id	sid	tid	token	lemma	pos
brj-23306	1	1	peer	peer	NOUN
brj-23306	1	2	-	-	PUNCT
brj-23306	1	3	review	review	NOUN
brj-23306	1	4	article	article	NOUN
brj-23306	1	5	peer	peer	NOUN
brj-23306	1	6	-	-	PUNCT
brj-23306	1	7	reviewed	review	VERB
brj-23306	1	8	article	article	NOUN
brj-23306	1	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	1	10	raju	raju	PROPN
brj-23306	1	11	et	et	PROPN
brj-23306	1	12	al	al	PROPN
brj-23306	1	13	.	.	PROPN
brj-23306	2	1	(	(	PUNCT
brj-23306	2	2	2024	2024	NUM
brj-23306	2	3	)	)	PUNCT
brj-23306	2	4	.	.	PUNCT
brj-23306	3	1	“	"	PUNCT
brj-23306	3	2	ag	ag	PROPN
brj-23306	3	3	nanoparticles	nanoparticle	NOUN
brj-23306	3	4	from	from	ADP
brj-23306	3	5	leaves	leave	NOUN
brj-23306	3	6	,	,	PUNCT
brj-23306	3	7	”	"	PUNCT
brj-23306	3	8	bioresources	bioresource	NOUN
brj-23306	3	9	19(2	19(2	NUM
brj-23306	3	10	)	)	PUNCT
brj-23306	3	11	,	,	PUNCT
brj-23306	3	12	3328	3328	NUM
brj-23306	3	13	-	-	SYM
brj-23306	3	14	3352	3352	NUM
brj-23306	3	15	.	.	PUNCT
brj-23306	3	16	3328	3328	NUM
brj-23306	3	17	deciphering	decipher	VERB
brj-23306	3	18	the	the	DET
brj-23306	3	19	therapeutic	therapeutic	ADJ
brj-23306	3	20	,	,	PUNCT
brj-23306	3	21	larvicidal	larvicidal	NOUN
brj-23306	3	22	,	,	PUNCT
brj-23306	3	23	and	and	CCONJ
brj-23306	3	24	chemical	chemical	ADJ
brj-23306	3	25	pollutant	pollutant	ADJ
brj-23306	3	26	degrading	degrade	VERB
brj-23306	3	27	properties	property	NOUN
brj-23306	3	28	of	of	ADP
brj-23306	3	29	leaves	leave	NOUN
brj-23306	3	30	-	-	PUNCT
brj-23306	3	31	mediated	mediate	VERB
brj-23306	3	32	silver	silver	NOUN
brj-23306	3	33	nanoparticles	nanoparticle	NOUN
brj-23306	3	34	obtained	obtain	VERB
brj-23306	3	35	from	from	ADP
brj-23306	3	36	alpinia	alpinia	PROPN
brj-23306	3	37	purpurata	purpurata	PROPN
brj-23306	3	38	manikandan	manikandan	PROPN
brj-23306	3	39	vani	vani	PROPN
brj-23306	3	40	raju	raju	PROPN
brj-23306	3	41	,	,	PUNCT
brj-23306	3	42	a	a	DET
brj-23306	3	43	meenakshi	meenakshi	NOUN
brj-23306	3	44	kaniyur	kaniyur	NOUN
brj-23306	3	45	chandrasekaran	chandrasekaran	VERB
brj-23306	3	46	,	,	PUNCT
brj-23306	3	47	a	a	DET
brj-23306	3	48	meenakshi	meenakshi	PROPN
brj-23306	3	49	sundari	sundari	PROPN
brj-23306	3	50	rajendran	rajendran	PROPN
brj-23306	3	51	,	,	PUNCT
brj-23306	3	52	a	a	DET
brj-23306	3	53	gopalakrishnan	gopalakrishnan	NOUN
brj-23306	3	54	velliyur	velliyur	ADJ
brj-23306	3	55	kanniappan	kanniappan	NOUN
brj-23306	3	56	,	,	PUNCT
brj-23306	3	57	b	b	PROPN
brj-23306	3	58	rathi	rathi	PROPN
brj-23306	3	59	muthaiyan	muthaiyan	PROPN
brj-23306	3	60	ahalliya	ahalliya	PROPN
brj-23306	3	61	,	,	PUNCT
brj-23306	3	62	a	a	DET
brj-23306	3	63	,	,	PUNCT
brj-23306	3	64	*	*	PROPN
brj-23306	3	65	guru	guru	NOUN
brj-23306	3	66	kumar	kumar	PROPN
brj-23306	3	67	dugganaboyana	dugganaboyana	PROPN
brj-23306	3	68	,	,	PUNCT
brj-23306	3	69	c	c	PROPN
brj-23306	3	70	mikhlid	mikhlid	PROPN
brj-23306	3	71	h.	h.	PROPN
brj-23306	3	72	almutairi	almutairi	PROPN
brj-23306	3	73	,	,	PUNCT
brj-23306	3	74	d	d	PROPN
brj-23306	3	75	bader	bader	PROPN
brj-23306	3	76	o.	o.	PROPN
brj-23306	3	77	almutairi	almutairi	PROPN
brj-23306	3	78	,	,	PUNCT
brj-23306	3	79	d	d	PROPN
brj-23306	3	80	ameer	ameer	PROPN
brj-23306	3	81	khusro	khusro	PROPN
brj-23306	3	82	,	,	PUNCT
brj-23306	3	83	e	e	NOUN
brj-23306	3	84	and	and	CCONJ
brj-23306	3	85	ponnuswamy	ponnuswamy	NOUN
brj-23306	3	86	vijayaraghavan	vijayaraghavan	NOUN
brj-23306	3	87	f	f	PROPN
brj-23306	3	88	the	the	DET
brj-23306	3	89	aim	aim	NOUN
brj-23306	3	90	of	of	ADP
brj-23306	3	91	the	the	DET
brj-23306	3	92	study	study	NOUN
brj-23306	3	93	was	be	AUX
brj-23306	3	94	to	to	PART
brj-23306	3	95	synthesize	synthesize	VERB
brj-23306	3	96	silver	silver	ADJ
brj-23306	3	97	nanoparticles	nanoparticle	NOUN
brj-23306	3	98	(	(	PUNCT
brj-23306	3	99	agnps	agnps	ADJ
brj-23306	3	100	)	)	PUNCT
brj-23306	3	101	from	from	ADP
brj-23306	3	102	alpinia	alpinia	PROPN
brj-23306	3	103	purpurata	purpurata	PROPN
brj-23306	3	104	leaves	leave	NOUN
brj-23306	3	105	and	and	CCONJ
brj-23306	3	106	evaluate	evaluate	VERB
brj-23306	3	107	their	their	PRON
brj-23306	3	108	cytotoxic	cytotoxic	ADJ
brj-23306	3	109	,	,	PUNCT
brj-23306	3	110	antimicrobial	antimicrobial	ADJ
brj-23306	3	111	,	,	PUNCT
brj-23306	3	112	antibiofilm	antibiofilm	NOUN
brj-23306	3	113	,	,	PUNCT
brj-23306	3	114	dye	dye	NOUN
brj-23306	3	115	degradation	degradation	NOUN
brj-23306	3	116	,	,	PUNCT
brj-23306	3	117	and	and	CCONJ
brj-23306	3	118	larvicidal	larvicidal	NOUN
brj-23306	3	119	potentials	potential	NOUN
brj-23306	3	120	.	.	PUNCT
brj-23306	4	1	the	the	DET
brj-23306	4	2	synthesized	synthesize	VERB
brj-23306	4	3	agnps	agnps	NOUN
brj-23306	4	4	were	be	AUX
brj-23306	4	5	characterized	characterize	VERB
brj-23306	4	6	using	use	VERB
brj-23306	4	7	ultraviolet	ultraviolet	NOUN
brj-23306	4	8	-	-	PUNCT
brj-23306	4	9	visible	visible	ADJ
brj-23306	4	10	spectroscopy	spectroscopy	NOUN
brj-23306	4	11	,	,	PUNCT
brj-23306	4	12	fourier	fourier	NOUN
brj-23306	4	13	transform	transform	NOUN
brj-23306	4	14	infrared	infrared	ADJ
brj-23306	4	15	,	,	PUNCT
brj-23306	4	16	and	and	CCONJ
brj-23306	4	17	high	high	ADJ
brj-23306	4	18	-	-	PUNCT
brj-23306	4	19	resolution	resolution	NOUN
brj-23306	4	20	transmission	transmission	NOUN
brj-23306	4	21	electron	electron	NOUN
brj-23306	4	22	microscopy	microscopy	NOUN
brj-23306	4	23	,	,	PUNCT
brj-23306	4	24	which	which	PRON
brj-23306	4	25	confirmed	confirm	VERB
brj-23306	4	26	agnps	agnps	ADJ
brj-23306	4	27	synthesis	synthesis	NOUN
brj-23306	4	28	and	and	CCONJ
brj-23306	4	29	revealed	reveal	VERB
brj-23306	4	30	nanoparticle	nanoparticle	NOUN
brj-23306	4	31	size	size	NOUN
brj-23306	4	32	(	(	PUNCT
brj-23306	4	33	10	10	NUM
brj-23306	4	34	to	to	PART
brj-23306	4	35	30	30	NUM
brj-23306	4	36	nm	nm	NOUN
brj-23306	4	37	)	)	PUNCT
brj-23306	4	38	and	and	CCONJ
brj-23306	4	39	the	the	DET
brj-23306	4	40	presence	presence	NOUN
brj-23306	4	41	of	of	ADP
brj-23306	4	42	silver	silver	NOUN
brj-23306	4	43	.	.	PUNCT
brj-23306	5	1	cytotoxicity	cytotoxicity	NOUN
brj-23306	5	2	tests	test	NOUN
brj-23306	5	3	showed	show	VERB
brj-23306	5	4	ic50	ic50	PROPN
brj-23306	5	5	values	value	NOUN
brj-23306	5	6	of	of	ADP
brj-23306	5	7	4.59	4.59	NUM
brj-23306	5	8	±	±	NUM
brj-23306	5	9	0.6	0.6	NUM
brj-23306	5	10	µg	µg	NOUN
brj-23306	5	11	/	/	SYM
brj-23306	5	12	ml	ml	NOUN
brj-23306	5	13	in	in	ADP
brj-23306	5	14	a549	a549	PROPN
brj-23306	5	15	cells	cell	NOUN
brj-23306	5	16	and	and	CCONJ
brj-23306	5	17	3.48	3.48	NUM
brj-23306	5	18	±	±	NUM
brj-23306	5	19	0.4	0.4	NUM
brj-23306	5	20	µg	µg	NOUN
brj-23306	5	21	/	/	SYM
brj-23306	5	22	ml	ml	ADV
brj-23306	5	23	in	in	ADP
brj-23306	5	24	pa1	pa1	NOUN
brj-23306	5	25	cells	cell	NOUN
brj-23306	5	26	,	,	PUNCT
brj-23306	5	27	inducing	induce	VERB
brj-23306	5	28	apoptosis	apoptosis	NOUN
brj-23306	5	29	and	and	CCONJ
brj-23306	5	30	dna	dna	PROPN
brj-23306	5	31	fragmentation	fragmentation	NOUN
brj-23306	5	32	.	.	PUNCT
brj-23306	6	1	flow	flow	NOUN
brj-23306	6	2	cytometry	cytometry	PROPN
brj-23306	6	3	revealed	reveal	VERB
brj-23306	6	4	cell	cell	NOUN
brj-23306	6	5	cycle	cycle	NOUN
brj-23306	6	6	arrest	arrest	NOUN
brj-23306	6	7	at	at	ADP
brj-23306	6	8	g0	g0	ADJ
brj-23306	6	9	-	-	PUNCT
brj-23306	6	10	g1	g1	PROPN
brj-23306	6	11	phase	phase	NOUN
brj-23306	6	12	.	.	PUNCT
brj-23306	7	1	agnps	agnps	PROPN
brj-23306	7	2	exhibited	exhibit	VERB
brj-23306	7	3	significant	significant	ADJ
brj-23306	7	4	antimicrobial	antimicrobial	ADJ
brj-23306	7	5	activity	activity	NOUN
brj-23306	7	6	,	,	PUNCT
brj-23306	7	7	with	with	ADP
brj-23306	7	8	maximum	maximum	ADJ
brj-23306	7	9	inhibition	inhibition	NOUN
brj-23306	7	10	zones	zone	NOUN
brj-23306	7	11	against	against	ADP
brj-23306	7	12	k.	k.	PROPN
brj-23306	7	13	pneumoniae	pneumoniae	PROPN
brj-23306	7	14	(	(	PUNCT
brj-23306	7	15	23	23	NUM
brj-23306	7	16	±	±	NUM
brj-23306	7	17	2	2	NUM
brj-23306	7	18	mm	mm	NOUN
brj-23306	7	19	)	)	PUNCT
brj-23306	7	20	and	and	CCONJ
brj-23306	7	21	f.	f.	PROPN
brj-23306	7	22	oxysporum	oxysporum	PROPN
brj-23306	7	23	(	(	PUNCT
brj-23306	7	24	17	17	NUM
brj-23306	7	25	±	±	NUM
brj-23306	7	26	2	2	NUM
brj-23306	7	27	mm	mm	NOUN
brj-23306	7	28	)	)	PUNCT
brj-23306	7	29	,	,	PUNCT
brj-23306	7	30	and	and	CCONJ
brj-23306	7	31	minimum	minimum	ADJ
brj-23306	7	32	inhibitory	inhibitory	ADJ
brj-23306	7	33	concentration	concentration	NOUN
brj-23306	7	34	(	(	PUNCT
brj-23306	7	35	mic	mic	ADJ
brj-23306	7	36	)	)	PUNCT
brj-23306	7	37	values	value	NOUN
brj-23306	7	38	ranging	range	VERB
brj-23306	7	39	from	from	ADP
brj-23306	7	40	12.5	12.5	NUM
brj-23306	7	41	±	±	NUM
brj-23306	7	42	0.25	0.25	NUM
brj-23306	7	43	to	to	ADP
brj-23306	7	44	75	75	NUM
brj-23306	7	45	±	±	NUM
brj-23306	7	46	2.5	2.5	NUM
brj-23306	7	47	µg	µg	NOUN
brj-23306	7	48	/	/	SYM
brj-23306	7	49	ml	ml	NOUN
brj-23306	7	50	.	.	PUNCT
brj-23306	8	1	they	they	PRON
brj-23306	8	2	also	also	ADV
brj-23306	8	3	reduced	reduce	VERB
brj-23306	8	4	bacterial	bacterial	ADJ
brj-23306	8	5	and	and	CCONJ
brj-23306	8	6	fungal	fungal	ADJ
brj-23306	8	7	biomass	biomass	NOUN
brj-23306	8	8	and	and	CCONJ
brj-23306	8	9	showed	show	VERB
brj-23306	8	10	antibiofilm	antibiofilm	NOUN
brj-23306	8	11	effects	effect	NOUN
brj-23306	8	12	.	.	PUNCT
brj-23306	9	1	photocatalytic	photocatalytic	ADJ
brj-23306	9	2	activity	activity	NOUN
brj-23306	9	3	degraded	degrade	VERB
brj-23306	9	4	methylene	methylene	NOUN
brj-23306	9	5	blue	blue	ADJ
brj-23306	9	6	dye	dye	NOUN
brj-23306	9	7	by	by	ADP
brj-23306	9	8	88.4	88.4	NUM
brj-23306	9	9	±	±	NUM
brj-23306	9	10	1.4	1.4	NUM
brj-23306	9	11	%	%	NOUN
brj-23306	9	12	in	in	ADP
brj-23306	9	13	60	60	NUM
brj-23306	9	14	minutes	minute	NOUN
brj-23306	9	15	.	.	PUNCT
brj-23306	10	1	larvicidal	larvicidal	NOUN
brj-23306	10	2	activity	activity	NOUN
brj-23306	10	3	resulted	result	VERB
brj-23306	10	4	in	in	ADP
brj-23306	10	5	100	100	NUM
brj-23306	10	6	%	%	NOUN
brj-23306	10	7	mortality	mortality	NOUN
brj-23306	10	8	of	of	ADP
brj-23306	10	9	a.	a.	NOUN
brj-23306	10	10	aegypti	aegypti	NOUN
brj-23306	10	11	larvae	larvae	NOUN
brj-23306	10	12	after	after	ADP
brj-23306	10	13	48	48	NUM
brj-23306	10	14	hours	hour	NOUN
brj-23306	10	15	exposure	exposure	NOUN
brj-23306	10	16	to	to	ADP
brj-23306	10	17	agnps	agnps	PROPN
brj-23306	10	18	(	(	PUNCT
brj-23306	10	19	10	10	NUM
brj-23306	10	20	mg	mg	PROPN
brj-23306	10	21	/	/	SYM
brj-23306	10	22	l	l	NOUN
brj-23306	10	23	)	)	PUNCT
brj-23306	10	24	,	,	PUNCT
brj-23306	10	25	additionally	additionally	ADV
brj-23306	10	26	reducing	reduce	VERB
brj-23306	10	27	chemical	chemical	NOUN
brj-23306	10	28	oxygen	oxygen	NOUN
brj-23306	10	29	demand	demand	NOUN
brj-23306	10	30	(	(	PUNCT
brj-23306	10	31	55.1	55.1	NUM
brj-23306	10	32	±	±	NUM
brj-23306	10	33	2.1	2.1	NUM
brj-23306	10	34	%	%	NOUN
brj-23306	10	35	to	to	ADP
brj-23306	10	36	63.8	63.8	NUM
brj-23306	10	37	±	±	NUM
brj-23306	10	38	1.5	1.5	NUM
brj-23306	10	39	%	%	NOUN
brj-23306	10	40	)	)	PUNCT
brj-23306	10	41	and	and	CCONJ
brj-23306	10	42	microbial	microbial	ADJ
brj-23306	10	43	load	load	NOUN
brj-23306	10	44	in	in	ADP
brj-23306	10	45	wastewater	wastewater	NOUN
brj-23306	10	46	(	(	PUNCT
brj-23306	10	47	2.5	2.5	NUM
brj-23306	10	48	to	to	PART
brj-23306	10	49	10	10	NUM
brj-23306	10	50	ppm	ppm	NOUN
brj-23306	10	51	)	)	PUNCT
brj-23306	10	52	.	.	PUNCT
brj-23306	11	1	doi	doi	NOUN
brj-23306	11	2	:	:	PUNCT
brj-23306	11	3	10.15376	10.15376	NUM
brj-23306	11	4	/	/	SYM
brj-23306	11	5	biores.19.2.3328	biores.19.2.3328	PROPN
brj-23306	11	6	-	-	PUNCT
brj-23306	11	7	3352	3352	NUM
brj-23306	11	8	keywords	keyword	NOUN
brj-23306	11	9	:	:	PUNCT
brj-23306	11	10	alpinia	alpinia	PROPN
brj-23306	11	11	purpurata	purpurata	PROPN
brj-23306	11	12	;	;	PUNCT
brj-23306	11	13	agnps	agnps	ADJ
brj-23306	11	14	;	;	PUNCT
brj-23306	11	15	cytotoxicity	cytotoxicity	NOUN
brj-23306	11	16	;	;	PUNCT
brj-23306	11	17	antimicrobial	antimicrobial	ADJ
brj-23306	11	18	;	;	PUNCT
brj-23306	11	19	larvicidal	larvicidal	NOUN
brj-23306	11	20	;	;	PUNCT
brj-23306	11	21	photocatalytic	photocatalytic	ADJ
brj-23306	11	22	activity	activity	NOUN
brj-23306	11	23	contact	contact	NOUN
brj-23306	11	24	information	information	NOUN
brj-23306	11	25	:	:	PUNCT
brj-23306	11	26	a	a	DET
brj-23306	11	27	:	:	PUNCT
brj-23306	11	28	department	department	NOUN
brj-23306	11	29	of	of	ADP
brj-23306	11	30	biochemistry	biochemistry	NOUN
brj-23306	11	31	,	,	PUNCT
brj-23306	11	32	karpagam	karpagam	PROPN
brj-23306	11	33	academy	academy	PROPN
brj-23306	11	34	of	of	ADP
brj-23306	11	35	higher	high	ADJ
brj-23306	11	36	education	education	NOUN
brj-23306	11	37	,	,	PUNCT
brj-23306	11	38	coimbatore	coimbatore	PROPN
brj-23306	11	39	,	,	PUNCT
brj-23306	11	40	tamil	tamil	PROPN
brj-23306	11	41	nadu	nadu	PROPN
brj-23306	11	42	,	,	PUNCT
brj-23306	11	43	india	india	PROPN
brj-23306	11	44	;	;	PUNCT
brj-23306	11	45	b	b	X
brj-23306	11	46	:	:	PUNCT
brj-23306	11	47	centre	centre	NOUN
brj-23306	11	48	for	for	ADP
brj-23306	11	49	plant	plant	NOUN
brj-23306	11	50	tissue	tissue	NOUN
brj-23306	11	51	culture	culture	NOUN
brj-23306	11	52	and	and	CCONJ
brj-23306	11	53	central	central	ADJ
brj-23306	11	54	instrumentation	instrumentation	NOUN
brj-23306	11	55	facility	facility	NOUN
brj-23306	11	56	,	,	PUNCT
brj-23306	11	57	karpagam	karpagam	PROPN
brj-23306	11	58	academy	academy	PROPN
brj-23306	11	59	of	of	ADP
brj-23306	11	60	higher	high	ADJ
brj-23306	11	61	education	education	NOUN
brj-23306	11	62	,	,	PUNCT
brj-23306	11	63	coimbatore	coimbatore	PROPN
brj-23306	11	64	,	,	PUNCT
brj-23306	11	65	tamil	tamil	PROPN
brj-23306	11	66	nadu	nadu	PROPN
brj-23306	11	67	,	,	PUNCT
brj-23306	11	68	india	india	PROPN
brj-23306	11	69	;	;	PUNCT
brj-23306	11	70	c	c	X
brj-23306	11	71	:	:	PUNCT
brj-23306	11	72	division	division	NOUN
brj-23306	11	73	of	of	ADP
brj-23306	11	74	biochemistry	biochemistry	NOUN
brj-23306	11	75	,	,	PUNCT
brj-23306	11	76	school	school	NOUN
brj-23306	11	77	of	of	ADP
brj-23306	11	78	life	life	NOUN
brj-23306	11	79	sciences	sciences	PROPN
brj-23306	11	80	,	,	PUNCT
brj-23306	11	81	jss	jss	PROPN
brj-23306	11	82	academy	academy	PROPN
brj-23306	11	83	of	of	ADP
brj-23306	11	84	higher	high	ADJ
brj-23306	11	85	education	education	NOUN
brj-23306	11	86	and	and	CCONJ
brj-23306	11	87	research	research	NOUN
brj-23306	11	88	,	,	PUNCT
brj-23306	11	89	mysore	mysore	NOUN
brj-23306	11	90	,	,	PUNCT
brj-23306	11	91	karnataka	karnataka	PROPN
brj-23306	11	92	,	,	PUNCT
brj-23306	11	93	india	india	PROPN
brj-23306	11	94	;	;	PUNCT
brj-23306	11	95	d	d	X
brj-23306	11	96	:	:	PUNCT
brj-23306	11	97	department	department	NOUN
brj-23306	11	98	of	of	ADP
brj-23306	11	99	zoology	zoology	NOUN
brj-23306	11	100	,	,	PUNCT
brj-23306	11	101	college	college	NOUN
brj-23306	11	102	of	of	ADP
brj-23306	11	103	science	science	NOUN
brj-23306	11	104	,	,	PUNCT
brj-23306	11	105	king	king	PROPN
brj-23306	11	106	saud	saud	PROPN
brj-23306	11	107	university	university	PROPN
brj-23306	11	108	,	,	PUNCT
brj-23306	11	109	p.o	p.o	PROPN
brj-23306	11	110	.	.	PROPN
brj-23306	11	111	box	box	PROPN
brj-23306	11	112	2455	2455	NUM
brj-23306	11	113	,	,	PUNCT
brj-23306	11	114	riyadh	riyadh	PROPN
brj-23306	11	115	11451	11451	NUM
brj-23306	11	116	,	,	PUNCT
brj-23306	11	117	riyadh	riyadh	PROPN
brj-23306	11	118	,	,	PUNCT
brj-23306	11	119	saudi	saudi	PROPN
brj-23306	11	120	arabia	arabia	PROPN
brj-23306	11	121	;	;	PUNCT
brj-23306	11	122	e	e	X
brj-23306	11	123	:	:	PUNCT
brj-23306	11	124	department	department	NOUN
brj-23306	11	125	of	of	ADP
brj-23306	11	126	research	research	NOUN
brj-23306	11	127	analytics	analytic	NOUN
brj-23306	11	128	,	,	PUNCT
brj-23306	11	129	saveetha	saveetha	VERB
brj-23306	11	130	dental	dental	ADJ
brj-23306	11	131	college	college	NOUN
brj-23306	11	132	and	and	CCONJ
brj-23306	11	133	hospitals	hospital	NOUN
brj-23306	11	134	,	,	PUNCT
brj-23306	11	135	saveetha	saveetha	PROPN
brj-23306	11	136	institute	institute	PROPN
brj-23306	11	137	of	of	ADP
brj-23306	11	138	medical	medical	ADJ
brj-23306	11	139	and	and	CCONJ
brj-23306	11	140	technical	technical	ADJ
brj-23306	11	141	sciences	science	NOUN
brj-23306	11	142	,	,	PUNCT
brj-23306	11	143	saveetha	saveetha	PROPN
brj-23306	11	144	university	university	PROPN
brj-23306	11	145	,	,	PUNCT
brj-23306	11	146	chennai	chennai	PROPN
brj-23306	11	147	–	–	PUNCT
brj-23306	11	148	600077	600077	NUM
brj-23306	11	149	,	,	PUNCT
brj-23306	11	150	india	india	PROPN
brj-23306	11	151	;	;	PUNCT
brj-23306	11	152	f	f	X
brj-23306	11	153	:	:	PUNCT
brj-23306	11	154	bioprocess	bioprocess	NOUN
brj-23306	11	155	engineering	engineering	NOUN
brj-23306	11	156	division	division	NOUN
brj-23306	11	157	,	,	PUNCT
brj-23306	11	158	smykon	smykon	NOUN
brj-23306	11	159	biotech	biotech	NOUN
brj-23306	11	160	,	,	PUNCT
brj-23306	11	161	kanniyakumari	kanniyakumari	PROPN
brj-23306	11	162	,	,	PUNCT
brj-23306	11	163	india	india	PROPN
brj-23306	11	164	;	;	PUNCT
brj-23306	11	165	*	*	PUNCT
brj-23306	11	166	corresponding	correspond	VERB
brj-23306	11	167	author	author	NOUN
brj-23306	11	168	:	:	PUNCT
brj-23306	11	169	rathiajith@gmail.com	rathiajith@gmail.com	X
brj-23306	11	170	introduction	introduction	NOUN
brj-23306	11	171	at	at	ADP
brj-23306	11	172	present	present	ADJ
brj-23306	11	173	,	,	PUNCT
brj-23306	11	174	cancer	cancer	NOUN
brj-23306	11	175	stands	stand	VERB
brj-23306	11	176	as	as	ADP
brj-23306	11	177	one	one	NUM
brj-23306	11	178	of	of	ADP
brj-23306	11	179	the	the	DET
brj-23306	11	180	prominent	prominent	ADJ
brj-23306	11	181	causes	cause	NOUN
brj-23306	11	182	of	of	ADP
brj-23306	11	183	global	global	ADJ
brj-23306	11	184	mortality	mortality	NOUN
brj-23306	11	185	,	,	PUNCT
brj-23306	11	186	accounting	account	VERB
brj-23306	11	187	for	for	ADP
brj-23306	11	188	over	over	ADP
brj-23306	11	189	10	10	NUM
brj-23306	11	190	million	million	NUM
brj-23306	11	191	deaths	death	NOUN
brj-23306	11	192	annually	annually	ADV
brj-23306	11	193	.	.	PUNCT
brj-23306	12	1	among	among	ADP
brj-23306	12	2	diversified	diversified	ADJ
brj-23306	12	3	forms	form	NOUN
brj-23306	12	4	of	of	ADP
brj-23306	12	5	cancer	cancer	NOUN
brj-23306	12	6	,	,	PUNCT
brj-23306	12	7	lung	lung	NOUN
brj-23306	12	8	cancer	cancer	NOUN
brj-23306	12	9	is	be	AUX
brj-23306	12	10	one	one	NUM
brj-23306	12	11	of	of	ADP
brj-23306	12	12	the	the	DET
brj-23306	12	13	most	most	ADV
brj-23306	12	14	commonly	commonly	ADV
brj-23306	12	15	diagnosed	diagnose	VERB
brj-23306	12	16	forms	form	NOUN
brj-23306	12	17	of	of	ADP
brj-23306	12	18	cancer	cancer	NOUN
brj-23306	12	19	worldwide	worldwide	ADV
brj-23306	12	20	,	,	PUNCT
brj-23306	12	21	which	which	PRON
brj-23306	12	22	is	be	AUX
brj-23306	12	23	responsible	responsible	ADJ
brj-23306	12	24	for	for	ADP
brj-23306	12	25	the	the	DET
brj-23306	12	26	maximum	maximum	ADJ
brj-23306	12	27	number	number	NOUN
brj-23306	12	28	of	of	ADP
brj-23306	12	29	cancer	cancer	NOUN
brj-23306	12	30	-	-	PUNCT
brj-23306	12	31	linked	link	VERB
brj-23306	12	32	fatalities	fatality	NOUN
brj-23306	12	33	.	.	PUNCT
brj-23306	13	1	it	it	PRON
brj-23306	13	2	is	be	AUX
brj-23306	13	3	estimated	estimate	VERB
brj-23306	13	4	that	that	SCONJ
brj-23306	13	5	around	around	ADV
brj-23306	13	6	2	2	NUM
brj-23306	13	7	million	million	NUM
brj-23306	13	8	new	new	ADJ
brj-23306	13	9	cases	case	NOUN
brj-23306	13	10	arise	arise	VERB
brj-23306	13	11	each	each	DET
brj-23306	13	12	year	year	NOUN
brj-23306	13	13	,	,	PUNCT
brj-23306	13	14	resulting	result	VERB
brj-23306	13	15	in	in	ADP
brj-23306	13	16	approximately	approximately	ADV
brj-23306	13	17	1.76	1.76	NUM
brj-23306	13	18	million	million	NUM
brj-23306	13	19	deaths	death	NOUN
brj-23306	13	20	annually	annually	ADV
brj-23306	13	21	.	.	PUNCT
brj-23306	14	1	in	in	ADP
brj-23306	14	2	2022	2022	NUM
brj-23306	14	3	,	,	PUNCT
brj-23306	14	4	the	the	DET
brj-23306	14	5	estimated	estimate	VERB
brj-23306	14	6	number	number	NOUN
brj-23306	14	7	of	of	ADP
brj-23306	14	8	lung	lung	NOUN
brj-23306	14	9	cancer	cancer	NOUN
brj-23306	14	10	cases	case	NOUN
brj-23306	14	11	reached	reach	VERB
brj-23306	14	12	10,3371	10,3371	NUM
brj-23306	14	13	,	,	PUNCT
brj-23306	14	14	securing	secure	VERB
brj-23306	14	15	its	its	PRON
brj-23306	14	16	peer	peer	NOUN
brj-23306	14	17	-	-	PUNCT
brj-23306	14	18	reviewed	review	VERB
brj-23306	14	19	article	article	NOUN
brj-23306	14	20	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	14	21	raju	raju	PROPN
brj-23306	14	22	et	et	PROPN
brj-23306	14	23	al	al	PROPN
brj-23306	14	24	.	.	PROPN
brj-23306	15	1	(	(	PUNCT
brj-23306	15	2	2024	2024	NUM
brj-23306	15	3	)	)	PUNCT
brj-23306	15	4	.	.	PUNCT
brj-23306	16	1	“	"	PUNCT
brj-23306	16	2	ag	ag	PROPN
brj-23306	16	3	nanoparticles	nanoparticle	NOUN
brj-23306	16	4	from	from	ADP
brj-23306	16	5	leaves	leave	NOUN
brj-23306	16	6	,	,	PUNCT
brj-23306	16	7	”	"	PUNCT
brj-23306	16	8	bioresources	bioresource	NOUN
brj-23306	16	9	19(2	19(2	NUM
brj-23306	16	10	)	)	PUNCT
brj-23306	16	11	,	,	PUNCT
brj-23306	16	12	3328	3328	NUM
brj-23306	16	13	-	-	SYM
brj-23306	16	14	3352	3352	NUM
brj-23306	16	15	.	.	PUNCT
brj-23306	16	16	3329	3329	NUM
brj-23306	16	17	place	place	NOUN
brj-23306	16	18	among	among	ADP
brj-23306	16	19	the	the	DET
brj-23306	16	20	top	top	ADJ
brj-23306	16	21	five	five	NUM
brj-23306	16	22	prevalent	prevalent	ADJ
brj-23306	16	23	cancer	cancer	NOUN
brj-23306	16	24	types	type	NOUN
brj-23306	16	25	for	for	ADP
brj-23306	16	26	both	both	DET
brj-23306	16	27	men	man	NOUN
brj-23306	16	28	and	and	CCONJ
brj-23306	16	29	women	woman	NOUN
brj-23306	16	30	.	.	PUNCT
brj-23306	17	1	the	the	DET
brj-23306	17	2	overall	overall	ADJ
brj-23306	17	3	cancer	cancer	NOUN
brj-23306	17	4	estimates	estimate	NOUN
brj-23306	17	5	in	in	ADP
brj-23306	17	6	india	india	PROPN
brj-23306	17	7	have	have	AUX
brj-23306	17	8	shown	show	VERB
brj-23306	17	9	a	a	DET
brj-23306	17	10	5	5	NUM
brj-23306	17	11	%	%	NOUN
brj-23306	17	12	increment	increment	NOUN
brj-23306	17	13	,	,	PUNCT
brj-23306	17	14	from	from	ADP
brj-23306	17	15	1,392,179	1,392,179	NUM
brj-23306	17	16	cases	case	NOUN
brj-23306	17	17	in	in	ADP
brj-23306	17	18	2020	2020	NUM
brj-23306	17	19	to	to	ADP
brj-23306	17	20	1,461,427	1,461,427	NUM
brj-23306	17	21	cases	case	NOUN
brj-23306	17	22	in	in	ADP
brj-23306	17	23	2022	2022	NUM
brj-23306	17	24	(	(	PUNCT
brj-23306	17	25	sathishkumar	sathishkumar	PROPN
brj-23306	17	26	et	et	PROPN
brj-23306	17	27	al	al	PROPN
brj-23306	17	28	.	.	PROPN
brj-23306	17	29	2023	2023	NUM
brj-23306	17	30	)	)	PUNCT
brj-23306	17	31	.	.	PUNCT
brj-23306	18	1	although	although	SCONJ
brj-23306	18	2	there	there	PRON
brj-23306	18	3	are	be	VERB
brj-23306	18	4	disparate	disparate	ADJ
brj-23306	18	5	reasons	reason	NOUN
brj-23306	18	6	for	for	ADP
brj-23306	18	7	the	the	DET
brj-23306	18	8	increasing	increase	VERB
brj-23306	18	9	cases	case	NOUN
brj-23306	18	10	of	of	ADP
brj-23306	18	11	lung	lung	NOUN
brj-23306	18	12	cancer	cancer	NOUN
brj-23306	18	13	,	,	PUNCT
brj-23306	18	14	tobacco	tobacco	NOUN
brj-23306	18	15	usage	usage	NOUN
brj-23306	18	16	in	in	ADP
brj-23306	18	17	our	our	PRON
brj-23306	18	18	society	society	NOUN
brj-23306	18	19	is	be	AUX
brj-23306	18	20	the	the	DET
brj-23306	18	21	prime	prime	ADJ
brj-23306	18	22	cause	cause	NOUN
brj-23306	18	23	.	.	PUNCT
brj-23306	19	1	according	accord	VERB
brj-23306	19	2	to	to	ADP
brj-23306	19	3	the	the	DET
brj-23306	19	4	data	datum	NOUN
brj-23306	19	5	,	,	PUNCT
brj-23306	19	6	smokers	smoker	NOUN
brj-23306	19	7	have	have	VERB
brj-23306	19	8	a	a	DET
brj-23306	19	9	15	15	NUM
brj-23306	19	10	to	to	PART
brj-23306	19	11	30	30	NUM
brj-23306	19	12	times	time	NOUN
brj-23306	19	13	greater	great	ADJ
brj-23306	19	14	chance	chance	NOUN
brj-23306	19	15	of	of	ADP
brj-23306	19	16	acquiring	acquire	VERB
brj-23306	19	17	lung	lung	NOUN
brj-23306	19	18	cancer	cancer	NOUN
brj-23306	19	19	than	than	ADP
brj-23306	19	20	non	non	ADJ
brj-23306	19	21	-	-	NOUN
brj-23306	19	22	smokers	smoker	NOUN
brj-23306	19	23	.	.	PUNCT
brj-23306	20	1	similarly	similarly	ADV
brj-23306	20	2	,	,	PUNCT
brj-23306	20	3	ovarian	ovarian	ADJ
brj-23306	20	4	cancer	cancer	NOUN
brj-23306	20	5	ranked	rank	VERB
brj-23306	20	6	as	as	ADP
brj-23306	20	7	the	the	DET
brj-23306	20	8	third	third	ADJ
brj-23306	20	9	most	most	ADV
brj-23306	20	10	prevalent	prevalent	ADJ
brj-23306	20	11	gynecological	gynecological	ADJ
brj-23306	20	12	cancer	cancer	NOUN
brj-23306	20	13	worldwide	worldwide	ADV
brj-23306	20	14	in	in	ADP
brj-23306	20	15	2020	2020	NUM
brj-23306	20	16	.	.	PUNCT
brj-23306	21	1	ovarian	ovarian	ADJ
brj-23306	21	2	carcinoma	carcinoma	NOUN
brj-23306	21	3	,	,	PUNCT
brj-23306	21	4	constituting	constitute	VERB
brj-23306	21	5	more	more	ADJ
brj-23306	21	6	than	than	ADP
brj-23306	21	7	90	90	NUM
brj-23306	21	8	%	%	NOUN
brj-23306	21	9	of	of	ADP
brj-23306	21	10	all	all	DET
brj-23306	21	11	cases	case	NOUN
brj-23306	21	12	of	of	ADP
brj-23306	21	13	ovarian	ovarian	ADJ
brj-23306	21	14	cancer	cancer	NOUN
brj-23306	21	15	,	,	PUNCT
brj-23306	21	16	presents	present	VERB
brj-23306	21	17	as	as	ADP
brj-23306	21	18	the	the	DET
brj-23306	21	19	most	most	ADV
brj-23306	21	20	frequent	frequent	ADJ
brj-23306	21	21	type	type	NOUN
brj-23306	21	22	.	.	PUNCT
brj-23306	22	1	it	it	PRON
brj-23306	22	2	often	often	ADV
brj-23306	22	3	gets	get	AUX
brj-23306	22	4	detected	detect	VERB
brj-23306	22	5	in	in	ADP
brj-23306	22	6	its	its	PRON
brj-23306	22	7	advanced	advanced	ADJ
brj-23306	22	8	stages	stage	NOUN
brj-23306	22	9	,	,	PUNCT
brj-23306	22	10	rendering	render	VERB
brj-23306	22	11	it	it	PRON
brj-23306	22	12	the	the	DET
brj-23306	22	13	deadliest	deadly	ADJ
brj-23306	22	14	among	among	ADP
brj-23306	22	15	gynecological	gynecological	ADJ
brj-23306	22	16	cancers	cancer	NOUN
brj-23306	22	17	.	.	PUNCT
brj-23306	23	1	generally	generally	ADV
brj-23306	23	2	,	,	PUNCT
brj-23306	23	3	its	its	PRON
brj-23306	23	4	prognosis	prognosis	NOUN
brj-23306	23	5	is	be	AUX
brj-23306	23	6	low	low	ADJ
brj-23306	23	7	,	,	PUNCT
brj-23306	23	8	and	and	CCONJ
brj-23306	23	9	over	over	ADP
brj-23306	23	10	the	the	DET
brj-23306	23	11	past	past	ADJ
brj-23306	23	12	five	five	NUM
brj-23306	23	13	years	year	NOUN
brj-23306	23	14	,	,	PUNCT
brj-23306	23	15	it	it	PRON
brj-23306	23	16	reflected	reflect	VERB
brj-23306	23	17	only	only	ADV
brj-23306	23	18	17	17	NUM
brj-23306	23	19	%	%	NOUN
brj-23306	23	20	survival	survival	NOUN
brj-23306	23	21	rate	rate	NOUN
brj-23306	23	22	for	for	ADP
brj-23306	23	23	individuals	individual	NOUN
brj-23306	23	24	in	in	ADP
brj-23306	23	25	the	the	DET
brj-23306	23	26	advanced	advanced	ADJ
brj-23306	23	27	stages	stage	NOUN
brj-23306	23	28	.	.	PUNCT
brj-23306	24	1	as	as	ADP
brj-23306	24	2	a	a	DET
brj-23306	24	3	result	result	NOUN
brj-23306	24	4	,	,	PUNCT
brj-23306	24	5	it	it	PRON
brj-23306	24	6	becomes	become	VERB
brj-23306	24	7	crucial	crucial	ADJ
brj-23306	24	8	to	to	PART
brj-23306	24	9	know	know	VERB
brj-23306	24	10	the	the	DET
brj-23306	24	11	causes	cause	NOUN
brj-23306	24	12	and	and	CCONJ
brj-23306	24	13	risk	risk	NOUN
brj-23306	24	14	factors	factor	NOUN
brj-23306	24	15	of	of	ADP
brj-23306	24	16	ovarian	ovarian	ADJ
brj-23306	24	17	cancer	cancer	NOUN
brj-23306	24	18	to	to	PART
brj-23306	24	19	prevent	prevent	VERB
brj-23306	24	20	the	the	DET
brj-23306	24	21	onset	onset	NOUN
brj-23306	24	22	of	of	ADP
brj-23306	24	23	this	this	DET
brj-23306	24	24	illness	illness	NOUN
brj-23306	24	25	(	(	PUNCT
brj-23306	24	26	huang	huang	PROPN
brj-23306	24	27	et	et	PROPN
brj-23306	24	28	al	al	PROPN
brj-23306	24	29	.	.	PROPN
brj-23306	24	30	2022	2022	NUM
brj-23306	24	31	)	)	PUNCT
brj-23306	24	32	.	.	PUNCT
brj-23306	25	1	caspases	caspase	NOUN
brj-23306	25	2	,	,	PUNCT
brj-23306	25	3	a	a	DET
brj-23306	25	4	family	family	NOUN
brj-23306	25	5	of	of	ADP
brj-23306	25	6	15	15	NUM
brj-23306	25	7	cysteine	cysteine	NOUN
brj-23306	25	8	proteases	protease	NOUN
brj-23306	25	9	,	,	PUNCT
brj-23306	25	10	play	play	VERB
brj-23306	25	11	crucial	crucial	ADJ
brj-23306	25	12	roles	role	NOUN
brj-23306	25	13	in	in	ADP
brj-23306	25	14	programmed	program	VERB
brj-23306	25	15	cell	cell	NOUN
brj-23306	25	16	death	death	NOUN
brj-23306	25	17	and	and	CCONJ
brj-23306	25	18	inflammation	inflammation	NOUN
brj-23306	25	19	.	.	PUNCT
brj-23306	26	1	among	among	ADP
brj-23306	26	2	these	these	PRON
brj-23306	26	3	,	,	PUNCT
brj-23306	26	4	caspase-3	caspase-3	PRON
brj-23306	26	5	serves	serve	VERB
brj-23306	26	6	as	as	ADP
brj-23306	26	7	a	a	DET
brj-23306	26	8	typical	typical	ADJ
brj-23306	26	9	executor	executor	NOUN
brj-23306	26	10	of	of	ADP
brj-23306	26	11	apoptosis	apoptosis	NOUN
brj-23306	26	12	.	.	PUNCT
brj-23306	27	1	its	its	PRON
brj-23306	27	2	activation	activation	NOUN
brj-23306	27	3	by	by	ADP
brj-23306	27	4	initiator	initiator	NOUN
brj-23306	27	5	caspases	caspase	NOUN
brj-23306	27	6	such	such	ADJ
brj-23306	27	7	as	as	ADP
brj-23306	27	8	caspase-8	caspase-8	NOUN
brj-23306	27	9	or	or	CCONJ
brj-23306	27	10	caspase-9	caspase-9	PROPN
brj-23306	27	11	leads	lead	VERB
brj-23306	27	12	to	to	ADP
brj-23306	27	13	the	the	DET
brj-23306	27	14	cleavage	cleavage	NOUN
brj-23306	27	15	of	of	ADP
brj-23306	27	16	various	various	ADJ
brj-23306	27	17	vital	vital	ADJ
brj-23306	27	18	proteins	protein	NOUN
brj-23306	27	19	in	in	ADP
brj-23306	27	20	the	the	DET
brj-23306	27	21	cell	cell	NOUN
brj-23306	27	22	,	,	PUNCT
brj-23306	27	23	ultimately	ultimately	ADV
brj-23306	27	24	inducing	induce	VERB
brj-23306	27	25	apoptosis	apoptosis	NOUN
brj-23306	27	26	.	.	PUNCT
brj-23306	28	1	many	many	ADJ
brj-23306	28	2	treatments	treatment	NOUN
brj-23306	28	3	for	for	ADP
brj-23306	28	4	cancer	cancer	NOUN
brj-23306	28	5	,	,	PUNCT
brj-23306	28	6	such	such	ADJ
brj-23306	28	7	as	as	ADP
brj-23306	28	8	cytotoxic	cytotoxic	ADJ
brj-23306	28	9	drugs	drug	NOUN
brj-23306	28	10	,	,	PUNCT
brj-23306	28	11	radiotherapy	radiotherapy	NOUN
brj-23306	28	12	,	,	PUNCT
brj-23306	28	13	or	or	CCONJ
brj-23306	28	14	immunotherapy	immunotherapy	NOUN
brj-23306	28	15	,	,	PUNCT
brj-23306	28	16	induce	induce	VERB
brj-23306	28	17	tumor	tumor	NOUN
brj-23306	28	18	cell	cell	NOUN
brj-23306	28	19	death	death	NOUN
brj-23306	28	20	by	by	ADP
brj-23306	28	21	triggering	trigger	VERB
brj-23306	28	22	caspase-3	caspase-3	NUM
brj-23306	28	23	activation	activation	NOUN
brj-23306	28	24	.	.	PUNCT
brj-23306	29	1	so	so	ADV
brj-23306	29	2	,	,	PUNCT
brj-23306	29	3	numerous	numerous	ADJ
brj-23306	29	4	researchers	researcher	NOUN
brj-23306	29	5	utilize	utilize	VERB
brj-23306	29	6	caspase-3	caspase-3	NUM
brj-23306	29	7	activation	activation	NOUN
brj-23306	29	8	as	as	ADP
brj-23306	29	9	an	an	DET
brj-23306	29	10	indicator	indicator	NOUN
brj-23306	29	11	of	of	ADP
brj-23306	29	12	the	the	DET
brj-23306	29	13	effectiveness	effectiveness	NOUN
brj-23306	29	14	of	of	ADP
brj-23306	29	15	cancer	cancer	NOUN
brj-23306	29	16	therapies	therapy	NOUN
brj-23306	29	17	(	(	PUNCT
brj-23306	29	18	zhou	zhou	X
brj-23306	29	19	et	et	PROPN
brj-23306	29	20	al	al	PROPN
brj-23306	29	21	.	.	PROPN
brj-23306	29	22	2018	2018	NUM
brj-23306	29	23	)	)	PUNCT
brj-23306	29	24	.	.	PUNCT
brj-23306	30	1	nanotechnology	nanotechnology	PROPN
brj-23306	30	2	has	have	AUX
brj-23306	30	3	emerged	emerge	VERB
brj-23306	30	4	as	as	ADP
brj-23306	30	5	a	a	DET
brj-23306	30	6	revolutionary	revolutionary	ADJ
brj-23306	30	7	tool	tool	NOUN
brj-23306	30	8	in	in	ADP
brj-23306	30	9	the	the	DET
brj-23306	30	10	field	field	NOUN
brj-23306	30	11	of	of	ADP
brj-23306	30	12	drug	drug	NOUN
brj-23306	30	13	delivery	delivery	NOUN
brj-23306	30	14	,	,	PUNCT
brj-23306	30	15	with	with	ADP
brj-23306	30	16	the	the	DET
brj-23306	30	17	capacity	capacity	NOUN
brj-23306	30	18	to	to	PART
brj-23306	30	19	transform	transform	VERB
brj-23306	30	20	medication	medication	NOUN
brj-23306	30	21	administration	administration	NOUN
brj-23306	30	22	and	and	CCONJ
brj-23306	30	23	targeting	targeting	NOUN
brj-23306	30	24	.	.	PUNCT
brj-23306	31	1	it	it	PRON
brj-23306	31	2	greatly	greatly	ADV
brj-23306	31	3	improves	improve	VERB
brj-23306	31	4	drug	drug	NOUN
brj-23306	31	5	efficacy	efficacy	NOUN
brj-23306	31	6	while	while	SCONJ
brj-23306	31	7	modifying	modify	VERB
brj-23306	31	8	the	the	DET
brj-23306	31	9	adverse	adverse	ADJ
brj-23306	31	10	effects	effect	NOUN
brj-23306	31	11	(	(	PUNCT
brj-23306	31	12	anjum	anjum	PROPN
brj-23306	31	13	et	et	PROPN
brj-23306	31	14	al	al	PROPN
brj-23306	31	15	.	.	PROPN
brj-23306	31	16	2021	2021	NUM
brj-23306	31	17	)	)	PUNCT
brj-23306	31	18	.	.	PUNCT
brj-23306	32	1	green	green	ADJ
brj-23306	32	2	synthesis	synthesis	NOUN
brj-23306	32	3	of	of	ADP
brj-23306	32	4	nanoparticles	nanoparticle	NOUN
brj-23306	32	5	plays	play	VERB
brj-23306	32	6	a	a	DET
brj-23306	32	7	crucial	crucial	ADJ
brj-23306	32	8	role	role	NOUN
brj-23306	32	9	in	in	ADP
brj-23306	32	10	the	the	DET
brj-23306	32	11	field	field	NOUN
brj-23306	32	12	of	of	ADP
brj-23306	32	13	medicine	medicine	NOUN
brj-23306	32	14	,	,	PUNCT
brj-23306	32	15	as	as	SCONJ
brj-23306	32	16	it	it	PRON
brj-23306	32	17	provides	provide	VERB
brj-23306	32	18	safer	safe	ADJ
brj-23306	32	19	and	and	CCONJ
brj-23306	32	20	more	more	ADV
brj-23306	32	21	efficient	efficient	ADJ
brj-23306	32	22	approaches	approach	NOUN
brj-23306	32	23	for	for	ADP
brj-23306	32	24	the	the	DET
brj-23306	32	25	therodiagnostic	therodiagnostic	ADJ
brj-23306	32	26	purpose	purpose	NOUN
brj-23306	32	27	of	of	ADP
brj-23306	32	28	any	any	DET
brj-23306	32	29	disease	disease	NOUN
brj-23306	32	30	.	.	PUNCT
brj-23306	33	1	with	with	ADP
brj-23306	33	2	respect	respect	NOUN
brj-23306	33	3	to	to	ADP
brj-23306	33	4	the	the	DET
brj-23306	33	5	other	other	ADJ
brj-23306	33	6	methods	method	NOUN
brj-23306	33	7	of	of	ADP
brj-23306	33	8	synthesis	synthesis	NOUN
brj-23306	33	9	,	,	PUNCT
brj-23306	33	10	green	green	ADJ
brj-23306	33	11	synthesis	synthesis	NOUN
brj-23306	33	12	method	method	NOUN
brj-23306	33	13	is	be	AUX
brj-23306	33	14	steadily	steadily	ADV
brj-23306	33	15	gaining	gain	VERB
brj-23306	33	16	popularity	popularity	NOUN
brj-23306	33	17	and	and	CCONJ
brj-23306	33	18	recognition	recognition	NOUN
brj-23306	33	19	,	,	PUNCT
brj-23306	33	20	particularly	particularly	ADV
brj-23306	33	21	because	because	SCONJ
brj-23306	33	22	of	of	ADP
brj-23306	33	23	its	its	PRON
brj-23306	33	24	sustainability	sustainability	NOUN
brj-23306	33	25	,	,	PUNCT
brj-23306	33	26	environmental	environmental	ADJ
brj-23306	33	27	awareness	awareness	NOUN
brj-23306	33	28	,	,	PUNCT
brj-23306	33	29	and	and	CCONJ
brj-23306	33	30	safety	safety	NOUN
brj-23306	33	31	(	(	PUNCT
brj-23306	33	32	aboyewa	aboyewa	VERB
brj-23306	33	33	et	et	PROPN
brj-23306	33	34	al	al	PROPN
brj-23306	33	35	.	.	PROPN
brj-23306	33	36	2021	2021	NUM
brj-23306	33	37	)	)	PUNCT
brj-23306	33	38	.	.	PUNCT
brj-23306	34	1	using	use	VERB
brj-23306	34	2	hot	hot	ADJ
brj-23306	34	3	water	water	NOUN
brj-23306	34	4	as	as	SCONJ
brj-23306	34	5	the	the	DET
brj-23306	34	6	extraction	extraction	NOUN
brj-23306	34	7	solvent	solvent	NOUN
brj-23306	34	8	can	can	AUX
brj-23306	34	9	be	be	AUX
brj-23306	34	10	advantageous	advantageous	ADJ
brj-23306	34	11	.	.	PUNCT
brj-23306	35	1	primarily	primarily	ADV
brj-23306	35	2	,	,	PUNCT
brj-23306	35	3	hot	hot	ADJ
brj-23306	35	4	water	water	NOUN
brj-23306	35	5	extraction	extraction	NOUN
brj-23306	35	6	is	be	AUX
brj-23306	35	7	considered	consider	VERB
brj-23306	35	8	safer	safe	ADJ
brj-23306	35	9	and	and	CCONJ
brj-23306	35	10	more	more	ADV
brj-23306	35	11	environmentally	environmentally	ADV
brj-23306	35	12	friendly	friendly	ADJ
brj-23306	35	13	compared	compare	VERB
brj-23306	35	14	to	to	ADP
brj-23306	35	15	organic	organic	ADJ
brj-23306	35	16	solvents	solvent	NOUN
brj-23306	35	17	including	include	VERB
brj-23306	35	18	ethyl	ethyl	PROPN
brj-23306	35	19	alcohol	alcohol	PROPN
brj-23306	35	20	,	,	PUNCT
brj-23306	35	21	which	which	PRON
brj-23306	35	22	may	may	AUX
brj-23306	35	23	pose	pose	VERB
brj-23306	35	24	health	health	NOUN
brj-23306	35	25	and	and	CCONJ
brj-23306	35	26	safety	safety	NOUN
brj-23306	35	27	risks	risk	NOUN
brj-23306	35	28	and	and	CCONJ
brj-23306	35	29	require	require	VERB
brj-23306	35	30	additional	additional	ADJ
brj-23306	35	31	processing	processing	NOUN
brj-23306	35	32	steps	step	NOUN
brj-23306	35	33	for	for	ADP
brj-23306	35	34	solvent	solvent	NOUN
brj-23306	35	35	removal	removal	NOUN
brj-23306	35	36	.	.	PUNCT
brj-23306	36	1	additionally	additionally	ADV
brj-23306	36	2	,	,	PUNCT
brj-23306	36	3	hot	hot	ADJ
brj-23306	36	4	water	water	NOUN
brj-23306	36	5	extraction	extraction	NOUN
brj-23306	36	6	is	be	AUX
brj-23306	36	7	efficient	efficient	ADJ
brj-23306	36	8	in	in	ADP
brj-23306	36	9	extracting	extract	VERB
brj-23306	36	10	a	a	DET
brj-23306	36	11	wide	wide	ADJ
brj-23306	36	12	range	range	NOUN
brj-23306	36	13	of	of	ADP
brj-23306	36	14	compounds	compound	NOUN
brj-23306	36	15	,	,	PUNCT
brj-23306	36	16	including	include	VERB
brj-23306	36	17	polar	polar	ADJ
brj-23306	36	18	and	and	CCONJ
brj-23306	36	19	heatstable	heatstable	ADJ
brj-23306	36	20	molecules	molecule	NOUN
brj-23306	36	21	such	such	ADJ
brj-23306	36	22	as	as	ADP
brj-23306	36	23	polysaccharides	polysaccharide	NOUN
brj-23306	36	24	,	,	PUNCT
brj-23306	36	25	proteins	protein	NOUN
brj-23306	36	26	,	,	PUNCT
brj-23306	36	27	and	and	CCONJ
brj-23306	36	28	some	some	DET
brj-23306	36	29	alkaloids	alkaloid	NOUN
brj-23306	36	30	,	,	PUNCT
brj-23306	36	31	commonly	commonly	ADV
brj-23306	36	32	found	find	VERB
brj-23306	36	33	in	in	ADP
brj-23306	36	34	plant	plant	NOUN
brj-23306	36	35	materials	material	NOUN
brj-23306	36	36	.	.	PUNCT
brj-23306	37	1	moreover	moreover	ADV
brj-23306	37	2	,	,	PUNCT
brj-23306	37	3	hot	hot	ADJ
brj-23306	37	4	water	water	NOUN
brj-23306	37	5	extraction	extraction	NOUN
brj-23306	37	6	is	be	AUX
brj-23306	37	7	relatively	relatively	ADV
brj-23306	37	8	simple	simple	ADJ
brj-23306	37	9	,	,	PUNCT
brj-23306	37	10	cost	cost	NOUN
brj-23306	37	11	-	-	PUNCT
brj-23306	37	12	effective	effective	ADJ
brj-23306	37	13	,	,	PUNCT
brj-23306	37	14	and	and	CCONJ
brj-23306	37	15	easily	easily	ADV
brj-23306	37	16	scalable	scalable	ADJ
brj-23306	37	17	,	,	PUNCT
brj-23306	37	18	making	make	VERB
brj-23306	37	19	it	it	PRON
brj-23306	37	20	a	a	DET
brj-23306	37	21	practical	practical	ADJ
brj-23306	37	22	choice	choice	NOUN
brj-23306	37	23	for	for	ADP
brj-23306	37	24	large	large	ADJ
brj-23306	37	25	-	-	PUNCT
brj-23306	37	26	scale	scale	NOUN
brj-23306	37	27	extraction	extraction	NOUN
brj-23306	37	28	processes	process	NOUN
brj-23306	37	29	.	.	PUNCT
brj-23306	38	1	overall	overall	ADV
brj-23306	38	2	,	,	PUNCT
brj-23306	38	3	these	these	DET
brj-23306	38	4	factors	factor	NOUN
brj-23306	38	5	contribute	contribute	VERB
brj-23306	38	6	to	to	ADP
brj-23306	38	7	the	the	DET
brj-23306	38	8	preference	preference	NOUN
brj-23306	38	9	for	for	ADP
brj-23306	38	10	using	use	VERB
brj-23306	38	11	hot	hot	ADJ
brj-23306	38	12	water	water	NOUN
brj-23306	38	13	as	as	ADP
brj-23306	38	14	the	the	DET
brj-23306	38	15	extraction	extraction	NOUN
brj-23306	38	16	solvent	solvent	NOUN
brj-23306	38	17	in	in	ADP
brj-23306	38	18	various	various	ADJ
brj-23306	38	19	studies	study	NOUN
brj-23306	38	20	(	(	PUNCT
brj-23306	38	21	castro‐puyana	castro‐puyana	NOUN
brj-23306	38	22	et	et	PROPN
brj-23306	38	23	al	al	PROPN
brj-23306	38	24	.	.	PROPN
brj-23306	38	25	2017	2017	NUM
brj-23306	38	26	)	)	PUNCT
brj-23306	38	27	.	.	PUNCT
brj-23306	39	1	biosynthesized	biosynthesize	VERB
brj-23306	39	2	silver	silver	ADJ
brj-23306	39	3	nanoparticles	nanoparticle	NOUN
brj-23306	39	4	hold	hold	VERB
brj-23306	39	5	potential	potential	ADJ
brj-23306	39	6	as	as	ADP
brj-23306	39	7	cancer	cancer	NOUN
brj-23306	39	8	therapeutics	therapeutic	NOUN
brj-23306	39	9	,	,	PUNCT
brj-23306	39	10	especially	especially	ADV
brj-23306	39	11	against	against	ADP
brj-23306	39	12	lung	lung	NOUN
brj-23306	39	13	cancer	cancer	NOUN
brj-23306	39	14	.	.	PUNCT
brj-23306	40	1	while	while	SCONJ
brj-23306	40	2	cytotoxic	cytotoxic	ADJ
brj-23306	40	3	assays	assay	NOUN
brj-23306	40	4	have	have	AUX
brj-23306	40	5	been	be	AUX
brj-23306	40	6	the	the	DET
brj-23306	40	7	main	main	ADJ
brj-23306	40	8	approach	approach	NOUN
brj-23306	40	9	to	to	ADP
brj-23306	40	10	studying	study	VERB
brj-23306	40	11	their	their	PRON
brj-23306	40	12	effects	effect	NOUN
brj-23306	40	13	,	,	PUNCT
brj-23306	40	14	biologically	biologically	ADV
brj-23306	40	15	synthesized	synthesize	VERB
brj-23306	40	16	agnps	agnps	NOUN
brj-23306	40	17	have	have	AUX
brj-23306	40	18	also	also	ADV
brj-23306	40	19	been	be	AUX
brj-23306	40	20	found	find	VERB
brj-23306	40	21	to	to	PART
brj-23306	40	22	disrupt	disrupt	VERB
brj-23306	40	23	the	the	DET
brj-23306	40	24	cell	cell	NOUN
brj-23306	40	25	cycle	cycle	NOUN
brj-23306	40	26	,	,	PUNCT
brj-23306	40	27	influence	influence	NOUN
brj-23306	40	28	signaling	signal	VERB
brj-23306	40	29	pathways	pathway	NOUN
brj-23306	40	30	,	,	PUNCT
brj-23306	40	31	induce	induce	VERB
brj-23306	40	32	cell	cell	NOUN
brj-23306	40	33	death	death	NOUN
brj-23306	40	34	,	,	PUNCT
brj-23306	40	35	and	and	CCONJ
brj-23306	40	36	enhance	enhance	VERB
brj-23306	40	37	the	the	DET
brj-23306	40	38	production	production	NOUN
brj-23306	40	39	of	of	ADP
brj-23306	40	40	intracellular	intracellular	ADJ
brj-23306	40	41	molecules	molecule	NOUN
brj-23306	40	42	(	(	PUNCT
brj-23306	40	43	mejia	mejia	PROPN
brj-23306	40	44	-	-	PUNCT
brj-23306	40	45	mendez	mendez	PROPN
brj-23306	40	46	et	et	PROPN
brj-23306	40	47	al	al	PROPN
brj-23306	40	48	.	.	PROPN
brj-23306	40	49	2023	2023	NUM
brj-23306	40	50	)	)	PUNCT
brj-23306	40	51	.	.	PUNCT
brj-23306	41	1	silver	silver	ADJ
brj-23306	41	2	nanoparticles	nanoparticle	NOUN
brj-23306	41	3	are	be	AUX
brj-23306	41	4	an	an	DET
brj-23306	41	5	excellent	excellent	ADJ
brj-23306	41	6	vehicle	vehicle	NOUN
brj-23306	41	7	in	in	ADP
brj-23306	41	8	carrying	carry	VERB
brj-23306	41	9	or	or	CCONJ
brj-23306	41	10	encapsulating	encapsulate	VERB
brj-23306	41	11	plant	plant	NOUN
brj-23306	41	12	-	-	PUNCT
brj-23306	41	13	derived	derive	VERB
brj-23306	41	14	therapeutic	therapeutic	ADJ
brj-23306	41	15	agents	agent	NOUN
brj-23306	41	16	,	,	PUNCT
brj-23306	41	17	such	such	ADJ
brj-23306	41	18	as	as	ADP
brj-23306	41	19	antioxidants	antioxidant	NOUN
brj-23306	41	20	or	or	CCONJ
brj-23306	41	21	anti	anti	ADJ
brj-23306	41	22	-	-	ADJ
brj-23306	41	23	inflammatory	inflammatory	ADJ
brj-23306	41	24	drugs	drug	NOUN
brj-23306	41	25	,	,	PUNCT
brj-23306	41	26	which	which	PRON
brj-23306	41	27	enhances	enhance	VERB
brj-23306	41	28	their	their	PRON
brj-23306	41	29	uptake	uptake	NOUN
brj-23306	41	30	and	and	CCONJ
brj-23306	41	31	efficacy	efficacy	NOUN
brj-23306	41	32	in	in	ADP
brj-23306	41	33	the	the	DET
brj-23306	41	34	treatment	treatment	NOUN
brj-23306	41	35	of	of	ADP
brj-23306	41	36	non	non	ADJ
brj-23306	41	37	-	-	ADJ
brj-23306	41	38	communicable	communicable	ADJ
brj-23306	41	39	diseases	disease	NOUN
brj-23306	41	40	.	.	PUNCT
brj-23306	42	1	due	due	ADP
brj-23306	42	2	to	to	ADP
brj-23306	42	3	its	its	PRON
brj-23306	42	4	unique	unique	ADJ
brj-23306	42	5	characteristics	characteristic	NOUN
brj-23306	42	6	and	and	CCONJ
brj-23306	42	7	extensive	extensive	ADJ
brj-23306	42	8	applications	application	NOUN
brj-23306	42	9	,	,	PUNCT
brj-23306	42	10	agnps	agnps	PROPN
brj-23306	42	11	are	be	AUX
brj-23306	42	12	playing	play	VERB
brj-23306	42	13	a	a	DET
brj-23306	42	14	significant	significant	ADJ
brj-23306	42	15	role	role	NOUN
brj-23306	42	16	in	in	ADP
brj-23306	42	17	oncological	oncological	ADJ
brj-23306	42	18	research	research	NOUN
brj-23306	42	19	(	(	PUNCT
brj-23306	42	20	li	li	PROPN
brj-23306	42	21	et	et	PROPN
brj-23306	42	22	al	al	PROPN
brj-23306	42	23	.	.	PROPN
brj-23306	42	24	2020	2020	NUM
brj-23306	42	25	)	)	PUNCT
brj-23306	42	26	.	.	PUNCT
brj-23306	43	1	agnps	agnps	PROPN
brj-23306	43	2	have	have	VERB
brj-23306	43	3	the	the	DET
brj-23306	43	4	ability	ability	NOUN
brj-23306	43	5	to	to	PART
brj-23306	43	6	impair	impair	VERB
brj-23306	43	7	the	the	DET
brj-23306	43	8	mitochondrial	mitochondrial	ADJ
brj-23306	43	9	process	process	NOUN
brj-23306	43	10	in	in	ADP
brj-23306	43	11	cancer	cancer	NOUN
brj-23306	43	12	cells	cell	NOUN
brj-23306	43	13	,	,	PUNCT
brj-23306	43	14	which	which	PRON
brj-23306	43	15	causes	cause	VERB
brj-23306	43	16	energy	energy	NOUN
brj-23306	43	17	depletion	depletion	NOUN
brj-23306	43	18	and	and	CCONJ
brj-23306	43	19	cell	cell	NOUN
brj-23306	43	20	death	death	NOUN
brj-23306	43	21	.	.	PUNCT
brj-23306	44	1	one	one	NUM
brj-23306	44	2	important	important	ADJ
brj-23306	44	3	mechanism	mechanism	NOUN
brj-23306	44	4	behind	behind	ADP
brj-23306	44	5	their	their	PRON
brj-23306	44	6	anticancer	anticancer	NOUN
brj-23306	44	7	effect	effect	NOUN
brj-23306	44	8	may	may	AUX
brj-23306	44	9	be	be	AUX
brj-23306	44	10	the	the	DET
brj-23306	44	11	disturbance	disturbance	NOUN
brj-23306	44	12	of	of	ADP
brj-23306	44	13	mitochondrial	mitochondrial	ADJ
brj-23306	44	14	peer	peer	NOUN
brj-23306	44	15	-	-	PUNCT
brj-23306	44	16	reviewed	review	VERB
brj-23306	44	17	article	article	NOUN
brj-23306	44	18	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	44	19	raju	raju	PROPN
brj-23306	44	20	et	et	PROPN
brj-23306	44	21	al	al	PROPN
brj-23306	44	22	.	.	PROPN
brj-23306	45	1	(	(	PUNCT
brj-23306	45	2	2024	2024	NUM
brj-23306	45	3	)	)	PUNCT
brj-23306	45	4	.	.	PUNCT
brj-23306	46	1	“	"	PUNCT
brj-23306	46	2	ag	ag	PROPN
brj-23306	46	3	nanoparticles	nanoparticle	NOUN
brj-23306	46	4	from	from	ADP
brj-23306	46	5	leaves	leave	NOUN
brj-23306	46	6	,	,	PUNCT
brj-23306	46	7	”	"	PUNCT
brj-23306	46	8	bioresources	bioresource	NOUN
brj-23306	46	9	19(2	19(2	NUM
brj-23306	46	10	)	)	PUNCT
brj-23306	46	11	,	,	PUNCT
brj-23306	46	12	3328	3328	NUM
brj-23306	46	13	-	-	SYM
brj-23306	46	14	3352	3352	NUM
brj-23306	46	15	.	.	PUNCT
brj-23306	46	16	3330	3330	NUM
brj-23306	46	17	function	function	NOUN
brj-23306	46	18	.	.	PUNCT
brj-23306	47	1	agnps	agnps	PROPN
brj-23306	47	2	can	can	AUX
brj-23306	47	3	cause	cause	VERB
brj-23306	47	4	cell	cell	NOUN
brj-23306	47	5	death	death	NOUN
brj-23306	47	6	by	by	ADP
brj-23306	47	7	activating	activate	VERB
brj-23306	47	8	apoptotic	apoptotic	ADJ
brj-23306	47	9	pathways	pathway	NOUN
brj-23306	47	10	in	in	ADP
brj-23306	47	11	cancer	cancer	NOUN
brj-23306	47	12	cells	cell	NOUN
brj-23306	47	13	via	via	ADP
brj-23306	47	14	several	several	ADJ
brj-23306	47	15	routes	route	NOUN
brj-23306	47	16	.	.	PUNCT
brj-23306	48	1	in	in	ADP
brj-23306	48	2	the	the	DET
brj-23306	48	3	study	study	NOUN
brj-23306	48	4	reported	report	VERB
brj-23306	48	5	by	by	ADP
brj-23306	48	6	artiukh	artiukh	PROPN
brj-23306	48	7	et	et	PROPN
brj-23306	48	8	al	al	PROPN
brj-23306	48	9	.	.	PROPN
brj-23306	49	1	(	(	PUNCT
brj-23306	49	2	2022	2022	NUM
brj-23306	49	3	)	)	PUNCT
brj-23306	49	4	,	,	PUNCT
brj-23306	49	5	it	it	PRON
brj-23306	49	6	was	be	AUX
brj-23306	49	7	observed	observe	VERB
brj-23306	49	8	that	that	SCONJ
brj-23306	49	9	in	in	ADP
brj-23306	49	10	noncancerous	noncancerous	ADJ
brj-23306	49	11	cell	cell	NOUN
brj-23306	49	12	lines	line	NOUN
brj-23306	49	13	,	,	PUNCT
brj-23306	49	14	the	the	DET
brj-23306	49	15	cellular	cellular	ADJ
brj-23306	49	16	parameters	parameter	NOUN
brj-23306	49	17	remained	remain	VERB
brj-23306	49	18	similar	similar	ADJ
brj-23306	49	19	to	to	ADP
brj-23306	49	20	those	those	PRON
brj-23306	49	21	of	of	ADP
brj-23306	49	22	the	the	DET
brj-23306	49	23	untreated	untreated	ADJ
brj-23306	49	24	control	control	NOUN
brj-23306	49	25	cells	cell	NOUN
brj-23306	49	26	.	.	PUNCT
brj-23306	50	1	a	a	DET
brj-23306	50	2	plethora	plethora	NOUN
brj-23306	50	3	of	of	ADP
brj-23306	50	4	studies	study	NOUN
brj-23306	50	5	are	be	AUX
brj-23306	50	6	under	under	ADP
brj-23306	50	7	investigation	investigation	NOUN
brj-23306	50	8	to	to	PART
brj-23306	50	9	reduce	reduce	VERB
brj-23306	50	10	cytotoxicity	cytotoxicity	NOUN
brj-23306	50	11	and	and	CCONJ
brj-23306	50	12	stop	stop	VERB
brj-23306	50	13	the	the	DET
brj-23306	50	14	development	development	NOUN
brj-23306	50	15	of	of	ADP
brj-23306	50	16	cancer	cancer	NOUN
brj-23306	50	17	cells	cell	NOUN
brj-23306	50	18	(	(	PUNCT
brj-23306	50	19	hashem	hashem	X
brj-23306	50	20	et	et	PROPN
brj-23306	50	21	al	al	PROPN
brj-23306	50	22	.	.	PROPN
brj-23306	50	23	2022	2022	NUM
brj-23306	50	24	)	)	PUNCT
brj-23306	50	25	.	.	PUNCT
brj-23306	51	1	a	a	DET
brj-23306	51	2	critical	critical	ADJ
brj-23306	51	3	checkpoint	checkpoint	NOUN
brj-23306	51	4	in	in	ADP
brj-23306	51	5	the	the	DET
brj-23306	51	6	apoptotic	apoptotic	ADJ
brj-23306	51	7	cascade	cascade	NOUN
brj-23306	51	8	,	,	PUNCT
brj-23306	51	9	i.e.	i.e.	X
brj-23306	51	10	,	,	PUNCT
brj-23306	51	11	caspase	caspase	NOUN
brj-23306	51	12	3	3	NUM
brj-23306	51	13	activation	activation	NOUN
brj-23306	51	14	,	,	PUNCT
brj-23306	51	15	ensures	ensure	VERB
brj-23306	51	16	the	the	DET
brj-23306	51	17	ordered	order	VERB
brj-23306	51	18	and	and	CCONJ
brj-23306	51	19	regulated	regulated	ADJ
brj-23306	51	20	death	death	NOUN
brj-23306	51	21	of	of	ADP
brj-23306	51	22	cells	cell	NOUN
brj-23306	51	23	.	.	PUNCT
brj-23306	52	1	this	this	DET
brj-23306	52	2	process	process	NOUN
brj-23306	52	3	is	be	AUX
brj-23306	52	4	necessary	necessary	ADJ
brj-23306	52	5	for	for	ADP
brj-23306	52	6	a	a	DET
brj-23306	52	7	number	number	NOUN
brj-23306	52	8	of	of	ADP
brj-23306	52	9	physiological	physiological	ADJ
brj-23306	52	10	and	and	CCONJ
brj-23306	52	11	pathological	pathological	ADJ
brj-23306	52	12	circumstances	circumstance	NOUN
brj-23306	52	13	,	,	PUNCT
brj-23306	52	14	such	such	ADJ
brj-23306	52	15	as	as	ADP
brj-23306	52	16	tissue	tissue	NOUN
brj-23306	52	17	growth	growth	NOUN
brj-23306	52	18	,	,	PUNCT
brj-23306	52	19	repair	repair	NOUN
brj-23306	52	20	,	,	PUNCT
brj-23306	52	21	and	and	CCONJ
brj-23306	52	22	the	the	DET
brj-23306	52	23	body	body	NOUN
brj-23306	52	24	's	's	PART
brj-23306	52	25	response	response	NOUN
brj-23306	52	26	to	to	ADP
brj-23306	52	27	cell	cell	NOUN
brj-23306	52	28	damage	damage	NOUN
brj-23306	52	29	.	.	PUNCT
brj-23306	53	1	because	because	SCONJ
brj-23306	53	2	of	of	ADP
brj-23306	53	3	its	its	PRON
brj-23306	53	4	pivotal	pivotal	ADJ
brj-23306	53	5	function	function	NOUN
brj-23306	53	6	in	in	ADP
brj-23306	53	7	apoptosis	apoptosis	NOUN
brj-23306	53	8	,	,	PUNCT
brj-23306	53	9	caspase	caspase	NOUN
brj-23306	53	10	3	3	NUM
brj-23306	53	11	is	be	AUX
brj-23306	53	12	a	a	DET
brj-23306	53	13	topic	topic	NOUN
brj-23306	53	14	of	of	ADP
brj-23306	53	15	considerable	considerable	ADJ
brj-23306	53	16	interest	interest	NOUN
brj-23306	53	17	in	in	ADP
brj-23306	53	18	both	both	PRON
brj-23306	53	19	fundamental	fundamental	ADJ
brj-23306	53	20	cell	cell	NOUN
brj-23306	53	21	biology	biology	NOUN
brj-23306	53	22	and	and	CCONJ
brj-23306	53	23	clinical	clinical	ADJ
brj-23306	53	24	research	research	NOUN
brj-23306	53	25	for	for	ADP
brj-23306	53	26	conditions	condition	NOUN
brj-23306	53	27	like	like	ADP
brj-23306	53	28	cancer	cancer	NOUN
brj-23306	53	29	(	(	PUNCT
brj-23306	53	30	takáč	takáč	NOUN
brj-23306	53	31	et	et	NOUN
brj-23306	53	32	al	al	PROPN
brj-23306	53	33	.	.	PROPN
brj-23306	53	34	2023	2023	NUM
brj-23306	53	35	)	)	PUNCT
brj-23306	53	36	.	.	PUNCT
brj-23306	54	1	alpinia	alpinia	PROPN
brj-23306	54	2	purpurata	purpurata	PROPN
brj-23306	54	3	,	,	PUNCT
brj-23306	54	4	commonly	commonly	ADV
brj-23306	54	5	referred	refer	VERB
brj-23306	54	6	to	to	ADP
brj-23306	54	7	as	as	ADP
brj-23306	54	8	red	red	ADJ
brj-23306	54	9	ginger	ginger	NOUN
brj-23306	54	10	or	or	CCONJ
brj-23306	54	11	ostrich	ostrich	NOUN
brj-23306	54	12	plume	plume	NOUN
brj-23306	54	13	,	,	PUNCT
brj-23306	54	14	is	be	AUX
brj-23306	54	15	a	a	DET
brj-23306	54	16	tropical	tropical	ADJ
brj-23306	54	17	flowering	flower	VERB
brj-23306	54	18	plant	plant	NOUN
brj-23306	54	19	native	native	ADJ
brj-23306	54	20	to	to	ADP
brj-23306	54	21	malaysia	malaysia	PROPN
brj-23306	54	22	and	and	CCONJ
brj-23306	54	23	the	the	DET
brj-23306	54	24	pacific	pacific	PROPN
brj-23306	54	25	islands	island	NOUN
brj-23306	54	26	.	.	PUNCT
brj-23306	55	1	its	its	PRON
brj-23306	55	2	cultivation	cultivation	NOUN
brj-23306	55	3	is	be	AUX
brj-23306	55	4	primarily	primarily	ADV
brj-23306	55	5	for	for	ADP
brj-23306	55	6	the	the	DET
brj-23306	55	7	sake	sake	NOUN
brj-23306	55	8	of	of	ADP
brj-23306	55	9	its	its	PRON
brj-23306	55	10	ornamental	ornamental	ADJ
brj-23306	55	11	and	and	CCONJ
brj-23306	55	12	captivating	captivating	ADJ
brj-23306	55	13	flowers	flower	NOUN
brj-23306	55	14	.	.	PUNCT
brj-23306	56	1	this	this	DET
brj-23306	56	2	perennial	perennial	ADJ
brj-23306	56	3	,	,	PUNCT
brj-23306	56	4	herbaceous	herbaceous	ADJ
brj-23306	56	5	plant	plant	NOUN
brj-23306	56	6	has	have	VERB
brj-23306	56	7	the	the	DET
brj-23306	56	8	potential	potential	NOUN
brj-23306	56	9	to	to	PART
brj-23306	56	10	grow	grow	VERB
brj-23306	56	11	up	up	ADP
brj-23306	56	12	to	to	ADP
brj-23306	56	13	a	a	DET
brj-23306	56	14	towering	tower	VERB
brj-23306	56	15	height	height	NOUN
brj-23306	56	16	of	of	ADP
brj-23306	56	17	10	10	NUM
brj-23306	56	18	ft	ft	NOUN
brj-23306	56	19	(	(	PUNCT
brj-23306	56	20	approximately	approximately	ADV
brj-23306	56	21	3	3	NUM
brj-23306	56	22	m	m	NOUN
brj-23306	56	23	)	)	PUNCT
brj-23306	56	24	(	(	PUNCT
brj-23306	56	25	arul	arul	PROPN
brj-23306	56	26	raj	raj	PROPN
brj-23306	56	27	et	et	PROPN
brj-23306	56	28	al	al	PROPN
brj-23306	56	29	.	.	PROPN
brj-23306	56	30	2012	2012	NUM
brj-23306	56	31	)	)	PUNCT
brj-23306	56	32	.	.	PUNCT
brj-23306	57	1	in	in	ADP
brj-23306	57	2	ancient	ancient	ADJ
brj-23306	57	3	times	time	NOUN
brj-23306	57	4	,	,	PUNCT
brj-23306	57	5	it	it	PRON
brj-23306	57	6	found	find	VERB
brj-23306	57	7	utility	utility	NOUN
brj-23306	57	8	in	in	ADP
brj-23306	57	9	addressing	address	VERB
brj-23306	57	10	a	a	DET
brj-23306	57	11	variety	variety	NOUN
brj-23306	57	12	of	of	ADP
brj-23306	57	13	health	health	NOUN
brj-23306	57	14	concerns	concern	NOUN
brj-23306	57	15	,	,	PUNCT
brj-23306	57	16	including	include	VERB
brj-23306	57	17	digestive	digestive	ADJ
brj-23306	57	18	ailments	ailment	NOUN
brj-23306	57	19	and	and	CCONJ
brj-23306	57	20	skin	skin	NOUN
brj-23306	57	21	irritations	irritation	NOUN
brj-23306	57	22	(	(	PUNCT
brj-23306	57	23	anusooriya	anusooriya	NOUN
brj-23306	57	24	et	et	PROPN
brj-23306	57	25	al	al	PROPN
brj-23306	57	26	.	.	PROPN
brj-23306	57	27	2022	2022	NUM
brj-23306	57	28	)	)	PUNCT
brj-23306	57	29	.	.	PUNCT
brj-23306	58	1	considering	consider	VERB
brj-23306	58	2	the	the	DET
brj-23306	58	3	wide	wide	ADV
brj-23306	58	4	-	-	PUNCT
brj-23306	58	5	ranging	range	VERB
brj-23306	58	6	applications	application	NOUN
brj-23306	58	7	of	of	ADP
brj-23306	58	8	nanoparticles	nanoparticle	NOUN
brj-23306	58	9	,	,	PUNCT
brj-23306	58	10	it	it	PRON
brj-23306	58	11	is	be	AUX
brj-23306	58	12	hypothesized	hypothesize	VERB
brj-23306	58	13	that	that	SCONJ
brj-23306	58	14	agnps	agnps	PROPN
brj-23306	58	15	synthesized	synthesize	VERB
brj-23306	58	16	using	use	VERB
brj-23306	58	17	a.	a.	NOUN
brj-23306	58	18	purpurata	purpurata	PROPN
brj-23306	58	19	leaves	leave	NOUN
brj-23306	58	20	will	will	AUX
brj-23306	58	21	exhibit	exhibit	VERB
brj-23306	58	22	cytotoxic	cytotoxic	ADJ
brj-23306	58	23	activity	activity	NOUN
brj-23306	58	24	against	against	ADP
brj-23306	58	25	a549	a549	PROPN
brj-23306	58	26	and	and	CCONJ
brj-23306	58	27	pa1	pa1	PROPN
brj-23306	58	28	cancer	cancer	NOUN
brj-23306	58	29	cell	cell	NOUN
brj-23306	58	30	lines	line	NOUN
brj-23306	58	31	,	,	PUNCT
brj-23306	58	32	inducing	induce	VERB
brj-23306	58	33	apoptosis	apoptosis	NOUN
brj-23306	58	34	in	in	ADP
brj-23306	58	35	cancer	cancer	NOUN
brj-23306	58	36	cells	cell	NOUN
brj-23306	58	37	by	by	ADP
brj-23306	58	38	activating	activate	VERB
brj-23306	58	39	caspase	caspase	PROPN
brj-23306	58	40	3	3	X
brj-23306	58	41	.	.	PUNCT
brj-23306	59	1	also	also	ADV
brj-23306	59	2	,	,	PUNCT
brj-23306	59	3	the	the	DET
brj-23306	59	4	nanoparticles	nanoparticle	NOUN
brj-23306	59	5	are	be	AUX
brj-23306	59	6	evaluated	evaluate	VERB
brj-23306	59	7	for	for	ADP
brj-23306	59	8	antimicrobial	antimicrobial	ADJ
brj-23306	59	9	,	,	PUNCT
brj-23306	59	10	antibiofilm	antibiofilm	NOUN
brj-23306	59	11	,	,	PUNCT
brj-23306	59	12	dye	dye	NOUN
brj-23306	59	13	degradation	degradation	NOUN
brj-23306	59	14	,	,	PUNCT
brj-23306	59	15	and	and	CCONJ
brj-23306	59	16	larvicidal	larvicidal	ADJ
brj-23306	59	17	potentialities	potentiality	NOUN
brj-23306	59	18	.	.	PUNCT
brj-23306	60	1	experimental	experimental	ADJ
brj-23306	60	2	materials	material	NOUN
brj-23306	60	3	and	and	CCONJ
brj-23306	60	4	methods	method	NOUN
brj-23306	60	5	plant	plant	NOUN
brj-23306	60	6	collection	collection	NOUN
brj-23306	60	7	and	and	CCONJ
brj-23306	60	8	extract	extract	VERB
brj-23306	60	9	preparation	preparation	NOUN
brj-23306	60	10	a	a	DET
brj-23306	60	11	specimen	speciman	NOUN
brj-23306	60	12	of	of	ADP
brj-23306	60	13	a.	a.	NOUN
brj-23306	60	14	purpurata	purpurata	PROPN
brj-23306	60	15	was	be	AUX
brj-23306	60	16	collected	collect	VERB
brj-23306	60	17	from	from	ADP
brj-23306	60	18	kanyakumari	kanyakumari	PROPN
brj-23306	60	19	,	,	PUNCT
brj-23306	60	20	tamil	tamil	PROPN
brj-23306	60	21	nadu	nadu	PROPN
brj-23306	60	22	,	,	PUNCT
brj-23306	60	23	india	india	PROPN
brj-23306	60	24	,	,	PUNCT
brj-23306	60	25	and	and	CCONJ
brj-23306	60	26	its	its	PRON
brj-23306	60	27	authenticity	authenticity	NOUN
brj-23306	60	28	was	be	AUX
brj-23306	60	29	confirmed	confirm	VERB
brj-23306	60	30	by	by	ADP
brj-23306	60	31	dr	dr	PROPN
brj-23306	60	32	.	.	PROPN
brj-23306	60	33	g.v.s	g.v.s	PROPN
brj-23306	60	34	.	.	PUNCT
brj-23306	61	1	murthy	murthy	ADJ
brj-23306	61	2	,	,	PUNCT
brj-23306	61	3	director	director	NOUN
brj-23306	61	4	,	,	PUNCT
brj-23306	61	5	botanical	botanical	ADJ
brj-23306	61	6	survey	survey	NOUN
brj-23306	61	7	of	of	ADP
brj-23306	61	8	india	india	PROPN
brj-23306	61	9	,	,	PUNCT
brj-23306	61	10	tnau	tnau	PROPN
brj-23306	61	11	campus	campus	PROPN
brj-23306	61	12	,	,	PUNCT
brj-23306	61	13	coimbatore	coimbatore	PROPN
brj-23306	61	14	,	,	PUNCT
brj-23306	61	15	india	india	PROPN
brj-23306	61	16	.	.	PUNCT
brj-23306	62	1	to	to	PART
brj-23306	62	2	preserve	preserve	VERB
brj-23306	62	3	it	it	PRON
brj-23306	62	4	for	for	ADP
brj-23306	62	5	future	future	ADJ
brj-23306	62	6	reference	reference	NOUN
brj-23306	62	7	,	,	PUNCT
brj-23306	62	8	a	a	DET
brj-23306	62	9	voucher	voucher	ADJ
brj-23306	62	10	specimen	speciman	NOUN
brj-23306	62	11	was	be	AUX
brj-23306	62	12	archived	archive	VERB
brj-23306	62	13	in	in	ADP
brj-23306	62	14	the	the	DET
brj-23306	62	15	laboratory	laboratory	NOUN
brj-23306	62	16	under	under	ADP
brj-23306	62	17	the	the	DET
brj-23306	62	18	code	code	PROPN
brj-23306	62	19	bsi	bsi	PROPN
brj-23306	62	20	/	/	SYM
brj-23306	62	21	sc/5/23/10	sc/5/23/10	PROPN
brj-23306	62	22	-	-	PUNCT
brj-23306	62	23	11	11	NUM
brj-23306	62	24	/	/	SYM
brj-23306	62	25	tech	tech	NOUN
brj-23306	62	26	.	.	PUNCT
brj-23306	63	1	the	the	DET
brj-23306	63	2	leaves	leave	NOUN
brj-23306	63	3	of	of	ADP
brj-23306	63	4	a.	a.	NOUN
brj-23306	63	5	purpurata	purpurata	PROPN
brj-23306	63	6	were	be	AUX
brj-23306	63	7	collected	collect	VERB
brj-23306	63	8	,	,	PUNCT
brj-23306	63	9	dried	dry	VERB
brj-23306	63	10	in	in	ADP
brj-23306	63	11	the	the	DET
brj-23306	63	12	shade	shade	NOUN
brj-23306	63	13	,	,	PUNCT
brj-23306	63	14	and	and	CCONJ
brj-23306	63	15	then	then	ADV
brj-23306	63	16	ground	ground	VERB
brj-23306	63	17	into	into	ADP
brj-23306	63	18	a	a	DET
brj-23306	63	19	fine	fine	ADJ
brj-23306	63	20	powder	powder	NOUN
brj-23306	63	21	.	.	PUNCT
brj-23306	64	1	this	this	DET
brj-23306	64	2	powder	powder	NOUN
brj-23306	64	3	(	(	PUNCT
brj-23306	64	4	500	500	NUM
brj-23306	64	5	g	g	NOUN
brj-23306	64	6	)	)	PUNCT
brj-23306	64	7	was	be	AUX
brj-23306	64	8	subjected	subject	VERB
brj-23306	64	9	to	to	ADP
brj-23306	64	10	extraction	extraction	NOUN
brj-23306	64	11	with	with	ADP
brj-23306	64	12	water	water	NOUN
brj-23306	64	13	in	in	ADP
brj-23306	64	14	a	a	DET
brj-23306	64	15	2:10	2:10	NUM
brj-23306	64	16	(	(	PUNCT
brj-23306	64	17	weight	weight	NOUN
brj-23306	64	18	-	-	PUNCT
brj-23306	64	19	to	to	PART
brj-23306	64	20	volume	volume	VERB
brj-23306	64	21	)	)	PUNCT
brj-23306	64	22	ratio	ratio	NOUN
brj-23306	64	23	using	use	VERB
brj-23306	64	24	a	a	DET
brj-23306	64	25	soxhlet	soxhlet	ADJ
brj-23306	64	26	apparatus	apparatus	NOUN
brj-23306	64	27	for	for	ADP
brj-23306	64	28	72	72	NUM
brj-23306	64	29	h.	h.	NOUN
brj-23306	64	30	the	the	DET
brj-23306	64	31	resulting	result	VERB
brj-23306	64	32	extract	extract	NOUN
brj-23306	64	33	was	be	AUX
brj-23306	64	34	further	far	ADV
brj-23306	64	35	processed	process	VERB
brj-23306	64	36	by	by	ADP
brj-23306	64	37	a	a	DET
brj-23306	64	38	complete	complete	ADJ
brj-23306	64	39	drying	dry	VERB
brj-23306	64	40	process	process	NOUN
brj-23306	64	41	using	use	VERB
brj-23306	64	42	a	a	DET
brj-23306	64	43	rotary	rotary	ADJ
brj-23306	64	44	flash	flash	NOUN
brj-23306	64	45	evaporator	evaporator	NOUN
brj-23306	64	46	of	of	ADP
brj-23306	64	47	buchi	buchi	PROPN
brj-23306	64	48	type	type	NOUN
brj-23306	64	49	for	for	ADP
brj-23306	64	50	further	further	ADJ
brj-23306	64	51	purposes	purpose	NOUN
brj-23306	64	52	.	.	PUNCT
brj-23306	65	1	qualitative	qualitative	ADJ
brj-23306	65	2	phytochemical	phytochemical	ADJ
brj-23306	65	3	screening	screening	NOUN
brj-23306	65	4	the	the	DET
brj-23306	65	5	desiccated	desiccate	VERB
brj-23306	65	6	aqueous	aqueous	ADJ
brj-23306	65	7	extract	extract	NOUN
brj-23306	65	8	was	be	AUX
brj-23306	65	9	diluted	dilute	VERB
brj-23306	65	10	with	with	ADP
brj-23306	65	11	water	water	NOUN
brj-23306	65	12	and	and	CCONJ
brj-23306	65	13	subjected	subject	VERB
brj-23306	65	14	to	to	ADP
brj-23306	65	15	a	a	DET
brj-23306	65	16	qualitative	qualitative	ADJ
brj-23306	65	17	phytochemical	phytochemical	ADJ
brj-23306	65	18	analysis	analysis	NOUN
brj-23306	65	19	for	for	ADP
brj-23306	65	20	confirming	confirm	VERB
brj-23306	65	21	the	the	DET
brj-23306	65	22	presence	presence	NOUN
brj-23306	65	23	of	of	ADP
brj-23306	65	24	alkaloids	alkaloid	NOUN
brj-23306	65	25	,	,	PUNCT
brj-23306	65	26	flavonoids	flavonoid	NOUN
brj-23306	65	27	,	,	PUNCT
brj-23306	65	28	tannins	tannin	NOUN
brj-23306	65	29	,	,	PUNCT
brj-23306	65	30	phenols	phenol	NOUN
brj-23306	65	31	,	,	PUNCT
brj-23306	65	32	saponins	saponin	NOUN
brj-23306	65	33	,	,	PUNCT
brj-23306	65	34	terpenoids	terpenoid	NOUN
brj-23306	65	35	,	,	PUNCT
brj-23306	65	36	steroids	steroid	NOUN
brj-23306	65	37	,	,	PUNCT
brj-23306	65	38	and	and	CCONJ
brj-23306	65	39	glycosides	glycoside	NOUN
brj-23306	65	40	(	(	PUNCT
brj-23306	65	41	thotathil	thotathil	VERB
brj-23306	65	42	et	et	PROPN
brj-23306	65	43	al	al	PROPN
brj-23306	65	44	.	.	PROPN
brj-23306	65	45	2022	2022	NUM
brj-23306	65	46	)	)	PUNCT
brj-23306	65	47	.	.	PUNCT
brj-23306	66	1	test	test	NOUN
brj-23306	66	2	for	for	ADP
brj-23306	66	3	alkaloids	alkaloid	NOUN
brj-23306	66	4	the	the	DET
brj-23306	66	5	presence	presence	NOUN
brj-23306	66	6	of	of	ADP
brj-23306	66	7	a	a	DET
brj-23306	66	8	brownish	brownish	ADJ
brj-23306	66	9	-	-	PUNCT
brj-23306	66	10	red	red	ADJ
brj-23306	66	11	precipitate	precipitate	NOUN
brj-23306	66	12	after	after	ADP
brj-23306	66	13	adding	add	VERB
brj-23306	66	14	six	six	NUM
brj-23306	66	15	drops	drop	NOUN
brj-23306	66	16	of	of	ADP
brj-23306	66	17	dragendorff	dragendorff	NOUN
brj-23306	66	18	reagent	reagent	NOUN
brj-23306	66	19	to	to	ADP
brj-23306	66	20	1	1	NUM
brj-23306	66	21	ml	ml	NOUN
brj-23306	66	22	of	of	ADP
brj-23306	66	23	plant	plant	NOUN
brj-23306	66	24	extract	extract	NOUN
brj-23306	66	25	and	and	CCONJ
brj-23306	66	26	1	1	NUM
brj-23306	66	27	ml	ml	NOUN
brj-23306	66	28	of	of	ADP
brj-23306	66	29	1	1	NUM
brj-23306	66	30	%	%	NOUN
brj-23306	66	31	hcl	hcl	PROPN
brj-23306	66	32	indicates	indicate	VERB
brj-23306	66	33	the	the	DET
brj-23306	66	34	presence	presence	NOUN
brj-23306	66	35	of	of	ADP
brj-23306	66	36	alkaloids	alkaloid	NOUN
brj-23306	66	37	.	.	PUNCT
brj-23306	67	1	peer	peer	NOUN
brj-23306	67	2	-	-	PUNCT
brj-23306	67	3	reviewed	review	VERB
brj-23306	67	4	article	article	NOUN
brj-23306	67	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	67	6	raju	raju	PROPN
brj-23306	67	7	et	et	PROPN
brj-23306	67	8	al	al	PROPN
brj-23306	67	9	.	.	PROPN
brj-23306	68	1	(	(	PUNCT
brj-23306	68	2	2024	2024	NUM
brj-23306	68	3	)	)	PUNCT
brj-23306	68	4	.	.	PUNCT
brj-23306	69	1	“	"	PUNCT
brj-23306	69	2	ag	ag	PROPN
brj-23306	69	3	nanoparticles	nanoparticle	NOUN
brj-23306	69	4	from	from	ADP
brj-23306	69	5	leaves	leave	NOUN
brj-23306	69	6	,	,	PUNCT
brj-23306	69	7	”	"	PUNCT
brj-23306	69	8	bioresources	bioresource	NOUN
brj-23306	69	9	19(2	19(2	NUM
brj-23306	69	10	)	)	PUNCT
brj-23306	69	11	,	,	PUNCT
brj-23306	69	12	3328	3328	NUM
brj-23306	69	13	-	-	SYM
brj-23306	69	14	3352	3352	NUM
brj-23306	69	15	.	.	PUNCT
brj-23306	70	1	3331	3331	NUM
brj-23306	70	2	test	test	NOUN
brj-23306	70	3	for	for	ADP
brj-23306	70	4	steroids	steroid	NOUN
brj-23306	70	5	a	a	DET
brj-23306	70	6	blue	blue	ADJ
brj-23306	70	7	-	-	PUNCT
brj-23306	70	8	green	green	ADJ
brj-23306	70	9	ring	ring	NOUN
brj-23306	70	10	that	that	SCONJ
brj-23306	70	11	forms	form	NOUN
brj-23306	70	12	after	after	ADP
brj-23306	70	13	adding	add	VERB
brj-23306	70	14	equal	equal	ADJ
brj-23306	70	15	parts	part	NOUN
brj-23306	70	16	of	of	ADP
brj-23306	70	17	chloroform	chloroform	NOUN
brj-23306	70	18	and	and	CCONJ
brj-23306	70	19	acetic	acetic	ADJ
brj-23306	70	20	anhydride	anhydride	NOUN
brj-23306	70	21	to	to	ADP
brj-23306	70	22	1.0	1.0	NUM
brj-23306	70	23	ml	ml	NOUN
brj-23306	70	24	of	of	ADP
brj-23306	70	25	plant	plant	NOUN
brj-23306	70	26	extract	extract	NOUN
brj-23306	70	27	indicates	indicate	VERB
brj-23306	70	28	the	the	DET
brj-23306	70	29	presence	presence	NOUN
brj-23306	70	30	of	of	ADP
brj-23306	70	31	steroids	steroid	NOUN
brj-23306	70	32	.	.	PUNCT
brj-23306	71	1	flavonoids	flavonoid	NOUN
brj-23306	71	2	to	to	ADP
brj-23306	71	3	5	5	NUM
brj-23306	71	4	ml	ml	NOUN
brj-23306	71	5	of	of	ADP
brj-23306	71	6	diluted	diluted	ADJ
brj-23306	71	7	ammonia	ammonia	NOUN
brj-23306	71	8	solution	solution	NOUN
brj-23306	71	9	,	,	PUNCT
brj-23306	71	10	1.0	1.0	NUM
brj-23306	71	11	ml	ml	NOUN
brj-23306	71	12	of	of	ADP
brj-23306	71	13	concentrated	concentrated	ADJ
brj-23306	71	14	sulphuric	sulphuric	ADJ
brj-23306	71	15	acid	acid	NOUN
brj-23306	71	16	,	,	PUNCT
brj-23306	71	17	and	and	CCONJ
brj-23306	71	18	5	5	NUM
brj-23306	71	19	ml	ml	NOUN
brj-23306	71	20	of	of	ADP
brj-23306	71	21	plant	plant	NOUN
brj-23306	71	22	extract	extract	NOUN
brj-23306	71	23	were	be	AUX
brj-23306	71	24	added	add	VERB
brj-23306	71	25	.	.	PUNCT
brj-23306	72	1	yellow	yellow	ADJ
brj-23306	72	2	colour	colour	NOUN
brj-23306	72	3	formation	formation	NOUN
brj-23306	72	4	indicates	indicate	VERB
brj-23306	72	5	the	the	DET
brj-23306	72	6	presence	presence	NOUN
brj-23306	72	7	of	of	ADP
brj-23306	72	8	flavonoids	flavonoid	NOUN
brj-23306	72	9	.	.	PUNCT
brj-23306	73	1	tannins	tannin	VERB
brj-23306	73	2	a	a	DET
brj-23306	73	3	blue	blue	ADJ
brj-23306	73	4	-	-	PUNCT
brj-23306	73	5	black	black	ADJ
brj-23306	73	6	precipitate	precipitate	NOUN
brj-23306	73	7	formed	form	VERB
brj-23306	73	8	after	after	ADP
brj-23306	73	9	adding	add	VERB
brj-23306	73	10	a	a	DET
brj-23306	73	11	few	few	ADJ
brj-23306	73	12	drops	drop	NOUN
brj-23306	73	13	of	of	ADP
brj-23306	73	14	ferric	ferric	ADJ
brj-23306	73	15	chloride	chloride	NOUN
brj-23306	73	16	to	to	ADP
brj-23306	73	17	1.0	1.0	NUM
brj-23306	73	18	ml	ml	NOUN
brj-23306	73	19	of	of	ADP
brj-23306	73	20	plant	plant	NOUN
brj-23306	73	21	extract	extract	NOUN
brj-23306	73	22	showed	show	VERB
brj-23306	73	23	that	that	SCONJ
brj-23306	73	24	tannins	tannin	NOUN
brj-23306	73	25	were	be	AUX
brj-23306	73	26	present	present	ADJ
brj-23306	73	27	.	.	PUNCT
brj-23306	74	1	reducing	reduce	VERB
brj-23306	74	2	sugars	sugar	NOUN
brj-23306	74	3	a	a	DET
brj-23306	74	4	few	few	ADJ
brj-23306	74	5	drops	drop	NOUN
brj-23306	74	6	of	of	ADP
brj-23306	74	7	fehlings	fehling	NOUN
brj-23306	74	8	solutions	solution	NOUN
brj-23306	74	9	a	a	PRON
brj-23306	74	10	and	and	CCONJ
brj-23306	74	11	b	b	NOUN
brj-23306	74	12	were	be	AUX
brj-23306	74	13	added	add	VERB
brj-23306	74	14	to	to	ADP
brj-23306	74	15	1.0	1.0	NUM
brj-23306	74	16	ml	ml	NOUN
brj-23306	74	17	of	of	ADP
brj-23306	74	18	plant	plant	NOUN
brj-23306	74	19	extract	extract	VERB
brj-23306	74	20	orange	orange	ADJ
brj-23306	74	21	-	-	PUNCT
brj-23306	74	22	red	red	NOUN
brj-23306	74	23	precipitate	precipitate	NOUN
brj-23306	74	24	,	,	PUNCT
brj-23306	74	25	confirming	confirm	VERB
brj-23306	74	26	the	the	DET
brj-23306	74	27	presence	presence	NOUN
brj-23306	74	28	of	of	ADP
brj-23306	74	29	reducing	reduce	VERB
brj-23306	74	30	sugars	sugar	NOUN
brj-23306	74	31	.	.	PUNCT
brj-23306	75	1	cardiac	cardiac	ADJ
brj-23306	75	2	glycosides	glycoside	NOUN
brj-23306	75	3	a	a	DET
brj-23306	75	4	2	2	NUM
brj-23306	75	5	ml	ml	NOUN
brj-23306	75	6	of	of	ADP
brj-23306	75	7	sample	sample	NOUN
brj-23306	75	8	1	1	NUM
brj-23306	75	9	ml	ml	NOUN
brj-23306	75	10	of	of	ADP
brj-23306	75	11	glacial	glacial	ADJ
brj-23306	75	12	acetic	acetic	ADJ
brj-23306	75	13	acid	acid	NOUN
brj-23306	75	14	was	be	AUX
brj-23306	75	15	prepared	prepare	VERB
brj-23306	75	16	containing	contain	VERB
brj-23306	75	17	a	a	DET
brj-23306	75	18	few	few	ADJ
brj-23306	75	19	drops	drop	NOUN
brj-23306	75	20	of	of	ADP
brj-23306	75	21	fecl3	fecl3	PROPN
brj-23306	75	22	.	.	PUNCT
brj-23306	76	1	conc.h2so4	conc.h2so4	PROPN
brj-23306	76	2	was	be	AUX
brj-23306	76	3	added	add	VERB
brj-23306	76	4	to	to	ADP
brj-23306	76	5	the	the	DET
brj-23306	76	6	above	above	ADJ
brj-23306	76	7	mixture	mixture	NOUN
brj-23306	76	8	,	,	PUNCT
brj-23306	76	9	giving	give	VERB
brj-23306	76	10	a	a	DET
brj-23306	76	11	green	green	ADJ
brj-23306	76	12	-	-	PUNCT
brj-23306	76	13	blue	blue	ADJ
brj-23306	76	14	colour	colour	NOUN
brj-23306	76	15	and	and	CCONJ
brj-23306	76	16	indicating	indicate	VERB
brj-23306	76	17	the	the	DET
brj-23306	76	18	positive	positive	ADJ
brj-23306	76	19	results	result	NOUN
brj-23306	76	20	for	for	ADP
brj-23306	76	21	the	the	DET
brj-23306	76	22	presence	presence	NOUN
brj-23306	76	23	of	of	ADP
brj-23306	76	24	cardiac	cardiac	ADJ
brj-23306	76	25	glycosides	glycoside	NOUN
brj-23306	76	26	.	.	PUNCT
brj-23306	77	1	saponins	saponin	NOUN
brj-23306	77	2	to	to	ADP
brj-23306	77	3	1.0	1.0	NUM
brj-23306	77	4	ml	ml	NOUN
brj-23306	77	5	of	of	ADP
brj-23306	77	6	plant	plant	NOUN
brj-23306	77	7	extract	extract	NOUN
brj-23306	77	8	,	,	PUNCT
brj-23306	77	9	5	5	NUM
brj-23306	77	10	ml	ml	NOUN
brj-23306	77	11	of	of	ADP
brj-23306	77	12	distilled	distil	VERB
brj-23306	77	13	water	water	NOUN
brj-23306	77	14	was	be	AUX
brj-23306	77	15	added	add	VERB
brj-23306	77	16	,	,	PUNCT
brj-23306	77	17	and	and	CCONJ
brj-23306	77	18	the	the	DET
brj-23306	77	19	mixture	mixture	NOUN
brj-23306	77	20	was	be	AUX
brj-23306	77	21	violently	violently	ADV
brj-23306	77	22	agitated	agitated	ADJ
brj-23306	77	23	for	for	ADP
brj-23306	77	24	2	2	NUM
brj-23306	77	25	minutes	minute	NOUN
brj-23306	77	26	.	.	PUNCT
brj-23306	78	1	the	the	DET
brj-23306	78	2	development	development	NOUN
brj-23306	78	3	of	of	ADP
brj-23306	78	4	stable	stable	ADJ
brj-23306	78	5	foam	foam	NOUN
brj-23306	78	6	is	be	AUX
brj-23306	78	7	a	a	DET
brj-23306	78	8	sign	sign	NOUN
brj-23306	78	9	that	that	SCONJ
brj-23306	78	10	saponins	saponin	NOUN
brj-23306	78	11	are	be	AUX
brj-23306	78	12	present	present	ADJ
brj-23306	78	13	.	.	PUNCT
brj-23306	79	1	terpenoids	terpenoid	NOUN
brj-23306	79	2	2	2	NUM
brj-23306	79	3	ml	ml	NOUN
brj-23306	79	4	of	of	ADP
brj-23306	79	5	chloroform	chloroform	NOUN
brj-23306	79	6	and	and	CCONJ
brj-23306	79	7	3	3	NUM
brj-23306	79	8	ml	ml	NOUN
brj-23306	79	9	of	of	ADP
brj-23306	79	10	concentrated	concentrate	VERB
brj-23306	79	11	sulphuric	sulphuric	PROPN
brj-23306	79	12	acid	acid	NOUN
brj-23306	79	13	were	be	AUX
brj-23306	79	14	added	add	VERB
brj-23306	79	15	to	to	ADP
brj-23306	79	16	1.0	1.0	NUM
brj-23306	79	17	ml	ml	NOUN
brj-23306	79	18	of	of	ADP
brj-23306	79	19	plant	plant	NOUN
brj-23306	79	20	extract	extract	NOUN
brj-23306	79	21	.	.	PUNCT
brj-23306	80	1	the	the	DET
brj-23306	80	2	presence	presence	NOUN
brj-23306	80	3	of	of	ADP
brj-23306	80	4	terpenoids	terpenoid	NOUN
brj-23306	80	5	was	be	AUX
brj-23306	80	6	confirmed	confirm	VERB
brj-23306	80	7	by	by	ADP
brj-23306	80	8	reddish	reddish	ADJ
brj-23306	80	9	-	-	PUNCT
brj-23306	80	10	brown	brown	ADJ
brj-23306	80	11	colour	colour	NOUN
brj-23306	80	12	development	development	NOUN
brj-23306	80	13	.	.	PUNCT
brj-23306	81	1	green	green	ADJ
brj-23306	81	2	synthesis	synthesis	NOUN
brj-23306	81	3	of	of	ADP
brj-23306	81	4	agnps	agnps	PROPN
brj-23306	81	5	the	the	DET
brj-23306	81	6	aqueous	aqueous	ADJ
brj-23306	81	7	extract	extract	NOUN
brj-23306	81	8	of	of	ADP
brj-23306	81	9	a.	a.	NOUN
brj-23306	81	10	purpurata	purpurata	PROPN
brj-23306	81	11	was	be	AUX
brj-23306	81	12	mixed	mix	VERB
brj-23306	81	13	with	with	ADP
brj-23306	81	14	the	the	DET
brj-23306	81	15	freshly	freshly	ADV
brj-23306	81	16	prepared	prepare	VERB
brj-23306	81	17	silver	silver	NOUN
brj-23306	81	18	nitrate	nitrate	NOUN
brj-23306	81	19	solution	solution	NOUN
brj-23306	81	20	in	in	ADP
brj-23306	81	21	a	a	DET
brj-23306	81	22	1:1	1:1	NUM
brj-23306	81	23	ratio	ratio	NOUN
brj-23306	81	24	and	and	CCONJ
brj-23306	81	25	kept	keep	VERB
brj-23306	81	26	at	at	ADP
brj-23306	81	27	room	room	NOUN
brj-23306	81	28	temperature	temperature	NOUN
brj-23306	81	29	undisturbed	undisturbed	ADJ
brj-23306	81	30	.	.	PUNCT
brj-23306	82	1	after	after	ADP
brj-23306	82	2	24	24	NUM
brj-23306	82	3	h	h	NOUN
brj-23306	82	4	,	,	PUNCT
brj-23306	82	5	a	a	DET
brj-23306	82	6	noticeable	noticeable	ADJ
brj-23306	82	7	brownish	brownish	ADJ
brj-23306	82	8	coloration	coloration	NOUN
brj-23306	82	9	was	be	AUX
brj-23306	82	10	observed	observe	VERB
brj-23306	82	11	.	.	PUNCT
brj-23306	83	1	after	after	ADP
brj-23306	83	2	this	this	PRON
brj-23306	83	3	,	,	PUNCT
brj-23306	83	4	the	the	DET
brj-23306	83	5	mixture	mixture	NOUN
brj-23306	83	6	was	be	AUX
brj-23306	83	7	centrifuged	centrifuge	VERB
brj-23306	83	8	at	at	ADP
brj-23306	83	9	18,000	18,000	NUM
brj-23306	83	10	rpm	rpm	NOUN
brj-23306	83	11	for	for	ADP
brj-23306	83	12	20	20	NUM
brj-23306	83	13	min	min	NOUN
brj-23306	83	14	.	.	PUNCT
brj-23306	84	1	the	the	DET
brj-23306	84	2	resulting	result	VERB
brj-23306	84	3	pellet	pellet	NOUN
brj-23306	84	4	was	be	AUX
brj-23306	84	5	carefully	carefully	ADV
brj-23306	84	6	rinsed	rinse	VERB
brj-23306	84	7	with	with	ADP
brj-23306	84	8	double	double	ADJ
brj-23306	84	9	distilled	distil	VERB
brj-23306	84	10	water	water	NOUN
brj-23306	84	11	and	and	CCONJ
brj-23306	84	12	then	then	ADV
brj-23306	84	13	allowed	allow	VERB
brj-23306	84	14	to	to	PART
brj-23306	84	15	air	air	NOUN
brj-23306	84	16	-	-	PUNCT
brj-23306	84	17	dry	dry	ADJ
brj-23306	84	18	at	at	ADP
brj-23306	84	19	room	room	NOUN
brj-23306	84	20	temperature	temperature	NOUN
brj-23306	84	21	for	for	ADP
brj-23306	84	22	further	further	ADJ
brj-23306	84	23	characterization	characterization	NOUN
brj-23306	84	24	purposes	purpose	NOUN
brj-23306	84	25	(	(	PUNCT
brj-23306	84	26	vijay	vijay	NOUN
brj-23306	84	27	et	et	PROPN
brj-23306	84	28	al	al	PROPN
brj-23306	84	29	.	.	PROPN
brj-23306	84	30	2023	2023	NUM
brj-23306	84	31	)	)	PUNCT
brj-23306	84	32	.	.	PUNCT
brj-23306	85	1	agnps	agnps	ADJ
brj-23306	85	2	characterization	characterization	NOUN
brj-23306	85	3	ultraviolet	ultraviolet	NOUN
brj-23306	85	4	-	-	PUNCT
brj-23306	85	5	visible	visible	ADJ
brj-23306	85	6	(	(	PUNCT
brj-23306	85	7	uv	uv	NOUN
brj-23306	85	8	-	-	PUNCT
brj-23306	85	9	vis	vis	X
brj-23306	85	10	)	)	PUNCT
brj-23306	85	11	spectrophotometry	spectrophotometry	NOUN
brj-23306	85	12	(	(	PUNCT
brj-23306	85	13	thermo	thermo	PROPN
brj-23306	85	14	fisher	fisher	PROPN
brj-23306	85	15	evolution	evolution	PROPN
brj-23306	85	16	201	201	NUM
brj-23306	85	17	;	;	PUNCT
brj-23306	85	18	full	full	ADJ
brj-23306	85	19	thermo	thermo	NOUN
brj-23306	85	20	fisher	fisher	PROPN
brj-23306	85	21	scientific	scientific	PROPN
brj-23306	85	22	inc	inc	PROPN
brj-23306	85	23	.	.	PROPN
brj-23306	85	24	,	,	PUNCT
brj-23306	85	25	waltham	waltham	PROPN
brj-23306	85	26	,	,	PUNCT
brj-23306	85	27	ma	ma	PROPN
brj-23306	85	28	,	,	PUNCT
brj-23306	85	29	usa	usa	PROPN
brj-23306	85	30	)	)	PUNCT
brj-23306	85	31	analysis	analysis	NOUN
brj-23306	85	32	was	be	AUX
brj-23306	85	33	conducted	conduct	VERB
brj-23306	85	34	within	within	ADP
brj-23306	85	35	the	the	DET
brj-23306	85	36	wavelength	wavelength	NOUN
brj-23306	85	37	range	range	NOUN
brj-23306	85	38	of	of	ADP
brj-23306	85	39	200	200	NUM
brj-23306	85	40	to	to	PART
brj-23306	85	41	900	900	NUM
brj-23306	85	42	nm	nm	NOUN
brj-23306	85	43	.	.	PUNCT
brj-23306	86	1	fourier	fourier	PROPN
brj-23306	86	2	transform	transform	VERB
brj-23306	86	3	infrared	infrared	ADJ
brj-23306	86	4	(	(	PUNCT
brj-23306	86	5	ft	ft	NOUN
brj-23306	86	6	-	-	PUNCT
brj-23306	86	7	ir	ir	NOUN
brj-23306	86	8	)	)	PUNCT
brj-23306	86	9	analysis	analysis	NOUN
brj-23306	86	10	was	be	AUX
brj-23306	86	11	performed	perform	VERB
brj-23306	86	12	using	use	VERB
brj-23306	86	13	a	a	DET
brj-23306	86	14	shimatzu	shimatzu	NOUN
brj-23306	86	15	(	(	PUNCT
brj-23306	86	16	irtracer-100	irtracer-100	NOUN
brj-23306	86	17	;	;	PUNCT
brj-23306	86	18	shimadzu	shimadzu	PROPN
brj-23306	86	19	corporation	corporation	PROPN
brj-23306	86	20	,	,	PUNCT
brj-23306	86	21	kyoto	kyoto	PROPN
brj-23306	86	22	,	,	PUNCT
brj-23306	86	23	japan	japan	PROPN
brj-23306	86	24	)	)	PUNCT
brj-23306	86	25	spectrometer	spectrometer	NOUN
brj-23306	86	26	,	,	PUNCT
brj-23306	86	27	covering	cover	VERB
brj-23306	86	28	the	the	DET
brj-23306	86	29	spectral	spectral	ADJ
brj-23306	86	30	range	range	NOUN
brj-23306	86	31	4000	4000	NUM
brj-23306	86	32	to	to	ADP
brj-23306	86	33	400	400	NUM
brj-23306	86	34	cm-1	cm-1	NOUN
brj-23306	86	35	.	.	PUNCT
brj-23306	87	1	high	high	ADJ
brj-23306	87	2	-	-	PUNCT
brj-23306	87	3	resolution	resolution	NOUN
brj-23306	87	4	transmission	transmission	NOUN
brj-23306	87	5	electron	electron	NOUN
brj-23306	87	6	microscopy	microscopy	NOUN
brj-23306	87	7	(	(	PUNCT
brj-23306	87	8	hr	hr	NOUN
brj-23306	87	9	-	-	PUNCT
brj-23306	87	10	tem	tem	NOUN
brj-23306	87	11	)	)	PUNCT
brj-23306	87	12	(	(	PUNCT
brj-23306	87	13	jeol	jeol	PROPN
brj-23306	87	14	jem	jem	PROPN
brj-23306	87	15	2100	2100	NUM
brj-23306	87	16	high	high	ADJ
brj-23306	87	17	resolution	resolution	NOUN
brj-23306	87	18	transmission	transmission	NOUN
brj-23306	87	19	electron	electron	NOUN
brj-23306	87	20	microscope	microscope	NOUN
brj-23306	87	21	;	;	PUNCT
brj-23306	87	22	jeol	jeol	PROPN
brj-23306	87	23	ltd	ltd	PROPN
brj-23306	87	24	.	.	PROPN
brj-23306	87	25	,	,	PUNCT
brj-23306	87	26	akishima	akishima	PROPN
brj-23306	87	27	,	,	PUNCT
brj-23306	87	28	japan	japan	PROPN
brj-23306	87	29	)	)	PUNCT
brj-23306	87	30	analysis	analysis	NOUN
brj-23306	87	31	provided	provide	VERB
brj-23306	87	32	qualitative	qualitative	ADJ
brj-23306	87	33	measurements	measurement	NOUN
brj-23306	87	34	of	of	ADP
brj-23306	87	35	https://www.google.com/search?sca_esv=bd6b57e9623f4453&rlz=1c1gcea_enin1094in1094&q=waltham&si=akbgx_paacugddykux2hetjmr0_fgrox2azkvmitg2eqr2d-rqcciz_koo07oljeck_nqms7zmwtgcmt4h-rthkhv4k9wwwlz5et5jkmm-6yy2l5svfsdlcebhajxhyyvvmiccq3je8ujqa5n11t67cubgzwr4iexduonlrgrl0kex8hyxj_3dgp6z8r8fpewd1xyesg_sl8&sa=x&ved=2ahukewibtffq1s-eaxvwcwwghzhebr0qmxmoaxoecfkqaw	https://www.google.com/search?sca_esv=bd6b57e9623f4453&rlz=1c1gcea_enin1094in1094&q=waltham&si=akbgx_paacugddykux2hetjmr0_fgrox2azkvmitg2eqr2d-rqcciz_koo07oljeck_nqms7zmwtgcmt4h-rthkhv4k9wwwlz5et5jkmm-6yy2l5svfsdlcebhajxhyyvvmiccq3je8ujqa5n11t67cubgzwr4iexduonlrgrl0kex8hyxj_3dgp6z8r8fpewd1xyesg_sl8&sa=x&ved=2ahukewibtffq1s-eaxvwcwwghzhebr0qmxmoaxoecfkqaw	PROPN
brj-23306	87	36	peer	peer	NOUN
brj-23306	87	37	-	-	PUNCT
brj-23306	87	38	reviewed	review	VERB
brj-23306	87	39	article	article	NOUN
brj-23306	87	40	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	87	41	raju	raju	PROPN
brj-23306	87	42	et	et	PROPN
brj-23306	87	43	al	al	PROPN
brj-23306	87	44	.	.	PROPN
brj-23306	88	1	(	(	PUNCT
brj-23306	88	2	2024	2024	NUM
brj-23306	88	3	)	)	PUNCT
brj-23306	88	4	.	.	PUNCT
brj-23306	89	1	“	"	PUNCT
brj-23306	89	2	ag	ag	PROPN
brj-23306	89	3	nanoparticles	nanoparticle	NOUN
brj-23306	89	4	from	from	ADP
brj-23306	89	5	leaves	leave	NOUN
brj-23306	89	6	,	,	PUNCT
brj-23306	89	7	”	"	PUNCT
brj-23306	89	8	bioresources	bioresource	NOUN
brj-23306	89	9	19(2	19(2	NUM
brj-23306	89	10	)	)	PUNCT
brj-23306	89	11	,	,	PUNCT
brj-23306	89	12	3328	3328	NUM
brj-23306	89	13	-	-	SYM
brj-23306	89	14	3352	3352	NUM
brj-23306	89	15	.	.	PUNCT
brj-23306	89	16	3332	3332	NUM
brj-23306	89	17	the	the	DET
brj-23306	89	18	synthesized	synthesize	VERB
brj-23306	89	19	nanoparticles	nanoparticle	NOUN
brj-23306	89	20	,	,	PUNCT
brj-23306	89	21	including	include	VERB
brj-23306	89	22	particle	particle	NOUN
brj-23306	89	23	size	size	NOUN
brj-23306	89	24	,	,	PUNCT
brj-23306	89	25	distribution	distribution	NOUN
brj-23306	89	26	,	,	PUNCT
brj-23306	89	27	and	and	CCONJ
brj-23306	89	28	morphology	morphology	NOUN
brj-23306	89	29	.	.	PUNCT
brj-23306	90	1	energy	energy	NOUN
brj-23306	90	2	dispersive	dispersive	ADJ
brj-23306	90	3	microanalysis	microanalysis	NOUN
brj-23306	90	4	(	(	PUNCT
brj-23306	90	5	edx	edx	NOUN
brj-23306	90	6	)	)	PUNCT
brj-23306	90	7	techniques	technique	NOUN
brj-23306	90	8	were	be	AUX
brj-23306	90	9	used	use	VERB
brj-23306	90	10	to	to	PART
brj-23306	90	11	verify	verify	VERB
brj-23306	90	12	the	the	DET
brj-23306	90	13	presence	presence	NOUN
brj-23306	90	14	of	of	ADP
brj-23306	90	15	silver	silver	NOUN
brj-23306	90	16	as	as	ADV
brj-23306	90	17	well	well	ADV
brj-23306	90	18	as	as	ADP
brj-23306	90	19	other	other	ADJ
brj-23306	90	20	metal	metal	NOUN
brj-23306	90	21	elements	element	NOUN
brj-23306	90	22	within	within	ADP
brj-23306	90	23	the	the	DET
brj-23306	90	24	synthesized	synthesize	VERB
brj-23306	90	25	nanoparticles	nanoparticle	NOUN
brj-23306	90	26	(	(	PUNCT
brj-23306	90	27	jeol	jeol	PROPN
brj-23306	90	28	jem	jem	PROPN
brj-23306	90	29	2100	2100	NUM
brj-23306	90	30	high	high	ADJ
brj-23306	90	31	resolution	resolution	NOUN
brj-23306	90	32	transmission	transmission	NOUN
brj-23306	90	33	electron	electron	NOUN
brj-23306	90	34	microscope	microscope	NOUN
brj-23306	90	35	;	;	PUNCT
brj-23306	90	36	jeol	jeol	PROPN
brj-23306	90	37	ltd	ltd	PROPN
brj-23306	90	38	.	.	PROPN
brj-23306	90	39	,	,	PUNCT
brj-23306	90	40	akishima	akishima	PROPN
brj-23306	90	41	,	,	PUNCT
brj-23306	90	42	japan	japan	PROPN
brj-23306	90	43	)	)	PUNCT
brj-23306	90	44	.	.	PUNCT
brj-23306	91	1	cytotoxic	cytotoxic	ADJ
brj-23306	91	2	activity	activity	NOUN
brj-23306	91	3	lung	lung	NOUN
brj-23306	91	4	cancer	cancer	NOUN
brj-23306	91	5	cell	cell	NOUN
brj-23306	91	6	line	line	NOUN
brj-23306	91	7	(	(	PUNCT
brj-23306	91	8	a549	a549	PROPN
brj-23306	91	9	)	)	PUNCT
brj-23306	91	10	and	and	CCONJ
brj-23306	91	11	ovarian	ovarian	ADJ
brj-23306	91	12	cancer	cancer	NOUN
brj-23306	91	13	cell	cell	NOUN
brj-23306	91	14	line	line	NOUN
brj-23306	91	15	(	(	PUNCT
brj-23306	91	16	pa1	pa1	NOUN
brj-23306	91	17	)	)	PUNCT
brj-23306	91	18	cells	cell	NOUN
brj-23306	91	19	were	be	AUX
brj-23306	91	20	purchased	purchase	VERB
brj-23306	91	21	from	from	ADP
brj-23306	91	22	the	the	DET
brj-23306	91	23	national	national	ADJ
brj-23306	91	24	center	center	NOUN
brj-23306	91	25	for	for	ADP
brj-23306	91	26	cell	cell	NOUN
brj-23306	91	27	science	science	NOUN
brj-23306	91	28	,	,	PUNCT
brj-23306	91	29	pune	pune	NOUN
brj-23306	91	30	(	(	PUNCT
brj-23306	91	31	india	india	PROPN
brj-23306	91	32	)	)	PUNCT
brj-23306	91	33	.	.	PUNCT
brj-23306	92	1	the	the	DET
brj-23306	92	2	cytotoxicity	cytotoxicity	NOUN
brj-23306	92	3	of	of	ADP
brj-23306	92	4	agnps	agnps	PROPN
brj-23306	92	5	on	on	ADP
brj-23306	92	6	both	both	DET
brj-23306	92	7	a549	a549	PROPN
brj-23306	92	8	and	and	CCONJ
brj-23306	92	9	pa1	pa1	NOUN
brj-23306	92	10	cells	cell	NOUN
brj-23306	92	11	was	be	AUX
brj-23306	92	12	evaluated	evaluate	VERB
brj-23306	92	13	using	use	VERB
brj-23306	92	14	the	the	DET
brj-23306	92	15	mtt	mtt	NOUN
brj-23306	92	16	assay	assay	NOUN
brj-23306	92	17	(	(	PUNCT
brj-23306	92	18	mosmann	mosmann	NOUN
brj-23306	92	19	1983	1983	NUM
brj-23306	92	20	)	)	PUNCT
brj-23306	92	21	.	.	PUNCT
brj-23306	93	1	for	for	ADP
brj-23306	93	2	this	this	DET
brj-23306	93	3	assay	assay	NOUN
brj-23306	93	4	,	,	PUNCT
brj-23306	93	5	cells	cell	NOUN
brj-23306	93	6	were	be	AUX
brj-23306	93	7	seeded	seed	VERB
brj-23306	93	8	at	at	ADP
brj-23306	93	9	a	a	DET
brj-23306	93	10	density	density	NOUN
brj-23306	93	11	of	of	ADP
brj-23306	93	12	1	1	NUM
brj-23306	93	13	×	×	NOUN
brj-23306	93	14	105	105	NUM
brj-23306	93	15	cells	cell	NOUN
brj-23306	93	16	per	per	ADP
brj-23306	93	17	well	well	ADV
brj-23306	93	18	in	in	ADP
brj-23306	93	19	96	96	NUM
brj-23306	93	20	-	-	PUNCT
brj-23306	93	21	well	well	NOUN
brj-23306	93	22	plates	plate	NOUN
brj-23306	93	23	,	,	PUNCT
brj-23306	93	24	with	with	ADP
brj-23306	93	25	each	each	DET
brj-23306	93	26	well	well	NOUN
brj-23306	93	27	containing	contain	VERB
brj-23306	93	28	0.2	0.2	NUM
brj-23306	93	29	ml	ml	NOUN
brj-23306	93	30	of	of	ADP
brj-23306	93	31	medium	medium	NOUN
brj-23306	93	32	.	.	PUNCT
brj-23306	94	1	these	these	DET
brj-23306	94	2	plates	plate	NOUN
brj-23306	94	3	were	be	AUX
brj-23306	94	4	then	then	ADV
brj-23306	94	5	placed	place	VERB
brj-23306	94	6	in	in	ADP
brj-23306	94	7	a	a	DET
brj-23306	94	8	5	5	NUM
brj-23306	94	9	%	%	NOUN
brj-23306	94	10	co2	co2	NOUN
brj-23306	94	11	environment	environment	NOUN
brj-23306	94	12	for	for	ADP
brj-23306	94	13	72	72	NUM
brj-23306	94	14	h.	h.	NOUN
brj-23306	94	15	after	after	ADP
brj-23306	94	16	the	the	DET
brj-23306	94	17	initial	initial	ADJ
brj-23306	94	18	incubation	incubation	NOUN
brj-23306	94	19	,	,	PUNCT
brj-23306	94	20	varying	vary	VERB
brj-23306	94	21	concentrations	concentration	NOUN
brj-23306	94	22	of	of	ADP
brj-23306	94	23	agnps	agnps	PROPN
brj-23306	94	24	,	,	PUNCT
brj-23306	94	25	each	each	PRON
brj-23306	94	26	with	with	ADP
brj-23306	94	27	0.1	0.1	NUM
brj-23306	94	28	%	%	NOUN
brj-23306	94	29	dimethyl	dimethyl	NOUN
brj-23306	94	30	sulfoxide	sulfoxide	NOUN
brj-23306	94	31	(	(	PUNCT
brj-23306	94	32	dmso	dmso	NOUN
brj-23306	94	33	)	)	PUNCT
brj-23306	94	34	,	,	PUNCT
brj-23306	94	35	were	be	AUX
brj-23306	94	36	introduced	introduce	VERB
brj-23306	94	37	into	into	ADP
brj-23306	94	38	the	the	DET
brj-23306	94	39	wells	well	NOUN
brj-23306	94	40	and	and	CCONJ
brj-23306	94	41	incubated	incubate	VERB
brj-23306	94	42	for	for	ADP
brj-23306	94	43	an	an	DET
brj-23306	94	44	additional	additional	ADJ
brj-23306	94	45	48	48	NUM
brj-23306	94	46	h	h	NOUN
brj-23306	94	47	in	in	ADP
brj-23306	94	48	the	the	DET
brj-23306	94	49	presence	presence	NOUN
brj-23306	94	50	of	of	ADP
brj-23306	94	51	5	5	NUM
brj-23306	94	52	%	%	NOUN
brj-23306	94	53	co2	co2	NOUN
brj-23306	94	54	.	.	PUNCT
brj-23306	95	1	cell	cell	NOUN
brj-23306	95	2	images	image	NOUN
brj-23306	95	3	were	be	AUX
brj-23306	95	4	captured	capture	VERB
brj-23306	95	5	using	use	VERB
brj-23306	95	6	an	an	DET
brj-23306	95	7	inverted	inverted	ADJ
brj-23306	95	8	microscope	microscope	NOUN
brj-23306	95	9	(	(	PUNCT
brj-23306	95	10	ix53	ix53	PROPN
brj-23306	95	11	;	;	PUNCT
brj-23306	95	12	olympus	olympus	PROPN
brj-23306	95	13	corporation	corporation	NOUN
brj-23306	95	14	,	,	PUNCT
brj-23306	95	15	shinjuku	shinjuku	PROPN
brj-23306	95	16	city	city	PROPN
brj-23306	95	17	,	,	PUNCT
brj-23306	95	18	japan	japan	PROPN
brj-23306	95	19	)	)	PUNCT
brj-23306	95	20	at	at	ADP
brj-23306	95	21	40x	40x	NOUN
brj-23306	95	22	magnification	magnification	NOUN
brj-23306	95	23	,	,	PUNCT
brj-23306	95	24	and	and	CCONJ
brj-23306	95	25	photographs	photograph	NOUN
brj-23306	95	26	were	be	AUX
brj-23306	95	27	taken	take	VERB
brj-23306	95	28	.	.	PUNCT
brj-23306	96	1	following	follow	VERB
brj-23306	96	2	the	the	DET
brj-23306	96	3	removal	removal	NOUN
brj-23306	96	4	of	of	ADP
brj-23306	96	5	the	the	DET
brj-23306	96	6	sample	sample	NOUN
brj-23306	96	7	solutions	solution	NOUN
brj-23306	96	8	,	,	PUNCT
brj-23306	96	9	a	a	DET
brj-23306	96	10	solution	solution	NOUN
brj-23306	96	11	containing	contain	VERB
brj-23306	96	12	3-(4,5	3-(4,5	PROPN
brj-23306	96	13	-	-	PUNCT
brj-23306	96	14	dimethyl-2	dimethyl-2	PROPN
brj-23306	96	15	-	-	PUNCT
brj-23306	96	16	thiazolyl)-2,5	thiazolyl)-2,5	NOUN
brj-23306	96	17	-	-	PUNCT
brj-23306	96	18	diphenyl	diphenyl	NOUN
brj-23306	96	19	-	-	PUNCT
brj-23306	96	20	tetrazolium	tetrazolium	NOUN
brj-23306	96	21	bromide	bromide	NOUN
brj-23306	96	22	(	(	PUNCT
brj-23306	96	23	mtt	mtt	NOUN
brj-23306	96	24	)	)	PUNCT
brj-23306	96	25	at	at	ADP
brj-23306	96	26	a	a	DET
brj-23306	96	27	concentration	concentration	NOUN
brj-23306	96	28	of	of	ADP
brj-23306	96	29	5	5	NUM
brj-23306	96	30	mg	mg	NOUN
brj-23306	96	31	/	/	SYM
brj-23306	96	32	ml	ml	NOUN
brj-23306	96	33	in	in	ADP
brj-23306	96	34	phosphate	phosphate	NOUN
brj-23306	96	35	-	-	PUNCT
brj-23306	96	36	buffered	buffer	VERB
brj-23306	96	37	saline	saline	NOUN
brj-23306	96	38	(	(	PUNCT
brj-23306	96	39	pbs	pbs	PROPN
brj-23306	96	40	)	)	PUNCT
brj-23306	96	41	solution	solution	NOUN
brj-23306	96	42	(	(	PUNCT
brj-23306	96	43	20	20	NUM
brj-23306	96	44	µl	µl	PART
brj-23306	96	45	/	/	SYM
brj-23306	96	46	well	well	NOUN
brj-23306	96	47	)	)	PUNCT
brj-23306	96	48	was	be	AUX
brj-23306	96	49	added	add	VERB
brj-23306	96	50	.	.	PUNCT
brj-23306	97	1	after	after	ADP
brj-23306	97	2	4	4	NUM
brj-23306	97	3	h	h	NOUN
brj-23306	97	4	,	,	PUNCT
brj-23306	97	5	1	1	NUM
brj-23306	97	6	ml	ml	NOUN
brj-23306	97	7	of	of	ADP
brj-23306	97	8	dmso	dmso	NOUN
brj-23306	97	9	was	be	AUX
brj-23306	97	10	added	add	VERB
brj-23306	97	11	to	to	ADP
brj-23306	97	12	each	each	DET
brj-23306	97	13	well	well	ADV
brj-23306	97	14	.	.	PUNCT
brj-23306	98	1	the	the	DET
brj-23306	98	2	quantification	quantification	NOUN
brj-23306	98	3	of	of	ADP
brj-23306	98	4	viable	viable	ADJ
brj-23306	98	5	cells	cell	NOUN
brj-23306	98	6	was	be	AUX
brj-23306	98	7	achieved	achieve	VERB
brj-23306	98	8	by	by	ADP
brj-23306	98	9	measuring	measure	VERB
brj-23306	98	10	the	the	DET
brj-23306	98	11	absorbance	absorbance	NOUN
brj-23306	98	12	at	at	ADP
brj-23306	98	13	540	540	NUM
brj-23306	98	14	nm	nm	NOUN
brj-23306	98	15	.	.	PUNCT
brj-23306	99	1	subsequently	subsequently	ADV
brj-23306	99	2	,	,	PUNCT
brj-23306	99	3	measurements	measurement	NOUN
brj-23306	99	4	were	be	AUX
brj-23306	99	5	conducted	conduct	VERB
brj-23306	99	6	,	,	PUNCT
brj-23306	99	7	and	and	CCONJ
brj-23306	99	8	the	the	DET
brj-23306	99	9	concentration	concentration	NOUN
brj-23306	99	10	required	require	VERB
brj-23306	99	11	to	to	PART
brj-23306	99	12	achieve	achieve	VERB
brj-23306	99	13	a	a	DET
brj-23306	99	14	50	50	NUM
brj-23306	99	15	%	%	NOUN
brj-23306	99	16	inhibition	inhibition	NOUN
brj-23306	99	17	of	of	ADP
brj-23306	99	18	cell	cell	NOUN
brj-23306	99	19	viability	viability	NOUN
brj-23306	99	20	(	(	PUNCT
brj-23306	99	21	ic50	ic50	PROPN
brj-23306	99	22	)	)	PUNCT
brj-23306	99	23	was	be	AUX
brj-23306	99	24	determined	determine	VERB
brj-23306	99	25	through	through	ADP
brj-23306	99	26	graphical	graphical	ADJ
brj-23306	99	27	analysis	analysis	NOUN
brj-23306	99	28	.	.	PUNCT
brj-23306	100	1	flow	flow	NOUN
brj-23306	100	2	cytometry	cytometry	PROPN
brj-23306	100	3	initially	initially	ADV
brj-23306	100	4	,	,	PUNCT
brj-23306	100	5	the	the	DET
brj-23306	100	6	cells	cell	NOUN
brj-23306	100	7	were	be	AUX
brj-23306	100	8	cultured	cultured	ADJ
brj-23306	100	9	in	in	ADP
brj-23306	100	10	t25	t25	NOUN
brj-23306	100	11	or	or	CCONJ
brj-23306	100	12	t75	t75	NOUN
brj-23306	100	13	culture	culture	NOUN
brj-23306	100	14	flasks	flask	NOUN
brj-23306	100	15	.	.	PUNCT
brj-23306	101	1	upon	upon	SCONJ
brj-23306	101	2	reaching	reach	VERB
brj-23306	101	3	confluence	confluence	NOUN
brj-23306	101	4	,	,	PUNCT
brj-23306	101	5	the	the	DET
brj-23306	101	6	cells	cell	NOUN
brj-23306	101	7	were	be	AUX
brj-23306	101	8	transferred	transfer	VERB
brj-23306	101	9	to	to	ADP
brj-23306	101	10	6	6	NUM
brj-23306	101	11	-	-	PUNCT
brj-23306	101	12	well	well	ADV
brj-23306	101	13	adherent	adherent	ADJ
brj-23306	101	14	culture	culture	NOUN
brj-23306	101	15	plates	plate	NOUN
brj-23306	101	16	.	.	PUNCT
brj-23306	102	1	after	after	ADP
brj-23306	102	2	24	24	NUM
brj-23306	102	3	h	h	NOUN
brj-23306	102	4	,	,	PUNCT
brj-23306	102	5	the	the	DET
brj-23306	102	6	cells	cell	NOUN
brj-23306	102	7	were	be	AUX
brj-23306	102	8	treated	treat	VERB
brj-23306	102	9	with	with	ADP
brj-23306	102	10	the	the	DET
brj-23306	102	11	ic50	ic50	PROPN
brj-23306	102	12	concentration	concentration	NOUN
brj-23306	102	13	of	of	ADP
brj-23306	102	14	agnps	agnps	PROPN
brj-23306	102	15	for	for	ADP
brj-23306	102	16	an	an	DET
brj-23306	102	17	additional	additional	ADJ
brj-23306	102	18	24	24	NUM
brj-23306	102	19	h.	h.	NOUN
brj-23306	102	20	to	to	PART
brj-23306	102	21	harvest	harvest	VERB
brj-23306	102	22	the	the	DET
brj-23306	102	23	cells	cell	NOUN
brj-23306	102	24	,	,	PUNCT
brj-23306	102	25	trypsinization	trypsinization	NOUN
brj-23306	102	26	was	be	AUX
brj-23306	102	27	carried	carry	VERB
brj-23306	102	28	out	out	ADP
brj-23306	102	29	using	use	VERB
brj-23306	102	30	a	a	DET
brj-23306	102	31	trypsin	trypsin	NOUN
brj-23306	102	32	(	(	PUNCT
brj-23306	102	33	0.05%)-edta	0.05%)-edta	NOUN
brj-23306	102	34	(	(	PUNCT
brj-23306	102	35	0.54	0.54	NUM
brj-23306	102	36	mm	mm	NOUN
brj-23306	102	37	)	)	PUNCT
brj-23306	102	38	solution	solution	NOUN
brj-23306	102	39	.	.	PUNCT
brj-23306	103	1	the	the	DET
brj-23306	103	2	cells	cell	NOUN
brj-23306	103	3	were	be	AUX
brj-23306	103	4	then	then	ADV
brj-23306	103	5	washed	wash	VERB
brj-23306	103	6	thoroughly	thoroughly	ADV
brj-23306	103	7	with	with	ADP
brj-23306	103	8	culture	culture	NOUN
brj-23306	103	9	media	medium	NOUN
brj-23306	103	10	through	through	ADP
brj-23306	103	11	vortexing	vortexing	NOUN
brj-23306	103	12	,	,	PUNCT
brj-23306	103	13	followed	follow	VERB
brj-23306	103	14	by	by	ADP
brj-23306	103	15	centrifugation	centrifugation	NOUN
brj-23306	103	16	at	at	ADP
brj-23306	103	17	1200	1200	NUM
brj-23306	103	18	rpm	rpm	NOUN
brj-23306	103	19	for	for	ADP
brj-23306	103	20	5	5	NUM
brj-23306	103	21	min	min	NOUN
brj-23306	103	22	.	.	PROPN
brj-23306	104	1	this	this	PRON
brj-23306	104	2	was	be	AUX
brj-23306	104	3	followed	follow	VERB
brj-23306	104	4	by	by	ADP
brj-23306	104	5	a	a	DET
brj-23306	104	6	wash	wash	NOUN
brj-23306	104	7	with	with	ADP
brj-23306	104	8	pbs	pbs	PROPN
brj-23306	104	9	and	and	CCONJ
brj-23306	104	10	centrifugation	centrifugation	NOUN
brj-23306	104	11	at	at	ADP
brj-23306	104	12	1200	1200	NUM
brj-23306	104	13	rpm	rpm	NOUN
brj-23306	104	14	for	for	ADP
brj-23306	104	15	5	5	NUM
brj-23306	104	16	min	min	NOUN
brj-23306	104	17	.	.	PUNCT
brj-23306	105	1	the	the	DET
brj-23306	105	2	supernatant	supernatant	NOUN
brj-23306	105	3	was	be	AUX
brj-23306	105	4	discarded	discard	VERB
brj-23306	105	5	,	,	PUNCT
brj-23306	105	6	and	and	CCONJ
brj-23306	105	7	the	the	DET
brj-23306	105	8	pellet	pellet	NOUN
brj-23306	105	9	was	be	AUX
brj-23306	105	10	resuspended	resuspend	VERB
brj-23306	105	11	in	in	ADP
brj-23306	105	12	300	300	NUM
brj-23306	105	13	µl	µl	NOUN
brj-23306	105	14	of	of	ADP
brj-23306	105	15	pbs	pbs	PROPN
brj-23306	105	16	within	within	ADP
brj-23306	105	17	a	a	DET
brj-23306	105	18	falcon	falcon	NOUN
brj-23306	105	19	tube	tube	NOUN
brj-23306	105	20	.	.	PUNCT
brj-23306	106	1	subsequently	subsequently	ADV
brj-23306	106	2	,	,	PUNCT
brj-23306	106	3	700	700	NUM
brj-23306	106	4	µl	µl	NOUN
brj-23306	106	5	of	of	ADP
brj-23306	106	6	ice	ice	NOUN
brj-23306	106	7	-	-	PUNCT
brj-23306	106	8	cold	cold	ADJ
brj-23306	106	9	100	100	NUM
brj-23306	106	10	%	%	NOUN
brj-23306	106	11	ethanol	ethanol	NOUN
brj-23306	106	12	was	be	AUX
brj-23306	106	13	added	add	VERB
brj-23306	106	14	to	to	PART
brj-23306	106	15	fix	fix	VERB
brj-23306	106	16	the	the	DET
brj-23306	106	17	cells	cell	NOUN
brj-23306	106	18	.	.	PUNCT
brj-23306	107	1	the	the	DET
brj-23306	107	2	ethanol	ethanol	NOUN
brj-23306	107	3	-	-	PUNCT
brj-23306	107	4	fixed	fix	VERB
brj-23306	107	5	cells	cell	NOUN
brj-23306	107	6	were	be	AUX
brj-23306	107	7	washed	wash	VERB
brj-23306	107	8	twice	twice	ADV
brj-23306	107	9	with	with	ADP
brj-23306	107	10	pbs	pbs	PROPN
brj-23306	107	11	,	,	PUNCT
brj-23306	107	12	and	and	CCONJ
brj-23306	107	13	the	the	DET
brj-23306	107	14	supernatant	supernatant	NOUN
brj-23306	107	15	was	be	AUX
brj-23306	107	16	removed	remove	VERB
brj-23306	107	17	.	.	PUNCT
brj-23306	108	1	triton	triton	PROPN
brj-23306	108	2	x-100	x-100	PROPN
brj-23306	109	1	(	(	PUNCT
brj-23306	109	2	556	556	NUM
brj-23306	109	3	µl	µl	NOUN
brj-23306	109	4	at	at	ADP
brj-23306	109	5	0.5	0.5	NUM
brj-23306	109	6	%	%	NOUN
brj-23306	109	7	)	)	PUNCT
brj-23306	109	8	,	,	PUNCT
brj-23306	109	9	containing	contain	VERB
brj-23306	109	10	rnase	rnase	NOUN
brj-23306	109	11	(	(	PUNCT
brj-23306	109	12	20	20	NUM
brj-23306	109	13	µl	µl	NOUN
brj-23306	109	14	at	at	ADP
brj-23306	109	15	0.1	0.1	NUM
brj-23306	109	16	mg	mg	PROPN
brj-23306	109	17	/	/	SYM
brj-23306	109	18	ml	ml	NOUN
brj-23306	109	19	)	)	PUNCT
brj-23306	109	20	,	,	PUNCT
brj-23306	109	21	was	be	AUX
brj-23306	109	22	added	add	VERB
brj-23306	109	23	and	and	CCONJ
brj-23306	109	24	incubated	incubate	VERB
brj-23306	109	25	for	for	ADP
brj-23306	109	26	1	1	NUM
brj-23306	109	27	h.	h.	NOUN
brj-23306	109	28	after	after	ADP
brj-23306	109	29	that	that	PRON
brj-23306	109	30	,	,	PUNCT
brj-23306	109	31	24	24	NUM
brj-23306	109	32	µl	µl	NOUN
brj-23306	109	33	of	of	ADP
brj-23306	109	34	propidium	propidium	NOUN
brj-23306	109	35	iodide	iodide	NOUN
brj-23306	109	36	(	(	PUNCT
brj-23306	109	37	at	at	ADP
brj-23306	109	38	a	a	DET
brj-23306	109	39	concentration	concentration	NOUN
brj-23306	109	40	of	of	ADP
brj-23306	109	41	40	40	NUM
brj-23306	109	42	µg	µg	NOUN
brj-23306	109	43	/	/	SYM
brj-23306	109	44	ml	ml	NOUN
brj-23306	109	45	)	)	PUNCT
brj-23306	109	46	was	be	AUX
brj-23306	109	47	added	add	VERB
brj-23306	109	48	and	and	CCONJ
brj-23306	109	49	incubated	incubate	VERB
brj-23306	109	50	further	far	ADV
brj-23306	109	51	in	in	ADP
brj-23306	109	52	the	the	DET
brj-23306	109	53	dark	dark	NOUN
brj-23306	109	54	for	for	ADP
brj-23306	109	55	45	45	NUM
brj-23306	109	56	min	min	NOUN
brj-23306	109	57	(	(	PUNCT
brj-23306	109	58	plotnikov	plotnikov	PROPN
brj-23306	109	59	et	et	PROPN
brj-23306	109	60	al	al	PROPN
brj-23306	109	61	.	.	PROPN
brj-23306	109	62	2023	2023	NUM
brj-23306	109	63	)	)	PUNCT
brj-23306	109	64	.	.	PUNCT
brj-23306	110	1	the	the	DET
brj-23306	110	2	samples	sample	NOUN
brj-23306	110	3	were	be	AUX
brj-23306	110	4	then	then	ADV
brj-23306	110	5	analyzed	analyze	VERB
brj-23306	110	6	using	use	VERB
brj-23306	110	7	a	a	DET
brj-23306	110	8	flow	flow	NOUN
brj-23306	110	9	cytometer	cytometer	NOUN
brj-23306	110	10	.	.	PUNCT
brj-23306	111	1	dna	dna	PROPN
brj-23306	111	2	fragmentation	fragmentation	NOUN
brj-23306	111	3	analysis	analysis	NOUN
brj-23306	111	4	cancer	cancer	NOUN
brj-23306	111	5	cells	cell	NOUN
brj-23306	111	6	(	(	PUNCT
brj-23306	111	7	a549	a549	PROPN
brj-23306	111	8	and	and	CCONJ
brj-23306	111	9	pa1	pa1	PROPN
brj-23306	111	10	)	)	PUNCT
brj-23306	111	11	were	be	AUX
brj-23306	111	12	seeded	seed	VERB
brj-23306	111	13	in	in	ADP
brj-23306	111	14	12	12	NUM
brj-23306	111	15	-	-	PUNCT
brj-23306	111	16	well	well	NOUN
brj-23306	111	17	plates	plate	NOUN
brj-23306	111	18	and	and	CCONJ
brj-23306	111	19	incubated	incubate	VERB
brj-23306	111	20	in	in	ADP
brj-23306	111	21	a	a	DET
brj-23306	111	22	5	5	NUM
brj-23306	111	23	%	%	NOUN
brj-23306	111	24	co2	co2	NOUN
brj-23306	111	25	incubator	incubator	NOUN
brj-23306	111	26	for	for	ADP
brj-23306	111	27	72	72	NUM
brj-23306	111	28	h.	h.	NOUN
brj-23306	111	29	subsequently	subsequently	ADV
brj-23306	111	30	,	,	PUNCT
brj-23306	111	31	1	1	NUM
brj-23306	111	32	ml	ml	NOUN
brj-23306	111	33	of	of	ADP
brj-23306	111	34	the	the	DET
brj-23306	111	35	respective	respective	ADJ
brj-23306	111	36	samples	sample	NOUN
brj-23306	111	37	was	be	AUX
brj-23306	111	38	added	add	VERB
brj-23306	111	39	to	to	ADP
brj-23306	111	40	the	the	DET
brj-23306	111	41	wells	well	NOUN
brj-23306	111	42	and	and	CCONJ
brj-23306	111	43	incubated	incubate	VERB
brj-23306	111	44	for	for	ADP
brj-23306	111	45	24	24	NUM
brj-23306	111	46	h	h	NOUN
brj-23306	111	47	in	in	ADP
brj-23306	111	48	a	a	DET
brj-23306	111	49	5	5	NUM
brj-23306	111	50	%	%	NOUN
brj-23306	111	51	co2	co2	NOUN
brj-23306	111	52	incubator	incubator	NOUN
brj-23306	111	53	.	.	PUNCT
brj-23306	112	1	after	after	ADP
brj-23306	112	2	removing	remove	VERB
brj-23306	112	3	the	the	DET
brj-23306	112	4	sample	sample	NOUN
brj-23306	112	5	solution	solution	NOUN
brj-23306	112	6	,	,	PUNCT
brj-23306	112	7	500	500	NUM
brj-23306	112	8	µl	µl	NOUN
brj-23306	112	9	of	of	ADP
brj-23306	112	10	tpvg	tpvg	NOUN
brj-23306	112	11	(	(	PUNCT
brj-23306	112	12	trypsinization	trypsinization	NOUN
brj-23306	112	13	)	)	PUNCT
brj-23306	112	14	was	be	AUX
brj-23306	112	15	added	add	VERB
brj-23306	112	16	,	,	PUNCT
brj-23306	112	17	and	and	CCONJ
brj-23306	112	18	the	the	DET
brj-23306	112	19	solution	solution	NOUN
brj-23306	112	20	was	be	AUX
brj-23306	112	21	discarded	discard	VERB
brj-23306	112	22	.	.	PUNCT
brj-23306	113	1	after	after	ADP
brj-23306	113	2	this	this	PRON
brj-23306	113	3	,	,	PUNCT
brj-23306	113	4	1	1	NUM
brj-23306	113	5	ml	ml	NOUN
brj-23306	113	6	of	of	ADP
brj-23306	113	7	1x	1x	PROPN
brj-23306	113	8	pbs	pbs	PROPN
brj-23306	113	9	solution	solution	NOUN
brj-23306	113	10	was	be	AUX
brj-23306	113	11	added	add	VERB
brj-23306	113	12	to	to	PART
brj-23306	113	13	collect	collect	VERB
brj-23306	113	14	the	the	DET
brj-23306	113	15	samples	sample	NOUN
brj-23306	113	16	for	for	ADP
brj-23306	113	17	dna	dna	PROPN
brj-23306	113	18	fragmentation	fragmentation	NOUN
brj-23306	113	19	analysis	analysis	NOUN
brj-23306	113	20	(	(	PUNCT
brj-23306	113	21	gad	gad	NOUN
brj-23306	113	22	et	et	PROPN
brj-23306	113	23	al	al	PROPN
brj-23306	113	24	.	.	PROPN
brj-23306	113	25	2021	2021	NUM
brj-23306	113	26	)	)	PUNCT
brj-23306	113	27	.	.	PUNCT
brj-23306	114	1	peer	peer	NOUN
brj-23306	114	2	-	-	PUNCT
brj-23306	114	3	reviewed	review	VERB
brj-23306	114	4	article	article	NOUN
brj-23306	114	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	114	6	raju	raju	PROPN
brj-23306	114	7	et	et	PROPN
brj-23306	114	8	al	al	PROPN
brj-23306	114	9	.	.	PROPN
brj-23306	115	1	(	(	PUNCT
brj-23306	115	2	2024	2024	NUM
brj-23306	115	3	)	)	PUNCT
brj-23306	115	4	.	.	PUNCT
brj-23306	116	1	“	"	PUNCT
brj-23306	116	2	ag	ag	PROPN
brj-23306	116	3	nanoparticles	nanoparticle	NOUN
brj-23306	116	4	from	from	ADP
brj-23306	116	5	leaves	leave	NOUN
brj-23306	116	6	,	,	PUNCT
brj-23306	116	7	”	"	PUNCT
brj-23306	116	8	bioresources	bioresource	NOUN
brj-23306	116	9	19(2	19(2	NUM
brj-23306	116	10	)	)	PUNCT
brj-23306	116	11	,	,	PUNCT
brj-23306	116	12	3328	3328	NUM
brj-23306	116	13	-	-	SYM
brj-23306	116	14	3352	3352	NUM
brj-23306	116	15	.	.	PUNCT
brj-23306	116	16	3333	3333	NUM
brj-23306	116	17	rt	rt	ADJ
brj-23306	116	18	-	-	PUNCT
brj-23306	116	19	pcr	pcr	PROPN
brj-23306	116	20	analysis	analysis	NOUN
brj-23306	116	21	total	total	ADJ
brj-23306	116	22	rna	rna	NOUN
brj-23306	116	23	was	be	AUX
brj-23306	116	24	extracted	extract	VERB
brj-23306	116	25	for	for	ADP
brj-23306	116	26	the	the	DET
brj-23306	116	27	agnps	agnps	PROPN
brj-23306	116	28	-	-	PUNCT
brj-23306	116	29	treated	treat	VERB
brj-23306	116	30	a549	a549	PROPN
brj-23306	116	31	and	and	CCONJ
brj-23306	116	32	pa1	pa1	NOUN
brj-23306	116	33	cells	cell	NOUN
brj-23306	116	34	,	,	PUNCT
brj-23306	116	35	as	as	ADP
brj-23306	116	36	per	per	ADP
brj-23306	116	37	the	the	DET
brj-23306	116	38	manufacturer	manufacturer	NOUN
brj-23306	116	39	's	's	PART
brj-23306	116	40	guidelines	guideline	NOUN
brj-23306	116	41	using	use	VERB
brj-23306	116	42	trizol	trizol	PROPN
brj-23306	116	43	reagent	reagent	ADJ
brj-23306	116	44	.	.	PUNCT
brj-23306	117	1	the	the	DET
brj-23306	117	2	concentration	concentration	NOUN
brj-23306	117	3	of	of	ADP
brj-23306	117	4	rna	rna	NOUN
brj-23306	117	5	was	be	AUX
brj-23306	117	6	determined	determine	VERB
brj-23306	117	7	using	use	VERB
brj-23306	117	8	spectrophotometric	spectrophotometric	ADJ
brj-23306	117	9	method	method	NOUN
brj-23306	117	10	.	.	PUNCT
brj-23306	118	1	subsequently	subsequently	ADV
brj-23306	118	2	,	,	PUNCT
brj-23306	118	3	1	1	NUM
brj-23306	118	4	µg	µg	NOUN
brj-23306	118	5	of	of	ADP
brj-23306	118	6	total	total	ADJ
brj-23306	118	7	rna	rna	NOUN
brj-23306	118	8	was	be	AUX
brj-23306	118	9	utilized	utilize	VERB
brj-23306	118	10	for	for	ADP
brj-23306	118	11	a	a	DET
brj-23306	118	12	reverse	reverse	ADJ
brj-23306	118	13	transcription	transcription	NOUN
brj-23306	118	14	reaction	reaction	NOUN
brj-23306	118	15	.	.	PUNCT
brj-23306	119	1	the	the	DET
brj-23306	119	2	cdna	cdna	PROPN
brj-23306	119	3	was	be	AUX
brj-23306	119	4	precipitated	precipitate	VERB
brj-23306	119	5	and	and	CCONJ
brj-23306	119	6	amplified	amplify	VERB
brj-23306	119	7	using	use	VERB
brj-23306	119	8	specific	specific	ADJ
brj-23306	119	9	primer	primer	NOUN
brj-23306	119	10	sequences	sequence	NOUN
brj-23306	119	11	to	to	PART
brj-23306	119	12	ensure	ensure	VERB
brj-23306	119	13	efficient	efficient	ADJ
brj-23306	119	14	and	and	CCONJ
brj-23306	119	15	targeted	target	VERB
brj-23306	119	16	amplification	amplification	NOUN
brj-23306	119	17	.	.	PUNCT
brj-23306	120	1	primer	primer	NOUN
brj-23306	120	2	sets	set	VERB
brj-23306	120	3	targeting	target	VERB
brj-23306	120	4	cas-3	cas-3	ADJ
brj-23306	120	5	(	(	PUNCT
brj-23306	120	6	apoptotic	apoptotic	ADJ
brj-23306	120	7	gene	gene	NOUN
brj-23306	120	8	)	)	PUNCT
brj-23306	120	9	and	and	CCONJ
brj-23306	120	10	gapdh	gapdh	NOUN
brj-23306	120	11	(	(	PUNCT
brj-23306	120	12	housekeeping	housekeeping	NOUN
brj-23306	120	13	gene	gene	NOUN
brj-23306	120	14	)	)	PUNCT
brj-23306	120	15	were	be	AUX
brj-23306	120	16	specifically	specifically	ADV
brj-23306	120	17	designed	design	VERB
brj-23306	120	18	for	for	ADP
brj-23306	120	19	cdna	cdna	NOUN
brj-23306	120	20	amplification	amplification	NOUN
brj-23306	120	21	(	(	PUNCT
brj-23306	120	22	baharara	baharara	NOUN
brj-23306	120	23	et	et	PROPN
brj-23306	120	24	al	al	PROPN
brj-23306	120	25	.	.	PROPN
brj-23306	120	26	2015	2015	NUM
brj-23306	120	27	)	)	PUNCT
brj-23306	120	28	.	.	PUNCT
brj-23306	121	1	the	the	DET
brj-23306	121	2	primers	primer	NOUN
brj-23306	121	3	used	use	VERB
brj-23306	121	4	for	for	ADP
brj-23306	121	5	analysis	analysis	NOUN
brj-23306	121	6	are	be	AUX
brj-23306	121	7	shown	show	VERB
brj-23306	121	8	in	in	ADP
brj-23306	121	9	table	table	NOUN
brj-23306	121	10	1	1	NUM
brj-23306	121	11	.	.	PUNCT
brj-23306	121	12	table	table	NOUN
brj-23306	121	13	1	1	NUM
brj-23306	121	14	.	.	PUNCT
brj-23306	122	1	primers	primer	NOUN
brj-23306	122	2	used	use	VERB
brj-23306	122	3	for	for	ADP
brj-23306	122	4	rt	rt	ADJ
brj-23306	122	5	-	-	PUNCT
brj-23306	122	6	pcr	pcr	NOUN
brj-23306	122	7	analysis	analysis	NOUN
brj-23306	122	8	n	n	PRON
brj-23306	122	9	o	o	NOUN
brj-23306	122	10	gene	gene	NOUN
brj-23306	122	11	forward	forward	ADV
brj-23306	122	12	reverse	reverse	VERB
brj-23306	122	13	1	1	NUM
brj-23306	122	14	cas3	cas3	ADJ
brj-23306	122	15	5’-aggggtcatttatgggaca3	5’-aggggtcatttatgggaca3	NUM
brj-23306	122	16	’	'	PUNCT
brj-23306	122	17	5’-tacacgggatctgtttctttg-3	5’-tacacgggatctgtttctttg-3	NUM
brj-23306	122	18	’	'	PUNCT
brj-23306	122	19	2	2	NUM
brj-23306	122	20	gapd	gapd	NOUN
brj-23306	122	21	h	h	NOUN
brj-23306	122	22	5’ccatgttcgtcatgggtgtgaacc	5’ccatgttcgtcatgggtgtgaacc	PROPN
brj-23306	122	23	a-3	a-3	PROPN
brj-23306	122	24	’	'	PUNCT
brj-23306	122	25	5’gccactagaggcagggatgatgtt	5’gccactagaggcagggatgatgtt	NUM
brj-23306	122	26	c-3	c-3	NOUN
brj-23306	122	27	’	'	PUNCT
brj-23306	122	28	microorganisms	microorganism	NOUN
brj-23306	122	29	used	use	VERB
brj-23306	122	30	and	and	CCONJ
brj-23306	122	31	culture	culture	NOUN
brj-23306	122	32	preparation	preparation	NOUN
brj-23306	122	33	bacteria	bacteria	NOUN
brj-23306	123	1	[	[	X
brj-23306	123	2	enterococcus	enterococcus	NOUN
brj-23306	123	3	faecalis	faecalis	NOUN
brj-23306	123	4	(	(	PUNCT
brj-23306	123	5	mtcc	mtcc	NOUN
brj-23306	123	6	439	439	NUM
brj-23306	123	7	)	)	PUNCT
brj-23306	123	8	,	,	PUNCT
brj-23306	123	9	bacillus	bacillus	NOUN
brj-23306	123	10	subtilis	subtili	NOUN
brj-23306	123	11	(	(	PUNCT
brj-23306	123	12	mtcc	mtcc	NOUN
brj-23306	123	13	482	482	NUM
brj-23306	123	14	)	)	PUNCT
brj-23306	123	15	,	,	PUNCT
brj-23306	123	16	bacillus	bacillus	NOUN
brj-23306	123	17	coagulans	coagulan	NOUN
brj-23306	123	18	(	(	PUNCT
brj-23306	123	19	mtcc	mtcc	NOUN
brj-23306	123	20	492	492	NUM
brj-23306	123	21	)	)	PUNCT
brj-23306	123	22	,	,	PUNCT
brj-23306	123	23	enterobacter	enterobacter	ADJ
brj-23306	123	24	cloacae	cloacae	NOUN
brj-23306	123	25	(	(	PUNCT
brj-23306	123	26	mtcc	mtcc	NOUN
brj-23306	123	27	509	509	NUM
brj-23306	123	28	)	)	PUNCT
brj-23306	123	29	,	,	PUNCT
brj-23306	123	30	pseudomonas	pseudomona	VERB
brj-23306	123	31	aeruginosa	aeruginosa	NOUN
brj-23306	123	32	(	(	PUNCT
brj-23306	123	33	mtcc51034	mtcc51034	PROPN
brj-23306	123	34	)	)	PUNCT
brj-23306	123	35	,	,	PUNCT
brj-23306	123	36	klebsiella	klebsiella	NOUN
brj-23306	123	37	pneumoniae	pneumoniae	ADJ
brj-23306	123	38	(	(	PUNCT
brj-23306	123	39	mtcc	mtcc	NOUN
brj-23306	123	40	432	432	NUM
brj-23306	123	41	)	)	PUNCT
brj-23306	123	42	,	,	PUNCT
brj-23306	123	43	and	and	CCONJ
brj-23306	123	44	staphylococcus	staphylococcus	NOUN
brj-23306	123	45	aureus	aureus	PROPN
brj-23306	123	46	(	(	PUNCT
brj-23306	123	47	mtcc902	mtcc902	PROPN
brj-23306	123	48	)	)	PUNCT
brj-23306	123	49	]	]	PUNCT
brj-23306	123	50	,	,	PUNCT
brj-23306	123	51	and	and	CCONJ
brj-23306	123	52	fungi	fungi	VERB
brj-23306	123	53	[	[	PUNCT
brj-23306	123	54	aspergillus	aspergillus	NOUN
brj-23306	123	55	niger	niger	NOUN
brj-23306	123	56	(	(	PUNCT
brj-23306	123	57	mtcc404	mtcc404	PROPN
brj-23306	123	58	)	)	PUNCT
brj-23306	123	59	,	,	PUNCT
brj-23306	123	60	fusarium	fusarium	NOUN
brj-23306	123	61	oxysporum	oxysporum	NOUN
brj-23306	123	62	(	(	PUNCT
brj-23306	123	63	mtcc	mtcc	NOUN
brj-23306	123	64	2087	2087	NUM
brj-23306	123	65	)	)	PUNCT
brj-23306	123	66	,	,	PUNCT
brj-23306	123	67	rhizopus	rhizopus	PROPN
brj-23306	123	68	microsporus	microsporus	PROPN
brj-23306	123	69	(	(	PUNCT
brj-23306	123	70	mtcc	mtcc	NOUN
brj-23306	123	71	1250	1250	NUM
brj-23306	123	72	)	)	PUNCT
brj-23306	123	73	,	,	PUNCT
brj-23306	123	74	rhizopus	rhizopus	PROPN
brj-23306	123	75	oryzae	oryzae	NOUN
brj-23306	123	76	(	(	PUNCT
brj-23306	123	77	mtcc262	mtcc262	PROPN
brj-23306	123	78	)	)	PUNCT
brj-23306	123	79	,	,	PUNCT
brj-23306	123	80	and	and	CCONJ
brj-23306	123	81	penicillium	penicillium	NOUN
brj-23306	123	82	chrysogenum	chrysogenum	PROPN
brj-23306	123	83	(	(	PUNCT
brj-23306	123	84	mtcc	mtcc	NOUN
brj-23306	123	85	947	947	NUM
brj-23306	123	86	)	)	PUNCT
brj-23306	123	87	]	]	PUNCT
brj-23306	123	88	used	use	VERB
brj-23306	123	89	in	in	ADP
brj-23306	123	90	this	this	DET
brj-23306	123	91	study	study	NOUN
brj-23306	123	92	were	be	AUX
brj-23306	123	93	obtained	obtain	VERB
brj-23306	123	94	from	from	ADP
brj-23306	123	95	the	the	DET
brj-23306	123	96	microbial	microbial	ADJ
brj-23306	123	97	type	type	NOUN
brj-23306	123	98	culture	culture	NOUN
brj-23306	123	99	collection	collection	NOUN
brj-23306	123	100	and	and	CCONJ
brj-23306	123	101	gene	gene	NOUN
brj-23306	123	102	bank	bank	PROPN
brj-23306	123	103	,	,	PUNCT
brj-23306	123	104	chandigarh	chandigarh	PROPN
brj-23306	123	105	,	,	PUNCT
brj-23306	123	106	india	india	PROPN
brj-23306	123	107	.	.	PUNCT
brj-23306	124	1	antimicrobial	antimicrobial	ADJ
brj-23306	124	2	activities	activity	NOUN
brj-23306	124	3	of	of	ADP
brj-23306	124	4	agnps	agnps	PROPN
brj-23306	124	5	the	the	DET
brj-23306	124	6	bacterial	bacterial	ADJ
brj-23306	124	7	cultures	culture	NOUN
brj-23306	124	8	were	be	AUX
brj-23306	124	9	cultivated	cultivate	VERB
brj-23306	124	10	in	in	ADP
brj-23306	124	11	250	250	NUM
brj-23306	124	12	-	-	PUNCT
brj-23306	124	13	ml	ml	NOUN
brj-23306	124	14	erlenmeyer	erlenmeyer	PROPN
brj-23306	124	15	flasks	flask	NOUN
brj-23306	124	16	containing	contain	VERB
brj-23306	124	17	100	100	NUM
brj-23306	124	18	ml	ml	NOUN
brj-23306	124	19	of	of	ADP
brj-23306	124	20	mueller	mueller	PROPN
brj-23306	124	21	hinton	hinton	PROPN
brj-23306	124	22	broth	broth	PROPN
brj-23306	124	23	(	(	PUNCT
brj-23306	124	24	mhb	mhb	PROPN
brj-23306	124	25	)	)	PUNCT
brj-23306	124	26	(	(	PUNCT
brj-23306	124	27	himedia	himedia	PROPN
brj-23306	124	28	,	,	PUNCT
brj-23306	124	29	mumbai	mumbai	PROPN
brj-23306	124	30	,	,	PUNCT
brj-23306	124	31	india	india	PROPN
brj-23306	124	32	)	)	PUNCT
brj-23306	124	33	and	and	CCONJ
brj-23306	124	34	incubated	incubate	VERB
brj-23306	124	35	at	at	ADP
brj-23306	124	36	37	37	NUM
brj-23306	124	37	°	°	SYM
brj-23306	124	38	c	c	NOUN
brj-23306	124	39	in	in	ADP
brj-23306	124	40	a	a	DET
brj-23306	124	41	rotary	rotary	ADJ
brj-23306	124	42	shaker	shaker	NOUN
brj-23306	124	43	incubator	incubator	NOUN
brj-23306	124	44	for	for	ADP
brj-23306	124	45	24	24	NUM
brj-23306	124	46	h.	h.	NOUN
brj-23306	124	47	the	the	DET
brj-23306	124	48	cultures	culture	NOUN
brj-23306	124	49	were	be	AUX
brj-23306	124	50	maintained	maintain	VERB
brj-23306	124	51	to	to	PART
brj-23306	124	52	reach	reach	VERB
brj-23306	124	53	0.1	0.1	NUM
brj-23306	124	54	od	od	NOUN
brj-23306	124	55	at	at	ADP
brj-23306	124	56	600	600	NUM
brj-23306	124	57	nm	nm	NOUN
brj-23306	124	58	,	,	PUNCT
brj-23306	124	59	and	and	CCONJ
brj-23306	124	60	mid	mid	ADJ
brj-23306	124	61	-	-	ADJ
brj-23306	124	62	log	log	ADJ
brj-23306	124	63	phase	phase	NOUN
brj-23306	124	64	bacterial	bacterial	ADJ
brj-23306	124	65	cultures	culture	NOUN
brj-23306	124	66	were	be	AUX
brj-23306	124	67	used	use	VERB
brj-23306	124	68	for	for	ADP
brj-23306	124	69	antibacterial	antibacterial	ADJ
brj-23306	124	70	activity	activity	NOUN
brj-23306	124	71	.	.	PUNCT
brj-23306	125	1	the	the	DET
brj-23306	125	2	fungal	fungal	ADJ
brj-23306	125	3	strains	strain	NOUN
brj-23306	125	4	were	be	AUX
brj-23306	125	5	cultivated	cultivate	VERB
brj-23306	125	6	on	on	ADP
brj-23306	125	7	sabouraud	sabouraud	NOUN
brj-23306	125	8	dextrose	dextrose	NOUN
brj-23306	125	9	agar	agar	NOUN
brj-23306	125	10	(	(	PUNCT
brj-23306	125	11	sda	sda	NOUN
brj-23306	125	12	)	)	PUNCT
brj-23306	125	13	(	(	PUNCT
brj-23306	125	14	himedia	himedia	NOUN
brj-23306	125	15	,	,	PUNCT
brj-23306	125	16	mumbai	mumbai	PROPN
brj-23306	125	17	,	,	PUNCT
brj-23306	125	18	india	india	PROPN
brj-23306	125	19	)	)	PUNCT
brj-23306	125	20	for	for	ADP
brj-23306	125	21	5	5	NUM
brj-23306	125	22	days	day	NOUN
brj-23306	125	23	at	at	ADP
brj-23306	125	24	28	28	NUM
brj-23306	125	25	°	°	NOUN
brj-23306	125	26	c	c	NOUN
brj-23306	125	27	.	.	PUNCT
brj-23306	126	1	after	after	ADP
brj-23306	126	2	5	5	NUM
brj-23306	126	3	days	day	NOUN
brj-23306	126	4	of	of	ADP
brj-23306	126	5	incubation	incubation	NOUN
brj-23306	126	6	,	,	PUNCT
brj-23306	126	7	10	10	NUM
brj-23306	126	8	ml	ml	NOUN
brj-23306	126	9	of	of	ADP
brj-23306	126	10	ice	ice	NOUN
brj-23306	126	11	-	-	PUNCT
brj-23306	126	12	cold	cold	ADJ
brj-23306	126	13	double	double	ADJ
brj-23306	126	14	distilled	distil	VERB
brj-23306	126	15	water	water	NOUN
brj-23306	126	16	was	be	AUX
brj-23306	126	17	added	add	VERB
brj-23306	126	18	,	,	PUNCT
brj-23306	126	19	and	and	CCONJ
brj-23306	126	20	the	the	DET
brj-23306	126	21	spore	spore	ADJ
brj-23306	126	22	suspension	suspension	NOUN
brj-23306	126	23	was	be	AUX
brj-23306	126	24	used	use	VERB
brj-23306	126	25	for	for	ADP
brj-23306	126	26	antifungal	antifungal	ADJ
brj-23306	126	27	activity	activity	NOUN
brj-23306	126	28	.	.	PUNCT
brj-23306	127	1	disc	disc	NOUN
brj-23306	127	2	diffusion	diffusion	NOUN
brj-23306	127	3	assay	assay	VERB
brj-23306	127	4	the	the	DET
brj-23306	127	5	antibacterial	antibacterial	ADJ
brj-23306	127	6	activity	activity	NOUN
brj-23306	127	7	of	of	ADP
brj-23306	127	8	the	the	DET
brj-23306	127	9	extract	extract	NOUN
brj-23306	127	10	was	be	AUX
brj-23306	127	11	initially	initially	ADV
brj-23306	127	12	screened	screen	VERB
brj-23306	127	13	against	against	ADP
brj-23306	127	14	the	the	DET
brj-23306	127	15	selected	select	VERB
brj-23306	127	16	bacterial	bacterial	ADJ
brj-23306	127	17	pathogens	pathogen	NOUN
brj-23306	127	18	by	by	ADP
brj-23306	127	19	disk	disk	NOUN
brj-23306	127	20	diffusion	diffusion	NOUN
brj-23306	127	21	method	method	NOUN
brj-23306	127	22	.	.	PUNCT
brj-23306	128	1	the	the	DET
brj-23306	128	2	bacterial	bacterial	ADJ
brj-23306	128	3	cultures	culture	NOUN
brj-23306	128	4	were	be	AUX
brj-23306	128	5	spread	spread	VERB
brj-23306	128	6	on	on	ADP
brj-23306	128	7	sterile	sterile	ADJ
brj-23306	128	8	mha	mha	NOUN
brj-23306	128	9	medium	medium	NOUN
brj-23306	128	10	using	use	VERB
brj-23306	128	11	a	a	DET
brj-23306	128	12	sterile	sterile	ADJ
brj-23306	128	13	cotton	cotton	NOUN
brj-23306	128	14	swab	swab	NOUN
brj-23306	128	15	.	.	PUNCT
brj-23306	129	1	the	the	DET
brj-23306	129	2	sterile	sterile	ADJ
brj-23306	129	3	blank	blank	ADJ
brj-23306	129	4	disk	disk	NOUN
brj-23306	129	5	was	be	AUX
brj-23306	129	6	loaded	load	VERB
brj-23306	129	7	with	with	ADP
brj-23306	129	8	20	20	NUM
brj-23306	129	9	μl	μl	ADP
brj-23306	129	10	of	of	ADP
brj-23306	129	11	nps	nps	PROPN
brj-23306	129	12	and	and	CCONJ
brj-23306	129	13	dried	dry	VERB
brj-23306	129	14	.	.	PUNCT
brj-23306	130	1	it	it	PRON
brj-23306	130	2	was	be	AUX
brj-23306	130	3	further	far	ADV
brj-23306	130	4	placed	place	VERB
brj-23306	130	5	on	on	ADP
brj-23306	130	6	the	the	DET
brj-23306	130	7	mha	mha	NOUN
brj-23306	130	8	plates	plate	NOUN
brj-23306	130	9	and	and	CCONJ
brj-23306	130	10	incubated	incubate	VERB
brj-23306	130	11	at	at	ADP
brj-23306	130	12	37	37	NUM
brj-23306	130	13	°	°	NOUN
brj-23306	130	14	c	c	NOUN
brj-23306	130	15	for	for	ADP
brj-23306	130	16	24	24	NUM
brj-23306	130	17	h.	h.	PROPN
brj-23306	130	18	after	after	ADP
brj-23306	130	19	24	24	NUM
brj-23306	130	20	h	h	NOUN
brj-23306	130	21	,	,	PUNCT
brj-23306	130	22	the	the	DET
brj-23306	130	23	zone	zone	NOUN
brj-23306	130	24	of	of	ADP
brj-23306	130	25	inhibition	inhibition	NOUN
brj-23306	130	26	was	be	AUX
brj-23306	130	27	measured	measure	VERB
brj-23306	130	28	.	.	PUNCT
brj-23306	131	1	peer	peer	NOUN
brj-23306	131	2	-	-	PUNCT
brj-23306	131	3	reviewed	review	VERB
brj-23306	131	4	article	article	NOUN
brj-23306	131	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	131	6	raju	raju	PROPN
brj-23306	131	7	et	et	PROPN
brj-23306	131	8	al	al	PROPN
brj-23306	131	9	.	.	PROPN
brj-23306	132	1	(	(	PUNCT
brj-23306	132	2	2024	2024	NUM
brj-23306	132	3	)	)	PUNCT
brj-23306	132	4	.	.	PUNCT
brj-23306	133	1	“	"	PUNCT
brj-23306	133	2	ag	ag	PROPN
brj-23306	133	3	nanoparticles	nanoparticle	NOUN
brj-23306	133	4	from	from	ADP
brj-23306	133	5	leaves	leave	NOUN
brj-23306	133	6	,	,	PUNCT
brj-23306	133	7	”	"	PUNCT
brj-23306	133	8	bioresources	bioresource	NOUN
brj-23306	133	9	19(2	19(2	NUM
brj-23306	133	10	)	)	PUNCT
brj-23306	133	11	,	,	PUNCT
brj-23306	133	12	3328	3328	NUM
brj-23306	133	13	-	-	SYM
brj-23306	133	14	3352	3352	NUM
brj-23306	133	15	.	.	PUNCT
brj-23306	133	16	3334	3334	NUM
brj-23306	133	17	minimum	minimum	ADJ
brj-23306	133	18	inhibitory	inhibitory	ADJ
brj-23306	133	19	concentration	concentration	NOUN
brj-23306	133	20	(	(	PUNCT
brj-23306	133	21	mic	mic	ADJ
brj-23306	133	22	)	)	PUNCT
brj-23306	133	23	the	the	DET
brj-23306	133	24	minimum	minimum	ADJ
brj-23306	133	25	inhibitory	inhibitory	ADJ
brj-23306	133	26	concentration	concentration	NOUN
brj-23306	133	27	of	of	ADP
brj-23306	133	28	agnps	agnps	PROPN
brj-23306	133	29	was	be	AUX
brj-23306	133	30	tested	test	VERB
brj-23306	133	31	as	as	SCONJ
brj-23306	133	32	described	describe	VERB
brj-23306	133	33	previously	previously	ADV
brj-23306	133	34	.	.	PUNCT
brj-23306	134	1	the	the	DET
brj-23306	134	2	agnps	agnps	PROPN
brj-23306	134	3	were	be	AUX
brj-23306	134	4	serially	serially	ADV
brj-23306	134	5	diluted	dilute	VERB
brj-23306	134	6	in	in	ADP
brj-23306	134	7	2	2	NUM
brj-23306	134	8	%	%	NOUN
brj-23306	134	9	dmso	dmso	NOUN
brj-23306	134	10	,	,	PUNCT
brj-23306	134	11	and	and	CCONJ
brj-23306	134	12	the	the	DET
brj-23306	134	13	initial	initial	ADJ
brj-23306	134	14	agnps	agnps	ADJ
brj-23306	134	15	concentration	concentration	NOUN
brj-23306	134	16	was	be	AUX
brj-23306	134	17	0.25	0.25	NUM
brj-23306	134	18	mg	mg	PROPN
brj-23306	134	19	/	/	SYM
brj-23306	134	20	ml	ml	NOUN
brj-23306	134	21	.	.	PUNCT
brj-23306	135	1	the	the	DET
brj-23306	135	2	test	test	NOUN
brj-23306	135	3	solution	solution	NOUN
brj-23306	135	4	was	be	AUX
brj-23306	135	5	serially	serially	ADV
brj-23306	135	6	diluted	dilute	VERB
brj-23306	135	7	twofold	twofold	ADV
brj-23306	135	8	.	.	PUNCT
brj-23306	136	1	the	the	DET
brj-23306	136	2	experiment	experiment	NOUN
brj-23306	136	3	was	be	AUX
brj-23306	136	4	performed	perform	VERB
brj-23306	136	5	on	on	ADP
brj-23306	136	6	a	a	DET
brj-23306	136	7	microtiter	microtiter	NOUN
brj-23306	136	8	plate	plate	NOUN
brj-23306	136	9	and	and	CCONJ
brj-23306	136	10	inoculated	inoculate	VERB
brj-23306	136	11	with	with	ADP
brj-23306	136	12	20	20	NUM
brj-23306	136	13	µl	µl	NOUN
brj-23306	136	14	of	of	ADP
brj-23306	136	15	bacteria	bacteria	NOUN
brj-23306	136	16	(	(	PUNCT
brj-23306	136	17	107	107	NUM
brj-23306	136	18	cfu	cfu	NOUN
brj-23306	136	19	/	/	SYM
brj-23306	136	20	ml	ml	NOUN
brj-23306	136	21	)	)	PUNCT
brj-23306	136	22	.	.	PUNCT
brj-23306	137	1	the	the	DET
brj-23306	137	2	microtiter	microtiter	ADJ
brj-23306	137	3	plates	plate	NOUN
brj-23306	137	4	were	be	AUX
brj-23306	137	5	incubated	incubate	VERB
brj-23306	137	6	at	at	ADP
brj-23306	137	7	37	37	NUM
brj-23306	137	8	ºc	ºc	NOUN
brj-23306	137	9	for	for	ADP
brj-23306	137	10	bacteria	bacteria	NOUN
brj-23306	137	11	,	,	PUNCT
brj-23306	137	12	and	and	CCONJ
brj-23306	137	13	the	the	DET
brj-23306	137	14	visible	visible	ADJ
brj-23306	137	15	growth	growth	NOUN
brj-23306	137	16	was	be	AUX
brj-23306	137	17	examined	examine	VERB
brj-23306	137	18	after	after	SCONJ
brj-23306	137	19	24	24	NUM
brj-23306	137	20	h.	h.	PROPN
brj-23306	137	21	streptomycin	streptomycin	PROPN
brj-23306	137	22	was	be	AUX
brj-23306	137	23	used	use	VERB
brj-23306	137	24	as	as	ADP
brj-23306	137	25	the	the	DET
brj-23306	137	26	positive	positive	ADJ
brj-23306	137	27	control	control	NOUN
brj-23306	137	28	.	.	PUNCT
brj-23306	138	1	the	the	DET
brj-23306	138	2	mic	mic	ADJ
brj-23306	138	3	value	value	NOUN
brj-23306	138	4	of	of	ADP
brj-23306	138	5	the	the	DET
brj-23306	138	6	agnps	agnps	ADJ
brj-23306	138	7	was	be	AUX
brj-23306	138	8	calculated	calculate	VERB
brj-23306	138	9	as	as	ADP
brj-23306	138	10	the	the	DET
brj-23306	138	11	absolute	absolute	ADJ
brj-23306	138	12	lowest	low	ADJ
brj-23306	138	13	amount	amount	NOUN
brj-23306	138	14	of	of	ADP
brj-23306	138	15	the	the	DET
brj-23306	138	16	nps	nps	PROPN
brj-23306	138	17	completely	completely	ADV
brj-23306	138	18	inhibiting	inhibit	VERB
brj-23306	138	19	the	the	DET
brj-23306	138	20	visible	visible	ADJ
brj-23306	138	21	growth	growth	NOUN
brj-23306	138	22	of	of	ADP
brj-23306	138	23	the	the	DET
brj-23306	138	24	test	test	NOUN
brj-23306	138	25	bacteria	bacteria	NOUN
brj-23306	138	26	in	in	ADP
brj-23306	138	27	microtiter	microtiter	NOUN
brj-23306	138	28	plates	plate	NOUN
brj-23306	138	29	.	.	PUNCT
brj-23306	139	1	fungal	fungal	ADJ
brj-23306	139	2	biomass	biomass	NOUN
brj-23306	139	3	inhibitory	inhibitory	ADJ
brj-23306	139	4	effect	effect	NOUN
brj-23306	139	5	the	the	DET
brj-23306	139	6	fungal	fungal	ADJ
brj-23306	139	7	biomass	biomass	NOUN
brj-23306	139	8	inhibitory	inhibitory	ADJ
brj-23306	139	9	property	property	NOUN
brj-23306	139	10	of	of	ADP
brj-23306	139	11	agnps	agnps	PROPN
brj-23306	139	12	was	be	AUX
brj-23306	139	13	analyzed	analyze	VERB
brj-23306	139	14	as	as	SCONJ
brj-23306	139	15	described	describe	VERB
brj-23306	139	16	previously	previously	ADV
brj-23306	139	17	.	.	PUNCT
brj-23306	140	1	briefly	briefly	ADV
brj-23306	140	2	,	,	PUNCT
brj-23306	140	3	100	100	NUM
brj-23306	140	4	ml	ml	NOUN
brj-23306	140	5	of	of	ADP
brj-23306	140	6	potato	potato	NOUN
brj-23306	140	7	dextrose	dextrose	NOUN
brj-23306	140	8	broth	broth	NOUN
brj-23306	140	9	(	(	PUNCT
brj-23306	140	10	pdb	pdb	NOUN
brj-23306	140	11	)	)	PUNCT
brj-23306	140	12	was	be	AUX
brj-23306	140	13	mixed	mix	VERB
brj-23306	140	14	with	with	ADP
brj-23306	140	15	0.5	0.5	NUM
brj-23306	140	16	mg	mg	NOUN
brj-23306	140	17	/	/	SYM
brj-23306	140	18	ml	ml	PROPN
brj-23306	140	19	of	of	ADP
brj-23306	140	20	agnps	agnps	PROPN
brj-23306	140	21	and	and	CCONJ
brj-23306	140	22	inoculated	inoculate	VERB
brj-23306	140	23	with	with	ADP
brj-23306	140	24	0.5	0.5	NUM
brj-23306	140	25	ml	ml	NOUN
brj-23306	140	26	of	of	ADP
brj-23306	140	27	fungus	fungus	NOUN
brj-23306	140	28	(	(	PUNCT
brj-23306	140	29	1	1	NUM
brj-23306	140	30	×	×	PROPN
brj-23306	140	31	107	107	NUM
brj-23306	140	32	cfu	cfu	NOUN
brj-23306	140	33	/	/	SYM
brj-23306	140	34	ml	ml	NOUN
brj-23306	140	35	)	)	PUNCT
brj-23306	140	36	.	.	PUNCT
brj-23306	141	1	the	the	DET
brj-23306	141	2	flasks	flask	NOUN
brj-23306	141	3	were	be	AUX
brj-23306	141	4	incubated	incubate	VERB
brj-23306	141	5	for	for	ADP
brj-23306	141	6	5	5	NUM
brj-23306	141	7	days	day	NOUN
brj-23306	141	8	at	at	ADP
brj-23306	141	9	28	28	NUM
brj-23306	141	10	°	°	NOUN
brj-23306	141	11	c	c	NOUN
brj-23306	141	12	.	.	PUNCT
brj-23306	142	1	after	after	ADP
brj-23306	142	2	5	5	NUM
brj-23306	142	3	days	day	NOUN
brj-23306	142	4	of	of	ADP
brj-23306	142	5	incubation	incubation	NOUN
brj-23306	142	6	,	,	PUNCT
brj-23306	142	7	fungal	fungal	ADJ
brj-23306	142	8	hyphae	hypha	NOUN
brj-23306	142	9	were	be	AUX
brj-23306	142	10	filtered	filter	VERB
brj-23306	142	11	using	use	VERB
brj-23306	142	12	a	a	DET
brj-23306	142	13	whatman	whatman	NOUN
brj-23306	142	14	number	number	NOUN
brj-23306	142	15	1	1	NUM
brj-23306	142	16	filter	filter	NOUN
brj-23306	142	17	paper	paper	NOUN
brj-23306	142	18	.	.	PUNCT
brj-23306	143	1	the	the	DET
brj-23306	143	2	fungal	fungal	ADJ
brj-23306	143	3	biomass	biomass	NOUN
brj-23306	143	4	was	be	AUX
brj-23306	143	5	determined	determine	VERB
brj-23306	143	6	,	,	PUNCT
brj-23306	143	7	and	and	CCONJ
brj-23306	143	8	the	the	DET
brj-23306	143	9	result	result	NOUN
brj-23306	143	10	was	be	AUX
brj-23306	143	11	compared	compare	VERB
brj-23306	143	12	with	with	ADP
brj-23306	143	13	the	the	DET
brj-23306	143	14	positive	positive	ADJ
brj-23306	143	15	control	control	NOUN
brj-23306	143	16	.	.	PUNCT
brj-23306	144	1	antibiofilm	antibiofilm	NOUN
brj-23306	144	2	activity	activity	NOUN
brj-23306	144	3	of	of	ADP
brj-23306	144	4	agnps	agnps	PROPN
brj-23306	144	5	the	the	DET
brj-23306	144	6	antibiofilm	antibiofilm	NOUN
brj-23306	144	7	activity	activity	NOUN
brj-23306	144	8	of	of	ADP
brj-23306	144	9	agnps	agnps	PROPN
brj-23306	144	10	was	be	AUX
brj-23306	144	11	evaluated	evaluate	VERB
brj-23306	144	12	at	at	ADP
brj-23306	144	13	1/2	1/2	NUM
brj-23306	144	14	,	,	PUNCT
brj-23306	144	15	1/4	1/4	NUM
brj-23306	144	16	,	,	PUNCT
brj-23306	144	17	and	and	CCONJ
brj-23306	144	18	1/8	1/8	NUM
brj-23306	144	19	mic	mic	ADJ
brj-23306	144	20	values	value	NOUN
brj-23306	144	21	of	of	ADP
brj-23306	144	22	the	the	DET
brj-23306	144	23	agnps	agnps	PROPN
brj-23306	144	24	.	.	PUNCT
brj-23306	145	1	the	the	DET
brj-23306	145	2	antibiofilm	antibiofilm	NOUN
brj-23306	145	3	assay	assay	NOUN
brj-23306	145	4	was	be	AUX
brj-23306	145	5	performed	perform	VERB
brj-23306	145	6	using	use	VERB
brj-23306	145	7	crystal	crystal	NOUN
brj-23306	145	8	violet	violet	ADJ
brj-23306	145	9	staining	stain	VERB
brj-23306	145	10	method	method	NOUN
brj-23306	145	11	.	.	PUNCT
brj-23306	146	1	briefly	briefly	ADV
brj-23306	146	2	,	,	PUNCT
brj-23306	146	3	the	the	DET
brj-23306	146	4	selected	select	VERB
brj-23306	146	5	bacterial	bacterial	ADJ
brj-23306	146	6	strains	strain	NOUN
brj-23306	146	7	were	be	AUX
brj-23306	146	8	cultured	cultured	ADJ
brj-23306	146	9	in	in	ADP
brj-23306	146	10	a	a	DET
brj-23306	146	11	microtiter	microtiter	NOUN
brj-23306	146	12	plate	plate	NOUN
brj-23306	146	13	containing	contain	VERB
brj-23306	146	14	400	400	NUM
brj-23306	146	15	µl	µl	NOUN
brj-23306	146	16	of	of	ADP
brj-23306	146	17	sterile	sterile	ADJ
brj-23306	146	18	mhb	mhb	PROPN
brj-23306	146	19	medium	medium	NOUN
brj-23306	146	20	,	,	PUNCT
brj-23306	146	21	inoculated	inoculate	VERB
brj-23306	146	22	with	with	ADP
brj-23306	146	23	20	20	NUM
brj-23306	146	24	µl	µl	NOUN
brj-23306	146	25	of	of	ADP
brj-23306	146	26	culture	culture	NOUN
brj-23306	146	27	medium	medium	NOUN
brj-23306	146	28	,	,	PUNCT
brj-23306	146	29	and	and	CCONJ
brj-23306	146	30	incubated	incubate	VERB
brj-23306	146	31	at	at	ADP
brj-23306	146	32	37	37	NUM
brj-23306	146	33	°	°	NOUN
brj-23306	146	34	c	c	NOUN
brj-23306	146	35	for	for	ADP
brj-23306	146	36	24	24	NUM
brj-23306	146	37	h.	h.	NOUN
brj-23306	146	38	in	in	ADP
brj-23306	146	39	the	the	DET
brj-23306	146	40	microtiter	microtiter	NOUN
brj-23306	146	41	plates	plate	NOUN
brj-23306	146	42	,	,	PUNCT
brj-23306	146	43	particular	particular	ADJ
brj-23306	146	44	concentrations	concentration	NOUN
brj-23306	146	45	of	of	ADP
brj-23306	146	46	agnps	agnps	PROPN
brj-23306	146	47	were	be	AUX
brj-23306	146	48	supplemented	supplement	VERB
brj-23306	146	49	.	.	PUNCT
brj-23306	147	1	after	after	ADP
brj-23306	147	2	24	24	NUM
brj-23306	147	3	h	h	NOUN
brj-23306	147	4	,	,	PUNCT
brj-23306	147	5	the	the	DET
brj-23306	147	6	floating	float	VERB
brj-23306	147	7	non	non	ADJ
brj-23306	147	8	-	-	ADJ
brj-23306	147	9	adherent	adherent	ADJ
brj-23306	147	10	bacterial	bacterial	ADJ
brj-23306	147	11	cells	cell	NOUN
brj-23306	147	12	were	be	AUX
brj-23306	147	13	completely	completely	ADV
brj-23306	147	14	removed	remove	VERB
brj-23306	147	15	and	and	CCONJ
brj-23306	147	16	air	air	NOUN
brj-23306	147	17	dried	dry	VERB
brj-23306	147	18	for	for	ADP
brj-23306	147	19	30	30	NUM
brj-23306	147	20	min	min	NOUN
brj-23306	147	21	.	.	NOUN
brj-23306	148	1	after	after	ADP
brj-23306	148	2	30	30	NUM
brj-23306	148	3	min	min	NOUN
brj-23306	148	4	,	,	PUNCT
brj-23306	148	5	the	the	DET
brj-23306	148	6	plates	plate	NOUN
brj-23306	148	7	were	be	AUX
brj-23306	148	8	dried	dry	VERB
brj-23306	148	9	,	,	PUNCT
brj-23306	148	10	and	and	CCONJ
brj-23306	148	11	the	the	DET
brj-23306	148	12	wells	well	NOUN
brj-23306	148	13	were	be	AUX
brj-23306	148	14	stained	stain	VERB
brj-23306	148	15	with	with	ADP
brj-23306	148	16	crystal	crystal	NOUN
brj-23306	148	17	violet	violet	NOUN
brj-23306	148	18	and	and	CCONJ
brj-23306	148	19	incubated	incubate	VERB
brj-23306	148	20	in	in	ADP
brj-23306	148	21	the	the	DET
brj-23306	148	22	dark	dark	NOUN
brj-23306	148	23	for	for	ADP
brj-23306	148	24	10	10	NUM
brj-23306	148	25	min	min	NOUN
brj-23306	148	26	.	.	PUNCT
brj-23306	149	1	then	then	ADV
brj-23306	149	2	,	,	PUNCT
brj-23306	149	3	the	the	DET
brj-23306	149	4	excess	excess	ADJ
brj-23306	149	5	stain	stain	NOUN
brj-23306	149	6	was	be	AUX
brj-23306	149	7	removed	remove	VERB
brj-23306	149	8	and	and	CCONJ
brj-23306	149	9	washed	wash	VERB
brj-23306	149	10	with	with	ADP
brj-23306	149	11	sterile	sterile	ADJ
brj-23306	149	12	,	,	PUNCT
brj-23306	149	13	double	double	ADJ
brj-23306	149	14	-	-	PUNCT
brj-23306	149	15	distilled	distil	VERB
brj-23306	149	16	water	water	NOUN
brj-23306	149	17	.	.	PUNCT
brj-23306	150	1	the	the	DET
brj-23306	150	2	plate	plate	NOUN
brj-23306	150	3	was	be	AUX
brj-23306	150	4	air	air	NOUN
brj-23306	150	5	dried	dry	VERB
brj-23306	150	6	,	,	PUNCT
brj-23306	150	7	250	250	NUM
brj-23306	150	8	µl	µl	NOUN
brj-23306	150	9	of	of	ADP
brj-23306	150	10	ethanol	ethanol	NOUN
brj-23306	150	11	(	(	PUNCT
brj-23306	150	12	90	90	NUM
brj-23306	150	13	%	%	NOUN
brj-23306	150	14	)	)	PUNCT
brj-23306	150	15	was	be	AUX
brj-23306	150	16	added	add	VERB
brj-23306	150	17	,	,	PUNCT
brj-23306	150	18	and	and	CCONJ
brj-23306	150	19	the	the	DET
brj-23306	150	20	absorbance	absorbance	NOUN
brj-23306	150	21	of	of	ADP
brj-23306	150	22	the	the	DET
brj-23306	150	23	sample	sample	NOUN
brj-23306	150	24	was	be	AUX
brj-23306	150	25	measured	measure	VERB
brj-23306	150	26	at	at	ADP
brj-23306	150	27	620	620	NUM
brj-23306	150	28	nm	nm	NOUN
brj-23306	150	29	against	against	ADP
brj-23306	150	30	the	the	DET
brj-23306	150	31	reagent	reagent	ADJ
brj-23306	150	32	blank	blank	NOUN
brj-23306	150	33	.	.	PUNCT
brj-23306	151	1	the	the	DET
brj-23306	151	2	percentage	percentage	NOUN
brj-23306	151	3	optical	optical	ADJ
brj-23306	151	4	density	density	NOUN
brj-23306	151	5	of	of	ADP
brj-23306	151	6	the	the	DET
brj-23306	151	7	microtiter	microtiter	NOUN
brj-23306	151	8	plate	plate	NOUN
brj-23306	151	9	wells	well	NOUN
brj-23306	151	10	treated	treat	VERB
brj-23306	151	11	with	with	ADP
brj-23306	151	12	agnps	agnps	PROPN
brj-23306	151	13	was	be	AUX
brj-23306	151	14	compared	compare	VERB
brj-23306	151	15	with	with	ADP
brj-23306	151	16	the	the	DET
brj-23306	151	17	control	control	NOUN
brj-23306	151	18	.	.	PUNCT
brj-23306	152	1	photocatalytic	photocatalytic	ADJ
brj-23306	152	2	activity	activity	NOUN
brj-23306	152	3	of	of	ADP
brj-23306	152	4	agnps	agnps	PROPN
brj-23306	152	5	on	on	ADP
brj-23306	152	6	methylene	methylene	ADJ
brj-23306	152	7	blue	blue	ADJ
brj-23306	152	8	methylene	methylene	NOUN
brj-23306	152	9	blue	blue	NOUN
brj-23306	152	10	(	(	PUNCT
brj-23306	152	11	mb	mb	NOUN
brj-23306	152	12	)	)	PUNCT
brj-23306	152	13	was	be	AUX
brj-23306	152	14	prepared	prepare	VERB
brj-23306	152	15	at	at	ADP
brj-23306	152	16	a	a	DET
brj-23306	152	17	concentration	concentration	NOUN
brj-23306	152	18	of	of	ADP
brj-23306	152	19	10	10	NUM
brj-23306	152	20	ppm	ppm	NOUN
brj-23306	152	21	in	in	ADP
brj-23306	152	22	the	the	DET
brj-23306	152	23	doubledistilled	doubledistille	VERB
brj-23306	152	24	water	water	NOUN
brj-23306	152	25	.	.	PUNCT
brj-23306	153	1	two	two	NUM
brj-23306	153	2	ml	ml	NOUN
brj-23306	153	3	of	of	ADP
brj-23306	153	4	mb	mb	NOUN
brj-23306	153	5	was	be	AUX
brj-23306	153	6	mixed	mix	VERB
brj-23306	153	7	with	with	ADP
brj-23306	153	8	0.5	0.5	NUM
brj-23306	153	9	ml	ml	NOUN
brj-23306	153	10	of	of	ADP
brj-23306	153	11	agnps	agnps	ADJ
brj-23306	153	12	solution	solution	NOUN
brj-23306	153	13	(	(	PUNCT
brj-23306	153	14	10	10	NUM
brj-23306	153	15	ppm	ppm	NOUN
brj-23306	153	16	)	)	PUNCT
brj-23306	153	17	in	in	ADP
brj-23306	153	18	very	very	ADV
brj-23306	153	19	clean	clean	ADJ
brj-23306	153	20	glassware	glassware	NOUN
brj-23306	153	21	.	.	PUNCT
brj-23306	154	1	the	the	DET
brj-23306	154	2	photocatalytic	photocatalytic	ADJ
brj-23306	154	3	activity	activity	NOUN
brj-23306	154	4	was	be	AUX
brj-23306	154	5	regularly	regularly	ADV
brj-23306	154	6	monitored	monitor	VERB
brj-23306	154	7	at	at	ADP
brj-23306	154	8	660	660	NUM
brj-23306	154	9	nm	nm	NOUN
brj-23306	154	10	for	for	ADP
brj-23306	154	11	60	60	NUM
brj-23306	154	12	min	min	NOUN
brj-23306	154	13	.	.	PUNCT
brj-23306	155	1	the	the	DET
brj-23306	155	2	dye	dye	NOUN
brj-23306	155	3	degradation	degradation	NOUN
brj-23306	155	4	potentials	potential	NOUN
brj-23306	155	5	of	of	ADP
brj-23306	155	6	nps	nps	PROPN
brj-23306	155	7	were	be	AUX
brj-23306	155	8	calculated	calculate	VERB
brj-23306	155	9	using	use	VERB
brj-23306	155	10	eq	eq	ADP
brj-23306	155	11	.	.	PROPN
brj-23306	155	12	1	1	NUM
brj-23306	155	13	,	,	PUNCT
brj-23306	155	14	dye	dye	NOUN
brj-23306	155	15	degradation	degradation	NOUN
brj-23306	155	16	(	(	PUNCT
brj-23306	155	17	%	%	INTJ
brj-23306	155	18	)	)	PUNCT
brj-23306	155	19	=	=	PUNCT
brj-23306	156	1	(	(	PUNCT
brj-23306	156	2	1	1	NUM
brj-23306	156	3	−	−	NOUN
brj-23306	156	4	at	at	ADP
brj-23306	156	5	/	/	SYM
brj-23306	156	6	a0	a0	NOUN
brj-23306	156	7	)	)	PUNCT
brj-23306	156	8	(	(	PUNCT
brj-23306	156	9	1	1	X
brj-23306	156	10	)	)	PUNCT
brj-23306	156	11	where	where	SCONJ
brj-23306	156	12	at	at	ADP
brj-23306	156	13	is	be	AUX
brj-23306	156	14	the	the	DET
brj-23306	156	15	absorbance	absorbance	NOUN
brj-23306	156	16	after	after	ADP
brj-23306	156	17	time	time	NOUN
brj-23306	156	18	t	t	PROPN
brj-23306	156	19	(	(	PUNCT
brj-23306	156	20	min	min	NOUN
brj-23306	156	21	)	)	PUNCT
brj-23306	156	22	and	and	CCONJ
brj-23306	156	23	ao	ao	PROPN
brj-23306	156	24	is	be	AUX
brj-23306	156	25	the	the	DET
brj-23306	156	26	initial	initial	ADJ
brj-23306	156	27	absorbance	absorbance	NOUN
brj-23306	156	28	.	.	PUNCT
brj-23306	157	1	larvicidal	larvicidal	ADJ
brj-23306	157	2	activity	activity	NOUN
brj-23306	157	3	of	of	ADP
brj-23306	157	4	agnps	agnps	PROPN
brj-23306	157	5	third	third	ADJ
brj-23306	157	6	instar	instar	X
brj-23306	157	7	aedes	aedes	PROPN
brj-23306	157	8	aegypti	aegypti	VERB
brj-23306	157	9	(	(	PUNCT
brj-23306	157	10	n	n	NOUN
brj-23306	157	11	=	=	SYM
brj-23306	157	12	48	48	NUM
brj-23306	157	13	)	)	PUNCT
brj-23306	157	14	larvae	larvae	NOUN
brj-23306	157	15	were	be	AUX
brj-23306	157	16	maintained	maintain	VERB
brj-23306	157	17	in	in	ADP
brj-23306	157	18	a	a	DET
brj-23306	157	19	glass	glass	NOUN
brj-23306	157	20	beaker	beaker	NOUN
brj-23306	157	21	.	.	PUNCT
brj-23306	158	1	to	to	ADP
brj-23306	158	2	the	the	DET
brj-23306	158	3	beakers	beaker	NOUN
brj-23306	158	4	,	,	PUNCT
brj-23306	158	5	100	100	NUM
brj-23306	158	6	ml	ml	NOUN
brj-23306	158	7	of	of	ADP
brj-23306	158	8	tap	tap	NOUN
brj-23306	158	9	water	water	NOUN
brj-23306	158	10	was	be	AUX
brj-23306	158	11	added	add	VERB
brj-23306	158	12	,	,	PUNCT
brj-23306	158	13	and	and	CCONJ
brj-23306	158	14	different	different	ADJ
brj-23306	158	15	concentrations	concentration	NOUN
brj-23306	158	16	(	(	PUNCT
brj-23306	158	17	2.5	2.5	NUM
brj-23306	158	18	to	to	PART
brj-23306	158	19	10	10	NUM
brj-23306	158	20	mg	mg	NUM
brj-23306	158	21	/	/	SYM
brj-23306	158	22	l	l	NOUN
brj-23306	158	23	)	)	PUNCT
brj-23306	158	24	of	of	ADP
brj-23306	158	25	green	green	ADJ
brj-23306	158	26	synthesized	synthesize	VERB
brj-23306	158	27	agnps	agnps	NOUN
brj-23306	158	28	were	be	AUX
brj-23306	158	29	fixed	fix	VERB
brj-23306	158	30	.	.	PUNCT
brj-23306	159	1	to	to	ADP
brj-23306	159	2	the	the	DET
brj-23306	159	3	control	control	NOUN
brj-23306	159	4	group	group	NOUN
brj-23306	159	5	,	,	PUNCT
brj-23306	159	6	only	only	ADV
brj-23306	159	7	tap	tap	NOUN
brj-23306	159	8	water	water	NOUN
brj-23306	159	9	was	be	AUX
brj-23306	159	10	added	add	VERB
brj-23306	159	11	.	.	PUNCT
brj-23306	160	1	a	a	DET
brj-23306	160	2	complete	complete	ADJ
brj-23306	160	3	randomized	randomized	ADJ
brj-23306	160	4	experimental	experimental	ADJ
brj-23306	160	5	trial	trial	NOUN
brj-23306	160	6	was	be	AUX
brj-23306	160	7	performed	perform	VERB
brj-23306	160	8	.	.	PUNCT
brj-23306	161	1	the	the	DET
brj-23306	161	2	number	number	NOUN
brj-23306	161	3	of	of	ADP
brj-23306	161	4	dead	dead	ADJ
brj-23306	161	5	larvae	larvae	NOUN
brj-23306	161	6	was	be	AUX
brj-23306	161	7	counted	count	VERB
brj-23306	161	8	after	after	SCONJ
brj-23306	161	9	24	24	NUM
brj-23306	161	10	and	and	CCONJ
brj-23306	161	11	48	48	NUM
brj-23306	161	12	h	h	NOUN
brj-23306	161	13	of	of	ADP
brj-23306	161	14	exposure	exposure	NOUN
brj-23306	161	15	and	and	CCONJ
brj-23306	161	16	percentage	percentage	NOUN
brj-23306	161	17	mortality	mortality	NOUN
brj-23306	161	18	was	be	AUX
brj-23306	161	19	registered	register	VERB
brj-23306	161	20	.	.	PUNCT
brj-23306	162	1	peer	peer	NOUN
brj-23306	162	2	-	-	PUNCT
brj-23306	162	3	reviewed	review	VERB
brj-23306	162	4	article	article	NOUN
brj-23306	162	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	162	6	raju	raju	PROPN
brj-23306	162	7	et	et	PROPN
brj-23306	162	8	al	al	PROPN
brj-23306	162	9	.	.	PROPN
brj-23306	163	1	(	(	PUNCT
brj-23306	163	2	2024	2024	NUM
brj-23306	163	3	)	)	PUNCT
brj-23306	163	4	.	.	PUNCT
brj-23306	164	1	“	"	PUNCT
brj-23306	164	2	ag	ag	PROPN
brj-23306	164	3	nanoparticles	nanoparticle	NOUN
brj-23306	164	4	from	from	ADP
brj-23306	164	5	leaves	leave	NOUN
brj-23306	164	6	,	,	PUNCT
brj-23306	164	7	”	"	PUNCT
brj-23306	164	8	bioresources	bioresource	NOUN
brj-23306	164	9	19(2	19(2	NUM
brj-23306	164	10	)	)	PUNCT
brj-23306	164	11	,	,	PUNCT
brj-23306	164	12	3328	3328	NUM
brj-23306	164	13	-	-	SYM
brj-23306	164	14	3352	3352	NUM
brj-23306	164	15	.	.	PUNCT
brj-23306	164	16	3335	3335	NUM
brj-23306	164	17	chemical	chemical	NOUN
brj-23306	164	18	oxygen	oxygen	NOUN
brj-23306	164	19	demand	demand	NOUN
brj-23306	164	20	(	(	PUNCT
brj-23306	164	21	cod	cod	NOUN
brj-23306	164	22	)	)	PUNCT
brj-23306	164	23	and	and	CCONJ
brj-23306	164	24	bacterial	bacterial	ADJ
brj-23306	164	25	load	load	NOUN
brj-23306	164	26	determination	determination	NOUN
brj-23306	164	27	in	in	ADP
brj-23306	164	28	municipal	municipal	ADJ
brj-23306	164	29	wastewater	wastewater	NOUN
brj-23306	164	30	the	the	DET
brj-23306	164	31	cod	cod	NOUN
brj-23306	164	32	analysis	analysis	NOUN
brj-23306	164	33	of	of	ADP
brj-23306	164	34	municipal	municipal	ADJ
brj-23306	164	35	wastewater	wastewater	NOUN
brj-23306	164	36	(	(	PUNCT
brj-23306	164	37	n	n	NOUN
brj-23306	164	38	=	=	NOUN
brj-23306	164	39	4	4	NUM
brj-23306	164	40	)	)	PUNCT
brj-23306	164	41	before	before	SCONJ
brj-23306	164	42	and	and	CCONJ
brj-23306	164	43	after	after	SCONJ
brj-23306	164	44	agnps	agnps	ADJ
brj-23306	164	45	treatment	treatment	NOUN
brj-23306	164	46	was	be	AUX
brj-23306	164	47	performed	perform	VERB
brj-23306	164	48	using	use	VERB
brj-23306	164	49	colorimetric	colorimetric	ADJ
brj-23306	164	50	method	method	NOUN
brj-23306	164	51	.	.	PUNCT
brj-23306	165	1	aliquots	aliquot	NOUN
brj-23306	165	2	of	of	ADP
brj-23306	165	3	a	a	DET
brj-23306	165	4	10	10	NUM
brj-23306	165	5	ml	ml	NOUN
brj-23306	165	6	sample	sample	NOUN
brj-23306	165	7	were	be	AUX
brj-23306	165	8	collected	collect	VERB
brj-23306	165	9	before	before	ADV
brj-23306	165	10	and	and	CCONJ
brj-23306	165	11	after	after	ADP
brj-23306	165	12	agnps	agnps	ADJ
brj-23306	165	13	treatment	treatment	NOUN
brj-23306	165	14	.	.	PUNCT
brj-23306	166	1	the	the	DET
brj-23306	166	2	cod	cod	NOUN
brj-23306	166	3	analysis	analysis	NOUN
brj-23306	166	4	was	be	AUX
brj-23306	166	5	performed	perform	VERB
brj-23306	166	6	without	without	ADP
brj-23306	166	7	any	any	DET
brj-23306	166	8	sediment	sediment	NOUN
brj-23306	166	9	particles	particle	NOUN
brj-23306	166	10	.	.	PUNCT
brj-23306	167	1	the	the	DET
brj-23306	167	2	serial	serial	ADJ
brj-23306	167	3	dilution	dilution	NOUN
brj-23306	167	4	method	method	NOUN
brj-23306	167	5	was	be	AUX
brj-23306	167	6	used	use	VERB
brj-23306	167	7	for	for	ADP
brj-23306	167	8	the	the	DET
brj-23306	167	9	determination	determination	NOUN
brj-23306	167	10	of	of	ADP
brj-23306	167	11	total	total	ADJ
brj-23306	167	12	bacteria	bacteria	NOUN
brj-23306	167	13	in	in	ADP
brj-23306	167	14	the	the	DET
brj-23306	167	15	treated	treat	VERB
brj-23306	167	16	wastewater	wastewater	NOUN
brj-23306	167	17	.	.	PUNCT
brj-23306	168	1	statistical	statistical	ADJ
brj-23306	168	2	analysis	analysis	NOUN
brj-23306	168	3	graphpad	graphpad	NOUN
brj-23306	168	4	prism	prism	NOUN
brj-23306	168	5	9	9	NUM
brj-23306	168	6	(	(	PUNCT
brj-23306	168	7	graphpad	graphpad	NOUN
brj-23306	168	8	software	software	NOUN
brj-23306	168	9	in	in	ADP
brj-23306	168	10	,	,	PUNCT
brj-23306	168	11	prism	prism	NOUN
brj-23306	168	12	9	9	NUM
brj-23306	168	13	,	,	PUNCT
brj-23306	168	14	la	la	PROPN
brj-23306	168	15	jolla	jolla	PROPN
brj-23306	168	16	,	,	PUNCT
brj-23306	168	17	ca	ca	PROPN
brj-23306	168	18	,	,	PUNCT
brj-23306	168	19	usa	usa	PROPN
brj-23306	168	20	)	)	PUNCT
brj-23306	168	21	was	be	AUX
brj-23306	168	22	used	use	VERB
brj-23306	168	23	for	for	ADP
brj-23306	168	24	the	the	DET
brj-23306	168	25	statistical	statistical	ADJ
brj-23306	168	26	analysis	analysis	NOUN
brj-23306	168	27	.	.	PUNCT
brj-23306	169	1	experiments	experiment	NOUN
brj-23306	169	2	were	be	AUX
brj-23306	169	3	performed	perform	VERB
brj-23306	169	4	in	in	ADP
brj-23306	169	5	triplicate	triplicate	NOUN
brj-23306	169	6	.	.	PUNCT
brj-23306	170	1	the	the	DET
brj-23306	170	2	average	average	ADJ
brj-23306	170	3	standard	standard	ADJ
brj-23306	170	4	deviation	deviation	NOUN
brj-23306	170	5	(	(	PUNCT
brj-23306	170	6	sd	sd	NOUN
brj-23306	170	7	)	)	PUNCT
brj-23306	170	8	of	of	ADP
brj-23306	170	9	the	the	DET
brj-23306	170	10	used	used	ADJ
brj-23306	170	11	triplicates	triplicate	NOUN
brj-23306	170	12	was	be	AUX
brj-23306	170	13	used	use	VERB
brj-23306	170	14	to	to	PART
brj-23306	170	15	reflect	reflect	VERB
brj-23306	170	16	the	the	DET
brj-23306	170	17	outcomes	outcome	NOUN
brj-23306	170	18	of	of	ADP
brj-23306	170	19	each	each	DET
brj-23306	170	20	experiment	experiment	NOUN
brj-23306	170	21	.	.	PUNCT
brj-23306	171	1	one	one	NUM
brj-23306	171	2	-	-	PUNCT
brj-23306	171	3	way	way	NOUN
brj-23306	171	4	analysis	analysis	NOUN
brj-23306	171	5	of	of	ADP
brj-23306	171	6	variance	variance	NOUN
brj-23306	171	7	(	(	PUNCT
brj-23306	171	8	anova	anova	PROPN
brj-23306	171	9	)	)	PUNCT
brj-23306	171	10	(	(	PUNCT
brj-23306	171	11	dunnett	dunnett	PROPN
brj-23306	171	12	’s	’s	PART
brj-23306	171	13	test	test	NOUN
brj-23306	171	14	)	)	PUNCT
brj-23306	171	15	was	be	AUX
brj-23306	171	16	used	use	VERB
brj-23306	171	17	to	to	PART
brj-23306	171	18	achieve	achieve	VERB
brj-23306	171	19	the	the	DET
brj-23306	171	20	examination	examination	NOUN
brj-23306	171	21	of	of	ADP
brj-23306	171	22	variance	variance	NOUN
brj-23306	171	23	and	and	CCONJ
brj-23306	171	24	significant	significant	ADJ
brj-23306	171	25	variations	variation	NOUN
brj-23306	171	26	between	between	ADP
brj-23306	171	27	the	the	DET
brj-23306	171	28	means	mean	NOUN
brj-23306	171	29	with	with	ADP
brj-23306	171	30	p	p	X
brj-23306	171	31	<	<	X
brj-23306	171	32	0.05	0.05	NUM
brj-23306	171	33	.	.	PUNCT
brj-23306	172	1	results	result	NOUN
brj-23306	172	2	and	and	CCONJ
brj-23306	172	3	discussion	discussion	NOUN
brj-23306	172	4	qualitative	qualitative	VERB
brj-23306	172	5	phytochemical	phytochemical	ADJ
brj-23306	172	6	screening	screening	NOUN
brj-23306	172	7	the	the	DET
brj-23306	172	8	aqueous	aqueous	ADJ
brj-23306	172	9	extract	extract	NOUN
brj-23306	172	10	of	of	ADP
brj-23306	172	11	a.	a.	NOUN
brj-23306	172	12	purpurata	purpurata	PROPN
brj-23306	172	13	contains	contain	VERB
brj-23306	172	14	a	a	DET
brj-23306	172	15	spectrum	spectrum	NOUN
brj-23306	172	16	of	of	ADP
brj-23306	172	17	valuable	valuable	ADJ
brj-23306	172	18	phytochemicals	phytochemical	NOUN
brj-23306	172	19	,	,	PUNCT
brj-23306	172	20	including	include	VERB
brj-23306	172	21	alkaloids	alkaloid	NOUN
brj-23306	172	22	,	,	PUNCT
brj-23306	172	23	tannins	tannin	NOUN
brj-23306	172	24	,	,	PUNCT
brj-23306	172	25	phenolic	phenolic	ADJ
brj-23306	172	26	compounds	compound	NOUN
brj-23306	172	27	,	,	PUNCT
brj-23306	172	28	flavonoids	flavonoid	NOUN
brj-23306	172	29	,	,	PUNCT
brj-23306	172	30	steroids	steroid	NOUN
brj-23306	172	31	,	,	PUNCT
brj-23306	172	32	and	and	CCONJ
brj-23306	172	33	terpenoids	terpenoid	NOUN
brj-23306	172	34	(	(	PUNCT
brj-23306	172	35	table	table	NOUN
brj-23306	172	36	2	2	NUM
brj-23306	172	37	)	)	PUNCT
brj-23306	172	38	.	.	PUNCT
brj-23306	173	1	these	these	DET
brj-23306	173	2	phytochemicals	phytochemical	NOUN
brj-23306	173	3	are	be	AUX
brj-23306	173	4	organic	organic	ADJ
brj-23306	173	5	compounds	compound	NOUN
brj-23306	173	6	naturally	naturally	ADV
brj-23306	173	7	found	find	VERB
brj-23306	173	8	in	in	ADP
brj-23306	173	9	plants	plant	NOUN
brj-23306	173	10	,	,	PUNCT
brj-23306	173	11	each	each	PRON
brj-23306	173	12	with	with	ADP
brj-23306	173	13	their	their	PRON
brj-23306	173	14	unique	unique	ADJ
brj-23306	173	15	properties	property	NOUN
brj-23306	173	16	and	and	CCONJ
brj-23306	173	17	potential	potential	ADJ
brj-23306	173	18	health	health	NOUN
brj-23306	173	19	benefits	benefit	NOUN
brj-23306	173	20	.	.	PUNCT
brj-23306	174	1	the	the	DET
brj-23306	174	2	presence	presence	NOUN
brj-23306	174	3	of	of	ADP
brj-23306	174	4	various	various	ADJ
brj-23306	174	5	compounds	compound	NOUN
brj-23306	174	6	in	in	ADP
brj-23306	174	7	the	the	DET
brj-23306	174	8	extract	extract	NOUN
brj-23306	174	9	,	,	PUNCT
brj-23306	174	10	such	such	ADJ
brj-23306	174	11	as	as	ADP
brj-23306	174	12	alkaloids	alkaloid	NOUN
brj-23306	174	13	,	,	PUNCT
brj-23306	174	14	proteins	protein	NOUN
brj-23306	174	15	,	,	PUNCT
brj-23306	174	16	enzymes	enzyme	NOUN
brj-23306	174	17	,	,	PUNCT
brj-23306	174	18	amino	amino	NOUN
brj-23306	174	19	acids	acid	NOUN
brj-23306	174	20	,	,	PUNCT
brj-23306	174	21	alcoholic	alcoholic	ADJ
brj-23306	174	22	compounds	compound	NOUN
brj-23306	174	23	,	,	PUNCT
brj-23306	174	24	and	and	CCONJ
brj-23306	174	25	polysaccharides	polysaccharide	NOUN
brj-23306	174	26	,	,	PUNCT
brj-23306	174	27	indicates	indicate	VERB
brj-23306	174	28	a	a	DET
brj-23306	174	29	complex	complex	ADJ
brj-23306	174	30	mixture	mixture	NOUN
brj-23306	174	31	with	with	ADP
brj-23306	174	32	potential	potential	ADJ
brj-23306	174	33	reducing	reduce	VERB
brj-23306	174	34	properties	property	NOUN
brj-23306	174	35	for	for	ADP
brj-23306	174	36	silver	silver	ADJ
brj-23306	174	37	ions	ion	NOUN
brj-23306	174	38	(	(	PUNCT
brj-23306	174	39	mittal	mittal	PROPN
brj-23306	174	40	et	et	PROPN
brj-23306	174	41	al	al	PROPN
brj-23306	174	42	.	.	PROPN
brj-23306	174	43	2013	2013	NUM
brj-23306	174	44	)	)	PUNCT
brj-23306	174	45	.	.	PUNCT
brj-23306	175	1	alkaloids	alkaloid	NOUN
brj-23306	175	2	and	and	CCONJ
brj-23306	175	3	tannins	tannin	NOUN
brj-23306	175	4	are	be	AUX
brj-23306	175	5	recognized	recognize	VERB
brj-23306	175	6	for	for	ADP
brj-23306	175	7	their	their	PRON
brj-23306	175	8	potent	potent	ADJ
brj-23306	175	9	antioxidant	antioxidant	ADJ
brj-23306	175	10	capabilities	capability	NOUN
brj-23306	175	11	and	and	CCONJ
brj-23306	175	12	potential	potential	ADJ
brj-23306	175	13	medicinal	medicinal	ADJ
brj-23306	175	14	uses	use	NOUN
brj-23306	175	15	.	.	PUNCT
brj-23306	176	1	flavonoids	flavonoid	NOUN
brj-23306	176	2	are	be	AUX
brj-23306	176	3	known	know	VERB
brj-23306	176	4	for	for	ADP
brj-23306	176	5	their	their	PRON
brj-23306	176	6	strong	strong	ADJ
brj-23306	176	7	antioxidant	antioxidant	NOUN
brj-23306	176	8	and	and	CCONJ
brj-23306	176	9	anti	anti	ADJ
brj-23306	176	10	-	-	ADJ
brj-23306	176	11	inflammatory	inflammatory	ADJ
brj-23306	176	12	properties	property	NOUN
brj-23306	176	13	,	,	PUNCT
brj-23306	176	14	making	make	VERB
brj-23306	176	15	them	they	PRON
brj-23306	176	16	the	the	DET
brj-23306	176	17	phytoconstituents	phytoconstituent	NOUN
brj-23306	176	18	of	of	ADP
brj-23306	176	19	great	great	ADJ
brj-23306	176	20	interest	interest	NOUN
brj-23306	176	21	in	in	ADP
brj-23306	176	22	health	health	NOUN
brj-23306	176	23	and	and	CCONJ
brj-23306	176	24	nutrition	nutrition	NOUN
brj-23306	176	25	(	(	PUNCT
brj-23306	176	26	ullah	ullah	PROPN
brj-23306	176	27	et	et	PROPN
brj-23306	176	28	al	al	PROPN
brj-23306	176	29	.	.	PROPN
brj-23306	176	30	2020	2020	NUM
brj-23306	176	31	)	)	PUNCT
brj-23306	176	32	.	.	PUNCT
brj-23306	177	1	steroids	steroid	NOUN
brj-23306	177	2	,	,	PUNCT
brj-23306	177	3	a	a	DET
brj-23306	177	4	diverse	diverse	ADJ
brj-23306	177	5	group	group	NOUN
brj-23306	177	6	of	of	ADP
brj-23306	177	7	compounds	compound	NOUN
brj-23306	177	8	,	,	PUNCT
brj-23306	177	9	play	play	VERB
brj-23306	177	10	dynamic	dynamic	ADJ
brj-23306	177	11	roles	role	NOUN
brj-23306	177	12	in	in	ADP
brj-23306	177	13	various	various	ADJ
brj-23306	177	14	biological	biological	ADJ
brj-23306	177	15	processes	process	NOUN
brj-23306	177	16	and	and	CCONJ
brj-23306	177	17	are	be	AUX
brj-23306	177	18	crucial	crucial	ADJ
brj-23306	177	19	in	in	ADP
brj-23306	177	20	physiological	physiological	ADJ
brj-23306	177	21	functions	function	NOUN
brj-23306	177	22	(	(	PUNCT
brj-23306	177	23	adhya	adhya	PROPN
brj-23306	177	24	et	et	PROPN
brj-23306	177	25	al	al	PROPN
brj-23306	177	26	.	.	PROPN
brj-23306	177	27	2018	2018	NUM
brj-23306	177	28	)	)	PUNCT
brj-23306	177	29	.	.	PUNCT
brj-23306	178	1	additionally	additionally	ADV
brj-23306	178	2	,	,	PUNCT
brj-23306	178	3	terpenoids	terpenoid	NOUN
brj-23306	178	4	,	,	PUNCT
brj-23306	178	5	with	with	ADP
brj-23306	178	6	their	their	PRON
brj-23306	178	7	vast	vast	ADJ
brj-23306	178	8	diversity	diversity	NOUN
brj-23306	178	9	,	,	PUNCT
brj-23306	178	10	exhibit	exhibit	VERB
brj-23306	178	11	a	a	DET
brj-23306	178	12	wide	wide	ADJ
brj-23306	178	13	range	range	NOUN
brj-23306	178	14	of	of	ADP
brj-23306	178	15	pharmacological	pharmacological	ADJ
brj-23306	178	16	properties	property	NOUN
brj-23306	178	17	and	and	CCONJ
brj-23306	178	18	have	have	AUX
brj-23306	178	19	been	be	AUX
brj-23306	178	20	utilized	utilize	VERB
brj-23306	178	21	in	in	ADP
brj-23306	178	22	traditional	traditional	ADJ
brj-23306	178	23	medicine	medicine	NOUN
brj-23306	178	24	for	for	ADP
brj-23306	178	25	their	their	PRON
brj-23306	178	26	potential	potential	ADJ
brj-23306	178	27	health	health	NOUN
brj-23306	178	28	advantages	advantage	NOUN
brj-23306	178	29	.	.	PUNCT
brj-23306	179	1	table	table	NOUN
brj-23306	179	2	2	2	NUM
brj-23306	179	3	.	.	PUNCT
brj-23306	179	4	qualitative	qualitative	ADJ
brj-23306	179	5	phytochemical	phytochemical	ADJ
brj-23306	179	6	screening	screening	NOUN
brj-23306	179	7	of	of	ADP
brj-23306	179	8	a.	a.	PROPN
brj-23306	179	9	purpurata	purpurata	PROPN
brj-23306	179	10	s.	s.	PROPN
brj-23306	180	1	no	no	DET
brj-23306	180	2	phytochemicals	phytochemical	NOUN
brj-23306	180	3	aqueous	aqueous	ADJ
brj-23306	180	4	extract	extract	VERB
brj-23306	180	5	1	1	NUM
brj-23306	180	6	alkaloids	alkaloid	NOUN
brj-23306	180	7	+	+	CCONJ
brj-23306	180	8	2	2	NUM
brj-23306	180	9	saponin	saponin	NOUN
brj-23306	180	10	3	3	NUM
brj-23306	180	11	tannin	tannin	NOUN
brj-23306	180	12	and	and	CCONJ
brj-23306	180	13	phenolic	phenolic	ADJ
brj-23306	180	14	compounds	compound	NOUN
brj-23306	180	15	+	+	CCONJ
brj-23306	180	16	4	4	NUM
brj-23306	180	17	flavonoids	flavonoid	NOUN
brj-23306	180	18	+	+	SYM
brj-23306	180	19	5	5	NUM
brj-23306	180	20	steroids	steroid	NOUN
brj-23306	180	21	+	+	CCONJ
brj-23306	180	22	6	6	NUM
brj-23306	180	23	cardiac	cardiac	ADJ
brj-23306	180	24	glycosides	glycoside	NOUN
brj-23306	180	25	7	7	NUM
brj-23306	180	26	oils	oil	NOUN
brj-23306	180	27	and	and	CCONJ
brj-23306	180	28	fats	fat	VERB
brj-23306	180	29	8	8	NUM
brj-23306	180	30	terpenoids	terpenoid	NOUN
brj-23306	180	31	+	+	CCONJ
brj-23306	180	32	9	9	NUM
brj-23306	180	33	amino	amino	NOUN
brj-23306	180	34	acids	acid	NOUN
brj-23306	180	35	and	and	CCONJ
brj-23306	180	36	proteins	protein	NOUN
brj-23306	180	37	10	10	NUM
brj-23306	180	38	carbohydrates	carbohydrate	NOUN
brj-23306	180	39	presence	presence	NOUN
brj-23306	180	40	(	(	PUNCT
brj-23306	180	41	+	+	NOUN
brj-23306	180	42	)	)	PUNCT
brj-23306	180	43	,	,	PUNCT
brj-23306	180	44	absence	absence	NOUN
brj-23306	180	45	(	(	PUNCT
brj-23306	180	46	-	-	PUNCT
brj-23306	180	47	)	)	PUNCT
brj-23306	180	48	peer	peer	NOUN
brj-23306	180	49	-	-	PUNCT
brj-23306	180	50	reviewed	review	VERB
brj-23306	180	51	article	article	NOUN
brj-23306	180	52	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	180	53	raju	raju	PROPN
brj-23306	180	54	et	et	PROPN
brj-23306	180	55	al	al	PROPN
brj-23306	180	56	.	.	PROPN
brj-23306	181	1	(	(	PUNCT
brj-23306	181	2	2024	2024	NUM
brj-23306	181	3	)	)	PUNCT
brj-23306	181	4	.	.	PUNCT
brj-23306	182	1	“	"	PUNCT
brj-23306	182	2	ag	ag	PROPN
brj-23306	182	3	nanoparticles	nanoparticle	NOUN
brj-23306	182	4	from	from	ADP
brj-23306	182	5	leaves	leave	NOUN
brj-23306	182	6	,	,	PUNCT
brj-23306	182	7	”	"	PUNCT
brj-23306	182	8	bioresources	bioresource	NOUN
brj-23306	182	9	19(2	19(2	NUM
brj-23306	182	10	)	)	PUNCT
brj-23306	182	11	,	,	PUNCT
brj-23306	182	12	3328	3328	NUM
brj-23306	182	13	-	-	SYM
brj-23306	182	14	3352	3352	NUM
brj-23306	182	15	.	.	PUNCT
brj-23306	182	16	3336	3336	NUM
brj-23306	182	17	in	in	ADP
brj-23306	182	18	the	the	DET
brj-23306	182	19	realm	realm	NOUN
brj-23306	182	20	of	of	ADP
brj-23306	182	21	cancer	cancer	NOUN
brj-23306	182	22	treatment	treatment	NOUN
brj-23306	182	23	,	,	PUNCT
brj-23306	182	24	specific	specific	ADJ
brj-23306	182	25	alkaloids	alkaloid	NOUN
brj-23306	182	26	have	have	AUX
brj-23306	182	27	revealed	reveal	VERB
brj-23306	182	28	formidable	formidable	ADJ
brj-23306	182	29	cytotoxic	cytotoxic	ADJ
brj-23306	182	30	effects	effect	NOUN
brj-23306	182	31	on	on	ADP
brj-23306	182	32	cancer	cancer	NOUN
brj-23306	182	33	cells	cell	NOUN
brj-23306	182	34	.	.	PUNCT
brj-23306	183	1	they	they	PRON
brj-23306	183	2	disrupt	disrupt	VERB
brj-23306	183	3	vital	vital	ADJ
brj-23306	183	4	cellular	cellular	ADJ
brj-23306	183	5	mechanisms	mechanism	NOUN
brj-23306	183	6	,	,	PUNCT
brj-23306	183	7	such	such	ADJ
brj-23306	183	8	as	as	ADP
brj-23306	183	9	dna	dna	PROPN
brj-23306	183	10	replication	replication	NOUN
brj-23306	183	11	,	,	PUNCT
brj-23306	183	12	cell	cell	NOUN
brj-23306	183	13	cycle	cycle	NOUN
brj-23306	183	14	progression	progression	NOUN
brj-23306	183	15	,	,	PUNCT
brj-23306	183	16	and	and	CCONJ
brj-23306	183	17	protein	protein	NOUN
brj-23306	183	18	synthesis	synthesis	NOUN
brj-23306	183	19	.	.	PUNCT
brj-23306	184	1	ultimately	ultimately	ADV
brj-23306	184	2	,	,	PUNCT
brj-23306	184	3	this	this	DET
brj-23306	184	4	disruption	disruption	NOUN
brj-23306	184	5	triggers	trigger	VERB
brj-23306	184	6	apoptosis	apoptosis	NOUN
brj-23306	184	7	within	within	ADP
brj-23306	184	8	cancer	cancer	NOUN
brj-23306	184	9	cells	cell	NOUN
brj-23306	184	10	.	.	PUNCT
brj-23306	185	1	also	also	ADV
brj-23306	185	2	,	,	PUNCT
brj-23306	185	3	alkaloids	alkaloid	NOUN
brj-23306	185	4	have	have	AUX
brj-23306	185	5	been	be	AUX
brj-23306	185	6	noted	note	VERB
brj-23306	185	7	for	for	ADP
brj-23306	185	8	their	their	PRON
brj-23306	185	9	ability	ability	NOUN
brj-23306	185	10	to	to	PART
brj-23306	185	11	delay	delay	VERB
brj-23306	185	12	angiogenesis	angiogenesis	NOUN
brj-23306	185	13	(	(	PUNCT
brj-23306	185	14	an	an	DET
brj-23306	185	15	essential	essential	ADJ
brj-23306	185	16	process	process	NOUN
brj-23306	185	17	for	for	ADP
brj-23306	185	18	tumor	tumor	NOUN
brj-23306	185	19	advancement	advancement	NOUN
brj-23306	185	20	and	and	CCONJ
brj-23306	185	21	metastasis	metastasis	NOUN
brj-23306	185	22	by	by	ADP
brj-23306	185	23	inhibiting	inhibit	VERB
brj-23306	185	24	the	the	DET
brj-23306	185	25	growth	growth	NOUN
brj-23306	185	26	of	of	ADP
brj-23306	185	27	new	new	ADJ
brj-23306	185	28	blood	blood	NOUN
brj-23306	185	29	vessels	vessel	NOUN
brj-23306	185	30	)	)	PUNCT
brj-23306	185	31	(	(	PUNCT
brj-23306	185	32	khan	khan	PROPN
brj-23306	185	33	et	et	PROPN
brj-23306	185	34	al	al	PROPN
brj-23306	185	35	.	.	PROPN
brj-23306	185	36	2022	2022	NUM
brj-23306	185	37	)	)	PUNCT
brj-23306	185	38	.	.	PUNCT
brj-23306	186	1	agnps	agnps	ADJ
brj-23306	186	2	synthesis	synthesis	NOUN
brj-23306	186	3	synthesis	synthesis	NOUN
brj-23306	186	4	of	of	ADP
brj-23306	186	5	agnps	agnps	PROPN
brj-23306	186	6	was	be	AUX
brj-23306	186	7	confirmed	confirm	VERB
brj-23306	186	8	by	by	ADP
brj-23306	186	9	observing	observe	VERB
brj-23306	186	10	the	the	DET
brj-23306	186	11	change	change	NOUN
brj-23306	186	12	in	in	ADP
brj-23306	186	13	color	color	NOUN
brj-23306	186	14	of	of	ADP
brj-23306	186	15	the	the	DET
brj-23306	186	16	mixture	mixture	NOUN
brj-23306	186	17	from	from	ADP
brj-23306	186	18	orange	orange	NOUN
brj-23306	186	19	to	to	ADP
brj-23306	186	20	brown	brown	NOUN
brj-23306	186	21	(	(	PUNCT
brj-23306	186	22	fig	fig	NOUN
brj-23306	186	23	.	.	PUNCT
brj-23306	187	1	1	1	NUM
brj-23306	187	2	)	)	PUNCT
brj-23306	187	3	.	.	PUNCT
brj-23306	188	1	this	this	DET
brj-23306	188	2	transformation	transformation	NOUN
brj-23306	188	3	was	be	AUX
brj-23306	188	4	a	a	DET
brj-23306	188	5	result	result	NOUN
brj-23306	188	6	of	of	ADP
brj-23306	188	7	the	the	DET
brj-23306	188	8	bio	bio	NOUN
brj-23306	188	9	-	-	NOUN
brj-23306	188	10	reduction	reduction	NOUN
brj-23306	188	11	of	of	ADP
brj-23306	188	12	silver	silver	ADJ
brj-23306	188	13	nitrate	nitrate	NOUN
brj-23306	188	14	by	by	ADP
brj-23306	188	15	the	the	DET
brj-23306	188	16	phytochemicals	phytochemical	NOUN
brj-23306	188	17	present	present	ADJ
brj-23306	188	18	in	in	ADP
brj-23306	188	19	the	the	DET
brj-23306	188	20	plant	plant	NOUN
brj-23306	188	21	extract	extract	NOUN
brj-23306	188	22	.	.	PUNCT
brj-23306	189	1	color	color	NOUN
brj-23306	189	2	transformation	transformation	NOUN
brj-23306	189	3	was	be	AUX
brj-23306	189	4	regularly	regularly	ADV
brj-23306	189	5	observed	observe	VERB
brj-23306	189	6	,	,	PUNCT
brj-23306	189	7	and	and	CCONJ
brj-23306	189	8	a	a	DET
brj-23306	189	9	visible	visible	ADJ
brj-23306	189	10	change	change	NOUN
brj-23306	189	11	was	be	AUX
brj-23306	189	12	noticed	notice	VERB
brj-23306	189	13	after	after	ADP
brj-23306	189	14	about	about	ADV
brj-23306	189	15	3	3	NUM
brj-23306	189	16	to	to	PART
brj-23306	189	17	4	4	NUM
brj-23306	189	18	h.	h.	NOUN
brj-23306	189	19	this	this	DET
brj-23306	189	20	shift	shift	NOUN
brj-23306	189	21	to	to	ADP
brj-23306	189	22	a	a	DET
brj-23306	189	23	deeper	deep	ADJ
brj-23306	189	24	and	and	CCONJ
brj-23306	189	25	darker	dark	ADJ
brj-23306	189	26	color	color	NOUN
brj-23306	189	27	is	be	AUX
brj-23306	189	28	attributed	attribute	VERB
brj-23306	189	29	to	to	ADP
brj-23306	189	30	the	the	DET
brj-23306	189	31	surface	surface	NOUN
brj-23306	189	32	plasmon	plasmon	NOUN
brj-23306	189	33	resonance	resonance	NOUN
brj-23306	189	34	,	,	PUNCT
brj-23306	189	35	a	a	DET
brj-23306	189	36	size	size	NOUN
brj-23306	189	37	-	-	PUNCT
brj-23306	189	38	dependent	dependent	ADJ
brj-23306	189	39	trait	trait	NOUN
brj-23306	189	40	of	of	ADP
brj-23306	189	41	nanoparticles	nanoparticle	NOUN
brj-23306	189	42	.	.	PUNCT
brj-23306	190	1	surface	surface	NOUN
brj-23306	190	2	plasmon	plasmon	ADJ
brj-23306	190	3	resonance	resonance	NOUN
brj-23306	190	4	plays	play	VERB
brj-23306	190	5	a	a	DET
brj-23306	190	6	crucial	crucial	ADJ
brj-23306	190	7	role	role	NOUN
brj-23306	190	8	in	in	ADP
brj-23306	190	9	the	the	DET
brj-23306	190	10	comprehensive	comprehensive	ADJ
brj-23306	190	11	investigation	investigation	NOUN
brj-23306	190	12	and	and	CCONJ
brj-23306	190	13	design	design	NOUN
brj-23306	190	14	process	process	NOUN
brj-23306	190	15	of	of	ADP
brj-23306	190	16	new	new	ADJ
brj-23306	190	17	nanoparticles	nanoparticle	NOUN
brj-23306	190	18	for	for	ADP
brj-23306	190	19	biomedical	biomedical	ADJ
brj-23306	190	20	applications	application	NOUN
brj-23306	190	21	(	(	PUNCT
brj-23306	190	22	de	de	PROPN
brj-23306	190	23	macedo	macedo	PROPN
brj-23306	190	24	et	et	PROPN
brj-23306	190	25	al	al	PROPN
brj-23306	190	26	.	.	PROPN
brj-23306	190	27	2022	2022	NUM
brj-23306	190	28	)	)	PUNCT
brj-23306	190	29	.	.	PUNCT
brj-23306	191	1	the	the	DET
brj-23306	191	2	intensity	intensity	NOUN
brj-23306	191	3	of	of	ADP
brj-23306	191	4	the	the	DET
brj-23306	191	5	color	color	NOUN
brj-23306	191	6	change	change	NOUN
brj-23306	191	7	reflects	reflect	VERB
brj-23306	191	8	effective	effective	ADJ
brj-23306	191	9	bio	bio	NOUN
brj-23306	191	10	-	-	NOUN
brj-23306	191	11	reduction	reduction	NOUN
brj-23306	191	12	of	of	ADP
brj-23306	191	13	silver	silver	ADJ
brj-23306	191	14	ions	ion	NOUN
brj-23306	191	15	,	,	PUNCT
brj-23306	191	16	resulting	result	VERB
brj-23306	191	17	in	in	ADP
brj-23306	191	18	a	a	DET
brj-23306	191	19	significant	significant	ADJ
brj-23306	191	20	yield	yield	NOUN
brj-23306	191	21	of	of	ADP
brj-23306	191	22	silver	silver	ADJ
brj-23306	191	23	nanoparticles	nanoparticle	NOUN
brj-23306	191	24	within	within	ADP
brj-23306	191	25	24	24	NUM
brj-23306	191	26	h	h	NOUN
brj-23306	191	27	(	(	PUNCT
brj-23306	191	28	anandalakshmi	anandalakshmi	NOUN
brj-23306	191	29	et	et	PROPN
brj-23306	191	30	al	al	PROPN
brj-23306	191	31	.	.	PROPN
brj-23306	191	32	2015	2015	NUM
brj-23306	191	33	)	)	PUNCT
brj-23306	191	34	.	.	PUNCT
brj-23306	192	1	fig	fig	NOUN
brj-23306	192	2	.	.	PUNCT
brj-23306	193	1	1	1	X
brj-23306	193	2	.	.	X
brj-23306	193	3	color	color	NOUN
brj-23306	193	4	changes	change	NOUN
brj-23306	193	5	during	during	ADP
brj-23306	193	6	the	the	DET
brj-23306	193	7	synthesis	synthesis	NOUN
brj-23306	193	8	of	of	ADP
brj-23306	193	9	agnps	agnps	ADJ
brj-23306	193	10	(	(	PUNCT
brj-23306	193	11	a	a	PRON
brj-23306	193	12	)	)	PUNCT
brj-23306	193	13	plant	plant	NOUN
brj-23306	193	14	extract	extract	NOUN
brj-23306	193	15	and	and	CCONJ
brj-23306	193	16	(	(	PUNCT
brj-23306	193	17	b	b	NOUN
brj-23306	193	18	)	)	PUNCT
brj-23306	193	19	synthesized	synthesize	VERB
brj-23306	193	20	agnps	agnps	ADJ
brj-23306	193	21	characterization	characterization	NOUN
brj-23306	193	22	of	of	ADP
brj-23306	193	23	agnps	agnps	PROPN
brj-23306	193	24	uv‑vis	uv‑vis	DET
brj-23306	193	25	spectral	spectral	ADJ
brj-23306	193	26	analysis	analysis	NOUN
brj-23306	193	27	upon	upon	SCONJ
brj-23306	193	28	analyzing	analyze	VERB
brj-23306	193	29	the	the	DET
brj-23306	193	30	spectrum	spectrum	NOUN
brj-23306	193	31	of	of	ADP
brj-23306	193	32	the	the	DET
brj-23306	193	33	synthesized	synthesize	VERB
brj-23306	193	34	nanoparticles	nanoparticle	NOUN
brj-23306	193	35	,	,	PUNCT
brj-23306	193	36	a	a	DET
brj-23306	193	37	prominent	prominent	ADJ
brj-23306	193	38	absorbance	absorbance	NOUN
brj-23306	193	39	peak	peak	NOUN
brj-23306	193	40	at	at	ADP
brj-23306	193	41	420	420	NUM
brj-23306	193	42	nm	nm	NOUN
brj-23306	193	43	was	be	AUX
brj-23306	193	44	observed	observe	VERB
brj-23306	193	45	(	(	PUNCT
brj-23306	193	46	fig	fig	NOUN
brj-23306	193	47	.	.	PUNCT
brj-23306	194	1	2a	2a	NUM
brj-23306	194	2	)	)	PUNCT
brj-23306	194	3	,	,	PUNCT
brj-23306	194	4	which	which	PRON
brj-23306	194	5	is	be	AUX
brj-23306	194	6	a	a	DET
brj-23306	194	7	characteristic	characteristic	NOUN
brj-23306	194	8	of	of	ADP
brj-23306	194	9	surface	surface	NOUN
brj-23306	194	10	plasmon	plasmon	ADJ
brj-23306	194	11	resonance	resonance	NOUN
brj-23306	194	12	for	for	ADP
brj-23306	194	13	green	green	ADV
brj-23306	194	14	-	-	PUNCT
brj-23306	194	15	synthesized	synthesize	VERB
brj-23306	194	16	nanoparticles	nanoparticle	NOUN
brj-23306	194	17	(	(	PUNCT
brj-23306	194	18	kumar	kumar	PROPN
brj-23306	194	19	et	et	PROPN
brj-23306	194	20	al	al	PROPN
brj-23306	194	21	.	.	PROPN
brj-23306	194	22	2023	2023	NUM
brj-23306	194	23	)	)	PUNCT
brj-23306	194	24	.	.	PUNCT
brj-23306	195	1	an	an	DET
brj-23306	195	2	extraordinary	extraordinary	ADJ
brj-23306	195	3	optical	optical	ADJ
brj-23306	195	4	property	property	NOUN
brj-23306	195	5	of	of	ADP
brj-23306	195	6	agnps	agnps	PROPN
brj-23306	195	7	lies	lie	VERB
brj-23306	195	8	in	in	ADP
brj-23306	195	9	their	their	PRON
brj-23306	195	10	strong	strong	ADJ
brj-23306	195	11	interaction	interaction	NOUN
brj-23306	195	12	with	with	ADP
brj-23306	195	13	specific	specific	ADJ
brj-23306	195	14	light	light	ADJ
brj-23306	195	15	wavelengths	wavelength	NOUN
brj-23306	195	16	.	.	PUNCT
brj-23306	196	1	this	this	DET
brj-23306	196	2	interaction	interaction	NOUN
brj-23306	196	3	varies	vary	VERB
brj-23306	196	4	based	base	VERB
brj-23306	196	5	on	on	ADP
brj-23306	196	6	the	the	DET
brj-23306	196	7	size	size	NOUN
brj-23306	196	8	and	and	CCONJ
brj-23306	196	9	morphology	morphology	NOUN
brj-23306	196	10	of	of	ADP
brj-23306	196	11	the	the	DET
brj-23306	196	12	synthesized	synthesize	VERB
brj-23306	196	13	nanoparticles	nanoparticle	NOUN
brj-23306	196	14	,	,	PUNCT
brj-23306	196	15	giving	give	VERB
brj-23306	196	16	rise	rise	NOUN
brj-23306	196	17	to	to	ADP
brj-23306	196	18	a	a	DET
brj-23306	196	19	spectrum	spectrum	NOUN
brj-23306	196	20	of	of	ADP
brj-23306	196	21	colors	color	NOUN
brj-23306	196	22	,	,	PUNCT
brj-23306	196	23	spanning	span	VERB
brj-23306	196	24	from	from	ADP
brj-23306	196	25	orange	orange	PROPN
brj-23306	196	26	to	to	ADP
brj-23306	196	27	brown	brown	PROPN
brj-23306	196	28	.	.	PUNCT
brj-23306	197	1	in	in	ADP
brj-23306	197	2	this	this	DET
brj-23306	197	3	study	study	NOUN
brj-23306	197	4	,	,	PUNCT
brj-23306	197	5	the	the	DET
brj-23306	197	6	peak	peak	NOUN
brj-23306	197	7	exhibited	exhibit	VERB
brj-23306	197	8	a	a	DET
brj-23306	197	9	broad	broad	ADJ
brj-23306	197	10	spectrum	spectrum	NOUN
brj-23306	197	11	extending	extend	VERB
brj-23306	197	12	from	from	ADP
brj-23306	197	13	300	300	NUM
brj-23306	197	14	to	to	PART
brj-23306	197	15	600	600	NUM
brj-23306	197	16	nm	nm	NOUN
brj-23306	197	17	,	,	PUNCT
brj-23306	197	18	strongly	strongly	ADV
brj-23306	197	19	indicating	indicate	VERB
brj-23306	197	20	the	the	DET
brj-23306	197	21	presence	presence	NOUN
brj-23306	197	22	of	of	ADP
brj-23306	197	23	agnps	agnps	PROPN
brj-23306	197	24	in	in	ADP
brj-23306	197	25	the	the	DET
brj-23306	197	26	sample	sample	NOUN
brj-23306	197	27	solution	solution	NOUN
brj-23306	197	28	due	due	ADP
brj-23306	197	29	to	to	ADP
brj-23306	197	30	surface	surface	NOUN
brj-23306	197	31	plasmon	plasmon	ADJ
brj-23306	197	32	resonance	resonance	NOUN
brj-23306	197	33	.	.	PUNCT
brj-23306	198	1	the	the	DET
brj-23306	198	2	obtained	obtain	VERB
brj-23306	198	3	results	result	NOUN
brj-23306	198	4	closely	closely	ADV
brj-23306	198	5	resembled	resemble	VERB
brj-23306	198	6	those	those	PRON
brj-23306	198	7	reported	report	VERB
brj-23306	198	8	in	in	ADP
brj-23306	198	9	previous	previous	ADJ
brj-23306	198	10	study	study	NOUN
brj-23306	198	11	(	(	PUNCT
brj-23306	198	12	kumar	kumar	PROPN
brj-23306	198	13	et	et	PROPN
brj-23306	198	14	al	al	PROPN
brj-23306	198	15	.	.	PROPN
brj-23306	198	16	2023	2023	NUM
brj-23306	198	17	)	)	PUNCT
brj-23306	198	18	.	.	PUNCT
brj-23306	199	1	peer	peer	NOUN
brj-23306	199	2	-	-	PUNCT
brj-23306	199	3	reviewed	review	VERB
brj-23306	199	4	article	article	NOUN
brj-23306	199	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	199	6	raju	raju	PROPN
brj-23306	199	7	et	et	PROPN
brj-23306	199	8	al	al	PROPN
brj-23306	199	9	.	.	PROPN
brj-23306	200	1	(	(	PUNCT
brj-23306	200	2	2024	2024	NUM
brj-23306	200	3	)	)	PUNCT
brj-23306	200	4	.	.	PUNCT
brj-23306	201	1	“	"	PUNCT
brj-23306	201	2	ag	ag	PROPN
brj-23306	201	3	nanoparticles	nanoparticle	NOUN
brj-23306	201	4	from	from	ADP
brj-23306	201	5	leaves	leave	NOUN
brj-23306	201	6	,	,	PUNCT
brj-23306	201	7	”	"	PUNCT
brj-23306	201	8	bioresources	bioresource	NOUN
brj-23306	201	9	19(2	19(2	NUM
brj-23306	201	10	)	)	PUNCT
brj-23306	201	11	,	,	PUNCT
brj-23306	201	12	3328	3328	NUM
brj-23306	201	13	-	-	SYM
brj-23306	201	14	3352	3352	NUM
brj-23306	201	15	.	.	PUNCT
brj-23306	201	16	3337	3337	NUM
brj-23306	201	17	ft	ft	PROPN
brj-23306	201	18	-	-	PUNCT
brj-23306	201	19	ir	ir	NOUN
brj-23306	201	20	analysis	analysis	NOUN
brj-23306	201	21	agnps	agnps	PROPN
brj-23306	201	22	displayed	display	VERB
brj-23306	201	23	distinct	distinct	ADJ
brj-23306	201	24	absorbance	absorbance	NOUN
brj-23306	201	25	bands	band	NOUN
brj-23306	201	26	in	in	ADP
brj-23306	201	27	the	the	DET
brj-23306	201	28	infrared	infrared	ADJ
brj-23306	201	29	spectrum	spectrum	NOUN
brj-23306	201	30	.	.	PUNCT
brj-23306	202	1	notably	notably	ADV
brj-23306	202	2	,	,	PUNCT
brj-23306	202	3	a	a	DET
brj-23306	202	4	strong	strong	ADJ
brj-23306	202	5	absorbance	absorbance	NOUN
brj-23306	202	6	band	band	NOUN
brj-23306	202	7	was	be	AUX
brj-23306	202	8	observed	observe	VERB
brj-23306	202	9	at	at	ADP
brj-23306	202	10	approximately	approximately	ADV
brj-23306	202	11	3410.2	3410.2	NUM
brj-23306	202	12	cm-1	cm-1	NOUN
brj-23306	202	13	,	,	PUNCT
brj-23306	202	14	which	which	PRON
brj-23306	202	15	can	can	AUX
brj-23306	202	16	be	be	AUX
brj-23306	202	17	accredited	accredit	VERB
brj-23306	202	18	to	to	ADP
brj-23306	202	19	the	the	DET
brj-23306	202	20	presence	presence	NOUN
brj-23306	202	21	of	of	ADP
brj-23306	202	22	bonded	bond	VERB
brj-23306	202	23	o	o	PROPN
brj-23306	202	24	-	-	ADJ
brj-23306	202	25	h	h	ADJ
brj-23306	202	26	groups	group	NOUN
brj-23306	202	27	.	.	PUNCT
brj-23306	203	1	another	another	DET
brj-23306	203	2	absorbance	absorbance	NOUN
brj-23306	203	3	band	band	NOUN
brj-23306	203	4	was	be	AUX
brj-23306	203	5	noted	note	VERB
brj-23306	203	6	at	at	ADP
brj-23306	203	7	approximately	approximately	ADV
brj-23306	203	8	16249.1	16249.1	NUM
brj-23306	203	9	cm-1	cm-1	NOUN
brj-23306	203	10	,	,	PUNCT
brj-23306	203	11	indicating	indicate	VERB
brj-23306	203	12	the	the	DET
brj-23306	203	13	presence	presence	NOUN
brj-23306	203	14	of	of	ADP
brj-23306	203	15	c	c	NOUN
brj-23306	203	16	=	=	NOUN
brj-23306	203	17	c	c	NOUN
brj-23306	203	18	groups	group	NOUN
brj-23306	203	19	.	.	PUNCT
brj-23306	204	1	also	also	ADV
brj-23306	204	2	,	,	PUNCT
brj-23306	204	3	absorbance	absorbance	NOUN
brj-23306	204	4	bands	band	NOUN
brj-23306	204	5	were	be	AUX
brj-23306	204	6	identified	identify	VERB
brj-23306	204	7	at	at	ADP
brj-23306	204	8	around	around	ADP
brj-23306	204	9	1388.8	1388.8	NUM
brj-23306	204	10	cm-1	cm-1	NOUN
brj-23306	204	11	and	and	CCONJ
brj-23306	204	12	1112.9	1112.9	NUM
brj-23306	204	13	cm-1	cm-1	NOUN
brj-23306	204	14	,	,	PUNCT
brj-23306	204	15	corresponding	correspond	VERB
brj-23306	204	16	to	to	ADP
brj-23306	204	17	the	the	DET
brj-23306	204	18	presence	presence	NOUN
brj-23306	204	19	of	of	ADP
brj-23306	204	20	c	c	NOUN
brj-23306	204	21	-	-	PUNCT
brj-23306	204	22	n	n	NOUN
brj-23306	204	23	and	and	CCONJ
brj-23306	204	24	c	c	NOUN
brj-23306	204	25	-	-	PUNCT
brj-23306	204	26	o	o	NOUN
brj-23306	204	27	groups	group	NOUN
brj-23306	204	28	(	(	PUNCT
brj-23306	204	29	fig	fig	NOUN
brj-23306	204	30	.	.	PUNCT
brj-23306	204	31	2b	2b	NUM
brj-23306	204	32	)	)	PUNCT
brj-23306	204	33	.	.	PUNCT
brj-23306	205	1	the	the	DET
brj-23306	205	2	carbonyl	carbonyl	NOUN
brj-23306	205	3	group	group	NOUN
brj-23306	205	4	within	within	ADP
brj-23306	205	5	amino	amino	NOUN
brj-23306	205	6	acid	acid	NOUN
brj-23306	205	7	residues	residue	NOUN
brj-23306	205	8	demonstrates	demonstrate	VERB
brj-23306	205	9	a	a	DET
brj-23306	205	10	healthy	healthy	ADJ
brj-23306	205	11	affinity	affinity	NOUN
brj-23306	205	12	for	for	ADP
brj-23306	205	13	silver	silver	NOUN
brj-23306	205	14	,	,	PUNCT
brj-23306	205	15	implying	imply	VERB
brj-23306	205	16	the	the	DET
brj-23306	205	17	development	development	NOUN
brj-23306	205	18	of	of	ADP
brj-23306	205	19	protective	protective	ADJ
brj-23306	205	20	layers	layer	NOUN
brj-23306	205	21	composed	compose	VERB
brj-23306	205	22	of	of	ADP
brj-23306	205	23	agnps	agnps	PROPN
brj-23306	205	24	.	.	PUNCT
brj-23306	206	1	these	these	DET
brj-23306	206	2	layers	layer	NOUN
brj-23306	206	3	act	act	VERB
brj-23306	206	4	as	as	ADP
brj-23306	206	5	effective	effective	ADJ
brj-23306	206	6	capping	capping	NOUN
brj-23306	206	7	mediators	mediator	NOUN
brj-23306	206	8	,	,	PUNCT
brj-23306	206	9	preventing	prevent	VERB
brj-23306	206	10	agglomeration	agglomeration	NOUN
brj-23306	206	11	and	and	CCONJ
brj-23306	206	12	conferring	confer	VERB
brj-23306	206	13	stability	stability	NOUN
brj-23306	206	14	to	to	ADP
brj-23306	206	15	the	the	DET
brj-23306	206	16	medium	medium	NOUN
brj-23306	206	17	.	.	PUNCT
brj-23306	207	1	this	this	PRON
brj-23306	207	2	further	far	ADV
brj-23306	207	3	validates	validate	VERB
brj-23306	207	4	the	the	DET
brj-23306	207	5	role	role	NOUN
brj-23306	207	6	of	of	ADP
brj-23306	207	7	phytocompounds	phytocompound	NOUN
brj-23306	207	8	,	,	PUNCT
brj-23306	207	9	not	not	PART
brj-23306	207	10	only	only	ADV
brj-23306	207	11	in	in	ADP
brj-23306	207	12	reducing	reduce	VERB
brj-23306	207	13	silver	silver	NOUN
brj-23306	207	14	ions	ion	NOUN
brj-23306	207	15	but	but	CCONJ
brj-23306	207	16	also	also	ADV
brj-23306	207	17	in	in	ADP
brj-23306	207	18	stabilizing	stabilize	VERB
brj-23306	207	19	the	the	DET
brj-23306	207	20	resultant	resultant	NOUN
brj-23306	207	21	nanoparticles	nanoparticle	NOUN
brj-23306	207	22	(	(	PUNCT
brj-23306	207	23	zuhrotun	zuhrotun	NOUN
brj-23306	207	24	et	et	NOUN
brj-23306	207	25	al	al	PROPN
brj-23306	207	26	.	.	PROPN
brj-23306	207	27	2023	2023	NUM
brj-23306	207	28	)	)	PUNCT
brj-23306	207	29	.	.	PUNCT
brj-23306	208	1	hr	hr	PROPN
brj-23306	208	2	-	-	PUNCT
brj-23306	208	3	tem	tem	NOUN
brj-23306	208	4	with	with	ADP
brj-23306	208	5	edx	edx	PROPN
brj-23306	208	6	to	to	PART
brj-23306	208	7	ascertain	ascertain	VERB
brj-23306	208	8	the	the	DET
brj-23306	208	9	structural	structural	ADJ
brj-23306	208	10	morphology	morphology	NOUN
brj-23306	208	11	,	,	PUNCT
brj-23306	208	12	a	a	DET
brj-23306	208	13	detailed	detailed	ADJ
brj-23306	208	14	tem	tem	NOUN
brj-23306	208	15	analysis	analysis	NOUN
brj-23306	208	16	was	be	AUX
brj-23306	208	17	performed	perform	VERB
brj-23306	208	18	.	.	PUNCT
brj-23306	209	1	the	the	DET
brj-23306	209	2	tem	tem	PROPN
brj-23306	209	3	micrographs	micrograph	NOUN
brj-23306	209	4	distinctly	distinctly	ADV
brj-23306	209	5	displayed	display	VERB
brj-23306	209	6	agnps	agnps	PROPN
brj-23306	209	7	with	with	ADP
brj-23306	209	8	a	a	DET
brj-23306	209	9	particle	particle	NOUN
brj-23306	209	10	size	size	NOUN
brj-23306	209	11	ranging	range	VERB
brj-23306	209	12	between	between	ADP
brj-23306	209	13	10	10	NUM
brj-23306	209	14	and	and	CCONJ
brj-23306	209	15	30	30	NUM
brj-23306	209	16	nm	nm	NOUN
brj-23306	209	17	(	(	PUNCT
brj-23306	209	18	fig	fig	NOUN
brj-23306	209	19	.	.	PUNCT
brj-23306	209	20	2c	2c	NUM
brj-23306	209	21	)	)	PUNCT
brj-23306	209	22	.	.	PUNCT
brj-23306	210	1	this	this	DET
brj-23306	210	2	technique	technique	NOUN
brj-23306	210	3	stands	stand	VERB
brj-23306	210	4	as	as	ADP
brj-23306	210	5	a	a	DET
brj-23306	210	6	potent	potent	ADJ
brj-23306	210	7	tool	tool	NOUN
brj-23306	210	8	for	for	ADP
brj-23306	210	9	precise	precise	ADJ
brj-23306	210	10	characterization	characterization	NOUN
brj-23306	210	11	of	of	ADP
brj-23306	210	12	the	the	DET
brj-23306	210	13	size	size	NOUN
brj-23306	210	14	and	and	CCONJ
brj-23306	210	15	shape	shape	NOUN
brj-23306	210	16	of	of	ADP
brj-23306	210	17	nanoparticles	nanoparticle	NOUN
brj-23306	210	18	.	.	PUNCT
brj-23306	211	1	the	the	DET
brj-23306	211	2	selected	select	VERB
brj-23306	211	3	area	area	NOUN
brj-23306	211	4	electron	electron	NOUN
brj-23306	211	5	diffraction	diffraction	NOUN
brj-23306	211	6	pattern	pattern	NOUN
brj-23306	211	7	(	(	PUNCT
brj-23306	211	8	saed	saed	NOUN
brj-23306	211	9	)	)	PUNCT
brj-23306	211	10	of	of	ADP
brj-23306	211	11	the	the	DET
brj-23306	211	12	synthesized	synthesize	VERB
brj-23306	211	13	agnps	agnps	NOUN
brj-23306	211	14	showcased	showcase	VERB
brj-23306	211	15	prominent	prominent	ADJ
brj-23306	211	16	and	and	CCONJ
brj-23306	211	17	well	well	ADV
brj-23306	211	18	-	-	PUNCT
brj-23306	211	19	defined	define	VERB
brj-23306	211	20	rings	ring	NOUN
brj-23306	211	21	(	(	PUNCT
brj-23306	211	22	fig	fig	NOUN
brj-23306	211	23	.	.	PUNCT
brj-23306	211	24	2d	2d	NOUN
brj-23306	211	25	)	)	PUNCT
brj-23306	211	26	.	.	PUNCT
brj-23306	212	1	the	the	DET
brj-23306	212	2	nanoscale	nanoscale	NOUN
brj-23306	212	3	characterization	characterization	NOUN
brj-23306	212	4	through	through	ADP
brj-23306	212	5	tem	tem	PROPN
brj-23306	212	6	further	far	ADV
brj-23306	212	7	gave	give	VERB
brj-23306	212	8	evidence	evidence	NOUN
brj-23306	212	9	of	of	ADP
brj-23306	212	10	successful	successful	ADJ
brj-23306	212	11	nanoparticle	nanoparticle	NOUN
brj-23306	212	12	synthesis	synthesis	NOUN
brj-23306	212	13	from	from	ADP
brj-23306	212	14	the	the	DET
brj-23306	212	15	extract	extract	NOUN
brj-23306	212	16	.	.	PUNCT
brj-23306	213	1	for	for	ADP
brj-23306	213	2	a	a	DET
brj-23306	213	3	deeper	deep	ADJ
brj-23306	213	4	understanding	understanding	NOUN
brj-23306	213	5	,	,	PUNCT
brj-23306	213	6	an	an	DET
brj-23306	213	7	edx	edx	PROPN
brj-23306	213	8	micro	micro	NOUN
brj-23306	213	9	-	-	NOUN
brj-23306	213	10	analysis	analysis	NOUN
brj-23306	213	11	was	be	AUX
brj-23306	213	12	conducted	conduct	VERB
brj-23306	213	13	,	,	PUNCT
brj-23306	213	14	involving	involve	VERB
brj-23306	213	15	the	the	DET
brj-23306	213	16	study	study	NOUN
brj-23306	213	17	of	of	ADP
brj-23306	213	18	energy	energy	NOUN
brj-23306	213	19	and	and	CCONJ
brj-23306	213	20	intensity	intensity	NOUN
brj-23306	213	21	distribution	distribution	NOUN
brj-23306	213	22	of	of	ADP
brj-23306	213	23	x	x	NOUN
brj-23306	213	24	-	-	NOUN
brj-23306	213	25	ray	ray	NOUN
brj-23306	213	26	signals	signal	NOUN
brj-23306	213	27	originating	originate	VERB
brj-23306	213	28	from	from	ADP
brj-23306	213	29	the	the	DET
brj-23306	213	30	electron	electron	NOUN
brj-23306	213	31	beam	beam	NOUN
brj-23306	213	32	interacting	interact	VERB
brj-23306	213	33	with	with	ADP
brj-23306	213	34	the	the	DET
brj-23306	213	35	specimen	speciman	NOUN
brj-23306	213	36	.	.	PUNCT
brj-23306	214	1	the	the	DET
brj-23306	214	2	resulting	result	VERB
brj-23306	214	3	peaks	peak	NOUN
brj-23306	214	4	in	in	ADP
brj-23306	214	5	the	the	DET
brj-23306	214	6	edx	edx	NOUN
brj-23306	214	7	analysis	analysis	NOUN
brj-23306	214	8	are	be	AUX
brj-23306	214	9	graphically	graphically	ADV
brj-23306	214	10	shown	show	VERB
brj-23306	214	11	in	in	ADP
brj-23306	214	12	fig	fig	NOUN
brj-23306	214	13	.	.	PUNCT
brj-23306	215	1	2e	2e	NOUN
brj-23306	215	2	.	.	PUNCT
brj-23306	216	1	these	these	DET
brj-23306	216	2	spectra	spectra	NOUN
brj-23306	216	3	conclusively	conclusively	ADV
brj-23306	216	4	validate	validate	VERB
brj-23306	216	5	the	the	DET
brj-23306	216	6	presence	presence	NOUN
brj-23306	216	7	of	of	ADP
brj-23306	216	8	silver	silver	NOUN
brj-23306	216	9	(	(	PUNCT
brj-23306	216	10	ag	ag	PROPN
brj-23306	216	11	)	)	PUNCT
brj-23306	216	12	within	within	ADP
brj-23306	216	13	the	the	DET
brj-23306	216	14	synthesized	synthesize	VERB
brj-23306	216	15	agnps	agnps	NOUN
brj-23306	216	16	.	.	PUNCT
brj-23306	217	1	additionally	additionally	ADV
brj-23306	217	2	,	,	PUNCT
brj-23306	217	3	there	there	PRON
brj-23306	217	4	were	be	VERB
brj-23306	217	5	distinct	distinct	ADJ
brj-23306	217	6	peaks	peak	NOUN
brj-23306	217	7	corresponding	correspond	VERB
brj-23306	217	8	to	to	ADP
brj-23306	217	9	other	other	ADJ
brj-23306	217	10	metallic	metallic	ADJ
brj-23306	217	11	elements	element	NOUN
brj-23306	217	12	,	,	PUNCT
brj-23306	217	13	including	include	VERB
brj-23306	217	14	copper	copper	NOUN
brj-23306	217	15	(	(	PUNCT
brj-23306	217	16	cu	cu	PROPN
brj-23306	217	17	)	)	PUNCT
brj-23306	217	18	.	.	PUNCT
brj-23306	218	1	these	these	DET
brj-23306	218	2	elements	element	NOUN
brj-23306	218	3	point	point	VERB
brj-23306	218	4	to	to	ADP
brj-23306	218	5	the	the	DET
brj-23306	218	6	existence	existence	NOUN
brj-23306	218	7	of	of	ADP
brj-23306	218	8	capping	cap	VERB
brj-23306	218	9	organic	organic	ADJ
brj-23306	218	10	agents	agent	NOUN
brj-23306	218	11	firmly	firmly	ADV
brj-23306	218	12	bound	bind	VERB
brj-23306	218	13	to	to	ADP
brj-23306	218	14	the	the	DET
brj-23306	218	15	surface	surface	NOUN
brj-23306	218	16	of	of	ADP
brj-23306	218	17	the	the	DET
brj-23306	218	18	agnps	agnps	ADJ
brj-23306	218	19	(	(	PUNCT
brj-23306	218	20	abdulazeem	abdulazeem	PROPN
brj-23306	218	21	et	et	PROPN
brj-23306	218	22	al	al	PROPN
brj-23306	218	23	.	.	PROPN
brj-23306	218	24	2023	2023	NUM
brj-23306	218	25	)	)	PUNCT
brj-23306	218	26	.	.	PUNCT
brj-23306	219	1	the	the	DET
brj-23306	219	2	rings	ring	NOUN
brj-23306	219	3	represent	represent	VERB
brj-23306	219	4	the	the	DET
brj-23306	219	5	crystallographic	crystallographic	ADJ
brj-23306	219	6	planes	plane	NOUN
brj-23306	219	7	characteristic	characteristic	ADJ
brj-23306	219	8	within	within	ADP
brj-23306	219	9	the	the	DET
brj-23306	219	10	agnps	agnps	NOUN
brj-23306	219	11	,	,	PUNCT
brj-23306	219	12	offering	offer	VERB
brj-23306	219	13	critical	critical	ADJ
brj-23306	219	14	insights	insight	NOUN
brj-23306	219	15	into	into	ADP
brj-23306	219	16	their	their	PRON
brj-23306	219	17	crystalline	crystalline	ADJ
brj-23306	219	18	structure	structure	NOUN
brj-23306	219	19	.	.	PUNCT
brj-23306	220	1	the	the	DET
brj-23306	220	2	distinct	distinct	ADJ
brj-23306	220	3	arrangement	arrangement	NOUN
brj-23306	220	4	and	and	CCONJ
brj-23306	220	5	characteristics	characteristic	NOUN
brj-23306	220	6	of	of	ADP
brj-23306	220	7	these	these	DET
brj-23306	220	8	rings	ring	NOUN
brj-23306	220	9	within	within	ADP
brj-23306	220	10	the	the	DET
brj-23306	220	11	diffraction	diffraction	NOUN
brj-23306	220	12	pattern	pattern	NOUN
brj-23306	220	13	provide	provide	VERB
brj-23306	220	14	a	a	DET
brj-23306	220	15	window	window	NOUN
brj-23306	220	16	into	into	ADP
brj-23306	220	17	the	the	DET
brj-23306	220	18	orientation	orientation	NOUN
brj-23306	220	19	and	and	CCONJ
brj-23306	220	20	spatial	spatial	ADJ
brj-23306	220	21	organization	organization	NOUN
brj-23306	220	22	of	of	ADP
brj-23306	220	23	the	the	DET
brj-23306	220	24	nanoparticles	nanoparticle	NOUN
brj-23306	220	25	,	,	PUNCT
brj-23306	220	26	elevating	elevate	VERB
brj-23306	220	27	our	our	PRON
brj-23306	220	28	understanding	understanding	NOUN
brj-23306	220	29	of	of	ADP
brj-23306	220	30	their	their	PRON
brj-23306	220	31	properties	property	NOUN
brj-23306	220	32	and	and	CCONJ
brj-23306	220	33	potential	potential	ADJ
brj-23306	220	34	applications	application	NOUN
brj-23306	220	35	(	(	PUNCT
brj-23306	220	36	mourdikoudis	mourdikoudi	NOUN
brj-23306	220	37	et	et	PROPN
brj-23306	220	38	al	al	PROPN
brj-23306	220	39	.	.	PROPN
brj-23306	220	40	2018	2018	NUM
brj-23306	220	41	)	)	PUNCT
brj-23306	220	42	.	.	PUNCT
brj-23306	221	1	peer	peer	NOUN
brj-23306	221	2	-	-	PUNCT
brj-23306	221	3	reviewed	review	VERB
brj-23306	221	4	article	article	NOUN
brj-23306	221	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	221	6	raju	raju	PROPN
brj-23306	221	7	et	et	PROPN
brj-23306	221	8	al	al	PROPN
brj-23306	221	9	.	.	PROPN
brj-23306	222	1	(	(	PUNCT
brj-23306	222	2	2024	2024	NUM
brj-23306	222	3	)	)	PUNCT
brj-23306	222	4	.	.	PUNCT
brj-23306	223	1	“	"	PUNCT
brj-23306	223	2	ag	ag	PROPN
brj-23306	223	3	nanoparticles	nanoparticle	NOUN
brj-23306	223	4	from	from	ADP
brj-23306	223	5	leaves	leave	NOUN
brj-23306	223	6	,	,	PUNCT
brj-23306	223	7	”	"	PUNCT
brj-23306	223	8	bioresources	bioresource	NOUN
brj-23306	223	9	19(2	19(2	NUM
brj-23306	223	10	)	)	PUNCT
brj-23306	223	11	,	,	PUNCT
brj-23306	223	12	3328	3328	NUM
brj-23306	223	13	-	-	SYM
brj-23306	223	14	3352	3352	NUM
brj-23306	223	15	.	.	PUNCT
brj-23306	223	16	3338	3338	NUM
brj-23306	223	17	fig	fig	NOUN
brj-23306	223	18	.	.	PUNCT
brj-23306	224	1	2	2	X
brj-23306	224	2	.	.	X
brj-23306	224	3	characterization	characterization	NOUN
brj-23306	224	4	of	of	ADP
brj-23306	224	5	agnps	agnps	ADJ
brj-23306	224	6	:	:	PUNCT
brj-23306	224	7	(	(	PUNCT
brj-23306	224	8	a	a	X
brj-23306	224	9	)	)	PUNCT
brj-23306	224	10	uv	uv	NOUN
brj-23306	224	11	-	-	PUNCT
brj-23306	224	12	vis	vis	X
brj-23306	224	13	spectra	spectra	NOUN
brj-23306	224	14	,	,	PUNCT
brj-23306	224	15	(	(	PUNCT
brj-23306	224	16	b	b	NOUN
brj-23306	224	17	)	)	PUNCT
brj-23306	224	18	ft	ft	PROPN
brj-23306	224	19	-	-	PUNCT
brj-23306	224	20	ir	ir	NOUN
brj-23306	224	21	spectrum	spectrum	NOUN
brj-23306	224	22	,	,	PUNCT
brj-23306	224	23	(	(	PUNCT
brj-23306	224	24	c	c	X
brj-23306	224	25	)	)	PUNCT
brj-23306	224	26	hr	hr	NOUN
brj-23306	224	27	-	-	PUNCT
brj-23306	224	28	tem	tem	NOUN
brj-23306	224	29	image	image	NOUN
brj-23306	224	30	,	,	PUNCT
brj-23306	224	31	(	(	PUNCT
brj-23306	224	32	d	d	NOUN
brj-23306	224	33	)	)	PUNCT
brj-23306	224	34	saed	saed	NOUN
brj-23306	224	35	pattern	pattern	NOUN
brj-23306	224	36	,	,	PUNCT
brj-23306	224	37	and	and	CCONJ
brj-23306	224	38	(	(	PUNCT
brj-23306	224	39	e	e	NOUN
brj-23306	224	40	)	)	PUNCT
brj-23306	224	41	edx	edx	NOUN
brj-23306	224	42	analysis	analysis	NOUN
brj-23306	224	43	cytotoxic	cytotoxic	ADJ
brj-23306	224	44	activity	activity	NOUN
brj-23306	224	45	phase	phase	NOUN
brj-23306	224	46	contrast	contrast	VERB
brj-23306	224	47	images	image	NOUN
brj-23306	224	48	of	of	ADP
brj-23306	224	49	a549	a549	PROPN
brj-23306	224	50	and	and	CCONJ
brj-23306	224	51	pa1	pa1	NOUN
brj-23306	224	52	cells	cell	NOUN
brj-23306	224	53	at	at	ADP
brj-23306	224	54	different	different	ADJ
brj-23306	224	55	concentrations	concentration	NOUN
brj-23306	224	56	of	of	ADP
brj-23306	224	57	agnps	agnps	PROPN
brj-23306	224	58	represented	represent	VERB
brj-23306	224	59	significant	significant	ADJ
brj-23306	224	60	alterations	alteration	NOUN
brj-23306	224	61	in	in	ADP
brj-23306	224	62	the	the	DET
brj-23306	224	63	cellular	cellular	ADJ
brj-23306	224	64	morphology	morphology	NOUN
brj-23306	224	65	,	,	PUNCT
brj-23306	224	66	mainly	mainly	ADV
brj-23306	224	67	cell	cell	NOUN
brj-23306	224	68	detachment	detachment	NOUN
brj-23306	224	69	and	and	CCONJ
brj-23306	224	70	cellular	cellular	ADJ
brj-23306	224	71	shrinkage	shrinkage	NOUN
brj-23306	224	72	,	,	PUNCT
brj-23306	224	73	indicating	indicate	VERB
brj-23306	224	74	a	a	DET
brj-23306	224	75	notable	notable	ADJ
brj-23306	224	76	reduction	reduction	NOUN
brj-23306	224	77	in	in	ADP
brj-23306	224	78	cell	cell	NOUN
brj-23306	224	79	viability	viability	NOUN
brj-23306	224	80	.	.	PUNCT
brj-23306	225	1	the	the	DET
brj-23306	225	2	inhibition	inhibition	NOUN
brj-23306	225	3	of	of	ADP
brj-23306	225	4	cell	cell	NOUN
brj-23306	225	5	growth	growth	NOUN
brj-23306	225	6	ultimately	ultimately	ADV
brj-23306	225	7	led	lead	VERB
brj-23306	225	8	to	to	ADP
brj-23306	225	9	cell	cell	NOUN
brj-23306	225	10	death	death	NOUN
brj-23306	225	11	.	.	PUNCT
brj-23306	226	1	the	the	DET
brj-23306	226	2	study	study	NOUN
brj-23306	226	3	unequivocally	unequivocally	ADV
brj-23306	226	4	demonstrates	demonstrate	VERB
brj-23306	226	5	that	that	SCONJ
brj-23306	226	6	the	the	DET
brj-23306	226	7	cytotoxic	cytotoxic	ADJ
brj-23306	226	8	activity	activity	NOUN
brj-23306	226	9	of	of	ADP
brj-23306	226	10	agnps	agnps	PROPN
brj-23306	226	11	is	be	AUX
brj-23306	226	12	a	a	DET
brj-23306	226	13	dose	dose	NOUN
brj-23306	226	14	-	-	PUNCT
brj-23306	226	15	dependent	dependent	ADJ
brj-23306	226	16	process	process	NOUN
brj-23306	226	17	(	(	PUNCT
brj-23306	226	18	fig	fig	NOUN
brj-23306	226	19	.	.	PUNCT
brj-23306	226	20	3a	3a	NUM
brj-23306	226	21	)	)	PUNCT
brj-23306	226	22	.	.	PUNCT
brj-23306	227	1	the	the	DET
brj-23306	227	2	ic50	ic50	PROPN
brj-23306	227	3	values	value	NOUN
brj-23306	227	4	for	for	ADP
brj-23306	227	5	agnps	agnps	ADJ
brj-23306	227	6	were	be	AUX
brj-23306	227	7	calculated	calculate	VERB
brj-23306	227	8	as	as	ADP
brj-23306	227	9	3.48	3.48	NUM
brj-23306	227	10	±	±	NUM
brj-23306	227	11	0.4	0.4	NUM
brj-23306	227	12	µg	µg	NOUN
brj-23306	227	13	/	/	SYM
brj-23306	227	14	ml	ml	X
brj-23306	227	15	for	for	ADP
brj-23306	227	16	pa1	pa1	NOUN
brj-23306	227	17	cells	cell	NOUN
brj-23306	227	18	(	(	PUNCT
brj-23306	227	19	fig	fig	NOUN
brj-23306	227	20	.	.	PUNCT
brj-23306	228	1	3b	3b	NUM
brj-23306	228	2	)	)	PUNCT
brj-23306	228	3	and	and	CCONJ
brj-23306	228	4	4.59	4.59	NUM
brj-23306	228	5	±	±	NOUN
brj-23306	228	6	0.6	0.6	NUM
brj-23306	228	7	µg	µg	NOUN
brj-23306	228	8	/	/	SYM
brj-23306	228	9	ml	ml	NOUN
brj-23306	228	10	for	for	ADP
brj-23306	228	11	a549	a549	PROPN
brj-23306	228	12	cells	cell	NOUN
brj-23306	228	13	(	(	PUNCT
brj-23306	228	14	fig	fig	NOUN
brj-23306	228	15	.	.	PUNCT
brj-23306	229	1	3c	3c	NUM
brj-23306	229	2	)	)	PUNCT
brj-23306	229	3	.	.	PUNCT
brj-23306	230	1	in	in	ADP
brj-23306	230	2	a	a	DET
brj-23306	230	3	previously	previously	ADV
brj-23306	230	4	reported	report	VERB
brj-23306	230	5	study	study	NOUN
brj-23306	230	6	,	,	PUNCT
brj-23306	230	7	agnp	agnp	NOUN
brj-23306	230	8	at	at	ADP
brj-23306	230	9	a	a	DET
brj-23306	230	10	concentration	concentration	NOUN
brj-23306	230	11	of	of	ADP
brj-23306	230	12	2.5	2.5	NUM
brj-23306	230	13	 	 	SPACE
brj-23306	230	14	μg	μg	NOUN
brj-23306	230	15	/	/	SYM
brj-23306	230	16	ml	ml	PROPN
brj-23306	230	17	showed	show	VERB
brj-23306	230	18	80	80	NUM
brj-23306	230	19	%	%	NOUN
brj-23306	230	20	viability	viability	NOUN
brj-23306	230	21	of	of	ADP
brj-23306	230	22	healthy	healthy	ADJ
brj-23306	230	23	cells	cell	NOUN
brj-23306	230	24	,	,	PUNCT
brj-23306	230	25	whereas	whereas	SCONJ
brj-23306	230	26	the	the	DET
brj-23306	230	27	viability	viability	NOUN
brj-23306	230	28	of	of	ADP
brj-23306	230	29	cancer	cancer	NOUN
brj-23306	230	30	cells	cell	NOUN
brj-23306	230	31	was	be	AUX
brj-23306	230	32	less	less	ADJ
brj-23306	230	33	than	than	ADP
brj-23306	230	34	50	50	NUM
brj-23306	230	35	%	%	NOUN
brj-23306	230	36	.	.	PUNCT
brj-23306	231	1	this	this	DET
brj-23306	231	2	significant	significant	ADJ
brj-23306	231	3	difference	difference	NOUN
brj-23306	231	4	underscores	underscore	VERB
brj-23306	231	5	the	the	DET
brj-23306	231	6	potential	potential	ADJ
brj-23306	231	7	selectivity	selectivity	NOUN
brj-23306	231	8	of	of	ADP
brj-23306	231	9	agnps	agnps	PROPN
brj-23306	231	10	in	in	ADP
brj-23306	231	11	targeting	target	VERB
brj-23306	231	12	and	and	CCONJ
brj-23306	231	13	affecting	affect	VERB
brj-23306	231	14	cancer	cancer	NOUN
brj-23306	231	15	cells	cell	NOUN
brj-23306	231	16	,	,	PUNCT
brj-23306	231	17	while	while	SCONJ
brj-23306	231	18	exhibiting	exhibit	VERB
brj-23306	231	19	relatively	relatively	ADV
brj-23306	231	20	lower	low	ADJ
brj-23306	231	21	impact	impact	NOUN
brj-23306	231	22	on	on	ADP
brj-23306	231	23	healthy	healthy	ADJ
brj-23306	231	24	cells	cell	NOUN
brj-23306	231	25	,	,	PUNCT
brj-23306	231	26	which	which	PRON
brj-23306	231	27	is	be	AUX
brj-23306	231	28	a	a	DET
brj-23306	231	29	critical	critical	ADJ
brj-23306	231	30	aspect	aspect	NOUN
brj-23306	231	31	for	for	ADP
brj-23306	231	32	considering	consider	VERB
brj-23306	231	33	their	their	PRON
brj-23306	231	34	application	application	NOUN
brj-23306	231	35	in	in	ADP
brj-23306	231	36	cancer	cancer	NOUN
brj-23306	231	37	therapeutics	therapeutic	NOUN
brj-23306	231	38	(	(	PUNCT
brj-23306	231	39	artiukh	artiukh	NOUN
brj-23306	231	40	et	et	PROPN
brj-23306	231	41	al	al	PROPN
brj-23306	231	42	.	.	PROPN
brj-23306	231	43	2022	2022	NUM
brj-23306	231	44	)	)	PUNCT
brj-23306	231	45	.	.	PUNCT
brj-23306	232	1	peer	peer	NOUN
brj-23306	232	2	-	-	PUNCT
brj-23306	232	3	reviewed	review	VERB
brj-23306	232	4	article	article	NOUN
brj-23306	232	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	232	6	raju	raju	PROPN
brj-23306	232	7	et	et	PROPN
brj-23306	232	8	al	al	PROPN
brj-23306	232	9	.	.	PROPN
brj-23306	233	1	(	(	PUNCT
brj-23306	233	2	2024	2024	NUM
brj-23306	233	3	)	)	PUNCT
brj-23306	233	4	.	.	PUNCT
brj-23306	234	1	“	"	PUNCT
brj-23306	234	2	ag	ag	PROPN
brj-23306	234	3	nanoparticles	nanoparticle	NOUN
brj-23306	234	4	from	from	ADP
brj-23306	234	5	leaves	leave	NOUN
brj-23306	234	6	,	,	PUNCT
brj-23306	234	7	”	"	PUNCT
brj-23306	234	8	bioresources	bioresource	NOUN
brj-23306	234	9	19(2	19(2	NUM
brj-23306	234	10	)	)	PUNCT
brj-23306	234	11	,	,	PUNCT
brj-23306	234	12	3328	3328	NUM
brj-23306	234	13	-	-	SYM
brj-23306	234	14	3352	3352	NUM
brj-23306	234	15	.	.	PUNCT
brj-23306	234	16	3339	3339	NUM
brj-23306	234	17	fig	fig	NOUN
brj-23306	234	18	.	.	PUNCT
brj-23306	235	1	3	3	X
brj-23306	235	2	.	.	X
brj-23306	235	3	(	(	PUNCT
brj-23306	235	4	a	a	X
brj-23306	235	5	)	)	PUNCT
brj-23306	235	6	cytotoxic	cytotoxic	ADJ
brj-23306	235	7	activity	activity	NOUN
brj-23306	235	8	against	against	ADP
brj-23306	235	9	a549	a549	PROPN
brj-23306	235	10	and	and	CCONJ
brj-23306	235	11	pa1	pa1	NOUN
brj-23306	235	12	cells	cell	NOUN
brj-23306	235	13	,	,	PUNCT
brj-23306	235	14	(	(	PUNCT
brj-23306	235	15	b	b	X
brj-23306	235	16	)	)	PUNCT
brj-23306	235	17	ic50	ic50	PROPN
brj-23306	235	18	determination	determination	NOUN
brj-23306	235	19	against	against	ADP
brj-23306	235	20	pa1	pa1	NOUN
brj-23306	235	21	cells	cell	NOUN
brj-23306	235	22	,	,	PUNCT
brj-23306	235	23	and	and	CCONJ
brj-23306	235	24	(	(	PUNCT
brj-23306	235	25	c	c	X
brj-23306	235	26	)	)	PUNCT
brj-23306	235	27	ic50	ic50	PROPN
brj-23306	235	28	determination	determination	NOUN
brj-23306	235	29	against	against	ADP
brj-23306	235	30	a549	a549	PROPN
brj-23306	235	31	cells	cell	NOUN
brj-23306	235	32	flow	flow	VERB
brj-23306	235	33	cytometry	cytometry	NOUN
brj-23306	235	34	this	this	DET
brj-23306	235	35	study	study	NOUN
brj-23306	235	36	confirmed	confirm	VERB
brj-23306	235	37	that	that	SCONJ
brj-23306	235	38	exposure	exposure	NOUN
brj-23306	235	39	of	of	ADP
brj-23306	235	40	a549	a549	PROPN
brj-23306	235	41	cells	cell	NOUN
brj-23306	235	42	and	and	CCONJ
brj-23306	235	43	pa1	pa1	NOUN
brj-23306	235	44	cells	cell	NOUN
brj-23306	235	45	to	to	ADP
brj-23306	235	46	4.59	4.59	NUM
brj-23306	235	47	±	±	NUM
brj-23306	235	48	0.6	0.6	NUM
brj-23306	235	49	and	and	CCONJ
brj-23306	235	50	3.48	3.48	NUM
brj-23306	235	51	±	±	NUM
brj-23306	235	52	0.4	0.4	NUM
brj-23306	235	53	µg	µg	NOUN
brj-23306	235	54	/	/	SYM
brj-23306	235	55	ml	ml	PROPN
brj-23306	235	56	of	of	ADP
brj-23306	235	57	agnps	agnps	PROPN
brj-23306	235	58	led	lead	VERB
brj-23306	235	59	to	to	ADP
brj-23306	235	60	25.8	25.8	NUM
brj-23306	235	61	%	%	NOUN
brj-23306	235	62	and	and	CCONJ
brj-23306	235	63	54.9	54.9	NUM
brj-23306	235	64	%	%	NOUN
brj-23306	235	65	apoptosis	apoptosis	NOUN
brj-23306	235	66	(	(	PUNCT
brj-23306	235	67	fig	fig	NOUN
brj-23306	235	68	.	.	PUNCT
brj-23306	236	1	4	4	NUM
brj-23306	236	2	d	d	NOUN
brj-23306	236	3	,	,	PUNCT
brj-23306	236	4	e	e	NOUN
brj-23306	236	5	,	,	PUNCT
brj-23306	236	6	and	and	CCONJ
brj-23306	236	7	f	f	X
brj-23306	236	8	)	)	PUNCT
brj-23306	236	9	.	.	PUNCT
brj-23306	237	1	in	in	ADP
brj-23306	237	2	contrast	contrast	NOUN
brj-23306	237	3	,	,	PUNCT
brj-23306	237	4	the	the	DET
brj-23306	237	5	control	control	NOUN
brj-23306	237	6	group	group	NOUN
brj-23306	237	7	exhibited	exhibit	VERB
brj-23306	237	8	a	a	DET
brj-23306	237	9	remarkably	remarkably	ADV
brj-23306	237	10	high	high	ADJ
brj-23306	237	11	percentage	percentage	NOUN
brj-23306	237	12	of	of	ADP
brj-23306	237	13	viable	viable	ADJ
brj-23306	237	14	cells	cell	NOUN
brj-23306	237	15	(	(	PUNCT
brj-23306	237	16	99.86	99.86	NUM
brj-23306	237	17	%	%	NOUN
brj-23306	237	18	in	in	ADP
brj-23306	237	19	a549	a549	PROPN
brj-23306	237	20	and	and	CCONJ
brj-23306	237	21	98.28	98.28	NUM
brj-23306	237	22	%	%	NOUN
brj-23306	237	23	in	in	ADP
brj-23306	237	24	pa1	pa1	NOUN
brj-23306	237	25	cells	cell	NOUN
brj-23306	237	26	)	)	PUNCT
brj-23306	237	27	.	.	PUNCT
brj-23306	238	1	the	the	DET
brj-23306	238	2	flow	flow	NOUN
brj-23306	238	3	cytometry	cytometry	NOUN
brj-23306	238	4	analysis	analysis	NOUN
brj-23306	238	5	results	result	NOUN
brj-23306	238	6	are	be	AUX
brj-23306	238	7	visually	visually	ADV
brj-23306	238	8	presented	present	VERB
brj-23306	238	9	in	in	ADP
brj-23306	238	10	fig	fig	NOUN
brj-23306	238	11	.	.	PUNCT
brj-23306	239	1	4	4	NUM
brj-23306	239	2	j	j	PROPN
brj-23306	239	3	,	,	PUNCT
brj-23306	239	4	k	k	NOUN
brj-23306	239	5	,	,	PUNCT
brj-23306	239	6	and	and	CCONJ
brj-23306	239	7	l.	l.	NOUN
brj-23306	239	8	in	in	ADP
brj-23306	239	9	the	the	DET
brj-23306	239	10	control	control	NOUN
brj-23306	239	11	a549	a549	PROPN
brj-23306	239	12	cells	cell	NOUN
brj-23306	239	13	,	,	PUNCT
brj-23306	239	14	the	the	DET
brj-23306	239	15	r5	r5	PROPN
brj-23306	239	16	range	range	NOUN
brj-23306	239	17	signifies	signify	VERB
brj-23306	239	18	the	the	DET
brj-23306	239	19	presence	presence	NOUN
brj-23306	239	20	of	of	ADP
brj-23306	239	21	cell	cell	NOUN
brj-23306	239	22	viability	viability	NOUN
brj-23306	239	23	in	in	ADP
brj-23306	239	24	the	the	DET
brj-23306	239	25	g0	g0	PROPN
brj-23306	239	26	-	-	PUNCT
brj-23306	239	27	g1	g1	PROPN
brj-23306	239	28	phase	phase	NOUN
brj-23306	239	29	,	,	PUNCT
brj-23306	239	30	with	with	ADP
brj-23306	239	31	a	a	DET
brj-23306	239	32	recorded	record	VERB
brj-23306	239	33	viability	viability	NOUN
brj-23306	239	34	of	of	ADP
brj-23306	239	35	99.86	99.86	NUM
brj-23306	239	36	%	%	NOUN
brj-23306	239	37	.	.	PUNCT
brj-23306	240	1	conversely	conversely	ADV
brj-23306	240	2	,	,	PUNCT
brj-23306	240	3	the	the	DET
brj-23306	240	4	treated	treat	VERB
brj-23306	240	5	a549	a549	PROPN
brj-23306	240	6	cells	cell	NOUN
brj-23306	240	7	exhibited	exhibit	VERB
brj-23306	240	8	cell	cell	NOUN
brj-23306	240	9	death	death	NOUN
brj-23306	240	10	,	,	PUNCT
brj-23306	240	11	as	as	SCONJ
brj-23306	240	12	indicated	indicate	VERB
brj-23306	240	13	by	by	ADP
brj-23306	240	14	the	the	DET
brj-23306	240	15	r5	r5	PROPN
brj-23306	240	16	range	range	NOUN
brj-23306	240	17	at	at	ADP
brj-23306	240	18	76.4	76.4	NUM
brj-23306	240	19	%	%	NOUN
brj-23306	240	20	,	,	PUNCT
brj-23306	240	21	and	and	CCONJ
brj-23306	240	22	the	the	DET
brj-23306	240	23	viable	viable	ADJ
brj-23306	240	24	cells	cell	NOUN
brj-23306	240	25	in	in	ADP
brj-23306	240	26	the	the	DET
brj-23306	240	27	g0	g0	PROPN
brj-23306	240	28	-	-	PUNCT
brj-23306	240	29	g1	g1	PROPN
brj-23306	240	30	phase	phase	NOUN
brj-23306	240	31	at	at	ADP
brj-23306	240	32	25.8	25.8	NUM
brj-23306	240	33	%	%	NOUN
brj-23306	240	34	.	.	PUNCT
brj-23306	241	1	moving	move	VERB
brj-23306	241	2	to	to	ADP
brj-23306	241	3	the	the	DET
brj-23306	241	4	control	control	NOUN
brj-23306	241	5	pa1	pa1	PROPN
brj-23306	241	6	,	,	PUNCT
brj-23306	241	7	the	the	DET
brj-23306	241	8	r5	r5	PROPN
brj-23306	241	9	range	range	NOUN
brj-23306	241	10	also	also	ADV
brj-23306	241	11	indicated	indicate	VERB
brj-23306	241	12	the	the	DET
brj-23306	241	13	occurrence	occurrence	NOUN
brj-23306	241	14	of	of	ADP
brj-23306	241	15	cell	cell	NOUN
brj-23306	241	16	viability	viability	NOUN
brj-23306	241	17	in	in	ADP
brj-23306	241	18	the	the	DET
brj-23306	241	19	g0	g0	PROPN
brj-23306	241	20	-	-	PUNCT
brj-23306	241	21	g1	g1	PROPN
brj-23306	241	22	phase	phase	NOUN
brj-23306	241	23	,	,	PUNCT
brj-23306	241	24	with	with	ADP
brj-23306	241	25	a	a	DET
brj-23306	241	26	measured	measured	ADJ
brj-23306	241	27	viability	viability	NOUN
brj-23306	241	28	of	of	ADP
brj-23306	241	29	98.3	98.3	NUM
brj-23306	241	30	%	%	NOUN
brj-23306	241	31	.	.	PUNCT
brj-23306	242	1	however	however	ADV
brj-23306	242	2	,	,	PUNCT
brj-23306	242	3	the	the	DET
brj-23306	242	4	treated	treat	VERB
brj-23306	242	5	pa1	pa1	NOUN
brj-23306	242	6	displayed	display	VERB
brj-23306	242	7	cell	cell	NOUN
brj-23306	242	8	death	death	NOUN
brj-23306	242	9	,	,	PUNCT
brj-23306	242	10	marked	mark	VERB
brj-23306	242	11	by	by	ADP
brj-23306	242	12	the	the	DET
brj-23306	242	13	r5	r5	PROPN
brj-23306	242	14	range	range	NOUN
brj-23306	242	15	at	at	ADP
brj-23306	242	16	47.6	47.6	NUM
brj-23306	242	17	%	%	NOUN
brj-23306	242	18	,	,	PUNCT
brj-23306	242	19	and	and	CCONJ
brj-23306	242	20	the	the	DET
brj-23306	242	21	highest	high	ADJ
brj-23306	242	22	percentage	percentage	NOUN
brj-23306	242	23	of	of	ADP
brj-23306	242	24	viable	viable	ADJ
brj-23306	242	25	cells	cell	NOUN
brj-23306	242	26	in	in	ADP
brj-23306	242	27	the	the	DET
brj-23306	242	28	g0	g0	PROPN
brj-23306	242	29	-	-	PUNCT
brj-23306	242	30	g1	g1	PROPN
brj-23306	242	31	phase	phase	NOUN
brj-23306	242	32	at	at	ADP
brj-23306	242	33	54.9	54.9	NUM
brj-23306	242	34	%	%	NOUN
brj-23306	242	35	.	.	PUNCT
brj-23306	243	1	peer	peer	NOUN
brj-23306	243	2	-	-	PUNCT
brj-23306	243	3	reviewed	review	VERB
brj-23306	243	4	article	article	NOUN
brj-23306	243	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	243	6	raju	raju	PROPN
brj-23306	243	7	et	et	PROPN
brj-23306	243	8	al	al	PROPN
brj-23306	243	9	.	.	PROPN
brj-23306	244	1	(	(	PUNCT
brj-23306	244	2	2024	2024	NUM
brj-23306	244	3	)	)	PUNCT
brj-23306	244	4	.	.	PUNCT
brj-23306	245	1	“	"	PUNCT
brj-23306	245	2	ag	ag	PROPN
brj-23306	245	3	nanoparticles	nanoparticle	NOUN
brj-23306	245	4	from	from	ADP
brj-23306	245	5	leaves	leave	NOUN
brj-23306	245	6	,	,	PUNCT
brj-23306	245	7	”	"	PUNCT
brj-23306	245	8	bioresources	bioresource	NOUN
brj-23306	245	9	19(2	19(2	NUM
brj-23306	245	10	)	)	PUNCT
brj-23306	245	11	,	,	PUNCT
brj-23306	245	12	3328	3328	NUM
brj-23306	245	13	-	-	SYM
brj-23306	245	14	3352	3352	NUM
brj-23306	245	15	.	.	PUNCT
brj-23306	245	16	3340	3340	NUM
brj-23306	245	17	fig	fig	NOUN
brj-23306	245	18	.	.	PUNCT
brj-23306	246	1	4	4	X
brj-23306	246	2	.	.	X
brj-23306	246	3	(	(	PUNCT
brj-23306	246	4	a	a	X
brj-23306	246	5	)	)	PUNCT
brj-23306	246	6	,	,	PUNCT
brj-23306	246	7	(	(	PUNCT
brj-23306	246	8	b	b	NOUN
brj-23306	246	9	)	)	PUNCT
brj-23306	246	10	,	,	PUNCT
brj-23306	246	11	and	and	CCONJ
brj-23306	246	12	(	(	PUNCT
brj-23306	246	13	c	c	X
brj-23306	246	14	)	)	PUNCT
brj-23306	246	15	flow	flow	NOUN
brj-23306	246	16	cytometry	cytometry	NOUN
brj-23306	246	17	graph	graph	NOUN
brj-23306	246	18	of	of	ADP
brj-23306	246	19	control	control	NOUN
brj-23306	246	20	a549	a549	PROPN
brj-23306	246	21	cells	cell	NOUN
brj-23306	246	22	;	;	PUNCT
brj-23306	246	23	(	(	PUNCT
brj-23306	246	24	d	d	X
brj-23306	246	25	)	)	PUNCT
brj-23306	246	26	,	,	PUNCT
brj-23306	246	27	(	(	PUNCT
brj-23306	246	28	e	e	NOUN
brj-23306	246	29	)	)	PUNCT
brj-23306	246	30	,	,	PUNCT
brj-23306	246	31	and	and	CCONJ
brj-23306	246	32	(	(	PUNCT
brj-23306	246	33	f	f	X
brj-23306	246	34	)	)	PUNCT
brj-23306	246	35	flow	flow	NOUN
brj-23306	246	36	cytometry	cytometry	NOUN
brj-23306	246	37	graph	graph	NOUN
brj-23306	246	38	of	of	ADP
brj-23306	246	39	treated	treat	VERB
brj-23306	246	40	a549	a549	PROPN
brj-23306	246	41	cells	cell	NOUN
brj-23306	246	42	;	;	PUNCT
brj-23306	246	43	(	(	PUNCT
brj-23306	246	44	g	g	NOUN
brj-23306	246	45	)	)	PUNCT
brj-23306	246	46	,	,	PUNCT
brj-23306	246	47	(	(	PUNCT
brj-23306	246	48	h	h	NOUN
brj-23306	246	49	)	)	PUNCT
brj-23306	246	50	,	,	PUNCT
brj-23306	246	51	and	and	CCONJ
brj-23306	246	52	(	(	PUNCT
brj-23306	246	53	i	i	NOUN
brj-23306	246	54	)	)	PUNCT
brj-23306	246	55	flow	flow	VERB
brj-23306	246	56	cytometry	cytometry	NOUN
brj-23306	246	57	graph	graph	NOUN
brj-23306	246	58	of	of	ADP
brj-23306	246	59	control	control	NOUN
brj-23306	246	60	pa1	pa1	NOUN
brj-23306	246	61	cells	cell	NOUN
brj-23306	246	62	;	;	PUNCT
brj-23306	246	63	(	(	PUNCT
brj-23306	246	64	j	j	NOUN
brj-23306	246	65	)	)	PUNCT
brj-23306	246	66	,	,	PUNCT
brj-23306	246	67	(	(	PUNCT
brj-23306	246	68	k	k	NOUN
brj-23306	246	69	)	)	PUNCT
brj-23306	246	70	,	,	PUNCT
brj-23306	246	71	and	and	CCONJ
brj-23306	246	72	(	(	PUNCT
brj-23306	246	73	l	l	NOUN
brj-23306	246	74	)	)	PUNCT
brj-23306	246	75	flow	flow	NOUN
brj-23306	246	76	cytometry	cytometry	NOUN
brj-23306	246	77	graph	graph	NOUN
brj-23306	246	78	of	of	ADP
brj-23306	246	79	treated	treat	VERB
brj-23306	246	80	pa1	pa1	NOUN
brj-23306	246	81	cells	cell	NOUN
brj-23306	246	82	the	the	DET
brj-23306	246	83	conflicting	conflicting	ADJ
brj-23306	246	84	results	result	NOUN
brj-23306	246	85	observed	observe	VERB
brj-23306	246	86	in	in	ADP
brj-23306	246	87	this	this	DET
brj-23306	246	88	study	study	NOUN
brj-23306	246	89	strongly	strongly	ADV
brj-23306	246	90	suggest	suggest	VERB
brj-23306	246	91	that	that	SCONJ
brj-23306	246	92	the	the	DET
brj-23306	246	93	involvement	involvement	NOUN
brj-23306	246	94	of	of	ADP
brj-23306	246	95	additional	additional	ADJ
brj-23306	246	96	parameters	parameter	NOUN
brj-23306	246	97	that	that	PRON
brj-23306	246	98	influence	influence	VERB
brj-23306	246	99	nanoparticle	nanoparticle	NOUN
brj-23306	246	100	-	-	PUNCT
brj-23306	246	101	mediated	mediate	VERB
brj-23306	246	102	cell	cell	NOUN
brj-23306	246	103	death	death	NOUN
brj-23306	246	104	.	.	PUNCT
brj-23306	247	1	these	these	DET
brj-23306	247	2	variations	variation	NOUN
brj-23306	247	3	in	in	ADP
brj-23306	247	4	outcomes	outcome	NOUN
brj-23306	247	5	may	may	AUX
brj-23306	247	6	arise	arise	VERB
brj-23306	247	7	from	from	ADP
brj-23306	247	8	complex	complex	ADJ
brj-23306	247	9	interactions	interaction	NOUN
brj-23306	247	10	influenced	influence	VERB
brj-23306	247	11	by	by	ADP
brj-23306	247	12	factors	factor	NOUN
brj-23306	247	13	,	,	PUNCT
brj-23306	247	14	such	such	ADJ
brj-23306	247	15	as	as	ADP
brj-23306	247	16	nanoparticle	nanoparticle	NOUN
brj-23306	247	17	size	size	NOUN
brj-23306	247	18	,	,	PUNCT
brj-23306	247	19	concentration	concentration	NOUN
brj-23306	247	20	,	,	PUNCT
brj-23306	247	21	exposure	exposure	NOUN
brj-23306	247	22	duration	duration	NOUN
brj-23306	247	23	,	,	PUNCT
brj-23306	247	24	cell	cell	NOUN
brj-23306	247	25	type	type	NOUN
brj-23306	247	26	,	,	PUNCT
brj-23306	247	27	and	and	CCONJ
brj-23306	247	28	the	the	DET
brj-23306	247	29	specific	specific	ADJ
brj-23306	247	30	biological	biological	ADJ
brj-23306	247	31	environment	environment	NOUN
brj-23306	247	32	(	(	PUNCT
brj-23306	247	33	mohammadi	mohammadi	NOUN
brj-23306	247	34	et	et	PROPN
brj-23306	247	35	al	al	PROPN
brj-23306	247	36	.	.	PROPN
brj-23306	247	37	2021	2021	NUM
brj-23306	247	38	)	)	PUNCT
brj-23306	247	39	.	.	PUNCT
brj-23306	248	1	in	in	ADP
brj-23306	248	2	the	the	DET
brj-23306	248	3	study	study	NOUN
brj-23306	248	4	conducted	conduct	VERB
brj-23306	248	5	by	by	ADP
brj-23306	248	6	rezazadeh	rezazadeh	PROPN
brj-23306	248	7	et	et	PROPN
brj-23306	248	8	al	al	PROPN
brj-23306	248	9	.	.	PROPN
brj-23306	249	1	(	(	PUNCT
brj-23306	249	2	2018	2018	NUM
brj-23306	249	3	)	)	PUNCT
brj-23306	249	4	,	,	PUNCT
brj-23306	249	5	local	local	ADJ
brj-23306	249	6	delivery	delivery	NOUN
brj-23306	249	7	(	(	PUNCT
brj-23306	249	8	aerosol	aerosol	NOUN
brj-23306	249	9	)	)	PUNCT
brj-23306	249	10	of	of	ADP
brj-23306	249	11	chemotherapeutic	chemotherapeutic	ADJ
brj-23306	249	12	drugs	drug	NOUN
brj-23306	249	13	to	to	ADP
brj-23306	249	14	the	the	DET
brj-23306	249	15	lungs	lung	NOUN
brj-23306	249	16	was	be	AUX
brj-23306	249	17	highlighted	highlight	VERB
brj-23306	249	18	as	as	ADP
brj-23306	249	19	offering	offer	VERB
brj-23306	249	20	numerous	numerous	ADJ
brj-23306	249	21	advantages	advantage	NOUN
brj-23306	249	22	for	for	ADP
brj-23306	249	23	the	the	DET
brj-23306	249	24	treatment	treatment	NOUN
brj-23306	249	25	of	of	ADP
brj-23306	249	26	lung	lung	NOUN
brj-23306	249	27	cancer	cancer	NOUN
brj-23306	249	28	in	in	ADP
brj-23306	249	29	comparison	comparison	NOUN
brj-23306	249	30	to	to	ADP
brj-23306	249	31	conventional	conventional	ADJ
brj-23306	249	32	peer	peer	NOUN
brj-23306	249	33	-	-	PUNCT
brj-23306	249	34	reviewed	review	VERB
brj-23306	249	35	article	article	NOUN
brj-23306	249	36	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	249	37	raju	raju	PROPN
brj-23306	249	38	et	et	PROPN
brj-23306	249	39	al	al	PROPN
brj-23306	249	40	.	.	PROPN
brj-23306	250	1	(	(	PUNCT
brj-23306	250	2	2024	2024	NUM
brj-23306	250	3	)	)	PUNCT
brj-23306	250	4	.	.	PUNCT
brj-23306	251	1	“	"	PUNCT
brj-23306	251	2	ag	ag	PROPN
brj-23306	251	3	nanoparticles	nanoparticle	NOUN
brj-23306	251	4	from	from	ADP
brj-23306	251	5	leaves	leave	NOUN
brj-23306	251	6	,	,	PUNCT
brj-23306	251	7	”	"	PUNCT
brj-23306	251	8	bioresources	bioresource	NOUN
brj-23306	251	9	19(2	19(2	NUM
brj-23306	251	10	)	)	PUNCT
brj-23306	251	11	,	,	PUNCT
brj-23306	251	12	3328	3328	NUM
brj-23306	251	13	-	-	SYM
brj-23306	251	14	3352	3352	NUM
brj-23306	251	15	.	.	PUNCT
brj-23306	251	16	3341	3341	NUM
brj-23306	251	17	systemic	systemic	ADJ
brj-23306	251	18	chemotherapy	chemotherapy	NOUN
brj-23306	251	19	.	.	PUNCT
brj-23306	252	1	the	the	DET
brj-23306	252	2	researchers	researcher	NOUN
brj-23306	252	3	synthesized	synthesize	VERB
brj-23306	252	4	novel	novel	ADJ
brj-23306	252	5	mixed	mixed	ADJ
brj-23306	252	6	polymeric	polymeric	ADJ
brj-23306	252	7	micelles	micelle	NOUN
brj-23306	252	8	,	,	PUNCT
brj-23306	252	9	comprising	comprise	VERB
brj-23306	252	10	tocopheryl	tocopheryl	NOUN
brj-23306	252	11	succinate	succinate	NOUN
brj-23306	252	12	-	-	PUNCT
brj-23306	252	13	polyethylene	polyethylene	NOUN
brj-23306	252	14	glycol	glycol	NOUN
brj-23306	252	15	and	and	CCONJ
brj-23306	252	16	loaded	load	VERB
brj-23306	252	17	them	they	PRON
brj-23306	252	18	with	with	ADP
brj-23306	252	19	paclitaxel	paclitaxel	PROPN
brj-23306	252	20	.	.	PUNCT
brj-23306	253	1	subsequently	subsequently	ADV
brj-23306	253	2	,	,	PUNCT
brj-23306	253	3	the	the	DET
brj-23306	253	4	optimized	optimize	VERB
brj-23306	253	5	micelles	micelle	NOUN
brj-23306	253	6	were	be	AUX
brj-23306	253	7	incorporated	incorporate	VERB
brj-23306	253	8	into	into	ADP
brj-23306	253	9	lactose	lactose	ADJ
brj-23306	253	10	carrier	carrier	NOUN
brj-23306	253	11	particles	particle	NOUN
brj-23306	253	12	using	use	VERB
brj-23306	253	13	a	a	DET
brj-23306	253	14	spray	spray	NOUN
brj-23306	253	15	drying	dry	VERB
brj-23306	253	16	technique	technique	NOUN
brj-23306	253	17	,	,	PUNCT
brj-23306	253	18	resulting	result	VERB
brj-23306	253	19	in	in	ADP
brj-23306	253	20	the	the	DET
brj-23306	253	21	creation	creation	NOUN
brj-23306	253	22	of	of	ADP
brj-23306	253	23	a	a	DET
brj-23306	253	24	colloidal	colloidal	NOUN
brj-23306	253	25	aerosol	aerosol	NOUN
brj-23306	253	26	drug	drug	NOUN
brj-23306	253	27	delivery	delivery	NOUN
brj-23306	253	28	system	system	NOUN
brj-23306	253	29	.	.	PUNCT
brj-23306	254	1	the	the	DET
brj-23306	254	2	findings	finding	NOUN
brj-23306	254	3	presented	present	VERB
brj-23306	254	4	in	in	ADP
brj-23306	254	5	the	the	DET
brj-23306	254	6	study	study	NOUN
brj-23306	254	7	conducted	conduct	VERB
brj-23306	254	8	by	by	ADP
brj-23306	254	9	(	(	PUNCT
brj-23306	254	10	lee	lee	PROPN
brj-23306	254	11	et	et	PROPN
brj-23306	254	12	al	al	PROPN
brj-23306	254	13	.	.	PROPN
brj-23306	254	14	2011	2011	NUM
brj-23306	254	15	)	)	PUNCT
brj-23306	254	16	demonstrated	demonstrate	VERB
brj-23306	254	17	comparable	comparable	ADJ
brj-23306	254	18	outcomes	outcome	NOUN
brj-23306	254	19	,	,	PUNCT
brj-23306	254	20	indicating	indicate	VERB
brj-23306	254	21	that	that	SCONJ
brj-23306	254	22	silver	silver	ADJ
brj-23306	254	23	nanoparticles	nanoparticle	NOUN
brj-23306	254	24	exhibit	exhibit	VERB
brj-23306	254	25	similar	similar	ADJ
brj-23306	254	26	efficacy	efficacy	NOUN
brj-23306	254	27	in	in	ADP
brj-23306	254	28	cell	cell	NOUN
brj-23306	254	29	arrest	arrest	NOUN
brj-23306	254	30	.	.	PUNCT
brj-23306	255	1	the	the	DET
brj-23306	255	2	contradictory	contradictory	ADJ
brj-23306	255	3	outcomes	outcome	NOUN
brj-23306	255	4	observed	observe	VERB
brj-23306	255	5	in	in	ADP
brj-23306	255	6	this	this	DET
brj-23306	255	7	investigation	investigation	NOUN
brj-23306	255	8	strongly	strongly	ADV
brj-23306	255	9	indicate	indicate	VERB
brj-23306	255	10	the	the	DET
brj-23306	255	11	potential	potential	ADJ
brj-23306	255	12	influence	influence	NOUN
brj-23306	255	13	of	of	ADP
brj-23306	255	14	supplementary	supplementary	ADJ
brj-23306	255	15	factors	factor	NOUN
brj-23306	255	16	affecting	affect	VERB
brj-23306	255	17	nanoparticle	nanoparticle	NOUN
brj-23306	255	18	-	-	PUNCT
brj-23306	255	19	induced	induce	VERB
brj-23306	255	20	cell	cell	NOUN
brj-23306	255	21	death	death	NOUN
brj-23306	255	22	.	.	PUNCT
brj-23306	256	1	apoptosis	apoptosis	NOUN
brj-23306	256	2	induced	induce	VERB
brj-23306	256	3	in	in	ADP
brj-23306	256	4	the	the	DET
brj-23306	256	5	cells	cell	NOUN
brj-23306	256	6	treated	treat	VERB
brj-23306	256	7	with	with	ADP
brj-23306	256	8	agnps	agnps	PROPN
brj-23306	256	9	resulted	result	VERB
brj-23306	256	10	in	in	ADP
brj-23306	256	11	a	a	DET
brj-23306	256	12	decrease	decrease	NOUN
brj-23306	256	13	in	in	ADP
brj-23306	256	14	the	the	DET
brj-23306	256	15	proportion	proportion	NOUN
brj-23306	256	16	of	of	ADP
brj-23306	256	17	cells	cell	NOUN
brj-23306	256	18	in	in	ADP
brj-23306	256	19	the	the	DET
brj-23306	256	20	g0	g0	PROPN
brj-23306	256	21	/	/	SYM
brj-23306	256	22	g1	g1	PROPN
brj-23306	256	23	phase	phase	NOUN
brj-23306	256	24	and	and	CCONJ
brj-23306	256	25	an	an	DET
brj-23306	256	26	elevation	elevation	NOUN
brj-23306	256	27	in	in	ADP
brj-23306	256	28	the	the	DET
brj-23306	256	29	proportion	proportion	NOUN
brj-23306	256	30	of	of	ADP
brj-23306	256	31	cells	cell	NOUN
brj-23306	256	32	in	in	ADP
brj-23306	256	33	the	the	DET
brj-23306	256	34	g2	g2	PROPN
brj-23306	256	35	/	/	SYM
brj-23306	256	36	m	m	PROPN
brj-23306	256	37	phase	phase	NOUN
brj-23306	256	38	.	.	PUNCT
brj-23306	257	1	this	this	DET
brj-23306	257	2	shift	shift	NOUN
brj-23306	257	3	indicates	indicate	VERB
brj-23306	257	4	cell	cell	NOUN
brj-23306	257	5	cycle	cycle	NOUN
brj-23306	257	6	arrest	arrest	NOUN
brj-23306	257	7	at	at	ADP
brj-23306	257	8	the	the	DET
brj-23306	257	9	g2	g2	PROPN
brj-23306	257	10	/	/	SYM
brj-23306	257	11	m	m	PROPN
brj-23306	257	12	phase	phase	NOUN
brj-23306	257	13	.	.	PUNCT
brj-23306	258	1	dna	dna	PROPN
brj-23306	258	2	fragmentation	fragmentation	NOUN
brj-23306	258	3	analysis	analysis	NOUN
brj-23306	258	4	to	to	PART
brj-23306	258	5	evaluate	evaluate	VERB
brj-23306	258	6	the	the	DET
brj-23306	258	7	effect	effect	NOUN
brj-23306	258	8	of	of	ADP
brj-23306	258	9	the	the	DET
brj-23306	258	10	synthesized	synthesize	VERB
brj-23306	258	11	agnps	agnps	NOUN
brj-23306	258	12	on	on	ADP
brj-23306	258	13	dna	dna	PROPN
brj-23306	258	14	damage	damage	NOUN
brj-23306	258	15	,	,	PUNCT
brj-23306	258	16	the	the	DET
brj-23306	258	17	a549	a549	PROPN
brj-23306	258	18	and	and	CCONJ
brj-23306	258	19	pa1	pa1	NOUN
brj-23306	258	20	cell	cell	NOUN
brj-23306	258	21	lines	line	NOUN
brj-23306	258	22	were	be	AUX
brj-23306	258	23	treated	treat	VERB
brj-23306	258	24	with	with	ADP
brj-23306	258	25	100	100	NUM
brj-23306	258	26	µl	µl	NOUN
brj-23306	258	27	of	of	ADP
brj-23306	258	28	the	the	DET
brj-23306	258	29	effective	effective	ADJ
brj-23306	258	30	concentration	concentration	NOUN
brj-23306	258	31	(	(	PUNCT
brj-23306	258	32	as	as	SCONJ
brj-23306	258	33	determined	determine	VERB
brj-23306	258	34	by	by	ADP
brj-23306	258	35	the	the	DET
brj-23306	258	36	mtt	mtt	NOUN
brj-23306	258	37	cell	cell	NOUN
brj-23306	258	38	viability	viability	NOUN
brj-23306	258	39	assay	assay	PROPN
brj-23306	258	40	)	)	PUNCT
brj-23306	258	41	of	of	ADP
brj-23306	258	42	agnps	agnps	PROPN
brj-23306	258	43	for	for	ADP
brj-23306	258	44	24	24	NUM
brj-23306	258	45	h.	h.	NOUN
brj-23306	258	46	the	the	DET
brj-23306	258	47	results	result	NOUN
brj-23306	258	48	vividly	vividly	ADV
brj-23306	258	49	demonstrated	demonstrate	VERB
brj-23306	258	50	that	that	SCONJ
brj-23306	258	51	agnps	agnps	PROPN
brj-23306	258	52	induced	induce	VERB
brj-23306	258	53	a	a	DET
brj-23306	258	54	prominent	prominent	ADJ
brj-23306	258	55	increase	increase	NOUN
brj-23306	258	56	in	in	ADP
brj-23306	258	57	cell	cell	NOUN
brj-23306	258	58	death	death	NOUN
brj-23306	258	59	by	by	ADP
brj-23306	258	60	causing	cause	VERB
brj-23306	258	61	fragmentation	fragmentation	NOUN
brj-23306	258	62	of	of	ADP
brj-23306	258	63	nuclear	nuclear	ADJ
brj-23306	258	64	dna	dna	NOUN
brj-23306	258	65	in	in	ADP
brj-23306	258	66	both	both	PRON
brj-23306	258	67	a549	a549	PROPN
brj-23306	258	68	and	and	CCONJ
brj-23306	258	69	pa1	pa1	NOUN
brj-23306	258	70	cells	cell	NOUN
brj-23306	258	71	,	,	PUNCT
brj-23306	258	72	resulting	result	VERB
brj-23306	258	73	in	in	ADP
brj-23306	258	74	a	a	DET
brj-23306	258	75	distinct	distinct	ADJ
brj-23306	258	76	ladder	ladder	NOUN
brj-23306	258	77	-	-	PUNCT
brj-23306	258	78	like	like	ADJ
brj-23306	258	79	pattern	pattern	NOUN
brj-23306	258	80	.	.	PUNCT
brj-23306	259	1	this	this	DET
brj-23306	259	2	observation	observation	NOUN
brj-23306	259	3	underscores	underscore	VERB
brj-23306	259	4	the	the	DET
brj-23306	259	5	potential	potential	NOUN
brj-23306	259	6	of	of	ADP
brj-23306	259	7	agnps	agnps	PROPN
brj-23306	259	8	to	to	PART
brj-23306	259	9	induce	induce	VERB
brj-23306	259	10	significant	significant	ADJ
brj-23306	259	11	cellular	cellular	ADJ
brj-23306	259	12	changes	change	NOUN
brj-23306	259	13	,	,	PUNCT
brj-23306	259	14	particularly	particularly	ADV
brj-23306	259	15	in	in	ADP
brj-23306	259	16	terms	term	NOUN
brj-23306	259	17	of	of	ADP
brj-23306	259	18	dna	dna	PROPN
brj-23306	259	19	integrity	integrity	NOUN
brj-23306	259	20	and	and	CCONJ
brj-23306	259	21	cell	cell	NOUN
brj-23306	259	22	viability	viability	NOUN
brj-23306	259	23	.	.	PUNCT
brj-23306	260	1	a	a	DET
brj-23306	260	2	comparable	comparable	ADJ
brj-23306	260	3	outcome	outcome	NOUN
brj-23306	260	4	was	be	AUX
brj-23306	260	5	substantiated	substantiate	VERB
brj-23306	260	6	by	by	ADP
brj-23306	260	7	chaturvedi	chaturvedi	PROPN
brj-23306	260	8	et	et	PROPN
brj-23306	260	9	al	al	PROPN
brj-23306	260	10	.	.	PROPN
brj-23306	261	1	(	(	PUNCT
brj-23306	261	2	2020	2020	NUM
brj-23306	261	3	)	)	PUNCT
brj-23306	261	4	,	,	PUNCT
brj-23306	261	5	wherein	wherein	SCONJ
brj-23306	261	6	cancer	cancer	NOUN
brj-23306	261	7	cell	cell	NOUN
brj-23306	261	8	lines	line	NOUN
brj-23306	261	9	treated	treat	VERB
brj-23306	261	10	with	with	ADP
brj-23306	261	11	silver	silver	ADJ
brj-23306	261	12	nanoparticles	nanoparticle	NOUN
brj-23306	261	13	exhibited	exhibit	VERB
brj-23306	261	14	the	the	DET
brj-23306	261	15	distinct	distinct	ADJ
brj-23306	261	16	formation	formation	NOUN
brj-23306	261	17	of	of	ADP
brj-23306	261	18	a	a	DET
brj-23306	261	19	dna	dna	NOUN
brj-23306	261	20	ladder	ladder	NOUN
brj-23306	261	21	pattern	pattern	NOUN
brj-23306	261	22	.	.	PUNCT
brj-23306	262	1	in	in	ADP
brj-23306	262	2	a	a	PRON
brj-23306	262	3	previously	previously	ADV
brj-23306	262	4	reported	report	VERB
brj-23306	262	5	in	in	ADP
brj-23306	262	6	vivo	vivo	NOUN
brj-23306	262	7	study	study	NOUN
brj-23306	262	8	,	,	PUNCT
brj-23306	262	9	it	it	PRON
brj-23306	262	10	was	be	AUX
brj-23306	262	11	observed	observe	VERB
brj-23306	262	12	that	that	SCONJ
brj-23306	262	13	high	high	ADJ
brj-23306	262	14	amounts	amount	NOUN
brj-23306	262	15	of	of	ADP
brj-23306	262	16	silver	silver	ADJ
brj-23306	262	17	nanoparticles	nanoparticle	NOUN
brj-23306	262	18	accumulated	accumulate	VERB
brj-23306	262	19	in	in	ADP
brj-23306	262	20	the	the	DET
brj-23306	262	21	cancerous	cancerous	ADJ
brj-23306	262	22	tissue	tissue	NOUN
brj-23306	262	23	of	of	ADP
brj-23306	262	24	solid	solid	ADJ
brj-23306	262	25	tumor	tumor	NOUN
brj-23306	262	26	-	-	PUNCT
brj-23306	262	27	bearing	bear	VERB
brj-23306	262	28	mice	mouse	NOUN
brj-23306	262	29	following	follow	VERB
brj-23306	262	30	intravenous	intravenous	ADJ
brj-23306	262	31	and	and	CCONJ
brj-23306	262	32	intratumoral	intratumoral	ADJ
brj-23306	262	33	injection	injection	NOUN
brj-23306	262	34	of	of	ADP
brj-23306	262	35	radioactively	radioactively	NOUN
brj-23306	262	36	labeled	label	VERB
brj-23306	262	37	agnps	agnps	ADJ
brj-23306	262	38	.	.	PUNCT
brj-23306	263	1	although	although	SCONJ
brj-23306	263	2	some	some	DET
brj-23306	263	3	nanoparticle	nanoparticle	NOUN
brj-23306	263	4	accumulation	accumulation	NOUN
brj-23306	263	5	was	be	AUX
brj-23306	263	6	noted	note	VERB
brj-23306	263	7	in	in	ADP
brj-23306	263	8	the	the	DET
brj-23306	263	9	liver	liver	NOUN
brj-23306	263	10	and	and	CCONJ
brj-23306	263	11	spleen	spleen	NOUN
brj-23306	263	12	of	of	ADP
brj-23306	263	13	the	the	DET
brj-23306	263	14	animals	animal	NOUN
brj-23306	263	15	,	,	PUNCT
brj-23306	263	16	the	the	DET
brj-23306	263	17	substantial	substantial	ADJ
brj-23306	263	18	accumulation	accumulation	NOUN
brj-23306	263	19	in	in	ADP
brj-23306	263	20	tumor	tumor	NOUN
brj-23306	263	21	tissue	tissue	NOUN
brj-23306	263	22	indicates	indicate	VERB
brj-23306	263	23	that	that	SCONJ
brj-23306	263	24	intravenously	intravenously	ADV
brj-23306	263	25	administered	administer	VERB
brj-23306	263	26	agnps	agnps	PROPN
brj-23306	263	27	have	have	VERB
brj-23306	263	28	the	the	DET
brj-23306	263	29	capability	capability	NOUN
brj-23306	263	30	to	to	PART
brj-23306	263	31	effectively	effectively	ADV
brj-23306	263	32	reach	reach	VERB
brj-23306	263	33	cancerous	cancerous	ADJ
brj-23306	263	34	tissue	tissue	NOUN
brj-23306	263	35	(	(	PUNCT
brj-23306	263	36	sakr	sakr	NOUN
brj-23306	263	37	et	et	PROPN
brj-23306	263	38	al	al	PROPN
brj-23306	263	39	.	.	PROPN
brj-23306	263	40	2018	2018	NUM
brj-23306	263	41	)	)	PUNCT
brj-23306	263	42	.	.	PUNCT
brj-23306	264	1	the	the	DET
brj-23306	264	2	study	study	NOUN
brj-23306	264	3	proposed	propose	VERB
brj-23306	264	4	by	by	ADP
brj-23306	264	5	gurunathan	gurunathan	NOUN
brj-23306	264	6	et	et	PROPN
brj-23306	264	7	al	al	PROPN
brj-23306	264	8	.	.	PROPN
brj-23306	265	1	(	(	PUNCT
brj-23306	265	2	2013	2013	NUM
brj-23306	265	3	)	)	PUNCT
brj-23306	265	4	showed	show	VERB
brj-23306	265	5	that	that	SCONJ
brj-23306	265	6	the	the	DET
brj-23306	265	7	exposure	exposure	NOUN
brj-23306	265	8	to	to	ADP
brj-23306	265	9	agnps	agnps	PROPN
brj-23306	265	10	prompted	prompt	VERB
brj-23306	265	11	the	the	DET
brj-23306	265	12	generation	generation	NOUN
brj-23306	265	13	of	of	ADP
brj-23306	265	14	micronuclei	micronucleus	NOUN
brj-23306	265	15	.	.	PUNCT
brj-23306	266	1	this	this	PRON
brj-23306	266	2	suggests	suggest	VERB
brj-23306	266	3	that	that	SCONJ
brj-23306	266	4	nanoparticles	nanoparticle	NOUN
brj-23306	266	5	,	,	PUNCT
brj-23306	266	6	along	along	ADP
brj-23306	266	7	with	with	ADP
brj-23306	266	8	reactive	reactive	ADJ
brj-23306	266	9	oxidative	oxidative	ADJ
brj-23306	266	10	species	specie	NOUN
brj-23306	266	11	,	,	PUNCT
brj-23306	266	12	instigate	instigate	VERB
brj-23306	266	13	dna	dna	NOUN
brj-23306	266	14	damage	damage	NOUN
brj-23306	266	15	,	,	PUNCT
brj-23306	266	16	thus	thus	ADV
brj-23306	266	17	triggering	trigger	VERB
brj-23306	266	18	the	the	DET
brj-23306	266	19	activation	activation	NOUN
brj-23306	266	20	of	of	ADP
brj-23306	266	21	p53	p53	NOUN
brj-23306	266	22	and	and	CCONJ
brj-23306	266	23	dna	dna	PROPN
brj-23306	266	24	repair	repair	NOUN
brj-23306	266	25	-	-	PUNCT
brj-23306	266	26	related	relate	VERB
brj-23306	266	27	proteins	protein	NOUN
brj-23306	266	28	.	.	PUNCT
brj-23306	267	1	this	this	DET
brj-23306	267	2	mechanism	mechanism	NOUN
brj-23306	267	3	bears	bear	VERB
brj-23306	267	4	resemblance	resemblance	VERB
brj-23306	267	5	to	to	ADP
brj-23306	267	6	the	the	DET
brj-23306	267	7	carcinogenesis	carcinogenesis	NOUN
brj-23306	267	8	induced	induce	VERB
brj-23306	267	9	by	by	ADP
brj-23306	267	10	irradiation	irradiation	NOUN
brj-23306	267	11	.	.	PUNCT
brj-23306	268	1	rt	rt	ADJ
brj-23306	268	2	-	-	PUNCT
brj-23306	268	3	pcr	pcr	PROPN
brj-23306	268	4	analysis	analysis	NOUN
brj-23306	268	5	figures	figure	VERB
brj-23306	268	6	5c	5c	NOUN
brj-23306	268	7	and	and	CCONJ
brj-23306	268	8	d	d	AUX
brj-23306	268	9	show	show	VERB
brj-23306	268	10	caspase-3	caspase-3	NUM
brj-23306	268	11	expression	expression	NOUN
brj-23306	268	12	due	due	ADP
brj-23306	268	13	to	to	ADP
brj-23306	268	14	agnps	agnps	NOUN
brj-23306	268	15	on	on	ADP
brj-23306	268	16	a549	a549	PROPN
brj-23306	268	17	and	and	CCONJ
brj-23306	268	18	pa1	pa1	NOUN
brj-23306	268	19	cells	cell	NOUN
brj-23306	268	20	.	.	PUNCT
brj-23306	269	1	these	these	DET
brj-23306	269	2	findings	finding	NOUN
brj-23306	269	3	provide	provide	VERB
brj-23306	269	4	compelling	compelling	ADJ
brj-23306	269	5	evidence	evidence	NOUN
brj-23306	269	6	regarding	regard	VERB
brj-23306	269	7	the	the	DET
brj-23306	269	8	apoptotic	apoptotic	ADJ
brj-23306	269	9	potential	potential	NOUN
brj-23306	269	10	of	of	ADP
brj-23306	269	11	silver	silver	ADJ
brj-23306	269	12	nanoparticles	nanoparticle	NOUN
brj-23306	269	13	in	in	ADP
brj-23306	269	14	human	human	ADJ
brj-23306	269	15	a549	a549	PROPN
brj-23306	269	16	and	and	CCONJ
brj-23306	269	17	pa1	pa1	NOUN
brj-23306	269	18	cells	cell	NOUN
brj-23306	269	19	,	,	PUNCT
brj-23306	269	20	highlighting	highlight	VERB
brj-23306	269	21	their	their	PRON
brj-23306	269	22	promising	promising	ADJ
brj-23306	269	23	role	role	NOUN
brj-23306	269	24	in	in	ADP
brj-23306	269	25	inducing	induce	VERB
brj-23306	269	26	apoptosis	apoptosis	NOUN
brj-23306	269	27	and	and	CCONJ
brj-23306	269	28	potentially	potentially	ADV
brj-23306	269	29	inhibiting	inhibit	VERB
brj-23306	269	30	cancer	cancer	NOUN
brj-23306	269	31	cell	cell	NOUN
brj-23306	269	32	growth	growth	NOUN
brj-23306	269	33	.	.	PUNCT
brj-23306	270	1	understanding	understanding	NOUN
brj-23306	270	2	and	and	CCONJ
brj-23306	270	3	analyzing	analyze	VERB
brj-23306	270	4	the	the	DET
brj-23306	270	5	complex	complex	ADJ
brj-23306	270	6	elements	element	NOUN
brj-23306	270	7	are	be	AUX
brj-23306	270	8	crucial	crucial	ADJ
brj-23306	270	9	for	for	ADP
brj-23306	270	10	separating	separate	VERB
brj-23306	270	11	the	the	DET
brj-23306	270	12	complex	complex	ADJ
brj-23306	270	13	mechanisms	mechanism	NOUN
brj-23306	270	14	that	that	PRON
brj-23306	270	15	underlie	underlie	VERB
brj-23306	270	16	nanoparticle	nanoparticle	NOUN
brj-23306	270	17	-	-	PUNCT
brj-23306	270	18	induced	induce	VERB
brj-23306	270	19	cellular	cellular	ADJ
brj-23306	270	20	responses	response	NOUN
brj-23306	270	21	and	and	CCONJ
brj-23306	270	22	apoptosis	apoptosis	NOUN
brj-23306	270	23	.	.	PUNCT
brj-23306	271	1	further	further	ADJ
brj-23306	271	2	research	research	NOUN
brj-23306	271	3	and	and	CCONJ
brj-23306	271	4	a	a	DET
brj-23306	271	5	comprehensive	comprehensive	ADJ
brj-23306	271	6	exploration	exploration	NOUN
brj-23306	271	7	of	of	ADP
brj-23306	271	8	these	these	DET
brj-23306	271	9	diverse	diverse	ADJ
brj-23306	271	10	features	feature	NOUN
brj-23306	271	11	will	will	AUX
brj-23306	271	12	not	not	PART
brj-23306	271	13	only	only	ADV
brj-23306	271	14	enhance	enhance	VERB
brj-23306	271	15	our	our	PRON
brj-23306	271	16	understanding	understanding	NOUN
brj-23306	271	17	of	of	ADP
brj-23306	271	18	nanoparticle	nanoparticle	NOUN
brj-23306	271	19	-	-	PUNCT
brj-23306	271	20	cell	cell	NOUN
brj-23306	271	21	interactions	interaction	NOUN
brj-23306	271	22	but	but	CCONJ
brj-23306	271	23	also	also	ADV
brj-23306	271	24	refine	refine	VERB
brj-23306	271	25	their	their	PRON
brj-23306	271	26	potential	potential	ADJ
brj-23306	271	27	applications	application	NOUN
brj-23306	271	28	in	in	ADP
brj-23306	271	29	various	various	ADJ
brj-23306	271	30	biomedical	biomedical	ADJ
brj-23306	271	31	domains	domain	NOUN
brj-23306	271	32	.	.	PUNCT
brj-23306	272	1	caspase-3	caspase-3	NUM
brj-23306	272	2	,	,	PUNCT
brj-23306	272	3	a	a	DET
brj-23306	272	4	protease	protease	NOUN
brj-23306	272	5	enzyme	enzyme	NOUN
brj-23306	272	6	,	,	PUNCT
brj-23306	272	7	is	be	AUX
brj-23306	272	8	frequently	frequently	ADV
brj-23306	272	9	activated	activate	VERB
brj-23306	272	10	within	within	ADP
brj-23306	272	11	cells	cell	NOUN
brj-23306	272	12	,	,	PUNCT
brj-23306	272	13	being	be	AUX
brj-23306	272	14	a	a	DET
brj-23306	272	15	vital	vital	ADJ
brj-23306	272	16	component	component	NOUN
brj-23306	272	17	of	of	ADP
brj-23306	272	18	both	both	CCONJ
brj-23306	272	19	intrinsic	intrinsic	ADJ
brj-23306	272	20	and	and	CCONJ
brj-23306	272	21	extrinsic	extrinsic	ADJ
brj-23306	272	22	apoptosis	apoptosis	NOUN
brj-23306	272	23	pathways	pathway	NOUN
brj-23306	272	24	.	.	PUNCT
brj-23306	273	1	the	the	DET
brj-23306	273	2	intrinsic	intrinsic	ADJ
brj-23306	273	3	pathway	pathway	NOUN
brj-23306	273	4	is	be	AUX
brj-23306	273	5	initiated	initiate	VERB
brj-23306	273	6	by	by	ADP
brj-23306	273	7	signals	signal	NOUN
brj-23306	273	8	originating	originate	VERB
brj-23306	273	9	from	from	ADP
brj-23306	273	10	within	within	ADP
brj-23306	273	11	the	the	DET
brj-23306	273	12	cell	cell	NOUN
brj-23306	273	13	,	,	PUNCT
brj-23306	273	14	often	often	ADV
brj-23306	273	15	prompted	prompt	VERB
brj-23306	273	16	by	by	ADP
brj-23306	273	17	cellular	cellular	ADJ
brj-23306	273	18	stress	stress	NOUN
brj-23306	273	19	or	or	CCONJ
brj-23306	273	20	dna	dna	NOUN
brj-23306	273	21	damage	damage	NOUN
brj-23306	273	22	.	.	PUNCT
brj-23306	274	1	conversely	conversely	ADV
brj-23306	274	2	,	,	PUNCT
brj-23306	274	3	the	the	DET
brj-23306	274	4	extrinsic	extrinsic	ADJ
brj-23306	274	5	pathway	pathway	NOUN
brj-23306	274	6	is	be	AUX
brj-23306	274	7	activated	activate	VERB
brj-23306	274	8	by	by	ADP
brj-23306	274	9	external	external	ADJ
brj-23306	274	10	signals	signal	NOUN
brj-23306	274	11	,	,	PUNCT
brj-23306	274	12	typically	typically	ADV
brj-23306	274	13	halting	halt	VERB
brj-23306	274	14	from	from	ADP
brj-23306	274	15	factors	factor	NOUN
brj-23306	274	16	in	in	ADP
brj-23306	274	17	the	the	DET
brj-23306	274	18	cellular	cellular	ADJ
brj-23306	274	19	environment	environment	NOUN
brj-23306	274	20	or	or	CCONJ
brj-23306	274	21	peer	peer	NOUN
brj-23306	274	22	-	-	PUNCT
brj-23306	274	23	reviewed	review	VERB
brj-23306	274	24	article	article	NOUN
brj-23306	274	25	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	274	26	raju	raju	PROPN
brj-23306	274	27	et	et	PROPN
brj-23306	274	28	al	al	PROPN
brj-23306	274	29	.	.	PROPN
brj-23306	275	1	(	(	PUNCT
brj-23306	275	2	2024	2024	NUM
brj-23306	275	3	)	)	PUNCT
brj-23306	275	4	.	.	PUNCT
brj-23306	276	1	“	"	PUNCT
brj-23306	276	2	ag	ag	PROPN
brj-23306	276	3	nanoparticles	nanoparticle	NOUN
brj-23306	276	4	from	from	ADP
brj-23306	276	5	leaves	leave	NOUN
brj-23306	276	6	,	,	PUNCT
brj-23306	276	7	”	"	PUNCT
brj-23306	276	8	bioresources	bioresource	NOUN
brj-23306	276	9	19(2	19(2	NUM
brj-23306	276	10	)	)	PUNCT
brj-23306	276	11	,	,	PUNCT
brj-23306	276	12	3328	3328	NUM
brj-23306	276	13	-	-	SYM
brj-23306	276	14	3352	3352	NUM
brj-23306	276	15	.	.	PUNCT
brj-23306	276	16	3342	3342	NUM
brj-23306	276	17	neighboring	neighboring	NOUN
brj-23306	276	18	cells	cell	NOUN
brj-23306	276	19	.	.	PUNCT
brj-23306	277	1	also	also	ADV
brj-23306	277	2	,	,	PUNCT
brj-23306	277	3	there	there	PRON
brj-23306	277	4	have	have	AUX
brj-23306	277	5	been	be	AUX
brj-23306	277	6	thoughtful	thoughtful	ADJ
brj-23306	277	7	efforts	effort	NOUN
brj-23306	277	8	to	to	PART
brj-23306	277	9	adapt	adapt	VERB
brj-23306	277	10	agnps	agnps	PROPN
brj-23306	277	11	,	,	PUNCT
brj-23306	277	12	optimizing	optimize	VERB
brj-23306	277	13	them	they	PRON
brj-23306	277	14	for	for	ADP
brj-23306	277	15	precise	precise	ADJ
brj-23306	277	16	targeting	targeting	NOUN
brj-23306	277	17	of	of	ADP
brj-23306	277	18	cancer	cancer	NOUN
brj-23306	277	19	cells	cell	NOUN
brj-23306	277	20	.	.	PUNCT
brj-23306	278	1	this	this	DET
brj-23306	278	2	enhancement	enhancement	NOUN
brj-23306	278	3	aims	aim	VERB
brj-23306	278	4	to	to	PART
brj-23306	278	5	enlarge	enlarge	VERB
brj-23306	278	6	their	their	PRON
brj-23306	278	7	ability	ability	NOUN
brj-23306	278	8	to	to	PART
brj-23306	278	9	induce	induce	VERB
brj-23306	278	10	apoptosis	apoptosis	NOUN
brj-23306	278	11	by	by	ADP
brj-23306	278	12	activating	activate	VERB
brj-23306	278	13	caspase-3	caspase-3	PROPN
brj-23306	278	14	.	.	PUNCT
brj-23306	279	1	silver	silver	ADJ
brj-23306	279	2	nanoparticles	nanoparticle	NOUN
brj-23306	279	3	possess	possess	VERB
brj-23306	279	4	the	the	DET
brj-23306	279	5	capacity	capacity	NOUN
brj-23306	279	6	to	to	PART
brj-23306	279	7	deliver	deliver	VERB
brj-23306	279	8	apoptotic	apoptotic	ADJ
brj-23306	279	9	signals	signal	NOUN
brj-23306	279	10	selectively	selectively	ADV
brj-23306	279	11	to	to	ADP
brj-23306	279	12	cancer	cancer	NOUN
brj-23306	279	13	cells	cell	NOUN
brj-23306	279	14	,	,	PUNCT
brj-23306	279	15	prompting	prompt	VERB
brj-23306	279	16	caspase-3	caspase-3	NUM
brj-23306	279	17	activation	activation	NOUN
brj-23306	279	18	and	and	CCONJ
brj-23306	279	19	enabling	enable	VERB
brj-23306	279	20	regulated	regulated	ADJ
brj-23306	279	21	cellular	cellular	ADJ
brj-23306	279	22	death	death	NOUN
brj-23306	279	23	within	within	ADP
brj-23306	279	24	the	the	DET
brj-23306	279	25	tumor	tumor	NOUN
brj-23306	279	26	.	.	PUNCT
brj-23306	280	1	the	the	DET
brj-23306	280	2	complex	complex	ADJ
brj-23306	280	3	interaction	interaction	NOUN
brj-23306	280	4	between	between	ADP
brj-23306	280	5	agnps	agnps	PROPN
brj-23306	280	6	and	and	CCONJ
brj-23306	280	7	caspase-3	caspase-3	NUM
brj-23306	280	8	holds	hold	VERB
brj-23306	280	9	a	a	DET
brj-23306	280	10	key	key	ADJ
brj-23306	280	11	role	role	NOUN
brj-23306	280	12	in	in	ADP
brj-23306	280	13	the	the	DET
brj-23306	280	14	progression	progression	NOUN
brj-23306	280	15	of	of	ADP
brj-23306	280	16	precise	precise	ADJ
brj-23306	280	17	cancer	cancer	NOUN
brj-23306	280	18	therapies	therapy	NOUN
brj-23306	280	19	.	.	PUNCT
brj-23306	281	1	utilizing	utilize	VERB
brj-23306	281	2	the	the	DET
brj-23306	281	3	capabilities	capability	NOUN
brj-23306	281	4	of	of	ADP
brj-23306	281	5	agnps	agnps	NOUN
brj-23306	281	6	to	to	PART
brj-23306	281	7	control	control	VERB
brj-23306	281	8	caspase-3	caspase-3	NUM
brj-23306	281	9	activation	activation	NOUN
brj-23306	281	10	leads	lead	VERB
brj-23306	281	11	pioneering	pioneer	VERB
brj-23306	281	12	and	and	CCONJ
brj-23306	281	13	efficient	efficient	ADJ
brj-23306	281	14	approaches	approach	NOUN
brj-23306	281	15	in	in	ADP
brj-23306	281	16	cancer	cancer	NOUN
brj-23306	281	17	treatment	treatment	NOUN
brj-23306	281	18	.	.	PUNCT
brj-23306	282	1	these	these	DET
brj-23306	282	2	strategies	strategy	NOUN
brj-23306	282	3	prioritize	prioritize	VERB
brj-23306	282	4	the	the	DET
brj-23306	282	5	induction	induction	NOUN
brj-23306	282	6	of	of	ADP
brj-23306	282	7	apoptosis	apoptosis	NOUN
brj-23306	282	8	in	in	ADP
brj-23306	282	9	malignant	malignant	ADJ
brj-23306	282	10	cells	cell	NOUN
brj-23306	282	11	,	,	PUNCT
brj-23306	282	12	while	while	SCONJ
brj-23306	282	13	minimizing	minimize	VERB
brj-23306	282	14	the	the	DET
brj-23306	282	15	adverse	adverse	ADJ
brj-23306	282	16	effect	effect	NOUN
brj-23306	282	17	on	on	ADP
brj-23306	282	18	the	the	DET
brj-23306	282	19	healthy	healthy	ADJ
brj-23306	282	20	cells	cell	NOUN
brj-23306	282	21	.	.	PUNCT
brj-23306	283	1	fig	fig	NOUN
brj-23306	283	2	.	.	PUNCT
brj-23306	284	1	5	5	NUM
brj-23306	284	2	.	.	X
brj-23306	284	3	(	(	PUNCT
brj-23306	284	4	a	a	X
brj-23306	284	5	)	)	PUNCT
brj-23306	284	6	dna	dna	NOUN
brj-23306	284	7	fragmentation	fragmentation	NOUN
brj-23306	284	8	of	of	ADP
brj-23306	284	9	a549	a549	PROPN
brj-23306	284	10	cells	cell	NOUN
brj-23306	284	11	,	,	PUNCT
brj-23306	284	12	(	(	PUNCT
brj-23306	284	13	b	b	X
brj-23306	284	14	)	)	PUNCT
brj-23306	284	15	dna	dna	NOUN
brj-23306	284	16	fragmentation	fragmentation	NOUN
brj-23306	284	17	of	of	ADP
brj-23306	284	18	pa1	pa1	NOUN
brj-23306	284	19	cells	cell	NOUN
brj-23306	284	20	,	,	PUNCT
brj-23306	284	21	(	(	PUNCT
brj-23306	284	22	c	c	X
brj-23306	284	23	)	)	PUNCT
brj-23306	284	24	caspase	caspase	NOUN
brj-23306	284	25	3	3	NUM
brj-23306	284	26	expression	expression	NOUN
brj-23306	284	27	in	in	ADP
brj-23306	284	28	a549	a549	PROPN
brj-23306	284	29	cells	cell	NOUN
brj-23306	284	30	,	,	PUNCT
brj-23306	284	31	and	and	CCONJ
brj-23306	284	32	(	(	PUNCT
brj-23306	284	33	d	d	X
brj-23306	284	34	)	)	PUNCT
brj-23306	284	35	caspase	caspase	NOUN
brj-23306	284	36	3	3	NUM
brj-23306	284	37	expression	expression	NOUN
brj-23306	284	38	in	in	ADP
brj-23306	284	39	pa1	pa1	NOUN
brj-23306	284	40	cells	cell	NOUN
brj-23306	284	41	antibacterial	antibacterial	ADJ
brj-23306	284	42	activity	activity	NOUN
brj-23306	284	43	of	of	ADP
brj-23306	284	44	agnps	agnps	PROPN
brj-23306	284	45	findings	finding	NOUN
brj-23306	284	46	revealed	reveal	VERB
brj-23306	284	47	that	that	SCONJ
brj-23306	284	48	the	the	DET
brj-23306	284	49	agnps	agnps	ADJ
brj-23306	284	50	were	be	AUX
brj-23306	284	51	effectively	effectively	ADV
brj-23306	284	52	suppressing	suppress	VERB
brj-23306	284	53	the	the	DET
brj-23306	284	54	growth	growth	NOUN
brj-23306	284	55	of	of	ADP
brj-23306	284	56	human	human	ADJ
brj-23306	284	57	bacterial	bacterial	ADJ
brj-23306	284	58	pathogens	pathogen	NOUN
brj-23306	284	59	at	at	ADP
brj-23306	284	60	different	different	ADJ
brj-23306	284	61	potencies	potency	NOUN
brj-23306	284	62	.	.	PUNCT
brj-23306	285	1	as	as	SCONJ
brj-23306	285	2	illustrated	illustrate	VERB
brj-23306	285	3	in	in	ADP
brj-23306	285	4	fig	fig	NOUN
brj-23306	285	5	.	.	PUNCT
brj-23306	286	1	10	10	NUM
brj-23306	286	2	,	,	PUNCT
brj-23306	286	3	agnps	agnps	PROPN
brj-23306	286	4	exhibited	exhibit	VERB
brj-23306	286	5	the	the	DET
brj-23306	286	6	maximum	maximum	ADJ
brj-23306	286	7	zone	zone	NOUN
brj-23306	286	8	of	of	ADP
brj-23306	286	9	inhibition	inhibition	NOUN
brj-23306	286	10	against	against	ADP
brj-23306	286	11	k.	k.	PROPN
brj-23306	286	12	pneumoniae	pneumoniae	PROPN
brj-23306	286	13	(	(	PUNCT
brj-23306	286	14	23	23	NUM
brj-23306	286	15	±	±	NUM
brj-23306	286	16	2	2	NUM
brj-23306	286	17	mm	mm	NOUN
brj-23306	286	18	)	)	PUNCT
brj-23306	286	19	,	,	PUNCT
brj-23306	286	20	followed	follow	VERB
brj-23306	286	21	by	by	ADP
brj-23306	286	22	p.	p.	PROPN
brj-23306	286	23	aeruginosa	aeruginosa	PROPN
brj-23306	286	24	(	(	PUNCT
brj-23306	286	25	21	21	NUM
brj-23306	286	26	±	±	NUM
brj-23306	286	27	2	2	NUM
brj-23306	286	28	mm	mm	NOUN
brj-23306	286	29	)	)	PUNCT
brj-23306	286	30	and	and	CCONJ
brj-23306	286	31	b.	b.	PROPN
brj-23306	286	32	subtilis	subtilis	PROPN
brj-23306	286	33	(	(	PUNCT
brj-23306	286	34	19	19	NUM
brj-23306	286	35	±	±	NUM
brj-23306	286	36	2	2	NUM
brj-23306	286	37	mm	mm	NOUN
brj-23306	286	38	)	)	PUNCT
brj-23306	286	39	.	.	PUNCT
brj-23306	287	1	moreover	moreover	ADV
brj-23306	287	2	,	,	PUNCT
brj-23306	287	3	agnps	agnps	PROPN
brj-23306	287	4	exhibited	exhibit	VERB
brj-23306	287	5	less	less	ADJ
brj-23306	287	6	zone	zone	NOUN
brj-23306	287	7	of	of	ADP
brj-23306	287	8	inhibition	inhibition	NOUN
brj-23306	287	9	against	against	ADP
brj-23306	287	10	e.	e.	PROPN
brj-23306	287	11	faecalis	faecalis	PROPN
brj-23306	287	12	(	(	PUNCT
brj-23306	287	13	16	16	NUM
brj-23306	287	14	±	±	NUM
brj-23306	287	15	1	1	NUM
brj-23306	287	16	mm	mm	NOUN
brj-23306	287	17	)	)	PUNCT
brj-23306	287	18	,	,	PUNCT
brj-23306	287	19	s.	s.	PROPN
brj-23306	287	20	aureus	aureus	PROPN
brj-23306	287	21	(	(	PUNCT
brj-23306	287	22	16	16	NUM
brj-23306	287	23	±	±	NUM
brj-23306	287	24	1	1	NUM
brj-23306	287	25	mm	mm	NOUN
brj-23306	287	26	)	)	PUNCT
brj-23306	287	27	,	,	PUNCT
brj-23306	287	28	b.	b.	PROPN
brj-23306	287	29	coagulans	coagulans	PROPN
brj-23306	287	30	(	(	PUNCT
brj-23306	287	31	13	13	NUM
brj-23306	287	32	±	±	NUM
brj-23306	287	33	1	1	NUM
brj-23306	287	34	mm	mm	NOUN
brj-23306	287	35	)	)	PUNCT
brj-23306	287	36	,	,	PUNCT
brj-23306	287	37	and	and	CCONJ
brj-23306	287	38	e.	e.	PROPN
brj-23306	287	39	cloacae	cloacae	PROPN
brj-23306	287	40	(	(	PUNCT
brj-23306	287	41	9	9	NUM
brj-23306	287	42	±	±	NUM
brj-23306	287	43	0	0	NUM
brj-23306	287	44	mm	mm	NOUN
brj-23306	287	45	)	)	PUNCT
brj-23306	287	46	,	,	PUNCT
brj-23306	287	47	correspondingly	correspondingly	ADV
brj-23306	287	48	(	(	PUNCT
brj-23306	287	49	fig	fig	NOUN
brj-23306	287	50	.	.	PUNCT
brj-23306	287	51	6	6	NUM
brj-23306	287	52	)	)	PUNCT
brj-23306	287	53	.	.	PUNCT
brj-23306	288	1	in	in	ADP
brj-23306	288	2	this	this	DET
brj-23306	288	3	study	study	NOUN
brj-23306	288	4	,	,	PUNCT
brj-23306	288	5	the	the	DET
brj-23306	288	6	greensynthesized	greensynthesize	VERB
brj-23306	288	7	agnps	agnps	PROPN
brj-23306	288	8	exhibited	exhibit	VERB
brj-23306	288	9	antimicrobial	antimicrobial	ADJ
brj-23306	288	10	activities	activity	NOUN
brj-23306	288	11	against	against	ADP
brj-23306	288	12	clinical	clinical	ADJ
brj-23306	288	13	pathogens	pathogen	NOUN
brj-23306	288	14	.	.	PUNCT
brj-23306	289	1	generally	generally	ADV
brj-23306	289	2	,	,	PUNCT
brj-23306	289	3	agnps	agnps	PROPN
brj-23306	289	4	exhibit	exhibit	VERB
brj-23306	289	5	antimicrobial	antimicrobial	ADJ
brj-23306	289	6	activity	activity	NOUN
brj-23306	289	7	by	by	ADP
brj-23306	289	8	several	several	ADJ
brj-23306	289	9	cellular	cellular	ADJ
brj-23306	289	10	mechanisms	mechanism	NOUN
brj-23306	289	11	,	,	PUNCT
brj-23306	289	12	including	include	VERB
brj-23306	289	13	inducing	induce	VERB
brj-23306	289	14	oxidative	oxidative	ADJ
brj-23306	289	15	stress	stress	NOUN
brj-23306	289	16	,	,	PUNCT
brj-23306	289	17	releasing	release	VERB
brj-23306	289	18	metal	metal	NOUN
brj-23306	289	19	ions	ion	NOUN
brj-23306	289	20	,	,	PUNCT
brj-23306	289	21	generating	generate	VERB
brj-23306	289	22	reactive	reactive	ADJ
brj-23306	289	23	oxygen	oxygen	NOUN
brj-23306	289	24	species	specie	NOUN
brj-23306	289	25	,	,	PUNCT
brj-23306	289	26	causing	cause	VERB
brj-23306	289	27	loss	loss	NOUN
brj-23306	289	28	of	of	ADP
brj-23306	289	29	microbial	microbial	ADJ
brj-23306	289	30	cell	cell	NOUN
brj-23306	289	31	integrity	integrity	NOUN
brj-23306	289	32	,	,	PUNCT
brj-23306	289	33	and	and	CCONJ
brj-23306	289	34	damaging	damage	VERB
brj-23306	289	35	proteins	protein	NOUN
brj-23306	289	36	and	and	CCONJ
brj-23306	289	37	dna	dna	PROPN
brj-23306	289	38	(	(	PUNCT
brj-23306	289	39	al	al	PROPN
brj-23306	289	40	-	-	PUNCT
brj-23306	289	41	wrafy	wrafy	PROPN
brj-23306	289	42	et	et	PROPN
brj-23306	289	43	al	al	PROPN
brj-23306	289	44	.	.	PROPN
brj-23306	289	45	2022	2022	NUM
brj-23306	289	46	)	)	PUNCT
brj-23306	289	47	.	.	PUNCT
brj-23306	290	1	peer	peer	NOUN
brj-23306	290	2	-	-	PUNCT
brj-23306	290	3	reviewed	review	VERB
brj-23306	290	4	article	article	NOUN
brj-23306	290	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	290	6	raju	raju	PROPN
brj-23306	290	7	et	et	PROPN
brj-23306	290	8	al	al	PROPN
brj-23306	290	9	.	.	PROPN
brj-23306	291	1	(	(	PUNCT
brj-23306	291	2	2024	2024	NUM
brj-23306	291	3	)	)	PUNCT
brj-23306	291	4	.	.	PUNCT
brj-23306	292	1	“	"	PUNCT
brj-23306	292	2	ag	ag	PROPN
brj-23306	292	3	nanoparticles	nanoparticle	NOUN
brj-23306	292	4	from	from	ADP
brj-23306	292	5	leaves	leave	NOUN
brj-23306	292	6	,	,	PUNCT
brj-23306	292	7	”	"	PUNCT
brj-23306	292	8	bioresources	bioresource	NOUN
brj-23306	292	9	19(2	19(2	NUM
brj-23306	292	10	)	)	PUNCT
brj-23306	292	11	,	,	PUNCT
brj-23306	292	12	3328	3328	NUM
brj-23306	292	13	-	-	SYM
brj-23306	292	14	3352	3352	NUM
brj-23306	292	15	.	.	PUNCT
brj-23306	292	16	3343	3343	NUM
brj-23306	292	17	fig	fig	NOUN
brj-23306	292	18	.	.	PUNCT
brj-23306	293	1	6	6	NUM
brj-23306	293	2	.	.	PUNCT
brj-23306	293	3	antibacterial	antibacterial	ADJ
brj-23306	293	4	activity	activity	NOUN
brj-23306	293	5	of	of	ADP
brj-23306	293	6	agnps	agnps	NOUN
brj-23306	293	7	against	against	ADP
brj-23306	293	8	bacterial	bacterial	ADJ
brj-23306	293	9	pathogens	pathogen	NOUN
brj-23306	293	10	antifungal	antifungal	ADJ
brj-23306	293	11	activity	activity	NOUN
brj-23306	293	12	of	of	ADP
brj-23306	293	13	agnps	agnps	PROPN
brj-23306	293	14	agnps	agnps	PROPN
brj-23306	293	15	inhibited	inhibit	VERB
brj-23306	293	16	fungal	fungal	ADJ
brj-23306	293	17	mycelia	mycelia	NOUN
brj-23306	293	18	growth	growth	NOUN
brj-23306	293	19	and	and	CCONJ
brj-23306	293	20	exhibited	exhibit	VERB
brj-23306	293	21	the	the	DET
brj-23306	293	22	maximum	maximum	ADJ
brj-23306	293	23	zone	zone	NOUN
brj-23306	293	24	of	of	ADP
brj-23306	293	25	inhibition	inhibition	NOUN
brj-23306	293	26	against	against	ADP
brj-23306	293	27	f.	f.	PROPN
brj-23306	293	28	oxysporum	oxysporum	PROPN
brj-23306	293	29	(	(	PUNCT
brj-23306	293	30	17	17	NUM
brj-23306	293	31	±	±	NUM
brj-23306	293	32	2	2	NUM
brj-23306	293	33	mm	mm	NOUN
brj-23306	293	34	)	)	PUNCT
brj-23306	293	35	.	.	PUNCT
brj-23306	294	1	the	the	DET
brj-23306	294	2	antifungal	antifungal	ADJ
brj-23306	294	3	activity	activity	NOUN
brj-23306	294	4	ranged	range	VERB
brj-23306	294	5	from	from	ADP
brj-23306	294	6	9	9	NUM
brj-23306	294	7	±	±	NUM
brj-23306	294	8	0	0	NUM
brj-23306	294	9	mm	mm	NOUN
brj-23306	294	10	to	to	ADP
brj-23306	294	11	17	17	NUM
brj-23306	294	12	±	±	NUM
brj-23306	294	13	2	2	NUM
brj-23306	294	14	mm	mm	NOUN
brj-23306	294	15	and	and	CCONJ
brj-23306	294	16	the	the	DET
brj-23306	294	17	sensitivity	sensitivity	NOUN
brj-23306	294	18	varied	vary	VERB
brj-23306	294	19	based	base	VERB
brj-23306	294	20	on	on	ADP
brj-23306	294	21	the	the	DET
brj-23306	294	22	types	type	NOUN
brj-23306	294	23	of	of	ADP
brj-23306	294	24	fungi	fungi	PROPN
brj-23306	294	25	.	.	PUNCT
brj-23306	295	1	two	two	NUM
brj-23306	295	2	rhizopus	rhizopus	NOUN
brj-23306	295	3	strains	strain	NOUN
brj-23306	295	4	(	(	PUNCT
brj-23306	295	5	r.	r.	NOUN
brj-23306	295	6	microsporus	microsporus	PROPN
brj-23306	295	7	and	and	CCONJ
brj-23306	295	8	r.	r.	PROPN
brj-23306	295	9	oryzae	oryzae	PROPN
brj-23306	295	10	)	)	PUNCT
brj-23306	295	11	were	be	AUX
brj-23306	295	12	selected	select	VERB
brj-23306	295	13	for	for	ADP
brj-23306	295	14	this	this	DET
brj-23306	295	15	study	study	NOUN
brj-23306	295	16	and	and	CCONJ
brj-23306	295	17	agnps	agnps	PROPN
brj-23306	295	18	showed	show	VERB
brj-23306	295	19	10	10	NUM
brj-23306	295	20	±	±	NUM
brj-23306	295	21	2	2	NUM
brj-23306	295	22	mm	mm	NOUN
brj-23306	295	23	and	and	CCONJ
brj-23306	295	24	16	16	NUM
brj-23306	295	25	±	±	NUM
brj-23306	295	26	2	2	NUM
brj-23306	295	27	mm	mm	NOUN
brj-23306	295	28	of	of	ADP
brj-23306	295	29	zone	zone	NOUN
brj-23306	295	30	of	of	ADP
brj-23306	295	31	inhibition	inhibition	NOUN
brj-23306	295	32	against	against	ADP
brj-23306	295	33	r.	r.	PROPN
brj-23306	295	34	microsporus	microsporus	PROPN
brj-23306	295	35	and	and	CCONJ
brj-23306	295	36	r.	r.	PROPN
brj-23306	295	37	oryzae	oryzae	PROPN
brj-23306	295	38	,	,	PUNCT
brj-23306	295	39	correspondingly	correspondingly	ADV
brj-23306	295	40	.	.	PUNCT
brj-23306	296	1	agnps	agnps	PROPN
brj-23306	296	2	exhibited	exhibit	VERB
brj-23306	296	3	a	a	DET
brj-23306	296	4	<	<	X
brj-23306	296	5	10	10	NUM
brj-23306	296	6	mm	mm	NOUN
brj-23306	296	7	zone	zone	NOUN
brj-23306	296	8	of	of	ADP
brj-23306	296	9	inhibition	inhibition	NOUN
brj-23306	296	10	against	against	ADP
brj-23306	296	11	a.	a.	NOUN
brj-23306	296	12	niger	niger	NOUN
brj-23306	296	13	and	and	CCONJ
brj-23306	296	14	p.	p.	NOUN
brj-23306	296	15	chrysogenum	chrysogenum	PROPN
brj-23306	296	16	(	(	PUNCT
brj-23306	296	17	fig	fig	NOUN
brj-23306	296	18	.	.	PUNCT
brj-23306	296	19	7	7	NUM
brj-23306	296	20	)	)	PUNCT
brj-23306	296	21	.	.	PUNCT
brj-23306	297	1	fig	fig	NOUN
brj-23306	297	2	.	.	PUNCT
brj-23306	298	1	7	7	X
brj-23306	298	2	.	.	NUM
brj-23306	298	3	antifungal	antifungal	ADJ
brj-23306	298	4	activity	activity	NOUN
brj-23306	298	5	of	of	ADP
brj-23306	298	6	agnps	agnps	NOUN
brj-23306	298	7	against	against	ADP
brj-23306	298	8	fungal	fungal	ADJ
brj-23306	298	9	pathogens	pathogen	NOUN
brj-23306	298	10	minimum	minimum	VERB
brj-23306	298	11	inhibitory	inhibitory	ADJ
brj-23306	298	12	concentration	concentration	NOUN
brj-23306	298	13	the	the	DET
brj-23306	298	14	mic	mic	ADJ
brj-23306	298	15	value	value	NOUN
brj-23306	298	16	of	of	ADP
brj-23306	298	17	agnps	agnps	PROPN
brj-23306	298	18	was	be	AUX
brj-23306	298	19	extremely	extremely	ADV
brj-23306	298	20	low	low	ADJ
brj-23306	298	21	against	against	ADP
brj-23306	298	22	both	both	DET
brj-23306	298	23	gram	gram	NOUN
brj-23306	298	24	-	-	PUNCT
brj-23306	298	25	positive	positive	ADJ
brj-23306	298	26	and	and	CCONJ
brj-23306	298	27	gram	gram	NOUN
brj-23306	298	28	-	-	PUNCT
brj-23306	298	29	negative	negative	ADJ
brj-23306	298	30	bacteria	bacteria	NOUN
brj-23306	298	31	in	in	ADP
brj-23306	298	32	broth	broth	ADJ
brj-23306	298	33	dilution	dilution	NOUN
brj-23306	298	34	technique	technique	NOUN
brj-23306	298	35	.	.	PUNCT
brj-23306	299	1	the	the	DET
brj-23306	299	2	mic	mic	ADJ
brj-23306	299	3	value	value	NOUN
brj-23306	299	4	of	of	ADP
brj-23306	299	5	agnps	agnps	PROPN
brj-23306	299	6	against	against	ADP
brj-23306	299	7	bacteria	bacteria	NOUN
brj-23306	299	8	ranged	range	VERB
brj-23306	299	9	from	from	ADP
brj-23306	299	10	12.5	12.5	NUM
brj-23306	299	11	±	±	NUM
brj-23306	299	12	0.25	0.25	NUM
brj-23306	299	13	to	to	ADP
brj-23306	299	14	75	75	NUM
brj-23306	299	15	±	±	NUM
brj-23306	299	16	2.5	2.5	NUM
brj-23306	299	17	µg	µg	NOUN
brj-23306	299	18	/	/	SYM
brj-23306	299	19	ml	ml	NOUN
brj-23306	299	20	.	.	PUNCT
brj-23306	300	1	the	the	DET
brj-23306	300	2	pathogenic	pathogenic	ADJ
brj-23306	300	3	k.	k.	NOUN
brj-23306	300	4	pneumoniae	pneumoniae	PROPN
brj-23306	300	5	and	and	CCONJ
brj-23306	300	6	p.	p.	NOUN
brj-23306	300	7	aeruginosa	aeruginosa	PROPN
brj-23306	300	8	presented	present	VERB
brj-23306	300	9	the	the	DET
brj-23306	300	10	lowest	low	ADJ
brj-23306	300	11	mic	mic	ADJ
brj-23306	300	12	values	value	NOUN
brj-23306	300	13	(	(	PUNCT
brj-23306	300	14	12.5	12.5	NUM
brj-23306	300	15	±	±	NUM
brj-23306	300	16	0.25	0.25	NUM
brj-23306	300	17	µg	µg	NOUN
brj-23306	300	18	/	/	SYM
brj-23306	300	19	ml	ml	NOUN
brj-23306	300	20	)	)	PUNCT
brj-23306	300	21	.	.	PUNCT
brj-23306	301	1	the	the	DET
brj-23306	301	2	drug	drug	NOUN
brj-23306	301	3	resistant	resistant	ADJ
brj-23306	301	4	s.	s.	PROPN
brj-23306	301	5	aureus	aureus	PROPN
brj-23306	301	6	strains	strain	NOUN
brj-23306	301	7	documented	document	VERB
brj-23306	301	8	an	an	DET
brj-23306	301	9	mic	mic	ADJ
brj-23306	301	10	value	value	NOUN
brj-23306	301	11	of	of	ADP
brj-23306	301	12	40	40	NUM
brj-23306	301	13	±	±	NUM
brj-23306	301	14	2.5	2.5	NUM
brj-23306	301	15	µg	µg	NOUN
brj-23306	301	16	/	/	SYM
brj-23306	301	17	ml	ml	NOUN
brj-23306	301	18	,	,	PUNCT
brj-23306	301	19	which	which	PRON
brj-23306	301	20	was	be	AUX
brj-23306	301	21	similar	similar	ADJ
brj-23306	301	22	to	to	ADP
brj-23306	301	23	that	that	PRON
brj-23306	301	24	of	of	ADP
brj-23306	301	25	0	0	NUM
brj-23306	301	26	5	5	NUM
brj-23306	301	27	10	10	NUM
brj-23306	301	28	15	15	NUM
brj-23306	301	29	20	20	NUM
brj-23306	301	30	25	25	NUM
brj-23306	301	31	30	30	NUM
brj-23306	301	32	z	z	NOUN
brj-23306	301	33	o	o	NOUN
brj-23306	301	34	n	n	NOUN
brj-23306	301	35	e	e	X
brj-23306	301	36	o	o	X
brj-23306	301	37	f	f	X
brj-23306	301	38	in	in	ADP
brj-23306	301	39	h	h	PROPN
brj-23306	302	1	ib	ib	NOUN
brj-23306	302	2	it	it	PRON
brj-23306	302	3	io	io	ADP
brj-23306	302	4	n	n	PROPN
brj-23306	303	1	(	(	PUNCT
brj-23306	303	2	m	m	VERB
brj-23306	303	3	m	m	VERB
brj-23306	303	4	)	)	PUNCT
brj-23306	303	5	0	0	NUM
brj-23306	304	1	2	2	NUM
brj-23306	304	2	4	4	NUM
brj-23306	304	3	6	6	NUM
brj-23306	304	4	8	8	NUM
brj-23306	304	5	10	10	NUM
brj-23306	304	6	12	12	NUM
brj-23306	304	7	14	14	NUM
brj-23306	304	8	16	16	NUM
brj-23306	304	9	18	18	NUM
brj-23306	304	10	20	20	NUM
brj-23306	304	11	a.	a.	NOUN
brj-23306	304	12	niger	niger	PROPN
brj-23306	304	13	f.	f.	PROPN
brj-23306	304	14	oxysporum	oxysporum	PROPN
brj-23306	304	15	r.	r.	PROPN
brj-23306	304	16	microsporus	microsporus	PROPN
brj-23306	304	17	r.	r.	PROPN
brj-23306	304	18	oryzae	oryzae	PROPN
brj-23306	304	19	p.	p.	PROPN
brj-23306	304	20	chrysogenum	chrysogenum	PROPN
brj-23306	305	1	z	z	NOUN
brj-23306	305	2	o	o	NOUN
brj-23306	306	1	n	n	X
brj-23306	306	2	e	e	X
brj-23306	306	3	o	o	X
brj-23306	306	4	f	f	X
brj-23306	306	5	in	in	ADP
brj-23306	306	6	h	h	PROPN
brj-23306	306	7	ib	ib	NOUN
brj-23306	306	8	it	it	PRON
brj-23306	306	9	io	io	ADP
brj-23306	306	10	n	n	PROPN
brj-23306	307	1	(	(	PUNCT
brj-23306	307	2	m	m	PROPN
brj-23306	307	3	m	m	VERB
brj-23306	307	4	)	)	PUNCT
brj-23306	307	5	peer	peer	NOUN
brj-23306	307	6	-	-	PUNCT
brj-23306	307	7	reviewed	review	VERB
brj-23306	307	8	article	article	NOUN
brj-23306	307	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	307	10	raju	raju	PROPN
brj-23306	307	11	et	et	PROPN
brj-23306	307	12	al	al	PROPN
brj-23306	307	13	.	.	PROPN
brj-23306	308	1	(	(	PUNCT
brj-23306	308	2	2024	2024	NUM
brj-23306	308	3	)	)	PUNCT
brj-23306	308	4	.	.	PUNCT
brj-23306	309	1	“	"	PUNCT
brj-23306	309	2	ag	ag	PROPN
brj-23306	309	3	nanoparticles	nanoparticle	NOUN
brj-23306	309	4	from	from	ADP
brj-23306	309	5	leaves	leave	NOUN
brj-23306	309	6	,	,	PUNCT
brj-23306	309	7	”	"	PUNCT
brj-23306	309	8	bioresources	bioresource	NOUN
brj-23306	309	9	19(2	19(2	NUM
brj-23306	309	10	)	)	PUNCT
brj-23306	309	11	,	,	PUNCT
brj-23306	309	12	3328	3328	NUM
brj-23306	309	13	-	-	SYM
brj-23306	309	14	3352	3352	NUM
brj-23306	309	15	.	.	PUNCT
brj-23306	309	16	3344	3344	NUM
brj-23306	309	17	e.	e.	PROPN
brj-23306	309	18	faecalis	faecalis	PROPN
brj-23306	309	19	(	(	PUNCT
brj-23306	309	20	37.5	37.5	NUM
brj-23306	309	21	±	±	NUM
brj-23306	309	22	1.25	1.25	NUM
brj-23306	309	23	µg	µg	NOUN
brj-23306	309	24	/	/	SYM
brj-23306	309	25	ml	ml	NOUN
brj-23306	309	26	)	)	PUNCT
brj-23306	309	27	.	.	PUNCT
brj-23306	310	1	the	the	DET
brj-23306	310	2	mic	mic	ADJ
brj-23306	310	3	value	value	NOUN
brj-23306	310	4	was	be	AUX
brj-23306	310	5	high	high	ADJ
brj-23306	310	6	against	against	ADP
brj-23306	310	7	the	the	DET
brj-23306	310	8	gram	gram	NOUN
brj-23306	310	9	-	-	PUNCT
brj-23306	310	10	negative	negative	ADJ
brj-23306	310	11	,	,	PUNCT
brj-23306	310	12	rodshaped	rodshaped	ADJ
brj-23306	310	13	and	and	CCONJ
brj-23306	310	14	facultatively	facultatively	ADV
brj-23306	310	15	-	-	PUNCT
brj-23306	310	16	anaerobic	anaerobic	NOUN
brj-23306	310	17	e.	e.	PROPN
brj-23306	310	18	cloacae	cloacae	PROPN
brj-23306	310	19	(	(	PUNCT
brj-23306	310	20	75	75	NUM
brj-23306	310	21	±	±	NUM
brj-23306	310	22	2.5	2.5	NUM
brj-23306	310	23	µg	µg	NOUN
brj-23306	310	24	/	/	SYM
brj-23306	310	25	ml	ml	NOUN
brj-23306	310	26	)	)	PUNCT
brj-23306	310	27	(	(	PUNCT
brj-23306	310	28	fig	fig	NOUN
brj-23306	310	29	.	.	PUNCT
brj-23306	311	1	8)	8)	NUM
brj-23306	311	2	.	.	PUNCT
brj-23306	312	1	the	the	DET
brj-23306	312	2	standard	standard	PROPN
brj-23306	312	3	streptomycin	streptomycin	PROPN
brj-23306	312	4	exhibited	exhibit	VERB
brj-23306	312	5	lower	low	ADJ
brj-23306	312	6	mic	mic	ADJ
brj-23306	312	7	values	value	NOUN
brj-23306	312	8	than	than	SCONJ
brj-23306	312	9	the	the	DET
brj-23306	312	10	green	green	ADJ
brj-23306	312	11	synthesized	synthesize	VERB
brj-23306	312	12	agnps	agnps	NOUN
brj-23306	312	13	.	.	PUNCT
brj-23306	313	1	the	the	DET
brj-23306	313	2	study	study	NOUN
brj-23306	313	3	by	by	ADP
brj-23306	313	4	medina	medina	PROPN
brj-23306	313	5	-	-	PUNCT
brj-23306	313	6	cruz	cruz	PROPN
brj-23306	313	7	et	et	PROPN
brj-23306	313	8	al	al	PROPN
brj-23306	313	9	.	.	PROPN
brj-23306	313	10	(	(	PUNCT
brj-23306	313	11	2021	2021	NUM
brj-23306	313	12	)	)	PUNCT
brj-23306	313	13	showed	show	VERB
brj-23306	313	14	similar	similar	ADJ
brj-23306	313	15	minimum	minimum	ADJ
brj-23306	313	16	inhibitory	inhibitory	ADJ
brj-23306	313	17	concentration	concentration	NOUN
brj-23306	313	18	(	(	PUNCT
brj-23306	313	19	mic	mic	ADJ
brj-23306	313	20	)	)	PUNCT
brj-23306	313	21	values	value	NOUN
brj-23306	313	22	of	of	ADP
brj-23306	313	23	biosynthesized	biosynthesize	VERB
brj-23306	313	24	ag	ag	PROPN
brj-23306	313	25	-	-	PROPN
brj-23306	313	26	nps	nps	PROPN
brj-23306	313	27	against	against	ADP
brj-23306	313	28	s.	s.	PROPN
brj-23306	313	29	aureus	aureus	PROPN
brj-23306	313	30	,	,	PUNCT
brj-23306	313	31	b.	b.	PROPN
brj-23306	313	32	subtilis	subtilis	PROPN
brj-23306	313	33	,	,	PUNCT
brj-23306	313	34	e.	e.	PROPN
brj-23306	313	35	coli	coli	PROPN
brj-23306	313	36	,	,	PUNCT
brj-23306	313	37	p.	p.	NOUN
brj-23306	313	38	aeruginosa	aeruginosa	PROPN
brj-23306	313	39	,	,	PUNCT
brj-23306	313	40	and	and	CCONJ
brj-23306	313	41	s.	s.	PROPN
brj-23306	313	42	typhimurium	typhimurium	PROPN
brj-23306	313	43	,	,	PUNCT
brj-23306	313	44	which	which	PRON
brj-23306	313	45	were	be	AUX
brj-23306	313	46	found	find	VERB
brj-23306	313	47	to	to	PART
brj-23306	313	48	be	be	AUX
brj-23306	313	49	25.0	25.0	NUM
brj-23306	313	50	ppm	ppm	NOUN
brj-23306	313	51	,	,	PUNCT
brj-23306	313	52	12.5	12.5	NUM
brj-23306	313	53	ppm	ppm	NOUN
brj-23306	313	54	,	,	PUNCT
brj-23306	313	55	12.5	12.5	NUM
brj-23306	313	56	ppm	ppm	NOUN
brj-23306	313	57	,	,	PUNCT
brj-23306	313	58	12.5	12.5	NUM
brj-23306	313	59	ppm	ppm	NOUN
brj-23306	313	60	,	,	PUNCT
brj-23306	313	61	and	and	CCONJ
brj-23306	313	62	25.0	25.0	NUM
brj-23306	313	63	ppm	ppm	NOUN
brj-23306	313	64	,	,	PUNCT
brj-23306	313	65	respectively	respectively	ADV
brj-23306	313	66	.	.	PUNCT
brj-23306	314	1	correspondingly	correspondingly	ADV
brj-23306	314	2	,	,	PUNCT
brj-23306	314	3	the	the	DET
brj-23306	314	4	zones	zone	NOUN
brj-23306	314	5	of	of	ADP
brj-23306	314	6	inhibition	inhibition	NOUN
brj-23306	314	7	(	(	PUNCT
brj-23306	314	8	zois	zois	NOUN
brj-23306	314	9	)	)	PUNCT
brj-23306	314	10	were	be	AUX
brj-23306	314	11	measured	measure	VERB
brj-23306	314	12	at	at	ADP
brj-23306	314	13	(	(	PUNCT
brj-23306	314	14	10.16	10.16	NUM
brj-23306	314	15	±	±	NUM
brj-23306	314	16	0.7	0.7	NUM
brj-23306	314	17	)	)	PUNCT
brj-23306	314	18	mm	mm	PROPN
brj-23306	314	19	,	,	PUNCT
brj-23306	314	20	(	(	PUNCT
brj-23306	314	21	13.3	13.3	NUM
brj-23306	314	22	±	±	NUM
brj-23306	314	23	0.6	0.6	NUM
brj-23306	314	24	)	)	PUNCT
brj-23306	314	25	mm	mm	PROPN
brj-23306	314	26	,	,	PUNCT
brj-23306	314	27	(	(	PUNCT
brj-23306	314	28	10.3	10.3	NUM
brj-23306	314	29	±	±	NUM
brj-23306	314	30	0.3	0.3	NUM
brj-23306	314	31	)	)	PUNCT
brj-23306	314	32	mm	mm	PROPN
brj-23306	314	33	,	,	PUNCT
brj-23306	314	34	(	(	PUNCT
brj-23306	314	35	9.5	9.5	NUM
brj-23306	314	36	±	±	NUM
brj-23306	314	37	0.4	0.4	NUM
brj-23306	314	38	)	)	PUNCT
brj-23306	314	39	mm	mm	PROPN
brj-23306	314	40	,	,	PUNCT
brj-23306	314	41	and	and	CCONJ
brj-23306	314	42	(	(	PUNCT
brj-23306	314	43	9.5	9.5	NUM
brj-23306	314	44	±	±	NUM
brj-23306	314	45	0.4	0.4	NUM
brj-23306	314	46	)	)	PUNCT
brj-23306	314	47	mm	mm	PROPN
brj-23306	314	48	,	,	PUNCT
brj-23306	314	49	respectively	respectively	ADV
brj-23306	314	50	.	.	PUNCT
brj-23306	315	1	fig	fig	NOUN
brj-23306	315	2	.	.	PUNCT
brj-23306	316	1	8	8	X
brj-23306	316	2	.	.	X
brj-23306	317	1	mic	mic	NOUN
brj-23306	317	2	of	of	ADP
brj-23306	317	3	agnps	agnps	PROPN
brj-23306	317	4	against	against	ADP
brj-23306	317	5	bacterial	bacterial	ADJ
brj-23306	317	6	pathogens	pathogen	NOUN
brj-23306	317	7	inhibitory	inhibitory	ADJ
brj-23306	317	8	effect	effect	NOUN
brj-23306	317	9	of	of	ADP
brj-23306	317	10	fungal	fungal	ADJ
brj-23306	317	11	biomass	biomass	NOUN
brj-23306	317	12	agnps	agnps	PROPN
brj-23306	317	13	inhibited	inhibit	VERB
brj-23306	317	14	fungal	fungal	ADJ
brj-23306	317	15	biomass	biomass	NOUN
brj-23306	317	16	after	after	ADP
brj-23306	317	17	5	5	NUM
brj-23306	317	18	days	day	NOUN
brj-23306	317	19	of	of	ADP
brj-23306	317	20	incubation	incubation	NOUN
brj-23306	317	21	,	,	PUNCT
brj-23306	317	22	and	and	CCONJ
brj-23306	317	23	the	the	DET
brj-23306	317	24	results	result	NOUN
brj-23306	317	25	are	be	AUX
brj-23306	317	26	depicted	depict	VERB
brj-23306	317	27	in	in	ADP
brj-23306	317	28	fig	fig	NOUN
brj-23306	317	29	.	.	PUNCT
brj-23306	318	1	9	9	NUM
brj-23306	318	2	.	.	X
brj-23306	319	1	after	after	ADP
brj-23306	319	2	5	5	NUM
brj-23306	319	3	days	day	NOUN
brj-23306	319	4	of	of	ADP
brj-23306	319	5	incubation	incubation	NOUN
brj-23306	319	6	,	,	PUNCT
brj-23306	319	7	agnps	agnps	PROPN
brj-23306	319	8	effectively	effectively	ADV
brj-23306	319	9	reduced	reduce	VERB
brj-23306	319	10	the	the	DET
brj-23306	319	11	fungal	fungal	ADJ
brj-23306	319	12	biomass	biomass	NOUN
brj-23306	319	13	in	in	ADP
brj-23306	319	14	f.	f.	PROPN
brj-23306	319	15	oxysporum	oxysporum	PROPN
brj-23306	319	16	(	(	PUNCT
brj-23306	319	17	83	83	NUM
brj-23306	319	18	±	±	NUM
brj-23306	319	19	3.1	3.1	NUM
brj-23306	319	20	%	%	NOUN
brj-23306	319	21	)	)	PUNCT
brj-23306	319	22	and	and	CCONJ
brj-23306	319	23	r.	r.	PROPN
brj-23306	319	24	oryzae	oryzae	PROPN
brj-23306	319	25	(	(	PUNCT
brj-23306	319	26	78	78	NUM
brj-23306	319	27	±	±	NUM
brj-23306	319	28	2.4	2.4	NUM
brj-23306	319	29	%	%	NOUN
brj-23306	319	30	)	)	PUNCT
brj-23306	319	31	.	.	PUNCT
brj-23306	320	1	moreover	moreover	ADV
brj-23306	320	2	,	,	PUNCT
brj-23306	320	3	agnps	agnps	PROPN
brj-23306	320	4	showed	show	VERB
brj-23306	320	5	less	less	ADJ
brj-23306	320	6	biomass	biomass	NOUN
brj-23306	320	7	inhibitory	inhibitory	ADJ
brj-23306	320	8	effect	effect	NOUN
brj-23306	320	9	against	against	ADP
brj-23306	320	10	a.	a.	NOUN
brj-23306	320	11	niger	niger	PROPN
brj-23306	320	12	,	,	PUNCT
brj-23306	320	13	r.	r.	PROPN
brj-23306	320	14	microspores	microspores	PROPN
brj-23306	320	15	,	,	PUNCT
brj-23306	320	16	and	and	CCONJ
brj-23306	320	17	p.	p.	PROPN
brj-23306	320	18	chrysogenum	chrysogenum	PROPN
brj-23306	320	19	.	.	PUNCT
brj-23306	321	1	fig	fig	NOUN
brj-23306	321	2	.	.	PUNCT
brj-23306	322	1	9	9	X
brj-23306	322	2	.	.	X
brj-23306	322	3	fungal	fungal	ADJ
brj-23306	322	4	biomass	biomass	NOUN
brj-23306	322	5	inhibitory	inhibitory	ADJ
brj-23306	322	6	effect	effect	NOUN
brj-23306	322	7	of	of	ADP
brj-23306	322	8	agnps	agnps	PROPN
brj-23306	322	9	0	0	NUM
brj-23306	322	10	10	10	NUM
brj-23306	322	11	20	20	NUM
brj-23306	322	12	30	30	NUM
brj-23306	322	13	40	40	NUM
brj-23306	322	14	50	50	NUM
brj-23306	322	15	60	60	NUM
brj-23306	322	16	70	70	NUM
brj-23306	322	17	80	80	NUM
brj-23306	322	18	e.	e.	PROPN
brj-23306	322	19	faecalis	faecalis	PROPN
brj-23306	322	20	b.	b.	PROPN
brj-23306	322	21	subtilis	subtilis	PROPN
brj-23306	322	22	b.	b.	PROPN
brj-23306	322	23	coagulans	coagulans	PROPN
brj-23306	322	24	e.	e.	PROPN
brj-23306	322	25	cloacae	cloacae	PROPN
brj-23306	322	26	p.	p.	PROPN
brj-23306	322	27	aeruginosa	aeruginosa	PROPN
brj-23306	323	1	k.	k.	PROPN
brj-23306	324	1	pneumoniae	pneumoniae	PROPN
brj-23306	324	2	s.	s.	PROPN
brj-23306	324	3	aureus	aureus	PROPN
brj-23306	324	4	m	m	PROPN
brj-23306	324	5	ic	ic	PROPN
brj-23306	324	6	(	(	PUNCT
brj-23306	324	7	µ	µ	X
brj-23306	324	8	g	g	NOUN
brj-23306	324	9	/m	/m	SYM
brj-23306	324	10	l	l	NOUN
brj-23306	324	11	)	)	PUNCT
brj-23306	324	12	0	0	NUM
brj-23306	324	13	10	10	NUM
brj-23306	324	14	20	20	NUM
brj-23306	324	15	30	30	NUM
brj-23306	324	16	40	40	NUM
brj-23306	324	17	50	50	NUM
brj-23306	324	18	60	60	NUM
brj-23306	324	19	70	70	NUM
brj-23306	324	20	80	80	NUM
brj-23306	324	21	90	90	NUM
brj-23306	324	22	100	100	NUM
brj-23306	324	23	a.	a.	NOUN
brj-23306	324	24	niger	niger	PROPN
brj-23306	324	25	f.	f.	PROPN
brj-23306	324	26	oxysporum	oxysporum	PROPN
brj-23306	324	27	r.	r.	PROPN
brj-23306	324	28	microsporus	microsporus	PROPN
brj-23306	324	29	r.	r.	PROPN
brj-23306	324	30	oryzae	oryzae	PROPN
brj-23306	325	1	p.	p.	PROPN
brj-23306	325	2	chrysogenum	chrysogenum	PROPN
brj-23306	326	1	f	f	PROPN
brj-23306	326	2	u	u	PROPN
brj-23306	326	3	n	n	CCONJ
brj-23306	326	4	g	g	NOUN
brj-23306	326	5	a	a	DET
brj-23306	326	6	l	l	NOUN
brj-23306	326	7	b	b	X
brj-23306	326	8	io	io	X
brj-23306	326	9	m	m	PROPN
brj-23306	326	10	a	a	DET
brj-23306	326	11	s	s	X
brj-23306	326	12	s	s	X
brj-23306	326	13	i	i	PRON
brj-23306	327	1	n	n	NOUN
brj-23306	327	2	h	h	NOUN
brj-23306	328	1	ib	ib	VERB
brj-23306	328	2	it	it	PRON
brj-23306	328	3	io	io	PROPN
brj-23306	328	4	n	n	PROPN
brj-23306	328	5	(	(	PUNCT
brj-23306	328	6	%	%	NOUN
brj-23306	328	7	)	)	PUNCT
brj-23306	328	8	peer	peer	NOUN
brj-23306	328	9	-	-	PUNCT
brj-23306	328	10	reviewed	review	VERB
brj-23306	328	11	article	article	NOUN
brj-23306	328	12	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	328	13	raju	raju	PROPN
brj-23306	328	14	et	et	PROPN
brj-23306	328	15	al	al	PROPN
brj-23306	328	16	.	.	PROPN
brj-23306	329	1	(	(	PUNCT
brj-23306	329	2	2024	2024	NUM
brj-23306	329	3	)	)	PUNCT
brj-23306	329	4	.	.	PUNCT
brj-23306	330	1	“	"	PUNCT
brj-23306	330	2	ag	ag	PROPN
brj-23306	330	3	nanoparticles	nanoparticle	NOUN
brj-23306	330	4	from	from	ADP
brj-23306	330	5	leaves	leave	NOUN
brj-23306	330	6	,	,	PUNCT
brj-23306	330	7	”	"	PUNCT
brj-23306	330	8	bioresources	bioresource	NOUN
brj-23306	330	9	19(2	19(2	NUM
brj-23306	330	10	)	)	PUNCT
brj-23306	330	11	,	,	PUNCT
brj-23306	330	12	3328	3328	NUM
brj-23306	330	13	-	-	SYM
brj-23306	330	14	3352	3352	NUM
brj-23306	330	15	.	.	PUNCT
brj-23306	330	16	3345	3345	NUM
brj-23306	330	17	antibiofilm	antibiofilm	NOUN
brj-23306	330	18	activity	activity	NOUN
brj-23306	330	19	the	the	DET
brj-23306	330	20	antibiofilm	antibiofilm	NOUN
brj-23306	330	21	activity	activity	NOUN
brj-23306	330	22	of	of	ADP
brj-23306	330	23	agnps	agnps	PROPN
brj-23306	330	24	was	be	AUX
brj-23306	330	25	evaluated	evaluate	VERB
brj-23306	330	26	at	at	ADP
brj-23306	330	27	various	various	ADJ
brj-23306	330	28	concentrations	concentration	NOUN
brj-23306	330	29	against	against	ADP
brj-23306	330	30	p.	p.	NOUN
brj-23306	330	31	aeruginosa	aeruginosa	PROPN
brj-23306	330	32	and	and	CCONJ
brj-23306	330	33	k.	k.	NOUN
brj-23306	330	34	pneumoniae	pneumoniae	PROPN
brj-23306	330	35	,	,	PUNCT
brj-23306	330	36	and	and	CCONJ
brj-23306	330	37	the	the	DET
brj-23306	330	38	results	result	NOUN
brj-23306	330	39	are	be	AUX
brj-23306	330	40	depicted	depict	VERB
brj-23306	330	41	in	in	ADP
brj-23306	330	42	fig	fig	NOUN
brj-23306	330	43	.	.	PUNCT
brj-23306	331	1	10	10	NUM
brj-23306	331	2	.	.	PUNCT
brj-23306	332	1	at	at	ADP
brj-23306	332	2	1/2	1/2	NUM
brj-23306	332	3	mic	mic	NOUN
brj-23306	332	4	,	,	PUNCT
brj-23306	332	5	antibiofilm	antibiofilm	NOUN
brj-23306	332	6	activity	activity	NOUN
brj-23306	332	7	was	be	AUX
brj-23306	332	8	higher	high	ADJ
brj-23306	332	9	against	against	ADP
brj-23306	332	10	k.	k.	PROPN
brj-23306	332	11	pneumoniae	pneumoniae	PROPN
brj-23306	332	12	(	(	PUNCT
brj-23306	332	13	87.4	87.4	NUM
brj-23306	332	14	±	±	NUM
brj-23306	332	15	5.3	5.3	NUM
brj-23306	332	16	%	%	NOUN
brj-23306	332	17	)	)	PUNCT
brj-23306	332	18	than	than	ADP
brj-23306	332	19	p.	p.	NOUN
brj-23306	332	20	aeruginosa	aeruginosa	PROPN
brj-23306	332	21	(	(	PUNCT
brj-23306	332	22	86.1	86.1	NUM
brj-23306	332	23	±	±	NUM
brj-23306	332	24	4.1	4.1	NUM
brj-23306	332	25	%	%	NOUN
brj-23306	332	26	)	)	PUNCT
brj-23306	332	27	.	.	PUNCT
brj-23306	333	1	at	at	ADP
brj-23306	333	2	low	low	ADJ
brj-23306	333	3	agnps	agnps	ADJ
brj-23306	333	4	concentrations	concentration	NOUN
brj-23306	333	5	,	,	PUNCT
brj-23306	333	6	a	a	DET
brj-23306	333	7	reduction	reduction	NOUN
brj-23306	333	8	in	in	ADP
brj-23306	333	9	antibiofilm	antibiofilm	NOUN
brj-23306	333	10	activity	activity	NOUN
brj-23306	333	11	was	be	AUX
brj-23306	333	12	observed	observe	VERB
brj-23306	333	13	with	with	ADP
brj-23306	333	14	respect	respect	NOUN
brj-23306	333	15	to	to	ADP
brj-23306	333	16	the	the	DET
brj-23306	333	17	positive	positive	ADJ
brj-23306	333	18	control	control	NOUN
brj-23306	333	19	.	.	PUNCT
brj-23306	334	1	the	the	DET
brj-23306	334	2	synthesized	synthesize	VERB
brj-23306	334	3	agnps	agnps	NOUN
brj-23306	334	4	showed	show	VERB
brj-23306	334	5	antibiofilm	antibiofilm	NOUN
brj-23306	334	6	activity	activity	NOUN
brj-23306	334	7	too	too	ADV
brj-23306	334	8	against	against	ADP
brj-23306	334	9	k.	k.	PROPN
brj-23306	334	10	pneumoniae	pneumoniae	PROPN
brj-23306	334	11	and	and	CCONJ
brj-23306	334	12	p.	p.	NOUN
brj-23306	334	13	aeruginosa	aeruginosa	PROPN
brj-23306	334	14	.	.	PUNCT
brj-23306	335	1	the	the	DET
brj-23306	335	2	antibiofilm	antibiofilm	NOUN
brj-23306	335	3	property	property	NOUN
brj-23306	335	4	was	be	AUX
brj-23306	335	5	described	describe	VERB
brj-23306	335	6	previously	previously	ADV
brj-23306	335	7	(	(	PUNCT
brj-23306	335	8	shehabeldine	shehabeldine	VERB
brj-23306	335	9	et	et	PROPN
brj-23306	335	10	al	al	PROPN
brj-23306	335	11	.	.	PROPN
brj-23306	335	12	2022	2022	NUM
brj-23306	335	13	)	)	PUNCT
brj-23306	335	14	.	.	PUNCT
brj-23306	336	1	fig	fig	NOUN
brj-23306	336	2	.	.	PUNCT
brj-23306	337	1	10	10	NUM
brj-23306	337	2	.	.	X
brj-23306	337	3	antibiofilm	antibiofilm	NOUN
brj-23306	337	4	activity	activity	NOUN
brj-23306	337	5	of	of	ADP
brj-23306	337	6	agnps	agnps	NOUN
brj-23306	337	7	against	against	ADP
brj-23306	337	8	p.	p.	NOUN
brj-23306	337	9	aeruginosa	aeruginosa	PROPN
brj-23306	337	10	and	and	CCONJ
brj-23306	337	11	k.	k.	NOUN
brj-23306	337	12	pneumoniae	pneumoniae	NOUN
brj-23306	337	13	at	at	ADP
brj-23306	337	14	1/2	1/2	NUM
brj-23306	337	15	,	,	PUNCT
brj-23306	337	16	1/4	1/4	NUM
brj-23306	337	17	,	,	PUNCT
brj-23306	337	18	and	and	CCONJ
brj-23306	337	19	1/8	1/8	NUM
brj-23306	337	20	mic	mic	ADJ
brj-23306	337	21	-	-	PUNCT
brj-23306	337	22	values	value	NOUN
brj-23306	337	23	fig	fig	NOUN
brj-23306	337	24	.	.	PUNCT
brj-23306	338	1	11	11	NUM
brj-23306	338	2	.	.	PUNCT
brj-23306	338	3	photocatalytic	photocatalytic	ADJ
brj-23306	338	4	activity	activity	NOUN
brj-23306	338	5	of	of	ADP
brj-23306	338	6	agnps	agnps	NOUN
brj-23306	338	7	at	at	ADP
brj-23306	338	8	various	various	ADJ
brj-23306	338	9	catalytic	catalytic	ADJ
brj-23306	338	10	reaction	reaction	NOUN
brj-23306	338	11	times	time	NOUN
brj-23306	338	12	.	.	PUNCT
brj-23306	339	1	the	the	DET
brj-23306	339	2	initial	initial	ADJ
brj-23306	339	3	mb	mb	PROPN
brj-23306	339	4	dye	dye	NOUN
brj-23306	339	5	concentration	concentration	NOUN
brj-23306	339	6	was	be	AUX
brj-23306	339	7	10	10	NUM
brj-23306	339	8	ppm	ppm	NOUN
brj-23306	339	9	,	,	PUNCT
brj-23306	339	10	and	and	CCONJ
brj-23306	339	11	the	the	DET
brj-23306	339	12	photocatalytic	photocatalytic	ADJ
brj-23306	339	13	reaction	reaction	NOUN
brj-23306	339	14	was	be	AUX
brj-23306	339	15	carried	carry	VERB
brj-23306	339	16	out	out	ADP
brj-23306	339	17	for	for	ADP
brj-23306	339	18	60	60	NUM
brj-23306	339	19	min	min	NOUN
brj-23306	339	20	.	.	NOUN
brj-23306	339	21	0	0	NUM
brj-23306	339	22	20	20	NUM
brj-23306	339	23	40	40	NUM
brj-23306	339	24	60	60	NUM
brj-23306	339	25	80	80	NUM
brj-23306	339	26	100	100	NUM
brj-23306	339	27	120	120	NUM
brj-23306	339	28	1/2	1/2	NUM
brj-23306	339	29	mic	mic	ADJ
brj-23306	339	30	1/4	1/4	NUM
brj-23306	339	31	mic	mic	ADJ
brj-23306	339	32	1/8	1/8	NUM
brj-23306	339	33	mic	mic	ADJ
brj-23306	339	34	control	control	NOUN
brj-23306	339	35	a	a	PRON
brj-23306	339	36	n	n	NOUN
brj-23306	339	37	ti	ti	X
brj-23306	339	38	b	b	PROPN
brj-23306	339	39	io	io	X
brj-23306	339	40	fi	fi	PROPN
brj-23306	340	1	lm	lm	INTJ
brj-23306	340	2	a	a	DET
brj-23306	340	3	c	c	NOUN
brj-23306	340	4	ti	ti	NOUN
brj-23306	340	5	v	v	ADP
brj-23306	340	6	it	it	PRON
brj-23306	340	7	y	y	PROPN
brj-23306	340	8	(	(	PUNCT
brj-23306	340	9	%	%	INTJ
brj-23306	340	10	)	)	PUNCT
brj-23306	341	1	p.	p.	NOUN
brj-23306	341	2	aeruginosa	aeruginosa	PROPN
brj-23306	341	3	k.	k.	PROPN
brj-23306	342	1	pneumoniae	pneumoniae	ADJ
brj-23306	342	2	0	0	NUM
brj-23306	342	3	10	10	NUM
brj-23306	342	4	20	20	NUM
brj-23306	342	5	30	30	NUM
brj-23306	342	6	40	40	NUM
brj-23306	342	7	50	50	NUM
brj-23306	342	8	60	60	NUM
brj-23306	342	9	70	70	NUM
brj-23306	342	10	80	80	NUM
brj-23306	342	11	90	90	NUM
brj-23306	342	12	100	100	NUM
brj-23306	342	13	0	0	NUM
brj-23306	342	14	10	10	NUM
brj-23306	342	15	20	20	NUM
brj-23306	342	16	30	30	NUM
brj-23306	342	17	40	40	NUM
brj-23306	342	18	50	50	NUM
brj-23306	342	19	60	60	NUM
brj-23306	342	20	70	70	NUM
brj-23306	342	21	p	p	NOUN
brj-23306	342	22	h	h	NOUN
brj-23306	342	23	o	o	NOUN
brj-23306	342	24	to	to	ADP
brj-23306	342	25	c	c	PROPN
brj-23306	342	26	a	a	DET
brj-23306	342	27	ta	ta	X
brj-23306	342	28	ly	ly	ADP
brj-23306	342	29	ti	ti	PROPN
brj-23306	342	30	c	c	NOUN
brj-23306	342	31	a	a	PRON
brj-23306	342	32	c	c	NOUN
brj-23306	342	33	ti	ti	NOUN
brj-23306	342	34	v	v	ADP
brj-23306	342	35	it	it	PRON
brj-23306	343	1	y	y	NOUN
brj-23306	343	2	o	o	NOUN
brj-23306	343	3	f	f	NOUN
brj-23306	344	1	n	n	PRON
brj-23306	344	2	p	p	NOUN
brj-23306	344	3	s	s	X
brj-23306	344	4	(	(	PUNCT
brj-23306	344	5	%	%	NOUN
brj-23306	344	6	)	)	PUNCT
brj-23306	344	7	photocatalytic	photocatalytic	ADJ
brj-23306	344	8	reaction	reaction	NOUN
brj-23306	344	9	(	(	PUNCT
brj-23306	344	10	min	min	NOUN
brj-23306	344	11	)	)	PUNCT
brj-23306	344	12	peer	peer	NOUN
brj-23306	344	13	-	-	PUNCT
brj-23306	344	14	reviewed	review	VERB
brj-23306	344	15	article	article	NOUN
brj-23306	344	16	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	344	17	raju	raju	PROPN
brj-23306	344	18	et	et	PROPN
brj-23306	344	19	al	al	PROPN
brj-23306	344	20	.	.	PROPN
brj-23306	345	1	(	(	PUNCT
brj-23306	345	2	2024	2024	NUM
brj-23306	345	3	)	)	PUNCT
brj-23306	345	4	.	.	PUNCT
brj-23306	346	1	“	"	PUNCT
brj-23306	346	2	ag	ag	PROPN
brj-23306	346	3	nanoparticles	nanoparticle	NOUN
brj-23306	346	4	from	from	ADP
brj-23306	346	5	leaves	leave	NOUN
brj-23306	346	6	,	,	PUNCT
brj-23306	346	7	”	"	PUNCT
brj-23306	346	8	bioresources	bioresource	NOUN
brj-23306	346	9	19(2	19(2	NUM
brj-23306	346	10	)	)	PUNCT
brj-23306	346	11	,	,	PUNCT
brj-23306	346	12	3328	3328	NUM
brj-23306	346	13	-	-	SYM
brj-23306	346	14	3352	3352	NUM
brj-23306	346	15	.	.	PUNCT
brj-23306	346	16	3346	3346	NUM
brj-23306	346	17	photocatalytic	photocatalytic	ADJ
brj-23306	346	18	activity	activity	NOUN
brj-23306	346	19	of	of	ADP
brj-23306	346	20	agnps	agnps	PROPN
brj-23306	346	21	the	the	DET
brj-23306	346	22	photocatalytic	photocatalytic	ADJ
brj-23306	346	23	activity	activity	NOUN
brj-23306	346	24	of	of	ADP
brj-23306	346	25	agnps	agnps	PROPN
brj-23306	346	26	was	be	AUX
brj-23306	346	27	determined	determine	VERB
brj-23306	346	28	using	use	VERB
brj-23306	346	29	mb	mb	ADP
brj-23306	346	30	dye	dye	NOUN
brj-23306	346	31	,	,	PUNCT
brj-23306	346	32	and	and	CCONJ
brj-23306	346	33	the	the	DET
brj-23306	346	34	result	result	NOUN
brj-23306	346	35	is	be	AUX
brj-23306	346	36	illustrated	illustrate	VERB
brj-23306	346	37	in	in	ADP
brj-23306	346	38	fig	fig	NOUN
brj-23306	346	39	.	.	PUNCT
brj-23306	347	1	11	11	NUM
brj-23306	347	2	.	.	PUNCT
brj-23306	348	1	the	the	DET
brj-23306	348	2	photocatalytic	photocatalytic	ADJ
brj-23306	348	3	activity	activity	NOUN
brj-23306	348	4	showed	show	VERB
brj-23306	348	5	a	a	DET
brj-23306	348	6	decreased	decrease	VERB
brj-23306	348	7	absorbance	absorbance	NOUN
brj-23306	348	8	spectrum	spectrum	NOUN
brj-23306	348	9	in	in	ADP
brj-23306	348	10	the	the	DET
brj-23306	348	11	visible	visible	ADJ
brj-23306	348	12	region	region	NOUN
brj-23306	348	13	.	.	PUNCT
brj-23306	349	1	the	the	DET
brj-23306	349	2	increase	increase	NOUN
brj-23306	349	3	in	in	ADP
brj-23306	349	4	exposure	exposure	NOUN
brj-23306	349	5	time	time	NOUN
brj-23306	349	6	decreased	decrease	VERB
brj-23306	349	7	the	the	DET
brj-23306	349	8	absorbance	absorbance	NOUN
brj-23306	349	9	at	at	ADP
brj-23306	349	10	660	660	NUM
brj-23306	349	11	nm	nm	NOUN
brj-23306	349	12	.	.	PUNCT
brj-23306	350	1	the	the	DET
brj-23306	350	2	percentage	percentage	NOUN
brj-23306	350	3	mb	mb	ADP
brj-23306	350	4	dye	dye	NOUN
brj-23306	350	5	degradation	degradation	NOUN
brj-23306	350	6	potential	potential	NOUN
brj-23306	350	7	was	be	AUX
brj-23306	350	8	calculated	calculate	VERB
brj-23306	350	9	as	as	ADP
brj-23306	350	10	13	13	NUM
brj-23306	350	11	±	±	NUM
brj-23306	350	12	0.5	0.5	NUM
brj-23306	350	13	%	%	NOUN
brj-23306	350	14	degradation	degradation	NOUN
brj-23306	350	15	after	after	ADP
brj-23306	350	16	a	a	DET
brj-23306	350	17	10	10	NUM
brj-23306	350	18	-	-	PUNCT
brj-23306	350	19	min	min	NOUN
brj-23306	350	20	photocatalytic	photocatalytic	ADJ
brj-23306	350	21	reaction	reaction	NOUN
brj-23306	350	22	.	.	PUNCT
brj-23306	351	1	the	the	DET
brj-23306	351	2	photocatalytic	photocatalytic	ADJ
brj-23306	351	3	activity	activity	NOUN
brj-23306	351	4	increased	increase	VERB
brj-23306	351	5	with	with	ADP
brj-23306	351	6	the	the	DET
brj-23306	351	7	increased	increase	VERB
brj-23306	351	8	reaction	reaction	NOUN
brj-23306	351	9	time	time	NOUN
brj-23306	351	10	,	,	PUNCT
brj-23306	351	11	and	and	CCONJ
brj-23306	351	12	88.4	88.4	NUM
brj-23306	351	13	±	±	NUM
brj-23306	351	14	1.4	1.4	NUM
brj-23306	351	15	%	%	NOUN
brj-23306	351	16	degradation	degradation	NOUN
brj-23306	351	17	was	be	AUX
brj-23306	351	18	achieved	achieve	VERB
brj-23306	351	19	after	after	ADP
brj-23306	351	20	60	60	NUM
brj-23306	351	21	min	min	PROPN
brj-23306	351	22	.	.	PROPN
brj-23306	351	23	larvicidal	larvicidal	ADJ
brj-23306	351	24	activity	activity	NOUN
brj-23306	351	25	of	of	ADP
brj-23306	351	26	agnps	agnps	PROPN
brj-23306	351	27	the	the	DET
brj-23306	351	28	mortality	mortality	NOUN
brj-23306	351	29	percentage	percentage	NOUN
brj-23306	351	30	(	(	PUNCT
brj-23306	351	31	%	%	NOUN
brj-23306	351	32	)	)	PUNCT
brj-23306	351	33	of	of	ADP
brj-23306	351	34	ae	ae	PROPN
brj-23306	351	35	.	.	PUNCT
brj-23306	352	1	aegypti	aegypti	NOUN
brj-23306	352	2	exposed	expose	VERB
brj-23306	352	3	to	to	ADP
brj-23306	352	4	different	different	ADJ
brj-23306	352	5	concentrations	concentration	NOUN
brj-23306	352	6	of	of	ADP
brj-23306	352	7	agnps	agnps	PROPN
brj-23306	352	8	after	after	ADP
brj-23306	352	9	24	24	NUM
brj-23306	352	10	and	and	CCONJ
brj-23306	352	11	48	48	NUM
brj-23306	352	12	h	h	NOUN
brj-23306	352	13	is	be	AUX
brj-23306	352	14	shown	show	VERB
brj-23306	352	15	in	in	ADP
brj-23306	352	16	fig	fig	NOUN
brj-23306	352	17	.	.	PUNCT
brj-23306	353	1	12	12	NUM
brj-23306	353	2	.	.	PUNCT
brj-23306	354	1	the	the	DET
brj-23306	354	2	concentration	concentration	NOUN
brj-23306	354	3	of	of	ADP
brj-23306	354	4	the	the	DET
brj-23306	354	5	agnps	agnps	ADJ
brj-23306	354	6	and	and	CCONJ
brj-23306	354	7	treatment	treatment	NOUN
brj-23306	354	8	time	time	NOUN
brj-23306	354	9	affected	affect	VERB
brj-23306	354	10	the	the	DET
brj-23306	354	11	larvicidal	larvicidal	NOUN
brj-23306	354	12	properties	property	NOUN
brj-23306	354	13	.	.	PUNCT
brj-23306	355	1	the	the	DET
brj-23306	355	2	mortality	mortality	NOUN
brj-23306	355	3	of	of	ADP
brj-23306	355	4	larvae	larvae	NOUN
brj-23306	355	5	increased	increase	VERB
brj-23306	355	6	after	after	ADP
brj-23306	355	7	48	48	NUM
brj-23306	355	8	h	h	NOUN
brj-23306	355	9	of	of	ADP
brj-23306	355	10	exposure	exposure	NOUN
brj-23306	355	11	compared	compare	VERB
brj-23306	355	12	to	to	ADP
brj-23306	355	13	24	24	NUM
brj-23306	355	14	h.	h.	PROPN
brj-23306	355	15	likewise	likewise	ADV
brj-23306	355	16	,	,	PUNCT
brj-23306	355	17	increased	increase	VERB
brj-23306	355	18	mortality	mortality	NOUN
brj-23306	355	19	was	be	AUX
brj-23306	355	20	observed	observe	VERB
brj-23306	355	21	at	at	ADP
brj-23306	355	22	a	a	DET
brj-23306	355	23	concentration	concentration	NOUN
brj-23306	355	24	of	of	ADP
brj-23306	355	25	10	10	NUM
brj-23306	355	26	mg	mg	NUM
brj-23306	355	27	/	/	SYM
brj-23306	355	28	l	l	NOUN
brj-23306	355	29	of	of	ADP
brj-23306	355	30	agnps	agnps	PROPN
brj-23306	355	31	,	,	PUNCT
brj-23306	355	32	as	as	SCONJ
brj-23306	355	33	compared	compare	VERB
brj-23306	355	34	to	to	ADP
brj-23306	355	35	2.5	2.5	NUM
brj-23306	355	36	mg	mg	PROPN
brj-23306	355	37	/	/	SYM
brj-23306	355	38	l.	l.	PROPN
brj-23306	355	39	amarasinghe	amarasinghe	PROPN
brj-23306	355	40	et	et	PROPN
brj-23306	355	41	al	al	PROPN
brj-23306	355	42	.	.	PROPN
brj-23306	356	1	(	(	PUNCT
brj-23306	356	2	2020	2020	NUM
brj-23306	356	3	)	)	PUNCT
brj-23306	356	4	conducted	conduct	VERB
brj-23306	356	5	a	a	DET
brj-23306	356	6	study	study	NOUN
brj-23306	356	7	in	in	ADP
brj-23306	356	8	which	which	PRON
brj-23306	356	9	they	they	PRON
brj-23306	356	10	found	find	VERB
brj-23306	356	11	that	that	SCONJ
brj-23306	356	12	silver	silver	ADJ
brj-23306	356	13	nanoparticles	nanoparticle	NOUN
brj-23306	356	14	synthesized	synthesize	VERB
brj-23306	356	15	through	through	ADP
brj-23306	356	16	the	the	DET
brj-23306	356	17	use	use	NOUN
brj-23306	356	18	of	of	ADP
brj-23306	356	19	annona	annona	PROPN
brj-23306	356	20	squamosa	squamosa	PROPN
brj-23306	356	21	leaf	leaf	PROPN
brj-23306	356	22	broth	broth	NOUN
brj-23306	356	23	exhibited	exhibit	VERB
brj-23306	356	24	a	a	DET
brj-23306	356	25	notable	notable	ADJ
brj-23306	356	26	increase	increase	NOUN
brj-23306	356	27	in	in	ADP
brj-23306	356	28	mortality	mortality	NOUN
brj-23306	356	29	rates	rate	NOUN
brj-23306	356	30	among	among	ADP
brj-23306	356	31	fourth	fourth	ADJ
brj-23306	356	32	instar	instar	ADJ
brj-23306	356	33	larvae	larvae	NOUN
brj-23306	356	34	of	of	ADP
brj-23306	356	35	aedes	aedes	PROPN
brj-23306	356	36	aegypti	aegypti	PROPN
brj-23306	356	37	,	,	PUNCT
brj-23306	356	38	commonly	commonly	ADV
brj-23306	356	39	known	know	VERB
brj-23306	356	40	as	as	ADP
brj-23306	356	41	the	the	DET
brj-23306	356	42	yellow	yellow	ADJ
brj-23306	356	43	fever	fever	NOUN
brj-23306	356	44	mosquito	mosquito	NOUN
brj-23306	356	45	.	.	PUNCT
brj-23306	357	1	fig	fig	NOUN
brj-23306	357	2	.	.	PUNCT
brj-23306	358	1	12	12	NUM
brj-23306	358	2	.	.	PUNCT
brj-23306	358	3	larvicidal	larvicidal	ADJ
brj-23306	358	4	activity	activity	NOUN
brj-23306	358	5	of	of	ADP
brj-23306	358	6	agnps	agnps	PROPN
brj-23306	358	7	at	at	ADP
brj-23306	358	8	various	various	ADJ
brj-23306	358	9	concentrations	concentration	NOUN
brj-23306	358	10	after	after	ADP
brj-23306	358	11	24	24	NUM
brj-23306	358	12	and	and	CCONJ
brj-23306	358	13	48	48	NUM
brj-23306	358	14	h	h	NOUN
brj-23306	358	15	cod	cod	NOUN
brj-23306	358	16	and	and	CCONJ
brj-23306	358	17	bacterial	bacterial	ADJ
brj-23306	358	18	load	load	NOUN
brj-23306	358	19	reduction	reduction	NOUN
brj-23306	358	20	municipal	municipal	ADJ
brj-23306	358	21	wastewater	wastewater	NOUN
brj-23306	358	22	treated	treat	VERB
brj-23306	358	23	with	with	ADP
brj-23306	358	24	agnps	agnps	PROPN
brj-23306	358	25	reduced	reduce	VERB
brj-23306	358	26	the	the	DET
brj-23306	358	27	cod	cod	NOUN
brj-23306	358	28	,	,	PUNCT
brj-23306	358	29	and	and	CCONJ
brj-23306	358	30	the	the	DET
brj-23306	358	31	result	result	NOUN
brj-23306	358	32	is	be	AUX
brj-23306	358	33	depicted	depict	VERB
brj-23306	358	34	in	in	ADP
brj-23306	358	35	fig	fig	NOUN
brj-23306	358	36	.	.	PUNCT
brj-23306	359	1	13a	13a	PROPN
brj-23306	359	2	.	.	PUNCT
brj-23306	360	1	at	at	ADP
brj-23306	360	2	2.5	2.5	NUM
brj-23306	360	3	ppm	ppm	NOUN
brj-23306	360	4	concentration	concentration	NOUN
brj-23306	360	5	of	of	ADP
brj-23306	360	6	agnps	agnps	PROPN
brj-23306	360	7	,	,	PUNCT
brj-23306	360	8	the	the	DET
brj-23306	360	9	cod	cod	NOUN
brj-23306	360	10	reduction	reduction	NOUN
brj-23306	360	11	was	be	AUX
brj-23306	360	12	obtained	obtain	VERB
brj-23306	360	13	as	as	ADP
brj-23306	360	14	55.1	55.1	NUM
brj-23306	360	15	±	±	NUM
brj-23306	360	16	2.1	2.1	NUM
brj-23306	360	17	%	%	NOUN
brj-23306	360	18	,	,	PUNCT
brj-23306	360	19	but	but	CCONJ
brj-23306	360	20	the	the	DET
brj-23306	360	21	cod	cod	NOUN
brj-23306	360	22	reduction	reduction	NOUN
brj-23306	360	23	percentage	percentage	NOUN
brj-23306	360	24	increased	increase	VERB
brj-23306	360	25	at	at	ADP
brj-23306	360	26	10	10	NUM
brj-23306	360	27	ppm	ppm	NOUN
brj-23306	360	28	concentration	concentration	NOUN
brj-23306	360	29	of	of	ADP
brj-23306	360	30	agnps	agnps	PROPN
brj-23306	360	31	in	in	ADP
brj-23306	360	32	the	the	DET
brj-23306	360	33	wastewater	wastewater	NOUN
brj-23306	360	34	(	(	PUNCT
brj-23306	360	35	63.8	63.8	NUM
brj-23306	360	36	±	±	NUM
brj-23306	360	37	1.5	1.5	NUM
brj-23306	360	38	%	%	NOUN
brj-23306	360	39	)	)	PUNCT
brj-23306	360	40	.	.	PUNCT
brj-23306	361	1	in	in	ADP
brj-23306	361	2	contrast	contrast	NOUN
brj-23306	361	3	,	,	PUNCT
brj-23306	361	4	the	the	DET
brj-23306	361	5	bacterial	bacterial	ADJ
brj-23306	361	6	population	population	NOUN
brj-23306	361	7	in	in	ADP
brj-23306	361	8	agnpstreated	agnpstreate	VERB
brj-23306	361	9	wastewater	wastewater	NOUN
brj-23306	361	10	was	be	AUX
brj-23306	361	11	estimated	estimate	VERB
brj-23306	361	12	as	as	ADP
brj-23306	361	13	9700	9700	NUM
brj-23306	361	14	±	±	NUM
brj-23306	361	15	178	178	NUM
brj-23306	361	16	cfu	cfu	NOUN
brj-23306	361	17	/	/	SYM
brj-23306	361	18	ml	ml	NOUN
brj-23306	361	19	,	,	PUNCT
brj-23306	361	20	5350	5350	NUM
brj-23306	361	21	±	±	NOUN
brj-23306	361	22	102	102	NUM
brj-23306	361	23	cfu	cfu	NOUN
brj-23306	361	24	/	/	SYM
brj-23306	361	25	ml	ml	NOUN
brj-23306	361	26	,	,	PUNCT
brj-23306	361	27	3874	3874	NUM
brj-23306	361	28	±	±	NUM
brj-23306	361	29	79	79	NUM
brj-23306	361	30	cfu	cfu	NOUN
brj-23306	361	31	/	/	SYM
brj-23306	361	32	ml	ml	NOUN
brj-23306	361	33	,	,	PUNCT
brj-23306	361	34	and	and	CCONJ
brj-23306	361	35	3280	3280	NUM
brj-23306	361	36	±	±	NUM
brj-23306	361	37	22	22	NUM
brj-23306	361	38	cfu	cfu	NOUN
brj-23306	361	39	/	/	SYM
brj-23306	361	40	ml	ml	ADP
brj-23306	361	41	,	,	PUNCT
brj-23306	361	42	at	at	ADP
brj-23306	361	43	2.5	2.5	NUM
brj-23306	361	44	,	,	PUNCT
brj-23306	361	45	5	5	NUM
brj-23306	361	46	,	,	PUNCT
brj-23306	361	47	7.5	7.5	NUM
brj-23306	361	48	,	,	PUNCT
brj-23306	361	49	and	and	CCONJ
brj-23306	361	50	10	10	NUM
brj-23306	361	51	ppm	ppm	NOUN
brj-23306	361	52	concentration	concentration	NOUN
brj-23306	361	53	of	of	ADP
brj-23306	361	54	agnps	agnps	ADJ
brj-23306	361	55	,	,	PUNCT
brj-23306	361	56	correspondingly	correspondingly	ADV
brj-23306	361	57	(	(	PUNCT
brj-23306	361	58	fig	fig	NOUN
brj-23306	361	59	.	.	PUNCT
brj-23306	361	60	13b	13b	NUM
brj-23306	361	61	)	)	PUNCT
brj-23306	361	62	.	.	PUNCT
brj-23306	362	1	the	the	DET
brj-23306	362	2	agnps	agnps	PROPN
brj-23306	362	3	exhibited	exhibit	VERB
brj-23306	362	4	larvicidal	larvicidal	NOUN
brj-23306	362	5	activity	activity	NOUN
brj-23306	362	6	against	against	ADP
brj-23306	362	7	ae	ae	PROPN
brj-23306	362	8	.	.	PUNCT
brj-23306	363	1	aegypti	aegypti	PROPN
brj-23306	363	2	.	.	PUNCT
brj-23306	364	1	this	this	DET
brj-23306	364	2	experimental	experimental	ADJ
brj-23306	364	3	evidence	evidence	NOUN
brj-23306	364	4	demonstrated	demonstrate	VERB
brj-23306	364	5	the	the	DET
brj-23306	364	6	multifunctional	multifunctional	ADJ
brj-23306	364	7	properties	property	NOUN
brj-23306	364	8	of	of	ADP
brj-23306	364	9	the	the	DET
brj-23306	364	10	synthesized	synthesize	VERB
brj-23306	364	11	agnps	agnps	NOUN
brj-23306	364	12	.	.	PUNCT
brj-23306	365	1	in	in	ADP
brj-23306	365	2	addition	addition	NOUN
brj-23306	365	3	to	to	ADP
brj-23306	365	4	this	this	PRON
brj-23306	365	5	,	,	PUNCT
brj-23306	365	6	agnps	agnps	PROPN
brj-23306	365	7	were	be	AUX
brj-23306	365	8	used	use	VERB
brj-23306	365	9	to	to	PART
brj-23306	365	10	treat	treat	VERB
brj-23306	365	11	wastewater	wastewater	NOUN
brj-23306	365	12	,	,	PUNCT
brj-23306	365	13	and	and	CCONJ
brj-23306	365	14	cod	cod	NOUN
brj-23306	365	15	removal	removal	NOUN
brj-23306	365	16	potential	potential	NOUN
brj-23306	365	17	was	be	AUX
brj-23306	365	18	registered	register	VERB
brj-23306	365	19	.	.	PUNCT
brj-23306	366	1	the	the	DET
brj-23306	366	2	bactericidal	bactericidal	ADJ
brj-23306	366	3	activity	activity	NOUN
brj-23306	366	4	of	of	ADP
brj-23306	366	5	agnps	agnps	PROPN
brj-23306	366	6	reduced	reduce	VERB
brj-23306	366	7	the	the	DET
brj-23306	366	8	bacterial	bacterial	ADJ
brj-23306	366	9	load	load	NOUN
brj-23306	366	10	in	in	ADP
brj-23306	366	11	the	the	DET
brj-23306	366	12	agnp	agnp	NOUN
brj-23306	366	13	-	-	PUNCT
brj-23306	366	14	treated	treat	VERB
brj-23306	366	15	wastewater	wastewater	NOUN
brj-23306	366	16	(	(	PUNCT
brj-23306	366	17	el‐telbany	el‐telbany	NOUN
brj-23306	366	18	and	and	CCONJ
brj-23306	366	19	el	el	PROPN
brj-23306	366	20	-	-	NOUN
brj-23306	366	21	sharaki	sharaki	PROPN
brj-23306	366	22	2022	2022	NUM
brj-23306	366	23	)	)	PUNCT
brj-23306	366	24	.	.	PUNCT
brj-23306	367	1	to	to	PART
brj-23306	367	2	fully	fully	ADV
brj-23306	367	3	grasp	grasp	VERB
brj-23306	367	4	and	and	CCONJ
brj-23306	367	5	0	0	NUM
brj-23306	367	6	20	20	NUM
brj-23306	367	7	40	40	NUM
brj-23306	367	8	60	60	NUM
brj-23306	367	9	80	80	NUM
brj-23306	367	10	100	100	NUM
brj-23306	367	11	120	120	NUM
brj-23306	367	12	2.5	2.5	NUM
brj-23306	367	13	5	5	NUM
brj-23306	367	14	7.5	7.5	NUM
brj-23306	367	15	10	10	NUM
brj-23306	367	16	l	l	NOUN
brj-23306	367	17	a	a	PRON
brj-23306	367	18	rv	rv	X
brj-23306	368	1	ic	ic	PROPN
brj-23306	368	2	i	i	PROPN
brj-23306	368	3	d	d	PROPN
brj-23306	368	4	a	a	PROPN
brj-23306	368	5	l	l	NOUN
brj-23306	368	6	a	a	DET
brj-23306	368	7	c	c	NOUN
brj-23306	368	8	ti	ti	NOUN
brj-23306	368	9	v	v	ADP
brj-23306	368	10	it	it	PRON
brj-23306	368	11	y	y	PROPN
brj-23306	368	12	(	(	PUNCT
brj-23306	368	13	%	%	INTJ
brj-23306	368	14	)	)	PUNCT
brj-23306	369	1	agnps	agnps	PROPN
brj-23306	369	2	(	(	PUNCT
brj-23306	369	3	mg	mg	PROPN
brj-23306	369	4	/	/	SYM
brj-23306	369	5	l	l	NOUN
brj-23306	369	6	)	)	PUNCT
brj-23306	369	7	24	24	NUM
brj-23306	369	8	h	h	NOUN
brj-23306	369	9	48	48	NUM
brj-23306	369	10	h	h	NOUN
brj-23306	369	11	peer	peer	NOUN
brj-23306	369	12	-	-	PUNCT
brj-23306	369	13	reviewed	review	VERB
brj-23306	369	14	article	article	NOUN
brj-23306	369	15	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	369	16	raju	raju	PROPN
brj-23306	369	17	et	et	PROPN
brj-23306	369	18	al	al	PROPN
brj-23306	369	19	.	.	PROPN
brj-23306	370	1	(	(	PUNCT
brj-23306	370	2	2024	2024	NUM
brj-23306	370	3	)	)	PUNCT
brj-23306	370	4	.	.	PUNCT
brj-23306	371	1	“	"	PUNCT
brj-23306	371	2	ag	ag	PROPN
brj-23306	371	3	nanoparticles	nanoparticle	NOUN
brj-23306	371	4	from	from	ADP
brj-23306	371	5	leaves	leave	NOUN
brj-23306	371	6	,	,	PUNCT
brj-23306	371	7	”	"	PUNCT
brj-23306	371	8	bioresources	bioresource	NOUN
brj-23306	371	9	19(2	19(2	NUM
brj-23306	371	10	)	)	PUNCT
brj-23306	371	11	,	,	PUNCT
brj-23306	371	12	3328	3328	NUM
brj-23306	371	13	-	-	SYM
brj-23306	371	14	3352	3352	NUM
brj-23306	371	15	.	.	PUNCT
brj-23306	372	1	3347	3347	NUM
brj-23306	372	2	harness	harness	NOUN
brj-23306	372	3	the	the	DET
brj-23306	372	4	multifunctional	multifunctional	ADJ
brj-23306	372	5	potential	potential	NOUN
brj-23306	372	6	of	of	ADP
brj-23306	372	7	a.	a.	NOUN
brj-23306	372	8	purpurata	purpurata	NOUN
brj-23306	372	9	,	,	PUNCT
brj-23306	372	10	additional	additional	ADJ
brj-23306	372	11	research	research	NOUN
brj-23306	372	12	and	and	CCONJ
brj-23306	372	13	clinical	clinical	ADJ
brj-23306	372	14	investigations	investigation	NOUN
brj-23306	372	15	are	be	AUX
brj-23306	372	16	needed	need	VERB
brj-23306	372	17	.	.	PUNCT
brj-23306	373	1	a	a	DET
brj-23306	373	2	b	b	NOUN
brj-23306	373	3	fig	fig	NOUN
brj-23306	373	4	.	.	PUNCT
brj-23306	374	1	13	13	NUM
brj-23306	374	2	.	.	PUNCT
brj-23306	374	3	reduction	reduction	NOUN
brj-23306	374	4	of	of	ADP
brj-23306	374	5	chemical	chemical	ADJ
brj-23306	374	6	oxygen	oxygen	NOUN
brj-23306	374	7	demand	demand	NOUN
brj-23306	374	8	(	(	PUNCT
brj-23306	374	9	a	a	NOUN
brj-23306	374	10	)	)	PUNCT
brj-23306	374	11	and	and	CCONJ
brj-23306	374	12	bacterial	bacterial	ADJ
brj-23306	374	13	population	population	NOUN
brj-23306	374	14	(	(	PUNCT
brj-23306	374	15	b	b	NOUN
brj-23306	374	16	)	)	PUNCT
brj-23306	374	17	in	in	ADP
brj-23306	374	18	agnp	agnp	NOUN
brj-23306	374	19	(	(	PUNCT
brj-23306	374	20	2.5	2.5	NUM
brj-23306	374	21	to	to	PART
brj-23306	374	22	10	10	NUM
brj-23306	374	23	ppm)-treated	ppm)-treate	VERB
brj-23306	374	24	municipal	municipal	ADJ
brj-23306	374	25	wastewater	wastewater	NOUN
brj-23306	374	26	conclusions	conclusion	NOUN
brj-23306	374	27	1	1	X
brj-23306	374	28	.	.	PUNCT
brj-23306	374	29	silver	silver	ADJ
brj-23306	374	30	nanoparticles	nanoparticle	NOUN
brj-23306	374	31	were	be	AUX
brj-23306	374	32	successfully	successfully	ADV
brj-23306	374	33	synthesized	synthesize	VERB
brj-23306	374	34	using	use	VERB
brj-23306	374	35	leaf	leaf	NOUN
brj-23306	374	36	extract	extract	NOUN
brj-23306	374	37	of	of	ADP
brj-23306	374	38	a.	a.	NOUN
brj-23306	374	39	purpurata	purpurata	PROPN
brj-23306	374	40	and	and	CCONJ
brj-23306	374	41	characterized	characterize	VERB
brj-23306	374	42	using	use	VERB
brj-23306	374	43	various	various	ADJ
brj-23306	374	44	techniques	technique	NOUN
brj-23306	374	45	.	.	PUNCT
brj-23306	375	1	2	2	X
brj-23306	375	2	.	.	X
brj-23306	375	3	characterization	characterization	NOUN
brj-23306	375	4	of	of	ADP
brj-23306	375	5	nanoparticles	nanoparticle	NOUN
brj-23306	375	6	showed	show	VERB
brj-23306	375	7	particle	particle	NOUN
brj-23306	375	8	sizes	size	NOUN
brj-23306	375	9	ranging	range	VERB
brj-23306	375	10	from	from	ADP
brj-23306	375	11	10	10	NUM
brj-23306	375	12	to	to	PART
brj-23306	375	13	30	30	NUM
brj-23306	375	14	nm	nm	NOUN
brj-23306	375	15	and	and	CCONJ
brj-23306	375	16	the	the	DET
brj-23306	375	17	presence	presence	NOUN
brj-23306	375	18	of	of	ADP
brj-23306	375	19	silver	silver	ADJ
brj-23306	375	20	atoms	atom	NOUN
brj-23306	375	21	.	.	PUNCT
brj-23306	376	1	3	3	X
brj-23306	376	2	.	.	X
brj-23306	376	3	the	the	DET
brj-23306	376	4	study	study	NOUN
brj-23306	376	5	showed	show	VERB
brj-23306	376	6	that	that	SCONJ
brj-23306	376	7	biologically	biologically	ADV
brj-23306	376	8	synthesized	synthesize	VERB
brj-23306	376	9	silver	silver	ADJ
brj-23306	376	10	nanoparticles	nanoparticle	NOUN
brj-23306	376	11	(	(	PUNCT
brj-23306	376	12	agnps	agnps	ADJ
brj-23306	376	13	)	)	PUNCT
brj-23306	376	14	using	use	VERB
brj-23306	376	15	a.	a.	NOUN
brj-23306	376	16	purpurata	purpurata	PROPN
brj-23306	376	17	leaves	leave	NOUN
brj-23306	376	18	possess	possess	VERB
brj-23306	376	19	promising	promise	VERB
brj-23306	376	20	antiproliferative	antiproliferative	ADJ
brj-23306	376	21	activity	activity	NOUN
brj-23306	376	22	in	in	ADP
brj-23306	376	23	cancer	cancer	NOUN
brj-23306	376	24	cells	cell	NOUN
brj-23306	376	25	,	,	PUNCT
brj-23306	376	26	potentially	potentially	ADV
brj-23306	376	27	achieved	achieve	VERB
brj-23306	376	28	through	through	ADP
brj-23306	376	29	the	the	DET
brj-23306	376	30	induction	induction	NOUN
brj-23306	376	31	of	of	ADP
brj-23306	376	32	apoptosis	apoptosis	NOUN
brj-23306	376	33	by	by	ADP
brj-23306	376	34	activating	activate	VERB
brj-23306	376	35	caspase	caspase	PROPN
brj-23306	376	36	3	3	NUM
brj-23306	376	37	,	,	PUNCT
brj-23306	376	38	with	with	ADP
brj-23306	376	39	ic50	ic50	PROPN
brj-23306	376	40	values	value	NOUN
brj-23306	376	41	of	of	ADP
brj-23306	376	42	4.59	4.59	NUM
brj-23306	376	43	±	±	NUM
brj-23306	376	44	0.6	0.6	NUM
brj-23306	376	45	µg	µg	NOUN
brj-23306	376	46	/	/	SYM
brj-23306	376	47	ml	ml	NOUN
brj-23306	376	48	in	in	ADP
brj-23306	376	49	a549	a549	PROPN
brj-23306	376	50	cells	cell	NOUN
brj-23306	376	51	and	and	CCONJ
brj-23306	376	52	3.48	3.48	NUM
brj-23306	376	53	±	±	NUM
brj-23306	376	54	0.4	0.4	NUM
brj-23306	376	55	µg	µg	NOUN
brj-23306	376	56	/	/	SYM
brj-23306	376	57	ml	ml	ADV
brj-23306	376	58	in	in	ADP
brj-23306	376	59	pa1	pa1	NOUN
brj-23306	376	60	cells	cell	NOUN
brj-23306	376	61	.	.	PUNCT
brj-23306	377	1	4	4	X
brj-23306	377	2	.	.	X
brj-23306	377	3	the	the	DET
brj-23306	377	4	synthesized	synthesize	VERB
brj-23306	377	5	agnps	agnps	PROPN
brj-23306	377	6	exhibited	exhibit	VERB
brj-23306	377	7	antimicrobial	antimicrobial	ADJ
brj-23306	377	8	activities	activity	NOUN
brj-23306	377	9	against	against	ADP
brj-23306	377	10	bacterial	bacterial	ADJ
brj-23306	377	11	and	and	CCONJ
brj-23306	377	12	fungal	fungal	ADJ
brj-23306	377	13	pathogens	pathogen	NOUN
brj-23306	377	14	.	.	PUNCT
brj-23306	378	1	the	the	DET
brj-23306	378	2	synthesized	synthesize	VERB
brj-23306	378	3	agnps	agnps	NOUN
brj-23306	378	4	exhibited	exhibit	VERB
brj-23306	378	5	potent	potent	ADJ
brj-23306	378	6	photocatalytic	photocatalytic	NOUN
brj-23306	378	7	,	,	PUNCT
brj-23306	378	8	larvicidal	larvicidal	NOUN
brj-23306	378	9	,	,	PUNCT
brj-23306	378	10	and	and	CCONJ
brj-23306	378	11	cod	cod	NOUN
brj-23306	378	12	reduction	reduction	NOUN
brj-23306	378	13	potentials	potential	VERB
brj-23306	378	14	.	.	PUNCT
brj-23306	379	1	0	0	NUM
brj-23306	380	1	10	10	NUM
brj-23306	380	2	20	20	NUM
brj-23306	380	3	30	30	NUM
brj-23306	380	4	40	40	NUM
brj-23306	380	5	50	50	NUM
brj-23306	380	6	60	60	NUM
brj-23306	380	7	70	70	NUM
brj-23306	380	8	2.5	2.5	NUM
brj-23306	380	9	5	5	NUM
brj-23306	380	10	7.5	7.5	NUM
brj-23306	380	11	10	10	NUM
brj-23306	381	1	c	c	NOUN
brj-23306	381	2	o	o	NOUN
brj-23306	382	1	d	d	NOUN
brj-23306	382	2	r	r	NOUN
brj-23306	382	3	e	e	NOUN
brj-23306	382	4	d	d	X
brj-23306	382	5	u	u	X
brj-23306	382	6	c	c	NOUN
brj-23306	382	7	ti	ti	NOUN
brj-23306	382	8	o	o	NOUN
brj-23306	382	9	n	n	PROPN
brj-23306	382	10	(	(	PUNCT
brj-23306	382	11	%	%	NOUN
brj-23306	382	12	)	)	PUNCT
brj-23306	382	13	agnps	agnps	PROPN
brj-23306	382	14	(	(	PUNCT
brj-23306	382	15	ppm	ppm	NOUN
brj-23306	382	16	)	)	PUNCT
brj-23306	382	17	peer	peer	NOUN
brj-23306	382	18	-	-	PUNCT
brj-23306	382	19	reviewed	review	VERB
brj-23306	382	20	article	article	NOUN
brj-23306	382	21	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	382	22	raju	raju	PROPN
brj-23306	382	23	et	et	PROPN
brj-23306	382	24	al	al	PROPN
brj-23306	382	25	.	.	PROPN
brj-23306	383	1	(	(	PUNCT
brj-23306	383	2	2024	2024	NUM
brj-23306	383	3	)	)	PUNCT
brj-23306	383	4	.	.	PUNCT
brj-23306	384	1	“	"	PUNCT
brj-23306	384	2	ag	ag	PROPN
brj-23306	384	3	nanoparticles	nanoparticle	NOUN
brj-23306	384	4	from	from	ADP
brj-23306	384	5	leaves	leave	NOUN
brj-23306	384	6	,	,	PUNCT
brj-23306	384	7	”	"	PUNCT
brj-23306	384	8	bioresources	bioresource	NOUN
brj-23306	384	9	19(2	19(2	NUM
brj-23306	384	10	)	)	PUNCT
brj-23306	384	11	,	,	PUNCT
brj-23306	384	12	3328	3328	NUM
brj-23306	384	13	-	-	SYM
brj-23306	384	14	3352	3352	NUM
brj-23306	384	15	.	.	PUNCT
brj-23306	384	16	3348	3348	NUM
brj-23306	384	17	5	5	NUM
brj-23306	384	18	.	.	PUNCT
brj-23306	385	1	however	however	ADV
brj-23306	385	2	,	,	PUNCT
brj-23306	385	3	further	further	ADJ
brj-23306	385	4	research	research	NOUN
brj-23306	385	5	is	be	AUX
brj-23306	385	6	essential	essential	ADJ
brj-23306	385	7	to	to	PART
brj-23306	385	8	illuminate	illuminate	VERB
brj-23306	385	9	the	the	DET
brj-23306	385	10	multifunctional	multifunctional	ADJ
brj-23306	385	11	properties	property	NOUN
brj-23306	385	12	of	of	ADP
brj-23306	385	13	a.	a.	NOUN
brj-23306	385	14	purpurata	purpurata	PROPN
brj-23306	385	15	leaves	leave	NOUN
brj-23306	385	16	-	-	PUNCT
brj-23306	385	17	based	base	VERB
brj-23306	385	18	agnps	agnps	NOUN
brj-23306	385	19	in	in	ADP
brj-23306	385	20	vivo	vivo	NOUN
brj-23306	385	21	.	.	PUNCT
brj-23306	386	1	future	future	ADJ
brj-23306	386	2	perspectives	perspective	NOUN
brj-23306	386	3	in	in	ADP
brj-23306	386	4	the	the	DET
brj-23306	386	5	future	future	NOUN
brj-23306	386	6	,	,	PUNCT
brj-23306	386	7	the	the	DET
brj-23306	386	8	authors	author	NOUN
brj-23306	386	9	’	’	PART
brj-23306	386	10	medical	medical	ADJ
brj-23306	386	11	research	research	NOUN
brj-23306	386	12	activities	activity	NOUN
brj-23306	386	13	are	be	AUX
brj-23306	386	14	geared	gear	VERB
brj-23306	386	15	towards	towards	ADP
brj-23306	386	16	transforming	transform	VERB
brj-23306	386	17	cancer	cancer	NOUN
brj-23306	386	18	treatment	treatment	NOUN
brj-23306	386	19	methodologies	methodology	NOUN
brj-23306	386	20	with	with	ADP
brj-23306	386	21	innovative	innovative	ADJ
brj-23306	386	22	approaches	approach	NOUN
brj-23306	386	23	.	.	PUNCT
brj-23306	387	1	one	one	NUM
brj-23306	387	2	such	such	ADJ
brj-23306	387	3	new	new	ADJ
brj-23306	387	4	strategy	strategy	NOUN
brj-23306	387	5	involves	involve	VERB
brj-23306	387	6	employing	employ	VERB
brj-23306	387	7	aerosol	aerosol	NOUN
brj-23306	387	8	-	-	PUNCT
brj-23306	387	9	based	base	VERB
brj-23306	387	10	nanoparticle	nanoparticle	NOUN
brj-23306	387	11	therapy	therapy	NOUN
brj-23306	387	12	to	to	PART
brj-23306	387	13	combat	combat	VERB
brj-23306	387	14	lung	lung	NOUN
brj-23306	387	15	cancer	cancer	NOUN
brj-23306	387	16	.	.	PUNCT
brj-23306	388	1	by	by	ADP
brj-23306	388	2	connecting	connect	VERB
brj-23306	388	3	the	the	DET
brj-23306	388	4	distinctive	distinctive	ADJ
brj-23306	388	5	characteristics	characteristic	NOUN
brj-23306	388	6	of	of	ADP
brj-23306	388	7	nanoparticles	nanoparticle	NOUN
brj-23306	388	8	,	,	PUNCT
brj-23306	388	9	the	the	DET
brj-23306	388	10	goal	goal	NOUN
brj-23306	388	11	is	be	AUX
brj-23306	388	12	to	to	PART
brj-23306	388	13	craft	craft	VERB
brj-23306	388	14	targeted	target	VERB
brj-23306	388	15	delivery	delivery	NOUN
brj-23306	388	16	systems	system	NOUN
brj-23306	388	17	practiced	practice	VERB
brj-23306	388	18	on	on	ADP
brj-23306	388	19	cancerous	cancerous	ADJ
brj-23306	388	20	cells	cell	NOUN
brj-23306	388	21	within	within	ADP
brj-23306	388	22	the	the	DET
brj-23306	388	23	lungs	lung	NOUN
brj-23306	388	24	,	,	PUNCT
brj-23306	388	25	all	all	PRON
brj-23306	388	26	while	while	SCONJ
brj-23306	388	27	mitigating	mitigate	VERB
brj-23306	388	28	systemic	systemic	ADJ
brj-23306	388	29	side	side	NOUN
brj-23306	388	30	effects	effect	NOUN
brj-23306	388	31	.	.	PUNCT
brj-23306	389	1	also	also	ADV
brj-23306	389	2	,	,	PUNCT
brj-23306	389	3	research	research	NOUN
brj-23306	389	4	is	be	AUX
brj-23306	389	5	being	be	AUX
brj-23306	389	6	conducted	conduct	VERB
brj-23306	389	7	on	on	ADP
brj-23306	389	8	the	the	DET
brj-23306	389	9	intra	intra	ADJ
brj-23306	389	10	-	-	ADJ
brj-23306	389	11	tumoral	tumoral	ADJ
brj-23306	389	12	liposomemediated	liposomemediated	ADJ
brj-23306	389	13	nanoparticle	nanoparticle	NOUN
brj-23306	389	14	delivery	delivery	NOUN
brj-23306	389	15	,	,	PUNCT
brj-23306	389	16	specifically	specifically	ADV
brj-23306	389	17	for	for	ADP
brj-23306	389	18	the	the	DET
brj-23306	389	19	treatment	treatment	NOUN
brj-23306	389	20	of	of	ADP
brj-23306	389	21	ovarian	ovarian	ADJ
brj-23306	389	22	cancer	cancer	NOUN
brj-23306	389	23	.	.	PUNCT
brj-23306	390	1	liposomes	liposome	NOUN
brj-23306	390	2	,	,	PUNCT
brj-23306	390	3	characterized	characterize	VERB
brj-23306	390	4	as	as	ADP
brj-23306	390	5	lipid	lipid	NOUN
brj-23306	390	6	-	-	PUNCT
brj-23306	390	7	based	base	VERB
brj-23306	390	8	vesicles	vesicle	NOUN
brj-23306	390	9	,	,	PUNCT
brj-23306	390	10	serve	serve	VERB
brj-23306	390	11	as	as	ADP
brj-23306	390	12	efficient	efficient	ADJ
brj-23306	390	13	vehicles	vehicle	NOUN
brj-23306	390	14	for	for	ADP
brj-23306	390	15	transporting	transport	VERB
brj-23306	390	16	therapeutic	therapeutic	ADJ
brj-23306	390	17	agents	agent	NOUN
brj-23306	390	18	directly	directly	ADV
brj-23306	390	19	to	to	ADP
brj-23306	390	20	tumor	tumor	NOUN
brj-23306	390	21	sites	site	NOUN
brj-23306	390	22	.	.	PUNCT
brj-23306	391	1	through	through	ADP
brj-23306	391	2	this	this	DET
brj-23306	391	3	intensive	intensive	ADJ
brj-23306	391	4	effort	effort	NOUN
brj-23306	391	5	,	,	PUNCT
brj-23306	391	6	the	the	DET
brj-23306	391	7	aim	aim	NOUN
brj-23306	391	8	is	be	AUX
brj-23306	391	9	to	to	PART
brj-23306	391	10	strengthen	strengthen	VERB
brj-23306	391	11	treatment	treatment	NOUN
brj-23306	391	12	efficacy	efficacy	NOUN
brj-23306	391	13	while	while	SCONJ
brj-23306	391	14	minimizing	minimize	VERB
brj-23306	391	15	adverse	adverse	ADJ
brj-23306	391	16	effects	effect	NOUN
brj-23306	391	17	on	on	ADP
brj-23306	391	18	healthy	healthy	ADJ
brj-23306	391	19	tissues	tissue	NOUN
brj-23306	391	20	.	.	PUNCT
brj-23306	392	1	in	in	ADP
brj-23306	392	2	future	future	ADJ
brj-23306	392	3	antimicrobial	antimicrobial	ADJ
brj-23306	392	4	and	and	CCONJ
brj-23306	392	5	biofilm	biofilm	NOUN
brj-23306	392	6	management	management	NOUN
brj-23306	392	7	in	in	ADP
brj-23306	392	8	medical	medical	ADJ
brj-23306	392	9	devices	device	NOUN
brj-23306	392	10	holds	hold	VERB
brj-23306	392	11	immense	immense	ADJ
brj-23306	392	12	potential	potential	NOUN
brj-23306	392	13	for	for	ADP
brj-23306	392	14	enhancing	enhance	VERB
brj-23306	392	15	patient	patient	ADJ
brj-23306	392	16	safety	safety	NOUN
brj-23306	392	17	,	,	PUNCT
brj-23306	392	18	decrease	decrease	VERB
brj-23306	392	19	healthcare	healthcare	NOUN
brj-23306	392	20	-	-	PUNCT
brj-23306	392	21	associated	associate	VERB
brj-23306	392	22	infections	infection	NOUN
brj-23306	392	23	,	,	PUNCT
brj-23306	392	24	and	and	CCONJ
brj-23306	392	25	expanding	expand	VERB
brj-23306	392	26	the	the	DET
brj-23306	392	27	overall	overall	ADJ
brj-23306	392	28	efficacy	efficacy	NOUN
brj-23306	392	29	of	of	ADP
brj-23306	392	30	medical	medical	ADJ
brj-23306	392	31	interventions	intervention	NOUN
brj-23306	392	32	.	.	PUNCT
brj-23306	393	1	abbreviations	abbreviation	NOUN
brj-23306	393	2	1	1	NUM
brj-23306	393	3	.	.	PUNCT
brj-23306	394	1	agnps	agnps	ADJ
brj-23306	394	2	silver	silver	ADJ
brj-23306	394	3	nanoparticles	nanoparticle	NOUN
brj-23306	394	4	2	2	NUM
brj-23306	394	5	.	.	PUNCT
brj-23306	394	6	hcl	hcl	PROPN
brj-23306	394	7	hydrochloric	hydrochloric	PROPN
brj-23306	394	8	acid	acid	PROPN
brj-23306	394	9	3	3	NUM
brj-23306	394	10	.	.	PUNCT
brj-23306	395	1	h2so4	h2so4	PROPN
brj-23306	395	2	sulphuric	sulphuric	PROPN
brj-23306	395	3	acid	acid	PROPN
brj-23306	395	4	4	4	NUM
brj-23306	395	5	.	.	PUNCT
brj-23306	396	1	fecl3	fecl3	PROPN
brj-23306	396	2	ferric	ferric	ADJ
brj-23306	396	3	chloride	chloride	NOUN
brj-23306	396	4	5	5	NUM
brj-23306	396	5	.	.	PUNCT
brj-23306	397	1	uv	uv	NOUN
brj-23306	397	2	-	-	PUNCT
brj-23306	397	3	vis	vis	X
brj-23306	397	4	ultraviolet	ultraviolet	NOUN
brj-23306	397	5	-	-	PUNCT
brj-23306	397	6	visible	visible	ADJ
brj-23306	397	7	6	6	NUM
brj-23306	397	8	.	.	PUNCT
brj-23306	397	9	ft	ft	PROPN
brj-23306	397	10	-	-	PUNCT
brj-23306	397	11	ir	ir	PROPN
brj-23306	397	12	fourier	fourier	NOUN
brj-23306	397	13	transform	transform	NOUN
brj-23306	397	14	infrared	infrared	ADJ
brj-23306	397	15	7	7	NUM
brj-23306	397	16	.	.	PUNCT
brj-23306	397	17	hr	hr	PROPN
brj-23306	397	18	-	-	PUNCT
brj-23306	397	19	tem	tem	NOUN
brj-23306	397	20	high	high	ADJ
brj-23306	397	21	-	-	PUNCT
brj-23306	397	22	resolution	resolution	NOUN
brj-23306	397	23	transmission	transmission	NOUN
brj-23306	397	24	electron	electron	NOUN
brj-23306	397	25	microscopy	microscopy	NOUN
brj-23306	397	26	8	8	NUM
brj-23306	397	27	.	.	PUNCT
brj-23306	398	1	edx	edx	PROPN
brj-23306	398	2	energy	energy	PROPN
brj-23306	398	3	dispersive	dispersive	NOUN
brj-23306	398	4	microanalysis	microanalysis	NOUN
brj-23306	398	5	9	9	NUM
brj-23306	398	6	.	.	PUNCT
brj-23306	398	7	mtt	mtt	NOUN
brj-23306	398	8	3-(4,5	3-(4,5	PROPN
brj-23306	398	9	-	-	PUNCT
brj-23306	398	10	dimethyl-2	dimethyl-2	PROPN
brj-23306	398	11	-	-	PUNCT
brj-23306	398	12	thiazolyl)-2,5	thiazolyl)-2,5	NOUN
brj-23306	398	13	-	-	PUNCT
brj-23306	398	14	diphenyl	diphenyl	NOUN
brj-23306	398	15	-	-	PUNCT
brj-23306	398	16	tetrazolium	tetrazolium	NOUN
brj-23306	398	17	bromide	bromide	NOUN
brj-23306	398	18	10	10	NUM
brj-23306	398	19	.	.	PUNCT
brj-23306	399	1	dmso	dmso	ADJ
brj-23306	399	2	dimethyl	dimethyl	NOUN
brj-23306	399	3	sulfoxide	sulfoxide	PROPN
brj-23306	399	4	11	11	NUM
brj-23306	399	5	.	.	PUNCT
brj-23306	400	1	pbs	pbs	PROPN
brj-23306	400	2	phosphate	phosphate	NOUN
brj-23306	400	3	-	-	PUNCT
brj-23306	400	4	buffered	buffer	VERB
brj-23306	400	5	saline	saline	NOUN
brj-23306	400	6	12	12	NUM
brj-23306	400	7	.	.	PUNCT
brj-23306	401	1	mhb	mhb	PROPN
brj-23306	401	2	mueller	mueller	PROPN
brj-23306	401	3	hinton	hinton	PROPN
brj-23306	401	4	broth	broth	PROPN
brj-23306	401	5	13	13	NUM
brj-23306	401	6	.	.	PUNCT
brj-23306	402	1	cfu	cfu	NOUN
brj-23306	402	2	colony	colony	NOUN
brj-23306	402	3	forming	form	VERB
brj-23306	402	4	unit	unit	NOUN
brj-23306	402	5	14	14	NUM
brj-23306	402	6	.	.	PUNCT
brj-23306	403	1	mb	mb	ADP
brj-23306	403	2	methylene	methylene	PROPN
brj-23306	403	3	blue	blue	ADJ
brj-23306	403	4	15	15	NUM
brj-23306	403	5	.	.	PUNCT
brj-23306	404	1	cod	cod	PROPN
brj-23306	404	2	chemical	chemical	NOUN
brj-23306	404	3	oxygen	oxygen	NOUN
brj-23306	404	4	demand	demand	NOUN
brj-23306	404	5	16	16	NUM
brj-23306	404	6	.	.	PUNCT
brj-23306	405	1	pa1	pa1	NOUN
brj-23306	405	2	ovarian	ovarian	ADJ
brj-23306	405	3	cancer	cancer	NOUN
brj-23306	405	4	cell	cell	NOUN
brj-23306	405	5	line	line	NOUN
brj-23306	405	6	17	17	NUM
brj-23306	405	7	.	.	PUNCT
brj-23306	406	1	a549	a549	PROPN
brj-23306	406	2	lung	lung	NOUN
brj-23306	406	3	cancer	cancer	NOUN
brj-23306	406	4	cell	cell	NOUN
brj-23306	406	5	line	line	NOUN
brj-23306	406	6	acknowledgments	acknowledgment	NOUN
brj-23306	406	7	researchers	researcher	NOUN
brj-23306	406	8	supporting	support	VERB
brj-23306	406	9	project	project	NOUN
brj-23306	406	10	number	number	NOUN
brj-23306	406	11	(	(	PUNCT
brj-23306	406	12	rsp2024r414	rsp2024r414	NOUN
brj-23306	406	13	)	)	PUNCT
brj-23306	406	14	,	,	PUNCT
brj-23306	406	15	king	king	PROPN
brj-23306	406	16	saud	saud	PROPN
brj-23306	406	17	university	university	PROPN
brj-23306	406	18	,	,	PUNCT
brj-23306	406	19	riyadh	riyadh	PROPN
brj-23306	406	20	,	,	PUNCT
brj-23306	406	21	saudi	saudi	PROPN
brj-23306	406	22	arabia	arabia	PROPN
brj-23306	406	23	.	.	PUNCT
brj-23306	407	1	conflict	conflict	NOUN
brj-23306	407	2	of	of	ADP
brj-23306	407	3	interest	interest	NOUN
brj-23306	407	4	the	the	DET
brj-23306	407	5	authors	author	NOUN
brj-23306	407	6	declare	declare	VERB
brj-23306	407	7	no	no	DET
brj-23306	407	8	competing	compete	VERB
brj-23306	407	9	interests	interest	NOUN
brj-23306	407	10	.	.	PUNCT
brj-23306	408	1	peer	peer	NOUN
brj-23306	408	2	-	-	PUNCT
brj-23306	408	3	reviewed	review	VERB
brj-23306	408	4	article	article	NOUN
brj-23306	408	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	408	6	raju	raju	PROPN
brj-23306	408	7	et	et	PROPN
brj-23306	408	8	al	al	PROPN
brj-23306	408	9	.	.	PROPN
brj-23306	409	1	(	(	PUNCT
brj-23306	409	2	2024	2024	NUM
brj-23306	409	3	)	)	PUNCT
brj-23306	409	4	.	.	PUNCT
brj-23306	410	1	“	"	PUNCT
brj-23306	410	2	ag	ag	PROPN
brj-23306	410	3	nanoparticles	nanoparticle	NOUN
brj-23306	410	4	from	from	ADP
brj-23306	410	5	leaves	leave	NOUN
brj-23306	410	6	,	,	PUNCT
brj-23306	410	7	”	"	PUNCT
brj-23306	410	8	bioresources	bioresource	NOUN
brj-23306	410	9	19(2	19(2	NUM
brj-23306	410	10	)	)	PUNCT
brj-23306	410	11	,	,	PUNCT
brj-23306	410	12	3328	3328	NUM
brj-23306	410	13	-	-	SYM
brj-23306	410	14	3352	3352	NUM
brj-23306	410	15	.	.	PUNCT
brj-23306	411	1	3349	3349	NUM
brj-23306	411	2	references	reference	NOUN
brj-23306	411	3	cited	cite	VERB
brj-23306	411	4	abdulazeem	abdulazeem	NOUN
brj-23306	411	5	,	,	PUNCT
brj-23306	411	6	l.	l.	PROPN
brj-23306	411	7	,	,	PUNCT
brj-23306	411	8	alasmari	alasmari	PROPN
brj-23306	411	9	,	,	PUNCT
brj-23306	411	10	a.	a.	PROPN
brj-23306	411	11	f.	f.	PROPN
brj-23306	411	12	,	,	PUNCT
brj-23306	411	13	alharbi	alharbi	PROPN
brj-23306	411	14	,	,	PUNCT
brj-23306	411	15	m.	m.	NOUN
brj-23306	411	16	,	,	PUNCT
brj-23306	411	17	alshammari	alshammari	NOUN
brj-23306	411	18	,	,	PUNCT
brj-23306	411	19	a.	a.	NOUN
brj-23306	411	20	,	,	PUNCT
brj-23306	411	21	and	and	CCONJ
brj-23306	411	22	muhseen	muhseen	PROPN
brj-23306	411	23	,	,	PUNCT
brj-23306	411	24	z.	z.	PROPN
brj-23306	411	25	t.	t.	PROPN
brj-23306	411	26	(	(	PUNCT
brj-23306	411	27	2023	2023	NUM
brj-23306	411	28	)	)	PUNCT
brj-23306	411	29	.	.	PUNCT
brj-23306	412	1	“	"	PUNCT
brj-23306	412	2	utilization	utilization	NOUN
brj-23306	412	3	of	of	ADP
brj-23306	412	4	aqueous	aqueous	ADJ
brj-23306	412	5	broccoli	broccoli	NOUN
brj-23306	412	6	florets	floret	NOUN
brj-23306	412	7	extract	extract	VERB
brj-23306	412	8	for	for	ADP
brj-23306	412	9	green	green	ADJ
brj-23306	412	10	synthesis	synthesis	NOUN
brj-23306	412	11	and	and	CCONJ
brj-23306	412	12	characterization	characterization	NOUN
brj-23306	412	13	of	of	ADP
brj-23306	412	14	silver	silver	ADJ
brj-23306	412	15	nanoparticles	nanoparticle	NOUN
brj-23306	412	16	,	,	PUNCT
brj-23306	412	17	with	with	ADP
brj-23306	412	18	potential	potential	ADJ
brj-23306	412	19	biological	biological	ADJ
brj-23306	412	20	applications	application	NOUN
brj-23306	412	21	,	,	PUNCT
brj-23306	412	22	”	"	PUNCT
brj-23306	412	23	heliyon	heliyon	NOUN
brj-23306	412	24	9(9	9(9	NUM
brj-23306	412	25	)	)	PUNCT
brj-23306	412	26	,	,	PUNCT
brj-23306	412	27	article	article	NOUN
brj-23306	412	28	i	i	PROPN
brj-23306	412	29	d	d	PROPN
brj-23306	412	30	e19723	e19723	PROPN
brj-23306	412	31	.	.	PROPN
brj-23306	412	32	doi	doi	NOUN
brj-23306	412	33	:	:	PUNCT
brj-23306	412	34	10.1016	10.1016	NUM
brj-23306	412	35	/	/	SYM
brj-23306	412	36	j.heliyon.2023.e19723	j.heliyon.2023.e19723	PROPN
brj-23306	412	37	aboyewa	aboyewa	PROPN
brj-23306	412	38	,	,	PUNCT
brj-23306	412	39	j.	j.	PROPN
brj-23306	412	40	a.	a.	PROPN
brj-23306	412	41	,	,	PUNCT
brj-23306	412	42	sibuyi	sibuyi	PROPN
brj-23306	412	43	,	,	PUNCT
brj-23306	412	44	n.	n.	PROPN
brj-23306	412	45	r.	r.	PROPN
brj-23306	412	46	s.	s.	PROPN
brj-23306	412	47	,	,	PUNCT
brj-23306	412	48	meyer	meyer	PROPN
brj-23306	412	49	,	,	PUNCT
brj-23306	412	50	m.	m.	NOUN
brj-23306	412	51	,	,	PUNCT
brj-23306	412	52	and	and	CCONJ
brj-23306	412	53	oguntibeju	oguntibeju	ADV
brj-23306	412	54	,	,	PUNCT
brj-23306	412	55	o.	o.	NOUN
brj-23306	412	56	o.	o.	NOUN
brj-23306	412	57	(	(	PUNCT
brj-23306	412	58	2021	2021	NUM
brj-23306	412	59	)	)	PUNCT
brj-23306	412	60	.	.	PUNCT
brj-23306	413	1	“	"	PUNCT
brj-23306	413	2	green	green	ADJ
brj-23306	413	3	synthesis	synthesis	NOUN
brj-23306	413	4	of	of	ADP
brj-23306	413	5	metallic	metallic	ADJ
brj-23306	413	6	nanoparticles	nanoparticle	NOUN
brj-23306	413	7	using	use	VERB
brj-23306	413	8	some	some	DET
brj-23306	413	9	selected	select	VERB
brj-23306	413	10	medicinal	medicinal	ADJ
brj-23306	413	11	plants	plant	NOUN
brj-23306	413	12	from	from	ADP
brj-23306	413	13	southern	southern	PROPN
brj-23306	413	14	africa	africa	PROPN
brj-23306	413	15	and	and	CCONJ
brj-23306	413	16	their	their	PRON
brj-23306	413	17	biological	biological	ADJ
brj-23306	413	18	applications	application	NOUN
brj-23306	413	19	,	,	PUNCT
brj-23306	413	20	”	"	PUNCT
brj-23306	413	21	plants	plant	NOUN
brj-23306	413	22	10(9	10(9	NUM
brj-23306	413	23	)	)	PUNCT
brj-23306	413	24	,	,	PUNCT
brj-23306	413	25	article	article	NOUN
brj-23306	413	26	1929	1929	NUM
brj-23306	413	27	.	.	PUNCT
brj-23306	414	1	doi	doi	NOUN
brj-23306	414	2	:	:	PUNCT
brj-23306	414	3	10.3390	10.3390	NUM
brj-23306	414	4	/	/	SYM
brj-23306	414	5	plants10091929	plants10091929	PROPN
brj-23306	414	6	adhya	adhya	PROPN
brj-23306	414	7	,	,	PUNCT
brj-23306	414	8	d.	d.	PROPN
brj-23306	414	9	,	,	PUNCT
brj-23306	414	10	annuario	annuario	PROPN
brj-23306	414	11	,	,	PUNCT
brj-23306	414	12	e.	e.	PROPN
brj-23306	414	13	,	,	PUNCT
brj-23306	414	14	lancaster	lancaster	PROPN
brj-23306	414	15	,	,	PUNCT
brj-23306	414	16	m.	m.	NOUN
brj-23306	414	17	a.	a.	PROPN
brj-23306	414	18	,	,	PUNCT
brj-23306	414	19	price	price	NOUN
brj-23306	414	20	,	,	PUNCT
brj-23306	414	21	j.	j.	PROPN
brj-23306	414	22	,	,	PUNCT
brj-23306	414	23	baron‐cohen	baron‐cohen	PROPN
brj-23306	414	24	,	,	PUNCT
brj-23306	414	25	s.	s.	PROPN
brj-23306	414	26	,	,	PUNCT
brj-23306	414	27	and	and	CCONJ
brj-23306	414	28	srivastava	srivastava	PROPN
brj-23306	414	29	,	,	PUNCT
brj-23306	414	30	d.	d.	PROPN
brj-23306	414	31	p.	p.	PROPN
brj-23306	414	32	(	(	PUNCT
brj-23306	414	33	2018	2018	NUM
brj-23306	414	34	)	)	PUNCT
brj-23306	414	35	.	.	PUNCT
brj-23306	415	1	“	"	PUNCT
brj-23306	415	2	understanding	understand	VERB
brj-23306	415	3	the	the	DET
brj-23306	415	4	role	role	NOUN
brj-23306	415	5	of	of	ADP
brj-23306	415	6	steroids	steroid	NOUN
brj-23306	415	7	in	in	ADP
brj-23306	415	8	typical	typical	ADJ
brj-23306	415	9	and	and	CCONJ
brj-23306	415	10	atypical	atypical	ADJ
brj-23306	415	11	brain	brain	NOUN
brj-23306	415	12	development	development	NOUN
brj-23306	415	13	:	:	PUNCT
brj-23306	415	14	advantages	advantage	NOUN
brj-23306	415	15	of	of	ADP
brj-23306	415	16	using	use	VERB
brj-23306	415	17	a	a	DET
brj-23306	415	18	‘	'	PUNCT
brj-23306	415	19	brain	brain	NOUN
brj-23306	415	20	in	in	ADP
brj-23306	415	21	a	a	DET
brj-23306	415	22	dish	dish	NOUN
brj-23306	415	23	’	'	PUNCT
brj-23306	415	24	approach	approach	NOUN
brj-23306	415	25	,	,	PUNCT
brj-23306	415	26	”	"	PUNCT
brj-23306	415	27	journal	journal	NOUN
brj-23306	415	28	of	of	ADP
brj-23306	415	29	neuroendocrinology	neuroendocrinology	NOUN
brj-23306	415	30	30(2	30(2	NUM
brj-23306	415	31	)	)	PUNCT
brj-23306	415	32	,	,	PUNCT
brj-23306	415	33	article	article	NOUN
brj-23306	415	34	12547	12547	NUM
brj-23306	415	35	.	.	PUNCT
brj-23306	416	1	doi	doi	NOUN
brj-23306	416	2	:	:	PUNCT
brj-23306	416	3	10.1111	10.1111	NUM
brj-23306	416	4	/	/	SYM
brj-23306	416	5	jne.12547	jne.12547	NUM
brj-23306	416	6	al	al	PROPN
brj-23306	416	7	-	-	PUNCT
brj-23306	416	8	wrafy	wrafy	PROPN
brj-23306	416	9	,	,	PUNCT
brj-23306	416	10	f.	f.	PROPN
brj-23306	416	11	a.	a.	PROPN
brj-23306	416	12	,	,	PUNCT
brj-23306	416	13	al	al	PROPN
brj-23306	416	14	-	-	PUNCT
brj-23306	416	15	gheethi	gheethi	PROPN
brj-23306	416	16	,	,	PUNCT
brj-23306	416	17	a.	a.	NOUN
brj-23306	416	18	,	,	PUNCT
brj-23306	416	19	ponnusamy	ponnusamy	NOUN
brj-23306	416	20	,	,	PUNCT
brj-23306	416	21	s.	s.	PROPN
brj-23306	416	22	k.	k.	PROPN
brj-23306	416	23	,	,	PUNCT
brj-23306	416	24	noman	noman	PROPN
brj-23306	416	25	,	,	PUNCT
brj-23306	416	26	e.	e.	PROPN
brj-23306	416	27	a.	a.	PROPN
brj-23306	416	28	,	,	PUNCT
brj-23306	416	29	and	and	CCONJ
brj-23306	416	30	fattah	fattah	PROPN
brj-23306	416	31	,	,	PUNCT
brj-23306	416	32	s.	s.	PROPN
brj-23306	416	33	a.	a.	PROPN
brj-23306	416	34	(	(	PUNCT
brj-23306	416	35	2022	2022	NUM
brj-23306	416	36	)	)	PUNCT
brj-23306	416	37	.	.	PUNCT
brj-23306	417	1	“	"	PUNCT
brj-23306	417	2	nanoparticles	nanoparticle	NOUN
brj-23306	417	3	approach	approach	VERB
brj-23306	417	4	to	to	PART
brj-23306	417	5	eradicate	eradicate	VERB
brj-23306	417	6	bacterial	bacterial	ADJ
brj-23306	417	7	biofilm	biofilm	NOUN
brj-23306	417	8	-	-	PUNCT
brj-23306	417	9	related	relate	VERB
brj-23306	417	10	infections	infection	NOUN
brj-23306	417	11	:	:	PUNCT
brj-23306	417	12	a	a	DET
brj-23306	417	13	critical	critical	ADJ
brj-23306	417	14	review	review	NOUN
brj-23306	417	15	,	,	PUNCT
brj-23306	417	16	”	"	PUNCT
brj-23306	417	17	chemosphere	chemosphere	VERB
brj-23306	417	18	288	288	NUM
brj-23306	417	19	,	,	PUNCT
brj-23306	417	20	article	article	NOUN
brj-23306	417	21	i	i	PROPN
brj-23306	417	22	d	d	PROPN
brj-23306	417	23	132603	132603	NUM
brj-23306	417	24	.	.	PUNCT
brj-23306	418	1	doi	doi	NOUN
brj-23306	418	2	:	:	PUNCT
brj-23306	418	3	10.1016	10.1016	NUM
brj-23306	418	4	/	/	SYM
brj-23306	418	5	j.chemosphere.2021.132603	j.chemosphere.2021.132603	PROPN
brj-23306	418	6	amarasinghe	amarasinghe	PROPN
brj-23306	418	7	,	,	PUNCT
brj-23306	418	8	l.	l.	PROPN
brj-23306	418	9	d.	d.	PROPN
brj-23306	418	10	,	,	PUNCT
brj-23306	418	11	wickramarachchi	wickramarachchi	PROPN
brj-23306	418	12	,	,	PUNCT
brj-23306	418	13	p.	p.	NOUN
brj-23306	418	14	a.	a.	PROPN
brj-23306	418	15	s.	s.	PROPN
brj-23306	418	16	r.	r.	PROPN
brj-23306	418	17	,	,	PUNCT
brj-23306	418	18	aberathna	aberathna	NOUN
brj-23306	418	19	,	,	PUNCT
brj-23306	418	20	a.	a.	NOUN
brj-23306	418	21	a.	a.	NOUN
brj-23306	418	22	a.	a.	PROPN
brj-23306	418	23	u.	u.	PROPN
brj-23306	418	24	,	,	PUNCT
brj-23306	418	25	sithara	sithara	PROPN
brj-23306	418	26	,	,	PUNCT
brj-23306	418	27	w.	w.	PROPN
brj-23306	418	28	s.	s.	PROPN
brj-23306	418	29	,	,	PUNCT
brj-23306	418	30	and	and	CCONJ
brj-23306	418	31	de	de	PROPN
brj-23306	418	32	silva	silva	PROPN
brj-23306	418	33	,	,	PUNCT
brj-23306	418	34	c.	c.	PROPN
brj-23306	418	35	r.	r.	PROPN
brj-23306	418	36	(	(	PUNCT
brj-23306	418	37	2020	2020	NUM
brj-23306	418	38	)	)	PUNCT
brj-23306	418	39	.	.	PUNCT
brj-23306	419	1	“	"	PUNCT
brj-23306	419	2	comparative	comparative	ADJ
brj-23306	419	3	study	study	NOUN
brj-23306	419	4	on	on	ADP
brj-23306	419	5	larvicidal	larvicidal	ADJ
brj-23306	419	6	activity	activity	NOUN
brj-23306	419	7	of	of	ADP
brj-23306	419	8	green	green	ADJ
brj-23306	419	9	synthesized	synthesize	VERB
brj-23306	419	10	silver	silver	NOUN
brj-23306	419	11	nanoparticles	nanoparticle	NOUN
brj-23306	419	12	and	and	CCONJ
brj-23306	419	13	annona	annona	PROPN
brj-23306	419	14	glabra	glabra	NOUN
brj-23306	419	15	(	(	PUNCT
brj-23306	419	16	annonaceae	annonaceae	NOUN
brj-23306	419	17	)	)	PUNCT
brj-23306	419	18	aqueous	aqueous	ADJ
brj-23306	419	19	extract	extract	NOUN
brj-23306	419	20	to	to	PART
brj-23306	419	21	control	control	VERB
brj-23306	419	22	aedes	aedes	PROPN
brj-23306	419	23	aegypti	aegypti	PROPN
brj-23306	419	24	and	and	CCONJ
brj-23306	419	25	aedes	aedes	PROPN
brj-23306	419	26	albopictus	albopictus	PROPN
brj-23306	419	27	(	(	PUNCT
brj-23306	419	28	diptera	diptera	NOUN
brj-23306	419	29	:	:	PUNCT
brj-23306	419	30	culicidae	culicidae	NOUN
brj-23306	419	31	)	)	PUNCT
brj-23306	419	32	,	,	PUNCT
brj-23306	419	33	”	"	PUNCT
brj-23306	419	34	heliyon	heliyon	NOUN
brj-23306	419	35	6(6	6(6	NOUN
brj-23306	419	36	)	)	PUNCT
brj-23306	419	37	,	,	PUNCT
brj-23306	420	1	article	article	NOUN
brj-23306	420	2	e04322	e04322	PROPN
brj-23306	420	3	.	.	PROPN
brj-23306	420	4	doi	doi	PROPN
brj-23306	420	5	:	:	PUNCT
brj-23306	420	6	10.1016	10.1016	NUM
brj-23306	420	7	/	/	SYM
brj-23306	420	8	j.heliyon.2020.e04322	j.heliyon.2020.e04322	PRON
brj-23306	420	9	anandalakshmi	anandalakshmi	PROPN
brj-23306	420	10	,	,	PUNCT
brj-23306	420	11	k.	k.	PROPN
brj-23306	420	12	,	,	PUNCT
brj-23306	420	13	venugobal	venugobal	PROPN
brj-23306	420	14	,	,	PUNCT
brj-23306	420	15	j.	j.	PROPN
brj-23306	420	16	,	,	PUNCT
brj-23306	420	17	and	and	CCONJ
brj-23306	420	18	ramasamy	ramasamy	NOUN
brj-23306	420	19	,	,	PUNCT
brj-23306	420	20	v.	v.	CCONJ
brj-23306	420	21	(	(	PUNCT
brj-23306	420	22	2015	2015	NUM
brj-23306	420	23	)	)	PUNCT
brj-23306	420	24	.	.	PUNCT
brj-23306	421	1	“	"	PUNCT
brj-23306	421	2	characterization	characterization	NOUN
brj-23306	421	3	of	of	ADP
brj-23306	421	4	silver	silver	ADJ
brj-23306	421	5	nanoparticles	nanoparticle	NOUN
brj-23306	421	6	by	by	ADP
brj-23306	421	7	green	green	ADJ
brj-23306	421	8	synthesis	synthesis	NOUN
brj-23306	421	9	method	method	NOUN
brj-23306	421	10	using	use	VERB
brj-23306	421	11	pedalium	pedalium	NOUN
brj-23306	421	12	murex	murex	ADJ
brj-23306	421	13	leaf	leaf	NOUN
brj-23306	421	14	extract	extract	NOUN
brj-23306	421	15	and	and	CCONJ
brj-23306	421	16	their	their	PRON
brj-23306	421	17	antibacterial	antibacterial	ADJ
brj-23306	421	18	activity	activity	NOUN
brj-23306	421	19	,	,	PUNCT
brj-23306	421	20	”	"	PUNCT
brj-23306	421	21	applied	apply	VERB
brj-23306	421	22	nanoscience	nanoscience	NOUN
brj-23306	421	23	6(3	6(3	PROPN
brj-23306	421	24	)	)	PUNCT
brj-23306	421	25	,	,	PUNCT
brj-23306	421	26	399	399	NUM
brj-23306	421	27	-	-	SYM
brj-23306	421	28	408	408	NUM
brj-23306	421	29	.	.	PUNCT
brj-23306	422	1	doi	doi	NOUN
brj-23306	422	2	:	:	PUNCT
brj-23306	422	3	10.1007	10.1007	NUM
brj-23306	422	4	/	/	SYM
brj-23306	422	5	s13204015	s13204015	PROPN
brj-23306	422	6	-	-	PUNCT
brj-23306	422	7	0449	0449	NUM
brj-23306	422	8	-	-	PUNCT
brj-23306	422	9	z	z	NOUN
brj-23306	422	10	anjum	anjum	PROPN
brj-23306	422	11	,	,	PUNCT
brj-23306	422	12	s.	s.	PROPN
brj-23306	422	13	,	,	PUNCT
brj-23306	422	14	ishaque	ishaque	ADJ
brj-23306	422	15	,	,	PUNCT
brj-23306	422	16	s.	s.	PROPN
brj-23306	422	17	,	,	PUNCT
brj-23306	422	18	fatima	fatima	PROPN
brj-23306	422	19	,	,	PUNCT
brj-23306	422	20	h.	h.	PROPN
brj-23306	422	21	,	,	PUNCT
brj-23306	422	22	farooq	farooq	PROPN
brj-23306	422	23	,	,	PUNCT
brj-23306	422	24	w.	w.	PROPN
brj-23306	422	25	,	,	PUNCT
brj-23306	422	26	hano	hano	PROPN
brj-23306	422	27	,	,	PUNCT
brj-23306	422	28	c.	c.	PROPN
brj-23306	422	29	,	,	PUNCT
brj-23306	422	30	abbasi	abbasi	PROPN
brj-23306	422	31	,	,	PUNCT
brj-23306	422	32	b.	b.	PROPN
brj-23306	422	33	h.	h.	PROPN
brj-23306	422	34	,	,	PUNCT
brj-23306	422	35	and	and	CCONJ
brj-23306	422	36	anjum	anjum	PROPN
brj-23306	422	37	,	,	PUNCT
brj-23306	422	38	i.	i.	PROPN
brj-23306	422	39	(	(	PUNCT
brj-23306	422	40	2021	2021	NUM
brj-23306	422	41	)	)	PUNCT
brj-23306	422	42	.	.	PUNCT
brj-23306	423	1	“	"	PUNCT
brj-23306	423	2	emerging	emerge	VERB
brj-23306	423	3	applications	application	NOUN
brj-23306	423	4	of	of	ADP
brj-23306	423	5	nanotechnology	nanotechnology	NOUN
brj-23306	423	6	in	in	ADP
brj-23306	423	7	healthcare	healthcare	PROPN
brj-23306	423	8	systems	system	NOUN
brj-23306	423	9	:	:	PUNCT
brj-23306	423	10	grand	grand	ADJ
brj-23306	423	11	challenges	challenge	NOUN
brj-23306	423	12	and	and	CCONJ
brj-23306	423	13	perspectives	perspective	NOUN
brj-23306	423	14	,	,	PUNCT
brj-23306	423	15	”	"	PUNCT
brj-23306	423	16	pharmaceuticals	pharmaceutical	NOUN
brj-23306	423	17	14(8	14(8	NUM
brj-23306	423	18	)	)	PUNCT
brj-23306	423	19	,	,	PUNCT
brj-23306	423	20	article	article	NOUN
brj-23306	423	21	707	707	NUM
brj-23306	423	22	.	.	PUNCT
brj-23306	424	1	doi	doi	NOUN
brj-23306	424	2	:	:	PUNCT
brj-23306	424	3	10.3390	10.3390	NUM
brj-23306	424	4	/	/	SYM
brj-23306	424	5	ph14080707	ph14080707	NOUN
brj-23306	424	6	anusooriya	anusooriya	NOUN
brj-23306	424	7	,	,	PUNCT
brj-23306	424	8	p.	p.	NOUN
brj-23306	424	9	,	,	PUNCT
brj-23306	424	10	kannappan	kannappan	NOUN
brj-23306	424	11	,	,	PUNCT
brj-23306	424	12	p.	p.	NOUN
brj-23306	424	13	,	,	PUNCT
brj-23306	424	14	and	and	CCONJ
brj-23306	424	15	gopalakrishnan	gopalakrishnan	NOUN
brj-23306	424	16	,	,	PUNCT
brj-23306	424	17	v.	v.	PROPN
brj-23306	424	18	k.	k.	PROPN
brj-23306	424	19	(	(	PUNCT
brj-23306	424	20	2022	2022	NUM
brj-23306	424	21	)	)	PUNCT
brj-23306	424	22	.	.	PUNCT
brj-23306	425	1	“	"	PUNCT
brj-23306	425	2	anticancer	anticancer	NOUN
brj-23306	425	3	activity	activity	NOUN
brj-23306	425	4	of	of	ADP
brj-23306	425	5	alpinia	alpinia	PROPN
brj-23306	425	6	purpurata	purpurata	PROPN
brj-23306	425	7	(	(	PUNCT
brj-23306	425	8	vieill	vieill	NOUN
brj-23306	425	9	)	)	PUNCT
brj-23306	425	10	k.	k.	NOUN
brj-23306	425	11	schum	schum	PROPN
brj-23306	425	12	.	.	PUNCT
brj-23306	426	1	against	against	ADP
brj-23306	426	2	mnu	mnu	PROPN
brj-23306	426	3	and	and	CCONJ
brj-23306	426	4	testosterone	testosterone	NOUN
brj-23306	426	5	induced	induce	VERB
brj-23306	426	6	prostate	prostate	NOUN
brj-23306	426	7	cancer	cancer	NOUN
brj-23306	426	8	in	in	ADP
brj-23306	426	9	male	male	PROPN
brj-23306	426	10	wistar	wistar	PROPN
brj-23306	426	11	albino	albino	PROPN
brj-23306	426	12	rats	rat	NOUN
brj-23306	426	13	,	,	PUNCT
brj-23306	426	14	”	"	PUNCT
brj-23306	426	15	pharmacological	pharmacological	ADJ
brj-23306	426	16	research	research	NOUN
brj-23306	426	17	modern	modern	ADJ
brj-23306	426	18	chinese	chinese	ADJ
brj-23306	426	19	medicine	medicine	NOUN
brj-23306	426	20	3	3	NUM
brj-23306	426	21	,	,	PUNCT
brj-23306	426	22	article	article	NOUN
brj-23306	426	23	i	i	PROPN
brj-23306	426	24	d	d	PROPN
brj-23306	426	25	100105	100105	NUM
brj-23306	426	26	.	.	PUNCT
brj-23306	427	1	doi	doi	NOUN
brj-23306	427	2	:	:	PUNCT
brj-23306	427	3	10.1016	10.1016	NUM
brj-23306	427	4	/	/	SYM
brj-23306	427	5	j.prmcm.2022.100105	j.prmcm.2022.100105	PROPN
brj-23306	427	6	artiukh	artiukh	PROPN
brj-23306	427	7	,	,	PUNCT
brj-23306	427	8	l.	l.	PROPN
brj-23306	427	9	,	,	PUNCT
brj-23306	427	10	povnitsa	povnitsa	NOUN
brj-23306	427	11	,	,	PUNCT
brj-23306	427	12	o.	o.	PROPN
brj-23306	427	13	,	,	PUNCT
brj-23306	427	14	zahorodnia	zahorodnia	PROPN
brj-23306	427	15	,	,	PUNCT
brj-23306	427	16	s.	s.	PROPN
brj-23306	427	17	,	,	PUNCT
brj-23306	427	18	pop	pop	PROPN
brj-23306	427	19	,	,	PUNCT
brj-23306	427	20	c.	c.	PROPN
brj-23306	427	21	v.	v.	PROPN
brj-23306	427	22	,	,	PUNCT
brj-23306	427	23	and	and	CCONJ
brj-23306	427	24	rizun	rizun	NOUN
brj-23306	427	25	,	,	PUNCT
brj-23306	427	26	n.	n.	NOUN
brj-23306	427	27	(	(	PUNCT
brj-23306	427	28	2022	2022	NUM
brj-23306	427	29	)	)	PUNCT
brj-23306	427	30	.	.	PUNCT
brj-23306	428	1	“	"	PUNCT
brj-23306	428	2	effect	effect	NOUN
brj-23306	428	3	of	of	ADP
brj-23306	428	4	coated	coated	ADJ
brj-23306	428	5	silver	silver	ADJ
brj-23306	428	6	nanoparticles	nanoparticle	NOUN
brj-23306	428	7	on	on	ADP
brj-23306	428	8	cancerous	cancerous	ADJ
brj-23306	428	9	vs.	vs.	CCONJ
brj-23306	428	10	healthy	healthy	ADJ
brj-23306	428	11	cells	cell	NOUN
brj-23306	428	12	,	,	PUNCT
brj-23306	428	13	”	"	PUNCT
brj-23306	428	14	journal	journal	NOUN
brj-23306	428	15	of	of	ADP
brj-23306	428	16	toxicology	toxicology	NOUN
brj-23306	428	17	2022	2022	NUM
brj-23306	428	18	,	,	PUNCT
brj-23306	428	19	article	article	NOUN
brj-23306	428	20	i	i	PROPN
brj-23306	428	21	d	d	PROPN
brj-23306	428	22	1519104	1519104	NUM
brj-23306	428	23	.	.	PUNCT
brj-23306	429	1	doi	doi	NOUN
brj-23306	429	2	:	:	PUNCT
brj-23306	429	3	10.1155/2022/1519104	10.1155/2022/1519104	NUM
brj-23306	429	4	arul	arul	PROPN
brj-23306	429	5	raj	raj	PROPN
brj-23306	429	6	,	,	PUNCT
brj-23306	429	7	c.	c.	PROPN
brj-23306	429	8	,	,	PUNCT
brj-23306	429	9	sophia	sophia	PROPN
brj-23306	429	10	,	,	PUNCT
brj-23306	429	11	d.	d.	PROPN
brj-23306	429	12	,	,	PUNCT
brj-23306	429	13	ragavendran	ragavendran	NOUN
brj-23306	429	14	,	,	PUNCT
brj-23306	429	15	p.	p.	PROPN
brj-23306	429	16	,	,	PUNCT
brj-23306	429	17	starlin	starlin	PROPN
brj-23306	429	18	,	,	PUNCT
brj-23306	429	19	t.	t.	PROPN
brj-23306	429	20	,	,	PUNCT
brj-23306	429	21	ma	ma	PROPN
brj-23306	429	22	,	,	PUNCT
brj-23306	429	23	r.	r.	PROPN
brj-23306	429	24	,	,	PUNCT
brj-23306	429	25	and	and	CCONJ
brj-23306	429	26	gopalakrishnan	gopalakrishnan	NOUN
brj-23306	429	27	,	,	PUNCT
brj-23306	429	28	v.	v.	PROPN
brj-23306	429	29	k.	k.	PROPN
brj-23306	429	30	(	(	PUNCT
brj-23306	429	31	2012	2012	NUM
brj-23306	429	32	)	)	PUNCT
brj-23306	429	33	.	.	PUNCT
brj-23306	430	1	“	"	PUNCT
brj-23306	430	2	leaf	leaf	NOUN
brj-23306	430	3	extract	extract	NOUN
brj-23306	430	4	of	of	ADP
brj-23306	430	5	alpinia	alpinia	PROPN
brj-23306	430	6	purpurata	purpurata	PROPN
brj-23306	430	7	(	(	PUNCT
brj-23306	430	8	vieill	vieill	NOUN
brj-23306	430	9	.	.	PUNCT
brj-23306	430	10	)	)	PUNCT
brj-23306	431	1	k.	k.	PROPN
brj-23306	431	2	schum	schum	PROPN
brj-23306	431	3	screened	screen	VERB
brj-23306	431	4	for	for	ADP
brj-23306	431	5	its	its	PRON
brj-23306	431	6	phytochemical	phytochemical	ADJ
brj-23306	431	7	constituents	constituent	NOUN
brj-23306	431	8	and	and	CCONJ
brj-23306	431	9	antibacterial	antibacterial	ADJ
brj-23306	431	10	and	and	CCONJ
brj-23306	431	11	anticancer	anticancer	NOUN
brj-23306	431	12	activities	activity	NOUN
brj-23306	431	13	,	,	PUNCT
brj-23306	431	14	”	"	PUNCT
brj-23306	431	15	journal	journal	NOUN
brj-23306	431	16	of	of	ADP
brj-23306	431	17	chinese	chinese	ADJ
brj-23306	431	18	integrative	integrative	ADJ
brj-23306	431	19	medicine	medicine	NOUN
brj-23306	431	20	10(12	10(12	NUM
brj-23306	431	21	)	)	PUNCT
brj-23306	431	22	,	,	PUNCT
brj-23306	431	23	1460	1460	NUM
brj-23306	431	24	-	-	SYM
brj-23306	431	25	1464	1464	NUM
brj-23306	431	26	.	.	PUNCT
brj-23306	432	1	doi	doi	NOUN
brj-23306	432	2	:	:	PUNCT
brj-23306	432	3	10.3736	10.3736	NUM
brj-23306	432	4	/	/	SYM
brj-23306	432	5	jcim20121219	jcim20121219	PROPN
brj-23306	432	6	baharara	baharara	NOUN
brj-23306	432	7	,	,	PUNCT
brj-23306	432	8	j.	j.	PROPN
brj-23306	432	9	,	,	PUNCT
brj-23306	432	10	namvar	namvar	PROPN
brj-23306	432	11	,	,	PUNCT
brj-23306	432	12	f.	f.	PROPN
brj-23306	432	13	,	,	PUNCT
brj-23306	432	14	ramezani	ramezani	PROPN
brj-23306	432	15	,	,	PUNCT
brj-23306	432	16	t.	t.	PROPN
brj-23306	432	17	,	,	PUNCT
brj-23306	432	18	mousavi	mousavi	PROPN
brj-23306	432	19	,	,	PUNCT
brj-23306	432	20	m.	m.	NOUN
brj-23306	432	21	,	,	PUNCT
brj-23306	432	22	and	and	CCONJ
brj-23306	432	23	mohamad	mohamad	PROPN
brj-23306	432	24	,	,	PUNCT
brj-23306	432	25	r.	r.	PROPN
brj-23306	432	26	(	(	PUNCT
brj-23306	432	27	2015	2015	NUM
brj-23306	432	28	)	)	PUNCT
brj-23306	432	29	.	.	PUNCT
brj-23306	433	1	“	"	PUNCT
brj-23306	433	2	silver	silver	ADJ
brj-23306	433	3	nanoparticles	nanoparticle	NOUN
brj-23306	433	4	biosynthesized	biosynthesize	VERB
brj-23306	433	5	using	use	VERB
brj-23306	433	6	achillea	achillea	PROPN
brj-23306	433	7	biebersteinii	biebersteinii	PROPN
brj-23306	433	8	flower	flower	NOUN
brj-23306	433	9	extract	extract	NOUN
brj-23306	433	10	:	:	PUNCT
brj-23306	433	11	apoptosis	apoptosis	NOUN
brj-23306	433	12	induction	induction	NOUN
brj-23306	433	13	in	in	ADP
brj-23306	433	14	mcf-7	mcf-7	NOUN
brj-23306	433	15	cells	cell	NOUN
brj-23306	433	16	via	via	ADP
brj-23306	433	17	caspase	caspase	NOUN
brj-23306	433	18	activation	activation	NOUN
brj-23306	433	19	and	and	CCONJ
brj-23306	433	20	regulation	regulation	NOUN
brj-23306	433	21	of	of	ADP
brj-23306	433	22	bax	bax	PROPN
brj-23306	433	23	and	and	CCONJ
brj-23306	433	24	bcl-2	bcl-2	NOUN
brj-23306	433	25	gene	gene	NOUN
brj-23306	433	26	expression	expression	NOUN
brj-23306	433	27	,	,	PUNCT
brj-23306	433	28	”	"	PUNCT
brj-23306	433	29	molecules	molecule	NOUN
brj-23306	433	30	20(2	20(2	NUM
brj-23306	433	31	)	)	PUNCT
brj-23306	433	32	,	,	PUNCT
brj-23306	433	33	2693	2693	NUM
brj-23306	433	34	-	-	SYM
brj-23306	433	35	2706	2706	NUM
brj-23306	433	36	.	.	PUNCT
brj-23306	434	1	doi	doi	NOUN
brj-23306	434	2	:	:	PUNCT
brj-23306	434	3	10.3390	10.3390	NUM
brj-23306	434	4	/	/	SYM
brj-23306	434	5	molecules20022693	molecules20022693	PROPN
brj-23306	434	6	peer	peer	NOUN
brj-23306	434	7	-	-	PUNCT
brj-23306	434	8	reviewed	review	VERB
brj-23306	434	9	article	article	NOUN
brj-23306	434	10	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	434	11	raju	raju	PROPN
brj-23306	434	12	et	et	PROPN
brj-23306	434	13	al	al	PROPN
brj-23306	434	14	.	.	PROPN
brj-23306	434	15	(	(	PUNCT
brj-23306	434	16	2024	2024	NUM
brj-23306	434	17	)	)	PUNCT
brj-23306	434	18	.	.	PUNCT
brj-23306	435	1	“	"	PUNCT
brj-23306	435	2	ag	ag	PROPN
brj-23306	435	3	nanoparticles	nanoparticle	NOUN
brj-23306	435	4	from	from	ADP
brj-23306	435	5	leaves	leave	NOUN
brj-23306	435	6	,	,	PUNCT
brj-23306	435	7	”	"	PUNCT
brj-23306	435	8	bioresources	bioresource	NOUN
brj-23306	435	9	19(2	19(2	NUM
brj-23306	435	10	)	)	PUNCT
brj-23306	435	11	,	,	PUNCT
brj-23306	435	12	3328	3328	NUM
brj-23306	435	13	-	-	SYM
brj-23306	435	14	3352	3352	NUM
brj-23306	435	15	.	.	PUNCT
brj-23306	436	1	3350	3350	NUM
brj-23306	436	2	castro‐puyana	castro‐puyana	PROPN
brj-23306	436	3	,	,	PUNCT
brj-23306	436	4	m.	m.	NOUN
brj-23306	436	5	,	,	PUNCT
brj-23306	436	6	marina	marina	NOUN
brj-23306	436	7	,	,	PUNCT
brj-23306	436	8	m.	m.	NOUN
brj-23306	436	9	l.	l.	PROPN
brj-23306	436	10	,	,	PUNCT
brj-23306	436	11	and	and	CCONJ
brj-23306	436	12	plaza	plaza	PROPN
brj-23306	436	13	,	,	PUNCT
brj-23306	436	14	m.	m.	NOUN
brj-23306	436	15	(	(	PUNCT
brj-23306	436	16	2017	2017	NUM
brj-23306	436	17	)	)	PUNCT
brj-23306	436	18	.	.	PUNCT
brj-23306	437	1	“	"	PUNCT
brj-23306	437	2	water	water	NOUN
brj-23306	437	3	as	as	ADP
brj-23306	437	4	green	green	ADJ
brj-23306	437	5	extraction	extraction	NOUN
brj-23306	437	6	solvent	solvent	NOUN
brj-23306	437	7	:	:	PUNCT
brj-23306	437	8	principles	principle	NOUN
brj-23306	437	9	and	and	CCONJ
brj-23306	437	10	reasons	reason	NOUN
brj-23306	437	11	for	for	ADP
brj-23306	437	12	its	its	PRON
brj-23306	437	13	use	use	NOUN
brj-23306	437	14	,	,	PUNCT
brj-23306	437	15	”	"	PUNCT
brj-23306	437	16	current	current	ADJ
brj-23306	437	17	opinion	opinion	NOUN
brj-23306	437	18	in	in	ADP
brj-23306	437	19	green	green	ADJ
brj-23306	437	20	and	and	CCONJ
brj-23306	437	21	sustainable	sustainable	ADJ
brj-23306	437	22	chemistry	chemistry	NOUN
brj-23306	437	23	,	,	PUNCT
brj-23306	437	24	5	5	NUM
brj-23306	437	25	,	,	PUNCT
brj-23306	437	26	31	31	NUM
brj-23306	437	27	-	-	SYM
brj-23306	437	28	36	36	NUM
brj-23306	437	29	.	.	PUNCT
brj-23306	438	1	doi	doi	NOUN
brj-23306	438	2	:	:	PUNCT
brj-23306	438	3	10.1016	10.1016	NUM
brj-23306	438	4	/	/	SYM
brj-23306	438	5	j.cogsc.2017.03.009	j.cogsc.2017.03.009	PROPN
brj-23306	438	6	chaturvedi	chaturvedi	PROPN
brj-23306	438	7	,	,	PUNCT
brj-23306	438	8	v.	v.	PROPN
brj-23306	438	9	k.	k.	PROPN
brj-23306	438	10	,	,	PUNCT
brj-23306	438	11	yadav	yadav	PROPN
brj-23306	438	12	,	,	PUNCT
brj-23306	438	13	n.	n.	PROPN
brj-23306	438	14	,	,	PUNCT
brj-23306	438	15	neeraj	neeraj	PROPN
brj-23306	438	16	,	,	PUNCT
brj-23306	438	17	k.	k.	PROPN
brj-23306	438	18	,	,	PUNCT
brj-23306	438	19	ellah	ellah	PROPN
brj-23306	438	20	,	,	PUNCT
brj-23306	438	21	n.	n.	PROPN
brj-23306	438	22	h.	h.	PROPN
brj-23306	438	23	a.	a.	PROPN
brj-23306	438	24	,	,	PUNCT
brj-23306	438	25	bohara	bohara	PROPN
brj-23306	438	26	,	,	PUNCT
brj-23306	438	27	r.	r.	PROPN
brj-23306	438	28	a.	a.	PROPN
brj-23306	438	29	,	,	PUNCT
brj-23306	438	30	rehan	rehan	PROPN
brj-23306	438	31	,	,	PUNCT
brj-23306	438	32	i.	i.	PROPN
brj-23306	438	33	f.	f.	PROPN
brj-23306	438	34	,	,	PUNCT
brj-23306	438	35	marraiki	marraiki	PROPN
brj-23306	438	36	,	,	PUNCT
brj-23306	438	37	n.	n.	NOUN
brj-23306	438	38	,	,	PUNCT
brj-23306	438	39	batiha	batiha	VERB
brj-23306	438	40	,	,	PUNCT
brj-23306	438	41	g.	g.	PROPN
brj-23306	438	42	e.	e.	PROPN
brj-23306	438	43	,	,	PUNCT
brj-23306	438	44	hetta	hetta	PROPN
brj-23306	438	45	,	,	PUNCT
brj-23306	438	46	h.	h.	PROPN
brj-23306	438	47	f.	f.	PROPN
brj-23306	438	48	,	,	PUNCT
brj-23306	438	49	and	and	CCONJ
brj-23306	438	50	singh	singh	NOUN
brj-23306	438	51	,	,	PUNCT
brj-23306	438	52	m.	m.	NOUN
brj-23306	438	53	(	(	PUNCT
brj-23306	438	54	2020	2020	NUM
brj-23306	438	55	)	)	PUNCT
brj-23306	438	56	.	.	PUNCT
brj-23306	439	1	“	"	PUNCT
brj-23306	439	2	pleurotus	pleurotus	PROPN
brj-23306	439	3	sajor	sajor	NOUN
brj-23306	439	4	-	-	PUNCT
brj-23306	439	5	cajumediated	cajumediate	VERB
brj-23306	439	6	synthesis	synthesis	NOUN
brj-23306	439	7	of	of	ADP
brj-23306	439	8	silver	silver	NOUN
brj-23306	439	9	and	and	CCONJ
brj-23306	439	10	gold	gold	NOUN
brj-23306	439	11	nanoparticles	nanoparticle	NOUN
brj-23306	439	12	active	active	ADJ
brj-23306	439	13	against	against	ADP
brj-23306	439	14	colon	colon	NOUN
brj-23306	439	15	cancer	cancer	NOUN
brj-23306	439	16	cell	cell	NOUN
brj-23306	439	17	lines	line	NOUN
brj-23306	439	18	:	:	PUNCT
brj-23306	439	19	a	a	DET
brj-23306	439	20	new	new	ADJ
brj-23306	439	21	era	era	NOUN
brj-23306	439	22	of	of	ADP
brj-23306	439	23	herbonanoceutics	herbonanoceutic	NOUN
brj-23306	439	24	,	,	PUNCT
brj-23306	439	25	”	"	PUNCT
brj-23306	439	26	molecules	molecule	NOUN
brj-23306	439	27	25(13	25(13	NUM
brj-23306	439	28	)	)	PUNCT
brj-23306	439	29	,	,	PUNCT
brj-23306	439	30	article	article	NOUN
brj-23306	439	31	3091	3091	NUM
brj-23306	439	32	.	.	PUNCT
brj-23306	440	1	doi	doi	NOUN
brj-23306	440	2	:	:	PUNCT
brj-23306	440	3	10.3390	10.3390	NUM
brj-23306	440	4	/	/	SYM
brj-23306	440	5	molecules25133091	molecules25133091	PROPN
brj-23306	440	6	de	de	X
brj-23306	440	7	macedo	macedo	PROPN
brj-23306	440	8	,	,	PUNCT
brj-23306	440	9	e.	e.	PROPN
brj-23306	440	10	f.	f.	PROPN
brj-23306	440	11	,	,	PUNCT
brj-23306	440	12	santos	santos	PROPN
brj-23306	440	13	,	,	PUNCT
brj-23306	440	14	n.	n.	PROPN
brj-23306	440	15	s.	s.	PROPN
brj-23306	440	16	,	,	PUNCT
brj-23306	440	17	nascimento	nascimento	PROPN
brj-23306	440	18	,	,	PUNCT
brj-23306	440	19	l.	l.	PROPN
brj-23306	440	20	s.	s.	PROPN
brj-23306	440	21	,	,	PUNCT
brj-23306	440	22	mathey	mathey	PRON
brj-23306	440	23	,	,	PUNCT
brj-23306	440	24	r.	r.	PROPN
brj-23306	440	25	,	,	PUNCT
brj-23306	440	26	brenet	brenet	NOUN
brj-23306	440	27	,	,	PUNCT
brj-23306	440	28	s.	s.	PROPN
brj-23306	440	29	,	,	PUNCT
brj-23306	440	30	de	de	PROPN
brj-23306	440	31	moura	moura	PROPN
brj-23306	440	32	,	,	PUNCT
brj-23306	440	33	m.	m.	NOUN
brj-23306	440	34	s.	s.	PROPN
brj-23306	440	35	,	,	PUNCT
brj-23306	440	36	hou	hou	PROPN
brj-23306	440	37	,	,	PUNCT
brj-23306	440	38	y.	y.	PROPN
brj-23306	440	39	,	,	PUNCT
brj-23306	440	40	and	and	CCONJ
brj-23306	440	41	tada	tada	PROPN
brj-23306	440	42	,	,	PUNCT
brj-23306	440	43	d.	d.	PROPN
brj-23306	440	44	b.	b.	PROPN
brj-23306	440	45	(	(	PUNCT
brj-23306	440	46	2022	2022	NUM
brj-23306	440	47	)	)	PUNCT
brj-23306	440	48	.	.	PUNCT
brj-23306	441	1	“	"	PUNCT
brj-23306	441	2	interaction	interaction	NOUN
brj-23306	441	3	between	between	ADP
brj-23306	441	4	nanoparticles	nanoparticle	NOUN
brj-23306	441	5	,	,	PUNCT
brj-23306	441	6	membranes	membrane	NOUN
brj-23306	441	7	and	and	CCONJ
brj-23306	441	8	proteins	protein	NOUN
brj-23306	441	9	:	:	PUNCT
brj-23306	441	10	a	a	DET
brj-23306	441	11	surface	surface	NOUN
brj-23306	441	12	plasmon	plasmon	NOUN
brj-23306	441	13	resonance	resonance	NOUN
brj-23306	441	14	study	study	NOUN
brj-23306	441	15	,	,	PUNCT
brj-23306	441	16	”	"	PUNCT
brj-23306	441	17	international	international	ADJ
brj-23306	441	18	journal	journal	NOUN
brj-23306	441	19	of	of	ADP
brj-23306	441	20	molecular	molecular	ADJ
brj-23306	441	21	sciences	science	NOUN
brj-23306	441	22	24(1	24(1	NUM
brj-23306	441	23	)	)	PUNCT
brj-23306	441	24	,	,	PUNCT
brj-23306	441	25	article	article	NOUN
brj-23306	441	26	591	591	NUM
brj-23306	441	27	.	.	PUNCT
brj-23306	442	1	doi	doi	NOUN
brj-23306	442	2	:	:	PUNCT
brj-23306	442	3	10.3390	10.3390	NUM
brj-23306	442	4	/	/	SYM
brj-23306	442	5	ijms24010591	ijms24010591	PROPN
brj-23306	442	6	el‐telbany	el‐telbany	NOUN
brj-23306	442	7	,	,	PUNCT
brj-23306	442	8	m.	m.	NOUN
brj-23306	442	9	,	,	PUNCT
brj-23306	442	10	and	and	CCONJ
brj-23306	442	11	el	el	PROPN
brj-23306	442	12	-	-	PUNCT
brj-23306	442	13	sharaki	sharaki	NOUN
brj-23306	442	14	,	,	PUNCT
brj-23306	442	15	a.	a.	NOUN
brj-23306	442	16	(	(	PUNCT
brj-23306	442	17	2022	2022	NUM
brj-23306	442	18	)	)	PUNCT
brj-23306	442	19	.	.	PUNCT
brj-23306	443	1	“	"	PUNCT
brj-23306	443	2	antibacterial	antibacterial	ADJ
brj-23306	443	3	and	and	CCONJ
brj-23306	443	4	anti	anti	ADJ
brj-23306	443	5	-	-	ADJ
brj-23306	443	6	biofilm	biofilm	ADJ
brj-23306	443	7	activity	activity	NOUN
brj-23306	443	8	of	of	ADP
brj-23306	443	9	silver	silver	ADJ
brj-23306	443	10	nanoparticles	nanoparticle	NOUN
brj-23306	443	11	on	on	ADP
brj-23306	443	12	multi	multi	ADJ
brj-23306	443	13	-	-	ADJ
brj-23306	443	14	drug	drug	ADJ
brj-23306	443	15	resistance	resistance	NOUN
brj-23306	443	16	pseudomonas	pseudomona	NOUN
brj-23306	443	17	aeruginosa	aeruginosa	NOUN
brj-23306	443	18	isolated	isolate	VERB
brj-23306	443	19	from	from	ADP
brj-23306	443	20	dental	dental	ADJ
brj-23306	443	21	-	-	PUNCT
brj-23306	443	22	implant	implant	NOUN
brj-23306	443	23	,	,	PUNCT
brj-23306	443	24	”	"	PUNCT
brj-23306	443	25	journal	journal	NOUN
brj-23306	443	26	of	of	ADP
brj-23306	443	27	oral	oral	ADJ
brj-23306	443	28	biology	biology	NOUN
brj-23306	443	29	and	and	CCONJ
brj-23306	443	30	craniofacial	craniofacial	ADJ
brj-23306	443	31	research	research	NOUN
brj-23306	443	32	12(1	12(1	NUM
brj-23306	443	33	)	)	PUNCT
brj-23306	443	34	,	,	PUNCT
brj-23306	443	35	199	199	NUM
brj-23306	443	36	-	-	SYM
brj-23306	443	37	203	203	NUM
brj-23306	443	38	.	.	PUNCT
brj-23306	444	1	doi	doi	NOUN
brj-23306	444	2	:	:	PUNCT
brj-23306	444	3	10.1016	10.1016	NUM
brj-23306	444	4	/	/	SYM
brj-23306	444	5	j.jobcr.2021.12.002	j.jobcr.2021.12.002	PROPN
brj-23306	444	6	gad	gad	PROPN
brj-23306	444	7	,	,	PUNCT
brj-23306	444	8	s.	s.	PROPN
brj-23306	444	9	s.	s.	PROPN
brj-23306	444	10	,	,	PUNCT
brj-23306	444	11	abdelrahim	abdelrahim	PROPN
brj-23306	444	12	,	,	PUNCT
brj-23306	444	13	d.	d.	PROPN
brj-23306	444	14	s.	s.	PROPN
brj-23306	444	15	,	,	PUNCT
brj-23306	444	16	ismail	ismail	PROPN
brj-23306	444	17	,	,	PUNCT
brj-23306	444	18	s.	s.	PROPN
brj-23306	444	19	h.	h.	PROPN
brj-23306	444	20	,	,	PUNCT
brj-23306	444	21	and	and	CCONJ
brj-23306	444	22	ibrahim	ibrahim	PROPN
brj-23306	444	23	,	,	PUNCT
brj-23306	444	24	s.	s.	PROPN
brj-23306	444	25	m.	m.	PROPN
brj-23306	444	26	(	(	PUNCT
brj-23306	444	27	2021	2021	NUM
brj-23306	444	28	)	)	PUNCT
brj-23306	444	29	.	.	PUNCT
brj-23306	445	1	“	"	PUNCT
brj-23306	445	2	selenium	selenium	NOUN
brj-23306	445	3	and	and	CCONJ
brj-23306	445	4	silver	silver	NOUN
brj-23306	445	5	nanoparticles	nanoparticle	NOUN
brj-23306	445	6	:	:	PUNCT
brj-23306	445	7	a	a	DET
brj-23306	445	8	new	new	ADJ
brj-23306	445	9	approach	approach	NOUN
brj-23306	445	10	for	for	ADP
brj-23306	445	11	treatment	treatment	NOUN
brj-23306	445	12	of	of	ADP
brj-23306	445	13	bacterial	bacterial	ADJ
brj-23306	445	14	and	and	CCONJ
brj-23306	445	15	viral	viral	ADJ
brj-23306	445	16	hepatic	hepatic	ADJ
brj-23306	445	17	infections	infection	NOUN
brj-23306	445	18	via	via	ADP
brj-23306	445	19	modulating	modulate	VERB
brj-23306	445	20	oxidative	oxidative	ADJ
brj-23306	445	21	stress	stress	NOUN
brj-23306	445	22	and	and	CCONJ
brj-23306	445	23	dna	dna	NOUN
brj-23306	445	24	fragmentation	fragmentation	NOUN
brj-23306	445	25	,	,	PUNCT
brj-23306	445	26	”	"	PUNCT
brj-23306	445	27	journal	journal	NOUN
brj-23306	445	28	of	of	ADP
brj-23306	445	29	biochemical	biochemical	ADJ
brj-23306	445	30	and	and	CCONJ
brj-23306	445	31	molecular	molecular	ADJ
brj-23306	445	32	toxicology	toxicology	NOUN
brj-23306	445	33	36(3	36(3	NOUN
brj-23306	445	34	)	)	PUNCT
brj-23306	445	35	,	,	PUNCT
brj-23306	445	36	article	article	NOUN
brj-23306	445	37	i	i	PROPN
brj-23306	445	38	d	d	PROPN
brj-23306	445	39	22972	22972	NUM
brj-23306	445	40	.	.	PUNCT
brj-23306	446	1	doi	doi	NOUN
brj-23306	446	2	:	:	PUNCT
brj-23306	446	3	10.1002	10.1002	NUM
brj-23306	446	4	/	/	SYM
brj-23306	446	5	jbt.22972	jbt.22972	NUM
brj-23306	446	6	gurunathan	gurunathan	NOUN
brj-23306	446	7	,	,	PUNCT
brj-23306	446	8	s.	s.	PROPN
brj-23306	446	9	,	,	PUNCT
brj-23306	446	10	han	han	PROPN
brj-23306	446	11	,	,	PUNCT
brj-23306	446	12	j.	j.	PROPN
brj-23306	446	13	s.	s.	PROPN
brj-23306	446	14	,	,	PUNCT
brj-23306	446	15	eppakayala	eppakayala	PROPN
brj-23306	446	16	,	,	PUNCT
brj-23306	446	17	v.	v.	PROPN
brj-23306	446	18	,	,	PUNCT
brj-23306	446	19	jeyaraj	jeyaraj	PROPN
brj-23306	446	20	,	,	PUNCT
brj-23306	446	21	m.	m.	NOUN
brj-23306	446	22	,	,	PUNCT
brj-23306	446	23	and	and	CCONJ
brj-23306	446	24	kim	kim	PROPN
brj-23306	446	25	,	,	PUNCT
brj-23306	446	26	j.	j.	PROPN
brj-23306	446	27	(	(	PUNCT
brj-23306	446	28	2013	2013	NUM
brj-23306	446	29	)	)	PUNCT
brj-23306	446	30	.	.	PUNCT
brj-23306	447	1	“	"	PUNCT
brj-23306	447	2	cytotoxicity	cytotoxicity	NOUN
brj-23306	447	3	of	of	ADP
brj-23306	447	4	biologically	biologically	ADV
brj-23306	447	5	synthesized	synthesize	VERB
brj-23306	447	6	silver	silver	ADJ
brj-23306	447	7	nanoparticles	nanoparticle	NOUN
brj-23306	447	8	in	in	ADP
brj-23306	447	9	mda	mda	PROPN
brj-23306	447	10	-	-	PUNCT
brj-23306	447	11	mb-231	mb-231	PROPN
brj-23306	447	12	human	human	ADJ
brj-23306	447	13	breast	breast	NOUN
brj-23306	447	14	cancer	cancer	NOUN
brj-23306	447	15	cells	cell	NOUN
brj-23306	447	16	,	,	PUNCT
brj-23306	447	17	”	"	PUNCT
brj-23306	447	18	biomed	biome	VERB
brj-23306	447	19	research	research	NOUN
brj-23306	447	20	international	international	ADJ
brj-23306	447	21	2013	2013	NUM
brj-23306	447	22	,	,	PUNCT
brj-23306	447	23	1	1	NUM
brj-23306	447	24	-	-	SYM
brj-23306	447	25	10	10	NUM
brj-23306	447	26	.	.	PUNCT
brj-23306	448	1	doi	doi	NOUN
brj-23306	448	2	:	:	PUNCT
brj-23306	448	3	10.1155/2013/535796	10.1155/2013/535796	NUM
brj-23306	448	4	hashem	hashem	NOUN
brj-23306	448	5	,	,	PUNCT
brj-23306	448	6	s.	s.	PROPN
brj-23306	448	7	,	,	PUNCT
brj-23306	448	8	ali	ali	PROPN
brj-23306	448	9	,	,	PUNCT
brj-23306	448	10	t.	t.	PROPN
brj-23306	448	11	,	,	PUNCT
brj-23306	448	12	akhtar	akhtar	PROPN
brj-23306	448	13	,	,	PUNCT
brj-23306	448	14	s.	s.	PROPN
brj-23306	448	15	,	,	PUNCT
brj-23306	448	16	nisar	nisar	PROPN
brj-23306	448	17	,	,	PUNCT
brj-23306	448	18	s.	s.	PROPN
brj-23306	448	19	,	,	PUNCT
brj-23306	448	20	sageena	sageena	PROPN
brj-23306	448	21	,	,	PUNCT
brj-23306	448	22	g.	g.	PROPN
brj-23306	448	23	,	,	PUNCT
brj-23306	448	24	ali	ali	PROPN
brj-23306	448	25	,	,	PUNCT
brj-23306	448	26	s.	s.	PROPN
brj-23306	448	27	,	,	PUNCT
brj-23306	448	28	al	al	PROPN
brj-23306	448	29	-	-	PUNCT
brj-23306	448	30	mannai	mannai	PROPN
brj-23306	448	31	,	,	PUNCT
brj-23306	448	32	s.	s.	PROPN
brj-23306	448	33	,	,	PUNCT
brj-23306	448	34	therachiyil	therachiyil	PROPN
brj-23306	448	35	,	,	PUNCT
brj-23306	448	36	l.	l.	PROPN
brj-23306	448	37	,	,	PUNCT
brj-23306	448	38	mir	mir	PROPN
brj-23306	448	39	,	,	PUNCT
brj-23306	448	40	r.	r.	PROPN
brj-23306	448	41	,	,	PUNCT
brj-23306	448	42	elfaki	elfaki	NOUN
brj-23306	448	43	,	,	PUNCT
brj-23306	448	44	i.	i.	PROPN
brj-23306	448	45	,	,	PUNCT
brj-23306	448	46	et	et	PROPN
brj-23306	448	47	al	al	PROPN
brj-23306	448	48	.	.	PROPN
brj-23306	448	49	(	(	PUNCT
brj-23306	448	50	2022	2022	NUM
brj-23306	448	51	)	)	PUNCT
brj-23306	448	52	.	.	PUNCT
brj-23306	449	1	“	"	PUNCT
brj-23306	449	2	targeting	target	VERB
brj-23306	449	3	cancer	cancer	NOUN
brj-23306	449	4	signaling	signal	VERB
brj-23306	449	5	pathways	pathway	NOUN
brj-23306	449	6	by	by	ADP
brj-23306	449	7	natural	natural	ADJ
brj-23306	449	8	products	product	NOUN
brj-23306	449	9	:	:	PUNCT
brj-23306	449	10	exploring	explore	VERB
brj-23306	449	11	promising	promise	VERB
brj-23306	449	12	anti	anti	ADJ
brj-23306	449	13	-	-	ADJ
brj-23306	449	14	cancer	cancer	ADJ
brj-23306	449	15	agents	agent	NOUN
brj-23306	449	16	,	,	PUNCT
brj-23306	449	17	”	"	PUNCT
brj-23306	449	18	biomedicine	biomedicine	NOUN
brj-23306	449	19	&	&	CCONJ
brj-23306	449	20	pharmacotherapy	pharmacotherapy	NOUN
brj-23306	449	21	150	150	NUM
brj-23306	449	22	,	,	PUNCT
brj-23306	449	23	article	article	NOUN
brj-23306	449	24	i	i	PROPN
brj-23306	449	25	d	d	PROPN
brj-23306	449	26	113054	113054	NUM
brj-23306	449	27	.	.	PUNCT
brj-23306	450	1	doi	doi	NOUN
brj-23306	450	2	:	:	PUNCT
brj-23306	450	3	10.1016	10.1016	NUM
brj-23306	450	4	/	/	SYM
brj-23306	450	5	j.biopha.2022.113054	j.biopha.2022.113054	PROPN
brj-23306	450	6	huang	huang	PROPN
brj-23306	450	7	,	,	PUNCT
brj-23306	450	8	j.	j.	PROPN
brj-23306	450	9	,	,	PUNCT
brj-23306	450	10	chan	chan	PROPN
brj-23306	450	11	,	,	PUNCT
brj-23306	450	12	w.	w.	PROPN
brj-23306	450	13	c.	c.	PROPN
brj-23306	450	14	,	,	PUNCT
brj-23306	450	15	ngai	ngai	PROPN
brj-23306	450	16	,	,	PUNCT
brj-23306	450	17	c.	c.	PROPN
brj-23306	450	18	h.	h.	PROPN
brj-23306	450	19	,	,	PUNCT
brj-23306	450	20	lok	lok	PROPN
brj-23306	450	21	,	,	PUNCT
brj-23306	450	22	v.	v.	PROPN
brj-23306	450	23	,	,	PUNCT
brj-23306	450	24	zhang	zhang	PROPN
brj-23306	450	25	,	,	PUNCT
brj-23306	450	26	l.	l.	PROPN
brj-23306	450	27	,	,	PUNCT
brj-23306	450	28	lucero	lucero	PROPN
brj-23306	450	29	-	-	PUNCT
brj-23306	450	30	prisno	prisno	NOUN
brj-23306	450	31	,	,	PUNCT
brj-23306	450	32	d.	d.	PROPN
brj-23306	450	33	e.	e.	PROPN
brj-23306	450	34	,	,	PUNCT
brj-23306	450	35	iii	iii	PROPN
brj-23306	450	36	,	,	PUNCT
brj-23306	450	37	xu	xu	PROPN
brj-23306	450	38	,	,	PUNCT
brj-23306	450	39	w.	w.	PROPN
brj-23306	450	40	,	,	PUNCT
brj-23306	450	41	zheng	zheng	PROPN
brj-23306	450	42	,	,	PUNCT
brj-23306	450	43	z.	z.	PROPN
brj-23306	450	44	j.	j.	PROPN
brj-23306	450	45	,	,	PUNCT
brj-23306	450	46	elcarte	elcarte	PROPN
brj-23306	450	47	,	,	PUNCT
brj-23306	450	48	e.	e.	PROPN
brj-23306	450	49	,	,	PUNCT
brj-23306	450	50	withers	wither	NOUN
brj-23306	450	51	,	,	PUNCT
brj-23306	450	52	m.	m.	NOUN
brj-23306	450	53	,	,	PUNCT
brj-23306	450	54	wong	wong	PROPN
brj-23306	450	55	,	,	PUNCT
brj-23306	450	56	m.	m.	PROPN
brj-23306	450	57	c.	c.	PROPN
brj-23306	450	58	s.	s.	PROPN
brj-23306	450	59	,	,	PUNCT
brj-23306	450	60	and	and	CCONJ
brj-23306	450	61	on	on	ADP
brj-23306	450	62	behalf	behalf	NOUN
brj-23306	450	63	of	of	ADP
brj-23306	450	64	ncd	ncd	PROPN
brj-23306	450	65	global	global	PROPN
brj-23306	450	66	health	health	PROPN
brj-23306	450	67	research	research	PROPN
brj-23306	450	68	group	group	NOUN
brj-23306	450	69	of	of	ADP
brj-23306	450	70	association	association	PROPN
brj-23306	450	71	of	of	ADP
brj-23306	450	72	pacific	pacific	PROPN
brj-23306	450	73	rim	rim	PROPN
brj-23306	450	74	universities	university	NOUN
brj-23306	450	75	(	(	PUNCT
brj-23306	450	76	apru	apru	PROPN
brj-23306	450	77	)	)	PUNCT
brj-23306	450	78	(	(	PUNCT
brj-23306	450	79	2022	2022	NUM
brj-23306	450	80	)	)	PUNCT
brj-23306	450	81	.	.	PUNCT
brj-23306	451	1	“	"	PUNCT
brj-23306	451	2	worldwide	worldwide	ADJ
brj-23306	451	3	burden	burden	NOUN
brj-23306	451	4	,	,	PUNCT
brj-23306	451	5	risk	risk	NOUN
brj-23306	451	6	factors	factor	NOUN
brj-23306	451	7	,	,	PUNCT
brj-23306	451	8	and	and	CCONJ
brj-23306	451	9	temporal	temporal	ADJ
brj-23306	451	10	trends	trend	NOUN
brj-23306	451	11	of	of	ADP
brj-23306	451	12	ovarian	ovarian	ADJ
brj-23306	451	13	cancer	cancer	NOUN
brj-23306	451	14	:	:	PUNCT
brj-23306	451	15	a	a	DET
brj-23306	451	16	global	global	ADJ
brj-23306	451	17	study	study	NOUN
brj-23306	451	18	,	,	PUNCT
brj-23306	451	19	”	"	PUNCT
brj-23306	451	20	cancers	cancer	NOUN
brj-23306	451	21	14(9	14(9	NUM
brj-23306	451	22	)	)	PUNCT
brj-23306	451	23	,	,	PUNCT
brj-23306	451	24	article	article	NOUN
brj-23306	451	25	2230	2230	NUM
brj-23306	451	26	.	.	PUNCT
brj-23306	452	1	doi	doi	NOUN
brj-23306	452	2	:	:	PUNCT
brj-23306	452	3	10.3390	10.3390	NUM
brj-23306	452	4	/	/	SYM
brj-23306	452	5	cancers14092230	cancers14092230	PROPN
brj-23306	452	6	khan	khan	PROPN
brj-23306	452	7	,	,	PUNCT
brj-23306	452	8	h.	h.	PROPN
brj-23306	452	9	,	,	PUNCT
brj-23306	452	10	alam	alam	PROPN
brj-23306	452	11	,	,	PUNCT
brj-23306	452	12	w.	w.	PROPN
brj-23306	452	13	,	,	PUNCT
brj-23306	452	14	alsharif	alsharif	PROPN
brj-23306	452	15	,	,	PUNCT
brj-23306	452	16	k.	k.	PROPN
brj-23306	452	17	f.	f.	PROPN
brj-23306	452	18	,	,	PUNCT
brj-23306	452	19	aschner	aschner	NOUN
brj-23306	452	20	,	,	PUNCT
brj-23306	452	21	m.	m.	NOUN
brj-23306	452	22	,	,	PUNCT
brj-23306	452	23	pervez	pervez	PROPN
brj-23306	452	24	,	,	PUNCT
brj-23306	452	25	s.	s.	PROPN
brj-23306	452	26	,	,	PUNCT
brj-23306	452	27	and	and	CCONJ
brj-23306	452	28	saso	saso	PROPN
brj-23306	452	29	,	,	PUNCT
brj-23306	452	30	l.	l.	PROPN
brj-23306	452	31	(	(	PUNCT
brj-23306	452	32	2022	2022	NUM
brj-23306	452	33	)	)	PUNCT
brj-23306	452	34	.	.	PUNCT
brj-23306	453	1	“	"	PUNCT
brj-23306	453	2	alkaloids	alkaloid	NOUN
brj-23306	453	3	and	and	CCONJ
brj-23306	453	4	colon	colon	NOUN
brj-23306	453	5	cancer	cancer	NOUN
brj-23306	453	6	:	:	PUNCT
brj-23306	453	7	molecular	molecular	ADJ
brj-23306	453	8	mechanisms	mechanism	NOUN
brj-23306	453	9	and	and	CCONJ
brj-23306	453	10	therapeutic	therapeutic	ADJ
brj-23306	453	11	implications	implication	NOUN
brj-23306	453	12	for	for	ADP
brj-23306	453	13	cell	cell	NOUN
brj-23306	453	14	cycle	cycle	NOUN
brj-23306	453	15	arrest	arrest	NOUN
brj-23306	453	16	,	,	PUNCT
brj-23306	453	17	”	"	PUNCT
brj-23306	453	18	molecules	molecule	NOUN
brj-23306	453	19	27(3	27(3	NUM
brj-23306	453	20	)	)	PUNCT
brj-23306	453	21	,	,	PUNCT
brj-23306	453	22	article	article	NOUN
brj-23306	453	23	920	920	NUM
brj-23306	453	24	.	.	PUNCT
brj-23306	454	1	doi	doi	NOUN
brj-23306	454	2	:	:	PUNCT
brj-23306	454	3	10.3390	10.3390	NUM
brj-23306	454	4	/	/	SYM
brj-23306	454	5	molecules27030920	molecules27030920	NOUN
brj-23306	454	6	kumar	kumar	PROPN
brj-23306	454	7	,	,	PUNCT
brj-23306	454	8	d.	d.	PROPN
brj-23306	454	9	g.	g.	PROPN
brj-23306	454	10	,	,	PUNCT
brj-23306	454	11	achar	achar	PROPN
brj-23306	454	12	,	,	PUNCT
brj-23306	454	13	r.	r.	PROPN
brj-23306	454	14	r.	r.	PROPN
brj-23306	454	15	,	,	PUNCT
brj-23306	454	16	kumar	kumar	PROPN
brj-23306	454	17	,	,	PUNCT
brj-23306	454	18	j.	j.	PROPN
brj-23306	454	19	r.	r.	PROPN
brj-23306	454	20	,	,	PUNCT
brj-23306	454	21	george	george	PROPN
brj-23306	454	22	,	,	PUNCT
brj-23306	454	23	a.	a.	NOUN
brj-23306	454	24	,	,	PUNCT
brj-23306	454	25	gopalakrishnan	gopalakrishnan	NOUN
brj-23306	454	26	,	,	PUNCT
brj-23306	454	27	v.	v.	PROPN
brj-23306	454	28	,	,	PUNCT
brj-23306	454	29	pradeep	pradeep	PROPN
brj-23306	454	30	,	,	PUNCT
brj-23306	454	31	s.	s.	PROPN
brj-23306	454	32	,	,	PUNCT
brj-23306	454	33	shati	shati	PROPN
brj-23306	454	34	,	,	PUNCT
brj-23306	454	35	a.	a.	NOUN
brj-23306	454	36	a.	a.	PROPN
brj-23306	454	37	,	,	PUNCT
brj-23306	454	38	alfaifi	alfaifi	ADJ
brj-23306	454	39	,	,	PUNCT
brj-23306	454	40	m.	m.	NOUN
brj-23306	454	41	y.	y.	PROPN
brj-23306	454	42	,	,	PUNCT
brj-23306	454	43	elbehairi	elbehairi	PROPN
brj-23306	454	44	,	,	PUNCT
brj-23306	454	45	s.	s.	PROPN
brj-23306	454	46	e.	e.	PROPN
brj-23306	454	47	i.	i.	PROPN
brj-23306	454	48	,	,	PUNCT
brj-23306	454	49	silina	silina	PROPN
brj-23306	454	50	,	,	PUNCT
brj-23306	454	51	e.	e.	PROPN
brj-23306	454	52	,	,	PUNCT
brj-23306	454	53	et	et	PROPN
brj-23306	454	54	al	al	PROPN
brj-23306	454	55	.	.	PROPN
brj-23306	454	56	(	(	PUNCT
brj-23306	454	57	2023	2023	NUM
brj-23306	454	58	)	)	PUNCT
brj-23306	454	59	.	.	PUNCT
brj-23306	455	1	“	"	PUNCT
brj-23306	455	2	assessment	assessment	NOUN
brj-23306	455	3	of	of	ADP
brj-23306	455	4	antimicrobial	antimicrobial	ADJ
brj-23306	455	5	and	and	CCONJ
brj-23306	455	6	anthelmintic	anthelmintic	ADJ
brj-23306	455	7	activity	activity	NOUN
brj-23306	455	8	of	of	ADP
brj-23306	455	9	silver	silver	ADJ
brj-23306	455	10	nanoparticles	nanoparticle	NOUN
brj-23306	455	11	bio	bio	ADV
brj-23306	455	12	-	-	PUNCT
brj-23306	455	13	synthesized	synthesize	VERB
brj-23306	455	14	from	from	ADP
brj-23306	455	15	viscum	viscum	ADJ
brj-23306	455	16	orientale	orientale	PROPN
brj-23306	455	17	leaf	leaf	NOUN
brj-23306	455	18	extract	extract	NOUN
brj-23306	455	19	,	,	PUNCT
brj-23306	455	20	”	"	PUNCT
brj-23306	455	21	bmc	bmc	ADJ
brj-23306	455	22	complementary	complementary	ADJ
brj-23306	455	23	medicine	medicine	NOUN
brj-23306	455	24	and	and	CCONJ
brj-23306	455	25	therapies	therapy	NOUN
brj-23306	455	26	23(1	23(1	NUM
brj-23306	455	27	)	)	PUNCT
brj-23306	455	28	,	,	PUNCT
brj-23306	455	29	article	article	NOUN
brj-23306	455	30	167	167	NUM
brj-23306	455	31	.	.	PUNCT
brj-23306	456	1	doi	doi	NOUN
brj-23306	456	2	:	:	PUNCT
brj-23306	456	3	10.1186	10.1186	NUM
brj-23306	456	4	/	/	SYM
brj-23306	456	5	s12906	s12906	VERB
brj-23306	456	6	-	-	PUNCT
brj-23306	456	7	023	023	NUM
brj-23306	456	8	-	-	PUNCT
brj-23306	456	9	03982	03982	NUM
brj-23306	456	10	-	-	PUNCT
brj-23306	456	11	1	1	NUM
brj-23306	456	12	li	li	PROPN
brj-23306	456	13	,	,	PUNCT
brj-23306	456	14	x.	x.	PROPN
brj-23306	456	15	,	,	PUNCT
brj-23306	456	16	wang	wang	PROPN
brj-23306	456	17	,	,	PUNCT
brj-23306	456	18	y.	y.	PROPN
brj-23306	456	19	y.	y.	PROPN
brj-23306	456	20	,	,	PUNCT
brj-23306	456	21	huang	huang	PROPN
brj-23306	456	22	,	,	PUNCT
brj-23306	456	23	j.	j.	PROPN
brj-23306	456	24	,	,	PUNCT
brj-23306	456	25	chen	chen	PROPN
brj-23306	456	26	,	,	PUNCT
brj-23306	456	27	c.	c.	PROPN
brj-23306	456	28	y.	y.	PROPN
brj-23306	456	29	,	,	PUNCT
brj-23306	456	30	wang	wang	PROPN
brj-23306	456	31	,	,	PUNCT
brj-23306	456	32	z.	z.	PROPN
brj-23306	456	33	,	,	PUNCT
brj-23306	456	34	and	and	CCONJ
brj-23306	456	35	xie	xie	PROPN
brj-23306	456	36	,	,	PUNCT
brj-23306	456	37	h.	h.	PROPN
brj-23306	456	38	(	(	PUNCT
brj-23306	456	39	2020	2020	NUM
brj-23306	456	40	)	)	PUNCT
brj-23306	456	41	.	.	PUNCT
brj-23306	457	1	“	"	PUNCT
brj-23306	457	2	silver	silver	ADJ
brj-23306	457	3	nanoparticles	nanoparticle	NOUN
brj-23306	457	4	:	:	PUNCT
brj-23306	457	5	synthesis	synthesis	NOUN
brj-23306	457	6	,	,	PUNCT
brj-23306	457	7	medical	medical	ADJ
brj-23306	457	8	applications	application	NOUN
brj-23306	457	9	and	and	CCONJ
brj-23306	457	10	biosafety	biosafety	NOUN
brj-23306	457	11	,	,	PUNCT
brj-23306	457	12	”	"	PUNCT
brj-23306	457	13	theranostics	theranostic	NOUN
brj-23306	457	14	10(20	10(20	NUM
brj-23306	457	15	)	)	PUNCT
brj-23306	457	16	,	,	PUNCT
brj-23306	457	17	8996	8996	NUM
brj-23306	457	18	-	-	SYM
brj-23306	457	19	9031	9031	NUM
brj-23306	457	20	.	.	PUNCT
brj-23306	458	1	doi	doi	NOUN
brj-23306	458	2	:	:	PUNCT
brj-23306	458	3	10.7150	10.7150	NUM
brj-23306	458	4	/	/	SYM
brj-23306	458	5	thno.45413	thno.45413	PROPN
brj-23306	458	6	lee	lee	PROPN
brj-23306	458	7	,	,	PUNCT
brj-23306	458	8	y.	y.	PROPN
brj-23306	458	9	s.	s.	PROPN
brj-23306	458	10	,	,	PUNCT
brj-23306	458	11	kim	kim	PROPN
brj-23306	458	12	,	,	PUNCT
brj-23306	458	13	d.	d.	PROPN
brj-23306	458	14	h.	h.	PROPN
brj-23306	458	15	,	,	PUNCT
brj-23306	458	16	lee	lee	PROPN
brj-23306	458	17	,	,	PUNCT
brj-23306	458	18	y.	y.	PROPN
brj-23306	458	19	h.	h.	PROPN
brj-23306	458	20	,	,	PUNCT
brj-23306	458	21	oh	oh	INTJ
brj-23306	458	22	,	,	PUNCT
brj-23306	458	23	j.	j.	PROPN
brj-23306	458	24	h.	h.	PROPN
brj-23306	458	25	,	,	PUNCT
brj-23306	458	26	yoon	yoon	PROPN
brj-23306	458	27	,	,	PUNCT
brj-23306	458	28	s.	s.	PROPN
brj-23306	458	29	,	,	PUNCT
brj-23306	458	30	choi	choi	NOUN
brj-23306	458	31	,	,	PUNCT
brj-23306	458	32	m.	m.	NOUN
brj-23306	458	33	s.	s.	PROPN
brj-23306	458	34	,	,	PUNCT
brj-23306	458	35	lee	lee	PROPN
brj-23306	458	36	,	,	PUNCT
brj-23306	458	37	s.	s.	PROPN
brj-23306	458	38	k.	k.	PROPN
brj-23306	458	39	,	,	PUNCT
brj-23306	458	40	kim	kim	PROPN
brj-23306	458	41	,	,	PUNCT
brj-23306	458	42	j.	j.	PROPN
brj-23306	458	43	w.	w.	PROPN
brj-23306	458	44	,	,	PUNCT
brj-23306	458	45	lee	lee	PROPN
brj-23306	458	46	,	,	PUNCT
brj-23306	458	47	k.	k.	PROPN
brj-23306	458	48	,	,	PUNCT
brj-23306	458	49	and	and	CCONJ
brj-23306	458	50	song	song	NOUN
brj-23306	458	51	,	,	PUNCT
brj-23306	458	52	c.	c.	PROPN
brj-23306	458	53	(	(	PUNCT
brj-23306	458	54	2011	2011	NUM
brj-23306	458	55	)	)	PUNCT
brj-23306	458	56	.	.	PUNCT
brj-23306	459	1	“	"	PUNCT
brj-23306	459	2	silver	silver	ADJ
brj-23306	459	3	nanoparticles	nanoparticle	NOUN
brj-23306	459	4	induce	induce	VERB
brj-23306	459	5	apoptosis	apoptosis	NOUN
brj-23306	459	6	and	and	CCONJ
brj-23306	459	7	g2	g2	PROPN
brj-23306	459	8	/	/	SYM
brj-23306	459	9	m	m	PROPN
brj-23306	459	10	arrest	arrest	NOUN
brj-23306	459	11	via	via	ADP
brj-23306	459	12	pkcζ	pkcζ	NOUN
brj-23306	459	13	-	-	PUNCT
brj-23306	459	14	dependent	dependent	ADJ
brj-23306	459	15	signaling	signal	VERB
brj-23306	459	16	in	in	ADP
brj-23306	459	17	a549	a549	PROPN
brj-23306	459	18	lung	lung	NOUN
brj-23306	459	19	cells	cell	NOUN
brj-23306	459	20	,	,	PUNCT
brj-23306	459	21	”	"	PUNCT
brj-23306	459	22	archives	archive	NOUN
brj-23306	459	23	of	of	ADP
brj-23306	459	24	toxicology	toxicology	NOUN
brj-23306	459	25	85(12	85(12	NUM
brj-23306	459	26	)	)	PUNCT
brj-23306	459	27	,	,	PUNCT
brj-23306	459	28	1529	1529	NUM
brj-23306	459	29	-	-	SYM
brj-23306	459	30	1540	1540	NUM
brj-23306	459	31	.	.	PUNCT
brj-23306	460	1	doi	doi	NOUN
brj-23306	460	2	:	:	PUNCT
brj-23306	460	3	10.1007	10.1007	NUM
brj-23306	460	4	/	/	SYM
brj-23306	460	5	s00204	s00204	NOUN
brj-23306	460	6	-	-	PUNCT
brj-23306	460	7	011	011	NUM
brj-23306	460	8	-	-	PUNCT
brj-23306	460	9	0714	0714	NUM
brj-23306	460	10	-	-	SYM
brj-23306	460	11	1	1	NUM
brj-23306	460	12	peer	peer	NOUN
brj-23306	460	13	-	-	PUNCT
brj-23306	460	14	reviewed	review	VERB
brj-23306	460	15	article	article	NOUN
brj-23306	460	16	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	460	17	raju	raju	PROPN
brj-23306	460	18	et	et	PROPN
brj-23306	460	19	al	al	PROPN
brj-23306	460	20	.	.	PROPN
brj-23306	460	21	(	(	PUNCT
brj-23306	460	22	2024	2024	NUM
brj-23306	460	23	)	)	PUNCT
brj-23306	460	24	.	.	PUNCT
brj-23306	461	1	“	"	PUNCT
brj-23306	461	2	ag	ag	PROPN
brj-23306	461	3	nanoparticles	nanoparticle	NOUN
brj-23306	461	4	from	from	ADP
brj-23306	461	5	leaves	leave	NOUN
brj-23306	461	6	,	,	PUNCT
brj-23306	461	7	”	"	PUNCT
brj-23306	461	8	bioresources	bioresource	NOUN
brj-23306	461	9	19(2	19(2	NUM
brj-23306	461	10	)	)	PUNCT
brj-23306	461	11	,	,	PUNCT
brj-23306	461	12	3328	3328	NUM
brj-23306	461	13	-	-	SYM
brj-23306	461	14	3352	3352	NUM
brj-23306	461	15	.	.	PUNCT
brj-23306	461	16	3351	3351	NUM
brj-23306	461	17	mathur	mathur	PROPN
brj-23306	461	18	,	,	PUNCT
brj-23306	461	19	p.	p.	PROPN
brj-23306	461	20	,	,	PUNCT
brj-23306	461	21	sathishkumar	sathishkumar	PROPN
brj-23306	461	22	,	,	PUNCT
brj-23306	461	23	k.	k.	PROPN
brj-23306	461	24	,	,	PUNCT
brj-23306	461	25	chaturvedi	chaturvedi	PROPN
brj-23306	461	26	,	,	PUNCT
brj-23306	461	27	m.	m.	NOUN
brj-23306	461	28	,	,	PUNCT
brj-23306	461	29	das	das	PROPN
brj-23306	461	30	,	,	PUNCT
brj-23306	461	31	p.	p.	NOUN
brj-23306	461	32	,	,	PUNCT
brj-23306	461	33	and	and	CCONJ
brj-23306	461	34	stephen	stephen	PROPN
brj-23306	461	35	,	,	PUNCT
brj-23306	461	36	s.	s.	PROPN
brj-23306	461	37	(	(	PUNCT
brj-23306	461	38	2023	2023	NUM
brj-23306	461	39	)	)	PUNCT
brj-23306	461	40	.	.	PUNCT
brj-23306	462	1	“	"	PUNCT
brj-23306	462	2	cancer	cancer	NOUN
brj-23306	462	3	incidence	incidence	NOUN
brj-23306	462	4	estimates	estimate	NOUN
brj-23306	462	5	for	for	ADP
brj-23306	462	6	2022	2022	NUM
brj-23306	462	7	&	&	CCONJ
brj-23306	462	8	projection	projection	NOUN
brj-23306	462	9	for	for	ADP
brj-23306	462	10	2025	2025	NUM
brj-23306	462	11	:	:	PUNCT
brj-23306	462	12	result	result	NOUN
brj-23306	462	13	from	from	ADP
brj-23306	462	14	national	national	ADJ
brj-23306	462	15	cancer	cancer	NOUN
brj-23306	462	16	registry	registry	PROPN
brj-23306	462	17	programme	programme	PROPN
brj-23306	462	18	,	,	PUNCT
brj-23306	462	19	india	india	PROPN
brj-23306	462	20	,	,	PUNCT
brj-23306	462	21	”	"	PUNCT
brj-23306	462	22	indian	indian	ADJ
brj-23306	462	23	journal	journal	NOUN
brj-23306	462	24	of	of	ADP
brj-23306	462	25	medical	medical	ADJ
brj-23306	462	26	research	research	NOUN
brj-23306	462	27	156(4&5	156(4&5	NUM
brj-23306	462	28	)	)	PUNCT
brj-23306	462	29	,	,	PUNCT
brj-23306	462	30	598607	598607	NUM
brj-23306	462	31	.	.	PUNCT
brj-23306	463	1	doi	doi	NOUN
brj-23306	463	2	:	:	PUNCT
brj-23306	463	3	10.4103	10.4103	NUM
brj-23306	463	4	/	/	SYM
brj-23306	463	5	ijmr.ijmr_1821_22	ijmr.ijmr_1821_22	NOUN
brj-23306	463	6	mittal	mittal	ADJ
brj-23306	463	7	,	,	PUNCT
brj-23306	463	8	a.	a.	PROPN
brj-23306	463	9	k.	k.	PROPN
brj-23306	463	10	,	,	PUNCT
brj-23306	463	11	chisti	chisti	PROPN
brj-23306	463	12	,	,	PUNCT
brj-23306	463	13	y.	y.	NOUN
brj-23306	463	14	,	,	PUNCT
brj-23306	463	15	and	and	CCONJ
brj-23306	463	16	banerjee	banerjee	PROPN
brj-23306	463	17	,	,	PUNCT
brj-23306	463	18	u.	u.	PROPN
brj-23306	463	19	c.	c.	PROPN
brj-23306	463	20	(	(	PUNCT
brj-23306	463	21	2013	2013	NUM
brj-23306	463	22	)	)	PUNCT
brj-23306	463	23	.	.	PUNCT
brj-23306	464	1	“	"	PUNCT
brj-23306	464	2	synthesis	synthesis	NOUN
brj-23306	464	3	of	of	ADP
brj-23306	464	4	metallic	metallic	ADJ
brj-23306	464	5	nanoparticles	nanoparticle	NOUN
brj-23306	464	6	using	use	VERB
brj-23306	464	7	plant	plant	NOUN
brj-23306	464	8	extracts	extract	NOUN
brj-23306	464	9	,	,	PUNCT
brj-23306	464	10	”	"	PUNCT
brj-23306	464	11	biotechnology	biotechnology	NOUN
brj-23306	464	12	advances	advance	VERB
brj-23306	464	13	31(2	31(2	NUM
brj-23306	464	14	)	)	PUNCT
brj-23306	464	15	,	,	PUNCT
brj-23306	464	16	346	346	NUM
brj-23306	464	17	-	-	SYM
brj-23306	464	18	356	356	NUM
brj-23306	464	19	.	.	PUNCT
brj-23306	465	1	doi	doi	NOUN
brj-23306	465	2	:	:	PUNCT
brj-23306	465	3	10.1016	10.1016	NUM
brj-23306	465	4	/	/	SYM
brj-23306	465	5	j.biotechadv.2013.01.003	j.biotechadv.2013.01.003	PROPN
brj-23306	465	6	medina	medina	PROPN
brj-23306	465	7	-	-	PUNCT
brj-23306	465	8	cruz	cruz	PROPN
brj-23306	465	9	,	,	PUNCT
brj-23306	465	10	d.	d.	PROPN
brj-23306	465	11	,	,	PUNCT
brj-23306	465	12	vernet	vernet	NOUN
brj-23306	465	13	-	-	PUNCT
brj-23306	465	14	crua	crua	PROPN
brj-23306	465	15	,	,	PUNCT
brj-23306	465	16	a.	a.	NOUN
brj-23306	465	17	,	,	PUNCT
brj-23306	465	18	mostafavi	mostafavi	PROPN
brj-23306	465	19	,	,	PUNCT
brj-23306	465	20	e.	e.	PROPN
brj-23306	465	21	,	,	PUNCT
brj-23306	465	22	gonzález	gonzález	PROPN
brj-23306	465	23	,	,	PUNCT
brj-23306	465	24	m.	m.	NOUN
brj-23306	465	25	u.	u.	PROPN
brj-23306	465	26	,	,	PUNCT
brj-23306	465	27	martínez	martínez	PROPN
brj-23306	465	28	,	,	PUNCT
brj-23306	465	29	l.	l.	PROPN
brj-23306	465	30	,	,	PUNCT
brj-23306	465	31	jones	jones	PROPN
brj-23306	465	32	,	,	PUNCT
brj-23306	465	33	a.-a	a.-a	PROPN
brj-23306	465	34	.	.	PUNCT
brj-23306	466	1	d.	d.	PROPN
brj-23306	466	2	,	,	PUNCT
brj-23306	466	3	kusper	kusper	PROPN
brj-23306	466	4	,	,	PUNCT
brj-23306	466	5	m.	m.	NOUN
brj-23306	466	6	,	,	PUNCT
brj-23306	466	7	sotelo	sotelo	ADJ
brj-23306	466	8	,	,	PUNCT
brj-23306	466	9	e.	e.	PROPN
brj-23306	466	10	,	,	PUNCT
brj-23306	466	11	gao	gao	PROPN
brj-23306	466	12	,	,	PUNCT
brj-23306	466	13	m.	m.	NOUN
brj-23306	466	14	,	,	PUNCT
brj-23306	466	15	geoffrion	geoffrion	NOUN
brj-23306	466	16	,	,	PUNCT
brj-23306	466	17	l.	l.	PROPN
brj-23306	466	18	d.	d.	PROPN
brj-23306	466	19	,	,	PUNCT
brj-23306	466	20	shah	shah	PROPN
brj-23306	466	21	,	,	PUNCT
brj-23306	466	22	v.	v.	ADV
brj-23306	466	23	,	,	PUNCT
brj-23306	466	24	guisbiers	guisbier	NOUN
brj-23306	466	25	,	,	PUNCT
brj-23306	466	26	g.	g.	PROPN
brj-23306	466	27	,	,	PUNCT
brj-23306	466	28	cholula	cholula	NOUN
brj-23306	466	29	-	-	PUNCT
brj-23306	466	30	díaz	díaz	NOUN
brj-23306	466	31	,	,	PUNCT
brj-23306	466	32	j.	j.	PROPN
brj-23306	466	33	l.	l.	PROPN
brj-23306	466	34	,	,	PUNCT
brj-23306	466	35	guillermier	guillermier	NOUN
brj-23306	466	36	,	,	PUNCT
brj-23306	466	37	c.	c.	PROPN
brj-23306	466	38	,	,	PUNCT
brj-23306	466	39	khanom	khanom	PROPN
brj-23306	466	40	,	,	PUNCT
brj-23306	466	41	f.	f.	PROPN
brj-23306	466	42	,	,	PUNCT
brj-23306	466	43	huttel	huttel	NOUN
brj-23306	466	44	,	,	PUNCT
brj-23306	466	45	y.	y.	NOUN
brj-23306	466	46	,	,	PUNCT
brj-23306	466	47	garcía	garcía	NOUN
brj-23306	466	48	-	-	PUNCT
brj-23306	466	49	martín	martín	NOUN
brj-23306	466	50	,	,	PUNCT
brj-23306	466	51	j.	j.	PROPN
brj-23306	466	52	m.	m.	PROPN
brj-23306	466	53	,	,	PUNCT
brj-23306	466	54	and	and	CCONJ
brj-23306	466	55	webster	webster	PROPN
brj-23306	466	56	,	,	PUNCT
brj-23306	466	57	t.	t.	PROPN
brj-23306	466	58	j.	j.	PROPN
brj-23306	466	59	(	(	PUNCT
brj-23306	466	60	2021	2021	NUM
brj-23306	466	61	)	)	PUNCT
brj-23306	466	62	.	.	PUNCT
brj-23306	467	1	“	"	PUNCT
brj-23306	467	2	aloe	aloe	PROPN
brj-23306	467	3	vera	vera	NOUN
brj-23306	467	4	-	-	PUNCT
brj-23306	467	5	mediated	mediate	VERB
brj-23306	467	6	te	te	ADP
brj-23306	467	7	nanostructures	nanostructure	NOUN
brj-23306	467	8	:	:	PUNCT
brj-23306	467	9	highly	highly	ADV
brj-23306	467	10	potent	potent	ADJ
brj-23306	467	11	antibacterial	antibacterial	ADJ
brj-23306	467	12	agents	agent	NOUN
brj-23306	467	13	and	and	CCONJ
brj-23306	467	14	moderated	moderated	ADJ
brj-23306	467	15	anticancer	anticancer	NOUN
brj-23306	467	16	effects	effect	NOUN
brj-23306	467	17	,	,	PUNCT
brj-23306	467	18	”	"	PUNCT
brj-23306	467	19	nanomaterials	nanomaterial	NOUN
brj-23306	467	20	11(2	11(2	NOUN
brj-23306	467	21	)	)	PUNCT
brj-23306	467	22	,	,	PUNCT
brj-23306	467	23	article	article	NOUN
brj-23306	467	24	514	514	NUM
brj-23306	467	25	.	.	PUNCT
brj-23306	468	1	doi	doi	NOUN
brj-23306	468	2	:	:	PUNCT
brj-23306	468	3	10.3390	10.3390	NUM
brj-23306	468	4	/	/	SYM
brj-23306	468	5	nano11020514	nano11020514	NOUN
brj-23306	468	6	mohammadi	mohammadi	NOUN
brj-23306	468	7	,	,	PUNCT
brj-23306	468	8	m.	m.	NOUN
brj-23306	468	9	,	,	PUNCT
brj-23306	468	10	zaki	zaki	PROPN
brj-23306	468	11	,	,	PUNCT
brj-23306	468	12	l.	l.	PROPN
brj-23306	468	13	,	,	PUNCT
brj-23306	468	14	karimipoursaryazdi	karimipoursaryazdi	PROPN
brj-23306	468	15	,	,	PUNCT
brj-23306	468	16	a.	a.	NOUN
brj-23306	468	17	,	,	PUNCT
brj-23306	468	18	tavakoli	tavakoli	NOUN
brj-23306	468	19	,	,	PUNCT
brj-23306	468	20	p.	p.	PROPN
brj-23306	468	21	,	,	PUNCT
brj-23306	468	22	tavajjohi	tavajjohi	PROPN
brj-23306	468	23	,	,	PUNCT
brj-23306	468	24	a.	a.	NOUN
brj-23306	468	25	,	,	PUNCT
brj-23306	468	26	poursalehi	poursalehi	PROPN
brj-23306	468	27	,	,	PUNCT
brj-23306	468	28	r.	r.	PROPN
brj-23306	468	29	,	,	PUNCT
brj-23306	468	30	delavari	delavari	PROPN
brj-23306	468	31	,	,	PUNCT
brj-23306	468	32	h.	h.	PROPN
brj-23306	468	33	,	,	PUNCT
brj-23306	468	34	and	and	CCONJ
brj-23306	468	35	ghaffarifar	ghaffarifar	NOUN
brj-23306	468	36	,	,	PUNCT
brj-23306	468	37	f.	f.	PROPN
brj-23306	468	38	(	(	PUNCT
brj-23306	468	39	2021	2021	NUM
brj-23306	468	40	)	)	PUNCT
brj-23306	468	41	.	.	PUNCT
brj-23306	469	1	“	"	PUNCT
brj-23306	469	2	efficacy	efficacy	NOUN
brj-23306	469	3	of	of	ADP
brj-23306	469	4	green	green	ADJ
brj-23306	469	5	synthesized	synthesize	VERB
brj-23306	469	6	silver	silver	ADJ
brj-23306	469	7	nanoparticles	nanoparticle	NOUN
brj-23306	469	8	via	via	ADP
brj-23306	469	9	ginger	ginger	NOUN
brj-23306	469	10	rhizome	rhizome	NOUN
brj-23306	469	11	extract	extract	VERB
brj-23306	469	12	against	against	ADP
brj-23306	469	13	leishmania	leishmania	NOUN
brj-23306	469	14	major	major	NOUN
brj-23306	469	15	in	in	ADP
brj-23306	469	16	vitro	vitro	NOUN
brj-23306	469	17	,	,	PUNCT
brj-23306	469	18	”	"	PUNCT
brj-23306	469	19	plos	plos	PROPN
brj-23306	469	20	one	one	NUM
brj-23306	469	21	16(8	16(8	NUM
brj-23306	469	22	)	)	PUNCT
brj-23306	469	23	,	,	PUNCT
brj-23306	469	24	article	article	NOUN
brj-23306	469	25	i	i	PROPN
brj-23306	469	26	d	d	PROPN
brj-23306	469	27	e0255571	e0255571	PROPN
brj-23306	469	28	.	.	PUNCT
brj-23306	470	1	doi	doi	NOUN
brj-23306	470	2	:	:	PUNCT
brj-23306	470	3	10.1371	10.1371	NUM
brj-23306	470	4	/	/	SYM
brj-23306	470	5	journal.pone.0255571	journal.pone.0255571	PROPN
brj-23306	470	6	mejía	mejía	PROPN
brj-23306	470	7	-	-	PUNCT
brj-23306	470	8	mendez	mendez	PROPN
brj-23306	470	9	,	,	PUNCT
brj-23306	470	10	j.	j.	PROPN
brj-23306	470	11	l.	l.	PROPN
brj-23306	470	12	,	,	PUNCT
brj-23306	470	13	lopez	lopez	NOUN
brj-23306	470	14	-	-	PUNCT
brj-23306	470	15	mena	mena	PROPN
brj-23306	470	16	,	,	PUNCT
brj-23306	470	17	e.	e.	PROPN
brj-23306	470	18	r.	r.	PROPN
brj-23306	470	19	,	,	PUNCT
brj-23306	470	20	and	and	CCONJ
brj-23306	470	21	sanchez‐arreola	sanchez‐arreola	PROPN
brj-23306	470	22	,	,	PUNCT
brj-23306	470	23	e.	e.	PROPN
brj-23306	470	24	(	(	PUNCT
brj-23306	470	25	2023	2023	NUM
brj-23306	470	26	)	)	PUNCT
brj-23306	470	27	.	.	PUNCT
brj-23306	471	1	“	"	PUNCT
brj-23306	471	2	activities	activity	NOUN
brj-23306	471	3	against	against	ADP
brj-23306	471	4	lung	lung	NOUN
brj-23306	471	5	cancer	cancer	NOUN
brj-23306	471	6	of	of	ADP
brj-23306	471	7	biosynthesized	biosynthesize	VERB
brj-23306	471	8	silver	silver	ADJ
brj-23306	471	9	nanoparticles	nanoparticle	NOUN
brj-23306	471	10	:	:	PUNCT
brj-23306	471	11	a	a	DET
brj-23306	471	12	review	review	NOUN
brj-23306	471	13	,	,	PUNCT
brj-23306	471	14	”	"	PUNCT
brj-23306	471	15	biomedicines	biomedicine	VERB
brj-23306	471	16	11(2	11(2	NOUN
brj-23306	471	17	)	)	PUNCT
brj-23306	471	18	,	,	PUNCT
brj-23306	471	19	article	article	NOUN
brj-23306	471	20	389	389	NUM
brj-23306	471	21	.	.	PUNCT
brj-23306	472	1	doi	doi	NOUN
brj-23306	472	2	:	:	PUNCT
brj-23306	472	3	10.3390	10.3390	NUM
brj-23306	472	4	/	/	SYM
brj-23306	472	5	biomedicines11020389	biomedicines11020389	PROPN
brj-23306	472	6	mosmann	mosmann	PROPN
brj-23306	472	7	,	,	PUNCT
brj-23306	472	8	t.	t.	PROPN
brj-23306	472	9	r.	r.	PROPN
brj-23306	472	10	(	(	PUNCT
brj-23306	472	11	1983	1983	NUM
brj-23306	472	12	)	)	PUNCT
brj-23306	472	13	.	.	PUNCT
brj-23306	473	1	“	"	PUNCT
brj-23306	473	2	rapid	rapid	ADJ
brj-23306	473	3	colorimetric	colorimetric	ADJ
brj-23306	473	4	assay	assay	NOUN
brj-23306	473	5	for	for	ADP
brj-23306	473	6	cellular	cellular	ADJ
brj-23306	473	7	growth	growth	NOUN
brj-23306	473	8	and	and	CCONJ
brj-23306	473	9	survival	survival	NOUN
brj-23306	473	10	:	:	PUNCT
brj-23306	473	11	application	application	NOUN
brj-23306	473	12	to	to	ADP
brj-23306	473	13	proliferation	proliferation	NOUN
brj-23306	473	14	and	and	CCONJ
brj-23306	473	15	cytotoxicity	cytotoxicity	NOUN
brj-23306	473	16	assays	assay	NOUN
brj-23306	473	17	,	,	PUNCT
brj-23306	473	18	”	"	PUNCT
brj-23306	473	19	journal	journal	NOUN
brj-23306	473	20	of	of	ADP
brj-23306	473	21	immunological	immunological	ADJ
brj-23306	473	22	methods	method	NOUN
brj-23306	473	23	65(1–2	65(1–2	PROPN
brj-23306	473	24	)	)	PUNCT
brj-23306	473	25	,	,	PUNCT
brj-23306	473	26	55	55	NUM
brj-23306	473	27	-	-	SYM
brj-23306	473	28	63	63	NUM
brj-23306	473	29	.	.	PUNCT
brj-23306	474	1	doi	doi	NOUN
brj-23306	474	2	:	:	PUNCT
brj-23306	474	3	10.1016/0022	10.1016/0022	NUM
brj-23306	474	4	-	-	SYM
brj-23306	474	5	1759(83)90303	1759(83)90303	NUM
brj-23306	474	6	-	-	SYM
brj-23306	474	7	4	4	NUM
brj-23306	474	8	mourdikoudis	mourdikoudis	NOUN
brj-23306	474	9	,	,	PUNCT
brj-23306	474	10	s.	s.	PROPN
brj-23306	474	11	,	,	PUNCT
brj-23306	474	12	pallares	pallare	VERB
brj-23306	474	13	,	,	PUNCT
brj-23306	474	14	r.	r.	PROPN
brj-23306	474	15	m.	m.	PROPN
brj-23306	474	16	,	,	PUNCT
brj-23306	474	17	and	and	CCONJ
brj-23306	474	18	thanh	thanh	VERB
brj-23306	474	19	,	,	PUNCT
brj-23306	474	20	n.	n.	PROPN
brj-23306	474	21	t.	t.	PROPN
brj-23306	474	22	k.	k.	PROPN
brj-23306	474	23	(	(	PUNCT
brj-23306	474	24	2018	2018	NUM
brj-23306	474	25	)	)	PUNCT
brj-23306	474	26	.	.	PUNCT
brj-23306	475	1	“	"	PUNCT
brj-23306	475	2	characterization	characterization	NOUN
brj-23306	475	3	techniques	technique	NOUN
brj-23306	475	4	for	for	ADP
brj-23306	475	5	nanoparticles	nanoparticle	NOUN
brj-23306	475	6	:	:	PUNCT
brj-23306	475	7	comparison	comparison	NOUN
brj-23306	475	8	and	and	CCONJ
brj-23306	475	9	complementarity	complementarity	NOUN
brj-23306	475	10	upon	upon	SCONJ
brj-23306	475	11	studying	study	VERB
brj-23306	475	12	nanoparticle	nanoparticle	NOUN
brj-23306	475	13	properties	property	NOUN
brj-23306	475	14	,	,	PUNCT
brj-23306	475	15	”	"	PUNCT
brj-23306	475	16	nanoscale	nanoscale	NOUN
brj-23306	475	17	10(27	10(27	NUM
brj-23306	475	18	)	)	PUNCT
brj-23306	475	19	,	,	PUNCT
brj-23306	475	20	12871	12871	NUM
brj-23306	475	21	-	-	SYM
brj-23306	475	22	12934	12934	NUM
brj-23306	475	23	.	.	PUNCT
brj-23306	476	1	doi	doi	NOUN
brj-23306	476	2	:	:	PUNCT
brj-23306	476	3	10.1039	10.1039	NUM
brj-23306	476	4	/	/	SYM
brj-23306	476	5	c8nr02278j	c8nr02278j	PROPN
brj-23306	476	6	plotnikov	plotnikov	PROPN
brj-23306	476	7	,	,	PUNCT
brj-23306	476	8	e.	e.	PROPN
brj-23306	476	9	,	,	PUNCT
brj-23306	476	10	tretayakova	tretayakova	PROPN
brj-23306	476	11	,	,	PUNCT
brj-23306	476	12	m.	m.	NOUN
brj-23306	476	13	s.	s.	PROPN
brj-23306	476	14	,	,	PUNCT
brj-23306	476	15	garibo	garibo	NOUN
brj-23306	476	16	-	-	PUNCT
brj-23306	476	17	ruíz	ruíz	NOUN
brj-23306	476	18	,	,	PUNCT
brj-23306	476	19	d.	d.	PROPN
brj-23306	476	20	,	,	PUNCT
brj-23306	476	21	rodríguez	rodríguez	NOUN
brj-23306	476	22	-	-	PUNCT
brj-23306	476	23	hernández	hernández	PROPN
brj-23306	476	24	,	,	PUNCT
brj-23306	476	25	a.	a.	NOUN
brj-23306	476	26	g.	g.	PROPN
brj-23306	476	27	,	,	PUNCT
brj-23306	476	28	pestryakov	pestryakov	PROPN
brj-23306	476	29	,	,	PUNCT
brj-23306	476	30	a.	a.	NOUN
brj-23306	476	31	,	,	PUNCT
brj-23306	476	32	toledano	toledano	PROPN
brj-23306	476	33	-	-	PUNCT
brj-23306	476	34	magaña	magaña	VERB
brj-23306	476	35	,	,	PUNCT
brj-23306	476	36	y.	y.	PROPN
brj-23306	476	37	,	,	PUNCT
brj-23306	476	38	and	and	CCONJ
brj-23306	476	39	bogdanchikova	bogdanchikova	PROPN
brj-23306	476	40	,	,	PUNCT
brj-23306	476	41	n.	n.	NOUN
brj-23306	476	42	(	(	PUNCT
brj-23306	476	43	2023	2023	NUM
brj-23306	476	44	)	)	PUNCT
brj-23306	476	45	.	.	PUNCT
brj-23306	477	1	“	"	PUNCT
brj-23306	477	2	a	a	DET
brj-23306	477	3	comparative	comparative	ADJ
brj-23306	477	4	study	study	NOUN
brj-23306	477	5	of	of	ADP
brj-23306	477	6	cancer	cancer	NOUN
brj-23306	477	7	cells	cell	NOUN
brj-23306	477	8	susceptibility	susceptibility	NOUN
brj-23306	477	9	to	to	ADP
brj-23306	477	10	silver	silver	ADJ
brj-23306	477	11	nanoparticles	nanoparticle	NOUN
brj-23306	477	12	produced	produce	VERB
brj-23306	477	13	by	by	ADP
brj-23306	477	14	electron	electron	NOUN
brj-23306	477	15	beam	beam	NOUN
brj-23306	477	16	,	,	PUNCT
brj-23306	477	17	”	"	PUNCT
brj-23306	477	18	pharmaceutics	pharmaceutic	NOUN
brj-23306	477	19	15(3	15(3	NUM
brj-23306	477	20	)	)	PUNCT
brj-23306	477	21	,	,	PUNCT
brj-23306	477	22	article	article	NOUN
brj-23306	477	23	962	962	NUM
brj-23306	477	24	.	.	PUNCT
brj-23306	478	1	doi	doi	NOUN
brj-23306	478	2	:	:	PUNCT
brj-23306	478	3	10.3390	10.3390	NUM
brj-23306	478	4	/	/	SYM
brj-23306	478	5	pharmaceutics15030962	pharmaceutics15030962	NOUN
brj-23306	478	6	rezazadeh	rezazadeh	PROPN
brj-23306	478	7	,	,	PUNCT
brj-23306	478	8	m.	m.	NOUN
brj-23306	478	9	,	,	PUNCT
brj-23306	478	10	davatsaz	davatsaz	PROPN
brj-23306	478	11	,	,	PUNCT
brj-23306	478	12	z.	z.	PROPN
brj-23306	478	13	,	,	PUNCT
brj-23306	478	14	emami	emami	PROPN
brj-23306	478	15	,	,	PUNCT
brj-23306	478	16	j.	j.	PROPN
brj-23306	478	17	,	,	PUNCT
brj-23306	478	18	hasanzadeh	hasanzadeh	PROPN
brj-23306	478	19	,	,	PUNCT
brj-23306	478	20	f.	f.	PROPN
brj-23306	478	21	,	,	PUNCT
brj-23306	478	22	and	and	CCONJ
brj-23306	478	23	jahanian	jahanian	ADJ
brj-23306	478	24	-	-	PUNCT
brj-23306	478	25	najafabadi	najafabadi	NOUN
brj-23306	478	26	,	,	PUNCT
brj-23306	478	27	a.	a.	NOUN
brj-23306	478	28	(	(	PUNCT
brj-23306	478	29	2018	2018	NUM
brj-23306	478	30	)	)	PUNCT
brj-23306	478	31	.	.	PUNCT
brj-23306	479	1	“	"	PUNCT
brj-23306	479	2	preparation	preparation	NOUN
brj-23306	479	3	and	and	CCONJ
brj-23306	479	4	characterization	characterization	NOUN
brj-23306	479	5	of	of	ADP
brj-23306	479	6	spray	spray	NOUN
brj-23306	479	7	-	-	PUNCT
brj-23306	479	8	dried	dry	VERB
brj-23306	479	9	inhalable	inhalable	ADJ
brj-23306	479	10	powders	powder	NOUN
brj-23306	479	11	containing	contain	VERB
brj-23306	479	12	polymeric	polymeric	ADJ
brj-23306	479	13	micelles	micelle	NOUN
brj-23306	479	14	for	for	ADP
brj-23306	479	15	pulmonary	pulmonary	ADJ
brj-23306	479	16	delivery	delivery	NOUN
brj-23306	479	17	of	of	ADP
brj-23306	479	18	paclitaxel	paclitaxel	PROPN
brj-23306	479	19	in	in	ADP
brj-23306	479	20	lung	lung	NOUN
brj-23306	479	21	cancer	cancer	NOUN
brj-23306	479	22	,	,	PUNCT
brj-23306	479	23	”	"	PUNCT
brj-23306	479	24	journal	journal	NOUN
brj-23306	479	25	of	of	ADP
brj-23306	479	26	pharmacy	pharmacy	NOUN
brj-23306	479	27	and	and	CCONJ
brj-23306	479	28	pharmaceutical	pharmaceutical	NOUN
brj-23306	479	29	sciences	science	NOUN
brj-23306	479	30	21(1s	21(1s	NUM
brj-23306	479	31	)	)	PUNCT
brj-23306	479	32	,	,	PUNCT
brj-23306	479	33	200s-214s	200s-214s	NUM
brj-23306	479	34	.	.	PUNCT
brj-23306	480	1	doi	doi	NOUN
brj-23306	480	2	:	:	PUNCT
brj-23306	480	3	10.18433	10.18433	NUM
brj-23306	480	4	/	/	SYM
brj-23306	480	5	jpps30048	jpps30048	NOUN
brj-23306	480	6	sakr	sakr	NOUN
brj-23306	480	7	,	,	PUNCT
brj-23306	480	8	t.	t.	NOUN
brj-23306	480	9	m.	m.	NOUN
brj-23306	480	10	,	,	PUNCT
brj-23306	480	11	khowessah	khowessah	NOUN
brj-23306	480	12	,	,	PUNCT
brj-23306	480	13	o.	o.	NOUN
brj-23306	480	14	m.	m.	NOUN
brj-23306	480	15	,	,	PUNCT
brj-23306	480	16	motaleb	motaleb	PROPN
brj-23306	480	17	,	,	PUNCT
brj-23306	480	18	m.	m.	NOUN
brj-23306	480	19	a.	a.	PROPN
brj-23306	480	20	,	,	PUNCT
brj-23306	480	21	el	el	PROPN
brj-23306	480	22	-	-	PUNCT
brj-23306	480	23	bary	bary	PROPN
brj-23306	480	24	,	,	PUNCT
brj-23306	480	25	a.	a.	NOUN
brj-23306	480	26	a.	a.	PROPN
brj-23306	480	27	,	,	PUNCT
brj-23306	480	28	el	el	PROPN
brj-23306	480	29	-	-	PROPN
brj-23306	480	30	kolaly	kolaly	PROPN
brj-23306	480	31	,	,	PUNCT
brj-23306	480	32	m.	m.	NOUN
brj-23306	480	33	t.	t.	PROPN
brj-23306	480	34	,	,	PUNCT
brj-23306	480	35	and	and	CCONJ
brj-23306	480	36	swidan	swidan	NOUN
brj-23306	480	37	,	,	PUNCT
brj-23306	480	38	m.	m.	NOUN
brj-23306	480	39	m.	m.	NOUN
brj-23306	480	40	(	(	PUNCT
brj-23306	480	41	2018	2018	NUM
brj-23306	480	42	)	)	PUNCT
brj-23306	480	43	.	.	PUNCT
brj-23306	481	1	“	"	PUNCT
brj-23306	481	2	i-131	i-131	X
brj-23306	481	3	doping	doping	NOUN
brj-23306	481	4	of	of	ADP
brj-23306	481	5	silver	silver	ADJ
brj-23306	481	6	nanoparticles	nanoparticle	NOUN
brj-23306	481	7	platform	platform	NOUN
brj-23306	481	8	for	for	ADP
brj-23306	481	9	tumor	tumor	NOUN
brj-23306	481	10	theranosis	theranosis	NOUN
brj-23306	481	11	guided	guide	VERB
brj-23306	481	12	drug	drug	NOUN
brj-23306	481	13	delivery	delivery	NOUN
brj-23306	481	14	,	,	PUNCT
brj-23306	481	15	”	"	PUNCT
brj-23306	481	16	european	european	PROPN
brj-23306	481	17	journal	journal	PROPN
brj-23306	481	18	of	of	ADP
brj-23306	481	19	pharmaceutical	pharmaceutical	PROPN
brj-23306	481	20	sciences	science	NOUN
brj-23306	481	21	122	122	NUM
brj-23306	481	22	,	,	PUNCT
brj-23306	481	23	239	239	NUM
brj-23306	481	24	-	-	SYM
brj-23306	481	25	245	245	NUM
brj-23306	481	26	.	.	PUNCT
brj-23306	482	1	doi	doi	NOUN
brj-23306	482	2	:	:	PUNCT
brj-23306	482	3	10.1016	10.1016	NUM
brj-23306	482	4	/	/	SYM
brj-23306	482	5	j.ejps.2018.06.029	j.ejps.2018.06.029	PROPN
brj-23306	482	6	shehabeldine	shehabeldine	PROPN
brj-23306	482	7	,	,	PUNCT
brj-23306	482	8	a.	a.	NOUN
brj-23306	482	9	m.	m.	NOUN
brj-23306	482	10	,	,	PUNCT
brj-23306	482	11	salem	salem	PROPN
brj-23306	482	12	,	,	PUNCT
brj-23306	482	13	s.	s.	PROPN
brj-23306	482	14	s.	s.	PROPN
brj-23306	482	15	,	,	PUNCT
brj-23306	482	16	ali	ali	PROPN
brj-23306	482	17	,	,	PUNCT
brj-23306	482	18	o.	o.	PROPN
brj-23306	482	19	m.	m.	NOUN
brj-23306	482	20	,	,	PUNCT
brj-23306	482	21	abd	abd	PROPN
brj-23306	482	22	-	-	PUNCT
brj-23306	482	23	elsalam	elsalam	PROPN
brj-23306	482	24	,	,	PUNCT
brj-23306	482	25	k.	k.	PROPN
brj-23306	482	26	a.	a.	PROPN
brj-23306	482	27	,	,	PUNCT
brj-23306	482	28	elkady	elkady	PROPN
brj-23306	482	29	,	,	PUNCT
brj-23306	482	30	f.	f.	PROPN
brj-23306	482	31	m.	m.	PROPN
brj-23306	482	32	,	,	PUNCT
brj-23306	482	33	and	and	CCONJ
brj-23306	482	34	hashem	hashem	PROPN
brj-23306	482	35	,	,	PUNCT
brj-23306	482	36	a.	a.	PROPN
brj-23306	482	37	h.	h.	PROPN
brj-23306	482	38	(	(	PUNCT
brj-23306	482	39	2022	2022	NUM
brj-23306	482	40	)	)	PUNCT
brj-23306	482	41	.	.	PUNCT
brj-23306	483	1	“	"	PUNCT
brj-23306	483	2	multifunctional	multifunctional	ADJ
brj-23306	483	3	silver	silver	ADJ
brj-23306	483	4	nanoparticles	nanoparticle	NOUN
brj-23306	483	5	based	base	VERB
brj-23306	483	6	on	on	ADP
brj-23306	483	7	chitosan	chitosan	NOUN
brj-23306	483	8	:	:	PUNCT
brj-23306	483	9	antibacterial	antibacterial	ADJ
brj-23306	483	10	,	,	PUNCT
brj-23306	483	11	antibiofilm	antibiofilm	NOUN
brj-23306	483	12	,	,	PUNCT
brj-23306	483	13	antifungal	antifungal	PROPN
brj-23306	483	14	,	,	PUNCT
brj-23306	483	15	antioxidant	antioxidant	NOUN
brj-23306	483	16	,	,	PUNCT
brj-23306	483	17	and	and	CCONJ
brj-23306	483	18	wound	wound	NOUN
brj-23306	483	19	-	-	PUNCT
brj-23306	483	20	healing	healing	NOUN
brj-23306	483	21	activities	activity	NOUN
brj-23306	483	22	,	,	PUNCT
brj-23306	483	23	”	"	PUNCT
brj-23306	483	24	journal	journal	NOUN
brj-23306	483	25	of	of	ADP
brj-23306	483	26	fungi	fungi	PROPN
brj-23306	483	27	8(6	8(6	NUM
brj-23306	483	28	)	)	PUNCT
brj-23306	483	29	,	,	PUNCT
brj-23306	483	30	article	article	NOUN
brj-23306	483	31	612	612	NUM
brj-23306	483	32	.	.	PUNCT
brj-23306	484	1	doi	doi	NOUN
brj-23306	484	2	:	:	PUNCT
brj-23306	484	3	10.3390	10.3390	NUM
brj-23306	484	4	/	/	SYM
brj-23306	484	5	jof8060612	jof8060612	NOUN
brj-23306	484	6	takáč	takáč	NOUN
brj-23306	484	7	,	,	PUNCT
brj-23306	484	8	p.	p.	NOUN
brj-23306	484	9	,	,	PUNCT
brj-23306	484	10	michalková	michalková	PROPN
brj-23306	484	11	,	,	PUNCT
brj-23306	484	12	r.	r.	PROPN
brj-23306	484	13	,	,	PUNCT
brj-23306	484	14	čižmáriková	čižmáriková	PROPN
brj-23306	484	15	,	,	PUNCT
brj-23306	484	16	m.	m.	NOUN
brj-23306	484	17	,	,	PUNCT
brj-23306	484	18	bedlovičová	bedlovičová	X
brj-23306	484	19	,	,	PUNCT
brj-23306	484	20	z.	z.	PROPN
brj-23306	484	21	,	,	PUNCT
brj-23306	484	22	balážová	balážová	X
brj-23306	484	23	,	,	PUNCT
brj-23306	484	24	ľ	ľ	PROPN
brj-23306	484	25	.	.	NOUN
brj-23306	484	26	,	,	PUNCT
brj-23306	484	27	and	and	CCONJ
brj-23306	484	28	takáčová	takáčová	NOUN
brj-23306	484	29	,	,	PUNCT
brj-23306	484	30	g.	g.	PROPN
brj-23306	484	31	(	(	PUNCT
brj-23306	484	32	2023	2023	NUM
brj-23306	484	33	)	)	PUNCT
brj-23306	484	34	.	.	PUNCT
brj-23306	485	1	“	"	PUNCT
brj-23306	485	2	the	the	DET
brj-23306	485	3	role	role	NOUN
brj-23306	485	4	of	of	ADP
brj-23306	485	5	silver	silver	ADJ
brj-23306	485	6	nanoparticles	nanoparticle	NOUN
brj-23306	485	7	in	in	ADP
brj-23306	485	8	the	the	DET
brj-23306	485	9	diagnosis	diagnosis	NOUN
brj-23306	485	10	and	and	CCONJ
brj-23306	485	11	treatment	treatment	NOUN
brj-23306	485	12	peer	peer	NOUN
brj-23306	485	13	-	-	PUNCT
brj-23306	485	14	reviewed	review	VERB
brj-23306	485	15	article	article	NOUN
brj-23306	485	16	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23306	485	17	raju	raju	PROPN
brj-23306	485	18	et	et	PROPN
brj-23306	485	19	al	al	PROPN
brj-23306	485	20	.	.	PROPN
brj-23306	486	1	(	(	PUNCT
brj-23306	486	2	2024	2024	NUM
brj-23306	486	3	)	)	PUNCT
brj-23306	486	4	.	.	PUNCT
brj-23306	487	1	“	"	PUNCT
brj-23306	487	2	ag	ag	PROPN
brj-23306	487	3	nanoparticles	nanoparticle	NOUN
brj-23306	487	4	from	from	ADP
brj-23306	487	5	leaves	leave	NOUN
brj-23306	487	6	,	,	PUNCT
brj-23306	487	7	”	"	PUNCT
brj-23306	487	8	bioresources	bioresource	NOUN
brj-23306	487	9	19(2	19(2	NUM
brj-23306	487	10	)	)	PUNCT
brj-23306	487	11	,	,	PUNCT
brj-23306	487	12	3328	3328	NUM
brj-23306	487	13	-	-	SYM
brj-23306	487	14	3352	3352	NUM
brj-23306	487	15	.	.	PUNCT
brj-23306	487	16	3352	3352	NUM
brj-23306	487	17	of	of	ADP
brj-23306	487	18	cancer	cancer	NOUN
brj-23306	487	19	:	:	PUNCT
brj-23306	487	20	are	be	AUX
brj-23306	487	21	there	there	PRON
brj-23306	487	22	any	any	DET
brj-23306	487	23	perspectives	perspective	NOUN
brj-23306	487	24	for	for	ADP
brj-23306	487	25	the	the	DET
brj-23306	487	26	future	future	NOUN
brj-23306	487	27	?	?	PUNCT
brj-23306	487	28	,	,	PUNCT
brj-23306	487	29	”	"	PUNCT
brj-23306	487	30	life	life	NOUN
brj-23306	487	31	13(2	13(2	NOUN
brj-23306	487	32	)	)	PUNCT
brj-23306	487	33	,	,	PUNCT
brj-23306	487	34	article	article	NOUN
brj-23306	487	35	466	466	NUM
brj-23306	487	36	.	.	PUNCT
brj-23306	488	1	doi	doi	NOUN
brj-23306	488	2	:	:	PUNCT
brj-23306	488	3	10.3390	10.3390	NUM
brj-23306	488	4	/	/	SYM
brj-23306	488	5	life13020466	life13020466	PROPN
brj-23306	488	6	thotathil	thotathil	VERB
brj-23306	488	7	,	,	PUNCT
brj-23306	488	8	v.	v.	ADV
brj-23306	488	9	,	,	PUNCT
brj-23306	488	10	rizk	rizk	PROPN
brj-23306	488	11	,	,	PUNCT
brj-23306	488	12	h.	h.	PROPN
brj-23306	488	13	h.	h.	PROPN
brj-23306	488	14	,	,	PUNCT
brj-23306	488	15	fakrooh	fakrooh	NOUN
brj-23306	488	16	,	,	PUNCT
brj-23306	488	17	a.	a.	NOUN
brj-23306	488	18	,	,	PUNCT
brj-23306	488	19	and	and	CCONJ
brj-23306	488	20	sreerama	sreerama	PROPN
brj-23306	488	21	,	,	PUNCT
brj-23306	488	22	l.	l.	PROPN
brj-23306	488	23	(	(	PUNCT
brj-23306	488	24	2022	2022	NUM
brj-23306	488	25	)	)	PUNCT
brj-23306	488	26	.	.	PUNCT
brj-23306	489	1	“	"	PUNCT
brj-23306	489	2	phytochemical	phytochemical	ADJ
brj-23306	489	3	analysis	analysis	NOUN
brj-23306	489	4	of	of	ADP
brj-23306	489	5	acacia	acacia	NOUN
brj-23306	489	6	ehrenbergiana	ehrenbergiana	PROPN
brj-23306	489	7	(	(	PUNCT
brj-23306	489	8	hayne	hayne	PROPN
brj-23306	489	9	)	)	PUNCT
brj-23306	489	10	grown	grow	VERB
brj-23306	489	11	in	in	ADP
brj-23306	489	12	qatar	qatar	NOUN
brj-23306	489	13	:	:	PUNCT
brj-23306	489	14	identification	identification	NOUN
brj-23306	489	15	of	of	ADP
brj-23306	489	16	active	active	ADJ
brj-23306	489	17	ingredients	ingredient	NOUN
brj-23306	489	18	and	and	CCONJ
brj-23306	489	19	their	their	PRON
brj-23306	489	20	biological	biological	ADJ
brj-23306	489	21	activities	activity	NOUN
brj-23306	489	22	,	,	PUNCT
brj-23306	489	23	”	"	PUNCT
brj-23306	489	24	molecules	molecule	NOUN
brj-23306	489	25	27(19	27(19	NUM
brj-23306	489	26	)	)	PUNCT
brj-23306	489	27	,	,	PUNCT
brj-23306	489	28	article	article	NOUN
brj-23306	489	29	6400	6400	NUM
brj-23306	489	30	.	.	PUNCT
brj-23306	490	1	doi	doi	NOUN
brj-23306	490	2	:	:	PUNCT
brj-23306	490	3	10.3390	10.3390	NUM
brj-23306	490	4	/	/	SYM
brj-23306	490	5	molecules27196400	molecules27196400	PROPN
brj-23306	490	6	ullah	ullah	PROPN
brj-23306	490	7	,	,	PUNCT
brj-23306	490	8	a.	a.	PROPN
brj-23306	490	9	,	,	PUNCT
brj-23306	490	10	munir	munir	PROPN
brj-23306	490	11	,	,	PUNCT
brj-23306	490	12	s.	s.	PROPN
brj-23306	490	13	,	,	PUNCT
brj-23306	490	14	badshah	badshah	PROPN
brj-23306	490	15	,	,	PUNCT
brj-23306	490	16	s.	s.	PROPN
brj-23306	490	17	l.	l.	PROPN
brj-23306	490	18	,	,	PUNCT
brj-23306	490	19	khan	khan	PROPN
brj-23306	490	20	,	,	PUNCT
brj-23306	490	21	n.	n.	PROPN
brj-23306	490	22	,	,	PUNCT
brj-23306	490	23	ghani	ghani	PROPN
brj-23306	490	24	,	,	PUNCT
brj-23306	490	25	l.	l.	PROPN
brj-23306	490	26	,	,	PUNCT
brj-23306	490	27	jaremko	jaremko	NOUN
brj-23306	490	28	,	,	PUNCT
brj-23306	490	29	m.	m.	NOUN
brj-23306	490	30	,	,	PUNCT
brj-23306	490	31	and	and	CCONJ
brj-23306	490	32	emwas	emwas	NOUN
brj-23306	490	33	,	,	PUNCT
brj-23306	490	34	a.	a.	NOUN
brj-23306	490	35	(	(	PUNCT
brj-23306	490	36	2020	2020	NUM
brj-23306	490	37	)	)	PUNCT
brj-23306	490	38	.	.	PUNCT
brj-23306	491	1	“	"	PUNCT
brj-23306	491	2	important	important	ADJ
brj-23306	491	3	flavonoids	flavonoid	NOUN
brj-23306	491	4	and	and	CCONJ
brj-23306	491	5	their	their	PRON
brj-23306	491	6	role	role	NOUN
brj-23306	491	7	as	as	ADP
brj-23306	491	8	a	a	DET
brj-23306	491	9	therapeutic	therapeutic	ADJ
brj-23306	491	10	agent	agent	NOUN
brj-23306	491	11	,	,	PUNCT
brj-23306	491	12	”	"	PUNCT
brj-23306	491	13	molecules	molecule	NOUN
brj-23306	491	14	25(22	25(22	NOUN
brj-23306	491	15	)	)	PUNCT
brj-23306	491	16	,	,	PUNCT
brj-23306	491	17	article	article	NOUN
brj-23306	491	18	5243	5243	NUM
brj-23306	491	19	.	.	PUNCT
brj-23306	492	1	doi	doi	NOUN
brj-23306	492	2	:	:	PUNCT
brj-23306	492	3	10.3390	10.3390	NUM
brj-23306	492	4	/	/	SYM
brj-23306	492	5	molecules25225243	molecules25225243	PROPN
brj-23306	492	6	vijay	vijay	NOUN
brj-23306	492	7	,	,	PUNCT
brj-23306	492	8	r.	r.	PROPN
brj-23306	492	9	,	,	PUNCT
brj-23306	492	10	drisya	drisya	PROPN
brj-23306	492	11	,	,	PUNCT
brj-23306	492	12	v.	v.	ADP
brj-23306	492	13	m.	m.	NOUN
brj-23306	492	14	,	,	PUNCT
brj-23306	492	15	selta	selta	PROPN
brj-23306	492	16	,	,	PUNCT
brj-23306	492	17	d.	d.	PROPN
brj-23306	492	18	r.	r.	PROPN
brj-23306	492	19	f.	f.	PROPN
brj-23306	492	20	,	,	PUNCT
brj-23306	492	21	rathi	rathi	PROPN
brj-23306	492	22	,	,	PUNCT
brj-23306	492	23	m.	m.	NOUN
brj-23306	492	24	a.	a.	PROPN
brj-23306	492	25	,	,	PUNCT
brj-23306	492	26	krishnan	krishnan	PROPN
brj-23306	492	27	,	,	PUNCT
brj-23306	492	28	vk	vk	PROPN
brj-23306	492	29	.	.	PUNCT
brj-23306	493	1	g.	g.	PROPN
brj-23306	493	2	,	,	PUNCT
brj-23306	493	3	alkhalifah	alkhalifah	PROPN
brj-23306	493	4	,	,	PUNCT
brj-23306	493	5	d.	d.	PROPN
brj-23306	493	6	h.	h.	PROPN
brj-23306	493	7	m.	m.	PROPN
brj-23306	493	8	,	,	PUNCT
brj-23306	493	9	and	and	CCONJ
brj-23306	493	10	hozzein	hozzein	PROPN
brj-23306	493	11	,	,	PUNCT
brj-23306	493	12	w.	w.	PROPN
brj-23306	493	13	n.	n.	PROPN
brj-23306	493	14	(	(	PUNCT
brj-23306	493	15	2023	2023	NUM
brj-23306	493	16	)	)	PUNCT
brj-23306	493	17	.	.	PUNCT
brj-23306	494	1	“	"	PUNCT
brj-23306	494	2	synthesis	synthesis	NOUN
brj-23306	494	3	and	and	CCONJ
brj-23306	494	4	characterization	characterization	NOUN
brj-23306	494	5	of	of	ADP
brj-23306	494	6	silver	silver	ADJ
brj-23306	494	7	nanomaterial	nanomaterial	NOUN
brj-23306	494	8	from	from	ADP
brj-23306	494	9	aqueous	aqueous	ADJ
brj-23306	494	10	extract	extract	NOUN
brj-23306	494	11	of	of	ADP
brj-23306	494	12	commelina	commelina	NOUN
brj-23306	494	13	forskaolii	forskaolii	NOUN
brj-23306	494	14	and	and	CCONJ
brj-23306	494	15	its	its	PRON
brj-23306	494	16	potential	potential	ADJ
brj-23306	494	17	antimicrobial	antimicrobial	ADJ
brj-23306	494	18	activity	activity	NOUN
brj-23306	494	19	against	against	ADP
brj-23306	494	20	gram	gram	NOUN
brj-23306	494	21	negative	negative	ADJ
brj-23306	494	22	pathogens	pathogen	NOUN
brj-23306	494	23	,	,	PUNCT
brj-23306	494	24	”	"	PUNCT
brj-23306	494	25	journal	journal	NOUN
brj-23306	494	26	of	of	ADP
brj-23306	494	27	king	king	PROPN
brj-23306	494	28	saud	saud	PROPN
brj-23306	494	29	university	university	PROPN
brj-23306	494	30	science	science	PROPN
brj-23306	494	31	35(1	35(1	NUM
brj-23306	494	32	)	)	PUNCT
brj-23306	494	33	,	,	PUNCT
brj-23306	494	34	article	article	NOUN
brj-23306	494	35	i	i	PROPN
brj-23306	494	36	d	d	PROPN
brj-23306	494	37	102373	102373	NUM
brj-23306	494	38	.	.	PUNCT
brj-23306	495	1	doi	doi	NOUN
brj-23306	495	2	:	:	PUNCT
brj-23306	495	3	10.1016	10.1016	NUM
brj-23306	495	4	/	/	SYM
brj-23306	495	5	j.jksus.2022.102373	j.jksus.2022.102373	PROPN
brj-23306	495	6	zhou	zhou	PROPN
brj-23306	495	7	,	,	PUNCT
brj-23306	495	8	m.	m.	NOUN
brj-23306	495	9	,	,	PUNCT
brj-23306	495	10	liu	liu	PROPN
brj-23306	495	11	,	,	PUNCT
brj-23306	495	12	x.	x.	PROPN
brj-23306	495	13	,	,	PUNCT
brj-23306	495	14	li	li	PROPN
brj-23306	495	15	,	,	PUNCT
brj-23306	495	16	z.	z.	PROPN
brj-23306	495	17	,	,	PUNCT
brj-23306	495	18	huang	huang	PROPN
brj-23306	495	19	,	,	PUNCT
brj-23306	495	20	q.	q.	PROPN
brj-23306	495	21	,	,	PUNCT
brj-23306	495	22	li	li	PROPN
brj-23306	495	23	,	,	PUNCT
brj-23306	495	24	f.	f.	PROPN
brj-23306	495	25	,	,	PUNCT
brj-23306	495	26	and	and	CCONJ
brj-23306	495	27	li	li	PROPN
brj-23306	495	28	,	,	PUNCT
brj-23306	495	29	c.	c.	PROPN
brj-23306	495	30	y.	y.	PROPN
brj-23306	495	31	(	(	PUNCT
brj-23306	495	32	2018	2018	NUM
brj-23306	495	33	)	)	PUNCT
brj-23306	495	34	.	.	PUNCT
brj-23306	496	1	“	"	PUNCT
brj-23306	496	2	caspase‐3	caspase‐3	NOUN
brj-23306	496	3	regulates	regulate	VERB
brj-23306	496	4	the	the	DET
brj-23306	496	5	migration	migration	NOUN
brj-23306	496	6	,	,	PUNCT
brj-23306	496	7	invasion	invasion	NOUN
brj-23306	496	8	and	and	CCONJ
brj-23306	496	9	metastasis	metastasis	NOUN
brj-23306	496	10	of	of	ADP
brj-23306	496	11	colon	colon	NOUN
brj-23306	496	12	cancer	cancer	NOUN
brj-23306	496	13	cells	cell	NOUN
brj-23306	496	14	,	,	PUNCT
brj-23306	496	15	”	"	PUNCT
brj-23306	496	16	international	international	ADJ
brj-23306	496	17	journal	journal	NOUN
brj-23306	496	18	of	of	ADP
brj-23306	496	19	cancer	cancer	NOUN
brj-23306	496	20	143(4	143(4	NUM
brj-23306	496	21	)	)	PUNCT
brj-23306	496	22	,	,	PUNCT
brj-23306	496	23	921	921	NUM
brj-23306	496	24	-	-	SYM
brj-23306	496	25	930	930	NUM
brj-23306	496	26	.	.	PUNCT
brj-23306	497	1	doi	doi	NOUN
brj-23306	497	2	:	:	PUNCT
brj-23306	497	3	10.1002	10.1002	NUM
brj-23306	497	4	/	/	SYM
brj-23306	497	5	ijc.31374	ijc.31374	NOUN
brj-23306	497	6	zuhrotun	zuhrotun	NOUN
brj-23306	497	7	,	,	PUNCT
brj-23306	497	8	a.	a.	NOUN
brj-23306	497	9	,	,	PUNCT
brj-23306	497	10	oktaviani	oktaviani	PROPN
brj-23306	497	11	,	,	PUNCT
brj-23306	497	12	d.	d.	PROPN
brj-23306	497	13	j.	j.	PROPN
brj-23306	497	14	,	,	PUNCT
brj-23306	497	15	and	and	CCONJ
brj-23306	497	16	hasanah	hasanah	PROPN
brj-23306	497	17	,	,	PUNCT
brj-23306	497	18	a.	a.	NOUN
brj-23306	497	19	n.	n.	NOUN
brj-23306	497	20	(	(	PUNCT
brj-23306	497	21	2023	2023	NUM
brj-23306	497	22	)	)	PUNCT
brj-23306	497	23	.	.	PUNCT
brj-23306	498	1	“	"	PUNCT
brj-23306	498	2	biosynthesis	biosynthesis	NOUN
brj-23306	498	3	of	of	ADP
brj-23306	498	4	gold	gold	NOUN
brj-23306	498	5	and	and	CCONJ
brj-23306	498	6	silver	silver	ADJ
brj-23306	498	7	nanoparticles	nanoparticle	NOUN
brj-23306	498	8	using	use	VERB
brj-23306	498	9	phytochemical	phytochemical	ADJ
brj-23306	498	10	compounds	compound	NOUN
brj-23306	498	11	,	,	PUNCT
brj-23306	498	12	”	"	PUNCT
brj-23306	498	13	molecules	molecule	NOUN
brj-23306	498	14	28(7	28(7	NUM
brj-23306	498	15	)	)	PUNCT
brj-23306	498	16	,	,	PUNCT
brj-23306	498	17	article	article	NOUN
brj-23306	498	18	3240	3240	NUM
brj-23306	498	19	.	.	PUNCT
brj-23306	499	1	doi	doi	NOUN
brj-23306	499	2	:	:	PUNCT
brj-23306	499	3	10.3390	10.3390	NUM
brj-23306	499	4	/	/	SYM
brj-23306	499	5	molecules28073240	molecules28073240	NOUN
brj-23306	499	6	article	article	NOUN
brj-23306	499	7	submitted	submit	VERB
brj-23306	499	8	:	:	PUNCT
brj-23306	499	9	january	january	PROPN
brj-23306	499	10	25	25	NUM
brj-23306	499	11	,	,	PUNCT
brj-23306	499	12	2024	2024	NUM
brj-23306	499	13	;	;	PUNCT
brj-23306	499	14	peer	peer	NOUN
brj-23306	499	15	review	review	NOUN
brj-23306	499	16	completed	complete	VERB
brj-23306	499	17	:	:	PUNCT
brj-23306	499	18	march	march	PROPN
brj-23306	499	19	22	22	NUM
brj-23306	499	20	,	,	PUNCT
brj-23306	499	21	2024	2024	NUM
brj-23306	499	22	;	;	PUNCT
brj-23306	499	23	revised	revise	VERB
brj-23306	499	24	version	version	NOUN
brj-23306	499	25	received	receive	VERB
brj-23306	499	26	and	and	CCONJ
brj-23306	499	27	accepted	accept	VERB
brj-23306	499	28	:	:	PUNCT
brj-23306	499	29	april	april	PROPN
brj-23306	499	30	3	3	NUM
brj-23306	499	31	,	,	PUNCT
brj-23306	499	32	2024	2024	NUM
brj-23306	499	33	;	;	PUNCT
brj-23306	499	34	published	publish	VERB
brj-23306	499	35	:	:	PUNCT
brj-23306	499	36	april	april	PROPN
brj-23306	499	37	12	12	NUM
brj-23306	499	38	,	,	PUNCT
brj-23306	499	39	2024	2024	NUM
brj-23306	499	40	.	.	PUNCT
brj-23306	500	1	doi	doi	NOUN
brj-23306	500	2	:	:	PUNCT
brj-23306	500	3	10.15376	10.15376	NUM
brj-23306	500	4	/	/	SYM
brj-23306	500	5	biores.19.2.3328	biores.19.2.3328	PROPN
brj-23306	500	6	-	-	SYM
brj-23306	500	7	3352	3352	NUM