bangladesh journal of pharmacology volume: 18; number 1; year 2023 cite this article as: interino jo, alombro nc, de vera pjd. cytotoxic activity of centrosema molle leaf aqueous extracts. bangladesh j pharmacol. 2023; 18: 33-35. cytotoxic activity of centrosema molle leaf aqueous extracts sir, currently, about 39% of the approved drugs by the food and drug administration are of natural origin (boy et al. 2018). the biomedical importance of natural products especially in plants can be attributed to the presence of their diverse secondary metabolites (atanasov et al., 2021). these secondary metabolites play a key role in biological activities, especially in their cytotoxic activity. cytotoxic activity is a critical factor for the success of developing novel drugs from natural products. in drug development, the tolerable level of a cell from natural products should be determined before proceeding to experiments in animal models (bácskay et al., 2018). moreover, the toxicity test serves as a basis for dosage selection that may involve both in vitro and in vivo setups (maheshwari and shaikh, 2016). plants such as iphonia aucheri (shah et al., 2020), cyperus iria (de vera et al., 2022) had shown to have cytotoxic activities. centrosema molle mart. ex benth. is a perennial and a common climbing herb and does not have any recorded folkloric medicinal uses yet but it was noted that it has been utilized by the indigenous people in maguindanao province, philippines in treating wounds. in laos, this weed had been used for treating scorpions and snakebites (chima et al., 2013). in nigeria, the leaves of this plant had been used for treating skin diseases (ariwaodo et al., 2012). in addition, a study had been conducted that shows the potential of this plant for wound-healing activity (ekpo et al., 2011). thus, this plant shows potential for bioactive properties if proven to be non-toxic to cells. this study determined the in vitro cytotoxic activity of c. molle leaf aqueous extract using brine shrimp lethality assay (meyer et al., 1982). this preliminary study will help establish the dosage or concentration that will be used for future studies involving the biological activities of c. molle extract in both in vitro and in vivo setups. this also explores as a potential source of novel drugs in the future. the c. molle plant leaves (1 kg) were collected from pinaring, sultan kudarat, maguindanao, and was authenticated at the biology department of ateneo de davao university, davao city. c. molle extract was prepared by suspending 30 g of c. molle leaf powder in 100 ml of deionized water, then was heated at a 60°c water bath (thermo fisher scientific, usa). the water bath temperature was regularly checked to maintain the desired temperature range. after 1 hour of heating, the suspension was filtered through cheesecloth and placed in a beaker. centrifugation (thermo fisher scientific, usa) at 3,000 rpm for 5 min was done, and the resulting supernatant liquid was placed in a clean amber glass bottle. c. molle extract concentrations were prepared by diluting different amounts of the collected supernatant liquid into different amounts of deionized water to make different concentrations. the presence of secondary metabolites was determined using standard methods by harborne (1993). brine shrimp lethality assay was conducted to determine the cytotoxicity of the different concentrations of c. molle extract. the assay began by transferring three thousand microliters (3000 µl) of the different c. molle extract concentrations and control (artificial seawater) in their respective well using a pasteur pipette. in every microwell, ten brine shrimps were pipetted. after 30  min, 6 hours, and 24 hours of exposure of brine shrimps to the samples and control, the number of them that were alive, impaired, and dead was determined. probit analysis was employed to generate the median lethal concentrations (lc50) value and 95% confidence intervals of each time of exposure of c. molle extract to brine shrimps (finley, 1952). lc50 was obtained using a regression line by plotting the concentration against the percent mortality on a probit scale. percent mortality was calculated using the equation: the presence of different secondary metabolites present in c. molle extract was determined. saponins were found to be absent in the c. molle extract when tested using the froth test (data not shown). on the other hand, carbohydrates, reducing sugar, tannins, flavonoids, and alkaloids were present. the percent mortality rate of the brine shrimps exposed to c. molle extract increased in concentration and time dependent (figure 1). results showed that 10,000 µg/ ml concentration of c. molle extract had the highest percent mortality. analysis of the results also indicated a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 33-35 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v18i1.62627 letter to the editor this work is licensed under a creative commons attribution 4.0 international license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor that the correlation coefficient of the logarithm of the concentration to the percent mortality from brine shrimps was 0.992 for the c. molle extract at 24 hours of exposure. this value meets the required value of >0.99 which is used to indicate an almost perfect correlation and the relationship between the ordinate and axis (akoglu, 2018). thus, increasing the concentration of c. molle extract higher than 10,000 µg/ml might also increase the percent mortality of the brine shrimps. data from the brine shrimp lethality assay (table i) also shows an lc50 of 14,842.9 µg/ml concentration of c. molle extract at 24 hours of exposure. this indicates that a 14,842.9 µg/ml concentration of c. molle extract can kill 50% of the brine shrimps. the lc50 value at 14,842.9 µg/ml concentration of c. molle extract can be the basis for dosage or concentration selection in determining the other biological activities of c. molle extract such as its anti-inflammatory and anti-diabetic activities. the c. molle extract at a concentration of 10,000 µg/ml showed a higher percent mortality rate among the c. molle extract concentrations being tested. data from brine shrimp lethality assay also shows an lc50 of 14,842.9 µg/ml c. molle extract concentration. the correlation coefficient of the logarithm of the c. molle extract concentrations to the percent mortality of the brine shrimps indicated that as the concentration of c. molle extract increases, the percent mortality rate may also increase. thus, this implies that the lc50 value of c. molle extract can be used to establish the dosage or concentration to be tested for future studies that involve c. molle extract’s biological activities such as antiinflammatory and anti-diabetic properties for both in vitro and in vivo setups. jawhar o. interino1, nancy c. alombro1 and peter jan d. de vera 2 1 natural sciences department, notre dame university, cotabato city, philippines; 2 natural sciences department, college of arts and sciences, mindanao state university, maguindanao, dalican, datu odin sinsuat, maguindanao, philippines. corresponding author: email: peterjandevera0302@gmail.com references akoglu h. user’s guide to correlation coefficients. 2018; 18: 9193. ariwaodo jo, chukwuma ec, adeniji ka. some medicinal plant species of asamagbe stream bank vegetation, forestry research institute of nigeria, ibadan. ethnobot res appl. 2014; 10: 541-49. atanasov ag, zotchev sb, dirsch vm, supuran ct. natural products in drug discovery: advances and opportunities. nat rev drug discov. 2021; 20: 200-16. bácskay i, nemes d, fenyvesi f, váradi j, vasvári g, fehér p, vecsernyes m, ujhelyi z. role of cytotoxicity experiments in pharmaceutical development. in: cytotoxicity. london, intech, 2018, pp 131-46. 34 bangladesh j pharmacol 2023; 18: 33-35 figure 1: percent mortality of brine shrimps at a different time of exposure to c. molle leaf aqueous extract table i lc50 of c. molle at different time of exposure length of exposure (hour) lc50 (µg/ml) confidence interval 0.5 62,461.4 23301.9; 167430.2 6 14,882.9 8076.4; 27425.5 24 14,842.9 8076.5; 27308.5 mailto:peterjandevera0302@gmail.com boy hia, rutilla ajh, santos ka, ty amt, yu ai, mahboob t, tangpoong j, nissapatorn v. recommended medicinal plants as source of natural products: a review. digital chinese med. 2018; 1: 131-42. chima ud, ofodile ea, okorie mc. a survey of plants used in the treatment of ante-natal and post-natal disorders in nneochi local government area of abia state, nigeria. greener j biol sci. 2013; 3: 229-37. de vera pjd, tayone jc, de las llagas mcs. cyperus iria linn. roots ethanolic extract: its phytochemicals, cytotoxicity, and anti-inflammatory activity. j taibah univ sci. 2022; 16: 85462. ekpo m, mbagwu h, jackson c, eno m. anti-microbial and wound healing activities of centrosema pubescens (leguminosae). int j curr res. 2011; 1: 1-6. finley dj. probit analysis: a statistical treatment of the sigmoid response curve. cambridge, cambridge university press, 1952. harborne jb. phytochemical methods: a guide to a modern technique in plant analysis. new york, chapman and hall, 1993. maheshwari dg, shaikh nk. an overview on toxicity testing method. int j pharm technol. 2016; 8: 3834-49. meyer bn, ferrigni nr, putnam je, jacobsen lb, nichols de, mclaughlin jl. brine shrimp: a convenient general bioassay for active plant constituents. planta med. 1982; 45: 3134. shah mar, khan ra, ahmed m. anti-diabetic activity of iphiona aucheri leaf extract. bangladesh j pharmacol. 2020; 15: 99-109. bangladesh j pharmacol 2023; 18: 33-35 35 bangladesh journal of pharmacology volume: 1; number 1; year 2006 cite this article as: nahar s. evaluation of medical teachers and traditional teaching in pharmacology. bangladesh j pharmacol. 2006; 1: 33-34. evaluation of medical teachers and traditional teaching in pharmacology sir, medical teaching is a noble profession in the field of medical science. everybody is aware of the fact that health is wealth. people want to live in good health. this can be achieved with the help of service provided by medical practitioners. medical practitioners however can only provide good medical health facilities after passing the full mbbs course and acquiring a registration from bmdc. in western countries, the facilities for medical care are widely available as well as of fine quality. in underdeveloped countries however, the story is quite different. proper facilities are hardly available and the quality is poor and steadily declining. the patients are flying abroad for treatment, the most common destinations being india and singapore. since ‘health for all’ is our slogan, we must rise to take measures against this and ensure that medical health in our country depends solely on the medical practitioners of our country. our doctors acquire their mbbs degree after passing three professional examinations. the full course, along with the training takes six years. a paper has been published in journal of chittagong medical college teachers association (1996; 7: 59-62) from which it is clear that they are hardly interested in acquiring knowledge; rather they are interested in getting their mbbs certificates in the easiest ways possible. simultaneously, the medical teachers are the ones held responsible for producing doctors who prove to be national assets. pharmacology is one of the vital branches of medical science that acknowledges the doctor on how to write out a prescription rational. sadly though, in my lifetime of teaching i have discovered a mere 5% of the students to be interested in pharmacology. the students somehow manage to pass their examinations after which they write out drugs in their prescriptions with help from medical representatives. this leads to me another thoughtwhether it is the students or rather the teachers who are actually responsible for this lack of interest. there must be some lacunae in the teachers. we should try to make pharmacology understandable and interesting too, because whichever field in medical science our students undertake, they will always require some knowledge of pharmacology if they are to fulfill the moral and legal duties they have towards their patients. all in all, i conclude that both students and teachers ought to be evaluated: one by the other. admittedly, it is very difficult to evaluate teachers. i, however, have taken upon the challenge to evaluate teachers with the help of post-graduate medical students. the study was carried out at the department of pharmacology, chittagong medical college during the years 1992, 1993 and 1994. postgraduate students were the subjects, those studying for da, dch and dgo. the total number of students present was 45, out of which only 25 agreed to take part in the survey. six students out of 10 participated in the study carried out in 1992, while 10 out of 15 participated in 1993. in 1994, nine out of 15 were interested. a questionnaire was prepared and supplied to the students each year after they completed their course of pharmacology. after completion of the questionnaires, a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2017; 12: 33-34 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v1i1.485 letter to the editor this work is licensed under a creative commons attribution 4.0 international license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor table i evaluation of medical teachers mean scoringa area of valuation 1992 1993 1994 selection of topic 3.5 3.7 4.2 clear audible voice 3.6 4.1 3.8 able to make the subject clear 3.1 3.4 3.3 interest in teaching 4.3 4.4 4.2 modern concept in pharmacology 3.0 3.3 2.8 using audio-visual aids 2.5 3.8 3.3 behavior of the teacher with the student 5.0 4.8 4.8 teacherregular, sincere and punctual 4.8 4.8 5.0 any other comment 2.6 3.6 3.5 abelow average 1; average 2; good 3; very good 4; excellent 5 the data collected was analyzed. the teachers were evaluated on the basis of parameters like, the topics they chose to teach, whether they possessed a clear, audible voice, whether they were capable of clarifying a topic, how interested they were in teaching the students, whether their conceptions of pharmacology were contemporary and whether the teacher was regular, sincere and punctual. shamsun nahar department of pharmacology mymensingh medical college mymensingh, bangladesh. 34 bangladesh j pharmacol 2017; 12: 33-34 dateprinted: this article was downloaded by you on: nov 03, 2017 bangladesh journal of pharmacology volume: 18; number 3; year 2023 cite this article as: maher ra, alombro nc, de vera peter jd. anti-angiogenic activity of centrosema molle leaf aqueous extract. bangladesh j pharmacol. 2023; 18: 116-18. anti-angiogenic activity of centrosema molle leaf aqueous extract sir, angiogenesis is a process in which new blood vessels are formed from pre-existing vessels. this process is a crucial factor associated with tumor growth, progression, and metastasis (teleanu et al., 2019). plants such as teucrium stocksianum (tabassum et al., 2015), gynura segetum (seow et al., 2011), and nelumbo nucifera (lee et al., 2015) have been reported to have anti-angiogenic properties. centrosema molle mart. ex benth (butterfly pea) is a climbing, trailing, and twining perennial plant belonging to the family fabaceae. it has no recorded folkloric medicinal use in the philippines. however, in other countries, this plant has been used for treating snake and scorpion bites and womb cleansing (ariwaodo et al., 2012). several studies had already been conducted regarding the biological activities of this plant, such as cytotoxic (interino et al., 2023) and wound-healing (ekpo et al., 2011) activities. one of the most common and feasible ways of preliminary investigating the anti-angiogenic activity of plant extracts is the chick embryo chorioallantoic membrane (cam) assay. this assay enables the researchers to study the angiogenic effect and metastasis of plant extracts. this in vivo model is a relatively simple and low-cost and quick estimation of anti-angiogenic potential. moreover, this assay does not require the approval of any institutional animal research ethics committee. through this assay, the anti-angiogenic activity of the plant extract to be tested was established by counting the disrupted blood vessels around the disc that were submerged in the plant extract (ribatti, 2014). the present study determined the anti-angiogenic activity of the c. molle leaf aqueous extract through cam assay and hopefully will contribute to the discovery and development of new anti-cancer molecules and drugs in the future. prior to the collection of the c. molle leaves for aqueous extraction, plant samples were first sent for authentication to the biology department of ateneo de davao university, davao city. after authentication, plant leaf samples were collected from pinaring, sultan kudarat, maguindanao del norte, bangsamoro autonomous region in muslim mindanao. aqueous extraction of c. molle leaf was done by pulverizing the dried leaf samples and 30 g of it was suspended in 100 ml of deionized water. the solution was heated at 60°c using a water bath and was regularly monitored to obtain the appropriate temperature. filtration of the heated solution using cheesecloth was done after 1 hour of heating and was centrifuged at 3,000 rpm for 5 min. the obtained supernatant liquid was kept in a clean amber glass bottle. serial dilution was done to prepare the different concentrations (5, 250, 500, 750, and 1000 µg/ml) of c. molle aqueous extract. the presence of secondary metabolites in the extract was studies by the standard method (harborne, 1993). the cam assay was used to determine the anti-angiogenic activity of the different concentrations of c. molle leaf aqueous extract. the method was described elsewhere (chen et al., 2013). a four-day-old 63 fertilized chicken eggs were bought from a nearby hatchery. these fertilized eggs were sprayed with 70% ethanol to prevent any contamination. incubation was done at 37° c and moisture of about 60%-70% was provided. incubation was done in 5 days. the experiment was done in three replicates and in three trials. distilled water was used as negative control while retinoic acid for positive control. perforation of eggs was done carefully to avoid possible contamination. perforated windows in the eggs were as small as 2 cm and this was done by removing the outer and inner covering of the egg at the air-space location. then, perforated windows were covered with decontaminated parafilm and incubated. after the 6th day of incubation, perforated windows of incubated eggs were opened and a sterile filter paper disc which was initially soaked with the different concentrations of the c. molle leaf aqueous extract, positive and negative controls were placed at the junction of two large blood vessels of the cam using sterile forceps. the treated eggs were covered with decontaminated parafilm and were re-incubated for 24 hours. the sealed windows were unlocked during the 7th day of incubation. the embryos were sacrificed and the cams were harvested by removing the hard shell and were placed on a petri dish. the cam at the site of application of the filter disc was examined. any changes such as inhibition of blood vessel formation were noted in terms of their number and were compared with the eggs treated with negative a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 116-118 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v18i3.67311 letter to the editor this work is licensed under a creative commons attribution 4.0 international license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor and positive controls. the number of cam vessel branch points at the area of the filter paper disc was counted. inhibition of angiogenesis by the extracts would result in the absence or lack of new blood vessel formation. the number of branch points was noted by counting all the intersections of branching blood vessels. table i showed the results of phytochemical screening. alkaloids, carbohydrates, flavonoids, reducing sugar, and tannins were found to be present in the c. molle leaf aqueous extract while saponins were found to be absent. cam assay tested c. molle leaf aqueous extract concentrations (5, 250, 500, 750, and 1000 µg/ml) for antiangiogenic activity and was compared against the positive and negative controls. results showed that all the concentrations of c. molle leaf aqueous extract except 50 µg/ml were able to inhibit the branching points of blood vessels in cam during the experiment (figure 1). the negative control (distilled water) yielded the highest branching points while no branching points were noted in the eggs treated with positive control (retinoic acid). the calculated ic50 for the c. molle leaf aqueous extract concentrations tested in this study is 79.17 µg/ml. the results of this study may indicate the potential of the c. molle leaf aqueous extract concentrations’ anti-angiogenic activity. several studies had already indicated the anti-angiogenic potential of some secondary metabolites present in plant extracts that may interfere with angiogenesis and may affect the branching of blood vessels (dai et al. 2015). thus, future studies identifying bioactive and isolating bioactive compounds present in the c. molle leaf aqueous extract concentration are recommended to determine their respective contribution to the antiangiogenic activity. since this study is only limited to the branching points of blood vessels in the cam, it is also recommended that in future studies, other parameters in the cam assay such as the diameter and roughness of blood vessels should be considered. financial support: self-funded conflict of interest: the authors declare that they have no conflict of interest. rawan a. maher1, nancy c. alombro1 and peter jan d. de vera2 1 natural sciences department, notre dame university, cotabato city, philippines; 2 natural sciences department, college of arts and sciences, mindanao state university – maguindanao, dalican, datu odin sinsuat, maguindanao del norte, bangsamoro autonomous region in muslim mindanao (barmm), philippines. corresponding author: email: peterjandevera0302@gmail.com references ariwaodo jo, chukwuma ec, adeniji ka. some medicinal plant species of asamagbe stream bank vegetation, forestry bangladesh j pharmacol 2023; 18: 116-118 117 figure 1: anti-angiogenic effects of different c. molle leaf aqueous extract using cam assay (n = 63) table i phytochemical screening of c. molle leaf aqueous extract phytochemicals types of test results alkaloids dragendorff’s and mayer’s + carbohydrates molisch’s + flavonoids wilstatter + reducing sugar benedict’s + saponins froth tannins ferric chloride + n u m b e r o f b ra n c h in g p o in ts 100 80 60 40 20 0 negative control positive control 50 250 500 750 1000 µg/ml y = -10.444x + 57.498 r 2 = 0.44 mailto:mohanrajupu62@gmail.com mailto:peterjandevera0302@gmail.com research institute of nigeria, ibadan. ethnobot res appl. 2012; 10: 541-49. chen z, wen z, bai x. in vivo chick chorioallantoic membrane (cam) angiogenesis assays. bio protoc. 2013; 13: e913. dai xy, yu ym, kong zf, cao ys, huang dd, hu xr, huang za, xie yy, zhang s. tectorigenin inhibits caco-2 human colon cells via nf-κb pathway suppression. bangladesh j pharamacol. 2015; 10: 948-55. ekpo m, mbagwu h, jackson c, eno m. anti-microbial and wound healing activities of centrosema pubescens (leguminosae). int j curr res. 2011; 1: 1-6. harborne jb. phytochemical methods: a guide to a modern technique in plant analysis. new york, chapman and hall, 1993. interino jo, alombro nc, de vera pjd. cytotoxic activity of centrosema molle leaf aqueous extracts. bangladesh j pharamacol. 2023; 18: 33-35. lee js, shukla s, kim ja, kim m. anti-angiogenic effect of nelumbo nucifera leaf extracts in human umbilical vein endothelial cells with antioxidant potential. plos one. 2015; 10: e0118552. ribatti d. the chick embryo chorioallantoic membrane as a model for tumor biology. exp. cell. res. 2014; 328: 314-24. seow lj, beh hk, majid am, murugaiyah v, ismail n, asmawi mz. anti-angiogenic activity of gynura segetum leaf extracts and its fractions. j ethnopharmacol. 2011; 134: 22127. tabassum n, alamgeer, aziz a, ahmad b. evaluation of pharmacological effect of teucrium stocksianum extract on angiogenesis using chorioallantoic membrane assay. bangladesh j pharamacol. 2015; 11: 621-27. teleanu ri, chircov c, grumezescu am, teleanu dm. tumor angiogenesis and anti-angiogenic strategies for cancer treatment. j clin med. 2019; 9: 1-21. 118 bangladesh j pharmacol 2023; 18: 116-118 bangladesh journal of pharmacology volume: 18; number 3; year 2023 cite this article as: ayyakkannu p, yahyah s, packirisamy m, paranthaman sr. anti-cancer effect of naringin in human lung carcinoma cell line. bangladesh j pharmacol. 2023; 18: 113-15. anti-cancer effect of naringin in human lung carcinoma cell line sir, lung cancer is the most common cancer and the leading cause of cancer death in men. the use of chemotherapeutic agents and/or ionizing radiation (combination therapy) is the major choice to treat cancer. currently, cisplatin has been the cornerstone of most combination regimens in advanced non-small cell lung cancer. taxanes, gemcitabine, topotecan, and berberine are some of the compounds that have been used to treat lung cancer (bao and chan, 2011). naringin, a flavonoid, is present in the citrus fruits. it has the inhibitory potential against numerous cancer types, including breast, lungs, liver, prostate, pancreatic, brain, throat, skin, colorectal, bladder, and mammary carcinosarcoma cancer both in vivo and in vitro. naringin alone or in combination with other polyphenols, were proven to have efficacy and safety for cancer patients (rauf et al., 2022). the effect of naringin is not studied with respect to dna fragmentation. to delineate the biological hallmarks of apoptosis, a dna fragmentation assay is performed. also pro-apoptotic and anti-apoptotic proteins’ expression pattern are analyzed in the present study on a549 lung cancer cell lines in vitro. the sources of chemicals are as follows: 3-(4,5-dimethyl -thiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt), naringin, dulbecco’s modified eagle medium (dmem) and dmso were purchased from sigma-aldrich (usa). all the chemicals used were of the highest grade commercially available. all the plastic wares were of cell culture grade and obtained from spl, korea. lung cancer (a549) cell line was obtained from national centre for cell science, india. the cells were grown in t25 culture flasks containing dmem supplemented with 1 mm sodium bicarbonate, 10% heat-inactivated fetal bovine serum (fbs) and 1% antibiotics. the cells were maintained in a humidified incubator at 37°c with 5% co2. cell proliferation of a549 cancer cell line was assessed using mtt. cells were seeded at density of 2.5 × 104 cells per well in a 24-well plate, incubated overnight at 37°c in a 5% co2 incubator and treated with various concentrations of naringin (5, 10, 25, 50, 75, 100, 125, 150, 200 and 250 µm) or vehicle alone (dmso) for 24 hours. after treatment, mtt solution (5 mg/ml in 1x pbs) was added followed by incubation for 3 hours at 37°c in the dark. the formazan crystals formed were solubilized by incubating cells with 500 μl of dmso. cell absorbance was read by an elisa reader at 550 nm (sirios, seac radim group, italy). the growth inhibition was determined by the formula (rubinstein et al., 1990): growth inhibition (%)=control od sample od/control od× 100 percentage inhibitions were calculated and plotted against the concentrations and used to calculate the ic50 values for dna fragmentation assay dna was isolated with little modification following dna extraction protocol (rogakou et al., 2000). briefly, untreated and naringintreated a549 cells incubated for 24 hours were harvested and were lysed with cell lysis buffer for 30 sec at room temperature. the supernatant was collected after centrifugation at 3,000 rpm for 5 min followed by incubation at 56°c for 2 hours after adding 10% sds solution and rnase a. proteinase k (25 mg/ml) was added and incubated overnight till complete lysis at 37° c. after adding saturated nacl and absolute ethanol to the samples, the mixture was incubated at -80°c for precipitation. centrifugation for 20 min at 12,000 rpm followed by washing the white pellet with 80% ice cold ethanol and air-dried at room temperature. the obtained pellets were dissolved in 1x te buffer. the total dna solutions were then subjected to 1.5% agarose gel electrophoresis at 100 v for 45 min at room temperature. then, the gel was stained with ethidium bromide and viewed under uv-transilluminator (uvp white/ultra violet transilluminator, usa) and photographed. for reverse transcriptase-polymerase chain reaction (rt -pcr), total rna was isolated from cells using total rna isolation reagent from invitrogen. the concentration and purity of rna were determined spectrophotometrically at a260/280 nm. a ratio of absorbance of >1.8 was considered as good quality rna. total rna was used for the synthesis of complementary dna (cdna). the specific oligonucleotide primers were used for the generation of complementary dnas (table i). statistical analysis was performed using one-way a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 113-115 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v18i3.46647 letter to the editor this work is licensed under a creative commons attribution 4.0 international license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor analysis of variance (anova) followed by duncan’s multiple range test for post hoc comparison by spss software version 16. statistical significance was set at p<0.05. all the data that were collected from at least three individual experiments were presented as mean ± sd. in order to assess the potential antiproliferative activity of naringin on a549 cancer cells, mtt assay was conducted. the antiproliferative effect of naringin was found to be doseand time-dependent (figure 1). the treatment with different doses of naringin (5 µm 250 µm) exhibited inhibition of cell proliferation. besides, the ic50 value was found to be 150 µm at 24 hours. the apoptotic effect of naringin on cancer a549 lung cancer cell lines was investigated by qualitative and quantitative analyses of dna fragmentation, one of the key biochemical hallmarks of apoptosis (hanahan and weinberg, 2011). as shown in figure 2 naringin induced dna fragmentation on lung cancer cell lines. the expression patterns of six genes viz. bax, bclxl, bcl2, bad, fasl and faddr were analyzed with cyc-a as an internal control. naringin significantly down-regulated the expression of anti-apoptotic bclxl and bcl2. conversely, the expression of pro-apoptotic bax, bad, fasl, bclxl and faddr were up-regulated (figure 3). the expression of bax was significantly increased on treatment with naringin by two fold and six fold at 100 µm and 150 µm concentrations of naringin, respectively (figure 3a). likewise, the expression of bad was significantly increased on treatment with naringin by 5.7 fold and 11.2 fold when compared to control at 100 µm and 150 µm concentrations of naringin, respectively (figure 3d). similarly, the expression of fasl (figure 3e) and faddr (figure 3d) were significantly increased on treatment with naringin by 10.7 fold and 5.1 fold, respectively at 100 µm concentrations. in contrast, the expression of bclxl was significantly decreased on treatment with naringin by 0.69 fold at 100 µm concentration (figure 3b). the expression of bcl2 was decreased significantly on treatment by 0.17 fold at 150 µm concentrations of naringin (figure 3c). from these results, it can be implied that naringin exhibits strong anti-cancer properties by inhibiting cell proliferation and inducing programmed cell death through intrinsic and extrinsic pathways of apoptosis. taken together, it seems that naringin has the potential to be a promising anti-cancer agent for treating lung cancer. financial support: self-funded ethical issue: the development, acquisition, authentication, cryopreservation, and transfer of cell lines between labora114 bangladesh j pharmacol 2023; 18: 113-115 table i reverse transcriptase-polymerase chain reaction and primer sequences gene primer sequence (5’→3’) product/ amplicon size bad fcctcaggcctatgcaaaaag raaacccaaaacttccgatgg 120 bp bax fgctggacattggacttcctc rctcagcccatcttcttccag 168 bp bcl-xl fggctgggatacttttgtgga raagagtgagcccagcagaac 131 bp bcl2 fttgttcaaacgggattcaca rgagcaagtgcagccacaata 176 bp faddr fagatgaacctggtggctgac raggacgcttcggaggtagat 120 bp fasl fccatgtgaagagggagaagc raagacagtcccccttgaggt 146 bp cyc-a f gtggtgtttggcaaagtgaa r -tcgagttgtccacagtcagc 116 bp 120 100 80 60 40 20 0 % c e ll v ia b il it y control + naringin (µm) 10 25 50 75 100 125 150 175 200 250 figure 1: growth inhibitory effect of naringin on a549 cell proliferation. incubation time was 24 hours. each value is expressed as mean ± sd from minimum of three independent experiments 4 kbp 3 kbp 2 kbp 1 kbp 500 bp 250 bp l1 l2 l3 l4 figure 2: effect of naringin on dna fragmentation in control and naringin-treated a549 cells. lane 1: 1 kb dna ladder; lane 2: control a549 dna; lane 3: a549 cells treated with 100 µm of naringin; lane 4: a549 cells treated with 150 µm of naringin tories were followed according to the guidelines published in british journal of cancer, 2014. conflict of interest: the authors declare that they have no conflict of interest. acknowledgment: we greatly thank department of genetics, dr. alm p-g institute of basic medical sciences, university of madras, taramani campus, chennai 600113, tamil nadu, india for extending the instrumentation facility to carry out this research work. purushothaman ayyakkannu1, showket yahyah2, meenatchi packirisamy2, subramanian rajasekaran paranthaman1 1 department of biochemistry and microbiology, peri college of arts and science (affiliated to university of madras), peri knowledge park, chennai 600048, tamil nadu, india; 2 department of biochemistry, mohamed sathak college of arts and science (affiliated to university of madras), chennai 600119, tamil nadu, india. corresponding author: email: purushothamanbiochem@gmail.com references bao r, chan p. novel compounds in the treatment of lung cancer: current and developing therapeutic agents. j exp pharmacol. 2011: 16: 21-34. hanahan d and weinberg ra. hallmarks of cancer: the next generation. cell 2011; 144: 646-74. rauf a, shariati ma, imran m, bashir k, khan sa, mitra s, emran tb, badalova k, uddin ms, mubarak ms, aljohani asm, alhumaydhi fa, derkho m, korpayev s, zengin g. comprehensive review on naringenin and naringin polyphenols as a potent anticancer agent. environ sci pollut res int. 2022; 29: 31025-41. rogakou ep, nieves-neira w, boon c, pommier y, bonner wm. initiation of dna fragmentation during apoptosis induces phosphorylation of h2ax histone at serine 139. j biol chem. 2000; 275: 9390-95. rubinstein lv, shoemaker rh, paull kd, simon rm, tosini s, skehan p, et al. comparison of in vitro anticancer-drugscreening data generated with a tetrazolium assay versus a protein assay against a diverse panel of human tumor cell lines. natl cancer inst. 1990; 82: 111-16. figure 3: effect of different concentrations of naringin (100 and 150 µm) on expression of bax (a), bclxl (b), bcl2 ©, bad (d), fasl (e), and faddr (f); statistical significance ap<0.05, bp<0.01 a a a a b b b b b b b a b c d e f bangladesh j pharmacol 2023; 18: 113-115 115 mailto:mohanrajupu62@gmail.com mailto:purushothamanbiochem@gmail.com introduction endophyte, an important member of plant microbial community, has been shown to be a prolific producer of bioactive secondary metabolites (zhang et al., 2006). as we know, medicinal plants have been used for centuries as remedies to treat human diseases. a great number of valuable therapeutic agents from medicinal plants had been isolated and identified from their derived endophytic microbes, such as taxol, camptothecin, vinblastine (zhang et al., 2014). therefore, chemical investigation of medicinal plant-derived endophyte not only contributes to the protection of plant resources, but also provides an alternative way to look for natural leading compounds and/or sustainably supply natural medicines. edgeworthia chrysantha lindl. (e. papyrifera s. et z., thymelaeaceae), widely distributed in eastern asia, is used to make paper in korea and japan. its alabastrum is the succedaneum of traditional chinese medicine “buddleja officinalis maxim (chinese name: mi meng hua)” used to treat swelling of eye, ophthalmalgia, delacrimation, nephelium of eye and nocturnal emission (baba et al., 1989; hashimoto et al., 1991; baba et al., 1990). pharmacological study showed that e. chrysantha has many biological effects, such as anticoagulated blood, antimicrobial, anti-inflammation and antioxidant activities. however, there is not any report on biology and chemistry of endophytic microbe associated with this plant. in our continuous investigation of functional endophytic fungi from medicinal plants, ten endophytic strains (numbered as 58, 3-11, f, 5-19, d, bz, 3-8, 4-12, b, 28) were isolated from e. chrysantha and evaluation of their antimicrobial activities was carried out in this work. material and methods the healthy plant of e. chrysantha was obtained from zhaohui campus of zhejiang university of technology (hangzhou, china) and used for endophyte isolation within 48 hours after harvest. five testing pathogenic strains, including three human pathogens, escherichia a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 529-532 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract ten fungal strains isolated from edgeworthia chrysantha, one of traditional medicinal plants in china, were evaluated their antimicrobial activities against three human pathogens, escherichia coli, staphyloccocus aureus and candida albicans, and two phytopathogens, rhizoctonia cerealis and colletotrichum gloeosporioides. the results indicated that most ethyl acetate extracts of fermentation broth of these fungal endophytes had stronger antimicrobial activities than their fermentation broth. among these endophytic strains, both fermentation broth and the ethyl acetate extract of strain d showed the strongest inhibitory effects on all pathogens. strains 5-19 and bz also exhibited potent antibacterial activities. however, other strains had weak or no antimicrobial effect. this was the first report on the isolation and antimicrobial effects of endophytic fungi from e. chrysantha. article info received: 3 may 2015 accepted: 17 may 2015 available online: 1 july 2015 doi: 10.3329/bjp.v10i3.23575 cite this article: zhang h, ruan c, bai x. isolation and antimicrobial effects of endophytic fungi from edgeworthia chrysantha. bangladesh j pharmacol. 2015; 10: 529 -32. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. isolation and antimicrobial effects of endophytic fungi from edgeworthia chrysantha huawei zhang1, chuanfeng ruan1 and xuelian bai2 1school of pharmaceutical sciences, zhejiang university of technology, hangzhou 310 014, p. r. china; 2college of life and environmental sciences, hangzhou normal university, 310 036, p. r. china. coli, staphyloccocus aureus, candida albicans, and two phytopathogens, rhizoctonia cerealis, colletotrichum gloeosporioides, were purchased from china center for type culture collection. all chemicals used in this project were of analytical grade. isolation of endophytic strain: endophytic fungal strains from e. chrysantha were isolated according to our reported procedure (zhang et al., 2012). all these fungal strains were transferred into potato dextrose agar slants followed by storing at 4ºc. preparation of fermentation broth and its ethyl acetate extract: each fungal strain was cultured on potato dextrose agar at 28ºc for 7 days. then a balanced amount of fungal colony was transferred to culture broth in a 500 ml erlenmeyer flask, which contained 200 ml sterilized potato dextrose broth, followed by shaking at 150 rpm for 15 days at 28ºc. after fermentation, the mycelium and the culture broth were separated by centrifugation at 4,500 rpm for 15 min at 4ºc. about 2 ml fermentation broth of each endophytic fungus was filtered with a bacterial filter (0.22 µm) and preserved at 4ºc until antimicrobial assay. the residual fermentation broth was extracted twice with 400 ml ethyl acetate (merck). then the upper solvent was evaporated at 25ºc in vacuum to yield the ethyl acetate extract, which possibly had antimicrobial secondary metabolites. each afforded extract was kept in a vacuum drier for 3 days and dissolved in dimethyl sulfoxide (dmso, merck) before bioassay. the final concentration of each ethyl acetate extract had two levels, including 1, 10 mg/ml. antibacterial test: the antibacterial activity was carried out using disc diffusion method (taylora et al., 1995). e. coli and s. aureus were separately transferred into two 500-ml erlenmeyer flasks, which contained 200 ml sterilized nutrition agar, and incubated at 37ºc on a rotary shaker at 150 rpm for 24 hours. firstly, 5 ml melt water agar medium was evenly poured into petri dishes (ф = 9 cm). next, 200 µl seed liquid was added to fresh nutrition agar medium and mix well. thirdly, the same amount of fresh nutrition agar medium was poured on the solidified water agar medium and the testing plate with double medium for bioassay was prepared. after 5 holes (ф = 6 mm) were equidistantly drilled on inoculated media, a piece of standard sterile filter paper (ф = 6 mm) was put in one hole followed by adding 100 μl fermentation broth or ethyl acetate extract of endophytic fungal strain. ampicillin sodium (30 µg/ disk, amresco) was used as the positive control while dmso and sterilized water were the negative controls. then the plates were incubated at 37ºc for 48 hours. all tests were performed in triplicate and the anti-bacterial activity was expressed as the average value of inhibition diameters (mm). antifungal test: the antifungal assay was also carried out using disc diffusion method. three fungal blocks of c. albicans, r. cerealis and c. gloeosporioides were separately transferred into three 500-ml erlenmeyer flasks, each flask had 200 ml sterilized potato dextrose broth. the seed liquid was prepared after incubation at 28ºc on a rotary shaker at 150 rpm for 3 days. the testing plate with double medium for bioassay was made using the same approach described above. amphotericin b (30 µg/disk, sigma-aldrich) was used as the positive control and the pure dmso or sterilized water was the negative control. the diameter of inhibition zone (in mm) was measured to assess anti-fungal activity. all tests were carried out in triplicate. results a total of 10 endophytic fungi were isolated from the healthy e. chrysantha, which were numbered as 58, 3-11, f, 5-19, d, bz, 3-8, 4-12, b, 28. as shown in tables i and ii, the ethyl acetate extracts of endophytic fungi and their fermentation broth had different inhibitory effect on pathogenic microbes, including e. coli, s. aureus, c. albicans, r. cerealis and c. gloeosporioides. generally, their antibacterial ability was better than their antifungal. moreover, the inhibitory effects of their ethyl acetate extracts were stronger than those of fermentation broth. the higher concentration (10 mg/ml) of ethyl acetate extract had more potent antimicrobial activity than the low (1 mg/ml). discussion during the long co-evolution of endophytes and their host plants, endophytes have adapted themselves to their special microenvironments by genetic variation, including uptake of some plant dna into their own genomes (germaine et al., 2004). this could have led to the ability of certain endophytic microbes to biosynthesize some ‘phytochemicals’ originally from their host plants (zhang et al., 2014). a growing evidence suggests that endophytic microbes are widely distributed in plants on the earth and have abundant biodiversity. numerous chemical investigations indicate that endophyte is one of rich sources of bioactive natural products. these functional compounds would effectively accelerate new drug discovery and contribute to the development of natural products chemistry. in the present work, ten fungal strains (coded as 58, 311, f, 5-19, d, bz, 3-8, 4-12, b, 28) were characterized from e. chrysantha. bioassay results showed that both fermentation broth and its ethyl acetate extract of strain d exhibited the strongest inhibitory effects on all test pathogens. strains 5-19, d, 3-8, b and 28 had inhibitory effects on at least three pathogens. strains 5-19, d and bz had the strongest activities against e. coli and s. aureus at the concentration of 10 mg/ml, which inhibi530 bangladesh j pharmacol 2015; 10: 529-532 tion zones were respectively as much as 20, 20, 22, 25, 33, 30 mm. it also suggested that strains 5-19, d and bz were the best biocontrol candidates. preliminary identification showed that 5-19 and d respectively belonged to fusarium, aspergillus genus and had potential application in medicine and pesticide industry. this was the first report on isolation and evaluation of antimicrobial effect of endophytic fungi from e. chrysantha. acknowledgments financial supports from the natural science foundation of zhejiang province of china (q14c200005) and huahai students innovation program (2014) from zhejiang university of technology were gratefully appreciated. table i antimicrobial activities of ethyl acetate extracts of endophytic fungi from edgeworthia chrysantha antimicrobial effecta strain no. concentration e. coli s. aurius c. albicans r. cerealis c. gloeosporioides 58 1 ++ 10 +++ 3-11 1 + 10 ++ + f 1 ++ + 10 ++++ +++ 5-19 1 + 10 +++ ++++ +++ + d 1 ++ +++ ++ +++ 10 +++ ++++ + +++ ++++ bz 1 + 10 +++ ++++ 3-8 1 10 + + ++ 4-12 1 10 + + b 1 + 10 + ++++ 1 + 10 ++ + ++ ampicillin 30 µg/disk +++ ++++ amphotericin b 30 µg/disk ++++ ++++ ++++ dmso 28 aexpressed by the diameter of inhibition zones: -, no inhibition; +, <10 mm; ++,10-15 mm; +++, 16–20 mm; ++++, >20 mm table ii antimicrobial effects of the fermentation broth of endophytic fungi from edgeworthia chrysantha antimicrobial effecta concentration e. coli s. aurius c. albicans r. cerealis c. gloeosporioides 58 3-11 f 5-19 ++++ +++ d ++ ++ ++ bz ++++ 3-8 + 4-12 + b 28 ++ ampicillin ++++ ++++ amphotericin b ++++ ++++ ++++ dmso aexpressed by the diameter of inhibition zones: -, no inhibition; +, <10 mm; ++,10-15 mm; +++, 16–20 mm; ++++, >20 mm bangladesh j pharmacol 2015; 10: 529-532 531 author info huawei zhang (principal contact) e-mail: hwzhang@zjut.edu.cn references baba k, tabata y, taniguti m, kozawa m. coumarins from edgeworthia chrysantha. phytochemistry 1989; 28: 221-25. baba k, taniguti m, yoneda y, kozawa m. coumarin glycosides from edgeworthia chrysantha. phytochemistry 1990; 29: 247-49. germaine k, keogh e, garcia-cabellos g, borremans b, lelie d, barac t, oeyen l, vangronsveld j, moore fp, moore erb, campbell cd, ryan d, dowling dn. colonisation of poplar trees by gfp expressing bacterial endophytes. fems microbiol ecol. 2004; 48: 109-18. hashimoto t, tori m, asakawa y. piscicidal sterol acylglucosides from edgeworthia chrysantha. phytochemistry 1991; 30: 2927-31. taylora rs, manandharb np, towers ghn. screening of selected medicinal plants of nepal for antimicrobial activities. j ethnopharmacol. 1995; 46: 153-59. zhang hw, bai xl, wu bx. evaluation of anti-microbial activities of extracts of endophytic fungi from artemisia annua linn. bangladesh j pharmacol. 2012; 7: 249-57. zhang hw, song yc, tan rx. biology and chemistry of endophytes. nat prod rep. 2006; 23: 753-71. zhang hw, ying c, bai xl. advancement in endophytic microbes from medicinal plants. int j pharm sci res. 2014; 5: 1589-600. 532 bangladesh j pharmacol 2015; 10: 529-532 introduction: material and methods: c if: antimicrobial effect: acknowledgments: dateprinted: this article was downloaded by you on: jul 26, 2015 bangladesh journal of pharmacology research article evaluation of antileishmanial activity evaluation of antileishmanial activity evaluation of antileishmanial activity of plants used in indian traditional of plants used in indian traditional of plants used in indian traditional medicinemedicinemedicine bjp introduction leishmaniasis is a current public health concern and is among the five parasitic diseases of high social impact world-wide (de albuquerque melo et al., 2014). despite the existence of several antileishmanial drugs including pentavalent antimonials, amphotericin b and pentamidine, none is fully effective due to toxicity, variable efficacy, long-term parenteral administration and emergence of drug resistance (camacho et al., 2003; croft et al., 2006). the drugs which are effective to some extent are very expensive and are usually unavailable in the endemic areas of the disease. people in rural areas of developing countries have been using traditional medicinal plants as oral decoctions for the treatment of visceral leishmaniasis and the paste form for topical application for curing skin infections like cuta-neous leishmaniasis (chan-bacab and pena rodriguez 2001). in the present study, ten of the traditionally used medicinal plants were selected on the basis of their ethno-botanical reports and were screened for the anti-leishmanial potential against l. donovani promastigotes. materials and methods plant material and preparation of extracts authenticated plants were obtained from y.s. parmar university of horticulture and forestry, nauni, h.p., india. plant parts included in the study were dried under shade and pulverized to yield coarse powder. the powder of each plant was then extracted in methanol using hot soxhlet extraction for 24 hours. the extracts were concentrated under reduced pressure using rotary evaporator and the concentrated extracts were further dried in a desiccator using calcium chloride as desiccant. dried extracts were weighed to obtain the percentage yield and stored in air tight bottles at 4°c until use. parasite stock culture axenic culture of l. donovani (ldmipl-1) was maintained at 25°c in rpmi 1640 (himedia, india) medium supplemented with 10% heat inactivated fetal bovine serum (fbs) (himedia, india), streptomycin (150 μg/ml), penicillin g (100 μg/ml) and gentamycin a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 423-426 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 abstract the present study was aimed at in vitro antileishmanial screening of 10 plants used in the traditional medicine in india. mtt method was used to evaluate the cell death after application of 100, 250, 350 and 500 μg/ml of the methanolic extracts followed by incubation for 24 hours at 25°c. methanolic leaf extracts of acorus calamus, alstonia scholaris and berberis aristata showed significant antileishmanial activity at a concentration of 500 µg/ml. in order to identify the antileishmanial compounds present in the active extracts of the screened plants, an lc-ms analysis of the tested extracts was carried out. the active extracts revealed the presence of some natural products with known antileishmanial activity along with other compounds. the present study suggests that the active plant extracts may be processed to isolate the compounds that may further be screened for their antileishmanial potential. article info received: 25 march 2015 accepted: 2 may 2015 available online: 15 may 2015 doi: 10.3329/bjp.v10i2.22674 cite this article: sidana a, farooq u. evaluation of antileishmanial activity of plants used in indian traditional medicine. bangladesh j pharmacol. 2015; 10: 423-26. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. evaluation of antileishmanial activity of plants used in indian traditional medicine arushdeep sidana and umar farooq molecular and immuno-parasitology laboratory, faculty of biotechnology, shoolini university, solan 173 229, himachal pradesh, india. (150 μg/ml) at ph 7.2. antileishmanial assay for antileishmanial activity, pro-mastigotes of l. donovani were sub-cultured in schneider's insect medium (himedia, india) supplemented with 10% heat inactivated fbs, streptomycin (150 μg/ml), penicillin g (100 μg/ml) and gentamycin (150 μg/ml). the antileishmanial screening was performed in 96-well flat bottom tissue culture plates (corning life sciences, usa). one hundred microliters of cell suspension containing 2 × 106 to 3 × 106 cells/ml was poured in each well of the plate. four different concentrations of the methanolic extracts i.e. 100, 250, 350 and 500 μg/ ml, dissolved in dimethyl sulfoxide (<0.025% v/v), were added to the culture. the plates were then incubated at 25°c for 24 hours. amphotericin b and sodium stibugluconate were used as positive controls and cell suspension with 0.02% dmso was used as a negative control. inhibition of the promastigotes was assessed by measuring the cleavage of 10 mg/ml of mtt [3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyl tetrazolium bromi-de] (mossman, 1983). the absorbance was measured by using elisa plate reader (biotek, usa) at 595 nm. percent growth inhibition was calculated by the following formula: lc-ms analysis of the active extracts the lc-ms analysis was carried out on x-bridge c18 (2.1 x 50 mm, 3.5 μm) column fitted to an lc-ms 6320 ion trap instrument (agilent technologies). a gradient of 50 to 100% acetonitrile in 25 mm ammonium acetate buffer was used as a mobile phase and the flow rate was set at 0.4 ml/min. injection volume was 5 μl. statistical analysis all the assays were performed in triplicate with at least two replicates of each concentration tested. the results were expressed as mean ± standard error of the mean. the statistical analysis of the differences between mean values obtained was done by means of one-way anova using graphpad prism 5.02 software. a value of p<0.05 was considered significant. results a total of ten methanolic extracts of medicinal plants used in traditional medicine in india were evaluated for their antileishmanial potential using mtt reduction assay (table i). methanolic extracts of acorus calamus leaves, alstonia scholaris leaves and berberis aristata leaves showed significant leishmanicidal activity against l. donovani promastigotes. the most active extract was a. scholaris at a concentration of 500 μg/ml. it inhibited 40.3% of l. donovani promastigotes within 24 hours of incubation. the inhibition was concentration dependent as the inhibition increased with the increase in concentration of the extract. leaf extract of b. aristata at a concentration of 500 μg/ml showed 36.2% inhibition whereas a. calamus showed 35.6% inhibition (figure 1). the three active extracts viz. acorus calamus, alstonia scholaris and berberis aristata were subjected to lc-ms analysis so as to identify the antileishmanial compounds present in the extracts. in the case of a. calamus, the major chromatographic peak eluted at 5.7 min and presented a base peak at m/z 210 [m+2]+ in the mass spectrum. the molecular ion peak, however, was detected at m/z 208 [m]+. this molecular weight matched with that of the three major phenyl propanoids namely -, and -asarones (1-3) reported from the plant (figure 2). the chromatogram of a. scholaris revealed the presence of several overlapping peaks attributed to alkaloids. the ms analysis indicated the presence of picrinine (eluted at 6.0 min, m/z 337 [m-1]+, 4) and nareline and/or tetrahydroalstonine (eluted at 424 bangladesh j pharmacol 2015; 10: 423-426 table i details of the plants used for antileishmanial activity evaluation botanical name family local name part used extractive value (%) acorus calamus acoraceae boiye leaf 7.1 alstonia scholaris apocynaceae chitvan leaf 9.4 andrographis paniculata acanthaceae kalmegh stem 11.2 berberis aristata berberidaceae kashmal leaf 10.8 butea monosperma fabaceae palash flower 18.2 eclipta prostrata asteraceae bhringraja whole plant 9.4 gloriosa superba colchicaceae kalihari tuber 2.5 juglans regia juglandaceae akhrot bark 10.9 mesua ferrea calophyllaceae nagkesara flower bud 14.7 tinospora cordifolia menispermaceae guduchi stem 6.4 6.6 min, m/z 351 [m-1]+, 5a/b). the major peak in the chromatogram of b. aristata extract eluted at 4.6 min and presented an [m]+ peak at m/z 336. this molecular weight corresponds to berberine (6), a major compound reported from this plant. epiberberine (7), another compound with similar molecular structure, also corresponds to this molecular weight. a small peak in the chromatogram, eluting at 5.4 min, gave an [m]+ ion at m/z 352 in the mass spectrum. this molecular ion could be attributed to berberastine (8). figure 2 presents the structures of compounds 1-8. discussion out of the ten crude methanolic extracts, three have shown significant leishmanicidal activity by inhibiting 35-40% promastigotes within 24 hours of application. these active extracts were further analysed by lc-ms to determine the presence of various components. the major compounds present in the extract of acorus calamus were isomeric phenyl propanoids (1-3). this is the first report of the antileishmanial activity of this plant. the ethanolic extract of the stem of alstonia scholaris has been previously screened for its antileishmanial activity against some strains of l. donovani (rocha et al., 2005). however, no study so far has reported the antileishmanial activity of the compounds detected in the extract viz. picrinine (4) nareline (5a) and tetrahydro -alstonine (5b). in the case of b. aristata, the chief alkaloid i.e. berberine (6) is used in folk remedies for the treatment of cutaneous leishmaniasis. other structurally related alkaloids have also been found active against leishmania (chan-bacab and penarodriguez, 2001). further studies are required to establish the antileishmanial potential of these compounds. acknowledgement the authors are thankful to the management of shoolini university, solan for providing the required facilities and resources to carry out this research. references camacho mdr, phillipson jd, croft sl, solis pn, marshall sj, ghazanfar sa. screening of plant extracts for antiprotozoal and cytotoxic activities. j ethnopharmacol. 2003; 89: 185-91. chan-bacab mj, peña-rodríguez lm. plant natural products with leishmanicidal activity. nat prod rep. 2001; 18: 674-88. bangladesh j pharmacol 2015; 10: 423-426 425 concentration µg/ml figure 1: percentage inhibition of l. donovani promastigotes in the presence of methanolic leaf extracts of acorus calamus, alstonia scholaris and berberis aristata (100-500 μg/ml). each data value represents mean ± sem of at least three experiments performed in duplicate 100 250 350 500 % in hi bi tio n 50 40 30 20 10 0 acorus alstonia berberis o n + oh o o o 8 o n + o o o 6 o n + o o o 7 oo o o o ooo o 1 2 3 n n ho o o 4 n no oo hn 5b5a o n oh o o h h figure 2: the structures of the compounds present in the active extracts as indicated by lc-ms analysis croft sl, sundar s, fairlamb ah. drug resistance in leishmaniasis. clin microbiol rev. 2006; 19: 111-26. de albuquerque melo gm, silva mc, guimaraes tp, pinheiro km, da matta cb, de queiroz ac, pivatto m, bolzani vda s, alexandre-moreira ms, viegas c jr. leishmanicidal activity of the crude extract, fractions and major piperidine alkaloids from the flowers of senna spectabilis. phytomedicine 2014; 21: 277-81. mossman t. rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. j immunol methods. 1983; 65: 55-63. rocha lg, almeida jrgs, macedo ro, barbosa-filho, jm. a review of natural products with antileishmanial activity. phytomedicine 2005; 12: 514–35. 426 bangladesh j pharmacol 2015; 10: 423-426 author info umar farooq (principal contact) e-mail: ufarooq8@gmail.com mailto:ufarooq8@gmail.com dateprinted: this article was downloaded by you on: aug 28, 2017 bangladesh journal of pharmacology volume: 18; number 2; year 2023 cite this article as: rokkarukala s, chander mp, mohanraju r. gc-ms analysis and antibacterial properties of the selected soft corals from south andaman, india. bangladesh j pharmacol. 2023; 18: 72-74. gc-ms analysis and antibacterial properties of the selected soft corals from south andaman, india sir, marine organisms consist of secondary metabolites that serve as a rich source of naturally occurring, bioactive substances with a variety of structural characteristics. long utilized as sources of various natural chemicals with pharmacological or aesthetic value include a wide range of reef invertebrates, including soft corals (chao et al., 2011). alcyonacean corals are classified under the category octocorallia, which distinguishes these from hexacorallian scleractinia colonies by implying the presence of polyps with eight tentacles. alcyonaceans are huge sessile invertebrates with a distinct stalk and a capitulum, or smooth, mushroom-shaped top. their tissue contains sclerites, which support the colony. octocorals are found in the majority of benthic habitats, where they are influenced by a variety of environmental conditions, demonstrating their adaptability (van de water et al., 2018). sclerite classification has historically been used to identify and categorize the majority of soft coral. there are 35 species of sarcophyton, and six more have been described (benayahu et al., 2009). soft corals are a highly diverse group of marine organisms that contain a rich source of secondary metabolites. due to the lack of efficient physical protection in the highly competitive and hostile marine environment, soft corals majorly depend on their secondary metabolites for survival (shahbudin et al., 2011). the organo-solvent extract produced from various genera of soft corals consists majorly of lipids and sterols, about 90%, and the remaining 10% of the bioactive compounds consists of diterpenes, sesquiterpenes, steroids, terpenoids, and alkaloids (chao et al., 2011). soft corals have recently received attention for their pharmacological potential as antioxidants, anti-microbials, anticancer, and anti-inflammatory proper-ties (gomaa et al., 2016; cooper et al., 2014; marican et al., 2016). andaman and nicobar islands’ marine ecosystem is unique and understudied, and may have a potential source of antimicrobial agents. there are nearly 300 islands rich in coral reefs, dominated by fringing reefs and few barrier reefs, harboring rich diversity of corals and rare marine species (laxmilatha et al., 2021). therefore, it was worthwhile to investigate the antibacterial properties of soft corals against human pathogenic bacteria that often cause infectious diseases. soft corals were collected from burma nallah (lat: 11° 34.298'n, long: 92°44.160'e) by hand-picking method during the inter-tidal survey. specimens were transferred to the laboratory in plastic containers with sufficient seawater. the released mucus attached rock particles, and sand was washed with sterile seawater. the specimen was identified based on the identification key as described by janes (2008). the sample was chopped into small pieces, and 25 g were weighed and soaked in 100 ml of organic solvent methanol and ethyl acetate respectively for 48 hours. the crude extract obtained was subjected to vacuum filtration and the resulting filtrate was concentrated using a rotary evaporator (buchi 2412v0 rii, switzerland). this crude extract was transferred into air-tight bottles and stored at 4°c till further use. the investigation of the antibacterial properties of the crude extracts against 12 human pathogenic bacterial species was performed by the agar well diffusion method (chander et al., 2016). gc-ms analysis of active extracts was carried out on an alglient© 7890, which is employed for the analysis of compounds. the peaks of the compounds representing mass-to-charge ratio characteristics were compared with the nist library to identify the corresponding organic compounds. the results presented in table i revealed that among the three soft coral methanol extracts, sarcophyton trocheliophorum displayed potential antibacterial activity against the tested organisms. the methanol extract of s. trocheliophorum restricted the growth of maximum test pathogens and the highest activity was visualized against vibrio fluvialis (29.7 ± 1.5 mm) followed by escherichia coli (21.3 ± 0.6 mm) and salmonella typhi (15.3 ± 0.6 mm). cladiella pachyclados inhibited seven test pathogens, most active in the case of shigella flexneri (20.3 ± 0.6 mm) followed by e. coli (18.3 ± 1.5 mm) and s. boydii (17.3 ± 1.5 mm). the compounds of sarcophyton ehrenbergi were moderately effective against tested pathogens and the highest activity was found against e. coli (20.0 ± 1.0 mm) followed by s. sonnei (15.7 ± 0.6 mm) and s. typhi (15.0 ± 1.0 mm). s. typhi was found to be sensitive to all the studied soft coral extracts whereas shiga toxin-producin e. coli was found to be resistant to all the extracts. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 72-74 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v18i2.64228 letter to the editor this work is licensed under a creative commons attribution 4.0 international license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor gc–ms analysis of methanol extracts of three soft corals revealed the presence of bioactive compounds (table ii). the most abundant compound was 1hexadecanol, 5,8,11,14-eicosatetraenoic acid, methyl ester, (all-z)-, naphthalene, 1,2,3,4-tetrahydro-1,6-dimethyl-4-(1-methylethyl)-, (1s-cis)-, azuleno[4,5-b]furan -2(3h)-one, 9a-[(acetyloxy)methyl] decahydro-6a,9-dihy -droxy-6-methyl-3-methylene-, γ-linolenic acid, methyl bangladesh j pharmacol 2023; 18: 72-74 73 table i antibacterial activity of methanol crude extracts of soft corals (in mm) s. ehrenbergi c. pachyclados s. trocheliophorum pathogens 50 (µg/ml) 100 (µg/ml) 50 (µg/ml) 100 (µg/ml) 50 (µg/ml) 100 (µg/ml) e. coli 12.3 ± 0.6 20.0 ± 1.0 13.7 ± 1.2 18.3 ± 1.5 15.3 ± 1.5 21.3 ± 0.6 shiga toxin-producing e. coli _ _ _ _ _ _ s. flexneri _ _ 13.3 ± 0.6 20.3 ± 0.6 _ 13.0 ± 0.0 s. dysentery type s _ _ 12.3 ± 0.6 15.7 ± 0.6 10.3 ± 0.6 14.3 ± 1.5 s.boydii _ 12.3 ± 1.5 11.3 ± 1.5 17.3 ± 1.5 _ 11.7 ± 0.6 s. sonnei 11.7 ± 1.2 15.7 ± 0.6 _ 12.7 ± 0.6 _ 12.3 ± 1.2 s. typhi 11.3 ± 0.6 15.0 ± 1.0 14.0 ± 0.0 16.3 ± 0.6 11.3 ± 0.6 15.3 ± 0.6 v. cholera _ _ _ _ _ 13.7 ± 1.2 v. fluvialis _ _ _ _ 20.3 ± 0.6 29.7 ± 1.5 a. hydrophila _ _ 11.7 ± 1.2 13.7 ± 1.2 11.3 ± 1.5 15.0 ± 0.6 table ii compounds identified from the methanol extracts of soft corals by gc-ms analysis species compounds retention time (min) molecular formula molecular weight (g/mol) peak area (%) s. ehrenbergi 1-hexadecanol 31.198 c16h34o 242 15.68 5,8,11,14-eicosatetraenoic acid, methyl ester, (all-z)38.088 c21h34o2 318 8.50 naphthalene, 1,2,3,4-tetrahydro-1,6-dimethyl-4-(1methylethyl)-, (1s-cis) 23.092 c15h22 202 7.35 hexadecanoic acid, methyl ester 31.949 c17h34o2 270 5.84 γ-linolenic acid, methyl ester 34.834 c19h32o2 292 5.84 1-octadecanol 35.053 c18h38o 270 4.51 batilol 45.400 c21h44o3 344 4.03 c. pachyclados 1-hexadecanol 31.013 c16h34o 242 13.46 azuleno[4,5-b]furan-2(3h)-one, 9a-[(acetyloxy)methyl] decahydro-6a,9-dihydroxy-6-methyl-3-methylene 46.754 c17h24o6 324 11.86 γ-linolenic acid, methyl ester 34.769 c19h32o2 292 10.57 5-(7a-isopropenyl-4,5-dimethyl-octahydroinden-4-yl)-3methyl-pent-2-enal 45.254 c20h32o 288 9.57 2,5-furandione, dihydro-3-(2-tetradecenyl) 39.037 c18h30o3 294 7.44 2-[4-methyl-6-(2,6,6-trimethylcyclohex-1-enyl)hexa-1,3,5 -trienyl]cyclohex-1-en-1-carboxaldehyde 44.788 c23h32o 324 6.96 hexadecanoic acid, methyl ester 31.864 c17h34o2 270 5.33 hexadecanoic acid, methyl ester 31.856 c17h34o2 270 24.06 s. trocheliophorum 1-octadecanol 34.956 c18h38o 270 11.68 1-hexadecanol 30.995 c16h34o 242 10.81 campesterol 55.081 c28h48o 400 7.89 thunbergol 34.343 c20h34o 290 4.80 2-pentenoic acid, 5-(decahydro-5,5,8a-trimethyl-2-me thylene-1-naphthalenyl)-3-methyl-, [1s-[1α(e),4aβ,8aα]] 36.295 c20h32o2 304 3.22 trans-13-octadecenoic acid, methyl ester 35.188 c19h36o2 296 2.90 ergost-5-en-3-ol, acetate, (3β,24r)50.221 c30h50o2 442 2.80 ester, hexadecanoic acid, methyl ester, 1-octadecanol, campesterol, thunbergol respectively. the study results of the antibacterial assay, the bioactive compounds of three soft coral extracts inhibited the growth of human pathogenic bacteria. gc-ms analysis revealed bioactive compounds from these three soft corals, and each compound has been structurally characterized so that these metabolites can act as potential pharmaceutical products or lead structures for the development of new drugs in the future. the antibacterial properties of the soft corals from south andaman are the first of their kind from the islands and they should be further investigated for their application in developing novel bioactive compounds. acknowledgment: the authors express their sincere gratitude to pondicherry university, port blair for providing basic infrastructure for carrying out the research work. the authors are also thankful to the zoological survey of india (zsi/ anrc), port blair for helping with the identification of soft coral specimens. conflict of interest: the authors declare that they have no conflict of interest. financial support: self-funded samson rokkarukala1, m. punnam chander2, raju mohanraju1 1 department of ocean studies and marine biology, pondicherry university, brookshabad campus, port blair, andaman and nicobar islands, 744112, india; 2 model rural health research unit, khumulwng, tripura 799035, india. corresponding author: email: asmohanrajupu@pondiuni.ac.in references benayahu y, van ofwegen lp. new species of sarcophyton and lobophytum (octocorallia: alcyonacea) from hong kong. zool meded. 2009; 83: 863-76. chander mp, vijayachari p. in vitro antibacterial and antioxidant potentials of selected seaweeds of andaman and nicobar islands, india. bangladesh j pharmacol. 2016; 11: 874-75. chao ch, chou kj, huang cy, wen zh, hsu ch, wu yc, sheu jh. bioactive cembranoids from the soft coral sinularia crassa. mar drugs. 2011; 9: 1955-68. cooper el, hirabayashi k, strychar kb, sammarco pw. corals and their potential applications to integrative medicine. evid based complement altern med. 2014; 1-9. gomaa mn, soliman k, ayesh a, el-wahed aa, hamza z, mansour hm, khalifa sam, ali hbm, el-seedi hr. antibacterial effect of the red sea soft coral sarcophyton trocheliophorum. nat prod res. 2016; 30: 729-34. janes mp. a study of the xeniidae (octocorallia, alcyonacea) collected on the “tyro” expedition to the seychelles with a description of a new genus and species. zool med leiden. 2008; 82: 599-626. laxmilatha p, jasmine s, kingsly j, ameri a, labeeb ka. coral reef biodiversity of selected sites in andaman and nicobar islands. marine fisheries information service technical & extension series – 248, 2021, pp 24-29. marican h, edros r, mohammad m, salleh s. antimicrobial activity of tropical soft corals in the northern straits of malacca. int j eng technol. 2016; 6: 1-10. shahbudin s, deny s, zakirun amt, haziyamin tah, john ba, taher m. antioxidant properties of soft coral dendronephthya sp. int j pharmacol, 2011; 7: 263-67. van de water jajm, allemand d, ferrier-pagès c. hostmicrobe interactions in octocoral holobionts: recent advances and perspectives. microbiome 2018; 6: 64. 74 bangladesh j pharmacol 2023; 18: 72-74 mailto:asmohanrajupu@pondiuni.ac.in bangladesh journal of pharmacology volume: 18; number 2; year 2023 cite this article as: segaran g, srinivasan c, sathiavelu m. antibacterial activity of calathea anulque. bangladesh j pharmacol. 2023; 18: 77-78. antibacterial activity of calathea anulque sir, the genus calathea has about 300 species. these are well-known as pot plants owing to their ornamental leaves and many have been cultivated for their beautiful and exotic variegated foliage. one of the plants of this genus calathea zebrine showed significant antibacterial activity against escherichia coli, staphylococcus aureus, streptococcus sp., and proteus vulgaris (sethi et al., 2015). the antibacterial effect of c. anulque is not known. we selected c. anulque to evaluate its antibacterial activity and phytochemical constituents. the healthy and fresh leaves of the c. anulque plant were collected in a sterile polyethylene bag from thotakalai nursery garden, ecr, chennai, tamilnadu, india. the collected leaves were washed using tap water to eliminate the dust particles from the surface followed by milli-q water. they were stored for drying under the shade without exposure to sunlight for a week. the dried leaves were finely powdered using an electric blender. two distinct solvents, methanol and ethyl acetate, were used for extraction purposes. about 1 g of finely powdered leaves samples were added to 100 ml of two different in a 250 ml erlenmeyer flask. the flasks were sealed using parafilm and kept in a shaker for 48 hours at 120 rpm. after 48 hours, the extracts were collected by filtering through a whatman filter paper no 1. the filtrates were evaporated using a rotary vacuum evaporator to attain dried crude extracts. the agar well diffusion method was carried out to determine the antibacterial activity of crude extracts against pathogenic organisms such as staphylococcus aureus and streptococcus pneumoniae (gram positive bacteria), klebsiella pneumoniae and escherichia coli (gram negative bacteria). the bacterial stock cultures were prepared using nutrient broth. for the antibacterial assay, the mueller-hinton agar plates were prepared. the suspended organisms were swabbed in the agar plates and the wells were made using the sterile cork borer. the 100 μl extracts of three different concentrations (100, 50, and 25 μg/ml) have loaded in the three wells and an antibiotic disc (streptomycin 10 mg) was used as a positive control. the test plates were incubated at 37ºc overnight and clear zone development around the well was noted (shankar and sathiavelu, 2021). the plant crude extracts were dissolved in dimethyl sulfoxide and used for phytochemical analysis. about 2 ml of 2% ferric chloride solution was added to the plant extract. the presence of phenol in the extract is indicated by the appearance of a blue-green to black color. the plant extracts were treated with 2 ml of 2% sodium hydroxide solution to identify the presence of flavonoids. the intense color change from yellow to colorless after the addition of diluted acid confirms the flavonoids. after the addition of 2 ml of concentrated sulfuric acid, the plant extract was heated until it evaporates. the presence of terpenoids was confirmed by the appearance of a greyish color. about 5 ml of distilled water was added to the test tube containing plant extract, and the contents were vigorously shaken. the presence of saponins was confirmed by the formation of stable foam (segaran et al., 2020). this is the first research conducted on c. anulque. a qualitative phytochemical analysis of extracts was done to analyze the active components present in the plants, revealing the presence of saponins and terpenoids (table i). both the plant crude extracts tested positive for antibacterial activity against s. aureus (table ii). the antimicrobial effect of ethyl acetate extract on s. aureus was more significant with the greatest inhibition zone of 28 mm. s. aureus was inhibited by a methanolic extract of c. anulque with an inhibition zone of 25 mm. other three test pathogens (s. pneumoniae, k. pneumoniae and e. coli) were not inhibited by both the plant extracts. previous research suggested that plants that thrive in low-light environments indoors might be useful for removing airborne microorganisms and toxins that are a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 77-78 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v18i2.64690 letter to the editor this work is licensed under a creative commons attribution 4.0 international license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor table i phytochemical screening of calathea anulque leaf extracts phytochemicals methanol ethyl acetate flavonoids phenol saponins + + terpenoids ++ + tannins ++ indicates moderately positive; + indicates low positive; indicates negative frequently found to pollute indoor air. the growth of corynebacterium diphtheriae and s. aureus was inhibited by methanolic extracts of ornamental plants such as dieffenbachia spp. and cordyline spp. microbe control may be influenced by volatile chemicals released by indoor plants such as cyperus alternifolius, philodendron domesticum, codiaeum variegatum, and dieffenbachia camille (chunduri et al., 2015). free radical scavengers such as phenolic compounds (such as coumarins, flavonoids, quinones, etc.), terpenoids, nitrogen compounds (such as alkaloids), and other metabolites are found in plants. traditional medicine in panama uses c. warscewiczii to treat a variety of illnesses. aqueous and ethanol extracts of the ornamental plant c. panamensis have shown the presence of phytochemicals like alkaloids, monoterpenoids, and polyphenols. non-flavonoid polyphenols from c. panamensis were found in its ethanol extract. the c. panamensis showed antiradical activity and has non-flavonoid polyphenolic compounds and alkaloid compounds in different solvent extracts (rodriguez et al., 2008). c. anulque shows low extent of antibacterial activity in comparison to c. zebrine. phytochemical study shows that c. anulque contains no phenols and tannins. whereas c. zebrine contains high concentration of phenols and tannins (sethi et al., 2015). financial support: vellore institute of technology (sg id: sg20220100) conflict of interest: the authors declare that they have no conflict of interest acknowledgment: the authors thank vellore institute of technology, vellore for providing a vit seed grant for carrying out this research gayathri segaran, chitrashalini srinivasan and mythili sathiavelu department of biotechnology, school of bio sciences and technology, vellore institute of technology, vellore, india. corresponding author: email: smythili@vit.ac.in references chunduri jr, jagtap p, panchal s, sagar s. indoor ornamental plants and their antimicrobial properties. int j pharm life sci. 2015; 5: 246-49. rodriguez m, hasegawa m, gonzález-mújica f, motta n, castillo a, castillo j, zea e, mora k, sousa l, gonzález a, camejo d. antidiabetic and antiradical activities of plants from venezuelan amazon maría rodríguez. rev bras farmacogn braz j pharmacogn. 2008; 18: 331-38. segaran g, anitha ukpg, sathiavelu m. evaluation of antioxidant, total phenol and phytoconstituents of culvularia sp., a fungal endophyte of boerhaaviadiffusa. res j biotech. 2020; 15: 117-22 sethi s, khanna s, khan a, hatti n. evaluation of antimicrobial and antioxidant activity of leaf extracts of medicinal plants. world j pharm pharm sci. 2015; 4: 1403-13. shankar s, sathiavelu m. antibacterial activity of dracaena lisa. bangladesh j pharmacol. 2021; 16: 84-86. 78 bangladesh j pharmacol 2023; 18: 77-78 table ii antibacterial activity of calathea anulque leaf extracts using agar well diffusion method extract concentration (µg/ml) organisms zone of inhibition (mm) staphylococcus aureus klebsiella pneumonia escherichia coli streptococcus pneumonia methanol 25 11 50 20 100 25 ethyl acetate 25 50 25 100 28 standard (streptomycin) 10 mg disc 15 28 30 25 mailto:mohanrajupu62@gmail.com bangladesh journal of pharmacology research article effect of effect of effect of aralia chinensisaralia chinensisaralia chinensis on serum on serum on serum tnftnftnf---a, ila, ila, il---4 and il4 and il4 and il---10 level in rats 10 level in rats 10 level in rats with adjuvantwith adjuvantwith adjuvant---induced arthritisinduced arthritisinduced arthritis bjp introduction rheumatoid arthritis is an autoimmune disease characterized by symmetrical arthritis in multiple joints, chronic inflammation in the synovium and progressive destruction of joints. it may cause damage to multiple organs including heart, lung and kidney. late stage may result in ankylosis, joint deformity and severe joint dysfunction, which significantly influence the health and quality of life. in the present study, the effect of aralia chinensis l on the serum tumor necrosis factor (tnf-α), interleukins (il-4, il-10) was investigated in rats with adjuvant arthritis aiming to explore the pathogenesis of rheumatoid arthritis. materials and methods animals male sd rats (specific pathogen free) weighing 200 ± 20 g and aged 8-10 weeks were purchased from the experimental animal center of xi’an jiaotong university. animals were given ad libitum access to food and water. main reagent, drugs and instrument a. chinensis (shenlong hospital of traditional chinese medicine), liquid extract 1 g/ml), tripterygium wilfordii (huangshi feiyun pharmaceutical co. ltd; z33020422), incomplete freund's adjuvant and detection kits for tnf-, il-4 and il-10 (sigmaaldrich) were used in this study. vernier calliper (tesa, swiss), gtza precision balance (gtza, jiangsu, china), 721 grating spectrophotometer (suzhou qile electronic technology co., ltd), and refrigerated centrifuge (xiangyi centrifuge co., ltd) were used in the present study. preparation of the animal model sd rats were allowed to accommodate to the environment for 2 weeks and then divided into 2 groups randomly. in the control group, 8 rats were this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work . you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2012; 7: 285-288 journal homepage: www.banglajol.info; www.bdjpharmacol.com abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 effect of aralia chinensis on serum tnf-a, il-4 and il-10 level in rats with adjuvant-induced arthritis lei yi1, jianjun feng2, haiwang ji1 and xuechong zhang1 1department of traditional chinese medicine, shaanxi provincial people’s hospital, xi’an, china; 2department of geriatric neurology, second affiliated hospital of medical collage of xi’an jiaotong university, xi’an, china. abstract our study investigated the effect of aralia chinensis on serum tumor necrosis factor (tnf), interleukins (il-4, il-10) in rats with adjuvant-induced arthritis. adjuvant-induced arthritis rats had more slowly increased body weight, dramatically increased tnf level but reduced il-4, il-10 levels compared with control group. a. chinensis, tripterygium wilfordii and control group had significantly increased body weight, il-4, il-10, and markedly reduced arthritis index and tnf level compared with the adjuvant-induced arthritis group. a. chinensis and t. wilfordii group had significantly increased il-4 and il-10 levels and markedly reduced tnf level compared with control group. a. chinensis could significantly increase the il-4 level compared with the control group and it can balance the cytokines in arthritis rats, which attributes to the improvement of adjuvant induced arthritis. article info received: 21 november 2012 accepted: 3 december 2012 available online: 10 december 2012 doi: 10.3329/bjp.v7i4.12725 cite this article: yi l, feng j, ji h, zhang x. effect of aralia chinensis on serum tnf-a, il-4 and il-10 level in rats with adjuvantinduced arthritis. bangladesh j pharmacol. 2012; 7: 285-88. included and received no treatment. remaining rats received subcutaneous injection of incomplete freund's adjuvant at the right hind paw (0.1 ml). from the second day, edema of the paw was present. a second injection was done at day 8. at 14 days after first injection, adjuvant arthritis animal model was induced. grouping and treatment in the control group, rats received no treatment. the remaining rats were divided randomly into 3 groups (n = 8 per group): adjuvant arthritis group, t. wilfordii group and a. chinensis extract group. in the t. wilfordii group, rats were intragastrically treated with t. wilfordii at 6.0 mg/kg (3 ml) once daily; in the a. chinensis extract group, rats were intragastrically treated with a. chinensis extract at 1 g/ml (3 ml) once daily. treatment was done at 15 days after first injection of incomplete freund's adjuvant and continued for 28 days. in the control and adjuvant arthritis groups, rats received intragastrically treatment with normal saline of equal volume once daily for 28 days. observations and detection a) observation of general condition: before and after preparation of animal model and treatment, the spirit, hair, appetite and activity of these animals were observed, and the body weight, thickness of voix pedis and arthritis index were detected; b) detection of biochemical parameters: at 28 days after treatment, blood was collected from the femoral artery and placed in a dry tube followed by centrifugation at 3,000 rpm for 8 min. the supernatant was obtained. the serum levels of tnf-, il-4 and il-10 were detected according to the manufacturer’s instructions. statistical analysis quantitative data were expressed as mean ± sd and statistical analysis was done with spss version 15.0. one-way analysis of variance was employed for comparisons among groups and ‘t’-test was used for comparisons between two groups. results at 4 days after first injection, rats developed lassitude, less activities, loss of appetite and lameness, and significant edema was found in the right hind paw. at 9 days after first injection, the hair lost luster, inflammatory nodules were present sequentially at the tail, and congestion of nasal mucosa, mental fatigue, loss of appetite and edema of left hind paw were also observed. at 12 days after treatment, the mental status and appetite in the control group, a. chinensis extract group and t. wilfordii group were improved gradually, but remained unchanged in the adjuvant arthritis group. none died during the experiment. after introduction of adjuvant arthritis, the body weight gain was slower than that in the control group. after treatment with a. chinensis extract or t. wilfordii, the body weight gain was significantly higher than that in the adjuvant arthritis group (p<0.05). there was no marked difference in the body weight gain among a. chinensis extract group, t. wilfordii group and control group (p>0.05; table i). there was no significant difference in the arthritis index among groups before treatment (p>0.05). after 286 bangladesh j pharmacol 2012; 7: 285-288 table i body weight of rats in different groups before and after treatment group n before (g) after (g) control 8 255.5 ± 10.5 298.6 ± 9.3c adjuvant arthritis 8 255.5 ± 11.4 264.0 ± 11.3a t. wilfordii 8 250.1 ± 11.1 277.1 ± 13.1ab a. chinensis 8 252.8 ± 3.6 279.0 ± 9.7ab ap<0.01 vs control group; bp<0.05; cp<0.0 vs aa group table ii arthritis index in different groups before and after treatment group n before after adjuvant arthritis 8 7.9 ± 0.8 10.0 ± 1.5 t. wilfordii 8 8.6 ± 1.3 8.3 ± 1.6a a. chinensis 8 7.8 ± 1.4 7.5 ± 0.8a data are mean ± sd; ap<0.05 vs aa group table iii changes in serum levels of tnf-α, il-4 and il-10 after treatment group n tnf (pg/ml) il-4 (pg/ml) il-10 (pg/ml) control 8 83.1 ± 11.5d 54.4 ± 4.5c 25.1 ± 1.7d adjuvant arthritis 8 268.8 ± 22.9b 49.3 ± 0.7a 15.8 ± 1.9b t. wilfordii 8 159.5 ± 12.0bd 65.1 ± 2.1bd 31.1 ± 1.5bd a. chinensis 8 178.5 ± 11.2bd 76.1 ± 2.8bde 29.2 ± 1.7bd data are mean ± sd; note: ap<0.05, bp<0.01 vs control group; cp<0.05, dp<0.0 vs adjuvant arthritis group; ep<0.01 vs t. wilfordii group treatment, the arthritis index in the a. chinensis extract group and t. wilfordii group was markedly reduced (p<0.05). no significant difference was observed between t. wilfordii group and a. chinensis extract group (p>0.05; table ii). when compared with control group, the tnf level increased significantly but the il-4 and il-10 reduced markedly (p<0.05 or <0.01). in the t. wilfordii group and a. chinensis extract group, the tnf level reduced and the il-4 and il-10 increased (p<0.01). moreover, the increased in il-4 in the at group was higher than that in the t. wilfordii group (p<0.01; table iii). discussion the etiology and pathogenesis of rheumatoid arthritis is still poorly understood and has been found to be related to multiple factors. some studies support that rheumatoid arthritis is an inflammatory disease due to the regulatory dysfunction of immune system. the inflammatory response in rheumatoid arthritis is very complex and has involvement of multiple genes (springer, 1994; murdoch and finn, 2000), and a lot of cytokines have been found to participate in the regulation of complicated immune network. among numerous cytokines in rheumatoid arthritis, tnf and il are found to play important roles in the pathology of rheumatoid arthritis (yu, 2007). tnf has potent biological activity. studies have confirmed that tnf can induce the inflammatory response and mediate the killing of targeted cells (virus infected cells) and cancer cells, may cause fever, metabolic disorder and dyscrasia and has found to be related to the damage to articular cartilage in rheumatoid arthritis. il-4 and il-10 are two anti-inflammatory factors. il-4 can promote the migration of macrophages into the inflammatory sites; il-4 can inhibit the secretion and activities of tnf-a, il1 and il-6 to antagonize the effect of il-1; il-4 may promote the proliferation of th2 cells to suppress the th1 mediated immune response (wang and chen, 1994). il-10 can down-regulate th1 mediated immune response and increase the il-10/tnf producing regulatory t lymphocytes, which may inhibit the inflammation and the damage to the bone and cartilage and reduce the production of tnf and il-1 (gonzalez -rey et al., 2007). there is evidence showing that il-4 and il-10 can synergistically inhibit the secretion of proteases that can degrade the cartilages, and reverse the function of decomposition factors, both of which may inhibit the damage to cartilages (palmer et al., 2002). in healthy subjects, there is a balance between anti-inflammatory cytokines and pro-inflammatory cytokines. the disruption of this balance may induce the occurrence of rheumatoid arthritis. t. wilfordii is a common drug used in the clinical treatment of rheumatoid arthritis having favorable efficacy. however, t. wilfordii may cause reduction of white blood cells and platelets and influence the reproductive system leading to menstrual disorder, compromised sperm activity and reduction of sperms. thus, in the present study, a. chinensis extract with relatively less side effects was used to treat rheumatoid arthritis and the therapeutic efficacy was evaluated and compared with that of t. wilfordii. rheumatoid arthritis is one of arthralgias in traditional chinese medicine. the inner canon of huangdi proposed that the combination of wind-cold-damp results in arthralgias. thus, to dispel wind, disperse cold and eliminate damp have been used in the treatment of arthralgias. a. chinensis is a plant of araliaceae belonging to aralia genus. a. chinensis is mainly distributed in the mountain area of central and west china. the type specimen is mainly obtained from taibai in shaanxi province. non-governmentally, a. chinensis is also known as one of seven taibaishan herbs in qinling of shaanxi. it is rich in china and the skin of root and stem, the stem, the leaf and fruit of a. chinesis can be used as drugs (wang et al., 1998). at has the characteristics of dispelling wind and eliminating damp, attenuating heat and relieving pain, activating blood circulation and dissipating blood stasis, inducing diuresis and reducing edema, invigorating qi for tranquilization and liver-preservation (wang et al., 1997). its bioeffects are consistent with the principles of treatment based on syndrome differentiation in traditional chinese medicine. our results demonstrated that a. chinensis could recover the energy, increase the body weight and attenuate the inflammatory response in rats with rheumatoid arthritis, exerting therapeutic effect on rheumatoid arthritis. this effect on rheumatoid arthritis may be related to the down-regulation of tnf- and up -regulation of il-4 and il-10 as well as the recovery of balance between anti-inflammatory cytokines and proinflammatory cytokines. acknowledgement this work was supported by the science and technology research project in shanxi province (2012k19-05-03). references gonzalez-rey e, chorny a, varela n, o'valle f, delgado m. therapeutic effect of urocortin on collagen-induced arthritis by down-regulation of inflammatory and th1 responses and induction of regulatory t cells. arthritis rheum. 2007; 56: 531-43. murdoch c, finn a. chemokine receptors and their role in inflammation and infectious diseases. blood 2000; 95: 303243. bangladesh j pharmacol 2012; 7: 285-288 287 palmer g, guerne pa, mezin f, maret m, guicheux j, goldring mb, gabay c. production of interleukin-1 receptor antagonist by human articular chondrocytes. arthritis res. 2002; 4: 226-31. springer ta. traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. cell 1994; 76: 301-14. wang tg, chen wf. advance in biological effect of interleukin-4. foreign med sci (section immunol). 1994; 1: 13-16. wang y, zhu z, wang c, yang j. [determination of oleanolic acid and total saponins in aralia l]. [article in chinese] zhongguo zhong yao za zhi. 1998; 23: 518-21, 574. wang z, tang h, su z, tan m, hu j, li c, yi y. [resources survey of medicinal species from genus aralia]. [article in chinese] zhongguo zhong yao za zhi. 1997; 22: 3-6, 60. yu ss. clinical significance of measurements of changes of serum il-2, sil-2r and tnf levels after treatment in patients with rheumatoid arthritis. j radioimmunol. 2007; 20: 231-33. 288 bangladesh j pharmacol 2012; 7: 285-288 author info lei yi (principal contact) e-mail: yilei1108@yeah.net dateprinted: this article was downloaded by you on: jan 02, 2018 speech of the chief guest: bangladesh j pharmacol 2006; 1: 1-4 available online at www.bdjpharmacol.com copyright © by bangladesh pharmacological society early days of pharmacology education in bangladesh* mohammad shamsuzzoha (borndecember 1, 1923) honorary professor of pharmacology, bangladesh medical college, dhanmondi, dhaka, bangladesh. honorable chairperson prof. a.k.m. nurul anwar and respected participants of this excellent program, assalamualaikum. a heartfelt thanks you to all for having selected me as the chief guest of this event. i am honored. it is delightful to think that the younger generation of which the majority is constituted of has not forgotten the old. they have taken care to even remember an ancient person like me. the best part of this occasion is the fact that the pharmacological society is being launched, a wish that pharmacologists had long cherished in their hearts. this special wish, with all our thanks to the almighty is being granted today, the 10th of march, 2006, although delayed. it is better late than never. pharmacologists, it is now your duty and responsibility to make this society flourish and blossom before everybody’s eyes. it is my belief that every physician should have some idea as to how the subject pharmacology evolved. pharmacology is a branch of medical science that had long been neglected not only in this country but throughout the world. it had no identity of its own but had always functioned under the supervision of the physiology department. to the extent of my knowledge, there used to be no medical college in bangladesh before 1946. only a meager number of medical schools in the *this speech was delivered at the first annual meeting of bangladesh pharmacological society at dhaka on march 10, 2006. country were involved in teaching medical science. after successfully completing a four years’ course, graduates used to be awarded with an lmf diploma. among these institutions, mitford medical school of dhaka and campbell medical school of calcutta were renowned. after the partition (1947), established 5 medical schools were located in dhaka, chittagong, sylhet, khulna and mymensingh. pharmacology was taught in the second year of the course under the name of materia medica. dose, identification, composition, incompatibility, and prescription writing of drugs were taught as the part of practical lessons while the theoretical part consisted of a summary of the syllabus as constructed in those days. it was in the year 1946 when we were students at calcutta medical college when it came to our knowledge that a medical college had been established in dhaka. the present building of dhaka medical college was then a part of dhaka university. a portion of the northern wing of this building first served as the dhaka medical college and hospital. after completing my mbbs and pre-registration clinical assistant within the november of 1948, i joined dhaka medical college and hospital in the june of 1949. at that time, the principal and superintendent was the respectable eye specialist dr. t. ahmed. he was someone who would always try his utmost for the development and success of dhaka medical college and hospital in spite of various technical difficulties that he had to encounter. consequently i had to work part time in the pharmacology department for the first six months in spite of my being assigned to the hospital. at that time pharmacology, pathology, jurisprudence and hygiene were taught in the 3rd and 4th year. dr. hafizuddin who was the resident physician of the hospital, earnestly requested me to teach pharmacology to the students. i began to teach the subject during gaps in my hospital schedule. after facing a lot of problems, the most of which involved noncooperation from the clinical staff, dr. hafizuddin, dr. yusuf ali, dr. nesaruddin and i endeavored to establish the department of pharmacology together. at the end of the year, dr. a.k.s. ahmed (a double mrcp) was assigned as the professor of the department. although relieved, we wondered whether he would be able to look over the department or whether he would be interested at all. this is exactly what happened. he got completely busy with the hospital. dr. hafizuddin became full resident physician, dr. yusuf ali full house physician, and i received papers assigning me as the demonstrator of pharmacology. being a non-bengali, dr. nesaruddin was not interested in working for east pakistan. henceforth, the entire responsibility of the pharmacology department was bestowed upon me unawares. then the staffing of the department began. the entire education planning and curriculum of the then east pakistan’s department of pharmacology, dhaka medical college was assigned to a newly passed mbbs graduate, dr. zoha. with the exception of one or two lectures all the lectures, practical and theoretical classes had to be taken by me. the students were in 4th year in 1949. since it was not known whether the students had learnt any pharmacology in the 3rd year, the entire course had to be covered in their 4th year. the greatest of help then were mr. hamid ali and mr. naimuddin (class iv employees), pharmacist mr. ali shaheb (class iii employee) whose sincerity and devotion i still reminisce with earnest respect. the topics which then used to be given maximum preference were practical and applied education. the chief preparations in the practical classes used to be emulsions constituting of castor oil, cod liver oil, glycerin suppository, quinine mixtures, etc. students had to learn to calculate via the metric, apothecaries’ and avoirdssepois system. at that time, 50 to 60 years from now, the medical students were very eager to learn for which they usually came out with flying colors. it is not as though there weren’t kids who had not interest. there had been situations when students had passed medicine, surgery, gyne-obs, however, were failing pharmacology year after year in succession. consequently, they were not being able to acquire their final mbbs certificate. shamsuzzoha early days of pharmacology vol. 1, no. 1, june 20062 during then, the rule was that a student had to sit for the final professional three years after taking their second professional irrespective of whether they had passed every subject or not. after all this and successive reshufflings, it was finally decided that pharmacology would be taught in the 3rd and 4th year along with pathology, forensic medicine and community medicine. according to the latest curriculum, preclinical subjects are taught for one and a half years while clinical and para-clinical subjects are taught for three and a half years. i rejoined dhaka medical college in the march of 1958 after completing my phd. the college had then acquired its very own building, which is the present building we have, with good adequate space for the accommodation of every department. we succeeded in enabling the students to carry out the common pharmacological experiments from the early 1959. they were: blood pressure of anaesthetized cats, isolated heart perfusion, and effects of acetylcholine, adrenaline, noradrenaline, vasomotor reversal, isolated auricle (guinea pig/ rabbit), effects of drug on isolated guinea pig ileum, rabbit duodenum, frog rectus abdominis muscle, effect of drug on blood vessels, etc. the students were first allowed demonstrations that we carried out after which they had to carry out the experiments themselves. everything was running with enthusiasm and vigor, when at the end of the year, i was transferred to chittagong medical college as an associate professor. the then professor of dhaka medical college was dr. mir monsur ali who never voluntarily participated in such things, but never discouraged anything either. prof. kamaluddin had tried to continue the classes, however, he too left for glasgow university after a while for his phd. prof. mazharul imam took over the charge but the entire process began to lag. to my dismay, i discovered that the pharmacology department at chittagong medical college was anything but developed. i sent over the requisitions for necessary equipments, which i was granted after one year. it was then that experimental pharmacology was established at chittagong medical college. next, i was transferred to rajshahi medical college as a full professor. during that time i traveled to pakistan to attend a meeting of the pakistan pharmacopoea committee. there i raised a question to the then health minister of the central government lt. general barki about why west pakistan had so many more medical colleges compared to east pakistan who admitted that i was right and offered to look into the matter. the pharmacology department of rmc in 1964 was almost non-existent, not to mention, non functional. it took me great hours of toil to set out requests and requisitions till at long last, all the required space, staff, equipment, and everything necessary was obtained and a full-fledged good department of experimental pharmacology was established. it is worth mentioning here that the first fully equipped and facilitated experimental pharmacology department was pioneered from there at rajshahi medical college, complete with an animal house. i was retransferred to dhaka medical college in 1966 and then to chittagong in 1969 as principal, superintendent, as well as the head of the department of pharmacology. there i found that the construction of the huge new hospital complex as well as the medical college was complete. to my great disappointment i discovered that no space had been allotted for the pharmacology department. great was my sorrow at this especially because this was a subject devoid of which neither could any drugs be correctly prescribed, nor any maladies rightly cured. at the inauguration ceremony of the new hospital building, i held up this matter directly to the health secretary who insisted that i take full charge of the matter. being the principal as well as the superintendent i then indeed had the right to do anything i wanted. so i proceeded to take over the old hospital building and renovate it to turn it into a big flourishing department devoted wholly to pharmacology. later on the departments of community medicine and jurisprudence were accommodated in that building also. i also had to bear with the realization that the department had bangladesh j pharmacol 3 remained absolutely static and devoid of any development since i had left it and all the equipments for which i had previously laid out requisitions were sealed up in packets. gradually by and by, these requisitions were set out, animals and animal houses bought, lab technicians and class iv employees hired till the department was established and running. by observing the rapid development occurring at dhaka medical college, chittagong medical college and rajshahi medical college, the rest of the medical colleges began to develop more or less. today it is very disheartening to see that experimental pharmacology is no more practically carried out by the government as well as the non-government medical colleges. expensive equipments that were acquired via the foreign exchange had either become useless due to lack of use or have been dumped at the corners of storerooms. the current teaching staffs of pharmacology are much more qualified and there are plenty of opportunities. in addition, there is a special section allotted for experimental pharmacology in the syllabus of bangladesh medical and dental council. in spite of all these, this subject is not paid much attention, the reason of which i cannot understand. i am of the opinion that everywhere outside bangladesh, medical students themselves carry out experiments in experimental pharmacology, and in our country, the little that used to be practiced have ceased. teaching and research are interconnected for which i believe that paying as much heed to research as is paid to teaching the theory, is a must. in spite of all limitations i believe that someone in the country has interest in developing the research sector. shamsuzzoha early days of pharmacology vol. 1, no. 1, june 20064 introduction hyperlidemia is the current medical as well social problem, specially associated with diabetes mellitus leading to increasing morbidity and mortality. the major risk factors of hyperlipidemia are associated with atherosclerosis which predisposes ischemic heart disease and cerebro-vascular disease (brown and goldstein, 1990). in type 2 diabetic patients there is mild to moderate hypertriglyceridemia, low level of high density lipoprotein (hdl) and over production of very low density lipoprotein (vldl) (foster, 1991). serum total cholesterol is also increased (florey et al, 1973). in the present century modern medicine draws its nourishment from the rich legacy of traditional medicine. fenugreek (trigonella foenumgraecum) is one of the oldest medicinal plants, dating back to hippocrates and ancient egyptian times (jensen, 1992). the antihyperlipidemic properties of oral fenugreek seed powder has been suggested (basch, 2003). alhabori et al. (1998) showed the effect of fenugreek seeds and its extracts on plasma lipid profile on rabbits. studies have also shown that fenugreek seeds reduce serum lipids in experimental animals. sharma (1984, 1986) demonstrated that fenugreek administration increased excretion of bile acids and neutral sterols in feces, thus depleting the cholesterol stores in the body in experimental rats. awal et al. (1999) has studied the effect of fenugreek and karela on lipid profile in hypercholesterolemic diabetic patients and shown that fenugreek significantly reduces the lipid level. the present study was undertaken to demonstrate the effect of whole fenugreek seed on lipid profile. materials and methods thirty patients of type 2 diabetes mellitus with hyperlipidemia of either sex, aged 30-65 years, weighing 58-84 kg were selected for the study from diabetic center, rajshahi. patients having history of coexisting liver, kidney or thyroid disorder, etc were not included in the study. patients were well controlled with hypoglycemic drug and not on any other hypolipidemic medications. counseling of the patients about the study was done and informed consents were a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 64-67 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract effects of fenugreek (trigonella foenugraecum) on serum lipid profile in hypercholesteremic type 2 diabetic patients were studied. administration of fenugreek seed powder of 25 gm orally twice daily for 3 and 6 weeks produces significant (p<0.001) reduction of serum total cholesterol, triacylglyceride and ldl-cholesterol in hypercholesteremic group but the change of serum hdl-cholesterol was not significant. on other hand, changes of lipid profile in hypercholesteremic type 2 diabetic patients without fenugreek were not significant (p<0.001). the present study suggests that fenugreek seed powder would be considered as effective agent for lipid lowering purposes. article info received: 18 july 2006 accepted: 20 september 2006 available online: 3 january 2008 doi: 10.3329/bjp.v1i2.490 cite this article: moosa asm, rashid mu, asadi azs, ara n, uddin mm, ferdaus a. hypolipidemic effects of fenugreek seed powder. bangladesh j pharmacol. 2006; 1: 64-67. hypolipidemic effects of fenugreek seed powder abu saleh m. moosa, mamun ur rashid, a.z.s. asadi, nazma ara, m. mojib uddin and a. ferdaus department of pharmacology, rajshahi medical college, rajshahi, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. taken from the patients. three fasting blood samples of 5 ml were collected on three separate days to estimate lipid profile. the fenugreek seeds were collected from the local market. these were washed with clean water and dried in sun light. after drying seeds was crushed in an electric grinder to make powder. the powder was then stored in a clean, oven-dried stopper plastic container. the patients were divided into two groups: one group received only their usual anti-diabetic treatment (control group) and another group received fenugreek seed powder with their usual treatment (experimental group). patients were advised to come after overnight fasting and blood samples were collected in early morning. the control group on the day 1, blood sample was taken as baseline record and advised to continue their usual diabetic treatment (i.e. drug or diet control plus exercise). another two blood samples were taken on day 21 and day 42 for the study of serum lipid levels. in experimental group on day 1, blood sample was taken as baseline record and advised to continue their usual diabetic treatment (i.e. drug or diet control plus exercise). they were advised to swallow 25 gm of fenugreek seed powder twice daily (after breakfast and after dinner). again two blood samples were taken on day 21 and day 42 day as study group serum level. all the parameters of lipid profile i.e. serum total cholesterol, ldl-cholesterol, triacylglyceride and hdlcholesterol were done. all values expressed as mean in mg/dl ± sem (standard error of mean). statistical significance of difference between the base line serum level i.e. control (day 1) serum level and after 3 weeks (day 21) of treatment serum level and again base line serum level i.e. control (day 1) serum level and after 6 weeks (day 42) of treatment serum level was performed. the ‘p’ values of 0.05 or less were regarded as significant. results the mean serum total cholesterol, ldl-cholesterol, triacylglyceride and hdl-cholesterol level of control group on the first day, after 3 weeks (day 21) and after 6 weeks (day 42) was compared with serum total cholesterol, ldl-cholesterol, triacylglyceride and hdlcholesterol level of experimental group, on the first day, after 3 weeks (day 21) and after 6 weeks (day 42). the results are shown in table i. the fenugreek seed powder significantly (p<0.001) reduced serum total cholesterol, serum triacylglyceride level and serum ldl-cholesterol level in hyperlipidemic type 2 diabetic patients. the serum hdl-cholesterol level increased but not significantly by the fenugreek seed powder. no significant changes found in control group i.e. hyperlipidemic patients not taking fenugreek. discussion the present study has been undertaken to demonstrate the effect of fenugreek (local name: methy) seed powder on lipid profile in hyperlipidemic type 2 diabetic patients. in this study parameter of lipid profile was done for all hyperlipidemic patients. estimation of lipid profile was done in all the patients after 3 and 6 weeks. no significant changes were observed in all the parameters of lipid profile in control group. but significant changes were observed in serum total cholesterol, ldl-cholesterol and triacylglyceride level in experimental group. changes of serum hdlcholesterol level were not significant. similar observations were made by number of workers, demonstrated hypolipidemic effect of fenugreek powder in experimental animals like rabbit, rat, etc (alhabori et al., 1998). some researchers also demonstrated the hypolipidemic effect of fenugreek seeds in hyperlipidemic type 2 diabetic patients (sharma, 1986; awal et al., 1999; prasanna, 2000). modern lipid lowering agents i.e. statins (atorvastatin, cimvastatin, rosuvastatin etc.) are expensive. the most important adverse effects of statins are liver and muscle toxicity. other risk factors are: hepatic dysfunction, renal insufficiency, hypothyroidism, advanced age and serious infections (stancu and sima, 2001). limitations of the use of synthetic statins are pregnancy and lactations, etc (james, 2004). liver and kidney functions may be modified. on the other hand herbal agents like fenugreek, are cheap easily available in many countries like bangladesh, india, nepal, pakistan and mediterranean region and south african countries. there is no toxic or adverse effect shown by any researcher worked on fenugreek cited above. in addition to its high fiber content (total fiber content 48%), fenugreek also contains a biologically significant level of saponins. saponins are known to have hypocholesterolemic effects (sharma, 1986; sharma and raghuram, 1990). the quality and quantity of protein in the diets have a direct effect on the levels of cholesterol. generally plant protein appears to lower cholesterol level (james, 2004). the plant protein in fenugreek is 26%, so it might exert a lipid lowering effect (sharma, 1986). further, since a high proportion of diabetic patients in tropics and subtropics suffer from malnutrition, fenugreek which is in rich protein (26%), has an added advantage in that it is a good source of protein as well as fiber (48%) (sharma, 1986). bangladesh j pharmacol 2006; 1: 64-67 65 from the results it can be concluded that fenugreek seeds exhibits significant hypolipideic effect in hyperlipidemic persons. synthetic statins has some adverse effects and costly. in the light of these comparative findings, it can be stated that fenugreek seeds may be useful in hyperlipidemic states of patients with hypertension, atherosclerosis, ischemic heart diseases etc. conclusion the present study fenugreek seed powder significantly reduced serum total cholesterol, triacylglyceride and ldl-cholesterol but serum hdl-cholesterol level elevation is not significant. so, it can be suggested that fenugreek may be used for lipid lowering purposes and needs extensive comparative study with the modern lipid lowering agents. further study on the fenugreek seeds in this aspect and isolation of active principles from the extract is suggested. references al-habori m, al-aghban am, al-mamary m. effect of fenugreek seeds and its extracts on plasma lipid profile: a study on rabbits. phytotherapy res. 1998; 12: 572-75. awal ma, rashid mu, ahmed kw, asadi zs, islam k. effect of karela and fenugreek on lipid profile in hypocholesterolemic diabetic patients. bangladesh j physiol pharmacol. 1999; 15: 6-8. basch e, ulbricht c, kuo g, szapary p, smith m. therapeutic applications of fenugreek. altern med rev. 2003; 8: 20-27. mahley rw, bersot tp. drug therapy for hypercholesterolemia and dyslipidemia. in: goodman & gilman's the pharmacological basis of therapeutics. hardman jg and limbird le (eds). 10th edi, new york, mcgraw-hill, 2001, pp 971-1002. florey cd, medonald h, miall w. serum lipids and their relations to blood glucose in cardiovascular measurements in rural population of jamaican adults. j chronic dis. 1973; 26-85. powers ac. diabetes mellitus. in: harrison’s principles of internal medicine. kasper et al. (eds). 16th ed, new york, mcgraw-hill, 2005, pp 2152-80. james h, atrovastatin reduces remnant lipoproteins and small, dense low-density lipoprteins regardless of the baseline lipid pattern. prev cardiol. 2004; 7: 154-60. jensen r. fenugreek, overlooked but not forgotten. ucla lactation alumni newsletter. 1992; 1: 2-3. prasanna m. hypolipidemic effect of fenugreek: a clinical study. indian j pharma. 2000; 32: 34-36. sharma rd. effects of fenugreek seeds and leaves on blood glucose and serum insulin responses in human subjects. nutr res. 1986; 6: 1353-64. table i serum lipid profile in patients with type 2 diabetes mellitus treated with or without fenugreek day without fenugreek with fenugreek total cholesterol (mg/dl) day 1 285.0 ± 1.5 285.12 ± 2.40 day 21 288.0 ± 2.2ns 279.12 ± 2.36a day 42 289.9 ± 1.9ns 278.37 ± 2.31a ldl-cholesterol (mg/dl) day 1 157.3 ± 0.4 158.7 ± 0.6 day 21 156.0 ± 1.3ns 155.7 ± 0.5ns day 42 160.7 ± 4.2ns 152.0 ± 6.4a triacylglyceride (mg/dl) day 1 201.5 ± 1.6 202.6 ± 4.1 day 21 201.1 ± 4.4ns 191.9 ± 3.7a day 42 201.1 ± 4.4ns 189.4 ± 4.1a hdl-cholesterol (mg/dl) day 1 35.4 ± 0.6 35.0 ± 0.2 day 21 35.5 ± 0.3ns 36.5 ± 0.5 day 42 34.8 ± 0.4ns 37.4 ± 0.7 66 bangladesh j pharmacol 2006; 1: 64-67 author info abu saleh m. moosa (principal contact) e-mail: asmmoosa@yahoo.com sharma rd, raghuram tc. hypoglycaemic effect of fenugreek seeds in non-insulin dependent diabetic subjects. nutr res. 1990; 10: 731-39. sharma rd. hypocholesterolemic activity of fenugreek an experimental study in rat. nutr rep int. 1984; 30: 221-31. stancu c, sima a. statin: mechanism of action and effects. “nicolae simionescu” institute of cellular biology and pathology, bucharest, romania, 2001. bangladesh j pharmacol 2006; 1: 64-67 67 dateprinted: this article was downloaded by you on: oct 23, 2017 introduction liver cancer is one of most common cancers (wolosz et al., 2014). every year, about 64 thousands of people all over the world are initially diagnosed with liver cancer, among which more than half are chinese (zhang et al., 2014b). in china, the leading cause of liver cancer’s remarkable rise lies in the evolution of liver cirrhosis after infection of hbv (allam et al., 2010). data on 1990s showed that fatality rates of liver cancer are ranked the second (tang, 2001). liver cancer is progressing fast and its attack is concealed (outwater, 2010). consequently, intra-hepatic or extra-hepatic metastasis has occurred for most patients at initial diagnosis, thus they lost chances to receive radical treatment (behe et al., 2003). for a few patients, disease can be found at early stage and diagnosis as well as treatment can be conducted, thus they can live longer (xie et al., 2015). pharmacogenetics is a subject studying effects of genetic polymorphism on drug reaction (gonzalezvacarezza et al., 2013). in view of functional genomics and molecular pharmacology, pharmacogenomics is developed on the basis of pharmacogenetics at the end of 1990s and is an achievement of implementation of hgp (vasku et al., 2009). its main focus is to study pharmacogenetics by using results of genomics (li et al., 2013). more specifically, it is to study the hereditary basis of polymorphism of drug reactions, to prove and explain modes of action as well as toxic and adverse effects of drug therapeutic effects and actions from the perspective of molecular level, which provides a platform to develop new drugs and guide rational drug use (lam et al., 2013). therefore, security and effectiveness of drug use are increased and adverse reactions are avoided. meanwhile, costs and risks of drug therapy decrease (kim et al., 2013). a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 726-731 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract we detected the expression of microrna-132 in chinese patient with liver cancer and evaluated down-regulation of microrna-132 affect on cell growth and apoptotic of liver cancer cell. twenty four patients with liver cancer and 24 normal patients were obtained from the 105th hospital of people’s liberation army. we measured the expression of microrna-132 in all selected patients using quantitative rtpcr (qrt-pcr). lastly, cell growth and apoptotic of liver cancer human liver cancer mhcc97h cells after antimicrorna-132 transfection were evaluated using cck‑8 solution and annexin v-fitc and propidium iodide kit. there was significant suppression in microrna-132 expression of exosome and whose liver cancer cell, comparison with normal patients. down-regulation of microrna-132 could inhibit cell growth and activated apoptotic of liver cancer cell. these findings indicate that microrna-132 provides increased sensitivity of detection than normal patients. microrna-132 may serve as a potential biomarker for treatment on liver cancer. article info received: 4 june 2015 accepted: 9 august 2015 available online: 26 august 2015 doi: 10.3329/bjp.v10i3.23572 cite this article: liu lw, zhu lx, liu b. expression of microrna-132 in patient with liver cancer and mediation of microrna132 on cell growth of liver cancer cell. bangladesh j pharmacol. 2015; 10: 726 -31. expression of microrna-132 in patient with liver cancer and mediation of microrna-132 on cell growth of liver cancer cell li-wei liu1, li-xin zhu2 and bo liu3 1department of biotherapy, the 105th hospital of people’s liberation army, hefei anhui 230 061, china; 2central lab, the first hospital of anhui medical university, hefei anhui 230 061, china; 3department of infection disease, the 105th hospital of people’s liberation army, hefei anhui 230 061, china. http://www.bioxbio.com/if/html/bangl-j-pharmacol.html microrna is a non-coding single stranded rna with a length of about 22 nucleotides, which is formed by dicer enzyme-processing of precursors of single stranded rna in cell nucleus and cytoplasm. it was recognized early in 1993 (zhang et al., 2014a). it is single structured and participates in essential biological functions such as cell development, apoptosis and metabolism, etc (wang et al., 2013). as the important role of microrna in some tumors has been confirmed, many scholars conducted initial studies on relationship between microrna and occurrence, development and metastasis of liver cancer (toffanin et al., 2011; wang et al., 2014). results showed that microrna was closely related with liver cancer. materials and methods participants twenty four patients with liver cancer and 24 patients other than liver cancer were obtained from the 105th hospital of people’s liberation army. blood samples of all patients were gathered and stored at -80°c for analysis. the tumor type and the grade of liver cancer were diagnosed based on the criteria of world health organization (who) and international union against cancer (uicc) tnm classification. serum samples firstly, peripheral blood from all participants was gathered and centrifuged at 2,000 rpm for 10 min at 4°c. then, the supernatants were gathered and centrifuged at 12,000 xg for 10 min at 4°c. the serum samples were stored at −80°c for analysis. total exosome isolation reagent was used to isolate exosomes from serum samples following the manufacturer’s protocol (invitrogen). 0.2 ml of total exosome isolation reagent (invitrogen) and 1 ml of serum were blended and incubated for 30 min at 4°c. then, exosomes was gathered and centrifuged at 10,000 ×g for 10 min at room temperature. quantification of serum microrna-132 total rna was isolated using isothiocyanate-phenol/ chloroform extraction procedures. sybr premix dimer eraser kit (takara, shiga, japan) was used to perform real-time quantitative rtpcr (qrt-pcr) using abi prism 7900ht detection system (applied biosystems, foster city, ca). anti-microrna-132 plasmid transfection anti-microrna-132 plasmid : 5 ′ c g c c a a u a u u uacgugcugcua-3′, the negative control: 5′-caguacuuuuguguag uacaa-3′. anti-microrna-132 plasmid and negative control plasmid were structured by sangon biotech (shanghai, china) and transfected into u87 cell using lipofectamine 2000 (invitrogen), according to the manufacturer’s instructions. cell culture and cell viability human liver cancer mhcc97h cells were obtained from the first hospital of anhui medical university and were cultured in dmem culture medium (gibco, billings, mt, usa) containing 10% fetal blood serum (hyclone-thermo scientific, germany) supplemented with 100 u of penicillin/ml, 100 mg of streptomycin/ ml at 37°c under a humidified atmosphere of 5% co2. mhcc97h cells-transfected was seeded onto 96-wellplate (1 × 103 cell/well). then, 10 µl of thawed cck‑8 solution (wuhan boshide biotechnology co., ltd, wuhan, china) was added to mhcc97h cells-transfected and incubated for 4 hours at 37˚c. cell viability was read using the microplate reader (thermo fisher scientific, waltham, ma, usa) at 450 nm/600 nm. cell apoptotic mhcc97h cells-transfected were analyzed by flow cytometry (beckman coulter inc., miami, fl, usa) using the annexin v-fitc/propidium iodide apoptosis detection kit according to the manufacturer's instructions (bestbio biotechnology co., ltd, china). mhcc97h cells-transfected was seeded onto 6-well-plate (1-2 × 106 cell/well) and washed by ice pbs. mhcc97h cells was gathered and cultured with annexin v-fitc and propidium iodide on ice for 30 min in the dark. cell apoptotic were measured using flow cytometry (beckman coulter inc., miami, fl, usa). statistical analysis data were expressed as the means ± standard error (s.e.m.) and kruskal-wallis test were performed to determine the significance of the differences. a value of <0.05 was considered significant. results characterization of participants there was no significant in age, sex, hbv status, liver cirrhosis and tnm staging in liver cancer and normal patients (table i). serum microrna-132 expression in higher liver cancer patients in this study, there was no significant difference in age (≥ 60 or < 60 years), sex and hbsag of low microrna132 expression and high microrna-132 expression (table ii). however, cases of liver cirrhosis of low microrna-132 expression was higher than that of high microrna-132 expression. the statistical analysis revealed that high level of serum microrna-132 expression positively correlated with tnm staging. correlations of microrna-132 expression and patient clinicopathologic characteristics to determine the correlations of microrna-132 expre bangladesh j pharmacol 2015; 10: 726-731 727 ssion and patient clinicopathologic characteristics, microrna-132 expression was measured by qrt-pcr. there was significant suppression in microrna-132 expression of exosome and whose liver cancer cell, comparison with control group (figure 1). meanwhile, microrna-132 expression of exosome cell was higher than that of whose cell in liver cancer cell or normal control group. mediation of microrna-132 on cell growth of liver cancer cell to determine whether down-regulation of microrna132 played a role in the cell growth of liver cancer cell, we transfected mhcc97h cells with anti-microrna132. as shown in figure 2, transfection of antimicrorna-132 inhibited cell growth of liver cancer cell, comparison with control group. mediation of microrna-132 on apoptotic of liver cancer cell we have showed down-regulation of microrna-132 affect on apoptotic of liver cancer cell. these results indicated down-regulation of microrna-132 activated apoptotic of liver cancer cell, comparison with control group (figure 3). discussion in our study, cases of liver cirrhosis of low microrna132 expression were higher than that of high microrna -132 expression. the statistical analysis revealed that high level of serum microrna-132 expression positively correlated with tnm staging. mir-132 is highly conserved in evolution and possesses same arrays and structures in species like human beings, rats, mice and apes (guo et al., 2014). it is positioned on chromosome 10 in rats while chromosome 11 and chromosome 17 are for mice and human beings, respectively (maharshak et al., 2013). mir-132 has tissue specificity and has high expressions in nervetable i characterization of participants patient without liver cancer (n = 24) liver cancer group (n = 24) age (years) 62.2 ± 6.9 63.1 ± 7.2 sex female 9 9 male 15 15 hbv status positive 0 20 negative 24 4 liver cirrhosis positive 0 19 negative 24 5 tnm staging i 7 ii 6 iii-iv 11 table ii serum microrna-132 expression in higher hcc patients characteristics n low (%) high (%) p value age (years) ≥ 60 17 10 (58.8) 7 (41.2) 0.971 < 60 7 4 (57.1) 3 (42.9) sex female 9 6 (66.7) 3 (33.3) 0.588 male 15 9 (60.0) 6 (40.0) hbsag positive 20 11 (55.0) 9 (45.0) 0.361 negative 4 3 (75.0) 1 (25.0) liver cirrhosis positive 19 9 (47.4) 10 (52.6) 0.021 negative 5 5 (100) 0 (0) tnm staging i 7 6 (85.7) 1 (14.3) 0.001 ii 6 5 (83.3) 1 (16.7) iii-iv 11 3 (27.3) 8 (72.7) 728 bangladesh j pharmacol 2015; 10: 726-731 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_4#_enref_4 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_9#_enref_9 related tissues (wang et al., 2013). it participates in axon growth, proliferation and differentiation of synapsis and formation of nerve tumors. it also takes part in regulating cancers, neurodegenerative diseases, schizophrenia and immunological diseases (wanet et al., 2012). in present study, there was significant suppression in microrna-132 expression of exosome and whose liver cancer cell. meanwhile, microrna-132 expression of exosome cell was higher than that of whose cell in liver cancer cell or normal control group. expression of mir-132 is regulated by promoters and play significant part in metastasis and colony formation of tumor cells (wei et al., 2013). studies showed that upstream stimulatory factor-1 can increase expressions of mir-132 by incorporating with promoters of mir-132 (kumarswamy et al., 2014). as a result, gene silencing of usf-1 can lead to down regulation of mir-132, then to avoid apoptosis of hepg2 cells under the conditions of oxygen-glucosede privation, which can be regarded as the therapeutic target (wang et al., 2014). in carcinoma of prostate cells, methylation of cpg island could down regulate mir-132 which controls cell adhesion by directly acting on protein-heparinbinding epidermal growth factor and talin 2, thus prevent the metastasis of carcinoma of prostate (wei et al., 2013). we found that the down-regulation of microrna-132 could inhibit cell growth and activated apoptotic of liver cancer cell. conclusion we observed cases liver cirrhosis of low microrna-132 expression was higher than that of high microrna-132 expression. there was significant suppression in microrna-132 expression of exosome and whose liver cancer cell. down-regulation of microrna-132 could inhibit cell growth and activated apoptotic of liver cancer cell. furthermore, our study indicated that figure 1: correlations of microrna-132 expression and patient clinicopathologic characteristics ##p<0.01 compared with normal group figure 2: mediation of microrna-132 on cell growth of liver cancer cell; ##p<0.01 compared with normal group bangladesh j pharmacol 2015; 10: 726-731 729 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_16#_enref_16 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_14#_enref_14 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_14#_enref_14 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_17#_enref_17 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_6#_enref_6 file:///e:/documents%20and%20settings/administrator/local%20settings/application%20data/youdao/dict/application/6.3.67.3030/resultui/frame/javascript:void\(0\); file:///e:/documents%20and%20settings/administrator/local%20settings/application%20data/youdao/dict/application/6.3.67.3030/resultui/frame/javascript:void\(0\); file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_15#_enref_15 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_17#_enref_17 file:///c:/users/aim/desktop/23572-84800-1-new1.doc#_enref_17#_enref_17 microrna-132 provides increased sensitivity of detection than normal patients. microrna-132 may serve as a potential biomarker for treatment on liver cancer. ethical issue the study was approved by the institutional review board of hospital ethics committee. written consents were obtained from all subjects prior to the recruitment. references allam n, al saghier m, el sheikh y, al sofayan m, khalaf h, al sebayel m, helmy a, kamel y, aljedai a, abdel-dayem h, kenetman nm, al saghier a, al hamoudi w, abdo aa. clinical outcomes for saudi and egyptian patients receiving deceased donor liver transplantation in china. am j transplant. 2010; 10: 1834-41. behe m, becker w, gotthardt m, angerstein c, behr tm. improved kinetic stability of dtpadglu as compared with conventional monofunctional dtpa in chelating indium and yttrium: preclinical and initial clinical evaluation of radiometal labelled minigastrin derivatives. eur j nucl med mol imaging. 2003; 30: 1140-46. gonzalez-vacarezza n, abad-santos f, carcas-sansuan a, dorado p, penas-lledo e, estevez-carrizo f, llerena a. use of pharmacogenetics in bioequivalence studies to reduce sample size: an example with mirtazapine and cyp2d6. pharmacogenomics j. 2013; 13: 452-55. guo j, wang h, wang q, chen y, chen s. expression of pcreb and activity-dependent mir-132 in temporal lobe epilepsy. int j clin exp med. 2014; 7: 1297-306. kim ds, marsillach j, furlong ce, jarvik gp. pharmacogenetics of paraoxonase activity: elucidating the role of highdensity lipoprotein in disease. pharmacogenomics 2013; 14: 1495-515. kumarswamy r, volkmann i, beermann j, napp lc, jabs o, bhayadia r, melk a, ucar a, chowdhury k, lorenzen jm, gupta sk, batkai s, thum t. vascular importance of the mir -212/132 cluster. eur heart j. 2014; 35: 3224-31. lam mp, yeung ck, cheung bm. pharmacogenetics of allopurinol--making an old drug safer. j clin pharmacol. 2013; 53: 675-79. li yh, huang x, wang y, fan r, zhang hm, ren p, chen y, zhou hh, liu zq, liang yz, lu hm. pharmacokinetic comparison of the vasorelaxant compound ferulic acid following the administration of guanxin ii to healthy volunteers and patients with angina pectoris. exp ther med. 2013; 6: 1283-89. maharshak n, shenhar-tsarfaty s, aroyo n, orpaz n, guberman i, canaani j, halpern z, dotan i, berliner s, soreq h. microrna-132 modulates cholinergic signaling and inflammation in human inflammatory bowel disease. inflamm bowel dis. 2013; 19: 1346-53. outwater ek. imaging of the liver for hepatocellular cancer. cancer control. 2010; 17: 72-82. tang zy. hepatocellular carcinoma: cause, treatment and metastasis. world j gastroenterol. 2001; 7: 445-54. toffanin s, alsinet c, cornella h, sia d, llovet jm. micrornas and the myc network: a major piece in the puzzle of liver cancer. gastroenterology 2011; 140: 2138-40. vasku v, vasku a, vasku jb. pharmacogenetic contribution of leptin gene polymorphism in cutaneous t-cell lymphoma. int j clin exp pathol. 2009; 2: 163-68. wanet a, tacheny a, arnould t, renard p. mir-212/132 expression and functions: within and beyond the neuronal compartment. nucleic acids res. 2012; 40: 4742-53. wang r, liang h, li h, dou h, zhang m, baobuhe, du z, gao m, wang r. usf-1 inhibition protects against oxygen-andglucose-deprivation-induced apoptosis via the downregulation of mir-132 in hepg2 cells. biochem biophys res commun. 2014; 446: 1053-59. wang ry, phang rz, hsu ph, wang wh, huang ht, liu iy. figure 3: mediation of microrna-132 on apoptotic of liver cancer cell; ##p<0.01 compared with normal group 730 bangladesh j pharmacol 2015; 10: 726-731 author info bo liu (principal contact) e-mail: liweiliu100@.163.com; tel: +86-189-6181 in vivo knockdown of hippocampal mir-132 expression impairs memory acquisition of trace fear conditioning. hippocampus 2013; 23: 625-33. wei x, tan c, tang c, ren g, xiang t, qiu z, liu r, wu z. epigenetic repression of mir-132 expression by the hepatitis b virus x protein in hepatitis b virus-related hepatocellular carcinoma. cell signal. 2013; 25: 1037-43. wolosz d, walczak a, wilczynski gm, szparecki g, wilczek e, gornicka b. deleted in liver cancer 1 expression and localization in hepatocellular carcinoma tissue sections. oncol lett. 2014; 8: 785-88. xie x, yao m, chen x, lu w, lv q, wang k, zhang l, lu f. reduced red blood cell count predicts poor survival after surgery in patients with primary liver cancer. medicine (baltimore). 2015; 94: e577. zhang l, huang d, wang q, shen d, wang y, chen b, zhang j, gai l. mir-132 inhibits expression of sirt1 and induces pro-inflammatory processes of vascular endothelial inflammation through blockade of the srebp-1c metabolic pathway. cardiovasc drugs ther. 2014a; 28: 303-11. zhang y, zhang wl, huang ds, hong l, wang yz, zhu x, hu hm, zhang pw, yi y, han t. clinical effectiveness of multimodality treatment on advanced pediatric hepatoblastoma. eur rev med pharmacol sci. 2014b; 18, 1018-26. bangladesh j pharmacol 2015; 10: 726-731 731 introduction: materials and methods: results: discussion: conclusion: ethical issue: references: author info bo liu principal contact email liweiliu100163com tel 861896181: dateprinted: this article was downloaded by you on: aug 26, 2016 bangladesh journal of pharmacology research article serum iron concentration and total serum iron concentration and total serum iron concentration and total iron binding capacity in patients of iron binding capacity in patients of iron binding capacity in patients of oral squamous cell carcinomaoral squamous cell carcinomaoral squamous cell carcinoma bjp duration of betel quid with tobacco habit (years) 500 400 300 200 100 0 s er um ir on ( µg /d l) 0 10 20 30 40 50 case (n = 24) r = -0.409, p<0.05a control (n = 13) r = -0.184,p>0.05ns introduction oral cancer is becoming a problem for all over the world and the incidence is high in the least developed or undeveloped countries like bangladesh (who, 1984; chiba et al., 1998; watkinson, 2001; goselin, 2006). in bangladesh the number of new cancer cases per year is about 200,000 of which oral cancer is about 20% (shaheed et al., 1995). due to some geographic distribution and socioeconomic condition, the rate of oral cancer is high in our country than the developed countries. the common site of oral cancer also differs due to some habit (hasan and molla, 1997; talukder and molla, 1997). the etiology of oral cancer is a complex, multi-factorial, ill-defined and incomplete concept. risk factor includes betel nut, chewing tobacco, smoking, age, familial or genetic predisposition, poor oral hygiene and chronic irritation, nutritional status, alcohol, exposure to industrial products or heavy metals, viruses, ionizing radiation, oral candidiasis, etc (goselin 2006; binnie et al., 1983). the etiological factors of oral squamous cell carcinoma (oscc) are also different in different areas of the world (shaheed et al., 1995). iron deficiency has long been known to have profound effects on the oral mucosa and also to have association with both oral and pharyngeal cancer (paterson-kelly syndrome), and with chronic candidiasis (huggs and wells, 1972). the findings of joynson et al. (1972) showed an impairment of cell mediated immunity in iron deficient patients. deficiency as well as excess body iron, both may cause carcinogenesis. some researchers emphasize that few habitual etiology have synergistic effect on iron to cause carcinogenesis (bhattathiri, 2006). the potential role of iron in cancer etiology is supported by several possible mechanisms. as transitional metals, iron can generate the reactive oxygen species including hydroxyl radical. these reactive oxygen species can attack dna and cause dna mutation; thus contributing to the pathological process of cancer a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2007; 2: 49-54 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the serum iron concentration and total iron binding capacity (tibc) status of 24 patients of oral squamous cell carcinoma (oscc) were compared with the findings of 13 healthy subjects. oscc was found to have association with low serum iron level. more patients were found to be with significantly lower iron content in serum (p<0.05). but no association between serum tibc and increased risk of cancer was found (p>0.05). irrespective of age, sex, smoking and betel nut chewing habit of subjects, low serum iron level significantly increase the risk of oral malignancy. article info received: 22 may 2007 accepted: 27 june 2007 available online: 3 january 2008 doi: 10.3329/bjp.v2i1.500 cite this article: hossain s, molla mr, akhter m. serum iron concentration and total iron binding capacity in patients of oral squamous cell carcinoma. bangladesh j pharmacol. 2007; 2: 49-54. serum iron concentration and total iron binding capacity in patients of oral squamous cell carcinoma shakhawat hossain, motiur rahman molla and mahmuda akhter department of oral and maxillofacial surgery, faculty of dentistry, bangabandhu sheikh mujib medical university, shahbag, dhaka 1000, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. (huggs and wells, 1972; joynson et al., 1972; graham et al., 1977; toykuni, 1996; stevens and kalkwarf, 1990). iron is an essential nutrient for body. it has a central role in metabolism. it is also an essential component in dna synthesis and in respiratory and oxidative metabolism. these functions relate to the properties of unremitting proliferation and a more anaerobic metabolism that may contribute to a selective advantage of neoplastic cells over non-neoplastic cells. clinical correlations have been made linking cellular iron content to the development of cancer in human (huggs and wells, 1972; joynson et al., 1972; graham et al., 1977). severe iron deficiency leads to immune compromise, which in turn may cause cancer. a study conducted by rennie and mac-donald (1982) in united kingdom have shown that in human iron deficiency anemia and in experimental iron deficiency in hamsters, qualitative histological changes in the oral epithelium are demonstrable. level of serum iron, ferritin, total iron binding capacity (tibc) and transferrin saturation are the important diagnostic measures of iron deficiency (hepplestone and pippard, 1996; dallman et al., 1980; dallman and reeves, 1984). so, tibc has a relation with oscc like serum iron. few researchers conducted some study to get the relationship. a study conducted in india among 289 patients with epidermoid oral cancer and got relationship (bhattathiri, 2006). materials and methods the study includes 24 (12 male, 12 female) histopathologically diagnosed oscc patients and 13 (7 male, 6 female) healthy subjects. a detailed history of the patients including age, sex, duration of disease, greatest tumor diameter, number and size of involved lymph nodes, duration of smoking and betel nut chewing habit were taken. collection of blood sample with all aseptic precaution 5 ml of whole blood was collected by venipuncture using disposable syringes. blood was collected at the morning in fasting condition of the patient. then the blood was poured into a metal free tube and taken to the laboratory of the department of pharmacology, bangabandhu sheikh mujib medical university, dhaka, bangladesh. centrifugation of blood was done at 4,000 rpm for 10 min to separate the serum. then the serum was preserved in 1.5 ml appendrof tube in deep freeze until measuring iron and tibc. all apparatus (test tubes, microtubes, pipette etc.) used in the study were made metal free. procedure of serum iron measurement iron is released from transferrin through a decrease in the ph of serum. in an acidic medium transferrin bound iron dissociates into free ferric ions. hydroxylamine hydrochloride reduces the ferric ions to ferrous ions which react with ferrozine to form a strongly colored purple complex with an absorption maximum near 560 nm. absorbance is proportional to iron concentration. one milliliter of reagent a (1.5 g of hydroxylamine hydrochloride in 0.3 g of sodium acetate ph 4.5) was taken in each test tube placed for blank, standard and unknown sample. then 200 ml water in the blank, 20 ml feso4 solution and 150 ml water in the standard and 200 ml serum in the unknown sample tube was mixed. 40 ml of reagent b (24 mg of ferrozine and 95.5 g of hydroxylamine hydrochloride) was mixed in 6.2 ml water was then placed in each tube, mixed well and wait for 10-15 min. a turnery purple colored complex was formed. then absorbance was measured in a spectrophotometer at 560 nm. the absorbance of blank was subtracted form the absorbance of other tubes. then the result was calculated to get the serum iron in mg/dl. procedure of serum tibc measurement the serum unsaturated iron binding capacity and tibc are determined by addition of sufficient fe3+ to saturate iron binding sites on transferrin. the access fe3+ is removed with adsorbant like light magnesium carbonate (mgco3) powder and the assay for iron content was then repeated. from this second measurement the tibc was obtained. iron standard solution was prepared by 7.3 mg fecl3 taken in 500 ml water and then 0.3 ml of hydrochloric acid was added to it. this was saturating iron solution for tibc measurement. 0.5 ml of serum was taken in a test tube. 0.5 ml of saturating iron solution was added. mixed well and wait for 15 min. then 100 mg (± 15 mg) light magnesium carbonate (mgco3) was added and shake vigorously. wait for 30-60 min. then centrifuge it at 4,000 rpm for 10 min. supernatant was removed and centrifuged. 0.5 ml of supernatant was taken. method of serum iron measurement was repeated using this supernatant solution instead of serum and then tibc was calculated. results the mean (± sd) age of patients was 54.1 ± 14.4 years. among them 16 patients (66.7%) were above 50 years (table i). but in case of healthy subjects mean age was 31.6 ± 8.5 years. among the patients 8 (33.3%) were smoker, 18 (75.0%) were betel quid with tobacco chewer and 7 (29.2%) had both smoking and betel chewing habit. but in case of healthy subjects only 4 (30.8%) 50 bangladesh j pharmacol 2007; 2: 49-54 were smoker, 5 (38.5%) were betel quid with tobacco chewer and only one had both smoking and betel chewing habit. the duration of smoking habit in patient and healthy controls were 8.7 ± 14.5 years and 2.7 ± 7.0 years respectively. the mean duration of betel quid with tobacco chewing habit was 21.8 ± 17.1 years in patients and 5.0 ± 7.1 years was in healthy controls. here the difference was statistically significant (p<0.01). the mean serum iron level in case of male study group was 160.8 ±105.6 mg/dl and in male control 198.5 ± 57.6 mg/dl where the difference was not significant (table ii). but mean serum iron in case of female study group was 136.3 ± 55.3 mg/dl and female control 250.0 ± 137.6 mg/dl. mean serum iron was lower in case of female patient than the healthy female control and the result is statistically significant (p<0.05). considering the tumor size the highest number of cases (10) was in t2 (2-4 cm; table iii). the lowest level of iron was in t4 size (87.0 ± 45.3 mg/dl) and the highest was in t1 size (233.1 ± 134.0 mg/dl). serum iron level decreased with the increasing of size of the lesion. the tibc level was lowest in t3 (164.4 ± 47.7 mg/dl) and highest in t1 (250.0 ± 88.0 mg/dl). unlike serum iron level, tibc level was not correlated with the size of lesion. regarding the histopathological grading the highest number of cases (41.7%) was found as grade ii. serum iron level decreased with the increase in number of grade. tibc level was not correlated with histopathological grading. with the increase of duration of betel quid with tobacco chewing habit serum iron level of oscc patient decreased (r = -0.409) which was significant (figure 1). in case of healthy control group serum iron also decreased (r = -0.184) but the result was not significant (p>0.50). with the increase of duration of betel quid with tobacco chewing habit tibc level decreased (r = 0.101) in oscc patient insignificantly (p>0.50). iron level also decreased markedly (r = 0.579) with the increase of duration of cancer (figure 2). tibc also decreased but not markedly. table i distribution of age and sex of the subjects parameters number of case number of control age up to 25 1 3 26‑50 7 10 51 and above 16 0 sex male 12 7 female 12 6 table ii level of serum iron and tibc in males and females parameters case control p value serum iron (μg/dl) male 160.8 (105.7) 198.5 (57.6) >0.10 female 136.3 (55.3) 250.0 (137.6) <0.05 p value >0.1 >0.1 tibc (μg/dl) male 189.2 (46.1) 236.2 (34.1) <0.05 female 205.1 (81.3) 223.7 (56.2) >0.50 p value >0.5 >0.5 table iii after raa treatment parameter n serum iron (μg/dl) (mean ± sd) serum tibc (μg/dl) (mean ± sd) size of lesion <2 cm (t1) 2 233.1 ± 134.0 174.0 ± 2.8 2-4 cm (t2) 10 134.9 ± 53.6 210.8 ± 44.8 >4 cm (t3) 7 125.1 ± 43.5 146.4 ± 47.7 any size involving adjacent structure (t4) 5 87.0 ± 45.3 250.0 ± 88.1 histopathological grading grade i 8 223.3 ± 102.5 223.7 ± 77.1 grade ii 10 130.3 ± 28.6 178.0 ± 58.2 grade iii 6 79.2 ± 21.8 193.5 ± 56.9 bangladesh j pharmacol 2007; 2: 49-54 51 discussion researches across the globe endeavored to elucidate possible relationship of trace elements with the risk of cancer in humans. several of their ventures uncovered the peril related with several familiar trace elements, particularly with zinc, copper, iron, tibc and ferritin as well. iron deficiency has long been documented to have profound effects on the oral mucosa and some even tries times link it with both oral and pharyngeal cancer (graham et al., 1977). attempts of clinical correlation were also made by several clinical epidemiologists in this regard to establish a causal mechanism of malignancy inflicted by deficiency or excess of trace elements (joynson et al., 1972). present study was conducted among 24 oscc patients to find out the association of serum iron and tibc with oscc. thirteen control subjects were also taken to facilitate comparison between cancer and non cancer subjects. biochemistry of iron, suggests that this metal may play an important role in carcinogenesis (toyokuni, 1996). meta analysis of studies conducted to uncover the relation of these trace elements with cancer risk failed to reach conclusive agreement. although several of them confirmed the relationship (stevens et al., 1988; knekt et al., 1994; merk et al., 1990). further epidemiological evidence was provided by ahlbom (1936). iron is a component of the enzyme system which catalyze the electron-transfer and respiration reaction which are essential for cell viability (neilands, 1972). in present investigation serum iron level were compared between the two groups. serum iron content were found to be significantly low among the oscc patients (p<0.05) than the healthy control in the study. serum iron level individually in male was low but insignificant (p>0.05) but incase of female it is significantly low (p<0.05). results of several studies have been consistent with present study result. tibc also found lower in oscc patient then control but it was insignificant (p>0.10). when serum tibc was analyzed separately in men and women, tibc level in case of male oscc patient was significantly lower than male healthy control. it is also lower in female patient, but insignificant. stevens (1994) described low serum iron is clearly detrimental. a study conducted by rennie and macdonald (1982) in united kingdom have shown that in human iron deficiency anemia and in experimental iron deficiency in hamsters, qualitative histological changes in the oral epithelium are demonstrable. study conducted by bhattathiri (2006) suggested like present study that iron promotes cancer growth. they further emphasize iron as a factor for treatment and prevention of neoplastic diseases. bhattathri’s study was conducted in india, almost similar socio demographic distribution like bangladesh. he found nearly one-third of the patients were hypoferrimic and this was more in women. women had lesser serum iron, tibc and serum ferritin than men. although in his study smoking has been identified as a strong confounder. in the current study serum iron level decreased significantly (p<0.05). with the increasing of size, duration of cancer, and duration of betel quid with tobacco chewing. tibc also decrease but insignificantly. duration of betel quid with tobacco habit (years) 500 400 300 200 100 0 s er um ir on ( µg /d l) 0 10 20 30 40 50 case (n = 24) r = -0.409, p<0.05a control (n = 13) r = -0.184,p>0.05ns figure 1: relationship between serum iron concentration and duration of intake of betel quid with tobacco 52 bangladesh j pharmacol 2007; 2: 49-54 baseline parameter in the study were analyzed and in the distribution of age, significant deference exists in between 26-50 years of age group. duration of betel quid chewing habit was also significant. majority of the malignancy were diagnosed with t2 tumor size and histopathological grade ii. in line with biochemical evidence oscc is found to be association with low serum iron level. in the current study serum total iron binding capacity was also lower in oral cancer patients but insignificant. acknowledgement we are grateful to prof. mir misbahuddin of bangabandhu sheikh mujib medical university for allowing us to use his laboratory. references ahlbom he. simple achlorhydric anaemia, plummer-vinson syndrome and carcinoma of the mouth, pharynx and oesophagus in women. bmj. 1936; 2: 331-33. bhattathiri vn. paradoxes in iron indices in oral cancer patients vis-a-vis tobacco-alcohol habits. health administrator. 2006; 17: 76-82. binnie wh, rankin kv, mackenzie ic. etiology of oral squamous cell carcinoma. j oral pathol. 1983, 12: 11-29. chiba i, muthumala m, yamazaki y. characteristics of p53 gene of oral squamous cell carcinomas associated with betel quid chewing in sri lanka. int j cancer. 1998; 77: 839-42. dallman pr, reeves jd. laboratory diagnosis of iron deficiency. in: iron nutrition in infancy and childhood. stekel a (ed), new york, raven press, 1984, pp 11-24. dallman pr, siemes ma, stekel a. iron deficiency in infancy and childhood. am j clin nutr. 1980; 33: 89-118. gosselin bj. malignant tumors of the mobile tongue. http// www.emedicine.com. 2006; 8: 1-18. graham s, dayal h, rohrer t, swanson m, sultz h, shedd d, fischman s. dentition, diet, tobacco and alcohol in the epidemiology of oral cancer. j natl cancer inst. 1977; 59: 1611-16. hasan mn, molla mr. primary sites, clinical staging and histological grading of 102 oral squamous cell carcinoma. bangladesh dental j. 1997; 12: 17-21. hepplestone ad, pippard mj. microcytic and macro-cytic anemia. med group j. 1996, 23: 4-10. huggs jm, wells rs. chronic mucocutaneous candi-diasis associated abnormalities of iron metabo-lism. br j dermatol. 1972; 86: 88-102. joynson dh, walker dm, jacobs a, dolby ae. defect of cellmediated immunity in patients with iron-deficiency anaemia. lancet 1972; 2: 1058-59. knekt p, reunanen a, takkunen h, aromaa a, heliovaara m, hakulinen t. body iron stores and risk of cancer. int j cancer. 1994; 56: 379-82. merk k, mattsson b, mattsson a, hold g, gullbring b, bjorkholm m. the incidence of cancer among blood donors. int j epidemiol. 1990; 19: 505-9. neilands jb. evolution of biological iron binding center. structure bonding. 1972; 11: 145-70. rennie js, macdonald dg. quantitative histological analysis of the epithelium of the ventral surface of the hamster tongue in iron deficiency. arch oral biol. 1982; shaheed i, hossain a, molla mr. histological and causative s er um ir on ( µg /d l) 500 400 300 200 100 0 0 1 2 3 4 5 6 7 8 9 10 11 12 duration of cancer (month) case (n = 24) r = -0.579, p<0.01b figure 2: relationship between serum iron concentration and duration of cancer bangladesh j pharmacol 2007; 2: 49-54 53 author info shakhawat hossain (principal contact) e-mail: sayantha15@yahoo.com factor of oral cancer in bangladesh. oral oncology, applied. proceedings of the 4th international congress on oral cancer. ogaki city, japan, 1995, pp 27-30. stevens rg, graubard bi, micozzi ms, nerishi k, blumberg bs. moderate elevation of body iron level and increased risk of cancer occurrence and death. int j cancer 1994; 56: 364-69. stevens rg, joncs dy, micozzi ms, taylor pr. body iron and the risk of cancer. n engl j med. 1988; 319: 1047-52. stevens rg, kalkwarf dr. iron, radiation and cancer. environ health perspect. 1990; 87: 291-300. talukder ma, haq r, molla mr. a retrospective study of oral cancer and its cervical lymph nodes metastasis in bangladesh. bangladesh dental j. 1997; 13: 21-26. toyokuni s. iron-induced carcinogenesis: the role of redox regulution. free radi biol med. 1996; 20: 553-66. watkinson jc, gaze mn, wilson ja. stell and maran’s head and neck surgery. 4th ed, 2001, pp 1-3. world health organization. control of oral cancer in developing countries; from the report of who meeting, colombo, bull who 62, sri lanka, 1984, pp 817-30. 54 bangladesh j pharmacol 2007; 2: 49-54 bjp: dateprinted: this article was downloaded by you on: oct 29, 2017 bangladesh journal of pharmacology research article studies on bronchodilator and cardiac stimulant activities of urginea indica bjp introduction urginea indica kunth., belonging to the family liliaceae, is a perennial glabrous herb commonly known as “indian squill” and locally in pakistan as “junglipiyaz”, where it grows in salt range, kotli near mirpur and mt.tilla (baquar, 1989). in the indigenous traditional system of medicine, u. indica is reputed for a number of therapeutic benefits, for which bulb or rhizome are the most commonly employed plant parts. it is chiefly used in chronic bronchitis and asthma. the other actions attributed to u. indica are anthelmintic, cardiotonic in heart insufficiency, deobstruent, digestive, expectorant, stomachic, diuretic, emmenagogue and purgative, in addition to its use in calculous and paralytic affections, rheumatism, leprosy, skin diseases, internal pain and scabies (baquar, 1989; kirtikar and basu, 1988; prajapati et al., 2003). bulbs crushed or sliced are also applied under the sole of feet to prevent burning sensation (kapoor, 1990; usmanghani et al., 1997) and are externally used for removing corns and warts (kapoor, 1990; prajapati et al., 2003). among phytochemical constituents, the glycosides, scillarin-a and scillarin-b have been reported to be present in fresh squill (prajapati et al., 2003). other constituents found in squill include flavonoids, carbohydrates, antifungal glycoproteins, steroids, alkaloids, tannins, coumarins and saponins (abbas et al., 2012; kameshwari et al., 2012). pharmacological evaluations have revealed the presence of antibacterial, antifungal (shenoy et al., 2006), laxative and spasmodic (abbas et al., 2012), antioxidant, antiangiogenic and pro-apoptotic activities in u. indica (deepak and salimath, 2006). despite of its extensive medicinal application in airways hyperactivity disorders and also in cardiac disorabstract this study was designed to evaluate bronchodilator and cardio-tonic effects of urginea indica to provide rational for these medicinal uses. u. indica bulb extract was studied on rabbit tracheal and guinea-pig atrial preparations mounted in tissue baths under simulated physiological conditions. u. indica inhibited carbachol (1 µm) and k+ (80 mm)-induced contractions in rabbit trachea, similar to dicyclomine, suggesting the presence of anticholinergic and calcium channel blocking (ccb) mechanisms in u. indica. anticholinergic and ccb effects of u. indica were respectively confirmed when it shifted the carbachol and ca2+ concentration-response curves rightwards, similar to dicyclomine. u. indica (0.01-1 mg/ml) increased force of guinea-pig atrial contractions without significantly affecting the rate. these data, indicating that u. indica possesses the bronchodilator activity possibly mediated through a combination of anticholinergic and ca2+ antagonist mechanisms together with selective positive inotropic effect, provide rational for medicinal applications of u. indica in airways and cardiac disorders. article info received: 29 april 2013 accepted: 9 may 2013 available online: 20 may 2013 doi: 10.3329/bjp.v8i3.14825 cite this article: bashir s, abbas s, khan a, gilani ah. studies on bronchodilator and cardiac stimulant activities of urginea indica. bangladesh j pharmacol. 2013; 8: 24954. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2013; 8: 249-254 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 studies on bronchodilator and cardiac stimulant activities of urginea indica samra bashir1,2, saima abbas1, aslam khan2 and anwar h. gilani2,3 1faculty of pharmacy, bahauddin zakariya university, multan, pakistan; 2department of biological and biomedical sciences, the aga khan university, karachi 74800, pakistan; 3college of health sciences, mekelle university, tigray, ethiopia. ders, u. indica has not been studied widely to evaluate these medicinal uses. this study was aimed to provide pharmacological basis for the medicinal use of u. indica in broncho-spastic disorders like asthma and as cardiac stimulant. material and methods plant material and preparation of crude extract the bulbs of u. indica were collected fresh from fields of mianwali subsequent to the identification of the plant by an expert taxonomist at the institute of pure & applied biology, bahauddin zakariya university, multan, pakistan. a specimen of the plant has been deposited at herbarium of the same institute (voucher no. p. fl 59-1843). the plant material was washed for any contaminants and subjected to shade drying. the dried plant material (400 g) was ground into coarse powders through electrically driven device and the powder was soaked in 70% aqueous-methanol (v/v) for three days in amber colored glass bottles with occasional shaking. the soaked material was passed through double layered muslin cloth to remove vegetative debris and the obtained fluid was subsequently filtered through filter paper (williamson et al., 1998). the residue was re -soaked for next three days and the procedure repeated twice. the filtrates were evaporated on a rotary evaporator (r-210, buchi, switzerland) under reduced pressure (-760 mmhg) at 37ºc to a thick, semi-solid paste of dark brown colour, the crude extract of u. indica bulb yielding 10%. u. indica extract was solubilized in distilled water for all in vitro experiments. animals animals used in the study were rabbits of local breed and either sex; housed at the animal house of the aga khan university, karachi, maintained at 23-25ºc. animals were provided with standard diet and tap water ad libitum. experiments were performed in compliance with the rulings of the institute of laboratory animals resources, commission on life sciences, national research council (nrc, 2011). chemicals acetylcholine chloride (ach), carbachol (cch) and dicylclomine were purchased from sigma chemical co., usa. chemicals used for preparing physiological salt solutions were ethylenediamine tetra-acetic acid (edta), potassium chloride (sigma chemical co.), calcium chloride, glucose, magnesium chloride, magnesium sulfate, potassium dihydrogen phosphate, sodium dihydrogen phosphate, sodium chloride and sodium bicarbonate (merck, darmstadt, germany). all chemical used were of the analytical grade available. stock solutions of all the chemicals were made in distilled water and their dilutions were made fresh on the day of experiment. the vehicle used for solubilization of drugs had no effect on tissue contractility in the control experiments. isolated tissue experiments isolated tissue experiments were performed following the methods previously employed in our laboratory (gilani et al., 1997; 2007; 2012). trachea was dissected out and kept in kreb’s solution. the trachea was cleaned free from the surrounding fatty tissues and cut into rings having 2-3 mm width (containing 2 cartilages). each ring was then opened by longitudinal cut on the side opposite to the smooth muscle layer in such a way that smooth muscles were in between the c-shaped cartilaginous part. the isolated preparations were then mounted in tissue baths containing kreb´s solution and aerated with carbogen at 37°c. the composition of kreb’s solution was (mm): nacl 118.2, nahco3 25.0, cacl2 2.5, kcl 4.7, kh2po4 1.3, mgso4 1.2 and glucose 11.7 (ph 7.4). a tension of 1 g was applied to the tracheal strips continuously and equilibrated for 1 hour before the addition of any chemical substance. cch (1 μm) was used to stabilize the preparations until constant responses to successive treatments were achieved (usually after 3-4 exposures). the bronchodilator activity of the plant extract and control drugs was studied on cch (1 μm) or high k+induced sustained contractions, by adding them in a cumulative manner. cumulative curves to cch were constructed using increasing concentration of agonist. when a 3-fold increase in concentration produced no further increment in response, the tissue was washed to re-establish the base-line tension. the cch crcs were repeated in the presence of increasing concentrations of u. indica and dicyclomine. isometric responses were recorded by force transducer (model fort100) coupled to a transbridge (model tbm4m, world precision instruments, hertfordshire, uk) and powerlab data acquisition system (model ml845, ad instruments, australia) and computer running chart software (version 6). paired atria from healthy guinea-pigs were dissected out, cleaned of fatty tissues and mounted in 15 ml tissue organ baths containing kreb’s solution, at 32°c and the tissues were aerated with carbogen. the tissues exhibited spontaneous beating under the resting tension of 1 g due to the presence of pacemaker cells. an equilibrium period of 30 min was provided before the application of any chemical substance. control responses of ach (0.3 μm) and isoprenaline (1 μm) were obtained at least in duplicate. tension changes in the tissue were obtained via a grass force-displacement transducer (model ft-03) and were recorded using grass model 7 polygraph. statistical analysis 250 bangladesh j pharmacol 2013; 8: 249-254 all the data expressed are mean ± standard error of mean (sem., n = number of experiments) and the median effective concentration (ec50) with 95% confidence intervals (ci) concentration–response curves (crcs) were analyzed by non-linear regression using graphpad program (graphpad, sandiego, ca, usa). the statistical parameter applied is the student’s t-test. p<0.05 was considered significantly different. results u. indica caused relaxation of tracheal preparations precontracted with cch (1 µm) and k+ (80 mm) with respective ec50 values of 0.1 mg/ml (0.1-0.2, n = 6) and 0.8 mg/ml (0.5-1.2, n = 6; figure 1a). dicyclomine similarly was found to be more potent in inhibiting cch (1 µm) induced contractions compared to that against high k+ with respective ec50 values of 0.2 µm (0.1-0.2, n = 5) and 1.8 (1.2-2.5, n = 5; figure 1b). when studied for its possible anticholinergic action, u. indica produced rightward parallel displacement of the cch crcs without suppression of the maximum contractile response at 0.03 mg/ml, followed by nonparallel shift with suppression of the maximum effect at next higher concentration (0.1 mg/ml; figure 2a). dicyclomine (0.03 and 0.1 µm) exhibited a similar pattern of shift in cch crcs (figure 2b). when studied for its effect on ca2+ influx, u. indica shifted ca2+ crcs towards right in a concentration bangladesh j pharmacol 2013; 8: 249-254 251 % o f c on tr ol a % o f c c h m ax . b figure 1: concentration-dependent inhibitory effects of (a) crude extract of u. indica and (b) dicyclomine on k+ (80 mm) and carbachol (1 µm)-induced contractions in isolated rabbit trachea. values are shown as mean ± sem., n = 5-6. 0.003 0.03 0.3 3 [ u. indica] mg/ml 100 75 50 25 0 k+-induced carbachol-induced 0.01 0.10 1.00 10.00 [dicyclomine] µm 100 75 50 25 0 k+-induced carbachol-induced figure 2: concentration-response curve of carbachol in the absence and presence of (a) crude extract of u. indica and (b) dicyclomine in isolated rabbit tracheal preparations. values are expressed as mean ± sem., n = 2-4. 100 75 50 25 0 % o f c c h m ax . a log [carbachol] m -2.5 -1.5 -0.5 0.5 1.5 control u. indica-0.03 mg/ml u. indica-0.1 mg/ml 100 75 50 25 0 -2.5 -1.5 -0.5 0.5 1.5 log [carbachol] m % o f c c h m ax . b control dicyclomine-0.03 µm dicyclomine-0.1 µm dependent manner (0.1-1 mg/ml), similar to dicyclomine (0.3-3 µm; figure 3a and b). u. indica caused a concentration-dependent (0.01-1.0 mg/ml) increase in the force of spontaneous contractions of paired atria followed by inhibition at the higher concentrations (3.0-10.0 mg/ml) without significantly affecting the rate of contractions (figure 4). discussion u. indica plant has traditionally been used to relieve airways disorders including asthma and bronchitis, therefore, the current study was undertaken to see primarily its bronchodilator effect to rationalize the medicinal uses. the proposed broncho-relaxant activity of u. indica was investigated on cch (1 µm) and high k+-induced contractions in isolated rabbit tracheal preparations. u. indica exhibited relaxant effect on both the contractions with higher potency against cch-induced contraction, in a manner similar to dicyclomine, a dual blocker of muscarinic receptors and ca2+ influx (downie et al., 1977; mcgrath et al., 1964). to confirm the antimuscarinic activity, effect of the plant extract was studied on cch-concentration-response curves constructed in the isolated rabbit tracheal preparations. at lower concentration, u. indica caused rightward displacement of the curve without suppression of the maximum response and at higher concentrations, it shifted the curve in a non-parallel manner with suppression of the maximum response. the parallel shift of cch-curves at lower concentration of u. indica without suppression of maximum response is indication for blockade of muscarinic receptors in a competitive manner; whereas, non-parallel shift of cch -curves observed at higher concentration of u. indica with suppression of the maximum response can be attributed to the presence of some non-competitive inhibitor like that exhibited by a ca2+-channel blocker. the ccb effect was confirmed when pretreatment of 252 bangladesh j pharmacol 2013; 8: 249-254 figure 3: concentration-response curve of ca2+ in the absence and presence of (a) crude extract of u. indica and (b) dicyclomine in isolated rabbit trachea. values are expressed as mean ± sem., n = 4 % o f c on tr ol 100 75 50 25 0 a b -4.5 -3.5 -2.5 -1.5 log[ca++]m % o f c on tr ol 100 75 50 25 0 -4.5 -3.5 -2.5 -1.5 log[ca++]m control u. indica 0.1 mg/ml u. indica 0.3 mg/ml u. indica 1 mg/ml control dicyclomine 0.3 µm dicyclomine 1.0 µm dicyclomine 3.0 µm figure 4: effect of crude extract of u. indica on force and rate of contraction in isolated guinea pig atria. values are shown as mean ± sem., n = 3. % o f c on tr ol 150 125 100 75 50 force of contraction rate of contraction 0.01 0.1 1 10 [u. indica] mg/ml the tissue with u. indica also produced a concentrationdependent rightward shift in the ca2+ concentrationresponse curve, similar to dicyclomine. the ca2+ channel blockers have been found to be useful in broncho-spastic disorders (ahmed, 1992; mathewson, 1985) and muscarinic antagonists are also included as present day treatment for the relief from asthma and similar diseases (boushey, 2006). the tone of bronchiolar smooth muscles is regulated by the parasympathetic division of autonomic nervous system and reflex increase in parasympathetic activity may contribute toward bronchoconstriction because the respiratory tract is rich in cholinergic innervations through vagal fibers linked to m1 muscarinic receptors situated in the mucosal surface of the respiratory tract. the mucus secretions are also involved in adding up miseries to the pathology of the respiratory tract particularly submucosal glands are rich in parasympathetic innervetions mostly through m3 receptors and this may be one of the plausible explanations using muscarinic antagonist in chronic obstructive pulmonary disease as well as asthma (barnes and hansel, 2004). in isolated guinea-pig atria, u. indica produced positive inotropic effect at lower concentrations followed by inhibition of the contractile force at higher concentrations, suggesting the presence of dose-related cardiotonic effect in u. indica. indian squill is already been used in its crude form for the treatment of cardiac insufficiency but there is not report on cardiac stimulant effect of the plant itself, however the plant is reported to contain scillaren-a and scillaren-b (prajapati et al., 2003), the cardio-active glycosides producing their effect through inhibition of na+/k+-atpase, similar to that of digitalis glycosides (barceloux, 2008). cardiac inhibitory effect observed at higher concentrations could possibly be the result of the presence of ca2+ channel blocking activity in u. indica. these results, showing cardiac stimulant effect in u. indica, explain this use of the plant in traditional medicine for cardiac insufficiency. these investigations indicate that the crude extract of u. indica possesses bronchodilator activity possibly mediated through a dual blockade of ca2+ influx and muscarininc receptors and cardiac stimulant effect through selective inotropic effect, which can be the possible reason for its medicinal use in airways disorders and cardiac insufficiency. acknowledgment this study was supported pakistan science foundation (grant # psf/res/s-aku/bio(377). references abbas s, bashir s, khan a, mehmood mh, gilani ah. gastrointestinal stimulant effect of urginea indica kunth. and involvement of muscarinic receptors. phytother res. 2012; 26: 704-08. ahmed t. calcium antagonists: potential for asthma therapy. choices respire manage. 1992; 22: 41-43. arshad u, janbaz kh, bashir s, najeeb-ur-rehman, mehmood mh, gilani ah. ethnopharmacological studies on chrozophora prostrata in perspective of its folkloric reputation as purgative. bangladesh j pharmacol. 2012; 7: 243-48. baquar sr. medicinal and poisonous plants of pakistan. karachi, printas, 1989, p 458. barceloux dg. medical toxicology of natural substances: foods, fungi, medicinal herbs, plants, and venomous animals. hoboken, john wiley & sons inc, 2008. barnes pj, hansel tt. prospects for new drugs for chronic pulmonary disease. lancet 2004; 364; 985-96. boushey ha. drugs used in asthma. in; basic and clinical pharmacology. katzung bg (ed). 10th ed. new york, mcgraw-hill, 2006, pp 315-32. deepak av, salimath bp. antiangiogenic and proapoptotic activity of a novel glycoprotein from urginea indica is mediated by nf-kappab and caspase activated dnase in ascites tumor model. biochmie 2006; 88: 297-307. downie jw, twiddy da, awad sa. antimuscrinic and noncompetitive antagonist properties of dicyclomine hydrochloride in isolated human and rabbit bladder muscle. j pharmacol exp ther. 1977: 20; 662-68. gilani ah, bashir s, khan a. pharmacological basis for the use of borago officinalis in gastrointestinal, respiratory and cardiovascular disorders. j ethnopharmacol. 2007; 114: 39399. gilani ah, shaheen f, christopoulos a, mitchelson f. interaction of ebeinone, an alkaloid from fritillaria imperialis, at two muscarinic acetylcholine receptor subtypes. life sci. 1997; 60: 535-44. kameshwari mns, lakshman ab, paramasivam g. biosystematics studies on medicinal plant urginea indica kunth. liliaceae: a review. ijpls. 2012; 3: 1394-1406. kapoor ld. handbook of ayurvedic medicinal plants. boca raton, crc press, 1990, pp 328-29. kirtikar kr, basu bd. indian medicinal plants. volume 3. 2nd ed. dehradun, international book distributors, 1987, pp 2518-19. mathewson hs. anti-asthmatic properties of calcium antagonists. respir care. 1985; 30: 779-81. mcgrath wr, lewis re, kuhan wl. the dual mode of the antispasmodic effect of dicyclomine hydrochloride. j pharmacol exp ther. 1964; 146: 354-58. national research council. guide for the care and use of bangladesh j pharmacol 2013; 8: 249-254 253 laboratory animals. washington dc, national academy press, 2011. prajapati nd, purohit ss, sharma ak, kumar t. a handbook of medicinal plants: a complete source book. new delhi, agrobios, 2003, p 529. shenoy sr, kameshwari mn, swaminathan s, gupta mn. major antifungal activity from the bulbs of indian squill urginea indica. biotechnol prog. 2006; 22: 631-37. usmanghani k, saeed a, alam mt. indusyunic medicine. karachi, university of karachi press, 1997, pp 433-34. williamson em, okpako dt, evans fj. selection, preparation and pharmacological evaluation of plant material. chichester, john wiley & sons, 1998, pp 15-23. 254 bangladesh j pharmacol 2013; 8: 249-254 author info anwar h. gilani (principal contact) email: anwar.gilani@aku.edu dateprinted: this article was downloaded by you on: jul 04, 2018 bangladesh journal of pharmacology research article computational selections of ter-computational selections of ter-computational selections of terpenes present in the plant penes present in the plant penes present in the plant calotropis calotropis calotropis gigantea gigantea gigantea as mosquito larvicide’s by as mosquito larvicide’s by as mosquito larvicide’s by blocking the sterol carrying protein, blocking the sterol carrying protein, blocking the sterol carrying protein, aescpaescpaescp---222 bjp introduction calotropis gigantea (asclepiadaceae), known as milk weed, is a common wasteland weed, drought resistant, salt tolerant, grows wild up throughout india (sastry and kavathekar, 1990). it is one of the peculiar plants not consumed by grazing animals (sharma, 1934). the identified phytochemicals in this plant are usharin, gigantin, and -calotropeol, -amyrin, fatty acids, hydrocarbons, a mixture of tetracyclic triterpene compounds, sterols, and giganteol (murti and seshadri, 1943, 1945a,b). cardenolide, calotropin (kupchan et al., 1964), -amyrin, -amyrin, taraxasterol, -sitosterol, amyrin methylbutazone, -amyrin methylbutazone, amyrin acetate, -amyrin acetate, taraxasteryl acetate, lupeol acetate b, gigantursenyl acetate a, gigantursenyl acetate b (sen et al., 1992; habib et al., 2007), flavonol glycoside, akundarol, uscharidin, calotropin, frugoside, calotroposides a to g were isolated. thus, the plant has immense potential to cure various diseases and disorders (csir, 1992; duke, 1992; chitme et al., 2004; tenpe et al., 2007). the present study reports in silico docking analysis carried out to assess the mosquito larvicidal potential of four terpene compounds isolated from c. gigantea. materials and methods plant material collection and processing the aerial parts of the plant parts were collected from tiruchirappalli, tamil nadu, india, on september 2008. the collected plant materials were then brought in to the laboratory and washed thoroughly with the distilled water to remove the dirt and other contaminations. then the washed plant materials were dried carefully under shade, at room temperature so as to retain their fresh green colour, and also to prevent decomposition a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2012; 7: 1-5 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the present study reports the phytochemical properties of calotropis gigantea (asclepiadaceae) commonly known as milk weed. in addition, in silico docking analysis was also carried out to assess the mosquito larvicidal potential of three terpene compounds isolated from c. gigantea. considerable amount of primary metabolites, essential macro and micro nutrients were documented in the plant. the gc-ms analysis of the chloroform extract revealed the presence of eight terpenes in the plant. from the docking studies it is evident that -amyrin has a great potential against aescp-2. the phytochemical screening and docking results gives strong baseline information for the posterity. article info received: 21 august 2011 accepted: 13 december 2011 available online: 22 january 2012 doi: 10.3329/bjp.v7i1.8414 cite this article: kumar ps, chezhian a, senthil raja ps, sathiyapriya j. computational selections of terpenes present in the plant calotropis gigantea as mosquito larvicide’s by blocking the sterol carrying protein, aescp-2. bangladesh j pharmacol. 2012; 7: 1-5. computational selections of terpenes present in the plant calotropis gigantea as mosquito larvicide’s by blocking the sterol carrying protein, aescp-2 p. suresh kumar1, a. chezhian1, p. senthil raja2 and j. sathiyapriya3 1faculty of marine sciences, cas in marine biology, annamalai university, parangipettai 608 502, india; 2department of zoology, annamalai university, chidambaram 608 001, india; 3department of biochemistry, annamalai university, chidambaram 608 001, india. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. of the active compounds. the dried leaves were powdered using a stone grinder. the powdered materials were stored in airtight, dark, glass container to prevent photochemical reactions. phytochemical analysis the drugs were used to determine the organic carbon (walkley and black, 1934); carbohydrate (hedge and hofreiter, 1962); protein (lowry et al., 1951); lipid (folch et al., 1957); ash content (renaud et al., 1994); total nitrogen (balasubramanian and sadasivam, 1987); phosphorous, potassium (jackson, 1973); calcium, magnesium, zinc, copper, iron, manganese, boron, molybdenum, chromium, nickel, cadmium, lead, cobalt, mercury, arsenic, cyanide, selenium and silver (baker and suhr, 1982; allen, 1989). elemental analysis two grams of dried sample was digested in a mixture of nitric acid, sulfuric acid and perchloric acid in the ratio 11:6:3, for 24 hours to remove the organic matters. the digested sample was made up to 100 ml and used for the assay of the trace elements through atomic absorption spectrophotometer (aasvarion 200aa) using suitable hollow-cathode lamps. appropriate working standard was prepared for each element. all elements were determined through this procedure. a blank reading was also obtained. extraction and gc-ms analysis of terpenes the crude drug was subjected to extraction with analytical grade solvent of chloroform for gc-ms analysis. 25 g of the crude drug was taken in a round bottom flask and 50 ml of analytical grade chloroform was added and refluxed for 8 hours. after completion of the 8 hours, the round bottom flask was cooled and the extract was filtered through the buchner funnel. the extract was evaporated to dryness under nitrogen atmosphere using turbo evaporator. the residue obtained was dissolved in 2 ml chloroform and transferred into the gc vial and injected into the gcms port. gc–ms analysis was performed on an agilent gas chromatograph model 6890 n coupled to an agilent 5973 n mass selective detector. analytes were separated on an hp-5ms capillary column (30 m x 0.25 mm x 1.0 μl) by applying the following temperature program: 40°c for 5 min, 40–70°c at 2°c /min, 70°c for 2 min, 70–120°c at 3°c/min, 120–150°c at 5°c/min, 150 –220°c at 10°c/min and then 220°c for 2 min. transfer line temperature was 280°c. mass detector conditions were: electronic impact (ei) mode at 70 ev; source temperature: 230°c; scanning rate 2.88 scan s-1; mass scanning range: m/z 29–540. carrier gas was helium at 1.0 ml/min. the tentative identification of volatile components was achieved by comparing the mass spectra with the data system library (nist) and other published spectra (mass spectrometry data centre., 1974), supported by retention index data, which were compared with available literature retention indices. all compounds were quantified as 3-octanol equivalents. docking studies the present biocomputational investigation was carried out to identify the candidate therapeutic terpene compounds having potential for inhibiting the growth of mosquito larvae. the 3-d crystal structure of the protein aescp-2 was retrieved from the protein data bank (pdb). aescp-2 protein is a low molecular weight with high levels of expression in the midgut of the larvae and high binding affinity to cholesterol in the aedes aegypti mosquito species (kitamura et al., 1996). structural and active site enumeration were done by using pymol molecular visualization software and castp (computed atlas of surface topography of proteins). four phytochemicals namely -amyrin, oleanolic acid, 5-norbornene-2-carboxylic acid and pyrethrin were screened against the protein aescp-2. the details of these phytochemical were obtained from pubchem database and there chemical structures were generated from smiles notation (simplified molecular input line entry specification) by using the chemsketch software (www.acdlabs.com). the molecular docking analysis was performed using argus lab 4.0 which is widely distributed public domain molecular docking software. results and discussion leaf sample of c. gigantea was analyzed for the composition of ash materials and the organic carbon, primary metabolites, essential macro nutrient, essential micro nutrient and trace elements. the plant contains 1.69% of ash and 27.5% of organic carbon (table i). the primary metabolites, carbohydrate, protein and lipids were 0.97, 0.55 and 0.29% respectively. the essential macronutrients such as nitrogen (2.16%), phosphorous (0.42%), potassium (2.97%), calcium (4.59%), magnesium (3.16%), and sulfur (0.48%) were found in considerable level. the essential micro nutrients were also found in considerable level. among micronutrients the amount of iron (156.3 ppm) was the highest and molybdenum (0.1 ppm) was the lowest. the heavy metals except arsenic and cyanide, all other heavy metals were found to be present in considerable level in this plant. lead was the most dominating heavy metal (0.16 mg/l), whereas nickel (0.02 mg/l) was the least. compared to previous studies our results are also in considerable level. similar study on c. procera showed varied concentrations of phytochemicals (altaf, 1997) and similar variations were also found in our study. these differences could be due to ecological, time of collection, collection sites or may be because of increasing pollution or environmental factors. previous 2 bangladesh j pharmacol 2012; 7: 1-5 studies have also report the presence of phytochemicals like terpenes, cardenolides, flavonoids, pregnanes, nonprotein amino acid and cardiac glycoside as major constituents in calotropis sp. and presence of these phytochemicals sturdily acknowledge the medicinal property of this plant (wang et al., 2008; ali and gupta, 1999). the gc mass spectra (figure 1) showed the presence of eight terpenes in the plant namely bicyclo (3.1.1) heptane,2,6,6-trimethyl-,(1alpha, 2alpha, 5alpha); phytol; urs-12-en-24-oic acid, 3-oxo-,methyl ester,(+)-; squalene; taraxasterol; -amyrin; beta-amyrin and 12oleanen-3-yl acetate, (3alpha) (table ii). the 12-oleanen3-yl acetate, (3alpha) was the major portion of the terpenes which showed the peak area percentage of 16.9. approximately 3 billion people, one half of the world’s population, live in at risk regions for malaria infection. this leads to about 250 million malaria cases every year and nearly one million deaths. one of the most crucial obstacles for eradicating malaria is a widespread resistance of malarial parasite to almost all chemotherapeutic agents (snow et al., 2005). considering the dreadful global issue of the health, in silico docking analysis was carried out. four phytochemicals namely -amyrin, oleanolic acid, 5-norbornene-2-carboxylic acid and pyrethrin were selected for screening against the protein aescp-2. the compounds table i phytochemicals present in the calotropis gigantea quantity parameter quantity parameter quantity% parameter 3.2% nickel 0.02 ppm ash 1.7 magnesium 0.5% cadmium 0.04 ppm organic carbon 27.5 sulfur 3.2 ppm lead 0.16 ppm carbohydrate 1.0 zinc 1.0 ppm cobalt 0.05 ppm proteins 0.6 copper lipids 0.3 iron 156.3 ppm mercury 0.001 ppm nitrogen 2.2 manganese 22.6 ppm arsenic bdl phosphorous 0.4 boron 0.1 ppm cyanide bdl potassium 3.0 molybdenum 0.1 ppm selenium 0.59 ppm calcium 4.6 chromium 0.002 ppm silver 0.02 ppm figure 1: gc mass spectra of calotropis gigantea bangladesh j pharmacol 2012; 7: 1-5 3 were docked in argus lab 4.0. docking energy was found to be -14.1213 kcal/mol, -13.7876 kcal/mol and 8.3558 kcal/mol in -amyrin, oleanolic acid and 5norbornene-2-carboxylic acid respectively (table iii). hence, from the docking studies it is evident that amyrin (c. gigantea derived terpene) has a great potential against aescp-2. medicinal plants are being probed as an alternate source to get therapeutic compounds based on their medicinal properties. c. gigantea is easily available in most of the agricultural and non-agricultural fields and the usage of this plant for medicinal purpose was reported by several researchers. we conclude that c. gigantea represents a rich source of valuable medicinal compounds and leaves of c. gigantea contain -amyrin which could be a potential source for inhibiting the aescp-2. references ali m, gupta j. new pentacyclic triterpenic esters from the roots of calotropis procera. indian j chem. 1999; 38: 877-81. allen se. chemical analysis of ecological materials. 2nd ed. blackwell science publishers, oxford, 1989. altaf wj. effect of motorway traffic emission on roadside wildplants in saudi arabia. radioanalytical nuclear chem. 1997; 217: 91-94. baker de, suhr nh. atomic absorption and flame emission spectrometry. in: methods of soil analysis. usa, american society of agronomy, 1982, pp 13-76. balasubramanian t, sadasivam s. changes in starch, oil, protein and amino acids in developing seeds of okra (abelmoschus esculentus l. moench). plant foods human nutri. (formerly qualitas plantarum). 1987; 37: 41-46. chitme hr, chandra m, kaushik s. studies on anti-diarrhoeal table ii terpenes screened from calotropis gigantea sl. no. retention time peak area% compound name cid no. molecular formula m. wt [g/mol] 1 13.8 0.5 5-norbornene-2carboxylic acid 78949 c8h10o2 138.2 2 16.8 1.1 phytol 5280435 c20h40o 296.5 3 26.0 1.8 squalene 1105 c30h50 410.7 4 35.7 5.8 alpha-amyrin 225688 c30h50o 426.7 5 37.0 8.4 beta-amyrin 73145 c30h50o 426.7 5 38.4 16.9 oleanolic acid 10494 c30h48o3 456.7 6 40.2 4.2 taraxasterol 5270604 c30h50o 426.7 7 47.8 other compounds table iii docking studies compound name pubchem id compound structure molecular weight (g/mol) hydrogen donor/ acceptor docking energy level (kcal/mol) 5-norbornene-2carboxylic acid cid: 78949 138.2 1,2 -8.4 alpha-amyrin cid: 25688 426.7 1,1 -14.1 oleanolic acid cid: 10494 456.7 2,3 -13.8 4 bangladesh j pharmacol 2012; 7: 1-5 author info p. suresh kumar (principal contact) e-mail: savegreenenvironment@gmail.com activity of calotropis gigantea r. br. in experimental animals. j pharm pharmaceut sci. 2004; 25: 70-75. csir. the wealth of india: raw materials. vol: 3. new delhi, publication and information directorate, 1992, pp 78-84. duke ja. handbook of biologically active phytochemicals and their activities. florida, crc press, 1992, pp 22-25. folch j, lees m, sloane stanley gh. a simple method for the isolation and purification of total lipids from animal tissues. j biol chem. 1957; 226: 497-509. habib mr, nikkon f, rahman m, haque me, karim mr. isolation of stigmasterol and β-sitosterol from methanolic extract of root bark of calotropis gigantea (linn). pak j biol sci. 2007; 10: 4174-76. hedge je, hofreiter bt. in: carbohydrate chemistry. whistler rl, be miller jn (eds). new york, academic press, 1962. jackson ml. soil chemical analysis. new delhi, prentice hall of india, 1973, pp 10-144. kitamura t, kobayashi s, okada m. regional ezpression of the transcript encoding sterol carrier protein x-related thiolase and its regulation by homeotic genes in the midgut of drosophila embryos. dev growth differ. 1996; 38: 373-81. kupchan sm, knox jr, kelsey je, saenzrenauld ja. calotropin, a cytotoxic principle isolated from asclepias curassavica l. science 1964; 146: 1685-86. lowry oh, rosebrough nj, farr al, randall rj. protein measurement with the folin phenol reagent. j biol chem. 1951; 193: 265. mass spectrometry data centre eight peak index of mass spectra, (2nd ed., vols 1 and 2). in collabration with ici ltd. (organic division), reading, 1974. murti pbr, seshadri tr. chemical composition of calotropis gigantean. part 1. wax and resin components of the latex. proc indian acad sci. 1943; 18: 145-59. murti pbr, seshadri tr. chemical composition of calotropis gigantean. part ii. wax and resin components of the stem bark. proc indian acad sci. 1945a; 21: 8-18. murti pbr, seshadri tr. chemical composition of calotropis gigantean: part vi. flowers: a comparison of the composition of the various parts of the plant. proc indian acad sci. 1945b; 21: 304–09. renaud sm, parry dl, luong-van t. microalgae for use in tropical aquaculture i: gross chemical and fatty acid composition of twelve species of microalgae from the northern territory, australia. j appl phycol. 1994; 6: 337-45. sastry cst, kavathekar ky. in: plants for reclamation of wasteland. new delhi, publication and information directorate, csir, 1990, pp 175-79. sen s, sahu np, mahato sb. flavonol glycosides from calotropis gigantea. phytochemistry 1992; 31: 2919-21. sharma gk. calotropis procera and calotropis gigantea. indian j veterinary sci. 1934; 4: 63-74. snow rw, guerra ca, noor am, myint hy, hay si. the global distribution of clinical episodes of plasmodium falciparum malaria. nature 2005; 434: 214-17. tenpe cr, upaganlawar ab, dongre pa, yeole pg. screening of methanolic extract of calotropis gigantea leaves for hepatoprotective activity. indian drugs. 2007; 44: 874-75. walkley a, black ia. an examination of the degtjareff method for determining organic carbon in soils: effect of variations in digestion conditions and of inorganic soil constituents. soil sci. 1934; 63: 251-63. wang zn, wang my, mei wl, han z, dai hf. a new cytotoxic pregnanone from calotropis gigantean. molecules. 2008; 13: 3033-39. bangladesh j pharmacol 2012; 7: 1-5 5 dateprinted: this article was downloaded by you on: nov 16, 2017 introduction natural products, especially plants, have been used for the treatment of various diseases for thousands of years. terrestrial plants have been used as medicines in egypt, china, india and greece from ancient time and an impressive number of modern drugs have been developed from them. the first written records on the medicinal uses of plants appeared in about 2600 bc from the sumerians and akkaidians (samuelsson, 1999). the “ebers papyrus”, the best known egyptian pharmaceutical record, which documented over 700 drugs, represents the history of egyptian medicine dated from 1500 bc. the chinese materia medica, which describes more than 600 medicinal plants, has been well documented with the first record dating from about 1100 bc (cragg et al., 1997). documentation of the ayurvedic system recorded in susruta and charaka dates from about 1000 bc (kappor, 1990). the greeks also contributed substantially to the rational development of the herbal drugs. dioscorides, the greek physician (100 a.d.), described in his work “de materia medica” more than 600 medicinal plants (samuelsson, 1999). the world health organization estimates that approximately 80% of the world’s inhabitants rely on traditional medicine for their primary health care (farnsworth et al., 1985). cancer is a major public health burden in both developed and developing countries. it was estimated that there were 10.9 millions new cases, 6.7 million deaths, and 24.6 million persons living with cancer around the world in 2002 (parkin et al., 2005). cancer is the second leading cause of death in the united states (hoyert et al., 2005), where one in four deaths is due to cancer. plants have long been used in the treatment of cancer (hartwell, 1982). the national cancer institute collected about 35,000 plant samples from 20 countries and has screened around 114,000 extracts for anti-cancer activity (shoeb, 2005). of the 92 anti-cancer drugs commercially available prior to 1983 in the us and among world wide approved anti-cancer drugs between 1983 and 1994, 60% are of natural origin (cragg et al., 1997). in this instance, natural origin is defined as natural products, derivatives of natural products or synthetic pharmaceuticals based on natural product models (jaspars and lawton, 1998). a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 35-41 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract cancer is a major public health burden in both developed and developing countries. plant derived agents are being used for the treatment of cancer. several anti-cancer agents including taxol, vinblastine, vincristine, the camptothecin derivatives, topotecan and irinotecan, and etoposide derived from epipodophyllotoxin are in clinical use all over the world. a number of promising agents such as flavopiridol, roscovitine, combretastatin a-4, betulinic acid and silvestrol are in clinical or preclinical development. article info received: 29 november 2006 accepted: 20 december 2006 available online: 3 january 2008 doi: 10.3329/bjp.v1i2.486 cite this article: shoeb m. anti-cancer agents from medicinal plants. bangladesh j pharmacol. 2006; 1: 35-41. anti-cancer agents from medicinal plants mohammad shoeb department of chemistry, university of dhaka, dhaka 1000, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. m in i-r ev ie w plant-derived anti-cancer agents in clinical use the isolation of the vinca alkaloids, vinblastine (1) and vincristine (2) from the madagascar periwinkle, catharanthus roseus g. don. (apocynaceae) introduced a new era of the use of plant material as anti-cancer agents. they were the first agents to advance into clinical use for the treatment of cancer (cragg and newman, 2005). vinblastine and vincristine are primarily used in combination with other cancer chemotherapeutic drugs for the treatment of a variety of cancers, including leukemias, lymphomas, advanced testicular cancer, breast and lung cancers, and kaposi’s sarcoma (cragg and newman, 2005). the discovery of paclitaxel (taxolò, 3) from the bark of the pacific yew, taxus brevifolia nutt. (taxaceae), is another evidence of the success in natural product drug discovery. various parts of taxus brevifolia and other taxus species (e.g., taxus canadensis marshall, taxus baccata l.) have been used by several native american tribes for the treatment of some non-cancerous cases (cragg and newman, 2005) while taxus baccata was reported to use in the indian ayurvedic medicine for the treatment of cancer. the structure of paclitaxel was elucidated in 1971 and was clinically introduced to the 36 bangladesh j pharmacol 2006; 1: 35-41 n n o ome h me o me o r h meo oh n h n me oh o ome nh o o oh o me me me oo me o me o h oh oh o me o o o n n o o ooh me n n o o ooh oh me n me me n n o o ooh me me on o n 1 r=me 2 r=cho 3 4 6 5 figure 1: plant-derived anti-cancer agents in clinical use us market in the early 1990s (wani et al., 1971; rowinsky et al., 1992). paclitaxel is significantly active against ovarian cancer, advanced breast cancer, small and non-small cell lung cancer (rowinsky et al., 1992). camptothecin (4), isolated from the chinese ornamental tree camptotheca acuminate decne (nyssaceae), was advanced to clinical trials by nci in the 1970s but was dropped because of severe bladder toxicity (potmeisel, 1995). topotecan (5) and irinotecan (6) are semisynthetic derivatives of camptothecin and are used for the treatment of ovarian and small cell lung cancers, and colorectal cancers, respectively (creemers et al., 1996; bertino, 1997). epipodophyllotoxin is an isomer of podophyllotoxin (7) which was isolated as the active anti-tumor agent from the roots of podophyllum species, podophyllum peltatum linnaeus and podophyllum emodi wallich (berberidaceae) (stahelin, 1973). etoposide (8) and teniposide (9) are two semi-synthetic derivatives of epipodophyllotoxin and are used in the treatment of lymphomas and bronchial and testicular cancers (cragg and newman, 2005; harvey, 1997). homoharringtonine (10), isolated from the chinese tree cephalotaxus harringtonia var. drupacea (sieb and zucc.) (cephalotaxaceae), is another plant-derived agent in clinical use (itokawa et al., 2005; powell et al, 1970). a racemic mixture of harringtonine and homoharringtonine has been used successfully in china for the treatment of acute myelogenous leukemia and chronic myelogenous leukemia (cragg and newman, 2005; kantarjian et al., 1996). elliptinium (11), a derivative of ellipticine, isolated from a fijian medicinal plant bleekeria vitensis a.c. sm., is marketed in france for the treatment of breast cancer (cragg and newman, 2005). plant-derived anti-cancer agents for future development numerous types of bioactive compounds have been isolated from plant sources. several of them are currently in clinical trials or preclinical trials or figure 1: plant-derived anti-cancer agents in clinical use (continued) o o o or h h o or' meo ome o oh oh o o h me o oh oh o o h s o o n h ome o o me o oh me me oh o n h n oh me me me 7 8 h me h 9 h r r' 10 mecoo+ 11 bangladesh j pharmacol 2006; 1: 35-41 37 figure 2: plant-derived anti-cancer agents for future development oh ome ome meo meo oh oh n cl ch 3 oh o n n n n ch 3 ch 3 nh oh ch 3 nh oh h h h o oh o ome meo meo o n oh o o ome ome ome ch 3 o o o o oh oh coome ome oh oh h ome ome nn n h n h o n h n h o nh oh n o oh ome nh oh n o oh ome 14 12 13 15 16 17 18 19 38 bangladesh j pharmacol 2006; 1: 35-41 undergoing further investigation. flavopiridol (12) is a synthetic flavone, derived from the plant alkaloid rohitukine, which was isolated from dysoxylum binectariferum hook. f. (meliaceae) (kellard et al., 2000). it is currently in phase i and phase ii clinical trials against a broad range of tumors, including leukemia, lymphomas and solid tumors (christian et al., 1997). synthetic agent roscovitine (13) which is derived from natural product olomucine, originally isolated from raphanus sativus l. (brassicaceae), is in phase ii clinical trials in europe (cragg and newman, 2005; meijer et al., 2003). combretastatins were isolated from the bark of the south african tree combretum caffrum (eckl. & zeyh.) kuntze (combretaceae) (pettit et al., 1987). combretastatin a-4 (14) is active against colon, lung and leukemia cancers and it is expected that this molecule is the most cytotoxic phytomolecule isolated so far (ohsumi et al., 1998; pettit et al., 1995). betulinic acid (15), a pentacyclic triterpene, is a common secondary metabolite of plants, primarily from betula species (betulaceae) (cichewitz et al., 2004). betulinic acid was isolated from zizyphus species, e.g. mauritiana, rugosa and oenoplia (pisha et al., 1995; nahar et al., 1997) and displayed selective cytotoxicity against human melanoma cell lines (balunas et al., 2005). the development of systemic and topical formulations of the agent for potential clinical trials by the nci is ongoing (cragg and newman, 2005). pervilleine a (16) was isolated from the roots of erythroxylum pervillei baill. (erythroxylaceae) (silva et al., 2001). pervilleine a was selectively cytotoxic against a multidrug resistant (mdr) oral epidermoid cancer cell line (kb-v1) in the presence of the anti-cancer agent vinblastine (mi et al., 2001). pervilleine a is currently in preclinical development (mi et al., 2003). silvestrol (17) was first isolated from the fruits of aglaila sylvestre (m. roemer) merrill (meliaceae) (hwang et al., 2004). silvestrol exhibited cytotoxicity against lung and breast cancer cell lines (cragg and newman, 2005). biological studies are ongoing to determine the mechanism(s) of action for silvestrol. two novel alkaloids, schischkinnin (18) and montamine (19) have been isolated from the seeds of centaurea schischkinii and centaurea montana (shoeb et al., 2005; 2006). both of the alkaloids exhibited significant cytotoxicity against human colon cancer cell lines. the unique structural features of 18 and 19 can be exploited as a template for generating compounds with enhanced anti-cancer activity. however, further investigations are necessary for their use as anti-cancer agents. conclusion natural products discovered from medicinal plants have played an important role in the treatment of cancer. natural products or natural product derivatives comprised 14 of the top 35 drugs in 2000 based on worldwide sales (butlet, 2004). two plant derived natural products, paclitaxel and camptothecin were estimated to account for nearly one-third of the global anti-cancer market or about $3 billion of $9 billion in total annually in 2002 (oberlines and kroll, 2004). there are more than 270,000 higher plants existing on this planet. but only a small portion has been explored phytochemically. so, it is anticipated that plants can provide potential bioactive compounds for the development of new ‘leads’ to combat cancer diseases. financial support self-funded conflict of interest author declares no conflict of interest references balunas mj, kinghorn ad. drug discovery from medicinal plants. life sci. 2005; 78: 431-41. bertino jr. irinotecan for colorectal cancer. semin oncol. 1997; 24: s18-23. butlet ms. the role of natural product chemistry in drug discovery. j nat prod. 2004; 67: 2141-53. cichewitz rh, kouzi sa. chemistry, biological activity, and chemotherapeutic potential of betulinic acid for the prevention and treatment of cancer and hiv infection. med res rev. 2004; 24: 90-114. cox pa. ethnopharmacology and the search for new drugs. in: bioactive compounds from plants. ciba foundation symposium 154. chichester, england, john wiley and sons, 1990, pp 40-55. christian mc, pluda jm, ho tc, arbuck sg, murgo aj, sausville ea. promising new agents under development by division of cancer treatment, diagnosis, and centers of the national cancer institute. semin oncol. 1997; 13: 2643-55. cragg gm, newman dj, snader km. natural products in drug discovery and development. j nat prod. 1997; 60: 52-60. cragg gm, newman dj. plants as source of anti-cancer agents. j ethnopharmacol. 2005; 100: 72-79. bangladesh j pharmacol 2006; 1: 35-41 39 creemers gj, bolis g, gore m, scarfone g, lacave aj, guastalla jp, despax r, favalli g, kreinberg r, vanbelle s, hudson i, verweij j, huinink wwt. topotecan, an active drug in the second-line treatment of epithelial ovarian cancer: results of a large european phase ii study. j clin oncol. 1996; 14: 3056-61. farnsworth nr, akerele o, bingel as, soejarto dd, guo z. medicinal plants in therapy. bull world health organ. 1985; 63: 965-81. hartwell jl. plants used against cancer: a survey. lawrence, ma. quarterman publications, 1982, pp 438-39. harvey al. medicines from nature: are natural products still relevant to drug discovery. trends pharmacol sci. 1999; 20: 196-98. hoyer dl, kung hc, smith bl. natl vital stat rep. 2005; 53: 148. hwang by, su bn, chai h, mi q, kardono lb, afriastini jj, riswan s, santarsiero b d, mesecar ad, wild r, fairchild cr, vite gd, rose wc, farnsworth nr, cordell ga, pezzuto jm, swanson sm, kinghorn ad. silvestrol and episilvestrol, potential anti-cancer rocaglate derivatives from aglaila silvestris. j org chem. 2004; 69: 3350-58 (ibid. 69 (18), 6156). itokawa h, wang x, lee kh. homoharringtonine and related compounds. in: cragg gm, kingston, dgi, newman d, (eds). anti-cancer agents from natural products. boca raton, florida, brunner-routledge psychology press, taylor & francis group, 2005, pp 47-70. jaspars m, lawton la. cyanobacteria as a novel source of pharmaceuticals. curr opin drug discovery develop. 1998; 1: 77-84. kantarjian hm, o’brien s, anderlini p, talpaz m. treatment of chronic myelogenous leukemia: current status and investigational options. blood 1996; 87: 3069-81. kappor ld. crc handbook of ayurvedic medicinal plants. boca raton, florida, crc press, 1990, pp 416-17. kelland lr. flavopiridol, the first cyclic-dependent kinase inhibitor to enter the clinic: current status. expert opin investig drugs. 2000; 9: 2903-11. meijer l, raymond e. roscovitine and other purines as kinase inhibitors. from starfish oocytes to clinical trials. accounts chem res. 2003; 36: 417-25. mi q, cui b, silva gl, lantvit d, lim e, chai h, you m, hollingshead mg, mayo jg, kinghorn ad, pezzuto jm. pervilleine a, a novel tropane alkaloid that reverses the multidrug-resistance phenotype. cancer res. 2001; 61: 84250. mi q, cui b, silva gl, lantvit d, reyes-lim e, chai h, pezzuto jm, kinghorn ad, swanson sm. pervilleine f, a new tropane alkaloid aromatic ester that reverses the multidrug-resistance phenotype. anti-cancer res. 2003; 23: 3607-16. nahar n, das rn, shoeb m, marma ms, aziz ma, mosihuzzaman m. four triterpenoids from the bark of zizyphus rugosa and z. oenoplia. j bangladesh academy sci. 1997; 21: 151-56. oberlines nh, kroll dj. camptothecins and taxol: historic achievement in natural products research. j nat prod. 2004; 67: 129-35. ohsumi k, nakagawa r, fukuda y, hatanaka t, morinaga y, nihei y, ohishi k, suga y, akiyama y, tsuji t. new combretastatin analogues effective against murine solid tumors: design and structure-activity relationship. j med chem. 1998; 41: 705-06. parkin dm, bray f, ferlay j, pisani p. global cancer statistics, 2002. ca cancer j clin. 2005; 55: 74-108. pettit gr, singh sb, niven ml, hamel e, schmit jm. isolation, structure, and synthesis of combretastatins a-1 and b-1, potent new inhibitors of microtubule assembly, derived from combretum caffrum. j nat prod. 1987; 50: 119-20. pettit gr, singh sb, boyd mr, hamel e, pettit r, schmit jm, hogan f. antineoplastic agents. 291. isolation and synthesis of combretastatins a-4, a-5 and a-6. j med chem. 1995; 38: 1666-72. pisha e, chai h, lee is, chagwedera te, farnsworth nr, cordell ga, beecher cw, fong hh, kinghorn ad, brown dm, wani mc, wall me, hieken tj, das gupta tk, pezzuto jm. discovery of betulinic acid as a selective inhibitor of human melanoma that functions by induction of apoptosis. nat med. 1995; 1: 1046-51. potmeisel m, pinedo h. camptothecins: new anti-cancer agents. boca raton, florida, crc press, 1995, pp 149-50. powell rg, weisleder d, smith crjr, rohwedder wk. structures of harringtonine, isoharringtonine, and homoharringtonine. tetrahedron lett. 1970; 11: 815-18. rowinsky ek, onetto n, canetta rm, arbuck sg, taxol-the 1st of the texanes, an important new class of anti-tumor agents. semin oncol. 1992; 19: 646-62. samuelsson g. drugs of natural origin: a textbook of pharmacognosy. 4th ed., stockholm, swedish pharmaceutical press, 1999. shoeb m. cytotoxic compounds from the genus centaurea. phd thesis. aberdeen, uk, the robert gordon university, 2005. shoeb m, celik s, jaspars, m, kumarasamy y, macmanus s, nahar l, kong tlp, sarker sd. isolation, structure elucidation and bioactivity of schischkiniin, a unique indole alkaloid from the seeds of centaurea schischkinii. tetrahedron 2005; 61: 9001-06. shoeb m, macmanus sm, jaspars m, trevidadu j, nahar l, thoo-lin pk, sarker sd. montamine, a unique dimeric 40 bangladesh j pharmacol 2006; 1: 35-41 author info mohammad shoeb (principal contact) e-mail: shoeb71@yahoo.com indole alkaloid, from the seeds of centaurea montana (asteraceae), and its in vitro cytotoxic activity against the caco2 colon cancer cells. tetrahedron 2006; 62: 11172-77. silva gl, cui b, chavez d, you m, chai hb, rasoanaive p, lynn sm, o’neill mj, lewis ja, besterman jm, monks a, farnsworth nr, cordell ga, pezzuto jm, kinghorn ad. modulation of the multidrug-resistance phenotype by new tropane alkaloids aromatic esters from erythroxylum pervillei. j nat prod. 2001; 64: 1514-20. stahelin h. activity of a new glycosidic lignan derivative (vp 16-213) related to podophyllotoxin in experimental tumors. eur j cancer. 1973; 9: 215-21. wall me, wani mc. camptothecin and taxol: from discovery to clinic. j ethnopharmacol. 1996; 51: 239-53. wani mc, taylor hl, wall me, coggon p, mcphail at. plant anti-tumor agents. vi. the isolation and structure of taxol, a novel anti-leukemic and anti-tumor agent from taxus brevifolia. j am chem soc. 1971; 93: 2325-27. bangladesh j pharmacol 2006; 1: 35-41 41 bangladesh journal of pharmacology research article artemisia scoparia: a new source of artemisinin bjp introduction malaria is one of the world’s most important parasitic diseases. there are at least 300 million acute cases of malaria each year globally, resulting in more than a million deaths. multi-drug resistance of the plasmodium strains to the cheapest and most widely used antimalarials such as chloroquine, mefloquine and sulfadoxinepyrimethamine is one of the biggest challenges in the fight against malaria. artemisia annua l. (sweet wormwood), a herb of the asteraceae family has been used for centuries for the treatment of fever and malaria. the who recommends that all countries experiencing resistance to conventional monotherapies should use combination therapies, preferably those containing artemisinin derivatives (acts-artemisinin-based combination therapies). as artemisinin cannot be synthesized chemically in an economically feasible way, a. annua is the only practical source of this valuable drug. artemisinin is the new and promising drug which is also active against resistant plasmodium malaria (mcintosh and olliaro, 2004). extensive work on the production of artemisinin from plant of a. annua has been done (actona and klayman, 1985; acton et al., 1985; el-sohly, 1990; jha et al., 1988; ferreira and janick, 1996a, 1996b; ferreira et al., 1994; ferreira and simon, 1995a, 1995b; theoharides et al., 1988; titulaer et al., 1990). artemisinin has also been reported from tissue culture of this plant (jha et al., 1988; fulzele et al., 1991; jaziri, 1995; martinez and staba, 1992; nair et al., 1986; van nieuwerburgh et al., 2006) and biochemical as well as molecular approaches for enhanced production of artemisinin from a. annua has also been tried (abdin et al., 2003; van nieuwerburgh et al., 2006). the present investigation has reported a. scoparia waldst et kit. as a new source of artemisinin. materials and methods unorganized callus of a. scoparia was raised from the young nodal stem segments. the sterile nodal segments were inoculated on ms medium supplemented with 2, 4-d (3 mg/l), kinetin (0.25 mg/l) and proline (100 mg/l). callus initiation started after 15-20 days of inoculation and maintained on ms medium by frequent subculturing after 6-8 weeks for a period of 8 months before using it for the biochemical analysis. old callus (4-6 weeks) as well as aerial plant parts were harvested and subjected to extraction procedures for artemisinin separately. aerial plant parts and harvested callus were dried and abstract artemisinin is considered as the most active and potent antimalarial drug. till date artemisia annua linn. plant is the only source for its production. the present investigation was carried out with an objective to search a new plant for artemisinin. an attempt was made on a perennial faintly odoratus herb, artemisia scoparia waldst et kit. to find out an alternative of a. annua for the production of artemisinin. the yield of artemisinin was higher in aerial plant parts (0.015%) in comparison to callus culture (0.001%). the present study concluded that a. scoparia contains an antimalarial drug artemisinin. article info received: 27 april 2010 accepted: 27 april 2010 available online: 4 may 2010 doi: 10.3329/bjp.v5i1.4901 cite this article: singh a, sarin r. artemisia scoparia: a new source of artemisinin. bangladesh j pharmacol. 2010; 5: 17-20. artemisia scoparia: a new source of artemisinin aditi singh and renu sarin laboratory of bioactive compounds, department of botany, university of rajasthan, jaipur 302004, india. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2010; 5: 17-20 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded and social sciences citation index issn: 1991-0088 powdered and extracted by continuous percolation over a period of four to six hours using five to ten fold volume of the non-aqueous solvent ethanol. the extraction process was repeated three to five times to ensure maximum extraction of artemisinin from the herb. the resulting extract was concentrated to 1 to 5% of the original volume by distillation under vacuum. the excess of water (four times of the reduced volume of ethanol extract) to be added to the concentrated to make it 80% aqueous followed by partitioning of the contents between water and hexane. for partitioning, the aqueous content and hexane were used in a ratio of 1:1 or 2:1 v/v. partitioning of aqueous content with hexane were repeated three to five times using the same solvent ratio in order to ensure maximum transfer of artemisinin to hexane fraction. the combined hexane fractions were pooled together before they were distilled under vacuum (to recover the solvent for using again) to obtain 1-5% of its original volume. the concentrated liquid was a light to dark green oily liquid. ethyl acetate (10-20% v/v) is added to it. to remove the green pigmentation this liquid was treated with 1-3% w/v of activated charcoal. the yellowish liquid obtained after removal of activated charcoal (by filtration) was subjected to the evaporative crystallization yielding substantially pure artemisinin. the purified crystals thus obtained were further analyzed for artemisinin by infra-red spectroscopy, thin layer chromatography and nuclear magnetic resonance thin layer chromatography (tlc) thin glass plates coated with silica gel ‘g’ were prepared and activated. the extract so obtained were dissolved in ethanol and applied separately 1 cm above the edge of the activated plates along with the standard reference compound of artemisinin. the glass plates were then developed in an 50:2 ratio organic solvent mixture of dichloromethane and ethyl acetate (de vries et al., 1999). the plates were sprayed with a spray mixture consist of 1.5 ml anisaldehyde, 30 ml glacial acetic acid, 225 ml methanol and 1.5 ml sulphuric acid. the plates were dried for 5 min at 110-120ºc and after cooling sprayed again for at least 10 sec and dried for 10 min at constant temperature. infra red spectroscopy the ir spectra of isolated and standard artemisinin were developed in kbr disc on a perkin elmer, 337, grating infra red spectrophotometer (4000 to 400 cm-1). when the spectrums of both the isolated and standard artemisinin were superimposed there was a similarity in the peaks of isolated and standard compounds at corresponding points. nuclear magnetic resonance the nmr of the isolated artemisinin was developed by dissolving the samples in dimethyl sulfoxide (nmr grade d6). results and discussion in the present investigation presence of artemisinin in a. scoparia plant as well as in callus tissue was confirmed by tlc, ir and mnr studies. by thin layer chromatographic studies a brown spot with rf value of 0.7 corresponding with that of standard compound was observed. the ir spectrum of the extracts of callus tissue and aerial plant parts showed considerable over lapping with the ir spectra of standard artemisinin (figure 1 and 2). 1h nmr spectra of the plant extract were done in dmso (d6, nmr grade) matched considerably with that of artemisinin spectra provided in literature (extraction of ionic liquids; bioniqs ltd) indicating the presence of artemisinin in the extracts of a. scoparia 18 bangladesh j pharmacol 2010; 5: 17-20 figure 1: ir spectra of standard and isolated artemisinin from artemisia scoparia waldst et kit. tissue culture (figure 3). the yield of artemisinin was higher (0.015%) in aerial plant parts in comparison to that of callus cultures (0.001%; figure 4). the present investigation confirms that aerial plant parts and callus cultures of a. scoparia waldst et kit. has the potentiality to produce artemisinin. this study concluded that a. scoparia besides possessing antibacterial and insecticidal properties also contains artemisinin. thus, the plants of a. scoparia hold a new promise to the field of medicinally and economically important bioactive compounds which should be explored further to open new vistas for mankind. acknowledgement the authors are grateful to head, department of botany and figure 2: ir spectra of standard and isolated artemisinin from aerial plant parts of artemisia scoparia waldst et kit figure 3: 1h nmr spectra of artemisinin isolated from aerial plant parts of artemisia scoparia waldst et kit figure 4: unorganised callus of artemisia scoparia bangladesh j pharmacol 2010; 5: 17-20 19 author info aditi singh (principal contact) e-mail: aditisingh_21@yahoo.co.in head, department of chemistry for providing the lab facilities to carry out this work. references abdin mz, israr m, rehman ru, jain sk. artemisinin, a novel antimalarial drug: biochemical and molecular approaches for enhanced production. planta med. 2003; 69: 289-99. acton n, klayman dl. artemisinin, a new sesquiterpene lactone endoperoxide from artemisia annua. planta med. 1985; 47: 442-45. acton n, klayman dl, rollman ij. reductive electrochemical hplc assay for artemisinin (qinghaosu). planta med. 1985; 51: 445-46. de vries p, dien tk. clinical pharmacology and therapeutic potential of artemisinin and its derivatives in the treatment of malaria. drugs 1996; 52: 818–36. elsohly hn, croom em, el-feraly fs, el-sherei mm. a large scale extraction technique of artemisinin from artemisia annua. j nat prod. 1990; 53: 1560-64. ferreira jf, janick j. a comparison of gas chromatography and high performance liquid chromatography for artemisinin analyses. j phytochem. 1996a; 41: 97-104. ferreira jf, charles dj, wood k, simon je, janick j. a comparison of gas chromatography and high performance liquid chromatography for artemisinin analyses. phytochem anal. 1994; 5: 116-20. ferreira jf, janick j. roots as an enhancing factor for the production of artemisinin in shoot cultures of artemisia annua. plant cell tissue organ cult. 1996b; 44: 211-17. ferreira jf, simon je, janick j. developmental studies of artemisia annua: flowering and artemisinin production under greenhouse and field conditions. planta med. 1995a; 61: 167-70. ferreira jf, simon je, janick j. relationship of artemisinin content of tissue-cultured, greenhouse-grown, and fieldgrown plants of artemisia annua. planta med. 1995b; 61: 35155. fulzele dp, sipahimalani at, heble mr. tissue cultures of artemisia annua: organogenesis and artemisinin production. phytother res. 1991; 5: 149-53. jaziri m, shimomura k, yoshimatsu k, fauconnier ml, marlier m, homes j. establishment of normal and transformed root cultures of artemisia annua l. for artemisinin production. j plant physiol. 1995; 145: 175-77. jha j, jha tb, mahato sb. tissue culture of artemisia annua l.: a potential source of an antimalarial drug. curr sci. 1988; 57: 344-46. martinez bc, staba ej. the production of artemisinin in artemisia annua l. tissue cultures. adv cell cult. 1988; 6: 6987. mcintosh hm, olliaro p. artemisinin derivatives for treating severe malaria. the cochrane library 2. oxford, update software, 2004. nair ms, acton n, klayman dl, kendrick k, basile dv, mante s. production of artemisinin in tissue cultures of artemisia annua. j nat prod. 1986; 49: 504-07. theoharides ad, smyth mh, ashmore rw, halverson jm, zhou zm, ridder we, lin aj. determination of dihydroqinghaosu in blood by pyrolysis gas chromatography/mass spectrometry. j anal chem. 1988; 60: 115-20. titulaer ha, zuidema j, kager pa, wetsteyn jc, lugt cb, merkus fw. the pharmacokinetics of artemisinin after oral, intramuscular and rectal administration to volunteers. j pharm pharmacol. 1990; 42: 810–13. van nieuwerburgh fc, vande casteele sr, maes l, goossens a, inzé d, van bocxlaer j, deforce dl. quantitation of artemisinin and its biosynthetic precursors in artemisia annua l. by high performance liquid chromatographyelectrospray quadrupole time-of-flight tandem mass spectrometry. j chromatogr a. 2006; 1118: 180-87. 20 bangladesh j pharmacol 2010; 5: 17-20 introduction: materials and methods: results and discussion: figure 3 1h nmr spectra of artemisinin isolated from aerial plant parts of artemisia scoparia waldst et kit: figure 4 unorganised callus of artemisia scoparia: acknowledgement: references: author info aditi singh principal contact email aditisingh21yahoocoin: dateprinted: bangladesh journal of pharmacology research article status of sennosides content in various indian herbal formulations: method standardization by hptlc bjp introduction cassia angustifolia (family: caesalpiniaceae), popularly known as senna, is a valuable plant drug in ayurvedic and modern system of medicine for the treatment of constipation (atal et al., 1982; das et al., 2003; martindale, 1977; sharma, 2004). sennoside a and b are the two anthraquinone glycosides that are responsible for purgative action of senna. a variety of poly-herbal formulations containing senna leaves are available in india to relief constipation and allied troubles. senna is a strong purgative that should be taken in proper dosage otherwise it may lead to gripping and colon problem (bhattacharjee, 2004). different analytical techniques, viz, thin layer chromatography, spectrophotometry, column chromatography have been reported in the literature for estimation of sennosides (azam et al., 2002; bala et al., 2000; habib et al., 1980; lin et al., 1998). hptlc method has also been reported (shah et al., 2000). but these techniques are tedious and time consuming. the present paper reports a simple, rapid and accurate hptlc method for analysis of sennoside a and b occurring in herbal formulations and to make an assessment on the status of sennoside a and b content in the laxative formulations. materials and methods ten different branded herbal formulations (polyherbal, a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2008; 3: 64-68 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract several polyherbal formulations containing senna (cassia angustifolia) leaves are available in the indian market for the treatment of constipation. the purgative effect of senna is due to the presence of two unique hydroxy anthracene glycosides sennosides a and b. a hptlc method for the quantitative analysis of sennosides a and b present in the formulation has been developed. methanol extract of the formulations was analyzed on a silica gel 60 gf254 hptlc plates with spot visualization under uv and scanning at 350 nm in absorption/reflection mode. calibration curves were found to be linear in the range 200-1,000 ng. the correlation coefficients were found to be 0.991 for sennoside a and 0.997 for sennoside b. the average recovery rate was 95% for sennoside a and 97% for sennoside b showing the reliability and reproducibility of the method. limit of detection and quantification were determined as 0.05 and 0.25 μg/g respectively. the validity of the method with respect to analysis was confirmed by comparing the uv spectra of the herbal formulations with that of the standard within the same rf window. the analysis revealed a significant variation in sennosides content. article info received: 14 may 2008 accepted: 20 may 2008 available online: 20 may 2008 doi: 10.3329/bjp.v3i2.839 cite this article: aktar mw, poi r, bhattacharyya a. status of sennosides content in various indian herbal formulations: method standardization by hptlc. bangladesh j pharmacol. 2008; 3: 64-68. status of sennosides content in various indian herbal formulations: method standardization by hptlc md. wasim aktar, rajlakshmi poi and anjan bhattacharyya regional analytical laboratory for medicinal and aromatic plants, department of agricultural chemicals, bidhan chandra krishi viswavidyalaya, mohanpur 741252, nadia, west bengal, india. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. powdered/microgranules) were collected from herbal shops of local markets. analytical standards of sennoside a and b were obtained from m/s. chromadex, santa ana, ca, usa. solvents (methanol, 2-propanol, ethyl acetate, formic acid) used in entire study were from merck, india. preparation of standard solutions standard solutions of sennoside a and sennoside b (1 mg/5 ml) were prepared in methanol. extraction of samples each 4 g of different branded formulation was sonnicated with 70% methanol (3 x 20 ml) for about 45 min. then the extract was filtered in a buchner funnel using whatman no. 1 filter paper and was concentrated under vacuum in a rotary evaporator at 50ºc, redissolved in methanol and finally reconstituted in 20 ml methanol prior to hptlc analysis. chromatographic parameters chromatography was performed on glass-backed silica gel 60 gf254 hptlc layers (20 x 20 cm; 0.3 mm layer thickness) prepared using a camag tlc plate auto coater (camag, switzerland). samples and standard compounds 1 and 2 of known concentrations were applied as 8 mm wide bands using camag linomat 5 automated tlc applicator (camag, multenz, switzerland) with nitrogen flow providing delivery speed 150 nl/sec from the syringe. these parameters were kept constant through out the analysis. detection and quantification of sennosides after completion of sample application, the plate was developed in a camag twin through glass tank presaturated with mobile phase of 2-propanol: ethyl acetate: water: formic acid (17:19:12:2.) for one hour. the tlc runs were performed under laboratory conditions of 25 ± 2ºc and 60% relative humidity. after development the plates were taken off and dried by drier. sennosides a and b were quantified using a camag tlc scanner model 3 equipped with camag wincats software applying the following conditions: slit width 6 x 0.5 mm, wavelength (λmax) 350 nm, absorption -reflection scan mode. the identification of sennosides a and b in formulations was confirmed by superimposing the uv spectra of samples and standards within the same rf window. validation of hptlc method the linearity of the method was evaluated by analyzing a series of standard solutions. eight different concentrations of standard solutions (each volume repeated twice) containing sennosides a and b were analyzed by hptlc exactly as described above and the standard calibration curves were obtained by plotting the concentration of standard solutions versus peak area. the amount of sennosides a and b present in the formulations were determined by means of calibration curve. to study the accuracy and precision of the method, recovery studies were performed by addition of standard solutions 0.1, 0.5 and 1 μg per gram of the formulations and the quantitative analysis was repeated thrice. peak purity test of sennoside a and b were done by comparing uv spectra of sennoside a and b respectively in standard and sample tracks. peak purity results (obtained by scanning at 350 nm) were satisfactory. results and discussion figure 1 shows the distinct separate bands of sennoside a and b by tlc. the high resolution and reproducible peaks were obtained (figure 2) by using the mobile phase 2-propanol: ethyl acetate: water: formic acid (17:19:12:2). the wavelength 350 nm was found to give the highest sensitivity. linearity of sennoside a and b was found in the concentration range 200-1000 ng. regression analysis of the experimental data points showed a linear relationship with excellent correlation coefficient (r) of sennoside a and sennoside b of 0.991 and 0.997, respectively (table i). the average recovery rate was 95% for sennoside a and 97% for sennoside b (table ii) showing the reliability and reproducibility of the method. in this study the limit of detection (lod) and limit of quantification of sennoside a and b were determined to be 0.05 and 0.25 mg/g. the result (table iii) showed that the relative amount of sennoside a and b in formulation-1 was highest and in formulation-10 it was lowest. the result reflected a 2.8 times higher concentration in formulation-1 compared to that of formulation-10. the minimum content of sennoside b (considering the highest content as 100%) was shown only by 5.4% in case of formulation-10 and less than 17.5% in case of formulation number ‘3’ to ‘9’. this result clearly revealed that there is a significant variation of sennoside a and b content in popular herbal formulations. since the chemical contents are biologically active, variation in their daily dose may impact on health benefits. therefore, it is necessary that herbal formulations should always be analyzed to bangladesh j pharmacol 2008; 3: 64-68 65 66 bangladesh j pharmacol 2008; 3: 64-68 figure 1: tlc plate showing the distinct separation of sennoside a and b after development in twin trough chamber figure 2: scan (at 350 nm) showing the separation of sennoside a and b in the extract of a laxative formulation maintain the quality of the herbs present inthe formulation. conclusion the proposed hptlc method can be used for the determination of sennoside a and b in various commercial formulations for quality evaluation. method is very simple, rapid and suitable for rapid screening of plant materials for genotypic assessment and can be performed without any special sample pretreatment. the method is less expensive than an lc method. the method is, thus, suitable for quality control laboratories, where economical use of time and space is essential. financial support ministry of agriculture, government of india, nmpb, government of india and fpi & h, government of west bengal ethical issue the study was approved by the ethical committee of the bidhan chandra krishi viswavidyalaya conflict of interest authors declare no conflict of interest references atal ck, kapoor bm. cultivation and utilization of medicinal plants. jammu twai, india, rrl, 1982, p 8. azam mm, limy t. an improved hplc method for estimation of sennosides in senna. indian j pharm sci. 2002; 64: 178-81. bala s, uniyal gc, dubey t, singh sp. an improved method for the analysis of sennosides in cassia angustifolia by hplc presented on national seminars on frontiers of research and development in medicinal plants. lucknow, cimap, 2000. bhattacharjee sk. a handbook of medicinal plant. jaipur, bangladesh j pharmacol 2008; 3: 64-68 67 table ii precision and recovery result in spike test of sennoside a and sennoside b compound amount fortified (mg/g) observed value (mg/g) observed value (mg/g) observed value (mg/g) c.v. (%) average recovery (%) sennoside a 0.1 0.097 0.089 0.098 5.10 95 sennoside a 0.5 0.451 0.484 0.493 4.65 95 sennoside a 1.0 0.981 0.933 0.942 2.68 95 sennoside b 0.1 0.098 0.102 0.105 3.45 97 sennoside b 0.5 0.482 0.462 0.501 4.04 97 sennoside b 1.0 0.954 0.991 1.01 3.01 97 table iii sennoside a and b in selected herbal formulations herbal formulations sennoside a (mg/g of formulation) sennoside b (mg/g of formulation) formulation-1 2.5 25.9 formulation-2 2.3 12.7 formulation-3 2.1 2.6 formulation-4 1.8 1.9 formulation-5 1.6 1.9 formulation-6 1.6 1.7 formulation-7 1.4 4.5 formulation-8 1.2 1.5 formulation-9 0.9 1.5 formulation-10 0.9 1.4 table i rf values by hptlc and linear regression equation for the determination of sennoside a and b compound rf value regression equation r sennoside a 0.84 y=7.087x+107.744 0.991 sennoside b 0.63 y=3.589x+702.086 0.997 author info md. wasim aktar (principal contact) e-mail: wasim04101981@yahoo.co.in india, pointer publisher, 2004, pp 74-79. das pn, purohit ss, sharma ak, kumar t. a handbook of medicinal plants. jodhpur, india, agrobios, 2003, p 118. evans fj, lee mg, games de. electron impact, chemical ionization and field desorption mass spectra of some anthraquinone and anthrone derivatives of plant origin. biol mass spectrometry. 1979; 6: 374-80. habib aa, ei-sebakhy na. spectrophotometric estimation of sennosides and rhein glycosides in senna and its preparations. j nat prod. 1980; 43: 452-58. khafagy sm, girgis an, khayyal se, helmi ma. estimation of sennosides a, b, c and d in senna leaves, pods and formulation. planta med. 1972; 21: 304-09. lin yt, huang cy. determination of sennoside a and b in diet tea by hplc. j fd drug anal. 1998; 6: 433-38. martindale. the extra pharmacopoeia. 27th ed. london, the pharmaceutical press, 1977, pp 1342-43. shah sa, ravisankara mn, nirmal a, shishoo cj, rathod is, suhagia bn. estimation of individual sennosides in plant material and marketed formulations by an hptlc method. j pharm pharmocol. 2000; 52: 445-49. sharma r. agro-techniques of medicinal plants. delhi, daya publishing house, 2004, pp 176-77. 68 bangladesh j pharmacol 2008; 3: 64-68 bangladesh journal of pharmacology research article effect of endophytic fungi daldinia eschscholtzii against multidrug resistant pathogens bjp introduction natural products are most likely to afford a wide range of difficult-to-synthesize structures, making them the prospective sources of novel antibiotic classes (bate et al., 2020). fungi are the most often isolated endophytes. opportunities exist for retrieving unknown fungi, as most of the plants endophytes have not yet been studied (strobel and daisy, 2003). endophytic fungi are well-known biological agents that live inside the plant's internal tissues and cause no harm to their hosts (khan et al., 2021). endophytes have a mutualistic relationship with their host plants by receiving protection and nutrition from a host and providing increased resistance to pathogens, herbivores, and abiotic stresses. depending on the growth phase of the fungus and host, host defense response and environmental factors, some endophytic fungi can become plant pathogens (hema et al., 2015). they are the reservoir of various phytochemicals like alkaloids, quinones, terpenoids, tannins, steroids, phenolic acids, and saponins (verma et al., 2022). endophytes-derived secondary metabolites can inhibit the mechanism of resistance by incapacitating pathogenic invasion (manganyi and ateba, 2020). thus, the compounds derived from endophytes exhibit a broad range of activities in human diseases, including immunomodulatory, anti-diabetic, antifungal, antioxidant and anti-cancer (verma et al., 2022). the bioactive metabolites produced by the fungal endophytes were divided into four groups, including terpenes, alkaloids, polyketides and non-ribosomal peptides based on their biosynthetic pathway and chemical structures (khan et al., 2021). in ethnobotanical aspects of plant protection, conservation and sustainable use, researchers have been interested in isolating microbes associated with plants. abstract this study aimed to explore the in vitro antibacterial potential of endophytic fungus isolated from the roots of polianthes tuberosa against multidrug resistant pathogens. fungal isolates were screened for their antibacterial activities by disc diffusion, agar plug diffusion, mic, and mbc method. gcms was carried out to determine the crude extract's chemical profile. the highest antagonistic effect in the disc diffusion method was seen in the ethyl acetate extract of ptr3, with an inhibitory zone ranging from 14-18 mm. therefore, the potent isolate was identified as daldinia eschscholtzii. the maximum inhibition of 18 mm and 20 mm was observed against mrsa (atcc 43300) (atcc 700699), followed by vre (14 mm). the mic and mbc were between 3.12-25 μg/ml and 6.25-50 μg/ml, respectively. 1,2-benzene dicarboxylic acid and diheptyl ester were the primary chemical constituents present in the extract. these findings confirm that d. eschscholtzii ptr3 crude extract shows antibacterial activity. article info received: 21 november 2022 accepted: 11 january 2023 available online: 13 january 2023 doi: 10.3329/bjp.v18i1.62914 cite this article: sundar rdv, arunachalam s. effect of endophytic fungi daldinia eschscholtzii against multidrug resistant pathogens. bangladesh j pharmacol. 2023; 18: 17-23. effect of endophytic fungi daldinia eschscholtzii against multidrug resistant pathogens ranjitha dhevi v. sundar1 and sathiavelu arunachalam2 1 department of biotechnology, school of biosciences and technology, vellore institute of technology, vellore 14, india; 2 department of agriculture microbiology, vellore institute of technology school of agricultural innovations and advanced learning, vellore institute of technology, vellore, india. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 17-23 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 endophytic fungi meet this demand and serve as the best substitute source of compounds with a range of bioactivity (verma et al., 2022). the ethyl acetate extracts obtained from pestalotiopsis sp. eef-9, chaetomium sp. eef-10 and lophiostoma sp. eef-7 of eucalyptus exserta exhibited potent antibacterial activitiy against some pathogenic bacteria (ababutain et al., 2021). cyperaceae plants harbor numerous endophytes that produce antibacterial metabolites active against both gram positive and, to a lesser extent, gram negative bacteria (ratnaweera et al., 2018). there is report of antimicrobial effects of endophytic fungi from e. chrysantha. (zhang et al., 2015). due to the increased demand for alternative therapy for infectious diseases, the present research focused on isolating and identifying endophytic fungi from the polianthes tuberosa plant. it belongs to the family of amaryllidaceae and is an ornamental plant (sundar and arunachalam, 2022). the antibacterial activities, including kirby bauer disc diffusion, minimum inhibitory and bactericidal concentration and time-kill study of the endophytic fungal extracts against grampositive resistant pathogens, were investigated. materials and methods isolation and identification of endophytes p. tuberosa plant materials were collected and bought in a polythene bag to the laboratory from the vellore district. the collected samples were washed thoroughly in running tap water to remove the surface adhere dust or soil particles. surface sterilization was processed under the laminar hood using ethanol (70%) for 30 sec, followed by 3-5 min washing in 1% sodium hypochlorite solution. later, washed two to three times under sterilized distilled water. the segment was placed aseptically on a potato dextrose agar medium and incubated for a week at 27 ± 2°c. mycelial tips were subcultured on potato dextrose agar to produce pure colonies and stored for further analysis. fungal isolates were morphologically identified by colony characteristics such as hyphal features, reproductive structures and spores arrangement. lacto phenol cotton blue staining was carried out for microscopic identification. 18s rrna its molecular sequencing identification was carried out for the molecular identification of the fungus (roopa et al., 2015). mycelial growth rate the isolated endophytic fungus was cultured and incubated at 27 ± 2°c. after 7 days, the mycelial colony diameter of all three fungi was measured every 3 days to determine the growth characteristics of the fungal isolates (techaoei et al., 2020). preparation of biomass filtrate of active fungus fungal endophytes were grown in potato dextrose agar (500 ml) in a 1l erlenmeyer flask at 27 ± 2°c for 21 days. the fermented broth of each isolate was thoroughly blended with solvents of different polarities, such as hexane, dichloromethane, ethyl acetate and n-butanol, sequentially in equal volumes. the obtained crudes were dried and the resultant dissolved in dimethyl sulfoxide to prepare a stock solution of 1 mg/ml and used for antibacterial studies (palanichamy et al., 2018; elghaffar et al., 2022). kirby bauer disc diffusion assay the endophytic fungal isolates that exhibited a broader antibacterial spectrum in the initial screening were taken further for secondary investigation by following the disc diffusion protocol. the test bacteria were uniformly seeded on the surface of mueller-hinton agar. about 6 mm sterile discs loaded with different extract concentrations (25, 50, 75, 100 µg/ml) prepared from the stock solution were placed on the medium. inoculated plates were incubated overnight at 37°c and measured for inhibition zone to evaluate their anti18 bangladesh j pharmacol 2023; 18: 17-23 box 1: agar plug diffusion assay principle the agar plug diffusion method was primarily used to determine the antibacterial activity. requirements muller hinton agar, potato dextrose agar, tryptic soy broth, brain heart infusion broth, test pathogens (methicillinresistant staphylococcus aureus-mrsa (atcc 43300), (atcc 700699), vancomycin-resistant enterococci-vre (atcc 51299), s. aureus (atcc 25923), s. aureus (mtcc 3160) and enterococcus faecalis procedure step 1: the isolated fungal colonies were grown on the pda medium at 27 ± 2°c for 7 days step 2: from the actively growing culture, 1 cm (diameter) and 4 mm (thickness) agar plugs were bored and transferred onto the mha medium spread with the test microbes step 3: the plates were sealed and initially kept overnight at 4° c to allow the diffusion of bioactive compounds step 4: post incubation, the plates were incubated at 37°c for 12 hours. the clear zone around the agar plugs was measured reference taufiq and darah, 2018 references (video) rattanasuk et al., 2021; semerci et al., 2020; krishnan et al., 2019 bacterial action. dimethyl sulfoxide (5%) and oxacillin (1 µg) were included in the plates as a negative and positive control (katoch et al., 2017; marcellano et al., 2017). in addition, the activity index for each extract was calculated (singh and kumar, 2012). activity index = inhibition zone of the sample / inhibition zone of the standard minimum inhibitory concentration the two-fold micro broth dilution method recommended by clsi was used to determine the minimum inhibitory concentration (mic) of ethyl acetate crude extracts that displayed the highest antagonistic activity. first, 50 to 0.39 µg/ml extract concentration was prepared from the stock solution. then, muller hinton broth (100 µl) and extract (different dilution) were added to the 96-well microtiter plate. about 10 µl of bacterial inoculum was added and the setup was incubated at 37°c overnight. the lowest concentration was recorded with no visible bacterial growth (ohikhena et al., 2017). minimum bactericidal concentration the different turbidity sample (6.25 and 3.12 μg/ml concentration) from the mic microtiter plate was used to determine the minimum bactericidal concentration (mbc) value. the samples were streaked on the mueller-hinton agar medium and incubated at 37°c for 18 hours. post incubation, the lowest concentration showing no visible growth of bacteria was noted as the mbc of the extract (ohikhena et al., 2017). gc-ms analysis ethyl acetate derived from ptr3 containing different metabolites was subjected to gc-ms analysis. the study was carried out in perkin elmer clarus 680 equipped with clarus 600 mass spectrometer that was fitted with 30 m, 0.25 mm id, 250 µm df elite-5ms capillary column. initially, the gc oven was maintained for 3 min at 55º, ramp 10°c/min 300°c for 6 min. helium is used as a carrier with a flow rate of 1 ml/ min. the mass transfer line and source temperature are set at 240°c. turbo mass version 5.4.2 is used for spectral studies. the obtained unknown spectrum was compared with known spectrum components stored in the nist library 2008 for structure identification (liu et al., 2021). results isolation and antibacterial screening of endophytic fungi three endophytic fungi were isolated from the root part and coded ptr1, ptr2 and ptr3 (figure 1). each of these isolates showed different morphological and microscopic features. then the isolates were subjected to antibacterial potential against the selected resistant pathogens. the isolated ptr3 had a remarkable inhibitory ability against the pathogens developing a clear zone in primary screening. further, the crude extracts obtained from ptr3 were tested by the agar disc diffusion method. table i shows the antibacterial activities exhibited by the active fungal crude extracts against the tested bacteria at 100 µg/disc concentration. all four solvent crude extracts prepared from the potent isolate demonstrated promising antagonistic effects. of them, ethyl acetate extract exhibited potent inhibition against the test pathogens. furthermore, it revealed the highest inhibition zone (iz) of 20 mm with activity index (ai) 3.3 and (iz 18 mm; ai 3) against mrsa (atcc 700699) and (atcc 43300), which was 2 to 3 times higher than the positive control linezolid. moreover, for vre (iz 14 mm; ai 1.4) zone was recorded (table i). thus, it indicates the isolate was a promising source for a novel antibiotic agent. morphological and molecular identification of the ptr3 isolate the 18s rrna sequencing identified the potent fungus as daldinia eschscholtzii and submitted it to genbank (accession no. op800285). figure 2 shows the phylofigure 1: endophytic fungal colony characteristics in pda plates ptr1 (a), ptr2 (b), ptr3 (c) a b c bangladesh j pharmacol 2023; 18: 17-23 19 genetic tree and morphological sem study of ptr3. evaluation of mic and mbc of active extract the d. eschscholtzii ptr3 ethyl acetate extract that showed the maximum antagonistic effect was subjected further to determine their mic and mbc. the extract showed a mic of 6.25 and 3.12 µg/ml, an mbc of 50 and 25 µg/ml against two mrsa (i.e., atcc 43300, atcc 700699), respectively (table ii). whereas, against vre, the mic and mbc were 12.5 and 50 µg/ml. growth rate of mycelia the radial growth of the ptr3 fungus was more rapid when compared with ptr1 and ptr2 isolates, representing that nutrient-rich media could enrich mycelial density and the growth rate (data not shown). figure 2: lcb stained at 40x (a) and 100x (b), sem (c), phylogenetic tree (d) generated by maximum likelihood of daldinia eschscholtzii ptr3 table i average inhibition zone and activity index of ptr3 ethyl acetate extract (100 µg/ml) pathogens average inhibition zone (mm) hexane dichloromethane ethyl acetate n-butanol zoi ai zoi ai zoi ai zoi ai mrsa (atcc 43300) 6.5 1.1 15 2.5 18 3 10 1.7 mrsa (atcc 700699) 12.5 2.1 20 3.3 6.8 1.1 s. aureus (atcc 25923) 13 0.8 17 1.1 19 1.2 11 0.7 s. aureus (mtcc 3160) 14 0.9 16 1.0 20 1.3 17 1.1 vre (atcc 51299) 10.2 1.0 14 1.4 zoi means zone of inhibition; ai means activity index table ii minimum inhibitory and minimum bactericidal concentration of ptr3 ethyl acetate extract test pathogens concentration (µg/ml) mic mbc mrsa (atcc 43300) 6.25 50 mrsa (atcc 700699) 3.12 25 s. aureus (atcc 25923) 3.12 6.25 s. aureus (mtcc 3160) 3.12 12.5 vre (atcc 51299) 12.5 50 oxacillin vancomycin 25 mic means minimum inhibitory concentration; mbc means minimum bactericidal concentration a b c d 20 bangladesh j pharmacol 2023; 18: 17-23 gc-ms of potent extract as seen in figure 3, 1,2-benzene dicarboxylic acid and diheptyl ester were the primary compound present in two different retention times of 19.3 and 19.8 min with an area percentage of 24.1% and 19.2% respectively. discussion the present study demonstrated significant antibacterial activity of d. eschscholtzii isolated from p. tuberosa against drug-resistant pathogens. the previous study reported that at 1 mg/ml concentration, ethyl acetate crude extracts of d. eschscholtzii isolated from the plant musa paradisiaca displayed substantial antibacterial activity against p. aeruginosa (5 mm), e. coli (7 mm) and b. subtilis (3 mm). it also inhibited extended spectrum beta lactamase, a resistant bacterial strain of e. coli, with a 4 mm zone of inhibition (victor et al., 2020). the ethyl acetate extract obtained from d. eschscholtzii of psidium guajava has antibacterial activity against b. subtilis, s. aureus, e. faecalis, p. aeruginosa, e. coli, p. aeruginosa and p. vulgaris. e. faecalis was the most sensitive to the extract, with an inhibition zone of 15.7 ± 0.6 mm and a mic of 1.25 mg/ml (chutulo and chalannavar, 2020). the broth ethyl acetate extract of d. eschscholtzii fk511p from gorgonian annella sp. inhibited gram-positive bacteria s. aureus and mrsa with 8.3 ± 0.5 and 11.8 ± 1.0 mm inhibition, respectively, and gram-negative e. coli with 9.0 ± 0.5 mm inhibition. furthermore, mycelia methanol extract inhibited s. aureus and mrsa with inhibition zones of 8.1 ± 1.0 and 17.1 ± 1.2 mm, respectively, and e.coli with an inhibition zone of 12.1 ± 1.6 mm (kandou et al., 2021). nodulisporin h and 8-o-methyl-nodulisporin f, two new polyketides isolated from the ethanolic extract of the mangrove-derived fungus d. eschscholtzii hj004, demonstrated moderate antibacterial activity against s. aureus, mrsa and bacillus cereus, with mic ranging from 6.25 to 12.5 μg/ml. the compound 5-hydroxy-2methoxy-6,7-dimethyl-1,4-naphthoquinone had antibacterial activity against b. cereus with a mic value of 12.5 μg/ml (liao et al., 2019). endophytic d. cf concentrica and its volatile metabolites from olea europaea have shown antibacterial efficacy against plant pathogenic fungi. similarly, d. sacchari metabolites from sugarcane in south india displayed antibacterial action against fungus and gram-positive bacteria (chutulo and chalannavar, 2020). previous studies reported that 1,2-benzene dicarboxylic acid, mono(2-ethylhexyl) ester isolated from leaves of stevia rebaudiana showed antifungal activity against s. sclerotiorum with an inhibition zone of 29 mm after 48 hours. similarly, the compound 1,2-benzene dicarboxylic acid, (2-ethylhexyl) ester produced by the marine burkholderia cepacia showed potential antibacterial activity against aeromonas hydrophila, edwardsiella tarda and vibrio ordalii (verma et al., 2014). 1,2-benzene dicarboxylic acid, bis (2-ethyhexyl) ester and 1,2-benzenedicarboxylic acid, dibutyl ester derived from ethyl acetate fraction of alternaria sp. isolated from salvadora persica showed antimicrobial and antioxidant activity (elgorban et al., 2019). and also, 1,2-benzene dicarboxylic acid and dioctyl ester isolated from the soluble subportion of ethyl acetate extract of the nauclea latifolia unripe fruits displayed antibacterial activity against gram-positive bacteria. this is the first report on endophytic fungi d. eschscholtzii isolated from a root of p. tuberosa and their antibacterial activity. conclusion this study shows the significant antibacterial activity of the endophytic fungi d. eschscholtzii isolated from the figure 3: chromatogram analysis of ethyl acetate extract bangladesh j pharmacol 2023; 18: 17-23 21 root of p. tuberosa against antibiotic-resistant pathogens. financial support self-funded conflict of interest authors declare no conflict of interest acknowledgement the authors thank vellore institute of technology's management for providing the facilities to carry out this study. references ababutain im , aldosary sk, aljuraifani aa, alghamdi ai, alabdalall ah, al-khaldi em, aldakeel sa, almandil nb, sayed abdulazeez s, borgio jf. identification and antibacterial characterization of endophytic fungi from artemisia sieberi. int j microbiol. 2021; 2021. bate pnn, orock ae, nyongbela kd, babiaka sb, kukwah a, ngemenya mn. in vitro activity against multi-drug resistant bacteria and cytotoxicity of lichens collected from mount cameroon. j king saud univ sci. 2020; 32: 614-19. chutulo ec, chalannavar rk. daldinia eschscholtzii: an endophytic fungus isolated from psidium guajava as an alternative source of bioactive secondary metabolites. asian j mycol. 2020; 3: 376-98. elghaffar rya, amin bh, hashem ah, sehim ae. promising endophytic alternaria alternata from leaves of ziziphus spina‑christi: phytochemical analyses, antimicrobial and antioxidant activities. appl biochem biotechnol. 2022; 194: 3984-4001. elgorban am, bahkali ah, farraj daa, abdel-wahab ma. natural products of alternaria sp., an endophytic fungus isolated from salvadora persica from saudi arabia. saudi j biol sci. 2019; 26: 1068-77. hema p, murali m, thriveni mc, prathibha m, jayaramu sc, amruthesh kn. phytochemical analysis and antibacterial activity of endophytic fungi isolated from basella rubra l. a medicinal plant. j pure appl microbiol. 2015; 9: 2971-78. kandou fef, mangindaan rep, rompas rm, simbala hi. molecular identification and antibacterial activity of marineendophytic fungi isolated from sea fan annella sp. from bunaken waters, manado, north sulawesi, indonesia. aacl bioflux. 2021; 14: 317-27. katoch m, phull s, vaid s, singh s. diversity, phylogeny, anticancer and antimicrobial potential of fungal endophytes associated with monarda citriodora l. bmc microbiol. 2017; 17: 1-13. khan ms, gao j, munir i, zhang m, liu y, moe ts, xue j, zhang x. characterization of endophytic fungi, acremonium sp., from lilium davidii and analysis of its antifungal and plant growth-promoting effects. biomed res int. 2021; 1-14. krishnan m, dey dk, sharma c, kang sc. antibacterial activity of weissella confusa by disc diffusion method. bangladesh j pharmacol. 2019; 14: 117-22. liao hx, shao tm, mei rq, huang gl, zhou xm, zheng cj,wang cy. bioactive secondary metabolites from the culture of the mangrove-derived fungus daldinia eschscholtzii hj004. mar drugs. 2019; 17: 1-9. manganyi ms, ateba cn. untapped potentials of endophytic fungi: a review of novel bioactive compounds with biological applications. microorganisms. 2020; 8: 1934. mao z, zhang w, wu c, feng h, peng y, shahid h, cui z , ding p, shan t. diversity and antibacterial activity of fungal endophytes from eucalyptus exserta. bmc microbiol. 2021; 2021. marcellano jp, collanto as, fuentes rg. antibacterial activity of endophytic fungi isolated from the bark of cinnamomum mercadoi. pharmacogn j. 2017; 9: 405-09. ohikhena fu, wintola oa, afolayan aj. evaluation of the antibacterial and antifungal properties of phragmanthera capitate (sprengel) balle (loranthaceae), a mistletoe growing on rubber tea, using the dilution techniques. sci world j. 2017; 1-8. palanichamy p, krishnamoorthy g, kannan s, marudhamuthu m. bioactive potential of secondary metabolites derived from medicinal plant endophytes. egypt j basic appl sci. 2018; 5: 303-12. ratnaweera pb, walgama rc, jayasundera ku, herath sd, abira s, williams de, andersen rj, de silva ed. antibacterial activities of endophytic fungi isolated from six sri lankan plants of the family cyperaceae. bangladesh j pharmacol. 2018; 13: 264-72. rattanasuk s, boongapim r, phiwthong t. antibacterial activity of cathormion umbellatum. bangladesh j pharmacol. 2021; 16: 91-95. roopa g, madhusudhan mc, sunil kcr, lisa n, calvin r, poornima r, zeinab n, kini kr, prakash hs, geetha n. identification of taxol-producing endophytic fungi isolated from salacia oblonga through genomic mining approach. j genet eng biotechnol. 2015; 13: 119-12. semerci ab, i̇nceçayır d, mammadova v, hoş a, tunç k. antimicrobial activities of allium staticiforme and allium subhirsutum. bangladesh j pharmacol. 2020; 15: 19-23. singh g and kumar p. antibacterial potential of alkaloids of withania somnifera l. & euphorbia hirta l. int j pharm pharm sci. 2012; 4: 78-81. strobel g, daisy b. bioprospecting for microbial endophytes and their natural products. microbiol mol biol rev. 2003; 67: 491-502. sundar rdv, arunachalam s. anti-mrsa activity of pollianthes tuberosa leaf extracts. bangladesh j pharmacol. 2022; 17: 11-13. taufiq mmj, darah i. fungal endophytes isolated from the leaves of a medicinal plant, ocimum sanctum linn and evaluation of their antimicrobial activities. afr j microbiol res. 2018; 12: 616-22. 22 bangladesh j pharmacol 2023; 18: 17-23 author info sathiavelu arunachalam (principal contact) e-mail: asathiavelu@vit.ac.in techaoei s, jirayuthcharoenkul c, jarmkom k, dumrongphuttidecha t, khobjai w. chemical evaluation and antibacterial activity of novel bioactive compounds from endophytic fungi in nelumbo nucifera. saudi j biol sci. 2020; 27: 2883-89. victor c, moses o, eze a, festus o, charles e. isolation, identification, and evaluation of biological activities of daldinia eschscholtzii, an endophytic fungus isolated from the leaves of musa paradisiaca. gsc biol pharm sci. 2020; 12: 216-28. verma a, johri bn, prakash a. antagonistic evaluation of bioactive metabolite from endophytic fungus, aspergillus flavipes kf671231. j mycol. 2014; 2014. verma a, gupta p, rai n, tiwari rk, kumar a, salvi p, kamble sc, singh sk, vg. assessment of biological activities of fungal endophytes derived bioactive compounds isolated from amoora rohituka. j fungi. 2022; 8: 285. zhang h, ruan c, bai x. isolation and antimicrobial effects of endophytic fungi from edgeworthia chrysantha. bangladesh j pharmacol. 2015; 10: 529-32. bangladesh j pharmacol 2023; 18: 17-23 23 mailto:asathiavelu@vit.ac.in bangladesh journal of pharmacology research article in silico prediction of functional loss of cst3 gene in hereditary cerebral amyloid angiopathy bjp introduction single nucleotide polymorphisms (snps) are the most abundant form of genetics variations in the human genome. most of the snps in the human genome are present in the non-coding dna consisting of 5’ and 3’ and translated regions (utr) (rajasekaran et al., 2007). the dbsnp is used for the same and it is a public domain archive (sherry et al., 2001). the gene, cst3, codes for human cystatin c, and has the same organization as the cst1 gene for cystatin sn and the cst2 gene for cystatin sa (saitoh et al., 1989). it has been found to play a role in brain disorder example amyloid (a specific type of protein deposition) (goate et al., 1991). analysis found that missense mutation in the cst3 gene lead to a condition called hereditary cerebral amyloid angiopathy. this condition is characterised by stock and dementia which begins in mid adulthood. cst3 gene is located from base pair 23, 608, 533 to base pair 23, 618, 684 on chromosome 20 (saitoh et al., 1989). as far as presence scenario is concerned the discovery of deleterious snps is crucial task for pharmacogenomics and pharmacogenetics. we undertook this work basically to perform a computational analysis of cst3 gene consisting of ns snps and identification of possible deleterious mutation. out of the 24 snps, the most deleterious snps which are significant in causing disease are y60c, c123y, l19p, y88c, and l94q. these mutations can be a candidate of most concern in the disease hereditary cerebral amyloid angiopathy caused by cst3 gene. materials and methods dataset db-snp (http://www.ncbi.nlm.nih.gov/snp/) is used to obtain the snps and their related protein sequence a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2013; 8: 390-394 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 abstract the computational identification of missense mutation in cst3 (cystatin 3 or cystatin c) gene has been done in the present study. the missense mutations in the cst3 gene will leads to hereditary cerebral amyloid angiopathy the initiation of the analysis was done with sift followed by polyphen-2 and i-mutant 2.0 using 24 variants of cst3 gene of homo sapiens which were derived from dbsnp. the analysis showed that 5 variants (y60c, c123y, l19p, y88c, l94q) were found to be less stable and damaging by sift, polyphen-2 and i-mutant2.0. furthermore the outputs of snp & go are collaborated with phd-snp (predictor of human deleterious-single nucleotide polymorphism) and panther to predict 5 variants (y60c, y88c, c123y, l19p, and l94q) having clinical impact in causing the disease. these findings will be certainly helpful for the present medical practitioners for the treatment of cerebral amyloid angiopathy. article info received: 7 october 2013 accepted: 23 november 2013 available online: 27 november 2013 doi: 10.3329/bjp.v8i4.16524 cite this article: choudhary p, singh j, karthick v, shanthi v, rajasekaran r, ramanathan k. in silico prediction of functional loss of cst3 gene in hereditary cerebral amyloid angiopathy. bangladesh j pharmacol. 2013; 8: 390-94. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. in silico prediction of functional loss of cst3 gene in hereditary cerebral amyloid angiopathy piyush choudhary1, juhee singh1, v. karthick1, v. shanthi1, r. rajasekaran2 and k. ramanathan1 1industrial biotechnology division, 2bioinformatics division, school of bio sciences and technology, vellore institute of technology, vellore 632014, tamil nadu, india. for cst3 gene of homo sapiens for the computational analysis. (arnold et al., 2006). every snp consist of an unique id, reference id (rsids). complete information about that snp as well as the amino acid changes, their respective positions and corresponding accessions ids are obtained by clicking on each rsids. clicking on accessions id delivers information regarding the protein encoded by the genes. also we are thankful for the availability of numerous comprehensive and easy to use software packages and web-based services to detect the structures (kumar et al., 2009). sequence homology based method (sift)-analysis of functional effect of point’s mutations the damaging single amino acid polymorphism detected by the sift programme (ng and henikoff, 2003). the main concept behind this technique is mainly based on the evolutionary amino acid conservation with in protein families. the more the conserved positions are the more they are intolerant to substitution where as the vice versa is also true. therefore, the results are deleterious or damaging when the changes occurs at well conserved positions. protein sequence forms of queries are being submitted. sift works by using multiple sequence alignment information on a considered query sequence for the prediction (capriotti et al., 2005) of tolerated as well as deleterious substitution for each position for the query sequence. the multistep sift process consist of a) protein database search for related sequences, b) sequence alignment build-up, c) probability scaling at every position from the alignment. the cut off value of tolerance index for sift program >0.5. the tolerance index is inversely proportions to the impact of amino acid substitutions that is higher the tolerance index lesser the impact of substitution and lesser the tolerance index the higher the functional impact of amino acid substitution. structure and sequence based method-polyphen2 (polymorphism phenotyping v2) polyphen2 is a physical and comparison based tool that shows the impact of amino acid substitution on the structure and function of human protein (ramensky et al., 2002). the input is a protein sequence with mutational positions and two variants of amino acids. this is followed by psic scores calculations for both the variants and then the difference between two are computed. the greater the psic score difference the higher the functional impact of particular amino acid substitution. stability analysisi-mutant 2.0 it is a svm based tools that is i.e, which is support vector machine based tool. i-mutant2.0 leads to automatic protein stability change prediction which is caused by single point mutation (capriotti et al., 2005). the initiations were done either by using protein structure or more precisely from the protein sequence. the output is a free energy change value (δδg). positive δδg value infers that the protein being mutated is of higher stability and vice versa is also true. snps & go(disease related mutations predictions) snps tends for single nucleotide polymorphism data base and go is gene ontology. like i-mutant2.0 snps & go (calabrese et al., 2009) is also a support vector machine (svm) which is based on the method to accurately predict the mutation related to disease from protein sequence. the input is the fasta sequence of the whole protein, the output is based on the difference among the neutral and disease related variations of the protein sequence. the ri (reliability index) with value of greater than 5 depicts the disease related effect caused by mutation on the function of parent protein. the phd snp (altschul et al., 1997) & panther algorithms were also used in the display of output. results and discussion there are 24 missense mutation were found namely y60c, p33l, v75m, v44m, m67k, a129t, y88c, a72s, d113a, a2s, g30s, t98m, c123y, t142a, l19p,l94q, r71s, r71h, v17m, g3r, r96g, g38a, r79h, a25t. these mutations were retrieved from dbsnp (smigielski et al., 2000). the mutations were one by one submitted in sift program for the tolerance index (ng and henikoff, 2003) check. out of the 24 variants, 8 variants were found to be deleterious with a tolerance index score of >.05. the result has been depicted in table i. it was observed that 4 out of 8 variants were highly deleterious with a tolerance index score of 0. one variant with a tolerance index of 0.01, one with 0.03, one with 0.04 and one with 0.05. the polyphen2 program (ramensky et al., 2002) was used after sift with protein sequence having mutational position submitted as inputs, a psic score > 0.950 were found to be probably damaging, a psic score of >0.5 were found to be possibly damaging and the rest were found to be benign (table i). following the polyphen2 was i-mutant2 program for the analysis. the program tells about protein structure stability, out of 24 variants 22 variants were found to have less stability (table i). the transformations that happened in the amino acids as a result of the missense mutations are y60c (polar amino acid to a polar amino acid), p33l (non-polar amino acid to non-polar amino acid), v75m (non-polar amino acid to non-polar amino acid), v44m (non-polar amino acid to non-polar amino acid), m67k (non-polar amino acid to polar basic amino acid), a129t (non-polar amino acid to polar amino acid), y88c (polar amino acid to polar amino acid), a72s (non-polar amino acid to polar amino acid), bangladesh j pharmacol 2013; 8: 390-394 391 d113a (polar acidic amino acid to non-polar amino acid), a2s (non-polar amino acid to polar amino acid), g30s (non-polar amino acid to polar amino acid), t98m (polar amino acid to non-polar amino acid), c123y (polar amino acid to polar amino acid), t142a (polar amino acid to non-polar amino acid), l19p (non-polar amino acid to non-polar amino acid), l94q (non-polar amino acid to polar amino acid), r71s (polar basic amino acid to polar amino acid), r71h (polar basic amino acid to polar basic amino acid), v17m (non-polar amino acid to non-polar amino acid), g3r (non-polar amino acid to polar basic amino acid), r96g (polar basic amino acid to non-polar amino acid), g38a (nonpolar amino acid to non-polar amino acid), r79h (polar basic amino acid to polar basic amino acid), a25t (nonpolar amino acid to polar amino acid). it can be said that by preserving the pysico chemical properties of amino acids may not necessarily result in mutations that are harmless. out of the 24 variants, 8 variants namely y60c, c123y, l19p, r79h, v75m, y88c, a2s, l94q were found to be deleterious and damaging by all the three programs that is sift, polphen 2 and i-mutant2.0 (capriotti et al., 2005). the snps and go server predicted 7 variants as disease causing mutation (table ii), whereas phdsnp server predicted 12 variants to be disease related (table iii), and panther predicted 11 variants as disease (table iv). finally combining the results of all 392 bangladesh j pharmacol 2013; 8: 390-394 table i list of nssnp predicted as deleterious, damaging and less stable by sift, polyphen-2 and i-mutant respectively rsid aa change tolerance index psic sd prediction stability rs377450166 y60c 0.03 0.999 probably damaging decrease rs375692362 p33l 0.32 0.051 benign decrease rs373743268 v75m 0 1 probably damaging increase rs373213120 v44m 0.16 0.867 possibly damaging decrease rs373177867 m67k 0.92 0 benign decrease rs371605207 a129t 0.63 0.01 benign decrease rs371124032 y88c 0 1 probably damaging decrease rs202145575 a72s 0.09 0.37 benign decrease rs201184716 d113a 0.38 0.607 possibly damaging decrease rs200984369 a2s 0 0.939 possibly damaging decrease rs200245337 g30s 0.72 0.01 benign decrease rs200037041 t98m 0.09 0.975 probably damaging decrease rs149051742 c123y 0.05 1 probably damaging decrease rs141643699 t142a 0.45 0.002 benign decrease rs113550984 l19p 0.01 0.94 possibly damaging increase rs28939068 l94q 0 0.988 probably damaging decrease rs11542364 r71s 0.44 1 probably damaging decrease rs11542360 r71h 0.1 0.999 probably damaging decrease rs11542359 v17m 0.1 0.63 possibly damaging decrease rs11542357 g3r 0.09 0.002 benign decrease rs11542355 r96g 0.16 1 probably damaging decrease rs11542354 g38a 0.2 0.243 benign decrease rs11542353 r79h 0.04 0.999 probably damaging decrease rs1064039 a25t 0.41 0.003 benign decrease table ii list of nssnp predicted as disease associated by snp & go server rsid aa change snp & go prediction probability score ri rs377450166 y60c disease 0.73 5 rs375692362 p33l neutral 0.048 9 rs373743268 v75m neutral 0.416 2 rs373213120 v44m neutral 0.021 10 rs373177867 m67k neutral 0.145 7 rs371605207 a129t neutral 0.072 9 rs371124032 y88c disease 0.835 7 rs202145575 a72s neutral 0.107 8 rs201184716 d113a neutral 0.033 9 rs200984369 a2s neutral 0.015 10 rs200245337 g30s neutral 0.037 9 rs200037041 t98m neutral 0.056 9 rs149051742 c123y disease 0.9 8 rs141643699 t142a neutral 0.012 10 rs113550984 l19p disease 0.537 1 rs28939068 l94q disease 0.682 4 rs11542364 r71s disease 0.56 1 rs11542360 r71h neutral 0.357 3 rs11542359 v17m neutral 0.054 9 rs11542357 g3r neutral 0.009 10 rs11542355 r96g disease 0.541 1 rs11542354 g38a neutral 0.034 9 rs11542353 r79h neutral 0.253 5 rs1064039 a25t neutral 0.042 9 the programs, 5 variants namely y60c, y88c, c123y, l19p and l94q were predicted to have functional effect on protein function and stability (table v), and further these functionally significant variants were superimposed with native structure using pymol (figure 1). conclusion we examined clinically important mutations in cst3 gene by means of different genomic algorithms. we certainly believe that this analysis will have immense importance in clinical management of cerebral amyloid angiopathy. bangladesh j pharmacol 2013; 8: 390-394 393 table iii list of nssnp predicted as disease associated by phd-snp server rsid aa change phd-snp prediction probability score ri rs377450166 y60c disease 0.962 9 rs375692362 p33l neutral 0.195 6 rs373743268 v75m disease 0.863 7 rs373213120 v44m neutral 0.148 7 rs373177867 m67k disease 0.625 3 rs371605207 a129t neutral 0.348 3 rs371124032 y88c disease 0.991 10 rs202145575 a72s disease 0.509 0 rs201184716 d113a neutral 0.324 4 rs200984369 a2s neutral 0.132 7 rs200245337 g30s neutral 0.341 3 rs200037041 t98m neutral 0.499 0 rs149051742 c123y disease 0.993 10 rs141643699 t142a neutral 0.03 9 rs113550984 l19p disease 0.954 9 rs28939068 l94q disease 0.897 8 rs11542364 r71s disease 0.889 8 rs11542360 r71h disease 0.824 6 rs11542359 v17m neutral 0.427 1 rs11542357 g3r neutral 0.044 9 rs11542355 r96g disease 0.931 9 rs11542354 g38a neutral 0.365 3 rs11542353 r79h disease 0.718 4 rs1064039 a25t neutral 0.254 5 table iv list of nssnp predicted as disease associated by panther server rsid aa change panther prediction probability score ri rs377450166 y60c disease 0.975 10 rs375692362 p33l disease 0.504 0 rs373743268 v75m disease 0.808 6 rs373213120 v44m neutral 0.294 4 rs373177867 m67k neutral 0.371 3 rs371605207 a129t neutral 0.391 2 rs371124032 y88c disease 0.973 9 rs202145575 a72s neutral 0.365 3 rs201184716 d113a neutral 0.188 6 rs200984369 a2s neutral 0.038 9 rs200245337 g30s neutral 0.112 8 rs200037041 t98m neutral 0.392 2 rs149051742 c123y disease 0.995 10 rs141643699 t142a neutral 0.189 6 rs113550984 l19p disease 0.734 5 rs28939068 l94q disease 0.859 7 rs11542364 r71s disease 0.817 6 rs11542360 r71h disease 0.848 7 rs11542359 v17m neutral 0.352 3 rs11542357 g3r neutral 0.099 8 rs11542355 r96g disease 0.847 7 rs11542354 g38a neutral 0.23 5 rs11542353 r79h disease 0.628 3 rs1064039 a25t neutral 0.294 4 table v list of nssnp predicted as disease associated by snp & go, phd-snp and panther server rsid aa change snp & go phdsnp panther rs377450166 y60c disease disease disease rs149051742 c123y disease disease disease rs113550984 l19p disease disease disease rs371124032 y88c disease disease disease rs28939068 l94q disease disease disease acknowledgement the authors would like to thank management of vit university for providing the facilities to carry out this work. references altschul sf, madden tl, schäffer aa, zhang j, zhang z, miller w, lipman dj. gapped blast and psi-blast: a new generation of protein database search programs. nucleic acids res. 1997; 25: 3389-402. arnold k, bordoli l, kopp j, schwede t. the swiss-model workspace: a web-based environment for protein structure homology modeling. bioinformatics 2006; 22: 195-201. calabrese r, capriotti e, fariselli p, martelli pl, casadio r. functional annotations improve the predictive score of human disease-related mutations in proteins. human mutation 2009; 30: 1237-44. capriotti e, fariselli p, casadio r. i-mutant2.0: predicting stability changes upon mutation from the protein sequence or structure. nucleic acids res. 2005; 33: 306-10. goate a, chartier-harlin mc, mullan m, brown j, crawford f, fidani l, giuffra l, haynes a, irving n, james l, mant r, newton p, rooke k, roques p, talbot c, pericak-vance m, roses a, williamson r, rossor m, owen m, hardy j. segregation of a missense mutation in the amyloid precursor protein gene with familial alzheimer's disease. nature 1991; 349: 704-06. johansson mu, zoete v, michielin o, guex n. defining and searching for structural motifs using deepview/swisspdbviewer. bmc bioinformatics. 2012; 13: 173. kumar p, henikoff s, ng pc. predicting the effects of coding nonsynonymous variants on protein function using the sift algorithm. nat protoc. 2009; 4: 1073-81. ng pc, henikoff s. predicting deleterious amino acid substitutions. genome res. 2001; 11: 863-74. ng pc, henikoff s. sift: predicting amino acid changes that affect protein function. nucleic acids res. 2003; 31: 3812-14. rajasekaran r, sudandiradoss c, doss cg, sethumadhavan r. identification and in silico analysis of functional snps of the brca1 gene. genomics 2007; 90: 447-52. ramensky v, bork p, sunyaev s. human non-synonymous snps: server and survey. nucleic acids res. 2002; 30: 38943900. saitoh e, sabatini lm, eddy rl, shows tb, azen ea, isemura s, sanada k. the human cystatin c gene (cst3) is a member of the cystatin gene family which is localized on chromosome 20. biochem biophys res commun. 1989; 162: 1324-31. sherry st, ward mh, kholodov m, baker j, phan l, smigielski em, sirotkin k. dbsnp: the ncbi database of genetic variation. nucleic acids res. 2001; 29: 308-11. 394 bangladesh j pharmacol 2013; 8: 390-394 author info k. ramanathan (principal contact) e-mail: kramanathan@vit.ac.in a b c d e figure 1: superimposed view of c60y (a), y88c (b), c123y(c), l19p (d) and l94q (e) rendered using pymol introduction: materials and methods: dateprinted: this article was downloaded by you on: aug 29, 2018 introduction perinatal asphyxia, all over the world, remains an important cause of perinatally acquired brain injury in full term infants. in developing countries, perinatal asphyxia appears to be more common. during perinatal asphyxia, hypoxia and ischemia cause primary neuronal injury because of cell necrosis (hossman, 1983). neonatal resuscitation results in oxygenation and reperfusion, which in turn, leads to delayed, or secondary neuronal injury. the mechanisms believed to be important in this secondary phase of neuronal injury include oxygen free radical production (mccord, 1985), intracellular calcium entry and apoptosis (evans and levene, 1999). numerous studies have suggested that free radicals could have a key role in causing hypoxic ischemic damage to the brain, especially during the reoxygenation/reperfusion phase (ogihara et al., 2003). vitamin e is a fat-soluble vitamin that exits in eight different forms, four tocopherols (α-, β-, γand δ-) and four tocotrienols (also α-, β-, γand δ-). α-tocopherol is the name of the most active form of vitamin e in humans. vitamin e or tocopherol is a membrane bound, chain breaking anti-oxidant. once lipid peroxidation is initiated, peroxyl radicals react with vitamin e instead of an adjacent fatty acid, thus terminating the process (palmer and vanucci, 1993). perinatal asphyxia is a leading cause of morbidity and mortality of neonates in our country. it is seen that infants with asphyxia have elevated oxidative stress, and leads to delay or secondary neuronal injury. this problem may cause death or subsequent severe neuro developmental disability/handicap in future. in the present study, administrating α-tocopherol acts as a free radicals scavenger to infants following perinatal asphyxia with primary aims of prevention of death or subsequent severe neurodevelopemental disability by reducing secondary neuronal injury from free radicals. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 5-9 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract twenty asphyxiated neonates were studied by estimating reduced gluthathione (gsh) level in red blood cell (rbc) to assess the level of oxidative stress. neonates were randomly divided into two groups. one group received α-tocopherol (10 mg/kg body weight) once orally daily for 5 days and other group received only vehicle. the mean (± sd) value of gsh in rbc within 24 hours of age of asphyxiated neonates was 12.3 ± 4.3 mg/dl in untreated group and 12.0 ± 2.3 mg/dl in treated group. after 5 days of asphyxiated neonates (in α-tocopherol untreated group) the gsh level increased to 14.5 ± 3.5 mg/dl whereas in asphyxiated neonates treated with α-tocopherol, it increased to 25.7 ± 5.0 mg/dl indicating 5 days treatment with α-tocopherol among asphyxiated neonates caused approximately 2-fold increase in gsh level which was statistically significant (p<0.001). this study suggests that αtocopherol may be useful to reduce the oxidative stress in patients of perinatal asphyxia. article info received: 13 december 2005 accepted: 11 january 2006 available online: 3 january 2008 doi: 10.3329/bjp.v1i1.480 cite this article: karim r, mannan ma. α-tocopherol reduces oxidative stress in perinatal asphyxia. bangladesh j pharmacol. 2006; 1: 5-9. α-tocopherol reduces oxidative stress in perinatal asphyxia rashidul karim and m. a. mannan department of pediatrics, bangabandhu sheikh mujib medical university, shahbag, dhaka 1000, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. materials and methods chemical α-tocopherol was a gift from square pharmaceuticals ltd (bangladesh). dtnb was purchased from sigma chemicals (usa). design and place of study this prospective study was conducted at the department of pediatrics (neonatal unit), bangabandhu sheikh mujib medical university and dhaka medical college hospital. the study was carried out from july 2004 to january 2005. subjects a total number of 30 newborns were selected randomly of which 20 were asphyxiated neonates and the rest 10 were non-asphyxiated normal neonates. asphyxiated neonates were equally divided into two groups. one group was supplemented with α-tocopherol and another group received vehicle only. term neonates, who did not require respiratory support, were clinically stable, not suffering from perinatal asphyxia or sepsis, having no major congenital malformations were taken as the control. all the cases of this study were infants, irrespective of male and female, having gestational age of 37 completed weeks to 42 weeks with the birth weight of more than 2,500 g, whose postnatal age were within 24 hours. asphyxia neonataram was diagnosed by performing apgar score 3 or less at the end of 1st min of life, delayed onset of first cry, infants who required resuscitation with positive pressure ventilation to establish spontaneous respiration after birth and also showed overt clinical signs of asphyxia, such as hypotonia, apnea, non responsive to external stimuli, pallor and also bradycardia (<80/min). any major congenital anomalies, neonatal sepsis, hemolytic disease or any other symptomatic hematologic disorders were excluded from the study. study procedure after enrolment in this study relevant information from history, physical findings were recorded on a predesigned questionnaire form. the purpose and procedure of the study were explained to the parents and their consents were taken. α-tocopherol 10 mg/kg body weight/dose was given to 10 asphyxiated neonates as daily single dose in the morning for 5 days. under all precaution minimal 1 ml of blood samples were drawn from a peripheral vein. the blood was collected into heparinized tubes. blood samples were drawn twice, within 24 hours of age and after 5 days of age. laboratory procedure the amount of gsh in rbc was estimated spectrophotometrically by the method described elsewhere and expressed as mg/dl of rbc (beutler et al., 1963). in brief, 1 ml of heparinized blood was centrifuged at 4,000 rpm for 5 min. upper clear solution (plasma) was removed and erythrocytes were washed twice with phosphate buffer solution. 1 ml of tca (tri-chloroacetic acid) was added, mixed thoroughly and again centrifuged for 5 min at 4,000 rpm. after centrifuged, 0.3 ml of clear fluid was taken into another test tube and 2 ml of buffer solution (na2hpo4) and 0.3 ml of dtnb reagent were added and mixed thoroughly. 40 μl of glutathione standard (1 mg/ml) solution and 210 μl of deionized water was taken in another test tube as standard, 2 ml of na2-hpo4 and 0.3 ml of dtnb were also added in a test tube and mixed thoroughly, and a blank reagent obtained by replacing blood with deionized water, were included. the absorbance was measured by spectrophotometer (uv-vis 1201, shimadzu, japan) at 412 nm after 20 min of adding dtnb solution. the absorbance of the reagent blank was subtracted from those of the standard and samples. hematocrit value of whole blood was measured. ethical consideration prior to commencement of this study, the university ethical committee approved the research protocol. the aims and objectives of this study along with its procedure and benefits of this study were explained to the parents of the newborns in detail in easily and perfectly understandable language and informed consent was taken. statistical analysis collected data were checked for correctness and editing and coding was done and then data were entered into computer. the numerical data obtained from the study were analyzed and significance of difference was estimated by using the statistical methods. data were analyzed by using computer based spss (statistical package for social science) program (version 11.5). data were expressed in percentage, mean and standard deviation as applicable. comparison between groups 6 bangladesh j pharmacol 2006; 1: 5-9 was done by unpaired student’s t-test and paired t-test as applicable. probability less than 0.05 was considered as significant. results gsh level in rbc according to causes of perinatal asphyxia it was evident that among the asphyxiated patients, frequent causes of perinatal asphyxia were obstructed labor (55.0%) followed by eclampsia (40.0%) and forcep delivery (5.0%). the mean value of gsh in rbc of obstructed labor was 13.7 ± 3.4 mg/dl and of eclampsia was 9.7 ± 1.1 mg/dl and the mean difference was statistically significant (p<0.001). gsh level in rbc of normal and asphyxiated neonates the mean value of gsh in rbc of normal baby within 24 hours of age was 65.6 ± 12.6 mg/dl. but in asphyxiated neonates, it was reduced to 12.3 ± 4.3 mg/ dl (α-tocopherol untreated group) and 12.0 ± 2.3 mg/ dl (α-tocopherol treated group) respectively. asphyxia reduced the level of gsh to 18.7 and 18.1% respectively. this difference was not statistically significant (p>0.05). after 5 days of treatment with conventional therapy, the level of gsh increased from 12.3 ± 4.3 to 14.5 ± 3.5 mg/dl (17.9%), which was not statistically significant (p>0.05). on the other hand, asphyxiated baby treated with α-tocopherol increased the level of gsh from 12.0 ± 2.3 to 25.7 ± 5.0 mg/dl (114.3%), which was statistically significant (p<0.001). gsh improvement was found only 22.0% in asphyxiated neonates treated without α-tocopherol, whereas 39.1% improvement was evident in neonates treated with α-tocopherol compared to that of the normal neonates, which was considered as 100.0%. discussion oxidative stress in vivo is a degenerative process caused by the overproduction and propagation of free radical reactions (buonocore et al., 2001). oxidative stress may be assessed by determining gsh, gssg and antioxidant enzyme activities. blood gsh/gssg ratio may be an indicator of oxidative stress. decrease in gsh and increase in gssg reflects oxidative stress (vento et al., 2003). in this study, degree of oxidative stress assayed in the newborns was performed by the measurement of gsh level only could the other parameters, as mentioned above, be measured in this study; stress conditions would definitely be better assessed. however, those measurements could not be done because of lack of necessary laboratory supports. this study showed the mean ± sd concentration of gsh in rbc within 24 hours of age of normal baby was 65.6 ± 12.6 mg/dl. but in asphyxiated neonates, it was reduced to 12.3 ± 4.3 mg/dl (α-tocopherol untreated group) and 12.0 ± 2.3 mg/dl (α-tocopherol treated group). this finding is consistent with the finding of vento et al. (2003). this result suggests that newborn undergoes oxidative stress in perinatal asphyxia. perinatal asphyxia causes oxidative stress, can be explained by the observation of ogihara et al. (2003). as they viewed, free radicals could have a key role in causing hypoxic-ischemic damage to the brain, especially during neonatal resuscitation results in reoxigenation and reperfusion phase in perinatal asphyxia palmer, (1995) also explained that oxygen in paradoxitable i the mean (± sd) concentration of gsh in rbc according to causes of perinatal asphyxia causes gsh level (mg/dl) in rbc within 24 hours of agea p value obstructed labor (n=12) 13.7 ± 3.4 <0.001 eclampsia (n=8) 9.7 ± 1.1 table ii gsh level in rbc of normal and asphyxiated neonates study subjects gsh level (mg/dl) in rbca within 24 hours of age after 5 days normal neonates 65.6 ± 12.6 asphyxiated neonates without αtocopherol 12.3 ± 4.3 14.5 ± 3.5c with αtocopherolb 12.0 ± 2.3 25.7 ± 5.0d adata are expressed as mean ± sd; p value reached from unpaired student’s test adata are expressed as mean ± sd; bdose of α-tocopherol 10 mg/kg body weight/day for 5 days; cp value >0.05; dp value<0.001 bangladesh j pharmacol 2006; 1: 5-9 7 cally the basis of most free radical species generated during reperfusion in perinatal asphyxia. during reperfusion of the previously ischemic brain, potentially damaging amounts of superoxide, hydrogen peroxide, and the even more reactive species such as the hydroxyl radical can be produced by free fatty acid and prostaglandin metabolism. during cerebral hypoxiaischemia, mitochondrial oxidative phosphorylation is impaired, causing atp degradation and accumulation of hypoxanthine. hypoxanthine is metabolized by xanthine oxidase to xanthine and uric acid in reactions that produce superoxide and hydrogen peroxide. this study also showed the mean (± sd) concentration of gsh in rbc after 5 days of age (α-tocopherol untreated group) was increased from 12.3 ± 4.3 mg/dl to 14.5 ± 3.5 mg/dl whereas in asphyxiated neonates treated with α-tocopherol, it was increased from 12.0 ± 2.3 mg/dl to 25.7 ± 5.0 mg/dl indicating 5 days treatment with α-tocopherol among asphyxiated neonates showed approximately 2-fold increased gsh level which was statistically significant (p<0.001). there is no comparable data regarding the role of α-tocopherol in the treatment of oxidative stress in perinatal asphyxia. this favorable role of α-tocopherol in improving the oxidative stress conditions in perinatal asphyxia in the term newborns can be explained by the observations of conner and grisham (1996). as they viewed, vitamin e or tocopherol is a membrane bound, chain breaking anti -oxidant may protect against reactive oxygen metabolites mediated cellular damage through free radical scavenging properties. it prevents the oxidation of low density lipoprotein, inhibits the propagation of lipid per -oxidation, and reduces toxicity associated with glutathione depleting agents palmer and vanucci (1993) also explained that vitamin e or tocopherol reduces the damaging effects of oxidative stress by once lipid peroxidation is initiated, peroxylradicals react with vitamin e instead of an adjacent fatty acid, thus terminating the process. in this study, as α-tocopherol was administered, the condition of oxidative stress improved. although gsh level rose significantly higher following supplementation of α-tocopherol in asphyxiated newborns yet the rise of gsh was not as high as that of a normal baby. inappropriate duration α-tocopherol treatment could be one of the factors responsible for that. in this respect, another point of concern should be the use of lipid soluble α-tocopherol. it was reported previously, that the use of water-soluble α-tocopherol could improve its absorption from gi tract (jansson et al., 1984). because of nonavilability of the preparation of water-soluble αtocopherol, we did not use that preparation. conclusion oxidative stress was observed in asphyxiated term neonates and α-tocopherol administration was seen to produce some favorable impact in the reduction of oxidative stress in perinatal asphyxia. therefore, αtocopherol may be useful to reduce the oxidative stress in patients of perinatal asphyxia. this study recommends more prospective studies with bigger sample size to determine the duration of αtocopherol therapy in asphyxiated newborn. financial support self-funded ethical issue the study was approved be the ethical committee of bangabandhu sheikh mujib medical university. conflict of interest authors declare no conflict of interest references beutler e, duron o, kelly bm. improved method for the determination of blood glutathione. j lab clin med. 1963; 61: 882-88. buonocore g, perrone s, bracci r. free radicals and brain damage in the newborn. biol neonate. 2001; 79: 180-86. conner em, grisham mb. inflammation, free radicals and antioxidants. nutrition 1996; 12: 274-77. evans dj, levene mi. hypoxic-ischemic injury. in: textbook of neonatology. rennie jm, roberton nrc (eds). 3rd edi. london, churchill livinstone, 1999, pp 1233-34. gitto e, reiter rj, karbownik m, tan dx, gitto p, barberi s, barberi i. causes of oxidative stress in the preand perinatal period. biol neonate. 2002; 81: 146-57. hossmann ka. neuronal survival and revival during and after cerebral ischemia. am j emerg med. 1983; 1: 191-97. jansson l, lindroth m, tyopponen j. intestinal absorption of vitamin e in low birth weight infants. acta paediatr scand. 1984; 73: 329-32. mccord jm. oxygen derived free radicals in post-ischemic tissue injury. n engl j med. 1985; 312: 159-63. ogihara t, hirano k, ogihara h, misaki k, hiroi 8 bangladesh j pharmacol 2006; 1: 5-9 https://www.ncbi.nlm.nih.gov/pubmed/?term=gitto%20e%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=reiter%20rj%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=karbownik%20m%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=tan%20dx%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=gitto%20p%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=barberi%20s%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=barberi%20s%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.ncbi.nlm.nih.gov/pubmed/?term=barberi%20i%5bauthor%5d&cauthor=true&cauthor_uid=11937719 https://www.nature.com/articles/pr2003273#auth-1 https://www.nature.com/articles/pr2003273#auth-2 https://www.nature.com/articles/pr2003273#auth-1 author info rashidul karim (principal contact) m, morinobu t, kim hs, ogawa s, ban r, hasegawa m, tamai h. non-protein bound transition metals and hydroxyl radical regeneration in cerebrospinal fluid of newborn infants with hypoxic ischemic encephalopathy. pediatr res. 2003; 53: 594-99. palmer c, vannucci rc. potential new therapies for perinatal cerebral hypoxia ischemia. clin perinatol. 1993; 20: 411-32. palmer c. hypoxic ischaemic encephalopathy (therapeutic approaches aganist microvascular injury, and role of neutrophils, paf, and free radicals). clin perinatol. 1995; 22: 481517. bangladesh j pharmacol 2006; 1: 5-9 9 https://www.nature.com/articles/pr2003273#auth-6 https://www.nature.com/articles/pr2003273#auth-11 bangladesh journal of pharmacology research article chemical investigation of the leaf and rhizome essential oils of zingiber zerumbet (l.) smith from bangladesh bjp introduction zingiber zerumbet (l) smith, a member of the family zingiberaceae is well known as jangli adha in bangladesh. the plant is widely cultivated in village gardens in the tropics for its medicinal properties and as a marketable spice (saadiah and halijah, 1995). it grows in the edges of the forests, village thickets in partial shade. it is distributed in bangladesh, india, malaysia, nepal and srilanka (anonymous, 1976). it has been reported that plants from this family have antiinflammatory (jaganath and ng, 2000; somchit and shukriyah, 2003), anti-ulceration (mascolo et al., 1989), anti-oxidant (agrawal et al., 2000) and antimicrobial properties (nakatani, 2000). it is used to treat stomach aches in indonesian traditional medicine under the name jamu (burkill, 1966). in polynesia it is an ingredient of several medical preparations used to treat ear inflammation and diarrhea (petard, 1986). it is used in local traditional medicine as a cure for swelling, sores and loss of appetite. the juice of the boiled rhizomes has also been used as a medicine for worm infestation in children. the volatile oil of the rhizomes has been shown to contain zerumbone, humulene and camprene (hasnah, 1991; srivastava et al., 2000). on reunion island z. zerumbet is grown only in gardens and is used to treat severe sprains in horses and to relieve rheumatic pain. the rhizome oil of z. zeruibet has been the subject of many studies, especially in india. dev (1960) isolated and determined the structure of zerumbone. nigam and levi (1963) identified, among other constituents, -humulene, zerumbone, and humulene monoxide. damodaran and dev (1968) characterized humulene oxides i, ii and iii, humulenols i and ii, caryophyllene oxide, -caryophyllene, dihydrophotozerumbone and photo-zerumbone. chhabra et al. (1975) found zerumbone epoxide. in oil from fiji, duve (1980) found highest levels of zerumbone (59%). dung et al. (1995) found high proportions of (z)nerolidol (22-36%), which was absent from rhizomes, in extracts of stems, leaves and flowers, and found zerumbone to predominate in leaves. srivastava et al. (2000) found in similar proportions curzerenone (14.4%), zerumbone (12.6%) and camphor (12.8%). chane-ming et al. (2003) reported that rhizomes were rich in zerumbone (37%), a-humulene (14.4%) and camphene (13.8%) and leaves were rich in transa journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2009; 4: 9-12 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 chemical investigation of the leaf and rhizome essential oils of zingiber zerumbet (l.) smith from bangladesh md. nazrul islam bhuiyan, jasim uddin chowdhury and jaripa begum medicinal and aromatic plants research division, bcsir laboratories, p.o. chittagong cantonment, chittagong 4220, bangladesh. article info received: 22 may 2008 accepted: 18 july 2008 available online: 9 august 2008 doi: 10.3329/bjp.v4i1.845 cite this article: bhuiyan mni, chowdhury ju, begum j. chemical investigation of the leaf and rhizome essential oils of zingiber zerumbet (l.) smith from bangladesh. bangladesh j pharmacol. 2009; 4: 9-12. abstract zingiber zerumbet (l.) smith leaf and rhizome oils, obtained by hydrodistillation, were analyzed by gas chromatography mass spectroscopy (gc-ms). twentynine components were identified in the leaf oil. the major components were zerumbone (37.0%); a-caryophyllene (16.4%) and camphene (9.2%). thirty components were identified in rhizome oil with the main components being in zerumbone (46.8%); a-caryophyllene (19.0%) and 1,5,5,8-tetramethyl-12oxabicyclo[9.1.0]dodeca-3,7-diene (4.3%). the compositions of both oils varied qualitatively and quantitatively. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor nerolidol (21.4%), -caryophyllene (6.9%) and linalool (7.7%). the characteristics of the oils from the leaves and rhizomes of z. zerumbet allow them to be identified unequivocally. lechat-vahirua et al. (1993) reported also the presence of zerumbone (65.3%) as major compounds in the oil from french polynesia. there are no previous references in literature about these bangladeshi oils. in this work we have determined the chemical composition of leaf and rhizome oils of z. zerumbet. these features allow it to be identified for medicinal use and classified among the other ginger oils available in the international market. materials and methods plant material the plant materials of z. zerumbet were collected from the plants grown in the campus of bcsir laboratory, chittagong during october 2007. a voucher specimen (y-569) was deposited in the herbarium of bcsir laboratory, chittagong. extraction of essential oil samples of leaf were harvested from healthy, wellgrown, two-year-old plants. freshly harvested leaves (500 g) and rhizome (200 g) were grounded in a blender separately. the grounded leaves and rhizome were subjected to hydrodistillation using a modified clevenger-type glass apparatus for 4 hours for isolation of oils separately. the oil samples were stored at 0°c in airtight containers after drying them over anhydrous sodium sulfate and filtered before going to gc-ms analysis. gc-ms analysis the essential oil from leaves and rhizomes of z. zerumbet were analyzed by gc-ms electron impact ionization (ei) method on gc-17a gas chromatograph (shimadzu) coupled to a gc-ms qp 5050a mass spectrometer (shimadzu); fused silica capillary column (30 m x 2.5 mm; 0.25 mm film thickness), coated with db-5 (j & w); column temperature 100°c (2 min) to 250°c at the rate of 3°c/min; carrier gas, helium at constant pressure of 90 kpa. acquisition parameters full scan; scan range 40-350 amu. identification of the compounds compound identification was done by comparing the nist library data of the peaks with those reported in literature, mass spectra of the peaks with literature data. percentage composition was computed from gc peak areas on db-5 column without applying correction factors. results and discussion the volatile compounds were identified in the leaves and rhizomes oil of z. zerumbet from bangladesh were 29 and 30 respectively (table i). the oil yields were 0.01% and 1.1% respectively. the leaves oil were rich in zerumbone (37.0%); -caryophyllene (16.4%); camphene (9.2%); 1,2-dihydropyridine,1-(1-oxobutyl),(5.8%); 3-cyclo hexen-1-carboxaldehyde, 3,4-dimethyl(3.9%); caryophyllene (3.3%); camphor (2.7%); caryophyllene oxide (2.5%); -pinene (2.2%); eucalyptol (1.7%) and longipinene, [e]-(1.7%). the rhizome oil was rich in zerumbone (46.8%); -caryophyllene (19.0%); 1,5,5,8-tetramethyl-12-oxabicyclo[9.1.0]dodeca -3,7diene (4.3%); caryophy-llene (4.0%); caryophyllene oxide (3.7%); camphene (3.6%); camphor (2.8%); kauran -18-al, 17-(acetyloxy)-, (4.beta.) (2.2%); 1h-cycloprop[e] azulen-4-ol, deca-hydro-1,1,4,7-tetramethyl-, [1ar(1a.alpha., 4.beta., 4a.beta., 7.alpha.,7a.beta.,7b.alpha.)] (1.9%); eucalyptol (1.3%) and -pinene (1.2%). results showed that the oils were complex mixture of numerous compounds, many of which were present in trace amounts. it is worth mentioning here that there is great variation in the chemical composition of leaves and rhizomes oils. zerumbone and -caryophyllene are the main common component in leaves and rhizomes oils. zerumbone is a anti-cancer bioactive compound (sharifah et al., 2007). zerumbone, -caryophyllene, caryophyllene, camphor, caryophyllene oxide, limonene, -pinene, eucalyptol, camphene, 3-carene, linalool, borneol, 4-terpineol and cycloheptane, 4-methylene-1-methyl-2-(2-methyl-1propen-1-1-yl)-1-vinyl were observed as the fourteen versatile common compounds present in both the oils with variations in percent content (table i). on the other hand, comparison of our oils composition with those reported from different places in the world earlier showed that our oil is especially different to others. but it is very interesting to note that comparison of our results reported on the leaf oil composition from the different places showed different results in the percentage content of some of the major and minor constituents. zerumbone and -caryophyllene, which have been reported as major constituents in our oils as well as in almost all the leaves and rhizomes oils of the world (vahirua et al., 1993; dung et al., 1993; chane et al., 2003; srivastava et al., 2000; chhabra et al., 1975; duve, 1980; nigam and levi, 1963) were either absent or present in trace amounts in the oil reported. this confirms that the variations in the cultivar reported are not due to geographic divergence and ecological conditions but that is due to different chemotype than ours. on the basis of above fact it may be concluded that z. zerumbet, growing widely in bangladesh, may be uti10 bangladesh j pharmacol 2009; 4: 9-12 lized as a source for the isolation of natural zerumbone and -caryophyllene respectively. as a result of this study, the essential oil of z. zerumbet has been extracted and its components identified. the high concentration of zerumbone and -caryophyllene in leaf and rhizome oil makes it respectively potentially useful in the medicines because they exhibit anti-inflammatory (jaganath and ng, 2000; somchit and shukriyah, 2003), anti-ulceration (mascolo et al., 1989), anti-oxidant (agrawal et al., 2000) and antimicrobial properties (nakatani, 2000). it is worth noting that the oil of z. zerumbet have been reported to be used in folk medicine in the treatment of inflammation, diarrhea and rheumatic pain. bangladesh j pharmacol 2009; 4: 9-12 11 table i constituents of leaf and rhizome essential oil from zingiber zerumbet peak no. name of constituents of leaf essential oil % name of constituents of rhizome essential oil % 1 tricyclene 0.6 -pinene 1.2 2 -pinene 2.2 camphene 3.6 3 camphene 9.2 3-carene 0.8 4 3-carene 1.0 -cymene 0.2 5 eucalyptol 1.7 limonene 0.9 6 limonene 1.1 eucalyptol 1.3 7 linalool 0.9 linalool 0.6 8 camphor 2.7 camphor 2.8 9 borneol 0.5 borneol 0.3 10 bornel 0.8 4-terpineol 0.2 11 4-terpineol 0.5 -terpinyl acetate 0.3 12 -terpineol 0.5 caryophyllene 4.0 13 caryophyllene 3.3 -caryophyllene 19.0 14 -caryophyllene 16.4 2,4-diisopropenyl-1-methylcyclohexane 0.5 15 cycloheptane, 4-methylene-1-methyl-2-(2methyl-1-propen-1-1-yl)-1-vinyl 0.7 anisole, p-styryl0.4 16 1,6,10-dodecatrien-3-ol, 3,7,11-trimethyl, -[s -(z)] 0.5 trans-nerolidol 0.5 17 caryophyllene oxide 2.5 germacrene d-4-ol 0.2 18 1,2-dihydropyridine,1-(1-oxobutyl),5.8 caryophyllene oxide 3.7 19 3-cyclohexen-1-carboxaldehyde, 3,4dimethyl 3.9 1,5,5,8-tetramethyl-12-oxabicyclo[9.1.0] dodeca-3,7-diene 4.3 20 azulene 1,2,3,4,5,6,7,8-octahydro-1,4dimethyl-7-(1-methylethylidene), -(is-cis) 0.5 2-naphthalenemethanol, 1,2,3,4,4a,5,6,7octahydro-.alpha.,.alpha.,4a,8-tetramethyl-, (2r-cis) 0.4 21 2,6-dimethyl bicyclo [3,2,1]octane 0.7 bicyclo[3.1.0]hexane-6-methanol, 2-hydroxy1,4,4-trimethyl 0.9 22 7-octylidenebicyclo [4.1.0] heptan0.7 kauran-18-al, 17-(acetyloxy)-, (4.beta.)2.2 23 1,5-cycloundecadien, 8,8-dimethyl-9methylene 1.1 1h-cycloprop[e]azulen-4-ol, decahydro1,1,4,7-tetramethyl-, [1ar(1a.alpha.,4.beta.,4a.beta., 7.alpha.,7a.beta.,7b.alpha.)] 1.9 24 3-isopropyltricyclo [4.3.1.1] (2,5) undec -3en-l0-ol 0.8 4-isopropenyl-4,7-dimethyl-1-oxaspiro[2.5] octane 0.2 25 –eudesmol 0.7 2-methylenecholestan-3-ol 1.0 26 agerospirol 1.0 carveol 0.9 27 3a,9-dimethyldodecahydrocyclohepta [d] inden-3-one 0.7 norethynodrel 0.2 28 trans-longipinene 1.7 zerumbone 46.8 29 zerumbone 37.0 bicyclo[5.3.0]decane, 2-methylene-5-(1methylvinyl)-8-methyl 0.4 30 cycloheptane, 4-methylene-1-methyl-2-(2methyl-1-propen-1-yl)-1-vinyl 0.5 author info md. nazrul islam bhuiyan (principal contact) e-mail: nazrul119@yahoo.com references agrawal ak, rao cv, sairam k, joshi vk. antipyretic and analgesic activities of zingiber zerumbet extracts. indian j exp biol. 2000; 38: 994-98. anonymous. the wealth of india. raw materials. vol. 11. india, csir, 1976, pp 89-90. burkill hi. dictionary of the economic products of the malay peninsula. ministry of agriculture and coop., kuala lumpur, 1966, p 2345. chane-ming j, vera r, chalchat jc. chemical composition of the essential oil from rhizomes, leaves and flowers of zingiber zerumbet smith from reunion island. j essent oil res. 2003; 15: 202-05. chhabra np, dhillon rs, wadia ms, kalsi ps. structure of zerumbone oxide: a new sesquiterpene epoxy ketone from zingiber zerumbet smith (wild ginger oil). indian j chem. 1975; 13: 222-24. damodaran np, dev s. studies in sesquiterpenes xxxix. structure of humulenols. tetrahedron 1968; 24: 4133-42. damodaran np, dev s. studies in sesquiterpenes xxxvii. sesquiterpenoids from the essential oil of zingiber zerumbet smith. tetrahedron 1968; 24: 4113-22. damodaran np, dev s. studies in sesquiterpenes xxxviii. structure of humulene epoxide-i and humulene epoxide-11. tetrahedron 1968, 24: 4123-32. dev s. sesquiterpenes. xvi. zerumbone, a monocyclic sesquiterpene ketone. tetrahedron 1960; 8: 171-80. dung nx, chinh td, leclercq pa. chemical investigation of the aerial parts of zingiber zerumbet (l.) sm. from vietnam. j essent oil res. 1995; 7: 153-57. dung nx, chinh td, rang dd, leclercq pa. the constituents of the rhizome oil of zingiber zerumbet (l.) sm. from vietnam. j essentl oil res. 1993; 5: 553-55. duve rn. highlights of the chemistry and pharmacology of wild ginger (zingiber zerumbet smith). fiji agric j. 1980; 42: 41-43. hasnah ms. chemical constituents of some medicinal plants of zingiberaceae: medicinal products from tropical rain forest. proceedings of the concerence, forest research institute malaysia, kuala lumpur, 1991; 2: 299-304. jaganath ib, ng lt. herbs: the green pharmacy of malaysia. vinpress sdn. bhd. and malaysia agricultural research and development institute, 2000, pp 95-99. mascolo n, jain r, jain sc, capasso fj. ethnopharmacologic investigation of. ginger (zingiber officinale). ethnopharmacology 1989; 27: 129-40. nakatani n. phenolic anti-oxidants from herbs and species. biofactors 2000; 13: 141-46. nigam lc, levi l. column and gas chromatographic analysis of oil of wild ginger: identification and estimation of some new constituents. can j chem. 1963; 41: 1726-30. petard p. quelques plantes utiles de la polynesie et ra'au tahiti. papeete, haere po no tahiti, 1986, p 1876. saadiah ms, halijah i. proceedings of the national convention on herbal medicine. vol. 21, kuala lumpur, forest research institute malaysia, 1995, pp 205-07. sharifah sakinah sa, tri handayani s, azimahtol hawariah lp. zerumbone induced apoptosis in liver cancer cells via modulation of bax/bcl-2 ratio. cancer cell int. 2007; 7: 4. somchit nhareet m, shukriyah nur mh. anti-inflammatory property of ethanol and water extracts of zingiber zerumbet. indian j pharmacol. 2003; 35: 181-82. srivastava ak, srivastava sk, shah nc. essential oil composition of zingiber zerumbet (l.) sm. from india. j essent oil res. 2000; 12: 595-97. lechat-vahirua i, francois p, menut c, lamely g, bessiere jm. aromatic plants of french polynesia. 1. constituents of the essential oils of rhizomes of three zingiberaceae: zingiber zerumbet smith, hedychium coronarium koenig and etlingera cevuga smith. j essent oil res. 1993; 5: 55-59. 12 bangladesh j pharmacol 2009; 4: 9-12 dateprinted: this article was downloaded by you on: mar 11, 2018 introduction about half of the total populations (more than 50 millions) of bangladesh, at present, are consuming arsenic through drinking and cooking (misbahuddin, 2003; mudur, 2000). among them more than 40,000 people have already developed the signs and symptoms of chronic arsenic toxicity. the basic treatment is to stop drinking arsenic contaminated water and allow the patient to use arsenic-safe water (smith et al., 2000). some authors suggest the use of β-carotene, vitamin a, ascorbic acid, α-tocopherol, zinc, selenium and spirulina for the treatment of chronic arsenic toxicity (ahmad et al., 1998; misbahuddin et al., 2006). these are anti-oxidants in nature. although some are watersoluble anti-oxidants and some are lipid soluble. duration of treatment ranges from 4-12 months. prolong duration of treatment affects the patients’ compliance as well as treatment cost. our body also contains α-lipoic acid, which is a short chain fatty acid with sulfhydryl (-sh) groups that has potent anti-oxidant property (packer et al., 1995). antioxidant properties of α-lipoic acid are due to its ability to scavenge hydroxy radicals, hypochlorous acid and singlet oxygen (biewenga et al., 1997). α-lipoic acid is present in our diet such as spinach, broccoli and tomatoes. naturally occurring renantiomer of α-lipoic acid is an essential cofactor in α-keto-acid dehydrogenase complexes and the glycine cleavage system (jones et al., 2002). it is readily absorbed from the gut and the mean peak plasma concentration of α-lipoic acid following a single oral administration of 200 mg was 3.1 μm. the mean plasma half-life of α-lipoic acid was about 30 min (teichert et al., 1998). within the tissue, it is rapidly converted into dihydrolipoic acid (dhla). both α-lipoic acid and dhla may chelate or bind metal ions and facilitating their removal from the cell (ou et al., 1995). exogenous administration of αlipoic acid has been found to be effective in many pathological condition associated with oxidative stress, a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 27-32 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the patient of chronic arsenic toxicity shows oxidative stress. to overcome the oxidative stress, several anti-oxidants such as β-carotene, ascorbic acid, αtocopherol, zinc and selenium had been suggested in the treatment of chronic arsenic toxicity. in the present study universal anti-oxidant (both water and lipid soluble anti-oxidant) α-lipoic acid was used to examine the effectiveness of reducing the amount of arsenic from arsenic-loaded isolated liver tissues of rat. isolated liver tissues of long evans norwegian rats were cut into small pieces and incubated first in presence or absence of arsenic and then with different concentrations of α-lipoic acid during the second incubation. αlipoic acid decreases the amount of arsenic and malondialdehyde (mda) in liver tissues as well as increases the reduced glutathione (gsh) level in dose dependent manner. these results suggest that α-lipoic acid remove arsenic from arsenic-loaded isolated liver tissues of rat. article info received: 26 may 2006 accepted: 1 july 2006 available online: 22 april 2008 doi: 10.3329/bjp.v1i1.484 cite this article: tabassum ne. effect of alpha-lipoic acid on the removal of arsenic from arsenic-loaded isolated liver tissues of rat. bangladesh j pharmacol. 2006; 1: 27-32. effect of alpha-lipoic acid on the removal of arsenic from arsenicloaded isolated liver tissues of rat noor-e-tabassum department of pharmacology, bangabandhu sheikh mujib medical university, shahbag, dhaka 1000, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. diabetic neuropathy (zeigler et al., 1999), metal toxicity (muller and menzel, 1990), hypertension (el midaoui and champlain, 2002), diabetic complication and cataracts (packer, 1994). recently it has been found that α-lipoic acid suppressed the free radicals initiated by arsenic in different parts of rat brain regions (shila et al., 2005a). α-lipoic acid also causes an increase in intracellular gsh in vitro as well as in vivo (busse et al., 1992). simultaneous administration of lipoate (α-lipoic acid) to arsenic-treated rats has been shown to decrease arsenic content and increase glutathi-one status remarkably in discrete brain areas (shila et al., 2005b). glutathione and glutathione related enzyme play an important role in the cell against the effect of reactive oxygen species (ros). gsh also stimulates the arsenic detoxification process by modulating arsenic speciation (scott et al., 1993). therefore, this study was designed to evaluate the effect of α-lipoic acid on the removal of arsenic from the arsenic-loaded isolated liver tissue of rat. materials and methods chemicals and reagents arsenic trioxide (as2o3), reduced glutathione (gsh), 5,5-dithio-bis-2-nitro-benzoic acid (dtnb) and thiobarbituric acid were purchased from sigma chemical company (st. louis, mo, usa). chemicals and reagents to measure lactase dehydrogenase (ldh) and total protein were from human gmbh (germany). α-lipoic acid was a gift from opsonin pharma limited, bangladesh. all other rea-gents and solvents were highest analytical grade available. preparation of isolated liver tissues the study was carried out on isolated liver tissues of long evans norwegian adult healthy male rats weighing about 150-180 g. the rats were housed in standard plastic cages in a clean rodent room where a 12 hours light/dark cycle was maintained. on the day of experiment, rats were sacrificed under chloroform anesthesia and the abdomen was opened by giving a midline incision. the liver was dissected out and immersed immediately into the physiological solution (nacl 150 mm, kcl 5.6 mm, nahco3 25 mm, nah2po4 2.5 mm, glucose 10 mm), placed in ice bath. the liver tissues were chopped into small pieces (approximately 2 mm in size). research design isolated liver tissues of rat were incubated with in presence or absence of arsenic (50 μg) at 37°c for 45 min. after the first incubation, tissues were washed twice with physiological solution. the purpose of this incubation was to load the liver tissues with arsenic. then during the second incubation (at 37°c for another 45 min), liver tissues were treated with different concentrations of α-lipoic acid (1, 10, 100 μm). several test tubes were taken and each test tube contains 250 mg small pieces of liver tissues immersed in 5 ml of physiological solution. the test tubes were marked as groups: group icontrol; group iiarsenic (50 μg); group iiiarsenic (50 μg) + α-lipoic acid (1 μm); group ivarsenic (50 μg) + α-lipoic acid (10 μm); group varsenic (50 μg) + α-lipoic acid (100 μm). number of the test tubes (samples) in each group was six. after second incubation, tissues were homogenized and used for the estimation of total arsenic, total protein, malondialdehyde (mda), and gsh level. estimation of arsenic the amount of total arsenic was measured using atomic absorption spectrophotometer with hydride generator (buck scientific, usa). in brief (wang et al., 1994): the sample, at first, digested with nitric acid (3 ml), sulfuric acid (2 ml) and perchloric acid (2 ml) for 2 hours by bunsen burner. following digestion, each sample was introduced into the hydride generator by continuous flow of 10% hydrochloric acid, 3% sulfuric acid and 1.5% sodium borohydride into a gas-liquid separator. the arsine vapor produced by arsenic and the hydrogen gas (produced by sodium borohydride and acid) was carried out by flowing argon gas into quartz t-tube. the tube was heated in an air-acetylene flame (2300°c), serve as atomization cell. the current of the hollow cathode lamp for arsenic was 10 ma. the wavelength and spectral bandwidth were 193.7 and 0.7 nm respectively. estimation of mda the extent of lipid peroxidation was estimated by using the thiobarbituric acid method to determine mda levels described by wilber et al. (1949). briefly, 1 ml of tissues homogenate was reacted with 4.5 ml of 5.5% trichloroacetic acid. the mixture was vortexes and centrifuged at 4,000 x g for 10 min. 1 ml of 0.7% thiobarbituric acid was added to supernatant and heated at 100°c for 10 min, forming a pink colored solution. after cooling of the mixtures, absorbance was measured by spectrophotometer (uv-vis 1201; shimadzu, japan) at 532 nm. the results were expressed as nmol mda per mg of protein. estimation of gsh gsh level was assayed by the method of ellman, (1959). in brief, 1 ml of tissues homogenate was added to 1 ml of 5% trichloroacetic acid and the mixture was 28 bangladesh j pharmacol 2006; 1: 27-32 vortexes and centrifuged at 4,000 x g for 5 min. to 250 μl of supernatant, 2 ml na2hpo4 (4.3%) and 250 μl of dtnb (0.04%) were added. the mixture was allowed to stand for approximately 15 min, and forming a yellow substance. the absorbance was measured at 412 nm using a spectrophotometer. cell viability test the tissues were incubated with different strengths of arsenic (25, 50, 100, 200 μg) at 37°c for 45 min to determine the concentration of arsenic that would not induce tissues damage. cytotoxicity was determined by the release of ldh into the medium. after the incubation of tissues with arsenic, the supernatant (medium) were removed and analyzed for ldh content using human gmbh diagnostic ldh assay based on the technique of schumann et al. (2002). estimation of protein protein concentration of tissues was estimated by 'biuret' method described by weichselbaum (1949). bovine serum albumin (8 g/dl) was used as standard. statistical analysis statistical analyses were carried out using statistical package for social science (spss), version 9.0, usa. the values were expressed as mean ± sem for results obtained with six samples in each group and the significant of differences between values was determined by one-way analysis of variance (anova) f-test coupled with the dunnets’s multiple comparison test. statistical significance was determined by p value less than 0.05. results the amount of total arsenic in arsenic-loaded isolated liver tissues of rat after second incubation was 91.9 ± 2.0 μg/g of protein (table i). but when the arsenic-loaded tissues were incubated with 1, 10, and 100 μm concentration of α-lipoic acid during the second incubation, the amounts of total arsenic in tissues were decreased to 67.7 ± 2.5, 50.1 ± 1.7, and 27.2 ± 1.7 μg/g of protein respectively. the removals of accumulated arsenic from tissues were 26.3, 45.5 and 70.5% respectively. these effects of removing arsenic were dose dependent and statistically significant (p<0.001). as shown in table ii, the mean (± sem) concentration of gsh in arsenic-untreated tissues was 2.8 ± 0.1 μg/ mg of protein and following incubation of tissues with 50 μg of arsenic, the concentration of gsh decreased to 1.4 ± 0.04 μg/mg of protein which was statistically significant (p<0.001) in comparison to the control group. in arsenic plus α-lipoic acid (1 μm) treated group, gsh concentration averaged 1.7 ± 0.1 μg/mg of protein. with increasing the doses of α-lipoic acid (10 and 100 μm), gsh concentration significantly (p<0.001) table i effect of α-lipoic acid on the removal of arsenic from arsenic-loaded isolated liver tissues of rat group n incubation of liver tissues at 37°c for 45 min tissues concentration of arsenic after second incubation (μg/g protein; mean ± sem) p value first incubation second incubation i 6 none none 1.1 ± 0.1 ii 6 arsenic (50 μg) none 91.9 ± 2.0 iii 6 arsenic (50 μg) lipoic acid (1 μm) 67.7 ± 2.5 p<0.001 iv 6 arsenic (50 μg) lipoic acid (10 μm) 50.1 ± 1.7 p<0.001 v 6 arsenic (50 μg) lipoic acid (100 μm) 27.2 ± 1.7 p<0.001 n = number of samples in each group; none means tissues were incubated with physiological solution without arsenic table ii effect of α-lipoic acid on the levels of gsh and mda in arsenic-loaded isolated liver tissues of rat parameter control arsenic (50 μg) arsenic (50 μg) + lipoic acid (1 μm) arsenic (50 μg) + lipoic acid (10 μm) arsenic (50 μg) + lipoic acid (100 μm) p value gsh 2.8 ± 0.1 1.4 ± 0.04 1.7 ± 0.1 2.1 ± 0.1 2.5 ± 0.1 p<0.001a mda 3.1 ± 0.1 9.3 ± 0.1 6.8 ± 0.2 5.2 ± 0.2 3.9 ± 0.2 p<0.001 values were expressed as mean ± sem of six samples in each group; gsh refers to reduced glutathione level expressed as μg sulfhydryl groups/mg protein; mda refers to malondialdehyde level expressed as nmol/mg protein. asignificance based on dunnet’s multiple comparison tests for comparison of treated groups with standard (only arsenic-treated) group bangladesh j pharmacol 2006; 1: 27-32 29 increased to 2.1 ± 0.1 and 2.5 ± 0.1 μg/mg of protein respectively. this result also indicate that gsh level significantly (p<0.001) decreased in arsenic-treated groups by 52% compared to control while administration of α-lipoic acid in arsenic-loaded isolated liver tissues significantly (p<0.001) restored the gsh level by 25, 47 and 79% at 1, 10 and 100 μm concentration respectively. the mean (± sem) concentration of mda in arsenic-untreated group was 3.1 ± 0.1 nmol/mg protein. when the tissues were treated with 50 μg of arsenic, the concentration of mda increased to 9.3 ± 0.1 nmol/mg protein which was statistically significant (p<0.001) in comparison to the control group. treatment of arsenic-loaded isolated liver tissues with different concentrations of α-lipoic acid (1, 10, and 100 μm) significantly (p<0.001) decreased the mda concentration thus bring back the changes to near normalcy (6.8 ± 0.2, 5.2 ± 0.2, 3.9 ± 0.2 nmol/mg protein respectively). the increased production of mda by exposure to arsenic and its recovery by different concentrations of α-lipoic acid treatment were shown in table ii. results indicate that mda production, an indicator of lipid peroxidation, was increased (p<0.001) in arsenic-treated groups and it was 201% compared to control while administration of different concentrations of α-lipoic acid (1, 10, and 100 μm) in arsenic-loaded tissues could significantly (p< 0.001) reduce the production of mda by 40, 66 and 88% respectively. the effect of different concentrations of arsenic (25, 50, 100 and 200 μg) on cell viability was examined. the ldh activity after incubation of tissues with 100 and 200 μg of arsenic were 58.5 ± 0.9 and 139.2 ± 3.1 u/i respectively, whereas, the ldh activity was not detected in tissues loaded with 25 and 50 μg of arsenic. these result suggested that 25 and 50 μg of arsenic preserve cell viability. discussion oxidative stress due to enhanced production of free radicals has been incriminated as one of the several mechanisms involved in arsenic-induced toxic effects in different organs. in view of the anti-oxidant properties of α-lipoic acid, the present work was conducted to evaluate its effects on the removal of arsenic from arsenic-loaded isolated liver tissues of rat. in this study, viability of the tissues was determined by the activity of ldh. the activity of ldh was not showed in a concentration of 25 and 50 μg of arsenic. these data not only suggested that the preparations were viable but also suggested that arsenic exposure at least at the 50 μg concentrations used in this experiments was not induce tissue damage. in the present work, a substantial increase in the level of arsenic was observed in the tissues treated with arsenic. however, treatment with different concentrations of αlipoic acid remarkably brings down the level of arsenic (p<0.001) in a dose-dependent manner. arsenic binds to the sh group of dihydrolipoate and inhibits pyruvate dehydrogenase consequently prevents oxidation of dihydrolipoate to lipoate, which is needed in the formation of acetyl-coa from pyruvate (miller et al., 2002). dose-dependent protection offered by α-lipoic acid might be attributed to the ability of αlipoic acid to protect the sh groups in the reduced form or compete with mitochondrial lipoamide for availability of arsenic, which thus prevents the binding of arsenic to proteins in isolated liver tissues of rat. arsenic exposure in this experiment resulted in a significant (p<0.001) reductions in the level of the gsh and associated with increases in lipid peroxidations in comparison to control group. arsenic content causes extensive oxidation of intramitochondrial nadph by inhibition of α-ketoacid dehydrogenase (shi et al., 2004). the shortage of nadph production during arsenic exposure would suppress the reduction of gssg subsequently decrease the gsh content. the increase in the levels of mda was due to the increased release of iron that was believed to be involved in the fenton type of reaction. arsenic is shown to stimulate the release of iron from ferritin and through the activation of heme oxygenease the rate limiting enzyme in heme degradation (ahmad et al., 2000). the free iron is considered as a potent enhancer of ros formation, as exemplified by the reduction of h2o2 with the generation of highly aggressive hydroxyl radical (farber, 1994). therefore, this may be the possible reason for elevation of the levels of mda with a concomitant fall in the gsh content. the inverse relationship between lipid peroxidation and gsh levels in the liver on arsenic exposure was suggested by ramos et al. (1995). however, treatment with different concentrations of αlipoic acid significantly (p<0.001) increase the levels of gsh. enhancement of intracellular availability of cysteine, by passing the rate limiting cystine transport system may be the underlying mechanism of α-lipoic acid-induced elevation of gsh levels observed in this study. this finding was in agreement with previous in vitro research work (busse et al., 1992). in the present study, the decrease levels of mda observed in the α-lipoic acid treatment group may be 30 bangladesh j pharmacol 2006; 1: 27-32 attributed to its capacity to regenerate the reduced glutathione pool and/or may be directly react with ros. these findings were consistent with the results of previous studies (shila et al., 2005b). conclusion the finding of the present study suggests that exposure of liver tissues with arsenic was associated with a depletion of gsh and increased lipid peroxidation. αlipoic acid administration offered a significant removal of arsenic, which was associated with its anti-oxidant activity that combine free radical scavenging and metal chelating properties. however, further studies with αlipoic acid need to be carried out in vivo to ascertain their therapeutic efficacy in modifying chronic arsenic toxicity. financial support self-funded ethical issue the study was approved by the ethical committee of bangabandhu sheikh mujib medical university. acknowledgement i am grateful to prof. mir misbahuddin, department of pharmacology, bangabandhu sheikh mujib medical university, shahbag, dhaka 1000, bangladesh for his support and encouragement throughout this work. references ahmad s, kitchin kt, cullen wr. arsenic species that causes release of iron from ferritin and generation of activated oxygen. arch biochem biophys. 2000; 382: 195-202. ahmad sa, faruquee mh, sayed mhsu, khan mh, hadi sa, khan aw. chronic arsenicosis: management by vitamin a, e, c regimen. j prev soc med. 1998; 17: 19-26. biewenga g, haenen grmm, bast a. the pharmacology of anti-oxidant lipoic acid. gen pharmacol. 1997; 29: 315-31. busse e, zimmer g, schopohl b, kornhuber b. influence of alpha-lipoic acid on intracellular glutathione in vitro and in vivo. arzneimittelforschung. 1992; 42: 829-31. el midaoui a, de champlain j. prevention of hypertension, insulin resistance, and oxidative stress by α-lipoic acid. hypertension. 2002; 39: 303-07. ellman lg. tissues sulfhydryl groups. arch biochem biophys. 1959; 82: 70-77. farber jl. mechanisms of cell injury by activated oxygen species. environ health perspect. 1994; 102: 17-24. jones w, li x, qu zc, perriott l, whitesell rr, may jm. uptake, recycling, and anti-oxidant action of α-lipoic acid in endothelial cells. free radic biol med. 2002; 33: 83-93. miller jr wh, schipper hm, lee js, singer j, waxman s. mechanisms of action of arsenic trioxide. cancer res. 2002; 62: 3893-903. misbahuddin m, maidul islam azm, khandker s, mahmud ia, islam n, anjumanara. efficacy of spirulina extract plus zinc in patients of chronic arsenic poisoning: a randomized placebo-controlled study. clin toxicol. 2006; 44: 135-41. misbahuddin m. consumption of arsenic through cooked rice. lancet 2003; 361: 435-36. mudur g. half of bangladeshi population at risk of arsenic poisoning. br med j. 2000; 320: 822. muller l, menzel h. studies on the efficacy of lipoate and dihydrolipoate in the alteration of cadmium2+ toxicity in isolated hepatocytes. biochim biophys acta. 1990; 1052: 38691. ou p, trischler hj, wolff sp. thiotic (lipoic) acid: a therapeutic metal-chelating anti-oxidant? biochem pharmacol. 1995; 50: 123-26. packer l, witt eh, tritschler hj. alpha-lipoic acid as a biological anti-oxidant. free radic biol med. 1995; 19: 227-50. packer l. anti-oxidant properties of lipoic acid and its therapeutic effects in prevention of diabetes complications and cataracts. ann n y acad sci. 1994; 738: 257-64. ramos o, carrizales l, yanez l, mejia j, batres l, ortiz d, díaz-barriga f. arsenic increased lipid peroxidation in rat tissues by a mechanism independent of glutathione levels. environ health perspect. 1995; 103: 85-88. schumann g, bonora r, ceriotti f, ferard g, ferrero ca, franck pfh, gella fj, hoelzel w, jørgensen pj, kanno t, kessner a, klauke r, kristiansen n, lessinger jm, linsinger tpj, misaki h, panteghini m, pauwels j, schiele f, schimmel hg. ifcc primary reference procedures for the measurement of catalytic activity concentrations of enzymes at 37°c. clin chem lab med. 2002; 40: 725-33. scott n, hatlelid km, mackenzie ne, carter ce. reactions of arsenic (iii) and arsenic (v) species with glutathione. chem res toxicol. 1993; 6: 102-06. shi h, shi x, liu kj. oxidative mechanism of arsenic toxicity and carcinogenesis. mol cell biochem. 2004; 255: 67-78. shila s, kokilavani v, subathra m, panneerselvam c. brain regional responses in anti-oxidant system to alpha-lipoic acid in arsenic intoxicated rat. toxicology 2005a; 210: 25-36. shila s, subathra m, devi ma, panneerselvam c. arsenic intoxication-induced reduction of glutathione level and of the activity of related enzymes in rat brain regions: reversal by dl α-lipoic acid. arch toxicol. 2005b; 79: 140-46. smith ah, lingas eo, rahman m. contamination of drinkingwater by arsenic in bangladesh: a public health emergency. bull world health organ. 2000; 78: 1093-103. teichert j, kern j, trischler hj, ulrich h, preiss r. investibangladesh j pharmacol 2006; 1: 27-32 31 author info noor-e-tabassum (principal contact) e-mail: drtabassum_1@yahoo.co.uk gations on the pharmacokinetics of α-lipoic acid in healthy volunteers. int j clin pharmacol ther. 1998; 36: 625-28. wang ct, chang wt, huang cw, chou ss, lin ct, liau sj, wang rt. studies on the concentrations of arsenic, selenium, copper, zinc and iron in the hair of blackfoot disease patients in different clinical stages. eur j clin chem clin biochem. 1994; 32: 107-11. weichselbaum te. estimation of serum total protein by biuret method. am j clin pathol. 1946; 16: 40-48. wilber km, baerheim f, shapiro ow. the thiobarbituric acid reagent as a test for the oxidation of unsaturated fatty acid by various reagents. arch biochem biophys. 1949; 24: 304-11. ziegler d, reljanovic m, mehnert h, gries fa. α-lipoic acid in the treatment of diabetes polyneuropathy in germany: current evidence from clinical trials. exp clin endocrin diab. 1999; 107: 421-30. 32 bangladesh j pharmacol 2006; 1: 27-32 https://www.ncbi.nlm.nih.gov/pubmed/8031959 bangladesh journal of pharmacology research article in vivo hypoglycemic and anti-diabetic study of oncocalyx glabratus bjp introduction diabetes mellitus is considered as a metabolic disorder characterized by fast rising of blood sugar level. it is a chronic disease that occurs either by the deficiency in production of insulin by β cells in pancreas (type 1) or by the incompetence of produced insulin (type 2) (who, 1999). even though substantial work has been done in the treatment of diabetes by administration of oral hypoglycemic agents, exploration of new drugs is still required as the existing drugs have many restrictions (kavishanker et al., 2011). hence search for new anti-diabetic agents has continued to be an important area of concern. since time immemorial diabetes has been treated orally by numerous medicinal plants (gupta et al., 2005). family loranthaceae is one of the largest flowering parasitic plants having about 70 genera and 1000 species (calvin and wilson, 2006). this family comprises epiphytic and hemiparasitic plants, known as mistletoe (loranzi, 2000). mistletoes are known as “cure all” and have been found beneficial for more than twenty health problems (adodo, 2004), including diabetes (obatomi et al., 1994). oncocalyx glabratus belongs to family loranthaceae is fairly common only locally in kingdom of saudi arabia (colenette, 1999). in view of the remedial property associated with mistletoes, the title plant was investigated for its hypoglycemic and anti-diabetic potential. materials and methods plant material o. glabratus was collected in february, 2014 from dos village, saudi arabia and was identified by a taxonomist dr. m. yusuf and a voucher specimen of the plant (no. 16320) was deposited at the herbarium of the college of pharmacy, king saud university, riyadh, saudi arabia. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 830-835 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the present study was designed to investigate the hypoglycemic and antidiabetic potential of oncocalyx glabratus. the extracts and fractions of plant were administrated orally to mice at a dose of 400 mg/kg. the hypoglycemic effect, glucose tolerance test and lipid profile were assessed in treated mice, compared with normal, diabetic and standard drug treated mice. in the hypoglycemic and anti-diabetic study the extracts and fraction reduced blood glucose level and achieved the significant value (p<0.001). the glucose tolerance test was performed in mice loaded with 3 g/kg glucose solution. nhexane extract and water fraction reduced the glucose level significantly (p<0.001) after 60, 90 and 120 min conversely ethyl acetate and methanol extracts showed the significant (p<0.001) reduction after 90 and 120 min. ethyl acetate and methanol extracts showed substantial changes in biochemical parameters, compared to the standard drug. so, the study suggested the hypoglycemic and anti-diabetic activity of the title plant. article info received: 6 june 2015 accepted: 14 july 2015 available online: 13 october 2015 doi: 10.3329/bjp.v10i4.23600 cite this article: ahmed s, mothana ra, al-rehaily aj. in vivo hypoglycemic and antidiabetic study of oncocalyx glabratus. bangladesh j pharmacol. 2015; 10: 830 -35. in vivo hypoglycemic and anti-diabetic study of oncocalyx glabratus sarfaraz ahmed, ramzi a. mothana and adnan j. al-rehaily department of pharmacognosy, college of pharmacy, king saud university, p.o. box 2457, riyadh 11451, saudi arabia. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. chemicals solvents used for the extraction and fractionation were n-hexane, dichloromethane, ethyl acetate, methanol, nbutanol (sigma chemicals, usa) and distilled water. all solvents except n-butanol were distilled in the laboratory prior to use. alloxan was purchased from sigma (usa) and glibenclamide was purchased from spimaco (saudi arabia). kits used in the estimation of different biochemical parameters were purchased from different sources. extraction process the dried and coarsely grinded material of the aerial part (691 g) was extracted in sequence with n-hexane, dichloromethane, ethyl acetate, methanol and water (2 l × 3) at room temperature for 72 hours (24 hours × 3). the extract was filtered through filter paper (whatman no. 1) and solvent was evaporated to dryness at 40ºc under reduced pressure using buchi rotavapour which gave n-hexane extract (18.9 g), dichloromethane extract (4.6 g), ethyl acetate extract (2.3 g), methanol extract (88.0 g) and water extract (51.0 g). the methanol extract (50.0 g) was dissolved in water and extracted with ethyl acetate (29.3 g), n-butanol (12.2 g) and water (7.8 g). animals male swiss albino mice (20-25 g) roughly of same age group were procured from the experimental animal care center, college of pharmacy, king saud university, riyadh. the animals were kept at constant temperature (22 ± 2°c), humidity (55%) and light-dark conditions (12/12 hours light/dark). they were provided with purina chow and free access to drinking water ad libitum. the experimental animals were acclimatized for seven days prior being used for the studies. evaluation of hypoglycemic and anti-diabetic activity the dose of 400 mg/kg body weight was given to each animal. tween 80 solvent (1 ml) was added to each extract/fraction. the experiment was performed according to the procedure described (el tahir, 2007). briefly for hypoglycemic study, we prepared eight groups of animals (each group consists of four mice). one group was given normal saline, second was given tween 80, third was given standard hypoglycemic drug, daonil® (glibenclamide) at a dose of 1 mg/kg body weight and rest of the groups were given extracts/fractions being examined. the extracts/fractions and drugs were given orally to animals after 24 hours fasting. blood samples were taken before giving the drug (zero time) and 2 hours after giving drugs and glucose blood level was measured using reflotron® instrument. for anti-diabetic screening, diabetes was induced in the overnight fasted experimental animals by injecting alloxan intraperitoneal (150 mg/kg). after 72 hours of injection the animals became diabetic and the experiment were performed as described in hypoglycemic experiment. glucose tolerance test in normal mice mice were divided into seven groups comprising of four animals each. all animals were fasted before the experiment. group i was kept as control given 1 ml normal saline, group ii was kept as vehicle control which received 1 ml tween 80, group iii was given glibenclamide (1 mg/kg) and rest of the four groups were given n-hexane, ethyl acetate, methanol extracts and water fraction at a dose of 400 mg/kg body weight respectively. the animals were loaded with glucose (3 g/kg p.o) (hemant et al., 2009) and the blood samples were collected just prior to drug administration and at 30, 60, 90 and 120 min time interval. serum glucose level was determined immediately by means of glucose estimation kit refretron (roche, germany) to observe the hypoglycemic effects of the tested extracts/fractions relative to control and standard group. biochemical parameters animals were also treated at a dose of 400 mg/kg body weight for seven days. then the animals were given alloxan 1 mg/kg and after 72 hours, cholesterol, triglycerides (tg), high density lipoprotein (hdl-c), very low density lipoprotein (vldl-c) and low density lipoprotein (ldl-c) were measured by using diagnostic kit refretron (roche, germany). statistical analysis data were expressed as arithmetic means ± standard deviation of the mean (sd) and statistically analyzed by using the one-way analysis of variance (anova) followed by student’s t-test. results hypoglycemic activity the effect of different extracts of the plant at a dose of 400 mg/kg body weight on fasting blood sugar level was assessed in normal mice and the results are summarized in table i. the decrease in glucose level by the n-hexane, ethyl acetate and methanol extracts were found to be 41%, 40% and 42% respectively, which was significant reduction in glucose level at the given dose as compared to standard drug. while slight increase in glucose level was observed for the dichloromethane and water extracts in the experimental animals. anti-diabetic activity changes in blood glucose level in diabetes-induced mice on treatment with different extracts (n-hexane, dichloromethane, ethyl acetate, methanol and water) at a dose of 400 mg/kg body weight are shown in table i. the significant reduction of glucose level by the treatment of n-hexane, ethyl acetate and methanol extracts are found to be 48%, 43% and 47% respectively as compared to standard drug. bangladesh j pharmacol 2015; 10: 830-835 831 while significant increase in glucose level 31% by water extract was observed, on the other hand, dichloromethane extract showed negligible increase in the glucose level. based on above results methanol extracts was further fractionated into ethyl acetate, n-butanol and water fractions and tested for hypoglycemic and anti-diabetic activity and results are summarized in table i. from the results it was found that out of three fractions only water fraction showed significant reduction in hypoglycemic and anti-diabetic activity (47% and 46%) respectively. the hypoglycemic and anti-diabetic results of the tested extracts/fractions were significant and prompted us to investigate the effects of these active extracts/fraction on glucose tolerance test and different biochemical parameters. glucose tolerance test significant increase in blood glucose level was observed after one hour of administration of glucose (3 g/kg) in normal mice (figure 1). no significant change in blood glucose level was observed after 30 min of the drug administration. after 60 min n-hexane extract and water fraction showed the 36% and 39% reduction respectively in glucose level. on the other hand, after 90 min all the extracts/fraction (n-hexane, ethyl acetate, methanol and water) showed the significant reduction of 41%, 29%, 50% and 54% in glucose level respectively. after 2 hours the reduction in the glucose level in nhexane (46%), ethyl acetate extract (42%), methanol extract (52%) and water fraction (58%) treated groups were observed. biochemical parameters significant differences were observed in serum lipid profile by the ethyl acetate and methanol extracts (table ii). the percent decrease in cholesterol and triglycerides level by the ethyl acetate extract was 22% and 32% respectively and while percent decrease in cholesterol and triglycerides level by the methanol extract was 32% and 36% respectively. ethyl acetate and methanol extracts increase the hdl-c percentage by 42% and 80%. conversely ethyl acetate extract decrease vldl-c and ldl-c percentage by 32% and 30% respectively and methanol extract decrease vldl-c and ldl-c percentage by 36% and 50% respectively. discussion in present study, different extracts of o. glabratus were examined for hypoglycemic and anti-diabetic activity. administration of the n-hexane, ethyl acetate and methanol extracts out of five extracts showed significant reduction in blood glucose level in both normal and diabetic induced mice at a given dose of table i hypoglycemic study of o. glabratus on normal and diabetic mice treatment dose (mg/kg) orally glucose levels in normal mice (mg/dl) % inhibition % inhibition glucose levels in diabetic mice (mg/dl) before treatment 2 hours after treatment before treatment 2 hours after treatment normal saline 100.1 ± 6.5 108.5 ± 3.6 ↑8 307.0 ± 6.0 309.7 ± 6.4 vehicle (tween-80) 108.3 ± 4.1 111.0 ± 6.7 325.3 ± 14.1 316.2 ± 7.9 glibenclamide 1 114.0 ± 4.1 45.3 ± 3.0b ↓60 319.8 ± 11.6 155.8 ± 4.9b ↓52 n-hexane extract 400 102.0 ± 5.4 60.7 ± 2.0 ↓41 301.3 ± 9.1 156.0 ± 4.1b ↓48 dichloromethane extract 400 116.2 ± 3.1 132.0 ± 3.2a ↑14 317.3 ± 5.1 329.2 ± 12.1 ↑4 ethyl acetate extract 400 105.0 ± 6.4 62.9 ± 3.1b ↓40 294.7 ± 12.4 168.2 ± 6.1b ↓43 methanol extract 400 114.3 ± 4.5 66.5 ± 4.2b ↓42 301.7 ± 7.4 160.8 ± 11.8b ↓47 water extract 400 106.7 ± 5.3 136.7 ± 5.7a ↑28 306.2 ± 13.6 400.2 ± 10.2b ↑31 ethyl acetate fraction 400 112.8 ± 2.5 94.5 ± 23.3 ↓16 300.0 ± 7.2 293.0 ± 9.8 n-butanol fraction 400 110.8 ± 5.6 100.3 ± 7.6 ↓10 285.5 ± 20.3 277.5 ± 14.1 water fraction 400 116.0 ± 4.4 61.7 ± 2.9b ↓47 316.0 ± 9.4 170.3 ± 8.2b ↓46 data are mean of 4 male in each group ± sd; ap<0.01; bp<0.001 student's t-test 832 bangladesh j pharmacol 2015; 10: 830-835 table ii effects of o. glabratus on lipid profile in normal and diabetic mice treatment cholesterol (mg/dl) triglycerides (mg/dl) hdl-c (mg/dl) vldl-c (mg/dl) ldl-c (mg/dl) mean (se) % change mean (se) % change mean (se) % change mean (se) % change mean (se) % change normal 94.3 (4.4) 92.8 (6.8) 54.1 (2.3) 18.5 (1.4) 21.7 (1.6) diabetic 195.3 (10.1)c 185.8 (6.5)c 22.6 (1.6)c 37.2 (1.3)c 133.5 (9.4)c vehicle 189.3 (11.4) 3↓ 175.5 (11.6) 6↓ 24.8 (1.9) 10↑ 34.9 (2.3) 6↓ 129.6 (8.6) 4↓ glibenclamide 113.3 (4.8)c 42↓ 109.5 (4.2)c 41↓ 42.8 (2.5)c 89↑ 21.9 (0.8)c 41↓ 48.5 (5.6)c 64↓ n-hexane extract 166.0 (7.8)a 15↓ 163.5 (3.9)a 12↓ 26.8 (1.2) 19↑ 32.7 (0.8)a 12↓ 106.5 (9.2) 21↓ ethyl acetate extract 152.0 (5.0)b 22↓ 126.5 (5.1)c 32↓ 32.2 (1.5)b 42↑ 25.3 (1.0)c 32↓ 94.6 (4.4)b 30↓ methanol extract 132.8 (5.7)c 32↓ 119.0 (3.3)c 36↓ 40.7 (2.5)c 80↑ 23.8 (0.7)c 36↓ 68.2 (8.2)c 50↓ water fraction 176.0 (7.8) 10↓ 166.0 (7.4) 11↓ 24.3 (1.5) 8↑ 33.2 (1.5) 11↓ 115.5 (9.9) 13↓ data are mean of 4 male in each group ± sd; ap<0.01; bp<0.05; cp<0.001 student's t-test figure 1: effects of o. glabratus on glucose tolerance test bangladesh j pharmacol 2015; 10: 830-835 833 400 mg/kg body weight which was comparable to that of glibenclamide. further fractionation of the methanol extracts into ethyl acetate, n-butanol and water fraction revealed that water fraction was the active fraction. in glucose tolerance test the active n-hexane extract and water fraction reduced the glucose level significantly after 60, 90 and 120 min conversely ethyl acetate extract and methanol extract showed the significant reduction after 90 and 120 min over all maximum reduction in glucose level by the active extracts and fraction was observed after 120 min which was comparable with glibenclamide. as far as the biochemical parameters are concerned the maximum increase (80%) in hdl-c level was observed by methanol extract as compared to other tested extracts/fraction, it also altered the values of cholesterol, triglyceride, vldl-c and ldl-c in a good way and suggested most active extract. while n-hexane, ethyl acetate and methanol extracts and water fraction showed the varying degree of reduction in glucose level this was comparable to that of standard drug. water fraction showed negligible changes in the cholesterol, triglycerides, hdl-c, vldl-c and ldl-c as compared to methanol extract itself proven that more activity of methanol extract may be due to synergetic effect. the significant lowering of blood glucose level in both normal and diabetes induced experimental animals and as well as in glucose tolerance test particularly by the extracts n-hexane, ethyl acetate and methanol extract, and water fraction ranges from 40 to 58% was a sign of hypoglycemic activity of the plant. previous studies (khan and shechter, 1991) have suggested that a 25% lowering in blood glucose levels was considered a significant hypoglycemic effect. a number of mechanisms of action have been proposed for plant extract to exert their effects. some of the proposed hypothesis related to their effects on the activity of pancreatic β cells, increase in the inhibitory action against insulinase enzyme and increase in insulin sensitivity/insulin like activity. other mechanism may also be included, increase in peripheral utizilation of glucose, increase in the synthesis of hepatic glycogen or decrease of glycogenolysis, inhibition of intestinal glucose absorption, reduction of glycemic index of carbohydrate and reduction of the effect of glutathione (bnouham et al., 2006). moreover, in general, we can say that there are numerous hypoglycemic plants and their chemical structure responsible for the activity varies widely. therefore, mechanism of action must also be varied. some of them act by increasing the discharge of insulin and require least number of β cells to exert their action. conversely other plant extract or their active chemical constituents act by modifying blood glucose metabolism and there are some that seems to correct the complications of diabetes. all are equally important since they potentially can be used for the treatment of different aspects of diabetes mellitus. so, they are the rich source of new hypoglycemic agents (ivorra et al., 1989). o. glabratus have been reported to contain reducing sugar, terpenoids, steroids, flavonoids and tannis, (waly et al., 2012). thus hypoglycemic and anti-diabetic activity of the o. glabratus may be attributed due the presence of these secondary metabolites which could act as synergistically or independently. conclusion the plant has potential hypoglycemic and anti-diabetic activity beside this it increases the hdl-c level and decrease the cholesterol, triglycerides, vldl-c, ldl-c and glucose level, may recommended as a potential source of anti-diabetic agent. ethical issue the conduct of experiments and the procedure of sacrifice (using ether) were approved by the ethics committee of the experimental animal care society, college of pharmacy, king saud university, riyadh, saudi arabia. acknowledgements the authors extended their appreciation to the deanship of scientific research at king saud university for funding the work through the research group project no. (rgp-vpp-073). the assistance of mr. malik sawood ahmed is thankfully acknowledged. references adodo a. nature power: a christian approach to herbal medicine. benedictine publication nigeria, 3rd ed. lagos, generation press ltd, surulere, 2004, pp 103-11. bnouham m, ziyyat a, mekhfi h, tahri a, legssyer a. medicinal plants with potential anti-diabetic activity: a review of ten years of herbal medicine research (1990–2000) int j diabetes metab. 2006; 14: 1–25. calvin cl, wilson ca. comparative morphology of epicortical roots in old and new world loranthaceae with reference to root types, origin, patterns of longitudinal extension and potential for clonal growth. flora (jena). 2006; 201: 51-64. collenette s. wild flowers of saudi arabia. national commission for wild life conservation and development, kingdom of saudi arabia, 1999, p 543. el tahir k. a guide to drug discovery: directions for pharmacological screening for new synthetic and natural compounds leading to discovery of new medicines. riyadh, el tahir publication, 2007, pp 100-05. gupta rk, kesari an, murthy ps, chandra r, tandon v, watal g. hypoglycemic and anti-diabetic effect of ethanolic 834 bangladesh j pharmacol 2015; 10: 830-835 author info sarfaraz ahmed (principal contact) e-mail: ahmsarfaraz@gmail.com extract of leaves of annona squamosa l. in experimental animals. j ethnopharmacol. 2005; 99: 75-81. hemant p, sharma s, khajja bs, jain k, jain gc. evaluation of hypoglycemic and antihyperglycemic potential of tridax procumbens linn. bmc complement altern med. 2009; 9: 48. ivorra md, paya m, villar a. a review of natural products and plants as potential anti-diabetic drugs. j ethnopharmacol. 1989; 27: 243-75. kavishankar gb, lakshmidevi n, murthy sm, prakash hs, niranjana sr. diabetes and medicinal plants: a review. int j pharm biomed sci. 2011; 2: 65-80. khan cr, shechter y. oral hypoglycemic agents and the pharmacology of the endocrine pancreas. in: goodman and gilman’s the pharmacological basis of therapeutics. theodore wr, alan sn, taylor p, gilman ag (eds). 8th edn, new york, mcgraw-hill, 1991, pp 1463-95. lorenzi h. weeds of brazil: terrestrial, aquatic, parasitic and toxic herbs. 3rd ed. brazil, nova odessa, 2000. obatomi dk, bikomo eo, temple vj. anti-diabetic properties of the african mistletoe in streptozotocin-induced diabetic rats. j ethnopharmacol. 1994; 43: 13-17. waly nm, ali ae el din, jrais rn. botanical and biological studies of six parasitic species of family loranthaceae growing in kingdom of saudi arabia. int j environ sci. 2012; 4: 196-205. who. expert committee on diabetes mellitus: diagnosis and classification of diabetes mellitus. technical report series. part 1. geneva, world health organization, 1999. bangladesh j pharmacol 2015; 10: 830-835 835 dateprinted: this article was downloaded by you on: dec 02, 2018 introduction breast cancer is the commonest form of malignancy in western countries and accounts for 12% of all cancers, 10% of all cancer deaths and 20-25% of all female cancer deaths. worldwide there are 500,000-700,000 new cases annually (bomford et al., 1993). it is estimated that in 2002 more than 175,000 women in the united states a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2007; 2: 13-19 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the efficacy and safety of ondansetron, administered alone and in combination with domperidone to prevent chemotherapy-induced nausea and vomiting of breast cancer patients receiving chemotherapy fac regimen (5-fluorouracil, adriamycin and cyclophosphamide) were evaluated. a consecutive open-label interventional study was conducted on a total number of 86 female breast cancer patients who were receiving chemotherapy. forty two patients received ondansetron (8 mg) intravenously 30 min before chemotherapy which is followed by ondansetron (8 mg) administered orally every 8 hourly for 2 days from the day of start of chemotherapy. another 44 patients received ondansetron (8 mg) intravenously 30 min before chemotherapy followed by ondansetron (8 mg) plus domperidone (20 mg) administered orally 8 hourly for 48 hours from the day of start of chemotherapy. the number of emetic episodes, severity of nausea, assessment of appetite and adverse events were recorded at 8 hours intervals for two days study period using specific scoring criteria. ondansetron in combination with domperidone significantly decreased the chemotherapy-induced nausea and vomiting in comparison with ondansetron administered alone (p<0.001). appetite status was good with combination therapy (p<0.001). improvement in appetite indicates that ondansetron plus domperidone exert protective effect against nausea and maintain normal appetite, while patients who were getting monotherapy experience loss of appetite. the common adverse event, headache was present in both the groups. no extrapyramidal reaction was observed in any group. this study showed that ondansetron plus domperidone exert more pronounced antiemetic effect in patients with breast cancer receiving moderately emetogenic chemotherapy (fac regimen) with good appetite status and less adverse effect. article info received: 8 may 2007 accepted: 11 june 2007 available online: 3 january 2008 doi: 10.3329/bjp.v2i1.495 cite this article: gupta kd, hossain akmm, jaigirdar ar, uddin b, choudhury t, saha dr. effects of ondansetron alone and in combination with domperidone in the prevention of chemotherapy-induced nausea and vomiting in breast cancer patients. bangladesh j pharmacol. 2007; 2: 13-19. effects of ondansetron alone and in combination with domperidone in the prevention of chemotherapy-induced nausea and vomiting in breast cancer patients kaberi das gupta1, a. k. m. mosharrof hossain1, abdur raquib jaigirdar2, borhan uddin1, tridiv choudhury2 and dipti rani saha1 1department of pharmacology, sylhet m. a. g. osmani medical college, sylhet 3100; 2department of radiotherapy, sylhet m. a. g. osmani medical college, sylhet 3100, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. were diagnosed with breast cancer and that more than 43,000 of these women died (rodabaugh and bloss, 2001). prevalence of breast cancer in female is also remarkable in bangladesh like that of other developing countries. there is no perfect data about the carcinoma breast among the whole population of bangladesh. in a study, among the total number of 23,820 patients treated in the cancer department of dhaka and chittagong medical college hospital and kumudini hospital, tangail during the period of 1964-1977, it is found that breast cancer is the 3rd most common malignant disease among females with an incidence of 14.5% (huq, 1980). six cycles of 5-fluorouracil, doxorubicin, and cyclophosphamide (fac regimen) or 5-fluoro-uracil, epirubicin, and cyclophosphamide (fec) is considered standard adjuvant therapy for breast cancer (bonadonna, 1988). this regimen is emetogenic, inducing nausea and vomiting in 60-90% of patients not treated with antiemetic drug (clavel et al., 1995). the objective response rates to combination chemotherapy are generally higher (60%) but with greater toxicity (bomford et al., 1993). chemotherapy-induced nausea and vomiting, is one of the most common and most incapacitating experiences of patients undergoing cancer chemotherapy that can lead to electrolyte imbalance, dehydration, cachexia, and malnutrition. poorly controlled chemotherapyinduced nausea and vomiting lead patients to refuse further treatment (hesketh et al., 1994). commonly used antiemetic agents are metoclopramide, domperidone, selective serotonin (5-ht3) receptor antagonists, etc. selective 5-ht3 receptor antagonists were first introduced in the mid-1980 and appear to prevent and control acute phase chemotherapy-induced nausea and vomiting (gregory and ettinger, 1998). 5ht3 receptor antagonists are ondansetron, granisetron, dolasetron and tropisetron. the most common adverse effects are headache, dizziness and constipation (mcquaid, 2004). ondansetron, a commonly used antiemetic, also has modest gastric prokinetic activity, which is attributed to its ability to act as an antagonist at 5-ht3 receptors. it also may prolong colonic transit time, possibly by increasing colonic tone (wilde and markham, 1996). metoclopramide is not used due to extrapyramidal symptom (eps). furthermore, the superiority of ondansetron (5-ht3 receptor antagonists) in the prevention of nausea and vomiting induced by a fac chemo-therapy regimen has been demonstrated in a comparative study with metoclopramide (metz, 1990). domperidone is a d2-receptor antagonist with antinauseant and prokinetic effects. it enhances coordinated gastro intestinal motility and transit of material in the gastrointestinal tract. vomiting following breast cancer treated with emetogenic chemotherapy is troublesome. in control of cinv in breast cancer, no operational study has been carried out in our country to address this problem. the aim of the present study is to compare anti-emetic effect of ondansetron plus domperidone with that of ondansetron administered alone in the prevention of chemotherapy-induced nausea and vomiting. materials and methods an open label, consecutive and interventional study was carried out during the period from january to december 2006. the patients admitted in radiotherapy ward of with diagnosis of breast cancer diseases were taken as study population. patients receiving fac regimen for the treatment of breast cancer were the samples of this study as per inclusion and exclusion criteria designed for the study. the study subjects (86) were divided in two groups. forty two patients with odd registration number were enrolled in group i (constituted the treatment arm ondansetron alone) while 44 patient with even registration number were enrolled in group ii (constituted the treatment arm ondansetron plus domperidone). ondansetron-treated group ondansetron (8 mg) was injected intravenously, 30 min before chemotherapy (fac regimen) which is followed by ondansetron (8 mg) administered orally every 8 hourly for 48 hours. ondansetron plus domperidone-treated group ondansetron (8 mg) was injected intravenously, 30 min before chemotherapy (fac regimen) and is followed by ondansetron (8 mg) administered orally every 8 hourly for 48 hours plus domperidone (20 mg) 8 hourly for 48 hours from the day of start of chemotherapy. scoring for severity of nausea, the number of emetic episode and appetite assessment was conducted for 48 hours period. 14 bangladesh j pharmacol 2007; 2: 13-19 data were collected through preformed data collection sheet, from initiation of chemotherapy, every 8 hourly for 48 hours. severity of nausea, episodes of vomiting, appetite status assessment, any sort of adverse-effects and necessity of any rescue medications were observed. episode of vomiting, severity of nausea and effect on appetite were assessed according to the standard scoring system (stewart et al., 2000). scoring the number of episode of vomiting number of episode in 24 hours: none (score 0), 1 (score 1), 2 (score 2), 3 (score 3), 4 or more (score 4). an emetic episode is defined as a single vomit, or any number of continuous vomits. emetic episodes are separated from one another by an absence of vomiting for at least 1 min. scoring for severity of nausea none (score 0), mild (loss of appetite without alteration in eating habits) score 1; moderate (oral intake decreased without significant weight loss, dehydration or malnutrition; iv fluids indicated <24 hours) score 2; severe (inadequate oral intake; iv fluids, tube feedings, indicated ≥24 hours or life threatening consequences) score 3. scoring for appetite (holdsworth et al., 1998) no appetite (not assessable) score 0, a little appetite (worse than usual) score1; some appetite (as usual) score 2; good appetite (better than usual) score 3. statistical analysis all statistical analyses were done by spss software package, 12.0 for windows. values were presented as mean ± sd. 95% confidence limit with p<0.05 was taken as level of significance. unpaired t-test was done to see any difference between two groups. results the mean (± sd) age for group i and ii were 44.6 ± 7.5 years and 42.8 ± 6.2 years respectively. there was no significant difference of age distribution between two groups. effect of ondansetron administered alone and in combination with domperidone on chemotherapyinduced nausea is represented in table i. the maximum score for nausea (2.0 ± 0.6) was observed at 24 hours after administering ondansetron. in case of both ondansetron and domperidone on chemotherapyinduced nausea, the maximum score was about half (0.9 ± 0.5) and was observed similarly at 24 hours of treatment. the differences between the two groups were highly significant at 1% level of significance in all hours. so, ondansetron and domperidone combination administered appears more effective than ondansetron alone in management of chemotherapy-induced nausea. the maximum score for vomiting (3.1 ± 2.1) was observed at 8 hours after administering ondansetron. but in case of both ondansetron and domperidone on chemotherapy-induced vomiting, the maximum score was about one-third (1.0 ± 1.1) and was observed at 16 hours of treatment. the statistical analysis shows that the differences between the two groups were highly significant p<0.001 in all hours. so, it can be assumed that combination effect of ondansetron plus domperidone is better than ondansetron alone in table i effect of ondansetron administered alone and in combination with domperidone on chemotherapy-induced nausea, vomiting and appetite hours score for nausea score for vomiting score for appetite ondansetron ondansetron plus domperidone ondansetron ondansetron plus domperidone ondansetron ondansetron plus domperidone 8 1.6 ± 1.2 0.3 ± 0.5a 3.1 ± 2.1 0.5 ± 0.9a 1.4 ± 0.9 2.6 ± 0.5a 16 1.9 ± 0.9 0.8 ± 0.7a 1.7 ± 1.6 1.0 ± 1.1a 1.1 ± 0.8 2.3 ± 0.5a 24 2.0 ± 0.6 0.9 ± 0.5a 1.3 ± 1.3 0.7 ± 0.9a 1.0 ± 0.7 2.3 ± 0.6a 32 1.4 ± 0.59 0.6 ± 0.5a 0.7 ± 0.9 0.1 ± 0.2a 1.1 ± 0.8 2.6 ± 0.5a 40 1.1 ± 0.4 0.1 ± 0.3a 0.5 ± 0.7 0.1 ± 0.3a 1.4 ± 0.8 2.6 ± 0.5a 48 0.6 ± 0.6 0.0 ± 0.0a 0.02 ± 0.2 0.0 ± 0.0a 1.9 ± 0.8 2.7 ± 0.4a data are mean ± sd; aunpaired t-test shows the significant difference between the two group at p<0.001 bangladesh j pharmacol 2007; 2: 13-19 15 chemotherapy-induced vomiting. the maximum score for appetite (1.9 ± 0.8) was observed at 48 hours both treatment groups. the score indices for nausea and vomiting were lower for ondansetron plus domperidone. most commonly recorded adverse events are shown in table ii. on day 1, notable adverse events were headache, dizziness and abdominal cramp in ondansetrontreated group. only 2 patients did not have any adverse effect whereas 10 patients in ondansetron and domperidone-treated group had no adverse effect. on day 2, increased number of patients in ondansetrontreated group was free from adverse effects. the number of patients complaining headache were reduced in ondansetron and domperidone-treated group (low in day 2 compared to on day 1). discussion chemotherapy-induced nausea and vomiting if inadequately controlled by antiemetic treatment, will limit a patient’s ability and desire to eat and drink, significantly reduce quality of life, threaten the success of therapy, and may result in increased mortality, morbidity, and importantly, health care costs. prevention of nausea and vomiting is critical in the management of patients with cancer. the 5ht3-receptor antagonist are currently perceived as the gold standard antiemetic treatment providing effective control of acute nausea and vomiting, offering a substantial tolerability benefit over older conventional antiemetics. ondansetron is the most widely used drug for the prevention of chemotherapy-induced nausea and vomiting. previously, metoclopramide (d2-receptor antagonist) was used. domperidone is another d2receptor antagonist with anti-nauseant and prokinetic effects. its principal advantage over metoclopramide is the lack of cns side effects because of its poor penetration into the brain. various types of antiemetic drugs can be combined, with the goal of increasing antiemetic efficacy or decreasing associated toxicity. in this study, we compared the effect of ondansetron plus domperidone with the effect of ondansetron administered alone in the prevention of acute and delayed nausea and vomiting in breast cancer patients receiving moderately emetogenic chemotherapy. the severity of emesis is different in different chemotherapy schedule. for this reason, we used only the breast cancer patients using a definite schedule to compare the table ii adverse events observed in ondansetron alone and ondansetron plus domperidone treated groups adverse events number of cases day 1 day 2 ondansetron ondansetron plus domperidone ondansetron ondansetron plus domperidone headache 14 (33.3) 20 (45.5) 12 (28.6) 4 (9.1) dizziness 17 (40.5) 10 (22.7) 12 (28.6) 12 (27.3) abdominal cramp 9 (21.4) 4 (9.1) 1 (2.4) 9 (20.5) dry mouth 1 (2.3) diarrhea 3 (6.8) extrapyramidal effect no adverse effect 2 (4.8) 10 (22.7) 7 (16.7) 12 (27.3) data within parenthesis are expressed as percentage 16 bangladesh j pharmacol 2007; 2: 13-19 antiemetic effect of combined therapy and monotherapy. control of nausea and vomiting is particularly important during the initial cycle of chemotherapy as the development of anticipatory vomiting occurs more frequently in patients with poor control during previous chemotherapy treatment. it is probably more effective to prevent anticipatory emesis than to try to treat this conditioned response. our study shows that ondansetron plus domperidone is able to prevent vomiting in most patients having their first cycle of cyclophosphamide-based chemotherapy. the patients of both groups in our study were age matched. so there was no chance of variation of antiemetic response with age. ondansetron in combination with domperidone significantly decreased the chemotherapy-induced nausea and vomiting in comparison with ondansetron alone (p<0.001). ondansetron releases serotonin from enterochromaffin cells in the small intestinal mucosa contributes to the acute nausea and vomiting associated with chemotherapy. serotonin activates receptors on vagal afferent fibers in the intestinal mucosa which relay sensory information to discrete brain areas involved in the genesis of nausea and vomiting (anastasia, 2000). ondansetron specially blocks the binding of serotonin to the receptors on the vagal nerves that trigger the emetic response (doherty, 1999). cisplatin-induced emesis is completely controlled if serotonin stores are depleted by inhibition of serotonin synthesis (barnes et al., 1987). ondansetron is a highly selective 5-ht3 receptor antagonist that is effective in preventing highly emetogenic cisplatin-induced nausea and vomiting (cubeddu et al., 1990). kaasa et al., (1990) have shown intravenous ondansetron to be effective in the prevention of emesis associated with cyclophosphamide-based chemotherapies. ondansetron is rapidly and completely absorbed when administered as a tablet. despite the better antiemetic efficacy observed with ondansetron in terms of nausea and vomiting, the control of emesis induced by fac chemotherapy with ondansetron alone is still suboptimal, and could be improved by using domperidone in combination. domperidone acts by increasing the motility of the upper gastrointestinal tract and has a direct blocking effect on the chemoreceptor trigger zone. thus, domperidone is an effective antiemetic medication (watcha and white, 1992) in a study by esseboom et al. (1995) suggested that domperidone administered 20 mg three times daily is more effective than ondansetron 8 mg three times daily for the prevention of delayed nausea and/or vomiting which occur following highly emetogenic chemotherapy (p<0.05). the major emetogenic agent in our chemotherapy combination, cyclophosphamide, is known to cause emesis with considerable delay from the time of administration (fetting et al., 1982). with this view in our study, domperidone is added with ondansetron in management of nausea and vomiting induced by fac regimen. in our study combined ondansetron and domperidone showed the more pronounced antiemetic effect. after chemotherapy the patients experience the loss of appetite. we also observed the effect of drugs on appetite in patients having chemotherapy. effect on appetite by ondansetron plus domperidone was significantly better than ondansetron alone in our study. improvement in appetite indicates that ondansetron plus domperidone offered protection against nausea and maintaining appetite. the better appetite scores of co-administered drugs on appetite obviously attributed to their additive effect on appetite. common reported adverse effects of ondansetron when used for short-term period are constipation, headache, dizziness, abdominal cramp, etc. common adverse effects of domperidone are dry mouth, loose motion, dizziness, headache, and galactorrhoea (tripathi, 2003). in this study the common adverse event headache was observed in both of the treated groups which was decreased intensity over the observation period during the 2nd day. dizziness was experienced by both the groups which was similar in both the groups during the 2nd day of observation. both treatments were well-tolerated; the drug related adverse events reported in the two groups being minor and transient. the results of this study demonstrate that ondansetron alone was not sufficient for controlling chemotherapyinduced nausea and vomiting but combination treatment of ondansetron plus domperidone brought a good control while maintaining normal appetite. bangladesh j pharmacol 2007; 2: 13-19 17 physicians concerned with the treatment of cancer patients may consider combined antiemetic therapy using ondansetron plus domperidone for effecttive control of chemotherapy-induced nausea and vomiting. the co-administration of ondansetron and domperidone offers a promising new antiemetic management strategy for the prevention of chemotherapy-induced nausea and vomiting. the combination use of these agents provides good appetite status with no apparent risk of adverse events. in clinical practice, the combination regimen may provide a useful treatment for patients who are unable to attain a satisfactory antiemetic effect with ondansetron alone. this study was conducted on a small number of patients. it was single center trial and follow-up was done for 48 hours. as the trial was fairly of short duration, analysis of long-term efficacy and safety was not possible. because direct comparison was carried out between two treatment groups of patients, the findings would have been more significant if a placebo group had been used. but a placebo controlled study was ethically not possible. therefore, a control group was not included in this study. further prospective interventional consecutive trials and longer follow-up period are suggested for better assessment of antiemetic efficacy and safety profile. references anastasia pj. effectiveness of oral 5-ht3 receptor antagonists for emetogenic chemotherapy. oncol nurs forum 2000; 27: 483-93. barnes nm, barrg jm, costal b. antagonism by parachlorophenylalanine of cisplatin-induced emesis. br j pharmacol. 1987; 92: 649. bomford ck, kunkler ih, sherriff sb. walter and miller’s textbook of radiotherapy, 5th ed, london, churchill livingstone, 1993, pp 383-97. bonadonna g. handbook of medical oncology. 3rd edi, masson, milano, 1988, p 407, 1076. cubeddu lx, hoffmann is, fuenmayor nt, finn al. efficacy of ondansetron and the role of serotonin in cisplatin-induced nausea and vomiting. n engl j med. 1990; 322: 810-16. doherty km. closing the gap in prophylactic antiemetic therapy: patient factors in calculating the emetogenic potential of chemotherapy. clin j oncol nurs. 1999; 3: 11319. esseboom eu, rojer ra, borm jj, statius van eps lw. prophylaxis of delayed nausea and vomiting after cancer chemotherapy. neth j med. 1995; 47: 12-17. fetting jh, grochow lb, folstein mf, ettinger ds, colvin m. the course of nausea and vomiting after high-dose cyclophosphamide. cancer treat rep. 1982; 66: 1487-93. gregory re, ettinger ds. 5-ht3 receptor antagonists for the prevention of chemotherapy-induced nausea and vomiting: a comparison of their pharmacology and clinical efficacy. drugs 1998; 55: 173-89. clavel m, bonneterre j, d’allens h, paillarse jm. oral ondansetron in the prevention of chemo-therapy-induced emesis in breast cancer patients. eur j cancer 1995; 31a: 1519. hesketh pj, harvey wh, harker wg. a randomized, double blind comparison of intravenous ondansetron alone and in combination with intravenous dexamethasone in the prevention of high dose cisplatin-induced emesis. j clin oncol. 1994; 12: 596-600. holdsworth mt, raisch dw, winter ss, chavez cm. assesment of the emotogenic potential of intrathecal chemotherapy and response to prophylactic treatment with ondansetron. support care cancer, 1998; 6: 132-38. huq sf. cancer incidence in bangladesh. j bangladesh coll phys surg. 1980; 5: 1-7. kassa s, kvaloy s, dicato ma, ries f, huys jv, royer e, et al. a comparison of ondansetron with metoclopramide in the prophylaxis chemotherapy-induced nausea and vomiting: a randomized, double-blind study. eur j cancer. 1990; 26: 31114. mcquaid kr. drugs used in the treatment of gastrointestinal disease. in: basic and clinical pharmacology, katzung bg (ed), 9th ed, boston, mcgraw-hill, 2004, p 1052. metz r. a randomized double blind comparison of ondansetron and metoclopramide in the prophylaxis of emesis produced by cyclophosphamide, fluouracil and doxorubicin or epirubicin chemotherapy. j clin oncol. 1990; 8: 1063-69. rodabaugh kj, bloss jd. breast cancer prevention. clin obstet gynecol. 2001; 44: 478-84. stewart l, crawford sm, taylor pa. the comparative effectiveness of ondansetron and granisetron in a once daily dosage in the prevention of nausea and vomiting caused by cisplatin: a double-blind clinical trial. pharmaceutical j. 2000; 265: 59-62. tripathi kd. emetics, antiemetics and other gastro-intestinal drugs. in: essentials of medical pharmacology, 5th ed, jaypee brother’s, new delhi, 2003, pp 602-04. 18 bangladesh j pharmacol 2007; 2: 13-19 author info a. k. m. mosharrof hossain (principal contact) watcha mf, white pf. post-operative nausea and vomiting: its etiology, treatment and prevention. anesthesiology 1992; 77: 162-84. wilde mi, markham a. ondansetron: a review of its pharmacology and preliminary clinical findings in novel applications. drugs 1996; 52: 773-94. bangladesh j pharmacol 2007; 2: 13-19 19 dateprinted: this article was downloaded by you on: oct 26, 2017 introduction high concentration arsenic consumption through drinking water and food is a major public health problem in bangladesh (tondel et al., 1999; misbahuddin, 2003). at present more than 25,000 are suffering from arsenicinduced skin manifestations and it is predicted that 0.20.3 million people will die due to arsenic-induced cancer (meharg and rahman, 2003). recent report shows that people consuming arsenic without skin manifestation may shows systemic manifestation (majumdar et al., 2009). but any specific treatment for chronic arsenic toxicity is yet to be found. researchers have suggested the use of corn (chowdhury et al., 2009), spirulina (misbahuddin et al., 2006), spinach (umar, 2007), -lipoic acid, -carotene, vitamin a, ascorbic acid (saha, 2006), -tocopherol and zinc (kamaluddin and misbahuddin, 2006). arsenic-induced chronic toxicity varies from person to person. significant ameliorative efficacy of cystine, methionine, ascorbic acid and thiamine is reported in experimental arsenic toxicity in rats when given simultaneously as compared to post exposure treatment (nandi et al., 2005). one-carbon metabolism, the biochemical pathway responsible for methylation of arsenic, is a folate-dependent pathway. folate deficiency is not uncommon largely because naturally occurring folate is highly susceptible to oxidative degradation, as it happens during cooking process. p r e v a l e n c e o f f o l a t e d e f i c i e n c y a n d hyperhomocysteniemia is not uncommon in rural bangladesh (gamble et al., 2005) current study was undertaken to investigate the beneficial effects of folate on experimentally induced arsenic toxicity in rat. materials and methods chemicals and reagents arsenic trioxide (as2cb), silver diethyldithiocarbamate (sddc), hexamethylenetetramine, zinc fillings and other reagents for arsenic estimation were purchased from e. merck (germany). thiobarbituric acid (tba) and reduced glutathione (gsh) were purchased from sigma aldrich cheme (gmbh, germany). folic acid was collected from beximco pharma (bangladesh). twenty four male long evan's rats weighing 160-200 g, aged between 4 to 5 months and maintained on a pellet abstract quest is still going on for a cheap, effective, and easily available remedy for chronic arsenic toxicity. this study was designed to investigate the effects of folic acid and tetrahydrofolate in lowering the arsenic burden in tissues. rats received arsenic at 700 pg/day by gavage for 28 days except the control group. arsenic accumulation was significantly lowered (p<0.05), in liver, kidney, heart, lung and skin in both the folic acid and tetrahydrofolate-treated groups compared to arsenic only treated group. the oxidative stress induced by arsenic treatment was reduced as evident by the reduction in rise of malondialdehyde level in both groups. but folic acid was found to be more efficacious compared to tetrahydrofolate. article info received: 12 november 2009 accepted: 13 april 2010 available online: 22 may 2010 doi: 10.3329/bjp.v5i1.4909 cite this article: effect of folic acid and tetrahydrofolate on tissue arsenic level in rat. rahman mf, misbahuddin m. bangladesh j pharmacol. 2010; 5: 25-29. effect of folic acid and tetrahydrofolate on tissue arsenic level in rat md. faizur rahman and mir misbahuddin department of pharmacology, faculty of basic sciences, bangabandhu sheikh mujib medical university, shahbag, dhaka 1000, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2010; 5: 25-29 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded and social sciences citation index issn: 1991-0088 diet in the animal house were used. room was well ventilated, temperature was kept towards normal and 12/12 hours light/dark cycle was maintained. preparation of tetrahydrofolate from folic acid folic acid 1.7 g with a water content of about 8% was suspended in a solution of 1.8 mg pb(no3)2 in 20 ml de-ionized water. the ph of the mixture was adjusted to 7.5 by the drop wise addition of 20% naoh under vigorous stirring at room temperature. a clear solution was obtained and was cooled to 10°c. a solution of 0.05 g nabhi in 25 ml de-ionized water was added drop wise over 20 min under stirring at this temperature. during this addition the ph-value of the mixture was kept between 8.5 and 8.8 by means of the drop wise addition of 20% aqueous citric acid. after completion of nabh4 addition, temperature was allowed to increase to 23°c under stirring, and it was stirred at this temperature for further 2 hours. then this solution was cooled to 10°c under vigorous stirring and drop wise 18% hcl was added until the mixture had a ph value of 3.6. during this acidification the tetrahydrofolate precipitated. the precipitated tetrahydrofolate was isolated by means of filtration, washed once with degased and de-ionized water and once with 90% ethanol. the obtained solid was dried under reduced pressure. there were obtained 1.6 g tetrahydrofolate. study design the rats were randomly divided into 4 groups to assess the effect folic acid and tetrahydrofolate on arsenic level. each rat received normal diet and water ad libitum. one group received normal diet and water ad libitum for 28 days and considered as control. arsenic group received 700 pg (umar, 2007) of arsenic (0.7 ml of solution containing 1 mg/ml of arsenic) everyday by stomach tube for 28 days. arsenic plus folic acid group received 700 pg of arsenic for 21 days and in addition 1 ml of folic acid solution (200 pg/ ml) from day 22 to day 28 by stomach tube. arsenic plus tetrahydrofolate group received 700 pg of arsenic for 21 days and from day 22 to day 28 received 1 ml of tetrahydrofolate solution (200 pg/ml) by stomach tube. the rats of all groups were sacrificed on day 29. sacrifice procedure was performed under chloroform anesthesia. the abdomen of each rat was opened by midline incision and extended to open the thorax. then liver, kidneys, lungs, heart were dissected out and a portion of skin from the abdominal area was cut out. these organs were packed in separate polyethylene packets which were accurately labeled and preserved in a deep freezer until the period of analysis. estimation of tissue arsenic level total amount of tissue arsenic in all organs were measured by quantitative colorimetric method for total arsenic estimation using sddc method. in this method inorganic arsenic is reduced to arsine (ash3) by zinc in a strong acid solution in an arsine generator. arsine is then passed through a scrubber containing cotton wool moistened with lead acetate into an absorber tube containing sddc dissolved in chloroform. arsine reacts with the silver salt, forming a soluble red color complex whose absorbance is measured by a spectrophotometer (uvvis spectrophotometer-1201, shimadzu, japan) at 525 nm. there were two steps: acid digestion and arsine generation. estimation of mda level lipid peroxidation was estimated using the thiobarbituric acid method to determine the level of mda, which serves as an index of lipid peroxidation. one milliliter of tissue homogenate was taken in a test tube to which 4.5 ml of 5.5% tca was added. the mixture was vortexed (vortex mixer-2000, digisystem laboratory, taiwan) and centrifuged at 1,725 x g for 10 min. the supernatant was poured into another test tube. 1 ml of 0.7% tba was added to it. the mixture was kept in a boiling water bath (100°c) for 10 min. then, it was turned into a pink color solution. the mixture was then cooled immediately and the absorbance was taken at 532 nm by spectrophotometer. lipid peroxidation was calculated using molar extinction coefficient for mda of 1.56 x 105 mol/l. statistical analysis statistical analysis was done by statistical package for social science (spss), version 11. the quantitative variables were expressed as mean ± se. anova (multiple comparisons) was done to compare means of different treatment groups with that of negative control and positive control groups. results arsenic concentration in various tissues of rats treated with arsenic at 700 pg by gavage for 28 days with or without folic acid or tetrahydrofolate is shown in table i. significantly higher levels of arsenic were seen in all tissues of rats treated with only arsenic as compared to control group (p<0.001). highest accumulation (16.3 pg/g) was observed in liver. arsenic burden was significantly reduced in both groups treated in the last seven days with folic acid and tetrahydrofolate (p<0.05). higher efficacy was noted in group treated with folic acid. however the reduction of arsenic burden was not sufficient enough for mean values to be comparable with respective control values. highest inhibition (64.9%) took place in liver of folic acid treated group (table ii). reduction in all tissues was noted to be higher in folic acid treated group as compared to tetrahydrofolate treated group. 26 bangladesh j pharmacol 2010; 5: 25-29 figure 1 shows mda concentration, an end product indicative of the degree of lipid peroxidation in liver, kidney, heart, lung and skin from the experimental rats. the level of mda in all these tissues from arsenic only treated group was significantly (p<0.001) higher than respective control (not treated with arsenic) values. highest concentration of mda was observed in liver (mean16.6 nmol/g of tissue) and the lowest in skin. the rise was about 2-fold compared to control group. treatment with folic acid and tetrahydrofolate could prevent the rise in mda level in all tissues analyzed, but folic acid was found to be slightly more efficacious than tetrahydrofolate. mda level in skin and lung of tetrahydrofolate treated group was not significantly lowered as compared to arsenic only treated group. discussion the overall objective of this study was to observe how folate supplementation influences the arsenic level in different tissues in an animal model. concentration of arsenic was risen by many folds in different organs of rats following the administration of arsenic compared to control group. it is evident from this study that coadministration of folic acid and tetrahydrofolate with arsenic reduced the arsenic burden significantly. in rats treated with only arsenic, the highest accumulation of arsenic was detected in liver followed by kidney, liver, lung and skin. different biokinetic pattern of its distribution in various tissues (lindgren et al., 1982) could be responsible for these differences. inorganic arsenic such as asiii and asv are metabolized to mma and dma, and then rapidly cleared from tissues through urine. however, this biomethylation process can easily become saturated and leads to the excess inorganic arsenic being deposited in the skin, hair and nails, where it binds tightly to keratin (baldwin and marshall, 1999). individual nutritional status may be an important factor in this regard. a cross sectional study in the us compared the dietary intake of 30 nutrients to urinary arsenic metabolites and found that subjects in lowest quartile for protein intake have significantly higher % mma and a significantly lower %dma than did highest quartile for protein intake (steinmaus et al., 2005). no association was found between dietary folate intake and arsenic methylation, likely because the study was conducted after the united states mandated folic acid fortification. a case control study in the west bengal of india, found a modest increase in the risk of arsenic-induced skin lesions in persons who fell in the lowest quartiles for dietary intake of protein, folate, calcium and fiber (mitra et al., 2004). another cross sectional study in bangladesh found plasma folate concentrations were positively correlated with %dma and negatively correlated with %mma and %inas (gamble et al., 2005). in humans and most common laboratory animals, inorganic arsenic is extensively methylated and the metabolites are excreted primarily in the urine (gomez-caminero et al., 2001). though the folate status of the study animals could not be ascertained, results indicate that similar reactions bangladesh j pharmacol 2010; 5: 25-29 27 table ii percent reduction of arsenic level in different tis­ sues of rats given different treatments groups % inhibition liver kidney skin lung heart folic acid 64.9 61.3 53.4 44.3 52.0 tetrahydrofolate 54.5 53.6 31.3 29.7 41.4 table i arsenic concentration (µg/g of tissue) in different tissues of rats given different treatments treatment (n = 6) liver kidney lung heart skin control 2.7 ± 0.4 2.4 ± 0.5 1.5 ± 0.7 1.8 ± 0.6 1.5 ± 0.5 arsenic 16.3 ± 2.0a 14.5 ± 1.2a 12.8 ± 1.0a 14.1 ± 0.9a 7.8 ± 0.9a folic acid 7.5 ± 0.7b 7.1 ± 0.6b 7.4 ± 1.0b 7.9 ± 0.8b 4.2 ± 0.8b tetrahydrofolate 8.9 ± 0.8b 8.0 ± 0.7b 9.5 ± 0.5b 9.2 ± 0.8b 5.8 ± 1.1b ap<0.001 compared to control group; bp<0.05 compared with group exposed to arsenic only m d a le ve l ( nm ol /g o f t is su e) 18 16 24 12 10 8 6 4 2 0 liver kidney lung heart skin control arsenic folic acid tetrahydrofolate figure 1: mda levels in different tissues from rats given different treatments might have occurred in the rats and folate treatment reduced arsenic burden in tissues by enhancing its methylation. arsenic toxicity is mediated via the generation of reactive oxygen species (ramos et al., 1995), which in turn lead to the development of carcinogenesis and other cytotoxic effects (wang and huang, 1994). low folate intake results in elevated plasma homocysteine concentration in healthy men (jacob et al., 1994). in vitro studies have shown that homocysteine exerts its toxicity on endothelial cells by increasing h2o2 production, affecting anti-oxidant defense systems (blundell et al., 1996). in animals, the liver contains the most body folate storage and is susceptible to folate depletion (clifford et al., 1990). one carbon metabolism is disturbed by folate deficiency (balaghi and wagner, 1995). in folate depleted animals strong negative correlation was found between plasma homocysteine and hepatic folate concentration. elevated plasma homocysteine concentrations in folate depleted rats were strongly and significantly correlated with increased lipid peroxidation in either the absence or presence of additional oxidative stress (huang et al., 2001). possible mechanism for reduction in mda concentration among the folate treated groups in this study was probably due to the reduction in homocysteine concentration. both folic acid and the tetrahydrofolate has been found to be effective in lowering tissue arsenic burden in this study though folic acid was found to be slightly more effective. this could be due to the difference in their rate of absorption. body readily absorbs up to 90 percent of folic acid (supplement form). however, further studies with folic acid and tetrahydrofolate with different doses are needed to be carried out to ascertain the therapeutic benefit in chronic arsenic poisoning. references balaghi m, wagner c. folate deficiency inhibits pancreatic amylase secretion in rats. am j clin nutr. 1995; 61: 90-96. baldwin dr, marshall wj. heavy metal poisoning and its laboratory investigation. ann clin biochem. 1999; 36: 267300. blundell g, jones bg, rose fa, tudball n. homocysteine mediated endothelial cell toxicity and its amelioration. atherosclerosis 1996; 122: 163-72. chowdhury nja, misbahuddin m, rahman ms. corn extracts lower tissue arsenic level in rat. bangladesh med res counc bull. 2009; 35: 21-25. clifford aj, heid mk, muller hg, bills nd. tissue distribution and prediction of total body folate of rats. j nutr. 1990; 120: 1633-39. gamble mv, liu x, ahsan h, pilsner jr, ilievski v, slavkovich v, parvez f, chen y, levy d, factor-litvak p, graziano jh. folate and arsenic metabolism: a double-blind, placebo controlled folic acid-supplementation trial in bangladesh. am j clin nutr. 2006; 84: 1093-101. gamble mv, liu x, ahsan h, pilsner jr, ilievski v, slavkovich v, parvez f, chen y, levy d, factor-litvak p, graziano jh. folate, homocysteine, and arsenic metabolism in arsenic exposed individuals in bangladesh. environ health perspect. 2005; 113: 1683-88. gomez-caminero a, howe p, hughes m, kenyon e, lewis dr, moore m. properties and analytical procedures: arsenic and arsenic compound. environmental health criteria 224. international programme on chemical safety. geneva, world health organization, 2001, pp 9-27. huang rf, hsu yc, lin hl, yang fl. folate depletion and elevated plasma homocysteine promote oxidative stress in rat livers. j nutr. 2001; 131: 33-38. pmid:11208935 jacob ra, wu mm, henning sm, swendseid me. homocysteine increases as folate decreases in plasma of healthy men during short-term dietary folate and methyl group restriction. j nutr. 1994; 124: 1072-80. pmid:8027858 kamaluddin m, misbahuddin m. zinc supplement on tissue arsenic concentration in rats. bang med res coun bull. 2006; 32: 87-91. lindgren a, vahter m, dencker l. autoradiographic studies on the distribution of arsenic in mice and hamsters administered 74as-arsenite or -arsenate. acta pharmacol toxicol. 1982; 51: 253-65. pmid:7136731 majumdar kk, guha mazumder dn, ghose n, ghose a, lahiri s. systemic manifestations in chronic arsenic toxicity in absence of skin lesions in west bengal. indian j med res. 2009; 129: 75-82. meharg aa, rahman mm. arsenic contamination of bangladesh paddy field soils: implications for rice contribution to arsenic consumption. environ sci technol. 2003; 37: 229-34. misbahuddin m. consumption of arsenic through cooked rice. lancet. 2003; 361: 435-36. misbahuddin m, islam az, khandker s, ifthaker-al-mahmud, islam n, anjumanara. efficacy of spirulina extract plus zinc in patients of chronic arsenic poisoning: a randomized placebo-controlled study. clin toxicol (phila). 2006; 44: 13541. mitra sr, mazumdar dn, basu a, block g, haque r, samanta s, ghosh n, smith mm, von ehrenstein os, smith ah. nutritional factors and susceptibility to arsenic-caused skin lesions in west bengal, india. environ health perspect. 2004; 112: 1104-09. pmid:15238285 nandi d, patra rc, swarup d. effect of cysteine, methionine, ascorbic acid and thiamine on arsenic-induced oxidative stress and biochemical alterations in rats. toxicology 2005; 211: 26-35. ramos o, carrizales l, yanez l, mejia j, batres l, ortiz d, diaz-barriga f. arsenic increased lipid peroxidation in rat tissues by a mechanism independent of glutathione levels. 28 bangladesh j pharmacol 2010; 5: 25-29 author info mir misbahuddin (principal contact) e-mail: mmisbah@bsmmu.org environ health perspect. 1995; 103: 85-88. saha b. effect of ascorbic acid on reduced glutathione level in arsenic-loaded isolated liver tissues of rat. bangladesh j pharmacol. 2006; 1: 68-71. steinmaus c, carrigan k, kalman d, atallah r, yuan y, smith ah. dietary intake and arsenic methylation in a u.s. population. environ health perspect. 2005; 113: 1153-59. pmid:16140620 tabassum ne. effect of alpha-lipoic acid on the removal of arsenic from arsenic-loaded isolated liver tissues of rat. bangladesh j pharmacol. 2006; 1: 27-32. tondel m, rahman m, magnuson a, chowdhury ia, faruquee mh, ahmad sa. the relationship of arsenic levels in drinking water and the prevalence rate of skin lesions in bangladesh. environ health perspect. 1999; 107: 727-29. umar bu. effect of hexane extract of spinach in the removal of arsenic from rat. bangladesh j pharmacol. 2007; 2: 27-34. wang ts, huang h. active oxygen species are involved in the induction of micronuclei by arsenite in xrs-5 cells. mutagenesis 1994; 9: 253-57. bangladesh j pharmacol 2010; 5: 25-29 29 dateprinted: this article was downloaded by you on: apr 04, 2018 introduction tuberculosis (tb) causes three million death each year (wright et al., 1998), that is declared to be 'global health emergency' by world health organization (who, 1996). bangladesh is one of the top five high burden countries in the world where tb is the second killer infectious disease next to diarrhea and about 0.6 million people are estimated to suffer from tb (benoor et al., 1998). despite the availability of affective chemotherapy tb is still a major health problem in most countries (grange, 1990). the poor outcome was attributed to poor patient compliance, to primary multidrug resistance and to interruption partly due to adverse drug reaction (who, 1997). the most important step to ensure treatment is the patients’ adhere to treatment are introduction of direct observation treatmentshort course (dots) and use of fixed dose combination, as recommended by who (who, 1998; blomberg et al., 2001). anti-tb chemotherapy exhibit greater level of efficacy a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 51-57 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract tuberculosis (tb) is a leading cause of death throughout the world and bangladesh stands 4th among high burden countries. treatment of tb hampered with poor patient compliance and intolerance at least partly due to the adverse drug reactions. a prospective longitudinal non-randomized case study was conducted on 64 hospital admitted patients diagnosed as primary (category i) and resistant or treatment failure (category ii) to compare adverse effects between two anti-tb drug treatment regimen based on diagnostic category. category i received four drug (rifampicin, isoniazid, ethambutol, pyrazinamide) and category ii received five drug (rifampicin, isoniazid, ethambutol, pyrazinamide, sparfloxacin) combination treatments for initial 2 months under dots during the period of july 2004 to july 2005. adverse effect parameters e.g. gastrointestinal disturbances, arthralgia, hepatic dysfunction and renal impairment were estimated before, two and eight weeks after initiation of treatment. predisposing risk factors for adverse effects e.g. age, sex, nutritional status, associated disease, habits were also analyzed. in our study, 76.5% of total patients experienced some sorts of adverse effects. in 4and 5-drug regimen groups’ adverse reaction were observed in 50 and 95% of patients respectively. serum bilirubin, sgpt, creatinine did not change in neither of the treated group while alkaline phosphatase tended to decrease and uric acid to increase. no disease was established to be risk factor for drug intolerance. article info received: 4 july 2006 accepted: 13 september 2006 available online: 3 january 2008 doi: 10.3329/bjp.v1i2.488 cite this article: nahar bl, hossain akmm, islam mm, saha dr. a comparative study on the adverse effects of two antituberculosis drugs regimen in initial two-month treatment period. bangladesh j pharmacol. 2006; 1: 51-57. a comparative study on the adverse effects of two antituberculosis drugs regimen in initial two-month treatment period begum lutfun nahar1, a. k. m. mosharrof hossain1, m. monirul islam2 and dipti rani saha1 1department of pharmacology and therapeutics, sylhet mag osmani medical college, sylhet 3100, bangladesh; 2chest disease hospital, sylhet 3100, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. with an acceptable degree of toxicity, however combination treatment may produce severe adverse events (schaberg et al., 1996). important adverse effects are hepatitis, rash, gastrointestinal upset, hyperuricemia, peripheral neuropathy, visual disturbances (pande et al., 1996; hussain et al., 2003; bass et al., 1994; scott, 1995; solangi et al., 2004; pereira et al., 2000; tsai and lee, 1997). a few studies are done on adverse effects of anti-tb drugs related to specific regimen of drug and risk factors for those adverse effects. so, we aimed to study the adverse drug reaction and to analyze risk factors for intolerance and adverse effects of two anti-tb drug regimen in initial two month phase of treatment. materials and methods a prospective longitudinal non-randomized case study was carried out on diagnosed pulmonary tb patients admitted in the sylhet chest disease hospital and sylhet shaheed shamsuddin ahmed hospital during the period of july 2004 to july 2005. inclusion criteria were pulmonary tuberculosis patients diagnosed as primary treatment failure (category i) or relapse case or resistance tb (category ii). cases of either sex with age above 14 years and patients who were under dots. while patients with history of hepatitis, renal or hepatic impairment; pregnant women and age below 14 years were excluded from the study. in total 34 patients were included in this study, of which 14 had received category i, 4 anti-tb drugs that include rifampicin, isoniazid, ethambutol, pyrazinamide. another 20 patients received category ii: 5 antitb drugs that included rifampicin, isoniazid, ethambutol, pyrazinamide and sparfloxacin. all the patients received the drugs under direct observation therapy short-course (dots)-treatment program. primary variables were organ -related adverse effects e.g. signs, symptoms and function tests. secondary variables were predisposing risk factors e.g. age, sex, nutritional status, socio-economic condition and habits. organ-related adverse effects and biochemical parameters were estimated before (0 week) and 4 and 8 weeks after initiation of treatment. data was analyzed by x², one-way anova with repeated measure design and post hoc test of significance was done by pair t-test by using spss 11. results a total number of 64 patients were included of which 34 completed the study. among the 30 patients who did not complete the study, 4 patients expired and 26 patients dropped out. among the patients completed the study, 27 (79.4%) were male and 7 (20.6%) were female. in 4-drug treatment group 14 male and female patients of age 38.0 ± 9.6 years (mean ± sd) and in 5drug treatment group 20 male and female patients of age 38.6 ± 12.8 years were included. the mean age of male and female patients was 38.4 ± 11.6 years and 38.1 ± 13.9 years respectively. male and female patients did not differ in their age (t = 0.04, ns). all of 27 (100%) male patients and out of 7 female patients 5 (71.4%), yielding a total number of 32 (94.1%) were in under nutritional group and lived in low socio52 bangladesh j pharmacol 2006; 1: 51-57 table i adverse effects observed in course of two anti-tuberculosis drug treatment regimen recorded during initial two month of treatment symptoms 4-drug group n = 14 5-drug group n = 20 nausea 1 (7.1) 1 (5) vomiting 1 (7.1) 1 (5) anorexia 1 (7.1) 2 (10) abdominal pain 1 (7.1) 6 (30) joint pain 5 (35.7) 6 (30) joint swelling 0 3 (15) muscle weakness 2 (14.3) 5 (40) visual disturbances 4 (28.6) 5 (40) rash 0 3 (15) vestibular disturbances 1 (7.1) 0 peripheral neuropathy 00 1 (5) values in parenthesis are expressed in percentage economic condition. in habitual status 10 (37.0%) of males were smoker, while none of female had that habit. eight (29.6%) of male and 4 (57.1%) female patients making a total number of 12 (35.3%) were habituated with betel nuts. out of the treated patients 76.5% experienced some sorts of unwanted effects (table i). adverse effects were observed in 7 patients (50%) in 4-drug regimen group and in 19 patients (95%) in 5-drug regimen group. notable adverse effects were abdominal pain experienced by 1 patient (7.1%), muscle weakness by 2 patients (14.3%) and joint pain by 5 (35.7%) in 4-drug regimen group. in 5-drug regimen group abdominal pain was experienced by 6 (30%) patients, muscle weakness by 5 (40%) and joint pain by 6 (30%) patients respectively. in the 4-drug treatment group before initiation of treatment regimen the estimated serum glucose level was 93.6 ± 20.9 mg/dl. after 2 and 8 weeks of inception of treatment regimen glucose level was detected as 99.2 ± 20.7 and 85.2 ± 14.0 mg/dl respectively (table ii). these differences were not statistically significant. in the 5-drug treatment group before initiation of treatment regimen the estimated serum glucose level was 91.9 ± 25.5 mg/dl. after 2 and 8 weeks of inception of treatment regimen creatinine level was detected as 86.0 ± 27.2 and 84.5 ± 16.6 mg/dl respectively (table iii). in the 4-drug treatment group before implementing the treatment regimen bilirubin was 0.5 ± 0.2 mg/dl. after 2 and 8 weeks of inception of treatment regimen bilirubin level was estimated 0.6 ± 0.8 and 0.4 ± 0.2 mg/ dl respectively (table ii). one-way anova shows no changes in course of treatment in this group [f (2, 39) = 0.952, ns]. in the 5-drug treatment group before initiation of the treatment regimen bilirubin (mean ± sd) was 0.6 ± 0.7 mg/dl. after 2 and 8 weeks of inception of treatment regimen bilirubin level was estimated 0.7 ± 1.3 and 0.4 ± 0.3 mg/dl respectively (table iii). one-way anova shows no changes in course of treatment in this group [f (2, 57) = 0.547, ns]. in the 4-drug treatment group before administration of the treatment regimen sgpt was 4.8 ± 2.2 u/l. after 2 and 8 weeks of treatment regimen sgpt level was estimated 7.5 ± 6.0 mg/dl and 5.9 ± 3.1 u/l respectively (table ii). one-way anova shows no changes in sgpt in this group [f (2, 39) = 1.46, ns]. after two weeks of treatment sgpt tended to increase but was neither statistically significant nor clinically appreciable [t = 1.4; df 13, ns]. after 8 weeks of treatment sgpt level was almost same as that of pretable ii biochemical organ function tests of 4-drug treatment regimen group recorded during initial two month of treatment biochemical tests 0 week 4 weeks 8 weeks serum bilirubin 0.5 ± 0.2 0.6 ± 0.8 0.4 ± 0.2 serum alt (sgpt) 4.8 ± 2.2 7.5 ± 6.0 5.9 ± 3.1 serum alkaline phosphatase 102.8 ± 51.2 78.5 ± 24.1 70.7 ± 41.6 serum creatinine 1.1 ± 0.4 1.1 ± 0.4 1.0 ± 0.2 serum uric acid 4.9 ± 2.1 6.2 ± 2.7 6.3 ± 1.5 serum glucose 93.6 ± 20.9 99.2 ± 20.7 85.2 ± 14.0 table iii biochemical organ function tests of 5-drug treatment group recorded during initial two month of treatment biochemical tests 0 week 4 weeks 8 weeks serum bilirubin 0.5 ± 0.7 0.7 ± 1.3 0.4 ± 0.3 serum alt(sgpt) 11.1 ± 16.6 11.5 ± 8.9 8.1 ± 4.5 serum alkaline phosphatase 111.5 ± 85.7 106.3 ± 55.9 79.2 ± 26.1 serum creatinine 0.9 ± 0.3 1.1 ± 0.2 1.1 ± 0.2 serum uric acid 4.5 ± 1.6 5.6 ± 2.1 5.7 ± 2.5 serum glucose 91.9 ± 25.5 86.0 ± 27.2 84.5 ± 16.6 bangladesh j pharmacol 2006; 1: 51-57 53 treatment level [t = 1.1; df 13; ns]. there observed no difference between sgpt level estimated 2 and 8 weeks of treatment [t = 0.9; df 13; ns]. in the 5-drug treatment group before initiation of the treatment regimen sgpt was 11.1 ± 16.6 u/l. after 2 and 8 weeks of inception of treatment regimen sgpt level was estimated 11.5 ± 8.9 and 8.1 ± 4.5 u/l respectively (table iii). one-way anova shows no changes in course of treatment in this group [f (2, 57) = 0.569, ns]. there observed no difference between sgpt level estimated 2 and 8 weeks of treatment [t = 1.6; df 19; ns]. no differences in sgpt level was observed in the group of patients (4-drug vs 5-drug) when estimated after 2 weeks [t = 1.5; ns] and 8 weeks [t = 1.5; ns]. in the 4-drug treatment group before implementing treatment regimen serum alkaline phosphatase was 102.8 ± 51.2 u/l. after 2 and 8 weeks of inception of treatment regimen alkaline phosphatase tended to decrease to 78.5 ± 24.1 and 70.7 ± 41.6 u/l respectively (table ii). however, one-way anova shows no significant differences in alkaline phosphatase in course of treatment [f (2, 39) = 2.392, ns]. in the 5-drug treatment group before administration of treatment regimen serum alkaline phosphatase was 115.5 ± 85.7 u/l. after 2 and 8 weeks of inception of treatment regimen alkaline phosphates was estimated to be as 106.3 ± 55.9 and 79.2 ± 26.1 u/l respectively (table iii). however, one-way anova shows no significant differences in alkaline phosphatase in course of treatment [f (2, 57) = 1.91, ns]. in the 4-drug treatment group before initiation of treatment regimen the estimated creatinine level was 1.1 ± 0.4 mg/dl. after 2 and 8 weeks of inception of treatment regimen creatinine level was detected as 1.1 ± 0.4 and 1.0 ± 0.2 mg/dl respectively (table ii). in the 5-drug treatment group before initiation of treatment regimen the estimated creatinine level was 1.0 ± 0.3 mg/dl. after 2 and 8 weeks of inception of treatment regimen creatinine level was detected as 1.1 ± 0.2 and 1.1 ± 0.2 mg/dl respectively (table iii). in the 4-drug treatment group before implementing the treatment regimen serum uric acid level was 4.9 ± 2.1 mg/dl. after 2 and 8 weeks of inception of treatment regimen uric acid level was detected 6.2 ± 2.7 and 6.3 ± 1.5 mg/dl (table ii). after 2 weeks of treatment uric acid tended to increase but was not statistically significant [t = 2.1; df 13, ns]. after 2 months of treatment uric acid level significantly increased in this treatment group [t = 2.3, df 13; ns]. there observed no difference between uric acid level estimated 2 and 8 weeks of treatment [t= 0.2, df 13; ns]. in the 5-drug treatment group before administration of the treatment regimen serum uric acid level was 4.5 ± 1.6 mg/dl. after 2 and 8 weeks of inception of treatment regimen uric acid level was detected 5.6 ± 2.1 and 5.7 ± 2.5 mg/dl (table iii). after 2 weeks of treatment uric acid tended to increase but was not statistically significant [t=2.1; df 19, ns]. after 2 months of treatment uric acid level did not change [t=1.9, df 19; ns]. discussion in 1998 the global tb program of who established global tb research initiative to support related research. research has been done by ngos on health system and service research that include studies on dots by community health workers (chowdhury et al., 1997), on microscopic diagnosis (vandeun and portalels, 1998) and drug resistance surveillance (haque et al., 1995). compliance with anti-tb medication is essential to effective management. two strategies to ensure compliance are dots and fixed dose combination (fdc) (van leuven et al., 1997). our study fully applied on dots strategy. generally these drugs are well tolerated (dutt et al., 1983), may be associated with unwanted effects of different origin. adverse drug reactions had been extensively studied and reviewed (haque and golam nabi, 1999; mohan et al., 2004; resi et al., 2004; maddrey, 2005). the present prospective study was undertaken to demonstrate the extent of adverse effects of two antituberculosis drug treatment regimens under dots. adverse effects were assessed according to sign and symptoms of the patients and the systemic organrelated adverse effects were estimated by serum g l u co s e , s er u m bi l i r ubi n , s e r u m al an i n e aminotransferase, alkaline phosphatase, creatinine, uric acid. as predisposing risk factors for adverse effects we observed age, sex, nutritional status, socioeconomic condition and habit. serum glucose was estimated before the treatment initiation with the aim to assess hyperglycemia as predisposing risk factor for tb or adverse drug events involving hepatic or renal dysfunction. subsequently in course of treatment serum glucose level was monitored with the view of effects of these drugs on carbohydrate metabolism of liver. in our observation in course of treatment there were no significant changes in glucose level estimated neither before nor after two month of treatment. most of the tb patients complete treatment without any significant adverse effects, however data (ormerod and horsfield, 1996) showed that side effects occur in 57.8% patients, while we observed 76.5% of patients experienced some sort of unwanted effects. unwanted effects were minor in nature, only 2.9% exhibited major adverse effects e.g. 54 bangladesh j pharmacol 2006; 1: 51-57 hepatitis in our study, while shakya et al. (2004) reported an 8% incidence of hepatotoxicity. side effects related to the digestive system were observed in 29.4% of patients that was consistent with the observation of others (ormerod and horsfield, 1996). we observed no evidence of allergic reactions, neurotoxicity, cardiovascular-related adverse effects as observed by other (ormerod and horsfield, 1996). it is important that patients should be monitored during treatment so that adverse effects can be detected promptly and managed properly (who, 2003). serious adverse effects require documented change in therapy or hospitalization. if minor adverse effects develop patients should continue with reduced doses and receive symptomatic treatment, if major side effects develop the offending drug should be stopped (who, 2003). the withdrawal of treatment due to major adverse effect e.g. hepatitis in 1.8 to 6.0% patients (girling, 1978; smith and zirk, 1961). ormerod and horsfield (1996) reported that 51% had reaction to antituberculosis drug requiring modification of treatment while none of our patients required modification of treatment. termination of treatment either with inh, rifampicin or pyrazinamide because of severe side effects was necessary in 23% as reported by schaberg et al. (1996). baseline studies of complete blood counts, hepatic and renal function studies were suggested to be performed at the initiation of treatment (dutt et al., 1983). in our study hepatic and renal function tests were done with the view to assess the effects of the used drugs on these organs. we observed no substantial abnormality in baseline liver and renal function tests in course of treatment regimens. it is very uncommon to have adverse reactions to a single anti-tb drug, but such reaction with more than one is very small (smith and zirk, 1961), while adverse reactions to multiple drugs were reported (mathus et al., 1979; thamari and gupta, 1981). in our observation, major side effects as hepatitis developed in 2.9%, that was similar to the report of dutt et al., 1983). during the initial phase of 4-drug combination treatment regimen side effects were reported in 22.4% of patients (haque and golam nabi, 1999). in our 4-drug treatment regimen study group, 50% of patients developed side effects during the initial phase. of them 35.7% complained of arthralgia, 28.6% experienced git upset, muscle weakness evidenced in 14.3%, vestibular disturbances in 7.1% persons and sign of peripheral neuropathy was absent. our observation differed to some extent from observation of others (dutt et al., 1983; ohkawa et al., 2002). in 5-drug treatment regimen study group, adverse effects observed in 90% of patients. of them 30% developed arthalgia, 50% experienced git upset, 40% complained of muscle weakness. adverse effects showed commoner in 5-drug treatment group compared to 4-drug group was not statistically significant. in our study 21.4% patients exhibited a transient and symptomless increase of sgpt that was in agreement with other reports (lee, 1995; lee et al., 2002). fattinger et al. (1997) reported eight times increase of sgpt, while we observed 2-3 times increase in a few patients. incidence of hepatitis was reported in 7.7% with combination of use of rifampicin and pyrazinamide (lee et al., 2002), compared to drug used alone viz. with pyrazinamide 15%, with isoniazid 7%, with rifampicin 1.5% and hepatitis was suggested due to pyrazinamide rather than isoniazid or rifampicin (schaberg et al., 1996). isoniazid and pyrazinamide combination administration was associated with an increased mortality in patients with hepatitis. hepatotoxic potential of rifampicin or pyrazinamide is far less in the doses used in the modern day shortcourse regimen. we did not observe such results in our study. we analyzed serum uric acid and creatinine level to assess kidney functions. increase of uric acid level was reported (solangi et al., 2004; zierski and bek, 1980). in our study 55.9% of patients showed increased uric acid level, that confirms other studies. ethambutol is also reported to increase uric acid level (postlethwaite et al., 1971). we did not observe any change in serum creatinine level, while solangi et al. (2004) observed nonsignificant elevation. our observation suggests no appreciable effects of anti-tb drugs on kidneys. risk factors for anti-tb drugs-induced hepatitis had been studied (shakya et al., 2004; fauzi et al., 2004; marti et al., 2005; tost et al., 2005). case control studies were undertaken to assess the risk factors for hepatotoxicity with variable like age, sex, bmi, acetylator status, extent of disease, protein, alcohol intake (pande et al., 1996). in our study hepatotoxicity developed in younger males who were given pza that also is observed by ohkawa et al. (2002). as predisposing risk factors there is no suggestive finding in our observation related to age and habit, however we observed tb more common in male; in poor nutritious and low socio-economic status. our study applied on dots of both 4-drug and 5 drug– regimen patients. due to time constrains and limitation of facilities the obtained results may not reflect the actual effects of drugs on population. further prospective longitudinal interventional randomized studies with larger sample size of different subject group are necessarily recommended. bangladesh j pharmacol 2006; 1: 51-57 55 references bass jb, farer ls, hopewell pc, o’brien r, jacobs rf, ruben f, snider dej, thornton g. treatment of tuberculosis and tuberculosis infections in adults and children. am j respir crit care med. 1994; 149: 1359-74. benoor ks, mahmood am, huq akms. multidrug resistant tuberculosis: problem arise. abstract, the national conference of chest; 1998, p 15. blomberg b, spinaci s, fourie b, laing r. the rationale for recommending fixed-dose combination tablets for treatment of tuberculosis. who. 2001; 79: 61-68. chowdhury am, chowdhury s, islam mn, islam a, vaughan jp. control of tuberculosis by community health workers in bangladesh. lancet 1997; 350: 169-72. dutt ak, moers d, stead ww. undesirable side-effect of isoniazid and rifampicin in largely twice-weekly shortcourse chemotherapy for tuberculosis. am rev respir dis. 1983; 128: 419-24. fattinger k, braunschweig s, reichen j, meier-abt pj, krahenbuhl s. liver injury under tuberulostatic treatment. schweiz rundsch med prax. 1997; 86: 626-29. fauzi ar, shah a, rathor my, satwi s, risk factors for antituberculous drugs-induced hepatitis: a prospective survey from a chest clinic in a general hospital. med j malaysia. 2004; 59: 72-77. girling dj. the hepatictoxicity of antituberculosis regimens containing isoniazid, rifampicin and pyrazinamide. tubercle 1978; 59: 13-32. grange jm. drug resistance and tuberculosis elimination. bull int union tuberc lung dis. 1990; 65: 57-59. haque ma, golam nabi pd. achievements of national tb control program. bangladesh med res counc bull. 1999; 25: 71-82. haque me, yousuf m, haque akms. a study on side effects of thiacetazone. chest heart bull. 1995; 2: 63-65. hussain z, kar p, hussain sa. antituberculosis druginduced hepatitis; risk factors, prevention and management. indian j exp biol. 2003; 41: 1226-32. lee am, mennone jz, jones rc, paul ws. risk factors for hepatotoxicity associated with rifampicin and pyrazina-mide for the treatment of latent tuberculosis infection: experience from three public health tuberculosis clinics. int j tuberc lung dis. 2002; 6: 995-1000. lee wm. drug-induced hepatotoxicity. n engl j med. 2003; 349: 474-85. maddrey wc. drug-induced hepatotoxicity. j clin gastroenterol. 2005; 39: s83-89. marti l, del olmo ja, tosca j, ornia e, garcia-torres ml, serra ma, rodriguez f, lluch p, escudero a, rodrigo jm. clinical evaluation of drug-induced hepatitis. rev esp enferm dig. 2005; 97: 258-65. mathus kc, jain vk, gupta pp, jain a. multiple drug reaction during chemotherapy of tuberculosis. indian med gazette. 1979; 8: 274. mohan a, sharma sk. side effects of anti-tuberculosis drugs. am j respir crit care med. 2004; 169: 882-83. ohkawa k, hashiguchi m, ohno k, kiuchi c, takahashi s, kondo s, echizen h, ogata h. risk factors for antituberculosis chemotherapy-induced hepatotoxicity in japanese pediatric patients. clin pharmacol ther. 2002; 72: 220-26. ormerod lp, horsfield n. frequency and type of reactions to anti-tuberculosis drugs: observation in routine treatment. tuberc lung dis. 1996; 77: 37-42. pande jn, singh sp, khilnani gc, khilnani s, tandon rk. risk factors for hepatotoxicity from anti-tuberculosis drugs: a case-control study. thorax 1996; 51: 132-36. pereira rm, tresoldi at, hessel g. isoniazid-induced hepatic failure report of a case. arq gastroenteral. 2000; 37: 72-75. postlethwaite ae, bartel ag, kelley wn. hyperuricemia due to ethambutol. n engl j med. 1972; 286: 761-62. resi d, gangliotti c, moro ml. side effects of anti-tuberculosis therapy. am j respir crit care med. 2004; 169: 542. schaberg t, rebhan k, lode h. risk factors for side-effect of isoniazid, rifampicin and pyrazinamide in patients hospitalized for pulmonary tuberculosis. eur respir j. 1996; 9: 2026-30. scott jt. drug-induced gout. baillieres clin rheumatol. 1991; 5: 39-60. shakya r, rao bs, shrestha b. incidence of hepatotoxicity due to anti-tubercular medicines and assessment of risk factors. ann pharmacother. 2004; 38: 1074-79. smith jm, zirk mh. toxic and allergic drug reaction during the treatment of tuberculosis. tubercle 1961; 42: 287. solangi ga, zuberi bf, shaikh s, shaikh wm. pyrazinamideinduced hyperuricemia in patients taking anti-tuberculosis therapy. j coll physicians surg (pak). 2004; 14: 136-38. thamari jp, gupta vk. hypersensitivy of multiple drug in treatment of pulmonary tuberculosis. indian j tuberc. 1981; 28: 143. tost jr, vidal r, cayla j, diaz-cabanela d, jimenez a, broquetas jm. study group for severe hepatotoxicity due to anti-tuberculosis drugs. int j tuberc lung dis. 2005; 9: 53440. tsai rk, lee yh. reversibility of ethambutol optic neuropathy. j ocul pharmacol ther. 1997; 13: 473-77. van leuven m, de groot m, shean k. pulmonary resection as an adjunct in the treatment of multidrug resistant tuberculosis. ann throac surg. 1997; 63: 1370-72. vandeun a, portalels f. limitation and requirement for quality control of sputum smear microscopy for afb. int j tuberc lung dis. 1998; 2: 756-57. who. guide line for the management of drug resistant tuberculosis. 1998, pp 5-8. who. standardized treatment regimens. treatment of 56 bangladesh j pharmacol 2006; 1: 51-57 author info akm mosharrof hossain (principal contact) tuberculosis. guide lines for national programs, who/ tb. 2nd ed. 1997, pp 23-31. who. tb deaths reach historic levels. press release who; 1996, pp 1-3. who. treatment of tuberculosis guidelines for national program 3rd ed. geneva, who/cds/tb/ 2003, p 313. wright pw, wallace rj jr, write nw, brown ba, griffith de. sensitivity of flurochrome microscopy for detection of mycobacteria. j clin microbial. 1998; 4: 1046-49. zierski m, bek e. side-effect of drug regimens used in short course chemotherapy for pulmonary tuberculosis a controlled clinical study. tubercle 1980; 61: 41-49. bangladesh j pharmacol 2006; 1: 51-57 57 dateprinted: this article was downloaded by you on: oct 23, 2017 bangladesh journal of pharmacology research article effect of semen sojae germinatum on experimental osteoarthritis in the rabbit knee bjp introduction osteoarthritis (oa) characterized by progressive degeneration of the articular cartilage and accompanied by subchondral bone sclerosis and synovial inflammation is a degenerative joint disease afflicting an increasingly older population (felson et al., 2000). approximately 10% of adults aged 60 years or older suffer from oa of the knee (scott and kowalczyk, 2008). there is still no curative treatment for this disease despite availability of a large number of therapeutic options including nonpharmacological, pharmacological, and surgical therapies. drug therapy includes non-opioid analgesics such as non-steroidal antiinflammatory drugs (nsaids), topical analgesics, opioid analgesics and intra-articular steroid injection. such treatments can only relieve some symptoms of oa, and may prove ineffective in some patients (tramèr et al., 2000). the most common therapy for treating oa is nsaids, but their use may be restricted by adverse gastrointestinal effects including serious occurrences of bleeding causing many deaths (felson et al., 2000). hence, there appears to be a need for drugs with good efficacy and low toxicity in the treatment of oa. chinese medicine, such as herbal medicinal products, has been proved to be effective in the treatment of oa through slowing down cartilage degeneration, promoting articular cartilage repair and inhibiting synovial inflammation (wang et al., 2010a). importantly, no serious side effects were reported with any herbal intervention (cameron et al., 2009). in traditional chinese medicine, the condition which is congruent with oa is called "bi syndrome" (painful obstruction syndrome), and more specifically, “bi syndrome of bone”. “bi syndrome” manifests as pain, soreness, or numbness of muscles, tendons and joints, and is the result of the body being "invaded" by the external climatological factors of wind, cold, heat, and/or dampness (hua and o’brien, 2010). semen sojae germinatum (ssg) is one of chinese folk recipes treating “bi syndrome of bone” recorded by "shen a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2013; 8: 365-370 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 abstract as a complementary therapeutic approach, soy ingredients, such as soy protein and soybean unsaponifiables, recently attract more attention for relieving symptoms of osteoarthritis (oa). semen sojae germinatum (ssg) processed from bean-sprout coming from germinating glycine max l. merr. is a traditional chinese herbal medicine treating knee oa. we evaluated the effect of ssg as feed on the development of anterior cruciate ligament transaction (aclt) -induced knee oa in rabbits. the results showed that ssg reduced the severity of cartilage degeneration in macroscopic grading scale, and delayed the degradation of the cartilage matrix. the contents of prostaglandin e2 (pge2), nitric oxide (no), tumor necrosis factor (tnf), interleukin-6 (il-6) and il-1 in synovial fluid, mrna and protein expressions of matrix metalloproteinases (mmp)-3, mmp-13 in cartilage were effectively decreased in ssg group. these results demonstrate that ssg had a protective effect against the development of knee oa. article info received: 23 september 2013 accepted: 11 october 2013 available online: 29 october 2013 doi: 10.3329/bjp.v8i4.16446 cite this article: he b, wang j. effect of semen sojae germinatum on experimental osteoarthritis in the rabbit knee. bangladesh j pharmacol. 2013; 8: 365-70. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. effect of semen sojae germinatum on experimental osteoarthritis in the rabbit knee bingshu he1 and jun wang2 1department of orthopedic surgery, hubei woman and child hospital, wuhan 430070, china; 2department of pharmacy, medical college, wuhan university of science and technology, wuhan 430065, china. nong's herbal classic" and “compendium of materia medica”. indeed, ssg is processed bean sprout coming from germinating chinese black soybean (glycine max l. merr.) variety, and has been included in edition 2010 pharmacopoeia of people's republic of china as a new kind. although ssg has been widely used in traditional chinese medicine clinical practices based on the ancient chinese perception and experience, nowadays, study on the modern pharmacological effects of ssg is still rare. in this study, we attempted to determine whether ssg has the protective effect on articular cartilage in a rabbit knee oa model induced by anterior cruciate ligament transaction (aclt), and study its mechanism. materials and methods ssg preparation ssg was prepared referring to edition 2010 pharmacopoeia of people's republic of china. chinese black soybeans (glycine max l. merr.) were sprouted. when the sprouts are 1 cm high, spread them out, let wind blow them to a half dry, then dry them in the sun to prepare ssg. subsequently, lophatherum gracile and juncus effusus (lophatherum gracile 2 kg, juncus effusus 1 kg /ssg 100 kg ) were put in the pot, and decocted twice (first time 60 min, second time 30 min). then the decoction solution was mixed and filtrated. the filtrate and ssg were both put in a pot, then cooked until the filtrate was all absorbed by ssg. the total amount of daidzin (c21h20o9) and genistein (c21h20o10) accounted for no less than 0.08% (w/w) of the dry material using hplc method as described in edition 2010 pharmacopoeia of people's republic of china. finally, the prepared ssg was dried and smashed to make the standard granulated feed. animal and experimental arthritis new zealand white rabbits (2.0-2.5 kg) were obtained from the laboratory animal center of wuhan university (wuhan, hubei, china). animal care and treatment were in accordance with the guidelines of the laboratory animal management and review committee of wuhan university of science and technology. rabbits were randomly divided into 3 groups of 5 rabbits each: sham operated group, the oa model control group and ssg group. rabbits in ssg group were fed with the diet made of prepared ssg, while rabbits in sham operated group and the oa model control group were fed with normal diet. the basis of the food which was used to prepare the ssg containing food was the same as the food given to the control animals after the animals were fed with the corresponding diet for 4 weeks, oa was induced by aclt and excisions of medial menisci in the right knees (yoshioka et al., 1996) on the rabbits of oa model control group and ssg group. the sham operated group only had the right joint cavity opened and then the incision was sutured. the corresponding diet was given unceasingly. gross pathology observation and histological evaluation after 8 weeks, the rabbits were sacrificed and femoral condyles were collected for observation. the depth of erosion was graded on a scale of 0-4 (pelletier et al., 1998). all samples were graded by three independent observers unaware of the treatment groups. the cartilage samples were embedded in paraffin, and standard frontal sections of 5 μm sections were prepared and stained with toluidine blue in the lateral part of the femoral condyle cartilage according to gross observation (cake et al., 2000). prostaglandin (pg)e2, nitric oxide (no), tumor necrosis factor (tnf), interleukin (il)-6 and il-1 in synovial fluid after the rabbits were sacrificed, knees were washed with 1 ml of 0.9% (w/v) physiological saline solution through the patellar tendon. the contents of pge2 and no in synovial fluid were measured by the correspondding kits (chinese academy of medical sciences, beijing, and jiancheng co., nanjing, china, respectively). concentrations of tnf, il-6 and il-1 in synovial fluid were measured using elisa kits (jiancheng co., nanjing, china). mrna and protein expression of matrix metalloproteinases (mmp)-3 and mmp-13 in cartilage the expression levels of mmp-3 and mmp-13 mrna in 366 bangladesh j pharmacol 2013; 8: 365-370 table i primer sequences used in the study gene length sequence of primers mmp-3 sense 5′-agccaatggaaatgaaaactcttc-3′ 72 bp antisense 5′-ccagtggataggctgagcaaa-3′ mmp-13 60 bp sense 5’ttt tga aga cac ggg caa g -3’ antisense 5’tca tca tag ctc cag act tgg tt -3’ gapdh 66 bp sense 5’agc cac atc gct cag aca -3’ antisense 5’gcc caa tac gac caa atc c -3’ cartilage were detected by quantitative real-time pcr using taqman probes 59-fluorescent labeled with either fam or vic in a thermal cycler (abi prism 7500 sequence detector system, applied biosystems, foster city, ca, usa), employing glyceraldehyde-3phosphate dehydrogenase (gapdh) gene as a reference gene. the sequences of each primer set (invitrogen, carlsbad, ca) used are given in table i. the protein expression levels of mmp-3 and mmp-13 were detected by western blot. proteins in cartilage were separated by sds-page and proteins were transferred onto a polyvinylidene difluoride membrane by electroblotting. membrane was blocked overnight and then incubated for 2 hours with a 1:1000 dilution of goat polyclonal mmp-3 or rabbit polyclonal mmp-13 antibody (santa cruz, ca). after incubation with the secondary antibody, proteins were detected with an ecl chemiluminescence detection kit (advansta, usa.) and scanned. the amount of protein expression was corrected by the amount of gapdh in the same sample. data analysis comparisons between groups were per-formed with one-way anova analysis using spss 11.5 software. the data were reported as means ± standard deviation (sd). statistical significance was defined by the value of p<0.05. results knee articular cartilage of rabbits in sham operated group is smooth and lustrous. in the oa model control group, the articular cartilage surface was rough and had some superficial leakage and ulcers. in ssg group, cartilage lesions associated with oa were clearly seen, but the severity was milder than in oa group (figure 1 a). macroscopic grades in ssg group were significantly lower than those in the oa model control group (p< 0.05) as seen in figure 1b, suggesting ssg can reduce the severity of the cartilage degeneration in macroscopic grading scale. articular cartilage consists of chondrocytes sparsely embedded within an abundant extracellular matrix which is composed essentially of water, proteoglycans, collagens and non-collagenous proteins (cake et al., 2000). and cartilage proteoglycan loss is believed as one of the hallmarks of oa, because proteoglycans have the properties of resisting compression and generating the swelling pressure due to their affinity for water (echtermeyer et al., 2009). toluidine blue staining for proteoglycans (getzy et al., 1982) showed a distinct reduction of these compounds in the cartilage matrix of oa rabbits. in ssg group, the matrix degradation was less evident than oa group (figure 2). pro-inflammatory mediators alter matrix homeostasis and participate in the destruction of articular cartilage, thereby contributing to oa. it has been shown that oa bangladesh j pharmacol 2013; 8: 365-370 367 sham operated group oa model control group ssg groupa p<0.01 p<0.01 g ra de 4 3 2 1 0 b sham operated group oa model control group ssg group figure 1. gross pathological observation of the femoral condyle. a: representative images of the femoral condyle from rabbits in sham operated, oa model control and ssg groups; b: macroscopic grading scale of cartilage. cartilage spontaneously releases pge2 at 50-fold higher levels than in normal cartilage (wang et al., 2010b). also, no has been identified as another agent in oa. no is produced in large amounts by chondrocytes upon pro-inflammatory cytokine stimulation，and correlates with the pathophysiological changes in chondrocytes (schwager et al., 2011). in addition, proinflammatory cytokines il-1 , il-6 and tnf have been suggested as key players in oa pathogenesis, and they are of an important role for development of synovitis and destruction of cartilage matrix (bondeson et al., 2006; goekoop et al., 2010). the levels of pge2, no, tnf, il-6 and il-1 in synovial fluids were markedly higher in oa group than in sham operated group (p<0.01). in ssg group, the pge2 , no, tnf, il-6 and il-1 secretion reduced 13.9, 18.9, 22.7, 38.5 and 28.0% respectively com-pared to the oa group (p<0.05; p<0.01)(table ii), suggesting ssg inhibited the synovial inflammation. increased mmp expression can be detected in the early stages of oa (pelletier et al., 1990). mmp-3 can degrade the proteoglycan of cartilage (yamanaka et al., 2000), while mmp-13 is known to degrade collagens and glycosaminoglycans (roberts et al., 2000). as seen in figure 3, ssg showed the beneficial effect on mmp-13 and mmp-3 mrna and protein expression in cartilage which are related to cartilage matrix degradation (p<0.05). discussion alternative and complementary therapeutic approaches, such as the use of a wide array of herbal and nutritional manipulations, are becoming popular for relieving symptoms of oa (pirotta, 2010). notably, some components of soy have great potential in oa control. it has been demonstrated (arjmandi et al., 2004) that 40 g of supplemental soy protein daily for 3 months improved oa-associated symptoms, such as range of motion and several factors associated with pain and quality of life, in comparison to same dosage of milk-based protein. furthermore, biochemical markers of cartilage metabolism further supported the efficacy of soy protein supplementation in relieving symptoms of oa as indicated by a significant increase in serum level of insulin-like growth factor-i, a growth factor associated with cartilage synthesis, and a significant decrease in serum level of glycoprotein 39, a marker of cartilage degradation (arjmandi et al., 2004). besides, avocado/soybean unsaponifiables (asu), a new antiarthritic agent derived from unsaponifiable residues of avocado and soybean oils mixed in the ratio of 1:2 respectively, has also been recommended for treat -ing oa with published basic and clinical trials in animals and humans (maheu et al., 1998; appelboom et al., 2001; kut-lasserre et al., 2001; henrotin et al., 2003), thus considered a symptomatic disease-modifying osteo -arthritic compound (lippiello et al., 2008). metaanalysis data support better chances of success in patients with knee oa than in those with hip oa (christensen et al., 2008). therefore, components of soy 368 bangladesh j pharmacol 2013; 8: 365-370 a b c figure 2. histologic examination of cartilage change in rabbits of sham operated (a), oa model control (b) and ssg (c) groups. cartilages were stained with toluidine blue. (original magnification × 100) table ii concentration of pge2, no, tnf, il-6 and il-1 in synovial fluids from knees of rabbit oa group pge2/ng/ml no/µmol/l tnf/ ng/ml il-1 /pg/ml il-6/pg/ml sham operated 2.2 ± 0.4 29.8 ± 8.2 0.002 ± 0.0 8.5 ± 0.9 0.1± 0.03 oa model control 3.1 ± 0.3a 151.1 ± 21.2a 15.1 ± 3.1a 322.2 ± 84.5a 219.7 ± 45.5a ssg 2.7 ± 0.4b 122.6 ± 26.2b 11.7 ± 2.6b 198.2 ± 74.5c 158.2 ± 51.2b data are mean ± sd; n ＝ 5; ap<0.01, vs sham operated group; bp<0.05, cp<0.05 vs oa model control group seem to be the feasible alternative to the control of oa. similar to the soy protein and asu, ssg, a traditional chinese medicine for “bi syndrome of bone” and “knee pain”, also comes from the soy. ssg has been used for the treatment of joint pain and arthritis by chinese medical doctor for over 2000 years. from the unique perspective of chinese medicine, ssg has the effects of relieving exterior syndrome, activating blood circulation, detumescence and dehumidify. these effects, interpreted as analgesia, anti-inflammatory, promoting microcirculation and reducing swelling respectively in modern pharmacology, are all helpful for oa control. this study has shown that ssg as the feed material reduced the severity of the cartilage degeneration and delayed the degradation of cartilage matrix on rabbit knee oa model, indicating that ssg has a protective activity for oa. many researches have demonstrated that enzymatic cleavage by mmps together with pro-inflammatory cytokines plays critical roles in the initiation and progression of cartilage destruction (ju et al., 2010). the results of this study demonstrated that the contents of pge2, no, tnf, il-6 and il-1 in synovia and expressions of mmp-3, mmp-13 in cartilage were elevated in oa model group, whereas the elevation of pge2, no, tnf, il-6, il-1 , mmp-3 and mmp-13 levels were significantly suppressed in ssg groups. interestingly, these effects are similar to the antiosteoarthritic mechanism of asu (maheu et al., 1998; appelboom et al., 2001; kut-lasserre et al., 2001; henrotin et al., 2003). in addition, ssg is widely used in chinese medicine, and also a kind of processed food bean sprout, so its excellent safety record is reassuring. in the present study, no observable adverse effect of ssg as the feed material was seen during and after the 12-week feeding. references appelboom j, schuermans g, verbruggen g, henrotin y, reginster jy. symptoms modifying effect of avocado/ soybean unsaponifiables (asu) in knee osteoarthritis. scand j rheumatol. 2001; 30: 242-47. arjmandi bh, khalil da, lucas ea, smith bj, sinichi n, hodges sb, juma s, munson me, payton me, tivis rd, svanborg a. soy protein may alleviate osteoarthritis symp toms. phytomedicine 2004; 11: 567-75. bondeson j, wainwright sd, lauder s, amos n, hughes ce. the role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. arthritis res ther. 2006; 8: r187. cake ma, read ra, guillou b, ghosh p. modification of articular cartilage and subchondral bone pathology in an ovine meniscectomy model of osteoarthritis by avocado and soya unsaponifiables (asu). osteoarthritis cartilage. 2000; 8: 404-11. cameron m, gagnier jj, little cv, parsons tj, blümle a, chrubasik s. evidence of effectiveness of herbal medicinal products in the treatment of arthritis. part i: bangladesh j pharmacol 2013; 8: 365-370 369 figure 3: the mrna and protein expression levels of mmp-3 and mmp-13 were determined by rt-pcr (a) and western blot (b) respectively ##p<0.01, vs sham operated group; *p<0.05, vs oa model control group http://www.ncbi.nlm.nih.gov/pubmed?term=%22arjmandi%20bh%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22khalil%20da%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22arjmandi%20bh%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22khalil%20da%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22arjmandi%20bh%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22hodges%20sb%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22juma%20s%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22svanborg%20a%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed/?term=soy%20protein%20may%20alleviate%20osteoarthritis%20symptoms http://www.ncbi.nlm.nih.gov/pubmed?term=bondeson%20j%5bauthor%5d&cauthor=true&cauthor_uid=17177994 http://www.ncbi.nlm.nih.gov/pubmed?term=wainwright%20sd%5bauthor%5d&cauthor=true&cauthor_uid=17177994 http://www.ncbi.nlm.nih.gov/pubmed?term=bondeson%20j%5bauthor%5d&cauthor=true&cauthor_uid=17177994 http://www.ncbi.nlm.nih.gov/pubmed/17177994 http://www.ncbi.nlm.nih.gov/pubmed?term=%22cameron%20m%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22chrubasik%20s%22%5bauthor%5d osteoarthritis. phytother res. 2009; 23: 1497-515. christensen r, bartels em, astrup a, bliddal h. symptomatic efficacy of avocado-soybean unsaponifiables (asu) in osteoarthritis (oa) patients: a meta-analysis of randomized controlled trials. osteoarthritis cartilage. 2008; 16: 399408. echtermeyer f, bertrand j, dreier r, meinecke i, neugebauer k, fuerst m, lee yj, song yw, herzog c, theilmeier g, pap t. syndecan-4 regulates adamts-5 activation and cartilage breakdown in osteoarthritis. nat med. 2009; 15: 1072-76. felson dt, lawrence rc, dieppe pa, hirsch r, helmick cg, jordan jm, kington rs, lane ne, nevitt mc, zhang y, sowers m, mcalindon t, spector td, poole ar, yanovski sz, ateshian g, sharma l, buckwalter ja, brandt kd, fries jf. osteoarthritis: new insights. part 1: the disease and its risk factors. ann intern med. 2000; 133: 635-46. getzy ll, malemud cj, goldberg vm, moskowitz rw. factors influencing metachromtic staining in paraffin-embedded sections of rabbit and human cartilage: a comparison of the safranin o and toluidine blue techniques. j histotechnol. 1982; 5: 111-16. goekoop rj, kloppenburg m, kroon hm, frölich m, huizinga tw, westendorp rg, gussekloo j. low innate production of interleukin-1beta and interleukin-6 is associated with the absence of osteoarthritis in old age. osteoarthritis cartilage. 2010; 18: 942-47. henrotin ye, sanchez c, deberg ma, piccardi n, guillou gb, msika p, reginster jy. avocado/soybean unsaponifiables increase aggrecan synthesis and reduce catabolic and proinflammatory mediator production by human osteoarthritic chondrocytes. j rheumatol. 2003; 30: 1825-34. hua b, o’brien k. osteoarthritis and chinese medicine: an overview of theories and evidence. j chinese med. 2010; 94: 1-14. ju xd, deng m, ao yf, yu cl, wang jq, yu jk, cui gq, hu yl. protective effect of sinomenine on cartilage degradation and chondrocytes apoptosis. yakugaku zasshi. 2010; 130: 1053-60. kut-lasserre c, miller cc, ejeil al, gogly b, dridi m, piccardi n, guillou b, pellat b, godeau g. effect of avocado and soybean unsaponifiables on gelatinase a (mmp-2), stromelysin 1 (mmp-3) and tissue inhibitors of matrix metalloproteinase (timp-1 and timp-2) secretion by human fibroblasts in culture. j periodontol. 2001; 72: 1685-94. lippiello l, nardo jv, harlan r, chiou t. metabolic effects of avocado/soy unsaponifiables on articular chondro -cytes. evid based complement alternat med. 2008; 5: 19197. maheu e, mazières b, valat jp, loyau g, le loët x, bourgeois p, grouin jm, rozenberg s. symptomatic efficacy of avocado/soybean unsaponifiables in the treatment of osteoarthritis of the knee and hip. arthritis rheum. 1998; 41: 81-91. pelletier jp, jovanovic d, fernandes jc, manning p, connor jr, currie mg, di battista ja, martel-pelletier j. reduced progression of experimental osteoarthritis in vivo by selective inhibition of inducible nitric oxide synthase. arthritis rheum. 1998; 41: 1275-86. pelletier jp, mineau f, faure mp, martel-pelletier j. imbalance between the mehanisms of activation and inhibition of metallo-proteases in the early lesions of experimental osteoarthristis. arthritis rheum. 1990; 33: 1466-76. pirotta m. arthritis disease– the use of complementary therapies. aust fam physician. 2010; 39: 638-40. roberts s, caterson b, menage j, evans eh, jaffray dc, eisenstein sm. matrix metalloproteinases and aggrecanase: their role in disorders of the human intervertebral disc. spine 2000; 25: 3005-13. schwager j, hoeller u, wolfram s, richard n. rose hip and its constituent galactolipids confer cartilage protection by modulating cytokine, and chemokine expression. bmc complement altern med. 2011; 11: 105. scott d, kowalczyk a. osteoarthritis of the knee. am fam physician. 2008; 77: 1149-50. tramèr mr, moore ra, reynolds dj, mcquay hj. quantitative estimation of rare adverse events which follow a biological progression: a new model applied to chronic nsaids use. pain 2000; 85: 169-82. wang hm, liu jn, zhao y. progress on integrated chinese and western medicine in the treatment of osteoarthritis. chin j integr med. 2010a; 16: 378-84. wang p, zhu f, lee nh, konstantopoulos k. shear-induced interleukin-6 synthesis in chondrocytes: roles of e prostanoid (ep) 2 and ep3 in camp/protein kinase aand pi3-k/ akt-dependent nf-kappab activation. j biol chem. 2010b; 285: 24793-804. yamanaka h, matsuda y, tanaka m, sendo w, nakajima h, taniguchi a, kamatani n. serum matrix metalloproteinase 3 as a predictor of the degree of joint destruction during the six months after measurement, in patients with early rheumatoid arthritis. arthritis rheum. 2000; 43: 85258. yoshioka m, coutts rd, amiel d, hacker sa. characterization of a model of osteoarthritis in the rabbit knee. osteoarthritis cartilage. 1996; 4: 87-98. 370 bangladesh j pharmacol 2013; 8: 365-370 author info jun wang (principal contact) e-mail: wangj79@hotmail.com http://www.ncbi.nlm.nih.gov/pubmed?term=%22christensen%20r%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22bartels%20em%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22christensen%20r%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22bartels%20em%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22christensen%20r%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=symptomatic%20efficacy%20of%20avocado-soybean%20unsaponifiables%20(asu)%20in%20osteoarthritis%20(oa)%20patients%3a%20a%20meta-analysis%20of%20randomized%20controlled%20trials http://www.ncbi.nlm.nih.gov/pubmed?term=echtermeyer%20f%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=neugebauer%20k%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=fuerst%20m%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=neugebauer%20k%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=fuerst%20m%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=neugebauer%20k%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=fuerst%20m%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=neugebauer%20k%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=fuerst%20m%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=neugebauer%20k%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=fuerst%20m%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=neugebauer%20k%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=fuerst%20m%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=pap%20t%5bauthor%5d&cauthor=true&cauthor_uid=19684582 http://www.ncbi.nlm.nih.gov/pubmed?term=felson%20dt%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=lawrence%20rc%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=felson%20dt%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=helmick%20cg%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=jordan%20jm%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=helmick%20cg%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=jordan%20jm%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=helmick%20cg%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=jordan%20jm%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=helmick%20cg%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=jordan%20jm%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=helmick%20cg%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=jordan%20jm%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=sowers%20m%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=sowers%20m%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=sowers%20m%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=sowers%20m%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=zhang%20y%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=sowers%20m%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=yanovski%20sz%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=ateshian%20g%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=yanovski%20sz%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=ateshian%20g%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=yanovski%20sz%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=ateshian%20g%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=yanovski%20sz%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=ateshian%20g%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=yanovski%20sz%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=ateshian%20g%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=fries%20jf%5bauthor%5d&cauthor=true&cauthor_uid=11033593 http://www.ncbi.nlm.nih.gov/pubmed?term=goekoop%20rj%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=kloppenburg%20m%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=goekoop%20rj%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=huizinga%20tw%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=westendorp%20rg%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=huizinga%20tw%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=westendorp%20rg%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=gussekloo%20j%5bauthor%5d&cauthor=true&cauthor_uid=20417290 http://www.ncbi.nlm.nih.gov/pubmed/20417290 http://www.ncbi.nlm.nih.gov/pubmed?term=%22henrotin%20ye%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22sanchez%20c%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22henrotin%20ye%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22sanchez%20c%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22henrotin%20ye%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22msika%20p%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22reginster%20jy%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=ju%20xd%5bauthor%5d&cauthor=true&cauthor_uid=20686209 http://www.ncbi.nlm.nih.gov/pubmed?term=deng%20m%5bauthor%5d&cauthor=true&cauthor_uid=20686209 http://www.ncbi.nlm.nih.gov/pubmed?term=ju%20xd%5bauthor%5d&cauthor=true&cauthor_uid=20686209 http://www.ncbi.nlm.nih.gov/pubmed?term=hu%20yl%5bauthor%5d&cauthor=true&cauthor_uid=20686209 http://www.ncbi.nlm.nih.gov/pubmed/20686209 http://www.ncbi.nlm.nih.gov/pubmed?term=kut-lasserre%20c%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=piccardi%20n%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=guillou%20b%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=piccardi%20n%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=guillou%20b%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=piccardi%20n%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=guillou%20b%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=pellat%20b%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=godeau%20g%5bauthor%5d&cauthor=true&cauthor_uid=11811504 http://www.ncbi.nlm.nih.gov/pubmed?term=lippiello%20l%5bauthor%5d&cauthor=true&cauthor_uid=18604259 http://www.ncbi.nlm.nih.gov/pubmed?term=nardo%20jv%5bauthor%5d&cauthor=true&cauthor_uid=18604259 http://www.ncbi.nlm.nih.gov/pubmed?term=metabolic%20effects%20of%20avocado%2fsoy%20unsaponifiables%20on%20articular%20chondrocytes http://www.ncbi.nlm.nih.gov/pubmed?term=maheu%20e%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=mazi%c3%a8res%20b%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=maheu%20e%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=mazi%c3%a8res%20b%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=maheu%20e%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=mazi%c3%a8res%20b%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=bourgeois%20p%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=grouin%20jm%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=bourgeois%20p%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=grouin%20jm%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=rozenberg%20s%5bauthor%5d&cauthor=true&cauthor_uid=9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=pelletier%20jp%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=connor%20jr%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=currie%20mg%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=connor%20jr%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=currie%20mg%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=connor%20jr%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=currie%20mg%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=connor%20jr%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=currie%20mg%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed?term=di%20battista%20ja%5bauthor%5d&cauthor=true&cauthor_uid=9663486 http://www.ncbi.nlm.nih.gov/pubmed/9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=pelletier%20jp%5bauthor%5d&cauthor=true&cauthor_uid=2171538 http://www.ncbi.nlm.nih.gov/pubmed?term=mineau%20f%5bauthor%5d&cauthor=true&cauthor_uid=2171538 http://www.ncbi.nlm.nih.gov/pubmed/9433873 http://www.ncbi.nlm.nih.gov/pubmed?term=%22pirotta%20m%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed/20877766 http://www.ncbi.nlm.nih.gov/pubmed?term=roberts%20s%5bauthor%5d&cauthor=true&cauthor_uid=11145811 http://www.ncbi.nlm.nih.gov/pubmed?term=jaffray%20dc%5bauthor%5d&cauthor=true&cauthor_uid=11145811 http://www.ncbi.nlm.nih.gov/pubmed?term=eisenstein%20sm%5bauthor%5d&cauthor=true&cauthor_uid=11145811 http://www.ncbi.nlm.nih.gov/pubmed?term=jaffray%20dc%5bauthor%5d&cauthor=true&cauthor_uid=11145811 http://www.ncbi.nlm.nih.gov/pubmed?term=%22schwager%20j%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22hoeller%20u%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22wolfram%20s%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22richard%20n%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed/22051322 http://www.ncbi.nlm.nih.gov/pubmed/22051322 http://www.ncbi.nlm.nih.gov/pubmed?term=tram%c3%a8r%20mr%5bauthor%5d&cauthor=true&cauthor_uid=10692616 http://www.ncbi.nlm.nih.gov/pubmed?term=moore%20ra%5bauthor%5d&cauthor=true&cauthor_uid=10692616 http://www.ncbi.nlm.nih.gov/pubmed?term=tram%c3%a8r%20mr%5bauthor%5d&cauthor=true&cauthor_uid=10692616 http://www.ncbi.nlm.nih.gov/pubmed?term=moore%20ra%5bauthor%5d&cauthor=true&cauthor_uid=10692616 http://www.ncbi.nlm.nih.gov/pubmed?term=tram%c3%a8r%20mr%5bauthor%5d&cauthor=true&cauthor_uid=10692616 http://www.ncbi.nlm.nih.gov/pubmed?term=%22wang%20hm%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22liu%20jn%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22zhao%20y%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed/20697952 http://www.ncbi.nlm.nih.gov/pubmed?term=%22wang%20p%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22zhu%20f%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22lee%20nh%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22konstantopoulos%20k%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=%22wang%20p%22%5bauthor%5d http://www.ncbi.nlm.nih.gov/pubmed?term=yamanaka%20h%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed?term=nakajima%20h%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed?term=taniguchi%20a%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed?term=nakajima%20h%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed?term=taniguchi%20a%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed?term=kamatani%20n%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed?term=nakajima%20h%5bauthor%5d&cauthor=true&cauthor_uid=10765930 http://www.ncbi.nlm.nih.gov/pubmed/9433873 materials and methods: gene length sequence of primers: dateprinted: this article was downloaded by you on: aug 27, 2018 bangladesh journal of pharmacology research article pharmacological basis for the medicinal use of psidium guajava leave in hyperactive gut disorders bjp introduction psidium guajava l. (family; myrtaceae) commonly known as “guava” is a native of tropical america and has long been naturalized in southeast asia. different parts of the plant have been used in the indigenous system of medicine for the treatment of various human disorders. the decoction of young leaves and shoot is prescribed as spasmolytic in diarrhea (lozoya et al., 1994; duke, 2002; de wet et al., 2010). phytochemical analysis has resulted the isolation and identification of various terpenoids, flavonoids and tannins (lozoya et al., 1994). two of pentacyclic triterpenoids of the ursane series, namely ursolic acid, 2α-hydroxyursolic acid, oleanolic acid, maslinic acid and arjunolic acid (osman et al., 1974) were reported earlier. among the major constituents are quercetin, myricetin, luteolin and kaempferol (guti´erreza et al., 2008). psidium guajava has been studied for its effect in hyperactive gut disorders, particularly diarrhea and spasm. it has been reported that its leaf extract possesses antidiarrheal (ojewole et al., 2008) and spasmolytic (tona et al., 2000) activities. additionally, the plant extract also possessed, antimalarial (ponce et al., 1994) activity. in either study, the precise mode of action related to its antidiarrheal and/or antispasmodic effect is not yet clearly understood. this investigation was aimed to explore the underlying mechanism responsible for the medicinal use of p. guajava in diarrhea and gut spasm. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2011; 6: 100-105 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 pharmacological basis for the medicinal use of psidium guajava leave in hyperactive gut disorders abdul jabbar shah1,2, sabira begum3, syed imran hassan3, syed nawazish ali3, bina s. siddiqui3 and anwarul-hassan gilani1 1natural products research division; department of biological and biomedical sciences, the aga khan university medical college, karachi 74800, pakistan; 2department of pharmacy, comsats institute of information technology, abbottabad 22060, pakistan; 3hej research institute of chemistry, international center for chemical and biological sciences, university of karachi, karachi 75270, pakistan. abstract psidium guajava l. is reputed for its medicinal use in hyperactive gut disorders. this study was aimed to investigate mechanism responsible for its medicinal use in diarrhea and gut spasm. in castor oil-induced diarrheal model, the crude extract of p. guajava (100-1,000 mg/kg), provided 20.5-81.1% protection, similar to loperamide. in isolated rabbit jejunum preparations, crude extract was found more potent against high k+ than spontaneous precontractions, similar to verapamil, with ec50 values of 0.7 (0.4-1.0; n = 8) and 2.3 mg/ml (1.4-3.6; n = 8), respectively, suggests calcium channel blocking activity, as a possible mode of action. the ca++ channel blocking activity was further confirmed when pre-treatment of tissue with crude extract (0.3-1 mg/ ml) caused a rightward shift in the ca++ concentration-response curves, similar to verapamil. loperamide also inhibited spontaneous and high k+induced contractions and shifted the ca++ curves to the right. these data indicate that crude extract of p. guajava possesses ca++ antagonist-like constituent(s), which explain its inhibitory effect on gut motility. article info received: 6 october 2011 accepted: 12 october 2011 available online: 8 december 2011 doi: 10.3329/bjp.v6i2.8692 cite this article: shah aj, begum s, hassan si, ali sn, siddiqui bs, gilani ah. pharmacological basis for the medicinal use of psidium guajava leave in hyperactive gut disorders. bangladesh j pharmacol. 2011; 6: 100-105. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work . you must attribute the work in the manner specified by the author or licensor. materials and methods plant materials and extraction of crude extract fresh leaves (20.0 kg) of p. guajava were collected from karachi region and authenticated by dr. mohammad qaiser, department of botany, university of karachi, karachi, pakistan. a voucher specimen (kuh-gh no. 53976) has been deposited in the herbarium of the same department. plant material free of adulterants were repeatedly extracted (3 times) with etoh at room temperature and the combined extract was evaporated in rotary evaporator at 35-40°c to a semisolid mass, the crude extract of p. guajava. the extract was solubilized in normal saline and distilled water for the in vivo and in vitro experiments, respectively. drugs and standards the following reference chemicals were obtained from the sources specified: acetylcholine chloride, loperamide hydrochloride, verapamil hydrochloride, potassium chloride (sigma chemical company, u.s.a.) and castor oil (karachi chemical industries, pakistan). all chemicals used were of the highest purity grade. stock solutions of all the chemicals were made in distilled water and the dilutions were made fresh in normal saline on the day of experiment. animals experiments performed complied with the rulings of the institute of laboratory animal resources, commission on life sciences, national research council (national research council, 1996) and were approved by the ethical committee of the aga khan university, karachi, pakistan. balbc mice (20-25 g) and local rabbits (1.5-2 kg) of either sex used in the study were bred and housed in the animal house of the aga khan university under controlled environment (23-25°c). animals were given tap water ad libitum and a standard diet. castor oil-induced diarrhea the in vivo antidiarrheal activity of the extract was conducted following the methods previously described (awouters et al., 1978; jebunnessa, 2009; shah et al., 2011). in the present study balbc albino mice were fasted for 18 hours. the animals divided in five groups, housed in five steel cages with five in each and the bottom of each cage was covered with blotting sheet. the first group received saline as the vehicle control (10 ml/kg, orally) and acted as the negative control. the doses of the crude extract were selected on a trial basis and administered orally (100, 300 and 1,000 mg/kg) by intra-gastric feeding needle as a suspension to three groups of animals. the fifth group received loperamide (10 mg/kg) orally, which served as a positive control. one hour after treatment, each animal received 10 ml/ kg of castor oil orally and was then observed for defecation. the presence of diarrheal droppings was noted in blotting sheets in the individual cages for 4 hours after challenged with castor oil. percent protection against the castor oil-induced diarrhea was calculated based on the number of dry feces in each cage in comparison to the wet. isolated tissue preparations the isolated tissue experiments were carried out, as previously described (gilani et al., 2005; shah et al., 2011). rabbits had free access to water but were fasted for 24 hours before the experiment. the animals were sacrificed by cervical dislocation, the abdomen was cut open and the jejunal portion isolated out. preparations 2 cm long were mounted in 10 ml tissue baths containing tyrode’s solution maintained at 37°c and aerated with a mixture of 5% carbon dioxide in oxygen (carbogen). the composition of tyrode’s, in mm, was: kcl 2.7, nacl 136.9, mgcl2 1.1, nahco3 11.9, nah2po4 0.4, glucose 5.6 and cacl2 1.8 (ph 7.4). a preload of 1 g was applied to each tissue and were kept undisturbed for an equilibrium period of 30 min. after equilibration, control responses to a sub-maximal concentration of acetylcholine (0.3 mm) were obtained and the tissue presumed stable only after the reproducibility of the said responses. under these experimental conditions, rabbit jejunum exhibits spontaneous rhythmic contractions, allowing testing the relaxant (spasmolytic) activity directly without the use of an agonist or spasmogen (gilani et al., 2005). determination of calcium antagonist activity to assess whether the spasmolytic activity of the test substances was mediated through ca++ channel blockade, high concentration of k+ (80 mm), as kcl, was used to depolarize the preparations (farre et al., 1991), which produced a sustained contraction. plant extract and standards were then added in a cumulative fashion to obtain concentration-dependent inhibitory responses. the relaxation of intestinal preparations, pre -contracted with k+ was expressed as percent of the control pre-contraction. to confirm the ca++ antagonist activity of test substances, the tissues were allowed to stabilize in normal tyrode’s solution, which was then replaced with ca++free tyrode’s solution containing edta (0.1 mm) for 30 min in order to remove ca++ from the tissues. this solution was further replaced with k+-rich and ca++free tyrode's solution, having the following composition: kcl 50, nacl 91.04, mgcl2 1.05, nahco3 11.90, nah2po4 0.42, glucose 5.55 and edta 0.1 mm. following an incubation period of 30 min, control concentration-response curves of ca++ were obtained. when the control curves of ca++ were found superimposable (usually after two cycles), the tissue were then pretreated with the plant extract for 60 min to test bangladesh j pharmacol 2011; 6: 100-105 101 the possible ca++ channel blocking effect. the ca++ curves were reconstructed in the presence of different concentrations of the test material. statistics all the data expressed are mean ± standard error of the mean (sem) and the median effective concentrations (ec50) values are given with 95% confidence intervals (ci). the statistical parameter applied is the student ttest with p<0.05 noted as significantly different (graphpad program, graphpad, san diego, ca, usa) and concentration response curves were analyzed by non-linear regression (graphpad program). results and discussion based on the medicinal use of p. guajava in hyperactive gut disorders, such as diarrhea and spasm (lozoya et al., 1994; duke, 2002; de wet et al., 2010), its crude extract was screened for antidiarrheal effect in mice. the crude extract provided protection from diarrhea in castor oil-induced diarrhea, similar to loperamide, a standard antidiarrheal agent (reynolds et al., 1984). both extract and loperamide inhibited significantly (p<0.05) the frequency of defecation as well as wetting of feces when compared with the untreated group (i.e. mice received neither crude extract, nor loperamide, but castor oil only). the percent protection provided by the crude extract and loperamide was 20.5-81.1% and 97.3%, respectively (table i). verapamil, a standard calcium channel blocker (godfraind et al., 1986) also provided protection (35.6-82.3%) from castor oilinduced diarrhea. the induction of diarrhea by castor oil results from the action of recinoleic acid formed in the hydrolysis of the oil (iwao and terada, 1962), which produces changes in the transport of water and electrolytes resulting in a hypersecretory response and generation of a giant contraction of the intestine (croci et al., 1997). thus, a potential antidiarrheal agent may exhibit its antidiarrheal effect by inhibiting either gut motility and or electrolyte out flux (diarrheal droppings; croci et al., 1997). the protective effect of the crude extract against the castor oil-induced diarrhea in mice, similar to loperamide and verapamil, suggests that it has an inhibitory effect either on contraction and or on electrolyte out flux. there are studies available on the antidiarrheal and antispasmodic activities of the crude extract of p. guajava showing that the antidiarrheal effect of the extract was attributed either to its antibacterial (coutino et al., 2001; neira and ramirez, 2005), antisecretory (gutierrez et al., 2008) or spasmolytic (morales et al., 1994; ojewol et al., 2008) activities. morales et al. (1994) reported that the spasmolytic effect of quercetin, one of the major constituents of all parts of p. gujava, may be responsible for the intestinal inhibitory activity and hence for the antidiarrheal action. however, ojewol et al. (2008) attributed atropine-like spasmoyltic activity of crude extract to its antidiarrheal effect. to probe the precise mechanism of the spasmolytic effect of the extract, further study was carried out on gut motility in isolated spontaneously contracting rabbit jejunum, where cumulative addition of crude extract, loperamide and verapamil caused concentration-dependent inhibition of the spontaneous contractions (figure 1), with ec50 values of 2.28 mg/ml (1.4-3.6), 1.6 µm (1.2-2.2) and 0.2 µm (0.1-0.3), respectively (figure 2). this shows smooth muscle relaxant (spasmolytic) activity. the contraction of smooth muscle preparations, including rabbit jejunum, is depend upon an increase in the cytoplasmic free [ca++], which activates the contractile elements (karaki and weiss, 1983). the increase in intracellular ca++ occurs either via influx through voltage-dependent ca++ channels or its release from 102 bangladesh j pharmacol 2011; 6: 100-105 table i effect of the crude extract of the leaves of psidium gujava, verapamil and loperamide on castor oil-induced diarrhea in mice group dose total number of feces in 4 hours total number of wet feces in 4 hours protection (%) control (saline) 10 ml/kg 14.8 ± 1.1 0.2 ± 0.3 99.3 ± 0.9 castor oil 10 ml/kg 11.8 ± 0.8 11.6 ± 0.8 1.3 ± 0.8 + extract 100 mg/kg 19.8 ± 1.0 14.2 ± 1.0 20.5 ± 1.2a + extract 300 mg/kg 20.8 ± 1.1 9.2 ± 0.6 39.7 ± 3.2b + extract 1,000 mg/kg 13.8 ± 1.2 2.4 ± 0.9 81.1 ± 3.2c + verapamil 3 mg/kg 11.8 ± 1.7 64.5 ± 0.9 35.6 ± 3.5a + verapamil 10 mg/kg 13.8 ± 1.7 40.4 ± 4.6 59.6 ± 4.6b + verapamil 30 mg/kg 18.2 ± 3.3 17.7 ± 4.5 82.3 ± 4.5c + loperamide 10 mg/kg 8.8 ± 1.2 0.4 ± 0.3 97.3 ± 1.7 mean ± sem; n = 5; ap<0.05, bp<0.01, cp<0.001 vs. control, student’s t-test intracellular stores in the sarcoplasmic reticulum. periodic depolarization and repolarization regulates the spontaneous movements of the intestine and at the height of depolarization, the action potential appears as a rapid influx of ca++ via voltage dependent channels (brading, 1981). thus, the inhibitory effect of crude extract on spontaneous movements of rabbit jejunum may appear to be due to a ccb effect, possibly, due to interference of ca++ influx through ca++ channels. we previously observed that the spasmolytic constituents present in different medicinal plants mediate their effect usually through a ccb effect (gilani et al., 2005; shah et al., 2010; shah et al., 2011). to see, whether the spasmolytic effect of the p. guajava observed in this study is also mediated through a ca++ antagonist-like effect, a high concentration of k+ (80 mm) was added to the tissues bath, which is known to produce sustained contraction through opening of voltage dependent ca++ channels. the crude extract was then added in a cumulative fashion, where it was found more potent against high k+ pre-contractions than spontaneous contractions, with respective ec50 value of 0.7 mg/ml (0.4-1.0), similar to verapamil and loperamide (figure 2). a substance, which can inhibit high k+-induced contractions is therefore, possibly considered to be a ca++ antagonist (godfraind et al., 1986). thus, the inhibition of high k+ pre-contractions of rabbit jejunum by crude extract may reflect the restricted ca++ entry via voltage-dependent channels. this hypothesis was further strengthened when pre-treatment of the tissues with plant extract (0.3 -1 mg/ml) caused a rightward shift in the ca++ curves (figure 2), similar to verapamil. pretreatment of the tissues with loperamide also caused a rightward shift in the ca++ curves (figure 2), which is in accordance to its known ca++ antagonist effect at antidiarrheal doses (reynolds et al., 1984). these data indicate that plant extract possesses a ca++ antagonist effect, similar to verapamil or loperamideand and thus provides sound pharmacological basis to its antidiarrheal and antispasmodic effects, as the ca++ antagonists are considered useful in diarrhea and gut spasms (brunton, 1996). this is the first functional study of its kind on the gut motility with possible mode of action explored and the earlier studies on antibacterial action of the plant is of added benefit to the plant, thus making the plant more effective in a diarrhea of wide range etiology including infectious and non-infectious. in summary, this study shows that the crude extract of psidium guajava possesses antidiarrheal along with antispasmodic effects, mediated possibly through ca++ channel blockade, which provides sound pharmacological base to its medicinal use in diarrhea and gut bangladesh j pharmacol 2011; 6: 100-105 103 control psidium gujava loperamide verapamil 0.1 0.3 1 3 (µm) 3 10 30 100 (µm) 0.03 0.1 0.3 1 (µm) 1 min figure 1: a typical tracing showing the spasmolytic effects of the crude extract of p. gujava, loperamide and verapamil on spontaneous contractions in isolated rabbit jejunum preparation spasms, though additional mechanism(s) cannot be ruled out. acknowledgement this study was carried out with the partial support from the higher education commission, government of pakistan. references awouters f, niemegeers cje, lenaerts fm, janssen paj. delay of castor oil diarrhea in rats, a new way to evaluate inhibitors of prostaglandin biosynthesis. j pharm pharmacol. 1978; 30: 41-45. brading af. how do drugs initiate contraction in smooth muscles? trends pharmacol sci. 1981; 2: 261-65. brunton ll. agents affecting gastrointestinal water flux and motility; emesis and antiemetics; bile acids and pancreatic enzymes. in: goodman and gillman’s the pharmacological basis of therapeutics. hardman jg, limbird le, molinoff pb (eds). new york, mcgraw hill, 1996. croci t, landi m, almond-alt x, le f, maffrand jp, manara l. role of tachykinins in castor oil induced diarrhea in rats. br j pharmacol. 1997; 121: 375-80. coutino rr, hern´andez cp, giles rh. lectins in fruits having gas-trointestinal activity: their participation in the hemagglutinating property of escherichia coli o157:h7. arch med res. 2001; 32: 251-57. de wet h, nkwanyana mn, van vuuren sf. medicinal plants used for the treatment of diarrhea in northern maputaland, kwazulu-natal province, south africa. j ethnopharmacol. 2010; 130: 284-89. duke ja. handbook of medicinal herbs. london, crc press, 2002. farre aj, columbo m, fort m, gutierrez b. differential effects of various ca++ antagonists. gen pharmacol. 1991; 22: 177-81. gilani ah, shah aj, muhammad ng, kashif m. pharmacological basis for the use of turmeric in gastrointestinal and respiratory disorders. life sci. 2005; 76: 3089-3105. godfraind t, miller r, wibo m. calcium antagonism and calcium entry blockade. pharmacol rev. 1986; 38: 321-416. guti´erreza rmp, mitchell s, solis rv. psidium guajava: a review of its traditional uses, phytochemistry and pharmacology. j ethnopharmacol. 2008; 117: 1-27. iwao i, terada y. on the mechanism of diarrhea due to castor 104 bangladesh j pharmacol 2011; 6: 100-105 a b c d e f figure 2. concentration-response curves of; (a) the crude extract of psidium gujava (pg.cr), (c) loperamide, and (e) verapamil on spontaneous and high k+ (80 mm)-induced contractions. (b, d and f) depict the effect on ca++ concentration-response curves in the absence and presence of different concentrations of pg.cr, loperamide and verapamil, respectively, in isolated rabbit jejunum preparations. values shown are + sem (n = 5-7) oil. jap j pharmacol. 1962; 12: 137-45. jebunnessa, uddin sb, mahbub-uz-zaman m, akter r, ahmed nu. antidiarrheal activity of ethanolic bark extract of mitragyna diversifolia. bangladesh j pharmacol. 2009; 4: 144-46. karaki h, weiss g. calcium release in smooth muscles. life sci. 1983; 42: 111-22. lozoya x, meckes m, abou-zaid m, tortoriello j, nozzolillo c, arnason jt. quercetin glycosides in psidium guajava l. leaves and determination of a spasmolytic principle. arch med res. 1994; 25: 11-15. morales ma, tortoriello j, meckes m, paz d, lozoya x. calcium-antagonist effect of quercetin and its relation with the spasmolytic properties of psidium guajava l. arch med res. 1994; 25: 17-21. national research council. guide for the care and use of laboratory animals. washington dc, national academy press, 1996. neira ga, ramirez gmb. actividad antimicrobiana de extractos de dos especies de guayaba contra sterptococcus mutans y escherichia coli. actualidades biologicas. 2005; 27: 27-30. ojewole ja, awe eo, chiwororo wd. antidiarrheal activity of psidium guajava linn. (myrtaceae) leaf aqueous extract in rodents. j smooth muscle res. 2008; 44: 195-207. osman am, younes me, sheta ae. triterpenoids of the leaves of psidium guajava. phytochemistry 1974; 13: 2015-16. reynolds ij, gould rj, synder sh. loperamide blockade of calcium channel as mechanism for antidiarrheal effects. j exp pharmacol ther. 1984; 231: 628-32. shah aj, bhulani nn, khan sh, gilani ah. antidiarrhoeal and antispasmodic effects of mentha longifolia are mediated through calcium channel blockade. phytother res. 2010; 24: 1392-97. shah aj, zaidi ma, hamidullah sh, gilani ah. antidiarrheal and antispasmodic activities of vincetoxicum stocksii are mediated through calcium channel blockade. bangladesh j pharmacol. 2011; 6: 46-50. tona l, kambu k, ngimbi n, mesia k, penge o, lusakibanza m, cimanga k, de bruyne t, apers s, totte j, pieters l, vlietinck aj. antiamoebic and spasmolytic activities of extracts from some antidiarrheal traditional preparations used in kinshasa, congo. phytomedicine 2000; 7: 31-38. bangladesh j pharmacol 2011; 6: 100-105 105 author info anwarul-hassan gilani (principal contact) e-mail: anwar.gilani@aku.edu dateprinted: this article was downloaded by you on: may 20, 2018 bangladesh journal of pharmacology research article antiobesity effect of bauhinia variegata bark extract on female rats fed on hypercaloric diet bjp introduction obesity is a growing health problem in many of the nations of the world. with a body mass index (bmi) above 30, increased risk of non-insulin dependent diabetes mellitus, hypertension, hypertriglyceridemia and ischemic heart disease is prominent (farooqi et al., 2003). obese subjects also carry an increased risk of colon, breast, prostate, gall bladder, ovary and uterine cancer. since many factors influence energy balance, and they interact at many levels, determining the pathophysiology of obesity is difficult. the main determinant is a disturbance of the homeostatic mechanisms that control energy balance. other factors such as food intake and lack of physical activity also contribute. bauhinia variegata linn has been extensively used as indian traditional and folklore medicine to cure various human ailments. the stem contains some important phytoconstituents like p-sitosterol, lupeol, kaempferol-3 -glucoside and the root bark contains flavones. traditionally, a decoction is given in piles (also used against tumors), hematuria, and menorrhagia. root is carminative, used in dyspepsia and flatulence and a decoction is used to prevent obesity (khare, 2007). the ethanolic extract of b. variegata was reported to possess antitumor effect in dalton's ascitic lymphomas, antiulcer activity (rajkapoor et al., 2003a), chemo preventive and cytotoxic effect in liver tumor against diethyl nitrosamine (rajkapoor et al., 2006), anti arthritic activity (rajkapoor et al., 2007) and hepatoprotective activity (bodakhe and ram, 2007). the methanol extract possess significant antibacterial effect (chanda et al., 2006). the traditional folklore claim of the plant encouraged us to investigate the antiobesity activity of this plant. abstract the present study was carried out to investigate the antiobesity effect of methanolic extract of stem and root barks of bauhinia variegata linn in female rats fed with hypercaloric diet. obesity was induced by administration of hypercaloric diet for 40 days. the plant extract (at the tested doses of 200 and 400 mg/kg body weight) exhibited a significant hypolipidemic effect and thus reduced the obesity. the body weight and feed intake was reduced significantly. treatment of obese animals with the methanolic extract of b. variegata exhibited an increased brain serotonin level and high density lipoprotein with a concomitant decrease in total cholesterol, triglycerides and low density lipoprotein. thus, the study indicates that the antiobesity activity of methanolic extract of b. variegata could be attributed to the presence of p sitosterol in the stems and the tendency of the extract to reduce lipid profile and elicit the brain serotonin level. article info received: 30 january 2010 accepted: 15 march 2010 available online: 20 april 2010 doi: 10.3329/bjp.v5i1.4310 cite this article: balamurugan g, muralidharan p. antiobesity effect of bauhinia variegata bark extract on female rats fed on hypercaloric diet. bangladesh j pharmacol. 2010; 5: 8-12. antiobesity effect of bauhinia variegata bark extract on female rats fed on hypercaloric diet g. balamurugan and p. muralidharan department of pharmacology and toxicology, c. l. baid metha college of pharmacy, old mahabalipuram road, jyothi nagar, thoraipakkam, chennai 97,tamil nadu, india. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2010; 5: 8-12 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded and social sciences citation index issn: 1991-0088 materials and methods plant material root and stem barks of b. variegata was collected from thirunelveli district, tamil nadu, india during july 2007. the plant material was identified by dr. sasikala ethirajulu, research officer, ccras, govt. of india, chennai. a voucher specimen was deposited at c.l. baid metha college of pharmacy, chennai, tamil nadu, india for future reference. preparation of extract freshly collected root and stem barks of b. variegata were dried in shade and pulverized to a coarse powder. weighed quantity of powder was extracted with methanol in a soxhlet apparatus, the filtrate obtained was evaporated to dryness at 40-50°c in a rotary vacuum evaporator to obtain a dark colored molten mass. the percentage yield was found to be 8.8% w/w. experimental animals in bred female wistar rats weighing 150-160 g obtained from the animal house of c.l. baid metha college of pharmacy were used in the study. the animals were maintained in well ventilated rooms with 12:12 hours light/dark cycle in polypropylene cages. all animals were acclimatized to the laboratory conditions one week prior to the initiation of the study. acute toxicity studies wistar rats weighing 200-250 g (n=3) were use in the procedure. acute oral toxicity was performed as oecd423 guidelines (ecobichon, 1997). the animals were fasted overnight, provided only water, after which extract was administered to the animals orally at the dose of 5 mg/kg body weight by gastric intubation and the animals were observed for 24 hours. if mortality was observed in 2 or 3 animals, then the dose administered was assigned as a toxic dose. if mortality was observed in one animal, then the same dose was repeated again to confirm the toxic dose. if mortality was not observed, the procedure was repeated for further higher doses such as 50, 300 and 2,000 mg/kg body weight. the animals were observed for toxic symptoms such as behavioral changes, locomotion, convulsions and mortality for further 72 hours. induction of experimental obesity basal diet (rodent feed) was obtained from pranav agro industries, sangli, to which the following constituents were added to prepare hypercaloric diet (hcd): casein -20%; d-l-methionine0.3%; corn starch15%; sucrose27.5%; cellulose powder5%; mineral mixture3.5%; vitamin mixture1%; choline bitartarate0.2%; coconut oil-9.9% and lard oil-17.6% (vasselli et al., 2005). animal grouping the animals were divided into five groups containing six animals each. group i served as control; group ii received hcd; group iii received hcd and methanolic extract of b. variegata 200 mg/kg body weight; group iv hcd and methanolic extract of b. variegata 400 mg/kg body weight and group v received hcd and sibutramine 5 mg/kg body weight for 40 days. replenishing a known quantity of fresh food daily at 10.30 a.m. and thereby measuring the food intake of the previous day carried out measurement of daily food consumption. body weight of rats was recorded weekly to assess percentage of weight gain in each group. the daily feed intake for groups of animals were measured everyday for 40 days and expressed as mean daily feed intake in gram. general well being and behavior of the animals were observed daily throughout the period of study. the litter in the cage was renewed twice a week to ensure maximum comfort for the animals. the body rectal temperature were recorded post-treatment on day 41 in order to measure thermogenesis. estimation of lipid profile on day 41, the animals were sacrificed by cervical dislocation and blood samples were collected by carotid bleeding separately into sterilized dry centrifuge tubes and allowed to stand for 30 min at 37°c. the clear serum was separated at 2,500 rpm for 10 min and was used for the estimation of total cholesterol by chodpap method (siedel et al., 1983), high density lipoprotein (hdl) cholesterol by peg-chod-pap method (warnick and wood, 1995) and triglycerides by gpopap method (mcgowan et al., 1983) using standard kits. ldl-cholesterol, vldl-cholesterol and the atherogenic index was calculated using standard equations (friedwald et al., 1972). the percentage of lipid lowering effect was calculated according to the equation mentioned elsewhere (puri et al., 2007): estimation of serotonin serotonin level in rat brain was carried out by spectrofluorimetry. the whole brain was dissected out and the striatum and hippocampus was separated from the brain and homogenized in 3 ml hcl-butanol (0.9 ml of 37% hydrochloric acid in 1l n-butanol for spectroscopy) for 1 min in a cool environment. the sample was then centrifuged at 2,000 rpm for 10 min. supernatant phase 0.8 ml was removed and added to an eppendorf reagent tube containing 2 ml of heptane and 0.3 ml of 0.1 m hcl. after 10 min of vigorous shaking, the tube was centrifuged to separate two phases. upper organic phase was discarded and the aqueous phase was used for serotonin assay. 0.5 ml of tissue and 0.6 ml of ortho-pthalaldihyde was heated to 100°c for 10 min to develop fluorophore. after the samples reached equilibrium with ambient temperature, excitation/emission spectra readings were taken bangladesh j pharmacol 2018; 5: 8-12 9 at a wavelength 360-470 nm in a spectrofluorometer (schlumpf et al., 1974). statistical analysis one-way analysis of variance (anova) followed by dunnet's t-test for determining the statistical significance of difference between experimental groups. the minimum level of significance was set at p<0.05. results methanolic extract of b. variegata (mebv) did not produce any toxic symptom or mortality upto the dose level of 2,000 mg/kg body weight orally in rats and hence the extract was considered safe for further pharmacological screening. according to oecd-423 guidelines for acute oral toxicity, the ld 50 dose of 2,000 mg/kg is categorized as unclassified. group ii animals fed on hypercaloric diet exhibited a nonsignificant rise in body weight between day 1 and 40 as compared to group i animals. treatment with mebv (200 and 400 mg/kg body weight) exhibited a insignificant decrease in body weight of the animals in comparison with group ii animals. the standard drug sibutramine (5 mg/kg body weight) produced a reduction in body weight of the animals but statistically not significant (figure 1). the body rectal temperature were recorded post treatment on day 41 and was found to be elevated in groups iii, iv and v, but was statistically not significant (figure 2). similarly the animals fed on hcd showed an increased feed seeking behavior when compared to all the other group of animals. animals treated with mebv (200 and 400 mg/ kg body weight) and sibutramine (5 mg/kg) had a decreased feed consumption (p<0.001) than group ii animals (figure 3). administration of mebv at 200 mg/ kg orally to obesity induced animals resulted in a decreased total cholesterol (21.8%), triglycerides (10.6%), ldl-c (24.1%), vldl-c (10.6%) and a increased hdl-c (5.9%). with a dose of 400 mg/kg mebv, a further reduction occurred in total cholesterol (33.0%), triglycerides (16.5%), ldl-c (36.0%), vldl-c (16.6%) and an increased hdl-c (15.2%). sibutramine produced 41.9% reduction in total cholesterol and 23.2% reduction in triglyceride levels (table i). animals fed on hcd had a reduced level of serotonin in brain tissues (p<0.01) than the group i animals. treatment with mebv restored the decreased level of serotonin in a dose-dependent manner (p<0.01) when compared to group ii animals. sibutramine produced an increased serotonin level comparable to control animals (p<0.01; table ii). discussion in the present study, the antiobesity effect of barks of b. variegata was studied using dietary animal models of table i effect of b. variegata on serum lipid parameters group total cholesterol triglycerides hdl-cholesterol ldl-cholesterol vldl-cholesterol i 110.4 ± 1.6 173.0 ± 2.2 43.2 ± 0.9 84.4 ± 0.3 34.6 ± 2.0 ii 214.1 ± 2.4a*** 250.2 ± 4.6a*** 32.4 ± 1.1a*** 170.5 ± 0.5a*** 50.0 ± 2.1a*** iii 167.4 ± 0.9b*** 223.7 ± 2.2b*** 34.5 ± 0.4bns 129.5 ± 0.2b*** 44.7 ± 1.1bns iv 143.5 ± 0.7b*** 208.8 ± 2.7b*** 37.4 ± 0.4 b*** 109.2 ± 0.1b*** 41.8 ± 1.2b** v 124.4 ± 0.5b*** 192.2 ± 1.8b*** 40.4 ± 0.6 b*** 94.0 ± 0.2b*** 38.4 ± 0.4b*** values are expressed as mean ± sem, n = 6; comparisons: agp i vs gp ii, bgp ii vs gp iii & iv; ns; non significant; ***p<0.001; one-way anova followed by dunnet’s “t” test table ii effect of b. variegata on brain serotonin levels group serotonin i 375 ± 10.8 ii 175 ± 5.4a** iii 225 ± 7.9b** iv 257 ± 7.7b** v 328 ± 7.5b** values are expressed as mean ± sem, n = 6; comparisons: agp i vs gp ii, bgp ii vs gp iii & iv; ns; non significant; **p<0.01; one-way anova followed by dunnet’s “t” test w ei gh t i n g ra m s day 1 day 1 260 240 220 200 180 160 140 group i group ii group iii group iv group v figure 1: body weight variation between animal groups 10 bangladesh j pharmacol 2018; 5: 8-12 obesity as they have been reported to bear close resemblance to human obesity (sclafani and springer, 1976). the results of our study showed that rats fed with a hcd elicited significant increase in body weight. cafeteria diets have been previously reported to increase energy intake and cause obesity in humans (bull, 1988) and in animals (rothwellet et al., 1983). further the composition and variety of cafeteria foods also exert synergistic effects on the development of obesity. in our study, hypercaloric diet exhibited an increased body weight along with corresponding rise in cholesterol levels which was promptly reduced by the administration of mebv at the respective dosage levels. the weight reducing effect may be attributed to its potential to inhibit lipogenesis and enhanced thermogenesis, since obesity is associated with defective thermogenesis (pasquali and casimirri, 1993). the increased rectal body temperature may be attributed to the overall stimulant and thermogenic property of the phytoconstituents present in the extract. mebv may offer enormous therapeutic potential for the treatment of obesity at the tested doses, as evident from the reduced levels of total cholesterol and triglycerides. inclusion of saturated fatty acids in the diet has been shown to induce hypercholesterolemic effect in rats (zulet et al., 1999). the coconut oil included in the diet in this study contains saturated fatty acids and this could account for the difference in increase in the accumulation of cholesterol in the liver in this study. it is possible that the normal catabolism of liver lipids was impaired in the rats fed with modified diet with consequent accumulation of lipids in liver. the presence of phytoconstituents such as oleic acid, β-sitosterol is reported to reduce the hyperlipidemic states (boppanna et al., 1997) and such components are previously reported in b. variegata (khare, 2007). obesity is linked to high intake of diet and dietary fats. microinjection of serotonergic agents directly into paraventricular nucleus reduces the intake of carbohydrates and fats. this phenomenon of diet induced obesity in rats is a reliable model in which daily energy intake is markedly increased largely through an increase in the meal size. the standard drug sibutramine used in our study is a noradrenergic/serotonergic agent, which acts primarily by affecting appetite centre and satiety centre respectively. it affects food intake by enhancing serotonergic transmission in the hypothalamus and reduced food seeking behavior as well as decreases quantity of food consumed at any meal (tripathi, 2004), thus the role of serotonin in controlling appetite is evident. estimation of brain tissue serotonin in our study evidenced increased level of it and thus attributable to the reduced feed seeking behavior and reduction in body weight. also, 5-ht modulators are reported to possess significant beneficial effects on dyslipidemia in conditions of syndrome x (james et al., 2000). sibutramine was reported to possess significant lipid lowering activity associated with hyperglycemia and hyperinsulinemia (james et al., 2000; finer et al., 2000) and was also reported to reduce body weight in conditions of syndrome x (mclaughlin et al., 2001). similarly it appears that the beneficial effect obtained by b. variegata is similar to 5ht receptor modulator sibutramine. conclusion this study shows that b. variegata may be useful in conditions of hyperlipidemia and obesity as it can reduce the elevated cholesterol, triglyceride, vldl cholesterol levels and body weight. financial support self-funded ethical issue the study proposal was approved by institutional animal t em pe ra tu re in d eg re e ce lc iu s 40 38 36 34 32 0 30 60 90 120 time (min) figure 2: body temperature of animals post-treatment group i group ii group iii group iv group v figure 3: feed intake per day of animal groups bangladesh j pharmacol 2018; 5: 8-12 11 author info g. balamurugan (principal contact) e-mail: balamurugangunasekaran @gmail.com ethical committee constituted under cpscea. all animal experiments were carried out according to the law of animal experiments guidelines approved by national institute of health (nih). conflict of interest authors declare no conflict of interest references bodakhe sh, ram a. hepatoprotective properties of bauhinia variegata bark extract. yakugaku zasshi. 2007; 127: 1503-07. boppanna kn, bhagyalakshmi n, rathod sp, balaraman r, kannan j. cell culture derived hemisdesmus indicus in the prevention of hypercholesterolemia in normal and hyperlipidemic rats. ind j pharmacol. 1997; 29: 105-09. bull nl. studies of the dietary habits, food consumption and nutrient intakes of adolescents and young adults. world rev nutr diet. 1988; 57: 24-74. chanda s, karathia n, parekh j. screening of some traditionally used medicinal plants for potentially anti bacterial activity. ind j pharm sci. 2006; 68: 832-34. ecobichon dj. the basis of toxicology testing. new york, crc press, 1997. farooqi is, keogh jm, yeo gs, lank ej, cheetham t, o'rahilly s. clinical spectrum of obesity and mutations in the melanocortin 4 receptor gene. new eng j med. 2003; 348: 1085-95. finer n, james wp, kopelman pg, lean me, williams g. one year treatment of obesity: a randomized double blind, placebo controlled, multicentre study of orlistat, a gastrointestinal lipase inhibitor. int j obes relat metab disord. 2000; 24: 30613. friedwald wt, levy ri, fredrickson ds. estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. clin chem. 1972; 18: 499-502. james wp, astrup a, finer n, hilsted j, kopelman p, rossner s, saris wh, van gaal lf. effect of sibutramine on weight maintenance after weight loss: a randomized trail. lancet 2000; 356: 2119-25. khare cp. bauhinia variegata. in: indian medicinal plants. verlin/heidelberg, springer, 2007, pp 86-87. mcgowan mw, artiss jd, strandbergh dr, zak b. a peroxidase-coupled method for the colorimetric determination of serum triglycerides. clin chem. 1983; 29: 538-42. mclaughlin t, abbasi f, lamendola c, kim hs, reaven gm. metabolic changes following sibutramine-assisted weight loss in obese individuals: role of plasma free fatty acids in the insulin resistance of obesity. metabolism 2001; 50: 819-24. pasquali r, casimirri f. clinical aspects of ephedrine in the treatment of obesity. int j obes relat metab disord. 1993; 17: 65-68. puri a, khaliq t, rajendran sm, bhatia g, chandra r, narender t. antidyslipidemic activity of indigofera tinctoria. j herb pharmacother. 2007; 7: 59-64. rajkapoor b, jayakar b, anandan r, kavimani s. anti-ulcer effect of bauhinia variegata linn in rats. j nat rem. 2003; 3: 215-17. rajkapoor b, jayakar b, murugesh n, sakthisekaran d. chemoprevention and cytotoxic effect of bauhinia variegata against n-nitrosodiethylamine induced liver tumors and human cancer cell lines. j ethnopharmacol. 2006; 104: 407-09. rajkapoor b, jayakar b, murugesh n. antitumor activity of bauhinia variegata on dalton's ascitic lymphoma. j ethnopharmacol. 2003; 89: 107-09. rajkapoor b, ravichandran v, gobinath m, anbu j, harikrishnan n, sumithra m, sankari m, venugopal r, sakthisekaran d. effect of bauhinia variegata on complete freund's adjuvant induced arthritis in rats. j pharmacol toxicol. 2007; 2: 465-72. rothwell nj, stock mj, warwick bp. the effect of high fat and high carbohydrate cafeteria diets on diet-induced thermogenesis in the rat. int j obestet. 1983; 7: 263-70. schlumpf m, lichtensteiger w, langemann h, waser pg, hefti f. a fluorimetric micromethod for the simultaneous determination of serotonin, noradrenaline and dopamine in milligram amounts of brain tissue. biochem pharmacol. 1974; 23: 2337-446. sclafani a, springer d. dietary obesity in adult rats: similarities to hypothalamic and human obesity syndromes. physiol behav. 1976; 17: 461-71. siedel j, hagele eo, ziegenhorn j, whlefeld aw. reagent for the enzymatic determination of serum total cholesterol with improved lipolytic efficiency. clin chem. 1983; 29: 1075-80. pmid:6851096 tripathi kd. adrenergic drugs in: essentials of medical pharmacology. 5th ed. new delhi, jaypee brothers, 2004, pp 115-16. vasselli jr, weindruch r, heymsfield sb, pi-sunyer fx, boozer cn, yi n, wang c, pietrobelli a, allison db. intentional weight loss reduced mortality rate in a rodent model of dietary obesity. obes res. 2005; 13: 693-702. warnick gr, wood pd. national cholesterol education program recommendations for measurement of highdensity lipoprotein cholesterol: executive summary. the national cholesterol education program working group on lipoprotein measurement. clin chem. 1995; 41: 1427-33. 12 bangladesh j pharmacol 2018; 5: 8-12 bangladesh journal of pharmacology research article pharmacological evaluation of methanolic extract of cyperus scariosus bjp introduction in the previous decade, there has been a rising interest in the medical consequences of free radicals. free radicals are harmful and cause oxidative stress which may cause very serious human diseases (vani et al., 1997; jadhav and bhutani, 2002). many natural products have been using in practice for the cure of free radicals (kokate, 2004). those compounds which destroy the formation of ros, scavenge them or face their action are called anti-oxidants (khan et al., 2015). already some natural anti-oxidant are sold on business trade either as anti-oxidant flavors or nourishing food supplements (schuler, 1990). bajpai et al. (2005) and sun et al. (2002) reported that some nutrients and nonnutrient molecules of the medicinal and aromatic plants have anti-microbial properties. medicinal plants are also used in the treatment of cancer and play a significant part as a source of active anticancer agents (crabbe, 1979; mitscher et al., 1987; khan et al., 2010). nearly more than 60% anticancer agents are used in different ways from the natural source (chopra et al., 1992). the plant cyperus scariosus is an angiosperm belonging to family cyperaceae, contains almost 3,000 species out of which about 220 species are recognized as weeds. the rhizomes of c. scariosus used as an anti-microbial, anti-inflammatory, antifungal agent and it is also used as in many formulations for the ayurvedic systems of medicine (srivastava et al., 2014). the present study is aimed to evaluate anti-oxidants, antifungal, cytotoxicity activity and phytochemical analyses. materials and methods plant collection c. scariosus was collected from the district bannu and was recognized by prof. abdul rahman, gpgc bannu. collected plant sample was dried under shadow at a room temperature and ground mechanically up to a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2016; 11: 353-358 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the present study is aimed to investigate the phytochemical screening and biological activities of methanolic extract of cyperus scariosus roots. dried plant was grounded and extracted with methanol to prepare methanol crud extract. in vitro biological tests were conducted using this methanolic extracts according to the standard procedure. 100% death rate of brine shrimp was perceived at 3 mg/ml of plant extract after 72 hours. the extract showed action against aspergillus flavius i.e. 90% followed by a. niger (91%) while the highest activity was shown against a. fumegatrus (94%). important scavenging results were detected during scavenging of free radicals viz; 92.2% against dpph, 82.2% to abts, 75.8% to hydrogen peroxide, 88.1% to β-carotene, 86.1% to hydroxyl radical and 89.4% against phosphomolybdate at 3 mg/ml were obtained. the results obtained in this study point out that extract showed significant biological activities which might be due to the presence of bioactive constituents. article info received: 9 june 2015 accepted: 5 january 2016 available online: 25 march 2016 doi: 10.3329/bjp.v11i2.23611 cite this article: khan wu, khan ra, ahmed m, khan lu, khan mw. pharmacological evaluation of methanolic extract of cyperus scariosus. bangladesh j pharmacol. 2016; 11: 353-58. pharmacological evaluation of methanolic extract of cyperus scariosus wasi ullah khan, rahmat ali khan, mushtaq ahmed, latif ullah khan and muhammad waqas khan department of biotechnology, university of science and technology bannu 28100, kpk, pakistan. mash size 0.1 mm. plant extraction 100 g fine powder of c. scariosus was socked in 500 ml methanol with temperate shaking and then placed it at room temperature for 5 days. after five days the plant was extracted and filtered by using whatman filter paper. it was concentrated with the help of the rotary evaporator. then the concentration the extra methanol was evaporated at 37°c to obtain crude extract. qualitative phytochemical screening phytochemical screening was performed to recognize the existence of bioactive compounds in plant part by using standard phytochemical methods as described by khan et al. (2010). cytotoxic brine shrimp lethality test cytotoxic brine shrimp lethality test was carried out according to meyer-alber et al. (1992) with some modification as described by khan et al. (2015). antifungal bioassay the antifungal activity of the plant extract was screened through the agar tube dilution method by using the protocol by duraipandiyan and lgnacimuthu, (2009). dpph radical scavenging activity method was used for determination of dpph scavenging ability of various fractions. 3 mg dpph was dissolved in 30 ml methanol to prepare stock solution (duraipandiyan and lgnacimuthu, 2009). the stock solution was further diluted with methanol until reaching an absorbance less than 1.00 using the spectrophotometer at 517 nm. scavenging calculated through the following formula. scavenging effect (%) = [(od of control-od of sample) / (od of control)] ×100 abts radical scavenging assay with certain modifications the abts radical scavenging assay was measured using the method developed by re et al. (1999). equal volumes of 7 mm abts solution and 2.45 mm potassium per sulfate solution were mixed to prepare stock solution and incubated in the dark for 12 hours at room temperature to yield a dark colored solution consisting of abts•+ radicals. 50% methanol and stock solution were mixed to prepare working solution for an initial absorbance of about 0.700 (± 0.02) at 745 nm, with control temperature set at 30°c. free radical scavenging activity was determined by mixing 100 μl of different concentrations (3 mg/ml, 1.5 mg/ml, 0.75 mg/ml and 0.37 mg/ml in methanol) with 1 ml of abts working standard. when the solutions were mixed then after 1 min and 6 min of the decrease in absorbance was measured. experiment was done on four concentrations. ascorbic acid was used as positive controls in this experiment. the scavenging activity was determined based on the percentage of abts radicals scavenged by the formula given below. percent scavenging = [(a0 −as) / a0] × 100 where a0 = absorption of control, as = absorption of sample solution hydrogen peroxide scavenging assay with certain modifications the hydrogen peroxide scavenging activity was assessed using the method developed by ruch et al. (1989). phosphomolybdate assay the anti-oxidant activity of samples was calculated by the phosphomolybdenum method according to the procedure of umamaheswari and chatterjee, (2008). an aliquot of 0.1 ml of sample solution was mixed with 1 ml of reagent solution (0.6 m sulfuric acid, 28 mm sodium phosphate and 4 mm ammonium molybdate). the test tubes were capped with silver foil and incubated in a water bath at 95°c for 90 min. after the samples had cooled to room temperature, the absorbance of the mixture was measured at 765 nm against a blank. ascorbic acid was used as standard. the antioxidant capacity was estimated using following formula: anti-oxidant effect (%) = [(control absorbance-sample absorbance) / (control absorbance)] × 100 hydroxyl radical scavenging assay hydroxyl radical scavenging activity of extracts was examined by the method of halliwell and gutteridge, (1981). the reaction mixture contained 50 ml of 2deoxyribose (2.8 mm) in phosphate buffer (50 mm, ph 7.4), 10 ml of premixed ferric chloride (100 mm) and edta (100 mm) solution (1:1; v/v), 10 ml of h2o2 (200 mm) without or with the extract solution (10 ml). the reaction was triggered by adding 10 ml of 300 mm ascorbate and incubated for 1 hour at 37°c. a solution of tba in 1 ml (1%; w/v) of 50 mm naoh and 1 ml of 2.8% (w/v; aqueous solution) tca was added. the mixture was heated for 15 min on a boiling water bath and then cooled. the absorbance was measured at 532 nm. the scavenging activity on hydroxyl radical was calculated as follows: scavenging activity (%) = (1absorbance of sample / absorbance of control) × 100 β-carotene bleaching assay the assay was performed as given by elzaawely et al, (2007) and modified slightly. first, 1 mg of β-carotene dissolved in 5 ml of chloroform was mixed with 10 mg of linoleic acid and 50 ml of tween 80 followed by chloroform removing under nitrogen and 25 ml of distilled water adding with vigorous shacking to pre354 bangladesh j pharmacol 2016; 11: 353-358 pare β-carotene linoleate emulsion. an aliquot of sample (200 µl) was mixed with 800 µl of the suspension, and then the absorbance was resolute at 470 nm at 45°c for 2 hours. β-carotene bleaching inhibition was estimated as the following equation: bleaching inhibition (%) = (β-carotene content after 2 hours of assay/initial β-carotene content) × 100 results phytochemical composition phlobatannins, tannins and terpenoids were present in the extract while flavonoids, anthraquinone and saponins were absent. antifungal activity c. scariosus methanolic extract shows antifungal activities up to some extant against aspergillus niger, a. flavius, and a. fumigatus strain. the extract showed activity against a. flavius i.e. 90% followed by a. niger (91%) while the highest activity was shown against a. fumegatrus (94%). likewise the terbinofine, a positive control was shown highly active against this fungal strains, while the dmso (negative control) shows zero percent (0%) inhibition activity against all the used three fungal strains (table i). cytotoxic activity (%death) after 24, 48 and 72 hours incubation the cytotoxic effects of extract of different concentrations were noted and found that the brine shrimp survival rate was inversely proportional to the concentrations of the plant extracts and the period of incubations. the results of the present study show that c. scariosus had significant cytotoxic activity (figure 1). abts scavenging activity the abts (2,2, azo-bis-(3-ethyl benzothiazoline-6sulphonic acid) free radical scavenging capacity of the sample extract was less than the standard ascorbic acid (table ii). dpph free radical scavenging activity the 1,1-diphenyl-2-picryl–hydrazyl (dpph) free radical scavenging capability of the sample extract was less than the standard ascorbic acid (table ii). hydrogen peroxide-scavenging activity the methanolic extract showed distinct scavenging activity, markedly scavenged the free radial and were the most potent than reference chemical compound (table ii). phosphomolybedate scavenging activity the phosphomolybedate free radical scavenging ability table i antifungal activity of cyperus scariosus methanolic extract % inhibition fungal strain concentrations (mg/ml) cyperus scariosus terbinofine aspergillus flavius 3 90.0 ± 2.7 100.0 ± 0.7 1.5 84.1 ± 2.5 98.0 ± 0.5 0.75 81.3 ± 2.4 91.1 ± 0.3 0.37 76.4 ± 2.1 85.3 ± 0.2 aspergillus niger 3 91.0 ± 3.1 100 ± 0.7 1.5 85.1 ± 2.9 96.1 ± 0.4 0.75 81.2 ± 2.5 87.3 ± 0.2 0.37 78.7 ± 2.2 88.2 ± 0.3 aspergillus fumegatus 3 94.0 ± 3.4 100.0 ± 0.7 1.5 79.3 ± 2.3 97.1 ± 0.6 0.75 64.5 ± 2.2 89.2 ± 0.4 0.37 62.1 ± 2.0 85.3 ± 0.2 data are mean ± sd bangladesh j pharmacol 2016; 11: 353-358 355 of the sample extract along with the standard ascorbic acid recorded on different concentrations. it was found that the scavenging capacity of the sample extract was to some extent less than the standard (table ii). β-carotene bleaching assay with concern to the βcarotene bleaching assay, the anti-oxidant activity of sample can be classified as 3 mg/ml > 1.5 mg/ml > 0.75 mg/ml > 0.37 mg/ml. at 3 mg/ml, βcarotene bleaching inhibitions were 88.32, 1.5 mg/ml 82.67, 0.75 mg/ml 78.45 and 0.37 mg/ml 72.69. β-carotene bleaching assay showed the dose response graph for all the concentrations ranging from 3 mg/ml-0.37 mg/ml. it was found that the scavenging capacity of the sample extract was less than the standard (table ii). hydroxyl radical scavenging activity the hydroxyl radical scavenging activity can be categorized as 3 mg/ml > 1.5 mg/ml > 0.75 mg/ml > 0.37 mg/ml. all results showed anti-oxidant activity in dose-dependent manner at concentration 3-0.37 mg/ ml. however, the scavenging activity at all the concentrations less than the standard (table ii). discussion the c. scariosus revealed the presence of phlobatannins, tanninsand terpenoids, while anthraquinone, flavonoids, saponins were absent. reactive oxygen species are recognized to play a definite role in a wide variety of pathological expressions. anti-oxidants combat free radicals and protect us from various diseases. they utilize their action either by scavenging the reactive oxygen species or defending the anti-oxidant defense mechanisms (umamaheswari and chatterjee, 2008). the obtained results shows that c. scariosus have the ability to scavenge all this free radicals that is due to the existence of some bioactive compounds. the results which are drawn from the extract shows some resemblances with the study of hogerman et al. (1998) described that it is the quality of medicinal plants that have highly scavenge the free radicals. the anti-oxidants potential of methanolic extract of this plant might be due to the occurrence of phenolic and polyphenolic compounds in this medicinal plant which decrease the free radicals which cause the oxidative stress. the results that were obtained by kilani et al. (2008) also support the results obtained from the experiments. the cytotoxic activity of the plant extract offers information about the anticancer and anti-tumor possible of c. scariosus. cytotoxic effect of the methanolic extract was resolute by using brine shrimps lethality test. the order of the cytotoxicity 3 mg/ml > 1.5 mg/ml > 0.75 mg/ml and 0.37 mg/ml. from the experiments, the results showed that the brine shrimps survival is inversely proportional to the methanolic extract. it was reported that methanolic fraction of arceuthobium oxycedri showed 100 % cytotoxicity at high dose for brine shrimps which are similar to the current result. it is obvious from the extract that the results of the present study helps the traditional usage of the studied plant and recommends that methanolic extract possess some bioactive compounds with antifungal as well as anticancer ailment caused by the pathogens. literature shows that synthetic drugs have side effects and there is some strains of microorganism which are antibiotic resistant so due to this reason examination of effective anti-microbial drugs obtained from natural resources has been an objective of researchers and scientists. in our present, study the anti-microbial activities of c. scariosus results shows that the fungal strain are inhibited by these samples. the existence of phenolic compounds in medicinal plants also showed antimicrobial activities (baydar et al., 2004) and the antimicrobial activities of the medicinal plants are also due to the existence of bioactive compounds saponins (mothana et al., 2007). % m or ta lit y concentrations 120 100 80 60 40 20 0 3 mg/ ml 1.5 mg/ ml 0.75 mg/ ml 0.37 mg/ ml after 24 hours after 24 hours after 24 hours figure 1: cytotoxic effects of cyperus scariosus methanolic extract (% death) 356 bangladesh j pharmacol 2016; 11: 353-358 t a b le i i a n io x id a n t a ct iv it ie s o f c y p er u s sc a ri o su s m e th a n o li c e x tr a ct d p p h a b t s h 2 o 2 p h o sp h o m o ly b e d a te β c a ro te n e h y d ro x y l ra d ic a l c o n c, (m g / m l ) a sc o rb ic a ci d e x tr a ct a sc o rb ic a ci d e x tr a ct a sc o rb ic a ci d e x tr a ct a sc o rb ic a ci d e x tr a ct a sc o rb ic a ci d e x tr a ct a sc o rb ic a ci d e x tr a ct 3 9 4 .5 ± 5 .4 9 2 .2 ± 5 .2 8 4 .2 ± 4 .5 8 2 .2 ± 4 .4 8 0 .5 ± 4 .8 7 5 .8 ± 3 .9 9 7 .1 ± 5 .7 8 9 .4 ± 4 .9 9 3 .1 ± 4 .9 8 8 .1 ± 4 .3 9 0 .1 ± 4 .9 8 6 .1 ± 4 .3 1 .5 9 1 .3 ± 5 .2 8 8 .7 ± 4 .9 7 4 .7 ± 4 .3 7 2 .8 ± 4 .1 7 7 .2 ± 3 .9 7 3 .3 ± 3 .5 9 6 .2 ± 5 .6 8 4 .7 ± 4 .5 8 7 .9 ± 4 .6 8 3 .2 ± 4 .5 8 7 .2 ± 4 .5 8 2 .2 ± 4 .1 0 .7 5 8 9 .1 ± 4 .9 8 6 .2 ± 4 .4 6 8 .1 ± 3 .9 6 5 .7 ± 3 .6 7 4 .1 ± 3 .6 7 0 .4 ± 3 .4 9 4 .2 ± 5 .3 8 0 .3 ± 4 .3 8 4 .1 ± 4 .3 8 0 .5 ± 4 .2 8 4 .9 ± 4 .1 7 7 .1 ± 3 .7 0 .3 7 8 7 .5 ± 4 .8 8 4 .4 ± 4 .2 6 1 .1 ± 3 .6 5 9 .8 ± 3 .3 7 7 .6 ± 3 .4 6 7 .2 ± 3 .2 9 2 .1 ± 5 .1 7 7 .6 ± 3 .9 7 6 .4 ± 3 .9 7 2 .4 ± 3 .2 8 1 .1 ± 3 .5 7 3 .3 ± 3 .1 d a ta a re m e a n ± s d bangladesh j pharmacol 2016; 11: 353-358 357 author info rahmat ali khan (principal contact) e-mail: rahmatgul_81@yahoo.com conclusion c. scariosus showed significant cytotoxic and anti-oxidant activities as well as inhibitory effects on fungus which are might be due to the presence of bioactive constituents. references bajpai m, pande a, tewari sk, prakash d. phenolic contents and anti-oxidant activity of some food and medicinal plants. int j food sci nutr. 2005; 56: 287-91. baydar ng, ozkan g, sagdic o. total phenolic contents and antibacterial activities of grapes (vitis vinifera l.) extracts. food control. 2004; 5: 333-35. chopra rn, nayer sl, chopra ic. glossary of indian medicinal plants. 3rd edn. new dehli, council of scientific and industrial research, 1992, pp 7-246. crabbe p. some aspects of steroid research based on natural product from plant orgin. bull soc chim belg. 1979; 88: 5-7. duraipandiyan v, ignacimuthu s. antibacterial and antifungal activity of flindersine isolated from the traditional medicinal plant, toddalia asiatica (l.) lam. j ethanopharmacol. 2009; 123: 494-98. elzaawely aa, xuan td, koyama h, tawata s. anti-oxidant activity and contents of essential oil and phenolic compounds in flowers and seeds of alpinia zerumbet. food chem. 2007; 104: 1648–53. halliwell b, gutteridge jmc. formation of thiobarbituric acidreactive substance from deoxyribose in the presence of iron salts. febs lett. 1981; 128; 347-52. hogerman ae, riedl km, jones ga, sovik kn, ritchard nt, hartzfeld pw. high molecular weight plant polyphenolice (tannins) as biological anti-oxidants. j agric food chem. 1998; 46: 1887-92. jadhav hr, bhutani kk. anti-oxidant properties of indian medicinal plants. phytother res. 2002; 16: 771–73. kokate ck, purohit ap. textbook of pharmacognosy. 2004; 29: 317-18. kilani s, sghaier mb, limem i, bouhlel i, boubaker j, bhouri w, skandrani i, neffatti a, ammarb rb, dijoux-franca mg, ghedira k, chekir-ghedira l. in vitro evaluation of antibacterial, anti-oxidant, cytotoxic and apoptotic activities of the tubers infusion and extracts of cyperus rotundus. bioresour technol. 2008; 99: 9004-08. khan a, khan ra, ahmed m, mushtaq n. in vitro antioxidant, antifungal and cytotoxic activity of methanolic extract of c. polygonoides. bangladesh j pharmacol. 2015; 10: 316-20. khan ra, khan mr, sahreen s, khan jb. antimicrobial and phytotoxic screening of various fractions of sonchus asper afri j of biotech. 2010; 9: 3883-87. khan ra, khan mr, sahreen s. evaluation of launaea procumbensuse in renal disorders: a rat model. j ethnopharmacol. 2010; 128: 452–61. mitscher la, drake s, gollapudi sr, okwute sk. a modern look at folkloric use of anti-infective agents. j nat prod. 1987; 50: 1025-40. marino m, bersani c, and comi g. impedance measurements to study the anti-microbial activity of essential oils from lamiaceae and compositae. int j food microbiol. 2001; 67: 18795. mothana raa, gruenert r, lindequist u, bednarski pj. study of the anticancer potential of yemeni plants used in folk medicine. pharmazie 2007; 62: 305-07. meyer-alber a, hartmann h, sumpel f, creutzfeldt w. mechanism of insulin resistance in ccl4-induced cirrhosis of rats. gastroenterology 1992; 102: 223–29. ruch rj, cheng sj, claug je. prevention of cytoxicity and inhibition of intercellular communication by anti-oxidant catechins isolated from chinese green tea. carcinogen 1989; 10: 1003-08. re r, pellegrini n, proteggente a, pannala a, yong m, riceevas c. anti-oxidant activity applying an improved abts radical cation decolorusation assay. free radical biol medi. 1999; 26: 1231–37. srivastava rk, singh a, srivastava gp, lehri a, niranjan a, tewari sk, kumari k, kumari s. chemical constituents and biological activities of promising aromatic plant nagarmotha (cyperus scariosus r. br.): a review. proc indian natn sci acad. 2014; 80: 525-36. schuler p. naturnal anti-oxidants exploited commercially. in: food anti-oxidants. hudson bjf (eds). london, elsevier, 1990, pp 99-170. sun j, chu y, wu x, liu r, anti-oxidant and anti-proliferative activities of common fruits. j agric food chem. 2002; 50: 7449-54. umamaheswari m, chatterjee tk. in vitro anti-oxidant activities of the fractions of coccinia grandis l. leaf extract. afr j tradit complement alternat med. 2008; 5: 61–73. vani t, rajini m, sarkar s, shishoo cj. anti-oxidant properties of the ayurvedic formulation: triphala and its constituents. pharmaceut biol. 1997; 35: 313–17. 358 bangladesh j pharmacol 2016; 11: 353-358 your feedback about this paper 1. number of times you have read this paper 2. quality of paper 3. your comments conclusion: references: author info rahmat ali khan principal contact email rahmatgul81yahoocom: dateprinted: this article was downloaded by you on: jun 07, 2017 text2: dropdown3: [click] dropdown4: [0] bangladesh journal of pharmacology research article anticancer and apoptotic effects of theaflavin-3-gallate in non-small cell lung carcinoma bjp introduction cancer, which is the leading cause of death, is characterized by numerous hallmarks including uncontrolled growth and the tendency of cancer cells to migrate and invade neighboring tissues (hanahan and weinberg, 2011). the primary tumor ultimately transforms into a cancerous phenotype through a series of advanced physiological changes. the malignant phenotype leads to the spread of the cancers through metastasis. the invasion and development of a secondary tumor encompasses a cascade of consecutive steps, such as intravasation into the circulatory system and extravasation to a secondary site (joyce and pollard, 2009). all the cancer cells do not metastasize to other locations forming new cancerous tissues. although metastases cause more than 85% of human cancer-related deaths, they are not accountable for the growth of the primary tumor (mehlen and puisieux, 2006). lung cancer, also known as pulmonary carcinoma, is the most frequently diagnosed cancer accounting for over 1.37 million deaths every year all across the globe. lung cancer is instigated by activation of oncogenes or inactivation of tumor inhibitor genes. mutations in the k-ras proto-oncogene are accountable for 10–25% of lung adenocarcinomas. in china, lung cancer has substituted liver cancer as the principal cause of mortality among people with malignant tumors. according to the statistics from the national office on tumor cure and prevention, about 600,000 people die of lung cancer each year in china (alberg et al., 2005; american cancer society, 2014). clinically two general classes of lung cancer have been known, non-small-cell lung carcinoma and small-cell lung carcinoma. non-smallcell lung carcinoma is more prevalent, accounting for almost 80% of lung cancers. there are different options for the treatment of nona journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 790-798 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the objective was to determine the antiproliferative and apoptotic effects of theaflavin-3-gallate in human non-small cell lung cancer cells (a-549) along with determining the effect on cell cycle phase distribution, cell migration and invasion. cell viability was determined by mtt assay while as phase contrast and fluorescence microscopies were involved to study apoptotic morphological features in these cells. flow cytometry investigated the effect of theaflavin3-gallate on cell cycle phase distribution. theaflavin-3-gallate treatment led to a substantial cytotoxic effect in a-549 cancer cells with ic50 values of 42.1 µm and 27.9 µm at 24 and 48 hours respectively. further, 80 and 160 µm dose of theaflavin-3-gallate induced apoptotic features including chromatin margination and micronuclei presence. the population of cells in g2/m phase increased from 2.7% (control) to 6.8%, 17.2% and finally to 46.5% after treatment with 20, 80 and 160 µm concentration of theaflavin-3-gallate respectively indicating g2/m phase cell cycle arrest. article info received: 5 june 2015 accepted: 25 june 2015 available online: 27 september 2015 doi: 10.3329/bjp.v10i4.23580 cite this article: li dw, meng l, zhang kx, zhang wk. anticancer and apoptotic effects of theaflavin-3-gallate in non-small cell lung carcinoma. bangladesh j pharmacol. 2015; 10: 790-98. anticancer and apoptotic effects of theaflavin-3-gallate in non-small cell lung carcinoma da-wei li1, long meng2, kui-xing zhang1 and wei-ke zhang3 1department of cardiothoracic surgery, laigang hospital affiliated to taishan medical college, laiwu, shandong 271 104, china; 2department of thoracic surgery, shandong provincial hospital, ji’nan, shandong 250 021, china; 3department of oncology, laigang hospital affiliated to taishan medical college, laiwu, shandong 271 104, china. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. small-cell lung carcinoma including chemotherapy by platinum complexes such as cisplatin (cis-diammine dichloroplatinum ii) and carboplatin (cis-diammine [1, 1cyclobutane-dicarboxylato] platinum) (raghavan et al., 1997; yagoda et al., 1979; drelichman et al., 1985; trump et al., 1990). the chemotherapy treatment for lung cancer depends on the tumor type. small-cell lung carcinoma is treated primarily with chemotherapy and radiotherapy (hann and rudin, 2008). however, long-term chemotherapy can result in drug resistance through gene mutation or dna methylation. as such, drug resistance in cancer patients is gradually rising and anticancer drugs like paclitaxel, cisplatin, 5-fluorouracil, doxorubicin etc are becoming less effective. due to this growing menace of drug resistance by cancer cells, there is a pressing need to design and develop novel anticancer drugs which can overcome drug resistance problems (ma et al., 2010; sarkar et al., 2007). plant based natural products have been an encouraging source of such agents and around 60% of the drugs clinically used for cancer chemotherapy are directly or indirectly derived from plants. in this study, the anticancer effects of theaflavin-3gallate on the non-small cell lung cancer cells are reported along with its effects on apoptosis, cell cycle arrest, key cellular proteins, caspase activation, cell migration and invasion. materials and methods chemicals and other reagents theaflavin-3-gallate was purchased from sigma chemical company (usa). for in vitro studies, theaflavin-3gallate was dissolved in dimethyl sulfoxide (dmso) to create a stock solution (0.1 mol/l), which was stored at −20°c. to prepare working solutions, the stock solution was further diluted with culture media to yield the desired theaflavin-3-gallate concentrations. control cells were treated with an equal volume of vehicle. the dmso concentration was kept below 0.1% in cell culture and did not show any noticeable effect on cell growth or cell death. dulbecco’s modified eagle’s medium, fetal bovine serum (fbs), penicillin-streptomycin were obtained from hangzhou sijiqing biological products co., ltd, china. mtt kit was obtained from roche (usa). annexin v-fitc-propidium iodide apoptosis detection kit was purchased from (beyotime institute of biotechnology, shanghai, china). acridine orange and propidium iodide were purchased from beyotime, china. all other chemicals and solvents used were of the highest purity grade. the primary antibodies including anti-cyclin b, anti-dna degradation factor 45 kda (ddf45), anti-p21 and anti-cytochrome c were from bd biosciences co. anti-caspase-3, anti-bcl-2, anti-bcl-xl, anti-bad, anti-bax, anti-poly [adpribose] polymerase 1 (parp-1) and anti-p53 were from epitomics co. (santa cruz biotechnology, inc., santa cruz, ca, usa). the secondary antibodies such as goat anti-mouse igg-hrp and goat anti-rabbit igg-hrp were from santa cruz biotechnology inc. (cell signaling technology, inc.). cell line and culture conditions human non-small cell lung cancer cell line (a-549) was purchased from the shanghai institute of cell biology, chinese academy of sciences (cas, shanghai, china) and was kept at 37°c in a humidified atmosphere containing 5% co2. the cells were cultured in dulbecco’s modified eagle’s medium (sigma-aldrich, usa) supplemented with 10% v/v fbs, 2% v/v penicillin/ streptomycin and 1% v/v amphotericin b. cell viability evaluation by mtt assay inhibition of cell growth by theaflavin-3-gallate was evaluated by the mtt assay. briefly, cells were plated in 96-well culture plates (1 × 105 cells/well). after 24 hours incubation, cells were treated with theaflavin-3gallate (0, 5, 10, 20, 40, 80 and 160 μm, eight wells per concentration) for 24 and 48 hours, mtt solution (5 mg/ml) was then added to each well. after 4 hours incubation, the formazan precipitate was dissolved in 100 μl dimethyl sulfoxide, and then the absorbance was measured in an elisa reader (thermo molecular devices co., union city, usa) at 570 nm. the cell viability ratio was calculated by the following formula: inhibitory ratio (%) = (od control – od treated) / od control × 100% cytotoxicity was expressed as the concentration of theaflavin-3-gallate inhibiting cell growth by 50% (ic50 value). evaluation of a-549 cell morphology following theaflavin-3-gallate treatment a-549 cells were plated in six-well plates (guangzhou jet biofil, guangzhou, china) at a density of 1 x 105 cells/ml and then cultured for 24 hours to facilitate total attachment to the surface of the plates. subsequently, the cells were subjected to treatment with several concentrations of theaflavin-3-gallate (0, 20, 80 or 160 μm) for 48 hours. following drug treatment, culture plates were examined with an inverted light microscope (nikon corp., tokyo, japan) and images were captured. acridine orange and propidium iodide nuclei staining cells were analyzed with a staining method using acridine orange and propidium iodide (sigma-aldrich, usa), following incubation. a-549 cells were treated with various concentrations of theaflavin-3-gallate (0, 20, 80 or 160 μm) for 48 hours. subsequently, cells on cover slips were collected, washed twice with phosphate-buffered saline, stained with acridine bangladesh j pharmacol 2015; 10: 790-798 791 orange/propidium iodide solution (each 25 μg/ml), and inspected and photographed using a fluorescence microscope (nikon corp.). images are presented as maximum intensity projection or single-plane images. cell cycle analysis a-549 cells at a density of 1 x 105 cells/ml were grown on sterile culture plate overnight, and treated with theaflavin-3-gallate at concentrations of 0, 20, 80 and 160 μm for 48 hours at 37°c and 5% co2. the untreated cells were grown as a negative control. the cells were harvested, washed with phosphate buffer solution and fixed in ice-cold 70% ethanol overnight at -20°c. the ethanol-fixed cells were pelleted, washed with ice-cold phosphate buffer solution and resuspended in staining solution containing 50 µg/ml propidium iodide, 100 µg/ml rnase, 0.1% sodium citrate and 0.1% triton-x100. after incubation for 30 min, the cells were analyzed by flow cytometer (facs calibur instrument (bd biosciences, san jose, ca, usa) equipped with cell quest 3.3 software). detection of apoptosis by annexin v binding assay using flow cytometry detection of apoptosis was performed using the fitc annexin v apoptosis detection kit. a-549 cells at a density of 1 x 105 cells/ml were grown on sterile culture plate overnight, and treated with theaflavin-3gallate at concentrations of 0, 20, 80 and 160 μm for 48 hours at 37°c. the untreated cells were grown as a negative control. the cells were harvested, washed with phosphate buffer solution and double stained with annexin v and propidium iodide for 20 min at room temperature in dark. apoptosis was detected by facs calibur flow cytometer, and distribution of cell population in different quadrants was analyzed with quadrant statistics. the lower left quadrant represents viable cells, lower right quadrant represents early apoptotic cells, upper right quadrant represents late apoptotic/ secondary necrotic cells and upper left quadrant represents primary necrotic cells. cell migration assay this assay was performed using a standard method (liang et al., 2007). cells (1 x 105 cells/ml) were seeded in a 6-well plate and incubated at 37ºc until 95 to 100% full confluent monolayer was obtained. subsequent to 12 hours of starvation, a 100 ml pipette tip was used to create a straight cell-free wound. each well was washed twice with pbs to remove any debris and then exposed to various concentrations of theaflavin-3-gallate (0, 20, 80 and 160 µm) in a medium. after 48 hours of incubation, the cells were fixed and stained with 3% ethanol containing 0.5% crystal violet powder for 20 min, and randomly chosen fields were photographed under a light microscope (inverted light microscope (nikon corp., tokyo, japan). the number of cells that migrated into the scratched area were counted and lengths of wound were determined by image j (version 1.46) software. invasion assay this assay was done with a 24-well plate. matrigel (bd) coating was prepared on a polyvinylpyrrolidone-free polycarbonate filter (6 mm pore size). the lower chamber was filled with medium containing 10% fbs. a-549 cells (1 x 105 cells/well) were preincubated with theaflavin-3-gallate for 20 min at room temperature and the cell medium containing theaflavin-3-gallate was seeded onto the upper chamber wells. following incubation for 48 hours, the filter was fixed and stained with 3% ethanol containing 0.3% crystal violet for 20 min. the stained cells were counted under light microscope. western blot analysis: a-549 cells (1 × 105) were cultured in a 10-cm plate and incubated for 24 hours, after which the medium was removed and replaced with fresh medium or medium containing indicated doses (20, 80 and 160 μm) of theaflavin-3-gallate and incubated for another 36 hours. then the medium was removed followed by washing with phosphate buffer solution three times before detaching cells with a cell scraper and collecting by centrifuging at 15,000 rpm for 10 min. lysis buffer (cell signaling technology, danvers, ma, usa) was added to cell pellet of each treatment, and cells were disrupted with a sonicator for protein release, followed by centrifuging at 14,000 rpm (4°c) for 10 min. the protein containing supernatant was collected and stored at -20° c before use. protein concentrations were determined by bradford assay. proteins (40 µg) of each sample lysate were resolved by 14% sds-page and transferred to nitrocellulose membranes by semi-dry transfer method. after the transfer, the membranes were blocked with 1% bsa and probed with primary and hrp-conjugated secondary antibodies using snap i.d. protein detection system. the blots were visualized by developing the blot with chemiluminescent substrate. statistical analysis all results were presented as mean ± standard error (s.e.) from at least three independent experiments. the independent t-test was performed using spss statistics 17.0 to determine the statistical significance between untreated and treated groups. results with p<0.05 were considered as statistically significant. results effects of theaflavin-3-gallate on proliferation of nonsmall cell lung cancer cells (a-549) initially we demonstrated the antiproliferative activity of theaflavin-3-gallate on a-549 cells by using mtt assay. the results revealed that theaflavin-3-gallate had potent antiproliferative effects on a-549 cells. it showed 792 bangladesh j pharmacol 2015; 10: 790-798 both concentration dependent as well as timedependent growth inhibitory effects against these cells (figure 1). for determining the effectiveness of this polyphenolic compound, its ic50 value was also calculated to be 42.1 µm and 27.9 µm at 24 and 48 hours respectively. morphological study of apoptosis using phase contrast microscopy in this study, the morphological alterations of human non-small cell lung cancer cells (a-549) untreated and treated with theaflavin-3-gallate were detected under an inverted light microscope. the most noticeable changes characteristic of apoptosis were observed in the treated cells that include the detachment of the cells from substratum, cell shrinkage. as shown by inverted light microscopy, the untreated control cells were uniformly scattered on the substratum. decrease in the cell population was seen with the increase in the theaflavin3-gallate concentration. as can be seen in figure 2, untreated a-549 cells appeared as densely packed and organized multilayers, whereas after incubation with figure 1: cytotoxic effect of theaflavin-3-gallate in human non-small cell lung cancer cells (a-549). data are shown as the mean ± sd of three independent experiments. *p<0.05, **p<0.01 vs 0 µm (control) figure 2: morphology changes of a-549 cells after theaflavin-3-gallate treatment for 48 hours. compound treated cells were rounded and there was no cell to cell adhesion. arrows show membrane blebbing and rounded cells at 40x magnification. a, shows control cells with excellent cell to cell adhesion and normal cellular morphology. b, c and d represent cells treated with 20, 80 and 160 µm dose of theaflavin-3-gallate 110 100 90 80 70 60 50 40 30 20 10 0 % c el l d ea th 24 hours 0 5 10 20 40 80 125 concentration of theaflavin-3-gallate (µm) 48 hours **** ** **** * * *** bangladesh j pharmacol 2015; 10: 790-798 793 various concentrations of theaflavin-3-gallate for 48 hours several of the cells became rounded and shrunken, and detached from each other or floated in the medium. study of apoptosis using acridine orange/propidium iodide double staining in control (figure 3a) conditions, cells showed preserved green nuclei, indicating a good viability. however, after exposure to 20 µm of theaflavin-3-gallate, late apoptotic and necrotic changes were observed (figure 3b). however, 80 and 160 µm of theaflavin-3-gallate induced apoptotic features including chromatin margination in cup-shaped masses and presence of micronuclei (figure 3c, d). theaflavin-3-gallate induces g2/m phase cell cycle arrest in a-549 lung cancer cells in order to demonstrate whether theaflavin-3-gallate induces cell cycle disturbances in a-549 cells, flow cytometric analysis using propidium iodide as a staining agent was performed after theaflavin-3-gallate treatment at different concentrations (0, 20, 80, and 160 µm) for 48 hours. the population of cells in g2/m phase increased from 2.7% (untreated control) to 6.8%, 17.2% and finally to 46.5% after treatment with 20, 80 and 160 µm concentration of theaflavin-3-gallate respectively. the cells in the g0 phase also witnessed a slight increase from 2.1% to 4.6%, 12.3% and 18.7% after treatment with 20, 80 and 160 µm concentration of theaflavin-3-gallate respectively (figure 4a-d). annexin v-fitc/pi assay for apoptosis evaluation and quantification annexin v/propidium iodide double staining was used to detect apoptosis in the human lung cancer cells (a549) (figure 5). a-549 cells were treated with different concentration (0, 20, 80 and 160 µm) of theaflavin-3gallate for 48 hours. theaflavin-3-gallate induced both early and late apoptosis in a concentration-dependent manner (figure 5b-d) as compared to the untreated control cells (figure 5a). the different quadrants q1, q2, q3 and q4 represent necrotic cells, late apoptotic cells, viable cells and early apoptotic cell population respectively. percentage of apoptotic cells increases from 5.2% in control cells (a), to 17.1%, 49.1% and 78.2 % in 20 µm (b), 80 µm (c) and 160 µm (d) theaflavin-3gallate-treated cells respectively. effects of theaflavin-3-gallate on the migration of a549 cells in this experiment, we assessed the effect of theaflavin3-gallate on the cell migration in a-549 nsclc cells. confluent cells were scratched and then treated with theaflavin-3-gallate in a complete medium for 48 hours. the number of cells migrated into the scratched area was photographed (x40) and calculated as a percentage (%) of migration. as can be seen in figure 6, theaflavinfigure 3: fluorescent micrographs of acridine orange and propidium iodide double-stained a-549 cells. intact green nuclei appear in control (a) conditions suggesting a good cell viability. after exposure to different doses of theaflavin-3-gallate, apoptotic cells appear. a, shows control cells with normal cellular morphology. b, c and d represent cells treated with 20, 80 and 160 µm dose of theaflavin-3-gallate 794 bangladesh j pharmacol 2015; 10: 790-798 figure 4: effect of theaflavin-3-gallate on cell cycle phase distribution in a-549 non-small cell lung cancer cells. the cells were treated with different doses of the compound for 48 hours. the cell cycle distribution was determined by a flow cytometric analysis of the dna content after staining with propidium iodide. a, shows control while as b, c and d represent cells treated with 20, 80 and 160 µm dose of theaflavin-3-gallate respectively figure 5: quantification of theaflavin-3-gallate-induced apoptosis in human lung cancer cells (a-549). the cells were subjected to different doses of theaflavin-3-gallate (0, 20, 80 and 160 µm) for 48 hours and analyzed by flow cytometry with annexin v-fitc/ pi staining. the different quadrants q1, q2, q3 and q4 represent necrotic cells, late apoptotic cells, viable cells and early apoptotic cell population respectively. percentage of apoptotic cells increases from 5.2% in control cells (a), to 17.1%, 49.1% and 78.1 % in 20 µm (b), 80 µm (c) and 160 µm (d) theaflavin-3-gallate-treated cells respectively p ia 1000 100 10 1 0.1 1000 100 10 1 0.1 1000 100 10 1 0.1 1000 100 10 1 0.1 0.1 1 10 100 1000 0.1 1 10 100 10000.1 1 10 100 0.1 1 10 100 1000 fitc-a 800 700 600 500 400 300 200 100 0 300 250 200 150 100 50 0 50 100 150 200 250 50 100 150 200 250 50 100 150 200 250 300 250 200 150 100 50 0 50 100 150 200 250 340 300 250 200 150 100 50 0 c el ls c ou nt s dna content c g0 g1 g2/ms a g0 g1 s g2/m b g0 s g2/m g1 d g1 g0 s g2/m bangladesh j pharmacol 2015; 10: 790-798 795 3-gallatedistinctly reduced a-549 cell migration in a concentration dependent manner. figure 6a represents untreated (0 µm) control cells while figure 6b, c and d represent effect of 20, 80 and 160 µm dose of theaflavin3-gallate respectively. treatment of the cells with theaflavin3-gallate led to a decrease in the rate at which the cells migrate into the clear area created by scratch. effects of theaflavin-3-gallate on the invasion of a-549 cells lung cancer is very deadly because it is extremely invasive particularly in later stages. in this part of the study, we revealed whether theaflavin-3-gallate could inhibit the invasive behavior of nsclc (a-549) cells. the invasive assay was designed using a-549 cells using matrigel-coated 24-well microchemotaxis chambers in the presence of theaflavin-3-gallate at various concentrations. as can be seen in figure 7, theaflavin-3-gallate at various concentrations (ranging from 0 µm to 20, 80 and 160 µm) significantly inhibited the invasion of a-549 cells in a dose-dependent manner. discussion several natural products have been widely studied for their potential in cancer therapy and prevention over the last several decades. according to a recent review of natural products as sources of new drugs over the last 30 years, a total of 44 (~45%) out of 99 new anti-cancer drugs are either natural products or their synthetic or semisynthetic derivatives (newman and cragg, 2012). paclitaxel (taxol®), for instance, is a plant-derived diterpenoid isolated from the bark of the pacific yew tree, taxus brevifolia. it is a potent inhibitor of cell division by disturbing normal microtubule breakdown during mitosis and is presently used as anti-mitotic chemotherapy for lung, breast, ovarian, head and neck cancer, as well as advanced forms of kaposi’s sarcoma (wall and wani, 1995). even though conventional chemotherapeutic drugs induce cell death, they are inadequate due to their toxicity to normal cells. identification of natural agents in the form of either plant extracts or a bioactive compound, which effectively exhibits apoptotic and cell cycle modulating properties and at the same time shows lesser toxicity to normal cells, is therefore crucial (rebucci and michiels, 2013). theaflavin-3-gallate is an antioxidant polyphenol which is regarded as the biologically important active components of black tea. according to a study, the antiproliferative and cytotoxic effects of theaflavin-3-gallateon human squamous carcinoma (hsc-2) cells were more pronounced to the cancer cells than to the normal cells (babich et al., 2008). another study reports that theaflavin-3-gallateis effective in inhibiting the cancer cell proliferation of human liver cancer cells, gastric cancer cells and acute promyelocytic leukemia lh-60 cells (tu et al., 2004). however, anticancer effect of theaflavin-3gallate on the a-549 non-small cell lung cancer cells has figure 6: inhibitory effects of theaflavin-3-gallate on the migration of a-549 cells. (a) initial view of scratch at time 0, before any drug treatment, (b) control, after 24 hours, (c) theaflavin-3-gallate-treated cells at 24 hours at a dose of 80 µm, and (d) theaflavin-3gallate-treated cells at 24 hours at a dose of 160 µm 796 bangladesh j pharmacol 2015; 10: 790-798 not been reported so far to the best of our knowledge. as such the aim of the current study was to investigate the effect of this polyphenolic antioxidant compound on the a-549 cancer cell growth. theaflavin-3-gallate showed potent, concentration dependent as well as time-dependent growth inhibitory effects against a-549 cells. phase contrast microscopy revealed that cells became rounded and shrunken, and detached from each other or floated in the medium after theaflavin-3gallate treatment. in the progression of cancer, avoidance of apoptosis is one of the key factors resulting in overpopulation of malignant cells. apoptosis is an active form of cell death directed by a set of prosurvival and antisurvival genes. there is a strong connection between loss of apoptotic control and cancer instigation and progression, as tumor cells lose their capacity to activate the death signaling pathway (rebecca, 2011; fulda and debatin, 2003). other than apoptosis, deregulated cellcycle control is a key feature of cancer development. fluorescence microscopy showed that theaflavin-3gallate treatment triggered the appearance of late apoptotic and necrotic cells showing apoptotic features including chromatin margination in cup-shaped masses and micronuclei presence. theaflavin-3-gallate also induced both early and late apoptosis in a concentration -dependent manner. the compound also disturbed cell cycle phase distribution inducing cell cycle arrest at g2/m phase of the cell cycle. cancer cell migration and invasion were also significantly inhibited by the increasing doses of theaflavin-3-gallate. conclusion the current findings demonstrate that theaflavin-3gallate can act as a lead natural product based anticancer agent owing to its tendency to inhibit lung cancer cell proliferation through the induction of apoptosis, cell cycle arrest and inhibition of cell migration and invasion. conflict of interest the authors declare that there is no conflict of interest to reveal. references alberg aj, brock mv, stuart jm. epidemiology of lung cancer: figure 7: theaflavin-3-gallate decreases invasion of a-549 non-small cell lung cancer cells. invasion assay was carried out using modified 24-well microchemotaxis chambers. then selected fields were photographed (x100), and the number of cells migrated to the lower surface was calculated as a percentage of invasion. a shows untreated normal cells, while as b, c and d represent effect of 20, 80 and 160 µm dose of theaflavin-3-gallate on cell invasion respectively bangladesh j pharmacol 2015; 10: 790-798 797 author info wei-ke zhang (principal contact) e-mail: weizhang1440@gmail.com; tel & fax: 00860634-6828496 looking to the future. j clin oncol. 2005; 23: 3175–85. american cancer society. cancer facts & figures 2014. atlanta, american cancer society, 2014. babich h, gottesman rt, liebling ej, schuck ag. theaflavin-3 -gallate and theaflavin-3′-gallate, polyphenols in black tea with prooxidant properties. basic clin pharmacol toxicol. 2008; 103: 66–74. drelichman a, oldford j, al-sarraf m. evaluation of cyclophosphamide, adriamycin, and cis-platinum (cap) in patients with disseminated prostatic carcinoma: a phase ii study. am j clin oncol. 1985; 8: 255–59. fulda s, debatin km. apoptosis pathways in neuroblastomatherapy. cancer lett. 2003; 197: 131–35. hanahan d, weinberg ra. hallmarks of cancer: the next generation. cell. 2011; 144: 646–74. hann cl, rudin cm. management of small-cell lung cancer: incremental changes but hope for the future. oncology (williston park). 2008; 22: 1486–92. joyce ja, pollard jw. micro environmental regulation of metastasis. nat rev cancer. 2009; 9: 239–52. liang cc, park ay, guan jl. in vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. nat protoc. 2007; 2: 329-33. ma j, dong c, ji c. microrna and drug resistance. cancer gene therapy. 2010; 17: 523-31. mehlen p, puisieux a. metastasis: a question of life or death. nat rev cancer. 2006; 6: 449–58. newman dj, cragg gm. natural products as sources of new drugs over the 30 years from 1981 to 2010. j nat prod. 2012; 75: 311–35. raghavan d, koczwara b, javle m. evolving strategies of cytotoxic chemotherapy for advanced prostate cancer. eur j cancer. 1997; 33: 566–74. rebecca sy. apoptosis in cancer: from pathogenesis to treatment. j exp clin cancer res. 2011; 30: 87. rebucci m, michiels c. molecular aspects of cancer cell resistance to chemotherapy. biochem pharmacol. 2013; 85: 1219– 26. sarkar fh, banerjee s, li y. pancreatic cancer: pathogenesis, prevention and treatment. toxicol applied pharmacol. 2007; 224: 326-36. trump dl, marsh jc, kvols lk, citrin d, davis te, hahn rg, vogl se. a phase ii trial of carboplatin (nsc 241240) in advanced prostate cancer, refractory to hormonal therapy: an eastern cooperative group study. invest new drugs. 1990; 8: s91– 94. tu yy, tang ab, watanabe n. the theaflavin monomers inhibit the cancer cells growth in vitro. acta biochim biophys sin. 2004; 36: 508–12. wall me, wani mc. camptothecin and taxol: discovery to clinic—thirteenth bruce f. cain memorial award lecture. cancer res. 1995; 55: 753–60. yagoda a, watson rc, natale rb, barzell w, sogani p, grabstald h, whitmore wf. a critical analysis of response criteria in patients with prostatic cancer treated with cisdiamminedichloride platinum ii. cancer. 1979; 44: 1553–62. 798 bangladesh j pharmacol 2015; 10: 790-798 dateprinted: this article was downloaded by you on: sep 12, 2018 introduction in patients with acute asthma exacerbation, the use of isotonic magnesium as a vehicle for nebulized salbutamol produced a significantly greater increase in peak expiratory flow compared with salbutamol in saline. the more severe the baseline obstruction, the greater the response to the combined magnesium sulfate and salbutamol, which supports the observation that magnesium is particularly effective in acute exacerbations of asthma (nannini et al., 2000). the anticholinergic has little role if added to the repeated dose of β2-agonist; use of xanthine derivatives (methylxanthine) in acute asthma is controversial and steroid takes at least a few hours to act (expert panel report-2, 1997). the use of nebulized magnesium sulfate, in addition to a β2‑agonist, in the treatment of a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 72-80 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract a double-blind randomized controlled trial was conducted to examine the efficacy of nebulized magnesium sulfate in the treatment of acute exacerbation of asthma in children. thirty patients received nebulized salbutamol (0.15 mg/kg; minimum dose 2.5 mg) with 2.0 ml of isotonic magnesium sulfate solution and another 30 patients received same dose of salbutamol with 2.0 ml of normal saline on 3 occasions at 20 min intervals. mean percent of predicted peak expiratory flow rate (pefr) detected in both group at 0 min were not significantly different. but from 10 min up to 60 min, the values were significantly different among the groups. mean respiratory rate at 0 and 10 min were similar in both groups and from 20 up to 60 min, respiratory rate improvement were significantly different. arterial oxygen saturation (sao2) at presentation was not significantly different. but from 10 min up to 60 min differences were significant. with single dose of nebulization, in the magnesium sulfate with salbutamol group, by 20 min almost all (29 out of 30) patient achieved at least 60% of predicted pefr. within this 20 min, from control group none could achieve 60% of predicted pefr. after 2nd dose of nebulization control group started achieving 60% pefr value. regarding response criteria, with 2nd dose of nebulization, at 30 and 40 min 9 (30.0%) and 17 (56.7%) patient from magnesium sulfate with salbutamol group showed good response (pefr ≥70% predicted). but within this first 40 min time, none could show good response in control group. with 3rd dose of nebulization all from magnesium sulfate group showed good response but even at 60 min, 4 (13.3%) patient in control group failed to be included as good responder. so, it is evident that nebulization by isotonic magnesium sulfate solution with salbutamol provide early and better response as compared to conventional approach (salbutamol plus normal saline) in acute exacerbation of asthma in children. article info received: 17 october 2006 accepted: 1 december 2006 available online: 3 january 2008 doi: 10.3329/bjp.v1i2.492 cite this article: haqq ma, rahman mh, khanam s, mannan ma. efficacy of nebulized magnesium sulfate in the treatment of acute exacerbation of asthma in children. bangladesh j pharmacol. 2006; 1: 72-80. efficacy of nebulized magnesium sulfate in the treatment of acute exacerbation of asthma in children mohammed ataul haqq, md. hamidur rahman, selina khanam and m. a. mannan department of pediatrics, bangabandhu sheikh mujib medical university, shahbag, dhaka, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. acute exacerbation of asthma appears to produce benefits with respect to improved pulmonary function (blitz et al., 2005). bronchodilating effect of intravenous magnesium sulfate and its use and efficacy were suggested (bloch et al., 1995; boonyavorakul et al., 2000; santana et al., 2001). on the contrary, data on nebulized magnesium sulfate have been scant. the effect of nebulized magnesium sulfate as a vehicle for salbutamol has been less evaluated (kokturk et al., 2005). in pediatric population this type of study is very rare. quickly achieving at least 60% predicted peak expiratory flow rate (pefr) reduces the likelihood of relapse and hospitalization rate. one of the treatment goals in acute exacerbation of asthma is to achieve as rapidly as possible a safe value for the percentage predicted peak flow of about 60% (nannini et al., 2000). initial assessment of pulmonary function before treatment and repeat assessment after three dose of nebulization is necessary to categorize response (good, incomplete or poor) of individual patient (expert panel report-2, 1997). at present, regarding assessment of response, no published study is known in pediatric population. most of the studies (nannini et al., 2000; mollick, 2003) measured 1st outcome at 10 min after completion of the nebulization. some studies also measured 1st outcome at least 30 min after completion of nebulization. nebulization itself may continue for 5-10 min depending upon the volume of fluid/drug and properties of the nebulizer. in practical, their 1st measurement lies at not earlier than 15-20 min from the start point. no known study done measuring outcome before 10 min after completion of nebulization. in some study, it is found that magnesium sulfate nebulization has shown better response as compared to normal saline. but no known study completed recommended schedule of 3 doses of nebulization. the present study was carried out to see the effect of nebulized magnesium sulfate in presence of salbutamol in the treatment of acute exacerbation of asthma in children. materials and methods duration of study a double-blind randomized controlled trial was carried out from january to july 2006. study population a total of 60 children with acute exacerbation of asthma presented to the pediatric pulmonology follow-up clinic and asthma centre, bsmmu were included. children (age range 7-16 years) of either sex with acute exacerbation of asthma and capable of measuring pefr were included. exclusion criteria included a) severely ill patient requiring immediate hospital care, b) any evidence of respiratory tract infection or suppurative lung diseases, c) any history or evidence of cardiac, renal or hepatic dysfunction, d) use of short acting bronchodilator within 8 hours or long acting bronchodilator within 24 hours, and e) use of steroid within 7 days. they were distributed randomly as 30 patients in nebulized isotonic magnesium sulfate with salbutamol group and the rest 30 in nebulized salbutamol with normal saline i.e., control group. ethical issue the protocol of the study was approved by the ethical committee, bangabandhu sheikh mujib medical university. before enrolment, the aims and objectives of the study along with its procedure and benefits or draw -backs were explained to the guardian and patient (where applicable) in details in an understandable way. in case of any query, they were answered. when the guardian became satisfied, informed consent was obtained from the guardian and the patient was included in the study. they also had freedom to withdraw from the study at any time they would like. materials/instruments used a) salbutamol respirator solution containing 5 mg of salbutamol per ml (ventolin respirator solution, glaxo welcome bangladesh ltd.); b) normal saline (0.9% nacl, institute of public health, bangladesh); c) isotonic magnesium sulfate solution (7.5 g/100 ml, 286 mosm; d) 60 sets of identical eppendorf tube (each set containing 3 eppendorfs); e) nebulizer with face mask (medel aero-family®); f) pulse oxymeter (bionics® bpm-200); and g) peak flow meter (mini‑ wright™, clement clarke international ltd, uk). preparation for double-blind study sixty sets of identical eppendorf tube (each set containing 3 eppendorf tube) were taken and labeled serially from 1 to 60. in any set all the 3 eppendorf tube had the same label number. by following random table, prepared a coding sheet to distribute the eppendorf randomly within the two groups each containing 30 sets. according to the grouping based on label number, each set of eppendorf tube was filled with appropriate solution i.e.; isotonic magnesium sulfate solution in magnesium sulfate group and normal saline in control group. in any set, each eppendorf tube contained 2.0 ml of same fluid (either isotonic magnesium sulfate or normal saline solution). coding sheet was returned back to and preserved by the guide till the time to analyze the data. clinical procedure bangladesh j pharmacol 2006; 1: 72-80 73 clinical examinations of the patients were done with regards to the vital signs of acute attack as well as the chest findings as per requirements of the study. questionnaire-cum-data sheet filled in. objective measurement of airway obstruction was recorded with a peak flow meter. the procedure of using the peak flow meter was demonstrated to the patient. the use of peak flow meter was repeated at 10, 20, 30, 40, 50 and 60 min from the start point. starting from 0 min, every patient was under continuous monitoring with pulse oxymeter and readings regarding sao2. pulse and respiratory rates were recorded every 10 min starting from 0 min up to 60 min. in this step, at 0 min, each patient was given salbutamol (0.15 mg/kg; minimum dose 2.5 mg) along with the content solution of an eppendorf tube (containing 2.0 ml of either isotonic magnesium sulfate or normal saline solution), from a set based on serial, by air driven nebulizer with face mask. emptiness of the nebulizer was guided by lack of any further mist. when the nebulizer was sputtered it was gently shaken and then driven again until there was no more mist. first dose of nebulization done at 0 min. immediately after recording the information/data on data sheet, this step was repeated with 2nd dose of nebulization at 20 min and 3rd dose of nebulization at 40 min from start point using the eppendorf of same set. statistical analysis coding sheet was collected from the guide, data decoded and analyzed. results were expressed as mean ± sd. most of the analyses were done by spss 12.0 for windows (statistical package for social sciences) software. unpaired student's t-tests were used to compare means between two groups. chi-square analysis was done to compare distribution of age, sex, family history of asthma, history of smoking, medication and presenting symptoms and signs. confidence interval was set at 95% level. results were considered to be statistically significant at p value <0.05. results table i shows the baseline characteristics of patients of two groups. age of the patients in magnesium sulfate group was 11.8 ± 2.4 years whereas in control group it was 10.8 ± 2.8 years. in the isotonic magnesium sulfate with salbutamol group, 12 patients were male and 18 female. on the other hand in the control group, 13 were male and 17 female. in magnesium sulfate group and control group height was 57.2 ± 5.4 inches and 54.9 ± 6.2 inches respectively. weights of the patient in magnesium sulfate group and control group were 35.8 ± 8.9 kg and 33.9 ± 10.1 kg respectively. the duration of asthma was 1.6 ± 1.0 years in the magnesium sulfate group and 1.3 ± 0.5 years in the control group. in all cases the differences between the groups were not statistically significant. table ii shows that there was history of taking oral short acting β2-agonist in 26 cases in the magnesium sulfate group and 24 cases in the control group. short acting inhaled β2-agonist was taken by 2 and 4 patients in the magnesium sulfate group and control group respectively. the differences were not statistically significant. all the children were conscious and not cyanosed at presentation. table iii shows that only 1 patient from magnesium sulfate group and 2 from control group were exhausted during presentation. twenty eight patients talked in phrases and 2 in words in the magnesium sulfate group whereas 26 patients talked in phrases and 4 in words in the control group. in the magnesium sulfate group, loud and very loud wheeze was present in 25 and 5 patients respectively while in the control group they were found in 27 and 3 patients. table i baseline characteristics of patients parameters magnesium sulfate with salbutamol (n = 30) salbutamol (n = 30) p value age (years) 11.8 ± 2.4 10.8 ± 2.8 >0.10ns sex male 12 13 female 18 17 height (inch) 57.2 ± 5.4 54.9 ± 6.2 >0.10ns weight (kg) 35.8 ± 8.9 33.9 ± 10.1 >0.10ns duration of asthma (years) 1.6 ± 1.0 1.3 ± 0.5 >0.10ns family history of asthma 26 25 ns data are mean ± sd ; ns = not significant 74 bangladesh j pharmacol 2006; 1: 72-80 the differences were not statistically significant in all the parameters in both the group. in all cases pulse rate was within 100 160 per min and pefr was 40-60 percent of predicted value. in magnesium sulfate group and control group 28 and 26 patients respectively were breathless during talking while 2 and 4 patients were breathless during resting. table iv shows baseline pefr (l/min) between the two groups both in absolute value and percent of predicted were similar. absolute value (mean ± sd) for magnesium sulfate group was 164.2 ± 35.0 l/min and for control group was 146.7 ± 40.9 l/min. p value was reached by unpaired student's 't' test and was >0.05 which was not significant. mean of percent predicted table ii beta-2 agonist taken within seven days of presentation β2-agonist salbutamol (control) group (n = 30) magnesium sulfate with salbutamol group (n = 30) no. (%) no. (%) oral short acting 26 (86.7) 24 (80.0) oral long acting 2 (6.7) 2 (6.7) inhaler short acting 2 (6.7) 4 (13.3) inhaler long acting 0 (0.0) 0 (0.0) table iii presenting symptoms and signs parameters magnesium sulfate with salbutamol (n = 30) salbutamol (n = 30) no. (%) no. (%) symptoms breathlessness during talking 28 (93.3) 26 (86.7) resting 2 (6.7) 4 (13.3) physical exhaustion yes 1 (3.3) 2 (6.7) no 29 (96.7) 28 (93.3) talks in phrases 28 (93.3) 26 (86.7) words 2 (6.7) 4 (13.3) signs wheeze loud 25 (83.3) 27 (90.0) very loud 5 (16.7) 3 (10.0) use of accessory muscle no 2 (6.7) 2 (6.7) yes 28 (93.3) 27 (90.0) prominent 0 (0.0) 1 (3.3) pulse (per min) 100-160 30 (100.0) 30 (100.0) pefr (%) 40-60 30 (100.0) 30 (100.0) sao2 94% 90% 29 (96.7) 28 (93.3) <90% 1 (3.3) 2 (6.7) bangladesh j pharmacol 2006; 1: 72-80 75 value for magnesium sulfate group and control group were 48.9 ± 2.4 and 48.0 ± 2.2 respectively and the differences were also non-significant (p value >0.10). at 10 min, mean pefr, mean percent change from 0 min and mean percent of predicted value for magnesium sulfate group and control group respectively were 192.3 ± 40.3 and 166.8 ± 44.0 (p value <0.05); 17.4 ± 5.5 and 14.2 ± 5.7 (p value <0.05); 57.3 ± 1.7 and 54.8 ± 2.0 (p value <0.001) respectively. so, at 10 min, there were significant differences between the groups regarding peak flow rate (absolute value), percent improvement from baseline and improvement in percent predicted value. similar types of results were found up to 60 min of the study period. table v shows, at presentation, all the patient had pefr <60% of predicted value. in the magnesium sulfate group at 10 min from the start point only 2 (6.7%) patient and at 20 min 29 (96.7%) patient achieved at least 60% of predicted pefr. so with single dose of nebulization almost all children (29 out of 30) achieved at least 60% predicted pefr in magnesium sulfate group. within this 20 min, in the control group none could achieve pefr at least 60% of the predicted value. immediately after recording data as per schedule, second dose of nebulization done at 20 min (from start point). after another 10 min i.e.; at 30 min from start point 30 (100.0%) and 28 (93.3%) patient from magnesium sulfate group and control group respectively achieved at least 60 percent predicted value. from 40 min, all patient from both the group achieved pefr at least 60 percent predicted. table vi shows that within 20 min, none could show the good response. second dose of nebulization done at 20 min and after that, at 30 and 40 min only 9 (30.0%) and 17 (56.7%) patients respectively in the magnesium sulfate group showed good response. despite of using two doses of nebulization, within this first 40 min time, from control group none could show good response (pefr ≥ 70.0% of predicted). immediately after recording data at 40 min 3rd dose of nebulization done. at 50 min, 30 (100.0%) patient from magnesium sulfate group and 9 (30.0%) patient from control group showed good response. finally at 60 min 4 (13.3%) patient from the control group failed to be table iv pefr (l/min) status at different times parameters magnesium sulfate with salbutamol group (n=30), pefr (l/min) mean ± sd salbutamol (control) group (n=30) pefr (l/min) mean ± sd p value predicted 336.2 ± 71.5 305.1 ± 82.1 >0.10ns 0 min (baseline) 164.2 ± 35.0 146.7 ± 40.9 >0.05ns mean % of predicted 48.9 ± 2.4 48.0 ± 2.2 >0.10ns 10 min 192.3 ± 40.3 166.8 ± 44.0 <0.05a mean % change from 0 min 17.4 ± 5.5 14.2 ± 5.7 <0.05a mean % of predicted 57.3 ± 1.7 54.8 ± 2.0 <0.001a 20 min 209.2 ± 41.7 174.5 ± 46.6 <0.01a mean % change from 0 min 28.0 ± 7.0 19.4 ± 6.0 <0.001a mean % of predicted 62.4 ± 1.8 57.24 ± 1.53 <0.001a 30 min 229.2 ± 46.1 189.0 ± 49.8 <0.01a mean % change from 0 min 40.2 ± 8.2 29.4 ± 5.7 <0.001a mean % of predicted 68.4 ± 1.9 62.1 ± 1.6 <0.001a 40 min 235.3 ± 48.4 194.8 ± 52.7 <0.01a mean % change from 0 min 43.8 ± 7.1 33.2 ± 6.0 <0.001a mean % of predicted 70.1 ± 1.0 63.9 ± 1.5 <0.001a 50 min 250.3 ± 52.2 211.7 ± 56.9 <0.01a mean % change from 0 min 52.9 ± 8.4 44.8 ± 7.1 <0.001a mean % of predicted 74.5 ± 1.4 69.4 ± 1.7 <0.001a 60 min 257.8 ± 52.9 216.5 ± 57.5 <0.01a mean % change from 0 min 57.6 ± 9.1 48.2 ± 7.0 <0.001a mean % of predicted 76.8 ± 1.8 71.0 ± 1.5 <0.001a unpaired student's 't' test; ns = not significant, a = significant 76 bangladesh j pharmacol 2006; 1: 72-80 included as good responder. as shown in table vii, respiratory rate, pulse rate and sao2 were also recorded at 0, 10, 20, 30, 40, 50 and 60 min. at 0 min, regarding all the parameters, differences between two groups were not significant. from 10 to 60 min, differences of mean pefr percent of predicted were always significant between the groups (p value <0.001). respiratory rate at 0 and 10 min were similar in both groups and from 20 up to 60 min, respiratory rate improvement were significantly different. pulse rate differences were not statistically significant up to 40 min. at 50 and 60 min, mean pulse rate differences were significant. only 3 patient (1 in magnesium sulfate group and 2 in control group) had sao2 89% (within <90% range) at presentation and within 10 min, sao2 was ≥90% in all cases. so, as per protocol, oxygen was not used. mean oxygen saturation at presentation was not significantly different. but from 10 up to 60 min, improvement in mean sao2 was significantly different and magnesium sulfate group showed superiority. at the end of 60 min, magnesium sulfate group showed better and significant differences in clinical improvement and all the patients from both the groups were given step care management. discussion this double-blind randomized controlled study revealed that combining nebulized isotonic magnesium sulfate with salbutamol results in early and better response in peak flow as compared with the standard approach (salbutamol plus normal saline) for nebulization in the initial treatment of acute exacerbation of table v comparison of patients achieving at least 60% of predicted value parameters magnesium sulfate with salbutamol group (n = 30) salbutamol (control) group (n = 30) at 0 min pefr ≥60% of predicted 0 0 <60% of predicted 30 30 at 10 min pefr ≥60% of predicted 2 0 <60% of predicted 28 30 at 20 min pefr ≥60% of predicted 29 0 <60% of predicted 1 30 at 30 min pefr ≥60% of predicted 30 28 <60% of predicted 0 2 at 40 min pefr ≥60% of predicted 30 30 <60% of predicted 0 0 at 50 min pefr ≥60% of predicted 30 30 <60% of predicted 0 0 at 50 min pefr ≥60% of predicted 30 30 <60% of predicted 0 0 table vi response on percent predicted pefr pefr (% predicted) magnesium sulfate with salbutamol group (n = 30) salbutamol (control) group (n = 30) at 10 min good response 0 0 incomplete response 30 30 poor response 0 0 at 20 min good response 0 0 incomplete response 30 30 poor response 0 0 at 30 min good response 9 0 incomplete response 21 30 poor response 0 0 at 40 min good response 17 0 incomplete response 13 30 poor response 0 0 at 50 min good response 30 9 incomplete response 0 21 poor response 0 0 at 60 min good response 30 26 incomplete response 0 4 poor response 0 0 pefr ≥70% of predicted valuegood response; 50 to <70% of predicted valueincomplete response; <50% of predicted valuepoor response. (national guidelines, 2005) bangladesh j pharmacol 2006; 1: 72-80 77 asthma in children. the effect was evident at 10 min and was maintained up to 60 min from the start point. this finding is consistent with that of mollick, (2003). pefr expressed as percentage predicted value eliminated gender, age, weight and height bias and mean percent improvement in pefr from baseline (0 min) eliminated the bias introduced by difference in the degree of initial airflow obstruction. mean percent of predicted pefr detected in both group at 0, 10, 20, 30, 40, 50 and 60 min. results in both groups at base line were similar but from 10 up to 60 min, the values were significantly different. mean percent improvement in pefr from baseline was always significantly different from 10 up to 60 min and magnesium sulfate group showed superiority which is also consistent with findings of nannini et al. (2000). in this study, in the magnesium sulfate with salbutamol group at 10 min from the start point only 2 (6.7%) patient and at 20 min almost all (29 out of 30) patients achieved at least 60% of predicted pefr. following 1st dose of nebulization at 0 min, within this 1st 20 min, from the control group none could achieve pefr at least 60% of table vii respiratory rate, pulse rate and sao2 % at different times respiratory rate/min pulse rate / min sao2 % parameter 0 min magnesium sulfate with salbutamol group 34.0 ± 1.9 121.6 ± 6.3 90.8 ± 0.7 0 min salbutamol group 35.0 ± 2.0 123.2 ± 6.7 90.4 ± 0.7 0 min p value >0.05ns > 0.10ns >0.05ns 10 min magnesium sulfate with salbutamol group 31.2 ± 1.7 113.1 ± 8.0 92.2 ± 1.1 10 min salbutamol group 32.0 ± 1.6 115.7 ± 7.1 91.7 ± 0.8 10 min p value >0.05ns > 0.10ns < 0.05a 20 min magnesium sulfate with salbutamol group 28.6 ± 1.1 101.5 ± 5.5 92.6 ± 1.0 20 min salbutamol group 29.2 ± 1.1 102.9 ± 5.7 92.0 ± 1.00 20 min p value <0.05a > 0.10ns < 0.05a 30 min magnesium sulfate with salbutamol group 27.2 ± 1.0 96.0 ± 3.8 93.7 ± 0.9 30 min salbutamol group 27.7 ± 0.9 97.1 ± 3.6 93.2 ± 0.9 30 min p value < 0.05a > 0.10ns < 0.05a 40 min magnesium sulfate with salbutamol group 25.7 ± 0.8 91.7 ± 1.9 94.2 ± 1.0 40 min salbutamol group 26.3 ± 0.8 92.6 ± 2.1 93.7 ± 0.9 40 min p value < 0.01a > 0.05ns < 0.05a 50 min magnesium sulfate with salbutamol group 24.9 ± 0.9 89.1 ± 2.0 95.0 ± 0.7 50 min salbutamol group 25.6 ± 0.8 90.5 ± 2.3 94.6 ± 0.7 50 min p value < 0.01a < 0.05a < 0.05a 60 min magnesium sulfate with salbutamol group 24.1 ± 1.0 87.0 ± 2.3 95.5 ± 0.7 60 min salbutamol group 25.4 ± 0.8 88.6 ± 2.7 95.1 ± 0.6 60 min p value < 0.001a < 0.05a < 0.05a unpaired student's 't' test; ns = not significant, a = significant 78 bangladesh j pharmacol 2006; 1: 72-80 the predicted value. second dose of nebulization done at 20 min and after another 10 min i.e, at 30 min from start point, 30 (100.0%) and 28 (93.3%) patient from magnesium sulfate group and control group respectively achieved at least 60 percent predicted value. from 40 min, all patient from both the group achieved pefr at least 60 percent predicted. in acute exacerbation of asthma, to reduce the likelihood of relapse and hospitalization rate, achieving as rapidly as possible a safe value for the percentage predicted peak flow of about 60% is needed which is suggested as the cut-off point between discharge from emergency department and admission into the hospital (nannini, 1995). according to gina (2005), patient with post treatment lung function (fev1/pef) in the range of 40-60% of predicted value can potentially be discharged, assuming adequate follow-up is available in the community and compliance is assured. patients with objective evidence of lung function 60 percent predicted or greater can usually be discharged (gina, 2005). ten min after 2nd dose of nebulization i.e, at 30 and 40 min only 9 (30.0%) and 17 (56.7%) patients respectively in the magnesium sulfate group showed good response (pefr ≥70% predicted). despite of using two doses of nebulization, within this first 40 min time, from control group none could show good response. with three doses of nebulization, at 50 min, 30 (100.0%) patients from magnesium sulfate with salbutamol group and 9 (30.0%) patient in the control group showed good response. finally at 60 min 4 (13.3%) patient in the control group failed to be included as good responder. at present no known study done before to see this type of response. in the present study, all patient of magnesium sulfate group achieved 70% pefr after 3 dose of nebulization. nannini et al. (2000) conducted study with patient aged 18 years and over and found significant benefit after single dose of nebulization with isotonic magnesium sulfate. but the effect is much better in the present study. hughes et al. (2003) undertaken a double-blind placebo controlled study and found significantly greater improvement in fev1 with nebulized salbutamol plus isotonic magnesium sulfate solution than salbutamol plus normal saline. in that study 3 doses of nebulization were done and observations were made at 30 min interval and the response was similar as 10 min interval in the present study. mollick, (2003), carried out prospective controlled study in adult population and also found the similar response after 20 min of completion of treatment. the current recommendation for initial treatment of acute asthma is 3 doses of nebulization at 20 min interval for 1 hour but most of the studies (mangat et al., 1998; nannini et al., 2000; hughes et al., 2003; mollick, 2003) did not follow. moreover, they recorded peak flow at 10 and/or 20 and/or 30 min after completion of nebulization. but nebulization itself continues for 5-10 min depending upon the amount of fluid and properties of nebulizer. the outcome could be different if those protocols were adopted to see the effect of 3 doses of nebulization from the start point. though intravenous magnesium sulfate can be used as an adjunct to conventional nebulization and other therapy but if nebulization of salbutamol with isotonic magnesium sulfate can exert the same effect, use of this combination nebulization may be convenient both for the physician and for the patient (mollick, 2003). so the nebulized magnesium sulfate is preferable to iv magnesium. acute exacerbation of asthma requires start of treatment even at home and in the protocol of home management of asthma, oxygen administration is not recommended (expert panel report-2, 1997). acute hypoxia has no effect on short acting β2-agonist (salbutamol) induced broncho-dilatation in patients with asthma (dagg et al., 2001). improvements in oxygen saturation following bronchodilator administration documents the presence of relative preexisting hypoxemia which is reversed to some degree with bronchodilators (yamamoto et al., 1992). in our study, oxygen saturation also raised to a safe value in all patients. following current recommendation for initial treatment of acute exacerbation of asthma, in this study, nebulization was done as one dose every 20 min for 1 hour and found that patient gets comfort earlier if salbutamol nebulization done with isotonic magnesium sulfate solution. conclusion this study suggest that a) combining isotonic magnesium sulfate solution 2.0 ml with salbutamol for nebulization results in early response and greater improvement in pefr as compared with the standard approach (salbutamol nebulization with normal saline) in the initial treatment of acute exacerbation of asthma in children and b) patient treated by nebulized isotonic magnesium sulfate solution with salbutamol quickly achieves a safe value for the percentage predicted peak flow and at the end of initial treatment shows good response. references blitz m, blitz s, hughes r, diner b, beasley r, knopp j, rowe bh. aerosolized magnesium sulfate for acute asthma. chest 2005; 128: 337-44. bloch h, silverman r, mancherje n, grant s, jagminas l, scharf sm. intravenous magnesium sulfate as an adjunct in bangladesh j pharmacol 2006; 1: 72-80 79 author info mohammed ataul haqq (principal contact) e-mail: haqq@bangla.net the treatment of acute asthma. chest 1995; 107: 1576-81. boonyavorakul c, thakkinstian a, charoenpan p. intravenous magnesium sulfate in acute severe asthma. respirology 2000; 5: 21-25. dagg kd, clayton ra, thomson lj, chalmers gw, mcgrath jc, thomson nc. the effect of acute alteration in oxygen tension on the bronchodilator response to salbutamol in vitro and in vivo in man. pulm pharmacol ther. 2001; 14: 99-05. expert panel report-2: guidelines for the diagnosis and management of asthma 1997, national institutes of health, national heart, lung and blood institute, usa. gina. global strategy for asthma management and prevention. 2005. available at: http://www. ginasthma. org. hughes r, goldkorn a, masoli m, weatherall m, burgess c, beasley r. use of isotonic nebulised magnesium sulfate as an adjuvant to salbutamol in treatment of severe asthma in adults: randomised placebo-controlled trial. lancet 2003; 361: 2114-17. kokturk n, turktas h, kara p, mulloglu s, yilmaz f, karamercan a. a randomized clinical trial of magnesium sulfate as a vehicle for nebulized salbutamol in the treatment of moderate to severe asthma attacks. pulm pharmacol ther. 2005; 18: 416-21. mangat hs, d'souza ga, jacob ms. nebulized magnesium sulfate versus nebulized salbutamol in acute bronchial asthma: a clinical trial. eur respir j. 1998; 12: 341-44. mollick mka. comparison of nebulized magnesium sulfate plus salbutamol vs saline plus salbutamol in the treatment of acute asthma. md thesis, national institute of diseases of the chest & hospital, mahakhali, dhaka, bangladesh, 2003. nannini ljj. which pef value is the best? chest 1995; 107: 1475 -76. nannini ljj, pendino jc, corna ra, mannarino s, quispe r. magnesium sulfate as a vehicle for nebulized salbutamol in acute asthma. am j med. 2000; 108: 193-97. santana jc, baretto ssm, piva jp, garcia pcr. controlled study on intravenous magnesium sulfate or salbutamol in early treatment of severe acute asthma attack in children. j pediatr (rio j). 2001; 77: 279-87. silverman ra, osborn h, runge j, gallagher ej, chiang w, feldman j, gaeta t, freeman k, levin b, mancherje n, scharf s. iv magnesium sulfate in the treatment of acute severe asthma. a multicenter randomized controlled trial. chest 2002; 122: 489-97. yamamoto lg, wiebe ra, rosen lm, ringwood jw, uechi cm, beardsly es, toshi as, sugimoto sp, macpherson ka, young-sasaki wm. oxygen saturation changes during the pediatric emergency department treatment of wheezing. am j emerg med. 1992; 10: 274-84. 80 bangladesh j pharmacol 2006; 1: 72-80 http://www.ginasthma/ dateprinted: this article was downloaded by you on: oct 18, 2017 bangladesh journal of pharmacoloresearch article antiproliferative and apoptotic effects of pinocembrin in human prostate cancer cells bjp introduction plants provide many promising sources of potential anticancer agents and several lead structures in the past decades such as paclitaxel, camptothecin, vinca alkaloids, and etoposide have potential application in cancer chemotherapy, therefore, plants are considered as one of the most vital sources for the development of novel anti-cancer drugs (amin et al., 2009; cragg and newman, 2005). extensive researches have been carried out on the phytochemicals, which belong to one vital class of nutraceuticals found in plants, for their healthpromoting potential. pinocembrin is one of the most important phytochemicals among flavonoids, with antiinflammatory, antimicrobial and anti-oxidants properties (estevinho et al., 2008; feng et al., 2012; kumar et al., 2007). mainly pinocembrin was isolated from aerial parts of flourensia oolepis s.f. blake (asteraceae) (diaz napal et al., 2009) and honey (jaganathan and mandal, 2009). further, pinocembrin being a flavonoid natural compound have been found in fruits, vegetables, nuts, seeds, herbs, spices, stems, flowers, teas, and red wines (jiang and morgan, 2004; miyahisa et al., 2006). furthermore, pinocembrin has antiproliferative effect and induced apoptosis in cancer cells such as colon cancer (kumar et al., 2007; pan et al., 2011; zizic et al., 2013) and leukemia (hsu et al., 2010; salahdeen and murtala, 2012). however, the cytotoxic effects of pinocembrin on prostate cancer and its mechanism were still unknown. prostate cancer is an increasingly common and potentially lethal malignancy. it is the second leading a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2013; 8: 255-262 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 antiproliferative and apoptotic effects of pinocembrin in human prostate cancer cells zhenyu chen1, azhar rasul1, 2, chaoyue zhao1, faya martin millimouno2, ichiro tsuji3, takaki yamamura4, rehana iqbal5, mahadev malhi2, xiaomeng li2 and jiang li1 1dental hospital, jilin university, changchun 130041; 2the key laboratory of molecular epigenetics of moe, institute of genetics and cytology, school of life sciences, northeast normal university, changchun 130024, china; 3department of public health, tohoku university, sendai 980-8576, japan; 4food and nutrition, morioka college, iwate, japan; 5institute of pure and applied biology, bahauddin zakariya university, multan 60800, pakistan. abstract pinocembrin, (5, 7-dihydroxyflavanone), has been shown to possess anticancer activity against various cancer cells. however, its effect against prostate cancer cells remained enigmatic. in this study, for the first time, we investigated whether pinocembrin could inhibit growth of human prostate cancer cells. mtt assay and flow cytometric analysis were performed to examine the effects of pinocembrin on cell proliferation, cell cycle, and apoptosis. the results revealed that pinocembrin attenuated the cell viability of both androgen-sensitive (lncap) as well as androgen-independent (pc3 and du-145) prostate cancer cell lines, with different p53 status. further characterization showed that pinocembrin markedly induced apoptosis of lncap cells and arrested cell cycle at s and g2/m phase and involved in the dissipation of mitochondrial membrane potential before culminating in apoptosis in pinocembrin-treated lncap cells. these in vitro results suggested that pinocembrin should be further examined for in vivo activity in human prostate cancer. article info received: 30 april 2013 accepted: 9 may 2013 available online: 20 may 2013 doi: 10.3329/bjp.v8i3.14795 cite this article: chen z, rasul a, zhao c, millimouno fm, tsuji i, yamamura t, iqbal r, malhi m, li x, li j. anti-proliferative and apoptotic effects of pinocembrin in human prostate cancer cells. bangladesh j pharmacol. 2013; 8: 255-62. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. cause of cancer-related deaths among men in the united states, with similar trends in many western countries (jemal et al., 2010). prevailing treatment options have limited therapeutic success in human prostate cancer, therefore, there is considerable emphasis on identifying novel natural products that selectively induce apoptosis and growth arrest in prostate cancer cells without cytotoxic effects in normal cells (tsao et al., 2004). in the last few decades, several natural compounds have shown a great promise in treatment of cancer and prevention of metastasis; most of the researchers are interested in and are focusing on finding a cure for cancer and several published reports have identified numerous dietary and botanical natural compounds that have chemopreventive potential (rasul et al., 2013; rasul et al., 2012a; rasul et al., 2012c). therefore, novel therapeutic agents and treatment approaches are desired to improve the clinical outcome. for this purpose, therefore, we investigated whether pinocembrin could inhibit growth of both androgensensitive (lncap) as well as androgen-independent (pc3 and du-145) human prostate cancer cell lines, with different p53 status. pinocembrin showed potent anti-proliferative effect against prostate cancer cells. further characterization showed that pinocembrin effectively inhibited the proliferation of lncap cells through arresting cell cycle at s and g2/m phases and induction of apoptosis. material and methods chemical and reagents pinocembrin (figure 1) was purchased from national institute of food and drug control (beijing, china). fetal bovine serum was purchased from hangzhou sijiqing biological engineering materials co., ltd. dmem, mtt [3′-(4,5-dimethyl-thiazol-2-yl)-2,5diphenyl tetrazolium bromide], propidium iodide (pi) and dimethyl sulfoxide (dmso) were purchased from sigma chemical company (st. louis, usa). annexin vfitc apoptosis detection kit was purchased from beyotime institute of biotechnology (shanghai, china). rho-123 was purchased from eugene co. (oregon, u.s.a.). cell culture human prostate cancer lncap cells were propagated in dmem and t-medium (1:1) nutrients mixture supplemented with 10% fbs and antibiotics at 37°c in a humidified atmosphere with 5% co2 and 95% air. cells were seeded in 10 cm culture dish and allowed to grow to a pp rox im a tel y 70 % con fl ue nce be for e experimentation. cell proliferation assay the cytotoxic effects of the pinocembrin on the cells were determined by mtt assay as described previously (rasul et al., 2011a; rasul et al., 2011b). briefly, lncap cells were seeded at a density of 1 × 104 cells per well in 96-well plates and were allowed to grow overnight. cells were incubated with 100 µl of complete culture medium containing 0, 25, 50, 100, 150, and 200 µm of pinocembrin. after incubation for 24 hours, growth of cells was determined by adding 10 µl mtt (5 mg/ml in phosphate buffered saline) to each well and incubated for 4 hours. after removal of the medium, 150 µl dmso was added to each well and shaken carefully. the absorbance was read at a wavelength of 570 nm in a plate reader (elx 800, bio-tek instruments inc.). the growth curve was plotted against mean values which were calculated using the following equation: i% = [a570 (control) a570 (treated)] /a570 (control)× 100 flow cytometric analysis of cell cycle for cell analysis, lncap cells were seeded in 12-well plates and then treated with 100 and 150 µm of pinocembrin for 24 hours. after treatments, the percentages of cells in the different phases of cell cycle were evaluated by determining the dna content after propidium iodide (pi) staining (rasul et al., 2012b). briefly, cells were washed with pbs, trypsinized and centrifuged at 1,000 rpm at 4°c for 5 min. pellets were fixed overnight in 70% cold ethanol. after fixation, cells were washed twice with pbs and incubated in pbs containing rnase (1 mg/ml) for 10 min at room temperature. finally, samples were stained with propidium iodide (1 mg/ml) for 30 min at 4°c. data acquisition was done by flow cytometry (epicsxl-mcl, beckman coulter, us) using cell quest software. flow cytometric determination of apoptosis the apoptotic rate of lncap cells was examined by flow cytometry using annexin v-fitc/pi staining. briefly, lncap cells were cultured in 6-well plates and allowed to attach overnight. cells were treated with 100 and 150 µm of pinocembrin for 24 hours. then cells were collected, washed and resuspended in pbs. apoptotic cell death was measured by double staining annexin v-fitc and pi using the annexin v-fitc apoptosis detection kit (beyotime biotechnology shanghai, 256 bangladesh j pharmacol 2013; 8: 255-262 figure 1: structure of pinocembrin china) according to the manufacturer’s instructions. flow cytometric analysis was performed immediately after staining. data acquisition and analysis were performed by flow cytometry using cell quest software. flow cytometric determination of mitochondrial membrane potential (δψm) to probe the changes in δψm, pc3 cells were stained with rhodamine 123 (1 µm) after treatment of 100 and 150 µm of pinocembrin for 24 hours with control group. the fluorescence of rhodamine 123 was measured by flow cytometry with excitation and emission wavelengths of 488 and 530 nm. statistical analysis of data for the statistical analysis of data, comparisons between results from different groups were analyzed with spss for window version 15.0. p<0.05 value was defined as statistically significant. all experiments were repeated at least three times. results and discussion the investigation was started with screening of natural compounds against androgen-sensitive (lncap) as well as androgen-independent (pc3 and du-145) human prostate cancer cell lines, with different p53 status. we found that pinocembrin exhibited cytotoxic effects on the growth of both androgen-responsive (lncap) as well as androgen-resistant (pc3 and du145) human prostate cancer. pinocembrin is a natural compound that belongs to a flavonoid family. we examined the effects of pinocembrin on the growth of lncap human prostate cancer cells by quantifying the viable cells using mtt assay. pinocembrin attenuated the growth of lncap human prostate cancer cells in a dose-dependent manner (figure 2). morphological changes were observed under phase contrast microscopy after treating cells with 100 and 150 µm of pinocembrin. there was a significant decrease in the number of lncap cells treated with pinocembrin as compared to the control group. furthermore, the cells become round-shaped and poorly adhered to the cultured plates while the control group cells showed a typical polygonal and cobblestone monolayer appearance and remained firmly attached to cultured plates (figure 3). the results revealed that pinocembrin induced growth inhibition of lncap cells, in addition to other type of cancer cells previously reported including colon cancer (kumar et al., 2007; pan et al., 2011; zizic et al., 2013) and leukemia (hsu et al., 2010; salahdeen and murtala, 2012). there are several mechanisms which control the cell cycle to ensure the correct cell division. it is well known that progression of cell cycle is maintained by different check points in normal cells and the transition from one cell cycle phase to another occurs in an orderly fashion. in cancerous cells, some basic modifications occurred in the genetic control of cell division, resulting in an bangladesh j pharmacol 2013; 8: 255-262 257 c el l v ia bi lit y (% o f c on tr ol ) 120 100 80 60 40 20 0 0 25 50 100 150 200 concentration (µm) pc3 du-145 lncap figure 2: pinocembrin inhibited the cell growth and induced cell death in prostate cancer cells. lncap, pc-3 and du-145 cells were treated with indicated doses of pinocembrin for 24 hours and cell viability was measured by mtt assay. data are expressed as mean ± sd (n = 3) 258 bangladesh j pharmacol 2013; 8: 255-262 figure 3: morphological changes in human prostate cancer lncap cells were observed under phase contrast and fluorescence microscopy after treatment with 0, 100 and 150 µm of pinocembrin for 24 hours control 100 150 (µm) p ha se c on tr as t m ic ro sc op y fl uo re sc en ce m ic ro sc op y figure 4: flow cytometry analysis of cell cycle phase distribution in lncap cells treated with 100 and 150 µm pinocembrin for 24 hours. the data shown are representative of two independent experiments with the similar results. ap<0.05 and bp<0.01 compared with the control control 100 150 (µm) g1/g0 = 62.9% s = 26.4% g2/m = 10.7% g1/g0 = 33.6% s = 52.9% g2/m = 14.1% g1/g0 = 15.8% s = 49.8% g2/m = 34.58% 70 60 50 40 30 20 10 0 g0/g1 s g2/m cell cycle r el at iv e ce ll po pu la tio n (% ) control 100 µm 150 µm uncontrolled cell proliferation. as the deregulation of cell cycle progression is the hallmark of cancer; thereby cell cycle regulation could be a potential and effective strategy for the treatment of cancer (grana and reddy, 1995; vermeulen et al., 2003). therefore, we analyzed effect of pinocembrin on cell cycle progression of lncap cells. it was found that pinocembrin arrested cell cycle at s and g2/m phases. the percentage of accumulation of cells in the g2/m phase was increased from 10.7% in control group to 14.1%, and 34.5% in the cells treated with 100 and 150 µm of pinocembrin respectively while s phase was increased from 26.4% in control group to 52.6 and 49.8% respectively for 24 hours (figure 4). these findings revealed that s and g2/m phase cell cycle arrest was one of the mechanisms through which pinocembrin induces cytotoxicity in lncap cells. a number of recent studies have shown that by arresting the cell division at certain checkpoints in the cell cycle, several chemotherapeutic and chemopreventive agents have demonstrated potential anti-proliferative effects (rasul et al., 2013; rasul et al., 2012b). there are various modes of cell death such as apoptosis, autophagy and necrosis (leist and jaattela, 2001). apoptosis is most organized, well fashioned, and systematic mode of cell death, in which cells themselves play an active role in their own death (elmore, 2007; hengartner, 2000). the normal cellular signals for regulation of their growth are lost in the cancerous cells due to various mutations, preventing the cells from apoptosis and cell growth to uncontrolled status (hanahan and weinberg, 2000). the regulation of apoptosis is, therefore, most important in the treatment of cancer (fulda, 2010; lawen, 2003; reed, 2002). the chemopreventive agents, which can treat the cancer effectively, have potential to restore the natural signaling apoptotic pathway (reed, 1999). it is well known that various chemopreventive agents cause cell death through induction of apoptosis in different cancer cells (srivastava and gupta, 2006; xu et al., 2009). we studied whether pinocembrin inhibits cell growth in lncap cells through the induction of apoptosis. pinocembrin-induced apoptosis was determined by flow cytometric analysis. bangladesh j pharmacol 2013; 8: 255-262 259 control 100 150 (µm) b1 b2 b3 b4 103 102 101 100 100 101 102 103 b1 b2 b3 b4 b1 b2 b3 b4 100 101 102 103 100 101 102 103 0 concentration (µm) a po pt os is % 40 30 20 10 0 figure 5: apoptosis induced by pinocembrin in lncap cells. lncap cells were treated with 100 and 150 µm of pinocembrin for 24 hours. then cells were stained with fitc-conjugated annexin v and pi for flow cytometric analysis. the flow cytometry profile represents annexin v-fitc staining in x axis and pi in y axis. the data shown are representative of three independent experiments with the similar results. ap<0.05 and bp<0.01 compared with the control a b for flow cytometric analysis, cells were seeded in the 12 well plates. after incubation of cells without (control) or with pinocembrin for 24 hours, cells were collected in centrifuged tubes and stained with annexin v-fitc and pi double staining as described in material and methods part. the results of flow cytometric analysis showed that rates of apoptosis were 19.2 ± 2.0% and 35.4 ± 2.3% in the cells treated with 100 and 150 µm of pinocembrin respectively for 24 hours as compared to 4.0 ± 0.5% in the control cells (figure 5). pinocembrininduced apoptosis in lncap cells was consistent with previously reported studies in colon cancer (kumar et al., 2007). mitochondria play a fundamental role in the regulation of apoptotic cell death and consist of various proapoptotic proteins and cytochrome c. as highlighted earlier, apoptosis involves a dysfunction of mitochondrial membrane integrity, which leads to cell death (jeong and seol, 2008). previously it has been documented that disintegration of the mitochondrial membrane potential and the redistribution of cytochrome c are crucial actions in the apoptotic cascade (kluck et al., 1997; wang, 2001). cytochrome c plays central role in mitochondrial mediated apoptosis. upon the attenuation of mitochondrial transmembrane potential, cytochrome c releases from the mitochondria into the cytosol (kluck et al., 1997). once released into the cytosol, cytochrome c binds to form an “apoptosome” of apaf-1, cytochrome c, and caspase-9, which subsequently cleaves the effecter caspase-3 (ricci and zong, 2006). the effects of pinocembrin on the mitochondrial membrane potential of lncap cells were determined by flow cytometry using rhodamine 123 staining. the rates of depletion of mitochondrial membrane potential were 84.0 ± 1.3 and 71.2 ± 1.7% in the cells treated with 100 and 150 µm of pinocembrin, respectively, for 24 hours as compared to 96.1 ± 0.4% in the control group (figure 6). these results are similar with previously reported studies in colon cancer (kumar et al., 2007). 260 bangladesh j pharmacol 2013; 8: 255-262 control 100 150 (µm) 100 101 102 103 100 101 102 103 100 101 102 103 concentration (µm) (δ ψ m )% 100 80 60 40 20 0 figure 6: the effects of pinocembrin on mitochondrial transmembrane potential of lncap cells were determined by flow cytometry. the values indicate the percentages of rhodamine 123 fluorescence in the lncap cells treated without and with 100 and 150 µm of pinocembrin for 24 hours. the data shown are representative of three independent experiments with the similar results. ap<0.05 and bp<0.01 compared with the control 0 100 150 a b e e e conclusion pinocembrin induced apoptosis of lncap human prostate cancer cells accompanied by s and g2/m phase cell cycle arrest. further characterization showed that pinocembrin involved in dissipation of mitochondrial membrane potential before culminating in apoptosis in pinocembrin-treated lncap cells. acknowledgments this study was supported by ministry of science and technology (no. 2010dfa31430), ministry of education of china (ncet-10-0316; 101020031), jilin provincial science & technology department (no. yyzx201241, 20070719, and 200905116); changchun science & technology department (no. 2011114-11gh29) and national natural science foundation of china (nos.30871301). references adams jm, cory s. the bcl-2 apoptotic switch in cancer development and therapy. oncogene 2007; 26: 1324-37. amin ar, kucuk o, khuri fr, shin dm. perspectives for cancer prevention with natural compounds. j clin oncol. 2009; 27: 2712-25. burlacu a. regulation of apoptosis by bcl-2 family proteins. j cell mol med. 2003; 7: 249-57. cragg gm, newman dj. plants as a source of anti-cancer agents. j ethnopharmacol. 2005; 100: 72-79. danial nn. bcl-2 family proteins: critical checkpoints of apoptotic cell death. clin cancer res. 2007; 13: 7254-63. diaz napal gn, carpinella mc, palacios sm. antifeedant activity of ethanolic extract from flourensia oolepis and isolation of pinocembrin as its active principle compound. bioresour technol. 2009; 100: 3669-73. elmore s. apoptosis: a review of programmed cell death. toxicol pathol. 2007; 35: 495-516. estevinho l, pereira ap, moreira l, dias lg, pereira e. antioxidant and antimicrobial effects of phenolic compounds extracts of northeast portugal honey. food chem toxicol. 2008; 46: 3774-79. feng r, guo zk, yan cm, li eg, tan rx, ge hm. antiinflammatory flavonoids from cryptocarya chingii. phytochemistry 2012; 76: 98-105. fulda s. evasion of apoptosis as a cellular stress response in cancer. int j cell biol. 2010; 2010: 370835. grana x, reddy ep. cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (cdks), growth suppressor genes and cyclin-dependent kinase inhibitors (ckis). oncogene 1995; 11: 211-19. hanahan d, weinberg ra. the hallmarks of cancer. cell 2000; 100: 57-70. hengartner mo. the biochemistry of apoptosis. nature 2000; 407: 770-76. hsu cl, yu ys, yen gc. anti-cancer effects of alpinia pricei hayata roots. j agric food chem. 2010; 58: 2201-08. jaganathan sk, mandal m. anti-proliferative effects of honey and of its polyphenols: a review. j biomed biotechnol. 2009; 2009: 830616. jemal a, siegel r, xu j, ward e. cancer statistics, 2010. ca cancer j clin. 2010; 60: 277-300. jeong sy, seol dw. the role of mitochondria in apoptosis. bmb rep. 2008; 41: 11-22. jiang h, morgan ja. optimization of an in vivo plant p450 monooxygenase system in saccharomyces cerevisiae. biotechnol bioeng. 2004; 85: 130-137. kluck rm, bossy-wetzel e, green dr, newmeyer dd. the release of cytochrome c from mitochondria: a primary site for bcl-2 regulation of apoptosis. science 1997; 275: 1132-36. kumar ma, nair m, hema ps, mohan j, santhoshkumar tr. pinocembrin triggers bax-dependent mitochondrial apoptosis in colon cancer cells. mol carcinog. 2007; 46: 231-41. lawen a. apoptosis: an introduction. bioessays 2003; 25: 88896. leist m, jaattela m. four deaths and a funeral: from caspases to alternative mechanisms. nat rev mol cell biol. 2001; 2: 589-98. li l, yue gg, lau cb, sun h, fung kp, leung pc, han q, leung ps. eriocalyxin b induces apoptosis and cell cycle arrest in pancreatic adenocarcinoma cells through caspase and p53-dependent pathways. toxicol appl pharmacol. 2012; 262: 80-90. mallat z, tedgui a. apoptosis in the vasculature: mechanisms and functional importance. br j pharmacol. 2000; 130: 94762. miyahisa i, funa n, ohnishi y, martens s, moriguchi t, horinouchi s. combinatorial biosynthesis of flavones and flavonols in escherichia coli. appl microbiol biotechnol. 2006; 71: 53-58. pan l, matthew s, lantvit dd, zhang x, ninh tn, chai h, carcache de blanco ej, soejarto dd, swanson sm, kinghorn ad. bioassay-guided isolation of constituents of piper sarmentosum using a mitochondrial transmembrane potential assay. j nat prod. 2011; 74: 2193-99. rasul a, bao r, malhi m, zhao b, tsuji i, li j, li x. induction of apoptosis by costunolide in bladder cancer cells is mediated through ros generation and mitochondrial dysfunction. molecules 2013; 18: 1418-33. rasul a, ding c, li x, khan m, yi f, ali m, ma t. dracorhodin perchlorate inhibits pi3k/akt and nf-kappab activation, up-regulates the expression of p53, and enhances apoptosis. apoptosis 2012a; 17: 1104-19. rasul a, khan m, yu b, ma t, yang h. xanthoxyletin, a coumarin induces s phase arrest and apoptosis in human gastric adenocarcinoma sgc-7901 cells. asian pac j cancer prev. 2011a; 12: 1219-23. rasul a, song r, wei w, nishino y, tsuji i, li x, li j. bangladesh j pharmacol 2013; 8: 255-262 261 tubeimoside-1 inhibits growth via the induction of cell cycle arrest and apoptosis in human melanoma a375 cells. bangladesh j pharmacol. 2012b; 7: 150-56. rasul a, yu b, yang lf, ali m, khan m, ma t, yang h. induction of mitochondria-mediated apoptosis in human gastric adenocarcinoma sgc-7901 cells by kuraridin and nor-kurarinone isolated from sophora flavescens. asian pac j cancer prev. 2011b; 12: 2499-2504. rasul a, yu b, zhong l, khan m, yang h, ma t. cytotoxic effect of evodiamine in sgc-7901 human gastric adenocarcinoma cells via simultaneous induction of apoptosis and autophagy. oncol rep. 2012c; 27: 1481-87. reed jc. bcl-2 family proteins. oncogene 1998; 17: 3225-36. reed jc. dysregulation of apoptosis in cancer. j clin oncol. 1999; 17: 2941-53. reed jc. apoptosis-based therapies. nat rev drug discov. 2002; 1: 111-21. ricci ms, zong wx. chemotherapeutic approaches for targeting cell death pathways. oncologist 2006; 11: 342-57. salahdeen hm, murtala ba. vasorelaxant effects of aqueous leaf extract of tridax procumbens on aortic smooth muscle isolated from the rat. j smooth muscle res. 2012; 48: 37-45. srivastava jk, gupta s. tocotrienol-rich fraction of palm oil induces cell cycle arrest and apoptosis selectively in human prostate cancer cells. biochem biophys res commun. 2006; 346: 447-53. tsao as, kim es, hong wk. chemoprevention of cancer. ca cancer j clin. 2004; 54: 150-80. vermeulen k, van bockstaele dr, berneman zn. the cell cycle: a review of regulation, deregulation and therapeutic targets in cancer. cell prolif. 2003; 36: 131-49. wang x. the expanding role of mitochondria in apoptosis. genes dev. 2001; 15: 2922-33. xu y, chiu jf, he qy, chen f. tubeimoside-1 exerts cytotoxicity in hela cells through mitochondrial dysfunction and endoplasmic reticulum stress pathways. j proteome res. 2009; 8: 1585-93. zizic jb, vukovic nl, jadranin mb, andelkovic bd, tesevic vv, kacaniova mm, sukdolak sb, markovic sd. chemical composition, cytotoxic and anti-oxidative activities of ethanolic extracts of propolis on hct-116 cell line. j sci food agric. 2013. 262 bangladesh j pharmacol 2013; 8: 255-262 author info jiang li; xiaomeng li (principal contact) e-mail: lijiang69@yahoo.com.cn; lixm441@nenu.edu.cn dateprinted: this article was downloaded by you on: jul 04, 2018 bangladesh journal of pharmacology research article gcgcgc---ms analysis, evaluation of phy-ms analysis, evaluation of phy-ms analysis, evaluation of phytochemicals, antitochemicals, antitochemicals, anti---oxidant, throm-oxidant, throm-oxidant, thrombolytic and antibolytic and antibolytic and anti---inflammatory activ-inflammatory activ-inflammatory activiiitttiiieeesss ooofff exacum bicolor exacum bicolor exacum bicolor bjp introduction oxidative stress plays a pivotal role in the development of human diseases (rajendran et al., 2014). antioxidants that can scavenge or neutralise the reactive oxygen species are beneficial in reducing the oxidative stress (bandyopadhyay et al., 1999). plants rich in antioxidants have ability to protect against oxidative cell damage that can lead in the treatment of many human diseases including diabetes, cancer, alzheimer's, cardiovascular diseases, chronic inflammation, thrombus formation and several degenerative diseases in humans (danino et al., 2008; deore et al., 2008; dinstel et al., 2013). the free radical scavenging molecules such as flavonoids, phenols, tannins, alkaloids, amines, vitamins and other metabolites possess anti-inflammatory, thrombolytic, anti-carcinogenic, antibacterial and antiviral activities (filomena et al., 2008). inflammation is a key factor in all aspects of coronary disease including the initiation and progression of atherosclerotic plaque, plaque rupture, and thrombosis (atherothrombosis) where the oxidative stress is known to play a significant role (freedman, 2008). oxidative stress and inflammation are intimately linked with both the evolution of cardiovascular disease and acute coronary syndromes (pashkow, 2011). due to short comings present in the synthetic drugs, research has been directed towards the development of herbal medicine which are considered safer due to their natural activity. exacum bicolor roxb., a member of family gentianaceae, is a herbaceous plant possessing anti-oxidant and anthelmintic activities (ashwini and majumdar, 2014; ashwini and majumdar, 2015). ethanopharmacologically e. bicolor is used for curing human ailments like diabetes, malaria, skin disorders, fungal diseases and inflammation (marles and farnsworth, 1995; reddi et al., 2005; pullaiah, 2006; khare, 2007). no scientific report is a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 745-752 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the aim of the present study was to investigate the gc-ms analysis, phytochemical screening, anti-oxidant, thrombolytic and anti-inflammatory activities of methanol extract of leaves of exacum bicolor. ftir analysis confirmed the presence of alcohol, phenols, alkanes, aromatic compounds, aldehyde and ethers. gc-ms analysis revealed the presence of eight phytoconstituents. the total phenol, flavonoid and alkaloid contents were 18.0 ± 0.2 mg/gae/g, 13.1 ± 0.4 mg qe/g and 108.0 ± 1.2 mg ae/g respectively. the dpph assay exhibited potent anti-oxidant abilities with ic50 8.8 µg/ml. significant thrombolytic activity was demonstrated by clot lysis method (45.1 ± 0.8%). the methanol extract showed significant membrane stabilization on human red blood cell with ic50 value of 37.4 µg/ml. there was a significant correlation (r2>0.98) with total phenolic content versus anti-oxidant and antiinflammatory activity. the above results confirmed that e. bicolor could be a promising anti-oxidant, thrombolytic and anti-inflammatory agent. article info received: 9 june 2015 accepted: 26 june 2015 available online: 22 september 2015 doi: 10.3329/bjp.v10i4.23610 cite this article: ashwini am, puttarudrappa l, ravi bv, majumdar m. gc-ms analysis, evaluation of phytochemicals, antioxidant, thrombolytic and antiinflammatory activities of exacum bicolor. bangladesh j pharmacol. 2015; 10: 745-52. gc-ms analysis, evaluation of phytochemicals, anti-oxidant, thrombolytic and anti-inflammatory activities of exacum bicolor appaji mahesh ashwini1, latha puttarudrappa2, belagumba vijaykumar ravi2 and mala majumdar1 1department of biotechnology, centre for postgraduate studies, jain university, bangalore, karnataka 560 011, india; 2departments of biochemistry, kempegowda institute of medical sciences, bangalore, karnataka 560 070, india. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. available till date to validate these folkloric uses. e. bicolor is endemic to peninsular india and presently considered as an endangered species (sreelatha et al., 2007; brilliant et al., 2012). chemically e. bicolor consists of protocatechuic, apigenin, luteolin, vanillic, ρ-coumaric acids, secoiridoids and ρ-hydroxybenzoic (das et al., 1985; khare, 2007). hence, the present study is focussed to evaluate the anti-inflammatory and thrombolytic activities for the first time. materials and methods plant collection and extraction plant material was collected from kumar parvatha, western ghats, karnataka and authenticated by regional research institute bangalore, india (accession no.: 557). the leaves were dried at room temperature in the shade. twenty grams of the dried powdered leaves sample was soaked in 150 ml of methanol and was shaken intermediately. after 7 days the solution was filtered and was evaporated to dryness. infrared spectral analysis the methanol leaf extract of e. bicolor was subjected to ir spectrum which was determined using fourier transform infrared spectrophotometer (ftir-perkinelmer). the extract was ground with kbr powder and then pressed into pellets for ftir measurement in the frequency range of 4,000–400 cm-1 (bunghez et al., 2011). gas chromatography-mass spectrometry (gc-ms) analysis the methanol leaf extract was subjected for gc-ms analysis equipped with thermo gc-trace ultra ver: 5.0, thermo ms dsq ii and equipped with column db 5ms capillary standard non-polar (length 30 m x inner diameter 0.25 mm film thickness 0.25 μm) was used for analysis. helium gas was used as the carrier gas at constant flow rate 1 ml/min and an injection volume of 1 μl. the oven injector temperature 70°c and raised to 260°c at 6°c/min. overall runtime was 40.5 min. identification of components interpretation on mass spectrum gc-ms was conducted using the database of national institute standard and technology (nist) having more than 62,000 patterns. the spectrum of the unknown component was compared with relative retention time and mass spectra of the known components stored in the nist library. preliminary phytochemical screening the preliminary qualitative phytochemical study of the methanol leaves extract were screened for alkaloids (meyer’s test), flavonoids (shinoda test), saponin, steroids, terpenoids, glycosides (salkowski’s test), phenols, tannins, amino acids, proteins (ninhydrin test), carbohydrates (fehling’s test), coumarins, quinones, oxalates and phlobotannins and acids (harborne, 1973). total phenols the total phenolics content in methanol extract was determined by fc method with minor modifications (singleton and rossi 1965). to 1 ml of extract (25, 50, 75, 100 µg/ml) 0.5 ml fcr (diluted 1:10 v/v) was added and allowed to stand for 5 min. to the above solution 20% sodium carbonate (1 ml) was added and allowed to stand for half hour in dark. the sample was read against the blank at 765 nm using uv-spectrophotometer. results were expressed as in mg/g of dry weight of gallic acid equivalent (gae) which was used as standard. all experiments were carried out in triplicates and represented as mean ± se. estimation of flavonoids total flavonoid content was determined by aluminium chloride method using quercetin as a standard (chang et al., 2002). 1 ml of plant extract (25, 50, 75, 100 µg/ ml) and 0.5 ml of 5% sodium nitrite was added to the above solution 0.5 ml of 10% aluminium chloride was added. incubated at room temperature for 6 min and 2 ml of 1 m sodium hydroxide was added to the reaction mixture. volume was made up with distilled water and the absorbance was measured at 420 nm spectrophotometrically. results were expressed as quercetin equivalents (mg qe/g dry weight). all the tests were performed in triplicates and represented as mean ± se. estimation of alkaloids alkaloids were estimated according to shamsa et al. (2008). e. bicolor methanolic extract (100 mg) was dissolved in 2 n hcl. 1 ml of the filtrate was washed with chloroform. the ph of the solution was adjusted to 7 with 0.1 n naoh. atropine was used as standard to which bcg solution and phosphate buffer was added. the mixture was shaken well and using chloroform and made up to 10 ml in a volumetric flask. the absorbance was measured at 470 nm against the blank. the values were expressed as atropine equivalent (ae) mg/g dry weight. all experiments were carried out in triplicates and represented as mean ± se. anti-oxidant assay dpph (1,1-diphenyl-2-picrylhydrazyl) radical scavenging activity free radical scavenging activity of e. bicolor methanol extract was determined according to braca et al. (2003). the reaction mixture consist of extract (25, 50, 75, 100 µg/ml), 2 ml of 0.002% methanol solution of dpph. this solution was incubated for 30 min in dark. the absorbance was read at 517 nm using spectrophotometer. control was prepared by omitting the extracts, 746 bangladesh j pharmacol 2015; 10: 745-752 ascorbic acid was used as standard and the percentage inhibition activity was calculated using the equation: %inhibition = [(acontrol-aextract)/acontrol] × 100 where acontrol is the absorbance of the control and aextract the absorbance of the extract. all the tests were performed in triplicates represented as mean ± se. abts·+[2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid)+] radical cation scavenging assay abts radical cation decolorization assay was determined with minor modifications (katalinic et al., 2006). abts·+ was produced by reacting 2 mm abts with 17 mm potassium persulfate and allowed to stand in dark at room temperature for 12-16 hours before use. to 1 ml of extract (25, 50, 75, 100 µg/ml) 2 ml of abts reagent was added. the absorbance was read at 734 nm and percentage inhibition was calculated using formula. ascorbic acid was used as standard. % scavenging activity= [(a0-at)/a0] × 100. where a0 is the absorbance of the control and at is the absorbance of the extract. all the tests were performed in triplicates and represented as mean ± se. in vitro thrombolytic activity the thrombolytic activity was evaluated by the previously developed method (prasad et al., 2007). streptokinase (sk) vial was procured commercially of the brand name myokinase manufactured by biocon (india) ltd., bangalore of 15,00,000 i.u. 5 ml of distilled water was used to dissolve. 100 μl (30,000 i.u) from the stock was used for further studies. blood sample was drawn from human volunteers (n=50) who are healthy and do not show any history of acquiring oral contraceptive or undergoing anticoagulant therapy. 100 mg of powdered extract was dissolved in 10 ml distilled water. blood was collected and distributed in pre weighed sterile eppendorf tube (0.5 ml/tube) and incubated at 37°c for 45 min. after clot formation, the serum was completely removed without disturbing the clot and each tube with the clot was again weighed to determine the clot weight (clot weight = weight of clot with tube – weight of empty tube). to each preweighed tube containing the clot, 100 μl of e. bicolor methanol leaf extract (test extract), sk (positive control) and distilled water (negative control) were separately added to the tubes. tubes were incubated at 37°c for 90 min. the fluid released after the incubation period was removed and tubes were weighed again to observe the difference in weight after clot disruption. percentage of clot lysis was calculated by calculating the weight that is taken before and after clot. in vitro anti-inflammatory activity anti-inflammatory activity was assessed by human red blood cell (hrbc) membrane stabilization method (gandhisan et al., 1991). the blood sample was collected from healthy human volunteer. equal volume of alsever solution (2% dextrose, 0.8% sodium citrate, 0.5% citric acid and 0.42% nacl) was mixed and centrifuged at 3,000 rpm. the packed cells were washed with isosaline for 3 times and 10% suspension was made with isosaline. various concentration of extracts (25, 50, 75, 100 µg/ml), 1 ml of phosphate buffer, 2 ml hyposaline and 0.5 ml of hrbc suspension were added. it was incubated at 37°c for 30 min and later centrifuged at 3,000 rpm for 20 min. the haemoglobin content of the supernatant solution was estimated at 560 nm spectrophotometrically. diclofenac (10, 25, 50, 75, 100 µg/ml) was used as reference standard and control was prepared by omitting the extracts. the percentage of hemolysis and protection of hrbc membrane was calculated as follows: %hemolysis = (od of test sample /od of control) x 100 %protection = 100 – %hemolysis statistical analysis all the results are expressed as mean ± sem. ic50, percentage of clot lysis analysis was done using graph pad prism 6 using anova with post hoc analysis by dmrt. p values ≤0.05 were considered to be significant. the correlation coefficient (r2) values of all the different concentration of extracts between total phenols with dpph assay and anti-inflammatory activities were evaluated. results the ftir spectrum (figure 1) analysis revealed the identity of the functional groups of the active components present in the plant based on the peaks and the values in the ir region. e. bicolor exhibited characteristic absorption bands at 3436, 2919, 1689, 1604, 1402, 1370, 1239, 1101 and 1080 cm-1. these results of ftir analysis confirmed the presence of alcohols, phenols, alkanes, amines, aromatic compound, aldehyde and ethers. the gc-ms analysis of phytoconstituents in methanol extract of leaves of e. bicolor revealed the presence of eight major phytoconstituents (figure 2; table i). the identification of the compounds was confirmed based on the retention time, peak area and the molecular formula. the major phytocomponents reported are 1methyl 2-(3-oxocyclohexyenyl)imidazole (5.8%), erythrocentaurin (1.0%), neophytadiene (4.0%), hexadecanoic acid (5.4%), 6-octadeccenoic acid (12.0%), (+-)-inophylum d (2.7%), 4,6,8(14)-cholestatriene (6.0%) and methyl 3,4diphenylpyrrolo[2,1,5-cd] indolizine-1-carboxylate (5.5%). the preliminary qualitative phytochemical screening of the methanol extract revealed the presence of alkaloids, flavonoids, saponin, steroids, terpenoids, glycosides, bangladesh j pharmacol 2015; 10: 745-752 747 phenols, tannins, amino acids, proteins, carbohydrates and acids. the quantitative analysis of e. bicolor leaf methanol extract was based on the total phenols flavonoids and alkaloids. the total phenols, flavonoid and alkaloid content in methanol extract were found to be 18 ± 0.2 mg/ gae/g, 13.1 ± 0.4 mg qe/g and 108 ± 1.2 mg ae/g respectively. the results of dpph assay showed that methanol extract of e. bicolor had a good inhibitory activity in dose-dependent manner. the percentage inhibition of methanol extract was 91.8% at 100 µg/ml concentration with an ic50 value of 8.8 µg/ml. in terms of abts cation radical scavenging assay, the percentage inhibition of e. bicolor leaf extract was 76.9% at 100 µg/ml concentration with an ic50 value of 43.7 µg/ml. the extract also exhibited dose dependent inhibitory activity. ascorbic acid was used as standard for both dpph and abts assay with the ic50 value of 6.0 µg/ml and 11.3 µg/ml respectively. in the present study, thrombolytic activity was evaluated by clot disruption method. streptokinase, positive control, showed 54.8 ± 0.7% clot lysis. clots when treated with sterile distilled water (negative control) showed only 8.3 ± 0.5% of clot lysis. the mean difference in clot lysis percentage between positive and negative control was significant (p<0.0001). the tested methanolic extract of e. bicolor exhibited 45.1 ± 0.8% of clot lysis. in vitro anti-inflammatory activity of e. bicolor extracts at different concentrations showed significant stabilizafigure 1: ftir spectrum of e. bicolor (leaf) methanol extract figure 2: gc-ms analysis of exacum bicolor methanol leaf extract table i chemical profile identified by gc-ms analysis of methanol leaf extract of e. bicolor sl. no. rt compounds molecular formula mw %area 1 16.51 1-methyl 2-(3-oxocyclohexyenyl)imidazole c10h12n2o 176 5.8 2 17.72 erythrocentaurin c10h8o3 176 1.0 3 20.26 neophytadiene c20h38 278 4.0 4 22.01 hexadecanoic acid c17h34o2 270 5.4 5 25.33 6-octadeccenoic acid c19h36o2 296 12.0 6 28.78 (+-)-inophylum d c25h24o5 404 2.7 7 33.13 4,6,8(14)-cholestatriene c27h42 366 6.0 8 34.35 methyl 3,4-diphenylpyrrolo[2,1,5-cd] indolizine-1-carboxylate c24h17no2 351 5.5 cm-1 % t r el at iv e a bu nd an ce time (min) rt: 0.00 40.52 sm: 11g 100 90 80 70 60 50 40 30 20 10 0 0 5 10 15 20 25 30 35 40 6.49 9.62 13.58 16.51 20.26 22.01 25.33 28.78 34.35 37.78 nl: 9.26e6 tic ms c– 272 3500 3000 2500 2000 1500 1000 500 87 86 85 84 83 82 81 80 748 bangladesh j pharmacol 2015; 10: 745-752 tion towards hrbc membranes. the percentage protection (figure 3) at concentration 100 µg/ml was more when compared to the other concentrations in e. bicolor (84.6 ± 2.6%) and diclofenac (92.3 ± 4.4%) as standard. the ic50 values of e. bicolor and diclofenac were 37.4 and 28.0 µg/ml respectively. a positive, correlation of r2=0.9867 was found between the total phenols and dpph assay which was highly significant (p=0.007). whereas the total phenols were also significantly (p=0.006) correlated with anti-inflammatory activity (r2= 0.9916). discussion ft-ir showed typical bands arising as a result of strong o-h stretching (3550-3200 cm-1) intramolecular bonds. other bands, occurred at 3000-2840 cm-1 (c-h stretching), 1710-1685 cm-1, showed strong (c=o stretching) conjugated aldehyde peaks at 1650-1600 cm-1 resulted in medium (c=c stretching) conjugated alkene, signals at 1150-1085 cm-1 gave strong (c-o stretching) aliphatic ether, 1450-1375 cm-1 resulted medium c-h bending alkane with methyl group, at 10851050 cm-1 strong (co stretching) primary alcohol. based on the ft-ir spectrum, e. bicolor leaf extract contains various phytocompounds with functional groups such as phenols, amines, aldehyde, alkanes, carboxylic acids and alcohols. the gc-ms analysis of the plant extracts are becoming a valuable tool for detection of phytochemicals which can be aimed before the process of large scale purification (vinay et al., 2014). in the present study, the gc-ms analysis of methanol extract of e. bicolor majorly contained phenols, alkanes, terpenoids, alka loids which might be responsible for various medici nal activities (sellamuthu et al., 2009). according to the previously reported literature erythrocentaurin, a monoterpene alkaloid has also been identified from enicostemmahys sopifolium and swertia lawii (ghosal et al., 1974). neophytadienea (major component) and hexadecanoic acid were also present in centaurium erythraea (jovanovic et al., 2009) which belongs to family gentianaceae. the present study was in accordance with the above literature. phytochemicals or secondary metabolites are chemical compounds which are formed during the plants normal metabolic processes and plants use them to protect themselves during stress related conditions (ning et al., 2009). in the current study, the leaf extract of e. bicolor possesses 18 ± 0.2 mg/ gae/g of phenols, 13.1 ± 0.4 mg qe/g of flavo noids, 108 ± 0.0 mg ae/g of alkaloids when deter mined spectrophotometrically. according to baba and malik (2014), gentiana kurroo methanol leaf extract showed 34 ± 1.8 mg gae/g of phenols and 20 ± 1.5 mg re/g flavonoids respectively. the total phenols in methanol extract of s. chirata were about 38.4 ± 0.4 mg gae/g (tupe et al., 2013). phenolic compounds are widely distributed in various plant species which have received considerable attention (li et al., 2006). phenolic anti-oxidants provided tremendous potential benefits because of their ability to scavenge reactive oxygen species (bakirel et al., 2008). the total anti-oxidant power evaluates health beneficial effects because of the co-operative action of antioxidants. therefore, it is desirable to measure the radical scavenging capacity level by more than one method (fu et al., 2014). dpph anti-oxidant scavenging assay is based on the ability of dpph, to decolorize in the presence of antioxidants. the visible deep purple color is produced due to the dpph free radical which contains an odd electron. when dpph accepts an electron donated by an anti-oxidant compound, the dpph is decolorized which can be quantitatively measured by absorbance (nuengchamnong et al., 2009). the methanolic extract of e. bicolor in the present study exhibited potent antioxidant activity at 100 µg/ml (91.2 ± 0.7%) with lower ic50 value (8.8 µg/ml). according to vaijanathappa et al. (2008) the ic50 value of methanol extract of enicostemma axillare was 325.5 ± 5.9 µg/ml. in case of s. chirata, ic 50 value was 87.6 ± 0.4 (tupe et al., 2013). according to baba and malik (2014), gentiana kurroo showed 91% of inhibition at 600 µg/ml. in comparison to earlier findings, e. bicolor exhibited relatively strong radical scavenging activities and might serve as effective radical scavenger. abts method has chromophores which are soluble in both aqueous and organic solvents, and may therefore serve the need to simultaneously measure hydrophilic and lipophilic anti-oxidants (cekic et al., 2009). in this assay, abts radical cation was generated directly in figure 3: in vitro anti-inflammatory activity by hrbc membrane stabilization method of standard diclofenac and e. bicolor concentration (µg/ml) % p ro te ct io n 25 50 75 100 c c b b b b a a diclofenac e. bicolor100 80 60 40 20 0 bangladesh j pharmacol 2015; 10: 745-752 749 stable form using potassium persulfate and the antioxidant activity is measured in terms of decolorization (sanchez-moreno 2002). the free radical scavenging ability of e. bicolor was determined using abts radical cation which exhibited 76.9 ± 0.9% inhibition and the ic50 value was 43.7 µg/ml. tupe et al., (2013) reported that in s. chirata the ic50 value was 71.7 ± 1.7 µg/ml. but the present study with e. bicolor showed better anti-oxidant capacities when compared to s. chirata. atherothrombotic diseases occur as serious impacts of the thrombus formed in the blood vessels. thrombolytics dissolve blood clots and are used in treating myocardial infarction, cerebral stroke, high cholesterol hypertension, hypotension, arrhythmias, congestive heart failure, coronary artery disease, unwanted blood clots and arteriosclerosis (american pharmacist association, 2010). the synthetic drugs have limitations and can lead to serious and sometimes fatal consequences. studies have been conducted to find plants having antithrombotic compound which might lead to lower or no adverse effects (prasad et al., 2007). in case of e. bicolor, the methanol leaf extract was assessed by clot disruption method which revealed 45.1 ± 0.8% of clot lysis while the streptokinase (positive control) and water (negative control) demonstrated 56.2 ± 0.6% and 8.3 ± 0.5% lysis of clot respectively. the results were also statistically significant (p<0.0001). according to the previous study, s. chirata showed clot lysis of 46.1% and 31.9% in ethanolic and chloroform extract respectively (hossain et al., 2012). according to dhande et al., (2014) the crude extracts of s. chirata were found to have significant (p<0.01) thrombolytic activity at 1 mg/ ml. whereas, the e. bicolor methanolic leaf extract showed better thrombolytic activity with lower concentration (100 µg/ml) when compared to the above study. plants with anti-oxidants properties are used for minimizing the inflammation related diseases (wong et al., 2006). erythrocyte membrane is an analogue of lysosomal membrane. the plant extract plays an important role in stabilizing lysosomal membrane which limits the inflammatory response by preventing the release of activated neutrophils, which might further cause tissue damage and inflammation (murugasan et al., 1981). the extract may inhibit this process and acts as an anti-inflammatory compound. investigation on in vitro anti-inflammatory activity by human red blood cell membrane stabilization method in e. bicolor exhibited 87.2 ± 2.6% of protection at 100 µg/ml with ic50 value of 37.4 µg/ml, whereas leelaprakash and dass (2011) reported 30 ± 0.0% inhibition of hemolysis in enicostemma axillare methanol extract of which the present study exhibited potent anti-inflammatory activity. in order to understand the relationship between the anti-oxidant activity with total phenolic content, the correlation between the dpph scavenging activity and the total phenolics were measured. our results revealed that there is a strong and significant correlation (r2=0.9867) between total phenolic content and dpph free radical scavenging activity. there was also a positive correlation between total phenol contents and anti-inflammatory activity (r2 = 0.9916). conclusion methanolic leaf extract of e. bicolor possesses phytochemicals which might be playing a major role in antioxidant, anti-inflammatory and thrombolytic activities. the positive correlation between total phenolic content with dpph scavenging capacities and anti-inflammatory activity showed that total phenols might be the major contributor for these biological activities. e. bicolor extracts may be exploited as a source of beneficial compounds for oxidative stress related diseases in humans. ethical issue the collection of blood sample from the human volunteers was done with the approval by institutional ethics committee of kempegowda institute of medical sciences (kims), bangalore, karnataka with registration no. ecr/216/inst/kar/2013. the volunteer donors were supplied with a consent form which informed detail of investigations. acknowledgement the authors are thankful to management of jain university for providing all the infrastructural facilities and financial support to carry out the research work. references american pharmacist association. the pharmacy technician, 4th ed. englewood, morton publishing company, 2010, p 434. ashwini am, majumdar m. qualitative phytochemical screening and in vitro anthelmintic activity of exacum bicolor roxb., an endemic medicinal plant from western ghats in india. acta biol ind. 2014; 3: 510-14. ashwini am, majumdar m. quantification of phytochemical contents and in vitro anti-oxidant activity of exacum bicolor (roxb.), an endemic medicinal plant. int j pharm pharma sci. 2015; 7: 225-30. baba sa, malik sa. evaluation of anti-oxidant and antibacterial activity of methanolic extracts of gentiana kurroo royle. saudi j biol sci. 2014; 21: 493-98. bakirel t, bakirel u, keleş ou, ulgen sg, yardibi h. in vivo assessment of antidiabetic and anti-oxidant activities of rosemary (rosmarinus officinalis) in alloxan-diabetic rabbits. j 750 bangladesh j pharmacol 2015; 10: 745-752 ethnopharmacol. 2008; 116: 64-73. bandyopadhyay u, das d, banerjee rk. reactive oxygen specie: oxidative damage and pathogenesis. curr sci. 1999; 77: 658-66. braca a, politi m, sanogo r, sanou h, morelli i, pizza c, tommasi nd. chemical composition and anti-oxidant activity of phenolic compounds from wild and cultivated sclero caryabirrea (anacardiaceae) leaves. j agric food chem. 2003; 51: 6689-95. brilliant r, vincy mv, joby p, pradeepkumar. ap vegetation analysis of montane forest of western ghats with special emphasis on ret species. ijbc 2012; 4: 652-64. bunghez ir, raduly m. doncea s, aksahin i, ion rm. lycopene determination in tomatoes by different spectral techniques (uv–vis, ftir, and hplc). dig j nanomater bioest. 2011; 6: 1349-56. cekic sdc¸ baskan kn, tütem e, apak r. modified cupric reducing anti-oxidant capacity (cuprac) assay for measuring the anti-oxidant capacities of thiol-containing proteins in admixture with polyphenols. talanta 2009; 79: 344-51. chang c, yang m, wen h, chern j. estimation of total flavonoid content in propolis by two complementary colorimetric methods. j food drug anal. 2002; 10: 178-82. danino o, gottlieb he, grossman s, bergman m. anti-oxidant activity of 1,3-dicaffeoylquinic acid isolated from inula viscosa. food res int. 2008; 42: 1273-80. das s, barua, rn, sharma rp, baruah, jn, kulanthaivela p, herza w. secoiridoids from exacum tetragonum. phytochemistry 1985; 23: 908-09. deore sl, khadabadi ss, daulatkar vd, deokate ua, farooqui iu. evaluation of hypoglycemic and anti-diabetic activity of bark of butea monosperma. pharmacog mag. 2008; 4: 134-38. dhande sr, aakruti ak, kalpana ap, vilasrao k. antihyperlipidemic activity of bambusa bambos (druce.) and swertia chirata (buch-ham) in cholesterol suspension induced hypercholesterolemia in rats. int j pharm pharm sci. 2014; 6: 607-10. dinstel rr, cascio j, koukel s. the anti-oxidant level of alaska's wild berries: high, higher and highest. int j circumpolar health. 2013; 72: 796-802. filomena c, sosa s, mariangela m, statti f, uzunov g, tubaro d, menichini a, loggia f, della r. in vivo antiinflammatory and in vitro anti-oxidant activities of mediterranean dietary plants. j ethanopharma. 2008; 116: 144-51. freedman je. oxidative stress and platelets. arterioscl throm vas. 2008; 28: 11-16. fu r, zhang yt, guo yr, liu fx, chen f. determination of phenolic contents and anti-oxidant activities of extracts of jatropha curcas l. seed shell, a by-product, a new source of natural anti-oxidant. indian crop prod. 2014; 58: 265-70. gandhisan r, thamaraichelvan a, baburaj. anti-inflammatory action of lannea coromandelica hrbc membrane stabilization. fitotherapia 1991; 62: 82-83. ghosal s, singh ak, sharma pv, chaudhuri rk. chemical constituents of gentianacceae ix: natural occurrence of erythrocentaurin in enicostemma hissopifolium and swertia lawii. j pharm sci. 1974; 63: 944-45. harborne jb. phytochemical methods. london, chapman and hall ltd, 1973. hossain sm, sharmin if, sheikh t, hasan h, rashedul am. in vitro anti-oxidant, membrane stabilizing and thrombolytic activities of glycosmis arborea. j pharm biol sci. 2012; 15: 14143. jovanović o, radulović n, stojanović g, palić r, zlatković b, gudžić b. chemical composition of the essential oil of centaurium erythraea rafn (gentianaceae) from serbia. j essent oil res. 2009; 21: 317-22. katalinic v, milos m, kulisic t, jukicm. screening of 70 medicinal plant extracts for anti-oxidant capacity and total phenols. food chem. 2006; 94: 550-57. khare cc. indian medicinal plants: an illustrated dictonary. berlin, springer verlag, 2007, pp 699-700. leelaprakash g, dass sm. in vitro anti-inflammatory activity of methanol extract of enicostemma axillare. int j drug dev res. 2011; 3: 189-96. li bb, smith ab, hossainmm. extraction of phenolics from citrus peels: ii. enzyme-assisted extraction method. sep purif technol. 2006; 48: 189-96. marles rj, farnsworth nr. antidiabetic plants and their active constituents. phytomedicine 1995; 2: 137-89. murugasan n, vember s, damodharan c. studies on erythrocyte membrane iv. in vitro haemolytic activity of oleander extract. toxicol lett. 1981; 8: 33-38. ning g, tianhua l, xin y, he p. constituents in desmodium blandum and their antitumor activity. trad her drug. 2009; 40: 852-56. nuengchamnong n, krittasilp k, ingkaninan k. rapid screening and identification of anti-oxidants in aqueous extracts of houttuynia cordata using lc–esi-ms coupled with dpph assay. food chem. 2009; 117: 750-56. pashkow fj. oxidative stress and inflammation in heart disease: do anti-oxidants have a role in treatment and/or prevention? int j inflam. 2011; 514623. prasad s, kashyap rs, deopujari jy, purohit hj, taori gm, daginawala hf. effect of fagonia arabica (dhamasa) on in vitro thrombolysis. bmc complement altern med. 2007; 7: 36. pullaiah t. encyclopaedia of world medicinal plant. vol. ii. new delhi, regency pub, 2006. rajendran p, nandakumar n, rengarajan t, palaniswami r, gnanadhas n, lakshminarsaiah u, gopas j, nishigaki i. anti-oxidants and human diseases. clinica chimica acta. 2014; 436: 332-47. reddi stv, naidu bvar, prasanthi s. in: herbal remedies for diseases. alikhan i, khanum a (eds). hyderabad, ukay publications, 2005, pp 13-67. sanchez-moreno c. methods used to evaluate the free radical scavenging activity in foods and biological systems. food sci tech int. 2002; 8: 121-37. bangladesh j pharmacol 2015; 10: 745-752 751 author info mala majumdar (principal contact) e-mail: malamajumdar51@gmail.com sellamuthu ps, muniappan bp, perumal sm, kandasamy m. antihyperglycemic effect of mangiferin in streptozotocin induced diabetic rats. j health sci. 2009; 55: 206-14. shamsa f, monsef h, ghamooshi r, verdianrizi m. spectrophotometric determination of total alkaloids in some iranian medicinal plants. thai j pharm sci. 2008; 32: 17-20. singleton vl, rossi ja. colorimetry of phenols with phosphomolybdic–phospotungstic and reagents. am j enol viticult. 1965; 37: 144-48. sreelatha u, baburaj ts, kutty nc, nazeem p, bhaskar j. cultivation prospects of exacum bicolor royle: an endangered, ornamental & anti-diabetic herb. nat prod rad. 2007; 6: 402-04. tupe rs, kemse ng, khaire aa. evaluation of anti-oxidant potentials and total phenolic contents of selected indian herbs powder extracts. int food res j. 2013; 20: 1053-63. vaijanathappa j, baami s, bhojraj s. in vitro anti-oxidant activity of enicostemma axillare. j health sci. 2008; 54: 524-28. vinay v, karimulla s, saravanan d. gc-ms analysis, preliminary phytochemical screening, physicochemical analysis and anti-diabetic activity of ethanol extract of jasminum cuspidatum leaves. bangladesh j pharmacol. 2014; 9: 610-16. wong cc, li hb, cheng kw, chen f. a systematic survey of anti-oxidant activity of 30 chinese medicinal plants using the ferric reducing anti-oxidant power assay. food chem. 2006; 97: 705-11. 752 bangladesh j pharmacol 2015; 10: 745-752 dateprinted: this article was downloaded by you on: sep 12, 2018 introduction access to safe water supply is one of the most important detriments of health and socio-economic development. in the first half of the 1970s, bangladesh faced an infant mortality rate of around 140 per 1000 with diarrhea being a major determinant. for young children 1-4 years, diarrhea accounted for nearly half of all deaths. a solution was to provide tube wells sunk 20 -30 meter was free of harmful bacteria. at the initial stage government and other international agencies assisted the tube wells sinking. at present there are about 7-8 million tube wells to tap better quality water and 97% of rural drinking water supply is obtained from ground water sources (ahmed and ahmed, 2002). these tube well installation initiatives have contributed significantly to the halving of infant mortality over 36 years from 161 per 1000 in 1960 to 83 per 1000 in 1996. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2006; 1: 42-50 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract the role of arsenic-safe drinking water and antioxidants in the management of arsenicosis patients were observed. two hundred and fifty patients of arsenicosis from an arsenic-affected area of bangladesh were included and divided into five groups based on the source of drinking water (greenor redmarked tube well) and intake of antioxidants (vitamin a, c and e). melanosis improved in 43 patients of the group who took arsenic-safe drinking water from green-marked tube well and antioxidants regularly. patients of the group who took green-marked tube well water regularly but not the antioxidant showed improvement in melanosis in 22 cases. the respondents who were using red-marked tube well water and antioxidants, only two of them improved; and all other respondents either deteriorated or did not improve. the respondents who were using red-marked tube well water but not the anti -oxidant, none did show any improvement of their illness. the respondents who took antioxidants irregularly and had irregular intake of safe water, were not considered to compare the prognosis of skin lesions. regarding keratosis, the respondents who took green-marked tube well water regularly and antioxidant regularly, 8 of them improved, 1 case didn’t change; while the respondents who took green-marked tube well water regularly but not the antioxidant, 8 cases didn’t improve much but majority of them remain unchanged. among the respondents of other groups, keratosis deteriorated. this study suggests that both arsenic-safe drinking water and use of antioxidants gave good result in improvement of the arsenicosis. article info received: 10 july 2006 accepted: 12 august 2006 available online: 3 january 2008 doi: 10.3329/bjp.v1i2.487 cite this article: khandker s, dey rk, islam azmm, ahmad sa, ifthaker-al-mahmud. arsenic-safe drinking water and antioxidants for the management of arsenicosis patients. bangladesh j pharmacol. 2006; 1: 42-50. arsenic-safe drinking water and antioxidants for the management of arsenicosis patients salamat khandker1, ranjit kumar dey2, a. z. m. maidul islam3, sheikh akhtar ahmad4 and ifthaker-al-mahmud1 1who arsenic cell, kakrail, dhaka, bangladesh; 2directorate of health services, mohakhali, dhaka, bangladesh; 3department of dermatology, bangabandhu sheikh mujib medical university, shahbag, dhaka, bangladesh; 4department of occupational health, national institute for preventive and social medicine, mohakhali, dhaka, bangladesh. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. c lin ic al t ri al the situation became particularly complex, in 1993 when it was discovered that, substantial proportion of the tube wells were yielding water contaminated with high level of soluble arsenic compounds (who, 2000) to threat health and epidemiology of arsenicosis. the detection of arsenic in the ground water was first made in west bengal in 1983 and in bangladesh in 1987. chowdhury et al. (2000) states that until 1995 tube well contaminated by arsenic was not wide-spread across central and southern bangladesh. the most recent information comes from a testing project involving the collaboration of the department of international development (uk), the british geological survey, and the government of the peoples republic bangladesh. this project tested one tube well in every 36 km2 in the two thirds of the countries most affected areas and found that, 51% of the tube wells were contaminated with at least 0.01 mg arsenic/l, 35% with at least 0.05 mg arsenic/l, 25% with at least 0.1 mg arsenic/l, 8% with 0.3 mg arsenic/l or more and 0.1% with 1.0 mg arsenic/l or more. about 24.5 million people are currently chronically exposed to high levels of arsenic (above 50 μg/l) in drinking water derived from ground water supplied by millions of hand pump tube wells. the health hazards due to this contamination have raised the serious concern to public health. the first case of arsenicosis was detected in chomogram village of chapai nowabgonj district in 1994. since then, the number of areas and number of patients were gradually increasing. to date, 38,430 individuals with visible signs of arsenic toxicity have reported from different health sources. the arsenic poisoning in bangladesh is chronic in nature and is caused due to contamination of ground water. the time taken to develop clinically evident effects from drinking arsenic contaminated water is generally thought to be about 10 years, but early manifestations are not uncommon (caussy, 2005). most of the time, the victims do not complain of symptoms until they are detected through screening survey. the present experiment to identify the arsenic cases are by external manifestations especially with the presentation on the skin called melanosis and keratosis with the history of consuming arsenic contaminated water for a prolonged period. gangrene of peripheral organs and ulceration due to toxic effect on the small blood vessels may also be found. cancer of skin along with cancer of some internal organsliver, kidney, urinary bladder is not uncommon (kaufman et al., 2001). it is also reported that even if a person having no manifestation after chronic exposure of contaminated water the chance of having cancer cannot be ruled out. the only way to save lives is to identify patients at an earlier stage before the conditions become irreversible and to provide them arsenic-safe water and supportive management. the present knowledge about management of arsenicosis is far from satisfactory. the drugs used for chelating arsenic in acute poisoning have proved to be ineffective in chronic arsenicosis (guha mazumder et al., 2001). the use of arsenic-safe water may prevent progression of effects, but it is not clear whether reversal of effects is possible. supportive therapy with nutritional improvement may play some role in diminishing symptoms and may reverse some cases of melanosis. use of antioxidants like vitamins a, c and e, along with discontinuation of consuming arsenic contaminated water have shown evidences of improvement and some success in arresting the progression of symptoms (talukder, 1999). consequently, directorate general of health services (dghs) recommended these antioxidants in use for the management of patients suffering from arsenicosis. some experts had advocated for the use of spirulina extracts which are rich in antioxidants in treatment of arsenicosis (sikder et al., 2000). but, conclusive scientific evidences are still not available to make recommendation in this regard. numbers of studies are progressing on this issue, but enough evidences are yet to confirm or to reject their effectiveness (verret et al., 2005). considering the above facts, the present observational study has been designed to evaluate effectiveness of the antioxidants in management of arsenicosis patients. factors considered in this study were quality of water intake and intake of antioxidants. the purpose of the study was to see the effectiveness of antioxidant therapy in groups of arsenicosis patients taking arsenicsafe and arsenic-contaminated water, and to compare the result with groups of patients who were not receiving antioxidant therapy. materials and methods study area bhanga is an upazilla (sub-district) under faridpur district. it is 70 km southwest from the capital city, dhaka. it is a low land area and the river padma borders a major portion of this upazilla. the sitalakha and the kumar river pass through this upazilla too. the area covers 216.3 sq km. there are 221 villages, 12 unions and one paurashava in bhanga upazilla. the total number of populations is 230,300 (116,560 male and 113,740 female). sanitation and water supply of this upazilla are not satisfactory. majority people depend on tube well water for drinking and cooking purposes. according to bangladesh rural advancement committee (brac) survey report (2001), above 92% tube wells of this upazilla are contaminated with more than permissible arsenic concentration to bangladesh standard. dhaka community hospital (dch) bangladesh j pharmacol 2006; 1: 42-50 43 undertook active case detection in bhanga and so far identified 488 arsenicosis patients (dch, 2001). list of patients was available with the health service providers and some of those listed patients were receiving treatment with antioxidants (vitamin a50,000 i.u; αtocopherol200 mg; ascorbic acid500 mg) continuously for three months with two months interval for another three months. moreover, mapping of shallow tube wells and their water quality were also recorded by local directorate of public health and engineering (dphe) people, and the resulted marking in the tube wells made patients as well as other concerned people to know the quality of water in terms of arsenic contamination in those tube wells. duration of study the study was conducted during february to september 2003. initial two months were spent for preparation of the study, collecting socio-economic and epidemiological data and baseline clinical status of selected patients. study population for the selection of study population every odd number was chosen from the list purposively. thus a list of 244 patients was made. during our field interview we found 86 new patients. from the new patients list we selected 16 more patients randomly. in this way we prepared a list of 260 patients for interview. the patients were divided into 5 observation groups on the basis of their quality of water intake and receiving antioxidant therapy. if there were less than 50 patients for particular group new participants randomly selected to fulfill the target similarly rejected to interview patients of a particular group once the desired number was attained. thus in each group there were 50 patients and the groups were as follows (table i): group i: drinking water from green-marked tube wells (safe water) and receiving antioxidant treatment. group ii: drinking water from green-marked tube wells (safe water) but were not receiving antioxidant treatment. group iii: drinking water from red-marked tube wells (high arsenic contaminated water) and receiving antioxidant treatment. group iv: drinking water from red-marked tube wells (high arsenic contaminated water) but were not receiving antioxidant treatment. group v: drinking water from both red and greenmarked tube wells (irregular quality of drinking water) and/or irregular intake of antioxidants. development of questionnaire a questionnaire was developed containing general information of patients, information about source of drinking water and the duration of tube well used by the study population. the questionnaire was pre-tested and finalized after incorporation of feedback. interviewers socio-economic and water intake related data were collected by trained interviewer. fourteen interviewers were locally recruited for the purpose, and were given one day orientation training on different techniques to fill up the questionnaire. the interviewers were divided into two groups headed by one team leader and administered a structured questionnaire to all the selected patients. the interviewers submitted filled up forms to the project manager, recruited for the purpose, who then divided the patients into different groups mentioned above based on their statements about quality of drinking water and antioxidant therapy. table i source of drinking water and anti-oxidants in different groups group source of drinking water anti-oxidants green-marked tube well red-marked tube well i + + ii + iii + + iv + v irregular 44 bangladesh j pharmacol 2006; 1: 42-50 ethical issues the main ethical problem of this study was that a group of the study subject continued to drink arsenic contaminated tube well water. it was not possible to prevent this group to collect potable water from arsenic -contaminated water options although alternative arsenic-safe water options were installed in their neighborhoods. even in this situation dghs recommended antioxidants treatment for arsenicosis patients (talukder, 1999). local health authority used to supply the medicine free of cost. therefore, we did not face any ethical problem for drug intervention. data collection the medical officer performed clinical examinations of all those patients and recorded findings in the checklist. thus baseline and monthly clinical examination data were recorded in the structured checklist. the medical officer was not aware which group did a particular patient belong. a group of dermatologists evaluated the skin lesions at the beginning and at the end of the study. the evaluation was done in terms of regression of melanosis and keratosis through comparing the state of lesion of previous visit. patients' perception was also considered for evaluation of improvement. the improvement was evaluated as + = improvement, 0 = no improvement, and = deterioration. body mass index (bmi) was calculated as weight (kg)/height (meter square). analysis of data data were entered and analyzed using the spss software package. only univariate analysis was done using appropriate formula. standard deviation and mean value were also determined for each frequency distribution. results among the respondents, 59.6% were male and 40.4% were female. the age of the respondents varied from 13 -75 years. the mean age of the respondents of different groups was 37.7, 33.3, 38.0, 36.7 and 32.1 years respectively. maximum respondents were in the age group of 20-49 years. mean age of the respondents of group v and group ii were comparatively lower. common occupations of the respondents were service (37.7%), agriculture (25.5%) and business (22.7%) others were teachers and housewives. most (95.6%) of the respondents of all the groups used tube well water for drinking and cooking purposes. however, the source of domestic water differed among the respondents. of the different sources, pond water was the major (57.7%) source of domestic purpose. other sources for domestic water were tube well water (24.2%) and river water (15.3%). comparatively the respondents of group v (49.0%) and group i (48.0%) used pond water less than that of other groups (table ii). the daily drinking water requirement per person per day varied from 1-12 l. the mean water intake was 3.97 l/person/day. among the group v respondents the mean water intake was lower in comparison to the respondents of other groups which was 2.66 l/person/ day). the water intake per person per day was comparatively higher amongst the group iii respondents. the age of the tube wells used by the respondents varied from 3 months to 50 years. average age of tube well was 10.3 years. the mean years of age of the tube wells used by the group v (7.5 years), group i (6.1 years) and group ii (8.2 years) was comparatively lower than the tube wells used by group iii (14.0 years) and group iv (15.9 years). most (97.8%) of the respondents could not inform about the method used for measuring arsenic concentration of their tube wells. but majority of the study subjects replied correctly regarding painted color of the tube wells. above 96% of the respondents of each group reported that health professional advised them to abstain from drinking water of red-marked tube wells. of them 100% of the group i respondents and 98% of the group ii respondents didn’t use the water of red-marked tube wells for drinking and cooking purposes; while 100% respondents of group iii and iv still using red-marked tube wells for drinking purpose (table ii). almost all the respondents knew about arsenicosis. regarding a supplementary question on sources of information the participant reported that doctors and health workers made them aware about the disease. twenty five percent of the respondents were suffering from general weakness, cough, peptic ulcer, hypertension, diabetes mellitus etc. the mean bmi of the patients of 5 groups was in between 19 to 21. table iii shows that all the patients had melanosis. different forms of melanosis, e.g. round/hypopigmented, diffuse and both were almost homogeneously distributed in all the groups’ except group v. the ninety four respondents (38.8%) had keratolytic skin lesion. of them 14 were from group v, 9 from group i, 31 from group ii, 13 from group iii and 27 from group iv respectively. eighty percent of the melanosis was defuse-melanosis, and 74% of keratosis belongs to mild stage. the perception of all the respondents of group i felt that bangladesh j pharmacol 2006; 1: 42-50 45 they are improving from the illness by taking safe water and antioxidants regularly. the majority of respondents (38 out of 50) of group ii also felt that they are improving by green arsenic -safe water only. on the other hand, a few respondents (11) of group iii felt that they are improving but all other respondents felt that they are not improving at all. it was observed that the respondents who took arsenic-safe drinking water from green-marked tube well and antioxidants regularly (group i), melanosis improved in 43 respondents, 6 didn’t improve and none was found to have deteriorated (table iv). the respondents who took green-marked tube well water regularly but not the anti -oxidant (group ii), melanosis improved in 22 respondents, 24 did not improve and 4 deteriorated. the respondents who were using red-marked tube well water and antioxidants (group iii), only two of them improved; and all other respondents either deteriorated or did not improve. the respondents who were using red-marked tube well water but not the antioxidant (group iv), none did show any improvement of their illness. the respondents who took antioxidants irregularly and had irregular intake of safe water, were not considered to compare the prognosis of skin lesions. table ii distribution of respondents according to domestic use and drinking water sources source of water shallow tube well deep tube well dug well pond river for domestic purpose group i 17 2 0 24 7 group ii 6 0 0 32 12 group iii 13 0 0 32 5 group iv 13 0 1 31 4 group v 11 3 1 24 10 total 60 5 2 143 38 for drinking and cooking group i 46 4 0 0 0 group ii 48 2 0 0 0 group iii 50 0 0 0 0 group iv 49 0 0 0 0 group v 45 3 0 1 1 total 238 9 0 1 1 46 bangladesh j pharmacol 2006; 1: 42-50 regarding keratosis, the respondents who took greenmarked tube well water regularly and antioxidant regularly (group i), 8 of them improved, 1 didn’t change; while the respondents who took green-marked tube well water regularly but not the antioxidant (group ii), 8 out of 31 improved much, 21 remained unchanged and 2 deteriorated. among the respondents of other groups, keratosis deteriorated. discussion the highest proportions of affected people were service holder. usually service holders live in the upazilla headquarter and almost 100% tube wells of sadar upazilla are arsenic contaminated. this may be a reason why highest percent of arsenic affected people of our observation study are service holder. as expected, more than 95% of patients were reported to drink tube well water. from 1975 to 1997, dphe with co-operation of unicef was struggling to reduce mortality and morbidity of children due to waterborne diseases by ensuring bacteriological safe drinking water supply through installation of shallow tube well. at present there are about 6-8 million shallow tube well in table iv prognosis of respondents of different groups according to skin lesions group melanosis keratosis improved not improved deteriorated improved not improved deteriorated i 43 6 0 8 1 0 ii 22 24 4 8 21 2 iii 2 24 24 0 4 9 iv 0 8 42 0 0 27 total 67 62 70 16 26 38 table iii distribution of respondents according to skin lesions status group melanosis keratosis round/hypopigmented diffuse both mild moderate severe i 4 44 1 5 3 1 ii 5 40 5 20 9 2 iii 1 44 5 11 2 0 iv 2 40 8 22 5 0 v 1 31 18 12 2 0 total 13 199 37 70 21 3 bangladesh j pharmacol 2006; 1: 42-50 47 the country (ahmed and ahmed, 2002) and 97% of the rural drinking water supply in bangladesh is obtained from ground water. therefore majority of study population are using shallow tube well for drinking and cooking purposes. massive tube well water testing started from 1997. the field staff tested tube well water for arsenic, marked red in case of high (above 50 μg/l) arsenic concentration and provided health education on consequences of drinking water of red-marked tube well. as a result people are aware of the effects of using red-marked tube well. therefore, it was logical that 96.4% of the study subject reported that they have been informed about adverse effect of drinking water from red-marked tube well. the respondents of group iii and iv are still drinking arsenic contaminated water although they are aware about the consequences. this behavioral aspect indicates the gap between knowledge, attitude, practice and scope for using arsenic-safe drinking water. moreover, more than 32% of the patients could not correctly interpret the message of redand green-painted tube wells. the mean bmi of the patients of 5 groups was in between 19 to 21 that correspond to normal value of bangladeshi people (jahan and hossain, 1998). based on the finding it can be said that, on an average the study populations are maintaining a normal nutrition. although some researcher stated that poor nutritional status may increase an individual’s susceptibility to chronic arsenic toxicity, or alternatively that arsenicosis may contribute to poor nutritional status (milton et al., 2004). further intensive research is recommended in this field. all the respondents had melanosis and 38% had both keratosis and melansis. the respondents who took green-marked tube well water and antioxidant (group i) regularly, regression of melanosis was observed, while among the respondents who took green-marked tube well water regularly but no antioxidant (group ii) did not show much regression of melanosis and majority remain unchanged. among the respondents of other categories, deterioration of melanosis was observed. similarly, among the respondents who took green-marked tube well water and antioxidant regularly regression of keratosis was observed after 6 months. kosnet et al. (1990) opined on the basis of study findings that use of vitamin a analogues (retinoids) might be useful in treating precancerous arsenical dermatosis. however, recovery from chronic arsenic toxicity particularly the resulting peripheral neuropathy may take months and may not be complete. kosnet (1999) suggested that treatment with retinoids might have promise in the treatment of chronic cutaneous arsenism. it is observed that, the skin condition of group iii and iv deteriorated and group ii have improved but improvement was less than group i. these finding coincides with the study report of oshikawa et al. (2001) that drinking piped or bottled water increased the probability of regression in subjects with mild stage of arsenical lesion. therefore, early preventive measure is recommended to control deterioration of disease. bangladesh arsenic control society (2003) conducted a double-blind placebo-controlled trial among 319 arsenicosis patients. they treated the patients with βcarotene, ascorbic acid, α-tocopherol, selenium, zinc and folic acid in standard recommended doses for 6 consecutive months and then every alternative month for a total period of 12 months. they found significant clinical improvement of skin lesion among the treatment group. the severities of palmer and plantar keratosis were reduced after 12 months. it revealed from this study that, patients, who were taking arsenicsafe water as well as antioxidants, the improvement was more. the improvement of the disease could be observed which was evident from the skin color of the preand post-intervention photographs. it was observed that a combination of arsenic-safe water and antioxidant was the most effective for the management of arsenicosis patients. ahmad et al. (1998) stated that the manifestations of chronic arsenicosis, melanosis and keratosis showed clinical improvement on treatment with vitamin a, e and c, withdrawal of arsenic contaminated drinking water and use of keratolytic agent where applicable. amongst those who had used both arsenic safe drinking water and regular medications 90.5% showed improvement of melanosis, 86.4% showed improvement of keratosis but none showed deterioration. the study further stated that the observed clinical improvements almost coincided with patients' perceptions of subsidence of signs of disease. this finding is correlated to this observation study. comparatively only arsenic-safe water was more effective than only antioxidant treatment. therefore, for the management of arsenicosis it could be strongly recommend for ensuring arsenic-safe water as immediate preventive measure. dghs recommended arsenic-safe water and intervention with antioxidant e.g. vitamin a, e and c for a period of 6 months with two months interval in between. use of antioxidant for longer than 6 months should be cautiously recommended (talukder, 1999). verret et al. (2005) reported that supplementation with vitamin e and selenium, either alone or combination, slightly improved skin lesion status although the improvement was not statistically significant. recently, success in the treatment of arsenicosis with indigenous medicine ‘spirulina’ has been claimed. several investigators (sikder et al., 2000; khan et al., 2000; choudhury et al., 2000; huq et al., 2000) reported that spirulina, a natural microalie, is found to be effective in 48 bangladesh j pharmacol 2006; 1: 42-50 the treatment of chronic arsenic poisoning. misbahuddin et al. (2006) reported that alcohol extracted spirulina in combination with zinc is effective for the management of arsenicosis patients. ahmad et al. (2006) stated that 204 newly diagnosed patients have been included in the old list of bhanga upazilla. they identified 18 old patients those were asymptomatic. among them 12 were subject of this study. ahmad et al., (2006) opined that the asymptomatic patients might have recovered due to judicious usages of treatment options. conclusion the present study shows that combination of drinking arsenic-safe water and use of antioxidants give good result in improvement of the arsenicosis. it is also evident that both of the interventions have positive impact on arsenicosis patients, but further studies are required to evaluate objective prognosis as well as the individual potentiality. considering the gap between knowledge and practice about drinking arsenic contaminated water in a considerable number of respondents, interventions are needed to motivate the people with an aim to improve the practice of patients for drinking safe water. financial support world health organization ethical issue this study was approved by the ethical committee of bangladesh medical research council, bangladesh. conflict of interest authors declare no conflict of interest references ahmad sa, faruquee mh, sayed mhsu, khan mh, jalil ma. ahmed r, hadi sa. chronic arsenicosis: management by vitamin a, e, c regimen. jopsom. 1998; 17: 19-26. ahmad sa, rahman ms, ullah mhss, khan mh, faruquee mh, karim n. re-screening of arsenicosis patients in unf funded 3 upazillas. who-eh unit; 2006, p 27. ahmed mf, ahmed cm (eds). arsenic mitigation in bangladesh. ministry of local government, dhaka, 2002, pp 20-25. bangladesh arsenic control society. double -blind, randomized, placebo-controlled trial of antioxidant vitamins and minerals in the treatment of chronic arsenic poisoning in bangladesh. bacs, dhaka, 2003, pp 1-103. bangladesh rural advancement committee (brac). tube well screening report in bhanga upazilla, brac, dhaka, 2001, pp 1-22. caldwell bk, caldwell jc, mitra sn, smith w. searching for an optimal solution to the bangladesh water crisis. soc sci med. 2003; 56: 2089-96. caussy d. field guide for arsenicosis case detection, disease surveillance and patient management. who-searo, new delhi, 2005, pp 1-24. choudhury sar, khan ak, misbahuddin m, islam azmm, sahjahan m. role of spirulina in the treatment of chronic arsenic poisoning. bangladesh armed forces med j. 2000; 27: 181-85. chowdhury uk et al. ground water arsenic contamination in bangladesh and west bengal, india. environ health perspect. 2000; 108: 393-97. debra sm, stephen ew, david mc. n-acetylcysteine in the treatment of human arsenic poisoning. j am board fam pract. 1990; 3: 293-96. dhaka community hospital (dch). arsenicosis patient list of bhanga upazilla. arsenic patient identification and management in 7 upazilla, dch, dhaka, 2001, pp 1-11. guha mazumder dn, de bk, santra a, ghosh n, das s, lahiri s, das t. randomized placebo-controlled trial of 2,3dimercapto-1-propanesulfonate (dmps) in therapy of chronic arsenicosis due to drinking arsenic contaminated water. clin toxicol. 2001; 39: 665-74. huq ma, misbahuddin m, choudhury sar. spirulina in the treatment of chronic arsenic poisoning. bangladesh j physiol pharmacol. 2000; 16: 15-16. jahan k, hossain m. nature and extent of malnutrition in bangladesh. bangladesh national nutrition survey 1995-96. university of dhaka, dhaka, 1998, p 143. kaufmann rb, sorensen bh, rahman m, streatfield k, persson la. addressing the public health crisis caused by arsenic contamination of drinking water in bangladesh. world bank, dhaka, 2001, pp 1-30. khan mak, choudhury sar, misbahuddin m, islam azmm, shahjahan m. effects of spirulina in the treatment of chronic arsenic poisoning in bangladesh. bangladesh j med sci. 2001; 7: 223-31. kosnet jm, kreiss k. agency for toxic substances and disease registry (atsdr). case studies in environmental medicine. arsenic toxicity, 1990, p 18. kosnet jm. clinical approaches to the treatment of chronic arsenic intoxication: from chelation to chemoprevention. arsenic exposure and health effects, elsevier science, 1999, pp 349-54. milton ah, hassan s, shahidullah sm, sharmin s, jakariya m, rahman m, keith d, smith w. association between nutritional and arsenicosis due to chronic arsenic exposure bangladesh j pharmacol 2006; 1: 42-50 49 author info salamat khandker (principal contact) e-mail: khandkers@searo.who.int in bangladesh. int j environ health res. 2004; 14: 99-108. misbahuddin m, islam azmm, khandker s, ifthaker-almahmud, islam n, anjumanara. efficacy of spirulina extract plus zinc in patients of chronic arsenic poisoning: a randomized placebo-controlled study. clin toxicol. 2006; 44: 135-41. oshikawa s, geater a, chongsuvivatwong v, piampongsan t, chakraborti d, samanta g, mandal b, hotta n, kojo y, hironaka h. long-term changes in severity of arsenical skin lesions following intervention to reduce arsenic exposure. environ sci. 2001; 8: 435-48. sikder ms, islam azmm, khan mak, huq ma, choudhury sar, misbahuddin m. effect of spirulina in the treatment of chronic arsenicosis. bangladesh j dermatol venereal leprol. 2000; 17: 9-13. talukder kr. the diagnosis and management of arsenicosis cases, learning module, environmental and occupational health (including arsenic) unit, directorate general of health services, dhaka, 1999. verret wj, chen y, ahmed a, islam t, parvez f, kibriya mg, graziano jh, ahsan h. a randomized, double-blind placebo -controlled trial evaluation the effects of vitamin e and selenium on arsenic-induced skin lesions in bangladesh. j occup environ med. 2005; 47: 1026-35. 50 bangladesh j pharmacol 2006; 1: 42-50 bangladesh journal of pharmacology research article cytotoxic effect of methanol extract of cytotoxic effect of methanol extract of cytotoxic effect of methanol extract of conyza bonariensisconyza bonariensisconyza bonariensis on dmbaon dmbaon dmba---induced induced induced skin carcinogenesis: an skin carcinogenesis: an skin carcinogenesis: an in vivoin vivoin vivo studystudystudy bjp introduction cancer is emerging as one of the most horrific disease and almost all of the anticancer drugs available in the market have serious side effects. so, it is direly needed to explore new anticancer agents from plants which can effectively kill cancer cells without damaging normal body cells. many plants like convolvulous arvensis (saleem at al, 2014), catharanthus roseus (cragg and newman, 2005; okouneva et al., 2003; simeons et al., 2008), podophyllum peltatum and podophyllum emodi (shoeb et al., 2006), taxus brevifolia nutt, taxus baccata (kingston, 2007; hait et al., 2007), camptotheca acuminate (zhang et al., 2004, fuchs et al., 2006), berberis amarensis (xie et al., 2009; xu et al., 2006), hvdrastis canadensis l (wang et al., 2011; patil et al., 2010), tabebuia avellanedae (li et al., 2000; de almeida, 2009), betula alba (fulda, 2008), colchicum autumnale (dubey et al., 2008), curcuma longa (sa et al., 2010; goel et al., 2008), wikstroemia indica (lu et al. 2011; diogo et al., 2009), psoralea corylifolia (moon et al., 2006; dixon and ferreira, 2002), ochrosia elliptica (kuo et al., 2006), amoora rohituka and dysoxylum binectariferum (mans et al., 2000), euphorbia peplus l. (hampson et al., 2005), ipomoeca batatas l (ancuceanu and istudor, 2004), salvia prionitis (deng et al., 2011), centaurea schischkinii (shoeb et al., 2005) have been known to possess anticancer activity. in the present study conyza bonariensis was selected to evaluate its cytotoxic efects on dmba induced skin carcinogenesis. c. bonariensis is a cosmopolitan plant and belongs to family asteraceae (compositeae). it is used in fungal and bacterial infections (chaudhry et al., 2001), hepatic toxicity and gastro enteritis, diarrhea, leucorrhoea, menorrhagia. it possesses anticoagulant (favila and antonio, 2006), anti-oxidant (shahwar et al., 2012), homeostatic, tonic, astringent (ahmad, 2007), a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 467-474 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index; issn: 1991-0088 abstract in the present study, we examined the cytotoxic effect of conyza bonariensis (methanolic extract). the skin carcinogenesis was induced in two stages, first, applying tumor initiator, 7-12-dimethyl benz( )antheracene and thereafter applying croton oil, a tumor promotor in swiss albino mice. the morphological alterations observed and measured during the induction of skin ulceration, included; cumulative number of papilloma, tumor yield and tumor burden. c. bonariensis extract (300 and 600 mg/kg/day) was applied locally on mice skin for 16 weeks. the higher dose (600 mg/kg/day) inhibited the tumor formation up to 40% and showed a significant decline in cumulative number of papilloma of continuous group. the results indicated that extract increased the reduced glutathione, superoxide dismutase and catalase, and decreased lipid peroxidation compared to carcinogen group. histopathological changes showed papilomatosis and ulceration in carcinogen control group. hplc analysis indicated the presence of flavonoid i.e. quercetin which may be responsible for the cytotoxic action of c. bonariensis methanol extract. article info received: 18 december 2014 accepted: 18 may 2015 available online: 31 may 2015 doi: 10.3329/bjp.v10i2.23063 cite this article: saleem m, naseer f, hussain k, alamgeer. cytotoxic effect of methanol extract of conyza bonariensis on dmba -induced skin carcinogenesis: an in vivo study. bangladesh j pharmacol. 2015; 10: 467-74. this work is licensed under a creative commons attribution 3.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. cytotoxic effect of methanol extract of conyza bonariensis on dmba-induced skin carcinogenesis: an in vivo study mohammad saleem1, faiza naseer1, khalid hussain2 and alamgeer3 1college of pharmacy, government college university, faisalabad, pakistan; 2university college of pharmacy, punjab university, lahore, pakistan; 3faculty of pharmacy, university of sargodha, pakistan. cholinergic (khan et al., 2006), anti-inflammatory and antimitotic activities (santana et al., 2011). the following study indicated that methanol extract of c. bonariensisis possesses protective effects against skin carcinogenesis in swiss albino mice. materials and methods collection of plant whole plants of c. bonariensis were collected during april and may from both sides of motorway m2 from lahore to islamabad and were identified by a plant taxonomist dr. mansoor hameed, head of botany department, agriculture university, faisalabad. preparation of plant extract the aerial parts were washed, chopped and dried under shade at room temperature for several days until fully dried, ground by electric grinder, powdered and sieved. the powdered material was macerated in methanol for 7 days with frequent shaking every day, filtered out by using whatman filter paper. finally, the solvent from solid material was removed by using a rotary evaporator at 45-55°c and residues obtained were stored in small amber jars at 4°c. drug/chemical carcinogen, 7-12-dimethyl benz(a)anthe-racene (dmba) and croton oil obtained from sigma-aldrich chemical company usa. acetone was used as a vehicle for all topically applied carcinogens and dilution of plant extract and methanol (analytical grade) were purchased from asian scientific store, jinnah colony, faisalabad. experimental animals the male mice, 6-8 weeks old, weighing 20-30 g were obtained from national institute of health islamabad and kept in animal house of department of pharmacology, government college, university faisalabad under controlled conditions of temperature (25 ± 1°c) and humidity (50 ± 5°c). they were given standard diet and water ad libitum. mice were acclimatized to environment for one week prior to commencement of experiment (roslida et al., 2011). experimental plan dorsal skin of albino mice was shaved with an electric clipper for approximately 2 x 2 cm area and marked with permanent marker (arya and kumar, 2011). a total number of 50 animals were selected and divided into 5 subgroups (figure 1): (carcinogen control group): 10 mice were applied topically with a single dose of dmba as a tumor initiator on the shaved area of skin of mice and two weeks later croton oil was applied as tumor promoter thrice a week till the end of 16th week. (pre group): this group was subdivided into two sub groups, each group consisting of 5 mice and 300 mg/kg and 600 mg/kg c. bonariensis (methanol) extract was given topically to these two subgroups for consecutive 7 days. dmba single topical dose was applied at 8th day and two weeks later croton oil was applied thrice a week till the end of 16th week. (peri group): ten mice were divided into two sub groups each having 5 mice flow diagram of methodology 1 st week just 1 dose dmba 4 th week 300 & 600mg/kg c.b extract daily carcinogen control peri group pre group post group continuous group 2 nd week thrice/week, croton oil topically applied just 1 dose dmba at 8 th day 5 th week thrice/week, croton oil just 1 dose dmba after ½ hr, 300 & 600mg/kg c.b extract thrice/week, croton oil topically applied just 1 dose dmba 300 & 600mg/kg c.b extract daily after ½ hr, thrice/week, croton oil applied 300 & 600mg/kg c.b extract daily till 16 th week 16 th week just 1 dose dmba at 8 th day thrice/week, croton oil topically applied figure 1: flow diagram of methodology 468 bangladesh j pharmacol 2015; 10: 467-474 and were given dmba single dose topically, then 300 mg/kg and 600 mg/kg c. bonariensis (methanol) extract topically for consecutive 15 days. after that, croton oil was applied thrice a week till the end of 16th week. (post group): initially single dose of dmba was applied to this group. then the group was subdivided into two subgroups of 5 mice in each group and after 2 week, first subgroup received 300 mg/kg and second subgroup received 600 mg/kg c. bonariensis (methanol) extract topically and half an hour, croton oil was applied thrice a week till the end of 16th week. (continuous group): two subgroups, each having 5 mice received 300 mg/kg and 600 mg/kg c. bonariensis ( m e t h a n o l ) e x t r a c t t o p i c a l l y t h r o u g h o u t t h e experimental period daily and at 8th day, dmba single topical dose was applied and two weeks later croton oil was applied thrice a week till the end of 16th week. preparation of stock solutions 1m dmba was dissolved in acetone at 100 μg/100 μl (w/v) and croton oil at 1 μg/100 μl to make 1% (v/v) dilution, prepared just before its use and kept in amber glass bottle at about 20°c. a stock solution of extract was prepared by dissolving 10 mg extract in 1.0 ml acetone. serial dilution of 300 mg/kg and 600 mg/kg was made (roslida et al., 2011). preliminary phytochemical screening preliminary phyto-chemical analysis of c. bonariensis was performed according to protocol previously described (mojab et al., 2003; khan et al., 2011). determination of cytotoxic activity cytotoxic effect of the methanol extract of c. bonariensis was evaluated by considering various morphological parameters like 1tumor incidence: number of tumor bearing mice, 2cumulative number of papilloma: total number of papillomas, 3tumor yield: average number of tumor per mouse and 4tumor burden: number of tumor per tumor bearing mice (roslida et al., 2011). morphological studies skin of each mice was weekly observed for loss of hair, redness, ulceration and outgrowths. these were counted and measured by digital vernire caliper till the end of 16th weeks. biochemical studies mice were sacrificed and shaved ulcerated skin were removed, washed with cold normal saline and kept in formalin bottles. excised skin was used to prepare 10% tissue homogenate in 0.15 molar tris potassium chloride having a ph of 7.4. then centrifuge for ten mints at 2000 rpm. reduced glutathione, superoxide dismutase, catalase and lipid peroxidation level were determined by the methods previously described (marklund and marklund, 1974; moron et al., 1979; ohkhawa et al., 1979; aebi, 1984). histopathological study specimens of mice ulcerated skin were excised, washed with normal saline and fixed in 10% formalin for a day. again fixed with paraffin wax, cut 5 µm portion of each specimen and observed the histopathology (parmar et al., 2011). preliminary phytochemical analysis preliminary phyto-chemical screening methanol extract of c. bonariensis was performed according to the procedure described elsewhere (saleem et al, 2014). chromatogram by hplc for identification of active constituent high performance liquid chromatography (hplc) was performed to identify various compounds present in c. bonariensis methanol extract (ali et al., 2013). the sample was dissolved in 5 ml distilled water and 12 ml methanol, kept for 5 min, again added 6 ml distilled water, waited for 5 min and added 10 ml 5m hcl in this solution. placed in oven for 2 hours and filtered the solution by syringe filter. isocratic: dichloromethane: methanol (60:20:20) was used as the mobile phase with the flow rate of 1 ml/min. the column was ods 250 mm x 4.6 mm and uv detector was used to obtain chromatogram at 280 nm at room temperature (saleem et al., 2014). statistical analysis all the obtained results were statistically analyzed by one way analysis of variance (anova). minitab 16.0 software was used for calculation and all values were represented as mean ± standard deviation (std). values were taken as p<0.001 (significant). results results obtained from present study had shown that single topical application of carcinogen dmba followed by a thrice/week repeated application of 1% croton oil till 16th week produced 100% skin ulceration in the carcinogen control group. 18.2 ± 1.6, 3.6 ± 0.3 and 3.6 ± 0.3 were calculated as the cumulative number of papilloma, tumor yield and tumor burden respectively (table i). ulcerated skin specimens were observed under microscope after fixation with 10% formalin, shown in figure 2. c. bonariensis (methanol) extract was applied locally to pre, peri, post and continuous groups. significant decline in cumulative number of papillomas in 300 mg/ kg and 600 mg/kg from pre to continuous group 16.8 ± 3.6 to 7.4 ± 4.9 and 15.8 ± 2.4 to 4.8 ± 6.6 respectively. 300 mg/kg extract showed tumor yield from pre to bangladesh j pharmacol 2015; 10: 467-474 469 continuous groups 3.4 ± 0.7 to 1.5 ± 1.0 but 600 mg/kg showed 3.2 ± 0.5 to 1.0 ± 1.3. tumor burden in 300 mg/ kg was 3.4 ± 0.7 to 1.9 ± 1.2 and in 600 mg/kg was 3.6 ± 0.3 to 1.2 ± 1.7 shown in table i. the tumor incidence in continuous group was compared (p<0.001) with carcinogen group decreased up to 20% with 300 mg/kg but 40% with 600 mg/kg. results obtained from present study had shown that topical application of dmba and croton oil produced 100% skin ulceration in carcinogen control group and decreased the oxidative stress parameters, i.e. reduced glutathione, sod and catalase level to 3.3 ± 0.2 μmol/g, 1.7 ± 0.1 μmol/g and 13.6 ± 0.8 μmol of h2o2 reduction/mg protein/min respectively and increased the lipid peroxidation level as 7.7 ± 0.2 nmol/mg (table ii). c. bonariensis (methanol) extract in 300 mg/kg caused reduced glutathione, superoxide dismutase and catalase increased up to 9.7 ± 0.7 μmol/g, 7.9 ± 0.6 μmol/g and 18.8 ± 0.7 μmol of h2o2 reduction/mg protein/min but lipid peroxidation decreased up to 4.2 ± 0.6 nmol/ mg levels in the continuous group. while 600 mg/kg caused an induction in reduced glutathione 12.1 ± 1.1 μmol/g, superoxide dismutase 9.1 ± 0.8 μmol/g and catalase 25.5 ± 1.0 μmol of h2o2 reduction/mg protein/ min and increased the lipid peroxidation level to 1.4 ± 0.4 nmol/mg as compared with the carcinogen control group (p<0.001) shown in table ii. the phytochemical analysis showed the presence of reducing sugars, alkaloids, tannins, saponins, terpinoids, flavonoids, anthraquinones and glycosides and detection of quercetin by hplc analysis is shown in figure 3. discussion cancer chemoprevention by phytochemicals or herbal medicines is grabbing high interest now a day. these table i inhibition of morphological parameters of dmba/croton oil-induced skin tumors by c. bonariensis methanol extract control pre group peri group post group continuous group 300 mg/kg 600 mg/kg 300 mg/kg 600 mg/kg 300 mg/kg 600 mg/kg 300 mg/kg 600 mg/kg cumulative number of papilloma 18.2 (1.6) 16.8 (3.6) 15.8 (2.4) 12.0 (2.6) 10.6 (6.2) 10.0 (6.0) 8.6 (5.0) 7.4 ± 4.9c 4.8 ± 6.6c tumor yield 3.6 (0.3) 3.4 (0.7) 3.2 (0.5) 2.4 (0.5) 2.1 (1.2) 2.0 (1.2) 1.7 (1.0) 1.5 ± 1.0c 1.0 ± 1.3c tumor burden 3.6 (0.3) 3.4 (0.7) 3.6 (0.3) 2.4 (0.5) 2.7 (1.6) 2.5 (1.5) 1.2 (1.7) 1.9 ± 1.2c 1.2 ± 1.7c tumor incidence 5.0 (0.0) 5.0 (0.0) 5.0 (0.0) 4.0 (2.2) 4.0 (2.2) 4.0 (2.2) 3.0 (2.2) 4.0 ± 2.2c 3.0 ± 2.2c data are mean (sd); significance, ap<0.05; bp<0.01; cp<0.001 table ii induction of reduced glutathione, superoxide dismutase, catalase and inhibition of lipid peroxidase level by c. bonariensis methanol extract control pre group peri group post group continuous group 300 mg/kg 600 mg/kg 300 mg/kg 600 mg/kg 300 mg/kg 600 mg/kg 300 mg/kg 600 mg/kg reduced glutathione 3.3 (0.2) 3.7 (0.4) 7.6 (0.6) 4.1 (0.6) 8.7 (0.9) 7.9 (0.7) 10.3 (1.0) 9.7 (0.7)c 12.1 (1.1)c superoxide dismutase 1.7 (0.1) 2.0 (0.6) 4.2 (0.4) 5.5 (0.5) 6.7 (0.7) 7.0 (0.5) 8.8 (1.0) 7.9 (0.6)c 9.1 (0.8)c catalase 13.6 (0.8) 13.8 (0.6) 16.0 (0.3) 16.5 (0.7) 18.3 (1.1) 19.6 (1.0) 21.2 (1.3) 18.8 (0.7)c 25.5 (1.0)c lipid peroxidation 7.7 (0.2) 6.2 (0.4) 5.8 (0.2) 4.9 (0.5) 3.5 (0.8) 4.1 (0.5) 2.9 (0.6) 4.2 (0.6)c 1.4 (0.4)c data are mean (sd); the results are compared by one-way anova (analysis of variance); significance, ap<0.05; bp<0.01; cp<0.001 470 bangladesh j pharmacol 2015; 10: 467-474 figure 2: histopathology of control and c. bonariensis (methanol) extract treated groups obtained at the end of study. carcinogen control (a) ulceration and inflammatory slough on epidermis. c. bonariensis 300 mg/kg pre group (b) mild acanthosis, hyperkeratosis and mild papilomatosis with normal cytological features on epidermis. c. bonariensis 300 mg/kg continuous group (c) mild papillomatous changes on epidermis. c. bonariensis 600 mg/kg pre group (d): epidermis showed mild acanthosis with inflammation. c. bonariensis 600 mg/kg continuous group (e) mild degree of acanthosis with normal cytological features on epidermis figure 3: hplc chromatogram for analysis of c. bonariensis methanol extract bangladesh j pharmacol 2015; 10: 467-474 471 a b c d e 120 100 80 60 40 20 0 qurecetin [mv] v ol ta ge 5 10 15 20 25 30 time [min] 3.7 4.0 6.4 9.0 10.7 11.9 16.1 17.5 27.8 28.6 29.5 12.3 phytochemical exert their anti-cancer potential due to chemical constituents such as flavonoids, polyphenols, carotenoids, terpinoids and tannins which have been obtained from our daily dietary agents. flavonoids are potent anti-inflammatory, anti-oxidant and cytotoxic anti tumor agent. they have ability to reverse the process of carcinogenesis and inhibit the development of persistent tumor (sengupta et al., 2004). when tumor initiator, 7-12-dimethyl benz(a)antheracene (dmba) and tumor promoter, croton oil (active constituent: 12-o-tetradecanoylphorbol-13-acetate) was applied on the mice skin, they produced inflammation and reactive oxygen species (ros). these ros including o2-, oh-, h2o2 have ability to move from site of formation to the other healthy cells. dmba with its active metabolites cause mutation in healthy cells via diol epoxide induction. increased ros disturb the balance of oxidation/reduction reaction, oxidative stress parameters and take part in chemical carcinogenesis by changing the gene expression and destructing the cellular components. tpa along with ros, increase the epidermal ornithine decarboxylase, cox-2 and nitric oxide synthase level (shakilur et al., 2008). similarly, enzymatic oxidative stress parameters including superoxide dismutase and catalase and non enzymatic reduced glutathione help to play important role in enzymatic defense system and their lower level promote the tumor in healthy cells. reduced glutathione helps to protect the body from xenobiotics, toxic metabolites and ros (lu, 1999). superoxide dismutase and cat capture the reactive oxygen species and minimize their carcinogenic and mutagenic potential, balance the hydrogen/oxygen per oxide level by causing alteration in o2 and h2o2 radical (dasgupta et al., 2004). in carcinogen control group, level of reduced glutathione, superoxide dismutase and cat were significantly decreased and lipid peroxidation increased along with the tumor incidence, tumor yield and tumor burden due to the presence of increased ros. c. bonariensis methanol extract decreased the tumor incidence, tumor yield, tumor burden, cumulative number of papilloma and lipid peroxidation level as compare to carcinogen control group. the plant extract increased the level reduced glutathione, superoxide dismutase and catalase in continuous group in which plant extract was applied throughout the experimental period (16 weeks) with higher effects at 600 mg/kg/ b.wt as compare to 300 mg/kg. the phytochemical analysis had shown the presence of flavonoids, saponins, tannis and terpinoids and hplc analysis indicated querectin i.e a flavonoid. it is a potent bioactive molecule that possess anticarcinogenic potential since it can interfere with the initiation, development and progression of cancer by the modulation of cellular proliferation, differentiation, apoptosis, angiogenesis and metastasis (kumar et al., 2011). flavonoids have potential as chemopreventive agent for cancer treatment due to their ability to induce apoptosis (ramos, 2007) by arresting cell cycle at g1, s, g2 and m phases of cell cycle. also, previously, it is known that quercetin has ability to capture the ros, superoxide anions, hydroxyl and lipid peroxy radicals, inhibit cyclooxygenase, lipooxigenase, monoxygenase, phospholipase a2, protein kinase and nadh-oxidative pathways (kumar et al., 2011). so, it may be concluded that c. bonariensis methanol extract (at a dose of 600 mg/kg) possess significant cytotoxic activity which may due to the presence of quercetin (a flavonoid) against dmba induced skin carcinogenesis. references aebi h. catalase: in vitro. in: method in enzymology. colowick sp, kaplan no (eds). vol. 105. new york, academic press, 1984, pp 121-26. ahmad s. medicinal wild plants from lahore-islamabad motorway (m-2). pakistan j bot. 2007; 39: 355-75. ali m, qadir mi, saleem m, janbaz kh, gul h, hussain l, ahmad b. hepatoprotective potential of convolvulus arvensis against paracetamol-induced hepatotoxicity. bangladesh j pharmacol. 2013; 8: 300-04. ancuceanu rv, istudor v. pharmacologically active natural compounds for lung cancer. altern med rev. 2004; 9: 40219. arya p, kumar m. chemoprevention by triticum aestivum of mouse skin carcinogenesis induced by dmba and croton oil: association with oxidative status. asi pacific j can prev. 2011; 12: 143-48. chaudhry a, janbaz kh, uzair m, ejaz as. biological studies of conyza and euphorbia species. j res sci. 2001; 12: 85-88. cragg gm, newman dj. plants as a source of anti-cancer agents. j ethnopharmacol. 2005; 100: 72-79. dasgupta t, yadava pk, rao ar. chemomodulatory efficiency of basil leaf (ocimum basilicum) on drug metabolizing and anti-oxidant enzymes, and on carcinogen induced skin and fore-stomach papillomagenesis. j mol cell biochem. 2004; 226: 27-38. de almeida er. preclinical and clinical studies of lapachol and betalapachone. open nat prod j. 2009; 2: 42-47. deng f, lu jj, liu hy, lin lp, ding j, zhang js. synthesis and antitumor activity of novel salvicine analogues. chin chem lett. 2011; 2: 25-28. diogo cv, felix l, vilela s, burgeiro a, barbosa ia, carvalho m, oliveira p, peixoto f. mitochondrial toxicity of the phyotochemicals daphnetoxin and daphnoretin: relevance for possible anti-cancer application. toxicol in vitro. 2009; 23: 772-79. dixon ra, ferreira d. molecules of interest: genistein. phytochemistry 2002; 60: 205-11. dubey k, ray a, behera b. production of demethylated colchicine through microbial transformation and scale-up process 472 bangladesh j pharmacol 2015; 10: 467-474 development. process biochem. 2008; 43: 251-57. favila c, antonio m. chemical and biological study of conyza bonariensis (l.) cronquist (asteraceae). thesis dissertation. 2006. fuchs c, mitchell ep, hoff pm. irinotecan in the treatment of colorectal cancer. cancer treat rev. 2006; 32: 491-503. fulda s. betulinic acid for cancer treatment and prevention. int j mol sci. 2008; 9: 1096-107. goel a, kunnumakkara ab, aggarwal b. curcumin as ‘‘curecumin’’: from kitchen to clinic. biochem pharmacol. 2008; 75: 787-809. hait wn, rubin e, alli e, goodin s. tubulin targeting agents. update cancer ther. 2007; 2: 1-18. hampson p, wang k, lord j. treatment of actinic keratoses, acute myeloid leukemia therapy treatment of basal cell carcinoma protein kinase c activator. drugs fut. 2005; 30: 1003-05. khan fa, hussain i, farooq s, ahmad m, arif m, rehman iu. phytochemical screening of some pakistanian medicinal plants. middle-east j sci res. 2011; 8: 575-78. khan ra, bukhari ia, nawaz sa, choudhary mi. acetylcholinesterase and butyrylcholinesterase inhibitory potential of some pakistani medicinal plants. j basic appl sci. 2006; 2: 07-10. kingston dg. the shape of things to come: structural and synthetic studies of taxol and related compounds. phytochemistry. 2007; 68(14): 1844-54. kumar b, sandhar h, prasher s, tiwari p, salhan m, sharma p. a review of phytochemistry and pharmacology of flavonoids. int j pharmaceut sciencia. 2011; 1: 25-41. kuo y, kuo p, hsu y, cho c, lin c. ellipticine induces apoptosis through p53-dependent pathway in human hepatocellular carcinoma hepg2 cells. life sci. 2006; 78: 2550-57. li y, li c, yu d, pardee ab. potent induction of apoptosis by -lapachone in human multiple myeloma cell lines and patient cells. mol med. 2000; 6: 1008-15. lu l, li ym, fu gq, yang l, jiang jg, zhu l, lin fl, chen j, lin qs. extraction optimisation of daphnoretin from root bark of wikstroemia indica (l.) c.a. and its antitumour activity tests. food chem. 2011; 124: 1500-06. lu sc. regulation of hepatic glutathione synthesis: current concepts and controversies. faseb j. 1999; 13: 1169-73. mans, d, da rocha a, schwartsmann g. anti-cancer drug discovery and development in brazil: targeted plant collection as a rational strategy to acquire candidate anticancer compounds. oncologist 2000; 5: 185-98. marklund s, marklund g. involvement of the superoxide anion radical in autooxidation of pyrogallol and a convenient assay for superoxide dismutase. euo j biochem. 1974; 47: 469-74. mojab f, kamalinejad m, ghaderi n, vahidipour hr. phytochemical screening of some species of iranian plants. iran j pharmac res. 2003; 4: 77-82. moon yj, wang x, morris me. dietary flavonoids: effects on xenobiotic and carcinogen metabolism. toxicol in vitro. 2006; 20: 187-210. moron ma, depierre jw, mannervick b. levels of glutathione, glutathione reductase and glutathione s-transferase activities in rat lung and liver. biochem biophys acta. 1979; 582: 67-78. ohkhawa h, ohishi n, yogi k. assay for lipid peroxidation in animal tissue by thiobarbituric acid reaction. analy. biochem. 1979; 95: 351-58. okouneva t, hill bt, wilson l, jordan ma. the effects of vinflunine, vinorelbine, and vinblastine on centromere dynamics. mol cancer ther. 2003; 2: 427-36. parmar j, sharma p, verma p, goyal pk. modulation of dmba -induced biochemical and histopathological changes by syzygium cumini seed extract during skin carcinogenesis. int j curr biomed pharmac res. 2011; 1: 24-30. patil jb, kim j, jayaprakasha gk. berberine induces apoptosis in breast cancer cells (mcf-7) through mitochondrialdependent pathway. eur j pharmacol. 2010; 645: 70-78. ramos, s. effects of dietary flavonoids on apoptic pathways related to cancer chemoprevention. j nut biochem. 2007; 18: 427-42. roslida ah, fezah o, yeong lt. suppression of dmba/ croton oil-induced mouse skin tumor promotion by ardisia crispa root hexane extract. asi pacific j can prev. 2011; 12: 665-69. sa g, das t, banerjee s, chakraborty j. curcumin: from exotic spice to modern anticancer drug. al ameen j med sci. 2010; 3: 21-37. saleem m, ahmed b, qadir mi, rafiq m, ahmad m, ahmad b. hepatoprotective effect of chenopodium murale in mice. bangladesh j pharmacol. 2014; 9: 124-28. santana pm, miranda m, gutiérrez y, garcía g, orellana t, orellana-manzano a. anti-inflammatory and antimitotic effect of the alcoholic extract and chemical composition of the oil from conyza bonariensis (l.) cronquist (deer shinbone) leaves. rev cubana plant med. 2011; 16: 13-23. sengupta a, ghosh s, bhattacharjee s. indian food ingredients and cancer prevention: an experimental evaluation of anticarcinogenic effects of garlic in rat colon. asian pacific j can prev. 2004; 5: 126-32. shahwar d, raza ma, saeed a, riasat m, chattha f, javaid m, ullah s, ullah s. anti-oxidant potential of the extracts of putranjiva roxburghii, conyza bonariensis, woodfordia fruiticosa and senecio chrysanthemoids. afr j biotech. 2012; 11: 4288-95. shakilur r, kanchan b, abdul qk. topically applied vitamin e prevents massive cutaneous inflammatory and oxidative stress responses induced by double application of 12-otetradecanoylphorbol-13-acetate (tpa) in mice. chemicobiologi intera. 2008; 172: 195-205. shoeb m, macmanus sm, jaspars m, trevidadu j, nahar l, thoo-lin pk, sarker sd. montamine, a unique dimeric indole alkaloid, from the seeds of centaurea montana (asteraceae), and its in vitro cytotoxic activity against the caco2 colon cancer cells. tetrahedron 2006; 62: 11172-77. bangladesh j pharmacol 2015; 10: 467-474 473 author info mohammad saleem (principal contact) e-mail: saleem2978@hotmail.com; cell: +92-321-4289022 shoeb m, celik s, jaspars m, kumarasamy y, macmanus s, nahar l, kong t, sarker s. isolation, structure elucidation and bioactivity of schischkiniin, a unique indole alkaloid from the seeds of centaurea schischkinii. tetrahedron. 2005; 61: 9001-06. simoens c, lardon f, pauwels b, de pooter cm, lambrechts ha, pattyn gg, breillout f, vermorken jb. comparative study of the radiosensitising and cell cycle effects of vinflunine and vinorelbine, in-vitro. bmc cancer. 2008; 8: 65. wang f, gao y, gao l, xing t. study on the electrochemical behavior of the anticancer herbal drug berberine and its analytical application. j chin chem soc. 2011; 58. xie j, ma t, gu y, zhang x, qiu x, zhang l, xu r, yu y. berbamine derivatives: a novel class of compounds for antileukemia activity. eur j med chem. 2009; 44: 3293-98. xu r, dong q, yu y, zhao x, gan x, wu d, lu q, xu x, yu xf. berbamine: a novel inhibitor of bcr/abl fusion gene with potent anti-leukemia activity. leuk res. 2006; 30: 17-23. zhang ja, xuan t, parmar m, ma l, ugwu s, ali s, ahmad i. development and characterization of a novel liposomebased formulation of sn-38. int j pharm. 2004; 270: 93-107. 474 bangladesh j pharmacol 2015; 10: 467-474 mailto:saleem2978@hotmail.com dateprinted: this article was downloaded by you on: sep 10, 2017 bangladesh journal of pharmacology research article effects of l-dopa and p-coumaric acid combination on oxidative stress, dna damage, and mitochondrial apoptosis in neuroblastoma cells bjp introduction neuroblastoma is a ganglion cell-derived tumor group consisting of primordial neural crest cells (rha et al., 2003). through advances in basic science and clinical research in the treatment of neuroblastoma in recent years, new therapeutic options have been sought. in parkinson's, alzheimer's, and neurological cancers, dopaminergic neuron loss is characterized by a significant decrease in the neostriatal ingredient of dopamine and its main metabolites (hornykiewicz, 1966, 1973, 1988). with the preferred treatment, the administration of l-dopa is aimed at its conversion to dopamine by catalyzing decarboxylase in the brain and thus increasing dopamine in surviving neurons. although l-dopa can alleviate most of the signs of neurodegenerative diseases, treatment is not sufficient and dopaminergic cells proceed to die in most patients taking l-dopa therapy (german et al., 1989). studies have found that l -dopa and dopamine are cytotoxic to cells in culture. the mechanism of dopamine toxicity in melanoma and other tumor cells is not clear yet. studies show that focusing on the g1/s phase of the cell cycle and inhibition of dna synthesis in cells is necessary (oberley and buettner, 1979; park et al., 1990). inhibition of ribonucleotide reductase affects cytotoxicity (pawelek and lerner, 1978). p-coumaric acid, a phenolic acid of the hydroxycinnamic acid family, is synthesized by phenylalanine and tyrosine (ossio et al., 2017; kianmehr et al., 2020). it can be converted into phenolic acids, flavonoids, secondary metabolites, and lignin precursors. a protective role in atherosclerosis, oxidative cardiac injury, oxidative heart damage, uv-ocular tissue damage, neuron damage, anxiety, gout, and diabetes had been published (kianmehr et al., 2020). abstract this study aimed to investigate the effects of levodopa (l-dopa), p-coumaric acid, and combinations in the neuroblastoma (n1e-115) cell. l-dopa and ldopa plus p-coumaric acid group caused oxidative stress by increasing 12.5 and 3.7-fold in superoxide dismutase gene, 11.5 and 4.8-fold increase in catalase gene, respectively. in l-dopa and l-dopa plus p-coumaric acid application, p21 gene expression increased 1.3-fold and 3.2-fold, and the cell cycle stopped in the g1 phase in response to stress in the treatment groups. in the application of l-dopa plus p-coumaric acid to n1e-115 cells, the bcl-2 gene, which is an apoptosis inhibitor, was suppressed and the bax gene increased 13-fold compared to the control. as a result, it was determined that the cytotoxic effect of l-dopa plus p-coumaric acid application was less than the individual application of the substances, and p-coumaric acid had an inhibitory effect on l-dopa-induced stress. article info received: 8 april 2023 accepted: 15 may 2023 available online: 8 june 2023 doi: 10.3329/bjp.v18i2.65531 cite this article: turker np, bakar e. effects of l-dopa and p-coumaric acid combination on oxidative stress, dna damage, and mitochondrial apoptosis in neuroblastoma cells. bangladesh j pharmacol. 2023; 18: 49-57. effects of l-dopa and p-coumaric acid combination on oxidative stress, dna damage, and mitochondrial apoptosis in neuroblastoma cells nebiye pelin turker1 and elvan bakar2 1 technology research development application, and research center, trakya university, edirne, turkey; 2 department of basic pharmaceutical sciences, faculty of pharmacy, trakya university, edirne, turkey. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 49-57 journal homepage: www.banglajol.info; www.bdpsjournal.org0 abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 this study aims to elucidate the possible mechanisms by which combined l-dopa plus p-coumaric acid causes neuroblastoma toxicity. the idea is that p-coumaric acid may be associated with oxidative or non-oxidative dopamine toxicity. therefore, in this study, neuroblastoma (n1e-115) cells were exposed to concentrations of l-dopa and l-dopa plus p-coumaric acid for 24 hours. materials and methods cell culture and passage neuroblastoma n1e-115 (atcc® crl2263™) cell line was used in the study. the cell line was cultured in the flow room [safe fast elite (en 12469 2000)]. in the passage and culture of cells, dmem:emem:ham’s f-12 (multicell) (in proportion as: 1:1:1), 1% penicillinstreptomycin (multicell (450-201-z2), 1% l-glutamine [multicell (609-065-e2)], 5% newborn medium containing bovine serum (multicell, fbs-hi-iia) was used and incubated in sterile incubators at 37ºc and 5% co2 (panasonic). cultured cell lines were replicated until the 5th passage and stocks were prepared for further use (dmso (merck 67-68-15) was frozen in liquid nitrogen in medium-containing cryotubes and stored at -150°c (panasonic). in all studies, it started from the 5th passage of the cell lines, and the study was terminated at the 15th passage. application of molecules and dose determination cell viability and proliferation were determined by an mtt assay. first, l-dopa, p-coumaric acid, and l-dopa plus p-coumaric acid combination doses were calculated and ld50 doses was determined. rna isolation and cdna synthesis pure link rna isolation kit was used for total rna isolation from the n1e-115 cell line (invitrogen™12183018a). the amount of rna isolated was determined with nanodrop (nanoq optizen). pcr conditions using the cdna reverse transcription kit (applied biosystems-00709629) step 1: 25°c, 10 min; step 2: 37°c, 120 min; step 3: 85°c was programmed to be 5 min and cdna synthesis were done. 50 bangladesh j pharmacol 2023; 18: 49-57 box 1: mtt assay principle nad(p)h-linked oxidoreductase in living cells converts the yellow mtt reagent to dark purple formazan (an insoluble crystal). the darker the fluid, the more live and metabolically active cells there are. requirements benchtop centrifuge; dimethyl sulfoxide; ethanol; formazan; incubator with 5% co2 at 37°c; microplates-96 well; modified eagle medium culture of dulbecco (5% fbs); mtt (3-[4,5dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide); multi-channel pipette (0.01-0.3); multiwell plate reader (thermofisher, microplate reader); n1e-115 cells; plate shaker; round or flat bottom well; single channel pipette (0.001-1 ml) procedure mtt solution preparation step 1: dissolve 150 mg of mtt powder in 30 ml of phosphate buffer solution step 2: in the dark, mix the solution using a magnetic stirrer for roughly 1 hour step 3: sterilize the solution using a 0.22 mm filter and store in 10 ml aliquots at -20°c incubation of cell day 1 step 1: culture n1e-115 cells in 10 ml of dulbecco's modified eagle's medium step 2: centrifuge the medium for 2.3 min in a sterile hawk tube (15 ml) at 2500 rpm step 3: drain the medium and resuspend the cells in 1 ml of culture media step 4: count and record cells per ml aseptically step 5: dilute the cells to 106 cells/ml. use dulbecco's modified eagle medium to dilute cells step 6: add 180 µl of cells (105 cells total) to each well and incubate for 24 hours day 2 step 1: plant the substances to be applied in the wells at 20 µl step 2: final volume should be 200 µl/well step 3: cells are plated in 8 replicates to minimize variation in results. incubate cells for 24 hours day 3 step 1: add 20 µl of 0.5 mg/ml mtt to each well. everything should be done aseptically step 2: next, incubate the plate for an additional 2-4 hours at 37°c in a co2 incubator, depending on the cell. intracellular formazan crystals wait until it becomes visible under the microscope step 3: remove the medium and add 100-200 µl of dmso step 4: measure absorbance at 492 nm using the microplate reader calculation ic50 values were calculated by probit analysis of spss 20 software reference deivasigamani et al., 2019 reference (video) bahuguna et al., 2017 real-time pcr (qrt-pcr) quantstudio 6 flex qrt-pcr system (sybr green method (powersybr greenapplied biosystems1805575)), which can read 384-well microplates, was used. gapdh was used as the endogenous gene and samples were analyzed. the genes used and their sequences are given in supplementary table i. determination of intracellular ion concentration after the ld50 value was determined, the cells were taken into 6-well plates and this ld50 value was applied to n1e-115 cell lines. after 24 hours of incubation, the cells of the treatment and control groups were incubated with nitric acid overnight and the amounts of sodium and potassium were determined on the icp-ms device (agilent 7700x icp-ms). genetic stability analysis with random amplified polymorphic dna the genetic stability of the substances applied in the n1e-115 cell lines was evaluated on the cell by pcrbased rapd analysis using 3 randomly selected primers [30 opaf 05 (cccgatcaga), 5 opa 09 (gggtaacgcc), and 14 opc 09 (ctcaccgtcc)]. a commercial kit was used for dna isolation. the quality and quantity of dna were controlled from the values obtained by running on a 1% agarose gel and also with 260/280 nm uv. the duplicability of pcr amplification was evaluated using chosen primers with isolated dna samples. rapd pcr content and the amplification reaction are given in supplementary table ii. the pcr products were stained with 2% agarose gel, ethidium bromide (0.5 µg/ml) in 2% tris-acetate edta buffer, and were run on electrophoresis and imaged under uv light. the number of bands was registered using the gel doc system (bio-rad). the size of the amplification products was guessed using the 100–3000 bp dna ladder (biomatic, m7123-100 loads). genomic template stability (gts (%) was calculated with the following equation: gts%=100-(100a/n), where ‘n’ is the number of bands detected in control dna profiles, ‘a’ is the average number of changes in dna profiles immunofluorescence staining method n1e-115 cell lines were cultured for 24 hours in the presence of l-dopa, p-coumaric acid, and l-dopa plus p -coumaric acid, and then the cell lines were washed with pbs. cas3,7 (thermofisher cat. no. c10423), and cell viability imaging kit (blue/red) (thermofisher cat. no. r37610) using fluorescence microscopy (carl zeiss, axio observer) by staining according to the kit protocol images were obtained. statistical analysis in the mtt study, probit analysis was performed to determine the ic50. in the icp-ms study, one-way of variance (anova) duncan test was preferred. in real time pcr studies, gadph gene expression was used as δδct method and calibration curve and correction factor in determining gene expression differences between groups. in the comparison of control and trial groups, anova test was performed and the groups in which the averages entered were determined by duncan test (p<0.0001). spss 20 (university licensed) were used in all analyzes. results mtt analysis results within the scope of the study, the effect of l-dopa and l-dopa plus p-coumaric acid combinations on cell viability for 24 hours in n1e-115 cell lines was determined with the mtt. exposure of the n1e-115 cell line to l-dopa and l-dopa plus p-coumaric acid for 24 hours caused dose-related death on cell viability. the ld50 dose, which was 52.5 µm and 25.4 µm with the application of l-dopa and p-coumaric acid alone, 7.6 µm was found in the combination application. the cell viability (%) graph obtained from mtt results is given in figure 1. anova test revealed that there was a statistically significant difference in mean values between at three groups (f(17.1), 95% c.i., p=0.01). gene expression results by qrt-pcr in the study, changes in gene expressions were determined by the qrt-pcr method using cdnas obtained from rnas isolated from neuroblastoma cell lines. the changes in the expressions of the genes determined in the n1e-115 neuroblastoma cells of the groups in which the applications were made compared to the control group were included in the study as 3 repetitions and statistical evaluations were made. the changes caused by the combinations of l-dopa and l-dopa plus p-coumaric acid in the expression of 0 100 50 25 12.5 6.25 3.12 1.56 0.78 0.39 0.19 dose (µm) 100 80 60 40 20 0 % v ia b il it y l-dopa p-coumaric acid l-dopa plus p-coumaric acid figure 1: mtt cell viability (%) on n1e-115 neuroblastoma cell line after treatment with l-dopa, p-coumaric acid and both bangladesh j pharmacol 2023; 18: 49-57 51 apoptotic signaling pathway (intrinsic and extrinsic apoptosis) genes are given in figure 2a. when the ldopa plus p-coumaric acid combination was applied to neuroblastoma cells, it was determined that the bcl-2 gene, which is an apoptosis inhibitor, was suppressed and the bax gene increased 13.0 ± 0.5 times compared to the control (figure 2a). there was a statistically significant difference in bax gene between at l-dopa plus p-coumaric acid combination (f:5600.42, p=0.01, 95% c.i. = [13.04]). this increase in bax expression level disrupted the mitochondrial membrane and initiated apoptosis by releasing cytochrome-c into the cytosol. the increase in bax expression level in l-dopa administration could not suppress the activity of bcl-2 but increased bax gene expression changed the bax/ bcl-2 ratio (figure 2b). one-way anova was performed to compare the effect of gene expressions on three different groups. there was a statistically significant difference in the mean of some apoptosis genes between groups (p<0.05). average relative fold changes and standard deviation values are given in table i. figure 2c shows the changes in the expression of genes linked to the oxidative stress pathway induced by c b a figure 2: on n1e-115 neuroblastoma cell line, mrna expression of apoptotic signaling pathway genes (n=3 ± sd) (relative to the control group; one-way anova post hoc duncan, a,bp<0.05)[a]. bax/bcl-2 ratio relative fold change (n=3 ± sd) (relative to the control group; one-way anova post hoc duncan, a,bp<0.05)[b]. mrna expression of oxidative stress signaling pathway genes (n=3 ± sd) (relative to the control group; one-way anova post hoc duncan, a,bp<0.05)[c]. mrna expression of cell cycle signaling pathway genes (n=3 ± sd) (relative to the control group; one-way anova post hoc duncan, a,bp<0.05)[d] a 100 80 60 40 20 0 r e la ti v e f o ld c h a n g e apoptotic pathway genes relative fold change l-dopa p-coumaric acid l-dopa plus p-coumaric acid none 0 10 20 30 40 bax/bcl-2 d 25 20 15 10 5 0 r e la ti v e f o ld c h a n g e genes oxidative stress pathway 4 3 2 1 0 genes p27 p21 cell cycle pathway a a a a a a a a a a a a a a a a a a a a a a a b b b b b b b b 52 bangladesh j pharmacol 2023; 18: 49-57 combinations of l-dopa and l-dopa + p-coumaric acid. a one-way anova was performed to compare the effect of three groups' oxidative stress genes (95% c.i.). application of l-dopa, l-dopa plus p-coumaric acid combinations caused oxidative stress in n1e-115 cells and it was determined that it caused oxidative stress by increasing 12.5 ± 0.1 fold, 3.7 ± 0.1 fold in superoxide dismutase gene, 11.5 ± 0.1 fold, and 4.8 ± 0.0 fold in catalase gene, respectively (p<0.05). there was no statistically significant difference in glutathione peroxidase (p=0.101) and reduced glutathione (p=0.055). average relative fold changes and standard deviation values are given in table i. changes in p21cip1 and p27kip1 gene expressions are given in figure 2d. a one-way anova revealed that there was a statistically significant difference between groups. there was no statistically significant difference in p21 genes between groups (f:187.74, 95% c.i., p=0.066). according to the results of the analysis, the p21cip1 gene expression in the n1e-115 cell lines was increased by 1.4 ± 0.3 and 1.3 ± 0.5 fold, respectively, in the application of l-dopa and l-dopa plus p-coumaric acid combinations compared to control. the highest increase in p27kip1 gene expression was observed in ldopa plus p-coumaric acid (3.2 ± 0.3) (p27, f: 16.346, 95% c.i., p=0.01). average relative fold changes and standard deviation values are given in table i. results of intracellular na+, k+ determination l-dopa, l-dopa plus p-coumaric acid administration disrupted the intracellular ion balance (na+, k+) (data are not shown). while there was a 1.6-fold increase in ions with l-dopa application, there was a 2.4-fold decrease in l-dopa plus p-coumaric acid application (one-way anova post hoc duncan, p<0.05). genetic stability analysis results by rapd pcr fingerprint profiles of cells made by rapd markers were evaluated to confirm whether the cells were c figure 3: on n1e-115 neuroblastoma cell line, agarose gel electrophoresis image (nprimer: 3, marker: 100 bp)[a]. genetic stability analysis with rapd pcr (nprimer: 3, ± sd). (relative to the control group; one-way anova post hoc duncan, a,bp<0.05)[b] b a 150 100 50 0 % g e n e ti c s ta b il it y none l-dopa p-coumaric acid l-dopa plus p-coumaric acid 30 opaf 05 5 opa 09 14 opc 09 marker none l-dopa p-coumaric l-dopa + none l-dopa p-coumaric l-dopa + none l-dopa p-coumaric l-dopa + acid p-coumaric acid p-coumaric acid p-coumaric acid acid acid b a a bangladesh j pharmacol 2023; 18: 49-57 53 genetically stable with the substances applied in cell culture applications. a total of 3 random rapd primers were tested for initial screening (gel image figure 4). for each rapd primer, the treatment groups were compared with the control group, and the genetic stability ratios were calculated by determining the number of bands that disappeared (figure 3). a significant difference was found in the combination of ldopa plus p-coumaric acid compared to one-way anova (p=0.02). immunofluorescence staining results the images of cas3,7 and cell viability (blue/red) staining analysis performed in the n1e-115 neuroblastoma cell line are given in figure 4. in the staining results, the dead cell density was highest in the l-dopa application compared to the control. in the l-dopa plus p-coumaric acid application, as expressed in the qrt-pcr results, the change of bax/bcl-2 ratio and the initiation of cytochrome-c release was confirmed by apoptotic cells. discussion the combination group formed a more stable genetic structure in n1e-115 cells compared to l-dopa or pcoumaric acid applied alone. l-dopa induced oxidative stress-induced cellular death. in addition, the combination application caused an increase in tnf-α gene expression by binding tnf-α, one of the death signals, to the fas/tnfr/dr5 death receptors on the cell surface. with the increase in tnf-α, cas-9 was activated and there was an increase in gene expression compared to the control. in combination application, it is seen that the increases in the hsp70 and hsp83 genes show that p-coumaric acid has a protective effect against the oxidative stress caused by l-dopa in neuroblastoma cells. in addition, especially in the application of l-dopa plus p-coumaric acid combination increased atf-4 gene expression. it is thought that stress-sensitive genes may be increased as the main transcription factor in response to eif-2-alpha/eif2s1 phosphorylation caused by l-dopa-induced oxidative stress and to promote cell recovery. in the results of intracellular ion analysis with icp-ms. with the application of l-dopa, it is confirmed that sodium and potassium ions, which increase 1.6 times compared to the control, increase the ion permeability of the cell due to oxidative stress. in ldopa and p-coumaric acid combination (2.4 fold) administration, a decrease in sodium and potassium figure 4: immunofluorescent staining of control (a), l-dopa (b), p-coumaric acid (c), l-dopa plus p-coumaric acid (d) groups of neuroblastoma (n1e-115) cells by cell viability imaging kit caspase 3/7. (blue: live cell; red: dead cell; green: caspase 3/7 positive) a b c d 54 bangladesh j pharmacol 2023; 18: 49-57 channels occurred compared to the control. results of intracellular ion analysis by qrt-pcr confirm that death caused by l-dopa plus p-coumaric acid combination application is caused by apoptosis. auto-oxidation of l-dopa can occur both extracellularly and intracellularly, whereas cells do not have a dopamine transport system, and therefore dopamine likely only causes extracellular damage (leanza et al., 2013). this study suggests that l-dopa is a toxic agent. alie et al. (1995), in their study on l-dopa toxicity in pc12 cells, carbidopa, an inhibitor of a-aromatic lamino acid decarboxylase, is caused by dopamine composed of exogenously added l-dopa of l-dopa cytotoxicity. they investigated that it does not originate. the results showed that l-dopa is toxic to pc12 cells through its auto-oxidation (basma et al., 1995). pedrosa r. et al. (2002) conducted a study to evaluate the neurotoxicity of l-dopa and dopamine and oxidative stress/apoptosis. this study was made to appreciate the importance of dopamine and l-dopa in neuronal cell death. the results showed that besides h2o2 production and quinone generation, l-dopaand dopamine-dependent cell death may result from apoptosis induction by an increase in caspase3 activity. caspase-3 activity, which increased with dopamine administration, also showed dopamine-induced toxicity by a mechanism distended of oxidative stress (pedrosa and soares-da-silva, 2002). in this study, the increased catalase gene expression with l-dopa administration indicates that hydrogen peroxide is formed during the auto-oxidation of ldopa. the anti-proliferative effect of p-coumaric acid on glioblastoma cell lines (a172, ln-229, ln-18, and lbc3) were evaluated (naumowicz et al., 2019). concentrations of 0.5–10 mmol/dm3 for all four cell lines evaluated were found to cause reductions in cell viability. however, the cytotoxic effect of p-coumaric acid was found to be most effective in a172 and lbc3 cells. a significant increase in casp-9 activity was sighted in a172 cells applied to p-coumaric acid. administration of 5 mmol/dm3 p-coumaric acid produced a significant increase in casp-9 activity in lbc3 cells, while a concentration of 8 mmol/dm3 did not significantly increase this activity. similarly, in a172 cells, they observed an almost two-fold increase in caspase 3/7 activity at both p-coumaric acid doses tested. caspase 3/7 activity was reduced in lbc3 cells at both 5 and 8 mmol/dm3 p-coumaric acid doses. this effect showed that events other than apoptotic cell death may be responsible (naumowicz et al., 2019). xiuci yan et al. (2020); studied the protective effect of pcoumaric acid to alleviate hepatocyte damage induced by palmitic acid. in this study, intracellular lipid accumulation decreased and the percentage of viability increased with the progression of fatty acid p-oxidation and lipolysis in pa-treated hepatocytes. they concluded that p-coumaric acid is effective on multiple hepatocellular metabolic lanes to arrange lipid metabolism. they reported that their results increased the likelihood that the therapeutic use of p-coumaric acid could alleviate hepatic lipid metabolic disorders (yan et al., 2020). human cancer cell lines such as colon (ht29-d4, hct15), glioblastoma, lung (a549), and neuroblastoma have demonstrated anti-cancer activity with decreased proliferation and reduced adhesion-suppressed cell migration (chien et al., 1999; javadov et al., 2011). caffeic acid, tyrosol and p-coumaric acid are potent inhibitors of 5-s-cysteinyl-dopamine induced neurotoxicity (david et al., 2010). it was determined that p-coumaric acid is a dopamine inhibitor (vauzour et al., 2010). various channels act a role in ion balance in organelles such as the endoplasmic reticulum, lysosome, nucleus, and mitochondria. in mitochondria, which plays a table i statistically significant apoptotic signal path, oxidative stress singal path and cell cycle control genes relative fold change genes l-dopa p-coumaric acid l-dopa plus p-coumaric acid apoptotic signal path cyc-c 10.8 ± 0.2↑ 86.6 ± 0.2↑ 23.0 ± 0.0↑ bax 10.6 ± 0.3↑ 29.9 ± 0.1↑ 13.0 ± 0.5↑ bcl-2 4.9 ± 0.1↑ 1.0 ± 0.4↓ 0.6 ± 0.0↓ apaf-1 5.9 ± 0.1↑ 12.0 ± 1.1↑ 12.1 ± 0.0↑ atf4 1.6 ± 0.1↑ 19.7 ± 1.2↑ 10.4 ± 0.0↑ casp-9 1.1 ± 0.0↑ 1.0 ± 0.1↓ 4.0 ± 0.0↑ oxidative stress signal path superoxide dismutase 12.5 ± 0.0↑ 3.5 ± 0.0↑ 3.7 ± 0.1↑ catalase 11.5 ± 0.1↑ 5.4 ± 0.4↑ 4.8 ± 0.0↑ cell cycle control p21cip1 1.4 ± 0.3↑ 2.1 ± 0.2↑ 1.3 ± 0.5↑ p27kip1 1.3 ± 0.4↑ 3.3 ± 0.2↑ 3.2 ± 0.36↑ bangladesh j pharmacol 2023; 18: 49-57 55 centrical role in apoptosis, the transition of ion channels can cause the death of cancer cells. in oncotherapy, it is very important to selectively stimulate the inner mitochondrial membrane permeability of cancer cells. certain cellular stresses and cytotoxic agents stimulate a prime example of such a pathway that is considered to be the last common pathway of cell death, namely the mitochondrial transmissivity transition (brenner and grimm, 2006; brenner and moulin, 2012). opening large calcium to mitochondrial transmissivity transition makes the inner mitochondrial membrane permeable to ions, activated by oxidative stress. the mitochondrial membrane potential is hoped to attend in the regulation of ros production. the expression of the mitochondriatargeted potassium channel (kv1.3) structure, which plays a significant role in the potassium channel, has been defined as a target of the bax gene, indicating the physical interplay between the proteins in apoptotic cells. incubation of kv1.3 positive isolated mitochondria with bax has been found to stimulate apoptosis, including ros production, membrane potential changes, and cytochrome c release (szabo et al., 2008; szabo et al., 2011). the loss of mitochondrial membrane potential, ie, decrease in ions, induced apoptosis associated with cytochrome c release and caspase activation (fernandez-salas et al., 2002). conclusion p-coumaric acid causes death in n1e-115 cell lines due to apoptosis. addition of l-dopa indicates that alternative therapies are of great importance in the treatment of diseases. financial support self-funded ethical issue the development, acquisition, authentication, cryopreservation, and transfer of cell lines between laboratories were followed according to the guidelines published in british journal of cancer, 2014 conflict of interest authors declare no conflict of interest acknowledgement the authors would like to acknowledge trakya university technology research development application and research center references adamczyk b, tharmalingam t, rudd pm. glycans as cancer biomarkers. biochim biophys acta. 2012; 1820: 47-53. anden ne, hfuxe k, hamberger b, hokfelt t. a quantitative study on the nigro-neostriatal dopamine neuron system in the rat. acta physiol scand. 1966; 67: 106-12. annis mg, soucie el, dlugosz pj, cruz‐aguado ja, penn lz, leber b, andrews dw. bax forms multispanning monomers that oligomerize to permeabilize membranes during apoptosis. embo j. 2005; 24: 2096-03. bahuguna a, khan i, bajpai vk, kang sc. mtt assay to evaluate the cytotoxic potential of a drug. bangladesh j pharmacol. 2017; 12: 115-18. basma an, morris ej, nicklas wj, geller hm. l-dopa cytotoxicity to pc12 cells in culture is via its autoxidation. j neurochem. 1995; 64: 825-32. blunt sb, jenner p, marsden cd. suppressive effect of l-dopa on dopamine cells remaining in the ventral tegmental area of rats previously exposed to the neurotoxin 6-hydroxydopamine. mov disord. 1993; 8: 29-33. brenner c, grimm s. the permeability transition pore complex in cancer cell death. oncogene 2006; 25: 744-56. brenner c, moulin m. physiological roles of the permeability transition pore. circ res. 2012; 111:237-47. chien mm, zahradka ke, newell mk, freed jh. fas-induced b cell apoptosis requires an increase in free cytosolic magnesium as an early event. j biol chem. 1999; 274:059-66. cohen g. monoamine oxidase and oxidative stress at dopaminergic synapses. j neural transm suppl. 1990; 32: 29-38. cohen g. monoamine oxidase, hydrogen peroxide, and parkinson's disease. adv neurol. 1987; 45: 19-25. cohen g. the pathobiology of parkinson's disease: biochemical aspects of dopamine neuron senescence. j neural transm suppl. 1983; 19: 89-03. fernández-salas e, suh ks, speransky vv, bowers wl, levy jm, adams t, pathak kr, edwards le, hayes dd, cheng c, steven ac. mtclic/clic4, an organellular chloride channel protein, is increased by dna damage and participates in the apoptotic response to p53. mol cell biol. 2002; 22: 61020. german dc, manaye k, smith wk, woodward dj, saper cb. midbrain dopaminergic cell loss in parkinson's disease: computer visualization. ann neurol. 1989; 26: 107-14. hornykiewicz o. dopamine (3-hydroxytyramine) and brain function. pharmacol rev. 1966; 18: 25-64. hornykiewicz o. neurochemical pathology and the etiology of parkinson's disease: basic facts and hypothetical possibilities. mt sinai j med. 1988; 55: 11-20. hornykiewicz o. parkinson's disease: from brain homogenate to treatment. fed proc. 1973; 32: 83-90. javadov s, hunter jc, barreto-torres g, parodi-rullan r. targeting the mitochondrial permeability transition: cardiac ischemia-reperfusion versus carcinogenesis. cell physiol 56 bangladesh j pharmacol 2023; 18: 49-57 author info nebiye pelin turker (principal contact) e-mail: npelinturker@trakya.edu.tr biochem. 2011; 27: 179-90. kianmehr z, khorsandi k, mohammadi m, hosseinzadeh r. low-level laser irradiation potentiates anticancer activity of p-coumaric acid against human malignant melanoma cells. melanoma res. 2020; 30: 36-46. kushner bh. neuroblastoma: a disease requiring a multitude of imaging studies. j nucl med. 2004; 45: 72-88. leanza l, biasutto l, manago a, gulbins e, zoratti m, szabo i. intracellular ion channels and cancer. front physiol. 2013; 4: 227. lonergan gj, schwab cm, suarez es, carlson cl. neuroblastoma, ganglioneuroblastoma, and ganglioneuroma: radiologic-pathologic correlation. radiographics 2002; 22: 11-34. naumowicz m, kusaczuk m, kruszewski ma, gal m, krętowski r, cechowska-pasko m, kotyńska j. the modulating effect of lipid bilayer/p-coumaric acid interactions on electrical properties of model lipid membranes and human glioblastoma cells. bioorg chem. 2019; 92: 103-42. oberley lw, buettner gr. role of superoxide dismutase in cancer: a review. cancer res. 1979; 39: 41-49. ogawa n, edamatsu r, mizukawa k, asanuma m, kohno m, mori a. degeneration of dopaminergic neurons and free radicals. possible participation of levodopa. adv neurol. 1993; 60: 42-50. ossio r, roldan-marin r, martinez-said h, adams dj, roblesespinoza cd. melanoma: a global perspective. nat rev cancer. 2017; 17: 93-04. park jg, frucht h, larocca rv, bliss jr dp, kurita y, chen tr, henslee jg, trepel jb, jensen rt, johnson be, bang yj. characteristics of cell lines established from human gastric carcinoma. cancer res. 1990; 50: 73-80. pawelek jm, lerner ab. 5,6-dihydroxyindole is a melanin precursor showing potent cytotoxicity. nature 1978; 276: 2628. pedrosa r, soares-da-silva p. oxidative and non-oxidative mechanisms of neuronal cell death and apoptosis by l-3,4dihydroxyphenylalanine (l-dopa) and dopamine. br j pharmacol. 2002; 137: 305-13. rha se, byun jy, jung se, chun hj, lee hg, lee jm. neurogenic tumors in the abdomen: tumor types and ima-ging characteristics. radiographics 2003; 23: 29-43. szabó i, bock j, grassmé h, soddemann m, wilker b, lang f, zoratti m, gulbins e. mitochondrial potassium channel kv1.3 mediates bax-induced apoptosis in lymphocytes. proc natl acad sci usa. 2008; 105: 861-66. szabo i, soddemann m, leanza l, zoratti m, gulbins e. singlepoint mutations of a lysine residue change function of bax and bcl-xl expressed in baxand bak-less mouse embryonic fibroblasts: novel insights into the molecular mechanisms of bax-induced apoptosis. cell death differ. 2011; 18: 427-38. vauzour d, corona g, spencer jp. caffeic acid, tyrosol and pcoumaric acid are potent inhibitors of 5-s-cysteinyldopamine induced neurotoxicity. arch biochem biophys. 2010; 501: 106-11. yan x, chen x, xu x, liu j, fu c, zhao d, zhao w, ma r, sun l. mechanism underlying p-coumaric acid alleviation of lipid accumula-tion in palmitic acid-treated human hepatoma cells. j agric food chem. 2020; 68: 742-49. zoratti m, de marchi u, gulbins e, szabo i. novel channels of the inner mitochondrial membrane. biochim biophys acta. 2009; 1787: 351-63. bangladesh j pharmacol 2023; 18: 49-57 57 mailto:npelinturker@trakya.edu.tr introduction rheumatoid arthritis (ra) is a chronic inflammatory systemic disease of unknown etiology. it is characterized by high infiltration of leukocytes into the synovium, leading to hyperplasia of the synovial lining, which causes progressive destruction of the cartilage consequently resulting in erosion of the underlying bone (pope, 2002). the activated rheumatoid synovial fibroblasts (rasfs) aggressively participate in ra synovitis. rasfs in ra joints vigorously proliferate forming a pannus, which produce inflammatory mediators such as cytokines, matrix metalloproteinases (mmps), and cyclooxygenase-2 (cox-2) eventually leading to the destruction of articular bone and cartilage (cawston, 1995; han et al., 2003). interleukin 1 (il-1 ) is considered as the most important cytokine in the pathogenesis of inflammatory events in ra. il-1 induces the proliferation of rasfs and also causes the production of high levels of inflammatory mediatorsmmps and prostaglandin e2 (pge2) (choy and panayi, 2001). while the pathogenesis of ra is not completely understood, the process is reported to involve cellular infiltration into the synovial tissue with marked increase of inflammatory cytokines tumor necrosis factor(tnf) , interleukin(il)-1 and il6, that eventually contribute to cartilage and bone erosion (arend, 2001; choy, 2012). these mediators activate major signalling pathways such as the nuclear factor (nf)-κb and mitogen activated protein kinases (mapks) (tas et al., 2005). mapks are a family of serine/threonine kinases that are involved in various cellular events such as inflammation, transcription of pro-inflammatory factors and a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2015; 10: 714-725 journal homepage: www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088; doi: 10.3329/bjp.v10i3.22865 abstract the study aimed to determine the effect of tangeretin in inhibiting the interleukin-1 (il-1 )-induced proliferation of rasfs and suppression of the production of inflammatory mediators. rasfs were isolated from synovial tissue obtained from patients with ra during knee arthroscopy. the cells were exposed to il‑1 (1.0 ng/ml) and/ or tangeretin (50 or 100 µm). cell viability was assessed following treatments. expressions of mmps and cox-2 were analysed by real-time pcr and western blotting. production of prostaglandin e2 (pge2) by rasfs were analysed by elisa. expressions of mitogen activated protein kinases (mapks) and nuclear factor-kb (nf-kb) were assessed by western blotting. tangeretin significantly inhibited the proliferation of rasfs, as well as down-regulated the expression of mmp-1, mmp-3 and cox-2 mrna and protein and also the phosphorylation of erk, p38 and jnk. raised level of expression of nf-κb and pge2 induced by il-1 was reduced by tangeretin. results indicate that tangeretin was effective in inhibiting the synovial fibroblast proliferation, as well regulated mmps, cox2, pge2 via modulation of p38 mapk, erk and jnk pathways. article info received: 4 april 2015 accepted: 2 may 2015 available online: 21 august 2015 keywords: interleukin-1 protein kinase rheumatoid arthritis tangeretin number of figures: 5 number of tables: 0 number of refs: 48 correspondence: gl yz e-mail: ligangtpm@yeah.net zhouyan7703@gmail.com tangeretin inhibits il-1β induced proliferation of rheumatoid synovial fibroblasts and the production of cox-2, pge2 and mmps via modulation of p38 mapk/erk/jnk pathways yong-ji li1, ting zhang1, jian-xin tu1, gang li2 and yan zhou1 1department of rheumatoid immunology and 2chemoradiation oncology, the first affiliated hospital of wenzhou medical university, wenzhou, zhejiang 325 000, china. http://www.bioxbio.com/if/html/bangl-j-pharmacol.html phosphorylation of transcription factor nf-κb (su and karin, 1996; dong et al., 2002). further research have demonstrated the activation of the members of signalling cascades such as nf-κb p65, and extra cellular signal-regulated kinase (erk), junn-terminal kinase (jnk) and p38mapks in ra synovial tissue. upon activation erk, jnk and p38mapk play vital roles in synovial inflammation and proliferation of synovial cells (luo et al., 2010; yang et al., 2010). present day treatment strategies towards ra are targeted predominantly against inflammatory mediators. owing to the adverse effects of the chronic usage of anti-inflammatory drugs in the treatment, exploring alternative means is indispensible. flavonoids are widely present in fruit and vegetables. citrus flavonoids have a wide range of biological activities including anticarcinogenic and antitumor. tangeretin (5,6,7,8,4′ -pentamethoxy flavone) is present in oranges and in other citrus peels (dong et al., 2014). it has been reported to exhibit various pharmacological activities: anti-oxidant (chen et al., 2012), neuroprotective (datla et al., 2001), anti-inflammatory activity (ho and kuo, 2014; shu et al., 2014) and inhibition of cancer cell proliferation (dong et al., 2014; periyaswamy et al., 2015). tangeretin has been reported to reduce the production of nitric oxide (no) by inhibition of lpsinduced expression of nitric oxide synthase (inos) and cox-2 in microglial cells (shu et al., 2014). considering the biological activities of tangeretin, we investigated its effects in proliferation of rheumatoid synovial fibroblasts and production of chemokines by rasfs. influence of tangeretin on various signal transduction pathways involved in inflammation were also evaluated. materials and methods reagents and chemicals: tangeretin was obtained from sigma‑aldrich (st. louis, mo, usa) and dissolved in dmso with a concentration of 100 mm stock solution. fetal bovine serum (fbs) was obtained from sigma‑aldrich (st. louis, mo, usa). recombinant human il‑1 was purchased from cell signaling technology (beverly, md, usa). antibodies against ikb , nf‑κb (p65), erk, jnk, p38, p‑erk, p‑jnk, p‑p38, ‑actin (cell signaling technology (beverly, md, usa), mmp‑1, mmp‑3 and tissue inhibitors of metalloproteinases (timp), cox‑2 (santa cruz biotechnology, inc., santa cruz, ca, usa) were used in western blot analysis. all other chemicals used in the investigation were purchased from sigma-aldrich, (st. louis, mo, usa) unless otherwise specified. isolation and culture of rasfs: this study was approved by the national university hospital ethical committee. synovial tissues were obtained from patients at the total knee arthroplasty in accordance with the american college of rheumatology criteria for ra (arnett et al., 1998) and as previously described by lee et al. (2006) and informed consent was obtained from all patients. cells were incubated at 37°c in 5% co2 in rpmi 1640 medium supplemented with 10 % (v/v) fbs, 100 units/ ml of penicillin, and 100 μg/ml of streptomycin. the rasfs were isolated after 3-7 passages. the synovial cells were homogeneous in morphology and had the manifestation of rasfs with distinctive fibroblastoid configuration. purity of the cells were tested using phycoerythrin (pe)-conjugated anti-thy-1 (cd90) or anti-cd14 and fluorescein isothiocyanate (fitc)conjugated anti-cd3 mab (bd pharmingen, san diego, ca). determination of cell viability: cell viability of the rasfs was determined using cck-8 kit (dojindo laboratories, japan). cck-8 kit employs dojindo’s tetrazolium salt, wst-8 [2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)5-(2,4-disulfophenyl)-2h-tetrazolium, monosodium salt] for determining viable cells. wst-8 in the living cells is reduced by cellular dehydrogenases to an orange formazan product that is directly proportional to the viable cell counts. briefly, rasfs (2 x l04 cells/ well) were treated with various concentrations of tangeretin (50 and 100 µm) and incubated for 24 or 48 h with/without il-1 (1.0 ng/ml). following incubation, the cells were washed twice with pbs and cck-8 (20 μl) was added to each well and incubated for about 2-3 hours. formazan crystals formed were dissolved by adding dmso (100 µl/well). the absorbance was read at 450 nm using a microplate reader (model 3550, biorad, richmond, ca, usa). analysis of apoptosis by annexin v assay: following incubation with tangeretin with/without il-1 (1.0 ng/ ml) for 24 and 48 hours, cells were then trypsinized and collected for detection of apoptosis with annexin v‑fitc apoptosis detection kit (santa cruz biotechnology, santa cruz, ca, usa) according to the manufacturer's instructions. briefly, 1 × 106 cells that were pretreated with tangeretin were subjected to annexin v staining. the treated cells were washed in pbs, resuspended in 100 μl of binding buffer containing a fitc-conjugated anti-annexin v antibody. the cells were then analyzed for flurosence using a flow cytometer (facs calibur, bd biosciences). rna isolation and semi-quantitative rt-pcr: to evaluate the expression of mmp-1, mmp-3, timp-1 and cox-2 mrna, rasfs (1 × 106 cells) were cultured for 12, 24 or 48 hours with/without il-1 (1.0 ng/ml) and/or tangeretin (50 or 100 μm). total rna was extracted from cultured rasfs after incubation with tangeretin using trisol reagent (invitrogen, carlsbad, ca, usa) following the manufacturer’s instructions. cdna derived from the reverse transcription of rna using maxime rt premix kit (intron biotechnology, south korea) was amplified using the following primer sets: timp-1 (forward) 5′-cct tct gca att ccg acc bangladesh j pharmacol 2015; 10: 714-725 715 tcg tc-3′ (reverse) 5′-cgg gca gga ttc agg ctatct gg-3′, mmp-1 (forward) 5′-gaa gga gat gaa gca gcc cag atg t-3′ (reverse) 5′-cag ttg tgg cca gaa aac aga agt gaa a-3′, mmp-3 (forward) 5′gac acc agc atg aac ctt gtt-3′ (reverse) 5′-gga acc gag tca gga ctatg-3′, cox -2 (forward) 5′-tcc ttg ctg ttc cca ccc atg-3′ (reverse) 5′-cat cat cag acc agg cac cag-3′, gapdh (forward) 5′-aaa tca agt ggg gcg atg ct-3′ (reverse) 5′-agc ttc ccg ttc agc tca gg-3′. the products were subjected to electrophoresis in 1% agarose gel. the bands were visualized by staining with ethidium bromide. densitometric analysis was performed on the relative intensity of each band (multigauge program, version 3.0, fuji film, tokyo, japan). western blotting: rasfs were cultured with/without il1 (1.0 ng/ml) and/or tangeretin (50 or 100 μm). rasfs (1 × 106 cells) were seeded on 100-mm culture dishes and harvested in pbs. after washing with pbs, cell pellets were lysed with lysis buffer (20 mm hepes, ph 7.2, 150 mm nacl, 1% triton x-100, 0.1 mm phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, 1 mm edta). after incubation for 30 min at 4°c, cellular debris were removed by centrifugation at 100,000 g for 30 min, and supernatants were analyzed by sds-page. for cox-2 immunoblotting the cell membranes were prepared from isolated rasfs as described previously (hodgkin et al., 1990). to determine the cytoplasmic ikb, cytoplasmic extracts were prepared (lee et al., 2006). to analyze nf-kb (p65), nuclear extract was prepared using a previously described method (lee et al., 2006). protein concentration was determined by biorad protein assay kit (bio-rad laboratories, usa). proteins were then fractionated by sds-page, electro transferred to nitrocellulose membranes, blotted with respective antibodies (mmp-1, mmp-3, timp, cox-2, erk, p-erk1/2, p-38, p-p38 mapk, jnk, p-jnk, nfkb (p65), ikb , and -actin) and the immunoreactive bands were detected by enhanced chemiluminescence (ge healthcare). assay of pge2 production: to analyse pge2 production in rasfs, the cells (1 × 104 cells) were grown in 25 cm2 tissue culture flasks for 48 hours before treatment and starved serum overnight before stimulation with il-1 . after washing with pbs (ph 7.4), rasfs were pretreated with il-1 (1.0 ng/ml) and/ or tangeretin (50 or 100 μm) for 48 hours at 37°c in dmem supplemented with 10% (v/v) fcs in an atmosphere of 5% co2 (sung et al., 2012). the supernatant was collected after incubation for 48 hours. the levels of pge2 in the medium were determined by elisa kit (r&d systems, minneapolis, mn, usa). statistical analysis: all data were expressed as the mean ± sd of results of three or six individual experiments. the data were analyzed using spss (free version). group mean values were compared by one-way anova. the values at p<0.05 were considered significant. results tangeretin inhibits il-1β induced proliferation and induces apoptosis of rasfs: il-1 is a well-known potent growth‑promoting factor of synovial fibroblasts. il-1 induced the proliferation of rasfs significantly (p<0.05) as compared with the control cells cultured in dmso without tangeretin (figure 1a). exposure to tangeretin (50 or 100 μm) significantly (p<0.05) inhibited the proliferation of rasfs treated with or without il-1 (p<0.05). the decrease in cell proliferation and viability was almost multifold as compared to il-1 induction alone. further, the effects of tangeretin on apoptotic counts of rasfs were examined by flow cytometry. il-1 induced increased proliferation is accompanied with a marked decrease in apoptotic cell counts. however, the percentage of annexin v-positive cells was observed to be significantly increased in the rasfs treated with tangeretin at both the doses as compared with the cells cultured without tangeretin (p<0.05) (figure 1b;1c). tangeretin at 100 μm dose was observed to be more effective in reducing cell viability and inducing apoptosis than at 50 μm. effects of tangeretin on il-1β induced mmp-1, mmp-3 and timp-1 mrna expression: studies have reported the expression of cox2 and mmps in human rasfs is enhanced by pro-inflammatory cytokines such as il-1 (crofford et al., 1994; tolboom et al., 2002). in our study to evaluate the effects of tangeretin on expression of mmp-1, mmp-3 and timp-1 genes under the influence of il-1 , rt-pcr was performed. rasfs were stimulated with il-1 (1.0 ng/ml). il‑1 significantly (p<0.05), enhanced the mrna levels of mmp‑1 and mmp-3 in rasfs nearly twice. however much changes were not observed in timp‑1 mrna levels. co-treatment with tangeretin with il‑1 caused a marked (p<0.05) decline in the mrna levels of mmp‑1 and mmp‑3 (figure 2). the inhibition of mrna expression was more obvious on exposure to 100 μm. further, inhibition of the expression of mmps was in a dosedependent manner in both unstimulated and il-1 stimulated rasfs, indicating the anti-inflammatory potential of tangeretin. attenuation of il-1β-induced cox-2 expression by tangeretin: cox-2 is a major enzyme that catalyzes the synthesis of various pgs including pge2 (smith et al., 1996). we determined the effect of tangeretin on il-1 induced cox-2 expression in synovial fibroblasts. rasfs were co-treated with 1.0 ng/ml il-1 and/or tangeretin (50 or 100 μm) for 12, 24 or 48 hours, and cox-2 mrna levels were detected by rt-pcr. tangeretin significantly attenuated the il-1 -induced 716 bangladesh j pharmacol 2015; 10: 714-725 figure 1: influence of tangeretin on il-1 induced proliferation of rasfs exposure to tangeretin (50 or 100 μm) significantly (p<0.05) inhibited the proliferation of rasfs in a dose-dependent manner (a) and as well significantly induced apoptosis as seen by increased apoptotic cell counts by annexin v staining (b and c); [a-control; b-il-1 ; c-tangeretin 50 µm; dtangeretin 100 µm; e-il-1 + tangeretin 50 µm ; f-il-1 + tangeretin 100 µm]; values are represented as mean ± sd; n=6; *represents statistical significance at p<0.05 compared against control as determined by one-way anova a b c bangladesh j pharmacol 2015; 10: 714-725 717 cox-2 mrna expression on 12, 24 or 48 hours. exposure to tangeretin at 100 μm caused a more significant inhibition of cox-2 mrna expression. the cells revealed a dose-dependent inhibitory effect of tangeretin on the il-1 -induced increase in cox-2 mrna levels (figure 2). in addition, immunoblotting showed that tangeretin could attenuate the il-1 induced cox-2 protein increase (p<0.05). tangeretin inhibits il-1β-induced pge2 production in rasfs: pge2 is a pleiotropic mediator of inflammation and its excessive production is associated with many pathologic processes. pge2 plays a vital role in eliciting signs and symptoms of inflammation (martel-pelletier et al., 2004). we investigated the effects of tangeretin on pge2 production by rasfs. rasfs were cultured with il-1 (1.0 ng/ml) for 48 hours. a multifold increases in pge2 production occurred after il-1 treatment (p<0.05) in comparison to cells not exposed to il-1 . however, tangeretin treatment markedly inhibited pge2 production in a dose-dependent manner. the levels of pge2 were in line with the results of cox-2 expression, indicating that suppression of cox-2 decreased pge2 production (figure 3). effect of tangeretin on il-1β-induced signal pathways in rasfs: the influence of tangeretin on the expression of mapk pathway proteins and nf κb were determined by western blotting. mapk pathway is involved in regulation of cell proliferation, apoptosis, cytokine expression and mmp production (kim et al., 2006). nf‑κb and mapks have been reported to participate in the pathogenic mechanisms of inflammation and the destruction of joints in ra. il-1 at 1.0 ng/ml caused activation of the intracellular mapks including erk, p38, and jnk resulting in marked increase in the phosphorylation status of these proteins as well increase in mmp levels (figure 4 a-h). however, tangeretin significantly down-regulated il 1 -induced phosphorylation of jnk, erk, and p38. the inhibition of phosphorylation by tangeretin was observed to be time and dose-dependent. furthermore, tangeretin reduced the expressions of mmps and coxfigure 2: influence of tangeretin on il-1 induced mmp-1, mmp-3 and timp-1 mrna expression l1-control; l2-il-1 ; l3-tangeretin 50 µm; l4-tangeretin 100 µm; l5-il-1 + tangeretin 50 µm; l6-il-1 + tangeretin 100 µm figure 3: tangeretin inhibits il-1 -induced pge2 production in rasfs values are represented as mean ± sd; n=6; *represents statistical significance at p<0.05 compared against control as determin ed by one-way anova 718 bangladesh j pharmacol 2015; 10: 714-725 2. nuclear translocation and activation of nf-kb is known to be dependent on phosphorylation and subsequent degradation of ikb (adcock, 1997). while il-1 caused marked activation of nf-κb and p65, significant decrease of cytoplasmic ikb was observed in rasfs. nf-κb activation was observably inhibited by tangeretin with considerable increase in cytoplasmic ikb (figure 5 a-d). these results indicate that tangefigure 4: influence of tangeretin on il-1 -induced protein expressions tangeretin significantly reduced the il-1 -induced raised expressions of mmps and cox-2 following 24 hours (a and c) and 48 hours (b and d) of exposure. il-1 -induced marked increases in the phosphorylation status and as well increased expressions of mapk pathway proteins were regula ted by tangeretin at both the doses (50 and 100 µm) and at 24 hours (e and g) and 48 hours (f and h); l1-control; l2-il-1 ; l3-tangeretin 50 µm; l4tangeretin 100 µm; l5-il-1 + tangeretin 50 µm; l6-il-1 + tangeretin 100 µm; values are represented as mean ± sd; n=3; *represents statistical significance at p<0.05 compared against control as determined by one-way anova a b c bangladesh j pharmacol 2015; 10: 714-725 719 figure 4: influence of tangeretin on il-1 -induced protein expressions (cont.) tangeretin significantly reduced the il-1 -induced raised expressions of mmps and cox-2 following 24 hours (a and c) and 48 hours (b and d) of exposure. il-1 -induced marked increases in the phosphorylation status and as well increased expressions of mapk pathway proteins were regula ted by tangeretin at both the doses (50 and 100 µm) and at 24 hours (e and g) and 48 hours (f and h); l1-control; l2-il-1 ; l3-tangeretin 50 µm; l4tangeretin 100 µm; l5-il-1 + tangeretin 50 µm; l6-il-1 + tangeretin 100 µm; values are represented as mean ± sd; n=3; *represents statistical significance at p<0.05 compared against control as determined by one-way anova d e f 720 bangladesh j pharmacol 2015; 10: 714-725 retin potentially inhibited il-1 -induced, expression of cox-2 and regulated the intracellular mapks and nfκb pathways. discussion pathogenesis of ra involves cellular infiltration into the synovium and increase of inflammatory cytokines such as tnf, il-1 , and il-6 consequently leading to cartilage and bone erosion (arend, 2001; choy and panayi, 2001; pratt et al., 2009; choy, 2012). rasfs play critical role in the pathogenesis of ra by involvement in angiogenesis and in regulation of the inflammatory cells (cawston, 1995; han et al., 2003). strategies that aim in blocking either the proliferation of rasfs or production of the inflammatory mediators are possible means of therapy against ra. in our study, tangeretin potentially reduced the proliferation of rasfs and also raised the apoptotic cell counts. the aggressive proliferation of rasfs is the main mechanism for the hyperplasic growth of the ra synovium. cytokine -il-1 induces the proliferation of rasfs and plays an vital role in the pathogenesis of inflammatory synovitis and joint destruction (gitter et al., 1989; williams et al. 2007; tanida et al., 2009; choy, 2012). the results indicate that tangeretin (50 and 100 µm) significantly inhibits il-1 -induced proliferation of rasfs in a doseand time-dependent manner. further tangeretin was also able to reduce proliferation of synovial fibroblasts not exposed to il-1 as well. studies have shown that pro-inflammatory cytokines including il-1 could enhance the expression of cox‑2 and mmps in human rasfs (tolboom et al., 2002). mmps play a key role in the destruction of the figure 4: influence of tangeretin on il-1 -induced protein expressions (cont.) tangeretin significantly reduced the il-1 -induced raised expressions of mmps and cox-2 following 24 hours (a and c) and 48 hours (b and d) of exposure. il-1 -induced marked increases in the phosphorylation status and as well increased expressions of mapk pathway proteins were regula ted by tangeretin at both the doses (50 and 100 µm) and at 24 hours (e and g) and 48 hours (f and h); l1-control; l2-il-1 ; l3-tangeretin 50 µm; l4tangeretin 100 µm; l5-il-1 + tangeretin 50 µm; l6-il-1 + tangeretin 100 µm; values are represented as mean ± sd; n=3; *represents statistical significance at p<0.05 compared against control as determined by one-way anova g h bangladesh j pharmacol 2015; 10: 714-725 721 figure 5: tangeretin regulates the expressions of nf-kb and ikb tangeretin significantly reduced the nf-kb expression and regulated ikb ; following 24 hours (a and c) and 48 h (b and d) of exposure; l1-control; l2-il-1 ; l3-tangeretin 50 µm; l4-tangeretin 100 µm; l5-il-1 + tangeretin 50 µm; l6-il-1 + tangeretin 100 µm; values are represented as mean ± sd; n=3; *represents statistical significance at p<0.05 compared against control as determined by one-way anova a b c d 722 bangladesh j pharmacol 2015; 10: 714-725 extracellular matrix in articular structures. the cartilage destruction in ra is mainly caused by the activation of mmps (feldmann et al., 1996). mmp-1 and -3 have been shown to be the major enzymes produced by the synovial fibroblasts (konttinen et al., 1999). mmp-1 preferentially degrades fibrillar collagens, whereas mmp-3 degrades a broad array of extracellular matrix substrates (ogata et al., 1992; knauper et al., 1996; jackson et al., 2001). cox-2 is involved in the synthesis of inflammatory mediators and is responsible for the conversion of the free arachidonic acid to prostaglandins and variety of bioactive products. pge2, a pleiotropic mediator of inflammation, is involved in various pathological processes and further when in excess, it also elicits the signs and symptoms of inflammation (martel-pelletier et al., 2004). in this study we observed that tangeretin at both the doses were able to down-regulate the il-1 -induced expressions of mmp-1,3 and cox-2 both at the mrna and protein levels. down-regulation of cox-2 observed in tangeretin treatment also reflected in the levels of pge2. we found that tangeretin caused marked decreases in the levels of pge2 in a dose-dependent manner. the pro-inflammatory cytokines, upon binding to the respective receptors initiate various signalling pathways. cytokines, il-1 induce the activation of nf-kb in ra (morel and berenbaum, 2004; rannou et al., 2006; lie et al., 2012). nf-κb is an important transcriptional factor complex that regulates the expression of various genes involved in the process of inflammatory response (karin and lin, 2002; shaulian and karin, 2002). in the cell under normal conditions, nf-kb is maintained in an inactive state within the cytoplasm sequestered by ikb. upon stimulation chemokines like il-1, the ikb kinase complex gets activated leading to phosphorylation and degradation of ikb . this further causes a transitory increase in unbound nf-kb molecules that get activated and translocate to the nucleus, resulting in transcription of inflammatory responsive genes (tak and firestein, 2001; aggarwal, 2004). thus, the increase in nf-kb observed following il-1 treatment in our study is correlating with the concurrent decrease in expression of ikb . tangeretin was able to considerably regulate the expressions of ikb and nf-kb. at both the doses (50 and 100 µm) tangeretin significantly down-regulated nf-kb. the results suggest that tangeretin was able to inhibit il-1 induced inflammatory responses as evident from marked decrease in the cell proliferation and production of pge2. mapks are involved in a wide variety of cellular processes such as inflammation (su and karin, 1996; dong et al., 2002). the major members of mapk families erk, jnk, and p38 kinases, are expressed in active forms in synovial tissue and in cultured rasfs (schett et al., 2000; han et al., 2001; sweeney and firestein, 2004). several reports have demonstrated that inhibitors of nf‑κb or mapks reduce synovial inflammation, bone destruction and cartilage damage in animal models of arthritis (mcintyre et al., 2003; nishikawa et al., 2003). in our study, increased activated forms of mapk kinases (jnk, erk, p38) were seen upon il-1 exposure suggesting the activation of the signal transduction pathways. however, significant down-regulation in the phosphorylated forms of erk, jnk and p38 kinases were observed following tangeretin exposure, suggesting that tangeretin was able to effectively regulate the alterations in the mapk signalling cascades in rasfs. conclusion tangeretin was found effective in inhibiting il-1 induced rasfs proliferation and also regulates the inflammatory responses. it also reduced the signalling pathways, blocked the expressions of transcription factors, reduced the generation and effects of chemokines. references adcock im. transcription factors as activators of gene transcription: ap-1 and nf-kappa b. in: monaldi archives for chest disease (archivio monaldi per le malattie del torace/fondazione clinica del lavoro). vol. 52. irccs [and] istituto di clinica tisiologica e malattie apparato respiratorio, universita di napoli, secondo ateneo. 1997, pp 178-86. aggarwal bb. nuclear factor-kappa b: the enemy within. cancer cell. 2004; 6: 203-08. arend wp. cytokines and cellular interactions in inflammatory synovitis. j clin invest. 2001; 107: 1081-82. arnett fc, edworthy sm, bloch da, mcshane dj, fries jf, cooper ns, healey la, kaplan sr, liang mh, luthra hs. the american rheumatism association 1987 revised criteria for the classification of rheumatoid arthritis. arthritis rheum. 1998; 31: 315-24. cawston te. proteinase and connective tissue breakdown. in: mechanisms and models in rheumatoid arthritis. henderson b, edwards jcw, pettipher er (eds). london, academic press, 1995. chen zt, chu hl, chyau cc, chu cc, duh pd. protective effects of sweet orange (citrus sinensis) peel and their bioactive compounds on oxidative stress. food chem. 2012; 135: 2119-27. choy eh, panayi gs. cytokine pathways and joint inflammation in rheumatoid arthritis. n engl j med. 2001; 344: 907-16. choy e. understanding the dynamics: pathways involved in the pathogenesis of rheumatoid arthritis. rheumatology 2012; 51: v3-11. crofford lj, wilder rl, ristimaki ap, sano h, remmers ef, epps hr, hla t. cyclooxygenase-1 and -2 expression in rheumatoid synovial tissues: effects of interleukin1 beta, phorbol ester, and corticosteroids. j clin invest. 1994; 93: 1095-101. bangladesh j pharmacol 2015; 10: 714-725 723 http://www.ncbi.nlm.nih.gov/pubmed/?term=chen%20zt%5bauthor%5d&cauthor=true&cauthor_uid=22980779 http://www.ncbi.nlm.nih.gov/pubmed/?term=chu%20hl%5bauthor%5d&cauthor=true&cauthor_uid=22980779 http://www.ncbi.nlm.nih.gov/pubmed/?term=chyau%20cc%5bauthor%5d&cauthor=true&cauthor_uid=22980779 http://www.ncbi.nlm.nih.gov/pubmed/?term=chu%20cc%5bauthor%5d&cauthor=true&cauthor_uid=22980779 http://www.ncbi.nlm.nih.gov/pubmed/?term=duh%20pd%5bauthor%5d&cauthor=true&cauthor_uid=22980779 http://www.ncbi.nlm.nih.gov/pubmed/22980779 datla kp, christidou m, widmer ww, rooprai hk, dexter dt. tissue distribution and neuroprotective effects of citrus flavonoid tangeretin in a rat model of parkinson's disease. neuroreport. 2001; 12: 3871-75. dong c, davis rj, flavell ra. mapkinases in the immune response. annu rev immunol. 2002; 20: 55-72. dong y, cao a, shi j, yin p, wang l, ji g, xie j, wu d. tangeretin, a citrus polymethoxyflavonoid, induces apoptosis of human gastric cancer ags cells through extrinsic and intrinsic signaling pathways. oncol rep. 2014; 31: 178894. feldmann m, brennan fm, maini rn. role of cytokines in rheumatoid arthritis. annu rev immunol. 1996; 14: 397-440. gitter bd, labus jm, lees sl, scheetz me. characteristics of human synovial fibroblast activation by il-1 beta and tnf alpha. immunology 1989; 66: 196-200. han z, boyle dl, chang l, bennett b, karin m, yang l, manning am, firestein gs. c‑jun n‑terminal kinase is required for metalloproteinase expression and joint destruction in inflammatory arthritis. j clin invest. 2001; 108: 73‑81. han mk, kim js, park bh, kim jr, hwang by, lee hy, song ek, yoo wh. nf-kappab dependent lymphocyte hyperadhesiveness to synovial fibroblasts by hypoxia and reoxygenation: potential role in rheumatoid arthritis. j leukocyte biol. 2003; 73: 525-29. ho sc, kuo ct. hesperidin, nobiletin, and tangeretin are collectively responsible for the anti-neuroinflammatory capacity of tangerine peel (citri reticulatae pericarpium). food chem toxicol. 2014; 71: 176-82. hodgkin pd, yamashita lc, coffman rl, kehry mr. separation of events mediating b cell proliferation and ig production by using t cell membranes and lymphokines. j immunol. 1990; 145: 2025-34. jackson c, nguyen m, arkell j, sambrook p. selective matrix metalloproteinase (mmp) inhibition in rheumatoid arthritis– targetting gelatinase a activation. inflamm res. 2001; 50: 183 -86. karin m, lin a. nf-kappab at the cross roads of life and death. nat immunol. 2002; 3: 221-27. kim hg, shrestha b, lim sy, yoon dh, chang wc, shin dj, han sk, park sm, park jh, park hi, sung jm, jang y, chung n, hwang kc, kim tw. cordycepin inhibits lipopolysaccharide-induced inflammation by the supperssion of nf-kb through akt and p38 inhibition in raw 264.7 macrophage cells. eur j pharmacol. 2006; 545: 192-99. knauper v, lopez-otin c, smith b, knight g, murphy g. biochemical characterization of human collagenase-3. j biol chem. 1996; 271: 1544-50. konttinen yt, ainola m, valleala h, ma j, ida h, mandelin j, kinne rw, santavirta s, sorsa t, lópez-otín c, takagi m. analysis of 16 different matrix metalloproteinases (mmp-1 to mmp-20) in the synovial membrane: different profiles in trauma and rheumatoid arthritis. ann rheum dis. 1999; 58: 691-97. lee hy, jeon hs, song ek, han mk, park si, lee si, yun hj, kim jr, kim js, lee yc, kim si, kim hr, choi jy, kang i, kim hy, yoo wh. cd40 ligation of rheumatoid synovial fibroblasts regulates rankl-mediated osteoclastogenesis: evidence of nf-kappab-dependent, cd40-mediated bone destruction in rheumatoid arthritis. arthritis rheum. 2006; 54: 1747-58. lie pp, cheng cy, mruk dd. the biology of interleukin-1: emerging concepts in the regulation of the actin cytoskeleton and cell junction dynamics. cell mol life sci. 2012; 69: 487-500. luo sf, fang ry, hsieh hl, chi pl, lin cc, hsiao ld, wu cc, wang js, yang cm. involvement of mapks and nfkappab in tumor necrosis factor alpha-induced vascular cell adhesion molecule1expression in human rheumatoid arthritis synovial fibroblasts. arthritis rheum. 2010; 62: 10516. martel-pelletier j, pelletier jp, fahmi h. new insights into prostaglandin biology. j rheumatol. 2004; 31: 14-16. mcintyre kw, shuster dj, gillooly km, dambach dm, pattoli ma, lu p, zhou xd, qiu y, zusi fc, burke jr. a highly selective inhibitor of i kappa b kinase, bms‑345541, blocks both joint inflammation and destruction in collagen-induced arthritis in mice. arthritis rheum. 2003; 48: 2652‑59. morel j, berenbaum f. signal transduction pathways: new targets for treating rheumatoid arthritis. joint bone spine. 2004; 71: 503-10. nishikawa m, myoui a, tomita t, takahi k, nampei a and yoshikawa h. prevention of the onset and progression of collagen‑induced arthritis in rats by the potent p38 mitogen‑acti-vated protein kinase inhibitor fr167653. arthritis rheum. 2003; 48: 2670‑81. ogata y, enghild jj, nagase h. matrix metalloproteinase 3 (stromelysin) activates the precursor for the human matrix metalloproteinase 9. j biol chem. 1992; 267: 3581-84. periyasamy k, baskaran k, ilakkia a, vanitha k, selvaraj s, sakthisekaran d. antitumor efficacy of tangeretin by targeting the oxidative stress mediated on 7,12dimethylbenz(a) anthracene-induced proliferative breast cancer in sprague-dawley rats. cancer chemother pharmacol. 2015; 75: 263-72. pope rm. apoptosis as a therapeutic tool in rheumatoid arthritis. nat rev immunol. 2002; 2: 527-35. pratt ag, isaacs jd, mattey dl. current concepts in the pathogenesis of early rheumatoid arthritis. best pract res clin rheumatol. 2009; 23: 37-48. rannou f, francois m, corvol mt, berenbaum f. cartilage breakdown in rheumatoid arthritis. joint bone spine. 2006; 73: 29-36. schett g, tohidast-akrad m, smolen js , schmid bj, steiner cw, bitzan p, zenz p, redlich k, xu q, steiner g. activation, differential localization, and regulation of the stressactivated protein kinases, extracellular signal-regulated kinase, c-jun n-terminal kinase, and p38 mitogen-activated protein kinase, in synovial tissue and cells in rheumatoid arthritis. arthritis rheum. 2000; 43: 2501-12. shaulian e, karin m. ap-1 as a regulator of cell life and death. nat cell biol. 2002; 4: e131-36. 724 bangladesh j pharmacol 2015; 10: 714-725 http://www.ncbi.nlm.nih.gov/pubmed/?term=bennett%20b%5bauthor%5d&cauthor=true&cauthor_uid=11435459 http://www.ncbi.nlm.nih.gov/pubmed/?term=karin%20m%5bauthor%5d&cauthor=true&cauthor_uid=11435459 http://www.ncbi.nlm.nih.gov/pubmed/?term=yang%20l%5bauthor%5d&cauthor=true&cauthor_uid=11435459 http://www.ncbi.nlm.nih.gov/pubmed/?term=manning%20am%5bauthor%5d&cauthor=true&cauthor_uid=11435459 http://www.ncbi.nlm.nih.gov/pubmed/?term=firestein%20gs%5bauthor%5d&cauthor=true&cauthor_uid=11435459 http://www.ncbi.nlm.nih.gov/pubmed/?term=kim%20jr%5bauthor%5d&cauthor=true&cauthor_uid=12660227 http://www.ncbi.nlm.nih.gov/pubmed/?term=hwang%20by%5bauthor%5d&cauthor=true&cauthor_uid=12660227 http://www.ncbi.nlm.nih.gov/pubmed/?term=lee%20hy%5bauthor%5d&cauthor=true&cauthor_uid=12660227 http://www.ncbi.nlm.nih.gov/pubmed/?term=song%20ek%5bauthor%5d&cauthor=true&cauthor_uid=12660227 http://www.ncbi.nlm.nih.gov/pubmed/?term=song%20ek%5bauthor%5d&cauthor=true&cauthor_uid=12660227 http://www.ncbi.nlm.nih.gov/pubmed/?term=yoo%20wh%5bauthor%5d&cauthor=true&cauthor_uid=12660227 http://www.ncbi.nlm.nih.gov/pubmed?term=ho%20sc%5bauthor%5d&cauthor=true&cauthor_uid=24955543 http://www.ncbi.nlm.nih.gov/pubmed?term=kuo%20ct%5bauthor%5d&cauthor=true&cauthor_uid=24955543 http://www.ncbi.nlm.nih.gov/pubmed/24955543 http://www.ncbi.nlm.nih.gov/pubmed/24955543 http://www.ncbi.nlm.nih.gov/pubmed/?term=yoon%20dh%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=chang%20wc%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=shin%20dj%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=han%20sk%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=park%20sm%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=park%20jh%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=park%20hi%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=sung%20jm%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=jang%20y%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=chung%20n%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=hwang%20kc%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=kim%20tw%5bauthor%5d&cauthor=true&cauthor_uid=16899239 http://www.ncbi.nlm.nih.gov/pubmed/?term=ma%20j%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=ida%20h%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=mandelin%20j%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=kinne%20rw%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=santavirta%20s%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=sorsa%20t%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=l%c3%b3pez-ot%c3%adn%20c%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=takagi%20m%5bauthor%5d&cauthor=true&cauthor_uid=10531073 http://www.ncbi.nlm.nih.gov/pubmed/?term=dambach%20dm%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=pattoli%20ma%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=pattoli%20ma%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=lu%20p%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=zhou%20xd%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=qiu%20y%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=zusi%20fc%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/?term=burke%20jr%5bauthor%5d&cauthor=true&cauthor_uid=13130486 http://www.ncbi.nlm.nih.gov/pubmed/25431347 http://www.ncbi.nlm.nih.gov/pubmed/?term=schmid%20bj%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=steiner%20cw%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=steiner%20cw%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=bitzan%20p%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=zenz%20p%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=redlich%20k%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=xu%20q%5bauthor%5d&cauthor=true&cauthor_uid=11083274 http://www.ncbi.nlm.nih.gov/pubmed/?term=steiner%20g%5bauthor%5d&cauthor=true&cauthor_uid=11083274 shu z, yang b, zhao h, xu b, jiao w, wang q, wang z, kuang h. tangeretin exerts anti-neuroinflammatory effects via nfκb modulation in lipopolysaccharide-stimulated microglial cells. int immunopharmacol. 2014; 19: 275-82. smith wl, garavito rm, dewitt dl. prostaglandin endoperoxide h synthases (cyclooxygenases)-1 and -2. j biol chem. 1996; 271: 33157-60. su b, karin m. mitogen-activated protein kinase cascades and regulation of gene expression. curr opin immunol. 1996; 8: 402-11. sung ms, lee eg, jeon hs, chae hj, park sj, lee yc, yoo wh. quercetin inhibits il-1 induced proliferation and production of mmps, cox-2 and pge2 by rheumatoid synovial fibroblast. inflammation 2012; 35: 1585-94. sweeney se, firestein gs. signal transduction in rheumatoid arthritis. curr opin rheumatol. 2004; 16: 231-37. tak pp, firestein gs. nf-kappab: a key role in inflammatory diseases. j clin invest. 2001; 107: 7-11. tanida s, yoshitomi h, nishitani k, ishikawa m, kitaori t, ito h, nakamura t. ccl20 produced in the cytokine network of rheumatoid arthritis recruits ccr6+ mononuclear cells and enhances the production of il-6. cytokine 2009; 47: 11218. tas sw, remans ph, reedquist ka, tak pp. signal transduction pathways and transcription factors as therapeutic targets in inflammatory disease: towards innovative antirheumatic therapy. curr pharma design 2005; 11: 581-611. tolboom tc, pieterman e, van der laan wh, toes re, huidekoper al, nelissen rg, breedveld fc, huizinga tw. invasive properties of fibroblast-like synoviocytes: correlation with growth characteristics and expression of mmp-1, mmp-3, and mmp-10. annals rheum dis. 2002; 61: 975-80. williams ro, paleolog e, feldmann m. cytokine inhibitors in rheumatoid arthritis and other autoimmune diseases. curr opin pharmacol. 2007; 7: 412-17. yang cm, luo sf, hsieh hl, chi pl, lin cc, wu cc, hsiao ld. interleukin-1 beta induces icam-1 expression enhancing leukocyte adhesion in human rheumatoid arthritis synovial fibroblasts: involvement of erk, jnk, ap-1, and nf kappa b. j cell physiol. 2010; 224: 516-26. bangladesh j pharmacol 2015; 10: 714-725 725 http://www.ncbi.nlm.nih.gov/pubmed/24462494 http://www.ncbi.nlm.nih.gov/pubmed/?term=quercetin+inhibits+il-1%ce%b2-induced+proliferation+and+productionof+mmps%2c+cox-2%2c+and+pge2+by+rheumatoid+synovial+fibroblast article info: abstract: introduction: dateprinted: this article was downloaded by you on: aug 21, 2015 bangladesh journal of pharmacology research article effects of paeonol on proliferation and collagen synthesis of rat cardiac fibroblasts induced by aldosterone bjp introduction after myocardial infarction, ventricular remodeling will occur in the infarcted area, leading to a severe decline in cardiac function and eventual heart failure (toldo et al., 2015; lee et al., 2016; lagarto et al., 2019). therefore, delaying or preventing the occurrence and development of ventricular remodeling is critical to the prevention and treatment of heart failure after myocardial infarction (shintani et al., 2017). the mechanism of ventricular remodeling is very complex and characterized by extracellular matrix accumulation and fibrosis (gao et al., 2017; chen et al., 2020). the sympathetic nervous system is first activated after acute myocardial infarction (sunaga et al., 2019), followed by the reninangiotensin system, and the activation of it will lead to increased synthesis and releasing of aldosterone. (lieu et al., 2014; han et al., 2020). the increase in aldosterone in the early stage can increase cardiac output, but the long-term results can cause sodium and water retention, electrolyte imbalance, and ultimately arrhythmia (schmidt et al., 2010; prins et al., 2019). on the other hand, myocardial and vascular interstitial collagen deposition and fibrosis can lead to an increase in ventricular wall stiffness, the decrease of ventricular compliance, and the damage to diastolic function. it induces myocardial fibrosis, resulting in impairment of myocardial pump function, which is one of the critical effects of aldosterone on the heart (dartsch et al., 2013). collagen is an independent factor of myocardial fiber necrosis, and aldosterone can directly induce its synthesis. at the same time, aldosterone can break the balance of matrix collagen synthesis and degradation, thereby promoting the accumulation and fibrosis of extracellular matrix (hayashi et al., 2003). aldosterone can also induce myocardial fibrosis by up-regulating the level of angiotensin type i receptor; activating macrophages to increase the production of transforming growth factor β1 (tgf-β1), and the role of tgf-β1 is to stimulate cardiac fibroblasts to synthesize collagen and promote myocardial fibrosis (tsutamoto et al., 2001; hayashi et al., 2001; lu et al., 2019). in recent years, it has been reported in china that paeonol has a wide range of cardiovascular pharmacological effects (zhao et al., 2014; gu et al., 2015; zhou et al., 2017): a) it can significantly reduce the content of abstract the aim of this study was to explore the possible molecular mechanisms of paeonol in preventing ventricular remodeling. the cell viability of neonatal rat cardiac fibroblasts was detected by the method of mtt. rt-pcr and western blot were used to measure the expression of tgf-β1, type i collagen and type iii collagen. after treating the cardiac fibroblasts with paeonol, the cell viability decreased (p<0.01), and the expression of tgf-β1, type i collagen and types iii collagen was significantly reduced (p<0.01). thus, paeonol can inhibit the proliferation of fibroblast cells induced by aldosterone. the molecular mechanism is related to the down-regulation of tgf-β1 and type i and iii collagen gene expression. article info received: 23 january 2021 accepted: 22 february 2021 available online: 2 april 2021 doi: 10.3329/bjp.v16i2.51605 cite this article: xu q, wang ln, zhao jy, xiao, yh, du c. effects of paeonol on proliferation and collagen synthesis of rat cardiac fibroblasts induced by aldosterone. bangladesh j pharmacol. 2021; 16: 42-48. effects of paeonol on proliferation and collagen synthesis of rat cardiac fibroblasts induced by aldosterone qian xu, li-na wang, jing-yi zhao, yan-hong xiao and chao du department of biochemistry, chengde medical university, chengde 067000, hebei, china. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2021; 16: 42-48 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 malonaldehyde and the concentration of creatine kinase in myocardial ischemia tissue, increase the activity of superoxide dismutase, and increase the clearance rate of endogenous oxygen-free radicals; b) it can significantly antagonize the arrhythmic effect of myocardial ischemia-reperfusion model in rats by inhibiting calcium channels and reduce the myocardial ischemia and infarction range; c) cell experiments show that paeonol can inhibit the expression of mmp-9, il-1β, and il-8 induced by tnf-α, indicating that paeonol had an anti-inflammatory effect; d) paeonol can improve ventricular remodeling after myocardial infarction by blocking the inflammatory signal pathway in vivo. previous studies have shown that paeonol has prominent antioxidant activity and a strong protective effect on myocardial ischemia-reperfusion injury. paeonol can improve ventricular remodeling after myocardial infarction by inhibiting nfκb inflammatory pathway, however, whether it can inhibit the reninangiotensin-aldosterone system and inhibit ventricular remodeling after myocardial infarction and its molecular mechanism need to be further studied. in this study, neonatal rat cardiac fibroblasts were cultured in vitro. the cell model of fibroblast proliferation and collagen synthesis was established with aldosterone as the inducing factor, which was used as the cell model of ventricular remodeling. the proliferation level of cardiac fibroblasts was detected. the expression of tgf-β1 mrna and type i collagen mrna were detected. the expression of type iii collagen protein was measured. this study aimed to observe the effect of paeonol on ventricular remodeling after myocardial infarction at the cellular level by inhibiting the renin-angiotensin-aldosterone system and explore its molecular mechanism. materials and methods chemical and reagents dmem medium was obtained from gibco. trypsin and aldosterone were obtained from sigma. paeonol injecttion was purchased from ningbo tianzhen company. trizol was purchased from invitrogen and rt-pcr kit from takara biotechnology. all other chemicals used were of the purest grade commercially available. cell culture the heart tissue of suckling mice was minced, and a trypsin digestion solution was added. it was stirred on a magnetic stirrer for 8 min, and the calf serum was added to inactivate trypsin. this process could be repeated 8-10 times until the tissue is digested completely. cells were washed with d-hanks solution and centrifuged at 1,000 rpm for 10 min. this operation was repeated once. the cells were resuspended with dmem medium containing 10% fetal bovine serum, seeded in culture flasks, and cultured in a 37ºc, 5% co2 incubator for 90 min. the culture flask was shaken gently to pour out the cardiomyocyte suspension that had not yet been attached. then adherent fibroblasts were observed under a microscope. when the cell density was 80%, it was digested and passaged with 0.08% trypsin0.01% edta mixed digestive juice. cells at passages 2-4 were used for experiments. experimental grouping the cardiac fibroblasts were divide into six groups randomly: normal control group, aldosterone (10-7 mol/ l) model group, paeonol low-dose (10-7 mol/l aldosterone + 25 mg/l paeonol), medium-dose group: (10-7 mol/l aldosterone + 50 mg/l paeonol), high-dose group (10-7 mol/l aldosterone + 100 mg/l paeonol), captopril group (10-7 mol/l aldosterone + 1 mg/ml captopril). the normal control group cells were maintained in dmem supplemented with 5% fetal bovine serum. rt-pcr to detect the expression of tgf-β1 mrna and type i collagen mrna in cardiac fibroblasts of each group cardiac fibroblasts at passages 2-4 were used for subsequent rna extraction. when the cells reach 80% confluency, trizol (1 ml) was added to each well, and pipetted the cells repeatedly until there were no visible cell clumps remained, and left at room temperature for 5 min. chloroform (0.2 ml) was added, shaken vigorously for 15 sec and incubated at room temperature for 5 min. after centrifugation at 12,000 rpm at 4ºc for 15 min, the upper layer was carefully transferred to a new eppendorf tube. moreover, an equal volume of isopropanol was added. after centrifugation at 12,000 rpm at 4ºc for 10 min, the supernatant was discarded, and the bottom deposit was total rna. an amount of 2 μg rna was reverse transcribed into complementary dna (cdna), and cdna was amplified into dna products. tgf-β1 pcr amplification was performed with the following parameters: 30 cycles, 94° c for 2 min, 94°c for 30 sec, annealing at 61.2°c for 30 sec, extension at 72°c for 50 sec. the annealing temperature of type i collagen was 58°c. the annealing temperature of β-actin was 60.4°c. the primer sequences used for tgf-β1 were: forward, 5′ -gcctccgcatcccacctt tg-3′ and reverse, 5′-gcggttgacttctttggcgt -3′ the length of the pcr type i collagen product was 396 bp. the primer sequences used for type i collagen was: forward, 5′-tgccgtgacctcaagatgtg -3′ and reverse, 5′cacaagcgtgctgtaggtga3′. the length of the pcr type i collagen product was 462 bp. the primer sequences used for β-actin were forward, 5′-cacccgcgagtacaaccttc-3′ ，and reverse, 5′-cccatacccaccatcacacc-3′. the length of the pcr β-actin product was 207 bp. bangladesh j pharmacol 2021; 16: 42-48 43 pcr product (5 μl) was entirely mixed with dna loading buffer (2 μl of 6×) and separated by 2% agarose gel electrophoresis (constant voltage, 160 v, 50  min). the gels were visualized and photographed under a uv transilluminator. quantity one software was applied for semi-quantitative analysis. the ratio of the optical density of the target band to that of β-actin was estimated as the relative level of mrna expression of each target gene. western blot for detecting type iii collagen protein expression in cardiac fibroblasts of each group when the density of well-growing cardiac fibroblasts cells from passages two to four reached 80%, 150-200 μl of the cell lysate was added, and the culture flask was shaken, and the cells were scraped off the cell culture flask after ice bath for 20 min. the protein lysate was transferred to the ep tube, shook for 30 sec each time, once per 5 min, for a total of 8 to 10 times. furthermore, the shock was carried out for 30 sec each time, once per 5 min, for a total of eight to ten times. then centrifuged at 12,000 rpm for 20 min at 4ºc. the supernatant was the protein extract. protein concentration was measured using the bca method, sds-page electrophoresis, membrane transfer, and the addition of primary antibodies: (1:200 for type iii collagen and 1:3000 for β-actin), and incubation for two hours at room temperature on a shaker. after washing with tbst, the secondary antibody was added: (the dilution ratio of type iii collagen was 1:3000, the dilution ratio of β-actin was 1:5000) and incubated in a shaker at room temperature for one hour. after washing with tbst, the film was developed. statistical analysis the experimental data were expressed as mean ± sd. spss 17.0 software was used for statistical analysis. one -way analysis of variance was used to compare the means of measurement data among multiple groups, and snk test was used for pairwise comparison. p< 0.05 was considered statistically significant. results cell viability was evaluated by mtt the viability of cardiac fibroblasts in the model group (aldosterone group) was significantly increased (p<0.01). however, after adding different concentrations of paeonol, the cell viability of paeonol medium and high dose groups was significantly reduced (p<0.01), and the cell viability of paeonol in the high dose group was almost indifferent from that of positive control captopril group (figure 1). rt-pcr was used to detect tgf-β1 mrna expression and type i collagen in cardiac fibroblasts of each group between the 300-400 bp regions, a bright tgf-β1 band was observed. between the 400-500 bp regions, a clear collagen i band was observed. moreover, between the 200-300 bp regions, a clear β-actin band was observed (figure 2a; figure 3). rt-pcr results showed that after 10−7 mol/l aldosterone was applied to cardiac fibroblasts for 24 hours, the expression of tgf-β1 mrna and type i collagen mrna in the model group was significantly enhanced compared with the normal control group (p<0.01). compared with the model group, the expression of tgf-β1 mrna and type i collagen mrna in the paeonol low-dose group was not significantly changed. however, tgf-β1 mrna and type i collagen mrna expression in the middle-dose and the high-dose group of paeonol and the captopril group were remarkably lower than that of the model group (p<0.01) (figure 2b; figure 3b). western blot was used to measure the expression of type iii collagen in cardiac fibroblasts western blot results showed that a type iii collagen box 1: mtt assay principle quantification of cell viability and proliferation in vitro is assessed by the cell metabolic activity using a colorimetric method. requirements cultured cardiac fibroblasts, dmem medium, micro-plate reader, formazan, mtt solution, 96-well plate procedure step 1: the second-generation cultured cardiac fibroblasts were cultured in 96-well plates at a density of 1 × 105 cells with 200 μl medium. step 2: after cells reached 80% confluence, the culture medium was discarded. step 3: furthermore, 200 μl of dmem medium was added to each well to synchronize the cells. step 4: at the end of the treatment period, 20 µl of mtt solution (5 mg/ml) was added to each well. step 5: the cells were incubated at 37ºc for 4 hours. step 6: the supernatant was removed with caution, and 150 μl dmso per well was added to dissolve the formazan product completely. step 7: the absorbance was detected at 490 nm with a microplate reader. reference xu et al., 2015 reference (video) bahuguna et al., 2017; wang et al., 2018 44 bangladesh j pharmacol 2021; 16: 42-48 band was observed between protein marker 72 kd-95 kd. western blot results showed that a β-actin band could be seen between protein marker 34 kd-55 kd (figure 4a). compared with the normal control group, the expression of type iii collagen in the model group was significantly enhanced (p<0.01). compared with the model group, the expression of type iii collagen in each dose group of paeonol was enhanced (p<0.01) in a dose-dependent manner with the increase of paeonol concentration. compared with the low-dose group of paeonol, the expression of type iii collagen was enhanced in the paeonol middle-dose group (p<0.01). compared with the middle-dose group of paeonol, the expression of type iii collagen was significantly enhanced in the high-dose group of paeonol (p<0.01). compared with the model group, the protein normal model l-pae m-pae h-pae captopril a b s o rb a n c e figure 1: cell viability was detected in cardiac fibroblasts in each group by the method of mtt. compared with the normal control group *p<0.01; compared with the model group, #p<0.01 bp m 1 2 3 4 5 6 figure 2: tgf-β1 mrna expression of cardiac fibroblasts in each group by rt-pcr. 1-the normal control group; 2-the aldosterone model group; 3-the low-dose group of paeonol; 4the middle-dose group of paeonol; 5-the high-dose group of paeonol; 6-the captopril group; m marker (a); compared with the normal control group, *p<0.01; compared with the model group, #p<0.01 (b) tgf-β1 β-actin normal model low middle high captopril t g f -β m r n a a b type i collagen β-actin bp m 1 2 3 4 5 6 figure 3: the type i collagen mrna expression of cardiac fibroblasts in each group by rt-pcr. 1-the normal control group; 2-aldos-terone model group; 3-the low-dose group of paeonol; 4-middle-dose group of paeonol; 5-the high-dose group of paeonol; 6-the captopril group; m marker (a); compared with the normal control group, *p<0.01; compared with the model group, #p<0.01 (b) a b t y p e i c o ll a g e n m r n a 1 2 3 4 5 6 73 kd 43 kd type iii collagen β-actin a t y p e i ii c o ll a g e n m r n a b figure 4: type iii collagen expression of cardiac fibroblasts in each group by western blot. 1-the normal control group; 2-the aldosterone model group; 3-the low-dose group of paeonol; 4the middle-dose group of paeonol; 5-the high-dose group of paeonol; 6-the captopril group; m marker (a); compared with the normal control group, *p<0.01; compared with the model group, #p<0.01 (b) paeonol normal model low middle high captopril paeonol normal model low middle high captopril paeonol bangladesh j pharmacol 2021; 16: 42-48 45 expression of type iii collagen was enhanced in the captopril group (p<0.01) (figure 4). discussion as the primary effector cells of myocardial fibrosis, cardiac fibroblasts play an irreplaceable role in mf progression. cardiac fibroblasts are the primary cells constituting the myocardial tissue, accounting for approximately more than 60% of the total number of cells. cardiac fibroblasts are an essential component of the extracellular matrix, which can mediate various signaling transduction between cells and non-cellular tissues such as chemical and electrochemical signaling (wang, 2013), and their proliferation, as well as increased synthesis of the extracellular matrix, will lead to myocardial fibrosis (meekertetp et al., 2013). in this study, the proliferation of cardiac fibroblasts cells was significant in the aldosterone group, and the cell density and number of cardiac fibroblasts were increased under a light microscope. the cell viability was decreased, and the number of cells was decreased in the middle and high dose groups of paeonol. moreover, there was almost no difference in cell viability between the high-dose paeonol group and the positive control captopril group. this indicated that paeonol could inhibit the proliferation of cardiac fibroblasts cells. transforming growth factor beta (tgfβ) is a large family of cytokines that primarily regulate cell growth and differentiation, causing fibrosis. tgfβ also regulates inflammatory responses and extracellular matrix deposition (brandan et al., 2013). tgfβ is expressed in cardiac myocytes and cardiac fibroblasts. it plays an essential role in ventricular remodeling through two secretory modes, autocrine and paracrine. one classical mechanism by which tgfβ plays a role is the tgfβ binds to receptors on the cell surface, thereby activating the smad pathway, the smad-mediated signaling mechanisms. besides, tgfβ activates extracellular signaling-related protein kinases, c-jun amino-terminal kinase, p38 schistogen-activated protein kinase (derynck and zhang, 2003). there are four subtypes of tgf-β in mammals, which are β 1, β 2, β 3, and β 4 in turn. as a crucial fibrogenic cytokine, tgf-β1 can promote the proliferation of cardiac fibroblasts and the synthesis of type i and iii collagen (yang et al., 2013) . tgf-β1 can inhibit the synthesis of extracellular matrix-degrading enzymes, thus reducing the degradation of the extracellular matrix. tgf-β1 can also promote the expression of many kinds of proteases, such as metalloproteinase inhibitor (agrotis et al., 2014). tgf β could promote the synthesis of collagen and accelerate the process of cellulose in diabetic cardiomyopathy (asbun and villarreal, 2006). cardiac fibroblasts can synthesize and secrete collagen. type i collagen and type iii collagen is the main components of extracellular matrix, which in turn forms myocardial interstitium with fibroblasts, pericytes, and other fibrous connective tissues. in healthy adults, type i collagen accounts for about 80%-85% of myocardial collagen, while type iii collagen accounts for only 11%. mature type i collagen mainly forms crude fibers, which can determine the heart's stiffness because of its less resilience, higher stiffness, and resistance to some degree of traction. immature type iii collagen mainly forms fine fibers, which can reflect ventricular wall elasticity because of its strong extensibility. both types i collagen and type iii collagen are produced by fibroblasts. their appropriate proportion plays a vital role in maintaining the integrity of normal myocardial tissue structure and cardiac function (asbun and villarreal, 2001). abnormal collagen metabolism is the main pathological basis of myocardial fibrogenesis (cao et al., 2003). changes in the ratio of type i collagen and type iii collagen can reflect ventricular remodeling (sun et al., 2000; hanatani et al., 1998). rt-pcr results showed that the expression of tgf-β1 mrna and type i collagen mrna in the model group was significantly enhanced compared with the normal control group. the expression of tgf-β1 mrna and type i collagen mrna decreased significantly after the intervention of middle and high doses of paeonol. the expression of tgf-β1 mrna and type i collagen mrna was significantly decreased after positive control intervention. western blot results showed that the expression of type iii collagen in the model group was significantly enhanced compared with the normal control group. however, the expression of type iii collagen was significantly decreased after the intervention of paeonol. after the intervention of positive control, the expression of type iii collagen was significantly decreased. this shows that aldosterone can up-regulate the gene expression of tgf-β1, type i collagen and type iii collagen in cardiac fibroblasts. brilla et al., (1994) suggested that aldosterone promotes collagen synthesis in cardiac fibroblasts, and the results of this study are consistent with brilla's conclusion. however, after the addition of paeonol, paeonol can down-regulate the gene expression of tgf-β1 type i collagen and type iii collagen in cardiac fibroblasts, thereby improving ventricular remodeling. paeonol can antagonize the effect of aldosterone on promoting collagen synthesis. paeonol can reduce the synthesis of type i collagen and type iii collagen, to antagonize and reverse ventricular 46 bangladesh j pharmacol 2021; 16: 42-48 remodeling. it is unclear whether paeonol inhibits collagen synthesis through a direct or indirect pathway. if it is achieved through an indirect pathway, whether a series of responses mediated through tgf-β1 requires further investigation. this study will provide more basis for the development of paeonol as a new drug for anti-ventricular remodeling. conclusion paeonol can inhibit the proliferation and collagen synthesis of cardiac fibroblasts induced by aldosterone. moreover, it is proved that paeonol has the effect of anti -aldosterone-induced ventricular remodeling at the cellular level. the molecular mechanism may be related to the down-regulation of type i collagen and type iii collagen gene expression. financial support hebei provincial administration of traditional chinese medicine project (projects no.: 2018161), hebei provincial health and family planning commission (projects no.: 20170875), and chengde medical university (projects no.: 201612) ethical issue this study was approved by the animal ethics committee of chengde medical university (no.: cdmulac-20150716-003). conflict of interest authors declare no conflict of interest references agrotis a, saltis j, bobik a. transforming growth factor-β1 gene activation and growth of smooth muscle from hypertension rats. hypertension 1994; 23: 593-99. asbun j, villarreal fj. the pathogenesis of myocardial fibrosis in the setting of diabetic cardiomyopathy. j am coll cardiol. 2006; 47: 693-700. bahuguna a, khan i, bajpai vk, kang sc. mtt assay to evaluate the cytotoxic potential of a drug. bangladesh j pharmacol. 2017, 12: 115-18. brandan e, gutierrez j. role of proteoglycans in the regulation of the skeletal muscle fibrotic response. febs j. 2013; 280: 4109-17. brilla cg, zhou g, matsubara l, weber kt. collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin ii and aldosterone. j mol cell cardiol. 1994; 26: 809-20. cao zheng, wang jianing, yang guiyuan, li jianjun. aldosterone promotes collagen synthesis by rat cardiac fibroblasts induced by angiotensin ii. chinese j arterioscler. 2003; 11: 135-38. chen y, liu f, han f, lv l, tang ce, xie z, luo f. omentin-1 is associated with atrial fibrillation in patients with cardiac valve disease. bmc cardiovasc disord. 2020; 20: 214. dartsch t, fischer r, gapelyuk a, weiergraeber m, ladage d, schneider t, schirdewan a, reuter h, mueller-ehmsen j, zobel c. aldosterone induces electrical remodeling indepen -dent of hypertension. int j cardiol. 2013; 164: 170-78. derynck r, zhang ye. smad-dependent and smad-independent pathways in tgf-beta family signalling. nature 2003; 425: 577-84. gao y, zhang ym, qian lj, chu m, hong j, xu d. ano1 inhibits cardiac fibrosis after myocardial infraction via tgfβ/smad3 pathway. sci rep. 2017; 7: 2355. gu yuanyuan, zhou xiaohui , xu qian, zhao jingyi. effects of paeonol on ras occurred on the development of ventricular remodeling after acute myocardial infarction in rats. tianjin med, 2015; 43: 470-73. han l, tang y, li s, wu y, chen x, wu q, hong k, li j. protective mechanism of sirt1 on hcy-induced atrial fibrosis mediated by trpc3. j cell mol med. 2020; 24: 488510. hanatani a, yoshiyama m, kim s, omura t, ikuno y, takeuchi k, iwao h, yoshikawa j. assessment of cardiac function and gene expression at an early phase after myocardial infarction. jpn heart j. 1998; 39: 375-88. hayashi m, tsutamoto t, wada a, maeda k, mabuchi n, tsutsui t, matsui t, fujii m, matsumoto t, yamamoto t, horie h, ohnishi m, kinoshita m. relationship between transcardiac extraction of aldosterone and left ventricular remodeling in patients with first acute myocardial infarction: extracting aldosterone through the heart promotes ventricular remodeling after acute myocardial infarction. j am coll cardiol. 2001; 38: 1375-82. hayashi m, tsutamoto t, wada a, tsutsui t, ishii c, ohno k, fujii m, taniguchi a, hamatani t, nozato y, kataoka k, morigami n, ohnishi m, kinoshita m, horie m. immediate administration of mineralocorticoid receptor antagonist spiro-nolactone prevents post-infarct left ventricular remodeling associated with suppression of a marker of myocardial collagen synthesis in patients with first anterior acute myocardial infarction. circulation 2003; 107: 2559-65. lagarto jl, dyer bt, peters ns, french pmw, dunsby c, lyon ar. in vivo label-free optical monitoring of structural and metabolic remodeling of myocardium following infarction. biomed opt express. 2019; 10: 3506-21. lee cy, shin s, lee j, seo hh, lim kh, kim h, choi jw, kim sw, lee s, lim s, hwang kc. microrna-mediated downregulation of apoptosis signal-regulating kinase 1 (ask1) attenuates the apoptosis of human mesenchymal stem cells (mscs) transplanted into infarcted heart. int j mol sci. 2016; 17: 1752. lieu fk, lin cy, wang ps, jian cy, yeh yh, chen ya, wang kl, lin yc, chang ll, wang gj, wang sw. effect of swimming on the production of aldosterone in rats. plos one. 2014; 9: e87080. bangladesh j pharmacol 2021; 16: 42-48 47 author info chao du (principal contact) e-mail: 150993677@qq.com lu m, qin q, yao j, sun l, qin x. induction of lox by tgfβ1/smad/ap-1 signaling aggravates rat myocardial fibrosis and heart failure. iubmb life. 2019; 71: 1729-39. meckert pc, rivello hg, vigliano c, gonzález p, favaloro r, laguens r. endomitosis and polyploidization of myocardial cells in the periphery of human acute myocardial infarction. cardiovasc res. 2005; 67: 116-23. prins kw, thenappan t, weir ek, kalra r, pritzker m, archer sl. repurposing medications for treatment of pulmonary arterial hypertension: what's old is new again. j am heart assoc. 2019; 8: e011343. rossi g, boscaro m, ronconi v, funder jw. aldosterone as a cardiovascular risk factor. trends endocrinol metab. 2005; 16: 104-07. schmidt k, tissier r, ghaleh b, drogies t, felix sb, krieg t. cardioprotective effects of mineralocorticoid receptor antago-nists at reperfusion. eur heart j. 2010; 31: 1655-62. shintani y, ito t, fields l, shiraishi m, ichihara y, sato n, podaru m, kainuma s, tanaka h, suzuki k. il-4 as a repurposed biological drug for myocardial infarction through augmentation of reparative cardiac macrophages: proof-ofconcept data in mice. sci rep. 2017; 7: 6877. sun y, zhang jq, zhang j, lamparter s. cardiac remodeling by fibrous tissue after infarction in rats. j lab clin med. 2000; 135: 316-23. sunaga h, koitabashi n, iso t, matsui h, obokata m, kawakami r, murakami m, yokoyama t, kurabayashi m. activation of cardiac ampk-fgf21 feed-forward loop in acute myocardial infarction: role of adrenergic overdrive and lipolysis byproducts. sci rep. 2019; 9: 11841. toldo s, mezzaroma e, mcgeough md, peña ca, marchetti c, sonnino c, van tassell bw, salloum fn, voelkel nf, hoffman hm, abbate a. independent roles of the priming and the triggering of the nlrp3 inflammasome in the heart. cardio-vasc res. 2015; 105: 203-12. tsutamoto t, wada a, maeda k, mabuchi n, hayashi m, tsutsui t, ohnishi m, sawaki m, fujii m, matsumoto t, matsui t, kinoshita m. effect of spironolactone on plasma brain natriuretic peptide and left ventricular remodeling in patients with congestive heart failure. j am coll cardiol. 2001; 37: 1228-33. wang w. effect of epo on fibrosis of suckling mouse cardiac fibroblasts and the role of tgf-pi-taki-p38 mapk in it. kunming medical university, 2013. wang y, chen j, wang j, guo x, wang n, yuan j. antidepressant, neuropharmacological activity and mode of action of theaflavin-3-gallate in in vitro and in vivo models of depression. bangladesh j pharmacol. 2018; 13: 340-48. wilson em, spinale fg. myocardial remodeling and matrix metallo proteinase in heart failure: turmoil with in the interstitium. ann med. 2001; 33: 623-34. xu q, cao k, xiao yh, du c, dong xh, wang y, zhou xh. effects of paeonol on the expression of nf-κb pathways in human umbilical veins endothelial cells induced by homocysteine. bangladesh j pharmacol. 2015; 10: 604-11. yang t, zhang gf, chen xf, gu hh, fu sz, xu hf, feng q, ni ym. microrna-214 provokes cardiac hypertrophy via repression of ezh2. biochem biophys res commun. 2013; 436: 578-84. zeng zh, luo bh, gao yj, su cj, he cc, yi jj, li n, lee rm. control of vascular changes by renin-angiotensinaldosterone system in salt-sensitive hypertension. eur j pharmacol. 2004; 503: 129-33. zhang y, fan j. overview of the study on cortex moutan iv overview of the pharmacological action of cortex moutan. chongqing chinese herbal med res. 2009; 6: 24-31. zhao j, dong h, zhou x, yao y, zhang s. effects of paeonol on ventricular remodeling and expression of nf-κbp65 and il1mrna in rats with acute myocardial infarction. chinese j exper formulae. 2014; 20: 177-80. zhao j, zhang s, yao y, gu y, shi z, zhou x. effects of paeonol on nuclear factor-κb p65 pathway after acute myocardial infarction in rats. chinese j gerontol. 2017; 37: 22-24. 48 bangladesh j pharmacol 2021; 16: 42-48 bangladesh journal of pharmacology research article bjp introduction one of the most commonly used drugs is paracetamol. overdose of it can lead to the accumulation of toxic metabolites, which may lead to severe and even fatal hepatotoxicity and nephrotoxicity (bui et al., 2012). therefore, it is important to develop a method to determine paracetamol. there are many reports in this area, including titration (kumar et al., 1997), spectrophotometry (filik et al., 2009), capillary electrophoresis (pérez-ruiz et al., 2005), fluorometry (al-ghannam et al., 2002), fia (wangfuengkanagul et al., 2002) and hplc (nebot et al., 2007). however, these methods also have some disadvantages, including the need for sample pretreatment, high cost, and long analysis time. spectrophotometry is a simple, rapid, and inexpensive method for the determination of paracetamol, but it has some limitations (montaseri et al., 2018). the existence of spectral interference caused by other components of the drug, the maximum wavelength of paracetamol is 244 nm, which can be interfered with propyphenazone (266 nm) and caffeine (273 nm) (delvadiya et al., 2013). therefore, methods for the determination of paracetamol in pharmaceuticals need more selective and sensitive methods. for this purpose, a chemical-modified electrode can be modified with guanine. the chemical-modified electrode is coupled to an adapter that converts its interaction with the analyte into a measurable electrochemical signal (boumya et al., 2021). materials and methods chemicals and reagents all reagents used for the development of this work were of analytical grade, obtained from merck, fluka, riedel, and sigma-aldrich, including the pharmaceuticals paracetamol and guanine. all the chemicals were used without any purification. all solutions of used chemicals in characterization were prepared as 1 mm in non-aqueous medium; 100 mm tetrabutylammonium tetrafluoroborate (nbu4bf4) in acetonitrile (ch3cn). abstract in this study, guanine-modified glassy carbon electrode sensor was developed for the determination of paracetamol. the use of overdose continuously for a long time, its metabolites accumulate and affect the kidneys and liver. there -fore, the detection of paracetamol is of great significance. differential pulse voltammetry and cyclic voltammetry techniques were employed to analyze the behavior of paracetamol in 0.1 m britton-robinson buffer solution of ph 5.0 on guanine-modified electrode. guanine-modified glassy carbon electrode showed a good linear response in the concentration range from 0.5 mm to 10 μm for the quantitative determination of paracetamol with the lower limit of detection of 0.9 µm. article info received: 25 may 2023 accepted: 19 august 2023 available online: 21 august 2023 doi: 10.3329/bjp.v18i3.66459 cite this article: islamoglu n, demir mulazımoglu a. use of guanine-modified glassy carbon electrode as an electrochemical sensor for the determination of paracetamol. bangladesh j pharmacol. 2023; 18: 97-104. use of guanine-modified glassy carbon electrode as an electrochemical sensor for the determination of paracetamol nesim islamoglu and ayen demir mulazımoglu department of chemistry, ahmet keleolu faculty of education, necmettin erbakan university, konya, turkey. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 97-104 journal homepage: www.bdpsjournal.org; www.banglajol.info abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 the employed br buffer solutions were prepared by mixing h3po4, h3bo3, and ch3cooh according to preparation conditions in the literature, completed to the level by using ultrapure water. the ph adjustments were carried out by dropwise addition of 0.1 m/1 m naoh by a digital ph meter. all guanine solutions used in modification were 1 mm concentration in 0.1 m h2so4 solution. the modification was carried out only in aqueous media, while the electrochemical characterization was done in both non-aqueous and aqueous media. instruments ultrapure water with a resistance of 18.2 mω cm (mp minipure purification system, usa) was used to preparation all aqueous solutions, measurements, cleaning of the glassware, and polish the electrodes. all electrochemical experiments were completed at room temperature (25 ± 1°c) under a traditional threeelectrode cell system for all electrochemical experiments. ph meter with a combined glass ph electrode (vwr phenomenal) was used to measure the ph value in the aqueous solutions. cv and electrochemical impedance spectroscopic (eis) techniques were performed using a gamry reference pci4/series 750 and reference 600+ potentiostat/galvanostat/zra from gamry instruments (usa) equipped with a bas (bioanalytical systems, usa) model c3 cell stand. ag/agcl/kcl (sat) (bas model mf-2063) reference electrode was used in aqueous solutions. ag/ag+ (10 mm agno3) (bas model mf 2042) in 0.1 m nbu4bf4 in ch3cn reference electrode was used in non-aqueous solutions. a platinum wire (bas model mw-1033) was used as a counter electrode. bare gc electrode with a geometric area of 0.071 cm2 or guanine-modified gc electrode bas (bioanalytical systems, usa) model mf2012 and the tokai gc-20 (japan) gc electrode were used as a working electrode in all electrochemical experiments such as cv, eis and dpv. the gc electrode was cleaned and polished with 100 and 50 nm al2o3 suspension (baikowski int. corp., usa) on polishing pad (buehler, usa) for about 5 min and then washed with ultrapure water (upw). polished gc electrodes were sonicated (bandelin electronic, rk100h, germany) in upw for about 5 min in the following sonication gc electrodes were dipped in ch3cn media. all working electrodes were kept in ch3cn when they were not in use in all experiments. electrode preparation and modification the gc electrodes were prepared for the experiments by polishing to gain a mirror-like appearance, first with fine wet emery papers (grain size 4000) and then with 1.0 μm and 0.3 μm alumina slurry on micro-cloth pads (buehler, usa). after the initial polishing, the gc electrodes were resurfaced with 0.05 μm alumina slurry. first, in the following order, the gc electrodes were sonicated both in water and in ch3cn for 10 min, (demir mulazımoglu and mulazımoglu, 2013). electrochemical surface modification experiments were performed in the +0.5 and +1.7 v potential range at a 0.1 v s-1 scan rate with 20 cycles. then reduction experiments were achieved by using 0.1 m hcl solution in the 0 and -1.2 v potential range at a 0.1 v s-1 scan rate with 5 cycles. after the modification of the gc electrode, the surface of the obtained rgu/gc electrode was washed to remove all impurities from the electrode surface, and it was then used for other investigations described in this study. results modification of gc electrodes electrode modification plays an important role in electrochemical research and has been widely used in the past decade. these modified electrodes have achieved remarkable results in the determination of organic and inorganic substances. since the electrode surface can be prepared by electrochemical oxidation or reduction in a suitable medium and under optimal preparation conditions, modified electrodes can be physically prepared to get a sensor. although electrode modification is widely performed in aqueous media, recent studies can also be applied to non-aqueous media. modification methods in aqueous media are preferred since assays in research are often performed in aqueous media, which are considered to be more stable. the electrochemical modification on the surface of the gc electrodes was achieved with 1 mm guanine in 0.1m h2so4 as supporting electrolyte in aqueous media from +0.5 v to +1.7 v potential ranges using 0.1 v s−1 sweep rate with 20 cycles (figure 1a). the modified surface was electro-inactive. so, the surface was activated by reducing it in the 0 and -1.2 v potential range using 0.1 v s-1 scanning rate with 5 cycles (figure 1b). after that, the surface of obtained rgu/gc electrode was washed to remove all impurities from the electrode surface and then it was used for other investigations described in this study. electrochemical characterization of rgu/gc electrode as the surface characterization processes after modifications and reduction were performed electrochemically by using ferrocene redox probe in non-aqueous medium and fe(cn)63in aqueous medium with cv. for the characterization processes, it was made with ferrocene prepared by dissolving in 0.1 m nbu4bf4. a voltammogram with a potential range from +0.2 v to 98 bangladesh j pharmacol 2023; 18: 97-104 +0.6 v and a sweeping rate of 0.1 v s-1 was achieved (figure 2a). in addition to that, characterization also has been done with fe(cn)63that was prepared by letting it dissolve in br buffer solution, ph 2.0. a voltammogram with the potential range from +0.4 v to 0 v at a 0.1 v s-1 sweep rate was carried out (figure 2b). effect of buffer solution ph on the sensor response the ph value of the electrolyte can affect the peak shape, peak potential, and peak current of the modified electrode. it is also more conducive to estimating the ratio of protons and electrons participating in the electrode reaction. as shown in figures 3a, 3b, it was investigated the effect of ph values using br buffer solutions from 2.0 to 12.0 at a scan rate of 0.1 v s−1. the observed peak potential shifted in the negative direction with increasing ph, confirming the direct involvement of protons in the rate-limiting step. comparing the peak currents of paracetamol, the maximum response was observed at ph 5.0. therefore, the same ph was chosen for further determination. effect of scan rate on cvs of paracetamol at rgu/gc electrode the effect of scan rate on the electrochemical behavior of paracetamol was investigated by cv in br of ph 5.0. figure 4a shows the cvs of 1.0 mm paracetamol for br ph 5.0 at different scan rates from 25 to 500 mv s-1. for oxidation and reduction processes, the peak potentials shift towards more positive and negative values, respectively, indicating that both peak potentials (epa and epc) are a function of the scan rate. the oxidation and reduction peak currents (ipa, ipc) increase linearly with the square root of the scan rate (υ1/2) over the examined range. ipa(µa) = 81.094 + 27.507 υ1/2(mv s-1)1/2 r2 = 0.9937 ipc(µa) = 69.65 19.061 υ1/2(mv s-1)1/2 r2 = 0.9935 figure 1: cyclic voltammograms of preparation of guanine modified gc electrode, 1 mm aqueous solution of guanine was taken in 0.1 m h2so4 at 20 cycles with scan rate 0.1 v s−1 (a). cyclic voltammograms of reduction of guanine modified gc electrode, 0.1 m hcl was taken at 5 cycles with scan rate 0.1 v s−1 (b) figure 2: overlaying the bare gc and rgu/gc electrode voltammograms at ferrocene and k3fe(cn)6. a) 1 mm ferrocene redox probe solution vs. ag/ag+ (10 mm) in ch3cn+ 0.1 m nbu4bf4 using 0.1 v s-1 scanning rate and b) 1 mm k3fe(cn)6 redox probe solution vs. ag/agcl/kcl(sat) reference electrode in br buffer solution, ph 2.0 using 0.1 v s-1 scanning rate a b a b bangladesh j pharmacol 2023; 18: 97-104 99 these phenomena suggest that the electrochemical reaction is a diffusion-controlled process. on the other hand, a linear regression line plot of the logarithmic peak current and the logarithmic scan rate also provides information about the process controlled by diffusion or adsorption. two linear relationships were obtained (figure 4c) and represented by the following equation: logipa = 0.7349 logυ + 0.7739; r2 = 0.993 logipa = 0.8205 logυ + 0.3778; r2 = 0.990 the plot of peak potential (epa and epc) versus log υ is shown in figure 4e, and the corresponding regression equation is: epa = 93.63 log υ + 226.6; r2 = 0.9417 epc = 35.331 log υ + 364.41; r2 = 0.8401 effect of scan rate on lsv of paracetamol at rgu/gc electrode from figure 5a, for oxidation processes, the peak potentials shift towards more positive values, indicafigure 3: a) effect of ph values use of br buffer solutions from 2.0 to 12.0 to determine paracetamol at rgu/gc electrode by dpv from -0.2 to +0.8 v using 0.1 v s-1 scanning rate, and b) relation between ph and peak currents for 1 mm par at rgu/gc electrode figure 4: a) cvs obtained at rgu/gc electrode in br ph 5.0 containing 1.0 mm paracetamol at various scan rates (25-500 mv s-1), b) shows the plot of the anodic peak current versus scan rate. c) relation between log scan rate and log peak current. d) calibration plot of the redox peak currents vs. square root of scan rate. e) plot of variation of ep,mv versus log υ, mv s-1 a b b c a e d 100 bangladesh j pharmacol 2023; 18: 97-104 ting that peak potentials (epa) are a function of the scan rate. as shown in figure 5d, the oxidation peak currents (ipa) increase linearly with the square root of the scan rate (υ1/2) over the examined range. r2 = 0.9931 the linear relationship was obtained (figure 5c) and represented by the following equation: logipa = 0.8272 logv + 0.4416; r2 = 0.9991 the plot of peak potential (epa) versus log υ is shown in figure 6e, and the corresponding regression equation is: epa = 81.159logv + 231.26; r2 = 0.8925 voltammetric determination of paracetamol compared with conventional cvs, dpv has advantages of higher sensitivity and high resolution in quantitative analysis. therefore, dpv was used to determined paracetamol in 0.1 m br from 0 to +0.6 v using 0.1 v s-1 scanning rate as shown in figure 6. the oxidation experiments were performed under optimal conditions. the results of dpv are shown in figure 6a. the oxidation peak current of paracetamol increases linearly with increasing of concentration. figure 6b shows the linear relationship from 0.5 mm to 10 μm using the following linear equation: ipa(μa) = 0.0931 μm x [paracetamol] + 0.3688 r2 = 0.9904 the limits of detection (lod) was 0.9 µm, and the limit of quantification (loq) was 2.7 µm. discussion guanine and adenine are important components of dna (wang et al., 2002). the electrode surface can be prepared by electrochemical oxidation or reduction in a suitable medium under optimal preparation conditions. although electrode modification is widely used in aqueous media. our previous studies (mulazımoglu and demir mulazımoglu, 2012; demir mulazımoglu and mulazımoglu, 2013), demonstrated electrode modification with amine-containing compounds. the main purpose objective of this study was to improve a new chemical sensor electrode for the determination of paracetamol by using electrochemical and spectroelectrochemical techniques. (demir mulazımoglu and mulazımoglu, 2013; dundar et al., 2011; celik et al., 2020). the main target of this study was achieved to electrochemically modify guanine onto the gc electrode surface by using cyclic voltammetry (cv) and characterize gu-modified gc (rgu/gc) electrode by cv. this study also was performed to investigate whether the new sensor obtained is sensitive to the figure 5: a) impact of scan rate on 1.0 mm paracetamol in br ph 5.00 at rgu/gc electrode from 20-500 mv s-1, b) shows the plot of the anodic peak current versus scan rate. c) relation between log scan rate and log peak current. d) calibration plot of the redox peak currents vs. square root of scan rate. e) plot of variation of ep, mv versus log υ, mv s-1 bangladesh j pharmacol 2023; 18: 97-104 101 paracetamol through differential pulse voltammetry (dpv). recently, electrochemical methods have attracted much attention due to their simplicity, low cost, high sensitivity, and the possibility of miniaturization (beitollahi et al., 2013; esfandiari baghbamidi et al., 2013; mohammadizadeh et al., 2018; mohammadi et al., 2019). electrochemical techniques are of great significance in environmental monitoring, medicine and biotechnology, and industrial process management (mohammadi et al., 2021). paracetamol is an electroactive compound that can be detected using voltammetry. voltammetry has high sensitivity, high precision, low cost, low detection limit, and wider linear range (ejaz et al., 2017). the voltametric determination of paracetamol is widely used in blood samples, water, drugs and mixed compounds. results showed recoveries of 97-102%, with highly reproducible responses (ozcan et al., 2007; akbari et al., 2018; berto, 2018; tanuja et al., 2018). among them, carbon-based electrodes are widely used in voltammetry because of their low cost, wide potential window, low resistivity, and versatility of chemical modification. chemically modified electrodes are very interesting tools for the analysis of various trace substances using sensitive electroanalytical techniques. in this case, it is very important to choose the most suitable modifier for each analyte because the sensitivity and selectivity of the electroanalytical reaction depend on the nature of the modifier (barreto et al., 2023; liu et al., 2023; siavashi et al., 2023; smajdor et al., 2023). modification of carbon electrodes with organic molecules can improve the sensitivity and selectivity of paracetamol determination. the presence of specific modifier molecules on the surface of the electrode allows only certain molecules to diffuse to its surface. in this work, by using paracetamol as test analytes, the effectiveness of using modified carbon-based electrodes as an inexpensive and simple in pharmaceutical analysis is evaluated (akca et al., 2022; gashu et al., 2022; kablan et al., 2022; kassem et al., 2022; ozkan et al., 2022; budak et al., 2023; mohamed et al., 2023). the test analytes were determined individually by differential pulse voltammetry using guanine-modified glassy carbon electrode. under optimized experimental conditions (br buffer solution ph 5.0), the electrode showed a linear response in the range of 0.5 mm to 10.0 μm for quantitative determination of paracetamol with lower limit of detection of 0.9 µm. in this research, advantages were taken of its efficiency, availability, and low cost, avoiding complex, time-consuming. this study provides a reliable and economical basis for the development of low-cost, biodegradable electrode materials for electrochemical sensors. the technology can be used more than once sensor device, similar to a glucose sensor (sun et al., 2022; yang et al., 2022; youcef et al., 2022; zainul et al., 2022), to measure and quantify paracetamol. produced electrodes were tested for acceptable reproducibility. ultimately, the practical application of the developed sensor can be successfully used for the quantitative measurement of paracetamol in drug and serum samples (hussain et al., 2023; nigussie et al., 2023; qomi et al., 2023; richard et al., 2023; uzun et al., 2023). therefore, this strategy is expected to provide a simple and novel approach for sensor fabrication for the determination of paracetamol. conclusion the rgu/gc electrode presented an acceptable analytical performance for paracetamol determination with a figure 6: a) dpv curves of paracetamol on its concentration in the range of a) 5.0 × 10−4 m, b) 2.5 × 10−4 m, c) 1.0 × 10−4 m, d) 7.5 × 10−5 m, e) 5.0 × 10−5 m, f) 2.5 × 10−5 m, g) 1.0 × 10−5 m in br buffer solution ph 5.0, and b) the plot of ipa versus concentration of paracetamol 102 bangladesh j pharmacol 2023; 18: 97-104 wide linear range, from 0.5 mm to 10 μm with the limits of detection of 0.9 µm. financial support self-funded conflict of interest authors declare no conflict of interest references akbari m, shayani-jam h, yaftian m, parinejad m. electrochemical oxidation of acetaminophen in the presence of diclofenac and piroxicam: synthesis of new derivatives and kinetic investigation of toxic quinone imine/drugs interactions. j electroanal chem. 2018; 827: 160-66. akca z, izem ozok h, yardim y, senturk z. electroanalytical investigation and voltammetric quantification of antiviral drug favipiravir in the pharmaceutical formulation and urine sample using a glassy carbon electrode in anionic surfactant media. turk j chem. 2022; 46: 869-80. al-ghannam m, el-brashy m, al-farhan s. fluorimetric determination of some thiol compounds in their dosage forms. farmaco 2002; 57: 625-29. barreto f, leme da silva m, cesarino i. copper nanoparticles and reduced graphene oxide as an electrode modifier for the development of an electrochemical sensing platform for chloroquine phosphate determination. nanomaterials 2023; 13: 1436-47. beitollahi h, mohammadi s. selective voltammetric determination of norepinephrine in the presence of acetaminophen and tryptophan on the surface of a modified carbon nanotube paste electrode. mater sci eng c. 2013; 33: 3214-19. berto s. application of an electro-activated glassy-carbon electrode to the determination of acetaminophen (paracetamol) in surface waters. electrochim acta. 2018; 284: 279-86. boumya w, taoufik n, achak m, barka n. chemically modified carbon-based electrodes for the determination of paracetamol in drugs and biological samples. j pharm anal. 2021; 11: 138-54. budak f, cetinkaya a, kaya si, atici eb, ozkan sa. sensitive determination and electrochemical evaluation of anticancer drug tofacitinib in pharmaceutical and biological samples using glassy carbon and boron-doped diamond electrodes. diam relat mater. 2023; 133: 109751. bui n, li a, han n, pham x, seong h. determination of acetaminophen by electrochemical co-deposition of glutamic acid and gold nanoparticles. sens actuators b chem. 2012; 174: 318-24. celik h, ozcan s, demir mülazımoğlu a, yılmaz e, mercimek b, çukurovalı a, yılmaz i, solak ao, mulazımoglu ie. the synthesis of a novel ddphc diazonium salt: investigation of its usability in the determination of phenol and chlorophenols using cv, swv and dpv techniques. inorg chem commun. 2020; 116: 107893. delvadiya k, kimbahune r, kabra p, sunil k, patel p, nargund l. high-performance liquid chromatographic determination of paracetamol, propyphenazone, and caffeine in pharmaceutical formulations. indian j pharm educ res. 2013; 47: 65-72. demir mulazımoglu a, mulazımoglu ie. electrochemical properties of mda/gc electrode and investigation of usability as sensor electrode for determination of que, kae, lut and gal using cv, dpv and swv. food anal methods. 2013; 6: 141-47. demir mulazımoglu a, mulazımoglu ie. electrochemical behaviors of 2-amino-3-hydroxypyridine onto the glassy carbon sensor electrode: simultaneous and independent determinations of quercetin, galangin, 3-hydroxyflavone, and chrysin. food anal methods. 2013; 6: 845-53. dundar e, mulazımoglu ie, ozkan e. electrochemical and spectroelectrochemical investigation of the behaviors of hf, 3-hf, 6-hf, 3,6-dhf on glassy carbon electrode surfaces. rev anal chem. 2011; 30: 18-20. ejaz a, jeon s. a highly stable and sensitive go-xdamn2o3 electrochemical sensor for simultaneous electrooxidation of paracetamol and ascorbic acid. electrochim acta. 2017; 245: 742-51. esfandiari baghbamidi s, beitollahi h, mohammadi s, tajik s, soltani-nejad s, soltani-nejad v. nanostructure-based electrochemical sensor for the voltammetric determination of benserazide, uric acid, and folic acid. chin j catal. 2013; 34: 1869-75. filik h, aksu d, apak r, sener s, kılıc e. an optical fibre reflectance sensor for paminophenol determination based on tetrahydroxycalix[4]arene as sensing reagent. sens actuators b chem. 2009; 136: 105-12. gashu m, kassa a, tefera m, amare m, aragaw b. sensitive and selective electrochemical determination of doxycycline in pharmaceutical formulations using poly(dipicrylamine) modified glassy carbon electrode. sens bio-sens res. 2022; 37: 100507. hussain s, sadiq i, baig j, sadiq f, shahbaz m, solangi i, idrees m, saeed s, riaz s, naseem s. synthesis and characterization of vanadium ferrites, electrochemical sensing of acetaminophen in biological fluids and pharmaceutical samples. ceramics int. 2023; 49: 8165–71. kablan s, recber t, tezel g, timur s, karabulut c, karabulut t, eroglu h, kır s, nemutlu e. voltammetric sensor for covid-19 drug molnupiravir on modified glassy carbon electrode with electrochemically reduced graphene oxide. j electroanal chem. 2022; 920: 116579. kassem m, awad m, morad m, aljahdali b, pashameah r, alessa h, mohammed g, sayqal a. sensor based on copper nanoparticles modified electrochemically activated glassy carbon electrode for paracetamol determination. int j electrochem sci. 2022; 17: 220441. kumar g, letha r. determination of paracetamol in pure form and in dosage forms using n,n-di-bromo dimethylhydantoin. j pharm biomed anal. 1997; 15: 1725-28. liu y, zhang z, li y, shi f, ai y, wang b, zhang s, zhang x, sun w. electrochemical detection of hydroquinone based on marine biomass carbon from shrimp shells as electrode modifier. int j electrochem sci. 2023; 18: 100063. bangladesh j pharmacol 2023; 18: 97-104 103 author info ayen demir mulazımoglu (principal contact) e-mail: admulazimoglu@erbakan.edu.tr mohamed e, mahmoud a, nashat n, el‑mosallamy s. fabrication of novel electropolymerized conductive polymer of hydrophobic perfuorinated aniline as transducer layer on glassy carbon electrode: application to midazolam as a model drug of benzodiazepines. bmc chem. 2023; 2023. mohammadi s, beitollahi h, askaria m, hosseinzadeh r. application of a modified carbon paste electrode using core –shell magnetic nanoparticle and modifier for simultaneous determination of norepinephrine, acetaminophen and tryptophan. russian j electrochem. 2021; 57: 74–84. mohammadi s, beitollahi h, khodaparast b, hosseinzadeh r. electrochemical determination of epinephrine, uric acid and folic acid using a carbon paste electrode modified with novel ferrocene derivative and core–shell magnetic nanoparticles. res chem intermed. 2019; 45: 1117-29. mohammadizadeh n, mohammadi s, kaykhaii m. carbon paste electrode modified with zro2 nanoparticles and ionic liquid for sensing of dopamine in the presence of uric acid. j anal chem. 2018; 73: 685-94. montaseri h, forbes p. analytical techniques for the determination of acetaminophen: a review. trends anal chem. 2018; 108: 122-34. mulazımoglu ie, demir mulazımoglu a. investigation of sensitivity against different flavonoid derivatives of aminophenyl-modified glassy carbon sensor electrode and antioxidant activities. food anal methods. 2012; 5: 1419-26. mulazımoglu ie. electrochemical determination of copper (ii) ions at naringenin-modified glassy carbon electrode: application in lake water sample. desalin water treat. 2012; 44: 161–67. nebot c, gibb w, boyd g. quantification of human pharmaceuticals in water samples by high performance liquid chromatography: tandem mass spectrometry. anal chim acta. 2007; 598: 87-94. nigussie m, kassa a, guadie a, mulu m, lijalem t, teferam. selective and sensitive determination of tinidazole in pharmaceuticals and biological matrix using poly(diphenylamine-4-sulfonic acid) modified glassy carbon electrode. sens bio-sens res. 2023; 39: 100552. ozcan l, sahin y. determination of paracetamol based on electropolymerized-molecularly imprinted polypyrrole modified pencil graphite electrode. sens actuators b chem. 2007; 127: 362–69. ozkan e, cetinkaya a, ozcelikay g, nemutlu e, kır s, ozkan s. sensitive and cost-effective boron doped diamond and fe2o3/chitosan nanocomposite modified glassy carbon electrodes for the trace level quantification of anti-diabetic dapagliflozin drug. j electroanal chem. 2022; 908: 116092. pérez-ruiz t, martínez-lozano c, tomás v, galera r. migration behavior and separation of acetaminophen and paminophenol in capillary zone electrophoresis: analysis of drugs based on acetaminophen. j pharm biomed anal. 2005; 38: 87-93. qomi m, sarvestani m. highly sensitive voltammetric determination of acetaminophen by an overoxidized poly (paminophenol) modified glassy carbon electrode. int j new chem. 2023; 10: 140-50. richard y, lincy s, saravanakumar r, maheswaran r, dharuman v. sensitive detection of acetaminophen in body fluids, pharmaceuticals and herbal medicines at un-doped mesoporous carbon nitride film electrode. microchem j. 2023; 184: 108175. siavashi r, beitollahi h. molecularly imprinted polymer based sensor for measuring of levodopa: evaluation as a modifier for glassy carbon electrode in electrochemically detection. russian j electrochem. 2023; 59: 70–78. smajdor j, paczosa-bator b, grabarczyk m, piech r. glassy carbon electrode modified with cb/tio2 layer for sensitive determination of sumatriptan by means of voltammetry and flow injection analysis. sensors 2023; 23: 5397-412. sun y, xue w, zhao j, bao q, zhang k, liu y, li h. direct electrochemistry of glucose dehydrogenase-functionalized polymers on a modified glassy carbon electrode and its molecular recognition of glucose. int j mol sci. 2023; 24: 6152. tanuja s, kumara s, vasantakumar p. voltammetric determination of paracetamol using polyvinyl alcohol (pva)fe3o4 modified glassy carbon electrode. ind chem. 2018; 4: 1 -10. uzun d, calam t. electrochemical behavior and ultrasensitive, simple and effective voltammetric determination of acetaminophen using modified glassy carbon electrode based on 4 hydroxyquinoline-3-carboxylic acid. electroanalysis 2023; 35: 2200182. wang h, ju h, chen h. simultaneous determination of guanine and adenine in dna using an electrochemically pretreated glassy carbon electrode. anal chim acta. 2002; 461: 243-50. wangfuengkanagul n, chailapakul o. electrochemical analysis of acetaminophen using a borondoped diamond thin film electrode applied to flow injection system. j pharm biomed anal. 2002; 28: 841-47. yang t, xie y, zhang x, guo r, yang x. one-step electrodeposition of cuni bimetallic nanocatalyst anchored on reduced graphene oxide modified glassy carbon electrode for nonenzymatic sensing of glucose. int j electrochem sci. 2022; 17: 22098. youcef m, hamza b, nora h, walid b, salima m, ahmed b, malika f, marc s, christian b, wassila d, djamel eddine m, larbi z. a novel green synthesized nio nanoparticles modified glassy carbon electrode for non-enzymatic glucose sensing. microchem j. 2022; 178: 107332. zainul r, isa i, yazid s, hashim n, sharif s, saidin m, ahmad m, suyanta m, amir y. enhanced electrochemical sensor for electrocatalytic glucose analysis in orange juices and milk by the integration of the electron-withdrawing substituents on graphene/ glassy carbon electrode. j anal methods chem. 2022; 5029036. 104 bangladesh j pharmacol 2023; 18: 97-104 mailto:admulazimoglu@erbakan.edu.tr bangladesh journal of pharmacology research article anti-inflammatory effect of gallic acid on hacat keratinocytes through the inhibition of mapk-, nf-κb-, and akt-dependent signaling pathways bjp introduction keratinocytes are one of the major cell types in the epidermis. in addition to their structural roles in preventing pathogens from getting into the body, keratinocytes play important immune functions by secreting cytokines and chemokines upon stimulation by allergens and microbiological agents, resulting in an inflammatory response. gallic acid is a naturally occurring tri-phenolic compound found in various plants, with a particularly high abundance in gallnuts, witch hazel, oak bark, tea leaves, areca nut, bearberry, and blackberry. gallic acid exhibits antioxidant and anti-inflammatory properties (kahkeshani et al., 2019). because of these properties, its potential application in treating atopic dermatitis, a widely prevalent and chronically relapsing inflammatory skin disease, has been studied. gallic acid has been reported to suppress the expression of intercellular adhesion molecule-1 and the release of chemokines and cytokines in ku812 basophilic cells (liu et al., 2013). in addition, gallic acid can inhibit the release of the cytokine interleukin (il)-12 and the expression of functional surface markers in monocyte-derived dendritic cells (chan et al., 2015). gallic acid also suppressed the release of cytokines and chemokines in an eosinophildermal fibroblast co-culture (tsang et al., 2016). furthermore, in a 4-dinitrochlorobenzene-induced atopic dermatitis-like mouse model, gallic acid alleviated skin inflammation through the immunomodulation of th17 cells (hu and zhou, 2021). although an anti-inflammatory effect of gallic acid on dermatitis has been proposed, this was previously studied in white blood cells, such as basophils, eosinoabstract the objectives of the present study were to evaluate the antioxidant and antiinflammatory effects of gallic acid, a naturally occurring triphenolic compound, on hacat keratinocytes and study its mechanisms of action. the results showed that gallic acid at concentrations lower than 30 µm was nontoxic to hacat cells, reduced the intracellular level of reactive oxygen species, and suppressed the release of chemokines interleukin-8 and monocyte chemoattractant protein-1 in tumor necrosis factor-αand interferon-γstimulated hacat keratinocytes. in addition, gallic acid reduced the total protein expression of nf-κb and inhibited the phosphorylation of erk1/2, p38 mapk, and akt in stimulated hacat keratinocytes. in conclusion, our study revealed that gallic acid exhibited antioxidant and anti-inflammatory effects on keratinocytes, probably through the inhibition of mapk-, nf-κb-, and akt-dependent signaling pathways. article info received: 1 december 2022 accepted: 6 january 2023 available online: 13 january 2023 doi: 10.3329/bjp.v18i1.62914 cite this article: shiu pht, zheng c, rangsinth p, wang w, li j, li r, leung gph. antiinflammatory effect of gallic acid on hacat keratinocytes through the inhibition of mapk-, nf-kb-, and akt -dependent signaling pathways. bangladesh j pharmacol. 2023; 18: 2432. anti-inflammatory effect of gallic acid on hacat keratinocytes through the inhibition of mapk-, nf-kb-, and akt-dependent signaling pathways polly ho-ting shiu1, chengwen zheng1, panthakarn rangsinth1, wen wang1, jingjing li2, renkai li1 and george pak-heng leung1 1 department of pharmacology and pharmacy, the university of hong kong, hong kong sar, china; 2 department of rehabilitation sciences, faculty of health and social sciences, hong kong polytechnic university, hong kong sar, china. this work is licensed under a creative commons attribution 4.0 license. you are free to copy, distribute and perform the work. you must attribute the work in the manner specified by the author or licensor. a journal of the bangladesh pharmacological society (bdps) bangladesh j pharmacol 2023; 18: 24-32 journal homepage: www.banglajol.info; www.bdpsjournal.org abstracted/indexed in academic search complete, agroforestry abstracts, asia journals online, bangladesh journals online, biological abstracts, biosis previews, cab abstracts, current abstracts, directory of open access journals, embase/excerpta medica, global health, google scholar, hinari (who), international pharmaceutical abstracts, open j-gate, science citation index expanded, scopus and social sciences citation index issn: 1991-0088 phils, and monocytes. to our knowledge, the effect of gallic acid on keratinocytes, which comprise 95% of the dermis and are involved in the inflammatory response of the skin, has never been investigated. therefore, this study aimed to evaluate the antioxidant and antiinflammatory effects of gallic acid on tumor necrosis factor (tnf)-α/interferon (ifn)γ-stimulated hacat keratinocytes. the mechanism of action underlying these effects was also explored. materials and methods chemicals and reagents rpmi 1640 medium, fetal bovine serum, penicillinstreptomycin, 0.25% trypsin, human tnf-α recombinant protein, and cm-h2dcfda were purchased from invitrogen (usa). ripa lysis and extraction buffer, halt™ protease inhibitor cocktail, and bicinchoninic acid protein assay kit were purchased from thermo scientific (usa). gallic acid, thiazolyl blue tetrazolium bromide (mtt), dimethyl sulfoxide, and phenylmethylsulfonyl fluoride were purchased from sigma-aldrich (usa). the human cxcl8/il-8 duoset, human ccl2/ mcp-1 duoset, and human il-1 beta/il-1 f2 duoset enzyme-linked immunosorbent assay (elisa) kits and human ifn-γ recombinant protein were purchased from r&d systems (usa). all antibodies used for western blotting were purchased from cell signaling technology (usa). ecl select western blotting detection reagents were purchased from ge healthcare life sciences (usa). cell culture and drug treatment hacat keratinocytes (thermo fisher scientific) were cultured in rpmi medium supplemented with 8% heatinactivated fetal bovine serum and 1% penicillinstreptomycin and cultured at 37°c in an incubator with a humidified atmosphere of 5% co2. hacat keratinocytes were treated without (control) and with different concentrations of gallic acid in the presence of 10 ng/ml recombinant human tnf-α and 10 ng/ml ifn-γ for 24 hours. thereafter, cell viability assay, reactive oxygen species (ros) measurement, cytokine and chemokine release, and western blotting analysis were carried out as described below. cell viability assay to study the toxicity of gallic acid in hacat keratinocytes, cell viability was assessed using the mtt assay (bahuguna et al., 2017 for video). the cells were incubated in 0.4 mg/ml mtt for 4 hours at 37°c. dimethyl sulfoxide was added to lyse the cells and dissolve the formazan crystals formed in the cells. the absorbance was measured at 560 nm using a microplate reader. ros measurement the cells were washed with phosphate buffer solution and stained with 2 µm cm-h2dcfda for 15 min. unbound dye was removed by washing with pbs. the cells were then detached from the culture plates using 0.25% trypsin. the green fluorescent signal, which is an indicator of ros, was detected and quantified using a flow cytometer. elisa the cell suspension was centrifuged at 5,000 x g at 4°c for 10 min to remove cell debris. il-1β, il-8, and monocyte chemoattractant protein (mcp)-1 in the supernatants were detected using the human il-1 beta/il-1 f2 duoset elisa, human cxcl8/il-8 duoset elisa, and human ccl2/mcp-1 duoset elisa kits, according to the manufacturer’s instructions. western blotting analysis the total protein from hacat keratinocytes was extracted using ripa lysis buffer containing 1% phenylmethylsulfonyl fluoride and 1% halt™ protease inhibitor cocktail. the cell lysate was centrifuged at 13,000 rpm for 10 min at 4°c to remove the unbroken cell debris and nuclei. the supernatant was collected, and its protein concentration was measured using the bca assay according to the manufacturer’s instructions. protein samples (30 µg) were separated using 10% sodium dodecyl sulfate-polyacrylamide gel for electrophoresis and then electrotransferred onto phenylmethylsulfonyl fluoride membranes. the membranes were blocked with 5% non-fat milk for 1 hour at room temperature and then incubated with primary antibody (1:1000 dilution in 5% bovine serum albumin in trisbuffered saline) at 4°c overnight. after washing thrice with tris-buffered saline containing 0.1% tween-20 (tbst), the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody (1:2500 dilution in 5% bovine serum albumin in trisbuffered saline) for 1 hour at room temperature. the membrane was washed with tbst, and the protein bands were visualized using ecl select western blotting detection reagents with a chemidoc xrs molecular imager (bio-rad laboratories, usa). glyceraldehyde-3phosphate dehydrogenase (gapdh) protein expression was detected using a monoclonal mouse anti-actin antibody. the intensity of the different bands was normalized to that of the gapdh bands for semiquantitative analysis (lim et al., 2021 for video). statistical analysis all data are expressed as the mean ± sd of at least three independent experiments. a one-way analysis of variance (anova) followed by dunnett's multiple comparisons test was performed using graphpad prism 9 software (graphpad software inc., usa) to determine the statistical significance within groups. statistical significance was set at p<0.05. bangladesh j pharmacol 2023; 18: 24-32 25 results effect of gallic acid on the viability of hacat keratinocytes the cytotoxic effects of gallic acid were studied by incubating hacat keratinocytes with different concentrations of gallic acid for 24 hours. the results of the mtt assay showed that the viability of hacat keratinocytes was reduced by 18% at 100 µm but was not affected by lower concentrations (figure 1). therefore, gallic acid at concentrations below 30 µm was used in subsequent experiments. effect of gallic acid on intracellular level of ros in hacat keratinocytes the intracellular ros levels in hacat keratinocytes were detected using the fluorescent probe cmh2dcfda. the ros levels in hacat keratinocytes were elevated by 209% upon stimulation with tnf-α/ ifn-γ. the tnf-α/ifn-γ-induced ros levels were reduced by 17% and 9% by 30 µm and 10 µm gallic acid, respectively (figure 1). effects of gallic acid on the release of cytokines and chemokines in hacat keratinocytes the effects of gallic acid on the pro-inflammatory cytokine il-1β and the chemokines il-8 and mcp-1 were evaluated. tnf-α/ifn-γ increased the levels of il -1β, il-8, and mcp-1 released by hacat keratinocytes 39.2-, 11.3-, and 85.7-fold, respectively (figure 2). gallic acid at 30 µm inhibited tnf–α/ifn-γ-induced il-8 and mcp-1 release by 29% and 46%, respectively, but did not affect il-1β release. lower concentrations of gallic acid did not affect il-1β, il-8, or mcp-1 release. a b c control + gallic acid 1 3 10 30 100 µm a b c figure 1: effect of gallic acid on the viability of hacat keratinocytes (a) and ros generation (b,c). hacat cells were treated with various concentrations of gallic acid or vehicle (control) for 24 hours. cell viability was determined using the mtt assay. ros generation in hacat cells was detected by cm-h2dcfda staining and quantified via flow cytometry. hacat cells were treated without (control) and with different concentrations of gallic acid in the presence of 10 ng/ml recombinant human tnf-α and 10 ng/ml ifn-γ (t/i) for 24 hours. data are presented as a percentage of control group values (mean ± sd of three independent experiments). ap<0.0001 and bp<0.05 indicate a significant difference figure 2: effects of gallic acid on cytokine and chemokine release in hacat keratinocytes. hacat cells were treated without (control) and with different concentrations of gallic acid in the presence of 10 ng/ml recombinant human tnf-α and 10 ng/ml ifn-γ (t/i) for 24 hours. il-1β, il-8, and mcp1 in the culture media were detected using elisa. data are presented as a percentage of control group values (mean ± sd of three to six independent experiments). ap<0.0001, bp<0.001, and cp<0.05 indicate a significant difference 150 100 50 0 cm-h2dcfda fluorescence intensicontrol gallic acid t/i gallic acid 10 µm + t/i gallic acid 30 µm + t/i 400 300 200 100 0 control + gallic acid + 10 30 µm t/i + + + control + gallic acid 3 10 30 µm t/i + + + + 15 10 5 0 1000 800 600 400 200 0 5000 4000 3000 2000 1000 0 a a a b b a a b b c 26 bangladesh j pharmacol 2023; 18: 24-32 effects of gallic acid on inflammation-related signaling pathways in hacat keratinocytes western blot analysis was performed to study the effects of gallic acid on inflammation-related signaling pathways, including mitogen-activated protein kinase (mapk), nf-κb, and akt-dependent pathways. tnfα/ifn-γ did not affect the expression levels of total mapk kinase (mek)1/2 and extracellular signalregulated kinase (erk)1/2 but could increase their phosphorylation levels by 4.6and 3.6-fold, respectively. gallic acid (30 µm) did not affect the total and phosphorylated protein expression of mek1/2 and erk1/2 or the tnf-α/ifn-γ-induced phosphorylation of mek1/2, but it reduced the tnf-α/ifn-γ-induced phosphorylation levels of erk1/2 by 22% (figure 3). tnf-α/ifn-γ also did not affect the expression levels of total stress-responsive c-jun n-terminal kinase (jnk) and p38 mapk but increased their phosphorylation levels by 1.9and 11.8-fold, respectively. gallic acid (30 µm) did not affect the total and phosphorylated jnk figure 3: effects of gallic acid on total and phosphorylated protein levels of mek1/2, erk1/2, jnk and p38 mapk in hacat keratinocytes. hacat cells were treated without (control) and with different concentrations of gallic acid in the presence of 10 ng/ ml recombinant human tnf-a and 10 ng/ml ifn-γ (t/i) for 24 hours. protein expression levels of mek1/2, p-mek1/2, erk1/2, p-erk1/2, jnk, p-jnk, p38 mapk, and p-p38 mapk in hacat cells were determined using western blotting analysis. gapdh was used as a reference and the amounts of different proteins were normalized to that of gapdh. data are presented as a percentage of control group values (mean ± sd of three to six independent experiments). ap<0.0001, bp<0.01, and cp<0.05 indicate a significant difference a b c control + gallic acid + 10 30 µm t/i + + + p-mek1/2 mek1/2 p-erk1/2 erk1/2 gapdh control + gallic acid + 10 30 µm t/i + + + control + gallic acid + 10 30 µm t/i + + + d e 150 100 50 0 200 150 100 50 0 800 600 400 200 0 800 600 400 200 0 control + gallic acid + 10 30 µm t/i + + + p-jnk jnk p-p38 p38 gapdh 150 100 50 0 150 100 50 0 500 400 300 200 100 0 2000 1500 1000 500 0 f g h i j a a c a a c c a a a a c b bangladesh j pharmacol 2023; 18: 24-32 27 and p38 mapk protein levels. at a concentration of 30 µm, gallic acid reduced the tnf-α/ifn-γ-induced phosphorylation levels of p38 mapk by 20%, but it did not effect the phosphorylation of jnk (figure 3). tnf-α/ifn-γ increased the expression level of total nuclear factor-kappa b (nf-κb) by 60% but did not affect the expression level of total nuclear factor of kappa light polypeptide gene enhancer in b-cells inhibitor alpha (iκba). tnf-α/ifn-γ increased the phosphorylation levels of nf-κb and iκba by 267% and 91%, respectively. gallic acid (30 µm) alone did not affect the total and phosphorylated protein levels of nf-κb and iκba and abolished the tnf-α-/ifn-γ-induced expression of total nf-κb. however, 30 µm gallic acid did not affect the phosphorylation of iκba or nf-κb (figure 4). lastly, tnf-α/ifn-γ did not affect the expression levels of protein kinase b (akt) and the mammalian target of rapamycin (mtor) but increased their phosphorylation levels by 6and 1.5-fold, respectively. figure 4: effects of gallic acid on total and phosphorylated protein levels of ikba, nf-kb, akt and mtor in hacat keratinocytes. hacat cells were treated without (control) and with different concentrations of gallic acid in the presence of 10 ng/ml recombinant human tnf-α and 10 ng/ml ifn-γ (t/i) for 24 hours. protein expression levels of iκba, p-iκba, nfκb, p-nf-κb, akt, p-akt, mtor, and p-mtor in hacat cells were determined using western blotting analysis. gapdh was used as a reference and the amounts of different proteins were normalized to that of gapdh. data are presented as a percentage of control group values (mean ± sd of three to six independent experiments). ap<0.0001 and bp<0.01 indicate a significant difference a p-nf-κb nf-κb p-iκbα iκbα gapdh control + gallic acid + 10 30 µm t/i + + + b c d e 200 150 100 50 0 150 100 50 0 800 600 400 200 0 250 200 150 100 50 0 control + gallic acid + 10 30 µm control + gallic acid + 10 30 µm t/i + + + control + gallic acid + 10 30 µm t/i + + + p-akt akt p-mtor mtor gapdh f g h 150 100 50 0 150 100 50 0 1500 1000 500 0 400 300 200 100 0 i j a a a a a b a a a a a a b b b 28 bangladesh j pharmacol 2023; 18: 24-32 gallic acid (30 µm) alone did not effect total and phosphorylated protein levels of akt and mtor. gallic acid (30 µm) reduced the tnf-α/ifn-γ-induced phosphorylation levels of akt by 34% but did not effect the phosphorylation of mtor (figure 4). discussion gallic acid has been reported to suppress inflammatory responses in immune cells, such as monocytes, basophils, and eosinophils (liu et al., 2013; chan et al., 2015: tsang et al., 2016). this study was designed to examine whether gallic acid exerts anti-inflammatory effects on keratinocytes. primary culture of human keratinocytes is sometimes used to study the immunological and inflammatory responses of the skin. however, donor difference, instability between passages, and short culture lifetimes may affect data interpretation. therefore, hacat cells were used in the present study. they are immortalized human keratinocyte lines that can differentiate and are similar to normal keratinocytes in terms of the release of inflammatory mediators in response to tnf-α and inf-γ (cho et al., 2003; han et al., 2021). they have been widely used as models to investigate anti-inflammatory pharmacology in skin diseases, including atopic dermatitis. first, the cytotoxicity of gallic acid was examined. the results of the mtt assay showed that 30 µm gallic acid did not affect the viability of hacat keratinocytes; however, 100 µm gallic acid was slightly cytotoxic. these values were consistent with those of previous studies in which gallic acid was reported as safe and effective for most cells at lower concentrations and toxic at higher concentrations. for instance, 200 μm gallic acid had no effect on the viability of hepg2 cells (su et al., 2013), while higher concentration was slightly cytotoxic to b16f10 and raw 264.7 cells (cheng et al., tanaka et al., 2020). gallic acid concentrations higher than 100 μm were cytotoxic to bv-2 and nerve-2a cells; however, concentration less than 50 μm was safe to the cells (kim et al., 2011). gallic acid also produced significant cytotoxicity in caco2, l929, and u937 cells at concentrations above 200 μm (truzzi et al., 2020). oxidative stress is a major factor that contributes to inflammatory responses. ros can activate nf-κb, which in turn regulates the gene expressions of tnf-α, il-1, il-6, il-8, and inducible nitric oxide synthase (allen and tresini, 2000; baeuerle and henkel, 1994). moreover, oxidative stress activates protein kinase c (ricciarelli et al., 1998), which can increase the expression of tnf-α (wang and smart, 1999) and the produc -tion of cytokines (chabot-fletcher et al., 1994) in keratinocytes. therefore, antioxidant compounds may attenuate skin inflammation (portugal et al., 2007; sardana and sachdeva, 2022). the antioxidant effect of gallic acid is one of the most widely reported bioactivities (cho et al., 2003; serrano et al., 1998; yoshino et al., 2002). the present study showed that gallic acid consistently reduced ros production in tnf-α/ifn-γ-treated hacat keratinocytes. gallic acid possesses comparable or even higher antioxidant activity than trolox, ascorbic acid, caffeic acid, sinapic acid, and vitamin e in scavenging dpph (badhani et al., 2015; karamac et al., 2005; nenadis et al., 2007; sánchez-moreno et al., 1998). the para-substituted oh group of gallic acid scavenges radicals through intramolecular hydrogen bonding. the efficient hydrogen donation ability of gallic acid is also due to the presence of an easily ionizable carboxylic group (al zahrani et al., 2020). keratinocytes play a critical role in the initiation and maintenance phases of skin inflammation. keratinocytes respond to multiple triggers and release cytokines to stimulate the activation and maturation of myeloid dendritic cells. once synergistically activated by proinflammatory cytokines, keratinocytes can produce chemokines to recruit leukocytes and other inflammatory mediators to amplify inflammation (zhou et al., 2022). gallic acid can eliminate and regulate inflammatory molecules (tsang et al., 2016; chao et al., 2020; fan et al., 2019). it has been reported that gallic acid can suppress the levels of cytokines il-1 and il-6, chemokines mpc-1 and ccl-7, cyclooxygenase-2, and matrix metalloproteinase-9 in rheumatoid arthritis fibroblastlike synovial cells (yoon et al., 2013). gallic acid also decreased il-4, il-13, and il-17 levels in nasal lavage fluid of a mouse model of allergic rhinitis (fan et al., 2019). interestingly, oral administration of gallic acid could reduce tnf-α, il-4, ifn-γ, and il-17 levels in the lymph nodes of a 4-dinitrochlorobenzene-induced mouse model of skin inflammation (hu and zhou, 2021). in the same model, gallic acid activated regulatory t cells to suppress the immune response via the production of il-10 and tgf-β (hu and zhou, 2021). although the topical effect of gallic acid on skin cells in an in vivo model is not yet known, this systemic effect of gallic acid may shed light on its potential implications in inflammatory skin diseases. the results herein showed that gallic acid did not affect the production of cytokine il-1β but reduced the release of chemokines il -8 and mcp-1 in tnf-α/ifn-γ-stimulated keratinocytes. the present findings were different from those in other tissues because gallic acid mainly modulates the action of chemokines but not cytokines (yoon et al., 2013; hu and zhou, 2021). the reason for the lack of an effect of gallic acid on il-1β release is unknown, but it cannot exclude the possibility that il-1β release in keratinocytes is relatively independent of ros. tnf-α/ifn-γ triggers the release of cytokines and chemokines in hacat cells by activating mapks, including erk1/2, jnk, and p38 mapk (sung et al., 2012; takada et al., 2004; kyriakis and avruch, 2001). these mapks are activated by mek phosphorylation. for instance, erk1/2 is activated by mek1/2. in addition bangladesh j pharmacol 2023; 18: 24-32 29 to the mapk signaling pathway, the nf-κb signaling pathway is also involved in inflammation by regulating the expression of genes, enzymes, and adhesion molecules (lai et al., 2017). nf-κb is activated by iκbα phosphorylation. it has been reported that gallic acid mitigated the immunoglobulin e-induced systemic or local inflammatory reactions by inhibiting the activation of nf-κb and p38 mapk-dependent pathways, resulting in the decreased expression of tnf-α and il-6 (dominque et al., 2020). gallic acid also reduced the release of intercellular adhesion molecules, chemokines, and inflammatory factors in ku812 cells via the inhibition of p38 mapk, jnk, and nf-κb (liu et al., 2013). similarly, these results showed that gallic acid reduced the total protein expression of nf-κb and inhibited the phosphorylation (an indicator of activation) of erk1/2, p38 mapk in tnf-α/ifn-γ-stimulated hacat keratinocytes. interestingly, gallic acid also inhibits akt phosphorylation in hacat keratinocytes. there is no direct evidence that the anti-inflammatory effect of gallic acid is due to the inhibition of the akt/ mtor-dependent pathway. however, consistent with the present findings, polyphenols extracted from mangoes, which contained mainly gallic acid, reduced the inflammatory response by akt/mtor-dependent mechanism, partly through up-regulation of mirna126 expression (kim et al., 2017). moreover, the inhibitory effect of gallic acid on the akt/mtor-depen-dent pathway has been reported in other cell types, such as bone marrow cells, in which the inhibition of the akt/ mtor pathway by gallic acid could suppress mitochondrial respiration and induce apoptosis (gu et al., 2018). the findings in this study will provide valuable information for the research and development of novel therapeutic agents for inflammatory skin diseases, such as atopic dermatitis. corticosteroids, commonly used in clinical practice, can cause skin atrophy if applied frequently and for prolonged periods. gallic acid has few adverse effects. interestingly, gallic acid could also lower the hydrocortisone concentration required to resolve the inflammatory response (liu et al., 2013; chan et al., 2015). gallic acid not only acts on keratinocytes but also on other immune cells in the skin. due to its low toxicity, gallic acid may be implicated in treating inflammatory skin diseases or at least may serve as a lead compound so that further modification of its chemical structure may result in a promising antiinflammatory agent (al zahrani et al., 2020). moreover, many plants have high amounts of gallic acid; therefore, the use of plant extracts to alleviate inflammatory skin problems is worth further investigation. conclusion gallic acid exerts antioxidant and anti-inflammatory effects in hacat keratinocytes, probably through the inhibition of mapk-, nf-κb-, and akt-dependent signaling pathways. financial support this research was supported by the seed fund for basic research of the university of hong kong (project no. 201910159154) conflict of interest authors declare no conflict of interest references al zahrani na, el-shishtawy rm, asiri am. recent developments of gallic acid derivatives and their hybrids in medicinal chemistry: a review. eur j med chem. 2020; 204: 112609. allen rg, tresini m. oxidative stress and gene regulation. free radic biol med. 2000; 28: 463-99. badhani b, sharma n, kakkar r. gallic acid: a versatile antioxidant with promising therapeutic and industrial applications. rsc adv. 2015; 5: 27540-57. baeuerle pa, henkel t. function and activation of nf-kappa b in the immune system. annu rev immunol. 1994; 12: 141– 79. bahuguna a, khan i, bajpai vk, kang sc. mtt assay to evaluate the cytotoxic potential of a drug. bangladesh j pharmacol. 2017; 12: 115-18. chabot-fletcher m, breton j, lee j, young p, griswold de. interleukin-8 production is regulated by protein kinase c in human keratinocytes. j invest dermatol. 1994; 103: 509–15. chan bc, li lf, hu sq, wat e, wong ec, zhang vx, lau cb, wong ck, hon kl, hui pc, leung pc. gallic acid is the major active component of cortex moutan in inhibiting immune maturation of human monocyte-derived dendritic cells. molecules 2015; 20: 16388-403. chao j, cheng hy, chang ml, huang ss, liao jw, cheng yc, peng wh, pao lh. gallic acid ameliorated impaired lipid homeostasis in a mouse model of high-fat diet-and streptozotocin-induced nafld and diabetes through improvement of beta-oxidation and ketogenesis. front pharmacol. 2020; 11: 606759. cheng y, li x, tse hf, rong j. gallic acid-l-leucine conjugate protects mice against lps-induced inflammation and sepsis via correcting proinflammatory lipid mediator profiles and oxidative stress. oxid med cell longev. 2018; 1081287. cho ej, yokozawa t, rhyu dy, kim sc, shibahara n, park jc. study on the inhibitory effects of korean medicinal plants and their main compounds on the 1,1-diphenyl-2-picrylhydrazyl radical. phytomedicine 2003; 10: 544-51. domíngue r, zhang l, rocchetti g, lucini l, pateiro m, 30 bangladesh j pharmacol 2023; 18: 24-32 munekata pes, lorenzo jm. elderberry (sambucus nigra l.) as potential source of antioxidants: characterization, optimization of extraction parameters and bioactive properties. food chem. 2020; 330: 127266. fan y, piao ch, hyeon e, jung sy, eom je, shin hs, song ch, chai oh. gallic acid alleviates nasal inflammation via activation of th1 and inhibition of th2 and th17 in a mouse model of allergic rhinitis. int immunopharmacol. 2019; 70: 512-19. gu r, zhang m, meng h, xu d, xie y. gallic acid targets acute myeloid leukemia via akt/mtor-dependent mitochondrial respiration inhibition. biomed pharmacother. 2018; 105: 49197. han ej, fernando ips, kim hs, lee ds, kim a, je jg, seo mj, jee yh, jeon yj, kim sy. (–)-loliolide isolated from sargassum horneri suppressed oxidative stress and inflammation by activating nrf2/ho-1 signaling in ifn-γ/tnf-αstimulated hacat keratinocytes. antioxidants 2021; 10: 856. hu g, zhou x. gallic acid ameliorates atopic dermatitis-like skin inflammation through immune regulation in a mouse model. clin cosmet investig dermatol. 2021; 14: 1675-83. kahkeshani n, farzaei f, fotouhi m, alavi ss, bahramsoltani r, naseri r, momtaz s, abbasabadi z, rahimi r, farzaei mh, bishayee a. pharmacological effects of gallic acid in health and diseases: a mechanistic review. iran j basic med sci. 2019: 22: 225-37. karamac m, kosiñska a, pegg rb. comparison of radicalscavenging activities for selected phenolic acids. polish j food nutr sci. 2005; 14: 165-70. kim h, banerjee n, barnes rc, pfent cm, talcott st, dashwood rh, mertens-talcott su. mango polyphenolics reduce inflammation in intestinal colitis-involvement of the mir126/pi3k/akt/mtor axis in vitro and in vivo. mol carcinog. 2017; 56: 197-207. kim mj, seong ar, yoo jy, jin ch, lee yh, kim yj, lee j, jun wj, yoon hg. gallic acid, a histone acetyltransferase inhibitor, suppresses β-amyloid neurotoxicity by inhibiting microglial-mediated neuroinflammation. mol nutr food res. 2011; 55: 1798-808. kyriakis jm, avruch j. mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. physiol rev. 2001; 81: 807-69. lai j, liu y, liu c, qi m, liu r, zhu x, zhou q, chen y, guo a, hu c. indirubin inhibits lps-induced inflammation via tlr4 abrogation mediated by the nf-kb and mapk signaling pathways. inflammation 2017; 40: 1-12. lim hs, jang y, moon bc, park g. nf-κb signaling contributes to the inhibitory effects of bombyx batryticatus on neuroinflammation caused by mptp toxicity. bangladesh j pharmacol. 2021; 16: 96-102. liu ky, hu s, chan bc, wat ec, lau cb, hon kl, fung kp, leung pc, hui pc, lam cw, wong ck. anti-inflammatory and anti-allergic activities of pentaherb formula, moutan cortex (danpi) and gallic acid. molecules 2013; 18: 2483-500. nenadis n, lazaridou o, tsimidou mz. use of reference compounds in antioxidant activity assessment. j agric food chem. 2007; 55: 5452-60. portugal m, barak v, ginsburg i, kohen r. interplay among oxidants, antioxidants, and cytokines in skin disorders: present status and future considerations. biomed pharmacother. 2007; 61: 412-22. ricciarelli r, tasinato a, clément s, ozer nk, boscoboinik d, azzi a. alpha-tocopherol specifically inactivates cellular protein kinase c alpha by changing its phosphorylation state. biochem j. 1998; 334: 243-49. sánchez-moreno c, larrauri ja, saura-calixto f. a procedure to measure the antiradical efficiency of polyphenols. j sci food agric. 1998; 76: 270-76. sardana k, sachdeva s. role of nutritional supplements in selected dermatological disorders: a review. j cosmet dermatol. 2022; 21: 85–98. serrano a, palacios c, roy g, cespón c, villar ml, nocito m, gonzález-porqué p. derivatives of gallic acid induce apoptosis in tumoral cell lines and inhibit lymphocyte proliferation. arch biochem biophys. 1998; 350: 49-54. su tr, lin jj, tsai cc, huang tk, yang zy, wu mo, zheng yq, su cc, wu yj. inhibition of melanogenesis by gallic acid: possible involvement of the pi3k/akt, mek/erk and wnt/β-catenin signaling pathways in b16f10 cells. int j mol sci. 2013; 14: 20443-58. sung yy, kim ys, kim hk. illicium verum extract inhibits tnf-alphaand ifn-gamma-induced expression of chemokines and cytokines in human keratinocytes. j ethnopharmacol. 2012; 144: 182-89. takada y, khuri fr, aggarwal bb. protein farnesyltransferase inhibitor (sch 66336) abolishes nf-kappab activation induced by various carcinogens and inflammatory stimuli leading to suppression of nf-kappab-regulated gene expression and up-regulation of apoptosis. j biol chem. 2004; 279: 26287-99. tanaka m, sato a, kishimoto y, mabashi-asazuma h, kondo k, iida k. gallic acid inhibits lipid accumulation via ampk pathway and suppresses apoptosis and macrophage-mediated inflammation in hepatocytes. nutrients 2020; 12: 1479. truzzi f, valerii mc, tibaldi c, zhang y, abduazizova v, spisni e, dinelli g. are supplements safe? effects of gallic and ferulic acids on in vitro cell models. nutrients 2020; 12: 1591. tsang ms, jiao d, chan bc, hon kl, leung pc, lau cb, wong ec, cheng l, chan ck, lam cw, wong ck. antiinflammatory activities of pentaherbs formula, berberine, gallic acid and chlorogenic acid in atopic dermatitis-like skin inflammation. molecules 2016; 21: 519. wang hq, smart rc. overexpression of protein kinase calpha in the epidermis of transgenic mice results in striking alterations in phorbol ester-induced inflammation and cox2, mip-2 and tnf-alpha expression but not tumor promotion. j cell sci. 1999; 112: 3497-506. yoon ch, chung sj, lee sw, park yb, lee sk, park mc. gallic acid, a natural polyphenolic acid, induces apoptosis and inhibits proinflammatory gene expressions in rheumatoid arthritis fibroblast-like synoviocytes. joint bone spine. 2013; 80: 274-79. yoshino m, haneda m, naruse m, htay hh, iwata s, bangladesh j pharmacol 2023; 18: 24-32 31 author info george pak-heng leung (principal contact) e-mail: gphleung@hku.hk tsubouchi r, murakami k. prooxidant action of gallic acid compounds: copper-dependent strand breaks and the formation of 8-hydroxy-2'-deoxyguanosine in dna. toxicol in vitro 2002; 16: 705-09. zhou x, chen y, cui l, shi y, guo c. advances in the pathogenesis of psoriasis: from keratinocyte perspective. cell death dis. 2022; 13: 81. 32 bangladesh j pharmacol 2023; 18: 24-32 mailto:gphleung@hku.hk