Bangladesh Journal of Pharmacology 

Research Article 

 

BJP 



 

Introduction 

Lung cancer accounts for 12.8% of cancer diagnoses and 
17.8% of cancer-related deaths globally (Subak et al., 
2020). Lung cancer is attributed to smoking in 94% of 
cases, while the remaining 6% is linked to various 
factors including age, race, gender, occupation, air 
pollution, genetics, and radiation (Alar and Şahin, 
2012). Two major types of lung cancers are recognized: 
small cell (SCLC) and non-small cell (NSCLC). 

While some standards have been established, various 
approaches and treatments are implemented for each 
type of cancer. As modern medicine has advanced, 
cancer patients are increasingly seeking alternative 
treatment methods rather than relying solely on 
chemotherapy, radiotherapy, and surgery (Baykara, 
2016). Despite being treated with surgical methods, 
chemotherapy, and radiotherapy, the survival rate for 
patients with this type of cancer remains quite low. 

Consequently, it is essential to investigate the genetic 
development of lung cancer and to explore new 
treatment methods (Zamani and Zamani, 2013). A new 
avenue in lung cancer therapy being investigated is the 
synergistic use of natural compounds and conventional 
anti-cancer drugs. 

One of the natural compounds evaluated for therapeu-
tic purposes is carvacrol. Carvacrol [2-methyl-5-(1-
methylethyl)-phenol] is an antioxidant monoterpene 
phenolic substance detected in the volatile oils from 
aromatic plants such as thymus, peppercorn and wild 
bergamot, which has a curative effect on various 
ailments (Arkali et al., 2021). The consumption of 
carvacrol is typically deemed to be safe. It is recognized 
by the Food and Drug Administration (FDA) as safe for 
use in food-grade substances (Ultee et al., 1999). 
Multiple studies have focused on the antibacterial 
(Rattanachaikunsopon and Phumkhachorn, 2010; 
Ravishankar et al., 2010; Rivas et al., 2010), antifungal 

Abstract 

The intention of this work was to analyze that carvacrol could enhance cancer
-inhibiting potency of cetuximab (monoclonal antibody) in lung cancer cells. 
The combination of cetuximab and carvacrol was found to co-operatively 
suppress cell proliferation by enhancing apoptosis and inducing cell cycle 
arrest in A-549 and H1299 cells. Furthermore, the combination therapy 
triggered cell death by inducing membrane disruption. The most effective 
combinations were IC₁₀ cetuximab + IC₁₀ carvacrol for A-549 and IC₂₀ cetuxi-
mab + IC₁₀ carvacrol for H1299 (CI = 2.0). LDH activity increased by 101% in 
A-549 and 239% in H1299 (p<0.05). Caspase-3 activity rose by 1.6-fold in A-
549 and 1.4-fold in H1299 (p<0.05). The combination decreased PCNA, topo-
isomerase II-alpha, and cyclins D1, D2, E, A, and B (p<0.05). Overall, the com-
bination of carvacrol and cetuximab appears to enhance anti-cancer efficacy 
and may significantly improve therapeutic outcomes in lung cancer cells.  

Article Info 

Received:       1 April 2025 
Accepted:      22 April 2025 
Available Online:   25 April 2025  

 

DOI: 10.3329/bjp.v20i1.80949 

 
 
 

 
 
 
 
 

 
 
 
 

 
 
 
 
 

 
 
 
 
 

Cite this article: 
Erdogan A, Koras RA. Carvacrol en-
hances the sensitıvity of cetuximab in 
lung cancer cells through inducing 
apoptosis and cell cycle arrest. 
Bangladesh J Pharmacol. 2025; 20: 22-
34. 

Carvacrol enhances the sensitıvity of cetuximab in lung cancer cells 

through inducing apoptosis and cell cycle arrest 

Ayse Erdogan and Rahime Aybike Koras 

Department of Genetic and Bioengineering, Faculty of Engineering, Alanya Alaaddin Keykubat University, Alanya, 
Antalya, Turkey. 

This work is licensed under a Creative Commons Attribution 4.0 License. You are free to copy, distribute and perform the work. You must attribute 

the work in the manner specified by the author or licensor.  

A Journal of the Bangladesh Pharmacological Society (BDPS) Bangladesh J Pharmacol 2025; 20: 22-34 
Journal homepage: www.bdpsjournal.org; www.banglajol.info  
Abstracted/indexed in Academic Search Complete, Agroforestry Abstracts, Asia Journals Online, Bangladesh Journals Online, Biological Abstracts, 
BIOSIS Previews, CAB Abstracts, Current Abstracts, Directory of Open Access Journals, EMBASE/Excerpta Medica, Global Health, Google Scholar, 
HINARI (WHO), International Pharmaceutical Abstracts, Open J-gate, Science Citation Index Expanded, SCOPUS and Social Sciences Citation Index 

ISSN: 1991-0088 



 

(Chami et al., 2010), antiviral (Pilau et al., 2011), 
immunomodulatory (Hashemipour et al., 2013), and 
antioxidant properties (Alma et al., 2003; Radonic and 
Milos, 2003) of carvacrol, highlighting its therapeutic 
benefits for a range of conditions (Arunasree, 2010; 
Jayakumar et al., 2012; Melo et al., 2014). Recent 
findings show that people who frequently consume 
fruits and vegetables abundant in antioxidants exhibit a 
reduced chance of developing ailments like 
cardiovascular disease and cancer (Yaman et al., 2018). 
It is recognized that polyphenol compounds, 
particularly noted for their strong properties that 
combat oxidative damage, fulfill a pivotal role in 
protecting individuals from diseases, and research in 
this area continues to grow daily (Njume et al., 2009). 
The oxidative stress-reducing properties of carvacrol 
have been established not only in a laboratory setting 
but also in preclinical models of inflammation of the 
pancreas, liver toxicity, and hepatocellular carcinoma. 
Several laboratory setting studies have indicated that 
carvacrol may possess strong cancer-suppressing 
activity. It can alleviate oxidative stress by boosting 
enzymatic protection against oxidative stress like 
superoxide dismutase, catalase, and glutathione, while 
also neutralizing free radicals such as superoxide and 
hydrogen peroxide (Lee et al., 2020). It was found that 
the testicular cells and liver DNA of rats treated with 
carvacrol water were more resistant to hydrogen 
peroxide oxidation compared to the control group 
(Boduroglu, 2022). In a trial using MDA-MB 231 cell 
line, obtained from breast carcinoma, carvacrol was 
found to exhibit anti-carcinogenic effects (Arunasree, 
2010). 

Cetuximab (IMC-C225, Erbitux; ImClone Systems Inc., 
New York) is a chimeric human-murine IgG1 
monoclonal antibody that targets outer domain of 
epidermal growth factor receptor (EGFR) (Gill et al., 
1984). Cetuximab has a binding affinity to EGFR that is 
ten times greater than that of endogenous ligands like 
EGF and Transforming Growth Factor-α (TGF-α). This 
binding inhibits receptor tyrosine kinase activity and 
the associated MAPK, PI3K/Akt, and Jak/Stat 
pathways (Herbst and Shin, 2002). When it binds to 
EGFR, various pro-apoptotic pathways are activated 
within the cell (Cheng et al., 2013). Laboratory studies 
have illustrated that cetuximab exhibits cytotoxic and 
antiproliferative effects. Moreover, cetuximab has been 
evidenced to suppress tumor progression in engrafted 
tumor models (Wu et al., 1995; Baselga, 2001; 
Overholser et al., 2000). Furthermore, studies in mice 
have indicated that cetuximab can improve the tumor-
suppressing effects of various chemotherapeutic agents 
and radiotherapy (Buchsbaum et al., 2002; Bruns et al., 
2000). They reported that combination therapy with 5-
fluorouracil led to greater regression of tumor growth 
in vivo (Overholser et al., 2000). Following the 

completion of chemotherapy, cetuximab administration 

is typically continued until disease progression or 
unacceptable toxicity occurs. As with other EGFR-
targeted therapies, the primary adverse effects include 
acne-like skin rash and diarrhea. Recently, numerous 
researchers have revealed outcomes in both laboratory 
conditions and living organisms cancer scientific 
inquiries that combining chemotherapeutic agents with 
herbal compounds can yield additive or synergistic anti
-cancer effects. Given the harmlessness and tumor-
suppressing properties of botanical ingredients like 
carvacrol, such phenolic monoterpene agent may offer a 
harmless and low-cost therapeutic approach for lung 
cancer patients by mitigating the adverse effects of 
chemotherapeutics such as cetuximab. 

The intention of this study was to investigate the cell-
destructive, membrane-impairing, antioxidant, 
apoptotic repercussions and mechanisms of 
intervention of cetuximab and carvacrol on lung 
transformed cells (A-549 and H1299) in vitro. As a result 

of this study, the aim was to propose a new alternative 
treatment strategy for cancer patients by suggesting 
that lower doses of cetuximab could be used for those 
experiencing adverse effects from the drug.  

           

Materials and Methods 

Chemical agents and pharmaceutical 

Cetuximab (referred to by several names, including 
C225-03, IMC-C225, C225, and ch225) was supplied by 
Merck Serono (USA). Drugs were immediately diluted 
before being added to the growth substrate. Carvacrol 
was supplied by Sigma Chemical Co. (282197, Spain) 
and had 98% purity. Colorimetric caspase-3 activity 
assay kit was kindly provided by Elabscience 
Biotechnology Co., Ltd (USA). Activity of lactate 
dehydrogenase evaluation kit (MAK066) was supplied 
by Sigma-Aldrich (USA). RNeasy mini kit, utilized for 
RNA isolation with high purity from cells, was 
provided by Qiagen (USA). Titan one tube RT-PCR 
system kit, used for RT-PCR, was supplied by Roche 
Applied Science (Germany). 3-(4,5-Dimethylthiazol-2-
yl)-2,5-diphenyltetrazolium bromide (MTT) was pur-
chased from Gibco (USA) 

Cells used in the study 

H1299 and A-549 used in the study were commercially 

obtained from the American Type Culture Collection. 

Both cells used in the studies are members of the cell 

lines from human non-small-cell lung carcinoma 

(NSCLC). All tested cellular models reproduced under 

suitable conditions. Cells were propagated in Roswell 

Park Memorial Institute 1640 (RPMI 1640) medium and 

other medium components in appropriate proportions. 

After the cells reach sufficient density (more than 75%) 

 Bangladesh J Pharmacol 2025; 20: 22-34                                                                23 



 

in the culture vessel, experimental groups were created 

and then monoclonal antibody (cetuximab) (<IC50), and 

natural monoterpenic phenol (carvacrol) (<IC50), were 

introduced to the cell cultures for a duration of 48 hour. 

When comparing A-549 cells and H1299 cells in terms 

of p53 gene, it is known that A-549 cells have an intact 

p53 gene, while this situation is the opposite in H1299 

cells.  

Cytotoxicity assay 

H1299 and A-549 cells (1 x 104) were plated per well 
(200 μL) in a medium. Cell viability was determined 
after cetuximab and carvacrol were exposed to the cells 
over a 48-hour period. The metabolic activity of cells, 
indicative of living cell count, was established at 48 
hour using MTT assay. The working principle of the 
MTT test is dependent on the conversion of MTT into 
insoluble formazan by viable cells. After the test 
reagents were dispensed into the medium and 
processed for an incubation period of 2 hours at 37°C 
degrees, the reaction was terminated through 
incorporating dimethyl sulfoxide (DMSO) and 
incubation was carried out for another 1 hour. 
Afterwards, cytotoxicity was determined by taking 
measurements at 490 nm (Mosmann, 1983). Eight wells 
were replicated for each concentration. IC50 values (the 
concentrations that lead to 50% growth inhibition) and 
lower IC50 concentrations (<IC50) were calculated 
separately for cetuximab and carvacrol. The 
combination treatments were then carried out using 
these calculated lower IC50 values. Ultimately, the most 
therapeutically effective concentration pairs were 

identified based on cell viability results after 
administering cetuximab (<IC50) and carvacrol (<IC50) 
collectively. The combination index (CI) values were 
determined to investigate the nature of the 
interaction—additive, synergistic, or antagonistic—
between cetuximab and carvacrol in cell-based assays. 
The formula used to calculate the CI is given below: 

CI =(Ea + b)/(Ea + Eb - Ea × Eb) (Huang et al., 2014) 

where, Ea + b indicates the extent of suppression observed 
when both carvacrol and cetuximab are administered together, 
Ea refers to the inhibition rate by carvacrol alone, and Eb 
represents the inhibition rate by cetuximab alone. 

The effect of drug co-administration was classified as 
follows: a) additive (+) for CI values between 0.85 and 
1.15; b) synergistic (++) for CI values between 1.15 and 
2.0; c) subtractive (-) for CI values between 0.85 and 
0.55; and d) antagonistic (—) for CI values under 0.55. 
Control groups consisted of cells that were not exposed 
to any treatment and those treated with 0.1%DMSO. 
Data were collected from eight independent repetitions.  

Lactate dehydrogenase (LDH) enzyme activity 

LDH activity was measured after treating A-549 and 
H1299 cells with cetuximab alone (<IC50) and a 
combination of carvacrol (<IC50) concentrations, which 
exhibited the strongest cytotoxic effects, for 48 hours. 
Thus, an attempt was made to reveal the destructive 
effect on the membrane by examining the fluctuations 
in LDH activity. LDH activity was measured using a 
commercially available kit as outlined by the 
application operating procedures. In this test, LDH 
facilitates the conversion of NAD to NADH, which is 

Box 1: Glutathione peroxidase activity 

Principle 

Glutathione peroxidase (GPx) activity is measured spectro-
photometrically by coupling the enzymatic reduction of tert-
butyl hydroperoxide with the oxidation of reduced 
glutathione (GSH). The oxidized glutathione (GSSG) is then 
regenerated to GSH by glutathione reductase in the presence 
of NADPH. The rate of decrease in absorbance at 340 nm, due 
to the oxidation of NADPH to NADP+, is directly proportional 
to the GPx activity in the sample.   

Requirements 

A-549 cell; Bovine serum albumin (BSA); Bradford reagent; 
Carvacrol; Centrifuge; Cetuximab; Glutathione reductase; 
H1299 cell; NADPH; Phosphate buffered saline (PBS); 
Reduced glutathione; Tert-butyl hydroperoxide; 
Ultrasonicator; UV-Vis spectrophotometer  

Procedure 

Step 1: A-549 and H1299 cells were cultured and treated for 48 
hours with cetuximab alone and also together with carvacrol 
(using the most effective combination concentration based on 
prior cytotoxicity assay). 

Step 2: Following treatment, cells were harvested and 
centrifuged at 1,500 x g for 10 min at 4°C.  

Step 3: The pellet was resuspended in ice-cold PBS and lysed 
via ultrasonication on ice (3-4 pulses of 10 sec each, with 30 sec 
intervals).  

Step 4: The lysate was centrifuged at 12,000 x g for 15 min at 4°

C to remove cell debris. 

Step 5: The clear supernatant was collected and used for both 
GPx activity assay and total protein quantification.  

Calculation 

The decrease in absorbance at 340 nm was monitored for 5 
min at 25°C using a UV-Vis spectrophotometer. GPx activity 
was calculated based on the rate of NADPH consumption. 
Total protein concentration of the lysates was determined 
using the Bradford method, with BSA as the standard. All 
samples were analyzed in triplicate. One unit of GPx activity 
is defined as the amount of enzyme that catalyzes the 
oxidation of 1 µmol of NADPH per min under assay 
conditions. 

References 

Bradford, 1976; Flohe and Gunzler, 1984 

24 Bangladesh J Pharmacol 2025; 20: 22-34                                                                 



 

then measured colorimetrically at 450 nm. The formula 
used to calculate LDH activity is given below: 

LDH activity = The amount of NADH that occurs 
between the first and last measurement (nmol) × 
Sample dilution factor/Reaction time × Sample volume 
(mL) 

Caspase-3 activity 

By examining the changes in caspase-3 activity, a 
crucial enzyme in the apoptosis process,  after 48 hours 
of application of cetuximab alone and also in 
combination with carvacrol (at the concentration 
combination that showed the highest cytotoxic effect), 
the apoptotic effects of both alone and combined 
application on cells were tried to be explained. 
Apoptotic enzyme performance was measured through 
a commercially available colorimetric based caspase-3 
activity detection kit (Elabscience), following the 
provided protocol. The specimens were analyzed at 405 
nm with the aid of a microplate reader. The tests were 
conducted in three repetitions. The results are 
expressed as units per milligram of protein. 

RNA isolation and gene transcriptional activity  

Reverse transcription-based polymerase chain reaction 
(RT-PCR) method was implemented to reveal whether 
there was a change in the transcriptional levels of 
expression of many genes– proliferating cell nuclear 
antigen (PCNA) and various cyclins (D1, E, A, D2, B), 
topoisomerase II-alpha, Bax, and Bcl-2) in H1299 and A-
549 cells. 

RNA expression was analyzed after alone or in 
combination with carvacrol (at the most effective 
cytotoxic concentration) in H1299 and A-549 cells. Gene 
expression analysis was carried out in three separate 
repetitions. Total RNA was isolated after 48 hours of 
treatment according to the recommendation of the 
commercially available RNeasy mini kit supplied by 
Qiagen. After RNA harvesting, cDNA synthesis was 
undertaken using the specified steps in Roche Applied 
Science's Titan one tube RT-PCR system. 

A total of 30 cycles of RT-PCR were completed. In the 
RT-PCR protocol, denaturation step at 94°C for 1 min; 
annealing conducted for 1 min at temperatures between 
52°C and 60°C (these temperature ranges were used 
according to genes) were performed for each gene. 2 
min elongation was performed at 72°C, followed by a 
final 90 sec elongation at the same temperature. 

Bcl-2 gene was amplified using Touchdown PCR, 
starting with an annealing temperature of 73°C, which 
was gradually decreased by 1°C per cycle for the first 10 
cycles, and then held at 63°C for the remaining 25 
repetitions. Water was used as the control group. All 
RT-PCR experiments were conducted in three 
replicates. Glyceraldehyde-3-phosphate dehydrogenase 
(GAPDH) was applied as the stable reference gene for 
expression normalization. A precise explanation of the 
genes and primers utilized in the current investigation 
can be established in Table I. 

All amplified DNA fragments were interpreted using 
2.5% agar gel electrophoresis prepared using TBE 
buffer (containing ethidium bromide). The gel 
underwent electrophoresis for 30 min under a constant 
voltage of 120 V, utilizing a 100 bp DNA ladder used as 
molecular weight references. Band density was 
analyzed using Adobe Photoshop CS4. The intensity of 
PCR bands was evaluated by normalizing to the 
intensity of the housekeeping gene. All PCR samples 
were examined in relation to the control band 
intensities and the outcomes were given as percentage 
control (Bijwaard et al., 2001; Huang et al., 2003). 

Statistical analysis 

Replicate consequences were aggregated and displayed 
as  mean  ±  SEM.  Variance  analysis  (ANOVA)  was 
accomplished  for  quantitative  assessment.  One-way 
ANOVA was conducted to assess if marked differences 
were identified between the central tendencies of three 
or more independent groups with respect to a certain 
variable.  Tukey's  test  was  employed  for  pairwise 
comparisons. Significant quantitative differences was 
recorded at p<0.05. Data analysis was performed with 

Table I 

Sequence of utilized primers   

Gene F-Primer Sequence (5’-3’) R-Primer Sequence (5’-3’) 

PCNA CGCGCAGAGGGTTGGTAGTT AAGCCTTCGGAGCGCAGAGT 

Bcl-2 TGCACCTGACGCCCT TCAC AGACAGCCAGGAGAAATCAAACAG 

Bax ACCAAGAAGCTGAGCGAGTGTC ACAAAGATGGTCACGGTCTGCC 

GAPDH TTCATTGACCTCAACTACAT GAGGGGCCATCCACAGTCTT 

Cyclin  D1 CCG TCC ATG CGG AAG ATC ATG GCC AGC GGG AAG AC 

Cyclin  D2 TACTTCAAGTGCGTGCAGAAGGAC TCCCACACTTCCAGTTGCGATCAT 

Topoisomerase II-alpha CAGATCATGGAAAATGCTGA GCAGCATCATCTTCAGGACC 

Cyclin  A TGGAGAGTGTATGTTTGTTGTGGTG AAACTTAACAATACAACTAAACTAC 

Cyclin  B GACATGGAAGATGAAGATCCTAA TCAGCAGTCACCTCACCAATCT 

Cyclin  E CAGCCAAAAATGCGAGCAATTC TTCATCTCCTGAACAAGCTCCATC 

 Bangladesh J Pharmacol 2025; 20: 22-34                                                                25 

https://www.google.com.tr/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwii0orDs6nVAhWMfFAKHY1yAmAQFggmMAA&url=https%3A%2F%2Fen.wikipedia.org%2Fwiki%2FCyclin_D1&usg=AFQjCNHWAZjwZP0TK4WcD_mjsGBdEMwu2Q
https://www.google.com.tr/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwii0orDs6nVAhWMfFAKHY1yAmAQFggmMAA&url=https%3A%2F%2Fen.wikipedia.org%2Fwiki%2FCyclin_D1&usg=AFQjCNHWAZjwZP0TK4WcD_mjsGBdEMwu2Q
https://www.google.com.tr/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwii0orDs6nVAhWMfFAKHY1yAmAQFggmMAA&url=https%3A%2F%2Fen.wikipedia.org%2Fwiki%2FCyclin_D1&usg=AFQjCNHWAZjwZP0TK4WcD_mjsGBdEMwu2Q
https://www.google.com.tr/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwii0orDs6nVAhWMfFAKHY1yAmAQFggmMAA&url=https%3A%2F%2Fen.wikipedia.org%2Fwiki%2FCyclin_D1&usg=AFQjCNHWAZjwZP0TK4WcD_mjsGBdEMwu2Q
https://www.google.com.tr/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0ahUKEwii0orDs6nVAhWMfFAKHY1yAmAQFggmMAA&url=https%3A%2F%2Fen.wikipedia.org%2Fwiki%2FCyclin_D1&usg=AFQjCNHWAZjwZP0TK4WcD_mjsGBdEMwu2Q


 

the aid of Minitab software, version 13.0.       
 

Results 

Influence on cell proliferation 

Both A-549 and H1299 cells exhibited a concentration-
dependent response to treatment with cetuximab and 
carvacrol, with changes in cell viability observed. After 
treating A-549 cells with different concentrations of 
cetuximab for 48 hours, IC10, IC20, IC30, IC40, and IC50 
values were determined to be 174, 472, 770, 1067, and 
1365 µg/mL, respectively. Similarly, for H1299 cells 
exposed to varying cetuximab concentrations for 48 
hours, IC10, IC20, IC30, IC40, and IC50 values were 
determined to be 102, 369, 636, 904, and 1171 µg/mL, 
respectively (data not shown).  

Upon treatment of A-549 cells with a range of 
concentrations of carvacrol across 48 hours timeframe, 

IC10, IC20, IC30, IC40, and IC50 values were found to be 11, 
21, 31, 41, and 51 µg/mL, respectively. Similarly, for 
H1299 cells treated with varying concentrations of 
carvacrol for 48 hour, IC10, IC20, IC30, IC40, and IC50 
values were determined to be 8 µg/mL, 17 µg/mL, 26 
µg/mL, 35 µg/mL, and 49 µg/mL, respectively (data 
not shown). 

This investigation was designed to determine whether 
lower concentrations of carvacrol, below its IC50 value, 
could enhance the cytotoxic effects of cetuximab (<IC50) 
in A-549 and H1299 cells. To identify the most effective 
cytotoxic response, combinations of cetuximab and 
carvacrol at concentrations below their IC₅₀ values were 
administered and evaluated (Figure 1A-B). For A-549 
cells, the most effective combination was found to be 
IC10 cetuximab with IC10 carvacrol (Figure 1A). To 
evaluate the interaction between cetuximab and 
carvacrol, CI was computed, which indicated whether 
the dual treatment had combined, synergistic, or 

100 

 

 

80 

 

 

60 

 

 

40 

 

20 

 

0 

%
C

e
ll 

v
ia

b
ili

ty
 

100 

 

 

80 

 

 

60 

 

 

40 

 

20 

 

0 

%
C

e
ll 

v
ia

b
ili

ty
 

Cetuximab (IC10) Cetuximab (IC20) Cetuximab (IC30) Cetuximab (IC40) 

Carvacrol (IC10) 

Carvacrol (IC20) 

Carvacrol (IC30) 

Carvacrol (IC40) 

Control 

A 

B 

A-549 cell lines  

H1299 cell lines  

Figure 1: Cytotoxic effects of cetuximab (IC10, IC20, IC30, and IC40)  combined with carvacrol at IC10, IC20, IC30 and IC40 were 
assessed over 48 hours period on A-549 (A) and H1299 (B) cells. Results are expressed as a viability ratio relative to the control 
group, which included untreated cells receiving only the medium. Values represent the mean of three independent trials, each 
comprising three replicates, ± SEM 

a 

a 

a 

a 

a 

a 

a 

a 

a 

a 

a 

a 
a 

a 

a 
a 

a 

a 

a 

a 
a 

a 

a 

a 

a 

a 
a 

a a 

a 
a a 

26 Bangladesh J Pharmacol 2025; 20: 22-34                                                                 



 

opposing outcomes. CI value of 2 confirmed the 
synergistic effect of the IC10 cetuximab and IC10 
carvacrol combination in A-549 cells. In H1299 cells, the 
most effective combination was IC20 cetuximab with 
IC10 carvacrol (Figure 1B), and CI value of 2 again 
confirmed the synergistic effect of this combination. 
Statistical analysis showed that the impact of different 
cell line types and the influence of combined 
concentrations on cytotoxicity was significant (p<0.05). 
The cellular toxicity varied significantly between every 
cell line (p<0.05). Overall, the pairing of cetuximab and 
carvacrol enhanced the cytotoxic effects in both H1299 
and A-549 cells relative to cetuximab intervention in 
isolation. 

Cell-killing effect   

After 48 hours of exposure, changes in LDH activity 
were assessed in H1299 cells treated with cetuximab at 
IC20 concentration, both alone and in combination with 
IC10 carvacrol, which produced the strongest cytotoxic 
response. A significant elevation in LDH activity was 
observed in treated cells relative to the vehicle control 
group. Specifically, combination of cetuximab and 
carvacrol led to a 239% elevated in LDH activity in 
H1299 cells relative to the unexposed group, which 
consisted solely of growth medium excluding any 
treatment (Table II). 

LDH enzyme activity was assessed following the 
treatment of A-549 cells with IC10 cetuximab alone and 
in combination with IC10 carvacrol, which were found 
to induce the strongest cytotoxic effects, over a 48 h 
period (Table II). Following this incubation, a notable 
increase in LDH release was observed, with levels 
rising by approximately 25% for cetuximab alone and 
by 101% for the combination treatment, in relation to 
the baseline (p<0.05). When evaluating the results in 
relation to the control groups, both A-549 and H1299 
cells showed substantial discrepancy (p<0.05) in LDH 
enzymatic activity following treatment with cetuximab 

alone or the cetuximab-carvacrol combination. 
Additionally, the combination treatment led to a greater 
elevation in LDH levels than cetuximab alone in both 
cell lines, relative to their respective control groups. 

Effects of cetuximab and carvacrol on oxidative stress  

Following 48 hours of treatment with cetuximab alone 
or together with carvacrol, there was a significant 
increase in the antioxidant enzyme glutathione 
peroxidase (GPx) levels in both A-549 and H1299 cells 
(Table II). Cells treated with either cetuximab alone or 
the cetuximab-carvacrol combination showed a marked 
elevation in GPx and catalase activity (p<0.05). In 
particular, when H1299 were subjected to the 
combination treatment for 48 hours, GPx activity 
increased approximately multiplied by 1.6 in contrast to 
the baseline , which consisted solely of the cellular 
growth medium lacking the evaluated compounds. 
without the test compounds. This rise was statistically 
significant (p<0.05). The results suggest that both 
cetuximab alone and in combination with carvacrol 
induced oxidative stress in A-549 and H1299 cells, 
likely via the induction of reactive oxygen species. 

Impact on caspase-3 enzyme activity 

The ability of cetuximab, both alone and in combination 
with carvacrol, to trigger apoptosis was evaluated in A-
549 and H1299 cells following 48 hours of treatment. In 
A-549 cells, caspase-3 activity increased by 1.6-fold 
following treatment with the combination of IC10 
cetuximab and IC10 carvacrol. In H1299 cells, caspase-3 
activity was elevated by approximately 1.4-fold after 
exposure to the combination of IC20 cetuximab and IC10 
carvacrol, in relation to the control group (Table II). 
Apoptosis-inducing effect induced by cetuximab-
carvacrol combination was found to be 1.2 times 
stronger in A-549 cells than in H1299 cells, with A-549 
cells showing the most pronounced increase in caspase-
3 activity following treatment. 

B

Table II 

Effects of carvacrol with cetuximab on different parameters in two cell lines   

Concentrations LDH activity  
(mU/mL) 

Caspase-3 activity 
(µmol/mg protein) 

GPx activity 
(U/mg protein) 

A-549 cell lines    

Cetuximab (IC10) 144.7 ± 0.4a 17.5 ± 0.3a 2.2 ± 0.3a 

Cetuximab (IC10) + Carvacrol (IC10) 233.3 ± 0.4a 24.9 ± 0.3a 2.5 ± 1.0a 

Control 116.0 ± 0.1a 15.2 ± 0.4a 1.1 ± 0.3a 

H1299 cell lines    

Cetuximab (IC20) 272.7 ± 0.7a 17.0 ± 0.4a 2.4 ± 0.5a 

Cetuximab (IC20) + Carvacrol (IC10) 345.5 ± 0.7a 21.0 ± 0.4a 2.9 ± 0.2a 

Control 102.0 ± 0.6a   15.5 ± 0.2a 1.8 ± 0.9a 

Data are mean ± SEM; ap means <0.05 (statistically significant) of carvacrol with/without cetuximab in comparison to control as determined 

by ANOVA with Tukey’s test. LDH refers to lactate dehydrogenase, and GPx represents glutathione peroxidase. Each value is the mean of three 

repetitions for the activities of LDH, caspase-3, and GPx 

 Bangladesh J Pharmacol 2025; 20: 22-34                                                                27 



 

All applications, including single and combined appli-
cations, have membrane damaging, oxidative stress 
inducing effects and apoptosis inducing potentials 
showed significant differences when compared to the 
baseline groups (which were administered only using 
the culturing solution and not exposed to any test 
compounds) in all cell lines (p<0.05). 

Effects of on cell cycle and apoptotic mechanism 

RT-PCR analysis was carried out using designated 
primers for every target gene, using glyceraldehyde 3-
phosphate dehydrogenase (GAPDH) as an internal 
normalization control. Cellular proliferation marker 
PCNA is an essential protein that plays a vital function 
in DNA replication and repair mechanisms, functioning 
as a cofactor for DNA polymerase. It is vital for 
regulating the cell cycle, especially during the shift in 
the cell cycle from the G1 phase to the S phase. Due to 
its increased expression in proliferating cells, PCNA is 
commonly used as a marker for cell division. The 

expression of PCNA mRNA was analyzed to assess the 
antiproliferative influence of cetuximab by itself and in 
conjunction with carvacrol in A-549 and H1299 cells. 
The dual intervention was observed to be enhanced 
efficient in lowering levels of PCNA compared to 
cetuximab by itself in all cell types. The most notable 
decrease in PCNA expression levels was observed in 
H1299 human lung carcinoma cells, where expression 
reduced by 20% with cetuximab by itself and 44% with 
the dual therapy, when contrasted with the unexposed 
group (Figure 2B). 

Topoisomerase II-alpha is a critical enzyme that serves 
a crucial influence in DNA replication, transcription, 
and chromosome segregation. It modulates DNA 
topology by introducing or removing supercoils in the 
DNA structure, which is essential for processes such as 
cell division, where it helps untangle DNA strands. The 
most significant decrease in expression of 
topoisomerase II-alpha transcript was observed in 
human lung carcinoma A-549 cells following the two 

A 

B 

 

200 

 

 

160 

 

 

120 

 

 

80 

 
40 

 

0 

m
R

N
A

 e
x
p
re

s
s
io

n
 

%
C

o
n
tr

o
l 

160 

 

 

120 

 

 

80 

 

 

40 

 
0 

m
R

N
A

 e
x
p
re

s
s
io

n
 

%
C

o
n
tr

o
l 

Cetuximab (IC10) 

Cetuximab (IC10) + Carvacrol (IC10)  

Control 

Cetuximab (IC20) 

Cetuximab (IC20) + Carvacrol (IC10)  

Control 

PCNA Cyclin D1 Bax Cyclin E Cyclin B Cyclin A Cyclin D2 Bcl-2 
Topoisomerase 

II-alpha 

a 

a 

 

a 

a 

a 

 

a 

 

a 

a 

a 

 

a 

a 

 

 
 

a 

 

a 

 

a 

a 

 
   

 
  

     

 

 

a a 

 

 

 

 

 

 

 

 
 

 

Figure 2: Effects of cetuximab, both alone and in combination with carvacrol, on mRNA expression of PCNA, topoisomerase II-
alpha, cyclin D1, cyclin D2, cyclin E, cyclin A, cyclin B, Bax, and Bcl-2 were assessed in A-549 (A) and H1299 (B) cells. Data are 
mean ± SEM  

A-549 cell lines  

H1299 cell lines  

a 

a 

 

a 

a 

a 

 

a 

 

a 

a 

 
 

a a 

 

 

 

a 

a 

 

a 

a 

a 
 

 

a 

a 

 a 

 

 

 

 

a 

a 

  

28 Bangladesh J Pharmacol 2025; 20: 22-34                                                                 



 

conditions cetuximab by itself and combination 
treatments. Cetuximab alone intervention led to 38% 
decrease in topoisomerase II-alpha gene transcript 
expression in A-549 cells compared to control, whereas 
the combination intervention led to more substantial 
75% decrease (Figure 2A). 

Cyclins D1 and D2 are key regulators of the cellular 
proliferation cycle, especially during first growth phase. 
The influence of cetuximab, alone and in combination 
with carvacrol, on the G1 phase transition of the cell 
cycle was evaluated by quantifying changes in cyclin-
related RNA transcript levels. In adenocarcinomic 
human alveolar basal epithelial A-549 cells treated with 
cetuximab individually, cyclin D1 transcript level 
diminished by 30% as opposed to the experimental 
baseline group. On the other hand, at the time that 
cetuximab was combined with carvacrol, the most 
significant decrease in cyclin D1 was observed in H1299 
cells, where expression dropped by 62%. For cyclin D2, 
the greatest reduction was seen in H1299 cells, with a 
32% decrease following cetuximab alone, and a 49% 
reduction in A-549 cells after the combined treatment. 
Overall, the combination treatment was more effective 
than cetuximab alone in lowering the levels of both 
cyclin D1 and D2 in both cell lines (Figure 2A-B). 

Cyclin E is a key protein involved in modulating the 
cell proliferation cycle, especially throughout the shift 
beginning with G1 step to the S step. In human lung 
adenocarcinoma cells (A-549), cetuximab 
administration in isolation led to a 35% reduction in 
cyclin E transcription level in contrast to the 
experimental baseline, whereas the combination 
treatment contributed to extended substantial 64% 
diminution in cyclin E transcription level. The most 
significant decrease in cyclin E levels was seen in A-549 
cells for both treatments (Figure 2A). Furthermore, 
cetuximab in conjunction with carvacrol proved to be 
extended impactful as opposed to cetuximab by itself in 
lowering the transcription levels of cyclins D1, D2, and 
E-proteins that regulate different stages of the G1 
phase. These findings suggest that the combined 
treatment has a more potent effect on the initial growth 
phase of the cell proliferation cycle than cetuximab 
alone. 

In H1299 cells treated with cetuximab alone, cyclin A 
transcription level diminished by 13% as opposed to the 
baseline. In A-549, cetuximab alone resulted in 20% 
reduction in cyclin A expression relative to the control 
group (Figure 2A-B). The most notable decrease in 
cyclin A levels, however, was detected in A-549 cells 
following both cetuximab on its own and combination 
treatments. 

In A-549 cells, cetuximab treatment on its own caused 
to 30% decrease in cyclin B transcription level as 
opposed to the baseline. However, in the event that 
cetuximab was combined with carvacrol, there was a 

more pronounced 60% decline in cyclin B transcription 
level in contrast to the control group (Figure 2A). It has 
been shown that the combination application is more 
effective in arresting second growth phase (G2) and 
mitotic (M) phases of the cell proliferation cycle in both 
cells than the application alone. 

In both H1299 and A-549 cells, treatment with 
cetuximab alone and in combination with carvacrol 
resulted in a rise in Bax mRNA levels compared to 
control (Figure 2A-B). In H1299 cells, cetuximab alone 
induced 64% increase in Bax mRNA expression, while 
the combination treatment with cetuximab and 
carvacrol caused 88% increase (Figure 2B). Regarding 
Bcl-2, cetuximab alone led to 20% decrease in its mRNA 
expression in H1299 cells, whereas the combination 
treatment resulted in 34% reduction (Figure 2B). The 
combination therapy proved to be more effective than 
cetuximab on its own in  lowering Bcl-2 expression in 
both cell lines. Consequently, both treatments boosted 
correlation between Bax and Bcl-2 in H1299 along with 
A-549 cells, with the combined treatment showing a 
stronger effect than cetuximab alone in enhancing this 
ratio.    

 

Discussion 

The findings of this study demonstrate that the 
combination of cetuximab and carvacrol exerts a more 
pronounced anticancer effect than cetuximab alone in 
lung cancer cell lines A-549 and H1299. MTT assays 
confirmed a concentration-dependent inhibition of cell 
proliferation, with the most effective combinations 
being IC₁₀ cetuximab + IC₁₀ carvacrol for A-549 and IC₂₀ 
cetuximab + IC₁₀ carvacrol for H1299 (CI = 2.0), 
indicating strong synergistic interactions. LDH assays 
showed significantly elevated enzyme release, 
particularly 101.0% in A-549 and 239.0% in H1299 
(p<0.05), suggesting increased membrane damage. The 
combination therapy also significantly increased 
caspase-3 activity by 1.6-fold in A-549 and 1.4-fold in 
H1299 (p<0.05), highlighting enhanced apoptosis. RT-
PCR analysis revealed downregulation of cell cycle 
regulatory genes including PCNA, topoisomerase II-α, 
and cyclins D1, D2, E, A, and B, with the combined 
treatment producing stronger effects (p<0.05). 
Additionally, the Bax/Bcl-2 ratio was markedly 
increased, further supporting apoptosis induction. 
These results suggest that carvacrol significantly 
enhances the cytotoxic, oxidative, and apoptotic effects 
of cetuximab. 

Epidermal growth factor receptor (EGFR) is known to 
be overexpressed across various cancer types, Such as 
head and neck squamous cell carcinoma 
(Weichselbaum et al., 1989) (HNSCC), non-small cell 
lung cancer (Veale et al., 1987) (NSCLC), as well as 
cancers of the colon, breast (Lo et al., 2006), pancreas 

 Bangladesh J Pharmacol 2025; 20: 22-34                                                                29 



 

(Yasui et al., 1988), and brain (Libermann et al., 1984). 
Dysregulated EGFR signaling in these malignancies is 
associated with poor patient prognosis. Due to the close 
relationship between EGFR and cancer, treatments that 
target this structure are being developed and used 
today (Pearson et al., 2018). Cetuximab is a chimeric 
monoclonal antibody, combining both human and 
mouse components, designed to target EGFR. It 
attaches to the extracellular region of EGFR, facilitating 
receptor internalization and thereby reducing EGFR 
expression (Prewett et al., 1996). Cetuximab has been 
proven to constrain the enlargement of multiple 
cancerous human cell lines that exhibit increased EGFR 
expression (Matar et al., 2004; Huether et al., 2005). 
Received FDA approval in 2004 for the intervention of 
head and neck cancers (Galizia et al., 2007), cetuximab 
has also shown promise in treating non-small cell lung 
cancer (NSCLC) (Pirker et al., 2009; Douillard et al., 
2014). However, its effectiveness as a monotherapy is 
limited, with response rates falling below 15% in 
HNSCC patients (Petrelli et al., 2014). Therefore, 
evaluating the antitumor impacts of cetuximab in 
combination therapies has become crucial. Enhancing 
its anticancer potential and expanding its clinical 
applications remain key challenges. Consequently, 
combination therapies are being explored to improve 
efficacy, reduce side effects, and overcome resistance, 
with natural products gaining increasing attention in 
these strategies. 

Carvacrol, a potential anticancer agent, has shown 
effectiveness in suppressing cell growth, causing cell 
cycle blockage, and triggering programmed cell death 
in several cancerous human cell lines (Fatima et al., 
2022; Mari et al., 2021; Chiu et al., 2023). These actions 
contribute to enhancing the susceptibility of transfor-
med cells to chemotherapy along with targeted thera-
pies. Additionally, combining carvacrol with other 
treatments may improve the therapeutic outcomes of 
both chemotherapeutic agents and targeted drugs. 
Based on existing studies, this investigation aimed to 
determine whether carvacrol could contribute to 
overcoming acquired resistance to cetuximab. How-
ever, the impact of carvacrol on the reaction of NSCLC 
cells to cetuximab, as well as the mechanisms involved, 
remains poorly understood. This investigation exami-
nes the therapeutic impacts and underlying dynamics 
of combining cetuximab with carvacrol in A-549 and 
H1299 NSCLC cell lines. 

The findings indicate that the combination of carvacrol 
and cetuximab significantly reduced the viability and 
proliferation of A-549 and H1299 cells. This study 
demonstrates that using lower doses of cetuximab in 
combination with carvacrol enhances the antitumor 
effects in these cell lines, showing a synergistic impact 
compared to cetuximab alone. Detailed analysis 
revealed that the underlying mechanism of this effect 
involves disruption of the cell membrane, induction of 

programmed cell death, and cell cycle arrest in both A-
549 and H1299 cells. 

Studies have shown that cetuximab, when used in 
combination with various natural anticancer agents, can 
enhance apoptosis in human tumor cells. As an 
illustration, an exploration established that cetuximab 
blended with genistein, a soy-derived isoflavonoid, 
resulted in significant antitumor effects in mice with 
oral squamous cell carcinoma (OSCC) xenografts (Park 
et al., 2010). Similarly, when cetuximab was in 
combination with docetaxel, A taxane-based drug 
gathered from European yellow tree, it effectively 
suppressed the growth of non-small cell lung cancer 
PC9/G2 cells in both laboratory and animal models 
(Zhang et al., 2014). Additionally, the compound 
guggulsterone, in a natural manner found substance 
implemented in conventional Indian medicine, was 
shown to amplify the cell growth-blocking effects of 
cetuximab in squamous cell carcinoma of the head and 
neck (HNSCC) (Leeman-Neill et al., 2009).  

The pairing of cetuximab and oridonin, an active 
compound derived from Rabdosia rubescens, has 
demonstrated combined antitumor effects against 
laryngeal squamous cell carcinoma (LSCC) in both 
laboratory and animal models. Notably, this 
combination resulted in enhanced anti-proliferative 
activity in vitro, significantly inhibiting p-EGFR 
expression. In vivo, the combination treatment led to a 

marked reduction in p-EGFR levels within tumor 
tissues and promoted tumor regression in HEp-2 
xenografts, outperforming treatments with either 
cetuximab or oridonin alone. Throughout the study, no 
notable side effects were observed in the treatment 
groups. The results demonstrated that combining 
oridonin with cetuximab not only inhibited EGFR 
phosphorylation but also triggered considerable 
apoptosis in both laboratory and animal models. LSCC 
cells treated with both oridonin and Cetuximab 
treatment resulted in higher levels of Fas, FasL, and 
activated caspase-8 compared to such treated with 
oridonin by itself. In HEp-2 tumor-bearing mice, the 
combination therapy led to substantial apoptosis and a 
substantial enhancement in stimulated caspase-8 as 
well as caspase-3, indicating that Fas-mediated extrinsic 
apoptotic pathway is essential in the tumor cell death 
triggered by oridonin and cetuximab (Cao et al., 2016). 
In a separate study, the combination of honokiol, a 
natural substance extracted from the tree's outer layer 
and foliage of the Chinese magnolia tree, combined 
with cetuximab, was established to improve the 
susceptibility of KRASG13D mutant colorectal cancer 
(CRC) cells in laboratory as well as animal models. 
Honokiol was found to interfere with SNX3- retromer- 
dependent vesicular transport, resulting in disrupted 
proteolytic activity in lysosomes and suppression of 
autophagy and macropinocytosis. Honokiol was shown 
to disrupt SNX3-retromer-mediated trafficking, leading 

30 Bangladesh J Pharmacol 2025; 20: 22-34                                                                 



 

to impaired lysosomal proteolytic function and 
inhibition of autophagy and macropinocytosis. 
Additionally, honokiol blocked the activation of RAS 
through GDP to GTP exchange, which further enhanced 
responsiveness of KRASG13D mutant CRC cells 
response to cetuximab treatment. This combination 
therapy improved cetuximab efficacy by targeting the 
SNX3 retromer in a preclinical model of KRASG13D 
mutant colorectal cancer. These results offer a 
promising approach for enhancing targeted therapy in 
individuals with KRAS mutant colorectal cancer (Zhu 
et al., 2024). In another study, the findings indicate that 
honokiol could be a potent natural compound for 
defeating resistance developed to cetuximab. When 
honokiol was combined with cetuximab, significant 
reductions were observed in the quantities of pHER2, 
pHER3, pMAPK, pAKT, and pC-RAF (Pearson et al., 
2018), suggesting a potential mechanism for improving 
treatment outcomes in resistant cancer cases. 

It is believed that an increase in reactive oxygen species 
(ROS) within cells could trigger apoptosis through 
elevated oxidative stress (Pan et al., 2014). On the other 
hand, cancers, such as those associated with tobacco use 
and driven by ROS, often show heightened MAPK 
activation. This includes oral and lung cancers, as well 
as cancers linked to viruses like Epstein-Barr virus and 
hepatitis C. In these cancers, ROS play a key role in 
regulatory signaling networks that may play a role in 
tumor persistence and progression (Bonner and 
Arbiser, 2014). One of the findings from the study 
showed that combining honokiol with cetuximab led to 
a reduction in ROS production (Pearson et al., 2018). 
This decrease in ROS was associated with lower cell 
proliferation and survival, a halt in the initial growth 
phase (G1) of the cell proliferation cycle, and delayed 
tumor growth in patient-derived xenograft models 
from cetuximab-refractory HNSCC (Pearson et al., 
2018). 

Another study demonstrated a synergistic impact when 
125 μg/mL of β-elemene was used in conjuction with 
25 μg/mL of cetuximab in colorectal cancer (CRC) cells 
with KRAS mutations. In vitro, this combination 
induced the accumulation of iron-mediated reactive 
oxygen species (ROS), depletion of glutathione (GSH), 
increased lipid degradation, and enhanced expression 
of HO-1 and transferrin. The combination of β-elemene 
and cetuximab also led to the downregulation of key 
proteins associated with ferroptosis, such as GPX4, 
SLC7A11, FTH1, glutaminase, and SLC40A1, in CRC 
cells harboring KRAS mutations. This approach also 
suppressed cell displacement and reduced the 
manifestation of mesenchymal markers, including 
Vimentin, N-cadherin, Slug, Snail, and MMP-9, while 
promoting the manifestation of epithelial marker E-
cadherin. In animal models, the pairing of β-elemene 
and cetuximab significantly suppressed tumor 

progression and lymphatic tissues metastasis in KRAS 
mutant models (Chen et al., 2020). A study examined 
the impact of combining withaferin-A, a steroidal 
lactone originating from the Indian Ayurvedic herb 
Withania somnifera (widely referred to as 

Ashwagandha), with 5-fluorouracil in colorectal cancer 
(CRC) cells. The results showed that this combination 
induced both autophagy and apoptosis through the 
activation of endoplasmic reticulum stress, leading to a 
reduction in cell proliferation potential and enhancing 
The pharmaceutical's effectiveness opposed to CRC. 
Furthermore, the pairing therapy reduced 
overactivation of critical proteins in the Wnt/β-catenin 
signaling pathway by removing phosphate groups from 
β-catenin and GSK3β at Ser675 and Ser9, respectively, 
ultimately causing cellular division process arrest 
during the G2/M phase (Alnuqaydan et al., 2020). 

This study has several limitations. Reliance on A-549 
and H1299 cell lines may not capture the heterogeneity 
of human lung tumors, limiting generalizability. The 
lack of in vivo validation leaves efficacy, safety, and 

pharmacokinetics unassessed. MTT and LDH assays, 
used to assess viability and cytotoxicity, are prone to 
inaccuracies due to metabolic interference and serum-
derived LDH, respectively. Moreover, the molecular 
mechanisms underlying observed biomarker changes 
remain unexplored. Finally, the 48-hour treatment 
period may not reflect long-term effects or resistance 
mechanisms, which are critical for evaluating 
therapeutic sustainability and informing future 
treatment strategies. 

  

Conclusion 

Combining cetuximab with carvacrol at low concen-
trations effectively inhibits lung cancer cell proliferation 
by inducing apoptosis, oxidative stress, and cell cycle 
arrest, highlighting its potential as a synergistic and less 
toxic therapeutic strategy. 

 

Financial Support 

The author would like to thank the Scientific and Technologi-
cal Research Council of Turkey (TUBITAK) (1919B012201653) 
for financial support of this work.  

 

Ethical Issue 

Cell lines derived from the expansion of primary cell cultures 
in vitro were not relevant material, as all the original cells were 
divided and so the cell line had been created outside of the 
human body. The storage and use of cell lines created from 
primary human tissue, for research purposes, did not require 
ethical approval. 

 Bangladesh J Pharmacol 2025; 20: 22-34                                                                31 



 

Conflict of Interest 

Authors declare no conflict of interest.  

 

Acknowledgement 

Authors wish to thank Alanya Alaaddin Keykubat University 
for providing the necessary facilities to conduct this study. 

 

References 

Alar T, Şahin EM. Akciger kanseri: Birinci basamakta tanı, 
tedavi ve korunma. Smyrna Tıp Dergisi. 2012; 2: 68-74. 

Alma MH, Mavi A, Yildirim A, Digrak M, Hirata T. Screening 
chemical composition and in vitro antioxidant and 
antimicrobial activities of the essential oils from Origanum 
syriacum L. growing in Turkey. Biol Pharm Bull. 2003; 26: 
1725-29. 

Alnuqaydan AM, Rah B, Almutary AG, Chauhan SS. Syner-
gistic antitumor effect of 5-fluorouracil and withaferin-A 
induces endoplasmic reticulum stress-mediated autophagy 
and apoptosis in colorectal cancer cells. Am J Cancer Res. 
2020; 10: 799-815. 

Arkali G, Aksakal M, Kaya ŞO. Protective effects of carvacrol 
against diabetes‐induced reproductive damage in male rats: 
Modulation of Nrf2/HO‐1 signaling pathway and inhibi-
tion of Nf‐kB‐mediated testicular apoptosis and inflamma-
tion. Andrologia 2021; 53: e13899. 

Arunasree KM. Antiproliferative effects of carvacrol on a 
human metastatic breast cancer cell line, MDA-MB 231. 
Phytomedicine 2010; 17: 581-88. 

Baselga J. The EGFR as a target for anticancer therapy-focus on 
cetuximab. Eur J Cancer. 2001; 37: 16-22. 

Baykara O. Kanser tedavisinde güncel yaklaşımlar. Balıkesir 
Sağlık Bilimleri Dergisi. 2016; 5: 154-65 

Bijwaard KE, Aguilera NS, Monczak Y, Trudel M, Tauben-
berger JK, Lichy JH. Quantitative real-time reverse trans-
cription-PCR assay for cyclin D1 expression: Utility in the 
diagnosis of mantle cell lymphoma. Clin Chem. 2001; 47: 195
-201. 

Boduroglu B, Investigation of the effect of carvacrol against 
arsenic induced oxidatıve stress in rats. Master's thesis, 
Afyon Kocatepe University. Gazlıgol Yolu, 2022, pp 1-64. 

Bonner MY, Arbiser JL. The antioxidant paradox: what are 
antioxidants and how should they be used in a therapeutic 
context for cancer. Future Med Chem. 2014; 6: 1413-22. 

Bradford MM. A rapid and sensitive method for the 
quantitation of microgram quantities of protein utilizing the 
principle of protein-dye binding. Anal Biochem. 1976; 72: 
248-54. 

Bruns, C.J, Harbison MT, Davis DW, Portera CA, Tsan R, 
McConkey DJ., Evans DB, Abbruzzese JL, Hicklin DJ, 
Radinsky R. Epidermal growth factor receptor blockade 
with C225 plus gemcitabine results in regression of human 
pancreatic carcinoma growing orthotopically in nude mice 
by antiangiogenic mechanisms. Clin Cancer Res. 2000; 6: 

1936-48. 

Buchsbaum DJ, Bonner JA, Grizzle WE, Stackhouse MA, 
Carpenter M, Hicklin DJ, Bohlen P, Raisch KP. Treatment of 
pancreatic cancer xenografts with erbitux (IMC-C225) anti-
EGFR antibody, gemcitabine, and radiation. Int J Radiat 
Oncol Biol Phys. 2002; 54: 1180-93.  

Cao S, Xia M, Mao Y, Zhang Q, Donkor PO, Qiu F, Kang N. 
Combined oridonin with cetuximab treatment shows syner-
gistic anticancer effects on laryngeal squamous cell carci-
noma: Involvement of inhibition of EGFR and activation of 
reactive oxygen species-mediated JNK pathway. Int J Oncol. 
2016; 49: 2075-87.  

Chami N, Chami F, Bennis S, Trouillas J, Remmal A. Antifun-
gal treatment with carvacrol and eugenol of oral candidiasis 
in immunosuppressed rats. Brazil J Infect Dis. 2004; 8: 217-
26. 

Chen P, Li X, Zhang R, Liu S, Xiang Y, Zhang M, Chen X, Pan 
T, Yan L, Feng J, Duan T, Wang D, Chen B, Jin T, Wang W, 
Chen L, Huang X, Zhang W, Sun Y, Li G, Kong L, Chen X, 
Li Y, Yang Z, Zhang Q, Zhuo L, Sui X, Xie T. Combinative 
treatment of β-elemene and cetuximab is sensitive to KRAS 
mutant colorectal cancer cells by inducing ferroptosis and 
inhibiting epithelial-mesenchymal transformation. Thera-
nostics 2020; 10: 5107-19. 

Cheng YD, Yang H, Chen GQ, Zhang ZC. Molecularly targe-
ted drugs for metastatic colorectal cancer. Drug Des Devel 
Ther. 2013; 7: 1315-22. 

Chiu KW, Chen HY, Chen CL, Hsieh CP, Huang YF. Attenua-
tion of endoplasmic reticulum stress enhances carvacrol-
induced apoptosis in osteosarcoma cell lines. Life 2023; 13: 
744-. 

Douillard JY, Pirker R, O'Byrne KJ, Kerr KM, Störkel S, von 
Heydebreck A, Grote HJ, Celik I, Shepherd FA. Relationship 
between EGFR expression, EGFR mutation status, and the 
efficacy of chemotherapy plus cetuximab in FLEX study 
patients with advanced non-small-cell lung cancer. J Thorac 
Oncol. 2014; 9: 717-24. 

Fatima K, Luqman S, Meena A, Carvacrol arrests the prolifera-
tion of hypopharyngeal carcinoma cells by suppressing 
ornithine decarboxylase and hyaluronidase activities. Front 
Nutr. 2022; 9: 857256. 

Flohé L, Günzler WA. Assays of glutathione peroxidase. 
Methods Enzymol. 1984; 105: 114-20. 

Galizia G, Lieto E, De Vita F, Orditura M, Castellano P, Troiani 
T, Imperatore V, Ciardiello F. Cetuximab, a chimeric human 
mouse anti-epidermal growth factor receptor monoclonal 
antibody, in the treatment of human colorectal cancer. 
Oncogene. 2007; 26: 3654-60. 

Gill GN, Kawamoto T, Cochet C, Le A, Sato JD, Masui H, 
McLeod C, Mendelsohn J. Monoclonal anti-epidermal 
growth factor receptor antibodies which are inhibitors of 
epidermal growth factor binding and antagonists of 
epidermal growth factor-stimulated tyrosine protein kinase 
activity. J Biol Chem. 1984; 259: 7755-60.  

Hashemipour H, Kermanshahi H, Golian A, Veldkamp T. 
Metabolism and nutrition: Effect of thymol and carvacrol 
feed supplementation on performance, antioxidant enzyme 
activities, fatty acid composition, digestive enzyme 

32 Bangladesh J Pharmacol 2025; 20: 22-34                                                                 



 

activities, and immune response in broiler chickens. Poult 
Sci. 2013; 92: 2059-69. 

Herbst RS, Shin DM. Monoclonal antibodies to target epider-
mal growth factor receptor–positive tumors. Cancer 2002; 
94: 1593-611. 

Huang F, Wu XN, Chen JIE, Wang WX, Lu ZF. Resveratrol 
reverses multidrug resistance in human breast cancer 
doxorubicin-resistant cells. Exp Ther Med. 2014; 7: 1611-16. 

Huang ST, Yang RC, Yang LJ, Lee PN, Pang JHS. Phyllanthus 
urinaria triggers the apoptosis and Bcl-2 down-regulation in 
Lewis lung carcinoma cells. Life Sci. 2003; 72: 1705-16. 

Huether A, Hopfner M, Baradari V, Schuppan D, Scherübl H. 
EGFR blockade by cetuximab alone or as combination 
therapy for growth control of hepatocellular cancer. 
Biochem Pharmacol. 2005; 70: 1568-78. 

Jayakumar S, Madankumar A, Asokkumar S, Raghunandha-
kumar S, Gokula dhas K, Kamaraj S, Divya MG, Devaki T. 
Potential preventive effect of carvacrol against diethylnitro-
samine-induced hepatocellular carcinoma in rats. Mol Cell 
Biochem. 2012; 360: 51-60.  

Lee B, Yeom M, Shim I, Lee H, Hahm D. Inhibitory effect of 
carvacrol on lipopolysaccharide-induced memory impair-
ment in rats. Korean J Physiol Pharmacol. 2020; 24: 27-37. 

Leeman-Neill RJ, Wheeler SE, Singh SV, Thomas SM, Seethala 
RR, Neill DB, Panahandeh MC, Hahm ER, Joyce SC, Sen M, 
Cai Q, Freilino ML, Li C, Johnson DE, Grandis JR. Gugguls-
terone enhances head and neck cancer therapies via inhibi-
tion of signal transducer and activator of transcription-3. 
Carcinogenesis 2009; 30: 1848-56.  

Libermann TA, Razon N, Bartal AD, Yarden Y, Schlessinger J, 
Soreq H. Expression of epidermal growth factor receptors in 
human brain tumors. Cancer Res. 1984; 44: 753-60. 

Lo HW, Hsu SC, Hung MC. EGFR signaling pathway in breast 
cancers: from traditional signal transduction to direct 
nuclear translocalization. Breast Cancer Res Treat. 2006; 95: 
211-18. 

Kohrt HE, Colevas AD, Houot R, Weiskopf K, Goldstein MJ, 
Lund P, Mueller A, Sagiv-Barfi I, Marabelle A, Lira R, 
Troutner E, Richards L, Rajapaska A, Hebb J, Chester C, 
Waller E, Ostashko A, Weng WK, Chen L, Czerwinski D, Fu 
YX, Sunwoo J, Levy R. Targeting CD137 enhances the 
efficacy of cetuximab. J Clin Invest. 2014; 124: 2668-82. 

Mari A, Mani G, Nagabhishek SN, Balaraman G, Subramanian 
N, Mirza FB, Sundaram J, Thiruvengadam D. Carvacrol 
promotes cell cycle arrest and apoptosis through PI3K/AKT 
signaling pathway in MCF-7 breast cancer cells. Chin J 
Integr Med. 2021; 27: 680-87. 

Matar P, Rojo F, Cassia R, Moreno-Bueno G, Di Cosimo S, 
Tabernero J, Guzmán M, Rodriguez S, Arribas J, Palacios J, 
Baselga J. Combined epidermal growth factor receptor 
targeting with the tyrosine kinase inhibitor gefitinib 
(ZD1839) and the monoclonal antibody cetuximab (IMC-
C225): Superiority over single-agent receptor targeting. Clin 
Cancer Res. 2004; 10: 6487-501.  

Melo JO, Fachin AL, Rizo WF, Jesus HC, Arrigoni-Blank MF, 
Alves PB, Marins MA, França SC, Blank AF. Cytotoxic 

effects of essential oils from three Lippia gracilis Schauer 
genotypes on HeLa, B16, and MCF-7 cells and normal 
human fibroblasts. Genet Mol Res. 2014; 13: 2691-97.  

Mosmann T. Rapid colorimetric assay for cellular growth and 
survival: application to proliferation and cytotoxicity 
assays. J Immunol Methods. 1983; 65: 55-63. 

Njume C, Afolayan AJ, Ndip RN. An overview of antimicro-
bial resistance and the future of medicinal plants in the 
treatment of Helicobacter pylori infections. Afr J Pharm 
Pharmacol. 2009; 3: 685-99. 

Overholser JP, Prewett MC, Hooper AT, Waksal HW, Hicklin 
DJ. Epidermal growth factor receptor blockade by antibody 
IMC-C225 inhibits growth of a human pancreatic carcinoma 
xenograft in nude mice. Cancer 2000; 89: 74-82. 

Pan J, Zhang Q, Liu Q, Komas SM, Kalyanaraman B, Lubet 
RA, Wang Y, You M. Honokiol inhibits lung tumorigenesis 
through inhibition of mitochondrial function. Cancer Prev 
Res (Phila). 2014; 7: 1149-59. 

Park SJ, Kim MJ, Kim YK, Kim SM, Park JY, Myoung H. Com-
bined cetuximab and genistein treatment shows additive 
anti-cancer effect on oral squamous cell carcinoma. Cancer 
Lett. 2010; 292: 54-63. 

Pearson HE, Iida M, Orbuch RA, McDaniel NK, Nickel KP, 
Kimple RJ, Arbiser JL, Wheeler DL. Overcoming resistance 
to cetuximab with honokiol, A small-molecule polyphenol. 
Mol Cancer Ther. 2018; 17: 204-14. 

Petrelli F, Coinu A, Riboldi V, Borgonovo K, Ghilardi M, 
Cabiddu M, Lonati V, Sarti E, Barni S. Concomitant 
platinum-based chemotherapy or cetuximab with radio-
therapy for locally advanced head and neck cancer: A 
systematic review and meta-analysis of published studies. 
Oral Oncol. 2014; 50: 1041-48.  

Pilau MR, Alves SH, Weiblen R, Arenhart S, Cueto AP, Lovato 
LT. Antiviral activity of the Lippia graveolens (Mexican 
oregano) essential oil and its main compound carvacrol 
against human and animal viruses. Braz J Microbiol. 2011; 
42: 1616-24. 

Pirker R, Pereira JR, Szczesna A, von Pawel J, Krzakowski M, 
Ramlau R, Vynnychenko I, Park K, Yu CT, Ganul V, Roh JK, 
Bajetta E, O'Byrne K, de Marinis F, Eberhardt W, 
Goddemeier T, Emig M, Gatzemeier U; FLEX Study Team. 
Cetuximab plus chemotherapy in patients with advanced 
non-small-cell lung cancer (FLEX): An open-label 
randomised phase III trial. Lancet 2009; 373: 1525-31. 

Prewett M, Rockwell P, Rockwell RF, Giorgio NA, Mendel-
sohn J, Scher HI, Goldstein NI. The biologic effects of C225, 
a chimeric monoclonal antibody to the EGFR, on human 
prostate carcinoma. J Immunother Emphasis Tumor 
Immunol. 1996; 19: 419-27. 

Radonic A, Milos M, Chemical composition and in vitro 
evaluation of antioxidant effect of free volatile compounds 
from Satureja montana L. Free Radic Res. 2003; 37: 673-79. 

Rattanachaikunsopon P, Phumkhachorn P. Assessment of 
factors influencing antimicrobial activity of carvacrol and 
cymene against Vibrio cholerae in food. J Biosci Bioeng. 2010; 
110: 614-19. 

 Bangladesh J Pharmacol 2025; 20: 22-34                                                                33 



 

 

Author Info 

Ayse Erdogan (Principal contact) 
e-mail: ayse.erdogan@alanya.edu.tr  

Ravishankar S, Zhu L, Reyna-Granados J, Law B, Joens L, 
Friedman M. Carvacrol and cinnamaldehyde inactivate 
antibiotic-resistant Salmonella enterica in buffer and on celery 
and oysters. J Food Prot. 2010; 73: 234-40. 

Rivas L, McDonnell MJ, Burgess CM, O'Brien M, Navarro-Villa 
A, Fanning S, Duffy G. Inhibition of verocytotoxigenic 
Escherichia coli in model broth and rumen systems by 
carvacrol and thymol. Int J Food Microbiol. 2010; 139: 70-78. 

Subak M, Aksel N, Kılıç Oztürk Y. Incidence of anemia in 
cases with lung cancer at the time of diagnosis and relation 
between cancer types. Forbes J Med. 2020; 1: 11-14.  

Ultee A, Kets EPW, Smid EJ. Mechanisms of action of carvacrol 
on the food-borne pathogen Bacillus cereus. Appl Environ 
Microbiol. 1999; 65: 4606-10. 

Veale D, Ashcroft T, Marsh C, Gibson GJ, Harris AL. Epider-
mal growth factor receptors in non-small cell lung cancer. Br 
J Cancer. 1987; 55: 513-16. 

Weichselbaum RR, Dunphy EJ, Beckett MA, Tybor AG, Moran 
WJ, Goldman ME, Vokes EE, Panje WR. Epidermal growth 
factor receptor gene amplification and expression in head 
and neck cancer cell lines. Head Neck. 1989; 11: 437-42. 

Wu X, Fan Z, Masui H, Rosen N, Mendelsohn J. Apoptosis 

induced by an antiepidermal growth factor receptor 
monoclonal antibody in a human colorectal carcinoma cell 
line and its delay by insulin. J Clin Invest. 1995; 95: 1897-905. 

Yaman S, Ozdemir Z, Sit M, Ozer B, Catal O. Kekik yagı 
karvakrolun insan saglıgına etkileri. SETSCI Conference 
Indexing System. 2018; 2: 391-92. 

Yasui W, Sumiyoshi H, Hata J, Kameda T, Ochiai A, Ito H, 
Tahara E. Expression of epidermal growth factor receptor in 
human gastric and colonic carcinomas. Cancer Res. 1988; 48: 
137-41.  

Zamani AG, Zamani A. MikroRNA’lar ve akciger kanseri. 
Tuberk Toraks. 2013; 61: 57-62. 

Zhang L, Li XF, Tand L, Zhao YM, Zhou CC. The effects of 
cetuximab in combination with docetaxel for the acquired 
resistance to EGFR-TKI in non-small cell lung cancer cells. 
Tumor. 2014; 34: 584-90. 

Zhu Q, Zhang R, Gu X, Zhao Z, Gao Q, Chen M, Wu Q, Xie T, 
Sui X. Honokiol enhances the sensitivity of cetuximab in 
KRASG13D mutant colorectal cancer through destroying 

SNX3-retromer complex. Theranostics 2024; 14: 5443-60.  

34 Bangladesh J Pharmacol 2025; 20: 22-34                                                                 

mailto:ayse.erdogan@alanya.edu.tr