







































  
 
 

 

86 

Ann. psychophysiol. 
ISSN 2412-3188 (Online) | 2410-1354 (Print) 

APP| Published By AEIRC| https://doi.org/10.29052/2412-3188.v8.i2.2021.86-95 

 

 
Original Article                                                                                  

The identification of sialuria with different 
degrees of intellectual disabilities in 
children and adolescents 
Hina Ishtiaq1, Sonia Siddiqui2, Rukhsana Nawaz3, Muhammad Ashraf Hussain4, 
Fauzia Imtiaz2 & Zeba Haque2  
1Department of Neuroscience, Dr. Panjwani Center for Molecular Medicine and Drug 
Research, International Center for Chemical and Biological Sciences, University of Karachi, 
Karachi-Pakistan. 
2Department of Biochemistry, Dow University of Health Sciences, Karachi-Pakistan. 
3Department of Psychology, College of Humanities and Social Sciences, University of UAE,  
Al-Ain, UAE. 
4Combined Military Hospital, National University of Medical Sciences, Zhob, Baluchistan-
Pakistan. 

Abstract 
Background: Single nucleotide polymorphism/mutation in the R263L region of 
the allosteric site of the GNE gene produces a phenotype with an overproduction 
of intracellular levels of sialic acid and causes sialuria. In sialuria, a defective GNE 
gene, synthesized with lost feedback inhibition mechanism, produces many 
developmental delays and varying degrees of intellectual disabilities in children 
and adolescents. Several mutations in the epimerase and kinase domains exist that 
cause difficulty in getting a precise and exact effect of the GNE gene on the disease 
severity and sialic acid levels. This is the first study investigating the molecular 
basis of neuronal disorders exhibiting sialuria in Pakistani children/ adolescents.  
Methodology: The current study quantified the mRNA expression of the GNE 
gene and urinary sialic acid concentration by Realtime-qRT-PCR and Fluorimetric 
assays, respectively. The correlation between relative mRNA and urinary sialic 
acid levels was evaluated by using Pearson Bivariate correlations.  
Results: The data show that severely intellectually disabled (I.D.) patients showed 
significantly reduced mRNA expression levels of the GNE gene compared to 
controls. The concentrations of free sialic acid in urine were significantly reduced 
in severe I.D. patients compared to controls. Whereas patients with mild I.D. 
showed a two-fold increase in sialic acid levels when compared to controls. A 
significant correlation was found between an increased GNE mRNA and low 
urinary sialic acid levels from severe I.D. patients.  
Conclusion: The effect of the GNE gene is beyond hyposialylation that could 
hinder N-glycan structure and sialic acid biosynthesis. The study highlighted the 
possible involvement of sialic acid levels with different degrees of intellectual 
disabilities in Pakistani children and adolescents. 
 

Keywords 
Sialuria, Intellectual Disability, Metabolic Error. 

 

Citation: Ishtiaq H, Siddiqui S, Nawaz R, 
Hussain MA, Imtiaz F, Haque Z. The 
Identification of Sialuria with Different 
Degrees of Intellectual Disabilities in 
Children and Adolescents. APP. 
2021;8(2):86-95 
 
Corresponding Author Email: 
siddisbs@yahoo.com 
 
DOI: 10.29052/2412-3188.v8.i2.2021.86-95 
 
Received 06/09/2021 
 
Accepted 01/10/2021 
 
Published 01/12/2021 
 
Copyright © The Author(s). 2021 This  
 is an open access article distributed under 
the terms of the Creative Commons 
Attribution 4.0 International License, 
which permits unrestricted use, 
distribution, and reproduction in any 
medium, provided the original author  
and source are credited.  
 

 

Funding: The authors would like to 
thank HEC (grant no# 1028) and 
recurring grant, PCMD, for providing 
financial support.   

Conflicts of Interests: The authors have 
declared that no competing interests 
exist. 
 

https://doi.org/10.29052/2412-3188.v8.i2.2021.
http://creativecommons.org/licenses/by/4.0/)
http://creativecommons.org/licenses/by/4.0/)


 
 

87 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

Introduction  
Sialuria, an autosomal dominant disorder 
found in patients with a defective synthesis 
of a key enzyme UDP-N-acetylglucosamine-
2-epimerase N-acetylmannosamine kinase 
(GNE) due to the mutation in the R263L 
region of the GNE gene. Due to this 
mutation, the negative feedback inhibition is 
lost, disrupting sialic acid synthesis in 
mammals1. In sialuria, an increased 
overproduction of free sialic acid is found in 
the cytosol. Therefore, patients who exhibit 
an increased excretion of sialic acid in urine 
show many difficulties with developmental 
delays. Previously a transgenic mouse line 
that expresses GNE having a mutation in the 
same region R263L has been shown to 
produce and excrete 400 times higher RNA 
expression of mutated GNE gene than the 
wild type mice. N-acetylneuraminic acid 
levels were also higher in the brain 
cytoplasm with an increased polysialylation 
of neural cell adhesion molecule (NCAM) in 
transgenic mice than in wild type. However, 
the same study showed minor differences in 
membrane-bound sialylation in many 
organs. In contrast to this, a significantly 
higher expression of sialylation was 
observed on the surface of leukocytes. 
Kreuzmann and colleagues (2017) proved 
that the developmental delays associated 
with sialuria patient are due to increased 
intracellular levels of sialic acid that causes 
polysialylation on NCAM1.  
 
Sialic acids are composed of glycoproteins 
and glycolipids responsible for important 
cellular functions, infection, and metastasis. 
Its catabolism is important for a healthy 
heart and skeletal muscle functions not only 
in humans but in zebrafish as well2. Siblings 
with sialuria, exercise intolerance/muscle 
wasting, and cardiac symptoms were 
reported previously having heterozygous 
mutations in N-acetylneuraminate pyruvate 
lyase gene (NPL) at [chr1:182775324C>T 

(c.187C>T; p.Arg63Cys) and 
chr1:182772897A>G (c.133A>G; 
p.Asn45Asp)]. The effect was observed on 
sialic acid catabolism and cell-specific 
reductions in N-acetyl mannosamine 
(ManNAc) levels. Knockdown NPL in 
zebrafish leads to severe skeletal myopathy 
and cardiac edema, resembling the human 
phenotype. However, the phenotype was 
rescued by expressing wild-type human 
NPL. However, there was no change when 
p.Arg63Cys or p.Asn45Asp mutants were 
expressed. Surprisingly the phenotypes in 
zebrafish were rescued by feeding catabolic 
products of NPL: N-acetyl glucosamine 
(GlcNAc) and ManNAc2, suggesting 
monosaccharide replacement therapy for 
humans. As sialuria regulates neural 
development, neural regeneration, learning, 
and memory3,4, any alterations can alter 
humans' intellectual levels. Therefore, in this 
study, we have investigated the mRNA 
expression levels of the GNE gene in blood 
and sialic acid levels in urine, of the patients 
with different intellectual disabilities. 
 

Methodology 
Subject recruitment and Ethical Approval  
This study was approved by the Human 
Ethics Committee of the National Institute of 
Child Health and Rehabilitation Center 
(NICH), Jinnah Postgraduate Medical 
Center (JPMC), with the ethic number of 
HEA NO. F.2-81/2008-GENL/4086/JPMC. 
Parents of every subject were requested to 
read and understand the consent form before 
signing. The data was collected from 15th Jan 
to 30th July 2018. Overall 102 subjects were 
used for mRNA expression i.e. Controls 
(n=51) and patients (n=51). All subjects were 
between the ages of 0-17 years 
(male/females).  
 
These subjects were diagnosed according to 
the Diagnostic and Statistical Manual of 
Mental Disorders (DMS-IV) and 



 
 

88 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

International Classification of Diseases (ICD-
10) criteria and presented in Out-Patient-
Department (OPD) and Darul-Sukun, 
Karachi, Pakistan. Expert psychiatrists 
evaluated all subjects through history and 
clinical examinations.  
 
Biochemical analysis of Urinary Sialic Acid  
The levels of free sialic acid, N-
Acetylneuraminic acid, and urine were 
measured using the fluorometric sialic acid 
kit method (BioVision's cat # K566-100). 
Fluorescence at Ex/Em 535/587nm was 
measured using the molecular device 
SpectraMax Plus M5e Microplate Reader. 
Morning urine samples from I.D. subjects 
having risk for sialuria (10-13 years of age) 
were analyzed and compared with age-
matched control samples. Serial dilutions of 
sialic acid standards were performed 
according to the sialic acid assay kit. Urine 
samples collected from subjects and controls 
were centrifuged at 3000 rpm for 5 min to 
remove the metabolites.  
 
Real-Time Polymerase chain reaction (RT-
qPCR) 
Total RNA was extracted from whole blood 
(500 µl) using a whole blood RNA 
purification mini kit (Thermo Scientific 
GeneJET cat# K0761). The quality of 
extracted RNA was determined via a 
spectrophotometer (260/280 nm). According 
to the manufacturer's specifications, total 
RNA was transcribed to cDNA using 

RevertAid First Strand cDNA Synthesis Kit 
(Thermo Scientific cat# K1621). The PCR 
reaction was initiated by an incubation step 
at 25°C for 5 min, followed by only one cycle 
of annealing step at 42°C for 60 min with a 
termination step at 70°C for 5 min.  
 
PCR reaction performed with an ABI 7500 
software V.2.0.6 real-time PCR detection 
system (Applied Biosystem Inc. USA) using 
the Maxima SYBR Green/ROX qPCR Master 
Mix (Thermo Scientific). The thermal cycler 
program initiated by an incubating step at 
95°C for 10 min, followed by 40 cycles of 
denaturation step at 95°C for 15 s, annealing 
step at 55°C for 30 s, extension step at 72°C 
for 30 s and a final extension at 72°C for 5 
min (Table 1). No Template Control (NTC) 
and Reverse Transcriptase Minus (R.T.-) 
control along with PCR analysis was 
conducted in triplicate for each sample. The 
Delta Delta CT method used and selected 
genes' content was normalized to the 
housekeeping gene (HKG) GAPDH. The 
calculation was performed using the 
comparative Ct method according to the 
following formulas: 
 
ΔCtWT = Ctselected gene WT − CtHKG WT 

and 
ΔCtKO= Ctselected gene KO − CtHKG KO 

ΔΔCt =ΔCtKO −ΔCtWT 
Ratio = 2−ΔΔCt (maximum efficacy is 

presumed) 

 
 

Table 1: Thermal cycling conditions for RT-Qpcr. 

Gene                                            Primer sequence                                    PCR parameters for thermal cycle 

 
GNE mRNA         
 
 
GAPDH                            

 
5´CTCCGAGTTGCAATAGTCAG
3´ (F) 
CATCCAGAGACACAACAAGG 
(R) 
 
5´GCATCCTGGGCTACACTGAG
3´  (F)                             

1. Initial temperature______95⁰C for 10 
min 

2. Denaturing temperature__95⁰C for 15 
sec 

3. Annealing temperature__55⁰C for 30 
sec 

4. Extension Temperature__72⁰C for 30 
sec 

5. Go to repeat cycle _________2, 40 times 



 
 

89 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

*Thermal cycling conditions for RT-qPCR: The table is illustrating thermal cycling conditions for RT-qPCR with GNE 
and GAPDH primers. 
 
Statistical Analysis 
The data obtained in this study were 
analyzed using curve expert and SPSS 
software version 17. Differences between the 
mean values of different groups were 
identified by applying a student 
independent t-test. Each experiment was 
repeated three times. The correlation 
between relative mRNA and urinary sialic 
acid levels was evaluated by using Pearson 
Bivariate correlations.  P-value <0.05 was 
considered significant.  
 

Result 
Quantitative Estimation of Sialic Acid in 

Urine by Fluorometric Assay 

Free sialic acid (FSA) concentrations (Table 

2) from mild (0.32 ± 0.17), moderate (0.07 ± 

0.03) and severe (0.04 ± 0.01) intellectually 

disabled (I.D.) subjects were used to plot a 

bar diagram (Figure1). The result illustrates 

an average two-fold increase in sialic acid 

levels in mild I.D. subjects. However, the 

levels were not significant when compared 

to controls. In contrast, there was a 

significant decrease in the sialic acid levels 

found in the severely Intellectually Disabled 

subjects compared to controls. 

 

Fluorometric assay is used to quantify 

urinary free sialic acid (FSA) levels in ID 

patients. The table depicts no significant 

differences in sialic acid levels in mild and 

moderate ID. patients. However, there was a 

two-fold increase in the levels of sialic acid in 

mild ID. and a significant reduction in the 

free sialic acid levels in severe ID patients 

compared to controls. Statistical analysis 

was revealed by two independent t-test. 

Means values are ± S.D. p<0.05 was 

considered significant. 

 

 

Table 2: Fluorometric assay to quantify urinary free sialic acid (FSA) levels. 

 

Symptom 
Severity 

Age (Years) 
  

Free sialic acid (FSA) concentration 
in Urine µl) p-value 

(Means ± S.D.) 

Controls Subjects 
  

Controls 10-13   

Mild ID  10 

0.16±0.13 

0.32±0.17 <0.0005 

Moderate ID  11 0.07±0.03 <0.0005 

Severe ID  13 0.04±0.007 <0.0005 

5´TTGCCCTCAACGACCACTTT 
3´ (R) 

6. Final extension Temperature___72⁰C 
for 5 min 

7. Hold on _________________ 4⁰C 
forever 



 
 

90 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

 
Figure 1: Sialic acid levels in the urine controls and patients from Pakistan. 

 

The bar diagram shows the comparison of sialic acid levels among controls and ID patients. A 

significant difference was observed in patients with severe ID. Significant differences were 

evaluated by a two-tailed T-test (*p< 0.0005). 

 

GNE mRNA Expression levels 

The GNE gene expression in subjects with severe ID and controls was quantified concerning the 

housekeeping gene GAPDH. The results show a significant down-regulation in the expression of 

GNE gene levels in subjects with severe (P<0.003) ID when compared to controls (Figure 2).  

 
Figure 2: Relative expression levels of the GNE gene by real-time quantitative PCR. 

 

Bar graph representing the fold changes of GNE mRNA levels quantified by normalization to the 

GAPDH as an internal control. Mild, moderate, and severe ID. patients showed down-regulation 

in the GNE gene expression compared to controls. However, Mild and moderate ID. patients 

showed 2- and 0.5-fold up-regulation compared to severe ID. patients, respectively. 



 
 

91 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

Significant differences were evaluated by an 
independent T-test (**p< 0.01, ***p<0.003). 
Significant correlation was found between 
GNE mRNA and sialic acid levels of severe 
ID patients (0.048 ± 0.0076) (p= 0.021). 

 

Discussion 
Previously we have identified G/A 
substitution (R263Q) mutations in SNP: 
rs121908623 of the GNE gene in the Pakistani 
Population5. As sialuria is a very rare 
disorder, up till now, only 10 ten patients 
have been reported worldwide. The first 
patient was identified in 1968 by (A), and the 
tenth patient was identified by Ishtiaq and 
colleagues (2020). In all of the patients, the 
symptoms were similar such as jaundice, 
low birth weight, coarse facies, 
hepatomegaly, seizures; however, they had 
normal birth and delivery5. Besides this, the 
neurological symptoms included speech and 
motor impairments. All these patients had 
mutations in the GNE gene at G→T: 849, 
G→A:848, G→T:839, G→A:839, G→C:250, 
T→C:51+34 positions6-15. Recent works on 
sialuria presented a link between intellectual 
disability with low household income, low 
maternal education, and consanguinity 
marriages16. Sialic acids are negatively 
charged amino sugars and are added to 
many glycoproteins during posttranslational 
modifications of proteins. Due to this, they 
actively participate in biological molecular 
interactions17. 
 
Structural data of GNE/MNK homolog have 
developed by Kurochkina, Yardeni, and 
Huizing (2010) that exposes critical substrate 
binding sites on the enzyme18. This model 
helps explain the effects of missense 
mutations associated with HIBM or sialuria 
on enzyme actions, helix arrangement, and 
substrate binding. They confirmed that all 
reported mutations so far are, in fact, due to 
the mutations in the active site or secondary 
interfaces of the GNE/MNK enzyme. It was 

reported that a Persian-Jewish HIBM has 
mutation p.M12T at the interface of alpha4 
alpha10 that affected GlcNAc, Mg+2, ATP 
binding. Structural data helps develop the 
therapeutic options that target the 
misfolding of GNE/MNK in HIBM or 
Sialuria18. In this study, a few experiments 
were carried out separately to determine the 
sialic acid levels in urine and GNE mRNA 
expression levels in the blood of different 
subtypes of I.D. subjects. The data show a 
significant increase in urinary sialic acid in 
mild I.D. subjects and reduced GNE gene 
expression in severe I.D. subjects. It has been 
reported previously that patients with 
Sialuria tend to excrete more S.A. in urine 
than controls. It has been shown that the 
levels range from 10 to 30 folds is associated 
with several inborn errors of metabolic 
diseases such as salla disease, sialidosis, 
ISSD, and neuraminidase deficiency5, 6, 19, 20. 
In sialuria, free sialic acid levels can be 
elevated up to 70 to 200 folds7, 8, 21, 22. An 
earlier study reported a sixth subject of 
sialuria with mild developmental 
impairment showing an increased level of 
sialic acid in his urine. This is consistent with 
the current study that showed an increased 
sialic acid level in the urine. Subjects with 
mild Intellectual Disability exhibiting a 2-
fold increase in free sialic acid levels than 
controls proved that mild phenotype of 
Intellectual Disability might be associated 
with sialuria. Moreover, data on the single-
family also showed about 10-fold increased 
sialic acid levels in urine; however, the 
reductions in free sialic acid levels in subjects 
with severe Intellectual Disability showed 
that severe I.D. might not be linked with 
sialuria disease in Pakistani children and 
adolescents.  
 
For confirmation, we analyzed and 
compared the expression pattern of the GNE 
gene in controls and severe ID children and 
adolescents of Pakistan. All subjects with 
severe ID showed down-regulation when 



 
 

92 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

compared to controls. In earlier studies, 
subjects with mild impairments showed 
high expression of the GNE gene in their 
different tissue organs10. In contrast, when 
we analyzed the expression levels of GNE in 
subjects with severe I.D. who were suffering 
from severe developmental delay, our 
results show significantly low expression 
levels in these subjects, suggesting no 
association of Sialuria with severe mental 
illnesses. 
 
Nevertheless, only GNE mRNA and urinary 
sialic acid levels from severe I.D. patients 
have shown a significant correlation. This 
means an increased GNE mRNA expression 
levels positively influence the low excretion 
of sialic acid levels in urine. As silauria is 
known to cause an accumulation and 
urinary excretion of Neu5Ac sialuria, it 
differs from sialdoses, characterized as a 
defect in the storage and excretion of bound 
Neu5Ac from the body. The same GNE gene 
is involved in causing Nonaka myopathy 
(NK; MIM:605820) as well, besides sialuria 
and sialdoses. In Nonaka myopathy, muscle 
wasting and weakness of the distal and 
anterior tibial muscles takes place23,24. 
Several mutations in the GNE gene in 
epimerase and kinases domains alter the 
enzymatic activity in a very minute and 
precise way. It is very difficult to describe 
and identify the actual effect. 
 
Consequently, sometimes, the activity of the 
enzyme did not correlate with the severity of 
the disease 25-29. The predominant function of 
GNE is to regulate the sialylation of cell 
surface glycoproteins and glycolipids12-15. 
However, the correlation between 
hyposialylation and the severity of the 
disease is inadequate because many human 
patients suffering from GNE myopathy have 
sialic acid levels not much different from the 
controls. This is the main reason why a poor 
correlation exists between sialic acid levels 
and symptom severity. These results were 

also seen in animal models with D176V 
mutation in GNE gene 30. The symptoms in 
patients and mutant mice show normal and 
early birth but develop muscle weakness as 
they age, which can be relieved by providing 
them sialic acid or ManNAc. 
 
Nevertheless, the sialic acid levels in animals 
remained low than in control animals31. They 
suggested a lack of correlation between the 
severity of the disease and the sialic acid 
levels, emphasizing that GNE gene mutation 
has effects beyond hyposialylation. The 
mutation can affect the N-glycan structure 
by changing the sialic acid biosynthesis and 
flux UDP-GlcNAc levels via hexosamine 
biosynthetic pathway32,33. Our results 
propose that early effective avoidance from 
severe cognitive disabilities will obtain 
better information and averting the risk 
factors such as low birth weight, hypoxia, 
poverty, and serious diseases.  
 

Conclusion 
The urine analysis of sialic acid showed a 

significant reduction in severe mental 

retarded samples. There was an ave rage 

two-fold increase in the urinary sialic acid 

levels in mild I.D. subjects compared to 

controls. Results from RT-qPCR showed a 

significant reduction in the I.D. mRNA 

expression of the GNE gene in mild, 

moderate, and severe I.D. subjects. There 

was a fivefold up-regulation of GNE gene 

expression in mild I.D. subjects compared to 

severe I.D. subjects. Only GNE mRNA and 

urinary sialic acid levels from severe I.D. 

patients showed a significant correlation. 

Thus data suggest that mild I.D. might be 

associated with sialuria in Pakistani children 

and adolescents. Therefore, Intellectually 

Disabled subjects and their immediate 

family members must be monitored for the 

polymorphisms in codons 263 to 266 of the 

GNE gene. 



 
 

93 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

Acknowledgment  
The authors would like to thank Dr. Deepak 
Kumar for helping in getting the ethics 
approval, Dr. Atif Anjum from National 
Institute of Child Health, Jinnah 
Postgraduate Medical Center, Karachi, 
Nasreen Jumani, Principal, Govt. Girls 
Higher Secondary School and Mr. Tariq 
Samuel and Mr. Yasir Khursheed from Dar-
ul-Sukoon, Karachi, for providing the 
samples. 
 

References  
1. Kreuzmann D, Horstkorte R, Kohla G, 

Kannicht C, Bennmann D, Thate A, Bork 
K. Increased polysialylation of the neural 
cell adhesion molecule in a transgenic 
mouse model of sialuria. ChemBioChem. 
2017;18(13):1188-1193.  

2. Wen XY, Tarailo-Graovac M, Brand-
Arzamendi K, Willems A, Rakic B, 
Huijben K, Da Silva A, Pan X, El-Rass S, 
Ng R, Selby K. Sialic acid catabolism by 
N-acetylneuraminate pyruvate lyase is 
essential for muscle function. JCI insight. 
2018;3(24). 

3. Bonfanti L. PSA-NCAM in mammalian 
structural plasticity and neurogenesis. 
Progress in neurobiology. 2006;80(3):129-
164. 

4. Rutishauser U. Polysialic acid in the 
plasticity of the developing and adult 
vertebrate nervous system. Nat Rev 
Neurosci. 2008;9(1):26-35. 

5. Ishtiaq H, Siddiqui S, Nawaz R, Jamali 
KS, Khan AG. Sialuria-Related 
Intellectual Disability in Children and 
Adolescent of Pakistan: Tenth Patient 
Described has a Novel Mutation in the 
GNE Gene. CNS Neurolog Dis Drug 
Targets. 2020;19(2):127-41. 

6. Fontaine G, Biserte G, Montreuil J, 
Dupont A, Farriaux JP. La sialurie: Un 
trouble métabolique original? Helv 
Paediatr Acta Suppl. 1968;17:1-32. 

7. Wilcken B, Don N, Greenaway R, 
Hammond J, Sosula L. Sialuria: a second 
case. J Inherit Metab Dis. 1987;10(2):97-
102.  

8. Seppala R, Lehto VP, Gahl WA. 
Mutations in the human UDP-N-
acetylglucosamine 2-epimerase gene 
define the disease sialuria and the 
allosteric site of the enzyme. Am J Hum 
Genet. 1999;64(6):1563-1569.  

9. Krasnewich DM, Tietze FR, Krause WI, 
Pretzlaff R, Wenger DA, Diwadkar V, 
Gahl WA. Clinical and biochemical 
studies in an American child with 
sialuria. J Biochem Med Metab Biol. 
1993;49(1):90-96.  

10. Ferreira H, Seppala R, Pinto R, Huizing 
M, Martins E, Braga AC, Gomes L, 
Krasnewich DM, Miranda MC, Gahl 
WA. Sialuria in a Portuguese girl: 
clinical, biochemical, and molecular 
characteristics. Mol Genet Metab. 
1999;67(2):131-137.  

11. Leroy JG, Dacremont G, Desimpel H, 
Van Coster R. Sialuria (French type): new 
observation of this rare disorder. Am J 
Hum Genet. 1998;63:A269. 

12. Penner J, Mantey LR, Elgavish S, Ghaderi 
D, Cirak S, Berger M, Krause S, Lucka L, 
Voit T, Mitrani-Rosenbaum S, 
Hinderlich S. Influence of UDP-GlcNAc 
2-epimerase/ManNAc kinase mutant 
proteins on hereditary inclusion body 
myopathy. Biochem. 2006;45(9):2968-
2977. 

13. Huizing M, Rakocevic G, Sparks SE, 
Mamali I, Shatunov A, Goldfarb L, 
Krasnewich D, Gahl WA, Dalakas MC. 
Hypoglycosylation of α-dystroglycan in 
patients with hereditary IBM due to 
GNE mutations. Mol Genet Metab. 
2004;81(3):196-202. 

14. Ricci E, Broccolini A, Gidaro T, Morosetti 
R, Gliubizzi C, Frusciante R, Di Lella 
GM, Tonali PA, Mirabella M. NCAM is 
hyposialylated in hereditary inclusion 



 
 

94 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

body myopathy due to GNE mutations. 
Neurology. 2006;66(5):755-758. 

15. Noguchi S, Keira Y, Murayama K, 
Ogawa M, Fujita M, Kawahara G, Oya Y, 
Imazawa M, Goto YI, Hayashi YK, 
Nonaka I. Reduction of UDP-N-
acetylglucosamine 2-epimerase/N-
acetylmannosamine kinase activity and 
sialylation in distal myopathy with 
rimmed vacuoles. JBC. 
2004;279(12):11402-11407. 

16. Bhatti A, Ashfaq G. Frequency of 
chromosomal anomalies in mentally 
handicapped children. Pak J Med Res. 
2008;47(1):47-59. 

17. Weidemann W, Hering J, Bennmann D, 
Thate A, Horstkorte R. The key enzyme 
of the sialic acid metabolism is involved 
in embryoid body formation and 
expression of marker genes of germ layer 
formation. Int J Mol Sci. 
2013;14(10):20555-20563. 

18. Weidemann W, Hering J, Bennmann D, 
Thate A, Horstkorte R. The key enzyme 
of the sialic acid metabolism is involved 
in embryoid body formation and 
expression of marker genes of germ layer 
formation. Int J Mol Sci. 
2013;14(10):20555-20563. 

19. Sewell AC, Poets CF, Degen I, Stöß H, 
Pontz BF. The spectrum of free 
neuraminic acid storage disease in 
childhood: Clinical, morphological and 
biochemical observations in three non‐
Finnish patients. Am J Med Genet. 
1996;63(1):203-208. 

20. Mancini GM, Verheijen FW, Beerens CE, 
Renlund M, Aula P. Sialic acid storage 
disorders: observations on clinical and 
biochemical variation. Dev Neurosci. 
1991;13(4-5):327-330. 

21. Seppala R, Tietze F, Krasnewich D, Weiss 
P, Ashwell G, Barsh G, Thomas GH, 
Packman S, Gahl WA. Sialic acid 
metabolism in sialuria fibroblasts. J Biol 
Chem. 1991;266(12):7456-7461. 

22. Krasnewich DM, Tietze FR, Krause WI, 
Pretzlaff R, Wenger DA, Diwadkar V, 
Gahl WA. Clinical and biochemical 
studies in an American child with 
sialuria. J Biochem Med Metab Biol. 
1993;49(1):90-96. 

23. Leroy JG, Seppala R, Huizing M, 
Dacremont G, De Simpel H, Van Coster 
RN, Orvisky E, Krasnewich DM, Gahl 
WA . Dominant inheritance of sialuria, 
an inborn error of feedback inhibition. 
Am J Hum Genet. 2001;68(6):1419-1427. 

24. Nonaka I, Sunohara N, Ishiura S, 
Satoyoshi E. Familial distal myopathy 
with rimmed vacuole and lamellar 
(myeloid) body formation. J Neurol Sci. 
1981;51(1):141-155. 

25. Asaka T, Ikeuchi K, Okino S, Takizawa Y, 
Satake R, Nitta E, Komai K, Endo K, 
Higuchi S, Oyake T, Yoshimura T. 
Homozygosity and linkage 
disequilibrium mapping of autosomal 
recessive distal myopathy (Nonaka 
distal myopathy). J Human Genetics. 
2001;46(11):649-655. 

26. Celeste FV, Vilboux T, Ciccone C, de 
Dios JK, Malicdan MC, Leoyklang P, 
McKew JC, Gahl WA, Carrillo‐Carrasco 
N, Huizing M. Mutation update for GNE 
gene variants associated with GNE 
myopathy. Human Mutation. 
2014;35(8):915-26. 

27. Nishino I, Carrillo-Carrasco N, Argov Z. 
GNE myopathy: current update and 
future therapy. J Neurol Neurosurg 
Psychiatry. 2015;86(4):385-392. 

28. Hinderlich S, Salama I, Eisenberg I, 
Potikha T, Mantey LR, Yarema KJ, 
Horstkorte R, Argov Z, Sadeh M, Reutter 
W, Mitrani-Rosenbaum S. The 
homozygous M712T mutation of UDP-
N-acetylglucosamine 2-epimerase/N-
acetylmannosamine kinase results in 
reduced enzyme activities but not in 
altered overall cellular sialylation in 
hereditary inclusion body myopathy. 
FEBS letters. 2004;566(1-3):105-109. 



 
 

95 

ISSN 2412-3188 (Online) | 2410-1354 (Print) 

 

 

APP| Published By AEIRC| Volume 8 Issue 2  

 

 

29. Salama I, Hinderlich S, Shlomai Z, 
Eisenberg I, Krause S, Yarema K, Argov 
Z, Lochmuller H, Reutter W, Dabby R, 
Sadeh M. No overall hyposialylation in 
hereditary inclusion body myopathy 
myoblasts carrying the homozygous 
M712T GNE mutation. Biochem Biophys 
Res Commun. 2005;328(1):221-226. 

30. Saito F, Tomimitsu H, Arai K, Nakai S, 
Kanda T, Shimizu T, Mizusawa H, 
Matsumura K. A Japanese patient with 
distal myopathy with rimmed vacuoles: 
missense mutations in the epimerase 
domain of the UDP-N-
acetylglucosamine 2-epimerase/N-
acetylmannosamine kinase (GNE) gene 
accompanied by hyposialylation of 
skeletal muscle glycoproteins. 
Neuromuscul Disord. 2004;14(2):158-
161. 

31. Malicdan MC, Noguchi S, Nonaka I, 
Hayashi YK, Nishino I. A Gne knockout 
mouse expressing human GNE D176V 
mutation develops features similar to 
distal myopathy with rimmed vacuoles 
or hereditary inclusion body myopathy. 
Hum Mol Genet. 2007;16(22):2669-2682. 

32. Malicdan MC, Noguchi S, Hayashi YK, 
Nonaka I, Nishino I. Prophylactic 
treatment with sialic acid metabolites 
precludes the development of the 
myopathic phenotype in the DMRV-
hIBM mouse model. Nature Med. 
2009;15(6):690-695. 

33. Lau KS, Partridge EA, Grigorian A, 
Silvescu CI, Reinhold VN, Demetriou M, 
Dennis JW. Complex N-glycan number 
and degree of branching cooperate to 
regulate cell proliferation and 
differentiation. Cell. 2007;129(1):123-34. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

https://crossmark.crossref.org/dialog/?doi=10.29052/2412-3188.v8.i2.2022.86-95

