Bangladesh J. Plant Taxon. 32(1): 65-75, 2025 (June) DOI: https://doi.org/10.3329/bjpt.v32i1.82393 © 2025 Bangladesh Association of Plant Taxonomists MOLECULAR CHARACTERIZATION AND MULTILOCUS DNA BARCODE-BASED DELIMITATION OF DURANTA ERECTA L. MORPHOTYPES FROM NIGERIA ABDULQUADRI SAGAYA * AND ABDULLAHI ALANAMU ABDULRAHAMAN Department of Plant Biology, Faculty of Life Sciences,University of Ilorin, Ilorin, Nigeria Keywords: Duranta; Phylogenetic relationship; Plastid marker; Species identification; Phenotypic plasticity. Abstract This study assessed whether the observed morphological variation among eight distinct forms of Duranta erecta in Nigeria reflects true genetic divergence or represents phenotypic plasticity within a single species. The forms are distributed across geo- political zones in Nigeria and were characterized based on leaf coloration, margin types, and branching architecture. These forms exhibit variations in their chemical compositions, suggesting potential differences in their DNA profiles. DNA was extracted from leaf samples of all eight morphological forms, and conventional PCR was employed to amplify three marker regions: ITS, matK, and rbcL. The amplified fragments were visualized on 1% agarose gel electrophoresis, sequenced, and analyzed phylogenetically using MEGA-11. The matK marker exhibited 100% sequence identity, indicating minimal variation among the forms. In contrast, rbcL and ITS displayed 99% sequence identity, with ITS revealing greater polymorphic variation. Phylogenetic tree analysis showed the highest support values for rbcL, followed by ITS and matK. The combined topologies generated from the three markers revealed no significant differences in the evolutionary history of the eight Duranta erecta forms. This result suggests a gene flow among the forms, confirming their classification as a single species. Introduction The genus Duranta L., (Verbenaceae) comprises shrubs, often exhibiting a climbing growth habit. The branches are typically spiny, particularly on older stems, and young branches are pubescent. Of the approximately 17 species in the genus (Munir, 1995), Duranta erecta is the most widespread and extensively cultivated for ornamental purposes. In Nigeria, it is widely grown as an ornamental hedge plant, for beautification, boundary demarcation, and urban landscaping due to its hardiness and aesthetic appeal. Beyond its ornamental value, D. erecta has a long history of ethnomedicinal use. It is traditionally employed in the treatment of tumors, malaria with spleen inflammation, scorpion stings, insect bites, dysentery, and diarrhea. In countries such as Burkina Faso, Ghana, Nigeria, and Tanzania, it is also used for treating infections, parasitic and digestive system disorders, and diabetes (Maregesi et al., 2008; Ghaisas et al., 2009; Awah et al., 2010). D. erecta is distinguished by its axillary racemose inflorescences, membranous sparsely puberulent leaves, relatively long calyx teeth apicules, and a short corolla tube measuring 7–9 mm, which distinguish it from other related species (Sanders, 2001). Despite its well-defined morphology, D. erecta exhibits significant phenotypic variation in Nigeria, particularly in leaf shape, flower color, thorn, and reproductive traits. These inconsistencies have led to taxonomic debates, with some researchers suggesting the existence of *Corresponding author. Email: sagaya.aa@unilorin.edu.ng https://doi.org/10.3329/bjpt.v32i1.82393 mailto:sagaya.aa@unilorin.edu.ng 66 SAGAYA AND ABDULRAHAMAN multiple forms or subspecies (Liu et al., 2012; Moroni et al., 2019). While morphometric and chemometric studies (Sagaya and AbdulRahaman, 2023a, b) have attempted to address these complexities, a molecular characterization remains crucial for resolving ambiguities, as morphological traits alone can be influenced by environmental factors and phenotypic plasticity. DNA barcoding has emerged as a powerful tool for species delimitation, particularly in cases where morphological distinctions are unreliable (Heinrichs et al., 2011). This technique relies on short, standardized DNA sequences called “barcodes” to distinguish between species. Although highly effective in animals, especially through the use of the cytochrome c oxidase subunit I (COI) gene (Chen et al., 2010). Barcoding in plants presents unique challenges due to slower mutation rates, widespread hybridization, and polyploidy (Fazekas et al., 2009). To address this, plant DNA barcoding primarily relies on chloroplast (rbcL, matK) and nuclear (ITS) regions (Besse et al., 2021). The rbcL gene is widely used for its high amplification success across plant taxa (Kress and Erickson, 2007), while matK provides higher evolutionary resolution (Lahaye et al., 2008). The ITS region, due to its high variability, offers superior discriminatory power (Sass et al., 2007) and has been recommended by the Consortium for the Barcode of Life (CBOL, 2009) for plant identification alone or in combination with other barcode. This study employs ITS, matK, and rbcL markers to molecularly characterize the eight morphologically distinct forms of D. erecta in Nigeria. Resolving the taxonomic confusion surrounding this species is essential for clarifying its molecular relationships and improving the understanding of the various forms cultivated in Nigeria. Materials and Methods Sample Collection and DNA Extraction Fresh leaf samples from eight distinct morphological forms of Duranta erecta were collected from four states across three geopolitical zones: Kwara (North Central), Kebbi and Sokoto (North West), and Borno (North East) in Nigeria (Table 1). The leaves were cleaned, and genomic DNA was extracted using the Qiagen DNeasy Plant Mini Kit, following the protocol outlined by Lee et al. (2016). The extracted DNA was stored at –20°C in the DNA Bank of the Molecular Plant Systematics Research Group (MPSRG), University of Ilorin, Nigeria until further use. Polymerase Chain Reaction (PCR) Amplification and Agarose Gel Electrophoresis Three target DNA region were amplified: two plastid regions (matK and rbcL) and one nuclear ribosomal region (ITS) (Table 2). These regions were selected due to their frequent use in plant species identification, high interspecific variability and amplification efficiency (Kress et al., 2009; Kress et al., 2007; Lahaye et al. 2008). PCR reactions were carried out in a 25 μl reaction mixture containing 12.5 μl of Taq 2X PCR master mix (New England Biolabs), 1 μl each of forward and reverse primers (10 μM), 9.5 μl of double-sterilized distilled water (ddH₂O), and 1 μl of DNA template. A control reaction was prepared by substituting ddH₂O for the DNA template. To prepare the DNA samples for electrophoresis, 5 μl of the extracted DNA was mixed with 1 μl of 6X gel-loading buffer containing 0.25% bromophenol blue and 30% sucrose in TE buffer (pH 8.0). A 0.8% agarose gel was prepared using 0.5 μg/ml SYBR Green in 0.5X Tris-Borate- EDTA (TBE) buffer. The DNA mixture was loaded onto the gel, and TBE buffer was used as the running buffer. Electrophoresis was performed for one hour at 75 V. The gels were visualized using a Genei UV transilluminator, and photographs were captured under a UV lamp using a Nikon digital camera (AKZ-S9 model) (Fig. 1). MOLECULAR CHARACTERIZATION AND MULTILOCUS DNA BARCODE-BASED 67 Table 1. Brief descriptions and coordinates of the Duranta erecta forms employed in this study. Sl. No. Forms of D. Erecta Sample sources (states) Geopolitical zones Gps coordinate Brief morphological description of samples at their location 1 Green bush (GB) Kwara North Central 8o28’48.30672N 4o40’34.9824E Erect stem with serrate to entire green leaves, branches long rarely with a single node with fascicle leaves poorly developed. 2 Yellow bush (YB) Kwara North Central 8o28’48.30672N 4o40’34.9824E Branches composed of several nodes and internodes with fascicle serrated to entire yellow leaves well develop. 3 Variegated yellow (VY) Kwara North Central 8o28’48.30672N 4o40’34.9824E Erect stem with serrate to dentate variegated yellow leaves, branches are a bit longer with decussate opposite thorn and leaves. 4 Variegated white (VW) Kwara North Central 8o28’48.30672N 4o40’34.9824E Erect stem with serrate to dentate variegated white leaves, branches are a bit longer with decussate opposite leaves. 5 Thorny green (TG) Kebbi North West 12o27’16.22N 4o12’2.14E Erect stem with fully serrated green leaves, branches are upright, armed with thorn on opposite sides. 6 Variegated yellow double (VYD) Kebbi North West 12o27’16.22N 4o12’2.14E Erect stem with serrate to dentate plane with variegated yellow leaves, branches are a bit longer with decussate opposite leaves. 7 Plain yellow (PY) Sokoto North West 13o1’37.77N 5o14’20.998E Erect stem with serrate to dentate plain yellow leaves, branches are straight with decussate opposite thorn and leaves. 8 Broad green (BG) Borno North East 11o47’24N 13o10’12E Widely spread branches with half serrated to entire glabrous leaves. Note: GPS coordinates were converted to standard degree–minute–second (DMS) notation for consistency. Morphotype codes (e.g., GB, YB, VY) are used consistently in the text and figures to aid cross-reference. Table 2. Gene regions and their respective sequences. Primer name Sequence Reference ITS1 TCCGTAGGTGAACCTGCGG White et al. (1990) ITS4 TCCTCCGCTTATTGATATGC White et al. (1990) rbcL_F ATGTCACCACAAACAGAGACTAAAGC Levin, (2003) rbcL_R GTAAAATCAAGTCCACCRCG Kress and Erickson, (2007) matK_390f CGATCTATTCATTCAATATTTC Cuenoud et al. (2002) matK_132r TCTAGCACACGAAAGTCGAAGT Cuenoud et al. (2002) Sequence Quality, Alignment, and Phylogenetic Analyses Raw sequence data were analyzed using a combination of software tools. SeqTrace 0.9.0 (Singh and Kumar, 2012) to view raw sequence data and generate consensus sequences. Alignment of DNA sequences was carried out using AliView version 1.17-beta1 (Larsson, 2014). Finalized sequences were submitted to the NCBI GenBank database, and accession numbers were obtained. Phylogenetic tree construction was performed using MEGA 11 (Tamura et al., 2021). The DNA sequences of D. erecta samples were subjected to BLAST analysis in the NCBI database (http://www.ncbi.nlm.nih.gov/blast/blast.cgi) for species verification. Nucleotide composition (A, T, G, C content) and sequence lengths were determined using the online GC http://www.ncbi.nlm.nih.gov/blast/blast.cgi 68 SAGAYA AND ABDULRAHAMAN Content Calculator (https://www.sciencebuddies.org/science-fair-projects/references/genomics-g- c-content-calculator). Fig. 1. Image of the Gel electrophoresis for PCR quality check (A= rbcL; B= ITS and C= matK Note: L: Ladder; BG: Broad green; TG: Thorny green; YV: Plain yellow; VYD: Variegated yellow double; VW: Variegated white; VY: Variegated white; YB: yellow bush and GB: Green bush. For phylogenetic reconstruction, Parodianthus ilicifolius (GenBank Accession: DQ463786) was selected as the outgroup based on BLAST similarity and previous taxonomic placement. The sequence variation and similarity percentages were also assessed. Phylogenetic trees were constructed using both the Neighbor-Joining (NJ) and Maximum Likelihood (ML) methods implemented in MEGA v11 (Tamura et al., 2021). The optimal nucleotide substitution model was determined using Akaike Information Criterion (AIC), which selected the Tamura 3-parameter (T92) model. Node support was assessed with 1000 bootstrap replicates for both individual and concatenated barcode sequences. Gaps and ambiguous positions were excluded from the analyses to ensure accuracy. Results and Discussion DNA Extraction and Amplification High-quality genomic DNA could initially not be obtained from Duranta erecta forms due to their high content of secondary metabolites, which form complexes with proteins and nucleic acids (Agawane et al., 2019; Inglis, 2018). This issue was effectively mitigated by incubating leaf samples at 65°C for 35–45 min, which disrupted problematic polyphenolic compounds and https://www.sciencebuddies.org/science-fair-projects/references/genomics-g-c-content-calculator https://www.sciencebuddies.org/science-fair-projects/references/genomics-g-c-content-calculator MOLECULAR CHARACTERIZATION AND MULTILOCUS DNA BARCODE-BASED 69 reduced viscosity caused by co-precipitated polysaccharides (Sablok et al., 2009; Schenk et al., 2023). Schenk et al. (2023) emphasized that adjustments of extraction protocols improved DNA purity and subsequent PCR success. All three DNA-barcode regions (matK, rbcL, and nuclear ITS) were successfully amplified from the eight D. erecta forms. The observed amplicon sizes (875 bp for matK, 570 bp for rbcL, and 671 bp for ITS) fell within recommended ranges (CBOL, 2009; Li et al., 2011; Kumar et al., 2015). However, incomplete amplification was noted for ITS in the broad green form and rbcL in the variegated yellow form, likely due to sequence variation or incomplete concerted evolution (Mirarab et al., 2016). BLAST Identification and Sequence Variation BLAST analysis identified all barcode sequences as D. erecta with 92–100% sequence identity and E-value of zero (0), confirming species-level identification. High identity scores and low E-values are indicative of accurate taxonomic placement (Wahyuni et al., 2023). Among the barcodes, matK displayed 100% similarity, ITS 98–99%, and rbcL 92–99%. These results affirm the reliability of DNA barcodes in taxonomic identification. Sequence nucleotide composition and G–C content are summarized in Tables 3–5 and illustrated in Fig. 2. The ITS region exhibited the highest G–C content (64.8–66.5%), followed by rbcL (44.7–46.4%) and matK (34.6–35.1%). This ordering aligns with earlier findings (Castro et al., 2015; Tang et al., 2016; Song et al., 2021), and supporting the distinct genomic characteristics of each barcode region. Fig. 2. Percentage of Guanine -Cytosine (G-C) content for ITS, matK and rbcL for the eight Duranta erecta forms. Multiple sequence alignment (Table 6) revealed 77 variable sites (11.48%) in ITS, 62 (10.88%) in rbcL, and 18 (2.06%) in matK. The ITS region exhibited 66 single-nucleotide polymorphisms (SNPs), with the broad green form showing the highest levels of polymorphism and indel frequency. The high variability in ITS supports its potential as a discriminating marker in DNA barcoding studies (Pang et al., 2011; Wang et al., 2011; Su et al., 2015). Comparative studies (Fu et al., 2011; Castro et al., 2015) further affirm ITS is superior in resolution over chloroplast loci. 70 SAGAYA AND ABDULRAHAMAN Table 3. The size and nucleotide content of the ITS genes of Duranta erecta forms. Plant samples Size (bp) A (bp) T (bp) G (bp) C (bp) G-C content (%) Green bush 652 125 96 199 232 66.1 Thorny green 657 126 94 201 236 66.5 Broad green 236 41 42 63 90 64.8 Variegated yellow 656 126 95 201 234 66.3 Variegated white 637 125 92 193 227 65.9 Variegated yellow double 658 128 96 199 235 66.0 Yellow bush 664 127 97 203 237 66.3 Plain yellow 662 130 96 201 235 65.9 Table 4. The size and nucleotide content of the matK genes of Duranta erecta forms. Plant Samples Size (bp) A (bp) T (bp) G (bp) C (bp) G-C content (%) Green bush 850 246 307 137 160 34.9 Thorny green 860 247 314 137 162 34.8 Broad green 848 246 306 136 160 34.9 Variegated yellow 845 244 304 137 160 35.1 Variegated white 871 252 318 139 162 34.6 Variegated yellow double 871 251 316 139 165 34.9 Yellow bush 852 246 308 138 160 35 Plain yellow 856 247 311 137 161 34.8 Table 5. The size and nucleotide content of the rbcl genes of Duranta erecta forms. Plant Sample Size (bp) A (bp) T (bp) G (bp) C (bp) G-C content (%) Green bush 548 152 151 125 120 44.7 Thorny green 544 150 147 127 120 45.4 Broad green 570 158 154 134 124 45.3 Variegated yellow 332 87 91 76 78 46.4 Variegated white 538 150 146 125 117 45 Variegated yellow double 546 151 151 125 119 44.7 Yellow bush 554 156 151 127 120 44.6 Plain yellow 457 121 125 99 112 46.2 Table 6. Variation of the DNA barcodes of individual locus and their combinations. Parameters ITS rbcL matK Conserved 589 492 854 Variable site 77 62 18 Parsimony information site (PI) 11 18 5 Singleton 66 41 6 Percentage of variable point 11.48 10.88 2.06 Average pairwise distance 0.0112 0.0084 0.0015 MOLECULAR CHARACTERIZATION AND MULTILOCUS DNA BARCODE-BASED 71 Fig. 3. Neighbor joining tree constructed based on the A: ITS; B: matK and C: rbcL sequences with a bootstrap of 1000 replicates. Phylogenetic Analysis Neighbor-Joining (NJ) analysis produced bootstrap supports of ≥79%, 46%, and 27% for rbcL, ITS, and matK, respectively (Fig. 3). In contrast, Maximum Likelihood (ML) analysis produced stronger support values of 95, 81 and 50%, respectively (Fig. 4). These results suggest rbcL offers the highest phylogenetic resolution, outperforming ITS and matK. This trend corroborating previous reports (CBOL, 2009; Kress et al., 2009; Oyebanji et al., 2020). The lower resolution of matK supports the report of Parks et al. (2009), highlighting its limited effectiveness in recently diverged taxa. 72 SAGAYA AND ABDULRAHAMAN Fig. 4. Maximum Likelihood phylogram for A: rbcL; B: ITS and C: matK sequences in Duranta erecta and the sampled accessions. NJ trees distinctly separated the plain yellow form from other D. erecta forms, while ML results clustered most forms with reference sequences. Concatenated analyses of two-locus and three-locus combinations yielded modest gains in intraspecific structure; notably, the variegated yellow double and thorny green forms clustered together across rbcL+matK, matK+ITS, and rbcL+ITS analyses, though this association did not hold in the three-locus tree (Fig. 5). This indicates potential gene flow among the forms and suggests genetic cohesion within the species. MOLECULAR CHARACTERIZATION AND MULTILOCUS DNA BARCODE-BASED 73 Fig. 5. Maximum likelihood phylogram for the combined A: rbcL+matK; B: matK+ITS; C: rbcL+ITS; D: rbcL+matK+ITS sequences in Duranta erecta. This study confirms that rbcL is the most effective barcode for discriminating D. erecta forms, offering high amplification success, high BLAST identity, and strong phylogenetic resolution. The ITS region, despite lower amplification stability, exhibits highest sequence variability and potential for distinguishing closely related forms. The matK region, while useful for standardization, demonstrated limited resolution in this taxonomic context. These findings align with CBOL (2009) recommendations for multi-locus barcoding and support the inclusion ITS as a potent combination for intraspecific discrimination. Given the potential hybrid origin of D. erecta and its capacity for gene flow, caution should be taken when interpreting sensitive morphological forms. Future work could further improve resolution using whole plastome sequencing or genomic SNP analysis to robustly address intraspecific variation. Acknowledgements The authors wish to express their appreciation goes to the curator of Department of Plant Biology, University of Ilorin Herbarium in person of Mr Bolu Ajayi for his support on the provision and identification of the plant specimen used for this study. Also, to the laboratory technologist for the facilities provided and time given during the research work. References Agawane, S.B., Gupta, V.S., Kulkarni, M.J., Bhattacharya, A.K., Koratkar, S.S. and Rao, V.K. 2019. Patho- physiological evaluation of Duranta erecta for the treatment of urolithiasis. J. Ayurveda Integrated. Med. 10(1): 4–11. Awah, F.M., Uzoegwu, P.N., Oyugi, J.O., Rutherford, J., Ifeonu, P., Yao, X.J., Fowke, K.R. and Eze, M.O. 2010. Free radical scavenging activity andimmunomodulatory effect of Stachytarpheta angustifolia leaf extract. Food Chemistry, 119: 1409-1416. 74 SAGAYA AND ABDULRAHAMAN Besse, P., Da Silva, D. and Grisoni, M. 2021. Plant DNA Barcoding Principles and Limits: A Case Study in the Genus Vanilla. In: Besse, P. (ed.), Molecular Plant Taxonomy: Methods and Protocols, Methods in Molecular Biology Vol. 2222. Springer Nature, pp. 131–148. Castro, C., Hernandez, A., Alvarado, L. and Flores, D. 2015. DNA barcodes in fig cultivars (Ficus carica L.) using ITS regions of ribosomal DNA, the psbA-trnH spacer and the matK coding sequence. Am. J. Plant Sci. 6: 95–102. CBOL Plant Working Group. 2009. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 106(31): 12794–12797. Chen, S., Hui, Y., Jianping, H., Chang, L., Jingyuan, S., Linchun, S., Yingjie, Z., Xinye, M., Ting, G., Xiaohui, P., Kun, L., Ying, L., Xiwen, L., Xiaocheng, J., Yulin, L. and Christine, L. 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 5(1): e8613. Fazekas, A.J., Kesanakurti, P.R., Burgess, K.S., Percy, D.M., Graham, S.W., Barrett, S.C.H., Newmaster, S.G., Hajibabaei, M. and Husband, B.C. 2009. Are plant species inherently harder to discriminate than animal species using DNA barcoding markers? Mol. Ecol. Resour. 9: 130–139. Fu, Y.M., Jiang, W.M. and Fu, C.X. 2011. Identification of Species within Tetrastigma (Miq.) Planch. (Vitaceae) Based on DNA Barcoding Techniques. J. System. Evol. 49: 237-245. Ghaisas, M.M., Shaikh, S.A. and Deshpande, A.D. 2009. Evaluation of the immunomodulatory activity of ethanolic extract of the stem bark of Bauhinia variegata Linn. International J. Green Pharm. 3: 70-74. Heinrichs, J., Kreier, K. H.-P., FeldbergSchmidt, A. R., Zhu, R.-L., Shaw, B., Shaw, A. J. and Wissemann, V. 2011. Formalizing morphologically cryptic biological entities: new insights from DNA taxonomy, hybridization, and biogeography in the leafy liverwort Porella platyphylla (Jungermanniopsida, Porellales). American J. Bot. 98(8): 1252-1262. Inglis, P. W., Pappas, M. dC. R., Resende, L.V. and Grattapaglia, D. 2018. Fast and inexpensive protocols for consistent extraction of high quality DNA and RNA from challenging plant and fungal samples for high- throughput SNP genotyping and sequencing applications. PLoS ONE 13(10): e0206085. Kress, J.W., Erickson, D.L., Jones, F.A., Swenson, N.G., Perez, R. and Sanjur, O. 2009. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Nat. Acad. Sci. United States, 106: 18621-18626. Kress, W. J. and Erickson, D. L. 2007. A two-locus global dna barcode for land plants: the coding rbcL gene complements the non-coding trnh-psbA spacer region. PLoSONE, 2(6): E508. Kumar, J.U.S., Krishna, V., Seethapathy, G.S., Senthilkumar, U., Raghupathy, S., Ganeshaiah, K.N., Ganeshan, R., Newmaster, S.G., Ravikanth, G. and Shankar, R.U. 2015. DNA barcoding to assess species adulteration in raw drug trade of “Bala” herbal products in South India. Biochem. System. Ecol. 61: 501-509. Lahaye, R., van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, S. O., Duthiot, O., Barraclough, T.G. and Savolainen, V. 2008. DNA barcoding thefloras of biodiversity hotspots. Proceedings of the National Academy of Sciences, USA, 105(8): 2923–2928. Larsson, A. 2014. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics (Oxford, England) 30(22): 3276–3278. Lee, S.Y., Ng, W.L., Mahat, M.N., Nazre, M. and Mohammed, R. 2016. DNA barcoding of the endangered Aquilaria (Thymelaeaceae) and ITS application in species authentication of agarwood products traded in the market. PLoS ONE 11(4): e0154631. Li, L., Li, J., Rohwer, J.G., van der Werff, H., Wang, Z.H. and Li, H.W. 2011. Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical Amphi-Pacific disjunctions. American J. Bot. 98: 1520-1536. Liu, Z., Chen, S.L., Song, J.Y., Zhang, S.J. and Chen, K.L. 2012. Application of deoxyribonucleic acid barcoding in Lauraceae plants. Pharmacognosy Magazine 8: 4-11. MOLECULAR CHARACTERIZATION AND MULTILOCUS DNA BARCODE-BASED 75 Maregesi, S.M., Pieters, L., Ngassapa, O.D., Apers, S., Vingerhoets, R., Cos, P., Berghe, D. A. and Vlietinck, A. 2008. Screening of some Tanzanian medicinalplants from Bunda district for antibacterial, antifungal and antiviralactivities. J. Ethnopharmacol. 119: 58–66. Mirarab, S., Bayzid, M.S. and Warnow, T. 2016. Evaluating summary methods for multilocus species tree estimation in the presence of incomplete lineage sorting. Syst Biol. 65(3): 366–380. Moroni, P., Salomón, L. and O’Leary, N. 2019. A framework for untangling Linnaean names based on Plumier’sNova plantarumamericanarum genera: Revised typification of Duranta erecta. Taxon. 67(6): 1202–1220. Munir, A.A., 1995. A taxonomic review of the genus Duranta L. (Verbenaceae) in Australia. J. Adelaide Botanic Gardens 16: 1-16. Oyebanji, O.O., Chukwuma, E.C., Bolarinwa, K.A., Adejobi, O.I., Adeyemi, S.B., and Ayoola, A.O. 2020. Re-evaluation of the phylogenetic relationships and species delimitation of two closely related families (Lamiaceae and Verbenaceae) using two DNA barcode markers. J. Biosci. 45: 1-15. Pang, X. H., Song, J.Y., Zhu, Y.J., Xu, H.X., Huang, L.F. and Chen, S.L. 2011. Applying plant DNA barcodes for Rosaceae species identification. Cladistics, 27(2): 165–170. Parks, M., Cronn, R. and Liston, A. 2009. Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes . BMC Biol. 7(84): 1-17 Sablok, G., Gahlot, P., Gupta, A. K., Pareek, K. and Shekhawat, N.S. 2009. Extraction of PCR usable DNA from trees of arid environment. Plant Omics J. 2: 103-109. Sagaya, A. and AbdulRahaman A. A. 2023a. Morphometric studies of accessions of Duranta erecta L. (Vebernaceae) complex in Nigeria. Borneo J. Resource Sci. Technol. 13(1): 108-119. Sagaya, A. and AbdulRahaman, A.A. 2023b. Systematic Implication of GC-MS Analysis of Secondary Metabolites in Duranta erecta L. Forms in Nigeria. Sri Lankan J. Biol. 8(1): 23-33. Sanders, R. W. 2001. The genera of Verbenaceae in the southeastern United States. Harvard Papers in Bot. 5: 303–358. Sass, C., Little, D.P., Stevenson, D.W. and Specht, C.D. 2007. DNA barcoding in the Cycadales: testing the potential of proposed barcoding markers for species identification of cycads. PloS ONE 11: e1154. Schenk, J. J., Becklund, L. E., Carey, S. J. and Fabre, P. P. 2023. What is the "modified" CTAB protocol? Characterizing modifications to the CTAB DNA extraction protocol. Applied Plant Sci. 11(3): e11517. Singh, V. and Kumar, V. 2012. An optimised method of DNA isolation from highly mucilage rich okra (Abelmoschus esculentus L.) for PCR analysis, Pelagia Res. Library 3: 1809-1813. Song, W., Feng, Q., Zhang, Y., Wu, X., Shi, C and Wang, S. 2021. The complete chloroplast genome of Duranta erecta (Verbenaceae). Mitochondrial DNA Part B: Resources 6(7): 1832-1833. Su, X., Wu, G.L., Li, L.L. and Liu, J.Q. 2015. Species delimitation in plants using the Qinghai-Tibet Plateau endemic Orinus (Poaceae: Tridentinae) as an example. Annals of Botany, 116(1): 35–48. Tamura, K., Stecher, G. and Kumar, S. 2021. MEGA 11: Molecular Evolutionary Genetics Analysis version 11. Molecular Biol. Evolu. 38(7): 3022- 3027. Tang, Y., Wu, Y., Huang, R., Chao, N., Liu, Y., Xu, P., Li, K., Cai, D. and Luo, Y. 2016. Molecular identification of Uncaria(Gouteng) through DNA barcoding. Chinese Medicine 11(3): 1-14. Wahyuni, D. K., Yoku , B. F., Mukarromah, S. R., Purnama, P. R., Ilham, M., Rakashiwi, G. A., Indriati, D. T., Junairiaha, Wacharasindhu, S., Prasongsuk, S., Subramaniam, S. and Purnobasuki, H. 2023. Unraveling the secrets of Eclipta alba (L.) Hassk.: a comprehensive study of morpho-anatomy and DNA barcoding. Brazilian J. Bot. 83: 83, e274315. Wang, Q., Yu, Q.S. and Liu, J.Q. 2011. Are nuclear loci ideal for barcoding plants? A case study of genetic delimitation of two sister species using multiple loci and multiple intraspecific individuals. Journal of Systematics and Evolution, 49(3): 182–188. (Manuscript received on 15 December 2024; revised on 25 May 2025)