Zaaboubi et al. 2025, Biologica Nyssana 16(2) 16 (2) December 2025: DOI: 10.46793/BiolNyss.16.2.9AD PCR-based investigation on transgenic maize status in corn processed products Original Article Elham Ashrafi-Dehkordi Nutrition Research Center and Department of Food Hygiene and Quality Control, School of Nutrition and Food Sciences, Shiraz Uni- versity of Medical Sciences, Shiraz, Iran elhamashrafi@gmail.com (corresponding author) Mohsen Shahdadi Nutrition Research Center and Department of Food Hygiene and Quality Control, School of Nutrition and Food Sciences, Shiraz Uni- versity of Medical Sciences, Shiraz, Iran Enayat Berizi Nutrition Research Center and Department of Food Hygiene and Quality Control, School of Nutrition and Food Sciences, Shiraz Uni- versity of Medical Sciences, Shiraz, Iran Siavash Babajafari Nutrition Research Center and Department of Food Hygiene and Quality Control, School of Nutrition and Food Sciences, Shiraz Uni- versity of Medical Sciences, Shiraz, Iran Seyed Mohammad Mazloomi Nutrition Research Center and Department of Food Hygiene and Quality Control, School of Nutrition and Food Sciences, Shiraz Uni- versity of Medical Sciences, Shiraz, Iran Received: June 09, 2025 Revised: August 23, 2025 Accepted: August 23, 2025 Abstract: Monitoring genetically modified organisms (GMOs) is increasingly required by law in countries with GMO labeling regulations. Efficient extraction of high-quality genomic DNA is essential for detecting and quantifying GM content in foods using PCR techniques. This study developed and evaluated various DNA extraction methods from corn seeds and products to ensure sufficient DNA yield free of contaminants and PCR inhibitors. Thirty samples, including corn seeds and derived products, were randomly purchased from supermarkets and grocery stores. Genomic DNA was extracted by different methods, and PCR was used to detect GMO-specific regions: NOS- terminator, 35S promoter, and EPSPS. The zein gene was also amplified to confirm the presence of the maize genome in all samples. Results indicated that 14 samples contained the NOS-terminator, 13 the 35S promoter, and one the EPSPS region, identifying 17 (57%) samples as transgenic. The methods proved effective for extracting quality DNA suitable for GMO detection. Many GM-positive products lacked labeling, underscoring the need for reliable detection methods and stricter labeling enforcement. Key words: Genetically modified organism, labeling, Maize, PCR Apstrakt: Ispitivanje prisustva transgenog kukuruza u prerađenim proizvodima od kukuruza zasnovano na PCR metodi Praćenje genetički modifikovanih organizama (GMO) sve je češće zakonski zahtevano u zemljama koje imaju propise o označavanju GMO proizvoda. Efikasna ekstrakcija genomske DNK visokog kvaliteta od suštinskog je značaja za detekciju i kvantifikaciju GMO sadržaja u hrani primenom PCR tehnika. U ovom radu razvijene su i procenjene različite metode ekstrakcije DNK iz zrna kukuruza i proizvoda od kukuruza, kako bi se obezbedio dovoljan prinos DNK bez prisustva kontaminenata i inhibitora PCR reakcije. Trideset uzoraka, uključujući zrna kukuruza i prerađene proizvode, nasumično je nabavljeno iz supermarketa i prodavnica. Genomska DNK je ekstrahovana različitim protokolima, a PCR je korišćen za detekciju GMO-specifičnih regiona: NOS terminator, 35S promotor i EPSPS. Gen zein je amplifikovan radi potvrde prisustva genoma kukuruza u svim uzorcima. Rezultati su pokazali da je 14 uzoraka sadržalo NOS terminator, 13 uzoraka 35S promotor, a jedan uzorak EPSPS region, čime je ukupno 17 uzoraka (57%) identifikovano kao transgeno. Primenjene metode pokazale su se efikasnim za ekstrakciju DNK visokog kvaliteta pogodnu za detekciju GMO. Značajan broj GMO- pozitivnih proizvoda nije imao odgovarajuću oznaku, što ukazuje na potrebu za pouzdanim metodama detekcije i strožom kontrolom označavanja. Ključne reči: genetički modifikovani organizam, označavanje, kukuruz, PCR Introduction Recombinant DNA (rDNA) technologies have been developed to improve modern farming and have provided many advantages in crops such as herbicide tolerance, biotic and abiotic stress resistance, and improved nutritional value (Ashrafi Dehkordi et al., 2021; Dehkordi et al., 2018). Many GMCs (Genetically Modified crops) have been approved since the mid-1990s worldwide, and the global area of GMCs was more than 190 million hectares in 2019 (ISAAA, 2019) and is expected to continue to increase. More than 200 different GMCs with varying features, of which the highest cultivated © 2025 Ashrafi-Dehkordi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and build upon your work non-commercially under the same license as the original. area belongs to soy, corn, canola, and cotton, and several products of these GMCs are available in markets (Ashrafi-Dehkordi et al., 2022). Maize is one of the major agricultural crops and the cultivation of GM maize is increasing worldwide. The global area under GM maize is more than 60 million hectares, accounting for about 32% of global corn production (ISAAA, 2019). Although, maize is approved for use as feed/food in many countries based on their safety evaluation criteria. However, many consumers are demanding information and appropriate labeling for foods derived from GMOs. In this regard, different labeling systems for GM foods have been introduced in different countries such as the European Union (EU), Korea, Russia, and Japan. There are different thresholds (between 0 and 5%) for accidental mixing of GM crops; for example, the thresholds in Russia are 0.9%, in the European Union are 0.9%, in Korea, 3% and 5% in Japan (Chiaravutthi et al., 2022). Different technologies are used for the detection of GMOs in food samples, such as protein-based and DNA- based methods (Fraiture et al., 2015; Griffiths et al., 2002; Rott et al., 2004). PCR-based methods such as conventional PCR, multiplex PCR, and RT-PCR methods have become the primarily used approaches for GMO detection, which can detect even small amounts of the novel DNA in both raw and processed foods, most widely used, because of its sensitivity, specificity, versatility, and high throughput application (Li et al., 2022; Zhang et al., 2013). On the other hand, food processing can affect the quality and quantity of DNA, leading to its removal or degradation. Moreover, for the successful DNA amplification step, one must have an efficient DNA extraction step, because there are different compounds that inhibit amplification of DNA, such as lipids, polysaccharides, and polyphenols, or extraction chemicals such as phenol, CTAB, and isopropanol (Anklam et al., 2002; Hübner et al., 1999; Saghai-Maroof et al., 1984). Therefore, in order to be able to amplify DNA, it is necessary to use an extraction method that provides DNA with an acceptable quantity, quality, and purity. This step is often very time-consuming. To identify transgenic organisms, an endogenous reference gene is needed as a standard to confirm species identification and determine the quality of genomic DNA. Various studies have been conducted to confirm internal control genes for different plants. For example, the zein, zSSIIb, and invertase genes in corn (Germini et al., 2004; Hernández et al., 2004; Pan et al., 2006), Lectin in soybean (Terry et al., 2001), SPS, oryzain beta, and ppi-PPF in rice (Chaouachi et al., 2007; Hernández et al., 2005), and β-fructosidase in the Solanaceae family (Chaouachi et al., 2008). The elements such as the CaMV35S promoter (CaMV), nopaline synthase (NOS) terminator, and selectable markers including the pat/bar gene, HPT gene, and the NPTII gene are commonly derived from naturally occurring viruses, bacteria, and fungi found in many GMOs (Li et al., 2022). These elements are usually used for detection targets in GMO screening. This screening is a rapid and cost-efficient method for the detection of samples potentially containing one or several GMOs. In this study, three DNA extraction methods were employed for isolating DNA from maize samples, and a PCR method was used to detect GM maize in various processed foods collected from the Shiraz market. Materials and Methods Samples collection Thirty samples, including raw corn and its products (corn puff, corn nut, canned corn, corn starch, corn flour, and popcorn), were bought from supermarkets in Shiraz. Tab. 1 provides an overview of the corn samples collected from supermarkets in Shiraz. The table lists each sample’s identification number, product name, and product type, offering a clear classification of the various corn-based foods analyzed in this study. DNA extraction Three different CTAB-based (cetyltrimethyl ammonium bromide) methods were used for DNA extraction from the samples. The first method, referred to as “Method 1,” follows the standard CTAB precipitation of DNA protocol (Gryson et al., 2004) and was applied to raw corn, corn nut, and corn flour. The second method, referred to as “Method 2,” uses the CTAB protocol with ethanol precipitation of DNA (Sisea & Pamfil, 2007) and was applied to canned corn, corn puff, and popcorn. The third method, referred to as “Method 3,” follows another CTAB protocol (Waiblinger et al., 2012) and was used for corn starch. Method 1: The DNA samples were extracted from raw corn, corn nuts, and corn flour using the standard CTAB method. Following grinding samples with a mortar and pestle, the powder was mixed with 1000 μL of buffer (containing 100 mM Tris-HCl, 20 mM Na2EDTA, 1.4 M NaCl, and 20 g/L CTAB, pH 8.0). The sample mixtures were transferred to 2-ml tubes and were incubated at 65 °C for 90 minutes in a water bath. The mixtures were gently rotated every 10 minutes for intermittent mixing before being centrifuged for 20 minutes at 13,000g. The resulting supernatant was transferred to a fresh 2-ml tube, followed by the addition of 500 µL of chloroform (Merck, Germany) and vortexing for 30 seconds. BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products The tube was centrifuged again at 13,000 g for another 20 minutes. The upper phase was transferred to a fresh tube containing 0.7 volumes of pre-chilled isopropanol (Merck, Germany) and kept overnight at -20 °C. The mixture was centrifuged at 13,000 g for 10 minutes. The supernatant was discarded, and the pellet was washed with 500 μL of 70% ethanol (Merck, Germany). After that, the pellet was subjected to centrifugation for 10 minutes at 13,000 g. After the removal of the supernatant, the pellet was air-dried. Subsequently, the DNA was dissolved in 50 μL SDW. Method 2: The DNA sample was extracted from canned corn, corn puffs, and popcorn using the modified CTAB method. The samples were ground using a mortar and pestle. Before milling, liquid nitrogen was added to the popcorn, and the canned corn was heated to below 40 °C. Then, the powder was mixed with 1000 μL of buffer (containing 1.4 M NaCl, 0.1 M Tris-HCl, 20 mM Na2EDTA, 20 g/L CTAB, and pH 8.0) in a 2-mL tube, with the addition of 25 μL of 1% (w/v) sodium dodecyl sulfate (SDS) to the corn puffs and popcorns. The mixture was incubated in a water bath at 65 °C for 2-4 hours. The tubes were gently inverted every 10 minutes for intermittent mixing. After that, 20 μL proteinase K (20 mg/L) was added and incubated at 37 °C for 45 minutes. Next, the tube was centrifuged at 13,000 g for 20 minutes. The supernatant was transferred to a new 2-mL tube containing 500 µL of chloroform (Merck, Germany) and was shaken for 30 seconds. The tube was centrifuged for 20 minutes at 13,000 g. The upper phase was transferred to a new tube, and two volumes of CTAB precipitation buffer (5 g/L CTAB and 0.04 M NaCl) were added, and the tube was incubated at room temperature for 60 minutes. Then the tube was centrifuged for 20 minutes at 13,000 g. The supernatant was discarded, and the precipitate was dissolved in 350 µL chloroform and 350 µL1.2 M NaCl. The mixture was shaken for 30 seconds, and the tube was centrifuged for 20 minutes at 13,000 g. The upper phase was transferred to a new tube. The 0.7 volumes of pre-chilled isopropanol were added, and the tube was shaken and kept overnight at -20 °C. The tube was centrifuged for 20 minutes at 13,000 g. The supernatant was discarded and washed with 500 µL pre-chilled ethanol (70%) (Merck, Germany). The tube was shaken carefully, and then centrifugation was done for 20 minutes at 13,000 g. The pellet was air-dried, and DNA was dissolved in 50 µL SDW. Method 3: The DNA sample was extracted from corn starch using the modified protocol of Waiblinger et al. (2012). The sample (5 g) was mixed with 25 mL of CTAB buffer (0.1 M Tris-HCl, 1.4 M NaCl, 20 mM Na2EDTA, and 20 g/L CTAB, pH 8.0), and then 50 μL of α-amylase solution (10 mg/mL) was added to the mixture. The sample mixture was transferred to a 50-mL tube and incubated at 65 °C for 4 hours in a water bath, with the tubes gently inverted every 10 minutes for intermittent mixing. The tube was centrifuged for 20 minutes at 13,000 g. The supernatant was transferred to a new 50-mL tube containing 10 mL of chloroform (Merck, Germany) Sample code Product name Product type 1 Corn seed Nut 2 Corn seed Nut 3 Corn seed Nut 4 Corn seed Nut 5 Corn seed Nut 6 Corn seed Nut 7 Corn seed Nut 8 Corn seed Nut 9 Corn seed Nut 10 Corn seed Nut 11 Bulk corn seed Nut 12 Bulk corn seed Nut 13 Bulk corn seed Nut 14 Canned corn Canned 15 Canned corn Canned 16 Canned corn Canned 17 Canned corn Canned 18 Raw seed Raw corn 19 Raw seed Raw corn 20 Raw seed Raw corn 21 Corn flour Flour 22 Corn flour Flour 23 Popcorn Pop corn 24 Popcorn Pop corn 25 Popcorn Pop corn 26 Extruded snack Puff 27 Extruded snack Puff 28 Extruded snack Puff 29 Corn Starch Starch 30 Corn Starch Starch Table 1. Sample code, names of corn samples and product types collected from supermarkets in Shiraz BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products and was shaken for 30 s. The tube was centrifuged at 13,000 g for 20 minutes. The upper phase was transferred to a new tube with 0.7 volume of pre- chilled isopropanol (Merck, Germany) and then incubated overnight at -20 °C. The centrifugation was done at 13,000 g for 10 minutes. The supernatant was discarded, and the pellet was transferred to a 2-mL tube and washed with 1500 μL70% ethanol (Merck, Germany). The centrifugation was performed at 13,000 g for 10 minutes. Finally, the supernatant was discarded, and the pellet was air-dried. The DNA was dissolved in 50 μL SDW. DNA quantification and purity measurement DNA concentration was measured by an Eppendorf spectrophotometer (ScanDrop2, Analytic Jena, Germany), using the UV absorbance at 260 nm (nanograms of DNA per microliter extract). Oligonucleotide primers Specific oligonucleotide primers were used for amplifying amplicons. The primers of NOS, 35S, EPSPS, and Zm were used to detect NOS-terminator, CaMV35S promoter, EPSPS structure gene region, and Zein gene (as an endogenous control), respectively. The sequences of oligonucleotide primers are given in Tab. 2. Polymerase chain reaction PCR in thermal cycler (AB Applied Biosystems, Veriti 96 well, USA) was used in reaction mixtures (20 µL) containing 2.5 µL of 4 mM dNTP, 2.5 µL of 10 x PCR buffer, 3 µL DNA, 1.5 µL 25 mM MgCl2, 0.6 µL primers with 20 µM each and 5 unites/µL of Taq DNA polymerase (Sinagene, Tehran, Iran). A thermal cycler was used for amplification according to the following PCR step-cycle program for all primers, as shown in Tab. 3. The analysis of PCR products was done on a 1.0% agarose gel electrophoresis. Results Three different CTAB-based DNA extraction methods were applied to the corn and corn-derived food samples presented in Tab. 1. A summary of the DNA yields and purity ranges obtained using the three extraction methods is presented in Tab. 4. The results show that there are discrepancies in the DNA extraction between the three methods. Following the genomic DNA extraction, the PCR method was used to identify the GMO samples. Firstly, the specific maize sequence, the zein gene, was employed to distinguish negative and positive outcomes resulting from amplification interference (Forte et al., 2005). Secondly, for the identification of GM material in corn samples, the 35S-promoter and NOS-terminator were employed. Name 5’-3’ sequence Target Amplicon (bp) Refrence Zm-F CGCCAGAAATCGTTTTTCAT Zein 139 (Germini et al. 2004) Zm-R GGTGGTGTCCTTGCTTCCTA Zein 139 (Germini et al. 2004) 35SF-1 GCTCCTACAAATGCCATCA P-35S 195 (Cardarelli et al. 2005) 35SR-1 GATAGTGGGATTGTGCGTCA nos-F GACACCGCGCGCGATAATTTATCC T-NOS 118 (Cardarelli et al. 2005) nos-R GACACCGCGCGCGATAATTTATCC GMO-F ATCCCACTATCCTTCGCAAGA EPSPS 169 (Cardarelli et al. 2005) GMO-R TGGGGTTTATGGAAATTGGAA Table 2. The list of primer pairs used in this study Step Zein CaMV 35S NOS EPSPS Initial denaturation 95 °C, 3 min 95 °C, 3 min 95 °C, 3 min 95 °C, 3 min Denaturation 95 °C, 45S 95 °C, 45S 95 °C, 45S 95 °C, 45S Annealing 50 °C, 45S 52 °C, 45S 61 °C, 45S 57 °C, 45S Extension 72 °C, 40S 72 °C, 40S 72 °C, 40S 72 °C, 40S Final extension 72 °C, 10 min 72 °C, 10 min 72 °C, 10 min 72 °C, 10 min Cycles 35 35 35 35 Table 3. Reaction conditions for Zein, CaMV 35S, NOS and EPSPS amplification Subsequently, the samples were analyzed to identify the specific type of GMO by amplifying the Roundup Ready gene using specific primers (Lin et al., 2000). The electrophoresis results of the PCR products showed that the zein gene (a band of about 137 bp) of all corn samples was successfully amplified. This result showed that the BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products isolated DNAs have good quality and contain maize DNA (Fig. 1). The positive detection of targetp genes in each individual corn sample is summarized in Tab. 5. This table presents the sample numbers alongside the specific target detected through PCR analysis, providing a clear and detailed overview of GMO presence in the analyzed samples. Electrophoresis of the PCR products showed a 118-bp band for NOS (Fig. 2A), a 195-bp band for P35S (Fig. 2B), and a 169-bp band for the EPSPS gene (Fig. 2C). The results showed that 13, 14, and one sample were positive for the 35S, NOS, and EPSPS gene, respectively. Discussion The quantity and integrity of DNA depend on the extraction method and the type of food. Contaminants present in sample matrices, including lipids, polysaccharides, polyphenols, and extraction substances, can affect DNA purity (Anklam et al., 2002). The food processing techniques, such as enzymatic activities, low DNA extraction methods DNA yield (ng/µL) DNA purity A260nm/A280nm ratio A260nm/A230nm ratio Method 1 123.66±39.84 1.77±0.33 1.87±0.11 Method 2 122±69.70 1.89±0.47 1.67±0.13 Method 3 85.49±4.90 1.95±0.04 1.78±0.03 Table 4. Summary of Mean ±SD, DNA yield and purity for corn samples using different DNA extraction methods Fig. 1. Representative agarose gel electrophoresis of maize PCR products (137 bp for the detection of zein gene): Ladder: 100 bp DNA ladder, -: negative control,+: positive control, Lane 1-13: corn nut, Lanes 14-17: canned corn, Lane 18-20: raw corn, Lane 21-22: corn flour, Lane 23-25: popcorn, Lane 26-28: corn puff, Lane 29-30: corn starch. pH, and heat, affect the integrity and quantity of DNA, so extracting DNA in sufficient purity and quantity is a difficult step (Peano et al., 2004; Vijayakumar et al., 2009). The different methods of DNA extraction applied in this study are capable of extracting sufficient amounts and quality DNA to identify the GM corn. A more detailed comparison of our results with previous studies further illustrates the role of extraction methods and sample matrices in DNA yield and integrity. In this study, three CTAB-based DNA extraction methods were applied to various corn and corn-derived food samples. The results showed noticeable differences in both DNA yield and purity between the methods. As shown in Tab. 4, Method 1 produced the highest DNA yield (123.66±39.84 ng/µL) but with slightly lower purity ratios (A260/280=1.77±0.33; A260/230=1.87±0.11) compared to Method 3, which yielded lower DNA concentration (85.49±4.90 ng/µL) but the highest purity (A260/280=1.95±0.04; A260/230=1.780±0.03). These findings suggest that Method 1 is more effective in quantity, while Method 3 provides purer DNA, possibly due to better removal of PCR inhibitors. that intense food processing, such as autoclaving and baking, significantly reduces DNA fragment size, resulting in the complete degradation of long DNA fragments and the retention of only short fragments (<500 bp). Nevertheless, successful PCR amplification of short amplicons was still possible, highlighting the importance of using appropriate primer design and extraction protocols for reliable GMO detection in processed foods. In this study, PCR results using specific primers showed that 17 (57%) samples were transgenic. PCR techniques have been widely employed in several studies to detect genetically modified (GM) foods. For instance, Lin et al. (2001) reported that the 35S or NOS were present in 22 out of 28 commercial genetically modified crops. Fifty samples of meat products processed in Serbia were tested using the PCR method. The results showed that 12 out of the 50 samples contained GM soybeans (Taski-Ajdukovic et al., 2009). Results from another study showed that 60 of 66 food samples contained RR soy (Cardarelli et al., 2005). In another study, 100 food samples were randomly collected from Turkish markets, and transgenic soybeans and corn were identified using PCR; 25% of the samples were transgenic (Arun et al., 2013). Ujhelyi et al. (2008) reported that 38% of random samples collected in Hungary were transgenic and that 7 out of 80 foods contained RR soy. However, they did not contain the NOS terminator. Gurakan et al. (2011) reported that the 35S promoter was present in 11 out of 31 commercial Turkish food products containing corn. Conclusion In this study, three simple and cost-effective methods were used to extract DNA from maize seeds and their products. Subsequently, PCR was employed to screen for genetically modified organisms (GMOs)- derived products. For screening products derived from GMOs, the PCR method was used. The isolated DNA of all samples was confirmed by the presence of the zein gene. The 35S promoter, NOS, and EPSPS were found in a number of samples. These results show that 17 samples (57%) are transgenic, which is consistent with the fact that Iran imports the majority of its corn from countries cultivating genetically modified corn. Therefore, the detection and labeling of these products is one of the demands of consumers regarding food safety and quality. Funding. This work was supported by the Shiraz University of Medical Sciences. (Project no: 24647) BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products Sample code Pro1 nos GMO 1 û ü û 2 ü û û 3 û û û 4 û û û 5 û û û 6 û û û 7 û ü û 8 ü ü û 9 û û û 10 û ü û 11 û ü û 12 û û û 13 ü û û 14 ü ü ü 15 ü ü û 16 ü û û 17 ü ü û 18 ü ü û 19 ü ü û 20 ü ü û 21 ü ü û 22 ü ü û 23 û û û 24 û û û 25 û û û 26 û û û 27 û û û 28 ü ü û 29 û û û 30 û û û Table 5. Summary of positive PCR detection of target in individual corn samples These results are consistent with findings by Peano et al. (2004), who reported that DNA yield and integrity varied widely depending on the extraction method and the complexity of the food matrix. In their study, the NucleoSpin Food kit was most effective in extracting DNA from complex matrices, while Wizard and QIAamp kits performed better for simple matrices like flours. Similarly, Vijayakumar et al. (2009) demonstrated BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products Fig. 2. Representative agarose gel electrophoresis of maize PCR products: Ladder: 100 bp DNA ladder, -: negative control,+: positive control, Lane 1-13: corn nut, Lanes 14-17: canned corn, Lane 18-20: raw corn, Lane 21-22: corn flour, Lane 23-25: popcorn, Lane 26-28: corn puff, Lane 29-30: corn starch. A band of 118 bp for NOS (Fig. 2A), a band of 195 bp for P35S (Fig. 2B), and a band of 169 bp for the EPSPS gene (Fig. 2C) References Anklam, E., Gadani, F., Heinze, P., Pijnenburg, H., & Van Den Eede, G. (2002). Analytical methods for detection and determination of genetically modified organisms in agricultural crops and plant-derived food products. European Food Research and Technology, 214(1), 3–26.https://doi.org/10.1007/s002170100415 Arun, Ö. Ö., Yılmaz, F., & Muratoğlu, K. J. (2013). PCR detection of genetically modified maize and soy in mildly and highly processed foods. Food Control, 32(2), 525–531 https://doi.org/10.1016/j.foodcont.2013.01.023 Ashrafi-Dehkordi, E., Derakhshanfar, A., Alborzi, A., Pouladfar, G. R., Babajafari, S., Kian, M., Darya, G. H., Foladi, Z., & Mazloomi, S. M. (2022). The effect of feeding genetically modified soybean on histopathology of organs in Sprague– Dawley rats. International Journal of Nutrition Sciences, 7(3), 171–178. https://doi.org/10.30476/ IJNS.2022.96866.1203 Ashrafi-Dehkordi, E., Alemzadeh, A., Tanaka, N., & Razi, H. (2021). Effects of vacuum infiltration, Agrobacterium cell density and acetosyringone concentration on Agrobacterium-mediated transformation of bread wheat. Journal of Consumer Protection and Food Safety, 16(1), 59–69. https:// doi.org/10.1007/s00003-020-01312-y Cardarelli, P., Branquinho, M. R., Ferreira, R. T., da Cruz, F. P., & Gemal, A. L. (2005). Detection of GMO in food products in Brazil: The INCQS experience. Food Control, 16(10), 859–866. https://doi.org/10.1016/j.foodcont.2004.07.010 Chaouachi, M., El Malki, R., Berard, A., Romaniuk, M., Laval, V., Brunel, D., & Bertheau, Y. (2008). Development of a real-time PCR method for the differential detection and quantification of four Solanaceae in GMO analysis: Solanum tuberosum, Solanum lycopersicum, Solanum melongena, and Capsicum annuum. Journal of Agricultural and Food Chemistry, 56(6), 1818–1828. Chaouachi, M., Giancola, S., Romaniuk, M., Laval, V., Bertheau, Y., & Brunel, D. (2007). A strategy for designing multi-taxa specific reference gene systems: Example of application – ppi phosphofructokinase (ppi-PPF) used for the detection and quantification of three taxa: Zea mays, Gossypium hirsutum, and Oryza sativa. Journal of Agricultural and Food Chemistry, 55(20), 8003– 8010. https://doi.org/10.1021/jf071429d Chiaravutthi, Y., & Pongjit, C. (2022). Thai consumer willingness to pay for differing GM labeling policies: Comparisons across time. The Thai Journal of Agricultural Economics, 40(3), 69–86. Dehkordi, E. A., Alemzadeh, A., & Tanaka, N. (2018). Agrobacterium-mediated transformation of ovary of bread wheat (Triticum aestivum L.) with a gene encoding a tomato ERF protein. Plant Cell Biotechnology and Molecular Biology, 19, 24–33. Forte, V., Di Pinto, A., Martino, C., Tantillo, G., Grasso, G., & Schena, F. (2005). A general multiplex-PCR assay for the detection of genetically modified soya and maize. Food Control, 16(6), 535– 539. https://doi.org/10.1016/j.foodcont.2004.05.010 BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products Fraiture, M.-A., Herman, P., Taverniers, I., De Loose, M., Deforce, D., & Roosens, N. H. (2015). Current and new approaches in GMO detection: Challenges and solutions. BioMed Research International, 2015, Article 392872. https://doi. org/10.1155/2015/392872 Germini, A., Zanetti, A., Salati, C., Rossi, S., Forré, C., Schmid, S., & Marchelli, R. (2004). Development of a seven-target multiplex PCR for the simultaneous detection of transgenic soybean and maize in feeds and foods. Journal of Agricultural and Food Chemistry, 52(11), 3275–3280. https:// doi.org/10.1021/jf035052x Griffiths, K., Partis, L., Croan, D., Wang, N., & Emslie, K. R. (2002). Review of technologies for detecting genetically modified materials in commodities and food. Australian Government Analytical Laboratories Report. http://www.daff. gov.au/__data/assets/pdf_file/0008/196982/AGAL_ report.pdf Gryson, N., Messens, K., & Dewettinck, K. (2004). Evaluation and optimisation of five different extraction methods for soy DNA in chocolate and biscuits: Extraction of DNA as a first step in GMO analysis. Journal of the Science of Food and Agriculture, 84(11), 1357–1363. https://doi. org/10.1002/jsfa.1767 Gürakan, G. C., & Aydin, G. (2011). Qualitative detection of GM maize (Bt11) in food and feed sold commercially in Turkey by PCR-based methods. Journal of Food Science and Technology, 10, 143– 146. Hernández, M., Esteve, T., & Pla, M. (2005). Real- time polymerase chain reaction based assays for quantitative detection of barley, rice, sunflower, and wheat. Journal of Agricultural and Food Chemistry, 53(18), 7003–7009. https://doi.org/10.1021/ jf050797j Hernández, M., Esteve, T., Prat, S., & Pla, M. (2004). Development of real-time PCR systems based on SYBR® Green I, Amplifluor™, and TaqMan® technologies for specific quantitative detection of the transgenic maize event GA21. Journal of Cereal Science, 39(1), 99–107. https:// doi.org/10.1016/S0733-5210(03)00071-7 Hübner, P., Studer, E., & Lüthy, J. (1999). Quantitative competitive PCR for the detection of genetically modified organisms in food. Food Control, 10(6), 353–358. https://doi.org/10.1016/ BIOLOGICA NYSSANA ● 16 (2) December 2025: Ashrafi-Dehkordi et al. ● PCR-based investigation on transgenic maize status in corn processed products S0956-7135(99)00074-2 ISAAA. (2019). Global status of commercialized biotech/GM crops: 2018 (ISAAA Brief No. 54). ISAAA. Li, Y., Xiao, F., Zhai, C., Li, X., Wu, Y., Gao, H., Li, J., Zhai, S., Liu, B., & Wu, G. (2022). Qualitative and quantitative real-time PCR methods for assessing false-positive rates in genetically modified organisms based on the microbial- infection-linked HPT gene. International Journal of Molecular Sciences, 23(17), 10000. https://doi. org/10.3390/ijms231710000 Lin, H.-Y., Chiang, J.-W., & Shih, Y.-C. (2001). Detection of genetically modified soybeans by PCR method and immunoassay kits. Journal of Food and Drug Analysis, 9(3).* Lin, H.-Y., Chiueh, L. C., & Shih, D. Y. C. (2000). Detection of genetically modified soybeans and maize by the polymerase chain reaction method. Journal of Food and Drug Analysis, 8(3).* Pan, A., Yang, L., Xu, S., Yin, C., Zhang, K., Wang, Z., & Zhang, D. J. (2006). Event-specific qualitative and quantitative PCR detection of MON863 maize based upon the 3′-transgene integration sequence. Journal of Cereal Science, 43(2), 250–257. https:// doi.org/10.1016/j.jcs.2005.10.003 Peano, C., Samson, M. C., Palmieri, L., Gulli, M., & Marmiroli, N. (2004). Qualitative and quantitative evaluation of genomic DNA extracted from GMO and non-GMO foodstuffs with four different extraction methods. Journal of Agricultural and Food Chemistry, 52(23), 6962–6968. https:// doi.org/10.1021/jf040008i Rott, M. E., Lawrence, T. S., Wall, E. M., & Green, M. J. (2004). Detection and quantification of Roundup Ready soy in foods by conventional and real-time polymerase chain reaction. Journal of Agricultural and Food Chemistry, 52(16), 5223– 5232. https://doi.org/10.1021/jf030803g Saghai-Maroof, M. A., Soliman, K. M., Jorgensen, R. A., & Allard, R. (1984). Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proceedings of the National Academy of Sciences, 81(24), 8014–8018. https:// doi.org/10.1073/pnas.81.24.8014 Sisea, C., & Pamfil, D. (2007). Comparison of DNA extraction methods for GMO analysis of food products. Bulletin of the University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca: Journal of Animal Science and Biotechnologies, 64(1–2).* Taški-Ajduković, K., Nikolić, Z., Vujaković, M., Milošević, M., Ignjatov, M., & Petrović, D. (2009). Detection of genetically modified organisms in processed meat products on the Serbian food market. Meat Science, 81(1), 230–232. https://doi. org/10.1016/j.meatsci.2008.07.024 Terry, C. F., & Harris, N. (2001). Event-specific detection of Roundup Ready soya using two different real-time PCR detection chemistries. European Food Research and Technology, 213(6), 425–431. https://doi.org/10.1007/s002170100404 Ujhelyi, G., Vajda, B., Béki, E., Neszlényi, K., Jakab, J., & Jánosi, A. (2008). Surveying the Roundup Ready soy content of commercially available food products in Hungary. Food Control, 19(10), 967–973. https://doi.org/10.1016/j. foodcont.2007.10.004 Vijayakumar, K., Martin, A., Gowda, L. R., & Prakash, V. (2009). Detection of genetically modified soya and maize: Impact of heat processing. Food Chemistry, 117(3), 514–521. https://doi. org/10.1016/j.foodchem.2009.04.028 Waiblinger, H.-U., Ohmenhaeuser, M., Meissner, S., Schillinger, M., Pietsch, K., & Goerlich, O. (2012). In-house and interlaboratory validation of a method for the extraction of DNA from pollen in honey. Journal of Consumer Protection and Food Safety, 7(3), 243–254. https://doi.org/10.1007/ s00003-012-0774-z Zhang, M., Liu, Y., Chen, L., Quan, S., Jiang, S., & Zhang, D. (2013). One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on- field detection of genetically modified organisms. Analytical Chemistry, 85(1), 75–82. https://doi. org/10.1021/ac301640p