Biology, Medicine, & Natural Product Chemistry ISSN: 2089-6514
Volume 3, Number 2, 2014 | Pages: 59-63 | DOI: 10.14421/biomedich.2014.32.59-63

Substitution and Haplotype Diversity Analysis on the Partial Sequence
of the Mitochondrial DNA Cyt b of Indonesian Swamp Buffalo

(Bubalus bubalis)

Akhmad Sukri1*, Mohamad Amin2, Aris Winaya3 and Abdul Gofur2
1Department of Biology, IKIP Mataram, Jl. Pemuda No. 59A Mataram, Nusa Tenggara Barat, Indonesia

2State University of Malang, Jalan Semarang 5 Malang 65145, East Java, Indonesia
3University of Muhammadiyah Malang, Jl. Bandung 1 Malang, East Java, Indonesia

Author correspondency*:
sukri_bio04@yahoo.co.id

Abstract

This research aims to investigate the substitution pattern of nucleotide base and haplotype diversity of Indonesian swamp buffalo (Bubalus
bubalis) based on the mitochondrial DNA cyt b partial gene sequence. 17 samples were chosen from 7 different regions with each uniquely
represents Indonesian biogeography which comprise Aceh, Riau, Madiun, Blitar, Lombok, South Borneo and Tana Toraja. The result of
cyt b gene sequence alignment showed the presence of transition and transversion substitutions and the absence of insertion and deletion.
The amount of transitions was found to be higher than that of transversions and the amount of substitution in pyrimidine was also higher
than that in purine. The highest amount of transitions happened in base TC which is a silent substitution. The result of median joining
network analysis showed that Indonesian haplotype Bubalus bubalis could be classified into 16 haplotypes which form different haplogroups
unique to their geographical region. The result of median joining network analysis also indicated that the genetic relationships of swamp
buffaloes (Bubalus bubalis) in Indonesia are highly influenced by their geographical locations.

Keywords: Substitution, haplotype diversity, Bubalus bubalis, cyt b gene

Introduction

There are three kinds of genetic marker: morphological,
biochemical, and DNA marker. DNA marker has some
characteristics; it has a high rate of polymorphism, is
abundant in amount, is uninfluenced by environment and
has a rate of heritability of 100 percent. Molecular marker
is divided into two kinds: nuclear DNA, and non-nuclear
DNA marker. One of the non-nuclear DNA markers
mostly used for molecular analyses is mitochondrial
DNA (Surahman, 2002). There are two vantage points of
mitochondrial DNA: the evolution of mitochondrial DNA
happens through the pair substitution of a singular base
(Wolstenholme, 1992) and the velocity of mitochondrial
DNA evolution is 10 times faster than that of nuclear
DNA (Brown et al, 1979).

Mitochondrial DNA contains 13 protein-coding genes
and one of them is cyt b protein-coding gene which is
seen as a powerful marker for genetic analyses (Arif &
Khan, 2009). Due to the fact that cyt b gene is various and
experiences evolution quickly, it is then widely used and
is suitable for discovering variations on species level
(Bruford et al, 2003). Besides, cyt b is also one of the best
samples of mitochondrial DNA of mammals (Arnason &
Gullberg, 1996). Cyt b gene has been used mostly for
studying evolution and genetic relationships of mammals,
such as that in the studies of cows and buffaloes
(Schreiber et al, 1999; Kumar et al, 2007; Li et al, 2007;
Qifa et al, 2007; Tobe et al, 2010; Xuan et al, 2010).

In this research, the partial sequence of mitochondrial
DNA cyt b is used for identifying the substitution pattern

and haplotype diversity of Indonesian swamp buffalo
(Bubalus bubalis) as an actualisation for genetic
inventory of Indonesian swamp buffalo which is also
considered as an indirect endeavour to preserve and to
improve the genetic quantity and quality of the population
of swamp buffaloes in Indonesia.

Materials and Method

Blood sample, DNA isolation and PCR

Blood samples were taken from 17 Indonesian swamp
buffaloes (Bubalus bubalis) from 7 sampling regions,
comprising Aceh, Riau, Madiun, Blitar, South Borneo,
Tana Toraja and Lombok. The swamp buffalo blood was
taken through jugular vein using a venoject and vacuum
tube and was then mixed with an EDTA material as much
as 0.1 gram in order to keep the blood liquid. Next, the
tube containing the blood sample was labeled to mark the
sample number and location of the blood sampling. The
blood was then stored in a refrigerator until the DNA
isolation process was conducted.

The process of total DNA isolation was carried out
using NucleospinR Quickpure Blood Kit and was
complied with some established procedures. In order to
detect the result of the DNA isolation, agarose gel
electrophoresis as much as 0.8% was used. After that,
PCR (Polymerase Chain Reaction) was conducted using
a pair of partial mitochondrial DNA cyt b genes with
forward primers L14841:



60 Biology, Medicine, & Natural Product Chemistry 3 (2), 2014: 59-63

AAAAAGCTTCCATCCAACATCTCAGCAT
GATGAAA, and reverse primers H15149:
AAACTGCAGCCCCTCAGAATGATATTTG
TCCTCA (Kocher et al, 1989; Irwin et al, 1991). The
positions of the primers are illustrated in Figure 1. The
process of DNA amplification using PCR consisted of the
reaction mixture of 2,5 µl DNA template, 2,5 µl forward
primers, 2,5 µl reverse primers, 12,5 µl PCR mix, and 5,0
µl dH2O. The PCR process comprised 30 cycles with the
following phases: pre-denaturation phase at 930C for 30
seconds, denaturation phase at 930C for 1 minute,
annealing phase at 500C for 1 minute, elongation at 720C
for 5 minutes and post-elongation phase at 40C.

Sequencing and Data Analysis

Double-stranded DNA, which is the product of PCR, was
then purified and sequenced using one forward primer:
AAAAAGCTTCCAT CCAACATCTCAGCAT
GATGAAA (Kocher et al, 1989) using Taq Dye Deoxy
Terminator Cycle Sequencing Kit and 373S DNA
Sequencer (Perkin Elmer, USA). The total of 17 cyt b gene
sequences was then edited using a programme called
BioEdit Sequence Alignment Editor and all the cyt b gene
sequences were aligned using ClustalX programme
(Thompson et al, 1997) with African buffaloes (Syncerus
caffer) as the outgroup.

The results of the sequence alignment were then used
for discovering the variable and conserved regions, as
well as the substitution pattern of the cyt b gene sequences
of the Indonesian swamp buffaloes (Bubalus bubalis)
which was assisted by the use of MEGA 4 programme
(Kumar et al, 2007). In order to discover the haplotype
diversity of the Indonesian buffaloes, a median joining
network analysis method was conducted using DNA SP
and Network 4.1 programme (Bandelt et al, 1999).

Results

Fragments of DNA which were successfully amplified
using a pair of primers L14841 and H15149 in this

research were about 307 bp (Anderson et al, 1981;
Kohcer et al, 1989; Irwin et al, 1991, and Tanaka et al,
1996). The achieved findings were then confirmed using
BLAST (Basic Local Alignment Search Tool) method to
discover whether the gained sequences in the research
matched with the cyt b gene sequences of Bubalus
bubalis. The result of alignments of the gene sequences
with query from Genbank showed the rate of sequences
homologous ≥ 200 bp and the similarity rate of 98%. The
high percentage of similarity indicated that the sequences
gained in this research were the actual sequences of cyt b
gene of Bubalus bubalis.

The characteristics of a cyt b gene are that it does not
have any stop codon (termination codon) and it has the
lowest guanine as well as the highest cytosine of all genes
(Avise, 1994). The translation result of the DNA
sequences to amino acids found that there was no stop
codon found in the whole cyt b gene samples. This
showed that the amplified DNA sequences were the target
gene sequences.

The Composition of Nucleotide and Variable Region

The nucleotide base composition of Adenine, Thymine,
Guanine and Cytosine is consecutively 29.3%, 26.7%,
27.1% and 16.9%. The total amount of nucleotide A+T =
56% and G+C = 44%. Hence, GC<AT and this is
congruent with what was stated by Sueoka (1962), that
the comparison of CC<AT is relative equal to the content
of GC by 40-45% in vertebrate.

According to the sample and outgroup sequence
alignment result, it was found that the conserved region
was bigger than the variable region with the former as
much as 80.13% and the latter as much as 19.87%. This
finding showed that Indonesian Bubalus bubalis has quite
bigger homologous than African buffaloes, Syncerus
caffer. This is because African buffaloes or Syncerus
caffer is within the same family with Bubalus bubalis,
called Bovidae family, and in the group of buffalo of
genus of Bubalus with two different kinds of species:
Syncerus caffer and Bubalus bubalis.

Figure 1. The positions of the primers L14841 and H15149 in Amplifying Mitochondrial DNA Cyt b Gene Sequences (Source: Irwin et al, 1991).

This finding was supported by Cai et al (2013), who
studied the phylogeny among goats, cows and buffaloes
species under the family of Bovidae based on the SRY

gene sequence variations. They found that cows are
classified in genus Bos, goats in genus Capra, while
buffaloes (both Syncerus caffer and Bubalus bubalis) in



Akhmad Sukri, et al. – Substitution and Haplotype Diversity Analysis on the Partial Sequence … 61

genus Bubalus. A similar finding was also stated by
MacEachern et al (2009) who conducted species
phylogeny reconstruction under the cluster of Bovini,
who found that species from genus Bubalus and Syncerus
are under the same cluster of buffaloes.

Transition and Transversion Substitution

Cyt b gene has a characteristic of having the amount of
transition substitution more than that of transversion
(Avise, 1994). This could be observed from the amount
of nucleotide base which experienced transition
substitutions was 17, while that which experienced
transversion substitution was 6. (Table 1). The nucleotide
base which experienced transition substitutions was the
base numbered 7, 31, 47, 64, 76, 94, 127, 148, 163, 167,
172, 223, 226, 230, 266, 277, and 288, while the
nucleotide base which experienced transversion
substitutions was the base numbered 43, 73, 121, 166,

220, and 259. The transition substitutions mostly took
place in base TC and consecutively followed by CT,
AG and GA, while the transversion substitutions
mostly took place in base AC and CA and
consecutively followed by base substitution TG and
AT (Table 1).

The amount of transition substitutions in pyrimidine
base excelled that in purine base. It could be observed
either from the substitutions of base T to C or those of
base C to T which happened a lot more than the
substitutions of base A to G or those of base G to A. A
similar finding was reported by Tamura and Nei (1993)
and was also supported by Li et al. (2007) who proposed
the taxonomy status of Gayal (Bos frontalis) founded on
the partial sequence of cyt b gene which showed the
amount of substitutions in pyrimidine base (TC) was
more than that in purine base (AG).

Table 1. The Variations of Nucleotide Base of Cyt b Gene Sequences of the Indonesian Bubalus bubalis and of the Outgroup.

Haplotype Diversity

The result of median joining network analysis showed
that Indonesian Bubalus bubalis could be classified into
16 haplotypes according to their own biogeography
(Figure 2). The haplotypes form a haplogroup in
accordance to the biogeography of each sample of
Indonesian swamp buffalo (Bubalus bubalis). Based on
Figure 2, it was known that the variations of nucleotide
base between the haplotypes of the buffaloes from the
same region were smaller than the variations of
nucleotide base between the haplotypes of the buffaloes
from different regions. This suggested that the buffaloes
from the same region shared a higher rate of genetic
relationships than with those from different regions. This
phenomenon could be observed from the haplotypes of
the buffaloes from Aceh region which formed the
haplogroup of Aceh region (A1, A2 and A3) had

relatively smaller variations of nucleotide base between
themselves than with those of other distant regions
(Figure 2).

Discussions

Table 1 illustrates the absence of insertion or deletion but
it indicates the presence of the nucleotide substitutions in
307 bp of the cyt b gene sequence of Indonesian Bubalus
bubalis which were transition and transversion
substitutions. Transition substitution is a substitution
between purine base (A and G) or between pyrimidine
base (C and T), while transversion substitution is a
substitution between purine and pyrimidine base (Graur
and Li, 2000). Cyt b gene has more transition than
transversion substitutions (Brown et al, 1982; Avise,
1994). The same thing happened in this research as there

7 16 20 22 28 31 43 47 60 64 67 73 76 84 94 10
1

11
5

12
1

12
7

13
4

14
1

14
6

14
8

15
0

15
1

15
7

16
3

16
6

16
7

16
9

17
2

17
7

17
9

18
6

18
8

19
0

19
3

20
6

21
1

21
4

22
0

22
3

22
6

23
0

23
1

23
3

23
7

24
1

25
1

25
3

25
6

25
9

26
6

27
0

27
7

28
0

28
3

28
6

29
5

30
5

30
7

Syncerus caffer C T T C C A A T T T C A T C T G A T C A G A G A C C C A A A C T T A A A C C C T C C T T T G C A G A C C A T T G A C T T A
Madiun (1) T . . . T G C C . C . C C . C A G G T T . T A . . G T T G . T C G C T C G A . C A T C C . . . . . . . A G . C T . T C . .
Madiun (2) T . . . T G C C . C . C C T C A G G T T . T A . . G T T G . T C G C T C G A . C A T C C . . . . . . . A G . C T . T C . .
Aceh (3) T C . G G G C C . C . C C . C . . G T T . . A . G . T T G . T . . . . . . A . C A T C C . . . . . T T A G G C A . T G . .
Blitar (1) T C . . T G C C . C . C C . C A . G T . A . A . . . T T G G T C . . . C . T . G A T C C A . . . . T . A G G C A . T C . .
Blitar (2) T C . . T G C C . C . C C . C A . G T . . . A . . . T T G G T C . . . C . T . C A T C C A . . . . T . A G . C A . T C . .
Riau T C . . T G C C . C . C C . C . G G T T A . A . . . T T G . T . . . . . . A . C A T C C . . . G . . . A G . C A . T C . .
Tator (2) T C G . T G C C G C . C C . C C G G T . A . A . . . T T G . T . . . . . . A . C A T C C . . . . A . . A G . C A . T C . .
Kalimantan (3) T C . . . G C C . C . C C . C . G G T . A . A . . . T T G . T . . . . . G A . C A T C C . A . . T . . A G . C A . T C G .
Kalimantan (1) T C . . . G C C . C . C C . C . G G T . A . A . . . T T G . T . . . . . G A . C A T C C . A . . T . . A G . C A . T C G .
Kalimantan (2) T C . . . G C C . C . C C . C . G G T . . . A . . . T T G . T . . . . . G A . C A T C C . A . . T . . A G . C A . T C G .
Lombok (3) T C . . . G C C G C . C C . C . G G T . A . A . . . T T G . T . . . . . . A G G A T C C . A A . A . . A G . C A C T C . G
Lombok (2) T C . . . G C C G C . C C . C A G G T . A . A G . G T T G . T . . . C . . A G G A T C C . A A . A . . A G . C A C T C . G
Tator (3) T C G . T G C C G C . C C . C C G G T . A . A . . G T T G . T . G . . . . A . C A T C C . A . . A . . A C . C A . T C . .
Lombok (1) T C . . . G C C G C . C C . C . G G T . A . A G . G T T G . T . . . . . . A G G A T C C . A A . A . . A G . C A C T C . G
Tator (1) T C G . T G C C G C G C C . C . G G T . . . A . . . T T G . T . . . . C . A . C A T C C . . . . . . . A G . C A . T C . .
Aceh (1) T C . G G G C C . C . C C . C . . G T T . . A . G . T T G . T . . . . . . A . C A T C C . . . . . T T A G . C A . T G . .
Aceh (2) T C . G G G C C . C . C C . C . . G T T . . A . G . T T G . T . . . . . . A . C A T C C . . . . . T T A G . C A . T G . .

Samples
Nucleotide Base Variations (Base to-)



62 Biology, Medicine, & Natural Product Chemistry 3 (2), 2014: 59-63

were 17 transition substitutions and 6 transversion
substitutions. The fact that the transition substitution is
higher than transversion substitution is the result of the
saturation happens on the divergence levels in purine base
is lower than that in pyrimidine base; this makes the
frequency of A and G base to be much different than the
frequency of C and T (Kocher & Carleton, 1997).

The amount of transition substitutions which was
more than the amount of transversion substitutions
identified in this research is supported by Winaya (2013)
who found that there were 16 transition substitutions of
cyt b gene sequence in some kingdoms of cows with the
most amount of base substitutions of T to C base, and vice
versa, from C to T base. The substitution of T to C base
does not necessarily change amino acids since this
substitution is silent substitution. This is supported by
Anderson et al. (1981), who conducted sequencing and
organising the human mitochondrial genome, who
remarked that the substitution of T to C base is a hidden
substitution and does not change amino acids.

Based on the result of median joining network
analysis, there were 16 haplotypes of Indonesian Bubalus
bubalis (Figure 2). Haplotype is the variation of

nucleotide base of a species. The 16 Indonesian
haplotypes Bubalus bubalis identified are then classified
into 7 different haplogroups: the haplogroup of Borneo
(K-1, K-2 and K-3), the haplogroup of Aceh (A-1, A-2
and A-3), the haplogroup of Madiun (M-1 and M-2), the
haplogroup of Riau (R-1), the haplogroup of Tana Toraja
(T-1, T-2 and T-3), the haplogroup of Lombok L-1, L-2
and L-3) and the haplogroup of Blitar (B-1 and B-2). The
result of median joining network analysis showed that
each individual of swamp buffalo formed a haplogroup
according to their own biogeography, comprising Aceh,
Riau, Borneo, Madiun, Blitar, Tana Toraja and Lombok.

This result indicates that the samples taken for this
research are actually originated from the locations in
which the samplings were conducted. However, a
different finding was shown by the haplotype T-1 which
was separated from the haplotype T-2 and T-3 even
though it is still in the same haplogroup with the two
others, the haplogroup of Tana Toraja. This indicates that
the sample T-1 is from a different population of T-2 and
T-3, although it is still in the same region (Figure 2).

Figure 2. The haplotypes of the Indonesian Bubalus bubalis and the Outgroup Based on the Cyt b Gene Sequences. Haplotype is illustrated in Different
Circle Shapes (Big = 2 individuals, Small = 1 individual). The Red Number in the Branch Point Shows the Position of Various Base between
Haplotypes. L = The buffaloes from Lombok, T = The buffaloes from Tana Toraja, M = The buffaloes from Madiun, R = The buffaloes from
Riau, A = The buffaloes from Aceh, K = The buffaloes from Borneo (Kalimantan), B = The buffaloes from Blitar and Sc = Syncerus caffer.

Based on Figure 2, the amount of variations of
nucleotide base of each haplotype will be increased along
with the improvement of the distance amount between
regions or biogeography. This could be observed from the
haplotype of Madiun, Aceh and Riau which have one

branch point and are separated by the variations of
nucleotide base which are relatively small. Nevertheless,
the amount of variations of nucleotide base will get
increased when the haplotype of Aceh is compared with
the haplotype of Lombok which has a huge amount of



Akhmad Sukri, et al. – Substitution and Haplotype Diversity Analysis on the Partial Sequence … 63

variations of nucleotide base and which
biogeographically is very much distant between them.
Indirectly, the bigger the variations of nucleotide
indicates the more distant the genetic relationships, and
this is valid conversely. Therefore, the geographical
location or biogeography influences the genetic
relationships between Indonesian swamp buffaloes
(Bubalus bubalis).

Conclusions

Based on the analysis result it was found that there were
transition and transversion substitutions in cyt b gene
sequences of Indonesian swamp buffaloes (Bubalus
bubalis), and there was not any insertion or deletion.
Also, it was found that the amount of transition was
higher than transversion substitution. The result of
median joining network analysis showed that there were
16 haplotypes of Indonesian swamp buffaloes which
formed different haplogroups based on their own region
or biogeography. Hence, it was concluded that the
geographical location influenced the relatives rate or
genetic relationships of Indonesian swamp buffaloes
(Bubalus bubalis).

Acknowledgments

The authors would like to thank the Fund Management
Institution of Education Ministry of Finance of the
Republic of Indonesia, which has funded this research
(No:PRJ 481/LPDP/2013).

References

Anderson, S.,Bankier, A.T.,Barrel, B.G.,de Bruijn,
M.H.L.,Coulson, A.R.,Drouin, J.,Eperon, I.C.,Nierlich,
D.P.,Roe, B.A.,Sanger, F.,Schrier, P.H.,Smith, A.J.H.,Staden,
R.,& Young, I.G. 1981. Sequences and organization of the
human mitochondrial genome, Nature, Vol 290: 457-465.

Arif, I.A & Khan, H.A. 2009. Molecular markers for biodiversity
analysis of wildlife animals: a brief review. Anim. Biodiv and
Conserv. Vol 32 (1): 9-17.

Arnason, U & Gullberg, A. 1996. Cytochrome b nucleotide
sequences and the identification of five primary lineage of
Extant Cetaceans. Mol Biol Evol, 13(2): 407-417.

Avise, J.C. 1994. Molecular markers, natural history & evolution.
New York: Chapman & Hall.

Bandelts, H.J.,Forster, P.,& Rohl, A. 1999. Median joining network
for inferring intraspesific phylogenies, Molecular Biological
Evolution, 16: 37-48.

Brown, W.M.,George, Jr.M.,& Wilson, A.C. 1979. Rapid
evolution of mitochondrial DNA. Proceeding of the National
Academy and Science of USA, 76: 1967-1971.

Brown, W.M.,Prager, E.M.,Wang, A.,& Wilson, A.C. 1982.
Mitochondrial DNA sequences of primates: tempo and mode
of evolution, J.Mol.Evol, Vol 18: 225-239.

Bruford, M.W.,Bradley, D.G.,& Luikart, G. 2003. DNA markers
reveal the complexity of livestock domestication. Genetics, Vol
4: 900-910.

Cai, X.,Zhang, H., & Mipam, T.D. 2013. Unique variations of SRY
gene result in distinct patrilineal phylogeny of Capra hircus
and another domestic Bovidae, Animal Science Papers and
Reports, Vol 30(3): 219-227.

Graur, D. & Li, W.H. 2000. Fundamentals of molecular evolution.
USA: Sinauer Associates Inc.

Irwin, D.M.,Kocher, T.D.,& Wilson, A.C. 1991. Evolution of the
Cytochrome b gene of Mammals, J Mol Evol, Vol 32: 128-144.

Kocher, T.D.,Thomas, W.K.,Meyer, A.,Edwards, S.V.,Paabo,
S.,Villablanca, F.X.,& Wilson, A.C. 1989. Dynamics of
mitochondrial DNA evolution in animals: amplification and
sequencing with conserved primers, Proc.Natl.Acad.Sci, Vol
86: 6196-6200.

Kocher, R.D & Carleton, K.L. 1997. Base substitution in fish
mitochondrial DNA: pattern and rates. In Molecular
Systematics on Fish. Kocher, T.D and Ca Stepien (Eds.).
Academic Press: San Diego.

Kumar, S.,Nagarajan, M.,Sandhu, S.,Kumar, N.,Behl, V.,&
Nishanth, G. 2007. Mitochondrial DNA analysis of Indian
water buffalo support distinct genetic origin of river and swamp
buffalo, Animal genetics, 38:227-232.

Li, S.,Chang, H.,Ma, G.,Chen, H.,Ji, D.,& Geng, R. 2007. The
origin taxonomic status of the gayal based on cytochrome b
gene partial sequences, Research Journal of Animal Sciences,
Vol 1(4):114-119.

MacEachern, S.,McEwan, J, & Goodard, M. 2009. Phylogenetic
reconstruction and the identification of ancient polymorphism
in the Bovini tribe (Bovidae, Bovinae), BMC Genomics, Vol
10: 2-17.

Qifa, L.,Yinxia, L.,Xingbo, Z.,Zhenshan, L.,Yefen, X.,Dawei,
S.,Xunguang, Q.,Ning, L.,& Zhuang, X. 2007. Study on the
origin and taxonomic status of yak (Poephagus) using
cytochrome b gene of mitochondrial DNA, Front Agric China,
Vol 1(3): 329-333.

Schreiber, A.,Seibold, I.,Notzold, G.,& Wink, M. 1999.
Cytochrome b gene haplotypes characterize chromosomal
lineages of Anoa, the Sulawesi dwarf buffalo (Bovidae:
Bubalus sp), The American Genetics Association, 90: 165-176.

Surahman, M. 2002. Peta genetika tanaman, prinsip dan
aplikasinya. Bul.Agron, Vol 30 (1): 27-30.

Tamura, K dan Nei, M. 1993. Estimation of the number of
nucleotida substitutions in the control region of mitochondrial
DNA in humans and chimpanzees, Mol. Biol. Evol, Vol 10:
512-526.

Tanaka, K.,Solis, C.D.,Masangkay, J.S.,Maeda, K.,Kawamoto,
Y.,& Namikawa, T. 1996. Phylogenetic relationship among all
living species of the genus Bubalus based on DNA sequences
of the cytochrome b gene, Biochemical Genetics, Vol 34: 443-
452.

Thompson, J.D.,Gibson, T.J.,Plewniak, F.,Jeanmough, F.,&
Higgins, D.G. 1997. The Clustal-X windows interface: flexible
stategies for multiple sequences alignment aided by quality
analysis tools, Nucleic Acids Research, Vol 25: 4876-4882.

Tobe, S.S.,Kitchener, A.C.,& Linacre, M.T. 2010. Reconstructing
mammalian phylogenies: a detailed comparison of the
cytochrome b and cytochrome oxidase subunit I mitochondrial
genes, Mammalian Phylogeny Best Gene, Vol 5:1-14.

Winaya, A. 2010. Variasi Genetik dan Hubungan Filogenetik
Populasi Sapi Lokal Indonesia Berdasarkan Penciri Molekuler
DNA Mikrosatelit Kromosom Y dan Gen Cytochrome b.
Disertasi tidak diterbitkan. Bogor: Institut Pertanian Bogor.

Wolstenholme, D.R. 1992. Animal mitochondrial DNA: structure
and evolution, International Review of Cytology, 141: 173-215.

Xuan, T.P.,Georgescu, S.E., Manea, M.A., Hermenean, A.O., &
Costache, M. 2010. Genetic diversity and phylogenetic
relationship of Romanian cattle breeds inferred from
cytochrome b gene partial sequences, Romaian
Biotechnological Letters, Vol 15(2): 5154-5158.




	Content_v3n2_3.pdf (p.1-5)
	BLANK_KOSONG.pdf (p.6)