Bangladesh J. Plant Taxon. 29(2): 167-181, 2022 (December) DOI: https://doi.org/10.3329/bjpt.v29i2.63524 © 2022 Bangladesh Association of Plant Taxonomists A NEW TAXON OF SALVIA (LAMIACEAE) FROM TÜRKİYE ÖZGÜR EMINAGAOGLU*, MELAHAT OZCAN AND HAYAL AKYILDIRIM BEĞEN1 Department of Forest Engineering, Faculty of Forestry, Artvin Çoruh University, 08000 Artvin-Türkiye Keywords: Salvia divaricata subsp. artvinense; Artvin; Anatomy; Lamiaceae; New taxon; Türkiye. Abstract Salvia divaricata Montbret & Aucher ex Benth. subsp. artvinense Eminagaoglu, Ozcan & Akyıldırım is described as a new endemic subspecies from Ardanuç (Artvin, Türkiye). It is related to Salvia divaricata Montbret & Aucher ex Benth. and S. tomentosa Mill. from which it differs in stem, leaf characters and flower color and numbers. A key is given to distinguish the new subspecies from the other species in the genus Salvia. Morphology, stem, petiole and leaf anatomy, and nutlet micromorphology were investigated. Nearly rounded stem, hemispherical petiole, bifacial leaf with diacytic stomata, and ovoid to rotund nutlet with glabrous and distinctly rough to protuberances ornamentation were determined for this subspecies. Taxonomic interpretations of the new subspecies are given using morphological, anatomical and phylogenetic analyses. Introduction Lamiaceae is one of the largest family with nearly 210 genera and more or less 1000 species of annuals shrubs, perennials and herbaceous (Celep et al., 2015). Salvia L. belongs to the Nepetoideae subfamily. It was determined as a paraphyletic group, well supported by both morphological and molecular data (Walker et al., 2004; Walker and Sytsma, 2007) and 987 living species of Salvia are distributed on the world (Hassler, 2020). Previously, 86 Salvia species were determined in Turkey by Hedge (1982a) and later, the number of species was raised to 100 (Davis et al., 1988; Vural and Adiguzel, 1996; Donmez, 2001; Celep et al., 2015), 53 of which are endemic in Turkey (Guner et al., 2012; Celep et al., 2015). About half of the species generally found in Central Anatolia and 23 species are present in NE Anatolia (Guner et al., 2012). Boissier (1879) determined 75 Salvia species from Turkey. He found out seven sections (Salvia (Syn. Euphace) Benth. (1876:1195), Hymenosphace Benth. (1876:1195), Drymosphace Benth. (1876:1195), Aethiopis Benth. (1876:1195), Plethiosphace Benth. (1876:1195), Horminum Benth. (1876:1195) and Hemisphace Benth. (1876:1196), which had been all previously recognized by Bentham (1833). The section Salvia, represented by 24 species in Turkey (Celep et al., 2015), has about 600 species in the world (Santos, 1995). Turkish Salvia are shrubs or perennial herbs with a relatively primitive staminal structure. The characteristic features of this section are leaves pinnatisect or simple, stems herbaceous or suffruticose, calyx little enlarging after anthesis and not diverging lips, upper lip of corolla is more or less straight and corolla tube is annulate. Staminal connectives are equal or slightly longer than filaments and lower theca is fertile (Hedge, 1972). Türkiye is one of the major diversity centers for the genus Salvia and comprises aproximately 90 species in our country. Endemism ratio is 45% (Hedge, 1982; Davis et al., 1988; Hamzaoglu et al., 2005; Aktaş et al., 2009). Recent studies showed that Artvin has the highest plant species *Corresponding author. E-mail: oeminagaoglu@artvin.edu.tr 1Vocational School of Health Services, Artvin Çoruh University, 08000 Artvin-Türkiye. https://doi.org/10.3329/bjpt.v29i2.63524 mailto:oeminagaoglu@artvin.edu.tr 168 EMINAGAOGLU et al. in Turkey. There are lots of floristic studies and new plant records in Artvin (Anşin et al., 1997; Eminağaoğlu and Anşin, 2004; Eminağaoğlu, 2009; Eminağaoğlu, 2012; Eminağaoğlu et al., 2012a, b; Eminağaoğlu and Ozcan 2013, 2014, 2018; Eminağaoğlu, 2015; Yüksel and Eminağaoğlu, 2017; Eminağaoğlu et al., 2018; Yüksel and Akyıldırım Beğen, 2018; Akyıldırım Beğen and Yüksel, 2018; Eminağaoğlu and Eminağaoğlu, 2018). During fieldwork in Ardanuç in 2013, it was observed that the specimens were different from other Salvia species with morphology and habitat characteristics. Detailed studies with herbarium samples and all data about these specimens confirmed the existence of this new subspecies of Salvia, Salvia divaricata subsp. artvinense in Turkiye. Materials and Methods Plant material Specimens of Salvia divaricata subsp. artvinense were collected from Ardanuç province (Artvin) during field studies within the scope of the project “Determination of Native Plants in Artvin’’ (Eminağaoğlu, 2015). Morphological characteristics of new subspecies were recorded both in the field and in the laboratory. All specimens collected from area were evaluated and compared with literature (Komarov, 1934-78; Grossheim, 1939-1967; Hedge, 1982a; Eminağaoğlu and Anşin 2003, 2004) and different resources including Flora Orientalis (Boissier, 1879), Flora Europaea (Hedge, 1972) and Flora of the USSR (Pobedimova, 1954). Also, Salvia specimens have been checked in ANK, GAZI, ISTE and ISTO herbaria. Samples are deposited in Artvin Coruh University Herbarium (ARTH). The morphological features of the new subspecies were studied with stereo-binocular microscope. Furthermore, photos and notes made in the field were used for description and drawings from different parts of the samples by using stereo microscope (Figs 1, 2). Anatomical preparations Stem and leaf parts of living specimens were used in anatomical observations. Different plant parts were stored in 70% alcohol for anatomical studies. Transverse sections of stem and leaf, and peripheral sections of upper and lower epidermis of leaves were taken by hand using commercial razor blades, and Haematoxylin solution for about 15 min was used for staining. Sections were washed in water several times to remove the excess stain (Algan, 1981). Semi-permanent slides were mounted in glycerin, and well stained sections were examined under a light microscope and photographed using an Olympus BX53 microscope with digital camera attachment DP73. Micromorphological examinations Micro and macromorphological features of the seeds were studied using a stereomicroscope (Leica M60 with a digital camera attachment DFC295) and a scanning electron microscope (Zeiss Evo LS10, ACU Science-Research Center). The seeds were first examined using a stereomicroscope to determine size, shape, color and maturity, and were then photographed. For scanning electron microscopy, mature seeds were placed on stubs using double-sided adhesive tape, and coated with gold in a Cressington sputter coater 108 auto coating apparatus for 2-3 minutes. Seeds were examined and photographed from the middle part of the lateral region. The terminology for cypselar characteristics proposed by Stearn (1985) was adopted to describe the fruit coat, size and shape, cell arrangements and primary sculpturing. A NEW TAXON OF SALVIA (LAMIACEAE) 169 DNA extraction, polymerase chain reaction amplification (PCR) and sequencing DNA extraction of Salvia leaves was applied using kit procedure (PureLink Genomic DNA kits) according to the manufacturer’s protocol. trnL (UAG) (5- CTGCTTCCTAAGAGCAGCGT- 3) / rpL32 (5_ CAGTTCCAAAAAAACGTACTT C-3) primers (Shaw et al., 2007) were used for PCR amplification. PCR were performed in 50 μl volume containing Taq DNA polymerase buffer with 6 μl MgCl2 (2 mM), 5 μl 10x TAE Buffer, 0,5 μl dNTP (0.2 mM), 0,5 μl each forward and reverse primer (0.3 mM), 0,2 μl 5 U of Taq DNA polymerase and 2 μl of genomic DNA (20–100 ng). Thermocycling was performed with BioRad T100 Thermal Cycler. The temperature profile of amplification included an initial denaturation step of 95 °C for 5 min followed by 37 cycles of 94 °C for 30 s, 51°C for 1 min, 72 =°C for 1 min and a final elongation period of 72 °C for 5 min, then storaged at + 4 °C. PCR products were resolved in 1 % agarose gel by electrophoresis at 85 volts, after a single band was observed, PCR products (50–250 ng/ul) were cleaned and then sequenced both forward and reverse direction at the Macrogen. Phylogenetic studies The sequences were aligned in BioEdit v.7.0.9.0 (Hall, 1999) and DnaSP v.5.10 (Librado and Rozas, 2009). This programs were used to determine haplotypes and to estimate haplotype and nucleotide diversities within each species. We used MEGA 7.0 (Tamura et al., 2013) to calculate the genetic distances among sequences of the Salvia species, based on the Kimura 2- parameter (K2P) model of DNA substitution (Kimura, 1980) and their reliability has been tested with 10,000 bootstrap replications (Felsenstein, 1985). Phylogenetic trees were constructed using tree analyses: maximum parsimony (MP). S. hylocharis (KC473351) and S. coccinea (KC473345) species were used as an outgroup in the phylogenetic analysis. List of Salvia species were given in Table 1. All Salvia species on the table are genetically the closest species to S. divaricata subsp. artvinense selected by Blast (Basic Local Alignment Search Tool-Genebank). Table 1. Information and GenBank accession numbers of Salvia species. Taxon Voucher Location GeneBank accession Salvia divaricata subsp. artvinense O.Emin 16896 Artvin, Turkey S. divaricata W620659 NPGS KU578226.1 S. tomentosa W020129 Sichuan, China KU578214.1 S. aucheri W020132 Sichuan, China KU578248.1 S. coccinea NA67377 NPGS KC473345 S. sclarea W620660 NPGS KC473391 S. hylocharis PI440651 Sichuan, China KC473351 Results and Discussion Taxonomic treatment Salvia divaricata subsp. artvinense Eminagaoglu, Ozcan & Akyıldırım, subsp. nov. (Fig.1). Type: TURKEY. Artvin, Ardanuç, roadside, sloping area, 41°09′26″ N, 42°00′01″ E, 492 m, 19 June 2013, O.Emin 16896 (ARTH 13579, 13580). Morphological description: Erect, perennial herbs; 40–54 cm tall, with several stems arising from a woody rootstock; stems glabrous; Leaves simples, developed towards the base, spreading, petioles 1.1–6 cm long, ciliate; basal leaf blades ovate, 3.2–11 × 0.8–3.5 cm, apex and base 170 EMINAGAOGLU et al. obtuse, margin crenate, upper surface sparsely eglandular pilose, beneath densely tomentose (Fig. 3). Inflorescences an elongate, widely branched panicle, peduncles 4.5–9 cm long. Verticillasters 2-4 flowered, clearly distant. Bracts and bracteoles absent or deciduous early at the development of the inflorescence. Pedicels 1.8–3 cm long, glabrous, rigid, erecto-patent. Calyx tubular- campanulate, green, tube 12–17 mm long, densely glandular pilose and sometimes a few eglandular villous hairs; upper lip obsoletely tridentate; calyx lobes acuminate, posterior lobe 3- veined, lobes 5–6 mm long. Fig. 1. Salvia divaricata subsp. artvinense. A-B. Habit. C. Inflorescence peduncle and floral bracts. D. Calyx lobes and corolla color. E. Nutlets. Scale bar: 1000 µm. Corolla white-yellow or dirty yellow, tube straight below, widening above, 25–30 mm long; posterior lobe of the corolla galeate, with the external surface pubescent, 2–3 cm long; anterior lobe 5–7 (–8) mm long, reflexed, internal basal surface tomentosa pubescent. Stamens included; A NEW TAXON OF SALVIA (LAMIACEAE) 171 filaments 0.8–1 cm long; connectives 3–4 mm long. Style 2.5–3.5 cm long, pubescent. Stigma forked. Seed 69-78,5 x55-62 mm, pale or dark, black, brown, hilum 15-19 mm. Fig. 2. Drawings. A. inflorescens. B. basal leaves. C. flower. D. calyx. E. dissected flower. F-G. different type leave. Scale bars: A, B, D, F, G, H = 1 cm. C = 5 mm. E = 1mm, illustrations were drawn from the holotype (O.Emin 16896) by Dr. Melahat Ozcan. Distribution and ecology: Salvia divaricata subsp. artvinense is endemic to Artvin, Turkey and only known from the type locality. This species has small population size in the field observation. Partly a mixture of terrestrial and Mediterranean climate; the summers are warm and dry, while the winters are partly warm and less rainy, characteristic plants such as Alyssum artvinense Busch., Micromeria elliptica K.Koch, Hedysarum hedysaroides (L.) Schinz & Thell., Satureja hortensis L., Colutea armena Boiss. & Huet., Cotinus coggyria Scop., Teucrium polium L., Thymus praecox Opiz, Capparis sicula subsp. herbacea (Willd.) Inocencio, D.Rivera, Obón & Alcaraz. 172 EMINAGAOGLU et al. Phenology: It has been registered flowering in June and fruiting in September. Conservation status: Only one populations with nearly 45 individuals of Salvia divaricata subsp. artvinense in Artvin were determined. The area of occupancy was 8 km2 (less than 10 km2), extent of occurrence was 82 km2 (less than 100 km2) and continuing decline was observed, and number of mature individuals was 45 (less than 250). The population of the species is threatened by extinction because of road construction activities. Therefore, the threat category should be assessed as Critically Endangered [CR: B1+2b (i,ii); C2a(i)] status (IUCN, 2021). Fig. 3. Difference of leaf types between S. divaricata (A-B) and S. divaricata subsp. artvinense (C-D). Remarks: Salvia divaricata subsp. artvinense resembles S. divaricata, S. tomentosa (Sec. Salvia), in habit, pedicels long; narrow leaves shapes. However, yellow-white corolla color in Salvia divaricata subsp. artvinense differs significantly, whereas the lilac color and taller plant size, smaller pedicel size and lilac corolla of S. divaricata and S. tomentosa are very distinct morphological characters. In addition; S. divaricata subsp. artvinense spreads below 600 m, but S. divaricata is over 1400 m. Additional specimens examined (paratypes) Salvia divaricata subsp. artvinense: TÜRKİYE. Artvin: Ardanuç, 1-2 km to road, 41°09′26″ N, 42°00′01″ E, 483 m, 19 June 2013, O.Emin 16896 (ARTH! 13579); Artvin: Ardanuç, near road, 41°09′27″ N, 42°00′09″ E, 486 m, 02 June 2017, O.Emin 22364 (ARTH! 13580); S. divaricata: TURKEY. Sivas: between Zara-Divriği, 1630 m, 15 July 2007, Z.Aytaç 9543 (GAZİ!); Erzincan: İliç, Pınar village, 03 July 1977, G.Arar, M.A. Ömür, S.Boldağ (İSTE 116!); Nevşehir: Cappadoce Oriental, 1836, Coquebert de Montbret, A.F.E., 2379 (K, K000929686!); ARMENIA. Type Specimen; 1837 Aucher-Eloy, P.M.R. 1528 (CJB G00156024!); S. tomentosa: TÜRKİYE. Van: İ. Karakısa 1585 (VAN!). Key to the species of Salvia (sect. Salvia) based on morphological characters 1a. Stem quadrangular, verticillate 4-10 flowers S. tomentosa 1b. Stem rounded, verticillate 2-4 flowers 2 2a. Pedicels 15-30 mm; leaves narrowly oblong, 3.2-7.8 x 0.8-2.7 cm 3 A NEW TAXON OF SALVIA (LAMIACEAE) 173 2b. Pedicels 1.5-7 mm; leaves oblong to ovate, 1.4-13.5 x 0.6-6 cm 4 3a. Corolla lilac S. divaricata 3b. Corolla white-yellow S. divaricata subsp. artvinense 4a. Calyces 12-16 mm; leaves cuneate at base S. aramiensis 4b. Calyces 6-8 mm; leaves ± cordate or rounded at base S. aucheri Anatomical characteristics Stem: Anatomical studies reveal that stem is almost rounded and has collenchymatic tissue in the corners. The epidermis contains a single layer of cells. There are simple and multicellular trichomes above the epidermis. Parenchymatic cortex has been observing 6-8 series. Vascular bundles of corners are larger than others and it is possible to observe small vascular bundles at the interfacicular areas arranged in a one circle. Sclerenchymatous caps were present above vascular bundles. Cambium is indistinguishable. Large pith formed of cylindrical and thin walled big parenchymatic cells are present in the stem (Figs. 4A, 6C). Leaf: Midrib is hemispherical in outline. 2-3 layers of collenchyma are present under a single epidermal layer. One large vascular bundle can be seen in the midrib region. Simple densely trichomes or glandular trichomes are observed in upper and lower surfaces. Simple trichomes contain 2-4 stalk cells and glandular trichomes with in two shape as capitate and peltate. Capitate trichomes have one-two stalk cells and one or two head cells, while peltate trichomes contain one large head. This type trichomes are only present in abaxial surfaces of leaf. There is a single- layered epidermis. In terms of size, upper epidermal cells are much larger than those of the abaxial ones. Lamina is bifacial (dorsiventral) and mesophyll composed of 3-4 layers of spongy parenchyma and two layers of palisade parenchyma (Fig. 2C, D). Leaf is amphistomatic, and diacytic type stomata are observed in the depths (Fig. 5A; upper epidermis, 5B; lower epidermis). Petiole: It is hemisperical or more or less triangular in outline. Mechanical tissue develops in the corners of triangular outline. Petiole is also surrounded by collateral tissue. One large vascular bundle in the center and three-four accessory bundles in the corners are present (Fig. 4Bb). Several simple trichomes with up to four stalk cell and capitate trichomes with different stalk cells encircled the petiol (Figs. 4B, 6A, B). Mericarp micromorphology Mericarp color was brown to blackish. Their size varied from 2.57 mm to 4.13 mm in length and 2.0 mm to 3.26 in width. They ranged in length to width ratio from 1.27 to 1.36. Shape of the mericarps was broadly ovoid to rotund. The nutlet surfaces are glabrous, distinctly rought with protuberances and undulate. Epidemal cells are irregular and anticlinal walls are not distinct and represented by undulate channel. The attachment scar diameter ranges from 0.79 mm to 1.0 mm. Their color is dark brown to brackish (Fig. 7). Molecular analysis A dataset of cpDNA sequences with 800 bp was analyzed for 7 taxa. Both Bayesian and MP analyses produced the same topology. The Bayesian inference tree with both posterior probability and maximum parsimony bootstrap support values is shown in Fig. 8. Both Bayesian and MP analyses showed that the ingroup formed a well-supported clade with 0.63 posterior probability and 65% bootstrap value, respectively (Fig. 8). The new subspecies is resolved as sister to the S. divaricata confirming its novelty in the genus. 174 EMINAGAOGLU et al. Fig. 4. Cross sections of S. divaricata subsp. artvinense. A. stem. B. petiole. C. leaf midrib. D. leaf lamina. 1: general appearance, 2: magnified part. Scale bars: 1 = 200 µm. 2 = 100 µm. cl: collenchyma, ct: capitate trichome, p: pith, ph: phloem, pp: palisade parenchyma, pt: peltate trichome, s. sclerenchyma, sh: simple trichome, sp: spongy parenchyma, ue: upper epidermis, xy: xylem, vb: vascular bundle. A NEW TAXON OF SALVIA (LAMIACEAE) 175 Fig. 5. Peripheral sections of Salvia divaricata subsp. artvinense. A. upper epidermis. B. lower epidermis. C. trichomes from upper epidermis. D. trichomes from lower epidermis. See Fig. 1 for abbreviations. Scale bars: A, B, C2, D2 = 50 µm. C1, D1 = 100 µm. 176 EMINAGAOGLU et al. Fig. 6. Some trichomes from different parts of Salvia divaricata subsp. artvinense. A-B. petiole. C. stem. Scale bar: 100 µm. Fig. 7. Nutlet of S. divaricata subsp. artvinense. A. general appearance. B. 200X. C. 500X. D. 1000X. The new subspecies Salvia divaricata subsp. artvinense is smilar to S. divaricata, S. aucheri, S. tomentosa and S. aramiensis (Sect. Salvia), with some morphological characters but differented by yellow-white corolla color. S. aucheri and S. aramiensis can be separated from S. divaricata subsp. artvinense by various morphological characters including taller plant size, smaller pedicel size and lilac corolla color. S. divaricata subsp. artvinense has narrowly oblong leaves, tubular campanulate calyx shape and 2-4 flowers per node like S. divaricata. In contract, S. divaricata has lilac-pink corolla color, smaller leaf size (4-7 x 0, 8-2 cm) and less pubescence structure upper and lower surface of leaves. S. divaricata subsp. artvinense spreads below 600 m, but S. divaricata is over 1400 m. Their differences are given in Table 2. A NEW TAXON OF SALVIA (LAMIACEAE) 177 Table 2. Morphological comparisons of related Salvia species. Character S. divaricata subsp. artvinense S. tomentosa S. divaricata S. aucheri S. aramiensis Life form herb subshrub herb herb suffruticose Stem erect rounded quadrangular decumbent erect erect clump-forming Plant size (m) 0.4-0.6 0.4-0.75 0.4-0.5 0.3-1 1 Underground perennation structures present -- present absent absent Pubescence on the stem surface glabrous (above) pilose (below) glabrous above shortly patent hairs glabrous (above) Pilose (below) glabrous (above) Pilose (below) finely pilose Leaf Size (cm) 3.2–11 × 0.8–3.5 5–5.5 × 1.5–2 3-8 x 0.8-2.5 4-10x 2-5 1.4-5 x 0.6-1.7 Shape narrowly oblong - ovate elliptical narrowly oblong elliptic to ovate-elliptic, narrowly oblong to ovate Base obtuse rounded or cuneate obtuse -- clustered Pubescence in the upper surface densely pilose strongly rugose, sparsely covered pilose -- -- Pubescence in the lower surface densely tomentose short fine appressed white hairs tomentose adpressed white pubescent -- Petiole length (cm) 1.1–6 5-7 1-5 1.5-4 1.7-5.5 Inflorescence Pedicel size (mm) 18–30 5-10 15-30 3-4 1.5-4(-7) Number of flowers per node 2-4 4-10 2-4 2 4-10 Flower Calyx length (mm) 12–17 12-15 15 6-8 12-16 Calyx shape tubular-campanulate --- tubular- campanulate ovate- to tubular- campanulate campanulate Corolla color white-yellow pink-lilac lilac lilac Corola tube length (mm) 25–30 24-36 34 25 25-30 Flowering time 6-8 6-7 7-10 5-6 Elevation range 490-550 m 90-1600m 1500-1800m 550-1350m 250-600m In the Flora of USSR, some diagnostic characters of S. trigonocalyx missed, flower colors were not given in its description by Woronow (1912). Additionally, S. trigonocalyx taxon was indicated as synonym of S. tomentosa, recently (Hassler, 2020; Banki et al., 2021). Till now, S. divaricata was only collected from Sivas and Erzincan (Türkiye). This species was not reported from Artvin in recent investigations. By taking the morphological differences observed in stem, leaves, inflorescences and flower colour, S. divaricata subsp. artvinense was distinguished as a new subspecies, after its comparison with all the revised herbarium specimens and data provided in the bibliography. Metcalfe and Chalk (1972) has previously reported in the family Lamiaceae has a quadrangular stem and a well developed collenchyma in the corners. Özdemir and Şenel (1999) and Polat et al. (2017) also reported rectangular stem in S. sclarea L. and in S. divaricata Montbret & Aucher ex Benth, respectively. On the contrary, Aktaş et al. (2009) reported rounded stem without collenchyma in the corners for S. tchihatcheffii. Cortex consists of three different cell 178 EMINAGAOGLU et al. types as parenchyma, 6-8 layers and collenchyma, only in the corners. Simple and multicellular trichomes are observed in epidermal layers. Cambium is indistinguishable. Large pith formed of thin walled big parenchymatic cells in the pith of stem. Our findings about stem chracteristics are similar to the reports for S. sclarea (Özdemir and Şenel, 1999) and S. divaricata (Polat et al., 2017). Fig. 8. Molecular phylogenetic relationship within Salvia with the maximum parsimony bootstrap support values. Petiole anatomical structure is very important for the family Lamiaceae. Several studies were conducted on Salvia spp. (Özdemir and Şenel, 1999; Polat et al., 2017). Özdemir and Şenel (1999) previously reported eglandular and glandular trichomes, parenchymatic cortex and two large vascular bundles with small bundles in the petiole of S. sclarea. Polat et al. (2017) also mentioned many glandular and eglandular hairs on the uniseriate epidermal cells. Similarly, we found a lot of unicellular simple trichomes and peltate and capitate glandular trichomes in the epidermal layers of petioles. The petiole is triangular in outline and composed of large parenchymatic cortex. In contrast to S. sclarea (Özdemir and Şenel, 1999), one big vascular bundle in the middle of petiole and four small bundles on the edges can be seen in S. divaricata subsp. artvinense. These results are in accordance with some reports in literatures (Nakipoğlu and Oğuz, 1990). Polat et al. (2017) also reported single median vascular bundle with a crescent appearance but two small bundles on the edges differently from us. In addition, median vascular bundle of S. divaricata subsp. artvinense is smaller than S. divaricata and do not have crescent appearance. S. divaricata subsp. artvinense has bifacial (dorsiventral mesophyll) leaf and diacytic type of stomata. Stomata are present both upper and lower epidermal surfaces (amphistomatic leaf). Metcalfe and Chalk (1972); Özdemir and Şenel (1999) and Polat et al. (2017) also mentioned these characters in some Salvia species. Like stem and petiole, leaves also have different types of trichomes. Eglandular trichomes in all parts are unicellular, but glandular trichomes with in the shapes of capitate and peltate. Peltate trichomes with fragrant essential oil are present only in lower parts of leaves in S. divaricata subsp. artvinense and they have previously been reported in S. sclarea (Özdemir and Şenel, 1999), in S. tchihatcheffii (Aktaş et al., 2009) and Polat et al. (2017). Mericarp length, shape of mericarp and exocarp cells and structure of anticlinal walls have been reported significant diagnostic characters by Büyükkartal et al. (2011). Hedge (1982) reported rounded, trigonous or rounded-trigonous in the mericarp of some Turkish Salvia species. Özkan et al. (2009) determined three sculpturing in 12 Salvia taxa as foveate, reticulate and verrucate. Büyükkartal et al. (2011) reported colliculate pattern in some Salvia taxa. Seed of this new species was ovoid shape, however their surface ornamentation was determined as ruminate. A NEW TAXON OF SALVIA (LAMIACEAE) 179 Our molecular analysis based on cpDNA sequences confirmed that S. divaricata subsp. artvinense distinguishable from all other species in the series (Fig. 8). In the phylogeny, S. divaricata was resolved as sister to Salvia divaricata subsp. artvinense. All data confirmed that S. divaricata subsp. artvinense is distinguishable from all other species in the series (Table 2). The population of the species is in danger of extinction due to road construction activities. For this reason, it should be produced by being transported to the botanical garden (Eminağaoğlu and Eminağaoğlu, 2018), protected and transported to another suitable habitat. Acknowledgements The authors sincerely thank to Prof. Dr. Askın AKPULAT (curators of CUFH) and Prof. Dr. Sukran KULTUR (curators of the ISTE). These new taxa were collected during the Determination of Artvin’s Native Plants Project, which is funded by Ziraat Bank. References Aktas, K. Özdemir, C. Özkan, M. Akyol, Y. and Baran, P. 2009. Morphological and anatomical characteristics of Salvia tchihatcheffii endemic to Turkey. Afr. J. Biotechnol. 8(18): 4519–4528. Akyıldırım Beğen, H. and Yüksel, E. 2018. Alanbaşı ve Bakırtepe (Yusufeli, Artvin, Turkey) ve çevresinin florası. Turk. J. Biod. 1(1): 17–23. Algan, G. 1981. Bitkisel dokular için mikroteknik. Fırat Universitesi Fen Fakültesi Yayınları No.1 İstanbul Matbaa Teknisyenleri Basımevi. Anşin, R. Özkan, Z.C. Abay, G. and Eminağaoğlu, Ö. 1997. New floristic records from A8 (Artvin). Ot Sist. Botan. Derg. 4(1): 95–98. Bánki, O.R, Döring, Y., Ower, M., Vandepitte, G., Hobern, L., Remsen, D., Schalk, D., DeWalt, P., Keping, R.E., Miller, M., Orrell, J., Aalbu, T., Adlard, R., Adriaenssens, R., Aedo, E., Aescht, C., Akkari, E., Alonso-Zarazaga, N. 2021. Catalogue of Life Checklist (Version 2021-11-09). Catalogue of Life. https://doi.org/10.48580/d4t4. Bentham, G. 1832–1836. Labiatarum Genera et species. Ridgeway London. 783 pp. Bentham, G. 1876. Labiatae. In: Bentham, G. and Hooker, J.D. (Eds.), Genera Plantarum, vol. 2. Reeve & Co., 1160–1223, London. Boissier, E. 1879. Flora Orientalis. Regulation Acad Scientific 4: 823–854. Büyükkartal, H.N. Kahraman, A. Çölgeçen, H. Doğan, M. and Karabacaki E. 2011. Mericarp micromorphology and anatomy of Salvia hedgeana Dönmez, S. huberi Hedge and S. rosifolia Sm. (section Salvia Hedge, Lamiaceae). Acta Bot. Croat. 70 (1): 65–80. Celep, F. Dirmenci, T. and Güner, Ö. 2015. Salvia hasankeyfense (Lamiaceae), a new species from Hasankeyf (Batman, South-eastern Turkey). Phytotaxa 227 (3): 289–294. Davis, P.H. Mill, R.R. and Tan, K. 1988. Flora of Turkey and the east Aegean Islands. Edinburgh University Press. 10: 201–210 London. Donmez, A. 2001. A New Turkish species of Salvia L. (Lamiaceae). Bot J Linn Soc. 137: 413–416. Eminağaoğlu, Ö. (Ed). 2015. Artvin’ in Doğal Bitkileri (Native Plants of Artvin). İstanbul: Promat. Eminağaoğlu, Ö. 2009. The Plant Diversity of Tekkale-Çevreli and Cemketen Villages (Yusufeli, Artvin). Batumi Botanical Garden Bulletin 33: 152–159. Eminağaoğlu, Ö. 2012. Artvin'de Doğa Mirası, Camili'nin Doğal Bitkileri. İstanbul: Promat. Eminağaoğlu, Ö. and Anşin, R. 2003. The flora of Hatila Valley National Park and its close environs (Artvin). Turk. J. Bot. 27(1): 1–27. Eminağaoğlu, Ö. and Anşin, R. 2004. Flora of the Karagöl-Sahara National Park (Artvin) and its environs. Turk. J. Bot. 28(6): 557–590. Eminağaoğlu, Ö. and Eminağaoğlu, Z. 2018. Some thoughts on botanical garden establishment in Artvin. Int. J. Ecosyst. Ecol. Sci. 8(4): 767-776. https://doi.org/10.48580/d4t4. 180 EMINAGAOGLU et al. Eminağaoğlu, Ö. and Özcan, M. 2013. Euonymus leiophloeus (Celastraceae): A new record for the Flora of Turkey. Bangladesh J. Plant Taxon 20(2): 263–266. Eminağaoğlu, Ö. and Özcan, M. 2014. Systematics of Sisyrinchium angustifolium Mill. (Iridaceae), A newly recorded species from Turkey. Bangladesh J. Plant Taxon. 21 (2): 175–180. Eminağaoğlu, Ö. and Özcan, M. 2018. Morphological and anatomical studies of the newly recorded Rhus chinensis Mill. (Anacardiaceae) from Turkey. Bangladesh J. Plant Taxon 25 (1): 71–78. Eminağaoğlu, Ö. Akyıldırım Beğen, H. and Aksu, G. 2018. Karadağ florası (Yusufeli, Artvin-Türkiye). ACU J. For. Fac. 19(1): 93-113 Eminağaoğlu, Ö. Özcan, M. and Kültür, Ş. 2012b. Contributions to the leaf and stem anatomy of Tradescantia fluminensis Vell. (Commelinaceae): An alien species new to the flora of Turkey. ACU J. For Fac. 13 (2): 270–277. Eminağaoğlu, Ö. Özkaya, M.S. and Akpulat, H.A. 2012a. A New Record for the Flora of Turkey: Sorbus caucasica var. caucasica (Rosaceae). Turk. J. Bot. 36 (4): 426–426. Eminağaoğlu, Ö. Yüksel, E. and Akyıldırım Beğen, H. 2018. Flora of the Hod Valley (Artvin, Turkey). Int. J. Ecosyst. Ecol. Sci. 8(2): 273–282. Felsenstein, J. 1985. Confidence limits on phylogenies with a molecular clock. Syst Zool. 34: 152–161. Grossheim, A.A. 1939-1967. Flora Kavkaza, Vol. 1-7, Bakü ve Leningrad. Guner, A. Aslan, S. Ekim, T. Vural, M. and Babaç, M.T. 2012. Türkiye Bitkileri Listesi (Damarlı Bitkiler). Nezahat Gökyiğit Botanik Bahçesi ve Flora Araştırma Derneği Yayını, İstanbul. Hall, T. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41: 95–98. Hamzaoglu, E. Duran, A. and Pınar, N.M. 2005. Salvia anatolica (Lamiaceae), A new species from East Anatolia, Turkey. Ann. Bot. Fenn. 42: 215–220. Hassler, M. 2020. World Plants: Synonymic Checklists of the Vascular Plants of the World (version Nov 2018). In: Roskov Y., Ower G., Orrell T., Nicolson D., Bailly N., Kirk P.M., Bourgoin T., DeWalt R.E., Decock W., Nieukerken E. van, Zarucchi J., Penev L., (eds.), 2020. Species 2000 & ITIS Catalogue of Life, 2019 Annual Checklist. Digital resource at www.catalogueoflife.org/annual-checklist/2019. Species 2000: Naturalis, Leiden, the Netherlands. ISSN 2405-884X. Hedge, I. C. 1982a. Flora of Turkey and the east Aegean Islands. In: Davis Ph, Edmondson Jr, Mill Rr & Tan K. (eds), Salvia L. 7: 400–461, Edinburgh University Press. Hedge, I.C. 1972. Salvia L. In: Tutın Tg, Heywood Vh, Burges Na, Valentine Dh, Walters Sm & Webb Da. (ed.), Flora Europaea 3: 188–192 Cambridge University Press. Hedge, I.C. 1982b. Salvia L. In: Rechinger Kh. (ed.), Flora Iranica 150: 403–476, Akademische Druck und Verlagsanstalt, Graz. IUCN 2021. The IUCN Red List of Threatened Species. . IUCN, Gland, Switzerland. Retrieved on17 January 2020. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide substitutions. J. Mol. Evol. 16: 111–120. Komarov, V.L. 1934-78. Flora of the U.S.S.R. Vol. 1-30, Israel Program for Scientific Translations, Jerusalem. Librado, P. and Rozas, J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. J. Bioinform. 25: 1451–1452. Metcalfe, C.R. and Chalk, L. 1972. Anatomy of the Dicotyledons II. – Clarendon Press, Oxford 2: 1041– 1053. Nakipoğlu, M. and Oğuz, G. 1990. İzmir çevresinde yayılış gösteren Salvia (Adaçayı) türlerinin biyosistematiği üzerine araştırmalar. EGE JFS. 1(2): 23–29. Özdemir, C. and Şenel, G. 1999. The morphological, anatomical and karyological properties of Salvia sclarea L. Turk. J. Bot. 23: 7–18. http://www.catalogueoflife.org/annual-checklist/2019. http://www.iucnredlist.org A NEW TAXON OF SALVIA (LAMIACEAE) 181 Özkan, M. Aktaş, K. Özdemir, C. and Guerin, G. 2009. Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey. Acta Bot. Croat. 68(1): 105–115. Pobedimova, E.G. 1954. Salvia L. In: Schischkin BK (Ed.) Flora of the USSR. Vol. 21. – Translated from Russian, Israeli Program Scientific Translations, Jerusalem, pp. 178–260. Polat, R. Cakilcioglu, U. Selvi, S. Türkmen, Z. and Kandemir, A. 2017. The anatomical and micromorphological properties of three endemic and medicinal Salvia species (Lamiaceae) in Erzincan (Turkey). Plant Biosyst. 151 (1): 63–73. Santos, E.P. 1995. Estudo das inflorescências no gênero Salvia L. subgênero Calosphace (Benth.) Benth. (Lamiaceae). Bradea 6: 372–379. Shaw, J. Lickey, E.B. Schilling, E.E. and Small, R.L. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am. J. Bot. 94: 275–288. Stearn, W.T. 1985. Botanical Latin. 3th edition. David & Charles Publishers, USA. Tamura, K. Stecher, G. Peterson, D. Filipsk, A. and Kumar, S. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30: 2725–2729. Vural, M. and Adıgüzel, N. 1996. A new species from Central Anatolia: Salvia aytachii M.Vural et N. Adıgüzel (Labiateae). Turk. J. Bot. 20: 531–534. Walker, J.B. and Sytsma, K.J. 2007. Staminal evolution in the genus Salvia (Lamiaceae): molecular phylogenetic evidence for multiple origins of the staminal lever. Ann. Bot. 100: 375–391. Walker, J.B. Sytsma, K.J. Treutlein, J. and Wink, M. 2004. Salvia (Lamiaceae) is not monophyletic: implications for the systematics, radiation, and ecological specializations of Salvia and tribe Mentheae. Am. J. Bot. 91: 1115–1125. Yüksel, E. and Akyıldırım Beğen, H. 2018.The flora of Dereiçi village (Yusufeli, Artvin, Turkey) and its surroundings. Turk. J. Biod. 1(1): 34–40. Yüksel, E. and Eminağaoğlu, Ö. 2017. Flora of the Kamilet Valley (Arhavi, Artvin, Turkey). Int. J. Ecosyst. Ecol. Sci. 7(4): 905–914. (Manuscript received on 18 May, 2021; revised on 21 November, 2022)