Bangladesh J. Plant Taxon. 28(1): 125‒130, 2021 (June) https://doi.org/10.3329/bjpt.v28i1.54212 © 2021 Bangladesh Association of Plant Taxonomists MOLECULAR AUTHENTICATION OF EUPHORBIA SCHIMPERIANA SCHEELE USING INTERNAL TRANSCRIBED SPACER SEQUENCES OF NUCLEAR RIBOSOMAL DNA MESFER M. ALQAHTANI1*, M. AJMAL ALI2*, M. OLIUR RAHMAN3, FAHAD M. AL-HEMAID, SIDANAND V. KAMBHAR4 AND JOONGKU LEE5 Department of Botany and Microbiology, College of Science, King Saud University, Riyadh-11451, Saudi Arabia Keywords: Molecular signature; Euphorbia schimperiana; ITS; nrDNA; Phylogenetic relationships. Abstract The Internal Transcribed Spacers (ITS) sequences of nuclear ribosomal DNA (nrDNA) are commonly used in plant molecular phylogenetics for the molecular based taxonomic identification and DNA barcoding because of shorter length and easy to amplify by using the universal primers, and further has discrimination ability to distinguish the taxon at lower taxonomic level. The present molecular phylogenetic analysis of ITS nrDNA sequences focuses to determine the taxonomic status of an unresolved medicinally important species Euphorbia schimperiana Scheele of the family Euphorbiaceae reported from Saudi Arabia. The combined length of the entire ITS region in E. schimperiana is 644 nucleotides. The study reveals that E. schimperiana shows a close proximity with the members of the subgenus Esula. Introduction The Euphorbiaceae is a large family of flowering plants with about 300 genera and 7,500 species. The genus Euphorbia L. sensu lato belonging to the family Euphorbiaceae comprises nearly 2,000 recognized taxa with global distribution. It is considered as the largest genus of flowering plants (Govaerts et al., 2000; Frodin, 2004). In Saudi Arabia, Euphorbia is represented by 42 species (Abedin et al., 2001). The four main molecular phylogenetic studies of Euphorbia to date have revealed the overall phylogeny of the genus, with a major point of consensus being the recognition of four subgeneric clades: Rhizanthium, Esula, Euphorbia, and Chamaesyce (Steinmann and Porter, 2002; Bruyns et al., 2006; Park and Jansen, 2007; Zimmermann et al., 2010). The Internal Transcribed Spacers (ITS) of Nuclear Ribosomal DNA (nrDNA) in plants is being extensively used for phylogenetic studies, molecular discrimination of raw drug material and DNA barcoding (Ali et al., 2014). The DNA sequence of Euphorbia schimperiana has not been done before and is not available in the GenBank, moreover, the molecular evolutionary 1Department of Biological Sciences, Faculty of Science and Humanities, Shaqra University, P.O. Box 1040, Ad-Dawadimi 11911, Saudi Arabia (mesferalqahtani@hotmail.com) 2Corresponding author. Email: ajmalpdrc@gmail.com, majmalaliksu@gmail.com 3Department of Botany, University of Dhaka, Dhaka 1000, Bangladesh 4Post Graduate Department of Botany, KLE Society’s, Basavaprabhu Kore College, Chikodi-591 201, Belagavi, Karnataka, India 5Department of Environment and Forest Resources, Chungnam National University, Daehak-ro, Yuseong-gu, Daejeon, Republic of Korea *The first and second authors contributed equally to this study https://doi.org/10.3329/bjpt.v28i1.54212 mailto:(mesferalqahtani@hotmail.com) mailto:ajmalpdrc@gmail.com, mailto:majmalaliksu@gmail.com 126 ALQAHTANI et al. relationships of the Saudia Arabian E. schimperiana is lacking; thus molecular evolutionary study on E. schimperiana from Saudi Arabia is very much needed. Hence, this study has been undertaken to determine evolutionary relationships and molecular signature of the medicinally important E. schimperiana based on nrDNA ITS sequences. Materials and Methods Plant materials: Leaf material of E. schimperiana was collected from the herbarium specimen [Voucher information: Al-Baha, 26.10.1978, A. R. Dawood s.n. (RIY)] lodged at National Herbaium and GenBank, National Agriculture and Animal Resources Research Center, Ministry of Agriculture, Riyadh, Saudi Arabia, and the taxonomic identification of the species was confirmed through the consultation of Flora of Saudi Arabia (Abedin et al., 2001). Extraction of genomic DNA, amplification and sequencing of nrDNA ITS gene: The leaf material was crushed with liquid nitrogen using ‘Qiagen Tissue Lyser’ (# 85300). The robotic workstation ‘QIAcube’ (# 9001292) using ‘DNeasy Plant Mini Kit’ (# 69104) was used for automated purification of the total genomic DNA. The nuclear ribosomal DNA ITS sequences (ITS1-5.8S-ITS2) were amplified in the thermal cycler (Applied Biosystems Veriti) via Polymerase Chain Reaction (PCR) using the primers (White et al., 1990) [forward primer ITS1 (5’GTCCACTGAACCTTATCATTTAG3’) and the reverse primer ITS4 (5’TCCTCCGCTTATT GATATGC3’)] and PCR Mix (# K-2011, Bioneer, Daejeon, Republic of Korea). The DNA sequencing of the amplified product was performed using kit (# 4337455, BigDye Terminator cycle sequencing kit, Perkin-Elmer, Applied Biosystems) in DNA Analyzer (Perkin-Elmer, Applied Biosystems, # ABI PRISM 3730XL). Phylogenetic analyses: ITS sequences of nrDNA of 34 species of the genus Euphorbia including two sequences of Outgroup (Table 1) were retrieved from GenBank database of National Center for Biotechnology Information (www.ncbi.nlm.nih.gov). The sequence alignment was performed using Clustal X version 1.81 (Thompson et al., 1997), and then the alignment was subsequently adjusted manually using BioEdit (Hall, 1999). The gaps in the sequence alignment were treated as missing data in phylogenetic analysis. The sequence generated in the present study was submitted to NCBI GenBank (accession number KC432622). The Maximum Parsimony (MP) analysis with 1000 bootstrap replicates was performed using MEGA X (Kumar et al., 2018). Results and Discussion The combined length of the entire ITS region (ITS1, 5.8S and ITS2) in Euphorbia schimperiana was 644 nucleotides. The length of the ITS1 region and GC contents were 256 nucleotides and 63% respectively, the 5.8S gene was 162 nucleotides long, and the length of the ITS2 region and the GC contents were 226 nucleotides and 68% respectively. The length of the ITS1 region and GC contents in E. schimperiana was found consistent with some other earlier studies on the family Euphorbiaceae (Steinmann and Porter, 2002; Barres et al., 2011). The parsimony analysis of the whole ITS region resulted into two maximally parsimonious trees (MPTs) with a total length of 1,335 steps, a consistency index (CI) of 0.495 (0.490 CI excluding uninformative characters), a homoplasy index (HI) of 0.522 (0.510 HI excluding uninformative characters), rescaled consistency index (RC) of 0.362 and a retention index (RI) of 0.731. One of the MPTs is shown in Fig. 1 in which the numbers above the lines indicate the http://www.ncbi.nlm.nih.gov). MOLECULAR AUTHENTICATION OF EUPHORBIA SCHIMPERIANA 127 bootstrap support in 1000 replicates. The taxa included in the analyses are from all the four subgenera of Euphorbia i.e. Rhizanthium, Esula, Euphorbia, and Chamaesyce. A perusal of phylogenetic tree clearly indicates that the ingroup is monophyletic, and all the subgeneric clades are well resolved with strong bootstrap support, and E. schimperiana nested within the clade of the subgenus Esula (Fig. 1). Table 1. List of taxa used for phylogenetic analyses with accession number retrieved from NCBI GenBank. Group Subgenus Taxon GenBank Accession number Ingroup Rhizanthium 1. Euphorbia antso Denis AF537579 2. E. atrispina N.E. Br. AF537568 3. E. balsamifera Ait. AF537571 4. E. clava Jacq. AF537569 5. E. namuskluftensis L.C. Leach AF537562 6. E. obesa Hook. f. AF537566 Esula 7. E. aphylla Brouss. ex Willd. AF537540 8. E. characias L. GU984304 9. E. dendroides L. AF537539 10. E. exigua L. GU984325 11. E. mauritanica L. AF537531 12. E. orthoclada Baker DQ204876 13. E. peplus L. AF537532 14. E. regis-jubae J. Gay AF537541 15. E. schimperi C. Presl AF537537 16. E. schimperiana Scheele JN207816 Euphorbia 17. E. abdelkuri Balf. f. AF537458 18. E. beharensis Leandri AJ508983 19. E. cylindrifolia Marn.-Lap. & Rauh AJ508955 20. E. drupifera Thonn. AF537480 21. E. epiphylloides Kurz AF537484 22. E. milii Des Moul. AJ508974 23. E. ramipressa Croizat AF537481 24. E. teke Schweinf. ex Pax AF537485 Chamaesyce 25. E. fulgens Karw. ex Klotzsch AF537404 26. E. graminea Jacq. AF537410 27. E. heterophylla L. GU214931 28. E. ipecacuanhae L. AF537397 29. E. leucocephala Lotsy GU214932 30. E. misera Benth. AF537383 31. E. pulcherrima Willd. ex Klotzsch GU214943 32. E. sphaerorhiza Benth. AF537412 Outgroup 33. Dichostemma glaucescens Pierre AF537584 34. Neoguillauminia cleopatra (Baill.) Croizat AF537581 128 ALQAHTANI et al. Fig. 1. Molecular phylogenetics of Euphorbia schimperiana inferred from nrDNA ITS sequences using the Maximum Parsimony method. In the present investigation of the nrDNA ITS sequence of E. schimperiana with the members of sect. Tirucalli, subsect. Pachycladae, sect. Aphyllis, sect. Cymatospermum, sect. Esula, sect. Paralias, sect. Chylogala, sect. Helioscopia and sect. Myrsinites belonging to the subgenus Esula reveals the grouping of the taxon in the phylogenetic tree according to previously recognized sections of the subgenus Esula, and this result is found to be congruent with the previous study of molecular phylogeny of Euphorbia subg. Esula sect. Aphyllis (Barres et al., 2011) based on nrDNA and cpDNA markers. In the present study, E. schimperiana shows a close proximity with the members of the subgenus Esula. This is the first report of inferring the nrDNA ITS based phylogenetic relationships and establishment of molecular signature of the E. schimperiana, a medicinally important plant reported to be used as a laxative and vermifuge (Abulafatih, 1987). Recently, four bioactive MOLECULAR AUTHENTICATION OF EUPHORBIA SCHIMPERIANA 129 compounds were isolated from E. schimperiana and the species was found to possess potential antioxidant activity (Shaker et al., 2015). Therefore, the molecular authentication of E. schimperiana will be of immense importance in molecular validation of raw herbal drug material. The proper identification of medicinal plants is required to ensure the purity, quality and safety of drugs (Jayasinghe et al., 2009). Hence, in addition to the morpho-taxonomical key based conventional methods of identification of raw plant drug materials, the DNA-based methods have been developed for the proper identification of medicinal plants (Sucher and Carles, 2008). The attempts are being made to use several candidate DNA barcode regions to identify species. In absence of a universal plant DNA barcode as in animal systems, a number of candidate genes located in the chloroplast genome such as psbA-trnH have been suggested to be used as DNA barcodes (Kress et al., 2005; Shaw et al., 2005; Chase et al., 2007; Kress and Erickson, 2007). The ITS2 region has been suggested to use as a standard DNA barcode (Chen et al., 2010; Yao et al., 2010). The assessments of 871 species in 66 genera of the family Euphorbiaceae have demonstrated that ITS/ITS2 is a potential barcode in delimitation of Euphorbiaceous species (Pang et al., 2010), and in our study ITS has been found instrumental in molecular signature of E. schimperiana. Acknowledgement Joongku Lee is thankful to Chungnam National University, Daejeon, Republic of Korea for the support. References Abedin, S., Mossa, J.S., Al-Said, M.S. and Al-Yahya, M.A. 2001. Euphorbiaceae. In: Chaudhary, S. (Ed.), Flora of Saudi Arabia. Ministry of Agriculture and Water, National Herbarium, National Agriculture and Water Research Center, Riyadh, Saudi Arabia, II(1): 291–395. Abulafatih, H.A. 1987. Medicinal Plants in Southwestern Saudi Arabia. Economic Botany 41(3): 354–360. Ali, M.A., Gyulai, G., Norbert, H., Balázs, K., Al-Hemaid, F.M.A., Pandey, A.K. and Lee, J. 2014. The changing epitome of species identification - DNA barcoding. Saudi J. Biol. Sci. 21(3): 204–231. Barres, L., Vilatersana, R., Molero, J., Susanna, A. and Galbany-Casals, M. 2011. Molecular phylogeny of Euphorbia subg. Esula sect. Aphyllis (Euphorbiaceae) inferred from nrDNA and cpDNA markers with biogeographic insights. Taxon 60: 705–720. Bruyns, P.V., Mapaya, R.J. and Hedderson, T. 2006. A new subgeneric classification for Euphorbia (Euphorbiaceae) in southern Africa based on ITS and psbA-trnH sequence data. Taxon 55: 397–420. Chase, M.W., Cowan, R.S., Hollingsworth, P.M., Berg, C.V.D., Madriñán, S., Petersen, G., Seberg, O., Jørgsensen, T., Cameron, K.M., Carine, M., Pedersen, N., Hedderson, T.A.J., Conrad, F., Salazar, G.A., Richardson, J.E., Hollingsworth, M.L., Barraclough, T.G., Kelly, L. and Wilkinson, M. 2007. A proposal for a standardised protocol to barcode all land plants. Taxon 56: 295–299. Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang, X., Luo, K., Li, Y., Li, X., Jia, X., Lin, Y. and Leon, C. 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 5(1): e8613. Frodin, D.G. 2004. History and concepts of big plant genera. Taxon 53: 753–776. Govaerts, R., Frodin, D.G. and Radcliffe-Smith, A. 2000. World checklist and bibliography of Euphorbiaceae (with Pandaceae), Vol. 4. Royal Botanic Gardens, Kew, UK, 415 pp. Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acid Symp. Ser. 41: 95–98. Jayasinghe, R., Niu, L.H., Coram, T.E., Kong, S., Kaganovitch, J., Xue, C.C.L., Li, C.G., Pang, E.C.K. 2009. Effectiveness of an innovative prototype subtracted diversity array (SDA) for fingerprinting plant species of medicinal importance. Planta Medica 75: 1180–1185. 130 ALQAHTANI et al. Kress, W.J. and Erickson, D.L. 2007. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2: e508. Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A. and Janzen, D.H. 2005. Use of DNA barcodes to identify flowering plants. Proc. Nat. Acad. Sci. USA 102: 8369–8374. Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35(6): 1547–1549. Pang, X., Jingyuan, S., Yingjie, Z., Caixiang, X. and Shilin, C. 2010. Using DNA barcoding to identify species within Euphorbiaceae. Planta Medica 76(15): 1784–1786. Park, K.R. and Jansen, R.K. 2007. A phylogeny of Euphorbieae subtribe Euphorbiinae (Euphorbiaceae) based on molecular data. J. Plant Biol. 50: 644–649. Shaker, K.H., Al Shehri, B.M., Oteef, M.D.Y. and Mahmoud, M.F. 2015. Antioxidant compounds from Euphorbia schimperiana Scheele in Aseer Region, Saudi Arabia. Int. J. Pharm. Sci. Rev. Res. 32(1): 117–122. Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W.S., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E. and Small, R.L. 2005. The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92: 142–166. Steinmann, V.W. and Porter, J.M. 2002. Phylogenetic relationships in Euphorbieae (Euphorbiaceae) based on ITS and ndhF sequence data. Ann. Miss. Bot. Gard. 89: 453–490. Sucher, N.J. and Carles, M.C. 2008. Genome-based approaches to the authentication of medicinal plants. Planta Medica 74: 603–623. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, G.D. 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24: 4876–4882. White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninksky, J.J. and White, T.J. (Eds), PCR protocols: a guide to method and amplifications. Academic Press, San Diego, California, pp. 315–322. Yao, H., Song, J., Liu, C., Luo, K., Han, J., Li, Y., Pang, X., Xu, H., Zhu, Y., Xiao, P. and Chen, S. 2010. Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS ONE 5(10): e13102. Zimmermann, N.F.A., Ritz, C.M. and Hellwig, F.H. 2010. Further support for the phylogenetic relationships within Euphorbia L. (Euphorbiaceae) from nrITS and trnL-trnF IGS sequence data. Pl. Syst. Evol. 286: 39–58. (Manuscript received on 9 March, 2021; revised on 19 May, 2021)