Biology, Medicine, & Natural Product Chemistry ISSN 2089-6514 (paper) Volume 12, Number 2, October 2023 | Pages: 525-531 | DOI: 10.14421/biomedich.2023.122.525-531 ISSN 2540-9328 (online) In Silico B-Cell Epitope Design of Zika Virus Vaccine Using “Zika Virus Isolate Zika Virus/H. sapiens-Tc/Tha/2006/CVD 06-020, Complete Genome” Lisa Savitri1,*, Syntia Tanu Juwita1, Ester Lianawati Antoro1, Ida Septika Wulansari1, Datin An Nisa Sukmawati2, João Gregório Freitas1, Andre Mario Sequeira Alves Ornai1 1Department of Medical Laboratory Technology, Faculty of Health Sciences; 2Department of Pharmacy, Faculty of Health Sciences, Kadiri University, Jalan Selomangleng No. 1, Kediri, East Java, Indonesia. Corresponding author* lisasavitri@unik-kediri.ac.id Abstract ZIKV has been found in the cerebrospinal fluid (CSF) and brains of adults infected with viruses that manifest neurological disorders. ZIKV is a mosquito-borne single-stranded RNA virus, which belongs to the family Flaviviridae. The efforts of the scientific community have rapidly increased knowledge about this virus. However, understanding the complexities of ZIKV infection, transmission and pathogenesis remains an urgent challenge. Therefore, it is critical to study competent vectors and natural reservoirs for ZIKV, viral genetic diversity and flavivirus coinfection. Due to the great challenges to develop a ZIKV vaccine, it is still not possible to be immunized against ZIKV infection and related pathologies. The methods are nucleotide search for the Zika virus was carried out in silico, using the NCBI bioinformatics application by providing access to biomedical and genomic information. /H. sapiens-tc/THA/2006/CVD_06-020, the complete genome was then searched for FASTA, then prediction of vaccine epitope using the IEDB. The vaccine candidate peptides were analyzed for their antigenicity using VaxiJen. Proteins were classified by AllerTop to known allergenicity, then ToxinPred to predict and design toxic/non-toxic peptides. There are 30 peptide sequences are predicted to be a candidate of peptides B-cell epitope zika virus vaccine design using “zika virus isolate zika virus/H. sapiens-tc/THA/2006/CVD_06-020, complete genome”. Keywords: Vaccine; Zika Virus; B-Cell Epitope; In Silico. Abbreviations: automatic cross covariance transformation (ACC), antibody-dependent increase (ADE), cerebrospinal fluid (CSF), congenital Zika syndrome (CZS), Ebola virus (EBOV), immune epitope database (IEDB), Middle East Respiratory Syndrome (MERS), public health emergency of international concern (PHEIC), Severe Acute Respiratory Syndrome (SARS), Spondwenivirus (SPONV), quantitative structure-activity relationship (QSAR), World Health Organization (WHO), yellow fever virus (YFV). INTRODUCTION The World Health Organization (WHO) has identified, warned and tracked more than 1400 epidemic events in 172 countries due to viruses that emerged between 2018 and 2018, such as influenza, Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS), ebola, yellow fever, Zika, and others. Remarkably, in the last five years, WHO has declared three global health emergencies related to emerging viruses, namely SARS-CoV-2 in 2020, Ebola virus (EBOV) in 2014 (Koenig, et al., 2014; McCoy, et al., 14; Safari, et al., 2015) and Zika virus (ZIKV) in 2016. In the context of ZIKV, WHO referred to Zika as "an extraordinary event that needed a coordinated response, constituting a public health emergency of international concern (PHEIC)", because of the description of a large outbreak of rash, with short-term and mild fever (Brazil, et al., 2016), not in all cases, and a cluster of microcephaly in newborns to infected mothers (Kleber, et al., 2016; Driggers, et al., 2016; Martines, et al., 2016). In fact, ZIKV infection carries a risk of adverse pregnancy outcomes including an increased risk of preterm delivery, fetal death and stillbirth, and congenital malformations collectively characterized as congenital Zika syndrome (CZS), including the aforementioned microcephaly, abnormal brain development, limb contractures, eye abnormalities, brain calcifications, and other neurological manifestations (Martines, et al., 2016; Dudley, et al., 2018; Leisher, et al., 2020). ZIKV has been found in the cerebrospinal fluid (CSF) and brains of adults infected with viruses that manifest neurological disorders (Carteaux, et al., 2016; Da Silva, et al., 2017; Alves, et al., 2019). These flaviviruses cause harmful effects on the adult brain, such as GBS (Da Silva, et al., 2017; Azevedo, et al., 2016; Parra, et al., Manuscript received: 03 May, 2023. Revision accepted: 30 August, 2023. Published: 15 September, 2023. https://doi.org/10.14421/biomedich.2023.122.525-531 526 Biology, Medicine, & Natural Product Chemistry 12 (2), 2023: 525-531 2016; Brito, et al., 2017; Munoz, et al., ., 2016), encephalitis (Da Silva, et al., 2017; Brito, et al., 2017; Soares, et al., 2016), meningoencephalitis (Barbi, et al., 2017; Schwartzmann, et al., 2017 ), acute myelitis (Da Silva, et al., 2017; Muñoz, et al., 2016; Mécharles, et al., 2016) and encephalomyelitis (Da Silva, et al., 2017; Alves, et al., 2019 ), among sensory polyneuropathy and other neurological complications (Nicastri, et al., 2016; Bido, et al., 2018). ZIKV is a mosquito-borne single-stranded RNA virus, which belongs to the family Flaviviridae (genus Flavivirus) (Mayer, et al., 2017; Enfissi, et al., 2016). ZIKV is further classified on the basis of homology into Spondwenivirus (SPONV) within the Spondweni virus clade or serogroup (Kuno, et al., 2007; Haddow, et al., 2016; Brès, 1970), both viruses first characterized in Africa in 1947. and 1952 (Dick, et al., 1952; Haddow, et al., 2016), respectively. ZIKV was previously isolated from the sera of pyrexial rhesus monkeys caged in the canopy of the Zika Forest in Uganda (Dick, et al., 1952), and was discovered during a study of the vector responsible for the sylvan cycle of yellow fever virus (YFV) in Uganda (Brès, 1970). The first human infection confirmed by ZIKV occurred in Nigeria (1954) (Macnamara, et al., 1954), further cases were reported in Uganda (1962–63) and outside Africa in Central Java, Indonesia (1977) (Olson, et al., 1981). ZIKV presents three phylogenetic divisions related to East African, West African and Asian/American lineages (Lanciotti, et al., 2016; Collins, et al., 2019), constituting a single serotype (Heinz, et al., 2017). This ZIKV lineage is thought to have emerged from East Africa in the late 1800s or early 1900s (Lanciotti, et al., 2016; Gatherer, et al., 2016), with Asian lineages responsible for all ZIKV outbreaks in the Pacific. and America (WHO, 2017; Ikejezie, et al., 2017). ZIKV is mainly transmitted to humans by infected Aedes aegypti and Aedes albopictus mosquitoes (Boyer, et al., 2018). An increase in the Aedes mosquito population has been observed in tropical developing countries (Gubler, 2011). Thus, infected mosquitoes, densely populated areas, and global commercial and tourist activities together with modern transportation constitute an efficient scenario for spreading infected mosquitoes and viruses such as ZIKV around the world (Imperato, et al., 2016), as suggested. reported with Dengue (Gubler, 2011) and as was the case with ZIKV epidemic episodes in 2007 (Duffy, et al., 2009), 2013 (Boyer, et al., 2018) and 2014-2015 (Musso, 2015), stated as PHEIC by WHO. The efforts of the scientific community have rapidly increased knowledge about this virus. However, understanding the complexities of ZIKV infection, transmission and pathogenesis remains an urgent challenge. Therefore, it is critical to study competent vectors and natural reservoirs for ZIKV, viral genetic diversity and flavivirus coinfection (Eligio, et al., 2020), as well as potential cross-immune reactivity (i.e., challenging immune diagnosis) and increased infection immunity. (i.e., antibody-dependent increase (ADE)) (Rathore, 2020), fortunately not yet observed in humans (Terzian, et al., 2017), along with environmental factors that may have suddenly triggered the expansion of the ZIKV epidemic and worse viral pathogenesis. (Pierson, et al., 2018; Baud, et al., 2017; Rossati, 2017). Due to the great challenges to develop a ZIKV vaccine (Shan, et al., 2018; Lin, et al., 2018), it is still not possible to be immunized against ZIKV infection and related pathologies. Based on this phenomenon, it is necessary to conduct research to examine vaccine candidates for ZIKV by conducting In Silico B-Cell Epitope Zika Virus Vaccine Design Using “Zika virus isolate Zika virus/H. sapiens- tc/THA/2006/CVD_06-020, complete genome”. MATERIALS AND METHODS The population in this study was the Zika virus. The sample used in this study was Zika virus isolate Zika virus/H. sapiens-tc/THA/2006/CVD_06-020, complete genome. According to Savitri (2021), the nucleotide search for the Zika virus was carried out in silico, using the NCBI bioinformatics application, the National Center for Biotechnology Information advances science and health by providing access to biomedical and genomic information. Zika virus isolate Zika virus/H. sapiens- tc/THA/2006/CVD_06-020, the complete genome was then searched for FASTA. After obtaining FASTA, then prediction of vaccine epitope using the IEDB, which contains a catalog of experimental data on antibodies and T cell epitopes studied in humans, non-human primates, and animal species others in the context of infectious diseases, allergies, autoimmunity and transplantation was done. The IEDB also provides tools to aid in the prediction and analysis of epitopes. This study uses B Cell Epitope Prediction. The vaccine candidate peptides were analyzed for their antigenicity using VaxiJen with the target organism of the virus. This method is based on automatic cross covariance transformation (ACC) of protein sequences into vectors of equal and uniform length. It has been applied to the study of the quantitative structure-activity relationship (QSAR) of peptides of different lengths. The main properties of amino acids are represented by the five E descriptors, which were originally derived by Venkatarajan and Braun. They described the hydrophobicity of amino acids, molecular size, tendency to form helices, relative abundance of amino acids, and tendency to strand formation. Proteins were classified by the k-nearest neighbor algorithm (kNN, k=1) based on a training set containing 2427 known allergens of different species and 2427 non-allergens. Savitri et al. – In Silico B-Cell Epitope Design of Zika Virus Vaccine 527 ToxinPred is an in silico method developed to predict and design toxic/non-toxic peptides. The main data set used in this method consisted of 1805 toxic peptides (<=35 residues). One of the main features of the server is to calculate various physicochemical properties. Peptide analogues can be displayed in a sorting order based on the desired trait. RESULTS AND DISCUSSION Table 1. Candidate Types of Peptides B-Cell Epitope Zika Virus Vaccine Design Using “Zika Virus Isolate Zika Virus/H. sapiens-tc/THA/2006/CVD_06- 020, Complete Genome”. No. Code Peptide 1 Peptide 1 CTTTTTGAGATTC 2 Peptide 2 ATAGATGGGGTTCAGTGGGGAAAAAAGAGGCTATGGAAATAATAAAGAAGTTCAAGAAAGATCTGG 3 Peptide 3 GCTGGATGAGGGGGTAGAA 4 Peptide 4 CTTGGGTTGTGTACG 5 Peptide 5 TTGTGTA 6 Peptide 6 TTGGGAGGTTGAT 7 Peptide 7 GCTGATGTGGGGTGCTCGGTGGAC 8 Peptide 8 TGGAAGAGAATGGAGTTCA 9 Peptide 9 GTGGAGAGG 10 Peptide 10 TGTGAGGCTGGT 11 Peptide 11 GTGAAGT 12 Peptide 12 GAGAGAGAT 13 Peptide 13 GGAAGTAAAAAAGGGGGAG 14 Peptide 14 TGTTTGGCTG 15 Peptide 15 TACGGAGAGAAAAGAGTGC 16 Peptide 16 GAGGTGGATGGA 17 Peptide 17 GGAAATTGAG 18 Peptide 18 TTGTTGTGTTCCT 19 Peptide 19 TTGCTGGTGGTGC 20 Peptide 20 GTACTT 21 Peptide 21 GTGGAGAAAAAGATGGGACAGGTGC 22 Peptide 22 TGGGGGTGGGGGGAGGCTGGGGC 23 Peptide 23 TTGTGGGAAGG 24 Peptide 24 TGGAGTT 25 Peptide 25 AGTTCAAGAAGTGAAAGGAT 26 Peptide 25 TTAAGAGTGGGGTGGACGTC 27 Peptide 27 TGGTGGGGGATTGGCTTGAAAAA 28 Peptide 28 ATGATGGGAAAAAGAGAAAAGAAACAAGGGGAATTTGGAAAGGCCAAGGGC 29 Peptide 29 ACGAGGTGGTGTTGAAGGGCTGGGATTACA 30 Peptide 30 TGGAAAGGGAGAATGGATG Table 2. Antigenicity, Allergenicity, Toxicity, dan Mutation Position of Candidate Types of Peptides B-Cell Epitope Zika Virus Vaccine Design Using “Zika Virus Isolate Zika Virus/H. sapiens-tc/THA/2006/CVD_06-020, Complete Genome”. No. Code Antigenicity Allergenicity Toxicity Mutation Position 1 Peptide 1 Antigenic Non-Allergenic Non-Toxic No Mutation 2 Peptide 2 Antigenic Non-Allergenic Non-Toxic No Mutaion 3 Peptide 3 Antigenic Non-Allergenic Non-Toxic No Mutation 4 Peptide 4 Antigenic Non-Allergenic Non-Toxic No Mutation 5 Peptide 5 Antigenic Non-Allergenic Non-Toxic No Mutation 6 Peptide 6 Antigenic Non-Allergenic Non-Toxic No Mutation 7 Peptide 7 Antigenic Non-Allergenic Non-Toxic No Mutation 8 Peptide 8 Antigenic Non-Allergenic Non-Toxic No Mutation 9 Peptide 9 Antigenic Non-Allergenic Non-Toxic No Mutation 10 Peptide 10 Antigenic Non-Allergenic Non-Toxic No Mutation 11 Peptide 11 Antigenic Non-Allergenic Non-Toxic No Mutation 12 Peptide 12 Antigenic Non-Allergenic Non-Toxic No Mutation 13 Peptide 13 Antigenic Non-Allergenic Non-Toxic No Mutation 528 Biology, Medicine, & Natural Product Chemistry 12 (2), 2023: 525-531 Table 2. Cont. No. Code Antigenicity Allergenicity Toxicity Mutation Position 14 Peptide 14 Antigenic Non-Allergenic Non-Toxic No Mutation 15 Peptide 15 Antigenic Non-Allergenic Non-Toxic No Mutation 16 Peptide 16 Antigenic Non-Allergenic Non-Toxic No Mutation 17 Peptide 17 Antigenic Non-Allergenic Non-Toxic No Mutation 18 Peptide 18 Antigenic Non-Allergenic Non-Toxic No Mutation 19 Peptide 19 Antigenic Non-Allergenic Non-Toxic No Mutation 20 Peptide 20 Antigenic Non-Allergenic Non-Toxic No Mutation 21 Peptide 21 Antigenic Non-Allergenic Non-Toxic No Mutation 22 Peptide 22 Antigenic Non-Allergenic Non-Toxic No Mutation 23 Peptide 23 Antigenic Non-Allergenic Non-Toxic No Mutation 24 Peptide 24 Antigenic Non-Allergenic Non-Toxic No Mutation 25 Peptide 25 Antigenic Non-Allergenic Non-Toxic No Mutation 26 Peptide 25 Antigenic Non-Allergenic Non-Toxic No Mutation 27 Peptide 27 Antigenic Non-Allergenic Non-Toxic No Mutation 28 Peptide 28 Antigenic Non-Allergenic Non-Toxic No Mutation 29 Peptide 29 Antigenic Non-Allergenic Non-Toxic No Mutation 30 Peptide 30 Antigenic Non-Allergenic Non-Toxic No Mutation Table 3. SVM Soce, Hydrophobicity, Hydropathicity, Hydrophilicity, Charge, and Molecule Weight of Candidate Types of Peptides B-Cell Epitope Zika Virus Vaccine Design Using “Zika Virus Isolate Zika Virus/H. sapiens-tc/THA/2006/CVD_06-020, Complete Genome”. No. Code SVM Score Hydrophobicity Hydropathicity Hydrophilicity Charge Mol wt 1 Peptide 1 -0,84 -0,03 0,22 -0,45 0 1188,46 2 Peptide 2 -1,14 0,13 0,63 -0,33 0 3668,55 3 Peptide 3 -0,82 0,12 0,28 -0,25 0 1350,66 4 Peptide 4 -0,75 0,01 0,01 -0,33 0 1244,53 5 Peptide 5 -0,85 -0,02 -0,26 -0,3 0 607,71 6 Peptide 6 -0,67 -0,04 -0,18 -0,23 0 1008,2 7 Peptide 7 -0,78 0,06 0,19 -0,31 0 1864,34 8 Peptide 8 -0,75 0,12 0,5 -0,32 0 1422,75 9 Peptide 9 -0,73 0,14 0,06 -0,16 0 603,72 10 Peptide 10 -0,81 0,04 -0,08 -0,26 0 939,14 11 Peptide 11 -0,71 0,09 0,14 -0,26 0 533,63 12 Peptide 12 -0,71 0,16 0,54 -0,27 0 631,76 13 Peptide 13 -1,04 0,18 0,63 -0,26 0 1272,56 14 Peptide 14 -0,81 -0,02 -0,26 -0,3 0 855,03 15 Peptide 15 -0,81 0,15 0,8 -0,36 0 1394,75 16 Peptide 16 -0,74 0,13 0,1 -0,19 0 833 17 Peptide 17 -0,93 0,13 0,42 -0,28 0 732,88 18 Peptide 18 -0,44 -0,07 -0,14 -0,4 0 1204,47 19 Peptide 19 -0,81 0,01 -0,07 -0,31 0 1072,32 20 Peptide 20 -0,8 -0,01 0,3 -0,45 0 552,67 21 Peptide 21 -0,92 0,14 0,59 -0,31 0 1795,24 22 Peptide 22 -0,71 0,11 -0,09 -0,16 0 1568,94 23 Peptide 23 -0,73 0,08 -0,08 -0,2 0 805,96 24 Peptide 24 -0,68 0,03 -0,21 -0,24 0 563,66 25 Peptide 25 -0,84 0,13 0,68 -0,36 0 1507,86 26 Peptide 25 -0,81 0,08 0,26 -0,3 0 1527,89 27 Peptide 27 -0,78 0,09 0,22 -0,28 0 1725,11 28 Peptide 28 -0,93 0,16 0,8 -0,34 0 3566,47 29 Peptide 29 -0,68 0,09 0,33 -0,31 0 2274,83 30 Peptide 30 -0,91 0,14 0,36 -0,25 0 1332,62 Discussion According to Vita, et al. (2015), the Immune Epitope Database (IEDB) website hosts epitope-specific experimental assays which mean each assay reflects antibody to the antigen or epitope being tested experimentally. Structures entered as restricted epitopes Savitri et al. – In Silico B-Cell Epitope Design of Zika Virus Vaccine 529 are those that were tested in the test or were deduced as epitopes by multiple sources. In most cases, these amino acid residue sequences are more epitopecontaining regions. This means that the possible epitope can also not be limited only to a predetermined part. Epitope structures can be peptidic and non-peptidic. A peptidic epitope structure consists of linear and discontinuous amino acid sequences based on their position in the source protein. The peptidic epitope having 3D structural data is described in the presence of the residues found to be related to antibodies. Based on the tests that have been carried out, there are 30 peptide sequences predicted to have high antigenicity values. The high value of antigenicity in a peptide sequence is a marker of ideal properties possessed by vaccines. The higher the antigenicity value, the better its ability to stimulate B cells to form specific antibodies. Allergenicity test is a step carried out to test the selected vaccine candidate whether the peptide sequence to be used can cause allergies to the body or not. The ability not to create allergies for the body is also one of the ideal properties for a vaccine product. A high value of antigenicity is one of the ideal characteristics that all vaccines should have. Allergy is the ability possessed by material to cause allergies. Non-allergen is an ideal trait that anti-viral vaccines should have. Antigenicity is the ability of an antigen to stimulate the formation of specific antibodies by B cells in the body (Rezaldi, et al., 2021). Based on the tests that have been carried out, the 30 peptide sequences are predicted to be non-toxic to the human body. Toxicity testing at the vaccine prediction stage is important to obtain a peptide that is not toxic when administered into the human body. Only peptides with negative toxicity values can be selected for further use. In addition, this test also found the value of hydrophilicity. The higher the hydrophilicity value, the more certain the antigenic potential will be. his is following the statement of Sanchez-Trincado, et al. (2017) which states that by calculating the hydrophilicity of residues for the prediction of B cell epitope, it can be seen their antigenic potential. This is based on the assumption that the hydrophilic part is mainly located on the surface of the protein which will be directly accessible to the target antibody site. CONCLUSIONS There are 30 peptide sequences predicted to be a candidate of peptides B-cell epitope zika virus vaccine design using “zika virus isolate zika virus/H. sapiens- tc/THA/2006/CVD_06-020, complete genome”. This research can be continued with the immunoinformatics method for 3D visualization in order to know how compatible the peptide and epitope sequences are to be used as Zika virus vaccine candidates. Acknowledgements: Acknowledgments are expressed in a brief; all sources of institutional, private and corporate financial support for the work must be fully acknowledged, and any potential conflicts of interest are noted.The author would like to thank the Institute for Research, Development, and Community Service (LP3M) of Kadiri University which has always provided support for writing and publications. Authors’ Contributions: Lisa Savitri designed the study. Lisa Savitri, Syntia Tanu Juwita, Ester Lianawati Antoro, Ida Septika Wulansari, and Datin An Nisa Sukmawati analyzed the data. João Gregório Freitas and Andre Mario Sequeira Alves Ornai wrote the manuscript. All authors read and approved the final version of the article. Competing Interests: The authors declare that there are no competing interests. Funding: The authors declare funding if any. REFERENCES Alves-Leon, S.V.; Lima, M.D.R.; Nunes, P.C.G.; Chimelli, L.M.C.; Rabelo, K.; Nogueira, R.M.R.; de Bruycker-Nogueira, F.; de Azeredo, E.L.; Bahia, P.R.; Rueda Lopes, F.C.; et al. (2019). Zika virus found in brain tissue of a multiple sclerosis patient undergoing an acute disseminated encephalomyelitis- like episode. Mult. Scler. (Houndmills Basingstoke Engl.), 2019, 25, 427–430. Azevedo, R.S.; Araujo, M.T.; Martins Filho, A.J.; Oliveira, C.S.; Nunes, B.T.; Cruz, A.C.; Nascimento, A.G.; Medeiros, R.C.; Caldas, C.A.; Araujo, F.C.; et al. (2016). Zika virus epidemic in brazil. I. Fatal disease in adults: Clinical and laboratorial aspects. J. Clin. Virol. 2016, 85, 56–64. Baud, D.; Gubler, D.J.; Schaub, B.; Lanteri, M.C.; Musso. (2017). D. An update on Zika virus infection Lancet 2017, 390, 2099– 2109. Barbi, L.; Coelho, A.V.C.; Alencar, L.C.A.; Crovella, S. (2018). Prevalence of guillain-barré syndrome among Zika virus infected cases: A systematic review and meta-analysis. Braz. J. Infect. Dis. 2018, 22, 137–141. Bido-Medina, R.; Wirsich, J.; Rodríguez, M.; Oviedo, J.; Miches, I.; Bido, P.; Tusen, L.; Stoeter, P.; Sadaghiani, S. (2018). Impact of Zika virus on adult human brain structure and functional organization. Ann. Clin. Transl. Neurol. 2018, 5, 752–762. Boyer, S.; Calvez, E.; Chouin-Carneiro, T.; Diallo, D.; Failloux, A.B. (2018). An overview of mosquito vectors of Zika virus. Microbes Infect. 2018, 20, 646-660. Brasil, P.; Pereira, J.P., Jr.; Moreira, M.E.; Ribeiro Nogueira, R.M.; Damasceno, L.; Wakimoto, M.; Rabello, R.S.; Valderramos, S.G.; Halai, U.A.; Salles, T.S.; et al. (2016). Zika virus infection in pregnant women in rio de janeiro. N. Engl. J. Med.2016, 375, 2321–2334. Brès, P. (1970). Recent data from serological surveys on the prevalence of arbovirus infections in africa, with special reference to yellow fever. Bull. World Health Organ. 1970, 43, 223–267. 530 Biology, Medicine, & Natural Product Chemistry 12 (2), 2023: 525-531 Brito Ferreira, M.L.; Antunes de Brito, C.A.; Moreira, Á.J.P.; de Morais Machado,M.; Henriques Souza, A.; Cordeiro, M.T.; de Azevedo Marques, E.T.; Pena, L.J. (2017). Guillain-barré syndrome, acute disseminated encephalomyelitis and encephalitis associated with Zika virus infection in brazil: Detection of viral rna and isolation of virus during late infection. Am. J. Trop. Med. Hyg. 2017, 97, 1405–1409. Carteaux, G.; Maquart, M.; Bedet, A.; Contou, D.; Brugières, P.; Fourati, S.; Cleret de Langavant, L.; de Broucker, T.; Brun- Buisson, C.; Leparc-Goffart, I.; et al. (2016). Zika virus associated with meningoencephalitis. N. Engl. J. Med. 2016, 374, 1595–1596. Collins, N.D.; Widen, S.G.; Li, L.; Swetnam, D.M.; Shi, P.Y.; Tesh, R.B.; Sarathy, V.V. (2019). Inter-and intra-lineage genetic diversity of wild-type Zika viruses reveals both common and distinctive nucleotide variants and clusters of genomic diversity. Emerg. Microbes Infect. 2019, 8, 1126– 1138. Da Silva, I.R.F.; Frontera, J.A.; Bispo de Filippis, A.M.; Nascimento, O. (2017). Neurologic complications associated with the Zika virus in brazilian adults. JAMA Neurol. 2017, 74, 1190–1198. Dick, G.W.; Kitchen, S.F.; Haddow, A.J. (1952). Zika virus. I. Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. Dudley, D.M.; Van Rompay, K.K.; Coffey, L.L.; Ardeshir, A.; Keesler, R.I.; Bliss-Moreau, E.; Grigsby, P.L.; Steinbach, R.J.; Hirsch, A.J.; MacAllister, R.P.; et al. (2018). Miscarriage and stillbirth following maternal Zika virus infection in nonhuman primates. Nat. Med. 2018, 24, 1104–1107. Duffy, M.R.; Chen, T.H.; Hancock, W.T.; Powers, A.M.; Kool, J.L.; Lanciotti, R.S.; Pretrick, M.; Marfel, M.; Holzbauer, S.; Dubray, C.; et al. (2009). Zika virus outbreak on yap island, federated states of micronesia. N. Engl. J. Med. 2009, 360, 2536–2543. Driggers, R.W.; Ho, C.Y.; Korhonen, E.M.; Kuivanen, S.; Jääskeläinen, A.J.; Smura, T.; Rosenberg, A.; Hill, D.A.; DeBiasi, R.L.; Vezina, G.; et al. (2016). Zika virus infection with prolonged maternal viremia and fetal brain abnormalities. N. Engl. J. Med. 2016, 374, 2142–2151. Eligio-García, L.; Crisóstomo-Vázquez, M.D.P.; Caballero-García, M.L.; Soria-Guerrero, M.; Méndez-Galván, J.F.; López- Cancino, S.A.; Jiménez-Cardoso, E. (2019). Co-infection of dengue, Zika and chikungunya in a group of pregnant women from tuxtla gutiérrez, chiapas: Preliminary data. 2019. PLoS Negl. Trop. Dis. 2020, 14, e0008880. Enfissi, A.; Codrington, J.; Roosblad, J.; Kazanji, M.; Rousset, D. (2016). Zika virus genome from the americas. Lancet 2016, 387, 227–228. Gatherer, D.; Kohl, A. (2016). Zika virus: A previously slow pandemic spreads rapidly through the americas. J. Gen. Virol. 2016, 97, 269–273. Gubler, D.J. (2011). Dengue, urbanization and globalization: The unholy trinity of the 21(st) century. Trop. Med. Health 2011, 39, 3–11. Haddow, A.D.; Woodall, J.P. (2016). Distinguishing between Zika and spondweni viruses. Bull. World Health Organ. 2016, 94, 711. Heinz, F.X.; Stiasny, K. (2017). The antigenic structure of Zika virus and its relation to other flaviviruses: Implications for infection and immunoprophylaxis. Microbiol. Mol. Biol. Rev. Mmbr 2017, 81, e00055-16. Imperato, P.J. (2016). The convergence of a virus, mosquitoes, and human travel in globalizing the Zika epidemic. J. Community Health. 2016, 41, 674–679. Koenig, K.L.; Majestic, C.; Burns, M.J. (2014). Ebola virus disease: Essential public health principles for clinicians. West. J. Emerg. Med. 2014, 15, 728–731. Kuno, G.; Chang, G.J. (2007). Full-length sequencing and genomic characterization of bagaza, kedougou, and Zika viruses. Arch. Virol. 2007, 152, 687–696. Kleber de Oliveira, W.; Cortez-Escalante, J.; De Oliveira, W.T.; do Carmo, G.M.; Henriques, C.M.; Coelho, G.E.; Araújo de França, G.V. (2016). Increase in reported prevalence of microcephaly in infants born to women living in areas with confirmed Zika virus transmission during the first trimester of pregnancy—Brazil, 2015. MMWR Morb. Mortal. Wkly. Rep. 2016, 65, 242-247. Lanciotti, R.S.; Lambert, A.J.; Holodniy, M.; Saavedra, S.; Signor Ldel, C. (2016). Phylogeny of Zika virus in western hemisphere, 2015. Emerg. Infect. Dis. 2016, 22, 933–935. Leisher, S.H.; Balalian, A.A.; Reinebrant, H.; Shiau, S.; Flenady, V.; Kuhn, L.; Morse, S.S. (2020). Systematic review: Fetal death reporting and risk in Zika-affected pregnancies. Trop. Med. Int. Health 2020, 26, 133–145. Lin, H.H.; Yip, B.S.; Huang, L.M.; Wu, S.C. (2018). Zika virus structural biology and progress in vaccine development. Biotechnol. Adv. 2018, 36, 47–53. Macnamara, F.N. (1954). Zika virus: A report on three cases of human infection during an epidemic of jaundice in nigeria. Trans. R. Soc. Trop. Med. Hyg. 1954, 48, 139-145. Martines, R.B.; Bhatnagar, J.; Keating, M.K.; Silva-Flannery, L.; Muehlenbachs, A.; Gary, J. Goldsmith, C.; Hale, G.; Ritter, J.; Rollin, D.; et al. (2016). Notes from the field: Evidence of Zika virus infection in brain and placental tissues from two congenitally infected newborns and two fetal losses Brazil, 2015. MMWR Morb. Mortal. Wkly. Rep. 2016, 65, 159–160. Mayer, S.V.; Tesh, R.B.; Vasilakis, N. (2017). The emergence of arthropod-borne viral diseases: A global prospective on dengue, chikungunya and Zika fevers. Acta Trop. 2017, 166, 155 163. McCoy, C.E.; Lotfipour, S.; Chakravarthy, B.; Schultz, C.; Barton, E. (2014). Emergency medical services public health implications and interim guidance for the ebola virus in the united states. West. J. Emerg. Med. 2014, 15, 723–727. Mécharles, S.; Herrmann, C.; Poullain, P.; Tran, T.H.; Deschamps, N.; Mathon, G.; Landais, A.; Breurec, S.; Lannuzel, A. (2016). Acute myelitis due to Zika virus infection. Lancet 2016, 387, 1481. Muñoz, L.S.; Barreras, P.; Pardo, C.A. (2016). Zika virus- associated neurological disease in the adult: Guillain-barré syndrome, encephalitis, and myelitis. Semin. Reprod. Med. 2016, 34, 273-279. Musso, D. (2015). Zika virus transmission from french polynesia to brazil. Emerg. Infect. Dis. 2015, 21, 1887. Nicastri, E.; Castilletti, C.; Balestra, P.; Galgani, S.; Ippolito, G. (2016). Zika virus infection in the central nervous system and female genital tract. Emerg. Infect. Dis. 2016, 22, 2228–2230. Olson, J.G.; Ksiazek, T.G.; (1981). Suhandiman; Triwibowo. Zika virus, a cause of fever in central java, indonesia. Trans. R. Soc. Trop. Med. Hyg. 1981, 75, 389–393. Parra, B.; Lizarazo, J.; Jiménez-Arango, J.A.; Zea-Vera, A.F.; González-Manrique, G.; Vargas, J.; Angarita, J.A.; Zuñiga, G.; Lopez-Gonzalez, R.; Beltran, C.L.; et al. (2016). Guillain-barré Savitri et al. – In Silico B-Cell Epitope Design of Zika Virus Vaccine 531 syndrome associated with Zika virus infection in colombia. N. Engl. J. Med. 2016, 375, 1513-1523. Pierson, T.C.; Diamond, M.S. (2018). The emergence of Zika virus and its new clinical syndromes. Nature 2018, 560, 573– 581. Rathore, A.P.S.; St John, A.L. (2020). Cross-reactive immunity among flaviviruses. Front. Immunol. 2020, 11, 334. Rezaldi, F., Taupiqurrohman O, Fadillah MF,Rochmat A, Humaedi A, Fadhilah F. (2021). Identifikasi Kandidat Vaksin COVID-19 BerbasisPeptida dari Glikoprotein Spike SARS CoV-2 untuk Ras Asia secara In Silico. Jurnal Biotek Mediasiana Indonesia 10 (1): 77-85. https://doi.org/10.22435/jbmi.v10i1.5031. Rossati, A. (2017). Global warming and its health impact. Int. J. Occup. Environ. Med. 2017, 8, 7–20. Safari, S.; Baratloo, A.; Rouhipour, A.; Ghelichkhani, P.; Yousefifard, M. (2015). Ebola hemorrhagic fever as a public health emergency of international concern: A review article. Emergency (Tehran Iran) 2015, 3, 3–7. Savitri, L. (2021). Panduan Ringkas Desain Vaksin Berbasis Bioinformatika. Malang: Global Science. Schwartzmann, P.V.; Ramalho, L.N.; Neder, L.; Vilar, F.C.; Ayub- Ferreira, S.M.; Romeiro, M.F.; Takayanagui, O.M.; Dos Santos, A.C.; Schmidt, A.; Figueiredo, L.T.; et al. (2017). Zika virus meningoencephalitis in an immunocompromised patient. Mayo Clin. Proc. 2017, 92, 460-466. Shan, C.; Xie, X.; Shi, P.Y. (2018). Zika virus vaccine: Progress and challenges. Cell Host Microbe 2018, 24, 12–17. Soares, C.N.; Brasil, P.; Carrera, R.M.; Sequeira, P.; de Filippis, A.B.; Borges, V.A.; Theophilo, F.; Ellul, M.A.; Solomon, T. (2016). Fatal encephalitis associated with Zika virus infection in an adult. J. Clin. Virol. 2016, 83, 63–65. Terzian, A.C.B.; Schanoski, A.S.; Mota, M.T.O.; da Silva, R.A.; Estofolete, C.F.; Colombo, T.E.; Rahal, P.; Hanley, K.A.; Vasilakis, N.; Kalil, J.; et al. (2017). Viral load and cytokine response profile does not support antibody-dependent enhancement in dengue-primed Zika virus infected patients. Clin. Infect. Dis. 2017, 65, 1260–1265. Vita, R., Overton JA, Greenbaum JA, Ponomarenko J, Clark JD, Cantrell JR, et al. (2015). The Immune Epitope Database (IEDB) 3.0. Nucleic Acids Res. 43: 405-412. https://doi.org/10.1093/nar/gku938. WHO. (2017). WHO Situation Report. Zika Virus Microcephaly Guillain-Barré Syndrome. 2017. THIS PAGE INTENTIONALLY LEFT BLANK