id	sid	tid	token	lemma	pos
bionys-634	1	1	zaaboubi	zaaboubi	PROPN
bionys-634	1	2	et	et	PROPN
bionys-634	1	3	al	al	PROPN
bionys-634	1	4	.	.	PROPN
bionys-634	1	5	2025	2025	NUM
bionys-634	1	6	,	,	PUNCT
bionys-634	1	7	biologica	biologica	PROPN
bionys-634	1	8	nyssana	nyssana	PROPN
bionys-634	1	9	16(2	16(2	NUM
bionys-634	1	10	)	)	PUNCT
bionys-634	1	11	16	16	NUM
bionys-634	1	12	(	(	PUNCT
bionys-634	1	13	2	2	NUM
bionys-634	1	14	)	)	PUNCT
bionys-634	1	15	december	december	PROPN
bionys-634	1	16	2025	2025	NUM
bionys-634	1	17	:	:	PUNCT
bionys-634	1	18	doi	doi	NOUN
bionys-634	1	19	:	:	PUNCT
bionys-634	1	20	10.46793	10.46793	NUM
bionys-634	1	21	/	/	SYM
bionys-634	1	22	biolnyss.16.2.9ad	biolnyss.16.2.9ad	PROPN
bionys-634	1	23	pcr	pcr	NOUN
bionys-634	1	24	-	-	PUNCT
bionys-634	1	25	based	base	VERB
bionys-634	1	26	investigation	investigation	NOUN
bionys-634	1	27	on	on	ADP
bionys-634	1	28	transgenic	transgenic	NOUN
bionys-634	1	29	maize	maize	NOUN
bionys-634	1	30	status	status	NOUN
bionys-634	1	31	in	in	ADP
bionys-634	1	32	corn	corn	NOUN
bionys-634	1	33	processed	process	VERB
bionys-634	1	34	products	product	NOUN
bionys-634	1	35	original	original	ADJ
bionys-634	1	36	article	article	NOUN
bionys-634	1	37	elham	elham	PROPN
bionys-634	1	38	ashrafi	ashrafi	PROPN
bionys-634	1	39	-	-	PUNCT
bionys-634	1	40	dehkordi	dehkordi	PROPN
bionys-634	1	41	nutrition	nutrition	NOUN
bionys-634	1	42	research	research	NOUN
bionys-634	1	43	center	center	NOUN
bionys-634	1	44	and	and	CCONJ
bionys-634	1	45	department	department	NOUN
bionys-634	1	46	of	of	ADP
bionys-634	1	47	food	food	NOUN
bionys-634	1	48	hygiene	hygiene	NOUN
bionys-634	1	49	and	and	CCONJ
bionys-634	1	50	quality	quality	NOUN
bionys-634	1	51	control	control	NOUN
bionys-634	1	52	,	,	PUNCT
bionys-634	1	53	school	school	NOUN
bionys-634	1	54	of	of	ADP
bionys-634	1	55	nutrition	nutrition	NOUN
bionys-634	1	56	and	and	CCONJ
bionys-634	1	57	food	food	NOUN
bionys-634	1	58	sciences	sciences	PROPN
bionys-634	1	59	,	,	PUNCT
bionys-634	1	60	shiraz	shiraz	PROPN
bionys-634	1	61	university	university	PROPN
bionys-634	1	62	of	of	ADP
bionys-634	1	63	medical	medical	ADJ
bionys-634	1	64	sciences	sciences	PROPN
bionys-634	1	65	,	,	PUNCT
bionys-634	1	66	shiraz	shiraz	PROPN
bionys-634	1	67	,	,	PUNCT
bionys-634	1	68	iran	iran	PROPN
bionys-634	1	69	elhamashrafi@gmail.com	elhamashrafi@gmail.com	X
bionys-634	2	1	(	(	PUNCT
bionys-634	2	2	corresponding	correspond	VERB
bionys-634	2	3	author	author	NOUN
bionys-634	2	4	)	)	PUNCT
bionys-634	2	5	mohsen	mohsen	PROPN
bionys-634	2	6	shahdadi	shahdadi	PROPN
bionys-634	2	7	nutrition	nutrition	PROPN
bionys-634	2	8	research	research	NOUN
bionys-634	2	9	center	center	NOUN
bionys-634	2	10	and	and	CCONJ
bionys-634	2	11	department	department	NOUN
bionys-634	2	12	of	of	ADP
bionys-634	2	13	food	food	NOUN
bionys-634	2	14	hygiene	hygiene	NOUN
bionys-634	2	15	and	and	CCONJ
bionys-634	2	16	quality	quality	NOUN
bionys-634	2	17	control	control	NOUN
bionys-634	2	18	,	,	PUNCT
bionys-634	2	19	school	school	NOUN
bionys-634	2	20	of	of	ADP
bionys-634	2	21	nutrition	nutrition	NOUN
bionys-634	2	22	and	and	CCONJ
bionys-634	2	23	food	food	NOUN
bionys-634	2	24	sciences	sciences	PROPN
bionys-634	2	25	,	,	PUNCT
bionys-634	2	26	shiraz	shiraz	PROPN
bionys-634	2	27	university	university	PROPN
bionys-634	2	28	of	of	ADP
bionys-634	2	29	medical	medical	ADJ
bionys-634	2	30	sciences	sciences	PROPN
bionys-634	2	31	,	,	PUNCT
bionys-634	2	32	shiraz	shiraz	PROPN
bionys-634	2	33	,	,	PUNCT
bionys-634	2	34	iran	iran	PROPN
bionys-634	2	35	enayat	enayat	NOUN
bionys-634	2	36	berizi	berizi	VERB
bionys-634	2	37	nutrition	nutrition	NOUN
bionys-634	2	38	research	research	NOUN
bionys-634	2	39	center	center	NOUN
bionys-634	2	40	and	and	CCONJ
bionys-634	2	41	department	department	NOUN
bionys-634	2	42	of	of	ADP
bionys-634	2	43	food	food	NOUN
bionys-634	2	44	hygiene	hygiene	NOUN
bionys-634	2	45	and	and	CCONJ
bionys-634	2	46	quality	quality	NOUN
bionys-634	2	47	control	control	NOUN
bionys-634	2	48	,	,	PUNCT
bionys-634	2	49	school	school	NOUN
bionys-634	2	50	of	of	ADP
bionys-634	2	51	nutrition	nutrition	NOUN
bionys-634	2	52	and	and	CCONJ
bionys-634	2	53	food	food	NOUN
bionys-634	2	54	sciences	sciences	PROPN
bionys-634	2	55	,	,	PUNCT
bionys-634	2	56	shiraz	shiraz	PROPN
bionys-634	2	57	university	university	PROPN
bionys-634	2	58	of	of	ADP
bionys-634	2	59	medical	medical	ADJ
bionys-634	2	60	sciences	sciences	PROPN
bionys-634	2	61	,	,	PUNCT
bionys-634	2	62	shiraz	shiraz	PROPN
bionys-634	2	63	,	,	PUNCT
bionys-634	2	64	iran	iran	PROPN
bionys-634	2	65	siavash	siavash	PROPN
bionys-634	2	66	babajafari	babajafari	PROPN
bionys-634	2	67	nutrition	nutrition	PROPN
bionys-634	2	68	research	research	NOUN
bionys-634	2	69	center	center	NOUN
bionys-634	2	70	and	and	CCONJ
bionys-634	2	71	department	department	NOUN
bionys-634	2	72	of	of	ADP
bionys-634	2	73	food	food	NOUN
bionys-634	2	74	hygiene	hygiene	NOUN
bionys-634	2	75	and	and	CCONJ
bionys-634	2	76	quality	quality	NOUN
bionys-634	2	77	control	control	NOUN
bionys-634	2	78	,	,	PUNCT
bionys-634	2	79	school	school	NOUN
bionys-634	2	80	of	of	ADP
bionys-634	2	81	nutrition	nutrition	NOUN
bionys-634	2	82	and	and	CCONJ
bionys-634	2	83	food	food	NOUN
bionys-634	2	84	sciences	sciences	PROPN
bionys-634	2	85	,	,	PUNCT
bionys-634	2	86	shiraz	shiraz	PROPN
bionys-634	2	87	university	university	PROPN
bionys-634	2	88	of	of	ADP
bionys-634	2	89	medical	medical	ADJ
bionys-634	2	90	sciences	sciences	PROPN
bionys-634	2	91	,	,	PUNCT
bionys-634	2	92	shiraz	shiraz	PROPN
bionys-634	2	93	,	,	PUNCT
bionys-634	2	94	iran	iran	PROPN
bionys-634	2	95	seyed	seyed	PROPN
bionys-634	2	96	mohammad	mohammad	PROPN
bionys-634	2	97	mazloomi	mazloomi	PROPN
bionys-634	2	98	nutrition	nutrition	PROPN
bionys-634	2	99	research	research	NOUN
bionys-634	2	100	center	center	NOUN
bionys-634	2	101	and	and	CCONJ
bionys-634	2	102	department	department	NOUN
bionys-634	2	103	of	of	ADP
bionys-634	2	104	food	food	NOUN
bionys-634	2	105	hygiene	hygiene	NOUN
bionys-634	2	106	and	and	CCONJ
bionys-634	2	107	quality	quality	NOUN
bionys-634	2	108	control	control	NOUN
bionys-634	2	109	,	,	PUNCT
bionys-634	2	110	school	school	NOUN
bionys-634	2	111	of	of	ADP
bionys-634	2	112	nutrition	nutrition	NOUN
bionys-634	2	113	and	and	CCONJ
bionys-634	2	114	food	food	NOUN
bionys-634	2	115	sciences	sciences	PROPN
bionys-634	2	116	,	,	PUNCT
bionys-634	2	117	shiraz	shiraz	PROPN
bionys-634	2	118	university	university	PROPN
bionys-634	2	119	of	of	ADP
bionys-634	2	120	medical	medical	ADJ
bionys-634	2	121	sciences	sciences	PROPN
bionys-634	2	122	,	,	PUNCT
bionys-634	2	123	shiraz	shiraz	PROPN
bionys-634	2	124	,	,	PUNCT
bionys-634	2	125	iran	iran	PROPN
bionys-634	2	126	received	receive	VERB
bionys-634	2	127	:	:	PUNCT
bionys-634	2	128	june	june	PROPN
bionys-634	2	129	09	09	NUM
bionys-634	2	130	,	,	PUNCT
bionys-634	2	131	2025	2025	NUM
bionys-634	2	132	revised	revise	VERB
bionys-634	2	133	:	:	PUNCT
bionys-634	2	134	august	august	PROPN
bionys-634	2	135	23	23	NUM
bionys-634	2	136	,	,	PUNCT
bionys-634	2	137	2025	2025	NUM
bionys-634	2	138	accepted	accept	VERB
bionys-634	2	139	:	:	PUNCT
bionys-634	2	140	august	august	PROPN
bionys-634	2	141	23	23	NUM
bionys-634	2	142	,	,	PUNCT
bionys-634	2	143	2025	2025	NUM
bionys-634	2	144	abstract	abstract	NOUN
bionys-634	2	145	:	:	PUNCT
bionys-634	2	146	monitoring	monitor	VERB
bionys-634	2	147	genetically	genetically	ADV
bionys-634	2	148	modified	modify	VERB
bionys-634	2	149	organisms	organism	NOUN
bionys-634	2	150	(	(	PUNCT
bionys-634	2	151	gmos	gmos	PROPN
bionys-634	2	152	)	)	PUNCT
bionys-634	2	153	is	be	AUX
bionys-634	2	154	increasingly	increasingly	ADV
bionys-634	2	155	required	require	VERB
bionys-634	2	156	by	by	ADP
bionys-634	2	157	law	law	NOUN
bionys-634	2	158	in	in	ADP
bionys-634	2	159	countries	country	NOUN
bionys-634	2	160	with	with	ADP
bionys-634	2	161	gmo	gmo	PROPN
bionys-634	2	162	labeling	labeling	NOUN
bionys-634	2	163	regulations	regulation	NOUN
bionys-634	2	164	.	.	PUNCT
bionys-634	3	1	efficient	efficient	ADJ
bionys-634	3	2	extraction	extraction	NOUN
bionys-634	3	3	of	of	ADP
bionys-634	3	4	high	high	ADJ
bionys-634	3	5	-	-	PUNCT
bionys-634	3	6	quality	quality	NOUN
bionys-634	3	7	genomic	genomic	NOUN
bionys-634	3	8	dna	dna	NOUN
bionys-634	3	9	is	be	AUX
bionys-634	3	10	essential	essential	ADJ
bionys-634	3	11	for	for	ADP
bionys-634	3	12	detecting	detect	VERB
bionys-634	3	13	and	and	CCONJ
bionys-634	3	14	quantifying	quantify	VERB
bionys-634	3	15	gm	gm	PROPN
bionys-634	3	16	content	content	NOUN
bionys-634	3	17	in	in	ADP
bionys-634	3	18	foods	food	NOUN
bionys-634	3	19	using	use	VERB
bionys-634	3	20	pcr	pcr	ADJ
bionys-634	3	21	techniques	technique	NOUN
bionys-634	3	22	.	.	PUNCT
bionys-634	4	1	this	this	DET
bionys-634	4	2	study	study	NOUN
bionys-634	4	3	developed	develop	VERB
bionys-634	4	4	and	and	CCONJ
bionys-634	4	5	evaluated	evaluate	VERB
bionys-634	4	6	various	various	ADJ
bionys-634	4	7	dna	dna	NOUN
bionys-634	4	8	extraction	extraction	NOUN
bionys-634	4	9	methods	method	NOUN
bionys-634	4	10	from	from	ADP
bionys-634	4	11	corn	corn	NOUN
bionys-634	4	12	seeds	seed	NOUN
bionys-634	4	13	and	and	CCONJ
bionys-634	4	14	products	product	NOUN
bionys-634	4	15	to	to	PART
bionys-634	4	16	ensure	ensure	VERB
bionys-634	4	17	sufficient	sufficient	ADJ
bionys-634	4	18	dna	dna	NOUN
bionys-634	4	19	yield	yield	VERB
bionys-634	4	20	free	free	ADJ
bionys-634	4	21	of	of	ADP
bionys-634	4	22	contaminants	contaminant	NOUN
bionys-634	4	23	and	and	CCONJ
bionys-634	4	24	pcr	pcr	ADJ
bionys-634	4	25	inhibitors	inhibitor	NOUN
bionys-634	4	26	.	.	PUNCT
bionys-634	5	1	thirty	thirty	NUM
bionys-634	5	2	samples	sample	NOUN
bionys-634	5	3	,	,	PUNCT
bionys-634	5	4	including	include	VERB
bionys-634	5	5	corn	corn	NOUN
bionys-634	5	6	seeds	seed	NOUN
bionys-634	5	7	and	and	CCONJ
bionys-634	5	8	derived	derived	NOUN
bionys-634	5	9	products	product	NOUN
bionys-634	5	10	,	,	PUNCT
bionys-634	5	11	were	be	AUX
bionys-634	5	12	randomly	randomly	ADV
bionys-634	5	13	purchased	purchase	VERB
bionys-634	5	14	from	from	ADP
bionys-634	5	15	supermarkets	supermarket	NOUN
bionys-634	5	16	and	and	CCONJ
bionys-634	5	17	grocery	grocery	NOUN
bionys-634	5	18	stores	store	NOUN
bionys-634	5	19	.	.	PUNCT
bionys-634	6	1	genomic	genomic	PROPN
bionys-634	6	2	dna	dna	PROPN
bionys-634	6	3	was	be	AUX
bionys-634	6	4	extracted	extract	VERB
bionys-634	6	5	by	by	ADP
bionys-634	6	6	different	different	ADJ
bionys-634	6	7	methods	method	NOUN
bionys-634	6	8	,	,	PUNCT
bionys-634	6	9	and	and	CCONJ
bionys-634	6	10	pcr	pcr	NOUN
bionys-634	6	11	was	be	AUX
bionys-634	6	12	used	use	VERB
bionys-634	6	13	to	to	PART
bionys-634	6	14	detect	detect	VERB
bionys-634	6	15	gmo	gmo	PROPN
bionys-634	6	16	-	-	PUNCT
bionys-634	6	17	specific	specific	ADJ
bionys-634	6	18	regions	region	NOUN
bionys-634	6	19	:	:	PUNCT
bionys-634	6	20	nosterminator	nosterminator	NUM
bionys-634	6	21	,	,	PUNCT
bionys-634	6	22	35s	35	NOUN
bionys-634	6	23	promoter	promoter	NOUN
bionys-634	6	24	,	,	PUNCT
bionys-634	6	25	and	and	CCONJ
bionys-634	6	26	epsps	epsps	PROPN
bionys-634	6	27	.	.	PUNCT
bionys-634	7	1	the	the	DET
bionys-634	7	2	zein	zein	NOUN
bionys-634	7	3	gene	gene	NOUN
bionys-634	7	4	was	be	AUX
bionys-634	7	5	also	also	ADV
bionys-634	7	6	amplified	amplify	VERB
bionys-634	7	7	to	to	PART
bionys-634	7	8	confirm	confirm	VERB
bionys-634	7	9	the	the	DET
bionys-634	7	10	presence	presence	NOUN
bionys-634	7	11	of	of	ADP
bionys-634	7	12	the	the	DET
bionys-634	7	13	maize	maize	NOUN
bionys-634	7	14	genome	genome	NOUN
bionys-634	7	15	in	in	ADP
bionys-634	7	16	all	all	DET
bionys-634	7	17	samples	sample	NOUN
bionys-634	7	18	.	.	PUNCT
bionys-634	8	1	results	result	NOUN
bionys-634	8	2	indicated	indicate	VERB
bionys-634	8	3	that	that	SCONJ
bionys-634	8	4	14	14	NUM
bionys-634	8	5	samples	sample	NOUN
bionys-634	8	6	contained	contain	VERB
bionys-634	8	7	the	the	DET
bionys-634	8	8	nos	no	NOUN
bionys-634	8	9	-	-	NOUN
bionys-634	8	10	terminator	terminator	NOUN
bionys-634	8	11	,	,	PUNCT
bionys-634	8	12	13	13	NUM
bionys-634	8	13	the	the	DET
bionys-634	8	14	35s	35s	NUM
bionys-634	8	15	promoter	promoter	NOUN
bionys-634	8	16	,	,	PUNCT
bionys-634	8	17	and	and	CCONJ
bionys-634	8	18	one	one	NUM
bionys-634	8	19	the	the	DET
bionys-634	8	20	epsps	epsps	ADJ
bionys-634	8	21	region	region	NOUN
bionys-634	8	22	,	,	PUNCT
bionys-634	8	23	identifying	identify	VERB
bionys-634	8	24	17	17	NUM
bionys-634	8	25	(	(	PUNCT
bionys-634	8	26	57	57	NUM
bionys-634	8	27	%	%	NOUN
bionys-634	8	28	)	)	PUNCT
bionys-634	8	29	samples	sample	NOUN
bionys-634	8	30	as	as	ADP
bionys-634	8	31	transgenic	transgenic	NOUN
bionys-634	8	32	.	.	PUNCT
bionys-634	9	1	the	the	DET
bionys-634	9	2	methods	method	NOUN
bionys-634	9	3	proved	prove	VERB
bionys-634	9	4	effective	effective	ADJ
bionys-634	9	5	for	for	ADP
bionys-634	9	6	extracting	extract	VERB
bionys-634	9	7	quality	quality	NOUN
bionys-634	9	8	dna	dna	PROPN
bionys-634	9	9	suitable	suitable	ADJ
bionys-634	9	10	for	for	ADP
bionys-634	9	11	gmo	gmo	PROPN
bionys-634	9	12	detection	detection	NOUN
bionys-634	9	13	.	.	PUNCT
bionys-634	10	1	many	many	ADJ
bionys-634	10	2	gm	gm	ADJ
bionys-634	10	3	-	-	PUNCT
bionys-634	10	4	positive	positive	ADJ
bionys-634	10	5	products	product	NOUN
bionys-634	10	6	lacked	lack	VERB
bionys-634	10	7	labeling	labeling	NOUN
bionys-634	10	8	,	,	PUNCT
bionys-634	10	9	underscoring	underscore	VERB
bionys-634	10	10	the	the	DET
bionys-634	10	11	need	need	NOUN
bionys-634	10	12	for	for	ADP
bionys-634	10	13	reliable	reliable	ADJ
bionys-634	10	14	detection	detection	NOUN
bionys-634	10	15	methods	method	NOUN
bionys-634	10	16	and	and	CCONJ
bionys-634	10	17	stricter	strict	ADJ
bionys-634	10	18	labeling	labeling	NOUN
bionys-634	10	19	enforcement	enforcement	NOUN
bionys-634	10	20	.	.	PUNCT
bionys-634	11	1	key	key	ADJ
bionys-634	11	2	words	word	NOUN
bionys-634	11	3	:	:	PUNCT
bionys-634	11	4	genetically	genetically	ADV
bionys-634	11	5	modified	modify	VERB
bionys-634	11	6	organism	organism	NOUN
bionys-634	11	7	,	,	PUNCT
bionys-634	11	8	labeling	labeling	NOUN
bionys-634	11	9	,	,	PUNCT
bionys-634	11	10	maize	maize	NOUN
bionys-634	11	11	,	,	PUNCT
bionys-634	11	12	pcr	pcr	PROPN
bionys-634	11	13	apstrakt	apstrakt	NOUN
bionys-634	11	14	:	:	PUNCT
bionys-634	11	15	ispitivanje	ispitivanje	PROPN
bionys-634	11	16	prisustva	prisustva	PROPN
bionys-634	11	17	transgenog	transgenog	PROPN
bionys-634	11	18	kukuruza	kukuruza	NOUN
bionys-634	11	19	u	u	PROPN
bionys-634	11	20	prerađenim	prerađenim	VERB
bionys-634	11	21	proizvodima	proizvodima	PROPN
bionys-634	11	22	od	od	PROPN
bionys-634	11	23	kukuruza	kukuruza	PROPN
bionys-634	11	24	zasnovano	zasnovano	VERB
bionys-634	11	25	na	na	ADP
bionys-634	11	26	pcr	pcr	PROPN
bionys-634	11	27	metodi	metodi	PROPN
bionys-634	11	28	praćenje	praćenje	PROPN
bionys-634	11	29	genetički	genetički	PROPN
bionys-634	11	30	modifikovanih	modifikovanih	PROPN
bionys-634	11	31	organizama	organizama	NOUN
bionys-634	11	32	(	(	PUNCT
bionys-634	11	33	gmo	gmo	PROPN
bionys-634	11	34	)	)	PUNCT
bionys-634	11	35	sve	sve	PROPN
bionys-634	11	36	je	je	X
bionys-634	11	37	češće	češće	PROPN
bionys-634	11	38	zakonski	zakonski	PROPN
bionys-634	11	39	zahtevano	zahtevano	PROPN
bionys-634	11	40	u	u	PROPN
bionys-634	11	41	zemljama	zemljama	PROPN
bionys-634	11	42	koje	koje	PROPN
bionys-634	11	43	imaju	imaju	PROPN
bionys-634	11	44	propise	propise	NOUN
bionys-634	11	45	o	o	PROPN
bionys-634	11	46	označavanju	označavanju	NOUN
bionys-634	11	47	gmo	gmo	PROPN
bionys-634	11	48	proizvoda	proizvoda	PROPN
bionys-634	11	49	.	.	PUNCT
bionys-634	12	1	efikasna	efikasna	PROPN
bionys-634	12	2	ekstrakcija	ekstrakcija	PROPN
bionys-634	12	3	genomske	genomske	PROPN
bionys-634	12	4	dnk	dnk	NOUN
bionys-634	12	5	visokog	visokog	INTJ
bionys-634	12	6	kvaliteta	kvaliteta	PROPN
bionys-634	12	7	od	od	PROPN
bionys-634	13	1	suštinskog	suštinskog	PROPN
bionys-634	13	2	je	je	PROPN
bionys-634	13	3	značaja	značaja	PROPN
bionys-634	13	4	za	za	PROPN
bionys-634	13	5	detekciju	detekciju	PROPN
bionys-634	14	1	i	i	PRON
bionys-634	14	2	kvantifikaciju	kvantifikaciju	PROPN
bionys-634	14	3	gmo	gmo	PROPN
bionys-634	14	4	sadržaja	sadržaja	PROPN
bionys-634	14	5	u	u	PROPN
bionys-634	14	6	hrani	hrani	PROPN
bionys-634	14	7	primenom	primenom	PROPN
bionys-634	14	8	pcr	pcr	PROPN
bionys-634	14	9	tehnika	tehnika	NOUN
bionys-634	14	10	.	.	PUNCT
bionys-634	15	1	u	u	PROPN
bionys-634	15	2	ovom	ovom	PROPN
bionys-634	15	3	radu	radu	PROPN
bionys-634	15	4	razvijene	razvijene	PROPN
bionys-634	16	1	su	su	PROPN
bionys-634	17	1	i	i	PRON
bionys-634	17	2	procenjene	procenjene	PROPN
bionys-634	17	3	različite	različite	PROPN
bionys-634	17	4	metode	metode	PROPN
bionys-634	17	5	ekstrakcije	ekstrakcije	PROPN
bionys-634	17	6	dnk	dnk	VERB
bionys-634	17	7	iz	iz	SCONJ
bionys-634	17	8	zrna	zrna	NOUN
bionys-634	17	9	kukuruza	kukuruza	NOUN
bionys-634	17	10	i	i	PRON
bionys-634	17	11	proizvoda	proizvoda	VERB
bionys-634	17	12	od	od	PROPN
bionys-634	17	13	kukuruza	kukuruza	PROPN
bionys-634	17	14	,	,	PUNCT
bionys-634	17	15	kako	kako	PROPN
bionys-634	17	16	bi	bi	PROPN
bionys-634	17	17	se	se	PROPN
bionys-634	17	18	obezbedio	obezbedio	PROPN
bionys-634	17	19	dovoljan	dovoljan	NOUN
bionys-634	17	20	prinos	prino	NOUN
bionys-634	17	21	dnk	dnk	VERB
bionys-634	18	1	bez	bez	PROPN
bionys-634	18	2	prisustva	prisustva	NOUN
bionys-634	18	3	kontaminenata	kontaminenata	NOUN
bionys-634	19	1	i	i	PRON
bionys-634	19	2	inhibitora	inhibitora	VERB
bionys-634	19	3	pcr	pcr	ADJ
bionys-634	19	4	reakcije	reakcije	NOUN
bionys-634	19	5	.	.	PUNCT
bionys-634	20	1	trideset	trideset	VERB
bionys-634	20	2	uzoraka	uzoraka	PROPN
bionys-634	20	3	,	,	PUNCT
bionys-634	20	4	uključujući	uključujući	PROPN
bionys-634	20	5	zrna	zrna	VERB
bionys-634	20	6	kukuruza	kukuruza	PROPN
bionys-634	20	7	i	i	PRON
bionys-634	20	8	prerađene	prerađene	VERB
bionys-634	20	9	proizvode	proizvode	PROPN
bionys-634	20	10	,	,	PUNCT
bionys-634	20	11	nasumično	nasumično	PROPN
bionys-634	20	12	je	je	PROPN
bionys-634	20	13	nabavljeno	nabavljeno	PROPN
bionys-634	21	1	iz	iz	INTJ
bionys-634	21	2	supermarketa	supermarketa	NOUN
bionys-634	21	3	i	i	PRON
bionys-634	21	4	prodavnica	prodavnica	NOUN
bionys-634	21	5	.	.	PUNCT
bionys-634	22	1	genomska	genomska	PROPN
bionys-634	22	2	dnk	dnk	PROPN
bionys-634	22	3	je	je	PROPN
bionys-634	22	4	ekstrahovana	ekstrahovana	PROPN
bionys-634	22	5	različitim	različitim	PROPN
bionys-634	22	6	protokolima	protokolima	NOUN
bionys-634	22	7	,	,	PUNCT
bionys-634	22	8	a	a	DET
bionys-634	22	9	pcr	pcr	PROPN
bionys-634	22	10	je	je	PROPN
bionys-634	22	11	korišćen	korišćen	PROPN
bionys-634	22	12	za	za	PROPN
bionys-634	22	13	detekciju	detekciju	PROPN
bionys-634	22	14	gmo	gmo	PROPN
bionys-634	22	15	-	-	PUNCT
bionys-634	22	16	specifičnih	specifičnih	PROPN
bionys-634	22	17	regiona	regiona	PROPN
bionys-634	22	18	:	:	PUNCT
bionys-634	22	19	nos	nos	PROPN
bionys-634	22	20	terminator	terminator	NOUN
bionys-634	22	21	,	,	PUNCT
bionys-634	22	22	35s	35	NOUN
bionys-634	22	23	promotor	promotor	NOUN
bionys-634	22	24	i	i	PRON
bionys-634	22	25	epsps	epsps	VERB
bionys-634	22	26	.	.	PUNCT
bionys-634	23	1	gen	gen	PROPN
bionys-634	23	2	zein	zein	PROPN
bionys-634	23	3	je	je	PROPN
bionys-634	23	4	amplifikovan	amplifikovan	PROPN
bionys-634	23	5	radi	radi	PROPN
bionys-634	23	6	potvrde	potvrde	PROPN
bionys-634	23	7	prisustva	prisustva	PROPN
bionys-634	23	8	genoma	genoma	PROPN
bionys-634	23	9	kukuruza	kukuruza	PROPN
bionys-634	23	10	u	u	PROPN
bionys-634	23	11	svim	svim	PROPN
bionys-634	23	12	uzorcima	uzorcima	PROPN
bionys-634	23	13	.	.	PUNCT
bionys-634	24	1	rezultati	rezultati	PROPN
bionys-634	24	2	su	su	PROPN
bionys-634	24	3	pokazali	pokazali	PROPN
bionys-634	24	4	da	da	PROPN
bionys-634	24	5	je	je	PROPN
bionys-634	24	6	14	14	NUM
bionys-634	24	7	uzoraka	uzoraka	PROPN
bionys-634	24	8	sadržalo	sadržalo	PROPN
bionys-634	24	9	nos	nos	PROPN
bionys-634	24	10	terminator	terminator	PROPN
bionys-634	24	11	,	,	PUNCT
bionys-634	24	12	13	13	NUM
bionys-634	24	13	uzoraka	uzoraka	NOUN
bionys-634	24	14	35s	35s	NUM
bionys-634	24	15	promotor	promotor	NOUN
bionys-634	24	16	,	,	PUNCT
bionys-634	24	17	a	a	DET
bionys-634	24	18	jedan	jedan	PROPN
bionys-634	24	19	uzorak	uzorak	PROPN
bionys-634	24	20	epsps	epsps	PROPN
bionys-634	24	21	region	region	PROPN
bionys-634	24	22	,	,	PUNCT
bionys-634	24	23	čime	čime	NOUN
bionys-634	24	24	je	je	PROPN
bionys-634	24	25	ukupno	ukupno	PROPN
bionys-634	24	26	17	17	NUM
bionys-634	24	27	uzoraka	uzoraka	NOUN
bionys-634	24	28	(	(	PUNCT
bionys-634	24	29	57	57	NUM
bionys-634	24	30	%	%	NOUN
bionys-634	24	31	)	)	PUNCT
bionys-634	24	32	identifikovano	identifikovano	VERB
bionys-634	24	33	kao	kao	PROPN
bionys-634	24	34	transgeno	transgeno	PROPN
bionys-634	24	35	.	.	PUNCT
bionys-634	25	1	primenjene	primenjene	PROPN
bionys-634	25	2	metode	metode	PROPN
bionys-634	25	3	pokazale	pokazale	PROPN
bionys-634	25	4	su	su	PROPN
bionys-634	25	5	se	se	PROPN
bionys-634	25	6	efikasnim	efikasnim	PROPN
bionys-634	25	7	za	za	PROPN
bionys-634	25	8	ekstrakciju	ekstrakciju	PROPN
bionys-634	25	9	dnk	dnk	NOUN
bionys-634	25	10	visokog	visokog	PROPN
bionys-634	25	11	kvaliteta	kvaliteta	PROPN
bionys-634	25	12	pogodnu	pogodnu	PROPN
bionys-634	25	13	za	za	PROPN
bionys-634	25	14	detekciju	detekciju	PROPN
bionys-634	25	15	gmo	gmo	PROPN
bionys-634	25	16	.	.	PROPN
bionys-634	25	17	značajan	značajan	PROPN
bionys-634	25	18	broj	broj	PROPN
bionys-634	25	19	gmopozitivnih	gmopozitivnih	ADV
bionys-634	25	20	proizvoda	proizvoda	ADP
bionys-634	25	21	nije	nije	PROPN
bionys-634	25	22	imao	imao	PROPN
bionys-634	25	23	odgovarajuću	odgovarajuću	PROPN
bionys-634	25	24	oznaku	oznaku	PROPN
bionys-634	25	25	,	,	PUNCT
bionys-634	25	26	što	što	PROPN
bionys-634	25	27	ukazuje	ukazuje	NOUN
bionys-634	25	28	na	na	ADP
bionys-634	25	29	potrebu	potrebu	PROPN
bionys-634	25	30	za	za	PROPN
bionys-634	25	31	pouzdanim	pouzdanim	PROPN
bionys-634	25	32	metodama	metodama	PROPN
bionys-634	25	33	detekcije	detekcije	NOUN
bionys-634	25	34	i	i	PRON
bionys-634	25	35	strožom	strožom	VERB
bionys-634	25	36	kontrolom	kontrolom	ADJ
bionys-634	25	37	označavanja	označavanja	ADV
bionys-634	25	38	.	.	PUNCT
bionys-634	26	1	ključne	ključne	PROPN
bionys-634	26	2	reči	reči	NOUN
bionys-634	26	3	:	:	PUNCT
bionys-634	26	4	genetički	genetički	PROPN
bionys-634	26	5	modifikovani	modifikovani	PROPN
bionys-634	26	6	organizam	organizam	PROPN
bionys-634	26	7	,	,	PUNCT
bionys-634	26	8	označavanje	označavanje	NOUN
bionys-634	26	9	,	,	PUNCT
bionys-634	26	10	kukuruz	kukuruz	NOUN
bionys-634	26	11	,	,	PUNCT
bionys-634	26	12	pcr	pcr	ADJ
bionys-634	26	13	introduction	introduction	NOUN
bionys-634	26	14	recombinant	recombinant	ADJ
bionys-634	26	15	dna	dna	NOUN
bionys-634	26	16	(	(	PUNCT
bionys-634	26	17	rdna	rdna	NOUN
bionys-634	26	18	)	)	PUNCT
bionys-634	26	19	technologies	technology	NOUN
bionys-634	26	20	have	have	AUX
bionys-634	26	21	been	be	AUX
bionys-634	26	22	developed	develop	VERB
bionys-634	26	23	to	to	PART
bionys-634	26	24	improve	improve	VERB
bionys-634	26	25	modern	modern	ADJ
bionys-634	26	26	farming	farming	NOUN
bionys-634	26	27	and	and	CCONJ
bionys-634	26	28	have	have	AUX
bionys-634	26	29	provided	provide	VERB
bionys-634	26	30	many	many	ADJ
bionys-634	26	31	advantages	advantage	NOUN
bionys-634	26	32	in	in	ADP
bionys-634	26	33	crops	crop	NOUN
bionys-634	26	34	such	such	ADJ
bionys-634	26	35	as	as	ADP
bionys-634	26	36	herbicide	herbicide	NOUN
bionys-634	26	37	tolerance	tolerance	NOUN
bionys-634	26	38	,	,	PUNCT
bionys-634	26	39	biotic	biotic	ADJ
bionys-634	26	40	and	and	CCONJ
bionys-634	26	41	abiotic	abiotic	ADJ
bionys-634	26	42	stress	stress	NOUN
bionys-634	26	43	resistance	resistance	NOUN
bionys-634	26	44	,	,	PUNCT
bionys-634	26	45	and	and	CCONJ
bionys-634	26	46	improved	improve	VERB
bionys-634	26	47	nutritional	nutritional	ADJ
bionys-634	26	48	value	value	NOUN
bionys-634	26	49	(	(	PUNCT
bionys-634	26	50	ashrafi	ashrafi	PROPN
bionys-634	26	51	dehkordi	dehkordi	PROPN
bionys-634	26	52	et	et	PROPN
bionys-634	26	53	al	al	PROPN
bionys-634	26	54	.	.	PROPN
bionys-634	26	55	,	,	PUNCT
bionys-634	26	56	2021	2021	NUM
bionys-634	26	57	;	;	PUNCT
bionys-634	26	58	dehkordi	dehkordi	PROPN
bionys-634	26	59	et	et	PROPN
bionys-634	26	60	al	al	PROPN
bionys-634	26	61	.	.	PROPN
bionys-634	26	62	,	,	PUNCT
bionys-634	26	63	2018	2018	NUM
bionys-634	26	64	)	)	PUNCT
bionys-634	26	65	.	.	PUNCT
bionys-634	27	1	many	many	ADJ
bionys-634	27	2	gmcs	gmcs	NOUN
bionys-634	27	3	(	(	PUNCT
bionys-634	27	4	genetically	genetically	ADV
bionys-634	27	5	modified	modify	VERB
bionys-634	27	6	crops	crop	NOUN
bionys-634	27	7	)	)	PUNCT
bionys-634	27	8	have	have	AUX
bionys-634	27	9	been	be	AUX
bionys-634	27	10	approved	approve	VERB
bionys-634	27	11	since	since	SCONJ
bionys-634	27	12	the	the	DET
bionys-634	27	13	mid-1990s	mid-1990	NOUN
bionys-634	27	14	worldwide	worldwide	ADV
bionys-634	27	15	,	,	PUNCT
bionys-634	27	16	and	and	CCONJ
bionys-634	27	17	the	the	DET
bionys-634	27	18	global	global	ADJ
bionys-634	27	19	area	area	NOUN
bionys-634	27	20	of	of	ADP
bionys-634	27	21	gmcs	gmcs	NOUN
bionys-634	27	22	was	be	AUX
bionys-634	27	23	more	more	ADJ
bionys-634	27	24	than	than	ADP
bionys-634	27	25	190	190	NUM
bionys-634	27	26	million	million	NUM
bionys-634	27	27	hectares	hectare	NOUN
bionys-634	27	28	in	in	ADP
bionys-634	27	29	2019	2019	NUM
bionys-634	27	30	(	(	PUNCT
bionys-634	27	31	isaaa	isaaa	NOUN
bionys-634	27	32	,	,	PUNCT
bionys-634	27	33	2019	2019	NUM
bionys-634	27	34	)	)	PUNCT
bionys-634	27	35	and	and	CCONJ
bionys-634	27	36	is	be	AUX
bionys-634	27	37	expected	expect	VERB
bionys-634	27	38	to	to	PART
bionys-634	27	39	continue	continue	VERB
bionys-634	27	40	to	to	PART
bionys-634	27	41	increase	increase	VERB
bionys-634	27	42	.	.	PUNCT
bionys-634	28	1	more	more	ADJ
bionys-634	28	2	than	than	ADP
bionys-634	28	3	200	200	NUM
bionys-634	28	4	different	different	ADJ
bionys-634	28	5	gmcs	gmcs	NOUN
bionys-634	28	6	with	with	ADP
bionys-634	28	7	varying	vary	VERB
bionys-634	28	8	features	feature	NOUN
bionys-634	28	9	,	,	PUNCT
bionys-634	28	10	of	of	ADP
bionys-634	28	11	which	which	PRON
bionys-634	28	12	the	the	DET
bionys-634	28	13	highest	high	ADJ
bionys-634	28	14	cultivated	cultivate	VERB
bionys-634	28	15	©	©	PROPN
bionys-634	28	16	2025	2025	NUM
bionys-634	28	17	ashrafi	ashrafi	NOUN
bionys-634	28	18	-	-	PUNCT
bionys-634	28	19	dehkordi	dehkordi	PROPN
bionys-634	28	20	et	et	PROPN
bionys-634	28	21	al	al	PROPN
bionys-634	28	22	.	.	PUNCT
bionys-634	29	1	this	this	PRON
bionys-634	29	2	is	be	AUX
bionys-634	29	3	an	an	DET
bionys-634	29	4	open	open	ADJ
bionys-634	29	5	-	-	PUNCT
bionys-634	29	6	access	access	NOUN
bionys-634	29	7	article	article	NOUN
bionys-634	29	8	distributed	distribute	VERB
bionys-634	29	9	under	under	ADP
bionys-634	29	10	the	the	DET
bionys-634	29	11	terms	term	NOUN
bionys-634	29	12	of	of	ADP
bionys-634	29	13	the	the	DET
bionys-634	29	14	creative	creative	ADJ
bionys-634	29	15	commons	common	NOUN
bionys-634	29	16	attribution	attribution	NOUN
bionys-634	29	17	license	license	NOUN
bionys-634	29	18	,	,	PUNCT
bionys-634	29	19	which	which	PRON
bionys-634	29	20	permits	permit	VERB
bionys-634	29	21	unrestricted	unrestricted	ADJ
bionys-634	29	22	use	use	NOUN
bionys-634	29	23	,	,	PUNCT
bionys-634	29	24	distribution	distribution	NOUN
bionys-634	29	25	,	,	PUNCT
bionys-634	29	26	and	and	CCONJ
bionys-634	29	27	build	build	VERB
bionys-634	29	28	upon	upon	SCONJ
bionys-634	29	29	your	your	PRON
bionys-634	29	30	work	work	NOUN
bionys-634	29	31	non	non	ADJ
bionys-634	29	32	-	-	ADJ
bionys-634	29	33	commercially	commercially	ADV
bionys-634	29	34	under	under	ADP
bionys-634	29	35	the	the	DET
bionys-634	29	36	same	same	ADJ
bionys-634	29	37	license	license	NOUN
bionys-634	29	38	as	as	ADP
bionys-634	29	39	the	the	DET
bionys-634	29	40	original	original	ADJ
bionys-634	29	41	.	.	PUNCT
bionys-634	30	1	area	area	NOUN
bionys-634	30	2	belongs	belong	VERB
bionys-634	30	3	to	to	ADP
bionys-634	30	4	soy	soy	NOUN
bionys-634	30	5	,	,	PUNCT
bionys-634	30	6	corn	corn	NOUN
bionys-634	30	7	,	,	PUNCT
bionys-634	30	8	canola	canola	NOUN
bionys-634	30	9	,	,	PUNCT
bionys-634	30	10	and	and	CCONJ
bionys-634	30	11	cotton	cotton	NOUN
bionys-634	30	12	,	,	PUNCT
bionys-634	30	13	and	and	CCONJ
bionys-634	30	14	several	several	ADJ
bionys-634	30	15	products	product	NOUN
bionys-634	30	16	of	of	ADP
bionys-634	30	17	these	these	DET
bionys-634	30	18	gmcs	gmcs	NOUN
bionys-634	30	19	are	be	AUX
bionys-634	30	20	available	available	ADJ
bionys-634	30	21	in	in	ADP
bionys-634	30	22	markets	market	NOUN
bionys-634	30	23	(	(	PUNCT
bionys-634	30	24	ashrafi	ashrafi	NOUN
bionys-634	30	25	-	-	PUNCT
bionys-634	30	26	dehkordi	dehkordi	PROPN
bionys-634	30	27	et	et	PROPN
bionys-634	30	28	al	al	PROPN
bionys-634	30	29	.	.	PROPN
bionys-634	30	30	,	,	PUNCT
bionys-634	30	31	2022	2022	NUM
bionys-634	30	32	)	)	PUNCT
bionys-634	30	33	.	.	PUNCT
bionys-634	31	1	maize	maize	NOUN
bionys-634	31	2	is	be	AUX
bionys-634	31	3	one	one	NUM
bionys-634	31	4	of	of	ADP
bionys-634	31	5	the	the	DET
bionys-634	31	6	major	major	ADJ
bionys-634	31	7	agricultural	agricultural	ADJ
bionys-634	31	8	crops	crop	NOUN
bionys-634	31	9	and	and	CCONJ
bionys-634	31	10	the	the	DET
bionys-634	31	11	cultivation	cultivation	NOUN
bionys-634	31	12	of	of	ADP
bionys-634	31	13	gm	gm	PROPN
bionys-634	31	14	maize	maize	NOUN
bionys-634	31	15	is	be	AUX
bionys-634	31	16	increasing	increase	VERB
bionys-634	31	17	worldwide	worldwide	ADV
bionys-634	31	18	.	.	PUNCT
bionys-634	32	1	the	the	DET
bionys-634	32	2	global	global	ADJ
bionys-634	32	3	area	area	NOUN
bionys-634	32	4	under	under	ADP
bionys-634	32	5	gm	gm	PROPN
bionys-634	32	6	maize	maize	NOUN
bionys-634	32	7	is	be	AUX
bionys-634	32	8	more	more	ADJ
bionys-634	32	9	than	than	ADP
bionys-634	32	10	60	60	NUM
bionys-634	32	11	million	million	NUM
bionys-634	32	12	hectares	hectare	NOUN
bionys-634	32	13	,	,	PUNCT
bionys-634	32	14	accounting	account	VERB
bionys-634	32	15	for	for	ADP
bionys-634	32	16	about	about	ADV
bionys-634	32	17	32	32	NUM
bionys-634	32	18	%	%	NOUN
bionys-634	32	19	of	of	ADP
bionys-634	32	20	global	global	ADJ
bionys-634	32	21	corn	corn	NOUN
bionys-634	32	22	production	production	NOUN
bionys-634	32	23	(	(	PUNCT
bionys-634	32	24	isaaa	isaaa	NOUN
bionys-634	32	25	,	,	PUNCT
bionys-634	32	26	2019	2019	NUM
bionys-634	32	27	)	)	PUNCT
bionys-634	32	28	.	.	PUNCT
bionys-634	33	1	although	although	SCONJ
bionys-634	33	2	,	,	PUNCT
bionys-634	33	3	maize	maize	NOUN
bionys-634	33	4	is	be	AUX
bionys-634	33	5	approved	approve	VERB
bionys-634	33	6	for	for	ADP
bionys-634	33	7	use	use	NOUN
bionys-634	33	8	as	as	ADP
bionys-634	33	9	feed	feed	NOUN
bionys-634	33	10	/	/	SYM
bionys-634	33	11	food	food	NOUN
bionys-634	33	12	in	in	ADP
bionys-634	33	13	many	many	ADJ
bionys-634	33	14	countries	country	NOUN
bionys-634	33	15	based	base	VERB
bionys-634	33	16	on	on	ADP
bionys-634	33	17	their	their	PRON
bionys-634	33	18	safety	safety	NOUN
bionys-634	33	19	evaluation	evaluation	NOUN
bionys-634	33	20	criteria	criterion	NOUN
bionys-634	33	21	.	.	PUNCT
bionys-634	34	1	however	however	ADV
bionys-634	34	2	,	,	PUNCT
bionys-634	34	3	many	many	ADJ
bionys-634	34	4	consumers	consumer	NOUN
bionys-634	34	5	are	be	AUX
bionys-634	34	6	demanding	demand	VERB
bionys-634	34	7	information	information	NOUN
bionys-634	34	8	and	and	CCONJ
bionys-634	34	9	appropriate	appropriate	ADJ
bionys-634	34	10	labeling	labeling	NOUN
bionys-634	34	11	for	for	ADP
bionys-634	34	12	foods	food	NOUN
bionys-634	34	13	derived	derive	VERB
bionys-634	34	14	from	from	ADP
bionys-634	34	15	gmos	gmos	PROPN
bionys-634	34	16	.	.	PUNCT
bionys-634	35	1	in	in	ADP
bionys-634	35	2	this	this	DET
bionys-634	35	3	regard	regard	NOUN
bionys-634	35	4	,	,	PUNCT
bionys-634	35	5	different	different	ADJ
bionys-634	35	6	labeling	labeling	NOUN
bionys-634	35	7	systems	system	NOUN
bionys-634	35	8	for	for	ADP
bionys-634	35	9	gm	gm	PROPN
bionys-634	35	10	foods	food	NOUN
bionys-634	35	11	have	have	AUX
bionys-634	35	12	been	be	AUX
bionys-634	35	13	introduced	introduce	VERB
bionys-634	35	14	in	in	ADP
bionys-634	35	15	different	different	ADJ
bionys-634	35	16	countries	country	NOUN
bionys-634	35	17	such	such	ADJ
bionys-634	35	18	as	as	ADP
bionys-634	35	19	the	the	DET
bionys-634	35	20	european	european	PROPN
bionys-634	35	21	union	union	PROPN
bionys-634	35	22	(	(	PUNCT
bionys-634	35	23	eu	eu	PROPN
bionys-634	35	24	)	)	PUNCT
bionys-634	35	25	,	,	PUNCT
bionys-634	35	26	korea	korea	PROPN
bionys-634	35	27	,	,	PUNCT
bionys-634	35	28	russia	russia	PROPN
bionys-634	35	29	,	,	PUNCT
bionys-634	35	30	and	and	CCONJ
bionys-634	35	31	japan	japan	PROPN
bionys-634	35	32	.	.	PUNCT
bionys-634	36	1	there	there	PRON
bionys-634	36	2	are	be	VERB
bionys-634	36	3	different	different	ADJ
bionys-634	36	4	thresholds	threshold	NOUN
bionys-634	36	5	(	(	PUNCT
bionys-634	36	6	between	between	ADP
bionys-634	36	7	0	0	NUM
bionys-634	36	8	and	and	CCONJ
bionys-634	36	9	5	5	NUM
bionys-634	36	10	%	%	NOUN
bionys-634	36	11	)	)	PUNCT
bionys-634	36	12	for	for	ADP
bionys-634	36	13	accidental	accidental	ADJ
bionys-634	36	14	mixing	mixing	NOUN
bionys-634	36	15	of	of	ADP
bionys-634	36	16	gm	gm	PROPN
bionys-634	36	17	crops	crop	NOUN
bionys-634	36	18	;	;	PUNCT
bionys-634	36	19	for	for	ADP
bionys-634	36	20	example	example	NOUN
bionys-634	36	21	,	,	PUNCT
bionys-634	36	22	the	the	DET
bionys-634	36	23	thresholds	threshold	NOUN
bionys-634	36	24	in	in	ADP
bionys-634	36	25	russia	russia	PROPN
bionys-634	36	26	are	be	AUX
bionys-634	36	27	0.9	0.9	NUM
bionys-634	36	28	%	%	NOUN
bionys-634	36	29	,	,	PUNCT
bionys-634	36	30	in	in	ADP
bionys-634	36	31	the	the	DET
bionys-634	36	32	european	european	PROPN
bionys-634	36	33	union	union	PROPN
bionys-634	36	34	are	be	AUX
bionys-634	36	35	0.9	0.9	NUM
bionys-634	36	36	%	%	NOUN
bionys-634	36	37	,	,	PUNCT
bionys-634	36	38	in	in	ADP
bionys-634	36	39	korea	korea	PROPN
bionys-634	36	40	,	,	PUNCT
bionys-634	36	41	3	3	NUM
bionys-634	36	42	%	%	NOUN
bionys-634	36	43	and	and	CCONJ
bionys-634	36	44	5	5	NUM
bionys-634	36	45	%	%	NOUN
bionys-634	36	46	in	in	ADP
bionys-634	36	47	japan	japan	PROPN
bionys-634	36	48	(	(	PUNCT
bionys-634	36	49	chiaravutthi	chiaravutthi	X
bionys-634	36	50	et	et	PROPN
bionys-634	36	51	al	al	PROPN
bionys-634	36	52	.	.	PROPN
bionys-634	36	53	,	,	PUNCT
bionys-634	36	54	2022	2022	NUM
bionys-634	36	55	)	)	PUNCT
bionys-634	36	56	.	.	PUNCT
bionys-634	37	1	different	different	ADJ
bionys-634	37	2	technologies	technology	NOUN
bionys-634	37	3	are	be	AUX
bionys-634	37	4	used	use	VERB
bionys-634	37	5	for	for	ADP
bionys-634	37	6	the	the	DET
bionys-634	37	7	detection	detection	NOUN
bionys-634	37	8	of	of	ADP
bionys-634	37	9	gmos	gmos	PROPN
bionys-634	37	10	in	in	ADP
bionys-634	37	11	food	food	NOUN
bionys-634	37	12	samples	sample	NOUN
bionys-634	37	13	,	,	PUNCT
bionys-634	37	14	such	such	ADJ
bionys-634	37	15	as	as	ADP
bionys-634	37	16	protein	protein	NOUN
bionys-634	37	17	-	-	PUNCT
bionys-634	37	18	based	base	VERB
bionys-634	37	19	and	and	CCONJ
bionys-634	37	20	dnabased	dnabase	VERB
bionys-634	37	21	methods	method	NOUN
bionys-634	37	22	(	(	PUNCT
bionys-634	37	23	fraiture	fraiture	NOUN
bionys-634	37	24	et	et	PROPN
bionys-634	37	25	al	al	PROPN
bionys-634	37	26	.	.	PROPN
bionys-634	37	27	,	,	PUNCT
bionys-634	37	28	2015	2015	NUM
bionys-634	37	29	;	;	PUNCT
bionys-634	37	30	griffiths	griffiths	PROPN
bionys-634	37	31	et	et	PROPN
bionys-634	37	32	al	al	PROPN
bionys-634	37	33	.	.	PROPN
bionys-634	37	34	,	,	PUNCT
bionys-634	37	35	2002	2002	NUM
bionys-634	37	36	;	;	PUNCT
bionys-634	37	37	rott	rott	PROPN
bionys-634	37	38	et	et	PROPN
bionys-634	37	39	al	al	PROPN
bionys-634	37	40	.	.	PROPN
bionys-634	37	41	,	,	PUNCT
bionys-634	37	42	2004	2004	NUM
bionys-634	37	43	)	)	PUNCT
bionys-634	37	44	.	.	PUNCT
bionys-634	38	1	pcr	pcr	NOUN
bionys-634	38	2	-	-	PUNCT
bionys-634	38	3	based	base	VERB
bionys-634	38	4	methods	method	NOUN
bionys-634	38	5	such	such	ADJ
bionys-634	38	6	as	as	ADP
bionys-634	38	7	conventional	conventional	ADJ
bionys-634	38	8	pcr	pcr	NOUN
bionys-634	38	9	,	,	PUNCT
bionys-634	38	10	multiplex	multiplex	PROPN
bionys-634	38	11	pcr	pcr	PROPN
bionys-634	38	12	,	,	PUNCT
bionys-634	38	13	and	and	CCONJ
bionys-634	38	14	rt	rt	ADJ
bionys-634	38	15	-	-	PUNCT
bionys-634	38	16	pcr	pcr	ADJ
bionys-634	38	17	methods	method	NOUN
bionys-634	38	18	have	have	AUX
bionys-634	38	19	become	become	VERB
bionys-634	38	20	the	the	DET
bionys-634	38	21	primarily	primarily	ADV
bionys-634	38	22	used	use	VERB
bionys-634	38	23	approaches	approach	NOUN
bionys-634	38	24	for	for	ADP
bionys-634	38	25	gmo	gmo	PROPN
bionys-634	38	26	detection	detection	NOUN
bionys-634	38	27	,	,	PUNCT
bionys-634	38	28	which	which	PRON
bionys-634	38	29	can	can	AUX
bionys-634	38	30	detect	detect	VERB
bionys-634	38	31	even	even	ADV
bionys-634	38	32	small	small	ADJ
bionys-634	38	33	amounts	amount	NOUN
bionys-634	38	34	of	of	ADP
bionys-634	38	35	the	the	DET
bionys-634	38	36	novel	novel	ADJ
bionys-634	38	37	dna	dna	NOUN
bionys-634	38	38	in	in	ADP
bionys-634	38	39	both	both	CCONJ
bionys-634	38	40	raw	raw	ADJ
bionys-634	38	41	and	and	CCONJ
bionys-634	38	42	processed	process	VERB
bionys-634	38	43	foods	food	NOUN
bionys-634	38	44	,	,	PUNCT
bionys-634	38	45	most	most	ADV
bionys-634	38	46	widely	widely	ADV
bionys-634	38	47	used	use	VERB
bionys-634	38	48	,	,	PUNCT
bionys-634	38	49	because	because	SCONJ
bionys-634	38	50	of	of	ADP
bionys-634	38	51	its	its	PRON
bionys-634	38	52	sensitivity	sensitivity	NOUN
bionys-634	38	53	,	,	PUNCT
bionys-634	38	54	specificity	specificity	NOUN
bionys-634	38	55	,	,	PUNCT
bionys-634	38	56	versatility	versatility	NOUN
bionys-634	38	57	,	,	PUNCT
bionys-634	38	58	and	and	CCONJ
bionys-634	38	59	high	high	ADJ
bionys-634	38	60	throughput	throughput	NOUN
bionys-634	38	61	application	application	NOUN
bionys-634	38	62	(	(	PUNCT
bionys-634	38	63	li	li	PROPN
bionys-634	38	64	et	et	PROPN
bionys-634	38	65	al	al	PROPN
bionys-634	38	66	.	.	PROPN
bionys-634	38	67	,	,	PUNCT
bionys-634	38	68	2022	2022	NUM
bionys-634	38	69	;	;	PUNCT
bionys-634	38	70	zhang	zhang	PROPN
bionys-634	38	71	et	et	PROPN
bionys-634	38	72	al	al	PROPN
bionys-634	38	73	.	.	PROPN
bionys-634	38	74	,	,	PUNCT
bionys-634	38	75	2013	2013	NUM
bionys-634	38	76	)	)	PUNCT
bionys-634	38	77	.	.	PUNCT
bionys-634	39	1	on	on	ADP
bionys-634	39	2	the	the	DET
bionys-634	39	3	other	other	ADJ
bionys-634	39	4	hand	hand	NOUN
bionys-634	39	5	,	,	PUNCT
bionys-634	39	6	food	food	NOUN
bionys-634	39	7	processing	processing	NOUN
bionys-634	39	8	can	can	AUX
bionys-634	39	9	affect	affect	VERB
bionys-634	39	10	the	the	DET
bionys-634	39	11	quality	quality	NOUN
bionys-634	39	12	and	and	CCONJ
bionys-634	39	13	quantity	quantity	NOUN
bionys-634	39	14	of	of	ADP
bionys-634	39	15	dna	dna	PROPN
bionys-634	39	16	,	,	PUNCT
bionys-634	39	17	leading	lead	VERB
bionys-634	39	18	to	to	ADP
bionys-634	39	19	its	its	PRON
bionys-634	39	20	removal	removal	NOUN
bionys-634	39	21	or	or	CCONJ
bionys-634	39	22	degradation	degradation	NOUN
bionys-634	39	23	.	.	PUNCT
bionys-634	40	1	moreover	moreover	ADV
bionys-634	40	2	,	,	PUNCT
bionys-634	40	3	for	for	ADP
bionys-634	40	4	the	the	DET
bionys-634	40	5	successful	successful	ADJ
bionys-634	40	6	dna	dna	NOUN
bionys-634	40	7	amplification	amplification	NOUN
bionys-634	40	8	step	step	NOUN
bionys-634	40	9	,	,	PUNCT
bionys-634	40	10	one	one	PRON
bionys-634	40	11	must	must	AUX
bionys-634	40	12	have	have	VERB
bionys-634	40	13	an	an	DET
bionys-634	40	14	efficient	efficient	ADJ
bionys-634	40	15	dna	dna	NOUN
bionys-634	40	16	extraction	extraction	NOUN
bionys-634	40	17	step	step	NOUN
bionys-634	40	18	,	,	PUNCT
bionys-634	40	19	because	because	SCONJ
bionys-634	40	20	there	there	PRON
bionys-634	40	21	are	be	VERB
bionys-634	40	22	different	different	ADJ
bionys-634	40	23	compounds	compound	NOUN
bionys-634	40	24	that	that	PRON
bionys-634	40	25	inhibit	inhibit	VERB
bionys-634	40	26	amplification	amplification	NOUN
bionys-634	40	27	of	of	ADP
bionys-634	40	28	dna	dna	PROPN
bionys-634	40	29	,	,	PUNCT
bionys-634	40	30	such	such	ADJ
bionys-634	40	31	as	as	ADP
bionys-634	40	32	lipids	lipid	NOUN
bionys-634	40	33	,	,	PUNCT
bionys-634	40	34	polysaccharides	polysaccharide	NOUN
bionys-634	40	35	,	,	PUNCT
bionys-634	40	36	and	and	CCONJ
bionys-634	40	37	polyphenols	polyphenol	NOUN
bionys-634	40	38	,	,	PUNCT
bionys-634	40	39	or	or	CCONJ
bionys-634	40	40	extraction	extraction	NOUN
bionys-634	40	41	chemicals	chemical	NOUN
bionys-634	40	42	such	such	ADJ
bionys-634	40	43	as	as	ADP
bionys-634	40	44	phenol	phenol	NOUN
bionys-634	40	45	,	,	PUNCT
bionys-634	40	46	ctab	ctab	NOUN
bionys-634	40	47	,	,	PUNCT
bionys-634	40	48	and	and	CCONJ
bionys-634	40	49	isopropanol	isopropanol	NOUN
bionys-634	40	50	(	(	PUNCT
bionys-634	40	51	anklam	anklam	NOUN
bionys-634	40	52	et	et	PROPN
bionys-634	40	53	al	al	PROPN
bionys-634	40	54	.	.	PROPN
bionys-634	40	55	,	,	PUNCT
bionys-634	40	56	2002	2002	NUM
bionys-634	40	57	;	;	PUNCT
bionys-634	40	58	hübner	hübner	NOUN
bionys-634	40	59	et	et	PROPN
bionys-634	40	60	al	al	PROPN
bionys-634	40	61	.	.	PROPN
bionys-634	40	62	,	,	PUNCT
bionys-634	40	63	1999	1999	NUM
bionys-634	40	64	;	;	PUNCT
bionys-634	40	65	saghai	saghai	PROPN
bionys-634	40	66	-	-	PUNCT
bionys-634	40	67	maroof	maroof	PROPN
bionys-634	40	68	et	et	PROPN
bionys-634	40	69	al	al	PROPN
bionys-634	40	70	.	.	PROPN
bionys-634	40	71	,	,	PUNCT
bionys-634	40	72	1984	1984	NUM
bionys-634	40	73	)	)	PUNCT
bionys-634	40	74	.	.	PUNCT
bionys-634	41	1	therefore	therefore	ADV
bionys-634	41	2	,	,	PUNCT
bionys-634	41	3	in	in	ADP
bionys-634	41	4	order	order	NOUN
bionys-634	41	5	to	to	PART
bionys-634	41	6	be	be	AUX
bionys-634	41	7	able	able	ADJ
bionys-634	41	8	to	to	PART
bionys-634	41	9	amplify	amplify	VERB
bionys-634	41	10	dna	dna	PROPN
bionys-634	41	11	,	,	PUNCT
bionys-634	41	12	it	it	PRON
bionys-634	41	13	is	be	AUX
bionys-634	41	14	necessary	necessary	ADJ
bionys-634	41	15	to	to	PART
bionys-634	41	16	use	use	VERB
bionys-634	41	17	an	an	DET
bionys-634	41	18	extraction	extraction	NOUN
bionys-634	41	19	method	method	NOUN
bionys-634	41	20	that	that	PRON
bionys-634	41	21	provides	provide	VERB
bionys-634	41	22	dna	dna	NOUN
bionys-634	41	23	with	with	ADP
bionys-634	41	24	an	an	DET
bionys-634	41	25	acceptable	acceptable	ADJ
bionys-634	41	26	quantity	quantity	NOUN
bionys-634	41	27	,	,	PUNCT
bionys-634	41	28	quality	quality	NOUN
bionys-634	41	29	,	,	PUNCT
bionys-634	41	30	and	and	CCONJ
bionys-634	41	31	purity	purity	NOUN
bionys-634	41	32	.	.	PUNCT
bionys-634	42	1	this	this	DET
bionys-634	42	2	step	step	NOUN
bionys-634	42	3	is	be	AUX
bionys-634	42	4	often	often	ADV
bionys-634	42	5	very	very	ADV
bionys-634	42	6	time	time	NOUN
bionys-634	42	7	-	-	PUNCT
bionys-634	42	8	consuming	consume	VERB
bionys-634	42	9	.	.	PUNCT
bionys-634	43	1	to	to	PART
bionys-634	43	2	identify	identify	VERB
bionys-634	43	3	transgenic	transgenic	NOUN
bionys-634	43	4	organisms	organism	NOUN
bionys-634	43	5	,	,	PUNCT
bionys-634	43	6	an	an	DET
bionys-634	43	7	endogenous	endogenous	ADJ
bionys-634	43	8	reference	reference	NOUN
bionys-634	43	9	gene	gene	NOUN
bionys-634	43	10	is	be	AUX
bionys-634	43	11	needed	need	VERB
bionys-634	43	12	as	as	ADP
bionys-634	43	13	a	a	DET
bionys-634	43	14	standard	standard	NOUN
bionys-634	43	15	to	to	PART
bionys-634	43	16	confirm	confirm	VERB
bionys-634	43	17	species	species	NOUN
bionys-634	43	18	identification	identification	NOUN
bionys-634	43	19	and	and	CCONJ
bionys-634	43	20	determine	determine	VERB
bionys-634	43	21	the	the	DET
bionys-634	43	22	quality	quality	NOUN
bionys-634	43	23	of	of	ADP
bionys-634	43	24	genomic	genomic	ADJ
bionys-634	43	25	dna	dna	NOUN
bionys-634	43	26	.	.	PUNCT
bionys-634	44	1	various	various	ADJ
bionys-634	44	2	studies	study	NOUN
bionys-634	44	3	have	have	AUX
bionys-634	44	4	been	be	AUX
bionys-634	44	5	conducted	conduct	VERB
bionys-634	44	6	to	to	PART
bionys-634	44	7	confirm	confirm	VERB
bionys-634	44	8	internal	internal	ADJ
bionys-634	44	9	control	control	NOUN
bionys-634	44	10	genes	gene	NOUN
bionys-634	44	11	for	for	ADP
bionys-634	44	12	different	different	ADJ
bionys-634	44	13	plants	plant	NOUN
bionys-634	44	14	.	.	PUNCT
bionys-634	45	1	for	for	ADP
bionys-634	45	2	example	example	NOUN
bionys-634	45	3	,	,	PUNCT
bionys-634	45	4	the	the	DET
bionys-634	45	5	zein	zein	NOUN
bionys-634	45	6	,	,	PUNCT
bionys-634	45	7	zssiib	zssiib	NOUN
bionys-634	45	8	,	,	PUNCT
bionys-634	45	9	and	and	CCONJ
bionys-634	45	10	invertase	invertase	NOUN
bionys-634	45	11	genes	gene	NOUN
bionys-634	45	12	in	in	ADP
bionys-634	45	13	corn	corn	NOUN
bionys-634	45	14	(	(	PUNCT
bionys-634	45	15	germini	germini	PROPN
bionys-634	45	16	et	et	PROPN
bionys-634	45	17	al	al	PROPN
bionys-634	45	18	.	.	PROPN
bionys-634	45	19	,	,	PUNCT
bionys-634	45	20	2004	2004	NUM
bionys-634	45	21	;	;	PUNCT
bionys-634	45	22	hernández	hernández	PROPN
bionys-634	45	23	et	et	PROPN
bionys-634	45	24	al	al	PROPN
bionys-634	45	25	.	.	PROPN
bionys-634	45	26	,	,	PUNCT
bionys-634	45	27	2004	2004	NUM
bionys-634	45	28	;	;	PUNCT
bionys-634	45	29	pan	pan	PROPN
bionys-634	45	30	et	et	PROPN
bionys-634	45	31	al	al	PROPN
bionys-634	45	32	.	.	PROPN
bionys-634	45	33	,	,	PUNCT
bionys-634	45	34	2006	2006	NUM
bionys-634	45	35	)	)	PUNCT
bionys-634	45	36	,	,	PUNCT
bionys-634	45	37	lectin	lectin	NOUN
bionys-634	45	38	in	in	ADP
bionys-634	45	39	soybean	soybean	PROPN
bionys-634	45	40	(	(	PUNCT
bionys-634	45	41	terry	terry	PROPN
bionys-634	45	42	et	et	PROPN
bionys-634	45	43	al	al	PROPN
bionys-634	45	44	.	.	PROPN
bionys-634	45	45	,	,	PUNCT
bionys-634	45	46	2001	2001	NUM
bionys-634	45	47	)	)	PUNCT
bionys-634	45	48	,	,	PUNCT
bionys-634	45	49	sps	sps	PROPN
bionys-634	45	50	,	,	PUNCT
bionys-634	45	51	oryzain	oryzain	VERB
bionys-634	45	52	beta	beta	NOUN
bionys-634	45	53	,	,	PUNCT
bionys-634	45	54	and	and	CCONJ
bionys-634	45	55	ppi	ppi	PROPN
bionys-634	45	56	-	-	PUNCT
bionys-634	45	57	ppf	ppf	NOUN
bionys-634	45	58	in	in	ADP
bionys-634	45	59	rice	rice	NOUN
bionys-634	45	60	(	(	PUNCT
bionys-634	45	61	chaouachi	chaouachi	PROPN
bionys-634	45	62	et	et	PROPN
bionys-634	45	63	al	al	PROPN
bionys-634	45	64	.	.	PROPN
bionys-634	45	65	,	,	PUNCT
bionys-634	45	66	2007	2007	NUM
bionys-634	45	67	;	;	PUNCT
bionys-634	45	68	hernández	hernández	PROPN
bionys-634	45	69	et	et	PROPN
bionys-634	45	70	al	al	PROPN
bionys-634	45	71	.	.	PROPN
bionys-634	45	72	,	,	PUNCT
bionys-634	45	73	2005	2005	NUM
bionys-634	45	74	)	)	PUNCT
bionys-634	45	75	,	,	PUNCT
bionys-634	45	76	and	and	CCONJ
bionys-634	45	77	β	β	X
bionys-634	45	78	-	-	NOUN
bionys-634	45	79	fructosidase	fructosidase	NOUN
bionys-634	45	80	in	in	ADP
bionys-634	45	81	the	the	DET
bionys-634	45	82	solanaceae	solanaceae	ADJ
bionys-634	45	83	family	family	NOUN
bionys-634	45	84	(	(	PUNCT
bionys-634	45	85	chaouachi	chaouachi	PROPN
bionys-634	45	86	et	et	PROPN
bionys-634	45	87	al	al	PROPN
bionys-634	45	88	.	.	PROPN
bionys-634	45	89	,	,	PUNCT
bionys-634	45	90	2008	2008	NUM
bionys-634	45	91	)	)	PUNCT
bionys-634	45	92	.	.	PUNCT
bionys-634	46	1	the	the	DET
bionys-634	46	2	elements	element	NOUN
bionys-634	46	3	such	such	ADJ
bionys-634	46	4	as	as	ADP
bionys-634	46	5	the	the	DET
bionys-634	46	6	camv35s	camv35s	ADJ
bionys-634	46	7	promoter	promoter	NOUN
bionys-634	46	8	(	(	PUNCT
bionys-634	46	9	camv	camv	NOUN
bionys-634	46	10	)	)	PUNCT
bionys-634	46	11	,	,	PUNCT
bionys-634	46	12	nopaline	nopaline	NOUN
bionys-634	46	13	synthase	synthase	NOUN
bionys-634	46	14	(	(	PUNCT
bionys-634	46	15	nos	nos	NOUN
bionys-634	46	16	)	)	PUNCT
bionys-634	46	17	terminator	terminator	NOUN
bionys-634	46	18	,	,	PUNCT
bionys-634	46	19	and	and	CCONJ
bionys-634	46	20	selectable	selectable	ADJ
bionys-634	46	21	markers	marker	NOUN
bionys-634	46	22	including	include	VERB
bionys-634	46	23	the	the	DET
bionys-634	46	24	pat	pat	PROPN
bionys-634	46	25	/	/	SYM
bionys-634	46	26	bar	bar	NOUN
bionys-634	46	27	gene	gene	NOUN
bionys-634	46	28	,	,	PUNCT
bionys-634	46	29	hpt	hpt	NOUN
bionys-634	46	30	gene	gene	NOUN
bionys-634	46	31	,	,	PUNCT
bionys-634	46	32	and	and	CCONJ
bionys-634	46	33	the	the	DET
bionys-634	46	34	nptii	nptii	NOUN
bionys-634	46	35	gene	gene	NOUN
bionys-634	46	36	are	be	AUX
bionys-634	46	37	commonly	commonly	ADV
bionys-634	46	38	derived	derive	VERB
bionys-634	46	39	from	from	ADP
bionys-634	46	40	naturally	naturally	ADV
bionys-634	46	41	occurring	occur	VERB
bionys-634	46	42	viruses	virus	NOUN
bionys-634	46	43	,	,	PUNCT
bionys-634	46	44	bacteria	bacteria	NOUN
bionys-634	46	45	,	,	PUNCT
bionys-634	46	46	and	and	CCONJ
bionys-634	46	47	fungi	fungus	NOUN
bionys-634	46	48	found	find	VERB
bionys-634	46	49	in	in	ADP
bionys-634	46	50	many	many	ADJ
bionys-634	46	51	gmos	gmos	PROPN
bionys-634	46	52	(	(	PUNCT
bionys-634	46	53	li	li	PROPN
bionys-634	46	54	et	et	PROPN
bionys-634	46	55	al	al	PROPN
bionys-634	46	56	.	.	PROPN
bionys-634	46	57	,	,	PUNCT
bionys-634	46	58	2022	2022	NUM
bionys-634	46	59	)	)	PUNCT
bionys-634	46	60	.	.	PUNCT
bionys-634	47	1	these	these	DET
bionys-634	47	2	elements	element	NOUN
bionys-634	47	3	are	be	AUX
bionys-634	47	4	usually	usually	ADV
bionys-634	47	5	used	use	VERB
bionys-634	47	6	for	for	ADP
bionys-634	47	7	detection	detection	NOUN
bionys-634	47	8	targets	target	NOUN
bionys-634	47	9	in	in	ADP
bionys-634	47	10	gmo	gmo	PROPN
bionys-634	47	11	screening	screening	NOUN
bionys-634	47	12	.	.	PUNCT
bionys-634	48	1	this	this	DET
bionys-634	48	2	screening	screening	NOUN
bionys-634	48	3	is	be	AUX
bionys-634	48	4	a	a	DET
bionys-634	48	5	rapid	rapid	ADJ
bionys-634	48	6	and	and	CCONJ
bionys-634	48	7	cost	cost	NOUN
bionys-634	48	8	-	-	PUNCT
bionys-634	48	9	efficient	efficient	ADJ
bionys-634	48	10	method	method	NOUN
bionys-634	48	11	for	for	ADP
bionys-634	48	12	the	the	DET
bionys-634	48	13	detection	detection	NOUN
bionys-634	48	14	of	of	ADP
bionys-634	48	15	samples	sample	NOUN
bionys-634	48	16	potentially	potentially	ADV
bionys-634	48	17	containing	contain	VERB
bionys-634	48	18	one	one	NUM
bionys-634	48	19	or	or	CCONJ
bionys-634	48	20	several	several	ADJ
bionys-634	48	21	gmos	gmos	PROPN
bionys-634	48	22	.	.	PUNCT
bionys-634	49	1	in	in	ADP
bionys-634	49	2	this	this	DET
bionys-634	49	3	study	study	NOUN
bionys-634	49	4	,	,	PUNCT
bionys-634	49	5	three	three	NUM
bionys-634	49	6	dna	dna	NOUN
bionys-634	49	7	extraction	extraction	NOUN
bionys-634	49	8	methods	method	NOUN
bionys-634	49	9	were	be	AUX
bionys-634	49	10	employed	employ	VERB
bionys-634	49	11	for	for	ADP
bionys-634	49	12	isolating	isolate	VERB
bionys-634	49	13	dna	dna	NOUN
bionys-634	49	14	from	from	ADP
bionys-634	49	15	maize	maize	NOUN
bionys-634	49	16	samples	sample	NOUN
bionys-634	49	17	,	,	PUNCT
bionys-634	49	18	and	and	CCONJ
bionys-634	49	19	a	a	DET
bionys-634	49	20	pcr	pcr	ADJ
bionys-634	49	21	method	method	NOUN
bionys-634	49	22	was	be	AUX
bionys-634	49	23	used	use	VERB
bionys-634	49	24	to	to	PART
bionys-634	49	25	detect	detect	VERB
bionys-634	49	26	gm	gm	PROPN
bionys-634	49	27	maize	maize	NOUN
bionys-634	49	28	in	in	ADP
bionys-634	49	29	various	various	ADJ
bionys-634	49	30	processed	process	VERB
bionys-634	49	31	foods	food	NOUN
bionys-634	49	32	collected	collect	VERB
bionys-634	49	33	from	from	ADP
bionys-634	49	34	the	the	DET
bionys-634	49	35	shiraz	shiraz	NOUN
bionys-634	49	36	market	market	NOUN
bionys-634	49	37	.	.	PUNCT
bionys-634	50	1	materials	material	NOUN
bionys-634	50	2	and	and	CCONJ
bionys-634	50	3	methods	method	NOUN
bionys-634	50	4	samples	sample	VERB
bionys-634	50	5	collection	collection	NOUN
bionys-634	50	6	thirty	thirty	NUM
bionys-634	50	7	samples	sample	NOUN
bionys-634	50	8	,	,	PUNCT
bionys-634	50	9	including	include	VERB
bionys-634	50	10	raw	raw	ADJ
bionys-634	50	11	corn	corn	NOUN
bionys-634	50	12	and	and	CCONJ
bionys-634	50	13	its	its	PRON
bionys-634	50	14	products	product	NOUN
bionys-634	50	15	(	(	PUNCT
bionys-634	50	16	corn	corn	NOUN
bionys-634	50	17	puff	puff	NOUN
bionys-634	50	18	,	,	PUNCT
bionys-634	50	19	corn	corn	NOUN
bionys-634	50	20	nut	nut	NOUN
bionys-634	50	21	,	,	PUNCT
bionys-634	50	22	canned	can	VERB
bionys-634	50	23	corn	corn	NOUN
bionys-634	50	24	,	,	PUNCT
bionys-634	50	25	corn	corn	NOUN
bionys-634	50	26	starch	starch	NOUN
bionys-634	50	27	,	,	PUNCT
bionys-634	50	28	corn	corn	NOUN
bionys-634	50	29	flour	flour	NOUN
bionys-634	50	30	,	,	PUNCT
bionys-634	50	31	and	and	CCONJ
bionys-634	50	32	popcorn	popcorn	NOUN
bionys-634	50	33	)	)	PUNCT
bionys-634	50	34	,	,	PUNCT
bionys-634	50	35	were	be	AUX
bionys-634	50	36	bought	buy	VERB
bionys-634	50	37	from	from	ADP
bionys-634	50	38	supermarkets	supermarket	NOUN
bionys-634	50	39	in	in	ADP
bionys-634	50	40	shiraz	shiraz	PROPN
bionys-634	50	41	.	.	PUNCT
bionys-634	51	1	tab	tab	PROPN
bionys-634	51	2	.	.	PUNCT
bionys-634	51	3	1	1	NUM
bionys-634	51	4	provides	provide	VERB
bionys-634	51	5	an	an	DET
bionys-634	51	6	overview	overview	NOUN
bionys-634	51	7	of	of	ADP
bionys-634	51	8	the	the	DET
bionys-634	51	9	corn	corn	NOUN
bionys-634	51	10	samples	sample	NOUN
bionys-634	51	11	collected	collect	VERB
bionys-634	51	12	from	from	ADP
bionys-634	51	13	supermarkets	supermarket	NOUN
bionys-634	51	14	in	in	ADP
bionys-634	51	15	shiraz	shiraz	PROPN
bionys-634	51	16	.	.	PUNCT
bionys-634	52	1	the	the	DET
bionys-634	52	2	table	table	NOUN
bionys-634	52	3	lists	list	VERB
bionys-634	52	4	each	each	DET
bionys-634	52	5	sample	sample	NOUN
bionys-634	52	6	’s	’s	PART
bionys-634	52	7	identification	identification	NOUN
bionys-634	52	8	number	number	NOUN
bionys-634	52	9	,	,	PUNCT
bionys-634	52	10	product	product	NOUN
bionys-634	52	11	name	name	NOUN
bionys-634	52	12	,	,	PUNCT
bionys-634	52	13	and	and	CCONJ
bionys-634	52	14	product	product	NOUN
bionys-634	52	15	type	type	NOUN
bionys-634	52	16	,	,	PUNCT
bionys-634	52	17	offering	offer	VERB
bionys-634	52	18	a	a	DET
bionys-634	52	19	clear	clear	ADJ
bionys-634	52	20	classification	classification	NOUN
bionys-634	52	21	of	of	ADP
bionys-634	52	22	the	the	DET
bionys-634	52	23	various	various	ADJ
bionys-634	52	24	corn	corn	NOUN
bionys-634	52	25	-	-	PUNCT
bionys-634	52	26	based	base	VERB
bionys-634	52	27	foods	food	NOUN
bionys-634	52	28	analyzed	analyze	VERB
bionys-634	52	29	in	in	ADP
bionys-634	52	30	this	this	DET
bionys-634	52	31	study	study	NOUN
bionys-634	52	32	.	.	PUNCT
bionys-634	53	1	dna	dna	PROPN
bionys-634	53	2	extraction	extraction	NOUN
bionys-634	53	3	three	three	NUM
bionys-634	53	4	different	different	ADJ
bionys-634	53	5	ctab	ctab	NOUN
bionys-634	53	6	-	-	PUNCT
bionys-634	53	7	based	base	VERB
bionys-634	53	8	(	(	PUNCT
bionys-634	53	9	cetyltrimethyl	cetyltrimethyl	NOUN
bionys-634	53	10	ammonium	ammonium	NOUN
bionys-634	53	11	bromide	bromide	NOUN
bionys-634	53	12	)	)	PUNCT
bionys-634	53	13	methods	method	NOUN
bionys-634	53	14	were	be	AUX
bionys-634	53	15	used	use	VERB
bionys-634	53	16	for	for	ADP
bionys-634	53	17	dna	dna	PROPN
bionys-634	53	18	extraction	extraction	NOUN
bionys-634	53	19	from	from	ADP
bionys-634	53	20	the	the	DET
bionys-634	53	21	samples	sample	NOUN
bionys-634	53	22	.	.	PUNCT
bionys-634	54	1	the	the	DET
bionys-634	54	2	first	first	ADJ
bionys-634	54	3	method	method	NOUN
bionys-634	54	4	,	,	PUNCT
bionys-634	54	5	referred	refer	VERB
bionys-634	54	6	to	to	ADP
bionys-634	54	7	as	as	ADP
bionys-634	54	8	“	"	PUNCT
bionys-634	54	9	method	method	NOUN
bionys-634	54	10	1	1	NUM
bionys-634	54	11	,	,	PUNCT
bionys-634	54	12	”	"	PUNCT
bionys-634	54	13	follows	follow	VERB
bionys-634	54	14	the	the	DET
bionys-634	54	15	standard	standard	ADJ
bionys-634	54	16	ctab	ctab	ADJ
bionys-634	54	17	precipitation	precipitation	NOUN
bionys-634	54	18	of	of	ADP
bionys-634	54	19	dna	dna	PROPN
bionys-634	54	20	protocol	protocol	NOUN
bionys-634	54	21	(	(	PUNCT
bionys-634	54	22	gryson	gryson	NOUN
bionys-634	54	23	et	et	NOUN
bionys-634	54	24	al	al	PROPN
bionys-634	54	25	.	.	PROPN
bionys-634	54	26	,	,	PUNCT
bionys-634	54	27	2004	2004	NUM
bionys-634	54	28	)	)	PUNCT
bionys-634	54	29	and	and	CCONJ
bionys-634	54	30	was	be	AUX
bionys-634	54	31	applied	apply	VERB
bionys-634	54	32	to	to	ADP
bionys-634	54	33	raw	raw	ADJ
bionys-634	54	34	corn	corn	NOUN
bionys-634	54	35	,	,	PUNCT
bionys-634	54	36	corn	corn	NOUN
bionys-634	54	37	nut	nut	NOUN
bionys-634	54	38	,	,	PUNCT
bionys-634	54	39	and	and	CCONJ
bionys-634	54	40	corn	corn	NOUN
bionys-634	54	41	flour	flour	NOUN
bionys-634	54	42	.	.	PUNCT
bionys-634	55	1	the	the	DET
bionys-634	55	2	second	second	ADJ
bionys-634	55	3	method	method	NOUN
bionys-634	55	4	,	,	PUNCT
bionys-634	55	5	referred	refer	VERB
bionys-634	55	6	to	to	ADP
bionys-634	55	7	as	as	ADP
bionys-634	55	8	“	"	PUNCT
bionys-634	55	9	method	method	NOUN
bionys-634	55	10	2	2	NUM
bionys-634	55	11	,	,	PUNCT
bionys-634	55	12	”	"	PUNCT
bionys-634	55	13	uses	use	VERB
bionys-634	55	14	the	the	DET
bionys-634	55	15	ctab	ctab	ADJ
bionys-634	55	16	protocol	protocol	NOUN
bionys-634	55	17	with	with	ADP
bionys-634	55	18	ethanol	ethanol	NOUN
bionys-634	55	19	precipitation	precipitation	NOUN
bionys-634	55	20	of	of	ADP
bionys-634	55	21	dna	dna	PROPN
bionys-634	55	22	(	(	PUNCT
bionys-634	55	23	sisea	sisea	NOUN
bionys-634	55	24	&	&	CCONJ
bionys-634	55	25	pamfil	pamfil	PROPN
bionys-634	55	26	,	,	PUNCT
bionys-634	55	27	2007	2007	NUM
bionys-634	55	28	)	)	PUNCT
bionys-634	55	29	and	and	CCONJ
bionys-634	55	30	was	be	AUX
bionys-634	55	31	applied	apply	VERB
bionys-634	55	32	to	to	ADP
bionys-634	55	33	canned	can	VERB
bionys-634	55	34	corn	corn	NOUN
bionys-634	55	35	,	,	PUNCT
bionys-634	55	36	corn	corn	NOUN
bionys-634	55	37	puff	puff	NOUN
bionys-634	55	38	,	,	PUNCT
bionys-634	55	39	and	and	CCONJ
bionys-634	55	40	popcorn	popcorn	NOUN
bionys-634	55	41	.	.	PUNCT
bionys-634	56	1	the	the	DET
bionys-634	56	2	third	third	ADJ
bionys-634	56	3	method	method	NOUN
bionys-634	56	4	,	,	PUNCT
bionys-634	56	5	referred	refer	VERB
bionys-634	56	6	to	to	ADP
bionys-634	56	7	as	as	ADP
bionys-634	56	8	“	"	PUNCT
bionys-634	56	9	method	method	NOUN
bionys-634	56	10	3	3	NUM
bionys-634	56	11	,	,	PUNCT
bionys-634	56	12	”	"	PUNCT
bionys-634	56	13	follows	follow	VERB
bionys-634	56	14	another	another	DET
bionys-634	56	15	ctab	ctab	NOUN
bionys-634	56	16	protocol	protocol	NOUN
bionys-634	56	17	(	(	PUNCT
bionys-634	56	18	waiblinger	waiblinger	NOUN
bionys-634	56	19	et	et	PROPN
bionys-634	56	20	al	al	PROPN
bionys-634	56	21	.	.	PROPN
bionys-634	56	22	,	,	PUNCT
bionys-634	56	23	2012	2012	NUM
bionys-634	56	24	)	)	PUNCT
bionys-634	56	25	and	and	CCONJ
bionys-634	56	26	was	be	AUX
bionys-634	56	27	used	use	VERB
bionys-634	56	28	for	for	ADP
bionys-634	56	29	corn	corn	NOUN
bionys-634	56	30	starch	starch	NOUN
bionys-634	56	31	.	.	PUNCT
bionys-634	57	1	method	method	NOUN
bionys-634	57	2	1	1	NUM
bionys-634	57	3	:	:	PUNCT
bionys-634	58	1	the	the	DET
bionys-634	58	2	dna	dna	PROPN
bionys-634	58	3	samples	sample	NOUN
bionys-634	58	4	were	be	AUX
bionys-634	58	5	extracted	extract	VERB
bionys-634	58	6	from	from	ADP
bionys-634	58	7	raw	raw	ADJ
bionys-634	58	8	corn	corn	NOUN
bionys-634	58	9	,	,	PUNCT
bionys-634	58	10	corn	corn	NOUN
bionys-634	58	11	nuts	nut	NOUN
bionys-634	58	12	,	,	PUNCT
bionys-634	58	13	and	and	CCONJ
bionys-634	58	14	corn	corn	NOUN
bionys-634	58	15	flour	flour	NOUN
bionys-634	58	16	using	use	VERB
bionys-634	58	17	the	the	DET
bionys-634	58	18	standard	standard	ADJ
bionys-634	58	19	ctab	ctab	NOUN
bionys-634	58	20	method	method	NOUN
bionys-634	58	21	.	.	PUNCT
bionys-634	59	1	following	follow	VERB
bionys-634	59	2	grinding	grind	VERB
bionys-634	59	3	samples	sample	NOUN
bionys-634	59	4	with	with	ADP
bionys-634	59	5	a	a	DET
bionys-634	59	6	mortar	mortar	NOUN
bionys-634	59	7	and	and	CCONJ
bionys-634	59	8	pestle	pestle	NOUN
bionys-634	59	9	,	,	PUNCT
bionys-634	59	10	the	the	DET
bionys-634	59	11	powder	powder	NOUN
bionys-634	59	12	was	be	AUX
bionys-634	59	13	mixed	mix	VERB
bionys-634	59	14	with	with	ADP
bionys-634	59	15	1000	1000	NUM
bionys-634	59	16	μl	μl	ADP
bionys-634	59	17	of	of	ADP
bionys-634	59	18	buffer	buffer	NOUN
bionys-634	59	19	(	(	PUNCT
bionys-634	59	20	containing	contain	VERB
bionys-634	59	21	100	100	NUM
bionys-634	59	22	mm	mm	PROPN
bionys-634	59	23	tris	tris	PROPN
bionys-634	59	24	-	-	PUNCT
bionys-634	59	25	hcl	hcl	NOUN
bionys-634	59	26	,	,	PUNCT
bionys-634	59	27	20	20	NUM
bionys-634	59	28	mm	mm	PROPN
bionys-634	59	29	na2edta	na2edta	PROPN
bionys-634	59	30	,	,	PUNCT
bionys-634	59	31	1.4	1.4	NUM
bionys-634	59	32	m	m	NOUN
bionys-634	59	33	nacl	nacl	NOUN
bionys-634	59	34	,	,	PUNCT
bionys-634	59	35	and	and	CCONJ
bionys-634	59	36	20	20	NUM
bionys-634	59	37	g	g	NOUN
bionys-634	59	38	/	/	SYM
bionys-634	59	39	l	l	NOUN
bionys-634	59	40	ctab	ctab	NOUN
bionys-634	59	41	,	,	PUNCT
bionys-634	59	42	ph	ph	NOUN
bionys-634	59	43	8.0	8.0	NUM
bionys-634	59	44	)	)	PUNCT
bionys-634	59	45	.	.	PUNCT
bionys-634	60	1	the	the	DET
bionys-634	60	2	sample	sample	NOUN
bionys-634	60	3	mixtures	mixture	NOUN
bionys-634	60	4	were	be	AUX
bionys-634	60	5	transferred	transfer	VERB
bionys-634	60	6	to	to	ADP
bionys-634	60	7	2	2	NUM
bionys-634	60	8	-	-	PUNCT
bionys-634	60	9	ml	ml	NOUN
bionys-634	60	10	tubes	tube	NOUN
bionys-634	60	11	and	and	CCONJ
bionys-634	60	12	were	be	AUX
bionys-634	60	13	incubated	incubate	VERB
bionys-634	60	14	at	at	ADP
bionys-634	60	15	65	65	NUM
bionys-634	60	16	°	°	NOUN
bionys-634	60	17	c	c	NOUN
bionys-634	60	18	for	for	ADP
bionys-634	60	19	90	90	NUM
bionys-634	60	20	minutes	minute	NOUN
bionys-634	60	21	in	in	ADP
bionys-634	60	22	a	a	DET
bionys-634	60	23	water	water	NOUN
bionys-634	60	24	bath	bath	NOUN
bionys-634	60	25	.	.	PUNCT
bionys-634	61	1	the	the	DET
bionys-634	61	2	mixtures	mixture	NOUN
bionys-634	61	3	were	be	AUX
bionys-634	61	4	gently	gently	ADV
bionys-634	61	5	rotated	rotate	VERB
bionys-634	61	6	every	every	DET
bionys-634	61	7	10	10	NUM
bionys-634	61	8	minutes	minute	NOUN
bionys-634	61	9	for	for	ADP
bionys-634	61	10	intermittent	intermittent	ADJ
bionys-634	61	11	mixing	mixing	NOUN
bionys-634	61	12	before	before	ADP
bionys-634	61	13	being	be	AUX
bionys-634	61	14	centrifuged	centrifuge	VERB
bionys-634	61	15	for	for	ADP
bionys-634	61	16	20	20	NUM
bionys-634	61	17	minutes	minute	NOUN
bionys-634	61	18	at	at	ADP
bionys-634	61	19	13,000	13,000	NUM
bionys-634	61	20	g.	g.	NOUN
bionys-634	61	21	the	the	DET
bionys-634	61	22	resulting	result	VERB
bionys-634	61	23	supernatant	supernatant	NOUN
bionys-634	61	24	was	be	AUX
bionys-634	61	25	transferred	transfer	VERB
bionys-634	61	26	to	to	ADP
bionys-634	61	27	a	a	DET
bionys-634	61	28	fresh	fresh	ADJ
bionys-634	61	29	2	2	NUM
bionys-634	61	30	-	-	PUNCT
bionys-634	61	31	ml	ml	NOUN
bionys-634	61	32	tube	tube	NOUN
bionys-634	61	33	,	,	PUNCT
bionys-634	61	34	followed	follow	VERB
bionys-634	61	35	by	by	ADP
bionys-634	61	36	the	the	DET
bionys-634	61	37	addition	addition	NOUN
bionys-634	61	38	of	of	ADP
bionys-634	61	39	500	500	NUM
bionys-634	61	40	µl	µl	NOUN
bionys-634	61	41	of	of	ADP
bionys-634	61	42	chloroform	chloroform	NOUN
bionys-634	61	43	(	(	PUNCT
bionys-634	61	44	merck	merck	PROPN
bionys-634	61	45	,	,	PUNCT
bionys-634	61	46	germany	germany	PROPN
bionys-634	61	47	)	)	PUNCT
bionys-634	61	48	and	and	CCONJ
bionys-634	61	49	vortexing	vortexe	VERB
bionys-634	61	50	for	for	ADP
bionys-634	61	51	30	30	NUM
bionys-634	61	52	seconds	second	NOUN
bionys-634	61	53	.	.	PUNCT
bionys-634	62	1	biologica	biologica	PROPN
bionys-634	62	2	nyssana	nyssana	PROPN
bionys-634	63	1	●	●	PUNCT
bionys-634	63	2	16	16	NUM
bionys-634	63	3	(	(	PUNCT
bionys-634	63	4	2	2	NUM
bionys-634	63	5	)	)	PUNCT
bionys-634	63	6	december	december	PROPN
bionys-634	63	7	2025	2025	NUM
bionys-634	63	8	:	:	PUNCT
bionys-634	63	9	ashrafi	ashrafi	PROPN
bionys-634	63	10	-	-	PUNCT
bionys-634	63	11	dehkordi	dehkordi	PROPN
bionys-634	63	12	et	et	PROPN
bionys-634	63	13	al	al	PROPN
bionys-634	63	14	.	.	PUNCT
bionys-634	64	1	●	●	PUNCT
bionys-634	64	2	pcr	pcr	NOUN
bionys-634	64	3	-	-	PUNCT
bionys-634	64	4	based	base	VERB
bionys-634	64	5	investigation	investigation	NOUN
bionys-634	64	6	on	on	ADP
bionys-634	64	7	transgenic	transgenic	NOUN
bionys-634	64	8	maize	maize	NOUN
bionys-634	64	9	status	status	NOUN
bionys-634	64	10	in	in	ADP
bionys-634	64	11	corn	corn	NOUN
bionys-634	64	12	processed	process	VERB
bionys-634	64	13	products	product	NOUN
bionys-634	64	14	biologica	biologica	PROPN
bionys-634	64	15	nyssana	nyssana	PROPN
bionys-634	65	1	●	●	PUNCT
bionys-634	65	2	16	16	NUM
bionys-634	65	3	(	(	PUNCT
bionys-634	65	4	2	2	NUM
bionys-634	65	5	)	)	PUNCT
bionys-634	65	6	december	december	PROPN
bionys-634	65	7	2025	2025	NUM
bionys-634	65	8	:	:	PUNCT
bionys-634	65	9	ashrafi	ashrafi	PROPN
bionys-634	65	10	-	-	PUNCT
bionys-634	65	11	dehkordi	dehkordi	PROPN
bionys-634	65	12	et	et	PROPN
bionys-634	65	13	al	al	PROPN
bionys-634	65	14	.	.	PUNCT
bionys-634	65	15	●	●	PUNCT
bionys-634	65	16	pcr	pcr	NOUN
bionys-634	65	17	-	-	PUNCT
bionys-634	65	18	based	base	VERB
bionys-634	65	19	investigation	investigation	NOUN
bionys-634	65	20	on	on	ADP
bionys-634	65	21	transgenic	transgenic	NOUN
bionys-634	65	22	maize	maize	NOUN
bionys-634	65	23	status	status	NOUN
bionys-634	65	24	in	in	ADP
bionys-634	65	25	corn	corn	NOUN
bionys-634	65	26	processed	process	VERB
bionys-634	65	27	products	product	NOUN
bionys-634	65	28	the	the	DET
bionys-634	65	29	tube	tube	NOUN
bionys-634	65	30	was	be	AUX
bionys-634	65	31	centrifuged	centrifuge	VERB
bionys-634	65	32	again	again	ADV
bionys-634	65	33	at	at	ADP
bionys-634	65	34	13,000	13,000	NUM
bionys-634	65	35	g	g	NOUN
bionys-634	65	36	for	for	ADP
bionys-634	65	37	another	another	DET
bionys-634	65	38	20	20	NUM
bionys-634	65	39	minutes	minute	NOUN
bionys-634	65	40	.	.	PUNCT
bionys-634	66	1	the	the	DET
bionys-634	66	2	upper	upper	ADJ
bionys-634	66	3	phase	phase	NOUN
bionys-634	66	4	was	be	AUX
bionys-634	66	5	transferred	transfer	VERB
bionys-634	66	6	to	to	ADP
bionys-634	66	7	a	a	DET
bionys-634	66	8	fresh	fresh	ADJ
bionys-634	66	9	tube	tube	NOUN
bionys-634	66	10	containing	contain	VERB
bionys-634	66	11	0.7	0.7	NUM
bionys-634	66	12	volumes	volume	NOUN
bionys-634	66	13	of	of	ADP
bionys-634	66	14	pre	pre	ADJ
bionys-634	66	15	-	-	ADJ
bionys-634	66	16	chilled	chilled	ADJ
bionys-634	66	17	isopropanol	isopropanol	NOUN
bionys-634	66	18	(	(	PUNCT
bionys-634	66	19	merck	merck	PROPN
bionys-634	66	20	,	,	PUNCT
bionys-634	66	21	germany	germany	PROPN
bionys-634	66	22	)	)	PUNCT
bionys-634	66	23	and	and	CCONJ
bionys-634	66	24	kept	keep	VERB
bionys-634	66	25	overnight	overnight	ADV
bionys-634	66	26	at	at	ADP
bionys-634	66	27	-20	-20	NUM
bionys-634	66	28	°	°	PROPN
bionys-634	66	29	c	c	NOUN
bionys-634	66	30	.	.	PUNCT
bionys-634	67	1	the	the	DET
bionys-634	67	2	mixture	mixture	NOUN
bionys-634	67	3	was	be	AUX
bionys-634	67	4	centrifuged	centrifuge	VERB
bionys-634	67	5	at	at	ADP
bionys-634	67	6	13,000	13,000	NUM
bionys-634	67	7	g	g	NOUN
bionys-634	67	8	for	for	ADP
bionys-634	67	9	10	10	NUM
bionys-634	67	10	minutes	minute	NOUN
bionys-634	67	11	.	.	PUNCT
bionys-634	68	1	the	the	DET
bionys-634	68	2	supernatant	supernatant	NOUN
bionys-634	68	3	was	be	AUX
bionys-634	68	4	discarded	discard	VERB
bionys-634	68	5	,	,	PUNCT
bionys-634	68	6	and	and	CCONJ
bionys-634	68	7	the	the	DET
bionys-634	68	8	pellet	pellet	NOUN
bionys-634	68	9	was	be	AUX
bionys-634	68	10	washed	wash	VERB
bionys-634	68	11	with	with	ADP
bionys-634	68	12	500	500	NUM
bionys-634	68	13	μl	μl	ADP
bionys-634	68	14	of	of	ADP
bionys-634	68	15	70	70	NUM
bionys-634	68	16	%	%	NOUN
bionys-634	68	17	ethanol	ethanol	NOUN
bionys-634	68	18	(	(	PUNCT
bionys-634	68	19	merck	merck	PROPN
bionys-634	68	20	,	,	PUNCT
bionys-634	68	21	germany	germany	PROPN
bionys-634	68	22	)	)	PUNCT
bionys-634	68	23	.	.	PUNCT
bionys-634	69	1	after	after	ADP
bionys-634	69	2	that	that	PRON
bionys-634	69	3	,	,	PUNCT
bionys-634	69	4	the	the	DET
bionys-634	69	5	pellet	pellet	NOUN
bionys-634	69	6	was	be	AUX
bionys-634	69	7	subjected	subject	VERB
bionys-634	69	8	to	to	ADP
bionys-634	69	9	centrifugation	centrifugation	NOUN
bionys-634	69	10	for	for	ADP
bionys-634	69	11	10	10	NUM
bionys-634	69	12	minutes	minute	NOUN
bionys-634	69	13	at	at	ADP
bionys-634	69	14	13,000	13,000	NUM
bionys-634	69	15	g.	g.	NOUN
bionys-634	69	16	after	after	ADP
bionys-634	69	17	the	the	DET
bionys-634	69	18	removal	removal	NOUN
bionys-634	69	19	of	of	ADP
bionys-634	69	20	the	the	DET
bionys-634	69	21	supernatant	supernatant	NOUN
bionys-634	69	22	,	,	PUNCT
bionys-634	69	23	the	the	DET
bionys-634	69	24	pellet	pellet	NOUN
bionys-634	69	25	was	be	AUX
bionys-634	69	26	air	air	NOUN
bionys-634	69	27	-	-	PUNCT
bionys-634	69	28	dried	dry	VERB
bionys-634	69	29	.	.	PUNCT
bionys-634	70	1	subsequently	subsequently	ADV
bionys-634	70	2	,	,	PUNCT
bionys-634	70	3	the	the	DET
bionys-634	70	4	dna	dna	NOUN
bionys-634	70	5	was	be	AUX
bionys-634	70	6	dissolved	dissolve	VERB
bionys-634	70	7	in	in	ADP
bionys-634	70	8	50	50	NUM
bionys-634	70	9	μl	μl	ADP
bionys-634	70	10	sdw	sdw	PROPN
bionys-634	70	11	.	.	PROPN
bionys-634	70	12	method	method	PROPN
bionys-634	70	13	2	2	NUM
bionys-634	70	14	:	:	PUNCT
bionys-634	70	15	the	the	DET
bionys-634	70	16	dna	dna	PROPN
bionys-634	70	17	sample	sample	NOUN
bionys-634	70	18	was	be	AUX
bionys-634	70	19	extracted	extract	VERB
bionys-634	70	20	from	from	ADP
bionys-634	70	21	canned	can	VERB
bionys-634	70	22	corn	corn	NOUN
bionys-634	70	23	,	,	PUNCT
bionys-634	70	24	corn	corn	NOUN
bionys-634	70	25	puffs	puff	NOUN
bionys-634	70	26	,	,	PUNCT
bionys-634	70	27	and	and	CCONJ
bionys-634	70	28	popcorn	popcorn	NOUN
bionys-634	70	29	using	use	VERB
bionys-634	70	30	the	the	DET
bionys-634	70	31	modified	modify	VERB
bionys-634	70	32	ctab	ctab	NOUN
bionys-634	70	33	method	method	NOUN
bionys-634	70	34	.	.	PUNCT
bionys-634	71	1	the	the	DET
bionys-634	71	2	samples	sample	NOUN
bionys-634	71	3	were	be	AUX
bionys-634	71	4	ground	grind	VERB
bionys-634	71	5	using	use	VERB
bionys-634	71	6	a	a	DET
bionys-634	71	7	mortar	mortar	NOUN
bionys-634	71	8	and	and	CCONJ
bionys-634	71	9	pestle	pestle	NOUN
bionys-634	71	10	.	.	PUNCT
bionys-634	72	1	before	before	ADP
bionys-634	72	2	milling	milling	NOUN
bionys-634	72	3	,	,	PUNCT
bionys-634	72	4	liquid	liquid	ADJ
bionys-634	72	5	nitrogen	nitrogen	NOUN
bionys-634	72	6	was	be	AUX
bionys-634	72	7	added	add	VERB
bionys-634	72	8	to	to	ADP
bionys-634	72	9	the	the	DET
bionys-634	72	10	popcorn	popcorn	NOUN
bionys-634	72	11	,	,	PUNCT
bionys-634	72	12	and	and	CCONJ
bionys-634	72	13	the	the	DET
bionys-634	72	14	canned	can	VERB
bionys-634	72	15	corn	corn	NOUN
bionys-634	72	16	was	be	AUX
bionys-634	72	17	heated	heat	VERB
bionys-634	72	18	to	to	ADP
bionys-634	72	19	below	below	ADP
bionys-634	73	1	40	40	NUM
bionys-634	73	2	°	°	NOUN
bionys-634	73	3	c	c	NOUN
bionys-634	73	4	.	.	PUNCT
bionys-634	74	1	then	then	ADV
bionys-634	74	2	,	,	PUNCT
bionys-634	74	3	the	the	DET
bionys-634	74	4	powder	powder	NOUN
bionys-634	74	5	was	be	AUX
bionys-634	74	6	mixed	mix	VERB
bionys-634	74	7	with	with	ADP
bionys-634	74	8	1000	1000	NUM
bionys-634	74	9	μl	μl	ADP
bionys-634	74	10	of	of	ADP
bionys-634	74	11	buffer	buffer	NOUN
bionys-634	74	12	(	(	PUNCT
bionys-634	74	13	containing	contain	VERB
bionys-634	74	14	1.4	1.4	NUM
bionys-634	74	15	m	m	NOUN
bionys-634	74	16	nacl	nacl	NOUN
bionys-634	74	17	,	,	PUNCT
bionys-634	74	18	0.1	0.1	NUM
bionys-634	74	19	m	m	NOUN
bionys-634	74	20	tris	tris	NOUN
bionys-634	74	21	-	-	PUNCT
bionys-634	74	22	hcl	hcl	NOUN
bionys-634	74	23	,	,	PUNCT
bionys-634	74	24	20	20	NUM
bionys-634	74	25	mm	mm	PROPN
bionys-634	74	26	na2edta	na2edta	PROPN
bionys-634	74	27	,	,	PUNCT
bionys-634	74	28	20	20	NUM
bionys-634	74	29	g	g	NOUN
bionys-634	74	30	/	/	SYM
bionys-634	74	31	l	l	NOUN
bionys-634	74	32	ctab	ctab	NOUN
bionys-634	74	33	,	,	PUNCT
bionys-634	74	34	and	and	CCONJ
bionys-634	74	35	ph	ph	X
bionys-634	74	36	8.0	8.0	NUM
bionys-634	74	37	)	)	PUNCT
bionys-634	74	38	in	in	ADP
bionys-634	74	39	a	a	DET
bionys-634	74	40	2	2	NUM
bionys-634	74	41	-	-	PUNCT
bionys-634	74	42	ml	ml	NOUN
bionys-634	74	43	tube	tube	NOUN
bionys-634	74	44	,	,	PUNCT
bionys-634	74	45	with	with	ADP
bionys-634	74	46	the	the	DET
bionys-634	74	47	addition	addition	NOUN
bionys-634	74	48	of	of	ADP
bionys-634	74	49	25	25	NUM
bionys-634	74	50	μl	μl	ADP
bionys-634	74	51	of	of	ADP
bionys-634	74	52	1	1	NUM
bionys-634	74	53	%	%	NOUN
bionys-634	74	54	(	(	PUNCT
bionys-634	74	55	w	w	NOUN
bionys-634	74	56	/	/	SYM
bionys-634	74	57	v	v	NOUN
bionys-634	74	58	)	)	PUNCT
bionys-634	74	59	sodium	sodium	NOUN
bionys-634	74	60	dodecyl	dodecyl	NOUN
bionys-634	74	61	sulfate	sulfate	NOUN
bionys-634	74	62	(	(	PUNCT
bionys-634	74	63	sds	sds	PROPN
bionys-634	74	64	)	)	PUNCT
bionys-634	74	65	to	to	ADP
bionys-634	74	66	the	the	DET
bionys-634	74	67	corn	corn	NOUN
bionys-634	74	68	puffs	puff	NOUN
bionys-634	74	69	and	and	CCONJ
bionys-634	74	70	popcorns	popcorn	NOUN
bionys-634	74	71	.	.	PUNCT
bionys-634	75	1	the	the	DET
bionys-634	75	2	mixture	mixture	NOUN
bionys-634	75	3	was	be	AUX
bionys-634	75	4	incubated	incubate	VERB
bionys-634	75	5	in	in	ADP
bionys-634	75	6	a	a	DET
bionys-634	75	7	water	water	NOUN
bionys-634	75	8	bath	bath	NOUN
bionys-634	75	9	at	at	ADP
bionys-634	75	10	65	65	NUM
bionys-634	75	11	°	°	NOUN
bionys-634	75	12	c	c	NOUN
bionys-634	75	13	for	for	ADP
bionys-634	75	14	2	2	NUM
bionys-634	75	15	-	-	SYM
bionys-634	75	16	4	4	NUM
bionys-634	75	17	hours	hour	NOUN
bionys-634	75	18	.	.	PUNCT
bionys-634	76	1	the	the	DET
bionys-634	76	2	tubes	tube	NOUN
bionys-634	76	3	were	be	AUX
bionys-634	76	4	gently	gently	ADV
bionys-634	76	5	inverted	invert	VERB
bionys-634	76	6	every	every	DET
bionys-634	76	7	10	10	NUM
bionys-634	76	8	minutes	minute	NOUN
bionys-634	76	9	for	for	ADP
bionys-634	76	10	intermittent	intermittent	ADJ
bionys-634	76	11	mixing	mixing	NOUN
bionys-634	76	12	.	.	PUNCT
bionys-634	77	1	after	after	ADP
bionys-634	77	2	that	that	PRON
bionys-634	77	3	,	,	PUNCT
bionys-634	77	4	20	20	NUM
bionys-634	77	5	μl	μl	NUM
bionys-634	77	6	proteinase	proteinase	PROPN
bionys-634	77	7	k	k	PROPN
bionys-634	77	8	(	(	PUNCT
bionys-634	77	9	20	20	NUM
bionys-634	77	10	mg	mg	NUM
bionys-634	77	11	/	/	SYM
bionys-634	77	12	l	l	NOUN
bionys-634	77	13	)	)	PUNCT
bionys-634	77	14	was	be	AUX
bionys-634	77	15	added	add	VERB
bionys-634	77	16	and	and	CCONJ
bionys-634	77	17	incubated	incubate	VERB
bionys-634	77	18	at	at	ADP
bionys-634	77	19	37	37	NUM
bionys-634	77	20	°	°	NOUN
bionys-634	77	21	c	c	NOUN
bionys-634	77	22	for	for	ADP
bionys-634	77	23	45	45	NUM
bionys-634	77	24	minutes	minute	NOUN
bionys-634	77	25	.	.	PUNCT
bionys-634	78	1	next	next	ADV
bionys-634	78	2	,	,	PUNCT
bionys-634	78	3	the	the	DET
bionys-634	78	4	tube	tube	NOUN
bionys-634	78	5	was	be	AUX
bionys-634	78	6	centrifuged	centrifuge	VERB
bionys-634	78	7	at	at	ADP
bionys-634	78	8	13,000	13,000	NUM
bionys-634	78	9	g	g	NOUN
bionys-634	78	10	for	for	ADP
bionys-634	78	11	20	20	NUM
bionys-634	78	12	minutes	minute	NOUN
bionys-634	78	13	.	.	PUNCT
bionys-634	79	1	the	the	DET
bionys-634	79	2	supernatant	supernatant	NOUN
bionys-634	79	3	was	be	AUX
bionys-634	79	4	transferred	transfer	VERB
bionys-634	79	5	to	to	ADP
bionys-634	79	6	a	a	DET
bionys-634	79	7	new	new	ADJ
bionys-634	79	8	2	2	NUM
bionys-634	79	9	-	-	PUNCT
bionys-634	79	10	ml	ml	NOUN
bionys-634	79	11	tube	tube	NOUN
bionys-634	79	12	containing	contain	VERB
bionys-634	79	13	500	500	NUM
bionys-634	79	14	µl	µl	NOUN
bionys-634	79	15	of	of	ADP
bionys-634	79	16	chloroform	chloroform	NOUN
bionys-634	79	17	(	(	PUNCT
bionys-634	79	18	merck	merck	PROPN
bionys-634	79	19	,	,	PUNCT
bionys-634	79	20	germany	germany	PROPN
bionys-634	79	21	)	)	PUNCT
bionys-634	79	22	and	and	CCONJ
bionys-634	79	23	was	be	AUX
bionys-634	79	24	shaken	shake	VERB
bionys-634	79	25	for	for	ADP
bionys-634	79	26	30	30	NUM
bionys-634	79	27	seconds	second	NOUN
bionys-634	79	28	.	.	PUNCT
bionys-634	80	1	the	the	DET
bionys-634	80	2	tube	tube	NOUN
bionys-634	80	3	was	be	AUX
bionys-634	80	4	centrifuged	centrifuge	VERB
bionys-634	80	5	for	for	ADP
bionys-634	80	6	20	20	NUM
bionys-634	80	7	minutes	minute	NOUN
bionys-634	80	8	at	at	ADP
bionys-634	80	9	13,000	13,000	NUM
bionys-634	80	10	g.	g.	NOUN
bionys-634	80	11	the	the	DET
bionys-634	80	12	upper	upper	ADJ
bionys-634	80	13	phase	phase	NOUN
bionys-634	80	14	was	be	AUX
bionys-634	80	15	transferred	transfer	VERB
bionys-634	80	16	to	to	ADP
bionys-634	80	17	a	a	DET
bionys-634	80	18	new	new	ADJ
bionys-634	80	19	tube	tube	NOUN
bionys-634	80	20	,	,	PUNCT
bionys-634	80	21	and	and	CCONJ
bionys-634	80	22	two	two	NUM
bionys-634	80	23	volumes	volume	NOUN
bionys-634	80	24	of	of	ADP
bionys-634	80	25	ctab	ctab	ADJ
bionys-634	80	26	precipitation	precipitation	NOUN
bionys-634	80	27	buffer	buffer	NOUN
bionys-634	80	28	(	(	PUNCT
bionys-634	80	29	5	5	NUM
bionys-634	80	30	g	g	NOUN
bionys-634	80	31	/	/	SYM
bionys-634	80	32	l	l	NOUN
bionys-634	80	33	ctab	ctab	NOUN
bionys-634	80	34	and	and	CCONJ
bionys-634	80	35	0.04	0.04	NUM
bionys-634	80	36	m	m	NOUN
bionys-634	80	37	nacl	nacl	NOUN
bionys-634	80	38	)	)	PUNCT
bionys-634	80	39	were	be	AUX
bionys-634	80	40	added	add	VERB
bionys-634	80	41	,	,	PUNCT
bionys-634	80	42	and	and	CCONJ
bionys-634	80	43	the	the	DET
bionys-634	80	44	tube	tube	NOUN
bionys-634	80	45	was	be	AUX
bionys-634	80	46	incubated	incubate	VERB
bionys-634	80	47	at	at	ADP
bionys-634	80	48	room	room	NOUN
bionys-634	80	49	temperature	temperature	NOUN
bionys-634	80	50	for	for	ADP
bionys-634	80	51	60	60	NUM
bionys-634	80	52	minutes	minute	NOUN
bionys-634	80	53	.	.	PUNCT
bionys-634	81	1	then	then	ADV
bionys-634	81	2	the	the	DET
bionys-634	81	3	tube	tube	NOUN
bionys-634	81	4	was	be	AUX
bionys-634	81	5	centrifuged	centrifuge	VERB
bionys-634	81	6	for	for	ADP
bionys-634	81	7	20	20	NUM
bionys-634	81	8	minutes	minute	NOUN
bionys-634	81	9	at	at	ADP
bionys-634	81	10	13,000	13,000	NUM
bionys-634	81	11	g.	g.	NOUN
bionys-634	81	12	the	the	DET
bionys-634	81	13	supernatant	supernatant	NOUN
bionys-634	81	14	was	be	AUX
bionys-634	81	15	discarded	discard	VERB
bionys-634	81	16	,	,	PUNCT
bionys-634	81	17	and	and	CCONJ
bionys-634	81	18	the	the	DET
bionys-634	81	19	precipitate	precipitate	NOUN
bionys-634	81	20	was	be	AUX
bionys-634	81	21	dissolved	dissolve	VERB
bionys-634	81	22	in	in	ADP
bionys-634	81	23	350	350	NUM
bionys-634	81	24	µl	µl	ADP
bionys-634	81	25	chloroform	chloroform	NOUN
bionys-634	81	26	and	and	CCONJ
bionys-634	81	27	350	350	NUM
bionys-634	81	28	µl1.2	µl1.2	NOUN
bionys-634	81	29	m	m	NOUN
bionys-634	81	30	nacl	nacl	NOUN
bionys-634	81	31	.	.	PUNCT
bionys-634	82	1	the	the	DET
bionys-634	82	2	mixture	mixture	NOUN
bionys-634	82	3	was	be	AUX
bionys-634	82	4	shaken	shake	VERB
bionys-634	82	5	for	for	ADP
bionys-634	82	6	30	30	NUM
bionys-634	82	7	seconds	second	NOUN
bionys-634	82	8	,	,	PUNCT
bionys-634	82	9	and	and	CCONJ
bionys-634	82	10	the	the	DET
bionys-634	82	11	tube	tube	NOUN
bionys-634	82	12	was	be	AUX
bionys-634	82	13	centrifuged	centrifuge	VERB
bionys-634	82	14	for	for	ADP
bionys-634	82	15	20	20	NUM
bionys-634	82	16	minutes	minute	NOUN
bionys-634	82	17	at	at	ADP
bionys-634	82	18	13,000	13,000	NUM
bionys-634	82	19	g.	g.	NOUN
bionys-634	82	20	the	the	DET
bionys-634	82	21	upper	upper	ADJ
bionys-634	82	22	phase	phase	NOUN
bionys-634	82	23	was	be	AUX
bionys-634	82	24	transferred	transfer	VERB
bionys-634	82	25	to	to	ADP
bionys-634	82	26	a	a	DET
bionys-634	82	27	new	new	ADJ
bionys-634	82	28	tube	tube	NOUN
bionys-634	82	29	.	.	PUNCT
bionys-634	83	1	the	the	DET
bionys-634	83	2	0.7	0.7	NUM
bionys-634	83	3	volumes	volume	NOUN
bionys-634	83	4	of	of	ADP
bionys-634	83	5	pre	pre	ADJ
bionys-634	83	6	-	-	ADJ
bionys-634	83	7	chilled	chilled	ADJ
bionys-634	83	8	isopropanol	isopropanol	NOUN
bionys-634	83	9	were	be	AUX
bionys-634	83	10	added	add	VERB
bionys-634	83	11	,	,	PUNCT
bionys-634	83	12	and	and	CCONJ
bionys-634	83	13	the	the	DET
bionys-634	83	14	tube	tube	NOUN
bionys-634	83	15	was	be	AUX
bionys-634	83	16	shaken	shake	VERB
bionys-634	83	17	and	and	CCONJ
bionys-634	83	18	kept	keep	VERB
bionys-634	83	19	overnight	overnight	ADV
bionys-634	83	20	at	at	ADP
bionys-634	83	21	-20	-20	NUM
bionys-634	83	22	°	°	PROPN
bionys-634	83	23	c	c	NOUN
bionys-634	83	24	.	.	PUNCT
bionys-634	84	1	the	the	DET
bionys-634	84	2	tube	tube	NOUN
bionys-634	84	3	was	be	AUX
bionys-634	84	4	centrifuged	centrifuge	VERB
bionys-634	84	5	for	for	ADP
bionys-634	84	6	20	20	NUM
bionys-634	84	7	minutes	minute	NOUN
bionys-634	84	8	at	at	ADP
bionys-634	84	9	13,000	13,000	NUM
bionys-634	84	10	g.	g.	NOUN
bionys-634	84	11	the	the	DET
bionys-634	84	12	supernatant	supernatant	NOUN
bionys-634	84	13	was	be	AUX
bionys-634	84	14	discarded	discard	VERB
bionys-634	84	15	and	and	CCONJ
bionys-634	84	16	washed	wash	VERB
bionys-634	84	17	with	with	ADP
bionys-634	84	18	500	500	NUM
bionys-634	84	19	µl	µl	ADP
bionys-634	84	20	pre	pre	ADJ
bionys-634	84	21	-	-	ADJ
bionys-634	84	22	chilled	chilled	ADJ
bionys-634	84	23	ethanol	ethanol	NOUN
bionys-634	84	24	(	(	PUNCT
bionys-634	84	25	70	70	NUM
bionys-634	84	26	%	%	NOUN
bionys-634	84	27	)	)	PUNCT
bionys-634	84	28	(	(	PUNCT
bionys-634	84	29	merck	merck	PROPN
bionys-634	84	30	,	,	PUNCT
bionys-634	84	31	germany	germany	PROPN
bionys-634	84	32	)	)	PUNCT
bionys-634	84	33	.	.	PUNCT
bionys-634	85	1	the	the	DET
bionys-634	85	2	tube	tube	NOUN
bionys-634	85	3	was	be	AUX
bionys-634	85	4	shaken	shake	VERB
bionys-634	85	5	carefully	carefully	ADV
bionys-634	85	6	,	,	PUNCT
bionys-634	85	7	and	and	CCONJ
bionys-634	85	8	then	then	ADV
bionys-634	85	9	centrifugation	centrifugation	NOUN
bionys-634	85	10	was	be	AUX
bionys-634	85	11	done	do	VERB
bionys-634	85	12	for	for	ADP
bionys-634	85	13	20	20	NUM
bionys-634	85	14	minutes	minute	NOUN
bionys-634	85	15	at	at	ADP
bionys-634	85	16	13,000	13,000	NUM
bionys-634	85	17	g.	g.	NOUN
bionys-634	85	18	the	the	DET
bionys-634	85	19	pellet	pellet	NOUN
bionys-634	85	20	was	be	AUX
bionys-634	85	21	air	air	NOUN
bionys-634	85	22	-	-	PUNCT
bionys-634	85	23	dried	dry	VERB
bionys-634	85	24	,	,	PUNCT
bionys-634	85	25	and	and	CCONJ
bionys-634	85	26	dna	dna	PROPN
bionys-634	85	27	was	be	AUX
bionys-634	85	28	dissolved	dissolve	VERB
bionys-634	85	29	in	in	ADP
bionys-634	85	30	50	50	NUM
bionys-634	85	31	µl	µl	ADP
bionys-634	85	32	sdw	sdw	PROPN
bionys-634	85	33	.	.	PROPN
bionys-634	85	34	method	method	PROPN
bionys-634	85	35	3	3	NUM
bionys-634	85	36	:	:	PUNCT
bionys-634	85	37	the	the	DET
bionys-634	85	38	dna	dna	PROPN
bionys-634	85	39	sample	sample	NOUN
bionys-634	85	40	was	be	AUX
bionys-634	85	41	extracted	extract	VERB
bionys-634	85	42	from	from	ADP
bionys-634	85	43	corn	corn	NOUN
bionys-634	85	44	starch	starch	NOUN
bionys-634	85	45	using	use	VERB
bionys-634	85	46	the	the	DET
bionys-634	85	47	modified	modify	VERB
bionys-634	85	48	protocol	protocol	NOUN
bionys-634	85	49	of	of	ADP
bionys-634	85	50	waiblinger	waiblinger	PROPN
bionys-634	85	51	et	et	PROPN
bionys-634	85	52	al	al	PROPN
bionys-634	85	53	.	.	PROPN
bionys-634	86	1	(	(	PUNCT
bionys-634	86	2	2012	2012	NUM
bionys-634	86	3	)	)	PUNCT
bionys-634	86	4	.	.	PUNCT
bionys-634	87	1	the	the	DET
bionys-634	87	2	sample	sample	NOUN
bionys-634	87	3	(	(	PUNCT
bionys-634	87	4	5	5	NUM
bionys-634	87	5	g	g	NOUN
bionys-634	87	6	)	)	PUNCT
bionys-634	87	7	was	be	AUX
bionys-634	87	8	mixed	mix	VERB
bionys-634	87	9	with	with	ADP
bionys-634	87	10	25	25	NUM
bionys-634	87	11	ml	ml	NOUN
bionys-634	87	12	of	of	ADP
bionys-634	87	13	ctab	ctab	ADJ
bionys-634	87	14	buffer	buffer	NOUN
bionys-634	87	15	(	(	PUNCT
bionys-634	87	16	0.1	0.1	NUM
bionys-634	87	17	m	m	NOUN
bionys-634	87	18	tris	tris	NOUN
bionys-634	87	19	-	-	PUNCT
bionys-634	87	20	hcl	hcl	NOUN
bionys-634	87	21	,	,	PUNCT
bionys-634	87	22	1.4	1.4	NUM
bionys-634	87	23	m	m	NOUN
bionys-634	87	24	nacl	nacl	NOUN
bionys-634	87	25	,	,	PUNCT
bionys-634	87	26	20	20	NUM
bionys-634	87	27	mm	mm	PROPN
bionys-634	87	28	na2edta	na2edta	PROPN
bionys-634	87	29	,	,	PUNCT
bionys-634	87	30	and	and	CCONJ
bionys-634	87	31	20	20	NUM
bionys-634	87	32	g	g	NOUN
bionys-634	87	33	/	/	SYM
bionys-634	87	34	l	l	NOUN
bionys-634	87	35	ctab	ctab	NOUN
bionys-634	87	36	,	,	PUNCT
bionys-634	87	37	ph	ph	NOUN
bionys-634	87	38	8.0	8.0	NUM
bionys-634	87	39	)	)	PUNCT
bionys-634	87	40	,	,	PUNCT
bionys-634	87	41	and	and	CCONJ
bionys-634	87	42	then	then	ADV
bionys-634	87	43	50	50	NUM
bionys-634	87	44	μl	μl	ADP
bionys-634	87	45	of	of	ADP
bionys-634	87	46	α	α	NOUN
bionys-634	87	47	-	-	PUNCT
bionys-634	87	48	amylase	amylase	NOUN
bionys-634	87	49	solution	solution	NOUN
bionys-634	87	50	(	(	PUNCT
bionys-634	87	51	10	10	NUM
bionys-634	87	52	mg	mg	NUM
bionys-634	87	53	/	/	SYM
bionys-634	87	54	ml	ml	NOUN
bionys-634	87	55	)	)	PUNCT
bionys-634	87	56	was	be	AUX
bionys-634	87	57	added	add	VERB
bionys-634	87	58	to	to	ADP
bionys-634	87	59	the	the	DET
bionys-634	87	60	mixture	mixture	NOUN
bionys-634	87	61	.	.	PUNCT
bionys-634	88	1	the	the	DET
bionys-634	88	2	sample	sample	NOUN
bionys-634	88	3	mixture	mixture	NOUN
bionys-634	88	4	was	be	AUX
bionys-634	88	5	transferred	transfer	VERB
bionys-634	88	6	to	to	ADP
bionys-634	88	7	a	a	DET
bionys-634	88	8	50	50	NUM
bionys-634	88	9	-	-	PUNCT
bionys-634	88	10	ml	ml	NOUN
bionys-634	88	11	tube	tube	NOUN
bionys-634	88	12	and	and	CCONJ
bionys-634	88	13	incubated	incubate	VERB
bionys-634	88	14	at	at	ADP
bionys-634	88	15	65	65	NUM
bionys-634	88	16	°	°	NOUN
bionys-634	88	17	c	c	NOUN
bionys-634	88	18	for	for	ADP
bionys-634	88	19	4	4	NUM
bionys-634	88	20	hours	hour	NOUN
bionys-634	88	21	in	in	ADP
bionys-634	88	22	a	a	DET
bionys-634	88	23	water	water	NOUN
bionys-634	88	24	bath	bath	NOUN
bionys-634	88	25	,	,	PUNCT
bionys-634	88	26	with	with	SCONJ
bionys-634	88	27	the	the	DET
bionys-634	88	28	tubes	tube	NOUN
bionys-634	88	29	gently	gently	ADV
bionys-634	88	30	inverted	invert	VERB
bionys-634	88	31	every	every	DET
bionys-634	88	32	10	10	NUM
bionys-634	88	33	minutes	minute	NOUN
bionys-634	88	34	for	for	ADP
bionys-634	88	35	intermittent	intermittent	ADJ
bionys-634	88	36	mixing	mixing	NOUN
bionys-634	88	37	.	.	PUNCT
bionys-634	89	1	the	the	DET
bionys-634	89	2	tube	tube	NOUN
bionys-634	89	3	was	be	AUX
bionys-634	89	4	centrifuged	centrifuge	VERB
bionys-634	89	5	for	for	ADP
bionys-634	89	6	20	20	NUM
bionys-634	89	7	minutes	minute	NOUN
bionys-634	89	8	at	at	ADP
bionys-634	89	9	13,000	13,000	NUM
bionys-634	89	10	g.	g.	NOUN
bionys-634	89	11	the	the	DET
bionys-634	89	12	supernatant	supernatant	NOUN
bionys-634	89	13	was	be	AUX
bionys-634	89	14	transferred	transfer	VERB
bionys-634	89	15	to	to	ADP
bionys-634	89	16	a	a	DET
bionys-634	89	17	new	new	ADJ
bionys-634	89	18	50	50	NUM
bionys-634	89	19	-	-	PUNCT
bionys-634	89	20	ml	ml	NOUN
bionys-634	89	21	tube	tube	NOUN
bionys-634	89	22	containing	contain	VERB
bionys-634	89	23	10	10	NUM
bionys-634	89	24	ml	ml	NOUN
bionys-634	89	25	of	of	ADP
bionys-634	89	26	chloroform	chloroform	NOUN
bionys-634	89	27	(	(	PUNCT
bionys-634	89	28	merck	merck	PROPN
bionys-634	89	29	,	,	PUNCT
bionys-634	89	30	germany	germany	PROPN
bionys-634	89	31	)	)	PUNCT
bionys-634	89	32	sample	sample	NOUN
bionys-634	89	33	code	code	NOUN
bionys-634	89	34	product	product	NOUN
bionys-634	89	35	name	name	NOUN
bionys-634	89	36	product	product	NOUN
bionys-634	89	37	type	type	NOUN
bionys-634	89	38	1	1	NUM
bionys-634	89	39	corn	corn	NOUN
bionys-634	89	40	seed	seed	NOUN
bionys-634	89	41	nut	nut	NOUN
bionys-634	89	42	2	2	NUM
bionys-634	89	43	corn	corn	NOUN
bionys-634	89	44	seed	seed	NOUN
bionys-634	89	45	nut	nut	NOUN
bionys-634	89	46	3	3	NUM
bionys-634	89	47	corn	corn	NOUN
bionys-634	89	48	seed	seed	NOUN
bionys-634	89	49	nut	nut	NOUN
bionys-634	89	50	4	4	NUM
bionys-634	89	51	corn	corn	NOUN
bionys-634	89	52	seed	seed	NOUN
bionys-634	89	53	nut	nut	NOUN
bionys-634	89	54	5	5	NUM
bionys-634	89	55	corn	corn	NOUN
bionys-634	89	56	seed	seed	NOUN
bionys-634	89	57	nut	nut	NOUN
bionys-634	89	58	6	6	NUM
bionys-634	89	59	corn	corn	NOUN
bionys-634	89	60	seed	seed	NOUN
bionys-634	89	61	nut	nut	NOUN
bionys-634	89	62	7	7	NUM
bionys-634	89	63	corn	corn	NOUN
bionys-634	89	64	seed	seed	NOUN
bionys-634	89	65	nut	nut	NOUN
bionys-634	89	66	8	8	NUM
bionys-634	89	67	corn	corn	NOUN
bionys-634	89	68	seed	seed	NOUN
bionys-634	89	69	nut	nut	NOUN
bionys-634	89	70	9	9	NUM
bionys-634	89	71	corn	corn	NOUN
bionys-634	89	72	seed	seed	NOUN
bionys-634	89	73	nut	nut	NOUN
bionys-634	89	74	10	10	NUM
bionys-634	89	75	corn	corn	NOUN
bionys-634	89	76	seed	seed	NOUN
bionys-634	89	77	nut	nut	NOUN
bionys-634	89	78	11	11	NUM
bionys-634	89	79	bulk	bulk	ADJ
bionys-634	89	80	corn	corn	NOUN
bionys-634	89	81	seed	seed	NOUN
bionys-634	89	82	nut	nut	NOUN
bionys-634	89	83	12	12	NUM
bionys-634	89	84	bulk	bulk	ADJ
bionys-634	89	85	corn	corn	NOUN
bionys-634	89	86	seed	seed	NOUN
bionys-634	89	87	nut	nut	NOUN
bionys-634	89	88	13	13	NUM
bionys-634	89	89	bulk	bulk	ADJ
bionys-634	89	90	corn	corn	NOUN
bionys-634	89	91	seed	seed	NOUN
bionys-634	89	92	nut	nut	NOUN
bionys-634	90	1	14	14	NUM
bionys-634	90	2	canned	can	VERB
bionys-634	90	3	corn	corn	NOUN
bionys-634	90	4	canned	can	VERB
bionys-634	90	5	15	15	NUM
bionys-634	90	6	canned	can	VERB
bionys-634	90	7	corn	corn	NOUN
bionys-634	90	8	canned	can	VERB
bionys-634	90	9	16	16	NUM
bionys-634	90	10	canned	can	VERB
bionys-634	90	11	corn	corn	NOUN
bionys-634	90	12	canned	can	VERB
bionys-634	90	13	17	17	NUM
bionys-634	90	14	canned	can	VERB
bionys-634	90	15	corn	corn	NOUN
bionys-634	90	16	canned	can	VERB
bionys-634	90	17	18	18	NUM
bionys-634	90	18	raw	raw	ADJ
bionys-634	90	19	seed	seed	NOUN
bionys-634	90	20	raw	raw	ADJ
bionys-634	90	21	corn	corn	NOUN
bionys-634	90	22	19	19	NUM
bionys-634	90	23	raw	raw	ADJ
bionys-634	90	24	seed	seed	NOUN
bionys-634	90	25	raw	raw	ADJ
bionys-634	90	26	corn	corn	NOUN
bionys-634	90	27	20	20	NUM
bionys-634	90	28	raw	raw	ADJ
bionys-634	90	29	seed	seed	NOUN
bionys-634	90	30	raw	raw	ADJ
bionys-634	90	31	corn	corn	NOUN
bionys-634	90	32	21	21	NUM
bionys-634	90	33	corn	corn	NOUN
bionys-634	90	34	flour	flour	NOUN
bionys-634	90	35	flour	flour	NOUN
bionys-634	90	36	22	22	NUM
bionys-634	90	37	corn	corn	NOUN
bionys-634	90	38	flour	flour	NOUN
bionys-634	90	39	flour	flour	NOUN
bionys-634	90	40	23	23	NUM
bionys-634	90	41	popcorn	popcorn	NOUN
bionys-634	90	42	pop	pop	NOUN
bionys-634	90	43	corn	corn	NOUN
bionys-634	90	44	24	24	NUM
bionys-634	90	45	popcorn	popcorn	NOUN
bionys-634	90	46	pop	pop	NOUN
bionys-634	90	47	corn	corn	NOUN
bionys-634	90	48	25	25	NUM
bionys-634	90	49	popcorn	popcorn	NOUN
bionys-634	90	50	pop	pop	NOUN
bionys-634	90	51	corn	corn	NOUN
bionys-634	90	52	26	26	NUM
bionys-634	90	53	extruded	extrude	VERB
bionys-634	90	54	snack	snack	NOUN
bionys-634	90	55	puff	puff	NOUN
bionys-634	90	56	27	27	NUM
bionys-634	90	57	extruded	extruded	ADJ
bionys-634	90	58	snack	snack	NOUN
bionys-634	90	59	puff	puff	NOUN
bionys-634	90	60	28	28	NUM
bionys-634	90	61	extruded	extruded	ADJ
bionys-634	90	62	snack	snack	NOUN
bionys-634	90	63	puff	puff	NOUN
bionys-634	90	64	29	29	NUM
bionys-634	90	65	corn	corn	NOUN
bionys-634	90	66	starch	starch	NOUN
bionys-634	90	67	starch	starch	NOUN
bionys-634	90	68	30	30	NUM
bionys-634	90	69	corn	corn	NOUN
bionys-634	90	70	starch	starch	NOUN
bionys-634	90	71	starch	starch	NOUN
bionys-634	90	72	table	table	NOUN
bionys-634	90	73	1	1	NUM
bionys-634	90	74	.	.	PUNCT
bionys-634	90	75	sample	sample	PROPN
bionys-634	90	76	code	code	PROPN
bionys-634	90	77	,	,	PUNCT
bionys-634	90	78	names	name	NOUN
bionys-634	90	79	of	of	ADP
bionys-634	90	80	corn	corn	NOUN
bionys-634	90	81	samples	sample	NOUN
bionys-634	90	82	and	and	CCONJ
bionys-634	90	83	product	product	NOUN
bionys-634	90	84	types	type	NOUN
bionys-634	90	85	collected	collect	VERB
bionys-634	90	86	from	from	ADP
bionys-634	90	87	supermarkets	supermarket	NOUN
bionys-634	90	88	in	in	ADP
bionys-634	90	89	shiraz	shiraz	PROPN
bionys-634	90	90	biologica	biologica	PROPN
bionys-634	90	91	nyssana	nyssana	PROPN
bionys-634	91	1	●	●	PUNCT
bionys-634	91	2	16	16	NUM
bionys-634	91	3	(	(	PUNCT
bionys-634	91	4	2	2	NUM
bionys-634	91	5	)	)	PUNCT
bionys-634	91	6	december	december	PROPN
bionys-634	91	7	2025	2025	NUM
bionys-634	91	8	:	:	PUNCT
bionys-634	91	9	ashrafi	ashrafi	PROPN
bionys-634	91	10	-	-	PUNCT
bionys-634	91	11	dehkordi	dehkordi	PROPN
bionys-634	91	12	et	et	PROPN
bionys-634	91	13	al	al	PROPN
bionys-634	91	14	.	.	PUNCT
bionys-634	91	15	●	●	PUNCT
bionys-634	91	16	pcr	pcr	NOUN
bionys-634	91	17	-	-	PUNCT
bionys-634	91	18	based	base	VERB
bionys-634	91	19	investigation	investigation	NOUN
bionys-634	91	20	on	on	ADP
bionys-634	91	21	transgenic	transgenic	NOUN
bionys-634	91	22	maize	maize	NOUN
bionys-634	91	23	status	status	NOUN
bionys-634	91	24	in	in	ADP
bionys-634	91	25	corn	corn	NOUN
bionys-634	91	26	processed	process	VERB
bionys-634	91	27	products	product	NOUN
bionys-634	91	28	and	and	CCONJ
bionys-634	91	29	was	be	AUX
bionys-634	91	30	shaken	shake	VERB
bionys-634	91	31	for	for	ADP
bionys-634	91	32	30	30	NUM
bionys-634	91	33	s.	s.	PROPN
bionys-634	91	34	the	the	DET
bionys-634	91	35	tube	tube	NOUN
bionys-634	91	36	was	be	AUX
bionys-634	91	37	centrifuged	centrifuge	VERB
bionys-634	91	38	at	at	ADP
bionys-634	91	39	13,000	13,000	NUM
bionys-634	91	40	g	g	NOUN
bionys-634	91	41	for	for	ADP
bionys-634	91	42	20	20	NUM
bionys-634	91	43	minutes	minute	NOUN
bionys-634	91	44	.	.	PUNCT
bionys-634	92	1	the	the	DET
bionys-634	92	2	upper	upper	ADJ
bionys-634	92	3	phase	phase	NOUN
bionys-634	92	4	was	be	AUX
bionys-634	92	5	transferred	transfer	VERB
bionys-634	92	6	to	to	ADP
bionys-634	92	7	a	a	DET
bionys-634	92	8	new	new	ADJ
bionys-634	92	9	tube	tube	NOUN
bionys-634	92	10	with	with	ADP
bionys-634	92	11	0.7	0.7	NUM
bionys-634	92	12	volume	volume	NOUN
bionys-634	92	13	of	of	ADP
bionys-634	92	14	prechilled	prechille	VERB
bionys-634	92	15	isopropanol	isopropanol	NOUN
bionys-634	92	16	(	(	PUNCT
bionys-634	92	17	merck	merck	PROPN
bionys-634	92	18	,	,	PUNCT
bionys-634	92	19	germany	germany	PROPN
bionys-634	92	20	)	)	PUNCT
bionys-634	92	21	and	and	CCONJ
bionys-634	92	22	then	then	ADV
bionys-634	92	23	incubated	incubate	VERB
bionys-634	92	24	overnight	overnight	ADV
bionys-634	92	25	at	at	ADP
bionys-634	92	26	-20	-20	NUM
bionys-634	92	27	°	°	PROPN
bionys-634	92	28	c	c	NOUN
bionys-634	92	29	.	.	PUNCT
bionys-634	93	1	the	the	DET
bionys-634	93	2	centrifugation	centrifugation	NOUN
bionys-634	93	3	was	be	AUX
bionys-634	93	4	done	do	VERB
bionys-634	93	5	at	at	ADP
bionys-634	93	6	13,000	13,000	NUM
bionys-634	93	7	g	g	NOUN
bionys-634	93	8	for	for	ADP
bionys-634	93	9	10	10	NUM
bionys-634	93	10	minutes	minute	NOUN
bionys-634	93	11	.	.	PUNCT
bionys-634	94	1	the	the	DET
bionys-634	94	2	supernatant	supernatant	NOUN
bionys-634	94	3	was	be	AUX
bionys-634	94	4	discarded	discard	VERB
bionys-634	94	5	,	,	PUNCT
bionys-634	94	6	and	and	CCONJ
bionys-634	94	7	the	the	DET
bionys-634	94	8	pellet	pellet	NOUN
bionys-634	94	9	was	be	AUX
bionys-634	94	10	transferred	transfer	VERB
bionys-634	94	11	to	to	ADP
bionys-634	94	12	a	a	DET
bionys-634	94	13	2	2	NUM
bionys-634	94	14	-	-	PUNCT
bionys-634	94	15	ml	ml	NOUN
bionys-634	94	16	tube	tube	NOUN
bionys-634	94	17	and	and	CCONJ
bionys-634	94	18	washed	wash	VERB
bionys-634	94	19	with	with	ADP
bionys-634	94	20	1500	1500	NUM
bionys-634	94	21	μl70	μl70	PROPN
bionys-634	94	22	%	%	NOUN
bionys-634	94	23	ethanol	ethanol	NOUN
bionys-634	94	24	(	(	PUNCT
bionys-634	94	25	merck	merck	PROPN
bionys-634	94	26	,	,	PUNCT
bionys-634	94	27	germany	germany	PROPN
bionys-634	94	28	)	)	PUNCT
bionys-634	94	29	.	.	PUNCT
bionys-634	95	1	the	the	DET
bionys-634	95	2	centrifugation	centrifugation	NOUN
bionys-634	95	3	was	be	AUX
bionys-634	95	4	performed	perform	VERB
bionys-634	95	5	at	at	ADP
bionys-634	95	6	13,000	13,000	NUM
bionys-634	95	7	g	g	NOUN
bionys-634	95	8	for	for	ADP
bionys-634	95	9	10	10	NUM
bionys-634	95	10	minutes	minute	NOUN
bionys-634	95	11	.	.	PUNCT
bionys-634	96	1	finally	finally	ADV
bionys-634	96	2	,	,	PUNCT
bionys-634	96	3	the	the	DET
bionys-634	96	4	supernatant	supernatant	NOUN
bionys-634	96	5	was	be	AUX
bionys-634	96	6	discarded	discard	VERB
bionys-634	96	7	,	,	PUNCT
bionys-634	96	8	and	and	CCONJ
bionys-634	96	9	the	the	DET
bionys-634	96	10	pellet	pellet	NOUN
bionys-634	96	11	was	be	AUX
bionys-634	96	12	air	air	NOUN
bionys-634	96	13	-	-	PUNCT
bionys-634	96	14	dried	dry	VERB
bionys-634	96	15	.	.	PUNCT
bionys-634	97	1	the	the	DET
bionys-634	97	2	dna	dna	PROPN
bionys-634	97	3	was	be	AUX
bionys-634	97	4	dissolved	dissolve	VERB
bionys-634	97	5	in	in	ADP
bionys-634	97	6	50	50	NUM
bionys-634	97	7	μl	μl	ADP
bionys-634	97	8	sdw	sdw	PROPN
bionys-634	97	9	.	.	PUNCT
bionys-634	98	1	dna	dna	PROPN
bionys-634	98	2	quantification	quantification	NOUN
bionys-634	98	3	and	and	CCONJ
bionys-634	98	4	purity	purity	NOUN
bionys-634	98	5	measurement	measurement	NOUN
bionys-634	98	6	dna	dna	PROPN
bionys-634	98	7	concentration	concentration	NOUN
bionys-634	98	8	was	be	AUX
bionys-634	98	9	measured	measure	VERB
bionys-634	98	10	by	by	ADP
bionys-634	98	11	an	an	DET
bionys-634	98	12	eppendorf	eppendorf	PROPN
bionys-634	98	13	spectrophotometer	spectrophotometer	NOUN
bionys-634	98	14	(	(	PUNCT
bionys-634	98	15	scandrop2	scandrop2	PROPN
bionys-634	98	16	,	,	PUNCT
bionys-634	98	17	analytic	analytic	ADJ
bionys-634	98	18	jena	jena	PROPN
bionys-634	98	19	,	,	PUNCT
bionys-634	98	20	germany	germany	PROPN
bionys-634	98	21	)	)	PUNCT
bionys-634	98	22	,	,	PUNCT
bionys-634	98	23	using	use	VERB
bionys-634	98	24	the	the	DET
bionys-634	98	25	uv	uv	NOUN
bionys-634	98	26	absorbance	absorbance	NOUN
bionys-634	98	27	at	at	ADP
bionys-634	98	28	260	260	NUM
bionys-634	98	29	nm	nm	NOUN
bionys-634	98	30	(	(	PUNCT
bionys-634	98	31	nanograms	nanogram	NOUN
bionys-634	98	32	of	of	ADP
bionys-634	98	33	dna	dna	PROPN
bionys-634	98	34	per	per	ADP
bionys-634	98	35	microliter	microliter	NOUN
bionys-634	98	36	extract	extract	NOUN
bionys-634	98	37	)	)	PUNCT
bionys-634	98	38	.	.	PUNCT
bionys-634	99	1	oligonucleotide	oligonucleotide	VERB
bionys-634	99	2	primers	primer	NOUN
bionys-634	99	3	specific	specific	ADJ
bionys-634	99	4	oligonucleotide	oligonucleotide	NOUN
bionys-634	99	5	primers	primer	NOUN
bionys-634	99	6	were	be	AUX
bionys-634	99	7	used	use	VERB
bionys-634	99	8	for	for	ADP
bionys-634	99	9	amplifying	amplifying	ADJ
bionys-634	99	10	amplicons	amplicon	NOUN
bionys-634	99	11	.	.	PUNCT
bionys-634	100	1	the	the	DET
bionys-634	100	2	primers	primer	NOUN
bionys-634	100	3	of	of	ADP
bionys-634	100	4	nos	no	NOUN
bionys-634	100	5	,	,	PUNCT
bionys-634	100	6	35s	35s	NUM
bionys-634	100	7	,	,	PUNCT
bionys-634	100	8	epsps	epsp	NOUN
bionys-634	100	9	,	,	PUNCT
bionys-634	100	10	and	and	CCONJ
bionys-634	100	11	zm	zm	PROPN
bionys-634	100	12	were	be	AUX
bionys-634	100	13	used	use	VERB
bionys-634	100	14	to	to	PART
bionys-634	100	15	detect	detect	VERB
bionys-634	100	16	nos	no	NOUN
bionys-634	100	17	-	-	NOUN
bionys-634	100	18	terminator	terminator	NOUN
bionys-634	100	19	,	,	PUNCT
bionys-634	100	20	camv35s	camv35s	ADJ
bionys-634	100	21	promoter	promoter	NOUN
bionys-634	100	22	,	,	PUNCT
bionys-634	100	23	epsps	epsps	PROPN
bionys-634	100	24	structure	structure	NOUN
bionys-634	100	25	gene	gene	NOUN
bionys-634	100	26	region	region	NOUN
bionys-634	100	27	,	,	PUNCT
bionys-634	100	28	and	and	CCONJ
bionys-634	100	29	zein	zein	ADJ
bionys-634	100	30	gene	gene	NOUN
bionys-634	100	31	(	(	PUNCT
bionys-634	100	32	as	as	ADP
bionys-634	100	33	an	an	DET
bionys-634	100	34	endogenous	endogenous	ADJ
bionys-634	100	35	control	control	NOUN
bionys-634	100	36	)	)	PUNCT
bionys-634	100	37	,	,	PUNCT
bionys-634	100	38	respectively	respectively	ADV
bionys-634	100	39	.	.	PUNCT
bionys-634	101	1	the	the	DET
bionys-634	101	2	sequences	sequence	NOUN
bionys-634	101	3	of	of	ADP
bionys-634	101	4	oligonucleotide	oligonucleotide	ADJ
bionys-634	101	5	primers	primer	NOUN
bionys-634	101	6	are	be	AUX
bionys-634	101	7	given	give	VERB
bionys-634	101	8	in	in	ADP
bionys-634	101	9	tab	tab	NOUN
bionys-634	101	10	.	.	PUNCT
bionys-634	102	1	2	2	X
bionys-634	102	2	.	.	X
bionys-634	102	3	polymerase	polymerase	NOUN
bionys-634	102	4	chain	chain	NOUN
bionys-634	102	5	reaction	reaction	NOUN
bionys-634	102	6	pcr	pcr	PROPN
bionys-634	102	7	in	in	ADP
bionys-634	102	8	thermal	thermal	ADJ
bionys-634	102	9	cycler	cycler	NOUN
bionys-634	102	10	(	(	PUNCT
bionys-634	102	11	ab	ab	PROPN
bionys-634	102	12	applied	apply	VERB
bionys-634	102	13	biosystems	biosystem	NOUN
bionys-634	102	14	,	,	PUNCT
bionys-634	102	15	veriti	veriti	PROPN
bionys-634	102	16	96	96	NUM
bionys-634	103	1	well	well	INTJ
bionys-634	103	2	,	,	PUNCT
bionys-634	103	3	usa	usa	PROPN
bionys-634	103	4	)	)	PUNCT
bionys-634	103	5	was	be	AUX
bionys-634	103	6	used	use	VERB
bionys-634	103	7	in	in	ADP
bionys-634	103	8	reaction	reaction	NOUN
bionys-634	103	9	mixtures	mixture	NOUN
bionys-634	103	10	(	(	PUNCT
bionys-634	103	11	20	20	NUM
bionys-634	103	12	µl	µl	NOUN
bionys-634	103	13	)	)	PUNCT
bionys-634	103	14	containing	contain	VERB
bionys-634	103	15	2.5	2.5	NUM
bionys-634	103	16	µl	µl	NOUN
bionys-634	103	17	of	of	ADP
bionys-634	103	18	4	4	NUM
bionys-634	103	19	mm	mm	NOUN
bionys-634	103	20	dntp	dntp	NOUN
bionys-634	103	21	,	,	PUNCT
bionys-634	103	22	2.5	2.5	NUM
bionys-634	103	23	µl	µl	NOUN
bionys-634	103	24	of	of	ADP
bionys-634	103	25	10	10	NUM
bionys-634	103	26	x	x	NOUN
bionys-634	103	27	pcr	pcr	ADJ
bionys-634	103	28	buffer	buffer	NOUN
bionys-634	103	29	,	,	PUNCT
bionys-634	103	30	3	3	NUM
bionys-634	103	31	µl	µl	ADP
bionys-634	103	32	dna	dna	PROPN
bionys-634	103	33	,	,	PUNCT
bionys-634	103	34	1.5	1.5	NUM
bionys-634	103	35	µl	µl	ADP
bionys-634	103	36	25	25	NUM
bionys-634	103	37	mm	mm	NOUN
bionys-634	103	38	mgcl2	mgcl2	PROPN
bionys-634	103	39	,	,	PUNCT
bionys-634	103	40	0.6	0.6	NUM
bionys-634	103	41	µl	µl	ADP
bionys-634	103	42	primers	primer	NOUN
bionys-634	103	43	with	with	ADP
bionys-634	103	44	20	20	NUM
bionys-634	103	45	µm	µm	ADP
bionys-634	103	46	each	each	PRON
bionys-634	103	47	and	and	CCONJ
bionys-634	103	48	5	5	NUM
bionys-634	103	49	unites/µl	unites/µl	NUM
bionys-634	103	50	of	of	ADP
bionys-634	103	51	taq	taq	PROPN
bionys-634	103	52	dna	dna	PROPN
bionys-634	103	53	polymerase	polymerase	NOUN
bionys-634	103	54	(	(	PUNCT
bionys-634	103	55	sinagene	sinagene	NOUN
bionys-634	103	56	,	,	PUNCT
bionys-634	103	57	tehran	tehran	NOUN
bionys-634	103	58	,	,	PUNCT
bionys-634	103	59	iran	iran	PROPN
bionys-634	103	60	)	)	PUNCT
bionys-634	103	61	.	.	PUNCT
bionys-634	104	1	a	a	DET
bionys-634	104	2	thermal	thermal	ADJ
bionys-634	104	3	cycler	cycler	NOUN
bionys-634	104	4	was	be	AUX
bionys-634	104	5	used	use	VERB
bionys-634	104	6	for	for	ADP
bionys-634	104	7	amplification	amplification	NOUN
bionys-634	104	8	according	accord	VERB
bionys-634	104	9	to	to	ADP
bionys-634	104	10	the	the	DET
bionys-634	104	11	following	follow	VERB
bionys-634	104	12	pcr	pcr	ADJ
bionys-634	104	13	step	step	NOUN
bionys-634	104	14	-	-	PUNCT
bionys-634	104	15	cycle	cycle	NOUN
bionys-634	104	16	program	program	NOUN
bionys-634	104	17	for	for	ADP
bionys-634	104	18	all	all	DET
bionys-634	104	19	primers	primer	NOUN
bionys-634	104	20	,	,	PUNCT
bionys-634	104	21	as	as	SCONJ
bionys-634	104	22	shown	show	VERB
bionys-634	104	23	in	in	ADP
bionys-634	104	24	tab	tab	NOUN
bionys-634	104	25	.	.	PUNCT
bionys-634	105	1	3	3	X
bionys-634	105	2	.	.	X
bionys-634	106	1	the	the	DET
bionys-634	106	2	analysis	analysis	NOUN
bionys-634	106	3	of	of	ADP
bionys-634	106	4	pcr	pcr	ADJ
bionys-634	106	5	products	product	NOUN
bionys-634	106	6	was	be	AUX
bionys-634	106	7	done	do	VERB
bionys-634	106	8	on	on	ADP
bionys-634	106	9	a	a	DET
bionys-634	106	10	1.0	1.0	NUM
bionys-634	106	11	%	%	NOUN
bionys-634	106	12	agarose	agarose	NOUN
bionys-634	106	13	gel	gel	NOUN
bionys-634	106	14	electrophoresis	electrophoresis	NOUN
bionys-634	106	15	.	.	PUNCT
bionys-634	107	1	results	result	VERB
bionys-634	107	2	three	three	NUM
bionys-634	107	3	different	different	ADJ
bionys-634	107	4	ctab	ctab	NOUN
bionys-634	107	5	-	-	PUNCT
bionys-634	107	6	based	base	VERB
bionys-634	107	7	dna	dna	NOUN
bionys-634	107	8	extraction	extraction	NOUN
bionys-634	107	9	methods	method	NOUN
bionys-634	107	10	were	be	AUX
bionys-634	107	11	applied	apply	VERB
bionys-634	107	12	to	to	ADP
bionys-634	107	13	the	the	DET
bionys-634	107	14	corn	corn	NOUN
bionys-634	107	15	and	and	CCONJ
bionys-634	107	16	corn	corn	NOUN
bionys-634	107	17	-	-	PUNCT
bionys-634	107	18	derived	derive	VERB
bionys-634	107	19	food	food	NOUN
bionys-634	107	20	samples	sample	NOUN
bionys-634	107	21	presented	present	VERB
bionys-634	107	22	in	in	ADP
bionys-634	107	23	tab	tab	NOUN
bionys-634	107	24	.	.	PUNCT
bionys-634	108	1	1	1	X
bionys-634	108	2	.	.	X
bionys-634	109	1	a	a	DET
bionys-634	109	2	summary	summary	NOUN
bionys-634	109	3	of	of	ADP
bionys-634	109	4	the	the	DET
bionys-634	109	5	dna	dna	PROPN
bionys-634	109	6	yields	yield	NOUN
bionys-634	109	7	and	and	CCONJ
bionys-634	109	8	purity	purity	NOUN
bionys-634	109	9	ranges	range	NOUN
bionys-634	109	10	obtained	obtain	VERB
bionys-634	109	11	using	use	VERB
bionys-634	109	12	the	the	DET
bionys-634	109	13	three	three	NUM
bionys-634	109	14	extraction	extraction	NOUN
bionys-634	109	15	methods	method	NOUN
bionys-634	109	16	is	be	AUX
bionys-634	109	17	presented	present	VERB
bionys-634	109	18	in	in	ADP
bionys-634	109	19	tab	tab	NOUN
bionys-634	109	20	.	.	PUNCT
bionys-634	110	1	4	4	X
bionys-634	110	2	.	.	PUNCT
bionys-634	111	1	the	the	DET
bionys-634	111	2	results	result	NOUN
bionys-634	111	3	show	show	VERB
bionys-634	111	4	that	that	SCONJ
bionys-634	111	5	there	there	PRON
bionys-634	111	6	are	be	VERB
bionys-634	111	7	discrepancies	discrepancy	NOUN
bionys-634	111	8	in	in	ADP
bionys-634	111	9	the	the	DET
bionys-634	111	10	dna	dna	PROPN
bionys-634	111	11	extraction	extraction	NOUN
bionys-634	111	12	between	between	ADP
bionys-634	111	13	the	the	DET
bionys-634	111	14	three	three	NUM
bionys-634	111	15	methods	method	NOUN
bionys-634	111	16	.	.	PUNCT
bionys-634	112	1	following	follow	VERB
bionys-634	112	2	the	the	DET
bionys-634	112	3	genomic	genomic	ADJ
bionys-634	112	4	dna	dna	PROPN
bionys-634	112	5	extraction	extraction	NOUN
bionys-634	112	6	,	,	PUNCT
bionys-634	112	7	the	the	DET
bionys-634	112	8	pcr	pcr	ADJ
bionys-634	112	9	method	method	NOUN
bionys-634	112	10	was	be	AUX
bionys-634	112	11	used	use	VERB
bionys-634	112	12	to	to	PART
bionys-634	112	13	identify	identify	VERB
bionys-634	112	14	the	the	DET
bionys-634	112	15	gmo	gmo	PROPN
bionys-634	112	16	samples	sample	NOUN
bionys-634	112	17	.	.	PUNCT
bionys-634	113	1	firstly	firstly	ADV
bionys-634	113	2	,	,	PUNCT
bionys-634	113	3	the	the	DET
bionys-634	113	4	specific	specific	ADJ
bionys-634	113	5	maize	maize	NOUN
bionys-634	113	6	sequence	sequence	NOUN
bionys-634	113	7	,	,	PUNCT
bionys-634	113	8	the	the	DET
bionys-634	113	9	zein	zein	NOUN
bionys-634	113	10	gene	gene	NOUN
bionys-634	113	11	,	,	PUNCT
bionys-634	113	12	was	be	AUX
bionys-634	113	13	employed	employ	VERB
bionys-634	113	14	to	to	PART
bionys-634	113	15	distinguish	distinguish	VERB
bionys-634	113	16	negative	negative	ADJ
bionys-634	113	17	and	and	CCONJ
bionys-634	113	18	positive	positive	ADJ
bionys-634	113	19	outcomes	outcome	NOUN
bionys-634	113	20	resulting	result	VERB
bionys-634	113	21	from	from	ADP
bionys-634	113	22	amplification	amplification	NOUN
bionys-634	113	23	interference	interference	NOUN
bionys-634	113	24	(	(	PUNCT
bionys-634	113	25	forte	forte	PROPN
bionys-634	113	26	et	et	PROPN
bionys-634	113	27	al	al	PROPN
bionys-634	113	28	.	.	PROPN
bionys-634	113	29	,	,	PUNCT
bionys-634	113	30	2005	2005	NUM
bionys-634	113	31	)	)	PUNCT
bionys-634	113	32	.	.	PUNCT
bionys-634	114	1	secondly	secondly	ADV
bionys-634	114	2	,	,	PUNCT
bionys-634	114	3	for	for	ADP
bionys-634	114	4	the	the	DET
bionys-634	114	5	identification	identification	NOUN
bionys-634	114	6	of	of	ADP
bionys-634	114	7	gm	gm	PROPN
bionys-634	114	8	material	material	NOUN
bionys-634	114	9	in	in	ADP
bionys-634	114	10	corn	corn	NOUN
bionys-634	114	11	samples	sample	NOUN
bionys-634	114	12	,	,	PUNCT
bionys-634	114	13	the	the	DET
bionys-634	114	14	35s	35	NOUN
bionys-634	114	15	-	-	NOUN
bionys-634	114	16	promoter	promoter	NOUN
bionys-634	114	17	and	and	CCONJ
bionys-634	114	18	nos	no	NOUN
bionys-634	114	19	-	-	NOUN
bionys-634	114	20	terminator	terminator	NOUN
bionys-634	114	21	were	be	AUX
bionys-634	114	22	employed	employ	VERB
bionys-634	114	23	.	.	PUNCT
bionys-634	115	1	name	name	NOUN
bionys-634	115	2	5’-3	5’-3	NOUN
bionys-634	115	3	’	'	PUNCT
bionys-634	115	4	sequence	sequence	NOUN
bionys-634	115	5	target	target	NOUN
bionys-634	115	6	amplicon	amplicon	NOUN
bionys-634	115	7	(	(	PUNCT
bionys-634	115	8	bp	bp	PROPN
bionys-634	115	9	)	)	PUNCT
bionys-634	115	10	refrence	refrence	NOUN
bionys-634	115	11	zm	zm	PROPN
bionys-634	115	12	-	-	PUNCT
bionys-634	115	13	f	f	PROPN
bionys-634	115	14	cgccagaaatcgtttttcat	cgccagaaatcgtttttcat	PROPN
bionys-634	115	15	zein	zein	PROPN
bionys-634	115	16	139	139	NUM
bionys-634	115	17	(	(	PUNCT
bionys-634	115	18	germini	germini	PROPN
bionys-634	115	19	et	et	PROPN
bionys-634	115	20	al	al	PROPN
bionys-634	115	21	.	.	PROPN
bionys-634	115	22	2004	2004	NUM
bionys-634	115	23	)	)	PUNCT
bionys-634	116	1	zm	zm	NOUN
bionys-634	116	2	-	-	PUNCT
bionys-634	116	3	r	r	NOUN
bionys-634	116	4	ggtggtgtccttgcttccta	ggtggtgtccttgcttccta	NOUN
bionys-634	116	5	zein	zein	NOUN
bionys-634	116	6	139	139	NUM
bionys-634	116	7	(	(	PUNCT
bionys-634	116	8	germini	germini	PROPN
bionys-634	116	9	et	et	PROPN
bionys-634	116	10	al	al	PROPN
bionys-634	116	11	.	.	PROPN
bionys-634	116	12	2004	2004	NUM
bionys-634	116	13	)	)	PUNCT
bionys-634	117	1	35sf-1	35sf-1	NUM
bionys-634	117	2	gctcctacaaatgccatca	gctcctacaaatgccatca	NOUN
bionys-634	117	3	p-35s	p-35s	ADP
bionys-634	117	4	195	195	NUM
bionys-634	117	5	(	(	PUNCT
bionys-634	117	6	cardarelli	cardarelli	PROPN
bionys-634	117	7	et	et	PROPN
bionys-634	117	8	al	al	PROPN
bionys-634	117	9	.	.	PROPN
bionys-634	117	10	2005	2005	NUM
bionys-634	117	11	)	)	PUNCT
bionys-634	117	12	35sr-1	35sr-1	PROPN
bionys-634	117	13	gatagtgggattgtgcgtca	gatagtgggattgtgcgtca	ADJ
bionys-634	117	14	nos	nos	PROPN
bionys-634	117	15	-	-	PROPN
bionys-634	117	16	f	f	PROPN
bionys-634	117	17	gacaccgcgcgcgataatttatcc	gacaccgcgcgcgataatttatcc	PROPN
bionys-634	117	18	t	t	PROPN
bionys-634	117	19	-	-	PUNCT
bionys-634	117	20	nos	nos	X
bionys-634	117	21	118	118	NUM
bionys-634	117	22	(	(	PUNCT
bionys-634	117	23	cardarelli	cardarelli	PROPN
bionys-634	117	24	et	et	PROPN
bionys-634	117	25	al	al	PROPN
bionys-634	117	26	.	.	PROPN
bionys-634	117	27	2005	2005	NUM
bionys-634	117	28	)	)	PUNCT
bionys-634	117	29	nos	nos	PROPN
bionys-634	117	30	-	-	PUNCT
bionys-634	117	31	r	r	PROPN
bionys-634	117	32	gacaccgcgcgcgataatttatcc	gacaccgcgcgcgataatttatcc	NOUN
bionys-634	117	33	gmo	gmo	PROPN
bionys-634	117	34	-	-	PUNCT
bionys-634	117	35	f	f	PROPN
bionys-634	117	36	atcccactatccttcgcaaga	atcccactatccttcgcaaga	NOUN
bionys-634	117	37	epsps	epsp	VERB
bionys-634	117	38	169	169	NUM
bionys-634	117	39	(	(	PUNCT
bionys-634	117	40	cardarelli	cardarelli	PROPN
bionys-634	117	41	et	et	PROPN
bionys-634	117	42	al	al	PROPN
bionys-634	117	43	.	.	PROPN
bionys-634	117	44	2005	2005	NUM
bionys-634	117	45	)	)	PUNCT
bionys-634	117	46	gmo	gmo	PROPN
bionys-634	117	47	-	-	PUNCT
bionys-634	117	48	r	r	NOUN
bionys-634	117	49	tggggtttatggaaattggaa	tggggtttatggaaattggaa	NOUN
bionys-634	117	50	table	table	NOUN
bionys-634	117	51	2	2	NUM
bionys-634	117	52	.	.	PUNCT
bionys-634	118	1	the	the	DET
bionys-634	118	2	list	list	NOUN
bionys-634	118	3	of	of	ADP
bionys-634	118	4	primer	primer	NOUN
bionys-634	118	5	pairs	pair	NOUN
bionys-634	118	6	used	use	VERB
bionys-634	118	7	in	in	ADP
bionys-634	118	8	this	this	DET
bionys-634	118	9	study	study	NOUN
bionys-634	118	10	step	step	NOUN
bionys-634	118	11	zein	zein	NOUN
bionys-634	118	12	camv	camv	NOUN
bionys-634	118	13	35s	35	NOUN
bionys-634	118	14	nos	nos	PROPN
bionys-634	118	15	epsps	epsps	PROPN
bionys-634	118	16	initial	initial	ADJ
bionys-634	118	17	denaturation	denaturation	NOUN
bionys-634	118	18	95	95	NUM
bionys-634	119	1	°	°	ADP
bionys-634	119	2	c	c	NOUN
bionys-634	119	3	,	,	PUNCT
bionys-634	119	4	3	3	NUM
bionys-634	119	5	min	min	NOUN
bionys-634	119	6	95	95	NUM
bionys-634	119	7	°	°	NOUN
bionys-634	119	8	c	c	NOUN
bionys-634	119	9	,	,	PUNCT
bionys-634	119	10	3	3	NUM
bionys-634	119	11	min	min	NOUN
bionys-634	119	12	95	95	NUM
bionys-634	119	13	°	°	NOUN
bionys-634	119	14	c	c	NOUN
bionys-634	119	15	,	,	PUNCT
bionys-634	119	16	3	3	NUM
bionys-634	119	17	min	min	NOUN
bionys-634	119	18	95	95	NUM
bionys-634	119	19	°	°	NOUN
bionys-634	119	20	c	c	NOUN
bionys-634	119	21	,	,	PUNCT
bionys-634	119	22	3	3	NUM
bionys-634	119	23	min	min	NOUN
bionys-634	119	24	denaturation	denaturation	NOUN
bionys-634	119	25	95	95	NUM
bionys-634	119	26	°	°	ADP
bionys-634	119	27	c	c	NOUN
bionys-634	119	28	,	,	PUNCT
bionys-634	119	29	45s	45	NOUN
bionys-634	119	30	95	95	NUM
bionys-634	119	31	°	°	SYM
bionys-634	119	32	c	c	NOUN
bionys-634	119	33	,	,	PUNCT
bionys-634	119	34	45s	45	NOUN
bionys-634	119	35	95	95	NUM
bionys-634	119	36	°	°	SYM
bionys-634	119	37	c	c	NOUN
bionys-634	119	38	,	,	PUNCT
bionys-634	119	39	45s	45	NOUN
bionys-634	119	40	95	95	NUM
bionys-634	119	41	°	°	SYM
bionys-634	119	42	c	c	NOUN
bionys-634	119	43	,	,	PUNCT
bionys-634	119	44	45s	45	NOUN
bionys-634	119	45	annealing	anneal	VERB
bionys-634	119	46	50	50	NUM
bionys-634	119	47	°	°	NOUN
bionys-634	119	48	c	c	NOUN
bionys-634	119	49	,	,	PUNCT
bionys-634	119	50	45s	45	NOUN
bionys-634	119	51	52	52	NUM
bionys-634	119	52	°	°	NOUN
bionys-634	119	53	c	c	NOUN
bionys-634	119	54	,	,	PUNCT
bionys-634	119	55	45s	45	NOUN
bionys-634	119	56	61	61	NUM
bionys-634	119	57	°	°	NOUN
bionys-634	119	58	c	c	NOUN
bionys-634	119	59	,	,	PUNCT
bionys-634	119	60	45s	45	NOUN
bionys-634	119	61	57	57	NUM
bionys-634	119	62	°	°	NOUN
bionys-634	119	63	c	c	NOUN
bionys-634	119	64	,	,	PUNCT
bionys-634	119	65	45s	45	NOUN
bionys-634	119	66	extension	extension	NOUN
bionys-634	119	67	72	72	NUM
bionys-634	119	68	°	°	SYM
bionys-634	119	69	c	c	NOUN
bionys-634	119	70	,	,	PUNCT
bionys-634	119	71	40s	40s	NUM
bionys-634	119	72	72	72	NUM
bionys-634	119	73	°	°	SYM
bionys-634	119	74	c	c	NOUN
bionys-634	119	75	,	,	PUNCT
bionys-634	119	76	40s	40s	NUM
bionys-634	119	77	72	72	NUM
bionys-634	119	78	°	°	SYM
bionys-634	119	79	c	c	NOUN
bionys-634	119	80	,	,	PUNCT
bionys-634	119	81	40s	40s	NUM
bionys-634	119	82	72	72	NUM
bionys-634	119	83	°	°	SYM
bionys-634	119	84	c	c	NOUN
bionys-634	119	85	,	,	PUNCT
bionys-634	119	86	40s	40	NOUN
bionys-634	119	87	final	final	ADJ
bionys-634	119	88	extension	extension	NOUN
bionys-634	119	89	72	72	NUM
bionys-634	119	90	°	°	SYM
bionys-634	119	91	c	c	NOUN
bionys-634	119	92	,	,	PUNCT
bionys-634	119	93	10	10	NUM
bionys-634	119	94	min	min	NOUN
bionys-634	119	95	72	72	NUM
bionys-634	119	96	°	°	NOUN
bionys-634	119	97	c	c	NOUN
bionys-634	119	98	,	,	PUNCT
bionys-634	119	99	10	10	NUM
bionys-634	119	100	min	min	NOUN
bionys-634	119	101	72	72	NUM
bionys-634	119	102	°	°	NOUN
bionys-634	119	103	c	c	NOUN
bionys-634	119	104	,	,	PUNCT
bionys-634	119	105	10	10	NUM
bionys-634	119	106	min	min	NOUN
bionys-634	119	107	72	72	NUM
bionys-634	119	108	°	°	NOUN
bionys-634	119	109	c	c	NOUN
bionys-634	119	110	,	,	PUNCT
bionys-634	119	111	10	10	NUM
bionys-634	119	112	min	min	NOUN
bionys-634	119	113	cycles	cycle	NOUN
bionys-634	119	114	35	35	NUM
bionys-634	119	115	35	35	NUM
bionys-634	119	116	35	35	NUM
bionys-634	119	117	35	35	NUM
bionys-634	119	118	table	table	NOUN
bionys-634	119	119	3	3	NUM
bionys-634	119	120	.	.	PUNCT
bionys-634	119	121	reaction	reaction	NOUN
bionys-634	119	122	conditions	condition	NOUN
bionys-634	119	123	for	for	ADP
bionys-634	119	124	zein	zein	NOUN
bionys-634	119	125	,	,	PUNCT
bionys-634	119	126	camv	camv	NOUN
bionys-634	119	127	35s	35s	NUM
bionys-634	119	128	,	,	PUNCT
bionys-634	119	129	nos	nos	PROPN
bionys-634	119	130	and	and	CCONJ
bionys-634	119	131	epsps	epsp	VERB
bionys-634	119	132	amplification	amplification	NOUN
bionys-634	119	133	subsequently	subsequently	ADV
bionys-634	119	134	,	,	PUNCT
bionys-634	119	135	the	the	DET
bionys-634	119	136	samples	sample	NOUN
bionys-634	119	137	were	be	AUX
bionys-634	119	138	analyzed	analyze	VERB
bionys-634	119	139	to	to	PART
bionys-634	119	140	identify	identify	VERB
bionys-634	119	141	the	the	DET
bionys-634	119	142	specific	specific	ADJ
bionys-634	119	143	type	type	NOUN
bionys-634	119	144	of	of	ADP
bionys-634	119	145	gmo	gmo	PROPN
bionys-634	119	146	by	by	ADP
bionys-634	119	147	amplifying	amplify	VERB
bionys-634	119	148	the	the	DET
bionys-634	119	149	roundup	roundup	NOUN
bionys-634	119	150	ready	ready	ADJ
bionys-634	119	151	gene	gene	NOUN
bionys-634	119	152	using	use	VERB
bionys-634	119	153	specific	specific	ADJ
bionys-634	119	154	primers	primer	NOUN
bionys-634	119	155	(	(	PUNCT
bionys-634	119	156	lin	lin	PROPN
bionys-634	119	157	et	et	PROPN
bionys-634	119	158	al	al	PROPN
bionys-634	119	159	.	.	PROPN
bionys-634	119	160	,	,	PUNCT
bionys-634	119	161	2000	2000	NUM
bionys-634	119	162	)	)	PUNCT
bionys-634	119	163	.	.	PUNCT
bionys-634	120	1	the	the	DET
bionys-634	120	2	electrophoresis	electrophoresis	NOUN
bionys-634	120	3	results	result	NOUN
bionys-634	120	4	of	of	ADP
bionys-634	120	5	the	the	DET
bionys-634	120	6	pcr	pcr	ADJ
bionys-634	120	7	products	product	NOUN
bionys-634	120	8	showed	show	VERB
bionys-634	120	9	that	that	SCONJ
bionys-634	120	10	the	the	DET
bionys-634	120	11	zein	zein	ADJ
bionys-634	120	12	gene	gene	NOUN
bionys-634	120	13	(	(	PUNCT
bionys-634	120	14	a	a	DET
bionys-634	120	15	band	band	NOUN
bionys-634	120	16	of	of	ADP
bionys-634	120	17	about	about	ADV
bionys-634	120	18	137	137	NUM
bionys-634	120	19	bp	bp	NOUN
bionys-634	120	20	)	)	PUNCT
bionys-634	120	21	of	of	ADP
bionys-634	120	22	all	all	DET
bionys-634	120	23	corn	corn	NOUN
bionys-634	120	24	samples	sample	NOUN
bionys-634	120	25	was	be	AUX
bionys-634	120	26	successfully	successfully	ADV
bionys-634	120	27	amplified	amplify	VERB
bionys-634	120	28	.	.	PUNCT
bionys-634	121	1	this	this	DET
bionys-634	121	2	result	result	NOUN
bionys-634	121	3	showed	show	VERB
bionys-634	121	4	that	that	SCONJ
bionys-634	121	5	the	the	DET
bionys-634	121	6	biologica	biologica	PROPN
bionys-634	121	7	nyssana	nyssana	PROPN
bionys-634	121	8	●	●	PUNCT
bionys-634	121	9	16	16	NUM
bionys-634	121	10	(	(	PUNCT
bionys-634	121	11	2	2	NUM
bionys-634	121	12	)	)	PUNCT
bionys-634	121	13	december	december	PROPN
bionys-634	121	14	2025	2025	NUM
bionys-634	121	15	:	:	PUNCT
bionys-634	121	16	ashrafi	ashrafi	PROPN
bionys-634	121	17	-	-	PUNCT
bionys-634	121	18	dehkordi	dehkordi	PROPN
bionys-634	121	19	et	et	PROPN
bionys-634	121	20	al	al	PROPN
bionys-634	121	21	.	.	PUNCT
bionys-634	122	1	●	●	PUNCT
bionys-634	122	2	pcr	pcr	NOUN
bionys-634	122	3	-	-	PUNCT
bionys-634	122	4	based	base	VERB
bionys-634	122	5	investigation	investigation	NOUN
bionys-634	122	6	on	on	ADP
bionys-634	122	7	transgenic	transgenic	NOUN
bionys-634	122	8	maize	maize	NOUN
bionys-634	122	9	status	status	NOUN
bionys-634	122	10	in	in	ADP
bionys-634	122	11	corn	corn	NOUN
bionys-634	122	12	processed	process	VERB
bionys-634	122	13	products	product	NOUN
bionys-634	122	14	isolated	isolate	VERB
bionys-634	122	15	dnas	dna	NOUN
bionys-634	122	16	have	have	VERB
bionys-634	122	17	good	good	ADJ
bionys-634	122	18	quality	quality	NOUN
bionys-634	122	19	and	and	CCONJ
bionys-634	122	20	contain	contain	VERB
bionys-634	122	21	maize	maize	NOUN
bionys-634	122	22	dna	dna	PROPN
bionys-634	122	23	(	(	PUNCT
bionys-634	122	24	fig	fig	NOUN
bionys-634	122	25	.	.	PUNCT
bionys-634	122	26	1	1	NUM
bionys-634	122	27	)	)	PUNCT
bionys-634	122	28	.	.	PUNCT
bionys-634	123	1	the	the	DET
bionys-634	123	2	positive	positive	ADJ
bionys-634	123	3	detection	detection	NOUN
bionys-634	123	4	of	of	ADP
bionys-634	123	5	targetp	targetp	ADJ
bionys-634	123	6	genes	gene	NOUN
bionys-634	123	7	in	in	ADP
bionys-634	123	8	each	each	DET
bionys-634	123	9	individual	individual	ADJ
bionys-634	123	10	corn	corn	NOUN
bionys-634	123	11	sample	sample	NOUN
bionys-634	123	12	is	be	AUX
bionys-634	123	13	summarized	summarize	VERB
bionys-634	123	14	in	in	ADP
bionys-634	123	15	tab	tab	NOUN
bionys-634	123	16	.	.	PUNCT
bionys-634	124	1	5	5	X
bionys-634	124	2	.	.	PUNCT
bionys-634	124	3	this	this	DET
bionys-634	124	4	table	table	NOUN
bionys-634	124	5	presents	present	VERB
bionys-634	124	6	the	the	DET
bionys-634	124	7	sample	sample	NOUN
bionys-634	124	8	numbers	number	NOUN
bionys-634	124	9	alongside	alongside	ADP
bionys-634	124	10	the	the	DET
bionys-634	124	11	specific	specific	ADJ
bionys-634	124	12	target	target	NOUN
bionys-634	124	13	detected	detect	VERB
bionys-634	124	14	through	through	ADP
bionys-634	124	15	pcr	pcr	ADJ
bionys-634	124	16	analysis	analysis	NOUN
bionys-634	124	17	,	,	PUNCT
bionys-634	124	18	providing	provide	VERB
bionys-634	124	19	a	a	DET
bionys-634	124	20	clear	clear	ADJ
bionys-634	124	21	and	and	CCONJ
bionys-634	124	22	detailed	detailed	ADJ
bionys-634	124	23	overview	overview	NOUN
bionys-634	124	24	of	of	ADP
bionys-634	124	25	gmo	gmo	PROPN
bionys-634	124	26	presence	presence	NOUN
bionys-634	124	27	in	in	ADP
bionys-634	124	28	the	the	DET
bionys-634	124	29	analyzed	analyze	VERB
bionys-634	124	30	samples	sample	NOUN
bionys-634	124	31	.	.	PUNCT
bionys-634	125	1	electrophoresis	electrophoresis	NOUN
bionys-634	125	2	of	of	ADP
bionys-634	125	3	the	the	DET
bionys-634	125	4	pcr	pcr	ADJ
bionys-634	125	5	products	product	NOUN
bionys-634	125	6	showed	show	VERB
bionys-634	125	7	a	a	DET
bionys-634	125	8	118	118	NUM
bionys-634	125	9	-	-	PUNCT
bionys-634	125	10	bp	bp	NOUN
bionys-634	125	11	band	band	NOUN
bionys-634	125	12	for	for	ADP
bionys-634	125	13	nos	nos	X
bionys-634	125	14	(	(	PUNCT
bionys-634	125	15	fig	fig	NOUN
bionys-634	125	16	.	.	PUNCT
bionys-634	126	1	2a	2a	NUM
bionys-634	126	2	)	)	PUNCT
bionys-634	126	3	,	,	PUNCT
bionys-634	126	4	a	a	DET
bionys-634	126	5	195	195	NUM
bionys-634	126	6	-	-	PUNCT
bionys-634	126	7	bp	bp	NOUN
bionys-634	126	8	band	band	NOUN
bionys-634	126	9	for	for	ADP
bionys-634	126	10	p35s	p35s	PROPN
bionys-634	126	11	(	(	PUNCT
bionys-634	126	12	fig	fig	NOUN
bionys-634	126	13	.	.	PUNCT
bionys-634	127	1	2b	2b	NUM
bionys-634	127	2	)	)	PUNCT
bionys-634	127	3	,	,	PUNCT
bionys-634	127	4	and	and	CCONJ
bionys-634	127	5	a	a	DET
bionys-634	127	6	169	169	NUM
bionys-634	127	7	-	-	PUNCT
bionys-634	127	8	bp	bp	NOUN
bionys-634	127	9	band	band	NOUN
bionys-634	127	10	for	for	ADP
bionys-634	127	11	the	the	DET
bionys-634	127	12	epsps	epsps	ADJ
bionys-634	127	13	gene	gene	NOUN
bionys-634	127	14	(	(	PUNCT
bionys-634	127	15	fig	fig	NOUN
bionys-634	127	16	.	.	PUNCT
bionys-634	128	1	2c	2c	NUM
bionys-634	128	2	)	)	PUNCT
bionys-634	128	3	.	.	PUNCT
bionys-634	129	1	the	the	DET
bionys-634	129	2	results	result	NOUN
bionys-634	129	3	showed	show	VERB
bionys-634	129	4	that	that	SCONJ
bionys-634	129	5	13	13	NUM
bionys-634	129	6	,	,	PUNCT
bionys-634	129	7	14	14	NUM
bionys-634	129	8	,	,	PUNCT
bionys-634	129	9	and	and	CCONJ
bionys-634	129	10	one	one	NUM
bionys-634	129	11	sample	sample	NOUN
bionys-634	129	12	were	be	AUX
bionys-634	129	13	positive	positive	ADJ
bionys-634	129	14	for	for	ADP
bionys-634	129	15	the	the	DET
bionys-634	129	16	35s	35	NOUN
bionys-634	129	17	,	,	PUNCT
bionys-634	129	18	nos	nos	X
bionys-634	129	19	,	,	PUNCT
bionys-634	129	20	and	and	CCONJ
bionys-634	129	21	epsps	epsps	PROPN
bionys-634	129	22	gene	gene	NOUN
bionys-634	129	23	,	,	PUNCT
bionys-634	129	24	respectively	respectively	ADV
bionys-634	129	25	.	.	PUNCT
bionys-634	130	1	discussion	discussion	NOUN
bionys-634	130	2	the	the	DET
bionys-634	130	3	quantity	quantity	NOUN
bionys-634	130	4	and	and	CCONJ
bionys-634	130	5	integrity	integrity	NOUN
bionys-634	130	6	of	of	ADP
bionys-634	130	7	dna	dna	PROPN
bionys-634	130	8	depend	depend	VERB
bionys-634	130	9	on	on	ADP
bionys-634	130	10	the	the	DET
bionys-634	130	11	extraction	extraction	NOUN
bionys-634	130	12	method	method	NOUN
bionys-634	130	13	and	and	CCONJ
bionys-634	130	14	the	the	DET
bionys-634	130	15	type	type	NOUN
bionys-634	130	16	of	of	ADP
bionys-634	130	17	food	food	NOUN
bionys-634	130	18	.	.	PUNCT
bionys-634	131	1	contaminants	contaminant	NOUN
bionys-634	131	2	present	present	ADJ
bionys-634	131	3	in	in	ADP
bionys-634	131	4	sample	sample	NOUN
bionys-634	131	5	matrices	matrix	NOUN
bionys-634	131	6	,	,	PUNCT
bionys-634	131	7	including	include	VERB
bionys-634	131	8	lipids	lipid	NOUN
bionys-634	131	9	,	,	PUNCT
bionys-634	131	10	polysaccharides	polysaccharide	NOUN
bionys-634	131	11	,	,	PUNCT
bionys-634	131	12	polyphenols	polyphenol	NOUN
bionys-634	131	13	,	,	PUNCT
bionys-634	131	14	and	and	CCONJ
bionys-634	131	15	extraction	extraction	NOUN
bionys-634	131	16	substances	substance	NOUN
bionys-634	131	17	,	,	PUNCT
bionys-634	131	18	can	can	AUX
bionys-634	131	19	affect	affect	VERB
bionys-634	131	20	dna	dna	PROPN
bionys-634	131	21	purity	purity	NOUN
bionys-634	131	22	(	(	PUNCT
bionys-634	131	23	anklam	anklam	PROPN
bionys-634	131	24	et	et	PROPN
bionys-634	131	25	al	al	PROPN
bionys-634	131	26	.	.	PROPN
bionys-634	131	27	,	,	PUNCT
bionys-634	131	28	2002	2002	NUM
bionys-634	131	29	)	)	PUNCT
bionys-634	131	30	.	.	PUNCT
bionys-634	132	1	the	the	DET
bionys-634	132	2	food	food	NOUN
bionys-634	132	3	processing	processing	NOUN
bionys-634	132	4	techniques	technique	NOUN
bionys-634	132	5	,	,	PUNCT
bionys-634	132	6	such	such	ADJ
bionys-634	132	7	as	as	ADP
bionys-634	132	8	enzymatic	enzymatic	ADJ
bionys-634	132	9	activities	activity	NOUN
bionys-634	132	10	,	,	PUNCT
bionys-634	132	11	low	low	ADJ
bionys-634	132	12	dna	dna	NOUN
bionys-634	132	13	extraction	extraction	NOUN
bionys-634	132	14	methods	method	NOUN
bionys-634	132	15	dna	dna	PROPN
bionys-634	132	16	yield	yield	VERB
bionys-634	132	17	(	(	PUNCT
bionys-634	132	18	ng/µl	ng/µl	NUM
bionys-634	132	19	)	)	PUNCT
bionys-634	132	20	dna	dna	PROPN
bionys-634	132	21	purity	purity	NOUN
bionys-634	132	22	a260nm	a260nm	PROPN
bionys-634	132	23	/	/	SYM
bionys-634	132	24	a280	a280	PROPN
bionys-634	132	25	nm	nm	DET
bionys-634	132	26	ratio	ratio	NOUN
bionys-634	132	27	a260nm	a260nm	PROPN
bionys-634	132	28	/	/	SYM
bionys-634	132	29	a230	a230	PROPN
bionys-634	132	30	nm	nm	PRON
bionys-634	132	31	ratio	ratio	NOUN
bionys-634	132	32	method	method	NOUN
bionys-634	132	33	1	1	NUM
bionys-634	132	34	123.66±39.84	123.66±39.84	NUM
bionys-634	132	35	1.77±0.33	1.77±0.33	PRON
bionys-634	132	36	1.87±0.11	1.87±0.11	ADJ
bionys-634	132	37	method	method	NOUN
bionys-634	132	38	2	2	NUM
bionys-634	132	39	122±69.70	122±69.70	NUM
bionys-634	132	40	1.89±0.47	1.89±0.47	NUM
bionys-634	132	41	1.67±0.13	1.67±0.13	NUM
bionys-634	132	42	method	method	NOUN
bionys-634	132	43	3	3	NUM
bionys-634	132	44	85.49±4.90	85.49±4.90	NUM
bionys-634	132	45	1.95±0.04	1.95±0.04	NUM
bionys-634	132	46	1.78±0.03	1.78±0.03	NUM
bionys-634	132	47	table	table	NOUN
bionys-634	132	48	4	4	NUM
bionys-634	132	49	.	.	PUNCT
bionys-634	132	50	summary	summary	NOUN
bionys-634	132	51	of	of	ADP
bionys-634	132	52	mean	mean	PROPN
bionys-634	132	53	±sd	±sd	PROPN
bionys-634	132	54	,	,	PUNCT
bionys-634	132	55	dna	dna	NOUN
bionys-634	132	56	yield	yield	NOUN
bionys-634	132	57	and	and	CCONJ
bionys-634	132	58	purity	purity	NOUN
bionys-634	132	59	for	for	ADP
bionys-634	132	60	corn	corn	NOUN
bionys-634	132	61	samples	sample	NOUN
bionys-634	132	62	using	use	VERB
bionys-634	132	63	different	different	ADJ
bionys-634	132	64	dna	dna	NOUN
bionys-634	132	65	extraction	extraction	NOUN
bionys-634	132	66	methods	method	NOUN
bionys-634	132	67	fig	fig	NOUN
bionys-634	132	68	.	.	PUNCT
bionys-634	133	1	1	1	X
bionys-634	133	2	.	.	X
bionys-634	133	3	representative	representative	NOUN
bionys-634	133	4	agarose	agarose	NOUN
bionys-634	133	5	gel	gel	NOUN
bionys-634	133	6	electrophoresis	electrophoresis	NOUN
bionys-634	133	7	of	of	ADP
bionys-634	133	8	maize	maize	NOUN
bionys-634	133	9	pcr	pcr	NOUN
bionys-634	133	10	products	product	NOUN
bionys-634	133	11	(	(	PUNCT
bionys-634	133	12	137	137	NUM
bionys-634	133	13	bp	bp	NOUN
bionys-634	133	14	for	for	ADP
bionys-634	133	15	the	the	DET
bionys-634	133	16	detection	detection	NOUN
bionys-634	133	17	of	of	ADP
bionys-634	133	18	zein	zein	NOUN
bionys-634	133	19	gene	gene	NOUN
bionys-634	133	20	):	):	PUNCT
bionys-634	133	21	ladder	ladder	NOUN
bionys-634	133	22	:	:	PUNCT
bionys-634	133	23	100	100	NUM
bionys-634	133	24	bp	bp	PROPN
bionys-634	133	25	dna	dna	PROPN
bionys-634	133	26	ladder	ladder	NOUN
bionys-634	133	27	,	,	PUNCT
bionys-634	133	28	-	-	PUNCT
bionys-634	133	29	:	:	PUNCT
bionys-634	133	30	negative	negative	ADJ
bionys-634	133	31	control,+	control,+	NOUN
bionys-634	133	32	:	:	PUNCT
bionys-634	133	33	positive	positive	ADJ
bionys-634	133	34	control	control	NOUN
bionys-634	133	35	,	,	PUNCT
bionys-634	133	36	lane	lane	NOUN
bionys-634	133	37	1	1	NUM
bionys-634	133	38	-	-	SYM
bionys-634	133	39	13	13	NUM
bionys-634	133	40	:	:	PUNCT
bionys-634	133	41	corn	corn	NOUN
bionys-634	133	42	nut	nut	NOUN
bionys-634	133	43	,	,	PUNCT
bionys-634	133	44	lanes	lane	VERB
bionys-634	133	45	14	14	NUM
bionys-634	133	46	-	-	SYM
bionys-634	133	47	17	17	NUM
bionys-634	133	48	:	:	PUNCT
bionys-634	133	49	canned	can	VERB
bionys-634	133	50	corn	corn	NOUN
bionys-634	133	51	,	,	PUNCT
bionys-634	133	52	lane	lane	NOUN
bionys-634	133	53	18	18	NUM
bionys-634	133	54	-	-	SYM
bionys-634	133	55	20	20	NUM
bionys-634	133	56	:	:	PUNCT
bionys-634	133	57	raw	raw	ADJ
bionys-634	133	58	corn	corn	NOUN
bionys-634	133	59	,	,	PUNCT
bionys-634	133	60	lane	lane	NOUN
bionys-634	133	61	21	21	NUM
bionys-634	133	62	-	-	SYM
bionys-634	133	63	22	22	NUM
bionys-634	133	64	:	:	PUNCT
bionys-634	133	65	corn	corn	NOUN
bionys-634	133	66	flour	flour	NOUN
bionys-634	133	67	,	,	PUNCT
bionys-634	133	68	lane	lane	NOUN
bionys-634	133	69	23	23	NUM
bionys-634	133	70	-	-	SYM
bionys-634	133	71	25	25	NUM
bionys-634	133	72	:	:	PUNCT
bionys-634	133	73	popcorn	popcorn	NOUN
bionys-634	133	74	,	,	PUNCT
bionys-634	133	75	lane	lane	NOUN
bionys-634	133	76	26	26	NUM
bionys-634	133	77	-	-	SYM
bionys-634	133	78	28	28	NUM
bionys-634	133	79	:	:	PUNCT
bionys-634	133	80	corn	corn	NOUN
bionys-634	133	81	puff	puff	NOUN
bionys-634	133	82	,	,	PUNCT
bionys-634	133	83	lane	lane	NOUN
bionys-634	133	84	29	29	NUM
bionys-634	133	85	-	-	SYM
bionys-634	133	86	30	30	NUM
bionys-634	133	87	:	:	PUNCT
bionys-634	133	88	corn	corn	NOUN
bionys-634	133	89	starch	starch	NOUN
bionys-634	133	90	.	.	PUNCT
bionys-634	134	1	ph	ph	VERB
bionys-634	134	2	,	,	PUNCT
bionys-634	134	3	and	and	CCONJ
bionys-634	134	4	heat	heat	NOUN
bionys-634	134	5	,	,	PUNCT
bionys-634	134	6	affect	affect	VERB
bionys-634	134	7	the	the	DET
bionys-634	134	8	integrity	integrity	NOUN
bionys-634	134	9	and	and	CCONJ
bionys-634	134	10	quantity	quantity	NOUN
bionys-634	134	11	of	of	ADP
bionys-634	134	12	dna	dna	NOUN
bionys-634	134	13	,	,	PUNCT
bionys-634	134	14	so	so	ADV
bionys-634	134	15	extracting	extract	VERB
bionys-634	134	16	dna	dna	NOUN
bionys-634	134	17	in	in	ADP
bionys-634	134	18	sufficient	sufficient	ADJ
bionys-634	134	19	purity	purity	NOUN
bionys-634	134	20	and	and	CCONJ
bionys-634	134	21	quantity	quantity	NOUN
bionys-634	134	22	is	be	AUX
bionys-634	134	23	a	a	DET
bionys-634	134	24	difficult	difficult	ADJ
bionys-634	134	25	step	step	NOUN
bionys-634	134	26	(	(	PUNCT
bionys-634	134	27	peano	peano	PROPN
bionys-634	134	28	et	et	PROPN
bionys-634	134	29	al	al	PROPN
bionys-634	134	30	.	.	PROPN
bionys-634	134	31	,	,	PUNCT
bionys-634	134	32	2004	2004	NUM
bionys-634	134	33	;	;	PUNCT
bionys-634	134	34	vijayakumar	vijayakumar	PROPN
bionys-634	134	35	et	et	PROPN
bionys-634	134	36	al	al	PROPN
bionys-634	134	37	.	.	PROPN
bionys-634	134	38	,	,	PUNCT
bionys-634	134	39	2009	2009	NUM
bionys-634	134	40	)	)	PUNCT
bionys-634	134	41	.	.	PUNCT
bionys-634	135	1	the	the	DET
bionys-634	135	2	different	different	ADJ
bionys-634	135	3	methods	method	NOUN
bionys-634	135	4	of	of	ADP
bionys-634	135	5	dna	dna	PROPN
bionys-634	135	6	extraction	extraction	NOUN
bionys-634	135	7	applied	apply	VERB
bionys-634	135	8	in	in	ADP
bionys-634	135	9	this	this	DET
bionys-634	135	10	study	study	NOUN
bionys-634	135	11	are	be	AUX
bionys-634	135	12	capable	capable	ADJ
bionys-634	135	13	of	of	ADP
bionys-634	135	14	extracting	extract	VERB
bionys-634	135	15	sufficient	sufficient	ADJ
bionys-634	135	16	amounts	amount	NOUN
bionys-634	135	17	and	and	CCONJ
bionys-634	135	18	quality	quality	NOUN
bionys-634	135	19	dna	dna	NOUN
bionys-634	135	20	to	to	PART
bionys-634	135	21	identify	identify	VERB
bionys-634	135	22	the	the	DET
bionys-634	135	23	gm	gm	PROPN
bionys-634	135	24	corn	corn	NOUN
bionys-634	135	25	.	.	PUNCT
bionys-634	136	1	a	a	DET
bionys-634	136	2	more	more	ADV
bionys-634	136	3	detailed	detailed	ADJ
bionys-634	136	4	comparison	comparison	NOUN
bionys-634	136	5	of	of	ADP
bionys-634	136	6	our	our	PRON
bionys-634	136	7	results	result	NOUN
bionys-634	136	8	with	with	ADP
bionys-634	136	9	previous	previous	ADJ
bionys-634	136	10	studies	study	NOUN
bionys-634	136	11	further	far	ADV
bionys-634	136	12	illustrates	illustrate	VERB
bionys-634	136	13	the	the	DET
bionys-634	136	14	role	role	NOUN
bionys-634	136	15	of	of	ADP
bionys-634	136	16	extraction	extraction	NOUN
bionys-634	136	17	methods	method	NOUN
bionys-634	136	18	and	and	CCONJ
bionys-634	136	19	sample	sample	NOUN
bionys-634	136	20	matrices	matrix	NOUN
bionys-634	136	21	in	in	ADP
bionys-634	136	22	dna	dna	PROPN
bionys-634	136	23	yield	yield	NOUN
bionys-634	136	24	and	and	CCONJ
bionys-634	136	25	integrity	integrity	NOUN
bionys-634	136	26	.	.	PUNCT
bionys-634	137	1	in	in	ADP
bionys-634	137	2	this	this	DET
bionys-634	137	3	study	study	NOUN
bionys-634	137	4	,	,	PUNCT
bionys-634	137	5	three	three	NUM
bionys-634	137	6	ctab	ctab	NOUN
bionys-634	137	7	-	-	PUNCT
bionys-634	137	8	based	base	VERB
bionys-634	137	9	dna	dna	NOUN
bionys-634	137	10	extraction	extraction	NOUN
bionys-634	137	11	methods	method	NOUN
bionys-634	137	12	were	be	AUX
bionys-634	137	13	applied	apply	VERB
bionys-634	137	14	to	to	ADP
bionys-634	137	15	various	various	ADJ
bionys-634	137	16	corn	corn	NOUN
bionys-634	137	17	and	and	CCONJ
bionys-634	137	18	corn	corn	NOUN
bionys-634	137	19	-	-	PUNCT
bionys-634	137	20	derived	derive	VERB
bionys-634	137	21	food	food	NOUN
bionys-634	137	22	samples	sample	NOUN
bionys-634	137	23	.	.	PUNCT
bionys-634	138	1	the	the	DET
bionys-634	138	2	results	result	NOUN
bionys-634	138	3	showed	show	VERB
bionys-634	138	4	noticeable	noticeable	ADJ
bionys-634	138	5	differences	difference	NOUN
bionys-634	138	6	in	in	ADP
bionys-634	138	7	both	both	DET
bionys-634	138	8	dna	dna	PROPN
bionys-634	138	9	yield	yield	NOUN
bionys-634	138	10	and	and	CCONJ
bionys-634	138	11	purity	purity	NOUN
bionys-634	138	12	between	between	ADP
bionys-634	138	13	the	the	DET
bionys-634	138	14	methods	method	NOUN
bionys-634	138	15	.	.	PUNCT
bionys-634	139	1	as	as	SCONJ
bionys-634	139	2	shown	show	VERB
bionys-634	139	3	in	in	ADP
bionys-634	139	4	tab	tab	NOUN
bionys-634	139	5	.	.	PUNCT
bionys-634	140	1	4	4	NUM
bionys-634	140	2	,	,	PUNCT
bionys-634	140	3	method	method	NOUN
bionys-634	140	4	1	1	NUM
bionys-634	140	5	produced	produce	VERB
bionys-634	140	6	the	the	DET
bionys-634	140	7	highest	high	ADJ
bionys-634	140	8	dna	dna	NOUN
bionys-634	140	9	yield	yield	NOUN
bionys-634	140	10	(	(	PUNCT
bionys-634	140	11	123.66±39.84	123.66±39.84	NUM
bionys-634	140	12	ng/µl	ng/µl	NUM
bionys-634	140	13	)	)	PUNCT
bionys-634	140	14	but	but	CCONJ
bionys-634	140	15	with	with	ADP
bionys-634	140	16	slightly	slightly	ADV
bionys-634	140	17	lower	low	ADJ
bionys-634	140	18	purity	purity	NOUN
bionys-634	140	19	ratios	ratio	NOUN
bionys-634	140	20	(	(	PUNCT
bionys-634	140	21	a260/280=1.77±0.33	a260/280=1.77±0.33	NOUN
bionys-634	140	22	;	;	PUNCT
bionys-634	140	23	a260/230=1.87±0.11	a260/230=1.87±0.11	X
bionys-634	140	24	)	)	PUNCT
bionys-634	140	25	compared	compare	VERB
bionys-634	140	26	to	to	PART
bionys-634	140	27	method	method	VERB
bionys-634	140	28	3	3	NUM
bionys-634	140	29	,	,	PUNCT
bionys-634	140	30	which	which	PRON
bionys-634	140	31	yielded	yield	VERB
bionys-634	140	32	lower	low	ADJ
bionys-634	140	33	dna	dna	PROPN
bionys-634	140	34	concentration	concentration	NOUN
bionys-634	140	35	(	(	PUNCT
bionys-634	140	36	85.49±4.90	85.49±4.90	NUM
bionys-634	140	37	ng/µl	ng/µl	NUM
bionys-634	140	38	)	)	PUNCT
bionys-634	140	39	but	but	CCONJ
bionys-634	140	40	the	the	DET
bionys-634	140	41	highest	high	ADJ
bionys-634	140	42	purity	purity	NOUN
bionys-634	140	43	(	(	PUNCT
bionys-634	140	44	a260/280=1.95±0.04	a260/280=1.95±0.04	PROPN
bionys-634	140	45	;	;	PUNCT
bionys-634	140	46	a260/230=1.780±0.03	a260/230=1.780±0.03	PROPN
bionys-634	140	47	)	)	PUNCT
bionys-634	140	48	.	.	PUNCT
bionys-634	141	1	these	these	DET
bionys-634	141	2	findings	finding	NOUN
bionys-634	141	3	suggest	suggest	VERB
bionys-634	141	4	that	that	SCONJ
bionys-634	141	5	method	method	NOUN
bionys-634	141	6	1	1	NUM
bionys-634	141	7	is	be	AUX
bionys-634	141	8	more	more	ADV
bionys-634	141	9	effective	effective	ADJ
bionys-634	141	10	in	in	ADP
bionys-634	141	11	quantity	quantity	NOUN
bionys-634	141	12	,	,	PUNCT
bionys-634	141	13	while	while	SCONJ
bionys-634	141	14	method	method	NOUN
bionys-634	141	15	3	3	NUM
bionys-634	141	16	provides	provide	VERB
bionys-634	141	17	purer	pure	ADJ
bionys-634	141	18	dna	dna	NOUN
bionys-634	141	19	,	,	PUNCT
bionys-634	141	20	possibly	possibly	ADV
bionys-634	141	21	due	due	ADP
bionys-634	141	22	to	to	ADP
bionys-634	141	23	better	well	ADJ
bionys-634	141	24	removal	removal	NOUN
bionys-634	141	25	of	of	ADP
bionys-634	141	26	pcr	pcr	ADJ
bionys-634	141	27	inhibitors	inhibitor	NOUN
bionys-634	141	28	.	.	PUNCT
bionys-634	142	1	that	that	DET
bionys-634	142	2	intense	intense	ADJ
bionys-634	142	3	food	food	NOUN
bionys-634	142	4	processing	processing	NOUN
bionys-634	142	5	,	,	PUNCT
bionys-634	142	6	such	such	ADJ
bionys-634	142	7	as	as	ADP
bionys-634	142	8	autoclaving	autoclave	VERB
bionys-634	142	9	and	and	CCONJ
bionys-634	142	10	baking	baking	NOUN
bionys-634	142	11	,	,	PUNCT
bionys-634	142	12	significantly	significantly	ADV
bionys-634	142	13	reduces	reduce	VERB
bionys-634	142	14	dna	dna	PROPN
bionys-634	142	15	fragment	fragment	NOUN
bionys-634	142	16	size	size	NOUN
bionys-634	142	17	,	,	PUNCT
bionys-634	142	18	resulting	result	VERB
bionys-634	142	19	in	in	ADP
bionys-634	142	20	the	the	DET
bionys-634	142	21	complete	complete	ADJ
bionys-634	142	22	degradation	degradation	NOUN
bionys-634	142	23	of	of	ADP
bionys-634	142	24	long	long	ADJ
bionys-634	142	25	dna	dna	PROPN
bionys-634	142	26	fragments	fragment	NOUN
bionys-634	142	27	and	and	CCONJ
bionys-634	142	28	the	the	DET
bionys-634	142	29	retention	retention	NOUN
bionys-634	142	30	of	of	ADP
bionys-634	142	31	only	only	ADJ
bionys-634	142	32	short	short	ADJ
bionys-634	142	33	fragments	fragment	NOUN
bionys-634	142	34	(	(	PUNCT
bionys-634	142	35	<	<	X
bionys-634	142	36	500	500	NUM
bionys-634	142	37	bp	bp	NOUN
bionys-634	142	38	)	)	PUNCT
bionys-634	142	39	.	.	PUNCT
bionys-634	143	1	nevertheless	nevertheless	ADV
bionys-634	143	2	,	,	PUNCT
bionys-634	143	3	successful	successful	ADJ
bionys-634	143	4	pcr	pcr	ADJ
bionys-634	143	5	amplification	amplification	NOUN
bionys-634	143	6	of	of	ADP
bionys-634	143	7	short	short	ADJ
bionys-634	143	8	amplicons	amplicon	NOUN
bionys-634	143	9	was	be	AUX
bionys-634	143	10	still	still	ADV
bionys-634	143	11	possible	possible	ADJ
bionys-634	143	12	,	,	PUNCT
bionys-634	143	13	highlighting	highlight	VERB
bionys-634	143	14	the	the	DET
bionys-634	143	15	importance	importance	NOUN
bionys-634	143	16	of	of	ADP
bionys-634	143	17	using	use	VERB
bionys-634	143	18	appropriate	appropriate	ADJ
bionys-634	143	19	primer	primer	NOUN
bionys-634	143	20	design	design	NOUN
bionys-634	143	21	and	and	CCONJ
bionys-634	143	22	extraction	extraction	NOUN
bionys-634	143	23	protocols	protocol	NOUN
bionys-634	143	24	for	for	ADP
bionys-634	143	25	reliable	reliable	ADJ
bionys-634	143	26	gmo	gmo	PROPN
bionys-634	143	27	detection	detection	NOUN
bionys-634	143	28	in	in	ADP
bionys-634	143	29	processed	process	VERB
bionys-634	143	30	foods	food	NOUN
bionys-634	143	31	.	.	PUNCT
bionys-634	144	1	in	in	ADP
bionys-634	144	2	this	this	DET
bionys-634	144	3	study	study	NOUN
bionys-634	144	4	,	,	PUNCT
bionys-634	144	5	pcr	pcr	NOUN
bionys-634	144	6	results	result	NOUN
bionys-634	144	7	using	use	VERB
bionys-634	144	8	specific	specific	ADJ
bionys-634	144	9	primers	primer	NOUN
bionys-634	144	10	showed	show	VERB
bionys-634	144	11	that	that	SCONJ
bionys-634	144	12	17	17	NUM
bionys-634	144	13	(	(	PUNCT
bionys-634	144	14	57	57	NUM
bionys-634	144	15	%	%	NOUN
bionys-634	144	16	)	)	PUNCT
bionys-634	144	17	samples	sample	NOUN
bionys-634	144	18	were	be	AUX
bionys-634	144	19	transgenic	transgenic	NOUN
bionys-634	144	20	.	.	PUNCT
bionys-634	145	1	pcr	pcr	NOUN
bionys-634	145	2	techniques	technique	NOUN
bionys-634	145	3	have	have	AUX
bionys-634	145	4	been	be	AUX
bionys-634	145	5	widely	widely	ADV
bionys-634	145	6	employed	employ	VERB
bionys-634	145	7	in	in	ADP
bionys-634	145	8	several	several	ADJ
bionys-634	145	9	studies	study	NOUN
bionys-634	145	10	to	to	PART
bionys-634	145	11	detect	detect	VERB
bionys-634	145	12	genetically	genetically	ADV
bionys-634	145	13	modified	modify	VERB
bionys-634	145	14	(	(	PUNCT
bionys-634	145	15	gm	gm	NOUN
bionys-634	145	16	)	)	PUNCT
bionys-634	145	17	foods	food	NOUN
bionys-634	145	18	.	.	PUNCT
bionys-634	146	1	for	for	ADP
bionys-634	146	2	instance	instance	NOUN
bionys-634	146	3	,	,	PUNCT
bionys-634	146	4	lin	lin	PROPN
bionys-634	146	5	et	et	PROPN
bionys-634	146	6	al	al	PROPN
bionys-634	146	7	.	.	PROPN
bionys-634	147	1	(	(	PUNCT
bionys-634	147	2	2001	2001	NUM
bionys-634	147	3	)	)	PUNCT
bionys-634	147	4	reported	report	VERB
bionys-634	147	5	that	that	SCONJ
bionys-634	147	6	the	the	DET
bionys-634	147	7	35s	35	NOUN
bionys-634	147	8	or	or	CCONJ
bionys-634	147	9	nos	no	NOUN
bionys-634	147	10	were	be	AUX
bionys-634	147	11	present	present	ADJ
bionys-634	147	12	in	in	ADP
bionys-634	147	13	22	22	NUM
bionys-634	147	14	out	out	ADP
bionys-634	147	15	of	of	ADP
bionys-634	147	16	28	28	NUM
bionys-634	147	17	commercial	commercial	ADJ
bionys-634	147	18	genetically	genetically	ADV
bionys-634	147	19	modified	modify	VERB
bionys-634	147	20	crops	crop	NOUN
bionys-634	147	21	.	.	PUNCT
bionys-634	148	1	fifty	fifty	NUM
bionys-634	148	2	samples	sample	NOUN
bionys-634	148	3	of	of	ADP
bionys-634	148	4	meat	meat	NOUN
bionys-634	148	5	products	product	NOUN
bionys-634	148	6	processed	process	VERB
bionys-634	148	7	in	in	ADP
bionys-634	148	8	serbia	serbia	PROPN
bionys-634	148	9	were	be	AUX
bionys-634	148	10	tested	test	VERB
bionys-634	148	11	using	use	VERB
bionys-634	148	12	the	the	DET
bionys-634	148	13	pcr	pcr	ADJ
bionys-634	148	14	method	method	NOUN
bionys-634	148	15	.	.	PUNCT
bionys-634	149	1	the	the	DET
bionys-634	149	2	results	result	NOUN
bionys-634	149	3	showed	show	VERB
bionys-634	149	4	that	that	SCONJ
bionys-634	149	5	12	12	NUM
bionys-634	149	6	out	out	ADP
bionys-634	149	7	of	of	ADP
bionys-634	149	8	the	the	DET
bionys-634	149	9	50	50	NUM
bionys-634	149	10	samples	sample	NOUN
bionys-634	149	11	contained	contain	VERB
bionys-634	149	12	gm	gm	PROPN
bionys-634	149	13	soybeans	soybean	NOUN
bionys-634	149	14	(	(	PUNCT
bionys-634	149	15	taski	taski	ADJ
bionys-634	149	16	-	-	PUNCT
bionys-634	149	17	ajdukovic	ajdukovic	ADJ
bionys-634	149	18	et	et	PROPN
bionys-634	149	19	al	al	PROPN
bionys-634	149	20	.	.	PROPN
bionys-634	149	21	,	,	PUNCT
bionys-634	149	22	2009	2009	NUM
bionys-634	149	23	)	)	PUNCT
bionys-634	149	24	.	.	PUNCT
bionys-634	150	1	results	result	NOUN
bionys-634	150	2	from	from	ADP
bionys-634	150	3	another	another	DET
bionys-634	150	4	study	study	NOUN
bionys-634	150	5	showed	show	VERB
bionys-634	150	6	that	that	SCONJ
bionys-634	150	7	60	60	NUM
bionys-634	150	8	of	of	ADP
bionys-634	150	9	66	66	NUM
bionys-634	150	10	food	food	NOUN
bionys-634	150	11	samples	sample	NOUN
bionys-634	150	12	contained	contain	VERB
bionys-634	150	13	rr	rr	PROPN
bionys-634	150	14	soy	soy	NOUN
bionys-634	150	15	(	(	PUNCT
bionys-634	150	16	cardarelli	cardarelli	PROPN
bionys-634	150	17	et	et	PROPN
bionys-634	150	18	al	al	PROPN
bionys-634	150	19	.	.	PROPN
bionys-634	150	20	,	,	PUNCT
bionys-634	150	21	2005	2005	NUM
bionys-634	150	22	)	)	PUNCT
bionys-634	150	23	.	.	PUNCT
bionys-634	151	1	in	in	ADP
bionys-634	151	2	another	another	DET
bionys-634	151	3	study	study	NOUN
bionys-634	151	4	,	,	PUNCT
bionys-634	151	5	100	100	NUM
bionys-634	151	6	food	food	NOUN
bionys-634	151	7	samples	sample	NOUN
bionys-634	151	8	were	be	AUX
bionys-634	151	9	randomly	randomly	ADV
bionys-634	151	10	collected	collect	VERB
bionys-634	151	11	from	from	ADP
bionys-634	151	12	turkish	turkish	ADJ
bionys-634	151	13	markets	market	NOUN
bionys-634	151	14	,	,	PUNCT
bionys-634	151	15	and	and	CCONJ
bionys-634	151	16	transgenic	transgenic	NOUN
bionys-634	151	17	soybeans	soybean	NOUN
bionys-634	151	18	and	and	CCONJ
bionys-634	151	19	corn	corn	NOUN
bionys-634	151	20	were	be	AUX
bionys-634	151	21	identified	identify	VERB
bionys-634	151	22	using	use	VERB
bionys-634	151	23	pcr	pcr	NOUN
bionys-634	151	24	;	;	PUNCT
bionys-634	151	25	25	25	NUM
bionys-634	151	26	%	%	NOUN
bionys-634	151	27	of	of	ADP
bionys-634	151	28	the	the	DET
bionys-634	151	29	samples	sample	NOUN
bionys-634	151	30	were	be	AUX
bionys-634	151	31	transgenic	transgenic	NOUN
bionys-634	151	32	(	(	PUNCT
bionys-634	151	33	arun	arun	PROPN
bionys-634	151	34	et	et	PROPN
bionys-634	151	35	al	al	PROPN
bionys-634	151	36	.	.	PROPN
bionys-634	151	37	,	,	PUNCT
bionys-634	151	38	2013	2013	NUM
bionys-634	151	39	)	)	PUNCT
bionys-634	151	40	.	.	PUNCT
bionys-634	152	1	ujhelyi	ujhelyi	PROPN
bionys-634	152	2	et	et	PROPN
bionys-634	152	3	al	al	PROPN
bionys-634	152	4	.	.	PROPN
bionys-634	152	5	(	(	PUNCT
bionys-634	152	6	2008	2008	NUM
bionys-634	152	7	)	)	PUNCT
bionys-634	152	8	reported	report	VERB
bionys-634	152	9	that	that	SCONJ
bionys-634	152	10	38	38	NUM
bionys-634	152	11	%	%	NOUN
bionys-634	152	12	of	of	ADP
bionys-634	152	13	random	random	ADJ
bionys-634	152	14	samples	sample	NOUN
bionys-634	152	15	collected	collect	VERB
bionys-634	152	16	in	in	ADP
bionys-634	152	17	hungary	hungary	PROPN
bionys-634	152	18	were	be	AUX
bionys-634	152	19	transgenic	transgenic	NOUN
bionys-634	152	20	and	and	CCONJ
bionys-634	152	21	that	that	SCONJ
bionys-634	152	22	7	7	NUM
bionys-634	152	23	out	out	ADP
bionys-634	152	24	of	of	ADP
bionys-634	152	25	80	80	NUM
bionys-634	152	26	foods	food	NOUN
bionys-634	152	27	contained	contain	VERB
bionys-634	152	28	rr	rr	PROPN
bionys-634	152	29	soy	soy	NOUN
bionys-634	152	30	.	.	PUNCT
bionys-634	153	1	however	however	ADV
bionys-634	153	2	,	,	PUNCT
bionys-634	153	3	they	they	PRON
bionys-634	153	4	did	do	AUX
bionys-634	153	5	not	not	PART
bionys-634	153	6	contain	contain	VERB
bionys-634	153	7	the	the	DET
bionys-634	153	8	nos	nos	X
bionys-634	153	9	terminator	terminator	NOUN
bionys-634	153	10	.	.	PUNCT
bionys-634	154	1	gurakan	gurakan	INTJ
bionys-634	154	2	et	et	PROPN
bionys-634	154	3	al	al	PROPN
bionys-634	154	4	.	.	PROPN
bionys-634	155	1	(	(	PUNCT
bionys-634	155	2	2011	2011	NUM
bionys-634	155	3	)	)	PUNCT
bionys-634	155	4	reported	report	VERB
bionys-634	155	5	that	that	SCONJ
bionys-634	155	6	the	the	DET
bionys-634	155	7	35s	35s	NUM
bionys-634	155	8	promoter	promoter	NOUN
bionys-634	155	9	was	be	AUX
bionys-634	155	10	present	present	ADJ
bionys-634	155	11	in	in	ADP
bionys-634	155	12	11	11	NUM
bionys-634	155	13	out	out	ADP
bionys-634	155	14	of	of	ADP
bionys-634	155	15	31	31	NUM
bionys-634	155	16	commercial	commercial	ADJ
bionys-634	155	17	turkish	turkish	ADJ
bionys-634	155	18	food	food	NOUN
bionys-634	155	19	products	product	NOUN
bionys-634	155	20	containing	contain	VERB
bionys-634	155	21	corn	corn	NOUN
bionys-634	155	22	.	.	PUNCT
bionys-634	156	1	conclusion	conclusion	NOUN
bionys-634	156	2	in	in	ADP
bionys-634	156	3	this	this	DET
bionys-634	156	4	study	study	NOUN
bionys-634	156	5	,	,	PUNCT
bionys-634	156	6	three	three	NUM
bionys-634	156	7	simple	simple	ADJ
bionys-634	156	8	and	and	CCONJ
bionys-634	156	9	cost	cost	NOUN
bionys-634	156	10	-	-	PUNCT
bionys-634	156	11	effective	effective	ADJ
bionys-634	156	12	methods	method	NOUN
bionys-634	156	13	were	be	AUX
bionys-634	156	14	used	use	VERB
bionys-634	156	15	to	to	PART
bionys-634	156	16	extract	extract	VERB
bionys-634	156	17	dna	dna	NOUN
bionys-634	156	18	from	from	ADP
bionys-634	156	19	maize	maize	NOUN
bionys-634	156	20	seeds	seed	NOUN
bionys-634	156	21	and	and	CCONJ
bionys-634	156	22	their	their	PRON
bionys-634	156	23	products	product	NOUN
bionys-634	156	24	.	.	PUNCT
bionys-634	157	1	subsequently	subsequently	ADV
bionys-634	157	2	,	,	PUNCT
bionys-634	157	3	pcr	pcr	PROPN
bionys-634	157	4	was	be	AUX
bionys-634	157	5	employed	employ	VERB
bionys-634	157	6	to	to	PART
bionys-634	157	7	screen	screen	VERB
bionys-634	157	8	for	for	ADP
bionys-634	157	9	genetically	genetically	ADV
bionys-634	157	10	modified	modify	VERB
bionys-634	157	11	organisms	organism	NOUN
bionys-634	157	12	(	(	PUNCT
bionys-634	157	13	gmos)derived	gmos)derive	VERB
bionys-634	157	14	products	product	NOUN
bionys-634	157	15	.	.	PUNCT
bionys-634	158	1	for	for	ADP
bionys-634	158	2	screening	screen	VERB
bionys-634	158	3	products	product	NOUN
bionys-634	158	4	derived	derive	VERB
bionys-634	158	5	from	from	ADP
bionys-634	158	6	gmos	gmos	PROPN
bionys-634	158	7	,	,	PUNCT
bionys-634	158	8	the	the	DET
bionys-634	158	9	pcr	pcr	ADJ
bionys-634	158	10	method	method	NOUN
bionys-634	158	11	was	be	AUX
bionys-634	158	12	used	use	VERB
bionys-634	158	13	.	.	PUNCT
bionys-634	159	1	the	the	DET
bionys-634	159	2	isolated	isolated	ADJ
bionys-634	159	3	dna	dna	NOUN
bionys-634	159	4	of	of	ADP
bionys-634	159	5	all	all	DET
bionys-634	159	6	samples	sample	NOUN
bionys-634	159	7	was	be	AUX
bionys-634	159	8	confirmed	confirm	VERB
bionys-634	159	9	by	by	ADP
bionys-634	159	10	the	the	DET
bionys-634	159	11	presence	presence	NOUN
bionys-634	159	12	of	of	ADP
bionys-634	159	13	the	the	DET
bionys-634	159	14	zein	zein	NOUN
bionys-634	159	15	gene	gene	NOUN
bionys-634	159	16	.	.	PUNCT
bionys-634	160	1	the	the	DET
bionys-634	160	2	35s	35s	NUM
bionys-634	160	3	promoter	promoter	NOUN
bionys-634	160	4	,	,	PUNCT
bionys-634	160	5	nos	nos	ADP
bionys-634	160	6	,	,	PUNCT
bionys-634	160	7	and	and	CCONJ
bionys-634	160	8	epsps	epsps	PROPN
bionys-634	160	9	were	be	AUX
bionys-634	160	10	found	find	VERB
bionys-634	160	11	in	in	ADP
bionys-634	160	12	a	a	DET
bionys-634	160	13	number	number	NOUN
bionys-634	160	14	of	of	ADP
bionys-634	160	15	samples	sample	NOUN
bionys-634	160	16	.	.	PUNCT
bionys-634	161	1	these	these	DET
bionys-634	161	2	results	result	NOUN
bionys-634	161	3	show	show	VERB
bionys-634	161	4	that	that	SCONJ
bionys-634	161	5	17	17	NUM
bionys-634	161	6	samples	sample	NOUN
bionys-634	161	7	(	(	PUNCT
bionys-634	161	8	57	57	NUM
bionys-634	161	9	%	%	NOUN
bionys-634	161	10	)	)	PUNCT
bionys-634	161	11	are	be	AUX
bionys-634	161	12	transgenic	transgenic	NOUN
bionys-634	161	13	,	,	PUNCT
bionys-634	161	14	which	which	PRON
bionys-634	161	15	is	be	AUX
bionys-634	161	16	consistent	consistent	ADJ
bionys-634	161	17	with	with	ADP
bionys-634	161	18	the	the	DET
bionys-634	161	19	fact	fact	NOUN
bionys-634	161	20	that	that	SCONJ
bionys-634	161	21	iran	iran	PROPN
bionys-634	161	22	imports	import	VERB
bionys-634	161	23	the	the	DET
bionys-634	161	24	majority	majority	NOUN
bionys-634	161	25	of	of	ADP
bionys-634	161	26	its	its	PRON
bionys-634	161	27	corn	corn	NOUN
bionys-634	161	28	from	from	ADP
bionys-634	161	29	countries	country	NOUN
bionys-634	161	30	cultivating	cultivate	VERB
bionys-634	161	31	genetically	genetically	ADV
bionys-634	161	32	modified	modify	VERB
bionys-634	161	33	corn	corn	NOUN
bionys-634	161	34	.	.	PUNCT
bionys-634	162	1	therefore	therefore	ADV
bionys-634	162	2	,	,	PUNCT
bionys-634	162	3	the	the	DET
bionys-634	162	4	detection	detection	NOUN
bionys-634	162	5	and	and	CCONJ
bionys-634	162	6	labeling	labeling	NOUN
bionys-634	162	7	of	of	ADP
bionys-634	162	8	these	these	DET
bionys-634	162	9	products	product	NOUN
bionys-634	162	10	is	be	AUX
bionys-634	162	11	one	one	NUM
bionys-634	162	12	of	of	ADP
bionys-634	162	13	the	the	DET
bionys-634	162	14	demands	demand	NOUN
bionys-634	162	15	of	of	ADP
bionys-634	162	16	consumers	consumer	NOUN
bionys-634	162	17	regarding	regard	VERB
bionys-634	162	18	food	food	NOUN
bionys-634	162	19	safety	safety	NOUN
bionys-634	162	20	and	and	CCONJ
bionys-634	162	21	quality	quality	NOUN
bionys-634	162	22	.	.	PUNCT
bionys-634	163	1	funding	funding	NOUN
bionys-634	163	2	.	.	PUNCT
bionys-634	164	1	this	this	DET
bionys-634	164	2	work	work	NOUN
bionys-634	164	3	was	be	AUX
bionys-634	164	4	supported	support	VERB
bionys-634	164	5	by	by	ADP
bionys-634	164	6	the	the	DET
bionys-634	164	7	shiraz	shiraz	PROPN
bionys-634	164	8	university	university	PROPN
bionys-634	164	9	of	of	ADP
bionys-634	164	10	medical	medical	ADJ
bionys-634	164	11	sciences	science	NOUN
bionys-634	164	12	.	.	PUNCT
bionys-634	165	1	(	(	PUNCT
bionys-634	165	2	project	project	VERB
bionys-634	165	3	no	no	PRON
bionys-634	165	4	:	:	PUNCT
bionys-634	165	5	24647	24647	NUM
bionys-634	165	6	)	)	PUNCT
bionys-634	166	1	biologica	biologica	PROPN
bionys-634	166	2	nyssana	nyssana	PROPN
bionys-634	167	1	●	●	PUNCT
bionys-634	167	2	16	16	NUM
bionys-634	167	3	(	(	PUNCT
bionys-634	167	4	2	2	NUM
bionys-634	167	5	)	)	PUNCT
bionys-634	167	6	december	december	PROPN
bionys-634	167	7	2025	2025	NUM
bionys-634	167	8	:	:	PUNCT
bionys-634	167	9	ashrafi	ashrafi	PROPN
bionys-634	167	10	-	-	PUNCT
bionys-634	167	11	dehkordi	dehkordi	PROPN
bionys-634	167	12	et	et	PROPN
bionys-634	167	13	al	al	PROPN
bionys-634	167	14	.	.	PUNCT
bionys-634	167	15	●	●	PUNCT
bionys-634	167	16	pcr	pcr	NOUN
bionys-634	167	17	-	-	PUNCT
bionys-634	167	18	based	base	VERB
bionys-634	167	19	investigation	investigation	NOUN
bionys-634	167	20	on	on	ADP
bionys-634	167	21	transgenic	transgenic	NOUN
bionys-634	167	22	maize	maize	NOUN
bionys-634	167	23	status	status	NOUN
bionys-634	167	24	in	in	ADP
bionys-634	167	25	corn	corn	NOUN
bionys-634	167	26	processed	process	VERB
bionys-634	167	27	products	product	NOUN
bionys-634	167	28	sample	sample	NOUN
bionys-634	167	29	code	code	NOUN
bionys-634	167	30	pro1	pro1	PROPN
bionys-634	167	31	nos	nos	PROPN
bionys-634	167	32	gmo	gmo	PROPN
bionys-634	167	33	1	1	NUM
bionys-634	167	34	û	û	NOUN
bionys-634	167	35	ü	ü	NOUN
bionys-634	167	36	û	û	NOUN
bionys-634	167	37	2	2	NUM
bionys-634	167	38	ü	ü	NOUN
bionys-634	167	39	û	û	NOUN
bionys-634	167	40	û	û	NOUN
bionys-634	167	41	3	3	NUM
bionys-634	167	42	û	û	NOUN
bionys-634	167	43	û	û	NOUN
bionys-634	167	44	û	û	NOUN
bionys-634	167	45	4	4	NUM
bionys-634	167	46	û	û	NUM
bionys-634	167	47	û	û	NOUN
bionys-634	167	48	û	û	NOUN
bionys-634	167	49	5	5	NUM
bionys-634	167	50	û	û	NUM
bionys-634	167	51	û	û	NOUN
bionys-634	167	52	û	û	NOUN
bionys-634	167	53	6	6	NUM
bionys-634	167	54	û	û	NOUN
bionys-634	167	55	û	û	NOUN
bionys-634	167	56	û	û	NOUN
bionys-634	167	57	7	7	NUM
bionys-634	167	58	û	û	SYM
bionys-634	167	59	ü	ü	NOUN
bionys-634	167	60	û	û	NOUN
bionys-634	167	61	8	8	NUM
bionys-634	167	62	ü	ü	NOUN
bionys-634	167	63	ü	ü	NOUN
bionys-634	167	64	û	û	NOUN
bionys-634	168	1	9	9	NUM
bionys-634	168	2	û	û	NUM
bionys-634	168	3	û	û	NUM
bionys-634	168	4	û	û	NOUN
bionys-634	168	5	10	10	NUM
bionys-634	168	6	û	û	NOUN
bionys-634	168	7	ü	ü	NOUN
bionys-634	168	8	û	û	NOUN
bionys-634	168	9	11	11	NUM
bionys-634	168	10	û	û	SYM
bionys-634	168	11	ü	ü	NOUN
bionys-634	168	12	û	û	NOUN
bionys-634	168	13	12	12	NUM
bionys-634	168	14	û	û	NUM
bionys-634	168	15	û	û	NOUN
bionys-634	168	16	û	û	NOUN
bionys-634	168	17	13	13	NUM
bionys-634	169	1	ü	ü	NOUN
bionys-634	169	2	û	û	NOUN
bionys-634	169	3	û	û	NOUN
bionys-634	169	4	14	14	NUM
bionys-634	169	5	ü	ü	NOUN
bionys-634	169	6	ü	ü	NOUN
bionys-634	170	1	ü	ü	NOUN
bionys-634	170	2	15	15	NUM
bionys-634	170	3	ü	ü	NOUN
bionys-634	170	4	ü	ü	NOUN
bionys-634	170	5	û	û	NOUN
bionys-634	170	6	16	16	NUM
bionys-634	171	1	ü	ü	NOUN
bionys-634	171	2	û	û	NOUN
bionys-634	171	3	û	û	NOUN
bionys-634	171	4	17	17	NUM
bionys-634	171	5	ü	ü	NOUN
bionys-634	171	6	ü	ü	NOUN
bionys-634	171	7	û	û	NOUN
bionys-634	171	8	18	18	NUM
bionys-634	171	9	ü	ü	NOUN
bionys-634	171	10	ü	ü	NOUN
bionys-634	171	11	û	û	NOUN
bionys-634	171	12	19	19	NUM
bionys-634	171	13	ü	ü	NOUN
bionys-634	171	14	ü	ü	NOUN
bionys-634	171	15	û	û	NOUN
bionys-634	171	16	20	20	NUM
bionys-634	171	17	ü	ü	NOUN
bionys-634	171	18	ü	ü	NOUN
bionys-634	171	19	û	û	NOUN
bionys-634	171	20	21	21	NUM
bionys-634	171	21	ü	ü	NOUN
bionys-634	171	22	ü	ü	NOUN
bionys-634	171	23	û	û	NOUN
bionys-634	171	24	22	22	NUM
bionys-634	171	25	ü	ü	NOUN
bionys-634	171	26	ü	ü	NOUN
bionys-634	171	27	û	û	NOUN
bionys-634	171	28	23	23	NUM
bionys-634	171	29	û	û	NUM
bionys-634	171	30	û	û	NOUN
bionys-634	171	31	û	û	NOUN
bionys-634	171	32	24	24	NUM
bionys-634	171	33	û	û	NUM
bionys-634	171	34	û	û	NOUN
bionys-634	171	35	û	û	NOUN
bionys-634	171	36	25	25	NUM
bionys-634	171	37	û	û	NUM
bionys-634	171	38	û	û	NOUN
bionys-634	171	39	û	û	NOUN
bionys-634	171	40	26	26	NUM
bionys-634	171	41	û	û	NUM
bionys-634	171	42	û	û	NOUN
bionys-634	171	43	û	û	NOUN
bionys-634	171	44	27	27	NUM
bionys-634	171	45	û	û	NOUN
bionys-634	171	46	û	û	NOUN
bionys-634	171	47	û	û	NOUN
bionys-634	171	48	28	28	NUM
bionys-634	171	49	ü	ü	NOUN
bionys-634	171	50	ü	ü	NOUN
bionys-634	171	51	û	û	NOUN
bionys-634	171	52	29	29	NUM
bionys-634	171	53	û	û	NUM
bionys-634	171	54	û	û	NUM
bionys-634	171	55	û	û	NOUN
bionys-634	171	56	30	30	NUM
bionys-634	171	57	û	û	NUM
bionys-634	171	58	û	û	NUM
bionys-634	171	59	û	û	NOUN
bionys-634	171	60	table	table	NOUN
bionys-634	171	61	5	5	NUM
bionys-634	171	62	.	.	PUNCT
bionys-634	172	1	summary	summary	NOUN
bionys-634	172	2	of	of	ADP
bionys-634	172	3	positive	positive	ADJ
bionys-634	172	4	pcr	pcr	ADJ
bionys-634	172	5	detection	detection	NOUN
bionys-634	172	6	of	of	ADP
bionys-634	172	7	target	target	NOUN
bionys-634	172	8	in	in	ADP
bionys-634	172	9	individual	individual	ADJ
bionys-634	172	10	corn	corn	NOUN
bionys-634	172	11	samples	sample	NOUN
bionys-634	172	12	these	these	DET
bionys-634	172	13	results	result	NOUN
bionys-634	172	14	are	be	AUX
bionys-634	172	15	consistent	consistent	ADJ
bionys-634	172	16	with	with	ADP
bionys-634	172	17	findings	finding	NOUN
bionys-634	172	18	by	by	ADP
bionys-634	172	19	peano	peano	PROPN
bionys-634	172	20	et	et	PROPN
bionys-634	172	21	al	al	PROPN
bionys-634	172	22	.	.	PROPN
bionys-634	173	1	(	(	PUNCT
bionys-634	173	2	2004	2004	NUM
bionys-634	173	3	)	)	PUNCT
bionys-634	173	4	,	,	PUNCT
bionys-634	173	5	who	who	PRON
bionys-634	173	6	reported	report	VERB
bionys-634	173	7	that	that	SCONJ
bionys-634	173	8	dna	dna	PROPN
bionys-634	173	9	yield	yield	NOUN
bionys-634	173	10	and	and	CCONJ
bionys-634	173	11	integrity	integrity	NOUN
bionys-634	173	12	varied	vary	VERB
bionys-634	173	13	widely	widely	ADV
bionys-634	173	14	depending	depend	VERB
bionys-634	173	15	on	on	ADP
bionys-634	173	16	the	the	DET
bionys-634	173	17	extraction	extraction	NOUN
bionys-634	173	18	method	method	NOUN
bionys-634	173	19	and	and	CCONJ
bionys-634	173	20	the	the	DET
bionys-634	173	21	complexity	complexity	NOUN
bionys-634	173	22	of	of	ADP
bionys-634	173	23	the	the	DET
bionys-634	173	24	food	food	NOUN
bionys-634	173	25	matrix	matrix	NOUN
bionys-634	173	26	.	.	PUNCT
bionys-634	174	1	in	in	ADP
bionys-634	174	2	their	their	PRON
bionys-634	174	3	study	study	NOUN
bionys-634	174	4	,	,	PUNCT
bionys-634	174	5	the	the	DET
bionys-634	174	6	nucleospin	nucleospin	NOUN
bionys-634	174	7	food	food	NOUN
bionys-634	174	8	kit	kit	NOUN
bionys-634	174	9	was	be	AUX
bionys-634	174	10	most	most	ADV
bionys-634	174	11	effective	effective	ADJ
bionys-634	174	12	in	in	ADP
bionys-634	174	13	extracting	extract	VERB
bionys-634	174	14	dna	dna	NOUN
bionys-634	174	15	from	from	ADP
bionys-634	174	16	complex	complex	ADJ
bionys-634	174	17	matrices	matrix	NOUN
bionys-634	174	18	,	,	PUNCT
bionys-634	174	19	while	while	SCONJ
bionys-634	174	20	wizard	wizard	ADJ
bionys-634	174	21	and	and	CCONJ
bionys-634	174	22	qiaamp	qiaamp	PROPN
bionys-634	174	23	kits	kit	NOUN
bionys-634	174	24	performed	perform	VERB
bionys-634	174	25	better	well	ADV
bionys-634	174	26	for	for	ADP
bionys-634	174	27	simple	simple	ADJ
bionys-634	174	28	matrices	matrix	NOUN
bionys-634	174	29	like	like	ADP
bionys-634	174	30	flours	flour	NOUN
bionys-634	174	31	.	.	PUNCT
bionys-634	175	1	similarly	similarly	ADV
bionys-634	175	2	,	,	PUNCT
bionys-634	175	3	vijayakumar	vijayakumar	PROPN
bionys-634	175	4	et	et	PROPN
bionys-634	175	5	al	al	PROPN
bionys-634	175	6	.	.	PROPN
bionys-634	176	1	(	(	PUNCT
bionys-634	176	2	2009	2009	NUM
bionys-634	176	3	)	)	PUNCT
bionys-634	176	4	demonstrated	demonstrate	VERB
bionys-634	176	5	biologica	biologica	PROPN
bionys-634	176	6	nyssana	nyssana	PROPN
bionys-634	177	1	●	●	PUNCT
bionys-634	177	2	16	16	NUM
bionys-634	177	3	(	(	PUNCT
bionys-634	177	4	2	2	NUM
bionys-634	177	5	)	)	PUNCT
bionys-634	177	6	december	december	PROPN
bionys-634	177	7	2025	2025	NUM
bionys-634	177	8	:	:	PUNCT
bionys-634	177	9	ashrafi	ashrafi	PROPN
bionys-634	177	10	-	-	PUNCT
bionys-634	177	11	dehkordi	dehkordi	PROPN
bionys-634	177	12	et	et	PROPN
bionys-634	177	13	al	al	PROPN
bionys-634	177	14	.	.	PUNCT
bionys-634	177	15	●	●	PUNCT
bionys-634	177	16	pcr	pcr	NOUN
bionys-634	177	17	-	-	PUNCT
bionys-634	177	18	based	base	VERB
bionys-634	177	19	investigation	investigation	NOUN
bionys-634	177	20	on	on	ADP
bionys-634	177	21	transgenic	transgenic	NOUN
bionys-634	177	22	maize	maize	NOUN
bionys-634	177	23	status	status	NOUN
bionys-634	177	24	in	in	ADP
bionys-634	177	25	corn	corn	NOUN
bionys-634	177	26	processed	process	VERB
bionys-634	177	27	products	product	NOUN
bionys-634	177	28	fig	fig	NOUN
bionys-634	177	29	.	.	PUNCT
bionys-634	178	1	2	2	X
bionys-634	178	2	.	.	X
bionys-634	178	3	representative	representative	NOUN
bionys-634	178	4	agarose	agarose	NOUN
bionys-634	178	5	gel	gel	NOUN
bionys-634	178	6	electrophoresis	electrophoresis	NOUN
bionys-634	178	7	of	of	ADP
bionys-634	178	8	maize	maize	NOUN
bionys-634	178	9	pcr	pcr	ADJ
bionys-634	178	10	products	product	NOUN
bionys-634	178	11	:	:	PUNCT
bionys-634	178	12	ladder	ladder	NOUN
bionys-634	178	13	:	:	PUNCT
bionys-634	178	14	100	100	NUM
bionys-634	178	15	bp	bp	PROPN
bionys-634	178	16	dna	dna	PROPN
bionys-634	178	17	ladder	ladder	NOUN
bionys-634	178	18	,	,	PUNCT
bionys-634	178	19	-	-	PUNCT
bionys-634	178	20	:	:	PUNCT
bionys-634	178	21	negative	negative	ADJ
bionys-634	178	22	control,+	control,+	NOUN
bionys-634	178	23	:	:	PUNCT
bionys-634	178	24	positive	positive	ADJ
bionys-634	178	25	control	control	NOUN
bionys-634	178	26	,	,	PUNCT
bionys-634	178	27	lane	lane	NOUN
bionys-634	178	28	1	1	NUM
bionys-634	178	29	-	-	SYM
bionys-634	178	30	13	13	NUM
bionys-634	178	31	:	:	PUNCT
bionys-634	178	32	corn	corn	NOUN
bionys-634	178	33	nut	nut	NOUN
bionys-634	178	34	,	,	PUNCT
bionys-634	178	35	lanes	lane	VERB
bionys-634	178	36	14	14	NUM
bionys-634	178	37	-	-	SYM
bionys-634	178	38	17	17	NUM
bionys-634	178	39	:	:	PUNCT
bionys-634	178	40	canned	can	VERB
bionys-634	178	41	corn	corn	NOUN
bionys-634	178	42	,	,	PUNCT
bionys-634	178	43	lane	lane	NOUN
bionys-634	178	44	18	18	NUM
bionys-634	178	45	-	-	SYM
bionys-634	178	46	20	20	NUM
bionys-634	178	47	:	:	PUNCT
bionys-634	178	48	raw	raw	ADJ
bionys-634	178	49	corn	corn	NOUN
bionys-634	178	50	,	,	PUNCT
bionys-634	178	51	lane	lane	NOUN
bionys-634	178	52	21	21	NUM
bionys-634	178	53	-	-	SYM
bionys-634	178	54	22	22	NUM
bionys-634	178	55	:	:	PUNCT
bionys-634	178	56	corn	corn	NOUN
bionys-634	178	57	flour	flour	NOUN
bionys-634	178	58	,	,	PUNCT
bionys-634	178	59	lane	lane	NOUN
bionys-634	178	60	23	23	NUM
bionys-634	178	61	-	-	SYM
bionys-634	178	62	25	25	NUM
bionys-634	178	63	:	:	PUNCT
bionys-634	178	64	popcorn	popcorn	NOUN
bionys-634	178	65	,	,	PUNCT
bionys-634	178	66	lane	lane	NOUN
bionys-634	178	67	26	26	NUM
bionys-634	178	68	-	-	SYM
bionys-634	178	69	28	28	NUM
bionys-634	178	70	:	:	PUNCT
bionys-634	178	71	corn	corn	NOUN
bionys-634	178	72	puff	puff	NOUN
bionys-634	178	73	,	,	PUNCT
bionys-634	178	74	lane	lane	NOUN
bionys-634	178	75	29	29	NUM
bionys-634	178	76	-	-	SYM
bionys-634	178	77	30	30	NUM
bionys-634	178	78	:	:	PUNCT
bionys-634	178	79	corn	corn	NOUN
bionys-634	178	80	starch	starch	NOUN
bionys-634	178	81	.	.	PUNCT
bionys-634	179	1	a	a	DET
bionys-634	179	2	band	band	NOUN
bionys-634	179	3	of	of	ADP
bionys-634	179	4	118	118	NUM
bionys-634	179	5	bp	bp	PROPN
bionys-634	179	6	for	for	ADP
bionys-634	179	7	nos	nos	X
bionys-634	179	8	(	(	PUNCT
bionys-634	179	9	fig	fig	NOUN
bionys-634	179	10	.	.	PUNCT
bionys-634	179	11	2a	2a	NUM
bionys-634	179	12	)	)	PUNCT
bionys-634	179	13	,	,	PUNCT
bionys-634	179	14	a	a	DET
bionys-634	179	15	band	band	NOUN
bionys-634	179	16	of	of	ADP
bionys-634	179	17	195	195	NUM
bionys-634	179	18	bp	bp	NOUN
bionys-634	179	19	for	for	ADP
bionys-634	179	20	p35s	p35s	PROPN
bionys-634	179	21	(	(	PUNCT
bionys-634	179	22	fig	fig	NOUN
bionys-634	179	23	.	.	PUNCT
bionys-634	179	24	2b	2b	NUM
bionys-634	179	25	)	)	PUNCT
bionys-634	179	26	,	,	PUNCT
bionys-634	179	27	and	and	CCONJ
bionys-634	179	28	a	a	DET
bionys-634	179	29	band	band	NOUN
bionys-634	179	30	of	of	ADP
bionys-634	179	31	169	169	NUM
bionys-634	179	32	bp	bp	NOUN
bionys-634	179	33	for	for	ADP
bionys-634	179	34	the	the	DET
bionys-634	179	35	epsps	epsps	ADJ
bionys-634	179	36	gene	gene	NOUN
bionys-634	179	37	(	(	PUNCT
bionys-634	179	38	fig	fig	NOUN
bionys-634	179	39	.	.	PUNCT
bionys-634	180	1	2c	2c	NUM
bionys-634	180	2	)	)	PUNCT
bionys-634	180	3	references	reference	NOUN
bionys-634	180	4	anklam	anklam	PROPN
bionys-634	180	5	,	,	PUNCT
bionys-634	180	6	e.	e.	PROPN
bionys-634	180	7	,	,	PUNCT
bionys-634	180	8	gadani	gadani	PROPN
bionys-634	180	9	,	,	PUNCT
bionys-634	180	10	f.	f.	PROPN
bionys-634	180	11	,	,	PUNCT
bionys-634	180	12	heinze	heinze	PROPN
bionys-634	180	13	,	,	PUNCT
bionys-634	180	14	p.	p.	PROPN
bionys-634	180	15	,	,	PUNCT
bionys-634	180	16	pijnenburg	pijnenburg	PROPN
bionys-634	180	17	,	,	PUNCT
bionys-634	180	18	h.	h.	PROPN
bionys-634	180	19	,	,	PUNCT
bionys-634	180	20	&	&	CCONJ
bionys-634	180	21	van	van	PROPN
bionys-634	180	22	den	den	PROPN
bionys-634	180	23	eede	eede	PROPN
bionys-634	180	24	,	,	PUNCT
bionys-634	180	25	g.	g.	PROPN
bionys-634	180	26	(	(	PUNCT
bionys-634	180	27	2002	2002	NUM
bionys-634	180	28	)	)	PUNCT
bionys-634	180	29	.	.	PUNCT
bionys-634	181	1	analytical	analytical	ADJ
bionys-634	181	2	methods	method	NOUN
bionys-634	181	3	for	for	ADP
bionys-634	181	4	detection	detection	NOUN
bionys-634	181	5	and	and	CCONJ
bionys-634	181	6	determination	determination	NOUN
bionys-634	181	7	of	of	ADP
bionys-634	181	8	genetically	genetically	ADV
bionys-634	181	9	modified	modify	VERB
bionys-634	181	10	organisms	organism	NOUN
bionys-634	181	11	in	in	ADP
bionys-634	181	12	agricultural	agricultural	ADJ
bionys-634	181	13	crops	crop	NOUN
bionys-634	181	14	and	and	CCONJ
bionys-634	181	15	plant	plant	NOUN
bionys-634	181	16	-	-	PUNCT
bionys-634	181	17	derived	derive	VERB
bionys-634	181	18	food	food	NOUN
bionys-634	181	19	products	product	NOUN
bionys-634	181	20	.	.	PUNCT
bionys-634	182	1	european	european	ADJ
bionys-634	182	2	food	food	PROPN
bionys-634	182	3	research	research	NOUN
bionys-634	182	4	and	and	CCONJ
bionys-634	182	5	technology	technology	NOUN
bionys-634	182	6	,	,	PUNCT
bionys-634	182	7	214(1	214(1	NUM
bionys-634	182	8	)	)	PUNCT
bionys-634	182	9	,	,	PUNCT
bionys-634	182	10	3–26.https://doi.org/10.1007	3–26.https://doi.org/10.1007	NUM
bionys-634	182	11	/	/	SYM
bionys-634	182	12	s002170100415	s002170100415	NOUN
bionys-634	182	13	arun	arun	ADJ
bionys-634	182	14	,	,	PUNCT
bionys-634	182	15	ö.	ö.	PROPN
bionys-634	182	16	ö.	ö.	PROPN
bionys-634	182	17	,	,	PUNCT
bionys-634	182	18	yılmaz	yılmaz	PROPN
bionys-634	182	19	,	,	PUNCT
bionys-634	182	20	f.	f.	PROPN
bionys-634	182	21	,	,	PUNCT
bionys-634	182	22	&	&	CCONJ
bionys-634	182	23	muratoğlu	muratoğlu	PROPN
bionys-634	182	24	,	,	PUNCT
bionys-634	182	25	k.	k.	PROPN
bionys-634	182	26	j.	j.	PROPN
bionys-634	182	27	(	(	PUNCT
bionys-634	182	28	2013	2013	NUM
bionys-634	182	29	)	)	PUNCT
bionys-634	182	30	.	.	PUNCT
bionys-634	183	1	pcr	pcr	ADJ
bionys-634	183	2	detection	detection	NOUN
bionys-634	183	3	of	of	ADP
bionys-634	183	4	genetically	genetically	ADV
bionys-634	183	5	modified	modify	VERB
bionys-634	183	6	maize	maize	NOUN
bionys-634	183	7	and	and	CCONJ
bionys-634	183	8	soy	soy	NOUN
bionys-634	183	9	in	in	ADP
bionys-634	183	10	mildly	mildly	ADV
bionys-634	183	11	and	and	CCONJ
bionys-634	183	12	highly	highly	ADV
bionys-634	183	13	processed	process	VERB
bionys-634	183	14	foods	food	NOUN
bionys-634	183	15	.	.	PUNCT
bionys-634	184	1	food	food	NOUN
bionys-634	184	2	control	control	NOUN
bionys-634	184	3	,	,	PUNCT
bionys-634	184	4	32(2	32(2	NUM
bionys-634	184	5	)	)	PUNCT
bionys-634	184	6	,	,	PUNCT
bionys-634	184	7	525–531	525–531	NUM
bionys-634	184	8	https://doi.org/10.1016/j.foodcont.2013.01.023	https://doi.org/10.1016/j.foodcont.2013.01.023	NOUN
bionys-634	184	9	ashrafi	ashrafi	NOUN
bionys-634	184	10	-	-	PUNCT
bionys-634	184	11	dehkordi	dehkordi	NOUN
bionys-634	184	12	,	,	PUNCT
bionys-634	184	13	e.	e.	PROPN
bionys-634	184	14	,	,	PUNCT
bionys-634	184	15	derakhshanfar	derakhshanfar	PROPN
bionys-634	184	16	,	,	PUNCT
bionys-634	184	17	a.	a.	NOUN
bionys-634	184	18	,	,	PUNCT
bionys-634	184	19	alborzi	alborzi	NOUN
bionys-634	184	20	,	,	PUNCT
bionys-634	184	21	a.	a.	NOUN
bionys-634	184	22	,	,	PUNCT
bionys-634	184	23	pouladfar	pouladfar	ADV
bionys-634	184	24	,	,	PUNCT
bionys-634	184	25	g.	g.	PROPN
bionys-634	184	26	r.	r.	PROPN
bionys-634	184	27	,	,	PUNCT
bionys-634	184	28	babajafari	babajafari	PROPN
bionys-634	184	29	,	,	PUNCT
bionys-634	184	30	s.	s.	PROPN
bionys-634	184	31	,	,	PUNCT
bionys-634	184	32	kian	kian	PROPN
bionys-634	184	33	,	,	PUNCT
bionys-634	184	34	m.	m.	NOUN
bionys-634	184	35	,	,	PUNCT
bionys-634	184	36	darya	darya	PROPN
bionys-634	184	37	,	,	PUNCT
bionys-634	184	38	g.	g.	PROPN
bionys-634	184	39	h.	h.	PROPN
bionys-634	184	40	,	,	PUNCT
bionys-634	184	41	foladi	foladi	PROPN
bionys-634	184	42	,	,	PUNCT
bionys-634	184	43	z.	z.	PROPN
bionys-634	184	44	,	,	PUNCT
bionys-634	184	45	&	&	CCONJ
bionys-634	184	46	mazloomi	mazloomi	PROPN
bionys-634	184	47	,	,	PUNCT
bionys-634	184	48	s.	s.	PROPN
bionys-634	184	49	m.	m.	PROPN
bionys-634	184	50	(	(	PUNCT
bionys-634	184	51	2022	2022	NUM
bionys-634	184	52	)	)	PUNCT
bionys-634	184	53	.	.	PUNCT
bionys-634	185	1	the	the	DET
bionys-634	185	2	effect	effect	NOUN
bionys-634	185	3	of	of	ADP
bionys-634	185	4	feeding	feed	VERB
bionys-634	185	5	genetically	genetically	ADV
bionys-634	185	6	modified	modify	VERB
bionys-634	185	7	soybean	soybean	NOUN
bionys-634	185	8	on	on	ADP
bionys-634	185	9	histopathology	histopathology	NOUN
bionys-634	185	10	of	of	ADP
bionys-634	185	11	organs	organ	NOUN
bionys-634	185	12	in	in	ADP
bionys-634	185	13	sprague	sprague	NOUN
bionys-634	185	14	–	–	PUNCT
bionys-634	185	15	dawley	dawley	NOUN
bionys-634	185	16	rats	rat	NOUN
bionys-634	185	17	.	.	PUNCT
bionys-634	186	1	international	international	ADJ
bionys-634	186	2	journal	journal	PROPN
bionys-634	186	3	of	of	ADP
bionys-634	186	4	nutrition	nutrition	NOUN
bionys-634	186	5	sciences	science	NOUN
bionys-634	186	6	,	,	PUNCT
bionys-634	186	7	7(3	7(3	NUM
bionys-634	186	8	)	)	PUNCT
bionys-634	186	9	,	,	PUNCT
bionys-634	186	10	171–178	171–178	NUM
bionys-634	186	11	.	.	PUNCT
bionys-634	187	1	https://doi.org/10.30476/	https://doi.org/10.30476/	PROPN
bionys-634	187	2	ijns.2022.96866.1203	ijns.2022.96866.1203	ADJ
bionys-634	187	3	ashrafi	ashrafi	ADJ
bionys-634	187	4	-	-	PUNCT
bionys-634	187	5	dehkordi	dehkordi	NOUN
bionys-634	187	6	,	,	PUNCT
bionys-634	187	7	e.	e.	PROPN
bionys-634	187	8	,	,	PUNCT
bionys-634	187	9	alemzadeh	alemzadeh	PROPN
bionys-634	187	10	,	,	PUNCT
bionys-634	187	11	a.	a.	PROPN
bionys-634	187	12	,	,	PUNCT
bionys-634	187	13	tanaka	tanaka	PROPN
bionys-634	187	14	,	,	PUNCT
bionys-634	187	15	n.	n.	PROPN
bionys-634	187	16	,	,	PUNCT
bionys-634	187	17	&	&	CCONJ
bionys-634	187	18	razi	razi	PROPN
bionys-634	187	19	,	,	PUNCT
bionys-634	187	20	h.	h.	PROPN
bionys-634	187	21	(	(	PUNCT
bionys-634	187	22	2021	2021	NUM
bionys-634	187	23	)	)	PUNCT
bionys-634	187	24	.	.	PUNCT
bionys-634	188	1	effects	effect	NOUN
bionys-634	188	2	of	of	ADP
bionys-634	188	3	vacuum	vacuum	NOUN
bionys-634	188	4	infiltration	infiltration	NOUN
bionys-634	188	5	,	,	PUNCT
bionys-634	188	6	agrobacterium	agrobacterium	NOUN
bionys-634	188	7	cell	cell	NOUN
bionys-634	188	8	density	density	NOUN
bionys-634	188	9	and	and	CCONJ
bionys-634	188	10	acetosyringone	acetosyringone	NOUN
bionys-634	188	11	concentration	concentration	NOUN
bionys-634	188	12	on	on	ADP
bionys-634	188	13	agrobacterium	agrobacterium	NOUN
bionys-634	188	14	-	-	PUNCT
bionys-634	188	15	mediated	mediate	VERB
bionys-634	188	16	transformation	transformation	NOUN
bionys-634	188	17	of	of	ADP
bionys-634	188	18	bread	bread	NOUN
bionys-634	188	19	wheat	wheat	NOUN
bionys-634	188	20	.	.	PUNCT
bionys-634	189	1	journal	journal	NOUN
bionys-634	189	2	of	of	ADP
bionys-634	189	3	consumer	consumer	NOUN
bionys-634	189	4	protection	protection	NOUN
bionys-634	189	5	and	and	CCONJ
bionys-634	189	6	food	food	NOUN
bionys-634	189	7	safety	safety	NOUN
bionys-634	189	8	,	,	PUNCT
bionys-634	189	9	16(1	16(1	NUM
bionys-634	189	10	)	)	PUNCT
bionys-634	189	11	,	,	PUNCT
bionys-634	189	12	59–69	59–69	NUM
bionys-634	189	13	.	.	PUNCT
bionys-634	190	1	https://	https://	PROPN
bionys-634	190	2	doi.org/10.1007/s00003-020-01312-y	doi.org/10.1007/s00003-020-01312-y	NUM
bionys-634	190	3	cardarelli	cardarelli	PROPN
bionys-634	190	4	,	,	PUNCT
bionys-634	190	5	p.	p.	NOUN
bionys-634	190	6	,	,	PUNCT
bionys-634	190	7	branquinho	branquinho	NOUN
bionys-634	190	8	,	,	PUNCT
bionys-634	190	9	m.	m.	PROPN
bionys-634	190	10	r.	r.	PROPN
bionys-634	190	11	,	,	PUNCT
bionys-634	190	12	ferreira	ferreira	PROPN
bionys-634	190	13	,	,	PUNCT
bionys-634	190	14	r.	r.	PROPN
bionys-634	190	15	t.	t.	PROPN
bionys-634	190	16	,	,	PUNCT
bionys-634	190	17	da	da	PROPN
bionys-634	190	18	cruz	cruz	PROPN
bionys-634	190	19	,	,	PUNCT
bionys-634	190	20	f.	f.	PROPN
bionys-634	190	21	p.	p.	PROPN
bionys-634	190	22	,	,	PUNCT
bionys-634	190	23	&	&	CCONJ
bionys-634	190	24	gemal	gemal	ADJ
bionys-634	190	25	,	,	PUNCT
bionys-634	190	26	a.	a.	NOUN
bionys-634	190	27	l.	l.	PROPN
bionys-634	190	28	(	(	PUNCT
bionys-634	190	29	2005	2005	NUM
bionys-634	190	30	)	)	PUNCT
bionys-634	190	31	.	.	PUNCT
bionys-634	191	1	detection	detection	NOUN
bionys-634	191	2	of	of	ADP
bionys-634	191	3	gmo	gmo	PROPN
bionys-634	191	4	in	in	ADP
bionys-634	191	5	food	food	NOUN
bionys-634	191	6	products	product	NOUN
bionys-634	191	7	in	in	ADP
bionys-634	191	8	brazil	brazil	PROPN
bionys-634	191	9	:	:	PUNCT
bionys-634	191	10	the	the	DET
bionys-634	191	11	incqs	incqs	NOUN
bionys-634	191	12	experience	experience	NOUN
bionys-634	191	13	.	.	PUNCT
bionys-634	192	1	food	food	NOUN
bionys-634	192	2	control	control	NOUN
bionys-634	192	3	,	,	PUNCT
bionys-634	192	4	16(10	16(10	NOUN
bionys-634	192	5	)	)	PUNCT
bionys-634	192	6	,	,	PUNCT
bionys-634	192	7	859–866	859–866	NUM
bionys-634	192	8	.	.	PUNCT
bionys-634	193	1	https://doi.org/10.1016/j.foodcont.2004.07.010	https://doi.org/10.1016/j.foodcont.2004.07.010	PROPN
bionys-634	193	2	chaouachi	chaouachi	PROPN
bionys-634	193	3	,	,	PUNCT
bionys-634	193	4	m.	m.	NOUN
bionys-634	193	5	,	,	PUNCT
bionys-634	193	6	el	el	PROPN
bionys-634	193	7	malki	malki	PROPN
bionys-634	193	8	,	,	PUNCT
bionys-634	193	9	r.	r.	PROPN
bionys-634	193	10	,	,	PUNCT
bionys-634	193	11	berard	berard	PROPN
bionys-634	193	12	,	,	PUNCT
bionys-634	193	13	a.	a.	NOUN
bionys-634	193	14	,	,	PUNCT
bionys-634	193	15	romaniuk	romaniuk	NOUN
bionys-634	193	16	,	,	PUNCT
bionys-634	193	17	m.	m.	NOUN
bionys-634	193	18	,	,	PUNCT
bionys-634	193	19	laval	laval	PROPN
bionys-634	193	20	,	,	PUNCT
bionys-634	193	21	v.	v.	PROPN
bionys-634	193	22	,	,	PUNCT
bionys-634	193	23	brunel	brunel	PROPN
bionys-634	193	24	,	,	PUNCT
bionys-634	193	25	d.	d.	PROPN
bionys-634	193	26	,	,	PUNCT
bionys-634	193	27	&	&	CCONJ
bionys-634	193	28	bertheau	bertheau	PROPN
bionys-634	193	29	,	,	PUNCT
bionys-634	193	30	y.	y.	PROPN
bionys-634	193	31	(	(	PUNCT
bionys-634	193	32	2008	2008	NUM
bionys-634	193	33	)	)	PUNCT
bionys-634	193	34	.	.	PUNCT
bionys-634	194	1	development	development	NOUN
bionys-634	194	2	of	of	ADP
bionys-634	194	3	a	a	DET
bionys-634	194	4	real	real	ADJ
bionys-634	194	5	-	-	PUNCT
bionys-634	194	6	time	time	NOUN
bionys-634	194	7	pcr	pcr	NOUN
bionys-634	194	8	method	method	NOUN
bionys-634	194	9	for	for	ADP
bionys-634	194	10	the	the	DET
bionys-634	194	11	differential	differential	ADJ
bionys-634	194	12	detection	detection	NOUN
bionys-634	194	13	and	and	CCONJ
bionys-634	194	14	quantification	quantification	NOUN
bionys-634	194	15	of	of	ADP
bionys-634	194	16	four	four	NUM
bionys-634	194	17	solanaceae	solanaceae	NOUN
bionys-634	194	18	in	in	ADP
bionys-634	194	19	gmo	gmo	PROPN
bionys-634	194	20	analysis	analysis	NOUN
bionys-634	194	21	:	:	PUNCT
bionys-634	194	22	solanum	solanum	NOUN
bionys-634	194	23	tuberosum	tuberosum	NOUN
bionys-634	194	24	,	,	PUNCT
bionys-634	194	25	solanum	solanum	NOUN
bionys-634	194	26	lycopersicum	lycopersicum	NOUN
bionys-634	194	27	,	,	PUNCT
bionys-634	194	28	solanum	solanum	NOUN
bionys-634	194	29	melongena	melongena	NOUN
bionys-634	194	30	,	,	PUNCT
bionys-634	194	31	and	and	CCONJ
bionys-634	194	32	capsicum	capsicum	NOUN
bionys-634	194	33	annuum	annuum	PROPN
bionys-634	194	34	.	.	PROPN
bionys-634	194	35	journal	journal	PROPN
bionys-634	194	36	of	of	ADP
bionys-634	194	37	agricultural	agricultural	ADJ
bionys-634	194	38	and	and	CCONJ
bionys-634	194	39	food	food	NOUN
bionys-634	194	40	chemistry	chemistry	NOUN
bionys-634	194	41	,	,	PUNCT
bionys-634	194	42	56(6	56(6	NUM
bionys-634	194	43	)	)	PUNCT
bionys-634	194	44	,	,	PUNCT
bionys-634	194	45	1818–1828	1818–1828	NUM
bionys-634	194	46	.	.	PUNCT
bionys-634	195	1	chaouachi	chaouachi	PROPN
bionys-634	195	2	,	,	PUNCT
bionys-634	195	3	m.	m.	NOUN
bionys-634	195	4	,	,	PUNCT
bionys-634	195	5	giancola	giancola	PROPN
bionys-634	195	6	,	,	PUNCT
bionys-634	195	7	s.	s.	PROPN
bionys-634	195	8	,	,	PUNCT
bionys-634	195	9	romaniuk	romaniuk	NOUN
bionys-634	195	10	,	,	PUNCT
bionys-634	195	11	m.	m.	NOUN
bionys-634	195	12	,	,	PUNCT
bionys-634	195	13	laval	laval	PROPN
bionys-634	195	14	,	,	PUNCT
bionys-634	195	15	v.	v.	PROPN
bionys-634	195	16	,	,	PUNCT
bionys-634	195	17	bertheau	bertheau	NOUN
bionys-634	195	18	,	,	PUNCT
bionys-634	195	19	y.	y.	PROPN
bionys-634	195	20	,	,	PUNCT
bionys-634	195	21	&	&	CCONJ
bionys-634	195	22	brunel	brunel	PROPN
bionys-634	195	23	,	,	PUNCT
bionys-634	195	24	d.	d.	PROPN
bionys-634	195	25	(	(	PUNCT
bionys-634	195	26	2007	2007	NUM
bionys-634	195	27	)	)	PUNCT
bionys-634	195	28	.	.	PUNCT
bionys-634	196	1	a	a	DET
bionys-634	196	2	strategy	strategy	NOUN
bionys-634	196	3	for	for	ADP
bionys-634	196	4	designing	design	VERB
bionys-634	196	5	multi	multi	ADJ
bionys-634	196	6	-	-	ADJ
bionys-634	196	7	taxa	taxa	ADJ
bionys-634	196	8	specific	specific	ADJ
bionys-634	196	9	reference	reference	NOUN
bionys-634	196	10	gene	gene	NOUN
bionys-634	196	11	systems	system	NOUN
bionys-634	196	12	:	:	PUNCT
bionys-634	196	13	example	example	NOUN
bionys-634	196	14	of	of	ADP
bionys-634	196	15	application	application	NOUN
bionys-634	196	16	–	–	PUNCT
bionys-634	196	17	ppi	ppi	NOUN
bionys-634	196	18	phosphofructokinase	phosphofructokinase	NOUN
bionys-634	196	19	(	(	PUNCT
bionys-634	196	20	ppi	ppi	NOUN
bionys-634	196	21	-	-	PUNCT
bionys-634	196	22	ppf	ppf	NOUN
bionys-634	196	23	)	)	PUNCT
bionys-634	196	24	used	use	VERB
bionys-634	196	25	for	for	ADP
bionys-634	196	26	the	the	DET
bionys-634	196	27	detection	detection	NOUN
bionys-634	196	28	and	and	CCONJ
bionys-634	196	29	quantification	quantification	NOUN
bionys-634	196	30	of	of	ADP
bionys-634	196	31	three	three	NUM
bionys-634	196	32	taxa	taxa	NOUN
bionys-634	196	33	:	:	PUNCT
bionys-634	196	34	zea	zea	PROPN
bionys-634	196	35	mays	may	NOUN
bionys-634	196	36	,	,	PUNCT
bionys-634	196	37	gossypium	gossypium	NOUN
bionys-634	196	38	hirsutum	hirsutum	NOUN
bionys-634	196	39	,	,	PUNCT
bionys-634	196	40	and	and	CCONJ
bionys-634	196	41	oryza	oryza	PROPN
bionys-634	196	42	sativa	sativa	NOUN
bionys-634	196	43	.	.	PUNCT
bionys-634	197	1	journal	journal	NOUN
bionys-634	197	2	of	of	ADP
bionys-634	197	3	agricultural	agricultural	ADJ
bionys-634	197	4	and	and	CCONJ
bionys-634	197	5	food	food	NOUN
bionys-634	197	6	chemistry	chemistry	NOUN
bionys-634	197	7	,	,	PUNCT
bionys-634	197	8	55(20	55(20	NUM
bionys-634	197	9	)	)	PUNCT
bionys-634	197	10	,	,	PUNCT
bionys-634	197	11	8003	8003	NUM
bionys-634	197	12	–	–	PUNCT
bionys-634	197	13	8010	8010	NUM
bionys-634	197	14	.	.	PUNCT
bionys-634	198	1	https://doi.org/10.1021/jf071429d	https://doi.org/10.1021/jf071429d	NOUN
bionys-634	198	2	chiaravutthi	chiaravutthi	NOUN
bionys-634	198	3	,	,	PUNCT
bionys-634	198	4	y.	y.	PROPN
bionys-634	198	5	,	,	PUNCT
bionys-634	198	6	&	&	CCONJ
bionys-634	198	7	pongjit	pongjit	PROPN
bionys-634	198	8	,	,	PUNCT
bionys-634	198	9	c.	c.	NOUN
bionys-634	198	10	(	(	PUNCT
bionys-634	198	11	2022	2022	NUM
bionys-634	198	12	)	)	PUNCT
bionys-634	198	13	.	.	PUNCT
bionys-634	199	1	thai	thai	PROPN
bionys-634	199	2	consumer	consumer	NOUN
bionys-634	199	3	willingness	willingness	NOUN
bionys-634	199	4	to	to	PART
bionys-634	199	5	pay	pay	VERB
bionys-634	199	6	for	for	ADP
bionys-634	199	7	differing	differ	VERB
bionys-634	199	8	gm	gm	PROPN
bionys-634	199	9	labeling	labeling	NOUN
bionys-634	199	10	policies	policy	NOUN
bionys-634	199	11	:	:	PUNCT
bionys-634	199	12	comparisons	comparison	NOUN
bionys-634	199	13	across	across	ADP
bionys-634	199	14	time	time	NOUN
bionys-634	199	15	.	.	PUNCT
bionys-634	200	1	the	the	DET
bionys-634	200	2	thai	thai	PROPN
bionys-634	200	3	journal	journal	PROPN
bionys-634	200	4	of	of	ADP
bionys-634	200	5	agricultural	agricultural	ADJ
bionys-634	200	6	economics	economic	NOUN
bionys-634	200	7	,	,	PUNCT
bionys-634	200	8	40(3	40(3	NOUN
bionys-634	200	9	)	)	PUNCT
bionys-634	200	10	,	,	PUNCT
bionys-634	200	11	69–86	69–86	NUM
bionys-634	200	12	.	.	PUNCT
bionys-634	201	1	dehkordi	dehkordi	PROPN
bionys-634	201	2	,	,	PUNCT
bionys-634	201	3	e.	e.	PROPN
bionys-634	201	4	a.	a.	PROPN
bionys-634	201	5	,	,	PUNCT
bionys-634	201	6	alemzadeh	alemzadeh	PROPN
bionys-634	201	7	,	,	PUNCT
bionys-634	201	8	a.	a.	PROPN
bionys-634	201	9	,	,	PUNCT
bionys-634	201	10	&	&	CCONJ
bionys-634	201	11	tanaka	tanaka	PROPN
bionys-634	201	12	,	,	PUNCT
bionys-634	201	13	n.	n.	PROPN
bionys-634	201	14	(	(	PUNCT
bionys-634	201	15	2018	2018	NUM
bionys-634	201	16	)	)	PUNCT
bionys-634	201	17	.	.	PUNCT
bionys-634	202	1	agrobacterium	agrobacterium	NOUN
bionys-634	202	2	-	-	PUNCT
bionys-634	202	3	mediated	mediate	VERB
bionys-634	202	4	transformation	transformation	NOUN
bionys-634	202	5	of	of	ADP
bionys-634	202	6	ovary	ovary	NOUN
bionys-634	202	7	of	of	ADP
bionys-634	202	8	bread	bread	NOUN
bionys-634	202	9	wheat	wheat	NOUN
bionys-634	202	10	(	(	PUNCT
bionys-634	202	11	triticum	triticum	NOUN
bionys-634	202	12	aestivum	aestivum	PROPN
bionys-634	202	13	l.	l.	PROPN
bionys-634	202	14	)	)	PUNCT
bionys-634	202	15	with	with	ADP
bionys-634	202	16	a	a	DET
bionys-634	202	17	gene	gene	NOUN
bionys-634	202	18	encoding	encode	VERB
bionys-634	202	19	a	a	DET
bionys-634	202	20	tomato	tomato	NOUN
bionys-634	202	21	erf	erf	NOUN
bionys-634	202	22	protein	protein	NOUN
bionys-634	202	23	.	.	PUNCT
bionys-634	203	1	plant	plant	NOUN
bionys-634	203	2	cell	cell	NOUN
bionys-634	203	3	biotechnology	biotechnology	NOUN
bionys-634	203	4	and	and	CCONJ
bionys-634	203	5	molecular	molecular	ADJ
bionys-634	203	6	biology	biology	NOUN
bionys-634	203	7	,	,	PUNCT
bionys-634	203	8	19	19	NUM
bionys-634	203	9	,	,	PUNCT
bionys-634	203	10	24–33	24–33	NUM
bionys-634	203	11	.	.	PUNCT
bionys-634	204	1	forte	forte	PROPN
bionys-634	204	2	,	,	PUNCT
bionys-634	204	3	v.	v.	ADV
bionys-634	204	4	,	,	PUNCT
bionys-634	204	5	di	di	NOUN
bionys-634	204	6	pinto	pinto	NOUN
bionys-634	204	7	,	,	PUNCT
bionys-634	204	8	a.	a.	NOUN
bionys-634	204	9	,	,	PUNCT
bionys-634	204	10	martino	martino	PROPN
bionys-634	204	11	,	,	PUNCT
bionys-634	204	12	c.	c.	PROPN
bionys-634	204	13	,	,	PUNCT
bionys-634	204	14	tantillo	tantillo	PROPN
bionys-634	204	15	,	,	PUNCT
bionys-634	204	16	g.	g.	NOUN
bionys-634	204	17	,	,	PUNCT
bionys-634	204	18	grasso	grasso	PROPN
bionys-634	204	19	,	,	PUNCT
bionys-634	204	20	g.	g.	PROPN
bionys-634	204	21	,	,	PUNCT
bionys-634	204	22	&	&	CCONJ
bionys-634	204	23	schena	schena	PROPN
bionys-634	204	24	,	,	PUNCT
bionys-634	204	25	f.	f.	PROPN
bionys-634	204	26	(	(	PUNCT
bionys-634	204	27	2005	2005	NUM
bionys-634	204	28	)	)	PUNCT
bionys-634	204	29	.	.	PUNCT
bionys-634	205	1	a	a	DET
bionys-634	205	2	general	general	ADJ
bionys-634	205	3	multiplex	multiplex	NOUN
bionys-634	205	4	-	-	PUNCT
bionys-634	205	5	pcr	pcr	NOUN
bionys-634	205	6	assay	assay	NOUN
bionys-634	205	7	for	for	ADP
bionys-634	205	8	the	the	DET
bionys-634	205	9	detection	detection	NOUN
bionys-634	205	10	of	of	ADP
bionys-634	205	11	genetically	genetically	ADV
bionys-634	205	12	modified	modify	VERB
bionys-634	205	13	soya	soya	NOUN
bionys-634	205	14	and	and	CCONJ
bionys-634	205	15	maize	maize	NOUN
bionys-634	205	16	.	.	PUNCT
bionys-634	206	1	food	food	NOUN
bionys-634	206	2	control	control	NOUN
bionys-634	206	3	,	,	PUNCT
bionys-634	206	4	16(6	16(6	NUM
bionys-634	206	5	)	)	PUNCT
bionys-634	206	6	,	,	PUNCT
bionys-634	206	7	535	535	NUM
bionys-634	206	8	–	–	PUNCT
bionys-634	206	9	539	539	NUM
bionys-634	206	10	.	.	PUNCT
bionys-634	207	1	https://doi.org/10.1016/j.foodcont.2004.05.010	https://doi.org/10.1016/j.foodcont.2004.05.010	PROPN
bionys-634	207	2	biologica	biologica	PROPN
bionys-634	207	3	nyssana	nyssana	PROPN
bionys-634	208	1	●	●	PUNCT
bionys-634	208	2	16	16	NUM
bionys-634	208	3	(	(	PUNCT
bionys-634	208	4	2	2	NUM
bionys-634	208	5	)	)	PUNCT
bionys-634	208	6	december	december	PROPN
bionys-634	208	7	2025	2025	NUM
bionys-634	208	8	:	:	PUNCT
bionys-634	208	9	ashrafi	ashrafi	PROPN
bionys-634	208	10	-	-	PUNCT
bionys-634	208	11	dehkordi	dehkordi	PROPN
bionys-634	208	12	et	et	PROPN
bionys-634	208	13	al	al	PROPN
bionys-634	208	14	.	.	PUNCT
bionys-634	208	15	●	●	PUNCT
bionys-634	208	16	pcr	pcr	NOUN
bionys-634	208	17	-	-	PUNCT
bionys-634	208	18	based	base	VERB
bionys-634	208	19	investigation	investigation	NOUN
bionys-634	208	20	on	on	ADP
bionys-634	208	21	transgenic	transgenic	NOUN
bionys-634	208	22	maize	maize	NOUN
bionys-634	208	23	status	status	NOUN
bionys-634	208	24	in	in	ADP
bionys-634	208	25	corn	corn	NOUN
bionys-634	208	26	processed	process	VERB
bionys-634	208	27	products	product	NOUN
bionys-634	208	28	fraiture	fraiture	NOUN
bionys-634	208	29	,	,	PUNCT
bionys-634	208	30	m.-a	m.-a	NOUN
bionys-634	208	31	.	.	PUNCT
bionys-634	208	32	,	,	PUNCT
bionys-634	208	33	herman	herman	PROPN
bionys-634	208	34	,	,	PUNCT
bionys-634	208	35	p.	p.	PROPN
bionys-634	208	36	,	,	PUNCT
bionys-634	208	37	taverniers	tavernier	NOUN
bionys-634	208	38	,	,	PUNCT
bionys-634	208	39	i.	i.	NOUN
bionys-634	208	40	,	,	PUNCT
bionys-634	208	41	de	de	ADP
bionys-634	208	42	loose	loose	ADJ
bionys-634	208	43	,	,	PUNCT
bionys-634	208	44	m.	m.	NOUN
bionys-634	208	45	,	,	PUNCT
bionys-634	208	46	deforce	deforce	PROPN
bionys-634	208	47	,	,	PUNCT
bionys-634	208	48	d.	d.	PROPN
bionys-634	208	49	,	,	PUNCT
bionys-634	208	50	&	&	CCONJ
bionys-634	208	51	roosens	roosen	NOUN
bionys-634	208	52	,	,	PUNCT
bionys-634	208	53	n.	n.	PROPN
bionys-634	208	54	h.	h.	PROPN
bionys-634	208	55	(	(	PUNCT
bionys-634	208	56	2015	2015	NUM
bionys-634	208	57	)	)	PUNCT
bionys-634	208	58	.	.	PUNCT
bionys-634	209	1	current	current	ADJ
bionys-634	209	2	and	and	CCONJ
bionys-634	209	3	new	new	ADJ
bionys-634	209	4	approaches	approach	NOUN
bionys-634	209	5	in	in	ADP
bionys-634	209	6	gmo	gmo	PROPN
bionys-634	209	7	detection	detection	NOUN
bionys-634	209	8	:	:	PUNCT
bionys-634	209	9	challenges	challenge	NOUN
bionys-634	209	10	and	and	CCONJ
bionys-634	209	11	solutions	solution	NOUN
bionys-634	209	12	.	.	PUNCT
bionys-634	209	13	biomed	biome	VERB
bionys-634	209	14	research	research	NOUN
bionys-634	209	15	international	international	PROPN
bionys-634	209	16	,	,	PUNCT
bionys-634	209	17	2015	2015	NUM
bionys-634	209	18	,	,	PUNCT
bionys-634	209	19	article	article	NOUN
bionys-634	209	20	392872	392872	NUM
bionys-634	209	21	.	.	PUNCT
bionys-634	210	1	https://doi	https://doi	PROPN
bionys-634	210	2	.	.	PUNCT
bionys-634	210	3	org/10.1155/2015/392872	org/10.1155/2015/392872	PROPN
bionys-634	210	4	germini	germini	PROPN
bionys-634	210	5	,	,	PUNCT
bionys-634	210	6	a.	a.	NOUN
bionys-634	210	7	,	,	PUNCT
bionys-634	210	8	zanetti	zanetti	PROPN
bionys-634	210	9	,	,	PUNCT
bionys-634	210	10	a.	a.	NOUN
bionys-634	210	11	,	,	PUNCT
bionys-634	210	12	salati	salati	PROPN
bionys-634	210	13	,	,	PUNCT
bionys-634	210	14	c.	c.	PROPN
bionys-634	210	15	,	,	PUNCT
bionys-634	210	16	rossi	rossi	PROPN
bionys-634	210	17	,	,	PUNCT
bionys-634	210	18	s.	s.	PROPN
bionys-634	210	19	,	,	PUNCT
bionys-634	210	20	forré	forré	PROPN
bionys-634	210	21	,	,	PUNCT
bionys-634	210	22	c.	c.	PROPN
bionys-634	210	23	,	,	PUNCT
bionys-634	210	24	schmid	schmid	PROPN
bionys-634	210	25	,	,	PUNCT
bionys-634	210	26	s.	s.	PROPN
bionys-634	210	27	,	,	PUNCT
bionys-634	210	28	&	&	CCONJ
bionys-634	210	29	marchelli	marchelli	PROPN
bionys-634	210	30	,	,	PUNCT
bionys-634	210	31	r.	r.	PROPN
bionys-634	210	32	(	(	PUNCT
bionys-634	210	33	2004	2004	NUM
bionys-634	210	34	)	)	PUNCT
bionys-634	210	35	.	.	PUNCT
bionys-634	211	1	development	development	NOUN
bionys-634	211	2	of	of	ADP
bionys-634	211	3	a	a	DET
bionys-634	211	4	seven	seven	NUM
bionys-634	211	5	-	-	PUNCT
bionys-634	211	6	target	target	NOUN
bionys-634	211	7	multiplex	multiplex	NOUN
bionys-634	211	8	pcr	pcr	NOUN
bionys-634	211	9	for	for	ADP
bionys-634	211	10	the	the	DET
bionys-634	211	11	simultaneous	simultaneous	ADJ
bionys-634	211	12	detection	detection	NOUN
bionys-634	211	13	of	of	ADP
bionys-634	211	14	transgenic	transgenic	NOUN
bionys-634	211	15	soybean	soybean	NOUN
bionys-634	211	16	and	and	CCONJ
bionys-634	211	17	maize	maize	NOUN
bionys-634	211	18	in	in	ADP
bionys-634	211	19	feeds	feed	NOUN
bionys-634	211	20	and	and	CCONJ
bionys-634	211	21	foods	food	NOUN
bionys-634	211	22	.	.	PUNCT
bionys-634	212	1	journal	journal	NOUN
bionys-634	212	2	of	of	ADP
bionys-634	212	3	agricultural	agricultural	ADJ
bionys-634	212	4	and	and	CCONJ
bionys-634	212	5	food	food	NOUN
bionys-634	212	6	chemistry	chemistry	NOUN
bionys-634	212	7	,	,	PUNCT
bionys-634	212	8	52(11	52(11	PROPN
bionys-634	212	9	)	)	PUNCT
bionys-634	212	10	,	,	PUNCT
bionys-634	212	11	3275–3280	3275–3280	NUM
bionys-634	212	12	.	.	PUNCT
bionys-634	213	1	https://	https://	PROPN
bionys-634	213	2	doi.org/10.1021/jf035052x	doi.org/10.1021/jf035052x	PROPN
bionys-634	213	3	griffiths	griffiths	PROPN
bionys-634	213	4	,	,	PUNCT
bionys-634	213	5	k.	k.	PROPN
bionys-634	213	6	,	,	PUNCT
bionys-634	213	7	partis	partis	PROPN
bionys-634	213	8	,	,	PUNCT
bionys-634	213	9	l.	l.	PROPN
bionys-634	213	10	,	,	PUNCT
bionys-634	213	11	croan	croan	PROPN
bionys-634	213	12	,	,	PUNCT
bionys-634	213	13	d.	d.	PROPN
bionys-634	213	14	,	,	PUNCT
bionys-634	213	15	wang	wang	PROPN
bionys-634	213	16	,	,	PUNCT
bionys-634	213	17	n.	n.	PROPN
bionys-634	213	18	,	,	PUNCT
bionys-634	213	19	&	&	CCONJ
bionys-634	213	20	emslie	emslie	PROPN
bionys-634	213	21	,	,	PUNCT
bionys-634	213	22	k.	k.	PROPN
bionys-634	213	23	r.	r.	PROPN
bionys-634	213	24	(	(	PUNCT
bionys-634	213	25	2002	2002	NUM
bionys-634	213	26	)	)	PUNCT
bionys-634	213	27	.	.	PUNCT
bionys-634	214	1	review	review	NOUN
bionys-634	214	2	of	of	ADP
bionys-634	214	3	technologies	technology	NOUN
bionys-634	214	4	for	for	ADP
bionys-634	214	5	detecting	detect	VERB
bionys-634	214	6	genetically	genetically	ADV
bionys-634	214	7	modified	modify	VERB
bionys-634	214	8	materials	material	NOUN
bionys-634	214	9	in	in	ADP
bionys-634	214	10	commodities	commodity	NOUN
bionys-634	214	11	and	and	CCONJ
bionys-634	214	12	food	food	NOUN
bionys-634	214	13	.	.	PUNCT
bionys-634	215	1	australian	australian	ADJ
bionys-634	215	2	government	government	NOUN
bionys-634	215	3	analytical	analytical	ADJ
bionys-634	215	4	laboratories	laboratory	NOUN
bionys-634	215	5	report	report	VERB
bionys-634	215	6	.	.	PUNCT
bionys-634	216	1	http://www.daff	http://www.daff	NOUN
bionys-634	216	2	.	.	PUNCT
bionys-634	217	1	gov.au/__data/assets/pdf_file/0008/196982/agal	gov.au/__data/assets/pdf_file/0008/196982/agal	PROPN
bionys-634	217	2	_	_	PRON
bionys-634	217	3	report.pdf	report.pdf	PROPN
bionys-634	217	4	gryson	gryson	NOUN
bionys-634	217	5	,	,	PUNCT
bionys-634	217	6	n.	n.	NOUN
bionys-634	217	7	,	,	PUNCT
bionys-634	217	8	messens	messen	NOUN
bionys-634	217	9	,	,	PUNCT
bionys-634	217	10	k.	k.	PROPN
bionys-634	217	11	,	,	PUNCT
bionys-634	217	12	&	&	CCONJ
bionys-634	217	13	dewettinck	dewettinck	NOUN
bionys-634	217	14	,	,	PUNCT
bionys-634	217	15	k.	k.	PROPN
bionys-634	217	16	(	(	PUNCT
bionys-634	217	17	2004	2004	NUM
bionys-634	217	18	)	)	PUNCT
bionys-634	217	19	.	.	PUNCT
bionys-634	218	1	evaluation	evaluation	NOUN
bionys-634	218	2	and	and	CCONJ
bionys-634	218	3	optimisation	optimisation	NOUN
bionys-634	218	4	of	of	ADP
bionys-634	218	5	five	five	NUM
bionys-634	218	6	different	different	ADJ
bionys-634	218	7	extraction	extraction	NOUN
bionys-634	218	8	methods	method	NOUN
bionys-634	218	9	for	for	ADP
bionys-634	218	10	soy	soy	NOUN
bionys-634	218	11	dna	dna	PROPN
bionys-634	218	12	in	in	ADP
bionys-634	218	13	chocolate	chocolate	NOUN
bionys-634	218	14	and	and	CCONJ
bionys-634	218	15	biscuits	biscuit	NOUN
bionys-634	218	16	:	:	PUNCT
bionys-634	218	17	extraction	extraction	NOUN
bionys-634	218	18	of	of	ADP
bionys-634	218	19	dna	dna	PROPN
bionys-634	218	20	as	as	ADP
bionys-634	218	21	a	a	DET
bionys-634	218	22	first	first	ADJ
bionys-634	218	23	step	step	NOUN
bionys-634	218	24	in	in	ADP
bionys-634	218	25	gmo	gmo	PROPN
bionys-634	218	26	analysis	analysis	NOUN
bionys-634	218	27	.	.	PUNCT
bionys-634	219	1	journal	journal	NOUN
bionys-634	219	2	of	of	ADP
bionys-634	219	3	the	the	DET
bionys-634	219	4	science	science	NOUN
bionys-634	219	5	of	of	ADP
bionys-634	219	6	food	food	NOUN
bionys-634	219	7	and	and	CCONJ
bionys-634	219	8	agriculture	agriculture	NOUN
bionys-634	219	9	,	,	PUNCT
bionys-634	219	10	84(11	84(11	NUM
bionys-634	219	11	)	)	PUNCT
bionys-634	219	12	,	,	PUNCT
bionys-634	219	13	1357–1363	1357–1363	NUM
bionys-634	219	14	.	.	PUNCT
bionys-634	220	1	https://doi	https://doi	PROPN
bionys-634	220	2	.	.	PUNCT
bionys-634	220	3	org/10.1002	org/10.1002	PROPN
bionys-634	220	4	/	/	SYM
bionys-634	220	5	jsfa.1767	jsfa.1767	PROPN
bionys-634	220	6	gürakan	gürakan	VERB
bionys-634	220	7	,	,	PUNCT
bionys-634	220	8	g.	g.	PROPN
bionys-634	220	9	c.	c.	PROPN
bionys-634	220	10	,	,	PUNCT
bionys-634	220	11	&	&	CCONJ
bionys-634	220	12	aydin	aydin	PROPN
bionys-634	220	13	,	,	PUNCT
bionys-634	220	14	g.	g.	PROPN
bionys-634	220	15	(	(	PUNCT
bionys-634	220	16	2011	2011	NUM
bionys-634	220	17	)	)	PUNCT
bionys-634	220	18	.	.	PUNCT
bionys-634	221	1	qualitative	qualitative	ADJ
bionys-634	221	2	detection	detection	NOUN
bionys-634	221	3	of	of	ADP
bionys-634	221	4	gm	gm	PROPN
bionys-634	221	5	maize	maize	NOUN
bionys-634	221	6	(	(	PUNCT
bionys-634	221	7	bt11	bt11	PROPN
bionys-634	221	8	)	)	PUNCT
bionys-634	221	9	in	in	ADP
bionys-634	221	10	food	food	NOUN
bionys-634	221	11	and	and	CCONJ
bionys-634	221	12	feed	feed	NOUN
bionys-634	221	13	sold	sell	VERB
bionys-634	221	14	commercially	commercially	ADV
bionys-634	221	15	in	in	ADP
bionys-634	221	16	turkey	turkey	NOUN
bionys-634	221	17	by	by	ADP
bionys-634	221	18	pcr	pcr	NOUN
bionys-634	221	19	-	-	PUNCT
bionys-634	221	20	based	base	VERB
bionys-634	221	21	methods	method	NOUN
bionys-634	221	22	.	.	PUNCT
bionys-634	222	1	journal	journal	PROPN
bionys-634	222	2	of	of	ADP
bionys-634	222	3	food	food	NOUN
bionys-634	222	4	science	science	NOUN
bionys-634	222	5	and	and	CCONJ
bionys-634	222	6	technology	technology	NOUN
bionys-634	222	7	,	,	PUNCT
bionys-634	222	8	10	10	NUM
bionys-634	222	9	,	,	PUNCT
bionys-634	222	10	143	143	NUM
bionys-634	222	11	–	–	SYM
bionys-634	222	12	146	146	NUM
bionys-634	222	13	.	.	PUNCT
bionys-634	223	1	hernández	hernández	PROPN
bionys-634	223	2	,	,	PUNCT
bionys-634	223	3	m.	m.	NOUN
bionys-634	223	4	,	,	PUNCT
bionys-634	223	5	esteve	esteve	PROPN
bionys-634	223	6	,	,	PUNCT
bionys-634	223	7	t.	t.	PROPN
bionys-634	223	8	,	,	PUNCT
bionys-634	223	9	&	&	CCONJ
bionys-634	223	10	pla	pla	PROPN
bionys-634	223	11	,	,	PUNCT
bionys-634	223	12	m.	m.	NOUN
bionys-634	223	13	(	(	PUNCT
bionys-634	223	14	2005	2005	NUM
bionys-634	223	15	)	)	PUNCT
bionys-634	223	16	.	.	PUNCT
bionys-634	224	1	realtime	realtime	ADJ
bionys-634	224	2	polymerase	polymerase	NOUN
bionys-634	224	3	chain	chain	NOUN
bionys-634	224	4	reaction	reaction	NOUN
bionys-634	224	5	based	base	VERB
bionys-634	224	6	assays	assay	NOUN
bionys-634	224	7	for	for	ADP
bionys-634	224	8	quantitative	quantitative	ADJ
bionys-634	224	9	detection	detection	NOUN
bionys-634	224	10	of	of	ADP
bionys-634	224	11	barley	barley	NOUN
bionys-634	224	12	,	,	PUNCT
bionys-634	224	13	rice	rice	NOUN
bionys-634	224	14	,	,	PUNCT
bionys-634	224	15	sunflower	sunflower	NOUN
bionys-634	224	16	,	,	PUNCT
bionys-634	224	17	and	and	CCONJ
bionys-634	224	18	wheat	wheat	NOUN
bionys-634	224	19	.	.	PUNCT
bionys-634	225	1	journal	journal	NOUN
bionys-634	225	2	of	of	ADP
bionys-634	225	3	agricultural	agricultural	ADJ
bionys-634	225	4	and	and	CCONJ
bionys-634	225	5	food	food	NOUN
bionys-634	225	6	chemistry	chemistry	NOUN
bionys-634	225	7	,	,	PUNCT
bionys-634	225	8	53(18	53(18	NUM
bionys-634	225	9	)	)	PUNCT
bionys-634	225	10	,	,	PUNCT
bionys-634	225	11	7003–7009	7003–7009	NUM
bionys-634	225	12	.	.	PUNCT
bionys-634	226	1	https://doi.org/10.1021/	https://doi.org/10.1021/	NOUN
bionys-634	226	2	jf050797j	jf050797j	NOUN
bionys-634	226	3	hernández	hernández	PROPN
bionys-634	226	4	,	,	PUNCT
bionys-634	226	5	m.	m.	NOUN
bionys-634	226	6	,	,	PUNCT
bionys-634	226	7	esteve	esteve	PROPN
bionys-634	226	8	,	,	PUNCT
bionys-634	226	9	t.	t.	PROPN
bionys-634	226	10	,	,	PUNCT
bionys-634	226	11	prat	prat	NOUN
bionys-634	226	12	,	,	PUNCT
bionys-634	226	13	s.	s.	PROPN
bionys-634	226	14	,	,	PUNCT
bionys-634	226	15	&	&	CCONJ
bionys-634	226	16	pla	pla	PROPN
bionys-634	226	17	,	,	PUNCT
bionys-634	226	18	m.	m.	NOUN
bionys-634	226	19	(	(	PUNCT
bionys-634	226	20	2004	2004	NUM
bionys-634	226	21	)	)	PUNCT
bionys-634	226	22	.	.	PUNCT
bionys-634	227	1	development	development	NOUN
bionys-634	227	2	of	of	ADP
bionys-634	227	3	real	real	ADJ
bionys-634	227	4	-	-	PUNCT
bionys-634	227	5	time	time	NOUN
bionys-634	227	6	pcr	pcr	NOUN
bionys-634	227	7	systems	system	NOUN
bionys-634	227	8	based	base	VERB
bionys-634	227	9	on	on	ADP
bionys-634	227	10	sybr	sybr	ADJ
bionys-634	227	11	®	®	NOUN
bionys-634	227	12	green	green	PROPN
bionys-634	227	13	i	i	PROPN
bionys-634	227	14	,	,	PUNCT
bionys-634	227	15	amplifluor	amplifluor	PROPN
bionys-634	227	16	™	™	PROPN
bionys-634	227	17	,	,	PUNCT
bionys-634	227	18	and	and	CCONJ
bionys-634	227	19	taqman	taqman	NOUN
bionys-634	227	20	®	®	NOUN
bionys-634	227	21	technologies	technology	NOUN
bionys-634	227	22	for	for	ADP
bionys-634	227	23	specific	specific	ADJ
bionys-634	227	24	quantitative	quantitative	ADJ
bionys-634	227	25	detection	detection	NOUN
bionys-634	227	26	of	of	ADP
bionys-634	227	27	the	the	DET
bionys-634	227	28	transgenic	transgenic	NOUN
bionys-634	227	29	maize	maize	NOUN
bionys-634	227	30	event	event	NOUN
bionys-634	227	31	ga21	ga21	PROPN
bionys-634	227	32	.	.	PROPN
bionys-634	227	33	journal	journal	PROPN
bionys-634	227	34	of	of	ADP
bionys-634	227	35	cereal	cereal	NOUN
bionys-634	227	36	science	science	NOUN
bionys-634	227	37	,	,	PUNCT
bionys-634	227	38	39(1	39(1	NUM
bionys-634	227	39	)	)	PUNCT
bionys-634	227	40	,	,	PUNCT
bionys-634	227	41	99–107	99–107	PROPN
bionys-634	227	42	.	.	PUNCT
bionys-634	228	1	https://	https://	PROPN
bionys-634	228	2	doi.org/10.1016/s0733-5210(03)00071-7	doi.org/10.1016/s0733-5210(03)00071-7	PUNCT
bionys-634	228	3	hübner	hübner	NOUN
bionys-634	228	4	,	,	PUNCT
bionys-634	228	5	p.	p.	NOUN
bionys-634	228	6	,	,	PUNCT
bionys-634	228	7	studer	studer	NOUN
bionys-634	228	8	,	,	PUNCT
bionys-634	228	9	e.	e.	PROPN
bionys-634	228	10	,	,	PUNCT
bionys-634	228	11	&	&	CCONJ
bionys-634	228	12	lüthy	lüthy	PROPN
bionys-634	228	13	,	,	PUNCT
bionys-634	228	14	j.	j.	PROPN
bionys-634	228	15	(	(	PUNCT
bionys-634	228	16	1999	1999	NUM
bionys-634	228	17	)	)	PUNCT
bionys-634	228	18	.	.	PUNCT
bionys-634	229	1	quantitative	quantitative	ADJ
bionys-634	229	2	competitive	competitive	ADJ
bionys-634	229	3	pcr	pcr	NOUN
bionys-634	229	4	for	for	ADP
bionys-634	229	5	the	the	DET
bionys-634	229	6	detection	detection	NOUN
bionys-634	229	7	of	of	ADP
bionys-634	229	8	genetically	genetically	ADV
bionys-634	229	9	modified	modify	VERB
bionys-634	229	10	organisms	organism	NOUN
bionys-634	229	11	in	in	ADP
bionys-634	229	12	food	food	NOUN
bionys-634	229	13	.	.	PUNCT
bionys-634	230	1	food	food	NOUN
bionys-634	230	2	control	control	NOUN
bionys-634	230	3	,	,	PUNCT
bionys-634	230	4	10(6	10(6	NOUN
bionys-634	230	5	)	)	PUNCT
bionys-634	230	6	,	,	PUNCT
bionys-634	230	7	353–358	353–358	NUM
bionys-634	230	8	.	.	PUNCT
bionys-634	231	1	https://doi.org/10.1016/	https://doi.org/10.1016/	PROPN
bionys-634	231	2	biologica	biologica	PROPN
bionys-634	231	3	nyssana	nyssana	PROPN
bionys-634	231	4	●	●	PUNCT
bionys-634	231	5	16	16	NUM
bionys-634	231	6	(	(	PUNCT
bionys-634	231	7	2	2	NUM
bionys-634	231	8	)	)	PUNCT
bionys-634	231	9	december	december	PROPN
bionys-634	231	10	2025	2025	NUM
bionys-634	231	11	:	:	PUNCT
bionys-634	231	12	ashrafi	ashrafi	PROPN
bionys-634	231	13	-	-	PUNCT
bionys-634	231	14	dehkordi	dehkordi	PROPN
bionys-634	231	15	et	et	PROPN
bionys-634	231	16	al	al	PROPN
bionys-634	231	17	.	.	PUNCT
bionys-634	232	1	●	●	PUNCT
bionys-634	232	2	pcr	pcr	NOUN
bionys-634	232	3	-	-	PUNCT
bionys-634	232	4	based	base	VERB
bionys-634	232	5	investigation	investigation	NOUN
bionys-634	232	6	on	on	ADP
bionys-634	232	7	transgenic	transgenic	NOUN
bionys-634	232	8	maize	maize	NOUN
bionys-634	232	9	status	status	NOUN
bionys-634	232	10	in	in	ADP
bionys-634	232	11	corn	corn	NOUN
bionys-634	232	12	processed	process	VERB
bionys-634	232	13	products	product	NOUN
bionys-634	232	14	s0956	s0956	PROPN
bionys-634	232	15	-	-	PUNCT
bionys-634	232	16	7135(99)00074	7135(99)00074	PROPN
bionys-634	232	17	-	-	PUNCT
bionys-634	232	18	2	2	NUM
bionys-634	232	19	isaaa	isaaa	NOUN
bionys-634	232	20	.	.	PUNCT
bionys-634	233	1	(	(	PUNCT
bionys-634	233	2	2019	2019	NUM
bionys-634	233	3	)	)	PUNCT
bionys-634	233	4	.	.	PUNCT
bionys-634	234	1	global	global	ADJ
bionys-634	234	2	status	status	NOUN
bionys-634	234	3	of	of	ADP
bionys-634	234	4	commercialized	commercialize	VERB
bionys-634	234	5	biotech	biotech	NOUN
bionys-634	234	6	/	/	SYM
bionys-634	234	7	gm	gm	PROPN
bionys-634	234	8	crops	crop	NOUN
bionys-634	234	9	:	:	PUNCT
bionys-634	234	10	2018	2018	NUM
bionys-634	234	11	(	(	PUNCT
bionys-634	234	12	isaaa	isaaa	NOUN
bionys-634	234	13	brief	brief	NOUN
bionys-634	234	14	no	no	INTJ
bionys-634	234	15	.	.	PROPN
bionys-634	234	16	54	54	NUM
bionys-634	234	17	)	)	PUNCT
bionys-634	234	18	.	.	PUNCT
bionys-634	235	1	isaaa	isaaa	NOUN
bionys-634	235	2	.	.	PUNCT
bionys-634	236	1	li	li	PROPN
bionys-634	236	2	,	,	PUNCT
bionys-634	236	3	y.	y.	PROPN
bionys-634	236	4	,	,	PUNCT
bionys-634	236	5	xiao	xiao	PROPN
bionys-634	236	6	,	,	PUNCT
bionys-634	236	7	f.	f.	PROPN
bionys-634	236	8	,	,	PUNCT
bionys-634	236	9	zhai	zhai	PROPN
bionys-634	236	10	,	,	PUNCT
bionys-634	236	11	c.	c.	PROPN
bionys-634	236	12	,	,	PUNCT
bionys-634	236	13	li	li	PROPN
bionys-634	236	14	,	,	PUNCT
bionys-634	236	15	x.	x.	PROPN
bionys-634	236	16	,	,	PUNCT
bionys-634	236	17	wu	wu	PROPN
bionys-634	236	18	,	,	PUNCT
bionys-634	236	19	y.	y.	PROPN
bionys-634	236	20	,	,	PUNCT
bionys-634	236	21	gao	gao	PROPN
bionys-634	236	22	,	,	PUNCT
bionys-634	236	23	h.	h.	PROPN
bionys-634	236	24	,	,	PUNCT
bionys-634	236	25	li	li	PROPN
bionys-634	236	26	,	,	PUNCT
bionys-634	236	27	j.	j.	PROPN
bionys-634	236	28	,	,	PUNCT
bionys-634	236	29	zhai	zhai	PROPN
bionys-634	236	30	,	,	PUNCT
bionys-634	236	31	s.	s.	PROPN
bionys-634	236	32	,	,	PUNCT
bionys-634	236	33	liu	liu	PROPN
bionys-634	236	34	,	,	PUNCT
bionys-634	236	35	b.	b.	PROPN
bionys-634	236	36	,	,	PUNCT
bionys-634	236	37	&	&	CCONJ
bionys-634	236	38	wu	wu	PROPN
bionys-634	236	39	,	,	PUNCT
bionys-634	236	40	g.	g.	PROPN
bionys-634	236	41	(	(	PUNCT
bionys-634	236	42	2022	2022	NUM
bionys-634	236	43	)	)	PUNCT
bionys-634	236	44	.	.	PUNCT
bionys-634	237	1	qualitative	qualitative	ADJ
bionys-634	237	2	and	and	CCONJ
bionys-634	237	3	quantitative	quantitative	ADJ
bionys-634	237	4	real	real	ADJ
bionys-634	237	5	-	-	PUNCT
bionys-634	237	6	time	time	NOUN
bionys-634	237	7	pcr	pcr	ADJ
bionys-634	237	8	methods	method	NOUN
bionys-634	237	9	for	for	ADP
bionys-634	237	10	assessing	assess	VERB
bionys-634	237	11	false	false	ADJ
bionys-634	237	12	-	-	PUNCT
bionys-634	237	13	positive	positive	ADJ
bionys-634	237	14	rates	rate	NOUN
bionys-634	237	15	in	in	ADP
bionys-634	237	16	genetically	genetically	ADV
bionys-634	237	17	modified	modify	VERB
bionys-634	237	18	organisms	organism	NOUN
bionys-634	237	19	based	base	VERB
bionys-634	237	20	on	on	ADP
bionys-634	237	21	the	the	DET
bionys-634	237	22	microbialinfection	microbialinfection	NOUN
bionys-634	237	23	-	-	PUNCT
bionys-634	237	24	linked	link	VERB
bionys-634	237	25	hpt	hpt	NOUN
bionys-634	237	26	gene	gene	NOUN
bionys-634	237	27	.	.	PUNCT
bionys-634	238	1	international	international	ADJ
bionys-634	238	2	journal	journal	NOUN
bionys-634	238	3	of	of	ADP
bionys-634	238	4	molecular	molecular	ADJ
bionys-634	238	5	sciences	science	NOUN
bionys-634	238	6	,	,	PUNCT
bionys-634	238	7	23(17	23(17	NUM
bionys-634	238	8	)	)	PUNCT
bionys-634	238	9	,	,	PUNCT
bionys-634	238	10	10000	10000	NUM
bionys-634	238	11	.	.	PUNCT
bionys-634	239	1	https://doi	https://doi	X
bionys-634	239	2	.	.	PUNCT
bionys-634	239	3	org/10.3390	org/10.3390	PROPN
bionys-634	239	4	/	/	SYM
bionys-634	239	5	ijms231710000	ijms231710000	PROPN
bionys-634	239	6	lin	lin	PROPN
bionys-634	239	7	,	,	PUNCT
bionys-634	239	8	h.-y	h.-y	NOUN
bionys-634	239	9	.	.	PUNCT
bionys-634	239	10	,	,	PUNCT
bionys-634	239	11	chiang	chiang	PROPN
bionys-634	239	12	,	,	PUNCT
bionys-634	239	13	j.-w	j.-w	PROPN
bionys-634	239	14	.	.	PROPN
bionys-634	239	15	,	,	PUNCT
bionys-634	239	16	&	&	CCONJ
bionys-634	239	17	shih	shih	NOUN
bionys-634	239	18	,	,	PUNCT
bionys-634	239	19	y.-c	y.-c	PROPN
bionys-634	239	20	.	.	PUNCT
bionys-634	240	1	(	(	PUNCT
bionys-634	240	2	2001	2001	NUM
bionys-634	240	3	)	)	PUNCT
bionys-634	240	4	.	.	PUNCT
bionys-634	241	1	detection	detection	NOUN
bionys-634	241	2	of	of	ADP
bionys-634	241	3	genetically	genetically	ADV
bionys-634	241	4	modified	modify	VERB
bionys-634	241	5	soybeans	soybean	NOUN
bionys-634	241	6	by	by	ADP
bionys-634	241	7	pcr	pcr	ADJ
bionys-634	241	8	method	method	NOUN
bionys-634	241	9	and	and	CCONJ
bionys-634	241	10	immunoassay	immunoassay	PROPN
bionys-634	241	11	kits	kits	PROPN
bionys-634	241	12	.	.	PUNCT
bionys-634	242	1	journal	journal	PROPN
bionys-634	242	2	of	of	ADP
bionys-634	242	3	food	food	NOUN
bionys-634	242	4	and	and	CCONJ
bionys-634	242	5	drug	drug	NOUN
bionys-634	242	6	analysis	analysis	NOUN
bionys-634	242	7	,	,	PUNCT
bionys-634	242	8	9(3	9(3	NUM
bionys-634	242	9	)	)	PUNCT
bionys-634	242	10	.	.	PUNCT
bionys-634	243	1	*	*	PUNCT
bionys-634	243	2	lin	lin	PROPN
bionys-634	243	3	,	,	PUNCT
bionys-634	243	4	h.-y	h.-y	NOUN
bionys-634	243	5	.	.	PUNCT
bionys-634	243	6	,	,	PUNCT
bionys-634	243	7	chiueh	chiueh	PROPN
bionys-634	243	8	,	,	PUNCT
bionys-634	243	9	l.	l.	PROPN
bionys-634	243	10	c.	c.	PROPN
bionys-634	243	11	,	,	PUNCT
bionys-634	243	12	&	&	CCONJ
bionys-634	243	13	shih	shih	PROPN
bionys-634	243	14	,	,	PUNCT
bionys-634	243	15	d.	d.	PROPN
bionys-634	243	16	y.	y.	PROPN
bionys-634	243	17	c.	c.	PROPN
bionys-634	243	18	(	(	PUNCT
bionys-634	243	19	2000	2000	NUM
bionys-634	243	20	)	)	PUNCT
bionys-634	243	21	.	.	PUNCT
bionys-634	244	1	detection	detection	NOUN
bionys-634	244	2	of	of	ADP
bionys-634	244	3	genetically	genetically	ADV
bionys-634	244	4	modified	modify	VERB
bionys-634	244	5	soybeans	soybean	NOUN
bionys-634	244	6	and	and	CCONJ
bionys-634	244	7	maize	maize	NOUN
bionys-634	244	8	by	by	ADP
bionys-634	244	9	the	the	DET
bionys-634	244	10	polymerase	polymerase	NOUN
bionys-634	244	11	chain	chain	NOUN
bionys-634	244	12	reaction	reaction	NOUN
bionys-634	244	13	method	method	NOUN
bionys-634	244	14	.	.	PUNCT
bionys-634	245	1	journal	journal	NOUN
bionys-634	245	2	of	of	ADP
bionys-634	245	3	food	food	NOUN
bionys-634	245	4	and	and	CCONJ
bionys-634	245	5	drug	drug	NOUN
bionys-634	245	6	analysis	analysis	NOUN
bionys-634	245	7	,	,	PUNCT
bionys-634	245	8	8(3	8(3	NUM
bionys-634	245	9	)	)	PUNCT
bionys-634	245	10	.	.	PUNCT
bionys-634	246	1	*	*	PUNCT
bionys-634	246	2	pan	pan	PROPN
bionys-634	246	3	,	,	PUNCT
bionys-634	246	4	a.	a.	PROPN
bionys-634	246	5	,	,	PUNCT
bionys-634	246	6	yang	yang	PROPN
bionys-634	246	7	,	,	PUNCT
bionys-634	246	8	l.	l.	PROPN
bionys-634	246	9	,	,	PUNCT
bionys-634	246	10	xu	xu	PROPN
bionys-634	246	11	,	,	PUNCT
bionys-634	246	12	s.	s.	PROPN
bionys-634	246	13	,	,	PUNCT
bionys-634	246	14	yin	yin	PROPN
bionys-634	246	15	,	,	PUNCT
bionys-634	246	16	c.	c.	PROPN
bionys-634	246	17	,	,	PUNCT
bionys-634	246	18	zhang	zhang	PROPN
bionys-634	246	19	,	,	PUNCT
bionys-634	246	20	k.	k.	PROPN
bionys-634	246	21	,	,	PUNCT
bionys-634	246	22	wang	wang	PROPN
bionys-634	246	23	,	,	PUNCT
bionys-634	246	24	z.	z.	PROPN
bionys-634	246	25	,	,	PUNCT
bionys-634	246	26	&	&	CCONJ
bionys-634	246	27	zhang	zhang	PROPN
bionys-634	246	28	,	,	PUNCT
bionys-634	246	29	d.	d.	PROPN
bionys-634	246	30	j.	j.	PROPN
bionys-634	246	31	(	(	PUNCT
bionys-634	246	32	2006	2006	NUM
bionys-634	246	33	)	)	PUNCT
bionys-634	246	34	.	.	PUNCT
bionys-634	247	1	event	event	NOUN
bionys-634	247	2	-	-	PUNCT
bionys-634	247	3	specific	specific	ADJ
bionys-634	247	4	qualitative	qualitative	NOUN
bionys-634	247	5	and	and	CCONJ
bionys-634	247	6	quantitative	quantitative	ADJ
bionys-634	247	7	pcr	pcr	ADJ
bionys-634	247	8	detection	detection	NOUN
bionys-634	247	9	of	of	ADP
bionys-634	247	10	mon863	mon863	PROPN
bionys-634	247	11	maize	maize	NOUN
bionys-634	247	12	based	base	VERB
bionys-634	247	13	upon	upon	SCONJ
bionys-634	247	14	the	the	DET
bionys-634	247	15	3′-transgene	3′-transgene	NUM
bionys-634	247	16	integration	integration	NOUN
bionys-634	247	17	sequence	sequence	NOUN
bionys-634	247	18	.	.	PUNCT
bionys-634	248	1	journal	journal	PROPN
bionys-634	248	2	of	of	ADP
bionys-634	248	3	cereal	cereal	NOUN
bionys-634	248	4	science	science	NOUN
bionys-634	248	5	,	,	PUNCT
bionys-634	248	6	43(2	43(2	NUM
bionys-634	248	7	)	)	PUNCT
bionys-634	248	8	,	,	PUNCT
bionys-634	248	9	250–257	250–257	NUM
bionys-634	248	10	.	.	PUNCT
bionys-634	249	1	https://	https://	PROPN
bionys-634	249	2	doi.org/10.1016/j.jcs.2005.10.003	doi.org/10.1016/j.jcs.2005.10.003	PROPN
bionys-634	249	3	peano	peano	PROPN
bionys-634	249	4	,	,	PUNCT
bionys-634	249	5	c.	c.	PROPN
bionys-634	249	6	,	,	PUNCT
bionys-634	249	7	samson	samson	PROPN
bionys-634	249	8	,	,	PUNCT
bionys-634	249	9	m.	m.	PROPN
bionys-634	249	10	c.	c.	PROPN
bionys-634	249	11	,	,	PUNCT
bionys-634	249	12	palmieri	palmieri	PROPN
bionys-634	249	13	,	,	PUNCT
bionys-634	249	14	l.	l.	PROPN
bionys-634	249	15	,	,	PUNCT
bionys-634	249	16	gulli	gulli	PROPN
bionys-634	249	17	,	,	PUNCT
bionys-634	249	18	m.	m.	NOUN
bionys-634	249	19	,	,	PUNCT
bionys-634	249	20	&	&	CCONJ
bionys-634	249	21	marmiroli	marmiroli	PROPN
bionys-634	249	22	,	,	PUNCT
bionys-634	249	23	n.	n.	NOUN
bionys-634	249	24	(	(	PUNCT
bionys-634	249	25	2004	2004	NUM
bionys-634	249	26	)	)	PUNCT
bionys-634	249	27	.	.	PUNCT
bionys-634	250	1	qualitative	qualitative	ADJ
bionys-634	250	2	and	and	CCONJ
bionys-634	250	3	quantitative	quantitative	ADJ
bionys-634	250	4	evaluation	evaluation	NOUN
bionys-634	250	5	of	of	ADP
bionys-634	250	6	genomic	genomic	NOUN
bionys-634	250	7	dna	dna	PROPN
bionys-634	250	8	extracted	extract	VERB
bionys-634	250	9	from	from	ADP
bionys-634	250	10	gmo	gmo	PROPN
bionys-634	250	11	and	and	CCONJ
bionys-634	250	12	non	non	ADJ
bionys-634	250	13	-	-	ADJ
bionys-634	250	14	gmo	gmo	ADJ
bionys-634	250	15	foodstuffs	foodstuff	NOUN
bionys-634	250	16	with	with	ADP
bionys-634	250	17	four	four	NUM
bionys-634	250	18	different	different	ADJ
bionys-634	250	19	extraction	extraction	NOUN
bionys-634	250	20	methods	method	NOUN
bionys-634	250	21	.	.	PUNCT
bionys-634	251	1	journal	journal	NOUN
bionys-634	251	2	of	of	ADP
bionys-634	251	3	agricultural	agricultural	ADJ
bionys-634	251	4	and	and	CCONJ
bionys-634	251	5	food	food	NOUN
bionys-634	251	6	chemistry	chemistry	NOUN
bionys-634	251	7	,	,	PUNCT
bionys-634	251	8	52(23	52(23	NUM
bionys-634	251	9	)	)	PUNCT
bionys-634	251	10	,	,	PUNCT
bionys-634	251	11	6962–6968	6962–6968	NUM
bionys-634	251	12	.	.	PUNCT
bionys-634	252	1	https://	https://	PROPN
bionys-634	252	2	doi.org/10.1021/jf040008i	doi.org/10.1021/jf040008i	PROPN
bionys-634	252	3	rott	rott	PROPN
bionys-634	252	4	,	,	PUNCT
bionys-634	252	5	m.	m.	PROPN
bionys-634	252	6	e.	e.	PROPN
bionys-634	252	7	,	,	PUNCT
bionys-634	252	8	lawrence	lawrence	PROPN
bionys-634	252	9	,	,	PUNCT
bionys-634	252	10	t.	t.	PROPN
bionys-634	252	11	s.	s.	PROPN
bionys-634	252	12	,	,	PUNCT
bionys-634	252	13	wall	wall	PROPN
bionys-634	252	14	,	,	PUNCT
bionys-634	252	15	e.	e.	PROPN
bionys-634	252	16	m.	m.	PROPN
bionys-634	252	17	,	,	PUNCT
bionys-634	252	18	&	&	CCONJ
bionys-634	252	19	green	green	NOUN
bionys-634	252	20	,	,	PUNCT
bionys-634	252	21	m.	m.	NOUN
bionys-634	252	22	j.	j.	PROPN
bionys-634	252	23	(	(	PUNCT
bionys-634	252	24	2004	2004	NUM
bionys-634	252	25	)	)	PUNCT
bionys-634	252	26	.	.	PUNCT
bionys-634	253	1	detection	detection	NOUN
bionys-634	253	2	and	and	CCONJ
bionys-634	253	3	quantification	quantification	NOUN
bionys-634	253	4	of	of	ADP
bionys-634	253	5	roundup	roundup	NOUN
bionys-634	253	6	ready	ready	ADJ
bionys-634	253	7	soy	soy	NOUN
bionys-634	253	8	in	in	ADP
bionys-634	253	9	foods	food	NOUN
bionys-634	253	10	by	by	ADP
bionys-634	253	11	conventional	conventional	ADJ
bionys-634	253	12	and	and	CCONJ
bionys-634	253	13	real	real	ADJ
bionys-634	253	14	-	-	PUNCT
bionys-634	253	15	time	time	NOUN
bionys-634	253	16	polymerase	polymerase	NOUN
bionys-634	253	17	chain	chain	NOUN
bionys-634	253	18	reaction	reaction	NOUN
bionys-634	253	19	.	.	PUNCT
bionys-634	254	1	journal	journal	NOUN
bionys-634	254	2	of	of	ADP
bionys-634	254	3	agricultural	agricultural	ADJ
bionys-634	254	4	and	and	CCONJ
bionys-634	254	5	food	food	NOUN
bionys-634	254	6	chemistry	chemistry	NOUN
bionys-634	254	7	,	,	PUNCT
bionys-634	254	8	52(16	52(16	NOUN
bionys-634	254	9	)	)	PUNCT
bionys-634	254	10	,	,	PUNCT
bionys-634	254	11	5223	5223	NUM
bionys-634	254	12	–	–	PUNCT
bionys-634	254	13	5232	5232	NUM
bionys-634	254	14	.	.	PUNCT
bionys-634	255	1	https://doi.org/10.1021/jf030803	https://doi.org/10.1021/jf030803	ADP
bionys-634	255	2	g	g	PROPN
bionys-634	255	3	saghai	saghai	NOUN
bionys-634	255	4	-	-	PUNCT
bionys-634	255	5	maroof	maroof	NOUN
bionys-634	255	6	,	,	PUNCT
bionys-634	255	7	m.	m.	NOUN
bionys-634	255	8	a.	a.	PROPN
bionys-634	255	9	,	,	PUNCT
bionys-634	255	10	soliman	soliman	PROPN
bionys-634	255	11	,	,	PUNCT
bionys-634	255	12	k.	k.	PROPN
bionys-634	255	13	m.	m.	PROPN
bionys-634	255	14	,	,	PUNCT
bionys-634	255	15	jorgensen	jorgensen	PROPN
bionys-634	255	16	,	,	PUNCT
bionys-634	255	17	r.	r.	PROPN
bionys-634	255	18	a.	a.	PROPN
bionys-634	255	19	,	,	PUNCT
bionys-634	255	20	&	&	CCONJ
bionys-634	255	21	allard	allard	PROPN
bionys-634	255	22	,	,	PUNCT
bionys-634	255	23	r.	r.	PROPN
bionys-634	255	24	(	(	PUNCT
bionys-634	255	25	1984	1984	NUM
bionys-634	255	26	)	)	PUNCT
bionys-634	255	27	.	.	PUNCT
bionys-634	256	1	ribosomal	ribosomal	NOUN
bionys-634	256	2	dna	dna	PROPN
bionys-634	256	3	spacer	spacer	NOUN
bionys-634	256	4	-	-	PUNCT
bionys-634	256	5	length	length	NOUN
bionys-634	256	6	polymorphisms	polymorphism	NOUN
bionys-634	256	7	in	in	ADP
bionys-634	256	8	barley	barley	NOUN
bionys-634	256	9	:	:	PUNCT
bionys-634	256	10	mendelian	mendelian	ADJ
bionys-634	256	11	inheritance	inheritance	NOUN
bionys-634	256	12	,	,	PUNCT
bionys-634	256	13	chromosomal	chromosomal	ADJ
bionys-634	256	14	location	location	NOUN
bionys-634	256	15	,	,	PUNCT
bionys-634	256	16	and	and	CCONJ
bionys-634	256	17	population	population	NOUN
bionys-634	256	18	dynamics	dynamic	NOUN
bionys-634	256	19	.	.	PUNCT
bionys-634	257	1	proceedings	proceeding	NOUN
bionys-634	257	2	of	of	ADP
bionys-634	257	3	the	the	DET
bionys-634	257	4	national	national	PROPN
bionys-634	257	5	academy	academy	PROPN
bionys-634	257	6	of	of	ADP
bionys-634	257	7	sciences	sciences	PROPN
bionys-634	257	8	,	,	PUNCT
bionys-634	257	9	81(24	81(24	NUM
bionys-634	257	10	)	)	PUNCT
bionys-634	257	11	,	,	PUNCT
bionys-634	257	12	8014–8018	8014–8018	NUM
bionys-634	257	13	.	.	PUNCT
bionys-634	258	1	https://	https://	PROPN
bionys-634	258	2	doi.org/10.1073/pnas.81.24.8014	doi.org/10.1073/pnas.81.24.8014	PROPN
bionys-634	258	3	sisea	sisea	NOUN
bionys-634	258	4	,	,	PUNCT
bionys-634	258	5	c.	c.	PROPN
bionys-634	258	6	,	,	PUNCT
bionys-634	258	7	&	&	CCONJ
bionys-634	258	8	pamfil	pamfil	PROPN
bionys-634	258	9	,	,	PUNCT
bionys-634	258	10	d.	d.	PROPN
bionys-634	258	11	(	(	PUNCT
bionys-634	258	12	2007	2007	NUM
bionys-634	258	13	)	)	PUNCT
bionys-634	258	14	.	.	PUNCT
bionys-634	259	1	comparison	comparison	NOUN
bionys-634	259	2	of	of	ADP
bionys-634	259	3	dna	dna	PROPN
bionys-634	259	4	extraction	extraction	NOUN
bionys-634	259	5	methods	method	NOUN
bionys-634	259	6	for	for	ADP
bionys-634	259	7	gmo	gmo	PROPN
bionys-634	259	8	analysis	analysis	NOUN
bionys-634	259	9	of	of	ADP
bionys-634	259	10	food	food	NOUN
bionys-634	259	11	products	product	NOUN
bionys-634	259	12	.	.	PUNCT
bionys-634	260	1	bulletin	bulletin	NOUN
bionys-634	260	2	of	of	ADP
bionys-634	260	3	the	the	DET
bionys-634	260	4	university	university	NOUN
bionys-634	260	5	of	of	ADP
bionys-634	260	6	agricultural	agricultural	ADJ
bionys-634	260	7	sciences	science	NOUN
bionys-634	260	8	and	and	CCONJ
bionys-634	260	9	veterinary	veterinary	ADJ
bionys-634	260	10	medicine	medicine	NOUN
bionys-634	260	11	cluj	cluj	PROPN
bionys-634	260	12	-	-	PUNCT
bionys-634	260	13	napoca	napoca	NOUN
bionys-634	260	14	:	:	PUNCT
bionys-634	260	15	journal	journal	NOUN
bionys-634	260	16	of	of	ADP
bionys-634	260	17	animal	animal	NOUN
bionys-634	260	18	science	science	NOUN
bionys-634	260	19	and	and	CCONJ
bionys-634	260	20	biotechnologies	biotechnology	NOUN
bionys-634	260	21	,	,	PUNCT
bionys-634	260	22	64(1–2	64(1–2	NUM
bionys-634	260	23	)	)	PUNCT
bionys-634	260	24	.	.	PUNCT
bionys-634	261	1	*	*	PUNCT
bionys-634	261	2	taški	taški	PROPN
bionys-634	261	3	-	-	PUNCT
bionys-634	261	4	ajduković	ajduković	PROPN
bionys-634	261	5	,	,	PUNCT
bionys-634	261	6	k.	k.	PROPN
bionys-634	261	7	,	,	PUNCT
bionys-634	261	8	nikolić	nikolić	PROPN
bionys-634	261	9	,	,	PUNCT
bionys-634	261	10	z.	z.	PROPN
bionys-634	261	11	,	,	PUNCT
bionys-634	261	12	vujaković	vujaković	PROPN
bionys-634	261	13	,	,	PUNCT
bionys-634	261	14	m.	m.	NOUN
bionys-634	261	15	,	,	PUNCT
bionys-634	261	16	milošević	milošević	NOUN
bionys-634	261	17	,	,	PUNCT
bionys-634	261	18	m.	m.	NOUN
bionys-634	261	19	,	,	PUNCT
bionys-634	261	20	ignjatov	ignjatov	NOUN
bionys-634	261	21	,	,	PUNCT
bionys-634	261	22	m.	m.	NOUN
bionys-634	261	23	,	,	PUNCT
bionys-634	261	24	&	&	CCONJ
bionys-634	261	25	petrović	petrović	PROPN
bionys-634	261	26	,	,	PUNCT
bionys-634	261	27	d.	d.	PROPN
bionys-634	261	28	(	(	PUNCT
bionys-634	261	29	2009	2009	NUM
bionys-634	261	30	)	)	PUNCT
bionys-634	261	31	.	.	PUNCT
bionys-634	262	1	detection	detection	NOUN
bionys-634	262	2	of	of	ADP
bionys-634	262	3	genetically	genetically	ADV
bionys-634	262	4	modified	modify	VERB
bionys-634	262	5	organisms	organism	NOUN
bionys-634	262	6	in	in	ADP
bionys-634	262	7	processed	process	VERB
bionys-634	262	8	meat	meat	NOUN
bionys-634	262	9	products	product	NOUN
bionys-634	262	10	on	on	ADP
bionys-634	262	11	the	the	DET
bionys-634	262	12	serbian	serbian	ADJ
bionys-634	262	13	food	food	NOUN
bionys-634	262	14	market	market	NOUN
bionys-634	262	15	.	.	PUNCT
bionys-634	263	1	meat	meat	NOUN
bionys-634	263	2	science	science	NOUN
bionys-634	263	3	,	,	PUNCT
bionys-634	263	4	81(1	81(1	NUM
bionys-634	263	5	)	)	PUNCT
bionys-634	263	6	,	,	PUNCT
bionys-634	263	7	230–232	230–232	NUM
bionys-634	263	8	.	.	PUNCT
bionys-634	264	1	https://doi	https://doi	X
bionys-634	264	2	.	.	PUNCT
bionys-634	264	3	org/10.1016	org/10.1016	PROPN
bionys-634	264	4	/	/	SYM
bionys-634	264	5	j.meatsci.2008.07.024	j.meatsci.2008.07.024	PROPN
bionys-634	264	6	terry	terry	PROPN
bionys-634	264	7	,	,	PUNCT
bionys-634	264	8	c.	c.	PROPN
bionys-634	264	9	f.	f.	PROPN
bionys-634	264	10	,	,	PUNCT
bionys-634	264	11	&	&	CCONJ
bionys-634	264	12	harris	harris	PROPN
bionys-634	264	13	,	,	PUNCT
bionys-634	264	14	n.	n.	PROPN
bionys-634	264	15	(	(	PUNCT
bionys-634	264	16	2001	2001	NUM
bionys-634	264	17	)	)	PUNCT
bionys-634	264	18	.	.	PUNCT
bionys-634	265	1	event	event	NOUN
bionys-634	265	2	-	-	PUNCT
bionys-634	265	3	specific	specific	ADJ
bionys-634	265	4	detection	detection	NOUN
bionys-634	265	5	of	of	ADP
bionys-634	265	6	roundup	roundup	NOUN
bionys-634	265	7	ready	ready	ADJ
bionys-634	265	8	soya	soya	NOUN
bionys-634	265	9	using	use	VERB
bionys-634	265	10	two	two	NUM
bionys-634	265	11	different	different	ADJ
bionys-634	265	12	real	real	ADJ
bionys-634	265	13	-	-	PUNCT
bionys-634	265	14	time	time	NOUN
bionys-634	265	15	pcr	pcr	ADJ
bionys-634	265	16	detection	detection	NOUN
bionys-634	265	17	chemistries	chemistry	NOUN
bionys-634	265	18	.	.	PUNCT
bionys-634	266	1	european	european	ADJ
bionys-634	266	2	food	food	PROPN
bionys-634	266	3	research	research	NOUN
bionys-634	266	4	and	and	CCONJ
bionys-634	266	5	technology	technology	NOUN
bionys-634	266	6	,	,	PUNCT
bionys-634	266	7	213(6	213(6	NUM
bionys-634	266	8	)	)	PUNCT
bionys-634	266	9	,	,	PUNCT
bionys-634	266	10	425–431	425–431	NUM
bionys-634	266	11	.	.	PUNCT
bionys-634	267	1	https://doi.org/10.1007/s002170100404	https://doi.org/10.1007/s002170100404	PRON
bionys-634	267	2	ujhelyi	ujhelyi	PROPN
bionys-634	267	3	,	,	PUNCT
bionys-634	267	4	g.	g.	PROPN
bionys-634	267	5	,	,	PUNCT
bionys-634	267	6	vajda	vajda	PROPN
bionys-634	267	7	,	,	PUNCT
bionys-634	267	8	b.	b.	PROPN
bionys-634	267	9	,	,	PUNCT
bionys-634	267	10	béki	béki	PROPN
bionys-634	267	11	,	,	PUNCT
bionys-634	267	12	e.	e.	PROPN
bionys-634	267	13	,	,	PUNCT
bionys-634	267	14	neszlényi	neszlényi	PROPN
bionys-634	267	15	,	,	PUNCT
bionys-634	267	16	k.	k.	PROPN
bionys-634	267	17	,	,	PUNCT
bionys-634	267	18	jakab	jakab	PROPN
bionys-634	267	19	,	,	PUNCT
bionys-634	267	20	j.	j.	PROPN
bionys-634	267	21	,	,	PUNCT
bionys-634	267	22	&	&	CCONJ
bionys-634	267	23	jánosi	jánosi	PROPN
bionys-634	267	24	,	,	PUNCT
bionys-634	267	25	a.	a.	NOUN
bionys-634	267	26	(	(	PUNCT
bionys-634	267	27	2008	2008	NUM
bionys-634	267	28	)	)	PUNCT
bionys-634	267	29	.	.	PUNCT
bionys-634	268	1	surveying	survey	VERB
bionys-634	268	2	the	the	DET
bionys-634	268	3	roundup	roundup	NOUN
bionys-634	268	4	ready	ready	ADJ
bionys-634	268	5	soy	soy	NOUN
bionys-634	268	6	content	content	NOUN
bionys-634	268	7	of	of	ADP
bionys-634	268	8	commercially	commercially	ADV
bionys-634	268	9	available	available	ADJ
bionys-634	268	10	food	food	NOUN
bionys-634	268	11	products	product	NOUN
bionys-634	268	12	in	in	ADP
bionys-634	268	13	hungary	hungary	PROPN
bionys-634	268	14	.	.	PUNCT
bionys-634	269	1	food	food	NOUN
bionys-634	269	2	control	control	NOUN
bionys-634	269	3	,	,	PUNCT
bionys-634	269	4	19(10	19(10	NUM
bionys-634	269	5	)	)	PUNCT
bionys-634	269	6	,	,	PUNCT
bionys-634	269	7	967–973	967–973	NUM
bionys-634	269	8	.	.	PUNCT
bionys-634	270	1	https://doi.org/10.1016/j	https://doi.org/10.1016/j	NOUN
bionys-634	270	2	.	.	PUNCT
bionys-634	271	1	foodcont.2007.10.004	foodcont.2007.10.004	NOUN
bionys-634	271	2	vijayakumar	vijayakumar	PROPN
bionys-634	271	3	,	,	PUNCT
bionys-634	271	4	k.	k.	PROPN
bionys-634	271	5	,	,	PUNCT
bionys-634	271	6	martin	martin	PROPN
bionys-634	271	7	,	,	PUNCT
bionys-634	271	8	a.	a.	PROPN
bionys-634	271	9	,	,	PUNCT
bionys-634	271	10	gowda	gowda	PROPN
bionys-634	271	11	,	,	PUNCT
bionys-634	271	12	l.	l.	PROPN
bionys-634	271	13	r.	r.	PROPN
bionys-634	271	14	,	,	PUNCT
bionys-634	271	15	&	&	CCONJ
bionys-634	271	16	prakash	prakash	PROPN
bionys-634	271	17	,	,	PUNCT
bionys-634	271	18	v.	v.	PROPN
bionys-634	271	19	(	(	PUNCT
bionys-634	271	20	2009	2009	NUM
bionys-634	271	21	)	)	PUNCT
bionys-634	271	22	.	.	PUNCT
bionys-634	272	1	detection	detection	NOUN
bionys-634	272	2	of	of	ADP
bionys-634	272	3	genetically	genetically	ADV
bionys-634	272	4	modified	modify	VERB
bionys-634	272	5	soya	soya	NOUN
bionys-634	272	6	and	and	CCONJ
bionys-634	272	7	maize	maize	NOUN
bionys-634	272	8	:	:	PUNCT
bionys-634	272	9	impact	impact	NOUN
bionys-634	272	10	of	of	ADP
bionys-634	272	11	heat	heat	NOUN
bionys-634	272	12	processing	processing	NOUN
bionys-634	272	13	.	.	PUNCT
bionys-634	273	1	food	food	NOUN
bionys-634	273	2	chemistry	chemistry	NOUN
bionys-634	273	3	,	,	PUNCT
bionys-634	273	4	117(3	117(3	NUM
bionys-634	273	5	)	)	PUNCT
bionys-634	273	6	,	,	PUNCT
bionys-634	273	7	514–521	514–521	NUM
bionys-634	273	8	.	.	PUNCT
bionys-634	274	1	https://doi	https://doi	X
bionys-634	274	2	.	.	PUNCT
bionys-634	274	3	org/10.1016	org/10.1016	PROPN
bionys-634	274	4	/	/	SYM
bionys-634	274	5	j.foodchem.2009.04.028	j.foodchem.2009.04.028	NOUN
bionys-634	274	6	waiblinger	waiblinger	NOUN
bionys-634	274	7	,	,	PUNCT
bionys-634	274	8	h.-u	h.-u	PROPN
bionys-634	274	9	.	.	PUNCT
bionys-634	274	10	,	,	PUNCT
bionys-634	274	11	ohmenhaeuser	ohmenhaeuser	NOUN
bionys-634	274	12	,	,	PUNCT
bionys-634	274	13	m.	m.	NOUN
bionys-634	274	14	,	,	PUNCT
bionys-634	274	15	meissner	meissner	PROPN
bionys-634	274	16	,	,	PUNCT
bionys-634	274	17	s.	s.	PROPN
bionys-634	274	18	,	,	PUNCT
bionys-634	274	19	schillinger	schillinger	NOUN
bionys-634	274	20	,	,	PUNCT
bionys-634	274	21	m.	m.	NOUN
bionys-634	274	22	,	,	PUNCT
bionys-634	274	23	pietsch	pietsch	VERB
bionys-634	274	24	,	,	PUNCT
bionys-634	274	25	k.	k.	PROPN
bionys-634	274	26	,	,	PUNCT
bionys-634	274	27	&	&	CCONJ
bionys-634	274	28	goerlich	goerlich	PROPN
bionys-634	274	29	,	,	PUNCT
bionys-634	274	30	o.	o.	PROPN
bionys-634	274	31	(	(	PUNCT
bionys-634	274	32	2012	2012	NUM
bionys-634	274	33	)	)	PUNCT
bionys-634	274	34	.	.	PUNCT
bionys-634	275	1	in	in	ADP
bionys-634	275	2	-	-	PUNCT
bionys-634	275	3	house	house	NOUN
bionys-634	275	4	and	and	CCONJ
bionys-634	275	5	interlaboratory	interlaboratory	ADJ
bionys-634	275	6	validation	validation	NOUN
bionys-634	275	7	of	of	ADP
bionys-634	275	8	a	a	DET
bionys-634	275	9	method	method	NOUN
bionys-634	275	10	for	for	ADP
bionys-634	275	11	the	the	DET
bionys-634	275	12	extraction	extraction	NOUN
bionys-634	275	13	of	of	ADP
bionys-634	275	14	dna	dna	NOUN
bionys-634	275	15	from	from	ADP
bionys-634	275	16	pollen	pollen	NOUN
bionys-634	275	17	in	in	ADP
bionys-634	275	18	honey	honey	PROPN
bionys-634	275	19	.	.	PUNCT
bionys-634	276	1	journal	journal	PROPN
bionys-634	276	2	of	of	ADP
bionys-634	276	3	consumer	consumer	NOUN
bionys-634	276	4	protection	protection	NOUN
bionys-634	276	5	and	and	CCONJ
bionys-634	276	6	food	food	NOUN
bionys-634	276	7	safety	safety	NOUN
bionys-634	276	8	,	,	PUNCT
bionys-634	276	9	7(3	7(3	NUM
bionys-634	276	10	)	)	PUNCT
bionys-634	276	11	,	,	PUNCT
bionys-634	276	12	243–254	243–254	NUM
bionys-634	276	13	.	.	PUNCT
bionys-634	277	1	https://doi.org/10.1007/	https://doi.org/10.1007/	PROPN
bionys-634	277	2	s00003	s00003	PROPN
bionys-634	277	3	-	-	PROPN
bionys-634	277	4	012	012	NUM
bionys-634	277	5	-	-	PUNCT
bionys-634	277	6	0774	0774	NUM
bionys-634	277	7	-	-	PUNCT
bionys-634	277	8	z	z	PROPN
bionys-634	277	9	zhang	zhang	PROPN
bionys-634	277	10	,	,	PUNCT
bionys-634	277	11	m.	m.	NOUN
bionys-634	277	12	,	,	PUNCT
bionys-634	277	13	liu	liu	PROPN
bionys-634	277	14	,	,	PUNCT
bionys-634	277	15	y.	y.	PROPN
bionys-634	277	16	,	,	PUNCT
bionys-634	277	17	chen	chen	PROPN
bionys-634	277	18	,	,	PUNCT
bionys-634	277	19	l.	l.	PROPN
bionys-634	277	20	,	,	PUNCT
bionys-634	277	21	quan	quan	PROPN
bionys-634	277	22	,	,	PUNCT
bionys-634	277	23	s.	s.	PROPN
bionys-634	277	24	,	,	PUNCT
bionys-634	277	25	jiang	jiang	PROPN
bionys-634	277	26	,	,	PUNCT
bionys-634	277	27	s.	s.	PROPN
bionys-634	277	28	,	,	PUNCT
bionys-634	277	29	&	&	CCONJ
bionys-634	277	30	zhang	zhang	PROPN
bionys-634	277	31	,	,	PUNCT
bionys-634	277	32	d.	d.	PROPN
bionys-634	277	33	(	(	PUNCT
bionys-634	277	34	2013	2013	NUM
bionys-634	277	35	)	)	PUNCT
bionys-634	277	36	.	.	PUNCT
bionys-634	278	1	one	one	NUM
bionys-634	278	2	simple	simple	ADJ
bionys-634	278	3	dna	dna	NOUN
bionys-634	278	4	extraction	extraction	NOUN
bionys-634	278	5	device	device	NOUN
bionys-634	278	6	and	and	CCONJ
bionys-634	278	7	its	its	PRON
bionys-634	278	8	combination	combination	NOUN
bionys-634	278	9	with	with	ADP
bionys-634	278	10	modified	modify	VERB
bionys-634	278	11	visual	visual	ADJ
bionys-634	278	12	loop	loop	NOUN
bionys-634	278	13	-	-	PUNCT
bionys-634	278	14	mediated	mediate	VERB
bionys-634	278	15	isothermal	isothermal	ADJ
bionys-634	278	16	amplification	amplification	NOUN
bionys-634	278	17	for	for	ADP
bionys-634	278	18	rapid	rapid	ADJ
bionys-634	278	19	onfield	onfield	NOUN
bionys-634	278	20	detection	detection	NOUN
bionys-634	278	21	of	of	ADP
bionys-634	278	22	genetically	genetically	ADV
bionys-634	278	23	modified	modify	VERB
bionys-634	278	24	organisms	organism	NOUN
bionys-634	278	25	.	.	PUNCT
bionys-634	279	1	analytical	analytical	ADJ
bionys-634	279	2	chemistry	chemistry	NOUN
bionys-634	279	3	,	,	PUNCT
bionys-634	279	4	85(1	85(1	NOUN
bionys-634	279	5	)	)	PUNCT
bionys-634	279	6	,	,	PUNCT
bionys-634	279	7	75–82	75–82	NUM
bionys-634	279	8	.	.	PUNCT
bionys-634	280	1	https://doi	https://doi	X
bionys-634	280	2	.	.	PUNCT
bionys-634	280	3	org/10.1021	org/10.1021	NOUN
bionys-634	280	4	/	/	SYM
bionys-634	280	5	ac301640p	ac301640p	PUNCT