Atlas Journal of Biology 3 (1): 183–205, 2014 doi: 10.5147/ajb.2014.0133 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Transcriptome Profiling of the Shoot and Root Tips of S562L, a Soybean GmCLAVATA1A Mutant Saeid Mirzaei1,2, Jacqueline Batley1, Brett J Ferguson1, and Peter M Gresshoff1* 1 Centre of Excellence for Integrative Legume Research, School of Agriculture and Food Sciences, The Univer- sity of Queensland, St Lucia, Brisbane QLD 4072, Australia; 2 Present address: Department of Biotechnology, Institute of Science, High Technology and Environmental Sciences, Graduate University of Advanced Technol- ogy, Kerman, Iran Received: March 20, 2014 / Accepted: April 6, 2014 __________________________________________________ * Corresponding author: p.gresshoff@uq.edu.au 183 Abstract Plant shoot apical meristems (SAM) and root apical meri- stems (RAM) contain stem cells that form overall-plant ar- chitecture. Mechanisms acting in these regions keep a bal- ance between the stem cell population and differentiation. These mechanisms are well-studied in Arabidopsis, but little is known in the legume soybean (Glycine max (L.) Merr.). In Arabidopsis, the Leucine-rich repeat (LRR) Receptor kinase CLAVATA1 (CLV1) is a crucial regulator of this process in the SAM. In soybean, the receptor most similar to ATCLV1 is Gm- NARK, which is involved in nodulation control. In contrast, the homeologous partner of GmNARK in soybean, called GmCLV1A, appears to have no function in ‘Autoregulation of nodulation’ (AON) a role in regulating shoot architecture in the SAM. Here, the transcriptome of the shoot and root tip areas of a chemically induced and TILLING-selected Gm- CLV1A missense mutant, S562L, and its wild type, cultivar Forrest, were analysed to identify genes which are affected by impaired function of GmCLV1A. Among the differentially expressed genes identified, many were categorised as hav- ing a role in receptor kinase activity, transcription or defense/ stress-response. Molecular categories over-represented in the shoot tip of the mutant include those involved in hormone biosynthesis/activity and secondary metabolism, signalling, photosynthesis, and transport. Functional categories includ- ing those involved in polyamine metabolism, nucleotide metabolism, RNA regulation, protein targeting and protein degradation were under-represented in the shoot tip of the mutant. In the root tip, categories associated with signal Introduction Soybean (Glycine max (L.) Merr.), garden pea (Pisum sati- vum), common bean (Phaseolus vulgaris) and alfalfa/lucerne (Medicago sativa) are some of the important crops belonging to the legume family, which are second to the grasses in providing food for the world’s population. One-third of all dietary protein and one-third of processed vegetable oil for human consumption are provided by grain legumes (Gepts et al., 2005; Graham and Vance, 2003). Nitrogen is the most required nutrient of plants and enters into many biological molecules such as amino acids, proteins and nucleic acids. Although dinitrogen gas (N2) forms a main part of the earth’s atmospheric gas (78.1%), it cannot be used by most of the plants, generating a global need for nitrogen-containing fertiliser. Leguminous plants, however, are able to use dinitrogen gas through a symbiotic association with soil bacteria, collec- This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecom- mons.org/licenses/by/3.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the origi- nal work is properly cited. ling, transport, protein synthesis and metabolism were over- represented in the mutant, while categories associated with cell wall degradation, stress, RNA regulation, protein deg- radation and targeting were under-represented in the mu- tant. Factors similar to Arabidopsis regulatory components are most likely functioning in specialised shoot structures in legumes. Furthermore, GmCLV1A may have an unexpected role in the regulation of flavonoid biosynthesis in soybean. Keywords: Glycine max, legume, plant development, RAM, re- ceptor kinase, RNAseq, SAM, symbiosis. A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 184 tively named rhizobia (Ferguson et al., 2003). Apical meristems including those of the shoot (SAM) and root (RAM) are responsible for the aerial and underground organs of the plant, respectively (Stahl and Simon, 2010; Traas and Hamant, 2009). SAM and RAM are specialised regions contain- ing stem cells, which allow plants to grow continuously throughout their life through the control of a pool of stem cells. Similar to animal stem cells, plant stem cells are capable of generating diverse tissues and renewing the stem cell population (Sharma et al., 2003). Therefore, the major function of the SAM is to keep a dy- namic balance between maintenance of the pluripotent stem cell population and the formation of new organs (leaves and flow- ers) and enables plants to grow and reproduce (Fletcher, 2002). Some pathways and regulatory mechanisms in this process have been identified through studies using the model plant Arabidop- sis, a crucifer. Of particular significance is the role of the CLA- VATA (CLV) signalling network to regulate the size of the stem cell reservoir in the SAM. Mutations in genes (like CLV1, CLV2 and CLV3) acting in the CLV network lead to the proliferation of undifferentiated cells in the SAM and the development of an abnormal apical meristem (Clark et al., 1993; 1997). Within this gene network, CLV1 encodes a leucine-rich repeat receptor kinase (LRR-RK) and plays a critical role in this pathway. AtCLV1-like genes in soybean are GmNARK and GmCLV1A. GmNARK regulates nodulation through a mechanism called Au- toregulation Of Nodulation (AON) (Searle et al., 2003) and GmCLV1A appears to have a function in the SAM (Mirzaei et al., 2014; submitted). However, to date, little is known about the ‘CLV’ network of soybean. Recently, through TILLING, an EMS- induced missense mutation in a putative S-glycosylation site (S562L) in GmCLV1A was isolated (Batley et al., 2014; submit- ted). The mutant shows an alternative function from GmNARK and behaves as a loss-of-function allele. GmCLV1A lacks any measurable effect on nodulation despite sharing over 90% DNA sequence with GmNARK. The S562L mutation leads to severe nodal identity alterations in the basal parts of the emergent plant such as branching, as well as flower and pod abnormali- ties (Mirzaei et al., 2014; submitted). Several methods are available to study gene expression, such as qRT-PCR, microarrays and high-throughput RNA sequencing (RNA-seq) (Ozsolak et al., 2009). qRT-PCR is utilised for study- ing a small number of genes and samples, microarrays are used for large scale gene expression studies (e.g., whole transcrip- tome), and RNA-seq also evaluates the whole transcriptome, but with less danger of confusing data caused by cross-hybridisation of related genes. In recent years, RNA-seq has been widely used for transcript profiling and gene discoveries in plant spe- cies including legumes, such as soybean (Hayashi et al., 2012; Libault et al., 2010; Reid et al., 2012). In this study, we compared the transcriptome of the shoot and root tip of the S562L, Gmclv1a mutant, and its wild type parent (cultivar Forrest) using RNA-seq. The CLC genomics workbench program was subsequently used to map the RNA-seq data to the soybean reference genome and determine the relative tran- script abundance. The results provide further evidence to aid the understanding of meristem maintenance in soybean. Materials and Methods Plant Growth Conditions Soybean (Glycine max (L. Merr.) wild type cv. Forrest and the EMS-induced and TILLING-selected missense mutant S562L were used for this experiment. For RNA-seq, seeds were sur- face-sterilised by immersion in 70% ethanol for 30 s, then rinsed 5 times with sterile water, and were put between filter paper in sterile Petri dish and kept in a growth chamber at 25°C in dark conditions. Tissue Harvest Shoot tips (1 mm) and root tips (2 mm) were harvested after 48 hours using a sterile scalpel and immediately frozen in liquid nitrogen. Shoot tips of plants 48-hours old were collected under the dissecting microscope after opening the cotyledon and re- moving the emerging leaves. RNA Sample Preparation and Library Construction For RNA-seq, total RNA was extracted from dissected shoot and root tips using the Qiagen RNeasy Minikit with on-column DNAse digestion according to the manufacturer’s instructions (Qiagen, Maryland, USA). The Australian Genome Research Facility (AGRF) subsequently conducted cDNA library construc- tion and RNA sequencing. cDNA libraries for plant transcriptome sequencing were constructed using the Illumina Truseq RNA kit according to Illumina protocols and RNA sequencing was per- formed using the Illumina HiSeq 2000 platform, with four mul- tiplexed samples run on one flowcell lane generating 100 bp single-end reads. For qRT-PCR experiment, RNA was converted to cDNA in a 20-µl reaction mixture containing 0.5 mM deoxynucleoside tri- phosphates (dNTPs), 1 µl of 50 µm oligo(dT) primers, 40 unit of RNaseOUT (Invitrogen), 0.5 µg of DNA-free RNA, 1x first- strand buffer (Invitrogen), 5 mM dithiothreitol (DTT) and 100 units of SuperScript III reverse transcriptase (Invitrogen) at 500C for 60 min. Finally, cDNA was confirmed using GmCons6 primers (Libault et al., 2008) (Glyma12g05510; F box protein family) and PCR. Quantitative Real Time PCR Primers used for quantitative real-time PCR were designed using the online primer design program, Primer 3 version 0.4.0 (available at http://frodo.wi.mit.edu). Sequences from the soy- bean genome (Phytozome version 8.0; the United States De- partment of Energy Joint Genome Institute and Centre for In- tegrative Genomics; available at http://www.phytozome.net) were used for primer design. The sequences for forward and reverse primers for each gene are shown in Table 3. To ensure that the primers were specific and produced only a single band, normal PCR was run using Forrest cDNA. All primer pairs were found to amplify a single product of the correct size. The relative transcript abundance was detected using SYBR A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 185 Green PCR Master Mix (Applied Biosystems) on an ABI 7900HT cycler (Applied Biosystems) in a 384-well plate. The 384-well plates were set up using an Eppendorf epMotion 5075 Robotic system and contained no template (water) control and reverse transcription negative (RT-) controls to verify genomic DNA con- tamination of the samples. All reactions were carried out in du- plicate of one biological replicate. The qRT-PCR conditions used were as follows: initial denaturation of 95˚C for 10 min, then 45 cycles of 95˚C for 15 sec and 60˚C for 1 min followed by a dissociation stage of 95˚C for 2 mins to assess the specificity of the PCR. The expression level of the genes was normalised to the mRNA expression level of soybean GmCons6 (Libault et al., 2008) amplified by forward primer 5’-AAAGGTGAAATT- GCCTCTTCC-3’ and reverse primer 5’-CCCAAAGATCTGC- CAAATGTA-3’. PCR efficiency for each sample was calculated using the LinRegPCR 7.5 program (Ramakers et al., 2003). Bioinformatics and Data Analysis of Sequencing Output The read quality score was determined using the FastX tool kit. Shoot and root read sequence data were mapped separately against the soybean genome (available at Phytozome; http:// www.phytozome.net/) using the CLC Genomics Workbench with the RNA-seq function and the mapping setting: minimum length fraction 0.9, and minimum similarity fraction 0.8. Relative tran- script abundance was yielded in “Read Per Kilobase” of exon model Per Million mapped reads (RPKM) values. This value only uses the mapped reads and relative size of transcripts to deter- mine expression level. Differentially expressed genes were identified by comparing expression values between samples and using Kal’s test (Kal et al., 1999) which considers proportions, rather than raw data. Genes were determined to be differentially expressed using thresholds of fold change >=2 with Kal’s Z test p-value <0.05. Results Transcriptome Sequencing (RNA-seq) Outputs To help understand how GmCLV1A affects the gene expres- sion network in soybean, transcript profiles of the shoot and root tip of S562L Gmclv1a mutant and wild type (Forrest) were com- pared at germination. One hundred (100) bp single-end se- quence reads generated using an Illumina Hi-seq 2000 platform had a good quality (Phred quality score ≥ 32; Figure 1). Re- sults of mapping reads against the soybean reference genome (available at Phytozome; http://www.phytozome.net/) are sum- marised in Table 1. Overall a total of 84-87% of the reads from each sample uniquely mapped to the soybean genome, whereas ~4% were non-specifically mapped. Transcriptomes of Wild Type Forrest and Mutant S562L Shoot Tips By having at least one read match, a total of 40,229 genes were expressed in the wild type shoot tip compared with 41,172 genes in the S562L shoot tip. Comparison of wild type and S562L shoot tip genes expression value (RPKM) indicated that 631 genes had a differential transcript abundance (Kal’s Z test; P ≤ 0.05). Around 71% of differentially expressed genes (448 genes) had significantly higher expression in the S562L shoot tip relative to the wild type, and 29% of differentially ex- pressed genes (183 genes) genes had less expression. Of these, 277 (~62%) of the more-highly expressed genes had a fold change of two or greater, whereas 62 (~34%) lower-expressed genes had a fold change of two or greater. A subset of these differentially expressed genes, which were predicted to encode either protein kinases, transcription factors, protein binding, de- fense, stress response or catalytic activity, is presented in Table S1 [see additional file]. Transcriptomes of wild type Forrest and Mutant S562L Root Tips A total of 40,460 genes were expressed in the wild type root tip compared with 40,714 genes in the S562L root tip. Compari- son of gene expression values in the wild type and S562L root tips identified 1,204 genes that had differential transcript abun- dance (P ≤ 0.05). Around 64.5% of differentially expressed genes (777 genes) increased in expression in the S562L root tip relative to wild type and 35.5% of differentially expressed genes (427 genes) decreased. Four hundred and forty six (446: ~58%) of these more-highly expressed genes had a fold change of two or greater and 140 (~33%) lower-expressed genes had a fold change of two or greater. A subset of these differentially expressed genes, with activities such as protein ki- nase and signalling activity, transcription factor activity, protein binding, defence and stress response, and catalytic activity are presented in Table S2 [see additional file]. Table 1. Mapping RNA sequencing reads to the Glycine max genome. Wild type shoot tip S562L shoot tip Wild type root tip S562L root tip Total reads 39,284,610 44,789,650 34,169,345 33,856,295 Uniquely mapped reads 34,063,809 38,886,356 28,999,578 28,343,248 87% 87% 85% 84% Non-specifically mapped reads 1,639,245 1,879,153 1,450,399 1,400,816 4% 4% 4% 4% Un-mapped reads 3,581,556 4,024,141 3,719,369 4,112,231 9% 9% 11% 12% A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 186 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Figure 1. Phred quality scores of RNA sequencing reads. The percentage of base calling accuracy for each base position of the read. The X axis shows read position and the Y axis on the left shows the phred score and on the right shows the percentage of base call accuracy. 187 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Figure 2. qRT-PCR analysis of six differentially expressed genes (based on RNA-seq) in the shoot samples. This analysis was done in the same shoot samples used for high-throughput RNA sequencing. FST: Forrest shoot tip, S562LST: S562L shoot tip. 188 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Confirming the Expression of Some Differentially-Expressed Genes at the Shoot Tip From differentially-expressed genes, ten candidate genes (eight had over-expression and two had reduced-expression in the shoot or root tip of S562L) were selected based on homol- ogy to Arabidopsis genes that could influence the CLV pathway or were acting in developmental pathways (Table 2). The ex- pression of the selected genes was confirmed by qRT-PCR. qRT- PCR was carried out on the exact RNA samples that were used for deep sequencing. The result showed that the expression of all selected genes was consistent with the deep sequencing results (Figures 2 and 3). Soybean Functional Categories Regulated in the Shoot Tip Functional categories of genes that were differentially ex- pressed in the S562L shoot tip compared to the wild type shoot tip were analysed using Mapman (Thimm et al., 2004) and Pageman, an integrated program in Mapman. This analysis, ap- plying the Wilcoxon test with Benjamini-Hochberg correction, revealed 141 functional pathways (bins and sub-bins) to be sta- tistically different from the other pathways (p<0.05; Table S3; see additional file). These pathways are distributed into 22 bins out of 37 bins. Categories over-represented in the shoot tip of S562L included photosynthesis, cell wall, secondary metabolism, hormone metabolism, redox regulation, signalling and transport bins and sub-bins. Under-represented functional categories in- cluded polyamine metabolism, nucleotide metabolism, RNA, DNA and protein bins and sub-bins. Soybean Functional Categories Regulated in the Root Tip A comparison of the RNA-seq root tip outputs of S562L and its wild type found a total of 71 biological functional pathways to be statistically different from all other Bins (p<0.05; Table S4; see additional file). Over-represented categories included pho- tosynthesis, lipid metabolism, amino acid metabolism, secondary metabolism hormone metabolism, redox regulation, nucleotide metabolism, DNA, signalling, development and transport and under-represented functional categories included fermentation, cell wall, biosynthesis, stress, RNA, protein and cell biology. Figure 3. qRT-PCR analysis of four differentially expressed genes (based on RNA-seq) in the root samples. This analysis was done in the same root samples used for high-throughput RNA sequencing. FRT: Forrest root tip, S562LRT: S562L root tip. A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Discussion RNA-seq analysis provided a broad view of the gene ex- pression in the S562L shoot and root tip regions compared with the wild type. Our data revealed genes involved in signalling, transcription, metabolism and defense and stress response are over-represented in the S562L shoot and root tip. Moreover, genes that belong to the receptor protein kinase and transcrip- tion factor families, which are important in signalling and plant development, were also shown to have higher transcript abun- dance in the shoot and root tip of S562L compared to the wild type. WUS encodes a homeodomain transcription factor and is expressed in the organising centre at the SAM (Schoof et al., 2000). WUS regulates the meristem size through cytokinin sig- naling via repression of several type-A Arabidopsis response regulators (ARRs) (ARR5, ARR6, ARR7 and ARR15) as well as ac- tivation of CLV3 transcription by binding to its regulatory region (Leibfried et al., 2005; Yadave et al., 2011). Our RNA-seq data and qRT-PCR revealed that Glyma06g01940 (putative ortho- logue of AT4G35550; WUSCHEL related homeobox 13) was transcribed higher in the S562L shoot tip, which is reminiscent of the finding in Arabidopsis where the WUS expression domain expanded in the clv SAM (Schoof et al., 2000). This indicates that GmCLV1A of soybean is acting through a similar component as the CLV network in Arabidopsis. Receptor kinases are key elements in ligand-receptor systems to communicate signals in multicellular organism (i.e., plants) and are involved in diverse pathways in growth and development (Searle et al., 2003; Dievart et al., 2004; Shiu et al., 2004). In Figure 4. Predicted model of the regulatory network of factors acting in the legume SAM. In the model, it is proposed that GmCLV1A, CLV2 and KLV perceive a ligand probably similar to CLV3 in Arabidopsis and then negatively regulate a WUS-related protein. There is possibility that AON genes such as NARK also interact with GmCLV1A in some aspect of plant development. GmCLV1A also negatively regulates flavonoids biosynthesis. Arrows indicate positive regulation and barred lines indicate negative regulation. ‘?’ implies ‘unknown’. Table 2. Expression fold changes and putative annotation of genes selected for qRT-PCR. 189 Gene ID Putative annotation Proportion fold change Shoot Samples Glyma08g11620 Chalcone and stilbene synthase 39.30 Glyma10g44170 Homogentisate phytyltransferase 1 9.73 Glyma06g01940 WUSCHEL related homeobox 13 5.38 Glyma04g29250 Response regulator 9 8.19 Glyma16g33870 Succinyl-CoA ligase -18.38 Glyma05g36310 ACC oxidase 1 -5.29 Root Samples Glyma04g00930 GLN phosphoribosyl pyrophosphate amidotransferase 1 7.99 Glyma06g05300 CCCH-type zinc finger family protein 7.15 Glyma08g11620 Chalcone and stilbene synthase 6.91 Glyma07g35630 NAC-like, activated by AP3/PI 4.58 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Arabidopsis thaliana, the CLV family [19], ERECTA family (Torii et al., 1996; Uchida et al., 2013), BAM family (DeYoung et al., 2006; DeYoung and Clark, 2008), RPK2 (Kinoshita et al., 2010), RPK1 (receptor like protein kinase1) and ACR4 (Arabi- dopsis Crinkly4) (De Smet et al., 2008; 2009) are all receptor kinases and function in regulating cell division and differentia- tion in shoot and root meristems. LRR RKs, differentially regu- lated in the S562L shoot tip and root tip, are presented in Table S1 and Table S2 [see additional file]. None of these LRR RKs are paralogues of the above mentioned LRR RKs, indicating that they represent new candidates that function in signalling at the shoot and root tip and may play a similar role — controlling cell division and differentiation — as the above mentioned receptor kinases. Transcription factors play critical roles in plant development by regulating positively or negatively the expression level of relevant genes. Analysis of differentially expressed genes re- vealed their presence in the S562L shoot and root tip (Table S1, 2; see additional file). Transcripts that are related to AP2 (APETALA2) and a group of AP2, ethylene responsive element binding proteins, EREBPs, were also found to be differentially expressed in the shoot and root tip of S562L (Table S1, 2; see additional file). AP2/EREBP transcription factors are expressed in different tissues includ- ing: flower, leaves, inflorescence stem and root (Okamuro et al., 1997) and they are involved in several developmental pro- cesses that include: seed development, stem cell identity, floral organ identity, plant growth, nodulation and defense response (Agrawal et al., 2011; Andriankaja et al., 2007; Aoyama et al., 2012; Jofuku et al., 1994; Krishnaswamy et al., 2011; Yant et al., 2010). AP2-related transcripts are under-represented in the shoot while they are over- and under-represented in the root tip of S562L (Table S1, 2; see additional file). This sug- gests that the defect in GmCLV1A function, which is involved in plant development of soybean, might associate with over- and under-represented transcripts of this group of transcription fac- tors which function in developmental processes such as stem cell and thus nodal identity. Some transcripts correspond to the NAC (NAM, ATAF1/2 and CUC2) domain containing proteins, are also over-represented in the shoot and root tip of S562L (Table S1, 2). NAC domain con- taining proteins are another group of transcription factors that are involved in a wide range of biological processes, including embryogenesis, flower development, SAM development, wood formation and shoot branching (Aida et al., 1997; Hu et al., 2010; Mao et al., 2007; Ohtani et al., 2011; Xie et al., 2000). Interestingly, Glyma02g26480 is a putative orthologue of ATAF1 (AT1G01720) was over-represented in the shoot tip of S562L. ATAF1 is a homologue of the NAM (No Apical Meristem) gene in Petunia (Souer et al., 1996). In Petunia, nam mutants fail to develop a SAM (Souer et al., 1996). This indicates that the over-expression of this gene might be due to impaired Gm- CLV1A function in the S562L mutant. However, it has been shown that ATAF1 is involved in stress responses (Hu et al., 2010; Wang et al., 2009). Furthermore, Glyma13g35550, over-represented in the root tip data set, is also an ATAF1-like gene. There are genes highly expressed in the root and shoot tip of S562L that correspond to those of the WRKY transcription factors family (Table S1, 2; see additional file). WRKY tran- scription factors act as activators or repressors and control many plant biological processes including germination, senescence, bi- otic and abiotic responses and development. Moreover, WRKY factors have a key role in the innate immune system of plants (Rushton et al., 2010). Flavonoids play a pivotal role in plant biology. They pro- tect plants against UV irradiation, attract pollinators and sym- bionts, and contribute to plant hormone signalling (Dixon and Pasinetti, 2010; Stracke et al., 2007). MYB transcription factors also act in various plant biological processes and impact devel- opment, biotic and abiotic stresses and metabolism (Dubos et al., 2010). There is a member of the MYB transcription factors among the differentially regulated genes in the S562L shoot tip, which is involved in flavonol biosynthesis. Glyma16g02570, a putative orthologue of MYB111, was over-represented in the Gene ID Forward primer (5’-3’) Reverse primer (5’-3’) Glyma08g11620 TCCACCCCCATCATCATATC TTGCGCCTTACGAATCTCTT Glyma10g44170 TTCACGACACAAAAGGGAAAC AGCATGAGCTTCAAAACCAA Glyma06g01940 TCAAACGCTGGTGGTATTATTG GACAGATGGTGGCATAGACAGA Glyma04g29250 CTCAGAGAATGTCCCAGCAAG TTTCAACAAATGTGGCCTCAG Glyma16g33870 TGACATATGAAGCGGTTTTCC TCTGAAGGCAGTCAACGAAGT Glyma05g36310 ACCTTCCAAGAACAATGCCAT TCCAATGGGGTTATAGAAGGTG Glyma04g00930 GGTGTACCCGGGTGAAGTTAT ACCTCCCGAAAACAACAGAGT Glyma06g05300 AACAACTCCGCCTCGTAGTAAC ATTTTAACATTCCGCGTTGAGT Glyma07g35630 CCTCCTGGCTTTAGGTTTCAC GCAATTCCCAAGGATCAAACT Gene ID is according to the Phytozome database (http://www.phytozome.net). Table 3. Primer sequences used for qRT-PCR. 190 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) transcriptome data base of the S562L shoot tip. In Arabidop- sis, MYB111 controls flavonol biosynthesis and is mainly active in cotyledons (Stracke et al., 2007). As flavonol accumulation regulates polar auxin transport (Kuhn et al., 2011), it is likely that some phenotypes of S562L, such as increased branching, are the result of flavonol accumulation due to higher expres- sion of Glyma16g02570. Members of this group were also over-represented in the root tip data of S562L. Of interest is Glyma03g34110, a putative orthologue for AtMYB68. It is spe- cifically expressed in the root and responds to environmental conditions, temperature in particular (Feng et al., 2004). There is a possibility that over-expression of this gene causes a stronger phenotype of S562L under cold conditions; however, AtMYB68 expression is elevated at high temperature (Feng et al., 2004). Putative orthologues of Arabidopsis chalcone synthase (CHS) including Glyma08g11620, Glyma08g11520, Glyma0811650 and Glyma02g14450, were found to have higher expression in the S562L shoot and root tips compared to wild type shoot and root tips. CHS is a key enzyme in flavonoids biosynthesis (Win- kel-Shirley, 2001). This suggests a correlation between flavonoid biosynthesis and CLV signalling which may cause developmental outcomes. Overall, the existence of numerous transcription factors among the differentially expressed genes identified in this study is consistent with recent studies which show a wide range of tran- scription factors are active in the SAM and RAM of soybean (Haerizadeh et al., 2009; 2011). Furthermore, over-representa- tion of transcripts for MYB and WRKY transcription factors which are involved in a wide range of plant processes and mainly function in abiotic and biotic stresses, could be explained by SAM and RAM immunity systems, which may be affected by impaired function of GmCLV1A. A recent study demonstrates that CLV3, a main regulator of stem cell homeostasis, can also activate innate immunity (Lee et al., 2011). Moreover, Mathesius et al. (2011) by comparison of root tip and differentiated root, highlighted the importance of stress, defense response and fla- vonoid metabolism in the root apex. Conclusions and Future Work Past studies using the model plant Arabidopsis revealed regu- latory pathways in the SAM and RAM that sustain stem cells in both shoot and root meristems and exhibited some similari- ties between molecules and mechanisms. In legumes, it seems there is a divergence in CLV1 function as CLV1 orthologues in legumes, except for GmCLV1A in soybean, are involved in nodu- lation control. GmCLV1A (a paralogue of GmNARK, which is a key component in the regulation of nodule formation), acts in shoot architecture, leaf and pod development (Mirzaei et al., 2014; submitted). Investigation of the shoot tip transcriptome of S562L indicated that GmCLV1A suppresses the expression of Glyma06g01940 (WUSCHEL related homeobox 13) reminis- cent of CLV1 function in Arabidopsis. This finding along with the evidence of the function of LjCLV2, PsCLV2 (Krusell et al., 2011) and LjKLV (Lotus japonicus KLAVIER) (Miyazawa et al., 2010) in the SAM indicates that components similar to Arabidopsis regu- latory elements are most likely acting in specialised shoot struc- tures in legumes (Figure 4). Furthermore, it seems that GmCLV1A negatively controls the flavonoids biosynthesis through the chal- cone synthase and the MYB111 transcription factor. As auxin polar transport is regulated by flavonoids (Kuhn et al., 2011; Falcone et al., 2012), there is a possibility that they also have a function in regulating legume shoot structure. Further research is required revealing how pathways regu- lating flavonoids biosynthesis and pathways regulating plant development are connected together in the legume family. Moreover, more studies are required to identify other compo- nents (known or unknown in Arabidopsis) regulating the SAM of legumes. As mutations in LjCLV2/PsCLV2 and LjKLV lead to hyper-nodulation as well as stem fasciation (Krusell et al., 2011; Miyazawa et al., 2010), such lines of research may aid in un- derstanding not only the molecular mechanisms underlying SAM regulation in legumes, but also pathways acting in nodulation. Abbreviations SAM: Shoot Apical Meristems RAM: Root Apical Meristems CLV: CLAVATA LRR-RK: Leucine-Rich Repeat Receptor Kinase AON: Autoregulation Of Nodulation RPKM: Read Per Kilobase of exon model per Million mapped reads ARRs: Arabidopsis Response Regulators RPK1: Receptor like Protein Kinase1 ACR4: Arabidopsis Crinkly4 AP2: APETALA2 EREBPs: Ethylene Responsive Element Binding Proteins KLV: KLAVIER dNTPs: deoxynucleoside triphosphates DTT: dithiothreitol Competing Interest The authors declare that they have no competing interests. Author Contribution SM conducted experiments, evaluated results and wrote the manuscript. JB, BJF and PMG contributed to the conception, in- terpretation and supervision of the research and editing of the manuscript. Acknowledgements We thank the Australian Research Council and The University of Queensland for support through the Centre of Excellence scheme. We also thank A/Prof. Paul Ebert and Dr David Schli- palius at UQ for helping with analysing data using the CLC genomics workbench. Satomi Hayashi, Dr Dugald Reid, and Dr Stephen Kazakoff (all CILR) are thanked for technical discussion. 191 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) References Agarwal P, S Kapoor, and AK Tyagi (2011) Transcription factors reg- ulating the progression of monocot and dicot seed development. Bioessays 33: 189–202. Aida M, T Ishida, H Fukaki, H Fujisawa, and M Tasaka (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup- shaped cotyledon mutant. The Plant Cell Online 9: 841–857. Andriankaja A, A Boisson-Dernier, L Frances, L Sauviac, A Jauneau, DG Barker, and F de Carvalho-Niebel (2007) AP2-ERF transcription factors mediate nod factor–dependent Mt ENOD11 activation in root hairs via a novel cis-regulatory motif. The Plant Cell Online 19: 2866–2885. Aoyama T, Y Hiwatashi, M Shigyo, R Kofuji, M Kubo, M Ito, and M Hasebe (2012) AP2-type transcription factors determine stem cell identity in the moss Physcomitrella patens. Development 139: 3120– 3129. Clark SE, MP Running, and EM Meyerowitz (1993) CLAVATA1, a regu- lator of meristem and flower development in Arabidopsis. Develop- ment 119: 397–418. Clark SE, Williams RW, Meyerowitz EM: The CLAVATA1 gene encodes a putative receptor kinase that controls shoot and floral meristem size in Arabidopsis. Cell 1997, 89:575-585. De Smet I, V Vassileva, B De Rybel, MP Levesque, W Grunewald, D Van Damme, G Van Noorden, M Naudts, G Van Isterdael, R De Clercq, et al. (2008) Receptor-like kinase ACR4 restricts formative cell divi- sions in the Arabidopsis root. Science 322: 594–597. De Smet I, U Vosz, G Jurgens, and T Beeckman (2009) Receptor-like kinases shape the plant. Nat Cell Biol 11: 1166–1173. DeYoung BJ, KL Bickle, KJ Schrage, P Muskett, K Patel, and SE Clark (2006) The CLAVATA1-related BAM1, BAM2 and BAM3 receptor kinase-like proteins are required for meristem function in Arabidop- sis. The Plant Journal 45: 1–16. DeYoung BJ and SE Clark (2008) BAM receptors regulate stem cell specification and organ development through complex interactions with CLAVATA signaling. Genetics 180: 895–904. Dievart A and SE Clark (2004) LRR-containing receptors regulating plant development and defense. Development 131: 251–261. Dixon RA and GM Pasinetti (2010) Flavonoids and isoflavonoids: from plant biology to agriculture and neuroscience. Plant Physiology 154: 453–457. Dubos C, R Stracke, E Grotewold, B Weisshaar, C Martin, and L Lepiniec (2010) MYB transcription factors in Arabidopsis. Trends in Plant Sci- ence 15: 573–581. Falcone Ferreyra ML, S Rius, and P Casati (2012) Flavonoids: Biosynthe- sis, Biological functions and Biotechnological applications. Frontiers in Plant Science 2012, 222, 3. Feng CP, E Andreasson, A Maslak, HP Mock, O Mattsson, and J Mundy (2004) Arabidopsis MYB68 in development and responses to envi- ronmental cues. Plant Science 167: 1099–1107. Ferguson BJ, A Indrasumunar, S Hayashi, MH Lin, YH Lin, DE Reid, and PM Gresshoff (2010) Molecular analysis of legume nodule devel- opment and autoregulation. Journal of Integrative Plant Biology 52: 61–76. Fletcher JC (2002) Shoot and floral meristem maintenance in Arabidop- sis. Annual Review of Plant Biology 53: 45–66. Gepts P, WD Beavis, EC Brummer, RC Shoemaker, HT Stalker, NF Weeden, and ND Young (2005) Legumes as a model plant family. Genomics for food and feed report of the cross-legume advances through genomics conference. Plant Physiology 137: 1228–1235. Graham PH and CP Vance (2003) Legumes: Importance and constraints to greater use. Plant Physiology 131: 872–877. Haerizadeh F, MB Singh, and PL Bhalla (2011) Transcriptome profiling of soybean root tips. Functional Plant Biology 38: 451–461. Haerizadeh F, CE Wong, MB Singh, and PL Bhalla (2009) Genome- wide analysis of gene expression in soybean shoot apical meristem. Plant Mol Biol 69: 711–727. Hayashi S, DE Reid, MT Lorenc, J Stiller, D Edwards, PM Gresshoff, and BJ Ferguson (2012) Transient nod factor-dependent gene expres- sion in the nodulation-competent zone of soybean (Glycine max [L.] Merr.) roots. Plant Biotechnology Journal 10: 995–1010. Hu R, G Qi, Y Kong, D Kong, Q Gao, and G Zhou (2010) Compre- hensive analysis of NAC domain transcription factor gene family in Populus trichocarpa. BMC Plant Biology 2010, 10: 145. Jofuku KD, BG den Boer, M Van Montagu, and JK Okamuro (1994) Control of Arabidopsis flower and seed development by the homeo- tic gene APETALA2. The Plant Cell Online 6: 1211–1225. Kal AJ, AJ van Zonneveld, V Benes, M Van den Berg, MG Koerkamp, K Albermann, N Strack, JM Ruijter, A Richter, B Dujon B, et al. (1999) Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources. Molecular Biology of the Cell 10: 1859–1872. Kinoshita A, S Betsuyaku, Y Osakabe, S Mizuno, S Nagawa, Y Stahl, R Simon, K Yamaguchi-Shinozaki, H Fukuda, and S Sawa (2010) RPK2 is an essential receptor-like kinase that transmits the CLV3 signal in Arabidopsis. Development 137: 3911–3920. Krishnaswamy S, S Verma, M Rahman, and NV Kav (2011) Functional characterization of four APETALA2-family genes (RAP2.6, RAP2.6L, DREB19 and DREB26) in Arabidopsis. Plant Mol Biol 75: 107–127. Krusell L, N Sato, I Fukuhara, BEV Koch, C Grossmann, S Okamoto, E Oka-Kira, Y Otsubo, G Aubert, T Nakagawa, et al. (2011) The Clavata2 genes of pea and Lotus japonicus affect autoregulation of nodulation. The Plant Journal 65: 861–871. Kuhn BM, M Geisler, L Bigler, and C Ringli (2011) Flavonols accumu- late asymmetrically and affect auxin transport in Arabidopsis. Plant Physiology 156: 585–595. Lee H, OK Chah, and J Sheen (2011) Stem-cell-triggered immunity through CLV3p-FLS2 signalling. Nature 473: 376–U559. Leibfried A, JPC To, W Busch, S Stehling, A Kehle, M Demar, JJ Kieber, and JU Lohmann (2005) WUSCHEL controls meristem function by direct regulation of cytokinin-inducible response regulators. Nature 438: 1172–1175. Libault M, A Farmer, T Joshi, K Takahashi, RJ Langley, LD Franklin, J He, D Xu, G May, and G Stacey (2010) An integrated transcriptome atlas of the crop model Glycine max, and its use in comparative analyses in plants. The Plant Journal 63: 86–99. Libault M, S Thibivilliers, DD Bilgin, O Radwan, M Benitez, SJ Clough, and G Stacey (2008) Identification of four soybean reference genes for gene expression normalization. Plant Genome 1: 44–54. Mao C, W Ding, Y Wu, J Yu, X He, H Shou, and P Wu (2007) Overex- pression of a NAC-domain protein promotes shoot branching in rice. New Phytologist 176: 288–298. Mathesius U, MA Djordjevic, M Oakes, N Goffard, F Haerizadeh, GF Weiller, MB Singh, and PL Bhalla (2011) Comparative proteomic profiles of the soybean (Glycine max) root apex and differentiated root zone. Proteomics 11: 1707–1719. Miyazawa H, E Oka-Kira, N Sato, H Takahashi, GJ Wu, S Sato, M Hayashi, S Betsuyaku, M Nakazono, S Tabata, et al. (2010) The receptor-like kinase KLAVIER mediates systemic regulation of nodu- lation and non-symbiotic shoot development in Lotus japonicus. De- velopment 137: 4317–4325. Ohtani M, N Nishikubo, B Xu, M Yamaguchi, N Mitsuda, N Goué, F Shi, M Ohme-Takagi, and T Demura (2011) A NAC domain protein fam- 192 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) ily contributing to the regulation of wood formation in poplar. The Plant Journal 67: 499–512. Okamuro JK, B Caster, R Villarroel, M VanMontagu, and KD Jofuku (1997) The AP2 domain of APETALA2 defines a large new fam- ily of DNA binding proteins in Arabidopsis. Proceedings of the Na- tional Academy of Sciences of the United States of America 94: 7076–7081. Ozsolak F, AR Platt, DR Jones, JG Reifenberger, LE Sass, P McInerney, JF Thompson, J Bowers, M Jarosz, and PM Milos (2009) Direct RNA sequencing. Nature 461: 814–873. Ramakers C, JM Ruijter, RHL Deprez, and AFM Moorman (2003) As- sumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neuroscience Letters 339: 62–66. Reid DE, S Hayashi, M Lorenc, J Stiller, D Edwards, PM Gresshoff, and BJ Ferguson (2012) Identification of systemic responses in soybean nodulation by xylem sap feeding and complete transcriptome se- quencing reveal a novel component of the autoregulation pathway. Plant Biotechnology Journal 10: 680–689. Rushton PJ, IE Somssich, P Ringler, and QJ Shen (2010) WRKY transcrip- tion factors. Trends in Plant Science 15: 247–258. Schoof H, M Lenhard, A Haecker, KFX Mayer, G Jürgens, and T Laux (2000) The stem cell population of Arabidopsis shoot meristems is maintained by a regulatory loop between the CLAVATA and WUS- CHEL genes. Cell 100: 635–644. Searle IR, AE Men, TS Laniya, DM Buzas, I Iturbe-Ormaetxe, BJ Carroll, and PM Gresshoff (2003) Long-distance signaling in nodulation di- rected by a CLAVATA1-like receptor kinase. Science 299: 109–112. Sharma VK, C Carles, and JC Fletcher (2003) Maintenance of stem cell populations in plants. Proceedings of the National Academy of Sci- ences of the United States of America 100: 11823–11829. Shiu SH, WM Karlowski, R Pan, YH Tzeng, KFX Mayer, and WH Li (2004) Comparative analysis of the receptor-like kinase family in Arabidopsis and rice. Plant Cell 16: 1220–1234. Souer E, A Van Houwelingen, D Kloos, J Mol, and R Koes (1996) The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell 85: 159–170. Stahl Y and R Simon (2010) Plant primary meristems: shared functions and regulatory mechanisms. Current Opinion in Plant Biology 10: 53–58. Stracke R, H Ishihara, GHA Barsch, F Mehrtens, K Niehaus, and B Weis- shaar (2007) Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. Plant Journal 50: 660–677. Thimm O, O Bläsing, Y Gibon, A Nagel, S Meyer, P Krüger, J Selbig, LA Müller, SY Rhee, and M Stitt (2004) Mapman: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. The Plant Journal 37: 914–939. Torii KU, N Mitsukawa, T Oosumi, Y Matsuura, P Yokoyama, RF Whittier, and Y Komeda (1996) The Arabidopsis ERECTA gene encodes a putative receptor protein kinase with extracellular leucine-rich re- peats. The Plant Cell 8: 735–746. Traas J and O Hamant (2009) From genes to shape: Understanding the control of morphogenesis at the shoot meristem in higher plants using systems biology. Comptes Rendus Biologies 332: 974–985. Uchida N, M Shimada, and M Tasaka (2013) ERECTA-family receptor kinases regulate stem-cell homeostasis via buffering its cytokinin re- sponsiveness in the shoot apical meristem. Plant and Cell Physiology 54 (3): 343–351. Wang Xe, BMVS Basnayake, H Zhang, G Li, W Li, N Virk, T Mengiste, and F Song (2009) The Arabidopsis ATAF1, a NAC transcription factor, is a negative regulator of defense responses against necro- trophic fungal and bacterial pathogens. Molecular Plant-Microbe Interactions 22: 1227–1238. Winkel-Shirley B (2001) Flavonoid Biosynthesis. A Colorful Model for Genetics, Biochemistry, Cell Biology, and Biotechnology. Plant Physi- ology 126: 485–493. Xie Q, G Frugis, D Colgan, and NH Chua (2000) Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes & Development 14: 3024–3036. Yadav RK, M Perales, J Gruel, T Girke, H Jönsson, GV Reddy (2011) WUSCHEL protein movement mediates stem cell homeostasis in the Arabidopsis shoot apex. Genes & Development 25: 2025–2030. Yant L, J Mathieu, TT Dinh, F Ott, C Lanz, H Wollmann, X Chen, and M Schmid (2010) Orchestration of the floral transition and floral development in Arabidopsis by the bifunctional transcription factor APETALA2. The Plant Cell Online 22: 2156–2170. 193 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Mirzaei et al., 2014 - Supplementary Data Gene Name Proportion fold change P-value Putative annotation Protein kinase Glyma13g09870 6.95 0.02 Protein kinase superfamily protein Glyma13g09810 6.08 0.015 Protein kinase superfamily protein Glyma11g00320 4.55 0.041 Leucine-rich repeat (LRR) family protein Glyma20g27480 3.76 0.0009794 Cysteine-rich RLK (RECEPTOR-like protein kinase) 29 Transcription factor Glyma05g31800 271.42 0.004925 WRKY DNA-binding protein 51 Glyma08g15050 41.48 0.002085 WRKY DNA-binding protein 51 Glyma15g00570 9.28 0.0004699 WRKY DNA-binding protein 40 Glyma18g44030 9.02 0.029 WRKY DNA-binding protein 33 Glyma05g36970 5.07 0.016 WRKY family transcription factor Glyma09g00820 3.66 0.005466 WRKY family transcription factor Glyma09g41050 3.45 0.001657 WRKY DNA-binding protein 70 Glyma08g23380 3.35 0.041 WRKY DNA-binding protein 40 Glyma19g43420 4.11 0.049 bZIP transcription factor family protein Glyma03g40730 3.14 0.039 bZIP transcription factor family protein Glyma11g11790 -2.08 0.032 Basic-leucine zipper (bZIP) transcription factor family protein Glyma05g35050 19.91 0.043 myb domain protein 116 Glyma10g00930 18.05 0.014 myb domain protein 15 Glyma16g02570 8.04 0.00002565 myb domain protein 111 Glyma10g32410 7.53 0.003432 myb domain protein 15 Glyma02g00820 5.33 0.025 myb domain protein 15 Glyma20g35180 3.08 0.01 myb domain protein 15 Glyma16g04740 6.30 0.038 NAC domain containing protein 47 Glyma02g26480 2.10 0.027 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein Glyma08g47240 -13.65 0.029 AP2/B3-like transcriptional factor family protein Glyma18g38490 -4.65 0.033 AP2/B3-like transcriptional factor family protein Glyma18g43750 -2.28 0.022 Integrase-type DNA-binding superfamily protein Glyma13g31010 -2.05 0.0002355 ERF domain protein 12 Glyma12g12600 5.20 0.018 RING membrane-anchor 1 Table S1. A representative list of the genes that were differentially transcribed in the shoot tip of S562L compared with those of the wild type. Light green and light pink represent the most up-regulated and down-regulated gene in each category respectively. Grey shows genes that were differentially-expressed in both the shoot and root tip. 194 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S1. Continued. Protein binding Glyma14g07410 73.64 0.007283 Calcium-dependent lipid-binding (CaLB domain) family protein Glyma06g44870 30.02 0.019 Ankyrin repeat family protein Glyma02g41540 22.40 0.044 Calcium-dependent lipid-binding (CaLB domain) family protein Glyma03g16600 6.20 0.0008464 Glutathione S-transferase TAU 8 Glyma11g00320 4.55 0.041 Leucine-rich repeat (LRR) family protein Glyma16g25080 3.68 0.037 Disease resistance protein (TIR-NBS-LRR class), putative Glyma08g08360 3.24 0.045 Polygalacturonase inhibiting protein 1 Glyma10g33650 3.13 0.0008941 Glutathione S-transferase TAU 15 Glyma01g26220 2.66 0.0000691 Glutathione S-transferase TAU 8 Glyma15g40190 2.33 0.029 Glutathione S-transferase TAU 19 Glyma06g40710 2.22 0.047 Disease resistance protein (TIR-NBS-LRR class), putative Glyma11g33760 2.18 0.043 Calcium-dependent lipid-binding (CaLB domain) family protein Glyma15g03160 -2.06 0.035 Alfin-like 5 Glyma08g44960 -3.39 0.006228 Proteasome activating protein 200 Glyma07g04820 -3.75 0.002134 Chaperone DnaJ-domain superfamily protein Defense and stress response Glyma09g04520 46.20 9.26E-09 Pathogenesis-related protein Bet v I family Glyma07g37280 33.05 0.033 MLP-like protein 423 Glyma15g15600 28.99 0.006306 Pathogenesis-related protein Bet v I family Glyma15g15590 15.76 3.558E-10 MLP-like protein 423 Glyma17g03340 10.33 3.268E-11 MLP-like protein 423 Glyma07g37270 8.05 1.355E-09 MLP-like protein 423 Glyma09g04510 4.41 4.124E-10 MLP-like protein 423 Glyma07g37240 4.08 0 MLP-like protein 423 Glyma17g03350 3.87 0.000003783 MLP-like protein 423 Glyma03g41390 6.36 0.006478 Senescence-associated gene 21 Glyma20g23090 3.86 0.00249 Adenine nucleotide alpha hydrolases-like superfamily protein Glyma10g02210 3.01 0.006941 Senescence-associated gene 21 Glyma04g01130 -2.36 0.000005269 Cold-regulated 47 195 Catalytic activity Glyma11g31310 7.52 0.019 AMP-dependent synthetase and ligase family protein Glyma09g40580 7.20 0.034 NAD(P)-binding Rossmann-fold superfamily protein Glyma08g37670 6.66 0.013 Deoxyxylulose-5-phosphate synthase Glyma01g44270 6.39 0.002263 4-coumarate:CoA ligase 3 Glyma04g11250 5.96 0.047 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein Glyma01g43460 5.38 0.033 Highly ABA-induced PP2C gene 3 Glyma04g13880 4.97 0.004299 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein Glyma18g45260 4.29 0.00007771 NAD(P)-binding Rossmann-fold superfamily protein Glyma06g05280 3.25 0.013 Branched-chain amino acid transaminase 2 Glyma03g19810 2.81 0.032 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein Glyma08g42070 2.23 0.029 ATP-dependent caseinolytic (Clp) protease/crotonase family protein Glyma13g44950 2.22 0.049 4-coumarate:CoA ligase 2 Glyma07g36770 -2.95 0.039 Enoyl-CoA hydratase/isomerase A Table S1. Continued. A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) 196 Table S2. A representative list of genes that were differentially transcribed in the root tip of S562L compared with that of the wild type. Light green and light pink represent the most up-regulated and down-regulated gene in each category respectively. Grey indicates genes that were differentially-expressed in both the shoot and root tip. A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Gene Name Proportions fold change P-value Putative annotation Receptor kinase & signalling Glyma20g23890 7.67 0.00000151 ACT-like protein tyrosine kinase family protein Glyma08g23340 4.64 0.018 CBL-interacting protein kinase 5 Glyma09g33650 4.57 0 Phosphoenolpyruvate carboxykinase 1 Glyma08g25600 4.41 0.023 Leucine-rich repeat transmembrane protein kinase Glyma02g46670 3.24 0.021 Protein kinase superfamily protein Glyma01g02330 3.04 0.0000316 Phosphoenolpyruvate carboxykinase 1 Glyma13g38170 2.93 0.022 Receptor-like protein kinase-related family protein Glyma17g05660 2.69 0.037 Protein kinase superfamily protein Glyma09g41340 2.64 0.0005498 SOS3-interacting protein 1 Glyma01g37100 2.45 0.05 Calcium-dependent protein kinase 28 Glyma12g07770 2.31 0.025 Mitogen-activated protein kinase 3 Glyma02g02790 2.17 0.004924 Disease resistance protein (TIR-NBS-LRR class) family Glyma16g06940 2.07 0.044 Leucine-rich repeat receptor-like protein kinase family protein Glyma10g30710 -2.15 0.003837 Leucine-rich receptor-like protein kinase family protein Glyma06g06550 -2.23 0.013 CBL-interacting protein kinase 25 Glyma11g00320 2.48 0.046 Leucine-rich repeat (LRR) family protein Glyma08g04390 -2.12 0.00277 Leucine-rich repeat (LRR) family protein Glyma15g26790 -2.72 0.0002545 polygalacturonase inhibiting protein 1 197 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Transcription factor Glyma19g40470 6.61 0.028 WRKY DNA-binding protein 35 Glyma01g31920 6.40 0.012 WRKY DNA-binding protein 33 Glyma01g43420 6.11 0.00856 WRKY family transcription factor Glyma08g02580 5.14 0.004004 WRKY family transcription factor Glyma03g05220 4.90 0.007609 WRKY DNA-binding protein 33 Glyma05g36970 3.37 0.009669 WRKY family transcription factor Glyma15g00570 3.33 0.002048 WRKY DNA-binding protein 40 Glyma17g15480 2.96 0.023 Ethylene responsive element binding factor 1 Glyma10g34760 2.65 0.036 AP2/B3 transcription factor family protein Glyma17g15460 2.07 0.007356 Ethylene responsive element binding factor 5 Glyma14g09320 2.06 0.032 Related to AP2 1 Glyma15g16260 -2.26 0.025 Ethylene-responsive element binding protein Glyma17g33060 -2.89 0.001162 Integrase-type DNA-binding superfamily protein Glyma19g27790 -2.89 0.0004498 Integrase-type DNA-binding superfamily protein Glyma03g26450 -4.71 0.02 Ethylene-responsive element binding factor 13 Glyma19g43420 5.27 0.0000127 bZIP transcription factor family protein Glyma03g40730 2.46 0.002065 bZIP transcription factor family protein Glyma06g38410 8.29 0.038 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein Glyma07g35630 4.58 0.00009966 NAC-like, activated by AP3/PI Glyma01g06150 4.20 0.024 NAC-like, activated by AP3/PI Glyma16g04740 4.06 0.004638 NAC domain containing protein 47 Glyma13g35550 3.87 0.0002846 NAC domain containing protein 3 Glyma17g23740 3.42 0.044 NAC domain containing protein 83 Glyma03g34110 7.83 0.045 myb domain protein 68 Glyma09g03690 5.65 0.022 myb domain protein 78 Glyma02g00820 3.45 0.02 myb domain protein 15 Glyma09g37340 -2.27 0.009459 myb domain protein 30 Glyma06g05300 7.16 0.009363 CCCH-type zinc finger family protein Glyma04g05290 6.90 0.0000799 CCCH-type zinc finger family protein Glyma12g12600 3.11 1.516E-07 RING membrane-anchor 1 Glyma10g29750 3.09 0.004816 RING/U-box superfamily protein Glyma03g37740 3.07 0.039 RING/FYVE/PHD zinc finger superfamily protein Glyma05g36110 3.00 0.039 CCCH-type zinc finger family protein Glyma08g03540 2.97 0.036 CCCH-type zinc finger family protein Glyma11g36040 2.39 0.03 RING-H2 finger A2A Glyma07g24480 8.51 0.007142 GDP dissociation inhibitor family protein / Rab GTPase activator family protein Glyma01g39260 3.29 0.008994 Heat shock factor 4 Glyma20g32050 -2.02 0.00006938 GATA transcription factor 9 Glyma02g06560 5.44 0.032 Homeobox protein 40 Table S2. Continued. 198 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S2. Continued. Protein binding Glyma10g43670 9.06 0.034 F-box family protein Glyma16g32230 7.46 0.028 Phloem protein 2-A13 Glyma02g04420 4.95 0.028 Octicosapeptide/Phox/Bem1p family protein Glyma06g17910 4.56 0.000001083 SNF1-related protein kinase regulatory subunit gamma 1 Glyma13g44260 4.03 0.019 Cystathionine beta-synthase (CBS) protein Glyma11g33760 3.33 0.0002613 Calcium-dependent lipid-binding (CaLB domain) family protein Glyma01g03150 3.29 0.01 Octicosapeptide/Phox/Bem1p family protein Glyma05g28820 2.95 0.04 Galactose oxidase/kelch repeat superfamily protein Glyma01g42420 2.57 0.031 Phospholipase D beta 1 Glyma13g09290 2.53 0.008898 RNI-like superfamily protein Glyma08g10890 2.38 0.018 Galactose oxidase/kelch repeat superfamily protein Glyma15g01610 2.38 0.002209 Galactose oxidase/kelch repeat superfamily protein Glyma08g23540 2.26 0.001665 Chaperone DnaJ-domain superfamily protein Glyma10g33650 2.17 0.00002115 Glutathione S-transferase TAU 15 Glyma18g01140 2.15 0.008673 Galactose oxidase/kelch repeat superfamily protein Glyma04g37140 2.04 0.033 SNF1-related protein kinase regulatory subunit gamma 1 Glyma08g04390 -2.12 0.00277 Leucine-rich repeat (LRR) family protein Glyma19g24640 -2.39 0.011 Galactose oxidase/kelch repeat superfamily protein Glyma09g15600 -2.39 0.05 CCCH-type zinc finger protein with ARM repeat domain Glyma16g06690 -2.81 0.002079 Galactose oxidase/kelch repeat superfamily protein Glyma08g44960 -2.82 0.0002941 Proteasome activating protein 200 Defense and stress response Glyma02g03680 7.10 0.00001028 MLP-like protein 423 Glyma15g15590 5.84 0.021 MLP-like protein 423 Glyma07g37280 5.28 0.00628 MLP-like protein 423 Glyma17g03330 4.55 0.026 MLP-like protein 423 Glyma20g23090 2.34 0.02 Adenine nucleotide alpha hydrolases-like superfamily protein Glyma06g16810 2.23 0.00000118 Scorpion toxin-like knottin superfamily protein Glyma15g13870 2.04 0.019 Catalytic activity Glyma06g45950 31.05 0.00003716 Isocitrate lyase Glyma06g05280 4.69 1.221E-14 Branched-chain amino acid transaminase 2 Glyma04g05190 4.34 1.416E-08 Branched-chain amino acid transaminase 2 Glyma03g40720 3.05 0.004779 GDP-D-mannose 3\',5\'-epimerase Glyma06g41520 3.03 0.017 NAD(P)-binding Rossmann-fold superfamily protein Glyma20g28320 2.90 4.441E-16 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein Glyma13g01420 2.89 0.04 Trehalose phosphatase/synthase 11 Glyma06g19590 2.70 0.018 Trehalose-phosphatase/synthase 9 Glyma18g12660 2.41 0.009343 Rhamnose biosynthesis 1 Glyma11g31310 2.35 0.003131 AMP-dependent synthetase and ligase family protein Glyma03g19810 2.11 0.002617 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein Glyma09g05590 -2.01 0.009678 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein Glyma15g16850 -2.35 0.015 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 199 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S3. Biological categories that are regulated in the S562L shoot tip in comparison to wild type shoot tip as analysed by Mapman (Benjamini Hochberg-corrected; P < 0.05). Bin Name Elements p-value Photosynthesis 1 PS 317 0 1.1 PS.light reaction 220 0 1.1.1 PS.light reaction.photosystem II 98 0 1.1.1.1 PS.light reaction.photosystem II.LHC-II 38 1.46223E-10 1.1.1.2 PS.light reaction.photosystem II.PSII polypeptide subunits 60 1.28332E-06 1.1.2 PS.light reaction.photosystem I 39 1.82784E-07 1.1.2.2 PS.light reaction.photosystem I.PSI polypeptide subunits 31 9.16001E-08 1.1.5 PS.light reaction.other electron carrier (ox/red) 33 0.042731782 Major CHO metabolism 2.1.2 major CHO metabolism.synthesis.starch 56 0.019806396 2.1.2.1 major CHO metabolism.synthesis.starch.AGPase 17 0.011872219 2.1.2.2 major CHO metabolism.synthesis.starch.starch synthase 15 0.015657959 2.2 major CHO metabolism.degradation 147 0.033712098 2.2.1.3 major CHO metabolism.degradation.sucrose.invertases 37 0.028318178 2.2.1.3.2 major CHO metabolism.degradation.sucrose.invertases.cell wall 22 0.000328236 2.2.1.3.3 major CHO metabolism.degradation.sucrose.invertases.vacuolar 7 0.007550217 2.2.2 major CHO metabolism.degradation.starch 58 0.043862952 2.2.2.1 major CHO metabolism.degradation.starch.starch cleavage 26 0.021405036 Minor CHO metabolism 3.1 minor CHO metabolism.raffinose family 19 0.014279496 3.1.2 minor CHO metabolism.raffinose family.raffinose synthases 12 0.003851643 3.1.2.2 minor CHO metabolism.raffinose family.raffinose synthases.putative 12 0.003851643 3.2.2 minor CHO metabolism.trehalose.TPP 22 0.033634009 3.4.3 minor CHO metabolism.myo-inositol.InsP Synthases 4 0.040258978 Cell wall 10 cell wall 875 9.90407E-06 10.5.3 cell wall.cell wall proteins.LRR 22 0.020416261 10.7 cell wall.modification 153 0.009841828 10.8 cell wall.pectin*esterases 153 0.006763777 10.8.1 cell wall.pectin*esterases.PME 130 0.027926432 Lipid metabolism 11.9.3.4 lipid metabolism.lipid degradation.lysophospholipases.phospholipase A2 6 0.021694885 Amino acid metabolism 13.1.3.6 amino acid metabolism.synthesis.aspartate family.misc 11 0.015036573 13.1.3.6.1 amino acid metabolism.synthesis.aspartate family.misc.homoserine 11 0.015036573 13.1.3.6.1.1 amino acid metabolism.synthesis.aspartate family.misc.homoserine.aspartate kinase 8 0.015473113 S- assimilation 14.2 S-assimilation.APR 3 0.048354292 200 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S3. Continued. Secondary metabolism 16 secondary metabolism 761 2.10308E-09 16.1 secondary metabolism.isoprenoids 192 0.009275191 16.1.3 secondary metabolism.isoprenoids.tocopherol biosynthesis 24 0.000171833 16.1.3.2 secondary metabolism.isoprenoids.tocopherol biosynthesis.homogentisate phytyltransferase 12 0.003851643 16.2 secondary metabolism.phenylpropanoids 261 6.13238E-05 16.2.1 secondary metabolism.phenylpropanoids.lignin biosynthesis 118 5.45265E-07 16.2.1.1 secondary metabolism.phenylpropanoids.lignin biosynthesis.PAL 8 0.000396601 16.2.1.3 secondary metabolism.phenylpropanoids.lignin biosynthesis.4CL 31 0.011872219 16.2.1.6 secondary metabolism.phenylpropanoids.lignin biosynthesis.CCoAOMT 15 0.036064324 16.8 secondary metabolism.flavonoids 155 6.45017E-07 16.8.2 secondary metabolism.flavonoids.chalcones 26 2.09935E-08 16.8.5 secondary metabolism.flavonoids.isoflavonols 22 0.000638941 Hormone metabolism 17 hormone metabolism 1302 2.80432E-08 17.5 hormone metabolism.ethylene 430 1.19416E-05 17.5.2 hormone metabolism.ethylene.signal transduction 178 0.000622743 17.6 hormone metabolism.gibberelin 101 0.009275191 17.7 hormone metabolism.jasmonate 72 0.00068077 17.7.1 hormone metabolism.jasmonate.synthesis-degradation 70 0.000507643 17.7.1.2 hormone metabolism.jasmonate.synthesis-degradation.lipoxygenase 45 0.009861992 17.7.1.5 hormone metabolism.jasmonate.synthesis-degradation.12-Oxo-PDA- reductase 12 0.014129403 Stress 20 stress 1776 7.21114E-07 20.1 stress.biotic 979 0 20.1.7 stress.biotic.PR-proteins 711 0 20.2 stress.abiotic 775 0.013788265 20.2.1 stress.abiotic.heat 375 5.46072E-10 Redox regulation 21 redox.regulation 405 0.005916683 21.4 redox.glutaredoxins 89 0.029935211 Polyamine metabolism 22.2 polyamine metabolism.degradation 4 0.021694885 22.2.1 polyamine metabolism.degradation.polyamin oxidase 4 0.021694885 Nucleotide metabolism 23 nucleotide metabolism 269 0.007504987 23.1 nucleotide metabolism.synthesis 66 0.000192645 23.1.1 nucleotide metabolism.synthesis.pyrimidine 26 0.009342322 23.1.1.1 nucleotide metabolism.synthesis.pyrimidine.carbamoyl phosphate synthetase 7 0.041272522 23.1.2 nucleotide metabolism.synthesis.purine 28 0.025728984 Biodegradation of Xenobiotics 24.2 Biodegradation of Xenobiotics.lactoylglutathione lyase 27 0.048107793 201 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) RNA 27 RNA 6310 1.69051E-36 27.1 RNA.processing 582 4.64734E-33 27.1.1 RNA.processing.splicing 101 5.37497E-06 27.1.2 RNA.processing.RNA helicase 73 3.60128E-12 27.2 RNA.transcription 232 0.00022923 27.3 RNA.regulation of transcription 5289 9.85113E-13 27.3.25 RNA.regulation of transcription.MYB domain transcription factor family 667 1.55764E-11 27.3.32 RNA.regulation of transcription.WRKY domain transcription factor family 174 0 27.3.44 RNA.regulation of transcription.Chromatin Remodeling Factors 102 3.61765E-06 27.3.50 RNA.regulation of transcription.General Transcription 60 8.02228E-05 27.3.52 RNA.regulation of transcription.Global transcription factor group 29 0.015473113 27.3.54 RNA.regulation of transcription.Histone acetyltransferases 24 0.013788265 27.3.57 RNA.regulation of transcription.JUMONJI family 32 0.014129403 27.3.63 RNA.regulation of transcription.PHD finger transcription factor 39 0.009861992 27.3.64 RNA.regulation of transcription.PHOR1 39 1.17597E-06 27.3.67 RNA.regulation of transcription.putative transcription regulator 397 1.95682E-11 27.3.69 RNA.regulation of transcription.SET-domain transcriptional regulator family 77 0.033634009 27.3.99 RNA.regulation of transcription. unclassified 621 2.00383E-06 27.4 RNA.RNA binding 267 1.14682E-12 DNA 28 DNA 939 4.19444E-18 28.1 DNA.synthesis/chromatin structure 567 8.43108E-16 28.1.3 DNA.synthesis/chromatin structure. histone 71 4.61178E-08 28.2 DNA repair 116 0.000367641 Protein 29 protein 6420 2.50503E-26 29.1 protein.aa activation 135 2.80432E-08 29.1.30 protein.aa activation.pseudouridylate synthase 24 0.022243842 29.2 protein.synthesis 976 3.46656E-17 29.2.1 protein.synthesis.ribosomal protein 670 0.001970238 29.2.1.1.1.1 protein.synthesis.ribosomal protein.prokaryotic.chloroplast.30S subunit 31 0.009275191 29.2.1.2 protein.synthesis.ribosomal protein.eukaryotic 428 0.000668567 29.2.1.2.1 protein.synthesis.ribosomal protein.eukaryotic.40S subunit 163 0.006166941 29.2.2 protein.synthesis.misc ribososomal protein 22 0.007251695 29.2.2.50 protein.synthesis.misc ribososomal protein.BRIX 11 0.007550217 29.2.3 protein.synthesis.initiation 184 7.66744E-16 29.2.4 protein.synthesis.elongation 66 0.004180482 29.2.99 protein.synthesis.misc 12 0.037356552 29.3 protein.targeting 490 1.60382E-08 29.3.1 protein.targeting.nucleus 98 1.60564E-08 29.3.3 protein.targeting.chloroplast 66 0.022901299 29.3.4.2 protein.targeting.secretory pathway.golgi 24 0.019980876 29.4.1 protein.postranslational modification.kinase 550 1.31382E-07 29.4.1.57 protein.postranslational modification.kinase.receptor like cytoplasmatic kinase VII 515 2.97425E-07 29.5 protein.degradation 2751 0.000556946 29.5.11 protein.degradation.ubiquitin 1824 0.000367641 29.5.11.5 protein.degradation.ubiquitin.ubiquitin protease 72 4.92242E-08 29.5.11.20 protein.degradation.ubiquitin.proteasom 151 2.00383E-06 Table S3. Continued. 202 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S3. Continued. Signalling 30 signalling 2836 0 30.1 signalling.in sugar and nutrient physiology 98 0.037356552 30.2 signalling.receptor kinases 1307 0 30.2.11 signalling.receptor kinases.leucine rich repeat XI 365 2.49818E-07 30.2.17 signalling.receptor kinases.DUF 26 554 0 30.2.24 signalling.receptor kinases.S-locus glycoprotein like 66 0.000142501 30.2.25 signalling.receptor kinases.wall associated kinase 39 0.028132661 30.2.99 signalling.receptor kinases.misc 219 7.58628E-06 30.3 signalling.calcium 496 1.02576E-07 30.5 signalling.G-proteins 482 0.004180482 Cell 31.1 cell.organisation 843 0.008218999 31.2 cell.division 161 0.001000067 Development 33.1 development.storage proteins 89 1.26332E-05 Transport 34.3 transport.amino acids 180 0.002846344 34.9 transport.metabolite transporters at the mitochondrial membrane 141 0.015657959 34.19 transport.Major Intrinsic Proteins 96 9.49911E-05 34.19.2 transport.Major Intrinsic Proteins.TIP 37 0.000233643 34.22 transport.cyclic nucleotide or calcium regulated channels 41 0.003764466 34.99 transport.misc 639 1.5495E-18 203 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S4. Biological categories that are regulated in the S562L root tip in comparison to wild type root tip as analysed by Mapman (Ben- jamini Hochberg-corrected; P < 0.05). Bin name elements p-value Photosynthesis 1 PS 317 2.23E-06 1.1 PS.light reaction 220 1.56E-08 1.1.1 PS.light reaction.photosystem II 98 1.88E-06 1.1.1.1 PS.light reaction.photosystem II.LHC-II 38 4.79E-04 1.1.1.2 PS.light reaction.photosystem II.PSII polypeptide subunits 60 0.006735025 1.1.2 PS.light reaction.photosystem I 39 7.10E-04 1.1.2.2 PS.light reaction.photosystem I.PSI polypeptide subunits 31 5.16E-05 Fermentation 5.2 fermentation. PDC 8 0.01995843 Cell wall 10 cell wall 875 0.001131608 10.6 cell wall degradation 254 0.004153439 Lipid metabolism 11.9 lipid metabolism.l ipid degradation 271 0.0015716 11.9.2 lipid metabolism.lipid degradation.l ipases 113 0.00294316 11.9.2.1 lipid metabolism.lipid degradation.lipases.triacylglycerol lipase 89 0.038454121 Amino acid metabolism 13.2 amino acid metabolism.degradation 156 0.018542453 13.2.3 amino acid metabolism.degradation.aspartate family 45 0.046371554 13.2.4 amino acid metabolism.degradation.branched chain group 31 0.002102358 Secondary metabolism 16 secondary metabolism 761 0.034592476 16.2.1 secondary metabolism.phenylpropanoids.lignin biosynthesis 118 0.005204386 16.2.1.1 secondary metabolism.phenylpropanoids.lignin biosynthesis.PAL 8 0.014817383 16.2.1.3 secondary metabolism.phenylpropanoids.lignin biosynthesis.4CL 31 0.014331695 16.8 secondary metabolism.flavonoids 155 0.011867805 16.8.2 secondary metabolism.flavonoids.chalcones 26 0.001215041 Hormone metabolism 17 hormone metabolism 1302 0.004747464 17.2.2 hormone metabolism.auxin.signal transduction 54 0.021272135 17.5.2 hormone metabolism.ethylene.signal transduction 178 0.04073287 17.7 hormone metabolism.jasmonate 72 0.033698515 Stress 20.1 stress.biotic 979 0.025578528 20.1.7.6 stress.biotic.PR-proteins.proteinase inhibitors 34 0.002102358 20.2 stress.abiotic 775 0.002668161 20.2.1 stress.abiotic.heat 375 5.16E-05 20.2.3 stress.abiotic.drought/salt 129 0.033698515 204 A tla s Jo ur na l o f Bi ol og y - IS SN 2 15 8- 91 51 . P ub lis he d By A tla s Pu bl ish in g, L P (w w w .a tla s- pu bl ish in g. or g) Table S4. Continued. Redox regulation 21.4 redox.glutaredoxins 89 0.033698515 Nucleotide metabolism 23.1.2 nucleotide metabolism.synthesis.purine 28 0.034892781 23.1.2.1 nucleotide metabolism.synthesis.purine.amidophosphoribosyltransferase 5 0.021645967 Misc 26.2 misc.UDP glucosyl and glucoronyl transferases 502 0.011867805 26.1 misc.cytochrome P450 398 0.007547013 26.12 misc.peroxidases 185 2.37E-05 RNA 27 RNA 6310 7.58E-05 27.3 RNA.regulation of transcription 5289 0.014817383 27.3.4 RNA.regulation of transcription.ARF, Auxin Response Factor family 57 0.002008989 27.3.14 RNA.regulation of transcription.CCAAT box binding factor family, HAP2 21 0.008713324 27.3.30 RNA.regulation of transcription.Trihelix, Triple-Helix transcription factor family 64 0.008713324 27.3.32 RNA.regulation of transcription.WRKY domain transcription factor family 174 4.18E-11 27.3.64 RNA.regulation of transcription.PHOR1 39 1.05E-04 27.3.80 RNA.regulation of transcription.zf-HD 43 0.002668161 27.3.99 RNA.regulation of transcription.unclassified 621 3.38E-07 DNA 28.1.3 DNA.synthesis/chromatin structure.histone 71 2.24E-08 Protein 29.2 protein.synthesis 976 2.44E-09 29.2.1 protein.synthesis.ribosomal protein 670 0 29.2.1.2 protein.synthesis.ribosomal protein.eukaryotic 428 0 29.2.1.2.1 protein.synthesis.ribosomal protein.eukaryotic.40S subunit 163 1.76E-08 29.2.1.2.2 protein.synthesis.ribosomal protein.eukaryotic.60S subunit 265 3.25E-13 29.2.3 protein.synthesis.initiation 184 0.007187207 29.3 protein.targeting 490 0.00294316 29.3.4 protein.targeting.secretory pathway 237 2.13E-06 29.3.4.2 protein.targeting.secretory pathway.golgi 24 0.001431831 29.5 protein.degradation 2751 0.014770075 29.5.11 protein.degradation.ubiquitin 1824 0.034568824 29.5.11.5 protein.degradation.ubiquitin.ubiquitin protease 72 0.003802264 29.5.11.20 protein.degradation.ubiquitin.proteasom 151 5.16E-05 29.7 protein.glycosylation 58 0.029399721 Signalling 30 signalling 2836 0.008713324 30.2 signalling.receptor kinases 1307 2.24E-08 30.2.17 signalling.receptor kinases.DUF 26 554 2.26E-12 30.2.24 signalling.receptor kinases.S-locus glycoprotein like 66 0.010926445 30.2.25 signalling.receptor kinases.wall associated kinase 39 0.007347366 30.2.99 signalling.receptor kinases.misc 219 0.018034925 Cell 31 cell 1584 6.23E-05 31.4 cell.vesicle transport 336 2.13E-06 Development 33.1 development.storage proteins 89 1.06E-04 Transport 34.19 transport.Major Intrinsic Proteins 96 0.002528114 205