KBM Journal of Biology (2010) 1 (2): 30-33 doi: 10.5147/kbmjb.2010.0008 KB M J ou rn al o f Bi ol og y - IS SN 1 94 8- 58 83 . P ub lis he d By K BM S ci en tifi c Pu bl ish in g, L P (w w w .k bm -s ci en tifi c- pu bl ish in g. or g) Archaeal Diversity in a Municipal Wastewater Sludge Daniel Williams1 and James W. Brown2* 1 Department of Biology, North Carolina Central University, Durham, NC 27707, USA; 2* Department of Mi- crobiology, North Carolina State University, Raleigh, NC 27695, USA Received: September 21, 2010 / Accepted: November 11, 2010 Abstract The diversity of Archaea in a municipal wastewater sludge sample was investigated by amplification of ribosomal RNA genes from sludge DNA using archaeal-specific prim- ers. Surprisingly, a large fraction (32%) of these sequences were from Halobacteriales, not previously seen in surveys of wastewater sludge. Other abundant sequences were from members of uncultivated ‘environmental’ archaeal groups that are commonly detected in sludge and sediment environ- ments. Only a few distant relatives of Methanosarcina (which are commonly thought of as the predominant methanogenic species in sludge environments) were detected. Key Words: Archaea, methanogen, halophile, Euryarchaea, Crenarchaea. Introduction Anaerobic digestion of wastewater sludge involves the con- version of organic carbon compounds into acetate, formate, hy- drogen, and CO2 by a consortium of microorganisms (reviewed in Ferry, 1993). Methanogenic Archaea utilize these substrates to produce methane. Classically, the methanogens attributed to this process are Methanosarcina barkeri and relatives, which can use a relatively wide range of substrates for methanogenesis (reviewed in Whitman et al., 1991). Surveys of archaeal popu- lations in wastewater sludges have generally found primarily Methanomicrobia, including both Methanosarcinales and Metha- nomicrobiales, as well as ‘environmental’ Euryarchaea and Cre- narchaea of unknown phenotypes. As part of an early __________________________________________________ * Corresponding author: james_brown@ncsu.edu comparative analysis of ribonuclease P (RNase P) RNA structure in Archaea, we used DNA isolated from digested anaerobic- sludge from a municipal wastewater cesspool (euphemistically known as ‘lagoon’s) as a source of environmental RNase P RNA gene sequences (Harris et al., 2001). We were surprised that no sequences related to those of Methanosarcina were obtained, knowing that the primers used in the polymerase chain reactions were capable of amplifying the RNase P RNA sequence from at least M. barkeri. We therefore investigated the phylogenetic diversity of Archaea in this environment by analysis of ribosomal RNA sequences amplified from this DNA using archaeal-specific polymerase chain reaction (PCR) primers. Materials and Methods DNA from a sample of anaerobically-digested sludge from the Cary South Municipal Treatment Plant was isolated previously (Harris et al., 2001). Small subunit ribosomal RNA (ssu-rRNA) genes were amplified from this DNA using primers 8FAPL (GGCTGCAGTCTAGATCCGGTTGATCCTGCCGG) and 1492RPL (GGCTCGAGCGGCCGCCCGGGTTACCTTGTTAC- GACTT) (Edwards et al., 1989; Stackebrandt & Liesack, 1993). PCR reactions were performed in buffer containing 50 mM KCl, 10 mM tris(hydroxymethyl)aminomethane hydrochloride (Tris-Cl) (pH 8.3), 1.5 mM each dGTP, dCTP, dATP, and dTTP, 0.05% Non- ident P40, 5% acetamide, and 2mg/ml of each primer. Reac- tions were incubated for an initial 2 min at 94 0C and amplified for 30 cycles at 92 0C for 1.5 min, 55 0C for 1.5 min, 72 0C for 0.5 min followed by a final extension step at 72 0C for 7 min. 30 SHORT COMMUNICATION KB M J ou rn al o f Bi ol og y - IS SN 1 94 8- 58 83 . P ub lis he d By K BM S ci en tifi c Pu bl ish in g, L P (w w w .k bm -s ci en tifi c- pu bl ish in g. or g) KB M J ou rn al o f Bi ol og y - IS SN 1 94 8- 58 83 . P ub lis he d By K BM S ci en tifi c Pu bl ish in g, L P (w w w .k bm -s ci en tifi c- pu bl ish in g. or g) 31 Amplification products were digested with NotI and PstI and separated by agarose gel electrophoresis (3% NuSieve GTG; FMC, Rockland, ME). Gel slices containing ca. 1.5 kbp products were excised, melted at 65 0C, liquified with AgarACE (Promega, Madison, WI), and used directly in ligation reactions containing NotI and PstI-digested pBluescript KS+ DNA (Stratagene, now Agilent Tech., Santa Clara, CA). Ligation reactions were used to transform competent E. coli strain DH5 . Fifty-two clones containing ca. 1.5 kbp insertions were initially assessed from sequence data obtained from either end of each clone. The 35 non-chimeric (identified using CHECK_CHIMERA {Maidak et al., 2000}), full-length archaeal ssu-rRNA clones fell into 13 groups of 99% sequence identity. The complete se- quence of a single representative from each of these 13 groups was determined (accession numbers AF424763 - AF424775). Each sequence was used to search the National Center for Bio- technology Information (NCBI) database for the most similar sequence (and in cases where this was an uncultivated ‘envi- ronmental’ sequence, the most similar sequence from a named, cultivated specie); these sequences were added to an alignment Fig. 1. Phylogenetic analysis of wastewater sludge ssu-rRNA sequences. This tree was constructed by the neighbor-joining method using PHYLIP (Felsenstein, 1989). The alignment contained a representative sampling of sequences from the RDP (Cole et al., 2009) and the sequence most similar to each sludge sequence available in the NCBI/GenBank database (see text). The Escherichia coli and Thermotoga maritima sequences served as outgroup. The percentage of internal branches present in trees from 1000 bootstrap sampling of the alignment are shown above each branch; values below 50% and those not present in the consensus of the bootstrapped trees are not shown. The sludge sequences fell into the same phylogenetic groups in both parsimony and maximum-likelihood analyses (data not shown). α ≥ KB M J ou rn al o f Bi ol og y - IS SN 1 94 8- 58 83 . P ub lis he d By K BM S ci en tifi c Pu bl ish in g, L P (w w w .k bm -s ci en tifi c- pu bl ish in g. or g) 32 of sequences representing the major phylogenetic groups of Ar- chaea extracted from the Ribosomal Database Project (Cole et al., 2009). Phylogenetic analysis of this alignment was per- formed using PHYLIP (http://evolution.genetics.washington.edu/ phylip.html; Felsenstein, 1989) (See Fig. 1). Results and Discussion The archaeal wastewater sludge ssu-rRNA sequences fell into six phylogenetic clusters, five of which are euryarchaeal, the remainder (containing only 2 sequences) crenarchaeal (see Figure). No bacterial, eukaryotic or organellar sequences were obtained. The largest group of sequences (46-1, 39-2, 44A-1, and 69- 1, 13 sequences representing 38% of the total) was related to a large group of ‘environmental’ Euryarchaea known as the ‘Arc1’ group, from which no cultivated species have been identified, and therefore no specific phenotypic data are available (Ch- ouari et al., 2005). However, Arc1-group sequences are com- monly found in surveys of wastewater sludge, sediment, and oth- er methanogenic environments, and the phylogenetic placement of this group suggests that they are methanogenic, most likely utilizing hydrogen and one-carbon compounds (Riviere et al., 2009). Furthermore, members of this group have been shown to grow in the presence of formate or CO2 and hydrogen, although the production of methane specifically by these organisms has not been demonstrated (Chouari et al., 2005). Surprisingly, the next largest cluster of sequences, comprising 32% of the total (eleven 41-1 sequences and a single 38B-1 sequence), was related to alkaliphilic members of the Halobac- teriales (which, despite the name are Archaea rather than Bac- teria). Sequence 41-1 was the most frequent single sequence to occur in the data set. Halobacteriales have not previously been reported in wastewater sludge. Consistent with the iden- tification of these sequences is the observation that aerobic en- richment cultures in media designed for Halobacteria (Ameri- can Type Culture Collection media 974 and 1590, and Luria broth with 4M NaCl prepared using mineral water) grow quickly when inoculated with small amounts of this wastewater sludge. The presence of these organisms in wastewater sludge implies the presence of alkaline hypersaline microenvironments. In this anaerobic environment, it is expected that these organisms are growing photoheterotrophically, as do the purple non-sulfur Al- phaproteobacteria that are well-known inhabitants of wastewa- ter lagoons (see, for example, Do et al., 2003). Sequence 33-1 (4 sequences, 12% of the total) is related to another environmental euryarchaeal group, exemplified by sequence SBAR16, from the Santa Barbara channel (Delong, 1992) and distantly related to the genus Thermoplasma. The phenotypes of this group of organisms are unknown, but they presumable are not methanogenic. No sequences closely related to the genus Methanosarcina were obtained. However, four sequences, in two groups (with each of the four sequences occurring only once in the data set), were members of the Class Methanomicrobia. Clones 61-2 and 120A-4 were members of the Methanosarcinales, but were closely related to the genera Methanothrix and Methanosaeta rather than to Methansarcina. Clones 19-1 and 57-1 were mem- bers of the Methanomicrobiales, and most closely related to environmental clone WCHD3-07 and the genera Methanocul- lex and Methanospirillum. Indeed, the most obvious green auto- flourescent (from methanogenic cofactors F420 (DiMarco et al., 1990)) organisms seen in these sludge samples, and in meso- philic methanogen enrichment cultures from these samples grown using either CO2/H2 or methanol, are morphologically similar to Methanospirillum. These sequences presumably represent the methanogens in the wastewater environment utilizing hydrogen- independent substrates, e.g. methanol and acetate. Sequences 72-1 and 52-2 (2 sequences; 6% of the total) are related to a little-known group of environmental crenarchaeal sequences exemplified by pJP89 from Obsidian Pool, Yellow- stone National Park (Barnes et al., 1994), and most closely re- lated to the presumably mesophilic pGrfC26, from a freshwater lake sediment (Hershberger et al., 1996). The phenotypes of these organisms is not known, but environmental Crenarchaea sequences are commonly found in surveys of wastewater envi- ronments, soils and sediments, and these organisms have been shown to be physically associated with methanogenic Euryar- chaea in sludge environments (Collins et al., 2005). Sequences 72-1 and 52-2 are not related to known ammonia-oxidizing Crenarchaea. This analysis represents a qualitative view of Archaea a very complex and dynamic environment. Nevertheless, the phyloge- netic groups seen in this study, and even their relative propor- tions, are consistent with those seen in a number of molecular phylogenetic analyses of sludge environments (for example, Riv- iere et al., 2009) except for the detection of Halobacteria. The relative abundance of the halobacterial sequences obtained could well reflect bias in the PCR reactions, a well-established is- sue with any PCR-based survey (reviewed in von Wintzingerode, et al., 1997), but the presence of Halobacteria in the original sludge sample, and others taken at the same site over the course of 3 years, was confirmed by their growth in enrichment cultures. What role they play in this ecosystem, and whether their pres- ence is an idiosyncrasy of this site or has been overlooked in other wastewater sites, are not known. Acknowledgments We thank Mary Ellen Woods, Beverly Vucson, Dr. Shermalyn Greene, and Dr. Elizabeth Haas for assistance with this work. This work was supported by the North Carolina Waste Manage- ment Program, the North Carolina Agriculture Foundation, and NIH grant GM52894 to JWB. References Barnes SM, RE Fundyga, MW Jeffries, and NR Pace (1994) Remark- able archaeal diversity detected in a Yellowstone National Park hot spring environment. Proc. Natl. Acad. Sci. USA 91(5):1609-1613. Chouari R, D Le Paslier, P Daegelen, P Ginestet, J Weissenbach, and A. Sghir (2005) Novel predominant archaeal and bacterial groups revealed by molecular analysis of an anaerobic sludge digester. Environ. Microbiol. 7(8):1104-1115. KB M J ou rn al o f Bi ol og y - IS SN 1 94 8- 58 83 . P ub lis he d By K BM S ci en tifi c Pu bl ish in g, L P (w w w .k bm -s ci en tifi c- pu bl ish in g. or g) 33 Cole JR, Q Wang, E Cardenas, J Fish, B Chai, RJ Farris, AS Kulam-Syed- Mohideen, DM McGarrell, T Marsh, GM Garrity, and JM Tiedje (2009) The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37(Database issue): D141-D145. Collins G, L O’Connor, T Mahony, A Gieseke, D de Beer, and V O’Flaherty (2005) Distribution, localization, and phylogeny of abundant popu- lations of Crenarchaeota in anaerobic granular sludge. Applied En- viron. Microbiol. 71(11):7523-7527. Delong EF (1992) Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 89(12):5685-5689. DiMarco AA, TA Bobik, and RS Wolfe (1990) Unusual coenzymes of methanogens. Ann. Rev. Biochemistry 59:355-394. Do YS, TM Schmidt, JA Zahn, ES Boyd, A Mora, and AA DiSpirito (2003) Role of Rhodobacter sp. strain PS9, a purple non-sulfur photosyn- thetic bacterium isolated from an anaerobic swine waste lagoon, in odor remediation. Appl. Environ. Microbiol. 69(3):1710-1720. Edwards U, T Rogall, H Blöcker, M Emde, and EC Böttger (1989) Isola- tion and direct complete nucleotide determination of entire genes: characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res. 17(19):7843–7853. Felsenstein J (1989) PHYLIP - Phylogeny Inference Package (version 3.2). Cladistics 5:164-166. Ferry JG (1993) Methanogenesis. Chapman & Hall. Harris JK, ES Haas, D Williams, DN Frank, and JW Brown (2001) New insight into RNase P RNA structure from comparative analysis of the archaeal RNA. RNA 7(2):220-232. Hershberger KL, SM Barnes, AL Reysenbach, SC Dawson, and NR Pace (1996) Wide diversity of Crenarchaea. Nature 384(6608):420 Maidak BL, JR Cole, CT Parker Jr, GM Garrity, N Larsen, B Li, TG Lilburn, MJ McCaughey, GJ Olsen, R Overbeek, S Pramanik, TM Schmidt, JM Tiedje, and CR Woese (2000) The RDP (Ribosomal Database Proj- ect) continues. Nucleic Acids Res. 28(1):173-174. Riviere D, V Desvignes, E Pelletier, S Chaussonnerie, S Guermazi, J Weissenbach, T Li, P Camacho, and A Sghir (2009) Toward the defi- nition of a core of microorganisms involved in anaerobic digestion of sludge. ISME J. 3:700-714. Stackebrandt E, and W Liesack (1993) Nucleic acids and classification. In: Goodfellow M, AG O’Donnell (ed) Handbook of new bacterial systematics. Academic Press. pp. 152-189. Von Wintzingerode F, UB Göbel, and E Stackebrandt (1997) Deter- mination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol. Rev. 21(3):213-229. Whitman WB, TL Bowen, and DR Boone (1991) The methanogenic bac- teria. In: A. Barlows, HG Truper, M Dworkin, W Harder, KH Schleifer (ed) The prokaryotes. Springer-Verlag. pp 717-768.