Atlas Journal of Biology 2017, pp. 392–401 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Characterization of Diversity of Bradyrhizobia on Cowpea in Iraq Reveals Unusual Strain Characteristics Suad A. Al-Saedi1†, Naoufal Lakhssassi2†, My Abdelmajid Kassem3, Ibrahim B. Razaq1†, and Khalid Meksem2* 1 Agricultural Researcher Directorate, Ministry of Science and Technology, Baghdad, Iraq; 2 Department of Plant, Soil, and Agricultural Systems, Southern Illinois University, Carbondale, IL 62901, USA; 3 Plant Genomics and Biotechnology Laboratory, Department of Biological Sciences, Fayetteville State University, Fayetteville, NC 28301-4298, USA. Received: April 23, 2017 / Accepted: May 7, 2017 __________________________________________________ * Corresponding author: meksem@siu.edu. † These authors contributed equally to this work. 392 Abstract Rhizobium-legume symbiosis is considered as one of the most well established symbiotic nitrogen fixing system for agro- nomic studies. Association between legumes and rhizobia results in the formation of root nodules where symbiotic ni- trogen fixation occurs. The current study aimed to authenti- cate 110 isolates from 20 sites belonging to 10 governorates in Iraq, tested their capacity of nodulation with cowpea and classified them depending on the phenotype and genotype presented by sequence analysis of 16S rRNA. To fulfill these goals, many approaches have been implemented such as Au- thentication Tests, Bromothymol Blue Reaction, Colony Size and Morphology, Antibiotic Test, Sequencing of 16S rRNA and Phylogenetic analysis. This study provides an easy way to classify the Bradyrhizobia sp. strains by genotype analysis depending on the phenotypes (i.e. motility and colony size) by sample preservation and high quality DNA isolation from environmental soil samples followed by 16S rRNA sequenc- ing. This molecular technique has demonstrated the useful- ness of these methods, easy technologies, and their appli- cations to microbiome analysis and environmental science. Interestingly, a group of Bradyrhizobia identified in the cur- rent study was able to secrete acidic products before switch- ing and starting to secrete alkali products after 1, 2 and 3 days. This is an unusual phenotype observed within rhizobia strains. Keywords: 16S rRNA, Nitrogen, Symbiosis, Locations, Strains. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecom- mons.org/licenses/by/3.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the origi- nal work is properly cited. Introduction Crop yields are linked to the use of soil or foliar fertiliz- ers that are applied to supply one or more essential nutrients that support plant growth and production (Stewart et al., 2005). Many reports estimate that 30 to 50% of crop yields are attrib- uted to natural or synthetic commercial fertilizers (Gowariker et al., 2009; Stewart et al., 2005). There are 14 essential elements for plant growth and development. Nitrogen (N), Phosphorus (P) and Potassium (K) are the three essential elements needed in large quantity by plants, which are usually known as Macro- elements (Salisbury and Ross, 1985). Not all soils are rich in NPK and thus nutrients must be supplied through fertilizers (Dittmar et al., 2009). In fact, these three elements must be added to arable soils to secure the sufficiency level of each for optimum crop yield. However, most farmers worldwide, due to high costs and environmental concerns, limit the use of synthetic fertiliz- ers. Although much of the nitrogen is removed when protein-rich grains or hay are harvested, significant amounts can remain in the soil for future crops (Bisen et al., 2012). This is especially important when nitrogen fertilizer is not used, such as in crop rotation schemes used in less industrialized countries. Nitrogen is the most commonly deficient nutrient in many soils around the world; therefore, it is the most commonly supplied plant nutri- ent. During the last two decades, many studies focused on the widespread applications of natural nitrogen suppliers such as nitrogen-fixing Rhizobia sp. (Abaidoo et al., 2000; Shahzad et al., 2012; Steenkamp et al., 2008; Abdulameer, 2010; Mar- tyniuk et al., 2013). A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Rhizobia sp. is soil bacteria that fix nitrogen (diazotrophs) after establishing inside root nodules of legumes (Fabaceae) in a very well-known process called biological nitrogen fixation (BNF). Rhizobia require a plant host and cannot independent- ly fix nitrogen. The Rhizobium-legume symbiosis is one of the most prominent beneficial plant-microbe interactions (González and Gonzalez-López, 2013). BNF has received high attention because of the central role it plays in the maintenance of soil fertility (Sprent and Sprent, 1990; Chemining’wa et al., 2011). Legumes have the potential to contribute to soil nitrogen and increase yields of subsequent or associated non-legume crops through symbiotic nitrogen fixation (Brockwell et al., 1995). Cowpea (Vigna unguiculata L. Walp.) is one of the main prod- ucts of family farming in semi-arid regions such as Iraq and is of considerable importance as a protein source for low-income populations of rural areas. It is well known that cowpea is rela- tively resistant to salinity and drought stress (Eaglesham et al., 1992). Cowpea Rhizobia were first classified as a heteroge- neous group of slow-growing rhizobia that nodulates promiscu- ous tropical and subtropical legume species known as ‘cowpea cross-inoculation group’ (Allen and Allen, 1981). Furthermore, Rhizobia, representing the ‘cowpea group’ Cowpea Rhizobia (Bradyrhizobium spp.), are usually slow-growing bacteria of the genus Bradyrhizobium belonging to the order Rhizobiales of the Alphaproteobacteria class (Garrity et al., 2005; Jordan, 1982; Kuykendall, 2005a,b). Bradyrhizobium species are Gram-nega- tive bacilli (rod shaped) with a single subpolar or polar flagel- lum. Many changes in rhizobia taxonomy have occurred during the last decade due to an increase of available phenetic and genetic information about this group of bacteria (Silva et al., 2012). Knowledge of the diversity of rhizobia is of paramount importance as it is a source of genetic resources for selection of strains adapted to different conditions. Currently, the system of microbial taxonomy addresses a joint analysis of morphologi- cal, physiological and different molecular tools. Statistical meth- ods are used to evaluate the differences and similarities among microorganisms, providing quantitative measures of similarities among microorganisms. However, rhizobia taxonomy has been changed in recent years due to the use of molecular tools allow- ing for the identification of new groups of bacteria capable of nodulation and nitrogen fixation in legumes (Chen et al., 2005). In this study, a total of 110 strains isolated from 20 sites belong- ing to 10 governorates in Iraq were tested for their ability to fix nitrogen and to symbiotically interact with the cowpea as a plant host. Next, we focused on bacterial nodulation by testing new rhizobia isolates from the 20 sites belonging to the most important cowpea production area in Iraq. Interestingly, the 60 rhizobia strains were genetically identified and classified by se- quencing the 16S rRNA gene. The 16S rRNA gene is a highly conserved component of the transcriptional machinery of all DNA-based life forms and thus is highly suited as a target gene for sequencing DNA in samples containing up to thousands of different species. Material and Methods Bacterial Isolate One hundred and ten bacteria isolates were obtained from cowpea root nodules in 20 different field sites in 10 governor- ates of Iraq, belonging to the most important cowpea produc- tion areas in the country. These are namely: Al Basrah, Dhi-Qar, Misan, Wasit, Babil, Al Anbar, Baghdad, Salahudein, Suleiman- yah, and Ninevah. Nodules were surface sterilized by immersing in 95% v/v ethanol for 10 sec. followed by 30% v/v solution of sodium hypochlorite for 4 min and then rinsed with sterile dis- tilled water. They were then placed in 3% v/v hydrogen perox- ide for 1 min, followed by rinsing five times in sterile water. The sterilized nodules were crushed in a large drop of sterile water in a petri dish. The nodule suspension was next streak inoculated on yeast mannitol agar (YMA) (Somasegran and Hoben, 1994) and incubated at 28ºC for 5 days. Single colonies were selected and streaked onto YMA slant and kept at 4ºC for short-term storage with sub culturing every 4 months. Long-term storage was carried out by storing the culture broth in 10% glycerol at –80ºC. Authentication Tests All 110 bacterial strains were authenticated in order to deter- mine if they were cowpea rhizobia by observing nodule for- mation on cowpea roots grown in autoclaved sandy soil. Steril- ized seeds of cowpea cultivars were inoculated with different bacteria strains. Non-inoculated controls were used to check for cross-contamination. Nodulation Assay of the Cowpea Plants Cowpea plants were grown on autoclaved sandy and organ- ic soil (50:50) and watered as needed. Sixty rhizobium strains were grown in YMA medium for 5 days at 28ºC until reaching the exponential growth phase. Bacterial inoculation was done at the time of sowing (10% volume by seed weight). Inoculated plants were grown in the greenhouse under 27°C, 70% humidity, and 16-hour artificially supplemented light conditions. Bromothymol Blue Reaction All authenticated cowpea rhizobia cells were streaked onto agar plates containing YM medium with Bromothymol blue at 25 µl/ml final concentration. Then, the plates were incubated at 28ºC. The authenticity of each strain was detected during the 10 day incubation period with observation for color of the indicator dye on the plates (Somasegaran and Hoben, 1994). Fast grow- ing rhizobia changed color of the indicator dye to yellow while slow growing rhizobia turned the indicator dye to blue. Colony Size and Morphology Colony size and morphology were measured by incubating single cells onto the center of agar plates containing YM me- 393 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 394 dium. The plates were incubated at 28ºC for 10 days with mor- phology observations of movement, convex, flat, etc. The size of the colonies was also measured at the end of the 10-day incubation period. Antibiotic Test Antibiotic tests were conducted by spreading bacteria on pe- tri dishes containing Mueller-Hinton agar and testing two differ- ent antibiotic discs. The discs were equidistant from the others to avoid overlapping zones of inhibition. The antibiotics discs test- ed were Spectinomycin and Streptomycin at 100 µg and 300 µg concentrations, respectively. The plates were incubated at 28ºC. The presence or absence of an inhibition zone was noted, indicating susceptibility, resistance, or intermediate resistance. DNA Isolation In order to extract bacterial DNA, the bacteria isolates were incubated into YM broth in a 15 ml sterile tube and incubated under shaking conditions at 200 rpm, 28ºC for 5 days. Cells were harvested by centrifugation at 13.2 x 1000 rpm for 10 min then washed once with 0.85% NaCl solution to eliminate extracellular polysaccharides before chromosomal DNA isola- tion. Bacterial DNA was obtained using Wizard Genomic DNA purification kit from Promega. Polymerase Chain Reaction (PCR) Amplification of the 16S rRNA Gene Genomic DNA from each isolate was amplified using the primer fD1 (5`- AGAGTTTGATCCTGGCTCAG – 3`) and rD1 (5`- AAGGAGGTGATCCAGCC – 3`) in order to amplify the 16S rRNA as described by Weisburg et al. (1991). The selected primers were derived from conserved regions of the 16S rRNA gene and amplified nearly 1500 bp of full-length 16S rRNA gene (Weisburg et al. 1991). PCR amplifications were carried out in total reaction volumes of 25 µl containing 2.0 mmol/L MgCl2, 200 µmol/L of dNTPs, 1 µmol/L of each primer, 30 ng of genomic DNA and 1.5 U OF Pfu DNA polymerase (Agilent Technologies). The temperature profile was as follows: an initial denaturation step at 95ºC for 3 min, 35 cycles of denaturation at 94ºC for 30 sec; then annealing at 51ºC for 1 min and extension at 72ºC for 2 min with a final extension at 72ºC for 7 min. Sequencing of 16S rRNA Products of amplification belonging to approximately 60 strains were purified with QlA quick PCR purification kit (from QIAGEN) prior sequencing and then sequenced at GeneWiz Fig. 1. Geographic distribution of the rhizobia bacterial collection sites in Iraq. Sixty bacteria isolates were obtained from cowpea root nodules of 20 locations from different field sites in 10 governorates in Iraq, belonging to the most important cowpea production area in Iraq (Basrah, Dhi-Qar, Misan, Wasit, Babil, Al Anbar, Baghdad, Salahudein, Suleimanyah, and Ninevah). A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 395 Company, USA, using the primers fD1 and rD1. The 16S rRNA sequences were first analyzed with Seqman-DNA star Laser- gene software; then, the closely related sequences found were analyzed by Culstal W program. Phylogenetic Analysis and Genomic Structure Multiple sequence alignments were performed using the MEGA4 software package and the Clustal-W algorithm. An unrooted phylogenetic tree was calculated with the neighbour- joining method (Saitou and Nei, 1987), and tree topology ro- bustness was tested by bootstrap analysis of 5,000 replicates. Alignment analysis of the 16S rRNA sequenced genes from the different rhizobia strains, in addition to the reference 16S rRNA sequences were obtained using MegAlign 4 software. All pa- rameter values corresponded to default definitions. Results Authentication Test In this study, a total of 110 strains isolated from 20 sites be- longing to 10 governorates in Iraq (Fig. 1) were tested to their ability to form nodules. From the 110 bacteria isolated, we au- thenticated a total number of 60 isolates that re-nodulated their original host cowpea confirming their symbiotic status (Table 1). Strain ID Nodule number with Cowpea Colony size (mm) Antibiotic Test Spectinomycin Streptomycin After 5 days After 10 days S I R S I R S1 50 35 85 + + S2 20 85 85 + + S3 55 85 85 + + S4 12 12 20 + + S5 5 85 85 + + S6 25 85 85 + + S7 4 12 20 + + S8 30 10 15 + + S9 35 25 85 + + S10 7 12 20 + + S11 10 8 15 + + S12 25 20 55 + + S13 2 10 15 + + S14 17 10 20 + + S15 29 9 15 + + S16 7 19 85 + + S17 29 10 22 + + S18 7 10 20 + + S19 2 12 23 + + S20 3 12 24 + + S21 18 9 15 + + S22 6 10 15 + + S23 6 19 24 + + S24 7 18 25 + + S25 5 16 25 + + S26 25 10 20 + + S27 15 75 85 + + S28 10 75 85 + + S29 3 70 85 + + S31 10 12 24 + + S32 6 50 85 + + S33 7 50 85 + + S34 4 5 10 + + S35 6 9 16 + + S36 4 8 10 + + S37 2 10 20 + + S38 13 25 85 + + S39 10 85 85 + + S40 2 10 17 + + S41 2 7 10 + + S43 7 13 20 + + S44 3 8 12 + + S45 3 19 26 + + S46 2 20 27 + + S47 89 85 85 + + S48 21 5 10 + + S49 89 12 20 + + S50 89 10 20 + + S51 78 85 85 + + S52 3 20 39 + + S54 16 85 85 + + S55 3 9 20 + + S56 2 9 15 + + S57 7 10 15 + + S58 4 17 85 + + S59 19 12 20 + + S60 1 55 85 + + S61 5 85 85 + + S62 2 12 20 + + S63 10 18 28 + + Table 1. Phenotypic data of the Sixty cowpea rhizobia. Second column present the nodule number, third and fourth column show the colony size after 5 and 10 day of growth, last columns present antibiotic discs tested; Spectinomycin and Streptomycin at 100 mg and 300 mg con- centrations, respectively. S= susceptibility, R= resistance or I= Intermediate resistance. Red signs present the five cowpea rhizobia found to resist to both antibiotics. A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 396 Fig. 2. Reaction type of the sixty cowpea rhizobia with Bromothymol blue. The authenticity of each strain was detected during 10 days incubation period, with observation for color of the indicator dye on the plates. Fast growing rhizobia changed color of indicator dye to yellow while slow growing rhizobia turned the indicator dye to blue. Fig. 3. Colony size of the sixty cowpea rhizobia strains after 5 days (A) and 10 days (B) growth. A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 397 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Fig. 4. Neighbour Joining (NJ) tree showing the phylogenetic relatedness of 16RNA sequences for 43 cowpea rhizobia associated with the colony size (C.S) and cell movement. The phylogenetic tree was generated using ClustalW and Mega4 softwares, and boost- rap values are shown using 5,000 replicates. 398 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) The authentication test showed that 38 (63.3%) cowpea rhizo- bia presented a nodule number less than 10, 8 (13.3%) strains presented between 10 and 20 nodules, 6 (10%) strains pre- sented between 20 and 30 nodules, 3 (5%) strains presented between 30 and 70 nodules, and 4 super-nodulating (6.66%) strains (S47, S49, S50 and S51) presented between 70 and 90 nodules per plant. Surprisingly, the four strains from the last super-nodulating group belong to Al-Basrah governorate. This result may be related to the physical composition of the soil in this area, which differs from the rest of the 10 governorates in Iraq. Furthermore, all 60 strains were chosen for genotypic characterization (16S rRNA target sequencing) and phenotypic analysis including colony size, morphology, bromothymol blue reaction, and antibiotic resistance test. Phenomic Analysis of the Rhizobia Strains The bromothymol blue technique is used in bacteriology as a pH indicator in the agar. It changes to yellow in case of acid pro- duction during fermentation of lactose or changes to deep blue in case of alkalinization. Lactose-positive bacteria build yellow media. However, bacteria that decarboxylate L-Cystine cause an alkaline reaction and build deep blue media. This colorant is used essentially in order to classify rhizobia, especially Brady- rhizobium (Alkaline reaction) from rhizobium (Acidic reaction) strains. The reaction of the 60 cowpea rhizobia colonies on bro- mothymol blue (BTB) agar plates revealed two major types of reactions. In the first type of reaction, cells of 6 cowpea rhizobia were found to secrete acidic product during 10 days incubation. Surprisingly, 3 strains were able to secrete alkali product during the first 5 days before switching and starting the secretion of acidic product in the last 5 days during the 10 days incubation (Fig. 2). Furthermore, most cells were in the second type of BTB reaction and were found to secrete alkali product. This second type was divided into 4 types of reactions. Seven cowpea rhi- zobia belong to a group that secreted alkali product during the 10 days incubation. Surprisingly, the second, third and fourth groups were able to secrete acidic products during the first days before starting to secrete alkali products after 1 (16 strains), 2 (24 strains) and 3 (4 strains) days. This is an unusual phenotype observed within rhizobia strains (Fig. 2). Furthermore, the 60-cowpea rhizobia colonies were re- grouped in 4 groups depending on their capability to grow (col- ony size) and capacity to invade the whole petri dish (motility). The first group of the four-regrouped colony contained 13 cow- pea rhizobia presenting size of colonies between (10–15) mm, of which 8 bacteria were flat in shape and 5 were convex. The second group containing 15 bacteria showed sizes between 15 and 20 mm, of which 6 were flat in shape and 9 were convex. The third group with 7 bacteria had sizes between 20 and 25 mm, 6 of which were flat in shape and one was convex. Finally, the fourth group with 25 bacteria were able to grow more than 25 mm until they filled the whole plate during the 10 days of incubation; 20 of them were flat in shape and 5 were convex. In- terestingly, all bacteria belonging to groups one, two and three were not motile while all bacteria from group four were motile on agar medium (Fig. 3). Moreover, all 60 strains were tested in the presence of two kinds of antibiotics: Spectinomycin and Streptomycin. It has been shown that Rhizobia strains can be resistant to Spectinomycin or Streptomycin (Ramírez et al., 1998). However, resistance to both antibiotics can be possible if the strain carries a mutation in its genome (Zelazna-Kowalaska, 1971). The result given in Table 1 showed that 15 cowpea rhizobia were sensitive to spectinomy- cin and 55 sensitive to streptomycin. However, 25 cowpea rhi- zobia were resistant only to spectinomycin and 5 resistant only to streptomycin, while 20 cowpea rhizobia had an intermediate resistance to spectinomycin. Interestingly, five cowpea rhizobia (S31, S35, S51, S61 and S63) were found to resist both an- tibiotics (Table 1) (National Committee for Clinical Laboratory Standards–NCCLS). Sequencing the 16S rRNA The 16S rRNA gene sequencing is commonly used for identi- fication, classification, and quantification of microbes within com- plex biological mixtures such as environmental and gut samples (Schmidt et al., 1991; Ley et al., 2005). The 16S rRNA gene is a highly conserved component of the transcriptional machinery of all DNA-based life forms and thus is highly suited as a target gene for sequencing DNA in samples containing up to thousands of different species (Cox et al., 2013). Conveniently, the 16S rRNA gene consists of a conserved and a variable region. While the conserved region makes universal amplification possible, the variable regions allows discrimination between specific different microorganisms (Kolbert and Persing, 1999). Specific primers have been used in this study to target the conserved regions of 16S in order to target conserve and vari- able regions within the characterized cowpea rhizobia. Phylo- genetic analysis of the sequenced 16S rRNA from the 60 rhizo- bia separated the strains into four clades (Fig. 4). Surprisingly, the phylogenetic tree grouped all the strains based on their abil- ity to grow (colony size) and motility. Thus, Group I contained strains with lower colony size presenting between 10 and 15 mm, Group II strains’ size was between 15 and 20 mm, and Group III contained strains able to grow more than 25 mm until they invade the entire petri dish. Finally the last group IV con- tained strains with colony sizes varying between 20 and 25 mm. Discussion In this study we characterized a population of 60 Bradyrhizo- bium found in cowpea nodules, isolated from 20 sites belonging to the most important cowpea production area in Iraq for their ability to form nodules, resist to antibiotics, motility, and study their evolutionary relationships among other Bradyrhizobium species. In order to fulfill these goals, several techniques were employed such as Authentication Test, Bromothymol Blue Reac- tion, Resistance to antibiotics (Spectinomycin and Streptomycin), phenotypic analysis including colonies size and morphology, and phylogenetic analysis of the sequenced 16S rRNA. When high density inoculum of a rhizobial strain are inocu- lated into media containing an antibiotic, a few cells may ex- hibit resistance as a result of spontaneous genetic changes or A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 399 mutations (Josey et al., 1979; Beynon and Josey, 1980; Turco et al., 1986; Kuykendall et al., 1988). Resistance of a rhizobial strain to a particular antibiotic is a useful marker (Schwinghamer and Dudman, 1973; Pankhurst, 1977; Beynon and Josey, 1980; Turco et al., 1986). It is important that antibiotic-resistant strains that are selected for inoculation experiments have not lost their infectiveness (i.e. ability to form nodules) or their effectiveness (i.e. ability to fix nitrogen) in the symbiosis with the host plant (Beynon and Josey, 1980; Kremer and Peterson, 1982; Turco et al., 1986). Interestingly, from the 60 strains only five cowpea rhizobia (S31, S35, S51, S61 and S63) were found to resist to both an- tibiotics. It has been shown that rhizobia strains can be resistant to Spectinomycin or Streptomycin (Karanja and Wood, 1988; Ramírez et al., 1998). However, resistance to both of them can be possible only if the strain carries a mutation in its genome (Schwinghamer, 1964; Zelazna-Kowalaska, 1971; Turco et al., 1986). Several studies showed that mutants treated with gamma radiation were able to grow at 50°C (Chitchanok et al., 2011) or at temperatures higher than 40ºC (Hungria et al., 1993), and four of our strains were able to grow at 37°C and 50°C. These strains were probably mutated by the presence of high radia- tion level in the soil, since several studies showed that certain bacterial strains are sensitive to nuclear radiation (Makarova et al., 2001). Four strains, (S47, S49, S50, and S51) presenting 6.66% of the authenticated rhizobium were super-nodulated, presenting between 70 and 90 nodules per plant, and belong to Al-Basrah governorate. This result may be related to the physical composi- tion of the soil in this area, which differs from the rest of the 10 governorates in Iraq. Al-Basrah is located on the Shatt-Al-Arab waterway, downstream of which is the Arabian Gulf. The city is penetrated by a complex network of canals and streams vi- tal for irrigation and other agricultural use, which makes it one of the most fertile regions for agriculture, located at the junc- ture of two famous rivers in Iraq, Al forat and Dijlah. The sedi- ments of Al-Basrah soils are mainly silt clay in texture and silt clay loam with subordinate amount of sand. Al-Basrah soils are characterized by their wide spectrum of mineralogical composi- tion, non-clay minerals (calcite, dolomite, quartz, halite, gypsum, and feldspar), clay minerals (kaolinite, Illite, montmorillonite, palygorskite, chlorite, and mixed-layred clay minerals), and heavy mineral (opaque, pyroxene, hornblende, chlorite, biotite, epidote, garnet, kyanite, staurolite, celestite, zircon, and tourma- line). The organic matter content has widely ranged in present soils; its amount depends upon the intensity of vegetation cover. The detrital supply of clastic materials controls the concentration of silica and aluminum. Plant nutrition controls the concentration of Fe and K. Climatic conditions and hydrogeological setting controls the accumulation of Na, Ca and Mg in Basrah soils. The values of major elements in Al-Basrah saline soils survive sea- sonal fluctuations because of precipitation and dissolution alter- native processes (Al-Marsoumi and Al-Jabbri, 2007). Moreover, sequence analysis of 16S rRNA has also been used frequently for microbial taxonomy, and it is a powerful and accurate method for determining inter- and intra-specific relationships (Stackebrandt and Goebel, 1994; Janda and Ab- bott, 2007; Wang et al., 2007; Kim et al., 2012). On the ba- sis of 16S rRNA sequences, six of the strains we isolated from cowpea are closely related to both B. japonicum and Rhizobium species (representatives to group IV), which regrouped strains presenting colony sizes between 20 and 25 mm without motility. Phylogenetic analysis showed that all the rest of the 54 strains descended from the common ancestral copy in the group IV. Those 54 descendants evolved into different strains regrouped in 4 different sub-clades or branches. Group I contained strains with lower colony size between 10 and 15 mm, and Group II between 15 and 20 mm without motility, and Group III contained strains able to grow more than 25 mm until they invaded the entire petri dish showing a clear motility in the agar. As shown in different studies, phylogenetic analysis supported their descent from a common ancestral copy (Gherbi et al., 2008) and gener- ated a topology consistent with previous legume phylogenies (Wojciechowski et al., 2004). This gave rise to the hypothesis that the evolutionarily recent legume–rhizobia symbiosis reuses some of the molecular mechanisms of the more ancient arbuscu- lar mycorrhiza (AM) symbiosis (Hirsh, 2004). Using this molecular technique, we resolved the cowpea bradyrhizobial diversity of 60 nodulating strains regrouping them into four different geno- types (Fig. 4). This study provides an easy way to classify the rhizobia strains by genotype analysis depending on the phenotypes ob- served (i.e. motility and colony size) by sample preservation and high quality DNA isolation from environmental samples such as soil samples and 16S rRNA target sequencing. This demon- strated the usefulness of these methods, using easy technologies, and their applications to microbiome analysis and environmental science. Conflict of Interest The authors declare that they have no conflict of interest. References Allen ON and EK Allen (1981) The leguminosae. A source book of char- acteristics, uses and nodulation. London, UK: Mocmillan. Al-Marsoumi AMH and MHA Al-Jabbri (2007) Basrah Soils; Geochemi- cal Aspects and Physical Properties–A Review of Basrah Journal of Science(C) 25 (1): 89-103. Beynon JL and DP Josey (1980) Demonstration of Heterogeneity in a Natural Population of Rhizobium phaseoli using Variation in Intrinsic Antibiotic Resistance. Microbiology 118 (2): 437–442. Bisen PS, D Mousumi, and GB Prasad (2012) Microbes: Concepts and Applications. Brockwell J, PJ Bottomley, and JE Thies (1995) Manipulation of rhizo- bia microflora for improving legume productivity and soil fertility: a critical assessment. Plant Soil 174: 143-180. Chemining’wa GN, SWM Theuri, and JW Muthomi (2011) Abundance of indigenous Rhizobia nodulating cowpea and common bean in central Kenyan soils. Afr J Hort Sci 5: 92-97. Chen WM, EK James, JH Chou, SY Sheu, SZ Yang, and JI Sprent (2005)- Rhizobia from Mimosa pigra, a newly discovered invasive plant in- Taiwan. New Phytologist 168: 661-675. Chitchanok A, P Rattasaritt, S Suthatip, P Suphaporn, P Nattayana, and A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 400 T Yanee (2011) Improvement of Vitamin B6 Production from Rhizo- bium sp. 6-1C1 by Random Mutation. KKU Res J 16(8): 911-918. Cox MJ, WO Cookson, and MF Moffatt (2013) Sequencing the human- microbiome in health and disease. Hum Mol Genet 22 (R1): R88-94. Dittmar H, M Drach, R Vosskamp, ME Trenkel, R Gutser, and G Stef- fens (2009) Fertilizers, 2. Types. Ullmann’s Encyclopedia of Indus- trial Chemistry, Wiley-VCH, Weinheim. doi:10.1002/14356007. n10_n01. Eaglesham AR, JA Ayanaba, VR Rama, and DL Eskew (1992) Mineral N effects on cowpea and soybean crops in a Nigeria soil: Amounts of nitrogen fixed and accrual to the soil. Plant Soil 68: 183-186. Garrity GM, JA Bell, and T Liburn (2005) Class I. Alphaproteobacteria class. Nov. In Bergey`s Manual of systematic Bacteriology, 2nd end, vol. 2, part C, P. 1. Edited by Brenner DJ, Krieg, NR Staley JT and Garrity. GM New York: springer. Gherbi H, K Markmann, S Svistoonoff, J Estevan, D Autran, G Gic- zey, F Auguy, B Péret, L Laplaze, C Franche, M Parniske, and D Bogusz (2008) SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria. PNAS 105 (12): 4928–4932. doi: 10.1073/ pnas.0710618105. González MBR and J González-López (2014) Beneficial Plant-microbi- al Interactions: Ecology and Applications. CRC Press. Taylor & Fran- cis Group, Boca Raton, FL 33487-2742. Gowariker V, VN Krishnamurthy, S Gowariker, M Dhanorkar, and K Paranjape (2009) The Fertilizer Encyclopedia. John Wiley & Sons. ISBN 9780470410349. Online ISBN 9780470431771. doi: 10.1002/9780470431771. Handbook for Rhizobia: Methods in legume-rhizobium technology. New York: Springer-Verlag. pp. 1–6, 167. ISBN 0-387-94134-7. Hirsch AM (2004) Plant-Microbe Symbioses: A Continuum from Com- mensalism to Parasitism. Symbiosis 37: 1–19. The 4th International Symbiosis Congress, August 17–23, 2003, Halifax, Canada. Hungria M, AA Franco, and JI Sprent (1993) New sources of high-tem- perature tolerant rhizobia for Phaseolus vulgaris L. Plant and Soil 149 (1): 103–109. Janda JM and SL Abbott (2007) 16S rRNA Gene Sequencing for Bac- terial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. J. Clin. Microbiol. 45 (9): 2761–2764. Jones KM, H Kobayashi, BW Davies, ME Taga, and GC Walker (2007 How rhizobial symbionts invade plants: the Sinorhizobium-Medicago model. Nat Rev Microbiol 5: 619–633. Jordan DC (1982) Transfer of Rhizobium Japonicum Buchanan 1980 to Bradyrhizobim gen. nov. a genus of slow-growing, root nodule bacteria from leguminous plants. Int J Syst Bacteriol 32:136-139. Josey DP, JL Beynon, AWB Johnson, and JE Beringer (1979) Strain Iden- tification in Rhizobium Using Intrinsic Antibiotic Resistance. Journal of Applied Microbiology 46: 343–350. Karanja NK and M Wood (1988) Selecting Rhizobium phaseoli strains for use with beans (Phaseolus vulgaris L.) in Kenya: Tolerance of high temperature and antibiotic resistance. Plant and Soil 112 (1):15–22. Kim OS, YJ Cho, K Lee, SH Yoon, M Kim, H Na, SC Park, YS Jeon, JH Lee, H Yi, S Won, and J Chun (2012) Introducing EzTaxon-e: a prokary- otic 16S rRNA gene sequence database with phylotypes that repre- sent uncultured species. International Journal of Systematic and Evo- lutionary Microbiology 62: 716–721. doi:10.1099/ijs.0.038075-0. Kolbert CP and DH Persing DH (1999) Ribosomal DNA sequencing as a tool for identification of bacterial pathogens. Current Opinion in Microbiology 2 (3): 299–305. Kremer RJ and HL Peterson (1982) Nodulation Efficiency of Legume Inoculation as Determined by Intrinsic Antibiotic Resistance. Appl En- viron Microbiol 43 (2): 636–642. Kuykendall LD (2005a) Order VI. Rhizobiales ord. nov. In Bergey`s Manual of systematic Bacteriology, 2nd end, 2, part C, P. 324. Ed- ited by DJ Brenner, NR Krieg, JT Staley, and GM Garrity. Springer, New York. Kuykendall LD (2005b) Genus I. Bradyrhizobium Jordan 1982, 137vp In Bergey`s Manual of systematic Bacteriology, 2nd end, vol. 2, part C, pp. 438-443. Edited by DJ Brenner, NR Krieg, JT Staley, and GM Garrity. Springer, New York. Kuykendall LD, MA Roy, JJ O’Neill, and TE Devine (1988) Fatty Acids, Antibiotic Resistance, and Deoxyribonucleic Acid Homology Groups of Bradyrhizobiurn japonicum. International Journal of Systematic and Evolutionary Bacteriology 38 (4): 358–361. Ley RE, F Bäckhed, P Turnbaugh, CA Lozupone, RD Knight, and JI Gor- don (2005) Obesity alters gut microbial ecology. PNAS 102 (31): 11070-11075. Makarova KS, L Aravind, YI Wolf, RL Tatusov, KW Minton, EV Koonin, and MJ Daly (2001) Genome of the Extremely Radiation-Resistant Bacterium Deinococcus radiodurans Viewed from the Perspective of Comparative Genomics. Microbiology and Molecular Biology Re- views 65 (1): 44–79. Pankhurst CE (1977) Symbiotic effectiveness of antibiotic-resistant mu- tants of fast- and slow-growing strains of Rhizobium nodulating Lo- tus species. Canadian Journal of Microbiology 23 (8): 1026–1033. Ramírez ME, DW Israel, and AG Wollum (1998) Using spontaneous antibiotic-resistant mutants to assess competitiveness of bradyrhi- zobial inoculants for nodulation of soybean. Canadian Journal of Microbiology 44: 753-758. Saitou N and M Nei (1987) The neighbor-joining method: A new meth- od for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425. Salisbury FB and CW Ross (1985) plant physiology. Wadsubrth pub- lishing company inc. Ca, USA pp. 96-113. Schmidt TM, EF Delong, and NR Pace (1991) Analysis of a marine pi- coplankton community by 16S rRNA gene cloning and sequencing. Journal of Bacteriology 173 (14): 4371–4378. Schwinghamer EA (1964) Association between antibiotic resistance and ineffectiveness in mutant strains of Rhizobium spp. Canadian Journal of Microbiology 10 (2): 221–233. Schwinghamer EA and WF Dudman (1973) Evaluation of Spectinomycin Resistance as a Marker for Ecological Studies with Rhizobium spp. Journal of Applied Bacteriology 36 (2): 263–272. Silva FV, JL Simões-Araújo, JP Silva Júnior, GR Xavier, and NG Rum- janek (2012) Genetic diversity of Rhizobia isolates from Amazon soils using cowpea (Vigna unguiculata) as trap plant. Brazilian Jour- nal of Microbiology 43 (2): 682-691. Somasegaran P and HJ Hoben (1994) Handbook for Rhizobia. Meth- ods in Legume-Rhizobium Technology. Springer – Velag, New York. pp. 332-341. Sprent JI and P Sprent (1990) Nitrogen fixing organisums. Pure and ap- plied aspects. Chapman & Hall, London, United Kingdom. Stackebrandt E and BM Goebel (1994) Taxonomic Note: A Place for DNA-DNA Reassociation and 16S rRNA Sequence Analysis in the Present Species Definition in Bacteriology. International Journal of Systematic and Evolutionary Bacteriology 44 (4): 846–849. Stewart WM, DW Dibb, AE Johnston, and TJ Smyth (2005) The Contri- bution of Commercial Fertilizer Nutrients to Food Production. Agron- omy Journal 97: 1–6. doi: 10.2134/agronj2005.0001. Turco RF, TB Moorman, and DF Bezdicek (1986) Effectiveness and com- petitiveness of spontaneous antibiotic-resistant mutants of Rhizobium leguminosarum and Rhizobium japonicum. Soil Biology and Biochem- istry 18 (3): 259–262. Wang Q, GM Garrity, JM Tiedje, and JR Cole (2007) Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Bacterial Taxonomy. Applied and Environmental Microbiology 73 (16): 5261–5267. Weisburg WG, SM Barns, DA Pelletier, and DJ Lane (1991) 16S ribo- somal DNA amplification for phylogenetic study. J Bacteriol 173: 697–703. Wojciechowski MF, M Lavin, and MJ Sanderson (2004) A phylogeny of legumes (Leguminosae) based on analysis of the plastid matK gene resolves many well-supported subclades within the family. Am J Botany 91 (11): 1846–1862. Zelazna-Kowalaska I (1971) Correlation between streptomycin resis- tance and infectiveness in Rhizobium trifolii. Plant Soil. Spc. Vol. 67- 71. 401