat meat is the least preferred in the sudan [2, 4]. goat production systems are mainly traditional based on rangeland which deteriorated for many reasons and animals are generally neglected with low inputs and outputs. improving goat meat production will increase its demands and reduce meat prices and increase exports and national income and alleviates poverty and hunger. there are many goat breeds in the sudan [5]. the nubian is the main dairy breed and desert, nilotic, tagger and baggara and ingessana are classified as meat breeds. ingessana is the main breed in the ingessana area in the blue nile state and reputed for high quality meat and adaptation to harsh environments, but it is endangered due to haphazard crossing with other breeds. however, there is no information on the breed characteristics. consequently, this study was conducted to characterize the breed and furnish information on the phenotype, carcass and wholesale cuts characteristics. 2. materials and methods two studies were conducted to characterize ingessana goats in fadamia area in the ingessana area, blue nile state, sudan. 2.1. the first study: the phenotypic characteristics 2.1.1. location this study was conducted in fadamia area in the ingessana area, blue nile state, sudan. fadamia is a village in bao locality and is about 150km south of eldamazeen which is the state capital and is about 521km south east of khartoum. bao locality population is about 0.103 million. the state is located between latitudes 9-12◦ n and longitudes 32-35◦e in the rich savannah zone. the area is mainly mountains with eight important mountains. maximum and minimum temperatures are 31-32◦ and 17-21◦, respectively. autumn is from april to october and annual rainfall is 100-1000mm with high plants numbers. there are many seasonal streams and the area is fertile and is the main agricultural site in the state. cropping and animal production are the main occupations in the area. animal review, 2015, 2(1): 1-8 3 © 2015 conscientia beam. all rights reserved. 2.1.2. animals two hundred and fifty goats at different ages in different villages were used in this study. they were studied at water points and a translator was used to communicate with animal owners who were cooperative. the animals were mainly adult females as owners were interested in keeping productive animals and males were slaughtered or sold at young ages. animals age was determined using the lower jaw incisors [5]. body weight was measured using a 50 kg capacity spring balance and the animals were held in a sac and suspended by the spring balance. body measurements including height at withers (hw), heart girth (hg), body length (bl), abdominal girth (ag), horn length (hl), ear length (el) and tail length (tl) were measured using a measuring tape as described by owen and norman [6]. 2.1.3. statistical analysis mean bw and measurements were calculated at different age groups and the data was statistically analyzed according to mstat. the correlations between bw and measurements were calculated in different age groups as described by mukherjee, et al. [7]. linear regression equations were used to predict bw from somebody measurements and mean predicted and measured bw were compared as described by mukherjee, et al. [7]. correlations, regression coefficients and t-test were determined according to statistical analysis system (sas). 2.2. the second study: ingessana goats carcass characteristics 2.2.1. location this study was conducted in the premises of the goat research centre in elneshasheba farm in wad medani, gezira state, sudan. 2.2.2. animals six ingessana males were bought at random at less than one year and one year old (three in each age group) from fadamia livestock market and transported by car to wad medani. the animals were housed in individual pens, rested, watered and fed and treated with ivomec against external and internal parasites. they were fed groundnut haulm ad lib for a week. clean drinking water was offered ad lib. they were then fastened overnight, weighed at the morning and slaughtered according to islamic rituals. blood was collected in a plastic container and weighed for each animal. the heads and legs were separated and weighed separately for each animal. the animals were then skinned and the skins were weighed. the carcass was opened and the viscera were removed and weighed separately and the carcasses were weighed. the elementary tract was weighed full and empty and the gut contents were calculated by difference. empty body weights were calculated for each animal by subtracting the gut fill from live body weight. each body component weight was calculated as percentage of ebw for each animal. dressing percentages were calculated on live and empty body weight. animal review, 2015, 2(1): 1-8 4 © 2015 conscientia beam. all rights reserved. 2.2.3. wholesale cuts ingessana goats wholesale cuts characteristics were studied by splitting the hot carcasses into two halves along the vertebral column using a saw. one side was divided into six wholesale cuts as described by m.l.c. [8]. ingessana goat carcass composition was studied by dissecting the wholesale cuts foe each animal into muscles, bones and fat and were weighed and expressed as percentages of ebw. muscle: bone and muscle: fat were calculated for each animal and age group. 2.2.4. statistical analysis the data was statistically analyzed using mstat. body components and carcass characteristics were compared using student's ttest according to mstat. 3. results table 1 shows mean bw and measurements in ingessana goats in fadamia area, sudan. body weight and all body measurements, except horn and tail length were increased with age. the mean body weight of goats in the five age groups (<1, 1, 2, 3 and ≥4 years) were recorded to be 9.63, 17.53, 21.58, 25.10 and 28.29 kg respectively. the increased bw and hw were highest between <1 and 1 year old and declined with age. heart girth and ag increased significantly with age. table 2 shows the correlation coefficients between bw and body measurements in ingessana goats. the correlations between bw and hg generally declined with age and were highest at <1 year old. the correlations between bw and ag were highest at 2 years old and least <1 year old. the correlations between bw and bl were highest at 1 year old (0.63) and least at 3 years old (0.40). the correlations between bw and measurements were generally higher up to 2 years old. table 3 shows that different regression equations were used to predict bw from somebody weight in ingessana goats. the regression equations accurately predicted bw at different ages with no significant differences between measured and predicted bw. ingessana goat colours varied in fadamia area. it was mainly black and white (35%) followed by black (19%), white (16%), black, white and brown (11%) and then white and brown (9%). the least colours were grey (5%) and black and brown (5%). table 4 shows ingessana goats body components expressed as percentages of ebw. all body components percentages, except skin and small intestines, were higher at <1 year old. there were no significant differences in all body components percentages between the two age groups. table 5 shows ingessana goats slaughter weight and carcass characteristics. slaughter weight, ebw and hot carcass weight, 11.73, 9.27 and 5.67 kg respectively were significantly (p <0.05) higher at one year old. dressing percentages were higher on ebw than lbw in the two age groups. dressing percentages on ebw (60.00 and 61.52) and lbw (50.00 and 48.33) were not significantly different between the two age groups, respectively. carcass muscle, bones, fat and muscle: fat were not significantly different (p>0.05) between the two age groups. table 6 shows ingessana goats wholesale cuts as percentages of hot carcass animal review, 2015, 2(1): 1-8 5 © 2015 conscientia beam. all rights reserved. weight. there were no significant differences in the percentages of all wholesale cuts between the two age groups. the percentages of leg and chump, single short forequarter and loin were higher at one year old and the percentages of breast and neck were higher at <1 old. 4. discussion 4.1. body weight and measurements the increased bw and all body measurements, except tail and horns with age were mainly due to goats proportional growth. similar results were reported in tagger goats in nuba mountains, sudan [2, 9]. it was also found in nubian goats in elshukaba area [10] and kenana sugar company area [11] and desert goats in elobeid area [4] and bengl goats in india [7]. the highest increase in body measurements at early ages (<1 and 1 year old) was also found in tagger goats [2] and was attributed to relatively fast growth before puberty [12]. ingessana goat bw was close to baggara goat at 3 years old [13]. at four years old ingessana goat bw was higher than tagger females in eldaleng area [2] and mature bw in rashad area [9]. it was also higher than nilotic goats and lower than nubian and desert goats in the sudan [14]. all body measurements in ingessana goat were higher than tagger in rashad area [9]. ingessana goats hw and hg were close to tagger in eldaleng area [2] and higher than tagger in rashad area [9]. ingessana goat ag and bl were close to tagger in eldaleng area [2]. ingessana goats bc and hw were lower than in elshukaba [10]. ingessana goat bl and el were lower than nubian goat in kenana sugar company area [11]. ingessana goat ears and tails were longer than tagger [2, 9] and horns were shorter than tagger [2]. the results suggested that ingessana and tagger goats have different body weight and measurements. 4.2. correlations between bw and measurements and predicting body weight the strong correlations between bw and most body measurements were due to proportional growth. these correlations and different linear regression equations predicting bw with no significant differences between measured and predicted bw were also reported in tagger goats [2, 3], desert goat [4], nubian goats [10, 11] and bengal goats [7].the accurately predicted bw from linear equations is advantageous where weighing machines are not available or difficult to operate and maintain and will improve animal management and marketing. 4.3. body components ingessana goat body components as percentages of ebw were higher than desert goats except the stomach, small intestines and kidneys [3]. ingessana goat percentages of head, legs, skin, heart, stomach, small intestines, kidneys and lungs were higher than tagger [2]. the nonsignificant difference in body components percentages at <1 and 1 year old were also found in desert goats [3] and indicated little changes within this age. animal review, 2015, 2(1): 1-8 6 © 2015 conscientia beam. all rights reserved. 4.4. carcass characteristics the significantly increased slaughter weight, hot carcass weight and ebw with slaughter age were also found in desert goats in elobeid area [3] and were due to increased bw and proportional growth. the increased dressing percentages with increasing the slaughter weight were also reported in sudanese goat breeds [3, 11, 15, 16]. the non-significant differences in muscles, bone and fat percentages with slaughter age were also found in desert goats [3]. the increased slaughter weight, hot carcass weight, ebw and dressing percentages with slaughter age and non-significant differences in carcass muscles, bone and fat between the two age groups suggested slaughter at 1 year old due to increased percentages and carcass weight when quality is maintained. 4.5. wholesale cuts wholesale cuts percentages were generally lower in ingessana than desert goats [3]. the non-significant differences in wholesale cuts percentages at <1 and 1 year old and improved carcass characteristics with age in ingessana and desert goats highlighted the advantages of slaughter at 1 year old. the different wholesale cuts percentages between ingessana and tagger in nuba mountains [2, 9] suggested that they are different breeds. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] aoad, production year book. khartoum, sudan: arab organization for agricultural development printing press, 2006. [2] t. m. a. mudawi, "performance characteristics of tagger goats in south kordofan state, sudan," m. sc. thesis, department of animal science, university of gezira, wad medani, sudan, 2002. [3] m. e. elimam and y. a. ombabi, "carcass characteristics of male desert goats in elobeid area in north kordofan state, sudan," gezira journal of agricultural science, vol. 5, pp. 190– 202, 2007. [4] y. a. ombabi, "characteristics of desert goat as a meat producer in elobied area, sudan," m. sc. thesis, department of animal science, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2006. [5] c. devendra and g. b. mc leroy, goat and sheep production in the tropics. uk: commonwealth agricultural bureau, 1982. [6] j. b. owen and g. a. norman, "studies on the meat producing characteristics of botswana goat and sheep part iii. general body composition. carcass measurements and joint composition," meat. science, vol. 1, pp. 283 – 306, 1977. [7] d. k. mukherjee, c. s. p. singh, and h. r. mishra, "a note on body weight measurements relationships in grey bengal goat," indian journal of animal science, vol. 51, pp. 882 883, 1981. animal review, 2015, 2(1): 1-8 7 © 2015 conscientia beam. all rights reserved. [8] m.l.c., cutting and preparing lamb and pork. technical bulletin no. 24, 12-18. england: meat and livestock commission, 1977. [9] h. a. elbukhary, "production characteristics of tagger goats," m.sc. (anim. prod.) thesis, univ. of khartoum, sudan, 1998. [10] m. e. elimam and a. y. ayderous, "a note on characteristics and body measurements of goats in shukaba area in the gezira, sudan, khartoum," j. agric. sci., vol. 10, pp. 343 – 348, 2002. [11] n. b. h. khalifa, "characteristic and performance of garag sheep and nubian goats in kenana sugar company, sudan," m.sc. thesis, department of animal science, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2002. [12] r. t. wilson, husbandry, nutrition and productivity of goats and sheep in tropical africa. in: small ruminant in africa agriculture. addis ababa, ethiopia: ilca, 1982. [13] a. a. ageeb, "productive and reproductive characteristics of a flock of baggara goats of south kordofan, sudan," j. anim. prod., vol. 5, pp. 1-24, 1992. [14] f. m. tleimat, arab center for the studies of arid zones and dry lands (acsad). damascus, syria (cited by gall, c, 1996. goat breeds of theworld. c.t.a akersheim, margraf.). germany: institute for anim. prod, 1986. [15] a. bello and s. a. babiker, "growth and carcass characteristics of desert goat kids and their temoerate cross," animal production, vol. 46, pp. 231-235, 1988. [16] i. a. elkhidir, "desert goats and sheep meat production and quality," m. sc thesis. animal production, university of khartoum, shambat, khartoum north, sudan, 1989. table-1. body weight (kg) and measurements (cm) in ingessana goats in fadamia, bao province, blue nile state, sudan parameters age (years) <1 1 2 3 ≥4 body weight 09.63±0.66d 17.53±0.86c 21.58±0.57bc 25.10±0.52ab 28.29±0.67a height at withers 52.40±0.95d 57.28±0.63c 61.22±1.06bc 62.81±0.48ab 66.58±0.96a heart girth 53.58±0.95d 63.88±0.90c 67.50±0.76bc 71.07±0.51ab 74.07±0.42a barrel circumference 63.95±1.42d 79.18±1.25c 85.93±1.31bc 89.10±0.83ab 95.00±0.77a body length 36.05±1.43c 38.32±0.75bc 40.19±0.75ab 42.08±0.47a 43.39±0.95a ear length 15.02±0.39b 16.04±0.23ab 17.05±0.30a 16.75±0.21ab 16.63±0.26ab horn length 03.90±0.33c 05.70±0.43bc 07.78±0.40ab 08.77±0.44ab 10.20±0.45a tail length 11.87±0.20b 13.08±0.18ab 13.47±0.20ab 13.77±0.16a 13.63±0.22ab different letters within a row denote significant differences at p< 0.05 table-2. correlation coefficients between body weight and measurements at different ages in ingessana goats in fadamia, bao province, blue nile state, sudan. parameters age (years) <1 1 2 3 ≥4 heart girth 0.78 0.75 0.73 0.61 0.60 barrel circumference 0.20 0.64 0.79 0.35 0.67 body length 0.42 0.63 0.43 0.40 0.45 height at withers 0.46 0.66 0.15 0.09 0.06 table-3. regression equations predicting body weight and predicted body weight at different ages in ingessana goats in fadamia, bao province, blue nile state, sudan animal review, 2015, 2(1): 1-8 8 © 2015 conscientia beam. all rights reserved. age (years) equations predicted bw measured bw <1 y= 0.142x1+ 0.297x2 + 0.111x3 8.811 10.99±0.95 09.10±0.66 1 y= 0.047x1 + 0.121x2 + 0.617x3 29.63 17.64±1.14 17.10±1.61 2 y= 0.017x1 + 0.246x2 + 0.253x3 15.854 22.01±0.85 21.40±1.12 3 y= 0.239x1 + 0.091x2 + 0.433x3 23.982 25.34±0.83 26.10±1.35 ≥4 y= 0.426x1 + 0.455x2 + 0.218x3 – 49.441 28.37±1.25 28.90±1.75 bw= body weight (kg). table-4. body components (% of empty body weight) at different ages in ingessana goats in fadamia, bao province, blue nile state, sudan. parameters age (years) significance <1 1 head 13.50+1.77 13.22+1.73 ns skin 09.67+0.98 11.31+0.89 ns legs 06.27+0.30 05.97+0.51 ns stomach 04.27+0.43 05.07+0.19 ns small intestines 02.08+0.44 02.49+0.41 ns liver 02.62+0.34 02.57+0.08 ns spleen 00.54+0.06 00.52+0.06 ns kidneys 00.72+0.13 00.59+0.05 ns lungs 02.45+0.35 02.10+0.24 ns heart 01.12+0.15 01.01+0.09 ns ns= non significant differences at p>0.05 table-5. slaughter weight and carcass characteristics in different age groups in ingessana goats in fadamia area, bao province, blue nile state, sudan. parameters age (years) <1 1 significance slaughter weight (kg) 07.57+1.03 11.73+0.03 * ebw 06.23+0.57 09.27+0.33 * hot carcass weight (kg) 03.69+0.28 05.67+0.26 ** dressing %: ebw 60.00+6.12 61.52+3.53 ns : lbw 50.00+6.01 48.33+2.02 ns total carcass muscles (%) 65.0+11.28 65.00+0.16 ns total carcass bone (%) 23.00+5.52 24.33+0.88 ns total carcass fat (%) 01.00+0.00 01.0+0.00 ns muscle: bone 02.78+0.28 02.67=0.12 ns muscle: fat 65.00+5.36 65.00+0.94 ns ebw= empty body weight, lbw= live body weight. ns= non significant differences at p>0.05, *= significant differences at p<0>05, ** significant differences at p<0.01 table-6. wholesale cuts (% of hot carcass weight) in different age groups in ingessana goats in fadamia area, bao province, blue nile state, sudan. cuts age (years) significance <1 1 leg and chump 29.50+3.54 33.67+0.33 ns single short forequarter 32.33+4.92 32.67+0.88 ns loin 06.33+0.67 08.67+0.88 ns beast end of neck 05.33+0.33 05.33+0.33 ns breast 06.33+0.33 06.00+0.58 ns neck 11.00+2.31 10.33+2.34 ns ns= non significant differences at p>0.05 views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 20 © 2021 conscientia beam. all rights reserved. effect of pre-storage heating and period of storage on hatchability traits of dokki-4 eggs sherif, kh. el1 el-gogary, m. r.2 hasan, r.a.3 ismail, f. radwa4+ 1,2,4poultry production department, faculty of agriculture, mansoura university, mansoura, egypt. 1email: sherief_2015@yahoo.com 4email: brave_heart_agric@yahoo.com 3animal production research institute, ministry of agriculture, dokki, cairo, egypt. (+ corresponding author) abstract article history received: 6 august 2021 revised: 10 september 2021 accepted: 21 september 2021 published: 26 october 2021 keywords pre-storage heating eggs storage period hatchability chick quality laying hens. this study investigated the effects of pre-storage heating and storage period of hatching eggs on hatchability traits and chick quality of dokki-4 (egyptian local strain of chickens) laying hens. a total of 3600 eggs were collected from 46-week-old laying hens. eggs were distributed in a 3x4 factorial arrangement, with three storage times (4, 8 and 12 days at 18°c and 75% rh) and four heat treatments prior to storage (0, 3, 6 and 9 hours at 37.5°c and 56% rh). eggs were distributed to twelve treatments of 20 replicates. after storage, eggs were incubated under the normal conditions of incubation at the same time. the results showed that the long storage period increased egg weight loss. hatchability and chick quality results from 8-12 days stored eggs were lower than eggs stored for 4 days. the 6-hour pre-storage heating system substantially improved egg hatchability and chick quality relative to non-heated or 9-hour heating. important interactions were observed during pre-storage heating × egg storage time for loss in egg weight, hatchability of total and fertile eggs, embryonic mortality and chick quality. when eggs were stored for more than four days, pre-storage heating of hatching eggs for six hours improved hatchability and chick quality compared to unheated eggs or heated for 9 hours. conclusively, pre-storage heat treatment beneficially affects hatchability traits and chick quality, especially when hatching eggs are stored for long periods. contribution/originality: this study contributes to existing literature by investigating the effects of prestorage heating and storage period of hatching eggs on hatchability traits and chick quality of dokki-4 (egyptian local strain of chickens) laying hens. 1. introduction cooling of hatching eggs before incubation is common practice in poultry industry. it is well known that incubation length increases when the storage period is more than seven days [1, 2] and this may had adverse effects on hatchability [3, 4] and chick quality [1, 4]. furthermore, previous reports have established the adverse effects of long storage period on embryos development and viability, hatching rate [1, 5]. many publications have shown that storage of hatching eggs for long period decreased egg hatchability in aged breeder hens more than in young breeder hens [4, 5]. it was suggested that the adverse effects of long storage period of eggs could be attributed to the deterioration of egg quality, primarily albumen quality [6]. in this regard, lapao, et al. [5] found that albumen ph was raised with increasing storage period. albumen height was also decreased with increasing egg storage animal review 2021 vol. 8, no. 1, pp. 20-29. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar.2021.81.20.29 © 2021 conscientia beam. all rights reserved. https://orcid.org/0000-0001-5856-1853 https://orcid.org/0000-0003-0430-7731 https://orcid.org/0000-0003-2971-5854 https://orcid.org/0000-0002-4050-2641 mailto:sherief_2015@yahoo.com mailto:brave_heart_agric@yahoo.com https://www.doi.org/10.18488/journal.ar.2021.81.20.29 https://www.doi.org/10.18488/journal.ar.2021.81.20.29 animal review, 2021, 8(1): 20-29 21 © 2021 conscientia beam. all rights reserved. period [5]. also, jones and musgrove [7] yolk sac membrane elasticity decreased as storage time increased. nahm [8] found that mortality of chicken embryos during storage was strongly related to length of storage. warming of hatching eggs prior to storage was suggested as a managerial strategy for reducing the negative effects of long storage periods via improving the embryonic development. fasenko, et al. [3] and gucbilmez, et al. [9] suggested a correlation between pre-storage heat treatment and improved hatchability of chicken eggs. the same relationship was observed in turkeys [10] and quails [11]. hamidu, et al. [12]; hamidu, et al. [13] and dymond, et al. [14] found that prolonged storage of hatching eggs can cause embryonic stress, leading to increased embryonic mortality, depressed embryonic metabolism, and impaired development. therefore, it could be assumed that prestorage incubation might accelerate the embryonic development and enhance the viability of the developing embryos. the present study therefore aimed to investigate the effects of pre-storage heating and storage period of hatching eggs on hatchability and chick quality of dokki-4 laying hens. 2. materials and methods this study was performed at sakha research station, animal production research institute, ministry of agriculture, egypt. 2.1. experimental design and treatments in this trial, 3600 hatching eggs were collected from dokki-4 chicken hens (egyptian local strain of chickens) at 42 weeks old which maintained under similar environment and management conditions (male: female ratio was 1:10). light schedule included 16 h of light and 8 h of darkness). the eggs were distributed in a 3 x 4 factorial design, three storage periods (4, 8 and 12 days at 17ºc and 75 % relative humidity) and four incubation times prior to storage (0, 3, 6 and 9 hours at 37.5ºc and 56% relative humidity), summing up 12 treatments with 20 replicates of 15 eggs each. in order to simultaneously incubate all eggs, the eggs were collected in three groups, one group per day, representing the three storage periods (4, 8 and 12 days). the first category therefore corresponded to eggs stored for twelve days; the second to eggs stored for eight days, and the third to eggs stored for 12 days. 2.2. general management immediately after collection, the eggs was fumigated by paraformaldehyde gas [15] through the interaction of 35 ml formalin, 17.5 grams of potassium permanganate and 50 ml of warm water per cubic meter of the volume of evaporation room for 30 minutes then it was ventilated chamber by fresh air through the operation the air fan and opening the windows for about an hour to get rid of the residues of paraformaldehyde gas. all eggs in each group were individually weighed, numbered and randomly distributed into the treatments. the heating timing started when the temperature reached 37.5°c and the relative humidity 56% inside hatchery. after heating, eggs were kept for one hour at room temperature, then eggs stored at 17 ° c in a storage room and 75 percent relative humidity for the periods corresponding to the treatments. after storage, the eggs were kept at 25 ° c and 75% relative humidity for six hours before incubation, then incubated at a temperature of 37.5 °c and relative humidity of 56.5% for 18 days in a chick master incubator. after that, eggs were transferred to a chick master ® hatcher at 36.6°c temperature and 61.2% (relative humidity). 2.3. measurements 2.3.1. egg weight loss egg weight loss was calculated individually twice at the end of storage period and at day 18 of incubation. egg weight loss during storage was determined as the difference in egg weight between initial egg weight (at the day of egg collection) and the last day of storage as a percentage of egg weight at collection. egg weight loss during incubation was determined as the difference in egg weight between the last day of storage and day 18 of incubation animal review, 2021, 8(1): 20-29 22 © 2021 conscientia beam. all rights reserved. as a percentage of egg weight at the last day of storage. total egg weight loss was the sum of egg weight loss during storage and incubation. 2.3.2. embryonic mortality at 7 and 14 days of incubation all eggs were candled, and all clear eggs were removed from the trays. at the end of 18 day of incubation, all eggs were candled again and those with evidence of living embryos were transferred from the setter trays to the hatcher trays. [16] categorized the embryonic mortality into three categories: early from days 1 to 7, middle from days 8 to 14 and late from days 15 to 21. 2.3.3. piped eggs the formula referenced by lourens [17] was applied in determining the rate of piped eggs: rate of piped eggs % = number of piped eggs / number of fertilized eggs*100 2.3.4. fertility and hatchability fertility was calculated as total fertile eggs as a percentage of total eggs set into the incubator. hatchability was calculated as a percentage of fertile eggs and total eggs set. 2.3.5. chick quality all the chicks were classified to first grade 'a' and second grade ''b.'. a chick was grouped in grade a when it was completely healthy, clean, dry, free of deformities, with bright eyes [4]. the other chicks were classified in grade b. the chicks in both grades were expressed as a percentage of total hatched chicks. 2.3.6. chick length twenty chicks randomly selected from each treatment for individual measurement of chick length (cm) directly after hatch. the length of the chick was described as the length from the beak tip to the nail implantation on the middle toe [18]. 2.4. statistical analysis program of sas [19] was used to statistical analysis of the data according to a factorial experiment (3 × 4) applied in a complete randomized design (crd) to study the effect of three storage periods of eggs and four incubation time prior to storage eggs and their interference in different qualities. the differences between the averages were compared [20]. yijk = μ+ si + hj + sij + eijk μ = overall mean. si = effect of storage period (i=1, 2,3). hj= effect of incubation time prior to storage of eggs (j=1, 2, 3, 4). sij= interaction between storage period and incubation time before storage. eijk= residual error. 3. results 3.1. egg weight loss (lew) in table 1, mean percentage of lew during storage, first eighteen days of incubation and total lew were significantly higher for longer storage period (12 days) compared to the shorter periods (4 and 8 days). in the interaction between storage duration and pre-incubation periods, as pre-incubation periods increased, incremental increase with substantial impact in the percentage of egg weight loss was observed across all the periods studied. animal review, 2021, 8(1): 20-29 23 © 2021 conscientia beam. all rights reserved. group of eggs that incubated for 9 hours before 12 days of storage had the highest and most important percentage of egg weight loss during storage, first eighteen days of incubation and total percentage of egg weight loss compared to the other groups and the lowest one with significant value was reported for egg group that was not incubated before storage of 4 days. table-1. the effects of storage period, pre-storage incubation and their interaction on fresh egg weight and egg weight loss percentage of dokki4 eggs. treatments traits fresh egg weight (g) egg weight loss during storage, % egg weight loss after 18 days of incubation, % total egg loss, % egg storage period (days) 4 50.42 0.84c 10.57c 11.41c 8 50.45 1.17b 11.62b 12.80b 12 50.50 1.52a 12.51a 14.03a sem 0.0562 0.0639 0.2020 0.2593 p-value 0.865 0.0001 0.0001 0.0001 pre-storage incubation (hours at 37.5°c) 0 50.50 0.83c 10.73c 11.56c 3 50.43 1.20b 11.84ab 13.04b 6 50.53 1.17b 10.98bc 12.15bc 9 50.36 1.50a 12.73a 14.24a sem 0.0562 0.0639 0.2020 0.2593 p-value 0.747 0.001 0.0001 0.0001 interaction between storage period and pre-storage incubation 4 days * 0 hours 50.50 0.63e 10.06h 10.69g 4 days * 3 hours 50.30 0.88d 10.34gh 11.22fg 4 days * 6 hours 50.50 0.76de 10.10h 10.86fg 4 days * 9 hours 50.40 1.10c 11.80de 12.90cd 8 days * 0 hours 50.40 0.82d 10.80fgh 11.62ef 8 days * 3 hours 50.50 1.15c 12.06cd 13.21c 8 days * 6 hours 50.50 1.20c 11.05efg 12.25de 8 days * 9 hours 50.40 1.52b 12.60bc 14.12b 12 days * 0 hours 50.60 1.05c 11.33def 12.38d 12 days * 3 hours 50.50 1.58b 13.12ab 14.70b 12 days * 6 hours 50.60 1.56b 11.80de 13.36c 12 days * 9 hours 50.30 1.90a 13.80a 15.70a sem 0.0562 0.0639 0.2020 0.2593 p-value 0.996 0.0001 0.0001 0.0001 note: *means, within columns, for the main treatment effects or the interaction effects, with no common superscript, differ significantly (p≤0.05). ** sem = stander error of the mean. 3.2. fertility and hatchability table 2 demonstrates the effects of the egg fertility, hatchability of fertile and total eggs. there were no significant effects on the apparent percentage of fertility from the egg storage period, the pre-storage heating duration or the interaction between them. the hatchability of fertile and total eggs was significantly influenced by both the experimental factors and their interaction. longer egg storage time resulted in a significant linear decrease in the hatchability of fertile and total eggs, irrespective of the length of the preheating. overall, eggs heated for six hours had substantially higher hatchability of fertile and total eggs relative to non-heated or nine-hour heated eggs. pre-storage heating of eggs in eggs stored for more than 4 days for six hours substantially improved hatchability (table 2). during the storage time of four days, eggs heated for nine hours had significantly lower hatchability compared to the non-heated ones. pre-storage eggs heated for six hours had higher hatchability when stored for four or eight days as compared to eggs stored for 12 days table 2. the long storage or pre-storage heating eggs didn't affect apparent fertility in the present study. animal review, 2021, 8(1): 20-29 24 © 2021 conscientia beam. all rights reserved. table-2. the effects of storage period and pre-storage incubation and their interaction on fertility, hatchability and embryonic mortality of dokki4 eggs. treatments traits fertility, % hatchability of total eggs % hatchability of fertile eggs % embryonic mortality % early (1-7 days) mid (8-14 days) late (15-21days) piped egg rotten egg total egg storage period (days) 4 90.37 83.97a 92.77a 2.79c 0.633b 2.10c 0.650c 0.450c 6.62c 8 90.00 80.00b 89.57b 3.97b 0.650b 3.20b 1.050b 0.550b 9.42b 12 90.10 73.10c 81.97c 8.17a 0.733a 4.95a 2.025a 1.375a 17.25a sem 0.174 0.858 0.863 0.435 0.014 0.240 0.118 0.101 0.852 p-value 0.675 0.0001 0.0001 0.0001 0.008 0.0001 0.0001 0.0001 0.0001 pre-storage incubation (hours at 37.5°c) 0 90.33 78.33b 86.96b 5.86a 0.666 3.80a 1.70a 0.666b 12.70a 3 90.06 78.40b 87.43b 5.32a 0.666 3.56a 1.20b 0.533b 11.28b 6 90.33 82.10a 91.20a 3.56b 0.655 2.40b 0.800c 0.566b 7.98c 9 89.90 77.26b 86.83b 5.16a 0.700 3.90a 1.26b 1.400a 12.43a sem 0.1745 0.8583 0.8636 0.4356 0.0147 0.2405 0.1188 0.1019 0.8526 p-value 0.325 0.028 0.033 0.035 0.526 0.022 0.018 0.005 0.0001 interaction between storage period and pre-storage incubation 4 days * 0 hours 91.00 84.50a 93.20a 2.50h 0.633d 2.10gh 1.30cd 0.100h 6.63f 4 days * 3 hours 90.00 84.60a 93.60a 2.66h 0.634d 2.00g 0.600fg 0.200gh 6.10f 4 days * 6 hours 90.70 84.20a 94.00a 2.70h 0.633d 1.70g 0.200h 0.500ef 5.73f 4 days * 9 hours 89.80 82.60b 90.30b 3.30g 0.635d 2.60ef 0.500gh 1.000c 8.03e 8 days * 0 hours 90.00 79.50c 88.00c 5.10e 0.633d 3.30d 1.500c 0.400fg 10.93c 8 days * 3 hours 90.00 79.30cd 88.70bc 4.30f 0.634d 3.00de 1.000de 0.400fg 9.33d 8 days * 6 hours 90.30 83.20ab 92.80a 2.30h 0.633d 2.20gh 0.800efg 0.500ef 6.43f 8 days * 9 hours 89.70 78.00d 88.80bc 4.20f 0.700c 4.30c 0.900ef 0.900cd 11.00c 12 days * 0 hours 90.00 71.00e 79.70d 10.00a 0.733b 6.00a 2.3ab 1.500b 20.53a 12 days * 3 hours 90.20 71.30e 80.00d 9.00b 0.735b 5.70a 2.00b 1.000c 18.43b 12 days * 6 hours 90.00 78.90cd 86.80c 5.70d 0.700c 3.30d 1.400c 0.700de 11.80c 12 days * 9 hours 90.20 71.20e 81.40d 8.00c 0.7667a 4.80b 2.400a 2.300a 18.26b sem 0.1745 0.8583 0.8636 0.4356 0.0147 0.2405 0.1188 0.1019 0.8526 p-value 0.982 0.0001 0.0001 0.0001 0.044 0.0001 0.0001 0.0001 0.0001 note: *means, within columns, for the main treatment effects or the interaction effects, with no common superscript, differ significantly (p≤0.05). ** sem = stander error of the mean. animal review, 2021, 8(1): 20-29 25 © 2021 conscientia beam. all rights reserved. 3.3. embryonic mortality early and late embryo mortality table 2 above showed that eggs sorted for 12 days had significantly higher early and late mortality, piped eggs, rotted eggs and overall percentages of embryonic mortality relative to the other sorted period (4 days). table-3. the effect of storage period and pre-storage incubation and their combination on chick quality. treatments traits chick quality day old chick quality measur ments grade a1 grade b2 grade c3 body weight g) chick length (cm) egg storage period (days) 4 94.46a* 3.27b 2.25b 35.97a 16.27 8 93.30a 3.58b 3.11b 35.20b 16.22 12 88.26b 7.84a 3.89a 33.97c 16.15 sem 0.532 0.413 0.200 0.146 0.025 p-value 0.0001 0.0001 0.002 0.0001 0.141 pre-storage incubation (hours at 37.5°c) 0 90.71b 6.01a 3.27a 35.00 16.21 3 92.41ab 3.78c 3.80a 35.06 16.21 6 94.11a 4.10c 1.78b 35.13 16.25 9 90.81b 5.70b 3.48a 35.01 16.18 sem** 0.5328 0.413 0.2002 0.146 0.025 p-value 0.012 0.037 0.0001 0.989 0.845 interaction between storage period and pre-storage incubation 4 days * 0 hours 93.30cd 4.13de 2.56de 36.00a 16.30 4 days * 3 hours 94.36b 2.66g 2.96cde 36.00a 16.30 4 days * 6 hours 98.20a 1.30h 0.500f 36.00a 16.30 4 days * 9 hours 92.00e 5.00cd 3.00cde 35.90a 16.20 8 days * 0 hours 92.33e 4.30de 3.36bcd 35.20b 16.20 8 days * 3 hours 93.70bc 3.10fg 3.20cd 35.20b 16.20 8 days * 6 hours 94.33b 3.00fg 2.66de 35.30b 16.30 8 days * 9 hours 92.83de 3.93ef 3.23cd 35.13b 16.20 12 days * 0 hours 86.50h 9.60a 3.90bc 33.80c 16.13 12 days * 3 hours 89.16f 5.60c 5.23a 34.20c 16.13 12 days * 6 hours 89.80f 8.00b 2.20e 34.80c 16.16 12 days * 9 hours 87.60g 8.16b 4.23b 34.20c 16.16 sem 0.5328 0.4137 0.2002 0.1466 0.0259 p-value 0.0001 0.0001 0.0001 0.0001 0.920 note: *means, within columns, for the main treatment effects or the interaction effects, with no common superscript, differ significantly (p≤0.05). ** sem = stander error of the mean. 1grade a = good commercial chicks. 2grade b = bad chicks. 3grade c = very bad chicks. 3.4. chick quality different metrics were used for assessing the chick quality. these indicators included a grade of commercial chick quality, chick body weight and 1day old chick length. all chick quality characteristics studied were significantly affected by both storage period and duration of pre-storage heating table 3. long storage time of eggs was associated with a decrease in the percentage of chicks in grade a, body weight and length of chicks, at one day. in comparison, the levels of grade b and c chicks for eggs stored for more than four days were significantly higher than those stored for only four days. pre-storage heating of eggs for six hours resulted in significant improvements in all characteristics of chick quality compared to unheated eggs table 3. there were significant interactions for the grade of chicks between the storage period and the duration of incubation before storage. the data obtained indicated that the chicks produced from heated eggs for six hours and stored for 4–12 days had significantly higher percentages of a-grade chicks than non-heated eggs table 3. only when eggs were stored for four, eight or twelve days table 3 was observed the significant improvement in grade a chick’s percentage in the six-hour heating group as compared to threeor nine-hours heating group. when eggs were stored for 4, 8 or 12 days, chicks with a significantly heavier weight were produced by heating eggs for three, six or nine hours compared to the same storage period with unheated ones. the chicks hatched from six hours of heated eggs and kept for 4 to 12 days were considerably longer than those hatched from unheated or nine hours of heated eggs. no interaction between storage animal review, 2021, 8(1): 20-29 26 © 2021 conscientia beam. all rights reserved. time and pre-incubation heating profile was observed chick length table 3. chicks of the 4-d storage time were longer than chicks of the 8 and 12-d storage time. chick length reduced when storage time increased. the preincubation heating profile did not affect chick length. 4. discussion 4.1. egg weight loss increasing duration of pre-incubation periods means increasing eggs exposure time for the incubation temperature leading to increased loss of egg weight because the pressure of water vapor increases as the duration of pre-incubation rises. in addition, prolonged storage time of the eggs has resulted in a decrease in cuticle consistency, which may contribute to increased water vapor pressure, raising the loss of egg weight [21]. such findings are consistent with those reported by reijrink, et al. [6] who observed that storage of commercial cobb broiler breeder eggs for 3, 5, 8 or 12 days prior to hatching increased the percentage of lew during storage by 0.24, 0.53, 0.74 and 1.28 percent, respectively. also, reijrink, et al. [2] reported that the percentage of lew during incubation and the percentage of total lew for 4 hours pre-incubation was lower than for the 24 hours preincubation period. 4.2. fertility and hatchability the two main treatments should not have affected fertility because fertilization would have occurred or would not have occurred before the eggs were exposed to the treatments. fasenko, et al. [3]reported similar suggestions in chicken eggs, and petek and dikmen [11] in quail eggs. the latter authors found that the differences for the apparent fertility among the main groups of pre-storage heating and storage duration were not significant. hatchability in table 2, was substantially lower hatchability percentages of both fertile and total eggs were observed as storage periods increased because prolonged storage eggs leading to changes in egg components such as increased albumen ph and reduced albumen height and haugh units [5] which decreased embryonic viability [22] because albumen structure is said to be a dominant factor in successful development of the germ from anaerobic to aerobic metabolism, thereby hatchability percentage decreased [23]. in the long storage period (12 days), hatchability percentage was increased after exposure of the eggs for pre-storage incubation compared to nonpre-storage incubation (control) eggs but was still significantly lower than the same pre-storage incubation level in the short stored period (4 days) may be because pre storage incubation provides more incubation time for the egg to hatch [3], but the changes in the internal egg quality (albumen) due to prolonged eggs stored (14 days) are not prevented by pre storage incubation [6]. thus, in each pre-storage incubation procedure for the long storage period (12 days), the hatchability percentage is still significantly lower compared with the same amount of prestorage incubation over the short-stored period (4 days). dokki4 eggs exposed to warming for six h during the long storage time (12 days) had higher and significant hatchability percentages of fertile and total eggs compared with the control and other pre-heating eggs for 3 and 9h prior to eggs storage, may be because pre-incubation of eggs for 6 h prior to eggs storage for a long time (12 days) allowing the embryos to reach a developmental stage more suitable to survive the long storage period (12 days), which characterized by stopping embryonic development as measured by microscopic staging methods during eggs storage [24, 25] compared to the stages of embryos development that reach to it when pre-warming eggs for 0, 10 and 15h prior to eggs storage for 14 days. our findings are in accordance with those reported by fasenko, et al. [3], who demonstrated that pre-incubation periods before storage 6h treatment for broiler breeder eggs took the majority of eggs embryos to a development stage [26] which hypoblast formation is complete and cell migration and differentiation are minimal [27], at this developmental stage, embryos are at a relatively quiescent state which promotes embryos survival to prolonged storage and embryonic death and are better able to withstand developmental arrest during prolonged storage of 14 days [3]. these embryos that displayed an enhanced development due to pre-storage heat treatment may be were animal review, 2021, 8(1): 20-29 27 © 2021 conscientia beam. all rights reserved. better able to form an effective ph barrier between the inside of the embryo (ph ranges from 7.9 to 8.4; [28]) and its surroundings (albumen ph around 9.5, because after oviposition carbon dioxide is released from the embryo, resulting in an increase in albumen ph from about 7.6 to 9.5 within a short period of time, whereas the yolk remains slightly acidic, at a ph around 6.5 during early incubation than the less developed embryos (control) [2] due to that control treatment did not expose to any worming treatments and thereby its embryonic development which characterized by, area pellucida formation is complete [26], and the more advanced once because worming eggs for12 h or 18 h allowing the majority of eggs embryos to reach an embryonic development stage 3 or 4 which characterized by, primitive streak formation is approximately half complete or complete respectively [29] with extremely active periods of cellular division, migration and differentiation and do not respond favorably to developmental arrest during 14 d storage resulted in similar hatchability percentages of fertile and set eggs compared to the control group and both of them lower than group wormed for 6 h [3]. 4.3. embryonic mortality extended egg-storage periods leads to; 1) allow albumen to degrade excessively. this deterioration allows the blastoderm to pass close to the shell of the egg resulting in early embryonic mortality resulting from dehydration during the early incubation phases [30] increases sensitivity to suboptimal conditions of incubation which means that embryos are more sensitive to changes in temperature from storage to incubation time, leading to their higher early mortality [31] the number of viable embryonic cells is small as a function of long-term storage that may result in different steps in the development of the embryo at the beginning of the incubation period due to the lack of adequate cells in the embryo, unable to use the available o2 efficiently to break down the required nutrients in the yolk in order to release the energy needed for embryonic growth, leading to abnormal development or early embryonic death [13]. on the other hand, prolonged storage of eggs leads to reduced embryonic growth in some muscles such as the breast muscle (pectoralis major) and the hatching (complex) muscle, which are essential for metabolically mobilizing stored glycogen to help the embryo penetrate the shell of the egg and its membranes during the hatching process thereby increasing late embryonic mortality [32]. in the same storage period table 2, there was a steady rise of negligible mid-mortality values and significant values in early, late embryonic mortality, piped eggs, rotten eggs, and total percentages of embryonic mortality as the pre-incubation time before storage increased. this increase could be explained by silva, et al. [31] who stated that increasing eggs exposure period for the incubation temperature before storage then storage temperature then incubation temperature being embryos were more susceptible to temperature changes leading to their higher embryo mortality at all studied periods. 4.4. chick quality pre-storage egg heating for 6 hours improved chick quality in terms of grade a percentage of chicks, chick weight and length, regardless of storage time compared to unheated eggs. these results are consistent with those reported by yalçin and siegel [33] and reijrink, et al. [6]. reijrink, et al. [2] who demonstrated that heating the hatching eggs before storage improved chick length. they said, this difference in chick length between the control and the pre-storage heated groups could be caused by a difference in hatch time. pre-storage heating improved embryonic development, and thus pre-storage heated eggs hatched earlier than the control group chicks [6, 33]. this might explain why chick length and weight of the pre-storage heated eggs was higher at the moment of measurement than those of the non-heated eggs [18]. 5. conclusions based on our results, we can conclude that pre-storage heat treatment beneficially affects hatchability traits and chick quality, especially when hatching eggs are stored for long periods (12 days). animal review, 2021, 8(1): 20-29 28 © 2021 conscientia beam. all rights reserved. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. acknowledgement: all authors contributed equally to the conception and design of the study. references [1] k. tona, f. bamelis, b. de ketelaere, v. bruggeman, v. moraes, j. buyse, o. onagbesan, and e. decuypere, "effects of egg storage time on spread of hatch, chick quality, and chick juvenile growth," poultry science, vol. 82, pp. 736-741, 2003. available at: https://doi.org/10.1093/ps/82.5.736. [2] i. reijrink, r. meijerhof, b. kemp, and h. van den brand, "influence of egg warming during storage and hypercapnic incubation on egg characteristics, embryonic development, hatchability, and chick quality," poultry science, vol. 89, pp. 24702483, 2010. available at: https://doi.org/10.3382/ps.2010-00798. [3] g. fasenko, v. christensen, m. wineland, and j. petitte, "examining the effects of prestorage incubation of turkey breeder eggs on embryonic development and hatchability of eggs stored for four or fourteen days," poultry science, vol. 80, pp. 132138, 2001. available at: https://doi.org/10.1093/ps/80.2.132. [4] k. tona, o. onagbesan, b. de ketelaere, e. decuypere, and v. bruggeman, "effects of age of broiler breeders and egg storage on egg quality, hatchability, chick quality, chick weight, and chick posthatch growth to forty-two days," journal of applied poultry research, vol. 13, pp. 10-18, 2004. available at: https://doi.org/10.1093/japr/13.1.10. [5] c. lapao, l. gama, and m. c. soares, "effects of broiler breeder age and length of egg storage on albumen characteristics and hatchability," poultry science, vol. 78, pp. 640-645, 1999. available at: https://doi.org/10.1093/ps/78.5.640. [6] i. reijrink, r. meijerhof, b. kemp, e. graat, and h. van den brand, "influence of prestorage incubation on embryonic development, hatchability, and chick quality," poultry science, vol. 88, pp. 2649-2660, 2009. available at: https://doi.org/10.3382/ps.2008-00523. [7] d. jones and m. musgrove, "effects of extended storage on egg quality factors," poultry science, vol. 84, pp. 1774-1777, 2005. available at: https://doi.org/10.1093/ps/84.11.1774. [8] k. nahm, "effects of storage length and weight loss during incubation on the hatchability of ostrich eggs (struthio camuelus)," poultry science, vol. 80, pp. 1667-1670, 2001. available at: https://doi.org/10.1093/ps/80.12.1667. [9] m. gucbilmez, s. özlü, r. shiranjang, o. elibol, and j. brake, "effects of preincubation heating of broiler hatching eggs during storage, flock age, and length of storage period on hatchability," poultry science, vol. 92, pp. 3310-3313, 2013. available at: https://doi.org/10.3382/ps.2013-03133. [10] g. fasenko, f. robinson, a. whelan, k. kremeniuk, and j. walker, "prestorage incubation of long-term stored broiler breeder eggs: 1. effects on hatchability," poultry science, vol. 80, pp. 1406-1411, 2001. available at: https://doi.org/10.1093/ps/80.10.1406. [11] m. petek and s. dikmen, "the effects of prestorage incubation of quail breeder eggs on hatchability and subsequent growth performance of progeny," animal research, vol. 53, pp. 527-534, 2004. available at: https://doi.org/10.1051/animres:2004035. [12] j. hamidu, a. rieger, g. fasenko, and d. barreda, "dissociation of chicken blastoderm for examination of apoptosis and necrosis by flow cytometry," poultry science, vol. 89, pp. 901-909, 2010. available at: https://doi.org/10.3382/ps.2009-00552. [13] j. hamidu, z. uddin, m. li, g. fasenko, l. guan, and d. barreda, "broiler egg storage induces cell death and influences embryo quality," poultry science, vol. 90, pp. 1749-1757, 2011. available at: https://doi.org/10.3382/ps.2011-01361. [14] j. dymond, b. vinyard, a. nicholson, n. french, and m. bakst, "short periods of incubation during egg storage increase hatchability and chick quality in long-stored broiler eggs," poultry science, vol. 92, pp. 2977-2987, 2013. available at: https://doi.org/10.3382/ps.2012-02816. [15] s. a. naji, g. a. al-qaisi, z. t. al-danki, a. h. al-hilali, and y. j. jamil, hatching and management of hatcheries. baghdad, iraq: iraqi poultry producers union, 2009. [16] a. a. abdel-halim, f. mohamed, a. desoky, m. elmenawey, and h. gharib, "effect of heating hatching eggs before or during storage on the alleviation of the negative effect of prolonged storage periods on hatchability," egyptian poultry science journal, vol. 35, pp. 703-717, 2015. animal review, 2021, 8(1): 20-29 29 © 2021 conscientia beam. all rights reserved. [17] a. lourens, "heating eggs before storage," world poultry, vol. 22, pp. 22-23, 2006. [18] h. willemsen, n. everaert, a. witters, l. de smit, m. debonne, f. verschuere, p. garain, d. berckmans, e. decuypere, and v. bruggeman, "critical assessment of chick quality measurements as an indicator of posthatch performance," poultry science, vol. 87, pp. 2358-2366, 2008. available at: https://doi.org/10.3382/ps.2008-00095. [19] sas, sas / stat userۥs guide: statistics cary. usa: sas institute inc, 2009. [20] b. d. duncan, "multiple range and multiple f. tests," biometrics, vol. 11, pp. 1-42, 1955. available at: https://doi.org/10.2307/3001478. [21] k. de reu, k. grijspeerdt, messens, w. heyndrickx, m. uyttendaele, j. debevere, and l. herman, "eggshell factors influencing eggshell penetration and whole egg contamination by different bacteria, including salmonella enteritidis," international journal of food microbiology, vol. 112, pp. 253-260, 2006. available at: https://doi.org/10.1016/j.ijfoodmicro.2006.04.011. [22] k. arora and i. kosin, "changes in the gross morphological appearance of chicken and turkey blastoderms during preincubation storage," poultry science, vol. 45, pp. 819-825, 1996. [23] v. christensen, m. wineland, g. fasenko, and w. donaldson, "egg storage effects on plasma glucose and supply and demand tissue glycogen concentrations of broiler embryos," poultry science, vol. 80, pp. 1729-1735, 2001. available at: https://doi.org/10.1093/ps/80.12.1729. [24] g. fasenko, f. robinson, and r. hardin, "variability in preincubation embryonic development in domestic fowl. 2. effects of duration of egg storage period," poultry science, vol. 71, pp. 2129-2132, 1992. [25] m. bakst and s. gupta, "preincubation storage of turkey eggs: impact on rate of early embryonic development," british poultry science, vol. 38, pp. 374-377, 1997. available at: https://doi.org/10.1080/00071669708418005. [26] h. eyal-giladi and s. kochav, "from cleavage to primitive streak formation: a complementary normal table and a new look at the first stages of the development of the chick: i. general morphology," developmental biology, vol. 49, pp. 321-337, 1976. available at: https://doi.org/10.1016/0012-1606(80)90117-7. [27] r. bellairs, "the primitive streak," anatomy and embryology, vol. 174, pp. 1-14, 1986. [28] j. gillespie and s. mchanwell, "measurement of intra-embryonic ph during the early stages of development in the chick embryo," cell and tissue research, vol. 247, pp. 445-451, 1987. available at: https://doi.org/10.1007/bf00218326. [29] v. hamburger and h. l. hamilton, "a series of normal stages in the development of the chick embryo," journal of morphology, vol. 88, pp. 49–92, 1951. available at: https://doi.org/10.1002/jmor.1050880104. [30] j. brake, t. walsh, and s. vick, "hatchability of broiler eggs as influenced by storage and internal quality," zootech int, vol. 16, pp. 30-41, 1993. [31] f. silva, d. faria, k. torres, d. faria filho, a. coelho, and v. savino, "influence of egg pre-storage heating period and storage length on incubation results," brazilian journal of poultry science, vol. 10, pp. 17-22, 2008. available at: https://doi.org/10.1590/s1516-635x2008000100003. [32] j. de oliveira, z. uni, and p. ferket, "important metabolic pathways in poultry embryos prior to hatch," world's poultry science journal, vol. 64, pp. 488-499, 2008. available at: https://doi.org/10.1017/s0043933908000160. [33] s. yalçin and p. b. siegel, "developmental stability of broiler embryos in relation to length of egg storage prior to incubation," the journal of poultry science, vol. 40, pp. 298-308, 2003. available at: https://doi.org/10.2141/jpsa.40.298. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 37 † corresponding author © 2014 conscientia beam. all rights reserved. influence of dehydrated medicago sativa on quality characteristics of marchigiana beef giuseppe martino1† --lisa grotta2 --valentina ponzielli3 1, 2, 3 faculty of biosciences and technologies for agriculture food and environment, university of teramo, mosciano s.a., italy abstract the composition of cattle diets is one the most important parameters influencing meat quality .effects of pasture alone and supplementation with dehaydrated medicago sativa on carcass and meat quality were studied in marchigiana beef cattle, in particular lipid and stability. meat quality measurements were made on longissimus dorsi (ld) muscle in 20 animals slaughtered at 660-700 kg. the amount of lipids in the control group was lower with higher percentage of polyunsaturated fatty acids (pufa), especially linoleic (c18:2) and linolenic (c18:3) acid. there were significant differences (p≤0.01) of tbars values that were higher in the group fed with supplementation of medicago sativa than in the other group, the control one. keywords: dehydrated medicago sativa (alfalfa), pasture, meat quality, fatty acids, lipid oxidation, tbars, meat quality. contribution/ originality today people try more and more to replace soybean with other gmo-free protein foods. this study documents how the use of dehydrated alfalfa meal in calf nutrition instead of soybean enriches the meat in polyunsaturated acids but, at the same time, promotes the processes of lipid oxidation. 1. introduction meat quality is influenced by several factors as breeding, slaughtering, dissection and commercial distribution [1, 2]. several studies showed the relationship between pasture-feeding alone or supplemented and meat quality (refrences). ruminant tissues fatty acid profiles can be influenced by animal production system (encompassing diet and physical environment/facility used to produce or finish animals) or nutritional background [3-9]. animal review 2014 vol. 1, no. 3, pp. 37-44 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(3): 37-44 38 © 2014 conscientia beam. all rights reserved. there are increasing interest in manipulating meat fatty acids, especially saturated fatty acids, which have been implicated in diseases associated with modern life, especially in developed countries. furthermore, lipids quality is particularly important considering their oxidation [3, 8] . infact, lipid peroxidation not only is one of the major causes of quality deterioration in raw and cooked meat, but it is also considered to be important for the development of atherosclerosis, and it is thought to be involved in ageing and other clinical disorders, such as cancer or cardiovascular and liver diseases [9]. oxidation of polyunsaturated fatty acids (pufa) leads to the formation of hydroand endoperoxides, which undergo fragmentation in order to yield a wide range of reactive intermediates, including alkanals, alkenals, hydroxyalkenals and mda [10]. some of these compounds, as mda, are seen to be mutagenic [13-12]. as a result of policies against the use of gmo flours/meals in animal and human feeding and prejudices of consumers towards gmo foods, in recent years the use of dehydrated alfalfa meal as a protein source instead of large-scale produced genetically modified soybean is increasingly spreading. this study evaluated the effects of pasture-feeding alone and with the supplementation of dehydrated medicago sativa on carcass and meat quality of marchigiana beef cattle in particular lipid quality and stability. 2. materials and methods 2.1. animals and diets the experiment was conducted at a herd of marchigiana beef cattle site in the province of pescara (abruzzo, italy) during the spring of 2012 to evaluate meat quality, 20 marchigiana beef cattle were studied: animals were slaughtered at 680-700 kg live weight. these animals were divided into two groups, a control group (cg) and an experimental group (eg) and assigned to a different nutritional treatment for 90 days before slaughter. all animals received a food base consisting of corn silage and wheat straw and 7.5 kg / head / day of feed supplement. as regards the experimental group, a pasture with the same protein and energy content as the control group was used, but with the supplementation of dehydrated medicago sativa. the formulation of the experimental feed supplement was: 35% of maize meal, 25% of medicago sativa meal, 15% of barley meal, 15% of residue of flour, 6% of soybean extraction meal, 1.5% of saponified fats, vitamins and minerals. the feed supplement of the control group contained the same share of maize meal, barley, fats, vitamins and minerals ( without residue of flour and dehydrated medicago sativa) ,but with the addition of 8.5% of soybean extraction meal, 16% of bran, 10.5% of beetroot, 5% of corn gluten feed and 5% of sunflower extraction meal. animal review, 2014, 1(3): 37-44 39 © 2014 conscientia beam. all rights reserved. these two kind of fodders didn’t differ for the content of fibre, proteins and moisture, while lipid and mineral values were higher in experimental fodder than in the control one (tab.1). furthermore, the palmitic (c16:0) and oleic acid (c18:1) were higher in the control diet than in the experimental fodder that contained a significantly higher percentage of linoleic acid (c18:3) (tab.2). all the animals were slaughtered at an average age of 20-22 months. 2.2. sample collection and storage longissimus dorsi muscle (ld) was sampled from the 7th to 12th rib 24 hours after slaughter and stored at -20°c for laboratory analysis. meat quality measurements (ph, moisture, ash and protein) were made on ld with procedures quoted from the “animal science and production association” (aspa). samples used for mda determination were stored refrigerated from 2 to 4°c until 14 days from slaughtering and some shares were picked up to analysis at 6, 10 and 14 days and then stored frozen at -20°c until the use. 2.3. reagents all the chemicals used were reagent grade commercial products and were used without any further purification. tba: 2-thiobarbituric acid (sigma-aldrich, italy) in acetic acid 90% (carlo erba, italy); tca: trichloroacetic acid (carlo erba, italy) in distilled water; hcl: hydrochloric acid (carlo erba, italy) in distilled water; hclo4: perchloric acid (carlo erba, italy) in distilled water; bht: butylated hydroxytoluene (sigma-aldrich, italy) in methanol (carlo erba, italy); standard solution (std): 1,1,3,3-tetramethoxypropan 99% (malonaldhyde bis(diethylacetal) (sigma-aldrich, italy) in methanol (carlo erba, italy); sodio solfato anidro (carlo erba, italy); chloroform and methanol (sigma-aldrich, italy) 2:1; sodium chloride (sigma aldrich, italy); esano (sigma aldrich, italy); acido solforico concentrato 96% (carlo erba, italy); catalyst (copper catalyst foss); naoh al 40% (carlo erba italy); nitric acid at 65% (sigma aldrich, italy); hydrogen peroxide at 30% (sigma aldrich, italy). 2.4. meat colour determination meat colour (cie l*a*b*) was measured using a minolta cr-300, calibrated with standards, on longissimus dorsi muscle picked out near the bone, a part without defects of colour, damages or excess of connective tissue, 14 days after slaughtering.the colour was expressed with cielab system where l* is the brilliance, a* is red-green index and b* is yellow-blue index. 2.5. mineral determination minerals were calculated on ~1.9 g fresh meat, put in teflon containers (tfm), where were added 4 ml of nitric acid at 65% and 1 ml of hydrogen peroxide at 30%. samples were mineralized. after dilution, the samples were analysed using spectrophotometer perkin-elmer a300. mineral values were expressed in mg/kg. animal review, 2014, 1(3): 37-44 40 © 2014 conscientia beam. all rights reserved. 2.6. fatty acid analysis determination total fat for fatty acid analysis extracted with the method of folch was transmethylated into methyl esters (fame) at room temperature by using sodium methylate (0.2m) in methanol. fame composition was determined by gas chromatography using gas chromatograph fisons hrgc mega 2 with flame ionisation detection (fid) equipped with a varian column cpsil 88 of 100 m. the carrier gas was hydrogen. oven temperature programming was as follows: 160°c held for 1 min; 175°c at 4°c/min, held for 28 min; 215°c at 3°c/min, held for 30 min; 160°c at 10°c/min. fatty acid identification was carried out with standard mixture and fatty acid values were expressed in percentage. 2.7. lipid oxidation determination (tbars test) the extent of lipid oxidation in the ld was assessed by the 2-thiobarbituric acid (tba) distillation method of tarladgis, et al. [13] modified. 3.5 g of fresh meat was added 50 ml of aqueous trichloroacetic acid (tca) at 8% and 500 μl of methanolic butylated hydroxytoluene (bht) at 0.01%. so, samples were ultra-turraxed with ultra turrax t25 for 10 min and then distilled. 2 ml of distilled were mixed with 2 ml of tba in acetic acid (90%) at 0.02 m. following incubation for 1 h at 80°c, reaction mixtures were cooled to room temperature and submitted to spectrophotometry (perkin elmer lambda 20 uv/vis spectrophotometer) against blank reaction mixture at 534 nm.tbars values were obtained by multiplying the absorbance readings by a factor and expressed as mg malonaldehyde per kg sample. tbars were measured at 6, 10 and 14 days. 3. statistical analysis all the data were statistically analysed by one-way anova using spss 9.0 for windows. the significant differences were determined using t-test at the level of p < 0.05. 4. results and discussion 4.1. animal and carcass characteristics carcass incidence on live weight (yield) and ph24 values did not differ between feeding treatments. furthermore, all samples didn’t show significant differences of colour between the control and experimental groups (tab. 3). 4.2. composition characteristics the results of the proximate compositional analysis are shown in table 4. no significant differences in moisture, lipid, protein and mineral levels were determined between control and experimental samples. it has been shown a similar composition of meat for protein (~22%), moisture (~76%), and fat content (~1.3%).control and experimental meats have animal review, 2014, 1(3): 37-44 41 © 2014 conscientia beam. all rights reserved. shown a good quota of iron, zinc and calcium. these meat quality characteristics weren’t influenced by different pastures used in this study. 4.3. fatty acid profile the fatty acid profiles, extracted from ld muscle by chloroform/methanol according to the method of folch, et al. [14] are shown in table 5. experimental samples had higher percentage of polyunsaturated fatty acids (pufa), as docosapentaenoic (c22:5) and linoleic acid (c18:2) and, especially, linolenic (c18:3) (p<0.001) acid than control ones. this is possible probably because medicago sativa is particularly rich of polyunsaturated fatty acids. instead, the monounsaturated fatty acid (mufa) levels of experimental samples are lower than the pufa. there was no significant difference in the percentage of oleic acid (c18:1) that was higher in the control group. the meat of this group had also a major level of total monounsaturated fatty acids and palmitic acid (c16:0). the control meat had shown higher values of saturated fatty acids (sfa), cause of several diseases, but less subject to oxidation than unsaturated fatty acids. 4.4. lipid oxidation (tbars) of ld of animals studied the extent of lipid oxidation was determined by monitoring malonaldehyde (mda) formation by means of the tba assay. results have shown an equal increase of mda values between the control and the experimental samples. tbars were measured at 6, 10 and 14 days. the values significantly stood out(p ≤ 0.01), however, after 10 days of refrigerated storage between the two types of samples (tab.6). mda levels of experimental group were higher than the control ones, probably because in this kind of meat there was a major percentage of polyunsaturated fatty acids (pufa). in fact, in literature, it has been shown that the diet influences the mda development and extent [15]. 5. conclusions in the described work, we have evaluated the effects of pasture-feeding alone and with the supplementation of dehydrated medicago sativa on carcass and meat quality of marchigiana beef cattle in particular with reference to animal breeding parameters and lipid quality and stability. the present study indicates that there were lower lipid values and higher polyunsaturated fatty acids (pufa) percentages, especially docosapentaenoic (c22:5),linoleic (c18:2) and linolenic (c18:3) acid, in the experimental meat.this aspect is in conformity with levels of polyunsaturated fatty acids of medicago sativa which were higher than those in a diet without this supplementation. furthermore, there has been a significant difference (p ≤ 0.01) between the two types of studied meat. the experimental meat has showed mda levels which were higher than those in animal review, 2014, 1(3): 37-44 42 © 2014 conscientia beam. all rights reserved. the control meat, probably because in this kind of meat there was a major percentage of polyunsaturated fatty acids (pufa), particularly subject to oxidation. so, it is possible to affirm that pasture feeding with or without supplementation of medicago sativa influences lipid content and quality of meats. references [1] j. f. young, k. rosenvold, j. stagsted, c. l. steffensen, j. h. nielsen, and h. j. andersen, "significance of preslaughter stress and different tissue pufa levels on the oxidative status and stability of porcine muscle and meat," j. agric. chem., vol. 51, pp. 6877-6881, 2003. [2] g. preziuso and c. russo, "meat quality traits of longissimus thoracis, semitendinosus and triceps brachii muscles from chianina beef cattle slaughtered at two different ages," ital. j. anim. sci., vol. 3, pp. 267-273, 2004. [3] j. d. wood, r. i. richardson, g. r. nute, a. v. fishe, m. m. campo, e. kasapidou, p. r. sheard, and m. enser, "effect of fatty acids on meat quality: a review," meat science, vol. 63, 2003. [4] k. s. rhee, fatty acids in food and their health implications, 2nd-revised and expanded ed. new york marcel: dekker inc, 2000. [5] k. s. rhee, y. a. ziprin, c. e. bishop, and d. f. waldron, "composition and stability of goat meat patties as affected by breed type and feeding regimen," journal of food science, vol. 62, pp. 949-953, 962, 1997. [6] k. s. rhee, d. f. waldron, y. a. ziprin, and k. c. rhee, "fatty acid composition of goat diets vs intramuscular fat," meat science, vol. 54, pp. 313-318, 2000. [7] a. rowe, f. a. f. macedo, j. v. visentainer, n. e. souza, and m. matsushita, "muscle composition and fatty acid profile in lambs fattened in drylot or pasture," meat science, vol. 51, pp. 283288, 1999. [8] d. k. larick and b. e. turner, "influence of finishing diet on the phospholipids composition and fatty acid profile of individual phospholipids in lean muscle of beef cattle," journal of animal science, vol. 67, pp. 2282-2293, 1989. [9] w. n. marmer, r. j. maxwell, and j. e. williams, "effect of dietary regimen and tissue site on bovine fatty acid profiles," journal of animal science, vol. 59, pp. 109-121, 1984. [7] a. yang, m. c. lanari, m. brewster, and r. k. tume, "lipid stability and meat colour of beef from pasture and grain-fed cattle with or without vitamin e supplement," meat science, vol. 60, pp. 4150, 2002. [8] b. halliwell, "establishing the significance and optimal intake of dietary antioxidants: the biomarker concept," nut. rev., vol. 57, pp. 104 113, 1999. [9] h. esterbauer, j. gebicki, h. puhl, and g. jürgens, free radicals biol. med., vol. 13, pp. 341-390, 1992. [10] a. k. basu and l. j. marnett, "carcinogenesis," vol. 4, pp. 331-333, 1983. [11] r. j. shamberger, t. l. andreone, and c. e. willis, j. natl. cancer inst., vol. 53, pp. 1771-1773, 1974. [12] j. suttnar, l. masova, and e. dry, j. chromatogr. b., vol. 751, p. 193, 2001. animal review, 2014, 1(3): 37-44 43 © 2014 conscientia beam. all rights reserved. [13] b. g. tarladgis, b. m. watts, m. t. younathan, and l. dugan, "a distillation method for the quantitative determination of malonaldehyde in foods," journal of the american oil chemists society, vol. 37, pp. 44-50, 1960. [14] j. folch, m. lees, and stanley, "a simple method for the isolation and purification of lipids from animal tissues," journal of biological chemistry, vol. 226, pp. 497-509, 1957. [15] p. gatellier, c. hamelin, y. durand, and m. renerre, "effect of a dietary vitamin e supplementation colour stability and lipid oxidation of air and modified atmosphere-packaged beef," meat science, vol. 59, pp. 133-140, 2001. tab-1. composition of the two kind of feed supplement moisture % 10.1 9.48 dry matter % 89.9 90.52 crude protein % 13.97 13.87 crude fat % 2.63 3.74 crude cellulose % 7.73 7.33 ca % 1.05 0.9 p % 0.64 0.53 mg % 0.33 0.33 k % 0.63 0.83 fe mg/kg 256 613 cu mg/kg 4.07 3.63 zn mg/kg 47.62 42.22 mn mg/kg 44.6 44.91 tab-2. fatty acid composition of the fat extracted from the two kind of fodders (%). fatty acids soybean medicago sativa miristic (c16:0) 27.9 24.4 stearic (c18:0) 2.96 3.11 oleic (c18:1) 25.74 24.88 linoleic (c18:2) 36.44 35.5 linolenic (c18:3) 1.99 6.95 tab-3. animal and carcass characteristics. diet parameters soybean medicago sativa(alfalfa) yield (%) 65.90±1.45 65.38±1.56 ph 5.45±0.10 5.49±0.14 colour l* 39.35±3.21 38.21±1.47 a* 21.00±2.43 21.58±2.36 b* 9.54±2.96 10.35±2.43 animal review, 2014, 1(3): 37-44 44 © 2014 conscientia beam. all rights reserved. tab-4. analytical composition of meat of the two kind of animal groups (μ± ds). diet parameters soybean medicago sativa(alfalfa) moisture 76.31 ± 2.86 76.00 ± 0.72 ash 1.13 ± 0.14 1.11 ± 3.98 protein 21.75 ± 1.00 21.94 ± 0.87 total fat. % t.q. 1.32 ± 0.21 1.27 ± 0.20 fe mg/kg t.q. 18.62 ± 3.99 18.79 ± 3.23 cu mg/kg t.q. 0.12 ± 4.51 0.17 ± 6.55 zn mg/kg t.q. 41.21 ± 6.27 40.74 ± 3.71 ca mg/kg 33.63 ± 4.66 34.87 ± 4.01 tab-5. fatty acid composition of beef (ld muscle) of control and experimental animals (μ±ds). diet fatty acids soybean medicago sativa(alfalfa) c14:0 2.36 ± 0.50 2.30 ± 0.38 c15:0 0.34 ± 0.08 0.36 ± 0.05 c16:0 25.59 ± 2.47 25.39 ± 1.43 c17:0 0.85 ± 0.10 0.79 ± 0.13 c18:0 16.79 ± 2.29 15.79 ± 1.51 c20:0 0.10 ± 0.04 0.08 ± 0.05 sfa 46.03 44.71 c14:1 0.40 ± 0.17 0.35 ± 0.16 c16:1 2.30 ± 0.55 2.31 ± 0.62 c18:1t 2.15 ± 0.90 2.16 ± 0.85 c18:1ω9 29.70 ± 3.52 27.91 ± 4.19 c18:1 ω7 1.45 ± 0.25 1.53 ± 0.15 c20:1 0.12 ± 0.01 0.10 ± 0.06 mufa 36.12 34.36 c18:2 12.73 ± 3.70 14.44 ± 3.03 c18:3 ª 0.42 ± 0.07 b 0.59 ± 0.06 cla 0.35 ± 0.05 0.36 ± 0.12 c20:3 0.62 ± 0.24 0.82 ± 0.20 c20:4 3.23 ± 1.44 4.18 ± 0.90 c20:5 0.11 ± 0.07 0.13 ± 0.06 c22:5 0.40 ± 0.14 0.40 ± 0.25 pufa 17.86 20.92 a, b = p ≤ 0.05 tab-6. mda values (mg/kg) at 6, 10 and 14 days from slaughtering. days from the slaughtering soybean medicago sativa(alfalfa) 6 0.24±0.03 0.29±0.04 10 a 0.29 ± 0.03 b 0.38 ± 0.06 14 0.56 ± 0.07 0.60± 0.05 a,b = p ≤ 0.01 views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 43 † corresponding author © 2016 conscientia beam. all rights reserved. effect of a plant extract in several traits of plymouth rock barred hens and pullets challenged with salmonella typhimurium in a rural village in central mexico j.c. garcía-lópez1† --g. álvarez-fuentes2 --j.m. pinos-rodríguez3 --y. jasso-pineda4 --e. zapatapérez5 --h.a. lee-rangel6 --s. lópez-aguire7 --m.a. camacho-escobar8 1,2,4,7instituto de investigación de zonas desérticas, universidad autónoma de san luis potosí, méxico 3centro de biociencias, universidad autónoma de san luis potosí, méxico 5centro de estudios tecnológicos industrial y de servicios 106, ciudad fernández, méxico 6facultad de agronomía y veterinaria, universidad autónoma de san luis potosí, méxico 8instituto de industrias, universidad del mar campus puerto escondido. puerto escondido oaxaca, méxico abstract the effect of chrysactinia mexicana gray extract on poultry challenged with salmonella typhimurium, was evaluated: 1) the aim of the survey was to understand the status quo of backyard poultry production in a rural area, 2). a field study with forty plymouth rock barred laying hens were used to test the effects of c. mexicana, and 3) 160 day old plymouth rock barred pullets, were assigned to: t1 control; t2 control + s. typhimurium challenge; t3 control + s. typhimurium + c. mexicana; and t4 control + s. typhimurium + antibiotic. crop, gizzard, proventriculus and duodenum colony forming units (cfu) were measured, and leukocyte and erythrocyte counts. in addition, weight gain and feed intake was measured. the liver, bursa, thymus and spleen were weighed. results show that 75% of farmers in the community have hens. the main diseases in their fowl: respiratory 45%; diarrhea 35% and parasites 20%. 90% of farmers have no access to veterinary services. results from the field study show differences (p<0.05) between the treated group with c. mexicana and the control group with no treatment. feed intake, total weight gain and final body weight was higher (p<0.05) for control group among the other treatments. treatment challenged plus antibiotic showed lower cfu counts than treatment with s. typhimurium and c. mexicana. thymus, bursa and spleen weights were similar (p>0.05) for the c. mexicana and antibiotic treatments. leukocyte and erythrocyte counts were lower (p<0.05) in control group. c. mexicana extract could be a tool to diminish bacteria in hens. keywords: chrysactinia mexicana, salmomella typhimurium, poultry, backyard system. received: 17 june 2016/ revised: 27 august 2016/ accepted: 14 october 2016/ published: 3 november 2016 contribution/ originality this study is one of very few studies which have investigated the use of chrysactinia mexicana extract on poultry performance challenged with salmonella typhimurium 1. introduction village poultry can be found in all developing countries and play a vital role in many poor households providing scarce animal protein in the form of meat and eggs [1]. it has been estimated that 80 per cent of the global poultry population occurs in traditional family-based production systems [2]. livestock, especially poultry species, have been shown to provide a practical and effective first step in alleviating rural poverty as a ready source animal review 2016 vol. 3, no. 2, pp. 43-51 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.2/101.2.43.51 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.2/101.2.43.51 animal review, 2016, 3(2): 43-51 44 © 2016 conscientia beam. all rights reserved. of quality nutrients in the human diet [3]. in mexico more than 85% of the farmers practice it. animal diets basically consist of kitchen-leftovers, worms and when available, some maize grain. labor is provided by the household and the poultry represents an important source of protein from meat and eggs, especially for children [4, 5]. the backyard poultry production system is highly affected by several diseases; among them are the gastrointestinal bacteria like salmonella typhimurium that leads to high morbidity and mortality [6]. some researchers [7] in a study of rural poultry production in tetiz, yucatan ,mexico found that 97.3% of the families with poultry had chickens and showed high mortality and low production traits. it has been shown that the incorporation of herbs and their associated essential oils into their diet may provide beneficial effects on poultry performance and health due to the antimicrobial activity of their phytochemical components [8]. reports from around the world include exhaustive lists of plants that have been reported to have medicinal properties [9, 10]. chrysactinia mexicana gray, commonly known as false damiane is a small shrub distributed throughout the southwest united states and central and northern mexico [11]. the major chemical components of c. mexicana are: eucalyptol (41.3%), piperitone (37.7%) and linalyl acetate (9.1%) [12-15]. a group of researchers [16] studied the in vitro antimicrobial effects of c. mexicana, which have demonstrated some bactericidal activity. other group [17] evaluated the effect of c. mexicana in maize weevil (sitophilus zeamais motsch) and found that the leaf powder totally prevented f1 progeny from emerging. in another experiment [18] it was demonstrated that c. mexicana aqueous extract induced an antidepressant effect in mice. in another laboratory two experiments were conducted and found that chrysactinia mexicana showed antiprotozoal acitivity against entamoeba histolytica and giardia lamblia, also had an effect on trichomonas vaginalis trophozoites [19, 20]. moreover, other researchers [21] found that c. mexicana showed the greatest antimicrobial activity against the drug resistant strain of mycobacterium tuberculosis. an experiment was performed [22] to test the effect of c. mexicana ethanolic extract on 21 week old laying hens challenged with salmonella typhimurium, and showed the c. mexicana extract as having a bactericide effect. no research has been done elsewhere with c. mexicana extract and its effects on poultry. because of the high cost of antibiotics and the low income of these types of backyard poultry producers, it makes the treatment of their poultry a real problem. the objective of the present study was to perform a survey about the status quo of backyard poultry production of a rural community; perform a field study with plymouth rock barred hens to test the effect of c. mexicana through a spot agglutination test for salmonella typhimurium; and assess the effect of c. mexicana gray in a controlled experimental trial with plymouth rock barred pullets challenged with s. typhimurium. 2. materials and methods 2.1. survey the study was performed in the community of san diego municipality of rioverde s.l.p. central mexico. located 21° 54´ n and 100° 10´ w, and 980 m above sea level. climatic conditions include annual average temperature of 21 ° c and rainfall of 479.5 mm [23]. there were 326 families in the community. a survey using a random sample of 50 families, representing 15.3% of total population, was conducted to investigate back-yard poultry production issues. a questionnaire was designed to obtain information including; production, nutrition, health and reproductive aspects, facilities and equipment for poultry production, as well as meat and egg consumption. 2.2. plant extract plant collection was made from guadalcazar village, located in a semi-desert area in the center zone of méxico. leaves were separated from the plants, placed on plates and dried for three weeks at room temperature. the leaves were then ground and the extract was obtained by common extract methods, such as heat extraction, gravity column or percolation technique with ethanol [24, 25]. two hundred g of leaf ground powder samples were placed in a column by gravity or percolation and the solvent was added and sat for 48 h, using about 5 l of ethanol animal review, 2016, 3(2): 43-51 45 © 2016 conscientia beam. all rights reserved. solvent. the samples were then dried in an extraction chamber. the obtained extract was then concentrated at reduced pressure to 29 °c with a rotavapor (r-210/r-215 buchi) [26, 27]. finally, the extract was dried by freezedrying process (cryodesicattion). 2.3. field study the field study was performed in the same village as mentioned above. in order to describe the effect of c. mexicana extract under no controlled conditions, one poultry farmer was selected. 40 plymouth rock barred hens were chosen, at day one of the trial and a rapid whole blood agglutination test for salmonella typhimurium was applied to all of the hens. then two groups of 20 hens each were created. group 1 (g1) control group was managed as usual; group 2 (g2) same management as g1 but hens in this group received c. mexicana extract in the water for 15 days. after the end of the study the agglutination test for salmonella typhimurium was performed again. briefly, a clean white tile marked into squares of 3 x 3 cm was used. one drop (about 0.02 ml) of crystal-violet-stained antigen was placed in the center of each square. one sample of fresh whole blood was obtained from the wing vein of each hen using a needle with triangular point. an equal size drop of fresh whole blood was placed to a drop of antigen and mixed using a fine glass rod, the drops kept agitated for up 2 minutes. a positive reaction in indicated by easily visible clumping of the antigen within 2 minutes [28]. 2.4. experimental study a complete randomized design was used. 160 one day old plymouth rock barred laying pullets were allocated to individual cages, 40 pullets per treatment: t1: control, t2: control + s. typhimurium challenge, t3: control + s. typhimurium + c. mexicana extract and t4: control + s. typhimurium + antibiotic. the c. mexicana extract was administered orally via an esophageal cannula during 15 days with a dose of 0.5 ml of the extract according to previous research in our laboratory [22]. to test the plant extract a standard suspension of s. typhimurium (atcc 14028) was prepared to meet the 0.5 mc farland standard equivalents to 108 cfu/ml concentration [29]. s. typhimurium challenge was given in an identical manner at days two and six of the experiment [30]. the antibiotic used was enrofloxacin 5 mg (baytril 0.05 %, bayer, mexico) the dose was 1 ml/1l water every 24 hours. feed and water was offered ad libitum and, pullets were not vaccinated. feed was formulated to meet or exceed the nrc [31] requirements for laying pullets (table 1). measured variables were initial body weight, weight gain, final weight, feed intake and quantification of colony forming units per ml (cfu/ml) in gizzard, duodenum, proventriculus, and crop of hens which were slaughtered 15 days after s. typhimurium challenge. in addition, leukocyte and erythrocyte counts were determined by natt and herrick´s stain method [32]. briefly, a standard red blood cell diluting pipette was used to dilute whole anticoagulated blood with the natt & herrick´s solution at the rate of 1:200 the diluted blood was allowed to mix for two minutes before it was discharged into the hemacytometer counting chamber. then using the high dry (40x) objective of the microscope, the total number of red and white cells were counted. also, the liver, bursa, thymus, and spleen were removed and weighed. for the colony forming units (cfu), from the different organs and using sterile scissors a small (approximately 1 cm) hole was cut, two milliliters of sterile pbs were pipetted into each organ. only 2 to 4 ml of liquid was recovered. one milliliter was used for a culture. the colony counting procedure used was the membrane filter technique [33]. 2.5. data analysis analysis of the survey was analyzed using proc univariate and proc freq procedures of statistical analysis system (sas) software [34]. the field study data were analyzed by logistic regression (log reg) analysis of sas software [34]. for the experimental study, a complete randomized design was used to assess the extract activity. analysis of variance was performed with proc glm of sas, and tukey means with sas institute [34] software program. bacterial numbers were converted to log cfu for statistical analysis. animal review, 2016, 3(2): 43-51 46 © 2016 conscientia beam. all rights reserved. table-1. basal diet composition1 ingredient g/kg diet yellow corn 8% 566.33 soybean meal 46% 357.08 calcium 15.80 vegetable oil 28.35 phosphate 17.94 sodium chloride 4.00 vitamin mix2 2.50 mineral mix2 2.50 dl-methionine 2.38 threonine 0.30 l-lysine 1.75 choline 1.07 chemical composition metabolisable energy, kcal/kg 2975 crude protein, % 21.73 fat ,% 5.30 fibre, % 2.91 ash, % 6.62 methionine, % 0.64 lysine, % 1.33 calcium, % 1.00 phosphorus,% 0.75 threonine, % 0.86 1diet was offered ad libitum for the duration of the trial, and was formulated to meet or exceed all requirements for growing pullets [31]. 2vitamin mix provided (per kg final diet): thiamin, 1.8 mg; riboflavin, 3.6 mg; pantothenic acid, 11.5 mg; niacin, 35 mg; pyridoxine, 3.5 g; folic acid, 0.6 mg; biotin, 0.2 mg; vitamin b-12, 10 µg; retinyl palmitate, 0.9 mg; cholecalciferol, 50 µg, all-rac-α-tocopheryl acetate, 36.8 mg; menaquinone, 5 mg. mineral mix provided (per kg final diet) selenium, 0.2 mg; copper, 8.1 mg; zinc, 40.7 mg; manganese, 62 mg; iron, 105.4 mg; iodine, 0.35mg. 3. results 3.1. survey results from survey show that average family size is 5 ± 2 people with an average age of 25 ± 15years old. the level of education was 3rd year of elementary school. results also showed 70% of the people in the village own their houses and that 75% of farmers have poultry. all farmers have a backyard where they have different species of animal, such as rabbits, pigs, hens, chickens, turkey, sheep, cows and horses. of these species, poultry represents 33% of the total animals. the diseases present in their fowl were: respiratory 45%; diarrhea 35% and parasites 20%. in addition mortality was due to: respiratory 35%, diarrhea 55% and predators (human, dogs and fox) 10%. poultry breeds were divided among creole 50%, rhode island red 30% and plymouth rock barred 20%. table 2 shows the results of a portion of the questionnaire. it is divided into three columns based on the farmer´s income; very low income, low income and regular income. it can be seen that most of the items have lower values for the very-low income farmers; low egg and meat consumption as well as small flock size. the same is true for feed source, poultry housing and knowledge about diseases. moreover, the very-low income farmer does not typically access to veterinary services. 3.2. field study the results from the field study show differences (p<0.05) between the treated group with c. mexicana and the control group with no treatment. from the 20 hens positive to s. typhimuriun at the beginning of the study, only two were positive to s. typhimuriun at the end of the study, with a morbidity of 10% and 0% mortality (table 3). the 20 hens in the untreated group remained positive to s. typhimuriun, with 100% morbidity and 10% mortality at the end of the study. animal review, 2016, 3(2): 43-51 47 © 2016 conscientia beam. all rights reserved. table-2. backyard poultry production situation of san diego village, rioverde, slp. item very-low income low income regular income egg consumption 1 egg per week 80% 1-3 egg /week 15% 5 eggs /week 5% meat consumption 1 time a week 80% 2 times /weeks 17% 3 time/week 3% flock size 1-5 hens 50% 6-10 hens 30% 11-20 hens 20% access to veterinary services and pharmaceuticals never 90% sometimes 3% yes (frequently use private service providers) 7% feed source kitchen-leftovers, insects, worms 45% crop by-products, corn grain 45% balanced commercial ration 10% poultry housing none 85% sometimes, usually from used local materials 12% cages 3% training none 96% moderate: control of nd, gumboro, fowl cholera; breed selection, supplememnatary feeding, appropriate housing 3% considerable: wide ranging control; breed selection, used of balanced ration, good housing 1% results from survey from 50 families of san diego village community, rioverde, slp table-3. spot agglutination test for salmonella typhimurium, mortality and morbidity of hens item c. mexicana control day 0 20 hens positive/salmonella 20 hens positive/salmonella day 15 2 hens positive/salmonellab 20 hens positive/salmonellaa morbidity % 10 100 mortality % 0 10 abmeans within columns with different letter are significantly different (p<0.05) 3.3. experimental trial feed intake, total weight gain, final body weight and feed conversion rate was higher (p<0.05) for control group (t1) among the other treatments (table 4). treatment 2 with s. typhimurium challenge had the lowest trait performance. treatment with challenge and c. mexicana extract (t3) and treatment with challenge and antibiotic (t4) had similar (p>0.05) feed intake, total weight gain, final body weight and feed conversion rate response. the control group had lower (p<0.05) cfu for crop, gizzard, proventriculus and duodenum compared with the other treatments (table 4). the highest (p<0.05) content of cfu for all four organs was for the t2. the treatment challenged with s. typhimurium and c. mexicana extract had lower (p<0.05) cfu for the organs than t2. treatment challenged with antibiotic showed lower cfu counts than treatment challenged with s. typhimurium and c. mexicana extract. thymus, bursa and spleen weights were lower (p<0.05) for the control group than other treatments. thymus, bursa and spleen weight were similar (p>0.05) for control t3 and t4. treatment 2 had the highest (p<0.05) weight values among the rest of treatments. leukocyte and erythrocyte counts were lower (p<0.05) in control group compared with the other treatments, the highest values (p<0.05) were for the treatment challenged with s. typhimurium. treatment with challenge plus c. mexicana and treatment with challenge plus antibiotic had similar (p>0.05) weights. animal review, 2016, 3(2): 43-51 48 © 2016 conscientia beam. all rights reserved. table-4. means of plymouth rock barred pullets performance, organ weights, blood cells and colony forming units [log cfu/ml] on crop, gizzard, duodenum and proventriculus with different treatments treatment t1 t2 t3 t4 sem performance initial body weight [g] 33.05 32.47 33.18 32.57 0.918 final body weight [g] 203.75a 181.92c 200.05a 206.62a 2.015 total weight gain [g] 170.07a 149.45b 166.87a 174.05a 4.021 average daily gain [g] 8.12a 7.1b 7.9a 8.2a 0.112 feed intake [g] feed conversion rate 315.28b 1.85a 395.18a 2.60c 351.24c 2.10b 348.12c 2.00b 7.172 0.024 colony forming units [log cfu/ml] crop 5.20 d 5.44a 5.33b 5.30c 0.013 gizzard 1.90 d 2.90a 2.70b 2.50c 0.024 proventriculus 3.58 d 4.23a 3.91b 3.81c 0.018 duodenum 3.77 d 4.44a 4.06b 3.84c 0.039 organ weights thymus [g] 0.435c 1.178a 0.822b 0.805b 0.036 bursa [g] 0.689c 0.960a 0.789b 0.720b 0.055 spleen [g] 0.268c 0.359a 0.300b 0.299b 0.012 blood cells leukocyte/ mm3 5.01c 5.46a 5.33b 5.25b 0.010 erythrocytes/mm3 5.84c 6.34a 6.27b 6.19b 0.021 a,b,c,d means within columns with different letter are significantly different (p<0.05). t1=control basal diet; t2=control + challenge with s. typhimurium; t3=control + s. typhimurium + c. mexicana extract; t4= control + s. typhimurium + antibiotic. 4. discussion the survey shows that 75% of farmers in the community have hens in their backyard. this is consistent with a group of researchers [35] who carried out a study in a rural community of veracruz, mexico which found that 63 % of farmers have hens in their backyard. the results in the present study demonstrate that hens are very important in rural communities. the survey results illustrate that feeding and nutrition of the birds is still a problematic issue, with a high incidence of disease increasing the problem. another study performed by other group [4] in the state of puebla, mexico showed that several respiratory diseases and attacks by predators were mentioned as the main causes of mortality, and the lack of quality feed ingredients and practically no veterinary advice were identified as the most important constraints of household poultry production. moreover, it is clear that the field study performed in the rural community of san diego village demonstrated the problems of hens with the diseases mentioned above. with these results it’s very likely that the morbidity caused by s. typhimurium affects most of the fowl in the rural community, and the use of c. mexicana in these cases was very helpful in decreasing the presence of s. typhimurium. for the experimental trial the effect of c. mexicana in pullets performance was evident; the total weight gain for the treatment challenged plus c. mexicana and the group challenged with antibiotic were similar. this was probably due to the effects of the flavonoids of plant extract working to cope with the effects of the infection [22, 36]. as mentioned by other authors [37] who reported c. mexicana to have antimycobacterial activity, it also has anti-diarrheic activity [38]. eeucalyptol and 26 other diterpenes have been reported to decrease cytokines il-2 (th1) and il-10 (th2) that are anti-inflammatory inhibiting the response of t cells [39]. finally, it has been reported that the essential oil from cymbopogon proximus contains piperitone as the largest compound (73.8%). this compound antagonizes the actions of serotonin and histamine, by the interaction of its receptors [40]. according to the results of this experiment, the use of c. mexicana extract could be a good alternative, especially for low-income families in rural areas that cannot afford to purchase antibiotics for their hens. animal review, 2016, 3(2): 43-51 49 © 2016 conscientia beam. all rights reserved. 5. conclusion backyard poultry production in rural communities in mexico remains a very important activity, and production is limited by several factors; nutrition, and diseases among others. the chrysactinia mexicana extract showed good performance traits and could be a tool to increase poultry production in rural areas. funding: this work was supported by the research support fund of the promep/103.5/07/2783 and the uaslp grant co7fai 04.22.24. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] r. g. alders and r. a. e. pym, "village poultry: still important to millions, eight thousand years after domestication," world’s poultry science journal, vol. 56, pp. 181-190, 2009. [2] fao, "poultry development review. food and agriculture organization." retrieved from http://www.fao.org/docrep/019/i3531e/i3531e.pdf 2013. [3] s. mack, d. hoffmann, and j. otte, "the contribution of poultry to rural development," world’s poultry science journal, vol. 61, pp. 7-14, 2005. [4] b. s. b. centeno, d. c. a. lópez, and m. a. juárez, "household poultry production in ixtacamaxtitlán puebla: a case of study," técnica pecuaria en méxico, vol. 45, pp. 41-60, 2007. [5] c. j. c. segura, s. m. p. jerez, f. l. sarmiento, and r. r. santos, "egg production traits of creole hens in the tropics of mexico," arch. zootec., vol. 56, pp. 309-317, 2007. [6] j. c. l. garcía, m. e. o. suárez, j. m. r. pinos, and g. f. álvarez, "egg components, lipid fraction and fatty acid composition of creole and plymouth rock x rhode island red crossed hens fed with three diets," world´s poultry science journal, vol. 63, pp. 473-479, 2007. [7] t. m. a. gutierrez, c. j. c. segura, b. l. lopez, f. j. santos, r. r. santos, f. l. sarmiento, h. m. carvajal, and c. g. molina, "characteristics of backyard poultry husbandry in tetiz, yucatan, mexico," tropical and subtropical agroecosystems, vol. 7, pp. 217-224, 2007. [8] k. w. lee, h. everts, h. j. kappert, m. frehner, r. losa, and a. c. beynen, "effects of dietary essential oil components on growth performance, digestive enzymes and lipid metabolism in female broiler chickens," british poultry science, vol. 44, pp. 450-457, 2003. [9] j. b. githiori, s. athanasiadou, and s. m. thamsborg, "use of plants in novel approaches for control of gastrointestinal helminthes in livestock with emphasis on small ruminants," veterinary parasitology, vol. 139, pp. 308-320, 2006. [10] h. k. y. garcia, h. vibrans, g. m. rivas, and c. a. aguilar, "this plant treats that illness? the hot-cold system and therapeutic procedures mediate medicinal plant use in san miguel tulancingo, oaxaca, mexico," journal of ethnopharmacology, vol. 163, pp. 12-30, 2015. [11] j. rzedowski and c. g. rzedowski, flora fanerogámica del valle de méxico, 2nd ed. pátzcuaro, michoacán, méxico: instituto de ecología a.c. y comisión nacional para el conocimiento y uso de la biodiversidad, 2001. [12] g. delgado and m. y. rios, "monoterpens from chrysactinia mexicana," phytochemistry, vol. 30, pp. 3129-3131, 1991. [13] o. n. c. cárdenas, s. m. a. zavala, r. j. r. aguirre, g. c. pérez, and g. s. pérez, "chemical composition and antifungal activity of essential oil of chrysactinia mexicana gray," journal of agricultural and food chemistry, vol. 53, pp. 4347-4349, 2005. [14] d. gang, "springer. 50 years of phytochemistry research," einbardart buch, vol. 43, p. 159, 2013. [15] m. picard, g. lytra, s. tempere, j. c. barbe, g. revel, and s. marchand, "identification of piperitone as an aroma compound contributing to the positive mint nuances perceived in aged red bordeaux wines," journal of agricultural and food chemistry, vol. 1, pp. 01-20, 2016. http://www.fao.org/docrep/019/i3531e/i3531e.pdf animal review, 2016, 3(2): 43-51 50 © 2016 conscientia beam. all rights reserved. [16] a. d. alanis, j. calzada, a. cervantes, j. torres, and g. m. ceballos, "antibacterial properties of some plants used in mexican traditional medicine for the treatment of gastrointestinal disorders," journal of ethnopharmacology, vol. 100, pp. 153-157, 2005. [17] b. i. f. juárez, p. y. jasso, j. r. r. aguirre, and p. i. jasso, "effect of astereacea powder on maize weevil, sitophilus zeamais motsch," polibotánica, vol. 30, pp. 123-125, 2010. [18] j. cassani, c. o. a. ferreyra, b. a. m. dorantes, v. r. m. vigueras, b. d. arrieta, and r. r. estrada, "antidepressantlike and toxilogical effects of standardized aqueous extract of chrysactinia mexicana a. gray (asteraceae) in mice," journal of ethnopharmacology, vol. 171, pp. 295-306, 2015. [19] f. calzada, m. l. yepez, and a. aguilar, "in vitro susceptibility of entamoeba histolytica and giardia lamblia," journal of ethnopharmacology, vol. 108, pp. 367-370, 2006. [20] f. calzada, m. l. yepez, and c. a. tapia, "effect of mexican medicinal plant used to treat trichomoniasis on trichomonas vaginalis trophozoites," journal of ethnopharmacology, vol. 113, pp. 248-251, 2007. [21] s. g. m. molina, l. a. perez, m. p. becerril, a. r. salazar, f. s. said, and t. n. waksman, "evaluation of the flora of northern mexico for in vitro antimicrobial and antituberculosis activity," journal of ethnopharmacology, vol. 109, pp. 435-441, 2007. [22] j. c. l. garcía, j. m. r. pinos, g. f. álvarez, b. i. f. juárez, y. p. jasso, m. a. e. camacho, s. a. lópez, and l. o. a. hernández, "effect of chrysactinia mexicana gray extract on laying hens organs challenged with salmonella typhimurium," journal of applied life sciences international, vol. 5, pp. 1-8, 2016. [23] m. e. garcia, koppen climate classification modifications, 3rd ed.: geographic institute. national autonomous university of mexico, 1981. [24] j. b. harbone, phytochemical methods: a guide to modern technique of plant analysis, 2nd ed. london, new york: chapman and hall, 1984. [25] e. h. lennette, manual of clinical microbiology, 3rd ed. washington d.c: asm press. american society for microbiology, 1985. [26] nccls/cls, nccls/clsi national committee for clinical laboratory standards. methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 9th ed. vol. 32, 2012. [27] m. f. sidney, j. m. william, and g. s. elvyn, bailey and scott´s diagnostic microbiology, 5th ed.: elsevier, asin boo149ccb6, 1978. [28] c. wray and a. wray, salmonella in domestic animals. wallingford, oxon, uk: cab international, 2000. [29] m. koller, p. hesse, a. salerno, a. reiterer, and g. braunegg, "a viable antibiotic strategy against microbial contamination in biotechnological production of polyhydroxyalkanoates from surplus whey," biomass and bioenergy, vol. 35, pp. 748-753, 2011. [30] e. e. koneman, d. s. allen, v. r. dowell, w. m. janda, h. m. sommers, and w. c. winn, diagnostic microbiology, editor lippincott williams and walkins, 5th ed., 1998. [31] nrc, nutrient requirements of poultry, 8th ed. washington, d.c: national academy press, 1994. [32] t. w. campbell, avian hematology and citology, 2nd ed.: iowa state university press, 1995. [33] j. m. pelczar and d. r. reid, microbiology. new york, toronto, london: mcgraw-hill, book company, inc, 1958. [34] sas institute, sas user’s guide: statistics. cary, nc: sas institute inc, 1991. [35] r. e. aquino, l. a. arroyo, h. g. torres, d. d. riestra, l. f. gallardo, and y. b. a. lópez, "the criollo turkey (meleagris gallopavo) and the backyard livestock production in the central part of the state of veracruz," técnica pecuaria en méxico, vol. 41, pp. 165-173, 2003. [36] j. b. harbone, j. greenham, j. eagles, and e. wollenweber, "6-hidroxiflavonol glycosides from chrysactinia mexicana," phytochemistry, vol. 30, pp. 1044-1045, 1991. [37] c. l. cantrell, n. h. fischer, l. urbastsch, m. s. mcguire, and s. g. franzblau, "antimycobacterial crude plant extracts from south, central and north america," phytomedicine, vol. 5, pp. 137-145, 1998. animal review, 2016, 3(2): 43-51 51 © 2016 conscientia beam. all rights reserved. [38] y. yvon, e. raoelison, r. razafindrazaka, a. randriantsoa, m. romdhane, n. chabir, m. mkaddem, and j. bouajila, "relation between chemical composition or antioxidant activity and antihypertensive activity for six essential oils," journal of food science, vol. 77, pp. h184 – h191, 2012. [39] c. ku and j. lin, "anti-inflammatory effects of 27 selected terpenoid compounds tested through modulating th1/th2 cytokine secretion profiles using murine primary splenocytes," food chemistry, vol. 141, pp. 1104 – 1113, 2013. [40] a. al-taweel, g. fawzy, s. perveen, and e. k. tahir, "gas chromatographic mass analysis and further pharmacological actions of cymbopogon proximus essential oil," drug research, vol. 63, pp. 484 – 488, 2013. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 17 † corresponding author © 2014 conscientia beam. all rights reserved. effects of age at fattening on butana camel males carcass characteristics in the sudan asma himmed mohammed hamed1† --mohamed elamin elimam2 --solafa i.a.o.3 1 department of animal production, faculty of agricultural and environmental sciences, university of gadarif, gadarif, sudan 2 goat research centre, faculty of agricultural sciences, university of gezira, wad medani, sudan 3ministry of animal resources and fisheries, gadarif state, sudan abstract twelve male butana camels were bought from gadarif livestock market at 2, 3 and 4 years old (four in each age group) and fattened for eight weeks in the animal production research station in gadarif, gadarif state, sudan. they were weighed before the morning meal at the beginning of the experiment and then weekly. the animals were fed sorghum stover ad lib in two equal meals at 8.00 am and 4.00 pm each animal was daily offered 2.0 kg concentrates. the animals were fed for two weeks as a preliminary period before fattening for eight weeks. at the end of the experiment the animals were fasted overnight, weighed and then slaughtered. blood was collected and head, neck and legs were removed and weighed. the animals were then skinned, eviscerated and body components were removed and weighed separately. the gastro intestinal tract was weighed full and empty. the hot carcass was weighed with the kidneys intact and then one carcass side was divided into 6 whole sale cuts and the cuts were then dissected into muscle, bone and fat. data was statistically analyzed by analysis of variance for a completely randomized design using spss program. the means were compared using least significant difference (lsd). slaughter weight, ebw and hot carcass weight increased with age at fattening and were significantly (p< 0.05) lighter at 2 years old. dressing percentages on lbw and ebw increased with age at fattening and were higher on ebw. they were least at 2 years old and highest at 4 years old. there was significant difference between 2 and 4 years old and between 3 and 4 years old on ebw. all body components weight increased with age at fattening, except lungs, heart and spleen. mean weights of blood, head, liver, stomach and intestines were significantly (p< 0.05) higher at 4 years than at 2 years old, but not significantly (p> 0.05) different between 3 and 4 years old. hides, fore legs and hind legs weights were significantly (p< 0.05) heavier at 3 and 4 years old than at 2 years old. lungs weight increased up to 3 years and then declined. all body components weight as percentage of ebw increased with age, except lungs, spleen, kidneys and heart and was not significantly different among age groups. keywords: camelus dromedarius, age, fattening, carcass characteristics, dressing percentage, sudan animal review 2014 vol. 1, no. 2, pp. 17-25 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(2): 17-25 18 © 2014 conscientia beam. all rights reserved. contribution/ originality this study is one of very few studies which have investigated the effect of age at fattening on carcass characteristics of camelus dromedarius. it contributes in the existing literature. the papers primary contribution is finding that slaughter weight, ebw and hot carcass weight increased with age at fattening in camelus dromedarius. 1. introduction livestock population in sudan was about 141.9 millions including 52.1 millions of sheep, 43.4 millions of goats, 41.8 millions of cattle and 4.6 millions of camels [1]. livestock in the sudan produces about 46.9% of total agricultural production, 20-25% of total local production and 23.1% of exports revenues. it is the main nonoil export in recent years. camels (camelus dromedarius) are important in the sudan due to adaptation to harsh environments, high population ranking second to somalia in world 20 million camel population [2] and socioeconomic impacts. camels are important in the butana plain due to high population of about 0.75 million forming about 25% of camel population in the country [3]. sudanese camels were classified according to location, tribal ownership, colours and function [4]. camels are used for production of milk, meat, hides and waber and for riding, racing and packing [5]. camels are important and efficient meat producers in arid and semi-arid zones where it is difficult to rear other meat producing animals [6]. the one humped camel has practical and unique attributes for meat production in intensive management in arid areas [7].the amounts, composition and quality of camel meat vary with age, sex and feeding [8]. sudan is among the major african countries with relatively well developed camel trade for slaughter [9]. according to idriss [10] camel meat production in sudan increased from 1275000 tons in 1996 to 1624000 tons in 2002. however, camel meat consumption in the sudan and exports are very low compared to their population. this was mainly because the main preferred meats were mutton, lamb and beef and camel meat is consumed in certain areas in the country and is not promoted. camels are generally slaughtered at old ages with a decline in meat quality. camels can play an important role in all pastoral societies in butana area [11]. nutrition is one of the main constraints for camel production in the sudan as animals are mainly reared in traditional systems based on nomadism and rangelands which generally deteriorated due to many factors [12]. seasonal rainfall and fluctuations in feeds quantity and quality lead to serious shortages in the dry season affecting animal’s performance and health [13]. animals are generally slaughtered at old ages with a decline in meat quality. mean slaughter weight of fattened mature desert camels was 456 kg and mean empty body weight (ebw) was 404·8 kg [14]. camels dressing percentages vary greatly and are affected by many factors. they vary from 47 to 62 and were affected by sex, age, breed or type, body condition and digestive tract contents [15]. fattened mature sudanese desert camels dressing percentages were 55·8% on live body weight and 63·6% on ebw [14] and 47.4-51.4% [16]. camels in the butana area are important for improving meat production. however, there is no information on the appropriate age at fattening and effects of age at fattening on animals animal review, 2014, 1(2): 17-25 19 © 2014 conscientia beam. all rights reserved. carcass characteristics and body components. therefore, this study was conducted to furnish these vital information. 2. materials and methods the experiment described below was conducted in the premises of the animal production research station in gadarif, gadarif state, sudan. gadarif state is situated between latitudes 12◦40 and 15◦ -45 n and longitudes 33◦-45 and 36◦45 e. autumn is from july to october and annual rainfall is 602 mm. average maximum temperature is 40o.7 in april. the soil is generally sandy clay. 2.1. animals twelve male butana camels were bought from gadarif livestock market at 2, 3 and 4 years old (four animals in each age) and brought to the animal production research station where the trial was performed. the age was determined depending on skilled animal owners. the animals were randomly assigned to twelve experimental pens. 2.2. management the animals were housed in individual pens constructed from heavy steel rails with feed and water troughs. they were vaccinated against prevalent diseases(camel pox and haemorrhagic septicemia) and treated against external and internal parasites. the animals were weighed and allocated at random to the pens. they were weighed at the beginning of the experiment and then weekly to the end of the experiment. the animals were fed sorghum stover ad libitum in two equal meals at 8.00 am and 4.00 pm and each animal was offered daily 2.0 kg concentrates. the ingredients and composition of the concentrates are shown in table 1. clean drinking water was offered ad libitum. the animals were fed the experimental rations for a two weeks preliminary period before the experiment commenced and then fattened for eight weeks. table-1.the ingredients of the concentrates mix fed to butana male camels in gadarif, gadarif state, sudan. ingredients percentages sorghum grain 50 wheat bran 40 ground nut cake 08 oyster shell 01 salt 01 cp 17 me(mj/kg dm) 11 2.3. measurements 2.3.1. carcass characteristics and body components at the end of the fattening period the animals were transported by truck to gadarif modern abattoir in el rawashda area, about 20 km from the experimental site. they were fasted overnight (14 hours before slaughter) and weighed. they were slaughtered for the purpose of the animal review, 2014, 1(2): 17-25 20 © 2014 conscientia beam. all rights reserved. research according to islamic rituals under veterinary inspection. there were no any pathological lesions detected at abattoir. blood was collected and weighed and neck and feet were removed and weighed. the animals were then skinned and eviscerated. the carcasses were then hanged, opened and body components were removed and weighed separately. each part of the gastro intestinal tract was weighed full and empty and the gut content was calculated. the empty body weight (ebw) was calculated by difference between animals live body weight and gut contents weight. body components were calculated as percentages of ebw. dressing percentage was calculated on lbw and ebw. 2.4. statistical analysis the means and se or sd were calculated and the data was analyzed by analysis of variance for a completely randomized design using spss program. the means were compared using least significant difference (lsd). 3. results 3.1. carcass characteristics the effects of age at fattening on carcass characteristics are shown in table 2. slaughter weight, ebw and hot carcass weight increased with the increased age at fattening. they were significantly (p< 0.05) lighter at 2 years old and not significantly different between 3 and 4 years old. dressing percentages on lbw and ebw increased with increasing the age at fattening and were higher on ebw than lbw. they were significantly different between 2 and 4 years old. they were significantly different between 3 and 4 years old on ebw. table-2.carcass characteristics of male butana camels fattened at different ages in gadarif state, sudan. age (years) 2 3 4 s.e c.v% parameters 15.3 17.81 356.00±32.50c 329.00±34.97bc 246.5±35.30a slaughter weight (kg) 9.8 14.3 298.85±36.03c 284.38±26.20bc 211.28±28.94 a ebw (kg) 13.3 11.56 172.81±14.75c 157.19±13.57bc 115.40±17.22 a hot carcass weight (kg) 6.7 2.39 48.47c 47.66abc 46.73a dressing %: lbw 5.3 2.25 57.52c 55.00ab 54.21a dressing %: ebw ebw=empty body weight. means with the same letter within a row were not significantly different at p ≥ 0.05. different letters within a row denote significant differences at p ≤ 0.05. s.e = standard error 3.2. body components table 3 shows mean body components weight in male butana camels fattened at different ages. animal review, 2014, 1(2): 17-25 21 © 2014 conscientia beam. all rights reserved. all body components weight increased with age at fattening, except lungs, heart and spleen. mean weights of blood, head, liver, stomach and intestines were significantly (p< 0.05) higher at 4 years than at 2 years old, but not significantly (p> 0.05) different between 3 and 4 years old. hide, fore legs and hind legs weights were significantly (p< 0.05) heavier at 3 and 4 years old than at 2 years old. lungs weight increased up to 3 years and then declined. table 4 shows that all body components weight as percentage of ebw were increased with age, except lungs, spleen, kidneys and heart. all body components weight as percentage of ebw were generally least at 2 years, except heart which was least at 3 years old. there were no significant differences in body components as percentage of ebw in male butana camels fattened at different ages table-3.body components weights (kg) in male butana camels fattened at different ages in gadarif state, sudan. age (years) 2 3 4 s.e c.v% parameters 4.4 0.36 7.45±1.17bc 6.54± 2.01ab 5.04± 1.45a blood 17.6 0.77 10.93± 1.08bc 9.36±1.66ab 7.83±0.84a head 18.5 1.25 17.35± 2.42c 16.15± 1.79bc 12.13± 0.49a hide 24.7 0.74 7.10± 0.91c 6.83± 0.90bc 4.83± 0.45a forelegs 20.4 0.36 5.43± 0.69c 4.90± 0.52bc 4.00± 0.18a hind legs 16.2 0.19 2.06± 0.31cd 2.13± 0.25bd 1.69±0.24ac lungs 37.7 0.31 1.00± 0.41a 1.10± 0.43a 1.10±0.43a heart 25.6 0.46 3.31± 0.55a 3.25± 0.25a 2.31±0.69a diaphragm 27.2 0.67 4.81± 0.77bc 4.38± 1.33ac 3.19±0.63a liver 25.6 0..0 0.270± 0.002a 0.240± 0.01a 0.380±0.39a spleen 24.5 0.25 1.060± 0.18 cd 1.109± 0.08 bd 0.811± 0.13 ac kidneys 26.7 0.00 0.840± 0.19a 0.690± 0.24a 0.560±0.35a renal fat 43.2 1.45 7.38± 3.15a 5.50±1.37abc 3.80±0.94c stomach 21.6 1.07 11.36± 0.89bc 10.19± 1.34ac 8.53±1.28a intestines 25.4 0.01 0.55± 0.1b 0.50± 0.01b 0.33±0.01a tail means with the same letter within a row were not significantly different at p ≥ 0.05. different letters within a row denote significant differences at p ≤ 0.05. s.e = standard error. table-4.body components (% of empty body weight) in male butana camels fattened at different ages in gadarif state, sudan. age ( years ) parameters 4 3 2 2.47±0.18a 2.29±0.15a 2.43±0.32a blood 3.61±0.14ab 3.64±0.17ab 3.78±0.21a head 5.71±1.63a 6.05±1.10ab 5.92±0.36a hide 0.68±0.007a 0.75±0.007a 0.82±0.012ab lungs 0.33±0.20a 0.37±0.20a 0.50±0.20ab heart 1.58±0.80a 1.52±0.80a 1.53±0.80a liver 2.33±0.33a 2.41±0.33a 2.33±0.33a fore legs 1.78±0.17a 1.72±0.17a 1.94±0.17a hind legs 0.62±0.40a 0.63±0.40a 0.65±0.40a kidneys continue animal review, 2014, 1(2): 17-25 22 © 2014 conscientia beam. all rights reserved. 0.18±0.11b 0.17±0.11a 0.15±0.11a tail 0.36±0.12a 0.35±0.12a 0.33±0.12a spleen 1.09±0.0a 1.05±0.91a 1.11±0.17a diaphragm 2.38±0.46a 1.95±0.55a 1.86±0.62a stomach 0.21±0.06a 0.22±0.06a 0.23±0.07a renal fat 3.78±0.07a 3.60±0.30a 3.84±0.16a intestines 3.50±0.19a 3.63±0.19a 2.75±0.19 a hump means with the same letters within a row were not significantly different at p ≥ 0.05. different letters within a row denote significant differences at p ≤ 0.05. 4. discussion 4.1. slaughter weight and carcass characteristics the increased slaughter weight with increasing age at fattening in male butana camels was mainly due to increased initial and final body weights, feed intake and weight gain with increasing the age at fattening in this study and proportional growth [17]. similar results were found by abouheif, et al. [18]. male butana camels slaughter weight was within the range for camels fattened on molasses or sorghum grain based diets in sudan [19] and lower than in darfur (426.2kg) [20]. male butana camels weight at two years old was lower than at 21 months [21] and sudanese camels at 24 months old [22]. the increased hot carcass weight with increasing age at slaughter in male butana camels was mainly due to increased initial and final body weights, feed intake, weight gain and slaughter weight with increasing the age at fattening in this study and proportional growth [17]. similar results were found by adamou [23]. in addition abouheif, et al. [18] found that hot and cold carcasses were increased with increasing the slaughter age. male butana camels carcass weight was lower than sudanese camels in darfur [20], wilson [16] and values reported by yousif and babiker [14]. it was also lower than ethiopian camels [24]. the increased dressing percentages with increasing slaughter age in male butana camels were mainly due to increased bw, slaughter weight and carcass weight with age. it was reported that dressing percentages were affected by many factors including breed, nutrition and age [13, 25]. male butana camels dressing percentages were within the 54.4257.82% for sudanese camels fed sorghum grains or molasses based diets ad lib [19]. dressing percentages on ebw were close to the 55.9% on hot carcasses in sudanese camels [26] and the 46.2 – 55.6 and 41.3 – 53.5 % in males and females, respectively [16]. they were also close to the 54% in ethiopian male camels [24]. male butana camels dressing percentages were within the 52.1% for majaheem and 56.1% for hamra in saudi camels [27]. male butana camels dressing percentages were higher than that reported by [28] and adamou [23] and lower than in darfur (49 %) [20]. 4.2. body components the generally increased body components weight with age at fattening in male butana camels was mainly due to increased body weight and slaughter weight with age at fattening and proportional animal growth [17]. similarly age affected body components development beside breed and nutrition [29]. male butana camels body components weight as percentages of ebw animal review, 2014, 1(2): 17-25 23 © 2014 conscientia beam. all rights reserved. were generally close to those in dromedary camel in sudan [19]. male butana camels heart, liver and lungs weights were lower than nigerian camels [30]. the nonsignificant differences in body components percentages on ebw among male butana camel age groups were mainly due to proportional animals growth stated by hammond [17]. similar results were found in sudanese camels fattened with sorghum grains and molasses based diets [19]. male butanacamels body components percentages on ebw were higher for the head and lower for the liver and hide than values reported by yousif and babiker [14]. 5. conclusion slaughter weight, ebw, hot carcass weight and dressing percentages increased with age at fattening. all body components weight increased with age at fattening, except lungs, heart and spleen. all body components weight as percentage of ebw increased with age at fattening, except lungs, spleen, kidneys and heart with no significant differences. references [1] aoad, arab agricultural statistics book 3. khartoum, sudan: arab organization for agricultural development, 2011. [2] fao, quarterly bulletin of statistic. un, rome, italy: food and agriculture organization, 2009. [3] a. e. m. darosa, "studies on some camel production traits, and health in butana area sudan," ph. d. thesis, university of khartoum, sudan, 2005. [4] i. l. mason, "origin, history and distribution of domestic camels," presented at the paper presented foundation for science, provisional report no. 6, 1979. [5] e. o. c. albert, "the past, present and future extension on camel production in kenya," presented at the paper presented at the 8th kenya camel forum, 11–15 march, 2002, mile 46, kajiado, kenya, 2002. [6] z. t. farah, r. rellenmayer, and d. atkins, "vitamin a content of camel milk," int. j. vitamin nut. res., vol. 62, pp. 30-33, 1992. [7] r. wilson, productivity. in: the camel. essex, uk: longman, house burnt mill, harlow, 1984. [8] m. r. shalash, utilization of camel meat and milk in human nourishment. in: workshop on camels. khartoum, ifs, 1979. [9] g. williamson and w. j. a. payne, an introduction to camel husbandry in the tropics, 3rd ed. london: longmans, 1978. [10] b. idriss, marketing of camels in the sudan. sudan: ifs symposium, 2003. [11] m. s. ali, "some husbandry aspects of camels in the butana area in eastern sudan," m. sc thesis, university of khartoum, sudan, 2002. [12] h. m. h. asma, "utilization of upgraded straws of sorghum pearl, millet and sesame by nubian goat in the sudan," ph. d. thesis, university of gezira, wad medani, sudan, 2007. [13] m. a. ali, "the performance of desert sheep in kordofan, sudan," ph. d thesis, faculty of agricultural sciences, university of gezira, wad medani, sudan, 2003. animal review, 2014, 1(2): 17-25 24 © 2014 conscientia beam. all rights reserved. [14] o. k. yousif and s. a. babiker, "the desert camel as a meat animal," meat science, vol. 26, pp. 245254, 1989. [15] i. t. kadim, o. mahgoub, and r. w. purchas, "a review of the growth and carcass and meat quality characteristics of the onehumped camel (camelus dromedarius)," meat science, vol. 80, pp. 555-569, 2008. [16] r. t. wilson, "studies on the livestock of southern darfur, sudan. v. notes on camels," tropical animal health and production, vol. 10, pp. 19-25, 1978. [17] j. hammond, general principles metabolism and growth. london: oliver and boyd, 1983. [18] m. a. abouheif, s. m. basmaeil, and m. n. bakkar, "a standard method for jointing camel carcasses with reference to the effect of slaughter age on carcass characteristics in najdi camels. i. wholesale cut weight," ajas, vol. 3, pp. 97-102, 1990. [19] e. i. eltahir, a. m. mohamed, o. a. elkhidir, and m. atta, "feedlot performance and carcass characteristics of sudan dromedary camels (camelus dromedarius) fed on molasses and sorghum grain based diets," journal of camelid science, vol. 4, pp. 70-78, 2011. [20] o. bremaud, notes on camel production in the northern districts of the republic of kenya. institut d'elevage et de medicine vet. des pays trop., maisonalfort: paris – france, 1969. [21] m. salehi, g. zakheri, n. taherpour dari, h. r. ansari renani, b. lotfiilah nia, and a. eghbaleh, "evaluation of iranian native goats skin for grading and sorting. animal science research institute," agricultural and natural resources research organization. ministry of agriculture, iran, 2010. [22] y. a. el-badawi and m. h. m. yacout, "comparative study on growth performance of camel (camelus dromedarius) calves and cattle steers in the feedlot system," proceedings of the 7th science conference on animal nutrition ( ruminant, poultry and fish). 19-21 october 1999, elarish, egypt. part 1, egyptian journal of nutrition and feeds, 1999, pp. 319-330. [23] a. adamou, "comparison of carcass yield in two algerian camel populations: the targui and the sahroui," presented at the the 3rd isocard international conference, sultan qaboos university, college of agricultural and marine sciences, 2012. [24] m. y. kurtu, "an assessment of the productivity for meat and carcass yield of camel (camelus dromedarius) and the consumption of camel meat in the eastern region of ethiopia," tropical animal health and production, vol. 36, pp. 65-76, 2004. [25] e. s. gaili, y. s. ghanem, and a. m. mukhtar, "a comparative study of some carcass characteristics of sudan desert sheep and goats," anim. prod., vol. 14, pp. 351 – 357, 1972. [26] s. a. babiker and d. k. h. yousif, "chemical composition and quality of camel meat," meat science, vol. 27, pp. 283-287, 1989. [27] e. a. el-gasim and g. a. el-hag, "carcass characteristics of the arabian camel," camel newsletter, vol. 9, pp. 20-24, 1992. [28] s. a. babiker and i. m. tibin, "a note on desert camel meat production and characteristics," proceedings of the international symposium on the development of animal resources in the sudan, 1989, pp. 116-120. animal review, 2014, 1(2): 17-25 25 © 2014 conscientia beam. all rights reserved. [29] j. b. owen and g. a. norman, "studies on the meat producing characteristics of botswana goat and sheep. part 111. general body composition, carcass measurements and joint composition," meat sci., vol. 1, pp. 283–306, 1977. [30] b. f. muhammad and i. n. akpan, "camel (camelus dromedarius) meat utilization in kanonigeria. (ii):post-slaughter handling and marketing wholesale meat cuts," research journal in animal science, vol. 2, pp. 113-117, 2008. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 57 † corresponding author © 2014 conscientia beam. all rights reserved. studies on seasonal performance of newly developed bivoltine silkworm (bombyx mori l) hybrids tolerant to bmnpv and effect of temperature on disease induction l.vijaya lakshmi1† --v. sivaprasad2 --p. sujathamma3 1,3sri padmavathi mahila viswa vidyalayam, tirupathi, andhra pradesh, india 2central sericulture research and training institute, mysore, karnataka, india abstract season and region specific studies of silkworm bombyx mori l. are of greater importance in identifying and understanding the adaptability of silkworm genotypes, which are largely influenced by climatic factors. the performance of the newly developed hybrid combinations was evaluated for twelve economic traits during pre-monsoon, monsoon and post-monsoon seasons of the year to understand genotype and environment interactions and their stability under fluctuating tropical environmental conditions with bombyx mori nuclear polyhedro virus (bmnpv) inoculation @ 2x106 pib’s/larva. the data was subjected to two way analysis of variance and season-wise relative merit of individual hybrids was computed following multiple trait evaluation index method. the index values indicated that the hybrids bnr9 x bnr10 and bnr9 x bnr4 with higher average cumulative ei values were ranked i and ii and establishing their superiority over multiple traits. further the larvae soon after fourth moult were kept at room temperature (25ºc), low temperature (5ºc) and high temperature (32ºc) without feed for 6 hours and then inoculated perorally with bmnpv. the newly ecdysed fifth instar larvae when exposed to low temperature of 5ºc and starved enhanced larval susceptibility to bmnpv while the hybrids bnr9 x bnr10 and bnr9 x bnr4 exhibited higher tolerance to bmnpv at 25ºc and moderate tolerance at 32ºc. keywords: silkworm, bombyx mori nuclear polyhedro virus (bmnpv), seasonal performance, tropical environment, temperature effect, disease induction. contribution/ originality this study documents the evaluation of silkworm hybrids under bmnpv inoculated conditions during different seasons of the year. the methodology includes the estimation of the tolerance of the hybrids to bmnpv during various seasons influencing the physiological activities affecting their growth and development as well as the expression of economic characters. animal review 2014 vol. 1, no. 4, pp. 57-64 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(4): 57-64 58 © 2014 conscientia beam. all rights reserved. 1. introduction silkworm is one of the most important domesticated insects where the growth and development is greatly influenced by environmental conditions. success of silkworm breeds/hybrids largely depends on their adaptability to the environment in which it is destined to be reared. the biological as well as cocoon-related characters are influenced by ambient temperature, rearing seasons, quality mulberry leaf, and genetic constitution of silkworm strains. it is a well-established fact that under tropical conditions, unlike polyvoltines, bivoltines are more vulnerable to various stress like hot climatic conditions of tropics, poor leaf quality, and improper management of silkworm crop during summer that is not conducive for bivoltine rearing for technologically and economically poor farmers of india [1-3]. though the nature of silkworm healthiness is unclear, healthy silkworm varieties are important for the stabilization of silkworm crops. the use of commercial silkworm hybrids resistant to important silkworm diseases is economical and better option particularly in tropical areas. due to fluctuating climatic conditions, inadequate silkworm disease management practices and poor quality mulberry leaf, frequent crop losses are witnessed especially due to grasserie disease with the farmers in tropical areas. as epidemic of the viral diseases in silkworm is observed to have close link with climatic factors such as temperature, humidity, air current, food and the environment, to which the insect is exposed also plays an important role in the manifestation of resistance. the rate of disease induction is perhaps controlled by the host’s developmental stage, particularly moulting period [4], indicating that physiological changes in silkworms may also play an important role in the induction of viral diseases. tropical sericulture beset with wide and sudden fluctuations in the environment coupled with poor quality of mulberry and management practices by the farmers requires more flexible hybrids with genetic plasticity to buffer these adverse situations. the productive commercial hybrids presently used by farmers are susceptible to grasserie disease and it is felt that there is an urgent need to develop bivoltine silkworm hybrids resistant to these conditions with increased productivity. most of the small and marginal farmers in india are unable to practice complete disease management practices due to their socio-economic conditions where these breeds are better option and equipped to survive. in view of the above the present study was carried out at andhra pradesh state sericulture research institute, hindupur to evaluate the performance of newly developed bivoltine silkworm hybrids in various seasons under bmnpv inoculated conditions to identify the most promising combinations for commercial use. 2. materials and methods the performance of ten new hybrid combinations viz., bnr1 x bnr2, bnr1 x bnr6, bnr3 x bnr6, bnr3 x bnr8, bnr5 x bnr6, bnr7 x bnr2, bnr7 x bnr6, bnr9 x bnr4, bnr9 x bnr8 and bnr9 x bnr10 were evaluated under bmnpv inoculated conditions in three seasons namely, pre-monsoon, monsoon and post-monsoon season were evaluated in three seasons namely, pre-monsoon (february may), monsoon (june october) and post-monsoon (november january) seasons along with the existing bivoltine hybrids viz., aps45 x aps12 and csr2 x csr4 as controls. all the hybrids, their parents along with control breeds and hybrids animal review, 2014, 1(4): 57-64 59 © 2014 conscientia beam. all rights reserved. were reared under inoculated conditions with bmnpv polyhedra @ 2 x 106 pib’s /ml in each season with three replications of 300 larvae per replication after 3rd moult. the larvae were fed with v1 mulberry leaf. the rearings were carried out in randomized block design and data for twelve traits namely, fecundity, yield per 10,000 larvae by number, yield per 10,000 larvae by weight, survival rate, cocoon weight, cocoon shell weight, cocoon shell ratio and filament length, non-breakable filament length, raw silk percentage, denier and neatness was analysed using two way analysis of variance [5] for three seasons separately to find out genotype-environment interaction. the merit of the individual hybrids and their relative superiority was computed following the multiple trait evaluation index [6]. the combination which recorded highest average cumulative evaluation index value was assigned 1st rank and subsequent ranks were assigned for the combinations in descending order. effect of temperature on induction of disease in hybrids was studied by exposing inoculated larvae to low temperature (50c), room temperature (250c) and high temperature (320c) for 6 hours on first day of fifth instar within 2 hours of out of fourth moult. ten hybrid combinations along with controls with 25 basic number of larvae in three replications were inoculated with bmnpv polyhedra @ 20,000 pibs/ml (0.25ml/25 larvae). after 6 hours all the larvae were kept back at room temperature (250c) and reared under normal conditions. the rate of viral multiplication at different temperatures and mortality due to bmnpv was recorded up to pupal stage and the data was subjected to statistical analysis of variance. 3. results the data on mean of three seasons pertaining to twelve economic traits of the ten hybrids viz., bnr9 x bnr4, bnr1 x bnr6, bnr3 x bnr8, bnr9 x bnr10, bnr5 x bnr6, bnr7 x bnr2, bnr1 x bnr2, bnr9 x bnr8, bnr7 x bnr6 and bnr3 x bnr6 with control hybrids, aps45 x aps12 and csr2 x csr4 under bmnpv inoculated conditions are presented in table 1. analysis of variance results for hybrids are depicted in table 2 and evaluation index values for each of twelve traits are presented in table 3. the data related to the effect of temperature on disease induction is depicted in table 4. fecundity (no.): the overall performance for the trait over the three seasons revealed that bnr9 x bnr4 and bnr5 x bnr6 recorded the maximum (505) and minimum (467) eggs/laying with an average of 484 eggs/laying.cocoon yield per 10,000 larvae by number: the overall performance of the hybrids for cocoon yield per 10,000 larvae by number indicate that maximum (8787) and minimum (8196) cocoon yield was recorded for bnr9 x bnr7 and bnr1 x bnr2 respectively. cocoon yield per 10,000 larvae by weight (kg): comparison of the newly evolved hybrids for overall performance indicate that maximum (16.98 kg) and minimum (13.79 kg) cocoon yield was recorded for bnr9 x bnr10 and bnr1 x bnr2 respectively. survival rate (%): considering the overall performance over the three seasons, bnr9 x bnr10 recorded the maximum (85.20 %) value followed by bnr9 x bnr4 (83.89 %) and bnr7 x bnr2 (83.79 %).cocoon weight (g): comparison of the newly evolved hybrids over the three seasons indicate that maximum (1.812 g) and minimum (1.560 g) values were recorded for bnr9 x bnr10 and bnr1 x bnr2 respectively. cocoon shell weight (g): the overall performance of the animal review, 2014, 1(4): 57-64 60 © 2014 conscientia beam. all rights reserved. hybrids over three seasons together revealed that bnr9 x bnr10 and bnr3 x bnr6 recorded the maximum (0.404 g) and minimum (0.333 g) values respectively. cocoon shell ratio (%): the overall performance of the hybrids for the trait indicate that bnr9 x bnr10 and bnr3 x bnr6 recorded the maximum (22.30 %) and minimum (21.06 %) values respectively. filament length (m): comparison of the newly evolved hybrids over the three seasons of the year expressed maximum (977 m) and minimum (806 m) values for bnr9 x bnr10 and bnr3 x bnr6 respectively. non-breakable filament length (m): comparison of the newly evolved hybrids over the three seasons of the year revealed maximum (866 m) and minimum (694 m) values for bnr9 x bnr10 and bnr3 x bnr6 and bnr5 x bnr6 respectively. raw silk percentage (%): considering the overall performance over the three seasons, bnr9 x bnr10 recorded the maximum (18.09 %) value followed by bnr7 x bnr6 (17.19 %) and bnr3 x bnr8 (16.88 %) denier (d): the overall performance of the hybrids over three seasons together revealed that bnr7 x bnr6 and bnr7 x bnr6 recorded maximum (2.39) and minimum (2.31) values respectively. neatness (p): the overall performance of the hybrids for the trait neatness indicate that bnr7 x bnr2 and bnr1 x bnr6 recorded maximum (93 p) and minimum (90 p) values respectively. table-1. mean performance of hybrid combinations values represent mean of 3 seasons avg = average, s.d = standard deviation, s.e = standard error, c.v = coefficient of variation table-2. analysis of variance of hybrid combinations values represent mean of 3 seasons df = degree of freedom; * significant (p< 0.05); ** significant (p< 0.01) the overall mean performance of the hybrids reveals that bnr9 x bnr10 and bnr9 x bnr4 animal review, 2014, 1(4): 57-64 61 © 2014 conscientia beam. all rights reserved. recorded higher performance. the anova evaluated for the hybrids revealed highly significant differences (p<0.01) between hybrids, seasons and season x hybrid interactions and nonsignificant interaction between season x hybrid in neatness. evaluation index: the relative merit as represented by average cumulative index value recorded for the overall performance of the hybrids and presented in descending order showed that highest ei value for bnr9 x bnr10 (61.33) followed by bnr9 x bnr4 (567.48), bnr7 x bnr6 (56.13), bnr7 x bnr2 (52.88), bnr3 x bnr8 (52.87), bnr3 x bnr6 (50.63), and bnr1 x bnr6 (50.28) indicate their economic superiority over others including control hybrids aps45 x aps12 and csr2 x csr4 which recorded average cumulative index values of 41.13 and 31.10 respectively over twelve multiple traits evaluated. table-3. evaluation index of hybrids avg. ei= average evaluation index effect of temperature on disease induction: the pupation rate was observed 0.00 % when the bmnpv inoculated larvae exposed to 50c. the larvae when exposed to 250c highest pupation rate was observed in bnr9 x bnr10 (88.00 %) followed by bnr7 x bnr6 (86.67 %) and bnr9 x bnr4 (85.33 %). the larvae when exposed to high temperature (320c) highest pupation rate was observed in bnr9 x bnr10 (54.67 %) followed by bnr7 x bnr6 (52.00 %) and bnr9 x bnr4 (50.67 %). the analysis of variance results indicate highly significant (p<0.01) values for pupation. table-4. effect of temperature on disease induction in hybrids values represent mean of three replications animal review, 2014, 1(4): 57-64 62 © 2014 conscientia beam. all rights reserved. 4. discussion success of silkworm breeds/hybrids depends largely on their adaptability to the environment in which it is destined to be reared as opined by sato [7]. it is clear from the results, that under bmnpv inoculated conditions the survival rate and cocoon characters of newly evolved hybrids are significantly superior to that of controls during different seasons of the year. the peer analysis of the data on the performance of hybrids in pre-monsoon, monsoon and post-monsoon seasons of the year revealed maximum expression of economic traits during favourable postmonsoon season followed by monsoon and pre-monsoon season. these findings corroborate with [8-19]. however, the performance of the hybrids during three different seasons revealed marginal differences in the expression of economic traits. the higher survival rate and quantitative traits under bmnpv inoculated conditions were noticed in the newly evolved hybrids even during unfavourable months. the higher cocoon weight observed in the new hybrids, which is positively co-related with the cocoon yield indicates higher productivity under diversified environmental and bmnpv inoculated conditions reflecting their overall superiority and cocoon crop stability. the overall mean performance of the hybrids reveals that bnr9 x bnr10 and bnr9 x bnr4 recorded higher performance. the anova evaluated for the hybrids revealed highly significant differences (p<0.01) between hybrids, seasons and season x hybrid interactions and non-significant interaction between season x hybrid in neatness. further the evaluation index also confirmed the superiority of bnr9 x bnr10 (61.33) and bnr9 x bnr4 (57.48). extensive work has been done on the induction of viral diseases. among them, the important physical agents, which induce diseases in silkworms, are temperature and pathogenic virulence. temperature is the most important external physical factor for both silkworm susceptibility and multiplication of viruses in the host. most silkworm varieties have been adapted to rearing at 250c, which is most suitable for their development. accordingly, temperatures much higher or lower then 250c tend to act as a stress and increase the larval susceptibility to viral infections [4]. exposure of silkworm larvae to low temperature (50c) before peroral infection with npv enhanced susceptibility to each virus [20]. many workers were also successful in inducing npv with cold treatment soon after the ecdysis of iv instar [21]. however, in an experiment the virus concentration below 103 particles/ml injected into v instar larvae at 25ºc went hidden (occult) but were reactivated by cold treatment [22]. it has also been observed that the incidence of nuclear polyhedro virus (npv) was higher in sudden changes from room temperature to low temperature, i.e., 5ºc than in gradual changes [23, 24]. the results of the present study on disease induction corroborates with the above findings showing that the newly ecdysed fifth instar larvae when exposed to low temperature of 5ºc and starved enhanced larval susceptibility to bmnpv. environmental factor such as low temperature would activate the latent virus and once the occult virus reaches the infective state, the virus multiplication proceeds, in the same manner as in the case of normal/natural infections [25]. changes in the resistance to the infection with npv was investigated by subjecting 4th an 5th instar larvae to low temperature (50 and 10°c) and high temperature (330, 350 and 37°c) treatments for various periods of time animal review, 2014, 1(4): 57-64 63 © 2014 conscientia beam. all rights reserved. immediately after ecdysis [26]. in this study, the larvae when exposed to 250c highest pupation rate was observed in bnr9 x bnr10 (88.00 %) followed by bnr7 x bnr6 (86.67 %) and bnr9 x bnr4 (85.33 %) exhibiting higher level of tolerance at optimum temperature. the larvae when exposed to high temperature (320c) highest pupation rate was observed in bnr9 x bnr10 (54.67 %) followed by bnr7 x bnr6 (52.00 %) and bnr9 x bnr4 (50.67 %) expressing moderate tolerance showing that increase in temperature will decrease tolerance to bmnpv. based on the mean, index values, stability parameters and temperature effect on disease induction the newly evolved hybrids bnr9 × bnr10 and bnr9 × bnr4 tolerant to bombyx mori nuclear polyhedro virus (bmnpv) performed well for most of the characters and found suitable to rear throughout the year were recommended for commercial exploitation under tropical environmental conditions of andhra pradesh. references [1] n. suresh kumar, t. yamamoto, h. k. basavaraja, and r. k. datta, "studies on the effect of high temperature on f1 hybrids between polyvoltine and bivoltine silkworm races of bombyx mori l," international journal of industrial entomology, vol. 2, pp. 123–127, 2001. [2] h. lakshmi and chandrashekharaiah, "identification of breeding resource material for the development of thermo-tolerant breeds of silkworm, bombyx mori l," j. exp. zool., india, vol. 10, pp. 55 – 63, 2007. [3] n. a. r. begum, h. k. basavaraja, p. g. joge, and a. k. palit, "evaluation and identification of promising bivoltine breeds in the silkworm, bombyx mori l," international journal of industrial entomology, vol. 16, pp. 15–20, 2008. [4] h. aruga, n. yoshitake, and m. owada, "factors affecting the infection per os in the in the cytoplasmic polyhedrosis of the silkworm, bombyx mori l," j. sericult. sci., vol. 32, pp. 41-50, 1963. [5] o. kempthorne, the design and analysis of experiments. new york: john wiley & sons, inc, 1952. [6] y. mano, s. nirmal kumar, h. k. basavaraja, n. mal reddy, and r. k. datta, "a new method to select promising silkworm breeds/combinations," indian silk, vol. 31, p. 53, 1993. [7] s. sato, "adaptability in cocoon yield of useful hybrids in the silkworm, bombyx mori l," jidp, vol. 12, pp. 121-129, 1975. [8] j. jaroonchi, "batch selection of thai polyvoltine silkworm races 15th and 15 ky," bull. thai. seric. res. trg. cent., vol. 2, pp. 56-58, 1972. [9] m. n. narasimhanna, "contribution to the genetics of silkworm," ph.d. thesis, university of mysore, mysore, 1976. [10] g. subramanya, "eco-genetic approach for determination of high yielding breeds of silkworm, bombyx mori l," ph.d. thesis, university of mysore, mysore, 1985. [11] p. j. raju, "studies on the hybridization and synthesis of new breeds of silkworm, bombyx mori l," ph.d. thesis, university of mysore, mysore, 1990. [12] v. g. maribashetty, "evolution of superior bivoltine races of silkworm bombyx mori l. for tropics," ph.d thesis, university of mysore, mysore, 1991. animal review, 2014, 1(4): 57-64 64 © 2014 conscientia beam. all rights reserved. [13] g. v. kalpana, "breeding of superior races of silkworm, bombyx mori l. for tropical climates," ph.d. thesis, university of mysore, mysore, 1992. [14] h. k. basavaraja, "studies on the synthesis of productive bivoltine strains of bombyx mori l. through hybridization, selection and genetic evaluation," ph.d. thesis, university of mysore, mysore, 1996. [15] r. mahadevappa, "evolution of superior bivoltine races for tropical conditions," ph.d. thesis, bangalore university, bangalore, india, 2006. [16] d. guruswamy, "breeding of promising races of silkworm bombyx mori l. and identification of suitable hybrids for rainfed area in karnataka," ph.d thesis, bangalore university, bangalore, india, 2006. [17] h. lakshmi, m. ramesh babu, a. k. saha, chandrashekharaiah, and b. b. bindroo, "studies on the season wise evaluation of productive bivoltine silkworm (bombyx mori l) hybrids in tropical conditions," international journal of integrative sciences, innovation and technology, vol. 1, pp. 2030, 2012. [18] p. sudhakara rao, r. singh, g. v. kalpana, v. nishitha naik, h. k. basavaraja, and g. n. ramaswamy, "evaluation and identification of promising bivoltine hybrids of silkworm, bombyx mori l. for tropics," int. j. indust. entomol., vol. 3, pp. 31-35, 2001b. [19] m. ramesh babu, h. lakshmi, j. prasad, j. seetha ramulu, chandrashekharaiah, and a. k. goel, "evaluation and selection of potential bivoltine parents for silkworm (bombyx mori l.) breeding," indian j. seric., vol. 44, pp. 82-91, 2005a. [20] y. abe and c. ayuzawa, "susceptibility of larval tissues in the silkworm, bombyx mori l., to the nuclear polyhedrosis virus. i. changes of the susceptibility to the virus of mid-gut epithelial cells in the silkworm larvae treated with low temperature," j. sericult. sci., vol. 43, pp. 200-205, 1974. [21] h. aruga, "mechanism of resistance to virus diseases in the silkworm, bombyx mori. (ii) on the relation between the nuclear polyhedrosis and the cytoplasmic polyhedrosis," j. sericult. sci., vol. 26, pp. 279-283, 1957. [22] m. himeno, f. matsubara, and k. hayashiya, "the occult virus of nuclear polyhedrosis of the silkworm larvae," j. invertebr. pathol., vol. 17, p. 292, 1973. [23] ishimori, "on the relationship between the occurrence of grasserie and the temperature limit and the route of infection in the silkworm, bombyx mori l," j. seric. sci., vol. 20, pp. 51-52, 1951. [24] s. suzuki and t. hayashita, "survival curve of viruses infected in the 5th instar," j.seric. sci., vol. 24, p. 206, 1955. [25] e. a. steinhaus, principles of insect pathology. london: mcgraw hill books co., inc, 1949. [26] f. matsubara, y. go, h. mori, and h. oogashira, "changes in the resistance to the infection with npv induced by low and high temperature treatment in the germ-free silkworm, bombyx mori," journal of sericultural science of japan, vol. 53, pp. 538-542, 1984. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 76 † corresponding author © 2015 conscientia beam. all rights reserved. chemical analysis of acacia ehrenbergiana (salam) tree fruits (seed and pods) as dry season supplement for livestock in arid and semi –arid lands of sudan mohamed s .a abdalla1 --izeldin a. babiker2† --kamal f. elkalifa3 1organic farming project, giz, riyadh saudi arabia 2department of animal production, faculty of agriculture, university of zalingei, sudan 3department of silviculture , faculty of forestry, university of khartoum, shambat sudan abstract in developing countries farming and livestock keeping are the most dominant activities for the indigenous people, proper farming maintain good and adequate grazing for livestock and hence support livelihood in such countries. therefore, local inhabitants largely depend on some tree species suitable for grazing purposes. in the present study, the nutritional value for fruits of acacia ehrenbergiana (salam) (seeds and pods) at the lower atbra river basin in north eastern part of sudan was investigated. field samples of fruits were collected, each sample kept separately in a small cloth kit. chemical analysis of fruit samples was conducted to quantify the content of various nutritional attributes including: the crude protein, crude fibers, fats, starch, ash, and moisture content. in addition to some minerals namely p, ca, mg, na, cur and fe. chemical analysis revealed that cp is found to be as high as 30.99%, cf reached 25.11%, the starch content 12.12%, fat 4.1%, and ash content 11.81% .these values showed the high nutritional values fruits. similarly mineral contents demonstrate good amounts of na and ca that needed by livestock for adequate growth, but lower amounts of p that should be supplemented to the diets. most tested browse fruits revealed adequate nutritional values of acacia ehrenbergiana (salam) fruits as a protein or dry season supplement. fodder trees still need to be fully evaluated in order to reduce the cost of feed . this can be done by being used as a feed supplement to livestock .increasing the base for feed options (forages) with high quality feed will support the ever increasing demand for livestock products ,as feed is the most important factor influencing livestock production in the harsh environment of the dry lands. keywords: fodder analysis, acacia, nutritional value. received: 24 march 2015/ revised: 28 april 2015/ accepted: 3 may 2015/ published: 9 may 2015 animal review 2015 vol. 2, no. 3, pp. 76-80 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.3/101.3.76.80 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.3/101.3.76.80 http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.3/101.3.76.80 animal review, 2015, 2(3): 76-80 77 © 2015 conscientia beam. all rights reserved. 1. introduction in the butana (central eastern sudan) the household economy is based on an agro-pastoralist system of production where both livestock (goats, sheep, cattle and camels) and crop production (sorghum) are practiced [1]. small holder livestock keepers in this part of sudan, rarely use conventional concentrate feeds in livestock production system as they are expensive. nonconventional feeds need to be considered for this sector and areas [2]. camel and goats depend largely on natural range lands for their feed requirements, a situation unlikely to change in the foreseeable future. tropical rangeland is endowed with flora that is rich in protein. most range lands in sudan are dominated by acacia species beside other fodder tree species. in the dry season period in sudan, livestock experience serious shortage of feed, which in turn causes pressure on the range lands, resulting in degradation. the nutritional inadequacy of the dry season grazing imposes a major constraint on sustainable livestock production under traditional systems where grazing constitutes the only source of feed for livestock. the non-availability of forage during the dry season affects sedentary livestock more, as they lack the advantage of mobility exercised in the transhumant and nomadic systems. the utilization of protein rich fodder trees as feed supplement can counter the seasonal shortage of good quality forage for livestock. acacia ehrenbergiana has a wide distribution range at present. it is an important legume fodder treefor indigenous populations (it is used to feed animals, such as goats, sheep and camels). it is a valued fodder (leaves, flowers and seed pods) for camels, sheep and goats in the sahelian regions, where it is pollarded in the dry season. the role of fodder trees and shrubs (acacia, cadaba, maeruaetc) as a dry season source of feed (pods, leaves and twigs) should not be under-estimated. they are particularly valuable in the semi-desert and low rainfall savanna zones. elbehairy [3] evaluated acacia ehrenbergiana as browse tree in southwestern saudi arabia and found cp value of 8.45% while digestible crude protein (dcp) reached 4.6%, 12.78 for the ash content , 2.26% ee, and 35.22% cf. mineral concentration reported by the same researcher showed 2.19% na, 1.38% k, 1.17% ca, 1.56 mg and 0.4 % p. he concluded that, the potential nutritive value of acacia ehrenbergiana when comparable to the other browsers is rich in most minerals. fadelelseed, et al. [4] studied the nutritive evaluation of some fodder tree species during the dry season in central sudan, he reported that, acacia ehrenbergiana may have potential value for supplementation of energy or protein better in early dry or wet season , it contains higher levels of crude protein at early period of the season , but decreased at the late period. mineral concentration of acacia ehrenbergiana was found to be of relatively higher ca content as reported by [4-6], but with extremely low p content. the objective of this study was to assess the chemical analysis and potential nutritive value of some selected species of acacia ehrenbergiana fruits (pods and seeds) in lower atbara river area, based on their chemical composition animal review, 2015, 2(3): 76-80 78 © 2015 conscientia beam. all rights reserved. 2. material and methods 2.1. samples collection acaciaehrenbergiana(salam)grown along the downstream of atbara riverbank, sudan, as the most desirable sites bygrazers, was examined. eleven random seeds and pods were manually colle cted from acacia ehrenbergiana(salam) trees at different positions on the adopted sites .the fruit was hand‐picked to eliminate damaged pieces fruits,. these were immediately weighed and stored in cloth bags. samples were identified and labeled with botanical and local names. 2.2. laboratory sample preparation fruit samples were sun dried and their moisture contents were calculated. the dry samples were ground, burned to ash and treated with hcl and hno3 acid in order to digest any residues of organic matter. the samples were filtered for chemical analysis [7]. 2.3. sample chemical analysis proximate analysis for chemical components; moisture, crude protein, crude fiber, ash, fat and starch were determined by using (nirs=near-infrared reflectance spectroscopy). 2.4. chemical composition of fruits of commonly grazed species in the study area fruits minerals were determined as for phosphorus (p), calcium (ca), sodium (na), potassium (k), magnesium (mg), iron (fe) and copper (cu) according to the methods described by naumann and bassler [8]. potassium and sodium were analyzed by flame-photometer (coring eel 100) while calcium, magnesium, iron and copper were determined by atomic absorption spectrophotometer (2380 perkin elmer) and phosphorus was determined by the spectrophotometer (sp 6-200 unican. 3. results and discussion the current proximate analysis at table (1) showed that, the nutritive attributes of acacia ehrenbergiana regarding cp content are as high as (30. 99%) than the values for cp contents of the shoots and leaves reported by elbehairy [3] and fadelelseed, et al. [4]. this is due to that, in this study the whole fruit (pods and seeds) was involved in the chemical analysis, but both of them is higher than protein content of the shoots and forage of the same fodder tree. again, walker [9] reported that the crude protein content of browse plants is generally considerably higher than that for the grasses at all times other than the early growing season. the crude fiber (cf) content in the present study (25.11%), is lower than values reported by el behairy [3] for the tree shoots as 35.22%, the difference is partly reasonable due to lower values of cell wall fraction in seeds which being included in the chemical analysis in this study. minerals content of acacia ehrenbergiana fruits shown on table (2) is consistent with what had been reported by [4-6] and slightly lower than those reported by elbehairy [3] as .it showed adequate ca http://www.iucnredlist.org/details/19892054/0 animal review, 2015, 2(3): 76-80 79 © 2015 conscientia beam. all rights reserved. concentration, but with extremely low p content.its strongly recommended to supplement using an appropriate amount of phosphorus. table-1. proximal composition of fruits of commonly grazed species in the study area nutrient % dm 90.32 fat 4.10 cp 30.99 starch 12.12 cf 25.11 ash 11.81 table-2. mineral composition of fruits of commonly grazed species in the study area mineral concentration ca 0.71 p 0.23 k 1.25 mg 0.26 na 1055 ppm fe 215ppm cu 15.25 ppm 4. conclusion fodder trees fruits (pods and seeds) provide a considerable part of animal demand for protein and macrominerals to overcome the negative impact of the dry season as shown in our findings. efficient utilization of the available feed resources is a key factor in livestock production that may improve livelihood of resource poor communities and increase opportunities for the provision of animal protein in the forms of meat and milk. cheap protein sources will be a prerequisite for viable and sustainable animal production in the dry lands of sudan. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] m. abdalla, i. babiker, j. al-brahim, a. mohammed, m. el-kordufani, and m. elobeid, "potential of prosopischilensis (molina) stuntz as a non-conventional animal feed in the dry lands of sudan," international journal of plant, animal and environmental sciences, vol. 4, pp. 673-676, 1997. [2] t. smith, e. owen, i. muellerhrvey, j. sikosana, and v. mlambo, "incresing the productivity of small holder owned goats through supplementation with terr fruits," in proceedings of the british society of animal science york, 2005, p. 33. animal review, 2015, 2(3): 76-80 80 © 2015 conscientia beam. all rights reserved. [3] m. a. h. elbehairy, "nutritive evaluation of two acacia populations in southeastern saudi arabia," j. app. sci. res., vol. 5, pp. 1030-1039, 2009. [4] a. m. fadelelseed, a. e. amin, k. a. abdel ati, j. sekine, m. hishinuma, and k. hmana, "nutritive evaluation of some fodder tree species during the dry season in central sudan," ausian aust j. anim. sci., vol. 15, pp. 844-850, 2002. [5] s. abdulrazak, a. fujihara, j. k. ondeik, and r. e. orskov, "nutritive value of some acacia tree leaves from kenya," anim. feed sci.technol., vol. 85, pp. 89-98, 2000. [6] a. a. aganga, t. adogla-bessa, u. j. omphile, and k. tshirelesto, "significance of browses in the nutrition of tswana goats," archivos de zootecnia, vol. 49, pp. 469-480, 2000. [7] j. b. jones, laboratory guide for conducting soil tests and plant analysis. florida: crc press llc, 2001. [8] c. naumann and r. bassler, "diechemische untersuchung von futtermittenbuch bd.iii, melsungen feedipedia (2014), fao." available http://www.feedipedia.org/node/12591. [accessed 01 may 2014], 1976. [9] b. h. walker, a review of browse and its role in livestock in africa. production in southern africa. in: le houerou, h. n. (ed). browse in africa. the current state of knowledge vol. 7. addis ababa: ilca, 1980. . views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://www.feedipedia.org/node/12591 1 © 2022 conscientia beam. all rights reserved. internal and external egg qualities of layers fed two proprietary feeds interchangeably onabajo, a. o.1+ awojobi, h. a.2 apata, e. s.3 1rasable farm ventures, ijeun akoni village, odeda local government area, osiele-abeokuta, ogun state, nigeria. 1,2,3department of animal production, faculty of agricultural production and renewable resource, college of agricultural sciences, olabisi onabanjo university, ayetoro campus, ayetoro, ogun state, nigeria. 1email: onabajoadebisi@gmail.com 2email: hakeemawojobi@yahoo.com 3email: ebunoluapata2008@yahoo.com (+ corresponding author) abstract article history received: 18 august 2022 revised: 27 september 2022 accepted: 10 october 2022 published: 8 november 2022 keywords egg quality feed brands feeding frequency interchangeable layers poultry production proprietary feed. four hundred and eighty, 53 weeks old isa brown layers were used for the 8 weeks feeding trial to determine the internal and external egg qualities of layers fed two proprietary feeds (designated top feed (tf) and animal care feed (ac)) in five dynamics and two feeding frequencies. the birds were randomly allocated in a 5 x 2 factorial arrangement to five feeding dynamics (d1 tf only; d2 ac feed only; d3 weekly alternation of tf & ac; d4 alternation of tf & ac every two weeks; d5 monthly alternation of tf & ac) and two feeding frequencies (twice & thrice daily). data were collected on external and internal egg qualities and analyzed using analysis of variance (anova). the results showed that both feeding dynamics and feeding frequencies significantly (p<0.05, r2=0.4) contributed to egg length as single factor. however, egg shape index (p=0.002), % yolk (0.00), yolk weight (p=0.004), egg moisture (0.003), egg fat (0.001) and egg carbohydrate (0.001) were influenced by interaction effect of feeding dynamics and feeding frequency. from the findings of this study, alternating brands of feed in the short term (weekly) and feeding laying birds twice daily is recommended. contribution/originality: sudden change in the brand of feed fed to laying birds affects both the internal and external quality of eggs. however, such changes are not detrimental to egg quality where the nutrient composition of interchanged brands is comparable. feeding laying hens twice or thrice daily does not affect egg quality. 1. introduction the consumption of poultry products, especially poultry meat and egg, has consistently increased over the years as a result of increase in population, urbanization and income. this has resulted in profound effect on the demand for feed and feed raw materials. ojewole [1] and eruvbetine [2] reported that the rate and level of performance in the livestock industry especially poultry production has fallen below expectation due to high feed cost arising from fluctuations in feed supplies, rising prices of feed ingredients, high capital outlay in purchase and storage of ingredients over time, poor feed quality (adulterated feed), increase competitive demand for feed, scarcity of the conventional ingredients and most importantly inefficiency in feed production [3, 4]. in commercial poultry production, the main constraint to successful production is feed cost which accounts for about 75 to 80% of the total cost of production [5]. animal review 2022 vol. 9, no. 1, pp. 1-12. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v9i1.3186 © 2022 conscientia beam. all rights reserved. https://orcid.org/0000-0002-8471-2640 https://orcid.org/0000-0002-0352-418x https://orcid.org/0000-0001-9295-8168 mailto:onabajoadebisi@gmail.com mailto:hakeemawojobi@yahoo.com mailto:ebunoluapata2008@yahoo.com https://www.doi.org/10.18488/92.v9i1.3186 animal review, 2022, 9(1): 1-12 2 © 2022 conscientia beam. all rights reserved. fallen trend in commercial feed production in nigeria according to bello [6] started around 1998-2000 when feed production figures dropped from 2.4mmt in 1995 to 1.6mmt in 2000 with subsequent decline up to 1.00mmt in the year 2008. this low capacity feed resources utilization could be linked to inadequate information based on location and localization of feed resources, processing, storage, and quality enhancement. the net effect of all these are capacity under-utilization, curtailment of planned expansion programs and in extreme cases liquidation [2]. however, oyediji [7] reported that there was a rise in the quantity of poultry feed produced in nigeria from 2.2mmt in 2010 to about 3.3mmt in 2014. this was as a result of the ban imposed on the importation of frozen chicken and other livestock products which made poultry production more attractive. the rise in the number and size of poultry business has led to more demand for feeds and subsequent pressure on feed production ingredients. thus, the rise in the number of feed mills to meet this demand of most poultry farmers became inevitable and the incessant increase in prices of the feed could be attributed to decrease productivity and inefficiency in the use of resources by the feed industries [8]. laying chickens require a completely balanced diet to sustain maximum egg production over time and inadequacies can cause hens to stop-laying. to avert this, there has been introduction of feeding dynamism which is characterized by continuous change in feeding practices among poultry farmers due to limited availability of feed and changing feed quality of branded feed [9]. this usually involve shift from one source of commercial feed to another, either in the short, medium or long-run. this study therefore investigated the response of egg-type chickens to simulated dynamics of poultry feeding in practice, with emphasis on egg quality. 2. materials and methods 2.1. study location the experiment was conducted on a private farm at ijeun-akoni village, odeda local government area (lga), osiele, abeokuta, ogun state nigeria. odeda lga shares boundary with abeokuta north lga of ogun state. geographically, abeokuta lies on latitude 7015n and longitude 3025e. abeokuta lies on an altitude of about 157m above sea level amidst isolated outcrop of natural formation of granite rocks which give the town landscape its undulating characteristics. the area has rainfall of between 100mm and 200mm [10, 11]. 2.2. animal housing and management a total number of four hundred and eighty, 53 weeks old isa brown laying hens were used for the experiment. they were housed in battery cages 50x40x40cm/cell (4layers/cell). the experimental feeds were offered at 125g/bird/day and water was provided free-choice. birds were raised under natural day length. table 1. nutrient composition of experimental feeds. nutrients tf ac crude protein 16.50 16.50 fat/oil 5.00 3.00 crude fibre 6.00 7.00 calcium 3.60 3.60 phosphorus 0.45 0.45 methionine 0.34 lysine 0.80 salt 0.3 metabolizable energy (kcal/kg) 2500 2650 source: proprietary feeds leaflet. 2.3. feed and feeding practices two reputable commercial brands (tf and ac) of feeds (layers mash) of comparative nutritional quality were used for the experiment. the nutrient compositions of the experimental feeds are presented in table 1. the feeding practice was twice feeding daily or thrice feeding daily. animal review, 2022, 9(1): 1-12 3 © 2022 conscientia beam. all rights reserved. 2.4. experimentation the experiment was randomized complete block design (rcbd). the treatment being 5 (five) dynamics of feed change and the block (two feeding times per day).the five treatment groups are dynamic 1 (d1): use of tf layers mash throughout the experiment. dynamic 2 (d2): use of ac layers mash throughout the experiment. dynamic 3 (d3): short term (weekly) alternation of ac and tf throughout the experiment. dynamic 4 (d4): medium (2 weekly) alternation of ac and tf throughout the experiment. dynamic 5 (d5): long term (monthly) alternation of ac and tf throughout the experiment. the two blocks were: block 1 (b1): feeding twice daily at 7a.m in the morning and 2pm in the afternoon. block 2 (b2): feeding thrice daily at 7a.m in the morning, 1pm in the afternoon and 5pm in the evening. 2.5. data collection 2.5.1. external egg quality twelve (12) eggs were randomly selected weekly/group of 48 birds for egg quality analysis. the indices determined were as follows: egg weight (g): egg weight was taken for selected egg collected from the hens and the weighing was done for all the selected eggs. egg weight was taken to the nearest grams for all eggs collected individually. egg grade: egg grades were assigned according to agmark standards for market table eggs [12]. egg length and width: the length and width of the egg were measured with electronic digital vernier caliper sensitive to 0.00mm. egg shape index: the egg shape index was calculated as the proportion of egg length to diameter. egg shell thickness (mm): this was determined by pulling off the shell immediately the egg was broken and the shell was air-dried for 24 hours. thereafter the egg shell thickness was measured with a micrometer screw gauge. egg shell weight (g): each egg was carefully broken and dried after which the egg was weighed using a weighing balance. 2.6. internal egg quality albumen height: the eggs after weighing were broken into a flat bottom glass positioned on a flat surface. the albumen height was measured using a tripod micrometer [13]. albumen weight: albumen was placed in a petri-dish on an electronic digital scale and the weight determined by difference. percentage albumen: = albumen weight × 100 egg weight yolk height: the eggs after weighing were broken into a flat bottom glass (beaker) positioned on a flat surface. the yolk height was measured using a tripod micrometre. yolk weight (g): the yolk was separated from the albumen and placed in weighed petri-dish on an electronic digital scale and the weight of the yolk was determined by difference. yolk percentage: yolk weight × 100 egg weight haugh unit: this was calculated from the values obtained from the albumen height and egg weight by using the formula according to williams [14]. haugh’s unit = 100log10 (h+7.57-1.7w0.37). animal review, 2022, 9(1): 1-12 4 © 2022 conscientia beam. all rights reserved. 2.7. proximate composition of egg 2.7.1. preparation of egg for analyses the samples of various treatment eggs were carefully opened and the contents emptied into a beaker. egg samples were weighed using electronic balance and recorded. the sample were homogenized and kept in a dry, clean sample bottles and later used for analysis. 2.7.2. proximate composition moisture, ash, protein, and carbohydrate were determined by the methods described by aoac [15]. whereas lipid composition were determined by the method as described by mclean and drake [16]. 2.8. statistical analysis the statistical design was rcbd. data were arranged in a 5 by 2 factorial experimental layout. significant differences were separated using duncan’s multiple range test. all data analysis was done using [17]. yijk=µ+di+fj+(df)ij+∑ijk where: yijk = observed value of dependent variable. µ= overall mean. di = effect of the ith feeding dynamic (1, 2, 3, 4, 5). fj = effect of the jth feeding time (1, 2). (df)ij = effect of interaction between feed dynamics and feeding times. ∑ijk= residual error. 3. results and discussions 3.1. effects of simulated feeding dynamics on external egg quality of poultry birds the effects of simulated feeding dynamics on egg weight, grade, length, width, shape index, shell thickness and shell weight are presented in figure 1(a-g). the result showed that different simulated feeding dynamics significantly contributed (p<0.05) to only egg weight (figure a) and egg length (figure c). high values were recorded for egg weight and egg length from birds on feeding dynamics d3 (short term weekly alternation of feed brands). shell thickness (figure f) was highest in birds on dynamics d5 being significantly (p<0.05) higher than that of birds on dynamics d1, d2, d3. birds on dynamics 4 have intermediate value for shell thickness comparable (p>0.05) to that of other treatments. similarly, birds in dynamics d5 have the highest shell weight (figure g) which was higher (p<0.05) than that of other dynamics. the interactive effect is presented in table 2. the highest value for egg grade was recorded in dynamics d2 with thrice feeding, followed by dynamics 4 with twice feeding while the least value was observed dynamics d4 with thrice feeding. however, both feeding dynamics and feeding frequencies significantly (p<.05, r2 = 0.41) contribute to length as single factors. the two factors did not jointly interact to significantly affect the egg length. in this study, different feeding dynamics significantly affected the egg weight and egg length. the highest values for these two important egg production factors were recorded in birds fed with short term (weekly) alternation of ac and tf throughout the experiment. this implied that weekly alternation of ac and tf will ensure better egg weight and length of egg-type chickens. this finding was similar to the report of molnár, et al. [18], who reported improvement in egg characteristics of laying hens whose feeds were alternated on daily basis. however, alternation of feed in the longer course seems to increase shell thickness and shell weight of the eggs. the highest values for both shell thickness and weight were recorded in birds fed with tf and ac feed alternatively for one month. the organization of egg shell microstructure is determined by genetic, physiological and external factors [19]. egg shell thickness, firmness and weight are very important factors to consider in eggs because it conditions the biological and market value of eggs [19]. animal review, 2022, 9(1): 1-12 5 © 2022 conscientia beam. all rights reserved. to further explain this, hen forming thick egg shells had significantly higher egg shell weight, average egg shell thickness and lower rate of breakage (cracked, broken or shell-less eggs) in comparison with hens forming thin egg shells [19, 20]. the fact that long term alternation of feed resulted in better egg shell weight and thickness suggests that ca, p and mg metabolism for egg shell formation is not amenable to frequent change of feed brand. in this study, different feeding dynamics significantly affected the egg weight and egg length. the highest values for these two important egg production factors were recorded in birds fed with short term (weekly) alternation of ac and tf throughout the experiment. this implied that weekly alternation of ac care and tf will ensure better egg weight and length of egg-type chickens. this finding was similar to the report of molnár, et al. [18], who reported improvement in egg characteristics of laying hens whose feeds were alternated on daily basis. animal review, 2022, 9(1): 1-12 6 © 2022 conscientia beam. all rights reserved. figure 1. effects of simulated feeding dynamics on egg weight (a) grade (b) length (c) width (d) shape index (e) shell thickness (f) and shell weight (g). bars with different superscripts (alphabet) on a chart are significantly different (p<0.05). animal review, 2022, 9(1): 1-12 7 © 2022 conscientia beam. all rights reserved. table 2. interactive effects of stimulated feeding dynamics and feeding frequency on external egg quality of chicken’s egg dynamics feeding frequency egg weight egg grade egg length egg width egg shape index shell thickness shell weight dynamics 1 twice feeding 64.52±0.89 2.79±0.06ab 5.53±0.03ab 4.25±0.02a 1.30±0.01ab 0.72±0.01ab 6.66±0.11ab thrice feeding 63.29±0.66a 2.85±0.05b 5.54±0.03ab 4.20±0.01a 1.31±0.01b 0.72±0.01ab 6.40±0.01a dynamics 2 twice feeding 64.49±0.87ab 2.80±0.07ab 5.52±0.05ab 4.24±0.02a 1.31±0.01b 0.73±0.01ab 6.47±0.12a thrice feeding 66.44±0.71b 2.94±0.04b 5.65±0.03c 4.26±0.02a 1.32±0.01b 0.70±0.01a 6.39±0.01a dynamics 3 twice feeding 66.44±0.83b 2.90±0.05b 5.60±0.03abc 4.28±0.02a 1.31±0.01b 0.72±0.01ab 6.54±0.11ab thrice feeding 65.67±0.94ab 2.83±0.05b 5.63±0.03bc 4.24±0.02a 1.32±0.01b 0.72±0.01ab 6.58±0.10ab dynamics 4 twice feeding 64.83±0.58ab 2.92±0.04b 5.57±0.03abc 4.27±0.02a 1.30±0.01ab 0.73±0.01ab 6.65±0.08ab thrice feeding 63.88±0.95a 2.65±0.08a 5.61±0.04abc 12.09±7.85a 1.32±0.01b 0.72±0.01ab 6.43±0.12a dynamics 5 twice feeding 64.96±0.63ab 2.85±0.05b 5.51±0.02a 4.29±0.02a 1.29±0.01a 0.74±0.01b 6.57±0.01ab thrice feeding 64.38±0.63ab 2.83±0.05b 5.53±0.03ab 4.24±0.02a 1.32±0.01b 0.74±0.01b 6.77±0.09b interactions p-values p-values p-values p-values p-values p-values p-values dynamics 0.046 0.529 0.021* 0.404 0.463 0.071 0.245 feeding freq. 0.519 0.397 0.038* 0.326 0.002* 0.213 0.328 dynamics + feeding freq. 0.243 0.004* 0.365 0.405 0.350 0.384 0.132 r2 values 0.032 0.39 0.41 0.019 0.36 0.30 0.28 note: values with the same superscript (alphabet) in a column are not significantly different (p>0.05). *p-values with asterisk connotes significant interactions (p<0.05) . animal review, 2022, 9(1): 1-12 8 © 2022 conscientia beam. all rights reserved. 3.2. effects of simulated feeding dynamics on internal egg quality of poultry birds the effects of simulated feeding dynamics on egg albumen height, weight and percentage, yolk height, yolk weight, percentage yolk and haught unit are presented in figure 2(a-g). the result showed that different stimulated feeding dynamics significantly contributed (p<0.05) to albumen weight (figure a), yolk weight (figure e) and percentage yolk (figure f). the highest value for egg albumen weight was recorded in birds from feeding dynamics d2 while the least was recorded in birds from feeding dynamics d1. furthermore, the highest value for yolk weight and percentage yolk was recorded in birds from feeding dynamics d4 while the least was recorded in birds from feeding dynamics d2. the interactive effect is presented in table 3. it was recorded that all parameters on internal egg quality were not significantly (p>0.05) influenced by feed pattern. the results showed that both feeding dynamics and feeding frequencies did not significantly contribute to egg albumen height (p>0.05, r2 = 0.24), egg albumen weight (p>0.05, r2 = 0.35) and percentage albumen (0.05, r2 = 0.19) width either as single or joint factors. contrastingly, only feeding dynamics significantly contributed to yolk weight and percentage yolk as a single factor. however, no joint interaction effects of feeding dynamics and feeding frequency on yolk weight and percentage yolk was observed. the highest values for both yolk weight and percentage yolk were recorded in birds on feeding dynamics d4. the result from this study revealed that egg weight, comprises of the cumulative weight of its components such as albumen, haught unit, yolk, etc. the only variability observed with respect to albumin properties of the egg with respect to the different feeding dynamics observed in this study was observed in egg albumen weight. the different feeding dynamics significantly affected the yolk weight and percentage yolk, but did not significantly affect the yolk height and haught unit. studies have reported that egg quality characteristics such as yolk weight, percentage yolk, yolk height and colour have been of great interest to the egg industry [21-23]. hence determining feeding practices that best suit these properties is very important. this current study revealed that medium alternation (two weekly) of ac and tf throughout the experiment produced the best results for yolk weight and yolk percentage. to further understand the best feeding practices that will mostly influence these eggs qualities, we employed factorial analysis to study interactions between different feeding dynamics simulated feeding dynamics (sfd) and feeding (fq) frequencies using general linear model for univariate analysis of variance and this revealed that interaction between sfd and fq only significantly affected egg grade. this implied that the role of the feed in quality egg production might be more important than the feeding frequency employed in this study. this is in contrast with earlier report of molnár, et al. [18] who reported significant differences in some egg quality parameters with respect to different feeding frequencies. the reason for this disparity might be due to the differences in feeding frequency employed in this study and theirs. this study employed twice and thrice feeding a day, while their own study employed twice feeding and uncontrolled feeding (throughout the day). animal review, 2022, 9(1): 1-12 9 © 2022 conscientia beam. all rights reserved. figure 2. effects of simulated feeding dynamics on egg albumin height (a) weight (b) percentage albumin (c) yolk height (d) yolk weight € percentage yolk (f) and haugh unit (g). bars with different superscripts (alphabet) on a chart are significantly different (p<0.05). animal review, 2022, 9(1): 1-12 10 © 2022 conscientia beam. all rights reserved. table 3. interactive effects of stimulated feeding dynamics and feeding frequency on internal egg quality of chicken’s egg dynamics feeding frequency albumin height albumin weight % albumin yolk height yolk weight % yolk haught unit dynamics 1 twice feeding 11.64±0.03a 41.15±0.86ab 63.23±0.99a 4.52±0.03ab 19.83±0.41bcd 30.81±0.71abc 105.08±0.13ab thrice feeding 11.36±0.22a 38.94±0.56a 61.32±0.57a 4.42±0.02a 19.25±0.36ab 30.73±0.48abc 104.77±0.18ab dynamics 2 twice feeding 11.39±0.21a 40.96±0.72ab 63.39±0.57a 5.29±0.81b 19.08±0.36a 29.97±0.50ab 123.74±18.95b thrice feeding 11.57±0.04a 42.31±0.69b 63.75±0.85a 4.44±0.03ab 19.60±0.30bc 29.60±0.45a 105.26±0.13ab dynamics 3 twice feeding 11.63±0.03a 40.79±0.66ab 61.58±0.93a 4.52±0.03ab 20.29±0.34cd 30.67±0.55abc 105.08±0.13ab thrice feeding 11.62±0.03a 40.83±0.66ab 64.26±0.52a 4.45±0.03ab 19.69±0.25bc 30.10±0.41ab 105.01±0.17ab dynamics 4 twice feeding 11.69±0.04a 42.25±0.70b 62.74±0.96a 4.57±0.03ab 20.90±0.35d 32.83±0.88d 104.62±0.15ab thrice feeding 11.64±0.03a 40.77±0.72ab 64.79±1.02a 4.53±0.03ab 19.98±0.48bcd 31.95±0.53cd 104.85±0.13ab dynamics 5 twice feeding 11.64±0.03a 42.06±0.55b 64.31±0.76a 4.53±0.03ab 20.44±0.30cd 31.51±0.50bcd 103.31±1.99a thrice feeding 11.66±0.03a 40.77±0.94ab 64.34±0.76a 4.49±0.03ab 20.25±0.23bcd 31.66±0.43bcd 105.28±0.14ab interactions p-values p-values p-values p-values p-values p-values p-values dynamics 0.217 0.145 0.384 0.537 0.004* 0.000* 0.397 feeding freq. 0.681 0.114 0.304 0.181 0.105 0.324 0.392 dynamics + feeding freq. 0.253 0.100 0.410 0.452 0.269 0.906 0.425 r2 values 0.24 0.35 0.19 0.18 0.48 0.57 0.18 note: values with the same superscript (alphabet) in a column are not significantly different (p>0.05). * p-values with asterisk connotes significant interactions (p<0.05). animal review, 2022, 9(1): 1-12 11 © 2022 conscientia beam. all rights reserved. 3.3. interactive effects of simulated feeding dynamics and feeding frequency on proximate content of eggs the interactions effects of simulated feeding dynamics and feeding frequency on proximate contents of the eggs were presented in table 4. the results showed that feeding dynamics and feeding frequency significantly (p<0.05) contributed (both singly and jointly) to ash, and crude protein contents of the egg. these interactions accounted for over 90% of the variations observed in the parameters. feeding dynamics 4 and 5 significantly (p<0.05) decreased ash crude protein (cp) and carbohydrate (cho) constituents of the egg. feeding dynamics 4 and 5 also increased as well thrice feeding daily increased (p<0.05) the fat content of the egg. table 4. interactive effect of stimulated feeding dynamics and feeding frequency on proximate content of eggs. dynamics feeding frequency ash fat crude protein moisture cho dynamics 1 twice feeding 1.14cd 19.25c 12.48de 23.25c 43.87d thrice feeding 0.98bc 11.12a 13.49e 21.87bc 53.17g dynamics 2 twice feeding 1.48d 19.70c 11.82cd 21.96bc 45.29e thrice feeding 0.86b 21.50d 11.09bc 23.04c 43.51cd dynamics 3 twice feeding 1.04bc 16.70b 12.60de 20.77ab 48.91f thrice feeding 1.30cd 23.12e 10.29ab 22.00bc 43.92d dynamics 4 twice feeding 0.88b 27.18g 11.06bc 22.68c 38.75a thrice feeding 1.34cd 25.70f 9.67a 23.43c 39.87b dynamics 5 twice feeding 0.21a 26.70g 10.46ab 20.00a 42.65c thrice feeding 1.19cd 29.25h 9.74a 20.94ab 38.87ab interactions p-values p-values p-values p-values p-values dynamics 0.006* 0.001* 0.001* 0.003* 0.001* feeding freq. 0.019* 0.223 0.007* 0.130 0.900 dynamics + feeding freq. 0.001* 0.001* 0.018* 0.129 0.001* r2 values 0.913 0.997 0.910 0.824 0.994 note: values with the same superscript (alphabet) in a column are not significantly different (p>0.05).* p-values with asterisk connotes significant interactions (p<0.05) 4. conclusion the results of this study showed that different feeding dynamics have influence on the external egg quality for weight and length in birds fed with short term (weekly) alternation of ac and tf throughout the experiment. similarly the short term (dynamic 3) option gave better balance of nutrient composition of the egg than dynamics 4 and 5. alternation of feed in the longer course seems to favour increased shell thickness and shell weight of the eggs. from this study, it can be concluded that switching over to a feed of comparative quality not detrimental to egg quality however interchanging feeds on a short term basis (weekly) is recommended from the findings of this study. the study also observed that dividing daily feed allowance into three offers no advantage over feeding twice. feeding laying birds twice daily is therefore recommended. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. authors’ contributions: all authors contributed equally to the conception and design of the study. references [1] g. s. ojewole, "productive performance and body composition of broiler as influenced by dietary energyand protein in the humid tropics," phd thesis, department of animal science, university of ibadan, nigeria, 2004. [2] d. eruvbetine, "revolutionising the feed industry for increased poultry production," university of agriculture, abeokuta, nigeria, unaab inaugural lecture series no 262009. [3] u. doma, a. muhammad, k. bello, and e. ugbeh, "performance of broilers chickens fed with local formulated fed and commercial feeds," nigerian journal of tropical agriculture, vol. 3, pp. 83-86, 2001. [4] m. c. uchegbu, n. m. irechukwu, a. a. omede, c. h. nwaodu, g. a. anyanwu, i. c. okoli, and a. b. udedibie, "comparative evaluation of three commercial feed on the performance of broilers," in in proceedings of the forty first annual conference of agricultural society of nigeria zaria, nigeria, 2007, pp. 359 363. animal review, 2022, 9(1): 1-12 12 © 2022 conscientia beam. all rights reserved. [5] a. a. hassan, "comparative economic analysis of poultry egg production using commercial and homemade feed in kaduna state," an unpublished m.sc thesis, department of agric economics and rural sociology, a.b.u. zaria, 2002. [6] b. bello, "feed crisis: way out," in wpsa nig branch seminar, lagos. march 2008, 2008. [7] g. oyediji, "trend in the production of animal feed in nigeria and the way forward," in a three days training session organized for students of the nigerian institute of animal science lagos nigeria. june, 2015, 2015. [8] j. a. mbanasor and c. n. jonas, efficiency of indigenous. nigeria: poultry feed production enterprises in abia state, 2006. [9] a. o. onabajo, c. o. adamu, w. o. oyediran, b. o. onabajo, and y. t. adeyanju, "influence of poutry feed dynamism on egg production in odogbolu local govt area of ogun state nigeria," american journal of agricultural research, vol. 1, pp. 31-37, 2016. [10] o. o. oyesiku, ogun state in nigeria in: ogun state in maps. onakomaiya et al (eds). ibadan, oyo state, nigeria: rex charles publications, 1992. [11] o. gbadegesin, vegetation in ogun state in: ogun state in maps. onakomaiya, et al. (eds). ibadan, oyo state, nigeria: rex charles publications, 2000. [12] poultry mania, "agmark grading of eggs. retrieved from: https://poultrymania.com/tag/agmark-grading-ofeggs/?amp," 2021. [13] c. e. oyeagu, "response of nera black and shaver brown hens to self-compounded and commercial feeds in nsukka, enugu state," a thesis submitted to the department of animal science, university of nigeria, nsukka, 2014. [14] k. williams, "some factors affecting albumen quality with particular reference to haugh unit score," world's poultry science journal, vol. 48, pp. 5-16, 1992.available at: https://doi.org/10.1079/wps19920002. [15] aoac, official methods of analysis, 18th ed. washington dc: association of official analytical chemistry, 2005. [16] b. mclean and p. drake, "review of methods for the determination of fat and oil in foodstuffs," review no. 37. pp522002. [17] sas, users guide. usa, carry north caroline statistical analysis institute, inc, 2002. [18] a. molnár, c. hamelin, e. delezie, and y. nys, "sequential and choice feeding in laying hens: adapting nutrient supply to requirements during the egg formation cycle," world's poultry science journal, vol. 74, pp. 199-210, 2018.available at: https://doi.org/10.1017/s0043933918000247. [19] h. arpášová, m. halaj, and p. halaj, "eggshell quality and calcium utilization in feed of hens in repeated laying cycles," czech journal of animal science, vol. 55, pp. 66-74, 2010.available at: https://doi.org/10.17221/90/2009-cjas. [20] a. bar, e. vax, and s. striem, "relationships among age, eggshell thickness and vitamin d metabolism and its expression in the laying hen," comparative biochemistry and physiology part a: molecular & integrative physiology, vol. 123, pp. 147-154, 1999.available at: https://doi.org/10.1016/s1095-6433(99)00039-2. [21] s. giulia, f. bovera, g. parisi, and g. moniello, "quality of eggs and albumen technological properties as affected by hermetia illucens larvae meal in hens’ diet and hen age," animals, vol. 10, p. 81, 2020.available at: https://doi.org/10.3390/ani10010081. [22] k. kawasaki, y. hashimoto, a. hori, t. kawasaki, h. hirayasu, s.-i. iwase, a. hashizume, a. ido, c. miura, and t. miura, "evaluation of black soldier fly hermetically shining larvae and pre-pupae raised on household organic waste, as potential ingredients for poultry feed," animals, vol. 9, p. 98, 2019.available at: https://doi.org/10.3390/ani9030098. [23] z. mwaniki, m. neijat, and e. kiarie, "egg production and quality responses of adding up to 7.5% defatted black soldier fly larvae meal in a corn–soybean meal diet fed to shaver white leghorns from wk 19 to 27 of age," poultry science, vol. 97, pp. 2829-2835, 2018.available at: https://doi.org/10.3382/ps/pey118. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 36 † corresponding author © 2016 conscientia beam. all rights reserved. determination of milk composition, bacteriology and selected blood parameters of dairy goats under different feeding systems taskin degirmencioglu1† --gulsen goncagul2 --selda ozbilgin3 --huban gocmen4 1department of feed technology and animal nutrition, uludag university karacabey vocational school, bursa, republic of turkiye 2department of veterinary microbiology, uludag university mennan pasinli vocational school gorukle, republic of turkiye 3department of animal health and husbandry uludag university karacabey vocational school, republic of turkiye 4 department of microbiology, near east university faculty of veterinary medicine. nicosia north cyprus abstract this research was carried out at two farms located in the karacabey region of turkey: an extensive goat farm (a) and a semiintensive goat farm (b). a total of 32 saanen goats (3 years old) at an early stage of their second lactation were selected from farm a and farm b. the total dm intake (tdm) values were 1.89 and 1.86 (kg d-1) for goats housed on the a and b farms, respectively. compared with farm a, farm b produced more milk each day (p<0.05; 1.38 -. 1.76 kg day-1). the milk samples taken from farm a had a higher (p<0.05) milk fat content than the samples from farm b (milk fat=4.40 and 1.89 %, respectively). the serum creatinine values were significantly higher (p<0.05) in the blood of goats from farm a compared with farm b (1.11 and 0.56 mg dl-1, respectively). comparison of glucose levels from both farms showed a significantly higher level of glucose in the blood samples from goats at farm b (p<0.05; 24.23 and 61.43 mg dl-1). serum parameters for cholesterol, ggt and urea were not affected by the feeding system (p > 0.05). keywords: extensive or semi-intensive, goat, dry matter intake, milk composition, bacteriology, blood. received: 14 may 2016/ revised: 18 june 2016/ accepted: 14 july 2016/ published: 7 august 2016 contribution/ originality this study is one of very few studies which have investigated the milk composition, bacteriology and selected blood parameters of dairy goats under different feeding systems. 1. introduction the efficiency of goat production depends on the type of feeding system and the availability of nutrients for high productivity. feeding systems are divided into the following categories: extensive systems, semi-intensive systems and very intensive systems [1]. in the extensive system, goat flocks are kept at or close to the village or farm year-round. during the day they are grazed either on the common village range or on privately-owned or hired grazing areas. the extensive system is common in village farms within turkey. village flocks managed under this system may consist of 200–300 goats. some farms feed straw or hay to their goats during winter, and several of the flock owners feed their goats approximately 100 to 200 g of barley daily per head toward the end of pregnancy and during early lactation [2]. however, the productivity of goats under this traditional production system is very animal review 2016 vol. 3, no. 2, pp. 36-42 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.2/101.2.36.42 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.2/101.2.36.42 animal review, 2016, 3(2): 36-42 37 © 2016 conscientia beam. all rights reserved. low [3]. previous studies have reported that semi-intensive feeding improved milk yield in dairy ewes, goats and anatolian water buffaloes [4-8]. grazing animals in an extensive rearing system can cause a nutritional imbalance during the summertime. these animals may show decreased milk production [4]. the aim of the present work was to study the effects of different forms of management on feeding, milk quality and selected blood parameters at existing goat farms. 2. materials and methods this research was carried out at two farms located in the karacabey region of turkey: an extensive goat farm (a) and a semi-intensive goat farm (b). a total of 16 three-year-old saanen goats at 30-35 days of their second lactation were selected from farm a. during march, the goats had access to the natural pasture ad libitum and were provided with 2.0 kg of oat hay and salt blocks for licking. an equivalent number of saanen goats (3 years old; stage of second lactation, 30-38 days) were selected from farm b. on farm b, goats received ad libitum pasture as well as corn silage (1.5 kg d-1), alfalfa hay (1000 g), 0.40 kg of barley hay, 0.20 kg of a concentrate feed mixture (cfm, 180 g cp kg dm-1) and 2600 me (kcal kg dm-1). the individual consumption of roughage was not determined because a group feeding protocol was used in this study. the dry matter, organic matter, crude protein, crude fat and ash content of the diets were analyzed according to aoac [9]. neutral detergent fiber (ndf) and acid detergent fiber (adf) values were determined using the methods outlined by robertson and vansoest [10]. the metabolizable energy (me) content was also estimated [11]. the animals were milked once a day with a milking machine at both the a and b farms. the milk production of each goat was measured daily. raw milk samples were collected monthly. each sample was taken aseptically directly from the udder of individual goats after discarding the foremilk and was stored at 4 °c and analyzed within 2 hours. the somatic cell count (scc) was determined with a somacount 150 (bentley instruments, chaska, mn, usa). the total bacterial count was measured as the number of bacteria in a sample that were able to grow and form countable colonies on standard methods agar after being held at 32°c (90°f) for 48 hours [12]. the non-fat solids (snf), fat, protein and lactose contents of milk were analyzed using a milkoscan ft-120. for bacteriological analysis, the initial milk samples were incubated at 37°c for 24 hours on thioglycolate agar and then cultured on blood agar (bbl; 297876) and emb agar (eosin-methylene blue-lactose-saccharose) (bbl; 221355). the samples were then incubated again for 24 hours at 37°c. colonies were identified based on colony morphology and gram staining. to identify the bacteria, direct cultures were performed using bbl crystal gram-positive and gramnegative id system kits and the associated database (becton-dickinson, sparks, usa). all milk samples were inoculated with tenfold serial dilution in modified hayflick broth (oxoid, uk). following serial dilution of milk samples in the broth medium, several drops were spread on hayflick mycoplasma agar (oxoid, uk) and incubated at 37 0c under a 5-10 % co2 atmosphere (oxoid co2gen, uk) for 3-7 days [13]. plates were examined daily for ph change and opalescence, and the agar media were examined under a stereo microscope (olympus sz2-ilst zoom stereo microscope, japan) for typical ‘fried-egg’ colonies. if bacterial contamination was detected, milk was sterilized by filtering with a 0.45 µm minisart filter (sartorius ag, goettingen, germany) [13]. if mycoplasma growth was not observed on solid media or broth, the subculture interval was extended to 7 days. if there was no growth after this period, the result was considered negative [14]. blood samples were drawn from the jugular vein of 6 goats from each farm at 2 h post-feeding. the samples were centrifuged to obtain serum (2800 rpm × 10 min) after resting for 10 min to allow coagulation. the glucose, total cholesterol, urea, ggt and creatinine (cre) of the blood serum were analyzed using a reflotron at the central laboratory of the faculty of veterinary, uludag university. hemogram values were counted manually. an analysis of variance was conducted using the spss version 15.0 statistical package spss [15] and means were compared using the t-test models described by cochran and cox [16]: animal review, 2016, 3(2): 36-42 38 © 2016 conscientia beam. all rights reserved. yijkl= μ+ti+pj+eijk, where yijkl=observation, μ = population mean, ti = farming (extensive and semiintensive), pj = animals (j = 1, 2, 3…31 or 32) and eijk = residual error. 3. results and discussion the chemical composition of the diets, oat hay, alfalfa hay, corn silage and barley hay are presented in table 1. average total dry matter intake (tdm) was 1.89 and 1.86 kg day-1 at a and b farms, respectively (table 2). farm a fed lactating goats 1.89 kg dm of oat straw (per head per day). the goats also had access to the natural pasture ad libitum. farm b fed lactating goats 0.47 kg dm of maize silage, 0.94 kg dm of alfa hay, 0.26 kg dm of barley straw and 0.18 kg dm of cfm (per head per day). the tdm of farm a was similar to that of farm b. however, goats fed the semi-intensive diet had a richer nutrient intake than goats fed the extensive diet. the average milk yield of goats was higher for farm b than for farm a (21.59 %; p<0.05) (table 2). the difference in mean milk production between farm a and farm b was significant (p<0.05). this reduced milk production on farm a was probably associated with limited body reserves and a reduction in energy intake associated with the consumption of straw [4, 7]. these results are consistent with previous reports [3, 17] which stated that goats under a traditional production system had very low milk yield; however, the mean milk yield for farm b was 1.76 kg d-1 (table 2). this value is significantly lower than the 2.5 kg d-1 reported by pridolova, et al. [17] similarly; degirmencıoglu [18] reported that the mean daily milk yield was approximately 2.1 kg d-1 at a semi-intensive goat farm. cabbidu, et al. [19] reported that the level of energy was important for milk production of goats. the observed response of milk yield may be due to a lower total intake of me (cfm rate of 0.5 0.2 kg milk-1). milk fat content was lower on farm b compared with the milk fat content at the extensive farm (milk fat=4.40 and 1.89 %, respectively). in the present study, the 2.51 % reduction in milk fat at farm b (p<0.05) was probably due to either greater milk production or lower forage intake [8]. in addition, sales-duval, et al. [20] reported that fat content was lower when the proportion of natural pasture in feeding systems was lower. bacterial differences were observed among raw milk samples from the 2 farms. bacillus cereus was the most common isolate (47.8 %) in goat milk from the semiextensive (b) farm, whereas staphylococcus haemolyticus was the most common isolate (25 %) in goat milk from the extensive (a) farm (table 3). total bacteria (tb) was 4.587 ± 1.604 (a) and 1.093 ± 0.401 (b) (p<0.05) (table 3). however, the total milk somatic cell counts (scc) were similar for both groups (362 ± 61.036 (a) and 304 ± 71.914 (b)). mycoplasma and brucella spp. we’re not detected at either farm. bagnicka, et al. [21] isolated minor pathogens, such as coagulase negative staphylococci, alpha haemolytic streptococci, enterococcus spp., corynebacterium spp. (25.3 %), and major pathogens, such as streptococcus agalactia, staphylococcus intermedius, s. aureus (9.8 %), in goat milk samples. in most samples, the presence of bacterial pathogens in goat milk led to an increase in the total scc (1x10⁶/ml of scc). however, kyozaire, et al. [22] compared the microbiological quality of milk produced under 3 different types of dairy goat production systems (intensive, semi-intensive and extensive); the lowest contamination rates were found among goats under the extensive system (13.3 %) compared with infection rates of 43.3 % and 36.7 % under the intensive and semi-intensive productions systems, respectively. staphylococcus intermedius, staphylococcus epidermidis, and staphylococcus simulans were the most common bacteria (85.7 %) in milk samples, but there was no significant relation between the scc and the presence of bacterial contamination in goat milk. foschino, et al. [23] detected coliforms as a constant component of the microflora from goat milk samples. the overall mean scc was 9.9 x 10⁵ cells/ml with 47 % of samples having counts greater than 1 x 10⁶ cells/ml. according to foschino, et al. [23] scc did not show a positive correlation with any microbial group. in addition, pertinez, et al. [24] observed no correlation between the number of bacteria and scc. the ability of scc to predict intramammary infection in goat milk is lower than in cow’s milk. in our study, we found no relation between total bacteria counts or bacterial composition and scc. instead, milking hygiene was the primary factor affecting the bacterial composition of raw goat milk. bacteria were found in a high percentage of isolates, and their incidence was probably related to unsanitary farming practices. based on the results in table 2, we can say that serum values of goats from farm b animal review, 2016, 3(2): 36-42 39 © 2016 conscientia beam. all rights reserved. were superior to those from farm a. the serum creatinine values were significantly higher (p<0.05) at farm a than at farm b (1.11 and 0.56 mg dl-1, respectively). this could be due to increased degradation of phosphocreatine in muscle tissues due to a lack of available energy sources to meet the vital functions of animals during feed restriction [25]. in the current study, serum glucose (mg dl-1) was significantly reduced under the extensive feeding system (p<0.05; 24.23 61.43 mg dl-1) (table 2). the reduction in glucose was 37.2 % at the farm a compared with the farm b. imasuen [26] reported that serum glucose values of african dwarf goats were lower for extensive and semiintensive systems (47.75 and 51.66 mg dl-1, respectively) and higher (61.16 mg dl-1) for the intensive system. the glucose level for the extensive system studied here was observed to be lower than the value reported by imasuen [26]. the observed decrease in glucose levels correlates with the increase in maintenance energy requirements due to grazing in a mountainous region and having low energy of acetic acid in the rumen because of roughage (acetic acid, ch3-cooh propionic acid, c2h5-cooh) [27]. the serum glucose values of goats from farm b were increased by semi-intensive feeding (p<0.05; 61.43 24.23 mg dl-1) (table 2). this result is consistent with research suggesting that high energy diets in dairy goats increase serum glucose [26, 28]. the semi-intensive feeding system had no significant effect on serum cholesterol, ggt or urea. 4. conclusion dairy goat farms located in mountainous and hilly areas of the karacabey district of bursa city showed a reduction in milk yield, not only for economic reasons, but also because of the structure of the region, which results in the extensive feeding system used for goats. however, at goat farms that used semi-intensive feeding, there was a positive effect on milk yield. goat milk production has currently been increasing in some areas in turkey. the best ice-cream and butter products in our country are made with goat milk. therefore, the quality of goat raw milk is important for the quality of final products. the bacterial status of milk is more likely related to maintenance of sanitary conditions and preventive measures rather than the feeding system of the farms. improvement of sanitary conditions during milking is the principal control point for bacteriological hazards. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. the author wish to thank the american journal experts for english corrections of the text references [1] c. devendra, "feeding system for goats in the humid tropics," presented at the int. symp. on nutrition and systems of goat feeding. 12-15th may, 1981, tours, france, 1981. [2] b. c. yalcın, sheep and goats in turkey. rome: fao food and agriculture organization of the united nations, 1986. [3] n. p. singh and s. kumar, "an alternative approach to research for harnessing production potential of goats," in proceedings of 4 th national extension congress , jawaharlal nehru krishi vishwavidyalaya, jabalpur, 9-11march. world organısatıon for anımal health (oıe). contagious agalactia, terrestrial manual, 2007, pp. 992-997. [4] d. fedele, m. pizzillo, s. claps, p. morand-fehr, and r. rubino, "grazing behaviour and diet selection of goats on native pasture in southern italy," small ruminant res., vol. 11, pp. 305-322, 1993. [5] f. morge, "effet du niveau d’acidog´en´ecit´e de 2 concentr´es sur les performances zootechniques de ch`evres laiti`eres conduits au pˆaturage (effect of level of acidogenecity in 2 concentrates on milk performances of grazing dairy goats)," rapport station experimentale du pradel drsq/pa2000. [6] s. claps, r. rubino, v. fedele, g. morone, and a. trana, "effect of concentrate supplementation on milk production, chemical features and milk volatile compounds in grazing goats," presented at the in: fao-ciheam seminar on sustainable grazing, nutritional utilization and quality of sheep and goat products, grenada (sp.), 2–4 october 2003, session 2, 2003. animal review, 2016, 3(2): 36-42 40 © 2016 conscientia beam. all rights reserved. [7] g. pulina, a. mazzette, g. battacone, and a. nudda, "feed restriction alters milk production traits in sarda dairy ewes," j. dairy sci., vol. 89, p. 59, 2006. [8] t. degirmencıoglu, h. unal, and h. kuraloglu, "comparison of extensive or semi-intensive feeding for anatolian water buffalo," emirates journal of food and agriculture, vol. 27, pp. 712-715, 2015. [9] aoac, official methods of analysis, 15th ed. arlington, va: assoc. off. anal chem, 1990. [10] j. b. robertson and p. j. vansoest, the detergent system of analysis and its application to human foods. in the analysis of dietary fiber in food. wpt james and o theander, ed. new york: marcel dekker, 1981. [11] nrc, nutrient requirements of dairy goat 5 th reved. washington, dc: national academy of sciences, 1975. [12] anonymous, standart methods for examination of dairy product. 3th ed. by richardson, g.h. washington dc, usa, 412: american publish health assosiation, 1992. [13] r. a. j. nicholas, r. d. ayling, and l. mcauliffe, mycoplasma diseases of ruminants: disease, diagnosis and control, 98-111, detection and differentiation of mycoplasma species using pcr/denaturing gradient gel electrophoresis . wallingford,oxon, gbr: cabi publishing, 2008. [14] j. b. poveda, biochemical charactristics in mycoplasma identification. in: methods in molecular biology. mycoplasma protocols, editors: mıles, rj, nicholas ra vol. 104. totowa, nj: humana press inc, 1998. [15] spss, statistical package for social sciences. pc version 15. spss inc. 444. n. michigan avenue chicago: united states of america, 2006. [16] w. g. cochran and g. m. cox, in experimental designs, 2nd ed. new york: john wiley and sons, 1957. [17] h. pridolova, b. janstova, s. cupáková, m. drackova, p. navratilova, and l. vorlova, "somatic cell count in goat milk," folia veterinaria, vol. 53, p. 101—105, 2009. [18] t. degirmencıoglu, "using humic acid in diets for dairy goats," animal science papers and reports, vol. 32, pp. 25-32, 2014. [19] a. cabbidu, a. branca, m. decandia, a. pes, p. m. santucci, f. masoero, and l. calamari, "relationship between body condition score, metabolic profile, milk yield and milk composition in goats browsing a mediterranean shrubland," livest. prod. sci., vol. 61, pp. 267-273, 1999. [20] v. sales-duval, j. p. danon, and j. j. goby, "rochon influence of food systems of the catalan maquis area of the composition of the milk fat of goat fao-ciheam," presented at the seminar on sustainable grazing, nutritional utilization and quality of sheep and goat products and rangelands, grenada (sp.), 2–4 october 2003, session 2, 2003. [21] e. bagnicka, a. winnicka, and a. jaowick, "relationship between somatic cell count and bacterial pathogens in goat milk," small rum. res., vol. 100, pp. 72-77, 2011. [22] j. k. kyozaire, c. m. veary, i. m. petzer, and e. f. donkın, "microbiological quality of goats milk obtained under different production systems," j. s. afr. vet. ass., vol. 76, pp. 69-73, 2005. [23] r. foschino, a. invernizzi, r. barucco, and k. stradiotto, "microbial composition including the incidence of pathogens of goat milk from the bergamo region of italy during lactation year," j. dairy res., vol. 69, pp. 213-225, 2002. [24] m. d. pertinez, m. j. alcalde, j. l. gazman, j. m. castel, and f. caravaca, "effect of hygiene sanitory management on goat milk quality in semiextensive systems in spain," small rum. res., vol. 47, pp. 51-61, 2003. [25] z. j. liu and n. p. mcmeniman, "effect of nutrition level and diets on creatinine excretion by sheep," small ruminant res., vol. 63, pp. 265-273, 2006. [26] j. a. imasuen, "effect of different management environment on hematological perfomance ın west african dwarf (wad) goats," journal of research ın forestry, wıldlıfe and envıronment, vol. 4, pp. 73-78, 2013. [27] c. luckstadt, acidifiers in animal nutrition, 1st ed. nottingham: nottingham university press, 2007. [28] t. sahlu, h. carnerıo, h. m. e. l. shaer, and j. m. fernandez, "production performance and physiological responses of angora goat kids feed acidified milk replacer," j. dairy sci., vol. 75, pp. 1643-1650, 1992. animal review, 2016, 3(2): 36-42 41 © 2016 conscientia beam. all rights reserved. [29] k. h. teh, s. flint, j. palmer, d. lindsay, p. andrewes, and p. bremer, "thermo-resistant enzyme-producing bacteria isolated from the internal surfaces of raw milk tankers," international dairy journal, vol. 21, pp. 742-747, 2011. table-1. chemical composition of diets and roughages dm (g kg-1) nutrient composition extensive farm a semi-intensive farm b oat hay corn silage alfalfa hay barley hay diet dm 945.0 316.6 942.5 668.6 880.0 om 894.1 263.0 857.6 599.7 790.0 cp 27.9 69.4 128.0 35.3 180.0 ee 5.7 25.9 10.3 7.6 44.0 cell 306.5 226.3 328.0 365.2 112.0 ca 50.9 53.6 84.9 68.9 90.0 nitrogen free ext 554.0 391.3 191.6 454.0 starch 16.3 275.1 19.5 10.8 ndf 757.7 484.4 511.4 759.7 adf 607.4 363.3 450.8 612.9 adl 64.0 45.2 124.2 75.0 me (kcal kg dm-1)3 1710 731.34 1837.87 1183.42 2600 dm, dry matter; om, organic matter; cp, crude protein; ee, ether extract; cell, cellulose; ca, crude ash; ndf, neutral detergent fiber; adf, acid detergent fiber; 3 obtained by calculation [11]. table-2. dm intake, milk yield and composition and blood metabolites from two different goat farms (mean±se). item n a n b p-value body-weight 16 43.219±0.860 16 45.192±1.313 ns silage dm intake (kg d-1) -0.47 alfalfa dm intake (kg d-1) 0.94 barley straw dm intake 0.26 oat straw dm intake 1.89 concentrate dm intake 0.18 total dm intake1 1.89 1.86 milk yield (kg d-1) 16 1.38±0.08 16 1.76±0.07 * fat (%) 16 4.40± 0.28 16 1.89± 0.19 * snf (%) 16 9.12±0.07 16 8.92±0.13 ns protein (%) 16 3.64±0.05 16 3.39±0.13 ns lactose (%) 16 4.65±0.04 16 4.74±0.02 ns scc(x log10 ml-1) 16 362±61.03 16 304±71.91 ns tb ( x log10 cfu ml-1) 16 4.58±1.60 16 1.09±0.40 * blood parameters cre (mg dl-1) 6 1.11±0.07 6 0.56±0.17 * cholesterol (mg dl-1) 6 111.33±7.85 6 101.83±3.24 ns ggt (u l-1) 6 37.95±0.49 6 37.61±1.79 ns glucose (mg dl-1) 6 24.23±1.83 6 61.43±1.46 * urea (mg dl-1) 6 30.77±1.05 6 31.10±0.95 ns 1total dm intake values for goats were not added to pasture consumption. snf, non-fat solids; scc, somatic cell count; tb, total bacteria; cre, creatinine; ggt, gamma glutamyl transpeptidase; sem=standard error of the mean; ns, not significant; *p-value<0.05. ** p-value<0.01. x sx  x sx  animal review, 2016, 3(2): 36-42 42 © 2016 conscientia beam. all rights reserved. table-3. summary of bacteriological results from the milk of farm a and farm b extensive farm a bacteria isolates number (n) isolation ratio (%) staphylococcus haemolyticus 8 25.0 staphylococcus chromogenes 5 15.6 enterococcus faecium 4 12.5 e.coli 3 9.4 staphylococcus aureus 3 9.4 staphylococcus warneri 2 6.3 bacillus cereus 2 6.3 staphylococcus caprae 2 6.3 bacillus pumilus 1 3.1 bacillus licheniformis 1 3.1 staphylococcus pasteuri 1 3.0 total 32 100 semi-intensive farm b bacillus cereus 11 47.8 enterococcus faecium 1 4.3 bacillus licheniformis 2 8.7 pseudomonas fluorescens 1 4.3 e.coli 1 4.3 enterococcus hirae 1 4.3 streptococcus bovis i (group d 1 4.3 pseudomonas putida 1 4.3 staphylococcus haemolyticus 1 4.3 enterococcus feacalis 1 4.3 cedecea lapagei 1 4.3 acinetobacter lwoffii /haemolyticus 1 4.4 total 23 100 source: bacterial identification based on bbl crystal identification systems [29]. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 52 † corresponding author © 2016 conscientia beam. all rights reserved. effect of environmental pollution on production and metabolic profile in buffalo cows fiorella sarubbi1† --raffaele palomba2 --assunta arrichiello3 --giuseppe auriemma4 1,2,3,4institute for animal production system in mediterranean environment. national research council, naples, 80147 naples, italy abstract the aim of this study was to verify the effects of environmental impact caused by dioxin on milk production and metabolic profile in the buffalo cows. the authors analyzed some representative blood parameters related to their different metabolisms, the amount of zinc in blood samples, and milk production parameters, on 160 buffalo cows raised in four farms located in areas with a different environmental impact. urea, glucose, creatinine, ast (aspartate aminotransferase), alt (alanine aminotransferase) and zinc contents were determined on serum samples. milk samples from each buffalo were collected. daily milk yield and milk composition were significantly different among farms. no difference in milk protein content was found. urea content, was higher. glucose concentrations were significantly lower than in farms located in an area contaminated by dioxin. creatinine values were normal. ast and alt values were slightly higher than normal. so far, there are not studies on the effect of dioxin on production and metabolic profile in buffalo cows. this study indicates that buffalo breeding herds exposed to dioxins would induce damage in the hepatic parenchyma cells as a result of animal welfare. accordingly, the effects of environmental pollutants may expose the animals to several infections and diseases, which could affect not only the production traits, but also the qualitative features of their products devoted to human consumption. keywords: dioxin, metabolic profiles, milk quality, buffalo cows, polychlorinated dibenzo-para-dioxins/ furans, polychlorinated biphenyls. received: 13 october 2016/ revised: 4 november 2016/ accepted: 9 november 2016/ published: 14 november 2016 contribution/ originality considering the increasing economic relevance of the buffalo and considering the insufficiency information in the literature on the influence of micro pollutants on the buffalo, this work has focused the attention on the influence the environmental impact on buffalo health and on their production. it is important to remember that the animal is closely linked to the area, monitoring animal’s means monitoring the breeding environment. 1. introduction the increasing economic relevance of the italian mediterranean buffalo is due to the lack of milk production quotas in the european union and especially to the high market demand of buffalo “mozzarella” cheese, whose price is more than double than cow “mozzarella”. livestock animals represent a crucial point in the food chain, as they transform vegetable matter in animal protein. since the animal populations are closely linked to the area, monitoring animals means monitoring the breeding environment, especially in case of natural pasture or vegetal products growing in the same territories. animal review 2016 vol. 3, no. 2, pp. 52-58 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.2/101.2.52.58 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.2/101.2.52.58 animal review, 2016, 3(2): 52-58 53 © 2016 conscientia beam. all rights reserved. usually animals are kept on paddocks and are mainly fed with unifeed during lactation and with pasture in case of dry cows and heifers. the italian buffalo cow produces on average 2150 kg of milk per lactation, containing 8.28 and 4.74% of fat and protein respectively. according to food and agricultural organization (fao) [1] in italy the buffalo cow population increased from 182,000 heads in 2000 (68% female) to 307,100 heads in 2009 (63% female) and the buffalo milk production increased from 135,100 tonnes in 2000 to 210,000 tonnes in 2009. however, the knowledge of the effects of environmental pollution on milk production for this species is limited. recently, environmental pollution received increasing attention from politics, both at national and international level, as a result of the increasing awareness of social and health aspects involved in this issue. in particular, during the last two decades, a large environmental devastation occurred on several italian regions, because of the burning of municipal waste releasing significant quantities of high pollutant contaminants. iron and steel manufacturing factories are responsible for the emission of harmful pollutants, such as dioxin, sulphur oxides, nitrogen oxides, hydrocarbons etc. that can cause genotoxic and carcinogenic effects [2-5]. dioxin are polyhalogenated aromatic hydrocarbons, highly toxic and persistent, present at low level in the air, soil, water, feed as well as in foods such as dairy products [6]. a dioxin and furan concentration analysis were published in 2008 by arpac (regional agency for environmental protection of campania) [7] allowing the identification of three contaminated areas, scored as high (>1.4 ng/kg of dioxin and furan in the soil), medium (<1.4 and >1.0 ng/kg) and low (<1.0 ng/kg) impact. therefore, fodder is contaminated by toxic chemicals and the animal eats large quantities of these contaminants in feed, possibly damaging their own health and that of the human consumer of their products. some metals act as catalysts for dioxins and furans synthesis [8] actually providing a surface for a rapid formation of these compounds. according to the who (world health organization), metals of most immediate concern are chromium, zinc, iron, mercury and lead; zinc is a trace element essential in quantities exceeding any other trace element, besides iron, it is known for its protective properties against diseases and is also very important for immune system. considering the dual role (positive and negative) and toxicity of metals we made a preliminary investigation quantifying the blood parameters representative of the energetic and protein metabolisms, the zinc amount in blood samples, and the milk parameters of buffaloes reared in farms located in areas having different environmental impact. 2. material and methods 2.1 farm selection and animals the present research involved 160 lactating buffaloes in four farms (40 per farm), during 90 days of lactation. two of them (a and b) were located in an area of low environmental impact (near salerno – italy) and the other two (c and d) were in an area of high environment impact (near caserta – italy) (table 1). table-1. dioxin levels in the milk mass obtained from buffalo cows of groups a, b, c and d buffalo farms a b c d who-pcdd/f-teq (pg./g of fat) n.d. n.d. 17.00 (3.0) 15.90(3.0) who-pcb-teq (pg./g of fat) n.d n.d. 4.79 4.50 who-pcdd/f-pcb-teq (pg./g of fat) 1.6 (6.0) 1.3 (6.0) 21.79 (6.0) 20.57 (6.0) who: world health organization; teq: toxic equivalents; pcdd/f: polychlorinated dibenzo-para-dioxins and furans; pcb: polychlorinated biphenyls; n.d.: not detected maximum levels legally admitted are reported in parenthesis. data are expressed as pg. per g of milk fat farms were chosen on the basis of the agenzia regionale per la protezione ambientale della campania [7]. a and b farms showed dioxin, pcdd/f (polychlorinated dibenzo-para-dioxins/ furans) and pcb (polychlorinated animal review, 2016, 3(2): 52-58 54 © 2016 conscientia beam. all rights reserved. biphenyls) levels lower than 2 pg./g of milk fat, while in c and d farms these values were higher than 3 pg./g of milk fat (maximum permitted level reported by the commission directive 2002/69/ec of 26 july 2002). lactating buffalo cows were randomly sampled in farms. in each farms groups were homogeneous in parity, body condition score (bcs) and health condition. the analysis of dioxin levels in milk samples was carried out by accredited italian laboratories in according to the standards of national health agency. in each of the farms, animals had ad libitum access to unifeed containing vitamins and minerals. farms were also chosen according to their management: as shown in table 2, farms a and c, and farms b and d were also similar in ration characteristics, both in terms of forage/concentrate ratio (f:c), and chemical-nutrition characteristics. animals were raised in open paddocks in all farms. table-2. feed and chemical composition of the diets (as percent of dry matter) buffalo cows farm a b c d mais silage % 62.90 37.50 46.20 36.00 wheat straw % 14.30 --- concentrate % 8.00 43.90 20.5 44.00 barley straws % -18.60 12.80 - ryegrass hay % --20.50 20.00 f:c ratio 68.5 : 31.5 44.8 : 55.1 65.6 : 34.4 48.1 : 51.9 chemical composition crude protein %dm 13.70 16.82 13.38 18.65 ether extract %dm 3.51 3.89 3.15 3.92 crude fiber %dm 20.73 18.37 23.86 16.11 ash %dm 7.68 8.36 7.99 8.48 ndf %dm 37.52 28.79 44.21 24.49 adf %dm 22.93 18.73 27.80 14.53 nsc %dm 37.58 42.15 31.72 44.47 milk forage unit kg-1dm 0.79 0.79 0.74 0.83 ndf, neutral detergent fiber; adf, acid detergent fiber; nsc, nonstructural carbohydrates in each farm, the following mineral integrations, gr per kg of concentrate, were used (table 3). table-3. mineral integration in each farm (gr per kg of concentrate) mno feco3 cuo coso4•7h20 ki zno na2seo3 a 100.0 80.0 20.0 1.3 1.0 160.0 0.4 b 190.0 120.0 30.0 2.0 2.0 250.0 0.1 c 160.0 140.0 45.0 3.0 5.0 330.0 0.5 d 150.0 80.0 20.0 1.3 1.0 160.0 0.4 mno, manganous oxide; adf, feco3iron triossocarbonate; cuo, cupric oxide; coso4•7h20, cobalt sulfate heptahydrate; ki, potassium iodide; zno, zinc oxide; na2seo3, sodium selenite. 2.2 determination of metabolic profiles and zinc urea, glucose, creatinine, ast and alt contents were determined on serum samples, collected once a week from each buffalo from the jugular vein by the vacutainer method (12 samples per animal per farm). blood parameters were determined on serum by using reflotron (boehringer, ingelheim, germany), measuring urea, creatinine, alt, ast and glucose (table 4). the reference metabolic values are those reported by commission scientific association of animal production (aspa) [9] and shown in the legend. animal review, 2016, 3(2): 52-58 55 © 2016 conscientia beam. all rights reserved. zinc content was determined on serum samples by atomic absorption spectrometry. milk samples from each buffalo were collected fortnightly for 90 days (6 samples per animal per farm), during the morning and afternoon milking, in order to evaluate milk composition (fat and protein) by infrared method (milko scan 133b foss electric, hillerød, dk, calibrated with the appropriate buffalo standard). the numbers of somatic cells on each milk samples were determined by a fluoro-optometric method (fossomatic 90). somatic cell count (scc) was log10-transformed before analysis because it was not normally distributed. the samples for determining all parameters were processed in triplicate. table-4. metabolic profile buffalo cows, farms a b c d means ± sd means ± sd means ± sd means ± sd urea mg/dl 54.62 ± 8.12 56.40 ±9.41 50.90 ± 7.67 50.62 ± 8.25 glucose mm/l 3.34 ± 0.26 b 3.36 ± 0.95 b 2.41 ± 0.64 a 2.34 ± 0.71 a creatinine µm/l 137.4 ±16.79 136.27 ± 18.36 127.55 ± 16.57 129.78 ± 15.32 ast ui/l 157.0 ± 25.87 b 158.08 ± 26.13 b 165.77a ± 27.67 a 161.87 ± 29.92 a alt ui/l 63.49 ± 8.58 b 63.85 ± 9.24 b 66.15 ± 10.73 a 67.53 ± 9.15 a zinc µm/l 8.59 ± 0.99 a 8.65 ± 0.93 a 7.62 ± 0.94 b 7.55 ± 0.91 b a, b is significant at the 0.01 level reference values aspa commission: urea: 30 – 45 (mg/dl); glucose: 4.1 – 4.5 (mm/l); creatinine: 120 – 155 (µm/l); ast: 120-145 (ui/l); alt: 30-37(ui/l); zinc: 9-12 (µm/l). 2.3. statistical analysis anova was carried out to evaluate significant differences on milk production and milk quality among farms [10]. 3. results and discussion 3.1. analysis of metabolic profile and zinc content the arh cell receptor (aryl receptor hydrocarbon) is located in both the cytoplasm and nucleus of cells. dioxins bind to this receptor diffusing into the cells, which are equipped with arh receptors. the dioxin-receptor complex binds to a nuclear protein called arnt (ar nuclear translocator). thus forming a complex similar to some sequences of dna results in: interactions with growth factors; activity on the metabolism of some hormones; activity on the mechanisms of differentiation and cell division; hormone disturbances. according to these activities the study of the influence of different levels of dioxin on some proteins and energetic metabolisms has been widened. table 4 shows the average of metabolic profile on blood samples during the trial. urea content appears to be slightly higher than normal values in all tested farms. similar values were found by campanile, et al. [11]. the values we observed appear to be related to those that we observe when the buffalo recycles endogenous urea to maintain protein balance, which during chronic stress can induce inflammatory mechanisms in organs and tissues. in all tested buffalos, glucose values were significantly lower than the physiological values. this attitude may be due to both an energy deficit, to which animals can be subjected, and a prolonged stress. in ruminants the blood animal review, 2016, 3(2): 52-58 56 © 2016 conscientia beam. all rights reserved. glucose derives mainly from propionic acid produced in the rumen, and in a smaller extent from amino acids or from direct ingestion of starch. the latter is the most important action, which explains the huge variety of effects induced by dioxins. actually, two glands, adrenal medulla and pancreas, act keeping the blood glucose at a constant, balanced level, hence optimizing its use by many kinds of cells. the former produces adrenaline, a substance causing the raising of the blood glucose level, while the latter produces insulin, an hormone that helps "clearing" the blood glucose so that it enters in cells of several organs. strongly stressful situations stimulate the adrenal medulla to produce excess adrenaline, which in turn causes a rise in blood glucose. consequently, blood glucose level will rise, resulting in a continuous insulin requirement by the pancreas. thus one can achieve pancreatic stimulus such that even after small increases in blood glucose, a large insulin response will result, causing an excessive lowering of the glucose level according to sood, et al. [12]. these authors reported that chronic stress is associated with hormonal changes that are known to affect multiple systems, including the immune and endocrine systems. in farms located in high environmental impact areas, glucose concentration was significatively lower than that achieved in those localized in high impact areas. consequently, in c and d farms the environmental stress likely influenced the glucose levels, reducing them (p<0.01). the creatinine values were normal. the high levels of aspartate aminotransferase and alanine aminotransferase are pathognomonic of a liver disturbance. since the aspartate transferase enzyme is localized in the cytoplasm of biliary canals, it can be inferred that the damage is present in the parenchymatous cells. this cytolysis may not be directly linked to the environmental impact, but rather to a lack in glucose and a higher level of ammonia, or to an inflammatory reaction, that causes a reduction of circulating zinc. actually the highest values of alt and ast were observed in farms located in areas of higher environmental impact, these differences being highly significant (p<0.01). terzano, et al. [13] reported that different management and different environment influence glucose, nefa (non esterified fatty acids), urea, ast and alt concentrations. zinc values recorded in a and b farms were very close to their physiological levels, while in c and d farms the lacking of zinc is even more evident. these values can likely be related to the different pollution level to which different farms are exposed, and are consistent to the other measured blood parameters. this confirms the suspected effect of the environmental impact on different metabolisms, especially considering that mineral integration in highimpact farms is greater than in a and b farms. xu, et al. [14] showed that integration of vitamin e can reduce the effects of dioxin on the reproductive system in experimental animals. spagnuolo, et al. [15] reported that the higher levels of products of oxidative damage (pc protein-bound carbonyls, n-tyr nitro-tyrosine and lpo hydroperoxides), and decreased levels of antioxidants were detected in buffalo cows exposed to dioxins. this clearly indicates that breeding in dairy herds exposed to dioxins promotes plasma protein and lipid oxidation. the above-reported differences in the blood redox condition between the analyzed groups would indicate that exposure to dioxins impairs the non-enzymatic component of the antioxidant defense system, and that metabolic processes associated to dioxin detoxification might induce and/or enhance oxidative protein and lipid damage. 3.2. analysis of milk quality table 5 shows the average of milk yield, percentage of fat and protein, and scct (somatic cell count transformed log10) values of the milk collections during the trial. animal review, 2016, 3(2): 52-58 57 © 2016 conscientia beam. all rights reserved. table-5. daily milk yield and composition; number of transformed somatic cells buffalo cows farm a b c d means ± sd means ± sd means ± sd means ± sd m.y. (kg) 16.4 b ± 1.33 13.7 d ± 1.17 17.6 a ± 1.38 15.5 c ± 1.25 fat (%) 9.06 a ± 2.01 8.71 b ± 1.98 8.18 d ± 2.10 8.43 c ± 1.80 protein (%) 4.65 ± 0.94 4.71 ± 0.93 4.69 ± 0.87 4.67 ± 0.91 scc transformed 2.07 c ± 0.42 2.00 d ± 0.50 2.15 b ± 0.47 2.25 a ± 0.45 a, b, c and d is significant at the 0.05 level daily milk yield, fat content and scct resulted significantly different among farms (p<0.05), while no difference was found in milk protein content. 4. conclusions the buffalo, for its characteristics of rusticity, is probably able to better tolerate the stress factor represented by micro pollutants. this result indicates that buffalo breeding herds exposed to dioxins would induce damage in the hepatic parenchyma cells by consequences on animal welfare. accordingly, the effects of environmental pollutants may render animals susceptible to several infections and diseases, which could affect not only the production traits, but also the qualitative features of their products devoted to human consumption. however further investigation is necessary to assess the long-term effects on the productions. funding: the study was supported by the italian national research council under dg.rstl.083.001 we are grateful to giuseppe grazioli for his technical assistance. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] food and agricultural organization (fao), "faostat agriculture data." retrived from http://faostat.fao.org/default.aspx, 2010. [2] l. borskà, z. fiala, j. smejkalovà, and j. tejral, "health risk of occupational exposure in welding process i. genotowic risk," acta medica (hradec kralove), vol. 46, pp. 25-9, 2003. [3] b. desoize, "metals and metal compounds in cancerogenesis," in vivo, vol. 17, pp. 529-39, 2003. [4] r. mateuca, p. aka, m. de boeck, r. hauspie, m. kirsch-volders, and d. lison, "influence of h0gg1, xrcc1 andb xrcc3 genotypes on biomarkes of genotoxicity in workers exposed to cobalt or hard metal dists," toxicol. lett., vol. 1562, pp. 277-88, 2005. [5] d. cavallo, c. ursini, r. maiello, p. apostoli, s. catalani, and a. ciervo, "genotoxic and oxidative effects induced on a549 cells by extract of pm10 collected in an electric steel plant," acta biomed., vol. 79, pp. 87-96, 2008. [6] f. matsumura, "on the significance of the role of cellular stress response reactions in the toxic actions of dioxin," biochem. pharmacol., vol. 66, pp. 527–540, 2003. [7] agenzia regionale per la protezione ambientale della campania, arpac 2008 book: siti contaminati in campania. italy, n.d. [8] s. schlumberger, m. schuster, s. ringmann, and r. koralewska, "recovery of high purity zinc from filter ash produced during the thermal treatment of waste and inerting of residual materials," waste management & research, vol. 5, pp. 547-55, 2007. http://faostat.fao.org/default.aspx, animal review, 2016, 3(2): 52-58 58 © 2016 conscientia beam. all rights reserved. [9] commission scientific association of animal production (aspa), study commission: assessment buoyancy endocrine metabolism of animals in livestock production. guide the interpretation of metabolic profiles university of perugia . italy, 1999. [10] spss base system user's guide. chicago, il, usa: version 12.0. spss inc, 2003. [11] g. campanile, g. neglia, r. di palo, gasparrini, c. pacelli, and m. d’occhio, "relationship of body condition score and blood urea and ammonia to pregnancy in italian mediterranean buffaloes," reproduction nutrition development, vol. 46, pp. 57-62, 2006. [12] a. sood, g. armaiz-pena, j. halder, m. alpa, r. stone, w. hu, a. carroll, w. spannuth, m. deavers, j. allen, l. han, a. kamat, and m. shahzad, "adrenergic modulation of focal adhesion kinase protects human ovarian cancer cells from anoikis," j clin invest, vol. 120, pp. 1515-1523, 2010. [13] g. terzano, s. allegrini, m. d’elisi, m. mazzi, m. razzano, and a. borghese, "effect of intensive or extensive systems on buffalo heifers performances: blood metabolite values," italian journal animal science, vol. 6, pp. 1268-72, 2007. [14] j. xu, y. yi, and x. zhou, "effect of vitamin e on reproductive function in the mice treated with 2,3,7,8tetrachlorodibenzo-p-dioxin," toxicology and industrial health, vol. 24, pp. 595-601, 2008. [15] m. spagnuolo, f. sarubbi, c. rossetti, g. grazioli, g. di meo, and l. iannuzzi, "effect of dioxin exposure on several indices of blood redox status in lactating buffalo cows," journal of dairy research, vol. 4, pp. 1-6, 2011. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 65 † corresponding author © 2014 conscientia beam. all rights reserved. identification of cattle persistently infected with bvdv (pi) by ear-notch testing in southeast of iran ali asghar mozaffari1† --mohammad khalili2 --farzaneh jahangosha3 1department of clinical studies, school of veterinary medicine, shahid bahonar university of kerman, kerman, iran 2department of pathobiology, school of veterinary medicine, shahid bahonar university of kerman, kerman, iran 3graduated, school of veterinary medicine, shahid bahonar university of kerman, kerman, iran abstract bovine viral diarrhea virus (bvdv) infection can induce a variety of economically important clinical manifestations in cattle herds. one potential outcome is the creation of calves that are viremic but immunotolerant to the virus. these persistently infected (pi) calves are the result of in utero exposure to bvdv prior to the development of a competent fetal immune system. the aim of this study was to detect of cattle persistently infected with bvdv by ear-notch testing in southeast of iran. ear-notch skin samples, 3 mm in diameter, were collected from a total of 127 cattle from 6 randomly selected herds (calves aged under 12 months ), using pliers usually used for ear tagging and skin notch sampling, as described by the manufacturer of the herd check elisa kit (idexx) for the detection of bvdv antigen in pi cattle. overall, 0.78 per cent of the animals examined, were positive for bvdv antigen.this study identifies the cattle persistently infected with bvdv by ear-notch testing in southeast of iran for the first time. keywords: bvdv, pi, cattle, iran, ear-notch. contribution/ originality this study identifies the cattle persistently infected with bvdv by ear-notch testing in southeast of iran for the first time. 1. introduction bvdv is one of the most economically important pathogens in the cattle industry nowadays [1-4]. bovine viral diarrhea virus (bvdv) infection can produce a variety of economically important clinical manifestations in cattle herds. one potential outcome is the creation of calves that are viremic but immunotolerant to the virus. these persistently infected (pi) calves are the result of in utero exposure to bvdv prior to the development of a competent fetal immune system [5]. the calves are persistently viremic and continue to shed the virus for the rest of their lives. the neonatal mortality of pi calves is high and some of them are born weak [6]. pi calves can present as stunted animals with an unthrifty coat, but not all pi animals are in poor condition animal review 2014 vol. 1, no. 4, pp. 65-68 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(4): 65-68 66 © 2014 conscientia beam. all rights reserved. and it is not possible to diagnosis them from the physical appearance [7]. the real danger of pi calves lies in the fact that they are persistently viremic, immunosuppresed and constantly/intermittently shedding virus, and are the main source of infection for other animals [8, 9]. if pi calves can be detected, they can be removed in time to prevent spreading of virus to susceptible animals [10]. to the best of our knowledge, no report has been published on cattle persistently infected with bvdv in iran. the aim of this study was to detect of cattle persistently infected with bvdv by ear-notch testing in southeast of iran. 2. materials and methods ear-notch skin samples, 3 mm in diameter, were collected from a total of 127 cattle (iranian cross-breed) from 6 randomly selected herds (dairy cattle with different numbers) in kerman province of iran (calves aged under 12 months), using pliers usually used for ear tagging and skin notch sampling, as described by the manufacturer of the herd check elisa kit (idexx) for the detection of bvdv antigen in pi cattle. the collected samples were covered with the soaking buffer provided in the elisa kit, and were stored at –80°c until required. the elisa kit was then used on the collected ear-notch samples, according to the manufacturer’s instructions. the idexx bvdv ag/serum plus test is an enzyme-linked immunoassay for the detection of bovine viral diarrhea virus antigen in serum, plasma, whole blood and ear-notch tissue samples. to confirm pi, the animals were tested two or three weeks after first sampling. 3. results table 1 shows the results for detection of bvdv antigen in the 127 ear-notch samples. overall, 0.78 per cent of the animals examined were positive for bvdv antigen. the pi animal was not tested for antibodies anti-bvdv. the clinical condition of pi animals was normal in other respect. the history of studied farms showed a number of reproductive/respiratory problems, abortion, etc. 4. discussion ag elisa using ear-notch samples is an efficient technique for diagnosis of pi calves [11]. ear-notch testing is respected by many researchers as the method of choice to detect pi animals in cattle herds, as the samples are easy to collect, sophisticated equipment is not required, the samples can be used in a number of bvdv detection systems and they are not affected by the presence of passive antibodies [3, 11-15]. results of present study were accordant with records in the literature from other countries that indicated that up to 2 percent of cattle are pi with bvdv in most countries [3, 11, 15, 16]. the results of the this study indicate that there is bvdv activity in the farms under study, which necessitates a control policy to be implemented immediately [17, 18]. firstly, all existing pi calves should be eliminated from the herd, and routine testing of cattle should be introduced to enable the early identification and removal of new pi animals [15]. animal review, 2014, 1(4): 65-68 67 © 2014 conscientia beam. all rights reserved. secondly, precolostral serum samples from apparently healthy neonatal calves could be tested to determine exposure to bvdv in utero from 150 days of gestation; at this gestational age the fetus will be able to produce antibodies to bvdv, which will protect it from the ill effects of the virus, and the antibodies will be detectable in serum samples taken before colostrum feeding. calves infected in utero before 150 days will not mount an antibody response and can be pi. the third, the tissues of neonatal calves showing congenital malformations should be tested to confirm their exposure to bvdv. at last, surveillance should be carried out on the farm for animals showing clinical signs suspicious of mucosal disease [15]. as a result of present work, it is suggested that other dairy farms in iran also need to carry out a similar program of testing for bvdv and then adopt an appropriate control policy in the light of the findings [3, 15]. to the best of our knowledge, no report has been published on calves persistently infected with bvdv in iran. this study identifies the calves persistently infected with bvdv by ear-notch testing in southeast of iran for the first time. references [1] i. firat, s. ak, and h. bozkurt, "distribution of bovine viral diarrhoea virus (bvdv) in the genital system tissues of cattle," vet. arhiv., vol. 72, pp. 235-248, 2002. [2] m. van vuuren, "bovine viral diarrhea virus infection in livestock in southern africa. cab reviews," perspecfives in agriculture, veterinary science, nutrifion and natural resources, vol. 2005, pp. 4-12, 2005. [3] h. houe, a. lindberg, and v. moennig, "test strategies in bovine viral diarrhea virus control and eradication campaigns in europe," j. vet. diagn. invest., vol. 18, pp. 427-436, 2006. [4] m. hilbe, h. stalder, and e. peterhans, "comparison of five diagnostic methods for detecting bovine viral diarrhea virus infection in calves," j. vet. diagn. invest., vol. 19, pp. 28-34, 2007. [5] t. wittum, d. grotelueschen, and k. brock, "persistent bovine viral diarrhoea virus infection in us beef herds," prev. vet. med., vol. 49, pp. 83-94, 2001. [6] l. a. moczygemba, "review of the relationship between persistent infection of cattle with bovine viral diarrhea virus and feedlot morbidity and gain," bovine pr., vol. 37, pp. 155-161, 2003. [7] l. potgieter, "bovine viral diarrhoea and mucosal disease," infect dis livestock, vol. 2, pp. 946-969, 2004. [8] j. kampa, k. stahl, and l. renstrom, "evaluation of a commercial erns-capture elisa for detection of bvdv in routine diagnostic cattle serum samples," acta vet. scand., vol. 49, pp. 1-7, 2007. [9] c. luzzago, m. frigerio, and f. tolari, "indirect immunohistochemistry on skin biopsy for the detection of persistently infected cattle with bovine viral diarrhoea virus in italian dairy herds," new microbiol., vol. 29, pp. 127-131, 2006. [10] t. meiring, l. prozesky, e. r. du preez, and d. j. verwoerd, "the diagnosis and prevalence of persistent infection with bovine viral diarrhea virus in south african feedlot cattle," onderstepoort j. vet. res., vol. 78, p. 323, 2011. animal review, 2014, 1(4): 65-68 68 © 2014 conscientia beam. all rights reserved. [11] t. cornish, a. van olphen, and j. cavender, "comparison of ear notch immunohistochemistry, ear notch antigen-capture elisa, and buffy coat virus isolation for detection of calves persistently infected with bovine viral diarrhea virus," j. vet. diagn. invest., vol. 17, pp. 110-117, 2005. [12] s. kuhne, c. schroeder, and g. holmquist, "detection of bovine viral diarrhoea virus infected cattleâ€“testing tissue samples derived from ear tagging using an erns capture elisa," j. vet. med. b., vol. 52, pp. 272-277, 2005. [13] j. ridpath, b. hessman, and j. neill, "parameters of ear notch samples for bvdv testing: stability, size requirements and viral load," presented at the paper presented at: proc am assoc bov pract conf., 2006. [14] m. al-khaliyfa, e. abuelzein, and a. gameel, "identification of cattle persistently infected with bvdv by ear-notch testing in saudi arabia," vet. rec., vol. 167, pp. 660-661, 2010. [15] j. kampa, epidemiology of bovine viral diarrhoea virus and bovine herpesvirus type1 infections in dairy cattle herds. uppsala: sveriges lantbruksuniv, 2006, 2006. [16] a. lindberg and s. alenius, "principles for eradication of bovine viral diarrhoea virus (bvdv) infections in cattle populations," vet. microbiol., vol. 64, pp. 197-222, 1999. [17] components and goals of programs to control bvdv, available: www.ars.usda.gov/sp2userfiles/place/36253000/bvd2005/prod3_smith_hout.pdf.updatedla stupdateddate. [accessed january 8, 2013], 2005. [18] p. roeder and j. harkness, "bvd virus infection: prospects for control," vet. rec., vol. 119, pp. 143147, 1986. table-1. detection by elisa of bvdv antigen in ear notches from calves in 6 dairy farm herds in southeast of iran animals number tested number positive (%) herd 1(87) 27 0 herd 2(56) 23 1(0.78) herd 3(92) 24 0 herd 4(69) 19 0 herd 5(55) 18 0 herd 6(83) 16 0 total (442) 127 1(0.78) views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://www.ars.usda.gov/sp2userfiles/place/36253000/bvd2005/prod3_smith_hout.pdf.updatedlastupdateddate http://www.ars.usda.gov/sp2userfiles/place/36253000/bvd2005/prod3_smith_hout.pdf.updatedlastupdateddate 83 † corresponding author © 2016 conscientia beam. all rights reserved. the domestic livestock resources of turkey: social aspects, genetic resources and conservation of companion animal cats (felis catus) orhan yilmaz1 --yakup erdal erturk2 --fusun coskun3 --r. trevor wilson4† 1ardahan university, vocational high school of technical sciences, ardahan, turkey 2igdir university, faculty of agriculture, department of agricultural economics, igdir, turkey 3ahi evran university, vocational high school, department of vegetable and livestock production, kirsehir, turkey 4bartridge partners, umberleigh, uk abstract located at the boundaries of europe and asia, turkey is home to an extraordinary variety of domestic animal species and breeds that include bees, camels, cats, cattle, dogs, domestic fowl, donkeys, ducks, goats, geese, horses, mules, pigs, rabbits, sheep, silkworms, water buffalo and several species of domestic birds (partridge, pheasant, pigeon and ostrich). in addition to the clearly distinct angora and van cat breeds a short-haired nondescript cat breed is found throughout turkey. as well as private household ownership, angora cats have been raised at ankara zoo which has belonged to the ministry of food, agriculture and livestock since 1939. the van cat is raised at the van cat research centre at yuzuncu yil university in van province which also has a small clinic for the cats. there is a risk of extinction for the angora and van breeds but none for the short-haired nondescript type. this paper reviews social aspects, the genetic resources and conservation status of the native cat breeds of turkey. keywords: breed, angora cat, van cat, turkish native cat, genetic resources, pet animal, domestic animal. received: 3 december 2016/ revised: 31 december 2016/ accepted: 10 january 2017/ published: 19 january 2017 contribution/ originality the domestic cat is important in the social and cultural environments of turkey and has been kept as a companion/pet animal for many hundreds of years. two local cat breeds are valuable additions to the biodiversity of domestic animals. this paper provides the first overview of the cat in turkey. 1. introduction some forty species of animal have been domesticated by humans [1, 2]. in part due to its geographical location at the meeting point of europe and asia, turkey is home to almost half of these domesticated animals including include bees, camels, cats, cattle, dogs, domestic fowl, donkeys, ducks, goats, geese, horses, mules, pigs, rabbits, sheep, silkworms, water buffalo and several species of domestic birds (partridge, pheasant, pigeon and ostrich) [3]. the cat has advantages over dogs as a companion (pet) animal. cats are more independent, demand less attention to their toilet needs, do not have to be taken out for exercise and are satisfied with less external grooming. cats are not trained as are dogs and are generally less susceptible to disease and injury [4]. turkish cat breeds have been involved in racism and become victims in racism arguments. according to the star newspaper of 31 october 2000, under the heading of “kurdish cat”, the deutscher tierschutzbund (german animal welfare associations) had no interest in van cats until they heard a rumour that claimed turkish soldiers animal review 2016 vol. 3, no. 4, pp. 83-90 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.4/101.4.83.90 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.4/101.4.83.90 animal review, 2016, 3(4): 83-90 84 © 2016 conscientia beam. all rights reserved. were exterminating them in van region. the newspaper claimed that “the van cat was of interest to the germans because it was raised in kurdish area but the angora cat did not arouse the same interest because it was not in a kurdish area” [5]. the cat is one of the commonest figures as both stereotype and identity in turkish folklore and myths [6]. cats are also seen in many books and films as art or literature material [7-9]. during the 1990s when turkey's capital ankara was searching for a city emblem the angora cat was a favourite candidate [10]. a study in switzerland to identify the perpetrators of physical attack or robberies showed that the hairs of the angora cat (together with other cats and dogs) could be used in forensic investigations [11]. this paper reviews cat production, cat genetic resources and cat conservation activities in turkey. 2. domestication and history as all domestic cats, turkish cats are descended from the african wildcat (felis silvestris lybiaca). the fertile crescent was a place where cats were first domesticated. some archaeological remains show that cats were captured and attempts made to domesticate them by predynastic egyptians [12]. a genetic study has shown that the angora cat is closely related to the egyptian mau and to tunisian cats whereas the van cat is more closely related to israeli cats [13]. the small range of chromosome numbers -36 or 38 -in the felidae compared to 38 to 78 among the canidae shows that cats have not evolved to the same extent as dogs [14]. travelling between 1614 and 1626, the italian pietro della valle, drew attention to the angora cat in ankara. he noted the long hairs especially around the neck and tail and likened their tails to those of squirrels [15]. princess belgiojoso who visited ankara in 1858 noted that angora cats did not produce items for human consumption like goats but remarked that they were so beautiful, had different eye colours and had white long hair but some were deaf: they were not renowned as good hunters and spent their time being lazy inside the house [16]. an account in the kölnische zeitung newspaper about the city of gumushane in the nineteenth century noted that angora cats were white, grey, yellow or of mixed colours and were very beautiful [17]. cats from the eastern mountainous regions of anatolia developed into longhaired breeds such as the angora and the van through natural selection and directed (in-)breeding. long-haired cats were imported to parts of europe as early as the 14th century by soldiers returning from the crusades. they reached britain and france from asia minor, persia and russia as early as the late 16th century. the turkish angora was recognized as a distinct breed in europe by the 17th century. the turkish angora was used, almost to the point of extinction, to improve the coat of the persian. some cat associations consider the persian to be a natural breed but persians were developed from turkish angora mutations by british and american cat fanciers and in the 19th century persians and angoras were identical [18]. 3. genetic resources 3.1. overview in a study comprising 1040 cats of 38 breeds including 17 turkish angora and 28 turkish van cats it was shown that both were closely related to the russian blue. they also had affinities with the british shorthair/scottish fold and sphynx/devon rex [19]. another study showed turkish angora, turkish van and persian differed from siamese and bombay cats. this study also indicated that turkish angora and van cats had the pgd, me and esd loci but, unlike some other cat breeds, did not have enzyme loci ca 1 , sod, gpi and got [20]. an academic study investigated the genetic structure of various cat breeds through the use of microsatellites. the results indicated that the van had very high levels of heterozygosis. factorial correspondence analysis showed that turkish angora and van cats were different breeds and were statistically different from siamese and persian cats [4]. haematological characteristics analysed in van cats showed red blood cell counts as 7.8x106, white blood cell counts as 5.6x103 and blood platelets as 1.16x105. mean values of haemoglobin concentration were 12.5 g/dl animal review, 2016, 3(4): 83-90 85 © 2016 conscientia beam. all rights reserved. and haematocrit was 43.94%. mean corpuscular volume was 61.37 μ3, mean corpuscular haemoglobin was 16.85 pg and mean corpuscular haemoglobin concentration was 29.04% [21]. the prevalence of blood types a and b was examined in 28 angora and 85 van cats. frequencies of blood type a in angora cats was 40.0% and in van cats was 53.6%. values for blood type b were 60.0% in angora and 46.4% in van cats. there was no blood type ab in either breed [22]. in a study of serum elements in van cats levels of aluminium, barium, copper, manganese and strontium were statistically higher (p < 0.05) in male than in female cats but levels of arsenic, boron, cobalt, chromium, gallium, indium, iron, lead, lithium, nickel, selenium, silver, sulphur, vanadium and zinc did not differ between the sexes [23]. the levels of alanine aminotransferase, aspartate aminotransferase, glucose, total cholesterol, total protein, albumin, globulin, calcium, inorganic phosphorus and magnesium were determined in blood serum from angora and van cats. differences between the breeds were significant in mid-gestation for alanine aminotransferase and in late-gestation for globulin and calcium [24]. 3.2. angora cat (turkish: ankara kedisi) angora cats originated in ankara province in central anatolia. they are known for being easy to train and for a gentle temperament. they have been described as affectionate, intelligent and playful but enjoy peace and quiet [25]. turkish angoras were taken to canada in 1963 and were accepted as a pedigree breed in 1973 by the cat fanciers' association. until 1978 only white angoras were recognized but now all north american registers accept the angora in many colours and patterns. breeders in turkey are of the opinion that the cat fancy’s fine-boned version of their national breed is unrepresentative of true turkish cats which are much sturdier. american “turkish” angoras may have only a minimal remnant of the original ankara zoo dna and are only “purebred” on paper [26]. a study on 67 angora cats (33 at ankara zoo and 34 in private households) [4] showed average adult male weights of 3.8 kg and adult female weights of 3.4 kg. litter size was 2.92 with a survival rate to weaning of 73%. in the 33 zoo cats eye colour was different (dyschromatopsia: turkish = “tekgöz” or odd-eyed) in 30.3% of animals, amber in 48.5% and blue in 21.2%. among 34 household cats, dyschromatopsia was observed in 5.9% of animals, amber eyes were seen in 82.3% and blue eyes in 11.8% [4]. another study showed that percentages of odd-eyed and non-odd-eyed colour were 54% and 46% [27]. some 46% of all oestrous cycles were in spring and 64% in autumn [27]. hair care in th angora is easier than it is for persian cats due mainly to shorter and fewer hairs [28]. the coat has been described as very fine and silky with a lovely sheen and minimal undercoat [29]. the beautiful hair of the angora is very famous, with medium-length hairs on the body, longer around the neck and some curly hairs in the ears [4]. fibre diameter has been shown to be 23.5 μm, hauteur 27.5 mm, barbe 33.1 mm, tenacity 7.55 g/den and elongation 33.8% [27]. the most common coat colour is white but there are also black, blue (figure 1), chocolate, lilac, red, cream, tabby, grey, bicolour and tricolour (white-black-orange) [30]. figure-1. blue tabby angora source: photograph: orhan yilmaz animal review, 2016, 3(4): 83-90 86 © 2016 conscientia beam. all rights reserved. 3.3. van cat (turkish: van kedisi) van cats, known as “pişik” in the van region [31] are intelligent and agile. they are talented hunters of mice, lizards, birds and flies and other small insects but do not hunt other household animals or domestic poultry: they will eat melon, water melon and some other fruits. unlike most domestic cats the van is a strong swimmer. they prefer human attention and if this is not provided they can become quite wild. when fondled, vans jump onto a person's lap, slightly bite the hand and then lick it to show love whilst purring all the time. they can be quite jealous of attention by their owners to other cats or infants [31, 32]. when given food the cat twines itself around its owner's legs before it eats: it tests the temperature of its milk or food by means of its foot. it responds to its name at 2-3 months of age. the van cat is thus not only a utilitarian pest control agent but also a valued household member and a close friend. van cats appeared first in england in 1955 where they were known simply as turkish. a subsequent change to turkish van was to avoid confusion with the turkish angora. the turkish van cat club was established in 1983 and is committed to the promotion and welfare of turkish van and vankedisi cats: it holds an annual show. the van arrived in the usa in 1982. it was accepted into the cat fanciers’ association (usa) with a breed standard and championship status in 1994: vantastix is a non profit organization that aims to further the championship development of the turkish van and to provide an association for the common interest of breeders in the usa. there is also a strong fancy in australia [33]. the head shape is triangular, the body long and the tail long and fluffy. average adult male weight is 3.6 kg and that of females is 2.9 kg. the oestrous cycle is from february through june and lasts about 10 days [31] although other sources say that 60% of cycles occur in the spring and 40% in atumn [27]. gestation is about 62 days. after one month of gestation the female does not allow her abdomen to be touched and she starts to search for a quiet and dark place to give birth. suckling lasts about 50-60 days [31]. dyschromatopsia occurs in 73% of animals [27]. in the other 27% with both eyes of the same colour they are turquoise, blue or amber. the eyes of neonatal kittens are grey. from about 25 to 40 days the colour gradually assumes its permanent state [31]. the van cat has long white velvety hair (figure 2). although its fur is thick, it usually shivers in cold weather [31, 32]. fibre diameter has been measured as 25.6 μm, hauteur as 20.1 mm, barbe 23.4 mm, tenacity as 12.1 g/den and elongation as 24.0% [27]. figure-2. van cats at the van cat research centre, van yuzuncu yil university source: photograph: orhan yilmaz animal review, 2016, 3(4): 83-90 87 © 2016 conscientia beam. all rights reserved. 3.4. turkish native cat little formal study has been made on the turkish native cat but it can truly be described as nondescript. it is the ubiquitous household cat of the country, very common and widespread throughout. it receives little attention from its owners. usually short-haired, it occurs in a wide range of colours and in many mixed colours (figure 3). figure-3. colour diversity in turkish native cats (left to right, top to bottom): bicolour shorthair turkish native; black native cats from van; heavily pregnant native female; ginger tabby from istanbul; tabby and white shorthair turkish native; tricolour shorthair turkish native on the prowl source: all photographs: orhan yilmaz 4. conservation angora and van cats are native breeds of turkey. they were given legal status in 1997 when they were registered with the statements ts 12137 and ts 12138 by the turkish standards institution [32, 34, 35]. the short-haired nondescript cat breed found throughout turkey is not subject to official recognition. animal review, 2016, 3(4): 83-90 88 © 2016 conscientia beam. all rights reserved. ankara zoo, owned by the ministry of food, agriculture and livestock, has a small department for angora cats that was established in 1939. there are now some morphological differences between ankara zoo angora cats and angora cats raised in private households in ankara [4]. van yuzuncu yil university established the van cat research centre on its campus. the research centre includes a clinic for cats. as of 2006 some 336 cats were registered and treated at the centre. in the early twentyfirst century, van yuzuncu yil university and the environment directorate of van governorship prepared a van cat project to conserve this breed but the project was not implemented due to financial difficulties [31]. 5. conclusions hundreds of cat breeds around the world are endangered or approaching extinction. the angora and van breeds are in danger of extinction but there is no risk for the turkish native. stronger conservation programmes through a public-private partnership need to be established to ensure that the distinctive angora and van cats are conserved for future generations. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: the three first authors undertook fieldwork in turkey, contributed mainly to the literature review and wrote a rough first draft of the paper. the last author was responsible for the instigation of the study, contributed to the international literature review and modified and edited this version of the paper for technical content, presentation and language. all authors agree to the presentation of the paper. references [1] m. ertugrul, n. n. akman, g. dellal, and t. goncagul, "hayvan gen kaynaklarının korunması ve türkiye hayvan gen kaynakları [conservation of livestock genetic resources and farm animal genetic resources of turkey]," presented at the türkiye ziraat mühendisliği v. teknik kongresi, 17-21 january 2000, ankara. 2010, 2000. [2] m. ertugrul, g. dellal, c. almaci, a. o. akin, e. pehlivan, m. i. sosyal, and s. arat, "çiftlik hayvanları genetik kaynaklarının korunması ve sürdürülebilir kullanımı. tmmob ziraat mühendisleri [conservation of farm animal genetic resources and sustainable use]," presented at the odası türkiye ziraat mühendisliği vii. teknik kongresi, 11-15 january 2010, ankara, 2010. [3] o. yilmaz and r. t. wilson, "the domestic livestock resources of turkey: economic and social role, species and breeds, conservation measures and policy issues," livestock research for rural development, vol. 24, p. 157, 2012. view at google scholar [4] t. ozcetin, "ankara kedilerinde (felis catus angorensis) dış yapı, tüy, büyüme, gelişme ve üreme özellikleri üzerine araştırmalar [the morphological, coat, growth, development and reproduction characteristics of the angora cat (felis catus angorensis)," phd thesis, ankara, fen bilimleri enstitüsü, ankara üniversitesi, ankara, 2007. [5] m. g. bek, media and society. istanbul: zafer printing, 2003. [6] a. c. soyer, "storybooks of the pre-school kids: stereotypes and identities," journal of the social science institute of mehmet akif university, vol. 1, pp. 13-27, 2009. view at google scholar [7] m. o. oguz, "folklor: ortak bellek veya paylaşılan deneyim," millî folklor, vol. 74, pp. 5-8, 2007. view at google scholar [8] k. g. akdeniz, "simülasyon dünyasında çingeneler zamanı üzerinden post-modern batılı bilginin bir kritiği [the critics of western knowledge via gypsy time in a simulation world]," sosyoloji dergisi, vol. 3, pp. 503-516, 2011. view at google scholar [9] e. karatas, "mektup roman tekniği ve türk romanından i̇ki örnek: mektup aşkları ve kedi mektupları [the letter novel technique and two examples of turkish novel]," turkish studies, vol. 7, pp. 2173-2192, 2012. view at google scholar https://scholar.google.com/scholar?hl=en&q=the%20domestic%20livestock%20resources%20of%20turkey:%20economic%20and%20social%20role,%20species%20and%20breeds,%20conservation%20measures%20and%20policy%20issues https://scholar.google.com/scholar?hl=en&q=the%20domestic%20livestock%20resources%20of%20turkey:%20economic%20and%20social%20role,%20species%20and%20breeds,%20conservation%20measures%20and%20policy%20issues https://scholar.google.com/scholar?hl=en&q=storybooks%20of%20the%20pre-school%20kids:%20stereotypes%20and%20identities https://scholar.google.com/scholar?hl=en&q=folklor:%20ortak%20bellek%20veya%20paylaşılan%20deneyim https://scholar.google.com/scholar?hl=en&q=simülasyon%20dünyasında%20çingeneler%20zamanı%20üzerinden%20post-modern%20batılı%20bilginin%20bir%20kritiği https://scholar.google.com/scholar?hl=en&q=mektup%20roman%20tekniği%20ve%20türk%20romanından%20i̇ki%20örnek:%20mektup%20aşkları%20ve%20kedi%20mektupları animal review, 2016, 3(4): 83-90 89 © 2016 conscientia beam. all rights reserved. [10] a. ozer, "türkiye cumhuriyeti’nin başkenti ankara i̇çin düşünülen amblem ve tartışmalar [design of an emblem for ankara, the capital city of the turkish republic, and the disputes it brings]," anadolu üniversitesi sosyal bilimler dergisi, vol. 2, pp. 95-107, 2002. view at google scholar [11] t. a. ozer, "kıl delillerinin kriminalistik açısından önemi [importance of hair as criminological evidence]," polis bilimleri dergisi, vol. 2, pp. 291-304, 2000. view at google scholar [12] v. linseele, w. v. neer, and s. hendrickx, "evidence for early cat taming in egypt," journal of archaeological science, vol. 34, pp. 2081-2090, 2007. view at google scholar | view at publisher [13] m. j. lipinski, l. froenicke, k. c. baysac, n. c. billings, c. m. leuteneeger, a. m. levy, m. longeri, t. niini, h. ozpinar, m. r. slater, n. c. pederswen, and l. lyons, "the ascent of cat breeds: genetic evaluations of breeds and worldwide random-bred populations," genomics, vol. 91, pp. 12-21, 2008. view at google scholar | view at publisher [14] r. robinson, genetics for cat breeders. oxford: pergamon press, 1977. [15] e. grey, the travels of pietro della valle from the old english translation of 1664 by g. havers . london: hakluyt society, 1892. [16] a. galanti, türkler ve yahudiler. (tarihi, siyasi araştırma). türkçeleştirilmiş 3. bs. i̇stanbul vol. 2. istanbul: gözlem gazetecilik basın ve yayın, 1952. [17] n. alkan, "avrupalı seyyahların tasvirlerinde gümüşhane ve çevresi [gumushane and its region. depictions of the european pilgrims history studies," international journal of history, vol. 1, pp. 82-97, 2010. view at google scholar [18] f. simpson, the book of the cat. london: cassell and company ltd, 1903. [19] m. menotti-raymond, v. a. david, s. m. pflueger, k. lindblad-toh, c. m. wade, s. j. o’brien, and w. e. johnson, "patterns of molecular genetic variation among cat breeds," genomics, vol. 91, pp. 1-11, 2008. view at google scholar | view at publisher [20] v. altunok, n. yuksek, c. c. berkman, z. t. agaoglu, and i. togan, "genetic structure and variation of van cats," biochemical genetics, vol. 49, pp. 511-522, 2011. view at google scholar | view at publisher [21] m. eksen, z. t. agaoglu, and e. keskin, "sağlıklı van kedilerinde bazı hematolojik değerler [some haematological values in healthy van cats]," selçuk üniversitesi, veteriner fakültesi dergisi, vol. 8, pp. 45-47, 1992. view at google scholar [22] s. arikan, s. y. duru, m. gurkan, z. t. agaoglu, and u. giger, "blood type a and b frequencies in turkish van and angora cats in turkey," journal of veterinary medicine series a, vol. 6, pp. 303-306, 2003. view at google scholar | view at publisher [23] v. altunok, e. yazar, and y. n., "selected blood serum elements in van (turkey) cats," acta veterinaria, brno, vol. 76, pp. 171-177, 2007. view at google scholar | view at publisher [24] h. c. macun, m. cinar, s. erat, and s. arikan, "ankara ve van kedilerinin gebelik ve laktasyon dönemlerine ait bazı biyokimyasal paramatrelerin karşılaştırılması [comparison of some biochemical parameters of the gestation and lactation periods of angora and van cats]," erciyes üniversitesi, veteriner fakültesi dergisi, vol. 7, pp. 99-108, 2007. view at google scholar [25] a. edwards, the ultimate encyclopaedia of cats. cat breeds and cat care. leicester, uk: lorenzo books, 1999. [26] s. loeschke, "turkish angoras in ankara zoo... or on the road investigating the turkish angora." retrived from http://www.erkr.de/ezoo.htm. [accessed 21 september 1915], 1997. [27] s. erat and s. arikan, "the hair characteristics of turkish angora and van cats," turkish journal of veterinary and animal science, vol. 36, pp. 215-221, 2012. view at google scholar [28] c. burris, the proper care of cats. neptune city. new jersey nj: tfh publications, 1991. [29] d. a. d. prisco, cats look and learn. neptune city. new jersey nj: tfh publications, 1993. [30] d. taylor, you and your cat. london: dorling kindersley, 1991. [31] h. avcil, m. kaptanoglu, and r. akova, van i̇li cevre durum raporu [environmental status report of van province]. van: van valiliği, i̇l çevre ve orman müdürlüğü, 2006. [32] v. k. s. anon, "tse no: 12138, kabul tarihi: 07.03.1997. (erişim 25 nisan 2013)," 2013. https://scholar.google.com/scholar?hl=en&q=türkiye%20cumhuriyeti’nin%20başkenti%20ankara%20i̇çin%20düşünülen%20amblem%20ve%20tartışmalar https://scholar.google.com/scholar?hl=en&q=kıl%20delillerinin%20kriminalistik%20açısından%20önemi https://scholar.google.com/scholar?hl=en&q=evidence%20for%20early%20cat%20taming%20in%20egypt http://dx.doi.org/10.1016/j.jas.2007.02.019 https://scholar.google.com/scholar?hl=en&q=the%20ascent%20of%20cat%20breeds:%20genetic%20evaluations%20of%20breeds%20and%20worldwide%20random-bred%20populations http://dx.doi.org/10.1016/j.ygeno.2007.10.009 https://scholar.google.com/scholar?hl=en&q=avrupalı%20seyyahların%20tasvirlerinde%20gümüşhane%20ve%20çevresi https://scholar.google.com/scholar?hl=en&q=patterns%20of%20molecular%20genetic%20variation%20among%20cat%20breeds http://dx.doi.org/10.1016/j.ygeno.2007.08.008 http://dx.doi.org/10.1016/j.ygeno.2007.08.008 https://scholar.google.com/scholar?hl=en&q=genetic%20structure%20and%20variation%20of%20van%20cats http://dx.doi.org/10.1007/s10528-011-9426-8 https://scholar.google.com/scholar?hl=en&q=sağlıklı%20van%20kedilerinde%20bazı%20hematolojik%20değerler https://scholar.google.com/scholar?hl=en&q=blood%20type%20a%20and%20b%20frequencies%20in%20turkish%20van%20and%20angora%20cats%20in%20turkey http://dx.doi.org/10.1046/j.1439-0442.2003.00536.x http://dx.doi.org/10.1046/j.1439-0442.2003.00536.x https://scholar.google.com/scholar?hl=en&q=selected%20blood%20serum%20elements%20in%20van%20(turkey)%20cats http://dx.doi.org/10.2754/avb200776020171 https://scholar.google.com/scholar?hl=en&q=ankara%20ve%20van%20kedilerinin%20gebelik%20ve%20laktasyon%20dönemlerine%20ait%20bazı%20biyokimyasal%20paramatrelerin%20karşılaştırılması https://scholar.google.com/scholar?hl=en&q=ankara%20ve%20van%20kedilerinin%20gebelik%20ve%20laktasyon%20dönemlerine%20ait%20bazı%20biyokimyasal%20paramatrelerin%20karşılaştırılması http://www.erkr.de/ezoo.htm https://scholar.google.com/scholar?hl=en&q=the%20hair%20characteristics%20of%20turkish%20angora%20and%20van%20cats animal review, 2016, 3(4): 83-90 90 © 2016 conscientia beam. all rights reserved. [33] d. taylor, ultimate cat. new york: simon & schuster, 1989. [34] a. k. s. anon, "tse no: 12137, kabul tarihi: 07.03.1997. (erişim 25 nisan 2013)," 2013. [35] anon, "yerli hayvan genetik kaynaklarından norduz koyununun yerinde korunması." retrived from http://www.academia.edu/1436879/yerli_hayvan_genetik_kaynaklarindan_norduz_koyunun un_yerinde_korunmasi. [accessed erişim 1 mayıs 2013], 2013. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://www.academia.edu/1436879/yerli_hayvan_genetik_kaynaklarindan_norduz_koyununun_yerinde_korunmasi http://www.academia.edu/1436879/yerli_hayvan_genetik_kaynaklarindan_norduz_koyununun_yerinde_korunmasi 22 † corresponding author © 2016 conscientia beam. all rights reserved. apparent metabolisability of diets containing concentrate, zostera noltii or taraxacum officinalis in anas penelope carla fabro1† --matteo del fabbro2 --barbara piani3 --stefano filacorda4 --piero a. susmel5 1,3,4,5department of agricultural and environmental science – university of udine 2green solutions s.r.l. via piave, martignacco (ud) italy abstract four metabolisability trials on captive wigeons were conducted comparing a complete pelleted diet with others where taraxacum officinalis and zostera noltii were added. the daily dry matter (dm) intake of wigeons varied from 54.4 to 65.5 g/day and the amount of nutrients received from the four diets was similar. the nitrogen (n) content of droppings statistically diminished when wigeons were fed diets containing zostera noltii. correlation among cell wall components (cwc) of droppings and that of intakes was always highly significant and positive. the dm metabolisability of the four diets was 42-51 %. the crude protein (cp) metabolisability varied significantly from 21 % for the diet with taraxacum to 39 % for that with the zostera collected in june. the metabolizabilities of cwc also differed significantly among diets. the apparent metabolizabilities of ash with the zostera diets were significantly higher when compared to those of two other diets. keywords: wigeons, bird captivity, metabolisability, zostera noltii, taraxacum officinalis. received: 31 july 2015/ revised: 17 february 2016/ accepted: 22 february 2016/ published: 26 february 2016 contribution/ originality this study is one of very few studies, which have investigated the metabolic responses of captive wigeons (anas penelope) to four different diets and compared the results of nutritional aspects to those of their wild counterparts. 1. introduction the eurasian wigeon, anas penelope, the smallest grazing anseriform, is a migratory herbivorous bird, flying from the northern regions in early autumn to winter to warmer southern coastal areas and wetlands until early spring in order to feed on nutrient rich plants high in protein and low in fibre [1, 2]. ring recoveries suggest that the reproductive area of wigeons wintering in northern italy are found across different palearctic regions. migrations towards wintering sites begins during the months of september and october while spring backmigration occurs during march and april. if the reproductive sites do not ensure ideal conditions for moulting, wigeons may make an earlier juvenile or post-reproductive and pre-moult migration to safer and more adequate southern feeding grounds [3]. many environmental investigations deal with the role of this widespread dabbling duck, migratory and herbivore, on the ecology of wet grassland or marshes. early research carried out on wigeon dietary habits dates back to the turn of the century [4]. it was reported that this dabbling duck fed primarily on phanerogame species on coastal mudflats [5] its diet consists mainly of leaves, shoots, and seeds of enteromorpha spp. and zostera spp., and of a varying, but a significant amount of molluscs, chironomid larvae, and arthropods [6, 7]. the worldwide classified zostera spp. are 16 [8]. zostera noltii animal review 2016 vol. 3, no. 1, pp. 22-25 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.1/101.1.22.35 © 2016 conscientia beam. all rights reserved . http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.1/101.1.22.35 animal review, 2016, 3(1): 22-35 23 © 2016 conscientia beam. all rights reserved. (hornemann) and z. marina (l.) are widespread along the tidal zones of the european atlantic [9] and mediterranean coasts [10, 11] where it flourishes in perennial meadows [12, 13]. rhizomes secure it to the sandy or muddy substrates forming beds. zostera take root in april and maximum development stems and leaf development is reached over a short period of time. in autumn the leaves reach a length of 30-40 cm, when the incidence of generative shoots is higher [14]. short stems grow out from extensive, white branching rhizomes. more or less mature inflorescences and infructescences can be found from july to october; mature seeds are released in autumn and the natural decay of the plant is triggered with the onset of winter [15]. the ribbon-like leaves and shoots of this plant are eaten in large quantities (about 80 %), while rhizomes and stems make up about 5 % of the diet, and seeds about 10 % [16]. the submerged or floating vegetation is intensively grazed most of the day and night, preferably during ebbtide. other authors also reported regular inland feeding, mainly on saltmarshes (puccinellia and salicornia spp.) but also on flooded inland pastures (glyceria, festuca, poa pratensis, agrostis stolonifera, lolium perenne, dactylis glomerata [17] ranunculus repens, and trifolium repens [1820]. these plants differ in nutrient content and vegetal structure and consequently in palatability and digestibility. the taraxacum spp. is consumed by the wigeons together with other inland plants to integrate the zostera diet when necessary, as during reproduction, moulting, and before migration. a wigeon, weighing about 700 g, is subject to the digestive constraints of small vertebrate herbivore [21]. like other anatidae it has a simple gut and its caeca are not as well developed as other avian grazers, so it relies on ingesting very large quantities of food, which passes through the gut rapidly and is only in part digested [22]. the two caeca, positioned backwards along the terminal portion of the ileum, are blind sacs consisting of a narrowly constricted open end and a dilated thinner-walled blind portion. the caeca retain the liquid and soluble components of the intestinal contents for long periods. caecal length and activity in herbivorous birds are influenced by captivity [23, 24] fibre content of the diet [16, 25, 26] and ingestion rates [27]. studies on apparent digestibility or metabolisability of feedstuffs by wigeon are few. e.g., according to mayhew [5] the average digestive efficiency of dry matter (dm) by wigeons is 28.8 %; [2, 28, 29] considering that some grouse and waterfowl digest 15-35 % of the cell wall components (cwc). the present study was conducted on anas penelope kept in captivity to measure the apparent metabolisability of four diets containing similar amounts of concentrate pellet (the habitual feed, given alone), zostera noltii and taraxacum officinalis. two successive trials were performed to compare zostera collected in june, which should represent the feed consumed during reproductive and moulting period, to that vegetating in late september, at the time when wigeons arrive for wintering. taraxacum, a perennial wild herb native to the northern hemisphere, was also given as it is a common species along the lagoon banks of our region and represents a widespread source of complementary forage for wigeons. the results obtained on captive animals at an experimental facility were compared with those previously published obtained on wild animals. 2. materials and methods four trials were carried out to test the apparent digestibility. this consisted of administering either a pelleted complete feed (p), feed alone as a control, or with zostera noltii collected in june(pzj) and in late september (pzs), in the grado and marano lagoons (friuli venezia giulia – italy), or taraxacum officinalis (pt) leaves, harvested just before flowering (april) at the university farm, where the experiments were conducted. the same 4 three-year-old european wigeons (2 males and 2 females) born and reared on the farm were used. the animals were habitually housed outdoors, in an aviary and given ad libitum pellets of a complete feed (table 1) and on occasion some seasonal fresh forage available on the farm. to establish the amount of daily feed to administer during digestibility trials, preliminary feeding tests were carried out offering forage (taraxacum officinalis and zostera noltii) ad libitum to accustoming wigeons to the feed and to appraise their palatability. it appeared that taraxacum was more palatable than concentrate, while the daily animal review, 2016, 3(1): 22-35 24 © 2016 conscientia beam. all rights reserved. intake of zostera appeared to be less regular and residues were always recovered in the feeders. to maintain a comparable daily intake and digestibility condition, even with less palatable zostera, as well as prevent weight loss during the experimental periods, the original idea was that of administering a maintenance diet consisting of at least an equal amount of pellet and forage on a wet basis. given the chemical differences among forages, the experimental diets were formulated to obtain the chemical characteristics and nutritive proprieties as close as possible, with particular attention to crude protein (cp) and energy content (table 2). the nutrient and energy contents of concentrate pellets, taraxacum officinalis, and zostera noltii are reported in table 1. thus, the scheme of the amount of daily food offered to wigeons was outlined (table 2). table-1. dm and nutrient content of single feed used in experimental diets (% on dm) diet energy dm % cp cf ee ash ndf adf nfe wsc hemi cell kj/kg dm p 18581 91.9 18.9 15.3 3.36 7.7 36.7 18.6 54.8 33.4 18.1 12.2 pt 16890 12.8 16.7 14.7 3.8 16.4 27.1 22.0 48.3 35.9 5.1 14.1 pzj 11968 19.7 10.0 11.5 0.4 39.3 42.3 32.0 33.9 7.9 10.4 25.4 pzs 12982 20.7 10.2 9.5 0.4 33.3 38.9 25.0 46.5 17.1 13.9 21.2 cf: crude fibre; cp: crude protein; ee: ether extract; ndf: neutral detergent fibre; adf: acid detergent fibre; om: organic matter; nfe: nitrogen free extracts; wsc: water soluble carbohydrate; hemi: hemicellulose; cell: cellulose. the metabolisability trials were performed in november (p), april (pt), june (pzj), and september (pzs). during the digestibility trials, each bird was kept and individually fed with pelleted concentrate and forages daily harvested, in a single cage (60 x 50 x 50 cm), fitted with a removable tray for excreta collection. after a preliminary adjustment period of 5-7 days, all wigeons were individually weighed. the lengths of the experimental trials were 5 days for p, 7 days for pt, 7 days for pzj, and 12 days for pzs. as the amount of the dm daily intake resulted more variable when forages were added to the diet, the option of extending the length of the collection period was chosen when mixed diets were administered. wigeon live weights were recorded at the beginning and end of each experimental period to check that all animals maintained their live weight. after each trial, birds were brought back to their habitual housing. table-2. ingredients of the experimental diets feeds pellet forage total pellet forage total diet as sampled as sampled as sampled dm (g) dm (g) dm (g) (g) (g) (g) p 66 66 61.4 61.4 pt 60 100 160 55.8 12.8 68.6 pzj 60 85 145 55.8 16.7 72.5 pzs 60 85 145 55.94 17.6 73.5 pellet: complete feed; forage: taraxacum officinalis or zostera noltii. wigeons were fed twice daily, at 8:00 a.m. and 5:00 p.m., before and during the experimental periods. fresh water was always available, and animals were given grit (sand) to support the feed breakdown in the gizzard. feed consumption during the experimental period was recorded daily. spilled food was separately weighed to obtain the effective intake. at the same time, droppings were collected, weighed and then dried, and ground. the water content of feeds and dropping samples was determined by oven-drying (55° c). proximate analysis; neutral detergent fibre (ndf), acid detergent fibre (adf), and acid detergent lignin (adl) were determined on samples to calculate by difference hemicellulose and cellulose [30, 31] water-soluble carbohydrate contents (wsc) on dm was calculated according to the following: wsc = 100 % % ash % ether extract (ee) % ndf animal review, 2016, 3(1): 22-35 25 © 2016 conscientia beam. all rights reserved. % cp; nitrogen-free extract (nfe) was calculated according to the following: 100 % % ash % ee % crude fibre (cf) % cp. an adiabatic calorimeter (ika werke c7000) was used to measure the gross energy content of feeds and dropping samples. the apparent metabolisability -uncorrected for endogenous lossesof different nutrients was calculated using the following formula: metabolisability (%) = [(1-intake (g)/excreta (g)] x 100. data were statistically analysed by anova (spss statistics 17.0), setting the significance levels at p < 0.05; the pearson test to detect correlation among variables was also applied. 3. results we sampled and analysed zostera noltii in our coastal lagoon at different times, obtaining a set of different data on dm, nutrients, and energy contents. the vegetative state primarily determines the proportion and the chemical composition of rhizomes, shoots and leaves. a fraction of the leaves prevailed in the zostera collected in june, while in september wigeons received a higher quota of rhizomes and shouts. it seems that wigeons prefer the green shoots and young leaves. the higher incidence of young shoots in autumn could support the differences of adf, and consequently of hemicelluloses, cellulose, and of soluble carbohydrates (nfe and wsc) contents observed between zostera handpicked in june and in september (table 1). the comparison of the chemical composition of zostera noltii with taraxacum illustrates that the former contains less protein, fat, carbohydrates, and gross energy, but more ash, hemicelluloses, and celluloses (tables 1 and 2). table 3 shows the effective feed intake measured across the four trials. the dm intake of concentrate and of forages examined separately was not significantly different among diets. when forages were added to the ration, the total daily dm intake significantly increased with respect to p diet and varied from 61.0 to 65.5 g/d. when the birds were given taraxacum and zostera collected in september dm intake was significantly greater when compared to those measured with p diet (table 3). the intake of pzj was intermediate and not statistically different from the other three diets. the same trend was observed for organic matter (om) intake. table-3. concentrate, forage, and nutrients intake (dm, g/day) contents p pt pzj pzs f energy kj 1009 1168 1089 1167 3.37 dm 54.4b 64.0a 61.0ab 65.5a 4.52 cf 7.4a 9.9b 9.2b 9.9b 13.28 cp 11.6 11.1 10.5 11.2 1.25 ee 1.8a 2.4b 1.8b 1.8b 24.36 ash 4.6c 5.9b 6.5b 7.3a 13.26 ndf 19.6b 19.9b 21.4ab 26.7a 16.03 adf 9.3c 11.9b 13.3a 13.1a 11.71 om 49.8a 58.1b 53.4b 58.2b 4.64 nfe 28.1c 34.8ab 31.8bc 36.1a 8.69 wsc 16.8c 24.8a 20.8b 18.4bc 10.83 hemi 10.4b 9.0c 8.6c 11.5a 13.64 cell 5.7c 8.3b 10.2a 8.1b 43.07 a-bmeans within a row with different superscripts differ significantly for p < 0.05 cf: crude fibre; cp: crude protein; ee: ether extract; ndf: neutral detergent fibre; adf: acid detergent fibre; om: organic matter; nfe: nitrogen free extracts; wsc: water soluble carbohydrate; hemi: hemicellulose; cell: cellulose. the ingestion of cp does not vary among diets, while a statistically higher intake of soluble carbohydrates was observed when wigeons were fed with forages. with zostera collected in september, the ash intake of wigeons significantly increased. the daily individual average amount of excretions is reported in table 4. the amount of daily excretion was also variable within the same feeding treatment, as the number of droppings collected per diem animal review, 2016, 3(1): 22-35 26 © 2016 conscientia beam. all rights reserved. ranged between 50 and 85. the ndf constitutes the major component of dm wigeon dropping in all diets. the chemical composition of droppings sampled differed among treatments in cp and in some cwc components (table 4). a higher amount of dm was excreted when the wigeons were fed with zostera, corresponding to a significantly higher content of ndf, which indicates a poorer nutritional quality of the fibre found in this forage. the cp content of dm was always higher in droppings than in the rations consumed by wigeons, as well as, rather appropriately occurred for ash and for the components of the cell wall. the nitrogen (n) content of droppings of diet containing zostera noltii, poorer in cp than other feeds (tables 1 and 4), compared to those from p diet statistically diminished. the addition of taraxacum officinalis also caused a reduction of n content of dropping, lower but still significant. it is highly probable that these results do not solely depend on the n content of the diets, but also on the different chemical characteristics and on the fermentability of forages cwc. in fact, correlation between cwc, ndf, and adf of droppings and intake is always significantly and positively correlated (r = 0.97, r = 0.92, and r = 0.88, respectively). the correlations between intake and droppings calculated for other constituents, as cp, ash, and ee are also statistically correlated, but to a lesser degree. table-4. average daily excretion and chemical composition of droppings contents p pt pzj pzs f g/bird 235.6 ± 48.8 311.4 ± 39.1 240.5 ± 49.0 301.8 ± 21.7 g dm/bird 26.7c 32.0b 29.5bc 37.9a 10.22 energy kj 468.1d 555.7b 510.6b 643.0a 9.72 chemical composition dm (%) 11.5ab 10.4b 12.4a 12.6a 4.01 cf % on dm 23.3b 25.4a 25.0a 22.7b 6.08 cp % on dm 29.2a 27.2b 21.8c 21.3c 176.58 ee % on dm 0.7b 1.2a 0.8b 0.6bc 29.89 ash % on dm 14.1 14.7 14.1 13.2 2.6 ndf % on dm 49.4bc 45.5c 55.4b 66.8a 10.65 adf % on dm 24.6c 37.4a 35.3a 28.5b 55.5 om % on dm 85.9ab 85.3b 85.9ab 86.8a 2.6 nfe % on dm 32.7c 31.6c 38.3b 42.3a 51.36 wsc % on dm 6.7b 11.6a 7.9ab 10.9a 3.2 hemi % on dm 24.8ab 14.2c 20.1b 25.7a 8.4 cell % on dm 19.2b 22.5b 30.8a 18.1b 13.41 energy kj/kg dm 17981 16132 15266 17115 2.34 a-bmeans within a row with different superscripts differ significantly for p < 0.05 cf: crude fibre; cp: crude protein; ee: ether extract; ndf: neutral detergent fibre; adf: acid detergent fibre; om: organic matter; nfe: nitrogen free extracts; wsc: water soluble carbohydrate; hemi: hemicellulose; cell: cellulose. the overall effect following the addition of different forages to the ration on the amount and composition of dropping is better defined by energy excretion, which was significantly greater in pzs (643 kj/d), even if the energy concentration of excreta did not statistically differ among treatments. the average dm metabolisabilities measured with four diets varies from 42.2 % for pzs to 51.4 % pzj, the former value being significantly lower than the others (table 5). apart from the least result, from the outcome of dm metabolisabilities some distinct associative effects between forages and pellet can be excluded. a similar trend of assimilation efficiencies were found for om, even if the digestive and metabolic utilization of ash statistically differed among diets. the apparent metabolisability of cp ranged from 21.4 % for diets containing taraxacum to 38.8 % with pzj. the protein of the diet containing zostera harvested in june appears to have been more efficiently metabolised, more so than that of pzs, while the presence of taraxacum statistically reduced the protein metabolisability of the diet. animal review, 2016, 3(1): 22-35 27 © 2016 conscientia beam. all rights reserved. as expected, the metabolisability of ndf differed significantly across diets, being the highest in the control diet p. the average value of adf metabolisability was significantly lower in pt than in p and pzj. the metabolisability of hemicelluloses was statistically higher in pt and lower in pzs and pzj. the cellulose content of diets containing forages was less digestible than that of p diet. the values of wsc metabolisability was lower for the pzs diet. table-5. apparent metabolisability of diet contents (%) contents p pt pzj pzs f energy 53.6a 52.4a 52.9a 43.7b 6.45 dm 50.9a 50.1a 51.4a 42.2b 4.87 cf 16.2 17.6 19.9 13.6 0.55 cp 32.6ab 21.4bc 38.8a 28.3b 7.31 ee 90.0a 84.3c 86.8b 87.7b 5.7 ash 18.0b 20.0b 36.0a 31.7ab 3.54 ndf 33.2a 27.1ab 23.3b 21.0b 5.44 adf 29.1a 11.5b 21.2ab 18.0b 4.07 om 53.9a 53.1a 53.2a 43.5b 7.86 nfe 69.9a 71.1a 65.4b 54.5c 29.13 wsc 89.0 85.1 88.5 78.3 2.81 hemi 37.0ab 50.0a 30.8b 15.5c 9.43 cell 10.7 13.2 12.1 15.6 0.29 a-bmeans within a row with different superscripts differ significantly for p < 0.05 cf: crude fibre; cp: crude protein; ee: ether extract; ndf: neutral detergent fibre; adf: acid detergent fibre; om: organic matter; nfe: nitrogen free extracts; wsc: water soluble carbohydrate; hemi: hemicellulose; cell: cellulose. the ee metabolisability was significantly lower only when wigeons were given taraxacum. both zostera diets showed the highest ash metabolisability, so that the om metabolisability resulted only partially limited by the high ash content of zostera. 4. discussion very little information is available on the chemical composition of zostera noltii, however the composition of zostera collected and offered wigeons in june and september are consistent with those reported by mathers and montgomery [32]. the vegetal part of foodstuff collected always contained leaves, shoots, and rhizomes, but in different proportions. shoot and rhizome fractions prevailed in september. according to [32, 33] wigeon prefer to dabble for green shoots or short leaves and [34] observed that the above ground parts predominated in the diet. the contents of dm, ndf, and cp were similar while june zostera contained more adf and cellulose, but less wsc, and hemicellulose. fox [35] found that the rhizomes of autumnal zostera contain significantly less dm, cp, fibre or adf, and ash, but more wsc than shoots. mathers, et al. [36] chemically differentiated shoots and rhizomes, observing that rhizomes comprise 56 % of dm of the whole plant and are lower in fibre and higher in wsc than shoots. the high content of the ash of zostera noltii, as that of other saltmarsh species, was not indicated or commented in the literature, but does not seem to affect food selection and intake [32]. the gross energy content of september zostera given to wigeons was 13 kj/g dm, higher than june plants (12 kj/g dm), values comparable with those were reported by mathers, et al. [36]. inger, et al. [37] observed that the energetic value of zostera shoots varied widely between sites: at strangford it was 13 kj/g [32] compared with 20 kj/g for southern england [38] 19 kj/g for the wadden sea [34] and 18.6 kj/g for lindisfarne in northeastern england [39]. in our experiments, when forages were available, the dm intake significantly increased from 13 % (pzj) to 20 % (pt) (table3). animal review, 2016, 3(1): 22-35 28 © 2016 conscientia beam. all rights reserved. the observed levels of dm intakes we observed are comparable to those (65.2 g/d ash free dry weight) measured by madsen [34] in wigeons eating zostera, as the sole feed source. a higher intake of zostera (120 g/day dm) [40] of grass (91.6 g/day dm) [5] and of salicornia (110.7 g/day dm) [41] was found. whereas in another experiment the same forage determined a lower intake of 53.1 g/d dm [41]. all these investigations were conducted on wintering wigeons. the gross energy intake measured during the trials was 1009 kj/d with p and increased to an average of 1141 kj/d (1470 kj/kg0.75), when forages were also administered. woollhead [6] estimated that the energy consumption of a wild wigeon was 2055 kj/d, that is 2630 kj/kg0.75/d, which is consistent, but almost about double our values, measured at about maintenance level. there is evidence that, even if captive, the rationed wigeons have maintained an aptitude to consume forages to attain a higher intake of utilizable dm. miller [25] found that not only did gut length increase in mallards on a high fibre diet, but that the food consumption of these birds also increased. the diet quality regulates the intake: if digestive efficiency decreases in terms of bulk, the animal may try to eat more resulting in gut volume enlargement, and retention time is increased to cope with extra food to process each day [24]. the modification in gut size and feed consumption elicited by diet quality is often ephemeral, having its allometric downsides resulting in weight modifications and limitations to flight capability with a higher risk of predation [42]. in fact, the energetic cost of flight increases proportionally to body mass1.56 [43]. captivity can have a major effect on gut size, morphology, and digestive physiology of anatidae [23, 44]. in a select number of dead captive animals the length of the paired caeca measured 12.0 and 12.5 cm while that of wild wigeons shot in the lagoons (n = 71) was 19.1±2.8 and 19.3±2.4 cm (fabro and susmel, unpublished data). the dimensions of the caeca of wild wigeons we measured are consistent with those reported by [5, 45]. the chemical composition of dropping differed statistically among diets and was related to the intake and discloses the complexity of the digestive process. dm excretions are not directly comparable with other results of other experiences, as it depends on dm intake, on the quality of forages, or on the ndf digestive outcomes. similar to our figures, madsen [34] along with an intake of 64.8 g dm/d of zostera, measured a defecation of 35 g dm/d, but [18] collected 65.2 g dm/d droppings from wigeon ingesting only 91.6 g dm/d of grass. the high cp content of droppings not only represents the digestibility of protein source, but also endogenous faecal excretion composed of different components, including the remains of intestinal bacteria and the metabolic excretion of uric and other n chemical compounds (table 3). average cp excretion was statistically lower in the pzj diet than in other diets. considering the pzj and pzs excretions, it seems clear that cp emissions go hand in hand with the dm and ndf ones. if less protein were enzymatically digested and assimilated, less n would also be excreted in urine. the droppings of wigeons given the zostera diets contain a higher percentage of ndf and hemicelluloses. for all diets the correlation between ndf and hemicellulose excretions are statistically positive (r = 0.81), indicating that the hemicellulose digestion is progressively limited when the intake increases (r = 0.78) while for cellulose there is no significantly correlation (r = 0.30). when intake and excretions of these two components of the cell wall are correlated, cellulose fermentation is found to be very limited and higher intake linearly results in higher excretion (r = 0.91), whilst the excretion of hemicellulose increases to a lower extent (r = 0.74). methodologically, it may be argued that the results obtained with the criteria of partial substitution also have some limits, as the level of substitution of a test ingredient in a diet may per se change the metabolisability values. farrell [46] authoritatively asserts that there is little experimental evidence to support this, concluding that the effects of substitution, even at high levels, appear to be additive rather than associative. our results suggest that the dm metabolisability of taraxacum and zostera collected in june appears to be similar to that of p diet, close to 50 %, and significantly greater than that of pzs. a comparable value was found by madsen [34] who on wigeons grazing on zostera meadows measured a dm digestive efficiency of 46 %. these values are higher than the average value of 28.8 % measured by mayhew [18] on wild wigeons eating grass. animal review, 2016, 3(1): 22-35 29 © 2016 conscientia beam. all rights reserved. the metabolisabilities of ndf and adf diminished at various extents when pellet was associated to forage (table 5), displaying in this case a dissimilarly negative associative effect. a number of papers settle that anatidae can digest fibre to a variable extent [33]. [2, 28, 29] indicate that some grouse and waterfowl species digest 15-35 % of cwc, which is in the range of the metabolisability of ndf, measured in our experiments in wigeons. the rare findings on anas penelope, report values of 30.8 % and 5.0 % of ndf and adf digestibility of autumnal grass, respectively [33]. these values are similar to those measured on pt diet. jamroz, et al. [47] measured the metabolisability of ndf, adf and hemicellulose of cereals obtaining values of 18.1±8.6 %, 2.8±10.0 % and 27.8±12.4 % respectively, which are quite different from the metabolisability of p diet. the metabolisability of the hemicellulose of p diet is similar to that of seeds and tubers (35.0 %) measured by bruinzeel, et al. [48]. waterfowls can partly solubilise and digest hemicellulose through acid hydrolysis in the proventriculus and in the gizzard followed by rapid fermentation in the lower small intestine and caeca [49, 50]. the role of caecal microorganisms in fermenting cwc has been studied in different bird species. what is lacking is specific research on wigeons with less developed caeca. grazing geese [51-53] are considered to poorly digest [18] or not digest cellulose at all, as cellulolytic bacteria failed to show up in the intestinal tract [54]. instead, durant [33] reported that some adf digestibility was measured in wigeons. during the experimental trials, our captive wigeons were able to metabolise from 15.5 % to 50.0 % of hemicellulose and from 10.7 % to 15.6 % of cellulose. the question raised by the data is whether cellulose can be prevented from entering the caeca. little information is available on protein metabolisability on wild and, even less, on captive anseriformes. buchsbaum, et al. [2] depicts the cp apparent digestibility in different herbivore waterfowls in a range of values between 61 % and 80 %, but cp digestibility is always higher than metabolisability. the addition of less than 20 % of forages to the concentrate quota was sufficient to significantly modify the cp metabolisability among diets. our results, varying from 21.4 % for a taraxacum diet to 38.8 % for a pzj one, are more comparable to the value of 40 % for rye grass cp reported by van eerden [55]. this author suggests that the digestibility of foliage cp is not affected by body mass, as that of cwc, but could also indicate that wigeons are less efficient than other herbivores at digesting protein. in our study the cp metabolisability coefficients are not correlated with protein intake (r = 0.19), but the coefficient is negative. the correlation coefficient between cp intake and excretion is fairly positive (r = 0.60) and consequently the figure between cp metabolisability and content of droppings is higher and negative (r = 0.90), or highly dependant on cp excretion. in brief, high cp excretion might be attributable to intake, which over exceded the maintenance requirement while the imputable fraction coming from the weight loss (see below), can be estimated to be no more than 10 % of total cp excretion (0.20 g n/kg0.75). in fact, the wigeons retained on average 0.67g n/kg0.75/d more than enough to cover the maintenance requirements or at least to prevent the depletion body protein in the short term –, that [56] equalled to 0.49 g n/kg0.75/d. the smallest daily n retention was 0.46 g n/kg0.75 (pt) and the highest 0.84 g n/kg0.75(pzj). the metabolisability of lipids by wigeons is high, suggesting they may efficiently absorb the soluble compounds of a large molecular mass. the ash content of zostera is elevated and its apparent metabolisability resulted higher when compared to those of the other two diets. this result should not be considered positive because wigeons, since their salt glands are not fully developed to reduce levels of salt in the blood, respond mostly by drinking fresh water [57]. secondly, the excretion of salt is likely to have a high energy cost due to the process of the active transport of na+ and k+ ions [58]. the net benefit of a feed can be measured in terms of the changes in the body weight over time [59]. during the experimental period, an average weight loss of 7 g/d was measured. as the results of the trials demonstrate, the diets cover the n and energy requirements, and weight loss is most likely attributable to the disturbance due to the change of rearing conditions during experimental periods. a higher weight loss of 18.2 and 36.6 g/day were measured during digestibility trials [41] due to inadequate energy intake. wigeons are considered quite sensitive animal review, 2016, 3(1): 22-35 30 © 2016 conscientia beam. all rights reserved. to human presence and activities [18, 60] and their behaviour was constantly observed as being timid or fearful, even if born in captivity. the inevitable tending, handling and feeding wigeons in metabolisability cages generate a state of anxiety in the animals. mayhew [5] noted that wigeons might be under a great deal of stress when handled or when in contact with researchers, even if they have been imprinted by them. independently from the cause, weight loss contributes to the energy excretion of endogenous origin and could affect energy or protein metabolisability. if we accept the indication given for wigeons by durant, et al. [41] for an equivalent 22.6 kj/g of weight loss-quoted as half from fat and the other half from muscular tissues, our animals would rate a daily energy loss of 170 kj/d. otherwise [61] proposed to subtract 34.4 kj from metabolisable energy (me) for each gram of n lost to account for the energy required in the excretion of urinary nitrogen. for a loss of 3.5 g/d of muscular mass, which is about 170 mg/d of n while the amount of me is negligible at approximately 6 kj. then, we should conclude that the energy from weight loss is almost entirely converted into heat and a correction to n equilibrium for the scope of this type of research appears not to be necessary [62]. we measured the energy assimilated by the difference between the energy contents of feeds and droppings, just to estimate the level of nutrition achieved over the course of the trials. in fact, we were not able to find in the literature data on intake of metabolisable dm or om of wigeons receiving comparable mixed diets, but only occasional information on energy intake from forages. me is the conventional measure of the energy available to birds from their diet. in avian energetics, me is used to convert daily energy budgets into the weight of food required to supply energy needed by individuals or populations [62, 63]. the energy values measured of feeds and droppings collected from test birds, fed at maintenance, using a bomb calorimeter is recognised as a proper measure of energy metabolisability. me can be expressed as either apparent or true metabolisable energy. the true me value, in most cases measured on starved animals, is adjusted by the energy of non-food origin lost through faeces and urine. this component of excretion is rather independent of energy consumption, in fact as energy intake increases, the true me value progressively approaches that of the apparent me. according to miller and reinecke [61] in the nearness of maintenance, the energy requirement weighs up at 2.5 times the basal metabolic rate (bmr) in anas plutyrhynchos (1 kg of body weight), the difference between the two values is small, about 3 %. in our experiments, the differences between gross energy in foods on the one hand and droppings on the other amount to 540 kj/d with pellets and an average of 571 kj/d in birds fed mixed diets. no other experiences have been found where the metabolisability was measured on captive animals kept in metabolic cages. in feeding ecology researches, few balanced measures of food energy available to birds were instead obtained in semi-natural conditions on wild birds, using tracers, mobile aviaries, roost, and grazing patch enclosures. wintering on grass pastures wigeons grazed for 17.5 h/d, mayhew [18] measured a me intake of 630 kj/d. madsen [34] observed that wintering wigeons spent 12.7 h/d feeding on zostera, and evaluated a me intake of 592 kj/d, which he assumed to be the average daily energy expenditure (dee) value for wigeons (700 g of body weight). durant, et al. [41] using mobile aviaries to keep anas penelope grazing on salicornia marsh, quantified a daily me intake of 182 and 345 kj/d, in two successive experiments. in ecological and behavioural studies, the energy intake is quoted as dee (otherwise indicated as field metabolic rate), an all inclusive field maintenance requirement, which conceptually excludes productive and growth exigencies [64]. dee is measured, or more often estimated as a multiple of one category of the metabolic parameters. the minimum maintenance metabolic rate (resting, post absorptive, non growing, non-reproductive at thermo neutral environmental temperature), or bmr, measured under experimental conditions, represents a welldefined baseline energetic (heat) parameter concerning the animal [65-67]. allometric equations have been widely used to predict avian bmr from metabolic weight – bmw = kg0.75 [68-72]. the bmr was calculated using the average body weight of our wigeons (722 g) with the non-passerines equation of aschoff and pohl [73] correspond animal review, 2016, 3(1): 22-35 31 © 2016 conscientia beam. all rights reserved. to 242.3 kj/d. kendeigh, et al. [63] for a wigeon weighing 723 g gives a bmr of 241.8 kj/d (2.799 w). instead, mcnab [74] provides a non-passerines equation, containing six variables matching factors which accounts for 97.7 % of the variation in avian bmr measures to adjust the estimate of bmr to specific environmental conditions. when applied to our situation, using the suggested corrections, the bmr of wigeons averaged 259.9 kj/d. standard metabolic rate (smr; basal, not thermo neutrality) results slightly higher. for example, with a nonpasserines equation the value adapted to our data is 258.3 kj/d [18, 75]. resting metabolic rate (rmr; minimal activity, not post-absorptive), which accounts for the conditions under which data are obtained from test animals, is more variable and higher. an example could be that of using a general equation valid for dabbling ducks, the requirement corresponding to the weight of our experimental wigeons should be 354.9 kj/d [76]. the choice of the metabolic parameter among the numerous possible options for an assessment of dee depends upon the conditions of the study and influence the multiplication factor. the factor value used to derive the dee is differently designated, between 2.5 and 3 [54, 77]. with reference to anas penelope, in two of the above reported studies, dee was also calculated. madsen [34] evaluated the dee, as suggested by [73, 78] which resulted in 617 kj/day, close to the measured value. mayhew [5] calculated a dee of 631 kj/d [75, 78]. notwithstanding the difference of experimental conditions, these values are very similar. in fact, although anas penelope has different and varying patterns of activity during the day and night, energy expenditures for behaviour and for diurnal and nocturnal habits are almost the same [79]. in a wintering area of anas penelope in the wadden sea, to maintain the balance of vegetal biomass grazed by waterfowls, jacobs, et al. [40] quantified the number of wigeons feeding on seagrass bed and the consumption of zostera noltii. they estimate the me content of zostera and the average dee of wigeons through their smr [75] choosing a multiplication factor of 3. the calculated smr was 226 kj/d for wigeons (700 g of body weight), which is a dm intake of 54.1 g/d. theoretically, in adult animals at maintenance, daily me intake should correspond to dee. the me intake we have measured shows a close correspondence to dee values determined in the studies mentioned above. the fact that wigeons were kept in metabolic cages should have reduced the energy demand for maintenance. robbins [56] and kirkwood [80] devised that the maintenance requirement of adult captive birds in energy balance and kept in a comfortable thermal environment, come close to twice the bmr. if we consider that the average bmr of our wigeons ought to be 260 kj/d, as calculated by the mcnab [74] equation, the ratio with a me intake of 564 kj/d equals 2.2, but the factor approaches 1.6 if compared with the bmr value proposed by miller and mcaeadie [76]. in any case, the level of nutrition which were applied in our trials were satisfactory, but unlike protein, did not appreciably exceed the maintenance requirements. 5. conclusion this set of experiments dealt with two related objectives. the immediate one was to evaluate the metabolisable energy and nutrients concentration using the standard procedure of total collection on captive wigeons. the second purpose, essentially speculative, was to compare the results of the nutritional response of captive birds to those of their wild counterparts. methodological, ecological and behavioural aspects, which characterize the experimental settings, represent unavoidable differential elements. so scientific knowledge has to help in defining which part of nutritional explanation represents unmodifiable specific physiological characteristic and which parts of the feeding response depend upon the flexible and adaptable process, which is given in the biochemical and functional digestive and metabolic configuration. in other words, what is functional and what is behavioural? captive wigeons have less developed caeca compared to other herbivorous ducks, but we could assume that the basic functionality is maintained. wild grazing wigeons rely on ingesting highly variable and relatively large quantities of fresh food, higher than captive birds, but in both situations ingesta pass through the gut rapidly and is inefficiently digested. the digestive system of herbivorous anas penelope can be regarded as an adaptation to animal review, 2016, 3(1): 22-35 32 © 2016 conscientia beam. all rights reserved. differences in energy requirements and environmental conditions. the same way of thinking could apply to other aspects, like faecal and urinary excretion or bmr. these aspects are different from feeding behaviour, preferences, or real energy expenditure of waterfowl in natural conditions. the differences among diets were determined by the addition of two types of forages, which represented less than the 20 % of total dm intake. the differences of dm intake among the four diets denote a preference or palatability for forages rather than a response to a need for a greater intake of energy or dm. statistically significative changes in droppings excretion and in dietary nutrients metabolisability were observed. most of the differences in chemical composition between zostera noltii leaves harvested in june and september significantly affected metabolisability of cp, om, nfe, and wsc. not all the differences in metabolisability observed between taraxacum and zostera are attributable to chemical contents, but rather to the quality of the fibre. the in vivo trial seem to have screened the differences in the quality of forages more effectively than the chemical analysis. from the results it appears that, cellulose was almost partly digested leading to the consideration that caeca of captive wigeons have and keep the ability to ferment cellulose. the cp metabolisability coefficients were low and failed to correlate with protein intake, while this occurred significantly with the correlation coefficient between cp metabolisability and cp in droppings. more likely, the protein positively interacts in the digestion of other nutrients, particularly cwc. in fact, cp, ash, hemicellulose and cellulose intake was statistically correlated with crude protein metabolisability. the ash content of zostera also requires further investigation. in principle, the inorganic matter may be considered detrimental but this does not match the fact that this phanerogam represents a common feed for wigeons. this experiment suggests that with captive birds it is possible to obtain some useful information on the nutrition of wigeons, which can be extended to feeding in the wild. although the consequences arising from fear and stress that wigeons still exhibit in relation to man remain difficult to elude. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] m. owen, "food selection in geese," verh. ornithol. ges. bayer, vol. 23, pp. 169 176, 1978/1979. [2] r. buchsbaum, j. wilson, and i. valiela, "digestibility of plant constituents by canada geese and atlantic brant," ecology, vol. 67, pp. 386 393, 1986. [3] f. salomonsen, "the moult migration," wildfowl, vol. 19, pp. 5 24, 1968. [4] j. g. millais, the natural history of british surface feeding ducks. london: longmans, 1902. [5] p. w. mayhew, "the feeding ecology and behaviour of wigeon anas penelope," phd thesis, university of glasgow, scotland, 1985. [6] j. woollhead, "birds in the trophic web of lake esrom, denmark," hydrobiologie, vol. 279, pp. 29 38, 1994. [7] l. nilsson, "food seeking activity of south swedish diving ducks in the non breeding season," oikos, vol. 21, pp. 145 154, 1970. [8] r. h. a. govaerts, "world checklist of selected plant families published update. facilitated by the trustees of the royal botanic gardens, kew." available: http://apps.kew.org/wcsp/, 2011. [9] d. den hartog, the sea-grasses of the world. amsterdam: north-holland pub. co, 1970. [10] a. meinesz and m. simonian, "cartes de la vegetation sous marine des alpes maritimes (côtes françaises de la méditerranée). ii la vegetation mixte à cymodocea nodosa zostera noltii caulerpa prolifera et la limite supérieure de l'her bier de posidonia oceanica entre juan – les pins et golfe juan," ann. inst. océanogr, paris, vol. 59, pp. 21 35, 1983. [11] d. curiel, g. bellemo, and m. marzocchi, "new records of marine algae in the lagoon of venice," giorn bot ital, vol. 130, p. 352, 2008. [12] m. j. m. hootsmans, j. e. vermaat, and w. van vierssen, "seed bank development, germination and early seedling survival of two seagrass species from the netherlands: zostera marina l. and zostera noltii hornemann," aquat. bot., vol. 28, pp. 275 285, 1987. http://apps.kew.org/wcsp/, animal review, 2016, 3(1): 22-35 33 © 2016 conscientia beam. all rights reserved. [13] m. c. buia, l. gazzella, h. pirc, and g. f. russo, "fioritura di zostera noltii hornemann a ischia golfo di napoli," oebalia n.s, vol. 11, pp. 861 862, 1985. [14] a. sfriso and p. f. ghetti, "seasonal variation in biomass, morphometric parameters and production of seagrasses inthe lagoon of venice," aquat. bot., vol. 61, pp. 207 223, 1998. [15] d. curiel, a. bellato, a. rispondo, and m. marzocchi, "sexual reproduction of zostera noltii hornemann in the lagoon of venice italy, north adriatic," aquat. bot., vol. 52, pp. 313 318, 1996. [16] m. owen and g. j. thomas, "the feeding ecology and conservation of wigeon at the ouse washes, england," j. appl. ecol., vol. 16, pp. 795 809, 1979. [17] d. durant, "différences dans l’utilisation des hauteurs d’herbe par le anatidés herbivores et mécanismes sous jacents," phd thesis, université de la rochelle, france, 2001. [18] p. w. mayhew, "the daily energy intake of european wigeon in winter," ornis. aust. j. zool., vol. 19, pp. 217 223, 1988. [19] p. j. s. olney, "the autumn and winter feeding biology of certain sympatric ducks," presented at the transactions congress vi international game biologists, 1965. [20] p. j. s. olney, food habits of wildfowl in britain. in: the new wildfowler eds., n. m. sedgwick, p. whitaker, j. harrison. london: barrie & jenkins, 1970. [21] m. w. demment and p. j. van soest, "a nutritional explanation for body size patterns of ruminant and non ruminant herbivores," am. nat., vol. 125, pp. 641 672, 1985. [22] m. owen, "some factors affecting food intake and selection in white fronted geese," j. anim. ecol., vol. 41, pp. 79 92, 1972. [23] r. moss, "effects of captivity on gut lengths in red grouse," j. wildl manage., vol. 36, pp. 99 104, 1972. [24] r. m. sibly, strategies of digestion and defecation. in: physiological ecology, an evolutionary approach to resource use, c.r. townsend and p. calow, eds. london: blackwell, 1981. [25] m. r. miller, "gut morphology of mallards in relation to diet quality," j. wildl manage., vol. 39, pp. 168 173, 1975. [26] m. owen, "an assessment of fecal analysis technique in waterfowl feeding studies," j. wildl manage., vol. 39, pp. 271 279, 1975. [27] e. pulliainen and e. tunkkari, "seasonal changes in the gut length of willow grouse (lagopus lagopus) in finnish lapland," ann. zool. fenn., vol. 20, pp. 53 56, 1983. [28] c. w. gasaway, "cellulose digestion and metabolism by captive rock ptarmigan," comp. biochem. physio. a: physiol., vol. 54, pp. 179 182, 1976. [29] t. e. remington, "why do grouse have ceca? a test of the fiber digestion theory," j. exp. zool. supplement, vol. 3, pp. 87 94, 1989. [30] a.o.a.c, official methods of analysis of the association of official analytical chemist, 16th ed. washington, dc, usa: publ, 1990. [31] p. j. van soest, nutritional ecology of the ruminant: ruminant metabolism, nutritional strategies, the cellulotic fermentation and the chemistry of forages and plant fibres. corvallis: o and b books, 1982. [32] r. g. mathers and w. i. montgomery, "quality of food consumed by overwintering brent geese branta berniclahrota and wigeon anas penelope," biology and environment: proceedings of the royal irish academy, vol. 97b, pp. 81 90, 1997. [33] d. durant, "the digestion of fibre herbivorous anatidae: a review," wildfowl, vol. 54, pp. 7 24, 2003. [34] j. madsen, "autumn feeding ecology of herbivorous wildfowl in the danish wadden sea and impact of food supplies and shooting on movements," danish review of game biology, vol. 13, pp. 2 33, 1988. [35] a. d. fox, "zostera exploitation by brent geese and wigeon on the exe estuary, southern england," bird study, vol. 43, pp. 257 268, 1996. [36] r. g. mathers, a. a. portig, and w. i. montgomery, "the distribution and abundance of brent geese (branta bernicla hrota) and wigeon (anas penelope) in strangford lough, co. down, n. ireland," bird study, vol. 45, pp. 18 34, 1998. [37] r. inger, g. d. ruxton, j. newton, k. colhoun, k. mackie, j. a. robinson, and s. bearhop, "using daily ration models and stable isotope analysis to predict biomass depletion by herbivores," j. appl. ecol., vol. 43, pp. 1022 1030, 2006. [38] k. charman, "the grazing of zostera by wildfowl in britain," aquaculture, vol. 12, pp. 229 233, 1977. [39] s. m. percival, w. j. sutherland, and p. r. evans, "a spatial depletion model of the responses of grazing wildfowl to changes in availability of intertidal vegetation during the autumn and winter," j. appl. ecol., vol. 33, pp. 979 993, 1996. animal review, 2016, 3(1): 22-35 34 © 2016 conscientia beam. all rights reserved. [40] r. p. w. m. jacobs, c. den hartog, b. f. braster, and f. c. carriere, "grazing of the seagrass zostera noltii by birds at terschelling dutch wadden sea," aquat. bot., vol. 10, pp. 241 259, 1981. [41] d. durant, m. kersten, and h. fritz, "constraints of feeding on salicornia ramosissima by wigeon anas penelope: an experimental approach," j. ornithol., vol. 147, pp. 1-12, 2006. [42] s. lima, "predation risk and unpredictablefeeding conditions: determinants of body mass in birds," ecology, vol. 67, pp. 377 385, 1986. [43] r. dudley and g. j. vermej, "do the power requirements of flapping flight constrain folivoryin flying animals?," funct ecol., vol. 6, pp. 101 104, 1992. [44] f. p. kehoe, c. d. ankney, and r. t. alisauskas, "effects of dietary fiber and diet diversity on digestive organs of captive mallards anas platyrhynchos," can j. zoo, vol. 66, pp. 1597-1602, 1988. [45] j. s. sedinger, "adaptations to diet and consequences of an herbivorous in grouse and waterfowl," condor, vol. 99, pp. 314 326, 1997. [46] d. j. farrell, "the metabolizable energy (tme) and the alternative," in raan conference proceedings, 1980. [47] d. jamroz, a. wiliczkiewicz, j. orda, and j. skorupinska, "die scheinbare verdaulichkeit der gerüstkohlenhydrate und dorm fermentation verchiedener getreidearten bei drei geflügelspezies," iv wien tierӓrzte mschr, vol. 83, pp. 210 218, 1996. [48] l. w. bruinzeel, m. r. van eerden, r. h. drent, and j. t. vu link, "scaling metabolisable energy intake and daily energy expenditure in relation to the size of herbivorous waterfowl: limits set by available foraging time and digestive performance. in: patchwork: patch use, habitat exploitation and carrying capacity for water birds in dutch freshwater wetlands, m. van eerden," published phd thesis, university of groningen, 1998. [49] t. j. dawson, a. b. johns, and a. m. beal, "digestion in the australian wood duck (chenonetta jubata): a small avian herbivore showing selective digestion of the hemicellulose component of fiber," physiol. zool, vol. 62, pp. 522-540, 1989. [50] t. j. dawson, p. j. whitehead, a. mclean, f. d. fanning, and w. r. dawson, "digestive function in australian magpie geese anser anas semipalmata," aust. j. zool, vol. 48, pp. 265 279, 2000. [51] r. v. marriott and d. k. forbes, "the digestion of lucerne chaff by cape barren geese, cereopsis novae hollandiae latham," austr. j. zool, vol. 18, pp. 257 263, 1970. [52] j. g. mattocks, "goose feeding and cellulose digestion," wildfowl, vol. 22, pp. 107 113, 1971. [53] r. drent, b. ebbinge, and b. weijand, "balancing file energy budgets of arctic breeding geese throughout the annual cycle: a progress report," verh ornithol ges bayern, vol. 23, pp. 239 264, 1979. [54] e. m. barnes, "the avian intestinal flora with particular reference to the possible ecological significance of the caecal anaerobic bacteria," am. j. clin. nutr., vol. 25, pp. 1475 1479, 1972. [55] m. r. van eerden, waterfowl movements in relation to food stocks. in: evans p. e., goss, j. d. custarrd and w. g. hale, (eds). coastal waters and waterfowl in winter. cambridge: cambridge university press, 1984. [56] c. t. robbins, wildlife feeding and nutrition, 2nd ed. san diego: academic, 1993. [57] r. w. summers and m. m. smith, "an age related difference in the size of the nasal glands of brent geese branta bernicla," wildfowl, vol. 41, pp. 35 37, 1990. [58] l. p. milligan and b. w. mcbride, "energy costs of ion pumping by animal tissues," j. nutr., vol. 115, pp. 1374 1382, 1985. [59] t. s. coleman and d. a. boag, "canada goose foods: their significance to weight gain," wildfowl, vol. 38, pp. 82 88, 1987. [60] r. g. mathers, s. watson, r. stone, and w. i. montgomery, "a study of the impact of human disturbance on wigeons anas penelope and brent geese branta bernicla hrota on irish sea loch," wildfowl, vol. 51, pp. 67 81, 2000. [61] m. r. miller and k. j. reinecke, "proper expression of metabolizable energy in avian energetic," condor, vol. 86, pp. 396 400, 1984. [62] d. j. farrell, "a new rapid method for determining the metabolizable energy of poultry feedstuffs," in raan conference proceedings, 1977. [63] s. c. kendeigh, v. r. dol’nik, and v. m. govrilov, avian energetic. in: pinowski j. and s. c. kendeigh, eds., granivorous birds in ecosystems. cambridge: cambridge university press, 1977. [64] f. fournier, w. h. karasov, m. w. meyer, and k. p. kenow, "daily energy expenditures of free ranging common loon (gaviaimmer) chicks," auk, vol. 119, pp. 1121-1126, 2002. animal review, 2016, 3(1): 22-35 35 © 2016 conscientia beam. all rights reserved. [65] m. a. elgar and p. h. harvey, "basal metabolic rates in mammals: allometry, phylogeny and ecology," funct ecol., vol. 1, pp. 25 36, 1987. [66] b. i. tieleman and j. b. williams, "the adjustment of avian metabolic rates and water fluxes to desert environments," physiol. biochem. zool, vol. 72, pp. 87 100, 2000. [67] b. g. lovegrove, "the influence of climate on the basal metabolicrate of small mammals: a slow-fast metabolic continuum," j. comp. physiol., vol. 173, pp. 87 112, 2003. [68] c. bousque, m. a. pacheco, and r. b. siegel, "maintenance energy costs of two partially folivorous tropical passerines," auk, vol. 116, pp. 246 252, 1999. [69] j. b. williams, "heat production and evaporative water loss of dune larks from the namib desert," condor, vol. 101, pp. 432 438, 1999. [70] a. anava, v. i. kam, a. shkolnik, and a. a. degen, "heat production and body temperature of arabian babblers (turdoides squamiceps): a bird from hot desert habitats," j. arid. environ., vol. 48, pp. 59 67, 2001. [71] e. l. rezende, m. v. lopez calleja, and f. bozinovic, "standard and comparative energetics of a small avian herbivore phytotoma rara," auk, vol. 118, pp. 781 785, 2001. [72] c. hambly, e. j. harper, and j. r. speakman, "cost of flight in the zebra finch (taenopygia guttata): a novel approach based on elimination of c 13 labelled bicarbonate," j. comp. physiol., vol. 172, pp. 529 539, 2002. [73] u. aschoff and h. pohl, "rhythmic variation in energy metabolism," fed. proc., vol. 29, pp. 1541 1552, 1970. [74] b. k. mcnab, "ecological factors affect the level and scalingof avian bmr," comp. biochem. physiol., vol. 152, pp. 22 45, 2009. [75] r. c. lasiewski and w. r. dawson, "a re examination of the relation between standard metabolic rate and body weight in birds," condor, vol. 69, pp. 13 23, 1967. [76] m. r. miller and j. mcaeadie, "the allometric relationship between resting metabolic rate and body mass in wild waterfowl (anatide) and an application to estimation of wintering habitat requirement," condor, vol. 108, pp. 166 177, 2006. [77] k. a. nagy, "field metabolic rate and food requirement scaling in mammals and birds. ecological," monographs 57, vol. 11, pp. 1 128, 1987. [78] r. drent, b. weijand, and b. ebbinge, "balancing the energy budgetof arctic breeding geese throughout the annual cycle: a progress report," verh. ornithol. ges. bayern, vol. 23, pp. 239 264, 1978. [79] p. campredon, "hivernage du canard siffleur (anas penelope, l.) en camargue (france): stationnment et activities," alauda, vol. 49, pp. 161 193, 1981. [80] j. k. kirkwood, "energy requirements for maintenance and growth of wild mammals, birds and reptiles in captivity," j. nutr., vol. 121, pp. 29 34, 1991. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 66 † corresponding author © 2016 conscientia beam. all rights reserved. the effect of the reduced dose of gnrh on conception, ovulation and ovarian structures in ovsynch program of lactating dairy cows fikret karaca1† --gokhan dogruer2 --mustafa kemal saribay3 --yasar ergun4 --cafer tayyar ates5 1mustafa kemal university, faculty of veterinary medicine, department of reproduction and artificial insemination, hatay 2,3,4mustafa kemal university, faculty of veterinary medicine, department of obstetrics and gynecology, hatay 5mustafa kemal university, faculty of veterinary medicine, department of animal breeding, hatay abstract this study was conducted to evaluate the efficacy of reducing gnrh dose on the formation of ovulation and conception, and sizes of the ovarian structures following an ovsynch program in lactating cows. the cows were allocated randomly to two treatment groups (full dose; fd, n=20 and half dose; hd, n=20). cows in the fd group were treated with 10.5 µg buserelin acetate on day 0, with 0.150 mg dcloprostenol 7 d later and with 10.5 µg buserelin acetate 2 d later. estrous cycles in hd group were synchronized using the same scheme as fd-treated cows, but the dose of buserelin acetate was reduced to 5.25 µg at both gnrh administration times. ovarian structures were monitored by ultrasound with a 6-8 mhz linear trans-rectal probe on days 0, 7, 9, 10, and 11. cows were inseminated at the 16-20 h after second gnrh administration. no significant differences were observed in the dominant or ovulatory follicle diameters in fd and hd groups. ovulation incidence from second gnrh injection by the 24 hour after fixed-time ai did not differ between fd (85 %) and hd (90 %) groups. also, the conception percentages did not differ statistically between the hd (50%) and fd (40 %) groups. keywords: buserelin acetate, ovsynch, ovarian structures, ovulation, conception, dairy cows. received: 16 november 2016/ revised: 17 december 2016/ accepted: 30 december 2016/ published: 7 january 2017 contribution/ originality this study is one of very few studies which have investigated the effect of reducing doses of buserelin acetate on the follicular development, ovulation and conception rates in the ovsynch program of dairy cows. 1. introduction the goal for a successful estrous synchronization program in lactating dairy cattle is the precise control of estrous, which will allow high fertility to a fixed-timed artificial insemination (ftai) without the need for estrous detection [1]. previous studies, performed with pgf2α or progesterone based estrous synchronization programs in dairy cows, have shown that these programs are not adequate for ftai without estrous detection [2, 3]. in 1995, a hormonal protocol was developed to synchronize ovulation (ovsynch) in lactating dairy cows using gnrh and pgf 2α. ovsynch protocol may have a major impact on managing reproduction of lactating dairy cows, since it can permit ftai without the need for estrous detection [4]. in the ovsynch program, gnrh is given at a random stage of the estrous cycle, followed by pgf 2α on day 7 and second a dose of gnrh 48 h later [4, 5]. this program coordinates follicular recruitment, corpus luteum (cl) regression and time of ovulation also permits timed animal review 2016 vol. 3, no. 3, pp. 66-72 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2016.3.3/101.3.66.72 © 2016 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2016.3.3/101.3.66.72 animal review, 2016, 3(3): 66-72 67 © 2016 conscientia beam. all rights reserved. insemination 0 to 24 h after the last gnrh injection [1, 4, 6]. although conception rates after detected estrous were greater than those after ftai with ovsynch, pregnancy rates were higher for the ovsynch program because of estrous detection problems [7]. in addition, pursley, et al. [5] suggested that even in dairy herds with good reproductive management, ovsynch protocol can reduce days to conception. however, it has been suggested that the costs of labor and hormone expenses should be considered at deciding this form of reproductive program for routine use [8]. one of the most common objections to using ovsynch is the overall cost of the hormones needed to synchronize ovulation. gnrh creates about 70 % of the total hormone costs in the ovsynch protocols of dairy cows. it was reported that the reproductive performance in dairy cows was not effected when the gnrh dose (gonadorelin, fertirelin) was reduced to half (50 µg instead of 100 µg) in the ovsynch protocols [9, 10]. in a study conducted by ahmadzadeh, et al. [11] a reduced dose of gnrh (gonadorelin) did not affect ovulation time relative to the second gnrh injection and did not compromise the incidence of ovulation and luteal development used in ovsynch protocol. buserelin is a more potent gnrh agonist than both gonadorelin and fertilerin in the bovine for fsh and lh release [12, 13]. therefore, it is generally used at 8-10 µg doses for synchronizing ovulation in the dairy cows [14-16]. however, reducing doses of buserelin in the ovsynch program of dairy cows has not been tested yet. in this study, we have investigated the effect of decreasing the dose of buserelin acetate from 10.5 µg to 5.25 µg on sizes of the ovarian structures, ovulation and conception used in the ovsynch program in lactating dairy cows. 2. materials and methods present study was conducted at a commercial dairy cow farm (ceyhan, adana, turkey). animals were housed in a free stall barn, milked twice daily and fed with a total mixed ration ad libitum to meet the requirement for lactating cows. all cows were subjected to a gynecological examination by trans-rectal palpation and ultrasonography at the beginning of the study. forty lactating holstein cows (4-7 years of age) with normal reproduction at 70-110 days postpartum having body condition score of 2.5 – 3.0 were used in this trial. cows were allocated randomly divided into full-dose (fd, n=20) and half-dose (hd, n=20) ovsynch groups, according to status of luteal structures for minimized cyclic differences between groups. status of luteal structures observed on ovaries in ultrasonic image at the time of first gnrh administration in the animals in treatments groups is presented in table 1. table-1. status of cl diameters at the time of first gnrh administration in treatment groups tratment groups diameter of cl (mm) ≥ 20 mm 11-19 mm 5-10 mm fd ovsynch (n=20) 8 8 4 hf ovsynch (n=20) 7 8 5 total 15 16 9 cows in the fd group were treated with 10.5 µg buserelin acetate, which shows the same effect of 10 µg buserelin (receptal, intervet, turkey) on day 0, with 0.150 mg d-cloprostenol (pgf 2α, dalmazin, vetaş, turkey) on day 7, with 10.5 µg buserelin acetate on day 9. cows in the hd group were synchronized by the same protocol and received 5.25 µg per buserelin acetate injection. both gnrh and pgf2α were administered through intramuscular route, in the thigh muscle (semimembranosus) with 2 or 5 ml syringe with 22 gauge, 32 mm needle. cows in both groups, 16-20 h after their second treatment using buserelin acetate, were inseminated by the same operator. ovarian structures (antral follicles >5 mm in diameter and corpus luteum) were monitored by ultrasound using scanner with 6-8 mhz linear trans-rectal probe (falco vet 100; pie medical; holland) on days 0 (day of gnrh administration) 7, 9, 10, and 11. the equipment had an image freezer facility with electronic calipers for taking animal review, 2016, 3(3): 66-72 68 © 2016 conscientia beam. all rights reserved. measurements. presence of luteal structures at the time of first gnrh injection (day 0), diameter of corpus luteum at the time of pgf2α injection (day 7), diameter of the largest follicle (dominant follicle, df) at the time of the second gnrh injection (day 9) and diameter of the largest follicle (ovulatory follicle, of) at the time of artificial insemination (day 10) were determined by ultrasound. ovaries were also examined at 24 h (day 11) after artificial insemination to confirm ovulation. luteal and follicular structures were defined in real time ultrasound on the basis of their diameter [17-19] and echogenic appearance [20, 21]. ultrasound measurements of follicle and cl diameters were performed according to the technique described by taylor and rajamahendran [17]. briefly, the ovaries were scanned in several planes to identify follicles ≥ 5 mm in diameter and to provide an image of the cl with its greatest cross sectional area. desired images were frozen on the screen; measurements were taken using a built-in caliper system. all ultrasound examinations were performed by one operator. ovulations were determined by following the fate of follicles on the ovary at time of second gnrh injection, in artificial insemination (ai) time and at 24 h after ftai. ovulation was defined as the disappearance of any antral follicle ≥ 10 mm in diameter at the time of an ultrasound examination compared with the previous ultrasound examination [22]. ovulation incidence was calculated as the number of cows that ovulated at least one follicle from the second gnrh injection to 24 hours after ftai, expressed as a percentage of the total number of cows receiving ovsynch protocol. cows that ovulated at last one follicle between second gnrh injection and ftai were classified as ovulating before ftai. cows that did not ovulate by 24 h after ftai were classified as not ovulating during the treatment scheme. diameter of ovulatory follicle in cows synchronized with full-dose or half dose gnrh were determined on the day second gnrh treatment (d 9) and ftai (d 11) were provided. conceptions were determined by ultrasound detection of embryonic fluid and fetus at 30 d post ftai in all cows. all statistical analyses were performed with the spss 22.0. the significance of differences in the average cl diameter at time of pgf2α injection (d 7), dominant follicle diameter at time of second gnrh (d 9) injection and size of ovulatory follicle in the during ftai (d 10) between the groups were analyzed by t-test. number and percentage of cows ovulating after treatment with full dose or half dose of gnrh in the ovsynch protocol were compared using the fisher’s exact chi-square test. conception incidence at 30 d post ftai between treatment groups (fd or hd groups) were analyzed with chi-square test. 3. results mean cl diameter (±sem) at time of pgf2α injection (d 7), dominant follicle diameter at time of second gnrh injection (d 9) and ovulatory follicle diameter during ftai (d 10) in lactating holstein cows treated with 10.5 µg (fd) or 5.25 µg (hd) of gnrh are shown in table 2. all cows in treatment groups had a cl ( ≥ 10 mm) at time of pgf2α injection, the mean of cl diameters (±sem) were not different between fd and hd groups (p>0.05). no significant differences were observed between the means of dominant (16.8±0.7 mm vs. 17.7±0.8 mm) or ovulatory follicle (20.0±1.0 mm vs. 20.9±1.0 mm) diameters in fd and hd groups (p>0.05). table-2. the measurements of ovarian structures at time of pgf2α injection ( d 7), at time of second gnrh (d 9) injection and at ai (d 10) in treatment groups. treatment groups a cl diameter (mm) df diameter (mm) of diameter (mm) at pgf2α injection at second gnrh injection at time of ai fd ovsynch (n=20) 23.0 ± 1.6 16.8 ± 0.7 20.0 ± 1.0 hd ovsynch (n=20) 20.4 ± 1.7 17.7 ± 0.8 20.9 ± 1.0 cl: corpus luteum, df: dominant follicle, of: ovulatory follicle a for each item, no statistical difference between treatment groups was detected using ttest. p> 0.05 ovulation incidence of cows in the fd and hd groups from second gnrh injection to 24th hours after ftai is presented in table 3. animal review, 2016, 3(3): 66-72 69 © 2016 conscientia beam. all rights reserved. table-3. number and percentage of cows ovulating in full dose or half dose gnrh treatment groups treatment groups a ovulations before fixed-time aib, n (%) ovulations by 24th hours after fixed-time aic, n (%) yes no yes no fd ovsynch (n=20) 0 20 (100) 17 (85) 3 (15) hd ovsynch (n=20) 3 (15) 17 (85) 18 (90) 2 (10) a for each item, no statistical difference between treatment groups was detected using the fisher’s exact chi-square test. p> 0.05 b time interval from second gnrh to fixed-time ai. c time interval from second gnrh injection to 24th hours after fixed-time ai. ovulation incidence from second gnrh injection by 24th hours after ftai did not differ between fd (85 %) and hd (90 %) groups (p>0.05). ovulation between second gnrh and ftai was not observed in any of the cows in the fd group, however three cows (15 %) in the hd group showed ovulation within this time-interval. the percentages of non-ovulating cows within 24 h after ftai were 15 % and 10 % for fd and hd groups, respectively and no statistically difference was found (p>0.05). the percent of conception was 40 % (8/20) and 50 % (10/20) in fd and hd groups, respectively. the percent of conception was similar (p>0.05) between the treatment groups. 4. discussion and conclusion ovsynch is a useful protocol that control ovarian follicular and luteal functions also increases exactness of estrous synchronization in dairy cattle [5, 14]. gnrh is given at random stages of the estrous cycle to induce ovulation of the dominant follicle and synchronize follicle wave emergence. the morphological transformations of the cl present at the time of treatment are induced within a 6 d period after treatment with a gnrh agonist [14]. seven days later, pgf is given to regress either the original and/or newly formed cl [1]. in this study, all cows of fd and hd groups had a cl ( ≥ 10 mm) at time of pgf2α injection. bülbül, et al. [23] reported cows of which the ovsynch protocol began during oestrus, metoestrus, dioestrus or proestrus, 91.7 %, 100 %, 90 % and 100 % had lutein tissue on day 7, respectively. in addition, pierson and ginther [24] reported that the corpus luteum became visible approximately three days after ovulation and was identifiable throughout the rest of the interovulatory interval. studies on cl diameter at time of pgf2α injection (d 7) in the ovsynch program in dairy cows are limited. however, bülbül, et al. [23] reported that ovsynch protocol began during oestrus, metoestrus, dioestrus or proestrus, mean corpus luteum diameters (mm ± s.e.m) on day 7 were 22.0 ± 2.20, 29.0 ± 2.33, 22.3 ± 2.74 and 20.6 ± 1.55, respectively. the mean (± sem) corpus luteum diameters in the fd (23.0 ± 1.6 mm) and hd (20.4 ± 1.7 mm) groups were consistent with this report. in the present study, average dominant follicle diameters (± sem) at the time of second gnrh injection were 16.8 ± 0.7 mm and 17.7 ± 0.8 mm in the fd and hd groups, respectively. cavestany, et al. [25] stated that the largest size of df of the new wave was attained at the day of second gnrh and the diameter of df on day 9 was 16.2 ± 1.9 mm in cows treated with an ovsynch protocol with medroxyprogesterone acetate. in a previous study [16] it was reported that df diameter was 15.9 mm at 80 h after pgf injection of ovsynch in lactating dairy cows. bello, et al. [26] reported that the ovulatory follicle diameter was 15.7 ± 0.4 mm at the time of second gnrh injection of ovsynch. in agreement with previous findings [16, 25, 26] the present study demonstrated that usage of half dose buserelin acetate for ovsynch protocol in lactating cows did not have adverse effects on dominant follicle diameters. in the current study, the mean ovulatory follicle diameters at the time of ai (d 10) were not different in fd (10.5 µg buserelin acetate) and hd (5.25 µg buserelin acetate) groups. similarly, ahmadzadeh, et al. [11] reported that the size of ovulatory follicle in lactating holstein cows treated with a full (100 µg cystorelin) or half dose (50 µg cystorelin) of gnrh in the ovsynch protocol did not differ between full and half dose groups. in earlier studies, animal review, 2016, 3(3): 66-72 70 © 2016 conscientia beam. all rights reserved. the mean ovulatory follicle diameter at the time of ftai at 7-day gnrh-based protocol in lactating dairy cows was determined to be between 15.3 and 20.7 mm [27-30]. in the present study, percentages of ovulation rate obtained in fd (85 %) and hd (90 %) groups are similar to the findings of picard-hagen, et al. [31]; ahmadzadeh, et al. [11]; yamada, et al. [10]; cordoba and fricke [32] and fricke, et al. [9] who found ovulation rates ranging from 81.8 100 % in dairy cows treated with ovsynch protocol using full and half dose gnrh. the aim of second gnrh injections in ovsynch protocol is inducing the ovulations of dominant follicles [5, 10]. the results of this research shows that the reduced dose of buserelin acetate was as effective as full dose buserelin acetate for ovulation formation in ovsynch protocol in lactating cows. in the present study, conception percentages at 30 d post ai were similar in the fd (40 %) and hd (50 %) groups. fricke, et al. [9] reported that conception rates were 41.0 % and 41.1 % at 28 post ai in the ovsynch protocol using full and half dose gnrh (cystorelin: 100 or 50 µg). cordoba and fricke [32] reported that conception rate was 44.0 % on 32 d after ai in the ovsynch protocol using half dose gnrh (cystorelin; 50 µg). also, yamada, et al. [10] reported that conception rates were 59.5 % and 61.1% in lactating dairy cows following synchronization of ovulation/ftai using 100 or 50 µg fertirelin acetate. according to the results of the study reduced dose of buserelin acetate did not have any negative effect on conception rates. also, this finding is consistent with results of previous studies [9, 10, 32]. these results indicate that a reduced dose of buserelin acetate used in ovsynch protocol in lactating cows did not affect the corpus luteum diameters, dominant follicle diameters, ovulatory follicle diameters, ovulation and conception incidence. therefore, we conclude that 5.25 µg buserelin acetate is as effective as full dose (10.5 µg) in the ovsynch protocol of lactating dairy cows. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] w. w. thatcher, t. r. bilby, j. a. bartolome, f. silvestre, c. r. staples, and j. e. p. santos, "strategies for improving fertility in the modern dairy cow," theriogenology, vol. 65, pp. 30-44, 2006. view at google scholar | view at publisher [2] c. s. whisnant, s. p. washburn, and p. w. farin, "current concepts in synchronization of estrus and ovulation of dairy cows," journal of animal science, vol. 77, pp. 1-8, 2000. view at google scholar | view at publisher [3] m. c. lucy, s. mcdougall, and d. p. nation, "the use of hormonal treatments to improve the reproductive performance of lactating dairy cows in feedlot or pasture-based management systems," animal reproduction science, vol. 82–83, pp. 495-512, 2004. view at google scholar | view at publisher [4] j. r. pursley, m. o. mee, and m. c. wiltbank, "synchronization of ovulation in dairy cows using pgf2a and gnrh," theriogenology, vol. 44, pp. 915-923, 1995. view at google scholar | view at publisher [5] j. r. pursley, m. c. wiltbank, j. s. stevenson, j. s. ottobre, h. a. garverick, and l. l. anderson, "pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation or synchronized estrous," journal of dairy science, vol. 80, pp. 295300, 1997. view at google scholar | view at publisher [6] j. r. pursley, r. w. silcox, and m. c. wiltbank, "effect of time of artificial insemination on pregnancy rates, calving rates, pregnancy loss, and gender ratio after synchronization of ovulation in lactating dairy cows," journal of dairy science, vol. 81, pp. 2139-2144, 1998. view at google scholar | view at publisher [7] s. suadsong, "control of oestrus and ovulation in cows," thai journal of veterinary medicine supplement, vol. 41, pp. 9598, 2011. view at google scholar [8] a. r. rabiee, i. j. lean, and m. a. stevenson, "efficacy of ovsynch program on reproductive performance in dairy cattle: a meta-analysis," journal of dairy science, vol. 88, pp. 2754-2770, 2005. view at google scholar | view at publisher https://scholar.google.com/scholar?hl=en&q=strategies%20for%20improving%20fertility%20in%20the%20modern%20dairy%20cow http://dx.doi.org/10.1016/j.theriogenology.2005.10.004 https://scholar.google.com/scholar?hl=en&q=current%20concepts%20in%20synchronization%20of%20estrus%20and%20ovulation%20of%20dairy%20cows http://dx.doi.org/10.2527/jas2000.00218812007700es0042x https://scholar.google.com/scholar?hl=en&q=the%20use%20of%20hormonal%20treatments%20to%20improve%20the%20reproductive%20performance%20of%20lactating%20dairy%20cows%20in%20feedlot%20or%20pasture-based%20management%20systems http://dx.doi.org/10.1016/j.anireprosci.2004.05.004 https://scholar.google.com/scholar?hl=en&q=synchronization%20of%20ovulation%20in%20dairy%20cows%20using%20pgf2a%20and%20gnrh http://dx.doi.org/10.1016/0093-691x(95)00279-h https://scholar.google.com/scholar?hl=en&q=pregnancy%20rates%20per%20artificial%20insemination%20for%20cows%20and%20heifers%20inseminated%20at%20a%20synchronized%20ovulation%20or%20synchronized%20estrous http://dx.doi.org/10.3168/jds.s0022-0302(97)75937-x https://scholar.google.com/scholar?hl=en&q=effect%20of%20time%20of%20artificial%20insemination%20on%20pregnancy%20rates,%20calving%20rates,%20pregnancy%20loss,%20and%20gender%20ratio%20after%20synchronization%20of%20ovulation%20in%20lactating%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(98)75790-x https://scholar.google.com/scholar?hl=en&q=control%20of%20oestrus%20and%20ovulation%20in%20cows https://scholar.google.com/scholar?hl=en&q=efficacy%20of%20ovsynch%20program%20on%20reproductive%20performance%20in%20dairy%20cattle:%20a%20meta-analysis http://dx.doi.org/10.3168/jds.s0022-0302(05)72955-6 animal review, 2016, 3(3): 66-72 71 © 2016 conscientia beam. all rights reserved. [9] p. m. fricke, j. n. guenther, and m. c. wiltbank, "effıcacy of decreasing the dose of gnrh used in a protocol for synchronization of ovulation and timed ai in lactatıng dairy cows," theriogenology, vol. 50, pp. 1275-1284, 1998. view at google scholar | view at publisher [10] k. yamada, t. nakao, k. nakada, and g. matsuda, "influence of gnrh analogue (fertirelin acetate) doses on synchronization of ovulation and fixed-time artificial insemination in lactating dairy cows," animal reproduction science, vol. 74, pp. 27-34, 2002. view at google scholar | view at publisher [11] a. ahmadzadeh, r. manzo, c. b. sellars, and j. c. dalton, "the efficacy of a reduced dose of gonadotropin releasing hormone on the time and incidence of ovulation in holstein cows," journal of animal and veterinary advances, vol. 6, pp. 1328-1332, 2007. view at google scholar [12] j. r. chenault, "effect of fertirelin acetate or buserelin on conception rate at first or second insemination in lactating dairy cows," journal of dairy science, vol. 73, pp. 633-638, 1990. view at google scholar | view at publisher [13] k. l. macmillan, b. v. e. segwagve, and c. s. pino, "associated between the manipulation of patterns of follicular development and fertility in cattle," animal reproduction science, vol. 78, pp. 327-344, 2003. view at google scholar | view at publisher [14] h. twagiramungu, l. a. guilbault, and j. j. dufour, "synchronization of ovarian follicular waves with a gonadotropinreleasing hormone agonist to increase the precision of estrous in cattle: a review," journal of animal science, vol. 73, pp. 3141-3151, 1995. view at google scholar | view at publisher [15] z. z. xu, l. j. burton, and k. l. macmillan, "reproductive performance of lactating dairy cows following estrous synchronization regimens with pgf2α and progesterone," theriogenology, vol. 47, pp. 687-701, 1997. view at google scholar | view at publisher [16] m. m. herlihy, m. a. crowe, m. g. diskin, and s. t. butler, "effects of synchronization treatments on ovarian follicular dynamics, corpus luteum growth, and circulating steroid hormone concentrations in lactating dairy cows," journal of dairy science, vol. 95, pp. 743-754, 2012. view at google scholar | view at publisher [17] c. taylor and r. rajamahendran, "follicular dynamics and corpus luteum growth and function in pregnant versus nonpregnant dairy cows," journal of dairy science, vol. 74, pp. 115-123, 1991. view at google scholar | view at publisher [18] m. c. veronesi, g. gabai, m. battocchio, a. mollo, f. soldano, g. bono, and f. cairoli, "ultrasonographic appearance of tissue is a better indicator of cl function than cl diameter measurement in dairy cows," theriogenology, vol. 58, pp. 61-68, 2002. view at google scholar | view at publisher [19] a. gümen, j. n. guenther, and m. c. wiltbank, "follicular size and response to ovsynch versus detection of estrus in anovular and ovular lactating dairy cows," journal of dairy science, vol. 86, pp. 3184-3194, 2003. view at google scholar | view at publisher [20] p. m. fricke, "scanning the future-ultrasonography as a reproductive management tool for dairy cattle," journal of dairy science, vol. 85, pp. 1918-1926, 2002. view at google scholar | view at publisher [21] r. c. bicalho, k. n. galvão, c. l. guard, and j. e. p. santos, "optimizing the accuracy of detecting a functional corpus luteum in dairy cows," theriogenology, vol. 70, pp. 199-207, 2008. view at google scholar | view at publisher [22] h. kaneko, t. terada, k. taya, g. watanabe, s. sasamoto, y. hasegawa, and m. igarashi, "ovarian follicular dynamics and concentrations of oestradiol-17 beta, progesterone, luteinizing hormone and follicle stimulating hormone during the periovulatory phase of the oestrous cycle in the cow," reproduction, fertility and development, vol. 3, pp. 529535, 1991. view at google scholar | view at publisher [23] b. bülbül, m. kırbaş, m. köse, ş. dursun, and m. çolak, "the affects of ovsynch started in different phases of oestrus cycle on oestrus synchronization in cows," journal of the faculty of veterinary medicine, vol. 35, pp. 7-17, 2009. view at google scholar [24] r. a. pierson and o. j. ginther, "ultrasonography of the bovine ovary," theriogenology, vol. 21, pp. 495-504, 1984. view at google scholar | view at publisher https://scholar.google.com/scholar?hl=en&q=effıcacy%20of%20decreasing%20the%20dose%20of%20gnrh%20used%20in%20a%20protocol%20for%20synchronization%20of%20ovulation%20and%20timed%20ai%20in%20lactatıng%20dairy%20cows https://scholar.google.com/scholar?hl=en&q=effıcacy%20of%20decreasing%20the%20dose%20of%20gnrh%20used%20in%20a%20protocol%20for%20synchronization%20of%20ovulation%20and%20timed%20ai%20in%20lactatıng%20dairy%20cows http://dx.doi.org/10.1016/s0093-691x(98)00226-x https://scholar.google.com/scholar?hl=en&q=influence%20of%20gnrh%20analogue%20(fertirelin%20acetate)%20doses%20on%20synchronization%20of%20ovulation%20and%20fixed-time%20artificial%20insemination%20in%20lactating%20dairy%20cows http://dx.doi.org/10.1016/s0378-4320(02)00161-6 https://scholar.google.com/scholar?hl=en&q=the%20efficacy%20of%20a%20reduced%20dose%20of%20%20gonadotropin%20releasing%20hormone%20on%20the%20time%20and%20incidence%20of%20ovulation%20in%20holstein%20cows https://scholar.google.com/scholar?hl=en&q=effect%20of%20fertirelin%20acetate%20or%20buserelin%20on%20conception%20rate%20at%20first%20or%20second%20insemination%20in%20lactating%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(90)78714-0 https://scholar.google.com/scholar?hl=en&q=associated%20between%20the%20manipulation%20of%20patterns%20of%20follicular%20development%20and%20fertility%20in%20cattle http://dx.doi.org/10.1016/s0378-4320(03)00098-8 http://dx.doi.org/10.1016/s0378-4320(03)00098-8 https://scholar.google.com/scholar?hl=en&q=synchronization%20of%20ovarian%20follicular%20waves%20with%20a%20gonadotropin-releasing%20hormone%20agonist%20to%20increase%20the%20precision%20of%20estrous%20in%20cattle:%20a%20review http://dx.doi.org/10.2527/1995.73103141x https://scholar.google.com/scholar?hl=en&q=reproductive%20performance%20of%20lactating%20dairy%20cows%20following%20estrous%20synchronization%20regimens%20with%20pgf2α%20and%20progesterone https://scholar.google.com/scholar?hl=en&q=reproductive%20performance%20of%20lactating%20dairy%20cows%20following%20estrous%20synchronization%20regimens%20with%20pgf2α%20and%20progesterone http://dx.doi.org/10.1016/s0093-691x(97)00027-7 https://scholar.google.com/scholar?hl=en&q=effects%20of%20synchronization%20treatments%20on%20ovarian%20follicular%20dynamics,%20corpus%20luteum%20growth,%20and%20circulating%20steroid%20hormone%20concentrations%20in%20lactating%20dairy%20cows http://dx.doi.org/10.3168/jds.2011-4779 https://scholar.google.com/scholar?hl=en&q=follicular%20dynamics%20and%20corpus%20luteum%20growth%20and%20function%20in%20pregnant%20versus%20nonpregnant%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(91)78151-4 https://scholar.google.com/scholar?hl=en&q=ultrasonographic%20appearance%20of%20tissue%20is%20a%20better%20indicator%20of%20cl%20function%20than%20cl%20diameter%20measurement%20in%20dairy%20cows http://dx.doi.org/10.1016/s0093-691x(02)00915-9 https://scholar.google.com/scholar?hl=en&q=follicular%20size%20and%20response%20to%20ovsynch%20versus%20detection%20of%20estrus%20in%20anovular%20and%20ovular%20lactating%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(03)73921-6 http://dx.doi.org/10.3168/jds.s0022-0302(03)73921-6 https://scholar.google.com/scholar?hl=en&q=scanning%20the%20future-ultrasonography%20as%20a%20reproductive%20management%20tool%20for%20dairy%20cattle http://dx.doi.org/10.3168/jds.s0022-0302(02)74268-9 https://scholar.google.com/scholar?hl=en&q=optimizing%20the%20accuracy%20of%20detecting%20a%20functional%20corpus%20luteum%20in%20dairy%20cows http://dx.doi.org/10.1016/j.theriogenology.2008.03.015 https://scholar.google.com/scholar?hl=en&q=ovarian%20follicular%20dynamics%20and%20concentrations%20of%20oestradiol-17%20beta,%20progesterone,%20luteinizing%20hormone%20and%20follicle%20stimulating%20hormone%20during%20the%20periovulatory%20phase%20of%20the%20oestrous%20cycle%20in%20the%20cow http://dx.doi.org/10.1071/rd9910529 https://scholar.google.com/scholar?hl=en&q=the%20affects%20of%20ovsynch%20started%20in%20different%20phases%20of%20oestrus%20cycle%20on%20oestrus%20synchronization%20in%20cows https://scholar.google.com/scholar?hl=en&q=the%20affects%20of%20ovsynch%20started%20in%20different%20phases%20of%20oestrus%20cycle%20on%20oestrus%20synchronization%20in%20cows https://scholar.google.com/scholar?hl=en&q=ultrasonography%20of%20the%20bovine%20ovary https://scholar.google.com/scholar?hl=en&q=ultrasonography%20of%20the%20bovine%20ovary http://dx.doi.org/10.1016/0093-691x(84)90411-4 animal review, 2016, 3(3): 66-72 72 © 2016 conscientia beam. all rights reserved. [25] d. cavestany, a. meikle, h. kindahl, e. van lier, f. moreira , w. w. thatcher, and m. forsberg, "use of medroxyprogesterone asetate (map) in lactating holstein cows within an ovsynch protocol: follicular growth and hormonal patterns," theriogenology, vol. 59, pp. 1787-1798, 2003. view at google scholar | view at publisher [26] n. m. bello, j. p. steibel, and j. r. pursley, "optimizing ovulation to first gnrh improved outcomes to each hormonal injection of ovsynch in lactating dairy cows," journal of dairy science, vol. 89, pp. 3413-3424, 2006. view at google scholar | view at publisher [27] j. l. m. vasconcelos, r. w. silcox, g. j. m. rosa, j. r. pursley, and m. c. wiltbank, "synchronization rate, size of the ovulatory follicle, and pregnancy rate after synchronization of ovulation beginning on different days of the estrous cycle in lactating dairy cows," theriogenology, vol. 52, pp. 1067-1078, 1999. view at google scholar | view at publisher [28] r. l. a. cerri, h. m. rutigliano, r. c. chebel, and j. e. p. santos, "period of dominance of the ovulatory follicle influences embryo quality in lactating dairy cows," reproduction, vol. 137, pp. 813-823, 2009. view at google scholar | view at publisher [29] j. e. p. santos, c. d. narciso, f. rivera, w. w. thatcher, and r. c. chebel, "effect of reducing the period of follicle dominance in a timed artificial insemination protocol on reproduction of dairy cows," journal of dairy science, vol. 93, pp. 2976-2988, 2010. view at google scholar | view at publisher [30] m. köse, m. kırbaş, b. bülbül, and a. oyar, "investigation of efficacy of human chorionic gonadotropin (hcg) instead of second gonadotropin-releasing hormon injection (gnrh) at ovsynch protocol in cows," journal of the faculty of veterinary medicine, istanbul university, vol. 40, pp. 155-161, 2014. [31] n. picard-hagen, g. lhermie, s. florentin, d. merle , p. frein, and v. gayrard, "effect of gonadorelin, lecirelin, and buserelin on lh surge, ovulation, and progesterone in cattle," theriogenology, vol. 84, pp. 177-183, 2015. view at google scholar | view at publisher [32] m. c. cordoba and p. m. fricke, "evaluation of two hormonal protocols for synchronization of ovulation and timed artificial ınsemination in dairy cows managed in grazing-based dairies," journal of dairy science, vol. 84, pp. 2700-2708, 2001. view at google scholar | view at publisher views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://scholar.google.com/scholar?hl=en&q=use%20of%20medroxyprogesterone%20asetate%20(map)%20in%20lactating%20holstein%20cows%20within%20an%20ovsynch%20protocol:%20follicular%20growth%20and%20hormonal%20patterns http://dx.doi.org/10.1016/s0093-691x(02)01230-x https://scholar.google.com/scholar?hl=en&q=optimizing%20ovulation%20to%20first%20gnrh%20improved%20outcomes%20to%20each%20hormonal%20injection%20of%20ovsynch%20in%20lactating%20dairy%20cows http://dx.doi.org/10.3168/jds.s0022-0302(06)72378-5 https://scholar.google.com/scholar?hl=en&q=synchronization%20rate,%20size%20of%20the%20ovulatory%20follicle,%20and%20pregnancy%20rate%20after%20synchronization%20of%20ovulation%20beginning%20on%20different%20days%20of%20the%20estrous%20cycle%20in%20lactating%20dairy%20cows http://dx.doi.org/10.1016/s0093-691x(99)00195-8 https://scholar.google.com/scholar?hl=en&q=period%20of%20dominance%20of%20the%20ovulatory%20follicle%20influences%20embryo%20quality%20in%20lactating%20dairy%20cows http://dx.doi.org/10.1530/rep-08-0242 http://dx.doi.org/10.1530/rep-08-0242 https://scholar.google.com/scholar?hl=en&q=effect%20of%20reducing%20the%20period%20of%20follicle%20dominance%20in%20a%20timed%20artificial%20insemination%20protocol%20on%20reproduction%20of%20dairy%20cows http://dx.doi.org/10.3168/jds.2009-2870 https://scholar.google.com/scholar?hl=en&q=effect%20of%20gonadorelin,%20lecirelin,%20and%20buserelin%20on%20lh%20surge,%20ovulation,%20and%20progesterone%20in%20cattle https://scholar.google.com/scholar?hl=en&q=effect%20of%20gonadorelin,%20lecirelin,%20and%20buserelin%20on%20lh%20surge,%20ovulation,%20and%20progesterone%20in%20cattle http://dx.doi.org/10.1016/j.theriogenology.2015.03.004 https://scholar.google.com/scholar?hl=en&q=evaluation%20of%20two%20hormonal%20protocols%20for%20synchronization%20of%20ovulation%20and%20timed%20artificial%20ınsemination%20in%20dairy%20cows%20managed%20in%20grazing-based%20dairies http://dx.doi.org/10.3168/jds.s0022-0302(01)74724-8 58 † corresponding author © 2015 conscientia beam. all rights reserved. correlation between milk yield, somatic cell count and milk quality in dairy farming ferhan kaygısız1* --gürhan çiftçioğlu2 --gülhan h. türkay3 --yavuz cevger4 -ghassan issa5 --hülya yalçıntan6 --hasret yardibi7 1,6istanbul university, faculty of veterinary medicine, animal husbandry department, avcılar, i̇stanbul, turkey 2,5istanbul university, faculty of veterinary medicine, food hygiene and technology department ,avcılar, i̇stanbul, turkey 3,7istanbul university, faculty of veterinary medicine, biochemistry department, avcılar, i̇stanbul, turkey 4ankara university, faculty of veterinary medicine, animal health economics and management department, dışkapı, ankara, turkey abstract this study investigated between milk yield and somatic cell count, sampled from 3 different dairy enterprises. chemical and microbiological parameters analyzed for the relation with milk yield. milk samples have been collected from 10 dairy cows, two times per month during 1 year period. bacteriological analyzes have been employed for milks. milk yield data for each cow have been recorded in every sampling day. depending on the logistic regretion analyses on the data collected from all enterprises; high total plate count and e.coli counts have negative effects on milk yield, but has been found significally important (p<0.05) only for the data of e.coli. counts. in group 1; somatic cell count and e.coli counts have negative effect on milk yield and only the data of e.coli has been found statistically important (p<0.05). in group 2; only the data related negative effect of e.coli counts on milk yield has been found as statistically important (p<0.05). the third group, total plate count has negative effect on milk yield. regarding to the chemical analyses of fat in milk, non-fat dry matter, density and protein values have been detected in the enterprises 1, 2 and 3 as 2.88, 3.56, 4.34; 7.91, 7.83, 8.12; 1026.4, 1025.8, 1026; 3.04, 2.96, 3.07, respectively. according to the correlation analyses applied between milk yield and fat in milk, non fat-dry matter, protein and density in milk in all enterprises; there were significant correlation between non-fat dry matter and milk yield in enterprise 2 (p<0.05) and density and milk yield in enterprise 3 (p<0.01). keywords: cow, raw milk, milk yield, milk quality, somatic cell counts, biochemical parameters. received: 26 november 2014/ revised: 3 april 2015/ accepted: 7 april 2015/ published: 10 april 2015 animal review 2015 vol. 2, no. 2, pp. 58-67 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.2/101.2.58.67 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.2/101.2.58.67 animal review, 2015, 2(2): 58-67 59 © 2015 conscientia beam. all rights reserved. contribution/ originality the study contributes the existing literature, which the correlation between scc and the microbiological milk quality has been compared, in order to analize the possible effects on the production of dairy products and the reflection for dairy industry. 1. introduction milk quality can have a significant impact on milk processing efficiency and product quality and encompasses factors relating to composition, udder health and hygiene [1]. udder health and somatic cell count (scc) are among the most important criteria in evaluating the quality of milk produced and herd management, in the countries where animal husbandry is developed [2, 3]. the negative relationship between scc and milk yield is commonly used in estimating the financial losses related to mastitis in dairy cattle plants. these estimates guide for studies regarding the control and prevention of mastitis [4-7]. the european union (eu) has banned the consumption of milk, of which bulk tank scc (btscc) excesses the value of 400.000 cell/ml., since 1998. this limit is set in turkish food codex as 500.000 cell/ml. it became obligatory for the milk producers in turkey which carries out eu integration procedures to take the necessary measures regarding mastitis in order to increase operational profitability and to ensure the milk hygiene. the aim of the present study is to determine the relationship between scc and milk yield in three intensive plants and to explore the current situation in terms of recent quality of milk produced. 2. materials and methods 30 cows in three different intensive plants were used as animal materials in the present study. milk samples were taken from each udder lobe of 10 cows in each plant two times a month during one year. charm firefly, ff-ft-carry-cs model atp bioluminescence somatic cell count device and scc kits were used for scc determination. the milk composition analyses, fat, fat-free dry matter, density and protein analyses were performed by using the milkana ultrasonic milk analyser (ekomilk eon trading llç usa). after the scc analysis of the milks obtained from dairy cattle, microbiological analyses were employed for milks, which were over the limit of 500.000 cell/ml stated in the turkish food codex [8] and therefore found to be unsuitable for consumption. the raw milk samples brought to the laboratory were subjected to microbiological analyses in terms of total number of aerobic mesophylic bacteria (tmc), generic escherichia coli (e.coli) and staphylococcus aureus (s.aureus) counts. for microbiological analyses, serial decimal dilutions were prepared up to stage (1/10) 107 from main dilution of 10 ml milk sample / 90 ml phosphate buffer solution [9] and 1 ml from these dilutions were applied into appropriate 3m sterile petrifilms in duplicates. petrifilm aerobic count plates (3m, 06400) were used in order to determine total aerobic mesophylic bacteria count (tmc). petrifilms were inoculated and incubated at 321°c degree for 481 hours. the aerobic count plates were evaluated at the end of the incubation period [10]. petrifilm e.coli/coliform plates (3m, 06404) were used in order to animal review, 2015, 2(2): 58-67 60 © 2015 conscientia beam. all rights reserved. determine the number of coliform – e.coli bacteria. petrifilms were inoculated and incubated at 35°c degree for 242 hours. the coliform – e.coli bacteria count plates were evaluated at the end of the incubation period [11]. petrifilm s. aureus count plates (3m, 06490) were used in order to determine the number of s. aureus. petrifilms were inoculated and incubated at 371°c degree for 481 hours. biochemical identification tests were performed via the application of s.aureus discs on positive colonies at the end of the incubation period [12]. additionally, the data about the daily milk efficiency, the number of lactation on the date when the milk samples were taken and about lactation period were recorded. in order to determine the relationship between scc, milk yield, tmc, e.coli and s.aureus counts, the “logistic regression model” was used as a method of data analysis [13]. to this end, the variable milk yield (my) was categorized into two groups based on intra-group average milk yield: “below the group average” and “above the group average”. it was included in the created regression equation under two categories as “low” and “high”. due to the heterogeneous structure of the independent variables, these variables were included in the equation being logarithmically transformed. accordingly, 4 independent variables, which are logscc, logtmc, logecoli and logsaureus, were used. a correlation analysis was performed in order to determine the relationship between milk yield and fat, fat-free dry matter, density and protein in milk. 3. results 3.1. findings related to the relationship between milk yield and milk quality analyze results regarding to all enterprises have been given in table 1. table-1. logistic regression analysis results between milk yield and microbiological tests for all enterprises variables b sx wald df sig exp(b) logscc 0.100 0.298 0.112 1 0.738 1.105 logtmc -0.190 0.214 0.790 1 0.374 0.827 logecoli -0.336 0.162 4.310 1 0.038 0.714 logsaureus 0.094 0.099 0.903 1 0.342 1.098 constant 0.754 1.076 0.491 1 0.484 2.126 logscc: logaritmic somatic cell counts, logtmc: logaritmic total aerobic mesophylic bacteria, logecoli: logaritmic generic escherichia coli, logsaureus: logaritmic staphylococcus aureus b: regression coefficient, sx: standart error, wald: b/sx, df: degree of freedom, sig: significant, exp: odds ratio when table 1 is analyzed, where the results of the logistic regression performed on the data of all enterprises were shown, it was seen that tmc and e.coli counts in milk have a negative effect on milk yield; however only the value of e.coli was statistically significant (p<0.05). accordingly, a logarithmic increase of 1 unit in e.coli counts in milk was caused a 0.34% decrease in the total milk yield. animal review, 2015, 2(2): 58-67 61 © 2015 conscientia beam. all rights reserved. table-2. logistic regression analysis results between milk yield and microbiological tests for enterprise 1 variables b sx wald df sig exp(b) logscc -0.357 0.638 0.313 1 0.576 0.700 logtmc 0.207 0.420 0.243 1 0.622 1.231 logecoli -0.823 0.323 6.500 1 0.011 0.439 logsaureus 0.083 0.184 0.202 1 0.653 1.086 constant 1.093 2.259 0.234 1 0.629 2.983 logscc: logaritmic somatic cell counts, logtmc: logaritmic total aerobic mesophylic bacteria, logecoli: logaritmic generic escherichia coli, logsaureus: logaritmic staphylococcus aureus b: regression coefficient, sx: standart error, wald: b/sx, df: degree of freedom, sig: significant, exp: odds ratio when table 2, which shows the logistic regression analysis results of the data of the 1st enterprise, was examined, it was seen that number of somatic cells and e.coli counts have a negative effect on milk yield; however, only the value of e.coli was statistically significant (p<0.05). accordingly, a logarithmic increase of 1 unit in e.coli counts in milk was caused an 0.82% decrease in the total milk yield. table-3. logistic regression analysis results between milk yield and microbiological tests for enterprise 2 variables b sx wald df sig exp(b) logscc 0.433 0.618 0.491 1 0.483 1.543 logtmc 0.627 0.412 2.313 1 0.128 1.872 logecoli -0.874 0.368 5.652 1 0.017 0.417 logsaureus -0.041 0.224 0.033 1 0.856 0.960 constat -2.077 1.982 1.098 1 0.295 0.125 logscc: logaritmic somatic cell counts, logtmc: logaritmic total aerobic mesophylic bacteria, logecoli: logaritmic generic escherichia coli, logsaureus: logaritmic staphylococcus aureus b: regression coefficient, sx: standart error, wald: b/sx, df: degree of freedom, sig: significant, exp: odds ratio when table 3, which shows the logistic regression analysis results of the data of the 2nd enterprise, was examined, it was seen that only the negative effect of e.coli counts on milk yield was statistically significant (p<0.05). accordingly, a logarithmic increase of 1 unit in e.coli counts in milk was caused an 87% decrease in the total milk yield. table-4. logistic regression analysis results between milk yield and microbiological tests for enterprise 3 variables b sx wald df sig exp(b) logscc 0.546 0.470 1.347 1 0.246 1.726 logtmc -0.787 0.427 3.394 1 0.065 0.455 logecoli 0.204 0.268 0.576 1 0.448 1.226 logsaureus 0.199 0.159 1.568 1 0.211 1.220 constant 0.562 2.238 0.063 1 0.802 1.754 logscc: logaritmic somatic cell counts, logtmc: logaritmic total aerobic mesophylic bacteria, logecoli: logaritmic generic escherichia coli, logsaureus: logaritmic staphylococcus aureus b: regression coefficient, sx: standart error, wald: b/sx, df: degree of freedom, sig: significant, exp: odds ratio when table 4, which shows the logistic regression analysis results of the data of the 3rd enterprise, was examined, it was seen that tmc has a negative effect on milk yield for this group; however, this effect was not statistically significant (p<0.05). accordingly, a logarithmic increase animal review, 2015, 2(2): 58-67 62 © 2015 conscientia beam. all rights reserved. of 1 unit in tmc in milk was caused a 79% decrease in the total milk yield although this value was not statistically significant. 3.2. the findings of the relationship between milk efficiency and milk components the milk yield rates, the averages of some milk components and their standard deviations, belonging to the cattle in enterprises 1, 2 and 3, were given in table 9. the lowest milk yield was observed in enterprise 1, while the highest milk yield was observed in enterprise 3. in parallel, the highest amount of fat and non-fat dry matter was observed in the milks of enterprise 3. no statistically significant difference was found between the enterprises in terms of milk protein. table-5. milk yield and milk compositions in enterprise 1, 2 and 3 enterprise 1 enterprise 2 enterprise 3 parameters n x sx n x sx n x sx milk yield (kg/day) 103 16.00 ±4.00 79 18.70 ±2.95 97 22.64 ±8.17 fat (%) 72 2.88 ±3.26 79 3.56 ±3.43 85 4.34 ±4.22 non-fat dry matter (%) 86 7.91 ±1.07 84 7.83 ±1.02 87 8.12 ±0.96 dansity (g/ml) 88 1026.39 ±8.69 80 1025.84 ±6.20 99 1025.97 ±6.57 protein (%) 92 3.04 ±0.41 92 2.96 ±0.35 100 3.07 ±0.43 when table 6, which shows the results of the correlation analysis performed between the milk yield rates and milk components of enterprise 1, was examined, it was seen that there was no statistically significant relationship between milk yield and milk components. table-6. correlation analysis between milk yield and milk components belonging to enterprise 1 enterprise 1 milk yield fat non-fat dry matter dansity protein milk yield kg/cow/day correlation coefficient significancy total (n) 1.000 103 .085 .477 72 .32 .774 85 .142 .190 87 .022 .839 91 fat (%) correlation coefficient significancy total (n) 1.000 72 .101 .399 72 .134 .261 72 .135 .257 72 non-fat dry matter (%) correlation coefficient significancy total (n) 1.000 86 .262(a) .015 86 .326(b) .002 86 dansity (g/ml) correlation coefficient significancy total (n) 1.000 88 .419(b) .000 88 protein (%) correlation coefficient significancy total (n) 1.000 92 (a)p<0.05 (b)p< 0.01 animal review, 2015, 2(2): 58-67 63 © 2015 conscientia beam. all rights reserved. table-7. correlation analysis between milk yield and milk components belonging to enterprise 2 enterprise 1 milk yield fat non-fat dry matter dansity protein milk yield kg/cow/day correlation coefficient significancy total (n) 1.000 79 .160 .163 78 .237(a) .035 79 .031 .784 79 .250 .026 79 fat (%) correlation coefficient significancy total (n) 1.000 79 .033 .773 79 .161 .158 79 .045 .692 79 non-fat dry matter (%) correlation coefficient significancy total (n) 1.000 84 .302(b) .006 80 .861(b) .000 83 dansity (g/ml) correlation coefficient significancy total (n) 1.000 80 .326(b) .003 80 protein (%) correlation coefficient significancy total (n) 1.000 83 (a)p<0.05 (b)p<0.01 when table 7, which shows the results of the correlation analysis performed between the milk yield rates and milk components of enterprise 2, was examined, it was seen that there was a positive and statistically significant relationship between milk yield and the amount of dry matter and protein in milk (p<0.05). table-8. correlation analyze between milk yield and milk components belonging to enterprise 3 enterprise 1 milk yield fat non-fat dry matter dansity protein milk yield kg/cow/day correlation coefficient significancy total (n) 1.000 97 .142 .196 85 .136 .209 87 .327(b) .001 97 .146 .154 97 fat (%) correlation coefficient significancy total (n) 1.000 85 .023 .836 85 .130 .237 85 .012 .912 85 non-fat dry matter (%) correlation coefficient significancy total (n) 1.000 87 .197 .067 87 .283(b) .008 87 dansity (g/ml) correlation coefficient significancy total (n) 1.000 99 .173 .087 99 protein (%) correlation coefficient significancy total (n) 1.000 100 (a)p<0.05 (b)p<0.01 when table 8, which shows the results of the correlation analysis performed between the milk yield rates and milk components of enterprise 3, was examined, it was seen that there was a negative and statistically significant relationship between milk yield and milk density (p<0.01). animal review, 2015, 2(2): 58-67 64 © 2015 conscientia beam. all rights reserved. 4. discussion regarding to the data obtained from 3 different enterprises and statistical analyzes during this research, it was not able to found a statistically significant relationship between milk yield and scc. there are some studies in literature, in which the milk yield losses in cows with subclinical mastitis are determined based on the relationship between milk yield and scc [1417]. the milk yield losses were reported between 5.6 and 11.9 kg at 3 million cell/ml scc level, which is accepted as an advanced subclinical mastitis. in another study [18], it was stated that the decrease in milk yield up to scc rate of 500.000 cell/ml was not statistically significant. in this present study, as a result of the analyses performed for each enterprises, tmc and e.coli counts were found to have a negative effect on milk yield; however, only the value of e.coli was statistically significant (p<0.05). accordingly, 1 unit logarithmic increase of e.coli counts in milk was caused a 0.34% decrease in the total milk yield. it was statistically exposed that there would be a decrease in milk yield in subclinical mastitis cases which may be related to e.coli. among the analysed 252 milk samples, e.coli was found to be higher than 10 cfu/ml. e.coli is one of the major pathogens causing subclinical mastitis and it causes scc to increase. in a study [19] , it was reported that e.coli was isolated in 4.8% of the infected udder lobes in milk samples, while in another study [17] reported that they isolated e.coli in 54% of the infected milk samples and scc reached the value of 800.000 1.000.000 cell/ml in the milks where e.coli grew. the number of somatic cells in milk depends on many factors such as infection status of milk, the number of infected udder lobes, age of cattle, the number of lactation, seasonal conditions, techniques used and management conditions [20]. when the results of the analysis performed on the data of enterprise 1 are analyzed, scc was found to have a negative effect on milk yield but this effect was not statistically significant. no statistically significant effect of scc on milk yield was found in enterprises 2 and 3. according to the data analyses, it was agreed that the number of animals used in the present study was not sufficient to work with statistical data; therefore, it would be appropriate to use a higher number of experimental animals in the future studies. the average values of milk yield, milk fat, non-fat dry matter, density and protein of the milk samples taken from three different enterprises are given in table 9. the parameters of milk components analyzed in the present research were within the change interval developing with various effects. these limits were reported to be 2.5-6% for milk fat, 8-9% for non-fat dry matter and 2.9-5% for protein21. when the milk fat values given in the table were analyzed, the rate of milk fat was found to be within the change interval in enterprise 1, while this rate was found to be lower compared to enterprises 2 and 3. it is known that the rate of fat in milk varies depending on the race of cattle, the content and the amount of the consumed feed and also seasonal changes are observed [21, 22]. it is suggested that mastitis affects the content of milk and changes the rate of fat in milk [23]. a lower rate of fat in milk in enterprise 1 shows that the number of cows with mastitis is higher in this enterprise. when the amount of non-fat dry matter in the milk samples taken from the plants was analysed, it was seen that this amount was below the change limits in enterprises 1 and 2, while it animal review, 2015, 2(2): 58-67 65 © 2015 conscientia beam. all rights reserved. was within usual limits in enterprise 3. it is also known that the amount of non-fat dry matter varies depending on seasons and feed and it is related to milk amount and decreases due to mastitis [24]. the average milk densities in the three plants from which the milk samples were taken were found to be lower than the density values reported in literature [21]. it is reported that milk density changes depending on all the matters comprising milk [25]. when the milk samples taken from the plants were evaluated in terms of protein values, no statistically significant difference was found among the enterprises. it is known that changes in the rate of milk protein are not as common as the changes in milk fat [22] and milk protein was observed to be at lower limits in each enterprise. as the mastitis bacteria cause damages on udder gland cells and therefore cause a decrease in protein, fat and milk sugar synthesis, they negatively affect milk yield and quality [26]. although no statistically significant differences were observed among the amounts of fat, non-fat dry matter, density and protein in the milk samples analyzed in the present research, the parameters were found to be at the lower limits of the usual values. a correlation analysis was performed in order to determine the relationship between milk efficiency and fat, non-fat dry matter, density and protein in milk in each enterprise. a positive and statistically significant relationship was found between milk yield and the amount of dry matter and protein in milk (p<0.05) in enterprise 2, while there was a statistically significant relationship between milk yield and density (p<0.01) in enterprise 3. 5. conclusions the findings of the present study show that the subclinical mastitis cases, which may occur in dairy plants, may cause not only losses in milk yield but also decreases the chemical quality of milk. this strengthens the idea that the financial losses encountered especially in bacterial mastitis are related to the reduced technological quality of milk as well as reduced milk yield. given that a high rate of microbiological load to be observed in milk pose a risk for public health as well, early diagnosis of mastitis in dairy plants and steps to prevent mastitis are of great importance. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: this study was supported by research fund of istanbul university. project number: 1199. the authors also would like to thank kaan göksal and i̇lker çoban for their assistance. references [1] l. zhao, b. zheng, n. zheng, s. li, h. hu, y. zhang, and j. wang, "survey of somatic cell count, total bacterial count and milk protein in raw milk in tangshan city, china," j. food agr. environ., vol. 12, pp. 224-228, 2014. [2] s. göncü and k. özkütük, "intensive dairy farms in adana pure bred and cross-bred holstein cow milk somatic cell count and mastitis and factors affecting the relationship," j. anim. prod., vol. 43, pp. 44-53, 2002. animal review, 2015, 2(2): 58-67 66 © 2015 conscientia beam. all rights reserved. [3] c. uzmay, a. kaya, i̇. kaya, and y. akbaş, "studies on prevalence of mastitis and factors affecting prevalence in herds of izmir holstein breeders association. 2. relationships between managerial practices and subclinical mastitis," ege university, journal of agric. fakulty., vol. 38, pp. 71-78, 2001. [4] e. koldeweij, u. emanuelson, and l. janson, "relation of milk production loss to milk somatic cell count," acta vet. scand., vol. 40, pp. 47-56, 1999. [5] w. c. losinger, "economic impacts of reduced milk production associated, with an increase in bulk-tank somatic cell count on u.s. dairies," am. vet. med. assoc., vol. 226, pp. 1652-1658, 2005. [6] a. yalçın, y. cevger, n. türkyılmaz, and g. uysal, "estimated losses arising from the milk yield in dairy cows with subclinical mastitis," turk. j. vet. anim. sci., vol. 24, pp. 599-604, 2000. [7] a. yalçın, y. cevger, g. uysal, and k. türkyılmaz, "the effect of subclinical mastitis in cows milk yield and efficiency of the interaction of other factors affecting the estimation of quantitative methods," journal of veterinarian mikrobiology, vol. 1, pp. 47-52, 2001. [8] turkish food codex, notification of raw milk and heat-treated drinking milk. turkey: communiqué no: 2000/6. published in the official gazette: 14.02.2000-23964, 2000. [9] f. thaddeus, m. baryant, and r. g. baryant, sampling plans, sample collection, shipment, and preparation for analysis. in: downes fp, ito k (eds). compendium of methods for the microbiological examination of foods, 4th ed. washington dc: american public health association, 2001. [10] aoac official methods 991.14, "eschrerichia coli and coliform counts in foods. dry rehydratable film (petrifilm plate count of e. coli and coliform count plate) methods. 03", usa, 1998. [11] aoac official methods 989.10, "bacterial and coliform counts in dairy products. dry rehydratable film (petrifilm aerobic count plate and petrifilm coliform count plate) methods. 03,usa," 1998. [12] aoac official methods 975.55, "petrifilm tm 3m ™ staph express count plate method for the enumeration of staphylococcus aureus in selected dairy foods. 08, usa," 2003. [13] y. atakurt, "logistic regression analysis and an application for the use in the medical field," university of ankara journal of medical fakulty, vol. 52, pp. 191-199, 1999. [14] p. c. bartlett, g. y. miller, c. r. anderson, and j. h. kırk, "milk production and somatic cell count in michigan dairy herds," j. dairy sci., vol. 73, pp. 2794-2800, 1990. [15] g. m. jones, r. e. pearson, g. a. clabaugh, and c. e. heald, "relationships between somatic cell counts and milk production," j. dairy sci., vol. 67, pp. 1823-1831, 1984. [16] r. f. raubertas and g. e. shook, "relationship between lactation measures of somatic cell concentration and milk yield," j. dairy sci., vol. 65, pp. 419-425, 1982. [17] j. tyler, m. c. thurmond, and l. lassion, "relationship between somatic cell count test-day measures of dairy cows and milk production in california," can. j. vet. res., vol. 53, pp. 182-187, 1989. [18] g. e. ward and l. h. shultz, "relationship of somatic cells in quarter milk to type of bacteria and production," j. dairy sci., vol. 55, pp. 1428-1431, 1972. [19] j. m. sargeant, k. e. leslie, j. e. shirley, j. e. pulkrabek, and g. h. lim, "sensitivity and specificity of somatic cell count and california mastitis test for identifying intramammary infection in early lactation," j. dairy sci., vol. 84, pp. 2018-2024, 2001. animal review, 2015, 2(2): 58-67 67 © 2015 conscientia beam. all rights reserved. [20] i. r. dohoo and a. h. meek, "somatic cell counts in bovine milk," can. vet. j., vol. 23, pp. 119-125, 1982. [21] m. metin, dairy technology. the composition and processing of the milk. i̇zmir, turkey: ege university of engineering fakulty, issue no 33, 1998. [22] b. c. yalçın, "general animal science (textbook)," i̇stanbul, turkey: istanbul university veterinary fakulty. issue no: 1, 1981. [23] s. pyörälä, "indicators of inflammation in the diagnosis of mastitis," vet. res., vol. 34, pp. 565-578, 2003. [24] s. atasever and h. erdem, "the relationship between the electrical conductivity of the milk with mastitis in dairy cattle," ondokuz mayıs university, journal of agric. fakulty, vol. 23, pp. 131-136, 2008. [25] e. yaylak, a. alçiçek, y. koncal, and h. uysal, "milk samples collected during the winter months districts of i̇zmir physical properties of some of the changes in the determination of the nutrient," j. anim. prod., vol. 48, pp. 26-32, 2007. [26] a. baştan, m. fındık, m. kaymaz, and ö. duru, "cow's milk somatic cell count, serum proteins, lactose, and investigate the relationship between electrical conductivity," journal of ankara university vet. fakulty, vol. 44, pp. 1-5, 1997. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 9 † corresponding author © 2015 conscientia beam. all rights reserved. effect of whole inedible date and amino acid supplementation on growth performance of ross 308 broiler chicks alaeldein m. abudabos1* --mutassim m. abdelrahman2 --gamaleldin m. suliman3--ahmed a. al-sagan4 1,2,3department of animal production, college of food and agriculture sciences, king saud university, riyadh, saudi arabia 4king abdulaziz city for science and technology, riyadh, saudi arabia abstract this work aims to assess the potential of discarded date meal (ddm) as an alternative ingredient in broiler diets. the effect of substituting 5 or 10% of corn and soybean meal (sbm) with ddm on performance, carcass characteristics, serum constituents and nutrients retention of broilers from 12 to 35 d of age was evaluated. a total of 150 chicks were randomly distributed in a factorial arrangement (3x2) into six treatments. three levels of ddm (0, 5 and 10%) and 2 levels of aas (normal and high) were utilized. a significant interaction was detected for bwg (p<0.01) and fcr (p<0.001). birds which had received 0% and 5% ddm and high aas converted feed more efficiently when compared to those which had received low aas. when examining the main effects for fcr, both ddm and aas showed a significant effects on fcr (p<0.01 and 0.05, respectively). birds received 5% ddm converted feed more efficiently as compared to 0 and 10%. also, birds received the high aas level converted feed more efficiently as compared to the normal level. on the other hand, breast muscle yield and abdominal fat were affected by ddm and aas (p<0.01 and 0.05, respectively). birds on the 0% ddm had higher breast muscle yield as compared to 5 or 10% ddm. also, high aas increased breast yield by 1.5% as compared to normal aas. the results revealed that birds received 5% ddm performed better than the control or 10%. also, supplementing diets with higher aas level improved the performance. based on presented evidences, it is recommended to substitute 5% of corn and sbm withddm. keywords: amino acids (aa’s), broilers, discarded date meal (ddm), growth performance, nutrients retention, serum metabolite. received: 3 december 2014/ revised: 13 january 2015/ accepted: 19 january 2015/ published: 23 january 2015 animal review 2015 vol. 2, no. 1, pp. 9-18 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.1/101.1.9.18 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.1/101.1.9.18 animal review, 2015, 2(1): 9-18 10 © 2015 conscientia beam. all rights reserved. contribution/ originality this study contributes in the existing literature regarding the utilization of dates as a potential ingredient that could partially replace corn in broiler diets. this study documents that ddm could be incorporated in poultry diets as a cheap untraditional ingredient to reduce feeding cost. this study is one of very few studies which have investigated the effect of amino acids supplementation to ddm as a method to improve the nutritive value. 1. introduction broiler feed is based primarily on corn as a source of energy and soybean meal as a source of protein. in most areas of the world corn is the predominant source of energy in feed because of its abundance and digestibility, roughly 60-75% of the total makeup of broiler diets is corn. historically high corn prices, prompting nutritionists to search for other suitable raw materials to provide required nutrients for poultry to maintain productivity and to lower feed cost [1]. dates (phoenix dactylifera) are considered a main crop in saudi arabia. in the year 2012, the total production quantity was 1,050,000 tons which represented 15.1% of total world production. however, more than 20% of dates are considered inedible for humans [2]. dates which are not used for humans can be grinded and mixed with other livestock and poultry feed [3]. discarded date meal (ddm) is considered to be a potential ingredient that could partially replace corn in broiler diets. al-harthi [4] stated that ddm could be incorporated in poultry diets as a cheap untraditional ingredient to reduce feeding costs. in comparison with corn, ddm has low crude protein (5 to 7%) and essential amino acids (aas) lysine (lys), methionine (met) and threonine (thr).it has a fair me level because it contains 7 to 10% fat and 55 to 65% crude carbohydrate however; it contains high crude fibre content (10 to 20%) [5]. several studies were conducted on the effect of inclusion rate of ddm on broiler performance. kamel, et al. [6] concluded that whole zahdi dates at the expense of corn at 5, 10 and 30% supported growth performance of broilers as efficiently as the control diets. el-deek, et al. [7] concluded that whole inedible dates which consisted of date fruits (85%) and date pits (15.0%) could be used up to 15% in broiler diets from 15 and 42 days of age without any adverse effects on performance, digestibility of nutrients and meat quality measurements. in practical feeds the total sulfur aas (met+cys), lys and thr are usually considered as the most limiting amino acids in for growing chickens fed corn-sbm diets [8]. methionine, lys and thr may interact with one another to improve broiler performance [9]. overall dietary lys: met and lys: thr interactions were apparent to optimize meat accretion. according to kidd, et al. [10] if broilers feed is fortified with lys above the nrc [11] recommendations [11], thr requirements will increase. increasing dietary lys without an increase in met and thr may limit protein synthesis and reduce meat accretion [12, 13]. it was reported that diets fortified with lys and met (106 and 112% of the nrc [11], respectively) interacted to optimize carcass and breast meat yields of male broiler compared to control diet [14]. other research found no interactions between lys and met in broiler diets when both were fed equal or above the nrc [11] suggested animal review, 2015, 2(1): 9-18 11 © 2015 conscientia beam. all rights reserved. recommendations [15]. this trial was intended to evaluate the effect of substituting corn and sbm with discarded date meal (ddm) supplemented with two levels (normal and high) of aas (lys, met and thr). 2. materials and methods the study was conducted at king saud university, riyadh, saudi arabia. dates were obtained from the local market and the whole date was ground (the pits and the flesh). chicks were randomly distributed in a factorial arrangement into six treatments [3 levels of ddm (0, 5 and 10%) and 2 levels of aas (100% of aas as used in commercial practices (normal) and 115% (high))]: t1 = control corn-sbm diet (0% ddm+100% aas (lys, met. and thr). t2 = 0%ddm + 115% aas (lys, met and thr). t3 = 5% ddm+100% aas (lys, met and thr). t4 = 5% ddm + 115% (lys, me and thr). t5= 10% ddm +100% aas (lys, met and thr). t6 = 10% dds + 115% (lys, met and thr). before mixing the experimental diets, samples of raw materials were analyzed for chemical composition (table 1). the chicks were given common starter diet for two weeks (table 2) and were given the experimental diets from 15 to 42 days of age (table 3). a total of 150 chicks were obtained from a commercial hatchery and were grouped by weight, then chicks were allotted into 30 experimental cages with five chicks per cage in a four-deck cage system and received the experimental diets in electrically heated battery brooders with raised wire floors. this experiment was conducted at the environmentally controlled battery room at the animal production department, college of food and agriculture sciences, king saud university. the initial environmental temperature was kept at 35°c in the first week and then decreased to 22°c until the end of the experiment. at the hatchery, the chicks were vaccinated against infectious bronchitis, marek's disease and newcastle disease. 2.1. measurements the pen average for feed consumption (fi) and body weight gain (bwg) were recorded weekly and fcr was computed. mortality was checked daily and weights of dead birds were used to adjust fcr. a digestion trial was performed on a separate group of chicks. thirty six birds (3 replications per diet) were housed (2 birds / cage) in 18 cages with wire bottoms. at 35 day of age, all finisher diets were supplemented with 3g kg-1 chromic oxide as an analytical marker for the digestibility trial and were offered to the birds for 5 days as an adaptation period. after the adaptation period, approximately 200 grams of clean excreta were collected to for analysis. excreta and feed samples were dried and dry matter was determined by oven-drying at 60°c for 72 h, and then was ground to pass through a 1.0 mm screen. the following analyses were performed in duplicates, animal review, 2015, 2(1): 9-18 12 © 2015 conscientia beam. all rights reserved. crude protein (n x 6.25), ether extract, ndf and ame according to the procedures established by the a.o.a.c. [16]. chromic oxide was analyzed according to williams, et al. [17]. ame values were determined using the following equation: ame (kcal/kg of diet) = ge diet [ge excretes or digesta x (marker diet/marker excretes or digesta] and the following equation was used for calculation of percent retention: % nutrient retention = 100 ((diet cr2o3/fecal cr2o3 x fecal nutrient/diet nutrient) x 100 [18]. at 35 days of age a total of 36 birds (six/ treatment) were weighed then slaughtered to evaluate carcass characteristics and meat quality attributes. weights of wings, back, legs, drumsticks and breast were recorded. the birds were processed using manual evisceration; dressing and parts yield were calculated. at 42 days of age, six birds per treatment were selected and kept without feed for 12 h then were bled from a cutaneous ulnar vein. blood samples were centrifuged for 15 min at 2, 500 × g, and serum was harvested and stored at -80°c unless fresh sample is required for the analysis. the following analysis were conducted by using enzymatic colorimetric kits: total protein (biuret method), albumin (bromoreesol green method), globulin concentration was calculated, thereafter, as the difference between tp and albumin concentrations, total lipid (sulfo-phosphate vanillin method), cholesterol (trinders color method), glucose (modified trinder / god method), uric acid (end point method), sodium (sodium dependent β-galactosidase activity), potassium (turbidimetric method), and chloride (thiocyanate method); all analyses were carried out in duplicate. 2.2. statistical analysis data were evaluated by anova for a complete randomized block design with 3x2 factorial arrangements of treatments, using the general linear models procedure of sas software [19]. the data were tested for main effects of ddm, aas and for interaction effects of ddm x aas. 3. results and discussion performance results of ross 308 broilers are shown in table 4. no significant difference in feed intake was observed due to treatment (p>0.05). however, just numeric increase in feed intake was observed as the inclusion rate of ddm increased in the diet. a significant interaction was detected for bwg (p<0.01), this could be explained by the fact that bird on the high level of aas gained more weigh at 0% ddm as compared to normal aas (1855.9 vs. 1603.3 g, respectively). while those on the 5 and 10% ddm gained less weight at high aas as compared to low aas (1803.6 vs. 1850.7 g for birds received 5%; 1745.7 vs. 1817.7 g for birds received 10%, respectively). as a result, a significant interaction was detected for fcr (p<0.001). birds which had received 0% and 5% ddm and high aas converted feed more efficiently when compared to those which had received low aas (1.713 vs. 1.842 g: g for birds received 0% ddm; 1.713 vs. 1.727 g: g for birds received 5% ddm, respectively). in the contrary, birds which had received normal aas and 10% ddm converted feed more efficiently when compared to those which had received high aas (1.769 vs. 1.807 g: g, respectively). when examine the main effects for fcr, animal review, 2015, 2(1): 9-18 13 © 2015 conscientia beam. all rights reserved. both ddm and aas showed a significant effects on fcr (p<0.01 and 0.05, respectively). birds received 5% ddm converted feed more efficiently as compared to 0 and 10% (1.720, 1.777 and 1.788 g: g, respectively). also, birds received the high aas level converted feed more efficiently as compared to the normal level (1.744 vs. 1.779 g: g, respectively). in general, dates have abundant nutrients (approximately 7 to 5% crude protein; 10 to 7% fat; 20 to 10% fiber; 65 to 55% crude carbohydrate). dates which are not used for humans can be grinded and mixed with other livestock and poultry feed [3]. it was concluded that whole zahdi dates at the expense of corn at 5, 10 and 30% supported growth performance of broilers as efficiently as the control diets, but the incorporation of 47.7% of whole zahdi dates as a total replacement of corn resulted in some growth depression and a slight decrease in feed utilization [7]. it was reported that whole inedible dates which consisted of date fruits (85%) and date pits (15.0%) could be used up to 15% in broiler diets from 15 and 42 days of age without any adverse effects on performance, digestibility of nutrients and meat quality measurements [7]. however, based on the fcr in this trial, it’s recommended to add 5% ddm with the high aas level or 10% with normal aas. the ddm is a cheaper energy source for poultry when compared to corn and replacing part of the corn with ddm will reduce the diet cost. however, dates should be dry and very hard when ground. a problem in the grinding processes that dates smears and clogs the sieves of the hammer mill. to solve the problem of caking in the machinery, it is recommended to make a premix with another ingredient such as corn for example and then grind the mix. the mean percentage of carcass parts is documented in table 5. the results revealed no significant differences in dressing percentage and leg quarter (p<0.05). however, breast yield and abdominal fat were affected by ddm and aas (p<0.01 and 0.05, respectively). birds on the 0% ddm had higher breast muscle yield (33.8%) as compared to 5 or 10% ddm (31.1 and 31.2%, respectively). also, high aas increased breast yield by 1.5% as compared to normal aas. hickling, et al. [14] described that diets fortified with 106% lys and met 112% of the nrc [11] interrelated to enhance breast meat yields of male broilers. café and waldroup [20] reported that breast yield of broilers (35 d) fed diets supplemented with 115 or 130% met of nrc [11] and 120% lys of nrc [11] levels were greater than that of birds fed 100% (control). abdominal fat increased in birds which had received 10% ddm as compared to those which had received 0 and 5% (3.3 vs. 2.4 and 2.5, respectively). high aas decreased abdominal fat by 0.5% as compared to normal aas (2.5 vs. 3.0%). data related to serum biochemistry are shown in table 6. no interaction was detected between ddm and aas for blood biochemistry. however, serum glucose, na+ and clwere significantly affected by ddm level (p<0.001, p<0.01, p<0.01, respectively). serum glucose level increased as the inclusion rate of ddm increased in the diet (200.8, 202.7 and 203.8 mg/dl for 0, 5 and 10%, respectively). conversely, na+ and cllevel decreased as the inclusion rate of ddm increased. serum albumin decreased at high aas level as compared to normal (2.54 vs. 2.78 g/dl, respectively) while, globulin increased as a response to high aas level (0.77 for high vs. 0.68 g/dl for normal). serum cholesterol decreased at high aas level (90.6 mg/dl) as compared to normal animal review, 2015, 2(1): 9-18 14 © 2015 conscientia beam. all rights reserved. aas (112.7 mg/dl) (p<0.01). attia, et al. [21] reported that feeding low-cp diet fortified with met and lys resulted in higher plasma cholesterol, the result obtained in this trial disagree with that, since we found lower serum cholesterol in birds fed fortified diets. neither ddm nor aas had a significant effect on protein, total lipids, uric acid or k+ (p>0.05). table 7 shows nutrients retention for broilers which received the experimental diets. neither ddm nor aas had a significant effect on crude protein or ether extract retentions (p>0.05). a lower ndf retention was observed as the inclusion level of ddm increased in the diet (p<0.01). conversely, a higher amen retention was observed as the ddm inclusion rate increased (p<0.05). 4. conclusion in summary, based on the fcr in this trial, it’s recommended to add 5% ddm with the high aas level or 10% with normal aas. the ddm is a cheaper energy source for poultry when compared to corn and replacing part of the corn and sbm with ddm will reduce the diet cost. funding: the authors would like to extend their sincere appreciation to king abdul-aziz city for science and technology (kacst) for its funding of this research through the research project number lgp-32-15. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] a. m. abudabos, a. b. okab, r. s. aljumaah, e. m. samara, k. a. abdoun, and a. a. al-haidary, "nutritional value of green seaweed (ulva lactuca) for broiler chickens," ita. j. anim. sci., vol. 12, pp. 177-181, 2013. [2] a. h. al-homidan, "date waste, whole dates and date pits as ingredients in broiler diets," egypt. poult. sci. j., vol. 23, pp. 15-35, 2003. [3] w. h. barreld, "date palm products," fao agricultural services. bulletin no. 101, 1993. [4] m. a. al-harthi, "the influence of date waste meal supplemented with enzymes, probiotics or their combination on broiler performance," egypt. poult. sci. j., vol. 26, pp. 1031-1055, 2006. [5] a. a. el–deek, m. al–harthi, and h. m. yakout, "use of enzymes to supplement diets containing date waste meal for lohmann white layers," int. j. poult. sci., vol. 7, pp. 397-407, 2008. [6] b. s. kamel, m. f. diab, m. a. ilian, and a. j. salman, "nutritional value of whole dates and date pits in broiler rations," poult. sci., vol. 60, pp. 1005-1011, 1981. [7] a. a. el-deek, y. a. attia, and m. a. al-harthi, "whole inedible date in the grower-finisher broiler diets and the impact on productive performance, nutrient digestibility and meat quality," animal, vol. 4, pp. 1647-52, 2010. [8] m. t. kidd, "nutritional consideration concerning threonine in broilers," world’s poult. sci. j., vol. 56, pp. 139-151, 2000. [9] i. w. a. dozier, m. t. kidd, and a. corzo, "dietary amino acid responses of broiler chickens," j. applied poult. res., vol. 17, pp. 157-167, 2008. animal review, 2015, 2(1): 9-18 15 © 2015 conscientia beam. all rights reserved. [10] m. t. kidd, b. j. kerr, and n. b. anthony, "dietary interactions between lysine and threonine in broilers," poult. sci., vol. 76, pp. 608-614, 1997. [11] nrc, national research council. nutrient requirements of poultry, 9th ed. washington, dc, usa: national acad. press, 1994. [12] b. j. kerr, m. t. kidd, g. w. mcward, and c. l. quarles, "interactive effects of lysine and threonine on live performance and breast yield in male broilers," j. applied poult. res., vol. 8, pp. 391-399, 1999. [13] c. p. ojano-dirain and p. w. waldroup, "evaluation of lysine, methionine and threonine needs of broilers three to six weeks of age under moderate heat stress," int. j. poult. sci., vol. 1, pp. 16-21, 2002. [14] d. hickling, w. guenter, and m. e. jackson, "the effects of dietary methionine and lysine on broiler chicken performance and breast meat yield," canadian j. anim. sci., vol. 70, pp. 673-678, 1990. [15] j. si, j. h. kersey, c. a. fritts, and p. w. waldroup, "an evaluation of the interaction of lysine and methionine in diets for growing broilers," int. j. poult. sci., vol. 3, pp. 51-60, 2004. [16] a.o.a.c., official methods of analysis, 16th ed. washington, dc, usa: association of official analytical chemists, 1996. [17] c. h. williams, d. j. david, and o. iismaa, "the determination of chromic oxide in faeces samples by atomic absorption spectrometry," j. agric. sci., vol. 59, pp. 381-385, 1962. [18] m. l. scott, m. c. nesheim, and r. j. young, determination of metabolizable energy. in: m.l. scott and associates (eds). nutrition of the chicken, 3rd ed. ithaca, ny, 1982. [19] sas institute inc., sas users guide: statistics. version 9.1.3. cary, nc, usa: sas institute, 2003. [20] m. b. café and p. w. waldroup, "interaction between levels of methionine and lysine in broiler diets changed at typical industry intervals," int. j. poult. sci., vol. 5, pp. 1008-1015, 2006. [21] y. a. attia, s. a. abd el-rahman, and e. m. a. qota, "effects of microbial phytase with or without cell-wall splitting enzymes on the performance of broilers fed suboptimum levels of dietary protein and metabolisable energy," egypt. poultry sci. j., vol. 21, pp. 521-547, 2001. table-1. chemical composition of the raw materials used to mix the diets table-2. dietary ingredients (%) of the starter diets ingredients % corn 62.45 sbm 31.0 palm oil 2.19 d.c.p 2.50 continue id %, as is basis gross energy kcal/kg dm% ash% cp % ee % cf % nfe % corn 93.31 1.69 9.98 4.52 1.53 82.28 4463 sbm 95.10 7.08 48.30 1.63 2.64 40.36 4703 ddm 91.47 8.44 4.24 0.66 4.96 81.70 3853 animal review, 2015, 2(1): 9-18 16 © 2015 conscientia beam. all rights reserved. limestone 0.73 salt 0.25 mv mix1 0.20 dl-methionine 0.26 lysine-hcl 0.18 threonine 0.07 na-bicarbonate 0.12 choline cl 0.05 total 100 chemical composition: me, kcal/kg 3000 crude protein, % 21.5 methionine, % 0.55 lysine, % 1.2 meth&cys, % 0.9 threonine, % 0.9 calcium, % 1.0 phosphorus, % 0.5 1vitamin-mineral premix contains in the following per kg: vitamin a, 2400000 iu; vitamin d, 1000000 iu; vitamin e, 16000 iu; vitamin k, 800 mg; vitamin b1, 600 mg; vitamin b2, 1600 mg; vitamin b6, 1000 mg; vitamin b12, 6 mg; niacin, 8000 mg; folic acid, 400 mg; pantothenic acid, 3000 mg; biotin 40 mg; antioxidant, 3000 mg; cobalt, 80 mg; copper, 2000 mg; iodine, 400; iron, 1200 mg; manganese, 18000 mg; selenium, 60 mg, and zinc, 14000 mg. table-3. dietary ingredients (%) of the experimental diets 1same as in the starter diet (table 2). ingredients 1 2 3 4 5 6 corn 66.91 66.91 61.91 61.91 58.90 58.90 sbm 26.63 26.03 25.6 25.22 22.98 22.64 date 0.0 0.0 5.0 5.0 10.0 10.0 palm oil 2.8 3.0 3.8 3.8 4.4 4.4 dicalcium phosphate 2.0 2.0 2.0 2.0 2.0 2.0 limestone 0.59 0.59 0.59 0.59 0.59 0.59 salt 0.25 0.25 0.25 0.25 0.25 0.25 mv mix1 0.12 0.12 0.12 0.12 0.12 0.12 dl-methionine 0.20 0.28 0.20 0.28 0.20 0.28 lysine-hcl 0.24 0.42 0.24 0.42 0.24 0.42 threonine 0.11 0.24 0.14 0.24 0.16 0.24 na-bicarbonate 0.11 0.11 0.11 0.11 0.11 0.11 choline cl 0.04 0.04 0.04 0.04 0.04 0.04 total 100 100 100 100 100 100 chemical composition me poultry 3100 3100 3100 3100 3100 3100 crude protein, % 20.0 20.0 19.2 19.2 17.0 17.0 methionine, % 0.48 0.56 0.48 0.56 0.48 0.56 lysine, % 1.10 1.26 1.10 1.26 1.10 1.26 meth&cys, % 0.80 0.85 0.80 0.85 0.80 0.85 threonine, % 0.80 0.92 0.80 0.92 0.80 0.92 calcium, % 0.85 0.85 0.85 0.85 0.85 0.85 phosphorus, % 0.40 0.40 0.40 0.40 0.40 0.40 animal review, 2015, 2(1): 9-18 17 © 2015 conscientia beam. all rights reserved. table-4. performance of broiler chickens given the experimental diets °ddm: discarded date meal. ¥aas: amino acids. high: 15% extra lysine (lys.), methionine (met.) and threonine (thr.) added to the basal diet. abmeans in the columns with different superscripts differ significantly (* p < 0.05, **p < 0.01, ***p< 0.001, n.s: not significant) table-5. effect of different treatments on parts yield as percentages of broiler dressed weight °ddm: discarded date meal ¥aas: amino acids. high: 15% extra lysine (lys.), methionine (met.) and threonine (thr.) added to the basal diet. abmeans in the column with different superscripts differ significantly (* p < 0.05, **p < 0.01, n.s: not significant). treatment ddm° aas¥ performance feed (g) bwg (g) fcr (g: g) conti 1 0% normal 2953.1 1603.3 1.842 conti 2 0% high 3177.9 1855.9 1.713 3 5% normal 3194.6 1850.7 1.727 4 5% high 3088.4 1803.6 1.713 5 10% normal 3218.6 1817.7 1.769 6 10% high 3150.9 1745.7 1.807 sem± 90.9 50.8 0.018 ddm average 0% 3065.5 1729.6 1.777a 5% 3141.5 1827.2 1.720b 10% 3184.9 1781.7 1.788a sem± 64.2 35.9 0.013 aas average normal 3122.2 1757.2 1.779a high 3139.1 1801.7 1.744b sem± 52.5 29.3 0.010 statistical probabilities ddm ns ns ** aas ns ns * ddm*aas ns ** *** treatment ddm° aas¥ % dressing leg breast fat 1 0% normal 75.9 40.2 32.5 2.8 2 0% high 76.1 39.7 35.0 1.9 3 5% normal 76.1 40.9 30.6 2.7 4 5% high 75.9 40.1 31.5 2.4 5 10% normal 76.2 40.3 30.6 3.5 6 10% high 76.0 39.9 31.7 3.1 sem± 0.6 0.7 0.8 0.3 ddm average 0% 76.0 39.9 33.8a 2.4b 5% 76.0 40.5 31.1b 2.5b 10% 76.1 40.1 31.2b 3.3a sem± 0.4 0.4 0.60 0.2 aas average normal 76.0 39.9 32.8a 2.5b high 76.1 40.5 31.3b 3.0a sem± 0.3 0.4 0.5 0.1 statistical probabilities ddm ns ns ** ** aas ns ns * * ddm*aas ns ns ns ns animal review, 2015, 2(1): 9-18 18 © 2015 conscientia beam. all rights reserved. table-6. effect of dietary treatments on some serum constituents in broilers °ddm: discarded date meal ¥aas: amino acids. high: 15% extra lysine (lys.), methionine (met.) and threonine (thr.) added to the basal diet. * p < 0.05, **p < 0.01, ***p < 0.001, n.s: not significant. table-7. apparent nutrient retention of broiler chickens. treatment ddm° aas¥ cp ee ndf amen (%) (kcal/kg) 1 0% normal 59.8 70.2 29.3 2934 2 0% high 60.7 70.3 28.9 2911 3 5% normal 59.8 70.2 28.0 3037 4 5% high 60.0 70.2 27.3 3068 5 10% normal 58.9 71.1 26.5 3085 6 10% high 59.8 71.3 26.6 3072 sem± 0.4 0.5 0.5 55 ddm average 0% 60.3 70.3 29.1 2923 5% 59.9 70.2 27.6 3053 10% 59.4 71.2 26.6 3079 sem± 0.3 0.4 0.4 39 aas average normal 59.2 70.5 27.9 3017 high 60.2 70.6 27.6 3018 sem± 0.2 0.3 0.3 32 statistical probabilities ddm ns ns ** * aas ns ns ns ns ddm*aas ns ns ns ns °ddm: discarded date meal ¥aas: amino acids. high: 15% extra lysine (lys.), methionine (met.) and threonine (thr.) added to the basal diet. abcmeans in the column with different superscripts differ significantly (* p < 0.05, **p < 0.01, n.s: not significant). views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 26 † corresponding author © 2014 conscientia beam. all rights reserved. suitability of temperate and tropical crossbred dairy cattle under peri-urban production system in bangladesh nu siddiquee1† --m.a.wadud2 --msa bhuiyan3 --akma rahman4 -- m.r.amin5 --akfh bhuiyan6 1, 3 6 department of animal breeding and genetics 2department of dairy science, bangladesh agricultural university 4department of medicine,, bangladesh agricultural university 5faculty of agro based industry, university malaysia kelantan, malaysia bangladesh agricultural university, mymensingh bangladesh abstract suitability of temperate and tropical crossbred dairy cattle under peri-urban production system was investigated.the study was conducted during a period from april, 2010 to march, 2013 in peri -urban dairy production system of mymensingh district. the available dairy crossbred genotypes were 50% holstein friesian(hf) , 62.5% hf (5/8hf), 75% hf (3/4hf).a total of 103 households, possessing 358 lactating cows were selected where two different management environments were applied: (i) intervention (e1) group and (ii) non-intervention (e2) group. there were a total of 158 cows registered from 58 households in e1 and a total of 200 non-registered cows from 145 households in e2. average daily milk yield was 8.11±0.24 kg, it is higher in 62.5% hf genotype (8.60±0.41 kg) compared to 50% hf(8.32±0.42 kg) and 75% hf (7.42±0.42 kg). however, the intervention group (e1) was more efficient with an average of 9.85 ±0.39 than non intervention group (e2) with6.38±0.28 kg. the highest milk yield in 180 days was found (1550±74 kg) at 62.5 % hf and lowest (1339±76) at 75% hf genotype. against, g×e interaction effects were not significant on total milk yield (tmy) and daily milk yield though effect of environment was highly significant (p<0.001). the shortest dry period was found in 50% (89±2.53 days) and highest in 75% hf cross cows (102±2.72 days). the shortest age at first heat was found in 50 % (28±0.28) and highest in 75% (36±0.29) months. the shortest age at fist calving was found in 50% hf (37±0.30) and highest was in 75% hf (45±0.32) month. the shortest calving interval was found in 50% hf (378±8.63) and highest was in 75% hf (438±10.53) days. the shortest postpartum heat period found in 62.5% (91±3.31) days and highest in 75% hf (109±3.72) days. the lowest number of services per conception found in 62.5% (1.42±0.07) and highest in75% (1.64±0.08) hf cross genotype. conception rate was found shortest in 50% (71±2.66) and highest in 75% 80±2.52holstein friesian cross cows. in case of reproductive performances (number of services per conception, conception rate, animal review 2014 vol. 1, no. 2, pp. 26-36 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(2): 26-36 27 © 2014 conscientia beam. all rights reserved. age at first heat, age at first calving, dry period, calving interval), genotype, environment and g x e interaction had highly significant effects (p<0.001). therefore, it can be concluded that for reproduction 50% hf crossbred cows and for production both 50% and 62.5% hf crossbred cows are suitable in small holder peri-urban dairying system. keywords: holstein friesian crossbred cows, peri-urban system, tropical region, reproduction traits, milk yield, genotype by environment interaction. contribution/ originality this study contributes in the existing literature to inventive estimates of genotype by environment interactions to recommend appropriate crossbred cattle genotype to help bangladeshi farmer for higher milk yield in the peri-urban area. this study uses new estimation of methodology to use herd book keeping, following breeding policy properly, feeding management, farmers training, proper recording system, etc . 1. introduction in order to increase milk production in the tropical region of the world, cattle crossbreeding programs have long been used as one of the main strategies and temperate breeds have been introduced in many developing countries. to meet an increasing demand for milk, the livestock sector in bangladesh is undergoing rapid changes and intensive production expands by preferring a certain range of high-output dairy genotypes. genetic improvement of indigenous populations in the tropics through pure breeding (selection) is an extremely slow process because of poor infrastructure and organization among local small-holder dairy farmers. the first choice of means for genetic improvement should be use of a superior tropical breed for upgrading. improvement of indigenous zebu populations through upgrading with bos taurus breeds have to be carefully considered taking into account the perspective of not only well performing f1cows but also the establishment of a sustainable system in later generations. but in order to maximize overall profitability, the herd must have appropriate combination of genetically high potential breeds along with better feeding, management and healthcare practices [1]. the existing cattle breeding policy of the country is a two-tier system which kept provision of dairy development in the country using both i) high yielding variety (hyv) cattle which are crossbred e.g. ½ holstein friesian½ local, and ii) important indigenous dairy cattle types / breeds e.g. red chittagong, pabna, munshigonjetc. but high proportion crossbreds are not suitable for their maximum performance in our local environmental condition rather they need extra feed and other management of its origin, but our farmers are not able to provide these management. in addition, no attempt has yet been made in bangladesh know the degree of interaction between genotype and environment (g×e). as a result, different productive and reproductive problem arises in these crossbreds such as late puberty, lower conception rate, lower milk yield, late pregnancy, anestrous, increased calf mortality, various diseases etc. an estimation of g x e in various traits can there after help designing appropriate measure to avoid the said animal review, 2014, 1(2): 26-36 28 © 2014 conscientia beam. all rights reserved. problems because the said improvement can be limited due to genotype by environment interaction. in the village condition, farmers are not able to develop the dairy production. the major constrains are choice of species, breeds, availability of animals, smart feeding management, improved breeding, reproduction, animal health care, management of manure, organized marketing system, marketing outlet, capacity of investment. these constraints provide major opportunity to challenge research and develop to increase dairy production. nowadays, in periurban area peoples are very much interested of rearing the crossbred cows for more profitable business because of easy marketing and available resource management. in bangladesh, a periurban area refers to a transition or interaction zone, where urban and rural activities are juxtaposed, and landscape features are subject to rapid modifications, inducing by human activities. the present study was therefore carried out to reveal the suitability of temperate and tropical crossbred cattle in peri-urban dairy production system of the country. 2. materials and methods 2.1. place of study this work was carried out at the peri-urban farmers‟ herds of mymensingh district within seven kilometers around the artificial insemination centre, department of animal breeding and genetics, bangladesh agricultural university (bau). 2.2. source of experimental data the research data of the present study were collected from an on-going project titled “production of hyv vis-à-vis indigenous seed bulls to support smallholder dairying in bangladesh”, supported by department of animal breeding and genetics, bangladesh agricultural university (bau), mymensingh from april, 2010 to march, 2013 to evaluate productive and reproductive performances of available holstein friesian (hf) crossbred. an in-depth data collection format was prepared for collecting information on individual cows (mainly holstein – local crossbreds of different grade) in the project area. a total of 103 households, which 358 lactating cows were selected where two different environments): (i) intervention (e1) groupwhere year round inputs and services such as vaccination, de-worming (thrice in a year), ai using superior semen, fodder seeds and cuttings, necessary treatment, medicine, feces test, feeding and management advice, testing for tuberculosis (tb) and mastitis, management tools for mastitis control were provided on routine basis; and (ii) non-intervention (e2) group-where farmers provided their animals with conventional practices.. from the study area a total of 158 cows were selected from 58 households on the basis of intervention group and 200 cows were taken in non-intervention group. data on a total of 158 lactating cows were collected from holstein friesian x local crossbred cows. all cows were registered and every cow had an id number. non intervention group was unregistered and cows had no id number and management system was traditional. animal review, 2014, 1(2): 26-36 29 © 2014 conscientia beam. all rights reserved. 2.2.1. data structure the number of records in various traits according to parity, environment and genotype are presented in table 1trait environment genotype (%hf) intervention (e1) nonintervention (e2) 50 62.5 75 afh (m) 197 150 117 131 99 afc (m) 197 150 117 131 99 dp (day) 149 196 118 131 99 ci (day) 150 198 118 131 99 nsc (no.) 150 200 118 131 99 cr (%) 150 98 84 76 88 180dmy (kg) 75 140 74 78 67 dmy(kg) 75 140 74 78 67 afh= age at first heat (month), afc=age at first calving (month), dp=dry period (day), ci= calving interval (day), nsc= number of service per conception, cr= conception rate (%), dmy=daily milk yield (kg) 2.3. herd book opened a small book, where detailed information (e .g. id no. date of birth, sire, dam, date of maturity, production performance, reproduction efficiency, disease incidence, vaccination schedule etc.) of an animal is being recorded in written form. herd books were opened for every registered cows / heifers in the working area. 2.4 farmer’s training training on scientific cattle husbandry, record keeping and dairy production system was offered to the elite cattle owners. copies of “cattle rearing manual” was prepared and distributed among the farmers as ready reference. capacity building of a total of 210 farmers in a total of 4 training sessions were conducted to date.repeated trainings on the importance, contents and methods of maintaining herd book were arranged for both the animal recorder and the farmers. 2.5. feeding and management practices feeding and management practices followed at the farmers' herd were almost uniform throughout the year. most of the crossbred animals concentrate fed were supplied twice / thrice daily in the morning and evening and composed of rice polish, wheat bran, bran of legumes and oil cakes. among concentrates, wheat bran (29.6% for cow), oil cake (25.23% for cow), rice polish (18.38% for cow) are highly preferred. rice straw was used as bulk basal feed with some green grasses and concentrates. very few (around 5%) farmers' fed fresh fodder to their crossbred cows and road side grasses. it is also important to mention here that green grass supply was not on ad libitum basis because of the unavailability and seasonal fluctuations in the availability of green grass during different seasons of the year. animal review, 2014, 1(2): 26-36 30 © 2014 conscientia beam. all rights reserved. 2.6. milk production recording test day (morning and evening) milk yield data were recorded on fortnightly basis. moreover, all lactation parameters of elite cows were being recorded properly. alongside, all other information demanded by the herd book such as pedigree, date of birth, weight at birth, age and weight at weaning and maturity, disease incidence etc were being recorded through periodic visit to farmers‟ home by animal recorder who maintained data with the assistance of animal owner. 2.7. daily milk yield to get daily milk yield the whole lactation period was divided into start of lactation, peak of lactation and end of lactation with duration. then the average daily milk yield was calculated using the following equation. "total" milkyield = x1y1 +x2y2+x3y3 where, y1= milk yield at the start of lactation y2= milk yield at the peak of lactation y3= milk yield at the end of lactation x1, x2 and x3 denote the interval lengths of the different stages of lactation (start, peak and end) and they were summed up to lactation length. adjusted daily mean milk yield = the average daily milk yield (dmy) of a cow was measured by: total milk produced in a lactationlactation dmy = total number of days in the given lactation 2.8. estimation of genotype by environment interaction (g × e) the g ×e estimation of age at first calving, number of service per conception, age at first calving, parity, dry period, calving interval, lower conception, milk yield, increased calf mortality, various diseases etc. in dairy crossbred cattle (between local and holstein friesian) were measured taking two environments into consideration described above. in this study, factorial analysis of variance using a linear model, with an environmental factor, a genetic factor and interaction effect between the two factors, was fitted with genetic and interaction effects as random effects. 180dmy (kg) = sum of all test day yield × 180 number of test day records animal review, 2014, 1(2): 26-36 31 © 2014 conscientia beam. all rights reserved. 3. results and discussion 3.1. age at first heat (afh) table 1 shows the least squares means (±se) of reproductive traits of holstein-friesian crossbred cows. age at first heat of overall holstein-friesian crossbred of the present study was 30.96±0.18 months which is higher than the findings of majid, et al. [2] which was 26 months whereas, al-amin and nahar [3] found an afh of 25 months) and very similar to intervention group (25.39±0.23 months) of present study. in ½ hf (50%) and (5/8) hf crossbred (62.5% inheritance) afh were 28.03±0.28 and 28.69±0.25 moths which are almost same. but in ¾ hf (75%), it is higher (36.16±0.29 months). it was also evident that temperate crossbreds come into maturity at an earlier age than the breeds of tropical environment. in case of first heat, highly significant (p<0.001) of g x e interaction and genotype was observed. table-1. least squares means (±se) of reproductive traits of holstein-friesian crossbred cow 1parity-calving parity; environment-based on proper feeding, good management& health care (intervention) and conventional feeding and management (non-intervention); genotypebased on % of genetic material contents; gxeinteraction between genotype and environment; 2nscnumber of services per conception; crconception rate; afh-age at first heat; afc-age at first calving; *-significant at 0.05 level (p<0.05); **significant at 0.01 level (p<0.01); ***significant at 0.001 level (p<0.001); nsnon significant (p>0.05); figures in the parenthesis indicate the number of observation; means with uncommon superscripts in the same column differed significantly (p<0.05). 3.2. age at first calving (afc) tropical cattle are delayed to reach sexual maturity and though there may be some differences between breeds it is largely influenced by environment and especially poor nutrition, which can retard growth and development. in the majority of breeds age at first calving is generally about 36-48 months [4]. age at first calving for some breeds in indian cattle may be cited here on this context for comparisons by taneja and bhat [5]. they reported age at first calving for kankrej, sahiwal, tharparkar, red sindhi, gir, hariana, deoni, ongole and nondescript cattle as 47±0.8, 40±0.2, 49±0.4, 42±0.6, 47±0.8, 53±0.3, 53±1.0, 40±0.4 and 59±2.5 months, respectively. in the present study overall age at first calving was 40.00±0.17 months in hf crossbred cows, but in intervention group it was 35±0.26 months which were more or less similar to 37±3.21, 39±7.1, 36±3.48 months in holstein friesian crosscows according to, sarder [6] and islam, et al. [7], respectively in bangladesh. but in non intervention group it was 45±0.23 animal review, 2014, 1(2): 26-36 32 © 2014 conscientia beam. all rights reserved. months whereas results of rokonuzzaman, et al. [8], faruk, et al. [9], al-amin and nahar [3]which are respectively 34.00±3.78, 33.00±2.32, 34.3 months are very similar to intervention group in this study. in the present study average afc for 50%, 62.5%, and 75% hf crossbred cows were respectively 37.30± 0.30, 38.00± 0.28 and 44.99± 0.32 months which are higher than studies reported above. 3.3. dry period (dp) in present study, 50%, 62.5%and 75% hf cross cows had dry period of 88.99±2.53, 90.66±2.42 and 102.19±2.72 respectively. qureshi, et al. [10] in pakistan found a dry period of 89 days in 50 to 75% hf crossbred cows which are very close to the present findings of 50%, 62.5% and 75% hf crossbred cows. it was found that the effect of genotype, environment, g x e interaction were highly significant (p<0.001). early parity cows (table 1) showed shorter dry period (90 days) than the later (6+) parity cows (106 days). the highest dry period was found at parity six+ (106 days) and lowest dry period found at first parity (90 days) as shown in table 2. the dry period was slightly variable with the increase in parity but statistically non-significant (p>0.05) and could be considered as aging effect. it is generally believed that milk yield is affected by the preceding days of dry period. considering the biological limits and economics of the operation involved, many workers in tropical and sub-tropical regions have set a range of 40-60 days as an optimum dry period for the perspective of cow's health and farmer‟s profit. this also indicates that length of dry period is largely influenced by environment. pointed out that some managers of the farm are inclined to dry off their animals earlier to improve the herd average, while other managers go on milking the cows as long as it is affordable. emphasis should be given to select the animals on the basis of their production level and higher persistency of lactation, which should automatically lead to a decrease in dry period. 3.4. calving interval (ci) in the present study, overall calving interval of hf crossbred cows was 403.37± 6.27 days .. in the present study, 50%, 62.5%, and 75% hf crossbred cows had ci of 378.13± 8.63, 394.17± 8.73 and 437.80±10.53 days respectively. on the other hand, majid, et al. [2] reported calving intervals of 484±11.50, 514±21.63 and 515±28.28 days, respectively in 50% friesian (f1), 50% friesian (f2) and 75% friesian (f2) crossbred cows, qureshi, et al. [10] in pakistan found a slightly higher calving interval of 390 days in 50% hf crossbred cows than the present study. the effect of parity of cows on ci was non-significant (p>0.05) though 2nd parity cows had lowest ci with highest in parity 6+. this might be due to the practice of selective culling against slow breeders in later parities and the additional nutritional requirements of cows in early lactation life for growth. animal review, 2014, 1(2): 26-36 33 © 2014 conscientia beam. all rights reserved. 3.5. number of services per conception (nsc) the overall service per conception of hf crossbred cows found was 1.52±0.05 in the present study. al-amin and nahar [3] and hoque, et al. [11] found 1.50±0.1, 1.35±0.26 which is nearly similar to our study. analysis of variance shows that the number of services per conception is strongly related to the effect of the environment and its interaction with genotype (p <0.001) than the effect of genotype alone (p <0.05). the variations of services per conception from different workers for same as well as different breeds might be due to different genetic make-up, nutritional status of cattle, management, and failure in proper heat detection or efficiency of inseminator. 3.6. conception rate (cr) conception rate is an important factor affecting herd reproduction efficiency. the overall conception rate of present was 76±1.78. the conception rate depends on different genetic and non-genetic factors as cow herself, semen quality, time of insemination, proper heat detection, efficiency of inseminator, proper feeding management etc. highest conception rate was found in this study in third parity (80%)but no significant difference compared with other parities (p>0.05).while islam, et al. [7] reported significant effect (p<0.05) of conception rate on parity. it is evident by many workers that age has significant cause of variation for conception rate and is negatively associated with reproductive performance. but in this study age/parity did not show any significant variation on conception rate that could be due to habitual delayed age at puberty in tropical cross cattle that may lead to have retained reproductive efficiency up to senility begins. 3.7. 180-day milk yield (180dmy) the overall milk yield of 180 days was 1463± 44kg (table 2). al-amin and nahar [3] found the highest tmy observed in 50% hf was 1837±18 kg and l× sl was 1362±13 kg. reported that tmy in l×f (1765 kg). in this study, 180-day milk yield (180dmy) of 50% hf, 62.5% and 75% hf crossbred were 1500.33 ±76.46, 1549.79±73.86, and 1339.00±75.83 kg respectively. the effect of genotype was non-significant but 62.5% crossbred had higher milk yield than 75% hf crossbred cows. in this study environmental effect was highly significant (p<0.001). in intervention group, 180dmywas 1774.02±70.46 kg and nonintervention group it was 1152.06±51.13 kg. the g×e interaction was non-significant (p>0.05). the variations of lactation milk yield within and between breeds among different authors might obviously be due to animals of different origin, genetic make-up, lactation duration, feeding, management, environments, sample size etc. 3.8. daily milk yield (dmy) in this study, overall average daily milk yield was 8.11±0.24 kg and in 50% hf, 62.5% hf and 75% hf crossbred genotypes it was 8.32±0.42, 8.60±0.41 and 7.42±0.42 kg respectively. the intervention and non-intervention group had yields of 9.85±0.39 and 6.38±0.28.respectively animal review, 2014, 1(2): 26-36 34 © 2014 conscientia beam. all rights reserved. (table 2) which was statistically significantly different (p<0.001). molee, et al. [12] in thailand reported a daily milk yield of 11.84 kg in < 80% hf crossbred cows which slightly higher than present study results. mohamed-khair, et al. [13] reported daily milk yield of 50%, 62.5% and 75% hf crossbred cows were 9.77±0.30, 9.57±0.35 and 10.17±0.49 liters, respectively; which are almost similar with intervention group (9.85±0.39) of the present study. the effect of g x e was non-significant (p>0.05). table-2. least squares means (±se) of milk yield traits as affected by genotype and environment factors milk production traits 180 day milk yield (kg) daily milk yield (kg) genotype ns ns 50% hf 1500.33±76.46 (74) 8.32±0.42 (74) 62.5% hf 1549.79±73.86 (78) 8.60±0.41 (78) 75% hf 1339.00±75.83 (67) 7.42±0.42 (67) environment *** *** intervention 1774.02a±70.46 (75) 9.85a±0.39 (75) non-intervention 1152.06b±51.13 (144) 6.38b±0.28 (144) g×e ns ns overall mean 1463.04±43.53 (219) 8.11±0.24 (219) ns-non-significant (p<0.05); ***-significant (p<0.001); figures in the parenthesis indicate the number of observation; means with uncommon superscripts in the same column differed significantly (p<0.05); cv-co-efficient of variation; hf-holstein-friesian; g×e interaction between genotype and environment 4. conclusion the specific trait leads to the need for additional research to determine the effect of genotype by environment interaction. inventive estimates of genotype by environment interactions to recommend appropriate crossbred cattle genotype to help bangladeshi farmer for higher milk yield in the peri-urban area the present study indicates that the performance of 50% hf crossbred genotype are acceptable for the reproduction and 50% and 62.5% hf crossbred cows are acceptable for production under smallholder peri-urban dairying system in bangladesh . the study concludes that the performance of available selected dairy genotypes crossbreds were favorable for the farmers finally, herd book based farmer‟s participatory system might be one of the best ways to support small holder dairying in bangladesh. 5. acknowledgements this piece of work is a part of spgr funded sub-project titled „‟production hyv vis-à-vis indigenous seed bulls to support smallholder dairying in bangladesh‟‟ whose financial support is gratefully acknowledged. references [1] a. bhuiyan, "research on characterization, conservation and improvement of red chittagong cattle of bangladesh," final technical report of the usda funded project, 2008. animal review, 2014, 1(2): 26-36 35 © 2014 conscientia beam. all rights reserved. [2] m. a. majid, t. n. nahar, a. i. talukder, and m. a. rahman, "factors affecting the reproductive efficiency of crossbred cows," bangladesh journal of livestock research, vol. 2, pp. 18-22, 1995. [3] m. al-amin and a. nahar, "productive and reproductive performance of non-descript (local) and crossbred dairy cows in costal area of bangladesh," asian journal of animal and veterinary advances, vol. 2, pp. 46-49, 2007. [4] j. maule, the cattle of the tropics. edinburg, u.k.: university of edinburg centre for tropical veterinary medicine, 1990. [5] v. taneja and p. bhat, "milk and beef production in tropical environments," in 3rd world congress on genetics applied to livestock production, lincoln, nebraska, july 1986, 1986. [6] m. j. u. sarder, "a comparative study on reproductive performance of cross-bred dairy cows at greater rajshahi district," journal of animal and veterinary advances, vol. 5, pp. 679-685, 2006. [7] m. n. islam, m. m. rahman, and s. faruque, "reproductive performance of different crossbred and indigenous dairy cattle under small holder farming condition in bangladesh," online journal of biological sciences, vol. 2, pp. 205-207, 2002. [8] m. rokonuzzaman, m. r. hassan, s. islam, and s. sultana, "productive and reproductive performance of crossbred and indigenous dairy cows under smallholder farming system," journal of bangladesh agricultural university, vol. 7, pp. 69–72, 2009. [9] o. m. faruk, m. h. emran, and m. m. hassan, "productive and reproductive performance of crossbred and indigenous dairy cows under rural conditions in comilla, bangladesh," journal of zoology rajshahi university, vol. 26, pp. 67-70, 2007. [10] m. s. qureshi, j. m. khan, ihkhan, r. a. chaudhry, k. ashraf, and b. d. khan, "improvement in economic traits of local cattle through crossbreeding with holstein-friesian semen," pakistan veterinary journal, vol. 22, pp. 21-26, 2002. [11] m. a. hoque, m. r. amin, and m. s. hussen, "dairy potential of pabna cows and crossbreds with sahiwal and friesian and within and between breed sire effect," asian-australian journal of animal sciences, vol. 12, pp. 161-164, 1999. [12] a. b. molee, p. bundasak, kuadsantiat, and p. mernkrathoke, "suitable percentage of holstein in crossbred dairy cattle in climate change situation," journal of animal and veterinary advances, vol. 10, pp. 828-831, 2011. [13] a. a. mohamed-khair, t. b. ahmed, l. a. musa, and k. j. peters, "milk production and reproduction traits of different grades of zebu x friesian crossbreds under semi-arid conditions," archive fuertierzucht, dummerstorf, vol. 50, pp. 240-249, 2007. bibliography [1] a. bhuiyan, "production of genetically potential breeding bulls for cattle development in bangladesh," keynote paper presented at the national workshop2007 on breed up gradation through progeny testing project, government of bangladesh, biam conference hall, dhaka, 2007b. animal review, 2014, 1(2): 26-36 36 © 2014 conscientia beam. all rights reserved. [2] a. k. f. h. bhuiyan, "cattle breeding and improvement strategy in bangladeshpast, present and future," presented at a national seminar organized by the directorate of livestock services, government of the people‟s republic of bangladesh, 1997a. [3] e. p. cunningham and o. syrstad, "crossbreedng bosindicus and bostuarus for milk production in the tropics," fao animal production and health, p. 68, 1987. [4] m. n. haque, s. a. aziz, s. chanda, m. i. hossain, and m. a. baset, "a study of the milking and reproductive performances of indigenous cattle at urban area of bangladesh," pakistan journal of biological sciences, vol. 5, pp. 97-100, 2002. [5] s. s. islam and a. k. h. bhuiyan, "performance of crossbred sahiwal cattle at the pabna milk shed area in bangladesh," asian-australian journal of animal sciences, vol. 10, pp. 581-586, 1997. [6] j. mwacharo and j. rege, "on-farm characterization of the indigenous small east african shorthorn zebu cattle (seaz) in the southeast rangelands of kenya," animal genetic resources information, vol. 32, pp. 73-86, 2002. [7] t. n. nahar, m. islam, and m. a. hasnath, "a comparative study on the performances of f1 crossbred cows under rural conditions," asian-australian journal of animal sciences, vol. 5, pp. 435438, 1992. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 87 † corresponding author © 2015 conscientia beam. all rights reserved. in vitro differential effect of nerve growth factor on functional parameters of murrah buffalo spermatozoa in low and high fertile groups namagiri lakshmi s.1 --anand laxmi n.2† 1assistant professor, veterinary college and research institute, orathnadu, tamilnadu, india 2principal scientist, dairy cattle physiology division, national dairy research institute, karnal, haryana, india abstract aim of the present study was to examine the influence of in vitro supplementation of nerve growth factor (ngf) on functional parameters of murrah buffalo (bubalusbubalis) spermatozoa from fresh semen, like, motility, plasmalemma integrity, acrosomal integrity, atp concentration. fresh semen samples (n=6) were washed in tris buffer and divided into two equal parts (control and ngf groups). only in the ngf group, ngf was added to a final concentration of 50 and 100 ng/ml. the samples were incubated at 37o c for different time intervals in tcm 199 medium supplemented with bsa and the effects were observed at 0, 30, 60 and 120 min of incubation. the experiment was performed in low (lf) and high fertile(hf) groups based on previous three years conception rate and taking cutoff value , below and above this value were categorized as lf and hf group. the mean concentration of the buffalo seminal plasma (n=12) ngf was 67.7±3.25ng/ml and 65.5± 2.76 in lf and hf groups respectively. the concentration of ngf in blood plasma was 83.5±7.82 and 68.6±3.82 in hf and lf groups respectively. the concentration of blood plasma ngf being higher (p<0.05) in hf group. with either dose of ngf in vitro significant effect on the total motility (p<0.05), progressive forward motility (p<0.05) was observed. it could be maintained in hf group till 120 min but in lf group it was restricted to 60 min when compared with their respective control. the functional membrane integrity did not differ significantly between groups (control and ngf treated) in both lf and hf groups with either concentration of ngf. the plasma lemma integrity was significantly less (p<0.05) at 120 min of incubation when compared with the initial value at 0 min of incubation. the percentage of acrosomal intact spermatozoa decreased continuously over a period of time in both the groups. as compared to 0 min of incubation, the significant (p<0.05) loss of acrosome was observed at 60 and 120 min of incubation in lf and hf control groups animal review 2015 vol. 2, no. 4, pp. 87-98 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.4/101.4.87.98 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.4/101.4.87.98 animal review, 2015, 2(4): 87-98 88 © 2015 conscientia beam. all rights reserved. and ngf supplementation could maintain acrosome integrity in hf group for 60 min where as in lf group it could be maintained significantly only till 30 min of incubation when compared with the initial values of respective groups. viability of spermatozoa was not significantly different when compared between groups with their respective control, however when compared at different time intervals, the viability of sperms in hf and lf supplemented groups was significantly different from initial values only at 120 min of incubation whereas in respective control groups the loss in viability was significant from 60 min itself. with respect to atp concentration of spermatozoa in different groups it was observed that 100ng dose could increase the concentration of atp in hf group significantly (p<0.05) at 60 min of incubation only with ngf in vitro when compared with its respective control. in conclusion, all the parameters decreased significantly at 120 min of incubation when compared with their respective initial values for all the groups. in hf group supplementation of ngf@50ng/ml could maintain functional parameters of spermatozoa for a greater duration of time when compared with lf or control group. keywords: spermatozoa, nerve growth factor, murrah buffalo, fertility, time of incubation. received: 30 august 2015/ revised: 30 september 2015/ accepted: 5 october 2015/ published: 10 october 2015 1. introduction although various neurotrophins have been detected in mammalian testis [1] only ngf seems to have a potential role in male reproduction [2]. report of server and shooter [3] demonstrated the source of nerve growth factor (ngf) as sub mandibular gland of adult mouse but later presence and purification of ngf was done from seminal plasma of bovine species and was partially characterized. the biological unit of ngf was observed to be more per ml of semen in bovine, when compared with the activity of ngf of other ruminants and human [4]. in buffaloes no work has been carried out, hence the present study was undertaken for estimating the concentration of blood and seminal plasma ngf in low and high fertile group and study in vitro effect of ngf on buffalo spermatozoa functional parameters. studies on ngf/trka system indicated it’s role in the physiology of male reproduction [5-7]. exogenous ngf as cry oprotectant improved sperm viability and motility, increased intracellular no concentration, and decreased apoptosis content in normal human spermatozoa [8] ngf, belongs to a family of neurotrophins, whose role is in maintaining development of neurons. their role is not only restricted to nervous system, but they also have role in regulating reproductive system. it has been well studied in humans [9-11]. extensive work by li, et al. [12] immunolocalized the receptor on ejaculated bovine spermatozoa. the study also reported that exogenous supplementation of ngf to bovine sperm samples increased leptin secretion, sperm viability when concentration of ngf was increased from 20-120 ug/l. in humans, it’s differential level has been reported and lower level has been related with respect to inferior quality of the semen [2]. in the present study, a comprehensive study has been done to estimate the blood and semen plasma level of ngf, localize, ngf receptors in the spermatozoa of high and low fertile animal review, 2015, 2(4): 87-98 89 © 2015 conscientia beam. all rights reserved. murrah buffalo bull. in vitro effect of ngf @ 50ng and 100ng on spermatozoa functional parameters was also evaluated. 2. material and methods enzyme immunoassay kit (eia) for estimation of ngf in blood and seminal plasma was purchased from wkea med. supplies corporation, china. for estimation of atp in spermatozoa samples, kit was purchased from abnova co., germany. the primary antibody used against ngf receptor was purchased from biorbyt ltd., uk. the fitc conjugated secondary antibody was purchased from chromus co., bengaluru, india. for analyzing the pcr products for the ngf receptor and for capturing the image of gel with products , alpha digidoc, documentation system was used. 2.1. grouping of murrah buffalo bulls a total of 15 murrah buffalo bulls from artificial breeding research center, ndri were selected for the present study. they were maintained under routine management conditions and were fed ad libitum. data for total number of services for each bull was collected from the records available at the center. number of services, for these bulls ranged from 46 to 85. baseline for number of services was considered as 46. the conception rate was calculated based on first 46 no. of services of each bull. the conception rate obtained with semen of the selected bulls was fitted in normal distribution, and they were divided into high, medium and low fertile groups. average cr was 36.57% and sd value was 7.54. high and low fertile bulls were selected with higher and lower cr than the estimated value. six bulls for each high (hf) and low fertile (lf) groups were selected. mass activity of the semen sample was also considered, average being 2.7 ± 0.52. after grouping, average values for different parameters like body weight (kg), concentration of sperms (millions/ml) , testosterone (ng/ml) and other factors were also estimated/recorded for both the groups (table a). table-a. comparison of different parameters between two groups of murrah bulls parameters low fertile high fertile body weight (kg) 685±9.0 704±7.2 concentration of sperms (106/ml) 849±12 875±32 concentration of testosterone (ng/ml) 1.85±0.14 2.09±0.17 conception rate(%) 28±4.05 44±2.86 average volume of semen (ml) 2.9±0.54 3.2±0.28 2.2. collection of blood for estimation of testosterone and nerve growth factor (ngf) in blood and seminal plasma samples, blood was collected by jugular vein puncture once in 15d for two months. immediately after collection, blood samples were centrifuged at 3000 rpm, plasma was separated and stored at -20oc until assay was done. animal review, 2015, 2(4): 87-98 90 © 2015 conscientia beam. all rights reserved. 2.3. collection of semen samples and processing for assay of ngf in semen samples, fresh semen sample was collected from murrah bulls six number, each in hf and lf group using sterile artificial vagina (cmv france). hygienic conditions were followed during collection of semen. after collection of semen, samples were centrifuged at 5585 g for 10 min at 4oc to separate out the supernatant fraction containing seminal plasma. the seminal plasma samples were also stored at -20oc.spermatozoa fraction was also separated out, the fraction was washed with tris buffer (ph 7.2 ). then the sperm samples were suspended in tcm 199 medium to a concentration adjusted to 10 million sperms/ml. 2.4. evaluation of different spermatozoa functions sperm motility was estimated at 37°c, by examination of a wet mount using bright-field microscopy (400x). sperm viability was determined by preparing an eosin-nigrosin smear (37°c) and assessing at least 100 sperm under bright-field microscopy at 1000x; [13]. acrosome reaction evaluations were carried out using 10μl-semen smears that had been stained with trypan-blue/giemsa (tb) according to kitiyanant, et al. [14]. in each smear at 200x magnification, 200 spermatozoa were analyzed and two distinct spermatozoal classes were identified: 1) intact 2) damaged. sperm plasma membrane integrity was evaluated using supravitalhypoosmotic swelling test. after the incubation of hos, equal drop of hos solution and eosin [0.5% (w/v), sodium citrate 2.92%] was placed on a warm slide, mixed for 10 seconds and cover slip was placed before the evaluation for plasma membrane integrity under phase contrast microscope at 400x. a total of one hundred spermatozoa were observed in at least five different fields. clear heads and tails and swollen tails were considered intact with biochemically active sperm membranes, while pink heads and tails and unswollen tails were considered disrupted, inactive sperm membranes. hypoosmotic swelling (hos) assay was performed as described by ramu and jeyendran [15]. 2.5. in vitro studies 2.5.1. supplementation of ngf for in vitro studies after separating out seminal plasma from ejaculated semen, the precipitate fraction containing spermatozoa was dispersed in tcm 199 medium and they were adjusted to ten million number of sperms in one ml of the medium. nerve growth factor was supplemented @ 50 ng and 100 ng/ml for three different time periods of incubation viz. 30, 60 and 120 min for both lf and hf groups. percentage of motile or viable spermatozoa were estimated and spermatozoa were also evaluated for acrosome integrity, plasmalemma integrity by host test and atp production. each trial was conducted in triplicate and four trials for each parameter was conducted. 2.5.2. localization of ngf receptor by immunofluorescence for localizing receptor, spermatozoa were fixed with 100% methanol for 30 min followed by washing with pbs. subsequently sperms were incubated with mouse monoclonal antibody specific animal review, 2015, 2(4): 87-98 91 © 2015 conscientia beam. all rights reserved. for human ngf receptor (1: 100 dilution) or with pbs (for control) for 3 h followed by washing with pbs. specimens were then incubated with fitc-conjugated secondary antibody (anti-rabbit igg fitc conjugate, 1:100 dilution) for 90 min. at 37oc. further, samples were treated with 1,4diazabicycol (2.2.2) octane, covered with a cover slip and sealed. specimen were examined under a fluorescence microscope at 40 x magnification and as described by li, et al. [2]. 2.5.3. confirmation of receptor by pcr polymerase chain reaction was also performed for localizing the receptor. dna was extracted from spermatozoa samples using modified phenol chloroform extraction method [16]. a 100 ng dna was precipitated out from 40-50 x106 spermatozoa. a100 ng of extracted dna was amplified with the ngf primers (table-b) by pcr with different componants of pcr mixture as given in (table-c)as per the time for different events as given under reaction programme for pcr. pcr product obtained was evaluated by electrophoresis on a 1.8% agarose gel [17]. purity of the dna was estimated by taking the ratio of the absorbances recorded at 260 nm and 280 nm. the amount of dna (ng/ml) present was calculated as o.d. 1 at 260 nm is equivalent to 50 ng ds dna/ul). table-b. sequences of forward and reverse primers receptor primer selection fragment size ngf r (trka) 5’-ctgggtgagggtgccttt 3’-cgctcagacacctccttcag 112 bp table-c. concentration of different componants in pcr mixture contents quantity total mixture 50ul genomic dna 2ul primer (f) 0.5ul primer (r) 0.5ul master mix 25ul milliq water 22ul reaction programme for pcr initial denaturation 95oc 2 min. denaturation 95oc 30 s annealing 59oc 30s extension 72oc 45 s. the step was continued for 35 cycles and final extension was carried out at 72oc for 4 min. pcr was carried out in thermocycler (qb96, quanta biotech., uk). animal review, 2015, 2(4): 87-98 92 © 2015 conscientia beam. all rights reserved. 2.6. statistical analyses all analyses were done using software package. data from different experiments are presented a mean±sem. significance of the parameters was evaluated by using three way anova considering concentration of supplemented ngf in vitro ,incubation time and group factors. 3. results blood plasma concentration of ngf was observed to be higher (p<0.05) in hf group when compared with lf group. the concentration of ngf in seminal plasma when compared between groups, the difference was not significant. the mean±sem concentration of testosterone was also not significantly different between the groups (table 1).the intra and interassay cv percentage as analyzed for hormone estimations was always <10%. table-1. concentration of ngf in blood and seminal plasma and testosterone in blood plasma of low and high fertile groups values are expressed as mean±se. values with capital superscripts differ significantly (p<0.05) within a row. 3.1. in vitro supplementation of ngf on percentage of motile sperms when 10 million spermatozoa were treated with different concentrations of 50 or 100 ng ngf, change in the percentage of motile spermatozoa was not significant in lf or hf group when compared with their respective control, when time factor was kept constant. although at 60 min, it was observed that supplementation with either dose could maintain significantly greater percentage of motile sperms. when the motility parameter was estimated for different time intervals of incubation, with either dose of ngf, it was observed that there was decrease in the percentage of motile sperms with increase in the time of incubation but the decrease was significant (p<0.05) only at 120 min of incubation in hf group, where as in lf control group it was significant as early as at 60 min and was further significant also at 120 min (p<0.05), but such further significant decrease could not be observed at 120 min, in hf control group samples (table 2) . table-2. effect of in vitro supplementation of ngf (ng/ml) on percentage of motile sperms values are expressed as mean±se. values with small superscripts differ significantly (p<0.05) within a column. animal review, 2015, 2(4): 87-98 93 © 2015 conscientia beam. all rights reserved. 3.2. in vitro supplementation of ngf on percentage of viable spermatozoa on addition of ngf to hf/lf group spermatozoa samples; there was no significant effect on percentage of viable spermatozoa when time factor was kept constant except at 60 min supplementation increased the viability in hf group when compared with the viability of sperms of respective control group. when concentration of ngf @ 50 or 100ng was kept constant, it was observed that in both lf and hf groups percentage of viable sperms decreased significantly (p<0.05) only at 120 min of incubation, but without supplementation in the control group, viability could be maintained only till 30 min without significant change but further from 60 min the decrease was significant (p<0.05) from initial value (table 3). table-3. effect of in vitro supplementation of ngf (ng/ml) on percentage of viable sperms values are expressed as mean±se. values with capital superscripts differ significantly (p<0.05) within a row. values with small superscripts differ significantly (p<0.05) within a column. 3.3. in vitro supplementation of ngf on acrosome integrity when time factor was kept constant, within a group the acrosome integrity of spermatozoa of supplemented groups was not significantly different from the acrosome integrity of control group. on supplementation of either dose of ngf to spermatozoa of lf/hf group, the decrease in acrosome integrity observed was not significant, till 60 min of incubation from the initial value, but decreased significantly (p<0.05) at 120 min. in the lf control group samples, the values were significantly less (p<0.05) at 60 min of incubation and could be maintained only till 30 min. whereas in hf control group acrosome integrity of spermatozoa could be maintained till 60min but at 120 min it decreased significantly (p<0.05)(table 4). table-4. effect of in vitro supplementation of ngf (ng/ml) on percentage of sperms with acrosome integrity values are expressed as mean±se. values with small superscripts differ significantly (p<0.05) within a column. 3.4. in vitro supplementation of ngf on plasmalemma integrity in control group without supplementation of ngf, the integrity of plasmalemma as assessed by host test decreased with increase in the time of incubation, the decrease was significant animal review, 2015, 2(4): 87-98 94 © 2015 conscientia beam. all rights reserved. (p<0.05) at 120 min of incubation. similar was the trend observed in lf group on supplementation with either 50 or 100 ng dose of ngf. keeping the time factor constant, the plasmalemma integrity of spermatozoa was not significantly different from control when any time period of incubation was considered. in hf group supplementation of ngf did not alter the integrity of plasmalemma of spermatozoa significantly at different fixed time intervals when compared with the respective control. similar were the results when compared with the values at initial time period of incubation and also at different time intervals keeping dose factor constant (table 5). table-5. effect of in vitro supplementation of ngf (ng/ml) on percentage of sperms with plasmalemma integrity values are expressed as mean±se. values with small superscripts differ significantly (p<0.05) within a column. 2.5. in vitro supplementation of ngf on concentration of spermatozoa atp the concentration of atp in spermatozoa decreased significantly, as the time of incubation increased irrespective of whether the group was supplemented or not supplemented. when the time factor was kept constant, only at 60 min of incubation, supplementation with 100 ng dose of ngf in hf group could increase the concentration of spermatozoa atp, which was significantly(p<0.05) different from control, where as supplementation could not increase the concentration of atp significantly at 30 or 120 min of incubation (table 6). table-6. effect of in vitro supplementation of ngf (ng/ml) on concentration of atp in spermatozoa lysates values are expressed as mean±se. lysate of 10x106 sperms was used. values with different capital superscripts differ significantly (p<0.05) within a row. when all the parameters were compared between low and high fertile groups, keeping time factor constant at a time , it was observed that all the parameters were greater for hf group when compared with lf group, although were not significantly different, except at 60 min for motility, viability and concentration of spermatozoa atp. when different parameters were time of incubation lf hf dose of ngf supplemented dose of ngf supplemented 0 50 100 0 50 100 0 58.08a±1.02 58.45a±1.00 58.54a±1.03 65.25±1.02 65.86±0.99 68.83±0.95 30 56.23±0.99 56.89±1.02 56.89±0.98 64.23±1.01 65.23±1.00 67.45±0.98 60 56.45±0.96 56.23±0.99 56.45±0.92 63.32±0.98 64.89±0.97 67.23±0.96 120 46.98b±0.85 50.23b±0.75 49.87b±1.02 60.52±1.03 64.42±1.02 65.01±0.88 time of incubation lf hf dose of ngf supplemented dose of ngf supplemented 0 50 100 0 50 100 0 6.417±0.02 6.421±0.02 6.454±0.03 6.425±0.03 6.423±0.02 6.419±0.02 30 6.361±0.02 6.328±0.02 6.388±0.02 6.342±0.02 6.352±0.03 6.360±0.03 60 6.309±0.01 6.305±0.02 6.308±0.03 6.325a±0.03 6.320±0.02 6.358b±0.02 120 6.208±0.02 6.222±0.01 6.231±0.02 6.210±0.02 6.221±0.02 6.225±0.01 animal review, 2015, 2(4): 87-98 95 © 2015 conscientia beam. all rights reserved. compared for different time periods of incubation, in both high and low fertile group, all the parameters decreased significantly with increase in the time period of incubation, except for one parameter namely plasmalemma integrity which was not significantly different at any time period of incubation .in hf group supplementation of spermatozoa with ngf could maintain motility, viability and acrosome integrity for greater period of time i.e. 60 min whereas in lf supplemented groups it could be maintained till 30 min only . by immunoflourescence technique, using fluorescent antibody, it was observed that fluorescence was intense at the acrosomal and post acrosomal regions, irrespective of high or low fertile group. fluorescence could be observed in both the groups (fig 1). the test was qualitative. when the extracted spermatozoa dna was subjected to pcr, and run on 1.8 % agarose gel a 112 bp product was obtained for both lf and hf groups confirming the presence of receptor (fig 2). fig-1. immunolocalization of ngf receptor in murrah buffalo bull spermatozoa fig-2. pcr product of ngf receptor (112 bp) l 50 bp ladder lf (1 8),hf (9-12) ppositive marker for ngf receptor 3. discussion there is evidence that a neurotropin like ngf has important role in non neuronal cells in reproductive system [18]. in the present study, higher concentration of blood plasma ngf of hf group indicates positive relation between plasma concentration of ngf and spermatozoa functional parameters and fertility of bulls. in the sperm lysate, ngf could not be detected by eia. reports of li, et al. [19]; li, et al. [2] have suggested that ngf is present in spermatozoa, but the methodology for estimation was by western blotting and pcr. in the present study it was observed that all the parameters related to spermatozoa, were higher in the hf when compared with lf group. at the same time, concentration of blood plasma ngf was higher in hf group. it suggests regulatory role of circulatory ngf on buffalo sperm functional parameters. the physiological concentration of ngf (50/100 ng/ml) was more closely related in augmenting sperm physiological functions in vitro in the present study. li, et al. [2] reported the same in bovines and humans. with immunofluorescence technique it was observed that trka receptor is present on spermatozoa and pcr studies confirmed the presence of ngf receptor on murrah bull spermatozoa. using an immunofluorescent technique, ngf-immunoreactivity was localized to the sperm head and tail, whereas that of trka was detected in the acrosomal cap, animal review, 2015, 2(4): 87-98 96 © 2015 conscientia beam. all rights reserved. nucleus, and tail regions [2, 20].this is the first report in murrah bull confirming presence of ngf receptor in spermatozoa. in vitro studies regarding effect of ngf on human sperm motility by casa showed that sperm motility were enhanced in a time and dose dependant manner [21]. study by saeednia, et al. [8] reported that addition of ngf to medium containing post thawed sperms can enhance motility and viability of human sperms. hence from the present study, it can be suggested that supplementation of ngf in vitro might have enhanced buffalo spermatozoa viability and motility in both lf and hf groups till one hour of incubation when compared with the non supplemented group. this study was carried out for short duration of time; technology has to be improvised for conducting experiments for longer durations. report of perrard, et al. [22] suggested that ngf is produced by germ cells and acts on sertoti cells. in the present study, however, by eia technique, we could not measure ngf in sperm lysates. may be other techniques can demonstrate the presence/secretion of ngf by murrah bull spermatozoa. it’s known that trka binds ngf and its presence could be detected in buffalo bull spermatozoa, suggesting role of circulatory/seminal plasma ngf in regulating spermatozoa function. this was confirmed by in vitro studies with supplementation of ngf on different sperm functions. with respect to spermatozoa integrity and viability on ngf supplementation in vitro, it was observed that ngf could maintain viability/reduced permeability of membrane and plasmalemma integrity of spermatozoa for a greater duration of time in vitro when compared with control within 120 min of study. although the extent of its effect in augmenting functions or reducing the damage to the membrane was different when compared between lf and hf group . hence its effect was more prominent in maintaining spermatozoa functional parameters of hf group when compared with the functional parameters of lf group. the mechanism by which ngf affects the viability and motility parameters is not understood and study is required in this area. this study also suggests that enhancement of the sperm functions by supplementation of ngf in vitro may be applicable in assisted reproductive technologies yielding better results with murrah bull spermatozoa. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: both authors contributed equally to the conception and design of the study. refrences [1] l. f. reichardt, "neurotrophin-regulated signalling pathways," philosophical transactions of the royal society of london, vol. 361, pp. 1545 -1564, 2006. [2] c. li, l. zheng, c. wang, and x. zhou, "absence of nerve growth factor and comparison of tyrosine kinase receptor a levels in mature spermatozoa from oligoasthenozoospermic, asthenozoospermic and fertile men," clinica chimica acta., vol. 411, pp. 1482-1486, 2010. [3] a. c. server and e. m. shooter, "nerve growth factor," advances in protein chemistry, vol. 31, pp. 339–409, 1977. animal review, 2015, 2(4): 87-98 97 © 2015 conscientia beam. all rights reserved. [4] g. p. harper, w. robert, glanvillel, and h. thoenen, "the purification of nerve growth factor from bovine seminal plasma," journal of biological chemistry, vol. 257, pp. 8541-8548, 1982. [5] m. b. levanti, a. germanà, f. de carlos, e. ciriaco, j. a. vega, and germana, "effects of increased nerve growth factor plasma levels on the expression of trka and p75 in rat testicles," journal of anatomy, vol. 208, pp. 373-379, 2006 [6] p. lonnerberg, o. so der, m. parvinen, e. m. ritze´n, and h. persson, "b-nerve growth factor influences the expression of androgen-binding protein messenger ribonucleic acid in the rat testis," biology of reproduction, vol. 47, pp. 381–388, 1992. [7] w. jin, a. tanaka, g. watanabe, h. matsuda, and k. taya, "effect of ngf on the motility and acrosome reaction of golden hamster spermatozoa in vitro," journal of reproduction and development, vol. 56, pp. 437-443, 2010. [8] s. saeednia, h. bahadoran, f. amidi, m. h. asadi, m. naji, p. fallahi, and n. a. nejad, "nerve growth factor in human semen: effect of nerve growth factor on the normozoospermic men during cryopreservation process," iranian journal of basic medical sciences, vol. 18, pp. 292–299, 2015. [9] r. abir, b. fisch, s. jin, m. barnnet, a. ben-haroush, c. felz, g. kessler-icekson, d. feldberg, s. nitke, and a. ao, "presence of ngf and its receptors in ovaries from human fetuses and adults," molecular human reproduction, vol. 11, pp. 229-236, 2005. [10] l. l. robinson, j. townsend, and r. a. anderson, "the human fetal testis is a site of expression of neurotrophins and their receptors: regulation of the germ cell and peritubular cell population," journal of clinical endocrinology and metabolism, vol. 88, pp. 3943–3951, 2003. [11] d. muller, m. s. davidoff, o. bargheer, h. j. paust, w. pusch, y. koeva, d. jezek, a. f. holstein, and r. middendorff, "the expression of neurotrophins and their receptors in the prenatal and adult human testis: evidence for functions in leydig cells," histochemistry and cell biology, vol. 126, pp. 199–211, 2006. [12] c. li, y. f. sun, k. l. yi, y. h. ma, y. l. sun, w. zhang, and x. zhou, "detection of nerve growth factor (ngf) and its specific receptor (trka) in ejaculated bovine sperm, and the effects of ngf on sperm function," theriogenology, vol. 74, pp. 1615–1622, 2010. [13] e. blom, "the evaluation of bull semen, with special reference to its use in artificial insemination in danish," copenhagen: a/s carl fr mortensen. abstract in anim breed abstr, vol. 19, p. 648, 1950. [14] y. kitiyanant, b. chaisalee, and k. pavasuthipaisit, "evaluation of the acrosome reaction and viability in buffalo sperm using two staining methods: the effects of heparin and calcium ionophore a23187," inernational journal of andrology, vol. 25, pp. 215-222, 2002. [15] s. ramu and r. s. jeyendran, "the hypo-osmotic swelling test for evaluation of sperm membrane integrity," methods in molecular biology, vol. 927, pp. 21-25, 2013. [16] k. arvind, "application of sperm mediated gene transfer technique for evaluation of invitro fertilization in buffalo (bubalus bubalis)," mvsc. thesis submitted to national dairy research institte, karnal, haryana, india, 2012. [17] p. bosch, w. e. roudebush, r. a. mcgraw, j. m. dejarnette, c. e. marshall, j. massey, b. brackett, and g. benjamin, "bull spermatozoa express receptors for platelet activating factor," revista cientifica, vol. 19, pp. 513-521, 2009. animal review, 2015, 2(4): 87-98 98 © 2015 conscientia beam. all rights reserved. [18] k. kawamura, n. kawamura, s. m. mulders, m. d. sollewijn, gelpke, and a. j. hsueh, "ovarian brain-derived neurotrophic factor (bdnf) promotes the development of oocytes into preimplantation embryos," in proceedings national academy of science usa, 2005, pp. 9206–9211. [19] c. li, g. watanabe, q. weng, w. jin, c. furuta, a. k. suzuki, m. kawaguchi, and k. taya, "expression of nerve growth factor (ngf), and its receptors trka and p75 in the reproductive organs of the adult male rats," zoological science, vol. 22, pp. 933–937, 2005. [20] c. li and z. xu, "the potential roles of neurotrophins in male reproduction-a review," reproduction, vol. 145, pp. 89–95, 2013. [21] c. shi, k. lin, x. xu, s. zhang, n. wang, and m. fan, "evidence for the involvement of ngf in human sperm motility," journal of biomedical science and engineering, vol. 5, pp. 534-541, 2012. [22] m. h. perrard, m. vigier, a. damestoy, c. chapat, d. silandre, b. b. rudkin, and p. durand, "beta-nerve growth factor participates in an auto/paracrine pathway of regulation of the meiotic differentiation of rat spermatocytes," journal of cellular physiology, vol. 210, pp. 51-62, 2007. bibliography [1] c. w. jin, k. y. arai, k. shimizu, w. jin, k. y. arai, k. shimizu, c. kojima, m. itoh, g. watanabe, and k. taya, "cellular localization of ngf and its receptors trka and p75lngfr in male reproductive organs of the japanese monkey, macaca fuscata fuscata," endocrine, vol. 29, pp. 155160, 2006. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 45 † corresponding author © 2014 conscientia beam. all rights reserved. seleno-cystine affects the fatty acid profile in in vitro incubated ovine ruminal fluid containing -linolenic acid marian czauderna1† --rozbicka wieczorek a.j.2 --więsyk e.3 1, 2, 3the kielanowski institute of animal physiology and nutrition, polish academy of sciences, poland abstract the influence of seleno-cystine (cyse2) added to ovine ruminal fluids containing -linolenic acid (lna) on the profile of fatty acids (fa) was investigated. fluids were incubated in vitro at 39°c under co 2 either alone (rf) or with lna (1.67 mg/ml) or with a combination of lna with either a low (1.34 μg/ml) or high (3.33 μg/ml) level of se as cyse2. fluids were removed after 0, 6, 12, 18, 24 hrs of incubation and then analyzed to determine fa levels. lna added to the fluids without/with cyse2 decreased the c180 concentration for incubation at all times from 6 hrs compared with the rf or the fluid containing cyse2. lna added to the fluids without/with cyse2 decreased the biohydrogenation yield to c18:0. cyse2 added to the fluids decreased the c18:0 concentration and the index of the biohydrogenation to c18:0 compared with the rf. the higher concentration of cyse2 in the fluids with lna reduced the accumulation of trans11c18:1 for incubation at all times from 18 hrs compared with the fluids with lna, irrespective of the presence of the lower concentration of cyse2. the lowest concentration of trans11c18:1 in the fluids with lna and the higher concentration of cyse2 correlated with the lowest yield of the isomerization of lna into cis9trans11cis15c18:3 and the lowest yield of the initial biohydrogenation of cis9trans11cis15c18:3 to trans11cis15c18:2 in the fluids containing lna and the higher concentration of cyse2. cyse2 added to the fluids with lna decreased the ratio of polyunsaturated fa to saturated fa for incubation at all times from 12 hrs compared with the fluids containing lna. cyse2 in the fluids without/with lna reduced the fa sum in the fluids. keywords: selenium, -linolenic acid, ovine ruminal fluids, fatty acids, biohydrogenation, isomerization. contribution/ originality our original study documents that cyse2 added to the ovine ruminal fluids, irrespective of the presence of αlna, affects concentrations of fatty acids, the capacity of the bacterial isomerases and the biohydrogenation yield of unsaturated fatty acids in in vitro incubated ruminal fluids compared with the control fluid. animal review 2014 vol. 1, no. 3, pp. 45-56 issn(e): 2409-6490 issn(p): 2412-3382 © 2014 conscientia beam. all rights reserved. animal review, 2014, 1(3): 45-56 46 © 2014 conscientia beam. all rights reserved. 1. introduction a large proportion of selenium (se) in feedstuffs is present in organic compounds, as selenocysteine (cyse) and especially as seleno-methionine (se-met), and forms a part of the amino acid structure of protein molecules in the feed [1, 2]. rumen microorganisms can incorporate cyse and se-met into their own proteins, but can also reduce an excess of dietary se-compounds into inorganic forms (like selenide or seo) that are largely unavailable to the ruminant [3, 4]. ruminal microbial se concentrations were enriched relative to the concentration of se in rations. indeed, the concentration of se was significantly higher than that of the ration, whether considered relative to diet dry matter (average of 46-fold), nitrogen (average of 11.3-fold) or sulfur abundance (average of 26-fold) [5]. moreover, the enrichment of se in microbial cells (2-78-fold) was greater than the enrichment of either nitrogen (average of 4-fold) or sulfur (average of 1.6fold). ruminal microorganisms reduce much of dietary inorganic se (as selenite or selenate) to unabsorbable elemental se or inorganic selenide forms. bacteria are also able to synthesize semet and cyse, and then these se-amino acids (se-aa(s)) are incorporated into microbial proteins. thus, dietary se finds its way into a form metabolizable by ruminants, and so the way to improve the healthiness of ruminant meat and milk by increasing the concentration of cyse and se-met [6, 7]. recent investigations demonstrated that n-3 polyunsaturated fatty acids (pufa) like linolenic acid (lna) and long-chain pufa (lpufa) possessed also several potential health benefits, including cancer prevention, decreased atherosclerosis, improved immune response and altered fatty acids (fa) and protein metabolism [8-11]. numerous in vitro and in vivo studies documented that ruminant dietary c18-pufa like linoleic acid (la) or lna are direct incorporated into the ruminal bacteria, isomerized to other geometrical and positional isomers, metabolized into conjugated linoleic acid (cla) isomers [8, 10, 12-14], as well as biohydrogenated to trans11c18:1 (t11c18:1) and finally to c18:0. indeed, c18-pufa, especially lpufa, have toxic effects on cellulolytic bacteria and protozoa, act against ruminal lactate producers thereby favouring propionate producers [15-17]. interestingly, unsaturated fatty acids (like lna, la or cis9c18:1) inhibited bacterial enoyl-acyl carrier protein reductase, an essential component of bacterial fatty acid synthesis [18]. unsaturated fatty acids (ufa) are more toxic than saturated fatty acids (sfa) and can inhibit fermentation in the rumen more intensively [19]. ufa are especially toxic to g+ bacteria, whereas gbacteria are less sensitive to fatty acids at the same concentration [20]. biohydrogenation is a microbial pathway in ruminal contents designed to reduce unsaturation of lipids found within plant matter, and is likely an evolutionary adaptation to protect the microbial population from antimicrobial effects of unsaturated fatty acids (ufa) [8, 13]. current studies indicated that t11c18:1, the intermediate biohydrogenation product of αlna and la formed in a rumen, may also be of benefit in the prevention of cancer due to endogenous conversion of t11c18:1 to cis9,trans11cla (c9t11cla) in mammalian tissues [21-24]. in our recent studies it was found that the concentration of ufa in a body of animals, as well as in membrane of microorganisms cells were positively correlated with the se level in a diet [25-28]. indeed, se is an integral component of antioxidant enzymes (e.g. glutathione animal review, 2014, 1(3): 45-56 47 © 2014 conscientia beam. all rights reserved. peroxidases) that can decrease the risk of pufa peroxidation in particular [29, 30]. moreover, our recent studies revealed that of selenate or selenite changed concentrations of fas and cla isomers in particularly in incubated ovine ruminal fluid muscle [23, 24]. considering the above, we hypothesized that se-cystine (cyse2) added to the ovine ruminal fluids affected bacterial isomerization of -linolenic acid (lna) and reduced the biohydrogenation of ufa in in vitro incubated ruminal fluid. therefore, the major objective of the current study was to examine the hypothetically effect of cyse2 on the concentration of ufa, especially lna, their geometric and positional isomers, in in vitro incubated ovine ruminal fluids containing lna. 2. materials and methods 2.1. animals and diets eight ruminally fistulated adult sheep received a mixed diet comprising grass hay, barley, molasses, soybean meal and minerals and vitamins, at 500, 299.5, 100, 91 and 9.5 g/kg dry matter respectively, fed in equal meals of 500 g at 8.00 and 16.00 h [23]. ruminal digesta samples were taken before feeding in the morning from each sheep. the ruminal fluid was kept at 39c and strained through linen cloth before use. 2.2. reagents cyse2, lna and fatty acid methyl ester standards were purchased from sigma (poole, dorset, uk). other reagents were of analytical grade and were from poch (gliwice, poland). water used for the preparation of mobile phases and chemical reagents was prepared using an elixtm water purification system (millipore). 2.3. incubations with ruminal fluid in vitro strained ruminal fluids (srf) were incubated either alone or with a combination of lna and two concentrations of cyse2 to determine the interactions in the metabolism of lna. all in vitro experiments were performed on four different days using samples withdrawn from eight different sheep. in general, 1 ml of strained ruminal fluid was added under co2 to pyrex tubes (120 x 11 mm) containing 0.2 ml of water solution containing either alone (the positive control groups) or with a combination of lna, a low (l) or high (h) level of cyse2 (table 1). the tubes with the ovine ruminal fluids were incubated at 39°c. the tubes were removed after 0, 6, 12, 18 or 24 hrs of in vitro incubation, heated to inactivate ruminal microbial enzymes for 9–10 min in a block heater at 100°c and stored at –20°c before being submitted for the quantification of fa. the fa were extracted, methylated and analyzed as described below. 2.4. fatty acid extraction and preparation of fatty acid methyl esters (fame) the method of alkaline saponification and extraction was as described previously [24]. derivatization of the extracted free fatty acids to fame was carried out using a procedure that animal review, 2014, 1(3): 45-56 48 © 2014 conscientia beam. all rights reserved. contained mild, baseand acid-catalyzed methylation steps that minimized positional and geometrical isomerization of ufa [24]. fame were then analysed using gas chromatography (gc) according to czauderna, et al. [24]. the analyses of all fame in ruminal fluid samples were performed on a shimadzu gc-ms qp2010 plus ei equipped with a bpx70 fused silica capillary column (120 m x 0.25 mm i.d. x 0.25 µm film thickness; shim-pol), a quadrupole mass selective detector (model 5973n) and an injection port. fame identification was validated based on the electron impact ionization spectra of fame and compared with authentic fame standards and the nist 2007 reference mass spectra library. 2.5. statistical analyses statistical analyses were performed using the statistica software package (statsoft, version 10, 2010). statistical analyses of the effects of lna and cyse2 on the concentrations of selected fa in in vitro incubated ruminal fluids were conducted using the non-parametric mann-whitney u test. the results are presented as the means of the individually analyzed ruminal fluid samples. mean values in the columns with different superscripts are significantly different at a,bp < 0.05 and a,bp < 0.01. 3. results 3.1. the influence of cyse2 on the accumulation of selected saturated fatty acids (sfa) in in vitro incubated ruminal fluids with  lna although factors altering the microbial population and ruminal fermentation are undoubtedly keys to controlling the yield of the biohydrogenation and synthesis of positional or geometric isomers of fatty acids very few studies have directly associated production of fatty acid isomers and their products of the biohydrogenation in ruminal fluids enriched in se-compounds [12-14, 23, 24, 31, 32]. therefore, in vitro studies were conducted to determine the effect of cyse2 on the concentrations of selected fatty acids in ovine ruminal fluids containing extra lna. the results summarised in table 2 documented that the addition of lna to the incubated ruminal fluids, irrespective of the presence of cyse2, decreased the concentration of c180 from 6 to 24 hrs of in vitro incubation compared with the control ruminal fluid (rf) or the fluid containing only cyse2, regardless of its concentration. on the other hand, cyse2 added to the ruminal fluids revealed minute influence on the accumulation of c18:0 compared with the rf; indeed, cyse2, in dose dependent manner, slightly reduced the concentration of c18:0 from 12 to 24 hrs compared with the rf. of interest is the observation that the addition of lna to the fluids with cyse2, irrespective of its concentration, slightly stimulated the accumulation of c14:0 from 6 to 24 hrs compared with the rf and other ruminal fluids with lna or cyse2. moreover, lna added to the ruminal fluid, irrespective of the presence of cyse2, stimulated the accumulation of c20:0 and c22:0 especially from 18 to 24 hrs of incubation compared with the rf and the fluids with cyse2. on the other hand, all additives in the incubated fluids revealed negligible influence on the concentrations of c15:0 and c16:0 as well as the concentration sum of all assayed sfa (sfa) compared with the rf. animal review, 2014, 1(3): 45-56 49 © 2014 conscientia beam. all rights reserved. 3.2. the influence of cyse2 on the accumulation of selected monoand poly-unsaturated fatty acids in in vitro incubated ruminal fluids with lna as can be seen from the results summarized in table 3, all additives in the incubated ruminal fluids revealed negligible influence on the concentrations of c9c14:1 and c9c16:1 compared with the rf. similarly, the addition of cyse2 to the fluids enriched in lna revealed negligible influence on the concentrations of c9c18:1 and t11c18:1 (tva) as well as the concentration sums of cmufa and tc18:1 compared with the fluids containing only lna. the concentrations of c9c18:1, t11c18:1 and cmufa were higher from 6 to 24 hrs of incubation in the fluids with cyse2 and lna than in the fluids containing only cyse2. as can be seen from results summarized in table 4, cyse2 or/and lna added to the ruminal fluids affected the concentrations of pufa in in vitro incubated ruminal fluids. the concentration of t11c15c18:2 (tcc18:2) increased throughout the incubation in the ruminal fluids enriched in lna, whereas decreased in the rf and the fluids containing only cyse2. the addition of cyse2 to the fluids with lna reduced the concentrations of tcc18:2 and c9t11c15c18:3 (ctcc18:3) from 18 to 24 hrs of incubation compared with the fluids containing only lna. the concentrations of ctcc18:3, t9t11c15c18:3 (ttcc18:3) and lna were quantitatively detected in the fluids containing lna; the addition of cyse2 to the fluids with lna revealed negligible influence on the concentrations of ttcc18:3 and lna as well as on the concentration sum of pufa (pufa) compared with the fluids with lna. the addition of cyse2 to the ruminal fluids with lna slightly decreased the concentration ratio of pufa to sfa (pufa/sfa) from 12 to 24 hrs of incubation compared with the fluids with only lna. moreover, cyse2 added to the ruminal fluids without or with lna, decreased the concentration sum of all assayed fatty acids (fa) in incubated fluids compared with the rf and the fluids with only lna, respectively. as observed from the obtained results (table 4), lna or/and cyse2 added to the ruminal fluids changes the indexes of the initial, intermediate and final biohydrogenation in incubated fluids compared with the rf. 4. discussion wina, et al. [33] documented that the contents of the major ruminal microorganisms, including protozoa, were found to be kept at higher levels than after 24 hrs in in vitro incubation. considering the above, the in vitro incubation periods in the current investigation were set to 6, 12, 18 and 24 hrs to determine the influence of cyse2 and/or lna on the concentration of fa in incubated ovine ruminal fluids. interestingly, the concentration of protozoa in incubated fluids was highest at 12 hrs of in vitro incubation, whereas only slightly lower (15%) after 24 hrs of incubation compared with the initial concentration of protozoa [33]. our studies and other investigations have shown that ph of ruminal fluids containing lna slightly decreases after 24 hrs of in vitro incubation of ovine fluids; the ph value is reduced by approx. 0.5 [34, 35]. ruminal microorganisms may use the biohydrogenation as a method of defence against toxicity of ufa, especially pufa (like lna or la). therefore, the first step of the biohydrogenation consists of the enzymatic bacterial isomerisation, which turns cis bonds into animal review, 2014, 1(3): 45-56 50 © 2014 conscientia beam. all rights reserved. trans bonds. this isomerisation step is rapid compared with the biohydrogenation step [8]. as can be seen from data summarized in table 2, lna added to the ruminal fluids, irrespective of the presence of cyse2, decreased the yield of the final biohydrogenation (fbh) to c18:0. considering the above, we argue that lna decreased the activity of group b bacteria in a rumen [36]. indeed, group a included the ruminal bacteria that hydrogenate pufa (e.g. lna or la) into t11c18:1 where their effect was thought to end; on the other hand, group b ruminal bacteria were thought to be capable of converting the same pufa as those of group a bacteria, but they are more capable of biohydrogenating a wider range of fatty acids, ending with c18:0 flow from the rumen [36]. as consequence, the addition of lna to the fluids, regardless of the presence of cyse2, revealed negligible influence on the concentration of c14:0, c15:0 and c16:0 in incubated fluids. indeed, these saturated fatty acids are not the products of the fbh [8]. the current results documented that added cyse2, in dose depended manner, reduced the formation of c22:0 in the fluids containing lna compared with the fluids with only lna from 18 to 24 hrs of the incubation; so, our results suggested that added cyse2 decreased the capacity of the elongation of saturated fatty acids in the incubated ruminal fluids enriched in lna. our investigations revealed that cyse2 added to the fluids without or with lna reduced the synthesis of fatty acids or/and increased their oxidation. therefore, the concentration of fa was lower in the incubated fluids containing cyse2 without or with lna than in the rf or the ruminal fluids with lna. our current studies documented that the higher concentration of cyse2 in the ruminal fluids enriched in lna reduced the accumulation of t11c18:1 from 18 to 24 hrs of incubation compared with the fluids containing lna, irrespective of the presence of the lower concentration of cyse2 (table 3); t11c18:0 is the product of isomerization and/or the intermediate biohydrogenation of unsaturated fatty acids (c18:2), like t11c15c18:2 [25]. indeed, the higher concentration of cyse2 in the ruminal fluids containing lna most efficiently reduced the index of the initial biohydrogenation of c9t11c15c18:3 and t9t11c15c18:3 to t11c15c18:2 from 18 to 24 hrs of incubation (table 4). moreover, the lowest concentration of t11c18:1 in the fluids with lna and the higher concentration of cyse2 well correlated with the lowest yield of the bacterial isomerization of lna into c9t11c15c18:3 (ctcc18:3) and the lowest yield of the initial biohydrogenation of ctcc18:3 to t11c15c18:2 (tcc18:2) in the incubated fluids containing lna and the higher concentration of cyse2 (table 4). therefore, the concentration of ctcc18:3 and tcc18:2 in the fluids enriched in lna and the higher concentration of cyse2 was lower than in the fluids with lna, irrespective of the presence of the lower concentration of cyse2, from 12 to 24 hrs of the incubation. considering the above results, we argued that cyse2 added to the incubated fluids with lna reduced the yield of the bacterial isomerization of lna (table 3) as well as the initial biohydrogenation of ctcc18:3 in dose dependent manner from 18 to 24 hrs of the incubation (table 4). moreover, we suggest that lna added to the incubated fluids, irrespective of the presence of cyse2, reduced the capacity of the final biohydrogenation to c18:0 compared with the rf (tables 2 and 4). moreover, cyse2 added to the ruminal fluids decreased the concentration of c18:0 as well as the index of the final biohydrogenation to c18:0 compared with animal review, 2014, 1(3): 45-56 51 © 2014 conscientia beam. all rights reserved. the rf. current observations are also consistent with our recent in vitro studies that have reported that selenate or selenite added to the ruminal fluids containing lna reduced the capacity of the bacterial isomerization of c18-pufa and lowered the yield of the final biohydrogenation to c18:0 compared with the fluids with only lna [24]. interestingly, lna or/and cyse2 added to the ruminal fluids revealed an inconsistent effect on the index values of the intermediate biohydrogenation (table 4) involved in the formation of t11c18:1 (tva). we suggest that this inconsistent effect may be due to the fact that t11c18:1 is the substrate which is consumed during the final biohydrogenation. generally, the index values of the intermediate biohydrogenation to t11c18:1 were higher in the fluids containing lna and the higher or lower concentration of cyse2 compared with the ruminal fluids with only lna. on the other hand, our results suggest that the higher concentration of cyse2 in the fluids with lna usually stimulated the yield of elongation of c9c12c18:2 to c13c16c22:2 (i.e. the unsaturated fatty acids) compared with the incubated fluids containing only lna. surprisingly, cyse2 added to the ruminal fluids with lna decreased the concentration ratio of pufa to sfa (pufa/sfa) for incubation at all times from 12 hrs compared with the fluid containing lna (table 4). 5. conclusion in conclusion, cyse2, especially the higher concentration of cyse2, reduced the capacity of the biohydrogenation of ufa to c18:0 in the ruminal fluids. moreover, the higher concentration of cyse2 in the fluids with lna most effectively reduced the yield of the bacterial isomerization of lna to c9t11c15c18:3 and the formation of t11c18:1. our investigations revealed that cyse2 added to the fluids without or with lna reduced the accumulation of fatty acids in in vitro incubated ruminal fluids. 6. acknowledgements excellent sheep care and courteous assistance throughout the study were provided by mrs b. domańska and mrs g. oktaba. references [1] m. navarro-alarcon and c. cabrera-vique, "selenium in food and the human body: a review," sci. total envir., vol. 400, pp. 115-141, 2008. [2] c. thiry, a. ruttens, l. de temmerman, y.-j. schneider, and l. pussemier, "current knowledge in speciesrelated bioavailability of selenium in food," food chem., vol. 130, pp. 767–784, 2012. [3] d. t. juniper, r. h. phipps, e. ramos-morales, and g. bertin, "effect of dietary supplementation with selenium-enriched yeast or sodium selenite on selenium tissue distribution and meat quality in beef cattle," j. anim. sci., vol. 86, pp. 3100–3109, 2008. [4] j. b. j. van ryssen and g. e. schroeder, "effect of heat processing of protein sources on the disappearance of their selenium from mobile bags in the digestive tract of dairy cows," anim. feed sci. technol., vol. 107, pp. 15– 27, 2003. animal review, 2014, 1(3): 45-56 52 © 2014 conscientia beam. all rights reserved. [5] t. p. lyons and k. a. jacques, "science and technology in the feed industry," in proceedings of alltech’s seventeenth annual symposium, nottingham university press, nottingham, ng11 0ax, united kingdom, 2001, pp. 309-415. [6] d. m. driscoll and p. r. coperland, "mechanism and regulation of selenoprotein synthesis," annu. rev. nutr., vol. 23, pp. 17-40, 2003. [7] v. n. gladyshev, g. v. kryukov, d. e. fomenko, l. dolph, and d. l. hatfiel, "identification of trace element containing proteins in genomic databases," annu. rev. nutr., vol. 24, pp. 579-596, 2004. [8] a. buccioni, m. decandia, s. minieri, g. molle, and a. cabiddu, "lipid metabolism in the rumen: new insights on the lipolysis and biohydrogenation with an emphasis on the role of endogenous plant factors," anim. feed sci. technol., vol. 174, pp. 1–25, 2012. [9] m. kouba and j. mourot, "a review of nutritional effects on fat composition of animal products with special emphasis on n-3 polyunsaturated fatty acids," biochimie, vol. 93, pp. 13-17, 2011. [10] k. raes, s. de smet, and d. demeyer, "effect of dietary fatty acids on incorporation of long chain polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork meat: a review," animal feed sci. technol., vol. 113, pp. 199–221, 2004. [11] v. wijendran and k. c. hayes, "dietary n-6 and n-3 fatty acid balance and cardiovascular, health," annu. rev. nutr., vol. 24, pp. 597-615, 2004. [12] s. h. choi and m. k. song, "effect of c18-polyunsaturated fatty acids on their direct incorporation into the rumen bacterial lipids and cla production in vitro," asian-australasian j. anim. sci., vol. 18, pp. 512-515, 2005. [13] t. c. jenkins, r. j. wallace, p. j. moate, and e. e. mosley, "board-invited review: recent advances in biohydrogenation of unsaturated fatty acids within the rumen microbial ecosystem," j. anim. sci., vol. 86, pp. 397–412, 2008. [14] r. sieber, m. collomb, a. aeschlimann, p. jelen, and h. eyer, "impact of microbial cultures on conjugated linoleic acid in dairy products – review," int. dairy j., vol. 14, pp. 1-15, 2004. [15] m. doreau and a. ferlay, "effect of dietary lipids on nitrogen metabolism in the rumen: a review," livest. prod. sci., vol. 43, pp. 97-110, 1995. [16] i. kubo, h. muroi, m. himejima, y. yamagiwa, h. mera, k. tokushima, s. ohta, and t. kamikawa, "structureantibacterial activity relationships of anacardic acids," j. agr. food chem., vol. 41, pp. 1016-1019, 1993. [17] t. g. nagaraja, c. j. newbold, c. j. nevel, and d. i. demeyer, manipulation of ruminal fermentation. in: p.n. hobson, and c.s. stewart (eds.) the rumen microbial ecosystem: springer netherlands, 1997. [18] c. j. zheng, j.-s. yoo, t.-g. lee, h.-y. cho, y.-h. kim, and w.-g. kim, "fatty acid synthesis is a target for antibacterial activity of unsaturated fatty acids," febs lett., vol. 579, pp. 5157–5162, 2005. [19] m. szumacher-strabel, a. cieślak, and a. nowakowska, "effect of oils rich in linoleic acid on in vitro rumen fermentation parameters of sheep, goats and dairy cows," j. anim. feed sci., vol. 18, pp. 440-452, 2009. [20] d. jalč, s. kišidayová, and f. nerud, "effect of plant oils and organic acids on rumen fermentation in vitro," folia microbiol., vol. 47, pp. 171-177, 2002. [21] d. e. bauman, b. a. corl, and d. g. peterson, the biology of conjugated linoleic acids in ruminants. in: j.l. sebedio, w.w. christie, r.o. adlof, eds. advances in conjugated linoleic acid research vol. 2. champagign, illinois: aocs press, 2003. animal review, 2014, 1(3): 45-56 53 © 2014 conscientia beam. all rights reserved. [22] k. w. j. wahle, s. d. heys, and d. rotondo, "conjugated linoleic acids: are they beneficial or detrimental to health?," progress in lipid res., vol. 43, pp. 553–587, 2004. [23] m. czauderna, j. kowalczyk, and j. r. wallace, "selenite and selenate affected the fatty acid profile in in vitro incubated ovine ruminal fluid containing linoleic acid," j. anim. feed sci., vol. 21, pp. 477-492, 2012. [24] m. czauderna, j. kowalczyk, and m. marounek, "selenite and selenate affect the fatty acid profile in in vitro incubated ovine ruminal fluid containing linseed oil," czech j. anim. sci., vol. 58, pp. 328–341, 2013. [25] m. czauderna, j. kowalczyk, k. m. niedźwiedzka, i. wąsowska, and j. j. pająk, "the effect of selenium and linseed oil on growth of sheep and content of selected fatty acids in m. longissimus dorsi," j. anim. feed sci., vol. 13, pp. 303-306, 2004. [26] m. czauderna, j. kowalczyk, k. m. niedźwiedzka, i. wąsowska, j. j. pająk, e. bulska, and a. ruszczyńska, "the effect of linseed oil and selenium on the content of fatty acids and some elements in the liver and selected tissues of sheep," j. anim. feed sci., vol. 13, pp. 103-106, 2004. [27] m. czauderna, j. kowalczyk, and k. korniluk, "effect of dietary conjugated linoleic acid mixture and selenized yeast on concentrations of selected fatty acids and mineral elements in rats," arch. anim. nutr., vol. 61, pp. 135150, 2007. [28] k. korniluk, m. czauderna, j. kowalczyk, a. mieczkowska, m. taciak, and ľ. leng, "influence of dietary conjugated linoleic acid isomers and selenium on growth, feed efficiency, and liver fatty acid profile in rats," j. anim. feed sci., vol. 15, pp. 131-146, 2006. [29] h. traulsen, h. steinbrenner, d. p. buchczyk, l. o. klotz, and h. sies, "selenoprotein p protects low-density lipoprotein against oxidation," free radical res., vol. 38, pp. 123-128, 2004. [30] a. m. crespo, m. a. reis, and m. j. lanca, "effect of selenium supplementation on polyunsaturated fatty acids in rats," biol. trace elem. res., vol. 47, pp. 335-341, 1995. [31] g. demirel, a. m. wachira, l. a. sinclair, r. g. wilkinson, j. d. wood, and m. enser, "effects of dietary n-3 polyunsaturated fatty acids, breed and dietary vitamin e on the fatty acids of lamb muscle, liver and adipose tissue," brit. j. nutr., vol. 91, pp. 551-565, 2004. [32] w.-g. kim, r. h. liu, j. l. rychlik, and j. b. russell, "the enrichment of a ruminal bacterium (megasphaera elsdenii yj-4) that produces the trans-10,cis-12 isomer of conjugated linoleic acid," j. appl. microbiol., vol. 92, pp. 976–982, 2002. [33] e. wina, s. muetzel, e. hoffmann, h. p. s. makkarc, and k. becker, "saponins containing methanol extract of sapindus rarak affect microbial fermentation, microbial activity and microbial community structure in vitro," anim. feed sci. tech., vol. 121, pp. 159-174, 2005. [34] x. z. li, s. h. choi, g. l. jin, c. g. yan, r. j. long, c. y. liang, and m. k. song, "linolenic acid in association with malate or fumarate increased cla production and reduced methane generation by rumen microbes," asian-aust. j. anim. sci., vol. 22, pp. 819–826, 2009. [35] a. troegeler-meynadier, m. c. nicot, c. bayourthe, r. moncoulon, and f. enjalbert, "effects of ph and concentrations of linoleic and linolenic acids on extent and intermediates of ruminal biohydrogenation in vitro," j. dairy sci., vol. 86, pp. 4054–4063, 2003. [36] c. g. harfoot and g. p. hazelwood, lipid metabolism in the rumen. in: the rumen microbial ecosystem. p.n. hobson, and c.s. stewart (eds). london, uk: chapman & hall, 1997. [37] j. t. lin and t. a. mckeon, hplc of acyl lipids. new york: hnb publishing, 2005. animal review, 2014, 1(3): 45-56 54 © 2014 conscientia beam. all rights reserved. table-1. the scheme of in vitro experiments on ovine ruminal fluids1 group additive additive concentration number (n) of fluid samples individually analysed in every time2 rf3 water n=6 l lna 1.67 mg/ml n=6 sel cyse2 1.34 g/ml n=5 seh cyse2 3.33 g/ml n=5 l-sel cyse2 lna 1.33 g/ml 1.67 mg/ml n=6 l-seh cyse2 lna 3.33 g/ml 1.67 mg/ml n=6 1 1 ml of ovine ruminal fluids was added to 0.2 ml of water solution containing either solely -linolenic acid (lna), seleno-cystine (cyse2) at different concentrations (l low; h high), or their mutual combinations 2 n – ovine ruminal fluid samples collected from n sheep at different times and individually analyzed. all results in tables 2-4 are mean values from n fluid samples individually analysed in every time 3 rf = the negative control group (in vitro incubated 1ml of the ovine ruminal fluid with 0.2 ml of water (the control ruminal fluid) table-2. effects1 of two levels (low, l; high, h) of se-cystine (cyse2) on metabolism of lna and the concentration of selected saturated fatty acids (sfa) and the concentration sum of sfa (sfa) (g/ml) in in vitro incubated ruminal fluids group and in vitro incubation time, hrs c 1 4 :0 c 1 5 :0 c 1 6 :0 c 1 8 :0 c 2 0 :0 c 2 2 :0  s f a rf2 0 3.8 l 0 3.4a sel 0 3.5a seh 0 3.7a l-sel 0 3.7a l-seh 0 3.7a 23.5 24.0a 24.7a 24.2a 24.6a 24.7a 66 72a 66a 69a 74a 73a 93 99a 97a 94a 100a 100a -3 4.3 0.7bb 4.5a 4.6a 0.8b 191 199ab 195ab 195ab 203ab 202ab rf 6 4.4 l 6 5.1ab sel 6 4.5a seh 6 4.6a l-sel 6 5.4b l-seh 6 5.3ab 25.9 25.6a 24.4a 24.6a 25.8a 25.2a 79 99ab 76a 77a 103b 98ab 105 101a 106a 105a 104a 100a 0.9 7.8b 4.9 1.4b 4.7a 4.7a 2.7b 220 239abc 216abc 216abc 238bc 231abc rf 12 5.4 l 12 5.5b sel 12 5.3ab seh 12 5.3ab l-sel 12 5.9b l-seh 12 6.4b 25.6 25.3a 24.7a 25.0a 26.6a 25.3a 94 102ab 90ab 91ab 106b 104b 127 101a 121b 119ab 104ab 102a 1.1 6.3b 1.0aa 10.9b 4.8bb 3.2 2.8b 4.2a 4.4a 4.4a 2.6b 256 243bc 246bc 244bc 258bcd 245bcd rf 18 5.7 l 18 5.9b sel 18 6.1b seh 18 5.9b l-sel 18 6.3b l-seh 18 6.4b 25.1 25.8a 25.6a 24.7a 25.2a 25.6a 95 105b 98ab 96ab 107b 111b 132 100a 130b 124ab 104ab 102a 1.0 4.4b 1.0aa 1.0aa 8.4b 8.9b 4.5 9.0c 4.4a 4.5a 6.3ac 6.1ac 263 250cd 265cd 257cd 257cd 260cd rf 24 5.8 l 24 6.4b sel 24 6.2b seh 24 6.0b l-sel 24 6.5b l-seh 24 7.0b 26.9 26.3a 25.4a 24.6a 24.4a 26.5a 102 106b 100ab 99ab 106b 111b 142 101a 135b 131ab 101a 106ab 2.0 6.8b 1.9aa 1.8a 3.7abb 3.9abb 3.8 12.8ac 4.1b 3.4ab 10.3c 5.9a 283 260cd 273cd 266cd 252bcd 260cd 1 means in columns with the different letters are significantly different at (a,b)p < 0.05 or at (a,b)p < 0.01 2 rf – in vitro incubated ruminal fluids without the additives (the control ruminal fluid) 3 below the quantification limit (loq); loq was defined as 10 times the average noise level (loq was determined according to lin and mckeon [37]) animal review, 2014, 1(3): 45-56 55 © 2014 conscientia beam. all rights reserved. table-3. effects1 of two levels (low, l; high, h) of se-cystine (cyse2) on metabolism of lna and the concentration of selected monounsaturated fatty acids (mufa) and the concentration sums of cmufa (cmufa)2 and tc18:1 (tc18:1)3 (g/ml) in in vitro incubated ruminal fluids group and in vitro incubation time, hrs c9 c 1 4 :1 c 9 c 1 6 :1 c9 c 1 8 :1 t 9 c 1 8 :1 t1 1 c 2 1 8 : 1  cm u f a  tc 1 8 :1 rf 0 4.5 l 0 4.4a sel 0 4.4a seh 0 4.6ab l-sel 0 4.5a l-seh 0 4.5ab 4.5 1.4b 4.4ad 4.6ad 2.5ab 2.6ab 7.7 -4 7.6a 8.2a 2.8ab 2.5ab 3.8 2.9a 6.0b 3.9ab 1.9 2.2a 16.7 5.8bb 16.5a 17.4a 9.8b 9.6b 5.8 2.9ab 6.0a 6.1a rf 6 5.5 l 6 6.9ab sel 6 5.3ab seh 6 5.5ab l-sel 6 7.1b l-seh 6 6.9ab 5.5 6.1cd 5.2cd 5.2cd 6.4cd 6.0cd 8.4 16.1bc 7.3a 7.8a 13.9bc 14.7bc 5.3 7.6b 8.2bc 3.1a 2.3 7.3b 9.3ab 3.2a 19.4 29.1a 17.8a 18.5a 27.4ac 27.6ac 7.6 7.3a 7.6a 8.2a 9.3a 6.3a rf 12 6.0 l 12 7.2b sel 12 5.8ab seh 12 6.0ab l-sel 12 7.5b l-seh 12 7.2b 6.4 4.8ad 6.0cd 6.1cd 6.8cd 6.9cd 6.3 16.8bc 5.9a 6.8a 17.3bc 16.9bc 6.6 6.2b 7.2b 4.0 9.2b 4.2a 4.0a 9.9b 9.4a 18.7 28.8cc 17.7a 18.9a 31.7cc 31.0cc 10.5 9.2a 10.4a 11.2a 9.9a 9.4a rf 18 6.2 l 18 7.5b sel 18 6.5ab seh 18 6.3ab l-sel 18 7.6b l-seh 18 7.5b 7.7 7.7cd 6.6cd 6.3cd 7.0cd 7.1cd 2.5 17.2bc 3.1ab 3.9ab 17.3bc 14.4bc 5.9 2.1a 6.2b 6.8b 2.6a 3.9 15.1bc 4.3a 5.3a 15.5bc 14.1bc 16.5 32.4cc 16.2a 16.5a 31.9cc 29.0cc 9.8 17.2ba 110.4a 12.0a 15.5ba 16.7ba rf 24 6.7 l 24 8.0b sel 24 6.4ab seh 24 6.4ab l-sel 24 7.8b l-seh 24 8.0b 9.2 7.0cd 6.6cd 6.4cd 7.5cd 7.3cd 1.0 17.0bc 1.9ab 2.6ab 16.3bc 11.9bc 6.2 4.6ab 3.7a 3.1a 3.0a 15.1d 1.1 19.8bc 5.7ab 6.2b 19.8bc 14.9bc 16.9 32.0cc 14.9a 15.4a 31.6cc 27.1ac 7.3 24.4bd 9.3a 9.2a 22.8bd 30.0ccd 1 means in columns with the different letters are significantly different at (a,b)p < 0.05 or at (a,b)p < 0.01; all abbreviations as in table 2 2 cmufa = c9c14:1 + c9c16:1 + c9c18:1 3 tc18:1 = t9c18:1 + t11c18:1 (tva) 4 below the quantification limit (loq) animal review, 2014, 1(3): 45-56 56 © 2014 conscientia beam. all rights reserved. table-4. effects1 of two levels (low, l; high, h) of se-cystine (cyse2) on metabolism of lna and the concentrations of t11c15c18:2 (tcc18:2), c9t11c15c18:3 (ctcc18:3), t9t11c15c18:3 (ttcc18:3), c13c16c22:2 (c22:2), the concentration sums of pufa (pufa) and all assayed fatty acids (fa), the concentration ratio of pufa to sfa (pufa/sfa) and the indexes of the initial, intermediate and final biohydrogenation in in vitro incubated ruminal fluids 1 means in columns with the different letter are significantly different at (a,b)p < 0.05 or at (a,b)p < 0.01; all abbreviations as in table 2 2 below the quantification limit (loq) 3 the index of the initial biohydrogenation of c9t11c15c18:3 (ctcc18:3) and t9t11c15c18:3 (ttcc18:3) to t11c15c18:2 (tcc18:2) (indextcc18:2 = tcc18:2/(tcc18:2 + ctcc18:3 + ttcc18:3) 4 the index of the intermediate biohydrogenation of t11c15c18:2 to t11c18:1 (tva) (indextva= t11c18:1/(t11c18:1+t11c15c18:2) 5 the index of the final biohydrogenation of t11c18:1 to c18:0 (indexc18:0 = c18:0/(c18:0+t11c18:1) views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 1 © 2023 conscientia beam. all rights reserved. impact of led lighting color on productive and behavioral characteristics of the broiler chickens albert r reyad1 gala abou khadiga1 alaa e elkomy1,2+ ibraheim m abaza1 farid n k soliman3 1faculty of desert and environmental agriculture, matrouh university, matrouh, egypt. 1email: albertromil80@gmail.com 1email: galal.aboukhadiga@mau.edu.eg 1email: ibrahimabaza@mau.edu.eg 2arid lands cultivation research institute, city of scientific research and technology application, borg el-arab, egypt. 1,2email: alaa_elkomy@yahoo.com 3department of animal and poultry production, faculty of agriculture, alexandria university, egypt. 3email: nassif08@yahoo.com (+ corresponding author) abstract article history received: 6 february 2023 revised: 12 april 2023 accepted: 28 april 2023 published: 9 may 2023 keywords behavior broiler led light color. the present study was conducted to investigate the effect of color (white and bluegreen) of led lighting on the productive, carcass and behavior traits of cobb broiler chickens. total of 200 oneday-old unsexed chicks were used, and divided into two pens/groups (100 birds of each with 25 birds of each replicate), at stocking density of 8.7 bird/ square meters. first pen used for led white color and second pen for led bluegreen mix color light. the results showed that the birds exposed to blue-green light had significant higher (p≤0.01) bw, dbwg and fc values of the whole experimental period compared to those exposed to white color. however, the light color had no significant effect on fcr and mr measurements with average values 1.44 and 0.50%, respectively. the birds exposed to blue-green light had significant higher pre-slaughter live bw and carcass weights (p≤0.01) compared to those exposed to white color. the birds exposed to blue-green light had higher insignificant dressing percentage compared to those exposed to white color. the weekly behavior results showed highly significant differences (p≤0.01) among weeks for aggressiveness and immobility activities, while it being insignificant for pecking activity. the correlation value between immobility and five-week bw of birds reared under blue-green light was the only significant value (0.42) among all studied values. in conclusion, the results indicated that cobb broilers were calmer under blue-green light compared to those reared under white light, which contributed in more better performance traits. contribution/originality: lighting plays an important role in the behavior and productivity of broiler chicks. led bulbs are considered one of the modern lighting technologies, so this study was conducted to test the led lighting lamps on the productivity of broiler chicks to improving productivity and saving the high cost of electrical energy when using ordinary lamps. 1. introduction the broiler production sector is characterized by a higher feed conversion rate comparison with other animals, where, each one kg of meat needs 2.0-2.5 kg feed, meanwhile, each one kg of red meat needs more than 7 kg feed. also, it has a higher economic return due to its short production cycle. the capital cycle of broiler production can be repeated seven times a year, and needs small area compared to other animals [1]. moreover, the changing animal review 2023 vol. 10, no. 1, pp. 1-11. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v10i1.3360 © 2023 conscientia beam. all rights reserved. https://orcid.org/0000-0002-7203-7000 mailto:albertromil80@gmail.com mailto:galal.aboukhadiga@mau.edu.eg mailto:ibrahimabaza@mau.edu.eg mailto:alaa_elkomy@yahoo.com mailto:nassif08@yahoo.com https://www.doi.org/10.18488/92.v10i1.3360 animal review, 2023, 10(1): 1-11 2 © 2023 conscientia beam. all rights reserved. patterns of human resource usage and food consumption have profoundly impacted the earth’s biosphere, broiler chickens are one such distinctive signs of this impact. however, broiler chickens now unable to survive without human intervention [2]. breeders must adopt new technologies to meet this demand that will enable them to increase production at lower cost and with minimal stress on the environment. most of these production techniques focus on enhancing traditional inputs such as water, air, nutrients and housing. lighting and its characteristics need further clarification as a contributing factor to broiler productivity. factors involved in light management for poultry include light source, intensity, duration, uniformity, and wavelength/color [3]. artificial light in broiler production has a role in improving immunity [4, 5]. increasing the immune response can reduce the risks of diseases and the costs of their treatment, which is reflected in higher levels of survival and lower production costs, which supports profitability [6]. by choosing the optimal light source and taking advantage of the unique spectral requirements of poultry, it is possible to maximize growth and efficiency, while, reducing stress and fostering ideal behavior [7]. recently, light emitting diode (led) lamps have been interesting in poultry production sector because of their more durable, and retain the light intensity for considerably longer periods [8], high energy efficiency [9], long operating life, availabile in different wavelengths, low electricity consumption, provides adequate illumination, which, led to low rearing cost [10]. the present study was designed to investigate the effect of color (white and blue-green) of led lighting on the productive, carcass and behavior traits of cobb broiler chickens. 2. material and methods 2.1. experimental design and management the present study was conducted at private farm in marsa matrouh city from 10 april to 14 may 2020. the aim of the study was to investigate the effect of color (white and blue-green) of led lighting on the productive, carcass and behavior traits of cobb broiler chickens. total of 200 oneday-old unsexed broiler chicks (cobb strain) were purchased from al-watania poultry company. the average weight of the chick at oneday-old was 42 ± 3.00 grams. the experiment was conducted using two open pens; each has 3.3 × 3.5 × 3.10 m for length, width and height, respectively. each pen divided to four compartments (replicates), with repeated measures of 1.75x1.65 m. for length and width, respectively. the birds were divided into two groups (100 birds of each), then divided to 4 subgroups/replicates (25 birds of each), at stocking density of 8.7 bird/ square meters. a 70 cm high guard wire was used to separate the four replicates within each pen. light emitting diode (led) lamps (nine watts and 900 lumen) were installed in both pens. first pen used for led white color (650nm) light and another pen for led bluegreen mix color light (430-565nm). lamps were distributed as the distance between the lamps is twice the distance between the lamp and the wall, to ensure uniformity of illumination intensity. the lighting intensity was 25 lux, measured by lux meter each week. the lamps were cleaned from dust weekly for maintaining the intensity of light. the birds have the same managerial procedures in both pens throughout the experimental period (34 days of age). 2.2. studied traits live body weight (bw) and body weight gain (bwg) (as g) (for each bird) were recorded weekly per each treatment group. feed consumption (fc) (as g) and feed conversion ratio (fcr) (as g feed intake /g body weight gain) were recorded for each replicate of each treatment. daily mortality of chicks (mr) was recorded and calculated as a percentage for both treatments for the whole experimental period. at the end of the experiment, five birds from each replicate of each treatment were randomly chosen, weighed individually and slaughtered with a sharp knife by cutting the jugular veins of the neck. upon verification of complete bleeding, the feathers, viscera and other uneaten parts were removed and the carcass weight animal review, 2023, 10(1): 1-11 3 © 2023 conscientia beam. all rights reserved. of each bird measured. the dressing percentage expressed as carcass weight divided on live body weight was measured. each carcass was cut into two parts (breast and thigh). the breast (half of the whole breast) and thigh (single thigh + drumstick) were weighed using a sensitive digital scale to the nearest 0.01 gram, and expressed as a relative to live body weight. also, the gizzard, liver, heart and kidney were weighed, and expressed as a relative to live body weight. 2.3. behavior traits bird behavior was assessed on the basis of expression, where five birds were randomly selected from each replicate and painted black color on their backs weekly. the behavior of the birds was recorded using samsung video camera with specifications: • sensor type: complementary metal-oxide semiconductor (cmos). • video resolution: 1920×1080 pixels. • video fps: 30 fps (frames per second). the camera was placed at a height of 250cm to see the full pen. the registration of the behavior started on the fifth day. the behavior activities (immobility, aggressiveness and pecking) have been recorded as number/bird/hour for one hour each day between 10 pm to 11 pm. aggressiveness: categorized as a bird attacking another bird, as well as pecking the feathers and bodies of other birds, and attempting to cause injuries [11, 12]. immobility: categorized as a bird that transited from a state of movement to a state of sitting and stability, meaning that the bird does not eat, drink or perform any action or activity, and that behavior reflects comfort [11, 13-15]. pecking: categorized as a bird that pecking litter, walls, and equipment, not other bird [16]. 2.4. statistical analysis in order to assess the effect of wavelengths of lighting on the performance of broiler chickens, data of all variables were subjected to analyses of variance (anova) using the general linear models (glm) procedure [17]. significant differences among means were evaluated using duncan multiple range test [18]. in addition, simple correlation (pearson) values were estimated [17] between behavior and performance traits. 3. result and discussions 3.1. performance traits at the end of the experimental period, the results of table 1 showed significant effect between studied light treatments on five-week body weight (bw), daily body weight gain (dbwg), and feed consumption (fc) values, while it being in significant on feed conversion ratio (fcr) and mortality rate (mr) values. table 1. mean and standard error (µ±se) of performance traits of cobb broiler strain exposed to different ldl colors during fattening period. age (week) treatments overall mean p-value white light blue-green light 5-wk bw 44.51 ±2177.20b 46.24 ±2317.97a 32.60 ± 2247.58 0.03** 0-5wk dbwg 5.47 ± 61.01b 1.32 ±65.03a 0.93 ±63.02 0.03** 0-5wk fc 3068.27b ± 3.28 3115.17a ± 3.57 3091.72 ± 3.23 0.00** 0-5wk fcr 1.48 ± 0.03 1.40 ± 0.03 1.44 ± 0.02 0.11ns 0-5wk mr 0.60 ± 0.24 0.40 ± 0.24 0.50 ± 0.17 0.37ns note: ns: non significant, **: p<0.01, mean values with different superscripts within a row differ significantly. the birds exposed to blue-green light had significant higher bw, dbwg and fc values of the whole experimental period at (2317.97, 65.03 and 3115.17g, respectively) compared to those exposed to white color animal review, 2023, 10(1): 1-11 4 © 2023 conscientia beam. all rights reserved. (2177.20, 61.01, 3068.27g, respectively). however, the overall mean of fcr and mr values for both treatments were 1.44 and 0.50%, respectively. the findings of bw and dbwg are in agreement with the results of mosa, et al. [19]; senaratna, et al. [20] and balabel, et al. [21] who found that blue – green light among other light colors showed to be enhancer for growth bw in their studies with ross 308, cobb and cobb broiler chickens, respectively. moreover, broilers chickens reared under blue and green monochromatic light experienced increased bw compared to broilers exposed to white or red light [22-25]. moreover, nelson, et al. [26] found that ross 708 broilers reared under white led supplemented with blue/green light had higher overall day 45 live body weight than birds reared under only white led light. in contrast, the red light showed to has higher preference and improved bwg compared to green, blue and white color lights [27]. however, other studies have reported no effect of light wavelength on bw and bwg [28, 29]. to better understand the increased growth of broilers reared under green light, liu, et al. [30] found that satellite cell mitotic activity increased under green light compared to blue and red light. however, both blue and green lights had improved as insulin-like growth factor levels compared to red light. in respect of blue lighting, asih, et al. [31] illustrated that it makes the broiler chicken quieter and have less activity after meal so the excess energy can be converted into feeding, hence enhance the growth rate. the present fc and fcr results are in consistent with several studies indicate that light wavelength seems to stimulate broiler growth without significant effects on total fcr [15, 28, 29, 32, 33]. in addition, mohamed, et al. [25] showed that avian 48 broiler chicks reread under green and blue lights has significant higher fc and lower fcr at 40 days of age compared to those reread under white color light. also, balabel, et al. [21] found that the total fc were significantly lower in blue and/or g-bl groups compared to white and green color groups (4676, 4590g, 4830 and 4795g, respectively), with significant decreasing effect also on fcr values (1.82, 1.75, 2.38, 1.98, respectively). melatonin hormone synthesized by the pineal gland, retina and gastrointestinal tract, whose main function is to determine the periodicity of fc, as well as to induce behaviors associated with the nightday cycle [34]. in addition, asih, et al. [31] showed that broilers treated with the blue lighting for 24-hour or for 12-hour have significant longer feeding duration, lower feeding frequency, and lower fcr when compared to those of chickens with control lighting. the mr results of the present study confirms the previous finding of rozenboim, et al. [35]; cao, et al. [32] and ke, et al. [33] who reported that blue light seems to stimulate broiler growth at the end of the production cycle without significant effects on mortality rate. kasem [36] found that broiler cobb chicks reared under mixed greenblue and blue light has the lower mortality rate compared to white light group. table 2. mean and standard error (µ±se) of carcass traits of cobb broiler strain exposed to different ldl colors during fattening period. age treatments overall mean p-value white light blue-green light body weight 77.75 ±2388.00b 54.87 ±2624.25a 50.63 ±2506.13 0.02** carcass weight 60.47 ±1814.25b 41.05 ±2014.75a 39.48 ±1914.50 0.01** dressing (%) 0.61±75.35 0.0.50±76.00 0.39±76.40 0.27ns breast (%) 30.36 ± 0.60 30.26 ± 0.41 30.31 ± 0.36 0.79 ns thigh (%) 19.21 ± 0.21 19.75 ± 0.39 19.48 ± 0.28 0.34 ns liver (%) 2.55 ± 0.15 2.21 ± 0.08 2.38 ± 0.09 0.05* gizzard (%) 1.86 ± 0.06 1.72 ± 0.05 1.79 ± 0.04 0.07 ns heart (%) 0.48 ± 0.02 0.46 ± 0.02 0.47 ± 0.01 0.51 ns kidney (%) 0.53a ± 0.01 0.50b ± 0.01 0.52 ± 0.01 0.02** note: ns: non significant, *: p<0.05, **: p<0.01, a.b,c mean values with different superscripts within a row differ significantly. animal review, 2023, 10(1): 1-11 5 © 2023 conscientia beam. all rights reserved. however, balabel, et al. [21] found that mortality rate of cobb broiler chicks has significant influence among light color treatments (5.00, 3.33, 3.33 and 1.67% for white, green, blue and blue-green lighting, respectively). abdel-azeem and borham [37] revealed that ross308 broiler chickens exposed to led-blue light or led-green light during 7 to 35 days of age showed significant higher livability percentages than those exposed to other light colors (incandescent light, red, white and mixed led lights) groups (95.12, 94.43, 86.59, 92.51, 88.50 and 89.20%, respectively). the findings of carcass weight and dressing percentages of cobb broiler chickens (table 2) showed significant differences between studied light treatments for pre-slaughter live bw and carcass weight values, however it being insignificant for dressing percentage values. the birds exposed to blue-green light had significant higher live bw and carcass weights (2624.25 and 2388.00g, respectively) compared to those exposed to white color (2014.75 and 1814.25g, respectively). regardless the insignificant differences for dressing percentages values, the birds exposed to blue-green light had higher dressing percentage compared to those exposed to white color (76.00 and 75.35%, respectively). the relative breast and thigh + drumstick weights of the cobb broiler (table 2) showed insignificant differences between studied light treatments for relative breast and thigh + drumstick weights values, with overall mean were 30.31 and 19.48%, respectively. the relative weights of liver, gizzard and heart weight of cobb broiler chickens were insignificant between both studied lights, with overall mean were 2.38, 1.79 and 0.47%, respectively. however, the cobb broiler chickens reared under white light has significant higher relative kidney weight compared to those reared under blue-green light (0.53 and 0.50%, respectively). the present results of dressing percentage values are consistent with the findings of santana, et al. [28] and olanrewaju, et al. [29] who reported no effect of light color on carcass yield at different slaughter ages. moreover, nelson, et al. [26] showed that straight run ross 708 broilers reared under white led supplemented with blue/green light had higher carcass yield more than birds reared under only white led light. in addition, sayin, et al. [38] explained that the broiler chicks raised under mixed blue and green lighting recorded a higher body weight than birds raised under monochromatic light (white, blue, green) at the age of 42 and 56 days. however, cao, et al. [32] found a greater carcass yield for broiler chickens subjected to blue led lighting. in contrast, mosa, et al. [19] showed, regardless stocking density, that the carcass weight (1406.44g) and dressing percentage (74.16%) were significantly higher at 35th day in ross 308 broilers exposed to blue – green mix light compared to other color treatments (white, red, blue and green lights). mohamed, et al. [25] showed that avian 48 broiler chicks reread under green and blue lights has significant higher dressing percentage at 40 days of age compared to those reread under white color light (75.10, 75.90 and 71.30%, respectively). divergence among our results to the literature findings could be related to genetic strain, age, management and environmental conditions. similar to the present breast and thigh + drumstick weights results, santana, et al. [28] found insignificant differences for cuts percentage (breast and thigh + drumstick) among light treatments (red-led, blue-led and fluorescent bulb) light. also, the present results indicating that breast have highest portion among cuts up of broiler carcass, which are in line with all studies in that field. however, cao, et al. [32] found a greater breast, and thigh yield for broiler chickens subjected to blue led lighting. liu, et al. [30] found that birds reared under green light had higher breast muscle weight than those reared under blue, red, and white light. the present organ results are in agreement with the findings of mosa, et al. [19] who studied different light colors (red, blue, green and blue-green lights) and observed insignificant differences effect on relative liver and gizzard weights of ross 308 broiler chicks at 35 days of age, while positive effect of heart percentage was recorded in broilers reared under green light (0.64%), with no effect for stocking density in that respect. however, mohamed, et al. [25] showed that avian 48 broiler chicks reread under green and blue lights has significant lower relative animal review, 2023, 10(1): 1-11 6 © 2023 conscientia beam. all rights reserved. liver weight at 40 days of age compared to those reread under white color light (0.960, 0.958and 1.24 %, respectively). the results of behavior activities of cobb broiler strain (table 3) showed highly significant differences for all studied behavior traits. the results observed significant lower aggressiveness and pecking activities, while significant higher immobility activity for chicks reared under mixed green – blue light color (12.64, 103.86 and 170.07 number/bird/hour, respectively) compared to the corresponding values recoded for those reared under white light color (38.43, 464.29 and 113.79 number/bird/hour, respectively). table 3. mean and standard error of some behavior activities (number/bird/hour) of cobb broiler strain exposed to different ldl colors during fattening period. activities aggressiveness immobility pecking treatments white greenblue 38.43a ± 5.81 12.64b ± 3.48 113.79b ± 7.34 170.07a ± 6.31 464.29a ± 56.21 103.86b ± 34.21 p-value 0.00 0.00 0.00 overall average 25.54 ± 3.78 141.93 ± 6.12 284.07 ± 40.66 week intervals 1st 2nd 3rd 4th 5th 64.00a ± 12.54 45.57b ± 8.87 22.57c ± 6.36 10.43c ± 3.16 7.40c ± 2.25 89.00b ± 14.53 134.71a ± 12.49 157.07a ± 14.87 135.57a ± 10.21 160.90a ± 7.99 329.00 ± 133.06 361.86 ± 89.18 379.57 ± 98.88 173.57 ± 54.41 178.20 ± 82.35 p-value 0.00 0.00 0.76 overall average 25.54 ± 3.78 141.93 ± 6.12 284.07 ± 40.66 note: means in the same column having different superscripts in certain effect are significantly different (p≤0.05). aggressiveness: categorized as a bird attacking another bird, as well as pecking the feathers and bodies of other birds, and attempting to cause injuries. immobility: categorized as a bird that transited from a state of movement to a state of sitting and stability. pecking: categorized as a bird that pecking litter, walls, and equipment, not other bird. the cobb broiler chickens in the present study are significantly less active under mixed blue green light compared to white light. these results are consistent with the findings of cao, et al. [32]; cao, et al. [22]; liu, et al. [30]; mendes, et al. [39]; xie, et al. [40]; senaratna, et al. [27]; abu tabeekh and shawkat [11]; hesham, et al. [15] and mohamed, et al. [41] in their comparative studies of different light colors, who found that blue and/or green lights helped to regulate aggressiveness and other related behaviors, inducing calm broiler chickens, thereby providing optimum performance. sultana, et al. [13] pointed out that the red and red-yellow light activates movements and fear response in broiler chicken, while blue and green/blue keep broilers calmer. kasem [36] showed that the rest and sleep time of cobb chicks increase under mixed green blue and blue light color groups compared to white light group. khaliq, et al. [42] revealed that birds reared under blue and green light were calmer and more relaxed while as those reared under red or yellow light exhibited aggressiveness. abdel-azeem and borham [37] showed that ross-308 broiler chickens were calmer under led-blue light with 10 birds /m2 in broiler house which is preferable to other colors (red, green and white) and densities. franco, et al. [43] also showed that broiler chickens at the age of 33 to 34 days spent more time resting under blue light. the results of weekly behavior activities (table 3) showed highly significant differences among weeks for aggressiveness and immobility activities, while it being insignificant for pecking activity. regardless the color of light, the current results showed that aggressive activity has descending manner with age (64.00, 45.57, 22.57, 10.43 and 7.44 number/bird/hour for 1st, 2nd, 3th, 4th and 5th week, respectively). however, there is a swinging trend in immobility values with age activity, but in general it increases significantly, since the 1st week showed significant lesser ones. regard to the pecking activity, although there are no significant differences among weeks, the fourth and fifth weeks are the least effective for this activity. current behavioral results have found that cobb broiler chickens become calm with the advance of age; these findings are in line, as has been shown in numerous previous studies [e.g., [44-48]] they reported that the broilers animal review, 2023, 10(1): 1-11 7 © 2023 conscientia beam. all rights reserved. have been found to become increasingly inactive with age. sultana, et al. [13] showed that age affected most behavioural patterns. the ross×ross 308 broiler chicks, regardless the color of lighting, recorded 31.07, 31.99, 34.62, 38.75 and 40.56 minute/hour during for sitting and 28.94, 23.33, 26.99, 16.89and 11.89 n/bird/h for ground pecking during 1st, 2nd, 3th, 4th and 5th weeks of age, respectively. the rapid growth of broilers' breast muscles moves the center of body gravity forward and the legs outward, that produce a gait pattern is probably inefficient and tiring [49]. in addition, broilers may find walking painful [50] because they are increasingly prone to leg disorders [51]. differences among studies in this area have been reported to differences in breed, age, diet, feeding methods, litter, social rank, light (quality, intensity, photoperiod, and color), record method of observations, duration of exposure to light, flock size/stocking density, experiment procedures and so on. also, morphological factors such as comb type, plumage pattern and color. thus, the behavior of chickens is a function of interaction among genes, phenotypes, and the environment. table 4. phenotype correlation (pearson) values between behavior traits and some performance traits of cobb broiler strain reared under white and blue-green light. treatments behaviour activities carcass weight dressing percentage bw 5wk dbwg 0-5wk fc 0-5wk fcr 0-5wk white light aggressiveness -0.288 -0.243 -0.024 -0.147 -0.280 0.116 immobility -0.201 0.085 0.350 0.101 0.079 -0.162 pecking -0.242 0.308 0.181 0.161 -0.144 -0.210 blue-green light aggressiveness -0.077 -0.163 -0.214 -0.082 -0.190 0.039 immobility -0.032 -0.012 0.419* 0.159 0.008 -0.187 pecking -0.156 0.088 0.060 -0.011 -0.216 -0.054 note: *significant at (p≤0.05). aggressiveness: categorized as a bird attacking another bird, as well as pecking the feathers and bodies of other birds, and attempting to cause injuries. immobility: categorized as a bird that transited from a state of movement to a state of sitting and stability. pecking: categorized as a bird that pecking litter, walls, and equipment, not other bird. the results of phenotype correlation values (table 4) between studied behavior traits and some performance traits of cobb broiler strain reared under white and blue-green light, showed that all the correlation values of birds reared under white light has insignificant negative and positive values. the values of aggressiveness with all studied performance traits were negative, except with zero-five-week fcr it being positive. this result indicated that the increase of aggressiveness activity has insignificant reduction effect on all studied performance traits, whereas it increased zero-five-week fcr (positive value, 0.12). in addition, the increase of immobility and pecking activities decreased zero-five-week fcr (negative values, -0.16 and -0.21, respectively). also, both later activities have positive correlation values with five-week bw and zero-five-week dbwg traits. this result indicated that the increase of immobility and pecking activities increase these traits. on the other hand, the phenotype correlations of behavior traits and performance traits of birds reared under blue-green light has insignificant negative and positive values, except the correlation value between immobility activity and five-week bw trait it being significant (0.42). this result indicated that the increase of immobility activity increases significantly the five-week bw of the birds reared under blue-green light. also, the behavior traits have the same trend of correlation values with zero-five-week fcr traits, which revealed that the increase of aggressiveness activity increase zero-five-week fcr (0.04), whereas the increase of immobility and pecking activity decrease zero-five-week fcr (-0.19 and -0.05, respectively). most studies in literature were focused on feeding behavior traits and their relationship with live performance traits in broilers [e.g., [52-54]] and duck [55]. however, the results of phenotypic correlations in the present study support the previous finding of hakan and ali [56] who showed that shorter wavelength had positive effect on broiler performance compared to higher wavelength. also, tickle, et al. [57] found that locomotion is relatively energetically expensive in cobb500 broilers. animal review, 2023, 10(1): 1-11 8 © 2023 conscientia beam. all rights reserved. 4. conclusion the present results indicated that cobb broilers were calmer under blue-green light compared to those reared under white light, which contributed in better performance traits. this result encourages the use of mixed bluegreen lighting to raise broiler chicks in an appropriate environment and supports the welfare of birds. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. authors’ contributions: all authors contributed equally to the conception and design of the study. references [1] n. d. wahyono and m. m. d. utami, "a review of the poultry meat production industry for food safety in indonesia," presented at the iop conference series: journal of physics: conference series no. 953, 2018. [2] c. e. bennett et al., "the broiler chicken as a signal of a human reconfigured biosphere," royal society open science, vol. 5, no. 12, p. 180325, 2018. https://doi.org/10.1098/rsos.180325 [3] h. ç. akyüz and e. onbaşilar, "light wavelength on different poultry species," world's poultry science journal, vol. 74, no. 1, pp. 79-88, 2018. https://doi.org/10.1017/s0043933917001076 [4] h. bayraktar, a. altan, and c. seremet, "the effects of spot lighting on broiler performance and welfare," journal of animal and veterinary advances, vol. 11, no. 8, pp. 1139-1144, 2012. https://doi.org/10.3923/javaa.2012.1139.1144 [5] r. blatchford, g. archer, and j. mench, "contrast in light intensity, rather than day length, influences the behavior and health of broiler chickens," poultry science, vol. 91, no. 8, pp. 1768-1774, 2012. https://doi.org/10.3382/ps.201102051 [6] h.-s. seo et al., "effects of various led light colors on growth and immune response in broilers," the journal of poultry science, vol. 53, no. 1, pp. 76-81, 2015. https://doi.org/10.2141/jpsa.0150046 [7] g. s. archer, "comparison of incandescent, cfl, led and bird level led lighting: growth, fear and stress," international journal of poultry science, vol. 14, no. 8, pp. 449-455, 2015. https://doi.org/10.3923/ijps.2015.449.455 [8] n. khan and n. abas, "comparative study of energy saving light sources," renewable and sustainable energy reviews, vol. 15, no. 1, pp. 296-309, 2011. https://doi.org/10.1016/j.rser.2010.07.072 [9] b. huber-eicher, a. suter, and p. spring-stähli, "effects of colored light-emitting diode illumination on behavior and performance of laying hens," poultry science, vol. 92, no. 4, pp. 869-873, 2013. https://doi.org/10.3382/ps.2012-02679 [10] a. g. rogers, e. m. pritchett, r. l. alphin, e. m. brannick, and e. r. benson, "i. evaluation of the impact of alternative light technology on male broiler chicken growth, feed conversion, and allometric characteristics," poultry science, vol. 94, no. 3, pp. 408-414, 2015. https://doi.org/10.3382/ps/peu045 [11] m. a. s. abu tabeekh and t. f. shawkat, "effect of light color and stocking density on some behavioral traits of broilers and layers," journal of agricultural science and soil science, vol. 3, no. 9, pp. 122-130, 2015. [12] c. nie, l. ban, z. ning, and l. qu, "feather colour affects the aggressive behaviour of chickens with the same genotype on the dominant white (i) locus," plos one, vol. 14, no. 5, p. e0215921, 2019. https://doi.org/10.1371/journal.pone.0215921 [13] s. sultana, m. r. hassan, h. s. choe, and k. s. ryu, "the effect of monochromatic and mixed led light colour on the behaviour and fear responses of broiler chicken," avian biology research, vol. 6, no. 3, pp. 207-214, 2013. https://doi.org/10.3184/175815513x13739879772128 [14] n. kim, s.-r. lee, and s.-j. lee, "effects of light color on energy expenditure and behavior in broiler chickens," asianaustralasian journal of animal sciences, vol. 27, no. 7, pp. 1044-1049, 2014. https://doi.org/10.5713/ajas.2012.12425 [15] m. hesham, a. el shereen, and s. enas, "impact of different light colors in behavior, welfare parameters and growth performance of fayoumi broiler chickens strain," journal of the hellenic veterinary medical society, vol. 69, no. 2, pp. 951958, 2018. https://doi.org/10.12681/jhvms.18017 https://doi.org/10.1098/rsos.180325 https://doi.org/10.1017/s0043933917001076 https://doi.org/10.3923/javaa.2012.1139.1144 https://doi.org/10.3382/ps.2011-02051 https://doi.org/10.3382/ps.2011-02051 https://doi.org/10.2141/jpsa.0150046 https://doi.org/10.3923/ijps.2015.449.455 https://doi.org/10.1016/j.rser.2010.07.072 https://doi.org/10.3382/ps.2012-02679 https://doi.org/10.3382/ps/peu045 https://doi.org/10.1371/journal.pone.0215921 https://doi.org/10.3184/175815513x13739879772128 https://doi.org/10.5713/ajas.2012.12425 https://doi.org/10.12681/jhvms.18017 animal review, 2023, 10(1): 1-11 9 © 2023 conscientia beam. all rights reserved. [16] a. c. lucena, h. pandorfi, g. l. almeida, c. guiselini, j. e. araújo, and t. p. d. s. rodrigues, "behavior of broilers subjected to different light spectra and illuminances," brazilian journal of agricultural and environmental engineering, vol. 24, no. 6, pp. 415-421, 2020. https://doi.org/10.1590/1807-1929/agriambi.v24n6p415-421 [17] spss, ibm corp. released 2016. ibm spss statistics for windows, version 20.0. armonk, ny: ibm corp, 2016. [18] d. b. duncan, "multiple range and multiple f-test," biometrics, vol. 11, pp. 1-5, 1955. http://dx.doi.org/10.2307/3001478 [19] r. mosa, r. abbas, and m. tabeekh, "an investigation on light color and stocking density on some productive performance of broilers," basrah journal of veterinary research, vol. 14, no. 1, pp. 176-186, 2015. https://doi.org/10.33762/bvetr.2015.100463 [20] d. senaratna, t. samarakone, and w. gunawardena, "red color light at different intensities affects the performance, behavioral activities and welfare of broilers," asian-australasian journal of animal sciences, vol. 29, no. 7, pp. 1052-1059, 2016. https://doi.org/10.5713/ajas.15.0757 [21] t. balabel, r. mohamed, and m. saleh, "using different light colors as a stress factor on broiler performance in egypt," australian journal of basic and applied sciences, vol. 11, no. 9, pp. 165-170, 2017. [22] j. cao et al., "effect of combinations of monochromatic lights on growth and productive performance of broilers," poultry science, vol. 91, no. 12, pp. 3013-3018, 2012. https://doi.org/10.3382/ps.2012-02413 [23] m. kim et al., "growth performance and hematological traits of broiler chickens reared under assorted monochromatic light sources," poultry science, vol. 92, no. 6, pp. 1461-1466, 2013. https://doi.org/10.3382/ps.2012-02945 [24] m. r. hassan, s. sultana, h. s. choe, and k. s. ryu, "effect of combinations of monochromatic led light color on the performance and behavior of laying hens," the journal of poultry science, vol. 51, no. 3, pp. 321-326, 2014. https://doi.org/10.2141/jpsa.0130105 [25] r. mohamed, s. el-kholya, m. shukry, s. el-kassas, and n. el-saidy, "manipulation of broiler growth performance, physiological and fear responses using three monochromatic led lights," alexandria journal of veterinary sciences, vol. 53, no. 1, pp. 57-62, 2017. https://doi.org/10.5455/ajvs.263048 [26] j. r. nelson, j. l. bray, j. delabbio, and g. s. archer, "light emitting diode (led) color and broiler growth: effect of supplementing blue/green led to white led light on broiler growth, stress, and welfare," poultry science, vol. 99, no. 7, pp. 3519-3524, 2020. https://doi.org/10.1016/j.psj.2020.04.020 [27] d. senaratna, t. samarakone, a. madusanka, and w. gunawardane, "performance, behaviour and welfare aspects of broilers as affected by different colours of artificial light," tropical agricultural research and extension, vol. 14, no. 2, pp. 38-44, 2012. https://doi.org/10.4038/tare.v14i2.4840 [28] m. r. d. santana, r. g. garcia, i. d. a. naas, i. c. paz, f. r. caldara, and b. barreto, "light emitting diode (led) use in artificial lighting for broiler chicken production," agricultural engineering, vol. 34, no. 3, pp. 422-427, 2014. https://doi.org/10.1590/s0100-69162014000300005 [29] h. olanrewaju, j. purswell, s. collier, and s. branton, "effects of color temperatures (kelvin) of led bulbs on blood physiological variables of broilers grown to heavy weights," poultry science, vol. 94, no. 8, pp. 1721-1728, 2015. https://doi.org/10.3382/ps/pev139 [30] w. liu, z. wang, and y. chen, "effects of monochromatic light on developmental changes in satellite cell population of pectoral muscle in broilers during early posthatch period," the anatomical record: advances in integrative anatomy and evolutionary biology, vol. 293, no. 8, pp. 1315-1324, 2010. https://doi.org/10.1002/ar.21174 [31] d. r. asih, s. harimurti, and w. wihandoyo, "the effect of 12 and 24-hour blue lighting on performance and feeding behavior of broiler chickens," livestock newsletter, vol. 42, no. 1, pp. 15-19, 2018. https://doi.org/10.21059/buletinpeternak.v42i1.25696 [32] j. cao, w. liu, z. wang, d. xie, l. jia, and y. chen, "green and blue monochromatic lights promote growth and development of broilers via stimulating testosterone secretion and myofiber growth," journal of applied poultry research, vol. 17, no. 2, pp. 211-218, 2008. https://doi.org/10.3382/japr.2007-00043 https://doi.org/10.1590/1807-1929/agriambi.v24n6p415-421 http://dx.doi.org/10.2307/3001478 https://doi.org/10.33762/bvetr.2015.100463 https://doi.org/10.5713/ajas.15.0757 https://doi.org/10.3382/ps.2012-02413 https://doi.org/10.3382/ps.2012-02945 https://doi.org/10.2141/jpsa.0130105 https://doi.org/10.5455/ajvs.263048 https://doi.org/10.1016/j.psj.2020.04.020 https://doi.org/10.4038/tare.v14i2.4840 https://doi.org/10.1590/s0100-69162014000300005 https://doi.org/10.3382/ps/pev139 https://doi.org/10.1002/ar.21174 https://doi.org/10.21059/buletinpeternak.v42i1.25696 https://doi.org/10.3382/japr.2007-00043 animal review, 2023, 10(1): 1-11 10 © 2023 conscientia beam. all rights reserved. [33] y. ke, w. liu, z. wang, and y. chen, "effects of monochromatic light on quality properties and antioxidation of meat in broilers," poultry science, vol. 90, no. 11, pp. 2632-2637, 2011. https://doi.org/10.3382/ps.2011-01523 [34] h. huang, z. wang, s.-j. weng, x.-h. sun, and x.-l. yang, "neuromodulatory role of melatonin in retinal information processing," progress in retinal and eye research, vol. 32, pp. 64-87, 2013. https://doi.org/10.1016/j.preteyeres.2012.07.003 [35] i. rozenboim et al., "the effect of a green and blue monochromatic light combination on broiler growth and development," poultry science, vol. 83, no. 5, pp. 842-845, 2004. https://doi.org/10.1093/ps/83.5.842 [36] m. m. s. kasem, "impact of light management on broilers behavior and performance," msc. thesis, faculty of veterinary medicine, kfr el-sheikh university egypt, 2017. [37] a. abdel-azeem and b. borham, "productive and physiological response of broiler chickens exposed to different colored light-emitting diode and reared under different stocking densities," egyptian poultry science journal, vol. 38, no. 4, pp. 1243-1264, 2018. https://doi.org/10.21608/epsj.2019.23694 [38] y. sayin, o. kaplan, e. karaduman, d. haqyar, and d. narinç, "the effect of monochromatic, combined, and mixed light-emitting diode light regimes on growth traits, fear responses, and slaughter-carcass characteristics in broiler chickens," tropical animal health and production, vol. 54, no. 5, pp. 277-277, 2022. https://doi.org/10.21203/rs.3.rs1448612/v1 [39] a. s. mendes, r. reffat, r. restelatto, and s. j. paixão, "vision and lighting in modern poultry," brazilian journal of agroscience, vol. 16, no. 1, pp. 5-13, 2010. [40] d. xie et al., "effects of monochromatic light on mucosal mechanical and immunological barriers in the small intestine of broilers," poultry science, vol. 90, no. 12, pp. 2697-2704, 2011. https://doi.org/10.3382/ps.2011-01416 [41] r. mohamed et al., "effect of different monochromatic led light colour and intensity on growth performance, physiological response and fear reactions in broiler chicken," italian journal of animal science, vol. 19, no. 1, pp. 10991107, 2020. https://doi.org/10.1080/1828051x.2020.1821802 [42] t. khaliq et al., "behavioral study of broilers reared under different colours of light in the evening hours," journal of entomology and zoology studies, vol. 6, no. 4, pp. 1624-1627, 2018. [43] b. r. franco et al., "light color and the commercial broiler: effect on behavior, fear, and stress," poultry science, vol. 101, no. 11, p. 102052, 2022. [44] d. bizeray, c. leterrier, p. constantin, m. picard, and j. faure, "sequential feeding can increase activity and improve gait score in meat-type chickens," poultry science, vol. 81, no. 12, pp. 1798-1806, 2002. https://doi.org/10.1093/ps/81.12.1798 [45] d. bizeray, c. leterrier, p. constantin, m. picard, and j. faure, "early locomotor behaviour in genetic stocks of chickens with different growth rates," applied animal behaviour science, vol. 68, no. 3, pp. 231-242, 2000. https://doi.org/10.1016/s0168-1591(00)00105-2 [46] t. cornetto and i. estevez, "behavior of the domestic fowl in the presence of vertical panels," poultry science, vol. 80, no. 10, pp. 1455-1462, 2001. https://doi.org/10.1093/ps/80.10.1455 [47] s. shields, j. garner, and j. mench, "effect of sand and wood-shavings bedding on the behavior of broiler chickens," poultry science, vol. 84, no. 12, pp. 1816-1824, 2005. https://doi.org/10.1093/ps/84.12.1816 [48] h. h. kristensen et al., "the behaviour of broiler chickens in different light sources and illuminances," applied animal behaviour science, vol. 103, no. 1-2, pp. 75-89, 2007. https://doi.org/10.1016/j.applanim.2006.04.017 [49] s. corr, m. gentle, c. mccorquodale, and d. bennett, "the effect of morphology on walking ability in the modern broiler: a gait analysis study," animal welfare, vol. 12, no. 2, pp. 159-171, 2003. https://doi.org/10.1017/s0962728600025616 [50] t. danbury, c. weeks, a. waterman‐pearson, s. kestin, and j. chambers, "self‐selection of the analgesic drug carprofen by lame broiler chickens," veterinary record, vol. 146, no. 11, pp. 307-311, 2000. https://doi.org/10.3382/ps.2011-01523 https://doi.org/10.1016/j.preteyeres.2012.07.003 https://doi.org/10.1093/ps/83.5.842 https://doi.org/10.21608/epsj.2019.23694 https://doi.org/10.21203/rs.3.rs-1448612/v1 https://doi.org/10.21203/rs.3.rs-1448612/v1 https://doi.org/10.3382/ps.2011-01416 https://doi.org/10.1080/1828051x.2020.1821802 https://doi.org/10.1093/ps/81.12.1798 https://doi.org/10.1016/s0168-1591(00)00105-2 https://doi.org/10.1093/ps/80.10.1455 https://doi.org/10.1093/ps/84.12.1816 https://doi.org/10.1016/j.applanim.2006.04.017 https://doi.org/10.1017/s0962728600025616 animal review, 2023, 10(1): 1-11 11 © 2023 conscientia beam. all rights reserved. [51] j. a. mench, "leg problems. in measuring and auditing broiler welfare. c.a. weeks and a. butterworth ed." wallingford, uk: cab, 2004, pp. 3–17. [52] j. howie, s. avendano, b. tolkamp, and i. kyriazakis, "genetic parameters of feeding behavior traits and their relationship with live performance traits in modern broiler lines," poultry science, vol. 90, no. 6, pp. 1197-1205, 2011. https://doi.org/10.3382/ps.2010-01313 [53] j. teng et al., "relationship between feeding behavior and production performance of broiler chickens based on automatic feeding system," journal of south china agricultural university, vol. 39, no. 4, pp. 7-12, 2018. [54] w. yan, c. sun, c. wen, c. ji, d. zhang, and n. yang, "relationships between feeding behaviors and performance traits in slow-growing yellow broilers," poultry science, vol. 98, no. 2, pp. 548-555, 2019. [55] t. bley and w. bessei, "recording of individual feed intake and feeding behavior of pekin ducks kept in groups," poultry science, vol. 87, no. 2, pp. 215-221, 2008. [56] b. hakan and a. ali, "effects of light wavelength on broiler performance," animal production, vol. 46, pp. 22-32, 2005. [57] p. g. tickle, j. r. hutchinson, and j. r. codd, "energy allocation and behaviour in the growing broiler chicken," scientific reports, vol. 8, no. 1, pp. 1-13, 2018. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://doi.org/10.3382/ps.2010-01313 13 © 2022 conscientia beam. all rights reserved. a preliminary comparison of beef carcases stunned using dts: diathermic syncope® or captive bolt in terms of selected meat quality attributes and plasma biomarker concentrations alison small1+ joanne hughes2 1csiro agriculture and food, chiswick. locked bag 1, armidale dc nsw 2350, australia. email: alison.small@csiro.au 2csiro agriculture and food, coopers plains, archerfield qld 4108, australia. email: joanne.hughes@csiro.au (+ corresponding author) abstract article history received: 2 september 2022 revised: 5 october 2022 accepted: 12 october 2022 published: 8 november 2022 keywords cattle meat color humane slaughter insensibility microwave stun shear force stress endocrinology. a novel technology for inducing unconsciousness prior to slaughter has been developed (dts). for commercial reasons meat quality attributes are important, and impacts on endocrine responses provide an indication of animal welfare. we compared endocrine, ultimate ph and meat quality (after 1 and 10 weeks of storage) attributes of cattle carcases processed using dts with those processed using penetrative captive bolt (cb). there were no significant differences between treatments in the change in plasma cortisol, adrenocorticotropic hormone, β-endorphin and catecholamines between baseline and immediately post-slaughter, and no significant differences in terms of ph at 24 h post slaughter. there were no significant differences in ph, shear force, tbars or drip loss between dts and cb samples of round and loin at week 1 and week 10 post slaughter; dts meat was yellower at quartering (minolta b* p < 0.05). at week 1, dts loins were redder (minolta a*, p < 0.05) and yellower (minolta b*, p < 0.05), while dts rounds were lighter (minolta l*, p < 0.05), than cb. at week 10, there were no significant meat color differences between treatments. processing cattle using dts results in endocrine changes and meat quality attributes that are comparable to cb. contribution/originality: dts: diathermic syncope® is a novel method for inducing unconsciousness in cattle prior to slaughter. this is the first study investigating the impacts of using dts in cattle processing on meat quality attributes of the carcases and endocrine responses of the animals. 1. introduction to ensure that animal welfare is safeguarded at the point of slaughter, there is an urgent need to develop a means of rendering cattle insensible prior to slaughter that also complies with the requirements of the halal and kosher markets: namely that the animal is whole and undamaged at the time of slaughter, and that the animal does not die as a result of the stunning method [1]. mechanical stunning results in damage to the skull and brain [2, 3] and while head-only electrical stunning does not result in physical damage and the animal can recover, carcase quality problems such as ecchymoses (blood splash) in the muscle [4, 5] pose a commercial obstacle to widespread adoption of electrical stunning in prime beef production. furthermore, if an animal is mis-stunned and experiences sub-convulsive stimulation rather than grand mal epilepsy subsequent to electrical stunning, this could be detrimental to welfare [6]. a novel technology that uses microwave energy to selectively raise the temperature of animal review 2022 vol. 9, no. 1, pp. 13-23. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v9i1.3187 © 2022 conscientia beam. all rights reserved. https://orcid.org/0000-0003-4477-3462 https://orcid.org/0000-0003-2791-4817 mailto:alison.small@csiro.au mailto:joanne.hughes@csiro.au https://www.doi.org/10.18488/92.v9i1.3187 animal review, 2022, 9(1): 13-23 14 © 2022 conscientia beam. all rights reserved. the brain and thereby induce unconsciousness has been developed (dts: diathermic syncope®; patent wo2011137497-a) and has been shown to induce electro encephalographic (eeg) changes incompatible with sensibility [7, 8]. the purpose of the study reported here was to conduct a preliminary evaluation of the meat quality (ph, shear force, lipid oxidation, water holding capacity and meat color) and endocrine (cortisol, adrenocorticotropic hormone (acth), β-endorphin and catecholamines) attributes of cattle carcases stunned prior to slaughter using the dts: diathermic syncope® system (dts), as compared with cattle stunned prior to slaughter using penetrative captive bolt (cb). 2. materials and methods research ethics: this study was conducted with the approval of the victorian state government wildlife and small institutions animal ethics committee, authority reference 29.13. 2.1. sample collection samples were collected during conduct of trial 1 as described by small, et al. [8]. briefly, the study involved 18 angus cross-bred heifers in the liveweight range 350-400 kg. they were sourced from the normal commercial intake at the abattoir and had been lairaged for 4 days with ad-libitum water and hay provided. the study was conducted over a 2-day period in september 2014, 7 animals processed on the first day (reduced numbers to allow time for discussion with state regulators and animal ethics committee inspectors), and 11 on the second. assigned treatments were: penetrative captive bolt (cb); cash magnum .22 caliber penetrative captive bolt (frontmatec, uk), with a 4-grain cartridge, applied at the frontal position (n = 7); dts 30 kw incident power (n = 5) and dts 20 kw incident power (n = 6). during dts application, technical faults in the system resulted in variable total energy (kj) being delivered to each animal. dts energy deliveries ranged from 3.55 to 297.97 kj. animals were assigned to treatments randomly as they were presented at the point of slaughter. each animal was individually brought to the restraint unit by a single lairage staff member, using low-stress animal handling techniques (used of flight-zone pressure-release to move animals within the lairage, and ‘flapper’ and voice within the race. electric goads were not used). at the knocking box, a baseline blood sample (vacutainer brand, anticoagulant ethylenediaminetetraacetic acid (edta), becton dickinson (bd) australia, north ryde, new south wales (nsw)) was taken from the tail vein, and the animal’s head was captured and restrained for stunning. restraint was prolonged (2-5 minutes) to allow pre-treatment eeg to be collected (reported in small, et al. [8]). following application of the assigned treatment, corneal reflexes, visual function of the eye and response to a painful stimulus of the nose was assessed, and the stunned carcass rolled onto the bleed table. exsanguination was delayed for 60-120 s to allow eeg to be collected (reported in small, et al. [8]). a thoracic sticking procedure was used, and a second blood sample collected from the free-flowing exsanguinate. the carcase was then dressed as normal practice, chilled overnight, and de-boned the following day. all blood samples were centrifuged and plasma extracted within one hour of collection. plasma samples were frozen and stored at -20°c until laboratory processing within 3 months of collection. carcase dressing was monitored, with attention paid to evidence of bruises or blood splash. during chilling, ph and temperature measurements were taken at one hour post treatment application until the ph had dropped below ph6 (approximately 4 hours), using a wp-80 digital ph meter (tps instruments pty ltd., springwood, queensland (qld)), with a combination electrode for temperature compensation. the meter was calibrated using ph4 and ph 7 standards immediately before use, after every hour, and at the end of the session according to the manufacturer’s instructions. ph, temperature and meat color, measured using a minolta cr300® colorimeter under light source d65, calibrated immediately before and after the measurement session using a standard white animal review, 2022, 9(1): 13-23 15 © 2022 conscientia beam. all rights reserved. tile as per the manufacturer’s instructions, were recorded from the carcases at quartering, approximately 24 hours post slaughter, prior to de-boning. during deboning, members of the plant quality assurance (qa) staff and the research team observed the process, with attention paid for any abnormality such as blood splash; ecchymosis or discoloration of the primals. at de-boning, a sample of loin (m. longissimus lumborum) and round (m. semitendinosus) was removed, vacuum packed and refrigerated. one sample of each muscle was randomly assigned to a one-week storage treatment; while the other assigned to a 10-week storage treatment. these samples were transported to the laboratory by refrigerated vehicle, within the first week post slaughter, and placed in a cold room set to 0°c ± 2°c for storage. 2.2. meat quality analysis 2.2.1. sample collection and preparation at each of 1 week post slaughter, and 10 weeks post slaughter, the muscle samples were unpacked, and sectioned into subsamples for color, ph, shear force, lipid oxidation and drip loss evaluation. 2.2.2. ph a wp-80 digital ph meter (tps instruments, springwood, qld), which incorporated a combination electrode to allow temperature compensation, was used to measure carcase ph. the ph meter was calibrated using ph4 and ph 7 standards immediately before use, after every 18 measurements, and at the end of the session according to the manufacturer’s instructions. the probes were inserted at least 10 mm into the substance of the muscle from the cross-grain cut surface, and data recorded when the readings had stabilised. 2.2.3. shear force for shear force measurement, samples were first cooked for 60 minutes at 70°c, before being tested using a lloyd instruments lrx® materials testing machine the machine was fitted with a 500 n load cell (lloyd instruments ltd., hampshire uk). the methodology used for measurement of warner-bratzler (wb) shear force followed the procedures described by bouton, et al. [9] and bouton and harris [10]. 2.2.4. lipid oxidation lipid oxidation was determined by the thiobarbituric acid-reactive substances (tbars) method of witte, et al. [11]. duplicate, meat samples (2 ± 0.01 g) were first heated at 75°c for 20 minutes in a water bath and cooled on ice (30 min at 5 °c). a standard curve of malondialdehyde (mda) was prepared by acidification of tep (1,1,3,3tetraethoxypropane), and tbars, expressed as mg mda per kg sample were calculated from this curve. 2.2.5. meat color meat color was measured using a minolta cr400® chromameter (minolta pty ltd., japan, light source d65, observer angle 2°, φ11 mm illumination area) calibrated immediately before and after each measurement session using a standard white tile as per the manufacturer’s instructions. 2.2.6. water holding capacity drip loss was measured using the method outlined by honikel, et al. [12] and warner, et al. [13]. briefly, blocks of muscle were cut to a target weight of approximately 50 g, measuring 2-3 cm thick and 3-4 cm across. each block was weighed to the nearest 0.1g on a laboratory balance (spe6001, ohaus corporation, usa), and suspended using suture material (3.5 metric braided silk, ethicon inc, usa) from a frame housed in a cold room set to 4 ± 2 °c. after 48 h storage, the muscle blocks were removed from the frame and reweighed. drip loss was calculated as the percentage reduction in weight over 48 hours. animal review, 2022, 9(1): 13-23 16 © 2022 conscientia beam. all rights reserved. 2.3. plasma sample analysis plasma samples were tested for cortisol concentration using radio-immuno-assay (cortisol ct kit, mp biomedical, eschwege, germany), adapted and validated for bovine plasma according to the method described by paull, et al. [14]. plasma concentrations of acth were determined using commercial enzyme-immuno-assay (eia) kits (ek-001-01; phoenix pharmaceuticals inc., burlingame, ca, usa). plasma β-endorphin was determined using commercial eia kits (ek-022-14; phoenix pharmaceuticals inc., burlingame, california (ca), usa). plasma concentrations of the catecholamines (epinephrine and norepinephrine) were determined using the cat-combi enzyme-linked immunosorbent assay (elisa) kit (re59242; ibl hamburg, germany). all commercial kits were used in accordance with the manufacturers’ instructions. 2.4. statistical analysis data were analysed using the nlme package within core and team [15]. plasma biomarker data were analysed within timepoint (baseline, t1, and post treatment, t2), and as the change in concentration between t1 and t2. differences between treatments for each parameter measured were assessed using a mixed model, fitting day (2 levels) and treatment (3 levels), with animal as the random variable and were considered significant at the p<0.05 level. the distribution of the residuals from the model were checked for normality using the shapiro-wilkes test, and transformations were used when required. ph declines were analysed using a repeated measures procedure to account for non-independent data points. animal 17 was excluded from analysis: it received a very low dose of energy (35.55 kj), which did not render the animal insensible, and was euthanased by captive bolt stun and exsanguination. initial analysis indicated that there was no significant effect of day, and that there were no significant differences between dts 30 kw and dts 20 kw treatments. thus, dts data were pooled leading to a simple regression with treatment (cb or dts) as the only fixed variable. 3. results 3.1. carcase characteristics superficial bruising was evident on the bony protuberance of the wing of the ilium (pelvis) on one, or both sides of 12 carcases, 6 of which were captive bolt animals. the right side was most often affected, and where the left side was affected, the bruise was smaller than that on the right side. these bruises are most likely to be associated with pre-treatment contact with the rigid structure of the raceway and restraint box. on deboning, no evidence of blood splash, ecchymosis or discoloration of primal cuts was noted. 3.2. ph values below ph 6 while the carcase temperature remained above 35°c were recorded for animals 7 (dts 20 kw, 191.28 kj: ph 5.87 at 36.0°c, 1 h post slaughter); 14 (dts 30 kw, 45.87 kj: ph 5.84 at 37.6°c, 1 h post slaughter) and 16 (dts 20 kw, 184.68 kj: ph 5.91 at 38.2°c, 1 h post slaughter). in all carcases, ph had dropped below 6 before a temperature of 15°c was recorded. there were no significant differences between treatments (p > 0.05) in terms of ph at 24 h post slaughter (phu, cb 5.69 ± 0.05, dts 5.68 ± 0.06). similarly, there were no significant differences in ph between dts and cb samples of round and loin at week 1 and week 10 post slaughter table 1. 3.3. shear force, lipid oxidation and water holding capacity shear force in both loin and in round did not differ significantly between treatments (p > 0.05) at either week 1 or week 10 (table 1). there were no significant differences in tbars measurements by treatment (p > 0.05) at week 1 or week 10, in either muscle table 1. there were no significant treatment differences in drip loss (p > 0.05) from either round or loin at week 1 or week 10 of storage table 1. animal review, 2022, 9(1): 13-23 17 © 2022 conscientia beam. all rights reserved. 3.4. meat color meat color measurements taken at quartering, on the day following slaughter; one week post slaughter and 10 weeks post slaughter are shown in table 1. dts meat was slightly yellower at quartering (minolta b* 2.71 ± 0.59 dts; 1.06 ± 0.44 cb, p < 0.05); dts loins were slightly redder (minolta a* 23.22 ± 0.92 dts; 20.89 ± 0.69 cb, p < 0.05) and slightly yellower (minolta b* 2.79 ± 0.93 dts; 0.77 ± 0.70 cb, p < 0.05) at week 1; and dts rounds were slightly lighter (minolta l* 43.32 ± 1.05 dts; 40.94 ± 0.78 cb, p < 0.05) at week 1, than cb samples. these values in turn affected the hue and chroma results at these time points; hue and chroma being calculated from the minolta a* and b* values. there were no significant differences between treatments in terms of meat color attributes of loin and round at week 10. table 1. meat quality attributes of cb and dts carcases (mean ± standard deviation). analysis captive bolt dts significance# ultimate ph (phu) 24 hrs post slaughter 5.69 ± 0.05 5.68 ± 0.06 n/s minolta l* at quartering 33.45 ± 0.50 33.71 ± 0.67 n/s minolta a* at quartering 23.16 ± 1.39 23.74 ± 1.86 n/s minolta b* at quartering 1.06 ± 0.44 2.71 ± 0.59 p < 0.05 hue at quartering 0.045 ± 0.02 0.11 ± 0.02 p < 0.05 chroma at quartering 24.10 ± 4.38 38.27 ± 5.87 p < 0.05 after 1 week of storage week 1 loin ph 5.50 ± 0.03 5.50 ± 0.04 n/s week 1 loin shear force (n) 45.31 ± 3.33 39.32 ± 4.41 n/s week 1 loin tbars (mg/kg) 2.01 ± 0.26 2.31 ± 0.35 n/s week 1 loin minolta l* 34.73 ± 0.82 36.05 ± 1.11 n/s week 1 loin minolta a* 20.89 ± 0.69 23.22 ± 0.92 p < 0.05 week 1 loin minolta b* 0.77 ± 0.70 2.79 ± 0.93 p < 0.05 week 1 loin hue 0 03 ± 0.03 0.113 ± 0.04 n/s week 1 loin chroma 22.51 ± 4.71 40.29 ± 6.31 p < 0.05 week 1 loin water holding capacity (% drip lost) 15.08 ±0.79 16.33 ±1.06 n/s week 1 round ph 5.45 ± 0.02 5.48 ± 0.02 n/s week 1 round shear force (n) 53.45 ± 2.45 47.46 ± 3.24 n/s week 1 round tbars (mg/kg) 3.17 ± 0.19 2.56 ± 0.26 n/s week 1 round minolta l* 40.94 ± 0.78 43.32 ± 1.05 p < 0.05 week 1 round minolta a* 21.93 ± 0.49 22.47 ± 0.65 n/s week 1 round minolta b* 4.12 ± 0.56 5.25 ± 0.75 n/s week 1 round hue 0.19 ± 0.02 0.23 ± 0.03 n/s week 1 round chroma 48.21 ± 4.56 57.08 ± 6.12 n/s week 1 round water holding capacity (% drip lost) 13.38 ±0.34 12.91 ±0.45 n/s after 10 weeks’ storage week 10 loin ph 5.51 ± 0.03 5.51 ± 0.04 n/s week 10 loin shear force (n) 34.72 ± 2.84 32.17 ± 3.82 n/s week 10 loin tbars (mg/kg) 3.43 ± 0.38 3.17 ± 0.51 n/s week 10 loin minolta l* 35.14 ± 0.67 36.06 ± 0.90 n/s week 10 loin minolta a* 22.16 ± 0.52 23.14 ± 0.69 n/s week 10 loin minolta b* 2.00 ± 0.33 2.77 ± 0.44 n/s week 10 loin hue 0.09 ± 0.01 0.12 ± 1.57 n/s week 10 loin chroma 32.59 ± 3.18 40.27 ± 4.26 n/s week 10 loin water holding capacity (% drip lost) 21.43 ± 0.80 21.95 ± 1.07 n/s week 10 round ph 5.44 ± 0.02 5.48 ± 0.03 n/s week 10 round shear force (n) 53.54 ± 2.55 46.19 ± 3.53 p = 0.05 week 10 round tbars (mg/kg) 2.62 ± 0.13 2.45 ± 0.18 n/s week 10 round minolta l* 41.04 ± 0.89 42.75 ± 1.19 n/s week 10 round minolta a* 21.92 ± 0.46 22.31 ± 0.61 n/s week 10 round minolta b* 5.85 ± 0.39 6.47 ± 0.52 n/s week 10 round hue 0.26 ± 0.02 0.28 ± 0.02 n/s week 10 round chroma 59.49 ± 2.90 64.45 ± 3.89 n/s week 10 round water holding capacity (% drip lost) 19.60 ± 1.00 21.00 ±1.35 n/s note: # n/s: not significant, *p > 0.05. animal review, 2022, 9(1): 13-23 18 © 2022 conscientia beam. all rights reserved. 3.5. plasma biomarkers both treatments resulted in an increase in cortisol from baseline (dts 33.19 ± 16.89 nmol/l; cb 61.43 ± 12.59 nmol/l, p > 0.05) to post-treatment levels (dts 150.38 ± 17.79 nmol/l; cb 160.64 ± 13.26 nmol/l, p > 0.05). the increase in plasma cortisol concentration was not significantly different between treatments (p > 0.05). acth levels required inverse transformation for statistical analysis, therefore data presented in table 2 are backtransformed. there were no significant differences in acth levels (p > 0.05) between dts and cb animals at t1 (0.097 and 0.053 ng/ml respectively; backtransformed data) or t2 (0.033 and 0.063 ng/ml respectively; backtransformed data). the change in acth levels was not significantly different between treatments (p > 0.05). there were no significant differences in βendorphin levels between dts and cb animals at t1 (2.75 ± 0.68 and 2.38 ± 0.5 ng/ml respectively, p > 0.05) or t2 (2.24 ± 0.61 and 2.13 ± 0.46 ng/ml respectively, p > 0.05). the reduction in βendorphin levels was not significantly different between treatments (p > 0.05). epinephrine concentrations required inverse transformation for statistical analysis, therefore data presented in table 2 are backtransformed. there were no significant differences in epinephrine concentrations between dts and cb animals at t1 (8.37 and 8.44 ng/ml respectively, p > 0.05; backtransformed data) or t2 (16.22 and 8.96 ng/ml respectively, p > 0.05; backtransformed data). the change in epinephrine levels was not significantly different between treatments (p > 0.05). plasma norepinephrine levels were below detection limit (0.02 ng/ml) at t1 (baseline) in ten samples (55%). the data were therefore not normally distributed, and assessment of change in norepinephrine as a result of the treatment was not possible. at t1, the highest norepinephrine concentration in the cb group was 18.75 ng/ml; and in the dts group 9.54 ng/ml. data at t2 were square root transformed to achieve normality. there were no significant differences between the cb and the dts group at t2 (mean 9.70 ng/ml and 11.34 ng/ml respectively, p > 0.05; backtransformed data). table 2. change in plasma biomarker concentrations between preand post-treatment samples (mean ±standard deviation). parameter captive bolt dts significance# change in cortisol between preand post-treatment samples (nmol/l) 99.21 ± 17.19 117.19 ± 23.07 n/s change in acth between preand post-treatment samples (ng/ml) -0.141* -0.051* n/s change in -endorphin between preand post-treatment samples (ng/ml) -0.25 ± 0.56 -0.51 ± 0.76 n/s change in epinephrine between preand post-treatment samples (ng/ml) 146.16* 17.28* n/s note: # n/s: not significant, p > 0.05; *backtransformed data. 4. discussion visual inspection of the carcases showed no abnormality. bruises were present on the bony tip of the pelvis on some animals, from both treatment groups, and were deemed to be caused pre-slaughter during handling and restraint. no abnormalities of color were noted at quartering. in general, there were no significant differences between meat from dts animals and meat from cb animals. three carcases showed a very rapid initial drop in ph post slaughter, reaching values below ph 6, while the carcase temperature was still above 35°c: animals 7 (dts 20 kw, 191.28 kj); 14 (dts 30 kw, 45.87 kj) and 16 (dts 20 kw, 184.68 kj). this rapid fall in ph may be indicative of a raised metabolic rate [16] and may suggest a tendency towards development of heat toughening, although this was not borne out by the meat quality analyses undertaken on loin and round at 1 and 10 weeks post slaughter. the raised metabolic rate could be a result of the prolonged restraint prior to stunning (collection of eeg data), the stunning treatment, or the prolonged stun-stick interval (collection of eeg data). the current data set is insufficient to assess which of these parameters was most animal review, 2022, 9(1): 13-23 19 © 2022 conscientia beam. all rights reserved. influential, and ideally the study would be repeated under more commercial conditions that did not involve prolonged restraint or delayed exsanguination. after death, anaerobic metabolism utilises stored glycogen reserves, facilitating an accumulation of lactate, prolonging glycolysis and utilising ‘free’ hydrogen ions, which is associated with a decline in muscle ph postmortem. well-fed and well-rested animals normally have sufficient muscle glycogen energy reserves at processing to reduce the ph of muscles to near to 5.5. if an animal has lowered glycogen <0.6 % (usually as a result of fatigue, that could be due to long-distance transport, fighting, mustering or prolonged periods of raised metabolic rate immediately prior to slaughter) and has had insufficient time to re-establish the muscle energy reserves, the ph will not fall to below 5.8, and will yield what is known as ‘dark-cutting’ meat [16, 17]. in the current study, phu in both groups was below ph 5.8, indicating that dark cutting was not induced, and ph values of loin and round at weeks 1 and 10 of storage lay within normal ranges (ph4 – ph 6), suggestive that glycogen reserves were sufficient (1-1.5 %) [17]. there were some slight differences in meat color at quartering, and in the first week after slaughter. marbling was not objectively measured but was considered similar across all carcases in the study. dts quarters were slightly yellower (greater minolta b*) at quartering; and at 1 week post slaughter dts loins were slightly redder (greater minolta a*) and slightly yellower (greater minolta b*); and dts rounds were slightly lighter (greater minolta l*) than cb samples. however, these differences were marginal, and the values align with published data on minolta color attributes of loin (m. longissimus lumborum) and round (m. semitendinosus) [18-20]. in light of the small sample size the current findings should be interpreted with caution. there was also a trend that dts samples were more tender than cb samples, but similarly, this trend should be interpreted with caution, in light of the small sample size. when calculating from newtons to kg/ force, shear force values for loins at one week post slaughter in the current study were 4.62 ± 0.34 kg and 4.01 ± 0.45 kg in cb and dts respectively; while at 10 weeks post slaughter these values were 3.45 ± 0.29 kg and 3.28 ± 0.39 respectively. these results are indicative of intermediate (week 1) and tender (week 10) classifications and lie within normal ranges sullivan and calkins [21]. warner, et al. [20] report values of 7.0 kg at 6 days post slaughter, and 4.8 kg at 21 days post slaughter; gruber, et al. [22] report a range of 3.5 to 5.11 kg measured over a range of ageing periods from 3 to 28 days; while sazili, et al. [19] report 9.19 ± 0.97 to 9.96 ± 0.72 kg at one week post slaughter. for rounds, the current study measured 5.54 ± 0.25 kg for cb and 4.84 ± 0.33 kg for dts at one week post slaughter, and 5.46 ± 0.26 and 4.71 ± 0.36 kg respectively at week 10. these values again align with previously published ranges, for example 4 – 18 kg [23], 4.12 ± 0.16– 6.63 ± 0.2 kg [24] and 4.6 – 9.5 kg [25]. the tbars results are higher than would be expected from fresh meat. this may not be reflective of the product or treatment but due to a loss of temperature control during sample storage, after sample collection. the samples in week 1 underwent an unforeseen delay between collection (held under refrigeration + 2°c and storage at 80°c prior to analysis, which may have resulted in excess lipid oxidation. for consistency, at week 10, we replicated the storage conditions encountered at week 1. nevertheless, there were no significant differences in tbars levels between the dts and the cb muscles. the endocrine stress responses measured indicate activation of two physiological response systems [26]. one is the ‘fight – or – flight’ response initiated by all animals when a threatening or ‘emergency’ situation is perceived: activation of this response leads to increases in catecholamines (epinephrine and norepinephrine). the catecholamines speed blood circulation and divert blood, and therefore oxygen, from internal organs to the brain and muscle, readying the animal for action. the second response is the hpa axis (hypothalamic-pituitary-adrenal axis): activation of this response leads to the release of adrenocorticotrophic hormone (acth) which leads to increased cortisol levels. this in turn increases the rate of production of glucose from glycogen reserves, so that the energy required for action is available. this increase in rate of glycogen breakdown, circulation, and metabolism generally can have detrimental effects on meat quality: very rapid metabolism at the point of slaughter animal review, 2022, 9(1): 13-23 20 © 2022 conscientia beam. all rights reserved. can lead to the pale, soft, exudative condition; prolonged raised metabolism leads to reductions in glycogen stores, which in turn lead to dark cutting [16]. in a commercial slaughterhouse situation, comparison against published reference ranges, based on resting animals, is inappropriate, as there will always be some underlying effect of the pre-slaughter transport and handling phase. even differences between abattoirs can strongly influence the endocrine stress response [27]. for example, zulkifli, et al. [28] working in a large commercial slaughterhouse, report higher, and a wider range in, cortisol concentrations than do tume and shaw [29], from a small experimental facility. thus, baseline samples are taken prior to treatment, against which the post-treatment samples are compared. the values obtained in the current study fall with the ranges published for pre and post slaughter samples collected from cattle [28-33]. in the current study, baseline cortisol in the dts group was significantly lower than post-treatment cortisol in that group, but not significantly different from baseline cb, and post-treatment cortisol in either group was not significantly different from the aggregate of all baseline cortisol results. therefore, the fact that post-treatment cortisol was significantly different from baseline cortisol in the dts group, and not in the cb group, is likely to be an artefact of small sample size. both methods resulted in an increase in cortisol from baseline (dts 33.19 ±1 6.89 nmol/l; cb 61.43 ± 12.59 nmol/l) to post-treatment levels (dts 150.38 ± 17.79 nmol/l; cb 160.64 ± 13.26 nmol/l), indicating a physiological response. however, it is unclear if this response is due to the stunning method; or to the head capture and prolonged restraint, which was longer than in a commercial situation due to the need to take baseline eeg recordings; or to a combination of both restraint and treatment. shaw and tume [30] and zulkifli, et al. [28] both report that cortisol levels in cattle are not affected by captive bolt stunning, however, the former carried out their study in a highly controlled research abattoir environment, in which external stimuli are likely to have been minimised, while the latter carried out their study in a commercial slaughterhouse, and baseline cortisol levels prior to slaughter were already high, as a result of the preslaughter handling and environment. both dunn [33] and zulkifli, et al. [28] report post stun cortisol levels greater than those measured in the current study, but it is important to note that these both relate to the case of slaughter without prior stunning. indeed, the latter authors demonstrated an increase in cortisol levels associated with slaughter without prior stunning, but not in the case of captive bolt stunned slaughter. mitchell, et al. [32] did find that captive bolt stunned slaughter resulted in an increase in cortisol levels (+ 61.2 nmol/l), but this increase was less than in cattle that were handled through a race (+ 151.7 nmol/l). by inference, it is likely that the cortisol response seen in the current study is predominantly due to the head capture and restraint. a tightly restrained head is required to ensure delivery of the dts energy; however, prolonged tight head capture is likely to be very stressful to the animal, and struggling while restrained is considered to be an indication of excessive pressure [34]. the european food safety authority recommends that “all restraining devices should use the concept of optimal pressure” [35] however, the parameters that constitute ‘optimal pressure’ have not been determined. in the current study, there was neither a difference in acth levels between baseline and post-treatment samples, nor was there a treatment effect. the values generated in the current study were lower than those reported by zulkifli, et al. [28] but similar to those reported by mitchell, et al. [32] who found that acth was, like cortisol, affected more by transportation and handling than by stunning alone. catecholamines (epinephrine and/or norepinephrine) have been reported to increase as a result of stunning zulkifli, et al. [28]; rulofson, et al. [31]; mitchell, et al. [32]. zulkifli, et al. [28] report no significant changes in epinephrine levels as a result of penetrative captive bolt stunning, or high powered percussive stunning, but an increase as a result of low powered percussive stunning and slaughter without prior stunning, while norepinephrine levels increased in all treatment groups; findings that concur with the current study. however, mitchell, et al. [32] and rulofson, et al. [31] both report an increase in both epinephrine and norepinephrine associated with captive animal review, 2022, 9(1): 13-23 21 © 2022 conscientia beam. all rights reserved. bolt slaughter. in the current study, both epinephrine and norepinephrine levels tended to increase between the pre-slaughter and post-slaughter samples, and there were no significant differences between stunning treatments. β-endorphins have a role in modulating the physiological stress response, and increases are associated with painful stimuli, fear and excitement. in the current study, there was no significant effect of treatment on βendorphin concentrations in either group, although the mean value appeared to decrease slightly. this finding concurs with that of zulkifli, et al. [28] who demonstrated no significant change in concentrations as a result of penetrative captive bolt, percussive captive bolt, and slaughter without prior stunning at a commercial abattoir. the slight decline in β-endorphin concentrations also reflects the findings of shaw and tume [30] who demonstrated a significantly lower concentration in captive bolt slaughtered cattle than in the live animals. those authors however, carried out their study in a small research abattoir, and the live animal blood samples were collected on a separate occasion within a month prior to slaughter. thus, the live animal values they report may not relate well to the baseline samples collected in the current study and that of zulkifli, et al. [28] which were collected immediately prior to stunning, in the restraint box. to summarise, this study provides a preliminary assessment of the meat quality attributes and plasma biomarker concentrations in cattle stunned prior to slaughter using the dts: diathermic syncope® system, demonstrating comparable outcomes to cattle stunned using penetrative captive bolt. key limitations of this study are (i) a prolonged period in restraint, which may have increased arousal and metabolic rate in the animals; (ii) a prolonged stun-stick interval, which could have resulted in returning sensibility and thus alterations in metabolic rate (although any animal showing return of brainstem reflexes was immediately re-stunned using a penetrative captive bolt; (iii) technical faults during energy delivery resulting in a wide range of total energy applied to individual animals – the dts application system has undergone further development since this study was conducted, and these issues have been corrected (j. ralph, wagstaff food services, personal communication); and (iv) a small sample size, such that there is a risk that any differences identified may not be true findings: indeed application of a bonferroni adjustment to the analysis would render all observed differences as not statistically significant. 5. conclusions this preliminary study indicates that stunning of cattle prior to slaughter using the dts: diathermic syncope system results in no, or negligible impacts on changes in plasma biomarker concentrations or meat quality attributes, the outcomes being comparable to those associated with stunning using penetrative captive bolt. these results should be validated in a larger sample size under more commercial processing conditions. funding: this work is supported by the australian red meat industry through processor levies managed by meat and livestock australia ltd (grant number: p.pip.0395) and the australian meat processor corporation ltd (grant number: ampc_2013-5034_g.paw.009). competing interests: the authors declare that they have no competing interests. authors’ contributions: both authors contributed equally to the conception and design of the study. references [1] a. fuseini, t. g. knowles, j. lines, p. j. hadley, and s. b. wotton, "the stunning and slaughter of cattle within the eu: a review of the current situation with regard to the halal market," animal welfare, vol. 25, pp. 365-376, 2016.available at: https://doi.org/10.7120/09627286.25.3.365. [2] m. m. farouk, "advances in the industrial production of halal and kosher red meat," meat science, vol. 95, pp. 805-820, 2013.available at: https://doi.org/10.1016/j.meatsci.2013.04.028. [3] j. finnie, "neuropathological changes produced by non-penetrating percussive captive bolt stunning of cattle," new zealand veterinary journal, vol. 43, pp. 183-185, 1995.available at: https://doi.org/10.1080/00480169.1995.35886. animal review, 2022, 9(1): 13-23 22 © 2022 conscientia beam. all rights reserved. [4] c. j. mpamhanga and s. b. wotton, "the effects of pre-slaughter restraint (for the purpose of cattle identification) on post-slaughter responses and carcass quality following the electrical stun/killing of cattle in a jarvis beef stunner," meat science, vol. 107, pp. 104-108, 2015.available at: https://doi.org/10.1016/j.meatsci.2015.04.012. [5] n. g. gregory and t. grandin, "stunning and slaughter, in animal welfare and meat production, n.g. gregory and t. grandin, editors," ed oxfordshire, uk: cabi wallingford, 2007, pp. 191-212. [6] a. z. zivotofsky and r. d. strous, "a perspective on the electrical stunning of animals: are there lessons to be learned from human electro-convulsive therapy (ect)?," meat science, vol. 90, pp. 956-961, 2012.available at: https://doi.org/10.1016/j.meatsci.2011.11.039. [7] j. rault, p. hemsworth, p. cakebread, d. mellor, and c. johnson, "evaluation of microwave energy as a humane stunning technique based on electroencephalography (eeg) of anaesthetised cattle," animal welfare, vol. 23, pp. 391400, 2014.available at: https://doi.org/10.7120/09627286.23.4.391. [8] a. small, j. lea, d. niemeyer, j. hughes, d. mclean, j. mclean, and j. ralph, "development of a microwave stunning system for cattle 2: preliminary observations on behavioural responses and eeg," research in veterinary science, vol. 122, pp. 72-80, 2019.available at: https://doi.org/10.1016/j.rvsc.2018.11.010. [9] p. bouton, p. t. harris, and w. shorthose, "effect of ultimate ph upon the water-holding capacity and tenderness of mutton," journal of food science, vol. 36, pp. 435-439, 1971.available at: https://doi.org/10.1111/j.13652621.1971.tb06382.x. [10] p. e. bouton and p. v. harris, "the effects of cooking temperature and time on some mechanical properties of meat," journal of food science, vol. 37, pp. 140-144, 1972. [11] v. c. witte, g. f. krause, and m. e. bailey, "a new extraction method for determining 2-thiobarbituric acid values of pork and beef during storage," journal of food science, vol. 35, pp. 582-585, 1970.available at: https://doi.org/10.1111/j.1365-2621.1970.tb04815.x. [12] k. honikel, c. kim, r. hamm, and p. roncales, "sarcomere shortening of prerigor muscles and its influence on drip loss," meat science, vol. 16, pp. 267-282, 1986.available at: https://doi.org/10.1016/0309-1740(86)90038-0. [13] r. warner, r. kauffman, and m. greaser, "muscle protein changes post mortem in relation to pork quality traits," meat science, vol. 45, pp. 339-352, 1997.available at: https://doi.org/10.1016/s0309-1740(96)00116-7. [14] d. r. paull, c. lee, i. colditz, s. atkinson, and a. fisher, "the effect of a topical anaesthetic formulation, systemic flunixin and carprofen, singly or in combination, on cortisol and behavioural responses of merino lambs to mulesing," australian veterinary journal, vol. 85, pp. 98-106, 2007.available at: https://doi.org/10.1111/j.1751-0813.2007.00115.x. [15] r. core and r. a. team, language and environment for statistical computing, editor^editors. vienna, austria: r foundation for statistical computing, 2018. [16] r. a. lawrie, "meat quality," food australia, vol. 42, pp. 84-86, 1990. [17] b. knee, l. cummins, p. walker, g. kearney, and r. warner, "reducing dark-cutting in pasture-fed beef steers by high-energy supplementation," australian journal of experimental agriculture, vol. 47, pp. 1277-1283, 2007.available at: https://doi.org/10.1071/ea05362. [18] a. önenç and a. kaya, "the effects of electrical stunning and percussive captive bolt stunning on meat quality of cattle processed by turkish slaughter procedures," meat science, vol. 66, pp. 809-815, 2004.available at: https://doi.org/10.1016/s0309-1740(03)00191-8. [19] a. sazili, b. norbaiyah, i. zulkifli, y. goh, m. lotfi, and a. small, "quality assessment of longissimus and semitendinosus muscles from beef cattle subjected to non-penetrative and penetrative percussive stunning methods," asian-australasian journal of animal sciences, vol. 26, pp. 723-731, 2013.available at: https://doi.org/10.5713/ajas.2012.12563. [20] r. warner, d. ferguson, j. cottrell, and b. knee, "acute stress induced by the preslaughter use of electric prodders causes tougher beef meat," australian journal of experimental agriculture, vol. 47, pp. 782-788, 2007.available at: https://doi.org/10.1071/ea05155. animal review, 2022, 9(1): 13-23 23 © 2022 conscientia beam. all rights reserved. [21] g. sullivan and c. calkins, "ranking beef muscles for warner–bratzler shear force and trained sensory panel ratings from published literature," journal of food quality, vol. 34, pp. 195-203, 2011.available at: https://doi.org/10.1111/j.1745-4557.2011.00386.x. [22] s. gruber, j. tatum, t. engle, p. chapman, k. belk, and g. smith, "relationships of behavioral and physiological symptoms of preslaughter stress to beef longissimus muscle tenderness," journal of animal science, vol. 88, pp. 11481159, 2010.available at: https://doi.org/10.2527/jas.2009-2183. [23] s. odusanya and a. okubanjo, "shear force values for steaks from the semitendinosus muscle of pre-rigor leg-twisted beef carcasses," journal of food science, vol. 48, pp. 1577-1578, 1983.available at: https://doi.org/10.1111/j.13652621.1983.tb03548.x. [24] m. otremba, m. dikeman, g. milliken, s. stroda, j. unruh, and e. chambers iv, "interrelationships among evaluations of beef longissimus and semitendinosus muscle tenderness by warner-bratzler shear force, a descriptivetexture profile sensory panel, and a descriptive attribute sensory panel," journal of animal science, vol. 77, pp. 865-873, 1999.available at: https://doi.org/10.2527/1999.774865x. [25] i. hwang, b. park, s. cho, and j. lee, "effects of muscle shortening and proteolysis on warner–bratzler shear force in beef longissimus and semitendinosus," meat science, vol. 68, pp. 497-505, 2004.available at: https://doi.org/10.1016/j.meatsci.2004.04.002. [26] j. e. hall and m. e. hall, guyton and hall tetbook of medical physiology. guyton physiology, 14th ed. us: elsevier, 2020. [27] p. h. hemsworth and j. l. barnett, "human–animal interactions and animal stress. in: moberg, g. p. & mench, j. a. (eds.) the biology of animal stress – basic principles and implications for animal welfare," ed oxon, uk, 2001, pp. 309-335. [28] i. zulkifli, y. goh, b. norbaiyah, a. sazili, m. lotfi, a. soleimani, and a. small, "changes in blood parameters and electroencephalogram of cattle as affected by different stunning and slaughter methods in cattle," animal production science, vol. 54, pp. 187-193, 2013. [29] r. tume and f. shaw, "beta-endorphin and cortisol concentrations in plasma of blood samples collected during exsanguination of cattle," meat science, vol. 31, pp. 211-217, 1992.available at: https://doi.org/10.1016/03091740(92)90040-b. [30] f. shaw and r. tume, "beta-endorphin and cortisol concentrations in plasma of cattle," australian veterinary journal, vol. 67, pp. 423-424, 1990.available at: https://doi.org/10.1111/j.1751-0813.1990.tb03044.x. [31] f. rulofson, d. brown, and r. bjur, "effect of blood sampling and shipment to slaughter on plasma catecholamine concentrations in bulls," journal of animal science, vol. 66, pp. 1223-1229, 1988.available at: https://doi.org/10.2527/jas1988.6651223x. [32] g. mitchell, j. hattingh, and m. ganhao, "stress in cattle assessed after handling, after transport and after slaughter," the veterinary record, vol. 123, pp. 201-205, 1988.available at: https://doi.org/10.1136/vr.123.8.201. [33] c. dunn, "stress reactions of cattle undergoing ritual slaughter using two methods of restraint," the veterinary record, vol. 126, pp. 522-525, 1990. [34] t. grandin and j. m. regenstein, "religious slaughter and animal welfare: a discussion for meat scientists," meat focus international, vol. 3, pp. 115-123, 1994. [35] efsa, welfare aspects of animal stunning and killing methods, editor^editors. european food safety authority. parma, italy: scientific panel for animal health and welfare, 2004. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 12 © 2023 conscientia beam. all rights reserved. blood and carcass characteristics of two chicken strains subjected to ocimum graticimum leaf based diet as substitute for synthetic antibiotics emenim raphael onainor1,3 ufuoma godstime sorhue1+ lawrence bratte1 ikenna sylvanus omeje1 adimabua mike moemeka2 joseph uguru4 1department of animal science, faculty of agriculture, delta state university abraka, nigeria. 1,3email: merryraph@yahoo.com 1email: gtsorhue@yahoo.com 1email: lawrencebrt@gmail.com 1email: siomeje@gmail.com 2department of animal production, faculty of agriculture, dennis osadebey university, asaba, nigeria. 2email: maikeadison1@gmail.com 3department of agricultural education, delta state college of education, pmb 4088 sapele nigeria. 4department of animal science, ebonyi state university, pmb 053, abakaliki, nigeria. 4email: joseph.uguru@ebsu.edu.ng (+ corresponding author) abstract article history received: 2 may 2023 revised: 19 june 2023 accepted: 26 june 2023 published: 6 july 2023 keywords antibiotic alternatives broilers haematology phytogenics strains. this study was designed to evaluate the effect of graded levels of scent leaf meals on blood parameters and carcass characteristics among two broiler strains. a total of 150 unsexed broilers consisting of 75 abor acre and 75 cobb were randomly allotted into 5 treatments of 15 birds for each strain. treatment one (t1) had no scent leaf meal (control); treatment two (t2), treatment three (t3), treatment four (t4) and treatment five (t5) had 0.5%, 1.0%, 1.5%, and 2.0% throughout the experimental period (56days). blood samples and carcass characteristics were evaluated after the feeding trial and subjected to analysis of variance in a completely randomized design. results revealed that diets and strain significantly (p < 0.05) affected live weight, dressed weights, and dressing percentages. t3 had the highest live and dressed weight (2091.50 ± 85.27 g and 1737.67 ± 22.16 g), while t5 recorded the lowest (1700 ± 102.47 g and1253.17 ± 68.09 g). cobb was superior to arbor acre for all carcass traits except for leg weight. red blood cell, white blood cell, mean corpuscular volume, mean corpuscular haemoglobin and mean corpuscular haemoglobin count of the two strains were significantly (p < 0.05) different, while pack cell volume, haemoglobin, neutrophils, lymphocytes, monocytes, eosinphils and basophils were not significantly different (p > 0.05). this study revealed no detrimental effect of the test ingredients on birds, though 1.5% inclusion rate could be tolerated, 1.0% is recommended for optimum performance, and can therefore efficiently replace synthetic antibiotic in broiler production. contribution/originality: the observed deposits of chemical residues in meats due to antibiotic use have necessitated alternative sources. this study therefore contributes to existing literatures by accessing the implications of phytobiotics on blood and carcass characteristics in two common broiler strains, which are characters required for efficient and profitable broiler production. animal review 2023 vol. 10, no. 1, pp. 12-20. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v10i1.3401 © 2023 conscientia beam. all rights reserved. https://orcid.org/0000-0001-9039-2404 https://orcid.org/0000-0001-8061-6662 https://orcid.org/0000-0001-8429-463x https://orcid.org/0000-0002-4704-441x https://orcid.org/0000-0003-2956-0987 https://orcid.org/0000-0003-1048-4320 mailto:merryraph@yahoo.com mailto:gtsorhue@yahoo.com mailto:lawrencebrt@gmail.com mailto:siomeje@gmail.com mailto:maikeadison1@gmail.com mailto:joseph.uguru@ebsu.edu.ng https://www.doi.org/10.18488/92.v10i1.3401 animal review, 2023, 10(1): 12-20 13 © 2023 conscientia beam. all rights reserved. 1. introduction chicken which is poultry meat is an essential component of animal protein both man and livestock. broiler which is a fast growing meat-type bird are table ready between 8 10wks of age and must have reached 1.8 to 2.5 kg at 8 to 10 [1]. broilers are over stressed due to intensification of production to meet demand leading to the proliferation of pathogenic disease infections which is a major problem facing poultry industry [2]. this has continued to threaten the poultry industry leading to reduced growth rate and high economic losses. unfortunately, synthetic antibiotics which had hitherto been used to reduce this ugly phenomenon had continued to cause negative effects due to growth of resistance resulting from continuous and prolong use. the continuous and prolong use of synthetic antibiotics had been revealed to cause accumulated residues in poultry product, as well as exchange in antibiotic resistance between animal and man, hence, restrictions and ban have become the only alternative solution in most countries [3, 4]. hence, the search for reasonable and cautious alternatives is beginning to gain popularity in animal nutrition. animal scientists are currently into phytogenics in order to overcome the high economic losses resulting from diseases in animal farms [5]. phytogenics are used mainly as growth promoters and health stabilizers in animal diet, they include saponin, tanin, essential oils and flavonoid, extracted from medicinal plants (spices and herbs), since they fight pathogenic microorganisms and contain antioxidants [6]. scent leaf which is a very good and important type of medicinal plant used as additive had been reported to improve growth performance in finishing broilers, improve weight gain and carcass characteristics of broilers [7, 8]. scent leaf and other plant derived product have been certified safe to use in livestock feeding as feed additives because of its capacity to fight disease pathogens and enhance growth [9]. high addition rates of the test ingredient have also been reported to reduce inflammation and enhance growth in chickens [10]. however, there is inadequate research information on the effects of ocimum gratissimum on the haematological and carcass attributes of broiler birds, hence the need for this study. 2. materials and methods 2.1. experimental site and ethical approval this study was executed at the poultry unit of the teaching and research farm of delta state university, asaba nigeria. the departmental research board approved this experiment; with reference number phd 0303202. 2.2. experimental birds and management a total of 150 unsexed broilers consisting of 75 cobb and 75 arbor acre strains were used for the study. the birds were raised on deep litter and fed for 56 days. all routine management practices for broiler management were followed according to sorhue, et al. [10]. 2.3. experimental diets and design one hundred and fifty (150) unsexed day-old broiler chicks were randomly allotted into five dietary treatment groups. the treatments were made up of 75 birds of each strain to give 15 birds per sub-treatment and each treatment was replicated thrice in a completely randomized block design. birds were given routine vaccination for young chicks, while feed and water were supplied adlibitum for the entire duration of the experiment. the test ingredient/scent leaf meal (slm) was introduced in week two for treatments two (0.5%), treatment three (1.0%), treatment four (1.5%), and treatment five (2.0%), while treatment one served as the control group receiving normal medication routine for broilers. the feeds used for treatment one to treatment five were formulated to contain between 22.12 % 22.21 % crude protein and 2792.03 metabolizable energy me kcal/kg, dry matter (dm) 2803.43 me kcal/kg dm for starter phase, and 20.19 20.28 me kcal/kg dm and 2833.54 2844.94 me kcal/kg dm for finisher phase as recommended by national research council (nrc) [11]. the proximate animal review, 2023, 10(1): 12-20 14 © 2023 conscientia beam. all rights reserved. composition of test ingredient used for this study contained 7.47, 14.38, 6.04, 2.49, 3.75, and 65.87 percent of moisture, crude protein, crude fibre, ether extract, ash and nitrogen free extract respectively. 2.4. data collection at the end of 56days feeding trial, 6 birds were randomly collected per treatment, three per strain. the selected birds were fasted for 16 hours, weighed before euthanized by cervical dislocation. the birds were later scalded at 65oc in steaming water for 30 seconds before de-feathering. thereafter the carcasses were disemboweled, and the different parts and organs such as legs, wings, chest and neck region, gizzard, kidneys, heart, liver and spleen were collected and weighed and the values expressed in grams (g). blood samples for haematological evaluation were collected with the aid of a sterilized disposable syringe from under the wing veins. just before the broilers were bled a cotton wool swab soaked in 70% ethanol was used to sterilize the skin and to dilate the vein. the blood samples were collected from the six sampled birds per treatment and transferred into a labeled sterile container with ethylene diamine tetra acetic acid (edtaa) as an anti-coagulant and used to determine the following hematological components: haemoglobin (hb), packed cell volume (pcv), red blood cell count (rbc), white blood cell count (wbc), mean corpuscular volume (mcv), mean corpuscular haemoglobin (mch) and mean corpuscular haemoglobin concentration (mchc). rbc, wbc, hb, and pcv were determined according to standard procedures as described by sorhue, et al. [12] while mcv, mch, and mchc were calculated using standard expressions. differential leukocyte counts: neutrophils, lymphocytes, monocytes, eosinophils and basophils were carried out on blood smear stained with leishman stain using standard techniques. 2.5. data analysis data collected were subjected to analysis of variance using statistical package for social sciences. significantly different means were separated using duncan’s new multiple range test at 5% level of significance [13]. table 1. effect of dietary treatments on carcass characteristics of broilers. parameter (g/broiler) t1 0.0% slm t2 0.5% slm t3 1.0% slm t4 1.5% slm t5 2.0% slm lwt 1893.33±18.92b 1835.83±16.08b 2091.50±15.27a 1968.00±17.30ab 1700.00±12.47c dwt 1396.50±16.09ab 1421.33±12.95ab 1737.67±22.16a 1589.67±12.52ab 1253.17±18.09b dp 73.60±0.94c 76.58±2.08bc 82.91±2.96a 80.62±0.78ab 73.89±1.49c legs 340.33±41.23 336.50±52.90 376.17±19.93 336.33±13.45 288.17±27.21 wings 215.33±18.50 199.50±35.93 228.17±23.25 207.67±12.21 190.67±18.29 chest 275.83±41.51b 263.17±48.92b 413.67±36.84a 373.50±47.92ab 288.33±26.48ab neck 77.83±12.11b 77.17±10.08b 89.17±3.77a 65.67±7.74bc 63.00±9.71c liver 41.56±2.58b 40.26±3.68b 45.71±1.94a 42.96±2.84b 37.93±1.96c gizzard 51.54±4.06ab 49.68±5.70b 55.18±4.75a 43.51±4.48b 41.06±2.63b lungs 10.79±0.56ab 10.46±0.95ab 12.22±0.53a 11.22±0.78ab 9.65±0.58b heart 8.14±0.43 7.89±0.71 8.99±0.37 8.46±0.59 7.30±0.44 spleen 2.46±0.12 2.41±0.23 2.73±0.11 2.56±0.18 2.21±0.13 kidney 5.49±0.29 5.33±0.48 6.06±0.25 5.71±0.39 4.94±0.29 note: lwt live weight; dwt dressed weight; dpdressing percentage; a, b, c: means values with different superscripts on the same row are significant (p<0.05). 3. results and discussion 3.1. effect of dietary treatment on carcass characteristics of broilers table 1 shows the effect of dietary treatment on carcass characteristics of broiler birds fed experimental diet. the result revealed significant (p<0.05) differences in average live weight, dressed weight, dressing percentage, chest weight, neck weight, liver weight, gizzard weight and lungs. t3 with 1.00% slm had the highest live weight (2091.50±85.27g) while t5 with 2.00% slm recorded the lowest (1700.00±102.47g). similarly, t3 had the highest dressed weight (1737.67±22.16g) and t5 had the lowest (1253.17±68.09g). similar trend was observed in mean animal review, 2023, 10(1): 12-20 15 © 2023 conscientia beam. all rights reserved. values for legs, chest, neck and internal organs. however, there was no significant (p>0.05) difference in mean values for legs, wings, heart, spleen and kidney. the significant (p<0.05) differences observed in dressed weight, weights of legs and neck are in agreement with odoemelam, et al. [7] for scent leaf supplemented diets. the range of 73.60 for t1 to 82.91 for t3 for dressing percentage in this study were above the range of 68.60% 73.40% reported by duncan [13] but falls within recommended range of 79-82% for chickens. the mean value of 82.91% for t3 obtained in this study is also within the range of 81.68 84.50% reported by isikwenu, et al. [14] for broilers, and is slightly higher than reports by bamgbose and niba [15]. the significantly heavier dressed carcass weight and higher dressing percentage of birds fed 1.00% (t3) confirms that they were better and most efficient in nutrient utilization with regards to digestion, absorption and assimilation [16]. similar results were also obtained for all cut parts expressed as percentage of live weight. the mean values for the legs, wings, heart, spleen and kidney were numerically higher for birds fed 1.00% (t3). they were however not significantly (p>0.05) different across the groups, which is similar to the report of olumide and akintola [17]. this implies that the scent leaf meal had no deleterious effect on the carcass of the broiler birds since dressing percentage can be influenced by several factors including; sex, diet, castration, time spent in liarage, the actual dressing process (skinning or scalding), as well as time of collection in relation to the biological growth curve, size, weight and age of the animals. table 2. effect of strain on carcass characteristics of broilers. parameter (g/broiler) arbor acre (aa) cobb (cb) live weight 1880.13±79.54b 1915.53±81.48a dressed weight 1467.95±76.89b 1491.40±75.79a dressing % 77.44±1.62 77.61±1.31 legs 356.20±23.38a 314.80±18.74b wings 207.87±15.51 208.67±12.76 chest 320.60±26.39 325.20±31.95 neck 72.53±6.75b 76.60±5.92a liver 40.84±1.74b 42.52±1.73a gizzard 48.09±3.22 48.80±2.75 lungs 10.85±0.48 10.89±0.47 heart 8.08±0.34b 8.23±0.35a spleen 2.45±0.11 2.49±0.11 kidneys 5.46±0.23 5.56±0.24 note: a,b: mean values within the same row with different letter superscript are significantly (p<0.05) different. 3.2. effect of strain on carcass characteristics of birds fed experimental diets the result table 2 showed that there were significant (p<0.05) differences in the two broiler strains for live weight, dressed weight, weight of legs, neck, liver and heart of broiler strain fed scent leaf meal diet at varying levels. cobb (cb) had higher values for most of the carcass parameters which were significant except for the weight of the legs which value was higher for the arbor acre (aa) strain (356.20g) than cobb (314.80g). cobb had higher neck weight (78.60g) than arbor acre (72.53g). cobb had significantly higher live weight and dressed weight (1915.53g and 1491.40g) than arbor acre (1880.13g and 1467.95g) respectively. the dressing percentage was numerically higher for cobb (77.61%) than arbor acre (77.44%). cobb also had higher liver and heart weights than arbor acre. however, there are diverse reports on the supremacy of the most familiar strains of broilers with particular reference to their carcass traits. reports fadare, et al. [18] indicates a significant difference in dressing yield of cobb and arbor acre broiler strains. it was revealed that cobb strain produced significantly higher mean dressing percentage (77.19±3.79%) than arbor acre strain (70.63±1.79%). the superiority of cobb strain over arbor acre strain in this study is also in consonance with the findings of zaman, et al. [19] which had higher dressing percentage (though not significant) for cobb strain than arbor acre strain. in this present study, there were no significant (p>0.05) differences for dressing percentage, wings, chest, gizzard, lungs, spleen and kidney animal review, 2023, 10(1): 12-20 16 © 2023 conscientia beam. all rights reserved. between the cobb and arbor acre strains. non-significant differences in dressing percentage contradicted reports of fadare, et al. [18] for broiler strains. table 3. effect of dietary treatment on hematological parameters of broilers. parameter t1 0.0% slm t2 0.5% slm t3 1.0% slm t4 1.5% slm t5 2.0% slm pcv (%) 36.00±1.29b 35.50±1.67b 36.33±1.56b 42.00±0.73a 39.83±1.60a hb (g/dl) 11.95±0.48b 12.24±0.52ab 12.25±0.57ab 13.58±0.41a 13.12±0.52ab rbc 3.90±0.22c 4.40±0.18b 4.45±0.38b 5.03±0.06a 3.87±0.28c wbc 6100±27.08ab 5566.67±33.33c 5750±29.36bc 6250±88.51a 5933.33±13.33abc neutrophils (%) 49.33±0.84b 51.17±2.56b 49.16±3.15b 56.00±1.37a 51.33±0.66a lymphocyte (%) 45.33±0.72b 46.33±1.91a 47.00±2.11a 39.00±1.53a 43.67±1.20a monocyte (%) 1.17±0.40 1.17±0.31 1.67±0.56 2.33±0.56 2.33±0.33 eosinophil (%) 2.83±0.40a 1.83±0.65ab 1.67±0.56b 1.83±0.31ab 1.83±0.54ab basophils (%) 0.17±0.17 0.17±0.16 0.67±0.17 0.00±0.00 0.00±0.00 mcv (fl) 91.95±3.67b 80.64±1.58c 87.39±8.68bc 83.22±1.88c 105.09±3.27a mch(pg) 29.97±1.03b 27.19±0.45c 28.81±3.06bc 27.65±0.58c 33.89±0.89a mchc(g/dl) 33.35±0.01b 33.49±0.07a 33.41±0.05ab 33.35±0.49b 33.35±0.02b note: a,b,c: mean values within the row with different superscripts are significantly different (p<0.05); par=parameter; red blood cell (rbc x106/mm3), white blood cell (wbc x103/mm3) (mchc)-mean corpuscular haemoglobin concentration, hb-haemoglobin concentration; (mch)-mean corpuscular haemoglobin, (mcv)-mean corpuscular volume. 3.3. effect of dietary treatment on haematological parameters of broilers the results of dietary treatment on haematological parameters of broiler birds fed scent leaf meal are shown in table 3. there were significant effects (p<0.05) of dietary treatment on almost all the haematological parameters examined except for monocytes and basophils. t4 had the highest pcv value (42.00±0.73) which was not significantly different from t5 (39.83±1.60). t4 and t5 are significantly different from treatments 1 to 3. differences in rbc and wbc counts were also significant with t4 having the highest mean values of 5.03 ± 0.06 (x106/mm3) and 6250.00 ± 88.51 (x103/mm3) respectively. the control had the highest mean value (2.83±0.40) for eosinophil while t3 had the lowest (1.67±0.56) though not significantly different from other scent leaf meal treated groups (t2, t4 and t5). the values of the broiler birds for mcv and mch were significant, with t5 recording the highest mean values of 105.09±3.27 and 33.89±0.89 respectively. the mean value for pcv ranged from 35.5042.00%, which is within the normal range of 35-55% reported by mitruka and rawnsley [20] for healthy birds and 24.90-45.20% reported by oguntoye, et al. [21]. there were significant increases in the value of pcv as the level of inclusion of scent leaf meal increased up to t4. the highest value was recorded by t4 (1.50% slm) which was not significantly different from t5 (2.00% slm) while t2 (0.50% slm) had the lowest pcv value which was not significantly different from the control (0.00% slm). this is supported by the finding of olumide, et al. [22] which recorded a steady improvement in percentage pcv, rbc, wbc and haemoglobin (hb) when broiler diets were supplemented with slm at the rate of 100g, 200g, 300g or 400g/100kg. similarly, olobake and okaragu [23] who supplemented broiler diets with slm at rate of 1%, 2% and 3% recorded higher mch and mcv than the control (without scent leaf meal), though with no significant mean differences. in the same vein, ogbu and amaefule [8] and adeleye, et al. [24] observed no significant difference (p<0.05) effect of scent leaf on blood parameters of broilers. however, chineke, et al. [25] reported a significant reduction in haemoglobin (hb), pcv, rbc contents of the blood of broiler chicken at starter stage, but non-significant for all the haematological parameters measured at the finisher stage. the differences observed could be caused by the level of inclusion of scent leaf in the diets, age and the breed of the birds. pcv is involved in transportation of oxygen and absorption of nutrients. it is important in the diagnosis of anaemic condition. a pcv that is lower than 35% indicates anaemic condition while increased pcv suggests better and more oxygen transportation and utilization by the cells and thus preventing anaemic condition [24]. similarly, rbc count increased with increasing scent leaf meal inclusion of up to t4 (1.50%). the animal review, 2023, 10(1): 12-20 17 © 2023 conscientia beam. all rights reserved. control (t1) without scent leaf meal had the lowest. this study corresponds with the report of chineke, et al. [25] which revealed that pcv resulted to an increased number of rbc count. the range of haemoglobin observed was 11.95g/dl (t1) 13.58g/dl (t4) falls within normal range of 7-13g/dl recorded by bounous and stedman [26] for chickens. the result showed that there were significant differences in mean values for the white blood cell across the treatment groups. treatment 4 (1.5% slm diet) indicated higher significant value of 6250 (x103/mm3) than the control (t1) 6100 (x103/mm3). the red blood cell (rbc) increased with increasing level of scent leaf meal inclusion up to 1.50% (t4) with a mean value of 5.03 (x106/mm3). it also showed that the slm inclusion could only be tolerated up to 1.50% slm inclusion by the broiler birds with a decline at t5 which was not significantly different from t1. haemoglobin concentration is a determinant of the oxygen carrying capacity of the blood circulatory system while the rbc is responsible for the transport of oxygen from the lungs to the tissues. the result obtained showed a significant increase in rbc with increasing level of scent leaf meal inclusion up to 1.50%. the values ranged from 3.90±0.22 (t1, the control) – 5.03±0.06 (t4) which is higher than 2.0 (x103mm3) reported by thrall [27] for exotic chicken. white blood cells (wbc) are mainly recognized as a defense system of the body, and the observed significant differences in the wbc values are indications of differences in the body defense potential [28]. hence the broiler birds that received 1.50% slm (t4) had the highest immunity and therefore should be the least susceptible to infection and anaemia. mcv was significantly different (p<0.05) with a range of 80.64fl (t2)-105.09fl (t5). mch was also significant with t5 (33.49pg) significantly (p<0.05) higher than t1 (29.79pg). mcv and mch have taken a similar pattern with 2.00% (t5) slm having significantly (p<0.05) higher mean values than the control (t1). since mch is an indication of blood carrying ability of the rbc, this could mean that 2.00% (t5) slm is more efficient in performing respiratory function. mchc was significantly different with t2 (33.49g/dl) showing higher mean value than t1 (33.35g/dl) which was not significantly different from t3, t4 and t5. previous reports [23] observed that the mcv and mch of scent leaf meal supplemented diets were higher than control, though with no significant differences in means. some authors [8, 29] reported no significant effect of scent leaf on blood parameters of broilers. the result of lymphocyte and neutrophils show significant differences with t3 having significantly higher value than the control for lymphocytes and t4 mean value was significantly higher than control for neutrophils. the values observed for monocytes, eosinophils, basophils and neutrophils were within the normal range of healthy birds according to archetti, et al. [30]. the variations observed in the haematological indices of birds in this study might be due to genotype differences, age, physiological condition and nutrition [31]. table 4. effects of strain on haematological parameters of broilers. parameter arbor acre (ar) cobb (cb) pcv (%) 37.00±1.20 38.86±0.88 hb (g/dl) 12.49±0.39 12.77±0.32 rbc (x106/mm3) 3.97±0.18b 4.69±0.14a wbc (x103/mm3) 5773.33±128.91b 6066.67±94.95a neutrophils (%) 50.93±1.49 51.86±1.17 lymphocytes (%) 44.27±1.36 44.27±1.05 monocytes (%) 1.93±0.33 1.53±0.26 eosinophils (%) 1.93±0.34 2.07±0.25 basophils (%) 0.20±0.11 0.00±0.00 mcv (fl) 94.48±3.44a 84.85±3.25b mch (pg) 31.19±1.01a 27.81±1.04b mchc (g/dl) 33.44±0.04a 33.34±0.01b note: a,b: mean values with different letter superscript are significantly (p<0.05) different. 3.4. effects of strain on haematological parameters of broiler the effects of strains on haematological parameters as shown in table 4 reveals that rbc, wbc, mcv, mch, and mchc of the strains were significantly different (p <0.05) while pcv, hb, neutrophils, lymphocytes, animal review, 2023, 10(1): 12-20 18 © 2023 conscientia beam. all rights reserved. monocytes, eosinophils and basophils were not significant. the pcv, though not significantly different, falls within the normal range of 35-55% reported by mitruka and rawnsley [20] and 24.90-45.20% reported by oguntoye, et al. [21]. since mch indicates blood conveying potentials of the red blood cell (rbc), arbor acre having significantly higher mch value is more efficient in performing respiratory function than the cobb as observed by isaac, et al. [32]. white blood cells are known to fight against disease pathogens. cobb with higher wbc count has higher immune status than arbor acre and therefore is capable of generating antibodies during phagocytosis and has higher resistance to diseases [32] red blood cell functions as a carrier of haemoglobin and it is involved in movement of oxygen and carbon dioxide in and out of the body [32]. haemoglobin is an ironcontaining pigment found in the red blood cells of most animals. it illustrates the movement of oxygen and carbon dioxide in and out of the tissues for oxidation of digested food during energy production [12, 33]. a lower red blood count implies a lower oxygen and carbon dioxide that will be carried to the tissues and back to lungs respectively. this will also affect the rate of oxidation to release energy required for the various body functions. 4. conclusion scent leaf meal in diet of broilers performs best at 1% inclusion rate; however, 1.5% inclusion could be tolerated since it tends to enhance blood health characteristics and showed no detrimental effects to carcass characteristics. overall, the test ingredients have proven a better replacement for synthetic antibiotics considering the performance of experimental birds. funding: this work was supported by the delta state college of education mosogar through the tertiary education trust fund (grant number: tetfund/dess/coe/mosogar/ibr/2015/vol.1). ethical statement: the ethical committee of the department of animal science, delta state university abraka, nigeria, has granted approval for this study on 18 november 2022 (ref. no. phd-18112022). data availability statement: the corresponding author can provide the supporting data of this study upon a reasonable request. competing interests: the authors declare that they have no competing interests. authors’ contributions: the idea, concept and planning, e.r.o., l.b., i.s.o. and u.g.s.; supervision, l.b. and i.s.o.; execution, e.r.o., u.g.s., a.m.m, and j.u.; the draft, e.r.o.; editing, u.g.s., l.b., and i.s.o. all authors have read and agreed to the published version of the manuscript. references [1] j. a. oluyemi and f. a. roberts, poultry production in warm wet climate. london: macmillan press ltd, 2000. [2] o. akintunde and a. adeoti, "assessment of factors affecting the level of poultry disease management in southwest, nigeria," trends in agricultural economics, vol. 7, no. 2, pp. 41-56, 2014. https://doi.org/10.3923/tae.2014.41.56 [3] c. t. kamel, tracing modes of action and the role of plant extracts in non-ruminants. in garnsworthy, p. c. and wiseman, j. (eds.), recent advances in animal nutrition. nottingham uk: nottingham university press, 2001. [4] f. onwurah, g. ojewola, and s. akomas, "effect of basil (ocimum basilicum l.) on coccidial infection in broiler chicks," academic research international, vol. 1, no. 3, p. 438, 2011. [5] r. abbas, d. colwell, and j. gilleard, "botanicals: an alternative approach for the control of avian coccidiosis," world's poultry science journal, vol. 68, no. 2, pp. 203-215, 2012. https://doi.org/10.1017/s0043933912000268 [6] n. puvača et al., "beneficial effects of phytoadditives in broiler nutrition," world's poultry science journal, vol. 69, no. 1, pp. 27-34, 2013. https://doi.org/10.1017/s0043933913000032 [7] v. u. odoemelam, k. o. nwaogu, s. n. ukachukwu, b. o. esonu, and i. c. okoli, "growth response, carcass quality and organoleptic assessment of broiler chicken fed ocimum gratissimum l. supplemented diets," international journal of agriculture and rural development, vol. 16, no. 2, pp. 1521-1528, 2013. [8] c. c. ogbu and p. c. amaefule, "performance and haematological indices of broiler chickens fed supplements of gongronema latifolium, ocimum gratissimum and telfaria occidentalis," global science research journals, vol. 3, no. 2, pp. 140-145, 2015. https://doi.org/10.3923/tae.2014.41.56 https://doi.org/10.1017/s0043933912000268 https://doi.org/10.1017/s0043933913000032 animal review, 2023, 10(1): 12-20 19 © 2023 conscientia beam. all rights reserved. [9] r. j. wang, d. f. li, and s. bourne, "can 2000 years of herbal medicine history help us solve problems in the year 2000 in biotechnology in the feed industry?," in proceedings of alltech’s annual symposium nottingham, united kingdom, 1998, pp. 273–291. [10] u. g. sorhue, e. r. onainor, a. m. moemeka, and i.-e. e. peterson, "dietary inclusion of scent leaf meal (ocimum gratissimum) affects immune genes expression in chicken spleen at 28 and 56days," animal review, vol. 8, no. 1, pp. 10-19, 2021. https://doi.org/10.18488/journal.ar.2021.81.10.19 [11] national research council (nrc), nutrient requirements of poultry, 9th ed. washington dc: national academy press, 1994. [12] u. g. sorhue, p. o. akporhuarho, a. m. moemeka, e. p. irikefe-ekeke, and i. udeh, "haematological and serological indices of crossbred pigs fed different unconventional feeds," porcine research, vol. 12, no. 1, pp. 25-32, 2022. [13] d. b. duncan, "multiple range and multiple f tests," biometrics, vol. 11, no. 1, pp. 1-42, 1955. https://doi.org/10.2307/3001478 [14] j. o. isikwenu, s. i. omeje, g. okagbara, and o. j. akpodiete, "the effect of replacing groundnut cake with urea treated and fermented brewers dried grain on nutrient digestiility, retention and carcass characteristics of broiler finishers," nigerian journal animal production, vol. 37, no. 1, pp. 1-12, 2010. https://doi.org/10.51791/njap.v37i1.588 [15] a. m. bamgbose and a. t. niba, "the nigerian livestock industry in the 21st century," in proceedings of 3rd annual conference of animal science association of nigeria. ibadan, nigeria, 1998, pp. 84-87. [16] a. m. bamgbose, e. o. oyewoye, h. o. apata-olakulehin, a. s. mohammed, and a. m. musa, "utilization of roasted full-fat soyabean in diets for broiler chickens," in proceeding of nigerian society of animal production conference, abeokuta, nigeria, 1999, pp. 176-177. [17] m. olumide and a. akintola, "effect of scent leaf meal (ocimum gratissimum) supplementation on performance, carcass and meat quality of broiler chicken," nigerian journal of animal production, vol. 45, no. 3, pp. 228-236, 2018. https://doi.org/10.51791/njap.v45i3.436 [18] a. fadare, t. dawodu, and j. ilufoye, "variations in the carcass traits of three strains of broiler chickens," nigerian journal of animal science, vol. 22, no. 2, pp. 7-12, 2020. [19] r. zaman, s. s. jahan, a. islam, and s. ahmed, "production performance of three broiler strains in summer seasons in bangladesh," global journal of animal science, livestock production and animal breeding, vol. 3, no. 2, pp. 138-144, 2015. [20] b. m. mitruka and h. m. rawnsley, clinical biochemical and hematological reference values in normal experimental animals. new york: masson publishing usa inc., 1977. [21] m. oguntoye, j. bako, f. adamu, d. daniel, b. daniel, and e. joseph, "effect of maize and yam peels based diets supplemented with xylanase, amylase and protease multi-enzymes on serum biochemical and haematological indices of starter broiler chickens," nigerian journal of animal science, vol. 20, no. 4, pp. 355-363, 2018. [22] m. d. olumide, g. o. chioma, o. a. ajayi, and o. akinboye, "performance, haematological and serum biochemical profile of broilers chicken fed diets supplemented with ocimum gratissimum meal," international journal of modern biological research, vol. 6, pp. 27-34, 2018. [23] r. y. olobake and b. okaragu, "scent leaf (ocimum gratissimum) leaf improved the growth performance and lowered blood cholesterol level of cockerels," international journal of veterinary sciences and animal husbandry, vol. 6, no. 1, pp. 23-27, 2021. https://doi.org/10.22271/veterinary.2021.v6.i1a.319 [24] o. o. adeleye, l. t. egbeyale, g. o. fajohunbo, i. o. anifowose, and s. a. oduwaye, "response of broiler chickens to varying levels of ocimum gratissimum leaf meal," nigerian poultry science journal, vol. 11, pp. 164-171, 2014. [25] c. chineke, a. ologun, and c. ikeobi, "haematological parameters in rabbit breeds and crosses in humid tropics," pakistan journal of biological sciences, vol. 9, no. 11, pp. 2102-2106, 2006. https://doi.org/10.3923/pjbs.2006.2102.2106 [26] d. bounous and n. stedman, normal avian haematology: chicken and turkey. in feldman, b. f., zinki, g. j., jain, n. c. editors. schalm’ veterinery haematology. new york: wiley, 2000. https://doi.org/10.18488/journal.ar.2021.81.10.19 https://doi.org/10.2307/3001478 https://doi.org/10.51791/njap.v37i1.588 https://doi.org/10.51791/njap.v45i3.436 https://doi.org/10.22271/veterinary.2021.v6.i1a.319 https://doi.org/10.3923/pjbs.2006.2102.2106 animal review, 2023, 10(1): 12-20 20 © 2023 conscientia beam. all rights reserved. [27] m. a. thrall, veterinary haematology and clinical chemistry. new jersey, usa: blackwell publishing, 2006. [28] j. e. ganomg, a review of medical physiology, 23th ed. lange medical publication, 1991. [29] l. c. ndubuisi-ogbonna, o. a. abdur-rahman, o. j. afodu, t. o. ayo-bello, b. a. shobo, and o. a. ajayi, "effect of scent leaf on haematological indices of broilers," international journal of sciences: basic and applied research, vol. 30, no. 2, pp. 266-273, 2016. [30] i. archetti, c. tittarelli, m. cerioli, r. brivio, g. grilli, and a. lavazza, "serum chemistry and hematology values in commercial rabbits: preliminary data from industrial farms in northern italy," in proceedings of 9th the world rabbit congress, italy, 2008, pp. 1147-1151. [31] n. s. machebe, c. u. agbo, and c. c. onuaguluchi, "oral administration of gongronema latifolia leaf meal: implications on carcass and haematological profile of broiler finishers raised in the humid tropics," african journal of biotechnology, vol. 10, no. 30, pp. 5800-5805, 2011. [32] l. j. isaac, g. abah, b. apan, and i. u. ekaette, "haematological properties of different breeds and sexes of rabbits," in proceedings of the 18th annual conference of animal science association of nigeria ife, nigeria, 2013, pp. 24-27. [33] c. a. omiyale, a. g. yisa, and l. a. ali-dunkrah, "haematological characteristics of yankasa sheep fed fodio (digitaria iburua) straw based diets," in proceedings of 37th annual conference of nigerian society for animal production ibadan, nigeria, 2012, pp. 87-89. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 24 © 2022 conscientia beam. all rights reserved. effect of feed withdrawal and progut on broiler performance, carcasses traits and blood parameters hayam m. abo elmaaty1+ sara khalil sherif2 lina sabry foda3 1,2,3poultry production department, faculty of agriculture, mansoura university, egypt. 1email: hayiam151@yahoo.com 2email: sarashrif349@yahoo.com 3email: linasbry91@yahoo.com (+ corresponding author) abstract article history received: 27 july 2022 revised: 12 october 2022 accepted: 31 october 2022 published: 25 november 2022 keywords blood parameters broiler carcass feed additive feed withdrawal. this study evaluated the effect of feed withdrawal without/ with feed additive (progut®) on broiler chickens’ performance, carcass traits and some blood parameters, in a factorial arrangement (4 feed restriction×2 levels of feed additive). three hundred twenty-one-day-old broiler chicks (cobb 500) were distributed into 8 treatments with four replicates. in the first week all chicks fed starter basal diet, however during the second week, broiler chicks were exposed to feed restriction by feed withdrawal time (0, 6, 9, 12 hours/day). broiler chicks exposed to feed withdrawal had low body weight gain and feed consumption at 2 weeks of age. feed withdrawal had no effect on final weight, body weight change, total feed intake, total feed conversion, economic efficiency, carcass traits and serum blood composition of 42-day-old-broiler chicks. feed withdrawal and feed additive in broiler diets decreased total microflora counts and e coil and enhanced lacto bacillus, amylase and chemo trypsin in broiler guts. feed additive (progut®) decreased total feed consumption, improved total feed conversion and increased economic efficiency of broilers. feed additive increased the level of β globulin and decreased the level of α globulin in serum blood of broiler chicks. the obtained results suggested that feed withdrawal during the second week of age had not effect on broiler performance, carcass traits and serum blood characteristics and improved lacto bacillus, amylase and chemo trypsin. feed additive (progut®) in broiler diets improved growth performance and decreased total bacteria counts, e coli and increased lacto bacillus counts in broiler guts. contribution/originality: feed withdrawal reduces feed consumption, feed costs and abdominal fat, improves feed utilization and benefits from compensatory growth. yeast improves health of the bird, reduces using antibiotics and improves the quality of the carcass. feed withdrawal was combined with yeast product to improve growth performance of broilers and their carcasses. 1. introduction rising feed costs drive the interest in interventions such as feed restriction to improve feed efficiency and reduce abdominal fat content [1] reported there are 2 main methods to apply feed restriction, each with their own effect on production performance. qualitative feed restriction is defined as limiting (specific) nutrient intake through dilution of the diet. food deprivation is a commonly used management strategy in broilers, aiming to prevent excessive weight gain during growth and thereby to solve some health-related problems [2] while also preventing precocious fat deposition [3]. feed restriction also presents some economic benefits [4]. animal review 2022 vol. 9, no. 2, pp. 24-36. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v9i2.3203 © 2022 conscientia beam. all rights reserved. mailto:hayiam151@yahoo.com mailto:sarashrif349@yahoo.com mailto:linasbry91@yahoo.com https://www.doi.org/10.18488/92.v9i2.3203 animal review, 2022, 9(2): 24-36 25 © 2022 conscientia beam. all rights reserved. quantitative feed restriction is defined as reducing nutrient intake through reducing the amount of feed consumed. following a period of feed restriction, broilers normally experience a period of rapid growth, called compensatory growth [5]. the extent to which broilers show compensatory growth depends on many factors such as environment, period and method of the applied restriction, strain, and sex [6]. in addition, [7] showed that chickens provided 80% of ad libitum intake from 8 to 16 d of age do not differ in body weight, feed conversion ratio, or fat content at 35 d of age compared to ad libitum fed chickens. yeast (saccharomyces cerevisiae) and yeast cell wall (ycw) have been reported to contain polysaccharides and thus may have the potentials to improve the performance and health of birds [8]. the growth-promoting effect and immunomodulatory potential of prebiotic yeast, ycw products and their cell wall contents such as β-glucan and α-mannan in recent years are gaining research interest [9]. live yeast (ly) is one of the most potential microorganism derived products that can be used in animal ration as a dietary supplement [10] as well as a potential alternative to feed antibiotics in animals [11]. mannanoligosaccharide, derived from the outer cell wall of yeast (saccharomyces cerevisiae), can be applied as a growth promoter as well as a possible alternative to antibiotics in broiler diets [12]. dietary supplementation with whole yeast and yeast cell walls at 1.5–2 g/kg level could improve growth performance and meat yield in broilers [13]. progut® has successfully passed through different types of trials: in vitro trials: in laboratory trials progut® have shown its ability to prevent e. coli attachment to gut mucus, to modify intestinal macrobiotic and stimulate immunity. progut® has consistently demonstrated beneficial effects on intestinal macrobiotic and immunity with different animal species. progut® in poultry feeds has led to improved vitality, feed utilization, better productivity and growth. better intestinal health and immunity improves performance and profitability in poultry production. therefore, this study was performed to investigate the effect of feed restriction and feed additive (progut®) on broiler growth performance, carcass traits and serum blood characteristics. 2. materials and mehtodes this experiment was done at fac. of agric., mans. univ., throughout september and october 2021. this experiment was conducted to evaluate the effects of four-time feed withdrawal at the second week of age (0, 6, 9, 12 hours/day) with or without feed additive (progut®) on broiler performance, carcass traits and some blood parameters. this experiment was designed in factorial arrangement (4×2). three hundred twenty unsexed one-day-old cobb-500 broiler chicks were randomly assigned to eight experimental treatments with four replicates each (10 birds in each replicate). all chicks were fed the starter (0-3 weeks of age) and grower-finisher diets (3-6 weeks of age). the experimental diets were offered to chicks ad libitum during the experimental period (six weeks of age) except during the second week of age which feed withdrawal was done. the experimental treatments 1, 3, 5 and 7 fed the basal diets without additive, however treatments 2, 4, 6 and 8 fed basal diets supplements with 1g progut/kg in starter diet and 0.5g/kg in grower-finisher diet. diets were formulated using feedstuffs analyses tables of nrc national research council [14]. table 1 shows feed component and calculated analysis of the experimental diets. each 3 kg premix contains: vit. a, 10000000 iu; vit. d3, 2000000 iu; vit. e, 10000 mg; vit. k, 1000 mg; vit. b11000 mg; vit. b2, 5000 mg; vit. b6, 1500 mg; vit. b12, 10 mg; folic acid, 1000 mg; biotin, 50 mg; pantothenic acid, 10000 mg; nicotinic, 30000 mg, fe, 30000 mg; mn,60000mg; zn, 50000 mg; i, 300mg; co,100mg; cu, 4000 mg; se, 100 mg and caco3 up to 3000 g. feed additive (progut®) was new generation yeast product. dose of broilers: starter: 1 kg/t; finisher: 0.5 kg/t. animal review, 2022, 9(2): 24-36 26 © 2022 conscientia beam. all rights reserved. table 1. composition of experimental diets of broiler chicks. grower-finisher diet starter diet ingredients 65.2 57.5 yellow corn 21.0 25.6 soybean meal 8.0 10.5 corn gluten 1.0 1.5 sun-flower meal oil 1.8 1.8 di-calcium phosphate 2 2 limestone 0.3 0.3 salt 0.3 0.3 premix 0.1 0.1 methionine 0.3 0.4 lysine 100 100 total calculated analysis (as fed basis: [14]) 3061 3050 metabolizable energy (me), kcal/kg 20.1 23.1 crude protein (cp), % 3.85 4.15 ether extract (ee), % 3.01 3.19 crude fiber (cf), % 0.70 0.72 total phosphorus % 0.46 0.47 available phosphorus% 1.21 1.22 calcium, % 0.46 0.52 methionine, % 0.81 0.91 methionine + cystine,% 1.05 1.62 lysine, % 2.1. chicken growth performance chicken’s live body weight (lbw) and feed intake (fi) were weekly recorded at replicate basis. body weight gain (bwg) and feed conversion ratio (fcr) were calculated. the cumulative means of lbw, fi, bwg, and fcr were calculated for the whole experimental period (0-42 days of age). 2.2. carcass traits of broiler chicks at the end of feeding trial (42 days of age), 5 chicks were randomly chosen from each treatment to perform slaughter test. feed was withdrawn for 8 h. before slaughtering. individual lbw of birds was recorded immediately before slaughtering. carcass traits were recorded. procedures for cleaning out were performed on the hot carcasses. weights of carcass yield (cy) and edible organs were determined and expressed as a percentage of live body weight at slaughter. 2.3. serum blood parameters five chicks from each treatment at 42 days of age were chosen to collect 5 serum blood samples. blood serum was separated by centrifugation process at 3000 rpm for 15 minutes. serum concentrations of total protein, albumin, globulin, total lipids, triglycerides, cholesterol, were measured by commercial kits (commercial kits: spectrum diagnostic kits s.a.e., egyptian company of biotechnology, 2016). 2.4. estimation of humoral immune response (igg) immunoglobulin g, (igm) immunoglobulin m, (iga) immunoglobulin a were measured by commercial kits in blood serum of chicks (commercial kits: spectrum diagnostic kits s.a.e., egyptian company of biotechnology, 2016). animal review, 2022, 9(2): 24-36 27 © 2022 conscientia beam. all rights reserved. 2.5. statistical analysis statistical processing of results was performed by using two-way analysis of variance of the general linear model (glm) procedure of the sas [15]. the significant differences between treatment means were separated by tukey’s multiple range-test (p<0.05). the following statistical model was used: yij = µ + fi + aj + faij + eij. where: yij = observed traits; µ = the overall mean; fi = effect of feed restriction; i= (0, 1, 2 and 3); tj = effect of additive (progut®); j = (1and 2); etij = effect of interaction between feed restriction and additive progut®; eij = experimental random error. 3. results and discussion 3.1. growth performance 3.1.1. live body weight of chicks table 2 showed final body weight (fbw) of chicks and total body weight gain were not affected by feed withdrawal or feed additive (progut®) and the interaction between them. however, feed withdrawal and feed additive were enhanced numerically final body weight and body weight gain. broiler chicks exposed feed withdrawal 12 hours/day during the 2nd week was decreased lbw compared with the group exposed feed withdrawal 6 hours/day. the interaction between feed withdrawal and feed additive did not affected in lbw at all the experimental periods and total weight gain. our results agree with those of van der klein, et al. [16] who showed that fbw on broiler chicks did not significantly affected by feed restriction. jang, et al. [17] demonstrated that exposed broiler chicks to feed restriction had positive compensatory on growth at the total period. khetani, et al. [6] reported that limited time feed of broiler chicks did not significantly affected on fbw compared with the control group. tolkamp, et al. [18] found that fbw of broiler chicks was not different by used limited time feed due to feed restriction has associated with compensatory growth and enhanced fcr. table 2. effects of feed withdrawal and feed additive (progut®) on live body weight (kg) of broiler chick. treatments weeks of age total body weight gain, kg 0-6 wks 0 1 2 3 4 5 6 feed withdrawal a1 (0 h) 0.046 0.143 0.352ab 0.616 1.101 1.465 1.891 1.845 a2 (6 h) 0.045 0.146 0.358a 0.641 1.080 1.511 1.977 1.932 a3 (9 h) 0.045 0.146 0.335ab 0.618 1.048 1.499 1.986 1.940 a4 (12 h) 0.045 0.152 0.327b 0.605 1.015 1.416 1.915 1.870 sem 0.001 0.003 0.008 0.018 0.024 0.033 0.040 0.040 p value 0.127 0.123 0.027 0.553 0.095 0.188 0.288 0.283 feed additive b1 0.045 0.149 0.333b 0.646a 1.041 1.445 1.902 1.86 b2(progut) 0.045 0.144 0.353a 0.594b 1.082 1.500 1.982 1.94 sem 0.001 0.002 0.005 0.013 0.017 0.023 0.029 0.029 p value 0.810 0.086 0.013 0.008 0.103 0.104 0.058 0.057 interactions ab a1×b1 0.046 0.145 0.347 0.673 1.101 1.453 1.855 1.809 a1×b2 0.046 0.141 0.357 0.558 1.101 1.476 1.926 1.880 a2×b1 0.045 0.148 0.351 0.657 1.054 1.468 1.920 1.876 a2×b2 0.045 0.145 0.364 0.625 1.105 1.555 2.034 1.988 a3×b1 0.045 0.146 0.320 0.636 1.019 1.451 1.922 1.877 a3×b2 0.045 0.146 0.349 0.601 1.077 1.548 2.049 2.004 a4×b1 0.046 0.158 0.312 0.617 0.988 1.409 1.910 1.864 a4×b2 0.045 0.146 0.342 0.593 1.043 1.422 1.920 1.875 sem 0.001 0.004 0.011 0.026 0.034 0.046 0.057 0.057 p value 0.569 0.453 0.686 0.269 0.812 0.726 0.738 0.741 note: a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. animal review, 2022, 9(2): 24-36 28 © 2022 conscientia beam. all rights reserved. however, zukiwsky, et al. [19] found that broiler exposed feed restriction had significantly increased fbw of broiler chicks compared with control group. also, abaseid, et al. [20] reported that feed withdrawal during 4th and 5th weeks of age had increased in fbw compared with control group. on the other hand, orso, et al. [21] reported that fbw of broiler chicks was decreased due to feed restriction. our results agree with those of aristides, et al. [22] who observed that broiler growth performance did not effect by used yeast in broiler diets. yalçın, et al. [23] reported that broiler fed diets containing yeast was not affected on fbw of broiler chicks. however, he, et al. [24] found that used yeast in broiler diets was improved fbw compared with control group. also, sun, et al. [25] found that broiler fbw increased by supplemented yeast in broiler diets. 3.2. feed intake, feed conversion ratio and economic efficiency of broiler chicks data in table 3 showed broiler chicks exposed to feed withdrawal during the 2nd week (9, 12 hours/day) was decreased fi compared with the control group in this week. feed additive was decreased fi for the 2nd, 3rd and 4th weeks of age and total feed intake. where broiler chicks diets supplemented with feed additive (progut®) were significantly improved total fcr compared with the control group. feed additive was significantly increased economic efficiency compared with that of the control group. the interaction between feed withdrawal and feed additive did not affect in fi at all experimental periods, fcr and economic efficiency. our results partially agree with those of shafiei, et al. [26] who found that used feed withdrawal time (6, 8, 10, 12 hours/day) had decreased fi of broiler chicks at 2nd week of age but did not affect in fcr. van der klein, et al. [16] showed that fcr of broiler chicks did not significantly affected by feed restriction. abaseid, et al. [20] reported that feed withdrawal during the 4th and 5th weeks of age had not effect on tfi compared with control group however; fcr was improved by feed withdrawal of broiler chicks. novel, et al. [27] found that fcr of broiler chicks did not significantly affected by reared broiler under feed restriction at levels (50% and 25%). on the contrary, zukiwsky, et al. [19] found that broiler exposed feed restriction had significantly improved fcr of broiler chicks compared with control group. orso, et al. [21] reported that fi of broiler chicks was decreased and fcr was improved compared with control by feed restriction. butzen, et al. [7] determined that exposed broiler chicks to 20 % feed restriction at 8-16 day of age had improved fcr of broiler. also, romero, et al. [28] found that reared broiler under feed restriction had decreased fi on broiler. urdaneta-rincon and leeson [29] reported that the improvement in economic efficiency by limited time feed on broiler chicks due to compensatory growth of broiler chickens and improved fcr. lippens, et al. [30] showed that used feed withdrawal of broiler chicks improved fcr resulted improved in economic efficiency associated with decreased feed cost. our results agree with those of ahiwe, et al. [13] who found that broiler fed yeast (1.5 to 2g/kg diets) was significant improved fcr. ding, et al. [31] reported that yeast supplemented in broilers diets was improved fcr. sousa, et al. [10] showed that fi did not affected by used yeast (6%) in broiler diets but improved broiler fcr. also, sun, et al. [25] observed that broiler fi decreased and improved fcr by supplemented yeast in broiler diets. haldar, et al. [32] found that used yeast in broiler diets improved fcr in broiler. in this meaning, zhang, et al. [33] and spring, et al. [34] reported that the improvement in fcr in broiler fed yeast in diets due to improving the digestibility of nutrients resulted by live yeast cell wall could alter the gastrointestinal microorganism to beneficial organisms. however, cabuk, et al. [35] showed that broiler diets supplemented with yeast did not affected on fi and fcr compared with control group. 3.3. carcass traits table 4 showed the effects of feed withdrawal and feed additive on carcass traits of broiler chicks (cobb 500). carcass weight and parts percentages of broiler chicks were not affected by reared under feed withdrawal during animal review, 2022, 9(2): 24-36 29 © 2022 conscientia beam. all rights reserved. the second week of age. feed additive in broiler diets was decreased on liver and goblets percentage compared with the control. also, the interaction between feed withdrawal and feed additive were no significant differences in carcass parts percentages. our results agree with those of zukiwsky, et al. [19] who observed that broiler exposed feed restriction had no effect on carcass parts percentage compared with control group. sherif and mansour [36] observed that broiler reared under feed withdrawal did not effected on carcass parts percentage. van der klein, et al. [16] showed that carcass and parts percentage on broiler chicks did not significantly affected by feed restriction. david and subalini [37] who reported that carcass and giblets percentages of broiler chickens did not affected by feed withdrawal (3, 5 and 7 hours daily). table 3. effects of feed withdrawal and feed additive (progut®) on feed intake (kg), total feed conversion ratio and economic efficiency (%) of broiler chick. treatments feed intake/weeks of age total feed conversion ratio economic efficiency 1 2 3 4 5 6 tfi feed withdrawal a1 (0 h) 0.122 0.299a 0.490 0.744 0.927 1.083 3.663 1.991 129.125 a2 (6 h) 0.125 0.300a 0.502 0.738 0.946 1.106 3.716 1.931 135.625 a3 (9 h) 0.120 0.265b 0.504 0.753 0.966 1.154 3.761 1.943 134.250 a4 (12 h) 0.126 0.256b 0.507 0.710 0.930 1.085 3.612 1.935 135.000 sem 0.0045 0.0061 0.0094 0.0166 0.0145 0.0237 0.0496 0.0264 3.030 p value 0.767 0.001 0.596 0.315 0.227 0.152 0.195 0.365 0.427 feed additive b1 0.125 0.301a 0.524a 0.775a 0.954 1.102 3.779a 2.041a 125.313b b2(progut) 0.122 0.259b 0.477b 0.698b 0.931 1.112 3.597b 1.859b 141.688a sem 0.0032 0.0043 0.0067 0.0118 0.0103 0.0168 0.0351 0.0187 2.143 p value 0.550 0.001 0.001 0.001 0.132 0.702 0.001 0.001 0.001 interactions ab a1×b1 0.123 0.345 0.530 0.800 0.945 1.084 3.826 2.118 117.000 a1×b2 0.121 0.253 0.450 0.688 0.909 1.082 3.501 1.864 141.250 a2×b1 0.128 0.322 0.521 0.776 0.959 1.078 3.781 2.026 127.000 a2×b2 0.122 0.279 0.483 0.701 0.934 1.135 3.651 1.837 144.250 a3×b1 0.120 0.276 0.539 0.782 0.967 1.158 3.842 2.048 124.250 a3×b2 0.120 0.253 0.469 0.724 0.965 1.150 3.680 1.837 144.250 a4×b1 0.128 0.261 0.506 0.741 0.943 1.090 3.669 1.971 133.000 a4×b2 0.125 0.250 0.508 0.679 0.916 1.080 3.556 1.898 137.000 sem 0.006 0.009 0.013 0.024 0.021 0.034 0.070 0.037 4.285 p value 0.974 0.004 0.021 0.656 0.860 0.711 0.4263 0.118 0.130 note: a-b: means within column with different superscripts are significantly different. a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. however, shafiei, et al. [26] found that used feed withdrawal time at 8, 10 hours/day had increased carcass weight of broiler chicks compared with other groups. abaseid, et al. [20] reported that feed withdrawal during the 4th and 5th weeks of age had increased in carcass of broiler chicks compared with control group. our results agree with those of yalçın, et al. [23] who reported that broiler fed diets containing yeast was not affected on carcass and parts percentage. fathi, et al. [38] reported that used yeast in broiler diets did not significant effected in carcass and giblet weight. chumpawadee, et al. [39] found that carcass and parts percentage did not affected by used yeast in broiler diets. waldroup, et al. [40] reported that carcass weight of broiler chicks did not affected by supplementation of broiler diet with bio-mos mannan oligosaccharide. on the contrary, ahiwe, et al. [13] found that broiler fed yeast (2g/kg diets) was significantly increased carcass percentage compared to control group. yildirim, et al. [41] reported that used yeast in broiler diets did not significant effected in liver and gizzard weight. animal review, 2022, 9(2): 24-36 30 © 2022 conscientia beam. all rights reserved. 3.4. blood parameters table 5, 6, 7 showed that the effects of feed withdrawal and feed additive (progut®) on some serum blood characteristic and immunity of broiler chicks (cobb 500). serum blood characteristic of broiler chicks were not affected by reared under feed withdrawal during the second week of age. feed additive supplemented on broiler diets had not significantly effect on serum blood characteristic, however significantly increased level of β globulin and decreased level of α globulin in serum blood. also, the interaction between feed withdrawal and feed additive were not significantly difference in serum blood characteristic. our results agree with those of sherif and mansour [36] who observed that broiler reared under feed withdrawal did not effected on plasma total protein, albumin, globulin, triglycerides and cholesterol of broiler chicks compared with the control group. shafiei, et al. [26] found that plasma globulin; cholesterol and triglyceride values did not affected by used feed withdrawal with broiler chicks. also, xu, et al. [42] showed that the plasma total protein, albumin or globulin of broilers did not affected by reared broiler chicks under feed withdrawal. afsharmanesh, et al. [43] found that broiler exposed of feed withdrawal did not effected on total cholesterol and triglycerides of blood broilers. adeyemi, et al. [44] found that broiler exposed of feed withdrawal did not effected on serum concentrations of total protein, albumin and globulin. table 4. effects of feed withdrawal and feed additive (progut®) on carcass traits % of broiler chicks at 42 days of age. treatments live weight (g) carcass % liver% gizzard% heart% giblet % tep % feed withdrawal a1 (0 h) 2340 71.249 2.557 1.401 0.561 4.519 75.767 a2 (6 h) 2386 72.091 2.134 1.379 0.569 4.082 76.173 a3 (9 h) 2264 72.305 2.294 1.216 0.596 4.106 76.411 a4 (12 h) 2250 72.054 2.356 1.233 0.579 4.168 76.222 sem 63.1862 0.4407 0.1300 0.0769 0.0269 0.1766 0.4431 p value 0.390 0.360 0.165 0.215 0.808 0.283 0.772 feed additive b1 2211b 71.814 2.484a 1.375 0.582 4.442a 76.256 b2(progut) 2409a 72.035 2.186b 1.239 0.570 3.996b 76.031 sem 44.6794 0.3116 0.0919 0.0543 0.0190 0.1249 0.3133 p value 0.004 0.621 0.029 0.086 0.659 0.017 0.6146 interactions ab a1×b1 2274 71.332 2.736 1.566 0.551 4.853 76.185 a1×b2 2406 71.165 2.378 1.237 0.570 4.185 75.349 a2×b1 2212 72.172 2.322 1.544 0.568 4.434 76.605 a2×b2 2560 72.010 1.946 1.214 0.570 3.730 75.740 a3×b1 2228 71.851 2.412 1.224 0.597 4.233 76.084 a3×b2 2300 72.759 2.176 1.208 0.595 3.980 76.738 a4×b1 2130 71.902 2.467 1.168 0.612 4.247 76.149 a4×b2 2370 72.206 2.246 1.298 0.545 4.089 76.295 sem 89.359 0.623 0.184 0.109 0.038 0.2497 0.627 p value 0.438 0.802 0.962 0.101 0.691 0.601 0.5478 note: a-b: means within column with different superscripts are significantly different. a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. tep = total edible parts. our results agree with those of he, et al. [24] who reported that used yeast in broiler diets did not effected in serum total protein, globulin, albumin and increased in lgg value. sun, et al. [25] reported that broiler fed yeast in their diet increased serum iga and igg and not effected on total protein. yalçın, et al. [23] reported that yeast supplemented in broiler diets did not effected in serum total protein, cholesterol and triglyceride. fathi, et al. [38] reported that used yeast in broiler diets (1, 1.25, 1.5 g/kg) did not significant effected in igg and igm at 21 day of age compared with control group. animal review, 2022, 9(2): 24-36 31 © 2022 conscientia beam. all rights reserved. on the contrary, ding, et al. [31] found that addition yeast in broiler diets enhanced serum igg in broilers indicate to improvement serum immunity. orso, et al. [21] reported that igy of serum was increased due to reared broiler chicks under feed restriction. cotter, et al. [45] showed that the mannanoligosaccharides of live yeast has a role in improving the immune response by enhancing immunoglobulin production in poultry. 3.5. total micro flora counts and some enzymes table 8 showed the effects of feed withdrawal and feed additive (progut®) on total micro flora counts and some enzymes of broiler chicks (cobb 500). feed withdrawal and feed additive used in broiler diets had significantly decreased on total micro flora counts and e coil and enhanced lacto bacillus, amylase and chymotrypsin. interaction between feed withdrawal and feed additive progut® were not significantly difference in total micro flora counts and some enzymes of broiler chicks. table 5. effects of feed withdrawal and feed additive (progut®) on serum blood parameters of broiler chicks. treatments total protein g/dl albumin g/dl globulin g/dl alb/glb r α globulin g/dl β globulin g/dl ɣ globulin g/dl feed withdrawal a1 (0 h) 5.580 2.550 3.030 1.620 0.980 0.760 5.580 a2 (6 h) 5.520 2.630 2.890 1.650 1.000 0.810 5.520 a3 (9 h) 5.480 2.520 2.960 1.620 1.020 0.840 5.480 a4 (12 h) 5.710 2.530 3.180 1.610 0.930 0.830 5.710 sem 0.102 0.094 0.135 0.038 0.039 0.034 0.102 p value 0.417 0.836 0.480 0.893 0.419 0.377 0.417 feed additive b1 5.540 2.555 2.985 1.610 1.030a 0.775b 5.540 b2 (progut) 5.605 2.560 3.045 1.640 0.935b 0.845a 5.605 sem 0.072 0.066 0.095 0.027 0.028 0.024 0.072 p value 0.528 0.958 0.660 0.441 0.021 0.051 0.528 interactions ab a1×b1 5.720 2.600 3.120 1.620 1.080 0.740 5.720 a1×b2 5.440 2.500 2.940 1.620 0.880 0.780 5.440 a2×b1 5.420 2.600 2.820 1.620 1.000 0.780 5.420 a2×b2 5.620 2.660 2.960 1.680 1.000 0.840 5.620 a3×b1 5.400 2.560 2.840 1.660 1.120 0.780 5.400 a3×b2 5.560 2.480 3.080 1.580 0.920 0.900 5.560 a4×b1 5.620 2.460 3.160 1.540 0.920 0.800 5.620 a4×b2 5.800 2.600 3.200 1.680 0.940 0.860 5.800 sem 0.144 0.132 0.191 0.054 0.055 0.049 0.144 p value 0.297 0.771 0.724 0.242 0.086 0.859 0.297 note: a-b: means within column with different superscripts are significantly different. a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. table 6. effects of feed withdrawal and feed additive (progut®) on serum blood parameters of broiler chicks. treatments total lipids mg/dl triglycerides mg/dl cholesterol mg/dl feed withdrawal a1 (0 h) 5.870 179.600 211.200 a2 (6 h) 5.750 178.100 206.500 a3 (9 h) 5.780 173.000 202.100 a4 (12 h) 5.530 178.800 210.200 sem 0.258 2.751 3.237 p value 0.816 0.335 0.203 feed additive b1 5.920 176.900 206.700 b2 (progut) 5.545 177.850 208.300 sem 0.182 1.946 2.289 p value 0.156 0.732 0.625 animal review, 2022, 9(2): 24-36 32 © 2022 conscientia beam. all rights reserved. treatments total lipids mg/dl triglycerides mg/dl cholesterol mg/dl interactions ab a1×b1 6.000 180.800 212.000 a1×b2 5.740 178.400 210.400 a2×b1 6.400 176.200 205.000 a2×b2 5.100 180.000 208.000 a3×b1 5.860 178.200 199.600 a3×b2 5.700 167.800 204.600 a4×b1 5.420 172.400 210.200 a4×b2 5.640 185.200 210.200 sem 0.365 3.891 4.578 p value 0.211 0.037 0.889 note: a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. table 7. effects of feed withdrawal and feed additive (progut®) on immunity serum blood parameters of broiler chicks. treatments igg mg/100ml igm mg/100ml iga mg/100ml feed withdrawal a1 (0 h) 9.975 2.540 0.825 a2 (6 h) 10.030 2.540 0.814 a3 (9 h) 9.958 2.511 0.842 a4 (12 h) 9.999 2.528 0.818 sem 0.040 0.040 0.015 p value 0.614 0.949 0.585 feed additive b1 9.976 2.507 0.816 b2 (progut) 10.005 2.553 0.834 sem 0.028 0.028 0.011 p value 0.474 0.253 0.260 interactions ab a1×b1 9.982 2.558 0.824 a1×b2 9.968 2.522 0.826 a2×b1 9.984 2.528 0.804 a2×b2 10.076 2.552 0.824 a3×b1 9.980 2.464 0.850 a3×b2 9.936 2.558 0.834 a4×b1 9.958 2.476 0.786 a4×b2 10.040 2.580 0.850 sem 0.057 0.056 0.022 p value 0.545 0.574 0.303 note: igg= immunoglobulin g; igm= immunoglobulin m; iga= immunoglobulin a. a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. our results agree partially with lunedo, et al. [46] who found that used feed restriction on broiler chicks reduced enterococcus and enter bacteriaceae enhanced lactobacillus counts. shafiei, et al. [26] found that used feed withdrawal time at 8, 10 hours/day had not effected on e. coli count however, lactobacilli count was enhanced by exposed broiler chicks 12 h feed withdrawal. also, siegerstetter, et al. [47] reported that broiler exposed high feed restriction improved lactobacillus and decreased escherichia/shigella. yan, et al. [48] reported that broiler exposed feed restriction had increased beneficial macrobiotic indicate to improved digestion in digestive tract. our results agree partially with ahiwe, et al. [13] who found that broiler fed yeast (1.5 to 2g/kg diets) was significantly enhanced trypsin and chymotrypsin of birds. ogbuewu, et al. [49] found that account pathogenic bacteria decreased in gut intestine due to increased acidic in intestine by used yeast in broiler diets. yalçın, et al. [23] reported that broiler fed diets containing yeast decreased e. coli colonization and increased total aerobic bacteria in jejunum and ileum of the broilers. https://kidshealth.org/en/parents/test-iga.html animal review, 2022, 9(2): 24-36 33 © 2022 conscientia beam. all rights reserved. table 8. effects of feed withdrawal and feed additive (progut®) on total micro flora counts in broiler intestine and some enzymes of broiler chicks. note: a-c: means within column with different superscripts are significantly different. a1 – 0 feed withdrawal time at the 2nd week of age, a2 = 6 feed withdrawal time at the 2nd week of age, a3 = 9 feed withdrawal time at the 2nd week of age and a4 = 12 feed withdrawal time at the 2nd week of age. b1 = without feed additive and b2 = with feed additive. treatments total bacteria count e. coli lacto bacillus. amylase lipase trypsin chemotrypsin feed withdrawal a1 (0 h) 12.875a 6.580a 6.105c 3.032c 10.050 27.413a 18.948b a2 (6 h) 11.088c 5.422b 6.653a 3.248a 11.215 25.305b 18.463b a3 (9 h) 11.782b 5.522b 6.542ab 3.180b 12.392 27.592a 20.665a a4 (12 h) 10.912c 5.367b 6.402b 3.042c 14.058 26.997a 21.117a sem 0.059 0.065 0.035 0.015 1.082 0.413 0.132 p value 0.001 0.001 0.001 0.001 0.097 0.005 0.001 feed additive b1 12.957a 6.915a 4.868b 3.116 12.224 26.154b 19.212b b2 (progut) 10.372b 4.530b 7.983a 3.135 11.633 27.499a 20.385a sem 0.042 0.046 0.024 0.011 0.765 0.292 0.093 p value 0.001 0.001 0.001 0.218 0.593 0.005 0.001 interactions ab a1×b1 14.800 8.170 4.280 3.200 10.130 27.223 19.133 a1×b2 10.950 4.990 7.930 2.863 9.970 27.603 18.763 a2×b1 12.563 6.520 5.193 3.113 10.650 24.020 16.873 a2×b2 9.613 4.323 8.113 3.383 11.780 26.590 20.053 a3×b1 12.713 6.520 5.153 3.150 11.730 27.040 19.940 a3×b2 10.850 4.523 7.930 3.210 13.053 28.143 21.390 a4×b1 11.750 6.450 4.843 3.000 16.387 26.333 20.900 a4×b2 10.073 4.283 7.960 3.083 11.730 27.660 21.333 sem 0.084 0.091 0.049 0.021 1.531 0.584 0.187 p value 0.001 0.001 0.001 0.001 0.215 0.336 0.001 4. conclusion the obtained results suggested that feed withdrawal used during the second week had not effect on broiler performance, carcass traits and serum blood characteristics and improved lacto bacillus, amylase and chymotrypsin. feed additive (progut®) in broiler diets improved broiler growth performance and improved intestinal health. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. authors’ contributions: all authors contributed equally to the conception and design of the study. references [1] f. butzen, m. vieira, a. kessler, p. aristimunha, f. marx, l. bockor, and a. ribeiro, "early feed restriction in broilers. ii: body composition and nutrient gain," journal of applied poultry research, vol. 24, pp. 198-205, 2015. [2] ö. cangar, j.-m. aerts, e. vranken, and d. berckmans, "online growth control as an advance in broiler farm management," poultry science, vol. 86, pp. 439-443, 2007. [3] r. vakili and f. akbarogli, "effect of feed restriction method during rearing on growth and blood indices of stress in broiler breeder," in proceedings of the xii european poultry conference, 2006, p. 6. [4] a. boostani, a. ashayerizadeh, f. h. mahmoodian, and a. kamalzadeh, "comparison of the effects of several feed restriction periods to control ascites on performance, carcass characteristics and hematological indices of broiler chickens," brazilian journal of poultry science, vol. 12, pp. 170-177, 2010. [5] j.-l. hornick, c. van eenaeme, o. gérard, i. dufrasne, and l. istasse, "mechanisms of reduced and compensatory growth," domestic animal endocrinology, vol. 19, pp. 121-132, 2000. [6] t. khetani, t. nkukwana, m. chimonyo, and v. muchenje, "effect of quantitative feed restriction on broiler performance," tropical animal health and production, vol. 41, pp. 379-384, 2009. animal review, 2022, 9(2): 24-36 34 © 2022 conscientia beam. all rights reserved. [7] f. butzen, a. ribeiro, m. vieira, a. kessler, j. dadalt, and m. della, "early feed restriction in broilers. i–performance, body fraction weights, and meat quality," journal of applied poultry research, vol. 22, pp. 251-259, 2013. [8] r. morales-lópez, e. auclair, f. van immerseel, r. ducatelle, f. garcía, and j. brufau, "effects of different yeast cell wall supplements added to maize-or wheat-based diets for broiler chickens," british poultry science, vol. 51, pp. 399-408, 2010. [9] s. m. roto, p. m. rubinelli, and s. c. ricke, "an introduction to the avian gut microbiota and the effects of yeast-based prebiotic-type compounds as potential feed additives," frontiers in veterinary science, vol. 2, pp. 1-18, 2015. [10] r. f. sousa, l. r. b. dourado, j. b. lopes, m. l. fernandes, r. k. kato, d. c. n. nascimento, n. k. sakomura, s. b. p. lima, and g. j. b. c. ferreira, "effect of an enzymatic blend and yeast on the performance, carcass yield and histomorphometry of the small intestine in broilers from 21 to 42 days of age," brazilian journal of poultry science, vol. 21, pp. 1–6, 2019. [11] y. shen, x. piao, s. kim, l. wang, p. liu, i. yoon, and y. zhen, "effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs," journal of animal science, vol. 87, pp. 2614-2624, 2009. [12] y. yang, p. iji, and m. choct, "effects of different dietary levels of mannanoligosaccharide on growth performance and gut development of broiler chickens," asian-australasian journal of animal sciences, vol. 20, pp. 1084-1091, 2007. [13] e. ahiwe, m. abdallh, e. chang'a, a. omede, m. al-qahtani, h. gausi, h. graham, and p. iji, "influence of dietary supplementation of autolyzed whole yeast and yeast cell wall products on broiler chickens," asian-australasian journal of animal sciences, vol. 33, pp. 579-587, 2019. [14] nrc national research council, nutrient requirements of poultry, 9th ed. washington, dc, usa: national academey of science, 1994. [15] sas, sas / stat userۥs guide: statistics cary. usa: sas institute inc, 2009. [16] s. van der klein, f. silva, r. kwakkel, and m. zuidhof, "the effect of quantitative feed restriction on allometric growth in broilers," poultry science, vol. 96, pp. 118-126, 2017. [17] i. jang, s. kang, y. ko, y. moon, and s. sohn, "effect of qualitative and quantitative feed restriction on growth performance and immune function in broiler chickens," asian-australasian journal of animal sciences, vol. 22, pp. 388395, 2009. [18] b. tolkamp, v. sandilands, and i. kyriazakis, "effects of qualitative feed restriction during rearing on the performance of broiler breeders during rearing and lay," poultry science, vol. 84, pp. 1286-1293, 2005. [19] n. zukiwsky, m. afrouziyeh, f. robinson, and m. zuidhof, "broiler growth and efficiency in response to relaxed maternal feed restriction," poultry science, vol. 100, p. 100993, 2021. [20] a. m. a. abaseid, a. m. sayda, m. y. m. el beeli, and h. o. abdalla, "effect of feed withdrawal on growth performance and carcass characteristics of heat stressed broiler chicken," u. of k. journal of agricultural sciences, vol. 21, pp. 83-98, 2013. [21] c. orso, m. l. moraes, p. c. aristimunha, m. p. della, m. f. butzen, r. v. krás, v. s. ledur, d. gava, c. c. mcmaus, and a. m. l. ribeiro, "effect of early feed restriction programs and genetic strain on humoral immune response production in broiler chickens," poultry science, vol. 98, pp. 172–178, 2018. [22] l. aristides, e. venancio, a. alfieri, r. otonel, w. frank, and a. oba, "carcass characteristics and meat quality of broilers fed with different levels of saccharomyces cerevisiae fermentation product," poultry science, vol. 97, pp. 33373342, 2018. [23] s. yalçın, h. eser, s. yalçın, s. cengiz, and o. eltan, "effects of dietary yeast autolysate (saccharomyces cerevisiae) on performance, carcass and gut characteristics, blood profile, and antibody production to sheep red blood cells in broilers," journal of applied poultry research, vol. 25, pp. 55–61, 2013. animal review, 2022, 9(2): 24-36 35 © 2022 conscientia beam. all rights reserved. [24] t. he, s. mahfuz, x. piao, d. wu, w. wang, h. yan, t. ouyang, and y. liu, "effects of live yeast (saccharomyces cerevisiae) as a substitute to antibiotic on growth performance, immune function, serum biochemical parameters and intestinal morphology of broilers," journal of applied animal research, vol. 49, pp. 15-22, 2021. [25] z. sun, t. wang, n. demelash, s. zheng, w. zhao, x. chen, y. zhen, and g. qin, "effect of yeast culture (saccharomyces cerevisiae) on broilers: a preliminary study on the effective components of yeast culture," animals, vol. 10, pp. 1-18, 2019. [26] a. shafiei, s. khavarinezhad, f. javandel, m. nosrati, a. seidavi, and s. s. diarra, "effects of duration of early feed withdrawal and re-feeding on growth, carcass traits, plasma constituents and intestinal microflora of broiler chickens," journal of applied animal research, vol. 46, pp. 1358-1362, 2018. [27] d. novel, j. ng’ambi, d. norris, and c. a. mbajiorgu, "effect of different feed restriction regimes during the starter stage on productivity and carcass characteristics of male and female ross 308 broiler chickens," international journal of poultry science, vol. 8, pp. 35-39, 2009. [28] l. romero, m. zuidhof, r. renema, a. naeima, and f. robinson, "characterization of energetic efficiency in adult broiler breeder hens," poultry science, vol. 88, pp. 227-235, 2009. [29] m. urdaneta-rincon and s. leeson, "quantitative and qualitative feed restriction on growth characteristics of male broiler chickens," poultry science, vol. 81, pp. 679-688, 2002. [30] m. lippens, g. room, g. de groote, and e. decuypere, "early and temporary quantitative food restriction of broiler chickens. 1. effects on performance characteristics, mortality and meat quality," british poultry science, vol. 41, pp. 343354, 2000. [31] b. ding, j. zheng, x. wang, l. zhang, d. sun, q. xing, a. pirone, and b. fronte, "effects of dietary yeast beta-1, 3-1, 6-glucan on growth performance, intestinal morphology and chosen immunity parameters changes in haidong chicks," asian-australasian journal of animal sciences, vol. 32, pp. 1558-1564, 2019. [32] s. haldar, t. ghosh, and m. bedford, "effects of yeast (saccharomyces cerevisiae) and yeast protein concentrate on production performance of broiler chickens exposed to heat stress and challenged with salmonella enteritidis," animal feed science and technology, vol. 168, pp. 61-71, 2011. [33] a. zhang, b. lee, s. lee, k. lee, g. an, k. song, and c. lee, "effects of yeast (saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks," poultry science, vol. 84, pp. 1015-1021, 2005.available at: https://doi.org/10.1093/ps/84.7.1015. [34] p. spring, c. wenk, k. dawson, and k. newman, "the effects of dietary mannaoligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of salmonella-challenged broiler chicks," poultry science, vol. 79, pp. 205-211, 2000. [35] m. cabuk, a. alcicek, m. bozkurt, and s. akkan, "effect of yucca schidigera and natural zeolite on broiler performance," international journal of poultry science, vol. 3, pp. 651-654, 2004. [36] k. s. sherif and a. m. mansour, "effect of feed restriction on broiler performance, blood parameters under summer conditions," egyptian journal of nutrition and feeds, vol. 22, pp. 155-165, 2019. [37] l. david and e. subalini, "effects of feed restriction on the growth performance, organ size and carcass characteristics of broiler chickens," scholars journal of agriculture and veterinary sciences, vol. 2, pp. 108-111, 2015. [38] m. fathi, s. al-mansour, a. al-homidan, a. al-khalaf, and m. al-damegh, "effect of yeast culture supplementation on carcass yield and humoral immune response of broiler chicks," veterinary world, vol. 5, pp. 651-657, 2012. [39] s. chumpawadee, o. chinrasri, t. somchan, s. ngamluan, and s. soychuta, "effect of dietary inclusion of cassava yeast as probiotic source on growth performance, small intestine (ileum) morphology and carcass characteristic in broilers," international journal of poultry science, vol. 7, pp. 246-250, 2008. [40] p. waldroup, c. fritts, and f. yan, "utilization of bio-mos® mannan oligosaccharide and bioplex® copper in broiler diets," international journal of poultry science, vol. 2, pp. 44-52, 2003.available at: https://doi.org/10.3923/ijps.2003.44.52. animal review, 2022, 9(2): 24-36 36 © 2022 conscientia beam. all rights reserved. [41] e. yildirim, i. yalcinkaya, m. kanbur, m. cinar, and e. oruc, "effects of yeast glucomannan on performance, some biochemical parameters and pathological changes in experimental aflatoxicosis in broiler chickens," reviews medicine veterinary, vol. 162, pp. 413-420, 2011. [42] c. xu, h. yang, z. wang, y. wan, b. hou, and c. ling, "the effects of early feed restriction on growth performance, internal organs and blood biochemical indicators of broilers," animal and veterinary sciences, vol. 5, pp. 121-125, 2017. [43] m. afsharmanesh, m. lotfi, and z. mehdipour, "effects of wet feeding and early feed restriction on blood parameters and growth performance of broiler chickens," animal nutrition, vol. 2, pp. 168-172, 2016. [44] o. adeyemi, c. njoku, o. odunbaku, o. sogunle, and l. egbeyale, "response of broiler chickens to quantitative feed restriction with or without ascorbic acid supplementation," iranian journal of applied animal science, vol. 5, pp. 393-401, 2015. [45] p. f. cotter, a. e. sefton, and m. s. lilburn, manipulating the immune system of layers and breeders: novel applications for mannan oligosaccharides. in: nutritional biotechnology in the feed and food industries, lyons, t.p. and k.a. jacques (eds). nottingham, england: nottingham university press, 2002. [46] r. lunedo, l. r. furlan, m. f. fernandez-alarcon, g. h. squassoni, d. m. campos, d. perondi, and m. macari, "intestinal microbiota of broilers submitted to feeding restriction and its relationship to hepatic metabolism and fat mass: fast-growing strain," journal of animal physiology and animal nutrition, vol. 103, pp. 1070-1080, 2019. [47] s.-c. siegerstetter, r. m. petri, e. magowan, p. g. lawlor, q. zebeli, n. e. o'connell, and b. u. metzler-zebeli, "feed restriction modulates the fecal microbiota composition, nutrient retention, and feed efficiency in chickens divergent in residual feed intake," frontiers in microbiology, vol. 9, p. 2698, 2018. [48] w. yan, c. sun, j. yuan, and n. yang, "gut metagenomic analysis reveals prominent roles of lactobacillus and cecal microbiota in chicken feed efficiency," scientific reports, vol. 7, pp. 1-11, 2017. [49] i. ogbuewu, v. okoro, e. mbajiorgu, and c. mbajiorgu, "yeast (saccharomyces cerevisiae) and its effect on production indices of livestock and poultry—a review," comparative clinical pathology, vol. 28, pp. 669-677, 2019. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. 1 © 2024 conscientia beam. all rights reserved. one health approach on zoonotic helicobacter pylori in animals and man nourhan eissa1+ maha a. mohamed2 rahma s. shahban3 salma m. badrkhan4 jana f. mohamed5 somaya a. elsayed6 ola h. harb7 1department of animal hygiene and zoonoses, faculty of veterinary medicine, university of sadat city, egypt. email: vet_noura@yahoo.com 2department of biophysics, faculty of science, cairo university, egypt. email: mhmohamed2013@gmail.com 3department zoology and chemistry, faculty of science, cairo university, egypt. email: rrsaid315@gmail.com 4faculty of veterinary medicine, cairo university, egypt. email: shamms951@gmail.com 5faculty of physical therapy, cairo university, egypt. email: janafouad093@gmail.com 6department of chemistry, faculty of science, menoufia university, egypt. email: somayaelsayed@hotmail.com 7department of bacteriology, immunology and mycology, faculty of veterinary medicine, university of sadat city, egypt. email: ola.harb1373@vet.usc.edu.eg (+ corresponding author) abstract article history received: 21 october 2024 revised: 27 november 2024 accepted: 9 december 2024 published: 18 december 2024 keywords control diagnosis epidemiology h. pylori risk factors zoonoses. zoonotic disease-causing microbes are those naturally spread from animals to people, either directly or indirectly, with a serious hazard on the public health. emerging zoonoses are mostly caused by travel, animal transhumance, population increase, and migration from rural to urban regions. regarding the principal transmission route of helicobacter pylori (h. pylori), one of the most global prevalent anthroponotic illnesses, not a lot of information is currently known. in the 20th century, h. pylori contribute to individuals stomach problems and cancer. subsequently, an extensive amount of study has been conducted on the epidemiology of this intestinal infection, revealing that the likelihood of illness varies throughout individuals. this is a concise overview of the several epidemiological factors connected to zoonotic h. pylori infection. there are notable differences in the epidemiology of h. pylori in human and animal populations between developing and developed nations. moreover, a multiplicity of consistent lines of evidence suggests that demographic data, different individual habits, socioeconomic position and living conditions are the main risk factors influencing the acquisition rate of h. pylori pathogen. these results are troubling since they are expected to change global demography and increase the number of people susceptible to h. pylori and its emergence. to reduce the danger to public health and the associated economic effects, stakeholders in the h. pylori management plan need to start merging technological, social, political, policy, and regulatory problems and working together. an active mitigation program offers the chance to address global health concerns and halt the development of zoonoses. contribution/originality: the current study provides an overall view on the zoonotic impact of h. pylori in different animals and humans as an aid in health education of the public about the danger of the disease, sources, reservoirs transmission modes, epidemiology, different diagnostic tools, methods of prevention and control. animal review 2024 vol. 11, no. 1, pp. 1-17. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v11i1.4005 © 2024 conscientia beam. all rights reserved. https://orcid.org/0000-0002-3622-6023 https://orcid.org/0000-0003-0936-9130 https://orcid.org/0000-0002-2082-7692 https://orcid.org/0000-0002-0407-1151 https://orcid.org/0009-0003-9056-0027 https://orcid.org/0009-0005-8079-5206 https://orcid.org/0009-0003-5606-1937 mailto:vet_noura@yahoo.com mailto:mhmohamed2013@gmail.com mailto:rrsaid315@gmail.com mailto:shamms951@gmail.com mailto:janafouad093@gmail.com mailto:somayaelsayed@hotmail.com mailto:ola.harb1373@vet.usc.edu.eg https://www.doi.org/10.18488/92.v11i1.4005 animal review, 2024, 11(1): 1-17 2 © 2024 conscientia beam. all rights reserved. 1. introduction naturally, microorganisms that cause zoonotic illnesses can spread from animals to people. human health is seriously threatened by the present zoonotic disease epidemic, especially for those with close contact with domestic or wild animals and reside in underdeveloped areas [1-13]. the main way for different illnesses transmission is spread, either directly or indirectly, from animals to humans. the main causes of the emergence of new zoonotic illnesses are changing patterns between rural and urban areas, animal transhumance, international travel, and climate change [1-13]. two species of campylobacter belong in the genus helicobacter, according to parija [14]. these are campylobacter mustelae, also known as helicobacter mustelae, and campylobacter pylori, now known as helicobacter pylori. there are currently 47 species recognized in the genus helicobacter, a considerable increase from earlier estimates [15]. based on ecological settings and phylogenetic analyses, this genus of bacteria are roughly classified into: stomach (gh) and enterohepatic (ehh) helicobacter species [16]. h. pylori, often known as helicobacter pylori, is the species that has attracted the most attention from researchers. up to 50% of people worldwide suffer from some of the most severe human illnesses, which are caused by h. pylori. but in recent years, new illnesses and perhaps zoonotic infections have increased the significance of the remaining gh. reviews [17-19] have already addressed the evolution of these gastrointestinal species' taxonomy, epidemiology, and clinical significance. that being said, not much research has been done on ehh. but, there has been evidence linking ehh members to a range of human ailments, including acute gastroenteritis, inflammatory bowel disease, and problems related to the liver, gallbladder, and bile duct [19]. since the most recent research on ehh has piqued interest, more investigation is required to ascertain the possible significance of these recently discovered ailments. given this, the present review offers a brief of the current understanding of taxonomy, clinical relevance, and epidemiology of ehh with respect to animal hosts. 2. etiology employing helicobacter pylori as a model organism. every single individual from the helicobacter genus possesses the following physical traits: fusiform bacteria do not create spores and have a size range of 0.2 to 1.2 to 1.5 to 10 µm. they also generate cytochrome oxidase. in addition to having a helical, curved, microaerophilic, spiral, or rod-shaped structure where cells can become coccoid when exposed to air or become old cultures, they can also be gram-negative and feature periplasmic fibers. one or more sheathed or unsheathed flagella are what allow them to move. the majority of them grow well at 37 °c and are carbohydrate-free [20, 21]. 2.1. taxonomy table 1. taxonomy of helicobacter pylori according to polaka, et al. [21]. phylum: campylobacterota class: campylobacteria order: campylobacterales group: proteobacteria subgroup: epsilon subgroup of proteobacteria family: helicobacteraceae genus: helicobacter most known pathogenic species: helicobacter winghamensis, helicobacter pullorum, helicobacter canadensis, helicobacter apodemus, helicobacter hepaticus, helicobacter cinaedi, helicobacter equorum, helicobacter trogontum, and helicobacter mustelae are among the species of helicobacter that are commonly found in the stomach. table 1 presents that the taxonomic categorization of helicobacter has been hampered by the limited function of the 16s rrna gene, which is recognized as the "gold standard" gene for bacterial phylogeny. it is true to say that animal review, 2024, 11(1): 1-17 3 © 2024 conscientia beam. all rights reserved. 16s rdna is insufficient for identification of variant helicobacteraceae species because of the potential for misidentification [22]. this is in line with the creation of mosaic molecules lacking phylogenetic information and the horizontal transport of 16s rrna gene segments [23]. a greater number of identified pertinent phylogenetic markers have been examined to provide a more precise taxonomic evaluation of helicobacter species. a few of these markers are gyra, gyrb, cpn60, and atpa [23-26]. 2.2. virulence factors thanks to the identification and examination of more relevant phylogenetic markers, the taxonomic identity of helicobacter species may now be ascertained with greater certainty. several of these markers include gyra and gyrb [23] cpn60 [24] and atpa [25]. this gave information on the progression of the disease and assisted in identifying several virulence factors. since then, efforts have been made to determine the genes responsible for the virulence mechanisms of enterohepatic species. the orthologues of peb1 campylobacter coli and campylobacter jejuni, which are present in helicobacter apodemus and helicobacter hepaticus, have been shown to have an effect on adhesion [27]. additionally, it was shown that five ehh species—helicobacter hepaticus, helicobacter cinaedi, helicobacter equorum, helicobacter trogontum, and helicobacter mustelae—carry h. pylori homologs, such as hor, hom, hop, and maybe hord and horg. they are referred to as "hof-like outer membrane proteins" (omps). the bulk of omps, which are hop proteins, have a porin or sticky quality that aids in the pathogens' adhesion to the mucosal surface [28]. the existence of homologous genes is also established. these include virulent adhesin/omps flpa (fibronectinlike protein a), enables adherence of ehh species to the extracellular intestinal fibronectin, and irga (a virulence protein, is iron-regulated outer membrane protein), which appears in the enteric bacteria as campylobacter spp., escherichia coli, and salmonella enterica [29]. the urease gene cluster in helicobacter mustelae (ureabiefgh; urea2b2), cell-binding factor 2, gammaglutamyl transpeptidase, orthologs of systemic factor protein a (sfpa) and lipid a deacylase (lpxr), "immune evasion" genes (futa, futc, rfaj), and the outer membrane protein phospholipase a (ompla) are additional factors linked to ehh. additionally noted are genes associated with "secretion systems" (virb2, virb3, virb4, virb5, virb6, virb8, virb9, virb11, vird4, cag) and the hhgi1 type vi secretion system (icmf, hpc, vrgg). additionally, it was found that the cag-pai type iv secretion system (t4ss) is linked to the genes "helicobacter apodemus" and "helicobacter typhlonius". this route promotes cell division and proliferation, which in turn helps the bacterial gene caga enter stomach and aid in h. pylori pathogenesis. the latter species' dna was found to lack caga, and its relationship to t4ss is still unclear [30]. the only known cytotoxin of this bacterial family, cytolethal distending toxin (cdt), is translated by a collection of genes named cdta, cdtb, and cdtc, which occur in some species of ehh and other gram-negative bacteria [31]. this toxin, which is made up of the three subunits cdta, cdtb, and cdtc, is a heterotrimeric ab2 toxin [32]. the active "a" component of the ab2 toxin, cdtb, is transported into cells by the combination of the two binding "b" subunits, cdta and cdtc. cdtb is taken up from the host cell surface by the endoplasmic reticulum, the golgi apparatus, and the nucleus in a clathrin-dependent manner after adhering to the cell surface [16]. cdtb is structurally and functionally similar to mammalian dnase i. in a cell, it could result in chromosomal dna double strand breaks (dsbs). moreover, cdtb has been shown to have phosphatase activity, which speeds up t-cell death [33]. apoptosis and distention are the outcomes of the host cell cycle arrest that these two cdtb activities induce at the g2/m phase [33]. the existence of the toxin, its effects in vivo and in vitro, and the genes that encode it have all been reported by many ehh. furthermore, a putative cytotoxin homologs that were resembled the vaca gene were found to be present in "helicobacter winghamensis", "helicobacter pullorum", "helicobacter canadensis", and " animal review, 2024, 11(1): 1-17 4 © 2024 conscientia beam. all rights reserved. helicobacter apodemus" [34]. further investigation is required to ascertain the role this putative cytotoxin plays in virulence. additional factors that have been linked to the pathogenicity of bacteria include the n-linked protein glycosyltransferase, similar to the general protein glycosylation (pgl) genes in campylobacter jejuni. these genes facilitate attachment and entry into the epithelial cells of the host, even in vitro or in vivo. additionally, the campylobacter major protein (cmp), helicobacter pullorum ortholog, is responsible for both activity and adhesion to the cultured cells, according to ehh. pro-inflammatory cytokine release, the ability to resist complement protein degradation in vitro, and the durability of colonization in vivo are all linked to this [34]. 2.3. antibiotic resistance the global enormous issue of increasing antibiotic resistance among bacterial pathogens [8, 9] researchers began to study the mechanism of antibiotic resistance of different bacteria in a trial to evolve novel medications against them [8, 9]. however, the techniques of determining one's susceptibility to an ehh infection and managing the infection are not standardized. it is true that the clinical and laboratory standards institute (clsi) does not currently have any guidelines available for evaluating the antibiotic susceptibility of helicobacteria that are not helicobacter pylori (nhph). this is because helicobacter is a species that has particular growth requirements, which makes it challenging to develop precise techniques for determining the minimal inhibitory concentration (mic) [22]. ehh species have also been compared to conventional antibiotics (b-lactams, tetracyclines, aminoglycosides, fluoroquinolones, phenicols, diaminopyrimidines, carbapenems, glycopeptides, and sulphonamides) used to treat campylobacter sp. infections [35, 36]. amoxicillin is commonly used in mixed therapy to treat ehh infections because it works by getting rid of h. pylori [37]. despite the fact that other helicobacter species benefit from this treatment, the scant information now available raises concerns over the antibiotic sensitivity of these species [38]. 3. reservoirs of the infection 3.1. pet animals in terms of carrying ehh, dogs are the companion animal that are exposed to the various examinations. however, it is hitherto how ehh reservoirs could affect the future zoonotic transmission. a limited culture-based studies presented helicobacter cinaedi, helicobacter bilis, and helicobacter canis in feces of both healthy and diarrheal dogs offer most of the available ehh data in dogs [39]. the high incidence of these organisms in dogs implies that ehh might be a part of the canine microbiota, despite the lack of evidence demonstrating any beneficial or healthpromoting effects on their hosts [40]. abundant research of bacteraemia due to helicobacter canis in the immunosupressed individuals have been linked to close contact with infected dogs [41]. in addition, contact with infected cats also might be linked with helicobacter canis [38]. 3.2. livestock (farm animals) research on the connection between ehh and farm animals has been less extensive than that on campylobacteria. sheep are reservoirs for most zoonotic diseases, as evidenced by the recent isolation of helicobacter canis from their manure [42]. moreover, egypt has provided phylogenetic evidence in favor of the theory that humans acquired helicobacter canis from sheep [43]. in fact, a transmission dynamic might be linked to h. pylori, that fact is also showed in individuals with direct or indirect contact with sheep [44]. animal review, 2024, 11(1): 1-17 5 © 2024 conscientia beam. all rights reserved. 3.3. wildlife initially, a significant quantity of ehh was found in the waste products of wild animals including rats and birds. since ehh often affects numerous organs, it is unclear if these wild animals are true reservoirs for the sickness [45]. both wild rats and laboratory animals harbor these infections [46]. furthermore, several species of helicobacter have been found in wild birds [47]. research on the toxicity, clinical relevance, and zoonotic potential of most of these freshly found species remains necessary. 4. transmission of h. pylori infection table 2 explains both the direct and indirect routes of h. pylori transmission in animals and man, where the direct (main) route is oral route while the indirect (secondary) route is via contact. table 2. explains the transmission routes of h. pylori. direct transmission route indirect transmission route mainly through ingestion of the pathogen (oral transmission) via vomitus, feces, chopsticks, oral microbiota [48, 49] it is not a primary route. occurs through contact with food, water, and animals have all been reported to contain h. pylori or its dna [48]. 5. determinants of h. pylori epidemiology (risk factors) all the associated risk factors of acquisition of h. pylori concerning host factors, environmental factors and even pathogenic factors, are already shown in figure 1. figure 1. shows the schematic draw on risk factors of h. pylori. 6.1. host factors 6.1.1. age one of the most well-established and rarely contested features of the infection's epidemiology is the impact of age on the frequency of h. pylori infection. age and prevalence have been found to be strongly correlated in both developed and developing nations [50]. animal review, 2024, 11(1): 1-17 6 © 2024 conscientia beam. all rights reserved. the trend of adults having a higher frequency of infection than children has been partially explained by the birth cohort phenomenon, which was brought on by a greater prevalence in the past as a result of unsanitary living circumstances and inadequate sanitation [51]. 6.1.2. ethnic and genetic predisposition helicobacter pylori seroprevalence has been observed to differ significantly among people of different racial and cultural backgrounds [52]. according to certain theories, malaysian chinese and indian communities are more likely to contract h. pylori infection due to genetic predispositions [53]. ethnicity has been identified by a number of new zealand demographic groupings as a risk factor. maori had an intermediate prevalence of h. pylori infection, while europeans had the lowest prevalence. ethnicity was a significant covariate even after consideration of other variables like age and even socioeconomic levels [54]. however, an american study discovered that while the prevalence of h. pylori infection was somewhat greater in caucasians, it was almost the same in african americans and hispanic americans. however, socioeconomic circumstances were blamed for the observed variance and ethnicity was rejected as a relevant component [55]. in conclusion, studies on monozygotic and dizygotic twins revealed a possible genetic component to the frequency of h. pylori infection [56]. 6.1.3. gender studies evidenced that one sex/gender is more susceptible to infection than the other [2, 3, 9]. for example, it was shown that h. pylori infection was more among men than among women [57]. additional investigation shows that the incidence of h. pylori illness is not gender-specific [58]. 6.1.4. interfamilial relations the effect of interfamilial interactions on the h. pylori pathogen's transmission from adult to kid, particularly mother-to-child transmission, was the subject of earlier research [59]. moreover, it was suggested that parents or siblings could contract the virus from sick children [60]. h. pylori disease has also been represented to be favorably influenced by family size; the likelihood of infection in a home rises with the number of children residing there [61]. records of transfers between spouses were also kept [62]. 6.1.5. socioeconomic factors the likelihood that an h. pylori infection will spread is apparently significantly influenced by socioeconomic position [63]. on the other hand, higher socioeconomic status of inhabitants may be linked with h. pylori lower prevalences in developed countries [53]. the linkage between increasing age and increased frequency of h. pylori in underdeveloped countries would be directly related to low socioeconomic position. it should go without saying that socioeconomic standing includes elements like living standards, sanitization, urbanization, and educational attainment in addition to social class and money [64]. when taken as a whole, these variables may raise the chance of contracting infectious diseases generally. 6.1.6. crowding index (density of living) living in close quarters, sharing a bed, and having more household contact have all been related to an increased risk of h. pylori infection [65]. one's current h. pylori status is influenced by their upbringing in close quarters, and having more children in the house increases an adult's risk of infection [66]. animal review, 2024, 11(1): 1-17 7 © 2024 conscientia beam. all rights reserved. 6.1.7. lifestyle habits 6.1.7.1. breast-feeding according to dore, et al. [36] no statistical difference was shown in h. pylori seropositivity among children residing either urban or rural districts according to the infants' breastfeeding status. nevertheless, a prospective population-based investigation on asymptomatic neonates in the czech republic found that children who had never been nursed had a higher incidence of h. pylori [61]. however, children from low socioeconomic families in lagos, nigeria did not show any correlation or duration of h. pylori infection with exclusive nursing [62]. it has been suggested that breastfeeding serves as a natural antibiotic, shielding infants from illness. so, if mothers' breath milk included more anti-h. pylori iga than if it contained less, children were less likely to contract the virus [63]. 6.1.7.2. food studies have shown that dairy products, particularly raw milk, contain h. pylori dna, which is thought to be the primary food transmission mechanism [53]. traditional cheese and ovine milk were shown to be the most often contaminated items by dore, et al. [36] suggesting that milk consumed by humans may be affected. similar outcomes were also represented for raw cow milk specimens from farms in america [53] greece [64] and japan [60]. significantly, it was discovered by talaat al sherief and thabet [65] that milk and dairy products were often the source of h. pylori strains that were resistant to antibiotics. another notion about the potential reservoir of h. pylori is meat. it has been suggested that shepherds and their families may contract h. pylori from sheep [66]. direct interaction with sheep and sheepdogs may be connected to it. eating raw veggies can put a person at risk for h. pylori [53]. because of tainted washing water, raw veggies may have included h. pylori. thus, insufficient or nonexistent wastewater disinfection may enhance h. pylori persistence and is most likely a significant contributing factor to the chain of events that leads from people to bacteria. however, given the link between the condition and a lower socioeconomic standing, individuals with poor nutritional status may be more vulnerable to h. pylori infection [67]. 6.1.7.3. habits of tobacco smoking and even alcohol drinking research on the relationship between alcohol and tobacco use and h. pylori infection has produced a variety of results. despite the fact that gunathilake, et al. [68] showed no connection between alcohol or tobacco use and the development of h. pylori infection, smoking tobacco was found to be substantially linked to h. pylori seropositivity in adult japanese persons [69]. research conducted in northern ireland has revealed a favorable link between smoking and h. pylori infection. however, no significant correlation has been observed between alcohol use and smoking [70]. the higher stomach acidity caused by smoking may account for the unfavorable correlation between tobacco usage and illness. moreover, it has been proposed recently that nonsmokers and heavy alcohol users may be less susceptible to h. pylori infection than the general population [71]. 6.1.7.4. close contact with animals numerous research investigations looked at the processes by which various zoonotic bacteria could infect people as well as the toxicity of the bacteria in animals [1-13, 72]. ehh, however, has been given a considerable degree of zoonotic significance because it has been demonstrated that frequent and intimate human-animal contact is harmful [34]. animal review, 2024, 11(1): 1-17 8 © 2024 conscientia beam. all rights reserved. 6.1.8. occupation the risk of h. pylori in healthcare workers who work with patients has been the subject of numerous research. hospital work with a direct patient contact has been found to be a substantial risk for infection in comparison with other jobs without such contact [73]. as a result, research revealed that nursing staff was more likely than technical and administrative professionals to have an h. pylori infection [74]. 6.2. pathogen factors 6.2.1. microbiota the makeup of the gut microbiota may be influenced by a wide range of factors, such as lifestyle choices, infections, diseases, and environmental pollutants [75]. in stomach cancer dysbiosis, helicobacter abundance and microbial diversity are both reduced [76]. disease states have been associated with reduced microbial diversity; reports of this have been presented for inflammatory and malignant disorders [77]. according to zhang [75] h. pylori affects the intestinal microbiota indirectly in addition to influencing the makeup of the stomach microbiota in the animal model. moreover, the age-dependent immune responses of h. pylori-infected mice may influence the host's vulnerability to illness and infection [78]. an infant's microbiome may be significantly influenced by the shared microbiota of parents and children. 6.2.2. biological risk factors there are set of biological risk factors linked to increase the incidence of cancer among individuals. for example, viruses in humans account for 10% to 20% of cancer incidence globally. numerous experimental and epidemiological investigations have verified the link between anal cancer and the papillomavirus of humans. likewise, cancer of the upper and lower gastrointestinal tracts is probably caused by the epstein-barr virus (ebv) and the john cunningham virus (jcv) [79]. in a similar vein, human carcinogenicity has been linked to parasite illnesses such as schistosomiasis, opisthorchiasis, and clonorchiasis [80]. numerous bacteria have been connected to different neoplasms, such as chlamydia pneumoniae, salmonella typhi, and streptococcus bovis; however, it is unclear how these bacteria may aid in the development of cancer [81]. although h. pylori, prevotella copri, and propionibacterium acnes are critical factors for stomach cancer, a previously published case-control research [82] found that lactococcus lactis acts as a protective factor against stomach cancer. the main biological agent for stomach cancer is h. pylori pathogen. numerous studies that have looked at the various facets of this correlation have found a link between stomach cancer and h. pylori infection [83]. 6.3. environmental context 6.3.1. rural vs. urban living conditions one of the variables increasing the acquisition of h. pylori in people in the world is the variation in living conditions between urban and rural areas. there were more children living in rural regions than in urban areas [68]. socializing with dogs appears to have benefits, particularly in rural settings. in urban areas, the infection rate of h. pylori was substantially correlated with the parents' socioeconomic status, whereas in rural areas, there was no association between the head of the household's employment status and the incidence of infection [77]. 6.3.2. water hygiene water may be a significant source of h. pylori contamination, according to a number of epidemiologic studies [78]. due to the unsanitary distribution of water among the populace, waterborne infections—especially in poor nations—are the primary cause of h. pylori infections. in japan, well water containing h. pylori dna was tested positive for the infection by customers [79]. accordingly, two studies—one from portugal and the other from animal review, 2024, 11(1): 1-17 9 © 2024 conscientia beam. all rights reserved. germany—found a favorable correlation between h. pylori infection and well water intake [43, 84]. furthermore, it has been proposed that h. pylori contamination may exist in japanese river water [82]. public health is concerned about the possibility of live h. pylori infecting cells in water samples [83]. these results provide credence to the theory that water tainted with excrement could serve as a reservoir for the propagation of h. pylori. according to some theories, h. pylori's capacity to produce biofilm allows it to proliferate in natural water sources and water distribution networks [54]. when the temperature is over 20 °c, the optimal temperature range for h. pylori cultivability in water is fewer than ten hours [85]. the morphological transformation of bacteria into a rod shape, which is connected to the turnover of peptidoglycan (pg), is linked to the development of a culturable phenotype in water [54]. consequently, h. pylori undergoes a morphological transformation from a spiral form to a coccoid form and becomes a viable but not culturable (vbnc) pathogen few days after being injected into water [85]. 7. epidemiology of h. pylori (global distribution) in the past year, a lot of study has been done on the frequency of mutations associated with h. pylori and antibiotic resistance in patients with oncological illnesses (pancreatic cancer, colorectal cancer, gastric carcinoma, etc.). alaridah, et al. [86] study ma, et al. [87] examined 933 jordanians' general population's awareness and information regarding h. pylori. stomach cancer is highly prevalent among neoplasms in terms of occurrence in the country. 68.7% of participants are ignorant as possible considerations for stomach cancer, despite this and the fact that 63% of participants had a higher education degree [88]. in a different study, researchers looked at patients from over 360 us hospitals (18–65 years old, or 47,714,750 overall) to find out how much of a risk h. pylori infection had for colorectal cancer. based on a large population-based analysis, the correlation between occurrence of colorectal cancer and h. pylori illness (or 1.89, 95%ci: 1.69-2.10) has not been demonstrated before [88]. a different casecontrol study carried out in the usa looked at five prospective cohorts to see if there was a connection between pancreatic cancer and h. pylori illness. investigators declared that no significant relation was found between pancreatic cancer risk and h. pylori infection (or 0.83, 95% ci: 0.65-1.06) [89]. the frequency of evolutions related to clarithromycin resistance and the connection between virulence factors and h. pylori infection were the subjects of a study carried out in mexico. to get rid of h. pylori, a treatment strategy based on clarithromycin is required. the researchers discovered a greater than 15% frequency of mutations connected to clarithromycin resistance in addition to a linkage between 23s rrna gene alterations and caga and vaca genotypes. a2143g (56%) and a2142c (25%) were the most prevalent alterations, according to husnik, et al. [90]. there are several challenges associated with h. pylori infection. for more than 40 years, a large number of studies on risk factors, vaccination prophylaxis, effective eradication therapy, and interruption of transmission pathways have been carried out. the world gastroenterology organization (wgo) updated its h. pylori guidelines by using the "cascade" technique, which distills the management basics on regional resources and expertise [91]. with a total population of 2,163, alaridah, et al. [86] looked at 22 studies from 9 african countries to calculate the rate of h. pylori eradication in that continent, showing a pooled elemination rate of 79% (95% ci: 75%-82%), associated with a heterogeneity rate of 93.02%. an increased percentage of eradication (85%) was found in observational research as compared to randomized control trials (77%). ivory coast had the lowest eradication rate (22.3%) while ethiopia had the highest (90%). the occurrence of h. pylori infection in africa will be impacted by long-term eradication initiatives. of the 1,160 cases included in a pakistanian study conducted by boustany, et al. [92] 48% were h. pylori positive. that research was carried out to reveal the frequency and various features of h. pylori. higher incidence rates were seen among men between the ages of 20 and 40, the illiterate, diners at restaurants, users of municipal water systems, owners of pets, animal review, 2024, 11(1): 1-17 10 © 2024 conscientia beam. all rights reserved. and people who had interacted with animals. additionally, a linkage was discovered between h. pylori prevalence and sociodemographic characteristics [94]. 8. clinical importance different clinical signs can be recorded in cases infected with h. pylori either in animals or even humans as explained in table 3. table 3. clinical manifestations of helicobacteriosis in animals and man according to lee, et al. [93] and alarcónmillán, et al. [94]. in humans in animals can induce: diarrhoea bacteraemia systemic disease development of neoplasia gastroenteritis proctocolitis cellulitis arthritis septicaemia inflammatory bowel disease (ibd) crohn’s disease (cd) ulcerative colitis (uc) hepatobiliar disease may be asymptomatic or may include: inflammatory bowel disease (ibd) biliary and liver diseases gastric, breast, colon, and liver cancers rectal prolapse ovine abortion vibrionic hepatitis in laying hens episodic diarrhoea in cats 9. diagnosis of h. pylori infection there are many available direct and indirect diagnostic tools of zoonotic h. pylori available in both human and animals' fields as shown in figure 2. figure 2. presents the available diagnostic tools of h. pylori according to katelaris, et al. [95]. animal review, 2024, 11(1): 1-17 11 © 2024 conscientia beam. all rights reserved. 10. treatment of h. pylori infection there are many treatment lines concerning the treatment of h. pylori in animals and man as shown in table 4. table 4. presents ideal conventional lines of medications used for h. pylori infection. line of medication drugs used references first and second line clarithromycin, amoxicillin, clarithromycin, and proton pump inhibitor (ppi) bismuth-containing triple therapy fekadu, et al. [96] third line bismuth-based quadruple treatment amoxicillin, metronidazole, and ppi quinidine levofloxacin amoxicillin with high-dose ppi research suggest that eliminating h. pylori as soon as possible may help prevent stomach cancer. awan, et al. [97] awan, et al. [97] 11. future aspects in the purpose of shedding more light on the precise sources of infection and the part that animals play in the spread of disease, further case report studies are necessary. given the significant risk that h. pylori poses to the public, we advise public health authorities to give priority to developing preventive interventions against h. pylori infection. 12. conclusion gh is more better understood than ehh, despite the fact that a substantial amount of data has just been gathered. to understand the role of ehh in human and animal sickness, a great deal of unresolved questions remain to be explored. the microbiological identification of ehh is one of the most crucial areas for advancement; there wouldn't be many clinical reports without better isolation and detection techniques. a thorough understanding of the range of species that act as ehh reservoirs is also essential. this will enable us to ascertain their epidemiology, pinpoint potential channels of transmission, and maybe initiate preventive measures to avert human infection. similar opacity covers the specific pathologic pathways connected to ehh. therefore, it is necessary to investigate animal models' infection in order to screen the different pathogenicity determinants. moreover, future research should take these and other relevant factors into account in order to fully comprehend the risk that ehh actually poses to public health. there is hope that with all of the attention this class of bacteria has recently received, our knowledge of these freshly discovered microbes will advance dramatically in the years to come. 13. abbreviations °c, degree celsius; µm, micrometer; cd, crohnʼs disease; cdt, cytolethal distending toxin; clsi, clinical and laboratory standards institute; cmp, campylobacter major protein; dna, deoxyribonucleic acid; dsbs, double strand breaks; ebv, epstein-barr virus; ehh, enterohepatic helicobacter species; gh, gastric helicobacter species; h. pylori, helicobacter pylori; ibd, inflammatory bowel disease; iga, immunoglobulin type a; irga, iron-regulated outer membrane virulence protein; jcv, john cunningham virus; lpxr, lipid a deacylase; mic, minimal inhibitory concentration; nhph, non-helicobacter pylori species; ompla, outer membrane protein phospholipase a; omps, outer membrane proteins; pcr, polymerase chain reaction; pg, peptidoglycan, pgl, protein glycosylation; ppi, animal review, 2024, 11(1): 1-17 12 © 2024 conscientia beam. all rights reserved. proton pump inhibitor; rdna, ribodeoxyribonucleic acid; rrna, ribosomal ribonucleic acid; sfpa, systemic factor protein a; uc, ulcerative colitis; vbnc, viable but not culturable bacteria. funding: this study received no specific financial support. institutional review board statement: not applicable. transparency: the authors state that the manuscript is honest, truthful, and transparent, that no key aspects of the investigation have been omitted, and that any differences from the study as planned have been clarified. this study followed all writing ethics. competing interests: the authors declare that they have no competing interests. authors’ contributions: study design, scientific writing, data collection, overall revision, n.e.; data collection and scientific writing, m.a.m., r.s.s., s.m.b., j.f.m., s.a.e., o.h.h.; all authors have read and agreed to the published version of the manuscript. references [1] a. byomi, s. zidan, a. salama, a. elsify, g. hadad, and n. eissa, "public health implications of toxoplasmosis in animals and women in selected localities of menoufia governorate, egypt," assiut veterinary medical journal, vol. 64, no. 157, pp. 120-130, 2018. https://doi.org/10.21608/avmj.2018.168920 [2] a. byomi et al., "some associated risk factors with coxiella burnetii in sheep, humans and ticks in menoufiya governorate, egypt," bioscience research, vol. 16, no. s1-2, pp. 121-138, 2019a. [3] a. byomi et al., "coxiella burnetii infection in milk of cattle and the risk of human infection in menoufia governorate," journal of current veterinary research, vol. 1, no. 2, pp. 140-148, 2019b. https://doi.org/10.21608/jcvr.2019.65030 [4] n. m. bedair, m. a. sakr, and n. eissa, "covid-19: an overview of the risk factors in animals and humans," ec microbiology, vol. 17, pp. 41-51, 2021. [5] z. a. i. a. eldin, m. b. salman, d. a. salah eldin, and n. eissa, "an overview on: bacterial fish zoonoses," journal of current veterinary research, vol. 5, no. 2, pp. 196-215, 2023. https://doi.org/10.21608/jcvr.2023.320449 [6] n. eissa and o. h. harb, "diseases of the ear," in: key questions in clinical farm animal medicine, volume 2: types, causes and treatments of infectious disease (vol. 2), (eds.), rana, t, cabi, vol. 2, pp. 232-276, 2023. https://doi.org/10.1079/9781800624818.0007 [7] z. a. eldeen, a. m. younes, a. bazid, n. m. a. i. eissa, m. salman, and m. aboelkhair, "influence of some herbals on immunostimulation of cellular immunity in experimentally ndv-vaccinated chicks," egyptian journal of veterinary sciences, vol. 55, no. 5, pp. 1165-1174, 2024. https://doi.org/10.21608/ejvs.2024.256822.1734 [8] m. b. salman, a. i. a. zin eldin, n. s. ata, e. b. abdelfatah, and n. eissa, "prevalence, antimicrobial resistance and risk factors of zoonotic foodborne pathogens isolated from camel meat," journal of current veterinary research, vol. 6, no. 1, pp. 272-284, 2024a. [9] m. b. salman, a. i. a. z. eldin, n. eissa, a. maher, a.-e. aish, and s. i. abd el-moez, "evaluation of the effectiveness of some essential oils against zoonotic methicillin-resistant staphylococcus aureus isolated from dairy products and humans," journal of advanced veterinary and animal research, vol. 11, no. 2, p. 306, 2024b. https://doi.org/10.5455/javar.2024.k778 [10] n. eissa, fungal diseases of dogs and cats," in introduction to diseases, diagnosis, and management of dogs and cats. academic press. https://doi.org/10.1016/b978-0-443-18548-9.00035-4, 2024. [11] n. eissa, mycoplasma, rickettsia, and chlamydia diseases of dogs and cats in introduction to diseases, diagnosis, and management of dogs and cats. academic press. https://doi.org/10.1016/b978-0-443-18548-9.00033-0, 2024. [12] n. m. bedair, m. a. sakr, a. mourad, n. eissa, a. mostafa, and o. khamiss, "molecular characterization of the whole genome of h9n2 avian influenza virus isolated from egyptian poultry farms," archives of virology, vol. 169, no. 5, pp. 110, 2024. https://doi.org/10.1007/s00705-024-06018-2 [13] s. m. elgendy et al., "seroprevalence of neospora caninum, toxoplasma gondii and brucella species in sheep," journal of current veterinary research, vol. 6, no. 1, pp. 54-69, 2024. https://doi.org/10.21608/avmj.2018.168920 https://doi.org/10.21608/jcvr.2019.65030 https://doi.org/10.21608/jcvr.2023.320449 https://doi.org/10.1079/9781800624818.0007 https://doi.org/10.21608/ejvs.2024.256822.1734 https://doi.org/10.5455/javar.2024.k778 https://doi.org/10.1016/b978-0-443-18548-9.00035-4 https://doi.org/10.1016/b978-0-443-18548-9.00033-0 https://doi.org/10.1007/s00705-024-06018-2 animal review, 2024, 11(1): 1-17 13 © 2024 conscientia beam. all rights reserved. [14] s. c. parija, campylobacter and helicobacter. in textbook of microbiology and immunology. singapore: springer nature singapore, 2023, pp. 607-615. [15] a. c. parte, j. sardà carbasse, j. p. meier-kolthoff, l. c. reimer, and m. göker, "list of prokaryotic names with standing in nomenclature (lpsn) moves to the dsmz," international journal of systematic and evolutionary microbiology, vol. 70, no. 11, pp. 5607-5612, 2020. https://doi.org/10.1099/ijsem.0.004332 [16] s. ochoa and l. collado, "enterohepatic helicobacter species–clinical importance, host range, and zoonotic potential," critical reviews in microbiology, vol. 47, no. 6, pp. 728-761, 2021. https://doi.org/10.1080/1040841x.2021.1924117 [17] g. ahmad, "occurrence and characteriztion of helicobacter species from human, animals and foods of animal origin," phd thesis. indian veterinary research institute, 2019. [18] l. a. waskito et al., "the role of non-helicobacter pylori bacteria in the pathogenesis of gastroduodenal diseases," gut pathogens, vol. 14, no. 1, p. 19, 2022. https://doi.org/10.1186/s13099-022-00494-0 [19] a. m. jibrin, "potential of lysinibacillus fusiformis 5b and its immobilized urease for detection and biosorption of selected heavy metals," phd thesis, 2021. [20] h. berlamont et al., "differentiation of gastric helicobacter species using maldi-tof mass spectrometry," pathogens, vol. 10, no. 3, p. 366, 2021. https://doi.org/10.3390/pathogens10030366 [21] i. polaka, d. razuka-ebela, j. y. park, and m. leja, "taxonomy-based data representation for data mining: an example of the magnitude of risk associated with h. pylori infection," biodata mining, vol. 14, no. 1, p. 43, 2021. https://doi.org/10.1186/s13040-021-00271-w [22] p. aiewsakun, microbial evolutionary reconstruction in the presence of mosaic sequences," in: phylogenomics. academic press. https://doi.org/10.1016/b978-0-323-99886-4.00013-2, 2024. [23] d. m. m. palau, "detection of helicobacter pylori microevolution and multiple infection, and genomic analysis of helicobacter pylori strains," retrieved: https://diposit.ub.edu/dspace/handle/2445/146685 2019. [24] m. ivanova, "genomic and molecular identification and characterization of enterobacteriaceae and campylobacter," phd thesis, 2020. [25] b. j. pons, j. vignard, and g. mirey, "cytolethal distending toxin subunit b: a review of structure–function relationship," toxins, vol. 11, no. 10, p. 595, 2019. https://doi.org/10.3390/toxins11100595 [26] l. du and j. song, "delivery, structure, and function of bacterial genotoxins," virulence, vol. 13, no. 1, pp. 1199-1215, 2022. https://doi.org/10.1080/21505594.2022.2097417 [27] j. kim et al., "complete genome sequencing and comparative genomic analysis of helicobacter apodemus isolated from the wild korean striped field mouse (apodemus agrarius) for potential pathogenicity," frontiers in pharmacology, vol. 9, p. 838, 2018. https://doi.org/10.3389/fphar.2018.00838 [28] e. bauwens et al., "in silico proteomic and phylogenetic analysis of the outer membrane protein repertoire of gastric helicobacter species," scientific reports, vol. 8, no. 1, p. 15453, 2018. https://doi.org/10.1038/s41598-018-32476-1 [29] a. mannion, z. shen, and j. g. fox, "comparative genomics analysis to differentiate metabolic and virulence gene potential in gastric versus enterohepatic helicobacter species," bmc genomics, vol. 19, no. 1, pp. 1-19, 2018. [30] m. k. madhukar et al., "antimicrobial resistance landscape in a metropolitan city context using open drain wastewaterbased metagenomic analysis," environmental research, vol. 252, p. 118556, 2024. https://doi.org/10.1016/j.envres.2024.118556 [31] h. matsumoto, a. shiotani, and d. y. graham, "current and future treatment of helicobacter pylori infections helicobacter pylori in human diseases," adv microbiol infect dis public health, vol. 11, pp. 211-25, 2019. [32] c. a. fallone, s. f. moss, and p. malfertheiner, "reconciliation of recent helicobacter pylori treatment guidelines in a time of increasing resistance to antibiotics," gastroenterology, vol. 157, no. 1, pp. 44-53, 2019. https://doi.org/10.1053/j.gastro.2019.04.011 [33] b. lardinois, l. belkhir, and a. verroken, "helicobacter canis: a review of microbiological and clinical features," frontiers in microbiology, vol. 12, p. 814944, 2022. https://doi.org/10.1099/ijsem.0.004332 https://doi.org/10.1080/1040841x.2021.1924117 https://doi.org/10.1186/s13099-022-00494-0 https://doi.org/10.3390/pathogens10030366 https://doi.org/10.1186/s13040-021-00271-w https://doi.org/10.1016/b978-0-323-99886-4.00013-2 https://diposit.ub.edu/dspace/handle/2445/146685 https://doi.org/10.3390/toxins11100595 https://doi.org/10.1080/21505594.2022.2097417 https://doi.org/10.3389/fphar.2018.00838 https://doi.org/10.1038/s41598-018-32476-1 https://doi.org/10.1016/j.envres.2024.118556 https://doi.org/10.1053/j.gastro.2019.04.011 animal review, 2024, 11(1): 1-17 14 © 2024 conscientia beam. all rights reserved. [34] s. ansari and y. yamaoka, "animal models and helicobacter pylori infection," journal of clinical medicine, vol. 11, no. 11, p. 3141, 2022. [35] e. taillieu et al., "gastric helicobacter species associated with dogs, cats and pigs: significance for public and animal health," veterinary research, vol. 53, no. 1, p. 42, 2022. https://doi.org/10.1186/s13567-022-01059-4 [36] m. dore, g. pes, g. sanna, a. sepulveda, and d. graham, "helicobacter pylori infection in shepherds, sheep and sheepdogs," microb health dis, vol. 2, p. e306, 2020. [37] j. o. ashaolu, y.-j. tsai, c.-c. liu, and d.-d. ji, "prevalence, diversity and public health implications of helicobacter species in pet and stray dogs," one health, vol. 15, p. 100430, 2022. https://doi.org/10.1016/j.onehlt.2022.100430 [38] m. duan et al., "transmission routes and patterns of helicobacter pylori," helicobacter, vol. 28, no. 1, p. e12945, 2023. https://doi.org/10.1007/978-981-97-0013-4_1 [39] m. marrana, epidemiology of disease through the interactions between humans, domestic animals, and wildlife," one health. academic press. https://doi.org/10.1016/b978-0-12-822794-7.00001-0, 2022. [40] j. clement et al., "wild rats, laboratory rats, pet rats: global seoul hantavirus disease revisited," viruses, vol. 11, no. 7, p. 652, 2019. https://doi.org/10.3390/v11070652 [41] n. f. cortez et al., "molecular detection of human pathogenic gastric helicobacter species in wild rabbits (oryctolagus cuniculus) and wild quails (coturnix coturnix)," zoonotic diseases, vol. 1, no. 1, pp. 42-50, 2021. https://doi.org/10.3390/zoonoticdis1010005 [42] n. kim, prevalence and transmission routes of h. pylori. in helicobacter pylori. singapore: springer nature singapore, 2024, pp. 3-21. [43] a. sonnenberg, "epidemiology of helicobacter pylori," alimentary pharmacology & therapeutics, vol. 55, pp. s1-s13, 2022. [44] j. p. mackenbach, "health problems of industrializing societies," a history of population health, pp. 149-216, 2020. https://doi.org/10.1163/9789004429130_006 [45] h. brown, s. cantrell, h. tang, m. epplein, and k. s. garman, "racial differences in helicobacter pylori prevalence in the us: a systematic review," gastro hep advances, vol. 1, no. 5, pp. 857-868, 2022. https://doi.org/10.1016/j.gastha.2022.06.001 [46] a. hanafiah and b. s. lopes, "genetic diversity and virulence characteristics of helicobacter pylori isolates in different human ethnic groups," infection, genetics and evolution, vol. 78, p. 104135, 2020. https://doi.org/10.1016/j.meegid.2019.104135 [47] j. gurney, d. sarfati, j. stanley, c. kerrison, and j. koea, "equity of timely access to liver and stomach cancer surgery for indigenous patients in new zealand: a national cohort study," bmj open, vol. 12, no. 4, p. e058749, 2022. https://doi.org/10.1136/bmjopen-2021-058749 [48] j. a. merryweather, "the geographic pattern and socioecological factors of helicobacter pylori infections in the united states," doctoral dissertation, walden university, 2023. [49] h. g. choi et al., "comparison of concordance of peptic ulcer disease, non-adenomatous intestinal polyp, and gallstone disease in korean monozygotic and dizygotic twins: a cross-sectional study," international journal of environmental research and public health, vol. 19, no. 19, p. 12708, 2022. https://doi.org/10.3390/ijerph191912708 [50] d. a. almashhadany, s. m. mayas, h. i. mohammed, a. a. hassan, and i. u. khan, "population‐and gender‐based investigation for prevalence of helicobacter pylori in dhamar, yemen," canadian journal of gastroenterology and hepatology, vol. 2023, no. 1, p. 3800810, 2023. https://doi.org/10.1155/2023/3800810 [51] o. sjomina, j. pavlova, y. niv, and m. leja, "epidemiology of helicobacter pylori infection," helicobacter, vol. 23, p. e12514, 2018. [52] n. kim, helicobacter pylori infection and gastritis. insex/gender-specific medicine in the gastrointestinal diseases. singapore: springer nature singapore, 2022. https://doi.org/10.1186/s13567-022-01059-4 https://doi.org/10.1016/j.onehlt.2022.100430 https://doi.org/10.1007/978-981-97-0013-4_1 https://doi.org/10.1016/b978-0-12-822794-7.00001-0 https://doi.org/10.3390/v11070652 https://doi.org/10.3390/zoonoticdis1010005 https://doi.org/10.1163/9789004429130_006 https://doi.org/10.1016/j.gastha.2022.06.001 https://doi.org/10.1016/j.meegid.2019.104135 https://doi.org/10.1136/bmjopen-2021-058749 https://doi.org/10.3390/ijerph191912708 https://doi.org/10.1155/2023/3800810 animal review, 2024, 11(1): 1-17 15 © 2024 conscientia beam. all rights reserved. [53] h. aljaberi, n. k. ansari, m. xiong, h. peng, b. he, and s. wang, "current understanding of the transmission, diagnosis, and treatment of h. pylori infection: a comprehensive review," international journal of medical, pharmacy and drug research, vol. 7, p. 2, 2023. https://doi.org/10.22161/ijmpd.7.2.1 [54] k. kotilea, p. bontems, and e. touati, "epidemiology, diagnosis and risk factors of helicobacter pylori infection," helicobacter pylori in human diseases: advances in microbiology, infectious diseases and public health, vol. 11, pp. 17-33, 2019. [55] j. choi and j. kang, "concurrence of helicobacter pylori infection and its associated factors in korean couples," korean journal of family medicine, vol. 43, no. 1, p. 77, 2021. https://doi.org/10.4082/kjfm.21.0115 [56] y. xue, l.-y. zhou, h.-p. lu, and j.-z. liu, "recurrence of helicobacter pylori infection: incidence and influential factors," chinese medical journal, vol. 132, no. 07, pp. 765-771, 2019. https://doi.org/10.1097/cm9.0000000000000146 [57] t. attila et al., "upper socioeconomic status is associated with lower helicobacter pylori infection rate among patients undergoing gastroscopy," the journal of infection in developing countries, vol. 14, no. 03, pp. 298-303, 2020. https://doi.org/10.3855/jidc.11877 [58] c. w. howden and d. y. graham, "recent developments pertaining to h. pylori infection," official journal of the american college of gastroenterology| acg, vol. 116, no. 1, pp. 1-3, 2021. https://doi.org/10.14309/ajg.0000000000001031 [59] f. emerenini, e. nwolisa, f. iregbu, c. eke, and a. ikefuna, "prevalence and risk factors for helicobacter pylori infection among children in owerri, nigeria," nigerian journal of clinical practice, vol. 24, no. 8, pp. 1188-1193, 2021. https://doi.org/10.4103/njcp.njcp_687_20 [60] t. ueno et al., "influence of living environment during childhood on helicobacter pylori infection in japanese young adults," digestion, vol. 101, no. 6, pp. 779-784, 2020. https://doi.org/10.1159/000502574 [61] b. r. balas, l. e. meliț, and c. o. mărginean, "worldwide prevalence and risk factors of helicobacter pylori infection in children," children, vol. 9, no. 9, p. 1359, 2022. https://doi.org/10.3390/children9091359 [62] m. dadi, t. moti, d. dereje, b. dagne, t. maleda, and d. yadeta, "helicobacter pylori and associated factors among symptomatic and asymptomatic school-aged children attending hiwot fana specialized university hospital, eastern ethiopia," east african journal of health and biomedical sciences, vol. 6, no. 1, pp. 47-56, 2022. [63] j. m. ikobah et al., "prevalence and associated risk factors for helicobacter pylori infection using stool antigen test among children presenting to the outpatient clinic of a tertiary hospital in nigeria," calabar journal of health sciences, 2024. https://doi.org/10.25259/cjhs_3_2024 [64] r. van den brom, a. de jong, e. van engelen, a. heuvelink, and p. vellema, "zoonotic risks of pathogens from sheep and their milk borne transmission," small ruminant research, vol. 189, p. 106123, 2020. https://doi.org/10.1016/j.smallrumres.2020.106123 [65] l. m. talaat al sherief and s. s. thabet, "isolation of helicobacter pylori from raw milk and study on its survival in fermented milk products," journal of applied veterinary sciences, vol. 7, no. 2, pp. 73-81, 2022. https://doi.org/10.21608/javs.2022.124671.1133 [66] s. r. thompson, niche adaptation in campylobacter jejuni and helicobacter pylori. united kingdom: nottingham trent university, 2022. [67] r. monno, v. de laurentiis, p. trerotoli, a. m. roselli, e. ierardi, and p. portincasa, "helicobacter pylori infection: association with dietary habits and socioeconomic conditions," clinics and research in hepatology and gastroenterology, vol. 43, no. 5, pp. 603-607, 2019. https://doi.org/10.1016/j.clinre.2018.10.002 [68] m. n. gunathilake et al., "association between the relative abundance of gastric microbiota and the risk of gastric cancer: a case-control study," scientific reports, vol. 9, no. 1, p. 13589, 2019. https://doi.org/10.1038/s41598-01950054-x https://doi.org/10.22161/ijmpd.7.2.1 https://doi.org/10.4082/kjfm.21.0115 https://doi.org/10.1097/cm9.0000000000000146 https://doi.org/10.3855/jidc.11877 https://doi.org/10.14309/ajg.0000000000001031 https://doi.org/10.4103/njcp.njcp_687_20 https://doi.org/10.1159/000502574 https://doi.org/10.3390/children9091359 https://doi.org/10.25259/cjhs_3_2024 https://doi.org/10.1016/j.smallrumres.2020.106123 https://doi.org/10.21608/javs.2022.124671.1133 https://doi.org/10.1016/j.clinre.2018.10.002 https://doi.org/10.1038/s41598-019-50054-x https://doi.org/10.1038/s41598-019-50054-x animal review, 2024, 11(1): 1-17 16 © 2024 conscientia beam. all rights reserved. [69] s. mehata et al., "prevalence and correlates of helicobacter pylori infection among under-five children, adolescent and non-pregnant women in nepal: further analysis of nepal national micronutrient status survey 2016," plos neglected tropical diseases, vol. 15, no. 6, p. e0009510, 2021. https://doi.org/10.1371/journal.pntd.0009510 [70] m. hirabayashi et al., "helicobacter pylori infection, atrophic gastritis, and risk of pancreatic cancer: a populationbased cohort study in a large japanese population: the jphc study," scientific reports, vol. 9, no. 1, p. 6099, 2019. https://doi.org/10.1038/s41598-019-42365-w [71] p. du, c. zhang, a. wang, z. ma, s. shen, and x. li, "association of alcohol drinking and helicobacter pylori infection: a meta-analysis," journal of clinical gastroenterology, vol. 57, no. 3, pp. 269-277, 2023. https://doi.org/10.1097/mcg.0000000000001638 [72] w. wu, m. leja, v. tsukanov, z. basharat, d. hua, and w. hong, "sex differences in the relationship among alcohol, smoking, and helicobacter pylori infection in asymptomatic individuals," journal of international medical research, vol. 48, no. 5, p. 0300060520926036, 2020. https://doi.org/10.1177/0300060520926036 [73] s. he et al., "the impact of diet, exercise, and sleep on helicobacter pylori infection with different occupations: a crosssectional study," bmc infectious diseases, vol. 24, no. 1, p. 692, 2024. https://doi.org/10.1186/s12879-024-09505-8 [74] y. li, x. zhang, and q. rong, retracted: optimization of hospital computer network and helicobacter pylori ulcer nursing analysis. elsevier. https://doi.org/10.1016/j.micpro.2020.103771, 2021. [75] p. zhang, "influence of foods and nutrition on the gut microbiome and implications for intestinal health," international journal of molecular sciences, vol. 23, no. 17, p. 9588, 2022. https://doi.org/10.3390/ijms23179588 [76] y. guo et al., "effect of helicobacter pylori on gastrointestinal microbiota: a population-based study in linqu, a highrisk area of gastric cancer," gut, vol. 69, no. 9, pp. 1598-1607, 2020. https://doi.org/10.1136/gutjnl-2019-319696 [77] r. m. ferreira et al., "gastric microbial community profiling reveals a dysbiotic cancer-associated microbiota," gut, vol. 67, no. 2, pp. 226-236, 2018. https://doi.org/10.1136/gutjnl-2017-314205 [78] t. watanabe et al., "long-term persistence of gastric dysbiosis after eradication of helicobacter pylori in patients who underwent endoscopic submucosal dissection for early gastric cancer," gastric cancer, vol. 24, pp. 710-720, 2021. https://doi.org/10.1007/s10120-020-01141-w [79] g. r. l. araújo et al., "helicobacter pylori infection: how does age influence the inflammatory pattern?," world journal of gastroenterology, vol. 28, no. 4, p. 402, 2022. https://doi.org/10.3748/wjg.v28.i4.402 [80] h. wang et al., "associations between gastric cancer risk and virus infection other than epstein-barr virus: a systematic review and meta-analysis based on epidemiological studies," clinical and translational gastroenterology, vol. 11, no. 7, p. e00201, 2020. https://doi.org/10.1097/md.0000000000016708 [81] a. s. alshewered, "the parasitism and tumors carcinogenesis: a review subject," acta parasitologica, vol. 69, no. 1, pp. 183-189, 2024. https://doi.org/10.1007/s11686-024-00832-z [82] s. eyvazi et al., "the oncogenic roles of bacterial infections in development of cancer," microbial pathogenesis, vol. 141, p. 104019, 2020. https://doi.org/10.1016/j.micpath.2020.104019 [83] j. wen, h. c.-h. lau, m. peppelenbosch, and j. yu, "gastric microbiota beyond h. pylori: an emerging critical character in gastric carcinogenesis," biomedicines, vol. 9, no. 11, p. 1680, 2021. https://doi.org/10.3390/biomedicines9111680 [84] y. usui et al., "helicobacter pylori, homologous-recombination genes, and gastric cancer," new england journal of medicine, vol. 388, no. 13, pp. 1181-1190, 2023. https://doi.org/10.1056/nejmc2306877 [85] y. elshenawi, s. hu, and s. hathroubi, "biofilm of helicobacter pylori: life cycle, features, and treatment options," antibiotics, vol. 12, no. 8, p. 1260, 2023. https://doi.org/10.3390/antibiotics12081260 [86] n. alaridah et al., "knowledge and information sources towards helicobacter pylori in jordan," plos one, vol. 18, no. 3, p. e0278078, 2023. https://doi.org/10.1371/journal.pone.0278078 https://doi.org/10.1371/journal.pntd.0009510 https://doi.org/10.1038/s41598-019-42365-w https://doi.org/10.1097/mcg.0000000000001638 https://doi.org/10.1177/0300060520926036 https://doi.org/10.1186/s12879-024-09505-8 https://doi.org/10.1016/j.micpro.2020.103771 https://doi.org/10.3390/ijms23179588 https://doi.org/10.1136/gutjnl-2019-319696 https://doi.org/10.1136/gutjnl-2017-314205 https://doi.org/10.1007/s10120-020-01141-w https://doi.org/10.3748/wjg.v28.i4.402 https://doi.org/10.1097/md.0000000000016708 https://doi.org/10.1007/s11686-024-00832-z https://doi.org/10.1016/j.micpath.2020.104019 https://doi.org/10.3390/biomedicines9111680 https://doi.org/10.1056/nejmc2306877 https://doi.org/10.3390/antibiotics12081260 https://doi.org/10.1371/journal.pone.0278078 animal review, 2024, 11(1): 1-17 17 © 2024 conscientia beam. all rights reserved. [87] c. ma et al., "quantification and cultivation of helicobacter pylori (h. pylori) from various urban water environments: a comprehensive analysis of precondition methods and sample characteristics," environment international, vol. 187, p. 108683, 2024. https://doi.org/10.1016/j.envint.2024.108683 [88] t. cheng and i. g. boneca, "the shapeshifting helicobacter pylori: from a corkscrew to a ball," molecular microbiology, vol. 121, no. 2, pp. 260-274, 2024. https://doi.org/10.1111/mmi.15218 [89] f. carvalho et al., "diving into bacterial dormancy: emergence of osmotically stable wall-less forms in an aquatic environment," biorxiv, p. 2023.11. 16.566987, 2023. https://doi.org/10.1101/2023.11.16.566987 [90] r. husnik, j. klimes, s. kovarikova, and m. kolorz, "helicobacter species and their association with gastric pathology in a cohort of dogs with chronic gastrointestinal signs," animals, vol. 12, no. 10, p. 1254, 2022. https://doi.org/10.3390/ani12101254 [91] a. i. cardos et al., "evolution of diagnostic methods for helicobacter pylori infections: from traditional tests to high technology, advanced sensitivity and discrimination tools," diagnostics, vol. 12, no. 2, p. 508, 2022. https://doi.org/10.3390/diagnostics12020508 [92] a. boustany, s. onwuzo, a. almomani, and i. asaad, "epidemiology and risk of colorectal cancer in patients with a history of helicobacter pylori infection: a population-based study," annals of gastroenterology, vol. 36, no. 2, p. 203, 2023. https://doi.org/10.20524/aog.2023.0783 [93] a. a. lee et al., "helicobacter pylori seropositivity, abo blood type, and pancreatic cancer risk from 5 prospective cohorts," clinical and translational gastroenterology, vol. 14, no. 5, p. e00573, 2023. https://doi.org/10.14309/ctg.0000000000000573 [94] j. alarcón-millán et al., "helicobacter pylori virulence factors and clarithromycin resistance-associated mutations in mexican patients," pathogens, vol. 12, no. 2, p. 234, 2023. https://doi.org/10.3390/pathogens12020234 [95] p. katelaris et al., "helicobacter pylori world gastroenterology organization global guideline," journal of clinical gastroenterology, vol. 57, no. 2, pp. 111-126, 2023. https://doi.org/10.1097/mcg.0000000000001719 [96] s. fekadu et al., "effectiveness of eradication therapy for helicobacter pylori infection in africa: a systematic review and meta-analysis," bmc gastroenterology, vol. 23, no. 1, p. 55, 2023. https://doi.org/10.1186/s12876-023-02707-5 [97] u. awan et al., "frequency, distribution and determinants of helicobacter pylori infection in adults and adolescents with gastric symptoms: cross-sectional epidemiological inquiry in district haripur, pakistan," brazilian journal of biology, vol. 84, p. e248913, 2022. https://doi.org/10.1590/1519-6984.248913 views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://doi.org/10.1016/j.envint.2024.108683 https://doi.org/10.1111/mmi.15218 https://doi.org/10.1101/2023.11.16.566987 https://doi.org/10.3390/ani12101254 https://doi.org/10.3390/diagnostics12020508 https://doi.org/10.20524/aog.2023.0783 https://doi.org/10.14309/ctg.0000000000000573 https://doi.org/10.3390/pathogens12020234 https://doi.org/10.1097/mcg.0000000000001719 https://doi.org/10.1186/s12876-023-02707-5 https://doi.org/10.1590/1519-6984.248913 1 © 2025 conscientia beam. all rights reserved. a brief overview of the impact of avian influenza on animals john t. hancock1+ ros c. rouse2 gareth robinson3 tim j. craig4 1,3,4school of applied sciences, university of the west of england, bristol, bs16 1qy, uk. 1email: john.hancock@uwe.ac.uk 3email: gareth2.robinson@uwe.ac.uk 4email: tim.craig@uwe.ac.uk 2business and innovation, university of the west of england, bristol bs16 1qy, uk. 2email: ros.rouse@uwe.ac.uk (+ corresponding author) abstract article history received: 14 november 2024 revised: 30 december 2024 accepted: 10 january 2025 published: 27 january 2025 keywords animal-human transmission avian influenza bird flu cattle h5n1 marine mammals mink. avian influenza (ai) virus, and the (hpai)h5n1 subtype in particular, is a serious problem for many wild bird populations, where devastating losses have been reported. however, ai is not restricted to bird species. here, a literature search was used to assess the range of animals infected by ai. this included reports in the scientific journals as well as news outlets. as can be seen, infection has been reported in commercial mammals such as cattle and mink where there is close animal-to-animal contact, as well as close contact with humans. some domestic animals, such as cats, have been reported to be ai virus positive too, again where there is a possibility that conditions will be conducive to animal-tohuman transmission. many animals in the wild have been found to be infected with ai virus, and many of these, perhaps not surprisingly, are marine mammals. mink-to-mink viral transmission has been suggested to have taken place, but most animals which have been infected have had close contact with birds, often handling or eating carcasses. there are also reports of humans becoming infected, for example, from cattle. although this overview is intended to be neither comprehensive nor quantitative it is hoped that such information will aid in the management of ai, especially (hpai)h5n1, in the future. contribution/originality: this article gives an up-to-date overview of the range of animals which have been reported to be infection-positive for avian influenza. this shows that the viral infection is not restricted to birds, but is found in many mammalian species. 1. introduction avian influenza (ai) virus has been in circulation for many years. originally referred to as “fowl plague” it was first described in northern italy in 1878, and about twenty years later was found to be caused by a virus, which was further characterized in 1955 as a type a influenza virus [1]. avian influenza (ai: often known as avian flu or bird flu) virus, especially the (hpai)h5n1 subtype (clade 2.3.4.4b), is one of these. ai has led to devastating drops in bird populations, especially sea birds, such as reported by the bbc in february 2024 [2]. ai is caused by a virus which has two main types: highly pathogenicity avian influenza [hpai] and low pathogenicity avian influenza (lpai) [3]. these groups are subdivided into haemagglutinin [h1–h16] and neuraminidase [n1–n9] subtypes. most lpai viruses cause a milder form of disease. hpai viruses have h5 and h7 subtypes, and many of these subtypes have been found in infected birds. probably the subtype of most animal review 2025 vol. 12, no. 1, pp. 1-16. issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/92.v12i1.4051 © 2025 conscientia beam. all rights reserved. mailto:john.hancock@uwe.ac.uk mailto:gareth2.robinson@uwe.ac.uk mailto:tim.craig@uwe.ac.uk mailto:ros.rouse@uwe.ac.uk https://www.doi.org/10.18488/92.v12i1.4051 animal review, 2025, 12(1): 1-16 2 © 2025 conscientia beam. all rights reserved. concern is (hpai)h5n1. much has been written about bird outbreaks and possible bird infections, both in the scientific literature [4-6] and the popular media [2, 7-9] so this will not be considered in depth here. what is perhaps less well known is the evidence that ai viruses can infect a wide range of mammals, with differing symptoms. the fact that humans can become infected with the ai viruses is well-established, but remains of concern, and there is some discussion about h5n1 becoming the next pandemic subtype [10-12]. a recent british broadcasting corporation (bbc) article asks if the ai pandemic is inching towards humans [13]. although there are other reviews covering this topic, such as that by peacock, et al. [14] and others consortium, et al. [15]; graziosi, et al. [16] and plaza, et al. [17] it seems timely to bring some examples of non-avian species being reported as infected with the ai virus together. here a broad approach for a review is used, encompassing reports from science literature, but also more common media outlets such as news channels, as often these are looked at in isolation and by a wide range of readers. this is not a comprehensive report, but a brief overview to get an overall picture of what the present situation is like, and to highlight literature where a more in-depth discussion can be found if required. 2. materials and methods to obtain information for this overview a wide range of sources were used. these included reports found on the internet, and media outputs, such as guardian newspaper (uk) and the bbc. sci-entific literature was also sourced, primarily from google scholar [18] or national library of medicine pubmed [19] and the original articles accessed and cited. 3. evidence of a wide range of animal species being infected with ai there is certainly concern about where the next human viral pandemic will emerge from. sars-cov-2, which caused the covid-19 pandemic, was thought to originate from bats, and the transmission to humans has been hotly debated, for example in work by ridley and brown [20] and the exact route will probably never be known. however, others have asked what we might consider as the next emergent zoonotic disease [21] and ai is a candidate. in experimental animal models it has been clearly shown that some non-avian species can be infected with ai. h5n1 (hpai) can cause upper respiratory tract infection in ferrets and cats [22] and ferrets have been used in cytokine studies short, et al. [23]. rhesus macaques have also been used, again for studying cytokine effects caused by ai [24]. guinea pigs have been used for assessing the public health risk [25]. belser [26] gave an update on the use of animal models, albeit back in 2009 [26] which included a discussion of the use of mice. of course, more current reviews on the use of animals in influenza research are also available [e.g. nguyen, et al. [27]]. with the media reporting that several animals are now being infected by ai virus, it is timely to look at this more deeply. in april 2024 the guardian reported the first case of ai in a walrus [28] along with a wide range of birds, including penguins [29]. here, we have looked across the literature and pulled out examples which highlight the widespread nature of ai virus. it clearly is not just found in avian species, as can be seen in table 1. animal review, 2025, 12(1): 1-16 3 © 2025 conscientia beam. all rights reserved. table 1. examples of animals (including humans) being reported positive for avian influenza vi-rus. data was gathered until mid-august 2024. animal group animal type animal(s) country cause (if known) subtype (if known) ref. notes birds commercial poultry: broiler chickens, turkeys usa a(h7n3) usda [30] 11 flocks, 8.8 m birds poultry russia a(h5n8) pyankova, et al. [31] turkeys usa hpai h5n1 cdc [32] poultry india h5n1 world organization for animal health [33] birds wild goose, duck, sanderling, eagle, crow, bufflehead, owl, cormorant, hawk, raven, vulture, ruddy turnstone, blackbird, pigeon, grackle, teal, pintail, swan, gull usa usda [34] penguins south georgia bbc news [29] mute swans (cygnus olor) denmark h5n1 world organization for animal health (woah) [35] swans were dead various (non-poultry including wild birds) denmark h5n8 world organization for animal health [36] various (non-poultry including wild birds) canada h5n5 world organization for animal health [37] great skuas uk h5n1 guardian [38] 75% decline in population gannets uk h5n1 guardian [38] 25% decline in population black-headed gulls, guillemots, kittiwakes, herring gulls, terns uk rspb [39] cranes hungary rspb [39] large outbreaks swans romania rspb [39] large outbreaks black-headed gulls uk british trust for ornithology [40] 10000 (4% uk population: 2023) terns uk british trust for ornithology [40] birds domestic 8 cases in birds timor-leste h5n1 world organization for animal health [41] animal review, 2025, 12(1): 1-16 4 © 2025 conscientia beam. all rights reserved. mammal commercial dairy cows usa hpai h5n1 cdc [32] first cows reported (kansas and texas (march 2024) cows (cattle) usa usda [42] across at least 10 states mink spain from wild waterfowl? hpai h5n1 cdc [32] may have been minkmink transmission mink sweden lpai h10n4 cdc [32] 1984 (october) mink usa from people (?) a(h1n1) cdc [32] 2019 goats usa h5n1 world organization for animal health [43] 2024 (march) foxes, mink, raccoon dogs finland not confirmed uk health security agency [44] near bird oubreak big cat, lion, bobcat, bear, fox, coyote, fisher (pekania pennanti), marten, otter, racoon, skunk, opossum, squirrel usa includes h5n1 usda [45] seal, fox uk hpai h5n8 cdc [32] foxes, bears, skunks canada h5n1 cdc [32] mammal wild fox netherlands from birds? hpai h5n1 bbc news [29] 2021 fox estonia cdc [32] fox, otter, lynx, badger europe hpai h5 cdc [32] raccoon dogs, foxes japan hpai h5 cdc [32] polar bear arctic hpai a(h5n1) cdc [32] animal died/first report from arctic animal (2023: december) red fox sweden h5n1 world organization for animal health [46] 2023 (august) animal review, 2025, 12(1): 1-16 5 © 2025 conscientia beam. all rights reserved. red fox northern ireland hpai h5n1 world organization for animal health [47] 2023 (august) red fox scotland h5n1 world organization for animal health [47] cats poland h5n1 world organization for animal health [48] cats france, italy h5n1 uk health security agency [44] lion (panthera leo) peru h5n1 world organization for animal health [48] mammal domestic cat thailand ate pigeon carcass (hpai) h5n1 songserm, et al. [49] cat germany from wild birds? h5n1 klopfleisch, et al. [50] cat south korea migratory birds that travelled from japan and south korea? cidrap [51] dogs italy on poultry farm uk health security agency [44] 5 dogs infected bush dog uk contaminated meat? h5n1 cidrap [51] bottle nose dolphin, seal, usa usda [45] walrus hopen island (svalbard) the guardian [28] first such case april 2024 sea lions peru hpai h5n1 cdc [32] mammal marine sea lions new england h5n1 cdc [32] seals uk, germany, denmark h7n7, h4n5, h4n6, h3n3, h10n7 cdc [32] 2021 seals usa hpai h5n1 cdc [32] 10 animals animal review, 2025, 12(1): 1-16 6 © 2025 conscientia beam. all rights reserved. elephant seal, fur seal, south polar region hpai a(h5n1) cdc [32] first from south polar region: 2023 (december) grey seal, porpoise, dolphin uk hpai h5n1 (h5nx) world organization for animal health [47] 2023(march) southern elephant seals (mirounga leonina)/ 1 antarctic fur seal (arctocephalus gazella). south georgia island h5n1 world organization for animal health [47] seal lion (otaria flavescens)and dolphin (tursiops truncatus) peru h5n1 world organization for animal health [48] harbor seals (phoca vitulina) denmark possibly from dead swans hpai h5n1 world organization for animal health (woah) [35] spiny porpoise (phocoena spinipinnis) and chilean dolphin (cephalorhynchus eutropia). chile h5n1 world organization for animal health [48] mammal human 2 cases usa from poultry (2022), one from cattle (2024) cdc [52] 1 case russia poultry farmer (december 2020) a(h5n8) pyankova, et al. [31] child with moderate illness hong kong poultry (?) (2020) lpai h9n2 cdc [32] child with mild illness senegal poultry (2019) lpai h9n2 cdc [32] five cases china lpai h9n2 cdc [32] asymptomatic 80-year-old man england ducks hpai h5n1 cdc [32] china lpai h3n8 cdc [32] 2022 (april) seven cases china poultry hpai h5n6 cdc [32] 2022 four cases china lpai h9n2 cdc [32] young child cambodia lpai h9n2 cdc [32] animal review, 2025, 12(1): 1-16 7 © 2025 conscientia beam. all rights reserved. child vietnam poultry hpai a(h5) cdc [32] four cases (three children) china lpai h9n2 cdc [32] 2022 one case (died) china poultry hpai h5n1 cdc [32] 2022 child laos poultry hpai h5n6 cdc [32] 2021 one case (died) china poultry? lpai h10n3 cdc [32] 2021 (may) 36 cases china hpai h5n6 cdc [32] during 2021 18 deaths 24 cases china lpai h9n2 cdc [32] one death four cases china poultry hpai h5n6 cdc [32] may-sept 2022 one death one case china not known lpai h10n3 cdc [32] 2022(may) four cases china lpai h9n2 cdc [32] one hospitalised two cases (asymptomatic) spain poultry workers hpai h5n1 cdc [32] 2022 one case (child) ecuador poultry hpai a(h5) cdc [32] 2023 (january) two cases (asymptomatic) cambodia hpai h5n1 cdc [32] one death one case usa hpai) a(h5n1 cdc [32] first case of cow-human transmission one case usa h5n1 looi [53] farmer from cattle: state of michigan animal review, 2025, 12(1): 1-16 8 © 2025 conscientia beam. all rights reserved. there are some general points which can be highlighted from the data. firstly, it is obviously a global problem. in the uk, there are reports of major problems in birds in scotland and wales, for example, as reported by the bbc news [54] although on 30th may 2024 the uk government declared the country free of bird flu [55]. however, reports of animal infections span across usa, russia, japan, india, thailand, south korea etc. there are even reports from the polar regions, with elephant seals and fur seals being infected in the south [32] and polar bears being infected in the arctic [32]. secondly, there is a growing range of animals which are becoming infected. one of the groups which has reached prominence in the press is cattle [42]. this has been quite widespread, especially in the usa and it has been reported across at least ten states and 85 herds. other commercial animals include goats [56] but perhaps more notably mink [32, 57]. here worries may arise because of potential parallels with the prominence of mink infections during the covid-19 pandemic [58]. during covid-19, millions of mink in several countries were killed as they were found to be infected with sars-cov-2, mink-mink transmission was reported, and then perhaps more alarmingly there were suggestions of mink-human infection routes [59]. it has been thought that mink-mink ai viral transmission has already happened [32] as well as a farmer suspected of becoming infected from cattle [13]. a second case of a farmer being infected from a herd of cows was recently been reported [53] whilst in july 2024 it was reported that there were four dairy workers who had tested positive [60]. infected cows may pass on the virus in their milk. the situation with ai virus and cattle was recently reviewed by neumann and kawaoka [61]. in usa, it has been reported that 24 cats contracted h5n1 on a single farm, and this was thought to be down to consumption of raw milk [62]. half of these animals died. cats more generally have been raised as a concern, with reports that in the usa at least 16 have contracted ai virus this year [63] presumably from eating infected wild birds. as well as commercial animals which may be in contact with other animals, such as birds, but also in the close vicinity of humans, wild animals have been found to be infected. it is likely that these animals are becoming infected as they are in contact with, perhaps eating, infected carcasses. if a bird is frail because it is suffering, or if it had already died, then it becomes an easy target for other animals, many which are known to scavenge. perhaps it should come as no surprise that foxes, bears, and coyotes are listed. other species include lion, skunk, and otter. domestic animals are being reported as being infected, especially cats [62, 63] and these may have become infected by eating carcasses, for example, one was reported as eating a dead pigeon, even though it would be assumed that such animals are well fed in their domestic environment. cats were particularly infected with sars-cov-2 [64, 65] and although drawing parallels between the two diseases is fraught with issues due to the profound differences in the causative viruses, it is still quite concerning that companion animals are so susceptible to ai virus. indeed, ai infection in cats is not trivial. in poland, 47 cats were tested (including one caracal caracal), with 29 being positive from 13 regions of the country. cats had a range of symptoms, including bloody diarrhea, breathing problems and neurological issues. eleven cats died [66]. and as stated above 16 were found to be positive in the usa this year [63]. of prominence in the list given here are marine mammals (table 1), no doubt because of their proximity to seabirds such as tern and gulls. seals and walruses have already been mentioned here, but also listed are dolphins and porpoises. the reports are quite worldwide too, ranging from the uk and denmark to usa, and then down to peru, chile, and the polar regions. what can be seen from the results are several points worth noting. it is worldwide, it is not just avian species which have found to be infected, and, so far, contact with infected birds is often, but not always, the cause. animal review, 2025, 12(1): 1-16 9 © 2025 conscientia beam. all rights reserved. 4. discussion birds have been the focus in discussions of ai spread and prevalent, although not all birds have the same morbidity [67, 68]. this is not the first time the matter of ai viral infection has been dis-cussed outside of bird species [69-71] and it is unlikely to be the last. others are collating similar data, also on a global scale. one excellent source of data is from the food and agriculture organization of the united nations, which under a section on animal health, lists animals infected with h5nx hpai [72]. there are numerous bird species listed, as would be expected. these range across farmed animals including chickens, ducks, emu, and ostrich, as well as a wide range of wild birds. these include water birds such as ducks and geese, but also owls, hawks, robins, crows, and woodpeckers. mammalian species which have been reported to be infected include a similar range of animals to that listed above, but also include wild boars, pika, and badgers. what is also telling about this list is that any new species identified as being positive since 2021 are written in red, and a glance at the list suggests about half of all the listings are so colored. this is an indication that either the viruses are spreading to more species quite dramatically, or that surveillance has significantly improved, or a combination of both. one of the issues which is worth considering is of course why the virus has the ability to infect the cells of certain animals and not others. the molecular biology of the infection of cells with the ai virus is not covered here, but others have reviewed the area. for example, wang, et al. [11] consider the epidemiology, virology and pathogenicity of human infections, with the view to gaining a better understanding of interspecies transmission of the virus. charostad, et al. [73] discuss the structural biology and genetics of h5n1, and then go on to look at the immune response to the virus in humans. the apparent prevalence of the ai virus across a range of mammalian species leads to some suggesting that we should at least raise awareness [74] with the bmj asking if we should be worried “about a growing threat from “bird flu””, for example [75]. therefore, it seems a timely point to bring some of the reports on how ai is affecting mammalian species into one place, and to discuss the range of what is happening around the world. this is particularly important as conservation work continues, and people interact with the natural environment, and animals within it, in a variety of ways [76]. of importance here are the ramifications for human health. as highlighted in table 1, humans around the world have been reported to be ai virus positive. many of these so far are from china, cambodia, vietnam, hong kong and laos, although there are other examples from usa, spain, uk and ecuador. perhaps of particular concern is the suggestion that ai virus infected farmers who had close contact with their diseased cows [13, 53]. therefore, there is no reason why any area of the world is safe and not likely to see future infections in humans. such infections are often because people are in close contact with birds, usually poultry, which is an understandable route to become infected. recently, the first death of a person with the h5n2 subtype of the virus was reported [74, 77]. this is far from a comprehensive review of the situation, but does highlight the breadth of the issue. vaccines for ai are available, although in the uk it is stated that poultry and most captive birds must not be vaccinated, with zoo birds being able to be inoculated if they meet specific criteria [44]. what is unclear at this stage is how vaccination of animals involved in the food chain might be deemed appropriate, given it prevents serious disease rather than infection, thus might prove a risk within the food chain. this short review may enable researchers, academics, and students to reflect on their activities. if walking along a beach and seeing a few dead gannets, is it appropriate to use them as a research sample or elements of them in an artwork [76]? afterall, the european centre for disease prevention and control (ecdc) gives, “the general recommendation to not touch any sick or dead animals.” [71]. they go on to say “there is no single vaccine against avian influenza. a specific vaccine is needed for each specific avian influenza strain,” [as of feb 2023]. similar advice was given by the uk health security agency, who advised that: “members of the public should be discouraged from touching dead or sick animals.” [44]. in twenty-three years leading up to 2019, 881 infections of animal review, 2025, 12(1): 1-16 10 © 2025 conscientia beam. all rights reserved. h5n1 were reported in humans, with a case fatality rate (cfr) rate of 52%, so this can be a serious disease. of course, this is not the only review to suggest pandemic preparedness for ai [78] (and of course there is a general pandemic preparedness context [79]) but here are few there are things which could be done for the future. these may include: • better education of those who may come into contact with ai, especially if that contact may not be expected, such as on fieldtrips or simply being in the natural environment, or a farm setting. worryingly, some people are seeking raw milk infected with h5n1, thinking that it will boost their immunity [80] so clearly correct dissemination of information is important; • further vigilance and surveying of the global situation. this is taking place by several oganizations such as the cdc, but raw data needs to be fed into such databases; • further research into the animal-to-animal transmission of ai virus, and animal-to-human infection, as well as potentially human-to-animal infection with the virus; • can the susceptibility of animals to ai be predicted [78] and why do some animals get infected and not others [81]? this may give an idea of which species need to be targeted for surveillance and intervention, and as importantly, to know which animals can be ignored. such attempts at predictions for the susceptibility to the sars-cov-2 virus appeared to have limited success, and several surprises were seen [59] but this should not prevent similar work being carried out with the ai virus; • the consequences of the infection of specific animals need to be addressed in detail; not just from an economic or social point of view, but in the context of both human and animal disease control. which animals are more likely to pass the disease on to humans? and which animals are likely to be infected by humans? which animals (including humans) are likely to suffer more severe symptoms from the different subtypes? might some animals act as a means of transmission of the virus? might this be a source of a more contagious and/or virulent subtype, potentially with mammal to mammal and/or human-to-human transmission? certainly, there is evidence that, for some viruses at least, infection of specific animal populations may enhance the viral mutation rate, making the emergence of such a dangerous subtype more likely [59]. interestingly, it has been reported that the bovine hpai h5n1 virus may have features which facilitates its infection and also transmission in mammals [82]. • what preparatory action should be taken in terms of the development and production (ultmately at scale, and of a vaccine for the specific subtype(s) necessary at the time, so not stockpiled) of ai virus vaccines, and a planned roll-out if required? • how will the complexities of animal vaccination be navigated, both in relation to wild animals (including at risk populations), animals involved in the food chain (for meat, or eggs, for example), as well as pets. what will ‘animal welfare’ mean here for animals denied a vaccine, or subject to culling? how will this play out in terms of human need and human equity (such equity not being a feature of the sars-cov-2 pandemic) versus animal need? will some animals be given vaccines before some humans (assuming that vaccine supply will be limited), and will this be on the basis of their perceived utility (such as farm animals, or endangered/valued species), or on the basis of their role and importance in disease transmission? if vaccination is not found to be effective in pre-venting disease but only decreasing symptomatic response, what will this mean for animals – based on the sars-cov-2 pandemic (and prior examples in the uk such a tb in cattle and badgers) the response may be one of culling, not vaccination. how will the response be affected by the relative severity of symptoms of the prevalent subtypes in a pandemic for humans and animals? these issues may fundamentally affect the ‘landscape’ for animals in the future, as well as the welfare of individual animals. animal review, 2025, 12(1): 1-16 11 © 2025 conscientia beam. all rights reserved. • what might be the impact on global food security? if vaccination is not ‘the answer’ (as some infected animals may pass into the food chain) then what impacts might there be on the availability of animal-based food material, and what specific enhanced biosecurity measures might be needed, at what cost, and to whom? • in what ways should we be concerned about domestic animals, which after all, will have close contact with humans, so could infect, or be infected by, their humans. cats have been shown to be susceptible to infection with ai virus (and high morbidity and mortality), for example (also seen with sars-cov-2); it is to be remembered that in the early stages of the covid-19 pandemic, the uk government did consider a cull of domestic cats [59]. • if an hpai pandemic does arrive, with a subtype which has a high death rate for humans (say of the order of 50 percent), then what will be the impacts on animal welfare more broadly. we know during the covid-19 pandemic that panic meant some animals were targeted [59] so it is not unreasonable to assume that pet abandonment, and the killing of ‘suspected’ wildlife, might also feature in human responses across the globe. 5. conclusions it is clear that avian influenza viral infections are not restricted to birds and that several of the subtypes can cause infection in a wide range of mammal species, including humans. no reptiles, amphibians or fish have been found to be infected, but marine mammals are known to be ai virus positive. at the time of writing, one of the animals of most concern is cattle, partly as they are in the human food chain and also as they are in close contact with humans. farmers have been reported to be infected, but to date no deaths of humans have been reported from this transmission route, with this subtype. as with other zoonotic viruses, such as sars-cov-2, mutations are likely to take place in infected animals, and this will make it more likely that a wider range of vertebrate species could be infected, and it makes it more likely that a subtype will develop with the potential for human infection, and human to human transmission, and potentially high human morbidity and mortality, with potential for epidemic/pandemic. it is hoped that this article will highlight some of the interesting emergent information about the global position with ai virus and animals, even though it is not intended to be a comprehensive review. hopefully, the global pandemic preparedness initiatives will fully consider animal health, welfare and conservation aspects of ai infection. it is also to be hoped that current and future monitoring and vigilance, research and effective and timely mitigations will stop the spread and mutation of ai virus becoming the next human pandemic, with all the attendant animal and human welfare issues. funding: this study received no specific financial support. institutional review board statement: not applicable. transparency: the authors declare that the manuscript is honest, truthful and transparent, that no important aspects of the study have been omitted and that all deviations from the planned study have been made clear. this study followed all rules of writing ethics. competing interests: the authors declare that they have no competing interests. authors’ contributions: all authors contributed equally to the conception and design of the study. all authors have read and agreed to the published version of the manuscript. references [1] cdc, "highlights in the history of avian influenza," retrieved: https://www.cdc.gov/bird-flu/aviantimeline/index.html. [accessed 2024. [2] bbc news, "avian flu devastating wales' seabirds, says rspb," retrieved: https://www.bbc.co.uk/news/articles/c51028p25g4o 2024. [3] d. j. alexander, "an overview of the epidemiology of avian influenza," vaccine, vol. 25, pp. 5637-5644, 2007. [4] v. gamarra-toledo et al., "avian flu threatens neotropical birds," science, vol. 379, no. 6629, pp. 246-246, 2023. https://doi.org/10.1126/science.adg2271 https://www.cdc.gov/bird-flu/avian-timeline/index.html https://www.cdc.gov/bird-flu/avian-timeline/index.html https://www.bbc.co.uk/news/articles/c51028p25g4o https://doi.org/10.1126/science.adg2271 animal review, 2025, 12(1): 1-16 12 © 2025 conscientia beam. all rights reserved. [5] e. stokstad, "deadly flu spreads through north american birds," science, vol. 376, pp. 441-442, 2022. [6] a. m. ramey et al., "highly pathogenic avian influenza is an emerging disease threat to wild birds in north america," the journal of wildlife management, vol. 86, no. 2, p. e22171, 2022. https://doi.org/10.1002/jwmg.22171 [7] skynews, "bird flu leads to 'catastrophic' fall in seabird numbers in uk, rspb report says," retrieved: https://news.sky.com/story/bird-flu-leads-to-catastrophic-fall-in-seabird-numbers-rspb-report-says-13070535 2024. [8] financial times, "scientists express cautious optimism about decline in uk bird flu," retrieved: https://www.ft.com/content/b8d7e222-08c9-4f32-a802-f83e36843d7c 2024. [9] bbc news, "pirate of the seas' great skua in big decline after bird flu," retrieved: https://www.bbc.co.uk/news/science-environment-68276680. [accessed 07/08/24], 2024. [10] d. a. philippon, p. wu, b. j. cowling, and e. h. lau, "avian influenza human infections at the human-animal interface," the journal of infectious diseases, vol. 222, no. 4, pp. 528-537, 2020. https://doi.org/10.1093/infdis/jiaa105 [11] d. wang, w. zhu, l. yang, and y. shu, "the epidemiology, virology, and pathogenicity of human infections with avian influenza viruses," cold spring harbor perspectives in medicine, vol. 11, no. 4, p. a038620, 2021. https://doi.org/10.1101/cshperspect.a038620 [12] w. song and k. qin, "human‐infecting influenza a (h9n2) virus: a forgotten potential pandemic strain?," zoonoses and public health, vol. 67, no. 3, pp. 203-212, 2020. https://doi.org/10.1111/zph.12685 [13] bbc, "cows in the us have bird flu is it inching closer to humans?," retrieved: https://www.bbc.co.uk/news/articles/clee5685w19o 2024. [14] t. peacock et al., "the global h5n1 influenza panzootic in mammals," nature, pp. 1-2, 2024. https://doi.org/10.1038/s41586-024-08054-z [15] e. consortium et al., "the role of mammals in avian influenza: a review," efsa supporting publications, vol. 21, no. 3, p. 8692e, 2024 https://doi.org/10.2903/sp.efsa.2024.en-8692. [16] g. graziosi, c. lupini, e. catelli, and s. carnaccini, "highly pathogenic avian influenza (hpai) h5 clade 2.3. 4.4 b virus infection in birds and mammals," animals, vol. 14, no. 9, p. 1372, 2024. https://doi.org/10.3390/ani14091372 [17] p. i. plaza, v. gamarra-toledo, j. r. euguí, and s. a. lambertucci, "recent changes in patterns of mammal infection with highly pathogenic avian influenza a (h5n1) virus worldwide," emerging infectious diseases, vol. 30, no. 3, p. 444, 2024. https://doi.org/10.3201/eid3003.231098 [18] google scholar, "google scholar," retrieved: https://scholar.google.co.uk/ 2024. [19] national library of medicine pubmed, "pubmed," retrieved: https://pubmed.ncbi.nlm.nih.gov/ 2024. [20] m. ridley and brown, "viral: the search for the origin of covid‐19, cato institute united states of america," retrieved: https://policycommons.net/artifacts/2019765/viral/2772208/ 2021. [21] l. a. reperant and a. d. osterhaus, "aids, avian flu, sars, mers, ebola, zika… what next?," vaccine, vol. 35, no. 35, pp. 4470-4474, 2017. [22] d. van riel et al., "h5n1 virus attachment to lower respiratory tract," science, vol. 312, no. 5772, pp. 399-399, 2006. https://doi.org/10.1126/science.1125548 [23] k. r. short et al., "proinflammatory cytokine responses in extra-respiratory tissues during severe influenza," the journal of infectious diseases, vol. 216, no. 7, pp. 829-833, 2017. https://doi.org/10.1093/infdis/jix281 [24] k. shinya et al., "integrated clinical, pathologic, virologic, and transcriptomic analysis of h5n1 influenza virus-induced viral pneumonia in the rhesus macaque," journal of virology, vol. 86, no. 11, pp. 6055-6066, 2012. https://doi.org/10.1128/jvi.00365-12 [25] y. sun et al., "guinea pig model for evaluating the potential public health risk of swine and avian influenza viruses," plos one, vol. 5, no. 11, p. e15537, 2010. https://doi.org/10.1371/journal.pone.0015537 [26] j. a. belser, k. j. szretter, j. m. katz, and t. m. tumpey, "use of animal models to understand the pandemic potential of highly pathogenic avian influenza viruses," advances in virus research, vol. 73, pp. 55-97, 2009. https://doi.org/10.1002/jwmg.22171 https://news.sky.com/story/bird-flu-leads-to-catastrophic-fall-in-seabird-numbers-rspb-report-says-13070535 https://www.ft.com/content/b8d7e222-08c9-4f32-a802-f83e36843d7c https://www.bbc.co.uk/news/science-environment-68276680 https://doi.org/10.1093/infdis/jiaa105 https://doi.org/10.1101/cshperspect.a038620 https://doi.org/10.1111/zph.12685 https://www.bbc.co.uk/news/articles/clee5685w19o https://doi.org/10.1038/s41586-024-08054-z https://doi.org/10.2903/sp.efsa.2024.en-8692 https://doi.org/10.3390/ani14091372 https://doi.org/10.3201/eid3003.231098 https://scholar.google.co.uk/ https://pubmed.ncbi.nlm.nih.gov/ https://policycommons.net/artifacts/2019765/viral/2772208/ https://doi.org/10.1126/science.1125548 https://doi.org/10.1093/infdis/jix281 https://doi.org/10.1128/jvi.00365-12 https://doi.org/10.1371/journal.pone.0015537 animal review, 2025, 12(1): 1-16 13 © 2025 conscientia beam. all rights reserved. [27] t.-q. nguyen, r. rollon, and y.-k. choi, "animal models for influenza research: strengths and weaknesses," viruses, vol. 13, no. 6, p. 1011, 2021. https://doi.org/10.3390/v13061011 [28] the guardian, "first case of walrus dying from bird flu recorded in arctic," retrieved: https://www.theguardian.com/world/2024/apr/30/first-walrus-bird-flu-death-arctic-islands 2024. [29] bbc news, "south georgia: bird flu infects penguins at famous wildlife haven," retrieved: https://www.bbc.co.uk/news/science-environment-68538190 2024. [30] usda, "confirmations of highly pathogenic avian influenza in commercial and backyard flocks," retrieved: https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/commercial-backyardflocks 2024. [31] o. g. pyankova et al., "isolation of clade 2.3. 4.4 b a (h5n8), a highly pathogenic avian influenza virus, from a worker during an outbreak on a poultry farm, russia, december 2020," eurosurveillance, vol. 26, no. 24, p. 2100439, 2021. https://doi.org/10.2807/1560-7917.es.2021.26.24.2100439 [32] cdc, "2020-2024 highlights in the history of avian influenza (bird flu) timeline," retrieved: https://www.cdc.gov/bird-flu/avian timeline/2020s.html?cdc_aaref_val=https://www.cdc.gov/flu/avianflu/timeline/avian-timeline-2020s.htm. [accessed 07/08/24], 2020. [33] world organization for animal health, "event 5636," retrieved: https://wahis.woah.org/#/inevent/5636/dashboard. [accessed 07/08/24], 2024. [34] usda, "detections of highly pathogenic avian influenza in wild birds," retrieved: https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/wild-birds. [accessed 07/08/24], 2024. [35] world organization for animal health (woah), retrieved: https://www.woah.org/app/uploads/2023/09/202309hpai-h5n1-harbor-seals-denmark.pdf. [accessed 07/08/24], 2023. [36] world organization for animal health, "event 4412," retrieved: https://wahis.woah.org/#/inevent/4412/dashboard. [accessed 07/08/24], 2022. [37] world organization for animal health, "canada influenza a viruses of high pathogenicity," retrieved: https://wahis.woah.org/#/in-review/5065?reportid=166678&frompage=event-dashboard-url. [accessed 07/08/24], 2024. [38] guardian, "bird flu causing ‘catastrophic’ fall in uk seabird numbers, conservationists warn," retrieved: https://www.theguardian.com/environment/2024/feb/13/bird-flu-uk-seabird-numbers-h5n1-great-skua-gannets. [accessed 07/08/24], 2024. [39] rspb, "avian flu," retrieved: https://www.rspb.org.uk/birds-and-wildlife/avian-influenza-updates. [accessed 07/08/24], 2024. [40] british trust for ornithology, "new wave of bird flu rips through threatened gull and tern colo-nies," retrieved: https://www.bto.org/about-bto/press-releases/new-wave-bird-flu-rips-through-threatened-gull-and-tern-colonies. [accessed 07/8/24], 2023. [41] world organization for animal health, "event 5644," retrieved: https://wahis.woah.org/#/inevent/5644/dashboard. [accessed 07/08/24], 2024. [42] usda, "detections of highly pathogenic avian influenza (hpai) in livestock," retrieved: https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/livestock. [accessed 07/08/24], 2024. [43] world organization for animal health, "united states of america influenza a viruses of high pathogenicity," retrieved: https://wahis.woah.org/#/in-review/4451?reportid=166488&frompage=event-dashboard-url. [accessed 07/08/24], 2024. https://doi.org/10.3390/v13061011 https://www.theguardian.com/world/2024/apr/30/first-walrus-bird-flu-death-arctic-islands https://www.bbc.co.uk/news/science-environment-68538190 https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/commercial-backyard-flocks https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/commercial-backyard-flocks https://doi.org/10.2807/1560-7917.es.2021.26.24.2100439 https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/wild-birds https://www.woah.org/app/uploads/2023/09/202309-hpai-h5n1-harbor-seals-denmark.pdf https://www.woah.org/app/uploads/2023/09/202309-hpai-h5n1-harbor-seals-denmark.pdf https://wahis.woah.org/#/in-event/4412/dashboard https://wahis.woah.org/#/in-event/4412/dashboard https://wahis.woah.org/#/in-review/5065?reportid=166678&frompage=event-dashboard-url https://www.theguardian.com/environment/2024/feb/13/bird-flu-uk-seabird-numbers-h5n1-great-skua-gannets https://www.rspb.org.uk/birds-and-wildlife/avian-influenza-updates https://www.bto.org/about-bto/press-releases/new-wave-bird-flu-rips-through-threatened-gull-and-tern-colonies https://wahis.woah.org/#/in-event/5644/dashboard https://wahis.woah.org/#/in-event/5644/dashboard https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/livestock https://wahis.woah.org/#/in-review/4451?reportid=166488&frompage=event-dashboard-url animal review, 2025, 12(1): 1-16 14 © 2025 conscientia beam. all rights reserved. [44] uk health security agency, "hairs risk assessment: avian influenza a(h5n1) in non-avian uk species," retrieved: https://www.gov.uk/government/publications/hairs-risk-assessment-avian-influenza-ah5n1-in-non-avian-ukwildlife/hairs-risk-assessment-avian-influenza-ah5n1-in-non-avian-uk-wildlife. [accessed 07/08/24], 2023. [45] usda, "detections of highly pathogenic avian influenza in mammals," retrieved: https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/mammals. [accessed 07/08/24], 2024. [46] world organization for animal health, "h5n1 in a wild red fox in sweden," retrieved: https://www.woah.org/en/document/h5n1-in-a-wild-red-fox-in-sweden-august-2023/. [accessed 07/08/24], 2023. [47] world organization for animal health, "notification of further positive hpai results in wild mammalian species (uk)," retrieved: https://www.woah.org/app/uploads/2023/08/202308-notification-hpai-wild-mammals-uk.pdf. [accessed 07/08/24], 2023. [48] world organization for animal health, retrieved: https://www.woah.org/app/uploads/2023/05/notificacion-omsa-mamiferos-marinos-chile.pdf. [accessed 07/08/24], 2023. [49] t. songserm et al., "avian influenza h5n1 in naturally infected domestic cat," emerging infectious diseases, vol. 12, no. 4, p. 681, 2006. https://doi.org/10.3201/eid1204.051396 [50] r. klopfleisch et al., "distribution of lesions and antigen of highly pathogenic avian influenza virus a/swan/germany/r65/06 (h5n1) in domestic cats after presumptive infection by wild birds," veterinary pathology, vol. 44, no. 3, pp. 261-268, 2007. https://doi.org/10.1354/vp.44-3-261 [51] cidrap, "contaminated meat likely source of avian flu that killed bush dogs in uk zoo, pre-print suggests," retrieved: https://www.cidrap.umn.edu/avian-influenza-bird-flu/contaminated-meat-likely-source-avian-flu-killedbush-dogs-uk-zoo-preprint. [accessed 07/08/24], 2024. [52] cdc, "h5 bird flu: current situation," retrieved: https://www.cdc.gov/bird-flu/situation-summary/index.html 2024. [53] m.-k. looi, "bird flu: us confirms second human case in two months," british medical journal, vol. 385, 2024. https://doi.org/10.1136/bmj.q1203 [54] bbc news, "huge losses' of scottish seabirds due to avian flu," retrieved: https://www.bbc.co.uk/news/uk-scotlandnorth-east-orkney-shetland-67088869. [accessed 07/08/24], 2023. [55] uk government, "uk declares freedom from bird flu," retrieved: https://www.gov.uk/government/news/ukdeclares-freedom-from-bird-flu. [accessed 16/09/14], 2024. [56] the independent, "minnesota goat becomes first to test positive for bird flu in us," retrieved: https://www.independent.co.uk/news/world/americas/minnesota-goat-positive-bird-flu-b2517168.html. [accessed 07/08/24], 2024. [57] k. h. restori et al., "risk assessment of a highly pathogenic h5n1 influenza virus from mink," nature communications, vol. 15, no. 1, p. 4112, 2024. https://doi.org/10.1038/s41467-024-48475-y [58] f. fenollar et al., "mink, sars-cov-2, and the human-animal interface," frontiers in microbiology, vol. 12, p. 663815, 2021. https://doi.org/10.3389/fmicb.2021.663815 [59] j. t. hancock, r. c. rouse, and t. j. craig, animal welfare in a pandemic: what does covid-19 tell us for the future? boca raton: crc press, 2024. [60] bbc news, "cows, dairy workers, and america's struggle to track bird flu," retrieved: https://www.bbc.co.uk/news/articles/ce98zmpq467o. [accessed 16/09/24], 2024. [61] g. neumann and y. kawaoka, "highly pathogenic h5n1 avian influenza virus outbreak in cattle: the knowns and unknowns," nature reviews microbiology, vol. 22, no. 9, pp. 525-526, 2024. https://doi.org/10.1038/s41579-02401087-1 [62] telegraph newspaper, "cats died from bird flu ‘after consuming raw milk from infected cows," retrieved: https://www.telegraph.co.uk/global-health/science-and-disease/bird-flu-outbreak-us-cattle-farms-cat-deaths/ 2024. https://www.gov.uk/government/publications/hairs-risk-assessment-avian-influenza-ah5n1-in-non-avian-uk-wildlife/hairs-risk-assessment-avian-influenza-ah5n1-in-non-avian-uk-wildlife https://www.gov.uk/government/publications/hairs-risk-assessment-avian-influenza-ah5n1-in-non-avian-uk-wildlife/hairs-risk-assessment-avian-influenza-ah5n1-in-non-avian-uk-wildlife https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/mammals https://www.woah.org/en/document/h5n1-in-a-wild-red-fox-in-sweden-august-2023/ https://www.woah.org/app/uploads/2023/08/202308-notification-hpai-wild-mammals-uk.pdf https://www.woah.org/app/uploads/2023/05/notificacion-omsa--mamiferos-marinos-chile.pdf https://www.woah.org/app/uploads/2023/05/notificacion-omsa--mamiferos-marinos-chile.pdf https://doi.org/10.3201/eid1204.051396 https://doi.org/10.1354/vp.44-3-261 https://www.cidrap.umn.edu/avian-influenza-bird-flu/contaminated-meat-likely-source-avian-flu-killed-bush-dogs-uk-zoo-preprint https://www.cidrap.umn.edu/avian-influenza-bird-flu/contaminated-meat-likely-source-avian-flu-killed-bush-dogs-uk-zoo-preprint https://www.cdc.gov/bird-flu/situation-summary/index.html https://doi.org/10.1136/bmj.q1203 https://www.bbc.co.uk/news/uk-scotland-north-east-orkney-shetland-67088869 https://www.bbc.co.uk/news/uk-scotland-north-east-orkney-shetland-67088869 https://www.gov.uk/government/news/uk-declares-freedom-from-bird-flu https://www.gov.uk/government/news/uk-declares-freedom-from-bird-flu https://www.independent.co.uk/news/world/americas/minnesota-goat-positive-bird-flu-b2517168.html https://doi.org/10.1038/s41467-024-48475-y https://doi.org/10.3389/fmicb.2021.663815 https://www.bbc.co.uk/news/articles/ce98zmpq467o https://doi.org/10.1038/s41579-024-01087-1 https://doi.org/10.1038/s41579-024-01087-1 https://www.telegraph.co.uk/global-health/science-and-disease/bird-flu-outbreak-us-cattle-farms-cat-deaths/ animal review, 2025, 12(1): 1-16 15 © 2025 conscientia beam. all rights reserved. [63] sciencenews, "bird flu can infect cats. what does that mean for their people? ," retrieved: https://www.sciencenews.org/article/bird-flu-h5n1-infect-cats-people. [accessed 07/08/24], 2024. [64] j. segalés et al., "detection of sars-cov-2 in a cat owned by a covid-19− affected patient in spain," proceedings of the national academy of sciences, vol. 117, no. 40, pp. 24790-24793, 2020. [65] m. j. hosie et al., "anthropogenic infection of cats during the 2020 covid-19 pandemic," viruses, vol. 13, no. 2, p. 185, 2021. https://doi.org/10.3390/v13020185 [66] who, "influenza a(h5n1) in cats – poland," retrieved: https://www.who.int/emergencies/disease-outbreaknews/item/2023-don476. [accessed 07/08/24], 2023. [67] rspb, "avian influenza: a major threat to our struggling seabirds," retrieved: https://www.rspb.org.uk/birds-andwildlife/seabird-surveys-project-report. [accessed 16/09/24], 2023. [68] rspb, "uk seabird colony counts in 2023 following the 2021-22 outbreak of highly patho-genic avian influenza research report 76," retrieved: rspbhpaiseabirdcountsreport_feb24.pdf 2024. [69] c. j. cardona, z. xing, c. e. sandrock, and c. e. davis, "avian influenza in birds and mammals," comparative immunology, microbiology and infectious diseases, vol. 32, no. 4, pp. 255-273, 2009. [70] uk government, "bird flu (avian influenza): latest situation in england," retrieved: https://www.gov.uk/government/news/bird-flu-avian-influenza-latest-situation-in-england. [accessed 07/08/24], 2022. [71] ecdc, "questions and answers on avian influenza," retrieved: https://www.ecdc.europa.eu/en/zoonoticinfluenza/facts/faq-avianinfluenza#:~:text=transmission%20to%20other%20wild%20mammals,avoided%2c%20especially%20in%20affected% 20areas. [accessed 07/08/24], 2023. [72] food and agriculture organization of the united nations, "global avian influenza viruses with zoonotic potential situation update," retrieved: https://www.fao.org/animal-health/situation-updates/global-aiv-with-zoonoticpotential/bird-species-affected-by-h5nx-hpai/en. [accessed 07/08/24], 2024. [73] j. charostad et al., "a comprehensive review of highly pathogenic avian influenza (hpai) h5n1: an imminent threat at doorstep," travel medicine and infectious disease, p. 102638, 2023. https://doi.org/10.1016/j.tmaid.2023.102638 [74] bbc news, "what is bird flu and how worried should i be about a pandemic?," retrieved: https://www.bbc.co.uk/news/science-environment-63464065. [accessed 07/08/24], 2024. [75] the bjm, "should we worry about a growing threat from “bird flu”?," retrieved: https://www.bmj.com/content/385/bmj.q1199. [accessed 07/08/24], 2024. [76] l. r. pripon, "natural object or element of an artwork? case study: artists, artworks and exhibitions in cluj, romania," studia universitatis babes-bolyai-philosophia, vol. 65, no. sp. issue, pp. 159-172, 2020. https://doi.org/10.24193/subbphil.2020.spiss.12 [77] bbc news, "man in mexico dies with first human case of h5n2 bird flu," retrieved: https://www.bbc.co.uk/news/articles/cneejz1kdzmo. [accessed 07/08/24], 2024. [78] h. brüssow, "avian influenza virus cross‐infections as test case for pandemic preparedness: from epidemiological hazard models to sequence‐based early viral warning systems," microbial biotechnology, vol. 17, no. 1, p. e14389, 2024. https://doi.org/10.1111/1751-7915.14389 [79] who, "pandemic prevention, preparedness and response accord," retrieved: https://www.who.int/newsroom/questions-and-answers/item/pandemic-prevention--preparedness-and-response-accord. [accessed 16/09/24], 2024. [80] telegraph, "california’s ‘wellness’ devotees think raw milk infected with bird flu will ‘boost immunity’," retrieved: https://www.telegraph.co.uk/global-health/science-and-disease/bird-flu-raw-unpasteurised-h5n1-infected-milkcalifornia/. [accessed 07/08/24], 2024. https://www.sciencenews.org/article/bird-flu-h5n1-infect-cats-people https://doi.org/10.3390/v13020185 https://www.who.int/emergencies/disease-outbreak-news/item/2023-don476 https://www.who.int/emergencies/disease-outbreak-news/item/2023-don476 https://www.rspb.org.uk/birds-and-wildlife/seabird-surveys-project-report https://www.rspb.org.uk/birds-and-wildlife/seabird-surveys-project-report rspbhpaiseabirdcountsreport_feb24.pdf https://www.gov.uk/government/news/bird-flu-avian-influenza-latest-situation-in-england https://www.ecdc.europa.eu/en/zoonotic-influenza/facts/faq-avian-influenza#:~:text=transmission%20to%20other%20wild%20mammals,avoided%2c%20especially%20in%20affected%20areas https://www.ecdc.europa.eu/en/zoonotic-influenza/facts/faq-avian-influenza#:~:text=transmission%20to%20other%20wild%20mammals,avoided%2c%20especially%20in%20affected%20areas https://www.ecdc.europa.eu/en/zoonotic-influenza/facts/faq-avian-influenza#:~:text=transmission%20to%20other%20wild%20mammals,avoided%2c%20especially%20in%20affected%20areas https://www.ecdc.europa.eu/en/zoonotic-influenza/facts/faq-avian-influenza#:~:text=transmission%20to%20other%20wild%20mammals,avoided%2c%20especially%20in%20affected%20areas https://www.fao.org/animal-health/situation-updates/global-aiv-with-zoonotic-potential/bird-species-affected-by-h5nx-hpai/en https://www.fao.org/animal-health/situation-updates/global-aiv-with-zoonotic-potential/bird-species-affected-by-h5nx-hpai/en https://doi.org/10.1016/j.tmaid.2023.102638 https://www.bbc.co.uk/news/science-environment-63464065 https://www.bmj.com/content/385/bmj.q1199 https://doi.org/10.24193/subbphil.2020.spiss.12 https://www.bbc.co.uk/news/articles/cneejz1kdzmo https://doi.org/10.1111/1751-7915.14389 https://www.who.int/news-room/questions-and-answers/item/pandemic-prevention--preparedness-and-response-accord https://www.who.int/news-room/questions-and-answers/item/pandemic-prevention--preparedness-and-response-accord https://www.telegraph.co.uk/global-health/science-and-disease/bird-flu-raw-unpasteurised-h5n1-infected-milk-california/ https://www.telegraph.co.uk/global-health/science-and-disease/bird-flu-raw-unpasteurised-h5n1-infected-milk-california/ animal review, 2025, 12(1): 1-16 16 © 2025 conscientia beam. all rights reserved. [81] the associated press, "bird flu is highly lethal to some animals, but not to others. scientists want to know why," retrieved: https://apnews.com/article/bird-flu-humans-animals-deathsae01d3717783f0cf41e23f3fedb97017?utm_source=live+audience&utm_campaign=507caab053-nature-briefing-daily20240618&utm_medium=email&utm_term=0_b27a691814-507caab053-50657140. [accessed 07/08/24], 2024. [82] a. j. eisfeld et al., "pathogenicity and transmissibility of bovine h5n1 influenza virus," nature, vol. 633, no. 8029, pp. 426-432, 2024. https://doi.org/10.1038/s41586-024-07766-6 views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. https://apnews.com/article/bird-flu-humans-animals-deaths-ae01d3717783f0cf41e23f3fedb97017?utm_source=live+audience&utm_campaign=507caab053-nature-briefing-daily-20240618&utm_medium=email&utm_term=0_b27a691814-507caab053-50657140 https://apnews.com/article/bird-flu-humans-animals-deaths-ae01d3717783f0cf41e23f3fedb97017?utm_source=live+audience&utm_campaign=507caab053-nature-briefing-daily-20240618&utm_medium=email&utm_term=0_b27a691814-507caab053-50657140 https://apnews.com/article/bird-flu-humans-animals-deaths-ae01d3717783f0cf41e23f3fedb97017?utm_source=live+audience&utm_campaign=507caab053-nature-briefing-daily-20240618&utm_medium=email&utm_term=0_b27a691814-507caab053-50657140 https://doi.org/10.1038/s41586-024-07766-6 19 † corresponding author © 2015 conscientia beam. all rights reserved. climate relevant emissions from animal production and reduction potentials gerhard flachowsky1 --dirk von soosten2 --ulrich meyer3* 1,2,3institute of animal nutrition friedrich-loeffler-institut (fli) federal research institute for animal health bundesallee, braunschweig germany abstract animal production contributes substantially to global greenhouse gas emissions (about 14.5%). the socalled carbon footprint (cf) considers the greenhouse gas potential of climate relevant gases (e.g., co2 x 1; ch4 x 23; n2o x 296) and is given in co2-eq per g or kg product or per unit edible protein. the cf may help to assess the greenhouse gas emissions associated with the production of foods of animal origin such as milk, meat, eggs or fish. the cf may contribute to sensitizing producers and consumers to a more resourceefficient and environmentally-friendly production, to the consumption of food of animal origin, and to avoiding food wastage. the highest cf per unit edible protein is calculated for products of growing ruminants (beef and lamb), followed by milk and pork and eggs and poultry meat with the lowest values. discrepancies in the results of various studies are mainly explained by different system boundaries, allocation methods and computation of emissions, especially with regard to land use changes, enteric methane emissions and nitrous oxide emissions. a more standardized approach for data collection and cf-calculations would be a very useful tool to compare cf between production systems, regions and countries, and an indicator for food labelling, and is considered in the first part of this paper. the second part of the paper deals with the potential to reduce climate relevant gases from animal production. some specific influencing factors, such as plant and animal breeding, feed production, animal feeding as well as animal keeping, animal health and excrement management are analysed more in detail. most attention has been spent to the methane reduction potentials in the rumen. the reduction of cf in ruminant production per product should focus on a lowering of methane emissions from enteric fermentation and an increase of low production levels as well a reduction of ineffective animal numbers. in the future, results of plant and animal breeding may also substantially contribute to lower ghg emissions. furthermore, new potentials to improve protein supply for human nutrition should be used. the production of food of animal origin is a very complex process and selective consideration, i.e., focussing on single factors, does not provide an assessment that reflects the complexity of the subject. recommendations for further research activities are given. animal review 2015 vol. 2, no. 2, pp. 19-57 issn(e): 2409-6490 issn(p): 2412-3382 doi: 10.18488/journal.ar/2015.2.2/101.2.19.57 © 2015 conscientia beam. all rights reserved. http://crossmark.crossref.org/dialog/?doi=10.18488/journal.ar/2015.2.2/101.2.19.57 animal review, 2015, 2(2): 19-57 20 © 2015 conscientia beam. all rights reserved. keywords: greenhouse gas emissions, carbon footprints, reduction potentials, animals, milk, meat, eggs, aquaculture, edible protein. received: 6 november 2014/ revised: 24 march 2015/ accepted: 28 march 2015/ published: 2 april 2015 1. introduction more people and higher need for feed and food are associated with a growing demand for limited natural resources such as water, fuel, minerals, arable land, etc., and elevated emissions with greenhouse gas (ghg) potential such as carbon dioxide (co2), methane (ch4), nitrous oxide (laughing gas; n2o) and other substances (e.g., n, p, trace elements etc.). according to the [1, 2], the human population will increase globally from currently about 7 billion to more than 9 billion people in 2050, but the increase in the output of food of animal origin is estimated to be about 70% [3]; [4]. these changes characterize the situation all over the world (e.g., [5]; [6]; [7]; [1, 2]; [8]; [9]; [10]; [11]. malnutrition in all its forms (under-nutrition, micronutrient deficiencies (e.g., iron, iodine, vitamin a, etc.), and over-nutrition – the so-called ―triple burden‖ of malnutrition) is still recognized as a serious and intractable problem for humans [12]; [13]. food of animal nutrition, also called animal source food (asf; [14], may contribute to overcoming micronutrient deficiencies [15]. the energy and protein conversion efficiency from feed into food of animal origin is low and may vary between 3 % (energy beef) and up to 40 % (energy dairy; protein chicken for fattening; [16]; [17]. in some countries (e.g., usa) between 67 % (energy) and 80% (protein) of the crops are used as animal feed [17]. these developments and complex connections present the following question: ―is there any need for food of animal origin?‖ as vegans demonstrate, there is no essential need for food of animal origin, if the human diets are supplemented with all essential nutrients. but on the other hand, the consumption of meat, fish, milk and eggs may contribute significantly to meeting the human requirements of amino acids (e.g., [18]; [19]; [20]; [21]; [22], [13, 15]; [23] and some important trace nutrients (such as ca, p, zn, fe, i, se, vitamins a, d, e, b12) especially for children and juveniles as well as for pregnant and lactating women [24]. human nutritionists (e.g., [25]; [26] have recommended that about one third of the daily protein requirements (0.66 1g per kg body weight; e.g., [27]; [26]; [19] should originate from protein of animal origin. consequently, about 20 g of the daily intake of about 60 g protein should be of animal origin, which is lower than the present average consumption throughout the world. presently, there is an average consumption of protein of animal origin (without fish) of about 24 g per capita and day, ranging between 1.7 (burundi) and 69.0 g (usa; table 1). it is a challenge for the future to overcome this imbalance [23]. meat, milk and eggs provide around 13% of the energy and 28% of protein consumed globally, with the higher share in the so-called developed countries (around 20 and 40 % resp., [1]. it is difficult to assess the protein intake from fish and other animal protein sources (e.g., insects). [28] estimate that half of the world´s population consumes at least 15% of their animal protein from aquaculture. animal review, 2015, 2(2): 19-57 21 © 2015 conscientia beam. all rights reserved. table-1. intake of milk, meat and eggs as well as protein of animal origin per capita and year and portion (%) of total protein intake (global minimum-values; maximum-values and averages as well as german values for comparison; kg per capita and year: data base 2005; [1] food minimum average maximum germany milk (kg per year) 1.3 (kongo) 82.1 367.7 (sweden) 248.7 meat1) (kg per year) 3.1 (bangladesh) 41.2 142.5 (luxembourg) 83.3 eggs (kg per year) 0.1 (kongo) 9.0 20.2 (china) 11.8 edible protein of animal origin (g per capita and day) 1.7 (burundi) 23.9 69.0 (usa) 52.8 portion of animal protein in % of total protein intake per capita 4.0 (burundi) 27.9 59.5 (usa) 53.7 1) probably empty body weight (meat plus bones) other reasons for consumption of food of animal origin are the high bioavailability of most nutrients and their considerable ―enjoyment value‖. such food is presently also considered as an indicator for the standard of living in many regions of the world. eating food of animal origin, esp. meat, is not only a reflection of nutritional needs, but it is also determined by taste, odour, and texture, as well as by geographical area, culture, ethics and wealth. further reasons for the higher demand of food of animal origin in some countries are the increased income of the population [29] [30]; [31]; [12] and the imitation of the so-called ―western style of life‖ regarding the nutrition. many developing countries continue to consume more animal products than they produce. therefore, they will continue to drive the world demand for all agricultural products, including food of animal origin [32]. higher food amounts of animal origin require higher plant yields and/or more area for feed production [33]; [34]; [35]; [36] and more animals and/or higher animal yields as well an increase in agricultural trade. therefore, some authors propose a redefinition of agricultural yield and agriculture in general: ―from tonnes to people nourished per hectare‖ [31]; [17] and ask for more sustainable animal agriculture (e.g., [37], [38]; [39]. on the other hand, changing the eating patterns [40] and eating less or no livestock products, esp. meat, are often seen as possible solutions to reduce the environmental impact of animal agriculture [41]; [42], [43] and to reduce the per capita land requirements (e.g., [44]. in the future there will be strong competition for arable land and further non-renewable resources such as fossil carbon-sources, water [45]; [46]; [47]; [48], some minerals (such as phosphorus; [49]; [50] as well as between feed, food, fuel, fibre, flower and fun; (6 f`s-concept; [51] and areas for settlements and natural protected areas. in this connection, more attention should been paid to the need of limited natural resources per amount of animal product, expressed as footprints per product such as ―water footprints‖ [52]; [53], ―mineral (esp. phosphorus; p) footprints‖, ―land (arable or total land) footprints‖ animal review, 2015, 2(2): 19-57 22 © 2015 conscientia beam. all rights reserved. (see [54]; [55]; [56], [36]. these footprints are given in kilograms, litres or tonnes per unit product and characterize the efficiency of various production processes. on the other side, special attention has also been paid to the outputs from agriculture e.g., [7]; [10] including livestock keeping esp. so-called ghg relevant emissions‖ such as co2, ch4, n2o and further gases. all the climate relevant emissions are summarized to so-called carbon footprints (cf). they have also been modified or called ecological footprint (ef), eco-balances (eb), life cycle assessments (lca) or life cycle impact assessment (lcia). in all cases the term means a summarized parameter for all gaseous emissions with greenhouse gas potential to sensitize producers and consumers, e.g., [57]; [58]; [59], to an efficient use of fossil carbon sources and to reduce ghg emissions per product (see also [60]. cf or lca are used as a tool for estimating environmental effects caused by products or processes. furthermore, cf may also contribute to assessing the resource and feed efficiency between various regions and production systems. recently, some authors have written about problems with lcas, e.g., [61]; [62]; [63] and new developments such as more comprehensive life cycle sustainability analysis (lcsa; [64], but a unified solution to the subject is still lacking. therefore, cf are calculated and interpreted in the present paper in a common way. agriculture, and especially animal husbandry, are considered as important ghg sources because of the high ghg potential of some emissions associated with animal production (e.g., methane (ch4) and laughing gas (n2o)), which are estimated at 7.1 gt co2-eq per annum, representing about 14.5% of human-induced ghg [65]. table 2 summarized the present production of food of animal origin, expected growing rates and emissions for animal groups. globally, ruminant supply chains are estimated to emit 5.7 gt co2-eq per year, of which 81%, 11% and 8% are associated with cattle, buffalo and small ruminant production [66]. table-2. present production, growth rates and emissions for some food producing animal groups (calculated from data by gerber, et al. [65]; macleod, et al. [67], opio, et al. [66] animal groups ruminants pigs poultry production (mio. t) milk: 864 meat: 81 cw1): 110 eggs: 58 cw: 72 growth rate (% per year; until 2030/50) milk: 1.1 meat: 1.3 1.3 eggs: 1.6 meat: 2.4 emissions (gt; co2-eq per year) milk: 2.0 meat: 3.7 0.7 eggs: 0.2 meat: 0.4 1) carcass weight based on the developments mentioned above, philosophers and natural scientists of various disciplines studied and analysed more and more these global developments. the balance between planet (global resources and emissions) – people (social aspects of population all over the world) and profit (economic aspects, money-making) in the so-called 3p-concept, [68]; [69], is an important prerequisite for sustainable life and development on the earth. some authors are afraid that the balance between the 3ps is being more and more disturbed and that an ethical dimension animal review, 2015, 2(2): 19-57 23 © 2015 conscientia beam. all rights reserved. should be introduced as the fourth dimension [68]. profit should not and cannot be the single objective of production. we need to find a balance between a careful and sustainable use of limited resources (see above) on the one hand [70]; [71] and low emissions with local and global consequences for later generations [72] on the other hand. more studies and analyses should be the base for consequences for a more efficient use of limited resources and lower emissions per product. therefore, the objective of the present contribution is to analyse sources and amounts of greenhouse relevant gases associated with the production of food of animal origin and to deduce parameters to assess the level of emissions from animal production. furthermore, possibilities to lower the ghg emission from animal production, esp. methane, are discussed in the second part of the paper. the livestock environmental assessment and performance (leap) initiative of the fao [73] is an activity in many countries to include such environmental improvements in the livestock supply chain. 2. calculations of carbon footprints (cf) carbon footprints are defined as the total amount of ghg emissions (under consideration of their ghg potential) associated with a product along its supply (human food) chain. this chain includes ―plant production incl. harvesting, storing and treatment – feed preparation – feeding of food producing animals – preparation of food (milk, meat, eggs etc.) – distribution, market – households‖. sometimes cf includes also emissions from consumption, end-of-life recovery and disposal. usually, cf`s are expressed in kg or t of carbon dioxide equivalents (co2-eq) per unit product [66]. studies and publications about cf have increased dramatically during the last few years, demonstrating that the interest for more resource-efficient and cleaner production has been enhanced. agriculture, and especially animal husbandry, are considered as important ghg sources because of the high greenhouse potential of their emissions (e.g., co2 x 1; ch4 x 23 and n2o x 296; [6]. carbon footprints consider the ghg potential of climate relevant gases and are given in co2-eq per g or kg per product. various authors calculated such cf for agriculture in general, but also for separate segments. the public interest in cf is discussed in the context of global warming and possible climate changes [6]; [74]. the paper attempts to present the most important factors in agricultural primary production along the whole food chain, i.e., soil, plant production (harvesting, conservation), industrial feed production, livestock-keeping (incl. excrement management). it also addresses possible other influencing factors such as system boundaries, feed and food processing, transport and trade, resulting in climate-related emissions. consequences of land-use change (luc; e.g., change of forest into cropland or pasture) for cf-calculations should also be considered, but in some cases the values are not known or not considered in calculations (e.g., import of feeds). a number of factors (e.g., plant yield, animal species and performances, type of production) cannot be ignored when taking into account the greenhouse gas potential of the various gases (see above) to derive cf and for the comparison of values along the food chain. the origin of the most animal review, 2015, 2(2): 19-57 24 © 2015 conscientia beam. all rights reserved. important ghg, such as carbon dioxide, methane and nitrous oxide, are discussed in the next paragraphs. 2.1. carbon dioxide (co2) the direct carbon dioxide emission from the animals can be considered as emission-neutral. co2 will be fixed by photosynthesis of plants and excreted by the animals as a result of animal metabolism. but nevertheless, the co2 emission must be seen along the whole food chain and based on burning of fossil carbon during feed production and land-use changes (luc; [75]; [76]; [59]; [67]. in general, non-carbon dioxide ghg such as methane (ch4) and nitrous oxide (n2o) come directly from animals or from animal manure practices. 2.2. methane (ch4) methane is emitted under anaerobic conditions from the enteric fermentation in the digestive tract of animals, mainly in the rumen, but also during the manure management. excess of hydrogen during anaerobic fermentation in the rumen is catalysed by various reduction processes. the last step is catalysed with methyl-coenzyme m reductase of reduction of co2 to ch4 by hydrogenotropic methanogenic archaea [77]. details of the enteric methane production are described in many papers e.g., [78]; [79]; [80]; [81]; [82] and prediction equations are given, e.g., [6]; [83]; [84]; [85]; [86]; [87, 88]; [89]. reduction potentials are analysed in chapter 5 of this paper. methane contributes not only to the greenhouse effect, between 2 and 12% of the ingested cross energy of ruminants can be lost to methane [90] depending on diet composition and other influencing factors. apart from the environmental effect, this energy could potentially be used by the animals for growth and lactation as shown in a model calculation in table 3. table-3. model calculation to show the influence of methane reduction on the energy available for dairy cows and milk yields (conditions for calculation: dmi: 20 kg per cow per day; body weight: 650 kg per cow, energy intake: 7 mj nel per kg dm with 20 g ch4-emission; niemann, et al. [91] methane reduction (g per kg dmi) (g per cow per day) 30 600 25 500 20 400 15 300 energy intake (mj nel1) per day) 130 135 140 145 milk yield (kg per day) 28.0 29.5 31.0 32.5 methane emission (g per kg milk) 21.4 17.0 12.9 9.2 carbon footprint (g co2eq per kg milk) 735 585 440 315 1) net energy lactation the methane emissions from the manure management are generally not directly associated with animals, but the losses can be considerably high [87, 88]; [92], esp. if the excreta are stored under anaerobic conditions. animal review, 2015, 2(2): 19-57 25 © 2015 conscientia beam. all rights reserved. 2.3. nitrous oxide (laughing gas, n2o) animals do not excrete nitrous oxide directly, but it can be formed in manure depending on the storage conditions and following land application, e.g., [93]; [88, 94]; [92]. n2o is mainly produced in soils by microbial nitrification (the oxidation of ammonium nh4 + to nitrate no3 -) and denitrification (reduction of no3 to n2; [95]. these microbial processes depend on temperature, moisture content and oxidation status of the environment. high n-fertilization and soil compaction are important factors that increase n2o emissions. since 1750, the tropospheric concentration of n2o increased from 270 to 320 ppb [96]. more details about n2o production and emission from the soil are described by many authors and should not be considered in further details in the present paper, e.g., [97]; [98]; [99]; [100]; [101]; [102]; [103]. 3. cf for food of animal origin beginning with one and two studies per year in 1998-2000, about 20 studies per year were published in the last years [28]. the studies dealt with calculations of cf for nearly all types of food of animal origin (see summaries by williams, et al. [104]; leip, et al. [105]; gruenberg, et al. [106]; flachowsky [107]; flachowsky, et al. [108]; lesschen, et al. [109]; gerber, et al. [65]; macleod, et al. [67]; opio, et al. [66]. results of cf-calculation for foods of animal origin depend on many influencing factors such as animal species and categories, animal yields and endpoints of animal production. advantages and weaknesses of endpoints (outputs) of various forms of animal production are summarized in table 4. all endpoints are characterized by some advantages and disadvantages. from nutritional and scientific points of view edible protein seems to be the most favourable measurement (see chapter 4), but in the case of meat production its measurement is not easy and requires some analytical work. table-4. advantages and disadvantages of various outputs/endpoints of animal yields concerning the calculation of carbon footprints (by flachowsky and kamphues [110] animal yields advantages disadvantages milk, eggs easily measurable, almost complete edible variation in protein, fat and energy yield, analyses may be useful body weight gain easily measurable high portion of non edible fractions in the gains carcass weight easily measurable still contains fractions, which are not edible (e.g., bones) meat, edible fraction completely edible categorization and separation not easy edible protein most important objective of animal production; comparison of various ways and sources to produce protein of animal origin categorization of various fractions as edible and difficulties to measure; additional analytical work; variation in n/protein content for practical reasons carcass weight or weight gain (warm or cold) would be the most important endpoint to measure the yield of slaughtered animals because this weight is measurable animal review, 2015, 2(2): 19-57 26 © 2015 conscientia beam. all rights reserved. in the slaughtering houses [111] and can be used for further calculations. ways to calculate cf and examples for various food of animal origin are shown and discussed in the following sections (see tables 6-11). 3.1. cf of milk table 5 demonstrates some important emission sources and steps to calculate emissions per cow and year and per kg of milk. the values per cow or per kg milk depend mainly on the levels of emissions and on the milk yield. the calculation shows that in this case about 2/3 of emissions come from methane. table-5. calculation of emissions per cow and year (parameters: body weight: 650 kg per cow, milk yield: 8000 kg per year, 1 calf per year (by dämmgen and haenel [112] emissions (kg per cow per year) source of emissions co2 ch4 n2o fertilizer 210 5.5 1.1 feed 83 1.2 transport, treatment 43 rumen fermentation 119 fermentation of excrement management 19 0.9 emissions from soil2) 1 1.8 total 336 143 5 co2-equivalents (kg/cow and year) 5200 (g/kg milk)1) 650 co2equivalents of emission (kg/cow) 336 3290 1500 (% of total emissions) 6 65 29 1) without calf and heifer, 2) no land-use change (luc) table 6 shows exemplary the cf for milk under consideration of various boundaries. a clear definition of the system boundaries and the comprehensibility are important prerequisites for following the calculations and for making the results comparable [113, 114]; [115]. furthermore, a clear definition of milk (e.g., energy, protein or fat corrected milk; see table 6) is also necessary to compare calculations by various authors. scientists working in this field should agree on the system boundaries and ghg factors of climate relevant gases. table-6. model calculation to demonstrate the effects of various system boundaries of cf of milk (g co2-eq per kg of milk; 30 kg milk per cow and day; diet on dm-base: 60% roughage, 40% concentrate; 4% milk fat, 3.4% milk protein; 305 days of lactation; 60 days dry period, 3 years lactation; 30 months calf and heifer period (by flachowsky, et al. [108]) system system boundaries cf (g co2-eq/kg milk) 1 animal caused emissions (incl. ch4 during lactation period) 280 2 1 + emissions of feed production (without luc) 430 3 2 + dry period of cows 500 4 3 + heifer period 730 5 4 + animal housing and milking 760 6 5 + excrement management 820 7 6 + processing, transportation and trade of milk 1 100 animal review, 2015, 2(2): 19-57 27 © 2015 conscientia beam. all rights reserved. the large range in cf of milk comparing results of various authors depends on many influencing factors is shown in table 7. the cf for milk by various authors varies between 0.4 and 1.5 kg co2-eq/kg in europe, north america and oceania, and under consideration of different world regions between 1.3 (europe and north america) and >10 kg co2-eq/kg in sub-saharan africa or highlands in peru [8]; [116]; see table 7). most authors considered only the emissions during production, but sometimes luc as well as processing, transport and trade are also included in calculations. in their recent publication, [66] mentioned ranges from 1.6 to 9.0 kg co2-eq/kg fat and protein corrected milk (fpcm) for regional emission intensity. generally, milk production in low productive systems has higher emissions per kg fpcm than in high production systems [117]. methane and nitrous emissions per cow increase, but they decrease per kg milk with increasing productivity, while carbon dioxide increases because of a higher feeding of concentrates, but on a much lower scale. table-7. examples for cf (kg co2-eq/kg milk) in dependence on type of production (conventional or organic) published by various authors country type of production/farming authors conventional organic germany 0.83 0.84 [118] germany 0.85 0.78 [119] sweden 0.90 0.94 [120] germany 0.94 0.88 [121] the nl 0.97 1.13 [122] germany 0.98 0.92 [123] sweden 0.99 0.94 [124] uk 1.06 1.23 [104] austria 1.20 1.00 [125] uk 1.20 1.30 [126] germany 1.30 1.30 [127] the nl 1.40 1.50 [128] uk 1.6 (1.0-3.2) 1.3 (0.9-2.4) [129] without differentiation conventional/organic germany 0.40 (40 kg milk/day) [130] (model 0.55 (20 kg milk/day) ― calculation) 1.00 (10 kg milk/day) ― germany 0.65 [112] new zealand 0.65-0.75 [131] literature review 0.8 – 1.4 (on farm) 0.9 – 1.8 (on farm + post farm emissions) [132] new zealand 0.86 [133] germany 0.98 (10 000) 1.35 (6000kg milk per year; without allocation) [134] sweden 1.00 [135] canada 1.00 [136] uk 1.06 [104] usa 1.09 [137] eu 1.3 (1.0-2.3; eu-27) [109] ireland 1.3-1.5 [138] usa 1.35 [111] norway 1.5 – 1.6 (combined milk/meat; expanded boundaries) [139] global 2.4 (1.3-7.5; global) [140] global, cow buffalo small ruminants 2.8 3.4 6.5 [66] peru; coast highlands 3.2 13.8 [116] animal review, 2015, 2(2): 19-57 28 © 2015 conscientia beam. all rights reserved. 3.2. cf of food from slaughtered animals and eggs it is much more difficult to measure the yield from the animal body after slaughtering and processing of animals (see table 4). calculation of cf may base on various outputs. for practical reasons, carcass weight (warm or cold) or weight gain would be the most important endpoint to measure the yield of slaughtered animals. based on the values derived from table 8, cf is calculated for various endpoints under consideration of differences in feeding and ghg emissions and are shown in table 9. table-8. model-calculations of cf for beef (150-550 kg body weight1)) in dependence on feeding2),3), weight gain, methaneand n-emissions (by flachowsky [118] 1) production of calf up to 150 kg bw is not considered; 2) co2-output: 120 g/kg roughage-dm; 220 g/kg concentrate-dm, 3) feed sources may have a strong influence on cf. co-products of feed and food industry (see [119] can reduce the cf of food of animal origin [120] because of their lower environmental costs [121]; see also section 5.3. table-9. model calculation for illustrating various endpoints for growing/fattening bulls (150-550 kg body weight; calculation based on data by flachowsky [122] brutto weight gain (g/day) weight gain without content of intestinal tract (g/day) carcass weight (warm; % of weight gain) carcass weight gain (warm; g/day) meat gain (% of weight gain) meat gain (g/day) edible fraction gain1) (g/day) edible protein (g/day; 19% protein in edible fraction) 500 438 50 250 40 200 250 48 1 000 900 53 530 44 440 490 93 1 500 1 385 56 840 48 720 770 146 1) meat plus other edible tissues under farm conditions, only the ghg-balance per kg body weight gain can be calculated. normally, the ghg emissions for the whole beef system include also emissions of cows, calves and heifers needed to produce beef. they are much higher than in the system dairy cow – growing/fattening bulls for beef. the ghg-emissions to produce pork and poultry meat should also include the emissions of parent animals (sows and laying animals). the term ―meat‖ is not clearly described and is used for both ―real meat‖ and meat plus bones. [111] introduced the term ―hot standard carcass weight‖ (hscw) as the weight at the exit gate animal review, 2015, 2(2): 19-57 29 © 2015 conscientia beam. all rights reserved. of the meat processing plant. it varies between 50-62% of the live weight of slaughtered cattle, but it may vary between 50% in the case of sheep and up to 80% for fattening turkeys [122]; [104]; [111] therefore it is accompanied by substantial difficulties to find an adequate cf for meat or edible products from slaughtered animals (see tables 4 and 9). various authors used different bases to calculate cf for products from slaughtered animals. williams, et al. [104] estimated the killing out percentages for beef and poultry with 55 and 70% and 72, 75 and 77% for pigs with final body weights by 76, 87 and 109 kg resp. lesschen, et al. [109] used fixed values to calculate the carcass fraction from the final body weight of animals (e.g., 58% for beef; 75% for pork and 71% for poultry). most authors used a fixed fraction of 0.9 for all animal species for conversion of carcass weight to edible meat. beef the ruminant sector contributed to about 29% of the global meat production, but 5.7 gt co2eq representing about 80% of the global livestock emissions per year come from all ruminants (see table 2; [66]. the large range in cf comparing results of various authors, depending on many influencing factors, is shown in table 10 for beef. the values are much higher than those for milk (compare tables 7 with 10) and are influenced by body weight gain, feed production with or without luc, feeding and keeping of animals as well as system boundaries. the calculation base for the output of growing animals is more difficult (see tables 8 and 9) than calculating it for milk or eggs (see table 4). in dependence on the calculation base, the authors found a high variation in cf of beef. the highest values are given for beef cows (table 10). in general, all of the results, e.g., [111]; [123]; [108], [66], indicate that policies which are targeted at improvements in productivity and efficiency of resource use will result in a lower ghg-emission or lower cf per unit of product. in the case of beef production, about 15% of total emissions are associated with the expansion of grassland (luc) from forests [66]. pork the pig sector contributes with 37% to global meat production, it will grow by 32% during the period 2005-2030 [67]. only 0.7 gt co2-eq per annum representing about 9% of the livestock sector´s emissions comes from pigs (see table 2; [67]. the main emission sources from global pig supply chains are feed production (60%) and excrement management (27%). the remaining 13% arises from post-farm processing, transport, enteric fermentation and indirect energy use in pig production [67]. 13% of the total emissions arise from luc driven by increasing demand for feed crops (e.g., forest into arable land). macleod, et al. [67] compared the results of 14 studies with pigs from europe, north america and australia and found a range in emissions between 2.01 and 6.36 kg co2-eq/kg carcass weight. later, the same authors adjusted all studies to the same scope according to fao-rules and calculated values between 3.34 and 6.37 without luc and values between 4.71 and 9.85 kg co2-eq/kg carcass weight with luc. tan, et al. [124] analysed three case studies from australia and canada and found similar results (4.5 kg co2-eq per kg pork). animal review, 2015, 2(2): 19-57 30 © 2015 conscientia beam. all rights reserved. table-10. examples for cf (kg co2-eq/kg carcass weight gain) of beef cattle in dependence on type of production by various authors type of production/farming authors country conventional organic germany 8.5 29.0 (beef cow) [146] germany 8.7/10.1 10.2 [118] australia 9.9 (grain finished) 12.0 (grass finished) [111] global 10 (intensive – dairy beef) 32 – 40 (organic – suckler beef) [126] germany 13.3 11.4 [121] germany 15.2 17.5 [147] uk 15.8 18.2 [104] ireland 23.6 20.2 [113] global 24.5 20.9 [148] without differentiation conventional/organic germany 5.6 (6000) – 14.6 (10 000 kg milk per cow per year; without allocation) [134] canada 5.9 – 10.4 [136] germany 7.0 – 23.0 [130] germany 8.4 (fattening of calves from dairy cows) 16.8 (fattening of calves from beef cows) [119] sweden 10.1 [149] ireland 13.0 (11.3 – 15.6) [113, 114] eu 16.0-19.9 27.3 (suckler herd) [55] norway 17.7 – 18.4 combined milk/meat; expanded boundaries [139] global 15.6 (fattening of calves from dairy cows) 20.2 (fattening of calves from beef cows) [8] japan 19.6 [150] japan 36.4 (beef cows, fattening bulls; 40% meat yield) [151] 5 studies, literature review 32 [152] global; beef buffalo small ruminants 46.2 53.4 23.8 [66] all values mentioned above are much lower than data from beef (see table 10). the main reasons for this are the enteric methane production in ruminants and the low growth intensity of beef cattle (mostly <0.5% weight gain per day of body weight) compared with pigs (mostly >1% weight gain per day of body weight; see also table 10). poultry (meat and eggs) chickens meat accounts to about 24% to the global meat production. the global demand for chicken meat and chicken eggs are forecasted to grow by 61 and 39%, resp., during the period 2005-2030. chickens are estimated to emit 0.6 gt co2-eq per year, representing about 8% of the livestock sector`s emissions (see also table 2; [67]. in the case of chicken meat on the global scale, 78% of emissions come from feed production and only small amounts directly from farm energy use (8%), processing and transport of meat (7%) and excrement management (6%; [67]. some authors did not consider emissions from luc where it occurs. in such cases about 21% of poultry meat emissions and 13% of egg emissions came from luc through the conversion of forest into arable land; [67]. these authors compared the emissions of 18 studies with broilers animal review, 2015, 2(2): 19-57 31 © 2015 conscientia beam. all rights reserved. from europe, north america, brazil and australia and found a range between 1.30 and 5.53 kg co2-eq/kg carcass weight. later, the same authors adjusted all studies to the same scope according to fao-rules and calculated values between 1.89 and 5.00 without luc and values between 1.93 and 7.71 kg co2-eq/kg carcass weight with luc. tan, et al. [124] calculated 2.9 kg co2-eq/kg meat in three case studies on chicken from brazil and finland. the most important influencing factors of cf of broilers are the feed amounts needed per weight gain (feed conversion rate) and the feed transport [125]. the land-use change should not be neglected. in the case of eggs, feed production contributes to 69% and direct on farm energy use to 4%, post-farm processing and transport 6%, the rest of the emissions (about 20%) is manure storage and processing (excrement management; [67]. pelletier, et al. [126] came to a similar assessment after analysis of egg production in the midwestern united states. composition of eggs is well defined, but it may vary between various sources and in dependence on animal breed, feeding of animals and other influencing factors (see table 11). the yield can be measured as weight (kg, etc.) or on the basis of standardized products (e.g., standardized protein, fat, dry matter or energy). therefore analysis of egg composition (protein; fat) may contribute to a more specific measuring of the animal yield incl. the energy yield. eggs may be entirely used as food (except small amounts for egg shells; see table 11). in conclusion, growing intensity, laying performance, feed conversion rate (fcr), healthy animals and low animal losses are the key determinants of the emission intensity per kg food of animal origin from non-ruminants (pork, broiler meat and eggs). 3.3. cf of aquaculture and further protein sources aquaculture is a strongly upcoming way to produce food protein of animal origin. recently some authors tried to determine cf for various forms of aquaculture. mungkung, et al. [127] carried out a case study of combined aquaculture systems for carp and tilapia. the studied system included fingerling production in hatcheries, fish rearing in cages and transport of feed as well as that of harvested fish to markets.avadi and freon [28] reviewed 16 lca-studies applied to fisheries and considered in the comparison the following aspects: scope and system boundaries, functional unit allocation strategies for co-products, conventional and fishery specific impact categories, fuel use, impact assessment methods, level of detail of inventories, normalisation of results and sensitive analysis. fishery-specific impact categories and fuel use in fishing operation were identified as the main contributors to environmental impact. nijdam, et al. [56] analysed 18 and 11 studies for seafood from fisheries and agriculture resp. the authors summarized cf between 1-86 for seafood from fisheries and 3-15 kg co2-eq for seafood from agriculture resp. these authors also [28] define the need for a standardisation of fisheries lca research for further studies on sustainability of seafood and fisheries-based agrifood. apart from milk, meat, fish and eggs, other sources of protein of animal origin, such as wild animals and insects, are also consumed by humans. nothing is known about cf of food from wild animals. insects and their larvae are used in many countries. they are rich in protein (20 – 70%) and contain considerable amounts of fat (10 – 50% of dry matter; [8, 128]. more than two billion people include processed animal review, 2015, 2(2): 19-57 32 © 2015 conscientia beam. all rights reserved. insects in their diets [8]; [129]. experts assess [129] that about 1900 insect varieties are used as food and feed. the feed conversion of insects could be better than in ―traditional‖ animals and lower cf are expected, but more research in these fields, and also concerning feeding and feed supplementation with insects is required [8]; [130]; [131]; [132]. 4. cf for edible protein of animal origin the production of protein of animal origin is one of the most important goals of animal husbandry [54]; [109]; [110]; [56]. on the other hand, the efficiency and the emissions of food of animal origin can be also compared on the basis of edible protein. the n or protein (n x 6.25) content of various food of animal origin may vary from values used for calculations in table 11. these data do not substantially disagree with values from human food tables [133]. nijdam, et al. [56] used 160-200 g protein per kg food for seafood from fisheries and 170-200 g protein per kg food for seafood from agriculture for the calculation of cf. table-11. protein content of some edible animal products by various authors (in g per kg edible product) references product [144] [162-165] [161] [166] [109]1) [56] cows’ milk 34 34 33.3 (30.8-37.0) 34 34.4 35 beef 190 170-200 2202) (206-227) 206-212 206 200 pork 150 157 (129-178) 2202) (195-240) 183-216 156 200 poultry meat 200 n.d. 199 182-242 206 200 eggs 120 121 (110-124) 125 125 119 130 1) n-content x 6.25; 2) muscle only; n.d.: no data under consideration of various influencing factors such as animal yields, feeding, edible fractions and protein content in the edible fractions, the yield of edible protein per day and per kg body weight of animals is given in table 12. the feeding may influence the cf of food of animal origin. in the case of ruminants, higher amounts of concentrate are required with higher animal yields. the proportion of co-products, e.g., [121]; [119] used in animal nutrition not only has nutritional implications, but it also affects the results of calculations on land use [134]. there are large differences in animal protein yield per animal per day, or per kg body weight and day, depending on animal species and categories as well as their performances and the fractions considered as edible (see table 12). table 12 shows the highest protein yields per kg body weight for growing broilers as well for laying and lactating animals, and the lowest values for growing/fattening ruminants. based on those values, emissions per kg edible protein are given in table 13. higher portions of edible fractions or higher protein content may increase the protein yield and reduce the cf per product. at high levels of performance there are remarkable differences in co2 emissions due to a human animal review, 2015, 2(2): 19-57 33 © 2015 conscientia beam. all rights reserved. consumption of 1 g protein from food of animal origin (eggs and meat from poultry < pork < milk < beef, see table 13). table-12. influence of animal species, categories and performances on yield of edible protein [122] protein source (body weight) performance per day dry matter intake (kg per day) roughage to concentrate ratio (on dm base, %) edible fraction (% of product or body mass) protein in edible fraction (g per kg fresh matter) edible protei n (g per day) edible protein (g per kg body weight) dairy cow (650kg) 10kg milk 20kg milk 40kg milk 12 16 25 90/10 75/25 50/50 95 34 323 646 1292 0.5 1.0 2.0 dairy goat (60kg) 2kg milk 5kg milk 2 2.5 80/20 50/50 95 36 68 170 1.1 2.8 beef cattle (350kg) 500g1) 1000g1) 1500g1) 6.5 7.0 7.5 95/5 85/15 70/30 50 190 48 95 143 0.14 0.27 0.41 growing/fattenin g pig (80kg) 500g1) 700g1) 1000g1) 1.8 2 2.2 20/80 10/90 0/100 60 150 45 63 81 0.56 0.8 1.0 broiler (1.5kg) 40g1) 60g1) 0.07 0.08 10/90 0/100 60 200 4.8 7.2 3.2 4.8 laying hen (1.8kg) 50%2) 70%2) 90%2) 0.10 0.11 0.12 20/80 10/90 0/100 95 120 3.4 4.8 6.2 1.9 2.7 3.4 1)weight gain, 2)laying performance table-13. influence of animal species, categories and performances on emissions (per kg edible protein, own calculations on the base of data from tables 11 and 12, see [110] protein source (body weight) performance per day nexcretion (% of intake) methane emission (g per day)3) emissions in kg per kg protein p n ch4 3) co2-eq dairy cow (650kg) 10kg milk 20kg milk 40kg milk 75 70 65 310 380 520 0.10 0.06 0.04 0.65 0.44 0.24 1.0 0.6 0.4 30 16 12 dairy goat (60kg) 2kg milk 5kg milk 75 65 50 60 0.08 0.04 0.5 0.2 0.8 0.4 20 10 beef cattle (350kg) 500g1) 1000g1) 1500g1) 90 84 80 170 175 180 0.30 0.18 0.14 2.3 1.3 1.0 3.5 1.7 1.2 110 55 35 growing/fattening pig (80kg) 500g1) 700g1) 900g1) 85 80 75 5 5 5 0.20 0.12 0.09 1.0 0.7 0.55 0.12 0.08 0.05 16 12 10 broilers (1.5kg) 40g1) 60g1) 70 60 traces 0.04 0.03 0.35 0.25 0.01 0.01 4 3 laying hen (1.8kg) 50%2) 70%2) 90%2) 80 65 55 traces 0.12 0.07 0.05 0.6 0.4 0.3 0.03 0.02 0.02 7 5 3 1)weight gain 2)laying performance 3)ch4-emission depending on composition of diet animal review, 2015, 2(2): 19-57 34 © 2015 conscientia beam. all rights reserved. nijdam, et al. [56] analysed 52 lca-studies (table 14) and summarized cf per kg product and per kg edible protein of animal origin. the results indicate that large differences exist between the studies and the products. the outcomes for milk, pork, poultry meat and eggs show much more homogeneity than those for beef, mutton, lamb and seafood. this is largely because of the very wide variety in production systems of the last food groups. meat from non-ruminants has a lower cf than those from ruminants because methane is the main contributor to cf in ruminants. because of too low values for feed production and processing (see tables 5 and 6), most values shown in table 13 are considerably lower than data given in table 14. table-14. carbon footprints of protein of food of animal origin according to several lca studies summarized by nijdam, et al. [56] protein source (studies) kg co2-eq per kg product kg co2-eq per kg protein cow milk (n = 14) 1 2 28-43 beef, intensive system (n = 11) meadow, suckler herds (n = 8) extensive pastoral systems (n = 4) 9 – 42 23 – 52 12 129 45-210 114-250 58-643 mutton and lamb (n = 5) 10 150 51-750 pork (n = 11) 4 11 20-55 poultry meat (n = 5) 2 6 10-30 eggs (n = 5) 2 6 15-42 seafood from fisheries (n = 18) 1 86 4-540 seafood from agriculture (n = 11) 3 15 4-75 apart from protein, food of animal origin also contains other main nutrients (fat and lactose in the case of milk; fat in the case of meat and eggs), which contribute to human nutrition and which may replace energy of plant origin in human food. but at this point it has to be emphasized that this protein intake is accompanied willingly or not by an energy intake from the protein itself. therefore, the exclusive attribution of the co2 burden to the protein fraction ("edible protein") should be avoided. to prevent this fact from being neglected, there are different alternatives. in a first simple method, the co2 emissions due to 1 kg edible protein could be used as co2 burden of consumed energy (for example: 1 kg edible protein of eggs corresponds to about 8 kg egg, corresponds to 51.6 mj energy; this combined intake is related to a certain amount of co2-eq). "nutritional allocation" and/or ―economic allocation‖ [135]; [136]; [106]; [137]; [28]; [138] may distribute co2 emissions to different functions of the food, but should not be discussed in the present paper. 5 challenges for lower methane emissions and reduction potentials numerous factors contribute to the greenhouse gas emissions by animals. developing strategies to reduce emissions offers the potential to increase production efficiency and to reduce the impact of animals on the environment. most attention has been spent to reduce the methane animal review, 2015, 2(2): 19-57 35 © 2015 conscientia beam. all rights reserved. production in ruminants as summarized recently by hristov, et al. [88]. methane reduction potentials will be considered in the following subchapters. 5.1. plant breeding plant breeding can be considered as the starting point of the food chain (see [139]; [140]. traditional breeding, as well as ―green‖ biotechnology or green chemistry [11], may result in changing of composition and nutritive value of feed plants. lower fibre content and higher digestibility of plants may reduce methane emission from the rumen. presently, special attention is given to the adaptation of plants to expected climate changes, e.g., [141]; [142]; [143]; [144] and to improving their yield and the nutritive value for global food security [145]. genetically modified plants may contribute to achieving these objectives (see [146], but are presently under critical public discussion. nutritionists distinguish genetically modified (gm) plants into plants of the first and second generation. this designation is purely pragmatic or historical; it does not reflect any particular scientific principle or technological development. the first generation of gm plants is generally considered to be crops carrying simple input traits such as increased resistance to pests or tolerance against herbicides. other inputs, such as more efficient use of water and/or nutrients, or an increased resistance against heat and drought, are not expected to cause any substantial change in composition and nutritive value. the newly expressed proteins that confer these effects occur in gm-plants in very low concentrations and do not change their composition or feeding value significantly when compared with isogenic lines. gm-plants of the so-called second generation (or plants with output traits or substantial changes in composition) are being developed with specific benefits for the consumer or the animals. such biofortified crops contain higher amounts of desirable nutrients/substances such as proteins/amino acids, specific fatty acids, minerals, vitamins, enzymes, antioxidative substances, etc., or lower contents of undesirable substances, such as fibre/lignin, phytates, glucosinolates, mycotoxins, etc., [147] give a review about new events of gm crops in the pipeline as feed for animal nutrition. adequate feeding studies for the nutritional assessment of such feed of the second generation of gm crops are required. attention should be also devoted to changes in plant/feed composition in consequence of traditional plant breeding. 5.2. feed production, harvesting, storing and processing about 10 to 80% of ghg-emissions of animal husbandry come from feed production (see chapters above; lower values for ruminants, higher values for non-ruminants). feed production contributes to ghg-emissions by land uses changes (luc; e.g., change of forest into cropland or pasture with the consequences of high co2-emissions; see [67], by n2oemission in consequence of fertilizing the soil and by co2 from burning of fuel by machinery on the field, during harvesting and further processing of feed before feeding. reduction of post-harvest losses and losses during feed storage can be considered as an important contribution to lower cf per feed unit [11] animal review, 2015, 2(2): 19-57 36 © 2015 conscientia beam. all rights reserved. more details and reduction potentials of ghg during feed production, harvesting, storing and processing incl. production of mixed feed for animals have been described by many authors, e.g., [121], [148] and his team; [108]. 5.3. feeds the high portion of ghg-emission in non-ruminants comes from feed production (see chapters 3.2 and 5.1). therefore, an effective use of feeds and the partial replacement of feeds by co-products of agriculture, food and bio-fuel industry may contribute to reducing cf for food of animal origin. the reduction of feeds in animal nutrition, which can also be used in human nutrition (such as cereals, beans, oilseeds etc.), would also be a real challenge for animal feeding [149]. apart from roughages and concentrates, co-products from agriculture, such as cereal straw, e.g., [150]; [151], but also from food production, e.g., [152]; [153] and the biofuel-industry [119] are commonly used in animal feeding. co-products are by-products of main processes such as grain production (e.g., straw, stalks, husks), processing of raw products in the food industry (e.g., extracted oil meals from the oil industry, bran from the cereal processing; beet pulp or bagasse from the sugar industry; animal co-products from milk, fish or meat processing) or from the biofuel industry (e.g., distillers dried grains with solubles (ddgs); rape seed cake/meal or rape seed extracted oil meal as well as cakes and meals from other oil seeds). according to the fao [8], between 10 and 50% of the estimated concentrate feed comes from co-products in various global regions [117]. in some countries, up to 100% of concentrate may base on co-products. co-products are used in various amounts and proportions in animal diets. cereal straws and other co-products rich in plant cell-walls are mostly characterized by a low digestibility and are thus poor in energy and protein delivery to the animal. they are fed to ruminants with low animal yields or to meet their maintenance requirements. for high yielding ruminants they can only be considered as a source of fibre. normally, they are not used in the feeding of non-ruminants. the importance of co-products of the food and biofuel industry as feed for animal nutrition will increase during the next few years [119]. co-products from the food and fuel industry contain two to three times as many nutrients, which are not removed by processing (e.g., protein in the case of ddgs). they can be used as valuable sources of protein, minerals and other nutrients depending on the source material and the chemical or physical processing without any land-footprint. in the future more grains will be used for food and fuel and more co-products will be available for animal nutrition [131]. more details about the nutritive value and the utilisation of co-products from biofuel industry in animal nutrition were recently compiled by makkar [119]. co-products of agriculture and of industry are used to replace concentrates and roughage from grassland. in the future, we may expect some new developments in the field of co-products as animal feed. more people all over the world need more food and more energy. therefore cereals, legumes and oilseeds will be used directly in larger amounts for human nutrition and will be more animal review, 2015, 2(2): 19-57 37 © 2015 conscientia beam. all rights reserved. extracted during processing. that means that less concentrate and more extracted co-products will be available for animal nutrition. more analytical data are required for such co-products. the detoxification of substances rich in protein and energy would be also a challenge to increase the potential of feeds and co-products [131]. kitchen refusals are still used in many countries in animal nutrition. presently, the feeding of such refusals is not permitted in the european union because for hygienical reasons. because of the bse-crisis (bovine spongiform encephalopathy), the feeding of co-products from slaughterhouses (e.g., meat meal, blood meal, bone meal) has not been permitted in the european union since 2001. some research activities are underway for an efficient use of these valuable protein, energy and mineral sources in the future. 5.4. animal feeding and animal yields (productivity) one of the most important challenges to reduce the emissions per animal product is the increase of animal yields or an improved production efficiency [154]; [155]; [117] and in consequence, a reduction of animal numbers [156]. investments in the productivity simultaneously result in reduced emission per unit of product as exemplarily shown in table 15 and figure 1 for the milk production. the level of feed intake of animals is one of the most important prerequisites for animal yields. the higher the feed intake, the higher the portion of energy and nutrients available for animal performance, as shown in table 15 for milk table-15. model calculation to show the influence of dry matter intake (dmi; 7.0 mj nel/kg dm) of dairy cows (body weight: 650 kg; 4% milk fat; [157] on energy intake, percentage of energy for maintenance and milk yield, energy per kg of milk as well as emissions per kg of milk [91] dry matter intake (dmi, kg per day) 10 15 20 25 30 energy intake (mj nel per day) 70 105 140 175 210 energy requirement for maintenance (37.7 mj nel per cow per day; % of total nel-intake) 53.9 35.9 26.9 21.5 18.0 energy requirement for milk production (3.3 mj nel per kg) 9.8 20.4 31.0 41.6 52.2 net energy per kg milk (mj nel per kg milk) 7.1 5.1 4.5 4.2 4.0 methane emission1) (g per day) (g per kg milk) 240 24.5 360 17.6 480 15.5 600 14.4 720 13.8 carbon footprint (g co2eq per kg milk)2) 825 605 530 495 475 1) according to flachowsky and brade [78]: 24g ch4 per kg dmi for all diets 2) calculated on the basis of the greenhouse potential of ch4 (x 23) and the calculations by dämmgen and haenel [112] similar trends can be seen in milk yield per year and emission per kg fpcm (figure 1). the average of cf for the whole herd can be reduced after elimination of cows without milk or with very low milk yields. animal review, 2015, 2(2): 19-57 38 © 2015 conscientia beam. all rights reserved. figure-1. emission intensity (cf kgco2eq) in dependence of milk yield of cows (kg/year; by gerber, et al. [117]; opio [73] 5.5. rumen fermentation and methane (ch4) emission some possibilities for the reduction of methane mitigation, such as increasing forage digestibility and digestible forage intake, dietary lipids or concentrate portions in the ruminant diets [158]; [159]; [160], as well as the application of various feed additives are shown by some authors, e.g., [161]; [162]; [108]; [163]; [164] (table 16). table-16. feed measurements to reduce enteric methane emissions, importance on farm level and research need in ruminants measurements significance (esp. for europe) on farm level research need more concentrate, less fibre in the diet limited, because of high amounts already in many diets ~ forages with high digestibility, low fibre content consideration in plant breeding and practical feeding  fats and fatty acids in the diets limited, because of some side effects in the rumen  application of feed additives halogen compounds (e.g., chloral hydrates) banned in the eu ~ ionophores (e.g., monensin) banned in the eu  addition of hydrogen acceptors, such as fumaric acid, acrylic acid etc. presently no significance  addition of phytogenic substances (essential oils; plant extracts or plants containing such substances; e.g., garlic, tannines, saponines) presently no significance   addition of 3-nitrooxypropanol and other nitrooxycarboxylic acids presently no significance   further additives, such as yeasts, enzymes, etc. presently no significance   : high need; : need; ~: less important animal review, 2015, 2(2): 19-57 39 © 2015 conscientia beam. all rights reserved. enhanced animal productivity and feed efficiency with metabolic modifiers, such as growth hormones and ionophoric antibiotics [87], would reduce ghg emissions, but the applicability of these mitigation practices is limited to regions where the use of these substances is permitted. appuhamy, et al. [165] analysed the methane reduction potential of the ionophoric substance monensin via meta-analysis. data from 22 controlled feeding studies were used. the methane mitigation effects of monensin were small (12 or 14 g/d in dairy cows and beef cattle) when adjusted for the monensin dose. hydrogen acceptors, such as fumaric acid, acrylic acid and further substances may also contribute to h2-binding in the rumen, but the in vivo effects are low and inconsistent, e.g. [166]; [167]. many studies were done with phytogenic substances such as tannins, non-tannins, phenols, saponins, essential oils and whole plants or parts of plants, e.g., [168]. despite of limitations of dietary fat in the range of 5% in ruminant rations [169], caused by lower fibre digestion and modification of the microbial population, experiments with single fatty acids and rapeseed oil showed potential to decrease methanogenesis. in vitro incubation of ruminal fluid added with ricinoleic acid resulted in a decline of 28 % in methane production. a reason for that observation could be differential toxic effects on not know methanogens [170] new metatranscriptomic approaches applied to ruminal fluid (sequencing of the rumen microbiome) give new insight into the abundance of rumen microorganisms and their gene expression. a novel group of methanogens (thermoplasmata archaea) was recently described using this approach. thermoplasmata uses methylamine as a substrate for methanogenesis and rapeseed oil supplementation reduced the occurrence of these thermoplasmata and methylcoenzym m reductase. from these observations the authors concluded that thermoplasmata are a high potential target to reduce methane production in ruminants [171]. the development of new feed additives, mainly based on plant extracts to decrease methane production within the rumen, has attracted research activities over the last 20 years. the results remain variable and contradictory as summarized by benchaar and greathead [172]. the effectiveness of plants or plant extracts having a high content of saponins, flavonoids and tannins (see table 16) varied depending upon the source, type and level of secondary metabolite present in the plant material. these may restrict the uptake and use of such phytogenic substances in the animal feeding market. the reasons for such restrictions may be related to several factors, including the lack of persistency of the effects when they are tested in vivo due to the adaptation of the microbial ecosystem, the variability of concentration of active compounds in plant extracts, the stability of the active substance within the rumen, and possible side effects that compromise overall rumen fermentation [173]. most of the substances were tested in in vitro studies, they may have a potential to reduce methane emissions from ruminants although their long-term effect has not been well established and some are toxic, or may not be economically feasible. impressive results of in vitro studies were mostly not repeated under in vivo conditions. therefore, [174] proposed a five-stage programme to evaluate the effects of such additives under special consideration of phytogenic substances: 1. botanical characterization of the plant(s) and their composition animal review, 2015, 2(2): 19-57 40 © 2015 conscientia beam. all rights reserved. 2. analytical characterization of the active phytogenic substance(s) 3. in vitro studies to test effects of substances on rumen fermentation and methanogenesis (i.e., screening) 4. in vivo studies (e.g., feed intake, rumen fermentation, ch4 emissions) 5. long-term feeding studies with target animal species/categories (e.g., animal health and performance, quality and safety of food of animal origin, environmental impact, adaptation of microbes). another reason for the restricted use of phytogenic substances as methane inhibitors may be their unclear transfer from feed into food of animal origin and possible residues in animal products and their effects in humans, e.g. [175]; [176]; [177]. the development of synthetic compounds with specific activities to influence metabolic pathways essential to ruminal archaea may overcome some restrictions of phytogenic compounds. methyl-coenzyme m reductase catalyses the last step of reduction of co2 to ch4 by hydrogenotrophic methanogenic archaea [77]. in preliminary studies, e.g. [178]; [179]; [180, 181], some authors tested the effects of molecules, substituted at various positions with at least one nitrooxy group, as inhibitors of methyl-coenzyme m reductase, such as nitrooxy-propionate compounds on the ruminal fermentation and the methane emissions. these substances are able to reduce the final step of co2 to ch4 by methanogenic archaea [182]. [183] studied the effect of ethyl-3-nitroxy propionate (e3np) and 3-nitrooxypropanol (3np) in vitro and in vivo in non-lactating sheep on ruminal methane production, fermentation pattern, the abundance of major microbial groups, and feed degradability. the in vitro batch culture trial tested 2 doses of e3np and 3np (40 and 80 µl/l) and found a substantial reduction of methane production (up to 95%) without affecting concentration of volatile fatty acids. in sheep methane production decreased by 29% in comparison with the unsupplemented control, without any effect on rumen dry matter degradation. reynolds, et al. [184] tested effects of feeding of 0.5 and 2.5 g 3-nitrooxypropanol per cow and day on methane emissions, digestion and energy and nitrogen balance of lactating cows. the substance was administered through the rumen fistula. daily methane production was reduced by 3np of 6.6 and 9.8% for 0.5 and 2.5 g/d, respectively. a homogenous mixing with feed or a sustained-release bolus may be more effective than application used in the present studies. haisan, et al. [185] applied the additive by hand-mixing 2.5 g 3np per cow and day into the total mixed ration (tmr) once daily and measured a reduction of methane emission of about 60% (from 17.8 to 7.2 g/kg dry matter intake). dry matter intake of cows, milk yield and milk composition were not significantly affected by the additive, but the additive increased body weight gain (1.06 vs. 0.39 kg/d), indicating that the reduction of methane emissions increased energy availability to animals. the inconsistency in methane reduction in studies with dairy cows requires further experimental studies to understand the mode of action of 3-nitrooxypropanol in the rumen (see [174]. animal review, 2015, 2(2): 19-57 41 © 2015 conscientia beam. all rights reserved. 5.6. excrement management anaerobic excrement storage may contribute to methane emission from the excreta. about 18% of the global methane emissions from animal husbandry come from excreta [7]. therefore, the excreta should be used as substrate in biogas fermenters [186] or stored in airtight containers. there are a number of animal and management practices that are feasible and can effectively reduce n2o emissions from manure storage and/or land application [92]. optimizing the animal diet to improve n use efficiency and balancing n input with production level are important steps in reducing n2o emissions from the manure [187]; [188]. due to the complex interaction between nutrition, production, animal health, and economic performance, diet modification to reduce n inputs should be done carefully to prevent reduced fibre digestibility and to maintain animal productivity [92]. 5.7. animal keeping, genetic and animal health animal health, low animal losses, long periods of productive life of reproductive animals such as dairy cows, sows etc., a reduction in the number of ―unproductive‖ or low yielding animals and a feeding of animals according to species/categories as well as performances avoiding excess and deficiencies are general potentials for lower emissions with greenhouse potential. some recent reviews analysed and summarized ghg-emissions during animal keeping,e.g., [189]; [190]; [191], animal feeding and management mitigation options [87, 88, 94]; [92]; [66]. in an excellent review [88] summarized non-co2 ghg mitigation opportunities by: feed additives and feeding strategies manure handling strategies animal management strategies reproductive management strategies interactions among non-co2 ghg. the authors assess the relative effectiveness, the input required to achieve desired effects and the applicability to regions. improvement of feed conversion rate (fcr) is one of the most efficient ways to reduce emission per kg animal product and to decrease cf. this statement is right for ruminants [66], non-ruminants [126] and aquaculture [127]; [192]. special attention should be paid to the non-co2-emissions.improved genetics and animal health care as well animal management in combination with better reproduction and feeding (higher digestibility and quality of forages) and reduction the breeding overhead (i.e., animals kept to maintain the herd and old animals without lactation) may contribute to reducing emissions (esp. ch4) and cf [88]; [66]. [65] estimates that reducing the gap between livestock operations that generate high emissions vs. those that put out low emissions per unit of product could cut emissions by about 30 percent. higher feed intake is a key element for higher animal yields, improved feed efficiency and lower emissions per product [91], see table 15. another possibility to increase feed efficiency and to reduce emissions per unit edible protein is an increase in protein content in food of animal origin. it is not easy to increase the protein content of milk by cattle breeding, but it would be an animal review, 2015, 2(2): 19-57 42 © 2015 conscientia beam. all rights reserved. efficient measurement to reduce the ghg-emissions per kg milk protein as shown in a model in table 17. control cows should produce 9 000 kg milk per year with 3.4% protein (306 kg protein per year; 1 000 cows produce 306 t protein per year). table 17 shows the consequences of protein rich milk on animal numbers, methane emissions and ghg-amount per year in order to produce 306 t milk protein [193, 194]. table-17. required number of cows to produce 306 t milk protein in dependence on protein content of milk as well as methane emission from digestive tract, total ghg-emission and ghg-emission per kg milk protein [193, 194] kg milk per cow and year milk fat (%) milk protein (%) required number of cows ch4 from enteric fermentation (t/year) ghgpotential (t co2eq/year) co2eq per kg edible milk protein 9 000 9 0001) 9 000 9 000 9 000 4.2 4.1 3.7 3.6 3.4 3.35 3.40 3.60 3.65 3.75 1 015 1 000 945 932 907 129 126 116 114 110 4 522 4 421 4 046 3 959 3 790 1.48 1.44 1.32 1.29 1.24 1) shown in bold type: basal variant for comparison (9 000 kg milk/year with 3.4% milk protein) in summary, the reduction of cf in ruminant production per product should focus on a lowering of methane emissions from enteric fermentation and an increase of low production levels as well a reduction of ineffective animal numbers [78]; [65]; [88, 94]. in the future, results of plant (see [146] and animal breeding (e.g. [91]; [195] may also substantially contribute to lower ghg emissions. 6. conclusions global emissions from livestock are estimated at 7.1 gt co2-eq per year representing about 14.5% of human-induced ghg emissions [65]. beef and milk cattle, pigs for meat production as well as poultry for meat and egg production contribute to 41, 20, 9 and 8% resp. of the total emissions. feed production and processing and enteric fermentation from ruminants represent 45 and 39% of the total emissions. carbon footprints may help to assess the ghg emissions associated with the production of food of animal origin. they may contribute to sensitizing producers and consumers to a more resource-efficient and environmentally-friendly production and consumption of food of animal origin and to avoiding food wastage [196]. clear areas with high mitigation potential are the following: improving the feed production, esp. fertilization (n, manure), management and reduced luc. reduction of post harvest feed losses, storing losses and losses and waste at food consumption [11]. improving feed supply, feeding practices and digestibility of diets. animal review, 2015, 2(2): 19-57 43 © 2015 conscientia beam. all rights reserved. improving animal yields through genetics, animal health, feeding practices, animal management (incl. excrement management) and, in consequence, reduction of the number of low yielding animals. differences in the calculated cf per kg product or per kg edible protein are obvious. discrepancies in the results of various studies are explained by different system boundaries [197], allocation methods [137] and computation of emissions, especially with regard to land use changes, enteric methane and nitrous oxide emissions. a more standardized approach for cf-calculations would be very useful tool to provide an indicator for food labelling, to compare cf between production systems, regions and countries as well to assess the resource efficiency, esp. in non-ruminants. the high portion of methane in the cf of food from ruminants does not allow use of the cf of food from ruminants and nonruminants and conclude both food groups concerning feed efficiency. therefore, some authors (e.g. [62]; [197, 198]; [59]; [199] analysed limitations of cf as indicator of environmental sustainability and recommended significant efforts in more dynamic modelling to ameliorate the problems of spatial variation and local environmental uniqueness. furthermore, methodological problems must be solved [12] and more diverse researchers should be involved in such studies in order to improve the data basis. reduction of methane emissions from ruminants and other emissions with greenhouse potential are a great challenge for all those involved in feed production and animal feeding. some examples to do this are demonstrated in the paper. in summary, the production of food of animal origin is a very complex process and selective consideration, i.e., focussing on single factors, does not provide an assessment that reflects the complexity of the subject. funding: this study received no specific financial support. competing interests: the authors declare that they have no competing interests. contributors/acknowledgement: all authors contributed equally to the conception and design of the study. references [1] fao, "the state of food and agriculture. livestock in the balance," state of food and agriculture, p. 166, 2009. [2] fao, "how to feed the world in 2050. rome," p. 35, 2009. [3] n. alexandratos and j. bruinsma, world agriculture towards 2030/2050: the 2012 revision. rome: fao, 2012. [4] hlpe, "biofuels and food security (vo draft). a zero-draft consultation paper," p. 72, 2013. [5] c. l. delgado, "rising consumption of meat and milk in developing countries has created a new food revolution," j. nutr., vol. 133, pp. 3907s-3910s, 2003. [6] ipcc (intergovernmental panel on climate change), "guidelines for national greenhouse gas inventories," agriculture, forestry and other land use, vol. 4, 2006. [7] fao, "livestock´s long shadow, environmental issues and options. rome," p. 406, 2006. animal review, 2015, 2(2): 19-57 44 © 2015 conscientia beam. all rights reserved. [8] fao, "greenhouse gas emissions from the dairy sector. a life cycle assessment rome," p. 94, 2010. [9] h. c. godfray, j. r. beddington, i. r. crute, l. haddad, d. lawrence, and j. f. muir, "food security: the challenge of feeding 9 billion people," science, vol. 327, pp. 812-818, 2010. [10] s. j. vermeulen, b. m. campbell, and j. s. i. ingram, "climate change and food systems," annual review of environment and resources, vol. 37, pp. 195-222, 2012. [11] m. guillou and g. matheron, the world's challenge feeding 9 billion people. springer berlin: springer netherlands; ed. que, 2014. [12] hlpe, note on critical and emerging issues for food security and nutrition. rome, 06082014: fao, 2014. [13] b. thompson and l. amoroso, improving diets and nutrition: food-based approaches. wallingford uk and boston: food and agriculture organisation of the united nations (fao), rome and cab international, 2014. [14] c. g. neumann, n. o. bwibo, c. a. gewa, and n. drorbaugh, animal source foods as a food-based approach to improve diet and nutrition outcomes. in: thompson b, amoroso l, eds. improving diets and nutrition: food-based approaches. wallingford: cabi, 2014. [15] b. thompson and l. amoroso, combating micronutrient deficiencies: food-based approaches: food based approaches. wallingford uk: food and agriculture organisation of the united nations (fao), rome and cab international, 2010. [16] v. smil, "feeding the world: a challenge for the twenty-first century, feeding the world: a challenge for the twenty-first century," p. xxviii + 360, 2000. [17] e. s. cassidy, p. c. west, j. s. gerber, and j. a. foley, "redefining agricultural yields: from tonnes to people nourished per hectare," environ. res. lett., vol. 8, 2013. [18] v. r. young, d. m. bier, and p. l. pellett, "a theoretical basis for increasing current estimates of the amino acid requirements in adult man, with experimental support," am. j. clin. nutr., vol. 50, pp. 80-92, 1989. [19] f.a.u. who, "protein and amino acid requirements in human nutrition," report of a joint who/fao/unu expert consultation world health organization technical report series, 2007. [20] c. g. neumann, m. w. demment, a. maretzki, n. drorbaugh, and k. a. galvin, the livestock revolution and animal source food consumption: benefits, risks, and challenges in urban and rural settings of developing countries. in: steinfeld h, mooney ha, schneider f, neville le, eds. livestock in a changing landscape,: drivers, consequences and responses vol. 1. washington: island press, 2010. [21] j. p. f. d'mello, amino acids in human nutrition and health. wallingford (uk) and cambridge (usa): international c, 2011. [22] r. r. pillai and a. v. kurpad, amino acid requirements: quantitative estimates. in: d'mello jpf, eds. amino acids in human nutrition and health. wallingford: cabi, 2011. [23] j. smith, k. sones, d. grace, s. macmillan, s. tarawali, and m. herrero, "beyond milk, meat, and eggs: role of livestock in food and nutrition security," animal frontiers, vol. 3, pp. 6-13, 2013. [24] h. wennemer, g. flachowsky, and v. hoffmann, "protein, population, politics how protein can be supplied sustainable in the 21st century: plexus verlag, mittenberg and frankfurt/main," p. 160, 2006. animal review, 2015, 2(2): 19-57 45 © 2015 conscientia beam. all rights reserved. [25] j. c. waterlow, "the mysteries of nitrogen balance," nutrition research reviews, vol. 12, pp. 25-54, 1999. [26] a. a. jackson, protein. in: mann, j and s truswell (eds): essentials of human nutrition, 3rd ed.: oxford univ. press, 2007. [27] w. m. rand, p. l. pellett, and v. r. young, "meta-analysis of nitrogen balance studies for estimating protein requirements in healthy adults," am. j. clin. nutr., vol. 77, pp. 109-127, 2003. [28] a. avadi and p. freon, "life cycle assessment of fisheries: a review for fisheries scientists and managers," fish res., vol. 143, pp. 21-38, 2013. [29] m. a. keyzer, m. d. merbis, i. f. p. w. pavel, and c. f. a. van wesenbeeck, "diet shifts towards meat and the effects on cereal use: can we feed the animals in 2030," ecol. econ., vol. 55, pp. 187202, 2005. [30] d. tilman, c. balzer, j. hill, and b. l. befort, "global food demand and the sustainable intensification of agriculture," proc. natl. acad. sci. usa, vol. 108, pp. 20260-20264, 2011. [31] t. kastner, m. j. rivas, w. koch, and s. nonhebel, "global changes in diets and the consequences for land requirements for food," proc. natl. acad. sci. usa, vol. 109, pp. 6868-6872, 2012. [32] h. guyomard, s. manceron, and j. l. peyraud, "trade in feed grains, animals, and animal products: current trends, future prospects, and main issues," animal frontiers, vol. 3, pp. 14-18, 2013. [33] p. w. gerbens-leenes and s. nonhebel, "consumption patterns and their effects on land required for food," ecol. econ., vol. 42, pp. 185-199, 2002. [34] r. naylor, h. steinfeid, w. falcon, j. galloways, v. smil, and e. bradford, "losing the links between livestock and land," science, vol. 310, pp. 1621-1622, 2005. [35] s. wirsenius, c. azar, and g. berndes, "how much land is needed for global food production under scenarios of dietary changes and livestock productivity increases in 2030," agricultural systems, vol. 103, pp. 621-638, 2010. [36] g. flachowsky, u. meyer, and k. h. südekum, "land use for edible protein of animal origin a review," food security in press, vol. 6, 2014. [37] e. kebreab, "sustainable animal agriculture," cab international, p. xiii + 321, 2013. [38] safa, sustainable assessment of food and agriculture systems indicators. rome: fao. available: http://wwwfaoorg/docrep/015/an913e/an913epdf, 2013. [39] fao, "dairy asia: towards sustainability," in proceedings of an international consultation, held in bangkok, thailand, 2014, pp. 65. [accessed 21-23 may 2014]. [40] h. guyomard, b. darcy-vrillon, c. esnouf, m. marin, m. russel, and m. guillou, "eating patterns and food systems: critical knowledge requirements for policy design and implementation," agriculture and food security, vol. 1, p. 3. [accessed 3 september 2012], 2012. [41] d. pimentel and m. pimentel, "sustainability of meat-based and plant-based diets and the environment," am. j. clin. nutr., vol. 78, pp. 660s-663s, 2003. [42] l. reijnders and s. soret, "quantification of the environmental impact of different dietary protein choices," am. j. clin. nutr., vol. 78, pp. 664s-668s, 2003. http://wwwfaoorg/docrep/015/an913e/an913epdf animal review, 2015, 2(2): 19-57 46 © 2015 conscientia beam. all rights reserved. [43] l. baroni, l. cenci, m. tettamanti, and m. berati, "evaluating the environmental impact of various dietary patterns combined with different food production systems," eur. j. clin. nutr., vol. 61, pp. 279-286, 2007. [44] c. j. peters, j. l. wilkins, and g. w. fick, "testing a complete-diet model for estimating the land resource requirements of food consumption and agricultural carrying capacity: the new york state example," renew agr. food syst., vol. 22, pp. 145-153, 2007. [45] a. y. hoekstra and a. k. chapagain, "water footprints of nations: water use by people as a function of their consumption pattern," water resour. manag., vol. 21, pp. 35-48, 2007. [46] d. renault and w. w. wallender, "nutritional water productivity and diets," agr. water manage, vol. 45, pp. 275-296, 2000. [47] a. c. schlink, m. l. nguyen, and g. j. viljoen, "water requirements for livestock production: a global perspective," rev. sci. tech., vol. 29, pp. 603-619, 2010. [48] j. deikman, m. petracek, and j. e. heard, "drought tolerance through biotechnology: improving translation from the laboratory to farmers' fields," curr. opin. biotechnol., vol. 23, pp. 243-250, 2012. [49] d. c. hall and j. v. hall, "concepts and measures of natural-resource scarcity with a summary of recent trends," j. environ. econ. manag., vol. 11, pp. 363-379, 1984. [50] r. w. scholz and f. w. wellmer, "approaching a dynamic view on the availability of mineral resources: what we may learn from the case of phosphorus," global environ. chang, vol. 23, pp. 1127, 2013. [51] s. aerts, "agriculture´s 6 f´s and the need for more intensive agriculture. in: potthast t, meisch, s., eds. climate change and sustainable development," wageningen acad. publ., pp. 192-195, 2012. [52] m. m. mekonnen and a. v. hoestra, the green, blue and grey water footprint of farm animals and animal products. value of water res. rep. ser. no. 48. delft, the neterlands: unesco-ihe, 2010. [53] u. amarsinghe, water footprint of the dairy sector. bangkok thailand: proc of an intern consultation. [accessed 21-23 may 2014], 2014. [54] m. de vries and i. j. m. de boer, "comparing environmental impacts for livestock products: a review of life cycle assessments," livestock science, vol. 128, pp. 1-11, 2010. [55] t. l. t. nguyen, j. e. hermansen, and l. mogensen, "environmental consequences of different beef production systems in the eu," j. clean prod., vol. 18, pp. 756-766, 2010. [56] d. nijdam, t. rood, and h. westhoek, "the price of protein: review of land use and carbon footprints from life cycle assessments of animal food products and their substitutes," food policy, vol. 37, pp. 760-770, 2012. [57] p. upham, l. dendler, and m. bleda, "carbon labelling of grocery products: public perceptions and potential emissions reductions," j. clean prod., vol. 19, pp. 348-355, 2011. [58] w. young, s. xhwang, s. mcdonald, and c. j. oates, "sustainable consumption: green consumer behaviour when purchasing products," sustainable development, vol. 1, pp. 20-31, 2010. [59] k. r. caffrey and m. w. veal, "conducting an agricultural life cycle assessment: challenges and perspectives," sci. world j., 2013. animal review, 2015, 2(2): 19-57 47 © 2015 conscientia beam. all rights reserved. [60] r. a. f. de alvarenga, v. p. d. silva junior, s. r. soares, r. a. f. de alvarenga, and v. p. da silva junior, "comparison of the ecological footprint and a life cycle impact assessment method for a case study on brazilian broiler feed production," j. clean prod., vol. 28, pp. 25-32, 2012. [61] a. ciroth, g. fleischer, and j. steinbach, "uncertainty calculation in life cycle assessments a combined model of simulation and approximation," int. j. life cycle ass., vol. 9, pp. 216-226, 2004. [62] j. reap, f. roman, s. duncan, and b. bras, "a survey of unresolved problems in life cycle assessment," int. j. life cycle ass., vol. 13, pp. 374-388, 2008. [63] s. a. morais and c. delerue-matos, "a perspective on lca application in site remediation services: critical review of challenges," journal of hazard mater, vol. 175, pp. 12-22, 2010. [64] j. b. guinee, r. heijungs, g. huppes, a. zamagni, p. masoni, and r. buonamici, "life cycle assessment: past, present, and future," environ. sci. technol., vol. 45, pp. 90-96, 2011. [65] p. j. gerber, h. steinfeld, b. henderson, a. mollet, c. opio, and f. dijkman, tackling climate change through livestock a global assessment of emissions and mitigation opportunities. rome: food and agriculture organisation of the united nations (fao), 2013. [66] c. opio, p. gerber, a. mottet, a. falcucci, g. tempio, and m. macleod, greenhouse gas emissions from ruminant supply chains a global life cycle assessment. rome: food and agriculture organisation of the united nations (fao), 2013. [67] m. macleod, p. gerber, a. mottet, g. tempio, a. falcucci, and c. opio, greenhouse gas emissions from pig and chicken supply chains a global life cycle assessment. rome: food and agriculture organisation of the united nations (fao), 2013. [68] iunc, "the iunc programm 2005-2008. many voices, one earth. bangkok, thailand. available: https://cmsdata.iunc.org/downloads/programme-english.pdf. [accssed 17-25 nov. 2004]," 2005. [69] r. boonen, s. aerts, and l. de tavernier, which sustainability soits you? in: climate change and sustainable development. wageningen acad. publ.: potthast, t., meisch, s, 2012. [70] n. v. fedoroff, d. s. battisti, r. n. beachy, p. j. cooper, d. a. fischhoff, and c. n. hodges, "radically rethinking agriculture for the 21st century," science, vol. 327, pp. 833-834, 2010. [71] d. giovannucci, s. scherr, d. nierenberg, c. hebebrand, j. shapiro, and j. milder, food and agriculture: the future of sustainability. a strategic input to the sustainable development in the 21st century (sd21) project. new york: united nations department of economic and social affairs, division for sustainable development, 2012. [72] j. a. foley, n. ramankutty, k. a. brauman, e. s. cassidy, j. s. gerber, and m. johnston, "solutions for a cultivated planet," nature, vol. 478, pp. 337-342, 2011. [73] c. opio, "environmental performance of the dairy sector," in proc of an international consultation, bangkok, thailand, 21-23052014, 2014, pp. 12-13. [74] ipcc, "ipcc. (intergovernmental panel on climate change). mitigation of climate change," contribution of working iii to the fifth assessment report of the intergovernmental panel on climate change. cambridge, uk and new york, usa, cambridge university press2014. [75] h. kim, s. kim, and b. e. dale, "biofuels, land use change, and greenhouse gas emissions: some unexplored variables," environ. sci. technol., vol. 43, pp. 961-967, 2009. animal review, 2015, 2(2): 19-57 48 © 2015 conscientia beam. all rights reserved. [76] k. hergoualch and l. v. verchot, "stocks and fluxes of carbon associated with land use change in southeast asian tropical peatlands: a review," global biogeochemical cycles; gb2001, vol. 25, pp. 113, 2011. [77] g. attwood and c. mcsweeney, "methanogen genomics to discover targets for methane mitigation technologies and options for alternative h-2 utilisation in the rumen," aust. j. exp. agr., vol. 48, pp. 28-37, 2008. [78] g. flachowsky and w. brade, "reduction potentials for methane emissions from ruminants," züchtungskunde, vol. 79, pp. 417-465, 2007. [79] s. tamminga, a. bannink, z. dijkstra, and r. zom, "feeding strategies to reduce methane losses in cattle," animal science group, wageningen ur, rep., vol. 34, p. 44, 2007. [80] a. bannink, j. france, s. lopez, w. j. j. gerrits, e. kebreab, and s. tamminga, "modelling the implications of feeding strategy on rumen fermentation and functioning of the rumen wall," anim. feed sci. technol., vol. 143, pp. 3-26, 2008. [81] j. p. jouany, enteric methane production by ruminants and its control. in: andrieu s, wilde d, (eds). gut efficiency: the key ingredient in ruminant production elevating animal performance and health. wageningen: wageningen academic publishers, 2008. [82] k. a. beauchemin, t. a. mcallister, and s. m. mcginn, "dietary mitigation of enteric methane from cattle," cab reviews: perspectives in agriculture, veterinary science, nutrition and natural resources, vol. 4, pp. 1-18, 2009. [83] r. l. m. schils, j. e. olesen, a. del prado, and j. f. soussana, "a review of farm level modelling approaches for mitigating greenhouse gas emissions from ruminant livestock systems," livestock science, vol. 112, pp. 240-251, 2007. [84] t. yan, m. g. porter, and c. s. mayne, "prediction of methane emission from beef cattle using data measured in indirect open-circuit respiration calorimeters," animal science group, wageningen ur, rep., vol. 3, pp. 1455-1462, 2009. [85] j. dijkstra, j. france, s. lopez, j. l. ellis, e. kebreab, and a. bannink, "modelling biochemical rumen functions with special emphasis on methanogenesis," 23 hülsenberger gespräche 2010, lübeck, germany, 02-04062010, pp. 79-89, 2010. [86] j. l. ellis, a. bannink, j. france, e. kebreab, and j. dijkstra, "evaluation of enteric methane prediction equations for dairy cows used in whole farm models," global change biol., vol. 16, pp. 3246-3256, 2010. [87] a. n. hristov, j. oh, j. l. firkins, j. dijkstra, e. kebreab, and g. waghorn, "mitigation of methane and nitrous oxide emissions from animal operations: i a review of enteric methane mitigation options," j. anim. sci., vol. 91, pp. 5045-5069, 2013. [88] a. n. hristov, j. oh, c. lee, r. meinen, f. montes, and t. ott, mitigation of greenhouse gas emissions in livestock production a review of technical options for non-co2 emissions. in: gerber pjh, b.; makkar, h.p.s., (eds). rome, italy: fao animal production and health paper no. 177, fao, 2013. [89] p. ricci, j. a. rooke, i. nevison, and a. waterhouse, "methane emissions from beef and dairy cattle: quantifying the effect of physiological stage and diet characteristics," j. anim. sci., vol. 91, pp. 5379-5389, 2013. animal review, 2015, 2(2): 19-57 49 © 2015 conscientia beam. all rights reserved. [90] k. a. johnson and d. e. johnson, "methane emissions from cattle," j. anim. sci., vol. 73, pp. 24832492, 1995. [91] h. niemann, b. kuhla, and g. flachowsky, "perspectives for feed-efficient animal production," j. anim. sci., vol. 89, pp. 4344-4363, 2011. [92] f. montes, r. meinen, c. dell, a. rotz, a. n. hristov, and j. oh, "special topics--mitigation of methane and nitrous oxide emissions from animal operations: ii. a review of manure management mitigation options," j. anim. sci., vol. 91, pp. 5070-5094, 2013. [93] g. flachowsky and p. lebzien, "food producing animals and greenhouse gases possibilities of animal nutrition for reduction of the emissions (in german)," übers z tierern, vol. 35, pp. 191-231, 2007. [94] a. n. hristov, t. ott, j. tricarico, a. rotz, g. waghorn, and a. adesogan, "mitigation of methane and nitrous oxide emissions from animal operations: iii a review of animal management mitigation options," j. anim. sci., vol. 91, pp. 5095-5113, 2013. [95] r. j. stevens, r. j. laughlin, l. c. burns, j. r. m. arah, and r. c. hood, "measuring the contributions of nitrification and denitrification to the flux of nitrous oxide from soil," soil biol. biochem., vol. 29, pp. 139-151, 1997. [96] ipcc (intergovernmental panel on climate change), "synthesis report for policymakers," 2007. [97] h. flessa, w. pfau, p. dorsch, and f. beese, "the influence of nitrate and ammonium fertilization on n2o release and ch4 uptake of a well-drained topsoil demonstrated by a soil microcosm experiment," z pflanz bodenkunde, vol. 159, pp. 499-503, 1996. [98] o. oenema, g. l. velthof, s. yamulki, and s. c. jarvis, "nitrous oxide emissions from grazed grassland," soil use manage, vol. 13, pp. 288-295, 1997. [99] j. w. van groenigen, g. l. velthof, f. j. e. v. d. bolt, a. vos, p. j. kuikman, and f. j. e. v. der bolt, "seasonal variation in n 2o emissions from urine patches: effects of urine concentration, soil compaction and dung," plant and soil, vol. 273, pp. 15-27, 2005. [100] c. lampe, k. dittert, b. sattelmacher, m. wachendorf, r. loges, and f. taube, "sources and rates of nitrous oxide application of n-15-labelled emissions from grazed grassland after mineral fertilizer and slurry," soil biol biochem., vol. 38, pp. 2602-2613, 2006. [101] c. bessou, b. mary, j. leonard, m. roussel, e. grehan, and b. gabrielle, "modelling soil compaction impacts on nitrous oxide emissions in arable fields," eur. j. soil sci., vol. 61, pp. 348363, 2010. [102] p. weisskopf, r. reiser, j. rek, and h. r. oberholzer, "effect of different compaction impacts and varying subsequent management practices on soil structure, air regime and microbiological parameters," soil till res., vol. 111, pp. 65-74, 2010. [103] m. schmeer, r. loges, k. dittert, m. senbayram, r. horn, and f. taube, "legume-based forage production systems reduce nitrous oxide emissions," soil and tillage research, vol. 143, pp. 17-25, 2014. [104] a. g. williams, e. audsley, and d. l. sanders, "determining the environmental burdens and resource use in the production of agricultural and horticultural commodities," main report defra animal review, 2015, 2(2): 19-57 50 © 2015 conscientia beam. all rights reserved. research project is0205, bedford: cranfield university and defra. available: wwwsilsoecranfiedacuk, and wwwdefragovuk, 2006. [105] a. leip, f. weiss, t. wasenaar, i. perez, t. fellmann, and p. loudjami, "evaulation of the livestock sector´s cntribution to the eu greenhouse gas emissions (ggels)," final report, jrc, eu2010. [106] j. gruenberg, h. nieberg, and t. g. schmidt, "carbon footprints of food: a critical reflection," langbauforschung-ger, vol. 60, pp. 53-72, 2010. [107] g. flachowsky, "carbon-footprints for food of animal origin, reduction potentials and research need," j. appl. anim. res., vol. 39, pp. 2-14, 2011. [108] g. flachowsky, w. brade, a. feil, j. kamphues, u. meyer, and m. zehetmeier, "carbon (co 2)footprints of producing food of animal origin data base and reduction potentials (in german)," übers z tierern, vol. 39, pp. 1-45, 2011. [109] j. p. lesschen, m. van den berg, h. j. westhoek, h. p. witzke, and o. oenema, "greenhouse gas emission profiles of european livestock sectors," anim. feed sci. technol., vol. 166-67, pp. 16-28, 2011. [110] g. flachowsky and j. kamphues, "carbon footprints for food of animal origin: what are the most preferable criteria to measure animal yields," animals, vol. 2, pp. 108-126, 2012. [111] g. m. peters, h. v. rowley, s. wiedemann, r. tucker, m. d. short, and m. schulz, "red meat production in australia: life cycle assessment and comparison with overseas studies," environ. sci. technol., vol. 44, pp. 1327-1332, 2010. [112] u. dämmgen and h. d. haenel, "emissions of greenhouse gases and gaseous air pollutants a challenge for animal nutrition," proceedings of the society of nutrition physiology, vol. 17, pp. 163-167, 2008. [113] j. w. casey and n. m. holden, "quantification of ghg emissions from sucker-beef production in ireland," agricultural systems, vol. 90, pp. 79-98, 2006. [114] j. w. casey and n. m. holden, "greenhouse gas emissions from conventional, agri-environmental scheme, and organic irish suckler-beef units," j. environ. qual., vol. 35, pp. 231-239, 2006. [115] h. s. matthews, c. t. hendrickson, and c. l. weber, "the importance of carbon footprint estimation boundaries," environ. sci. technol., vol. 42, pp. 5839-5842, 2008. [116] k. bartl, c. a. gomez, and t. nemecek, "life cycle assessment of milk produced in two smallholder dairy systems in the highlands and the coast of peru," j. clean prod., vol. 19, pp. 1494-1505, 2011. [117] p. gerber, t. vellinga, c. opio, and h. steinfeld, "productivity gains and greenhouse gas emissions intensity in dairy systems," livestock science, vol. 139, pp. 100-108, 2011. [118] g. flachowsky, "greenhouse gases and resource efficiency. aspects of production of food of animal origin (in german)," ernährungs-umschau, vol. 55, pp. 414-419, 2008. [119] h. p. s. makkar, "biofuel co-products as livestock feed opportunities and challenges. biofuel coproducts as livestock feed opportunities and challenges," p. xviii + 533, 2012. [120] e. v. elferink, s. nonhebel, and h. c. moll, "feeding livestock food residue and the consequences for the environmental impact of meat," j. clean prod., vol. 16, pp. 1227-1233, 2008. animal review, 2015, 2(2): 19-57 51 © 2015 conscientia beam. all rights reserved. [121] f. j. bockisch, h. j. ahlgrimm, h. böhme, a. bramm, u. dämmgen, and g. flachowsky, "evaluation of organic and conventional agriculture concerning energy input and greenhouse gas emission output (in german)," landbauforschung völkenrode, vol. sh 211, p. 206, 2000. [122] g. flachowsky, "efficiency of energy and nutrient use in the production of edible protein of animal origin," j. appl. anim. res., vol. 22, pp. 1-24, 2002. [123] f. p. o'mara, "the significance of livestock as a contributor to global greenhouse gas emissions today and in the near future," anim. feed sci. technol., vol. 166-67, pp. 7-15, 2011. [124] m. q. b. tan, r. b. h. tan, and h. h. khoo, "prospects of carbon labelling – a life cycle point of view," j. clean prod., vol. 72, pp. 76-88, 2014. [125] a. thévenot, j. aubin, e. tillard, and j. vayssières, "accounting for farm diversity in life cycle assessment studies – the case of poultry production in a tropical island," j. clean prod., vol. 57, pp. 280-292, 2013. [126] n. pelletier, m. ibarburu, and h. w. xin, "a carbon footprint analysis of egg production and processing supply chains in the midwestern united states," j. clean prod., vol. 54, pp. 108-114, 2013. [127] r. mungkung, j. aubin, t. h. prihadi, j. slernbrouck, h. m. g. van der werf, and m. legendre, "life cycle assessment for environmentally sustainable aquaculture management: a case study of combined aquaculture systems for carp and tilapia," j. clean prod., vol. 57, pp. 249-256, 2013. [128] m. d. finke, nutrient content of insects organic value recovery solution studies. encyclopedia of entomology: springer, 2004. [129] a. van huis, "potential of insects as food and feed in assuring food security," annu. rev. entomol., vol. 58, pp. 563-583, 2013. [130] a. van huis, j. v. itterbeeck, h. klunder, e. mertens, a. halloran, and g. muir, "edible insects: future prospects for food and feed security, fao forestry paper," p. xvi + 187, 2013. [131] w. windisch, c. fahn, d. brugger, m. deml, and m. buffler, "strategies for sustainable animal nutrition strategien fur eine nachhaltige tierernahrung," zuchtungskunde, vol. 85, pp. 40-53, 2013. [132] j. mlcek, o. rop, m. borkovcova, and m. bednarova, "a comprehensive look at the possibilities of edible insects as food in europe a review," polish journal of food and nutrition sciences, vol. 64, pp. 147-157, 2014. [133] s. w. souci, w. fachmann, and h. kraut, food table for the practice. the little souci-fachmann-kraut (in german)," ed, deutsche forschungsanstalt für lebensmittelchemie, freising, 7th ed. stuttgart: wiss verlagsgesellschaft mbh, 2008. [134] m. j. vandehaar, "efficiency of nutrient use and relationship to profitability on dairy farms," j. dairy sci., vol. 81, pp. 272-282, 1998. [135] c. cederberg and m. stadig, "system expansion and allocation in life cycle assessment of milk and beef production," int. j. life cycle ass., vol. 8, pp. 350-356, 2003. [136] m. a. thomassen, k. j. van calker, m. c. j. smits, g. l. iepema, and i. j. m. de boer, "life cycle assessment of conventional and organic milk production in the netherlands," agricultural systems, vol. 96, pp. 95-107, 2008. animal review, 2015, 2(2): 19-57 52 © 2015 conscientia beam. all rights reserved. [137] m. zehetmeier, j. baudracco, h. hoffmann, and a. heissenhuber, "does increasing milk yield per cow reduce greenhouse gas emissions? a system approach," animal, vol. 6, pp. 154-166, 2012. [138] a. g. roer, a. johansen, a. k. bakken, k. daugstad, g. fystro, and a. h. stromman, "environmental impacts of combined milk and meat production in norway according to a life cycle assessment with expanded system boundaries," livestock science, vol. 155, pp. 384-396, 2013. [139] t. r. society, "reaping the benefits: science and the sustainable intensification of global agriculture. rs policy document 11/09, issued oct 2009, rs 1608," 2009. [140] g. flachowsky, u. meyer, and m. grün, "plant and animal breeding as starting points for sustainable," in: sustainable agriculture reviews: e. lichtfouse, pp. 201-224, 2012. [141] d. b. lobell, m. b. burke, c. tebaldi, m. d. mastrandrea, w. p. falcon, and r. l. naylor, "prioritizing climate change adaptation needs for food security in 2030," science, vol. 319, pp. 607610, 2008. [142] m. p. reynolds, climate change and crop production. wallingford/cambridge, usa: cab international, 2010. [143] j. a. newman, m. anand, h. a. l. henry, s. hunt, and z. gedalof, "climate change biology," climate change biology, p. xiii + 289, 2011. [144] hlpe, food security and climate change. a report by the high level panel of experts on food security and nutrition, june 2012. rome: committee on world food security; fao, 2012. [145] t. fischer, d. byerlee, and g. edmeades, "crop yields and global food security: will yield increase continue to feed the world?, crop yields and global food security: will yield increase continue to feed the world?," p. xxi + 634, 2014. [146] g. flachowsky, animal nutrition with transgenic plants. in: flachowsky g, editor. animal nutrition with transgenic plants. cabi: wallingford; uk, 2013. [147] p. tillie, k. dillen, and e. rodriguez-cerezo, the pipeline of gm crops for improved animal feed: challenges for commercial use. in: flachowsky g, editor. animal nutrition with transgenic plants. wallingford: cabi, 2013. [148] f. taube, "efficient utilization of resources feed production for dairy cows (in german), 23 hülsenberger gespräche 2010, lübeck, germany, 02-04062010," pp. 176-183, 2010. [149] w. windisch, d. brugger, m. buffler, m. deml, and c. fahn, "animal nutrition is looking for new feed sources (in german)," presented at the 12 boku-symposium tierernährung, wien, 11042013, 2013. [150] f. sundstol and e. owen, "straw and other fibrous by products as feed," developm animal vetsci, 14, elsevier amsterdam, p. 610, 1984. [151] g. flachowsky, stroh als futtermittel : ergebnisse und erfahrungen bei der strohaufbereitung und beim einsatz von unterschiedlich behandeltem stroh als futtermittel. berlin: veb deutscher landwirtschaftsverlag, 1987. [152] m. b. kling and w. h. wöhlbier, handelsfuttermittel, bd. 1. stuttgart: verlag eugen ulmer, 1977. [153] h. jeroch, g. flachowsky, and f. weissbach, futtermittelkunde. stuttgart: gustav fischer verlag jena, 1993. animal review, 2015, 2(2): 19-57 53 © 2015 conscientia beam. all rights reserved. [154] s. e. place and f. m. mitloehner, "invited review: contemporary environmental issues: a review of the dairy industry's role in climate change and air quality and the potential of mitigation through improved production efficiency," j. dairy sci., vol. 93, pp. 3407-3416, 2010. [155] t. yan, c. s. mayne, f. g. gordon, m. g. porter, r. e. agnew, and d. c. patterson, "mitigation of enteric methane emissions through improving efficiency of energy utilization and productivity in lactating dairy cows," j. dairy sci., vol. 93, pp. 2630-2638, 2010. [156] m. herrero, p. gerber, t. vellinga, t. garnett, a. leip, and c. opio, "livestock and greenhouse gas emissions: the importance of getting the numbers right," anim. feed sci. technol., vol. 166/167, pp. 779-782, 2011. [157] gfe, recommendations for energy and nutrient requirements of dairy cattle and heifers (in german). no. 8. in: energy and nutrient requirements of domestic animals. frankfurt: dlg-verlags-gmbh, 2001. [158] v. fievez, g. goel, c. boeckaert, and b. vlaaeminck, potential of fatty acids mitigating ruminal methanogenisis. in: doppenberg j, van der aar, p., editor. dynamics in animal nutrition: wageningen acad. publ., 2010. [159] c. martin, d. p. morgavi, and m. doreau, "methane mitigation in ruminants: from microbe to the farm scale," animal, vol. 4, pp. 351-365, 2010. [160] r. j. eckard, c. grainger, and c. a. m. de klein, "options for the abatement of methane and nitrous oxide from ruminant production: a review," livestock science, vol. 130, pp. 47-56, 2010. [161] k. l. blaxter and j. czerkawski, "modifications of the methane production of the sheep by supplementation of its diet," j. sci. food agric., vol. 17, pp. 417-421, 1966. [162] j. a. mills, j. dijkstra, a. bannink, s. b. cammell, e. kebreab, and j. france, "a mechanistic model of whole-tract digestion and methanogenesis in the lactating dairy cow: model development, evaluation, and application," j. anim. sci., vol. 79, pp. 1584-1597, 2001. [163] k. a. beauchemin, m. kreuzer, f. o'mara, and t. a. mcallister, "nutritional management for enteric methane abatement: a review," aust. j. exp. agr., vol. 48, pp. 21-27, 2008. [164] t. a. mcallister and c. j. newbold, "redirecting rumen fermentation to reduce methanogenesis," aust. j. exp. agr., vol. 48, pp. 7-13, 2008. [165] j. a. d. r. n. appuhamy, a. b. strathe, s. jayasundara, c. wagner-riddle, j. dijkstra, and j. france, "anti-methanogenic effects of monensin in dairy and beef cattle: a meta-analysis," j. dairy sci., vol. 96, pp. 5161-5173, 2013. [166] e. bayaru, s. kanda, t. kamada, h. itabashi, s. andoh, and t. nishida, "effect of fumaric acid on methane production, rumen fermentation and digestibility of cattle fed roughage alone," animal science journal, vol. 72, pp. 139-146, 2001. [167] n. remling, s. riede, p. lebzien, u. meyer, m. höltershinken, and s. kersten, "effects of fumaric acid on rumen fermentation, milk composition and metabolic parameters in lactating cows," j. anim. physiol. anim. nutr., vol. 98, pp. 968-981, 2014. [168] r. bodas, s. lopez, m. fernandez, r. garcia-gonzalez, a. b. rodriguez, and r. j. wallace, "in vitro screening of the potential of numerous plant species as antimethanogenic feed additives for ruminants," anim. feed sci. technol., vol. 145, pp. 245-258, 2008. animal review, 2015, 2(2): 19-57 54 © 2015 conscientia beam. all rights reserved. [169] d. l. palmquist, use of fats in diets for lactating dairy cows. in fats in animal nutrition. ed. by j. wiseman: butterworth, boston, 1984. [170] e. r. morales, m. a. m. espinosa, n. mckain, and r. j. wallace, "ricinoleic acid inhibits methanogenesis and fatty acid biohydrogenation in ruminal digesta from sheep and in bacterial cultures," j. anim. sci., vol. 90, pp. 4943-4950, 2012. [171] m. poulsen, c. schwab, b. b. jensen, r. m. engberg, a. spang, and n. canibe, "methylotrophic methanogenic thermoplasmata implicated in reduced methane emissions from bovine rumen," nat. commun., vol. 4, p. 1428, 2013. [172] c. benchaar and h. greathead, "essential oils and opportunities to mitigate enteric methane emissions from ruminants," anim. feed sci. technol., vol. 166-67, pp. 338-355, 2011. [173] k. j. hart, d. r. yanez-ruiz, s. m. duval, n. r. mcewan, and c. j. newbold, "plant extracts to manipulate rumen fermentation," anim. feed sci. technol., vol. 147, pp. 8-35, 2008. [174] g. flachowsky and p. lebzien, "effects of phytogenic substances on rumen fermentation and methane emissions: a proposal for a research process," anim. feed sci. technol., vol. 176, pp. 70-77, 2012. [175] efsa, "guidance on safety assessment of botanicals* and botanical preparations** intended for use as ingredients in food supplements," efsa journal, vol. 7, p. 1249, 2009. [176] g. speijers, b. bottex, b. dusemund, a. lugasi, j. toth, and j. amberg-muller, "safety assessment of botanicals and botanical preparations used as ingredients in food supplements: testing an european food safety authority-tiered approach," mol. nutr. food res., vol. 54, pp. 175-185, 2010. [177] s. j. van den berg, l. serra-majem, p. coppens, and i. m. rietjens, "safety assessment of plant food supplements (pfs)," food funct, vol. 2, pp. 760-768, 2011. [178] g. martinez-fernandez, a. acro, l. abecia, g. cantalapiedra-hijar, a. molina-alcaide, and i. martin-garcia, "the addition of ethyl-3-nitrooxy propionate and 3-nitrooxypropanol in the diet of sheep substantially reduces methane emissions and the effect persists over a month," advances in animal biosciences, vol. 4, 2013. [179] c. k. reynolds, d. j. humphries, p. kirton, m. kindermann, s. duval, and w. steinberg, "effects of incremental rumen doses of 3-nitrooxypropanol on methane production, digestion and rumen parameters in lactating dairy cows," advances in animal biosciences, vol. 4, p. 261, 2013. [180] romero perez, k. a. beauchemin, s. m. mcginn, e. k. okine, l. l. guan, and m. oba, "the potential of 3-nitrooxipropanol to lower enteric methane emissions from beef cattle," advances in animal biosciences, vol. 4, p. 387, 2013. [181] a. romero perez, k. a. beauchemin, e. k. okine, and s. m. duval, "effects of 3-nitrooxipropanol on methane production using the rumen simulation technique (rusitec)," advances in animal biosciences, vol. 4, p. 389, 2013. [182] s. duval and m. kindermann, "nitrooxy alkanoic acids and derivates thereof in feed for reducing methane emission in ruminants, and/or to improve ruminant performance. s duval and m kindermann, assignees us patent no 20, 120, 315, 339," 2012. [183] g. martinez-fernandez, l. abecia, a. arco, g. cantalapiedra-hijar, a. i. martin-garcia, and e. molina-alcaide, "effects of ethyl-3-nitrooxy propionate and 3-nitrooxypropanol on ruminal animal review, 2015, 2(2): 19-57 55 © 2015 conscientia beam. all rights reserved. fermentation, microbial abundance, and methane emissions in sheep," j. dairy sci., vol. 97, pp. 3790-3799, 2014. [184] c. k. reynolds, d. j. humphries, p. kirton, m. kindermann, s. duval, and w. steinberg, "effects of 3-nitrooxypropanol on methane emission, digestion, and energy and nitrogen balance of lactating dairy cows," j. dairy sci., vol. 97, pp. 3777-3789, 2014. [185] j. haisan, y. sun, l. l. guan, k. a. beauchemin, a. iwaasa, and s. duval, "the effects of feeding 3nitrooxypropanol on methane emissions and productivity of holstein cows in mid lactation," j. dairy sci., vol. 97, pp. 3110-3119, 2014. [186] s. godbout, m. verma, j. p. larouche, l. potvin, a. m. chapman, and s. p. lemay, "methane production potential (b0) of swine and cattle manures--a canadian perspective," environ. technol., vol. 31, pp. 1371-1379, 2010. [187] g. flachowsky and p. lebzien, "possibilities for reduction of nitrogen (n) excretion from ruminants and the need for further research a review," landbauforsch völk, vol. 56, pp. 19-30, 2006. [188] r. l. m. schils, a. verhagen, h. f. m. aarts, p. j. kuikman, and l. b. j. sebek, "effect of improved nitrogen management on greenhouse gas emissions from intensive dairy systems in the netherlands," global change biol., vol. 12, pp. 382-391, 2006. [189] w. s. kraatz, b. berg, and k. j. küstermann, hülsbergen. energy and carbon balancing in livestock kepping. proc world congress: agricultural engineering for a better world bonn 03-07092006, vdiberichte nr 1958. germany: vdi-verlag düsseldorf, 2006. [190] r. brunsch, s. kraatz, w. berg, and c. rus, "measurements of energy efficiency in animal keeping on the base of energy balances (in german)," ktbl-schrift, vol. 463, pp. 115-125, 2008. [191] s. kraatz, "energy efficiency in animal keeping shown in dairy cattle keeping (in german)," phdthesis, humboldt-university berlin, 2009. [192] a. wilfart, j. prudhomme, j. p. blancheton, and j. aubin, "lca and emergy accounting of aquaculture systems: towards ecological intensification," j. environ. manage, vol. 121, pp. 96-109, 2013. [193] w. brade, u. dämmgen, p. lebzien, and g. flachowsky, "milk production and emissions of greenhouse gases: consequences for the future milk cattle breeding in germany?," tieraerztl umschau, vol. 63, pp. 189-199, 2008. [194] w. brade, u. dämmgen, p. lebzien, and g. flachowsky, "influence of a changed milk fat/milk protein ratio by breeding measures on the greenhouse gas emissions in the milk production," züchtungskunde, vol. 80, pp. 360-369, 2008. [195] f. forabosco, m. lohmus, l. rydhmer, and l. f. sundstrom, "genetically modified farm animals and fish in agriculture: a review," livestock science, vol. 153, pp. 1-9, 2013. [196] fao, "food wastage footprint impacts on natural resources.," summary report, rome2013. [197] k. plassmann and g. edwards-jones, "where does the carbon footprint fall? developing a carbon map of food production, sustainable markets discussion paper no. 4," p. iii + 34, 2009. [198] a. laurent, s. i. olsen, and m. z. hauschild, "limitations of carbon footprint as indicator of environmental sustainability," environ. sci. technol., vol. 46, pp. 4100-4108, 2012. animal review, 2015, 2(2): 19-57 56 © 2015 conscientia beam. all rights reserved. [199] m. owsianiak, g. lemming, m. z. hauschild, and p. l. bjerg, "assessing environmental sustainability of remediation technologies in a life cycle perspective is not so easy," environ. sci. technol., vol. 47, pp. 1182-1183, 2013. bibliography [1] g. andersen, food table for the practice: the little souci-fachmann-kraut (in german). stuttgart: wissenschaftliche verlagsgesellschaft mbh, 2011. [2] c. basset-mens, s. ledgard, and m. boyes, "eco-efficiency of intensification scenarios for milk production in new zealand," ecol. econ., vol. 68, pp. 1615-1625, 2009. [3] c. cederberg, u. sonesson, m. henriksson, v. sund, and j. davis, greenhouse gas emissions from swedish production of meat, milk and eggs 1990 and 2005. goeteborg: sik, the swedish institute for food and biotechnology, 2009. [4] c. cederberg and b. mattsson, "life cycle assessment of milk production — a comparison of conventional and organic farming," j. clean prod., vol. 8, pp. 49-60, 2000. [5] c. cederberg and a. flysjo, "life cycle inventory of 23 dairy farms in south-western sweden," sik rapport, 2004. [6] j. w. casey and n. m. holden, "analysis of greenhouse gas emissions from the average irish milk production system," agricultural systems, vol. 86, pp. 97-114, 2005. [7] r. fritsche and u. eberle, greenhouse gas emissions during production and processing of fods (in german). darmstadt: öko-institut ev, 2007. [8] gemis, "global emissions-model of integrated systems (in german), version 45. available: http://wwwoekode/service/gemis," 2009. [9] gfe, recommendations for energy and nutrient requirements of beef cattle (in german). no. 6;. in: energy and nutrient requirements of domestic animals. frankfurt: dlg-verlags-gmbh, 1995. [10] gfe, recommendations for energy and nutrient requirements of laying hens and broilers (in german). no. 7. in: energy and nutrient requirements of domestic animals. frankfurt: dlg-verlags-gmbh, 1999. [11] gfe, recommendations for energy and nutrient requirements of pigs (in german). no. 10. in: energy and nutrient requirements of domestic animals. frankfurt: dlg-verlags gmbh, 2006. [12] g. haas, f. wetterich, and u. kopke, "comparing intensive, extensified and organic grassland farming in southern germany by process life cycle assessment," agr. ecosyst. environ., vol. 83, pp. 43-53, 2001. [13] j. hirschfeld, j. weiß, m. precht, and t. korbun, climate effects of agriculture in germany (in german). berlin: schriftenreihe des iöw 186/08, 2008. [14] g. f. lachowsky, u. meyer, and m. grün, "plant and animal breeding as starting points for sustainable," sustainable agriculture reviews: e. lichtfouse, pp. 201-224 2012. [15] t. lindenthal, t. markut, s. hörtenhuber, g. rudolph, and k. hanz, "climate advantages once more demonstrated: climate balance of organic products (in german)," ökologischer landbau, vol. 153, pp. 51-53, 2010. [16] s. ledgard, j. finalyson, m. patterson, r. carran, and m. wedderburn, "effects of intensification of dairy farming system in new zealand on whole-system resource use efficiency and environmental emissions," in proceedings of the 4th international conference, oct 6-8, byxholm, denmark, 2004, pp. 48-52. [17] a. ogino, k. kaku, t. osada, and k. shimada, "environmental impacts of the japanese beef-fattening system with different feeding lengths as evaluated by a life-cycle assessment method," j. anim. sci., vol. 82, pp. 2115-2122, 2004. http://wwwoekode/service/gemis, animal review, 2015, 2(2): 19-57 57 © 2015 conscientia beam. all rights reserved. [18] a. ogino, h. orito, k. shimada, and h. hirooka, "evaluating environmental impacts of the japanese beef cow-calf system by the life cycle assessment method," animal science journal, vol. 78, pp. 424-432, 2007. [19] h. w. phetteplace, d. e. johnson, and a. f. seidl, "greenhouse gas emissions from simulated beef and dairy livestock systems in the united states," nutr. cycl. agroecosys, vol. 60, pp. 99-102, 2001. [20] pas, "2050 scenario building to test and inform the development of a bsi method for assessing greenhouse gas emissions from food. available from: bsi http://www.bsi-global.com,2011," report submitted by adas, project ref no: yaw3408nd. [21] t. reitmayr, "the development of a computerized coefficient system for the economic and ecological evaluation of agricultural forms of land use illustrated by an example entwicklung eines rechnergestutzten kennzahlensystems zur okonomischen und okologischen beurteilung von agrarischen bewirtschaftungsformen dargestellt an einem beispiel," agrarwirtschaft, sonderheft, p. 302, 1995. [22] s. subak, "global environmental costs of beef production," ecol. econ., vol. 30, pp. 79-91, 1999. [23] e. h. schlich and u. fleissner, "the ecology of scale: assessment of regional energy turnover and comparison with global food," int. j. life cycle ass., vol. 10, pp. 219-223, 2005. [24] m. sevenster and f. a. de jong, "sustainable dairy sector. global, regional and live cycle facts and figures on greenhouse-gas emissions," report ce delft, solutions for environment, economy and technology, publ. no: 0877892008. [25] x. p. c. verge, j. a. dyer, r. l. desjardins, and d. worth, "greenhouse gas emissions from the canadian dairy industry in 2001," agricultural systems, vol. 94, pp. 683-693, 2007. [26] i. a. j. van der zijpp, "animal production systems: on integration and diversity," habilitation thesis, univ of wageningen, wageningen, the netherlands, 2001. [27] a. woitowicz, "auswirkungen einer einschränkung des verzehrs von lebensmitteln tierischer herkunft auf ausgewählte nachhaltigkeitsindikatoren – dargestellt am beispiel konventioneller und ökologischer wirtschaftsweise," phd, technical university munich, 2007. views and opinions expressed in this article are the views and opinions of the author(s), animal review shall not be responsible or answerable for any loss, damage or liability etc. caused in relation to/arising out of the use of the content. http://www.bsi-global.com,2011,/ 