item: #1 of 191 id: biomedich-101 author: Syuhada, Mahfud; Sofa, Sintia Ainus; Sedyadi, Endaruji title: The Effect of Cassava Peel Starch Addition to Bioplastic Biodegradation Based On Chitosan On Soil and River Water Media date: 2020-04-16 words: 5051 flesch: 64 summary: Table 1 showed that there was a decrease in water resistance along with the addition of cassava peel starch variations. Chitosan bioplastic thickness with the addition of cassava peel starch variations on average under 0.25 mm, so it can be said that some of the standard value set by JIS (Japanese Industrial Standard) of < 0.25 mm, with the exception of variations of 20. 10 Biology, Medicine, & Natural Product Chemistry 9 (1), 2020: 7-13 Based on Table 1, the addition cassava peel starch to chitosan bioplastics could increase the tensile strength of bioplastics. keywords: absorption; addition; amorphous; analysis; biodegradable; biodegradation; bioplastic; cassava; cassava peel; chitosan; cm-1; correlation; dari; day; decrease; effect; elongation; figure; form; fourteenth; ftir; grams; groups; increase; mass; materials; mechanical; media; modulus; number; pati; peel; peel starch; penambahan; polymer; presence; process; properties; raw; reduction; results; river; second; set; significant; soil; solution; starch; strength; table; tensile; test; thickness; value; variance; variation; water; wave; young cache: biomedich-101.pdf plain text: biomedich-101.txt item: #2 of 191 id: biomedich-103 author: Sugiyanto, Sugiyanto; Abrori, Muchammad title: A Mathematical Model of the Covid-19 Cases in Indonesia (Under and Without Lockdown Enforcement) date: 2020-04-16 words: 2697 flesch: 63 summary: 2d Natural death rates are not due to COVID-19 infected subpopulation. 3d Natural death rates are not due to COVID-19 recovery subpopulation. keywords: birth; countries; covid-19; day; death; deployment; individuals; indonesia; infected; interaction; lockdown; march; model; natural; number; parameter; people; person; rates; recovery; subpopulation; susceptible; value; virus cache: biomedich-103.pdf plain text: biomedich-103.txt item: #3 of 191 id: biomedich-104 author: Amin, Mohamad; Fahmi, Muhammad Najib; Ridho, Muhammad Andi Ali; Fitri, Nurul; Lestari, Umie; Maulina, Dina; Amin, Ihya Fakhrurizal title: The Potential of Chrysin of Oroxylum indicum L. to Induce Carbonic Anhydrase (CA) to Improve Cattle Fertility date: 2020-04-16 words: 4366 flesch: 57 summary: They were used to identify the bioactive Amin et al. – Amin et al. – keywords: 1999; 2007; 2013; 2016; activity; addition; amin; anhydrase; antioxidant; april; biochem; biological; biology; bungli; carbonic; cattle; chemistry; chrysin; ciftci; compound; dan; docking; doi; drug; effects; et al; fertility; flavonoids; flavonol; herbal; histochemical; human; india; indicum; indonesia; insemination; interaction; issn; journal; ligand; male; medicinal; medicine; mezquita; molecular; motility; natural; oroxylum; plant; potential; protein; pubchem; quality; rats; receptor; reproductive; research; sci; semen; seminal; software; sperm; structure; studies; study; swiss; system; target; testes; testicular; testosterone; vent; volume cache: biomedich-104.pdf plain text: biomedich-104.txt item: #4 of 191 id: biomedich-106 author: Kusuma, Trio Yonathan Teja title: Analysis of Body Posture using Rapid Entire Body Assessment (REBA) and Rapid Upper Limb Assessment (RULA) to Improve the Posture of Sand Paper Machine Operators and Reduce the Risk of Low Back Pain date: 2020-04-16 words: 2430 flesch: 72 summary: Assessment of body posture score. RULA score of sanding machine operator posture. keywords: analysis; angle; arm; assessment; body; dimensions; entire; group; load; machine; neck; operator; pain; posture; process; rapid; reba; results; risk; rula; sanding; score; table; upper; work; wrist cache: biomedich-106.pdf plain text: biomedich-106.txt item: #5 of 191 id: biomedich-107 author: Adikwu, Elias; Ehigiator, Ben title: Toxicological Effects of Ethanolic Stem Bark Extract of Xylopia Aethiopica on Testicular Oxidative Stress Markers and Histology of Male Rats date: 2020-05-11 words: 3562 flesch: 57 summary: Abstract Impairment in testicular function can occur through perturbations in testicular oxidative stress markers and histology. This observation is a sign of testicular oxidative stress caused by ROS.The overwhelming activity of ROS in the testis might have surpassed the regulatory capacity of antioxidants leading to their depletion. keywords: 2020; 800mg; aethiopica; albino; bark; cellular; control; damage; data; days; degeneration; dependent; dose; eexa; effect; ethanolic; extract; fashion; fig; function; glutathione; group; histology; infertility; interstitial; levels; loss; male; markers; mean; n=5; necrosis; nigeria; oxidative; p.o; p<0.001; p<0.05; rats; ros; significant; stem; stress; study; table; testicular; testis; time; tissues; toxicological; toxicology; university; xylopia; ±sem cache: biomedich-107.pdf plain text: biomedich-107.txt item: #6 of 191 id: biomedich-109 author: Hordofa, Teshome Gonfa title: Isolation and Characterization of Sesquiterpenes from Stem Bark of Warburgia ugandensis Sprague date: 2020-05-17 words: 4971 flesch: 70 summary: The compounds isolated from this plant also possess antifeedant, antibacterial, antifungal, anti-mycobacterial, cytotoxic (Rabe et al., 2000, Rajab et al., 2000) anti-plasmodial, anti-trypanosomal (Wube et al., 2010) anti-asthmatic (Karani et al., 2013) and antileishmanial activities (Ngure et al., 2009). The stem bark and roots have been used for the treatment of various diseases such as diarrhea, cough, common cold, general muscular pains, internal wounds, loss of appetite, malaria, syphilis, gonorrhea, stomachache, toothache, colds, throat and chest infections, fever, weak joints and general body pains (Rabe et al., 2000, Dharan et al., 2008). keywords: absorption; acetate; bark; bioactive; carbon; cdcl3; ch2; ch3; characterization; chemistry; cho; cinnamolide-3β; cm-1; compounds; data; doi; et al; ethiopia; figure; group; isolation; kioy; medicinal; melting; mhz; natural; nmr; o o; plant; point; ppm; presence; proton; quaternary; sesquiterpenes; spectroscopic; spectrum; sprague; stem; table; ugandensidial; ugandensis; warburgia; wu-2; wube cache: biomedich-109.pdf plain text: biomedich-109.txt item: #7 of 191 id: biomedich-111 author: Bioltif, Yilni Edward; Edward, Naanma Bioltif; Tyeng, Terry Dalyop title: A Chemical Overview of Azanza garckeana date: 2020-11-17 words: 2306 flesch: 51 summary: Keywords: Azanza garckeana; Chemical; Compounds; Mansonone. Azanza garckeana is a member of the Malvaceae family. keywords: acetate; acid; activity; azanza; azanza garckeana; bark; biology; ch3 ch3; ch3 o; chemical; chemistry; compounds; decoction; dichloromethane; different; diseases; eastern; edible; food; fruit; garckeana; goron; gossypol; growth; indigenous; infusion; leaves; long; malawi; mansonone; medicine; methanol; natural; nhexane; nigeria; nutritional; plant; properties; root; science; stem; tree; tula; uses; wild; zimbabwe cache: biomedich-111.pdf plain text: biomedich-111.txt item: #8 of 191 id: biomedich-112 author: Kiros, Tsegu title: Non-Alkaloidal Compounds from Khat (Catha edulis) Leaves date: 2020-11-17 words: 4559 flesch: 70 summary: Some of the representative compounds reported from Khat plant so far are: Dihydromyricetin (Szendrei, 2004; Al-Meshal et al., 1985; Ermias et al., 1984), Dihydromyricetin-3-O- rhamnoside (Szendrei, 2004; Al-Meshal et al., 1985; Ermias et al., 1984), Kaempferol (Szendrei, 2004; Al- Meshal et al., 1985; Ermias et al., 1984), Myricetin (Szendrei, 2004; Al-Meshal et al., 1985; Ermias et al., 1984; Bredholt, 2010), Myricetin-3-O-²̭D-galactoside (Szendrei, 2004; Al- Meshal et al., 1985; Ermias et al., 1984), Myricetin-3-O- https://doi.org/10.14421/biomedich.2020.92.81-89 82 Biology, Medicine, & Natural Product Chemistry 9 (2), 2020: 81-89 rhamnoside (Szendrei, 2004; Al-Meshal et al., 1985; Ermias et al., 1984), Quercetin (Szendrei, 2004; Al- Meshal et al., 1985; Bredholt, 2010), Quercetin-3-O-²̭D- galactoside (Szendrei, 2004; Al-Meshal et al., 1985; Ermias et al., 1984), Celastrol (Bredholt, 2010; Brossi, 1990); Baxter et al., 1979), Iguesterin (Brossi, 1990; Baxter et al., 1979), Pristimerin (Bredholt, 2010; Brossi, 1990; Baxter et al., 1979),Tingenin A (Bredholt, 2010; Brossi, 1990); Baxter et al., 1979), Tingenin B ( Bredholt, 2010; Brossi, 1990; Baxter et al., 1979), Friedeline (Brossi, 1990; Baxter et al., 1979), Sitosterol (Bredholt, 2010; Brossi, 1990; Baxter et al., 1979), (+)- Cathine (Brossi, 1990;Wabe and Mohammed, 2012; Feyissa and Kelly , 2008), (-)-Cathinone (Brossi, 1990; Wabe and Mohammed, 2012; Feyissa and Kelly, 2008), 3,6-Dimethyl-2,5-diphenyl pyrazine (Brossi, 1990; Wabe and Mohammed, 2012; Feyissa and Kelly, 2008), Merucathine (Brossi, 1990; Wabe and Mohammed, 2012; Feyissa and Kelly , 2008), Merucathinone (Brossi, 1990; Wabe and Mohammed, 2012; Feyissa and Kelly , 2008), Cathedulins E2- E6 (Szendrei, 2004; Dhaifalah et al., 2004; Brossi, 1990; Wabe et al., 2012; Baxter et al., 1979), Cathedulin K1 (Szendrei, 2004; Dhaifalah et al., 2004; Brossi, 1990; Wabe et al., 2012; Baxter et al., 1979), Cathedulin K2 (Szendrei, 2004; Dhaifalah et al., 2004; Brossi, 1990; Wabe et al., 2012; Baxter et al., 1979), Cathedulin K6 (Szendrei, 2004; Dhaifalah et al., 2004; Brossi, 1990; Wabe et al., 2012; Baxter et al., 1979), Cathedulin K12 (Szendrei, 2004; Dhaifalah et al., 2004; Brossi, 1990; Wabe et al., 2012; Baxter et al., 1979), Cathedulin K15 (Szendrei, 2004; Dhaifalah et al., 2004; Brossi, 1990; Wabe et al., 2012; Baxter et al., 1979), Alanine (Feyissa et al., 2008; Halbach, 1972), ±̭Aminobutyric acid (Feyissa et al., 2008; Halbach, 1972), Arginine (Feyissa et al., 2008; Halbach, 1972), Asparaginic acid , (Feyissa et al., 2008; Halbach, 1972), Choline (Feyissa et al., 2008; Halbach, 1972), Glutamic acid (Feyissa et al., 2008; Halbach, 1972), Glycine (Feyissa et al., 2008; Halbach, 1972), Histidine (Feyissa et al., 2008; Halbach, 1972), Isoleucine (Feyissa et al., 2008; Halbach, 1972), Leucine (Feyissa et al., 2008; Halbach, 1972), Ornithine (Feyissa et al., 2008; Halbach, 1972), Ascorbic acid (Feyissa et al., 2008; Halbach, 1972), Niacin (Feyissa et al., 2008; Halbach, 1972), Riboflavin (Feyissa et al., 2008; Halbach, 1972) and Thiamine (Feyissa et al., 2008; Halbach, 1972). Suggested chemical structure of compound KNA-1 86 Biology, Medicine, & Natural Product Chemistry 9 (2), 2020: 81-89 The 1H, 13C, and DEPT NMR spectral values of KNA-2 are tabulated and compared with literature value (Jr et al., 2009) as follows (Table 5). keywords: acid; alkaloidal; baxter; baxter et; brossi; c-1; c-2; c-3; c-4; c-6; catha; chemistry; chewable; compounds; dhaifalah; edulis; ermias; et al; ethiopia; etoac; extract; feyissa; figure; fractions; h-2; h-3; h-6; halbach; khat; kna-1; leaves; meod; meoh/; natural; nmr; non; plant; proton; rhamnoside; spectrum; szendrei; table; tlc; wabe cache: biomedich-112.pdf plain text: biomedich-112.txt item: #9 of 191 id: biomedich-113 author: Egwuatu, Tochukwu Frank; Iroanya, Onyekachi Ogbonnaya; Adekoya, Khalid Olajide title: Prevalence of Psychoactive Substance Use Among Nigerian Male Commercial Vehicle Drivers Selected from The Three Major Ethnic Groups in Nigeria date: 2020-07-26 words: 5664 flesch: 67 summary: This study showed that 25(26.04 %) of Igbo drivers used one or more drug(s) and this is lower than the findings of Aniedu and Okonkwo, (2008) who reported the prevalence of psychoactive drug use amongst taxi drivers to be 85.4 %. Prevalence of psychoactive drug use by Taxi drivers in Nigeria. keywords: 2012; 2018; abuse; accidents; administration; alcohol; analysis; associated; benzodiazepine; biology; bzo; chemistry; commercial; drivers; driving; drug; drug use; ethnic; ethnicities; ethnicity; findings; forensic; frequency; groups; hausa; health; highest; history; igbo; illicit; journal; major; male; marijuana; medicine; mop; morphine; n=96; nigeria; number; participants; pcp; phencyclidine; polysubstance; positive; prevalence; psychoactive; public; report; road; samples; study; substance; table; thc; times; toxicology; traffic; urine; use; users; vehicle; years; yoruba cache: biomedich-113.pdf plain text: biomedich-113.txt item: #10 of 191 id: biomedich-117 author: Kaur, Gunpreet; Gupta, Vikas; Singhal, R G; Bansal, Parveen title: Isolation and Characterization of Stigmasterol from Fritillaria roylei date: 2020-11-16 words: 2739 flesch: 54 summary: NMR spectra of isolated compound Stigmasterol from Fritillaria roylei (Kshirakakoli). As the market price of Stigmasterol is 32,334/10g (approximately) and it will be difficult for commercial manufacturers to replace Fritillaria roylei plant with stigmasterol just to claim the presence of Fritillaria roylei (Kshirakakoli). keywords: activity; analysis; ayurveda; chemical; cm-1; compound; doi; et al; extract; fritillaria; group; herbal; hexane; identification; india; isolated; isolation; issn; iucn; journal; kshirakakoli; lack; marker; mass; medicinal; medicine; methanol; natural; nmr; phytochemical; plant; presence; quality; research; root; roylei; sciences; screening; silica; standardization; steroids; stigmasterol; substitutes; substitution; tlc cache: biomedich-117.pdf plain text: biomedich-117.txt item: #11 of 191 id: biomedich-118 author: Halla, Noureddine; Boucherit, Kebir; Zeragui, Bankaddour; Djelti, Abdelkader; Belkhedim, Ziane; Hassani, Rachida; Benatallah, Saada; Djellouli, Hassiba; Kacimi, Oumlkheir; Boucherit-Otmani, Zahia title: Polyphenols Content and Antimicrobial, Antioxidant and Hemolytic Activities of Essential Oils from Four Selected Medicinal Plants Growing in Algeria date: 2020-11-13 words: 8834 flesch: 55 summary: Laghouiter et al. (2015) recorded an EC50 of around 208.495 ± 4.247 μg/mL of M. piperita essential oil. Keywords: Polyphenols; Antimicrobial; Antioxidant; Essential oils; Hemolytic; Mentha piperita; Myrtus nivellei; Pituranthos scoparius; Rosmarinus officinalis; Sahara. keywords: acid; activities; activity; aerial; aeruginosa; albicans; algeria; antibacterial; antifungal; antimicrobial; antioxidant; antioxidant activity; ascorbic; atcc; aureus; bacteria; biological; biology; candida; cells; cereus; chemical; chemistry; clsi; coli; composition; compounds; concentration; content; control; different; dpph; ec50; effect; essential; essential oils; et al; extract; food; gae; halla; harvest; hemolytic; higher; ic50; incubation; journal; laboratory; leaves; mbc; medicinal; medicine; membrane; mentha; mentha piperita; method; mfc; mics; min; minimum; myrtus; natural; nivellei; october; officinalis; officinalis essential; order; piperita; piperita essential; pituranthos; pituranthos scoparius; plants; polyphenols; positive; power; product; radical; results; rosmarinus; rosmarinus officinalis; sahara; salmonella; scoparius; scoparius essential; solution; species; staphylococcus; strains; study; table; tested; time; total; typhimurium; values; work; yield cache: biomedich-118.pdf plain text: biomedich-118.txt item: #12 of 191 id: biomedich-119 author: Smail, Harem Othman title: The Role of Gene Therapy in the Treatments of Type 1 Diabetes Mellitus: a review date: 2020-11-10 words: 6319 flesch: 56 summary: Cell therapy for type 1 diabetes: current and future strategies. Navigating two roads to glucose normalization in diabetes: automated insulin delivery devices and cell therapy. keywords: adult; advanced; approaches; autoimmune; beta; biology; cell; cell therapy; chemistry; clinical; control; cure; current; damage; development; diabetes; diabetes mellitus; diabetes therapy; diabetes type; diabetic; differentiation; early; et al; expression; function; future; gene; gene therapy; glucose; high; history; human; immunosuppression; induced; insulin; insulin gene; islet; islet transplantation; j.a; journal; leptin; life; liu; long; mass; medicine; mellitus; metabolism; methods; mice; molecular; natural; nature; new; non; pancreatic; patients; possible; potential; prevent; prevention; product; rats; recent; regeneration; replacement; research; response; review; role; science; secretion; shapiro; smail; stem; strategies; study; t1d; therapeutic; therapies; therapy; transfer; transplantation; treatment; trials; type; understanding; vectors; viral; wang; years; zhou; β cells cache: biomedich-119.pdf plain text: biomedich-119.txt item: #13 of 191 id: biomedich-120 author: Appeh, Osita Gabriel; Egwuatu, Tochukwu Frank; Ogbunta, Chiamaka Maryann title: Microbial Qualities of Nkwuaku and Ogbaru Streams Located in Awgu Local Government Area in Enugu State, Nigeria date: 2020-11-22 words: 4701 flesch: 56 summary: Nkwuaku stream sample had no objectionable odour while Ogbaru stream sample had an objectionable odour. 1 8.33% 12 100% Table 8 shows the percentage occurrence of fungi isolates from stream water samples. keywords: 100ml; aeruginosa; agar; area; aspergillus; aureus; bacterial; campylobacter; characteristics; coli; colonies; colour; convex; distilled; drinking; enterococcus; epa; escherichia; faecalis; fungal; fungi; government; grayish; higher; isolates; klebsiella; local; lower; measured; microbial; nigeria; nkwuaku; occurrence; odour; ogbaru; opaque; percentage; physicochemical; pink; proteus; pseudomonas; qualities; quality; salmonella; sample; smooth; solids; sources; spp; staphylococcus; state; stream; study; table; temperature; total; turbidity; value; water; water samples; white cache: biomedich-120.pdf plain text: biomedich-120.txt item: #14 of 191 id: biomedich-124 author: Hardiansyah, Muhammad Yusril; Musa, Yunus; Jaya, Abdul Mollah title: The Effectiveness of Giving Plant PGPR Rhizosphere Bamboo on Cocoa Seeds Germination at The Nursery Level date: 2021-07-01 words: 3444 flesch: 58 summary: This study aims to determine the effectiveness of the provision of Plant Growth Promoting Rhizobacteria bamboo rhizosphere against cocoa seed germination. The interaction between the use of cocoa species and the treatment of bamboo rhizosphere PGPR concentration has a very significant effect on cocoa seed germination. keywords: abnormal; abnormal seeds; average; bamboo; bantaeng; benih; cocoa; cocoa seeds; concentration; conditions; dan; day; design; effect; factor; gantarangkeke; germination; good; growth; gtb; highest; increase; indonesia; initial; local; low; mcc; microbes; number; nursery; observation; pgpr; phase; plant; process; provision; quality; rate; research; results; rhizobacteria; rhizosphere; seed germination; seed growth; seeds; soaking; solution; speed; sprouts; study; time; treatment; type; use; water cache: biomedich-124.pdf plain text: biomedich-124.txt item: #15 of 191 id: biomedich-125 author: Darmawan, Marsha Ruthy; Maharani, Elysanti Dwi title: Brittle Bone Brothers: Osteogenesis Imperfecta Conventional Serial Case date: 2021-07-13 words: 1829 flesch: 53 summary: Here we report three cases of OI type IV in adults. Here we present three cases of OI type IV in one family of three brothers in their 40s and the only adults with OI in our hospital. keywords: adults; bone; bowing; brittle; collagen; conventional; dijk; figure; forlino; fractures; group; humerus; imperfecta; left; long; marini; missing; mutation; old; osteogenesis; patients; ray; rays; sclera; skeletal; stature; type; union; van; year cache: biomedich-125.pdf plain text: biomedich-125.txt item: #16 of 191 id: biomedich-126 author: Sanadheera, Subhashinie; Subasinghe, Deepanjana; Solangaarachchi, Melissa Nethmi; Suraweera, Manju; Suraweera, Noshara Yushanthi; Tharangika, Nadeesha title: Hibiscus rosa-sinensis L. (red Hibiscus) Tea, Can It Be Used as A Home-Remedy to Control Diabetes and Hypercholesterolemia? date: 2021-07-27 words: 5056 flesch: 47 summary: Quantitative analyses have revealed that the aqueous extract of Hibiscus rosasinensis flower petals have high amounts of tannins and anthocyanin thus show high ferric reducing antioxidant power. Chronic toxic effects of Hibiscus rosasinensis flower extract have not been reported yet, although tea and drinks made from Hibiscus rosasinensis flower petals have been used globally from ancient times as a home remedy and a beverage. keywords: activity; acute; anti; antioxidant; aqueous; articles; available; beneficial; blood; chemistry; cholesterol; compounds; control; data; day; diabetes; diabetic; dose; effects; et al; ethanolic; extract; flower; glucose; haji; herbal; hibiscus; hibiscus rosasinensis; hibiscus tea; high; home; humans; induced; inflammatory; insulin; journal; lanka; level; linn; medicinal; medicine; people; petals; plant; pregnancy; present; rats; red; research; review; rosasinensis; sabdariffa; scientific; significant; sri; studies; study; tea; total; toxic; triglycerides; use; variety; water; wistar; world cache: biomedich-126.pdf plain text: biomedich-126.txt item: #17 of 191 id: biomedich-129 author: Mohammedi, Zohra title: Extraction, Phenolic Content and Hydrogen Peroxide Scavenging Capacity of Extracts from Some Honey Samples, Propolis and Bee Pollen date: 2021-07-16 words: 4618 flesch: 54 summary: Phenolic compounds from honey samples, propolis, and bee pollen were extracted by methanol and subjected to radical scavenging activity towards hydrogen peroxide. Total phenolic contents The total phenolic contents of honey samples, propolis, and bee pollen extracts were analyzed by the Folin- Ciocalteu method (Singleton et al., 1999) using gallic acid as a standard. keywords: acid; activities; activity; antioxidant; antioxidant activity; apis; ascorbic; authors; bee; bee pollen; biology; capacity; chemistry; chua; citrus; compounds; content; different; effect; et al; extraction; extracts; flavonoids; food; g honey; gallic; h2o2; high; honey; honey samples; hydrogen; hydrogen peroxide; ic50; journal; kaempferol; medicine; mellifera; methanol; method; mg/100; mggae/100; mgre/100; multiflower; natural; peroxide; phenolic; phenolic compounds; phenolic content; phenolic extracts; physicochemical; pollen; products; properties; propolis; radical; results; samples; scavenging; scavenging activity; sci; solution; sources; standard; study; table; test; total; total phenolic; type; values; water cache: biomedich-129.pdf plain text: biomedich-129.txt item: #18 of 191 id: biomedich-13 author: Setyowati, Rini; Sudarsono, Sudarsono; P, Setyowati E title: The Effect of Water-Soluble Stem Extract “Kayu Kuning“ (Arcangelisia flava L.Merr) On The Growth Inhibition of Candida albicans ATCC 10231 and Trichophyton mentagrophytes IN VITRO date: 2014-04-01 words: 2862 flesch: 60 summary: Results and Discussion Figure 1 showed that the hRf value of berberine chloride was 61 and spot like berberine solution test was 62 at visible light, UV 254 nm and 366 nm. Analysis result of Post Hoc Tukey for C.albicans and T.mentagrophytes, correlation between positive control group and test solution group were not showing significant differences, except group number 1 (0,0625% concentra-tion), that was by p>0,05 value. keywords: activities; activity; alkaloid; analysis; anti; berberine; c.albicans; candida; chloride; concentration; content; control; curve; extract; figure; fungi; group; growth; inhibition; kayu; kuning; media; medicine; mfc; mic; microbial; plant; sample; significant; soluble; solution; spot; stem; t.mentagrophytes; table; test; tlc; trichophyton; value; water cache: biomedich-13.pdf plain text: biomedich-13.txt item: #19 of 191 id: biomedich-130 author: Kaur, Gunpreet; Gupta, Vikas; Sharma, Ravinder; Kumar, Sanjiv; Singhal, R G; Singh, Ranjit; Bansal, Parveen title: Compliance Level of Textual Therapeutic Usage of Kshirakakoli Containing Formulations with a Serial Ethnomedicinal Survey and Modern System of Medicine date: 2021-07-01 words: 3916 flesch: 71 summary: The knowledge of medicinal plants started fading away with the desertion of Gurukul system of ancient teaching, as written details of most of the medicinal plants are not available (Sharma and Balkrishna, 2005). Yes Yes Used to treat inflammation, pain and arthritis, Useful in treatment of chronic back pain, Useful in treatment of female infertility, provide strength to the local soft tissues, thus play significant role in the management of cervical spondylosis or osteoarthritis of cervical spine (Pawar et al., 2011; Panda and Debnath, 2011; Kaushik et al., 2017; Kunjibettu et al., 2017). keywords: ancient; available; ayurveda; ayurvedic; biology; body; case; charaka; chemistry; chikitsa; clinical; compliance; date; diseases; disorders; doi; et al; female; formulations; fritillaria; ghrita; gout; hebbar; important; india; infertility; information; int; issn; j.v; journal; kaur; kshirakakoli; level; literature; management; march; medical; medicinal; medicine; mentioned; modern; natural; pain; pharm; plant; potentials; practitioners; pradesh; product; punjab; research; roylei; samhita; scientists; sharma; strength; studies; study; survey; system; taila; textual; therapeutic; tmps; traditional; trado; treatment; trials; usage; useful; uses; uttar cache: biomedich-130.pdf plain text: biomedich-130.txt item: #20 of 191 id: biomedich-135 author: Mulluye, Kelemu; Kebede, Ameha; Bussa, Negussie title: Production and Optimization of Pectinase from Pectinolytic Fungi Cultivated on Mango peels and Pectin Subjected to Submerged Fermentation date: 2021-07-01 words: 4275 flesch: 53 summary: Effect of incubation period on enzyme production. A slight decrease in enzyme production was observed until the concentration reached 2%. keywords: acid; activity; agar; aspergillus; broth; concentration; culture; days; different; distilled; effect; enzyme; extraction; fermentation; flask; fruit; fungal; fungi; growth; incubation; isolate; mango; mango pectin; media; medium; microbial; mixture; optimization; optimum; parameters; pectinase; pectinase production; pectinolytic; peels; period; preparation; processing; production; pure; solution; source; submerged; substrate; table; temperature; time; volume; waste; water; yield cache: biomedich-135.pdf plain text: biomedich-135.txt item: #21 of 191 id: biomedich-137 author: Wijaya, Panca Buana; Saraswati, Tyas Rini; Tana, Silvana; Sunarno, Sunarno; Prihastanti, Erma title: The Effect of Balimo (Zanthoxylum nitidum) Immersion Water On The Hematological Profile of White Rats (Rattus norvegicus) That Given Liquor (Ciu) date: 2021-07-23 words: 5518 flesch: 60 summary: Hematocrit value in group A3 showed a decrease in the hematocrit value with the same results as in group A1 because the Ciu was longer than the other groups so that the treatment ability of Balimo immersion water was not able to increase the hemoglobin level, because according to the hemoglobin A3 chart, it was less versus A1, and shows the same hematocrit value as A1. The erythrocytes count in group A3 has decreased and then increased because A3 approaches A0, this is because the erythrocytes count in group A3 has increased again and tends to maintain the erythrocytes count by protecting and repairing damage to blood cells from free radicals due to the presence of flavonoids and alkaloids that function as antioxidants in Balimo immersion water. keywords: a0 a1; a3 a3; a3 sig; a3 total; alcohol; alcoholic; alkaloids; analysis; antioxidant; balimo; balimo immersion; biology; blood; blood cells; body; cells; chemistry; cirrhosis; ciu; compounds; count; counting; dan; data; decrease; different; effect; erythrocytes; ethanol; figure; flavonoids; formation; free; function; group; hematocrit; hematocrit value; hematological; hematological status; hemoglobin; hemoglobin levels; immersion; immersion water; increase; journal; leukocytes; levels; liquor; liver; mean; medicine; natural; nitidum; norvegicus; number; product; rats; rattus; research; results; sig; significant; statistical; status; study; system; test; total; total count; toxic; treatment; tukey; value; water; weeks; zanthoxylum cache: biomedich-137.pdf plain text: biomedich-137.txt item: #22 of 191 id: biomedich-14 author: Fauziah, Rahmi Safarina; Sudarsono, Sudarsono; Mulyaningsih, Budi title: Larvicidal Activity of The Mixture of Cashew Nut Shell Liquid (CNSL) and Aqueous Extract of Sapindus rarak DC Against Larvae of Culex quinquefasciatus date: 2014-04-01 words: 2028 flesch: 52 summary: There was significant decreasing mortality percentage of the larvae by increasing CNSL concentration (table 2). HPLC analysis of CNSL constituents The identity of anacardic acid was confirmed by HPLC. keywords: acid; activity; aegypti; anacardic; aqueous; cashew; chemical; cnsl; concentration; culex; cx.quinquefasciatus; disease; effect; extract; indonesia; larvae; larvicidal; liquid; mixture; mosquito; natural; number; nut; physico; plant; ppm; properties; rarak; s.rarak; sapindus; shell; study; table; temephos; test; tropical; value; water cache: biomedich-14.pdf plain text: biomedich-14.txt item: #23 of 191 id: biomedich-143 author: Naser, Ahmad Saifun; Wisnu, Muhammad title: Callus Induction of Leaves and Stems in Krisan (Chrysanthemum morifolium Ramat cv Dewi ratih) with Alternative Foliar Fertilizers Media date: 2021-07-18 words: 4626 flesch: 66 summary: P2 treatment stem explants (Gandasil D + 0.25 mg/l BAP) (Figure 2) were able to form callus and shoots. Growmore + 0,25 mg/l BAP treatment yields the best callus on leaf explant, while Gandasil D + 0,25 mg/l BAP treatment yields the best callus on stem explant. keywords: alternative; bap; browning; callus; chrysanthemum; clear; color; compact; culture; cutting; dan; dap; day; dewi; dpa; explants; figure; foliar; formation; fresh; gandasil; green; growmore; krisan; l bap; leaf; leaves; media; medium; morifolium; mutiara; new; ramat; ratih; scar; shoots; solution; stem; study; surface; table; texture; tissue; treatment; uneven; visible; water cache: biomedich-143.pdf plain text: biomedich-143.txt item: #24 of 191 id: biomedich-144 author: Moke, Emuesiri Goodies; Umukoro, Emuesiri Kohworho; Ojugbeli, Evelyn Tarela; Ezedom, Theresa; Daubry, Tarela Melish Elias; Omorodion, Iziegbe Lisa title: Effect of Ethanol Extracts of Musa paradisiaca Fruit Pulp and Peels on Haematological Indices and Liver Enzymes of Experimental Rats date: 2021-07-29 words: 3238 flesch: 61 summary: Musa paradisiaca has been reported that it possesses various therapeutic efficacies. This study is aimed at evaluating the effect of parts of the ethanol fruit extracts of Musa paradisiaca on haematological indices and serum liver enzymes. keywords: activity; alp; alt; animals; ast; blood; cells; concentration; control; count; effect; enzymes; ethanol; ethanol fruit; experimental; extracts; figure; fruit; fruit extracts; fruit pulp; group; haematocrit; haematological; haemoglobin; hepatoprotective; increase; indices; level; liver; m g; m p; medicinal; medicine; moke; mpf; musa; musa paradisiaca; nigeria; non; p f; p u; p>0.05; paradisiaca; parts; peel; plants; pulp; rats; red; serum; significant; study; wistar cache: biomedich-144.pdf plain text: biomedich-144.txt item: #25 of 191 id: biomedich-145 author: Luthfi, Muhammad Ja'far; Noor, Mahanem Mat title: A Simple Technique for Rapid Assessment of Rat (Rattus norvegicus) Sperm Motility date: 2021-02-25 words: 2166 flesch: 58 summary: Keywords: sperm quality; sperm motility; rat; haemocytometer. These three components (sperm motility, sperm count, and sperm morphology) compose of sperm quality (Perreault & Cancel 2001). keywords: analysis; area; assessment; casa; chamber; counting; cover; epididymis; fertility; glass; grid; haemocytometer; human; important; javascript; laboratory; larger; luthfi; malaysia; male; manual; materials; method; motility; quality; rat; reproductive; samples; semen; simple; sperm; sperm motility; squares; study; technique; testing; toxicology cache: biomedich-145.pdf plain text: biomedich-145.txt item: #26 of 191 id: biomedich-146 author: Krisdiyanto, Didik; Sudarlin, Sudarlin; Supriyati, Hikmah title: Computational Chemical Study of Pigment of Mangosteen (Garcinia mangostana) Rind Extract as Dye Compound in Dye-Sensitized Solar Cell (DSSC) date: 2021-07-19 words: 3648 flesch: 60 summary: The energy difference of HOMO-LUMO β-mangostin is smaller than α-mangostin. The injection is influenced by the bond length, where the bond length of α-mangostin to TiO2 is smaller than that of β-mangostin to TiO2. keywords: atoms; band; bond; calculation; cell; charge; chemistry; compound; computational; dft; difference; dssc; dye; dyes; easier; electrode; electrons; energy; excitation; excited; extract; figure; form; groups; homo; length; light; lower; lumo; mangostin; material; molecules; natural; o-6; optimization; orbitals; pigment; research; results; rind; semiconductor; sensitized; smaller; solar; spectra; study; surface; table; tio2; transfer; visible cache: biomedich-146.pdf plain text: biomedich-146.txt item: #27 of 191 id: biomedich-147 author: Umartani, Lita Ayu; Nahdi, Maizer Said title: Ethnobotanical Study of Edible Plant Communities on the Slopes of Mount Merapi and Merbabu, Indonesia date: 2021-07-19 words: 4708 flesch: 65 summary: The highest importance values were rice (Oryza sativa L.) Keywords: Culture; Ethnobotany; in-depth interviews; Rice (Oryza sativa L.); Mount Merapi; Mount Merbabu. keywords: 0,01; area; baksari; benefits; biology; blood; body; chemistry; communities; community; cultivation; culture; cure; daily; dan; data; diversity; easy; edible; edible plants; environment; etnobotani; fabaceae; families; family; fennel; figure; foeniculum; food; food plants; fruit; generation; habitus; hamlets; health; heart; highest; humans; important; indonesia; information; interviews; java; jurnal; kabupaten; knowledge; leaves; local; market; medicinal; medicine; merapi; merbabu; methods; mill; mliwis; mount; mount merapi; nahdi; natural; ngarsapura; number; obat; parts; people; percentage; plants; prevent; product; reason; research; respondents; results; sativa; sellers; slopes; source; species; study; total; treat; tumbuhan; use; uvs; value; vegetables; village; vulgare; yogyakarta cache: biomedich-147.pdf plain text: biomedich-147.txt item: #28 of 191 id: biomedich-148 author: Okonofua, David Ehikhuemen; Asiwe, Jerome Ndudi; Anachuna, Kenneth Kelechi; Moke, Emuesiri Goodies; Sanusi, Kamaldeen Olalekan; Adagbada, Ebunoluwa Oluwabusola; Yusuf, Mariam Onono; Alawode, Damilola Ifeoluwa; Fasanmade, Adesoji Adedipe title: Effect of Diabetes Mellitus and Hypertension on Osmotic Fragility and Hemorheological Factors in Male Wistar Rats date: 2021-10-01 words: 5229 flesch: 61 summary: Increased blood viscosity and the onset of diabetic angiopathy have been related to abnormal hematocrit, plasma viscosity, fibrinogen concentration, erythrocyte deformability and rouleaux formation (Winberger and Baskurt, 2007). Although vessel diameter has been primarily linked with blood flow rate, in pathological conditions, the contributions of perfusion pressure and viscosity becomes greatly enhanced. keywords: animals; baskurt; blood; blood viscosity; c o; changes; control; control groups; decrease; diabetes; diabetic; diet; e c; e p; effect; erythrocyte; estimates; et al; experimental; factor; fibrinogen; figure; flow; fragility; glucose; groups; h s; heart; hematocrit; high; hsd; hypertensive; increase; male; medicine; mellitus; nacl; negative; negative control; normal; o n; o s; observed; osmotic; p o; perfusion; plasma; positive; positive control; pressure; properties; r e; rate; rats; salt; sci; significant; streptozotocin; study; stz; tissue; university; viscosity; water; wistar; wistar rats; z o cache: biomedich-148.pdf plain text: biomedich-148.txt item: #29 of 191 id: biomedich-152 author: Abiya, Efe Sylvanus; Ologundudu, Foluso Akinbode; wisdom, Ekpo title: Risk Assessment of Heavy Metals in Chromolaena odorata Collected Around Gemstone Mining Site in Ijero-Ekiti date: 2021-10-01 words: 3869 flesch: 62 summary: Cooke and Johnson (2002), Akcil and Koldas (2006) and Arogunjo (2007) observed that low pH in mine soils promoted solubility of heavy metals. A line transect of 20 cm was drawn and soil sample was collected, all samples were kept in a clean container and labeled accordingly before been transported to the laboratory for analysis. keywords: analysis; carbon; chemical; chromolaena; concentration; conductivity; control; control site; copper; degradation; ekiti; element; factor; heavy; ijero; lead; limit; line; metal; mining; mtf; nigeria; nitrogen; nutrient; odorata; organic; permissible; phosphorus; plant; root; sample; shoot; site; soil; study; table; transect; transfer; translocation; water; zinc cache: biomedich-152.pdf plain text: biomedich-152.txt item: #30 of 191 id: biomedich-157 author: Hidayanti, Fitria; Lestari, Kiki R.; Sujani, Nano; Raharjo, Jarot title: A Physical Chemistry Study of Black Powder Materials by Solution Combustion Synthesis Method date: 2021-10-08 words: 7618 flesch: 60 summary: In addition, Figure 10 shows the EDS spectrum for black powder samples with a temperature variation of 70 ºC containing the composition of the elements Ni, La and O. with each relative mass of the element at the first observation point (Figure 10a), namely Ni of 56.3%, element La is 24.8%, and element O is 18.9%. = O also appear at 1649, 1646, and 1640 cm-1 respectively in black powder samples 60, 70, and 80 ºC which were previously shifted at wave number 1634 cm- 1 in the forming material (Lanthanum Nitrate Hexahydrate). keywords: 500x; addition; analysis; batteries; battery; black; black powder; bonding; bonds; c black; characterization; chemistry; cm-1; combustion; composition; crystal; development; diffraction; eds; element; energy; et al; figure; form; ftir; glycine; group; high; hydride; hydrogen; indonesia; infrared; la2o3; lanthanum; magnification; mass; material; metal; method; nickel; nimh; nitrate; number; observation; observed; oxide; peak; phase; point; powder; powder sample; process; range; ray; reaction; results; sample; scs; sem; size; solution; spectrum; stretching; study; synthesis; table; technology; temperature; theta; transform; xrd; ° c cache: biomedich-157.pdf plain text: biomedich-157.txt item: #31 of 191 id: biomedich-158 author: Yakubu, Abdulbasit Haliru; Mohammed, Mohammed Mustapha; Bababe, Abdulqadir Bukar; Braimah, Hassan Yesufu title: Phytochemical Screening, Antioxidant and Antibacterial Activities of the Root Extract of Cyphostemma adenocaule (Steud. ex A. Rich.) Wild & R.B.Drumm date: 2021-10-11 words: 3538 flesch: 51 summary: In vitro antimicrobial activity of C. adenocaule extract. Percentage yield of C. adenocaule root extracts. keywords: activity; adenocaule; agar; analysis; antibacterial; antimicrobial; antioxidant; assay; aureus; bello; biological; carbohydrates; chcl3; chemistry; chloroform; coli; concentration; cyphostemma; dpph; extract; flavonoids; hexane; ic50; inhibition; journal; maiduguri; medicine; meoh; methanol; natural; nhex; nigeria; organisms; percentage; phytochemical; plant; present; product; properties; results; root; scavenging; screening; study; table; test; yield cache: biomedich-158.pdf plain text: biomedich-158.txt item: #32 of 191 id: biomedich-159 author: Rizkawati, Muflihah title: Potential of Tithonia diversifolia Hemsley A. Gray (Kembang Bulan) Leaf Extract as Anti-Cancer Agents date: 2021-10-07 words: 3514 flesch: 44 summary: Based on this study, it prove the cytotoxicity induced by ethyl acetate extracts of T. diversifolia leaves (Td-L-EA) in human HepG2 hepatoma cells that strengthen ethnopharmocologic use of T. diversifolia (Lu at., 2017). The next study was carried out by Wahyuningsih, et al in 2019 to determine the antifibrocytic mechanism of T. diversifolia extract. keywords: activity; agents; anti; anticancer; antioxidant; apoptosis; cancer; caspase; cells; compound; concentration; cytotoxic; death; diversifolia; doi; effect; ethanolic; extract; fibroblasts; gray; hemsley; hepatoma; hours; human; ic50; incubation; induced; inhibit; journal; keloid; known; leaves; lower; mechanism; medicine; natural; plant; population; potential; proliferation; results; study; tagitinin; therapy; tithonia; tithonia diversifolia; treatment; types; value; wahyuningsih cache: biomedich-159.pdf plain text: biomedich-159.txt item: #33 of 191 id: biomedich-162 author: Warri, Abednego Okeoghene; Moke, Emuesiri Goodies; Balogun, Aishat Oyinkansola; Nzeh, Kennedy Chibogu; Umukoro, Emuesiri Kohworho; Erhirhie, Earnest Oghenesuvwe title: Acute Toxicity and Hypoglycemic Effect of a Polyherbal Formulation on Blood Glucose in Oral Glucose Tolerance Test (OGTT) and Alloxan-Induced Diabetic Rats date: 2021-10-15 words: 3746 flesch: 58 summary: Blood glucose level was determined on 1st day, 7th day, 14th and 21st day. Blood glucose level at 30 minutes, 60 minutes, 90 minutes, and 120 minutes were taken and recorded. keywords: activity; acute; alloxan; aloe; animals; blood; blood glucose; body; control; day; diabetes; diabetic; drugs; effect; ekor; et al; formulation; glibenclamide; glucose; glucose level; group; herbal; herbal formulation; honey; hypoglycemic; insulin; ld50; level; management; medicinal; medicine; mellitus; mice; minutes; moke; nigeria; normal; oral; p<0.05; plants; polyherbal; rats; reduction; res; saline; significant; study; table; test; tolerance; toxicity; treatment; untreated cache: biomedich-162.pdf plain text: biomedich-162.txt item: #34 of 191 id: biomedich-163 author: Wijaya, Made Dharmesti; Indraningrat, Anak Agung Gede title: Antibacterial Activity of Mangrove Root Extracts from Ngurah Rai Mangrove Forest, Denpasar-Bali date: 2021-10-21 words: 2538 flesch: 51 summary: Although study on S. alba root extract is still limited, there are a number of studies focusing on leaves and bark of this plant. This research was aimed to evaluate antibacterial activities of crude extracts of four dominant mangrove plants from the Ngurah Rai Mangrove Forest namely Rhizophora mucronata, Avicennia marina, Rhizophora apiculata, and Sonneratia alba. keywords: activities; activity; alba; antibacterial; antimicrobial; apiculata; aureus; chloroform; compounds; crude; dan; extracts; gram; hexane; highest; indicator; mangrove; medicine; methanol; ml n; mucronata; mutans; natural; negative; plants; positive; resistance; rhizophora; root; species; strains; zoi cache: biomedich-163.pdf plain text: biomedich-163.txt item: #35 of 191 id: biomedich-164 author: Sugiyanto, Sugiyanto; Hamid, Mansoor Abdul; Adianta, Alya; Jayanti, Hanny Puspha; Luthfi, Muhammad Ja'far title: Stability Analysis of Mathematical Modeling of Interaction between Target Cells and COVID-19 Infected Cells date: 2021-11-02 words: 3046 flesch: 70 summary: The stability of the equilibrium point was influenced by all parameters, i.e. target cells die during each cycle, number of t arget cells at 𝑡′ = 0, target cells infected during each cycle based on virion unit density, effective surface area of the network, the ratio of the number of virus particles to the number of virions, infected cells die during each cycle, the number of virus particles produced by each infected cell during each cycle, and virus particles die during each cycle. For high, moderate and low immunity, respectively, the highest number of target cells is in high, medium and low immunity, whereas for the number of infected cells and the number of Covid-19, it is in the opposite sequence of the number of target cells. keywords: cells; covid-19; cycle; equilibrium; high; immunity; infected; low; number; particles; person; point; target; virus; 𝐴𝛼 𝑇; 𝐴𝛼 𝑉; 𝐸𝑃0; 𝐸𝑃1; 𝑘𝜏)(𝑝𝜏)𝑇0 𝐴𝛼 cache: biomedich-164.pdf plain text: biomedich-164.txt item: #36 of 191 id: biomedich-165 author: Indraningrat, Anak Agung Gede; Wijaya, Made Dharmesti; Suryanditha, Putu Arya; Siskayani, Ayu Savitri; Janurianti, Ni Made Defy title: Antibacterial Screening of Bacterial Isolates Associated with Mangrove Soil from the Ngurah Rai Mangrove Forest Bali date: 2021-11-02 words: 3066 flesch: 47 summary: Of these 68 isolates, 22 isolates displayed antibacterial activities ranging from weak to strong inhibition against at least one of four bacterial indicators namely Staphyloccocus aureus, Streptococus mutans, Escherichia coli and Klebsiella pneumoniae using perpendicular streak method. Overall, this study confirmed the untapped potential of antibacterial activities from bacteria associated with mangrove soil. keywords: actinobacteria; activities; activity; agar; antibacterial; antibacterial activity; antibiotic; antimicrobial; bacillus; bacterial isolates; bali; colonies; compounds; distance; dna; doi:10.3389; et al; figure; forest; gram; health; indicator; isolates; mangrove; mangrove soil; medicine; method; microbiol; ngurah; perpendicular; positive; potential; rai; resistance; rod; rod positive; sa4; samples; screening; sequence; soil; sterile; strains; streak; strong; subtilis cache: biomedich-165.pdf plain text: biomedich-165.txt item: #37 of 191 id: biomedich-166 author: Georgewill, Udeme Owunari; Adikwu, Elias title: Repurposing Dihydroartemisinin-Piperaquine-Doxycycline as an Antimalarial Drug: A Study in Plasmodium berghei-Infected Mice date: 2021-12-17 words: 4006 flesch: 57 summary: Dihydroartemisinin–piperaquine resistance in Plasmodium falciparum malaria in Cambodia: A multisite prospective cohort study. This study assessed the antiplasmodial activity of dihydroartemisinin-piperaquine- doxycycline (D-P- DX) on mice infected with Plasmodium berghei. keywords: activity; antimalarial; antiplasmodial; berghei; blood; cells; chloroquine; control; curative; daily; days; dihydroartemisinin; doses; doxycycline; drugs; effect; et al; falciparum; groups; hdl; infected; inhibitions; journal; levels; malaria; mean; medicine; mice; mst; negative; normal; p<0.001; p<0.05; parasitemia; pcv; percentage; piperaquine; plasmodium; prophylactic; rbcs; resistance; sem; significant; study; suppressive; survival; table; test; time; treatment; tropical cache: biomedich-166.pdf plain text: biomedich-166.txt item: #38 of 191 id: biomedich-167 author: Georgewill, Udeme Owunari; Adikwu, Elias title: Potential Antimalarial Activity of Artemether/Lumefantrine/Doxycycline: A Study in Mice Infected with Plasmodium berghei date: 2022-02-11 words: 4254 flesch: 55 summary: Curative effect of artemether/lumefantrine/doxycycline on Plasmodium berghei infected mice. Suppressive effect of artemether/lumefantrine/doxycycline on Plasmodium berghei infected mice. keywords: action; activity; antimalarial; antiplasmodial; artemether; berghei; blood; chloroquine; chol; combination; control; curative; daily; days; decreased; density; doxycycline; drug; effect; falciparum; group; hdl; inhibitions; journal; ldl; levels; lumefantrine; malaria; mean; mechanisms; medicine; mice; mst; negative; normal; p<0.001; p<0.05; parasitemia; parasites; pcv; percentage; plasmodium; prophylactic; rbcs; resistance; significant; study; suppressive; survival; table; test; time; treatment; tropical cache: biomedich-167.pdf plain text: biomedich-167.txt item: #39 of 191 id: biomedich-168 author: Agbatutu, Akpevwoghene; Asiwe, Jerome Ndudi; Adebayo, Olusegun Gafar title: Liver and Renal Cell Damage Following Excess Bee Honey Consumption in Male Wistar Rat date: 2022-03-01 words: 5978 flesch: 60 summary: Meanwhile, the side effect of honey consumption has not been well studied and there are major concerns with respect to excessive intake of honey causing increase in blood sugar level. RESULTS Honey consumption (HC) maintains blood glucose level and reduced body weight gain in rats The effect of honey consumption on blood glucose level and body weight was presented in table 1-2. keywords: 2ml/100; 3ml/100 g; activity; administration; ahmed; albumin; alp; analysis; animals; anti; antioxidant; asiwe; assessment; ast; bee; biology; blood; body; cell; change; chem; chemistry; clin; concentration; consumption; control; creatinine; damage; data; decrease; degeneration; diabetes; dose; effect; electrolytes; error; et al; excess; fig; figure; food; function; glucose; group; haematological; high; honey; honey consumption; ibadan; increase; indices; induced; inflammation; inflammatory; kidney; kit; level; liver; male; markers; mean; medicine; method; natural; nigeria; normal; pcv; plasma; potential; present; product; rats; rbc; renal; sci; serum; significant; standard; studies; study; table; tissues; total; toxicity; treatment; university; urea; values; variables; waili; week; weight; wistar; wound; yaghoobi cache: biomedich-168.pdf plain text: biomedich-168.txt item: #40 of 191 id: biomedich-17 author: Purwitasari, Diah; Astiti, Luh Gde Sri; Supriadi, Supriadi title: Identification Of Migratory Birds And Their Spesific Characteristics Of Habitat In The Salt Water Lake Of Gili Meno, North Lombok Distric date: 2014-04-01 words: 3855 flesch: 55 summary: Small islands in Indonesia provide habitats for a variety of migratory bird species to stopover. Therefore, this research was conducted to identify the diversity of migratory bird species in the ecosystem of salt water lake of Gili Meno and recognize the habitat characteristics that could support the wild birds’ lives in the ecosystem. keywords: activity; area; avicennia; bird species; birds; bogor; burung; characteristics; charadrius; dan; data; dense; diversity; ecosystem; egret; far; feeding; fish; food; gili; gili meno; habitat; heron; high; index; indonesia; island; jenis; lake; lombok; mangrove; marina; mataram; meno; migration; migratory; migratory birds; muddy; natural; number; nycticorax; observation; plover; population; research; salt; salt water; sandpiper; setiawan; shallow; shore; small; species; specific; stopover; striatus; study; tringa; trinil; vegetation; water; water lake cache: biomedich-17.pdf plain text: biomedich-17.txt item: #41 of 191 id: biomedich-170 author: Ekun, Oluwafemi Emmanuel; Olusola, Augustine Olusegun; Sanni, Joseph Adaviruku; Ishola, Feyisayo title: Peptide Fractions from Chymotrypsin-hydrolyzed Moringa oleifera Seed Proteins Inhibit α-amylase and α-glucosidase in vitro date: 2022-02-23 words: 6967 flesch: 48 summary: Moringa oleifera seed protein hydrolysates inhibit haemoglobin glycation and α-glucosidase activity in-vitro. This study suggests that subjecting M. oleifera seed proteins to proteolysis could yield therapeutic peptide products having immense potentials that could be harnessed to develop novel anti-diabetic agents and additives to food, which could serve as cost effective alternatives to current therapies. keywords: absence; acid; activities; activity; addition; aluko; amylase; analysis; antioxidant; awosika; biology; buffer; chemistry; chymotrypsin; concentrations; constant; content; control; degree; diabetes; different; effects; ekun; enzymatic; enzyme; et al; figure; food; fractions; glucosidase; higher; hydrolysate; hydrolysate fractions; hydrolysis; ic50; inhibition; inhibitory; isolate; journal; kinetic; leaves; means; medicine; method; mg ml-1; michaelis; min; ml-1; molecular; moringa; moringa oleifera; mune; natural; oleifera; oleifera seed; olusola; p<0.05; parameters; peptide; peptide fractions; percentage; phosphate; plot; presence; products; properties; protein; protein hydrolysate; reaction; residues; seed; seed protein; solution; standard; starch; study; substrate; table; unfractionated; values; vmax; yield; 𝐴𝑐𝑜𝑛𝑡𝑟𝑜𝑙 cache: biomedich-170.pdf plain text: biomedich-170.txt item: #42 of 191 id: biomedich-171 author: Asiandu, Angga Puja; Malayudha, Achmad Gusti title: The Bioprospecting of Mangrove Red Snapper Cultivation (Lutjanus argentimaculatus ForsskÃ¥l, 1775) Using Floating Cages date: 2022-03-01 words: 6212 flesch: 61 summary: Lack of dissolved oxygen can reduce the consumption of fish feed, this results in the inhibition of the growth of the fish (Riadhi et al., 2017). Parasitic infection also causes a decrease in the consumption of fish feed. keywords: activities; addition; adrison; affan; amp; aquaculture; area; argentimaculatus; authors; bioprospecting; body; cages; capacity; carrying; concentration; consumption; content; cultivation; cultured; dan; data; demand; economic; efficiency; environment; et al; factors; farming; feed; feeding; fish; fish feed; freshwater; giri; growth; high; higher; important; increase; indonesia; jurnal; level; lutjanus; mangrove; mangrove red; marine; natural; nature; net; optimum; paper; potential; process; production; protein; purba; rate; red; red snapper; related; salinity; sea; size; snapper; snapper cultivation; sources; study; success; system; temperature; tons; value; water; weight cache: biomedich-171.pdf plain text: biomedich-171.txt item: #43 of 191 id: biomedich-173 author: Nugraheni, Putranty Widha; Mahdi, Chanif title: Kidney Evaluation in Hyperuricemia Rats Treated with Green Tea Leaves (Camellia sinensis L.) Extract date: 2022-02-23 words: 6677 flesch: 53 summary: This group was used to compare the increase or decrease in kidney MDA levels due to treatment, induction of a high-purine diet, and GTE therapy. The decrease in kidney MDA levels in ALP therapy was lower than GTE's decrease in MDA levels. keywords: ability; absorbance; acid; activity; alp; american; analysis; antioxidant; biology; blood; body; caffeine; catechin; cells; chemistry; control; creatinine; creatinine levels; damage; decrease; diet; disease; effects; enzyme; et al; ethanol; extract; figure; flavonoids; formation; gallate; glomerulus; green; group; gte; high; histopathology; hua; hyperuricemia; indonesia; journal; kidney; levels; lipid; mahdi; malondialdehyde; mda; mda levels; medicine; minutes; molecular; natural; normal; nugraheni; oxidase; oxidative; pressure; previous; product; purine; rats; ros; serum; significant; slides; statistical; studies; study; tea; test; therapy; tissue; urate; uric; water; weight; xanthine; xod cache: biomedich-173.pdf plain text: biomedich-173.txt item: #44 of 191 id: biomedich-176 author: Smail, Harem Othman title: The Roles of the Fluorescent In Situ Hybridization (FISH) and Comparative Genomic Hybridization (CGH) Techniques in the Detection of the Breast Cancer date: 2022-03-24 words: 6676 flesch: 46 summary: That specific genetic modification is preserved in breast cancer cell lines despite repeated passage through tissue culture (Climent et al., 2007). Differences and homologies of chromosomal alterations within and between breast cancer cell lines: a clustering analysis. keywords: amplification; analysis; applications; array; basal; biology; break; breast; breast cancer; cancer; carcinomas; cell; cgh; changes; chemistry; chromosome; classical; clinical; comparative; comparative genomic; complementary; copy; cytogenetic; detection; diagnosis; dna; et al; expression; figure; fish; fluorescence; fusion; genes; genome; genomic; genomic hybridization; hapten; her2; high; hormone; human; hybridization; important; interphase; journal; kallioniemi; like; lines; locus; loss; luminal; medicine; metaphase; metastatic; methods; molecular; morphology; natural; negative; new; normal; number; oncology; painting; panel; pathology; prat; primary; probe; product; receptor; regions; research; role; sequences; signals; single; situ; situ hybridization; smail; specific; studies; study; subtypes; target; techniques; tissue; treatment; tumour; use cache: biomedich-176.pdf plain text: biomedich-176.txt item: #45 of 191 id: biomedich-177 author: Wijaya, Made Dharmesti title: Ethnomedicinal, Phytochemicals, and Pharmacological Aspects of Sentul (Sandoricum koetjape) date: 2022-04-18 words: 6198 flesch: 54 summary: Beside aforementioned pharmacological activities, S. koetjape extracts also show antiangiogenic, antifungal, antifeedant, ichthyotoxic, and insecticidal against lepidopteran larvae (Tabel 4) (Mikolajczak and Reed, 1987; Powell et al. 1991; doi: https://doi.org/10.1155/2016/6083136 Azziz, S. S. S. A, Alimon, H., Abdullah Sani, A., Daud, N., & Noor, N. (2013). keywords: a. m.; acid; activities; activity; agents; aisha; antibacterial; anticancer; antioxidant; aqueous; aspects; aureus; bark; biology; bumi; cancer; cell; chemistry; coli; compounds; constituents; cytotoxic; diarrhea; diseases; dna; doi; drug; efdi; et al; ethnomedicinal; extract; family; flavonoid; fruit; health; hexane; hulls; human; ic50; indonesia; ismail; ismail et; journal; kaneda; katonic; koetjape; koetjapic; koetjapic acid; leaves; limonoids; line; medicinal; medicine; meliaceae; merr; methanol; ml-1; nassar; natural; new; oic; olean-12; oxo; pharmaceutical; pharmacological; phytochemicals; plants; products; properties; range; research; ring; sandoricum; sandoricum koetjape; seed; sentulic; stem; table; tanaka; traditional; triterpene; triterpenoid; type cache: biomedich-177.pdf plain text: biomedich-177.txt item: #46 of 191 id: biomedich-178 author: Rakhmiyati, Rakhmiyati; Widiyani, Tetri; Budiharjo, Agung title: High Performance Liquid Chromatography (HPLC) for Detection of Glucosamine and Chondroitin Sulfate Compounds date: 2022-09-14 words: 2442 flesch: 56 summary: Abstract Glucosamine and chondroitin sulfate are compounds found in shark cartilage (Carcharhinus sorrah). Research conducted by Sulityowati et al (2015) showed that shark cartilage powder contained 28.36% glucosamine and 6.06% chondroitin. keywords: acid; biology; buffer; carcharhinus; cartilage; chondroitin; chondroitin sulfate; chromatogram; chromatography; column; compounds; detector; effects; et al; extract; figure; glucosamine; grams; high; hplc; huskisson; international; journal; liquid; method; natural; osteoarthritis; performance; phosphate; potassium; powder; research; results; retention; shark; shark cartilage; siagian; solution; sorrah; sulfate; sulityowati; time; tissue; water cache: biomedich-178.pdf plain text: biomedich-178.txt item: #47 of 191 id: biomedich-180 author: Murtono, Murtono; Sugiyanto, Sugiyanto; Hamid, Mansoor Abdul title: A Mathematical Model of Cervical Cancer Treatment by Radiotherapy Followed by Chemotherapy date: 2022-05-21 words: 3901 flesch: 79 summary:      (1b) 2 2 2 32 2 P dP If 3 3 4 0 M C v a d k            ,   2 2 2 32 2 2 2 0iRC M P iRC P K v a d k K P               , where 3, 4, 5i  and 6 0A  , 3 6 6 6 6 2 9 27 0A A B C   , 2 6 6 3 0A B keywords: asih; cancer; cells; cervical; chemotherapy; day; equilibrium; et al; mathematical; mm3; model; radiotherapy; rate; treatment;  ;  ;   cache: biomedich-180.pdf plain text: biomedich-180.txt item: #48 of 191 id: biomedich-182 author: Taiwo, Olayombo Margaret; Olaoluwa, Olaoluwa Omosalewa; Aiyelaagbe, Olapeju Oluyemisi; Matasyoh, Josphat Clement title: Phytochemical Constituents of F. Sagittifolia Warburg ex Mildbraed & Burret Leaves with Antimicrobial Activity date: 2022-06-30 words: 4473 flesch: 56 summary: Compounds 1 and 2 inhibited the growth of Pseudomonas aeruginosa and Aspergillus Niger at 6.25 mg/mL, respectively while compounds 2 and 4 were active against Helicobacter pylori at 6.25 mg/mL. These findings corroborate the ethno-medicinal use of F. sagittifolia leaves as a treatment for stomach disorders. Hence, this paper reports four known compounds from F. sagittifolia leaves and their antimicrobial activity for the first time. keywords: activities; activity; aeruginosa; antimicrobial; aromatic; atcc; bacteria; bark; c-2; c-3; c-4; c-6; carbon; ch2; ch3; chemistry; compounds; concentration; doi; ficus; flavonoids; fractions; fungi; glycoside; growth; hmbc; ibadan; journal; leaves; mhz; min; mmc; mmca; natural; niger; nmr; phytochemical; presence; protons; pylori; research; ring; sagittifolia; signals; spectra; stomach; table; taiwo; university cache: biomedich-182.pdf plain text: biomedich-182.txt item: #49 of 191 id: biomedich-19 author: Widodo, Widodo title: A Discovery and Characteristics Description of Telosma puberula (Asclepiadoideae) in Mount Gedang Atas and Mount Ijo, Baturagung Mountain Yogyakarta date: 2015-10-19 words: 3116 flesch: 61 summary: Based on the writer’s knowledge, there are no further information or study about Telosma accedens and Telosma puberula in Indonesia after Backer and Bakhuizen (1965: 273), Hooker (1885: 38) and Blume (1836). Information about Telosma puberula is very limited. keywords: accedens; atas; author; backer; bakhuizen; baturagung; biology; characteristics; collection; compound; description; figure; flora; flower; flowering; fruit; gedang; herbarium; http://; identification; ijo; java; k000873053; kerr; leaves; location; miq; mnhn; mount; mountains; national; natural; observation; october; paris; pergularia; plant; pollinia; procumbens; puberula; specimen; telosma; telosma puberula; unit; widodo; yogyakarta cache: biomedich-19.pdf plain text: biomedich-19.txt item: #50 of 191 id: biomedich-193 author: AbdulRahman, Muhammad Bashiru; Malami, Yusuf Gumburawa; Hassan, Sanusi Wara; Lawal, Mansur; Adanlawo, Waliu Temitope; Birnin Kebbi, Mansur Mohammed; Sanusi, Kamaldeen Olalekan title: Anti-oxidative Effects of Butanol Seed Extract of Parkinsonia aculeata on Carbon Tetrachloride-Induced Liver Damage on Wistar Rats date: 2022-06-30 words: 3639 flesch: 51 summary: This study sought to assess the anti-oxidative effects of butanol seed extract of Parkinsonia aculeata on carbon tetrachloride (CCl4)-induced liver damage on Wistar rats. This study therefore sought to assess the anti-oxidative effects of butanol seed extract of P. aculeata on carbon tetrachloride-induced liver damage on Wistar rats. keywords: 1ml; aculeata; antioxidant; butanol; carbon; catalase; ccl4; concentration; control; damage; danfodiyo; dismutase; effects; enzymatic; estimation; extract; free; glutathione; group; gsh; journal; levels; liver; mda; nigeria; observed; oxidative; p<0.05; parkinsonia; plant; radicals; rats; sample; seed; significant; sod; sokoto; solution; standard; study; superoxide; test; tetrachloride; university; usmanu; vitamin; water; wistar cache: biomedich-193.pdf plain text: biomedich-193.txt item: #51 of 191 id: biomedich-197 author: Agbatutu, Akpevwoghene; Ogie-Odia, Efosa A.; Ifedele, Mary Oromioshemime; Abdulrasaq, Funmilola Modinat; Eseigbe, Daniel; Imade, Francis Nosakhare title: Ethnobotanical Survey of Plants Used in The Management of Peptic Ulcer Diseases in Wukari Metropolis date: 2022-08-03 words: 4038 flesch: 61 summary: It was observed that plant leaves were mostly used while C. longa (Zingberaceae), M. paradisiaca (Musaceae) had the highest frequency of occurrence in recipes formulation. Scientific studies have established that medicinal plants used by traditional healers have displayed proven pharmacological, antioxidant and therapeutic activity against degenerative diseases. keywords: 143; acid; activity; agbatutu; aggressive; anti; area; biology; chan; chemistry; daily; different; disease; drugs; et al; ethnobotanical; extract; factors; families; figure; frequency; fruits; gastric; gratissimum; herbal; honey; indica; journal; knowledge; leaves; linn; local; longa; management; medicinal; medicine; metropolis; mixed; natural; nigeria; papaya; paradisiaca; paste; people; peptic; peptic ulcer; pharm; plants; population; powdered; product; proton; pud; pump; pylori; recipes; reported; research; respondents; rhizome; sapientum; scientific; species; state; stomach; studies; survey; table; taraba; tmp; total; traditional; treatment; ulcer; use; vera; water; wukari cache: biomedich-197.pdf plain text: biomedich-197.txt item: #52 of 191 id: biomedich-2 author: Cordell, Geoffrey A. title: Ecopharmacognosy: Exploring The Chemical And Biological Potential Of Nature For Human Health date: 2014-04-01 words: 12891 flesch: 48 summary: Of perhaps thirty different aspects which could be discussed regarding the future for natural products in drug discovery, six will be briefly presented: i) access to the biome, ii) acquisition and analysis of traditional knowledge and on-going research, iii) biotechnology development for secondary metabolites, iv) dereplication studies, v) strategies in natural product drug discovery, and vi) multitarget therapy and synergy research. Some selected aspects of the CBD that relate to natural product drug discovery will be mentioned briefly. keywords: academic; access; acquisition; active; activity; agents; agreement; analysis; areas; aspects; available; basis; benefit; bioassay; biodiversity; biological; biology; capacity; care; cbd; century; chemical; chemistry; clinical; collection; companies; compounds; concern; consideration; constituents; control; cordell; cost; countries; country; critical; data; dereplication; development; different; discovery; discussion; diseases; diversity; dna; drug; drug discovery; earth; ecopharmacognosy; effective; enzyme; essential; ethnomedical; evaluation; extracts; field; forest; future; g.a; genes; genetic; geoffrey; global; global health; government; health; health care; human; identification; iii; impact; important; indigenous; individual; information; international; issues; knowledge; local; long; major; manner; materials; medicinal; medicinal plants; medicine; metabolic; metabolites; nagoya; natural; natural products; natural resources; nature; need; new; numerous; overall; particular; people; pharmaceutical; plant; plant extracts; population; possible; potential; primary; prior; process; processes; product drug; production; products; programs; protocol; quality; rain; recent; related; renewable; research; resources; respect; science; scientific; scientists; screening; secondary; significant; single; species; strategies; strategy; studies; sustainability; sustainable; synergy; synthetic; systems; technology; terms; therapy; time; traditional; tropical; use; vast; world; years cache: biomedich-2.pdf plain text: biomedich-2.txt item: #53 of 191 id: biomedich-20 author: Raraswati, Glory Resia; Sudarsono, Sudarsono; Mulyaningsih, Budi title: Larvicidal Activity of A Mixture of Cashew Nut Shell Liquid and Water-Soluble Extract of Soap Nut Fruit (Sapindus rarak DC.) Against 3rd Instar Larvae of Aedes aegypti date: 2015-10-19 words: 3136 flesch: 55 summary: Based on the above observations, the water-soluble extract of soapnut fruit suspected of containing sapogenin steroid and triterpenoid sapogenin which is the aglycone of saponin glycosides and it can be used as a natural surfactant to emulsify cashew nut shell oil in aqueous media. Bioassay for larvicidal toxicity Mixture concentration series was made by mixing water- soluble extract of soapnut fruit at a concentration elected with cashew nut shell liquid. keywords: acetate; acid; activity; aegypti; anacardic; analysis; cashew; cashew nut; cnsl; compounds; concentration; ethyl; extract; figure; fraction; fruit; hexane; hrf; instar; kubo; larvae; larvicidal; lc50; lc90; light; liquid; mixture; mortality; natural; nut; nut shell; oil; percentage; ppm; probit; results; shell; shell liquid; soapnut; soapnut fruit; soluble; soluble extract; solution; spots; sulfuric; test; tlc; visible; water cache: biomedich-20.pdf plain text: biomedich-20.txt item: #54 of 191 id: biomedich-201 author: Uroko, Robert Ikechukwu; Chukwu, Charles Nnanna; Aaron, Chinomso Friday; Chidozie, Umezurike Benedict; Akachukwu, Doris; Atuh, Ndukwe Onyeani title: Phytochemical Compositions and Antioxidant Properties of Combined Funtumia africana and Abutilon mauritianum Extract (CFAE) date: 2022-07-31 words: 5024 flesch: 51 summary: Keywords: Abutilon mauritianum; Antioxidant activity; Antioxidant vitamins; Funtumia africana; Free radicals; Phytochemicals. Ascorbic acid is a potent antioxidant as an electron donor showing free radical scavenging ability; hence, it is commonly used in DPPH radical scavenging assay as a reference compound for measuring antioxidant activity. keywords: absorbance; abutilon; acid; activity; africana; alkaloids; analysis; antioxidant; ascorbic; biological; biology; capacity; cfae; chemistry; composition; compounds; concentrations; determination; deviation; dpph; effects; et al; extract; ferric; figure; flavonoids; food; frap; free; funtumia; glycosides; high; increase; journal; leaves; lower; management; mauritianum; mean; medicinal; medicine; mg/100; minutes; natural; nitric; observed; oxide; phenolic; phytochemical; plant; potent; presence; present; products; properties; radical; results; saponins; scavenging; source; standard; stem; steroids; study; table; tac; tannins; tbars; terpenoids; total; uroko; vitamins cache: biomedich-201.pdf plain text: biomedich-201.txt item: #55 of 191 id: biomedich-204 author: Gavanji, Shahin title: The Antiviral Potential of Iranian Herbal Pharmacopoeia (IHP) on Herpes Simplex Viruses (HSV): A Review Article date: 2022-07-30 words: 16486 flesch: 50 summary: http://journal.isv.org.ir/article-1-222-fa.html Parvez, M. K., Ahmed, S., Al-Dosari, M. S., Abdelwahid, M., Arbab, A. H., Al-Rehaily, A. J., & Al-Oqail, M. M. (2021). https://doi.org/10.3389%2Ffpls.2019.00834 Wahab, S., Annadurai, S., Abullais, S. S., Das, G., Ahmad, W., Ahmad, M. F., Kandasamy, G., Vasudevan, R., Ali, M. S., & Amir, M. (2021). keywords: abdul; acid; activities; activity; acyclovir; adsorption; agents; aloe; antibacterial; antiherpetic; antimicrobial; antioxidant; antiviral; antiviral activity; antiviral research; aqueous; archives; artemisia; astani et; asteraceae; attachment; aucheri; basel; behbahani; behbahani et; ben; bioactive; biological; biology; caffeic; cancer; cc50; cells; chemistry; chemotherapy; chen; chen et; chiang; clinical; communis; complementary; compounds; condition; constituents; culture; curcumin; cyminum; determined; different; diseases; dna; drugs; ec50; effect; efficacy; emodin; encephalitis; essential; et al; ethnopharmacology; eucalyptus; euphorbia; evaluation; evidence; expression; extract; families; family; farahani; flavonoids; food; frontiers; gavanji; gavanji et; gene; glabra; hassan; hepatitis; herbal; herpes; herpes simplex; herpetic; hiv; hsv-1; human; hypericum; ic50; ihp; important; infection; influenza; inhibition; inhibitory; inhibits; international; iranian; isolated; journal; karimi; karimi et; lamiaceae; lappa; larki; lee; lin; lin et; liu; longa; m. a.; m. e.; m. h.; m. k.; m. m.; m. s.; m. t.; major; marina; mechanisms; medical; medicinal; medicine; melissa; member; methanolic; microbiology; mohammadi; molecular; molecules; motamedifar; multiflora; natural; new; novel; officinalis; oil; oils; oral; palmatum; perforatum; persica; pharmaceutical; pharmacological; pharmacopoeia; phenolic; phytochemicals; phytomedicine; phytopharmacology; phytotherapy; piperita; plantago; plants; polymerase; polysaccharide; potential; product; properties; protein; purpurea; quercus; reichling; replication; research; respiratory; review; rosmarinic; s. a.; s. s.; salvia; schnitzler; schnitzler et; sciences; scientific; securidaca; securigera; serotypes; significant; simplex; simplex virus; sinensis; species; spinidens; strong; studies; study; switzerland; table; target; therapeutic; thymus; traditional; treatment; type; university; unknown; values; vera; vero; virology; virus; virus type; viruses; vitro; vivo; vulgaris; wang; zandi; zhang cache: biomedich-204.pdf plain text: biomedich-204.txt item: #56 of 191 id: biomedich-205 author: Sethuramalingam, Sabarinathan; Ravi, Revathy Leena; Rajiah, Janet Rani title: Detection of the Atherosclerotic PCSK9 gene Inhibitors Through in silico Method to Improve Targeted Therapy date: 2022-07-31 words: 7903 flesch: 48 summary: Molecular docking was performed to study the interaction of PCSK9 target proteins with computer-identified new drugs. The generated PDBQT file was reconstructed in SWISSMODEL (Waterhouse et al., 2018) using the entire human PCSK9 amino acid Sethuramalingam et al. – Identification of PCSK9 Inhibitors 123 sequence (Bateman et al., 2015; Leinonen et al., 2004) and lacked the original 3D structure. keywords: ace; acids; active; activity; addition; affinity; ala; amino; apob; arg; arterial; atherosclerosis; autodock; binding; bioavailability; biological; biology; blood; canadine; candidates; cardiovascular; catalytic; causes; cell; chemical; chemistry; cholesterol; complex; compounds; computational; database; density; design; discovery; disease; docking; domain; drug; dynamics; endocytosis; endothelial; energy; et al; figure; file; formation; heart; hesperetin; high; hydrogen; hypercholesterolemia; identification; increase; inhibitors; interaction; journal; known; labetalol; ldlc; ldlr; levels; ligand; lipid; lipoprotein; low; medicinal; medicine; moexipril; molecular; molecules; natural; new; number; oral; pass; pcsk9; pcsk9 inhibitors; pdb; pdbqt; pharmacophore; product; properties; protein; pubchem; quinapril; receptor; research; results; rmsd; screening; sethuramalingam; site; small; structure; studies; study; table; target; terminal; thr; trandolapril; trp; val; virtual; vldl; zinc; zinc0003900 cache: biomedich-205.pdf plain text: biomedich-205.txt item: #57 of 191 id: biomedich-206 author: Tapia-Merino, Jorge; Arrue, Lily; Martín, José San; Muñoz, Orlando title: The Triterpenes of Kageneckia oblonga date: 2022-08-01 words: 2506 flesch: 63 summary: Historia física y política de Chile. 4Departamento de Química, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago, Chile. keywords: acid; ageta; analysis; anti; biological; c-21; c-3; chile; cm-1; compound; cucurbitacins; en-3β; extract; fern-7; groups; hydrogens; iii; interactions; kageneckia; mecn; medicinal; methyl; min; motiol; muñoz; natural; oblonga; presence; rmn; sample; spectrum; structure; tree; trials; triterpenes; universidad cache: biomedich-206.pdf plain text: biomedich-206.txt item: #58 of 191 id: biomedich-208 author: Sethuramalingam, Sabarinathan; Ravi, Revathy Leena; Rajiah, Janet Rani title: Anti-oxidant, Anti-inflammatory and Anti-Atherosclerotic Activity of Bioactive Peptide HPAEDR Isolated from Catla catal Muscle on LPS Induced Inflammation on 246.7RAW Macrophage Cells and HCF Induced Hyperlipidemic Zebrafish Larvae date: 2022-08-23 words: 5124 flesch: 51 summary: The anti- oxidant capacity of CCM peptide shows that the 9th hr hrydrolysate has more activity when compared with Sethuramalingam et al. – Effect of Catla catla muscle derived peptide 155 other hydrolysate (Figure 3a). Cell viability (A) and anti-inflammatory activity of CCM peptide over (B) TNF-α, (C) IL-1 β, (D) IL-6, (E) COX2 and (F) NO production inLPS-induced RAW264.7cells, where N and Prepresent negative and positive control (mean ± SD) and there is significant difference, P< 0.05 keywords: 1mg; 9th; acid; active; activity; alcalase; amino; analysis; anti; antioxidant; assay; atherosclerotic; bioactive; biology; catla; ccm; cells; characterization; chemistry; cholesterol; composition; concentration; control; degree; dpph; effect; enzyme; et al; expression; figure; food; fraction; functional; group; higher; hrbc; hydrolysate; hydrolysis; inflammation; inflammatory; isolated; journal; larvae; macrophage; mean; medicine; membrane; minutes; molecular; muscle; natural; oliva; oxidant; pepsin; peptide; percentage; production; properties; protein; proximate; purification; purified; results; sample; shows; studies; study; table; trypsin; viability; vivo; zebrafish cache: biomedich-208.pdf plain text: biomedich-208.txt item: #59 of 191 id: biomedich-209 author: Onanuga, Adesegun Olusimba; Okpala, Ejike Onwudiegwu title: Chemical Compositions and Antioxidant Activity of Volatile Oils from Morinda citrifolia and Beta vulgaris Leaves from Nigeria date: 2022-08-31 words: 3107 flesch: 52 summary: Chemical compositions of M. citrifolia essential oils. Chemical compositions of B. Vulgaris essential oils. keywords: acid; activity; alcohol; aldehyde; alkane; analysis; antioxidant; aromatic; ascorbic; beta; chemical; chemistry; citrifolia; compositions; compounds; constituents; cycloalkane; dpph; essential; essential oils; figure; https://www.ncbi.nlm.nih.gov/pmc/articles/pmc4926392/; ibadan; leaf; leaves; methyl; morinda; nigeria; oils; okpala; onanuga; percentage; phytol; plants; radical; scavenging; table; total; volatile; vulgaris cache: biomedich-209.pdf plain text: biomedich-209.txt item: #60 of 191 id: biomedich-21 author: Sukri, Akhmad; Amin, Mohamad; Winaya, Aris; Gofur, Abdul title: Substitution and Haplotype Diversity Analysis on The Partial Sequence of The Mitochondrial DNA Cyt b of Indonesian Swamp Buffalo (Bubalus bubalis) date: 2015-10-19 words: 4317 flesch: 73 summary: T G C C G C G C C . After that, PCR (Polymerase Chain Reaction) was conducted using a pair of partial mitochondrial DNA cyt b genes with forward primers L14841: 60 Biology, Medicine, & Natural Product Chemistry 3 (2), 2014: 59-63 AAAAAGCTTCCATCCAACATCTCAGCAT GATGAAA, and reverse primers H15149: AAACTGCAGCCCCTCAGAATGATATTTG TCCTCA (Kocher et al, 1989; Irwin et al, 1991). keywords: aceh; analysis; base; biogeography; blitar; blood; bubalus; buffaloes; c base; c c; caffer; cyt; cytochrome; different; diversity; dna; evolution; figure; g c; g g; gene; genetic; haplogroup; haplotype; indonesian; lombok; madiun; median; mitochondrial; molecular; network; nucleotide; partial; primers; region; research; result; riau; sequences; species; substitution; swamp; syncerus; t c; t g; t t; transition; transversion; variations; vol cache: biomedich-21.pdf plain text: biomedich-21.txt item: #61 of 191 id: biomedich-210 author: Osagie-Eweka, Sammy Davies E.; Orhue, Noghayin E. J.; Amaechina, Fabian C.; Omogbai, Eric K. I.; Moke, Emuesiri Goodies title: Preliminary Investigative Study on the Blood Pressure-Lowering Potential of Aqueous Leaf Extract of Simarouba glauca (AESG) on Normotensive Adult Wistar Rats date: 2022-09-13 words: 2677 flesch: 51 summary: Literatures have reported vast findings on the ethno- medicinal benefits of S. glauca (Patil and Gaikwad, 2011; Ramasamy et al., 2022) with no record on the effect on cardiovascular system and blood pressure; hence this study. The Effect of AESG on Blood Pressure of Normotensive Rats. keywords: aesg; amaechina; angiotensin; anti; aqueous; arterial; artery; benin; blood; blood pressure; cardiovascular; caudal; data; dbp; diastolic; dose; effect; et al; experimental; extract; glauca; group; hypertension; hypotensive; invasive; journal; leaf; male; map; mean; medicinal; medicine; mmhg; normal; normotensive; pharmacology; plants; preliminary; pressure; procedure; rats; research; saline; sbp; simarouba; study; system; university; vein; wistar cache: biomedich-210.pdf plain text: biomedich-210.txt item: #62 of 191 id: biomedich-211 author: Obore, Eruore Amalaka; Asiwe, Jerome Ndudi; Iyawe, Vincent I; Edo, Andrew E. title: Co-Existent Hypertension with Diabetes Mellitus Exacerbates Renal Dysfunctions date: 2022-08-15 words: 3902 flesch: 49 summary: HTN=hypertension, DM=Diabetes mellitus and HTN/DM hypertension and Diabetes co-morbidity. HTN=hypertension, DM=Diabetes mellitus and HTN/DM hypertension and Diabetes co-morbidity. keywords: asiwe; authors; benin; blood; cardiovascular; chronic; clearance; condition; control; creatinine; data; diabetes; diabetes mellitus; diabetic; disease; et al; factors; failure; figure; functions; glucose; health; high; hospital; htn; hypertension; journal; kidney; mean; medical; medicine; mellitus; morbidity; n=25; nigeria; number; obore; p<0.05; participants; patients; people; plasma; pressure; renal; research; results; risk; sciences; significant; study; type; university; urea cache: biomedich-211.pdf plain text: biomedich-211.txt item: #63 of 191 id: biomedich-22 author: A, Tiara; H, Arief R; Sudarsono, Sudarsono title: The Antidepressant Effects of (Arcangelisia flava (l.) Merr) Water-Soluble Extract in Balb-C Mice Reviewed from Immobility Time by Forced date: 2015-10-19 words: 1601 flesch: 53 summary: Then from day 15 to day 28, every day is oral, positive control group (+) was given po at a dose of Amitriptyline were 3.25 mg / kg, negative control group (-) were given a placebo in the form of distilled water, groups P1, P2 and P3 were each given a stock solution in test p.o. at a dose of 78, 156, and 312. According to their experience in using hot water soluble of A.flavastem, could be work for the treatment of their problem. keywords: a.flava; alkaloid; animals; antidepressant; balb; berberine; biology; chloride; constituent; control; day; depression; dose; effects; extract; figure; group; hot; immobility; merr; method; mice; negative; och3; positive; problem; research; results; soluble; swim; test; time; water cache: biomedich-22.pdf plain text: biomedich-22.txt item: #64 of 191 id: biomedich-23 author: Luthfi, Muhammad Ja’far title: A Simple and Practical Method for Rat Epididymal Sperm Count (Rattus norvegicus) date: 2015-04-01 words: 1533 flesch: 63 summary: These method will aid researcher and practitioner in sperm quality analysis to determined sperm number rapidly and practically. Keywords: sperm quality, sperm number, sperm count, haemocytometer Introduction Rat is the most widely used testing animal in reproductive biology for several reasons. keywords: analysis; bww; cauda; chamber; concentration; counting; cover; determination; epididymis; glass; haemocytometer; large; line; male; method; number; page; quality; rat; reproductive; sample; sperm; swim; volume cache: biomedich-23.pdf plain text: biomedich-23.txt item: #65 of 191 id: biomedich-230 author: Uroko, Robert Ikechukwu; Uche, Mercylyn Ezinne; Nweje-Anyalowu, Paul Chukwuemaka; Obiwuru, Ikenna; Aguwamba, Chinedu; Aaron, Chinomso Friday title: Combined Anthocleista vogelii and Alstonia boonei Stem Barks Extract Alleviates Hyperlipidaemia and Renal Malfunctions in Benign Prostatic Hyperplasia-Induced Rats date: 2022-10-19 words: 6172 flesch: 41 summary: The renal tubules also contain unaltered outer and inner medulla, as shown in Figure 7 A. Similarly, the sections of kidneys from BPH control rats (Fig. 7B), standard control (Fig. 7 C), and BPH induced rats treated with 200 mg/kg and 400 mg/kg of CAASBE in Fig. The study comprised five treatment groups, with groups 1 – 5 being the normal control, BPH control, standard control, BPH+200 mg/kg CAASBE, and BPH+400 mg/kg CAASBE, respectively. keywords: administration; alstonia; anthocleista; associated; bark; benign; blood; boonei; bph; bph control; bph rats; caasbe; cholesterol; cholesterol concentration; combined; concentrations; control; control rats; creatinine; diseases; effects; elevated; et al; extract; figure; finasteride; findings; functions; groups; hdl; high; hyperlipidaemia; hyperplasia; increased; injection; journal; kg caasbe; kidney; ldl; level; lipid; low; mean; normal control; pathogenesis; profile; propionate; prostate; prostatic; rats; relative; renal; results; risk; serum; serum cholesterol; serum creatinine; serum hdl; serum tag; serum urea; significant; standard control; stem; study; tag; testosterone; therapeutic; total; treatment; urea; uroko; vogelii cache: biomedich-230.pdf plain text: biomedich-230.txt item: #66 of 191 id: biomedich-232 author: Idu, MacDonald; Ogedegbe-George, Sharon; Oriarewo, Precious Eromosele; Gabriel, Benjamin Ogunma title: Spermicidal, Antifertility and Contraceptive Effect of Azadirachta indica A. Juss. Seed Extract in Female and Male Wistar Rats date: 2022-11-04 words: 6572 flesch: 62 summary: IM 7 days IM 14 days IM 84 Biology, Medicine, & Natural Product Chemistry 12 (1), 2023: 79-88 in this research study could be a result of the active constituents in A. indica seed aqueous extract. Modifications in the circulating level of androgen may be distorted by A. indica seed aqueous extract leading to interference during spermatogenesis (Jensen, 2002). keywords: a. indica; activity; analysis; animals; antifertility; aqueous; aqueous extract; azadirachta; azadirachta indica; biology; body; coital; concentration; contraceptive; control; days; decrease; doses; effect; estrogen; et al; extract; female; figure; follicle; fsh; graded; groups; hormone; hours; increase; indica; indica seed; journal; kg a.; level; luteinizing; medicinal; medicine; minutes; motility; natural; neem; normal; number; oil; organs; phase; plant; plate; post; pre; progesterone; properties; property; rats; reproductive; results; sample; seconds; seed; seed aqueous; serum; sexual; significant; solution; spermicidal; standard; study; table; temperature; testes; testosterone; treatment; tree; use; uterus; wash; weight; wells; wistar cache: biomedich-232.pdf plain text: biomedich-232.txt item: #67 of 191 id: biomedich-24 author: Primiani, Cicilia Novi title: The Phytoestrogenic Potential of Yam Bean (Pachyrhizus erosus) on Ovarian and Uterine Tissue Structure of Premenopausal Mice date: 2015-04-01 words: 3036 flesch: 54 summary: In regard to this, yam bean is found to contain genistein and daidzein compounds with a chemical structure that resembles estrogen hormone, therefore yam bean is categorized in the phytoestrogen group. The purpose of this study was to identify the potential of yam bean on ovarian and uterine histology of mice. keywords: 1998; 2006; adlercreutz; bean; biology; changes; chemical; compounds; control; daidzein; day; dose; effects; endometrium; erosus; estrogen; figure; follicles; genistein; glands; grated; histology; hormone; isoflavone; layer; mice; myometrium; natural; observation; ovarian; ovary; pachyrhizus; phytoestrogens; postmenopausal; premenopausal; proliferation; provision; replacement; research; results; structure; tertiary; therapy; tissue; treatment; tunica; uterine; uterus; women; yam; yam bean cache: biomedich-24.pdf plain text: biomedich-24.txt item: #68 of 191 id: biomedich-240 author: Astutik, Linda; Yanti, Eka Fitri title: The Effect of Pumpkin Fruit Ripeness (Cucurbita moschata. D) on Total Flavonoid Levels and Antioxidant Activity date: 2022-10-03 words: 4178 flesch: 57 summary: Sharma et al., (2020) suggested that this plant has a broad spectrum for the treatment of diseases associated with its constituent compounds. The effects of flavonoid compounds are very diverse and very beneficial especially in relation to traditional medicine (Sopan et al., 2014). keywords: absorbance; activity; analysis; antioxidant; antioxidant activity; compounds; concentration; content; cucurbita; different; dpph; effect; et al; ethanol; extract; factors; flavonoid; flesh; free; fruit; high; ic50; indonesia; journal; levels; mature; mature pumpkin; method; mgqe/100; microplate; moschata; phenolic; plant; ppm; pumpkin; pumpkin fruit; quercetin; radicals; research; results; ripened; row; sample; solvent; study; table; temperature; test; total; total flavonoid; unripe; value; volume; yellow cache: biomedich-240.pdf plain text: biomedich-240.txt item: #69 of 191 id: biomedich-242 author: Ebong, Nwakaego Omonigho; Okokon, Jude Efiom; Idakwoji, Jesse title: Inhibitory Effect of Mammea africana on Alpha-Amylase and Alpha-Glucosidase Enzymes of Rats date: 2022-09-12 words: 3703 flesch: 56 summary: Volume 11, Number 2, October 2022 | Pages: 175-180 | DOI: 10.14421/biomedich.2022.112.175-180 ISSN 2540-9328 (online) Inhibitory Effect of Mammea africana on Alpha-Amylase and Alpha-Glucosidase Enzymes of Rats Nwakaego Omonigho Ebong1,*, Jude Efiom Okokon1,2, Jesse Idakwoji1 1Department of Pharmacology and Toxicology, Faculty of Pharmacy, Madonna University, Elele, Nigeria. 2Department of Pharmacology and Toxicology, Faculty of Pharmacy, University of Uyo, Uyo, Nigeria. Keywords: alpha-amylase; alpha-glucosidase; hypoglycaemia; Mammea africana. keywords: acarbose; activities; activity; administration; africana; alpha; amylase; antidiabetic; bgl; biology; blood; blood glucose; carpenter; chemistry; compounds; concentrations; control; coumarins; diabetes; dose; effect; enzymes; et al; ethanol; ethnopharmacology; extract; glucose; glucosidase; groups; guttiferae; increases; inhibition; inhibitory; journal; leaf; level; maltose; mammea; mammea africana; medicine; min; minutes; natural; nguelefack; nigeria; normal; okokon; plant; product; rats; significant; starch; stembark; stembark extract; study; sucrose; table; treatment; tropical cache: biomedich-242.pdf plain text: biomedich-242.txt item: #70 of 191 id: biomedich-243 author: Putra, Deksa Yudha Syach; Santoso, Setiyo Budi; Lutfiyati, Heni title: The Weight Performance Stability of Mice on Modeling Obesity-Associated Hyperglycemia Induced by Dextrose Monohydrate date: 2022-09-06 words: 3005 flesch: 52 summary: Dextrose monohydrate is more suitable to be used for modeling type 2 diabetes mellitus test animals due to the aspect of increasing body weight, rather than the two toxic compounds that actually suppress body weight, and they are more suitable for modeling mice with diabetes mellitus type 1 as well, aside from having a higher level of glucose elevation than alloxan and streptozotocin. RESULTS AND DISCUSSION Performance of Alloxan Induction Mice in groups A and D gained 35.86 grams and 37.98 grams of body weight after nine days of alloxan induction, respectively. keywords: alloxan; animals; body; body weight; days; dextrose; dextrose monohydrate; diabetes; ekstrak; et al; figure; gain; glucose; glycemic; grams; groups; growth; high; hyperglycemia; index; indonesia; induction; intervention; jurnal; line; mellitus; mencit; metformin; mice; modeling; models; monohydrate; obesity; pada; performance; period; research; stability; streptozotocin; test; type; weight cache: biomedich-243.pdf plain text: biomedich-243.txt item: #71 of 191 id: biomedich-249 author: Godfrey, Eneogwe Okechukwu; Esther, Ibrahim Izihyi; Faith, Obuye title: Proximate Composition, Levels of Some Essential Mineral Elements and Anti-Nutritional Components of Some Yam Species Found in Minna, Niger State date: 2022-09-27 words: 5795 flesch: 55 summary: Proximate Composition, Physiological Changes during Storage and Shelf Life of Some Nigerian varieties of Yams (Dioscorea species). Evaluation of the phytonutrients, mineral, and vitamin contents of some varieties of yam (Dioscorea species). keywords: absorbance; acid; alata; analysed; analysed yam; analysis; anti; aoac; ash; biology; calcium; carbohydrate; cayenensis; chemistry; cm3; composition; concentration; content; crude; cyanide; day; determination; dietary; different; dioscorea; dioscorea alata; dioscorea cayenensis; dioscorea dumenturom; dioscorea rotundata; dioscorea species; dumenturom; essential; et al; fat; fibre; filtrate; flask; food; highest; international; iron; journal; levels; medicine; method; mg/100; mg/100 g; mineral; minutes; moisture; nigeria; nutritional; oxalate; potassium; protein; proximate; p≤0.05; reports; research; result; rotundata; samples; science; significant; sodium; solution; species; standard; state; study; tannin; tubers; values; varieties; water; yam; yam species cache: biomedich-249.pdf plain text: biomedich-249.txt item: #72 of 191 id: biomedich-25 author: Supriadi, Supriadi; Janah, Maratun title: The Effect Of Intensive Keramba On The Presence Of Parasite Organisms In Rivers Of Lingsar Area date: 2015-04-01 words: 3252 flesch: 55 summary: Data of parasite species diversity index from three location show that there was a significant difference. The aims of this research are to find out the diversity of parasite species and the effect of intensive aquaculture method developed by the community on the presence of various parasitic organisms, particularly in the downstream area. keywords: amylodinium; area; biology; camallanus; dan; data; density; difference; diversity; downstream; downstream area; effect; endoparasites; entamoeba; factors; figure; fish; frequency; freshwater; gill; index; individual; infection; intensive; intensive keramba; keramba; location; lower; mataram; method; natural; number; organisms; parasite; parasite species; parasitic; presence; research; respectively; results; river; samples; sampling; significant; sites; species; tilapia; trichodina; upstream; values; worms cache: biomedich-25.pdf plain text: biomedich-25.txt item: #73 of 191 id: biomedich-26 author: Nurfaizah, Cici; Krisdiyanto, Didik; Khamidinal, Khamidinal; Sudarlin, Sudarlin title: Krokot Extract (Portulaca Oleracea. L) as Natural Light-harvesting pigments for Dye-Sensitized Solar Cells (DSSCs) : Influence of Dye Acidity date: 2015-04-01 words: 3567 flesch: 62 summary: It is only seen the carbonyl absorption shift of in TiO2 film is at a wavelength of 1635.64 cm-1 for natural pH shifted to a wave number 1636.00 cm-1 for 3.00 pH of extract krokot dye. The result of the UV-Vis shows that the absorption of wave-length from dye extract of krokot is located in the visible region with the absorbance peak in 410.5 nm and 664.5 nm which are the peak of chlorophyll. keywords: absorbance; absorption; acidity; band; cells; chemistry; chlorophyll; different; dsscs; dye; dye ph; effect; efficiency; electrode; electron; energy; extract; figure; film; glass; harvesting; ito; krokot; krokot extract; layer; light; natural; oleracea; peak; pigment; portulaca; product; sensitized; shows; solar; solution; spectra; stability; system; table; thin; tio2; vis; visible; voltage; wavelength cache: biomedich-26.pdf plain text: biomedich-26.txt item: #74 of 191 id: biomedich-260 author: Etuk, Idongesit Charles; Udobang, John Akpan; Ebong, Nwakaego Omonigho; Okokon, Jude Efiom title: Solanum anomalum Leaf Extract and Fractions Attenuate Oxidative Stress and Liver Injuries in Alloxan-Induced Diabetic Rats date: 2022-10-04 words: 8076 flesch: 52 summary: In vivo antihyperglycaemic and antihyperlipidemic activities and chemical constituents of leaf extract and fractions of Solanum anomalum in alloxan- induced diabetic rats. Etuk et al. – Biological activities of Solanum anomalum 35 Hematological Study After the animals were sacrificed under diethyl ether anesthesia, blood samples were collected from each rat by cardiac puncture using 21 gauge (21 G) needles mounted on a 5 ml syringe into ethylene diamine tetra- acetic acid (EDTA) – coated sample bottles for analyzed. keywords: acetate; activities; activity; alloxan; alp; alt; analysis; animals; anomalum; anomalum leaf; antidiabetic; antioxidant; antioxidative; ast; bilirubin; biochemistry; biological; biology; blood; body; cat; cellular; chemistry; clinical; compounds; control; damage; day; days; diabetes; diabetic; diabetic rats; dichloromethane; diosgenin; direct; dose; effect; enzymes; et al; ethyl; experimental; extract; fasting; fractions; free; function; glibenclamide; glucose; glutathione; gpx; group; gsh; gupta; hepatic; hepatocytes; hepatoprotective; hexane; hours; increases; international; journal; leaf; leaf extract; leaves; levels; lipid; liver; markers; mda; medicine; mellitus; metabolism; methanol; natural; nigeria; nigrum; normal; okokon; okokon et; organs; oxidative; p<0.05; parameters; period; peroxidation; pharmacology; plant; potentials; product; radicals; rats; reduced; reductions; research; results; sciences; serum; significant; sitosterol; sod; solanum; solanum anomalum; squalene; standard; status; streptozotocin; stress; study; superoxide; table; tissue; total; treatment; university; untreated; uyo; weights cache: biomedich-260.pdf plain text: biomedich-260.txt item: #75 of 191 id: biomedich-263 author: William, Ndanti Bartholomew; Bassey, Augustine Lawrence; Udobang, John Akpan; Okokon, Jude Efiom title: Antioxidative Stress and Hepatoprotective Activities of Leaf Extract and Fractions of Setaria megaphylla in Plasmodium berghei Infected Mice date: 2022-10-04 words: 5494 flesch: 49 summary: Besides, the histological analyses of livers from malaria infected mice showed a significant pathological signs. However, administration of S. megaphylla reduced and restored normal levels of total protein, albumin, direct and total protein and the activities of AST, ALT and ALP in the serum of infected treated mice. keywords: acetate; activities; activity; albumin; alp; alt; antimalarial; antioxidant; antioxidative; ast; berghei; bilirubin; blood; cat; cells; central; chloroquine; control; dependent; dose; effect; enzymes; et al; ethyl; extract; figure; fractions; glutathione; group; gsh; hepatocytes; hepatoprotective; hexane; highest; histologic; infected; infected mice; infection; journal; leaf; leaf extract; leaves; levels; liver; malaria; mda; medicine; megaphylla; methanol; mice; natural; nigeria; non; okokon; okokon et; oxidative; p<0.001; p<0.05; parasite; parasitemia; plasmodium; protein; reductions; research; sciences; sections; serum; setaria; significant; sinosoids; sod; stress; study; table; total; treatment; untreated; uyo; vein cache: biomedich-263.pdf plain text: biomedich-263.txt item: #76 of 191 id: biomedich-267 author: Smail, Harem Othman title: The Association Between Some Endocrine Conditions and COVID-19: A Review date: 2022-10-11 words: 7300 flesch: 53 summary: The development and progress of COVID-19 patients could be affected but not yet approved by all the studies. Furthermore, in COVID-19 patients with diabetes, the risk of mortality was found to be substantially higher relative to COVID-19 patients without diabetes, with a pooled risk ratio of 1.61 (95% CI: 1.16–2.25%), p = 0.005 (Hussain et al., 2020). keywords: ace2; addition; analysis; angiotensin; association; attention; biology; blood; body; cardiovascular; care; chen; china; clinical; complications; conditions; coronavirus; cov-2; covid-19; covid-19 pandemic; covid-19 patients; covid19; data; diabetes; diabetes mellitus; disease; disorders; effects; endocrine; endocrinology; et al; evidence; extreme; factors; function; health; high; higher; hussain; hypertension; immune; impact; individuals; infected; infection; journal; levels; management; medicine; mellitus; metabolic; mortality; natural; obese; obesity; outcomes; pandemic; pathophysiology; patients; people; potential; pressure; prevalence; pulmonary; related; relationship; research; respiratory; review; risk; sars; severe; severity; significant; smail; studies; study; syndrome; system; systematic; thyroid; treatment cache: biomedich-267.pdf plain text: biomedich-267.txt item: #77 of 191 id: biomedich-268 author: Krisdiyanto, Didik; Farihah, Tutik; Supriyati, Hikmah title: Synthesis, Characterization and Activity Test of Natural Zirconium Zeolite (Zr-ZA) Catalyst in The Esterification Reaction of Glycerol with Acetic Acid Anhydride date: 2022-10-17 words: 3855 flesch: 56 summary: Analysis of Glycerol Acetylation Results The product of glycerol esterification reaction with acetic acid anhydride using zirconium-impregnated natural zeolite (ZA-Zr) as catalyst was analyzed qualitatively using an infrared spectrophotometer. Interpretation results of infrared spectral data of glycerol esterification products. keywords: absorption; acetic; acid; acidity; additives; analysis; anhydride; anhydrous; catalyst; characterization; chromatogram; chromatography; cm-1; data; esterification; et al; figure; food; glycerol; group; halal; increase; infrared; intensity; interpretation; mass; metal; mordenite; natural; natural zeolite; number; peaks; presence; product; production; reaction; results; spectra; stretching; strong; synthesis; table; test; time; triacetin; vibration; volume; wave; xrd; zeolite; zirconium; zr-5 cache: biomedich-268.pdf plain text: biomedich-268.txt item: #78 of 191 id: biomedich-269 author: Yulion, Rizky; Perawati, Santi; Hartesi, Barmi; Anggresani, Lia; Andriani, Lili; Indriani, Lesra; Syahila, Lara; Ramadani, Suci; Monika, Nadia title: Acute Toxicity LD50 Fraction Ethyl Acetate Aquilaria malaccensis, Ficus benjamina, Mikania micrantha, and Fraction Water Cinnamomum burmanii in Mus Musculus date: 2022-10-17 words: 4566 flesch: 62 summary: The ingredients used were mice (25 males and 25 females), gaharu leaf extract, beringin leaf extract, sembung rambat leaf extract, kayu manis cortex extract, 70% ethanol, n-hexane, ethyl acetate, distilled water, HgCl2, KI, I2, Subnittric bismuth, glacial acetic acid (CH3COOH), HCL, ammonia (NH3), chloroform (CHCl3), magnesium (Mg), water, iron (III) Chloride solution (FeCl3), Ether, Sulfuric acid (H2SO4), and acetic acid anhydride (C4H6O3). In male mice with Gaharu leaf samples, the results of this study showed that the value of LD50 ethyl acetate fraction of gaharu leaves obtained a result of 2,454 mg/kg body weight are included in the category of slightly toxic. keywords: acetate; acute; anak; aquilaria; benjamina; beringin; beringin leaf; body; burmanii; cause; cinnamomum; cortex; data; dead; determination; ethyl; extract; extraction; female; ficus; fraction; gaharu; gaharu leaf; heart; hexane; jambi; journal; kayu; kayu manis; kgbb; kidney; ld50; leaf; leaves; liver; lung; malaccensis; male; male mice; manis; manis cortex; medicine; mice; micrantha; mikania; natural; organs; p<0.05; plants; product; rambat; rambat leaf; ratio; research; results; rizky; sample; sembung; sembung rambat; solvent; stomach; study; survive; test; toxicity; value; water; weight; yulion cache: biomedich-269.pdf plain text: biomedich-269.txt item: #79 of 191 id: biomedich-27 author: Mufidah, Reyza Anni; Khamidinal, Khamidinal; Sedyadi, Endaruji; Krisdiyanto, Didik title: Krokot (Portulaca oleracea L) As a Natural Sensitizer for TiO2 Dye-sensitized Solar Cells: The Effect of Temperature Extract date: 2015-10-15 words: 2885 flesch: 62 summary: For the UV-Vis solid system, there are the highest band gap in 50°C extract temperature that make the capability of absorption toward UV spectrum is large. Energy gap (A) thin layer TiO2, (B) thin layer TiO2-dye solution temperature extract (C) thin layer TiO2-dye 40°C temperature extract (D) thin layer TiO2-dye 50°C temperature extract and (E) thin layer TiO2-dye 60°C temperature extract. keywords: absorbance; absorption; band; cell; chemistry; chlorophyll; dssc; dye; efficiency; ekstrak; electrode; electron; energy; extract; figure; film; gap; glass; group; ito; krokot; layer; layer tio2; natural; pigment; sensitized; shows; solar; solution; temperature; temperature extract; thin; thin layer; tio2; vis; ° c cache: biomedich-27.pdf plain text: biomedich-27.txt item: #80 of 191 id: biomedich-270 author: Idu, MacDonald; Omoregbee, Anthonia; Gabriel, Benjamin Ogunma title: Phytochemical, Antioxidant Screening, Antinociceptive, and Anti-inflammatory Activities of Boswellia dalzielii Hutch (Burseraceae) Root Ethanol Extract Using Animal Model date: 2023-01-14 words: 5500 flesch: 51 summary: Abstract This study investigated the biological activities and phytochemical screening of Boswellia dalzielii root ethanol extract. Standard procures were used to evaluate the phytochemicals and antioxidant capacity, antipyretic activity in baker’s yeast-induced pyrexia in mice, analgesic property (hotplate and acetic acid-induced in mice), acute anti–inflammation (carrageenan-induce in rats) and chronic arthritis (formalin– induced in rats) on Boswellia dalzielii root ethanol extract. keywords: acetic; acid; action; activities; activity; alkaloids; analgesic; animals; anti; antioxidant; antipyretic; arthritis; aspirin; biological; biology; boswellia; boswellia dalzielii; cardiac; carrageenan; chemistry; control; dalzielii; dalzielii root; different; doses; edema; effect; et al; ethanol; ethanol extract; extract; formalin; group; hot; hours; hutch; increase; indomethacin; inflammation; inflammatory; journal; laboratory; m g; medicine; mice; minutes; morphine; nacl; natural; opioid; pain; paracetamol; paw; pharmaceutical; phytochemicals; plant; plate; presence; present; prostaglandins; rats; root; screening; significant; solution; standard; study; table; temperature; test; treatment cache: biomedich-270.pdf plain text: biomedich-270.txt item: #81 of 191 id: biomedich-271 author: Idu, MacDonald; Debby, Igori; Gabriel, Benjamin Ogunma title: Immunoprotective Effect of Cocos nucifera Oil on Sheep Red Blood Cell-Induced Immunocompromised Rats date: 2023-01-24 words: 6463 flesch: 63 summary: The anti-oxidant test carried out to estimate the in vivo scavenging power of Catalase Response on coconut oil extract in Wistar rat as shown in Figure 2b. The effect of immunomodulatory properties of coconut oil was evaluated after challenging the animals with 0.3 ml sheep red blood cells (SRBCs) intraperitoneally and further treated with graded doses (0.25, 0.5 and 1.0 ml/kg i.p) of the oil extract for 21 days. keywords: alveolar; animals; antioxidant; arrow; artery; azathioprine; bilirubin; biochemical; biology; blood; body; cells; chemistry; coconut; coconut oil; cocos; concentration; control; coronary; count; distinct; doses; drug; effect; et al; extract; figure; follicles; graded; group; heart; hematological; immune; immunoprotective; increase; interstitial; journal; kg coconut; kg srbc; kg standard; kidney; level; liver; long; long arrow; lung; medicine; negative; normal; nucifera; nucifera oil; oil; oil extract; parameters; product; prominent; protein; pulp; rats; red; response; scavenging; short; short arrow; significant; space; spleen; standard; study; system; total; treatment; untreated; water; white cache: biomedich-271.pdf plain text: biomedich-271.txt item: #82 of 191 id: biomedich-273 author: Gavanji, Shahin title: Cardiotoxicity Effects of Herbal Medicine, A Review Article date: 2022-12-13 words: 6009 flesch: 44 summary: https://doi.org/10.1136/bcr-2015- 209333 Christenhusz, M. J. M., & Byng, J. W. (2016). INTRODUCTION Throughout history, using of herbal medicines has been playing an increasingly important role to treat various health challenges (Chaachouay et al. 2022; Liu et al. 2022). keywords: aconitum; adverse; alkaloids; arrhythmia; article; asthma; basel; belladonna; bent; biloba; biology; bleeding; bulbifera; caffeine; cardiac; cardiotoxicity; cardiovascular; case; chemistry; clinical; damage; datura; different; diseases; disorders; drug; dunnick; effects; ephedra; ernst; et al; failure; family; fever; gavanji; ginkgo; health; heart; herbal; herbal medicine; herbs; important; increase; injury; interactions; journal; licorice; liu; mandragora; medical; medications; medicinal; medicine; napellus; natural; oleander; patients; people; perforatum; pharmacology; plant; poisoning; potential; problems; products; ranunculaceae; report; research; respiratory; review; risk; safety; scientific; solanaceae; species; stramonium; studies; study; sun; switzerland; system; tachycardia; toxicology; traditional; treat; treatment; use; warfarin; zhang cache: biomedich-273.pdf plain text: biomedich-273.txt item: #83 of 191 id: biomedich-274 author: Ibrahim, Ahsan; Haq, Ehtisham Ul title: Potential Inhibition of ACE2 Membrane Protein by Flavone Glycosides for Blocking Entrance of SARS- CoV-2 into the Cells; a Computational Study date: 2023-01-10 words: 5365 flesch: 58 summary: The molecular docking analysis, for total ten flavone glycosides was carried out, that laid out propitious results in terms of binding energies towards the active residues of ACE2 protein with a range of -9.3 to -7.1 kcal/mol. Receptor-binding domain (RBD) contains a receptor binding motif, which is the necessary for spike protein (S1) that binds to the outer surface of ACE2 protein. keywords: ace2; ace2 protein; active; analysis; angiotensin; apigenin; asp; baicalin; binding; biology; bond; candidates; cell; chemistry; complex; coronavirus; covid-19; diosmin; discovery; docking; drug; dynamics; effects; energies; energy; entry; enzyme; figure; flavone; glu; glycosides; haq; host; ibrahim; inhibition; interactions; isoorientin; isovitexin; journal; kcal; l10; lengths; ligands; liu; lonicerin; luteolin; medicine; membrane; mol; molecular; molecule; n.d; natural; pharmacology; potential; product; profile; protein; pubchem; receptor; research; residues; results; sarscov-2; scutellarin; september; simulation; site; spike; structure; studies; study; swertisin; table; toxicity; tricin; viral; virus cache: biomedich-274.pdf plain text: biomedich-274.txt item: #84 of 191 id: biomedich-275 author: Putri, Nina Nurazizah Purnomo; Anggriani, Rista; Sukardi, Sukardi title: Bioactive Compound in Solanum torvum and Its Potential as Functional Food and Drink: A Review date: 2023-02-15 words: 6355 flesch: 53 summary: (2021) found that Solanum torvum extract could be used as an additional ingredient in noodles. Volume 12, Number 1, April 2023 | Pages: 205-213 | DOI: 10.14421/biomedich.2023.121.205-213 ISSN 2540-9328 (online) Bioactive Compound in Solanum torvum and Its Potential as Functional Food and Drink: A Review Nina Nurazizah Purnomo Putri*, Rista Anggriani, Sukardi Food Technology Department, Faculty of Agriculture and Animal Husbandry, University of Muhammadiyah Malang, Jl. keywords: acid; activity; alkaloids; analgesic; analysis; antibacterial; antioxidant; aqueous; ash; benefits; berry; bioactive; biology; blood; body; carbohydrates; cells; chemical; chemistry; components; compounds; content; drink; drying; effects; et al; extract; fao; fat; fiber; flavonoids; flour; food; free; fruit; functional; green; growth; health; helilusiatiningsih; human; immune; inflammatory; international; iron; jaiswal; journal; leaves; lim; medicinal; medicine; method; mineral; mohan; natural; necessary; nutritional; october; phenolic; phytochemical; plant; pokak; potential; product; production; properties; protein; putri; radicals; reactive; research; review; roots; saponins; scher; science; seeds; solanaceae; solanum torvum; source; studies; study; sunlight; swartz; system; tannins; tea; torvum swartz; total; traditional; treatment; turkey; vacuum; values; vitamin; waghulde; water cache: biomedich-275.pdf plain text: biomedich-275.txt item: #85 of 191 id: biomedich-276 author: Restusari, Lily; Dewi, Ayu Komala; Elisanti, Alinea Dwi title: Fiber Concentration on Fermentation of Cleome Gynandra L Based on Storage Time and Solvent Change date: 2023-06-21 words: 4399 flesch: 60 summary: RESULTS AND DISCUSSION Results explain fiber content in CGL fermentation (Joruk Maman) base on storage time and solvent change and difference fiber concentration (Figure 2-3; Table 1-9). Description of fiber content of Joruk Maman base on storage time. keywords: acid; anova; average; bacteria; block; cgl; cgl fermentation; change; cleome; content; crude; data; day; days; design; dietary; difference; doi; effect; fermentation; fermented; fiber; fiber content; g/100; gr/100gr; gynandra; health; highest; joruk; leaves; lsd; maman; note; number; pairs; plant; post; refrigerator; research; results; riau; rokan; room; solvent; solvent change; storage; storage time; table; temperature; test; time; treatment; value; water cache: biomedich-276.pdf plain text: biomedich-276.txt item: #86 of 191 id: biomedich-278 author: Okokon, Jude Efiom; Etuk, Idongesit Charles; Udobang, John Akpan; Ebong, Nwakaego Omonigho title: In-Vivo Alpha-Amylase and Alpha-Glucosidase Inhibitory Activities of Solanum anomalum Leaf Extract and Fractions date: 2023-01-13 words: 3785 flesch: 54 summary: The rats in all groups were fasted for 18 hours and fasting blood glucose concentration was first taken at 0 minute before administration. In vivo alpha amylase and glucosidase inhibition assay Administration of starch (2g/kg) caused varying percentages of increase in blood glucose concentrations after 30 minutes. keywords: acarbose; acetate; activities; activity; administration; alpha; alpha glucosidase; amylase; anomalum; antidiabetic; blood; blood glucose; concentrations; control; diabetes; diabetic; diosgenin; dose; effect; enzymes; et al; ethyl; extract; fractions; glucose; glucosidase; group; hexane; increases; inhibition; inhibitory; journal; leaf; leaf extract; leaves; level; maltose; medicine; methanol; min; minutes; natural; nigeria; okokon; pharmacology; plant; rats; research; significant; solanum; starch; study; sucrose; university; uyo; vivo cache: biomedich-278.pdf plain text: biomedich-278.txt item: #87 of 191 id: biomedich-28 author: Kelik, Marmi title: Tapak Liman (Elephantopus scaber L) As Immunostimulant and Its Effect on Lymphocyte Differentiation in Mice BALB/C date: 2015-10-15 words: 2334 flesch: 59 summary: Total cells (Figure. 2) shows that the concentration of 1.0 g/kg increased the number of CD4+ cells (1615946) After the treatment carried out analysis of the percentage and number of cells that express CD4+, CD8+ and CD4+ CD8 + in thymus organ, using flowcytometry. keywords: analysis; anti; aqueous; balb; cd4; cd8; cells; concentration; control; cytotoxic; development; differentiation; effect; elephantopus; express; expression; extract; indian; liman; lin; lymphocytes; medicine; mice; number; organs; percentage; plant; rats; scaber; tapak; thymus; treatment; tsai; value cache: biomedich-28.pdf plain text: biomedich-28.txt item: #88 of 191 id: biomedich-280 author: Godfrey, Eneogwe Okechukwu; Faith, Obuye; Esther, Ibrahim Izihyi title: Comparative Assessment of the Proximate Composition, Functional Properties and Amino Acid Profile of Dioscorea bulbifera, Dioscorea alata and Dioscorea rotundata Found in Minna, Niger State date: 2023-01-24 words: 5920 flesch: 58 summary: Dioscorea bulbifera Dioscorea rotundata Dioscorea alata Figure 1. (2015) that ranged from 1.64±0.03 % to 1.78±0.03 % for Dioscorea alata species. keywords: absorption; acid; amino; amino acid; analysed; analysis; aoac; ash; bulk; capacity; carbohydrate; chemistry; cm3; composition; content; crude; density; different; dioscorea; dioscorea alata; dioscorea bulbifera; dioscorea rotundata; dioscorea species; dispersibility; essential; et al; fat; fibre; flask; flour; food; functional; g/100; highest; journal; method; minutes; moisture; non; nutrition; oil; percentage; profile; properties; protein; proximate; p≤0.05; reports; result; sample; science; source; species; starch; swelling; tubers; values; varieties; volume; water; weighed; weight; yam; yam species; 𝑊𝑒𝑖𝑔ℎ𝑡; 𝑊𝑒𝑖𝑔ℎ𝑡 𝑜𝑓; 𝑠𝑎𝑚𝑝𝑙𝑒 cache: biomedich-280.pdf plain text: biomedich-280.txt item: #89 of 191 id: biomedich-281 author: Kase, Maria Grasela; Prasetyaningsih, Aniek; Aditiyarini, Dwi title: Antioxidant and Antibacterial Activity of Pomegranate Extract (Punica granatum L.) in Lip Balm Formulation date: 2023-01-11 words: 6400 flesch: 63 summary: Therefore, this study was performed to study the potency of pomegranates as natural dyes, antioxidants, and antibacterial in lip balm. Lip balm was prepared in several concentrations of pomegranate juice which were 0%, 12.5%, 18.75%, and 25%. keywords: acid; activity; antibacterial; antioxidant; aureus; balm; blue; buah; cacao; color; compounds; concentration; content; data; difference; dpph; ekstrak; et al; extract; figure; flavonoids; formula; formulasi; formulation; fruit; gallic; granatum; ic50; ingredients; inhibition; irritation; juice; jurnal; lip; lip balm; lipbalm; lips; melting; natural; oil; oleum; panelists; point; pomegranate; pomegranate extract; positive; ppm; preparation; product; punica; red; research; results; sample; saponin; sebagai; sediaan; significant; skin; solution; standard; staphylococcus; study; subset; table; tannins; temperature; test; texture; total; value; water; week; weight; zone cache: biomedich-281.pdf plain text: biomedich-281.txt item: #90 of 191 id: biomedich-283 author: Audu, David; Idowu, Olufunmilayo Ajoke; Patel, Vinood B; Mshelbwala, Musa Fakilahyel; Idowu, Adewumi Babatunde title: The Effects of Frequent Therapeutic Administration of Artesunate-amodiaquine and Artemether-lumefantrine on Haematological Markers in BALB/c Mice date: 2023-03-02 words: 6317 flesch: 60 summary: This study explored how repeated artesunate- amodiaquine (A/A) and artemether-lumefantrine (A/L) treatment in non-infected mice affected haematological markers. WBC rose in infected and non-infected mice treated with A/L or A/A 1X, 2X, 3X, and 6X, with a substantial rise in non-infected mice treated with A/L (p < 0.01) and A/A (p < 0.001) three times. keywords: act; administration; amodiaquine; anaemia; artemether; artemisinin; artesunate; berghei; blood; cell; control; counts; ctl; doses; drug; effects; et al; group; haematological; haemoglobin; increase; inf+aa; infected; infected groups; infected mice; infection; journal; laboratory; level; lumefantrine; malaria; mchc; mcv; mean; medicine; mice; nigeria; non; noninfected; parameters; pcv; plasmodium; rats; rbc; red; research; significant; study; therapeutic; times; treatment; usage; use; volume; wbc; white cache: biomedich-283.pdf plain text: biomedich-283.txt item: #91 of 191 id: biomedich-285 author: El Finou, Hamza; Salhi, Nadia; Halmoune, Asma; El Rhaffari, Lhoussaine title: Ethnobotanical Survey of Aromatic and Medicinal Plants Used in Traditional Medicine and Agri-Food in The Fez-Meknes Region date: 2023-01-14 words: 4619 flesch: 47 summary: 0 5 10 15 20 25 30 Neurological-Neueropsychic Other Osteoarticular Respiratory Cardiovascular Dermatological Digestive 5% 7% 9% 13% 15% 21% 25% Percentage % Figure 4. Keywords: Agri-food; ethnobotany; medicinal plants; monograph; traditional medicine. keywords: anxiety; apiaceae; aromatic; asteraceae; biological; biology; cardiovascular; care; chemistry; citation; common; data; decoction; dermatological; des; digestion; digestive; diseases; disorders; ethnobotanical; ethnobotanique; fabaceae; families; family; fez; figure; finou; food; form; fresh; fruit; hair; herbaceae; high; infections; information; infusion; insomnia; interest; intestinal; journal; kahouadji; lamiaceae; leaves; maroc; medicinal; medicinal plants; medicine; meknes; metabolic; method; morocco; myrtaceae; médicinales; natural; number; officinalis; parts; percentage; plants; population; possible; preparation; present; problems; product; region; regulation; respiratory; results; rhaffari; rich; salhi; scientific; shrub; sleep; species; stem; stress; studies; study; survey; system; therapeutic; tract; traditional; treatment; tree; urinary; use; vitamin; years cache: biomedich-285.pdf plain text: biomedich-285.txt item: #92 of 191 id: biomedich-286 author: Abiola, Julius Leke; Aiyelaagbe, Olapeju Oluyemisi title: Phytochemical, Antimicrobial and Cytotoxic Activities of Strophanthus sarmentosus DC date: 2023-01-12 words: 4903 flesch: 59 summary: Antimicrobial activities of extracts (DZI, mm) of Strophanthus sarmentosus extracts. Minimum Inhibitory Concentration (MIC) (mg/mL) of Strophanthus sarmentosus extracts. keywords: acetate; activities; activity; antimicrobial; bacteria; biological; brine; chemistry; clarkson; compounds; concentration; constituents; control; cultures; cytotoxic; diseases; ethyl; ethyl acetate; extracts; flavonoids; fungi; glycosides; hexane; hispidus; journal; lc50; leaf; leaves; medicinal; medicine; methanol; minimum; natural; phytochemical; plant; presence; product; properties; root; saponins; sarmentosus extracts; sarmentosus root; sarmentosus stem; shrimps; solution; ssle; sslh; sslm; ssre; ssrh; ssrm; ssse; sssh; sssm; stem; steroids; strophanthus sarmentosus; table; tannins; test; toxicity; 𝑁𝑢𝑚𝑏𝑒𝑟 cache: biomedich-286.pdf plain text: biomedich-286.txt item: #93 of 191 id: biomedich-288 author: Durgam, Mohan Krishna; Vemuri, Praveen Kumar; Bodiga, Vijaya Lakshmi; Bodiga, Sreedhar title: Lupenone Isolated from Diospyros melanoxylon Bark Non-competitively Inhibits alpha-amylase Activity date: 2023-01-24 words: 3737 flesch: 52 summary: have good inhibitory effects against the protein tyrosine phosphatases 1B (PTP1B) and α-glucosidase enzyme activity, and the lupenone isolated from Euonymus alatus (Thunb.) Potent α-amylase inhibitory activity of Indian Ayurvedic medicinal plants. keywords: acarbose; active; activity; analysis; anti; bark; biology; carbon; chemical; chemistry; color; compound; data; diabetes; diabetic; diospyros; enzyme; extract; figure; fraction; group; india; inhibition; inhibitory; isolated; journal; leaves; lupenone; mass; medicine; melanoxylon; molecular; musa; natural; nmr; pancreatic; pentacyclic; potential; ppm; presence; product; research; spectrum; starch; structure; substrate; type; wang; yang; zhang; -amylase; 𝐴𝑏𝑠𝑜𝑟𝑏𝑎𝑛𝑐𝑒 cache: biomedich-288.pdf plain text: biomedich-288.txt item: #94 of 191 id: biomedich-289 author: Asiandu, Angga Puja; Sari, Widya; Sari, Septi Widiya; Majid, Alif Syahrul Abdul title: The Anticancer Properties of Guava Leaves (Psidium guajava L.) and Turmeric Rhizome (Curcuma longa L.) Against Breast Cancer: A Literature Study date: 2023-08-03 words: 4012 flesch: 56 summary: The Asiandu et al. – Anticancer of Guava and Turmeric 411 mechanisms of these compounds as anticancer include inhibiting the proliferation of cancer cells and inducing apoptosis of breast cancer cells. Also, Kaileh et al (2007), cited in Fathilah et al. (2010), stated that guava extract was effective in inhibiting the growth of MCF7 breast cancer cells within 24h with an IC50 value of 55 µg mL−1 mL-1 capable of killing cancer cells by 50%. keywords: activity; age; alkaloids; anticancer; apoptosis; authors; biology; breast; breast cancer; cancer; cancer cells; cause; cells; chemistry; chemotherapy; common; compounds; curcuma; curcumin; dan; data; death; dewi; effects; et al; extract; factors; figure; flavonoids; growth; guajava; guava; health; hendrati; indonesia; inhibit; jurnal; kanker; leaf; leaves; longa; medicine; ml-1; natural; number; patients; payudara; plants; product; properties; psidium; radiation; rate; rhizome; risk; saponins; secondary; sel; spread; study; tannins; tumor; turmeric; women cache: biomedich-289.pdf plain text: biomedich-289.txt item: #95 of 191 id: biomedich-29 author: Widowati, Wahyu; Herlina, Tati; Ratnawati, Hana; Constantia, Gabriella; Deva, I Dewa Gde Sathya; Maesaroh, Maesaroh title: Antioxidant Potential of Black, Green and Oolong Tea Methanol Extracts date: 2015-10-15 words: 3865 flesch: 56 summary: Equivalent (KE) Myricetin Equivalent (ME) Black tea extract 14,33 The antioxidant activity of green tea extracts was higher than oolong tea and black tea extracts (Gramza et al., 2005). keywords: + +; activities; activity; alkaloid; antioxidant; antioxidant activity; assay; bandung; black; black tea; catechin; chemistry; concentration; content; different; dpph; effects; equation; et al; extract; flavonoid; food; free; green; green tea; health; higher; highest; ic50; indonesia; java; kaempferol; med; medicine; methanol; myricetin; natural; nutr; oolong; oolong tea; oxidative; phenol; phenolic; phytochemical; polyphenols; properties; quercetin; radical; ratnawati; research; rev; sample; satoh; scavenging; sci; standard; steroid; table; tea; tea extract; total; widowati; widowati et cache: biomedich-29.pdf plain text: biomedich-29.txt item: #96 of 191 id: biomedich-290 author: Márquez, Andrés Eduardo; Pérez, Alida; Rojas, Luis; Aparicio, Rosa; Ramos, Freddy; Obregón, Ysbelia; Usubillaga, Alfredo title: A New ent-kaurene Diterpenoid Isolated from Leaves of Espeletia semiglobulata Cuatrec. and its Potential Antimicrobial Activity date: 2023-01-24 words: 5376 flesch: 59 summary: ent-kaur-16-en-19-oic acid has been identified on the fraction of acid extraction of the leaves of this plant as the most abundant component and known for its diverse biological properties (Sosa-Sequera et al., 1996; Cavalcanti et al., 2005; Kim et al., 2016; Zhang et al., 2017; Cotoras et al., 2004; Mongelli et al., 2002), and ent-kauran-19-oic acid, ent-kaur-9(11)-16-dien-19- oic acid, ent-kaur-15α-isovaleroxy-16-en-19-oic acid, ent-kaur-15α-hidroxy-16-en-19-oic acid, ent-kauran- 16α-hidroxy-19-oic acid, and ent-kaur-15-en-19-oic acid have been identified as the less abundant components. (Bohlmann et al., 1980; Peña et al., 2012), therefore, its isolation and characterization from E. semiglobulata Cuatrec. keywords: acid; activity; aeruginosa; analysis; antimicrobial; aparicio; atcc; bacterial; bond; c-13; c-3; c-4; cdcl3; ch2; ch3; coli; compound; control; correlation; cuatrec; data; diterpene; doi; donor; ent; escherichia; espeletia; et al; fraction; group; hexane; hmbc; iii; inhibition; isolated; kaur-16; kaurene; klebsiella; leaves; mhz; natural; neutral; new; nmr; oic; pneumoniae; product; proton; pseudomonas; semiglobulata; structure; type; usubillaga cache: biomedich-290.pdf plain text: biomedich-290.txt item: #97 of 191 id: biomedich-291 author: Egbuniwe, Maureen Ifeyinwa; Ozoani, Harrison Anezichukwu; Ajaghaku, Amara Anwuchaepe; Mbagwu, Ikechukwu Sonne; Orji, Uchechukwu Harrison; Ajaghaku, Daniel Lotanna title: Combination Interactive Effects of Gongronema latifolium Leaves and Picralima nitida Seeds Extracts on Glucose Tolerance date: 2023-03-18 words: 5209 flesch: 53 summary: In comparison to the control group, the area under the curve (AUC) of the plot of blood glucose against time was used to measure metabolic glucose tolerance. The percent change in blood glucose for each animal was calculated and the average for each group was determined. keywords: + +; acute; additivity; alkaloids; analysis; animals; auc; blood; combination; combined; control; diabetes; difference; distilled; dose; effect; enugu; et al; extracts; figure; glucose; glucose tolerance; gongronema; group; high; index; insulin; interaction; latifolium; leaves; levels; liver; medicine; metabolic; methanol; mice; minutes; mortality; negative; nigeria; nitida; p. nitida; pairs; percentage; phase; phytochemical; picralima; plant; positive; post; present; samples; seeds; significant; state; study; therapy; tolerance; toxicity; treatment; uptake; water cache: biomedich-291.pdf plain text: biomedich-291.txt item: #98 of 191 id: biomedich-293 author: Savitri, Lisa; Kasimo, Elfred Rinaldo; Krissanjaya, Rochmad; Juwita, Syntia Tanu; Antoro, Ester Lianawati; Wulansari, Ida Septika title: Interleukin-1 as a Predictor Cytokine SARS-CoV: Article Review date: 2023-02-11 words: 2713 flesch: 55 summary: HLH Across Speciality Collaboration, UK, COVID-19: consider cytokine storm syndromes and immunosuppression. Interestingly, virus-infected mice exhibiting IC protein E activity, either with a wild-type protein E sequence or with a revertant that restores ion transport, rapidly lost weight and died. keywords: activation; activity; acute; asc; cases; cells; coronavirus; cov; covid-19; cytokines; disease; doi; et al; function; gene; il-1; il-6; infection; inflammasome; inflammation; inflammatory; interleukin-1; levels; liu; lung; nlrp3; orf3a; patients; protein; receptor; respiratory; response; sars; severe; storm; syndrome; tnf; traf3; ubiquitination; wang; yang; zhang cache: biomedich-293.pdf plain text: biomedich-293.txt item: #99 of 191 id: biomedich-296 author: Isirima, Joshua Charles; Uahomo, Precious Ojo title: Comparative Cough Suppression of Chitosan Crab Extract of Uca tangeri and Dihydrocodeine date: 2023-02-14 words: 4972 flesch: 59 summary: 200 Biology, Medicine, & Natural Product Chemistry 12 (1), 2023: 197-203 RESULTS AND DISCUSSION Bronchoconstriction is significant in cough induction since the process stimulates intrapulmonary rapidly adapting receptor (RAR), a type of cough receptor to cause or enhance the sensitivity of the cough (Pavord, 2004). Effect of dihydrocodeine and Uca tangeri on percentage increase in cough latency in animals treated with acetic acid in a tussive protocol Table 4. keywords: 150mg; 25mg; 300mg; acetic; acid; acute; administration; animals; antitussive; associated; asthma; basal; bouts; chitin; chitosan; chronic; citric; cough; cough latency; coughing; crab; differences; different; dihydrocodeine; dose; drug; effect; extract; frames; group; guinea; health; high; hours; increase; intrapulmonary; kamei; laboratory; latency; low; medium; minutes; normal; number; observed; opioid; percentage; period; pigs; rar; receptor; reduction; reflex; respiratory; results; saline; significant; similar; study; suppression; table; tangeri; time; treatment; uca; uca tangeri; water cache: biomedich-296.pdf plain text: biomedich-296.txt item: #100 of 191 id: biomedich-297 author: Ekun, Oluwafemi Emmanuel title: Peptide Fractions from Pepsin-digested Moringa oleifera Seed Proteins Inhibit Hemoglobin Glycation and Carbohydrate-hydrolyzing Enzymes date: 2023-08-04 words: 7034 flesch: 49 summary: In contrast to the kinetics of α-amylase inhibition, there is limited data available in the literature regarding the kinetic analysis of α-glucosidase inhibition by protein hydrolysate fractions. Therefore, it is inferred that M. oleifera seed proteins encode potentially therapeutic peptide sequences that could be further processed to formulate potential antidiabetic agents. keywords: absence; acid; activities; activity; advanced; aluko; amylase; arise; biology; buffer; concentrations; constant; diabetes; different; effects; ekun; end; enzymatic; enzyme; et al; extracts; figure; food; fractions; glucosidase; glycation; hemoglobin; higher; hydrolysate; hydrolysis; inhibition; inhibitory; journal; kinetic; lower; maximum; medicine; mellitus; method; min; molecular; moringa; moringa oleifera; natural; oleifera; oleifera seed; olusola; p<0.05; parameters; pepsin; peptic; peptide; peptide fractions; percentage; phosphate; plot; presence; products; protein; protein hydrolysate; reaction; seed; seed protein; solution; standard; study; substrate; table; unfractionated; vmax; yield; 𝐴𝑐𝑜𝑛𝑡𝑟𝑜𝑙 cache: biomedich-297.pdf plain text: biomedich-297.txt item: #101 of 191 id: biomedich-298 author: Shahzad, Haseeba; Saleem, Shaifa; Hanif, Waqas; Ali, Zareena; Ahmed, Muhammad Zeeshan; Nawaz, Haq; Humma, Zelle; Rana, Laraib; Farid, Muhammad Qamar; Kalsoom, Hajira; Jaan, Samavia title: Medicinal Biospecificity of Ginger and Its Efficacious Bioactive Compounds in the Context of Its Biological Activities Against Predominant Health Issues: Current Study and New Avenues date: 2023-06-24 words: 13402 flesch: 52 summary: PloS one, 10(7), e0131321. Baliga, M. S., Haniadka, R., Pereira, M. M., D'Souza, J. J., Pallaty, P. L., Bhat, H. P., & Popuri, S. (2011). Crit Rev Food Sci Nutr, 51(6), 499-523. https://doi.org/10.1080/10408391003698669 Bernard, M. M., McConnery, J. R., & Hoskin, D. W. (2017). keywords: a. a.; a. m.; abbreviations; acid; action; activation; activities; activity; akt; analysis; anti; antibacterial; antimicrobial; antioxidant; antiviral; apoptosis; aqueous; arrow; arthritis; asian; available; bacteria; beneficial; bioactive; biological; biology; blood; body; cancer; cancerous; cells; cellular; chemistry; chen; choline; chronic; components; composition; compounds; constituents; control; countries; critical; cycle; cyclin; data; day; death; deficient; diet; different; diseases; effective; effects; enzymes; essential; et al; experimental; expression; extract; factor; fed; figure; fishes; food; formation; free; gastric; ginger; ginger diet; ginger essential; ginger extract; gingerol; gram; group; health; hepatitis; herbal; high; human; immunity; importance; increased; induced; infections; inflammation; inflammatory; inhibition; inhibits; international; investigation; journal; kinase; level; like; liu; lung; m. m.; major; mechanism; medicinal; medicine; mice; milligram; molecular; natural; new; non; nrf2; officinale; oil; oils; organization; oxidative; oxygen; pakistan; pancreatic; pathways; patients; phase; phenolic; phytochemicals; potential; prasad; presence; present; prevention; production; properties; prostate; protein; rats; reactive; reference; research; resistance; respiratory; response; responsible; results; review; role; roscoe; s. a.; s. m.; science; sesquiphellandrene; shahzad; shahzad et; shogaol; signaling; silva; singh; species; specific; stress; strong; studies; study; syndrome; table; therapeutic; tnf; treatment; types; university; viral; virus; viruses; vitro; vivo; wang; worldwide; zhang; zhou; zingerone; zingiber; zingiberene cache: biomedich-298.pdf plain text: biomedich-298.txt item: #102 of 191 id: biomedich-299 author: Moke, Emuesiri Goodies; Ahama, Endurance Efe; Toloyai, Pere-Ebi Yabrade; Enaohwo, Mamerhi Taniyohwo; Basil, Ekuerhare; Umukoro, Emuesiri Kohworho; Eduviere, Anthony Taghogho; Udumebraye, Ikuesirioghene; Udufowe, Choice title: Antihypertensive Drugs Therapy in Hypertension and Covid-19 Comorbidity date: 2023-02-11 words: 5120 flesch: 55 summary: The renin-angiotensin-aldosterone system (RAAS) inhibitors, such as ACE inhibitors and ARBs, are among the most often prescribed blood pressure medications (Wang et al., 2020). Various statistics on COVID-19 patients surfaced, revealing that some populations may be at higher risk than others (Booth et al., 2021; Enaohwo et al., 2021). keywords: abayomi; ace; ace2; aceis; acute; adrenergic; aldosterone; amlodipine; analysis; angiotensin; antihypertensive; arbs; articles; associated; basic; beta; biology; blockers; blood; blood pressure; calcium; cardiac; ccbs; cell; channel; chemistry; chen; china; clinical; common; comorbidities; comorbidity; converting; coronavirus; countries; cov-2; covid-19; covid-19 patients; covs; death; disease; drugs; effects; entry; enzyme; et al; faculty; global; health; heart; high; hypertension; hypertensives; illness; individuals; infected; infection; inhibitors; int; lancet; liu; management; medical; medications; medicine; mills; moke; mortality; natural; nigeria; novel; outcomes; patients; people; pressure; prevalence; product; proteins; raas; receptor; renin; reported; respiratory; result; review; risk; rna; sars; sciences; severe; severity; structural; studies; study; symptoms; syndrome; system; therapy; transcription; treatment; use; viral; wang; wuhan; zhang cache: biomedich-299.pdf plain text: biomedich-299.txt item: #103 of 191 id: biomedich-30 author: Luthfi, Muhammad Ja’far title: Effect of Lunasia amara Blanco on Sperm Number, Sperm Motility, and Testicular Histology of Male Rats date: 2015-10-15 words: 2186 flesch: 62 summary: The treatment groups have the betterment of sperms motility compared to the control groups. Further studies are required to confirm the mechanisms of action of sanrego on sperm motility. keywords: amara; analysis; aqueous; biology; blanco; cauda; control; count; data; diameter; dose; effect; evidence; extract; fertility; grade; group; histology; increase; lunasia; male; medicine; motility; number; plant; present; progressive; rats; sanrego; seminiferous; sperm; sperm motility; studies; study; table; testicular; traditional; treatment; tubules cache: biomedich-30.pdf plain text: biomedich-30.txt item: #104 of 191 id: biomedich-300 author: Salmeron, Amanda Costa Ayres; Calado, Maria Beatriz; Antunes, Mateus da Silva Matias; Silva, Gabriel Rodrigues Da; Carvalho, Deyse Cristina Madruga; Souza, Beatriz Fernandes de; Piuvezam, Márcia Regina; Rodrigues-Mascarenhas, Sandra title: Effects of Ouabain in Ehrlich Tumor Development in vitro and in vivo date: 2023-02-16 words: 7022 flesch: 53 summary: Ehrlich tumor cells develop ascetically when the cells are injected intraperitoneally (Fernandes et al., 2015) or solidly when the cells are injected subcutaneously or in the footpad (Bahr et al., 2015). Therefore, to gain more insights about new compounds to control tumor growth, we investigate the effects of OUA on Ehrlich tumor cells in vitro and on animal experimental models of solid and ascitic tumors. keywords: animals; ascitic; biology; cancer; cells; chemistry; concentration; control; count; cytokines; data; days; development; different; effects; ehrlich; ehrlich cells; ehrlich tumor; et al; experimental; figure; footpad; graphs; group; growth; hours; human; immune; increase; inflammation; inflammatory; journal; left; leite; lymph; mascarenhas; medicine; mice; microenvironment; migration; model; neutrophils; new; node; number; oua; ouabain; paw; pbs; popliteal; pretreatment; reduction; research; results; rodrigues; role; silva; solid; solid tumor; system; total; tumor; tumor cells; tumor development; viability; vitro; vivo; volume; weight cache: biomedich-300.pdf plain text: biomedich-300.txt item: #105 of 191 id: biomedich-301 author: Sari, Nur Maulida; Aryani, Farida; Wartomo, Wartomo; Hernandi, Muhammad Fikri; Rositah, Erna; Prayitno, Joko title: Phytochemical and Antioxidant Activity of Blumea balsamifera and Cordyline fruticosa Based on Ethnopharmacology Knowledge of Muara Tae Tribe, East Kalimantan date: 2023-03-23 words: 3962 flesch: 47 summary: Blumea balsamifera Cordyline fruticosa Ethyl Acetate Ethanol Ethyl Acetate Ethanol 23.68±19.69 17.59±18.71 73.72±14.42 20.17±17.59 The antioxidant activity of IC50 had a classification of the antioxidant activities compound based on the acquisition of the IC50 value as shown as Table 4 (Analianasari et al., 2022). Based on Figure 4, the linear equation value for Blumea balsamifera ethyl acetate extract y = 1.0237x+25.762, the calculation of the IC50 value for Blumea balsamifera ethyl acetate extract obtained the following values: y = 1.0237x+25.762 (for y = 50), then the x value is 23.68 ppm. keywords: acetate; acid; activities; activity; alkaloids; analysis; antioxidant; antioxidant activity; balsamifera; blumea; blumea balsamifera; compounds; concentration; cordyline; cordyline fruticosa; determination; dpph; ethanol; ethanol extracts; ethyl; ethyl acetate; extracts; figure; flavonoids; free; fruticosa; fruticosa leaves; harborne; hexane; ic50; indonesia; journal; leaves; medicinal; medicine; muara; natural; phytochemical; plants; potential; ppm; presence; radical; research; samples; scavenging; solution; studies; table; tae; tannins; traditional; tribe; use; value cache: biomedich-301.pdf plain text: biomedich-301.txt item: #106 of 191 id: biomedich-31 author: Luthfi, Muhammad Ja’far; Noor, Mahanem Mat; Latip, Jalifah title: Medicinal Plants: A Prospect in Developing Male Fertility Enhancing Agent date: 2015-10-15 words: 5561 flesch: 59 summary: Rats are divided into two groups for different plant extracts, namely every group is given plant extracts in dose 3.33 mg/ml and 333 mg/ml each and control group is given distilled water. Plant extracts or distilled water are given through force feeding once a day at 11.00 a.m. for 50 days. keywords: active; activities; ali; animal; aphrodisiac; bioactive; bioassays; biological; biology; body; chemical; chemistry; clinical; clove; components; compounds; control; data; development; different; discovery; disease; distilled; dosage; drug; dysfunction; effect; ethnopharmacology; extracts; fertility; ginger; group; human; important; journal; luthfi; malaysia; male; mat; medical; medication; medicinal; medicinal plants; medicine; methods; model; modern; morphology; motility; natural; new; noor; normal; number; pharmaceutical; plants; problem; product; rat; reproduction; research; result; sanrego; science; screening; sexual; significant; sperm; studies; study; system; table; test; tongkat; traditional; treatment; use; vivo; water cache: biomedich-31.pdf plain text: biomedich-31.txt item: #107 of 191 id: biomedich-312 author: Oladipo, Mary Adelaide; Ajao, Folasade Omobolanle; Adepoju, Adewusi John; Ishola, Kayode Taiwo; Ajeigbe, Olalekan Jamiu title: Synthesis, Spectroscopic Analysis and Antidiabetic Properties of Copper (II) Complex of Mangifera indica Leaf Crude Extract date: 2023-03-30 words: 4275 flesch: 56 summary: Histogram representation of effects of Mangifera indica leaf crude extract and its metal complex on blood glucose level. Histogram representation of effects of standard drug, Mangifera indica leaf crude extract and its Cu (II) complex on body weight of diabetic albino rats. keywords: 600mg; acetate; albino; alloxan; analysis; animals; antidiabetic; applied; biology; blood; body; chemistry; cm-1; complex; control; copper; crude; crude extract; day; diabetes; diabetic; dose; drug; experimental; extract; extract cu; figure; gain; glucose; group; indica; indica leaf; induced; insulin; kgb.wt; leaf; leaf crude; leaf extract; leaves; level; mangifera; mangifera indica; mango; metal; metal complex; metformin; natural; normal; plants; potential; properties; rats; significant; spectroscopic; standard; study; table; weight cache: biomedich-312.pdf plain text: biomedich-312.txt item: #108 of 191 id: biomedich-313 author: Sharma, Arun Dev; Kaur, Inderjeet title: Chemical Profile and in-silico Docking Studies on Bioactives from Essential Oil of Cymbopogan pendulus Targeting Penicillin Binding Proteins (PBPs) in Bacteria date: 2023-02-17 words: 4265 flesch: 51 summary: Anti-bacterial Activity In the present study the in-vitro anti-bacterial activity of LGO was quantitatively assessed against drug resistant microbial strains of Escherichia coli (MTCC-40), Bacillus subtilis (MTCC-121), Pseudomonas aeruginosa (MTCC-424) and Staphylococcus aureus (MTCC-3160), the results of which are depicted in Table-2 and Figure 4. Anti-bacterial activity of LGO against MTCC-121, MTCC-40, MTCC-424 and MTCC-3160. keywords: activity; aeruginosa; analysis; anti; antibacterial; antibiotics; antimicrobial; aureus; bacterial; binding; bioactive; biology; cell; chemical; chemistry; coli; compounds; cymbopogan; docking; drug; enzyme; escherichia; essential; essential oil; et al; fid; figure; geranial; gram; grass; hydrophobic; infections; inhibition; inhibitors; interactions; kaur; lactam; lemon; lgo; ligand; limonene; linalool; major; medicine; minor; molecular; molecules; myrcene; natural; negative; neral; oil; pbp5; pbps; pendulus; penicillin; peptide; peptidoglycan; positive; potential; present; product; profile; protein; pseudomonas; receptors; residues; resistance; score; sharma; silico; site; staphylococcus; structures; studies; study; synthesis; target; wall cache: biomedich-313.pdf plain text: biomedich-313.txt item: #109 of 191 id: biomedich-314 author: Ulmillah, Aulia; Alghifari, Arif; Widiani, Nurhaida title: Uncovering the Antioxidant Power: Investigating the Skin and Flesh of Crystal Guava with Chloroform and Methanol Extractions and DPPH Assay date: 2023-03-30 words: 4365 flesch: 57 summary: The results showed that the IC50 value of the chloroform extract of crystal guava fruit skin is 218.88 ppm and is classified as moderate, the methanol extract of crystal guava fruit skin is 89.78 ppm and is classified as strong, the chloroform extract of crystal guava fruit flesh is 270.56 ppm and is classified as weak, and the methanol extract of crystal guava fruit flesh is 185.72 ppm and is classified as moderate. The results showed that the IC50 value of the chloroform extract of crystal guava fruit skin is 218.88 ppm and is classified as moderate, the methanol extract of crystal guava fruit skin is 89.78 ppm and is classified as strong, the chloroform extract of crystal guava fruit flesh is 270.56 ppm and is classified as weak, and the methanol extract of crystal guava fruit flesh is 185.72 ppm and is classified as moderate. keywords: absorbance; acid; activity; aktivitas; analysis; antioksidan; antioxidant; ascorbic; buah; chloroform; chloroform extract; color; compounds; concentrated; concentration; content; crystal; crystal guava; different; doi; dpph; ekstrak; electrons; extract; extraction; flesh; free; fruit; fruit flesh; fruit skin; guajava; guava; guava fruit; ic50; jurnal; leaves; level; maceration; methanol; methanol extract; method; metode; natural; non; plant; polar; ppm; process; psidium; radicals; research; results; sample; skin; solvents; study; substances; test; testing; uji; value; vitamin; yield cache: biomedich-314.pdf plain text: biomedich-314.txt item: #110 of 191 id: biomedich-315 author: Dahiru, Mubarak Muhammad; Abaka, AbudulAzeez Mumsiri; Artimas, Susan Pwakangdi title: Phytochemical Analysis and Antibacterial Activity of Methanol and Ethyl Acetate Extracts of Detarium microcarpum Guill. & Perr. date: 2023-03-27 words: 4799 flesch: 50 summary: Biradar, Y. S., Jagatap, S., Khandelwal, K. R., & Singhania, S. S. (2008). Concentrations (mg/mL) S. aureus S. typhi E. coli M.E E.E M.E E.E M.E E.E 100 - - - - - - 50 - -* - - - -* 25 - + - -* -* + 12.5 -* + -* keywords: acetate; activities; activity; alkaloids; analysis; antibacterial; antimicrobial; aureus; bark; chemistry; coli; concentration; detarium; different; effects; esbe; et al; ethyl; extract; extraction; flavonoids; gram; inhibition; inhibitory; journal; liu; m.e; mbc; medicinal; medicine; methanol; method; microcarpum; minimum; msbe; natural; pharmacological; phytochemical; plants; product; research; resistance; review; saponins; sciences; stem; table; test; typhi; yang cache: biomedich-315.pdf plain text: biomedich-315.txt item: #111 of 191 id: biomedich-316 author: Tamfu, Alfred Ngenge; Koudoro, Alain Yaya; Kucukaydin, Selcuk; Olaye, Theophile; Agbangnan, Pascal Dossa Cokou; Sohounhloue, Dominique Codjo Koko; Sohounhloue, Dominique Codjo Koko; Avlessi, Felicien; Avlessi, Felicien title: Chemical Composition and Evaluation of Anti-tyrosinase and Anti-Oxidative Effects of Topical Cream Formulation from Acacia sieberiana, Vitellaria paradoxa and Beeswax date: 2023-03-13 words: 5777 flesch: 51 summary: Important skin protective fatty acids such as palmitic acid, linoleic acid, oleic acid and stearic acids were identified as major constituents. Keywords: Acacia sieberiana; topical cream; GC-MS; phenolic composition; skin diseases; antioxidant; tyrosinase inhibition. keywords: a.n; abts•+; acacia; acid; activities; activity; aging; alain; alfred; antibiofilm; antioxidant; assay; beeswax; carotene; ceylan; characterization; chelating; chemical; chemistry; components; composition; compounds; concentration; constituents; cosmetic; coumarin; cream; cuprac; dad; damage; diseases; disorders; doi; dpph•; duru; effects; enzyme; et al; evaluation; extract; fatty; food; hplc; ic50; important; inhibition; inhibitors; journal; kucukaydin; linoleic; m.e; medicinal; medicine; melanin; metal; min; mugla; natural; ngenge; oxidative; paradoxa; phenolic; pigmentation; plant; potential; product; production; propolis; rate; results; sensing; sieberiana; skin; species; spots; stress; synthetic; table; talla; tamfu; tamfu et; topical; topical cream; tyrosinase; university; vitellaria cache: biomedich-316.pdf plain text: biomedich-316.txt item: #112 of 191 id: biomedich-317 author: Sutandar, Vivi Hendra; Saleh, Mgs. Irsan; Maritska, Ziske title: GLUT4 as A Protein Target for T2DM Therapy with Natural Compounds date: 2023-03-28 words: 3112 flesch: 52 summary: This paper aims to pres ent the current research on potential plant extract in increasing GLUT4 translocation in diabetes conditions. insulin resistance st ate affecting GLUT4 translocation which is important in affecting glucose uptake. keywords: activation; akt; ampk; biology; cell; diabetes; et al; expression; extract; glucose; glucose uptake; glut4; glut4 translocation; help; increase; insulin; journal; medicine; membrane; methods; mice; muscle; natural; pathway; pi3k; plant; plasma; poe; potential; protein; rats; research; resistance; sce; skeletal; target; translocation; transporter; treatment; uptake cache: biomedich-317.pdf plain text: biomedich-317.txt item: #113 of 191 id: biomedich-319 author: Wanniarachchi, Binuki; Sathsarani, H.M.W.K.; Jayawardena, Bimali M.; Dewangani, H.G.N. title: Synthesis and Characterization of Cinnamon Loaded BSA Microparticles with Antidiabetic Properties date: 2023-03-03 words: 6333 flesch: 52 summary: Yield = Weight of the product (g) Weight of used BSA + Weight of cinnamon extract × 100 Determining antidiabetic activity of CLMP Antidiabetic activity of the pressured water extract of cinnamon quills, positive control acarbose and the CLMP were determined by carrying out in-vitro alpha amylase inhibition assay and alpha glucosidase inhibition assay. The objective of the study was to synthesize and characterize cinnamon encapsulated BSA microparticles with antidiabetic properties. keywords: absorbance; acarbose; acid; active; activity; agent; alpha; amylase; antidiabetic; aqueous; bsa; buffer; characterization; cinnamomum; cinnamon; cinnamon entrapment; cinnamon extract; citric; clmp; cm-1; compounds; concentration; cross; diabetes; efficiency; entrapment; enzyme; et al; extract; figure; form; glucosidase; greater; higher; ic50; inhibition; inhibitory; loading; medicine; mellitus; microparticles; minutes; natural; percentage; phosphate; potential; powder; pressured; product; protein; pure; sample; size; sodium; solubility; solution; spectra; spectrum; synthesis; table; value; water; weight; zeta; zeylanicum cache: biomedich-319.pdf plain text: biomedich-319.txt item: #114 of 191 id: biomedich-32 author: Widodo, Widodo; Luthfi, Muhammad Ja'far title: New Record Marsdenia tenacissima (Asclepiadoideae, Apocynaceae) In Gunung Ijo Baturagung Yogyakarta date: 2016-04-15 words: 3598 flesch: 62 summary: Marsdenia tenacissima herbarium from Gunung Ijo compared to KEW (A, B, C) & MNHN herbarium collection (D, E, F). Marsdenia tenacissima in Jawa was not reported in Flora of Java. keywords: apex; asclepiadoideae; author; backer; bakhuizen; base; baturagung; characteristics; china; collection; corolla; crocea; description; digital; distribution; figure; flora; flower; fruit; gunung; gunung ijo; herbarium; hooker; identification; ijo; java; leaves; lobes; long; marsdenia; marsdenia tenacissima; medicine; mnhn; natural; new; oblong; observation; pergularia; petiole; pilose; plant; pollinia; rounded; seed; similarity; size; species; specimen; structure; tenacissima; tube; widodo; yogyakarta; zipp cache: biomedich-32.pdf plain text: biomedich-32.txt item: #115 of 191 id: biomedich-325 author: Atmanto, Dwi; Ambarwati, Neneng Siti Silfi title: Development of An Eco-Shampoo Formulation Using Local Environmental Plant Extracts for Healthy Hair as an Effort to Increase the Potential of Environmental Resources date: 2023-07-20 words: 5539 flesch: 56 summary: Based on the results obtained, the distilled water fraction has the greatest fungal inhibiting activity so that anti-dandruff shampoo preparations are made using active ingredients, namely the distilled water fraction of aloe vera leaves and lemongrass oil with a concentration of 5% 10%, and 15%, surfactants, and additives. The higher the concentration of distilled water, the thicker it is anti-dandruff shampoo preparation, the greater the 404 Biology, Medicine, & Natural Product Chemistry 12 (1), 2023: 399-405 viscosity of the shampoo preparation. keywords: acid; active; activity; albicans; aloe; aloe vera; ambarwati; anti; aquadest; atmanto; chemistry; cmc; cocamide; compounds; concentration; content; cosmetics; dandruff; dandruff shampoo; development; distilled; distilled water; doi; eco; environmental; ethanol; evaluation; extract; faculty; foam; formulations; fraction; fungus; gel; hair; height; higher; important; indonesia; industry; ingredients; journal; leaf; leaves; lemongrass; lemongrass oil; local; materials; medicine; menthol; method; natural; oil; pacar; pharmaceutical; plants; preparation; process; product; pyrex; requirements; research; results; scalp; shampoo; shampoo preparation; sodium; stability; surfactants; table; test; testing; time; university; use; value; vera; viscosity; water; water fraction cache: biomedich-325.pdf plain text: biomedich-325.txt item: #116 of 191 id: biomedich-327 author: Isirima, Joshua Charles; Uahomo, Precious Ojo title: Antidiarrhoeal Activities of Lime (Citrus aurantiifolia) Extract in Experimentally-Induced Diarrhoea Model date: 2023-03-28 words: 5999 flesch: 53 summary: The test groups received various doses (97.65mg/kg, 195.3mg/kg, and 390.6mg/kg) of Citrus aurantiifolia juice extract; whereas positive controls received Loperamide (2.5mg/kg) and negative controls received distilled water (1ml/kg). This study shows that Citrus aurantiifolia demonstrates significant anti-diarrhoeal activity and can be used as an anti-diarrhoea agent. keywords: activities; activity; animals; antidiarrhoeal; aurantiifolia; body; castor; castor oil; charcoal; children; citrus; citrus aurantiifolia; content; control; control group; diarrhoea; disease; distance; distilled; dose; dry; effective; effects; electrolyte; enteropooling; experimental; extract; faeces; fluid; fresh; gastrointestinal; group; health; high; induced; inhibition; intestinal; journal; juice; lime; loperamide; low; mdtcm; meal; mean; mean number; mean weight; medicinal; medicine; medium; mnd; mnws; mot; mvic; natural; normal; number; observed; oil; onset; percentage; plants; rats; reduction; reversal; significant; small; stool; study; table; time; transit; treatment; unicef; volume; water; weight; wet; wistar; wistar rats; works; 𝐴𝐷𝐼𝑖𝑛𝑣𝑖𝑣𝑜 cache: biomedich-327.pdf plain text: biomedich-327.txt item: #117 of 191 id: biomedich-328 author: Savitri, Lisa; Kasimo, Elfred Rinaldo; Krissanjaya, Rochmad; Juwita, Syntia Tanu; Antoro, Ester Lianawati; Wulansari, Ida Septika title: Effect of Female Age on Crossing Over Frequency in Drosophila melanogaster Crosses N x bcl and N x ym and Their Reciprocals date: 2023-03-21 words: 3996 flesch: 68 summary: Randomized block design by crossing D. melanogaster strains ♂N>< ♀bcl and ♂N>< ♀ Based on the results of these crosses, the derived strains that appeared in the F2 cr osses showed the phenomenon of crossing over with the influence of the age of the female and the type of strain on crossing events. keywords: age; bcl; body; bottle; chromosomes; complex; crosses; crossing; data; days; decrease; drosophila; effect; factors; female; formation; frequency; medium; meiosis; melanogaster; older; percentage; process; protein; recessive; reciprocals; recombination; results; stock; strain; synaptonemal; treatment; type; ♀ n cache: biomedich-328.pdf plain text: biomedich-328.txt item: #118 of 191 id: biomedich-329 author: Odiyi, Bridget; Maku, Olubukola; Ologundudu, Foluso Akinbode; Abiya, Sylvanus Efetobor title: Effect of Quarry Activities on Some Morphological Parameters of Two Maize Varieties (SWAN 1 and SAMMAZ 52) date: 2023-03-28 words: 5579 flesch: 65 summary: The production of more leaves under the control regime may be a mechanism evolved by maize plants to increase the total surface area for photosynthesis due to reduced leaf area (Morgan et al, 2018). RESULT AND DISCUSSION Particulate emissions from a wide range of industrial operations may hinder plant growth and development. keywords: accumulation; activities; akure; analysis; area; available; biology; biomass; carbon; chlorophyll; control; corn; differences; different; distances; dry; dust; effect; et al; experimental; federal; greater; growth; higher; highest; increase; leaf; leaves; low; lower; magnesium; maize; maize varieties; mean; morphological; new; nitrogen; nutrient; p>0.05; parameters; photosynthetic; plants; pollution; production; protein; quarry; quarry site; range; rate; ratio; regime; result; root; sammaz; shoot; significant; site; soil; supply; swan; table; technology; university; uptake; varieties; weight cache: biomedich-329.pdf plain text: biomedich-329.txt item: #119 of 191 id: biomedich-33 author: Anggreini, Dewi title: Local Stability Analysis of a Mathematical Model of the Interaction of Two Populations of Differential Equations (Host-Parasitoid) date: 2016-04-15 words: 3587 flesch: 53 summary: Equilibrium point equation (9) is obtained if: 0 dt dh (10) 0. dp dt  (11) From equation (10) and (11) was obtained 0 1 *         bh pa rh (12) * 0. 1 a h a d p bh       (13) From equation (12) and (13) was obtained 3 obtained equilibrium point           dbaa ar ph *11 ,0,           0,, *22 dbaa d ph           dbaa ar dbaa d ph **33 ,, . Stability discussed in this study are stable equilibrium points are obtained from the characteristic equation systems of differential equations host and parasitoid interactions. keywords: analysis; characteristic; differential; eigenvalues; equation; equilibrium; equilibrium point; function; host; interaction; local; mathematical; matrix; model; parasitoid; point; population; predator; prey; real; response; stability; stable; study; system; time; unstable cache: biomedich-33.pdf plain text: biomedich-33.txt item: #120 of 191 id: biomedich-337 author: Oladipo, Mary Adelaide; Ojo, Ayodele Oluwabunmi; Ishola, Kayode Taiwo title: Analysis of Biological Activities of Two Novel Metal (II) Complexes of Andrographis Paniculata Crude Extract date: 2023-06-24 words: 3993 flesch: 53 summary: Keywords: Anti-diabetes; Anti-bacteria; Medicinal plant; Metal complexes. However, there is no report on biological activity of metal complex of the plant. keywords: absorbance; acarbose; activities; activity; agents; amylase; analysis; andrographis; andrographolide; antibacterial; antidiabetic; antimicrobial; antioxidant; bacteria; bands; biological; biology; ch2; chemistry; cm-1; complexes; concentration; control; crude; crude extract; different; diseases; drugs; effect; enzyme; ethanol; extract; figure; glucosidase; gram; highest; ic50; inhibition; inhibitory; medicinal; metal; metal complexes; natural; negative; oyo; paniculata; plant; plant crude; standard; state; table; visible; water; ν(c cache: biomedich-337.pdf plain text: biomedich-337.txt item: #121 of 191 id: biomedich-34 author: Supriatna, Supriatna; Niyartama, Thaqibul Fikri; Kuswidi, Iwan title: Determination of Leisure Levels of Village Patronage UIN Sunan Kalijaga Yogyakarta: Improving Governance Patronage towards Rural Green Village and Environmentally Friendly date: 2016-04-15 words: 1427 flesch: 49 summary: – Determination of Leisure Levels of Village Patronage UIN Sunan Kalijaga Yogyakarta … 17 Description: Horizontal axis : Temperature Humidity Index (THI) : +62-274-540971, Fax. +62-274-519739 Author correspondency1: soepriatna@yahoo.co.id Abstract This study took place in the village of Patronage UIN Sunan Kalidjaga Yogyakarta that consist of 13 hamlets (Klidon, Banjarsari, Wonosalam, Dongkelsari, Puntuk, Tanjung Sari, Karang Lo, Purworejo, Tanjung, Banturejo, Nglengkong and Surirejo), Sukoharjo Village, District Ngaglik, DIY Sleman regency. keywords: air; banturejo; dan; dongkelsari; environment; humidity; index; kalijaga; karang; level; nglengkong; patronage; puntuk; purworejo; quality; sari; sunan; surirejo; tanjung; temperature; thi; uin; uncomfortable; village; wonosalam; yogyakarta cache: biomedich-34.pdf plain text: biomedich-34.txt item: #122 of 191 id: biomedich-344 author: Kirtanayasa, I Gede Yoga Ayuning; Indraningrat, Anak Agung Gede; Candra, I Putu title: Phytochemical, Antibacterial and Antioxidant Activities of Schefflera elliptica Leaves date: 2023-04-01 words: 4484 flesch: 53 summary: Antibacterial activities of S. elliptica extract against testing bacteria. CONCLUSIONS In conclusion, this study confirmed antibacterial and antioxidant activities from S. elliptica crude extracts. keywords: acetate; acetate extract; acid; activities; activity; addition; aktivitas; antibacterial; antioxidant; atcc; aureus; bali; balinese; cell; change; coli; color; compounds; concentration; content; control; crude; daun; doi; drops; ekstrak; elliptica; et al; ethyl; ethyl acetate; extract; gram; hcl; hexane; hexane ethyl; indonesia; inhibition; jurnal; leaves; medicine; mixture; mutans; nalidixic; natural; negative; paper; phenol; phytochemical; plant; pneumoniae; polar; positive; presence; research; samples; schefflera; screening; solvents; study; tannins; test; uji; zoi; 𝐴𝑏𝑠 cache: biomedich-344.pdf plain text: biomedich-344.txt item: #123 of 191 id: biomedich-345 author: Diouf, El Hadji Gorgui; Diop, Doudou; Gueye, Abdoulaye; Ndior, Talibouya; Ndour, Mamadou Latyr; Faye, Adama; Kébé, Mamadou title: Ethnobotanical Survey on the Plants Used in the Control of Nematodes in the Zone of Niayes of Thies/Senegal date: 2023-04-02 words: 3809 flesch: 61 summary: Since the discovery of active ingredients of therapeutic interest from plant species selected according to criteria based on medical ethnobotany and ethnopharmacology is more frequent than in a simple random screening of plants (Svetaz L et al, 2010) and given that there are no or almost no nematological studies in the Niayes area of Thiès, we conducted an ethnobotanical survey among local farmers in this area in order to identify the plants used in the fight against nematodes as well as the methods of preparation of extracts from these plants. Keywords: Ethnobotanical survey; Senegalese Pharmacopoeia; Nematicidal plants; Market gardening; Niayes area; Niayes area of Thiès. keywords: age; agriculture; ait; application; area; azadirachta; calotropis; chemistry; control; crops; dakar; department; diop; diouf; distribution; effective; ethnobotanical; extracts; fabaceae; families; family; figure; frequency; fumigation; indica; juss; leaves; local; meliaceae; methods; natural; nematicidal; nematodes; niayes; people; pesticides; plant; population; preparation; procera; product; sample; scientific; senegal; senegalese; solvent; species; study; survey; table; thiès; use; vegetable; water; zone cache: biomedich-345.pdf plain text: biomedich-345.txt item: #124 of 191 id: biomedich-346 author: Hussein, Mohamed; Mumtaz, Madiha; Nasir, Iqra; Abdullahi, Anisa title: Nanotechnology-Based Vaccines date: 2023-06-21 words: 11996 flesch: 51 summary: Co- administration resulted in no change to influenza vaccine immune response although a reduction in antibody responses to the NVX-CoV2373 vaccine was noted. Vaccine efficacy against the severe disease was 96.7% (95% CI, 80.3 to Hussein et al. – Nanotechnology-Based Vaccines 345 99.9). keywords: adjuvant; adults; adverse; adverse events; aged; analysis; antibodies; antibody; antigen; arm; authors; baseline; blind; bnt; bnt162b2; candidate; cells; chad; chemistry; clinical; clinical trial; controlled; cov-2; cov2373; covid-19; data; date; days; delivery; diseases; doi:10.1016; dose; efficacy; elu; et al; events; geometric; gmts; group; healthy; higher; human; igg; immune; immunogenicity; influenza; influenza vaccine; injection; journal; local; low; mean; medicine; method; moderate; month; mrna; nanoparticle; nanotechnology; natural; negative; non; nps; nvx; nvxcov2373; participants; patients; people; phase; placebo; population; potential; primary; product; protein; protein vaccine; rabies; randomized; reactogenicity; recipients; recombinant; responses; results; safety; sars; second; severe; similar; specific; spike; study; systemic; titers; title; transient; trial; type; vaccination; vaccine; vaccine efficacy; variants; virus; years cache: biomedich-346.pdf plain text: biomedich-346.txt item: #125 of 191 id: biomedich-349 author: Dewi, Listiana Masyita; Ariffah, Hilda Zaniba; Aisyah, Riandini; Nurhayani, Nurhayani title: Bio-larvicidal Potential of Betel Leaves (Piper betle L) Ethanolic Extract in Addition of PEG 400 Diluent on Aedes aegypti Larvae date: 2023-08-15 words: 3094 flesch: 60 summary: Abstract Dengue hemorrhagic fever (DHF) is a kind of vector transmitted disease, by Aedes aegypti. Aedes aegypti is the main vector of Dengue Hemorrhagic Fever (DHF) and Chikunguya. keywords: active; addition; aedes; aedes aegypti; aegypti; betel; betle; bio; concentration; container; control; data; death; dhf; diluent; eebl; ethanolic; extract; group; health; hours; indonesia; laboratory; larval; larvicidal; leaves; mortality; muhammadiyah; negative; peg; piper; plant; positive; potential; study; surakarta; temephos; test; treatment; value; water cache: biomedich-349.pdf plain text: biomedich-349.txt item: #126 of 191 id: biomedich-35 author: Luthfi, Muhammad Ja’far title: Modified Alizarin Red S-Alcian Blue Staining for Reptilian Skeleton date: 2016-04-15 words: 1378 flesch: 57 summary: Keywords: Skeleton, Alizarin Red S, Alcian Blue, Reptilia, Double-staining Introduction Skeleton are supporting system for vertebrate body. Visualization of the Fetal Skeletal System by Double Staining with Alizarin Red and Alcian Blue. keywords: alcian; alizarin; blue; bone; cartilage; clearing; double; fat; figure; fixation; gecko; method; modified; red; reptilian; skeleton; skin; specimen; staining; study; tail; vertebrae cache: biomedich-35.pdf plain text: biomedich-35.txt item: #127 of 191 id: biomedich-351 author: Wijerathna, Rathnayaka Mudiyanselage Nipuni; Wijeweera, Achini Anuradha; Wijethunga, Anushi Madushani; Mapa, Mapa Mudiyanselage Sumudu Tharangani title: Determination of Oil Quality and Antifungal Effect of Selected Citronella Accessions (Cymbopogon nardus, Cymbopogon winterianus) to Formulate an Anti-Dandruff Shampoo date: 2023-08-23 words: 10085 flesch: 49 summary: The well of the medium was filled with 20 μL of Citronella oil shampoo. Keywords: Antidandruff shampoo; Antifungal activity; Citronella oil; Cymbopogon nardus; Cymbopogon winterianus. Abbreviations: International Standard Organization (ISO); Sri Lanka Standards (SLS); Minimal Inhibitory Concentration (MIC); Saburound Dextrose Agar (SDA); Potato Dextrose Agar (PDA); Dimethyl sulfoxide (DMSO). keywords: accessions; activity; albicans; antidandruff; antidandruff shampoo; antifungal; candida; ceylon citronella; citronella accessions; citronella oil; citronella samples; citronellal; composition; concentration; content; control; cymbopogon; density; difference; distillation; essential; ethanol; foam; formulated; formulation; geraniol; geranyl; hair; highest; hp t3; index; inhibition; inhibitory; iso; java; java citronella; journal; leaves; mean; mic; moisture; mp t1; nardus; natural; negative; oil antidandruff; oil hp; oil quantity; oil samples; oils; optical; organoleptic; pda; positive; product; properties; quality; quantity; range; refractive; relative; results; rotation; samples; sda; shampoo; shampoo samples; shows; significant; sls; solubility; sri; standards; steam; t1 citronella; t1 oil; table; tested; time; types; values; viscosity; water; wetting; winterianus; xylene; zone; 𝑂𝑖𝑙; 𝑠𝑎𝑚𝑝𝑙𝑒; 𝑤𝑒𝑖𝑔ℎ𝑡 cache: biomedich-351.pdf plain text: biomedich-351.txt item: #128 of 191 id: biomedich-354 author: Lestari, Tiffany Hanik; Susandarini, Ratna title: Identification of Primary and Secondary Metabolites of Apis cerana Honey using FTIR-ATR Diamond Spectroscopy and Their Botanical Origin date: 2023-08-21 words: 5765 flesch: 59 summary: Variation on primary and secondary metabolites in honey samples was strongly affected by the botanical origin, geographical origin, and the local condition around beekeeping areas where the honeycombs were placed. Honey samples were stored in a refrigerator at 4oC to maintain their quality prior to FTIR-ATR analysis. keywords: alcohol; amide; analysis; apis; area; atr; atr diamond; band; beekeeping; bees; biochemical; biology; bonds; cellulose; central; central java; cerana; cerana honey; chemical; chemistry; close; cm-1; community; compounds; content; diamond; et al; farmer; figure; flavonoid; food; ftir; groups; harvesting; heating; honey; honey samples; honeybee; house; iii; indonesia; infrared; java; journal; kasprzyk; lestari; lipid; magelang; medicine; metabolites; method; multifloral; natural; nests; origin; plants; pollen; presence; primary; process; properties; protein; quality; residential; results; samples; secondary; species; spectroscopy; stretching; structure; study; susandarini; table; tannin; tree; vibrations; water; yard; yogyakarta; ✓ ✓ cache: biomedich-354.pdf plain text: biomedich-354.txt item: #129 of 191 id: biomedich-36 author: Sedyadi, Endaruji; Aini, Syafiana Khusna; Anggraini, Dewi; Ekawati, Dian Prihatiningtias title: Starch-Glycerol Based Edible Film and Effect of Rosella (Hibiscus Sabdariffa Linn) Extract and Surimi Dumbo Catfish (Clarias gariepinus) Addition on Its Mechanical Properties date: 2016-10-24 words: 5744 flesch: 64 summary: CH (stretching) between edible films edible film tapioca with the addition of surimi and rosella extract is shown in wave number 2924.09 and 2854.65 cm-1. The tensile strength test with a variety of surimi edible film is presented in Figure 2 which shows that the tensile strength ranging between 0.83 to 1.09 N. keywords: absorption; addition; anthocyanin; catfish; changes; cm-1; coating; color; concentration; dan; dumbo; edible; edible film; effect; elongation; et al; extract; figure; film; flower; food; functional; glycerol; grams; graph; group; hcl; hibiscus; jurnal; kimia; materials; maximum; measurement; mechanical; method; mixture; natural; new; number; pangan; petals; presence; product; properties; protein; red; research; results; rosella; rosella extract; sabdariffa; sample; santoso; spectra; spectrum; starch; strength; surimi; surimi edible; tapioca; teknologi; tensile; test; thickness; transmission; value; vapor; variation; water; wave; wavenumber; wvtr cache: biomedich-36.pdf plain text: biomedich-36.txt item: #130 of 191 id: biomedich-37 author: Fitriawan, Fuad title: Analysis of Bull Sperm DNA Abnormalities Due to Cadmium Accumulation date: 2017-04-27 words: 2800 flesch: 59 summary: Based on the results of Bali bull sperm DNA amplification with a variation of the old treatment using a primer OPA2 cadmium, OPA4, and OPA6 showed that the highest percentage of sperm DNA damage treated with cadmium is composed of three groups: a) The purpose of this research was to get the results of the molecular characteristic picture of the overall characteristics of DNA loci that have abnormalities in bull sperm and get a picture of differences in overall DNA loci of abnormal and normal sperm. keywords: abnormalities; abnormality; analysis; atp; bali; biology; bull; cadmium; cause; changes; chloride; cik; control; damage; data; dna; ecto; effect; enzyme; figure; fitriawan; gene; group; hours; inability; infertility; medicine; method; molecular; motility; movement; opa; pages; pattern; pcr; percent; picture; rapd; research; results; semen; set; similarity; sperm; spermatozoa; study; total; treatment; university cache: biomedich-37.pdf plain text: biomedich-37.txt item: #131 of 191 id: biomedich-372 author: Sanni, Joseph Adaviruku; Sanni, Grace Omayoza; Awoniyi, Rufus Ranmilowo; Osanyinlusi, Remi; Richards, Yvonne Ego title: Proximate and Mineral Composition of Atlantic Mackerel (Scomber scombrus) and Atlantic Horse Mackerel (Trachurus trachurus) date: 2023-08-15 words: 3002 flesch: 61 summary: Abstract Atlantic mackerel (Scomber scombrus) and Atlantic horse mackerel (Trachurus trachurus), locally known as kote, are fishery species consumed in Nigeria due to their high nutritional values. This research determined the nutritional composition of the local dried fish, Scomber scombrus and Trachurus trachurus. keywords: aremu; ash; atlantic; composition; content; crucible; crude; essential; fat; fish; flask; food; heat; high; journal; mackerel; mg/100; mineral; moisture; nigeria; nutritional; oven; protein; proximate; result; sample; scomber; scomber scombrus; scombrus; species; trachurus; trachurus trachurus; value cache: biomedich-372.pdf plain text: biomedich-372.txt item: #132 of 191 id: biomedich-375 author: Noah, Kufre U.; Udobang, John A.; Okokon, Jude E.; Anagboso, Martin O.; Ebong, Nwakaego Omonigho title: Nephroprotective Activities of Ethanol Root Extract and Fractions of Hippocratea africana Against Doxorubicin-Induced Kidney Toxicity date: 2023-08-23 words: 5188 flesch: 49 summary: Rats in group 3 (C ) treated with 200 mg/kg of H. africana root extract and doxorubicin (1.66 mg/kg), group 4 (D) treated with 400 mg/kg of H. africana root extract and doxorubicin (1.66 mg/kg), group 6 (F) treated with 400 mg/kg of aqueous fraction of H. africana root and doxorubicin (1.66 mg/kg), group 7 (G) treated with 400 mg/kg of dichloromethane fraction of H. africana root and doxorubicin (1.66 mg/kg) and group 8 (H) treated with 100 mg/kg of silymarin of H. africana root and doxorubicin (1.66 mg/kg) had kidney sections showing normal renal tubules and glomeruli with no evidence of pathology seen. Noah et al. – Nephroprotective Activities of Ethanol Root Extract and Fractions … 479 RESULTS AND DISCUSSION Effect of root extract and fractions of H. africana on body and organs weights of rats with doxorubicin- induced toxicity Administration of H. africana root extract and fractions to rats with doxorubicin-induced organs toxicities caused considerable improvement of the body weights compared to the organotoxic group. keywords: activities; activity; administration; africana; africana root; animals; antioxidant; antioxidative; aqueous; blood; control; creatinine; days; dcm; dose; doxorubicin; effect; et al; ethanol; extract; figure; fractions; free; glomeruli; gpx; group; gsh; h&e; hippocratea; hippocratea africana; injury; journal; kidney; levels; magnification; markers; mda; medicine; natural; nephroprotective; nephrotoxicity; nigeria; non; normal; okokon; organotoxic; oxidative; p<0.05; pathology; pharmacology; photomicrograph; plant; product; rats; renal; root; root extract; section; significant; silymarin; sod; stain; stress; study; table; toxicity; toxicology; treatment; tubules; university; urea; uyo; x400 cache: biomedich-375.pdf plain text: biomedich-375.txt item: #133 of 191 id: biomedich-377 author: Fadhallah, Esa Ghanim; Koesoemawardani, Dyah; Indraningtyas, Lathifa title: Chemical Properties of Liquid Broth Extracted from Freshwater and Marine Shrimp Shells Waste date: 2023-08-12 words: 2832 flesch: 57 summary: The liquid broth obtained from marine shrimp shells has higher protein content, MSG content, and antioxidants than the broth obtained from freshwater shrimp shells. The liquid broth was extracted by boiling shrimp shells and heads in water with a ratio of 1:2 for 1 hour at 80oC. Results indicate that the type of shrimp used did not affect the broth's ash, fat, protein, MSG, or antioxidant content. keywords: acids; analysis; antioxidant; ash; astaxanthin; boiling; broth; chemical; content; difference; fat; fisheries; freshwater; freshwater shrimp; heads; indonesia; lampung; liquid; liquid broth; liu; marine; marine shrimp; msg; ppm; properties; protein; protein content; results; shells; shrimp; shrimp shells; significant; study; test; time; type; waste cache: biomedich-377.pdf plain text: biomedich-377.txt item: #134 of 191 id: biomedich-379 author: Hanum, Aghnia Rahmi; Wijayanti, Erna title: Identification of Medicinal Plants and Their Utilization by Community in Kendal Village, Kendal Sub-district date: 2023-08-15 words: 1750 flesch: 56 summary: Keywords: medicinal plants; traditional medicine; utilization. INTRODUCTION The Indonesian archipelago is renowned for its rich biodiversity and diverse agricultural output, which includes medicinal plants. keywords: community; consumption; dan; data; diseases; drunk; generation; interviews; jurnal; kabupaten; kendal; leaves; medicinal; medicinal plants; medicine; natural; obat; parts; people; plants; residents; rhizome; species; study; traditional; treatment; types; use; utilization; village; water cache: biomedich-379.pdf plain text: biomedich-379.txt item: #135 of 191 id: biomedich-38 author: Suryandari, Retno; Widodo, Widodo title: Checklist of Macroalgae in Waisai Coast, Raja Ampat date: 2016-05-01 words: 5388 flesch: 56 summary: Howe f. brevipes (J. Agardh Svedilus), Caulerpa cupressoides (Vahl) C. Agardh, Halimeda discoidea Decaisne, Halimeda Opuntia (Linnaeus) J.V. Lamoroux, Halimeda tuna (J. Ellis & Solander) J.V. Lamoroux, Halimeda cylindraceae Decaisne, Halimeda macroloba Decaisne, Avrainvillea erecta (Berkeley) A. Gepp & E.S. Gepp, Codium geppiorum O.C.Schmidt, Boergesenia forbesii (Hardvey) Feldmann, Valonia ventricosa J. Agardh, Dictyosphaeria cavernosa (Forsskål) Børgesen, Chaetomorpha spiralisOkamura, Anadyomene wrightii Harvey ex. Silva, Sargassum aquifolium (Turner) C. Agardh, Sargassum polycystum C. Agardh, Turbinaria ornata (Turner) J. Agardh, Padina australis Hauck, Canistrocarpus cervicornis (Kutzing) De Paula & De Clerck Hydroclathrus clatratus (C. Agardh ) M. Howe. keywords: agardh; ampat; aquifolium; asia; basal; biology; blade; branches; branching; broad; brown; børgesen; c. agardh; caulerpa; checklist; coast; colour; coral; cylindrical; dark; decaisne; description; distribution; erect; fig; figure; gepp; gmelin; gracilaria; green; growth; guiry; halimeda; holdfast; howe; indonesia; irregularly; j.v; jha; kutzing; lamoroux; laurencia; like; linnaeus; long; macroalgae; main; malaysia; marine; myanmar; opuntia; papilosa; philippines; raja; red; research; sargassum; segments; shaped; singapore; southeast; southeast asia; species; tall; thailand; thallus; transect; turner; vahl; vietnam; waisai cache: biomedich-38.pdf plain text: biomedich-38.txt item: #136 of 191 id: biomedich-388 author: David, Lekpa Kingdom; Uahomo, Precious Ojo; Idung, Victor Hogan; Dakoru, Rachael Data title: Assessment of Sensorimotor Behaviour in Konzo-Induced Rats Using the Irvine, Beattie Bresnahan Forelimb Scale date: 2023-08-12 words: 3496 flesch: 55 summary: Specifically, konzo is associated with a high cyanide diet of bitter cassava consumed over a period of several weeks combined with a low intake of protein, particularly a shortfall of essential S-containing amino acids that are needed to detoxify cyanide to thiocyanate in the body (Howlet et al, 1990). Duration (Weeks) Body Weight (g) Control Konzo Induced Konzo + Complan Konzo + Bambara Nut (Okpa) 334 Biology, Medicine, & Natural Product Chemistry 12 (2), 2023: 431-435 Figure 2. Contact Volar Support: A – Control (Fed with normal feeds – finishers), B – Fed with bitter cassava, C - fed with bitter cassava then treated with Complan, D - Fed with bitter cassava then treated with Bambara Nut Figure 3. keywords: ameliorated; animals; assessment; bambara; beattie; bitter; bitter cassava; body; bresnahan; cassava; cereal; cervical; complan; contact; control; cord; cyanide; david; difference; disease; eating; effect; elbow; experimental; figure; flexed; forelimb; grasping; group; ibb; induced; injury; irvine; joint; konzo; mean; method; models; motor; movement; neurons; normal; nut; okpa; predominant; rats; scale; significant; spinal; support; use; volar; weeks; weight cache: biomedich-388.pdf plain text: biomedich-388.txt item: #137 of 191 id: biomedich-39 author: Sutriyono, Sutriyono title: Optimization of Binocular Microscope with Micro Digital Camera for Measuring Seminiferous Tubules Epithelium Height date: 2016-10-24 words: 1495 flesch: 52 summary: 132,0 µm; 106,3 µm; 75,6 µm, (C). 119,6 µm; 144,8 µm; 101,1 µm, (B). keywords: 10x; binocular; biology; camera; cells; digital; epithelium; figure; height; image; lens; magnification; measurement; microscope; mus; optilab; optimization; organ; seminiferous; slide; testis; tubulus; values cache: biomedich-39.pdf plain text: biomedich-39.txt item: #138 of 191 id: biomedich-396 author: Kamran, Pernia; Ibrahim, Ahsan title: Alkaloids Lead to Potential Inhibition of the Acyl Carrier Protein Reductase to Attenuate Tuberculosis; an in-silico Analysis date: 2023-08-14 words: 4676 flesch: 52 summary: C1 (Protopine), C2 (Apropine), C3 (Avicine), C4 (Penduline), and C5 (Chelerythrine) were used to study the potential inhibition of mycobacterial acyl carrier protein reductase for preventing tuberculosis infection. Mycobacterium tuberculosis causes tuberculosis infection, leading to granulomatous lesions in affected lung tissue. keywords: acid; acp; active; activity; acyl; alkaloids; amino; analysis; anti; aporphine; avicine; binding; biology; bond; candidates; carrier; cells; chelerythrine; chemistry; complex; compounds; development; disease; docking; doi; drug; dynamics; enzyme; figure; ibrahim; ile; infection; inhibition; interactions; isoniazid; kamran; kcal; latent; lead; macromolecule; molecular; mycobacterial; natural; phe; potential; protein; protopine; pubchem; reductase; research; residues; results; silico; simulation; study; table; target; toxicity; tuberculosis; wang cache: biomedich-396.pdf plain text: biomedich-396.txt item: #139 of 191 id: biomedich-40 author: Widyastuti, Erni; Sedyadi, Endaruji; Prabawati, Susy Yunita title: Effect of Addition of Soursop Leaf Extract to Ganyong (Canna edulis Ker.) Starch Edible Film and its application in Red Grape Storage Time date: 2016-10-24 words: 3710 flesch: 68 summary: Red grape controls were subjected to 50% texture softening on day 13, red grape coated with edible films without extract additions were able to retain 50% of the texture for up to 41 days, and in red grape coated with edible film with the addition of soursop leaf extract subjected to as much texture softening 50% on day 40. This study aimed to determine the effect of addition of Soursop leaf extract to edible film and its effect on the storage time of red grapes. keywords: addition; aloe; antioxidant; application; cm-1; coated; coating; damage; dan; days; edible; edible film; effect; ekstrak; elongation; extract; figure; film; food; fruit; ftir; ganyong; grape; increase; jurnal; leaf; leaf extract; leaves; modulus; mpa; properties; rate; red; red grape; research; result; room; soursop; soursop leaf; starch; storage; strength; teknologi; temperature; tensile; test; texture; thickness; time; total; transmission; value; vapor; vera; water; weight; young cache: biomedich-40.pdf plain text: biomedich-40.txt item: #140 of 191 id: biomedich-401 author: Widiyawati, Ai; Susilo, Hadi; Mu'jijah, Mu'jijah; Suyamto, Suyamto; Abdilah, Nurullah Asep title: Weed Community Structure in Patia Village Rice Fields Patia Sub-District, Pandeglang Regency date: 2023-08-10 words: 5735 flesch: 61 summary: The results of the study were that the types of rice weeds found in the rice fields of Patia Village, District, and Patia, Pandeglang Regency, namely Ludwigia octovalvis (Jacq) Raven, Commanded cylindricaL. Beauv, Spigelia anthelmia, Ageratum conyzoides, Spihemoclea zeylanica, Altemanthera sessillis, Eclipta prostate, Cypress deformed L., Digitaria sp. and Mimosa chaste L. The structure of rice weeds in tidal fields with the highest INP value is the weed type Echinochloa chicken leg (41.16%). keywords: 2015; ability; ageratum; altemanthera; anthelmia; area; beauv; chaste; community; competition; control; conyzoides; crop; cylindrical; cypress; digitaria; district; diversity; dominance; ecosystem; environmental; factors; fields; growth; humidity; identification; important; index; indonesia; inp; jacq; journal; land; leaves; light; ludwigia; mimosa; number; octavalvis; pandeglang; patia; patia district; patia village; planting; plants; plot; production; prostate; raven; regency; research; results; rice; rice fields; rice weeds; roots; shannon; soil; species; spigelia; spihemoclea; structure; study; types; value; vegetation; village; water; weeds; wiener; zeylanica cache: biomedich-401.pdf plain text: biomedich-401.txt item: #141 of 191 id: biomedich-41 author: Rakhmiyati, Rakhmiyati; Luthfi, Muhammad Jafar title: Histological Study of Common House Gecko (Hemidactylus frenatus) Regenerated Tail date: 2016-10-24 words: 2079 flesch: 61 summary: According to research conducted by Rachman & Hadi (2008), the posterior part of original tail muscle of a lizard (Mabouya multifasciata Kuhl) has its origo on the chevron bone, spina neuralis, and transverse process, whereas the anterior part of the muscle inserted in the septum. Twenty four individuals consist of twelve common house gecko with original tail and twelve with regenerate tail were used. keywords: autotomy; biologi; cartilaginous; common; cross; dan; ekor; eosin; fat; figure; frenatus; gadjah; gecko; hemidactylus; histological; house; kadal; kuhl; mabouya; mada; magnification; mallory; multifasciata; muscle; original; original tail; perivertebral; regenerated; regenerated tail; section; soesilo; study; tail; tissue; tube; universitas; vertebrae cache: biomedich-41.pdf plain text: biomedich-41.txt item: #142 of 191 id: biomedich-42 author: Sugiyanto, Sugiyanto; Kusumo, Fajar Adi; Aryati, Lina; Hardianti, Mardiah Suci title: A Stability Mathematical Model of Nasopharyngeal Carcinoma on Cellular Level date: 2016-10-24 words: 2001 flesch: 70 summary: a c i d        3 2 3 4 4 ( )( ) For this case II: In the second case of this sub-population: high dysplastic lesion cells and invansive carcinoma cells is zero. keywords: carcinoma; case; cells; day; density; differential; dysplastic; ebv; equations; equilibrium; figure; high; infected; mathematical; nasopharyngeal; normal; parameter; point; stability; system;   cache: biomedich-42.pdf plain text: biomedich-42.txt item: #143 of 191 id: biomedich-43 author: Widyastuti, Dyah Ayu; Rahayu, Praptining title: Antioxidant Capacity Comparison of Ethanolic Extract of Soursop (Annona muricata Linn.) Leaves and Seeds as Cancer Prevention Candidate date: 2017-04-27 words: 2749 flesch: 54 summary: The antioxidant compound in soursop can be found not only in its fruit, but also in other parts like leaves, seeds, etc. Based on that potency, this study aimed to compare antioxidant capacity of soursop leaves and seeds, also to study about the utilization of soursop parts which is usually not used. Ethanolic extract of soursop leaves and seeds were then tested for antioxidant capacity with DPPH (1,1-diphenyl-2-picrylhydrazyl) method. keywords: 1,1; annona; antioxidant; antioxidant capacity; cancer; capacity; cells; compound; differences; dpph; effect; ethanolic; ethanolic extract; extract; extraction; free; higher; leaves; linn; maceration; method; muricata; natural; potency; potential; radicals; research; result; samples; seeds; significant; solution; soursop; soursop leaves; study; table; test; value cache: biomedich-43.pdf plain text: biomedich-43.txt item: #144 of 191 id: biomedich-44 author: Apriliani, Nurul Safitri; Luthfi, Muhammad Jafar title: Comparative Anatomy and Histology of Black Pomfret (Formio niger) and Nile tilapia (Oreochromis niloticus) Kidney date: 2017-04-27 words: 1746 flesch: 63 summary: Sketch topography of tilapia kidney. Nile tilapia has darker red colour and softer texture than black pomfret kidney. keywords: adult; anatomical; anatomy; black; black pomfret; body; comparative; differences; different; dorsal; figure; fin; fish; fishes; formio; glomerulus; histological; histology; karl; kidney; niger; nile; nile tilapia; niloticus; oreochromis; pomfret; red; shape; tilapia; topography; tubule cache: biomedich-44.pdf plain text: biomedich-44.txt item: #145 of 191 id: biomedich-45 author: Widodo, Widodo; Luthfi, Muhammad Jafar title: Checklist of Flowering Plants (Magnoliophyta) of Mount Nglanggeran, Gunungkidul: Confirmation and Update of Flora of Java and APG III date: 2017-04-27 words: 4301 flesch: 26 summary: Asclepiadaceae Available 6 Cryptolepis sinensis Calotropis gigantea Hoya sp Marsdenia brunoniana Telosma puberula Cosmostigma racemosum Cynanchum sp Marsdenia tenacissima Gymnema sylvestris Asterostemma repandum 162 Rubiaceae Available 8 Hedyotis corymbosa Widodo & Luthfi – Checklist of Flowering Plants (Magnoliophyta) of Mount Nglanggeran, Gunungkidul … 27 Ophiorrhiza mungos Nauclea orientalis Musaenda frondosa Pavetta indica Psychotria sp Paederia scandens Vangueria spinosa-Meyna grisea 163 Capriofoliaceae 164 Valerianaceae 165 Dipsaceae 166 Asteraceae Available 14 Vernonia cinerea Elephantopus scaber Pseudoelephantopus spicatus Ageratum conyzoides Euphatorium inulifolium Erigeron sumatrensis Eclipta prostrata Wedelia montana Wedelia biflora Synedrella nodiflora Bidens biternata Tridax procumbens Emilia sonchifolia 167 Gentianaceae Available 1 Isotoma longiflora 168 Primulaceae 169 Plumbaginaceae Available 1 Plumbago zeylanica 170 Plantaginaceae 171 Campanulaceae 172 Sphenocleaceae 173 Lobeliaceae 174 Goodeniaceae 175 Stylidiaceae 176 Polemoniaceae 177 Hydrophyllaceae 178 Boraginaceae Available 2 Ehretia microphylla Heliotropium indicum 179 Solanaceae 4 Physalis minima Solanum torvum Solanum comitis Solanum nigrum 180 Convolvulaceae Available 5 Merremia hastata Argyreia mollis 181 Scrophulariaceae Available 3 Lingdernia crustacea Scoparia dulcis 182 Orobanchaceae 183 Lentibulariaceaea 184 Gesneriaceae Available 1 micrantha Bridelia stipularis Croton hyrtus Acalypha indica Acalypha boehmerioides Jatropha gossypifolia Jatropha multifida Euphorbia hirta Euphorbia prostrata Euphorbia heterophylla Manihot esculenta Manihot glaziovii Hevea brasiliensis Croton variegatus Acalypha wilkesiana Ricinus communis Jatropha curcas Codiaeum variegatum Pedilanthus variegatus 100 Daphniphyllaceae 101 Cunoniaceae 102 Escalloniaceae 103 Hydrangeaceae Widodo & Luthfi – Checklist of Flowering Plants (Magnoliophyta) of Mount Nglanggeran, Gunungkidul … 25 104 Rosaceae Available 1 Rubus moluccanus 105 Dichapetalaceae 106 Caesalpiniaceae Available 3 Cassia siamea Cassia occidentalis Cassia obtusifolia 107 Mimosaceae Available 8 Albizia montana Albizia lebbeck Albizia procera Leucaena glauca Mimosa pdica Mimosa invisa Acacia auriculiformis Parkia speciosa 108 Papilionaceae Available 15 Crotalaria usaramoensis Crotalaria striata Indiofera sumatrana Desmodium pulchellum Desmodium gangeticum Desmodium triflorum Alysicarpus nummularifolius Uraria crinita Uraria logopoides Abrus precatorius Centrosema pubescens Mucuna pruriens Flemingia strobilifera Alysicarpus sp Gliricidia sepium 109 Hamamelidaceae 110 Buxaceae 111 Salicaceae Flacuortia indica 112 Myricaceae 113 Betulaceae 114 Fagaceae 115 Casuarinaceae Casuarina junghuhnia Casuarina equisetifolia 116 Ulmaceae 117 Moraceae Available 16 Fatoua sp Morus sp Malaisa scandens Streblus asper Streblus taxoides Maclura cochinchinensis Ficus benyamina Ficus septica Ficus montana Artocarpus integra Poikilospermum suaveolens 118 Urticaceaea Available Laportea sp Fleurya sp Pilea microphyla Pouzolzia zeylanica Boehmeria sp 119 Cannabaceae 120 Aquifoliaceae 121 Celastraceae Available 1 Celastrus scandens 122 keywords: acalypha; albizia; angiospermae; apg; area; asiatica; asterids; author; available; backer; bakhuizen; barringtonia; biology; book; boraginaceae; camera; capparis; cassia; category; characteristics; checklist; chemistry; clade; classification; collection; commeliniids; consist; core; core eudicot; data; description; desmodium; difficult; digital; dilleniaceae; dioscorea; diversity; dulcis; education; eudicot; euphorbia; existence; fabids; families; family; ficus; flora; flowering; flowering plants; fruit; genera; glochidion; groups; gunungkidul; gymnospermae; herbaria; herbarium; hisbiscus; identification; iii; illustrations; important; indica; indonesia; jatropha; java; java book; journal; literature; local; location; luthfi; lythraceae; magnoliophyta; main; malvids; materials; medicine; method; monitoring; monocot; montana; mount; mount nglanggeran; mountain; natural; natural product; nglanggeran; nikon; number; observation; old; order; paniculata; passiflora; percentage; period; phyllanthus; pinnata; piper; plant families; plant species; plants; polygonum; press; product; product chemistry; prostrata; representation; research; rosids; rumput; salicaceae; scandens; science; seed; sida; singapore; singh; situ; solanum; species; specimen; study; survey; systematics; table; technology; unrank; update; use; vegetation; visits; visual; volume; widodo; wild; yogyakarta; zyzigium cache: biomedich-45.pdf plain text: biomedich-45.txt item: #146 of 191 id: biomedich-46 author: Anisatuzzahro, Anisatuzzahro; Luthfi, Muhammad Jafar title: Anatomical Study of Male Reproductive Organs of the Indonesian Short-Nosed Fruit Bat (Cynopterus titthaecheilus Temminck, 1825) date: 2017-04-27 words: 2441 flesch: 57 summary: Morphology of bat C. titthaecheilus. One of the species of Megachiroptera is Cynopterus titthaecheilus (C. titthaecheilus). keywords: alveolar; anatomical; anatomy; bat; bats; body; bulbourethral; cells; columnar; cross; cynopterus; deferens; epididymis; epithelial; figure; fruit; garum; gland; indonesian; layer; lumen; magnification; male; mammals; muscle; nosed; organs; penis; prostate; reproductive; sectional; seminal; seminiferous; short; smooth; species; sperm; study; testes; tissue; titthaecheilus; tubule; tunica; vas; vesicle cache: biomedich-46.pdf plain text: biomedich-46.txt item: #147 of 191 id: biomedich-48 author: Anggreini, Dewi title: The Female Population Growth Projection Year 2021 in Trenggalek Regency by Leslie Matrix Model on the Birth Rate and Life Expectancy date: 2017-10-05 words: 6305 flesch: 75 summary: Population growth can provide information as to whether changes in population numbers for next year is always increasing, decreasing or constant. The eigenvectors are used to determine the number of female populations of each age interval, while the eigenvalues are used to determine population growth rates. keywords: 1,2; age; birth; cos; data; distribution; eigen; eigenvalue; equation; expectancy; female; female population; group; growth; leslie; leslie matrix; life; matrix; model; number; population; positive; rate; regency; research; time; trenggalek; vector; women; year; ⋮ ⋮;  ; 𝐱(𝑘; 𝑎2𝑏1; 𝑎𝑛𝑏1𝑏2; 𝑏𝑛−1; 𝑘−1 cache: biomedich-48.pdf plain text: biomedich-48.txt item: #148 of 191 id: biomedich-49 author: Kristamtini, Kristamtini; Wiranti, Endang Wisnu title: Clustering of 18 Local Black Rice Base on Total Anthocyanin date: 2017-10-05 words: 2625 flesch: 62 summary: Clustering dendogram shows that there were 4 groups of black rice cultivars based on the total anthocyanin content. Name of Observation or Cluster C AA AB S E Y W R D T B AF AE O AC AG AD A Average Distance Between Clusters 0 25 50 75 100 125 150 175 200 225 250 275 300 Kristamtini & Wiranti – Clustering of 18 Local Black Rice Base on Total Anthocyanin 51 SUGGESTION Required clustering of black rice cultivars based on morphological properties to support of clustering based on the total anthocyanin content. keywords: andel; anthocyanin; anthocyanin content; antioxidant; banjarnegara; bantul; beras; beras hitam; berbulu; black; black rice; cempo; clustering; color; content; cultivars; food; genetic; group; hitam; hitam tugiyo; indonesia; ireng; local; magelang; ntt; patalan; pericarp; purple; red; rice; sragen; total; total anthocyanin; tugiyo; umur; yogyakarta; yunianto cache: biomedich-49.pdf plain text: biomedich-49.txt item: #149 of 191 id: biomedich-5 author: Widodo, Widodo; Amin, Mohamad; Al-Muhdar, Mimien Henie Irawati; Luthfi, Muhammad Ja’far title: Morpho-Anatomical Analysis of Cosmostigma racemosum (Asclepiadoideae) Flowers date: 2014-04-01 words: 8044 flesch: 59 summary: 42 Biology, Medicine, & Natural Product Chemistry 3 (1), 2014: 35-46 The mesophyll tissues of C. racemosum flower are differentiated based on cell size and density. The objective of this study was to reveal morpho- anatomical structure of Cosmostigma racemosum flower. keywords: 2006; 2013; abaxial; analysis; anatomical; anatomy; anther; apocynaceae; arrangement; asclepiadoideae; base; biology; bundles; calyx; cells; chamber; characteristics; characters; colleter; corolla; corollines; corona; corpusculum; cosmostigma; cosmostigma racemosum; data; description; development; epidermal; epidermis; evolution; figure; filament; flora; flower; function; gland; green; gynostegium; identification; important; inflorescence; inner; international; journal; lanka; lateral; length; marsdenieae; medicine; mesophyll; microscope; middle; morphological; morphology; natural; new; nglanggeran; nikon; observation; outer; ovary; packed; parts; phylogeny; plant; pollen; pollinia; position; presence; press; racemosum; racemosum flower; receptacle; research; sac; science; section; shows; small; species; sri; stamen; staminal; state; stigma; stigmatic; structure; studies; study; systematics; theca; tip; tissues; transversal; tribe; tube; type; unit; university; upper; vascular; wall; widodo; yogyakarta cache: biomedich-5.pdf plain text: biomedich-5.txt item: #150 of 191 id: biomedich-50 author: Indrasari, Siti Dewi; Kristamtini, Kristamtini; Wiranti, Endang Wisnu title: Vitamin C and Total Sugar Content Characterization on 31 Accessions of Banana Collection of Banana Germplasm Plants of Yogyakarta date: 2017-10-05 words: 2507 flesch: 61 summary: In addition the content of Vitamin C and total sugar was the required character in the description of banana plants The aim of this research was to know and get the diversity of 31 accessions of banana collection of Banana Germplasm Garden of Yogyakarta based on vitamin C and total sugar content so that the relation of various bananas based on vitamin C and total sugar content are known. High standard deviation values indicate the large diversity of banana accessions that were characterized, indicating that the accessions of each characterized banana were separate accessions of one another. keywords: accessions; ambon; analysis; average; banana; c content; characterization; characters; collection; content; diversity; figure; garden; germplasm; good; high; hijau; indonesia; jaran; kepok; koja; kulon; kuning; lempereng; mangsan; mas; morphological; pisang; plant; progo; raja; sleman; sloka; sugar; sugar content; table; total; total sugar; vitamin; vitamin c; yogyakarta cache: biomedich-50.pdf plain text: biomedich-50.txt item: #151 of 191 id: biomedich-52 author: Luthfi, Muhammad Jafar; Riyanto, Riyanto title: On Designing Interactive Online Atlas of Reptile Anatomy (Mabouya multifacsiata) date: 2017-10-05 words: 1593 flesch: 49 summary: Original images organ Mabouya multifasciata on website system. The fourth step was system testing; there are 2 (two) tests conducted, namely alpha testing conducted directly by the research team about the functional website and beta testing conducted by the general public with a focus on the functionality and interface website. keywords: anatomy; andi; atlas; atlasanatomy.org; atlases; biology; brain; chemistry; data; dengan; design; development; digital; figure; hepar; image; indonesia; information; interactive; internet; mabouya; map; morphology; multifasciata; natural; online; product; reptile; research; results; step; study; system; technology; testing; website; yogyakarta cache: biomedich-52.pdf plain text: biomedich-52.txt item: #152 of 191 id: biomedich-53 author: Ilmawati, Riza Rahayu; Amin, Ahya Zhilalikbar; Amin, Mohamad title: Alliin as a Natural Bioactive from Single Bulb Garlic (Allium sativum) for Nitric Oxide (NO) Increasing in Atherosclerotic Process Based on Insilico Screening date: 2017-10-05 words: 2217 flesch: 50 summary: The mechanism is related to the garlic on cholesterol metabolism (Campbell et al., 2001). Target Selection Input alliin’s SMILES on Pharmmapper (http://lilab.ecust.edu.cn) to identify potential target candidates using mapping approaches Swiss Target Predictions (http: //www.swisstargetprediction.c/) and chemical structure associations with molecular 3D (Gong et al., 2013). keywords: alliin; allium; aspirin; atherosclerosis; biology; blood; bulb; cause; cells; chemistry; compound; dan; disease; docking; drug; endothelial; et al; function; garlic; hydrogen; indonesia; inhibitor; interaction; josling; journal; malang; molecular; muscle; natural; nitric; nos; oxide; plaque; potential; product; protein; reverse; sativum; single; smooth; study; synthase; target; vasodilation; vessels cache: biomedich-53.pdf plain text: biomedich-53.txt item: #153 of 191 id: biomedich-54 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2017-04-14 words: 2149 flesch: 53 summary: ISSN 2540-9328 (online) HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Jafar Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Widodo Department of Biology Education, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: keywords: address; analysis; article; authors; biodiversity; biology; charge; chemistry; communication; data; department; discussion; email; faculty; indonesia; islamic; issn; jafar; journal; kalijaga; kebangsaan; luthfi; malaysia; manuscript; muhammad; natural; new; number; online; picture; product; publication; research; results; science; scientific; sentence; state; submission; sunan; system; technology; text; title; university; words; yogyakarta cache: biomedich-54.pdf plain text: biomedich-54.txt item: #154 of 191 id: biomedich-55 author: Riyanto, Riyanto title: Table of Contents date: 2017-04-14 words: 130 flesch: 35 summary: Kidney Nurul Safitri Apriliani, Muhammad Jafar Luthfi 9 - 12 Anatomical Study of Male Reproductive Organs of the Indonesian Short-Nosed Fruit Bat (Cynopterus titthaecheilus Temminck, 1825) Anisatuzzahro, Muhammad Jafar Luthfi 13 - 17 Checklist of Flowering Plants (Magnoliophyta) of Mount Nglanggeran, Gunungkidul: Confirmation and Update of Flora of Java and APG III Widodo, Muhammad Jafar Luthfi 19 - 36 Leaves and Seeds as Cancer Prevention Candidate Dyah Ayu Widyastuti, Praptining Rahayu 1 - 4 Analysis of Bull Sperm DNA Abnormalities Due to Cadmium Accumulation Fuad Fitriawan 5 - 8 Comparative Anatomy and Histology of Black Pomfret (Formio niger) and Nile tilapia (Oreochromis niloticus) keywords: biology; issn; jafar; linn; luthfi; muhammad cache: biomedich-55.pdf plain text: biomedich-55.txt item: #155 of 191 id: biomedich-56 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2017-10-14 words: 2157 flesch: 53 summary: ISSN 2540-9328 (online) HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Jafar Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Widodo Department of Biology Education, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: keywords: address; article; authors; biodiversity; biology; biotechnology; charge; chemistry; communication; data; department; discussion; email; faculty; indonesia; islamic; issn; journal; kalijaga; kebangsaan; malaysia; manuscript; medicine; natural; new; number; online; original; picture; product; publication; research; results; science; scientific; sentence; state; submission; sunan; system; technology; text; title; university; words; year; yogyakarta cache: biomedich-56.pdf plain text: biomedich-56.txt item: #156 of 191 id: biomedich-57 author: Riyanto, Riyanto title: Table of Contents date: 2017-10-14 words: 138 flesch: 30 summary: ISSN 2540-9328 (online) CONTENTS The Female Population Growth Projection Year 2021 in Trenggalek Regency by Leslie Matrix Model on the Birth Rate and Life Expectancy Dewi Anggreini 37 - 45 Clustering of 18 Local Black Rice Base on Total Anthocyanin Kristamtini, Endang Wisnu Wiranti 47 - 51 Vitamin C and Total Sugar Content Characterization on 31 Accessions of Banana Collection of Banana Germplasm Plants of Yogyakarta Siti Dewi Indrasari, Kristamtini, Endang Wisnu Wiranti 53 - 57 Alliin as A Natural Bioactive from Single Bulb Garlic (Allium sativum) for Nitric Oxide (NO) Increasing in Atherosclerotic Process Based on Insilico Screening Riza Rahayu Ilmawati, Ahya Zhilalikbar Amin, Mohamad Amin 59 - 62 On Designing Interactive Online Atlas of Reptile Anatomy (Mabouya multifacsiata) Muhammad Jafar Luthfi, Riyanto 63 - 68 keywords: amin; banana; biology; issn; wiranti; wisnu cache: biomedich-57.pdf plain text: biomedich-57.txt item: #157 of 191 id: biomedich-58 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2016-04-14 words: 1889 flesch: 52 summary: Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Maizer Said Nahdi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Ja’far Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. keywords: address; article; authors; biology; chemistry; cover; data; department; discussion; editor; english; faculty; follow; indonesia; islamic; journal; kalijaga; kebangsaan; letter; malaysia; manuscript; natural; new; number; original; picture; product; publication; reference; research; results; science; scientific; sentence; space; state; sunan; system; technology; title; university; words; yogyakarta cache: biomedich-58.pdf plain text: biomedich-58.txt item: #158 of 191 id: biomedich-59 author: Riyanto, Riyanto title: Table of Contents date: 2016-04-14 words: 109 flesch: 20 summary: Dewi Anggreini 9 - 14 Determination of Levels Leisure Village Patronage UIN Sunan Kalijaga Yogyakarta: Improving Governance Patronage towards Rural Village Green and Environmentally Friendly Supriatna, Thaqibul Fikri Niyartama, Iwan Kuswidi 15 - 18 Modified Alizarin Red S-Alcian Blue Staining for Reptilian Skeleton Muhammad Jafar Luthfi 19 - 22 Checklist of Macroalgae in Waisai Coast, Raja Ampat Retno Suryandari, Widodo 23 - 32 In Gunung Ijo Baturagung Yogyakarta Widodo, Muhammad Jafar Luthfi 1 - 8 Local Stability Analysis of a Mathematical Model of the Interaction of Two Populations of Differential Equations (Host-Parasitoid) keywords: biology; jafar; luthfi; muhammad; widodo cache: biomedich-59.pdf plain text: biomedich-59.txt item: #159 of 191 id: biomedich-6 author: Ekaputri, Rahmawati; Sudarsono, Sudarsono; Mulyaningsih, Budi title: Larvicidal Effect of Vinca Fruit Extract (Vinca rosea) Against Aedes aegypti Larvae and Secondary Metabolites Profile by Thin Layer Chromatography date: 2014-04-01 words: 1565 flesch: 57 summary: The present study was carried out to determine the larvicidal activity of Vinca rosea fruit extract against Aedes aegypti larvae. Five concentrations of Vinca fruit extract were tested against the 3rd instar Aedes aegypti larvae. keywords: activity; aedes; aegypti; alkaloids; chromatography; concentrations; dragendorff; effect; extract; fruit; hours; larvae; larvicidal; layer; lc50; lc90; mosquito; ninhydrin; plant; positive; probit; reagent; results; rosea; thin; vinca; zones cache: biomedich-6.pdf plain text: biomedich-6.txt item: #160 of 191 id: biomedich-60 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2016-10-14 words: 2121 flesch: 52 summary: ISSN 2540-9328 (online) HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Jafar Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Widodo Department of Biology Education, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: keywords: address; article; authors; biodiversity; biology; biotechnology; charge; chemistry; communication; data; department; discussion; effect; email; faculty; indonesia; islamic university; issn; journal; kalijaga; malaysia; manuscript; medicine; natural; new; number; online; original; picture; product; publication; research; results; science; scientific; sentence; state; submission; sunan; system; technology; text; title; university; university kebangsaan; university sunan; words; yogyakarta cache: biomedich-60.pdf plain text: biomedich-60.txt item: #161 of 191 id: biomedich-61 author: Riyanto, Riyanto title: Table of Contents date: 2016-10-14 words: 142 flesch: 34 summary: Addition on Its Mechanical Properties Endaruji Sedyadi, Syafiana Khusna Aini, Dewi Anggraini, Dian Prihatiningtias Ekawati 33 - 40 Optimization of Binocular Microscope with Micro Digital Camera for Measuring Seminiferous Tubules Epithelium Height Sutriyono 41 - 47 Histological Study of Common House Gecko (Hemidactylus frenatus) Regenerated Tail Rakhmiyati, Muhammad Jafar Luthfi 49 - 53 Effect of Addition of Soursop Leaf Extract to Ganyong (Canna edulis Ker.) Erni Widyastuti, Endaruji Sedyadi, Susy Yunita Prabawati 55 - 59 A Stability Mathematical Model of Nasopharyngeal Carcinoma on Cellular Level Sugiyanto, Fajar Adi Kusumo, Lina Aryati, Mardiah Suci Hardianti 61 - 64 keywords: edible; endaruji; extract; film; issn; sedyadi; starch cache: biomedich-61.pdf plain text: biomedich-61.txt item: #162 of 191 id: biomedich-62 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2014-04-15 words: 1914 flesch: 49 summary: Volume 3 - Number 1 - 2014 I S S N 2 0 8 9 - 6 5 1 4 Biology, Medicine, & Natural Product Chemistry Volume 3 – Number 1 – 2014 ISSN 2089-6514 HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Ja’far Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Maizer Said Nahdi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, keywords: address; article; authors; biology; biotechnology; chemical; chemistry; data; department; discussion; editor; english; faculty; follow; indonesia; islamic; journal; kalijaga; kalijaga yogyakarta; kebangsaan; letter; malaysia; manuscript; medicine; natural; new; number; original; picture; product; publication; reference; research; results; science; scientific; sentence; state; state islamic; sunan; sunan kalijaga; technology; title; university; words; yogyakarta cache: biomedich-62.pdf plain text: biomedich-62.txt item: #163 of 191 id: biomedich-63 author: Riyanto, Riyanto title: Table of Contents date: 2014-04-15 words: 173 flesch: -25 summary: On the Growth Inhibition of Candida albicans ATCC 10231 and Trichophyton mentagrophytes In Vitro Rini Setyowati, Sudarsono, Setyowati E.P 15 - 19 Larvicidal Activity of The Mixture of Cashew Nut Shell Liquid (CNSL) and Aqueous Extract of Sapindus rarak DC Against Larvae of Culex quinquefasciatus Rahmi Safarina Fauziah, Sudarsono, Budi Mulyaningsih 21 - 23 Identification of Migratory Birds and Their Spesific Characteristics of Habitat in the Salt Water Lake of Gili Meno, North Lombok Distric Diah Purwitasari, Luh Gde Sri Astiti, Supriadi 25 - 30 Larvicidal Effect of Vinca Fruit Extract (Vinca rosea) Against Aedes aegypti Larvae and Secondary Metabolites Profile by Thin Layer Chromatography Rahmawati Ekaputri, Sudarsono, Budi Mulyaningsih 31 - 33 Morpho-Anatomical Analysis of Cosmostigma racemosum (Asclepiadoideae) Flowers Widodo, Mohamad Amin, Mimien Henie Irawati Al-Muhdar, Muhammad Ja’far Luthfi 35 - 46 Biology, Medicine, & Natural Product Chemistry Volume 3 – Number 1 – 2014 ISSN 2089-6514 CONTENTS Ecopharmacognosy: Exploring the Chemical and Biological Potential of Nature for Human Health Geoffrey A. Cordell 1 - 14 The Effect of Water-Soluble Stem Extract “Kayu Kuning“ (Arcangelisia flava L.Merr) keywords: biology; budi; extract; flowers widodo; ja’far luthfi; mulyaningsih; natural product; setyowati; sudarsono cache: biomedich-63.pdf plain text: biomedich-63.txt item: #164 of 191 id: biomedich-64 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2014-10-15 words: 1875 flesch: 50 summary: Volume 3 - Number 2 - 2014 I S S N 2 0 8 9 - 6 5 1 4 Biology, Medicine, & Natural Product Chemistry Volume 3 – Number 2 – 2014 ISSN 2089-6514 HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Ja’far Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Maizer Said Nahdi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: M. Iqbal A. T. & Riyanto PUBLISHER: State Islamic University Sunan Kalijaga Yogyakarta and The Society for Indonesian Biodiversity ONLINE: www.sciencebiology.org ADDRESS: State Islamic University Sunan Kalijaga Yogyakarta Jl. keywords: address; article; author; author(s; biology; biotechnology; chemistry; data; department; discussion; editor; english; faculty; follow; indonesia; islamic; journal; kalijaga; kebangsaan; letter; malaysia; manuscript; natural; new; number; original; picture; product; publication; reference; research; results; science; scientific; sentence; state; state islamic; sunan; sunan kalijaga; technology; title; university; words; yogyakarta cache: biomedich-64.pdf plain text: biomedich-64.txt item: #165 of 191 id: biomedich-65 author: Riyanto, Riyanto title: Table of Contents date: 2014-10-15 words: 126 flesch: 32 summary: Against 3rd Instar Larvae of Aedes aegypti Glory Resia Raraswati, Sudarsono, Budi Mulyaningsih 53 - 57 Substitution and Haplotype Diversity Analysis on the Partial Sequence of the Mitochondrial DNA Cytbofindonesian Swamp Buffalo (Bubalus bubalis) Biology, Medicine, & Natural Product Chemistry Volume 3 – Number 2 – 2014 ISSN 2089-6514 CONTENTS A Discovery and Characteristics Description of Telosma Puberula (Asclepiadoideae) in Mount Gedang Atas and Mount Ijo, Baturagung Mountain Yogyakarta Widodo 47 - 52 Larvicidal Activity of a Mixtureof Cashew Nut Shell Liquid and Water-Soluble Extract of Soapnut Fruit (Sapindus rarak dc.) keywords: biology; extract; mount; soluble; sudarsono; water cache: biomedich-65.pdf plain text: biomedich-65.txt item: #166 of 191 id: biomedich-66 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2015-04-15 words: 1865 flesch: 50 summary: Volume 4 - Number 1 - 2015 I S S N 2 0 8 9 - 6 5 1 4 Biology, Medicine, & Natural Product Chemistry Volume 4 – Number 1 – 2015 ISSN 2089-6514 HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Ja’far Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Maizer Said Nahdi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: Riyanto & M. Iqbal A. T. PUBLISHER: State Islamic University Sunan Kalijaga Yogyakarta and The Society for Indonesian Biodiversity ONLINE: www.sciencebiology.org ADDRESS: State Islamic University Sunan Kalijaga Yogyakarta Jl. keywords: address; article; authors; biology; chemistry; cover; data; department; discussion; editor; english; faculty; follow; indonesia; islamic; journal; kalijaga; kebangsaan; letter; malaysia; manuscript; natural; new; number; original; picture; product; publication; reference; research; results; science; scientific; sentence; space; state; sunan; system; technology; title; university; words; yogyakarta cache: biomedich-66.pdf plain text: biomedich-66.txt item: #167 of 191 id: biomedich-67 author: Riyanto, Riyanto title: Table of Contents date: 2015-04-15 words: 102 flesch: 41 summary: Biology, Medicine, & Natural Product Chemistry Volume 4 – Number 1 – 2015 ISSN 2089-6514 CONTENTS A Simple and Practical Method for Rat Epididymal Sperm Count (Rattus norvegicus) Muhammad Ja'far Luthfi 1 - 3 The Phytoestrogenic Potential of Yam Bean (Pachyrhizus erosus) on Ovarian and Uterine Tissue Structure of Premenopausal Mice Cicilia Novi Primiani 5 - 9 The Effect of Intensive Keramba on the Presence of Parasite Organisms in Rivers of Lingsar Area Supriadi, Maratun Janah 11 - 15 Krokot Extract (Portulaca Oleracea. keywords: biology; dye; medicine; natural; norvegicus cache: biomedich-67.pdf plain text: biomedich-67.txt item: #168 of 191 id: biomedich-68 author: Riyanto, Riyanto title: Cover, Editorial Board & Guidance for Authors date: 2015-10-15 words: 1892 flesch: 50 summary: Volume 4 - Number 2 - 2015 I S S N 2 0 8 9 - 6 5 1 4 Biology, Medicine, & Natural Product Chemistry Volume 4 – Number 2 – 2015 ISSN 2089-6514 HONORARY EDITORS: Hildebert Wagner Department Pharmazie, Ludwig-Maximilians-Universität München, Germany Geoffrey A. Cordell Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago, USA EDITOR-IN-CHIEF: Muhammad Ja’far Luthfi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia EDITORIAL BOARD: Mahanem Mat Noor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Jalifah Latip Centre of Chemical Science and Food Technology Studies, University Kebangsaan Malaysia Wisnu Nurcahyo Department of Veterinary Parasitology, Gadjah Mada University, Indonesia Shukor Md. Nor School of Bioscience & Biotechnology, Faculty of Science & Technology, University Kebangsaan Malaysia Maizer Said Nahdi Department of Biology, State Islamic University Sunan Kalijaga Yogyakarta, Indonesia Ahmad Dwi Setyawan Department of Biology, Sebelas Maret University, Indonesia Sugiyarto Department of Biology, Sebelas Maret University, Indonesia Alfred Pakpahan Faculty of Dentistry, Trisakti University, Indonesia Charis Amarantini Faculty of Biotechnology, Christian University Duta Wacana, Indonesia Marini Ahmad Marzuki Malaysian Agricultural Research and Development Institute DESIGN & LAYOUT: Riyanto & M. Iqbal A. T. PUBLISHER: Sunan Kalijaga State Islamic University Yogyakarta and The Society for Indonesian Biodiversity ONLINE: www.sciencebiology.org ADDRESS: State Islamic University Sunan Kalijaga Yogyakarta Jl. keywords: address; article; author; author(s; biology; biotechnology; chemistry; data; department; discussion; editor; effect; english; faculty; follow; indonesia; islamic; journal; kalijaga; kalijaga yogyakarta; kebangsaan; letter; malaysia; manuscript; natural; new; number; picture; product; publication; reference; research; science; scientific; sentence; state; state islamic; sunan; sunan kalijaga; technology; title; university; words; yogyakarta cache: biomedich-68.pdf plain text: biomedich-68.txt item: #169 of 191 id: biomedich-69 author: Riyanto, Riyanto title: Table of Contents date: 2015-10-15 words: 132 flesch: 21 summary: As a Natural Sensitizer for TiO2 Dye-sensitized Solar Cells: The Effect of Temperature Extract Reyza Anni Mufidah, Khamidinal, Endaruji Sedyadi, Didik Krisdiyanto 25 - 29 Effect of Lunasia amara Blanco on Sperm Number, Sperm Motility, and Testicular Histology of Male Rats Muhammad Ja'far Luthfi 31 - 33 Antioxidant Potential of Black, Green and Oolong Tea Methanol Extracts Wahyu Widowati, Tati Herlina, Hana Ratnawati, Gabriella Constantia, I Dewa Gde Sathya Deva, Maesaroh Maesaroh 35 - 39 Medicinal Plants: A Prospect in Developing Male Fertility Enhancing Agent Muhammad Ja'far Luthfi, Mahanem Mat Noor, Jalifah Latip 41 - 47 Tapak Liman (Elephantopus scaber L) As Immunostimulant and Its Effect on Lymphocyte Differentiation in Mice BALB/C Marmi Kelik 49 - 51 Biology, Medicine, & Natural Product Chemistry Volume 4 – Number 2 – 2015 ISSN 2089-6514 CONTENTS Krokot (Portulaca oleracea. keywords: effect; maesaroh; muhammad; natural; number; sperm cache: biomedich-69.pdf plain text: biomedich-69.txt item: #170 of 191 id: biomedich-70 author: Santoso, Heri Budi; Hidayaturrahmah, Hidayaturrahmah; Muhamat, Muhamat title: Leukocytes Description of Mudskipper (Periophthalmodon schlosseri) of Barito River Estuary, Desa Tanipah, Kalimantan Selatan date: 2018-04-30 words: 2332 flesch: 52 summary: The increase of leukocytes number in blood circulation was called lymphocytosis; however, the decrease was called leucopenia. The observation result from mudskipper blood samples were there was no basophil cell (0) and the eosinophil was 0,6%. keywords: average; barito; basophil; blood; cell; coastal; data; desa; description; differentiation; eosinophil; estuary; fish; kalimantan; leukocytes; lymphocytes; medicine; monocytes; mudskipper; neutrophil; normal; number; observation; percentage; periophthalmodon; preparation; research; result; river; samples; schlosseri; selatan; tanipah cache: biomedich-70.pdf plain text: biomedich-70.txt item: #171 of 191 id: biomedich-72 author: Siswanti, Dwi Umi; Asri, Nindy Senissia; Arlinda, Mifta; Rochman, Arianda Poetri Shofia; Syahidah, Akrima title: Physiological Response of 'Segreng' Rice Plant (Oryza sativa L.) to Biogas Sludge at Wukirsari Village, Cangkringan, Sleman date: 2018-04-30 words: 4031 flesch: 67 summary: The abundance of inorganic materials in the soil reduced the regeneration ability of rice plants (Sudadi & Widada, 2001 in Redono, 2016). Parameters measured on the growth of rice plants include the number of leaves, number of seedlings, plant height, and analysis of chlorophyll content by Spectrophotometric Method (AOAC, 1995). keywords: analysis; average; b b; biogas; biogas sludge; biomass; cangkringan; chlorophyll; content; different; field; figure; filled; generative; grains; growth; height; leaves; levels; m b; nitrate; nra; number; oryza; panicles; parameters; physiological; plant; planting; plot; polybag; research; response; result; rice; rice field; rice plant; seedlings; seeds; segreng; siswanti; sleman; sludge; soil; system; tajarwo; test; total; treatments; vegetative; village; week; wukirsari cache: biomedich-72.pdf plain text: biomedich-72.txt item: #172 of 191 id: biomedich-73 author: Arfa, Namira Nur; Daryono, Budi Setiadi; Reflinur, Reflinur title: Comparison of detergent and CTAB method for isolation of DNA from Salak ( Salacca zalacca (Gaert.) Voss. ‘Pondoh’) date: 2018-04-30 words: 4237 flesch: 64 summary: DNA isolation method was chose based on some consideration, such as amount and the molecular weight, purity, time, species and the cost. DNA isolation methods are of several types, such as simple methods using detergents, Nucleon ™ Phytopure ™ Genomic DNA Extraction Kit method and CTAB (Cetyl trimethyl ammonium bromide) method. keywords: 2012; agarose; analysis; biology; bromide; buffer; cell; chemistry; chloroform; compounds; concentration; ctab; ctab method; dan; density; detergent; detergent method; dna; dna isolation; edta; electrophoresis; factor; fruit; gaert; gel; genetic; grams; high; higher; indonesia; isolation; isolation method; isopropanol; leaves; medicine; method; minutes; molecular; mortar; nacl; natural; optical; pcr; plant; pondoh; precipitate; primer; process; product; purity; quality; result; rpm; salacca; salak; samples; separation; solution; study; supernatant; table; tbe; technique; temperature; total; value; voss cache: biomedich-73.pdf plain text: biomedich-73.txt item: #173 of 191 id: biomedich-74 author: Semiarti, Endang; Mursyanti, Exsyupransia; Suyoko, Ahmad; Perdana, Faiza Senja Widya; Widyastuti, Catharina Tri; Subchan, Aditya Nur title: Stability of T-DNA Integration in Phalaenopsis “Sogo Vivien” Transgenic Orchid Carrying 35S::Gal4::AtRKD4::GR date: 2018-04-30 words: 4343 flesch: 58 summary: The development of somatic pre- embryogenesis occurred after 4 weeks of culture characterized by the appearance of propagules on the surface of plant leaf explants. Thus, the stability of the AtRKD4 carrier T-DNA integration in the genomes of transgenic plants was 13.3%. keywords: atrkd4; biology; biotechnology; colour; dna; embryogenesis; embryos; explants; figure; formation; gal4; gene; genome; genomic; growth; iba; induction; integration; leaf; leaves; length; media; medium; mg.l-1; mursyanti; natural; non; normal; number; orchid; percentage; phalaenopsis; plants; ppm; previous; product; propagules; results; semiarti; sogo; sogo vivien; somatic; stability; study; t#1; t#2; t#4; table; tdz; transformant; transgenic; vivien; week; width cache: biomedich-74.pdf plain text: biomedich-74.txt item: #174 of 191 id: biomedich-76 author: Amin, Mohamad; Putra, Kurniawan Setia; Amin, Ihya Fakhrurizal; Earlia, Nanda; Maulina, Dina; Lukiati, Betty; Lestari, Umie title: Quercetin: the bioactive compound from Allium cepa L. as anti-inflammation based on in silico screening date: 2018-04-30 words: 2440 flesch: 44 summary: Third, observing potential target proteins on the SuperPret server online (http://prediction.charite.de/) to adjust the similarity of target proteins which found on the first and second servers. Docking Molecules Docking of quercetin molecules, target proteins, and control compounds (dexamethasone) which are chemical drugs in the treatment of inflammation using PyRx 0.8 software. keywords: -5.7; affinity; allium; analysis; anti; bioactive; biology; bond; cepa; chemical; compound; control; dexamethasone; diseases; docking; enzyme; figure; indonesia; inflammation; inflammatory; interaction; ligand; like; like protein; muscleblind; natural; potential; protein; quercetin; quercetinmuscleblind; receptor; results; server; silico; software; study; target; target protein; value; visualization cache: biomedich-76.pdf plain text: biomedich-76.txt item: #175 of 191 id: biomedich-78 author: Elfiana, Tiara Nur; Fitria, Anisa Nur Izza; Sedyadi, Endaruji; Prabawati, Susy Yunita; Nugraha, Irwan title: Degradation Study of Biodegradable Plastic Using Nata De Coco as A Filler date: 2018-10-31 words: 3881 flesch: 68 summary: The results show that the O-H group of Ganyong Canna (Canna edulis Kerr) biodegradable plastic is located at wave number 3298.03 cm- 1 and shifted to 3290.32 cm-1 after addition of nata de coco. The C-H bonds functional groups in Canna biodegradable plastics and nata de coco plastics are at wave numbers 2920.01 cm-1 and 2916.16 cm-1. keywords: acid; addition; biodegradable; biodegradable plastic; bonds; canna; canna edulis; cellulose; chemistry; cm-1; coco; days; de coco; degradation; edulis; elongation; figure; food; functional; ganyong; ganyong canna; glycerol; groups; high; hours; hydroxyl; increase; kerr; mass; mechanical; nata; nata de; natural; number; plastic; process; product; properties; results; soil; solution; starch; strength; study; tensile; test; thickness; value; vapor; water; wave; wvtr cache: biomedich-78.pdf plain text: biomedich-78.txt item: #176 of 191 id: biomedich-79 author: Karlina, Ina; Luthfi, Muhammad Ja’far title: Comparative Anatomy of Labyrinth and Gill of Catfish (Clarias gariepinus) (Burchell, 1822) and Snakehead Fish (Channa striata) (Bloch, 1793) date: 2018-10-31 words: 3164 flesch: 67 summary: Gill Results showed that catfish and Snakehead Fish gills have a thin epithelial layer for the efficiency of oxygen and gas exchange (absorption and release). Catfish and snakehead fish gills consist of primary lamella, secondary lamella, inter-lamella, blood vessels, epithelial cells, and pole cells. keywords: additional; anatomy; arch; blood; capillary; catfish; cells; channa; clarias; color; connective; dumbo; epithelial; exchange; figure; filament; function; gariepinus; gill; histology; labyrinth; lamella; lamina; layer; left; length; mass; oxygen; primary; raker; respiratory; right; secondary; snakehead; snakehead fish; striata; structure; study; surface; thin; tissue; vessels; water cache: biomedich-79.pdf plain text: biomedich-79.txt item: #177 of 191 id: biomedich-80 author: Sugiyanto, Sugiyanto; Aryati, Lina; Kusumo, Fajar Adi; Hardianti, Mardiah Suci title: Link of Nasopharyngeal Carcinoma and Epstein-Barr Virus date: 2018-10-31 words: 3312 flesch: 64 summary: The population of nasopharyngeal cells is divided into six sub-populations, normal cells, dysplasia cells, EBV-infected cells, high dysplastic cells, invasive carcinoma cells. The mechanism of Epstein-Barr virus infection in nasopharyngeal carcinoma cells. keywords: apoptosis; aryati; barr; barr virus; cancer; carcinoma; carcinoma cells; cells; day; development; dna; dysplastic; ebv; epstein; equation; et al; factors; high; increase; indonesia; infected; infection; invasive; invasive carcinoma; journal; mathematical; nasopharyngeal; nasopharyngeal carcinoma; normal; npc; proliferation; rate; virus cache: biomedich-80.pdf plain text: biomedich-80.txt item: #178 of 191 id: biomedich-81 author: Nugraha, Bayu Setya Aji; Widodo, Widodo; Yuntara, Rendi; Normalita, Normalita title: Diversity of Angiospermae Plant Class Liliopsida in Mount Nglanggeran date: 2018-10-31 words: 1322 flesch: 57 summary: Diagram of plant family class of liliopsida Araceae is the most abundant family of species, among the 8 species found, Alocasia crassifolia and Amorphophallus variabilis are abundant species and are often found around climbing routes. Araceae is the most abundant family of species, among the 8 species found, Alocasia crassifolia and Amorphophallus variabilis are abundant species and are often found around climbing routes. keywords: abundant; alocasia; amorphophallus; anceps; araceae; biology; class; climbing; crassifolia; dan; dioscorea; diversity; family; figure; flora; gunung; indonesia; liliopsida; lipi; mount; nervilia; nglanggeran; pholidota; plants; plicata; research; smilax; species; unique; variabilis; volcano; widodo; wild cache: biomedich-81.pdf plain text: biomedich-81.txt item: #179 of 191 id: biomedich-82 author: Rakhmiyati, Rakhmiyati; Luthfi, Muhammad Ja’far title: Alizarin Red S-Alcian Blue Staining for Regenerated tail of Common House Gecko (Hemidactylus frenatus) date: 2018-10-31 words: 1518 flesch: 59 summary: Bone of original tail; (B). Tail regeneration and other phenomena of wound healing and tissue restoration in lizards. keywords: alcian; alizarin; autotomy; biology; blue; bone; cartilage; common; days; dorsal; figure; frenatus; gecko; hemidactylus; house; magnification; original; processus; red; regenerate; regeneration; tail; ventral; vertebrae; vol cache: biomedich-82.pdf plain text: biomedich-82.txt item: #180 of 191 id: biomedich-84 author: Luthfi, Muhammad Ja'far title: Table of Contents date: 2018-10-31 words: 133 flesch: 42 summary: Ina Karlina, Muhammad Ja’far Luthfi 39 - 43 Diversity of Angiospermae Plant Class Liliopsida in Mount Nglanggeran Bayu Setya Aji Nugraha, Widodo, Rendi Yuntara, Normalita 45 - 49 Link of Nasopharyngeal Carcinoma and Epstein-Barr Virus Sugiyanto, Lina Aryati, Fajar Adi Kusumo, Mardiah Suci Hardianti 51 - 55 Alizarin Red S-Alcian Blue Staining for Regenerated tail of Common House Gecko (Hemidactylus frenatus) Rakhmiyati, Muhammad Ja’far Luthfi 57 - 59 ISSN 2540-9328 (online) CONTENTS Degradation Study of Biodegradable Plastic Using Nata De Coco as A Filler Tiara Nur Elfiana, Anisa Nur Izza Fitria, Endaruji Sedyadi, Susy Yunita Prabawati, Irwan Nugraha 33 - 38 Comparative Anatomy of Labyrinth and Gill of Catfish (Clarias gariepinus) (Burchell, 1822) and Snakehead Fish (Channa striata) (Bloch, 1793) keywords: biology; issn; ja’far; luthfi; muhammad; nugraha; nur cache: biomedich-84.pdf plain text: biomedich-84.txt item: #181 of 191 id: biomedich-85 author: Shaimi, Asma Ulhusna; Aasim, Wan Raihana Wan; Abdullah, Hasmah; Choon, Tan Soo; Wei, Ang Chee; Ismail, Zalina title: Novel Approaches for Detection Fluorescent-Labeled by Cellvizio Lab System on Hippocampal CA1 Region date: 2019-05-01 words: 3992 flesch: 54 summary: Conjugation between Alexa Fluor dye and antibodies were given exceptionally bright and most photostable (Panchuk-Voloshina et al., 1999). The stability to pH of Alexa Fluor dye was monitored by measuring their absorption spectra in buffers at pH 4-9. keywords: absorption; alexa; alexa fluor; antibodies; antibody; approach; brain; ca1; cellvizio; concentration; conjugation; degree; dehydroepiandrosterone; dheas; dheas fluorescence; dye; ester; et al; expression; ffm; figure; fluorescence; fluorophore; hippocampus; imaging; labelling; learning; level; malaysia; medicine; memory; method; neurosteroids; new; probe; protein; reactive; region; research; sdp; signal; solution; spectra; study; system; time; vivo cache: biomedich-85.pdf plain text: biomedich-85.txt item: #182 of 191 id: biomedich-86 author: Sutriyono, Sutriyono; Robbina, Muhammad Rodham; Ndii, Meksianis Zadrak title: The Effects of Wet Cupping Therapy in Blood Pressure, Glucose, Uric Acid and Total Cholesterol Levels date: 2019-10-31 words: 2771 flesch: 57 summary: In China wet cupping therapy become a formal treatment in the hospital. 14 centuries ago Prophet Muhammad implemented wet cupping therapy or hejamah as a curing treatment and become sunnah for muslim. keywords: acid; alternative; blood; blood pressure; cardiovascular; cholesterol; cholesterol level; cupping; cupping therapy; cups; diseases; effect; glucose; health; hejamah; level; mean; medicine; mgdl-1; mmhg; pressure; reduction; refaat; result; significant; skin; study; subjects; table; test; therapy; total; treatment; uric; wet; wet cupping cache: biomedich-86.pdf plain text: biomedich-86.txt item: #183 of 191 id: biomedich-87 author: Sugiyanto, Sugiyanto; Khalda, Luqyana; Ndii, Meksianis Zadrak title: Statistical Analysis of Habbatussauda’s Benefits for Health (Blood Pressure, Glucose and Uric Acid) date: 2019-05-01 words: 1973 flesch: 58 summary: During the two weeks Habbatussauda consumption, respondents were contacted by phone to remind them to consume Habbatussauda and ask them if there are any complaints or perceived side effects while taking the Habbatussauda. Furthermore, respondents who take a blood test will be given 42 Habbatussauda capsule for two weeks consumption, the respondent consumes 3 Habbatussauda capsules daily, each capsule contains 600 mg of pure Habbatussauda. keywords: acid; average; benefits; blood; data; diastole; glucose; habbatussauda; health; medicine; mmhg; pressure; probability; respondents; results; shapiro; systole; table; test; uric; value; wilk cache: biomedich-87.pdf plain text: biomedich-87.txt item: #184 of 191 id: biomedich-88 author: Murtono, Murtono; Ndii, Meksianis Zadrak; Sugiyanto, Sugiyanto title: Mathematical Model of Cervical Cancer Treatment Using Chemotherapy Drug date: 2019-05-01 words: 3106 flesch: 75 summary: I I k MI dt       (1b) 1 1 4 dV n d Cervical cancer cells will develop quickly, uncontrollably, and will continue to divide and then infiltrate the surrounding t issue and continue to spread to connective tissue, blood, and attack important organs and spinal nerves. keywords: asih; cancer; cancer cells; cells; cervical; cervical cancer; chemotherapy; day; equation; infected; mm2; model; normal; rate; treatment; u u;   cache: biomedich-88.pdf plain text: biomedich-88.txt item: #185 of 191 id: biomedich-90 author: Erhirhie, Earnest Oghenesuvwe; Ilodigwe, Emmanuel Emeka; Ajaghaku, Daniel Lotanna; Umeokoli, Blessing Ogechukwu; Eze, Peter Maduabuchi; Okoye, Festus Basden Chiedu title: Antioxidant Activities of the Leaf Extract and Fractions of Dryopteris filix-mas (L.) Schott could be Attributed to The Abundance of Polyphenol Compounds date: 2020-04-16 words: 3920 flesch: 48 summary: This study revealed that the polyphenol flavonoid, quercetin-3-O-αL-rhamnopyranoside could be responsible for antioxidant activity of ethno-medicinal property of D filix-mas leaf. Hindawi Publishing Corporation Oxidative Medicine and Cellular Longevity Volume 2016, Article ID 7432797, 9 pages http://dx.doi.org/10.1155/2016/7432797 Khatoon, M., Islam, E, Islam, R., Rahman, A.A., Alam, A.H.M.K., Khondkar, P., Rashid, M. and Parvin, S., 2013, Estimation of total phenol and in vitro antioxidant activity of Albizia procera leaves, BMC Res Notes. keywords: 2014; acetate; acid; activities; activity; antioxidant; ascorbic; assay; butanol; compound; concentration; diseases; dpph; dryopteris; erhirhie; et al; ethyl; extract; faculty; ferric; filix; flavonoids; fractions; frap; free; ic50; inhibition; isolated; leaf; leaves; mas; mean; medicinal; natural; nigeria; nitric; oxidative; oxide; pharmaceutical; phenolic; plant; power; properties; quercetin; radicals; res; scavenging; sciences; sph; study; table; university; values; vlc cache: biomedich-90.pdf plain text: biomedich-90.txt item: #186 of 191 id: biomedich-91 author: Adikwu, Elias; Nelson, Ebinyo Clemente title: Hepatotoxic Assessment of Tramadol-Diclofenac Use: A Study in a Rat Model date: 2019-10-31 words: 3413 flesch: 58 summary: (D): Liver of rat treated with diclofenac-tramadol showing hepatocyte necrosis RESULTS The effects of tramadol-diclofenac were not significant (p>0.05) on the body and liver weights of treated rats when compared to control (Table 1). In 44 Biology, Medicine, & Natural Product Chemistry 8 (2), 2019: 41-45 the present study, tramadol-diclofenac had no effects on the body and liver weights of treated rats. keywords: 6mg; acid; albino; alp; alt; ast; bilirubin; biochemical; blood; body; cat; cholesterol; control; data; day; days; diclofenac; drug; effects; et al; evaluated; function; ggt; glutathione; gpx; group; gsh; hepatic; hepatocyte; hepatotoxic; hepatotoxicity; ldh; levels; liver; mda; mean; n=6; natural; necrosis; normal; oxidative; p<0.001; p<0.05; pain; parameters; protein; rats; samples; sem; serum; significant; sod; stress; studies; study; table; tramadol; treatment; use; weight cache: biomedich-91.pdf plain text: biomedich-91.txt item: #187 of 191 id: biomedich-92 author: Adikwu, Elias; Kemelayefa, James; Ocheiga, Winifred title: Liver Profile of Atazanavir/Ritonavir in Pregnant Albino Rats date: 2019-10-31 words: 3870 flesch: 58 summary: This study assessed the liver profile of ATV/r in pregnant albino rats. Liver Profile of Atazanavir/Ritonavir in Pregnant Albino Rats 49 Table 1. Effects of atazanavir/ritonavir on body and liver weights of pregnant albino rats. keywords: 34.3/11.4; albino; alp; alt; aminotransferase; antiretroviral; ast; atazanavir; atv; bilirubin; biochemical; blood; cat; cell; cholesterol; clinical; control; density; dependent; dose; drug; et al; evaluated; fashion; fig; ggt; glutathione; gpx; group; gsh; hepatic; hepatocytes; hepatotoxicity; hiv; ldh; levels; lipid; lipoprotein; liver; low; maternal; mda; necrosis; observed; p<0.01; parameters; pregnancy; pregnant; pregnant albino; pregnant rats; profile; rats; ritonavir; samples; sem; serum; significant; sod; study; table; total; toxicology; use; women cache: biomedich-92.pdf plain text: biomedich-92.txt item: #188 of 191 id: biomedich-96 author: Supriyati, Hikmah; K, Setyawati Dwi; Ahzami, Ahzami; Sodiq, Farhani; Khoiriyah, Septiana title: Echinoderms Diversity and Abundance in Gunung Kidul Beach Yogyakarta date: 2019-05-01 words: 2363 flesch: 64 summary: Calculation of echinonderm abundance index shows that the Drini beach location has a high abundance value when compared to the abundance value at the Krakal beach loc ation. 2 Echinometra sp 58 85 3 Holothuria sp 1 0 4 Crinoidea 1 0 Based on the results of research conducted there were 4 types of species found on Krakal beach. keywords: abundance; area; aziz; beach; beaches; biology; calculation; class; coast; diversity; drini; drini beach; drini coast; echinoderms; factors; gunung; index; indonesia; intertidal; kidul; krakal; life; low; marine; meters; parameter; research; results; sampling; seaweed; species; temperature; transect; value; vol; waters; yogyakarta; yusron; zone cache: biomedich-96.pdf plain text: biomedich-96.txt item: #189 of 191 id: biomedich-97 author: Supriyati, Hikmah; Rakhmiyati, Rakhmiyati; Luthfi, Muhammad Ja’far title: Anatomical and Histological Study of Shark (Carcharhinus sorrah) Kidney date: 2019-10-31 words: 2722 flesch: 61 summary: Research results show that shark kidneys consist of three parts, namely the head kidney, the body kidney, and the tail kidney. Histological observations of shark kidney in the head kidney reveals many glomerulus, body kidney reveals many distal and tubule proximal contractile tubules whereas tail kidney reveals stroma that is rarely found in vertebrate kidney. keywords: anatomical; anatomy; animals; anterior; biology; blood; body; cartilaginous; cortex; dan; different; distal; dorsal; environment; excess; fins; fish; fluids; gills; glomerulus; head; histological; histology; jakarta; kidney; length; medulla; observations; organs; osmoregulation; parts; posterior; process; proximal; research; shark; shark kidney; stroma; structure; study; tail; transition; tubules; urea; vertebrate; vessels; water; yogyakarta cache: biomedich-97.pdf plain text: biomedich-97.txt item: #190 of 191 id: biomedich-98 author: Kusuma, Trio Yonathan Teja; Wirabhuana, Arya; Yusuf, Faurosi Syafa’atul title: Digital Anthropometer Development for Improving the Measurement Quality of Human Body Dimensions date: 2019-10-31 words: 3450 flesch: 59 summary: To be able to stick the product specifications process capability is calculated by quantifying process capability. The development plan for current application is to improve quality of measurement by testing ability of current application process and developing application to see the improvement in the application process capability. keywords: anthropometric; application; body; capability; chart; chin; control; cpk; current; data; development; digital; dimensions; distance; good; height; human; image; information; interface; length; limit; measurement; object; percentile; point; process; process capability; processing; quality; research; size; study; technology; user; value; width; 𝐶𝑝𝑘 cache: biomedich-98.pdf plain text: biomedich-98.txt item: #191 of 191 id: biomedich-99 author: Luthfi, Muhammad Ja’far; Soesilo, Nyoman Puniawati title: A Simple Method for Clearing and Staining Specimens for The Demonstration of Animal Skeleton date: 2019-05-01 words: 3069 flesch: 60 summary: The method described in this article is a procedure for clearing and staining animal skeleton specimens using Alizarin Red S-Alcian Blue as a tool in teaching the skeletal system. This research has successfully develop method for clearing and staining animal skeleton specimens with Alizarin Red S-Alcian Blue (figure 1, figure 2, figure 3, figure 4 and figure 5). keywords: alcian; alizarin; animals; autotomy; blue; bone; cartilage; clearing; dragon; education; fat; figure; fish; fixation; fracture; function; greene; high; learning; method; plane; process; real; red; removal; ribs; school; science; skeletal; skeleton; skink; snake; specimens; staining; structure; students; study; system; tail; teachers; teaching; turtle; vertebrae cache: biomedich-99.pdf plain text: biomedich-99.txt