id	sid	tid	token	lemma	pos
bionys-314	1	1	mohammadi	mohammadi	PROPN
bionys-314	1	2	et	et	PROPN
bionys-314	1	3	al	al	PROPN
bionys-314	1	4	.	.	PROPN
bionys-314	1	5	2020	2020	NUM
bionys-314	1	6	,	,	PUNCT
bionys-314	1	7	biologica	biologica	PROPN
bionys-314	1	8	nyssana	nyssana	PROPN
bionys-314	1	9	11(1	11(1	NUM
bionys-314	1	10	)	)	PUNCT
bionys-314	1	11	11	11	NUM
bionys-314	1	12	(	(	PUNCT
bionys-314	1	13	1	1	NUM
bionys-314	1	14	)	)	PUNCT
bionys-314	1	15	september	september	PROPN
bionys-314	1	16	2020	2020	NUM
bionys-314	1	17	:	:	PUNCT
bionys-314	1	18	45	45	NUM
bionys-314	1	19	-	-	SYM
bionys-314	1	20	54	54	NUM
bionys-314	1	21	doi	doi	NOUN
bionys-314	1	22	:	:	PUNCT
bionys-314	1	23	10.5281	10.5281	NUM
bionys-314	1	24	/	/	SYM
bionys-314	1	25	zenodo.4060294	zenodo.4060294	NUM
bionys-314	1	26	a	a	DET
bionys-314	1	27	real	real	ADJ
bionys-314	1	28	-	-	PUNCT
bionys-314	1	29	time	time	NOUN
bionys-314	1	30	pcr	pcr	NOUN
bionys-314	1	31	assay	assay	NOUN
bionys-314	1	32	for	for	ADP
bionys-314	1	33	evaluation	evaluation	NOUN
bionys-314	1	34	of	of	ADP
bionys-314	1	35	drought	drought	NOUN
bionys-314	1	36	tolerance	tolerance	NOUN
bionys-314	1	37	in	in	ADP
bionys-314	1	38	a	a	DET
bionys-314	1	39	new	new	ADJ
bionys-314	1	40	tea	tea	NOUN
bionys-314	1	41	clone	clone	NOUN
bionys-314	1	42	original	original	ADJ
bionys-314	1	43	article	article	NOUN
bionys-314	1	44	narjes	narjes	PROPN
bionys-314	1	45	mohammadi	mohammadi	PROPN
bionys-314	1	46	department	department	PROPN
bionys-314	1	47	of	of	ADP
bionys-314	1	48	biology	biology	NOUN
bionys-314	1	49	,	,	PUNCT
bionys-314	1	50	faculty	faculty	NOUN
bionys-314	1	51	of	of	ADP
bionys-314	1	52	science	science	NOUN
bionys-314	1	53	,	,	PUNCT
bionys-314	1	54	university	university	NOUN
bionys-314	1	55	of	of	ADP
bionys-314	1	56	guilan	guilan	PROPN
bionys-314	1	57	,	,	PUNCT
bionys-314	1	58	rasht	rasht	NOUN
bionys-314	1	59	,	,	PUNCT
bionys-314	1	60	iran	iran	PROPN
bionys-314	1	61	mohammadi_narges32@yahoo.com	mohammadi_narges32@yahoo.com	NUM
bionys-314	1	62	akbar	akbar	PROPN
bionys-314	1	63	norastehnia	norastehnia	PROPN
bionys-314	1	64	department	department	PROPN
bionys-314	1	65	of	of	ADP
bionys-314	1	66	biology	biology	NOUN
bionys-314	1	67	,	,	PUNCT
bionys-314	1	68	faculty	faculty	NOUN
bionys-314	1	69	of	of	ADP
bionys-314	1	70	science	science	NOUN
bionys-314	1	71	,	,	PUNCT
bionys-314	1	72	university	university	NOUN
bionys-314	1	73	of	of	ADP
bionys-314	1	74	guilan	guilan	PROPN
bionys-314	1	75	,	,	PUNCT
bionys-314	1	76	rasht	rasht	NOUN
bionys-314	1	77	,	,	PUNCT
bionys-314	1	78	iran	iran	PROPN
bionys-314	1	79	norasteh@guilan.ac.ir	norasteh@guilan.ac.ir	VERB
bionys-314	1	80	(	(	PUNCT
bionys-314	1	81	corresponding	corresponding	ADJ
bionys-314	1	82	author	author	NOUN
bionys-314	1	83	)	)	PUNCT
bionys-314	1	84	mohannad	mohannad	PROPN
bionys-314	1	85	m.	m.	NOUN
bionys-314	1	86	sohani	sohani	PROPN
bionys-314	1	87	department	department	PROPN
bionys-314	1	88	of	of	ADP
bionys-314	1	89	biology	biology	NOUN
bionys-314	1	90	,	,	PUNCT
bionys-314	1	91	faculty	faculty	NOUN
bionys-314	1	92	of	of	ADP
bionys-314	1	93	science	science	NOUN
bionys-314	1	94	,	,	PUNCT
bionys-314	1	95	university	university	NOUN
bionys-314	1	96	of	of	ADP
bionys-314	1	97	guilan	guilan	PROPN
bionys-314	1	98	,	,	PUNCT
bionys-314	1	99	rasht	rasht	NOUN
bionys-314	1	100	,	,	PUNCT
bionys-314	1	101	iran	iran	PROPN
bionys-314	1	102	msohani@guilan.ac.ir	msohani@guilan.ac.ir	VERB
bionys-314	1	103	korosh	korosh	PROPN
bionys-314	1	104	falakroo	falakroo	PROPN
bionys-314	1	105	tea	tea	PROPN
bionys-314	1	106	research	research	PROPN
bionys-314	1	107	institute	institute	PROPN
bionys-314	1	108	,	,	PUNCT
bionys-314	1	109	lahijan	lahijan	PROPN
bionys-314	1	110	,	,	PUNCT
bionys-314	1	111	iran	iran	PROPN
bionys-314	1	112	k.falakro@areo.ir	k.falakro@areo.ir	VERB
bionys-314	1	113	received	receive	VERB
bionys-314	1	114	:	:	PUNCT
bionys-314	1	115	september	september	PROPN
bionys-314	1	116	14	14	NUM
bionys-314	1	117	,	,	PUNCT
bionys-314	1	118	2019	2019	NUM
bionys-314	1	119	revised	revise	VERB
bionys-314	1	120	:	:	PUNCT
bionys-314	1	121	february	february	PROPN
bionys-314	1	122	24	24	NUM
bionys-314	1	123	,	,	PUNCT
bionys-314	1	124	2020	2020	NUM
bionys-314	1	125	accepted	accept	VERB
bionys-314	1	126	:	:	PUNCT
bionys-314	1	127	march	march	PROPN
bionys-314	1	128	23	23	NUM
bionys-314	1	129	,	,	PUNCT
bionys-314	1	130	2020	2020	NUM
bionys-314	1	131	abstract	abstract	NOUN
bionys-314	1	132	:	:	PUNCT
bionys-314	1	133	drought	drought	NOUN
bionys-314	1	134	stress	stress	NOUN
bionys-314	1	135	induces	induce	VERB
bionys-314	1	136	oxidative	oxidative	ADJ
bionys-314	1	137	stress	stress	NOUN
bionys-314	1	138	with	with	ADP
bionys-314	1	139	subsequent	subsequent	ADJ
bionys-314	1	140	increases	increase	NOUN
bionys-314	1	141	in	in	ADP
bionys-314	1	142	reactive	reactive	ADJ
bionys-314	1	143	oxygen	oxygen	NOUN
bionys-314	1	144	species	specie	NOUN
bionys-314	1	145	ros	ros	PROPN
bionys-314	1	146	in	in	ADP
bionys-314	1	147	plants	plant	NOUN
bionys-314	1	148	.	.	PUNCT
bionys-314	2	1	to	to	PART
bionys-314	2	2	evaluate	evaluate	VERB
bionys-314	2	3	oxidative	oxidative	ADJ
bionys-314	2	4	stress	stress	NOUN
bionys-314	2	5	intensity	intensity	NOUN
bionys-314	2	6	with	with	ADP
bionys-314	2	7	re	re	NOUN
bionys-314	2	8	-	-	NOUN
bionys-314	2	9	irrigation	irrigation	NOUN
bionys-314	2	10	,	,	PUNCT
bionys-314	2	11	changes	change	NOUN
bionys-314	2	12	in	in	ADP
bionys-314	2	13	superoxide	superoxide	NOUN
bionys-314	2	14	dismutase	dismutase	NOUN
bionys-314	2	15	(	(	PUNCT
bionys-314	2	16	sod	sod	NOUN
bionys-314	2	17	)	)	PUNCT
bionys-314	2	18	expression	expression	NOUN
bionys-314	2	19	were	be	AUX
bionys-314	2	20	investigated	investigate	VERB
bionys-314	2	21	by	by	ADP
bionys-314	2	22	real	real	ADJ
bionys-314	2	23	-	-	PUNCT
bionys-314	2	24	time	time	NOUN
bionys-314	2	25	pcr	pcr	NOUN
bionys-314	2	26	in	in	ADP
bionys-314	2	27	two	two	NUM
bionys-314	2	28	tea	tea	NOUN
bionys-314	2	29	clones	clone	NOUN
bionys-314	2	30	,	,	PUNCT
bionys-314	2	31	dn	dn	NOUN
bionys-314	2	32	and	and	CCONJ
bionys-314	2	33	100	100	NUM
bionys-314	2	34	.	.	PUNCT
bionys-314	3	1	results	result	NOUN
bionys-314	3	2	showed	show	VERB
bionys-314	3	3	that	that	SCONJ
bionys-314	3	4	sod	sod	NOUN
bionys-314	3	5	expression	expression	NOUN
bionys-314	3	6	and	and	CCONJ
bionys-314	3	7	other	other	ADJ
bionys-314	3	8	measured	measure	VERB
bionys-314	3	9	factors	factor	NOUN
bionys-314	3	10	,	,	PUNCT
bionys-314	3	11	except	except	SCONJ
bionys-314	3	12	for	for	ADP
bionys-314	3	13	carotenoids	carotenoid	NOUN
bionys-314	3	14	,	,	PUNCT
bionys-314	3	15	increased	increase	VERB
bionys-314	3	16	under	under	ADP
bionys-314	3	17	drought	drought	NOUN
bionys-314	3	18	stress	stress	NOUN
bionys-314	3	19	in	in	ADP
bionys-314	3	20	clone	clone	NOUN
bionys-314	3	21	dn	dn	NOUN
bionys-314	3	22	,	,	PUNCT
bionys-314	3	23	but	but	CCONJ
bionys-314	3	24	the	the	DET
bionys-314	3	25	changes	change	NOUN
bionys-314	3	26	were	be	AUX
bionys-314	3	27	not	not	PART
bionys-314	3	28	significant	significant	ADJ
bionys-314	3	29	in	in	ADP
bionys-314	3	30	clone	clone	NOUN
bionys-314	3	31	100	100	NUM
bionys-314	3	32	,	,	PUNCT
bionys-314	3	33	compared	compare	VERB
bionys-314	3	34	to	to	ADP
bionys-314	3	35	control	control	VERB
bionys-314	3	36	.	.	PUNCT
bionys-314	4	1	all	all	PRON
bionys-314	4	2	of	of	ADP
bionys-314	4	3	the	the	DET
bionys-314	4	4	meaningful	meaningful	ADJ
bionys-314	4	5	increases	increase	NOUN
bionys-314	4	6	in	in	ADP
bionys-314	4	7	evaluated	evaluated	ADJ
bionys-314	4	8	enzymatic	enzymatic	ADJ
bionys-314	4	9	and	and	CCONJ
bionys-314	4	10	non	non	ADJ
bionys-314	4	11	-	-	ADJ
bionys-314	4	12	enzymatic	enzymatic	ADJ
bionys-314	4	13	antioxidant	antioxidant	ADJ
bionys-314	4	14	factors	factor	NOUN
bionys-314	4	15	were	be	AUX
bionys-314	4	16	eliminated	eliminate	VERB
bionys-314	4	17	with	with	ADP
bionys-314	4	18	re	re	NOUN
bionys-314	4	19	-	-	NOUN
bionys-314	4	20	irrigation	irrigation	NOUN
bionys-314	4	21	.	.	PUNCT
bionys-314	5	1	the	the	DET
bionys-314	5	2	observed	observe	VERB
bionys-314	5	3	changes	change	NOUN
bionys-314	5	4	indicate	indicate	VERB
bionys-314	5	5	that	that	SCONJ
bionys-314	5	6	clone	clone	NOUN
bionys-314	5	7	dn	dn	NOUN
bionys-314	5	8	activated	activate	VERB
bionys-314	5	9	its	its	PRON
bionys-314	5	10	antioxidant	antioxidant	ADJ
bionys-314	5	11	defense	defense	NOUN
bionys-314	5	12	system	system	NOUN
bionys-314	5	13	in	in	ADP
bionys-314	5	14	response	response	NOUN
bionys-314	5	15	to	to	ADP
bionys-314	5	16	drought	drought	NOUN
bionys-314	5	17	.	.	PUNCT
bionys-314	6	1	in	in	ADP
bionys-314	6	2	contrast	contrast	NOUN
bionys-314	6	3	,	,	PUNCT
bionys-314	6	4	the	the	DET
bionys-314	6	5	lack	lack	NOUN
bionys-314	6	6	of	of	ADP
bionys-314	6	7	response	response	NOUN
bionys-314	6	8	in	in	ADP
bionys-314	6	9	clone	clone	NOUN
bionys-314	6	10	100	100	NUM
bionys-314	6	11	indicates	indicate	VERB
bionys-314	6	12	higher	high	ADJ
bionys-314	6	13	levels	level	NOUN
bionys-314	6	14	of	of	ADP
bionys-314	6	15	tolerance	tolerance	NOUN
bionys-314	6	16	of	of	ADP
bionys-314	6	17	this	this	DET
bionys-314	6	18	new	new	ADJ
bionys-314	6	19	clone	clone	NOUN
bionys-314	6	20	against	against	ADP
bionys-314	6	21	drought	drought	NOUN
bionys-314	6	22	.	.	PUNCT
bionys-314	7	1	key	key	ADJ
bionys-314	7	2	words	word	NOUN
bionys-314	7	3	:	:	PUNCT
bionys-314	7	4	drought	drought	NOUN
bionys-314	7	5	,	,	PUNCT
bionys-314	7	6	oxidative	oxidative	ADJ
bionys-314	7	7	stress	stress	NOUN
bionys-314	7	8	,	,	PUNCT
bionys-314	7	9	proline	proline	NOUN
bionys-314	7	10	,	,	PUNCT
bionys-314	7	11	superoxide	superoxide	NOUN
bionys-314	7	12	dismutase	dismutase	NOUN
bionys-314	7	13	,	,	PUNCT
bionys-314	7	14	tea	tea	NOUN
bionys-314	7	15	apstract	apstract	NOUN
bionys-314	7	16	:	:	PUNCT
bionys-314	7	17	ukupan	ukupan	PROPN
bionys-314	7	18	sadržaj	sadržaj	NOUN
bionys-314	7	19	fenola	fenola	PROPN
bionys-314	8	1	i	i	PRON
bionys-314	8	2	antioksidativni	antioksidativni	VERB
bionys-314	8	3	potencijal	potencijal	ADJ
bionys-314	8	4	različitih	različitih	NOUN
bionys-314	8	5	varijeteta	varijeteta	NOUN
bionys-314	8	6	brassica	brassica	PROPN
bionys-314	8	7	oleracea	oleracea	PROPN
bionys-314	8	8	stres	stres	PROPN
bionys-314	8	9	izazvan	izazvan	PROPN
bionys-314	8	10	sušom	sušom	PROPN
bionys-314	8	11	indukuje	indukuje	PROPN
bionys-314	8	12	oksidativni	oksidativni	PROPN
bionys-314	8	13	stres	stres	PROPN
bionys-314	8	14	sa	sa	PROPN
bionys-314	8	15	naknadnim	naknadnim	PROPN
bionys-314	8	16	povećanjem	povećanjem	PROPN
bionys-314	8	17	ros	ros	PROPN
bionys-314	8	18	-	-	PUNCT
bionys-314	8	19	a	a	DET
bionys-314	8	20	u	u	NOUN
bionys-314	8	21	biljkama	biljkama	NOUN
bionys-314	8	22	.	.	PUNCT
bionys-314	9	1	da	da	PROPN
bionys-314	9	2	bi	bi	PROPN
bionys-314	9	3	se	se	PROPN
bionys-314	9	4	procenio	procenio	PROPN
bionys-314	9	5	intenzitet	intenzitet	PROPN
bionys-314	9	6	oksidativnog	oksidativnog	PROPN
bionys-314	9	7	stresa	stresa	PROPN
bionys-314	9	8	ponovnim	ponovnim	NOUN
bionys-314	9	9	navodnjavanjem	navodnjavanjem	NOUN
bionys-314	9	10	,	,	PUNCT
bionys-314	9	11	ispitivane	ispitivane	NOUN
bionys-314	9	12	su	su	PROPN
bionys-314	9	13	promene	promene	PROPN
bionys-314	9	14	ekspresije	ekspresije	PROPN
bionys-314	9	15	superoksid	superoksid	VERB
bionys-314	9	16	dismutaze	dismutaze	PROPN
bionys-314	9	17	(	(	PUNCT
bionys-314	9	18	sod	sod	NOUN
bionys-314	9	19	)	)	PUNCT
bionys-314	9	20	pomoću	pomoću	NOUN
bionys-314	9	21	pcr	pcr	PROPN
bionys-314	9	22	-	-	PUNCT
bionys-314	9	23	a	a	DET
bionys-314	9	24	u	u	NOUN
bionys-314	9	25	realnom	realnom	NOUN
bionys-314	9	26	vremenu	vremenu	NOUN
bionys-314	9	27	u	u	NOUN
bionys-314	9	28	2	2	NUM
bionys-314	9	29	čajna	čajna	VERB
bionys-314	9	30	klona	klona	PROPN
bionys-314	9	31	dn	dn	PROPN
bionys-314	9	32	i	i	PRON
bionys-314	9	33	100	100	NUM
bionys-314	9	34	.	.	PUNCT
bionys-314	10	1	rezultati	rezultati	PROPN
bionys-314	10	2	su	su	PROPN
bionys-314	10	3	pokazali	pokazali	PROPN
bionys-314	10	4	da	da	PROPN
bionys-314	10	5	ekspresija	ekspresija	PROPN
bionys-314	10	6	sod	sod	NOUN
bionys-314	10	7	-	-	PUNCT
bionys-314	10	8	a	a	NOUN
bionys-314	10	9	i	i	PRON
bionys-314	10	10	drugih	drugih	PROPN
bionys-314	10	11	merenih	merenih	PROPN
bionys-314	10	12	faktora	faktora	PROPN
bionys-314	10	13	,	,	PUNCT
bionys-314	10	14	osim	osim	PROPN
bionys-314	10	15	karotenoida	karotenoida	PROPN
bionys-314	10	16	,	,	PUNCT
bionys-314	10	17	povećava	povećava	PROPN
bionys-314	10	18	stres	stres	PROPN
bionys-314	10	19	izazvan	izazvan	PROPN
bionys-314	10	20	sušom	sušom	VERB
bionys-314	10	21	u	u	PROPN
bionys-314	10	22	klonu	klonu	NOUN
bionys-314	10	23	dn	dn	PROPN
bionys-314	10	24	,	,	PUNCT
bionys-314	10	25	dok	dok	PROPN
bionys-314	10	26	promene	promene	PROPN
bionys-314	10	27	nisu	nisu	PROPN
bionys-314	10	28	bile	bile	PROPN
bionys-314	10	29	značajne	značajne	VERB
bionys-314	10	30	u	u	NOUN
bionys-314	10	31	klonu	klonu	NOUN
bionys-314	10	32	100	100	NUM
bionys-314	10	33	,	,	PUNCT
bionys-314	10	34	u	u	NOUN
bionys-314	10	35	poređenju	poređenju	NOUN
bionys-314	10	36	sa	sa	PROPN
bionys-314	10	37	kontrolom	kontrolom	PROPN
bionys-314	10	38	.	.	PUNCT
bionys-314	11	1	sva	sva	PROPN
bionys-314	11	2	značajna	značajna	PROPN
bionys-314	11	3	povećanja	povećanja	PROPN
bionys-314	11	4	procenjenih	procenjenih	ADJ
bionys-314	11	5	enzimskih	enzimskih	PROPN
bionys-314	12	1	i	i	PRON
bionys-314	12	2	neenzimskih	neenzimskih	PROPN
bionys-314	12	3	antioksidativnih	antioksidativnih	PROPN
bionys-314	12	4	faktora	faktora	PROPN
bionys-314	12	5	eliminisana	eliminisana	PROPN
bionys-314	12	6	su	su	PROPN
bionys-314	12	7	ponovnim	ponovnim	PROPN
bionys-314	12	8	navodnjavanjem	navodnjavanjem	PROPN
bionys-314	12	9	.	.	PUNCT
bionys-314	13	1	uočene	uočene	ADJ
bionys-314	13	2	promene	promene	PROPN
bionys-314	13	3	pokazuju	pokazuju	VERB
bionys-314	13	4	da	da	PROPN
bionys-314	13	5	je	je	PROPN
bionys-314	13	6	klon	klon	PROPN
bionys-314	13	7	dn	dn	PROPN
bionys-314	13	8	aktivirao	aktivirao	PROPN
bionys-314	13	9	svoj	svoj	PROPN
bionys-314	13	10	antioksidativni	antioksidativni	PROPN
bionys-314	13	11	odbrambeni	odbrambeni	PROPN
bionys-314	13	12	sistem	sistem	PROPN
bionys-314	13	13	kao	kao	PROPN
bionys-314	13	14	odgovor	odgovor	ADJ
bionys-314	13	15	na	na	ADP
bionys-314	13	16	sušu	sušu	NOUN
bionys-314	13	17	.	.	PUNCT
bionys-314	14	1	suprotno	suprotno	PROPN
bionys-314	14	2	tome	tome	PROPN
bionys-314	14	3	,	,	PUNCT
bionys-314	14	4	nedostatak	nedostatak	ADJ
bionys-314	14	5	odgovora	odgovora	NOUN
bionys-314	14	6	u	u	NOUN
bionys-314	14	7	klonu	klonu	NOUN
bionys-314	14	8	100	100	NUM
bionys-314	14	9	ukazuje	ukazuje	NOUN
bionys-314	14	10	na	na	ADP
bionys-314	14	11	viši	viši	PROPN
bionys-314	14	12	nivo	nivo	PROPN
bionys-314	14	13	tolerancije	tolerancije	PROPN
bionys-314	14	14	ovog	ovog	NOUN
bionys-314	14	15	novog	novog	ADJ
bionys-314	14	16	klona	klona	NOUN
bionys-314	14	17	na	na	ADP
bionys-314	14	18	sušu	sušu	NOUN
bionys-314	14	19	.	.	PUNCT
bionys-314	15	1	ključne	ključne	PROPN
bionys-314	15	2	reči	reči	NOUN
bionys-314	15	3	:	:	PUNCT
bionys-314	15	4	suša	suša	PROPN
bionys-314	15	5	,	,	PUNCT
bionys-314	15	6	oksidativni	oksidativni	PROPN
bionys-314	15	7	stres	stre	NOUN
bionys-314	15	8	,	,	PUNCT
bionys-314	15	9	prolin	prolin	PROPN
bionys-314	15	10	,	,	PUNCT
bionys-314	15	11	superoksid	superoksid	PROPN
bionys-314	15	12	dizmutaza	dizmutaza	PROPN
bionys-314	15	13	,	,	PUNCT
bionys-314	15	14	čaj	čaj	ADJ
bionys-314	15	15	introduction	introduction	NOUN
bionys-314	15	16	plants	plant	NOUN
bionys-314	15	17	are	be	AUX
bionys-314	15	18	often	often	ADV
bionys-314	15	19	exposed	expose	VERB
bionys-314	15	20	to	to	ADP
bionys-314	15	21	many	many	ADJ
bionys-314	15	22	stresses	stress	NOUN
bionys-314	15	23	,	,	PUNCT
bionys-314	15	24	such	such	ADJ
bionys-314	15	25	as	as	ADP
bionys-314	15	26	drought	drought	NOUN
bionys-314	15	27	,	,	PUNCT
bionys-314	15	28	high	high	ADJ
bionys-314	15	29	temperatures	temperature	NOUN
bionys-314	15	30	,	,	PUNCT
bionys-314	15	31	and	and	CCONJ
bionys-314	15	32	high	high	ADJ
bionys-314	15	33	salt	salt	NOUN
bionys-314	15	34	levels	level	NOUN
bionys-314	15	35	,	,	PUNCT
bionys-314	15	36	heavy	heavy	ADJ
bionys-314	15	37	metals	metal	NOUN
bionys-314	15	38	and	and	CCONJ
bionys-314	15	39	finally	finally	ADV
bionys-314	15	40	oxidative	oxidative	VERB
bionys-314	15	41	stress	stress	NOUN
bionys-314	15	42	.	.	PUNCT
bionys-314	16	1	drought	drought	NOUN
bionys-314	16	2	is	be	AUX
bionys-314	16	3	one	one	NUM
bionys-314	16	4	of	of	ADP
bionys-314	16	5	the	the	DET
bionys-314	16	6	environmental	environmental	ADJ
bionys-314	16	7	stresses	stress	NOUN
bionys-314	16	8	which	which	PRON
bionys-314	16	9	has	have	VERB
bionys-314	16	10	harmful	harmful	ADJ
bionys-314	16	11	effects	effect	NOUN
bionys-314	16	12	on	on	ADP
bionys-314	16	13	all	all	DET
bionys-314	16	14	stages	stage	NOUN
bionys-314	16	15	of	of	ADP
bionys-314	16	16	growth	growth	NOUN
bionys-314	16	17	and	and	CCONJ
bionys-314	16	18	triggers	trigger	VERB
bionys-314	16	19	the	the	DET
bionys-314	16	20	production	production	NOUN
bionys-314	16	21	of	of	ADP
bionys-314	16	22	ros	ros	PROPN
bionys-314	16	23	in	in	ADP
bionys-314	16	24	plants	plant	NOUN
bionys-314	16	25	(	(	PUNCT
bionys-314	16	26	farooq	farooq	PROPN
bionys-314	16	27	et	et	PROPN
bionys-314	16	28	al	al	PROPN
bionys-314	16	29	.	.	PROPN
bionys-314	16	30	,	,	PUNCT
bionys-314	16	31	2009	2009	NUM
bionys-314	16	32	)	)	PUNCT
bionys-314	16	33	.	.	PUNCT
bionys-314	17	1	the	the	DET
bionys-314	17	2	amount	amount	NOUN
bionys-314	17	3	of	of	ADP
bionys-314	17	4	damage	damage	NOUN
bionys-314	17	5	caused	cause	VERB
bionys-314	17	6	by	by	ADP
bionys-314	17	7	water	water	NOUN
bionys-314	17	8	shortage	shortage	NOUN
bionys-314	17	9	depends	depend	VERB
bionys-314	17	10	on	on	ADP
bionys-314	17	11	the	the	DET
bionys-314	17	12	plant	plant	NOUN
bionys-314	17	13	species	specie	NOUN
bionys-314	17	14	,	,	PUNCT
bionys-314	17	15	genotype	genotype	NOUN
bionys-314	17	16	,	,	PUNCT
bionys-314	17	17	duration	duration	NOUN
bionys-314	17	18	and	and	CCONJ
bionys-314	17	19	intensity	intensity	NOUN
bionys-314	17	20	of	of	ADP
bionys-314	17	21	water	water	NOUN
bionys-314	17	22	deficit	deficit	NOUN
bionys-314	17	23	,	,	PUNCT
bionys-314	17	24	soil	soil	NOUN
bionys-314	17	25	characteristics	characteristic	NOUN
bionys-314	17	26	,	,	PUNCT
bionys-314	17	27	age	age	NOUN
bionys-314	17	28	and	and	CCONJ
bionys-314	17	29	developmental	developmental	ADJ
bionys-314	17	30	stage	stage	NOUN
bionys-314	17	31	of	of	ADP
bionys-314	17	32	the	the	DET
bionys-314	17	33	plant	plant	NOUN
bionys-314	17	34	(	(	PUNCT
bionys-314	17	35	sánchez	sánchez	PROPN
bionys-314	17	36	et	et	PROPN
bionys-314	17	37	al	al	PROPN
bionys-314	17	38	.	.	PROPN
bionys-314	17	39	,	,	PUNCT
bionys-314	17	40	2001	2001	NUM
bionys-314	17	41	)	)	PUNCT
bionys-314	17	42	.	.	PUNCT
bionys-314	18	1	in	in	ADP
bionys-314	18	2	addition	addition	NOUN
bionys-314	18	3	to	to	ADP
bionys-314	18	4	the	the	DET
bionys-314	18	5	physiological	physiological	ADJ
bionys-314	18	6	changes	change	NOUN
bionys-314	18	7	that	that	PRON
bionys-314	18	8	occur	occur	VERB
bionys-314	18	9	in	in	ADP
bionys-314	18	10	plants	plant	NOUN
bionys-314	18	11	due	due	ADP
bionys-314	18	12	to	to	ADP
bionys-314	18	13	water	water	NOUN
bionys-314	18	14	shortages	shortage	NOUN
bionys-314	18	15	,	,	PUNCT
bionys-314	18	16	stress	stress	NOUN
bionys-314	18	17	also	also	ADV
bionys-314	18	18	inhibits	inhibit	VERB
bionys-314	18	19	photochemical	photochemical	ADJ
bionys-314	18	20	activity	activity	NOUN
bionys-314	18	21	and	and	CCONJ
bionys-314	18	22	reduces	reduce	VERB
bionys-314	18	23	calvin	calvin	NOUN
bionys-314	18	24	cycle	cycle	NOUN
bionys-314	18	25	activity	activity	NOUN
bionys-314	18	26	(	(	PUNCT
bionys-314	18	27	monakhova	monakhova	PROPN
bionys-314	18	28	&	&	CCONJ
bionys-314	18	29	chernyad’ev	chernyad’ev	PROPN
bionys-314	18	30	,	,	PUNCT
bionys-314	18	31	2004	2004	NUM
bionys-314	18	32	)	)	PUNCT
bionys-314	18	33	accumulation	accumulation	NOUN
bionys-314	18	34	of	of	ADP
bionys-314	18	35	ros	ros	PROPN
bionys-314	18	36	is	be	AUX
bionys-314	18	37	one	one	NUM
bionys-314	18	38	of	of	ADP
bionys-314	18	39	the	the	DET
bionys-314	18	40	many	many	ADJ
bionys-314	18	41	biochemical	biochemical	ADJ
bionys-314	18	42	changes	change	NOUN
bionys-314	18	43	which	which	PRON
bionys-314	18	44	occurs	occur	VERB
bionys-314	18	45	in	in	ADP
bionys-314	18	46	plants	plant	NOUN
bionys-314	18	47	under	under	ADP
bionys-314	18	48	stress	stress	NOUN
bionys-314	18	49	,	,	PUNCT
bionys-314	18	50	as	as	ADP
bionys-314	18	51	an	an	DET
bionys-314	18	52	inevitable	inevitable	ADJ
bionys-314	18	53	and	and	CCONJ
bionys-314	18	54	normal	normal	ADJ
bionys-314	18	55	product	product	NOUN
bionys-314	18	56	of	of	ADP
bionys-314	18	57	cell	cell	NOUN
bionys-314	18	58	metabolism	metabolism	NOUN
bionys-314	18	59	and	and	CCONJ
bionys-314	18	60	oxidative	oxidative	ADJ
bionys-314	18	61	damage	damage	NOUN
bionys-314	18	62	caused	cause	VERB
bionys-314	18	63	by	by	ADP
bionys-314	18	64	ros	ros	PROPN
bionys-314	18	65	is	be	AUX
bionys-314	18	66	the	the	DET
bionys-314	18	67	major	major	ADJ
bionys-314	18	68	limiting	limit	VERB
bionys-314	18	69	factor	factor	NOUN
bionys-314	18	70	for	for	ADP
bionys-314	18	71	plant	plant	NOUN
bionys-314	18	72	growth	growth	NOUN
bionys-314	18	73	(	(	PUNCT
bionys-314	18	74	allen	allen	PROPN
bionys-314	18	75	&	&	CCONJ
bionys-314	18	76	ort	ort	PROPN
bionys-314	18	77	,	,	PUNCT
bionys-314	18	78	2001	2001	NUM
bionys-314	18	79	)	)	PUNCT
bionys-314	18	80	.	.	PUNCT
bionys-314	19	1	while	while	SCONJ
bionys-314	19	2	there	there	PRON
bionys-314	19	3	are	be	VERB
bionys-314	19	4	several	several	ADJ
bionys-314	19	5	sources	source	NOUN
bionys-314	19	6	of	of	ADP
bionys-314	19	7	ros	ros	PROPN
bionys-314	19	8	production	production	NOUN
bionys-314	19	9	,	,	PUNCT
bionys-314	19	10	and	and	CCONJ
bionys-314	19	11	whereas	whereas	SCONJ
bionys-314	19	12	some	some	PRON
bionys-314	19	13	of	of	ADP
bionys-314	19	14	the	the	DET
bionys-314	19	15	most	most	ADV
bionys-314	19	16	common	common	ADJ
bionys-314	19	17	sources	source	NOUN
bionys-314	19	18	of	of	ADP
bionys-314	19	19	ros	ros	PROPN
bionys-314	19	20	are	be	AUX
bionys-314	19	21	the	the	DET
bionys-314	19	22	electron	electron	NOUN
bionys-314	19	23	transport	transport	NOUN
bionys-314	19	24	chains	chain	NOUN
bionys-314	19	25	in	in	ADP
bionys-314	19	26	mitochondria	mitochondria	NOUN
bionys-314	19	27	and	and	CCONJ
bionys-314	19	28	chloroplasts	chloroplast	NOUN
bionys-314	19	29	,	,	PUNCT
bionys-314	19	30	chloroplasts	chloroplast	NOUN
bionys-314	19	31	are	be	AUX
bionys-314	19	32	the	the	DET
bionys-314	19	33	main	main	ADJ
bionys-314	19	34	source	source	NOUN
bionys-314	19	35	of	of	ADP
bionys-314	19	36	ros	ros	PROPN
bionys-314	19	37	production	production	NOUN
bionys-314	19	38	in	in	ADP
bionys-314	19	39	plants	plant	NOUN
bionys-314	19	40	(	(	PUNCT
bionys-314	19	41	noctor	noctor	NOUN
bionys-314	19	42	et	et	PROPN
bionys-314	19	43	al	al	PROPN
bionys-314	19	44	.	.	PROPN
bionys-314	19	45	,	,	PUNCT
bionys-314	19	46	©	©	PROPN
bionys-314	19	47	2020	2020	NUM
bionys-314	19	48	mahammadi	mahammadi	NOUN
bionys-314	19	49	et	et	PROPN
bionys-314	19	50	al	al	PROPN
bionys-314	19	51	.	.	PUNCT
bionys-314	20	1	this	this	PRON
bionys-314	20	2	is	be	AUX
bionys-314	20	3	an	an	DET
bionys-314	20	4	open	open	ADJ
bionys-314	20	5	-	-	PUNCT
bionys-314	20	6	access	access	NOUN
bionys-314	20	7	article	article	NOUN
bionys-314	20	8	distributed	distribute	VERB
bionys-314	20	9	under	under	ADP
bionys-314	20	10	the	the	DET
bionys-314	20	11	terms	term	NOUN
bionys-314	20	12	of	of	ADP
bionys-314	20	13	the	the	DET
bionys-314	20	14	creative	creative	ADJ
bionys-314	20	15	commons	common	NOUN
bionys-314	20	16	attribution	attribution	NOUN
bionys-314	20	17	license	license	NOUN
bionys-314	20	18	,	,	PUNCT
bionys-314	20	19	which	which	PRON
bionys-314	20	20	permits	permit	VERB
bionys-314	20	21	unrestricted	unrestricted	ADJ
bionys-314	20	22	use	use	NOUN
bionys-314	20	23	,	,	PUNCT
bionys-314	20	24	distribution	distribution	NOUN
bionys-314	20	25	,	,	PUNCT
bionys-314	20	26	and	and	CCONJ
bionys-314	20	27	build	build	VERB
bionys-314	20	28	upon	upon	SCONJ
bionys-314	20	29	your	your	PRON
bionys-314	20	30	work	work	NOUN
bionys-314	20	31	non	non	ADJ
bionys-314	20	32	-	-	ADJ
bionys-314	20	33	commercially	commercially	ADV
bionys-314	20	34	under	under	ADP
bionys-314	20	35	the	the	DET
bionys-314	20	36	same	same	ADJ
bionys-314	20	37	license	license	NOUN
bionys-314	20	38	as	as	ADP
bionys-314	20	39	the	the	DET
bionys-314	20	40	original	original	NOUN
bionys-314	20	41	.	.	PUNCT
bionys-314	21	1	45	45	NUM
bionys-314	21	2	2014	2014	NUM
bionys-314	21	3	)	)	PUNCT
bionys-314	21	4	.	.	PUNCT
bionys-314	22	1	plants	plant	NOUN
bionys-314	22	2	respond	respond	VERB
bionys-314	22	3	to	to	ADP
bionys-314	22	4	increased	increase	VERB
bionys-314	22	5	ros	ros	PROPN
bionys-314	22	6	amounts	amount	NOUN
bionys-314	22	7	with	with	ADP
bionys-314	22	8	activation	activation	NOUN
bionys-314	22	9	of	of	ADP
bionys-314	22	10	their	their	PRON
bionys-314	22	11	enzymatic	enzymatic	ADJ
bionys-314	22	12	and	and	CCONJ
bionys-314	22	13	non	non	ADJ
bionys-314	22	14	-	-	ADJ
bionys-314	22	15	enzymatic	enzymatic	ADJ
bionys-314	22	16	defense	defense	NOUN
bionys-314	22	17	systems	system	NOUN
bionys-314	22	18	(	(	PUNCT
bionys-314	22	19	zhu	zhu	PROPN
bionys-314	22	20	,	,	PUNCT
bionys-314	22	21	2001	2001	NUM
bionys-314	22	22	;	;	PUNCT
bionys-314	22	23	mukhopadhyay	mukhopadhyay	NOUN
bionys-314	22	24	,	,	PUNCT
bionys-314	22	25	2014	2014	NUM
bionys-314	22	26	)	)	PUNCT
bionys-314	22	27	.	.	PUNCT
bionys-314	23	1	among	among	ADP
bionys-314	23	2	the	the	DET
bionys-314	23	3	most	most	ADV
bionys-314	23	4	important	important	ADJ
bionys-314	23	5	crops	crop	NOUN
bionys-314	23	6	subjected	subject	VERB
bionys-314	23	7	to	to	ADP
bionys-314	23	8	stress	stress	NOUN
bionys-314	23	9	in	in	ADP
bionys-314	23	10	iran	iran	PROPN
bionys-314	23	11	is	be	AUX
bionys-314	23	12	tea	tea	NOUN
bionys-314	23	13	.	.	PUNCT
bionys-314	24	1	the	the	DET
bionys-314	24	2	total	total	ADJ
bionys-314	24	3	area	area	NOUN
bionys-314	24	4	under	under	ADP
bionys-314	24	5	tea	tea	NOUN
bionys-314	24	6	cultivation	cultivation	NOUN
bionys-314	24	7	in	in	ADP
bionys-314	24	8	the	the	DET
bionys-314	24	9	north	north	NOUN
bionys-314	24	10	of	of	ADP
bionys-314	24	11	iran	iran	PROPN
bionys-314	24	12	is	be	AUX
bionys-314	24	13	over	over	ADP
bionys-314	24	14	40	40	NUM
bionys-314	24	15	thousand	thousand	NUM
bionys-314	24	16	hectares	hectare	NOUN
bionys-314	24	17	.	.	PUNCT
bionys-314	25	1	4	4	NUM
bionys-314	25	2	-	-	SYM
bionys-314	25	3	4,5	4,5	NUM
bionys-314	25	4	percent	percent	NOUN
bionys-314	25	5	of	of	ADP
bionys-314	25	6	the	the	DET
bionys-314	25	7	total	total	ADJ
bionys-314	25	8	tea	tea	NOUN
bionys-314	25	9	in	in	ADP
bionys-314	25	10	the	the	DET
bionys-314	25	11	world	world	NOUN
bionys-314	25	12	is	be	AUX
bionys-314	25	13	produced	produce	VERB
bionys-314	25	14	in	in	ADP
bionys-314	25	15	iran	iran	PROPN
bionys-314	25	16	.	.	PUNCT
bionys-314	26	1	it	it	PRON
bionys-314	26	2	is	be	AUX
bionys-314	26	3	essential	essential	ADJ
bionys-314	26	4	to	to	PART
bionys-314	26	5	elevate	elevate	VERB
bionys-314	26	6	the	the	DET
bionys-314	26	7	amount	amount	NOUN
bionys-314	26	8	of	of	ADP
bionys-314	26	9	product	product	NOUN
bionys-314	26	10	produced	produce	VERB
bionys-314	26	11	per	per	ADP
bionys-314	26	12	unit	unit	NOUN
bionys-314	26	13	to	to	PART
bionys-314	26	14	match	match	VERB
bionys-314	26	15	the	the	DET
bionys-314	26	16	increasing	increase	VERB
bionys-314	26	17	consumption	consumption	NOUN
bionys-314	26	18	of	of	ADP
bionys-314	26	19	tea	tea	NOUN
bionys-314	26	20	.	.	PUNCT
bionys-314	27	1	one	one	NUM
bionys-314	27	2	important	important	ADJ
bionys-314	27	3	strategy	strategy	NOUN
bionys-314	27	4	for	for	ADP
bionys-314	27	5	achieving	achieve	VERB
bionys-314	27	6	this	this	DET
bionys-314	27	7	goal	goal	NOUN
bionys-314	27	8	is	be	AUX
bionys-314	27	9	reducing	reduce	VERB
bionys-314	27	10	the	the	DET
bionys-314	27	11	environmental	environmental	ADJ
bionys-314	27	12	damage	damage	NOUN
bionys-314	27	13	caused	cause	VERB
bionys-314	27	14	by	by	ADP
bionys-314	27	15	stresses	stress	NOUN
bionys-314	27	16	such	such	ADJ
bionys-314	27	17	as	as	ADP
bionys-314	27	18	dehydration	dehydration	NOUN
bionys-314	27	19	.	.	PUNCT
bionys-314	28	1	although	although	SCONJ
bionys-314	28	2	most	most	ADJ
bionys-314	28	3	tea	tea	NOUN
bionys-314	28	4	gardens	garden	NOUN
bionys-314	28	5	in	in	ADP
bionys-314	28	6	iran	iran	PROPN
bionys-314	28	7	are	be	AUX
bionys-314	28	8	located	locate	VERB
bionys-314	28	9	in	in	ADP
bionys-314	28	10	areas	area	NOUN
bionys-314	28	11	with	with	ADP
bionys-314	28	12	high	high	ADJ
bionys-314	28	13	rainfall	rainfall	NOUN
bionys-314	28	14	,	,	PUNCT
bionys-314	28	15	reduced	reduce	VERB
bionys-314	28	16	crop	crop	NOUN
bionys-314	28	17	yields	yield	NOUN
bionys-314	28	18	are	be	AUX
bionys-314	28	19	nevertheless	nevertheless	ADV
bionys-314	28	20	encountered	encounter	VERB
bionys-314	28	21	due	due	ADP
bionys-314	28	22	to	to	ADP
bionys-314	28	23	the	the	DET
bionys-314	28	24	unequal	unequal	ADJ
bionys-314	28	25	distribution	distribution	NOUN
bionys-314	28	26	of	of	ADP
bionys-314	28	27	rainfall	rainfall	NOUN
bionys-314	28	28	in	in	ADP
bionys-314	28	29	different	different	ADJ
bionys-314	28	30	seasons	season	NOUN
bionys-314	28	31	,	,	PUNCT
bionys-314	28	32	especially	especially	ADV
bionys-314	28	33	in	in	ADP
bionys-314	28	34	the	the	DET
bionys-314	28	35	growing	grow	VERB
bionys-314	28	36	season	season	NOUN
bionys-314	28	37	.	.	PUNCT
bionys-314	29	1	research	research	NOUN
bionys-314	29	2	has	have	AUX
bionys-314	29	3	shown	show	VERB
bionys-314	29	4	that	that	SCONJ
bionys-314	29	5	in	in	ADP
bionys-314	29	6	areas	area	NOUN
bionys-314	29	7	where	where	SCONJ
bionys-314	29	8	the	the	DET
bionys-314	29	9	annual	annual	ADJ
bionys-314	29	10	rainfall	rainfall	NOUN
bionys-314	29	11	is	be	AUX
bionys-314	29	12	less	less	ADJ
bionys-314	29	13	than	than	ADP
bionys-314	29	14	1150	1150	NUM
bionys-314	29	15	mm	mm	NUM
bionys-314	29	16	,	,	PUNCT
bionys-314	29	17	tea	tea	NOUN
bionys-314	29	18	plant	plant	NOUN
bionys-314	29	19	growth	growth	NOUN
bionys-314	29	20	is	be	AUX
bionys-314	29	21	reduced	reduce	VERB
bionys-314	29	22	due	due	ADJ
bionys-314	29	23	to	to	ADP
bionys-314	29	24	stress	stress	NOUN
bionys-314	29	25	.	.	PUNCT
bionys-314	30	1	to	to	PART
bionys-314	30	2	reduce	reduce	VERB
bionys-314	30	3	losses	loss	NOUN
bionys-314	30	4	due	due	ADP
bionys-314	30	5	to	to	ADP
bionys-314	30	6	water	water	NOUN
bionys-314	30	7	deficits	deficit	NOUN
bionys-314	30	8	,	,	PUNCT
bionys-314	30	9	varieties	variety	NOUN
bionys-314	30	10	should	should	AUX
bionys-314	30	11	be	be	AUX
bionys-314	30	12	carefully	carefully	ADV
bionys-314	30	13	selected	select	VERB
bionys-314	30	14	to	to	PART
bionys-314	30	15	resist	resist	VERB
bionys-314	30	16	this	this	DET
bionys-314	30	17	stress	stress	NOUN
bionys-314	30	18	,	,	PUNCT
bionys-314	30	19	because	because	SCONJ
bionys-314	30	20	damage	damage	NOUN
bionys-314	30	21	to	to	ADP
bionys-314	30	22	the	the	DET
bionys-314	30	23	plant	plant	NOUN
bionys-314	30	24	is	be	AUX
bionys-314	30	25	dependent	dependent	ADJ
bionys-314	30	26	greatly	greatly	ADV
bionys-314	30	27	on	on	ADP
bionys-314	30	28	the	the	DET
bionys-314	30	29	plants	plant	NOUN
bionys-314	30	30	’	'	PUNCT
bionys-314	30	31	stress	stress	NOUN
bionys-314	30	32	tolerance	tolerance	NOUN
bionys-314	30	33	.	.	PUNCT
bionys-314	31	1	the	the	DET
bionys-314	31	2	first	first	ADJ
bionys-314	31	3	intracellular	intracellular	ADJ
bionys-314	31	4	line	line	NOUN
bionys-314	31	5	of	of	ADP
bionys-314	31	6	defense	defense	NOUN
bionys-314	31	7	is	be	AUX
bionys-314	31	8	sod	sod	NOUN
bionys-314	31	9	.	.	PUNCT
bionys-314	32	1	phospholipid	phospholipid	NOUN
bionys-314	32	2	membranes	membrane	NOUN
bionys-314	32	3	are	be	AUX
bionys-314	32	4	non	non	ADJ
bionys-314	32	5	-	-	ADJ
bionys-314	32	6	permeable	permeable	ADJ
bionys-314	32	7	to	to	ADP
bionys-314	32	8	o2	o2	PROPN
bionys-314	32	9	(	(	PUNCT
bionys-314	32	10	asada	asada	PROPN
bionys-314	32	11	,	,	PUNCT
bionys-314	32	12	2006	2006	NUM
bionys-314	32	13	)	)	PUNCT
bionys-314	32	14	.	.	PUNCT
bionys-314	33	1	it	it	PRON
bionys-314	33	2	is	be	AUX
bionys-314	33	3	therefore	therefore	ADV
bionys-314	33	4	essential	essential	ADJ
bionys-314	33	5	that	that	SCONJ
bionys-314	33	6	sod	sod	NOUN
bionys-314	33	7	be	be	AUX
bionys-314	33	8	present	present	ADJ
bionys-314	33	9	to	to	PART
bionys-314	33	10	remove	remove	VERB
bionys-314	33	11	them	they	PRON
bionys-314	33	12	in	in	ADP
bionys-314	33	13	places	place	NOUN
bionys-314	33	14	where	where	SCONJ
bionys-314	33	15	these	these	DET
bionys-314	33	16	compounds	compound	NOUN
bionys-314	33	17	are	be	AUX
bionys-314	33	18	formed	form	VERB
bionys-314	33	19	.	.	PUNCT
bionys-314	34	1	based	base	VERB
bionys-314	34	2	on	on	ADP
bionys-314	34	3	required	require	VERB
bionys-314	34	4	metal	metal	NOUN
bionys-314	34	5	co	co	NOUN
bionys-314	34	6	-	-	NOUN
bionys-314	34	7	factors	factor	NOUN
bionys-314	34	8	,	,	PUNCT
bionys-314	34	9	sod	sod	NOUN
bionys-314	34	10	enzymes	enzyme	NOUN
bionys-314	34	11	are	be	AUX
bionys-314	34	12	classified	classify	VERB
bionys-314	34	13	into	into	ADP
bionys-314	34	14	4	4	NUM
bionys-314	34	15	groups	group	NOUN
bionys-314	34	16	:	:	PUNCT
bionys-314	34	17	fesod	fesod	PROPN
bionys-314	34	18	,	,	PUNCT
bionys-314	34	19	mn	mn	PROPN
bionys-314	34	20	-	-	PUNCT
bionys-314	34	21	sod	sod	NOUN
bionys-314	34	22	,	,	PUNCT
bionys-314	34	23	cu	cu	PROPN
bionys-314	34	24	/	/	SYM
bionys-314	34	25	zn	zn	PROPN
bionys-314	34	26	-	-	NOUN
bionys-314	34	27	sod	sod	NOUN
bionys-314	34	28	,	,	PUNCT
bionys-314	34	29	and	and	CCONJ
bionys-314	34	30	ni	ni	NOUN
bionys-314	34	31	-	-	NOUN
bionys-314	34	32	sod	sod	NOUN
bionys-314	34	33	.	.	PUNCT
bionys-314	35	1	these	these	DET
bionys-314	35	2	isoforms	isoform	NOUN
bionys-314	35	3	are	be	AUX
bionys-314	35	4	located	locate	VERB
bionys-314	35	5	in	in	ADP
bionys-314	35	6	different	different	ADJ
bionys-314	35	7	cellular	cellular	ADJ
bionys-314	35	8	compartments	compartment	NOUN
bionys-314	35	9	:	:	PUNCT
bionys-314	35	10	fe	fe	NOUN
bionys-314	35	11	-	-	NOUN
bionys-314	35	12	sod	sod	NOUN
bionys-314	35	13	is	be	AUX
bionys-314	35	14	in	in	ADP
bionys-314	35	15	chloroplasts	chloroplast	NOUN
bionys-314	35	16	as	as	SCONJ
bionys-314	35	17	is	be	AUX
bionys-314	35	18	cu	cu	PROPN
bionys-314	35	19	/	/	SYM
bionys-314	35	20	zn	zn	PROPN
bionys-314	35	21	-	-	NOUN
bionys-314	35	22	sod	sod	NOUN
bionys-314	35	23	,	,	PUNCT
bionys-314	35	24	the	the	DET
bionys-314	35	25	latter	latter	NOUN
bionys-314	35	26	of	of	ADP
bionys-314	35	27	which	which	PRON
bionys-314	35	28	is	be	AUX
bionys-314	35	29	also	also	ADV
bionys-314	35	30	present	present	ADJ
bionys-314	35	31	in	in	ADP
bionys-314	35	32	cytosol	cytosol	NOUN
bionys-314	35	33	and	and	CCONJ
bionys-314	35	34	extracellular	extracellular	ADJ
bionys-314	35	35	spaces	space	NOUN
bionys-314	35	36	.	.	PUNCT
bionys-314	36	1	mn	mn	PROPN
bionys-314	36	2	-	-	PUNCT
bionys-314	36	3	sod	sod	NOUN
bionys-314	36	4	is	be	AUX
bionys-314	36	5	found	find	VERB
bionys-314	36	6	in	in	ADP
bionys-314	36	7	mitochondria	mitochondria	NOUN
bionys-314	36	8	and	and	CCONJ
bionys-314	36	9	peroxisomes	peroxisome	NOUN
bionys-314	36	10	(	(	PUNCT
bionys-314	36	11	jamal	jamal	PROPN
bionys-314	36	12	et	et	PROPN
bionys-314	36	13	al	al	PROPN
bionys-314	36	14	.	.	PROPN
bionys-314	36	15	,	,	PUNCT
bionys-314	36	16	2006	2006	NUM
bionys-314	36	17	)	)	PUNCT
bionys-314	36	18	,	,	PUNCT
bionys-314	36	19	and	and	CCONJ
bionys-314	36	20	the	the	DET
bionys-314	36	21	fourth	fourth	ADJ
bionys-314	36	22	isoform	isoform	NOUN
bionys-314	36	23	of	of	ADP
bionys-314	36	24	sod	sod	NOUN
bionys-314	36	25	,	,	PUNCT
bionys-314	36	26	ni	ni	NOUN
bionys-314	36	27	-	-	NOUN
bionys-314	36	28	sod	sod	NOUN
bionys-314	36	29	,	,	PUNCT
bionys-314	36	30	which	which	PRON
bionys-314	36	31	contains	contain	VERB
bionys-314	36	32	nickel	nickel	NOUN
bionys-314	36	33	in	in	ADP
bionys-314	36	34	its	its	PRON
bionys-314	36	35	active	active	ADJ
bionys-314	36	36	site	site	NOUN
bionys-314	36	37	has	have	AUX
bionys-314	36	38	been	be	AUX
bionys-314	36	39	found	find	VERB
bionys-314	36	40	in	in	ADP
bionys-314	36	41	several	several	ADJ
bionys-314	36	42	types	type	NOUN
bionys-314	36	43	of	of	ADP
bionys-314	36	44	soil	soil	NOUN
bionys-314	36	45	bacteria	bacteria	NOUN
bionys-314	36	46	(	(	PUNCT
bionys-314	36	47	bannister	bannister	PROPN
bionys-314	36	48	et	et	PROPN
bionys-314	36	49	al	al	PROPN
bionys-314	36	50	.	.	PROPN
bionys-314	36	51	,	,	PUNCT
bionys-314	36	52	1987	1987	NUM
bionys-314	36	53	;	;	PUNCT
bionys-314	36	54	bowler	bowler	NOUN
bionys-314	36	55	et	et	NOUN
bionys-314	36	56	al	al	PROPN
bionys-314	36	57	.	.	PROPN
bionys-314	36	58	,	,	PUNCT
bionys-314	36	59	1992	1992	NUM
bionys-314	36	60	)	)	PUNCT
bionys-314	36	61	.	.	PUNCT
bionys-314	37	1	many	many	ADJ
bionys-314	37	2	attempts	attempt	NOUN
bionys-314	37	3	have	have	AUX
bionys-314	37	4	been	be	AUX
bionys-314	37	5	made	make	VERB
bionys-314	37	6	to	to	PART
bionys-314	37	7	produce	produce	VERB
bionys-314	37	8	transgenic	transgenic	NOUN
bionys-314	37	9	plants	plant	NOUN
bionys-314	37	10	,	,	PUNCT
bionys-314	37	11	variously	variously	ADV
bionys-314	37	12	using	use	VERB
bionys-314	37	13	all	all	DET
bionys-314	37	14	3	3	NUM
bionys-314	37	15	isoforms	isoform	NOUN
bionys-314	37	16	of	of	ADP
bionys-314	37	17	sod	sod	NOUN
bionys-314	37	18	enzymes	enzyme	NOUN
bionys-314	37	19	.	.	PUNCT
bionys-314	38	1	most	most	ADJ
bionys-314	38	2	of	of	ADP
bionys-314	38	3	these	these	DET
bionys-314	38	4	reports	report	NOUN
bionys-314	38	5	have	have	AUX
bionys-314	38	6	noted	note	VERB
bionys-314	38	7	that	that	SCONJ
bionys-314	38	8	sod	sod	NOUN
bionys-314	38	9	over	over	ADP
bionys-314	38	10	-	-	PUNCT
bionys-314	38	11	expression	expression	NOUN
bionys-314	38	12	led	lead	VERB
bionys-314	38	13	to	to	ADP
bionys-314	38	14	increased	increase	VERB
bionys-314	38	15	tolerance	tolerance	NOUN
bionys-314	38	16	towards	towards	ADP
bionys-314	38	17	oxidative	oxidative	ADJ
bionys-314	38	18	stress	stress	NOUN
bionys-314	38	19	(	(	PUNCT
bionys-314	38	20	faize	faize	VERB
bionys-314	38	21	et	et	PROPN
bionys-314	38	22	al	al	PROPN
bionys-314	38	23	.	.	PROPN
bionys-314	38	24	,	,	PUNCT
bionys-314	38	25	2011	2011	NUM
bionys-314	38	26	)	)	PUNCT
bionys-314	38	27	.	.	PUNCT
bionys-314	39	1	however	however	ADV
bionys-314	39	2	,	,	PUNCT
bionys-314	39	3	only	only	ADV
bionys-314	39	4	in	in	ADP
bionys-314	39	5	transgenic	transgenic	NOUN
bionys-314	39	6	plants	plant	NOUN
bionys-314	39	7	containing	contain	VERB
bionys-314	39	8	mn	mn	PROPN
bionys-314	39	9	-	-	PUNCT
bionys-314	39	10	sod	sod	NOUN
bionys-314	39	11	protection	protection	NOUN
bionys-314	39	12	was	be	AUX
bionys-314	39	13	induced	induce	VERB
bionys-314	39	14	against	against	ADP
bionys-314	39	15	,	,	PUNCT
bionys-314	39	16	for	for	ADP
bionys-314	39	17	example	example	NOUN
bionys-314	39	18	,	,	PUNCT
bionys-314	39	19	reduced	reduce	VERB
bionys-314	39	20	biomass	biomass	NOUN
bionys-314	39	21	and	and	CCONJ
bionys-314	39	22	leaf	leaf	NOUN
bionys-314	39	23	damage	damage	NOUN
bionys-314	39	24	(	(	PUNCT
bionys-314	39	25	van	van	PROPN
bionys-314	39	26	breusegem	breusegem	PROPN
bionys-314	39	27	et	et	PROPN
bionys-314	39	28	al	al	PROPN
bionys-314	39	29	.	.	PROPN
bionys-314	39	30	,	,	PUNCT
bionys-314	39	31	1999	1999	NUM
bionys-314	39	32	;	;	PUNCT
bionys-314	39	33	samis	samis	PROPN
bionys-314	39	34	et	et	PROPN
bionys-314	39	35	al	al	PROPN
bionys-314	39	36	.	.	PROPN
bionys-314	39	37	,	,	PUNCT
bionys-314	39	38	2002	2002	NUM
bionys-314	39	39	)	)	PUNCT
bionys-314	39	40	.	.	PUNCT
bionys-314	40	1	many	many	ADJ
bionys-314	40	2	studies	study	NOUN
bionys-314	40	3	have	have	AUX
bionys-314	40	4	been	be	AUX
bionys-314	40	5	consistent	consistent	ADJ
bionys-314	40	6	with	with	ADP
bionys-314	40	7	this	this	DET
bionys-314	40	8	data	datum	NOUN
bionys-314	40	9	and	and	CCONJ
bionys-314	40	10	mn	mn	PROPN
bionys-314	40	11	-	-	PUNCT
bionys-314	40	12	sod	sod	NOUN
bionys-314	40	13	has	have	AUX
bionys-314	40	14	been	be	AUX
bionys-314	40	15	purified	purify	VERB
bionys-314	40	16	from	from	ADP
bionys-314	40	17	pea	pea	NOUN
bionys-314	40	18	(	(	PUNCT
bionys-314	40	19	sevilla	sevilla	NOUN
bionys-314	40	20	et	et	PROPN
bionys-314	40	21	al	al	PROPN
bionys-314	40	22	.	.	PROPN
bionys-314	40	23	,	,	PUNCT
bionys-314	40	24	1980	1980	NUM
bionys-314	40	25	;	;	PUNCT
bionys-314	40	26	palma	palma	PROPN
bionys-314	40	27	et	et	PROPN
bionys-314	40	28	al	al	PROPN
bionys-314	40	29	.	.	PROPN
bionys-314	40	30	,	,	PUNCT
bionys-314	40	31	1998	1998	NUM
bionys-314	40	32	)	)	PUNCT
bionys-314	40	33	,	,	PUNCT
bionys-314	40	34	corn	corn	NOUN
bionys-314	40	35	(	(	PUNCT
bionys-314	40	36	baum	baum	PROPN
bionys-314	40	37	&	&	CCONJ
bionys-314	40	38	scandalios	scandalios	PROPN
bionys-314	40	39	,	,	PUNCT
bionys-314	40	40	1981	1981	NUM
bionys-314	40	41	)	)	PUNCT
bionys-314	40	42	,	,	PUNCT
bionys-314	40	43	pine	pine	NOUN
bionys-314	40	44	(	(	PUNCT
bionys-314	40	45	streller	streller	NOUN
bionys-314	40	46	et	et	PROPN
bionys-314	40	47	al	al	PROPN
bionys-314	40	48	.	.	PROPN
bionys-314	40	49	,	,	PUNCT
bionys-314	40	50	1994	1994	NUM
bionys-314	40	51	)	)	PUNCT
bionys-314	40	52	and	and	CCONJ
bionys-314	40	53	tea	tea	NOUN
bionys-314	40	54	under	under	ADP
bionys-314	40	55	cold	cold	ADJ
bionys-314	40	56	stress	stress	NOUN
bionys-314	40	57	(	(	PUNCT
bionys-314	40	58	vyas	vyas	PROPN
bionys-314	40	59	&	&	CCONJ
bionys-314	40	60	kumar	kumar	PROPN
bionys-314	40	61	,	,	PUNCT
bionys-314	40	62	2005	2005	NUM
bionys-314	40	63	)	)	PUNCT
bionys-314	40	64	.	.	PUNCT
bionys-314	41	1	however	however	ADV
bionys-314	41	2	,	,	PUNCT
bionys-314	41	3	research	research	NOUN
bionys-314	41	4	has	have	AUX
bionys-314	41	5	not	not	PART
bionys-314	41	6	been	be	AUX
bionys-314	41	7	carried	carry	VERB
bionys-314	41	8	out	out	ADP
bionys-314	41	9	on	on	ADP
bionys-314	41	10	the	the	DET
bionys-314	41	11	role	role	NOUN
bionys-314	41	12	of	of	ADP
bionys-314	41	13	this	this	DET
bionys-314	41	14	isoform	isoform	NOUN
bionys-314	41	15	in	in	ADP
bionys-314	41	16	the	the	DET
bionys-314	41	17	improvement	improvement	NOUN
bionys-314	41	18	of	of	ADP
bionys-314	41	19	drought	drought	NOUN
bionys-314	41	20	tolerance	tolerance	NOUN
bionys-314	41	21	in	in	ADP
bionys-314	41	22	tea	tea	NOUN
bionys-314	41	23	.	.	PUNCT
bionys-314	42	1	in	in	ADP
bionys-314	42	2	light	light	NOUN
bionys-314	42	3	of	of	ADP
bionys-314	42	4	the	the	DET
bionys-314	42	5	results	result	NOUN
bionys-314	42	6	in	in	ADP
bionys-314	42	7	other	other	ADJ
bionys-314	42	8	plants	plant	NOUN
bionys-314	42	9	,	,	PUNCT
bionys-314	42	10	mn	mn	PROPN
bionys-314	42	11	-	-	PUNCT
bionys-314	42	12	sod	sod	NOUN
bionys-314	42	13	is	be	AUX
bionys-314	42	14	expected	expect	VERB
bionys-314	42	15	to	to	PART
bionys-314	42	16	play	play	VERB
bionys-314	42	17	a	a	DET
bionys-314	42	18	crucial	crucial	ADJ
bionys-314	42	19	role	role	NOUN
bionys-314	42	20	in	in	ADP
bionys-314	42	21	the	the	DET
bionys-314	42	22	improvement	improvement	NOUN
bionys-314	42	23	of	of	ADP
bionys-314	42	24	drought	drought	NOUN
bionys-314	42	25	tolerance	tolerance	NOUN
bionys-314	42	26	in	in	ADP
bionys-314	42	27	tea	tea	NOUN
bionys-314	42	28	.	.	PUNCT
bionys-314	43	1	hence	hence	ADV
bionys-314	43	2	,	,	PUNCT
bionys-314	43	3	in	in	ADP
bionys-314	43	4	this	this	DET
bionys-314	43	5	study	study	NOUN
bionys-314	43	6	,	,	PUNCT
bionys-314	43	7	the	the	DET
bionys-314	43	8	role	role	NOUN
bionys-314	43	9	of	of	ADP
bionys-314	43	10	this	this	DET
bionys-314	43	11	isoform	isoform	NOUN
bionys-314	43	12	in	in	ADP
bionys-314	43	13	resistance	resistance	NOUN
bionys-314	43	14	to	to	ADP
bionys-314	43	15	drought	drought	NOUN
bionys-314	43	16	was	be	AUX
bionys-314	43	17	examined	examine	VERB
bionys-314	43	18	.	.	PUNCT
bionys-314	44	1	complex	complex	ADJ
bionys-314	44	2	responses	response	NOUN
bionys-314	44	3	of	of	ADP
bionys-314	44	4	plants	plant	NOUN
bionys-314	44	5	to	to	ADP
bionys-314	44	6	abiotic	abiotic	ADJ
bionys-314	44	7	stresses	stress	NOUN
bionys-314	44	8	are	be	AUX
bionys-314	44	9	manifested	manifest	VERB
bionys-314	44	10	in	in	ADP
bionys-314	44	11	the	the	DET
bionys-314	44	12	expression	expression	NOUN
bionys-314	44	13	of	of	ADP
bionys-314	44	14	multiple	multiple	ADJ
bionys-314	44	15	genes	gene	NOUN
bionys-314	44	16	and	and	CCONJ
bionys-314	44	17	various	various	ADJ
bionys-314	44	18	biochemical	biochemical	ADJ
bionys-314	44	19	and	and	CCONJ
bionys-314	44	20	molecular	molecular	ADJ
bionys-314	44	21	pathways	pathway	NOUN
bionys-314	44	22	.	.	PUNCT
bionys-314	45	1	understanding	understand	VERB
bionys-314	45	2	these	these	DET
bionys-314	45	3	differences	difference	NOUN
bionys-314	45	4	will	will	AUX
bionys-314	45	5	lead	lead	VERB
bionys-314	45	6	to	to	ADP
bionys-314	45	7	the	the	DET
bionys-314	45	8	identification	identification	NOUN
bionys-314	45	9	of	of	ADP
bionys-314	45	10	genes	gene	NOUN
bionys-314	45	11	and	and	CCONJ
bionys-314	45	12	molecular	molecular	ADJ
bionys-314	45	13	processes	process	NOUN
bionys-314	45	14	that	that	PRON
bionys-314	45	15	play	play	VERB
bionys-314	45	16	roles	role	NOUN
bionys-314	45	17	in	in	ADP
bionys-314	45	18	a	a	DET
bionys-314	45	19	variety	variety	NOUN
bionys-314	45	20	of	of	ADP
bionys-314	45	21	conditions	condition	NOUN
bionys-314	45	22	within	within	ADP
bionys-314	45	23	biological	biological	ADJ
bionys-314	45	24	systems	system	NOUN
bionys-314	45	25	(	(	PUNCT
bionys-314	45	26	moody	moody	NOUN
bionys-314	45	27	,	,	PUNCT
bionys-314	45	28	2001	2001	NUM
bionys-314	45	29	)	)	PUNCT
bionys-314	45	30	.	.	PUNCT
bionys-314	46	1	in	in	ADP
bionys-314	46	2	this	this	DET
bionys-314	46	3	study	study	NOUN
bionys-314	46	4	,	,	PUNCT
bionys-314	46	5	the	the	DET
bionys-314	46	6	expression	expression	NOUN
bionys-314	46	7	levels	level	NOUN
bionys-314	46	8	of	of	ADP
bionys-314	46	9	sod	sod	NOUN
bionys-314	46	10	transcripts	transcript	NOUN
bionys-314	46	11	were	be	AUX
bionys-314	46	12	measured	measure	VERB
bionys-314	46	13	by	by	ADP
bionys-314	46	14	real	real	ADJ
bionys-314	46	15	-	-	PUNCT
bionys-314	46	16	time	time	NOUN
bionys-314	46	17	pcr	pcr	NOUN
bionys-314	46	18	.	.	PUNCT
bionys-314	47	1	to	to	PART
bionys-314	47	2	evaluate	evaluate	VERB
bionys-314	47	3	the	the	DET
bionys-314	47	4	adaptation	adaptation	NOUN
bionys-314	47	5	capacity	capacity	NOUN
bionys-314	47	6	of	of	ADP
bionys-314	47	7	the	the	DET
bionys-314	47	8	two	two	NUM
bionys-314	47	9	clones	clone	NOUN
bionys-314	47	10	investigated	investigate	VERB
bionys-314	47	11	100	100	NUM
bionys-314	47	12	and	and	CCONJ
bionys-314	47	13	dn	dn	VERB
bionys-314	47	14	against	against	ADP
bionys-314	47	15	oxidative	oxidative	ADJ
bionys-314	47	16	stress	stress	NOUN
bionys-314	47	17	caused	cause	VERB
bionys-314	47	18	by	by	ADP
bionys-314	47	19	drought	drought	NOUN
bionys-314	47	20	,	,	PUNCT
bionys-314	47	21	some	some	DET
bionys-314	47	22	indicators	indicator	NOUN
bionys-314	47	23	of	of	ADP
bionys-314	47	24	oxidative	oxidative	ADJ
bionys-314	47	25	stress	stress	NOUN
bionys-314	47	26	,	,	PUNCT
bionys-314	47	27	such	such	ADJ
bionys-314	47	28	as	as	ADP
bionys-314	47	29	malondialdehyde	malondialdehyde	PROPN
bionys-314	47	30	(	(	PUNCT
bionys-314	47	31	mda	mda	PROPN
bionys-314	47	32	)	)	PUNCT
bionys-314	47	33	,	,	PUNCT
bionys-314	47	34	carotenoid	carotenoid	NOUN
bionys-314	47	35	and	and	CCONJ
bionys-314	47	36	proline	proline	NOUN
bionys-314	47	37	content	content	NOUN
bionys-314	47	38	,	,	PUNCT
bionys-314	47	39	chlorophyll	chlorophyll	VERB
bionys-314	47	40	a	a	PRON
bionys-314	47	41	and	and	CCONJ
bionys-314	47	42	total	total	ADJ
bionys-314	47	43	chlorophyll	chlorophyll	NOUN
bionys-314	47	44	were	be	AUX
bionys-314	47	45	also	also	ADV
bionys-314	47	46	investigated	investigate	VERB
bionys-314	47	47	.	.	PUNCT
bionys-314	48	1	material	material	NOUN
bionys-314	48	2	and	and	CCONJ
bionys-314	48	3	methods	method	NOUN
bionys-314	48	4	sampling	sample	VERB
bionys-314	48	5	two	two	NUM
bionys-314	48	6	selected	select	VERB
bionys-314	48	7	genotypes	genotype	NOUN
bionys-314	48	8	belonging	belong	VERB
bionys-314	48	9	to	to	ADP
bionys-314	48	10	the	the	DET
bionys-314	48	11	tea	tea	NOUN
bionys-314	48	12	research	research	NOUN
bionys-314	48	13	center	center	NOUN
bionys-314	48	14	,	,	PUNCT
bionys-314	48	15	namely	namely	ADV
bionys-314	48	16	dn	dn	NOUN
bionys-314	48	17	and	and	CCONJ
bionys-314	48	18	100	100	NUM
bionys-314	48	19	,	,	PUNCT
bionys-314	48	20	were	be	AUX
bionys-314	48	21	used	use	VERB
bionys-314	48	22	in	in	ADP
bionys-314	48	23	this	this	DET
bionys-314	48	24	study	study	NOUN
bionys-314	48	25	.	.	PUNCT
bionys-314	49	1	farm	farm	NOUN
bionys-314	49	2	sampling	sampling	NOUN
bionys-314	49	3	was	be	AUX
bionys-314	49	4	done	do	VERB
bionys-314	49	5	from	from	ADP
bionys-314	49	6	8th	8th	ADJ
bionys-314	49	7	july	july	PROPN
bionys-314	49	8	till	till	SCONJ
bionys-314	49	9	25th	25th	ADJ
bionys-314	49	10	july	july	PROPN
bionys-314	49	11	for	for	ADP
bionys-314	49	12	17	17	NUM
bionys-314	49	13	days	day	NOUN
bionys-314	49	14	at	at	ADP
bionys-314	49	15	the	the	DET
bionys-314	49	16	fashalam	fashalam	PROPN
bionys-314	49	17	research	research	NOUN
bionys-314	49	18	station	station	NOUN
bionys-314	49	19	,	,	PUNCT
bionys-314	49	20	iran	iran	PROPN
bionys-314	49	21	.	.	PUNCT
bionys-314	50	1	the	the	DET
bionys-314	50	2	experiment	experiment	NOUN
bionys-314	50	3	was	be	AUX
bionys-314	50	4	arranged	arrange	VERB
bionys-314	50	5	with	with	ADP
bionys-314	50	6	a	a	DET
bionys-314	50	7	randomized	randomized	ADJ
bionys-314	50	8	complete	complete	ADJ
bionys-314	50	9	block	block	NOUN
bionys-314	50	10	design	design	NOUN
bionys-314	50	11	with	with	ADP
bionys-314	50	12	3	3	NUM
bionys-314	50	13	replicates	replicate	NOUN
bionys-314	50	14	.	.	PUNCT
bionys-314	51	1	10	10	NUM
bionys-314	51	2	-	-	PUNCT
bionys-314	51	3	year	year	NOUN
bionys-314	51	4	-	-	PUNCT
bionys-314	51	5	old	old	ADJ
bionys-314	51	6	vegetatively	vegetatively	ADV
bionys-314	51	7	propagated	propagate	VERB
bionys-314	51	8	tea	tea	NOUN
bionys-314	51	9	plants	plant	NOUN
bionys-314	51	10	(	(	PUNCT
bionys-314	51	11	70	70	NUM
bionys-314	51	12	-	-	SYM
bionys-314	51	13	80	80	NUM
bionys-314	51	14	cm	cm	NOUN
bionys-314	51	15	,	,	PUNCT
bionys-314	51	16	height	height	NOUN
bionys-314	51	17	)	)	PUNCT
bionys-314	51	18	were	be	AUX
bionys-314	51	19	used	use	VERB
bionys-314	51	20	under	under	ADP
bionys-314	51	21	farm	farm	NOUN
bionys-314	51	22	conditions	condition	NOUN
bionys-314	51	23	(	(	PUNCT
bionys-314	51	24	at	at	ADP
bionys-314	51	25	~24	~24	NOUN
bionys-314	51	26	-	-	SYM
bionys-314	51	27	33	33	NUM
bionys-314	51	28	°	°	PROPN
bionys-314	51	29	c	c	NOUN
bionys-314	51	30	day	day	NOUN
bionys-314	51	31	/	/	SYM
bionys-314	51	32	night	night	NOUN
bionys-314	51	33	and	and	CCONJ
bionys-314	51	34	relative	relative	ADJ
bionys-314	51	35	humidity	humidity	NOUN
bionys-314	51	36	of	of	ADP
bionys-314	51	37	75	75	NUM
bionys-314	51	38	-	-	SYM
bionys-314	51	39	80	80	NUM
bionys-314	51	40	%	%	NOUN
bionys-314	51	41	)	)	PUNCT
bionys-314	51	42	at	at	ADP
bionys-314	51	43	longitude	longitude	NOUN
bionys-314	51	44	and	and	CCONJ
bionys-314	51	45	latitude	latitude	NOUN
bionys-314	51	46	49	49	NUM
bionys-314	51	47	°	°	PROPN
bionys-314	51	48	55ʹ10ʺ	55ʹ10ʺ	NUM
bionys-314	51	49	and	and	CCONJ
bionys-314	51	50	37	37	NUM
bionys-314	51	51	°	°	NUM
bionys-314	51	52	8ʹ20ʺ	8ʹ20ʺ	NUM
bionys-314	51	53	,	,	PUNCT
bionys-314	51	54	respectively	respectively	ADV
bionys-314	51	55	.	.	PUNCT
bionys-314	52	1	soil	soil	NOUN
bionys-314	52	2	was	be	AUX
bionys-314	52	3	sandy	sandy	NOUN
bionys-314	52	4	-	-	PUNCT
bionys-314	52	5	loam	loam	NOUN
bionys-314	52	6	with	with	ADP
bionys-314	52	7	ph	ph	PROPN
bionys-314	52	8	5.8	5.8	NUM
bionys-314	52	9	and	and	CCONJ
bionys-314	52	10	electric	electric	ADJ
bionys-314	52	11	conductivity	conductivity	NOUN
bionys-314	52	12	=	=	SYM
bionys-314	52	13	270	270	NUM
bionys-314	52	14	.	.	PUNCT
bionys-314	53	1	based	base	VERB
bionys-314	53	2	on	on	ADP
bionys-314	53	3	data	datum	NOUN
bionys-314	53	4	obtained	obtain	VERB
bionys-314	53	5	previously	previously	ADV
bionys-314	53	6	,	,	PUNCT
bionys-314	53	7	a	a	DET
bionys-314	53	8	10	10	NUM
bionys-314	53	9	-	-	PUNCT
bionys-314	53	10	day	day	NOUN
bionys-314	53	11	drought	drought	NOUN
bionys-314	53	12	stress	stress	NOUN
bionys-314	53	13	was	be	AUX
bionys-314	53	14	imposed	impose	VERB
bionys-314	53	15	on	on	ADP
bionys-314	53	16	the	the	DET
bionys-314	53	17	plants	plant	NOUN
bionys-314	53	18	.	.	PUNCT
bionys-314	54	1	this	this	PRON
bionys-314	54	2	was	be	AUX
bionys-314	54	3	followed	follow	VERB
bionys-314	54	4	by	by	ADP
bionys-314	54	5	a	a	DET
bionys-314	54	6	one	one	NUM
bionys-314	54	7	week	week	NOUN
bionys-314	54	8	irrigation	irrigation	NOUN
bionys-314	54	9	period	period	NOUN
bionys-314	54	10	(	(	PUNCT
bionys-314	54	11	twice	twice	DET
bionys-314	54	12	a	a	DET
bionys-314	54	13	week	week	NOUN
bionys-314	54	14	,	,	PUNCT
bionys-314	54	15	according	accord	VERB
bionys-314	54	16	to	to	ADP
bionys-314	54	17	the	the	DET
bionys-314	54	18	usual	usual	ADJ
bionys-314	54	19	practice	practice	NOUN
bionys-314	54	20	of	of	ADP
bionys-314	54	21	the	the	DET
bionys-314	54	22	research	research	NOUN
bionys-314	54	23	station	station	NOUN
bionys-314	54	24	)	)	PUNCT
bionys-314	54	25	to	to	PART
bionys-314	54	26	exit	exit	VERB
bionys-314	54	27	from	from	ADP
bionys-314	54	28	the	the	DET
bionys-314	54	29	stress	stress	NOUN
bionys-314	54	30	condition	condition	NOUN
bionys-314	54	31	.	.	PUNCT
bionys-314	55	1	soil	soil	NOUN
bionys-314	55	2	moisture	moisture	NOUN
bionys-314	55	3	content	content	NOUN
bionys-314	55	4	(	(	PUNCT
bionys-314	55	5	smc	smc	PROPN
bionys-314	55	6	)	)	PUNCT
bionys-314	55	7	was	be	AUX
bionys-314	55	8	measured	measure	VERB
bionys-314	55	9	on	on	ADP
bionys-314	55	10	days	day	NOUN
bionys-314	55	11	0	0	NUM
bionys-314	55	12	,	,	PUNCT
bionys-314	55	13	5	5	NUM
bionys-314	55	14	,	,	PUNCT
bionys-314	55	15	10	10	NUM
bionys-314	55	16	and	and	CCONJ
bionys-314	55	17	15th	15th	ADJ
bionys-314	55	18	after	after	SCONJ
bionys-314	55	19	withholding	withhold	VERB
bionys-314	55	20	water	water	NOUN
bionys-314	55	21	began	begin	VERB
bionys-314	55	22	(	(	PUNCT
bionys-314	55	23	black	black	ADJ
bionys-314	55	24	,	,	PUNCT
bionys-314	55	25	1965	1965	NUM
bionys-314	55	26	)	)	PUNCT
bionys-314	55	27	.	.	PUNCT
bionys-314	56	1	sampling	sample	VERB
bionys-314	56	2	from	from	ADP
bionys-314	56	3	the	the	DET
bionys-314	56	4	third	third	ADJ
bionys-314	56	5	terminal	terminal	ADJ
bionys-314	56	6	leaf	leaf	NOUN
bionys-314	56	7	was	be	AUX
bionys-314	56	8	carried	carry	VERB
bionys-314	56	9	out	out	ADP
bionys-314	56	10	in	in	ADP
bionys-314	56	11	2	2	NUM
bionys-314	56	12	steps	step	NOUN
bionys-314	56	13	,	,	PUNCT
bionys-314	56	14	at	at	ADP
bionys-314	56	15	day	day	NOUN
bionys-314	56	16	10	10	NUM
bionys-314	56	17	and	and	CCONJ
bionys-314	56	18	day	day	NOUN
bionys-314	56	19	17	17	NUM
bionys-314	56	20	.	.	PUNCT
bionys-314	57	1	these	these	DET
bionys-314	57	2	samples	sample	NOUN
bionys-314	57	3	provided	provide	VERB
bionys-314	57	4	data	datum	NOUN
bionys-314	57	5	showing	show	VERB
bionys-314	57	6	the	the	DET
bionys-314	57	7	effects	effect	NOUN
bionys-314	57	8	of	of	ADP
bionys-314	57	9	drought	drought	NOUN
bionys-314	57	10	stress	stress	NOUN
bionys-314	57	11	and	and	CCONJ
bionys-314	57	12	exit	exit	NOUN
bionys-314	57	13	from	from	ADP
bionys-314	57	14	drought	drought	NOUN
bionys-314	57	15	conditions	condition	NOUN
bionys-314	57	16	,	,	PUNCT
bionys-314	57	17	respectively	respectively	ADV
bionys-314	57	18	.	.	PUNCT
bionys-314	58	1	leaves	leave	NOUN
bionys-314	58	2	were	be	AUX
bionys-314	58	3	moved	move	VERB
bionys-314	58	4	in	in	ADP
bionys-314	58	5	liquid	liquid	ADJ
bionys-314	58	6	nitrogen	nitrogen	NOUN
bionys-314	58	7	and	and	CCONJ
bionys-314	58	8	kept	keep	VERB
bionys-314	58	9	at	at	ADP
bionys-314	58	10	-70	-70	PROPN
bionys-314	58	11	°	°	PROPN
bionys-314	58	12	c	c	NOUN
bionys-314	58	13	until	until	SCONJ
bionys-314	58	14	needed	need	VERB
bionys-314	58	15	.	.	PUNCT
bionys-314	59	1	total	total	ADJ
bionys-314	59	2	rna	rna	NOUN
bionys-314	59	3	extraction	extraction	NOUN
bionys-314	59	4	fresh	fresh	ADJ
bionys-314	59	5	leaf	leaf	NOUN
bionys-314	59	6	tissue	tissue	NOUN
bionys-314	59	7	,	,	PUNCT
bionys-314	59	8	0.1	0.1	NUM
bionys-314	59	9	g	g	NOUN
bionys-314	59	10	,	,	PUNCT
bionys-314	59	11	was	be	AUX
bionys-314	59	12	used	use	VERB
bionys-314	59	13	for	for	ADP
bionys-314	59	14	rna	rna	NOUN
bionys-314	59	15	extraction	extraction	NOUN
bionys-314	59	16	according	accord	VERB
bionys-314	59	17	to	to	ADP
bionys-314	59	18	kit	kit	NOUN
bionys-314	59	19	instructions	instruction	NOUN
bionys-314	59	20	(	(	PUNCT
bionys-314	59	21	cinnagen	cinnagen	PROPN
bionys-314	59	22	co.	co.	PROPN
bionys-314	59	23	)	)	PUNCT
bionys-314	59	24	,	,	PUNCT
bionys-314	59	25	with	with	ADP
bionys-314	59	26	slight	slight	ADJ
bionys-314	59	27	modification	modification	NOUN
bionys-314	59	28	.	.	PUNCT
bionys-314	60	1	because	because	SCONJ
bionys-314	60	2	high	high	ADJ
bionys-314	60	3	levels	level	NOUN
bionys-314	60	4	of	of	ADP
bionys-314	60	5	secondary	secondary	ADJ
bionys-314	60	6	metabolites	metabolite	NOUN
bionys-314	60	7	in	in	ADP
bionys-314	60	8	tea	tea	NOUN
bionys-314	60	9	prevent	prevent	NOUN
bionys-314	60	10	high	high	ADJ
bionys-314	60	11	-	-	PUNCT
bionys-314	60	12	quality	quality	NOUN
bionys-314	60	13	rna	rna	NOUN
bionys-314	60	14	extraction	extraction	NOUN
bionys-314	60	15	,	,	PUNCT
bionys-314	60	16	isoamyl	isoamyl	NOUN
bionys-314	60	17	chloroform	chloroform	NOUN
bionys-314	60	18	(	(	PUNCT
bionys-314	60	19	1:24	1:24	NUM
bionys-314	60	20	)	)	PUNCT
bionys-314	60	21	was	be	AUX
bionys-314	60	22	used	use	VERB
bionys-314	60	23	to	to	PART
bionys-314	60	24	minimize	minimize	VERB
bionys-314	60	25	the	the	DET
bionys-314	60	26	deposition	deposition	NOUN
bionys-314	60	27	of	of	ADP
bionys-314	60	28	these	these	DET
bionys-314	60	29	compounds	compound	NOUN
bionys-314	60	30	in	in	ADP
bionys-314	60	31	rna	rna	NOUN
bionys-314	60	32	isolates	isolate	NOUN
bionys-314	60	33	,	,	PUNCT
bionys-314	60	34	and	and	CCONJ
bionys-314	60	35	sodium	sodium	NOUN
bionys-314	60	36	acetate	acetate	NOUN
bionys-314	60	37	(	(	PUNCT
bionys-314	60	38	2	2	NUM
bionys-314	60	39	m	m	VERB
bionys-314	60	40	)	)	PUNCT
bionys-314	60	41	was	be	AUX
bionys-314	60	42	applied	apply	VERB
bionys-314	60	43	to	to	PART
bionys-314	60	44	optimize	optimize	VERB
bionys-314	60	45	rna	rna	NOUN
bionys-314	60	46	precipitation	precipitation	NOUN
bionys-314	60	47	.	.	PUNCT
bionys-314	61	1	after	after	ADP
bionys-314	61	2	extraction	extraction	NOUN
bionys-314	61	3	,	,	PUNCT
bionys-314	61	4	the	the	DET
bionys-314	61	5	resulting	result	VERB
bionys-314	61	6	pellet	pellet	NOUN
bionys-314	61	7	was	be	AUX
bionys-314	61	8	dissolved	dissolve	VERB
bionys-314	61	9	in	in	ADP
bionys-314	61	10	50	50	NUM
bionys-314	61	11	μl	μl	ADP
bionys-314	61	12	depc	depc	NOUN
bionys-314	61	13	-	-	PUNCT
bionys-314	61	14	treated	treat	VERB
bionys-314	61	15	water	water	NOUN
bionys-314	61	16	and	and	CCONJ
bionys-314	61	17	maintained	maintain	VERB
bionys-314	61	18	at	at	ADP
bionys-314	61	19	-70	-70	PROPN
bionys-314	61	20	°	°	PROPN
bionys-314	61	21	c	c	NOUN
bionys-314	61	22	.	.	PUNCT
bionys-314	62	1	to	to	PART
bionys-314	62	2	determine	determine	VERB
bionys-314	62	3	the	the	DET
bionys-314	62	4	46	46	NUM
bionys-314	62	5	biologica	biologica	PROPN
bionys-314	62	6	nyssana	nyssana	PROPN
bionys-314	62	7	●	●	PUNCT
bionys-314	62	8	11	11	NUM
bionys-314	62	9	(	(	PUNCT
bionys-314	62	10	1	1	NUM
bionys-314	62	11	)	)	PUNCT
bionys-314	62	12	september	september	PROPN
bionys-314	62	13	2020	2020	NUM
bionys-314	62	14	:	:	PUNCT
bionys-314	62	15	45	45	NUM
bionys-314	62	16	-	-	SYM
bionys-314	62	17	54	54	NUM
bionys-314	62	18	mohammadi	mohammadi	NOUN
bionys-314	62	19	et	et	PROPN
bionys-314	62	20	al	al	PROPN
bionys-314	62	21	.	.	PUNCT
bionys-314	63	1	●	●	PUNCT
bionys-314	63	2	a	a	DET
bionys-314	63	3	real	real	ADJ
bionys-314	63	4	-	-	PUNCT
bionys-314	63	5	time	time	NOUN
bionys-314	63	6	pcr	pcr	NOUN
bionys-314	63	7	assay	assay	NOUN
bionys-314	63	8	for	for	ADP
bionys-314	63	9	evaluation	evaluation	NOUN
bionys-314	63	10	of	of	ADP
bionys-314	63	11	drought	drought	NOUN
bionys-314	63	12	tolerance	tolerance	NOUN
bionys-314	63	13	in	in	ADP
bionys-314	63	14	a	a	DET
bionys-314	63	15	new	new	ADJ
bionys-314	63	16	tea	tea	NOUN
bionys-314	63	17	clone	clone	NOUN
bionys-314	63	18	47	47	NUM
bionys-314	63	19	biologica	biologica	PROPN
bionys-314	63	20	nyssana	nyssana	PROPN
bionys-314	64	1	●	●	PUNCT
bionys-314	64	2	11	11	NUM
bionys-314	64	3	(	(	PUNCT
bionys-314	64	4	1	1	NUM
bionys-314	64	5	)	)	PUNCT
bionys-314	64	6	september	september	PROPN
bionys-314	64	7	2020	2020	NUM
bionys-314	64	8	:	:	PUNCT
bionys-314	64	9	45	45	NUM
bionys-314	64	10	-	-	SYM
bionys-314	64	11	54	54	NUM
bionys-314	64	12	mohammadi	mohammadi	NOUN
bionys-314	64	13	et	et	PROPN
bionys-314	64	14	al	al	PROPN
bionys-314	64	15	.	.	PUNCT
bionys-314	65	1	●	●	PUNCT
bionys-314	65	2	a	a	DET
bionys-314	65	3	real	real	ADJ
bionys-314	65	4	-	-	PUNCT
bionys-314	65	5	time	time	NOUN
bionys-314	65	6	pcr	pcr	NOUN
bionys-314	65	7	assay	assay	NOUN
bionys-314	65	8	for	for	ADP
bionys-314	65	9	evaluation	evaluation	NOUN
bionys-314	65	10	of	of	ADP
bionys-314	65	11	drought	drought	NOUN
bionys-314	65	12	tolerance	tolerance	NOUN
bionys-314	65	13	in	in	ADP
bionys-314	65	14	a	a	DET
bionys-314	65	15	new	new	ADJ
bionys-314	65	16	tea	tea	NOUN
bionys-314	65	17	clone	clone	NOUN
bionys-314	65	18	quality	quality	NOUN
bionys-314	65	19	of	of	ADP
bionys-314	65	20	the	the	DET
bionys-314	65	21	extracted	extract	VERB
bionys-314	65	22	rna	rna	NOUN
bionys-314	65	23	,	,	PUNCT
bionys-314	65	24	1	1	NUM
bionys-314	65	25	%	%	NOUN
bionys-314	65	26	agarose	agarose	NOUN
bionys-314	65	27	gel	gel	NOUN
bionys-314	65	28	electrophoresis	electrophoresis	NOUN
bionys-314	65	29	was	be	AUX
bionys-314	65	30	used	use	VERB
bionys-314	65	31	.	.	PUNCT
bionys-314	66	1	to	to	PART
bionys-314	66	2	determine	determine	VERB
bionys-314	66	3	the	the	DET
bionys-314	66	4	quantity	quantity	NOUN
bionys-314	66	5	and	and	CCONJ
bionys-314	66	6	the	the	DET
bionys-314	66	7	degree	degree	NOUN
bionys-314	66	8	of	of	ADP
bionys-314	66	9	contamination	contamination	NOUN
bionys-314	66	10	of	of	ADP
bionys-314	66	11	the	the	DET
bionys-314	66	12	rna	rna	NOUN
bionys-314	66	13	,	,	PUNCT
bionys-314	66	14	absorbance	absorbance	NOUN
bionys-314	66	15	was	be	AUX
bionys-314	66	16	read	read	VERB
bionys-314	66	17	at	at	ADP
bionys-314	66	18	a260/280	a260/280	NOUN
bionys-314	66	19	and	and	CCONJ
bionys-314	66	20	a260/230	a260/230	PRON
bionys-314	67	1	nm	nm	PROPN
bionys-314	67	2	.	.	PUNCT
bionys-314	68	1	rnas	rnas	PROPN
bionys-314	68	2	concentration	concentration	NOUN
bionys-314	68	3	in	in	ADP
bionys-314	68	4	µg/µl	µg/µl	NUM
bionys-314	68	5	was	be	AUX
bionys-314	68	6	calculated	calculate	VERB
bionys-314	68	7	as	as	ADP
bionys-314	68	8	:	:	PUNCT
bionys-314	68	9	cdna	cdna	PROPN
bionys-314	68	10	synthesis	synthesis	NOUN
bionys-314	68	11	by	by	ADP
bionys-314	68	12	the	the	DET
bionys-314	68	13	protocol	protocol	NOUN
bionys-314	68	14	included	include	VERB
bionys-314	68	15	with	with	ADP
bionys-314	68	16	the	the	DET
bionys-314	68	17	accupower	accupower	NOUN
bionys-314	68	18	rt	rt	PROPN
bionys-314	68	19	premix	premix	PROPN
bionys-314	68	20	kit	kit	NOUN
bionys-314	68	21	(	(	PUNCT
bionys-314	68	22	bioneer	bioneer	NOUN
bionys-314	68	23	)	)	PUNCT
bionys-314	68	24	,	,	PUNCT
bionys-314	68	25	one	one	NUM
bionys-314	68	26	microgram	microgram	NOUN
bionys-314	68	27	of	of	ADP
bionys-314	68	28	rna	rna	PROPN
bionys-314	68	29	was	be	AUX
bionys-314	68	30	used	use	VERB
bionys-314	68	31	for	for	ADP
bionys-314	68	32	cdna	cdna	PROPN
bionys-314	68	33	synthesis	synthesis	NOUN
bionys-314	68	34	.	.	PUNCT
bionys-314	69	1	first	first	ADV
bionys-314	69	2	,	,	PUNCT
bionys-314	69	3	1	1	NUM
bionys-314	69	4	µg	µg	NOUN
bionys-314	69	5	of	of	ADP
bionys-314	69	6	rna	rna	NOUN
bionys-314	69	7	was	be	AUX
bionys-314	69	8	mixed	mix	VERB
bionys-314	69	9	with	with	ADP
bionys-314	69	10	0.5	0.5	NUM
bionys-314	69	11	µg	µg	NOUN
bionys-314	69	12	of	of	ADP
bionys-314	69	13	oligo	oligo	ADJ
bionys-314	69	14	dt	dt	NOUN
bionys-314	69	15	primer	primer	NOUN
bionys-314	69	16	and	and	CCONJ
bionys-314	69	17	the	the	DET
bionys-314	69	18	mixture	mixture	NOUN
bionys-314	69	19	was	be	AUX
bionys-314	69	20	incubated	incubate	VERB
bionys-314	69	21	at	at	ADP
bionys-314	69	22	70	70	NUM
bionys-314	69	23	°	°	ADP
bionys-314	69	24	c	c	NOUN
bionys-314	69	25	for	for	SCONJ
bionys-314	69	26	5	5	NUM
bionys-314	69	27	min	min	NOUN
bionys-314	69	28	to	to	PART
bionys-314	69	29	complete	complete	VERB
bionys-314	69	30	annealing	annealing	NOUN
bionys-314	69	31	.	.	PUNCT
bionys-314	70	1	the	the	DET
bionys-314	70	2	product	product	NOUN
bionys-314	70	3	was	be	AUX
bionys-314	70	4	then	then	ADV
bionys-314	70	5	transferred	transfer	VERB
bionys-314	70	6	to	to	PART
bionys-314	70	7	accupower	accupower	VERB
bionys-314	70	8	rt	rt	PROPN
bionys-314	70	9	premix	premix	PROPN
bionys-314	70	10	microtube	microtube	NOUN
bionys-314	70	11	and	and	CCONJ
bionys-314	70	12	the	the	DET
bionys-314	70	13	volume	volume	NOUN
bionys-314	70	14	was	be	AUX
bionys-314	70	15	brought	bring	VERB
bionys-314	70	16	to	to	ADP
bionys-314	70	17	20	20	NUM
bionys-314	70	18	µl	µl	NOUN
bionys-314	70	19	with	with	ADP
bionys-314	70	20	depc	depc	NOUN
bionys-314	70	21	-	-	PUNCT
bionys-314	70	22	treated	treat	VERB
bionys-314	70	23	water	water	NOUN
bionys-314	70	24	.	.	PUNCT
bionys-314	71	1	this	this	PRON
bionys-314	71	2	was	be	AUX
bionys-314	71	3	vortexed	vortexe	VERB
bionys-314	71	4	for	for	ADP
bionys-314	71	5	a	a	DET
bionys-314	71	6	few	few	ADJ
bionys-314	71	7	seconds	second	NOUN
bionys-314	71	8	and	and	CCONJ
bionys-314	71	9	placed	place	VERB
bionys-314	71	10	for	for	ADP
bionys-314	71	11	60	60	NUM
bionys-314	71	12	min	min	NOUN
bionys-314	71	13	at	at	ADP
bionys-314	71	14	42	42	NUM
bionys-314	71	15	°	°	NOUN
bionys-314	71	16	c	c	NOUN
bionys-314	71	17	.	.	PUNCT
bionys-314	72	1	finally	finally	ADV
bionys-314	72	2	,	,	PUNCT
bionys-314	72	3	the	the	DET
bionys-314	72	4	mixture	mixture	NOUN
bionys-314	72	5	was	be	AUX
bionys-314	72	6	placed	place	VERB
bionys-314	72	7	at	at	ADP
bionys-314	72	8	94	94	NUM
bionys-314	72	9	°	°	ADP
bionys-314	72	10	c	c	NOUN
bionys-314	72	11	for	for	ADP
bionys-314	72	12	5	5	NUM
bionys-314	72	13	min	min	NOUN
bionys-314	72	14	and	and	CCONJ
bionys-314	72	15	the	the	DET
bionys-314	72	16	synthesized	synthesize	VERB
bionys-314	72	17	cdna	cdna	PROPN
bionys-314	72	18	was	be	AUX
bionys-314	72	19	maintained	maintain	VERB
bionys-314	72	20	at	at	ADP
bionys-314	72	21	-20	-20	NUM
bionys-314	72	22	°	°	PROPN
bionys-314	72	23	c	c	NOUN
bionys-314	72	24	.	.	PUNCT
bionys-314	73	1	primer	primer	NOUN
bionys-314	73	2	design	design	NOUN
bionys-314	73	3	primers	primer	NOUN
bionys-314	73	4	used	use	VERB
bionys-314	73	5	for	for	ADP
bionys-314	73	6	mn	mn	PROPN
bionys-314	73	7	-	-	PUNCT
bionys-314	73	8	sod	sod	NOUN
bionys-314	73	9	gene	gene	NOUN
bionys-314	73	10	and	and	CCONJ
bionys-314	73	11	the	the	DET
bionys-314	73	12	18s	18s	NUM
bionys-314	73	13	rrna	rrna	PROPN
bionys-314	73	14	reference	reference	NOUN
bionys-314	73	15	gene	gene	NOUN
bionys-314	73	16	were	be	AUX
bionys-314	73	17	designed	design	VERB
bionys-314	73	18	using	use	VERB
bionys-314	73	19	oligo7	oligo7	PROPN
bionys-314	73	20	software	software	NOUN
bionys-314	73	21	(	(	PUNCT
bionys-314	73	22	molecular	molecular	ADJ
bionys-314	73	23	biology	biology	NOUN
bionys-314	73	24	insights	insight	NOUN
bionys-314	73	25	,	,	PUNCT
bionys-314	73	26	inc	inc	PROPN
bionys-314	73	27	)	)	PUNCT
bionys-314	73	28	(	(	PUNCT
bionys-314	73	29	tab	tab	NOUN
bionys-314	73	30	.	.	NOUN
bionys-314	73	31	1	1	NUM
bionys-314	73	32	)	)	PUNCT
bionys-314	73	33	.	.	PUNCT
bionys-314	74	1	amplifications	amplification	NOUN
bionys-314	74	2	were	be	AUX
bionys-314	74	3	performed	perform	VERB
bionys-314	74	4	in	in	ADP
bionys-314	74	5	a	a	DET
bionys-314	74	6	total	total	ADJ
bionys-314	74	7	reaction	reaction	NOUN
bionys-314	74	8	volume	volume	NOUN
bionys-314	74	9	of	of	ADP
bionys-314	74	10	25	25	NUM
bionys-314	74	11	µl	µl	ADP
bionys-314	74	12	containing	contain	VERB
bionys-314	74	13	0.5	0.5	NUM
bionys-314	74	14	mm	mm	NOUN
bionys-314	74	15	of	of	ADP
bionys-314	74	16	dntp	dntp	PROPN
bionys-314	74	17	mix	mix	NOUN
bionys-314	74	18	,	,	PUNCT
bionys-314	74	19	1	1	NUM
bionys-314	74	20	µl	µl	ADP
bionys-314	74	21	of	of	ADP
bionys-314	74	22	each	each	DET
bionys-314	74	23	primer	primer	NOUN
bionys-314	74	24	,	,	PUNCT
bionys-314	74	25	2.5	2.5	NUM
bionys-314	74	26	µl	µl	NOUN
bionys-314	74	27	of	of	ADP
bionys-314	74	28	10x	10x	X
bionys-314	74	29	pcr	pcr	ADJ
bionys-314	74	30	buffer	buffer	NOUN
bionys-314	74	31	,	,	PUNCT
bionys-314	74	32	0.75	0.75	NUM
bionys-314	74	33	mm	mm	NOUN
bionys-314	74	34	mgcl2	mgcl2	PROPN
bionys-314	74	35	25	25	NUM
bionys-314	74	36	mm	mm	PROPN
bionys-314	74	37	,	,	PUNCT
bionys-314	74	38	0.3	0.3	NUM
bionys-314	74	39	unit	unit	NOUN
bionys-314	74	40	taq	taq	PROPN
bionys-314	74	41	dna	dna	PROPN
bionys-314	74	42	polymerase	polymerase	NOUN
bionys-314	74	43	and	and	CCONJ
bionys-314	74	44	4µl	4µl	NOUN
bionys-314	74	45	of	of	ADP
bionys-314	74	46	template	template	NOUN
bionys-314	74	47	cdna	cdna	PROPN
bionys-314	74	48	and	and	CCONJ
bionys-314	74	49	14.95	14.95	NUM
bionys-314	74	50	µl	µl	AUX
bionys-314	74	51	sterile	sterile	ADJ
bionys-314	74	52	distilled	distil	VERB
bionys-314	74	53	water	water	NOUN
bionys-314	74	54	with	with	ADP
bionys-314	74	55	an	an	DET
bionys-314	74	56	initial	initial	ADJ
bionys-314	74	57	denaturing	denature	VERB
bionys-314	74	58	step	step	NOUN
bionys-314	74	59	of	of	ADP
bionys-314	74	60	95	95	NUM
bionys-314	74	61	°	°	ADP
bionys-314	74	62	c	c	NOUN
bionys-314	74	63	for	for	ADP
bionys-314	74	64	5	5	NUM
bionys-314	74	65	min	min	NOUN
bionys-314	74	66	,	,	PUNCT
bionys-314	74	67	followed	follow	VERB
bionys-314	74	68	by	by	ADP
bionys-314	74	69	40	40	NUM
bionys-314	74	70	amplification	amplification	NOUN
bionys-314	74	71	cycles	cycle	NOUN
bionys-314	74	72	of	of	ADP
bionys-314	74	73	95	95	NUM
bionys-314	74	74	°	°	ADP
bionys-314	74	75	c	c	NOUN
bionys-314	74	76	for	for	ADP
bionys-314	74	77	45	45	NUM
bionys-314	74	78	s	s	NOUN
bionys-314	74	79	,	,	PUNCT
bionys-314	74	80	60.5±5	60.5±5	NUM
bionys-314	74	81	°	°	PRON
bionys-314	74	82	c	c	NOUN
bionys-314	74	83	for	for	ADP
bionys-314	74	84	45	45	NUM
bionys-314	74	85	s	s	NOUN
bionys-314	74	86	,	,	PUNCT
bionys-314	74	87	and	and	CCONJ
bionys-314	74	88	72	72	NUM
bionys-314	74	89	°	°	NOUN
bionys-314	74	90	c	c	NOUN
bionys-314	74	91	for	for	ADP
bionys-314	74	92	90	90	NUM
bionys-314	74	93	s	s	NOUN
bionys-314	74	94	and	and	CCONJ
bionys-314	74	95	a	a	DET
bionys-314	74	96	final	final	ADJ
bionys-314	74	97	extension	extension	NOUN
bionys-314	74	98	step	step	NOUN
bionys-314	74	99	of	of	ADP
bionys-314	74	100	72	72	NUM
bionys-314	74	101	°	°	NOUN
bionys-314	74	102	c	c	NOUN
bionys-314	74	103	for	for	ADP
bionys-314	74	104	5	5	NUM
bionys-314	74	105	min	min	NOUN
bionys-314	74	106	.	.	PROPN
bionys-314	74	107	finally	finally	ADV
bionys-314	74	108	60.5	60.5	NUM
bionys-314	74	109	°	°	PRON
bionys-314	74	110	c	c	NOUN
bionys-314	74	111	was	be	AUX
bionys-314	74	112	selected	select	VERB
bionys-314	74	113	for	for	ADP
bionys-314	74	114	annealing	anneal	VERB
bionys-314	74	115	tempreture	tempreture	NOUN
bionys-314	74	116	.	.	PUNCT
bionys-314	75	1	rtpcr	rtpcr	PROPN
bionys-314	75	2	was	be	AUX
bionys-314	75	3	used	use	VERB
bionys-314	75	4	to	to	PART
bionys-314	75	5	determine	determine	VERB
bionys-314	75	6	the	the	DET
bionys-314	75	7	appropriate	appropriate	ADJ
bionys-314	75	8	annealing	anneal	VERB
bionys-314	75	9	temperature	temperature	NOUN
bionys-314	75	10	of	of	ADP
bionys-314	75	11	the	the	DET
bionys-314	75	12	primers	primer	NOUN
bionys-314	75	13	.	.	PUNCT
bionys-314	76	1	pcr	pcr	ADJ
bionys-314	76	2	products	product	NOUN
bionys-314	76	3	were	be	AUX
bionys-314	76	4	electrophoresed	electrophorese	VERB
bionys-314	76	5	on	on	ADP
bionys-314	76	6	a	a	DET
bionys-314	76	7	2	2	NUM
bionys-314	76	8	%	%	NOUN
bionys-314	76	9	agarose	agarose	NOUN
bionys-314	76	10	gel	gel	NOUN
bionys-314	76	11	.	.	PUNCT
bionys-314	77	1	real	real	ADJ
bionys-314	77	2	-	-	PUNCT
bionys-314	77	3	time	time	NOUN
bionys-314	77	4	pcr	pcr	ADJ
bionys-314	77	5	various	various	ADJ
bionys-314	77	6	approaches	approach	NOUN
bionys-314	77	7	can	can	AUX
bionys-314	77	8	be	be	AUX
bionys-314	77	9	used	use	VERB
bionys-314	77	10	for	for	ADP
bionys-314	77	11	understanding	understand	VERB
bionys-314	77	12	gene	gene	NOUN
bionys-314	77	13	expression	expression	NOUN
bionys-314	77	14	in	in	ADP
bionys-314	77	15	different	different	ADJ
bionys-314	77	16	circumstances	circumstance	NOUN
bionys-314	77	17	.	.	PUNCT
bionys-314	78	1	using	use	VERB
bionys-314	78	2	of	of	ADP
bionys-314	78	3	real	real	ADJ
bionys-314	78	4	-	-	PUNCT
bionys-314	78	5	time	time	NOUN
bionys-314	78	6	pcr	pcr	NOUN
bionys-314	78	7	allows	allow	VERB
bionys-314	78	8	precise	precise	ADJ
bionys-314	78	9	quantization	quantization	NOUN
bionys-314	78	10	of	of	ADP
bionys-314	78	11	gene	gene	NOUN
bionys-314	78	12	expression	expression	NOUN
bionys-314	78	13	with	with	ADP
bionys-314	78	14	a	a	DET
bionys-314	78	15	minimum	minimum	NOUN
bionys-314	78	16	amount	amount	NOUN
bionys-314	78	17	of	of	ADP
bionys-314	78	18	nucleic	nucleic	ADJ
bionys-314	78	19	acid	acid	NOUN
bionys-314	78	20	sample	sample	NOUN
bionys-314	78	21	.	.	PUNCT
bionys-314	79	1	measurement	measurement	NOUN
bionys-314	79	2	of	of	ADP
bionys-314	79	3	mn	mn	PROPN
bionys-314	79	4	-	-	PUNCT
bionys-314	79	5	sod	sod	NOUN
bionys-314	79	6	gene	gene	NOUN
bionys-314	79	7	expression	expression	NOUN
bionys-314	79	8	was	be	AUX
bionys-314	79	9	performed	perform	VERB
bionys-314	79	10	on	on	ADP
bionys-314	79	11	treated	treat	VERB
bionys-314	79	12	and	and	CCONJ
bionys-314	79	13	control	control	NOUN
bionys-314	79	14	,	,	PUNCT
bionys-314	79	15	untreated	untreated	ADJ
bionys-314	79	16	samples	sample	NOUN
bionys-314	79	17	.	.	PUNCT
bionys-314	80	1	the	the	DET
bionys-314	80	2	reaction	reaction	NOUN
bionys-314	80	3	mixture	mixture	NOUN
bionys-314	80	4	contained	contain	VERB
bionys-314	80	5	12.5	12.5	NUM
bionys-314	80	6	μl	μl	ADP
bionys-314	80	7	real	real	ADJ
bionys-314	80	8	-	-	PUNCT
bionys-314	80	9	time	time	NOUN
bionys-314	80	10	master	master	NOUN
bionys-314	80	11	mix	mix	NOUN
bionys-314	80	12	,	,	PUNCT
bionys-314	80	13	2	2	NUM
bionys-314	80	14	μl	μl	ADP
bionys-314	80	15	each	each	PRON
bionys-314	80	16	of	of	ADP
bionys-314	80	17	forward	forward	ADV
bionys-314	80	18	and	and	CCONJ
bionys-314	80	19	reverse	reverse	ADJ
bionys-314	80	20	primers	primer	NOUN
bionys-314	80	21	,	,	PUNCT
bionys-314	80	22	6	6	NUM
bionys-314	80	23	μl	μl	ADP
bionys-314	80	24	template	template	NOUN
bionys-314	80	25	cdna	cdna	PROPN
bionys-314	80	26	and	and	CCONJ
bionys-314	80	27	2.5	2.5	NUM
bionys-314	80	28	μl	μl	ADV
bionys-314	80	29	sterile	sterile	ADJ
bionys-314	80	30	distilled	distil	VERB
bionys-314	80	31	water	water	NOUN
bionys-314	80	32	,	,	PUNCT
bionys-314	80	33	with	with	ADP
bionys-314	80	34	a	a	DET
bionys-314	80	35	final	final	ADJ
bionys-314	80	36	volume	volume	NOUN
bionys-314	80	37	of	of	ADP
bionys-314	80	38	25	25	NUM
bionys-314	80	39	μl	μl	ADV
bionys-314	80	40	by	by	ADP
bionys-314	80	41	35	35	NUM
bionys-314	80	42	amplification	amplification	NOUN
bionys-314	80	43	cycles	cycle	NOUN
bionys-314	80	44	.	.	PUNCT
bionys-314	81	1	3	3	NUM
bionys-314	81	2	replicates	replicate	NOUN
bionys-314	81	3	were	be	AUX
bionys-314	81	4	prepared	prepare	VERB
bionys-314	81	5	from	from	ADP
bionys-314	81	6	each	each	DET
bionys-314	81	7	sample	sample	NOUN
bionys-314	81	8	and	and	CCONJ
bionys-314	81	9	,	,	PUNCT
bionys-314	81	10	for	for	ADP
bionys-314	81	11	standardization	standardization	NOUN
bionys-314	81	12	,	,	PUNCT
bionys-314	81	13	the	the	DET
bionys-314	81	14	housekeeping	housekeeping	NOUN
bionys-314	81	15	gene	gene	NOUN
bionys-314	81	16	(	(	PUNCT
bionys-314	81	17	18s	18s	NUM
bionys-314	81	18	rrna	rrna	PROPN
bionys-314	81	19	)	)	PUNCT
bionys-314	81	20	was	be	AUX
bionys-314	81	21	used	use	VERB
bionys-314	81	22	.	.	PUNCT
bionys-314	82	1	finally	finally	ADV
bionys-314	82	2	,	,	PUNCT
bionys-314	82	3	after	after	ADP
bionys-314	82	4	standardizing	standardize	VERB
bionys-314	82	5	the	the	DET
bionys-314	82	6	data	datum	NOUN
bionys-314	82	7	using	use	VERB
bionys-314	82	8	the	the	DET
bionys-314	82	9	expression	expression	NOUN
bionys-314	82	10	level	level	NOUN
bionys-314	82	11	of	of	ADP
bionys-314	82	12	genes	gene	NOUN
bionys-314	82	13	in	in	ADP
bionys-314	82	14	the	the	DET
bionys-314	82	15	samples	sample	NOUN
bionys-314	82	16	,	,	PUNCT
bionys-314	82	17	the	the	DET
bionys-314	82	18	actual	actual	ADJ
bionys-314	82	19	amount	amount	NOUN
bionys-314	82	20	of	of	ADP
bionys-314	82	21	target	target	NOUN
bionys-314	82	22	gene	gene	NOUN
bionys-314	82	23	expression	expression	NOUN
bionys-314	82	24	(	(	PUNCT
bionys-314	82	25	mn	mn	NOUN
bionys-314	82	26	-	-	PUNCT
bionys-314	82	27	sod	sod	NOUN
bionys-314	82	28	)	)	PUNCT
bionys-314	82	29	was	be	AUX
bionys-314	82	30	determined	determine	VERB
bionys-314	82	31	using	use	VERB
bionys-314	82	32	model	model	NOUN
bionys-314	82	33	2ctδδ	2ctδδ	NUM
bionys-314	82	34	(	(	PUNCT
bionys-314	82	35	livak	livak	PROPN
bionys-314	82	36	&	&	CCONJ
bionys-314	82	37	schmittgen	schmittgen	PROPN
bionys-314	82	38	,	,	PUNCT
bionys-314	82	39	2001	2001	NUM
bionys-314	82	40	)	)	PUNCT
bionys-314	82	41	at	at	ADP
bionys-314	82	42	the	the	DET
bionys-314	82	43	level	level	NOUN
bionys-314	82	44	of	of	ADP
bionys-314	82	45	mrna	mrna	PROPN
bionys-314	82	46	synthesis	synthesis	NOUN
bionys-314	82	47	.	.	PUNCT
bionys-314	83	1	statistical	statistical	ADJ
bionys-314	83	2	analysis	analysis	NOUN
bionys-314	83	3	using	use	VERB
bionys-314	83	4	one	one	NUM
bionys-314	83	5	way	way	NOUN
bionys-314	83	6	anova	anova	PROPN
bionys-314	83	7	and	and	CCONJ
bionys-314	83	8	duncan	duncan	PROPN
bionys-314	83	9	test	test	NOUN
bionys-314	83	10	were	be	AUX
bionys-314	83	11	performed	perform	VERB
bionys-314	83	12	in	in	ADP
bionys-314	83	13	spss	spss	PROPN
bionys-314	83	14	18	18	NUM
bionys-314	83	15	and	and	CCONJ
bionys-314	83	16	charts	chart	NOUN
bionys-314	83	17	exhibiting	exhibit	VERB
bionys-314	83	18	the	the	DET
bionys-314	83	19	changes	change	NOUN
bionys-314	83	20	in	in	ADP
bionys-314	83	21	gene	gene	NOUN
bionys-314	83	22	expression	expression	NOUN
bionys-314	83	23	were	be	AUX
bionys-314	83	24	plotted	plot	VERB
bionys-314	83	25	in	in	ADP
bionys-314	83	26	excel	excel	NOUN
bionys-314	83	27	.	.	PUNCT
bionys-314	84	1	measurement	measurement	NOUN
bionys-314	84	2	of	of	ADP
bionys-314	84	3	leaf	leaf	NOUN
bionys-314	84	4	relative	relative	ADJ
bionys-314	84	5	water	water	NOUN
bionys-314	84	6	content	content	NOUN
bionys-314	84	7	relative	relative	ADJ
bionys-314	84	8	water	water	NOUN
bionys-314	84	9	content	content	NOUN
bionys-314	84	10	(	(	PUNCT
bionys-314	84	11	rwc	rwc	NOUN
bionys-314	84	12	)	)	PUNCT
bionys-314	84	13	was	be	AUX
bionys-314	84	14	measured	measure	VERB
bionys-314	84	15	on	on	ADP
bionys-314	84	16	days	day	NOUN
bionys-314	84	17	0	0	PUNCT
bionys-314	84	18	(	(	PUNCT
bionys-314	84	19	control	control	NOUN
bionys-314	84	20	)	)	PUNCT
bionys-314	84	21	,	,	PUNCT
bionys-314	84	22	5	5	NUM
bionys-314	84	23	,	,	PUNCT
bionys-314	84	24	10	10	NUM
bionys-314	84	25	and	and	CCONJ
bionys-314	84	26	17	17	NUM
bionys-314	84	27	based	base	VERB
bionys-314	84	28	on	on	ADP
bionys-314	84	29	barrs	barrs	PROPN
bionys-314	84	30	and	and	CCONJ
bionys-314	84	31	weatherley	weatherley	NOUN
bionys-314	84	32	(	(	PUNCT
bionys-314	84	33	1962	1962	NUM
bionys-314	84	34	)	)	PUNCT
bionys-314	84	35	.	.	PUNCT
bionys-314	85	1	after	after	ADP
bionys-314	85	2	calculating	calculate	VERB
bionys-314	85	3	the	the	DET
bionys-314	85	4	wet	wet	ADJ
bionys-314	85	5	(	(	PUNCT
bionys-314	85	6	or	or	CCONJ
bionys-314	85	7	fresh	fresh	ADJ
bionys-314	85	8	)	)	PUNCT
bionys-314	85	9	weight	weight	NOUN
bionys-314	85	10	(	(	PUNCT
bionys-314	85	11	fw	fw	ADJ
bionys-314	85	12	)	)	PUNCT
bionys-314	85	13	,	,	PUNCT
bionys-314	85	14	dry	dry	ADJ
bionys-314	85	15	weight	weight	NOUN
bionys-314	85	16	(	(	PUNCT
bionys-314	85	17	dw	dw	NOUN
bionys-314	85	18	)	)	PUNCT
bionys-314	85	19	and	and	CCONJ
bionys-314	85	20	saturated	saturate	VERB
bionys-314	85	21	weight	weight	NOUN
bionys-314	85	22	(	(	PUNCT
bionys-314	85	23	sw	sw	PROPN
bionys-314	85	24	)	)	PUNCT
bionys-314	85	25	,	,	PUNCT
bionys-314	85	26	the	the	DET
bionys-314	85	27	percentage	percentage	NOUN
bionys-314	85	28	of	of	ADP
bionys-314	85	29	leaf	leaf	NOUN
bionys-314	85	30	rwc	rwc	NOUN
bionys-314	85	31	in	in	ADP
bionys-314	85	32	the	the	DET
bionys-314	85	33	two	two	NUM
bionys-314	85	34	clones	clone	NOUN
bionys-314	85	35	was	be	AUX
bionys-314	85	36	obtained	obtain	VERB
bionys-314	85	37	in	in	ADP
bionys-314	85	38	triplicate	triplicate	NOUN
bionys-314	85	39	and	and	CCONJ
bionys-314	85	40	finally	finally	ADV
bionys-314	85	41	,	,	PUNCT
bionys-314	85	42	rwc	rwc	VERB
bionys-314	85	43	percentage	percentage	NOUN
bionys-314	85	44	was	be	AUX
bionys-314	85	45	calculated	calculate	VERB
bionys-314	85	46	by	by	ADP
bionys-314	85	47	following	follow	VERB
bionys-314	85	48	formula	formula	NOUN
bionys-314	85	49	:	:	PUNCT
bionys-314	85	50	rwc	rwc	VERB
bionys-314	85	51	=	=	SYM
bionys-314	85	52	(	(	PUNCT
bionys-314	85	53	fw	fw	PROPN
bionys-314	85	54	dw	dw	PROPN
bionys-314	85	55	/	/	SYM
bionys-314	85	56	sw	sw	PROPN
bionys-314	85	57	dw	dw	PROPN
bionys-314	85	58	)	)	PUNCT
bionys-314	85	59	×	×	NOUN
bionys-314	85	60	100	100	NUM
bionys-314	85	61	measurement	measurement	NOUN
bionys-314	85	62	of	of	ADP
bionys-314	85	63	proline	proline	NOUN
bionys-314	85	64	proline	proline	NOUN
bionys-314	85	65	measurement	measurement	NOUN
bionys-314	85	66	was	be	AUX
bionys-314	85	67	carried	carry	VERB
bionys-314	85	68	out	out	ADP
bionys-314	85	69	with	with	ADP
bionys-314	85	70	ninhydrin	ninhydrin	PROPN
bionys-314	85	71	reagent	reagent	NOUN
bionys-314	85	72	according	accord	VERB
bionys-314	85	73	to	to	ADP
bionys-314	85	74	bates	bates	PROPN
bionys-314	85	75	et	et	PROPN
bionys-314	85	76	al	al	PROPN
bionys-314	85	77	.	.	PUNCT
bionys-314	86	1	(	(	PUNCT
bionys-314	86	2	1973	1973	NUM
bionys-314	86	3	)	)	PUNCT
bionys-314	86	4	.	.	PUNCT
bionys-314	87	1	for	for	ADP
bionys-314	87	2	this	this	DET
bionys-314	87	3	purpose	purpose	NOUN
bionys-314	87	4	,	,	PUNCT
bionys-314	87	5	0.5	0.5	NUM
bionys-314	87	6	g	g	NOUN
bionys-314	87	7	of	of	ADP
bionys-314	87	8	fresh	fresh	ADJ
bionys-314	87	9	leaf	leaf	NOUN
bionys-314	87	10	tissue	tissue	NOUN
bionys-314	87	11	,	,	PUNCT
bionys-314	87	12	glacial	glacial	ADJ
bionys-314	87	13	acetic	acetic	ADJ
bionys-314	87	14	acid	acid	NOUN
bionys-314	87	15	and	and	CCONJ
bionys-314	87	16	toluene	toluene	NOUN
bionys-314	87	17	were	be	AUX
bionys-314	87	18	used	use	VERB
bionys-314	87	19	.	.	PUNCT
bionys-314	88	1	after	after	ADP
bionys-314	88	2	preparation	preparation	NOUN
bionys-314	88	3	of	of	ADP
bionys-314	88	4	the	the	DET
bionys-314	88	5	extracts	extract	NOUN
bionys-314	88	6	,	,	PUNCT
bionys-314	88	7	absorbance	absorbance	NOUN
bionys-314	88	8	of	of	ADP
bionys-314	88	9	the	the	DET
bionys-314	88	10	upper	upper	ADJ
bionys-314	88	11	layer	layer	NOUN
bionys-314	88	12	(	(	PUNCT
bionys-314	88	13	containing	contain	VERB
bionys-314	88	14	toluene	toluene	NOUN
bionys-314	88	15	and	and	CCONJ
bionys-314	88	16	proline	proline	NOUN
bionys-314	88	17	)	)	PUNCT
bionys-314	88	18	was	be	AUX
bionys-314	88	19	read	read	VERB
bionys-314	88	20	at	at	ADP
bionys-314	88	21	520	520	NUM
bionys-314	88	22	nm	nm	NOUN
bionys-314	88	23	.	.	PUNCT
bionys-314	89	1	by	by	ADP
bionys-314	89	2	using	use	VERB
bionys-314	89	3	the	the	DET
bionys-314	89	4	standard	standard	ADJ
bionys-314	89	5	curve	curve	NOUN
bionys-314	89	6	in	in	ADP
bionys-314	89	7	terms	term	NOUN
bionys-314	89	8	of	of	ADP
bionys-314	89	9	micrograms	microgram	NOUN
bionys-314	89	10	per	per	ADP
bionys-314	89	11	gram	gram	NOUN
bionys-314	89	12	fresh	fresh	ADJ
bionys-314	89	13	weight	weight	NOUN
bionys-314	89	14	of	of	ADP
bionys-314	89	15	leaves	leave	NOUN
bionys-314	89	16	,	,	PUNCT
bionys-314	89	17	proline	proline	NOUN
bionys-314	89	18	content	content	NOUN
bionys-314	89	19	was	be	AUX
bionys-314	89	20	determined	determine	VERB
bionys-314	89	21	.	.	PUNCT
bionys-314	90	1	measurement	measurement	NOUN
bionys-314	90	2	of	of	ADP
bionys-314	90	3	lipid	lipid	NOUN
bionys-314	90	4	peroxidation	peroxidation	NOUN
bionys-314	90	5	to	to	PART
bionys-314	90	6	determine	determine	VERB
bionys-314	90	7	the	the	DET
bionys-314	90	8	extent	extent	NOUN
bionys-314	90	9	of	of	ADP
bionys-314	90	10	lipid	lipid	NOUN
bionys-314	90	11	peroxidation	peroxidation	NOUN
bionys-314	90	12	,	,	PUNCT
bionys-314	90	13	mda	mda	PROPN
bionys-314	90	14	concentration	concentration	NOUN
bionys-314	90	15	was	be	AUX
bionys-314	90	16	measured	measure	VERB
bionys-314	90	17	using	use	VERB
bionys-314	90	18	the	the	DET
bionys-314	90	19	method	method	NOUN
bionys-314	90	20	of	of	ADP
bionys-314	90	21	heath	heath	PROPN
bionys-314	90	22	&	&	CCONJ
bionys-314	90	23	packer	packer	PROPN
bionys-314	90	24	(	(	PUNCT
bionys-314	90	25	1968	1968	NUM
bionys-314	90	26	)	)	PUNCT
bionys-314	90	27	.	.	PUNCT
bionys-314	91	1	for	for	ADP
bionys-314	91	2	this	this	DET
bionys-314	91	3	purpose	purpose	NOUN
bionys-314	91	4	,	,	PUNCT
bionys-314	91	5	0.5	0.5	NUM
bionys-314	91	6	g	g	NOUN
bionys-314	91	7	of	of	ADP
bionys-314	91	8	table	table	NOUN
bionys-314	91	9	1	1	NUM
bionys-314	91	10	.	.	PUNCT
bionys-314	91	11	sequence	sequence	NOUN
bionys-314	91	12	of	of	ADP
bionys-314	91	13	designed	design	VERB
bionys-314	91	14	primers	primer	NOUN
bionys-314	91	15	for	for	ADP
bionys-314	91	16	the	the	DET
bionys-314	91	17	rt	rt	ADJ
bionys-314	91	18	-	-	PUNCT
bionys-314	91	19	pcr	pcr	NOUN
bionys-314	91	20	analysis	analysis	NOUN
bionys-314	91	21	accession	accession	NOUN
bionys-314	91	22	number	number	NOUN
bionys-314	91	23	putative	putative	ADJ
bionys-314	91	24	function	function	NOUN
bionys-314	91	25	tm	tm	PROPN
bionys-314	91	26	(	(	PUNCT
bionys-314	91	27	°	°	ADP
bionys-314	91	28	c	c	NOUN
bionys-314	91	29	)	)	PUNCT
bionys-314	91	30	primer	primer	NOUN
bionys-314	91	31	sequence	sequence	NOUN
bionys-314	91	32	(	(	PUNCT
bionys-314	91	33	5´-3	5´-3	NUM
bionys-314	91	34	´	´	NOUN
bionys-314	91	35	)	)	PUNCT
bionys-314	91	36	size	size	NOUN
bionys-314	91	37	of	of	ADP
bionys-314	91	38	amplicon	amplicon	NOUN
bionys-314	91	39	ay641734.2	ay641734.2	VERB
bionys-314	91	40	manganese	manganese	ADJ
bionys-314	91	41	superoxide	superoxide	NOUN
bionys-314	91	42	dismutase	dismutase	NOUN
bionys-314	91	43	60.5	60.5	NUM
bionys-314	91	44	f	f	NOUN
bionys-314	91	45	:	:	PUNCT
bionys-314	91	46	cggagggcatatcaaccact	cggagggcatatcaaccact	VERB
bionys-314	91	47	r	r	NOUN
bionys-314	91	48	:	:	PUNCT
bionys-314	91	49	cacccatccagagcctcgt	cacccatccagagcctcgt	PROPN
bionys-314	91	50	121	121	NUM
bionys-314	91	51	bp	bp	PROPN
bionys-314	91	52	ay563528.1	ay563528.1	ADP
bionys-314	91	53	rrna	rrna	PROPN
bionys-314	91	54	18	18	NUM
bionys-314	91	55	57.7	57.7	NUM
bionys-314	91	56	f	f	NOUN
bionys-314	91	57	:	:	PUNCT
bionys-314	91	58	caacacggggaaacttaccag	caacacggggaaacttaccag	VERB
bionys-314	91	59	r	r	NOUN
bionys-314	91	60	:	:	PUNCT
bionys-314	91	61	taaccagacaaatcgctccac	taaccagacaaatcgctccac	PROPN
bionys-314	91	62	178	178	NUM
bionys-314	91	63	bp	bp	PROPN
bionys-314	91	64	fig	fig	NOUN
bionys-314	91	65	.	.	PUNCT
bionys-314	92	1	1	1	X
bionys-314	92	2	.	.	X
bionys-314	92	3	a	a	PRON
bionys-314	92	4	)	)	PUNCT
bionys-314	92	5	total	total	ADJ
bionys-314	92	6	rna	rna	NOUN
bionys-314	92	7	extracted	extract	VERB
bionys-314	92	8	from	from	ADP
bionys-314	92	9	tea	tea	NOUN
bionys-314	92	10	leaves	leave	NOUN
bionys-314	92	11	and	and	CCONJ
bionys-314	92	12	electrophoresed	electrophorese	VERB
bionys-314	92	13	on	on	ADP
bionys-314	92	14	1	1	NUM
bionys-314	92	15	%	%	NOUN
bionys-314	92	16	agarose	agarose	NOUN
bionys-314	92	17	gel	gel	NOUN
bionys-314	92	18	with	with	ADP
bionys-314	92	19	bands	band	NOUN
bionys-314	92	20	of	of	ADP
bionys-314	92	21	the	the	DET
bionys-314	92	22	5/8s	5/8s	NUM
bionys-314	92	23	,	,	PUNCT
bionys-314	92	24	18s	18	NOUN
bionys-314	92	25	,	,	PUNCT
bionys-314	92	26	and	and	CCONJ
bionys-314	92	27	28s	28	NOUN
bionys-314	92	28	rrna	rrna	PROPN
bionys-314	92	29	,	,	PUNCT
bionys-314	92	30	indicating	indicate	VERB
bionys-314	92	31	the	the	DET
bionys-314	92	32	absence	absence	NOUN
bionys-314	92	33	of	of	ADP
bionys-314	92	34	rna	rna	NOUN
bionys-314	92	35	degradation	degradation	NOUN
bionys-314	92	36	and	and	CCONJ
bionys-314	92	37	lack	lack	NOUN
bionys-314	92	38	of	of	ADP
bionys-314	92	39	protein	protein	NOUN
bionys-314	92	40	and	and	CCONJ
bionys-314	92	41	dna	dna	PROPN
bionys-314	92	42	contamination	contamination	NOUN
bionys-314	92	43	in	in	ADP
bionys-314	92	44	the	the	DET
bionys-314	92	45	samples	sample	NOUN
bionys-314	92	46	;	;	PUNCT
bionys-314	92	47	b	b	X
bionys-314	92	48	)	)	PUNCT
bionys-314	92	49	2	2	NUM
bionys-314	92	50	%	%	NOUN
bionys-314	92	51	agarose	agarose	NOUN
bionys-314	92	52	gel	gel	NOUN
bionys-314	92	53	of	of	ADP
bionys-314	92	54	mn	mn	PROPN
bionys-314	92	55	-	-	PUNCT
bionys-314	92	56	sod	sod	NOUN
bionys-314	92	57	gene	gene	NOUN
bionys-314	92	58	rt	rt	ADJ
bionys-314	92	59	-	-	PUNCT
bionys-314	92	60	pcr	pcr	ADJ
bionys-314	92	61	product	product	NOUN
bionys-314	92	62	in	in	ADP
bionys-314	92	63	clones	clone	NOUN
bionys-314	92	64	100	100	NUM
bionys-314	92	65	and	and	CCONJ
bionys-314	92	66	dn	dn	NOUN
bionys-314	92	67	.	.	NOUN
bionys-314	92	68	bands	band	NOUN
bionys-314	92	69	1	1	NUM
bionys-314	92	70	-	-	SYM
bionys-314	92	71	4	4	NUM
bionys-314	92	72	and	and	CCONJ
bionys-314	92	73	5	5	NUM
bionys-314	92	74	-	-	SYM
bionys-314	92	75	8	8	NUM
bionys-314	92	76	are	be	AUX
bionys-314	92	77	related	relate	VERB
bionys-314	92	78	to	to	ADP
bionys-314	92	79	the	the	DET
bionys-314	92	80	121	121	NUM
bionys-314	92	81	bp	bp	PROPN
bionys-314	92	82	fragment	fragment	NOUN
bionys-314	92	83	of	of	ADP
bionys-314	92	84	mn	mn	PROPN
bionys-314	92	85	-	-	PUNCT
bionys-314	92	86	sod	sod	NOUN
bionys-314	92	87	gene	gene	NOUN
bionys-314	92	88	in	in	ADP
bionys-314	92	89	clones	clone	NOUN
bionys-314	92	90	dn	dn	ADJ
bionys-314	92	91	and	and	CCONJ
bionys-314	92	92	100	100	NUM
bionys-314	92	93	,	,	PUNCT
bionys-314	92	94	respectively	respectively	ADV
bionys-314	92	95	.	.	PUNCT
bionys-314	93	1	the	the	DET
bionys-314	93	2	annealing	anneal	VERB
bionys-314	93	3	temperature	temperature	NOUN
bionys-314	93	4	48	48	NUM
bionys-314	93	5	fresh	fresh	ADJ
bionys-314	93	6	leaf	leaf	NOUN
bionys-314	93	7	tissue	tissue	NOUN
bionys-314	93	8	was	be	AUX
bionys-314	93	9	ground	grind	VERB
bionys-314	93	10	with	with	ADP
bionys-314	93	11	5	5	NUM
bionys-314	93	12	ml	ml	NOUN
bionys-314	93	13	of	of	ADP
bionys-314	93	14	5	5	NUM
bionys-314	93	15	%	%	NOUN
bionys-314	93	16	trichloroacetic	trichloroacetic	ADJ
bionys-314	93	17	acid	acid	NOUN
bionys-314	93	18	.	.	PUNCT
bionys-314	94	1	the	the	DET
bionys-314	94	2	extract	extract	NOUN
bionys-314	94	3	was	be	AUX
bionys-314	94	4	centrifuged	centrifuge	VERB
bionys-314	94	5	at	at	ADP
bionys-314	94	6	14000	14000	NUM
bionys-314	94	7	rpm	rpm	NOUN
bionys-314	94	8	for	for	ADP
bionys-314	94	9	15	15	NUM
bionys-314	94	10	minutes	minute	NOUN
bionys-314	94	11	at	at	ADP
bionys-314	94	12	room	room	NOUN
bionys-314	94	13	temperature	temperature	NOUN
bionys-314	94	14	and	and	CCONJ
bionys-314	94	15	the	the	DET
bionys-314	94	16	supernatant	supernatant	NOUN
bionys-314	94	17	was	be	AUX
bionys-314	94	18	separated	separate	VERB
bionys-314	94	19	using	use	VERB
bionys-314	94	20	a	a	DET
bionys-314	94	21	micropipette	micropipette	NOUN
bionys-314	94	22	.	.	PUNCT
bionys-314	95	1	an	an	DET
bionys-314	95	2	equal	equal	ADJ
bionys-314	95	3	volume	volume	NOUN
bionys-314	95	4	of	of	ADP
bionys-314	95	5	20	20	NUM
bionys-314	95	6	%	%	NOUN
bionys-314	95	7	tca	tca	NOUN
bionys-314	95	8	containing	contain	VERB
bionys-314	95	9	0.5	0.5	NUM
bionys-314	95	10	%	%	NOUN
bionys-314	95	11	tba	tba	NOUN
bionys-314	95	12	was	be	AUX
bionys-314	95	13	then	then	ADV
bionys-314	95	14	added	add	VERB
bionys-314	95	15	to	to	ADP
bionys-314	95	16	the	the	DET
bionys-314	95	17	supernatant	supernatant	NOUN
bionys-314	95	18	.	.	PUNCT
bionys-314	96	1	the	the	DET
bionys-314	96	2	mixture	mixture	NOUN
bionys-314	96	3	was	be	AUX
bionys-314	96	4	placed	place	VERB
bionys-314	96	5	in	in	ADP
bionys-314	96	6	a	a	DET
bionys-314	96	7	boiling	boil	VERB
bionys-314	96	8	water	water	NOUN
bionys-314	96	9	bath	bath	NOUN
bionys-314	96	10	at	at	ADP
bionys-314	96	11	100	100	NUM
bionys-314	96	12	°	°	ADP
bionys-314	96	13	c	c	NOUN
bionys-314	96	14	for	for	ADP
bionys-314	96	15	30	30	NUM
bionys-314	96	16	min	min	NOUN
bionys-314	96	17	.	.	PROPN
bionys-314	96	18	and	and	CCONJ
bionys-314	96	19	immediately	immediately	ADV
bionys-314	96	20	cooled	cool	VERB
bionys-314	96	21	on	on	ADP
bionys-314	96	22	ice	ice	NOUN
bionys-314	96	23	.	.	PUNCT
bionys-314	97	1	then	then	ADV
bionys-314	97	2	,	,	PUNCT
bionys-314	97	3	2	2	NUM
bionys-314	97	4	ml	ml	NOUN
bionys-314	97	5	of	of	ADP
bionys-314	97	6	the	the	DET
bionys-314	97	7	supernatant	supernatant	NOUN
bionys-314	97	8	was	be	AUX
bionys-314	97	9	transferred	transfer	VERB
bionys-314	97	10	to	to	ADP
bionys-314	97	11	a	a	DET
bionys-314	97	12	microtube	microtube	NOUN
bionys-314	97	13	and	and	CCONJ
bionys-314	97	14	centrifuged	centrifuge	VERB
bionys-314	97	15	for	for	ADP
bionys-314	97	16	5	5	NUM
bionys-314	97	17	min	min	NOUN
bionys-314	97	18	at	at	ADP
bionys-314	97	19	7500	7500	NUM
bionys-314	97	20	rpm	rpm	NOUN
bionys-314	97	21	.	.	PUNCT
bionys-314	98	1	mda	mda	PROPN
bionys-314	98	2	+	+	CCONJ
bionys-314	98	3	tba	tba	PROPN
bionys-314	98	4	complex	complex	ADJ
bionys-314	98	5	absorbance	absorbance	NOUN
bionys-314	98	6	was	be	AUX
bionys-314	98	7	read	read	VERB
bionys-314	98	8	at	at	ADP
bionys-314	98	9	532	532	NUM
bionys-314	98	10	nm	nm	NOUN
bionys-314	98	11	and	and	CCONJ
bionys-314	98	12	the	the	DET
bionys-314	98	13	non	non	ADJ
bionys-314	98	14	-	-	ADJ
bionys-314	98	15	specific	specific	ADJ
bionys-314	98	16	absorption	absorption	NOUN
bionys-314	98	17	of	of	ADP
bionys-314	98	18	the	the	DET
bionys-314	98	19	pigment	pigment	NOUN
bionys-314	98	20	was	be	AUX
bionys-314	98	21	determined	determine	VERB
bionys-314	98	22	at	at	ADP
bionys-314	98	23	600	600	NUM
bionys-314	98	24	nm	nm	NOUN
bionys-314	98	25	and	and	CCONJ
bionys-314	98	26	subtracted	subtract	VERB
bionys-314	98	27	from	from	ADP
bionys-314	98	28	absorption	absorption	NOUN
bionys-314	98	29	at	at	ADP
bionys-314	98	30	532	532	NUM
bionys-314	98	31	nm	nm	NOUN
bionys-314	98	32	.	.	PUNCT
bionys-314	99	1	the	the	DET
bionys-314	99	2	extinction	extinction	NOUN
bionys-314	99	3	coefficient	coefficient	NOUN
bionys-314	99	4	of	of	ADP
bionys-314	99	5	155	155	NUM
bionys-314	99	6	mm-1	mm-1	X
bionys-314	99	7	cm-1	cm-1	X
bionys-314	99	8	was	be	AUX
bionys-314	99	9	used	use	VERB
bionys-314	99	10	to	to	PART
bionys-314	99	11	calculate	calculate	VERB
bionys-314	99	12	the	the	DET
bionys-314	99	13	concentration	concentration	NOUN
bionys-314	99	14	of	of	ADP
bionys-314	99	15	mda	mda	PROPN
bionys-314	99	16	.	.	PUNCT
bionys-314	100	1	finally	finally	ADV
bionys-314	100	2	,	,	PUNCT
bionys-314	100	3	the	the	DET
bionys-314	100	4	reaction	reaction	NOUN
bionys-314	100	5	product	product	NOUN
bionys-314	100	6	of	of	ADP
bionys-314	100	7	lipid	lipid	NOUN
bionys-314	100	8	peroxidation	peroxidation	NOUN
bionys-314	100	9	(	(	PUNCT
bionys-314	100	10	malondialdehyde	malondialdehyde	NOUN
bionys-314	100	11	)	)	PUNCT
bionys-314	100	12	was	be	AUX
bionys-314	100	13	calculated	calculate	VERB
bionys-314	100	14	as	as	ADP
bionys-314	100	15	nm	nm	PRON
bionys-314	100	16	per	per	ADP
bionys-314	100	17	gram	gram	NOUN
bionys-314	100	18	of	of	ADP
bionys-314	100	19	fresh	fresh	ADJ
bionys-314	100	20	weight	weight	NOUN
bionys-314	100	21	.	.	PUNCT
bionys-314	101	1	measurement	measurement	NOUN
bionys-314	101	2	of	of	ADP
bionys-314	101	3	chlorophyll	chlorophyll	NOUN
bionys-314	101	4	and	and	CCONJ
bionys-314	101	5	carotenoids	carotenoid	NOUN
bionys-314	101	6	pigment	pigment	NOUN
bionys-314	101	7	measurement	measurement	NOUN
bionys-314	101	8	was	be	AUX
bionys-314	101	9	performed	perform	VERB
bionys-314	101	10	based	base	VERB
bionys-314	101	11	on	on	ADP
bionys-314	101	12	lichtenthaler	lichtenthaler	NOUN
bionys-314	101	13	(	(	PUNCT
bionys-314	101	14	1987	1987	NUM
bionys-314	101	15	)	)	PUNCT
bionys-314	101	16	.	.	PUNCT
bionys-314	102	1	chlorophyll	chlorophyll	NOUN
bionys-314	102	2	and	and	CCONJ
bionys-314	102	3	carotenoid	carotenoid	NOUN
bionys-314	102	4	concentrations	concentration	NOUN
bionys-314	102	5	were	be	AUX
bionys-314	102	6	obtained	obtain	VERB
bionys-314	102	7	in	in	ADP
bionys-314	102	8	terms	term	NOUN
bionys-314	102	9	of	of	ADP
bionys-314	102	10	µg/	µg/	NOUN
bionys-314	102	11	cm2	cm2	NOUN
bionys-314	102	12	of	of	ADP
bionys-314	102	13	leaf	leaf	NOUN
bionys-314	102	14	area	area	NOUN
bionys-314	102	15	.	.	PUNCT
bionys-314	103	1	results	result	VERB
bionys-314	103	2	extraction	extraction	NOUN
bionys-314	103	3	of	of	ADP
bionys-314	103	4	rna	rna	NOUN
bionys-314	103	5	from	from	ADP
bionys-314	103	6	tea	tea	NOUN
bionys-314	103	7	leaves	leave	VERB
bionys-314	103	8	the	the	DET
bionys-314	103	9	extracted	extract	VERB
bionys-314	103	10	rna	rna	NOUN
bionys-314	103	11	bands	band	NOUN
bionys-314	103	12	can	can	AUX
bionys-314	103	13	be	be	AUX
bionys-314	103	14	seen	see	VERB
bionys-314	103	15	in	in	ADP
bionys-314	103	16	fig	fig	NOUN
bionys-314	103	17	.	.	PUNCT
bionys-314	104	1	1a	1a	X
bionys-314	104	2	.	.	PUNCT
bionys-314	105	1	3	3	NUM
bionys-314	105	2	bands	band	NOUN
bionys-314	105	3	of	of	ADP
bionys-314	105	4	rrna	rrna	PROPN
bionys-314	105	5	,	,	PUNCT
bionys-314	105	6	corresponding	correspond	VERB
bionys-314	105	7	to	to	ADP
bionys-314	105	8	5.8s	5.8s	NUM
bionys-314	105	9	18s	18	NOUN
bionys-314	105	10	and	and	CCONJ
bionys-314	105	11	28s	28	NOUN
bionys-314	105	12	,	,	PUNCT
bionys-314	105	13	are	be	AUX
bionys-314	105	14	present	present	ADJ
bionys-314	105	15	in	in	ADP
bionys-314	105	16	the	the	DET
bionys-314	105	17	rna	rna	NOUN
bionys-314	105	18	extract	extract	NOUN
bionys-314	105	19	,	,	PUNCT
bionys-314	105	20	with	with	ADP
bionys-314	105	21	the	the	DET
bionys-314	105	22	width	width	ADJ
bionys-314	105	23	and	and	CCONJ
bionys-314	105	24	intensity	intensity	NOUN
bionys-314	105	25	of	of	ADP
bionys-314	105	26	the	the	DET
bionys-314	105	27	28s	28s	NUM
bionys-314	105	28	band	band	NOUN
bionys-314	105	29	higher	high	ADJ
bionys-314	105	30	than	than	ADP
bionys-314	105	31	the	the	DET
bionys-314	105	32	other	other	ADJ
bionys-314	105	33	bands	band	NOUN
bionys-314	105	34	.	.	PUNCT
bionys-314	106	1	the	the	DET
bionys-314	106	2	extracted	extract	VERB
bionys-314	106	3	rna	rna	NOUN
bionys-314	106	4	sample	sample	NOUN
bionys-314	106	5	was	be	AUX
bionys-314	106	6	used	use	VERB
bionys-314	106	7	for	for	ADP
bionys-314	106	8	cdna	cdna	PROPN
bionys-314	106	9	synthesis	synthesis	NOUN
bionys-314	106	10	in	in	ADP
bionys-314	106	11	rt	rt	NOUN
bionys-314	106	12	-	-	PUNCT
bionys-314	106	13	pcr	pcr	PROPN
bionys-314	106	14	(	(	PUNCT
bionys-314	106	15	fig	fig	NOUN
bionys-314	106	16	.	.	PUNCT
bionys-314	107	1	1a	1a	NOUN
bionys-314	107	2	)	)	PUNCT
bionys-314	107	3	.	.	PUNCT
bionys-314	108	1	fig	fig	NOUN
bionys-314	108	2	.	.	PUNCT
bionys-314	109	1	2	2	X
bionys-314	109	2	.	.	NOUN
bionys-314	109	3	melting	melt	VERB
bionys-314	109	4	curves	curve	NOUN
bionys-314	109	5	of	of	ADP
bionys-314	109	6	rt	rt	ADJ
bionys-314	109	7	-	-	PUNCT
bionys-314	109	8	pcr	pcr	NOUN
bionys-314	109	9	product	product	NOUN
bionys-314	109	10	(	(	PUNCT
bionys-314	109	11	mn	mn	NOUN
bionys-314	109	12	-	-	PUNCT
bionys-314	109	13	sod	sod	NOUN
bionys-314	109	14	gene	gene	NOUN
bionys-314	109	15	)	)	PUNCT
bionys-314	109	16	in	in	ADP
bionys-314	109	17	clones	clone	NOUN
bionys-314	109	18	100	100	NUM
bionys-314	109	19	and	and	CCONJ
bionys-314	109	20	dn	dn	PROPN
bionys-314	109	21	.	.	PROPN
bionys-314	109	22	dna	dna	PROPN
bionys-314	109	23	was	be	AUX
bionys-314	109	24	detected	detect	VERB
bionys-314	109	25	with	with	ADP
bionys-314	109	26	cyber	cyber	PROPN
bionys-314	109	27	green	green	PROPN
bionys-314	109	28	.	.	PUNCT
bionys-314	110	1	a	a	DET
bionys-314	110	2	:	:	PUNCT
bionys-314	110	3	melting	melt	VERB
bionys-314	110	4	curve	curve	NOUN
bionys-314	110	5	of	of	ADP
bionys-314	110	6	mn	mn	PROPN
bionys-314	110	7	-	-	PUNCT
bionys-314	110	8	sod	sod	NOUN
bionys-314	110	9	gene	gene	NOUN
bionys-314	110	10	related	relate	VERB
bionys-314	110	11	to	to	AUX
bionys-314	110	12	clone	clone	NOUN
bionys-314	110	13	dn	dn	NOUN
bionys-314	110	14	in	in	ADP
bionys-314	110	15	control	control	NOUN
bionys-314	110	16	treatments	treatment	NOUN
bionys-314	110	17	.	.	PUNCT
bionys-314	111	1	b	b	X
bionys-314	111	2	:	:	PUNCT
bionys-314	111	3	melting	melt	VERB
bionys-314	111	4	curve	curve	NOUN
bionys-314	111	5	of	of	ADP
bionys-314	111	6	mn	mn	PROPN
bionys-314	111	7	-	-	PUNCT
bionys-314	111	8	sod	sod	NOUN
bionys-314	111	9	gene	gene	NOUN
bionys-314	111	10	related	relate	VERB
bionys-314	111	11	to	to	ADP
bionys-314	111	12	clone	clone	NOUN
bionys-314	111	13	dn	dn	NOUN
bionys-314	111	14	in	in	ADP
bionys-314	111	15	10	10	NUM
bionys-314	111	16	days	day	NOUN
bionys-314	111	17	drought	drought	NOUN
bionys-314	111	18	treatment	treatment	NOUN
bionys-314	111	19	.	.	PUNCT
bionys-314	112	1	c	c	X
bionys-314	112	2	:	:	PUNCT
bionys-314	112	3	melting	melt	VERB
bionys-314	112	4	curve	curve	NOUN
bionys-314	112	5	of	of	ADP
bionys-314	112	6	mn	mn	PROPN
bionys-314	112	7	-	-	PUNCT
bionys-314	112	8	sod	sod	NOUN
bionys-314	112	9	gene	gene	NOUN
bionys-314	112	10	related	relate	VERB
bionys-314	112	11	to	to	ADP
bionys-314	112	12	clone	clone	NOUN
bionys-314	112	13	100	100	NUM
bionys-314	112	14	in	in	ADP
bionys-314	112	15	control	control	NOUN
bionys-314	112	16	treatments	treatment	NOUN
bionys-314	112	17	.	.	PUNCT
bionys-314	113	1	d	d	X
bionys-314	113	2	:	:	PUNCT
bionys-314	113	3	melting	melt	VERB
bionys-314	113	4	curve	curve	NOUN
bionys-314	113	5	of	of	ADP
bionys-314	113	6	mn	mn	PROPN
bionys-314	113	7	-	-	PUNCT
bionys-314	113	8	sod	sod	NOUN
bionys-314	113	9	gene	gene	NOUN
bionys-314	113	10	related	relate	VERB
bionys-314	113	11	to	to	ADP
bionys-314	113	12	clone	clone	VERB
bionys-314	113	13	100	100	NUM
bionys-314	113	14	in	in	ADP
bionys-314	113	15	10	10	NUM
bionys-314	113	16	days	day	NOUN
bionys-314	113	17	drought	drought	NOUN
bionys-314	113	18	treatment	treatment	NOUN
bionys-314	113	19	.	.	PUNCT
bionys-314	114	1	e	e	X
bionys-314	114	2	:	:	PUNCT
bionys-314	114	3	melting	melt	VERB
bionys-314	114	4	curve	curve	NOUN
bionys-314	114	5	of	of	ADP
bionys-314	114	6	mn	mn	PROPN
bionys-314	114	7	-	-	PUNCT
bionys-314	114	8	sod	sod	NOUN
bionys-314	114	9	gene	gene	NOUN
bionys-314	114	10	related	relate	VERB
bionys-314	114	11	to	to	ADP
bionys-314	114	12	clone	clone	NOUN
bionys-314	114	13	dn	dn	NOUN
bionys-314	114	14	in	in	ADP
bionys-314	114	15	17	17	NUM
bionys-314	114	16	-	-	PUNCT
bionys-314	114	17	day	day	NOUN
bionys-314	114	18	treatment	treatment	NOUN
bionys-314	114	19	(	(	PUNCT
bionys-314	114	20	retrieved	retrieve	VERB
bionys-314	114	21	by	by	ADP
bionys-314	114	22	re	re	NOUN
bionys-314	114	23	-	-	NOUN
bionys-314	114	24	watering	watering	NOUN
bionys-314	114	25	)	)	PUNCT
bionys-314	114	26	.	.	PUNCT
bionys-314	115	1	f	f	X
bionys-314	115	2	:	:	PUNCT
bionys-314	115	3	melting	melt	VERB
bionys-314	115	4	curve	curve	NOUN
bionys-314	115	5	of	of	ADP
bionys-314	115	6	mn	mn	PROPN
bionys-314	115	7	-	-	PUNCT
bionys-314	115	8	sod	sod	NOUN
bionys-314	115	9	gene	gene	NOUN
bionys-314	115	10	related	relate	VERB
bionys-314	115	11	to	to	ADP
bionys-314	115	12	clone	clone	VERB
bionys-314	115	13	100	100	NUM
bionys-314	115	14	in	in	ADP
bionys-314	115	15	17	17	NUM
bionys-314	115	16	-	-	PUNCT
bionys-314	115	17	day	day	NOUN
bionys-314	115	18	treatment	treatment	NOUN
bionys-314	115	19	(	(	PUNCT
bionys-314	115	20	retrieved	retrieve	VERB
bionys-314	115	21	by	by	ADP
bionys-314	115	22	re	re	NOUN
bionys-314	115	23	-	-	NOUN
bionys-314	115	24	watering	watering	NOUN
bionys-314	115	25	)	)	PUNCT
bionys-314	115	26	.	.	PUNCT
bionys-314	116	1	biologica	biologica	PROPN
bionys-314	116	2	nyssana	nyssana	PROPN
bionys-314	116	3	●	●	PUNCT
bionys-314	116	4	11	11	NUM
bionys-314	116	5	(	(	PUNCT
bionys-314	116	6	1	1	NUM
bionys-314	116	7	)	)	PUNCT
bionys-314	116	8	september	september	PROPN
bionys-314	116	9	2020	2020	NUM
bionys-314	116	10	:	:	PUNCT
bionys-314	116	11	45	45	NUM
bionys-314	116	12	-	-	SYM
bionys-314	116	13	54	54	NUM
bionys-314	116	14	mohammadi	mohammadi	NOUN
bionys-314	116	15	et	et	PROPN
bionys-314	116	16	al	al	PROPN
bionys-314	116	17	.	.	PUNCT
bionys-314	117	1	●	●	PUNCT
bionys-314	117	2	a	a	DET
bionys-314	117	3	real	real	ADJ
bionys-314	117	4	-	-	PUNCT
bionys-314	117	5	time	time	NOUN
bionys-314	117	6	pcr	pcr	NOUN
bionys-314	117	7	assay	assay	NOUN
bionys-314	117	8	for	for	ADP
bionys-314	117	9	evaluation	evaluation	NOUN
bionys-314	117	10	of	of	ADP
bionys-314	117	11	drought	drought	NOUN
bionys-314	117	12	tolerance	tolerance	NOUN
bionys-314	117	13	in	in	ADP
bionys-314	117	14	a	a	DET
bionys-314	117	15	new	new	ADJ
bionys-314	117	16	tea	tea	NOUN
bionys-314	117	17	clone	clone	NOUN
bionys-314	117	18	49	49	NUM
bionys-314	117	19	electrophoresis	electrophoresis	NOUN
bionys-314	117	20	and	and	CCONJ
bionys-314	117	21	melting	melt	VERB
bionys-314	117	22	curve	curve	NOUN
bionys-314	117	23	of	of	ADP
bionys-314	117	24	rt	rt	ADJ
bionys-314	117	25	-	-	PUNCT
bionys-314	117	26	pcr	pcr	ADJ
bionys-314	117	27	products	product	NOUN
bionys-314	117	28	of	of	ADP
bionys-314	117	29	mn	mn	PROPN
bionys-314	117	30	-	-	PUNCT
bionys-314	117	31	sod	sod	NOUN
bionys-314	117	32	gene	gene	NOUN
bionys-314	117	33	as	as	SCONJ
bionys-314	117	34	is	be	AUX
bionys-314	117	35	shown	show	VERB
bionys-314	117	36	in	in	ADP
bionys-314	117	37	fig	fig	NOUN
bionys-314	117	38	.	.	PUNCT
bionys-314	118	1	1b	1b	NUM
bionys-314	118	2	and	and	CCONJ
bionys-314	118	3	2	2	NUM
bionys-314	119	1	,	,	PUNCT
bionys-314	119	2	the	the	DET
bionys-314	119	3	melting	melting	NOUN
bionys-314	119	4	temperature	temperature	NOUN
bionys-314	119	5	for	for	ADP
bionys-314	119	6	the	the	DET
bionys-314	119	7	121	121	NUM
bionys-314	119	8	bp	bp	PROPN
bionys-314	119	9	fragment	fragment	NOUN
bionys-314	119	10	of	of	ADP
bionys-314	119	11	mn	mn	PROPN
bionys-314	119	12	-	-	PUNCT
bionys-314	119	13	sod	sod	NOUN
bionys-314	119	14	gene	gene	NOUN
bionys-314	119	15	rtpcr	rtpcr	NOUN
bionys-314	119	16	product	product	NOUN
bionys-314	119	17	and	and	CCONJ
bionys-314	119	18	of	of	ADP
bionys-314	119	19	the	the	DET
bionys-314	119	20	rrna	rrna	PROPN
bionys-314	119	21	18s	18s	PROPN
bionys-314	119	22	gene	gene	NOUN
bionys-314	119	23	are	be	AUX
bionys-314	119	24	73.5	73.5	NUM
bionys-314	119	25	°	°	ADP
bionys-314	119	26	c	c	NOUN
bionys-314	119	27	and	and	CCONJ
bionys-314	119	28	77.5	77.5	NUM
bionys-314	119	29	°	°	NOUN
bionys-314	119	30	c	c	NOUN
bionys-314	119	31	,	,	PUNCT
bionys-314	119	32	respectively	respectively	ADV
bionys-314	119	33	(	(	PUNCT
bionys-314	119	34	fig	fig	NOUN
bionys-314	119	35	.	.	PUNCT
bionys-314	120	1	1b	1b	NUM
bionys-314	120	2	,	,	PUNCT
bionys-314	120	3	fig	fig	NOUN
bionys-314	120	4	.	.	PUNCT
bionys-314	121	1	2	2	NUM
bionys-314	121	2	)	)	PUNCT
bionys-314	121	3	.	.	PUNCT
bionys-314	122	1	as	as	SCONJ
bionys-314	122	2	shown	show	VERB
bionys-314	122	3	in	in	ADP
bionys-314	122	4	fig	fig	NOUN
bionys-314	122	5	.	.	PUNCT
bionys-314	123	1	3	3	NUM
bionys-314	123	2	measurement	measurement	NOUN
bionys-314	123	3	of	of	ADP
bionys-314	123	4	mn	mn	PROPN
bionys-314	123	5	-	-	PUNCT
bionys-314	123	6	sod	sod	NOUN
bionys-314	123	7	gene	gene	NOUN
bionys-314	123	8	expression	expression	NOUN
bionys-314	123	9	was	be	AUX
bionys-314	123	10	carried	carry	VERB
bionys-314	123	11	out	out	ADP
bionys-314	123	12	in	in	ADP
bionys-314	123	13	leaf	leaf	NOUN
bionys-314	123	14	tissue	tissue	NOUN
bionys-314	123	15	from	from	ADP
bionys-314	123	16	2	2	NUM
bionys-314	123	17	clones	clone	NOUN
bionys-314	123	18	100	100	NUM
bionys-314	123	19	and	and	CCONJ
bionys-314	123	20	dn	dn	VERB
bionys-314	123	21	at	at	ADP
bionys-314	123	22	0	0	NUM
bionys-314	123	23	,	,	PUNCT
bionys-314	123	24	10	10	NUM
bionys-314	123	25	and	and	CCONJ
bionys-314	123	26	17	17	NUM
bionys-314	123	27	days	day	NOUN
bionys-314	123	28	after	after	ADP
bionys-314	123	29	treatment	treatment	NOUN
bionys-314	123	30	.	.	PUNCT
bionys-314	124	1	standardization	standardization	NOUN
bionys-314	124	2	of	of	ADP
bionys-314	124	3	gene	gene	NOUN
bionys-314	124	4	expression	expression	NOUN
bionys-314	124	5	data	datum	NOUN
bionys-314	124	6	was	be	AUX
bionys-314	124	7	carried	carry	VERB
bionys-314	124	8	out	out	ADP
bionys-314	124	9	using	use	VERB
bionys-314	124	10	18s	18	NOUN
bionys-314	124	11	rrna	rrna	PROPN
bionys-314	124	12	.	.	PUNCT
bionys-314	125	1	examining	examine	VERB
bionys-314	125	2	gene	gene	NOUN
bionys-314	125	3	expression	expression	NOUN
bionys-314	125	4	during	during	ADP
bionys-314	125	5	drought	drought	NOUN
bionys-314	125	6	stress	stress	NOUN
bionys-314	125	7	and	and	CCONJ
bionys-314	125	8	re	re	NOUN
bionys-314	125	9	-	-	NOUN
bionys-314	125	10	irrigation	irrigation	NOUN
bionys-314	125	11	yielded	yield	VERB
bionys-314	125	12	different	different	ADJ
bionys-314	125	13	results	result	NOUN
bionys-314	125	14	.	.	PUNCT
bionys-314	126	1	results	result	NOUN
bionys-314	126	2	indicate	indicate	VERB
bionys-314	126	3	that	that	SCONJ
bionys-314	126	4	the	the	DET
bionys-314	126	5	greatest	great	ADJ
bionys-314	126	6	amount	amount	NOUN
bionys-314	126	7	of	of	ADP
bionys-314	126	8	mn	mn	PROPN
bionys-314	126	9	-	-	PUNCT
bionys-314	126	10	sod	sod	NOUN
bionys-314	126	11	expression	expression	NOUN
bionys-314	126	12	was	be	AUX
bionys-314	126	13	observed	observe	VERB
bionys-314	126	14	in	in	ADP
bionys-314	126	15	clones	clone	NOUN
bionys-314	126	16	of	of	ADP
bionys-314	126	17	dn	dn	NOUN
bionys-314	126	18	after	after	ADP
bionys-314	126	19	undergoing	undergo	VERB
bionys-314	126	20	drought	drought	NOUN
bionys-314	126	21	conditions	condition	NOUN
bionys-314	126	22	for	for	ADP
bionys-314	126	23	10	10	NUM
bionys-314	126	24	days	day	NOUN
bionys-314	126	25	.	.	PUNCT
bionys-314	127	1	significant	significant	ADJ
bionys-314	127	2	increases	increase	NOUN
bionys-314	127	3	in	in	ADP
bionys-314	127	4	mrna	mrna	PROPN
bionys-314	127	5	synthesis	synthesis	NOUN
bionys-314	127	6	of	of	ADP
bionys-314	127	7	mn	mn	PROPN
bionys-314	127	8	-	-	PUNCT
bionys-314	127	9	sod	sod	NOUN
bionys-314	127	10	gene	gene	NOUN
bionys-314	127	11	occurred	occur	VERB
bionys-314	127	12	during	during	ADP
bionys-314	127	13	this	this	DET
bionys-314	127	14	period	period	NOUN
bionys-314	127	15	and	and	CCONJ
bionys-314	127	16	expression	expression	NOUN
bionys-314	127	17	level	level	NOUN
bionys-314	127	18	decreased	decrease	VERB
bionys-314	127	19	significantly	significantly	ADV
bionys-314	127	20	by	by	ADP
bionys-314	127	21	day	day	NOUN
bionys-314	127	22	17	17	NUM
bionys-314	127	23	day	day	NOUN
bionys-314	127	24	,	,	PUNCT
bionys-314	127	25	i.e.	i.e.	X
bionys-314	127	26	,	,	PUNCT
bionys-314	127	27	after	after	ADP
bionys-314	127	28	the	the	DET
bionys-314	127	29	7	7	NUM
bionys-314	127	30	day	day	NOUN
bionys-314	127	31	alleviation	alleviation	NOUN
bionys-314	127	32	of	of	ADP
bionys-314	127	33	the	the	DET
bionys-314	127	34	drought	drought	NOUN
bionys-314	127	35	conditions	condition	NOUN
bionys-314	127	36	,	,	PUNCT
bionys-314	127	37	compared	compare	VERB
bionys-314	127	38	to	to	ADP
bionys-314	127	39	expression	expression	NOUN
bionys-314	127	40	levels	level	NOUN
bionys-314	127	41	after	after	ADP
bionys-314	127	42	the	the	DET
bionys-314	127	43	10	10	NUM
bionys-314	127	44	day	day	NOUN
bionys-314	127	45	exposure	exposure	NOUN
bionys-314	127	46	to	to	ADP
bionys-314	127	47	drought	drought	NOUN
bionys-314	127	48	conditions	condition	NOUN
bionys-314	127	49	in	in	ADP
bionys-314	127	50	the	the	DET
bionys-314	127	51	same	same	ADJ
bionys-314	127	52	clone	clone	NOUN
bionys-314	127	53	.	.	PUNCT
bionys-314	128	1	in	in	ADP
bionys-314	128	2	contrast	contrast	NOUN
bionys-314	128	3	,	,	PUNCT
bionys-314	128	4	mn	mn	PROPN
bionys-314	128	5	-	-	PUNCT
bionys-314	128	6	sod	sod	NOUN
bionys-314	128	7	gene	gene	NOUN
bionys-314	128	8	expression	expression	NOUN
bionys-314	128	9	did	do	AUX
bionys-314	128	10	not	not	PART
bionys-314	128	11	significantly	significantly	ADV
bionys-314	128	12	change	change	VERB
bionys-314	128	13	in	in	ADP
bionys-314	128	14	clone	clone	NOUN
bionys-314	128	15	100	100	NUM
bionys-314	128	16	in	in	ADP
bionys-314	128	17	any	any	PRON
bionys-314	128	18	of	of	ADP
bionys-314	128	19	the	the	DET
bionys-314	128	20	2	2	NUM
bionys-314	128	21	treatments	treatment	NOUN
bionys-314	128	22	(	(	PUNCT
bionys-314	128	23	fig	fig	NOUN
bionys-314	128	24	.	.	PUNCT
bionys-314	129	1	3	3	NUM
bionys-314	129	2	)	)	PUNCT
bionys-314	129	3	.	.	PUNCT
bionys-314	130	1	measurement	measurement	NOUN
bionys-314	130	2	of	of	ADP
bionys-314	130	3	relative	relative	ADJ
bionys-314	130	4	water	water	NOUN
bionys-314	130	5	content	content	NOUN
bionys-314	130	6	and	and	CCONJ
bionys-314	130	7	soil	soil	NOUN
bionys-314	130	8	moisture	moisture	NOUN
bionys-314	130	9	content	content	NOUN
bionys-314	130	10	measurement	measurement	NOUN
bionys-314	130	11	of	of	ADP
bionys-314	130	12	smc	smc	PROPN
bionys-314	130	13	showed	show	VERB
bionys-314	130	14	that	that	SCONJ
bionys-314	130	15	soil	soil	NOUN
bionys-314	130	16	moisture	moisture	NOUN
bionys-314	130	17	was	be	AUX
bionys-314	130	18	decreased	decrease	VERB
bionys-314	130	19	meaningfully	meaningfully	ADV
bionys-314	130	20	in	in	ADP
bionys-314	130	21	all	all	DET
bionys-314	130	22	treatments	treatment	NOUN
bionys-314	130	23	which	which	PRON
bionys-314	130	24	were	be	AUX
bionys-314	130	25	inducted	induct	VERB
bionys-314	130	26	by	by	ADP
bionys-314	130	27	imposition	imposition	NOUN
bionys-314	130	28	of	of	ADP
bionys-314	130	29	drought	drought	NOUN
bionys-314	130	30	conditions	condition	NOUN
bionys-314	130	31	(	(	PUNCT
bionys-314	130	32	fig	fig	NOUN
bionys-314	130	33	.	.	PUNCT
bionys-314	130	34	4	4	NUM
bionys-314	130	35	)	)	PUNCT
bionys-314	130	36	.	.	PUNCT
bionys-314	131	1	the	the	DET
bionys-314	131	2	effect	effect	NOUN
bionys-314	131	3	of	of	ADP
bionys-314	131	4	drought	drought	NOUN
bionys-314	131	5	on	on	ADP
bionys-314	131	6	rwc	rwc	VERB
bionys-314	131	7	changes	change	NOUN
bionys-314	131	8	in	in	ADP
bionys-314	131	9	the	the	DET
bionys-314	131	10	100	100	NUM
bionys-314	131	11	and	and	CCONJ
bionys-314	131	12	dn	dn	NOUN
bionys-314	131	13	clones	clone	NOUN
bionys-314	131	14	showed	show	VERB
bionys-314	131	15	that	that	SCONJ
bionys-314	131	16	responses	response	NOUN
bionys-314	131	17	were	be	AUX
bionys-314	131	18	similar	similar	ADJ
bionys-314	131	19	in	in	ADP
bionys-314	131	20	both	both	DET
bionys-314	131	21	clones	clone	NOUN
bionys-314	131	22	and	and	CCONJ
bionys-314	131	23	rwc	rwc	NOUN
bionys-314	131	24	was	be	AUX
bionys-314	131	25	reduced	reduce	VERB
bionys-314	131	26	meaningfully	meaningfully	ADV
bionys-314	131	27	after	after	ADP
bionys-314	131	28	10	10	NUM
bionys-314	131	29	days	day	NOUN
bionys-314	131	30	of	of	ADP
bionys-314	131	31	drought	drought	NOUN
bionys-314	131	32	stress	stress	NOUN
bionys-314	131	33	.	.	PUNCT
bionys-314	132	1	in	in	ADP
bionys-314	132	2	the	the	DET
bionys-314	132	3	recovery	recovery	NOUN
bionys-314	132	4	treatment	treatment	NOUN
bionys-314	132	5	,	,	PUNCT
bionys-314	132	6	rwc	rwc	NOUN
bionys-314	132	7	levels	level	NOUN
bionys-314	132	8	increased	increase	VERB
bionys-314	132	9	in	in	ADP
bionys-314	132	10	both	both	DET
bionys-314	132	11	clones	clone	NOUN
bionys-314	132	12	.	.	PUNCT
bionys-314	133	1	this	this	DET
bionys-314	133	2	increase	increase	NOUN
bionys-314	133	3	was	be	AUX
bionys-314	133	4	similar	similar	ADJ
bionys-314	133	5	in	in	ADP
bionys-314	133	6	the	the	DET
bionys-314	133	7	2	2	NUM
bionys-314	133	8	clones	clone	NOUN
bionys-314	133	9	(	(	PUNCT
bionys-314	133	10	fig	fig	NOUN
bionys-314	133	11	.	.	PUNCT
bionys-314	134	1	4	4	NUM
bionys-314	134	2	)	)	PUNCT
bionys-314	134	3	.	.	PUNCT
bionys-314	135	1	proline	proline	NOUN
bionys-314	135	2	measurement	measurement	NOUN
bionys-314	135	3	a	a	DET
bionys-314	135	4	comparison	comparison	NOUN
bionys-314	135	5	of	of	ADP
bionys-314	135	6	proline	proline	NOUN
bionys-314	135	7	content	content	NOUN
bionys-314	135	8	in	in	ADP
bionys-314	135	9	clones	clone	NOUN
bionys-314	135	10	dn	dn	ADP
bionys-314	135	11	and	and	CCONJ
bionys-314	135	12	100	100	NUM
bionys-314	135	13	indicates	indicate	VERB
bionys-314	135	14	that	that	SCONJ
bionys-314	135	15	the	the	DET
bionys-314	135	16	responses	response	NOUN
bionys-314	135	17	of	of	ADP
bionys-314	135	18	the	the	DET
bionys-314	135	19	two	two	NUM
bionys-314	135	20	clones	clone	NOUN
bionys-314	135	21	differed	differ	VERB
bionys-314	135	22	in	in	ADP
bionys-314	135	23	samples	sample	NOUN
bionys-314	135	24	under	under	ADP
bionys-314	135	25	drought	drought	NOUN
bionys-314	135	26	and	and	CCONJ
bionys-314	135	27	recovery	recovery	NOUN
bionys-314	135	28	conditions	condition	NOUN
bionys-314	135	29	.	.	PUNCT
bionys-314	136	1	proline	proline	NOUN
bionys-314	136	2	levels	level	NOUN
bionys-314	136	3	increased	increase	VERB
bionys-314	136	4	under	under	ADP
bionys-314	136	5	drought	drought	NOUN
bionys-314	136	6	stress	stress	NOUN
bionys-314	136	7	in	in	ADP
bionys-314	136	8	clone	clone	NOUN
bionys-314	136	9	dn	dn	NOUN
bionys-314	136	10	,	,	PUNCT
bionys-314	136	11	whereas	whereas	SCONJ
bionys-314	136	12	significant	significant	ADJ
bionys-314	136	13	increases	increase	NOUN
bionys-314	136	14	were	be	AUX
bionys-314	136	15	not	not	PART
bionys-314	136	16	observed	observe	VERB
bionys-314	136	17	in	in	ADP
bionys-314	136	18	clone	clone	NOUN
bionys-314	136	19	100	100	NUM
bionys-314	136	20	compared	compare	VERB
bionys-314	136	21	to	to	ADP
bionys-314	136	22	control	control	NOUN
bionys-314	136	23	.	.	PUNCT
bionys-314	137	1	proline	proline	NOUN
bionys-314	137	2	content	content	NOUN
bionys-314	137	3	of	of	ADP
bionys-314	137	4	clone	clone	NOUN
bionys-314	137	5	dn	dn	NOUN
bionys-314	137	6	was	be	AUX
bionys-314	137	7	also	also	ADV
bionys-314	137	8	reduced	reduce	VERB
bionys-314	137	9	significantly	significantly	ADV
bionys-314	137	10	after	after	ADP
bionys-314	137	11	the	the	DET
bionys-314	137	12	recovery	recovery	NOUN
bionys-314	137	13	treatment	treatment	NOUN
bionys-314	137	14	;	;	PUNCT
bionys-314	137	15	however	however	ADV
bionys-314	137	16	,	,	PUNCT
bionys-314	137	17	changes	change	NOUN
bionys-314	137	18	of	of	ADP
bionys-314	137	19	proline	proline	NOUN
bionys-314	137	20	content	content	NOUN
bionys-314	137	21	were	be	AUX
bionys-314	137	22	again	again	ADV
bionys-314	137	23	not	not	PART
bionys-314	137	24	statistically	statistically	ADV
bionys-314	137	25	significant	significant	ADJ
bionys-314	137	26	in	in	ADP
bionys-314	137	27	clone	clone	NOUN
bionys-314	137	28	100	100	NUM
bionys-314	137	29	at	at	ADP
bionys-314	137	30	this	this	DET
bionys-314	137	31	point	point	NOUN
bionys-314	137	32	(	(	PUNCT
bionys-314	137	33	fig	fig	NOUN
bionys-314	137	34	.	.	PUNCT
bionys-314	138	1	5	5	NUM
bionys-314	138	2	)	)	PUNCT
bionys-314	138	3	.	.	PUNCT
bionys-314	139	1	fig	fig	NOUN
bionys-314	139	2	.	.	PUNCT
bionys-314	140	1	3	3	X
bionys-314	140	2	.	.	X
bionys-314	140	3	changes	change	NOUN
bionys-314	140	4	in	in	ADP
bionys-314	140	5	mrna	mrna	PROPN
bionys-314	140	6	level	level	NOUN
bionys-314	140	7	of	of	ADP
bionys-314	140	8	the	the	DET
bionys-314	140	9	mn	mn	PROPN
bionys-314	140	10	-	-	PUNCT
bionys-314	140	11	sod	sod	NOUN
bionys-314	140	12	gene	gene	NOUN
bionys-314	140	13	in	in	ADP
bionys-314	140	14	clones	clone	NOUN
bionys-314	140	15	100	100	NUM
bionys-314	140	16	and	and	CCONJ
bionys-314	140	17	dn	dn	VERB
bionys-314	140	18	in	in	ADP
bionys-314	140	19	treatments	treatment	NOUN
bionys-314	140	20	of	of	ADP
bionys-314	140	21	control	control	NOUN
bionys-314	140	22	(	(	PUNCT
bionys-314	140	23	0	0	NUM
bionys-314	140	24	)	)	PUNCT
bionys-314	140	25	,	,	PUNCT
bionys-314	140	26	10	10	NUM
bionys-314	140	27	days	day	NOUN
bionys-314	140	28	without	without	ADP
bionys-314	140	29	watering	watering	NOUN
bionys-314	140	30	(	(	PUNCT
bionys-314	140	31	10	10	NUM
bionys-314	140	32	)	)	PUNCT
bionys-314	140	33	and	and	CCONJ
bionys-314	140	34	treatments	treatment	NOUN
bionys-314	140	35	recovered	recover	VERB
bionys-314	140	36	with	with	ADP
bionys-314	140	37	reirrigation	reirrigation	NOUN
bionys-314	140	38	for	for	ADP
bionys-314	140	39	7	7	NUM
bionys-314	140	40	days	day	NOUN
bionys-314	140	41	(	(	PUNCT
bionys-314	140	42	17	17	NUM
bionys-314	140	43	)	)	PUNCT
bionys-314	140	44	.	.	PUNCT
bionys-314	141	1	data	datum	NOUN
bionys-314	141	2	is	be	AUX
bionys-314	141	3	average	average	ADJ
bionys-314	141	4	of	of	ADP
bionys-314	141	5	three	three	NUM
bionys-314	141	6	replicates	replicate	NOUN
bionys-314	141	7	±	±	NOUN
bionys-314	141	8	standard	standard	ADJ
bionys-314	141	9	error	error	NOUN
bionys-314	141	10	(	(	PUNCT
bionys-314	141	11	se	se	X
bionys-314	141	12	)	)	PUNCT
bionys-314	141	13	respectively	respectively	ADV
bionys-314	141	14	.	.	PUNCT
bionys-314	142	1	different	different	ADJ
bionys-314	142	2	letters	letter	NOUN
bionys-314	142	3	indicate	indicate	VERB
bionys-314	142	4	significant	significant	ADJ
bionys-314	142	5	differences	difference	NOUN
bionys-314	142	6	between	between	ADP
bionys-314	142	7	treatments	treatment	NOUN
bionys-314	142	8	according	accord	VERB
bionys-314	142	9	to	to	ADP
bionys-314	142	10	duncan	duncan	PROPN
bionys-314	142	11	’s	’s	PART
bionys-314	142	12	test	test	NOUN
bionys-314	142	13	with	with	ADP
bionys-314	142	14	p	p	NOUN
bionys-314	142	15	<	<	NOUN
bionys-314	142	16	0.05	0.05	NUM
bionys-314	142	17	.	.	PUNCT
bionys-314	142	18	fig	fig	NOUN
bionys-314	142	19	.	.	PUNCT
bionys-314	143	1	4	4	X
bionys-314	143	2	.	.	X
bionys-314	143	3	changes	change	NOUN
bionys-314	143	4	in	in	ADP
bionys-314	143	5	rwc	rwc	NOUN
bionys-314	143	6	of	of	ADP
bionys-314	143	7	clones	clone	NOUN
bionys-314	143	8	100	100	NUM
bionys-314	143	9	and	and	CCONJ
bionys-314	143	10	dn	dn	VERB
bionys-314	143	11	in	in	ADP
bionys-314	143	12	treatments	treatment	NOUN
bionys-314	143	13	of	of	ADP
bionys-314	143	14	control	control	NOUN
bionys-314	143	15	(	(	PUNCT
bionys-314	143	16	0	0	NUM
bionys-314	143	17	)	)	PUNCT
bionys-314	143	18	,	,	PUNCT
bionys-314	143	19	10	10	NUM
bionys-314	143	20	days	day	NOUN
bionys-314	143	21	without	without	ADP
bionys-314	143	22	watering	watering	NOUN
bionys-314	143	23	(	(	PUNCT
bionys-314	143	24	10	10	NUM
bionys-314	143	25	)	)	PUNCT
bionys-314	143	26	and	and	CCONJ
bionys-314	143	27	treatments	treatment	NOUN
bionys-314	143	28	recovered	recover	VERB
bionys-314	143	29	with	with	ADP
bionys-314	143	30	re	re	NOUN
bionys-314	143	31	-	-	NOUN
bionys-314	143	32	irrigation	irrigation	NOUN
bionys-314	143	33	for	for	ADP
bionys-314	143	34	7	7	NUM
bionys-314	143	35	days	day	NOUN
bionys-314	143	36	(	(	PUNCT
bionys-314	143	37	17	17	NUM
bionys-314	143	38	)	)	PUNCT
bionys-314	143	39	.	.	PUNCT
bionys-314	144	1	data	datum	NOUN
bionys-314	144	2	is	be	AUX
bionys-314	144	3	average	average	ADJ
bionys-314	144	4	of	of	ADP
bionys-314	144	5	three	three	NUM
bionys-314	144	6	replicates	replicate	NOUN
bionys-314	144	7	±	±	NOUN
bionys-314	144	8	standard	standard	ADJ
bionys-314	144	9	error	error	NOUN
bionys-314	144	10	(	(	PUNCT
bionys-314	144	11	se	se	X
bionys-314	144	12	)	)	PUNCT
bionys-314	144	13	respectively	respectively	ADV
bionys-314	144	14	.	.	PUNCT
bionys-314	145	1	different	different	ADJ
bionys-314	145	2	letters	letter	NOUN
bionys-314	145	3	indicate	indicate	VERB
bionys-314	145	4	significant	significant	ADJ
bionys-314	145	5	differences	difference	NOUN
bionys-314	145	6	between	between	ADP
bionys-314	145	7	treatments	treatment	NOUN
bionys-314	145	8	according	accord	VERB
bionys-314	145	9	to	to	ADP
bionys-314	145	10	duncan	duncan	PROPN
bionys-314	145	11	’s	’s	PART
bionys-314	145	12	test	test	NOUN
bionys-314	145	13	with	with	ADP
bionys-314	145	14	p	p	NOUN
bionys-314	145	15	<	<	NOUN
bionys-314	145	16	0.05	0.05	NUM
bionys-314	145	17	.	.	PUNCT
bionys-314	145	18	fig	fig	NOUN
bionys-314	145	19	.	.	PUNCT
bionys-314	146	1	5	5	X
bionys-314	146	2	.	.	X
bionys-314	146	3	changes	change	NOUN
bionys-314	146	4	of	of	ADP
bionys-314	146	5	proline	proline	NOUN
bionys-314	146	6	content	content	NOUN
bionys-314	146	7	of	of	ADP
bionys-314	146	8	clones	clone	NOUN
bionys-314	146	9	100	100	NUM
bionys-314	146	10	and	and	CCONJ
bionys-314	146	11	dn	dn	VERB
bionys-314	146	12	in	in	ADP
bionys-314	146	13	treatments	treatment	NOUN
bionys-314	146	14	of	of	ADP
bionys-314	146	15	control	control	NOUN
bionys-314	146	16	(	(	PUNCT
bionys-314	146	17	0	0	NUM
bionys-314	146	18	)	)	PUNCT
bionys-314	146	19	,	,	PUNCT
bionys-314	146	20	10	10	NUM
bionys-314	146	21	days	day	NOUN
bionys-314	146	22	without	without	ADP
bionys-314	146	23	watering	watering	NOUN
bionys-314	146	24	(	(	PUNCT
bionys-314	146	25	10	10	NUM
bionys-314	146	26	)	)	PUNCT
bionys-314	146	27	and	and	CCONJ
bionys-314	146	28	treatments	treatment	NOUN
bionys-314	146	29	recovered	recover	VERB
bionys-314	146	30	with	with	ADP
bionys-314	146	31	re	re	NOUN
bionys-314	146	32	-	-	NOUN
bionys-314	146	33	irrigation	irrigation	NOUN
bionys-314	146	34	for	for	ADP
bionys-314	146	35	7	7	NUM
bionys-314	146	36	days	day	NOUN
bionys-314	146	37	(	(	PUNCT
bionys-314	146	38	17	17	NUM
bionys-314	146	39	)	)	PUNCT
bionys-314	146	40	.	.	PUNCT
bionys-314	147	1	data	datum	NOUN
bionys-314	147	2	is	be	AUX
bionys-314	147	3	average	average	ADJ
bionys-314	147	4	of	of	ADP
bionys-314	147	5	three	three	NUM
bionys-314	147	6	replicates	replicate	NOUN
bionys-314	147	7	±	±	NOUN
bionys-314	147	8	standard	standard	ADJ
bionys-314	147	9	error	error	NOUN
bionys-314	147	10	(	(	PUNCT
bionys-314	147	11	se	se	X
bionys-314	147	12	)	)	PUNCT
bionys-314	147	13	respectively	respectively	ADV
bionys-314	147	14	.	.	PUNCT
bionys-314	148	1	different	different	ADJ
bionys-314	148	2	letters	letter	NOUN
bionys-314	148	3	indicate	indicate	VERB
bionys-314	148	4	significant	significant	ADJ
bionys-314	148	5	differences	difference	NOUN
bionys-314	148	6	between	between	ADP
bionys-314	148	7	treatments	treatment	NOUN
bionys-314	148	8	according	accord	VERB
bionys-314	148	9	to	to	ADP
bionys-314	148	10	duncan	duncan	PROPN
bionys-314	148	11	’s	’s	PART
bionys-314	148	12	test	test	NOUN
bionys-314	148	13	with	with	ADP
bionys-314	148	14	p	p	NOUN
bionys-314	148	15	<	<	NOUN
bionys-314	148	16	0.05	0.05	NUM
bionys-314	148	17	.	.	PUNCT
bionys-314	149	1	biologica	biologica	PROPN
bionys-314	149	2	nyssana	nyssana	PROPN
bionys-314	149	3	●	●	PUNCT
bionys-314	149	4	11	11	NUM
bionys-314	149	5	(	(	PUNCT
bionys-314	149	6	1	1	NUM
bionys-314	149	7	)	)	PUNCT
bionys-314	149	8	september	september	PROPN
bionys-314	149	9	2020	2020	NUM
bionys-314	149	10	:	:	PUNCT
bionys-314	149	11	45	45	NUM
bionys-314	149	12	-	-	SYM
bionys-314	149	13	54	54	NUM
bionys-314	149	14	mohammadi	mohammadi	NOUN
bionys-314	149	15	et	et	PROPN
bionys-314	149	16	al	al	PROPN
bionys-314	149	17	.	.	PUNCT
bionys-314	150	1	●	●	PUNCT
bionys-314	150	2	a	a	DET
bionys-314	150	3	real	real	ADJ
bionys-314	150	4	-	-	PUNCT
bionys-314	150	5	time	time	NOUN
bionys-314	150	6	pcr	pcr	NOUN
bionys-314	150	7	assay	assay	NOUN
bionys-314	150	8	for	for	ADP
bionys-314	150	9	evaluation	evaluation	NOUN
bionys-314	150	10	of	of	ADP
bionys-314	150	11	drought	drought	NOUN
bionys-314	150	12	tolerance	tolerance	NOUN
bionys-314	150	13	in	in	ADP
bionys-314	150	14	a	a	DET
bionys-314	150	15	new	new	ADJ
bionys-314	150	16	tea	tea	NOUN
bionys-314	150	17	clone	clone	NOUN
bionys-314	150	18	50	50	NUM
bionys-314	150	19	measurement	measurement	NOUN
bionys-314	150	20	of	of	ADP
bionys-314	150	21	lipid	lipid	NOUN
bionys-314	150	22	peroxidation	peroxidation	NOUN
bionys-314	150	23	as	as	SCONJ
bionys-314	150	24	seen	see	VERB
bionys-314	150	25	in	in	ADP
bionys-314	150	26	fig	fig	NOUN
bionys-314	150	27	.	.	PUNCT
bionys-314	151	1	6	6	NUM
bionys-314	151	2	changes	change	NOUN
bionys-314	151	3	in	in	ADP
bionys-314	151	4	malondialdehyde	malondialdehyde	NOUN
bionys-314	151	5	levels	level	NOUN
bionys-314	151	6	in	in	ADP
bionys-314	151	7	clone	clone	NOUN
bionys-314	151	8	100	100	NUM
bionys-314	151	9	are	be	AUX
bionys-314	151	10	different	different	ADJ
bionys-314	151	11	from	from	ADP
bionys-314	151	12	those	those	PRON
bionys-314	151	13	in	in	ADP
bionys-314	151	14	clone	clone	NOUN
bionys-314	151	15	dn	dn	NOUN
bionys-314	151	16	under	under	ADP
bionys-314	151	17	drought	drought	NOUN
bionys-314	151	18	stress	stress	NOUN
bionys-314	151	19	.	.	PUNCT
bionys-314	152	1	mda	mda	PROPN
bionys-314	152	2	content	content	PROPN
bionys-314	152	3	does	do	AUX
bionys-314	152	4	not	not	PART
bionys-314	152	5	increase	increase	VERB
bionys-314	152	6	in	in	ADP
bionys-314	152	7	clone	clone	NOUN
bionys-314	152	8	100	100	NUM
bionys-314	152	9	under	under	ADP
bionys-314	152	10	drought	drought	NOUN
bionys-314	152	11	stress	stress	NOUN
bionys-314	152	12	,	,	PUNCT
bionys-314	152	13	mda	mda	PROPN
bionys-314	152	14	levels	level	NOUN
bionys-314	152	15	are	be	AUX
bionys-314	152	16	very	very	ADV
bionys-314	152	17	substantially	substantially	ADV
bionys-314	152	18	increased	increase	VERB
bionys-314	152	19	in	in	ADP
bionys-314	152	20	clone	clone	NOUN
bionys-314	152	21	dn	dn	NOUN
bionys-314	152	22	after	after	ADP
bionys-314	152	23	10	10	NUM
bionys-314	152	24	days	day	NOUN
bionys-314	152	25	of	of	ADP
bionys-314	152	26	drought	drought	NOUN
bionys-314	152	27	treatment	treatment	NOUN
bionys-314	152	28	.	.	PUNCT
bionys-314	153	1	mda	mda	PROPN
bionys-314	153	2	levels	level	NOUN
bionys-314	153	3	in	in	ADP
bionys-314	153	4	clone	clone	NOUN
bionys-314	153	5	dn	dn	PROPN
bionys-314	153	6	dropped	drop	VERB
bionys-314	153	7	dramatically	dramatically	ADV
bionys-314	153	8	in	in	ADP
bionys-314	153	9	the	the	DET
bionys-314	153	10	7	7	NUM
bionys-314	153	11	day	day	NOUN
bionys-314	153	12	recovery	recovery	NOUN
bionys-314	153	13	period	period	NOUN
bionys-314	153	14	,	,	PUNCT
bionys-314	153	15	as	as	ADP
bionys-314	153	16	assayed	assayed	ADJ
bionys-314	153	17	on	on	ADP
bionys-314	153	18	day	day	NOUN
bionys-314	153	19	17	17	NUM
bionys-314	153	20	day	day	NOUN
bionys-314	153	21	of	of	ADP
bionys-314	153	22	the	the	DET
bionys-314	153	23	overall	overall	ADJ
bionys-314	153	24	experiment	experiment	NOUN
bionys-314	153	25	(	(	PUNCT
bionys-314	153	26	fig	fig	NOUN
bionys-314	153	27	.	.	PUNCT
bionys-314	154	1	6	6	NUM
bionys-314	154	2	)	)	PUNCT
bionys-314	154	3	.	.	PUNCT
bionys-314	155	1	measurement	measurement	NOUN
bionys-314	155	2	of	of	ADP
bionys-314	155	3	photosynthetic	photosynthetic	ADJ
bionys-314	155	4	pigments	pigment	NOUN
bionys-314	155	5	measurement	measurement	NOUN
bionys-314	155	6	of	of	ADP
bionys-314	155	7	carotenoids	carotenoid	NOUN
bionys-314	155	8	data	datum	NOUN
bionys-314	155	9	shows	show	VERB
bionys-314	155	10	that	that	SCONJ
bionys-314	155	11	the	the	DET
bionys-314	155	12	highest	high	ADJ
bionys-314	155	13	concentrations	concentration	NOUN
bionys-314	155	14	of	of	ADP
bionys-314	155	15	carotenoids	carotenoid	NOUN
bionys-314	155	16	occurred	occur	VERB
bionys-314	155	17	in	in	ADP
bionys-314	155	18	clone	clone	NOUN
bionys-314	155	19	100	100	NUM
bionys-314	155	20	in	in	ADP
bionys-314	155	21	the	the	DET
bionys-314	155	22	10	10	NUM
bionys-314	155	23	day	day	NOUN
bionys-314	155	24	treatment	treatment	NOUN
bionys-314	155	25	.	.	PUNCT
bionys-314	156	1	changes	change	NOUN
bionys-314	156	2	in	in	ADP
bionys-314	156	3	carotenoid	carotenoid	NOUN
bionys-314	156	4	level	level	NOUN
bionys-314	156	5	in	in	ADP
bionys-314	156	6	clone	clone	NOUN
bionys-314	156	7	dn	dn	NOUN
bionys-314	156	8	are	be	AUX
bionys-314	156	9	substantially	substantially	ADV
bionys-314	156	10	lower	low	ADJ
bionys-314	156	11	than	than	ADP
bionys-314	156	12	in	in	ADP
bionys-314	156	13	clone	clone	NOUN
bionys-314	156	14	100	100	NUM
bionys-314	156	15	(	(	PUNCT
bionys-314	156	16	fig	fig	NOUN
bionys-314	156	17	.	.	PUNCT
bionys-314	157	1	7	7	NUM
bionys-314	157	2	)	)	PUNCT
bionys-314	157	3	.	.	PUNCT
bionys-314	158	1	measurement	measurement	NOUN
bionys-314	158	2	of	of	ADP
bionys-314	158	3	chlorophyll	chlorophyll	NOUN
bionys-314	158	4	a	a	DET
bionys-314	158	5	measurement	measurement	NOUN
bionys-314	158	6	of	of	ADP
bionys-314	158	7	chlorophyll	chlorophyll	NOUN
bionys-314	158	8	a	a	PRON
bionys-314	158	9	in	in	ADP
bionys-314	158	10	the	the	DET
bionys-314	158	11	2	2	NUM
bionys-314	158	12	clones	clone	NOUN
bionys-314	158	13	showed	show	VERB
bionys-314	158	14	that	that	SCONJ
bionys-314	158	15	in	in	ADP
bionys-314	158	16	clone	clone	NOUN
bionys-314	158	17	dn	dn	PROPN
bionys-314	158	18	levels	level	NOUN
bionys-314	158	19	of	of	ADP
bionys-314	158	20	chlorophyll	chlorophyll	NOUN
bionys-314	158	21	a	a	PRON
bionys-314	158	22	were	be	AUX
bionys-314	158	23	increased	increase	VERB
bionys-314	158	24	after	after	ADP
bionys-314	158	25	10	10	NUM
bionys-314	158	26	days	day	NOUN
bionys-314	158	27	of	of	ADP
bionys-314	158	28	drought	drought	NOUN
bionys-314	158	29	stress	stress	NOUN
bionys-314	158	30	,	,	PUNCT
bionys-314	158	31	whereas	whereas	SCONJ
bionys-314	158	32	significant	significant	ADJ
bionys-314	158	33	changes	change	NOUN
bionys-314	158	34	were	be	AUX
bionys-314	158	35	not	not	PART
bionys-314	158	36	observed	observe	VERB
bionys-314	158	37	in	in	ADP
bionys-314	158	38	clone	clone	NOUN
bionys-314	158	39	100	100	NUM
bionys-314	158	40	.	.	PUNCT
bionys-314	159	1	the	the	DET
bionys-314	159	2	amount	amount	NOUN
bionys-314	159	3	of	of	ADP
bionys-314	159	4	chlorophyll	chlorophyll	NOUN
bionys-314	159	5	a	a	PRON
bionys-314	159	6	in	in	ADP
bionys-314	159	7	clone	clone	NOUN
bionys-314	159	8	dn	dn	NOUN
bionys-314	159	9	was	be	AUX
bionys-314	159	10	significantly	significantly	ADV
bionys-314	159	11	greater	great	ADJ
bionys-314	159	12	than	than	ADP
bionys-314	159	13	in	in	ADP
bionys-314	159	14	clone	clone	NOUN
bionys-314	159	15	100	100	NUM
bionys-314	159	16	after	after	ADP
bionys-314	159	17	the	the	DET
bionys-314	159	18	10	10	NUM
bionys-314	159	19	day	day	NOUN
bionys-314	159	20	drought	drought	NOUN
bionys-314	159	21	treatment	treatment	NOUN
bionys-314	159	22	.	.	PUNCT
bionys-314	160	1	by	by	ADP
bionys-314	160	2	day	day	NOUN
bionys-314	160	3	17	17	NUM
bionys-314	160	4	,	,	PUNCT
bionys-314	160	5	i.e.	i.e.	X
bionys-314	160	6	,	,	PUNCT
bionys-314	160	7	after	after	ADP
bionys-314	160	8	7	7	NUM
bionys-314	160	9	days	day	NOUN
bionys-314	160	10	recovery	recovery	NOUN
bionys-314	160	11	,	,	PUNCT
bionys-314	160	12	the	the	DET
bionys-314	160	13	amount	amount	NOUN
bionys-314	160	14	of	of	ADP
bionys-314	160	15	chlorophyll	chlorophyll	NOUN
bionys-314	160	16	a	a	PRON
bionys-314	160	17	in	in	ADP
bionys-314	160	18	clone	clone	NOUN
bionys-314	160	19	dn	dn	NOUN
bionys-314	160	20	had	have	AUX
bionys-314	160	21	dropped	drop	VERB
bionys-314	160	22	dramatically	dramatically	ADV
bionys-314	160	23	and	and	CCONJ
bionys-314	160	24	the	the	DET
bionys-314	160	25	levels	level	NOUN
bionys-314	160	26	in	in	ADP
bionys-314	160	27	it	it	PRON
bionys-314	160	28	and	and	CCONJ
bionys-314	160	29	dn	dn	PROPN
bionys-314	160	30	were	be	AUX
bionys-314	160	31	not	not	PART
bionys-314	160	32	significantly	significantly	ADV
bionys-314	160	33	different	different	ADJ
bionys-314	160	34	(	(	PUNCT
bionys-314	160	35	fig	fig	NOUN
bionys-314	160	36	.	.	PUNCT
bionys-314	161	1	8)	8)	NUM
bionys-314	161	2	.	.	PUNCT
bionys-314	161	3	measurement	measurement	NOUN
bionys-314	161	4	of	of	ADP
bionys-314	161	5	total	total	ADJ
bionys-314	161	6	chlorophyll	chlorophyll	NOUN
bionys-314	161	7	measurement	measurement	NOUN
bionys-314	161	8	of	of	ADP
bionys-314	161	9	total	total	ADJ
bionys-314	161	10	chlorophyll	chlorophyll	NOUN
bionys-314	161	11	content	content	NOUN
bionys-314	161	12	from	from	ADP
bionys-314	161	13	the	the	DET
bionys-314	161	14	2	2	NUM
bionys-314	161	15	clones	clone	NOUN
bionys-314	161	16	indicated	indicate	VERB
bionys-314	161	17	that	that	SCONJ
bionys-314	161	18	chlorophyll	chlorophyll	NOUN
bionys-314	161	19	content	content	NOUN
bionys-314	161	20	in	in	ADP
bionys-314	161	21	clone	clone	NOUN
bionys-314	161	22	100	100	NUM
bionys-314	161	23	did	do	AUX
bionys-314	161	24	not	not	PART
bionys-314	161	25	vary	vary	VERB
bionys-314	161	26	throughout	throughout	ADP
bionys-314	161	27	the	the	DET
bionys-314	161	28	experiment	experiment	NOUN
bionys-314	161	29	.	.	PUNCT
bionys-314	162	1	although	although	SCONJ
bionys-314	162	2	total	total	ADJ
bionys-314	162	3	chlorophyll	chlorophyll	NOUN
bionys-314	162	4	content	content	NOUN
bionys-314	162	5	appeared	appear	VERB
bionys-314	162	6	higher	high	ADJ
bionys-314	162	7	at	at	ADP
bionys-314	162	8	day	day	NOUN
bionys-314	162	9	10	10	NUM
bionys-314	162	10	compared	compare	VERB
bionys-314	162	11	to	to	ADP
bionys-314	162	12	day	day	NOUN
bionys-314	162	13	0	0	NUM
bionys-314	162	14	,	,	PUNCT
bionys-314	162	15	these	these	DET
bionys-314	162	16	differences	difference	NOUN
bionys-314	162	17	were	be	AUX
bionys-314	162	18	not	not	PART
bionys-314	162	19	statistically	statistically	ADV
bionys-314	162	20	significant	significant	ADJ
bionys-314	162	21	.	.	PUNCT
bionys-314	163	1	however	however	ADV
bionys-314	163	2	,	,	PUNCT
bionys-314	163	3	there	there	PRON
bionys-314	163	4	were	be	VERB
bionys-314	163	5	significant	significant	ADJ
bionys-314	163	6	differences	difference	NOUN
bionys-314	163	7	in	in	ADP
bionys-314	163	8	clone	clone	NOUN
bionys-314	163	9	dn	dn	NOUN
bionys-314	163	10	after	after	ADP
bionys-314	163	11	the	the	DET
bionys-314	163	12	recovery	recovery	NOUN
bionys-314	163	13	period	period	NOUN
bionys-314	163	14	,	,	PUNCT
bionys-314	163	15	i.e.	i.e.	X
bionys-314	163	16	at	at	ADP
bionys-314	163	17	day	day	NOUN
bionys-314	163	18	17	17	NUM
bionys-314	163	19	compared	compare	VERB
bionys-314	163	20	to	to	ADP
bionys-314	163	21	day	day	NOUN
bionys-314	163	22	10	10	NUM
bionys-314	163	23	days	day	NOUN
bionys-314	163	24	and	and	CCONJ
bionys-314	163	25	the	the	DET
bionys-314	163	26	control	control	NOUN
bionys-314	163	27	(	(	PUNCT
bionys-314	163	28	fig	fig	NOUN
bionys-314	163	29	.	.	PUNCT
bionys-314	164	1	9	9	NUM
bionys-314	164	2	)	)	PUNCT
bionys-314	164	3	.	.	PUNCT
bionys-314	165	1	discussion	discussion	NOUN
bionys-314	165	2	many	many	ADJ
bionys-314	165	3	studies	study	NOUN
bionys-314	165	4	have	have	AUX
bionys-314	165	5	shown	show	VERB
bionys-314	165	6	that	that	SCONJ
bionys-314	165	7	in	in	ADP
bionys-314	165	8	photosynthetic	photosynthetic	ADJ
bionys-314	165	9	plants	plant	NOUN
bionys-314	165	10	there	there	PRON
bionys-314	165	11	is	be	VERB
bionys-314	165	12	a	a	DET
bionys-314	165	13	strong	strong	ADJ
bionys-314	165	14	relationship	relationship	NOUN
bionys-314	165	15	between	between	ADP
bionys-314	165	16	tolerance	tolerance	NOUN
bionys-314	165	17	to	to	PART
bionys-314	165	18	oxidative	oxidative	VERB
bionys-314	165	19	stress	stress	NOUN
bionys-314	165	20	induced	induce	VERB
bionys-314	165	21	by	by	ADP
bionys-314	165	22	environmental	environmental	ADJ
bionys-314	165	23	stresses	stress	NOUN
bionys-314	165	24	and	and	CCONJ
bionys-314	165	25	increasing	increase	VERB
bionys-314	165	26	concentrations	concentration	NOUN
bionys-314	165	27	of	of	ADP
bionys-314	165	28	antioxidant	antioxidant	ADJ
bionys-314	165	29	enzymes	enzyme	NOUN
bionys-314	165	30	(	(	PUNCT
bionys-314	165	31	sairam	sairam	PROPN
bionys-314	165	32	&	&	CCONJ
bionys-314	165	33	saxena	saxena	PROPN
bionys-314	165	34	,	,	PUNCT
bionys-314	165	35	2000	2000	NUM
bionys-314	165	36	;	;	PUNCT
bionys-314	165	37	sairam	sairam	PROPN
bionys-314	165	38	&	&	CCONJ
bionys-314	165	39	srivastava	srivastava	PROPN
bionys-314	165	40	,	,	PUNCT
bionys-314	165	41	2001	2001	NUM
bionys-314	165	42	)	)	PUNCT
bionys-314	165	43	.	.	PUNCT
bionys-314	166	1	researchers	researcher	NOUN
bionys-314	166	2	have	have	AUX
bionys-314	166	3	shown	show	VERB
bionys-314	166	4	that	that	SCONJ
bionys-314	166	5	the	the	DET
bionys-314	166	6	concentrations	concentration	NOUN
bionys-314	166	7	of	of	ADP
bionys-314	166	8	antioxidant	antioxidant	ADJ
bionys-314	166	9	enzymes	enzyme	NOUN
bionys-314	166	10	double	double	VERB
bionys-314	166	11	under	under	ADP
bionys-314	166	12	stress	stress	NOUN
bionys-314	166	13	,	,	PUNCT
bionys-314	166	14	resulting	result	VERB
bionys-314	166	15	,	,	PUNCT
bionys-314	166	16	in	in	ADP
bionys-314	166	17	particular	particular	ADJ
bionys-314	166	18	,	,	PUNCT
bionys-314	166	19	in	in	ADP
bionys-314	166	20	increased	increase	VERB
bionys-314	166	21	resistance	resistance	NOUN
bionys-314	166	22	fig	fig	NOUN
bionys-314	166	23	.	.	PUNCT
bionys-314	167	1	6	6	NUM
bionys-314	167	2	.	.	X
bionys-314	167	3	changes	change	NOUN
bionys-314	167	4	of	of	ADP
bionys-314	167	5	mda	mda	PROPN
bionys-314	167	6	content	content	NOUN
bionys-314	167	7	of	of	ADP
bionys-314	167	8	clones	clone	NOUN
bionys-314	167	9	100	100	NUM
bionys-314	167	10	and	and	CCONJ
bionys-314	167	11	dn	dn	VERB
bionys-314	167	12	in	in	ADP
bionys-314	167	13	treatments	treatment	NOUN
bionys-314	167	14	of	of	ADP
bionys-314	167	15	control	control	NOUN
bionys-314	167	16	(	(	PUNCT
bionys-314	167	17	0	0	NUM
bionys-314	167	18	)	)	PUNCT
bionys-314	167	19	,	,	PUNCT
bionys-314	167	20	10	10	NUM
bionys-314	167	21	days	day	NOUN
bionys-314	167	22	without	without	ADP
bionys-314	167	23	watering	watering	NOUN
bionys-314	167	24	(	(	PUNCT
bionys-314	167	25	10	10	NUM
bionys-314	167	26	)	)	PUNCT
bionys-314	167	27	and	and	CCONJ
bionys-314	167	28	treatments	treatment	NOUN
bionys-314	167	29	recovered	recover	VERB
bionys-314	167	30	with	with	ADP
bionys-314	167	31	re	re	NOUN
bionys-314	167	32	-	-	NOUN
bionys-314	167	33	irrigation	irrigation	NOUN
bionys-314	167	34	for	for	ADP
bionys-314	167	35	7	7	NUM
bionys-314	167	36	days	day	NOUN
bionys-314	167	37	(	(	PUNCT
bionys-314	167	38	17	17	NUM
bionys-314	167	39	)	)	PUNCT
bionys-314	167	40	.	.	PUNCT
bionys-314	168	1	data	datum	NOUN
bionys-314	168	2	is	be	AUX
bionys-314	168	3	average	average	ADJ
bionys-314	168	4	of	of	ADP
bionys-314	168	5	three	three	NUM
bionys-314	168	6	replicates	replicate	NOUN
bionys-314	168	7	±	±	NOUN
bionys-314	168	8	standard	standard	ADJ
bionys-314	168	9	error	error	NOUN
bionys-314	168	10	(	(	PUNCT
bionys-314	168	11	se	se	X
bionys-314	168	12	)	)	PUNCT
bionys-314	168	13	respectively	respectively	ADV
bionys-314	168	14	.	.	PUNCT
bionys-314	169	1	different	different	ADJ
bionys-314	169	2	letters	letter	NOUN
bionys-314	169	3	indicate	indicate	VERB
bionys-314	169	4	significant	significant	ADJ
bionys-314	169	5	differences	difference	NOUN
bionys-314	169	6	between	between	ADP
bionys-314	169	7	treatments	treatment	NOUN
bionys-314	169	8	according	accord	VERB
bionys-314	169	9	to	to	ADP
bionys-314	169	10	duncan	duncan	PROPN
bionys-314	169	11	’s	’s	PART
bionys-314	169	12	test	test	NOUN
bionys-314	169	13	and	and	CCONJ
bionys-314	169	14	with	with	ADP
bionys-314	169	15	p	p	NOUN
bionys-314	169	16	<	<	NOUN
bionys-314	169	17	0.05	0.05	NUM
bionys-314	169	18	.	.	PUNCT
bionys-314	169	19	fig	fig	NOUN
bionys-314	169	20	.	.	PUNCT
bionys-314	170	1	7	7	X
bionys-314	170	2	.	.	X
bionys-314	170	3	changes	change	NOUN
bionys-314	170	4	in	in	ADP
bionys-314	170	5	carotenoid	carotenoid	NOUN
bionys-314	170	6	content	content	NOUN
bionys-314	170	7	in	in	ADP
bionys-314	170	8	clones	clone	NOUN
bionys-314	170	9	100	100	NUM
bionys-314	170	10	and	and	CCONJ
bionys-314	170	11	dn	dn	VERB
bionys-314	170	12	in	in	ADP
bionys-314	170	13	treatments	treatment	NOUN
bionys-314	170	14	of	of	ADP
bionys-314	170	15	control	control	NOUN
bionys-314	170	16	(	(	PUNCT
bionys-314	170	17	0	0	NUM
bionys-314	170	18	)	)	PUNCT
bionys-314	170	19	,	,	PUNCT
bionys-314	170	20	10	10	NUM
bionys-314	170	21	days	day	NOUN
bionys-314	170	22	without	without	ADP
bionys-314	170	23	watering	watering	NOUN
bionys-314	170	24	(	(	PUNCT
bionys-314	170	25	10	10	NUM
bionys-314	170	26	)	)	PUNCT
bionys-314	170	27	and	and	CCONJ
bionys-314	170	28	treatments	treatment	NOUN
bionys-314	170	29	recovered	recover	VERB
bionys-314	170	30	with	with	ADP
bionys-314	170	31	re	re	NOUN
bionys-314	170	32	-	-	NOUN
bionys-314	170	33	irrigation	irrigation	NOUN
bionys-314	170	34	for	for	ADP
bionys-314	170	35	7	7	NUM
bionys-314	170	36	days	day	NOUN
bionys-314	170	37	(	(	PUNCT
bionys-314	170	38	17	17	NUM
bionys-314	170	39	)	)	PUNCT
bionys-314	170	40	.	.	PUNCT
bionys-314	171	1	data	datum	NOUN
bionys-314	171	2	is	be	AUX
bionys-314	171	3	average	average	ADJ
bionys-314	171	4	of	of	ADP
bionys-314	171	5	three	three	NUM
bionys-314	171	6	replicates	replicate	NOUN
bionys-314	171	7	±	±	NOUN
bionys-314	171	8	standard	standard	ADJ
bionys-314	171	9	error	error	NOUN
bionys-314	171	10	(	(	PUNCT
bionys-314	171	11	se	se	X
bionys-314	171	12	)	)	PUNCT
bionys-314	171	13	respectively	respectively	ADV
bionys-314	171	14	.	.	PUNCT
bionys-314	172	1	different	different	ADJ
bionys-314	172	2	letters	letter	NOUN
bionys-314	172	3	indicate	indicate	VERB
bionys-314	172	4	significant	significant	ADJ
bionys-314	172	5	differences	difference	NOUN
bionys-314	172	6	between	between	ADP
bionys-314	172	7	treatments	treatment	NOUN
bionys-314	172	8	according	accord	VERB
bionys-314	172	9	to	to	ADP
bionys-314	172	10	duncan	duncan	PROPN
bionys-314	172	11	’s	’s	PART
bionys-314	172	12	test	test	NOUN
bionys-314	172	13	with	with	ADP
bionys-314	172	14	p	p	NOUN
bionys-314	172	15	<	<	NOUN
bionys-314	172	16	0.05	0.05	NUM
bionys-314	172	17	.	.	PUNCT
bionys-314	172	18	fig	fig	NOUN
bionys-314	172	19	.	.	PUNCT
bionys-314	173	1	8	8	X
bionys-314	173	2	.	.	PUNCT
bionys-314	174	1	changes	change	NOUN
bionys-314	174	2	of	of	ADP
bionys-314	174	3	chlorophyll	chlorophyll	NOUN
bionys-314	174	4	a	a	DET
bionys-314	174	5	content	content	NOUN
bionys-314	174	6	in	in	ADP
bionys-314	174	7	clones	clone	NOUN
bionys-314	174	8	100	100	NUM
bionys-314	174	9	and	and	CCONJ
bionys-314	174	10	dn	dn	VERB
bionys-314	174	11	in	in	ADP
bionys-314	174	12	treatments	treatment	NOUN
bionys-314	174	13	of	of	ADP
bionys-314	174	14	control	control	NOUN
bionys-314	174	15	(	(	PUNCT
bionys-314	174	16	0	0	NUM
bionys-314	174	17	)	)	PUNCT
bionys-314	174	18	,	,	PUNCT
bionys-314	174	19	10	10	NUM
bionys-314	174	20	days	day	NOUN
bionys-314	174	21	without	without	ADP
bionys-314	174	22	watering	watering	NOUN
bionys-314	174	23	(	(	PUNCT
bionys-314	174	24	10	10	NUM
bionys-314	174	25	)	)	PUNCT
bionys-314	174	26	and	and	CCONJ
bionys-314	174	27	treatments	treatment	NOUN
bionys-314	174	28	recovered	recover	VERB
bionys-314	174	29	with	with	ADP
bionys-314	174	30	re	re	NOUN
bionys-314	174	31	-	-	NOUN
bionys-314	174	32	irrigation	irrigation	NOUN
bionys-314	174	33	for	for	ADP
bionys-314	174	34	7	7	NUM
bionys-314	174	35	days	day	NOUN
bionys-314	174	36	(	(	PUNCT
bionys-314	174	37	17	17	NUM
bionys-314	174	38	)	)	PUNCT
bionys-314	174	39	.	.	PUNCT
bionys-314	175	1	data	datum	NOUN
bionys-314	175	2	is	be	AUX
bionys-314	175	3	average	average	ADJ
bionys-314	175	4	of	of	ADP
bionys-314	175	5	three	three	NUM
bionys-314	175	6	replicates	replicate	NOUN
bionys-314	175	7	±	±	NOUN
bionys-314	175	8	standard	standard	ADJ
bionys-314	175	9	error	error	NOUN
bionys-314	175	10	(	(	PUNCT
bionys-314	175	11	se	se	X
bionys-314	175	12	)	)	PUNCT
bionys-314	175	13	respectively	respectively	ADV
bionys-314	175	14	.	.	PUNCT
bionys-314	176	1	different	different	ADJ
bionys-314	176	2	letters	letter	NOUN
bionys-314	176	3	indicate	indicate	VERB
bionys-314	176	4	significant	significant	ADJ
bionys-314	176	5	differences	difference	NOUN
bionys-314	176	6	between	between	ADP
bionys-314	176	7	treatments	treatment	NOUN
bionys-314	176	8	according	accord	VERB
bionys-314	176	9	to	to	ADP
bionys-314	176	10	duncan	duncan	PROPN
bionys-314	176	11	’s	’s	PART
bionys-314	176	12	test	test	NOUN
bionys-314	176	13	with	with	ADP
bionys-314	176	14	p	p	NOUN
bionys-314	176	15	<	<	NOUN
bionys-314	176	16	0.05	0.05	NUM
bionys-314	176	17	.	.	PUNCT
bionys-314	177	1	biologica	biologica	PROPN
bionys-314	177	2	nyssana	nyssana	PROPN
bionys-314	177	3	●	●	PUNCT
bionys-314	177	4	11	11	NUM
bionys-314	177	5	(	(	PUNCT
bionys-314	177	6	1	1	NUM
bionys-314	177	7	)	)	PUNCT
bionys-314	177	8	september	september	PROPN
bionys-314	177	9	2020	2020	NUM
bionys-314	177	10	:	:	PUNCT
bionys-314	177	11	45	45	NUM
bionys-314	177	12	-	-	SYM
bionys-314	177	13	54	54	NUM
bionys-314	177	14	mohammadi	mohammadi	NOUN
bionys-314	177	15	et	et	PROPN
bionys-314	177	16	al	al	PROPN
bionys-314	177	17	.	.	PUNCT
bionys-314	178	1	●	●	PUNCT
bionys-314	178	2	a	a	DET
bionys-314	178	3	real	real	ADJ
bionys-314	178	4	-	-	PUNCT
bionys-314	178	5	time	time	NOUN
bionys-314	178	6	pcr	pcr	NOUN
bionys-314	178	7	assay	assay	NOUN
bionys-314	178	8	for	for	ADP
bionys-314	178	9	evaluation	evaluation	NOUN
bionys-314	178	10	of	of	ADP
bionys-314	178	11	drought	drought	NOUN
bionys-314	178	12	tolerance	tolerance	NOUN
bionys-314	178	13	in	in	ADP
bionys-314	178	14	a	a	DET
bionys-314	178	15	new	new	ADJ
bionys-314	178	16	tea	tea	NOUN
bionys-314	178	17	clone	clone	NOUN
bionys-314	178	18	51	51	NUM
bionys-314	178	19	to	to	PART
bionys-314	178	20	oxidative	oxidative	ADJ
bionys-314	178	21	stress	stress	NOUN
bionys-314	178	22	.	.	PUNCT
bionys-314	179	1	drought	drought	NOUN
bionys-314	179	2	stress	stress	NOUN
bionys-314	179	3	increases	increase	VERB
bionys-314	179	4	the	the	DET
bionys-314	179	5	activity	activity	NOUN
bionys-314	179	6	of	of	ADP
bionys-314	179	7	glutathione	glutathione	NOUN
bionys-314	179	8	reductase	reductase	NOUN
bionys-314	179	9	and	and	CCONJ
bionys-314	179	10	sod	sod	NOUN
bionys-314	179	11	especially	especially	ADV
bionys-314	179	12	(	(	PUNCT
bionys-314	179	13	gamble	gamble	NOUN
bionys-314	179	14	&	&	CCONJ
bionys-314	179	15	burke	burke	PROPN
bionys-314	179	16	,	,	PUNCT
bionys-314	179	17	1984	1984	NUM
bionys-314	179	18	;	;	PUNCT
bionys-314	179	19	lascano	lascano	PROPN
bionys-314	179	20	et	et	PROPN
bionys-314	179	21	al	al	PROPN
bionys-314	179	22	.	.	PROPN
bionys-314	179	23	,	,	PUNCT
bionys-314	179	24	2001	2001	NUM
bionys-314	179	25	)	)	PUNCT
bionys-314	179	26	.	.	PUNCT
bionys-314	180	1	this	this	PRON
bionys-314	180	2	is	be	AUX
bionys-314	180	3	not	not	PART
bionys-314	180	4	to	to	PART
bionys-314	180	5	say	say	VERB
bionys-314	180	6	that	that	SCONJ
bionys-314	180	7	all	all	DET
bionys-314	180	8	cultivars	cultivar	NOUN
bionys-314	180	9	of	of	ADP
bionys-314	180	10	a	a	DET
bionys-314	180	11	particular	particular	ADJ
bionys-314	180	12	species	specie	NOUN
bionys-314	180	13	are	be	AUX
bionys-314	180	14	stressed	stress	VERB
bionys-314	180	15	to	to	ADP
bionys-314	180	16	the	the	DET
bionys-314	180	17	same	same	ADJ
bionys-314	180	18	degree	degree	NOUN
bionys-314	180	19	by	by	ADP
bionys-314	180	20	drought	drought	NOUN
bionys-314	180	21	conditions	condition	NOUN
bionys-314	180	22	.	.	PUNCT
bionys-314	181	1	in	in	ADP
bionys-314	181	2	the	the	DET
bionys-314	181	3	present	present	ADJ
bionys-314	181	4	study	study	NOUN
bionys-314	181	5	,	,	PUNCT
bionys-314	181	6	a	a	DET
bionys-314	181	7	significant	significant	ADJ
bionys-314	181	8	increase	increase	NOUN
bionys-314	181	9	was	be	AUX
bionys-314	181	10	observed	observe	VERB
bionys-314	181	11	in	in	ADP
bionys-314	181	12	mn	mn	PROPN
bionys-314	181	13	-	-	ADJ
bionys-314	181	14	sod	sod	NOUN
bionys-314	181	15	gene	gene	NOUN
bionys-314	181	16	expression	expression	NOUN
bionys-314	181	17	in	in	ADP
bionys-314	181	18	clone	clone	NOUN
bionys-314	181	19	dn	dn	NOUN
bionys-314	181	20	during	during	ADP
bionys-314	181	21	10	10	NUM
bionys-314	181	22	days	day	NOUN
bionys-314	181	23	of	of	ADP
bionys-314	181	24	drought	drought	NOUN
bionys-314	181	25	treatment	treatment	NOUN
bionys-314	181	26	,	,	PUNCT
bionys-314	181	27	while	while	SCONJ
bionys-314	181	28	no	no	DET
bionys-314	181	29	significant	significant	ADJ
bionys-314	181	30	increase	increase	NOUN
bionys-314	181	31	in	in	ADP
bionys-314	181	32	the	the	DET
bionys-314	181	33	expression	expression	NOUN
bionys-314	181	34	of	of	ADP
bionys-314	181	35	this	this	DET
bionys-314	181	36	gene	gene	NOUN
bionys-314	181	37	was	be	AUX
bionys-314	181	38	found	find	VERB
bionys-314	181	39	in	in	ADP
bionys-314	181	40	clone	clone	NOUN
bionys-314	181	41	100	100	NUM
bionys-314	181	42	.	.	PUNCT
bionys-314	182	1	this	this	PRON
bionys-314	182	2	correlated	correlate	VERB
bionys-314	182	3	well	well	ADV
bionys-314	182	4	with	with	SCONJ
bionys-314	182	5	the	the	DET
bionys-314	182	6	other	other	ADJ
bionys-314	182	7	physiological	physiological	ADJ
bionys-314	182	8	parameters	parameter	NOUN
bionys-314	182	9	assayed	assayed	ADJ
bionys-314	182	10	and	and	CCONJ
bionys-314	182	11	reflected	reflect	VERB
bionys-314	182	12	clone	clone	NOUN
bionys-314	182	13	100	100	NUM
bionys-314	182	14	’s	’s	PART
bionys-314	182	15	greater	great	ADJ
bionys-314	182	16	resistance	resistance	NOUN
bionys-314	182	17	to	to	ADP
bionys-314	182	18	drought	drought	NOUN
bionys-314	182	19	in	in	ADP
bionys-314	182	20	the	the	DET
bionys-314	182	21	first	first	ADJ
bionys-314	182	22	place	place	NOUN
bionys-314	182	23	.	.	PUNCT
bionys-314	183	1	clone	clone	NOUN
bionys-314	183	2	dn	dn	PROPN
bionys-314	183	3	activates	activate	VERB
bionys-314	183	4	resistant	resistant	ADJ
bionys-314	183	5	mechanisms	mechanism	NOUN
bionys-314	183	6	against	against	ADP
bionys-314	183	7	oxidative	oxidative	ADJ
bionys-314	183	8	stress	stress	NOUN
bionys-314	183	9	caused	cause	VERB
bionys-314	183	10	by	by	ADP
bionys-314	183	11	drought	drought	NOUN
bionys-314	183	12	by	by	ADP
bionys-314	183	13	increasing	increase	VERB
bionys-314	183	14	the	the	DET
bionys-314	183	15	expression	expression	NOUN
bionys-314	183	16	of	of	ADP
bionys-314	183	17	mn	mn	PROPN
bionys-314	183	18	-	-	NOUN
bionys-314	183	19	sod	sod	NOUN
bionys-314	183	20	because	because	SCONJ
bionys-314	183	21	it	it	PRON
bionys-314	183	22	was	be	AUX
bionys-314	183	23	more	more	ADV
bionys-314	183	24	greatly	greatly	ADV
bionys-314	183	25	stressed	stress	VERB
bionys-314	183	26	by	by	ADP
bionys-314	183	27	the	the	DET
bionys-314	183	28	drought	drought	NOUN
bionys-314	183	29	conditions	condition	NOUN
bionys-314	183	30	.	.	PUNCT
bionys-314	184	1	malondialdehyde	malondialdehyde	PROPN
bionys-314	184	2	content	content	PROPN
bionys-314	184	3	rose	rise	VERB
bionys-314	184	4	,	,	PUNCT
bionys-314	184	5	also	also	ADV
bionys-314	184	6	,	,	PUNCT
bionys-314	184	7	in	in	ADP
bionys-314	184	8	only	only	ADV
bionys-314	184	9	clone	clone	NOUN
bionys-314	184	10	dn	dn	NOUN
bionys-314	184	11	and	and	CCONJ
bionys-314	184	12	not	not	PART
bionys-314	184	13	in	in	ADP
bionys-314	184	14	clone	clone	NOUN
bionys-314	184	15	100	100	NUM
bionys-314	184	16	.	.	PUNCT
bionys-314	185	1	increases	increase	NOUN
bionys-314	185	2	in	in	ADP
bionys-314	185	3	this	this	DET
bionys-314	185	4	product	product	NOUN
bionys-314	185	5	represent	represent	VERB
bionys-314	185	6	an	an	DET
bionys-314	185	7	increase	increase	NOUN
bionys-314	185	8	in	in	ADP
bionys-314	185	9	lipid	lipid	NOUN
bionys-314	185	10	peroxidation	peroxidation	NOUN
bionys-314	185	11	due	due	ADP
bionys-314	185	12	to	to	ADP
bionys-314	185	13	ros	ros	PROPN
bionys-314	185	14	production	production	NOUN
bionys-314	185	15	and	and	CCONJ
bionys-314	185	16	there	there	PRON
bionys-314	185	17	is	be	VERB
bionys-314	185	18	a	a	DET
bionys-314	185	19	positive	positive	ADJ
bionys-314	185	20	correlation	correlation	NOUN
bionys-314	185	21	(	(	PUNCT
bionys-314	185	22	r2=0.66	r2=0.66	NOUN
bionys-314	185	23	)	)	PUNCT
bionys-314	185	24	between	between	ADP
bionys-314	185	25	the	the	DET
bionys-314	185	26	amount	amount	NOUN
bionys-314	185	27	of	of	ADP
bionys-314	185	28	malondialdehyde	malondialdehyde	NOUN
bionys-314	185	29	and	and	CCONJ
bionys-314	185	30	sod	sod	NOUN
bionys-314	185	31	gene	gene	NOUN
bionys-314	185	32	expression	expression	NOUN
bionys-314	185	33	.	.	PUNCT
bionys-314	186	1	it	it	PRON
bionys-314	186	2	can	can	AUX
bionys-314	186	3	be	be	AUX
bionys-314	186	4	said	say	VERB
bionys-314	186	5	,	,	PUNCT
bionys-314	186	6	therefore	therefore	ADV
bionys-314	186	7	,	,	PUNCT
bionys-314	186	8	that	that	SCONJ
bionys-314	186	9	sod	sod	NOUN
bionys-314	186	10	gene	gene	NOUN
bionys-314	186	11	expression	expression	NOUN
bionys-314	186	12	in	in	ADP
bionys-314	186	13	clone	clone	NOUN
bionys-314	186	14	dn	dn	PROPN
bionys-314	186	15	was	be	AUX
bionys-314	186	16	increased	increase	VERB
bionys-314	186	17	to	to	PART
bionys-314	186	18	mitigate	mitigate	VERB
bionys-314	186	19	the	the	DET
bionys-314	186	20	effects	effect	NOUN
bionys-314	186	21	of	of	ADP
bionys-314	186	22	generated	generate	VERB
bionys-314	186	23	ros	ros	PROPN
bionys-314	186	24	.	.	PUNCT
bionys-314	187	1	again	again	ADV
bionys-314	187	2	,	,	PUNCT
bionys-314	187	3	neither	neither	CCONJ
bionys-314	187	4	mda	mda	PROPN
bionys-314	187	5	content	content	NOUN
bionys-314	187	6	nor	nor	CCONJ
bionys-314	187	7	sod	sod	NOUN
bionys-314	187	8	gene	gene	NOUN
bionys-314	187	9	expression	expression	NOUN
bionys-314	187	10	were	be	AUX
bionys-314	187	11	significantly	significantly	ADV
bionys-314	187	12	increased	increase	VERB
bionys-314	187	13	in	in	ADP
bionys-314	187	14	clone	clone	NOUN
bionys-314	187	15	100	100	NUM
bionys-314	187	16	,	,	PUNCT
bionys-314	187	17	indicating	indicate	VERB
bionys-314	187	18	that	that	SCONJ
bionys-314	187	19	a	a	DET
bionys-314	187	20	lower	low	ADJ
bionys-314	187	21	level	level	NOUN
bionys-314	187	22	of	of	ADP
bionys-314	187	23	cellular	cellular	ADJ
bionys-314	187	24	stress	stress	NOUN
bionys-314	187	25	was	be	AUX
bionys-314	187	26	induced	induce	VERB
bionys-314	187	27	by	by	ADP
bionys-314	187	28	drought	drought	NOUN
bionys-314	187	29	conditions	condition	NOUN
bionys-314	187	30	in	in	ADP
bionys-314	187	31	this	this	DET
bionys-314	187	32	cultivar	cultivar	NOUN
bionys-314	187	33	.	.	PUNCT
bionys-314	188	1	on	on	ADP
bionys-314	188	2	the	the	DET
bionys-314	188	3	other	other	ADJ
bionys-314	188	4	hand	hand	NOUN
bionys-314	188	5	,	,	PUNCT
bionys-314	188	6	appropriate	appropriate	ADJ
bionys-314	188	7	conditions	condition	NOUN
bionys-314	188	8	are	be	AUX
bionys-314	188	9	provided	provide	VERB
bionys-314	188	10	for	for	ADP
bionys-314	188	11	the	the	DET
bionys-314	188	12	growth	growth	NOUN
bionys-314	188	13	of	of	ADP
bionys-314	188	14	clones	clone	NOUN
bionys-314	188	15	with	with	ADP
bionys-314	188	16	re	re	NOUN
bionys-314	188	17	-	-	NOUN
bionys-314	188	18	watering	watering	NOUN
bionys-314	188	19	,	,	PUNCT
bionys-314	188	20	which	which	PRON
bionys-314	188	21	is	be	AUX
bionys-314	188	22	accompanied	accompany	VERB
bionys-314	188	23	by	by	ADP
bionys-314	188	24	reduced	reduced	ADJ
bionys-314	188	25	expression	expression	NOUN
bionys-314	188	26	of	of	ADP
bionys-314	188	27	the	the	DET
bionys-314	188	28	sod	sod	NOUN
bionys-314	188	29	gene	gene	NOUN
bionys-314	188	30	in	in	ADP
bionys-314	188	31	clone	clone	NOUN
bionys-314	188	32	dn	dn	PROPN
bionys-314	188	33	,	,	PUNCT
bionys-314	188	34	indicating	indicate	VERB
bionys-314	188	35	a	a	DET
bionys-314	188	36	reduction	reduction	NOUN
bionys-314	188	37	in	in	ADP
bionys-314	188	38	oxidative	oxidative	ADJ
bionys-314	188	39	stress	stress	NOUN
bionys-314	188	40	in	in	ADP
bionys-314	188	41	this	this	DET
bionys-314	188	42	clone	clone	NOUN
bionys-314	188	43	.	.	PUNCT
bionys-314	189	1	ten	ten	NUM
bionys-314	189	2	days	day	NOUN
bionys-314	189	3	of	of	ADP
bionys-314	189	4	drought	drought	NOUN
bionys-314	189	5	applied	apply	VERB
bionys-314	189	6	to	to	ADP
bionys-314	189	7	clone	clone	NOUN
bionys-314	189	8	100	100	NUM
bionys-314	189	9	did	do	AUX
bionys-314	189	10	not	not	PART
bionys-314	189	11	result	result	VERB
bionys-314	189	12	in	in	ADP
bionys-314	189	13	considerable	considerable	ADJ
bionys-314	189	14	stress	stress	NOUN
bionys-314	189	15	responses	response	NOUN
bionys-314	189	16	involving	involve	VERB
bionys-314	189	17	a	a	DET
bionys-314	189	18	significant	significant	ADJ
bionys-314	189	19	stimulation	stimulation	NOUN
bionys-314	189	20	of	of	ADP
bionys-314	189	21	the	the	DET
bionys-314	189	22	antioxidant	antioxidant	ADJ
bionys-314	189	23	defense	defense	NOUN
bionys-314	189	24	system	system	NOUN
bionys-314	189	25	.	.	PUNCT
bionys-314	190	1	many	many	ADJ
bionys-314	190	2	reports	report	NOUN
bionys-314	190	3	are	be	AUX
bionys-314	190	4	indicating	indicate	VERB
bionys-314	190	5	mn	mn	PROPN
bionys-314	190	6	-	-	ADJ
bionys-314	190	7	sod	sod	NOUN
bionys-314	190	8	expression	expression	NOUN
bionys-314	190	9	and	and	CCONJ
bionys-314	190	10	activity	activity	NOUN
bionys-314	190	11	increases	increase	NOUN
bionys-314	190	12	during	during	ADP
bionys-314	190	13	stress	stress	NOUN
bionys-314	190	14	(	(	PUNCT
bionys-314	190	15	shah	shah	NOUN
bionys-314	190	16	&	&	CCONJ
bionys-314	190	17	nahakpam	nahakpam	PROPN
bionys-314	190	18	,	,	PUNCT
bionys-314	190	19	2012	2012	NUM
bionys-314	190	20	)	)	PUNCT
bionys-314	190	21	.	.	PUNCT
bionys-314	191	1	for	for	ADP
bionys-314	191	2	example	example	NOUN
bionys-314	191	3	,	,	PUNCT
bionys-314	191	4	increased	increase	VERB
bionys-314	191	5	resistance	resistance	NOUN
bionys-314	191	6	to	to	ADP
bionys-314	191	7	cold	cold	ADJ
bionys-314	191	8	stress	stress	NOUN
bionys-314	191	9	was	be	AUX
bionys-314	191	10	correlated	correlate	VERB
bionys-314	191	11	with	with	ADP
bionys-314	191	12	a	a	DET
bionys-314	191	13	simultaneous	simultaneous	ADJ
bionys-314	191	14	increase	increase	NOUN
bionys-314	191	15	in	in	ADP
bionys-314	191	16	the	the	DET
bionys-314	191	17	expression	expression	NOUN
bionys-314	191	18	of	of	ADP
bionys-314	191	19	mn	mn	PROPN
bionys-314	191	20	-	-	NOUN
bionys-314	191	21	sod	sod	NOUN
bionys-314	191	22	in	in	ADP
bionys-314	191	23	chlorella	chlorella	NOUN
bionys-314	191	24	ellipsoidea	ellipsoidea	NOUN
bionys-314	191	25	(	(	PUNCT
bionys-314	191	26	clare	clare	NOUN
bionys-314	191	27	et	et	PROPN
bionys-314	191	28	al	al	PROPN
bionys-314	191	29	.	.	PROPN
bionys-314	191	30	,	,	PUNCT
bionys-314	191	31	1984	1984	NUM
bionys-314	191	32	)	)	PUNCT
bionys-314	191	33	.	.	PUNCT
bionys-314	192	1	similarly	similarly	ADV
bionys-314	192	2	,	,	PUNCT
bionys-314	192	3	transformation	transformation	NOUN
bionys-314	192	4	of	of	ADP
bionys-314	192	5	wheat	wheat	NOUN
bionys-314	192	6	plants	plant	NOUN
bionys-314	192	7	with	with	ADP
bionys-314	192	8	the	the	DET
bionys-314	192	9	mn	mn	PROPN
bionys-314	192	10	-	-	PUNCT
bionys-314	192	11	sod	sod	NOUN
bionys-314	192	12	gene	gene	NOUN
bionys-314	192	13	from	from	ADP
bionys-314	192	14	brassica	brassica	NOUN
bionys-314	192	15	species	specie	NOUN
bionys-314	192	16	and	and	CCONJ
bionys-314	192	17	its	its	PRON
bionys-314	192	18	overexpression	overexpression	NOUN
bionys-314	192	19	increased	increase	VERB
bionys-314	192	20	resistance	resistance	NOUN
bionys-314	192	21	to	to	ADP
bionys-314	192	22	oxidative	oxidative	ADJ
bionys-314	192	23	stress	stress	NOUN
bionys-314	192	24	and	and	CCONJ
bionys-314	192	25	aluminum	aluminum	NOUN
bionys-314	192	26	toxicity	toxicity	NOUN
bionys-314	192	27	(	(	PUNCT
bionys-314	192	28	gachon	gachon	PROPN
bionys-314	192	29	et	et	PROPN
bionys-314	192	30	al	al	PROPN
bionys-314	192	31	.	.	PROPN
bionys-314	192	32	,	,	PUNCT
bionys-314	192	33	2004	2004	NUM
bionys-314	192	34	)	)	PUNCT
bionys-314	192	35	in	in	ADP
bionys-314	192	36	the	the	DET
bionys-314	192	37	transgenic	transgenic	NOUN
bionys-314	192	38	wheat	wheat	NOUN
bionys-314	192	39	.	.	PUNCT
bionys-314	193	1	this	this	DET
bionys-314	193	2	method	method	NOUN
bionys-314	193	3	to	to	PART
bionys-314	193	4	increase	increase	VERB
bionys-314	193	5	sod	sod	NOUN
bionys-314	193	6	activity	activity	NOUN
bionys-314	193	7	has	have	AUX
bionys-314	193	8	also	also	ADV
bionys-314	193	9	been	be	AUX
bionys-314	193	10	reported	report	VERB
bionys-314	193	11	in	in	ADP
bionys-314	193	12	a	a	DET
bionys-314	193	13	study	study	NOUN
bionys-314	193	14	by	by	ADP
bionys-314	193	15	bowler	bowler	NOUN
bionys-314	193	16	et	et	PROPN
bionys-314	193	17	al	al	PROPN
bionys-314	193	18	.	.	PROPN
bionys-314	194	1	(	(	PUNCT
bionys-314	194	2	1992	1992	NUM
bionys-314	194	3	)	)	PUNCT
bionys-314	194	4	.	.	PUNCT
bionys-314	195	1	they	they	PRON
bionys-314	195	2	found	find	VERB
bionys-314	195	3	that	that	SCONJ
bionys-314	195	4	transformation	transformation	NOUN
bionys-314	195	5	of	of	ADP
bionys-314	195	6	maize	maize	NOUN
bionys-314	195	7	chloroplasts	chloroplast	NOUN
bionys-314	195	8	with	with	ADP
bionys-314	195	9	the	the	DET
bionys-314	195	10	tobacco	tobacco	NOUN
bionys-314	195	11	mn	mn	PROPN
bionys-314	195	12	-	-	PUNCT
bionys-314	195	13	sod	sod	NOUN
bionys-314	195	14	gene	gene	NOUN
bionys-314	195	15	enhanced	enhance	VERB
bionys-314	195	16	cold	cold	ADJ
bionys-314	195	17	tolerance	tolerance	NOUN
bionys-314	195	18	.	.	PUNCT
bionys-314	196	1	also	also	ADV
bionys-314	196	2	,	,	PUNCT
bionys-314	196	3	increased	increase	VERB
bionys-314	196	4	expression	expression	NOUN
bionys-314	196	5	of	of	ADP
bionys-314	196	6	mn	mn	PROPN
bionys-314	196	7	-	-	NOUN
bionys-314	196	8	sod	sod	NOUN
bionys-314	196	9	in	in	ADP
bionys-314	196	10	tobacco	tobacco	NOUN
bionys-314	196	11	considerably	considerably	ADV
bionys-314	196	12	enhances	enhance	VERB
bionys-314	196	13	resistance	resistance	NOUN
bionys-314	196	14	against	against	ADP
bionys-314	196	15	oxidative	oxidative	ADJ
bionys-314	196	16	stress	stress	NOUN
bionys-314	196	17	.	.	PUNCT
bionys-314	197	1	in	in	ADP
bionys-314	197	2	studies	study	NOUN
bionys-314	197	3	conducted	conduct	VERB
bionys-314	197	4	by	by	ADP
bionys-314	197	5	upadhyaya	upadhyaya	PROPN
bionys-314	197	6	et	et	PROPN
bionys-314	197	7	al	al	PROPN
bionys-314	197	8	.	.	PUNCT
bionys-314	198	1	(	(	PUNCT
bionys-314	198	2	2008	2008	NUM
bionys-314	198	3	)	)	PUNCT
bionys-314	199	1	,	,	PUNCT
bionys-314	199	2	performed	perform	VERB
bionys-314	199	3	on	on	ADP
bionys-314	199	4	4	4	NUM
bionys-314	199	5	tea	tea	NOUN
bionys-314	199	6	clones	clone	NOUN
bionys-314	199	7	,	,	PUNCT
bionys-314	199	8	a	a	DET
bionys-314	199	9	decrease	decrease	NOUN
bionys-314	199	10	in	in	ADP
bionys-314	199	11	sod	sod	NOUN
bionys-314	199	12	activity	activity	NOUN
bionys-314	199	13	occurred	occur	VERB
bionys-314	199	14	during	during	ADP
bionys-314	199	15	10	10	NUM
bionys-314	199	16	days	day	NOUN
bionys-314	199	17	drought	drought	NOUN
bionys-314	199	18	stress	stress	NOUN
bionys-314	199	19	in	in	ADP
bionys-314	199	20	clone	clone	NOUN
bionys-314	199	21	tv	tv	NOUN
bionys-314	199	22	1	1	NUM
bionys-314	199	23	that	that	PRON
bionys-314	199	24	is	be	AUX
bionys-314	199	25	resistant	resistant	ADJ
bionys-314	199	26	to	to	ADP
bionys-314	199	27	water	water	NOUN
bionys-314	199	28	stress	stress	NOUN
bionys-314	199	29	,	,	PUNCT
bionys-314	199	30	while	while	SCONJ
bionys-314	199	31	an	an	DET
bionys-314	199	32	increase	increase	NOUN
bionys-314	199	33	in	in	ADP
bionys-314	199	34	activity	activity	NOUN
bionys-314	199	35	was	be	AUX
bionys-314	199	36	seen	see	VERB
bionys-314	199	37	in	in	ADP
bionys-314	199	38	the	the	DET
bionys-314	199	39	sensitive	sensitive	ADJ
bionys-314	199	40	clone	clone	NOUN
bionys-314	199	41	tv	tv	NOUN
bionys-314	199	42	20	20	NUM
bionys-314	199	43	.	.	PUNCT
bionys-314	200	1	rwc	rwc	NOUN
bionys-314	200	2	is	be	AUX
bionys-314	200	3	a	a	DET
bionys-314	200	4	very	very	ADV
bionys-314	200	5	important	important	ADJ
bionys-314	200	6	index	index	NOUN
bionys-314	200	7	of	of	ADP
bionys-314	200	8	plant	plant	NOUN
bionys-314	200	9	water	water	NOUN
bionys-314	200	10	status	status	NOUN
bionys-314	200	11	and	and	CCONJ
bionys-314	200	12	dehydration	dehydration	NOUN
bionys-314	200	13	tolerance	tolerance	NOUN
bionys-314	200	14	,	,	PUNCT
bionys-314	200	15	and	and	CCONJ
bionys-314	200	16	consequently	consequently	ADV
bionys-314	200	17	reflects	reflect	VERB
bionys-314	200	18	the	the	DET
bionys-314	200	19	activity	activity	NOUN
bionys-314	200	20	of	of	ADP
bionys-314	200	21	metabolites	metabolite	NOUN
bionys-314	200	22	in	in	ADP
bionys-314	200	23	the	the	DET
bionys-314	200	24	tissue	tissue	NOUN
bionys-314	200	25	.	.	PUNCT
bionys-314	201	1	rwc	rwc	NOUN
bionys-314	201	2	is	be	AUX
bionys-314	201	3	at	at	ADP
bionys-314	201	4	its	its	PRON
bionys-314	201	5	highest	high	ADJ
bionys-314	201	6	level	level	NOUN
bionys-314	201	7	in	in	ADP
bionys-314	201	8	the	the	DET
bionys-314	201	9	early	early	ADJ
bionys-314	201	10	stages	stage	NOUN
bionys-314	201	11	of	of	ADP
bionys-314	201	12	leaf	leaf	NOUN
bionys-314	201	13	development	development	NOUN
bionys-314	201	14	and	and	CCONJ
bionys-314	201	15	decreases	decrease	NOUN
bionys-314	201	16	with	with	ADP
bionys-314	201	17	increasing	increase	VERB
bionys-314	201	18	leaf	leaf	NOUN
bionys-314	201	19	dry	dry	ADJ
bionys-314	201	20	matter	matter	NOUN
bionys-314	201	21	and	and	CCONJ
bionys-314	201	22	maturation	maturation	NOUN
bionys-314	201	23	.	.	PUNCT
bionys-314	202	1	this	this	DET
bionys-314	202	2	physiological	physiological	ADJ
bionys-314	202	3	parameter	parameter	NOUN
bionys-314	202	4	has	have	VERB
bionys-314	202	5	a	a	DET
bionys-314	202	6	direct	direct	ADJ
bionys-314	202	7	relationship	relationship	NOUN
bionys-314	202	8	with	with	ADP
bionys-314	202	9	water	water	NOUN
bionys-314	202	10	uptake	uptake	NOUN
bionys-314	202	11	of	of	ADP
bionys-314	202	12	root	root	NOUN
bionys-314	202	13	and	and	CCONJ
bionys-314	202	14	loss	loss	NOUN
bionys-314	202	15	of	of	ADP
bionys-314	202	16	water	water	NOUN
bionys-314	202	17	through	through	ADP
bionys-314	202	18	respiration	respiration	NOUN
bionys-314	202	19	(	(	PUNCT
bionys-314	202	20	anjum	anjum	PROPN
bionys-314	202	21	et	et	PROPN
bionys-314	202	22	al	al	PROPN
bionys-314	202	23	.	.	PROPN
bionys-314	202	24	,	,	PUNCT
bionys-314	202	25	2011	2011	NUM
bionys-314	202	26	)	)	PUNCT
bionys-314	202	27	.	.	PUNCT
bionys-314	203	1	different	different	ADJ
bionys-314	203	2	cultivars	cultivar	NOUN
bionys-314	203	3	show	show	VERB
bionys-314	203	4	different	different	ADJ
bionys-314	203	5	levels	level	NOUN
bionys-314	203	6	of	of	ADP
bionys-314	203	7	rwc	rwc	NOUN
bionys-314	203	8	,	,	PUNCT
bionys-314	203	9	depending	depend	VERB
bionys-314	203	10	on	on	ADP
bionys-314	203	11	duration	duration	NOUN
bionys-314	203	12	of	of	ADP
bionys-314	203	13	stress	stress	NOUN
bionys-314	203	14	and	and	CCONJ
bionys-314	203	15	ability	ability	NOUN
bionys-314	203	16	of	of	ADP
bionys-314	203	17	the	the	DET
bionys-314	203	18	genotypes	genotype	NOUN
bionys-314	203	19	to	to	PART
bionys-314	203	20	maintain	maintain	VERB
bionys-314	203	21	osmotic	osmotic	ADJ
bionys-314	203	22	potential	potential	NOUN
bionys-314	203	23	in	in	ADP
bionys-314	203	24	drought	drought	NOUN
bionys-314	203	25	conditions	condition	NOUN
bionys-314	203	26	at	at	ADP
bionys-314	203	27	different	different	ADJ
bionys-314	203	28	stages	stage	NOUN
bionys-314	203	29	of	of	ADP
bionys-314	203	30	development	development	NOUN
bionys-314	203	31	(	(	PUNCT
bionys-314	203	32	siddique	siddique	X
bionys-314	203	33	et	et	PROPN
bionys-314	203	34	al	al	PROPN
bionys-314	203	35	.	.	PROPN
bionys-314	203	36	,	,	PUNCT
bionys-314	203	37	2000	2000	NUM
bionys-314	203	38	;	;	PUNCT
bionys-314	203	39	allen	allen	PROPN
bionys-314	203	40	&	&	CCONJ
bionys-314	203	41	ort	ort	PROPN
bionys-314	203	42	,	,	PUNCT
bionys-314	203	43	2001	2001	NUM
bionys-314	203	44	)	)	PUNCT
bionys-314	203	45	.	.	PUNCT
bionys-314	204	1	interestingly	interestingly	ADV
bionys-314	204	2	,	,	PUNCT
bionys-314	204	3	a	a	DET
bionys-314	204	4	comparison	comparison	NOUN
bionys-314	204	5	of	of	ADP
bionys-314	204	6	rwc	rwc	NOUN
bionys-314	204	7	in	in	ADP
bionys-314	204	8	clones	clone	NOUN
bionys-314	204	9	dn	dn	ADP
bionys-314	204	10	and	and	CCONJ
bionys-314	204	11	100	100	NUM
bionys-314	204	12	revealed	reveal	VERB
bionys-314	204	13	that	that	SCONJ
bionys-314	204	14	rwc	rwc	NOUN
bionys-314	204	15	was	be	AUX
bionys-314	204	16	the	the	DET
bionys-314	204	17	same	same	ADJ
bionys-314	204	18	in	in	ADP
bionys-314	204	19	both	both	PRON
bionys-314	204	20	and	and	CCONJ
bionys-314	204	21	was	be	AUX
bionys-314	204	22	similarly	similarly	ADV
bionys-314	204	23	reduced	reduce	VERB
bionys-314	204	24	after	after	ADP
bionys-314	204	25	10	10	NUM
bionys-314	204	26	days	day	NOUN
bionys-314	204	27	of	of	ADP
bionys-314	204	28	drought	drought	NOUN
bionys-314	204	29	stress	stress	NOUN
bionys-314	204	30	;	;	PUNCT
bionys-314	204	31	whilst	whilst	SCONJ
bionys-314	204	32	re	re	VERB
bionys-314	204	33	-	-	VERB
bionys-314	204	34	watering	watering	NOUN
bionys-314	204	35	caused	cause	VERB
bionys-314	204	36	an	an	DET
bionys-314	204	37	essentially	essentially	ADV
bionys-314	204	38	identical	identical	ADJ
bionys-314	204	39	increase	increase	NOUN
bionys-314	204	40	in	in	ADP
bionys-314	204	41	rwc	rwc	NOUN
bionys-314	204	42	in	in	ADP
bionys-314	204	43	the	the	DET
bionys-314	204	44	leaves	leave	NOUN
bionys-314	204	45	of	of	ADP
bionys-314	204	46	both	both	DET
bionys-314	204	47	clones	clone	NOUN
bionys-314	204	48	.	.	PUNCT
bionys-314	205	1	that	that	SCONJ
bionys-314	205	2	the	the	DET
bionys-314	205	3	decrease	decrease	NOUN
bionys-314	205	4	in	in	ADP
bionys-314	205	5	leaf	leaf	NOUN
bionys-314	205	6	water	water	NOUN
bionys-314	205	7	content	content	NOUN
bionys-314	205	8	happens	happen	VERB
bionys-314	205	9	equally	equally	ADV
bionys-314	205	10	in	in	ADP
bionys-314	205	11	both	both	DET
bionys-314	205	12	clones	clone	NOUN
bionys-314	205	13	but	but	CCONJ
bionys-314	205	14	causes	cause	VERB
bionys-314	205	15	a	a	DET
bionys-314	205	16	different	different	ADJ
bionys-314	205	17	response	response	NOUN
bionys-314	205	18	in	in	ADP
bionys-314	205	19	these	these	DET
bionys-314	205	20	clones	clone	NOUN
bionys-314	205	21	strongly	strongly	ADV
bionys-314	205	22	indicates	indicate	VERB
bionys-314	205	23	that	that	SCONJ
bionys-314	205	24	lowered	lower	VERB
bionys-314	205	25	rwc	rwc	NOUN
bionys-314	205	26	does	do	AUX
bionys-314	205	27	not	not	PART
bionys-314	205	28	necessarily	necessarily	ADV
bionys-314	205	29	result	result	VERB
bionys-314	205	30	in	in	ADP
bionys-314	205	31	oxidative	oxidative	ADJ
bionys-314	205	32	stress	stress	NOUN
bionys-314	205	33	.	.	PUNCT
bionys-314	206	1	although	although	SCONJ
bionys-314	206	2	not	not	PART
bionys-314	206	3	receiving	receive	VERB
bionys-314	206	4	adequate	adequate	ADJ
bionys-314	206	5	moisture	moisture	NOUN
bionys-314	206	6	is	be	AUX
bionys-314	206	7	observed	observe	VERB
bionys-314	206	8	in	in	ADP
bionys-314	206	9	both	both	DET
bionys-314	206	10	examined	examine	VERB
bionys-314	206	11	clones	clone	NOUN
bionys-314	206	12	,	,	PUNCT
bionys-314	206	13	similar	similar	ADJ
bionys-314	206	14	water	water	NOUN
bionys-314	206	15	deficits	deficit	NOUN
bionys-314	206	16	will	will	AUX
bionys-314	206	17	not	not	PART
bionys-314	206	18	necessarily	necessarily	ADV
bionys-314	206	19	stimulate	stimulate	VERB
bionys-314	206	20	defense	defense	NOUN
bionys-314	206	21	responses	response	NOUN
bionys-314	206	22	in	in	ADP
bionys-314	206	23	the	the	DET
bionys-314	206	24	two	two	NUM
bionys-314	206	25	clones	clone	NOUN
bionys-314	206	26	equally	equally	ADV
bionys-314	206	27	.	.	PUNCT
bionys-314	207	1	each	each	DET
bionys-314	207	2	clone	clone	NOUN
bionys-314	207	3	can	can	AUX
bionys-314	207	4	activate	activate	VERB
bionys-314	207	5	its	its	PRON
bionys-314	207	6	defense	defense	NOUN
bionys-314	207	7	system	system	NOUN
bionys-314	207	8	tailored	tailor	VERB
bionys-314	207	9	to	to	ADP
bionys-314	207	10	its	its	PRON
bionys-314	207	11	needs	need	NOUN
bionys-314	207	12	and	and	CCONJ
bionys-314	207	13	ability	ability	NOUN
bionys-314	207	14	.	.	PUNCT
bionys-314	208	1	it	it	PRON
bionys-314	208	2	will	will	AUX
bionys-314	208	3	be	be	AUX
bionys-314	208	4	very	very	ADV
bionys-314	208	5	interesting	interesting	ADJ
bionys-314	208	6	to	to	PART
bionys-314	208	7	learn	learn	VERB
bionys-314	208	8	what	what	PRON
bionys-314	208	9	the	the	DET
bionys-314	208	10	bases	basis	NOUN
bionys-314	208	11	of	of	ADP
bionys-314	208	12	this	this	DET
bionys-314	208	13	difference	difference	NOUN
bionys-314	208	14	are	be	AUX
bionys-314	208	15	.	.	PUNCT
bionys-314	209	1	perhaps	perhaps	ADV
bionys-314	209	2	cytoplasmic	cytoplasmic	ADJ
bionys-314	209	3	proline	proline	NOUN
bionys-314	209	4	levels	level	NOUN
bionys-314	209	5	are	be	AUX
bionys-314	209	6	important	important	ADJ
bionys-314	209	7	here	here	ADV
bionys-314	209	8	.	.	PUNCT
bionys-314	210	1	clone	clone	NOUN
bionys-314	210	2	100	100	NUM
bionys-314	210	3	showed	show	VERB
bionys-314	210	4	much	much	ADV
bionys-314	210	5	higher	high	ADJ
bionys-314	210	6	basal	basal	ADJ
bionys-314	210	7	proline	proline	NOUN
bionys-314	210	8	than	than	SCONJ
bionys-314	210	9	did	do	VERB
bionys-314	210	10	clone	clone	NOUN
bionys-314	210	11	dn	dn	NOUN
bionys-314	210	12	.	.	PUNCT
bionys-314	210	13	relationships	relationship	NOUN
bionys-314	210	14	between	between	ADP
bionys-314	210	15	the	the	DET
bionys-314	210	16	production	production	NOUN
bionys-314	210	17	of	of	ADP
bionys-314	210	18	free	free	ADJ
bionys-314	210	19	radicals	radical	NOUN
bionys-314	210	20	and	and	CCONJ
bionys-314	210	21	proline	proline	NOUN
bionys-314	210	22	accumulation	accumulation	NOUN
bionys-314	210	23	in	in	ADP
bionys-314	210	24	plants	plant	NOUN
bionys-314	210	25	indicate	indicate	VERB
bionys-314	210	26	fig	fig	NOUN
bionys-314	210	27	.	.	PUNCT
bionys-314	211	1	9	9	X
bionys-314	211	2	.	.	X
bionys-314	211	3	changes	change	NOUN
bionys-314	211	4	of	of	ADP
bionys-314	211	5	total	total	ADJ
bionys-314	211	6	chlorophyll	chlorophyll	NOUN
bionys-314	211	7	content	content	NOUN
bionys-314	211	8	in	in	ADP
bionys-314	211	9	clones	clone	NOUN
bionys-314	211	10	100	100	NUM
bionys-314	211	11	and	and	CCONJ
bionys-314	211	12	dn	dn	VERB
bionys-314	211	13	in	in	ADP
bionys-314	211	14	treatments	treatment	NOUN
bionys-314	211	15	of	of	ADP
bionys-314	211	16	control	control	NOUN
bionys-314	211	17	(	(	PUNCT
bionys-314	211	18	0	0	NUM
bionys-314	211	19	)	)	PUNCT
bionys-314	211	20	,	,	PUNCT
bionys-314	211	21	10	10	NUM
bionys-314	211	22	days	day	NOUN
bionys-314	211	23	without	without	ADP
bionys-314	211	24	watering	watering	NOUN
bionys-314	211	25	(	(	PUNCT
bionys-314	211	26	10	10	NUM
bionys-314	211	27	)	)	PUNCT
bionys-314	211	28	and	and	CCONJ
bionys-314	211	29	treatments	treatment	NOUN
bionys-314	211	30	recovered	recover	VERB
bionys-314	211	31	with	with	ADP
bionys-314	211	32	re	re	NOUN
bionys-314	211	33	-	-	NOUN
bionys-314	211	34	irrigation	irrigation	NOUN
bionys-314	211	35	for	for	ADP
bionys-314	211	36	7	7	NUM
bionys-314	211	37	days	day	NOUN
bionys-314	211	38	(	(	PUNCT
bionys-314	211	39	17	17	NUM
bionys-314	211	40	)	)	PUNCT
bionys-314	211	41	.	.	PUNCT
bionys-314	212	1	data	datum	NOUN
bionys-314	212	2	is	be	AUX
bionys-314	212	3	average	average	ADJ
bionys-314	212	4	of	of	ADP
bionys-314	212	5	three	three	NUM
bionys-314	212	6	replicates	replicate	NOUN
bionys-314	212	7	±	±	NOUN
bionys-314	212	8	standard	standard	ADJ
bionys-314	212	9	error	error	NOUN
bionys-314	212	10	(	(	PUNCT
bionys-314	212	11	se	se	X
bionys-314	212	12	)	)	PUNCT
bionys-314	212	13	respectively	respectively	ADV
bionys-314	212	14	.	.	PUNCT
bionys-314	213	1	different	different	ADJ
bionys-314	213	2	letters	letter	NOUN
bionys-314	213	3	indicate	indicate	VERB
bionys-314	213	4	significant	significant	ADJ
bionys-314	213	5	differences	difference	NOUN
bionys-314	213	6	between	between	ADP
bionys-314	213	7	treatments	treatment	NOUN
bionys-314	213	8	according	accord	VERB
bionys-314	213	9	to	to	ADP
bionys-314	213	10	duncan	duncan	PROPN
bionys-314	213	11	’s	’s	PART
bionys-314	213	12	test	test	NOUN
bionys-314	213	13	with	with	ADP
bionys-314	213	14	p	p	NOUN
bionys-314	213	15	<	<	NOUN
bionys-314	213	16	0.05	0.05	NUM
bionys-314	213	17	.	.	PUNCT
bionys-314	214	1	biologica	biologica	PROPN
bionys-314	214	2	nyssana	nyssana	PROPN
bionys-314	214	3	●	●	PUNCT
bionys-314	214	4	11	11	NUM
bionys-314	214	5	(	(	PUNCT
bionys-314	214	6	1	1	NUM
bionys-314	214	7	)	)	PUNCT
bionys-314	214	8	september	september	PROPN
bionys-314	214	9	2020	2020	NUM
bionys-314	214	10	:	:	PUNCT
bionys-314	214	11	45	45	NUM
bionys-314	214	12	-	-	SYM
bionys-314	214	13	54	54	NUM
bionys-314	214	14	mohammadi	mohammadi	NOUN
bionys-314	214	15	et	et	PROPN
bionys-314	214	16	al	al	PROPN
bionys-314	214	17	.	.	PUNCT
bionys-314	215	1	●	●	PUNCT
bionys-314	215	2	a	a	DET
bionys-314	215	3	real	real	ADJ
bionys-314	215	4	-	-	PUNCT
bionys-314	215	5	time	time	NOUN
bionys-314	215	6	pcr	pcr	NOUN
bionys-314	215	7	assay	assay	NOUN
bionys-314	215	8	for	for	ADP
bionys-314	215	9	evaluation	evaluation	NOUN
bionys-314	215	10	of	of	ADP
bionys-314	215	11	drought	drought	NOUN
bionys-314	215	12	tolerance	tolerance	NOUN
bionys-314	215	13	in	in	ADP
bionys-314	215	14	a	a	DET
bionys-314	215	15	new	new	ADJ
bionys-314	215	16	tea	tea	NOUN
bionys-314	215	17	clone	clone	NOUN
bionys-314	215	18	a	a	DET
bionys-314	215	19	role	role	NOUN
bionys-314	215	20	for	for	ADP
bionys-314	215	21	proline	proline	NOUN
bionys-314	215	22	in	in	ADP
bionys-314	215	23	reducing	reduce	VERB
bionys-314	215	24	toxicity	toxicity	NOUN
bionys-314	215	25	,	,	PUNCT
bionys-314	215	26	a	a	DET
bionys-314	215	27	non	non	ADJ
bionys-314	215	28	-	-	ADJ
bionys-314	215	29	enzymatic	enzymatic	ADJ
bionys-314	215	30	defense	defense	NOUN
bionys-314	215	31	mechanism	mechanism	NOUN
bionys-314	215	32	for	for	ADP
bionys-314	215	33	removing	remove	VERB
bionys-314	215	34	free	free	ADJ
bionys-314	215	35	radicals	radical	NOUN
bionys-314	215	36	(	(	PUNCT
bionys-314	215	37	matysik	matysik	NOUN
bionys-314	215	38	et	et	PROPN
bionys-314	215	39	al	al	PROPN
bionys-314	215	40	.	.	PROPN
bionys-314	215	41	,	,	PUNCT
bionys-314	215	42	2002	2002	NUM
bionys-314	215	43	)	)	PUNCT
bionys-314	215	44	.	.	PUNCT
bionys-314	216	1	on	on	ADP
bionys-314	216	2	the	the	DET
bionys-314	216	3	other	other	ADJ
bionys-314	216	4	hand	hand	NOUN
bionys-314	216	5	,	,	PUNCT
bionys-314	216	6	increases	increase	VERB
bionys-314	216	7	in	in	ADP
bionys-314	216	8	proline	proline	NOUN
bionys-314	216	9	,	,	PUNCT
bionys-314	216	10	which	which	PRON
bionys-314	216	11	reduces	reduce	VERB
bionys-314	216	12	the	the	DET
bionys-314	216	13	acidity	acidity	NOUN
bionys-314	216	14	of	of	ADP
bionys-314	216	15	the	the	DET
bionys-314	216	16	cytosol	cytosol	NOUN
bionys-314	216	17	,	,	PUNCT
bionys-314	216	18	can	can	AUX
bionys-314	216	19	be	be	AUX
bionys-314	216	20	due	due	ADJ
bionys-314	216	21	to	to	ADP
bionys-314	216	22	various	various	ADJ
bionys-314	216	23	stresses	stress	NOUN
bionys-314	216	24	(	(	PUNCT
bionys-314	216	25	kurkdjian	kurkdjian	PROPN
bionys-314	216	26	&	&	CCONJ
bionys-314	216	27	guern	guern	PROPN
bionys-314	216	28	,	,	PUNCT
bionys-314	216	29	1989	1989	NUM
bionys-314	216	30	)	)	PUNCT
bionys-314	216	31	.	.	PUNCT
bionys-314	217	1	removing	remove	VERB
bionys-314	217	2	excess	excess	ADJ
bionys-314	217	3	h+	h+	NOUN
bionys-314	217	4	as	as	ADP
bionys-314	217	5	a	a	DET
bionys-314	217	6	positive	positive	ADJ
bionys-314	217	7	effect	effect	NOUN
bionys-314	217	8	of	of	ADP
bionys-314	217	9	proline	proline	NOUN
bionys-314	217	10	synthesis	synthesis	NOUN
bionys-314	217	11	results	result	NOUN
bionys-314	217	12	in	in	ADP
bionys-314	217	13	a	a	DET
bionys-314	217	14	reduction	reduction	NOUN
bionys-314	217	15	of	of	ADP
bionys-314	217	16	stress	stress	NOUN
bionys-314	217	17	.	.	PUNCT
bionys-314	218	1	the	the	DET
bionys-314	218	2	current	current	ADJ
bionys-314	218	3	study	study	NOUN
bionys-314	218	4	suggests	suggest	VERB
bionys-314	218	5	that	that	SCONJ
bionys-314	218	6	a	a	DET
bionys-314	218	7	change	change	NOUN
bionys-314	218	8	in	in	ADP
bionys-314	218	9	proline	proline	NOUN
bionys-314	218	10	content	content	NOUN
bionys-314	218	11	in	in	ADP
bionys-314	218	12	tea	tea	NOUN
bionys-314	218	13	plant	plant	NOUN
bionys-314	218	14	is	be	AUX
bionys-314	218	15	regulating	regulate	VERB
bionys-314	218	16	the	the	DET
bionys-314	218	17	level	level	NOUN
bionys-314	218	18	of	of	ADP
bionys-314	218	19	osmotic	osmotic	ADJ
bionys-314	218	20	potential	potential	NOUN
bionys-314	218	21	that	that	PRON
bionys-314	218	22	ultimately	ultimately	ADV
bionys-314	218	23	controls	control	VERB
bionys-314	218	24	the	the	DET
bionys-314	218	25	water	water	NOUN
bionys-314	218	26	absorption	absorption	NOUN
bionys-314	218	27	.	.	PUNCT
bionys-314	219	1	the	the	DET
bionys-314	219	2	same	same	ADJ
bionys-314	219	3	phenomenon	phenomenon	NOUN
bionys-314	219	4	has	have	AUX
bionys-314	219	5	been	be	AUX
bionys-314	219	6	previously	previously	ADV
bionys-314	219	7	observed	observe	VERB
bionys-314	219	8	in	in	ADP
bionys-314	219	9	cotton	cotton	NOUN
bionys-314	219	10	(	(	PUNCT
bionys-314	219	11	parida	parida	PROPN
bionys-314	219	12	et	et	PROPN
bionys-314	219	13	al	al	PROPN
bionys-314	219	14	.	.	PROPN
bionys-314	219	15	,	,	PUNCT
bionys-314	219	16	2008	2008	NUM
bionys-314	219	17	)	)	PUNCT
bionys-314	219	18	,	,	PUNCT
bionys-314	219	19	rice	rice	NOUN
bionys-314	219	20	(	(	PUNCT
bionys-314	219	21	pirdashti	pirdashti	VERB
bionys-314	219	22	et	et	PROPN
bionys-314	219	23	al	al	PROPN
bionys-314	219	24	.	.	PROPN
bionys-314	219	25	,	,	PUNCT
bionys-314	219	26	2009	2009	NUM
bionys-314	219	27	)	)	PUNCT
bionys-314	219	28	,	,	PUNCT
bionys-314	219	29	maize	maize	NOUN
bionys-314	219	30	(	(	PUNCT
bionys-314	219	31	valentovic	valentovic	PROPN
bionys-314	219	32	et	et	PROPN
bionys-314	219	33	al	al	PROPN
bionys-314	219	34	.	.	PROPN
bionys-314	219	35	,	,	PUNCT
bionys-314	219	36	2006	2006	NUM
bionys-314	219	37	)	)	PUNCT
bionys-314	219	38	and	and	CCONJ
bionys-314	219	39	in	in	ADP
bionys-314	219	40	tea	tea	NOUN
bionys-314	219	41	(	(	PUNCT
bionys-314	219	42	upadhyaya	upadhyaya	NOUN
bionys-314	219	43	&	&	CCONJ
bionys-314	219	44	panda	panda	NOUN
bionys-314	219	45	,	,	PUNCT
bionys-314	219	46	2013	2013	NUM
bionys-314	219	47	)	)	PUNCT
bionys-314	219	48	.	.	PUNCT
bionys-314	220	1	our	our	PRON
bionys-314	220	2	investigation	investigation	NOUN
bionys-314	220	3	shows	show	VERB
bionys-314	220	4	that	that	SCONJ
bionys-314	220	5	higher	high	ADJ
bionys-314	220	6	drought	drought	NOUN
bionys-314	220	7	resistance	resistance	NOUN
bionys-314	220	8	of	of	ADP
bionys-314	220	9	clone	clone	NOUN
bionys-314	220	10	100	100	NUM
bionys-314	220	11	compared	compare	VERB
bionys-314	220	12	to	to	ADP
bionys-314	220	13	clone	clone	NOUN
bionys-314	220	14	dn	dn	NOUN
bionys-314	220	15	is	be	AUX
bionys-314	220	16	due	due	ADJ
bionys-314	220	17	to	to	ADP
bionys-314	220	18	its	its	PRON
bionys-314	220	19	higher	high	ADJ
bionys-314	220	20	proline	proline	NOUN
bionys-314	220	21	level	level	NOUN
bionys-314	220	22	.	.	PUNCT
bionys-314	221	1	this	this	DET
bionys-314	221	2	capability	capability	NOUN
bionys-314	221	3	of	of	ADP
bionys-314	221	4	clone	clone	NOUN
bionys-314	221	5	100	100	NUM
bionys-314	221	6	might	might	AUX
bionys-314	221	7	be	be	AUX
bionys-314	221	8	more	more	ADV
bionys-314	221	9	effective	effective	ADJ
bionys-314	221	10	in	in	ADP
bionys-314	221	11	weak	weak	ADJ
bionys-314	221	12	or	or	CCONJ
bionys-314	221	13	moderate	moderate	ADJ
bionys-314	221	14	drought	drought	NOUN
bionys-314	221	15	and	and	CCONJ
bionys-314	221	16	probably	probably	ADV
bionys-314	221	17	less	less	ADV
bionys-314	221	18	effective	effective	ADJ
bionys-314	221	19	in	in	ADP
bionys-314	221	20	extreme	extreme	ADJ
bionys-314	221	21	drought	drought	NOUN
bionys-314	221	22	conditions	condition	NOUN
bionys-314	221	23	.	.	PUNCT
bionys-314	222	1	clones	clone	NOUN
bionys-314	222	2	dn	dn	VERB
bionys-314	222	3	and	and	CCONJ
bionys-314	222	4	100	100	NUM
bionys-314	222	5	differed	differ	VERB
bionys-314	222	6	also	also	ADV
bionys-314	222	7	in	in	ADP
bionys-314	222	8	their	their	PRON
bionys-314	222	9	chlorophyll	chlorophyll	NOUN
bionys-314	222	10	a	a	DET
bionys-314	222	11	profiles	profile	NOUN
bionys-314	222	12	throughout	throughout	ADP
bionys-314	222	13	the	the	DET
bionys-314	222	14	experiment	experiment	NOUN
bionys-314	222	15	.	.	PUNCT
bionys-314	223	1	chlorophyll	chlorophyll	VERB
bionys-314	223	2	a	a	DET
bionys-314	223	3	levels	level	NOUN
bionys-314	223	4	rose	rise	VERB
bionys-314	223	5	under	under	ADP
bionys-314	223	6	drought	drought	NOUN
bionys-314	223	7	conditions	condition	NOUN
bionys-314	223	8	in	in	ADP
bionys-314	223	9	clone	clone	NOUN
bionys-314	223	10	dn	dn	NOUN
bionys-314	223	11	but	but	CCONJ
bionys-314	223	12	were	be	AUX
bionys-314	223	13	unchanged	unchanged	ADJ
bionys-314	223	14	in	in	ADP
bionys-314	223	15	clone	clone	NOUN
bionys-314	223	16	100	100	NUM
bionys-314	223	17	.	.	PUNCT
bionys-314	224	1	similarly	similarly	ADV
bionys-314	224	2	,	,	PUNCT
bionys-314	224	3	upon	upon	SCONJ
bionys-314	224	4	relief	relief	NOUN
bionys-314	224	5	of	of	ADP
bionys-314	224	6	drought	drought	NOUN
bionys-314	224	7	,	,	PUNCT
bionys-314	224	8	chlorophyll	chlorophyll	VERB
bionys-314	224	9	a	a	DET
bionys-314	224	10	levels	level	NOUN
bionys-314	224	11	(	(	PUNCT
bionys-314	224	12	and	and	CCONJ
bionys-314	224	13	,	,	PUNCT
bionys-314	224	14	in	in	ADP
bionys-314	224	15	this	this	DET
bionys-314	224	16	case	case	NOUN
bionys-314	224	17	,	,	PUNCT
bionys-314	224	18	total	total	ADJ
bionys-314	224	19	chlorophyll	chlorophyll	NOUN
bionys-314	224	20	as	as	ADV
bionys-314	224	21	well	well	ADV
bionys-314	224	22	)	)	PUNCT
bionys-314	224	23	dropped	drop	VERB
bionys-314	224	24	in	in	ADP
bionys-314	224	25	clone	clone	NOUN
bionys-314	224	26	dn	dn	NOUN
bionys-314	224	27	and	and	CCONJ
bionys-314	224	28	,	,	PUNCT
bionys-314	224	29	again	again	ADV
bionys-314	224	30	,	,	PUNCT
bionys-314	224	31	did	do	AUX
bionys-314	224	32	not	not	PART
bionys-314	224	33	significantly	significantly	ADV
bionys-314	224	34	change	change	VERB
bionys-314	224	35	in	in	ADP
bionys-314	224	36	clone	clone	NOUN
bionys-314	224	37	100	100	NUM
bionys-314	224	38	.	.	PUNCT
bionys-314	225	1	changes	change	NOUN
bionys-314	225	2	in	in	ADP
bionys-314	225	3	chlorophyll	chlorophyll	NOUN
bionys-314	225	4	levels	level	NOUN
bionys-314	225	5	during	during	ADP
bionys-314	225	6	stress	stress	NOUN
bionys-314	225	7	are	be	AUX
bionys-314	225	8	related	relate	VERB
bionys-314	225	9	to	to	ADP
bionys-314	225	10	the	the	DET
bionys-314	225	11	duration	duration	NOUN
bionys-314	225	12	and	and	CCONJ
bionys-314	225	13	intensity	intensity	NOUN
bionys-314	225	14	of	of	ADP
bionys-314	225	15	the	the	DET
bionys-314	225	16	stress	stress	NOUN
bionys-314	225	17	(	(	PUNCT
bionys-314	225	18	zhang	zhang	PROPN
bionys-314	225	19	&	&	CCONJ
bionys-314	225	20	kirkham	kirkham	PROPN
bionys-314	225	21	,	,	PUNCT
bionys-314	225	22	1996	1996	NUM
bionys-314	225	23	)	)	PUNCT
bionys-314	225	24	.	.	PUNCT
bionys-314	226	1	chapman	chapman	PROPN
bionys-314	226	2	&	&	CCONJ
bionys-314	226	3	barreto	barreto	PROPN
bionys-314	226	4	(	(	PUNCT
bionys-314	226	5	1997	1997	NUM
bionys-314	226	6	)	)	PUNCT
bionys-314	226	7	believe	believe	VERB
bionys-314	226	8	that	that	SCONJ
bionys-314	226	9	the	the	DET
bionys-314	226	10	growth	growth	NOUN
bionys-314	226	11	stage	stage	NOUN
bionys-314	226	12	,	,	PUNCT
bionys-314	226	13	cultivar	cultivar	NOUN
bionys-314	226	14	and	and	CCONJ
bionys-314	226	15	environmental	environmental	ADJ
bionys-314	226	16	conditions	condition	NOUN
bionys-314	226	17	may	may	AUX
bionys-314	226	18	be	be	AUX
bionys-314	226	19	important	important	ADJ
bionys-314	226	20	factors	factor	NOUN
bionys-314	226	21	influencing	influence	VERB
bionys-314	226	22	the	the	DET
bionys-314	226	23	amount	amount	NOUN
bionys-314	226	24	of	of	ADP
bionys-314	226	25	chlorophyll	chlorophyll	NOUN
bionys-314	226	26	pigments	pigment	NOUN
bionys-314	226	27	under	under	ADP
bionys-314	226	28	stress	stress	NOUN
bionys-314	226	29	.	.	PUNCT
bionys-314	227	1	sairam	sairam	PROPN
bionys-314	227	2	et	et	PROPN
bionys-314	227	3	al	al	PROPN
bionys-314	227	4	.	.	PUNCT
bionys-314	228	1	(	(	PUNCT
bionys-314	228	2	2000	2000	NUM
bionys-314	228	3	and	and	CCONJ
bionys-314	228	4	2001	2001	NUM
bionys-314	228	5	)	)	PUNCT
bionys-314	228	6	have	have	AUX
bionys-314	228	7	also	also	ADV
bionys-314	228	8	stipulated	stipulate	VERB
bionys-314	228	9	that	that	SCONJ
bionys-314	228	10	higher	high	ADJ
bionys-314	228	11	levels	level	NOUN
bionys-314	228	12	of	of	ADP
bionys-314	228	13	carotenoids	carotenoid	NOUN
bionys-314	228	14	and	and	CCONJ
bionys-314	228	15	chlorophylls	chlorophyll	VERB
bionys-314	228	16	in	in	ADP
bionys-314	228	17	plants	plant	NOUN
bionys-314	228	18	under	under	ADP
bionys-314	228	19	drought	drought	NOUN
bionys-314	228	20	stress	stress	NOUN
bionys-314	228	21	conditions	condition	NOUN
bionys-314	228	22	can	can	AUX
bionys-314	228	23	be	be	AUX
bionys-314	228	24	associated	associate	VERB
bionys-314	228	25	with	with	ADP
bionys-314	228	26	different	different	ADJ
bionys-314	228	27	resistance	resistance	NOUN
bionys-314	228	28	genotypes	genotype	NOUN
bionys-314	228	29	.	.	PUNCT
bionys-314	229	1	machado	machado	PROPN
bionys-314	229	2	&	&	CCONJ
bionys-314	229	3	paulsen	paulsen	PROPN
bionys-314	229	4	(	(	PUNCT
bionys-314	229	5	2001	2001	NUM
bionys-314	229	6	)	)	PUNCT
bionys-314	229	7	found	find	VERB
bionys-314	229	8	that	that	SCONJ
bionys-314	229	9	rapid	rapid	ADJ
bionys-314	229	10	physiological	physiological	ADJ
bionys-314	229	11	changes	change	NOUN
bionys-314	229	12	such	such	ADJ
bionys-314	229	13	as	as	ADP
bionys-314	229	14	tubular	tubular	ADJ
bionys-314	229	15	leaves	leave	NOUN
bionys-314	229	16	,	,	PUNCT
bionys-314	229	17	reduced	reduce	VERB
bionys-314	229	18	leaf	leaf	NOUN
bionys-314	229	19	area	area	NOUN
bionys-314	229	20	,	,	PUNCT
bionys-314	229	21	and	and	CCONJ
bionys-314	229	22	increased	increase	VERB
bionys-314	229	23	stomatal	stomatal	ADJ
bionys-314	229	24	resistance	resistance	NOUN
bionys-314	229	25	may	may	AUX
bionys-314	229	26	be	be	AUX
bionys-314	229	27	factors	factor	NOUN
bionys-314	229	28	in	in	ADP
bionys-314	229	29	the	the	DET
bionys-314	229	30	apparent	apparent	ADJ
bionys-314	229	31	increase	increase	NOUN
bionys-314	229	32	in	in	ADP
bionys-314	229	33	chlorophylls	chlorophyll	NOUN
bionys-314	229	34	content	content	PROPN
bionys-314	229	35	,	,	PUNCT
bionys-314	229	36	as	as	ADP
bionys-314	229	37	part	part	NOUN
bionys-314	229	38	of	of	ADP
bionys-314	229	39	an	an	DET
bionys-314	229	40	avoidance	avoidance	NOUN
bionys-314	229	41	mechanism	mechanism	NOUN
bionys-314	229	42	to	to	ADP
bionys-314	229	43	drought	drought	NOUN
bionys-314	229	44	stress	stress	NOUN
bionys-314	229	45	.	.	PUNCT
bionys-314	230	1	during	during	ADP
bionys-314	230	2	stressful	stressful	ADJ
bionys-314	230	3	conditions	condition	NOUN
bionys-314	230	4	,	,	PUNCT
bionys-314	230	5	plants	plant	NOUN
bionys-314	230	6	reduce	reduce	VERB
bionys-314	230	7	transpiration	transpiration	NOUN
bionys-314	230	8	levels	level	NOUN
bionys-314	230	9	to	to	PART
bionys-314	230	10	prevent	prevent	VERB
bionys-314	230	11	water	water	NOUN
bionys-314	230	12	loss	loss	NOUN
bionys-314	230	13	through	through	ADP
bionys-314	230	14	lower	low	ADJ
bionys-314	230	15	leaf	leaf	NOUN
bionys-314	230	16	surfaces	surface	NOUN
bionys-314	230	17	.	.	PUNCT
bionys-314	231	1	consequently	consequently	ADV
bionys-314	231	2	,	,	PUNCT
bionys-314	231	3	the	the	DET
bionys-314	231	4	chlorophyll	chlorophyll	NOUN
bionys-314	231	5	content	content	NOUN
bionys-314	231	6	increases	increase	NOUN
bionys-314	231	7	per	per	ADP
bionys-314	231	8	unit	unit	NOUN
bionys-314	231	9	leaf	leaf	NOUN
bionys-314	231	10	area	area	NOUN
bionys-314	231	11	,	,	PUNCT
bionys-314	231	12	despite	despite	SCONJ
bionys-314	231	13	the	the	DET
bionys-314	231	14	decrease	decrease	NOUN
bionys-314	231	15	in	in	ADP
bionys-314	231	16	total	total	ADJ
bionys-314	231	17	chlorophyll	chlorophyll	NOUN
bionys-314	231	18	content	content	NOUN
bionys-314	231	19	.	.	PUNCT
bionys-314	232	1	clone	clone	NOUN
bionys-314	232	2	dn	dn	PROPN
bionys-314	232	3	is	be	AUX
bionys-314	232	4	a	a	DET
bionys-314	232	5	drought	drought	NOUN
bionys-314	232	6	resistant	resistant	ADJ
bionys-314	232	7	cultivar	cultivar	NOUN
bionys-314	232	8	and	and	CCONJ
bionys-314	232	9	is	be	AUX
bionys-314	232	10	considered	consider	VERB
bionys-314	232	11	as	as	ADP
bionys-314	232	12	a	a	DET
bionys-314	232	13	reference	reference	NOUN
bionys-314	232	14	strain	strain	NOUN
bionys-314	232	15	for	for	ADP
bionys-314	232	16	evaluating	evaluate	VERB
bionys-314	232	17	new	new	ADJ
bionys-314	232	18	iranian	iranian	ADJ
bionys-314	232	19	clones	clone	NOUN
bionys-314	232	20	used	use	VERB
bionys-314	232	21	at	at	ADP
bionys-314	232	22	tea	tea	NOUN
bionys-314	232	23	research	research	PROPN
bionys-314	232	24	institute	institute	PROPN
bionys-314	232	25	of	of	ADP
bionys-314	232	26	iran	iran	PROPN
bionys-314	232	27	.	.	PUNCT
bionys-314	233	1	perhaps	perhaps	ADV
bionys-314	233	2	at	at	ADP
bionys-314	233	3	least	least	ADJ
bionys-314	233	4	a	a	DET
bionys-314	233	5	part	part	NOUN
bionys-314	233	6	of	of	ADP
bionys-314	233	7	the	the	DET
bionys-314	233	8	changes	change	NOUN
bionys-314	233	9	in	in	ADP
bionys-314	233	10	chlorophylls	chlorophyll	NOUN
bionys-314	233	11	in	in	ADP
bionys-314	233	12	this	this	DET
bionys-314	233	13	cultivar	cultivar	NOUN
bionys-314	233	14	was	be	AUX
bionys-314	233	15	related	relate	VERB
bionys-314	233	16	to	to	ADP
bionys-314	233	17	the	the	DET
bionys-314	233	18	higher	high	ADJ
bionys-314	233	19	oxidative	oxidative	ADJ
bionys-314	233	20	stress	stress	NOUN
bionys-314	233	21	intensity	intensity	NOUN
bionys-314	233	22	experienced	experience	VERB
bionys-314	233	23	by	by	ADP
bionys-314	233	24	this	this	DET
bionys-314	233	25	clone	clone	NOUN
bionys-314	233	26	during	during	ADP
bionys-314	233	27	the	the	DET
bionys-314	233	28	drought	drought	NOUN
bionys-314	233	29	conditions	condition	NOUN
bionys-314	233	30	.	.	PUNCT
bionys-314	234	1	after	after	ADP
bionys-314	234	2	the	the	DET
bionys-314	234	3	7	7	NUM
bionys-314	234	4	day	day	NOUN
bionys-314	234	5	re	re	NOUN
bionys-314	234	6	-	-	NOUN
bionys-314	234	7	watering	watering	ADJ
bionys-314	234	8	period	period	NOUN
bionys-314	234	9	the	the	DET
bionys-314	234	10	morphological	morphological	ADJ
bionys-314	234	11	changes	change	NOUN
bionys-314	234	12	mentioned	mention	VERB
bionys-314	234	13	above	above	ADV
bionys-314	234	14	were	be	AUX
bionys-314	234	15	reversed	reverse	VERB
bionys-314	234	16	but	but	CCONJ
bionys-314	234	17	chlorophyll	chlorophyll	NOUN
bionys-314	234	18	levels	level	NOUN
bionys-314	234	19	nevertheless	nevertheless	ADV
bionys-314	234	20	fell	fall	VERB
bionys-314	234	21	in	in	ADP
bionys-314	234	22	clone	clone	NOUN
bionys-314	234	23	dn	dn	NOUN
bionys-314	234	24	to	to	ADP
bionys-314	234	25	values	value	NOUN
bionys-314	234	26	lower	low	ADJ
bionys-314	234	27	than	than	ADP
bionys-314	234	28	in	in	ADP
bionys-314	234	29	control	control	NOUN
bionys-314	234	30	.	.	PUNCT
bionys-314	235	1	it	it	PRON
bionys-314	235	2	is	be	AUX
bionys-314	235	3	possible	possible	ADJ
bionys-314	235	4	that	that	SCONJ
bionys-314	235	5	enhanced	enhanced	ADJ
bionys-314	235	6	chlorophyll	chlorophyll	NOUN
bionys-314	235	7	synthesis	synthesis	NOUN
bionys-314	235	8	could	could	AUX
bionys-314	235	9	not	not	PART
bionys-314	235	10	be	be	AUX
bionys-314	235	11	upgraded	upgrade	VERB
bionys-314	235	12	along	along	ADP
bionys-314	235	13	with	with	ADP
bionys-314	235	14	these	these	DET
bionys-314	235	15	morphological	morphological	ADJ
bionys-314	235	16	changes	change	NOUN
bionys-314	235	17	and/or	and/or	CCONJ
bionys-314	235	18	not	not	PART
bionys-314	235	19	enough	enough	ADJ
bionys-314	235	20	time	time	NOUN
bionys-314	235	21	was	be	AUX
bionys-314	235	22	available	available	ADJ
bionys-314	235	23	for	for	ADP
bionys-314	235	24	chlorophyll	chlorophyll	ADJ
bionys-314	235	25	synthesis	synthesis	NOUN
bionys-314	235	26	to	to	PART
bionys-314	235	27	reach	reach	VERB
bionys-314	235	28	levels	level	NOUN
bionys-314	235	29	present	present	ADJ
bionys-314	235	30	in	in	ADP
bionys-314	235	31	control	control	NOUN
bionys-314	235	32	samples	sample	NOUN
bionys-314	235	33	.	.	PUNCT
bionys-314	236	1	clone	clone	NOUN
bionys-314	236	2	100	100	NUM
bionys-314	236	3	displayed	display	VERB
bionys-314	236	4	better	well	ADJ
bionys-314	236	5	tolerance	tolerance	NOUN
bionys-314	236	6	to	to	ADP
bionys-314	236	7	drought	drought	NOUN
bionys-314	236	8	and	and	CCONJ
bionys-314	236	9	changes	change	NOUN
bionys-314	236	10	in	in	ADP
bionys-314	236	11	chlorophyll	chlorophyll	NOUN
bionys-314	236	12	content	content	NOUN
bionys-314	236	13	in	in	ADP
bionys-314	236	14	these	these	DET
bionys-314	236	15	clones	clone	NOUN
bionys-314	236	16	were	be	AUX
bionys-314	236	17	minimal	minimal	ADJ
bionys-314	236	18	.	.	PUNCT
bionys-314	237	1	again	again	ADV
bionys-314	237	2	,	,	PUNCT
bionys-314	237	3	it	it	PRON
bionys-314	237	4	will	will	AUX
bionys-314	237	5	be	be	AUX
bionys-314	237	6	very	very	ADV
bionys-314	237	7	interesting	interesting	ADJ
bionys-314	237	8	to	to	PART
bionys-314	237	9	learn	learn	VERB
bionys-314	237	10	the	the	DET
bionys-314	237	11	basis	basis	NOUN
bionys-314	237	12	for	for	ADP
bionys-314	237	13	the	the	DET
bionys-314	237	14	lack	lack	NOUN
bionys-314	237	15	of	of	ADP
bionys-314	237	16	apparent	apparent	ADJ
bionys-314	237	17	oxidative	oxidative	ADJ
bionys-314	237	18	stress	stress	NOUN
bionys-314	237	19	in	in	ADP
bionys-314	237	20	clone	clone	NOUN
bionys-314	237	21	100	100	NUM
bionys-314	237	22	as	as	SCONJ
bionys-314	237	23	contrasted	contrast	VERB
bionys-314	237	24	to	to	ADP
bionys-314	237	25	the	the	DET
bionys-314	237	26	clear	clear	ADJ
bionys-314	237	27	oxidative	oxidative	ADJ
bionys-314	237	28	stress	stress	NOUN
bionys-314	237	29	experienced	experience	VERB
bionys-314	237	30	by	by	ADP
bionys-314	237	31	clone	clone	NOUN
bionys-314	237	32	dn	dn	NOUN
bionys-314	237	33	under	under	ADP
bionys-314	237	34	conditions	condition	NOUN
bionys-314	237	35	of	of	ADP
bionys-314	237	36	drought	drought	NOUN
bionys-314	237	37	.	.	PUNCT
bionys-314	238	1	conclusion	conclusion	NOUN
bionys-314	238	2	10	10	NUM
bionys-314	238	3	-	-	PUNCT
bionys-314	238	4	day	day	NOUN
bionys-314	238	5	drought	drought	NOUN
bionys-314	238	6	stress	stress	NOUN
bionys-314	238	7	was	be	AUX
bionys-314	238	8	imposed	impose	VERB
bionys-314	238	9	on	on	ADP
bionys-314	238	10	two	two	NUM
bionys-314	238	11	clones	clone	NOUN
bionys-314	238	12	of	of	ADP
bionys-314	238	13	tea	tea	NOUN
bionys-314	238	14	plants	plant	NOUN
bionys-314	238	15	.	.	PUNCT
bionys-314	239	1	this	this	PRON
bionys-314	239	2	was	be	AUX
bionys-314	239	3	followed	follow	VERB
bionys-314	239	4	by	by	ADP
bionys-314	239	5	one	one	NUM
bionys-314	239	6	week	week	NOUN
bionys-314	239	7	irrigation	irrigation	NOUN
bionys-314	239	8	period	period	NOUN
bionys-314	239	9	(	(	PUNCT
bionys-314	239	10	twice	twice	DET
bionys-314	239	11	a	a	DET
bionys-314	239	12	week	week	NOUN
bionys-314	239	13	,	,	PUNCT
bionys-314	239	14	according	accord	VERB
bionys-314	239	15	to	to	ADP
bionys-314	239	16	the	the	DET
bionys-314	239	17	usual	usual	ADJ
bionys-314	239	18	practice	practice	NOUN
bionys-314	239	19	of	of	ADP
bionys-314	239	20	the	the	DET
bionys-314	239	21	research	research	NOUN
bionys-314	239	22	station	station	NOUN
bionys-314	239	23	)	)	PUNCT
bionys-314	239	24	to	to	PART
bionys-314	239	25	exit	exit	VERB
bionys-314	239	26	from	from	ADP
bionys-314	239	27	the	the	DET
bionys-314	239	28	stress	stress	NOUN
bionys-314	239	29	condition	condition	NOUN
bionys-314	239	30	.	.	PUNCT
bionys-314	240	1	the	the	DET
bionys-314	240	2	results	result	NOUN
bionys-314	240	3	showed	show	VERB
bionys-314	240	4	that	that	SCONJ
bionys-314	240	5	10	10	NUM
bionys-314	240	6	-	-	PUNCT
bionys-314	240	7	day	day	NOUN
bionys-314	240	8	stress	stress	NOUN
bionys-314	240	9	caused	cause	VERB
bionys-314	240	10	significant	significant	ADJ
bionys-314	240	11	changes	change	NOUN
bionys-314	240	12	in	in	ADP
bionys-314	240	13	metabolism	metabolism	NOUN
bionys-314	240	14	and	and	CCONJ
bionys-314	240	15	activity	activity	NOUN
bionys-314	240	16	of	of	ADP
bionys-314	240	17	antioxidant	antioxidant	ADJ
bionys-314	240	18	system	system	NOUN
bionys-314	240	19	in	in	ADP
bionys-314	240	20	dn	dn	PROPN
bionys-314	240	21	clone	clone	NOUN
bionys-314	240	22	,	,	PUNCT
bionys-314	240	23	while	while	SCONJ
bionys-314	240	24	these	these	DET
bionys-314	240	25	changes	change	NOUN
bionys-314	240	26	were	be	AUX
bionys-314	240	27	not	not	PART
bionys-314	240	28	observed	observe	VERB
bionys-314	240	29	in	in	ADP
bionys-314	240	30	clones	clone	NOUN
bionys-314	240	31	100	100	NUM
bionys-314	240	32	.	.	PUNCT
bionys-314	241	1	measurement	measurement	NOUN
bionys-314	241	2	of	of	ADP
bionys-314	241	3	membrane	membrane	NOUN
bionys-314	241	4	lipid	lipid	NOUN
bionys-314	241	5	peroxidation	peroxidation	NOUN
bionys-314	241	6	,	,	PUNCT
bionys-314	241	7	as	as	ADP
bionys-314	241	8	an	an	DET
bionys-314	241	9	important	important	ADJ
bionys-314	241	10	physiological	physiological	ADJ
bionys-314	241	11	indicator	indicator	NOUN
bionys-314	241	12	to	to	PART
bionys-314	241	13	detection	detection	NOUN
bionys-314	241	14	oxidative	oxidative	ADJ
bionys-314	241	15	stress	stress	NOUN
bionys-314	241	16	intensity	intensity	NOUN
bionys-314	241	17	and	and	CCONJ
bionys-314	241	18	check	check	VERB
bionys-314	241	19	out	out	ADP
bionys-314	241	20	the	the	DET
bionys-314	241	21	mn	mn	PROPN
bionys-314	241	22	-	-	PUNCT
bionys-314	241	23	sod	sod	NOUN
bionys-314	241	24	gene	gene	NOUN
bionys-314	241	25	expression	expression	NOUN
bionys-314	241	26	as	as	ADP
bionys-314	241	27	the	the	DET
bionys-314	241	28	first	first	ADJ
bionys-314	241	29	defense	defense	NOUN
bionys-314	241	30	enzyme	enzyme	NOUN
bionys-314	241	31	against	against	ADP
bionys-314	241	32	oxidative	oxidative	ADJ
bionys-314	241	33	stress	stress	NOUN
bionys-314	241	34	,	,	PUNCT
bionys-314	241	35	showed	show	VERB
bionys-314	241	36	that	that	SCONJ
bionys-314	241	37	during	during	ADP
bionys-314	241	38	the	the	DET
bionys-314	241	39	10	10	NUM
bionys-314	241	40	days	day	NOUN
bionys-314	241	41	of	of	ADP
bionys-314	241	42	water	water	NOUN
bionys-314	241	43	stress	stress	NOUN
bionys-314	241	44	,	,	PUNCT
bionys-314	241	45	the	the	DET
bionys-314	241	46	clone	clone	NOUN
bionys-314	241	47	100	100	NUM
bionys-314	241	48	is	be	AUX
bionys-314	241	49	not	not	PART
bionys-314	241	50	affected	affect	VERB
bionys-314	241	51	,	,	PUNCT
bionys-314	241	52	whereas	whereas	SCONJ
bionys-314	241	53	dn	dn	PROPN
bionys-314	241	54	clone	clone	NOUN
bionys-314	241	55	showed	show	VERB
bionys-314	241	56	increase	increase	NOUN
bionys-314	241	57	in	in	ADP
bionys-314	241	58	proline	proline	NOUN
bionys-314	241	59	,	,	PUNCT
bionys-314	241	60	mda	mda	PROPN
bionys-314	241	61	and	and	CCONJ
bionys-314	241	62	also	also	ADV
bionys-314	241	63	increased	increase	VERB
bionys-314	241	64	expression	expression	NOUN
bionys-314	241	65	of	of	ADP
bionys-314	241	66	superoxide	superoxide	NOUN
bionys-314	241	67	dismutase	dismutase	NOUN
bionys-314	241	68	.	.	PUNCT
bionys-314	242	1	with	with	ADP
bionys-314	242	2	the	the	DET
bionys-314	242	3	re	re	NOUN
bionys-314	242	4	-	-	NOUN
bionys-314	242	5	irrigation	irrigation	NOUN
bionys-314	242	6	of	of	ADP
bionys-314	242	7	the	the	DET
bionys-314	242	8	samples	sample	NOUN
bionys-314	242	9	,	,	PUNCT
bionys-314	242	10	the	the	DET
bionys-314	242	11	expression	expression	NOUN
bionys-314	242	12	of	of	ADP
bionys-314	242	13	superoxide	superoxide	NOUN
bionys-314	242	14	dismutase	dismutase	NOUN
bionys-314	242	15	and	and	CCONJ
bionys-314	242	16	the	the	DET
bionys-314	242	17	levels	level	NOUN
bionys-314	242	18	of	of	ADP
bionys-314	242	19	malondialdehyde	malondialdehyde	NOUN
bionys-314	242	20	are	be	AUX
bionys-314	242	21	also	also	ADV
bionys-314	242	22	decreased	decrease	VERB
bionys-314	242	23	in	in	ADP
bionys-314	242	24	dn	dn	NOUN
bionys-314	242	25	clone	clone	NOUN
bionys-314	242	26	similar	similar	ADJ
bionys-314	242	27	to	to	ADP
bionys-314	242	28	clone	clone	NOUN
bionys-314	242	29	100	100	NUM
bionys-314	242	30	,	,	PUNCT
bionys-314	242	31	indicating	indicate	VERB
bionys-314	242	32	that	that	SCONJ
bionys-314	242	33	this	this	DET
bionys-314	242	34	clone	clone	NOUN
bionys-314	242	35	has	have	AUX
bionys-314	242	36	been	be	AUX
bionys-314	242	37	out	out	ADP
bionys-314	242	38	of	of	ADP
bionys-314	242	39	stress	stress	NOUN
bionys-314	242	40	.	.	PUNCT
bionys-314	243	1	therefore	therefore	ADV
bionys-314	243	2	,	,	PUNCT
bionys-314	243	3	in	in	ADP
bionys-314	243	4	terms	term	NOUN
bionys-314	243	5	of	of	ADP
bionys-314	243	6	some	some	DET
bionys-314	243	7	responses	response	NOUN
bionys-314	243	8	to	to	ADP
bionys-314	243	9	drought	drought	NOUN
bionys-314	243	10	stress	stress	NOUN
bionys-314	243	11	,	,	PUNCT
bionys-314	243	12	clone	clone	NOUN
bionys-314	243	13	100	100	NUM
bionys-314	243	14	can	can	AUX
bionys-314	243	15	be	be	AUX
bionys-314	243	16	introduced	introduce	VERB
bionys-314	243	17	as	as	ADP
bionys-314	243	18	a	a	DET
bionys-314	243	19	more	more	ADV
bionys-314	243	20	compatible	compatible	ADJ
bionys-314	243	21	clone	clone	NOUN
bionys-314	243	22	for	for	ADP
bionys-314	243	23	planting	plant	VERB
bionys-314	243	24	in	in	ADP
bionys-314	243	25	the	the	DET
bionys-314	243	26	north	north	NOUN
bionys-314	243	27	region	region	NOUN
bionys-314	243	28	of	of	ADP
bionys-314	243	29	iran	iran	PROPN
bionys-314	243	30	.	.	PUNCT
bionys-314	244	1	acknowledgements	acknowledgement	NOUN
bionys-314	244	2	.	.	PUNCT
bionys-314	245	1	the	the	DET
bionys-314	245	2	authors	author	NOUN
bionys-314	245	3	acknowledge	acknowledge	VERB
bionys-314	245	4	for	for	ADP
bionys-314	245	5	the	the	DET
bionys-314	245	6	plant	plant	NOUN
bionys-314	245	7	material	material	NOUN
bionys-314	245	8	provided	provide	VERB
bionys-314	245	9	by	by	ADP
bionys-314	245	10	tea	tea	NOUN
bionys-314	245	11	research	research	PROPN
bionys-314	245	12	institute	institute	PROPN
bionys-314	245	13	of	of	ADP
bionys-314	245	14	lahijan	lahijan	PROPN
bionys-314	245	15	,	,	PUNCT
bionys-314	245	16	iran	iran	PROPN
bionys-314	245	17	.	.	PUNCT
bionys-314	246	1	references	reference	NOUN
bionys-314	246	2	allen	allen	PROPN
bionys-314	246	3	,	,	PUNCT
bionys-314	246	4	d.	d.	PROPN
bionys-314	246	5	j.	j.	PROPN
bionys-314	246	6	,	,	PUNCT
bionys-314	246	7	ort	ort	PROPN
bionys-314	246	8	,	,	PUNCT
bionys-314	246	9	d.	d.	PROPN
bionys-314	246	10	r.	r.	PROPN
bionys-314	246	11	2001	2001	NUM
bionys-314	246	12	:	:	PUNCT
bionys-314	246	13	impacts	impact	NOUN
bionys-314	246	14	of	of	ADP
bionys-314	246	15	chilling	chilling	ADJ
bionys-314	246	16	temperatures	temperature	NOUN
bionys-314	246	17	on	on	ADP
bionys-314	246	18	photosynthesis	photosynthesis	NOUN
bionys-314	246	19	in	in	ADP
bionys-314	246	20	warm	warm	ADJ
bionys-314	246	21	-	-	PUNCT
bionys-314	246	22	climate	climate	NOUN
bionys-314	246	23	plants	plant	NOUN
bionys-314	246	24	.	.	PUNCT
bionys-314	247	1	trends	trend	NOUN
bionys-314	247	2	in	in	ADP
bionys-314	247	3	plant	plant	NOUN
bionys-314	247	4	science	science	NOUN
bionys-314	247	5	,	,	PUNCT
bionys-314	247	6	6	6	NUM
bionys-314	247	7	(	(	PUNCT
bionys-314	247	8	1	1	NUM
bionys-314	247	9	):	):	PUNCT
bionys-314	247	10	36	36	NUM
bionys-314	247	11	-	-	SYM
bionys-314	247	12	42	42	NUM
bionys-314	247	13	.	.	PUNCT
bionys-314	248	1	anjum	anjum	PROPN
bionys-314	248	2	,	,	PUNCT
bionys-314	248	3	s.	s.	PROPN
bionys-314	248	4	a.	a.	PROPN
bionys-314	248	5	,	,	PUNCT
bionys-314	248	6	xie	xie	PROPN
bionys-314	248	7	,	,	PUNCT
bionys-314	248	8	x.-y	x.-y	PROPN
bionys-314	248	9	.	.	PROPN
bionys-314	248	10	,	,	PUNCT
bionys-314	248	11	wang	wang	PROPN
bionys-314	248	12	,	,	PUNCT
bionys-314	248	13	l.	l.	PROPN
bionys-314	248	14	,	,	PUNCT
bionys-314	248	15	saleem	saleem	PROPN
bionys-314	248	16	,	,	PUNCT
bionys-314	248	17	m.	m.	PROPN
bionys-314	248	18	f.	f.	PROPN
bionys-314	248	19	,	,	PUNCT
bionys-314	248	20	man	man	NOUN
bionys-314	248	21	,	,	PUNCT
bionys-314	248	22	c.	c.	PROPN
bionys-314	248	23	,	,	PUNCT
bionys-314	248	24	lei	lei	PROPN
bionys-314	248	25	,	,	PUNCT
bionys-314	248	26	w.	w.	NOUN
bionys-314	248	27	2011	2011	NUM
bionys-314	248	28	:	:	PUNCT
bionys-314	248	29	morphological	morphological	ADJ
bionys-314	248	30	,	,	PUNCT
bionys-314	248	31	physiological	physiological	ADJ
bionys-314	248	32	and	and	CCONJ
bionys-314	248	33	biochemical	biochemical	ADJ
bionys-314	248	34	responses	response	NOUN
bionys-314	248	35	of	of	ADP
bionys-314	248	36	plants	plant	NOUN
bionys-314	248	37	to	to	ADP
bionys-314	248	38	drought	drought	NOUN
bionys-314	248	39	stress	stress	NOUN
bionys-314	248	40	.	.	PUNCT
bionys-314	249	1	african	african	ADJ
bionys-314	249	2	journal	journal	NOUN
bionys-314	249	3	of	of	ADP
bionys-314	249	4	agricultural	agricultural	ADJ
bionys-314	249	5	research	research	NOUN
bionys-314	249	6	,	,	PUNCT
bionys-314	249	7	6	6	NUM
bionys-314	249	8	(	(	PUNCT
bionys-314	249	9	9	9	NUM
bionys-314	249	10	):	):	PUNCT
bionys-314	249	11	2026	2026	NUM
bionys-314	249	12	-	-	SYM
bionys-314	249	13	2032	2032	NUM
bionys-314	249	14	.	.	PUNCT
bionys-314	250	1	asada	asada	PROPN
bionys-314	250	2	k.	k.	PROPN
bionys-314	250	3	2006	2006	NUM
bionys-314	250	4	:	:	PUNCT
bionys-314	251	1	production	production	NOUN
bionys-314	251	2	and	and	CCONJ
bionys-314	251	3	scavenging	scavenging	NOUN
bionys-314	251	4	of	of	ADP
bionys-314	251	5	active	active	ADJ
bionys-314	251	6	oxygen	oxygen	NOUN
bionys-314	251	7	in	in	ADP
bionys-314	251	8	photosynthesis	photosynthesis	NOUN
bionys-314	251	9	.	.	PUNCT
bionys-314	252	1	plant	plant	NOUN
bionys-314	252	2	physiology	physiology	NOUN
bionys-314	252	3	,	,	PUNCT
bionys-314	252	4	141	141	NUM
bionys-314	252	5	,	,	PUNCT
bionys-314	252	6	391	391	NUM
bionys-314	252	7	̶	̶	PROPN
bionys-314	252	8	396	396	NUM
bionys-314	252	9	.	.	PUNCT
bionys-314	253	1	bannister	bannister	PROPN
bionys-314	253	2	,	,	PUNCT
bionys-314	253	3	j.	j.	PROPN
bionys-314	253	4	v.	v.	PROPN
bionys-314	253	5	,	,	PUNCT
bionys-314	253	6	bannister	bannister	PROPN
bionys-314	253	7	,	,	PUNCT
bionys-314	253	8	w.	w.	PROPN
bionys-314	253	9	h.	h.	PROPN
bionys-314	253	10	,	,	PUNCT
bionys-314	253	11	rotilio	rotilio	NOUN
bionys-314	253	12	,	,	PUNCT
bionys-314	253	13	g.	g.	PROPN
bionys-314	253	14	1987	1987	NUM
bionys-314	253	15	:	:	PUNCT
bionys-314	253	16	aspects	aspect	NOUN
bionys-314	253	17	of	of	ADP
bionys-314	253	18	the	the	DET
bionys-314	253	19	structure	structure	NOUN
bionys-314	253	20	,	,	PUNCT
bionys-314	253	21	function	function	NOUN
bionys-314	253	22	,	,	PUNCT
bionys-314	253	23	and	and	CCONJ
bionys-314	253	24	applications	application	NOUN
bionys-314	253	25	52	52	NUM
bionys-314	253	26	biologica	biologica	NOUN
bionys-314	253	27	nyssana	nyssana	PROPN
bionys-314	254	1	●	●	PUNCT
bionys-314	254	2	11	11	NUM
bionys-314	254	3	(	(	PUNCT
bionys-314	254	4	1	1	NUM
bionys-314	254	5	)	)	PUNCT
bionys-314	254	6	september	september	PROPN
bionys-314	254	7	2020	2020	NUM
bionys-314	254	8	:	:	PUNCT
bionys-314	254	9	45	45	NUM
bionys-314	254	10	-	-	SYM
bionys-314	254	11	54	54	NUM
bionys-314	254	12	mohammadi	mohammadi	NOUN
bionys-314	254	13	et	et	PROPN
bionys-314	254	14	al	al	PROPN
bionys-314	254	15	.	.	PUNCT
bionys-314	255	1	●	●	PUNCT
bionys-314	255	2	a	a	DET
bionys-314	255	3	real	real	ADJ
bionys-314	255	4	-	-	PUNCT
bionys-314	255	5	time	time	NOUN
bionys-314	255	6	pcr	pcr	NOUN
bionys-314	255	7	assay	assay	NOUN
bionys-314	255	8	for	for	ADP
bionys-314	255	9	evaluation	evaluation	NOUN
bionys-314	255	10	of	of	ADP
bionys-314	255	11	drought	drought	NOUN
bionys-314	255	12	tolerance	tolerance	NOUN
bionys-314	255	13	in	in	ADP
bionys-314	255	14	a	a	DET
bionys-314	255	15	new	new	ADJ
bionys-314	255	16	tea	tea	NOUN
bionys-314	255	17	clone	clone	NOUN
bionys-314	255	18	of	of	ADP
bionys-314	255	19	superoxide	superoxide	NOUN
bionys-314	255	20	dismutase	dismutase	NOUN
bionys-314	255	21	.	.	PUNCT
bionys-314	256	1	critical	critical	ADJ
bionys-314	256	2	reviews	review	NOUN
bionys-314	256	3	in	in	ADP
bionys-314	256	4	biochemistry	biochemistry	NOUN
bionys-314	256	5	and	and	CCONJ
bionys-314	256	6	molecular	molecular	ADJ
bionys-314	256	7	biology	biology	NOUN
bionys-314	256	8	,	,	PUNCT
bionys-314	256	9	22(2	22(2	NUM
bionys-314	256	10	):	):	PUNCT
bionys-314	256	11	111180	111180	NUM
bionys-314	256	12	.	.	PUNCT
bionys-314	257	1	barrs	barrs	PROPN
bionys-314	257	2	h.	h.	PROPN
bionys-314	257	3	,	,	PUNCT
bionys-314	257	4	weatherley	weatherley	PROPN
bionys-314	257	5	p.	p.	PROPN
bionys-314	257	6	1962	1962	NUM
bionys-314	257	7	,	,	PUNCT
bionys-314	257	8	a	a	DET
bionys-314	257	9	re	re	NOUN
bionys-314	257	10	-	-	NOUN
bionys-314	257	11	examination	examination	NOUN
bionys-314	257	12	of	of	ADP
bionys-314	257	13	the	the	DET
bionys-314	257	14	relative	relative	ADJ
bionys-314	257	15	turgidity	turgidity	NOUN
bionys-314	257	16	technique	technique	NOUN
bionys-314	257	17	for	for	ADP
bionys-314	257	18	estimating	estimate	VERB
bionys-314	257	19	water	water	NOUN
bionys-314	257	20	deficits	deficit	NOUN
bionys-314	257	21	in	in	ADP
bionys-314	257	22	leaves	leave	NOUN
bionys-314	257	23	.	.	PUNCT
bionys-314	258	1	australian	australian	ADJ
bionys-314	258	2	journal	journal	NOUN
bionys-314	258	3	of	of	ADP
bionys-314	258	4	biological	biological	ADJ
bionys-314	258	5	sciences	science	NOUN
bionys-314	258	6	,	,	PUNCT
bionys-314	258	7	15	15	NUM
bionys-314	258	8	:	:	SYM
bionys-314	258	9	413	413	NUM
bionys-314	258	10	̶	̶	NOUN
bionys-314	258	11	428	428	NUM
bionys-314	258	12	.	.	PUNCT
bionys-314	259	1	bates	bates	PROPN
bionys-314	259	2	l.	l.	PROPN
bionys-314	259	3	,	,	PUNCT
bionys-314	259	4	waldren	waldren	PROPN
bionys-314	259	5	r.	r.	PROPN
bionys-314	259	6	,	,	PUNCT
bionys-314	259	7	teare	teare	VERB
bionys-314	259	8	i.	i.	PROPN
bionys-314	259	9	1973	1973	NUM
bionys-314	259	10	:	:	PUNCT
bionys-314	259	11	rapid	rapid	ADJ
bionys-314	259	12	determination	determination	NOUN
bionys-314	259	13	of	of	ADP
bionys-314	259	14	free	free	ADJ
bionys-314	259	15	proline	proline	NOUN
bionys-314	259	16	for	for	ADP
bionys-314	259	17	water	water	NOUN
bionys-314	259	18	-	-	PUNCT
bionys-314	259	19	stress	stress	NOUN
bionys-314	259	20	studies	study	NOUN
bionys-314	259	21	.	.	PUNCT
bionys-314	260	1	plant	plant	NOUN
bionys-314	260	2	soil	soil	NOUN
bionys-314	260	3	,	,	PUNCT
bionys-314	260	4	39	39	NUM
bionys-314	260	5	:	:	SYM
bionys-314	260	6	205	205	NUM
bionys-314	260	7	̶	̶	PROPN
bionys-314	260	8	207	207	NUM
bionys-314	260	9	.	.	PUNCT
bionys-314	261	1	baum	baum	PROPN
bionys-314	261	2	,	,	PUNCT
bionys-314	261	3	j.	j.	PROPN
bionys-314	261	4	a.	a.	PROPN
bionys-314	261	5	,	,	PUNCT
bionys-314	261	6	scandalios	scandalios	PROPN
bionys-314	261	7	,	,	PUNCT
bionys-314	261	8	j.	j.	PROPN
bionys-314	261	9	g.	g.	PROPN
bionys-314	261	10	1981	1981	NUM
bionys-314	261	11	:	:	PUNCT
bionys-314	261	12	isolation	isolation	NOUN
bionys-314	261	13	and	and	CCONJ
bionys-314	261	14	characterization	characterization	NOUN
bionys-314	261	15	of	of	ADP
bionys-314	261	16	the	the	DET
bionys-314	261	17	cytosolic	cytosolic	ADJ
bionys-314	261	18	and	and	CCONJ
bionys-314	261	19	mitochondrial	mitochondrial	ADJ
bionys-314	261	20	superoxide	superoxide	NOUN
bionys-314	261	21	dismutases	dismutase	NOUN
bionys-314	261	22	of	of	ADP
bionys-314	261	23	maize	maize	NOUN
bionys-314	261	24	.	.	PUNCT
bionys-314	262	1	archives	archive	NOUN
bionys-314	262	2	of	of	ADP
bionys-314	262	3	biochemistry	biochemistry	NOUN
bionys-314	262	4	and	and	CCONJ
bionys-314	262	5	biophysics	biophysic	NOUN
bionys-314	262	6	,	,	PUNCT
bionys-314	262	7	206	206	NUM
bionys-314	262	8	(	(	PUNCT
bionys-314	262	9	2	2	NUM
bionys-314	262	10	):	):	PUNCT
bionys-314	262	11	249	249	NUM
bionys-314	262	12	-	-	SYM
bionys-314	262	13	264	264	NUM
bionys-314	262	14	.	.	PUNCT
bionys-314	263	1	black	black	ADJ
bionys-314	263	2	c.	c.	PROPN
bionys-314	263	3	a.	a.	PROPN
bionys-314	263	4	1965	1965	NUM
bionys-314	263	5	,	,	PUNCT
bionys-314	263	6	methods	method	NOUN
bionys-314	263	7	of	of	ADP
bionys-314	263	8	soil	soil	NOUN
bionys-314	263	9	analysis	analysis	NOUN
bionys-314	263	10	:	:	PUNCT
bionys-314	263	11	part	part	NOUN
bionys-314	263	12	i	i	NOUN
bionys-314	263	13	,	,	PUNCT
bionys-314	263	14	physical	physical	ADJ
bionys-314	263	15	and	and	CCONJ
bionys-314	263	16	mineralogical	mineralogical	ADJ
bionys-314	263	17	properties	property	NOUN
bionys-314	263	18	.	.	PUNCT
bionys-314	264	1	american	american	ADJ
bionys-314	264	2	society	society	NOUN
bionys-314	264	3	of	of	ADP
bionys-314	264	4	agronomy	agronomy	NOUN
bionys-314	264	5	,	,	PUNCT
bionys-314	264	6	madison	madison	PROPN
bionys-314	264	7	,	,	PUNCT
bionys-314	264	8	wisconsin	wisconsin	PROPN
bionys-314	264	9	,	,	PUNCT
bionys-314	264	10	1572	1572	NUM
bionys-314	264	11	p.	p.	NOUN
bionys-314	264	12	bowler	bowler	NOUN
bionys-314	264	13	,	,	PUNCT
bionys-314	264	14	c.	c.	PROPN
bionys-314	264	15	,	,	PUNCT
bionys-314	264	16	montagu	montagu	PROPN
bionys-314	264	17	,	,	PUNCT
bionys-314	264	18	m.	m.	NOUN
bionys-314	264	19	v.	v.	PROPN
bionys-314	264	20	,	,	PUNCT
bionys-314	264	21	inze	inze	NOUN
bionys-314	264	22	,	,	PUNCT
bionys-314	264	23	d.	d.	PROPN
bionys-314	264	24	1992	1992	NUM
bionys-314	264	25	:	:	PUNCT
bionys-314	264	26	superoxide	superoxide	NOUN
bionys-314	264	27	dismutase	dismutase	NOUN
bionys-314	264	28	and	and	CCONJ
bionys-314	264	29	stress	stress	NOUN
bionys-314	264	30	tolerance	tolerance	NOUN
bionys-314	264	31	.	.	PUNCT
bionys-314	265	1	annual	annual	ADJ
bionys-314	265	2	review	review	NOUN
bionys-314	265	3	of	of	ADP
bionys-314	265	4	plant	plant	NOUN
bionys-314	265	5	biology	biology	NOUN
bionys-314	265	6	,	,	PUNCT
bionys-314	265	7	43	43	NUM
bionys-314	265	8	(	(	PUNCT
bionys-314	265	9	1	1	NUM
bionys-314	265	10	):	):	PUNCT
bionys-314	265	11	83	83	NUM
bionys-314	265	12	-	-	SYM
bionys-314	265	13	116	116	NUM
bionys-314	265	14	.	.	PUNCT
bionys-314	266	1	chapman	chapman	PROPN
bionys-314	266	2	s.c	s.c	PROPN
bionys-314	266	3	.	.	PROPN
bionys-314	266	4	,	,	PUNCT
bionys-314	266	5	barreto	barreto	PROPN
bionys-314	266	6	h.j	h.j	PROPN
bionys-314	266	7	.	.	PROPN
bionys-314	266	8	1997	1997	NUM
bionys-314	266	9	:	:	PUNCT
bionys-314	266	10	using	use	VERB
bionys-314	266	11	a	a	DET
bionys-314	266	12	chlorophyll	chlorophyll	NOUN
bionys-314	266	13	meter	meter	NOUN
bionys-314	266	14	to	to	PART
bionys-314	266	15	estimate	estimate	VERB
bionys-314	266	16	specific	specific	ADJ
bionys-314	266	17	leaf	leaf	NOUN
bionys-314	266	18	nitrogen	nitrogen	NOUN
bionys-314	266	19	of	of	ADP
bionys-314	266	20	tropical	tropical	ADJ
bionys-314	266	21	maize	maize	NOUN
bionys-314	266	22	during	during	ADP
bionys-314	266	23	vegetative	vegetative	ADJ
bionys-314	266	24	growth	growth	NOUN
bionys-314	266	25	.	.	PUNCT
bionys-314	267	1	agronomy	agronomy	NOUN
bionys-314	267	2	journal	journal	NOUN
bionys-314	267	3	,	,	PUNCT
bionys-314	267	4	89	89	NUM
bionys-314	267	5	:	:	SYM
bionys-314	267	6	557	557	NUM
bionys-314	267	7	̶	̶	PROPN
bionys-314	267	8	562	562	NUM
bionys-314	267	9	.	.	PUNCT
bionys-314	267	10	clare	clare	PROPN
bionys-314	267	11	,	,	PUNCT
bionys-314	267	12	d.	d.	PROPN
bionys-314	267	13	a.	a.	PROPN
bionys-314	267	14	,	,	PUNCT
bionys-314	267	15	rabinowitch	rabinowitch	PROPN
bionys-314	267	16	,	,	PUNCT
bionys-314	267	17	h.	h.	PROPN
bionys-314	267	18	d.	d.	PROPN
bionys-314	267	19	,	,	PUNCT
bionys-314	267	20	fridovich	fridovich	PROPN
bionys-314	267	21	,	,	PUNCT
bionys-314	267	22	i.	i.	PROPN
bionys-314	267	23	1984	1984	NUM
bionys-314	267	24	:	:	PUNCT
bionys-314	267	25	superoxide	superoxide	NOUN
bionys-314	267	26	dismutase	dismutase	NOUN
bionys-314	267	27	and	and	CCONJ
bionys-314	267	28	chilling	chilling	ADJ
bionys-314	267	29	injury	injury	NOUN
bionys-314	267	30	in	in	ADP
bionys-314	267	31	chlorella	chlorella	NOUN
bionys-314	267	32	ellipsoidea	ellipsoidea	NOUN
bionys-314	267	33	.	.	PUNCT
bionys-314	268	1	archives	archive	NOUN
bionys-314	268	2	of	of	ADP
bionys-314	268	3	biochemistry	biochemistry	NOUN
bionys-314	268	4	and	and	CCONJ
bionys-314	268	5	biophysics	biophysic	NOUN
bionys-314	268	6	,	,	PUNCT
bionys-314	268	7	231	231	NUM
bionys-314	268	8	(	(	PUNCT
bionys-314	268	9	1	1	NUM
bionys-314	268	10	):	):	PUNCT
bionys-314	268	11	158	158	NUM
bionys-314	268	12	-	-	SYM
bionys-314	268	13	163	163	NUM
bionys-314	268	14	.	.	PUNCT
bionys-314	269	1	faize	faize	NOUN
bionys-314	269	2	,	,	PUNCT
bionys-314	269	3	m.	m.	NOUN
bionys-314	269	4	,	,	PUNCT
bionys-314	269	5	burgos	burgos	PROPN
bionys-314	269	6	,	,	PUNCT
bionys-314	269	7	l.	l.	PROPN
bionys-314	269	8	,	,	PUNCT
bionys-314	269	9	faize	faize	PROPN
bionys-314	269	10	,	,	PUNCT
bionys-314	269	11	l.	l.	PROPN
bionys-314	269	12	,	,	PUNCT
bionys-314	269	13	piqueras	piqueras	PROPN
bionys-314	269	14	,	,	PUNCT
bionys-314	269	15	a.	a.	PROPN
bionys-314	269	16	,	,	PUNCT
bionys-314	269	17	nicolas	nicolas	PROPN
bionys-314	269	18	,	,	PUNCT
bionys-314	269	19	e.	e.	PROPN
bionys-314	269	20	,	,	PUNCT
bionys-314	269	21	barba	barba	NOUN
bionys-314	269	22	-	-	PUNCT
bionys-314	269	23	espin	espin	NOUN
bionys-314	269	24	,	,	PUNCT
bionys-314	269	25	g.	g.	PROPN
bionys-314	269	26	,	,	PUNCT
bionys-314	269	27	clemente	clemente	PROPN
bionys-314	269	28	-	-	PROPN
bionys-314	269	29	moreno	moreno	PROPN
bionys-314	269	30	m.j	m.j	PROPN
bionys-314	269	31	.	.	PROPN
bionys-314	269	32	,	,	PUNCT
bionys-314	269	33	alcobendas	alcobendas	PROPN
bionys-314	269	34	r.	r.	PROPN
bionys-314	269	35	,	,	PUNCT
bionys-314	269	36	artlip	artlip	PROPN
bionys-314	269	37	t.	t.	PROPN
bionys-314	269	38	,	,	PUNCT
bionys-314	269	39	hernandez	hernandez	PROPN
bionys-314	269	40	j.a	j.a	PROPN
bionys-314	269	41	.	.	PROPN
bionys-314	269	42	2011	2011	NUM
bionys-314	269	43	:	:	PUNCT
bionys-314	270	1	involvement	involvement	NOUN
bionys-314	270	2	of	of	ADP
bionys-314	270	3	cytosolic	cytosolic	ADJ
bionys-314	270	4	ascorbate	ascorbate	NOUN
bionys-314	270	5	peroxidase	peroxidase	NOUN
bionys-314	270	6	and	and	CCONJ
bionys-314	270	7	cu	cu	PROPN
bionys-314	270	8	/	/	SYM
bionys-314	270	9	zn	zn	PROPN
bionys-314	270	10	-	-	PUNCT
bionys-314	270	11	superoxide	superoxide	NOUN
bionys-314	270	12	dismutase	dismutase	NOUN
bionys-314	270	13	for	for	ADP
bionys-314	270	14	improved	improved	ADJ
bionys-314	270	15	tolerance	tolerance	NOUN
bionys-314	270	16	against	against	ADP
bionys-314	270	17	drought	drought	NOUN
bionys-314	270	18	stress	stress	NOUN
bionys-314	270	19	.	.	PUNCT
bionys-314	271	1	journal	journal	NOUN
bionys-314	271	2	of	of	ADP
bionys-314	271	3	experimental	experimental	ADJ
bionys-314	271	4	botany	botany	NOUN
bionys-314	271	5	,	,	PUNCT
bionys-314	271	6	1	1	NUM
bionys-314	271	7	:	:	SYM
bionys-314	271	8	1	1	NUM
bionys-314	271	9	-	-	SYM
bionys-314	271	10	15	15	NUM
bionys-314	271	11	.	.	PUNCT
bionys-314	272	1	farooq	farooq	PROPN
bionys-314	272	2	,	,	PUNCT
bionys-314	272	3	m.	m.	NOUN
bionys-314	272	4	,	,	PUNCT
bionys-314	272	5	wahid	wahid	PROPN
bionys-314	272	6	,	,	PUNCT
bionys-314	272	7	a.	a.	PROPN
bionys-314	272	8	,	,	PUNCT
bionys-314	272	9	kobayashi	kobayashi	PROPN
bionys-314	272	10	,	,	PUNCT
bionys-314	272	11	n.	n.	PROPN
bionys-314	272	12	,	,	PUNCT
bionys-314	272	13	fujita	fujita	PROPN
bionys-314	272	14	,	,	PUNCT
bionys-314	272	15	d.	d.	PROPN
bionys-314	272	16	,	,	PUNCT
bionys-314	272	17	basra	basra	PROPN
bionys-314	272	18	,	,	PUNCT
bionys-314	272	19	s.	s.	PROPN
bionys-314	272	20	2009	2009	NUM
bionys-314	272	21	:	:	PUNCT
bionys-314	272	22	plant	plant	NOUN
bionys-314	272	23	drought	drought	NOUN
bionys-314	272	24	stress	stress	NOUN
bionys-314	272	25	:	:	PUNCT
bionys-314	272	26	effects	effect	NOUN
bionys-314	272	27	,	,	PUNCT
bionys-314	272	28	mechanisms	mechanism	NOUN
bionys-314	272	29	and	and	CCONJ
bionys-314	272	30	management	management	NOUN
bionys-314	272	31	.	.	PUNCT
bionys-314	273	1	in	in	ADP
bionys-314	273	2	sustainable	sustainable	ADJ
bionys-314	273	3	agriculture	agriculture	NOUN
bionys-314	273	4	,	,	PUNCT
bionys-314	273	5	29	29	NUM
bionys-314	273	6	:	:	SYM
bionys-314	273	7	153	153	NUM
bionys-314	273	8	-	-	SYM
bionys-314	273	9	188	188	NUM
bionys-314	273	10	.	.	PUNCT
bionys-314	274	1	gachon	gachon	PROPN
bionys-314	274	2	,	,	PUNCT
bionys-314	274	3	c.	c.	PROPN
bionys-314	274	4	,	,	PUNCT
bionys-314	274	5	mingam	mingam	ADV
bionys-314	274	6	,	,	PUNCT
bionys-314	274	7	a.	a.	NOUN
bionys-314	274	8	,	,	PUNCT
bionys-314	274	9	charrier	charrier	NOUN
bionys-314	274	10	,	,	PUNCT
bionys-314	274	11	b.	b.	PROPN
bionys-314	274	12	2004	2004	NUM
bionys-314	274	13	:	:	PUNCT
bionys-314	274	14	realtime	realtime	VERB
bionys-314	274	15	pcr	pcr	NOUN
bionys-314	274	16	:	:	PUNCT
bionys-314	274	17	what	what	DET
bionys-314	274	18	relevance	relevance	NOUN
bionys-314	274	19	to	to	PART
bionys-314	274	20	plant	plant	VERB
bionys-314	274	21	studies	study	NOUN
bionys-314	274	22	?	?	PUNCT
bionys-314	275	1	journal	journal	NOUN
bionys-314	275	2	of	of	ADP
bionys-314	275	3	experimental	experimental	ADJ
bionys-314	275	4	botany	botany	NOUN
bionys-314	275	5	,	,	PUNCT
bionys-314	275	6	55	55	NUM
bionys-314	275	7	(	(	PUNCT
bionys-314	275	8	402	402	NUM
bionys-314	275	9	):	):	PUNCT
bionys-314	275	10	1445	1445	NUM
bionys-314	275	11	-	-	SYM
bionys-314	275	12	1454	1454	NUM
bionys-314	275	13	.	.	PUNCT
bionys-314	276	1	gamble	gamble	NOUN
bionys-314	276	2	,	,	PUNCT
bionys-314	276	3	p.	p.	PROPN
bionys-314	276	4	e.	e.	PROPN
bionys-314	276	5	,	,	PUNCT
bionys-314	276	6	burke	burke	PROPN
bionys-314	276	7	,	,	PUNCT
bionys-314	276	8	j.	j.	PROPN
bionys-314	276	9	j.	j.	PROPN
bionys-314	276	10	1984	1984	NUM
bionys-314	276	11	:	:	PUNCT
bionys-314	277	1	effect	effect	NOUN
bionys-314	277	2	of	of	ADP
bionys-314	277	3	water	water	NOUN
bionys-314	277	4	stress	stress	NOUN
bionys-314	277	5	on	on	ADP
bionys-314	277	6	the	the	DET
bionys-314	277	7	chloroplast	chloroplast	ADJ
bionys-314	277	8	antioxidant	antioxidant	ADJ
bionys-314	277	9	system	system	NOUN
bionys-314	277	10	i.	i.	NOUN
bionys-314	277	11	alterations	alteration	NOUN
bionys-314	277	12	in	in	ADP
bionys-314	277	13	glutathione	glutathione	NOUN
bionys-314	277	14	reductase	reductase	NOUN
bionys-314	277	15	activity	activity	NOUN
bionys-314	277	16	.	.	PUNCT
bionys-314	278	1	plant	plant	NOUN
bionys-314	278	2	physiology	physiology	NOUN
bionys-314	278	3	,	,	PUNCT
bionys-314	278	4	76	76	NUM
bionys-314	278	5	(	(	PUNCT
bionys-314	278	6	3	3	NUM
bionys-314	278	7	):	):	PUNCT
bionys-314	278	8	615	615	NUM
bionys-314	278	9	-	-	SYM
bionys-314	278	10	621	621	NUM
bionys-314	278	11	.	.	PUNCT
bionys-314	279	1	heath	heath	PROPN
bionys-314	279	2	r.l	r.l	PROPN
bionys-314	279	3	.	.	PROPN
bionys-314	279	4	,	,	PUNCT
bionys-314	279	5	packer	packer	PROPN
bionys-314	279	6	l.	l.	PROPN
bionys-314	279	7	1968	1968	NUM
bionys-314	279	8	:	:	PUNCT
bionys-314	279	9	photoperoxidation	photoperoxidation	NOUN
bionys-314	279	10	in	in	ADP
bionys-314	279	11	isolated	isolated	ADJ
bionys-314	279	12	chloroplasts	chloroplast	NOUN
bionys-314	279	13	:	:	PUNCT
bionys-314	279	14	i.	i.	NOUN
bionys-314	279	15	kinetics	kinetic	NOUN
bionys-314	279	16	and	and	CCONJ
bionys-314	279	17	stoichiometry	stoichiometry	NOUN
bionys-314	279	18	of	of	ADP
bionys-314	279	19	fatty	fatty	NOUN
bionys-314	279	20	acid	acid	NOUN
bionys-314	279	21	peroxidation	peroxidation	NOUN
bionys-314	279	22	.	.	PUNCT
bionys-314	280	1	archives	archive	NOUN
bionys-314	280	2	of	of	ADP
bionys-314	280	3	biochemistry	biochemistry	NOUN
bionys-314	280	4	and	and	CCONJ
bionys-314	280	5	biophysics	biophysic	NOUN
bionys-314	280	6	,	,	PUNCT
bionys-314	280	7	125	125	NUM
bionys-314	280	8	:	:	SYM
bionys-314	280	9	189	189	NUM
bionys-314	280	10	̶	̶	PROPN
bionys-314	280	11	198	198	NUM
bionys-314	280	12	.	.	PUNCT
bionys-314	281	1	53	53	NUM
bionys-314	281	2	jamal	jamal	PROPN
bionys-314	281	3	,	,	PUNCT
bionys-314	281	4	a.	a.	PROPN
bionys-314	281	5	,	,	PUNCT
bionys-314	281	6	yoo	yoo	PROPN
bionys-314	281	7	,	,	PUNCT
bionys-314	281	8	n.	n.	PROPN
bionys-314	281	9	h.	h.	PROPN
bionys-314	281	10	,	,	PUNCT
bionys-314	281	11	yun	yun	PROPN
bionys-314	281	12	,	,	PUNCT
bionys-314	281	13	s.	s.	PROPN
bionys-314	281	14	j.	j.	PROPN
bionys-314	281	15	2006	2006	NUM
bionys-314	281	16	:	:	PUNCT
bionys-314	281	17	isoformspecific	isoformspecific	ADJ
bionys-314	281	18	responses	response	NOUN
bionys-314	281	19	of	of	ADP
bionys-314	281	20	superoxide	superoxide	NOUN
bionys-314	281	21	dismutase	dismutase	NOUN
bionys-314	281	22	to	to	PART
bionys-314	281	23	oxidative	oxidative	ADJ
bionys-314	281	24	stresses	stress	NOUN
bionys-314	281	25	and	and	CCONJ
bionys-314	281	26	hormones	hormone	NOUN
bionys-314	281	27	in	in	ADP
bionys-314	281	28	paraquat	paraquat	NOUN
bionys-314	281	29	-	-	PUNCT
bionys-314	281	30	tolerant	tolerant	ADJ
bionys-314	281	31	rehmannia	rehmannia	NOUN
bionys-314	281	32	glutinosa	glutinosa	NOUN
bionys-314	281	33	.	.	PUNCT
bionys-314	282	1	journal	journal	NOUN
bionys-314	282	2	of	of	ADP
bionys-314	282	3	agronomy	agronomy	NOUN
bionys-314	282	4	and	and	CCONJ
bionys-314	282	5	crop	crop	NOUN
bionys-314	282	6	science	science	NOUN
bionys-314	282	7	,	,	PUNCT
bionys-314	282	8	51	51	NUM
bionys-314	282	9	(	(	PUNCT
bionys-314	282	10	1	1	NUM
bionys-314	282	11	):	):	PUNCT
bionys-314	282	12	678	678	NUM
bionys-314	282	13	-	-	SYM
bionys-314	282	14	679	679	NUM
bionys-314	282	15	.	.	PUNCT
bionys-314	283	1	kurkdjian	kurkdjian	PROPN
bionys-314	283	2	,	,	PUNCT
bionys-314	283	3	a.	a.	NOUN
bionys-314	283	4	,	,	PUNCT
bionys-314	283	5	guern	guern	PROPN
bionys-314	283	6	,	,	PUNCT
bionys-314	283	7	j.	j.	PROPN
bionys-314	283	8	1989	1989	NUM
bionys-314	283	9	:	:	PUNCT
bionys-314	283	10	intracellular	intracellular	ADJ
bionys-314	283	11	ph	ph	NOUN
bionys-314	283	12	:	:	PUNCT
bionys-314	283	13	measurement	measurement	NOUN
bionys-314	283	14	and	and	CCONJ
bionys-314	283	15	importance	importance	NOUN
bionys-314	283	16	in	in	ADP
bionys-314	283	17	cell	cell	NOUN
bionys-314	283	18	activity	activity	NOUN
bionys-314	283	19	.	.	PUNCT
bionys-314	284	1	annual	annual	ADJ
bionys-314	284	2	review	review	NOUN
bionys-314	284	3	of	of	ADP
bionys-314	284	4	plant	plant	NOUN
bionys-314	284	5	biology	biology	NOUN
bionys-314	284	6	,	,	PUNCT
bionys-314	284	7	40	40	NUM
bionys-314	284	8	(	(	PUNCT
bionys-314	284	9	1	1	NUM
bionys-314	284	10	):	):	PUNCT
bionys-314	284	11	271	271	NUM
bionys-314	284	12	-	-	SYM
bionys-314	284	13	303	303	NUM
bionys-314	284	14	.	.	PUNCT
bionys-314	285	1	lascano	lascano	PROPN
bionys-314	285	2	,	,	PUNCT
bionys-314	285	3	h.	h.	PROPN
bionys-314	285	4	r.	r.	PROPN
bionys-314	285	5	,	,	PUNCT
bionys-314	285	6	antonicelli	antonicelli	PROPN
bionys-314	285	7	,	,	PUNCT
bionys-314	285	8	g.	g.	PROPN
bionys-314	285	9	e.	e.	PROPN
bionys-314	285	10	,	,	PUNCT
bionys-314	285	11	luna	luna	PROPN
bionys-314	285	12	,	,	PUNCT
bionys-314	285	13	c.	c.	PROPN
bionys-314	285	14	m.	m.	PROPN
bionys-314	285	15	,	,	PUNCT
bionys-314	285	16	melchiorre	melchiorre	PROPN
bionys-314	285	17	,	,	PUNCT
bionys-314	285	18	m.	m.	NOUN
bionys-314	285	19	n.	n.	PROPN
bionys-314	285	20	,	,	PUNCT
bionys-314	285	21	gómez	gómez	NOUN
bionys-314	285	22	,	,	PUNCT
bionys-314	285	23	l.	l.	PROPN
bionys-314	285	24	d.	d.	PROPN
bionys-314	285	25	,	,	PUNCT
bionys-314	285	26	racca	racca	PROPN
bionys-314	285	27	,	,	PUNCT
bionys-314	285	28	r.	r.	PROPN
bionys-314	285	29	w.	w.	PROPN
bionys-314	285	30	,	,	PUNCT
bionys-314	285	31	trippi	trippi	PROPN
bionys-314	285	32	v.	v.	PROPN
bionys-314	285	33	s	s	PROPN
bionys-314	285	34	,	,	PUNCT
bionys-314	285	35	casano	casano	PROPN
bionys-314	285	36	l.	l.	PROPN
bionys-314	285	37	m.	m.	PROPN
bionys-314	285	38	2001	2001	NUM
bionys-314	285	39	:	:	PUNCT
bionys-314	285	40	antioxidant	antioxidant	ADJ
bionys-314	285	41	system	system	NOUN
bionys-314	285	42	response	response	NOUN
bionys-314	285	43	of	of	ADP
bionys-314	285	44	different	different	ADJ
bionys-314	285	45	wheat	wheat	NOUN
bionys-314	285	46	cultivars	cultivar	NOUN
bionys-314	285	47	under	under	ADP
bionys-314	285	48	drought	drought	NOUN
bionys-314	285	49	:	:	PUNCT
bionys-314	285	50	field	field	NOUN
bionys-314	285	51	and	and	CCONJ
bionys-314	285	52	in	in	ADP
bionys-314	285	53	vitro	vitro	X
bionys-314	285	54	studies	study	NOUN
bionys-314	285	55	.	.	PUNCT
bionys-314	286	1	functional	functional	ADJ
bionys-314	286	2	plant	plant	NOUN
bionys-314	286	3	biology	biology	NOUN
bionys-314	286	4	,	,	PUNCT
bionys-314	286	5	28	28	NUM
bionys-314	286	6	(	(	PUNCT
bionys-314	286	7	11	11	NUM
bionys-314	286	8	):	):	PUNCT
bionys-314	286	9	1095	1095	NUM
bionys-314	286	10	-	-	SYM
bionys-314	286	11	1102	1102	NUM
bionys-314	286	12	.	.	PUNCT
bionys-314	287	1	lichtenthaler	lichtenthaler	PROPN
bionys-314	287	2	h.k	h.k	PROPN
bionys-314	287	3	.	.	PROPN
bionys-314	287	4	1987	1987	NUM
bionys-314	287	5	:	:	PUNCT
bionys-314	287	6	chlorophylls	chlorophyll	VERB
bionys-314	287	7	and	and	CCONJ
bionys-314	287	8	carotenoids	carotenoid	NOUN
bionys-314	287	9	:	:	PUNCT
bionys-314	287	10	pigments	pigment	NOUN
bionys-314	287	11	of	of	ADP
bionys-314	287	12	photosynthetic	photosynthetic	ADJ
bionys-314	287	13	biomembranes	biomembrane	NOUN
bionys-314	287	14	.	.	PUNCT
bionys-314	288	1	methods	method	NOUN
bionys-314	288	2	in	in	ADP
bionys-314	288	3	enzymology	enzymology	NOUN
bionys-314	288	4	,	,	PUNCT
bionys-314	288	5	148	148	NUM
bionys-314	288	6	:	:	PUNCT
bionys-314	288	7	350	350	NUM
bionys-314	288	8	̶	̶	PROPN
bionys-314	288	9	382	382	NUM
bionys-314	288	10	.	.	PUNCT
bionys-314	289	1	livak	livak	PROPN
bionys-314	289	2	k.j	k.j	PROPN
bionys-314	289	3	.	.	PROPN
bionys-314	289	4	,	,	PUNCT
bionys-314	289	5	schmittgen	schmittgen	PROPN
bionys-314	289	6	t.d	t.d	PROPN
bionys-314	289	7	.	.	PROPN
bionys-314	289	8	2001	2001	NUM
bionys-314	289	9	:	:	PUNCT
bionys-314	290	1	analysis	analysis	NOUN
bionys-314	290	2	of	of	ADP
bionys-314	290	3	relative	relative	ADJ
bionys-314	290	4	gene	gene	NOUN
bionys-314	290	5	expression	expression	NOUN
bionys-314	290	6	data	datum	NOUN
bionys-314	290	7	using	use	VERB
bionys-314	290	8	real	real	ADJ
bionys-314	290	9	-	-	PUNCT
bionys-314	290	10	time	time	NOUN
bionys-314	290	11	quantitative	quantitative	ADJ
bionys-314	290	12	pcr	pcr	NOUN
bionys-314	290	13	and	and	CCONJ
bionys-314	290	14	the	the	DET
bionys-314	290	15	2(-delta	2(-delta	NUM
bionys-314	290	16	delta	delta	NOUN
bionys-314	290	17	c(t	c(t	PROPN
bionys-314	290	18	)	)	PUNCT
bionys-314	290	19	)	)	PUNCT
bionys-314	290	20	method	method	NOUN
bionys-314	290	21	.	.	PUNCT
bionys-314	291	1	methods	method	NOUN
bionys-314	291	2	,	,	PUNCT
bionys-314	291	3	25	25	NUM
bionys-314	291	4	:	:	SYM
bionys-314	291	5	402	402	NUM
bionys-314	291	6	̶	̶	PROPN
bionys-314	291	7	408	408	NUM
bionys-314	291	8	.	.	PUNCT
bionys-314	292	1	machado	machado	PROPN
bionys-314	292	2	s.	s.	PROPN
bionys-314	292	3	,	,	PUNCT
bionys-314	292	4	paulsen	paulsen	PROPN
bionys-314	292	5	g.m	g.m	PROPN
bionys-314	292	6	.	.	PROPN
bionys-314	292	7	2001	2001	NUM
bionys-314	292	8	:	:	PUNCT
bionys-314	292	9	combined	combine	VERB
bionys-314	292	10	effects	effect	NOUN
bionys-314	292	11	of	of	ADP
bionys-314	292	12	drought	drought	NOUN
bionys-314	292	13	and	and	CCONJ
bionys-314	292	14	high	high	ADJ
bionys-314	292	15	temperature	temperature	NOUN
bionys-314	292	16	on	on	ADP
bionys-314	292	17	water	water	NOUN
bionys-314	292	18	relations	relation	NOUN
bionys-314	292	19	of	of	ADP
bionys-314	292	20	wheat	wheat	NOUN
bionys-314	292	21	and	and	CCONJ
bionys-314	292	22	sorghum	sorghum	NOUN
bionys-314	292	23	.	.	PUNCT
bionys-314	293	1	plant	plant	NOUN
bionys-314	293	2	soil	soil	NOUN
bionys-314	293	3	,	,	PUNCT
bionys-314	293	4	233	233	NUM
bionys-314	293	5	:	:	SYM
bionys-314	293	6	179	179	NUM
bionys-314	293	7	̶	̶	PROPN
bionys-314	293	8	187	187	NUM
bionys-314	293	9	.	.	PUNCT
bionys-314	294	1	matysik	matysik	PROPN
bionys-314	294	2	j.	j.	PROPN
bionys-314	294	3	,	,	PUNCT
bionys-314	294	4	bhalu	bhalu	PROPN
bionys-314	294	5	a.	a.	PROPN
bionys-314	294	6	,	,	PUNCT
bionys-314	294	7	mohanty	mohanty	PROPN
bionys-314	294	8	p.	p.	NOUN
bionys-314	294	9	2002	2002	NUM
bionys-314	294	10	:	:	PUNCT
bionys-314	294	11	molecular	molecular	ADJ
bionys-314	294	12	mechanism	mechanism	NOUN
bionys-314	294	13	of	of	ADP
bionys-314	294	14	quenching	quenching	NOUN
bionys-314	294	15	of	of	ADP
bionys-314	294	16	reactive	reactive	ADJ
bionys-314	294	17	oxygen	oxygen	NOUN
bionys-314	294	18	species	specie	NOUN
bionys-314	294	19	by	by	ADP
bionys-314	294	20	proline	proline	NOUN
bionys-314	294	21	under	under	ADP
bionys-314	294	22	water	water	NOUN
bionys-314	294	23	stress	stress	NOUN
bionys-314	294	24	in	in	ADP
bionys-314	294	25	plants	plant	NOUN
bionys-314	294	26	.	.	PUNCT
bionys-314	295	1	current	current	ADJ
bionys-314	295	2	science	science	NOUN
bionys-314	295	3	,	,	PUNCT
bionys-314	295	4	82	82	NUM
bionys-314	295	5	:	:	SYM
bionys-314	295	6	525	525	NUM
bionys-314	295	7	̶	̶	PROPN
bionys-314	295	8	532	532	NUM
bionys-314	295	9	.	.	PUNCT
bionys-314	296	1	monakhova	monakhova	PROPN
bionys-314	296	2	,	,	PUNCT
bionys-314	296	3	o.	o.	PROPN
bionys-314	296	4	,	,	PUNCT
bionys-314	296	5	chernyad’ev	chernyad’ev	PROPN
bionys-314	296	6	,	,	PUNCT
bionys-314	296	7	i.	i.	PROPN
bionys-314	296	8	2004	2004	NUM
bionys-314	296	9	:	:	PUNCT
bionys-314	296	10	effects	effect	NOUN
bionys-314	296	11	of	of	ADP
bionys-314	296	12	cytokinin	cytokinin	ADJ
bionys-314	296	13	preparations	preparation	NOUN
bionys-314	296	14	on	on	ADP
bionys-314	296	15	the	the	DET
bionys-314	296	16	stability	stability	NOUN
bionys-314	296	17	of	of	ADP
bionys-314	296	18	the	the	DET
bionys-314	296	19	photosynthetic	photosynthetic	ADJ
bionys-314	296	20	apparatus	apparatus	NOUN
bionys-314	296	21	of	of	ADP
bionys-314	296	22	two	two	NUM
bionys-314	296	23	wheat	wheat	NOUN
bionys-314	296	24	cultivars	cultivar	NOUN
bionys-314	296	25	experiencing	experience	VERB
bionys-314	296	26	water	water	NOUN
bionys-314	296	27	deficiency	deficiency	NOUN
bionys-314	296	28	.	.	PUNCT
bionys-314	297	1	applied	apply	VERB
bionys-314	297	2	biochemistry	biochemistry	NOUN
bionys-314	297	3	and	and	CCONJ
bionys-314	297	4	microbiology	microbiology	NOUN
bionys-314	297	5	,	,	PUNCT
bionys-314	297	6	40	40	NUM
bionys-314	297	7	(	(	PUNCT
bionys-314	297	8	6	6	NUM
bionys-314	297	9	):	):	PUNCT
bionys-314	297	10	573	573	NUM
bionys-314	297	11	-	-	SYM
bionys-314	297	12	580	580	NUM
bionys-314	297	13	.	.	PUNCT
bionys-314	298	1	mukhopadhyay	mukhopadhyay	PROPN
bionys-314	298	2	m	m	PROPN
bionys-314	298	3	,	,	PUNCT
bionys-314	298	4	mondal	mondal	PROPN
bionys-314	298	5	t.k	t.k	PROPN
bionys-314	298	6	.	.	PROPN
bionys-314	298	7	2014	2014	NUM
bionys-314	298	8	:	:	PUNCT
bionys-314	298	9	the	the	DET
bionys-314	298	10	physio	physio	NOUN
bionys-314	298	11	-	-	PUNCT
bionys-314	298	12	chemical	chemical	NOUN
bionys-314	298	13	responses	response	NOUN
bionys-314	298	14	of	of	ADP
bionys-314	298	15	camellia	camellia	NOUN
bionys-314	298	16	plants	plant	NOUN
bionys-314	298	17	to	to	ADP
bionys-314	298	18	abiotic	abiotic	ADJ
bionys-314	298	19	stresses	stress	NOUN
bionys-314	298	20	.	.	PUNCT
bionys-314	299	1	journal	journal	NOUN
bionys-314	299	2	of	of	ADP
bionys-314	299	3	plant	plant	NOUN
bionys-314	299	4	science	science	NOUN
bionys-314	299	5	and	and	CCONJ
bionys-314	299	6	research	research	NOUN
bionys-314	299	7	,	,	PUNCT
bionys-314	299	8	1(1	1(1	NUM
bionys-314	299	9	):	):	PUNCT
bionys-314	299	10	105	105	NUM
bionys-314	299	11	.	.	PUNCT
bionys-314	300	1	moody	moody	PROPN
bionys-314	300	2	,	,	PUNCT
bionys-314	300	3	d.	d.	PROPN
bionys-314	300	4	2001	2001	NUM
bionys-314	300	5	:	:	PUNCT
bionys-314	301	1	genomics	genomics	NOUN
bionys-314	301	2	techniques	technique	NOUN
bionys-314	301	3	:	:	PUNCT
bionys-314	301	4	an	an	DET
bionys-314	301	5	overview	overview	NOUN
bionys-314	301	6	of	of	ADP
bionys-314	301	7	methods	method	NOUN
bionys-314	301	8	for	for	ADP
bionys-314	301	9	the	the	DET
bionys-314	301	10	study	study	NOUN
bionys-314	301	11	of	of	ADP
bionys-314	301	12	gene	gene	NOUN
bionys-314	301	13	expression	expression	NOUN
bionys-314	301	14	.	.	PUNCT
bionys-314	302	1	journal	journal	NOUN
bionys-314	302	2	of	of	ADP
bionys-314	302	3	animal	animal	NOUN
bionys-314	302	4	science	science	NOUN
bionys-314	302	5	,	,	PUNCT
bionys-314	302	6	79	79	NUM
bionys-314	302	7	(	(	PUNCT
bionys-314	302	8	e	e	NOUN
bionys-314	302	9	-	-	ADJ
bionys-314	302	10	suppl	suppl	ADJ
bionys-314	302	11	)	)	PUNCT
bionys-314	302	12	,	,	PUNCT
bionys-314	302	13	e128	e128	PROPN
bionys-314	302	14	-	-	PUNCT
bionys-314	302	15	e135	e135	PROPN
bionys-314	302	16	.	.	PUNCT
bionys-314	303	1	noctor	noctor	PROPN
bionys-314	303	2	,	,	PUNCT
bionys-314	303	3	g.	g.	PROPN
bionys-314	303	4	,	,	PUNCT
bionys-314	303	5	mhamdi	mhamdi	NOUN
bionys-314	303	6	,	,	PUNCT
bionys-314	303	7	a.	a.	NOUN
bionys-314	303	8	,	,	PUNCT
bionys-314	303	9	foyer	foyer	NOUN
bionys-314	303	10	,	,	PUNCT
bionys-314	303	11	c.	c.	PROPN
bionys-314	303	12	h.	h.	PROPN
bionys-314	303	13	2014	2014	NUM
bionys-314	303	14	:	:	PUNCT
bionys-314	303	15	the	the	DET
bionys-314	303	16	roles	role	NOUN
bionys-314	303	17	of	of	ADP
bionys-314	303	18	reactive	reactive	ADJ
bionys-314	303	19	oxygen	oxygen	NOUN
bionys-314	303	20	metabolism	metabolism	NOUN
bionys-314	303	21	in	in	ADP
bionys-314	303	22	drought	drought	NOUN
bionys-314	303	23	:	:	PUNCT
bionys-314	303	24	not	not	PART
bionys-314	303	25	so	so	ADV
bionys-314	303	26	cut	cut	VERB
bionys-314	303	27	and	and	CCONJ
bionys-314	303	28	dried	dry	VERB
bionys-314	303	29	.	.	PUNCT
bionys-314	304	1	plant	plant	NOUN
bionys-314	304	2	physiology	physiology	NOUN
bionys-314	304	3	,	,	PUNCT
bionys-314	304	4	164	164	NUM
bionys-314	304	5	(	(	PUNCT
bionys-314	304	6	4	4	NUM
bionys-314	304	7	):	):	PUNCT
bionys-314	304	8	16361648	16361648	NUM
bionys-314	304	9	.	.	PUNCT
bionys-314	305	1	palma	palma	PROPN
bionys-314	305	2	,	,	PUNCT
bionys-314	305	3	j.	j.	PROPN
bionys-314	305	4	m.	m.	PROPN
bionys-314	305	5	,	,	PUNCT
bionys-314	305	6	lópez‐huertas	lópez‐huertas	PROPN
bionys-314	305	7	,	,	PUNCT
bionys-314	305	8	e.	e.	PROPN
bionys-314	305	9	,	,	PUNCT
bionys-314	305	10	corpas	corpas	PROPN
bionys-314	305	11	,	,	PUNCT
bionys-314	305	12	f.	f.	PROPN
bionys-314	305	13	j.	j.	PROPN
bionys-314	305	14	,	,	PUNCT
bionys-314	305	15	sandalio	sandalio	PROPN
bionys-314	305	16	,	,	PUNCT
bionys-314	305	17	l.	l.	PROPN
bionys-314	305	18	m.	m.	PROPN
bionys-314	305	19	,	,	PUNCT
bionys-314	305	20	gómez	gómez	NOUN
bionys-314	305	21	,	,	PUNCT
bionys-314	305	22	m.	m.	NOUN
bionys-314	305	23	,	,	PUNCT
bionys-314	305	24	del	del	PROPN
bionys-314	305	25	río	río	PROPN
bionys-314	305	26	,	,	PUNCT
bionys-314	305	27	l.	l.	PROPN
bionys-314	305	28	a.	a.	PROPN
bionys-314	305	29	1998	1998	NUM
bionys-314	305	30	:	:	PUNCT
bionys-314	305	31	peroxisomal	peroxisomal	ADJ
bionys-314	305	32	manganese	manganese	NOUN
bionys-314	305	33	superoxide	superoxide	NOUN
bionys-314	305	34	dismutase	dismutase	NOUN
bionys-314	305	35	:	:	PUNCT
bionys-314	305	36	purification	purification	NOUN
bionys-314	305	37	and	and	CCONJ
bionys-314	305	38	properties	property	NOUN
bionys-314	305	39	of	of	ADP
bionys-314	305	40	the	the	DET
bionys-314	305	41	isozyme	isozyme	NOUN
bionys-314	305	42	from	from	ADP
bionys-314	305	43	pea	pea	NOUN
bionys-314	305	44	leaves	leave	NOUN
bionys-314	305	45	.	.	PUNCT
bionys-314	306	1	physiologia	physiologia	PROPN
bionys-314	306	2	plantarum	plantarum	PROPN
bionys-314	306	3	,	,	PUNCT
bionys-314	306	4	104	104	NUM
bionys-314	306	5	(	(	PUNCT
bionys-314	306	6	4	4	NUM
bionys-314	306	7	):	):	PUNCT
bionys-314	306	8	720	720	NUM
bionys-314	306	9	-	-	SYM
bionys-314	306	10	726	726	NUM
bionys-314	306	11	.	.	PUNCT
bionys-314	307	1	biologica	biologica	PROPN
bionys-314	307	2	nyssana	nyssana	PROPN
bionys-314	307	3	●	●	PUNCT
bionys-314	307	4	11	11	NUM
bionys-314	307	5	(	(	PUNCT
bionys-314	307	6	1	1	NUM
bionys-314	307	7	)	)	PUNCT
bionys-314	307	8	september	september	PROPN
bionys-314	307	9	2020	2020	NUM
bionys-314	307	10	:	:	PUNCT
bionys-314	307	11	45	45	NUM
bionys-314	307	12	-	-	SYM
bionys-314	307	13	54	54	NUM
bionys-314	307	14	mohammadi	mohammadi	NOUN
bionys-314	307	15	et	et	PROPN
bionys-314	307	16	al	al	PROPN
bionys-314	307	17	.	.	PUNCT
bionys-314	308	1	●	●	PUNCT
bionys-314	308	2	a	a	DET
bionys-314	308	3	real	real	ADJ
bionys-314	308	4	-	-	PUNCT
bionys-314	308	5	time	time	NOUN
bionys-314	308	6	pcr	pcr	NOUN
bionys-314	308	7	assay	assay	NOUN
bionys-314	308	8	for	for	ADP
bionys-314	308	9	evaluation	evaluation	NOUN
bionys-314	308	10	of	of	ADP
bionys-314	308	11	drought	drought	NOUN
bionys-314	308	12	tolerance	tolerance	NOUN
bionys-314	308	13	in	in	ADP
bionys-314	308	14	a	a	DET
bionys-314	308	15	new	new	ADJ
bionys-314	308	16	tea	tea	NOUN
bionys-314	308	17	clone	clone	NOUN
bionys-314	308	18	parida	parida	PROPN
bionys-314	308	19	,	,	PUNCT
bionys-314	308	20	a.	a.	PROPN
bionys-314	308	21	k.	k.	PROPN
bionys-314	308	22	,	,	PUNCT
bionys-314	308	23	dagaonkar	dagaonkar	PROPN
bionys-314	308	24	,	,	PUNCT
bionys-314	308	25	v.	v.	PROPN
bionys-314	308	26	s.	s.	PROPN
bionys-314	308	27	,	,	PUNCT
bionys-314	308	28	phalak	phalak	NOUN
bionys-314	308	29	,	,	PUNCT
bionys-314	308	30	m.	m.	NOUN
bionys-314	308	31	s.	s.	PROPN
bionys-314	308	32	,	,	PUNCT
bionys-314	308	33	aurangabadkar	aurangabadkar	PROPN
bionys-314	308	34	,	,	PUNCT
bionys-314	308	35	l.	l.	PROPN
bionys-314	308	36	p.	p.	PROPN
bionys-314	308	37	2008	2008	NUM
bionys-314	308	38	:	:	PUNCT
bionys-314	308	39	differential	differential	NOUN
bionys-314	308	40	responses	response	NOUN
bionys-314	308	41	of	of	ADP
bionys-314	308	42	the	the	DET
bionys-314	308	43	enzymes	enzyme	NOUN
bionys-314	308	44	involved	involve	VERB
bionys-314	308	45	in	in	ADP
bionys-314	308	46	proline	proline	NOUN
bionys-314	308	47	biosynthesis	biosynthesis	NOUN
bionys-314	308	48	and	and	CCONJ
bionys-314	308	49	degradation	degradation	NOUN
bionys-314	308	50	in	in	ADP
bionys-314	308	51	drought	drought	NOUN
bionys-314	308	52	tolerant	tolerant	ADJ
bionys-314	308	53	and	and	CCONJ
bionys-314	308	54	sensitive	sensitive	ADJ
bionys-314	308	55	cotton	cotton	NOUN
bionys-314	308	56	genotypes	genotype	NOUN
bionys-314	308	57	during	during	ADP
bionys-314	308	58	drought	drought	NOUN
bionys-314	308	59	stress	stress	NOUN
bionys-314	308	60	and	and	CCONJ
bionys-314	308	61	recovery	recovery	NOUN
bionys-314	308	62	.	.	PUNCT
bionys-314	309	1	acta	acta	PROPN
bionys-314	309	2	physiologiae	physiologiae	NOUN
bionys-314	309	3	plantarum	plantarum	NOUN
bionys-314	309	4	,	,	PUNCT
bionys-314	309	5	30	30	NUM
bionys-314	309	6	(	(	PUNCT
bionys-314	309	7	5	5	NUM
bionys-314	309	8	):	):	PUNCT
bionys-314	309	9	619	619	NUM
bionys-314	309	10	-	-	SYM
bionys-314	309	11	627	627	NUM
bionys-314	309	12	.	.	PUNCT
bionys-314	310	1	pirdashti	pirdashti	PROPN
bionys-314	310	2	,	,	PUNCT
bionys-314	310	3	h.	h.	PROPN
bionys-314	310	4	,	,	PUNCT
bionys-314	310	5	sarvestani	sarvestani	PROPN
bionys-314	310	6	,	,	PUNCT
bionys-314	310	7	z.	z.	PROPN
bionys-314	310	8	t.	t.	PROPN
bionys-314	310	9	,	,	PUNCT
bionys-314	310	10	bahmanyar	bahmanyar	PROPN
bionys-314	310	11	,	,	PUNCT
bionys-314	310	12	m.	m.	NOUN
bionys-314	310	13	a.	a.	NOUN
bionys-314	310	14	2009	2009	NUM
bionys-314	310	15	:	:	PUNCT
bionys-314	310	16	comparison	comparison	NOUN
bionys-314	310	17	of	of	ADP
bionys-314	310	18	physiological	physiological	ADJ
bionys-314	310	19	responses	response	NOUN
bionys-314	310	20	among	among	ADP
bionys-314	310	21	four	four	NUM
bionys-314	310	22	contrast	contrast	NOUN
bionys-314	310	23	rice	rice	NOUN
bionys-314	310	24	cultivars	cultivar	NOUN
bionys-314	310	25	under	under	ADP
bionys-314	310	26	drought	drought	NOUN
bionys-314	310	27	stress	stress	NOUN
bionys-314	310	28	conditions	condition	NOUN
bionys-314	310	29	.	.	PUNCT
bionys-314	311	1	world	world	PROPN
bionys-314	311	2	academy	academy	PROPN
bionys-314	311	3	of	of	ADP
bionys-314	311	4	science	science	PROPN
bionys-314	311	5	.	.	PUNCT
bionys-314	311	6	,	,	PUNCT
bionys-314	311	7	engineering	engineering	NOUN
bionys-314	311	8	and	and	CCONJ
bionys-314	311	9	tech	tech	NOUN
bionys-314	311	10	,	,	PUNCT
bionys-314	311	11	49	49	NUM
bionys-314	311	12	:	:	SYM
bionys-314	311	13	52	52	NUM
bionys-314	311	14	-	-	SYM
bionys-314	311	15	53	53	NUM
bionys-314	311	16	.	.	PUNCT
bionys-314	312	1	sairam	sairam	PROPN
bionys-314	312	2	,	,	PUNCT
bionys-314	312	3	r.	r.	PROPN
bionys-314	312	4	,	,	PUNCT
bionys-314	312	5	saxena	saxena	PROPN
bionys-314	312	6	,	,	PUNCT
bionys-314	312	7	d.	d.	PROPN
bionys-314	312	8	2000	2000	NUM
bionys-314	312	9	:	:	PUNCT
bionys-314	312	10	oxidative	oxidative	ADJ
bionys-314	312	11	stress	stress	NOUN
bionys-314	312	12	and	and	CCONJ
bionys-314	312	13	antioxidants	antioxidant	NOUN
bionys-314	312	14	in	in	ADP
bionys-314	312	15	wheat	wheat	NOUN
bionys-314	312	16	genotypes	genotype	NOUN
bionys-314	312	17	:	:	PUNCT
bionys-314	312	18	possible	possible	ADJ
bionys-314	312	19	mechanism	mechanism	NOUN
bionys-314	312	20	of	of	ADP
bionys-314	312	21	water	water	NOUN
bionys-314	312	22	stress	stress	NOUN
bionys-314	312	23	tolerance	tolerance	NOUN
bionys-314	312	24	.	.	PUNCT
bionys-314	313	1	journal	journal	NOUN
bionys-314	313	2	of	of	ADP
bionys-314	313	3	agronomy	agronomy	NOUN
bionys-314	313	4	and	and	CCONJ
bionys-314	313	5	crop	crop	NOUN
bionys-314	313	6	science	science	NOUN
bionys-314	313	7	,	,	PUNCT
bionys-314	313	8	184	184	NUM
bionys-314	313	9	(	(	PUNCT
bionys-314	313	10	1	1	NUM
bionys-314	313	11	):	):	PUNCT
bionys-314	313	12	55	55	NUM
bionys-314	313	13	-	-	SYM
bionys-314	313	14	61	61	NUM
bionys-314	313	15	.	.	PUNCT
bionys-314	314	1	sairam	sairam	PROPN
bionys-314	314	2	,	,	PUNCT
bionys-314	314	3	r.	r.	PROPN
bionys-314	314	4	,	,	PUNCT
bionys-314	314	5	srivastava	srivastava	PROPN
bionys-314	314	6	,	,	PUNCT
bionys-314	314	7	g.	g.	PROPN
bionys-314	314	8	2001	2001	NUM
bionys-314	314	9	:	:	PUNCT
bionys-314	314	10	water	water	NOUN
bionys-314	314	11	stress	stress	NOUN
bionys-314	314	12	tolerance	tolerance	NOUN
bionys-314	314	13	of	of	ADP
bionys-314	314	14	wheat	wheat	NOUN
bionys-314	314	15	(	(	PUNCT
bionys-314	314	16	triticum	triticum	NOUN
bionys-314	314	17	aestivum	aestivum	PROPN
bionys-314	314	18	l.	l.	PROPN
bionys-314	314	19	):	):	PUNCT
bionys-314	314	20	variations	variation	NOUN
bionys-314	314	21	in	in	ADP
bionys-314	314	22	hydrogen	hydrogen	NOUN
bionys-314	314	23	peroxide	peroxide	NOUN
bionys-314	314	24	accumulation	accumulation	NOUN
bionys-314	314	25	and	and	CCONJ
bionys-314	314	26	antioxidant	antioxidant	ADJ
bionys-314	314	27	activity	activity	NOUN
bionys-314	314	28	in	in	ADP
bionys-314	314	29	tolerant	tolerant	ADJ
bionys-314	314	30	and	and	CCONJ
bionys-314	314	31	susceptible	susceptible	ADJ
bionys-314	314	32	genotypes	genotype	NOUN
bionys-314	314	33	.	.	PUNCT
bionys-314	315	1	journal	journal	NOUN
bionys-314	315	2	of	of	ADP
bionys-314	315	3	agronomy	agronomy	NOUN
bionys-314	315	4	and	and	CCONJ
bionys-314	315	5	crop	crop	NOUN
bionys-314	315	6	science	science	NOUN
bionys-314	315	7	,	,	PUNCT
bionys-314	315	8	186	186	NUM
bionys-314	315	9	(	(	PUNCT
bionys-314	315	10	1	1	NUM
bionys-314	315	11	):	):	PUNCT
bionys-314	315	12	6370	6370	NUM
bionys-314	315	13	.	.	PUNCT
bionys-314	316	1	samis	samis	PROPN
bionys-314	316	2	,	,	PUNCT
bionys-314	316	3	k.	k.	PROPN
bionys-314	316	4	,	,	PUNCT
bionys-314	316	5	bowley	bowley	PROPN
bionys-314	316	6	,	,	PUNCT
bionys-314	316	7	s.	s.	PROPN
bionys-314	316	8	,	,	PUNCT
bionys-314	316	9	mckersie	mckersie	PROPN
bionys-314	316	10	,	,	PUNCT
bionys-314	316	11	b.	b.	PROPN
bionys-314	316	12	2002	2002	NUM
bionys-314	316	13	:	:	PUNCT
bionys-314	316	14	pyramiding	pyramid	VERB
bionys-314	316	15	mn‐superoxide	mn‐superoxide	NOUN
bionys-314	316	16	dismutase	dismutase	NOUN
bionys-314	316	17	transgenes	transgene	NOUN
bionys-314	316	18	to	to	PART
bionys-314	316	19	improve	improve	VERB
bionys-314	316	20	persistence	persistence	NOUN
bionys-314	316	21	and	and	CCONJ
bionys-314	316	22	biomass	biomass	NOUN
bionys-314	316	23	production	production	NOUN
bionys-314	316	24	in	in	ADP
bionys-314	316	25	alfalfa	alfalfa	NOUN
bionys-314	316	26	.	.	PUNCT
bionys-314	317	1	journal	journal	NOUN
bionys-314	317	2	of	of	ADP
bionys-314	317	3	experimental	experimental	ADJ
bionys-314	317	4	botany	botany	NOUN
bionys-314	317	5	,	,	PUNCT
bionys-314	317	6	53	53	NUM
bionys-314	317	7	(	(	PUNCT
bionys-314	317	8	372	372	NUM
bionys-314	317	9	):	):	PUNCT
bionys-314	317	10	1343	1343	NUM
bionys-314	317	11	-	-	SYM
bionys-314	317	12	1350	1350	NUM
bionys-314	317	13	.	.	PUNCT
bionys-314	318	1	sánchez	sánchez	PROPN
bionys-314	318	2	,	,	PUNCT
bionys-314	318	3	f.	f.	PROPN
bionys-314	318	4	j.	j.	PROPN
bionys-314	318	5	,	,	PUNCT
bionys-314	318	6	manzanares	manzanare	NOUN
bionys-314	318	7	,	,	PUNCT
bionys-314	318	8	m.	m.	NOUN
bionys-314	318	9	a.	a.	PROPN
bionys-314	318	10	,	,	PUNCT
bionys-314	318	11	de	de	PROPN
bionys-314	318	12	andrés	andrés	PROPN
bionys-314	318	13	,	,	PUNCT
bionys-314	318	14	e.	e.	PROPN
bionys-314	318	15	f.	f.	PROPN
bionys-314	318	16	,	,	PUNCT
bionys-314	318	17	tenorio	tenorio	PROPN
bionys-314	318	18	,	,	PUNCT
bionys-314	318	19	j.	j.	PROPN
bionys-314	318	20	l.	l.	PROPN
bionys-314	318	21	,	,	PUNCT
bionys-314	318	22	ayerbe	ayerbe	PROPN
bionys-314	318	23	,	,	PUNCT
bionys-314	318	24	l.	l.	PROPN
bionys-314	318	25	2001	2001	NUM
bionys-314	318	26	:	:	PUNCT
bionys-314	318	27	residual	residual	ADJ
bionys-314	318	28	transpiration	transpiration	NOUN
bionys-314	318	29	rate	rate	NOUN
bionys-314	318	30	,	,	PUNCT
bionys-314	318	31	epicuticular	epicuticular	ADJ
bionys-314	318	32	wax	wax	NOUN
bionys-314	318	33	load	load	NOUN
bionys-314	318	34	and	and	CCONJ
bionys-314	318	35	leaf	leaf	NOUN
bionys-314	318	36	color	color	NOUN
bionys-314	318	37	of	of	ADP
bionys-314	318	38	pea	pea	NOUN
bionys-314	318	39	plants	plant	NOUN
bionys-314	318	40	in	in	ADP
bionys-314	318	41	drought	drought	NOUN
bionys-314	318	42	conditions	condition	NOUN
bionys-314	318	43	.	.	PUNCT
bionys-314	319	1	influence	influence	NOUN
bionys-314	319	2	on	on	ADP
bionys-314	319	3	harvest	harvest	NOUN
bionys-314	319	4	index	index	NOUN
bionys-314	319	5	and	and	CCONJ
bionys-314	319	6	canopy	canopy	NOUN
bionys-314	319	7	temperature	temperature	NOUN
bionys-314	319	8	.	.	PUNCT
bionys-314	320	1	european	european	ADJ
bionys-314	320	2	journal	journal	PROPN
bionys-314	320	3	of	of	ADP
bionys-314	320	4	agronomy	agronomy	NOUN
bionys-314	320	5	,	,	PUNCT
bionys-314	320	6	15	15	NUM
bionys-314	320	7	(	(	PUNCT
bionys-314	320	8	1	1	NUM
bionys-314	320	9	):	):	PUNCT
bionys-314	320	10	57	57	NUM
bionys-314	320	11	-	-	SYM
bionys-314	320	12	70	70	NUM
bionys-314	320	13	.	.	PUNCT
bionys-314	321	1	sevilla	sevilla	PROPN
bionys-314	321	2	,	,	PUNCT
bionys-314	321	3	f.	f.	PROPN
bionys-314	321	4	,	,	PUNCT
bionys-314	321	5	lopez	lopez	NOUN
bionys-314	321	6	-	-	PUNCT
bionys-314	321	7	gorge	gorge	NOUN
bionys-314	321	8	,	,	PUNCT
bionys-314	321	9	j.	j.	PROPN
bionys-314	321	10	,	,	PUNCT
bionys-314	321	11	gomez	gomez	PROPN
bionys-314	321	12	,	,	PUNCT
bionys-314	321	13	m.	m.	NOUN
bionys-314	321	14	,	,	PUNCT
bionys-314	321	15	&	&	CCONJ
bionys-314	321	16	del	del	PROPN
bionys-314	321	17	rio	rio	PROPN
bionys-314	321	18	,	,	PUNCT
bionys-314	321	19	l.	l.	PROPN
bionys-314	321	20	1980	1980	NUM
bionys-314	321	21	:	:	PUNCT
bionys-314	321	22	manganese	manganese	ADJ
bionys-314	321	23	superoxide	superoxide	NOUN
bionys-314	321	24	dismutase	dismutase	NOUN
bionys-314	321	25	from	from	ADP
bionys-314	321	26	a	a	DET
bionys-314	321	27	higher	high	ADJ
bionys-314	321	28	plant	plant	NOUN
bionys-314	321	29	.	.	PUNCT
bionys-314	322	1	planta	planta	PROPN
bionys-314	322	2	,	,	PUNCT
bionys-314	322	3	150	150	NUM
bionys-314	322	4	(	(	PUNCT
bionys-314	322	5	2	2	NUM
bionys-314	322	6	):	):	PUNCT
bionys-314	322	7	153	153	NUM
bionys-314	322	8	-	-	SYM
bionys-314	322	9	157	157	NUM
bionys-314	322	10	.	.	PUNCT
bionys-314	323	1	shah	shah	PROPN
bionys-314	323	2	,	,	PUNCT
bionys-314	323	3	k.	k.	PROPN
bionys-314	323	4	,	,	PUNCT
bionys-314	323	5	nahakpam	nahakpam	PROPN
bionys-314	323	6	,	,	PUNCT
bionys-314	323	7	s.	s.	PROPN
bionys-314	323	8	2012	2012	NUM
bionys-314	323	9	:	:	PUNCT
bionys-314	323	10	heat	heat	NOUN
bionys-314	323	11	exposure	exposure	NOUN
bionys-314	323	12	alters	alter	VERB
bionys-314	323	13	the	the	DET
bionys-314	323	14	expression	expression	NOUN
bionys-314	323	15	of	of	ADP
bionys-314	323	16	sod	sod	NOUN
bionys-314	323	17	,	,	PUNCT
bionys-314	323	18	pod	pod	NOUN
bionys-314	323	19	,	,	PUNCT
bionys-314	323	20	apx	apx	PROPN
bionys-314	323	21	and	and	CCONJ
bionys-314	323	22	cat	cat	NOUN
bionys-314	323	23	isozymes	isozyme	NOUN
bionys-314	323	24	and	and	CCONJ
bionys-314	323	25	mitigates	mitigate	VERB
bionys-314	323	26	low	low	ADJ
bionys-314	323	27	cadmium	cadmium	NOUN
bionys-314	323	28	toxicity	toxicity	NOUN
bionys-314	323	29	in	in	ADP
bionys-314	323	30	seedlings	seedling	NOUN
bionys-314	323	31	of	of	ADP
bionys-314	323	32	sensitive	sensitive	ADJ
bionys-314	323	33	and	and	CCONJ
bionys-314	323	34	tolerant	tolerant	ADJ
bionys-314	323	35	rice	rice	NOUN
bionys-314	323	36	cultivars	cultivar	NOUN
bionys-314	323	37	.	.	PUNCT
bionys-314	324	1	plant	plant	NOUN
bionys-314	324	2	physiology	physiology	NOUN
bionys-314	324	3	and	and	CCONJ
bionys-314	324	4	biochemistry	biochemistry	NOUN
bionys-314	324	5	,	,	PUNCT
bionys-314	324	6	57	57	NUM
bionys-314	324	7	:	:	SYM
bionys-314	324	8	106	106	NUM
bionys-314	324	9	-	-	SYM
bionys-314	324	10	113	113	NUM
bionys-314	324	11	.	.	PUNCT
bionys-314	325	1	siddique	siddique	NOUN
bionys-314	325	2	,	,	PUNCT
bionys-314	325	3	m.	m.	NOUN
bionys-314	325	4	,	,	PUNCT
bionys-314	325	5	hamid	hamid	PROPN
bionys-314	325	6	,	,	PUNCT
bionys-314	325	7	a.	a.	PROPN
bionys-314	325	8	,	,	PUNCT
bionys-314	325	9	islam	islam	PROPN
bionys-314	325	10	,	,	PUNCT
bionys-314	325	11	m.	m.	NOUN
bionys-314	325	12	2000	2000	NUM
bionys-314	325	13	:	:	PUNCT
bionys-314	325	14	drought	drought	NOUN
bionys-314	325	15	stress	stress	NOUN
bionys-314	325	16	effects	effect	NOUN
bionys-314	325	17	on	on	ADP
bionys-314	325	18	water	water	NOUN
bionys-314	325	19	relations	relation	NOUN
bionys-314	325	20	of	of	ADP
bionys-314	325	21	wheat	wheat	NOUN
bionys-314	325	22	.	.	PUNCT
bionys-314	326	1	botanical	botanical	ADJ
bionys-314	326	2	bulletin	bulletin	NOUN
bionys-314	326	3	of	of	ADP
bionys-314	326	4	academia	academia	PROPN
bionys-314	326	5	sinica	sinica	PROPN
bionys-314	326	6	,	,	PUNCT
bionys-314	326	7	41	41	NUM
bionys-314	326	8	:	:	SYM
bionys-314	326	9	35	35	NUM
bionys-314	326	10	-	-	SYM
bionys-314	326	11	39	39	NUM
bionys-314	326	12	.	.	PUNCT
bionys-314	327	1	streller	streller	NOUN
bionys-314	327	2	,	,	PUNCT
bionys-314	327	3	s.	s.	PROPN
bionys-314	327	4	,	,	PUNCT
bionys-314	327	5	krömer	krömer	PROPN
bionys-314	327	6	,	,	PUNCT
bionys-314	327	7	s.	s.	PROPN
bionys-314	327	8	,	,	PUNCT
bionys-314	327	9	wingsle	wingsle	NOUN
bionys-314	327	10	,	,	PUNCT
bionys-314	327	11	g.	g.	PROPN
bionys-314	327	12	1994	1994	NUM
bionys-314	327	13	:	:	PUNCT
bionys-314	327	14	isolation	isolation	NOUN
bionys-314	327	15	and	and	CCONJ
bionys-314	327	16	purification	purification	NOUN
bionys-314	327	17	of	of	ADP
bionys-314	327	18	mitochondrial	mitochondrial	ADJ
bionys-314	327	19	mn	mn	PROPN
bionys-314	327	20	-	-	PUNCT
bionys-314	327	21	superoxide	superoxide	NOUN
bionys-314	327	22	dismutase	dismutase	NOUN
bionys-314	327	23	from	from	ADP
bionys-314	327	24	the	the	DET
bionys-314	327	25	gymnosperm	gymnosperm	NOUN
bionys-314	327	26	pinus	pinus	NOUN
bionys-314	327	27	sylvestris	sylvestris	NOUN
bionys-314	327	28	l.	l.	PROPN
bionys-314	327	29	plant	plant	PROPN
bionys-314	327	30	and	and	CCONJ
bionys-314	327	31	cell	cell	NOUN
bionys-314	327	32	physiology	physiology	NOUN
bionys-314	327	33	,	,	PUNCT
bionys-314	327	34	35	35	NUM
bionys-314	327	35	(	(	PUNCT
bionys-314	327	36	6	6	NUM
bionys-314	327	37	):	):	PUNCT
bionys-314	327	38	859	859	NUM
bionys-314	327	39	-	-	SYM
bionys-314	327	40	867	867	NUM
bionys-314	327	41	.	.	PUNCT
bionys-314	328	1	upadhyaya	upadhyaya	PROPN
bionys-314	328	2	h.	h.	PROPN
bionys-314	328	3	,	,	PUNCT
bionys-314	328	4	panda	panda	NOUN
bionys-314	328	5	s.k	s.k	PROPN
bionys-314	328	6	.	.	PROPN
bionys-314	328	7	,	,	PUNCT
bionys-314	328	8	dutta	dutta	PROPN
bionys-314	328	9	b.k	b.k	PROPN
bionys-314	328	10	.	.	PROPN
bionys-314	328	11	2008	2008	NUM
bionys-314	328	12	:	:	PUNCT
bionys-314	328	13	variation	variation	NOUN
bionys-314	328	14	of	of	ADP
bionys-314	328	15	physiological	physiological	ADJ
bionys-314	328	16	and	and	CCONJ
bionys-314	328	17	antioxidative	antioxidative	ADJ
bionys-314	328	18	responses	response	NOUN
bionys-314	328	19	in	in	ADP
bionys-314	328	20	tea	tea	NOUN
bionys-314	328	21	cultivars	cultivar	NOUN
bionys-314	328	22	subjected	subject	VERB
bionys-314	328	23	to	to	ADP
bionys-314	328	24	elevated	elevated	ADJ
bionys-314	328	25	water	water	NOUN
bionys-314	328	26	stress	stress	NOUN
bionys-314	328	27	followed	follow	VERB
bionys-314	328	28	by	by	ADP
bionys-314	328	29	rehydration	rehydration	NOUN
bionys-314	328	30	recovery	recovery	NOUN
bionys-314	328	31	.	.	PUNCT
bionys-314	329	1	acta	acta	PROPN
bionys-314	329	2	physiologiae	physiologiae	NOUN
bionys-314	329	3	plantarum	plantarum	NOUN
bionys-314	329	4	,	,	PUNCT
bionys-314	329	5	30	30	NUM
bionys-314	329	6	:	:	SYM
bionys-314	329	7	457	457	NUM
bionys-314	329	8	̶	̶	PROPN
bionys-314	329	9	468	468	NUM
bionys-314	329	10	.	.	PUNCT
bionys-314	330	1	upadhyaya	upadhyaya	PROPN
bionys-314	330	2	,	,	PUNCT
bionys-314	330	3	h.	h.	PROPN
bionys-314	330	4	,	,	PUNCT
bionys-314	330	5	panda	panda	NOUN
bionys-314	330	6	,	,	PUNCT
bionys-314	330	7	s.	s.	PROPN
bionys-314	330	8	k.	k.	PROPN
bionys-314	330	9	2013	2013	NUM
bionys-314	330	10	:	:	PUNCT
bionys-314	330	11	abiotic	abiotic	ADJ
bionys-314	330	12	stress	stress	NOUN
bionys-314	330	13	responses	response	NOUN
bionys-314	330	14	in	in	ADP
bionys-314	330	15	tea	tea	NOUN
bionys-314	331	1	[	[	X
bionys-314	331	2	camellia	camellia	NOUN
bionys-314	331	3	sinensis	sinensis	NOUN
bionys-314	331	4	l	l	NOUN
bionys-314	331	5	(	(	PUNCT
bionys-314	331	6	o	o	NOUN
bionys-314	331	7	)	)	PUNCT
bionys-314	331	8	kuntze	kuntze	NOUN
bionys-314	331	9	]	]	X
bionys-314	331	10	:	:	PUNCT
bionys-314	331	11	an	an	DET
bionys-314	331	12	overview	overview	NOUN
bionys-314	331	13	.	.	PUNCT
bionys-314	332	1	reviews	review	NOUN
bionys-314	332	2	in	in	ADP
bionys-314	332	3	agricultural	agricultural	ADJ
bionys-314	332	4	science	science	NOUN
bionys-314	332	5	,	,	PUNCT
bionys-314	332	6	1	1	NUM
bionys-314	332	7	:	:	SYM
bionys-314	332	8	1	1	NUM
bionys-314	332	9	-	-	SYM
bionys-314	332	10	10	10	NUM
bionys-314	332	11	.	.	PUNCT
bionys-314	333	1	valentovic	valentovic	ADJ
bionys-314	333	2	,	,	PUNCT
bionys-314	333	3	p.	p.	PROPN
bionys-314	333	4	,	,	PUNCT
bionys-314	333	5	luxova	luxova	PROPN
bionys-314	333	6	,	,	PUNCT
bionys-314	333	7	m.	m.	NOUN
bionys-314	333	8	,	,	PUNCT
bionys-314	333	9	kolarovic	kolarovic	PROPN
bionys-314	333	10	,	,	PUNCT
bionys-314	333	11	l.	l.	PROPN
bionys-314	333	12	,	,	PUNCT
bionys-314	333	13	gasparikova	gasparikova	PROPN
bionys-314	333	14	,	,	PUNCT
bionys-314	333	15	o.	o.	NOUN
bionys-314	333	16	2006	2006	NUM
bionys-314	333	17	:	:	PUNCT
bionys-314	333	18	effect	effect	NOUN
bionys-314	333	19	of	of	ADP
bionys-314	333	20	osmotic	osmotic	ADJ
bionys-314	333	21	stress	stress	NOUN
bionys-314	333	22	on	on	ADP
bionys-314	333	23	compatible	compatible	ADJ
bionys-314	333	24	solutes	solute	NOUN
bionys-314	333	25	content	content	NOUN
bionys-314	333	26	,	,	PUNCT
bionys-314	333	27	membrane	membrane	NOUN
bionys-314	333	28	stability	stability	NOUN
bionys-314	333	29	and	and	CCONJ
bionys-314	333	30	water	water	NOUN
bionys-314	333	31	relations	relation	NOUN
bionys-314	333	32	in	in	ADP
bionys-314	333	33	two	two	NUM
bionys-314	333	34	maize	maize	NOUN
bionys-314	333	35	cultivars	cultivar	NOUN
bionys-314	333	36	.	.	PUNCT
bionys-314	334	1	plant	plant	NOUN
bionys-314	334	2	soil	soil	NOUN
bionys-314	334	3	and	and	CCONJ
bionys-314	334	4	environment	environment	NOUN
bionys-314	334	5	,	,	PUNCT
bionys-314	334	6	52	52	NUM
bionys-314	334	7	(	(	PUNCT
bionys-314	334	8	4	4	NUM
bionys-314	334	9	):	):	PUNCT
bionys-314	334	10	184	184	NUM
bionys-314	334	11	.	.	PUNCT
bionys-314	335	1	van	van	PROPN
bionys-314	335	2	breusegem	breusegem	PROPN
bionys-314	335	3	,	,	PUNCT
bionys-314	335	4	f.	f.	PROPN
bionys-314	335	5	,	,	PUNCT
bionys-314	335	6	slooten	slooten	PROPN
bionys-314	335	7	,	,	PUNCT
bionys-314	335	8	l.	l.	PROPN
bionys-314	335	9	,	,	PUNCT
bionys-314	335	10	stassart	stassart	NOUN
bionys-314	335	11	,	,	PUNCT
bionys-314	335	12	j.-m	j.-m	PROPN
bionys-314	335	13	.	.	PUNCT
bionys-314	335	14	,	,	PUNCT
bionys-314	335	15	botterman	botterman	NOUN
bionys-314	335	16	,	,	PUNCT
bionys-314	335	17	j.	j.	PROPN
bionys-314	335	18	,	,	PUNCT
bionys-314	335	19	moens	moens	PROPN
bionys-314	335	20	,	,	PUNCT
bionys-314	335	21	t.	t.	PROPN
bionys-314	335	22	,	,	PUNCT
bionys-314	335	23	van	van	PROPN
bionys-314	335	24	montagu	montagu	PROPN
bionys-314	335	25	,	,	PUNCT
bionys-314	335	26	m.	m.	NOUN
bionys-314	335	27	,	,	PUNCT
bionys-314	335	28	inzé	inzé	NOUN
bionys-314	335	29	,	,	PUNCT
bionys-314	335	30	d.	d.	PROPN
bionys-314	335	31	1999	1999	NUM
bionys-314	335	32	:	:	PUNCT
bionys-314	336	1	effects	effect	NOUN
bionys-314	336	2	of	of	ADP
bionys-314	336	3	overproduction	overproduction	NOUN
bionys-314	336	4	of	of	ADP
bionys-314	336	5	tobacco	tobacco	NOUN
bionys-314	336	6	mnsod	mnsod	NOUN
bionys-314	336	7	in	in	ADP
bionys-314	336	8	maize	maize	NOUN
bionys-314	336	9	chloroplasts	chloroplast	NOUN
bionys-314	336	10	on	on	ADP
bionys-314	336	11	foliar	foliar	ADJ
bionys-314	336	12	tolerance	tolerance	NOUN
bionys-314	336	13	to	to	AUX
bionys-314	336	14	cold	cold	ADJ
bionys-314	336	15	and	and	CCONJ
bionys-314	336	16	oxidative	oxidative	ADJ
bionys-314	336	17	stress	stress	NOUN
bionys-314	336	18	.	.	PUNCT
bionys-314	337	1	journal	journal	NOUN
bionys-314	337	2	of	of	ADP
bionys-314	337	3	experimental	experimental	ADJ
bionys-314	337	4	botany	botany	NOUN
bionys-314	337	5	,	,	PUNCT
bionys-314	337	6	50	50	NUM
bionys-314	337	7	(	(	PUNCT
bionys-314	337	8	330	330	NUM
bionys-314	337	9	):	):	PUNCT
bionys-314	337	10	71	71	NUM
bionys-314	337	11	-	-	SYM
bionys-314	337	12	78	78	NUM
bionys-314	337	13	.	.	PUNCT
bionys-314	338	1	vyas	vyas	PROPN
bionys-314	338	2	,	,	PUNCT
bionys-314	338	3	d.	d.	PROPN
bionys-314	338	4	,	,	PUNCT
bionys-314	338	5	kumar	kumar	PROPN
bionys-314	338	6	,	,	PUNCT
bionys-314	338	7	s.	s.	PROPN
bionys-314	338	8	2005	2005	NUM
bionys-314	338	9	:	:	PUNCT
bionys-314	338	10	purification	purification	NOUN
bionys-314	338	11	and	and	CCONJ
bionys-314	338	12	partial	partial	ADJ
bionys-314	338	13	characterization	characterization	NOUN
bionys-314	338	14	of	of	ADP
bionys-314	338	15	a	a	DET
bionys-314	338	16	low	low	ADJ
bionys-314	338	17	temperature	temperature	NOUN
bionys-314	338	18	responsive	responsive	ADJ
bionys-314	338	19	mn	mn	NOUN
bionys-314	338	20	-	-	NOUN
bionys-314	338	21	sod	sod	NOUN
bionys-314	338	22	from	from	ADP
bionys-314	338	23	tea	tea	NOUN
bionys-314	338	24	(	(	PUNCT
bionys-314	338	25	camellia	camellia	NOUN
bionys-314	338	26	sinensis	sinensis	NOUN
bionys-314	338	27	(	(	PUNCT
bionys-314	338	28	l.	l.	PROPN
bionys-314	338	29	)	)	PUNCT
bionys-314	338	30	o.	o.	PROPN
bionys-314	338	31	kuntze	kuntze	PROPN
bionys-314	338	32	)	)	PUNCT
bionys-314	338	33	.	.	PUNCT
bionys-314	339	1	biochemical	biochemical	ADJ
bionys-314	339	2	and	and	CCONJ
bionys-314	339	3	biophysical	biophysical	ADJ
bionys-314	339	4	research	research	NOUN
bionys-314	339	5	communications	communication	NOUN
bionys-314	339	6	,	,	PUNCT
bionys-314	339	7	329	329	NUM
bionys-314	339	8	(	(	PUNCT
bionys-314	339	9	3	3	NUM
bionys-314	339	10	):	):	PUNCT
bionys-314	339	11	831	831	NUM
bionys-314	339	12	-	-	SYM
bionys-314	339	13	838	838	NUM
bionys-314	339	14	.	.	PUNCT
bionys-314	340	1	zhang	zhang	PROPN
bionys-314	340	2	,	,	PUNCT
bionys-314	340	3	j.	j.	PROPN
bionys-314	340	4	,	,	PUNCT
bionys-314	340	5	kirkham	kirkham	PROPN
bionys-314	340	6	,	,	PUNCT
bionys-314	340	7	m.	m.	NOUN
bionys-314	340	8	1996	1996	NUM
bionys-314	340	9	:	:	PUNCT
bionys-314	340	10	antioxidant	antioxidant	ADJ
bionys-314	340	11	responses	response	NOUN
bionys-314	340	12	to	to	ADP
bionys-314	340	13	drought	drought	NOUN
bionys-314	340	14	in	in	ADP
bionys-314	340	15	sunflower	sunflower	NOUN
bionys-314	340	16	and	and	CCONJ
bionys-314	340	17	sorghum	sorghum	NOUN
bionys-314	340	18	seedlings	seedling	NOUN
bionys-314	340	19	.	.	PUNCT
bionys-314	341	1	new	new	ADJ
bionys-314	341	2	phytologist	phytologist	NOUN
bionys-314	341	3	,	,	PUNCT
bionys-314	341	4	132	132	NUM
bionys-314	341	5	(	(	PUNCT
bionys-314	341	6	3	3	NUM
bionys-314	341	7	):	):	PUNCT
bionys-314	341	8	361	361	NUM
bionys-314	341	9	-	-	SYM
bionys-314	341	10	373	373	NUM
bionys-314	341	11	.	.	PUNCT
bionys-314	342	1	zhu	zhu	PROPN
bionys-314	342	2	,	,	PUNCT
bionys-314	342	3	j.-k	j.-k	PROPN
bionys-314	342	4	.	.	PUNCT
bionys-314	343	1	2001	2001	NUM
bionys-314	343	2	:	:	PUNCT
bionys-314	343	3	plant	plant	NOUN
bionys-314	343	4	salt	salt	NOUN
bionys-314	343	5	tolerance	tolerance	NOUN
bionys-314	343	6	.	.	PUNCT
bionys-314	344	1	trends	trend	NOUN
bionys-314	344	2	in	in	ADP
bionys-314	344	3	plant	plant	NOUN
bionys-314	344	4	science	science	NOUN
bionys-314	344	5	,	,	PUNCT
bionys-314	344	6	6	6	NUM
bionys-314	344	7	(	(	PUNCT
bionys-314	344	8	2	2	NUM
bionys-314	344	9	):	):	PUNCT
bionys-314	344	10	66	66	NUM
bionys-314	344	11	-	-	SYM
bionys-314	344	12	71	71	NUM
bionys-314	344	13	.	.	PUNCT
bionys-314	345	1	54	54	NUM
bionys-314	345	2	biologica	biologica	PROPN
bionys-314	345	3	nyssana	nyssana	PROPN
bionys-314	345	4	●	●	PUNCT
bionys-314	345	5	11	11	NUM
bionys-314	345	6	(	(	PUNCT
bionys-314	345	7	1	1	NUM
bionys-314	345	8	)	)	PUNCT
bionys-314	345	9	september	september	PROPN
bionys-314	345	10	2020	2020	NUM
bionys-314	345	11	:	:	PUNCT
bionys-314	345	12	45	45	NUM
bionys-314	345	13	-	-	SYM
bionys-314	345	14	54	54	NUM
bionys-314	345	15	mohammadi	mohammadi	NOUN
bionys-314	345	16	et	et	PROPN
bionys-314	345	17	al	al	PROPN
bionys-314	345	18	.	.	PUNCT
bionys-314	346	1	●	●	PUNCT
bionys-314	346	2	a	a	DET
bionys-314	346	3	real	real	ADJ
bionys-314	346	4	-	-	PUNCT
bionys-314	346	5	time	time	NOUN
bionys-314	346	6	pcr	pcr	NOUN
bionys-314	346	7	assay	assay	NOUN
bionys-314	346	8	for	for	ADP
bionys-314	346	9	evaluation	evaluation	NOUN
bionys-314	346	10	of	of	ADP
bionys-314	346	11	drought	drought	NOUN
bionys-314	346	12	tolerance	tolerance	NOUN
bionys-314	346	13	in	in	ADP
bionys-314	346	14	a	a	DET
bionys-314	346	15	new	new	ADJ
bionys-314	346	16	tea	tea	NOUN
bionys-314	346	17	clone	clone	NOUN