id	sid	tid	token	lemma	pos
brj-23453	1	1	peer	peer	NOUN
brj-23453	1	2	-	-	PUNCT
brj-23453	1	3	review	review	NOUN
brj-23453	1	4	article	article	NOUN
brj-23453	1	5	peer	peer	NOUN
brj-23453	1	6	-	-	PUNCT
brj-23453	1	7	reviewed	review	VERB
brj-23453	1	8	article	article	NOUN
brj-23453	1	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	1	10	wani	wani	PROPN
brj-23453	1	11	et	et	PROPN
brj-23453	1	12	al	al	PROPN
brj-23453	1	13	.	.	PROPN
brj-23453	2	1	(	(	PUNCT
brj-23453	2	2	2024	2024	NUM
brj-23453	2	3	)	)	PUNCT
brj-23453	2	4	.	.	PUNCT
brj-23453	3	1	“	"	PUNCT
brj-23453	3	2	walnut	walnut	ADJ
brj-23453	3	3	population	population	NOUN
brj-23453	3	4	&	&	CCONJ
brj-23453	3	5	diversity	diversity	NOUN
brj-23453	3	6	,	,	PUNCT
brj-23453	3	7	”	"	PUNCT
brj-23453	3	8	bioresources	bioresource	NOUN
brj-23453	3	9	19(3	19(3	NUM
brj-23453	3	10	)	)	PUNCT
brj-23453	3	11	,	,	PUNCT
brj-23453	3	12	4213	4213	NUM
brj-23453	3	13	-	-	SYM
brj-23453	3	14	4237	4237	NUM
brj-23453	3	15	.	.	PUNCT
brj-23453	4	1	4213	4213	NUM
brj-23453	4	2	utilizing	utilize	VERB
brj-23453	4	3	ssr	ssr	ADJ
brj-23453	4	4	markers	marker	NOUN
brj-23453	4	5	to	to	PART
brj-23453	4	6	examine	examine	VERB
brj-23453	4	7	the	the	DET
brj-23453	4	8	population	population	NOUN
brj-23453	4	9	structure	structure	NOUN
brj-23453	4	10	and	and	CCONJ
brj-23453	4	11	molecular	molecular	ADJ
brj-23453	4	12	genetic	genetic	ADJ
brj-23453	4	13	diversity	diversity	NOUN
brj-23453	4	14	of	of	ADP
brj-23453	4	15	walnut	walnut	NOUN
brj-23453	4	16	(	(	PUNCT
brj-23453	4	17	juglans	juglan	NOUN
brj-23453	4	18	regia	regia	NOUN
brj-23453	4	19	l.	l.	PROPN
brj-23453	4	20	)	)	PUNCT
brj-23453	4	21	genotypes	genotype	NOUN
brj-23453	4	22	in	in	ADP
brj-23453	4	23	the	the	DET
brj-23453	4	24	northwestern	northwestern	ADJ
brj-23453	4	25	himalayan	himalayan	ADJ
brj-23453	4	26	region	region	NOUN
brj-23453	4	27	of	of	ADP
brj-23453	4	28	jammu	jammu	PROPN
brj-23453	4	29	and	and	CCONJ
brj-23453	4	30	kashmir	kashmir	PROPN
brj-23453	4	31	ab	ab	PROPN
brj-23453	4	32	waheed	waheed	PROPN
brj-23453	4	33	wani	wani	PROPN
brj-23453	4	34	,	,	PUNCT
brj-23453	4	35	a	a	DET
brj-23453	4	36	ghulam	ghulam	PROPN
brj-23453	4	37	i.	i.	PROPN
brj-23453	4	38	hassan	hassan	PROPN
brj-23453	4	39	,	,	PUNCT
brj-23453	4	40	b	b	PROPN
brj-23453	4	41	khalid	khalid	PROPN
brj-23453	4	42	m.	m.	PROPN
brj-23453	4	43	bhat	bhat	PROPN
brj-23453	4	44	,	,	PUNCT
brj-23453	4	45	b	b	NOUN
brj-23453	4	46	meraj	meraj	VERB
brj-23453	4	47	ahmad	ahmad	PROPN
brj-23453	4	48	,	,	PUNCT
brj-23453	4	49	c	c	PROPN
brj-23453	4	50	manzer	manzer	PROPN
brj-23453	4	51	h.	h.	PROPN
brj-23453	4	52	siddiqui	siddiqui	PROPN
brj-23453	4	53	,	,	PUNCT
brj-23453	4	54	d	d	PROPN
brj-23453	4	55	sanjeev	sanjeev	PROPN
brj-23453	4	56	kumar	kumar	PROPN
brj-23453	4	57	,	,	PUNCT
brj-23453	4	58	a	a	DET
brj-23453	4	59	ram	ram	NOUN
brj-23453	4	60	k.	k.	PROPN
brj-23453	4	61	naresh	naresh	PROPN
brj-23453	4	62	,	,	PUNCT
brj-23453	4	63	e	e	PROPN
brj-23453	4	64	and	and	CCONJ
brj-23453	4	65	rajeev	rajeev	PROPN
brj-23453	4	66	kumar	kumar	PROPN
brj-23453	4	67	gupta	gupta	PROPN
brj-23453	4	68	f	f	PROPN
brj-23453	4	69	,	,	PUNCT
brj-23453	4	70	*	*	PUNCT
brj-23453	4	71	by	by	ADP
brj-23453	4	72	using	use	VERB
brj-23453	4	73	16	16	NUM
brj-23453	4	74	simple	simple	ADJ
brj-23453	4	75	sequence	sequence	NOUN
brj-23453	4	76	repeat	repeat	NOUN
brj-23453	4	77	(	(	PUNCT
brj-23453	4	78	ssr	ssr	ADJ
brj-23453	4	79	)	)	PUNCT
brj-23453	4	80	markers	marker	NOUN
brj-23453	4	81	,	,	PUNCT
brj-23453	4	82	the	the	DET
brj-23453	4	83	genetic	genetic	ADJ
brj-23453	4	84	relatedness	relatedness	NOUN
brj-23453	4	85	of	of	ADP
brj-23453	4	86	21	21	NUM
brj-23453	4	87	exceptional	exceptional	ADJ
brj-23453	4	88	walnut	walnut	NOUN
brj-23453	4	89	genotypes	genotype	NOUN
brj-23453	4	90	was	be	AUX
brj-23453	4	91	assessed	assess	VERB
brj-23453	4	92	.	.	PUNCT
brj-23453	5	1	a	a	DET
brj-23453	5	2	significant	significant	ADJ
brj-23453	5	3	degree	degree	NOUN
brj-23453	5	4	of	of	ADP
brj-23453	5	5	genetic	genetic	ADJ
brj-23453	5	6	diversity	diversity	NOUN
brj-23453	5	7	was	be	AUX
brj-23453	5	8	observed	observe	VERB
brj-23453	5	9	within	within	ADP
brj-23453	5	10	a	a	DET
brj-23453	5	11	given	give	VERB
brj-23453	5	12	population	population	NOUN
brj-23453	5	13	,	,	PUNCT
brj-23453	5	14	as	as	SCONJ
brj-23453	5	15	indicated	indicate	VERB
brj-23453	5	16	by	by	ADP
brj-23453	5	17	the	the	DET
brj-23453	5	18	number	number	NOUN
brj-23453	5	19	of	of	ADP
brj-23453	5	20	alleles	allele	NOUN
brj-23453	5	21	per	per	ADP
brj-23453	5	22	locus	locus	NOUN
brj-23453	5	23	ranging	range	VERB
brj-23453	5	24	from	from	ADP
brj-23453	5	25	2	2	NUM
brj-23453	5	26	to	to	ADP
brj-23453	5	27	4	4	NUM
brj-23453	5	28	.	.	PUNCT
brj-23453	5	29	wga-1	wga-1	NUM
brj-23453	5	30	,	,	PUNCT
brj-23453	5	31	wga-4	wga-4	ADP
brj-23453	5	32	,	,	PUNCT
brj-23453	5	33	and	and	CCONJ
brj-23453	5	34	wga-79	wga-79	NOUN
brj-23453	5	35	contained	contain	VERB
brj-23453	5	36	the	the	DET
brj-23453	5	37	greatest	great	ADJ
brj-23453	5	38	number	number	NOUN
brj-23453	5	39	of	of	ADP
brj-23453	5	40	alleles	allele	NOUN
brj-23453	5	41	(	(	PUNCT
brj-23453	5	42	4	4	NUM
brj-23453	5	43	)	)	PUNCT
brj-23453	5	44	,	,	PUNCT
brj-23453	5	45	followed	follow	VERB
brj-23453	5	46	by	by	ADP
brj-23453	5	47	wga-118	wga-118	VERB
brj-23453	5	48	,	,	PUNCT
brj-23453	5	49	wga-202	wga-202	NOUN
brj-23453	5	50	,	,	PUNCT
brj-23453	5	51	and	and	CCONJ
brj-23453	5	52	wga-42	wga-42	NOUN
brj-23453	5	53	.	.	PUNCT
brj-23453	6	1	conversely	conversely	ADV
brj-23453	6	2	,	,	PUNCT
brj-23453	6	3	wga-27	wga-27	PROPN
brj-23453	6	4	,	,	PUNCT
brj-23453	6	5	wga-69	wga-69	PROPN
brj-23453	6	6	,	,	PUNCT
brj-23453	6	7	and	and	CCONJ
brj-23453	6	8	wga-32	wga-32	NUM
brj-23453	6	9	contained	contain	VERB
brj-23453	6	10	the	the	DET
brj-23453	6	11	fewest	few	ADJ
brj-23453	6	12	alleles	allele	NOUN
brj-23453	6	13	.	.	PUNCT
brj-23453	7	1	the	the	DET
brj-23453	7	2	range	range	NOUN
brj-23453	7	3	of	of	ADP
brj-23453	7	4	the	the	DET
brj-23453	7	5	pic	pic	NOUN
brj-23453	7	6	value	value	NOUN
brj-23453	7	7	was	be	AUX
brj-23453	7	8	0.11	0.11	NUM
brj-23453	7	9	to	to	ADP
brj-23453	7	10	0.38	0.38	NUM
brj-23453	7	11	.	.	PUNCT
brj-23453	8	1	using	use	VERB
brj-23453	8	2	model	model	NOUN
brj-23453	8	3	-	-	PUNCT
brj-23453	8	4	based	base	VERB
brj-23453	8	5	cluster	cluster	NOUN
brj-23453	8	6	analysis	analysis	NOUN
brj-23453	8	7	,	,	PUNCT
brj-23453	8	8	all	all	DET
brj-23453	8	9	genotypes	genotype	NOUN
brj-23453	8	10	were	be	AUX
brj-23453	8	11	categorized	categorize	VERB
brj-23453	8	12	into	into	ADP
brj-23453	8	13	two	two	NUM
brj-23453	8	14	primary	primary	ADJ
brj-23453	8	15	clusters	cluster	NOUN
brj-23453	8	16	according	accord	VERB
brj-23453	8	17	to	to	ADP
brj-23453	8	18	the	the	DET
brj-23453	8	19	upgma	upgma	PROPN
brj-23453	8	20	dendrogram	dendrogram	PROPN
brj-23453	8	21	,	,	PUNCT
brj-23453	8	22	with	with	ADP
brj-23453	8	23	varying	vary	VERB
brj-23453	8	24	degrees	degree	NOUN
brj-23453	8	25	of	of	ADP
brj-23453	8	26	sub	sub	NOUN
brj-23453	8	27	-	-	ADJ
brj-23453	8	28	clustering	clustering	ADJ
brj-23453	8	29	.	.	PUNCT
brj-23453	9	1	all	all	DET
brj-23453	9	2	the	the	DET
brj-23453	9	3	genotypes	genotype	NOUN
brj-23453	9	4	were	be	AUX
brj-23453	9	5	categorized	categorize	VERB
brj-23453	9	6	into	into	ADP
brj-23453	9	7	six	six	NUM
brj-23453	9	8	genetically	genetically	ADV
brj-23453	9	9	distant	distant	ADJ
brj-23453	9	10	subpopulations	subpopulation	NOUN
brj-23453	9	11	.	.	PUNCT
brj-23453	10	1	the	the	DET
brj-23453	10	2	genotypes	genotype	NOUN
brj-23453	10	3	were	be	AUX
brj-23453	10	4	genetically	genetically	ADV
brj-23453	10	5	distinct	distinct	ADJ
brj-23453	10	6	but	but	CCONJ
brj-23453	10	7	had	have	VERB
brj-23453	10	8	variable	variable	ADJ
brj-23453	10	9	degrees	degree	NOUN
brj-23453	10	10	of	of	ADP
brj-23453	10	11	admixture	admixture	NOUN
brj-23453	10	12	.	.	PUNCT
brj-23453	11	1	the	the	DET
brj-23453	11	2	anticipated	anticipate	VERB
brj-23453	11	3	heterozygosity	heterozygosity	NOUN
brj-23453	11	4	at	at	ADP
brj-23453	11	5	a	a	DET
brj-23453	11	6	specific	specific	ADJ
brj-23453	11	7	locus	locus	NOUN
brj-23453	11	8	ranged	range	VERB
brj-23453	11	9	from	from	ADP
brj-23453	11	10	0.563	0.563	NUM
brj-23453	11	11	to	to	ADP
brj-23453	11	12	0.741	0.741	NUM
brj-23453	11	13	.	.	PUNCT
brj-23453	12	1	additionally	additionally	ADV
brj-23453	12	2	,	,	PUNCT
brj-23453	12	3	population	population	NOUN
brj-23453	12	4	differentiation	differentiation	NOUN
brj-23453	12	5	(	(	PUNCT
brj-23453	12	6	fst	fst	NOUN
brj-23453	12	7	)	)	PUNCT
brj-23453	12	8	ranged	range	VERB
brj-23453	12	9	between	between	ADP
brj-23453	12	10	0.176	0.176	NUM
brj-23453	12	11	and	and	CCONJ
brj-23453	12	12	0.261	0.261	NUM
brj-23453	12	13	.	.	PUNCT
brj-23453	13	1	these	these	DET
brj-23453	13	2	findings	finding	NOUN
brj-23453	13	3	highlight	highlight	VERB
brj-23453	13	4	the	the	DET
brj-23453	13	5	importance	importance	NOUN
brj-23453	13	6	of	of	ADP
brj-23453	13	7	considering	consider	VERB
brj-23453	13	8	germplasm	germplasm	NOUN
brj-23453	13	9	diversity	diversity	NOUN
brj-23453	13	10	in	in	ADP
brj-23453	13	11	walnut	walnut	ADJ
brj-23453	13	12	breeding	breeding	NOUN
brj-23453	13	13	programs	program	NOUN
brj-23453	13	14	and	and	CCONJ
brj-23453	13	15	conservation	conservation	NOUN
brj-23453	13	16	efforts	effort	NOUN
brj-23453	13	17	aimed	aim	VERB
brj-23453	13	18	at	at	ADP
brj-23453	13	19	enhancing	enhance	VERB
brj-23453	13	20	walnut	walnut	ADJ
brj-23453	13	21	cultivation	cultivation	NOUN
brj-23453	13	22	in	in	ADP
brj-23453	13	23	the	the	DET
brj-23453	13	24	region	region	NOUN
brj-23453	13	25	.	.	PUNCT
brj-23453	14	1	overall	overall	ADV
brj-23453	14	2	,	,	PUNCT
brj-23453	14	3	this	this	DET
brj-23453	14	4	study	study	NOUN
brj-23453	14	5	contributes	contribute	VERB
brj-23453	14	6	to	to	ADP
brj-23453	14	7	our	our	PRON
brj-23453	14	8	understanding	understanding	NOUN
brj-23453	14	9	of	of	ADP
brj-23453	14	10	walnut	walnut	ADJ
brj-23453	14	11	genetic	genetic	ADJ
brj-23453	14	12	diversity	diversity	NOUN
brj-23453	14	13	in	in	ADP
brj-23453	14	14	the	the	DET
brj-23453	14	15	northwestern	northwestern	ADJ
brj-23453	14	16	himalayan	himalayan	ADJ
brj-23453	14	17	region	region	NOUN
brj-23453	14	18	of	of	ADP
brj-23453	14	19	jammu	jammu	PROPN
brj-23453	14	20	and	and	CCONJ
brj-23453	14	21	kashmir	kashmir	PROPN
brj-23453	14	22	and	and	CCONJ
brj-23453	14	23	informs	inform	VERB
brj-23453	14	24	future	future	ADJ
brj-23453	14	25	breeding	breeding	NOUN
brj-23453	14	26	and	and	CCONJ
brj-23453	14	27	conservation	conservation	NOUN
brj-23453	14	28	strategies	strategy	NOUN
brj-23453	14	29	.	.	PUNCT
brj-23453	15	1	doi	doi	NOUN
brj-23453	15	2	:	:	PUNCT
brj-23453	15	3	10.15376	10.15376	NUM
brj-23453	15	4	/	/	SYM
brj-23453	15	5	biores.19.3.4213	biores.19.3.4213	NOUN
brj-23453	15	6	-	-	PUNCT
brj-23453	15	7	4237	4237	NUM
brj-23453	15	8	keywords	keyword	NOUN
brj-23453	15	9	:	:	PUNCT
brj-23453	15	10	walnut	walnut	NOUN
brj-23453	15	11	;	;	PUNCT
brj-23453	15	12	upgma	upgma	NOUN
brj-23453	15	13	;	;	PUNCT
brj-23453	15	14	genetic	genetic	ADJ
brj-23453	15	15	diversity	diversity	NOUN
brj-23453	15	16	;	;	PUNCT
brj-23453	15	17	molecular	molecular	ADJ
brj-23453	15	18	characterization	characterization	NOUN
brj-23453	15	19	;	;	PUNCT
brj-23453	15	20	amova	amova	PROPN
brj-23453	15	21	contact	contact	NOUN
brj-23453	15	22	information	information	NOUN
brj-23453	15	23	:	:	PUNCT
brj-23453	15	24	a	a	DET
brj-23453	15	25	:	:	PUNCT
brj-23453	15	26	department	department	NOUN
brj-23453	15	27	of	of	ADP
brj-23453	15	28	horticulture	horticulture	NOUN
brj-23453	15	29	,	,	PUNCT
brj-23453	15	30	lovely	lovely	ADJ
brj-23453	15	31	professional	professional	ADJ
brj-23453	15	32	university	university	NOUN
brj-23453	15	33	,	,	PUNCT
brj-23453	15	34	punjab	punjab	PROPN
brj-23453	15	35	,	,	PUNCT
brj-23453	15	36	india	india	PROPN
brj-23453	15	37	,	,	PUNCT
brj-23453	15	38	144411	144411	NUM
brj-23453	15	39	;	;	PUNCT
brj-23453	16	1	b	b	X
brj-23453	16	2	:	:	PUNCT
brj-23453	16	3	division	division	NOUN
brj-23453	16	4	of	of	ADP
brj-23453	16	5	fruit	fruit	NOUN
brj-23453	16	6	science	science	NOUN
brj-23453	16	7	,	,	PUNCT
brj-23453	16	8	sher	sher	NOUN
brj-23453	16	9	-	-	PUNCT
brj-23453	16	10	e	e	PROPN
brj-23453	16	11	-	-	PROPN
brj-23453	16	12	kashmir	kashmir	PROPN
brj-23453	16	13	university	university	PROPN
brj-23453	16	14	of	of	ADP
brj-23453	16	15	agricultural	agricultural	PROPN
brj-23453	16	16	sciences	sciences	PROPN
brj-23453	16	17	&	&	CCONJ
brj-23453	16	18	technology	technology	PROPN
brj-23453	16	19	(	(	PUNCT
brj-23453	16	20	skuast	skuast	NOUN
brj-23453	16	21	-	-	PUNCT
brj-23453	16	22	k	k	NOUN
brj-23453	16	23	)	)	PUNCT
brj-23453	16	24	,	,	PUNCT
brj-23453	16	25	shalimar	shalimar	PROPN
brj-23453	16	26	srinagar	srinagar	PROPN
brj-23453	16	27	,	,	PUNCT
brj-23453	16	28	190025	190025	NUM
brj-23453	16	29	;	;	PUNCT
brj-23453	16	30	c	c	X
brj-23453	16	31	:	:	PUNCT
brj-23453	16	32	department	department	NOUN
brj-23453	16	33	of	of	ADP
brj-23453	16	34	soil	soil	NOUN
brj-23453	16	35	science	science	NOUN
brj-23453	16	36	and	and	CCONJ
brj-23453	16	37	agricultural	agricultural	ADJ
brj-23453	16	38	chemistry	chemistry	NOUN
brj-23453	16	39	,	,	PUNCT
brj-23453	16	40	lovely	lovely	ADJ
brj-23453	16	41	professional	professional	ADJ
brj-23453	16	42	university	university	NOUN
brj-23453	16	43	,	,	PUNCT
brj-23453	16	44	jalandhar	jalandhar	PROPN
brj-23453	16	45	–	–	PUNCT
brj-23453	16	46	144411	144411	NUM
brj-23453	16	47	,	,	PUNCT
brj-23453	16	48	punjab	punjab	PROPN
brj-23453	16	49	,	,	PUNCT
brj-23453	16	50	india	india	PROPN
brj-23453	16	51	;	;	PUNCT
brj-23453	16	52	d	d	X
brj-23453	16	53	:	:	PUNCT
brj-23453	16	54	department	department	NOUN
brj-23453	16	55	of	of	ADP
brj-23453	16	56	botany	botany	NOUN
brj-23453	16	57	and	and	CCONJ
brj-23453	16	58	microbiology	microbiology	NOUN
brj-23453	16	59	,	,	PUNCT
brj-23453	16	60	college	college	NOUN
brj-23453	16	61	of	of	ADP
brj-23453	16	62	science	science	NOUN
brj-23453	16	63	,	,	PUNCT
brj-23453	16	64	king	king	NOUN
brj-23453	16	65	saud	saud	PROPN
brj-23453	16	66	university	university	PROPN
brj-23453	16	67	,	,	PUNCT
brj-23453	16	68	riyadh	riyadh	PROPN
brj-23453	16	69	,	,	PUNCT
brj-23453	16	70	saudi	saudi	PROPN
brj-23453	16	71	arabia	arabia	PROPN
brj-23453	16	72	;	;	PUNCT
brj-23453	16	73	e	e	X
brj-23453	16	74	:	:	PUNCT
brj-23453	16	75	sardar	sardar	PROPN
brj-23453	16	76	vallabhbhai	vallabhbhai	PROPN
brj-23453	16	77	patel	patel	PROPN
brj-23453	16	78	university	university	PROPN
brj-23453	16	79	of	of	ADP
brj-23453	16	80	agriculture	agriculture	PROPN
brj-23453	16	81	&	&	CCONJ
brj-23453	16	82	technology	technology	PROPN
brj-23453	16	83	,	,	PUNCT
brj-23453	16	84	meerut	meerut	PROPN
brj-23453	16	85	,	,	PUNCT
brj-23453	16	86	india	india	PROPN
brj-23453	16	87	;	;	PUNCT
brj-23453	16	88	f	f	X
brj-23453	16	89	:	:	PUNCT
brj-23453	16	90	school	school	NOUN
brj-23453	16	91	of	of	ADP
brj-23453	16	92	agriculture	agriculture	NOUN
brj-23453	16	93	,	,	PUNCT
brj-23453	16	94	lovely	lovely	ADJ
brj-23453	16	95	professional	professional	ADJ
brj-23453	16	96	university	university	NOUN
brj-23453	16	97	,	,	PUNCT
brj-23453	16	98	jalandhar	jalandhar	PROPN
brj-23453	16	99	144001	144001	NUM
brj-23453	16	100	,	,	PUNCT
brj-23453	16	101	punjab	punjab	PROPN
brj-23453	16	102	,	,	PUNCT
brj-23453	16	103	india	india	PROPN
brj-23453	16	104	;	;	PUNCT
brj-23453	16	105	*	*	PUNCT
brj-23453	16	106	corresponding	correspond	VERB
brj-23453	16	107	author	author	NOUN
brj-23453	16	108	:	:	PUNCT
brj-23453	16	109	rajeev.30662@lpu.co.in	rajeev.30662@lpu.co.in	VERB
brj-23453	16	110	introduction	introduction	NOUN
brj-23453	16	111	walnut	walnut	NOUN
brj-23453	16	112	(	(	PUNCT
brj-23453	16	113	juglans	juglan	NOUN
brj-23453	16	114	regia	regia	PROPN
brj-23453	16	115	l.	l.	PROPN
brj-23453	16	116	)	)	PUNCT
brj-23453	16	117	,	,	PUNCT
brj-23453	16	118	with	with	ADP
brj-23453	16	119	2n	2n	NUM
brj-23453	16	120	=	=	SYM
brj-23453	16	121	2x	2x	NUM
brj-23453	16	122	=	=	SYM
brj-23453	16	123	32	32	NUM
brj-23453	16	124	sporophytic	sporophytic	ADJ
brj-23453	16	125	chromosomes	chromosome	NOUN
brj-23453	16	126	,	,	PUNCT
brj-23453	16	127	is	be	AUX
brj-23453	16	128	classified	classify	VERB
brj-23453	16	129	as	as	ADP
brj-23453	16	130	a	a	DET
brj-23453	16	131	member	member	NOUN
brj-23453	16	132	of	of	ADP
brj-23453	16	133	the	the	DET
brj-23453	16	134	juglandaceae	juglandaceae	PROPN
brj-23453	16	135	family	family	NOUN
brj-23453	16	136	.	.	PUNCT
brj-23453	17	1	it	it	PRON
brj-23453	17	2	is	be	AUX
brj-23453	17	3	referred	refer	VERB
brj-23453	17	4	to	to	ADP
brj-23453	17	5	as	as	ADP
brj-23453	17	6	“	"	PUNCT
brj-23453	17	7	jupiter	jupiter	PROPN
brj-23453	17	8	's	's	PART
brj-23453	17	9	royal	royal	ADJ
brj-23453	17	10	acorn	acorn	NOUN
brj-23453	17	11	”	"	PUNCT
brj-23453	17	12	and	and	CCONJ
brj-23453	17	13	in	in	ADP
brj-23453	17	14	kashmiri	kashmiri	PROPN
brj-23453	17	15	as	as	ADP
brj-23453	17	16	“	"	PUNCT
brj-23453	17	17	doan	doan	NOUN
brj-23453	17	18	.	.	PUNCT
brj-23453	17	19	”	"	PUNCT
brj-23453	18	1	juglans	juglan	NOUN
brj-23453	18	2	comprise	comprise	VERB
brj-23453	18	3	an	an	DET
brj-23453	18	4	estimated	estimate	VERB
brj-23453	18	5	20	20	NUM
brj-23453	18	6	species	specie	NOUN
brj-23453	18	7	,	,	PUNCT
brj-23453	18	8	including	include	VERB
brj-23453	18	9	heartnut	heartnut	NOUN
brj-23453	18	10	(	(	PUNCT
brj-23453	18	11	j.	j.	PROPN
brj-23453	18	12	ailantifolia	ailantifolia	PROPN
brj-23453	18	13	var	var	PROPN
brj-23453	18	14	.	.	PUNCT
brj-23453	19	1	cordiformis	cordiformis	PROPN
brj-23453	19	2	)	)	PUNCT
brj-23453	19	3	,	,	PUNCT
brj-23453	19	4	eastern	eastern	ADJ
brj-23453	19	5	black	black	ADJ
brj-23453	19	6	walnut	walnut	NOUN
brj-23453	19	7	(	(	PUNCT
brj-23453	19	8	j.	j.	PROPN
brj-23453	19	9	cinerea	cinerea	PROPN
brj-23453	19	10	)	)	PUNCT
brj-23453	19	11	,	,	PUNCT
brj-23453	19	12	and	and	CCONJ
brj-23453	19	13	butternut	butternut	PROPN
brj-23453	19	14	(	(	PUNCT
brj-23453	19	15	j.	j.	PROPN
brj-23453	19	16	cinerea	cinerea	PROPN
brj-23453	19	17	)	)	PUNCT
brj-23453	19	18	.	.	PUNCT
brj-23453	20	1	the	the	DET
brj-23453	20	2	reproductive	reproductive	ADJ
brj-23453	20	3	characteristics	characteristic	NOUN
brj-23453	20	4	of	of	ADP
brj-23453	20	5	walnuts	walnut	NOUN
brj-23453	20	6	have	have	AUX
brj-23453	20	7	contributed	contribute	VERB
brj-23453	20	8	to	to	ADP
brj-23453	20	9	their	their	PRON
brj-23453	20	10	substantial	substantial	ADJ
brj-23453	20	11	genetic	genetic	ADJ
brj-23453	20	12	variability	variability	NOUN
brj-23453	20	13	over	over	ADP
brj-23453	20	14	an	an	DET
brj-23453	20	15	extended	extended	ADJ
brj-23453	20	16	period	period	NOUN
brj-23453	20	17	in	in	ADP
brj-23453	20	18	a	a	DET
brj-23453	20	19	complex	complex	ADJ
brj-23453	20	20	environment	environment	NOUN
brj-23453	20	21	(	(	PUNCT
brj-23453	20	22	wu	wu	PROPN
brj-23453	20	23	et	et	PROPN
brj-23453	20	24	al	al	PROPN
brj-23453	20	25	.	.	PROPN
brj-23453	20	26	2000	2000	NUM
brj-23453	20	27	;	;	PUNCT
brj-23453	20	28	yang	yang	PROPN
brj-23453	20	29	and	and	CCONJ
brj-23453	20	30	xue	xue	PROPN
brj-23453	20	31	2005	2005	NUM
brj-23453	20	32	)	)	PUNCT
brj-23453	20	33	.	.	PUNCT
brj-23453	21	1	mailto:rajeev.30662@lpu.co.in	mailto:rajeev.30662@lpu.co.in	AUX
brj-23453	21	2	peer	peer	NOUN
brj-23453	21	3	-	-	PUNCT
brj-23453	21	4	reviewed	review	VERB
brj-23453	21	5	article	article	NOUN
brj-23453	21	6	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	21	7	wani	wani	PROPN
brj-23453	21	8	et	et	PROPN
brj-23453	21	9	al	al	PROPN
brj-23453	21	10	.	.	PROPN
brj-23453	22	1	(	(	PUNCT
brj-23453	22	2	2024	2024	NUM
brj-23453	22	3	)	)	PUNCT
brj-23453	22	4	.	.	PUNCT
brj-23453	23	1	“	"	PUNCT
brj-23453	23	2	walnut	walnut	ADJ
brj-23453	23	3	population	population	NOUN
brj-23453	23	4	&	&	CCONJ
brj-23453	23	5	diversity	diversity	NOUN
brj-23453	23	6	,	,	PUNCT
brj-23453	23	7	”	"	PUNCT
brj-23453	23	8	bioresources	bioresource	NOUN
brj-23453	23	9	19(3	19(3	NUM
brj-23453	23	10	)	)	PUNCT
brj-23453	23	11	,	,	PUNCT
brj-23453	23	12	4213	4213	NUM
brj-23453	23	13	-	-	SYM
brj-23453	23	14	4237	4237	NUM
brj-23453	23	15	.	.	PUNCT
brj-23453	24	1	4214	4214	NUM
brj-23453	24	2	the	the	DET
brj-23453	24	3	extent	extent	NOUN
brj-23453	24	4	to	to	PART
brj-23453	24	5	which	which	PRON
brj-23453	24	6	diverse	diverse	ADJ
brj-23453	24	7	and	and	CCONJ
brj-23453	24	8	distinct	distinct	ADJ
brj-23453	24	9	walnut	walnut	NOUN
brj-23453	24	10	germplasm	germplasm	NOUN
brj-23453	24	11	is	be	AUX
brj-23453	24	12	available	available	ADJ
brj-23453	24	13	globally	globally	ADV
brj-23453	24	14	remains	remain	VERB
brj-23453	24	15	unknown	unknown	ADJ
brj-23453	24	16	.	.	PUNCT
brj-23453	25	1	utilizing	utilize	VERB
brj-23453	25	2	state	state	NOUN
brj-23453	25	3	-	-	PUNCT
brj-23453	25	4	of	of	ADP
brj-23453	25	5	-	-	PUNCT
brj-23453	25	6	the	the	DET
brj-23453	25	7	-	-	PUNCT
brj-23453	25	8	art	art	NOUN
brj-23453	25	9	technology	technology	NOUN
brj-23453	25	10	is	be	AUX
brj-23453	25	11	imperative	imperative	ADJ
brj-23453	25	12	to	to	PART
brj-23453	25	13	ascertain	ascertain	VERB
brj-23453	25	14	evolutionary	evolutionary	ADJ
brj-23453	25	15	connections	connection	NOUN
brj-23453	25	16	and	and	CCONJ
brj-23453	25	17	genetic	genetic	ADJ
brj-23453	25	18	diversity	diversity	NOUN
brj-23453	25	19	among	among	ADP
brj-23453	25	20	identified	identify	VERB
brj-23453	25	21	species	specie	NOUN
brj-23453	25	22	,	,	PUNCT
brj-23453	25	23	thereby	thereby	ADV
brj-23453	25	24	fully	fully	ADV
brj-23453	25	25	harnessing	harness	VERB
brj-23453	25	26	the	the	DET
brj-23453	25	27	immense	immense	ADJ
brj-23453	25	28	potential	potential	NOUN
brj-23453	25	29	of	of	ADP
brj-23453	25	30	walnut	walnut	NOUN
brj-23453	25	31	diversity	diversity	NOUN
brj-23453	25	32	.	.	PUNCT
brj-23453	26	1	furthermore	furthermore	ADV
brj-23453	26	2	,	,	PUNCT
brj-23453	26	3	genetic	genetic	ADJ
brj-23453	26	4	diversity	diversity	NOUN
brj-23453	26	5	within	within	ADP
brj-23453	26	6	or	or	CCONJ
brj-23453	26	7	between	between	ADP
brj-23453	26	8	species	specie	NOUN
brj-23453	26	9	could	could	AUX
brj-23453	26	10	be	be	AUX
brj-23453	26	11	ascertained	ascertain	VERB
brj-23453	26	12	by	by	ADP
brj-23453	26	13	employing	employ	VERB
brj-23453	26	14	molecular	molecular	ADJ
brj-23453	26	15	and	and	CCONJ
brj-23453	26	16	biochemical	biochemical	ADJ
brj-23453	26	17	markers	marker	NOUN
brj-23453	26	18	to	to	PART
brj-23453	26	19	genetically	genetically	ADV
brj-23453	26	20	characterize	characterize	VERB
brj-23453	26	21	walnut	walnut	NOUN
brj-23453	26	22	varieties	variety	NOUN
brj-23453	26	23	,	,	PUNCT
brj-23453	26	24	in	in	ADP
brj-23453	26	25	addition	addition	NOUN
brj-23453	26	26	to	to	ADP
brj-23453	26	27	visual	visual	ADJ
brj-23453	26	28	identification	identification	NOUN
brj-23453	26	29	(	(	PUNCT
brj-23453	26	30	cervera	cervera	NOUN
brj-23453	26	31	et	et	PROPN
brj-23453	26	32	al	al	PROPN
brj-23453	26	33	.	.	PROPN
brj-23453	26	34	2000	2000	NUM
brj-23453	26	35	)	)	PUNCT
brj-23453	26	36	.	.	PUNCT
brj-23453	27	1	molecular	molecular	ADJ
brj-23453	27	2	markers	marker	NOUN
brj-23453	27	3	,	,	PUNCT
brj-23453	27	4	such	such	ADJ
brj-23453	27	5	as	as	ADP
brj-23453	27	6	rapds	rapds	NOUN
brj-23453	27	7	(	(	PUNCT
brj-23453	27	8	randomly	randomly	ADV
brj-23453	27	9	amplified	amplify	VERB
brj-23453	27	10	polymorphic	polymorphic	ADJ
brj-23453	27	11	dnas	dna	NOUN
brj-23453	27	12	)	)	PUNCT
brj-23453	27	13	,	,	PUNCT
brj-23453	27	14	rflps	rflp	NOUN
brj-23453	27	15	(	(	PUNCT
brj-23453	27	16	restriction	restriction	NOUN
brj-23453	27	17	fragment	fragment	NOUN
brj-23453	27	18	length	length	NOUN
brj-23453	27	19	polymorphisms	polymorphism	NOUN
brj-23453	27	20	)	)	PUNCT
brj-23453	27	21	,	,	PUNCT
brj-23453	27	22	issrs	issrs	X
brj-23453	27	23	(	(	PUNCT
brj-23453	27	24	inter	inter	ADJ
brj-23453	27	25	simple	simple	ADJ
brj-23453	27	26	sequence	sequence	NOUN
brj-23453	27	27	repeats	repeat	NOUN
brj-23453	27	28	)	)	PUNCT
brj-23453	27	29	(	(	PUNCT
brj-23453	27	30	potter	potter	NOUN
brj-23453	27	31	et	et	PROPN
brj-23453	27	32	al	al	PROPN
brj-23453	27	33	.	.	PROPN
brj-23453	27	34	2002	2002	NUM
brj-23453	27	35	)	)	PUNCT
brj-23453	27	36	,	,	PUNCT
brj-23453	27	37	and	and	CCONJ
brj-23453	27	38	ssrs	ssrs	PROPN
brj-23453	27	39	(	(	PUNCT
brj-23453	27	40	simple	simple	ADJ
brj-23453	27	41	sequence	sequence	NOUN
brj-23453	27	42	repeats	repeat	NOUN
brj-23453	27	43	)	)	PUNCT
brj-23453	27	44	(	(	PUNCT
brj-23453	27	45	victory	victory	NOUN
brj-23453	27	46	et	et	PROPN
brj-23453	27	47	al	al	PROPN
brj-23453	27	48	.	.	PROPN
brj-23453	27	49	2006	2006	NUM
brj-23453	27	50	)	)	PUNCT
brj-23453	27	51	,	,	PUNCT
brj-23453	27	52	have	have	AUX
brj-23453	27	53	emerged	emerge	VERB
brj-23453	27	54	as	as	ADP
brj-23453	27	55	indispensable	indispensable	ADJ
brj-23453	27	56	tools	tool	NOUN
brj-23453	27	57	in	in	ADP
brj-23453	27	58	the	the	DET
brj-23453	27	59	characterization	characterization	NOUN
brj-23453	27	60	of	of	ADP
brj-23453	27	61	walnuts	walnut	NOUN
brj-23453	27	62	.	.	PUNCT
brj-23453	28	1	these	these	DET
brj-23453	28	2	markers	marker	NOUN
brj-23453	28	3	offer	offer	VERB
brj-23453	28	4	a	a	DET
brj-23453	28	5	comprehensive	comprehensive	ADJ
brj-23453	28	6	approach	approach	NOUN
brj-23453	28	7	to	to	ADP
brj-23453	28	8	understanding	understand	VERB
brj-23453	28	9	the	the	DET
brj-23453	28	10	genetic	genetic	ADJ
brj-23453	28	11	diversity	diversity	NOUN
brj-23453	28	12	and	and	CCONJ
brj-23453	28	13	population	population	NOUN
brj-23453	28	14	dynamics	dynamic	NOUN
brj-23453	28	15	of	of	ADP
brj-23453	28	16	this	this	DET
brj-23453	28	17	valuable	valuable	ADJ
brj-23453	28	18	tree	tree	NOUN
brj-23453	28	19	species	specie	NOUN
brj-23453	28	20	.	.	PUNCT
brj-23453	29	1	in	in	ADP
brj-23453	29	2	contrast	contrast	NOUN
brj-23453	29	3	to	to	ADP
brj-23453	29	4	alternative	alternative	ADJ
brj-23453	29	5	marker	marker	NOUN
brj-23453	29	6	types	type	NOUN
brj-23453	29	7	,	,	PUNCT
brj-23453	29	8	ssr	ssr	PROPN
brj-23453	29	9	markers	marker	NOUN
brj-23453	29	10	possess	possess	VERB
brj-23453	29	11	the	the	DET
brj-23453	29	12	ability	ability	NOUN
brj-23453	29	13	to	to	PART
brj-23453	29	14	discern	discern	VERB
brj-23453	29	15	species	specie	NOUN
brj-23453	29	16	genetics	genetic	NOUN
brj-23453	29	17	unaffected	unaffected	ADJ
brj-23453	29	18	by	by	ADP
brj-23453	29	19	environmental	environmental	ADJ
brj-23453	29	20	factors	factor	NOUN
brj-23453	29	21	.	.	PUNCT
brj-23453	30	1	in	in	ADP
brj-23453	30	2	this	this	DET
brj-23453	30	3	regard	regard	NOUN
brj-23453	30	4	,	,	PUNCT
brj-23453	30	5	they	they	PRON
brj-23453	30	6	have	have	AUX
brj-23453	30	7	been	be	AUX
brj-23453	30	8	utilized	utilize	VERB
brj-23453	30	9	to	to	PART
brj-23453	30	10	examine	examine	VERB
brj-23453	30	11	genetic	genetic	ADJ
brj-23453	30	12	relationships	relationship	NOUN
brj-23453	30	13	among	among	ADP
brj-23453	30	14	walnut	walnut	NOUN
brj-23453	30	15	germplasm	germplasm	NOUN
brj-23453	30	16	and	and	CCONJ
brj-23453	30	17	have	have	AUX
brj-23453	30	18	been	be	AUX
brj-23453	30	19	validated	validate	VERB
brj-23453	30	20	as	as	ADP
brj-23453	30	21	the	the	DET
brj-23453	30	22	most	most	ADV
brj-23453	30	23	effective	effective	ADJ
brj-23453	30	24	(	(	PUNCT
brj-23453	30	25	dangl	dangl	ADJ
brj-23453	30	26	et	et	PROPN
brj-23453	30	27	al	al	PROPN
brj-23453	30	28	.	.	PROPN
brj-23453	30	29	2005	2005	NUM
brj-23453	30	30	;	;	PUNCT
brj-23453	30	31	di	di	X
brj-23453	30	32	et	et	PROPN
brj-23453	30	33	al	al	PROPN
brj-23453	30	34	.	.	PROPN
brj-23453	30	35	2006	2006	NUM
brj-23453	30	36	;	;	PUNCT
brj-23453	30	37	bernard	bernard	PROPN
brj-23453	30	38	et	et	PROPN
brj-23453	30	39	al	al	PROPN
brj-23453	30	40	.	.	PROPN
brj-23453	30	41	2018	2018	NUM
brj-23453	30	42	;	;	PUNCT
brj-23453	30	43	torokeldiev	torokeldiev	VERB
brj-23453	30	44	et	et	PROPN
brj-23453	30	45	al	al	PROPN
brj-23453	30	46	.	.	PROPN
brj-23453	30	47	2018	2018	NUM
brj-23453	30	48	;	;	PUNCT
brj-23453	30	49	yuan	yuan	NOUN
brj-23453	30	50	et	et	PROPN
brj-23453	30	51	al	al	PROPN
brj-23453	30	52	.	.	PROPN
brj-23453	30	53	2018	2018	NUM
brj-23453	30	54	;	;	PUNCT
brj-23453	30	55	balapanov	balapanov	NOUN
brj-23453	30	56	et	et	PROPN
brj-23453	30	57	al	al	PROPN
brj-23453	30	58	.	.	PROPN
brj-23453	30	59	2019	2019	NUM
brj-23453	30	60	;	;	PUNCT
brj-23453	30	61	lorenzo	lorenzo	PROPN
brj-23453	30	62	and	and	CCONJ
brj-23453	30	63	michelangelo	michelangelo	NOUN
brj-23453	30	64	2020	2020	NUM
brj-23453	30	65	)	)	PUNCT
brj-23453	30	66	.	.	PUNCT
brj-23453	31	1	microsatellites	microsatellite	NOUN
brj-23453	31	2	have	have	AUX
brj-23453	31	3	exhibited	exhibit	VERB
brj-23453	31	4	considerable	considerable	ADJ
brj-23453	31	5	ubiquity	ubiquity	NOUN
brj-23453	31	6	and	and	CCONJ
brj-23453	31	7	interspecies	interspecie	VERB
brj-23453	31	8	transferability	transferability	NOUN
brj-23453	31	9	in	in	ADP
brj-23453	31	10	the	the	DET
brj-23453	31	11	genomes	genome	NOUN
brj-23453	31	12	of	of	ADP
brj-23453	31	13	juglans	juglan	NOUN
brj-23453	31	14	(	(	PUNCT
brj-23453	31	15	ebrahimi	ebrahimi	X
brj-23453	31	16	et	et	PROPN
brj-23453	31	17	al	al	PROPN
brj-23453	31	18	.	.	PROPN
brj-23453	31	19	2016	2016	NUM
brj-23453	31	20	)	)	PUNCT
brj-23453	31	21	.	.	PUNCT
brj-23453	32	1	ahmed	ahmed	PROPN
brj-23453	32	2	et	et	PROPN
brj-23453	32	3	al	al	PROPN
brj-23453	32	4	.	.	PROPN
brj-23453	33	1	(	(	PUNCT
brj-23453	33	2	2012	2012	NUM
brj-23453	33	3	)	)	PUNCT
brj-23453	33	4	observed	observe	VERB
brj-23453	33	5	that	that	SCONJ
brj-23453	33	6	walnut	walnut	ADJ
brj-23453	33	7	populations	population	NOUN
brj-23453	33	8	in	in	ADP
brj-23453	33	9	india	india	PROPN
brj-23453	33	10	exhibited	exhibit	VERB
brj-23453	33	11	considerable	considerable	ADJ
brj-23453	33	12	genetic	genetic	ADJ
brj-23453	33	13	heterogeneity	heterogeneity	NOUN
brj-23453	33	14	,	,	PUNCT
brj-23453	33	15	as	as	SCONJ
brj-23453	33	16	determined	determine	VERB
brj-23453	33	17	by	by	ADP
brj-23453	33	18	morphological	morphological	ADJ
brj-23453	33	19	,	,	PUNCT
brj-23453	33	20	rapd	rapd	NOUN
brj-23453	33	21	,	,	PUNCT
brj-23453	33	22	and	and	CCONJ
brj-23453	33	23	ssr	ssr	ADJ
brj-23453	33	24	markers	marker	NOUN
brj-23453	33	25	.	.	PUNCT
brj-23453	34	1	ssr	ssr	PROPN
brj-23453	34	2	markers	marker	NOUN
brj-23453	34	3	are	be	AUX
brj-23453	34	4	increasingly	increasingly	ADV
brj-23453	34	5	recognized	recognize	VERB
brj-23453	34	6	and	and	CCONJ
brj-23453	34	7	utilized	utilize	VERB
brj-23453	34	8	in	in	ADP
brj-23453	34	9	the	the	DET
brj-23453	34	10	molecular	molecular	ADJ
brj-23453	34	11	characterization	characterization	NOUN
brj-23453	34	12	of	of	ADP
brj-23453	34	13	various	various	ADJ
brj-23453	34	14	plant	plant	NOUN
brj-23453	34	15	species	specie	NOUN
brj-23453	34	16	(	(	PUNCT
brj-23453	34	17	litt	litt	X
brj-23453	34	18	and	and	CCONJ
brj-23453	34	19	luty	luty	ADJ
brj-23453	34	20	1989	1989	NUM
brj-23453	34	21	;	;	PUNCT
brj-23453	34	22	gupta	gupta	NOUN
brj-23453	34	23	and	and	CCONJ
brj-23453	34	24	varshney	varshney	NOUN
brj-23453	34	25	2000	2000	NUM
brj-23453	34	26	)	)	PUNCT
brj-23453	34	27	.	.	PUNCT
brj-23453	35	1	cervera	cervera	NOUN
brj-23453	35	2	et	et	PROPN
brj-23453	35	3	al	al	PROPN
brj-23453	35	4	.	.	PROPN
brj-23453	36	1	(	(	PUNCT
brj-23453	36	2	2000	2000	NUM
brj-23453	36	3	)	)	PUNCT
brj-23453	36	4	define	define	VERB
brj-23453	36	5	ssrs	ssr	NOUN
brj-23453	36	6	as	as	ADP
brj-23453	36	7	a	a	DET
brj-23453	36	8	compilation	compilation	NOUN
brj-23453	36	9	of	of	ADP
brj-23453	36	10	short	short	ADJ
brj-23453	36	11	motifs	motif	NOUN
brj-23453	36	12	varying	vary	VERB
brj-23453	36	13	in	in	ADP
brj-23453	36	14	length	length	NOUN
brj-23453	36	15	from	from	ADP
brj-23453	36	16	1	1	NUM
brj-23453	36	17	to	to	PART
brj-23453	36	18	6	6	NUM
brj-23453	36	19	base	base	NOUN
brj-23453	36	20	pairs	pair	NOUN
brj-23453	36	21	.	.	PUNCT
brj-23453	37	1	multiallelism	multiallelism	NOUN
brj-23453	37	2	,	,	PUNCT
brj-23453	37	3	codominance	codominance	NOUN
brj-23453	37	4	,	,	PUNCT
brj-23453	37	5	repeatability	repeatability	NOUN
brj-23453	37	6	,	,	PUNCT
brj-23453	37	7	and	and	CCONJ
brj-23453	37	8	adequate	adequate	ADJ
brj-23453	37	9	genome	genome	NOUN
brj-23453	37	10	coverage	coverage	NOUN
brj-23453	37	11	have	have	AUX
brj-23453	37	12	emerged	emerge	VERB
brj-23453	37	13	as	as	ADP
brj-23453	37	14	potent	potent	ADJ
brj-23453	37	15	instruments	instrument	NOUN
brj-23453	37	16	for	for	ADP
brj-23453	37	17	integrating	integrate	VERB
brj-23453	37	18	sequence	sequence	NOUN
brj-23453	37	19	-	-	PUNCT
brj-23453	37	20	based	base	VERB
brj-23453	37	21	physical	physical	ADJ
brj-23453	37	22	mapping	mapping	NOUN
brj-23453	37	23	with	with	ADP
brj-23453	37	24	physiological	physiological	ADJ
brj-23453	37	25	and	and	CCONJ
brj-23453	37	26	genetic	genetic	ADJ
brj-23453	37	27	mapping	mapping	NOUN
brj-23453	37	28	in	in	ADP
brj-23453	37	29	plants	plant	NOUN
brj-23453	37	30	(	(	PUNCT
brj-23453	37	31	jacobs	jacobs	PROPN
brj-23453	37	32	et	et	PROPN
brj-23453	37	33	al	al	PROPN
brj-23453	37	34	.	.	PROPN
brj-23453	37	35	2006	2006	NUM
brj-23453	37	36	)	)	PUNCT
brj-23453	37	37	.	.	PUNCT
brj-23453	38	1	the	the	DET
brj-23453	38	2	utilization	utilization	NOUN
brj-23453	38	3	of	of	ADP
brj-23453	38	4	ssr	ssr	PROPN
brj-23453	38	5	markers	marker	NOUN
brj-23453	38	6	in	in	ADP
brj-23453	38	7	combination	combination	NOUN
brj-23453	38	8	with	with	ADP
brj-23453	38	9	rapd	rapd	NOUN
brj-23453	38	10	markers	marker	NOUN
brj-23453	38	11	has	have	AUX
brj-23453	38	12	been	be	AUX
brj-23453	38	13	demonstrated	demonstrate	VERB
brj-23453	38	14	to	to	PART
brj-23453	38	15	be	be	AUX
brj-23453	38	16	an	an	DET
brj-23453	38	17	effective	effective	ADJ
brj-23453	38	18	method	method	NOUN
brj-23453	38	19	for	for	ADP
brj-23453	38	20	evaluating	evaluate	VERB
brj-23453	38	21	molecular	molecular	ADJ
brj-23453	38	22	diversity	diversity	NOUN
brj-23453	38	23	and	and	CCONJ
brj-23453	38	24	genetic	genetic	ADJ
brj-23453	38	25	relationships	relationship	NOUN
brj-23453	38	26	between	between	ADP
brj-23453	38	27	various	various	ADJ
brj-23453	38	28	crop	crop	NOUN
brj-23453	38	29	species	specie	NOUN
brj-23453	38	30	.	.	PUNCT
brj-23453	39	1	prominent	prominent	ADJ
brj-23453	39	2	inheritance	inheritance	NOUN
brj-23453	39	3	,	,	PUNCT
brj-23453	39	4	ease	ease	NOUN
brj-23453	39	5	of	of	ADP
brj-23453	39	6	pcr	pcr	ADJ
brj-23453	39	7	detection	detection	NOUN
brj-23453	39	8	,	,	PUNCT
brj-23453	39	9	high	high	ADJ
brj-23453	39	10	polymorphism	polymorphism	NOUN
brj-23453	39	11	,	,	PUNCT
brj-23453	39	12	and	and	CCONJ
brj-23453	39	13	repeatability	repeatability	NOUN
brj-23453	39	14	are	be	AUX
brj-23453	39	15	all	all	PRON
brj-23453	39	16	attributes	attribute	NOUN
brj-23453	39	17	that	that	PRON
brj-23453	39	18	contribute	contribute	VERB
brj-23453	39	19	to	to	ADP
brj-23453	39	20	the	the	DET
brj-23453	39	21	high	high	ADJ
brj-23453	39	22	resolution	resolution	NOUN
brj-23453	39	23	that	that	PRON
brj-23453	39	24	these	these	DET
brj-23453	39	25	markers	marker	NOUN
brj-23453	39	26	offer	offer	VERB
brj-23453	39	27	for	for	ADP
brj-23453	39	28	genetic	genetic	ADJ
brj-23453	39	29	investigations	investigation	NOUN
brj-23453	39	30	(	(	PUNCT
brj-23453	39	31	gupta	gupta	NOUN
brj-23453	39	32	and	and	CCONJ
brj-23453	39	33	varshney	varshney	NOUN
brj-23453	39	34	2000	2000	NUM
brj-23453	39	35	)	)	PUNCT
brj-23453	39	36	.	.	PUNCT
brj-23453	40	1	these	these	DET
brj-23453	40	2	markers	marker	NOUN
brj-23453	40	3	have	have	AUX
brj-23453	40	4	evolved	evolve	VERB
brj-23453	40	5	into	into	ADP
brj-23453	40	6	highly	highly	ADV
brj-23453	40	7	versatile	versatile	ADJ
brj-23453	40	8	tools	tool	NOUN
brj-23453	40	9	that	that	PRON
brj-23453	40	10	are	be	AUX
brj-23453	40	11	commonly	commonly	ADV
brj-23453	40	12	employed	employ	VERB
brj-23453	40	13	as	as	ADP
brj-23453	40	14	genetic	genetic	ADJ
brj-23453	40	15	markers	marker	NOUN
brj-23453	40	16	across	across	ADP
brj-23453	40	17	various	various	ADJ
brj-23453	40	18	plant	plant	NOUN
brj-23453	40	19	species	specie	NOUN
brj-23453	40	20	.	.	PUNCT
brj-23453	41	1	markers	marker	NOUN
brj-23453	41	2	with	with	ADP
brj-23453	41	3	these	these	DET
brj-23453	41	4	characteristics	characteristic	NOUN
brj-23453	41	5	—	—	PUNCT
brj-23453	41	6	codominant	codominant	ADJ
brj-23453	41	7	,	,	PUNCT
brj-23453	41	8	hypervariable	hypervariable	ADJ
brj-23453	41	9	,	,	PUNCT
brj-23453	41	10	and	and	CCONJ
brj-23453	41	11	multiallelic	multiallelic	ADJ
brj-23453	41	12	—	—	PUNCT
brj-23453	41	13	are	be	AUX
brj-23453	41	14	favored	favor	VERB
brj-23453	41	15	for	for	ADP
brj-23453	41	16	use	use	NOUN
brj-23453	41	17	in	in	ADP
brj-23453	41	18	conservation	conservation	NOUN
brj-23453	41	19	genetics	genetic	NOUN
brj-23453	41	20	,	,	PUNCT
brj-23453	41	21	plant	plant	NOUN
brj-23453	41	22	breeding	breeding	NOUN
brj-23453	41	23	,	,	PUNCT
brj-23453	41	24	fingerprinting	fingerprinting	NOUN
brj-23453	41	25	,	,	PUNCT
brj-23453	41	26	and	and	CCONJ
brj-23453	41	27	phylogenetic	phylogenetic	ADJ
brj-23453	41	28	analyses	analysis	NOUN
brj-23453	41	29	.	.	PUNCT
brj-23453	42	1	ssrs	ssr	NOUN
brj-23453	42	2	are	be	AUX
brj-23453	42	3	tandemly	tandemly	ADV
brj-23453	42	4	repeated	repeat	VERB
brj-23453	42	5	dna	dna	PROPN
brj-23453	42	6	sequences	sequence	NOUN
brj-23453	42	7	ranging	range	VERB
brj-23453	42	8	from	from	ADP
brj-23453	42	9	two	two	NUM
brj-23453	42	10	to	to	PART
brj-23453	42	11	six	six	NUM
brj-23453	42	12	nucleotides	nucleotide	NOUN
brj-23453	42	13	.	.	PUNCT
brj-23453	43	1	karimi	karimi	PROPN
brj-23453	43	2	et	et	PROPN
brj-23453	43	3	al	al	PROPN
brj-23453	43	4	.	.	PROPN
brj-23453	43	5	(	(	PUNCT
brj-23453	43	6	2010	2010	NUM
brj-23453	43	7	)	)	PUNCT
brj-23453	43	8	found	find	VERB
brj-23453	43	9	its	its	PRON
brj-23453	43	10	widespread	widespread	ADJ
brj-23453	43	11	application	application	NOUN
brj-23453	43	12	in	in	ADP
brj-23453	43	13	breeding	breeding	NOUN
brj-23453	43	14	programs	program	NOUN
brj-23453	43	15	,	,	PUNCT
brj-23453	43	16	and	and	CCONJ
brj-23453	43	17	evolutionary	evolutionary	ADJ
brj-23453	43	18	and	and	CCONJ
brj-23453	43	19	conservation	conservation	NOUN
brj-23453	43	20	biology	biology	NOUN
brj-23453	43	21	.	.	PUNCT
brj-23453	44	1	multiple	multiple	ADJ
brj-23453	44	2	studies	study	NOUN
brj-23453	44	3	have	have	AUX
brj-23453	44	4	identified	identify	VERB
brj-23453	44	5	ssrs	ssr	NOUN
brj-23453	44	6	in	in	ADP
brj-23453	44	7	plants	plant	NOUN
brj-23453	44	8	and	and	CCONJ
brj-23453	44	9	other	other	ADJ
brj-23453	44	10	eukaryotic	eukaryotic	ADJ
brj-23453	44	11	taxa	taxa	NOUN
brj-23453	44	12	,	,	PUNCT
brj-23453	44	13	providing	provide	VERB
brj-23453	44	14	evidence	evidence	NOUN
brj-23453	44	15	of	of	ADP
brj-23453	44	16	their	their	PRON
brj-23453	44	17	utility	utility	NOUN
brj-23453	44	18	and	and	CCONJ
brj-23453	44	19	application	application	NOUN
brj-23453	44	20	(	(	PUNCT
brj-23453	44	21	mahmoodi	mahmoodi	NOUN
brj-23453	44	22	et	et	PROPN
brj-23453	44	23	al	al	PROPN
brj-23453	44	24	.	.	PROPN
brj-23453	44	25	2013	2013	NUM
brj-23453	44	26	)	)	PUNCT
brj-23453	44	27	.	.	PUNCT
brj-23453	45	1	with	with	ADP
brj-23453	45	2	an	an	DET
brj-23453	45	3	emphasis	emphasis	NOUN
brj-23453	45	4	on	on	ADP
brj-23453	45	5	precision	precision	NOUN
brj-23453	45	6	and	and	CCONJ
brj-23453	45	7	reliability	reliability	NOUN
brj-23453	45	8	,	,	PUNCT
brj-23453	45	9	microsatellite	microsatellite	ADJ
brj-23453	45	10	markers	marker	NOUN
brj-23453	45	11	have	have	AUX
brj-23453	45	12	become	become	VERB
brj-23453	45	13	instrumental	instrumental	ADJ
brj-23453	45	14	in	in	ADP
brj-23453	45	15	elucidating	elucidate	VERB
brj-23453	45	16	genetic	genetic	ADJ
brj-23453	45	17	diversity	diversity	NOUN
brj-23453	45	18	.	.	PUNCT
brj-23453	46	1	notably	notably	ADV
brj-23453	46	2	,	,	PUNCT
brj-23453	46	3	these	these	DET
brj-23453	46	4	markers	marker	NOUN
brj-23453	46	5	have	have	AUX
brj-23453	46	6	unveiled	unveil	VERB
brj-23453	46	7	a	a	DET
brj-23453	46	8	remarkable	remarkable	ADJ
brj-23453	46	9	aspect	aspect	NOUN
brj-23453	46	10	of	of	ADP
brj-23453	46	11	walnuts	walnut	NOUN
brj-23453	46	12	,	,	PUNCT
brj-23453	46	13	showcasing	showcase	VERB
brj-23453	46	14	the	the	DET
brj-23453	46	15	highest	high	ADJ
brj-23453	46	16	level	level	NOUN
brj-23453	46	17	of	of	ADP
brj-23453	46	18	polymorphism	polymorphism	NOUN
brj-23453	46	19	at	at	ADP
brj-23453	46	20	an	an	DET
brj-23453	46	21	impressive	impressive	ADJ
brj-23453	46	22	rate	rate	NOUN
brj-23453	46	23	of	of	ADP
brj-23453	46	24	89.6	89.6	NUM
brj-23453	46	25	%	%	NOUN
brj-23453	46	26	(	(	PUNCT
brj-23453	46	27	hamza	hamza	PROPN
brj-23453	46	28	et	et	PROPN
brj-23453	46	29	al	al	PROPN
brj-23453	46	30	.	.	PROPN
brj-23453	46	31	2004	2004	NUM
brj-23453	46	32	;	;	PUNCT
brj-23453	46	33	karimi	karimi	PROPN
brj-23453	46	34	et	et	PROPN
brj-23453	46	35	al	al	PROPN
brj-23453	46	36	.	.	PROPN
brj-23453	46	37	2010	2010	NUM
brj-23453	46	38	;	;	PUNCT
brj-23453	46	39	ahmed	ahmed	PROPN
brj-23453	46	40	et	et	PROPN
brj-23453	46	41	al	al	PROPN
brj-23453	46	42	.	.	PROPN
brj-23453	46	43	2012	2012	NUM
brj-23453	46	44	;	;	PUNCT
brj-23453	46	45	salieh	salieh	PROPN
brj-23453	46	46	et	et	PROPN
brj-23453	46	47	al	al	PROPN
brj-23453	46	48	.	.	PROPN
brj-23453	46	49	2013	2013	NUM
brj-23453	46	50	)	)	PUNCT
brj-23453	46	51	.	.	PUNCT
brj-23453	47	1	ahmed	ahmed	PROPN
brj-23453	47	2	et	et	PROPN
brj-23453	47	3	al	al	PROPN
brj-23453	47	4	.	.	PROPN
brj-23453	48	1	(	(	PUNCT
brj-23453	48	2	2012	2012	NUM
brj-23453	48	3	)	)	PUNCT
brj-23453	48	4	identified	identify	VERB
brj-23453	48	5	,	,	PUNCT
brj-23453	48	6	on	on	ADP
brj-23453	48	7	average	average	ADJ
brj-23453	48	8	,	,	PUNCT
brj-23453	48	9	two	two	NUM
brj-23453	48	10	polymorphic	polymorphic	ADJ
brj-23453	48	11	ssr	ssr	NOUN
brj-23453	48	12	loci	locus	NOUN
brj-23453	48	13	per	per	ADP
brj-23453	48	14	ssr	ssr	NOUN
brj-23453	48	15	primer	primer	NOUN
brj-23453	48	16	using	use	VERB
brj-23453	48	17	13	13	NUM
brj-23453	48	18	ssr	ssr	ADJ
brj-23453	48	19	primers	primer	NOUN
brj-23453	48	20	.	.	PUNCT
brj-23453	49	1	the	the	DET
brj-23453	49	2	walnut	walnut	ADJ
brj-23453	49	3	vegetation	vegetation	NOUN
brj-23453	49	4	in	in	ADP
brj-23453	49	5	the	the	DET
brj-23453	49	6	kashmir	kashmir	PROPN
brj-23453	49	7	region	region	PROPN
brj-23453	49	8	consists	consist	VERB
brj-23453	49	9	primarily	primarily	ADV
brj-23453	49	10	of	of	ADP
brj-23453	49	11	fortuitous	fortuitous	ADJ
brj-23453	49	12	seedlings	seedling	NOUN
brj-23453	49	13	,	,	PUNCT
brj-23453	49	14	and	and	CCONJ
brj-23453	49	15	to	to	ADP
brj-23453	49	16	date	date	NOUN
brj-23453	49	17	,	,	PUNCT
brj-23453	49	18	no	no	DET
brj-23453	49	19	characterization	characterization	NOUN
brj-23453	49	20	has	have	AUX
brj-23453	49	21	been	be	AUX
brj-23453	49	22	conducted	conduct	VERB
brj-23453	49	23	on	on	ADP
brj-23453	49	24	walnut	walnut	NOUN
brj-23453	49	25	plants	plant	NOUN
brj-23453	49	26	originating	originate	VERB
brj-23453	49	27	from	from	ADP
brj-23453	49	28	the	the	DET
brj-23453	49	29	study	study	NOUN
brj-23453	49	30	areas	area	NOUN
brj-23453	49	31	.	.	PUNCT
brj-23453	50	1	utilizing	utilize	VERB
brj-23453	50	2	the	the	DET
brj-23453	50	3	information	information	NOUN
brj-23453	50	4	and	and	CCONJ
brj-23453	50	5	efficacy	efficacy	NOUN
brj-23453	50	6	peer	peer	NOUN
brj-23453	50	7	-	-	PUNCT
brj-23453	50	8	reviewed	review	VERB
brj-23453	50	9	article	article	NOUN
brj-23453	50	10	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	50	11	wani	wani	PROPN
brj-23453	50	12	et	et	PROPN
brj-23453	50	13	al	al	PROPN
brj-23453	50	14	.	.	PROPN
brj-23453	51	1	(	(	PUNCT
brj-23453	51	2	2024	2024	NUM
brj-23453	51	3	)	)	PUNCT
brj-23453	51	4	.	.	PUNCT
brj-23453	52	1	“	"	PUNCT
brj-23453	52	2	walnut	walnut	ADJ
brj-23453	52	3	population	population	NOUN
brj-23453	52	4	&	&	CCONJ
brj-23453	52	5	diversity	diversity	NOUN
brj-23453	52	6	,	,	PUNCT
brj-23453	52	7	”	"	PUNCT
brj-23453	52	8	bioresources	bioresource	NOUN
brj-23453	52	9	19(3	19(3	NUM
brj-23453	52	10	)	)	PUNCT
brj-23453	52	11	,	,	PUNCT
brj-23453	52	12	4213	4213	NUM
brj-23453	52	13	-	-	SYM
brj-23453	52	14	4237	4237	NUM
brj-23453	52	15	.	.	PUNCT
brj-23453	53	1	4215	4215	NUM
brj-23453	53	2	generated	generate	VERB
brj-23453	53	3	by	by	ADP
brj-23453	53	4	microsatellite	microsatellite	NOUN
brj-23453	53	5	-	-	PUNCT
brj-23453	53	6	based	base	VERB
brj-23453	53	7	markers	marker	NOUN
brj-23453	53	8	,	,	PUNCT
brj-23453	53	9	the	the	DET
brj-23453	53	10	objective	objective	NOUN
brj-23453	53	11	of	of	ADP
brj-23453	53	12	this	this	DET
brj-23453	53	13	study	study	NOUN
brj-23453	53	14	was	be	AUX
brj-23453	53	15	to	to	PART
brj-23453	53	16	assess	assess	VERB
brj-23453	53	17	the	the	DET
brj-23453	53	18	genetic	genetic	ADJ
brj-23453	53	19	population	population	NOUN
brj-23453	53	20	,	,	PUNCT
brj-23453	53	21	genetic	genetic	ADJ
brj-23453	53	22	connections	connection	NOUN
brj-23453	53	23	,	,	PUNCT
brj-23453	53	24	and	and	CCONJ
brj-23453	53	25	genotype	genotype	NOUN
brj-23453	53	26	identity	identity	NOUN
brj-23453	53	27	of	of	ADP
brj-23453	53	28	21	21	NUM
brj-23453	53	29	walnut	walnut	NOUN
brj-23453	53	30	cultivars	cultivar	NOUN
brj-23453	53	31	sourced	source	VERB
brj-23453	53	32	from	from	ADP
brj-23453	53	33	the	the	DET
brj-23453	53	34	north	north	NOUN
brj-23453	53	35	-	-	PUNCT
brj-23453	53	36	west	west	NOUN
brj-23453	53	37	himalayas	himalayas	PROPN
brj-23453	53	38	in	in	ADP
brj-23453	53	39	the	the	DET
brj-23453	53	40	jammu	jammu	PROPN
brj-23453	53	41	and	and	CCONJ
brj-23453	53	42	kashmir	kashmir	PROPN
brj-23453	53	43	region	region	PROPN
brj-23453	53	44	.	.	PUNCT
brj-23453	54	1	specifically	specifically	ADV
brj-23453	54	2	focusing	focus	VERB
brj-23453	54	3	on	on	ADP
brj-23453	54	4	juglans	juglan	NOUN
brj-23453	54	5	regia	regia	PROPN
brj-23453	54	6	l.	l.	PROPN
brj-23453	54	7	,	,	PUNCT
brj-23453	54	8	commonly	commonly	ADV
brj-23453	54	9	known	know	VERB
brj-23453	54	10	as	as	ADP
brj-23453	54	11	persian	persian	ADJ
brj-23453	54	12	walnut	walnut	NOUN
brj-23453	54	13	or	or	CCONJ
brj-23453	54	14	english	english	ADJ
brj-23453	54	15	walnut	walnut	NOUN
brj-23453	54	16	,	,	PUNCT
brj-23453	54	17	the	the	DET
brj-23453	54	18	aim	aim	NOUN
brj-23453	54	19	was	be	AUX
brj-23453	54	20	to	to	PART
brj-23453	54	21	elucidate	elucidate	VERB
brj-23453	54	22	the	the	DET
brj-23453	54	23	population	population	NOUN
brj-23453	54	24	structure	structure	NOUN
brj-23453	54	25	and	and	CCONJ
brj-23453	54	26	molecular	molecular	ADJ
brj-23453	54	27	genetic	genetic	ADJ
brj-23453	54	28	diversity	diversity	NOUN
brj-23453	54	29	of	of	ADP
brj-23453	54	30	these	these	DET
brj-23453	54	31	walnut	walnut	ADJ
brj-23453	54	32	genotypes	genotype	NOUN
brj-23453	54	33	,	,	PUNCT
brj-23453	54	34	providing	provide	VERB
brj-23453	54	35	insights	insight	NOUN
brj-23453	54	36	into	into	ADP
brj-23453	54	37	their	their	PRON
brj-23453	54	38	genetic	genetic	ADJ
brj-23453	54	39	relationships	relationship	NOUN
brj-23453	54	40	and	and	CCONJ
brj-23453	54	41	diversity	diversity	NOUN
brj-23453	54	42	within	within	ADP
brj-23453	54	43	the	the	DET
brj-23453	54	44	region	region	NOUN
brj-23453	54	45	.	.	PUNCT
brj-23453	55	1	experimental	experimental	ADJ
brj-23453	55	2	sample	sample	NOUN
brj-23453	55	3	collections	collection	NOUN
brj-23453	55	4	of	of	ADP
brj-23453	55	5	leaves	leave	NOUN
brj-23453	55	6	twenty	twenty	NUM
brj-23453	55	7	-	-	PUNCT
brj-23453	55	8	one	one	NUM
brj-23453	55	9	walnut	walnut	NOUN
brj-23453	55	10	genotypes	genotype	NOUN
brj-23453	55	11	,	,	PUNCT
brj-23453	55	12	aged	age	VERB
brj-23453	55	13	between	between	ADP
brj-23453	55	14	50	50	NUM
brj-23453	55	15	and	and	CCONJ
brj-23453	55	16	100	100	NUM
brj-23453	55	17	years	year	NOUN
brj-23453	55	18	,	,	PUNCT
brj-23453	55	19	were	be	AUX
brj-23453	55	20	selected	select	VERB
brj-23453	55	21	from	from	ADP
brj-23453	55	22	the	the	DET
brj-23453	55	23	ganderbal	ganderbal	NOUN
brj-23453	55	24	and	and	CCONJ
brj-23453	55	25	budgam	budgam	NOUN
brj-23453	55	26	valleys	valley	NOUN
brj-23453	55	27	located	locate	VERB
brj-23453	55	28	in	in	ADP
brj-23453	55	29	the	the	DET
brj-23453	55	30	kashmiri	kashmiri	PROPN
brj-23453	55	31	district	district	PROPN
brj-23453	55	32	of	of	ADP
brj-23453	55	33	ganderbal	ganderbal	NOUN
brj-23453	55	34	for	for	ADP
brj-23453	55	35	inclusion	inclusion	NOUN
brj-23453	55	36	in	in	ADP
brj-23453	55	37	this	this	DET
brj-23453	55	38	study	study	NOUN
brj-23453	55	39	.	.	PUNCT
brj-23453	56	1	leaf	leaf	NOUN
brj-23453	56	2	samples	sample	NOUN
brj-23453	56	3	were	be	AUX
brj-23453	56	4	collected	collect	VERB
brj-23453	56	5	from	from	ADP
brj-23453	56	6	each	each	DET
brj-23453	56	7	genotype	genotype	NOUN
brj-23453	56	8	at	at	ADP
brj-23453	56	9	a	a	DET
brj-23453	56	10	consistent	consistent	ADJ
brj-23453	56	11	height	height	NOUN
brj-23453	56	12	of	of	ADP
brj-23453	56	13	1.5	1.5	NUM
brj-23453	56	14	meters	meter	NOUN
brj-23453	56	15	above	above	ADP
brj-23453	56	16	ground	ground	NOUN
brj-23453	56	17	level	level	NOUN
brj-23453	56	18	to	to	PART
brj-23453	56	19	ensure	ensure	VERB
brj-23453	56	20	uniformity	uniformity	NOUN
brj-23453	56	21	in	in	ADP
brj-23453	56	22	sampling	sample	VERB
brj-23453	56	23	across	across	ADP
brj-23453	56	24	all	all	DET
brj-23453	56	25	genotypes	genotype	NOUN
brj-23453	56	26	.	.	PUNCT
brj-23453	57	1	these	these	DET
brj-23453	57	2	samples	sample	NOUN
brj-23453	57	3	were	be	AUX
brj-23453	57	4	subsequently	subsequently	ADV
brj-23453	57	5	analyzed	analyze	VERB
brj-23453	57	6	at	at	ADP
brj-23453	57	7	the	the	DET
brj-23453	57	8	virus	virus	NOUN
brj-23453	57	9	indexing	indexing	NOUN
brj-23453	57	10	and	and	CCONJ
brj-23453	57	11	molecular	molecular	ADJ
brj-23453	57	12	laboratory	laboratory	NOUN
brj-23453	57	13	,	,	PUNCT
brj-23453	57	14	cith	cith	PROPN
brj-23453	57	15	,	,	PUNCT
brj-23453	57	16	srinagar	srinagar	NOUN
brj-23453	57	17	,	,	PUNCT
brj-23453	57	18	and	and	CCONJ
brj-23453	57	19	the	the	DET
brj-23453	57	20	division	division	NOUN
brj-23453	57	21	of	of	ADP
brj-23453	57	22	biotechnology	biotechnology	NOUN
brj-23453	57	23	,	,	PUNCT
brj-23453	57	24	skuast	skuast	NOUN
brj-23453	57	25	-	-	PUNCT
brj-23453	57	26	kashmir	kashmir	PROPN
brj-23453	57	27	.	.	PUNCT
brj-23453	58	1	care	care	PROPN
brj-23453	58	2	was	be	AUX
brj-23453	58	3	taken	take	VERB
brj-23453	58	4	to	to	PART
brj-23453	58	5	avoid	avoid	VERB
brj-23453	58	6	sampling	sample	VERB
brj-23453	58	7	from	from	ADP
brj-23453	58	8	branches	branch	NOUN
brj-23453	58	9	exhibiting	exhibit	VERB
brj-23453	58	10	visible	visible	ADJ
brj-23453	58	11	signs	sign	NOUN
brj-23453	58	12	of	of	ADP
brj-23453	58	13	disease	disease	NOUN
brj-23453	58	14	or	or	CCONJ
brj-23453	58	15	damage	damage	NOUN
brj-23453	58	16	,	,	PUNCT
brj-23453	58	17	as	as	SCONJ
brj-23453	58	18	these	these	PRON
brj-23453	58	19	may	may	AUX
brj-23453	58	20	introduce	introduce	VERB
brj-23453	58	21	confounding	confound	VERB
brj-23453	58	22	factors	factor	NOUN
brj-23453	58	23	into	into	ADP
brj-23453	58	24	the	the	DET
brj-23453	58	25	genetic	genetic	ADJ
brj-23453	58	26	analysis	analysis	NOUN
brj-23453	58	27	.	.	PUNCT
brj-23453	59	1	samples	sample	NOUN
brj-23453	59	2	were	be	AUX
brj-23453	59	3	collected	collect	VERB
brj-23453	59	4	from	from	ADP
brj-23453	59	5	multiple	multiple	ADJ
brj-23453	59	6	trees	tree	NOUN
brj-23453	59	7	per	per	ADP
brj-23453	59	8	genotype	genotype	NOUN
brj-23453	59	9	to	to	PART
brj-23453	59	10	account	account	VERB
brj-23453	59	11	for	for	ADP
brj-23453	59	12	within	within	ADP
brj-23453	59	13	-	-	PUNCT
brj-23453	59	14	genotype	genotype	NOUN
brj-23453	59	15	variability	variability	NOUN
brj-23453	59	16	.	.	PUNCT
brj-23453	60	1	all	all	DET
brj-23453	60	2	sampling	sample	VERB
brj-23453	60	3	procedures	procedure	NOUN
brj-23453	60	4	were	be	AUX
brj-23453	60	5	conducted	conduct	VERB
brj-23453	60	6	in	in	ADP
brj-23453	60	7	accordance	accordance	NOUN
brj-23453	60	8	with	with	ADP
brj-23453	60	9	established	establish	VERB
brj-23453	60	10	guidelines	guideline	NOUN
brj-23453	60	11	for	for	ADP
brj-23453	60	12	genetic	genetic	ADJ
brj-23453	60	13	sampling	sampling	NOUN
brj-23453	60	14	to	to	PART
brj-23453	60	15	ensure	ensure	VERB
brj-23453	60	16	the	the	DET
brj-23453	60	17	reliability	reliability	NOUN
brj-23453	60	18	and	and	CCONJ
brj-23453	60	19	accuracy	accuracy	NOUN
brj-23453	60	20	of	of	ADP
brj-23453	60	21	the	the	DET
brj-23453	60	22	results	result	NOUN
brj-23453	60	23	.	.	PUNCT
brj-23453	61	1	dna	dna	PROPN
brj-23453	61	2	extraction	extraction	NOUN
brj-23453	61	3	through	through	ADP
brj-23453	61	4	employing	employ	VERB
brj-23453	61	5	the	the	DET
brj-23453	61	6	methods	method	NOUN
brj-23453	61	7	described	describe	VERB
brj-23453	61	8	by	by	ADP
brj-23453	61	9	doyle	doyle	NOUN
brj-23453	61	10	and	and	CCONJ
brj-23453	61	11	doyle	doyle	PROPN
brj-23453	61	12	(	(	PUNCT
brj-23453	61	13	1990	1990	NUM
brj-23453	61	14	)	)	PUNCT
brj-23453	61	15	,	,	PUNCT
brj-23453	61	16	genomic	genomic	NOUN
brj-23453	61	17	dna	dna	NOUN
brj-23453	61	18	with	with	ADP
brj-23453	61	19	minor	minor	ADJ
brj-23453	61	20	modifications	modification	NOUN
brj-23453	61	21	was	be	AUX
brj-23453	61	22	isolated	isolate	VERB
brj-23453	61	23	.	.	PUNCT
brj-23453	62	1	the	the	DET
brj-23453	62	2	leaf	leaf	NOUN
brj-23453	62	3	tissues	tissue	NOUN
brj-23453	62	4	(	(	PUNCT
brj-23453	62	5	young	young	ADJ
brj-23453	62	6	leaf	leaf	NOUN
brj-23453	62	7	samples	sample	NOUN
brj-23453	62	8	from	from	ADP
brj-23453	62	9	21	21	NUM
brj-23453	62	10	genotypes	genotype	NOUN
brj-23453	62	11	)	)	PUNCT
brj-23453	62	12	were	be	AUX
brj-23453	62	13	reduced	reduce	VERB
brj-23453	62	14	to	to	ADP
brj-23453	62	15	fine	fine	ADJ
brj-23453	62	16	powder	powder	NOUN
brj-23453	62	17	in	in	ADP
brj-23453	62	18	a	a	DET
brj-23453	62	19	sterile	sterile	ADJ
brj-23453	62	20	mortar	mortar	NOUN
brj-23453	62	21	and	and	CCONJ
brj-23453	62	22	pestle	pestle	NOUN
brj-23453	62	23	containing	contain	VERB
brj-23453	62	24	liquid	liquid	ADJ
brj-23453	62	25	nitrogen	nitrogen	NOUN
brj-23453	62	26	.	.	PUNCT
brj-23453	63	1	pre	pre	VERB
brj-23453	63	2	-	-	VERB
brj-23453	63	3	warmed	warm	VERB
brj-23453	63	4	2	2	NUM
brj-23453	63	5	x	x	SYM
brj-23453	63	6	ctab	ctab	ADJ
brj-23453	63	7	extraction	extraction	NOUN
brj-23453	63	8	buffer	buffer	NOUN
brj-23453	63	9	(	(	PUNCT
brj-23453	63	10	65	65	NUM
brj-23453	63	11	°	°	NOUN
brj-23453	63	12	c	c	NOUN
brj-23453	63	13	)	)	PUNCT
brj-23453	63	14	was	be	AUX
brj-23453	63	15	mixed	mix	VERB
brj-23453	63	16	with	with	ADP
brj-23453	63	17	2.5	2.5	NUM
brj-23453	63	18	g	g	NOUN
brj-23453	63	19	of	of	ADP
brj-23453	63	20	powdered	powdered	ADJ
brj-23453	63	21	leaf	leaf	NOUN
brj-23453	63	22	tissue	tissue	NOUN
brj-23453	63	23	powder	powder	NOUN
brj-23453	63	24	in	in	ADP
brj-23453	63	25	a	a	DET
brj-23453	63	26	sterile	sterile	ADJ
brj-23453	63	27	50	50	NUM
brj-23453	63	28	-	-	PUNCT
brj-23453	63	29	ml	ml	NOUN
brj-23453	63	30	polypropylene	polypropylene	NOUN
brj-23453	63	31	dna	dna	PROPN
brj-23453	63	32	extraction	extraction	NOUN
brj-23453	63	33	vial	vial	NOUN
brj-23453	63	34	.	.	PUNCT
brj-23453	64	1	the	the	DET
brj-23453	64	2	materials	material	NOUN
brj-23453	64	3	were	be	AUX
brj-23453	64	4	thoroughly	thoroughly	ADV
brj-23453	64	5	combined	combine	VERB
brj-23453	64	6	with	with	ADP
brj-23453	64	7	the	the	DET
brj-23453	64	8	extraction	extraction	NOUN
brj-23453	64	9	buffer	buffer	NOUN
brj-23453	64	10	through	through	ADP
brj-23453	64	11	multiple	multiple	ADJ
brj-23453	64	12	inversions	inversion	NOUN
brj-23453	64	13	of	of	ADP
brj-23453	64	14	the	the	DET
brj-23453	64	15	tubes	tube	NOUN
brj-23453	64	16	.	.	PUNCT
brj-23453	65	1	subsequently	subsequently	ADV
brj-23453	65	2	,	,	PUNCT
brj-23453	65	3	the	the	DET
brj-23453	65	4	tubes	tube	NOUN
brj-23453	65	5	were	be	AUX
brj-23453	65	6	incubated	incubate	VERB
brj-23453	65	7	at	at	ADP
brj-23453	65	8	65	65	NUM
brj-23453	65	9	°	°	NOUN
brj-23453	65	10	c	c	NOUN
brj-23453	65	11	in	in	ADP
brj-23453	65	12	a	a	DET
brj-23453	65	13	water	water	NOUN
brj-23453	65	14	bath	bath	NOUN
brj-23453	65	15	for	for	ADP
brj-23453	65	16	a	a	DET
brj-23453	65	17	duration	duration	NOUN
brj-23453	65	18	of	of	ADP
brj-23453	65	19	60	60	NUM
brj-23453	65	20	min	min	NOUN
brj-23453	65	21	.	.	NOUN
brj-23453	65	22	in	in	ADP
brj-23453	65	23	three	three	NUM
brj-23453	65	24	-	-	PUNCT
brj-23453	65	25	quarters	quarter	NOUN
brj-23453	65	26	of	of	ADP
brj-23453	65	27	the	the	DET
brj-23453	65	28	dna	dna	PROPN
brj-23453	65	29	extraction	extraction	NOUN
brj-23453	65	30	tubes	tube	NOUN
brj-23453	65	31	,	,	PUNCT
brj-23453	65	32	water	water	NOUN
brj-23453	65	33	was	be	AUX
brj-23453	65	34	immersed	immerse	VERB
brj-23453	65	35	.	.	PUNCT
brj-23453	66	1	the	the	DET
brj-23453	66	2	contents	content	NOUN
brj-23453	66	3	of	of	ADP
brj-23453	66	4	the	the	DET
brj-23453	66	5	containers	container	NOUN
brj-23453	66	6	were	be	AUX
brj-23453	66	7	gently	gently	ADV
brj-23453	66	8	inverted	invert	VERB
brj-23453	66	9	every	every	DET
brj-23453	66	10	5	5	NUM
brj-23453	66	11	to	to	PART
brj-23453	66	12	10	10	NUM
brj-23453	66	13	min	min	NOUN
brj-23453	66	14	to	to	PART
brj-23453	66	15	facilitate	facilitate	VERB
brj-23453	66	16	mixing	mix	VERB
brj-23453	66	17	.	.	PUNCT
brj-23453	67	1	following	follow	VERB
brj-23453	67	2	incubation	incubation	NOUN
brj-23453	67	3	,	,	PUNCT
brj-23453	67	4	the	the	DET
brj-23453	67	5	specimens	specimen	NOUN
brj-23453	67	6	were	be	AUX
brj-23453	67	7	allowed	allow	VERB
brj-23453	67	8	to	to	PART
brj-23453	67	9	settle	settle	VERB
brj-23453	67	10	to	to	PART
brj-23453	67	11	room	room	VERB
brj-23453	67	12	temperature	temperature	NOUN
brj-23453	67	13	for	for	ADP
brj-23453	67	14	five	five	NUM
brj-23453	67	15	min	min	NOUN
brj-23453	67	16	before	before	ADP
brj-23453	67	17	their	their	PRON
brj-23453	67	18	addition	addition	NOUN
brj-23453	67	19	to	to	ADP
brj-23453	67	20	a	a	DET
brj-23453	67	21	5	5	NUM
brj-23453	67	22	ml	ml	NOUN
brj-23453	67	23	solution	solution	NOUN
brj-23453	67	24	of	of	ADP
brj-23453	67	25	chloroform	chloroform	NOUN
brj-23453	67	26	:	:	PUNCT
brj-23453	67	27	isoamyl	isoamyl	NOUN
brj-23453	67	28	(	(	PUNCT
brj-23453	67	29	24:1	24:1	NUM
brj-23453	67	30	)	)	PUNCT
brj-23453	67	31	.	.	PUNCT
brj-23453	68	1	through	through	ADP
brj-23453	68	2	repeated	repeat	VERB
brj-23453	68	3	gentle	gentle	ADJ
brj-23453	68	4	rotations	rotation	NOUN
brj-23453	68	5	of	of	ADP
brj-23453	68	6	the	the	DET
brj-23453	68	7	containers	container	NOUN
brj-23453	68	8	,	,	PUNCT
brj-23453	68	9	the	the	DET
brj-23453	68	10	samples	sample	NOUN
brj-23453	68	11	were	be	AUX
brj-23453	68	12	thoroughly	thoroughly	ADV
brj-23453	68	13	combined	combine	VERB
brj-23453	68	14	.	.	PUNCT
brj-23453	69	1	ten	ten	NUM
brj-23453	69	2	min	min	NOUN
brj-23453	69	3	of	of	ADP
brj-23453	69	4	centrifugation	centrifugation	NOUN
brj-23453	69	5	was	be	AUX
brj-23453	69	6	conducted	conduct	VERB
brj-23453	69	7	at	at	ADP
brj-23453	69	8	15000	15000	NUM
brj-23453	69	9	rpm	rpm	NOUN
brj-23453	69	10	.	.	PUNCT
brj-23453	70	1	following	follow	VERB
brj-23453	70	2	this	this	PRON
brj-23453	70	3	,	,	PUNCT
brj-23453	70	4	the	the	DET
brj-23453	70	5	uppermost	uppermost	ADJ
brj-23453	70	6	aqueous	aqueous	ADJ
brj-23453	70	7	phase	phase	NOUN
brj-23453	70	8	was	be	AUX
brj-23453	70	9	transferred	transfer	VERB
brj-23453	70	10	into	into	ADP
brj-23453	70	11	a	a	DET
brj-23453	70	12	pre	pre	ADJ
brj-23453	70	13	-	-	ADJ
brj-23453	70	14	sterilized	sterilize	VERB
brj-23453	70	15	centrifuge	centrifuge	NOUN
brj-23453	70	16	tube	tube	NOUN
brj-23453	70	17	.	.	PUNCT
brj-23453	71	1	the	the	DET
brj-23453	71	2	dna	dna	PROPN
brj-23453	71	3	was	be	AUX
brj-23453	71	4	spooled	spool	VERB
brj-23453	71	5	from	from	ADP
brj-23453	71	6	icecold	icecold	PROPN
brj-23453	71	7	isopropanol	isopropanol	NOUN
brj-23453	71	8	precipitate	precipitate	NOUN
brj-23453	71	9	in	in	ADP
brj-23453	71	10	an	an	DET
brj-23453	71	11	equivalent	equivalent	ADJ
brj-23453	71	12	volume	volume	NOUN
brj-23453	71	13	,	,	PUNCT
brj-23453	71	14	using	use	VERB
brj-23453	71	15	sterile	sterile	ADJ
brj-23453	71	16	glass	glass	NOUN
brj-23453	71	17	hooks	hook	NOUN
brj-23453	71	18	,	,	PUNCT
brj-23453	71	19	and	and	CCONJ
brj-23453	71	20	subsequently	subsequently	ADV
brj-23453	71	21	immersed	immerse	VERB
brj-23453	71	22	in	in	ADP
brj-23453	71	23	1	1	NUM
brj-23453	71	24	ml	ml	NOUN
brj-23453	71	25	of	of	ADP
brj-23453	71	26	70	70	NUM
brj-23453	71	27	%	%	NOUN
brj-23453	71	28	ethanol	ethanol	NOUN
brj-23453	71	29	for	for	ADP
brj-23453	71	30	a	a	DET
brj-23453	71	31	duration	duration	NOUN
brj-23453	71	32	of	of	ADP
brj-23453	71	33	10	10	NUM
brj-23453	71	34	min	min	NOUN
brj-23453	71	35	.	.	PROPN
brj-23453	71	36	following	follow	VERB
brj-23453	71	37	that	that	PRON
brj-23453	71	38	,	,	PUNCT
brj-23453	71	39	the	the	DET
brj-23453	71	40	tubes	tube	NOUN
brj-23453	71	41	were	be	AUX
brj-23453	71	42	centrifuged	centrifuge	VERB
brj-23453	71	43	at	at	ADP
brj-23453	71	44	10000	10000	NUM
brj-23453	71	45	rpm	rpm	NOUN
brj-23453	71	46	for	for	ADP
brj-23453	71	47	5	5	NUM
brj-23453	71	48	min	min	NOUN
brj-23453	71	49	;	;	PUNCT
brj-23453	71	50	the	the	DET
brj-23453	71	51	supernatant	supernatant	NOUN
brj-23453	71	52	was	be	AUX
brj-23453	71	53	discarded	discard	VERB
brj-23453	71	54	and	and	CCONJ
brj-23453	71	55	the	the	DET
brj-23453	71	56	dna	dna	PROPN
brj-23453	71	57	pellet	pellet	NOUN
brj-23453	71	58	settled	settle	VERB
brj-23453	71	59	to	to	ADP
brj-23453	71	60	the	the	DET
brj-23453	71	61	lower	low	ADJ
brj-23453	71	62	end	end	NOUN
brj-23453	71	63	of	of	ADP
brj-23453	71	64	the	the	DET
brj-23453	71	65	tube	tube	NOUN
brj-23453	71	66	.	.	PUNCT
brj-23453	72	1	the	the	DET
brj-23453	72	2	pellet	pellet	NOUN
brj-23453	72	3	was	be	AUX
brj-23453	72	4	then	then	ADV
brj-23453	72	5	desiccated	desiccate	VERB
brj-23453	72	6	at	at	ADP
brj-23453	72	7	room	room	NOUN
brj-23453	72	8	temperature	temperature	NOUN
brj-23453	72	9	until	until	SCONJ
brj-23453	72	10	any	any	DET
brj-23453	72	11	remaining	remain	VERB
brj-23453	72	12	ethanol	ethanol	NOUN
brj-23453	72	13	was	be	AUX
brj-23453	72	14	removed	remove	VERB
brj-23453	72	15	.	.	PUNCT
brj-23453	73	1	following	follow	VERB
brj-23453	73	2	the	the	DET
brj-23453	73	3	drying	dry	VERB
brj-23453	73	4	process	process	NOUN
brj-23453	73	5	,	,	PUNCT
brj-23453	73	6	the	the	DET
brj-23453	73	7	particle	particle	NOUN
brj-23453	73	8	was	be	AUX
brj-23453	73	9	dissolved	dissolve	VERB
brj-23453	73	10	in	in	ADP
brj-23453	73	11	a	a	DET
brj-23453	73	12	sufficient	sufficient	ADJ
brj-23453	73	13	volume	volume	NOUN
brj-23453	73	14	of	of	ADP
brj-23453	73	15	te	te	PROPN
brj-23453	73	16	buffer	buffer	NOUN
brj-23453	73	17	.	.	PUNCT
brj-23453	74	1	peer	peer	NOUN
brj-23453	74	2	-	-	PUNCT
brj-23453	74	3	reviewed	review	VERB
brj-23453	74	4	article	article	NOUN
brj-23453	74	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	74	6	wani	wani	PROPN
brj-23453	74	7	et	et	PROPN
brj-23453	74	8	al	al	PROPN
brj-23453	74	9	.	.	PROPN
brj-23453	75	1	(	(	PUNCT
brj-23453	75	2	2024	2024	NUM
brj-23453	75	3	)	)	PUNCT
brj-23453	75	4	.	.	PUNCT
brj-23453	76	1	“	"	PUNCT
brj-23453	76	2	walnut	walnut	ADJ
brj-23453	76	3	population	population	NOUN
brj-23453	76	4	&	&	CCONJ
brj-23453	76	5	diversity	diversity	NOUN
brj-23453	76	6	,	,	PUNCT
brj-23453	76	7	”	"	PUNCT
brj-23453	76	8	bioresources	bioresource	NOUN
brj-23453	76	9	19(3	19(3	NUM
brj-23453	76	10	)	)	PUNCT
brj-23453	76	11	,	,	PUNCT
brj-23453	76	12	4213	4213	NUM
brj-23453	76	13	-	-	SYM
brj-23453	76	14	4237	4237	NUM
brj-23453	76	15	.	.	PUNCT
brj-23453	77	1	4216	4216	NUM
brj-23453	77	2	ssr	ssr	PROPN
brj-23453	77	3	assay	assay	VERB
brj-23453	77	4	primers	primer	NOUN
brj-23453	77	5	used	use	VERB
brj-23453	77	6	for	for	ADP
brj-23453	77	7	dna	dna	ADJ
brj-23453	77	8	amplification	amplification	NOUN
brj-23453	77	9	a	a	DET
brj-23453	77	10	collection	collection	NOUN
brj-23453	77	11	of	of	ADP
brj-23453	77	12	16	16	NUM
brj-23453	77	13	primers	primer	NOUN
brj-23453	77	14	,	,	PUNCT
brj-23453	77	15	chosen	choose	VERB
brj-23453	77	16	at	at	ADP
brj-23453	77	17	random	random	ADJ
brj-23453	77	18	,	,	PUNCT
brj-23453	77	19	was	be	AUX
brj-23453	77	20	utilized	utilize	VERB
brj-23453	77	21	to	to	PART
brj-23453	77	22	amplify	amplify	VERB
brj-23453	77	23	genomic	genomic	ADJ
brj-23453	77	24	dna	dna	NOUN
brj-23453	77	25	.	.	PUNCT
brj-23453	78	1	following	follow	VERB
brj-23453	78	2	the	the	DET
brj-23453	78	3	findings	finding	NOUN
brj-23453	78	4	of	of	ADP
brj-23453	78	5	prior	prior	ADJ
brj-23453	78	6	research	research	NOUN
brj-23453	78	7	,	,	PUNCT
brj-23453	78	8	ssrs	ssrs	PROPN
brj-23453	78	9	were	be	AUX
brj-23453	78	10	chosen	choose	VERB
brj-23453	78	11	,	,	PUNCT
brj-23453	78	12	as	as	SCONJ
brj-23453	78	13	detailed	detailed	ADJ
brj-23453	78	14	in	in	ADP
brj-23453	78	15	table	table	NOUN
brj-23453	78	16	s1	s1	NOUN
brj-23453	78	17	.	.	PUNCT
brj-23453	79	1	amplification	amplification	NOUN
brj-23453	79	2	of	of	ADP
brj-23453	79	3	dna	dna	PROPN
brj-23453	79	4	a	a	DET
brj-23453	79	5	25	25	NUM
brj-23453	79	6	μl	μl	INTJ
brj-23453	79	7	pcr	pcr	PROPN
brj-23453	79	8	(	(	PUNCT
brj-23453	79	9	polymerase	polymerase	NOUN
brj-23453	79	10	chain	chain	NOUN
brj-23453	79	11	reaction	reaction	NOUN
brj-23453	79	12	)	)	PUNCT
brj-23453	79	13	reaction	reaction	NOUN
brj-23453	79	14	volume	volume	NOUN
brj-23453	79	15	was	be	AUX
brj-23453	79	16	utilized	utilize	VERB
brj-23453	79	17	,	,	PUNCT
brj-23453	79	18	which	which	PRON
brj-23453	79	19	included	include	VERB
brj-23453	79	20	the	the	DET
brj-23453	79	21	following	following	NOUN
brj-23453	79	22	:	:	PUNCT
brj-23453	79	23	1	1	X
brj-23453	79	24	.	.	X
brj-23453	79	25	hcl	hcl	PROPN
brj-23453	79	26	tris	tris	PROPN
brj-23453	79	27	10	10	NUM
brj-23453	79	28	mm	mm	NOUN
brj-23453	79	29	,	,	PUNCT
brj-23453	79	30	2	2	NUM
brj-23453	79	31	.	.	NOUN
brj-23453	79	32	0.1	0.1	NUM
brj-23453	79	33	mg	mg	PROPN
brj-23453	79	34	collagen	collagen	NOUN
brj-23453	79	35	per	per	ADP
brj-23453	79	36	ml	ml	PROPN
brj-23453	79	37	3	3	NUM
brj-23453	79	38	.	.	NOUN
brj-23453	79	39	50	50	NUM
brj-23453	79	40	ml	ml	NOUN
brj-23453	79	41	m	m	NOUN
brj-23453	79	42	kcl	kcl	NOUN
brj-23453	79	43	,	,	PUNCT
brj-23453	79	44	4	4	NUM
brj-23453	79	45	.	.	SYM
brj-23453	79	46	40	40	NUM
brj-23453	79	47	ng	ng	PROPN
brj-23453	79	48	dna	dna	PROPN
brj-23453	79	49	genomics	genomics	PROPN
brj-23453	79	50	,	,	PUNCT
brj-23453	79	51	5	5	NUM
brj-23453	79	52	.	.	NOUN
brj-23453	79	53	200	200	NUM
brj-23453	79	54	m	m	NOUN
brj-23453	79	55	mg	mg	PROPN
brj-23453	79	56	cl2	cl2	NOUN
brj-23453	79	57	in	in	ADP
brj-23453	79	58	addition	addition	NOUN
brj-23453	79	59	to	to	ADP
brj-23453	79	60	6	6	NUM
brj-23453	79	61	.	.	NOUN
brj-23453	79	62	0.5	0.5	NUM
brj-23453	79	63	units	unit	NOUN
brj-23453	79	64	of	of	ADP
brj-23453	79	65	taq	taq	NOUN
brj-23453	79	66	polymerase	polymerase	NOUN
brj-23453	79	67	for	for	ADP
brj-23453	79	68	dna	dna	PROPN
brj-23453	79	69	.	.	PUNCT
brj-23453	80	1	for	for	ADP
brj-23453	80	2	dna	dna	NOUN
brj-23453	80	3	amplification	amplification	NOUN
brj-23453	80	4	,	,	PUNCT
brj-23453	80	5	a	a	DET
brj-23453	80	6	thermal	thermal	ADJ
brj-23453	80	7	circler	circler	NOUN
brj-23453	80	8	(	(	PUNCT
brj-23453	80	9	bio	bio	NOUN
brj-23453	80	10	-	-	PROPN
brj-23453	80	11	rad	rad	NOUN
brj-23453	80	12	)	)	PUNCT
brj-23453	80	13	was	be	AUX
brj-23453	80	14	utilized	utilize	VERB
brj-23453	80	15	in	in	ADP
brj-23453	80	16	the	the	DET
brj-23453	80	17	pcr	pcr	ADJ
brj-23453	80	18	reaction	reaction	NOUN
brj-23453	80	19	.	.	PUNCT
brj-23453	81	1	the	the	DET
brj-23453	81	2	agarose	agarose	NOUN
brj-23453	81	3	utilized	utilize	VERB
brj-23453	81	4	for	for	ADP
brj-23453	81	5	the	the	DET
brj-23453	81	6	analysis	analysis	NOUN
brj-23453	81	7	of	of	ADP
brj-23453	81	8	the	the	DET
brj-23453	81	9	ethidium	ethidium	ADJ
brj-23453	81	10	bromide	bromide	NOUN
brj-23453	81	11	-	-	PUNCT
brj-23453	81	12	containing	contain	VERB
brj-23453	81	13	products	product	NOUN
brj-23453	81	14	was	be	AUX
brj-23453	81	15	2.0	2.0	NUM
brj-23453	81	16	%	%	NOUN
brj-23453	81	17	.	.	PUNCT
brj-23453	82	1	the	the	DET
brj-23453	82	2	resulting	result	VERB
brj-23453	82	3	bands	band	NOUN
brj-23453	82	4	were	be	AUX
brj-23453	82	5	subsequently	subsequently	ADV
brj-23453	82	6	evaluated	evaluate	VERB
brj-23453	82	7	for	for	ADP
brj-23453	82	8	polymorphism	polymorphism	NOUN
brj-23453	82	9	using	use	VERB
brj-23453	82	10	a	a	DET
brj-23453	82	11	scoring	scoring	NOUN
brj-23453	82	12	system	system	NOUN
brj-23453	82	13	based	base	VERB
brj-23453	82	14	on	on	ADP
brj-23453	82	15	their	their	PRON
brj-23453	82	16	presence	presence	NOUN
brj-23453	82	17	(	(	PUNCT
brj-23453	82	18	1	1	NUM
brj-23453	82	19	)	)	PUNCT
brj-23453	82	20	or	or	CCONJ
brj-23453	82	21	absence	absence	NOUN
brj-23453	82	22	(	(	PUNCT
brj-23453	82	23	0	0	NUM
brj-23453	82	24	)	)	PUNCT
brj-23453	82	25	.	.	PUNCT
brj-23453	83	1	data	datum	NOUN
brj-23453	83	2	analysis	analysis	NOUN
brj-23453	83	3	each	each	DET
brj-23453	83	4	character	character	NOUN
brj-23453	83	5	was	be	AUX
brj-23453	83	6	assessed	assess	VERB
brj-23453	83	7	independently	independently	ADV
brj-23453	83	8	,	,	PUNCT
brj-23453	83	9	with	with	ADP
brj-23453	83	10	bands	band	NOUN
brj-23453	83	11	that	that	PRON
brj-23453	83	12	were	be	AUX
brj-23453	83	13	uniform	uniform	ADJ
brj-23453	83	14	,	,	PUNCT
brj-23453	83	15	distinct	distinct	ADJ
brj-23453	83	16	,	,	PUNCT
brj-23453	83	17	and	and	CCONJ
brj-23453	83	18	reproducible	reproducible	VERB
brj-23453	83	19	being	be	AUX
brj-23453	83	20	assigned	assign	VERB
brj-23453	83	21	a	a	DET
brj-23453	83	22	value	value	NOUN
brj-23453	83	23	of	of	ADP
brj-23453	83	24	either	either	PRON
brj-23453	83	25	1	1	NUM
brj-23453	83	26	or	or	CCONJ
brj-23453	83	27	0	0	NUM
brj-23453	83	28	.	.	PUNCT
brj-23453	84	1	based	base	VERB
brj-23453	84	2	on	on	ADP
brj-23453	84	3	character	character	NOUN
brj-23453	84	4	state	state	NOUN
brj-23453	84	5	data	data	PROPN
brj-23453	84	6	,	,	PUNCT
brj-23453	84	7	ntsys	ntsy	NOUN
brj-23453	84	8	-	-	ADJ
brj-23453	84	9	pc	pc	ADJ
brj-23453	84	10	software	software	NOUN
brj-23453	84	11	version	version	NOUN
brj-23453	84	12	2.0e	2.0e	NUM
brj-23453	84	13	(	(	PUNCT
brj-23453	84	14	rohlf	rohlf	NOUN
brj-23453	84	15	1988	1988	NUM
brj-23453	84	16	)	)	PUNCT
brj-23453	84	17	,	,	PUNCT
brj-23453	84	18	arlequin	arlequin	NOUN
brj-23453	84	19	3.00	3.00	NUM
brj-23453	84	20	,	,	PUNCT
brj-23453	84	21	and	and	CCONJ
brj-23453	84	22	genalex	genalex	NOUN
brj-23453	84	23	were	be	AUX
brj-23453	84	24	utilized	utilize	VERB
brj-23453	84	25	to	to	PART
brj-23453	84	26	conduct	conduct	VERB
brj-23453	84	27	cluster	cluster	NOUN
brj-23453	84	28	analysis	analysis	NOUN
brj-23453	84	29	,	,	PUNCT
brj-23453	84	30	population	population	NOUN
brj-23453	84	31	structure	structure	NOUN
brj-23453	84	32	,	,	PUNCT
brj-23453	84	33	analysis	analysis	NOUN
brj-23453	84	34	of	of	ADP
brj-23453	84	35	molecular	molecular	ADJ
brj-23453	84	36	variance	variance	NOUN
brj-23453	84	37	(	(	PUNCT
brj-23453	84	38	amova	amova	PROPN
brj-23453	84	39	)	)	PUNCT
brj-23453	84	40	,	,	PUNCT
brj-23453	84	41	and	and	CCONJ
brj-23453	84	42	principal	principal	ADJ
brj-23453	84	43	coordinate	coordinate	NOUN
brj-23453	84	44	analysis	analysis	NOUN
brj-23453	84	45	(	(	PUNCT
brj-23453	84	46	pca	pca	NOUN
brj-23453	84	47	)	)	PUNCT
brj-23453	84	48	(	(	PUNCT
brj-23453	84	49	peakall	peakall	NOUN
brj-23453	84	50	and	and	CCONJ
brj-23453	84	51	smouse	smouse	NOUN
brj-23453	84	52	2006	2006	NUM
brj-23453	84	53	)	)	PUNCT
brj-23453	84	54	.	.	PUNCT
brj-23453	85	1	furthermore	furthermore	ADV
brj-23453	85	2	,	,	PUNCT
brj-23453	85	3	a	a	DET
brj-23453	85	4	comparison	comparison	NOUN
brj-23453	85	5	was	be	AUX
brj-23453	85	6	made	make	VERB
brj-23453	85	7	between	between	ADP
brj-23453	85	8	visual	visual	ADJ
brj-23453	85	9	interpretations	interpretation	NOUN
brj-23453	85	10	of	of	ADP
brj-23453	85	11	dendrograms	dendrogram	NOUN
brj-23453	85	12	generated	generate	VERB
brj-23453	85	13	by	by	ADP
brj-23453	85	14	clustering	cluster	VERB
brj-23453	85	15	methods	method	NOUN
brj-23453	85	16	that	that	PRON
brj-23453	85	17	utilized	utilize	VERB
brj-23453	85	18	similarity	similarity	NOUN
brj-23453	85	19	matrices	matrix	NOUN
brj-23453	85	20	and	and	CCONJ
brj-23453	85	21	genetic	genetic	ADJ
brj-23453	85	22	connections	connection	NOUN
brj-23453	85	23	.	.	PUNCT
brj-23453	86	1	dendrograms	dendrogram	NOUN
brj-23453	86	2	were	be	AUX
brj-23453	86	3	generated	generate	VERB
brj-23453	86	4	by	by	ADP
brj-23453	86	5	joining	join	VERB
brj-23453	86	6	neighbours	neighbour	NOUN
brj-23453	86	7	utilizing	utilize	VERB
brj-23453	86	8	the	the	DET
brj-23453	86	9	upgma	upgma	NOUN
brj-23453	86	10	(	(	PUNCT
brj-23453	86	11	unweighted	unweighted	ADJ
brj-23453	86	12	pair	pair	NOUN
brj-23453	86	13	group	group	NOUN
brj-23453	86	14	method	method	NOUN
brj-23453	86	15	with	with	ADP
brj-23453	86	16	arithmetic	arithmetic	ADJ
brj-23453	86	17	average	average	ADJ
brj-23453	86	18	)	)	PUNCT
brj-23453	86	19	technique	technique	NOUN
brj-23453	86	20	(	(	PUNCT
brj-23453	86	21	rohlf	rohlf	NOUN
brj-23453	86	22	1988	1988	NUM
brj-23453	86	23	)	)	PUNCT
brj-23453	86	24	.	.	PUNCT
brj-23453	87	1	the	the	DET
brj-23453	87	2	molecular	molecular	ADJ
brj-23453	87	3	data	datum	NOUN
brj-23453	87	4	were	be	AUX
brj-23453	87	5	collected	collect	VERB
brj-23453	87	6	and	and	CCONJ
brj-23453	87	7	analyzed	analyze	VERB
brj-23453	87	8	in	in	ADP
brj-23453	87	9	the	the	DET
brj-23453	87	10	required	require	VERB
brj-23453	87	11	‘	'	PUNCT
brj-23453	87	12	allelic	allelic	ADJ
brj-23453	87	13	format	format	NOUN
brj-23453	87	14	’	'	PUNCT
brj-23453	87	15	using	use	VERB
brj-23453	87	16	the	the	DET
brj-23453	87	17	darwin	darwin	PROPN
brj-23453	87	18	5	5	NUM
brj-23453	87	19	computer	computer	NOUN
brj-23453	87	20	software	software	NOUN
brj-23453	87	21	application	application	NOUN
brj-23453	87	22	to	to	PART
brj-23453	87	23	assess	assess	VERB
brj-23453	87	24	genetic	genetic	ADJ
brj-23453	87	25	diversity	diversity	NOUN
brj-23453	87	26	between	between	ADP
brj-23453	87	27	genotypes	genotype	NOUN
brj-23453	87	28	.	.	PUNCT
brj-23453	88	1	the	the	DET
brj-23453	88	2	approximate	approximate	ADJ
brj-23453	88	3	values	value	NOUN
brj-23453	88	4	of	of	ADP
brj-23453	88	5	the	the	DET
brj-23453	88	6	number	number	NOUN
brj-23453	88	7	of	of	ADP
brj-23453	88	8	private	private	ADJ
brj-23453	88	9	alleles	allele	NOUN
brj-23453	88	10	(	(	PUNCT
brj-23453	88	11	np	np	INTJ
brj-23453	88	12	)	)	PUNCT
brj-23453	88	13	,	,	PUNCT
brj-23453	88	14	expected	expect	VERB
brj-23453	88	15	heterozygosity	heterozygosity	NOUN
brj-23453	88	16	(	(	PUNCT
brj-23453	88	17	he	he	PRON
brj-23453	88	18	)	)	PUNCT
brj-23453	88	19	,	,	PUNCT
brj-23453	88	20	information	information	NOUN
brj-23453	88	21	index	index	NOUN
brj-23453	88	22	(	(	PUNCT
brj-23453	88	23	i	i	NOUN
brj-23453	88	24	)	)	PUNCT
brj-23453	88	25	,	,	PUNCT
brj-23453	88	26	and	and	CCONJ
brj-23453	88	27	observed	observe	VERB
brj-23453	88	28	heterozygosity	heterozygosity	NOUN
brj-23453	88	29	(	(	PUNCT
brj-23453	88	30	ho	ho	INTJ
brj-23453	88	31	)	)	PUNCT
brj-23453	88	32	,	,	PUNCT
brj-23453	88	33	effective	effective	ADJ
brj-23453	88	34	alleles	allele	NOUN
brj-23453	88	35	(	(	PUNCT
brj-23453	88	36	ne	ne	NOUN
brj-23453	88	37	)	)	PUNCT
brj-23453	88	38	,	,	PUNCT
brj-23453	88	39	and	and	CCONJ
brj-23453	88	40	effective	effective	ADJ
brj-23453	88	41	alleles	allele	NOUN
brj-23453	88	42	(	(	PUNCT
brj-23453	88	43	ne	ne	NOUN
brj-23453	88	44	)	)	PUNCT
brj-23453	88	45	per	per	ADP
brj-23453	88	46	locus	locus	NOUN
brj-23453	88	47	were	be	AUX
brj-23453	88	48	calculated	calculate	VERB
brj-23453	88	49	using	use	VERB
brj-23453	88	50	genalex	genalex	PROPN
brj-23453	88	51	(	(	PUNCT
brj-23453	88	52	nei	nei	PROPN
brj-23453	88	53	1973	1973	NUM
brj-23453	88	54	;	;	PUNCT
brj-23453	88	55	peakall	peakall	NOUN
brj-23453	88	56	and	and	CCONJ
brj-23453	88	57	smouse	smouse	NOUN
brj-23453	88	58	2006	2006	NUM
brj-23453	88	59	)	)	PUNCT
brj-23453	88	60	.	.	PUNCT
brj-23453	89	1	the	the	DET
brj-23453	89	2	genetic	genetic	ADJ
brj-23453	89	3	organization	organization	NOUN
brj-23453	89	4	and	and	CCONJ
brj-23453	89	5	gene	gene	NOUN
brj-23453	89	6	pool	pool	NOUN
brj-23453	89	7	were	be	AUX
brj-23453	89	8	deduced	deduce	VERB
brj-23453	89	9	utilizing	utilize	VERB
brj-23453	89	10	structure	structure	NOUN
brj-23453	89	11	v.2.3.4	v.2.3.4	NOUN
brj-23453	89	12	(	(	PUNCT
brj-23453	89	13	pritchard	pritchard	PROPN
brj-23453	89	14	et	et	PROPN
brj-23453	89	15	al	al	PROPN
brj-23453	89	16	.	.	PROPN
brj-23453	89	17	2000	2000	NUM
brj-23453	89	18	)	)	PUNCT
brj-23453	89	19	.	.	PUNCT
brj-23453	90	1	an	an	DET
brj-23453	90	2	additional	additional	ADJ
brj-23453	90	3	ten	ten	NUM
brj-23453	90	4	fictitious	fictitious	ADJ
brj-23453	90	5	populations	population	NOUN
brj-23453	90	6	(	(	PUNCT
brj-23453	90	7	k	k	NOUN
brj-23453	90	8	)	)	PUNCT
brj-23453	90	9	were	be	AUX
brj-23453	90	10	utilized	utilize	VERB
brj-23453	90	11	in	in	ADP
brj-23453	90	12	the	the	DET
brj-23453	90	13	experiment	experiment	NOUN
brj-23453	90	14	,	,	PUNCT
brj-23453	90	15	which	which	PRON
brj-23453	90	16	was	be	AUX
brj-23453	90	17	conducted	conduct	VERB
brj-23453	90	18	in	in	ADP
brj-23453	90	19	duplicate	duplicate	NOUN
brj-23453	90	20	.	.	PUNCT
brj-23453	91	1	the	the	DET
brj-23453	91	2	values	value	NOUN
brj-23453	91	3	for	for	ADP
brj-23453	91	4	iterations	iteration	NOUN
brj-23453	91	5	and	and	CCONJ
brj-23453	91	6	burn	burn	VERB
brj-23453	91	7	-	-	PUNCT
brj-23453	91	8	in	in	NOUN
brj-23453	91	9	were	be	AUX
brj-23453	91	10	2,000,000	2,000,000	NUM
brj-23453	91	11	,	,	PUNCT
brj-23453	91	12	and	and	CCONJ
brj-23453	91	13	1,000,000	1,000,000	NUM
brj-23453	91	14	,	,	PUNCT
brj-23453	91	15	respectively	respectively	ADV
brj-23453	91	16	.	.	PUNCT
brj-23453	92	1	an	an	DET
brj-23453	92	2	admixture	admixture	NOUN
brj-23453	92	3	-	-	PUNCT
brj-23453	92	4	free	free	ADJ
brj-23453	92	5	model	model	NOUN
brj-23453	92	6	with	with	ADP
brj-23453	92	7	correlated	correlate	VERB
brj-23453	92	8	allele	allele	NOUN
brj-23453	92	9	frequencies	frequency	NOUN
brj-23453	92	10	was	be	AUX
brj-23453	92	11	employed	employ	VERB
brj-23453	92	12	for	for	ADP
brj-23453	92	13	each	each	DET
brj-23453	92	14	trial	trial	NOUN
brj-23453	92	15	.	.	PUNCT
brj-23453	93	1	by	by	ADP
brj-23453	93	2	estimating	estimate	VERB
brj-23453	93	3	the	the	DET
brj-23453	93	4	most	most	ADV
brj-23453	93	5	probable	probable	ADJ
brj-23453	93	6	number	number	NOUN
brj-23453	93	7	of	of	ADP
brj-23453	93	8	groups	group	NOUN
brj-23453	93	9	with	with	ADP
brj-23453	93	10	the	the	DET
brj-23453	93	11	1k	1k	NUM
brj-23453	93	12	value	value	NOUN
brj-23453	93	13	,	,	PUNCT
brj-23453	93	14	the	the	DET
brj-23453	93	15	optimal	optimal	ADJ
brj-23453	93	16	range	range	NOUN
brj-23453	93	17	of	of	ADP
brj-23453	93	18	k	k	PROPN
brj-23453	93	19	was	be	AUX
brj-23453	93	20	determined	determine	VERB
brj-23453	93	21	(	(	PUNCT
brj-23453	93	22	evanno	evanno	ADV
brj-23453	93	23	et	et	PROPN
brj-23453	93	24	al	al	PROPN
brj-23453	93	25	.	.	PROPN
brj-23453	93	26	2005	2005	NUM
brj-23453	93	27	)	)	PUNCT
brj-23453	93	28	.	.	PUNCT
brj-23453	94	1	genotypes	genotype	NOUN
brj-23453	94	2	that	that	PRON
brj-23453	94	3	possess	possess	VERB
brj-23453	94	4	an	an	DET
brj-23453	94	5	affiliation	affiliation	NOUN
brj-23453	94	6	probability	probability	NOUN
brj-23453	94	7	(	(	PUNCT
brj-23453	94	8	i.e.	i.e.	X
brj-23453	94	9	,	,	PUNCT
brj-23453	94	10	inferred	inferred	ADJ
brj-23453	94	11	ancestry	ancestry	NOUN
brj-23453	94	12	)	)	PUNCT
brj-23453	94	13	exceeding	exceed	VERB
brj-23453	94	14	80	80	NUM
brj-23453	94	15	%	%	NOUN
brj-23453	94	16	were	be	AUX
brj-23453	94	17	categorized	categorize	VERB
brj-23453	94	18	as	as	ADP
brj-23453	94	19	“	"	PUNCT
brj-23453	94	20	admixtures	admixture	NOUN
brj-23453	94	21	”	"	PUNCT
brj-23453	94	22	within	within	ADP
brj-23453	94	23	a	a	DET
brj-23453	94	24	given	give	VERB
brj-23453	94	25	group	group	NOUN
brj-23453	94	26	.	.	PUNCT
brj-23453	95	1	this	this	DET
brj-23453	95	2	denotes	denote	VERB
brj-23453	95	3	that	that	SCONJ
brj-23453	95	4	these	these	DET
brj-23453	95	5	genotypes	genotype	NOUN
brj-23453	95	6	seem	seem	VERB
brj-23453	95	7	to	to	PART
brj-23453	95	8	be	be	AUX
brj-23453	95	9	a	a	DET
brj-23453	95	10	synthesis	synthesis	NOUN
brj-23453	95	11	of	of	ADP
brj-23453	95	12	parental	parental	ADJ
brj-23453	95	13	heritage	heritage	NOUN
brj-23453	95	14	originating	originate	VERB
brj-23453	95	15	from	from	ADP
brj-23453	95	16	different	different	ADJ
brj-23453	95	17	gene	gene	NOUN
brj-23453	95	18	pools	pool	NOUN
brj-23453	95	19	or	or	CCONJ
brj-23453	95	20	regions	region	NOUN
brj-23453	95	21	.	.	PUNCT
brj-23453	96	1	the	the	DET
brj-23453	96	2	heterozygosity	heterozygosity	NOUN
brj-23453	96	3	(	(	PUNCT
brj-23453	96	4	gene	gene	NOUN
brj-23453	96	5	diversity	diversity	NOUN
brj-23453	96	6	)	)	PUNCT
brj-23453	96	7	and	and	CCONJ
brj-23453	96	8	population	population	NOUN
brj-23453	96	9	differentiation	differentiation	NOUN
brj-23453	96	10	(	(	PUNCT
brj-23453	96	11	fst	fst	NOUN
brj-23453	96	12	)	)	PUNCT
brj-23453	96	13	between	between	ADP
brj-23453	96	14	individuals	individual	NOUN
brj-23453	96	15	in	in	ADP
brj-23453	96	16	a	a	DET
brj-23453	96	17	subpopulation	subpopulation	NOUN
brj-23453	96	18	were	be	AUX
brj-23453	96	19	predicted	predict	VERB
brj-23453	96	20	utilizing	utilize	VERB
brj-23453	96	21	the	the	DET
brj-23453	96	22	structure	structure	NOUN
brj-23453	96	23	software	software	NOUN
brj-23453	96	24	.	.	PUNCT
brj-23453	97	1	peer	peer	NOUN
brj-23453	97	2	-	-	PUNCT
brj-23453	97	3	reviewed	review	VERB
brj-23453	97	4	article	article	NOUN
brj-23453	97	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	97	6	wani	wani	PROPN
brj-23453	97	7	et	et	PROPN
brj-23453	97	8	al	al	PROPN
brj-23453	97	9	.	.	PROPN
brj-23453	98	1	(	(	PUNCT
brj-23453	98	2	2024	2024	NUM
brj-23453	98	3	)	)	PUNCT
brj-23453	98	4	.	.	PUNCT
brj-23453	99	1	“	"	PUNCT
brj-23453	99	2	walnut	walnut	ADJ
brj-23453	99	3	population	population	NOUN
brj-23453	99	4	&	&	CCONJ
brj-23453	99	5	diversity	diversity	NOUN
brj-23453	99	6	,	,	PUNCT
brj-23453	99	7	”	"	PUNCT
brj-23453	99	8	bioresources	bioresource	NOUN
brj-23453	99	9	19(3	19(3	NUM
brj-23453	99	10	)	)	PUNCT
brj-23453	99	11	,	,	PUNCT
brj-23453	99	12	4213	4213	NUM
brj-23453	99	13	-	-	SYM
brj-23453	99	14	4237	4237	NUM
brj-23453	99	15	.	.	PUNCT
brj-23453	100	1	4217	4217	NUM
brj-23453	100	2	results	result	VERB
brj-23453	100	3	ssr	ssr	ADJ
brj-23453	100	4	analysis	analysis	NOUN
brj-23453	100	5	in	in	ADP
brj-23453	100	6	the	the	DET
brj-23453	100	7	current	current	ADJ
brj-23453	100	8	investigation	investigation	NOUN
brj-23453	100	9	,	,	PUNCT
brj-23453	100	10	21	21	NUM
brj-23453	100	11	genotypes	genotype	NOUN
brj-23453	100	12	were	be	AUX
brj-23453	100	13	examined	examine	VERB
brj-23453	100	14	;	;	PUNCT
brj-23453	100	15	their	their	PRON
brj-23453	100	16	identifiers	identifier	NOUN
brj-23453	100	17	are	be	AUX
brj-23453	100	18	provided	provide	VERB
brj-23453	100	19	in	in	ADP
brj-23453	100	20	table	table	NOUN
brj-23453	100	21	s2	s2	PROPN
brj-23453	100	22	.	.	PUNCT
brj-23453	101	1	the	the	DET
brj-23453	101	2	ssr	ssr	ADJ
brj-23453	101	3	primers	primer	NOUN
brj-23453	101	4	were	be	AUX
brj-23453	101	5	utilized	utilize	VERB
brj-23453	101	6	to	to	PART
brj-23453	101	7	assess	assess	VERB
brj-23453	101	8	the	the	DET
brj-23453	101	9	genetic	genetic	ADJ
brj-23453	101	10	diversity	diversity	NOUN
brj-23453	101	11	of	of	ADP
brj-23453	101	12	these	these	DET
brj-23453	101	13	genotypes	genotype	NOUN
brj-23453	101	14	at	at	ADP
brj-23453	101	15	the	the	DET
brj-23453	101	16	molecular	molecular	ADJ
brj-23453	101	17	level	level	NOUN
brj-23453	101	18	nws-005	nws-005	NOUN
brj-23453	101	19	,	,	PUNCT
brj-23453	101	20	bws-024	bws-024	NOUN
brj-23453	101	21	,	,	PUNCT
brj-23453	101	22	bws-027	bws-027	PROPN
brj-23453	101	23	,	,	PUNCT
brj-23453	101	24	aws-037	aws-037	PROPN
brj-23453	101	25	,	,	PUNCT
brj-23453	101	26	pws-016	pws-016	PROPN
brj-23453	101	27	,	,	PUNCT
brj-23453	101	28	nws-012	nws-012	PROPN
brj-23453	101	29	,	,	PUNCT
brj-23453	101	30	sws-005	sws-005	PROPN
brj-23453	101	31	,	,	PUNCT
brj-23453	101	32	tws-039	tws-039	NOUN
brj-23453	101	33	,	,	PUNCT
brj-23453	101	34	mws-025	mws-025	PROPN
brj-23453	101	35	,	,	PUNCT
brj-23453	101	36	cws-023	cws-023	NOUN
brj-23453	101	37	,	,	PUNCT
brj-23453	101	38	rws-018	rws-018	NOUN
brj-23453	101	39	,	,	PUNCT
brj-23453	101	40	sws-033	sws-033	NOUN
brj-23453	101	41	,	,	PUNCT
brj-23453	101	42	mws-035	mws-035	NOUN
brj-23453	101	43	,	,	PUNCT
brj-23453	101	44	kws-025	kws-025	PROPN
brj-23453	101	45	,	,	PUNCT
brj-23453	101	46	kws-003	kws-003	PROPN
brj-23453	101	47	,	,	PUNCT
brj-23453	101	48	rws-004	rws-004	NOUN
brj-23453	101	49	,	,	PUNCT
brj-23453	101	50	aws-011	aws-011	ADJ
brj-23453	101	51	,	,	PUNCT
brj-23453	101	52	sws-007	sws-007	ADJ
brj-23453	101	53	,	,	PUNCT
brj-23453	101	54	kws-002	kws-002	ADV
brj-23453	101	55	,	,	PUNCT
brj-23453	101	56	bws-025	bws-025	INTJ
brj-23453	101	57	,	,	PUNCT
brj-23453	101	58	and	and	CCONJ
brj-23453	101	59	gws030	gws030	PROPN
brj-23453	101	60	were	be	AUX
brj-23453	101	61	the	the	DET
brj-23453	101	62	genotypes	genotype	NOUN
brj-23453	101	63	utilized	utilize	VERB
brj-23453	101	64	in	in	ADP
brj-23453	101	65	this	this	DET
brj-23453	101	66	investigation	investigation	NOUN
brj-23453	101	67	.	.	PUNCT
brj-23453	102	1	a	a	DET
brj-23453	102	2	total	total	NOUN
brj-23453	102	3	of	of	ADP
brj-23453	102	4	sixteen	sixteen	NUM
brj-23453	102	5	ssr	ssr	ADJ
brj-23453	102	6	primers	primer	NOUN
brj-23453	102	7	were	be	AUX
brj-23453	102	8	designed	design	VERB
brj-23453	102	9	to	to	PART
brj-23453	102	10	identify	identify	VERB
brj-23453	102	11	polymorphic	polymorphic	ADJ
brj-23453	102	12	ssr	ssr	NOUN
brj-23453	102	13	loci	loci	NOUN
brj-23453	102	14	(	(	PUNCT
brj-23453	102	15	woeste	woeste	NOUN
brj-23453	102	16	et	et	PROPN
brj-23453	102	17	al	al	PROPN
brj-23453	102	18	.	.	PROPN
brj-23453	102	19	2002	2002	NUM
brj-23453	102	20	;	;	PUNCT
brj-23453	102	21	dangl	dangl	PROPN
brj-23453	102	22	et	et	PROPN
brj-23453	102	23	al	al	PROPN
brj-23453	102	24	.	.	PROPN
brj-23453	102	25	2005	2005	NUM
brj-23453	102	26	)	)	PUNCT
brj-23453	102	27	.	.	PUNCT
brj-23453	103	1	the	the	DET
brj-23453	103	2	quantity	quantity	NOUN
brj-23453	103	3	of	of	ADP
brj-23453	103	4	amplified	amplify	VERB
brj-23453	103	5	bands	band	NOUN
brj-23453	103	6	generated	generate	VERB
brj-23453	103	7	by	by	ADP
brj-23453	103	8	these	these	DET
brj-23453	103	9	primer	primer	NOUN
brj-23453	103	10	pairs	pair	NOUN
brj-23453	103	11	varied	varied	ADJ
brj-23453	103	12	,	,	PUNCT
brj-23453	103	13	with	with	ADP
brj-23453	103	14	values	value	NOUN
brj-23453	103	15	spanning	span	VERB
brj-23453	103	16	from	from	ADP
brj-23453	103	17	100	100	NUM
brj-23453	103	18	to	to	PART
brj-23453	103	19	1100	1100	NUM
brj-23453	103	20	base	base	NOUN
brj-23453	103	21	pairs	pair	NOUN
brj-23453	103	22	.	.	PUNCT
brj-23453	104	1	in	in	ADP
brj-23453	104	2	all	all	DET
brj-23453	104	3	primers	primer	NOUN
brj-23453	104	4	,	,	PUNCT
brj-23453	104	5	two	two	NUM
brj-23453	104	6	bands	band	NOUN
brj-23453	104	7	were	be	AUX
brj-23453	104	8	generated	generate	VERB
brj-23453	104	9	per	per	ADP
brj-23453	104	10	genotype	genotype	NOUN
brj-23453	104	11	,	,	PUNCT
brj-23453	104	12	thereby	thereby	ADV
brj-23453	104	13	validating	validate	VERB
brj-23453	104	14	the	the	DET
brj-23453	104	15	diploidy	diploidy	NOUN
brj-23453	104	16	degree	degree	NOUN
brj-23453	104	17	of	of	ADP
brj-23453	104	18	this	this	DET
brj-23453	104	19	species	specie	NOUN
brj-23453	104	20	.	.	PUNCT
brj-23453	105	1	the	the	DET
brj-23453	105	2	pcr	pcr	NOUN
brj-23453	105	3	-	-	PUNCT
brj-23453	105	4	amplified	amplify	VERB
brj-23453	105	5	gel	gel	NOUN
brj-23453	105	6	patterns	pattern	NOUN
brj-23453	105	7	of	of	ADP
brj-23453	105	8	different	different	ADJ
brj-23453	105	9	walnut	walnut	NOUN
brj-23453	105	10	genotypes	genotype	NOUN
brj-23453	105	11	utilized	utilize	VERB
brj-23453	105	12	in	in	ADP
brj-23453	105	13	our	our	PRON
brj-23453	105	14	investigation	investigation	NOUN
brj-23453	105	15	are	be	AUX
brj-23453	105	16	given	give	VERB
brj-23453	105	17	in	in	ADP
brj-23453	105	18	figs	fig	NOUN
brj-23453	105	19	.	.	PUNCT
brj-23453	106	1	s1	s1	NOUN
brj-23453	106	2	to	to	ADP
brj-23453	106	3	s3	s3	PROPN
brj-23453	106	4	.	.	PUNCT
brj-23453	107	1	the	the	DET
brj-23453	107	2	genetic	genetic	ADJ
brj-23453	107	3	diversity	diversity	NOUN
brj-23453	107	4	analysis	analysis	NOUN
brj-23453	107	5	of	of	ADP
brj-23453	107	6	walnut	walnut	ADJ
brj-23453	107	7	genotypes	genotype	NOUN
brj-23453	107	8	incorporated	incorporate	VERB
brj-23453	107	9	the	the	DET
brj-23453	107	10	following	follow	VERB
brj-23453	107	11	factors	factor	NOUN
brj-23453	107	12	:	:	PUNCT
brj-23453	107	13	gene	gene	NOUN
brj-23453	107	14	flow	flow	NOUN
brj-23453	107	15	(	(	PUNCT
brj-23453	107	16	nm	nm	NOUN
brj-23453	107	17	)	)	PUNCT
brj-23453	107	18	,	,	PUNCT
brj-23453	107	19	population	population	NOUN
brj-23453	107	20	differentiation	differentiation	NOUN
brj-23453	107	21	or	or	CCONJ
brj-23453	107	22	genetic	genetic	ADJ
brj-23453	107	23	variation	variation	NOUN
brj-23453	107	24	(	(	PUNCT
brj-23453	107	25	fst	fst	NOUN
brj-23453	107	26	)	)	PUNCT
brj-23453	107	27	,	,	PUNCT
brj-23453	107	28	and	and	CCONJ
brj-23453	107	29	per	per	ADP
brj-23453	107	30	locus	locus	NOUN
brj-23453	107	31	na	na	NOUN
brj-23453	107	32	,	,	PUNCT
brj-23453	107	33	ho	ho	PROPN
brj-23453	107	34	,	,	PUNCT
brj-23453	107	35	he	he	PRON
brj-23453	107	36	,	,	PUNCT
brj-23453	107	37	pic	pic	NOUN
brj-23453	107	38	,	,	PUNCT
brj-23453	107	39	and	and	CCONJ
brj-23453	107	40	npa	npa	X
brj-23453	107	41	.	.	PUNCT
brj-23453	108	1	the	the	DET
brj-23453	108	2	na	na	NOUN
brj-23453	108	3	observed	observe	VERB
brj-23453	108	4	at	at	ADP
brj-23453	108	5	each	each	DET
brj-23453	108	6	locus	locus	NOUN
brj-23453	108	7	ranged	range	VERB
brj-23453	108	8	from	from	ADP
brj-23453	108	9	2	2	NUM
brj-23453	108	10	to	to	ADP
brj-23453	108	11	4	4	NUM
brj-23453	108	12	alleles	allele	NOUN
brj-23453	108	13	,	,	PUNCT
brj-23453	108	14	with	with	ADP
brj-23453	108	15	an	an	DET
brj-23453	108	16	average	average	NOUN
brj-23453	108	17	of	of	ADP
brj-23453	108	18	2.94	2.94	NUM
brj-23453	108	19	alleles	allele	NOUN
brj-23453	108	20	per	per	ADP
brj-23453	108	21	locus	locus	NOUN
brj-23453	108	22	,	,	PUNCT
brj-23453	108	23	as	as	SCONJ
brj-23453	108	24	shown	show	VERB
brj-23453	108	25	in	in	ADP
brj-23453	108	26	table	table	NOUN
brj-23453	108	27	s2	s2	PROPN
brj-23453	108	28	.	.	PUNCT
brj-23453	109	1	the	the	DET
brj-23453	109	2	values	value	NOUN
brj-23453	109	3	of	of	ADP
brj-23453	109	4	ne	ne	PROPN
brj-23453	109	5	and	and	CCONJ
brj-23453	109	6	i	i	PRON
brj-23453	109	7	in	in	ADP
brj-23453	109	8	the	the	DET
brj-23453	109	9	populations	population	NOUN
brj-23453	109	10	of	of	ADP
brj-23453	109	11	the	the	DET
brj-23453	109	12	budgam	budgam	NOUN
brj-23453	109	13	and	and	CCONJ
brj-23453	109	14	ganderbal	ganderbal	NOUN
brj-23453	109	15	ranged	range	VERB
brj-23453	109	16	between	between	ADP
brj-23453	109	17	1.00	1.00	NUM
brj-23453	109	18	and	and	CCONJ
brj-23453	109	19	1.80	1.80	NUM
brj-23453	109	20	and	and	CCONJ
brj-23453	109	21	1.24	1.24	NUM
brj-23453	109	22	and	and	CCONJ
brj-23453	109	23	1.68	1.68	NUM
brj-23453	109	24	,	,	PUNCT
brj-23453	109	25	respectively	respectively	ADV
brj-23453	109	26	,	,	PUNCT
brj-23453	109	27	with	with	ADP
brj-23453	109	28	means	mean	NOUN
brj-23453	109	29	of	of	ADP
brj-23453	109	30	1.37	1.37	NUM
brj-23453	109	31	and	and	CCONJ
brj-23453	109	32	1.45	1.45	NUM
brj-23453	109	33	.	.	PUNCT
brj-23453	110	1	wga-4	wga-4	PUNCT
brj-23453	110	2	exhibited	exhibit	VERB
brj-23453	110	3	the	the	DET
brj-23453	110	4	highest	high	ADJ
brj-23453	110	5	quantity	quantity	NOUN
brj-23453	110	6	of	of	ADP
brj-23453	110	7	expected	expect	VERB
brj-23453	110	8	heterozygosity	heterozygosity	NOUN
brj-23453	110	9	(	(	PUNCT
brj-23453	110	10	0.89	0.89	NUM
brj-23453	110	11	)	)	PUNCT
brj-23453	110	12	,	,	PUNCT
brj-23453	110	13	followed	follow	VERB
brj-23453	110	14	by	by	ADP
brj-23453	110	15	wga-27	wga-27	NUM
brj-23453	110	16	(	(	PUNCT
brj-23453	110	17	0.83	0.83	NUM
brj-23453	110	18	)	)	PUNCT
brj-23453	110	19	;	;	PUNCT
brj-23453	110	20	wga-27	wga-27	NUM
brj-23453	110	21	displayed	display	VERB
brj-23453	110	22	the	the	DET
brj-23453	110	23	lowest	low	ADJ
brj-23453	110	24	expected	expect	VERB
brj-23453	110	25	heterozygosity	heterozygosity	NOUN
brj-23453	110	26	(	(	PUNCT
brj-23453	110	27	0.52	0.52	NUM
brj-23453	110	28	)	)	PUNCT
brj-23453	110	29	.	.	PUNCT
brj-23453	111	1	the	the	DET
brj-23453	111	2	mean	mean	ADJ
brj-23453	111	3	heterozygosity	heterozygosity	NOUN
brj-23453	111	4	was	be	AUX
brj-23453	111	5	0.15	0.15	NUM
brj-23453	111	6	,	,	PUNCT
brj-23453	111	7	with	with	ADP
brj-23453	111	8	observed	observed	ADJ
brj-23453	111	9	values	value	NOUN
brj-23453	111	10	ranging	range	VERB
brj-23453	111	11	from	from	ADP
brj-23453	111	12	0.03	0.03	NUM
brj-23453	111	13	to	to	ADP
brj-23453	111	14	0.23	0.23	NUM
brj-23453	111	15	.	.	PUNCT
brj-23453	112	1	following	follow	VERB
brj-23453	112	2	the	the	DET
brj-23453	112	3	principal	principal	NOUN
brj-23453	112	4	ho	ho	PROPN
brj-23453	112	5	in	in	ADP
brj-23453	112	6	wga-292	wga-292	NOUN
brj-23453	112	7	and	and	CCONJ
brj-23453	112	8	wga-332	wga-332	NOUN
brj-23453	112	9	were	be	AUX
brj-23453	112	10	wga-1	wga-1	ADV
brj-23453	112	11	,	,	PUNCT
brj-23453	112	12	wga-69	wga-69	PROPN
brj-23453	112	13	,	,	PUNCT
brj-23453	112	14	and	and	CCONJ
brj-23453	112	15	wga-76	wga-76	NOUN
brj-23453	112	16	.	.	PUNCT
brj-23453	113	1	in	in	ADP
brj-23453	113	2	wga-27	wga-27	PROPN
brj-23453	113	3	,	,	PUNCT
brj-23453	113	4	a	a	DET
brj-23453	113	5	minimum	minimum	ADJ
brj-23453	113	6	value	value	NOUN
brj-23453	113	7	was	be	AUX
brj-23453	113	8	observed	observe	VERB
brj-23453	113	9	.	.	PUNCT
brj-23453	114	1	an	an	DET
brj-23453	114	2	average	average	ADJ
brj-23453	114	3	pic	pic	NOUN
brj-23453	114	4	of	of	ADP
brj-23453	114	5	0.22	0.22	NUM
brj-23453	114	6	was	be	AUX
brj-23453	114	7	determined	determine	VERB
brj-23453	114	8	.	.	PUNCT
brj-23453	115	1	the	the	DET
brj-23453	115	2	range	range	NOUN
brj-23453	115	3	of	of	ADP
brj-23453	115	4	the	the	DET
brj-23453	115	5	pic	pic	NOUN
brj-23453	115	6	value	value	NOUN
brj-23453	115	7	was	be	AUX
brj-23453	115	8	0.11	0.11	NUM
brj-23453	115	9	to	to	ADP
brj-23453	115	10	0.38	0.38	NUM
brj-23453	115	11	.	.	PUNCT
brj-23453	116	1	wga69	wga69	PROPN
brj-23453	116	2	yielded	yield	VERB
brj-23453	116	3	the	the	DET
brj-23453	116	4	highest	high	ADJ
brj-23453	116	5	pic	pic	NOUN
brj-23453	116	6	value	value	NOUN
brj-23453	116	7	,	,	PUNCT
brj-23453	116	8	which	which	PRON
brj-23453	116	9	was	be	AUX
brj-23453	116	10	subsequently	subsequently	ADV
brj-23453	116	11	surpassed	surpass	VERB
brj-23453	116	12	by	by	ADP
brj-23453	116	13	wga-1	wga-1	NUM
brj-23453	116	14	,	,	PUNCT
brj-23453	116	15	wga118	wga118	NOUN
brj-23453	116	16	,	,	PUNCT
brj-23453	116	17	and	and	CCONJ
brj-23453	116	18	wga-276	wga-276	ADJ
brj-23453	116	19	.	.	PUNCT
brj-23453	117	1	the	the	DET
brj-23453	117	2	lowest	low	ADJ
brj-23453	117	3	pic	pic	NOUN
brj-23453	117	4	value	value	NOUN
brj-23453	117	5	was	be	AUX
brj-23453	117	6	documented	document	VERB
brj-23453	117	7	in	in	ADP
brj-23453	117	8	wga-202	wga-202	PROPN
brj-23453	117	9	.	.	PUNCT
brj-23453	118	1	the	the	DET
brj-23453	118	2	average	average	ADJ
brj-23453	118	3	value	value	NOUN
brj-23453	118	4	of	of	ADP
brj-23453	118	5	private	private	ADJ
brj-23453	118	6	alleles	allele	NOUN
brj-23453	118	7	was	be	AUX
brj-23453	118	8	1.17	1.17	NUM
brj-23453	118	9	,	,	PUNCT
brj-23453	118	10	with	with	ADP
brj-23453	118	11	a	a	DET
brj-23453	118	12	range	range	NOUN
brj-23453	118	13	of	of	ADP
brj-23453	118	14	0.41	0.41	NUM
brj-23453	118	15	to	to	ADP
brj-23453	118	16	3.11	3.11	NUM
brj-23453	118	17	.	.	PUNCT
brj-23453	119	1	the	the	DET
brj-23453	119	2	wga-376	wga-376	NOUN
brj-23453	119	3	variant	variant	NOUN
brj-23453	119	4	exhibited	exhibit	VERB
brj-23453	119	5	the	the	DET
brj-23453	119	6	highest	high	ADJ
brj-23453	119	7	count	count	NOUN
brj-23453	119	8	of	of	ADP
brj-23453	119	9	private	private	ADJ
brj-23453	119	10	alleles	allele	NOUN
brj-23453	119	11	at	at	ADP
brj-23453	119	12	3.11	3.11	NUM
brj-23453	119	13	,	,	PUNCT
brj-23453	119	14	whereas	whereas	SCONJ
brj-23453	119	15	the	the	DET
brj-23453	119	16	wga-76	wga-76	NOUN
brj-23453	119	17	variant	variant	NOUN
brj-23453	119	18	documented	document	VERB
brj-23453	119	19	the	the	DET
brj-23453	119	20	lowest	low	ADJ
brj-23453	119	21	count	count	NOUN
brj-23453	119	22	at	at	ADP
brj-23453	119	23	0.41	0.41	NUM
brj-23453	119	24	.	.	PUNCT
brj-23453	120	1	the	the	DET
brj-23453	120	2	mean	mean	ADJ
brj-23453	120	3	population	population	NOUN
brj-23453	120	4	differentiation	differentiation	NOUN
brj-23453	120	5	(	(	PUNCT
brj-23453	120	6	fst	fst	NOUN
brj-23453	120	7	)	)	PUNCT
brj-23453	120	8	was	be	AUX
brj-23453	120	9	0.219	0.219	NUM
brj-23453	120	10	,	,	PUNCT
brj-23453	120	11	with	with	ADP
brj-23453	120	12	values	value	NOUN
brj-23453	120	13	ranging	range	VERB
brj-23453	120	14	from	from	ADP
brj-23453	120	15	0.156	0.156	NUM
brj-23453	120	16	to	to	ADP
brj-23453	120	17	0.343	0.343	NUM
brj-23453	120	18	.	.	PUNCT
brj-23453	121	1	the	the	DET
brj-23453	121	2	highest	high	ADJ
brj-23453	121	3	fst	fst	NOUN
brj-23453	121	4	value	value	NOUN
brj-23453	121	5	was	be	AUX
brj-23453	121	6	detected	detect	VERB
brj-23453	121	7	in	in	ADP
brj-23453	121	8	wga-76	wga-76	PROPN
brj-23453	121	9	,	,	PUNCT
brj-23453	121	10	with	with	ADP
brj-23453	121	11	wga-118	wga-118	VERB
brj-23453	121	12	and	and	CCONJ
brj-23453	121	13	wga-32	wga-32	NUM
brj-23453	121	14	following	follow	VERB
brj-23453	121	15	suit	suit	NOUN
brj-23453	121	16	.	.	PUNCT
brj-23453	122	1	in	in	ADP
brj-23453	122	2	wga-4	wga-4	ADV
brj-23453	122	3	,	,	PUNCT
brj-23453	122	4	the	the	DET
brj-23453	122	5	minimum	minimum	ADJ
brj-23453	122	6	value	value	NOUN
brj-23453	122	7	of	of	ADP
brj-23453	122	8	heterozygosity	heterozygosity	NOUN
brj-23453	122	9	(	(	PUNCT
brj-23453	122	10	fst	fst	NOUN
brj-23453	122	11	)	)	PUNCT
brj-23453	122	12	was	be	AUX
brj-23453	122	13	observed	observe	VERB
brj-23453	122	14	.	.	PUNCT
brj-23453	123	1	notably	notably	ADV
brj-23453	123	2	,	,	PUNCT
brj-23453	123	3	the	the	DET
brj-23453	123	4	examination	examination	NOUN
brj-23453	123	5	of	of	ADP
brj-23453	123	6	germplasm	germplasm	NOUN
brj-23453	123	7	effects	effect	NOUN
brj-23453	123	8	on	on	ADP
brj-23453	123	9	walnut	walnut	NOUN
brj-23453	123	10	trees	tree	NOUN
brj-23453	123	11	provided	provide	VERB
brj-23453	123	12	valuable	valuable	ADJ
brj-23453	123	13	findings	finding	NOUN
brj-23453	123	14	.	.	PUNCT
brj-23453	124	1	germplasm	germplasm	NOUN
brj-23453	124	2	variation	variation	NOUN
brj-23453	124	3	was	be	AUX
brj-23453	124	4	observed	observe	VERB
brj-23453	124	5	to	to	PART
brj-23453	124	6	have	have	VERB
brj-23453	124	7	a	a	DET
brj-23453	124	8	discernible	discernible	ADJ
brj-23453	124	9	impact	impact	NOUN
brj-23453	124	10	on	on	ADP
brj-23453	124	11	various	various	ADJ
brj-23453	124	12	phenotypic	phenotypic	ADJ
brj-23453	124	13	and	and	CCONJ
brj-23453	124	14	genotypic	genotypic	NOUN
brj-23453	124	15	traits	trait	NOUN
brj-23453	124	16	,	,	PUNCT
brj-23453	124	17	including	include	VERB
brj-23453	124	18	growth	growth	NOUN
brj-23453	124	19	characteristics	characteristic	NOUN
brj-23453	124	20	,	,	PUNCT
brj-23453	124	21	disease	disease	NOUN
brj-23453	124	22	resistance	resistance	NOUN
brj-23453	124	23	,	,	PUNCT
brj-23453	124	24	and	and	CCONJ
brj-23453	124	25	nut	nut	NOUN
brj-23453	124	26	quality	quality	NOUN
brj-23453	124	27	attributes	attribute	NOUN
brj-23453	124	28	.	.	PUNCT
brj-23453	125	1	specifically	specifically	ADV
brj-23453	125	2	,	,	PUNCT
brj-23453	125	3	certain	certain	ADJ
brj-23453	125	4	walnut	walnut	NOUN
brj-23453	125	5	genotypes	genotype	NOUN
brj-23453	125	6	exhibited	exhibit	VERB
brj-23453	125	7	distinct	distinct	ADJ
brj-23453	125	8	genetic	genetic	ADJ
brj-23453	125	9	profiles	profile	NOUN
brj-23453	125	10	and	and	CCONJ
brj-23453	125	11	phenotypic	phenotypic	ADJ
brj-23453	125	12	expressions	expression	NOUN
brj-23453	125	13	,	,	PUNCT
brj-23453	125	14	suggesting	suggest	VERB
brj-23453	125	15	the	the	DET
brj-23453	125	16	influence	influence	NOUN
brj-23453	125	17	of	of	ADP
brj-23453	125	18	specific	specific	ADJ
brj-23453	125	19	germplasm	germplasm	NOUN
brj-23453	125	20	on	on	ADP
brj-23453	125	21	tree	tree	NOUN
brj-23453	125	22	morphology	morphology	NOUN
brj-23453	125	23	and	and	CCONJ
brj-23453	125	24	performance	performance	NOUN
brj-23453	125	25	.	.	PUNCT
brj-23453	126	1	these	these	DET
brj-23453	126	2	observations	observation	NOUN
brj-23453	126	3	underscore	underscore	VERB
brj-23453	126	4	the	the	DET
brj-23453	126	5	importance	importance	NOUN
brj-23453	126	6	of	of	ADP
brj-23453	126	7	considering	consider	VERB
brj-23453	126	8	germplasm	germplasm	NOUN
brj-23453	126	9	diversity	diversity	NOUN
brj-23453	126	10	in	in	ADP
brj-23453	126	11	walnut	walnut	ADJ
brj-23453	126	12	breeding	breeding	NOUN
brj-23453	126	13	programs	program	NOUN
brj-23453	126	14	and	and	CCONJ
brj-23453	126	15	conservation	conservation	NOUN
brj-23453	126	16	efforts	effort	NOUN
brj-23453	126	17	aimed	aim	VERB
brj-23453	126	18	at	at	ADP
brj-23453	126	19	enhancing	enhance	VERB
brj-23453	126	20	walnut	walnut	ADJ
brj-23453	126	21	cultivation	cultivation	NOUN
brj-23453	126	22	in	in	ADP
brj-23453	126	23	the	the	DET
brj-23453	126	24	region	region	NOUN
brj-23453	126	25	.	.	PUNCT
brj-23453	127	1	further	further	ADJ
brj-23453	127	2	investigations	investigation	NOUN
brj-23453	127	3	into	into	ADP
brj-23453	127	4	the	the	DET
brj-23453	127	5	specific	specific	ADJ
brj-23453	127	6	mechanisms	mechanism	NOUN
brj-23453	127	7	underlying	underlie	VERB
brj-23453	127	8	germplasm	germplasm	NOUN
brj-23453	127	9	effects	effect	NOUN
brj-23453	127	10	on	on	ADP
brj-23453	127	11	walnut	walnut	NOUN
brj-23453	127	12	trees	tree	NOUN
brj-23453	127	13	are	be	AUX
brj-23453	127	14	warranted	warrant	VERB
brj-23453	127	15	to	to	PART
brj-23453	127	16	fully	fully	ADV
brj-23453	127	17	elucidate	elucidate	VERB
brj-23453	127	18	their	their	PRON
brj-23453	127	19	implications	implication	NOUN
brj-23453	127	20	for	for	ADP
brj-23453	127	21	tree	tree	NOUN
brj-23453	127	22	productivity	productivity	NOUN
brj-23453	127	23	and	and	CCONJ
brj-23453	127	24	resilience	resilience	NOUN
brj-23453	127	25	in	in	ADP
brj-23453	127	26	the	the	DET
brj-23453	127	27	northwestern	northwestern	ADJ
brj-23453	127	28	himalayan	himalayan	ADJ
brj-23453	127	29	region	region	NOUN
brj-23453	127	30	of	of	ADP
brj-23453	127	31	jammu	jammu	PROPN
brj-23453	127	32	and	and	CCONJ
brj-23453	127	33	kashmir	kashmir	PROPN
brj-23453	127	34	.	.	PUNCT
brj-23453	128	1	assessing	assess	VERB
brj-23453	128	2	the	the	DET
brj-23453	128	3	genetic	genetic	ADJ
brj-23453	128	4	population	population	NOUN
brj-23453	128	5	,	,	PUNCT
brj-23453	128	6	genetic	genetic	ADJ
brj-23453	128	7	relationships	relationship	NOUN
brj-23453	128	8	,	,	PUNCT
brj-23453	128	9	and	and	CCONJ
brj-23453	128	10	genotype	genotype	NOUN
brj-23453	128	11	identity	identity	NOUN
brj-23453	128	12	of	of	ADP
brj-23453	128	13	walnut	walnut	NOUN
brj-23453	128	14	trees	tree	NOUN
brj-23453	128	15	has	have	VERB
brj-23453	128	16	significant	significant	ADJ
brj-23453	128	17	implications	implication	NOUN
brj-23453	128	18	for	for	ADP
brj-23453	128	19	their	their	PRON
brj-23453	128	20	lifespan	lifespan	NOUN
brj-23453	128	21	and	and	CCONJ
brj-23453	128	22	conservation	conservation	NOUN
brj-23453	128	23	.	.	PUNCT
brj-23453	129	1	understanding	understand	VERB
brj-23453	129	2	the	the	DET
brj-23453	129	3	genetic	genetic	ADJ
brj-23453	129	4	diversity	diversity	NOUN
brj-23453	129	5	and	and	CCONJ
brj-23453	129	6	population	population	NOUN
brj-23453	129	7	structure	structure	NOUN
brj-23453	129	8	allows	allow	VERB
brj-23453	129	9	for	for	ADP
brj-23453	129	10	the	the	DET
brj-23453	129	11	identification	identification	NOUN
brj-23453	129	12	of	of	ADP
brj-23453	129	13	unique	unique	ADJ
brj-23453	129	14	genotypes	genotype	NOUN
brj-23453	129	15	with	with	ADP
brj-23453	129	16	desirable	desirable	ADJ
brj-23453	129	17	traits	trait	NOUN
brj-23453	129	18	,	,	PUNCT
brj-23453	129	19	such	such	ADJ
brj-23453	129	20	as	as	ADP
brj-23453	129	21	disease	disease	NOUN
brj-23453	129	22	resistance	resistance	NOUN
brj-23453	129	23	,	,	PUNCT
brj-23453	129	24	high	high	ADJ
brj-23453	129	25	yield	yield	NOUN
brj-23453	129	26	,	,	PUNCT
brj-23453	129	27	and	and	CCONJ
brj-23453	129	28	superior	superior	ADJ
brj-23453	129	29	nut	nut	NOUN
brj-23453	129	30	peer	peer	NOUN
brj-23453	129	31	-	-	PUNCT
brj-23453	129	32	reviewed	review	VERB
brj-23453	129	33	article	article	NOUN
brj-23453	129	34	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	130	1	wani	wani	PROPN
brj-23453	130	2	et	et	PROPN
brj-23453	130	3	al	al	PROPN
brj-23453	130	4	.	.	PROPN
brj-23453	130	5	(	(	PUNCT
brj-23453	130	6	2024	2024	NUM
brj-23453	130	7	)	)	PUNCT
brj-23453	130	8	.	.	PUNCT
brj-23453	131	1	“	"	PUNCT
brj-23453	131	2	walnut	walnut	ADJ
brj-23453	131	3	population	population	NOUN
brj-23453	131	4	&	&	CCONJ
brj-23453	131	5	diversity	diversity	NOUN
brj-23453	131	6	,	,	PUNCT
brj-23453	131	7	”	"	PUNCT
brj-23453	131	8	bioresources	bioresource	NOUN
brj-23453	131	9	19(3	19(3	NUM
brj-23453	131	10	)	)	PUNCT
brj-23453	131	11	,	,	PUNCT
brj-23453	131	12	4213	4213	NUM
brj-23453	131	13	-	-	SYM
brj-23453	131	14	4237	4237	NUM
brj-23453	131	15	.	.	PUNCT
brj-23453	132	1	4218	4218	NUM
brj-23453	132	2	quality	quality	NOUN
brj-23453	132	3	.	.	PUNCT
brj-23453	133	1	by	by	ADP
brj-23453	133	2	pinpointing	pinpoint	VERB
brj-23453	133	3	these	these	DET
brj-23453	133	4	valuable	valuable	ADJ
brj-23453	133	5	genetic	genetic	ADJ
brj-23453	133	6	resources	resource	NOUN
brj-23453	133	7	,	,	PUNCT
brj-23453	133	8	breeders	breeder	NOUN
brj-23453	133	9	can	can	AUX
brj-23453	133	10	develop	develop	VERB
brj-23453	133	11	improved	improved	ADJ
brj-23453	133	12	cultivars	cultivar	NOUN
brj-23453	133	13	that	that	PRON
brj-23453	133	14	are	be	AUX
brj-23453	133	15	better	well	ADV
brj-23453	133	16	adapted	adapt	VERB
brj-23453	133	17	to	to	ADP
brj-23453	133	18	local	local	ADJ
brj-23453	133	19	environmental	environmental	ADJ
brj-23453	133	20	conditions	condition	NOUN
brj-23453	133	21	and	and	CCONJ
brj-23453	133	22	more	more	ADV
brj-23453	133	23	resilient	resilient	ADJ
brj-23453	133	24	to	to	ADP
brj-23453	133	25	biotic	biotic	ADJ
brj-23453	133	26	and	and	CCONJ
brj-23453	133	27	abiotic	abiotic	ADJ
brj-23453	133	28	stresses	stress	NOUN
brj-23453	133	29	.	.	PUNCT
brj-23453	134	1	furthermore	furthermore	ADV
brj-23453	134	2	,	,	PUNCT
brj-23453	134	3	assessing	assess	VERB
brj-23453	134	4	genetic	genetic	ADJ
brj-23453	134	5	relationships	relationship	NOUN
brj-23453	134	6	helps	helps	AUX
brj-23453	134	7	elucidate	elucidate	VERB
brj-23453	134	8	the	the	DET
brj-23453	134	9	evolutionary	evolutionary	ADJ
brj-23453	134	10	history	history	NOUN
brj-23453	134	11	of	of	ADP
brj-23453	134	12	walnut	walnut	NOUN
brj-23453	134	13	populations	population	NOUN
brj-23453	134	14	,	,	PUNCT
brj-23453	134	15	informing	inform	VERB
brj-23453	134	16	conservation	conservation	NOUN
brj-23453	134	17	strategies	strategy	NOUN
brj-23453	134	18	to	to	PART
brj-23453	134	19	preserve	preserve	VERB
brj-23453	134	20	genetic	genetic	ADJ
brj-23453	134	21	diversity	diversity	NOUN
brj-23453	134	22	and	and	CCONJ
brj-23453	134	23	prevent	prevent	VERB
brj-23453	134	24	genetic	genetic	ADJ
brj-23453	134	25	erosion	erosion	NOUN
brj-23453	134	26	.	.	PUNCT
brj-23453	135	1	ultimately	ultimately	ADV
brj-23453	135	2	,	,	PUNCT
brj-23453	135	3	by	by	ADP
brj-23453	135	4	leveraging	leverage	VERB
brj-23453	135	5	genetic	genetic	ADJ
brj-23453	135	6	information	information	NOUN
brj-23453	135	7	,	,	PUNCT
brj-23453	135	8	stakeholders	stakeholder	NOUN
brj-23453	135	9	can	can	AUX
brj-23453	135	10	implement	implement	VERB
brj-23453	135	11	targeted	target	VERB
brj-23453	135	12	conservation	conservation	NOUN
brj-23453	135	13	efforts	effort	NOUN
brj-23453	135	14	and	and	CCONJ
brj-23453	135	15	sustainable	sustainable	ADJ
brj-23453	135	16	management	management	NOUN
brj-23453	135	17	practices	practice	NOUN
brj-23453	135	18	to	to	PART
brj-23453	135	19	ensure	ensure	VERB
brj-23453	135	20	the	the	DET
brj-23453	135	21	long	long	ADJ
brj-23453	135	22	-	-	PUNCT
brj-23453	135	23	term	term	NOUN
brj-23453	135	24	survival	survival	NOUN
brj-23453	135	25	and	and	CCONJ
brj-23453	135	26	productivity	productivity	NOUN
brj-23453	135	27	of	of	ADP
brj-23453	135	28	walnut	walnut	NOUN
brj-23453	135	29	trees	tree	NOUN
brj-23453	135	30	in	in	ADP
brj-23453	135	31	the	the	DET
brj-23453	135	32	northwestern	northwestern	ADJ
brj-23453	135	33	himalayan	himalayan	ADJ
brj-23453	135	34	region	region	NOUN
brj-23453	135	35	of	of	ADP
brj-23453	135	36	jammu	jammu	PROPN
brj-23453	135	37	and	and	CCONJ
brj-23453	135	38	kashmir	kashmir	PROPN
brj-23453	135	39	.	.	PUNCT
brj-23453	136	1	population	population	NOUN
brj-23453	136	2	variation	variation	NOUN
brj-23453	136	3	the	the	DET
brj-23453	136	4	mean	mean	ADJ
brj-23453	136	5	population	population	NOUN
brj-23453	136	6	variation	variation	NOUN
brj-23453	136	7	(	(	PUNCT
brj-23453	136	8	fst	fst	NOUN
brj-23453	136	9	)	)	PUNCT
brj-23453	136	10	for	for	ADP
brj-23453	136	11	each	each	DET
brj-23453	136	12	locus	locus	NOUN
brj-23453	136	13	under	under	ADP
brj-23453	136	14	investigation	investigation	NOUN
brj-23453	136	15	was	be	AUX
brj-23453	136	16	0.219	0.219	NUM
brj-23453	136	17	,	,	PUNCT
brj-23453	136	18	with	with	ADP
brj-23453	136	19	values	value	NOUN
brj-23453	136	20	ranging	range	VERB
brj-23453	136	21	from	from	ADP
brj-23453	136	22	0.156	0.156	NUM
brj-23453	136	23	to	to	ADP
brj-23453	136	24	0.343	0.343	NUM
brj-23453	136	25	(	(	PUNCT
brj-23453	136	26	tables	table	NOUN
brj-23453	136	27	s3	s3	PROPN
brj-23453	136	28	and	and	CCONJ
brj-23453	136	29	s4	s4	PROPN
brj-23453	136	30	)	)	PUNCT
brj-23453	136	31	.	.	PUNCT
brj-23453	137	1	table	table	NOUN
brj-23453	137	2	1	1	NUM
brj-23453	137	3	.	.	PUNCT
brj-23453	138	1	the	the	DET
brj-23453	138	2	nucleotide	nucleotide	ADJ
brj-23453	138	3	sequences	sequence	NOUN
brj-23453	138	4	of	of	ADP
brj-23453	138	5	the	the	DET
brj-23453	138	6	ssr	ssr	ADJ
brj-23453	138	7	primers	primer	NOUN
brj-23453	138	8	used	use	VERB
brj-23453	138	9	to	to	PART
brj-23453	138	10	screen	screen	VERB
brj-23453	138	11	walnut	walnut	NOUN
brj-23453	138	12	selections	selection	NOUN
brj-23453	138	13	/	/	SYM
brj-23453	138	14	genotypes	genotype	NOUN
brj-23453	138	15	s.	s.	PROPN
brj-23453	139	1	no	no	INTJ
brj-23453	139	2	.	.	PUNCT
brj-23453	140	1	primer	primer	PROPN
brj-23453	140	2	pic	pic	PROPN
brj-23453	140	3	*	*	PROPN
brj-23453	140	4	mi	mi	PROPN
brj-23453	140	5	*	*	PROPN
brj-23453	140	6	rp	rp	NOUN
brj-23453	140	7	*	*	PROPN
brj-23453	140	8	1	1	NUM
brj-23453	140	9	wga-69	wga-69	NOUN
brj-23453	140	10	0.38	0.38	NUM
brj-23453	140	11	0.38	0.38	NUM
brj-23453	140	12	0.98	0.98	NUM
brj-23453	140	13	2	2	NUM
brj-23453	140	14	wga-118	wga-118	VERB
brj-23453	140	15	0.29	0.29	NUM
brj-23453	140	16	0.28	0.28	NUM
brj-23453	140	17	1.89	1.89	NUM
brj-23453	140	18	3	3	NUM
brj-23453	140	19	wga32	wga32	NOUN
brj-23453	140	20	0.27	0.27	NUM
brj-23453	140	21	0.27	0.27	NUM
brj-23453	140	22	1.72	1.72	NUM
brj-23453	140	23	4	4	NUM
brj-23453	140	24	wga-202	wga-202	NOUN
brj-23453	140	25	0.11	0.11	NUM
brj-23453	140	26	0.10	0.10	NUM
brj-23453	140	27	1.32	1.32	NUM
brj-23453	140	28	5	5	NUM
brj-23453	140	29	wga-1	wga-1	NUM
brj-23453	140	30	0.33	0.33	NUM
brj-23453	140	31	0.33	0.33	NUM
brj-23453	140	32	0.85	0.85	NUM
brj-23453	140	33	6	6	NUM
brj-23453	140	34	wga-4	wga-4	NUM
brj-23453	140	35	0.12	0.12	NUM
brj-23453	140	36	0.12	0.12	NUM
brj-23453	140	37	0.56	0.56	NUM
brj-23453	140	38	7	7	NUM
brj-23453	140	39	wga-27	wga-27	NUM
brj-23453	140	40	0.19	0.19	NUM
brj-23453	140	41	0.18	0.18	NUM
brj-23453	140	42	0.71	0.71	NUM
brj-23453	140	43	8	8	NUM
brj-23453	140	44	wga-76	wga-76	VERB
brj-23453	140	45	0.17	0.17	NUM
brj-23453	140	46	0.16	0.16	NUM
brj-23453	140	47	1.85	1.85	NUM
brj-23453	140	48	9	9	NUM
brj-23453	140	49	wga-42	wga-42	NOUN
brj-23453	140	50	0.22	0.22	NUM
brj-23453	140	51	0.22	0.22	NUM
brj-23453	140	52	1.95	1.95	NUM
brj-23453	140	53	10	10	NUM
brj-23453	140	54	wga-79	wga-79	NOUN
brj-23453	140	55	0.21	0.21	NUM
brj-23453	140	56	0.21	0.21	NUM
brj-23453	140	57	0.78	0.78	NUM
brj-23453	140	58	11	11	NUM
brj-23453	140	59	wg-72	wg-72	NUM
brj-23453	140	60	0.28	0.28	NUM
brj-23453	140	61	0.28	0.28	NUM
brj-23453	140	62	0.44	0.44	NUM
brj-23453	140	63	12	12	NUM
brj-23453	140	64	wga-71	wga-71	PROPN
brj-23453	140	65	0.13	0.13	NUM
brj-23453	140	66	0.13	0.13	NUM
brj-23453	140	67	0.73	0.73	NUM
brj-23453	140	68	13	13	NUM
brj-23453	140	69	wga-276	wga-276	ADP
brj-23453	140	70	0.29	0.29	NUM
brj-23453	140	71	0.29	0.29	NUM
brj-23453	140	72	1.62	1.62	NUM
brj-23453	140	73	14	14	NUM
brj-23453	140	74	wga-225	wga-225	VERB
brj-23453	140	75	0.14	0.14	NUM
brj-23453	140	76	0.14	0.14	NUM
brj-23453	140	77	1.04	1.04	NUM
brj-23453	140	78	15	15	NUM
brj-23453	140	79	wga-376	wga-376	NOUN
brj-23453	140	80	0.23	0.23	NUM
brj-23453	140	81	0.22	0.22	NUM
brj-23453	140	82	1.83	1.83	NUM
brj-23453	140	83	16	16	NUM
brj-23453	140	84	wga-332	wga-332	NOUN
brj-23453	140	85	0.16	0.16	NUM
brj-23453	140	86	0.16	0.16	NUM
brj-23453	140	87	2.12	2.12	NUM
brj-23453	140	88	average	average	NOUN
brj-23453	140	89	0.22	0.22	NUM
brj-23453	140	90	0.199	0.199	NUM
brj-23453	140	91	1.27	1.27	NUM
brj-23453	140	92	*	*	NOUN
brj-23453	140	93	pic	pic	NOUN
brj-23453	140	94	=	=	SYM
brj-23453	140	95	polymorphic	polymorphic	ADJ
brj-23453	140	96	information	information	NOUN
brj-23453	140	97	content	content	NOUN
brj-23453	140	98	*	*	PUNCT
brj-23453	140	99	rp	rp	NOUN
brj-23453	140	100	=	=	VERB
brj-23453	140	101	resolving	resolve	VERB
brj-23453	140	102	power	power	NOUN
brj-23453	140	103	*	*	PUNCT
brj-23453	140	104	mi	mi	NOUN
brj-23453	140	105	=	=	NOUN
brj-23453	140	106	marker	marker	NOUN
brj-23453	140	107	index	index	NOUN
brj-23453	140	108	the	the	DET
brj-23453	140	109	population	population	NOUN
brj-23453	140	110	exhibited	exhibit	VERB
brj-23453	140	111	a	a	DET
brj-23453	140	112	range	range	NOUN
brj-23453	140	113	of	of	ADP
brj-23453	140	114	inbreeding	inbreede	VERB
brj-23453	140	115	levels	level	NOUN
brj-23453	140	116	(	(	PUNCT
brj-23453	140	117	fis	fis	PROPN
brj-23453	140	118	)	)	PUNCT
brj-23453	140	119	between	between	ADP
brj-23453	140	120	0.013	0.013	NUM
brj-23453	140	121	and	and	CCONJ
brj-23453	140	122	0.691	0.691	NUM
brj-23453	140	123	,	,	PUNCT
brj-23453	140	124	with	with	ADP
brj-23453	140	125	an	an	DET
brj-23453	140	126	average	average	ADJ
brj-23453	140	127	value	value	NOUN
brj-23453	140	128	of	of	ADP
brj-23453	140	129	0.188	0.188	NUM
brj-23453	140	130	.	.	PUNCT
brj-23453	141	1	similarly	similarly	ADV
brj-23453	141	2	,	,	PUNCT
brj-23453	141	3	the	the	DET
brj-23453	141	4	fit	fit	ADJ
brj-23453	141	5	coefficient	coefficient	NOUN
brj-23453	141	6	,	,	PUNCT
brj-23453	141	7	which	which	PRON
brj-23453	141	8	represents	represent	VERB
brj-23453	141	9	the	the	DET
brj-23453	141	10	overall	overall	ADJ
brj-23453	141	11	inbreeding	inbreede	VERB
brj-23453	141	12	,	,	PUNCT
brj-23453	141	13	fluctuated	fluctuate	VERB
brj-23453	141	14	between	between	ADP
brj-23453	141	15	a	a	DET
brj-23453	141	16	minimum	minimum	NOUN
brj-23453	141	17	of	of	ADP
brj-23453	141	18	0.167	0.167	NUM
brj-23453	141	19	in	in	ADP
brj-23453	141	20	wga-76	wga-76	NOUN
brj-23453	141	21	and	and	CCONJ
brj-23453	141	22	a	a	DET
brj-23453	141	23	maximum	maximum	NOUN
brj-23453	141	24	of	of	ADP
brj-23453	141	25	0.756	0.756	NUM
brj-23453	141	26	in	in	ADP
brj-23453	141	27	wga-4	wga-4	NOUN
brj-23453	141	28	.	.	PUNCT
brj-23453	142	1	the	the	DET
brj-23453	142	2	gene	gene	NOUN
brj-23453	142	3	flow	flow	NOUN
brj-23453	142	4	(	(	PUNCT
brj-23453	142	5	nm	nm	NOUN
brj-23453	142	6	)	)	PUNCT
brj-23453	142	7	values	value	NOUN
brj-23453	142	8	are	be	AUX
brj-23453	142	9	displayed	display	VERB
brj-23453	142	10	in	in	ADP
brj-23453	142	11	table	table	NOUN
brj-23453	142	12	s3	s3	PROPN
brj-23453	142	13	.	.	PUNCT
brj-23453	143	1	the	the	DET
brj-23453	143	2	results	result	NOUN
brj-23453	143	3	indicate	indicate	VERB
brj-23453	143	4	that	that	SCONJ
brj-23453	143	5	wga-4	wga-4	PUNCT
brj-23453	143	6	had	have	VERB
brj-23453	143	7	the	the	DET
brj-23453	143	8	highest	high	ADJ
brj-23453	143	9	gene	gene	NOUN
brj-23453	143	10	flow	flow	NOUN
brj-23453	143	11	(	(	PUNCT
brj-23453	143	12	1.352	1.352	NUM
brj-23453	143	13	nm	nm	NOUN
brj-23453	143	14	)	)	PUNCT
brj-23453	143	15	,	,	PUNCT
brj-23453	143	16	followed	follow	VERB
brj-23453	143	17	by	by	ADP
brj-23453	143	18	wga-225	wga-225	PROPN
brj-23453	143	19	,	,	PUNCT
brj-23453	143	20	with	with	ADP
brj-23453	143	21	wga-76	wga-76	NUM
brj-23453	143	22	having	have	VERB
brj-23453	143	23	the	the	DET
brj-23453	143	24	lowest	low	ADJ
brj-23453	143	25	(	(	PUNCT
brj-23453	143	26	0.479	0.479	NUM
brj-23453	143	27	nm	nm	NOUN
brj-23453	143	28	)	)	PUNCT
brj-23453	143	29	.	.	PUNCT
brj-23453	144	1	the	the	DET
brj-23453	144	2	maximum	maximum	ADJ
brj-23453	144	3	recorded	record	VERB
brj-23453	144	4	value	value	NOUN
brj-23453	144	5	of	of	ADP
brj-23453	144	6	the	the	DET
brj-23453	144	7	marker	marker	NOUN
brj-23453	144	8	index	index	NOUN
brj-23453	144	9	was	be	AUX
brj-23453	144	10	0.38	0.38	NUM
brj-23453	144	11	,	,	PUNCT
brj-23453	144	12	while	while	SCONJ
brj-23453	144	13	the	the	DET
brj-23453	144	14	minimum	minimum	ADJ
brj-23453	144	15	value	value	NOUN
brj-23453	144	16	was	be	AUX
brj-23453	144	17	0.10	0.10	NUM
brj-23453	144	18	,	,	PUNCT
brj-23453	144	19	achieved	achieve	VERB
brj-23453	144	20	using	use	VERB
brj-23453	144	21	the	the	DET
brj-23453	144	22	primers	primer	NOUN
brj-23453	144	23	wga69	wga69	PROPN
brj-23453	144	24	and	and	CCONJ
brj-23453	144	25	wga202	wga202	PROPN
brj-23453	144	26	,	,	PUNCT
brj-23453	144	27	which	which	PRON
brj-23453	144	28	had	have	VERB
brj-23453	144	29	a	a	DET
brj-23453	144	30	mean	mean	ADJ
brj-23453	144	31	value	value	NOUN
brj-23453	144	32	of	of	ADP
brj-23453	144	33	0.199	0.199	NUM
brj-23453	144	34	,	,	PUNCT
brj-23453	144	35	respectively	respectively	ADV
brj-23453	144	36	.	.	PUNCT
brj-23453	145	1	the	the	DET
brj-23453	145	2	range	range	NOUN
brj-23453	145	3	of	of	ADP
brj-23453	145	4	resolving	resolve	VERB
brj-23453	145	5	power	power	NOUN
brj-23453	145	6	peer	peer	NOUN
brj-23453	145	7	-	-	PUNCT
brj-23453	145	8	reviewed	review	VERB
brj-23453	145	9	article	article	NOUN
brj-23453	145	10	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	145	11	wani	wani	PROPN
brj-23453	145	12	et	et	PROPN
brj-23453	145	13	al	al	PROPN
brj-23453	145	14	.	.	PROPN
brj-23453	146	1	(	(	PUNCT
brj-23453	146	2	2024	2024	NUM
brj-23453	146	3	)	)	PUNCT
brj-23453	146	4	.	.	PUNCT
brj-23453	147	1	“	"	PUNCT
brj-23453	147	2	walnut	walnut	ADJ
brj-23453	147	3	population	population	NOUN
brj-23453	147	4	&	&	CCONJ
brj-23453	147	5	diversity	diversity	NOUN
brj-23453	147	6	,	,	PUNCT
brj-23453	147	7	”	"	PUNCT
brj-23453	147	8	bioresources	bioresource	NOUN
brj-23453	147	9	19(3	19(3	NUM
brj-23453	147	10	)	)	PUNCT
brj-23453	147	11	,	,	PUNCT
brj-23453	147	12	4213	4213	NUM
brj-23453	147	13	-	-	SYM
brj-23453	147	14	4237	4237	NUM
brj-23453	147	15	.	.	PUNCT
brj-23453	148	1	4219	4219	NUM
brj-23453	148	2	(	(	PUNCT
brj-23453	148	3	rp	rp	NOUN
brj-23453	148	4	)	)	PUNCT
brj-23453	148	5	was	be	AUX
brj-23453	148	6	between	between	ADP
brj-23453	148	7	0.44	0.44	NUM
brj-23453	148	8	and	and	CCONJ
brj-23453	148	9	2.12	2.12	NUM
brj-23453	148	10	,	,	PUNCT
brj-23453	148	11	with	with	ADP
brj-23453	148	12	an	an	DET
brj-23453	148	13	average	average	ADJ
brj-23453	148	14	value	value	NOUN
brj-23453	148	15	of	of	ADP
brj-23453	148	16	1.27	1.27	NUM
brj-23453	148	17	.	.	PUNCT
brj-23453	149	1	wga-332	wga-332	NOUN
brj-23453	149	2	contained	contain	VERB
brj-23453	149	3	the	the	DET
brj-23453	149	4	highest	high	ADJ
brj-23453	149	5	concentration	concentration	NOUN
brj-23453	149	6	of	of	ADP
brj-23453	149	7	rp	rp	NOUN
brj-23453	149	8	,	,	PUNCT
brj-23453	149	9	which	which	PRON
brj-23453	149	10	was	be	AUX
brj-23453	149	11	followed	follow	VERB
brj-23453	149	12	by	by	ADP
brj-23453	149	13	wga-42	wga-42	NOUN
brj-23453	149	14	and	and	CCONJ
brj-23453	149	15	wga-118	wga-118	VERB
brj-23453	149	16	.	.	PUNCT
brj-23453	150	1	at	at	ADP
brj-23453	150	2	the	the	DET
brj-23453	150	3	lowest	low	ADJ
brj-23453	150	4	level	level	NOUN
brj-23453	150	5	(	(	PUNCT
brj-23453	150	6	rp	rp	NOUN
brj-23453	150	7	=	=	NOUN
brj-23453	150	8	0.44	0.44	NUM
brj-23453	150	9	)	)	PUNCT
brj-23453	150	10	,	,	PUNCT
brj-23453	150	11	wga-72	wga-72	NUM
brj-23453	150	12	exhibited	exhibit	VERB
brj-23453	150	13	the	the	DET
brj-23453	150	14	results	result	NOUN
brj-23453	150	15	(	(	PUNCT
brj-23453	150	16	table	table	NOUN
brj-23453	150	17	1	1	NUM
brj-23453	150	18	)	)	PUNCT
brj-23453	150	19	.	.	PUNCT
brj-23453	151	1	analysis	analysis	NOUN
brj-23453	151	2	of	of	ADP
brj-23453	151	3	clusters	cluster	NOUN
brj-23453	151	4	and	and	CCONJ
brj-23453	151	5	population	population	NOUN
brj-23453	151	6	structure	structure	NOUN
brj-23453	151	7	using	use	VERB
brj-23453	151	8	the	the	DET
brj-23453	151	9	upgma	upgma	NOUN
brj-23453	151	10	and	and	CCONJ
brj-23453	151	11	arithmetic	arithmetic	ADJ
brj-23453	151	12	average	average	NOUN
brj-23453	151	13	,	,	PUNCT
brj-23453	151	14	a	a	DET
brj-23453	151	15	dendrogram	dendrogram	NOUN
brj-23453	151	16	was	be	AUX
brj-23453	151	17	constructed	construct	VERB
brj-23453	151	18	to	to	PART
brj-23453	151	19	illustrate	illustrate	VERB
brj-23453	151	20	the	the	DET
brj-23453	151	21	genetic	genetic	ADJ
brj-23453	151	22	relationships	relationship	NOUN
brj-23453	151	23	among	among	ADP
brj-23453	151	24	21	21	NUM
brj-23453	151	25	walnut	walnut	ADJ
brj-23453	151	26	genotypes	genotype	NOUN
brj-23453	151	27	.	.	PUNCT
brj-23453	152	1	the	the	DET
brj-23453	152	2	dendrogram	dendrogram	NOUN
brj-23453	152	3	provided	provide	VERB
brj-23453	152	4	evidence	evidence	NOUN
brj-23453	152	5	that	that	SCONJ
brj-23453	152	6	there	there	PRON
brj-23453	152	7	is	be	VERB
brj-23453	152	8	substantial	substantial	ADJ
brj-23453	152	9	genetic	genetic	ADJ
brj-23453	152	10	diversity	diversity	NOUN
brj-23453	152	11	among	among	ADP
brj-23453	152	12	all	all	DET
brj-23453	152	13	walnut	walnut	NOUN
brj-23453	152	14	accessions	accession	NOUN
brj-23453	152	15	.	.	PUNCT
brj-23453	153	1	the	the	DET
brj-23453	153	2	genetic	genetic	ADJ
brj-23453	153	3	connection	connection	NOUN
brj-23453	153	4	among	among	ADP
brj-23453	153	5	the	the	DET
brj-23453	153	6	genotypes	genotype	NOUN
brj-23453	153	7	was	be	AUX
brj-23453	153	8	illustrated	illustrate	VERB
brj-23453	153	9	by	by	ADP
brj-23453	153	10	the	the	DET
brj-23453	153	11	dendrogram	dendrogram	NOUN
brj-23453	153	12	derived	derive	VERB
brj-23453	153	13	from	from	ADP
brj-23453	153	14	the	the	DET
brj-23453	153	15	dna	dna	PROPN
brj-23453	153	16	profile	profile	NOUN
brj-23453	153	17	.	.	PUNCT
brj-23453	154	1	using	use	VERB
brj-23453	154	2	the	the	DET
brj-23453	154	3	empirical	empirical	ADJ
brj-23453	154	4	data	datum	NOUN
brj-23453	154	5	,	,	PUNCT
brj-23453	154	6	a	a	DET
brj-23453	154	7	dendrogram	dendrogram	NOUN
brj-23453	154	8	was	be	AUX
brj-23453	154	9	constructed	construct	VERB
brj-23453	154	10	.	.	PUNCT
brj-23453	155	1	fig	fig	NOUN
brj-23453	155	2	.	.	PUNCT
brj-23453	156	1	1	1	X
brj-23453	156	2	.	.	X
brj-23453	156	3	dendrogram	dendrogram	NOUN
brj-23453	156	4	depicting	depict	VERB
brj-23453	156	5	the	the	DET
brj-23453	156	6	genetic	genetic	ADJ
brj-23453	156	7	relationships	relationship	NOUN
brj-23453	156	8	among	among	ADP
brj-23453	156	9	21	21	NUM
brj-23453	156	10	juglans	juglan	NOUN
brj-23453	156	11	regia	regia	NOUN
brj-23453	156	12	l.	l.	NOUN
brj-23453	156	13	genotypes	genotype	NOUN
brj-23453	156	14	based	base	VERB
brj-23453	156	15	on	on	ADP
brj-23453	156	16	microsatellite	microsatellite	ADJ
brj-23453	156	17	data	datum	NOUN
brj-23453	156	18	analysis	analysis	NOUN
brj-23453	156	19	.	.	PUNCT
brj-23453	157	1	branch	branch	NOUN
brj-23453	157	2	lengths	length	NOUN
brj-23453	157	3	reflect	reflect	VERB
brj-23453	157	4	the	the	DET
brj-23453	157	5	degree	degree	NOUN
brj-23453	157	6	of	of	ADP
brj-23453	157	7	genetic	genetic	ADJ
brj-23453	157	8	similarity	similarity	NOUN
brj-23453	157	9	between	between	ADP
brj-23453	157	10	genotypes	genotype	NOUN
brj-23453	157	11	,	,	PUNCT
brj-23453	157	12	with	with	ADP
brj-23453	157	13	shorter	short	ADJ
brj-23453	157	14	branches	branch	NOUN
brj-23453	157	15	indicating	indicate	VERB
brj-23453	157	16	closer	close	ADJ
brj-23453	157	17	genetic	genetic	ADJ
brj-23453	157	18	relationships	relationship	NOUN
brj-23453	157	19	.	.	PUNCT
brj-23453	158	1	genotypes	genotype	NOUN
brj-23453	158	2	sharing	share	VERB
brj-23453	158	3	the	the	DET
brj-23453	158	4	same	same	ADJ
brj-23453	158	5	color	color	NOUN
brj-23453	158	6	and	and	CCONJ
brj-23453	158	7	symbol	symbol	NOUN
brj-23453	158	8	are	be	AUX
brj-23453	158	9	considered	consider	VERB
brj-23453	158	10	similar	similar	ADJ
brj-23453	158	11	in	in	ADP
brj-23453	158	12	terms	term	NOUN
brj-23453	158	13	of	of	ADP
brj-23453	158	14	their	their	PRON
brj-23453	158	15	genetic	genetic	ADJ
brj-23453	158	16	makeup	makeup	NOUN
brj-23453	158	17	.	.	PUNCT
brj-23453	159	1	the	the	DET
brj-23453	159	2	genotypes	genotype	NOUN
brj-23453	159	3	being	be	AUX
brj-23453	159	4	studied	study	VERB
brj-23453	159	5	exhibited	exhibit	VERB
brj-23453	159	6	a	a	DET
brj-23453	159	7	broad	broad	ADJ
brj-23453	159	8	dispersion	dispersion	NOUN
brj-23453	159	9	into	into	ADP
brj-23453	159	10	two	two	NUM
brj-23453	159	11	significant	significant	ADJ
brj-23453	159	12	clusters	cluster	NOUN
brj-23453	159	13	,	,	PUNCT
brj-23453	159	14	which	which	PRON
brj-23453	159	15	,	,	PUNCT
brj-23453	159	16	as	as	SCONJ
brj-23453	159	17	indicated	indicate	VERB
brj-23453	159	18	by	by	ADP
brj-23453	159	19	the	the	DET
brj-23453	159	20	dendrogram	dendrogram	NOUN
brj-23453	159	21	,	,	PUNCT
brj-23453	159	22	demonstrates	demonstrate	VERB
brj-23453	159	23	the	the	DET
brj-23453	159	24	considerable	considerable	ADJ
brj-23453	159	25	genetic	genetic	ADJ
brj-23453	159	26	diversity	diversity	NOUN
brj-23453	159	27	and	and	CCONJ
brj-23453	159	28	heterogeneity	heterogeneity	NOUN
brj-23453	159	29	of	of	ADP
brj-23453	159	30	the	the	DET
brj-23453	159	31	open	open	ADJ
brj-23453	159	32	-	-	PUNCT
brj-23453	159	33	populated	populate	VERB
brj-23453	159	34	walnut	walnut	NOUN
brj-23453	159	35	genotypes	genotype	NOUN
brj-23453	159	36	in	in	ADP
brj-23453	159	37	the	the	DET
brj-23453	159	38	districts	district	NOUN
brj-23453	159	39	of	of	ADP
brj-23453	159	40	budgam	budgam	NOUN
brj-23453	159	41	and	and	CCONJ
brj-23453	159	42	ganderbal	ganderbal	VERB
brj-23453	159	43	in	in	ADP
brj-23453	159	44	the	the	DET
brj-23453	159	45	kashmir	kashmir	PROPN
brj-23453	159	46	valley	valley	PROPN
brj-23453	159	47	.	.	PUNCT
brj-23453	160	1	the	the	DET
brj-23453	160	2	highest	high	ADJ
brj-23453	160	3	bootstrap	bootstrap	NOUN
brj-23453	160	4	value	value	NOUN
brj-23453	160	5	was	be	AUX
brj-23453	160	6	found	find	VERB
brj-23453	160	7	in	in	ADP
brj-23453	160	8	the	the	DET
brj-23453	160	9	node	node	NOUN
brj-23453	160	10	that	that	PRON
brj-23453	160	11	partitioned	partition	VERB
brj-23453	160	12	clusters	cluster	NOUN
brj-23453	160	13	i	i	PRON
brj-23453	160	14	and	and	CCONJ
brj-23453	160	15	ii	ii	PROPN
brj-23453	160	16	,	,	PUNCT
brj-23453	160	17	suggesting	suggest	VERB
brj-23453	160	18	that	that	SCONJ
brj-23453	160	19	the	the	DET
brj-23453	160	20	genotypes	genotype	NOUN
brj-23453	160	21	in	in	ADP
brj-23453	160	22	clusters	cluster	NOUN
brj-23453	160	23	i	i	PRON
brj-23453	160	24	and	and	CCONJ
brj-23453	160	25	ii	ii	PROPN
brj-23453	160	26	exhibited	exhibit	VERB
brj-23453	160	27	considerable	considerable	ADJ
brj-23453	160	28	diversity	diversity	NOUN
brj-23453	160	29	.	.	PUNCT
brj-23453	161	1	cluster	cluster	NOUN
brj-23453	161	2	ii	ii	PROPN
brj-23453	161	3	comprised	comprise	VERB
brj-23453	161	4	14	14	NUM
brj-23453	161	5	of	of	ADP
brj-23453	161	6	the	the	DET
brj-23453	161	7	genotypes	genotype	NOUN
brj-23453	161	8	,	,	PUNCT
brj-23453	161	9	the	the	DET
brj-23453	161	10	plurality	plurality	NOUN
brj-23453	161	11	.	.	PUNCT
brj-23453	162	1	the	the	DET
brj-23453	162	2	second	second	ADJ
brj-23453	162	3	cluster	cluster	NOUN
brj-23453	162	4	was	be	AUX
brj-23453	162	5	divided	divide	VERB
brj-23453	162	6	into	into	ADP
brj-23453	162	7	three	three	NUM
brj-23453	162	8	subgroups	subgroup	NOUN
brj-23453	162	9	,	,	PUNCT
brj-23453	162	10	with	with	ADP
brj-23453	162	11	each	each	DET
brj-23453	162	12	subgroup	subgroup	NOUN
brj-23453	162	13	consisting	consist	VERB
brj-23453	162	14	of	of	ADP
brj-23453	162	15	3	3	NUM
brj-23453	162	16	peer	peer	NOUN
brj-23453	162	17	-	-	PUNCT
brj-23453	162	18	reviewed	review	VERB
brj-23453	162	19	article	article	NOUN
brj-23453	162	20	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	163	1	wani	wani	PROPN
brj-23453	163	2	et	et	PROPN
brj-23453	163	3	al	al	PROPN
brj-23453	163	4	.	.	PROPN
brj-23453	163	5	(	(	PUNCT
brj-23453	163	6	2024	2024	NUM
brj-23453	163	7	)	)	PUNCT
brj-23453	163	8	.	.	PUNCT
brj-23453	164	1	“	"	PUNCT
brj-23453	164	2	walnut	walnut	ADJ
brj-23453	164	3	population	population	NOUN
brj-23453	164	4	&	&	CCONJ
brj-23453	164	5	diversity	diversity	NOUN
brj-23453	164	6	,	,	PUNCT
brj-23453	164	7	”	"	PUNCT
brj-23453	164	8	bioresources	bioresource	NOUN
brj-23453	164	9	19(3	19(3	NUM
brj-23453	164	10	)	)	PUNCT
brj-23453	164	11	,	,	PUNCT
brj-23453	164	12	4213	4213	NUM
brj-23453	164	13	-	-	SYM
brj-23453	164	14	4237	4237	NUM
brj-23453	164	15	.	.	PUNCT
brj-23453	164	16	4220	4220	NUM
brj-23453	164	17	genotypes	genotype	NOUN
brj-23453	164	18	and	and	CCONJ
brj-23453	164	19	12	12	NUM
brj-23453	164	20	in	in	ADP
brj-23453	164	21	number	number	NOUN
brj-23453	164	22	.	.	PUNCT
brj-23453	165	1	as	as	SCONJ
brj-23453	165	2	illustrated	illustrate	VERB
brj-23453	165	3	in	in	ADP
brj-23453	165	4	fig	fig	NOUN
brj-23453	165	5	.	.	PUNCT
brj-23453	166	1	1	1	NUM
brj-23453	166	2	,	,	PUNCT
brj-23453	166	3	the	the	DET
brj-23453	166	4	initial	initial	ADJ
brj-23453	166	5	cluster	cluster	NOUN
brj-23453	166	6	was	be	AUX
brj-23453	166	7	composed	compose	VERB
brj-23453	166	8	of	of	ADP
brj-23453	166	9	two	two	NUM
brj-23453	166	10	subgroups	subgroup	NOUN
brj-23453	166	11	of	of	ADP
brj-23453	166	12	seven	seven	NUM
brj-23453	166	13	genotypes	genotype	NOUN
brj-23453	166	14	.	.	PUNCT
brj-23453	167	1	with	with	ADP
brj-23453	167	2	respective	respective	ADJ
brj-23453	167	3	contributions	contribution	NOUN
brj-23453	167	4	of	of	ADP
brj-23453	167	5	16.30	16.30	NUM
brj-23453	167	6	%	%	NOUN
brj-23453	167	7	,	,	PUNCT
brj-23453	167	8	22.43	22.43	NUM
brj-23453	167	9	%	%	NOUN
brj-23453	167	10	,	,	PUNCT
brj-23453	167	11	and	and	CCONJ
brj-23453	167	12	9.8	9.8	NUM
brj-23453	167	13	%	%	NOUN
brj-23453	167	14	,	,	PUNCT
brj-23453	167	15	the	the	DET
brj-23453	167	16	first	first	ADJ
brj-23453	167	17	three	three	NUM
brj-23453	167	18	axes	axis	NOUN
brj-23453	167	19	accounted	account	VERB
brj-23453	167	20	for	for	ADP
brj-23453	167	21	48.58	48.58	NUM
brj-23453	167	22	%	%	NOUN
brj-23453	167	23	of	of	ADP
brj-23453	167	24	the	the	DET
brj-23453	167	25	genetic	genetic	ADJ
brj-23453	167	26	similarity	similarity	NOUN
brj-23453	167	27	variance	variance	NOUN
brj-23453	167	28	(	(	PUNCT
brj-23453	167	29	table	table	NOUN
brj-23453	167	30	2	2	NUM
brj-23453	167	31	;	;	PUNCT
brj-23453	167	32	fig	fig	NOUN
brj-23453	167	33	.	.	PUNCT
brj-23453	168	1	2	2	NUM
brj-23453	168	2	)	)	PUNCT
brj-23453	168	3	.	.	PUNCT
brj-23453	169	1	table	table	NOUN
brj-23453	169	2	2	2	NUM
brj-23453	169	3	.	.	PUNCT
brj-23453	169	4	principal	principal	ADJ
brj-23453	169	5	coordinate	coordinate	NOUN
brj-23453	169	6	analysis	analysis	NOUN
brj-23453	169	7	of	of	ADP
brj-23453	169	8	different	different	ADJ
brj-23453	169	9	walnut	walnut	NOUN
brj-23453	169	10	genotypes	genotype	NOUN
brj-23453	169	11	from	from	ADP
brj-23453	169	12	districts	district	NOUN
brj-23453	169	13	budgam	budgam	NOUN
brj-23453	169	14	and	and	CCONJ
brj-23453	169	15	ganderbal	ganderbal	ADJ
brj-23453	169	16	fig	fig	NOUN
brj-23453	169	17	.	.	PUNCT
brj-23453	170	1	2	2	X
brj-23453	170	2	.	.	X
brj-23453	170	3	principal	principal	ADJ
brj-23453	170	4	coordinate	coordinate	NOUN
brj-23453	170	5	analysis	analysis	NOUN
brj-23453	170	6	(	(	PUNCT
brj-23453	170	7	pcoa	pcoa	NOUN
brj-23453	170	8	)	)	PUNCT
brj-23453	170	9	plot	plot	NOUN
brj-23453	170	10	illustrating	illustrate	VERB
brj-23453	170	11	the	the	DET
brj-23453	170	12	genetic	genetic	ADJ
brj-23453	170	13	relationships	relationship	NOUN
brj-23453	170	14	among	among	ADP
brj-23453	170	15	21	21	NUM
brj-23453	170	16	juglans	juglan	NOUN
brj-23453	170	17	regia	regia	NOUN
brj-23453	170	18	l.	l.	NOUN
brj-23453	170	19	genotypes	genotype	NOUN
brj-23453	170	20	sourced	source	VERB
brj-23453	170	21	from	from	ADP
brj-23453	170	22	budgam	budgam	NOUN
brj-23453	170	23	and	and	CCONJ
brj-23453	170	24	ganderbal	ganderbal	ADJ
brj-23453	170	25	districts	district	NOUN
brj-23453	170	26	.	.	PUNCT
brj-23453	171	1	the	the	DET
brj-23453	171	2	plot	plot	NOUN
brj-23453	171	3	is	be	AUX
brj-23453	171	4	based	base	VERB
brj-23453	171	5	on	on	ADP
brj-23453	171	6	a	a	DET
brj-23453	171	7	matrix	matrix	NOUN
brj-23453	171	8	of	of	ADP
brj-23453	171	9	chord	chord	NOUN
brj-23453	171	10	distances	distance	NOUN
brj-23453	171	11	,	,	PUNCT
brj-23453	171	12	with	with	ADP
brj-23453	171	13	each	each	DET
brj-23453	171	14	point	point	NOUN
brj-23453	171	15	representing	represent	VERB
brj-23453	171	16	a	a	DET
brj-23453	171	17	genotype	genotype	NOUN
brj-23453	171	18	.	.	PUNCT
brj-23453	172	1	the	the	DET
brj-23453	172	2	proximity	proximity	NOUN
brj-23453	172	3	of	of	ADP
brj-23453	172	4	points	point	NOUN
brj-23453	172	5	on	on	ADP
brj-23453	172	6	the	the	DET
brj-23453	172	7	plot	plot	NOUN
brj-23453	172	8	reflects	reflect	VERB
brj-23453	172	9	the	the	DET
brj-23453	172	10	degree	degree	NOUN
brj-23453	172	11	of	of	ADP
brj-23453	172	12	genetic	genetic	ADJ
brj-23453	172	13	similarity	similarity	NOUN
brj-23453	172	14	between	between	ADP
brj-23453	172	15	genotypes	genotype	NOUN
brj-23453	172	16	,	,	PUNCT
brj-23453	172	17	with	with	ADP
brj-23453	172	18	closer	close	ADJ
brj-23453	172	19	points	point	NOUN
brj-23453	172	20	indicating	indicate	VERB
brj-23453	172	21	greater	great	ADJ
brj-23453	172	22	genetic	genetic	ADJ
brj-23453	172	23	resemblance	resemblance	NOUN
brj-23453	172	24	.	.	PUNCT
brj-23453	173	1	population	population	NOUN
brj-23453	173	2	structure	structure	NOUN
brj-23453	173	3	using	use	VERB
brj-23453	173	4	ssr	ssr	ADJ
brj-23453	173	5	markers	marker	NOUN
brj-23453	173	6	,	,	PUNCT
brj-23453	173	7	the	the	DET
brj-23453	173	8	population	population	NOUN
brj-23453	173	9	structure	structure	NOUN
brj-23453	173	10	of	of	ADP
brj-23453	173	11	21	21	NUM
brj-23453	173	12	walnut	walnut	NOUN
brj-23453	173	13	genotypes	genotype	NOUN
brj-23453	173	14	was	be	AUX
brj-23453	173	15	estimated	estimate	VERB
brj-23453	173	16	(	(	PUNCT
brj-23453	173	17	fig	fig	NOUN
brj-23453	173	18	.	.	PUNCT
brj-23453	174	1	3	3	NUM
brj-23453	174	2	)	)	PUNCT
brj-23453	174	3	;	;	PUNCT
brj-23453	174	4	the	the	DET
brj-23453	174	5	assignment	assignment	NOUN
brj-23453	174	6	procedure	procedure	NOUN
brj-23453	174	7	in	in	ADP
brj-23453	174	8	structure	structure	NOUN
brj-23453	174	9	determined	determine	VERB
brj-23453	174	10	that	that	SCONJ
brj-23453	174	11	the	the	DET
brj-23453	174	12	genotypes	genotype	NOUN
brj-23453	174	13	were	be	AUX
brj-23453	174	14	categorized	categorize	VERB
brj-23453	174	15	into	into	ADP
brj-23453	174	16	six	six	NUM
brj-23453	174	17	groups	group	NOUN
brj-23453	174	18	(	(	PUNCT
brj-23453	174	19	table	table	NOUN
brj-23453	174	20	3	3	NUM
brj-23453	174	21	)	)	PUNCT
brj-23453	174	22	.	.	PUNCT
brj-23453	175	1	as	as	SCONJ
brj-23453	175	2	demonstrated	demonstrate	VERB
brj-23453	175	3	in	in	ADP
brj-23453	175	4	fig	fig	NOUN
brj-23453	175	5	.	.	PUNCT
brj-23453	176	1	4	4	NUM
brj-23453	176	2	,	,	PUNCT
brj-23453	176	3	the	the	DET
brj-23453	176	4	clustering	clustering	ADJ
brj-23453	176	5	method	method	NOUN
brj-23453	176	6	indicated	indicate	VERB
brj-23453	176	7	that	that	SCONJ
brj-23453	176	8	the	the	DET
brj-23453	176	9	ln	ln	ADJ
brj-23453	176	10	probability	probability	NOUN
brj-23453	176	11	of	of	ADP
brj-23453	176	12	the	the	DET
brj-23453	176	13	data	datum	NOUN
brj-23453	176	14	provided	provide	VERB
brj-23453	176	15	the	the	DET
brj-23453	176	16	most	most	ADV
brj-23453	176	17	accurate	accurate	ADJ
brj-23453	176	18	prediction	prediction	NOUN
brj-23453	176	19	of	of	ADP
brj-23453	176	20	delta	delta	NOUN
brj-23453	176	21	k	k	PROPN
brj-23453	176	22	at	at	ADP
brj-23453	176	23	k	k	PROPN
brj-23453	176	24	=	=	SYM
brj-23453	176	25	5	5	X
brj-23453	176	26	.	.	PUNCT
brj-23453	177	1	this	this	PRON
brj-23453	177	2	substantiates	substantiate	VERB
brj-23453	177	3	the	the	DET
brj-23453	177	4	classification	classification	NOUN
brj-23453	177	5	of	of	ADP
brj-23453	177	6	21	21	NUM
brj-23453	177	7	walnut	walnut	ADJ
brj-23453	177	8	genotypes	genotype	NOUN
brj-23453	177	9	into	into	ADP
brj-23453	177	10	six	six	NUM
brj-23453	177	11	distinct	distinct	ADJ
brj-23453	177	12	populations	population	NOUN
brj-23453	177	13	through	through	ADP
brj-23453	177	14	substantial	substantial	ADJ
brj-23453	177	15	mixing	mixing	NOUN
brj-23453	177	16	,	,	PUNCT
brj-23453	177	17	thereby	thereby	ADV
brj-23453	177	18	illustrating	illustrate	VERB
brj-23453	177	19	the	the	DET
brj-23453	177	20	exceptionally	exceptionally	ADV
brj-23453	177	21	diverse	diverse	ADJ
brj-23453	177	22	character	character	NOUN
brj-23453	177	23	of	of	ADP
brj-23453	177	24	walnuts	walnut	NOUN
brj-23453	177	25	as	as	ADP
brj-23453	177	26	a	a	DET
brj-23453	177	27	species	specie	NOUN
brj-23453	177	28	.	.	PUNCT
brj-23453	178	1	the	the	DET
brj-23453	178	2	expected	expect	VERB
brj-23453	178	3	heterozygosity	heterozygosity	NOUN
brj-23453	178	4	,	,	PUNCT
brj-23453	178	5	which	which	PRON
brj-23453	178	6	quantifies	quantify	VERB
brj-23453	178	7	the	the	DET
brj-23453	178	8	likelihood	likelihood	NOUN
brj-23453	178	9	that	that	SCONJ
brj-23453	178	10	two	two	NUM
brj-23453	178	11	arbitrarily	arbitrarily	ADV
brj-23453	178	12	chosen	choose	VERB
brj-23453	178	13	individuals	individual	NOUN
brj-23453	178	14	will	will	AUX
brj-23453	178	15	be	be	AUX
brj-23453	178	16	heterozygous	heterozygous	ADJ
brj-23453	178	17	at	at	ADP
brj-23453	178	18	a	a	DET
brj-23453	178	19	specific	specific	ADJ
brj-23453	178	20	locus	locus	NOUN
brj-23453	178	21	,	,	PUNCT
brj-23453	178	22	ranged	range	VERB
brj-23453	178	23	between	between	ADP
brj-23453	178	24	0.563	0.563	NUM
brj-23453	178	25	and	and	CCONJ
brj-23453	178	26	0.741	0.741	NUM
brj-23453	178	27	in	in	ADP
brj-23453	178	28	the	the	DET
brj-23453	178	29	third	third	ADJ
brj-23453	178	30	subpopulation	subpopulation	NOUN
brj-23453	178	31	,	,	PUNCT
brj-23453	178	32	with	with	ADP
brj-23453	178	33	an	an	DET
brj-23453	178	34	average	average	NOUN
brj-23453	178	35	of	of	ADP
brj-23453	178	36	0.672	0.672	NUM
brj-23453	178	37	.	.	PUNCT
brj-23453	179	1	the	the	DET
brj-23453	179	2	fst	fst	NOUN
brj-23453	179	3	exhibited	exhibit	VERB
brj-23453	179	4	variability	variability	NOUN
brj-23453	179	5	,	,	PUNCT
brj-23453	179	6	ranging	range	VERB
brj-23453	179	7	from	from	ADP
brj-23453	179	8	0.176	0.176	NUM
brj-23453	179	9	in	in	ADP
brj-23453	179	10	the	the	DET
brj-23453	179	11	fourth	fourth	ADJ
brj-23453	179	12	subpopulation	subpopulation	NOUN
brj-23453	179	13	to	to	ADP
brj-23453	179	14	0.176	0.176	NUM
brj-23453	179	15	in	in	ADP
brj-23453	179	16	the	the	DET
brj-23453	179	17	third	third	ADJ
brj-23453	179	18	subpopulation	subpopulation	NOUN
brj-23453	179	19	.	.	PUNCT
brj-23453	180	1	nws005	nws005	PROPN
brj-23453	180	2	mws025	mws025	PROPN
brj-23453	180	3	cws023	cws023	PROPN
brj-23453	180	4	mws035	mws035	PROPN
brj-23453	180	5	nws012	nws012	PROPN
brj-23453	180	6	rws003	rws003	PROPN
brj-23453	180	7	rws018	rws018	NOUN
brj-23453	180	8	rws004	rws004	PROPN
brj-23453	180	9	aws011	aws011	PROPN
brj-23453	180	10	bws024	bws024	PROPN
brj-23453	180	11	kws025	kws025	PROPN
brj-23453	180	12	kws002	kws002	PROPN
brj-23453	180	13	pws016	pws016	PROPN
brj-23453	180	14	sws033	sws033	VERB
brj-23453	180	15	bws025	bws025	PROPN
brj-23453	180	16	sws007	sws007	PROPN
brj-23453	180	17	bws027	bws027	PROPN
brj-23453	180	18	gws030	gws030	PROPN
brj-23453	180	19	aws037	aws037	PROPN
brj-23453	180	20	sws005	sws005	PROPN
brj-23453	180	21	tws039	tws039	PROPN
brj-23453	181	1	c	c	NOUN
brj-23453	181	2	o	o	NOUN
brj-23453	181	3	o	o	X
brj-23453	181	4	rd	rd	NOUN
brj-23453	181	5	.	.	PUNCT
brj-23453	182	1	2	2	NUM
brj-23453	182	2	coord	coord	NOUN
brj-23453	182	3	.	.	PUNCT
brj-23453	183	1	1	1	NUM
brj-23453	183	2	principal	principal	ADJ
brj-23453	183	3	coordinates	coordinate	NOUN
brj-23453	183	4	(	(	PUNCT
brj-23453	183	5	pcoa	pcoa	NOUN
brj-23453	183	6	)	)	PUNCT
brj-23453	183	7	meerbud	meerbud	ADJ
brj-23453	183	8	rutsunbud	rutsunbud	ADJ
brj-23453	183	9	budranbud	budranbud	ADJ
brj-23453	183	10	chadbud	chadbud	ADJ
brj-23453	183	11	largdbl	largdbl	NOUN
brj-23453	183	12	kangangdbl	kangangdbl	NOUN
brj-23453	183	13	1	1	NUM
brj-23453	183	14	2	2	NUM
brj-23453	183	15	3	3	NUM
brj-23453	183	16	axis	axis	NOUN
brj-23453	183	17	%	%	NOUN
brj-23453	183	18	9.85	9.85	NUM
brj-23453	183	19	16.30	16.30	NUM
brj-23453	183	20	22.43	22.43	NUM
brj-23453	183	21	cum	cum	NOUN
brj-23453	183	22	%	%	NOUN
brj-23453	183	23	9.85	9.85	NUM
brj-23453	183	24	26.15	26.15	NUM
brj-23453	183	25	48.58	48.58	NUM
brj-23453	183	26	peer	peer	NOUN
brj-23453	183	27	-	-	PUNCT
brj-23453	183	28	reviewed	review	VERB
brj-23453	183	29	article	article	NOUN
brj-23453	183	30	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	183	31	wani	wani	PROPN
brj-23453	183	32	et	et	PROPN
brj-23453	183	33	al	al	PROPN
brj-23453	183	34	.	.	PROPN
brj-23453	184	1	(	(	PUNCT
brj-23453	184	2	2024	2024	NUM
brj-23453	184	3	)	)	PUNCT
brj-23453	184	4	.	.	PUNCT
brj-23453	185	1	“	"	PUNCT
brj-23453	185	2	walnut	walnut	ADJ
brj-23453	185	3	population	population	NOUN
brj-23453	185	4	&	&	CCONJ
brj-23453	185	5	diversity	diversity	NOUN
brj-23453	185	6	,	,	PUNCT
brj-23453	185	7	”	"	PUNCT
brj-23453	185	8	bioresources	bioresource	NOUN
brj-23453	185	9	19(3	19(3	NUM
brj-23453	185	10	)	)	PUNCT
brj-23453	185	11	,	,	PUNCT
brj-23453	185	12	4213	4213	NUM
brj-23453	185	13	-	-	SYM
brj-23453	185	14	4237	4237	NUM
brj-23453	185	15	.	.	PUNCT
brj-23453	186	1	4221	4221	NUM
brj-23453	186	2	table	table	NOUN
brj-23453	186	3	3	3	NUM
brj-23453	186	4	.	.	NOUN
brj-23453	186	5	heterozygosity	heterozygosity	NOUN
brj-23453	186	6	and	and	CCONJ
brj-23453	186	7	fst	fst	NOUN
brj-23453	186	8	value	value	NOUN
brj-23453	186	9	calculated	calculate	VERB
brj-23453	186	10	for	for	ADP
brj-23453	186	11	nine	nine	NUM
brj-23453	186	12	subpopulations	subpopulation	NOUN
brj-23453	186	13	of	of	ADP
brj-23453	186	14	walnut	walnut	NOUN
brj-23453	186	15	s.no	s.no	PROPN
brj-23453	186	16	sub	sub	NOUN
brj-23453	186	17	-	-	NOUN
brj-23453	186	18	population	population	ADJ
brj-23453	186	19	(	(	PUNCT
brj-23453	186	20	k	k	NOUN
brj-23453	186	21	)	)	PUNCT
brj-23453	186	22	expected	expect	VERB
brj-23453	186	23	heterozygosity	heterozygosity	NOUN
brj-23453	186	24	fst	fst	NOUN
brj-23453	186	25	value	value	NOUN
brj-23453	186	26	01	01	NUM
brj-23453	186	27	1	1	NUM
brj-23453	186	28	0.617	0.617	NUM
brj-23453	186	29	0.261	0.261	NUM
brj-23453	186	30	02	02	NUM
brj-23453	186	31	2	2	NUM
brj-23453	186	32	0.563	0.563	NUM
brj-23453	186	33	0.221	0.221	NUM
brj-23453	186	34	03	03	NUM
brj-23453	186	35	3	3	NUM
brj-23453	186	36	0.741	0.741	NUM
brj-23453	186	37	0.176	0.176	NUM
brj-23453	186	38	04	04	NUM
brj-23453	186	39	4	4	NUM
brj-23453	186	40	0.709	0.709	NUM
brj-23453	186	41	0.242	0.242	NUM
brj-23453	186	42	05	05	NUM
brj-23453	186	43	5	5	NUM
brj-23453	186	44	0.731	0.731	NUM
brj-23453	186	45	0.178	0.178	NUM
brj-23453	186	46	06	06	NUM
brj-23453	186	47	6	6	NUM
brj-23453	186	48	0.621	0.621	NUM
brj-23453	186	49	0.234	0.234	NUM
brj-23453	186	50	average	average	ADJ
brj-23453	186	51	0.672	0.672	NUM
brj-23453	186	52	0.215	0.215	NUM
brj-23453	186	53	fig	fig	NOUN
brj-23453	186	54	.	.	PUNCT
brj-23453	187	1	3	3	X
brj-23453	187	2	.	.	X
brj-23453	188	1	this	this	DET
brj-23453	188	2	graphical	graphical	ADJ
brj-23453	188	3	representation	representation	NOUN
brj-23453	188	4	visually	visually	ADV
brj-23453	188	5	depicts	depict	VERB
brj-23453	188	6	the	the	DET
brj-23453	188	7	population	population	NOUN
brj-23453	188	8	structure	structure	NOUN
brj-23453	188	9	in	in	ADP
brj-23453	188	10	walnut	walnut	NOUN
brj-23453	188	11	genotypes	genotype	NOUN
brj-23453	188	12	.	.	PUNCT
brj-23453	189	1	each	each	DET
brj-23453	189	2	vertical	vertical	ADJ
brj-23453	189	3	line	line	NOUN
brj-23453	189	4	represents	represent	VERB
brj-23453	189	5	an	an	DET
brj-23453	189	6	individual	individual	ADJ
brj-23453	189	7	genotype	genotype	NOUN
brj-23453	189	8	,	,	PUNCT
brj-23453	189	9	and	and	CCONJ
brj-23453	189	10	the	the	DET
brj-23453	189	11	colors	color	NOUN
brj-23453	189	12	within	within	ADP
brj-23453	189	13	each	each	DET
brj-23453	189	14	line	line	NOUN
brj-23453	189	15	indicate	indicate	VERB
brj-23453	189	16	the	the	DET
brj-23453	189	17	estimated	estimate	VERB
brj-23453	189	18	membership	membership	NOUN
brj-23453	189	19	percentage	percentage	NOUN
brj-23453	189	20	of	of	ADP
brj-23453	189	21	that	that	DET
brj-23453	189	22	genotype	genotype	NOUN
brj-23453	189	23	in	in	ADP
brj-23453	189	24	different	different	ADJ
brj-23453	189	25	clusters	cluster	NOUN
brj-23453	189	26	(	(	PUNCT
brj-23453	189	27	k	k	PROPN
brj-23453	189	28	clusters	cluster	NOUN
brj-23453	189	29	)	)	PUNCT
brj-23453	189	30	.	.	PUNCT
brj-23453	190	1	essentially	essentially	ADV
brj-23453	190	2	,	,	PUNCT
brj-23453	190	3	it	it	PRON
brj-23453	190	4	illustrates	illustrate	VERB
brj-23453	190	5	the	the	DET
brj-23453	190	6	degree	degree	NOUN
brj-23453	190	7	of	of	ADP
brj-23453	190	8	admixture	admixture	NOUN
brj-23453	190	9	or	or	CCONJ
brj-23453	190	10	genetic	genetic	ADJ
brj-23453	190	11	contribution	contribution	NOUN
brj-23453	190	12	from	from	ADP
brj-23453	190	13	different	different	ADJ
brj-23453	190	14	clusters	cluster	NOUN
brj-23453	190	15	within	within	ADP
brj-23453	190	16	each	each	DET
brj-23453	190	17	genotype	genotype	NOUN
brj-23453	190	18	.	.	PUNCT
brj-23453	191	1	by	by	ADP
brj-23453	191	2	examining	examine	VERB
brj-23453	191	3	the	the	DET
brj-23453	191	4	distribution	distribution	NOUN
brj-23453	191	5	of	of	ADP
brj-23453	191	6	colors	color	NOUN
brj-23453	191	7	across	across	ADP
brj-23453	191	8	the	the	DET
brj-23453	191	9	lines	line	NOUN
brj-23453	191	10	,	,	PUNCT
brj-23453	191	11	one	one	PRON
brj-23453	191	12	can	can	AUX
brj-23453	191	13	gain	gain	VERB
brj-23453	191	14	insights	insight	NOUN
brj-23453	191	15	into	into	ADP
brj-23453	191	16	the	the	DET
brj-23453	191	17	genetic	genetic	ADJ
brj-23453	191	18	composition	composition	NOUN
brj-23453	191	19	and	and	CCONJ
brj-23453	191	20	admixture	admixture	NOUN
brj-23453	191	21	patterns	pattern	NOUN
brj-23453	191	22	present	present	ADJ
brj-23453	191	23	within	within	ADP
brj-23453	191	24	the	the	DET
brj-23453	191	25	walnut	walnut	ADJ
brj-23453	191	26	population	population	NOUN
brj-23453	191	27	under	under	ADP
brj-23453	191	28	study	study	NOUN
brj-23453	191	29	.	.	PUNCT
brj-23453	192	1	analysis	analysis	NOUN
brj-23453	192	2	of	of	ADP
brj-23453	192	3	molecular	molecular	ADJ
brj-23453	192	4	variance	variance	NOUN
brj-23453	192	5	(	(	PUNCT
brj-23453	192	6	amova	amova	PROPN
brj-23453	192	7	)	)	PUNCT
brj-23453	192	8	the	the	DET
brj-23453	192	9	amount	amount	NOUN
brj-23453	192	10	of	of	ADP
brj-23453	192	11	percent	percent	NOUN
brj-23453	192	12	variation	variation	NOUN
brj-23453	192	13	that	that	PRON
brj-23453	192	14	exists	exist	VERB
brj-23453	192	15	between	between	ADP
brj-23453	192	16	distinct	distinct	ADJ
brj-23453	192	17	populations	population	NOUN
brj-23453	192	18	of	of	ADP
brj-23453	192	19	walnut	walnut	ADJ
brj-23453	192	20	genotypes	genotype	NOUN
brj-23453	192	21	was	be	AUX
brj-23453	192	22	determined	determine	VERB
brj-23453	192	23	using	use	VERB
brj-23453	192	24	an	an	DET
brj-23453	192	25	amova	amova	NOUN
brj-23453	192	26	.	.	PUNCT
brj-23453	193	1	the	the	DET
brj-23453	193	2	research	research	NOUN
brj-23453	193	3	outcomes	outcome	NOUN
brj-23453	193	4	revealed	reveal	VERB
brj-23453	193	5	a	a	DET
brj-23453	193	6	higher	high	ADJ
brj-23453	193	7	degree	degree	NOUN
brj-23453	193	8	of	of	ADP
brj-23453	193	9	variability	variability	NOUN
brj-23453	193	10	(	(	PUNCT
brj-23453	193	11	91	91	NUM
brj-23453	193	12	%	%	NOUN
brj-23453	193	13	)	)	PUNCT
brj-23453	193	14	among	among	ADP
brj-23453	193	15	populations	population	NOUN
brj-23453	193	16	within	within	ADP
brj-23453	193	17	kashmir	kashmir	PROPN
brj-23453	193	18	than	than	ADP
brj-23453	193	19	between	between	ADP
brj-23453	193	20	populations	population	NOUN
brj-23453	193	21	categorized	categorize	VERB
brj-23453	193	22	by	by	ADP
brj-23453	193	23	location	location	NOUN
brj-23453	193	24	,	,	PUNCT
brj-23453	193	25	cultivar	cultivar	NOUN
brj-23453	193	26	,	,	PUNCT
brj-23453	193	27	and	and	CCONJ
brj-23453	193	28	plant	plant	NOUN
brj-23453	193	29	.	.	PUNCT
brj-23453	194	1	this	this	PRON
brj-23453	194	2	suggests	suggest	VERB
brj-23453	194	3	that	that	SCONJ
brj-23453	194	4	walnut	walnut	ADJ
brj-23453	194	5	genotypes	genotype	NOUN
brj-23453	194	6	in	in	ADP
brj-23453	194	7	the	the	DET
brj-23453	194	8	region	region	NOUN
brj-23453	194	9	are	be	AUX
brj-23453	194	10	exceptionally	exceptionally	ADV
brj-23453	194	11	diverse	diverse	ADJ
brj-23453	194	12	.	.	PUNCT
brj-23453	195	1	the	the	DET
brj-23453	195	2	genetic	genetic	ADJ
brj-23453	195	3	differentiation	differentiation	NOUN
brj-23453	195	4	values	value	NOUN
brj-23453	195	5	(	(	PUNCT
brj-23453	195	6	fst	fst	NOUN
brj-23453	195	7	)	)	PUNCT
brj-23453	195	8	within	within	ADP
brj-23453	195	9	and	and	CCONJ
brj-23453	195	10	between	between	ADP
brj-23453	195	11	populations	population	NOUN
brj-23453	195	12	were	be	AUX
brj-23453	195	13	determined	determine	VERB
brj-23453	195	14	to	to	PART
brj-23453	195	15	be	be	AUX
brj-23453	195	16	0.04	0.04	NUM
brj-23453	195	17	,	,	PUNCT
brj-23453	195	18	suggesting	suggest	VERB
brj-23453	195	19	a	a	DET
brj-23453	195	20	high	high	ADJ
brj-23453	195	21	degree	degree	NOUN
brj-23453	195	22	of	of	ADP
brj-23453	195	23	homogeneity	homogeneity	NOUN
brj-23453	195	24	.	.	PUNCT
brj-23453	196	1	this	this	DET
brj-23453	196	2	conclusion	conclusion	NOUN
brj-23453	196	3	is	be	AUX
brj-23453	196	4	supported	support	VERB
brj-23453	196	5	by	by	ADP
brj-23453	196	6	the	the	DET
brj-23453	196	7	low	low	ADJ
brj-23453	196	8	fst	fst	NOUN
brj-23453	196	9	value	value	NOUN
brj-23453	196	10	,	,	PUNCT
brj-23453	196	11	which	which	PRON
brj-23453	196	12	signifies	signify	VERB
brj-23453	196	13	minimal	minimal	ADJ
brj-23453	196	14	genetic	genetic	ADJ
brj-23453	196	15	differentiation	differentiation	NOUN
brj-23453	196	16	.	.	PUNCT
brj-23453	197	1	anomalous	anomalous	ADJ
brj-23453	197	2	variations	variation	NOUN
brj-23453	197	3	exist	exist	VERB
brj-23453	197	4	both	both	CCONJ
brj-23453	197	5	among	among	ADP
brj-23453	197	6	and	and	CCONJ
brj-23453	197	7	within	within	ADP
brj-23453	197	8	groups	group	NOUN
brj-23453	197	9	,	,	PUNCT
brj-23453	197	10	as	as	SCONJ
brj-23453	197	11	stated	state	VERB
brj-23453	197	12	by	by	ADP
brj-23453	197	13	amova	amova	PROPN
brj-23453	197	14	.	.	PUNCT
brj-23453	198	1	in	in	ADP
brj-23453	198	2	contrast	contrast	NOUN
brj-23453	198	3	to	to	ADP
brj-23453	198	4	the	the	DET
brj-23453	198	5	2	2	NUM
brj-23453	198	6	%	%	NOUN
brj-23453	198	7	variation	variation	NOUN
brj-23453	198	8	observed	observe	VERB
brj-23453	198	9	in	in	ADP
brj-23453	198	10	the	the	DET
brj-23453	198	11	population	population	NOUN
brj-23453	198	12	,	,	PUNCT
brj-23453	198	13	individual	individual	ADJ
brj-23453	198	14	variation	variation	NOUN
brj-23453	198	15	was	be	AUX
brj-23453	198	16	73	73	NUM
brj-23453	198	17	%	%	NOUN
brj-23453	198	18	greater	great	ADJ
brj-23453	198	19	at	at	ADP
brj-23453	198	20	25	25	NUM
brj-23453	198	21	%	%	NOUN
brj-23453	198	22	(	(	PUNCT
brj-23453	198	23	table	table	NOUN
brj-23453	198	24	4	4	NUM
brj-23453	198	25	)	)	PUNCT
brj-23453	198	26	.	.	PUNCT
brj-23453	199	1	peer	peer	NOUN
brj-23453	199	2	-	-	PUNCT
brj-23453	199	3	reviewed	review	VERB
brj-23453	199	4	article	article	NOUN
brj-23453	199	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	199	6	wani	wani	PROPN
brj-23453	199	7	et	et	PROPN
brj-23453	199	8	al	al	PROPN
brj-23453	199	9	.	.	PROPN
brj-23453	200	1	(	(	PUNCT
brj-23453	200	2	2024	2024	NUM
brj-23453	200	3	)	)	PUNCT
brj-23453	200	4	.	.	PUNCT
brj-23453	201	1	“	"	PUNCT
brj-23453	201	2	walnut	walnut	ADJ
brj-23453	201	3	population	population	NOUN
brj-23453	201	4	&	&	CCONJ
brj-23453	201	5	diversity	diversity	NOUN
brj-23453	201	6	,	,	PUNCT
brj-23453	201	7	”	"	PUNCT
brj-23453	201	8	bioresources	bioresource	NOUN
brj-23453	201	9	19(3	19(3	NUM
brj-23453	201	10	)	)	PUNCT
brj-23453	201	11	,	,	PUNCT
brj-23453	201	12	4213	4213	NUM
brj-23453	201	13	-	-	SYM
brj-23453	201	14	4237	4237	NUM
brj-23453	201	15	.	.	PUNCT
brj-23453	201	16	4222	4222	NUM
brj-23453	201	17	fig	fig	NOUN
brj-23453	201	18	.	.	PUNCT
brj-23453	202	1	4	4	NUM
brj-23453	202	2	.	.	X
brj-23453	202	3	second	second	ADJ
brj-23453	202	4	order	order	NOUN
brj-23453	202	5	of	of	ADP
brj-23453	202	6	change	change	NOUN
brj-23453	202	7	of	of	ADP
brj-23453	202	8	the	the	DET
brj-23453	202	9	log	log	NOUN
brj-23453	202	10	-	-	PUNCT
brj-23453	202	11	likelihood	likelihood	NOUN
brj-23453	202	12	of	of	ADP
brj-23453	202	13	the	the	DET
brj-23453	202	14	data	datum	NOUN
brj-23453	202	15	(	(	PUNCT
brj-23453	202	16	delta	delta	NOUN
brj-23453	202	17	k	k	PROPN
brj-23453	202	18	)	)	PUNCT
brj-23453	202	19	as	as	ADP
brj-23453	202	20	a	a	DET
brj-23453	202	21	function	function	NOUN
brj-23453	202	22	of	of	ADP
brj-23453	202	23	k	k	PROPN
brj-23453	202	24	,	,	PUNCT
brj-23453	202	25	calculated	calculate	VERB
brj-23453	202	26	over	over	ADP
brj-23453	202	27	two	two	NUM
brj-23453	202	28	replications	replication	NOUN
brj-23453	202	29	table	table	NOUN
brj-23453	202	30	4	4	NUM
brj-23453	202	31	.	.	PUNCT
brj-23453	202	32	statistical	statistical	ADJ
brj-23453	202	33	amova	amova	PROPN
brj-23453	202	34	source	source	PROPN
brj-23453	202	35	df	df	PROPN
brj-23453	202	36	ss	ss	PROPN
brj-23453	202	37	ms	ms	PROPN
brj-23453	202	38	est	est	PROPN
brj-23453	202	39	.	.	PUNCT
brj-23453	203	1	var	var	NOUN
brj-23453	203	2	.	.	PUNCT
brj-23453	204	1	%	%	NOUN
brj-23453	204	2	among	among	ADP
brj-23453	204	3	pops	pop	NOUN
brj-23453	204	4	5	5	NUM
brj-23453	204	5	10.920	10.920	NUM
brj-23453	204	6	2.184	2.184	NUM
brj-23453	204	7	0.160	0.160	NUM
brj-23453	204	8	9	9	NUM
brj-23453	204	9	%	%	NOUN
brj-23453	204	10	within	within	ADP
brj-23453	204	11	pops	pop	NOUN
brj-23453	204	12	15	15	NUM
brj-23453	204	13	24.598	24.598	NUM
brj-23453	204	14	1.640	1.640	NUM
brj-23453	204	15	1.640	1.640	NUM
brj-23453	204	16	91	91	NUM
brj-23453	204	17	%	%	NOUN
brj-23453	204	18	total	total	NOUN
brj-23453	204	19	20	20	NUM
brj-23453	204	20	35.517	35.517	NUM
brj-23453	204	21	1.799	1.799	NUM
brj-23453	204	22	100	100	NUM
brj-23453	204	23	%	%	NOUN
brj-23453	204	24	stat	stat	NOUN
brj-23453	204	25	value	value	NOUN
brj-23453	204	26	p	p	X
brj-23453	204	27	<	<	X
brj-23453	204	28	0.05	0.05	NUM
brj-23453	204	29	ɸst	ɸst	PROPN
brj-23453	204	30	0.089	0.089	NUM
brj-23453	204	31	0.001	0.001	NUM
brj-23453	204	32	discussion	discussion	NOUN
brj-23453	204	33	a	a	DET
brj-23453	204	34	substantial	substantial	ADJ
brj-23453	204	35	degree	degree	NOUN
brj-23453	204	36	of	of	ADP
brj-23453	204	37	genetic	genetic	ADJ
brj-23453	204	38	diversity	diversity	NOUN
brj-23453	204	39	is	be	AUX
brj-23453	204	40	present	present	ADJ
brj-23453	204	41	in	in	ADP
brj-23453	204	42	walnut	walnut	NOUN
brj-23453	204	43	trees	tree	NOUN
brj-23453	204	44	,	,	PUNCT
brj-23453	204	45	and	and	CCONJ
brj-23453	204	46	significant	significant	ADJ
brj-23453	204	47	divergence	divergence	NOUN
brj-23453	204	48	is	be	AUX
brj-23453	204	49	observed	observe	VERB
brj-23453	204	50	in	in	ADP
brj-23453	204	51	their	their	PRON
brj-23453	204	52	germplasm	germplasm	NOUN
brj-23453	204	53	(	(	PUNCT
brj-23453	204	54	shahi	shahi	PROPN
brj-23453	204	55	et	et	PROPN
brj-23453	204	56	al	al	PROPN
brj-23453	204	57	.	.	PROPN
brj-23453	204	58	2023	2023	NUM
brj-23453	204	59	)	)	PUNCT
brj-23453	204	60	.	.	PUNCT
brj-23453	205	1	the	the	DET
brj-23453	205	2	observed	observe	VERB
brj-23453	205	3	genetic	genetic	ADJ
brj-23453	205	4	heterogeneity	heterogeneity	NOUN
brj-23453	205	5	and	and	CCONJ
brj-23453	205	6	heterozygosity	heterozygosity	NOUN
brj-23453	205	7	among	among	ADP
brj-23453	205	8	walnut	walnut	ADJ
brj-23453	205	9	genotypes	genotype	NOUN
brj-23453	205	10	are	be	AUX
brj-23453	205	11	primarily	primarily	ADV
brj-23453	205	12	attributable	attributable	ADJ
brj-23453	205	13	to	to	ADP
brj-23453	205	14	plantations	plantation	NOUN
brj-23453	205	15	cultivated	cultivate	VERB
brj-23453	205	16	from	from	ADP
brj-23453	205	17	seeds	seed	NOUN
brj-23453	205	18	(	(	PUNCT
brj-23453	205	19	buyuksolak	buyuksolak	NOUN
brj-23453	205	20	et	et	PROPN
brj-23453	205	21	al	al	PROPN
brj-23453	205	22	.	.	PROPN
brj-23453	205	23	2020	2020	NUM
brj-23453	205	24	)	)	PUNCT
brj-23453	205	25	.	.	PUNCT
brj-23453	206	1	forthcoming	forthcome	VERB
brj-23453	206	2	endeavors	endeavor	NOUN
brj-23453	206	3	in	in	ADP
brj-23453	206	4	crop	crop	NOUN
brj-23453	206	5	development	development	NOUN
brj-23453	206	6	must	must	AUX
brj-23453	206	7	evaluate	evaluate	VERB
brj-23453	206	8	the	the	DET
brj-23453	206	9	germplasm	germplasm	NOUN
brj-23453	206	10	presently	presently	ADV
brj-23453	206	11	available	available	ADJ
brj-23453	206	12	(	(	PUNCT
brj-23453	206	13	pop	pop	VERB
brj-23453	206	14	et	et	PROPN
brj-23453	206	15	al	al	PROPN
brj-23453	206	16	.	.	PROPN
brj-23453	206	17	2013	2013	NUM
brj-23453	206	18	;	;	PUNCT
brj-23453	206	19	akca	akca	PROPN
brj-23453	206	20	et	et	PROPN
brj-23453	206	21	al	al	PROPN
brj-23453	206	22	.	.	PROPN
brj-23453	206	23	2020	2020	NUM
brj-23453	206	24	)	)	PUNCT
brj-23453	206	25	.	.	PUNCT
brj-23453	207	1	critical	critical	ADJ
brj-23453	207	2	information	information	NOUN
brj-23453	207	3	for	for	ADP
brj-23453	207	4	selecting	select	VERB
brj-23453	207	5	desirable	desirable	ADJ
brj-23453	207	6	genetic	genetic	ADJ
brj-23453	207	7	resources	resource	NOUN
brj-23453	207	8	can	can	AUX
brj-23453	207	9	be	be	AUX
brj-23453	207	10	obtained	obtain	VERB
brj-23453	207	11	by	by	ADP
brj-23453	207	12	analyzing	analyze	VERB
brj-23453	207	13	these	these	DET
brj-23453	207	14	resources	resource	NOUN
brj-23453	207	15	for	for	ADP
brj-23453	207	16	a	a	DET
brj-23453	207	17	variety	variety	NOUN
brj-23453	207	18	of	of	ADP
brj-23453	207	19	traits	trait	NOUN
brj-23453	207	20	(	(	PUNCT
brj-23453	207	21	ebrahimi	ebrahimi	X
brj-23453	207	22	et	et	PROPN
brj-23453	207	23	al	al	PROPN
brj-23453	207	24	.	.	PROPN
brj-23453	207	25	2015	2015	NUM
brj-23453	207	26	;	;	PUNCT
brj-23453	207	27	hassani	hassani	PROPN
brj-23453	207	28	et	et	PROPN
brj-23453	207	29	al	al	PROPN
brj-23453	207	30	.	.	PROPN
brj-23453	207	31	2020	2020	NUM
brj-23453	207	32	)	)	PUNCT
brj-23453	207	33	.	.	PUNCT
brj-23453	208	1	molecular	molecular	ADJ
brj-23453	208	2	markers	marker	NOUN
brj-23453	208	3	contain	contain	VERB
brj-23453	208	4	information	information	NOUN
brj-23453	208	5	regarding	regard	VERB
brj-23453	208	6	genetic	genetic	ADJ
brj-23453	208	7	structure	structure	NOUN
brj-23453	208	8	and	and	CCONJ
brj-23453	208	9	evolution	evolution	NOUN
brj-23453	208	10	(	(	PUNCT
brj-23453	208	11	cervera	cervera	NOUN
brj-23453	208	12	et	et	PROPN
brj-23453	208	13	al	al	PROPN
brj-23453	208	14	.	.	PROPN
brj-23453	208	15	2000	2000	NUM
brj-23453	208	16	)	)	PUNCT
brj-23453	208	17	.	.	PUNCT
brj-23453	209	1	in	in	ADP
brj-23453	209	2	the	the	DET
brj-23453	209	3	domains	domain	NOUN
brj-23453	209	4	of	of	ADP
brj-23453	209	5	population	population	NOUN
brj-23453	209	6	genetics	genetic	NOUN
brj-23453	209	7	,	,	PUNCT
brj-23453	209	8	linkage	linkage	NOUN
brj-23453	209	9	mapping	mapping	NOUN
brj-23453	209	10	,	,	PUNCT
brj-23453	209	11	genotyping	genotyping	NOUN
brj-23453	209	12	,	,	PUNCT
brj-23453	209	13	determining	determine	VERB
brj-23453	209	14	parentage	parentage	NOUN
brj-23453	209	15	,	,	PUNCT
brj-23453	209	16	and	and	CCONJ
brj-23453	209	17	mapping	mapping	NOUN
brj-23453	209	18	qualitative	qualitative	NOUN
brj-23453	209	19	and	and	CCONJ
brj-23453	209	20	quantitative	quantitative	ADJ
brj-23453	209	21	features	feature	NOUN
brj-23453	209	22	,	,	PUNCT
brj-23453	209	23	they	they	PRON
brj-23453	209	24	are	be	AUX
brj-23453	209	25	indispensable	indispensable	ADJ
brj-23453	209	26	(	(	PUNCT
brj-23453	209	27	crespel	crespel	NOUN
brj-23453	209	28	et	et	PROPN
brj-23453	209	29	al	al	PROPN
brj-23453	209	30	.	.	PROPN
brj-23453	209	31	2002	2002	NUM
brj-23453	209	32	)	)	PUNCT
brj-23453	209	33	.	.	PUNCT
brj-23453	210	1	microsatellite	microsatellite	NOUN
brj-23453	210	2	markers	marker	NOUN
brj-23453	210	3	have	have	AUX
brj-23453	210	4	proven	prove	VERB
brj-23453	210	5	to	to	PART
brj-23453	210	6	be	be	AUX
brj-23453	210	7	efficacious	efficacious	ADJ
brj-23453	210	8	in	in	ADP
brj-23453	210	9	genetic	genetic	ADJ
brj-23453	210	10	research	research	NOUN
brj-23453	210	11	,	,	PUNCT
brj-23453	210	12	particularly	particularly	ADV
brj-23453	210	13	in	in	ADP
brj-23453	210	14	the	the	DET
brj-23453	210	15	examination	examination	NOUN
brj-23453	210	16	of	of	ADP
brj-23453	210	17	walnut	walnut	ADJ
brj-23453	210	18	genetic	genetic	ADJ
brj-23453	210	19	diversity	diversity	NOUN
brj-23453	210	20	(	(	PUNCT
brj-23453	210	21	hamza	hamza	PROPN
brj-23453	210	22	et	et	PROPN
brj-23453	210	23	al	al	PROPN
brj-23453	210	24	.	.	PROPN
brj-23453	210	25	2004	2004	NUM
brj-23453	210	26	;	;	PUNCT
brj-23453	210	27	karimi	karimi	PROPN
brj-23453	210	28	et	et	PROPN
brj-23453	210	29	al	al	PROPN
brj-23453	210	30	.	.	PROPN
brj-23453	210	31	2010	2010	NUM
brj-23453	210	32	;	;	PUNCT
brj-23453	210	33	ahmed	ahmed	PROPN
brj-23453	210	34	et	et	PROPN
brj-23453	210	35	al	al	PROPN
brj-23453	210	36	.	.	PROPN
brj-23453	210	37	2012	2012	NUM
brj-23453	210	38	)	)	PUNCT
brj-23453	210	39	,	,	PUNCT
brj-23453	210	40	because	because	SCONJ
brj-23453	210	41	of	of	ADP
brj-23453	210	42	the	the	DET
brj-23453	210	43	area	area	NOUN
brj-23453	210	44	's	's	PART
brj-23453	210	45	exceptional	exceptional	ADJ
brj-23453	210	46	conservation	conservation	NOUN
brj-23453	210	47	.	.	PUNCT
brj-23453	211	1	the	the	DET
brj-23453	211	2	utilization	utilization	NOUN
brj-23453	211	3	of	of	ADP
brj-23453	211	4	microsatellite	microsatellite	ADJ
brj-23453	211	5	markers	marker	NOUN
brj-23453	211	6	in	in	ADP
brj-23453	211	7	the	the	DET
brj-23453	211	8	current	current	ADJ
brj-23453	211	9	research	research	NOUN
brj-23453	211	10	identified	identify	VERB
brj-23453	211	11	a	a	DET
brj-23453	211	12	significant	significant	ADJ
brj-23453	211	13	degree	degree	NOUN
brj-23453	211	14	peer	peer	NOUN
brj-23453	211	15	-	-	PUNCT
brj-23453	211	16	reviewed	review	VERB
brj-23453	211	17	article	article	NOUN
brj-23453	211	18	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	211	19	wani	wani	PROPN
brj-23453	211	20	et	et	PROPN
brj-23453	211	21	al	al	PROPN
brj-23453	211	22	.	.	PROPN
brj-23453	212	1	(	(	PUNCT
brj-23453	212	2	2024	2024	NUM
brj-23453	212	3	)	)	PUNCT
brj-23453	212	4	.	.	PUNCT
brj-23453	213	1	“	"	PUNCT
brj-23453	213	2	walnut	walnut	ADJ
brj-23453	213	3	population	population	NOUN
brj-23453	213	4	&	&	CCONJ
brj-23453	213	5	diversity	diversity	NOUN
brj-23453	213	6	,	,	PUNCT
brj-23453	213	7	”	"	PUNCT
brj-23453	213	8	bioresources	bioresource	NOUN
brj-23453	213	9	19(3	19(3	NUM
brj-23453	213	10	)	)	PUNCT
brj-23453	213	11	,	,	PUNCT
brj-23453	213	12	4213	4213	NUM
brj-23453	213	13	-	-	SYM
brj-23453	213	14	4237	4237	NUM
brj-23453	213	15	.	.	PUNCT
brj-23453	214	1	4223	4223	NUM
brj-23453	214	2	of	of	ADP
brj-23453	214	3	polymorphism	polymorphism	NOUN
brj-23453	214	4	(	(	PUNCT
brj-23453	214	5	89.6	89.6	NUM
brj-23453	214	6	%	%	NOUN
brj-23453	214	7	)	)	PUNCT
brj-23453	214	8	,	,	PUNCT
brj-23453	214	9	which	which	PRON
brj-23453	214	10	is	be	AUX
brj-23453	214	11	consistent	consistent	ADJ
brj-23453	214	12	with	with	ADP
brj-23453	214	13	prior	prior	ADJ
brj-23453	214	14	discoveries	discovery	NOUN
brj-23453	214	15	in	in	ADP
brj-23453	214	16	walnuts	walnut	NOUN
brj-23453	214	17	(	(	PUNCT
brj-23453	214	18	ahmed	ahmed	PROPN
brj-23453	214	19	et	et	PROPN
brj-23453	214	20	al	al	PROPN
brj-23453	214	21	.	.	PROPN
brj-23453	214	22	2012	2012	NUM
brj-23453	214	23	;	;	PUNCT
brj-23453	214	24	salieh	salieh	PROPN
brj-23453	214	25	et	et	PROPN
brj-23453	214	26	al	al	PROPN
brj-23453	214	27	.	.	PROPN
brj-23453	214	28	2013	2013	NUM
brj-23453	214	29	)	)	PUNCT
brj-23453	214	30	.	.	PUNCT
brj-23453	215	1	other	other	ADJ
brj-23453	215	2	research	research	NOUN
brj-23453	215	3	has	have	AUX
brj-23453	215	4	revealed	reveal	VERB
brj-23453	215	5	that	that	SCONJ
brj-23453	215	6	,	,	PUNCT
brj-23453	215	7	on	on	ADP
brj-23453	215	8	average	average	ADJ
brj-23453	215	9	,	,	PUNCT
brj-23453	215	10	walnuts	walnut	NOUN
brj-23453	215	11	contain	contain	VERB
brj-23453	215	12	two	two	NUM
brj-23453	215	13	polymorphic	polymorphic	ADJ
brj-23453	215	14	ssr	ssr	NOUN
brj-23453	215	15	loci	locus	NOUN
brj-23453	215	16	per	per	ADP
brj-23453	215	17	ssr	ssr	PROPN
brj-23453	215	18	primer	primer	NOUN
brj-23453	215	19	.	.	PUNCT
brj-23453	216	1	ahmed	ahmed	PROPN
brj-23453	216	2	et	et	PROPN
brj-23453	216	3	al	al	PROPN
brj-23453	216	4	.	.	PROPN
brj-23453	217	1	(	(	PUNCT
brj-23453	217	2	2012	2012	NUM
brj-23453	217	3	)	)	PUNCT
brj-23453	217	4	identified	identify	VERB
brj-23453	217	5	an	an	DET
brj-23453	217	6	average	average	NOUN
brj-23453	217	7	of	of	ADP
brj-23453	217	8	two	two	NUM
brj-23453	217	9	polymorphic	polymorphic	ADJ
brj-23453	217	10	ssr	ssr	NOUN
brj-23453	217	11	loci	locus	NOUN
brj-23453	217	12	per	per	ADP
brj-23453	217	13	primer	primer	NOUN
brj-23453	217	14	when	when	SCONJ
brj-23453	217	15	thirteen	thirteen	NUM
brj-23453	217	16	primers	primer	NOUN
brj-23453	217	17	were	be	AUX
brj-23453	217	18	utilized	utilize	VERB
brj-23453	217	19	.	.	PUNCT
brj-23453	218	1	the	the	DET
brj-23453	218	2	results	result	NOUN
brj-23453	218	3	obtained	obtain	VERB
brj-23453	218	4	in	in	ADP
brj-23453	218	5	the	the	DET
brj-23453	218	6	present	present	ADJ
brj-23453	218	7	investigation	investigation	NOUN
brj-23453	218	8	regarding	regard	VERB
brj-23453	218	9	various	various	ADJ
brj-23453	218	10	primer	primer	NOUN
brj-23453	218	11	parameters	parameter	NOUN
brj-23453	218	12	align	align	VERB
brj-23453	218	13	with	with	ADP
brj-23453	218	14	those	those	PRON
brj-23453	218	15	reported	report	VERB
brj-23453	218	16	in	in	ADP
brj-23453	218	17	prior	prior	ADJ
brj-23453	218	18	research	research	NOUN
brj-23453	218	19	(	(	PUNCT
brj-23453	218	20	wani	wani	PROPN
brj-23453	218	21	et	et	PROPN
brj-23453	218	22	al	al	PROPN
brj-23453	218	23	.	.	PROPN
brj-23453	218	24	2017	2017	NUM
brj-23453	218	25	)	)	PUNCT
brj-23453	218	26	.	.	PUNCT
brj-23453	219	1	it	it	PRON
brj-23453	219	2	is	be	AUX
brj-23453	219	3	imperative	imperative	ADJ
brj-23453	219	4	to	to	PART
brj-23453	219	5	comprehend	comprehend	VERB
brj-23453	219	6	the	the	DET
brj-23453	219	7	magnitude	magnitude	NOUN
brj-23453	219	8	of	of	ADP
brj-23453	219	9	genetic	genetic	ADJ
brj-23453	219	10	variation	variation	NOUN
brj-23453	219	11	and	and	CCONJ
brj-23453	219	12	the	the	DET
brj-23453	219	13	genetic	genetic	ADJ
brj-23453	219	14	interrelationships	interrelationship	NOUN
brj-23453	219	15	among	among	ADP
brj-23453	219	16	genotypes	genotype	NOUN
brj-23453	219	17	within	within	ADP
brj-23453	219	18	a	a	DET
brj-23453	219	19	population	population	NOUN
brj-23453	219	20	to	to	PART
brj-23453	219	21	optimize	optimize	VERB
brj-23453	219	22	the	the	DET
brj-23453	219	23	utilization	utilization	NOUN
brj-23453	219	24	of	of	ADP
brj-23453	219	25	germplasm	germplasm	NOUN
brj-23453	219	26	resources	resource	NOUN
brj-23453	219	27	.	.	PUNCT
brj-23453	220	1	additionally	additionally	ADV
brj-23453	220	2	,	,	PUNCT
brj-23453	220	3	this	this	PRON
brj-23453	220	4	facilitates	facilitate	VERB
brj-23453	220	5	the	the	DET
brj-23453	220	6	formulation	formulation	NOUN
brj-23453	220	7	of	of	ADP
brj-23453	220	8	suitable	suitable	ADJ
brj-23453	220	9	approaches	approach	NOUN
brj-23453	220	10	to	to	PART
brj-23453	220	11	plant	plant	VERB
brj-23453	220	12	breeding	breeding	NOUN
brj-23453	220	13	,	,	PUNCT
brj-23453	220	14	such	such	ADJ
brj-23453	220	15	as	as	ADP
brj-23453	220	16	the	the	DET
brj-23453	220	17	establishment	establishment	NOUN
brj-23453	220	18	of	of	ADP
brj-23453	220	19	the	the	DET
brj-23453	220	20	genetic	genetic	ADJ
brj-23453	220	21	map	map	NOUN
brj-23453	220	22	and	and	CCONJ
brj-23453	220	23	the	the	DET
brj-23453	220	24	assessment	assessment	NOUN
brj-23453	220	25	of	of	ADP
brj-23453	220	26	quantitative	quantitative	ADJ
brj-23453	220	27	trait	trait	NOUN
brj-23453	220	28	loci	loci	NOUN
brj-23453	220	29	(	(	PUNCT
brj-23453	220	30	yilmaz	yilmaz	PROPN
brj-23453	220	31	et	et	PROPN
brj-23453	220	32	al	al	PROPN
brj-23453	220	33	.	.	PROPN
brj-23453	220	34	2012	2012	NUM
brj-23453	220	35	)	)	PUNCT
brj-23453	220	36	.	.	PUNCT
brj-23453	221	1	the	the	DET
brj-23453	221	2	genetic	genetic	ADJ
brj-23453	221	3	diversity	diversity	NOUN
brj-23453	221	4	,	,	PUNCT
brj-23453	221	5	population	population	NOUN
brj-23453	221	6	structure	structure	NOUN
brj-23453	221	7	,	,	PUNCT
brj-23453	221	8	and	and	CCONJ
brj-23453	221	9	relationships	relationship	NOUN
brj-23453	221	10	of	of	ADP
brj-23453	221	11	twenty	twenty	NUM
brj-23453	221	12	-	-	PUNCT
brj-23453	221	13	one	one	NUM
brj-23453	221	14	walnut	walnut	NOUN
brj-23453	221	15	genotypes	genotype	NOUN
brj-23453	221	16	selected	select	VERB
brj-23453	221	17	from	from	ADP
brj-23453	221	18	budgam	budgam	NOUN
brj-23453	221	19	and	and	CCONJ
brj-23453	221	20	ganderbal	ganderbal	PROPN
brj-23453	221	21	,	,	PUNCT
brj-23453	221	22	two	two	NUM
brj-23453	221	23	districts	district	NOUN
brj-23453	221	24	in	in	ADP
brj-23453	221	25	the	the	DET
brj-23453	221	26	valley	valley	NOUN
brj-23453	221	27	of	of	ADP
brj-23453	221	28	kashmir	kashmir	PROPN
brj-23453	221	29	,	,	PUNCT
brj-23453	221	30	were	be	AUX
brj-23453	221	31	analyzed	analyze	VERB
brj-23453	221	32	using	use	VERB
brj-23453	221	33	ssr	ssr	ADJ
brj-23453	221	34	markers	marker	NOUN
brj-23453	221	35	.	.	PUNCT
brj-23453	222	1	the	the	DET
brj-23453	222	2	ongoing	ongoing	ADJ
brj-23453	222	3	inquiry	inquiry	NOUN
brj-23453	222	4	has	have	AUX
brj-23453	222	5	uncovered	uncover	VERB
brj-23453	222	6	valuable	valuable	ADJ
brj-23453	222	7	genetic	genetic	ADJ
brj-23453	222	8	data	datum	NOUN
brj-23453	222	9	within	within	ADP
brj-23453	222	10	the	the	DET
brj-23453	222	11	genotypes	genotype	NOUN
brj-23453	222	12	of	of	ADP
brj-23453	222	13	walnuts	walnut	NOUN
brj-23453	222	14	that	that	PRON
brj-23453	222	15	were	be	AUX
brj-23453	222	16	gathered	gather	VERB
brj-23453	222	17	.	.	PUNCT
brj-23453	223	1	an	an	DET
brj-23453	223	2	average	average	NOUN
brj-23453	223	3	of	of	ADP
brj-23453	223	4	2.94	2.94	NUM
brj-23453	223	5	alleles	allele	NOUN
brj-23453	223	6	per	per	ADP
brj-23453	223	7	locus	locus	NOUN
brj-23453	223	8	was	be	AUX
brj-23453	223	9	observed	observe	VERB
brj-23453	223	10	,	,	PUNCT
brj-23453	223	11	with	with	ADP
brj-23453	223	12	values	value	NOUN
brj-23453	223	13	ranging	range	VERB
brj-23453	223	14	from	from	ADP
brj-23453	223	15	2	2	NUM
brj-23453	223	16	to	to	ADP
brj-23453	223	17	4	4	NUM
brj-23453	223	18	.	.	PUNCT
brj-23453	224	1	in	in	ADP
brj-23453	224	2	29	29	NUM
brj-23453	224	3	apricot	apricot	PROPN
brj-23453	224	4	genotypes	genotype	NOUN
brj-23453	224	5	,	,	PUNCT
brj-23453	224	6	messina	messina	PROPN
brj-23453	224	7	et	et	PROPN
brj-23453	224	8	al	al	PROPN
brj-23453	224	9	.	.	PROPN
brj-23453	225	1	(	(	PUNCT
brj-23453	225	2	2004	2004	NUM
brj-23453	225	3	)	)	PUNCT
brj-23453	225	4	reported	report	VERB
brj-23453	225	5	a	a	DET
brj-23453	225	6	range	range	NOUN
brj-23453	225	7	of	of	ADP
brj-23453	225	8	allele	allele	NOUN
brj-23453	225	9	numbers	number	NOUN
brj-23453	225	10	2	2	NUM
brj-23453	225	11	to	to	ADP
brj-23453	225	12	9	9	NUM
brj-23453	225	13	using	use	VERB
brj-23453	225	14	20	20	NUM
brj-23453	225	15	ssr	ssr	ADJ
brj-23453	225	16	producers	producer	NOUN
brj-23453	225	17	,	,	PUNCT
brj-23453	225	18	whereas	whereas	SCONJ
brj-23453	225	19	khadivi	khadivi	NOUN
brj-23453	225	20	-	-	PUNCT
brj-23453	225	21	khub	khub	NOUN
brj-23453	225	22	et	et	PROPN
brj-23453	225	23	al	al	PROPN
brj-23453	225	24	.	.	PROPN
brj-23453	226	1	(	(	PUNCT
brj-23453	226	2	2015	2015	NUM
brj-23453	226	3	)	)	PUNCT
brj-23453	226	4	reported	report	VERB
brj-23453	226	5	3	3	NUM
brj-23453	226	6	to	to	ADP
brj-23453	226	7	7	7	NUM
brj-23453	226	8	for	for	ADP
brj-23453	226	9	walnut	walnut	ADJ
brj-23453	226	10	genotypes	genotype	NOUN
brj-23453	226	11	.	.	PUNCT
brj-23453	227	1	walnuts	walnut	NOUN
brj-23453	227	2	(	(	PUNCT
brj-23453	227	3	juglans	juglan	NOUN
brj-23453	227	4	regia	regia	PROPN
brj-23453	227	5	l.	l.	PROPN
brj-23453	227	6	)	)	PUNCT
brj-23453	227	7	exhibited	exhibit	VERB
brj-23453	227	8	allelic	allelic	ADJ
brj-23453	227	9	numbers	number	NOUN
brj-23453	227	10	ranging	range	VERB
brj-23453	227	11	from	from	ADP
brj-23453	227	12	two	two	NUM
brj-23453	227	13	to	to	ADP
brj-23453	227	14	four	four	NUM
brj-23453	227	15	,	,	PUNCT
brj-23453	227	16	according	accord	VERB
brj-23453	227	17	to	to	ADP
brj-23453	227	18	ebrahimi	ebrahimi	PROPN
brj-23453	227	19	et	et	PROPN
brj-23453	227	20	al	al	PROPN
brj-23453	227	21	.	.	PROPN
brj-23453	228	1	(	(	PUNCT
brj-23453	228	2	2016	2016	NUM
brj-23453	228	3	)	)	PUNCT
brj-23453	228	4	.	.	PUNCT
brj-23453	229	1	the	the	DET
brj-23453	229	2	marker	marker	NOUN
brj-23453	229	3	index	index	NOUN
brj-23453	229	4	is	be	AUX
brj-23453	229	5	a	a	DET
brj-23453	229	6	characteristic	characteristic	NOUN
brj-23453	229	7	that	that	PRON
brj-23453	229	8	provides	provide	VERB
brj-23453	229	9	insight	insight	NOUN
brj-23453	229	10	into	into	ADP
brj-23453	229	11	the	the	DET
brj-23453	229	12	discriminatory	discriminatory	ADJ
brj-23453	229	13	capability	capability	NOUN
brj-23453	229	14	of	of	ADP
brj-23453	229	15	a	a	DET
brj-23453	229	16	marker	marker	NOUN
brj-23453	229	17	.	.	PUNCT
brj-23453	230	1	as	as	ADP
brj-23453	230	2	such	such	ADJ
brj-23453	230	3	,	,	PUNCT
brj-23453	230	4	it	it	PRON
brj-23453	230	5	was	be	AUX
brj-23453	230	6	computed	compute	VERB
brj-23453	230	7	for	for	ADP
brj-23453	230	8	each	each	PRON
brj-23453	230	9	of	of	ADP
brj-23453	230	10	them	they	PRON
brj-23453	230	11	,	,	PUNCT
brj-23453	230	12	with	with	SCONJ
brj-23453	230	13	the	the	DET
brj-23453	230	14	primers	primer	NOUN
brj-23453	230	15	wga69	wga69	VERB
brj-23453	230	16	and	and	CCONJ
brj-23453	230	17	wga202	wga202	PROPN
brj-23453	230	18	having	have	VERB
brj-23453	230	19	the	the	DET
brj-23453	230	20	lowest	low	ADJ
brj-23453	230	21	value	value	NOUN
brj-23453	230	22	of	of	ADP
brj-23453	230	23	0.10	0.10	NUM
brj-23453	230	24	and	and	CCONJ
brj-23453	230	25	the	the	DET
brj-23453	230	26	highest	high	ADJ
brj-23453	230	27	value	value	NOUN
brj-23453	230	28	of	of	ADP
brj-23453	230	29	0.38	0.38	NUM
brj-23453	230	30	(	(	PUNCT
brj-23453	230	31	with	with	ADP
brj-23453	230	32	a	a	DET
brj-23453	230	33	mean	mean	NOUN
brj-23453	230	34	of	of	ADP
brj-23453	230	35	0.199	0.199	NUM
brj-23453	230	36	)	)	PUNCT
brj-23453	230	37	.	.	PUNCT
brj-23453	231	1	the	the	DET
brj-23453	231	2	studies	study	NOUN
brj-23453	231	3	conducted	conduct	VERB
brj-23453	231	4	by	by	ADP
brj-23453	231	5	shah	shah	PROPN
brj-23453	231	6	et	et	PROPN
brj-23453	231	7	al	al	PROPN
brj-23453	231	8	.	.	PROPN
brj-23453	231	9	(	(	PUNCT
brj-23453	231	10	2018	2018	NUM
brj-23453	231	11	)	)	PUNCT
brj-23453	231	12	identified	identify	VERB
brj-23453	231	13	the	the	DET
brj-23453	231	14	highest	high	ADJ
brj-23453	231	15	(	(	PUNCT
brj-23453	231	16	0.89	0.89	NUM
brj-23453	231	17	)	)	PUNCT
brj-23453	231	18	and	and	CCONJ
brj-23453	231	19	lowest	low	ADJ
brj-23453	231	20	(	(	PUNCT
brj-23453	231	21	0.00	0.00	NUM
brj-23453	231	22	)	)	PUNCT
brj-23453	231	23	values	value	NOUN
brj-23453	231	24	of	of	ADP
brj-23453	231	25	mi	mi	PROPN
brj-23453	231	26	for	for	ADP
brj-23453	231	27	wga32	wga32	PROPN
brj-23453	231	28	,	,	PUNCT
brj-23453	231	29	wga331	wga331	PROPN
brj-23453	231	30	,	,	PUNCT
brj-23453	231	31	and	and	CCONJ
brj-23453	231	32	wga89	wga89	PROPN
brj-23453	231	33	,	,	PUNCT
brj-23453	231	34	with	with	ADP
brj-23453	231	35	a	a	DET
brj-23453	231	36	mean	mean	NOUN
brj-23453	231	37	of	of	ADP
brj-23453	231	38	0.244	0.244	NUM
brj-23453	231	39	.	.	PUNCT
brj-23453	232	1	lamia	lamia	NOUN
brj-23453	232	2	et	et	PROPN
brj-23453	232	3	al	al	PROPN
brj-23453	232	4	.	.	PROPN
brj-23453	233	1	(	(	PUNCT
brj-23453	233	2	2010	2010	NUM
brj-23453	233	3	)	)	PUNCT
brj-23453	233	4	examined	examine	VERB
brj-23453	233	5	81	81	NUM
brj-23453	233	6	apricot	apricot	PROPN
brj-23453	233	7	accessions	accession	NOUN
brj-23453	233	8	and	and	CCONJ
brj-23453	233	9	determined	determine	VERB
brj-23453	233	10	that	that	SCONJ
brj-23453	233	11	the	the	DET
brj-23453	233	12	average	average	ADJ
brj-23453	233	13	marker	marker	NOUN
brj-23453	233	14	index	index	NOUN
brj-23453	233	15	per	per	ADP
brj-23453	233	16	24	24	NUM
brj-23453	233	17	ssr	ssr	PROPN
brj-23453	233	18	markers	marker	NOUN
brj-23453	233	19	was	be	AUX
brj-23453	233	20	4.27	4.27	NUM
brj-23453	233	21	.	.	PUNCT
brj-23453	234	1	moreover	moreover	ADV
brj-23453	234	2	,	,	PUNCT
brj-23453	234	3	the	the	DET
brj-23453	234	4	most	most	ADV
brj-23453	234	5	crucial	crucial	ADJ
brj-23453	234	6	characteristic	characteristic	NOUN
brj-23453	234	7	of	of	ADP
brj-23453	234	8	a	a	DET
brj-23453	234	9	primer	primer	NOUN
brj-23453	234	10	is	be	AUX
brj-23453	234	11	its	its	PRON
brj-23453	234	12	pic	pic	NOUN
brj-23453	234	13	,	,	PUNCT
brj-23453	234	14	which	which	PRON
brj-23453	234	15	signifies	signify	VERB
brj-23453	234	16	its	its	PRON
brj-23453	234	17	capacity	capacity	NOUN
brj-23453	234	18	to	to	PART
brj-23453	234	19	differentiate	differentiate	VERB
brj-23453	234	20	among	among	ADP
brj-23453	234	21	various	various	ADJ
brj-23453	234	22	individuals	individual	NOUN
brj-23453	234	23	.	.	PUNCT
brj-23453	235	1	the	the	DET
brj-23453	235	2	investigation	investigation	NOUN
brj-23453	235	3	yielded	yield	VERB
brj-23453	235	4	an	an	DET
brj-23453	235	5	average	average	ADJ
brj-23453	235	6	pic	pic	NOUN
brj-23453	235	7	value	value	NOUN
brj-23453	235	8	of	of	ADP
brj-23453	235	9	0.22	0.22	NUM
brj-23453	235	10	.	.	PUNCT
brj-23453	236	1	the	the	DET
brj-23453	236	2	range	range	NOUN
brj-23453	236	3	of	of	ADP
brj-23453	236	4	the	the	DET
brj-23453	236	5	pic	pic	NOUN
brj-23453	236	6	value	value	NOUN
brj-23453	236	7	was	be	AUX
brj-23453	236	8	0.11	0.11	NUM
brj-23453	236	9	to	to	ADP
brj-23453	236	10	0.38	0.38	NUM
brj-23453	236	11	.	.	PUNCT
brj-23453	237	1	the	the	DET
brj-23453	237	2	wgas	wgas	NOUN
brj-23453	237	3	with	with	ADP
brj-23453	237	4	the	the	DET
brj-23453	237	5	highest	high	ADJ
brj-23453	237	6	pic	pic	NOUN
brj-23453	237	7	values	value	NOUN
brj-23453	237	8	were	be	AUX
brj-23453	237	9	wga-69	wga-69	PROPN
brj-23453	237	10	,	,	PUNCT
brj-23453	237	11	wga-1	wga-1	ADV
brj-23453	237	12	,	,	PUNCT
brj-23453	237	13	wga-118	wga-118	VERB
brj-23453	237	14	,	,	PUNCT
brj-23453	237	15	and	and	CCONJ
brj-23453	237	16	wga-276	wga-276	ADJ
brj-23453	237	17	.	.	PUNCT
brj-23453	238	1	at	at	ADP
brj-23453	238	2	0.22	0.22	NUM
brj-23453	238	3	per	per	ADP
brj-23453	238	4	locus	locus	NOUN
brj-23453	238	5	,	,	PUNCT
brj-23453	238	6	wga-202	wga-202	PROPN
brj-23453	238	7	exhibited	exhibit	VERB
brj-23453	238	8	the	the	DET
brj-23453	238	9	lowest	low	ADJ
brj-23453	238	10	pic	pic	NOUN
brj-23453	238	11	value	value	NOUN
brj-23453	238	12	,	,	PUNCT
brj-23453	238	13	falling	fall	VERB
brj-23453	238	14	short	short	ADV
brj-23453	238	15	of	of	ADP
brj-23453	238	16	the	the	DET
brj-23453	238	17	0.690	0.690	NUM
brj-23453	238	18	value	value	NOUN
brj-23453	238	19	reported	report	VERB
brj-23453	238	20	by	by	ADP
brj-23453	238	21	bakir	bakir	PROPN
brj-23453	238	22	et	et	PROPN
brj-23453	238	23	al	al	PROPN
brj-23453	238	24	.	.	PROPN
brj-23453	239	1	(	(	PUNCT
brj-23453	239	2	2019	2019	NUM
brj-23453	239	3	)	)	PUNCT
brj-23453	239	4	for	for	ADP
brj-23453	239	5	prunus	prunus	NOUN
brj-23453	239	6	armeniaca	armeniaca	NOUN
brj-23453	239	7	(	(	PUNCT
brj-23453	239	8	wild	wild	ADJ
brj-23453	239	9	form	form	NOUN
brj-23453	239	10	)	)	PUNCT
brj-23453	239	11	when	when	SCONJ
brj-23453	239	12	16	16	NUM
brj-23453	239	13	microsatellite	microsatellite	ADJ
brj-23453	239	14	primers	primer	NOUN
brj-23453	239	15	were	be	AUX
brj-23453	239	16	utilized	utilize	VERB
brj-23453	239	17	and	and	CCONJ
brj-23453	239	18	the	the	DET
brj-23453	239	19	0.546	0.546	NUM
brj-23453	239	20	value	value	NOUN
brj-23453	239	21	reported	report	VERB
brj-23453	239	22	by	by	ADP
brj-23453	239	23	bourguiba	bourguiba	PROPN
brj-23453	239	24	et	et	PROPN
brj-23453	239	25	al	al	PROPN
brj-23453	239	26	.	.	PROPN
brj-23453	240	1	(	(	PUNCT
brj-23453	240	2	2012	2012	NUM
brj-23453	240	3	)	)	PUNCT
brj-23453	240	4	when	when	SCONJ
brj-23453	240	5	24	24	NUM
brj-23453	240	6	ssr	ssr	ADJ
brj-23453	240	7	microsatellite	microsatellite	ADJ
brj-23453	240	8	primers	primer	NOUN
brj-23453	240	9	were	be	AUX
brj-23453	240	10	applied	apply	VERB
brj-23453	240	11	to	to	ADP
brj-23453	240	12	prunus	prunus	NOUN
brj-23453	240	13	armeniaca	armeniaca	NOUN
brj-23453	240	14	.	.	PUNCT
brj-23453	241	1	the	the	DET
brj-23453	241	2	mean	mean	ADJ
brj-23453	241	3	pic	pic	NOUN
brj-23453	241	4	value	value	NOUN
brj-23453	241	5	,	,	PUNCT
brj-23453	241	6	as	as	SCONJ
brj-23453	241	7	reported	report	VERB
brj-23453	241	8	by	by	ADP
brj-23453	241	9	shah	shah	PROPN
brj-23453	241	10	et	et	PROPN
brj-23453	241	11	al	al	PROPN
brj-23453	241	12	.	.	PROPN
brj-23453	241	13	(	(	PUNCT
brj-23453	241	14	2018	2018	NUM
brj-23453	241	15	)	)	PUNCT
brj-23453	241	16	,	,	PUNCT
brj-23453	241	17	was	be	AUX
brj-23453	241	18	0.168	0.168	NUM
brj-23453	241	19	.	.	PUNCT
brj-23453	242	1	persian	persian	ADJ
brj-23453	242	2	walnut	walnut	NOUN
brj-23453	242	3	populations	population	NOUN
brj-23453	242	4	in	in	ADP
brj-23453	242	5	iran	iran	PROPN
brj-23453	242	6	were	be	AUX
brj-23453	242	7	investigated	investigate	VERB
brj-23453	242	8	and	and	CCONJ
brj-23453	242	9	pic	pic	NOUN
brj-23453	242	10	values	value	NOUN
brj-23453	242	11	identified	identify	VERB
brj-23453	242	12	that	that	PRON
brj-23453	242	13	varied	vary	VERB
brj-23453	242	14	between	between	ADP
brj-23453	242	15	0.56	0.56	NUM
brj-23453	242	16	and	and	CCONJ
brj-23453	242	17	0.82	0.82	NUM
brj-23453	242	18	.	.	PUNCT
brj-23453	243	1	(	(	PUNCT
brj-23453	243	2	2015	2015	NUM
brj-23453	243	3	)	)	PUNCT
brj-23453	243	4	.	.	PUNCT
brj-23453	244	1	this	this	PRON
brj-23453	244	2	is	be	AUX
brj-23453	244	3	consistent	consistent	ADJ
brj-23453	244	4	with	with	ADP
brj-23453	244	5	the	the	DET
brj-23453	244	6	findings	finding	NOUN
brj-23453	244	7	of	of	ADP
brj-23453	244	8	orhan	orhan	PROPN
brj-23453	244	9	et	et	PROPN
brj-23453	244	10	al	al	PROPN
brj-23453	244	11	.	.	PROPN
brj-23453	245	1	(	(	PUNCT
brj-23453	245	2	2020	2020	NUM
brj-23453	245	3	)	)	PUNCT
brj-23453	245	4	,	,	PUNCT
brj-23453	245	5	who	who	PRON
brj-23453	245	6	obtained	obtain	VERB
brj-23453	245	7	an	an	DET
brj-23453	245	8	average	average	ADJ
brj-23453	245	9	pic	pic	NOUN
brj-23453	245	10	value	value	NOUN
brj-23453	245	11	of	of	ADP
brj-23453	245	12	0.68	0.68	NUM
brj-23453	245	13	across	across	ADP
brj-23453	245	14	32	32	NUM
brj-23453	245	15	walnut	walnut	NOUN
brj-23453	245	16	genotypes	genotype	NOUN
brj-23453	245	17	using	use	VERB
brj-23453	245	18	21	21	NUM
brj-23453	245	19	ssr	ssr	ADJ
brj-23453	245	20	markers	marker	NOUN
brj-23453	245	21	.	.	PUNCT
brj-23453	246	1	potential	potential	ADJ
brj-23453	246	2	causes	cause	NOUN
brj-23453	246	3	for	for	ADP
brj-23453	246	4	the	the	DET
brj-23453	246	5	inconsistencies	inconsistency	NOUN
brj-23453	246	6	in	in	ADP
brj-23453	246	7	these	these	DET
brj-23453	246	8	results	result	NOUN
brj-23453	246	9	include	include	VERB
brj-23453	246	10	the	the	DET
brj-23453	246	11	use	use	NOUN
brj-23453	246	12	of	of	ADP
brj-23453	246	13	a	a	DET
brj-23453	246	14	distinct	distinct	ADJ
brj-23453	246	15	set	set	NOUN
brj-23453	246	16	of	of	ADP
brj-23453	246	17	ssr	ssr	PROPN
brj-23453	246	18	markers	marker	NOUN
brj-23453	246	19	and	and	CCONJ
brj-23453	246	20	the	the	DET
brj-23453	246	21	examination	examination	NOUN
brj-23453	246	22	of	of	ADP
brj-23453	246	23	separate	separate	ADJ
brj-23453	246	24	genotypes	genotype	NOUN
brj-23453	246	25	.	.	PUNCT
brj-23453	247	1	informational	informational	ADJ
brj-23453	247	2	markers	marker	NOUN
brj-23453	247	3	include	include	VERB
brj-23453	247	4	loci	locus	NOUN
brj-23453	247	5	with	with	ADP
brj-23453	247	6	a	a	DET
brj-23453	247	7	pic	pic	NOUN
brj-23453	247	8	value	value	NOUN
brj-23453	247	9	greater	great	ADJ
brj-23453	247	10	than	than	ADP
brj-23453	247	11	0.5	0.5	NUM
brj-23453	247	12	,	,	PUNCT
brj-23453	247	13	whereas	whereas	SCONJ
brj-23453	247	14	loci	locus	NOUN
brj-23453	247	15	with	with	ADP
brj-23453	247	16	a	a	DET
brj-23453	247	17	pic	pic	NOUN
brj-23453	247	18	value	value	NOUN
brj-23453	247	19	greater	great	ADJ
brj-23453	247	20	than	than	ADP
brj-23453	247	21	0.7	0.7	NUM
brj-23453	247	22	are	be	AUX
brj-23453	247	23	deemed	deem	VERB
brj-23453	247	24	optimal	optimal	ADJ
brj-23453	247	25	for	for	ADP
brj-23453	247	26	mapping	mapping	NOUN
brj-23453	247	27	.	.	PUNCT
brj-23453	248	1	primer	primer	PROPN
brj-23453	248	2	wga-332	wga-332	PROPN
brj-23453	248	3	exhibited	exhibit	VERB
brj-23453	248	4	the	the	DET
brj-23453	248	5	maximum	maximum	ADJ
brj-23453	248	6	rp	rp	NOUN
brj-23453	248	7	(	(	PUNCT
brj-23453	248	8	resolving	resolve	VERB
brj-23453	248	9	power	power	NOUN
brj-23453	248	10	)	)	PUNCT
brj-23453	248	11	in	in	ADP
brj-23453	248	12	this	this	DET
brj-23453	248	13	investigation	investigation	NOUN
brj-23453	248	14	at	at	ADP
brj-23453	248	15	2.12	2.12	NUM
brj-23453	248	16	,	,	PUNCT
brj-23453	248	17	while	while	SCONJ
brj-23453	248	18	primer	primer	NOUN
brj-23453	248	19	wga-72	wga-72	NOUN
brj-23453	248	20	displayed	display	VERB
brj-23453	248	21	the	the	DET
brj-23453	248	22	lowest	low	ADJ
brj-23453	248	23	rp	rp	NOUN
brj-23453	248	24	(	(	PUNCT
brj-23453	248	25	resolving	resolve	VERB
brj-23453	248	26	power	power	NOUN
brj-23453	248	27	)	)	PUNCT
brj-23453	248	28	at	at	ADP
brj-23453	248	29	0.44	0.44	NUM
brj-23453	248	30	.	.	PUNCT
brj-23453	249	1	the	the	DET
brj-23453	249	2	method	method	NOUN
brj-23453	249	3	of	of	ADP
brj-23453	249	4	rp	rp	NOUN
brj-23453	249	5	is	be	AUX
brj-23453	249	6	a	a	DET
brj-23453	249	7	valuable	valuable	ADJ
brj-23453	249	8	approach	approach	NOUN
brj-23453	249	9	to	to	ADP
brj-23453	249	10	assessing	assess	VERB
brj-23453	249	11	the	the	DET
brj-23453	249	12	discriminatory	discriminatory	ADJ
brj-23453	249	13	power	power	NOUN
brj-23453	249	14	of	of	ADP
brj-23453	249	15	a	a	DET
brj-23453	249	16	primer	primer	NOUN
brj-23453	249	17	against	against	ADP
brj-23453	249	18	various	various	ADJ
brj-23453	249	19	genotypes	genotype	NOUN
brj-23453	249	20	(	(	PUNCT
brj-23453	249	21	shah	shah	PROPN
brj-23453	249	22	et	et	PROPN
brj-23453	249	23	al	al	PROPN
brj-23453	249	24	.	.	PROPN
brj-23453	249	25	2018	2018	NUM
brj-23453	249	26	)	)	PUNCT
brj-23453	249	27	.	.	PUNCT
brj-23453	250	1	furthermore	furthermore	ADV
brj-23453	250	2	,	,	PUNCT
brj-23453	250	3	the	the	DET
brj-23453	250	4	current	current	ADJ
brj-23453	250	5	report	report	NOUN
brj-23453	250	6	provides	provide	VERB
brj-23453	250	7	comprehensive	comprehensive	ADJ
brj-23453	250	8	documentation	documentation	NOUN
brj-23453	250	9	of	of	ADP
brj-23453	250	10	genetic	genetic	ADJ
brj-23453	250	11	diversity	diversity	NOUN
brj-23453	250	12	metrics	metric	NOUN
brj-23453	250	13	,	,	PUNCT
brj-23453	250	14	including	include	VERB
brj-23453	250	15	the	the	DET
brj-23453	250	16	effective	effective	ADJ
brj-23453	250	17	number	number	NOUN
brj-23453	250	18	of	of	ADP
brj-23453	250	19	alleles	allele	NOUN
brj-23453	250	20	,	,	PUNCT
brj-23453	250	21	observed	observed	ADJ
brj-23453	250	22	heterozygosity	heterozygosity	NOUN
brj-23453	250	23	,	,	PUNCT
brj-23453	250	24	anticipated	anticipate	VERB
brj-23453	250	25	heterozygosity	heterozygosity	NOUN
brj-23453	250	26	,	,	PUNCT
brj-23453	250	27	and	and	CCONJ
brj-23453	250	28	unbiased	unbiased	ADJ
brj-23453	250	29	heterozygosity	heterozygosity	NOUN
brj-23453	250	30	,	,	PUNCT
brj-23453	250	31	as	as	ADV
brj-23453	250	32	well	well	ADV
brj-23453	250	33	as	as	ADP
brj-23453	250	34	gene	gene	NOUN
brj-23453	250	35	diversity	diversity	NOUN
brj-23453	250	36	.	.	PUNCT
brj-23453	251	1	the	the	DET
brj-23453	251	2	calculated	calculate	VERB
brj-23453	251	3	values	value	NOUN
brj-23453	251	4	for	for	ADP
brj-23453	251	5	the	the	DET
brj-23453	251	6	observed	observed	ADJ
brj-23453	251	7	na	na	X
brj-23453	251	8	and	and	CCONJ
brj-23453	251	9	ne	ne	PROPN
brj-23453	251	10	were	be	AUX
brj-23453	251	11	2.94	2.94	NUM
brj-23453	251	12	and	and	CCONJ
brj-23453	251	13	1.37	1.37	NUM
brj-23453	251	14	,	,	PUNCT
brj-23453	251	15	respectively	respectively	ADV
brj-23453	251	16	.	.	PUNCT
brj-23453	252	1	li	li	PROPN
brj-23453	252	2	et	et	PROPN
brj-23453	252	3	al	al	PROPN
brj-23453	252	4	.	.	PROPN
brj-23453	253	1	(	(	PUNCT
brj-23453	253	2	2014	2014	NUM
brj-23453	253	3	)	)	PUNCT
brj-23453	253	4	identified	identify	VERB
brj-23453	253	5	4	4	NUM
brj-23453	253	6	to	to	PART
brj-23453	253	7	2	2	NUM
brj-23453	253	8	allelic	allelic	ADJ
brj-23453	253	9	peer	peer	NOUN
brj-23453	253	10	-	-	PUNCT
brj-23453	253	11	reviewed	review	VERB
brj-23453	253	12	article	article	NOUN
brj-23453	253	13	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	254	1	wani	wani	PROPN
brj-23453	254	2	et	et	PROPN
brj-23453	254	3	al	al	PROPN
brj-23453	254	4	.	.	PROPN
brj-23453	254	5	(	(	PUNCT
brj-23453	254	6	2024	2024	NUM
brj-23453	254	7	)	)	PUNCT
brj-23453	254	8	.	.	PUNCT
brj-23453	255	1	“	"	PUNCT
brj-23453	255	2	walnut	walnut	ADJ
brj-23453	255	3	population	population	NOUN
brj-23453	255	4	&	&	CCONJ
brj-23453	255	5	diversity	diversity	NOUN
brj-23453	255	6	,	,	PUNCT
brj-23453	255	7	”	"	PUNCT
brj-23453	255	8	bioresources	bioresource	NOUN
brj-23453	255	9	19(3	19(3	NUM
brj-23453	255	10	)	)	PUNCT
brj-23453	255	11	,	,	PUNCT
brj-23453	255	12	4213	4213	NUM
brj-23453	255	13	-	-	SYM
brj-23453	255	14	4237	4237	NUM
brj-23453	255	15	.	.	PUNCT
brj-23453	256	1	4224	4224	NUM
brj-23453	256	2	numbers	number	NOUN
brj-23453	256	3	and	and	CCONJ
brj-23453	256	4	ne	ne	X
brj-23453	256	5	in	in	ADP
brj-23453	256	6	apricots	apricot	NOUN
brj-23453	256	7	and	and	CCONJ
brj-23453	256	8	walnuts	walnut	NOUN
brj-23453	256	9	,	,	PUNCT
brj-23453	256	10	respectively	respectively	ADV
brj-23453	256	11	(	(	PUNCT
brj-23453	256	12	4.5	4.5	NUM
brj-23453	256	13	and	and	CCONJ
brj-23453	256	14	3.7	3.7	NUM
brj-23453	256	15	)	)	PUNCT
brj-23453	256	16	.	.	PUNCT
brj-23453	257	1	the	the	DET
brj-23453	257	2	average	average	ADJ
brj-23453	257	3	shannon	shannon	PROPN
brj-23453	257	4	’s	’s	PART
brj-23453	257	5	information	information	NOUN
brj-23453	257	6	index	index	NOUN
brj-23453	257	7	value	value	NOUN
brj-23453	257	8	for	for	ADP
brj-23453	257	9	the	the	DET
brj-23453	257	10	microsatellite	microsatellite	ADJ
brj-23453	257	11	primers	primer	NOUN
brj-23453	257	12	utilized	utilize	VERB
brj-23453	257	13	in	in	ADP
brj-23453	257	14	the	the	DET
brj-23453	257	15	current	current	ADJ
brj-23453	257	16	study	study	NOUN
brj-23453	257	17	was	be	AUX
brj-23453	257	18	1.45	1.45	NUM
brj-23453	257	19	,	,	PUNCT
brj-23453	257	20	which	which	PRON
brj-23453	257	21	is	be	AUX
brj-23453	257	22	comparable	comparable	ADJ
brj-23453	257	23	to	to	ADP
brj-23453	257	24	the	the	DET
brj-23453	257	25	values	value	NOUN
brj-23453	257	26	reported	report	VERB
brj-23453	257	27	by	by	ADP
brj-23453	257	28	ebrahimi	ebrahimi	PROPN
brj-23453	257	29	et	et	PROPN
brj-23453	257	30	al	al	PROPN
brj-23453	257	31	.	.	PROPN
brj-23453	258	1	(	(	PUNCT
brj-23453	258	2	2016	2016	NUM
brj-23453	258	3	)	)	PUNCT
brj-23453	258	4	for	for	ADP
brj-23453	258	5	walnut	walnut	ADJ
brj-23453	258	6	populations	population	NOUN
brj-23453	258	7	in	in	ADP
brj-23453	258	8	southeast	southeast	ADJ
brj-23453	258	9	iran	iran	PROPN
brj-23453	258	10	(	(	PUNCT
brj-23453	258	11	i	i	NOUN
brj-23453	258	12	=	=	NOUN
brj-23453	258	13	1.49	1.49	NUM
brj-23453	258	14	)	)	PUNCT
brj-23453	258	15	and	and	CCONJ
brj-23453	258	16	walnut	walnut	NOUN
brj-23453	258	17	accessions	accession	NOUN
brj-23453	258	18	from	from	ADP
brj-23453	258	19	europe	europe	PROPN
brj-23453	258	20	,	,	PUNCT
brj-23453	258	21	africa	africa	PROPN
brj-23453	258	22	,	,	PUNCT
brj-23453	258	23	and	and	CCONJ
brj-23453	258	24	asia	asia	PROPN
brj-23453	258	25	(	(	PUNCT
brj-23453	258	26	i	i	NOUN
brj-23453	258	27	=	=	NOUN
brj-23453	258	28	1.22	1.22	NUM
brj-23453	258	29	)	)	PUNCT
brj-23453	258	30	.	.	PUNCT
brj-23453	259	1	furthermore	furthermore	ADV
brj-23453	259	2	,	,	PUNCT
brj-23453	259	3	the	the	DET
brj-23453	259	4	values	value	NOUN
brj-23453	259	5	are	be	AUX
brj-23453	259	6	nearly	nearly	ADV
brj-23453	259	7	identical	identical	ADJ
brj-23453	259	8	(	(	PUNCT
brj-23453	259	9	i	i	NOUN
brj-23453	259	10	=	=	NOUN
brj-23453	259	11	1.05	1.05	NUM
brj-23453	259	12	)	)	PUNCT
brj-23453	259	13	as	as	SCONJ
brj-23453	259	14	reported	report	VERB
brj-23453	259	15	by	by	ADP
brj-23453	259	16	bourguiba	bourguiba	PROPN
brj-23453	259	17	et	et	PROPN
brj-23453	259	18	al	al	PROPN
brj-23453	259	19	.	.	PROPN
brj-23453	260	1	(	(	PUNCT
brj-23453	260	2	2010	2010	NUM
brj-23453	260	3	)	)	PUNCT
brj-23453	260	4	.	.	PUNCT
brj-23453	261	1	the	the	DET
brj-23453	261	2	mean	mean	ADJ
brj-23453	261	3	ho	ho	PROPN
brj-23453	261	4	value	value	NOUN
brj-23453	261	5	of	of	ADP
brj-23453	261	6	0.15	0.15	NUM
brj-23453	261	7	indicates	indicate	VERB
brj-23453	261	8	that	that	SCONJ
brj-23453	261	9	the	the	DET
brj-23453	261	10	population	population	NOUN
brj-23453	261	11	under	under	ADP
brj-23453	261	12	observation	observation	NOUN
brj-23453	261	13	has	have	VERB
brj-23453	261	14	the	the	DET
brj-23453	261	15	greatest	great	ADJ
brj-23453	261	16	degree	degree	NOUN
brj-23453	261	17	of	of	ADP
brj-23453	261	18	genetic	genetic	ADJ
brj-23453	261	19	diversity	diversity	NOUN
brj-23453	261	20	and	and	CCONJ
brj-23453	261	21	may	may	AUX
brj-23453	261	22	contain	contain	VERB
brj-23453	261	23	a	a	DET
brj-23453	261	24	greater	great	ADJ
brj-23453	261	25	number	number	NOUN
brj-23453	261	26	of	of	ADP
brj-23453	261	27	genetic	genetic	ADJ
brj-23453	261	28	variants	variant	NOUN
brj-23453	261	29	of	of	ADP
brj-23453	261	30	crucial	crucial	ADJ
brj-23453	261	31	adaptive	adaptive	ADJ
brj-23453	261	32	characteristics	characteristic	NOUN
brj-23453	261	33	,	,	PUNCT
brj-23453	261	34	as	as	SCONJ
brj-23453	261	35	it	it	PRON
brj-23453	261	36	ranged	range	VERB
brj-23453	261	37	from	from	ADP
brj-23453	261	38	0.03	0.03	NUM
brj-23453	261	39	to	to	ADP
brj-23453	261	40	0.44	0.44	NUM
brj-23453	261	41	.	.	PUNCT
brj-23453	262	1	as	as	SCONJ
brj-23453	262	2	mentioned	mention	VERB
brj-23453	262	3	earlier	early	ADV
brj-23453	262	4	,	,	PUNCT
brj-23453	262	5	the	the	DET
brj-23453	262	6	mean	mean	ADJ
brj-23453	262	7	fst	fst	NOUN
brj-23453	262	8	estimate	estimate	NOUN
brj-23453	262	9	for	for	ADP
brj-23453	262	10	each	each	DET
brj-23453	262	11	locus	locus	NOUN
brj-23453	262	12	examined	examine	VERB
brj-23453	262	13	was	be	AUX
brj-23453	262	14	0.219	0.219	NUM
brj-23453	262	15	,	,	PUNCT
brj-23453	262	16	with	with	ADP
brj-23453	262	17	a	a	DET
brj-23453	262	18	range	range	NOUN
brj-23453	262	19	of	of	ADP
brj-23453	262	20	0.156	0.156	NUM
brj-23453	262	21	to	to	ADP
brj-23453	262	22	0.343	0.343	NUM
brj-23453	262	23	.	.	PUNCT
brj-23453	263	1	the	the	DET
brj-23453	263	2	population	population	NOUN
brj-23453	263	3	exhibited	exhibit	VERB
brj-23453	263	4	a	a	DET
brj-23453	263	5	range	range	NOUN
brj-23453	263	6	of	of	ADP
brj-23453	263	7	inbreeding	inbreede	VERB
brj-23453	263	8	levels	level	NOUN
brj-23453	263	9	(	(	PUNCT
brj-23453	263	10	fis	fis	PROPN
brj-23453	263	11	)	)	PUNCT
brj-23453	263	12	between	between	ADP
brj-23453	263	13	0.013	0.013	NUM
brj-23453	263	14	and	and	CCONJ
brj-23453	263	15	0.691	0.691	NUM
brj-23453	263	16	,	,	PUNCT
brj-23453	263	17	with	with	ADP
brj-23453	263	18	an	an	DET
brj-23453	263	19	average	average	ADJ
brj-23453	263	20	value	value	NOUN
brj-23453	263	21	of	of	ADP
brj-23453	263	22	0.188	0.188	NUM
brj-23453	263	23	.	.	PUNCT
brj-23453	264	1	the	the	DET
brj-23453	264	2	minimum	minimum	ADJ
brj-23453	264	3	value	value	NOUN
brj-23453	264	4	of	of	ADP
brj-23453	264	5	fit	fit	ADJ
brj-23453	264	6	(	(	PUNCT
brj-23453	264	7	total	total	ADJ
brj-23453	264	8	inbreeding	inbreede	VERB
brj-23453	264	9	coefficient	coefficient	NOUN
brj-23453	264	10	)	)	PUNCT
brj-23453	264	11	was	be	AUX
brj-23453	264	12	0.167	0.167	NUM
brj-23453	264	13	in	in	ADP
brj-23453	264	14	wga-76	wga-76	NOUN
brj-23453	264	15	and	and	CCONJ
brj-23453	264	16	the	the	DET
brj-23453	264	17	maximum	maximum	ADJ
brj-23453	264	18	value	value	NOUN
brj-23453	264	19	was	be	AUX
brj-23453	264	20	0.756	0.756	NUM
brj-23453	264	21	in	in	ADP
brj-23453	264	22	wga4	wga4	NOUN
brj-23453	264	23	.	.	PUNCT
brj-23453	265	1	the	the	DET
brj-23453	265	2	largest	large	ADJ
brj-23453	265	3	gene	gene	NOUN
brj-23453	265	4	flow	flow	NOUN
brj-23453	265	5	(	(	PUNCT
brj-23453	265	6	1.352	1.352	NUM
brj-23453	265	7	)	)	PUNCT
brj-23453	265	8	was	be	AUX
brj-23453	265	9	identified	identify	VERB
brj-23453	265	10	in	in	ADP
brj-23453	265	11	wga-4	wga-4	NOUN
brj-23453	265	12	,	,	PUNCT
brj-23453	265	13	followed	follow	VERB
brj-23453	265	14	by	by	ADP
brj-23453	265	15	wga-225	wga-225	PROPN
brj-23453	265	16	(	(	PUNCT
brj-23453	265	17	table	table	NOUN
brj-23453	265	18	s3	s3	PROPN
brj-23453	265	19	)	)	PUNCT
brj-23453	265	20	,	,	PUNCT
brj-23453	265	21	whereas	whereas	SCONJ
brj-23453	265	22	the	the	DET
brj-23453	265	23	smallest	small	ADJ
brj-23453	265	24	gene	gene	NOUN
brj-23453	265	25	flow	flow	NOUN
brj-23453	265	26	(	(	PUNCT
brj-23453	265	27	nm	nm	NOUN
brj-23453	265	28	=	=	NOUN
brj-23453	265	29	0.479	0.479	NUM
brj-23453	265	30	)	)	PUNCT
brj-23453	265	31	was	be	AUX
brj-23453	265	32	identified	identify	VERB
brj-23453	265	33	in	in	ADP
brj-23453	265	34	wga-76	wga-76	NOUN
brj-23453	265	35	.	.	PUNCT
brj-23453	266	1	the	the	DET
brj-23453	266	2	lowest	low	ADJ
brj-23453	266	3	degree	degree	NOUN
brj-23453	266	4	of	of	ADP
brj-23453	266	5	heterozygosity	heterozygosity	NOUN
brj-23453	266	6	(	(	PUNCT
brj-23453	266	7	fst	fst	NOUN
brj-23453	266	8	)	)	PUNCT
brj-23453	266	9	was	be	AUX
brj-23453	266	10	observed	observe	VERB
brj-23453	266	11	in	in	ADP
brj-23453	266	12	wga-4	wga-4	NOUN
brj-23453	266	13	.	.	PUNCT
brj-23453	267	1	fst	fst	NOUN
brj-23453	267	2	values	value	NOUN
brj-23453	267	3	that	that	PRON
brj-23453	267	4	are	be	AUX
brj-23453	267	5	positive	positive	ADJ
brj-23453	267	6	are	be	AUX
brj-23453	267	7	commonly	commonly	ADV
brj-23453	267	8	interpreted	interpret	VERB
brj-23453	267	9	as	as	ADP
brj-23453	267	10	indicators	indicator	NOUN
brj-23453	267	11	of	of	ADP
brj-23453	267	12	genetic	genetic	ADJ
brj-23453	267	13	divergence	divergence	NOUN
brj-23453	267	14	or	or	CCONJ
brj-23453	267	15	structure	structure	NOUN
brj-23453	267	16	among	among	ADP
brj-23453	267	17	subpopulations	subpopulation	NOUN
brj-23453	267	18	.	.	PUNCT
brj-23453	268	1	this	this	DET
brj-23453	268	2	divergence	divergence	NOUN
brj-23453	268	3	can	can	AUX
brj-23453	268	4	occur	occur	VERB
brj-23453	268	5	due	due	ADJ
brj-23453	268	6	to	to	ADP
brj-23453	268	7	factors	factor	NOUN
brj-23453	268	8	,	,	PUNCT
brj-23453	268	9	such	such	ADJ
brj-23453	268	10	as	as	ADP
brj-23453	268	11	drift	drift	NOUN
brj-23453	268	12	,	,	PUNCT
brj-23453	268	13	assortative	assortative	ADJ
brj-23453	268	14	mating	mating	NOUN
brj-23453	268	15	,	,	PUNCT
brj-23453	268	16	or	or	CCONJ
brj-23453	268	17	natural	natural	ADJ
brj-23453	268	18	selection	selection	NOUN
brj-23453	268	19	,	,	PUNCT
brj-23453	268	20	all	all	PRON
brj-23453	268	21	of	of	ADP
brj-23453	268	22	which	which	PRON
brj-23453	268	23	are	be	AUX
brj-23453	268	24	facilitated	facilitate	VERB
brj-23453	268	25	by	by	ADP
brj-23453	268	26	the	the	DET
brj-23453	268	27	restriction	restriction	NOUN
brj-23453	268	28	of	of	ADP
brj-23453	268	29	gene	gene	NOUN
brj-23453	268	30	flow	flow	NOUN
brj-23453	268	31	between	between	ADP
brj-23453	268	32	populations	population	NOUN
brj-23453	268	33	.	.	PUNCT
brj-23453	269	1	almost	almost	ADV
brj-23453	269	2	every	every	DET
brj-23453	269	3	tree	tree	NOUN
brj-23453	269	4	species	specie	NOUN
brj-23453	269	5	that	that	PRON
brj-23453	269	6	undergo	undergo	VERB
brj-23453	269	7	wind	wind	NOUN
brj-23453	269	8	pollination	pollination	NOUN
brj-23453	269	9	has	have	AUX
brj-23453	269	10	been	be	AUX
brj-23453	269	11	investigated	investigate	VERB
brj-23453	269	12	.	.	PUNCT
brj-23453	270	1	the	the	DET
brj-23453	270	2	heterozygote	heterozygote	NOUN
brj-23453	270	3	deficit	deficit	NOUN
brj-23453	270	4	was	be	AUX
brj-23453	270	5	significant	significant	ADJ
brj-23453	270	6	at	at	ADP
brj-23453	270	7	each	each	PRON
brj-23453	270	8	of	of	ADP
brj-23453	270	9	the	the	DET
brj-23453	270	10	polymorphism	polymorphism	NOUN
brj-23453	270	11	loci	locus	NOUN
brj-23453	270	12	,	,	PUNCT
brj-23453	270	13	as	as	SCONJ
brj-23453	270	14	indicated	indicate	VERB
brj-23453	270	15	by	by	ADP
brj-23453	270	16	the	the	DET
brj-23453	270	17	inbreeding	inbreede	VERB
brj-23453	270	18	coefficient	coefficient	NOUN
brj-23453	270	19	(	(	PUNCT
brj-23453	270	20	fis	fis	PROPN
brj-23453	270	21	=	=	PUNCT
brj-23453	270	22	0.691	0.691	NUM
brj-23453	270	23	,	,	PUNCT
brj-23453	270	24	table	table	NOUN
brj-23453	270	25	s3	s3	PROPN
brj-23453	270	26	)	)	PUNCT
brj-23453	270	27	.	.	PUNCT
brj-23453	271	1	this	this	DET
brj-23453	271	2	phenomenon	phenomenon	NOUN
brj-23453	271	3	was	be	AUX
brj-23453	271	4	ascribed	ascribe	VERB
brj-23453	271	5	to	to	ADP
brj-23453	271	6	high	high	ADJ
brj-23453	271	7	levels	level	NOUN
brj-23453	271	8	of	of	ADP
brj-23453	271	9	inbreeding	inbreede	VERB
brj-23453	271	10	at	at	ADP
brj-23453	271	11	every	every	DET
brj-23453	271	12	locus	locus	NOUN
brj-23453	271	13	that	that	PRON
brj-23453	271	14	was	be	AUX
brj-23453	271	15	examined	examine	VERB
brj-23453	271	16	.	.	PUNCT
brj-23453	272	1	moreover	moreover	ADV
brj-23453	272	2	,	,	PUNCT
brj-23453	272	3	the	the	DET
brj-23453	272	4	inbreeding	inbreede	VERB
brj-23453	272	5	coefficient	coefficient	NOUN
brj-23453	272	6	across	across	ADP
brj-23453	272	7	populations	population	NOUN
brj-23453	272	8	(	(	PUNCT
brj-23453	272	9	0.691	0.691	NUM
brj-23453	272	10	)	)	PUNCT
brj-23453	272	11	was	be	AUX
brj-23453	272	12	lower	low	ADJ
brj-23453	272	13	than	than	ADP
brj-23453	272	14	the	the	DET
brj-23453	272	15	overall	overall	ADJ
brj-23453	272	16	inbreeding	inbreede	VERB
brj-23453	272	17	coefficient	coefficient	NOUN
brj-23453	272	18	(	(	PUNCT
brj-23453	272	19	fit	fit	NOUN
brj-23453	272	20	=	=	NOUN
brj-23453	272	21	0.756	0.756	NUM
brj-23453	272	22	)	)	PUNCT
brj-23453	272	23	.	.	PUNCT
brj-23453	273	1	the	the	DET
brj-23453	273	2	wahlund	wahlund	NOUN
brj-23453	273	3	effect	effect	NOUN
brj-23453	273	4	led	lead	VERB
brj-23453	273	5	to	to	ADP
brj-23453	273	6	an	an	DET
brj-23453	273	7	underestimation	underestimation	NOUN
brj-23453	273	8	of	of	ADP
brj-23453	273	9	the	the	DET
brj-23453	273	10	mean	mean	ADJ
brj-23453	273	11	genetic	genetic	ADJ
brj-23453	273	12	variability	variability	NOUN
brj-23453	273	13	in	in	ADP
brj-23453	273	14	this	this	DET
brj-23453	273	15	study	study	NOUN
brj-23453	273	16	.	.	PUNCT
brj-23453	274	1	the	the	DET
brj-23453	274	2	wahlund	wahlund	ADJ
brj-23453	274	3	effect	effect	NOUN
brj-23453	274	4	is	be	AUX
brj-23453	274	5	a	a	DET
brj-23453	274	6	consequence	consequence	NOUN
brj-23453	274	7	of	of	ADP
brj-23453	274	8	restricted	restricted	ADJ
brj-23453	274	9	gene	gene	NOUN
brj-23453	274	10	flow	flow	NOUN
brj-23453	274	11	leading	lead	VERB
brj-23453	274	12	to	to	ADP
brj-23453	274	13	population	population	NOUN
brj-23453	274	14	fragmentation	fragmentation	NOUN
brj-23453	274	15	(	(	PUNCT
brj-23453	274	16	hartel	hartel	NOUN
brj-23453	274	17	and	and	CCONJ
brj-23453	274	18	clark	clark	NOUN
brj-23453	274	19	2007	2007	NUM
brj-23453	274	20	)	)	PUNCT
brj-23453	274	21	.	.	PUNCT
brj-23453	275	1	in	in	ADP
brj-23453	275	2	anemophilic	anemophilic	PROPN
brj-23453	275	3	species	species	PROPN
brj-23453	275	4	,	,	PUNCT
brj-23453	275	5	fis	fis	PROPN
brj-23453	275	6	and	and	CCONJ
brj-23453	275	7	fst	fst	NOUN
brj-23453	275	8	estimates	estimate	NOUN
brj-23453	275	9	continue	continue	VERB
brj-23453	275	10	to	to	PART
brj-23453	275	11	be	be	AUX
brj-23453	275	12	extremely	extremely	ADV
brj-23453	275	13	prominent	prominent	ADJ
brj-23453	275	14	,	,	PUNCT
brj-23453	275	15	indicating	indicate	VERB
brj-23453	275	16	substantial	substantial	ADJ
brj-23453	275	17	inbreeding	inbreeding	NOUN
brj-23453	275	18	.	.	PUNCT
brj-23453	276	1	the	the	DET
brj-23453	276	2	results	result	NOUN
brj-23453	276	3	of	of	ADP
brj-23453	276	4	the	the	DET
brj-23453	276	5	current	current	ADJ
brj-23453	276	6	investigation	investigation	NOUN
brj-23453	276	7	indicate	indicate	VERB
brj-23453	276	8	that	that	SCONJ
brj-23453	276	9	walnut	walnut	ADJ
brj-23453	276	10	genotypes	genotype	NOUN
brj-23453	276	11	(	(	PUNCT
brj-23453	276	12	seed	seed	NOUN
brj-23453	276	13	propagated	propagate	VERB
brj-23453	276	14	)	)	PUNCT
brj-23453	276	15	exhibit	exhibit	VERB
brj-23453	276	16	a	a	DET
brj-23453	276	17	significant	significant	ADJ
brj-23453	276	18	level	level	NOUN
brj-23453	276	19	of	of	ADP
brj-23453	276	20	heterozygosity	heterozygosity	NOUN
brj-23453	276	21	.	.	PUNCT
brj-23453	277	1	the	the	DET
brj-23453	277	2	heterozygosity	heterozygosity	NOUN
brj-23453	277	3	values	value	NOUN
brj-23453	277	4	we	we	PRON
brj-23453	277	5	observed	observe	VERB
brj-23453	277	6	were	be	AUX
brj-23453	277	7	in	in	ADP
brj-23453	277	8	agreement	agreement	NOUN
brj-23453	277	9	with	with	ADP
brj-23453	277	10	those	those	PRON
brj-23453	277	11	documented	document	VERB
brj-23453	277	12	by	by	ADP
brj-23453	277	13	vahdati	vahdati	NOUN
brj-23453	277	14	et	et	PROPN
brj-23453	277	15	al	al	PROPN
brj-23453	277	16	.	.	PROPN
brj-23453	278	1	(	(	PUNCT
brj-23453	278	2	2015	2015	NUM
brj-23453	278	3	)	)	PUNCT
brj-23453	278	4	and	and	CCONJ
brj-23453	278	5	khokhlov	khokhlov	INTJ
brj-23453	278	6	et	et	PROPN
brj-23453	278	7	al	al	PROPN
brj-23453	278	8	.	.	PROPN
brj-23453	279	1	(	(	PUNCT
brj-23453	279	2	2019	2019	NUM
brj-23453	279	3	)	)	PUNCT
brj-23453	279	4	for	for	ADP
brj-23453	279	5	walnut	walnut	ADJ
brj-23453	279	6	genotypes	genotype	NOUN
brj-23453	279	7	.	.	PUNCT
brj-23453	280	1	those	those	DET
brj-23453	280	2	researchers	researcher	NOUN
brj-23453	280	3	documented	document	VERB
brj-23453	280	4	heterozygosity	heterozygosity	NOUN
brj-23453	280	5	values	value	NOUN
brj-23453	280	6	ranging	range	VERB
brj-23453	280	7	from	from	ADP
brj-23453	280	8	0.00	0.00	NUM
brj-23453	280	9	to	to	ADP
brj-23453	280	10	0.85	0.85	NUM
brj-23453	280	11	and	and	CCONJ
brj-23453	280	12	0.50	0.50	NUM
brj-23453	280	13	to	to	ADP
brj-23453	280	14	0.88	0.88	NUM
brj-23453	280	15	,	,	PUNCT
brj-23453	280	16	with	with	ADP
brj-23453	280	17	mean	mean	ADJ
brj-23453	280	18	values	value	NOUN
brj-23453	280	19	of	of	ADP
brj-23453	280	20	0.23	0.23	NUM
brj-23453	280	21	and	and	CCONJ
brj-23453	280	22	0.73	0.73	NUM
brj-23453	280	23	,	,	PUNCT
brj-23453	280	24	respectively	respectively	ADV
brj-23453	280	25	.	.	PUNCT
brj-23453	281	1	the	the	DET
brj-23453	281	2	current	current	ADJ
brj-23453	281	3	findings	finding	NOUN
brj-23453	281	4	are	be	AUX
brj-23453	281	5	consistent	consistent	ADJ
brj-23453	281	6	with	with	ADP
brj-23453	281	7	the	the	DET
brj-23453	281	8	maximal	maximal	ADJ
brj-23453	281	9	observed	observe	VERB
brj-23453	281	10	heterozygosity	heterozygosity	NOUN
brj-23453	281	11	of	of	ADP
brj-23453	281	12	0.62	0.62	NUM
brj-23453	281	13	reported	report	VERB
brj-23453	281	14	by	by	ADP
brj-23453	281	15	mahmood	mahmood	PROPN
brj-23453	281	16	et	et	PROPN
brj-23453	281	17	al	al	PROPN
brj-23453	281	18	.	.	PROPN
brj-23453	282	1	(	(	PUNCT
brj-23453	282	2	2013	2013	NUM
brj-23453	282	3	)	)	PUNCT
brj-23453	282	4	.	.	PUNCT
brj-23453	283	1	comparable	comparable	ADJ
brj-23453	283	2	to	to	ADP
brj-23453	283	3	the	the	DET
brj-23453	283	4	current	current	ADJ
brj-23453	283	5	findings	finding	NOUN
brj-23453	283	6	,	,	PUNCT
brj-23453	283	7	balapanov	balapanov	PROPN
brj-23453	283	8	et	et	PROPN
brj-23453	283	9	al	al	PROPN
brj-23453	283	10	.	.	PROPN
brj-23453	284	1	(	(	PUNCT
brj-23453	284	2	2019	2019	NUM
brj-23453	284	3	)	)	PUNCT
brj-23453	284	4	examined	examine	VERB
brj-23453	284	5	62	62	NUM
brj-23453	284	6	walnut	walnut	NOUN
brj-23453	284	7	genotypes	genotype	NOUN
brj-23453	284	8	containing	contain	VERB
brj-23453	284	9	11	11	NUM
brj-23453	284	10	microsatellite	microsatellite	ADJ
brj-23453	284	11	loci	locus	NOUN
brj-23453	284	12	and	and	CCONJ
brj-23453	284	13	discovered	discover	VERB
brj-23453	284	14	high	high	ADJ
brj-23453	284	15	levels	level	NOUN
brj-23453	284	16	of	of	ADP
brj-23453	284	17	polymorphism	polymorphism	NOUN
brj-23453	284	18	and	and	CCONJ
brj-23453	284	19	heterozygosity	heterozygosity	NOUN
brj-23453	284	20	,	,	PUNCT
brj-23453	284	21	with	with	ADP
brj-23453	284	22	values	value	NOUN
brj-23453	284	23	ranging	range	VERB
brj-23453	284	24	from	from	ADP
brj-23453	284	25	0.44	0.44	NUM
brj-23453	284	26	to	to	ADP
brj-23453	284	27	0.86	0.86	NUM
brj-23453	284	28	and	and	CCONJ
brj-23453	284	29	a	a	DET
brj-23453	284	30	mean	mean	NOUN
brj-23453	284	31	of	of	ADP
brj-23453	284	32	0.67	0.67	NUM
brj-23453	284	33	.	.	PUNCT
brj-23453	285	1	additionally	additionally	ADV
brj-23453	285	2	,	,	PUNCT
brj-23453	285	3	in	in	ADP
brj-23453	285	4	the	the	DET
brj-23453	285	5	present	present	ADJ
brj-23453	285	6	study	study	NOUN
brj-23453	285	7	,	,	PUNCT
brj-23453	285	8	the	the	DET
brj-23453	285	9	calculated	calculated	ADJ
brj-23453	285	10	mean	mean	ADJ
brj-23453	285	11	value	value	NOUN
brj-23453	285	12	of	of	ADP
brj-23453	285	13	predicted	predict	VERB
brj-23453	285	14	heterozygosity	heterozygosity	NOUN
brj-23453	285	15	was	be	AUX
brj-23453	285	16	0.68	0.68	NUM
brj-23453	285	17	,	,	PUNCT
brj-23453	285	18	ranging	range	VERB
brj-23453	285	19	from	from	ADP
brj-23453	285	20	0.52	0.52	NUM
brj-23453	285	21	to	to	ADP
brj-23453	285	22	0.89	0.89	NUM
brj-23453	285	23	.	.	PUNCT
brj-23453	286	1	the	the	DET
brj-23453	286	2	mean	mean	NOUN
brj-23453	286	3	and	and	CCONJ
brj-23453	286	4	variability	variability	NOUN
brj-23453	286	5	of	of	ADP
brj-23453	286	6	anticipated	anticipate	VERB
brj-23453	286	7	heterozygosity	heterozygosity	NOUN
brj-23453	286	8	values	value	NOUN
brj-23453	286	9	identified	identify	VERB
brj-23453	286	10	in	in	ADP
brj-23453	286	11	this	this	DET
brj-23453	286	12	research	research	NOUN
brj-23453	286	13	align	align	NOUN
brj-23453	286	14	with	with	ADP
brj-23453	286	15	those	those	PRON
brj-23453	286	16	reported	report	VERB
brj-23453	286	17	in	in	ADP
brj-23453	286	18	prior	prior	ADJ
brj-23453	286	19	investigations	investigation	NOUN
brj-23453	286	20	of	of	ADP
brj-23453	286	21	walnut	walnut	ADJ
brj-23453	286	22	genotypes	genotype	NOUN
brj-23453	286	23	(	(	PUNCT
brj-23453	286	24	wang	wang	PROPN
brj-23453	286	25	et	et	PROPN
brj-23453	286	26	al	al	PROPN
brj-23453	286	27	.	.	PROPN
brj-23453	286	28	2008	2008	NUM
brj-23453	286	29	;	;	PUNCT
brj-23453	286	30	ebrahimi	ebrahimi	PROPN
brj-23453	286	31	et	et	PROPN
brj-23453	286	32	al	al	PROPN
brj-23453	286	33	.	.	PROPN
brj-23453	286	34	2011	2011	NUM
brj-23453	286	35	;	;	PUNCT
brj-23453	286	36	0.86	0.86	NUM
brj-23453	286	37	to	to	ADP
brj-23453	286	38	0.87	0.87	NUM
brj-23453	286	39	)	)	PUNCT
brj-23453	286	40	.	.	PUNCT
brj-23453	287	1	the	the	DET
brj-23453	287	2	performance	performance	NOUN
brj-23453	287	3	of	of	ADP
brj-23453	287	4	the	the	DET
brj-23453	287	5	markers	marker	NOUN
brj-23453	287	6	employed	employ	VERB
brj-23453	287	7	in	in	ADP
brj-23453	287	8	this	this	DET
brj-23453	287	9	study	study	NOUN
brj-23453	287	10	in	in	ADP
brj-23453	287	11	differentiating	differentiate	VERB
brj-23453	287	12	21	21	NUM
brj-23453	287	13	walnut	walnut	NOUN
brj-23453	287	14	genotypes	genotype	NOUN
brj-23453	287	15	was	be	AUX
brj-23453	287	16	supported	support	VERB
brj-23453	287	17	by	by	ADP
brj-23453	287	18	the	the	DET
brj-23453	287	19	number	number	NOUN
brj-23453	287	20	of	of	ADP
brj-23453	287	21	effective	effective	ADJ
brj-23453	287	22	alleles	allele	NOUN
brj-23453	287	23	(	(	PUNCT
brj-23453	287	24	ne	ne	NOUN
brj-23453	287	25	)	)	PUNCT
brj-23453	287	26	,	,	PUNCT
brj-23453	287	27	observed	observe	VERB
brj-23453	287	28	heterozygosity	heterozygosity	NOUN
brj-23453	287	29	(	(	PUNCT
brj-23453	287	30	ho	ho	INTJ
brj-23453	287	31	)	)	PUNCT
brj-23453	287	32	,	,	PUNCT
brj-23453	287	33	expected	expect	VERB
brj-23453	287	34	heterozygosity	heterozygosity	NOUN
brj-23453	287	35	(	(	PUNCT
brj-23453	287	36	he	he	PRON
brj-23453	287	37	)	)	PUNCT
brj-23453	287	38	,	,	PUNCT
brj-23453	287	39	and	and	CCONJ
brj-23453	287	40	information	information	NOUN
brj-23453	287	41	index	index	NOUN
brj-23453	287	42	(	(	PUNCT
brj-23453	287	43	i	i	NOUN
brj-23453	287	44	)	)	PUNCT
brj-23453	287	45	.	.	PUNCT
brj-23453	288	1	these	these	DET
brj-23453	288	2	results	result	NOUN
brj-23453	288	3	indicate	indicate	VERB
brj-23453	288	4	that	that	SCONJ
brj-23453	288	5	the	the	DET
brj-23453	288	6	walnut	walnut	NOUN
brj-23453	288	7	germplasm	germplasm	NOUN
brj-23453	288	8	of	of	ADP
brj-23453	288	9	kashmir	kashmir	PROPN
brj-23453	288	10	,	,	PUNCT
brj-23453	288	11	specifically	specifically	ADV
brj-23453	288	12	in	in	ADP
brj-23453	288	13	the	the	DET
brj-23453	288	14	study	study	NOUN
brj-23453	288	15	area	area	NOUN
brj-23453	288	16	of	of	ADP
brj-23453	288	17	budgam	budgam	PROPN
brj-23453	288	18	and	and	CCONJ
brj-23453	288	19	ganderbal	ganderbal	PROPN
brj-23453	288	20	,	,	PUNCT
brj-23453	288	21	possesses	possess	VERB
brj-23453	288	22	a	a	DET
brj-23453	288	23	considerable	considerable	ADJ
brj-23453	288	24	degree	degree	NOUN
brj-23453	288	25	of	of	ADP
brj-23453	288	26	genetic	genetic	ADJ
brj-23453	288	27	diversity	diversity	NOUN
brj-23453	288	28	,	,	PUNCT
brj-23453	288	29	which	which	PRON
brj-23453	288	30	is	be	AUX
brj-23453	288	31	crucial	crucial	ADJ
brj-23453	288	32	for	for	ADP
brj-23453	288	33	the	the	DET
brj-23453	288	34	development	development	NOUN
brj-23453	288	35	,	,	PUNCT
brj-23453	288	36	maintenance	maintenance	NOUN
brj-23453	288	37	,	,	PUNCT
brj-23453	288	38	and	and	CCONJ
brj-23453	288	39	analysis	analysis	NOUN
brj-23453	288	40	of	of	ADP
brj-23453	288	41	parent	parent	NOUN
brj-23453	288	42	mixtures	mixture	NOUN
brj-23453	288	43	for	for	ADP
brj-23453	288	44	plan	plan	NOUN
brj-23453	288	45	implementation	implementation	NOUN
brj-23453	288	46	.	.	PUNCT
brj-23453	289	1	moreover	moreover	ADV
brj-23453	289	2	,	,	PUNCT
brj-23453	289	3	information	information	NOUN
brj-23453	289	4	regarding	regard	VERB
brj-23453	289	5	the	the	DET
brj-23453	289	6	genetic	genetic	ADJ
brj-23453	289	7	relationship	relationship	NOUN
brj-23453	289	8	among	among	ADP
brj-23453	289	9	the	the	DET
brj-23453	289	10	collected	collect	VERB
brj-23453	289	11	germplasm	germplasm	NOUN
brj-23453	289	12	could	could	AUX
brj-23453	289	13	peer	peer	NOUN
brj-23453	289	14	-	-	PUNCT
brj-23453	289	15	reviewed	review	VERB
brj-23453	289	16	article	article	NOUN
brj-23453	289	17	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	289	18	wani	wani	PROPN
brj-23453	289	19	et	et	PROPN
brj-23453	289	20	al	al	PROPN
brj-23453	289	21	.	.	PROPN
brj-23453	290	1	(	(	PUNCT
brj-23453	290	2	2024	2024	NUM
brj-23453	290	3	)	)	PUNCT
brj-23453	290	4	.	.	PUNCT
brj-23453	291	1	“	"	PUNCT
brj-23453	291	2	walnut	walnut	ADJ
brj-23453	291	3	population	population	NOUN
brj-23453	291	4	&	&	CCONJ
brj-23453	291	5	diversity	diversity	NOUN
brj-23453	291	6	,	,	PUNCT
brj-23453	291	7	”	"	PUNCT
brj-23453	291	8	bioresources	bioresource	NOUN
brj-23453	291	9	19(3	19(3	NUM
brj-23453	291	10	)	)	PUNCT
brj-23453	291	11	,	,	PUNCT
brj-23453	291	12	4213	4213	NUM
brj-23453	291	13	-	-	SYM
brj-23453	291	14	4237	4237	NUM
brj-23453	291	15	.	.	PUNCT
brj-23453	291	16	4225	4225	NUM
brj-23453	291	17	potentially	potentially	ADV
brj-23453	291	18	be	be	AUX
brj-23453	291	19	utilized	utilize	VERB
brj-23453	291	20	to	to	PART
brj-23453	291	21	identify	identify	VERB
brj-23453	291	22	parental	parental	ADJ
brj-23453	291	23	and	and	CCONJ
brj-23453	291	24	superior	superior	ADJ
brj-23453	291	25	genotypes	genotype	NOUN
brj-23453	291	26	to	to	PART
brj-23453	291	27	augment	augment	VERB
brj-23453	291	28	genetic	genetic	ADJ
brj-23453	291	29	material	material	NOUN
brj-23453	291	30	and	and	CCONJ
brj-23453	291	31	improve	improve	VERB
brj-23453	291	32	walnut	walnut	ADJ
brj-23453	291	33	germplasm	germplasm	NOUN
brj-23453	291	34	.	.	PUNCT
brj-23453	292	1	the	the	DET
brj-23453	292	2	authors	author	NOUN
brj-23453	292	3	analyzed	analyze	VERB
brj-23453	292	4	the	the	DET
brj-23453	292	5	population	population	NOUN
brj-23453	292	6	structure	structure	NOUN
brj-23453	292	7	,	,	PUNCT
brj-23453	292	8	connectivity	connectivity	NOUN
brj-23453	292	9	,	,	PUNCT
brj-23453	292	10	and	and	CCONJ
brj-23453	292	11	genetic	genetic	ADJ
brj-23453	292	12	diversity	diversity	NOUN
brj-23453	292	13	of	of	ADP
brj-23453	292	14	twenty	twenty	NUM
brj-23453	292	15	-	-	PUNCT
brj-23453	292	16	one	one	NUM
brj-23453	292	17	walnut	walnut	NOUN
brj-23453	292	18	genotypes	genotype	NOUN
brj-23453	292	19	in	in	ADP
brj-23453	292	20	the	the	DET
brj-23453	292	21	current	current	ADJ
brj-23453	292	22	report	report	NOUN
brj-23453	292	23	by	by	ADP
brj-23453	292	24	employing	employ	VERB
brj-23453	292	25	three	three	NUM
brj-23453	292	26	clustering	clustering	ADJ
brj-23453	292	27	techniques	technique	NOUN
brj-23453	292	28	:	:	PUNCT
brj-23453	292	29	the	the	DET
brj-23453	292	30	pcoa	pcoa	NOUN
brj-23453	292	31	plot	plot	NOUN
brj-23453	292	32	,	,	PUNCT
brj-23453	292	33	the	the	DET
brj-23453	292	34	neighbor	neighbor	NOUN
brj-23453	292	35	-	-	PUNCT
brj-23453	292	36	joining	join	VERB
brj-23453	292	37	(	(	PUNCT
brj-23453	292	38	nj	nj	PROPN
brj-23453	292	39	)	)	PUNCT
brj-23453	292	40	dendrogram	dendrogram	NOUN
brj-23453	292	41	,	,	PUNCT
brj-23453	292	42	and	and	CCONJ
brj-23453	292	43	population	population	NOUN
brj-23453	292	44	structure	structure	NOUN
brj-23453	292	45	analysis	analysis	NOUN
brj-23453	292	46	.	.	PUNCT
brj-23453	293	1	the	the	DET
brj-23453	293	2	dendrogram	dendrogram	NOUN
brj-23453	293	3	derived	derive	VERB
brj-23453	293	4	from	from	ADP
brj-23453	293	5	the	the	DET
brj-23453	293	6	dna	dna	PROPN
brj-23453	293	7	profile	profile	NOUN
brj-23453	293	8	unequivocally	unequivocally	ADV
brj-23453	293	9	illustrated	illustrate	VERB
brj-23453	293	10	the	the	DET
brj-23453	293	11	genetic	genetic	ADJ
brj-23453	293	12	connection	connection	NOUN
brj-23453	293	13	that	that	PRON
brj-23453	293	14	existed	exist	VERB
brj-23453	293	15	among	among	ADP
brj-23453	293	16	the	the	DET
brj-23453	293	17	genotypes	genotype	NOUN
brj-23453	293	18	.	.	PUNCT
brj-23453	294	1	following	follow	VERB
brj-23453	294	2	the	the	DET
brj-23453	294	3	disclosure	disclosure	NOUN
brj-23453	294	4	of	of	ADP
brj-23453	294	5	the	the	DET
brj-23453	294	6	investigative	investigative	ADJ
brj-23453	294	7	information	information	NOUN
brj-23453	294	8	,	,	PUNCT
brj-23453	294	9	the	the	DET
brj-23453	294	10	dendrogram	dendrogram	NOUN
brj-23453	294	11	was	be	AUX
brj-23453	294	12	constructed	construct	VERB
brj-23453	294	13	.	.	PUNCT
brj-23453	295	1	the	the	DET
brj-23453	295	2	genotypes	genotype	NOUN
brj-23453	295	3	being	be	AUX
brj-23453	295	4	studied	study	VERB
brj-23453	295	5	exhibited	exhibit	VERB
brj-23453	295	6	a	a	DET
brj-23453	295	7	broad	broad	ADJ
brj-23453	295	8	dispersion	dispersion	NOUN
brj-23453	295	9	into	into	ADP
brj-23453	295	10	two	two	NUM
brj-23453	295	11	significant	significant	ADJ
brj-23453	295	12	clusters	cluster	NOUN
brj-23453	295	13	,	,	PUNCT
brj-23453	295	14	which	which	PRON
brj-23453	295	15	,	,	PUNCT
brj-23453	295	16	as	as	SCONJ
brj-23453	295	17	indicated	indicate	VERB
brj-23453	295	18	by	by	ADP
brj-23453	295	19	the	the	DET
brj-23453	295	20	dendrogram	dendrogram	NOUN
brj-23453	295	21	,	,	PUNCT
brj-23453	295	22	demonstrates	demonstrate	VERB
brj-23453	295	23	the	the	DET
brj-23453	295	24	considerable	considerable	ADJ
brj-23453	295	25	genetic	genetic	ADJ
brj-23453	295	26	diversity	diversity	NOUN
brj-23453	295	27	and	and	CCONJ
brj-23453	295	28	heterogeneity	heterogeneity	NOUN
brj-23453	295	29	of	of	ADP
brj-23453	295	30	the	the	DET
brj-23453	295	31	open	open	ADJ
brj-23453	295	32	-	-	PUNCT
brj-23453	295	33	populated	populate	VERB
brj-23453	295	34	walnut	walnut	NOUN
brj-23453	295	35	genotypes	genotype	NOUN
brj-23453	295	36	in	in	ADP
brj-23453	295	37	the	the	DET
brj-23453	295	38	districts	district	NOUN
brj-23453	295	39	of	of	ADP
brj-23453	295	40	budgam	budgam	NOUN
brj-23453	295	41	and	and	CCONJ
brj-23453	295	42	ganderbal	ganderbal	VERB
brj-23453	295	43	in	in	ADP
brj-23453	295	44	the	the	DET
brj-23453	295	45	kashmir	kashmir	PROPN
brj-23453	295	46	valley	valley	PROPN
brj-23453	295	47	.	.	PUNCT
brj-23453	296	1	the	the	DET
brj-23453	296	2	highest	high	ADJ
brj-23453	296	3	bootstrap	bootstrap	NOUN
brj-23453	296	4	value	value	NOUN
brj-23453	296	5	was	be	AUX
brj-23453	296	6	found	find	VERB
brj-23453	296	7	in	in	ADP
brj-23453	296	8	the	the	DET
brj-23453	296	9	node	node	NOUN
brj-23453	296	10	that	that	PRON
brj-23453	296	11	separated	separate	VERB
brj-23453	296	12	clusters	cluster	NOUN
brj-23453	296	13	i	i	PRON
brj-23453	296	14	and	and	CCONJ
brj-23453	296	15	ii	ii	PROPN
brj-23453	296	16	,	,	PUNCT
brj-23453	296	17	indicating	indicate	VERB
brj-23453	296	18	that	that	SCONJ
brj-23453	296	19	the	the	DET
brj-23453	296	20	genotypes	genotype	NOUN
brj-23453	296	21	in	in	ADP
brj-23453	296	22	clusters	cluster	NOUN
brj-23453	296	23	i	i	PRON
brj-23453	296	24	and	and	CCONJ
brj-23453	296	25	ii	ii	PROPN
brj-23453	296	26	were	be	AUX
brj-23453	296	27	extremely	extremely	ADV
brj-23453	296	28	diverse	diverse	ADJ
brj-23453	296	29	.	.	PUNCT
brj-23453	297	1	cluster	cluster	NOUN
brj-23453	297	2	ii	ii	PROPN
brj-23453	297	3	comprised	comprise	VERB
brj-23453	297	4	14	14	NUM
brj-23453	297	5	of	of	ADP
brj-23453	297	6	the	the	DET
brj-23453	297	7	genotypes	genotype	NOUN
brj-23453	297	8	,	,	PUNCT
brj-23453	297	9	the	the	DET
brj-23453	297	10	plurality	plurality	NOUN
brj-23453	297	11	.	.	PUNCT
brj-23453	298	1	a	a	DET
brj-23453	298	2	total	total	NOUN
brj-23453	298	3	of	of	ADP
brj-23453	298	4	14	14	NUM
brj-23453	298	5	genotypes	genotype	NOUN
brj-23453	298	6	were	be	AUX
brj-23453	298	7	identified	identify	VERB
brj-23453	298	8	in	in	ADP
brj-23453	298	9	three	three	NUM
brj-23453	298	10	subgroups	subgroup	NOUN
brj-23453	298	11	comprising	comprise	VERB
brj-23453	298	12	the	the	DET
brj-23453	298	13	second	second	ADJ
brj-23453	298	14	cluster	cluster	NOUN
brj-23453	298	15	.	.	PUNCT
brj-23453	299	1	seven	seven	NUM
brj-23453	299	2	genotypes	genotype	NOUN
brj-23453	299	3	comprised	comprise	VERB
brj-23453	299	4	the	the	DET
brj-23453	299	5	initial	initial	ADJ
brj-23453	299	6	cluster	cluster	NOUN
brj-23453	299	7	,	,	PUNCT
brj-23453	299	8	which	which	PRON
brj-23453	299	9	was	be	AUX
brj-23453	299	10	further	far	ADV
brj-23453	299	11	subdivided	subdivide	VERB
brj-23453	299	12	into	into	ADP
brj-23453	299	13	two	two	NUM
brj-23453	299	14	groups	group	NOUN
brj-23453	299	15	.	.	PUNCT
brj-23453	300	1	therefore	therefore	ADV
brj-23453	300	2	,	,	PUNCT
brj-23453	300	3	genotypes	genotype	NOUN
brj-23453	300	4	collected	collect	VERB
brj-23453	300	5	from	from	ADP
brj-23453	300	6	diverse	diverse	ADJ
brj-23453	300	7	geographic	geographic	ADJ
brj-23453	300	8	locations	location	NOUN
brj-23453	300	9	tended	tend	VERB
brj-23453	300	10	to	to	PART
brj-23453	300	11	cluster	cluster	VERB
brj-23453	300	12	into	into	ADP
brj-23453	300	13	similar	similar	ADJ
brj-23453	300	14	clusters	cluster	NOUN
brj-23453	300	15	.	.	PUNCT
brj-23453	301	1	this	this	PRON
brj-23453	301	2	suggests	suggest	VERB
brj-23453	301	3	that	that	SCONJ
brj-23453	301	4	the	the	DET
brj-23453	301	5	clustering	cluster	VERB
brj-23453	301	6	process	process	NOUN
brj-23453	301	7	was	be	AUX
brj-23453	301	8	independent	independent	ADJ
brj-23453	301	9	of	of	ADP
brj-23453	301	10	geographic	geographic	ADJ
brj-23453	301	11	sites	site	NOUN
brj-23453	301	12	,	,	PUNCT
brj-23453	301	13	suggesting	suggest	VERB
brj-23453	301	14	that	that	SCONJ
brj-23453	301	15	the	the	DET
brj-23453	301	16	majority	majority	NOUN
brj-23453	301	17	of	of	ADP
brj-23453	301	18	genotypes	genotype	NOUN
brj-23453	301	19	share	share	VERB
brj-23453	301	20	a	a	DET
brj-23453	301	21	common	common	ADJ
brj-23453	301	22	gene	gene	NOUN
brj-23453	301	23	pool	pool	NOUN
brj-23453	301	24	and	and	CCONJ
brj-23453	301	25	that	that	SCONJ
brj-23453	301	26	morphological	morphological	ADJ
brj-23453	301	27	similarities	similarity	NOUN
brj-23453	301	28	may	may	AUX
brj-23453	301	29	exist	exist	VERB
brj-23453	301	30	between	between	ADP
brj-23453	301	31	genotypes	genotype	NOUN
brj-23453	301	32	in	in	ADP
brj-23453	301	33	the	the	DET
brj-23453	301	34	same	same	ADJ
brj-23453	301	35	cluster	cluster	NOUN
brj-23453	301	36	.	.	PUNCT
brj-23453	302	1	aside	aside	ADV
brj-23453	302	2	from	from	ADP
brj-23453	302	3	genotypes	genotype	NOUN
brj-23453	302	4	collected	collect	VERB
brj-23453	302	5	from	from	ADP
brj-23453	302	6	the	the	DET
brj-23453	302	7	same	same	ADJ
brj-23453	302	8	location	location	NOUN
brj-23453	302	9	and	and	CCONJ
brj-23453	302	10	the	the	DET
brj-23453	302	11	characteristics	characteristic	NOUN
brj-23453	302	12	of	of	ADP
brj-23453	302	13	walnuts	walnut	NOUN
brj-23453	302	14	,	,	PUNCT
brj-23453	302	15	there	there	PRON
brj-23453	302	16	was	be	VERB
brj-23453	302	17	no	no	DET
brj-23453	302	18	correlation	correlation	NOUN
brj-23453	302	19	between	between	ADP
brj-23453	302	20	geographical	geographical	ADJ
brj-23453	302	21	proximity	proximity	NOUN
brj-23453	302	22	and	and	CCONJ
brj-23453	302	23	germplasm	germplasm	NOUN
brj-23453	302	24	genetic	genetic	ADJ
brj-23453	302	25	proximity	proximity	NOUN
brj-23453	302	26	.	.	PUNCT
brj-23453	303	1	the	the	DET
brj-23453	303	2	distinct	distinct	ADJ
brj-23453	303	3	clustering	clustering	NOUN
brj-23453	303	4	of	of	ADP
brj-23453	303	5	genotypes	genotype	NOUN
brj-23453	303	6	collected	collect	VERB
brj-23453	303	7	from	from	ADP
brj-23453	303	8	various	various	ADJ
brj-23453	303	9	districts	district	NOUN
brj-23453	303	10	in	in	ADP
brj-23453	303	11	the	the	DET
brj-23453	303	12	kashmir	kashmir	PROPN
brj-23453	303	13	valley	valley	PROPN
brj-23453	303	14	may	may	AUX
brj-23453	303	15	be	be	AUX
brj-23453	303	16	accounted	account	VERB
brj-23453	303	17	for	for	ADP
brj-23453	303	18	by	by	ADP
brj-23453	303	19	outcrossing	outcrossing	NOUN
brj-23453	303	20	.	.	PUNCT
brj-23453	304	1	the	the	DET
brj-23453	304	2	aforementioned	aforementioned	ADJ
brj-23453	304	3	findings	finding	NOUN
brj-23453	304	4	are	be	AUX
brj-23453	304	5	in	in	ADP
brj-23453	304	6	immediate	immediate	ADJ
brj-23453	304	7	correlation	correlation	NOUN
brj-23453	304	8	with	with	ADP
brj-23453	304	9	each	each	DET
brj-23453	304	10	other	other	ADJ
brj-23453	304	11	(	(	PUNCT
brj-23453	304	12	simsek	simsek	NOUN
brj-23453	304	13	et	et	PROPN
brj-23453	304	14	al	al	PROPN
brj-23453	304	15	.	.	PROPN
brj-23453	304	16	2010	2010	NUM
brj-23453	304	17	;	;	PUNCT
brj-23453	305	1	ahmad	ahmad	PROPN
brj-23453	305	2	et	et	PROPN
brj-23453	305	3	al	al	PROPN
brj-23453	305	4	.	.	PROPN
brj-23453	305	5	2012	2012	NUM
brj-23453	305	6	;	;	PUNCT
brj-23453	305	7	orhan	orhan	PROPN
brj-23453	305	8	et	et	PROPN
brj-23453	305	9	al	al	PROPN
brj-23453	305	10	.	.	PROPN
brj-23453	305	11	2020	2020	NUM
brj-23453	305	12	)	)	PUNCT
brj-23453	305	13	.	.	PUNCT
brj-23453	306	1	the	the	DET
brj-23453	306	2	first	first	ADJ
brj-23453	306	3	three	three	NUM
brj-23453	306	4	axes	axis	NOUN
brj-23453	306	5	accounted	account	VERB
brj-23453	306	6	for	for	ADP
brj-23453	306	7	9.8	9.8	NUM
brj-23453	306	8	%	%	NOUN
brj-23453	306	9	,	,	PUNCT
brj-23453	306	10	16.3	16.3	NUM
brj-23453	306	11	%	%	NOUN
brj-23453	306	12	,	,	PUNCT
brj-23453	306	13	and	and	CCONJ
brj-23453	306	14	22.4	22.4	NUM
brj-23453	306	15	%	%	NOUN
brj-23453	306	16	,	,	PUNCT
brj-23453	306	17	respectively	respectively	ADV
brj-23453	306	18	,	,	PUNCT
brj-23453	306	19	of	of	ADP
brj-23453	306	20	the	the	DET
brj-23453	306	21	genetic	genetic	ADJ
brj-23453	306	22	similarity	similarity	NOUN
brj-23453	306	23	variance	variance	NOUN
brj-23453	306	24	,	,	PUNCT
brj-23453	306	25	or	or	CCONJ
brj-23453	306	26	48.5	48.5	NUM
brj-23453	306	27	%	%	NOUN
brj-23453	306	28	,	,	PUNCT
brj-23453	306	29	as	as	SCONJ
brj-23453	306	30	shown	show	VERB
brj-23453	306	31	in	in	ADP
brj-23453	306	32	table	table	NOUN
brj-23453	306	33	5	5	NUM
brj-23453	306	34	.	.	PUNCT
brj-23453	307	1	the	the	DET
brj-23453	307	2	outcomes	outcome	NOUN
brj-23453	307	3	generated	generate	VERB
brj-23453	307	4	by	by	ADP
brj-23453	307	5	pcoa	pcoa	NOUN
brj-23453	307	6	closely	closely	ADV
brj-23453	307	7	resemble	resemble	VERB
brj-23453	307	8	those	those	PRON
brj-23453	307	9	obtained	obtain	VERB
brj-23453	307	10	from	from	ADP
brj-23453	307	11	the	the	DET
brj-23453	307	12	upgma	upgma	PROPN
brj-23453	307	13	dendrogram	dendrogram	PROPN
brj-23453	307	14	.	.	PUNCT
brj-23453	308	1	the	the	DET
brj-23453	308	2	geographical	geographical	ADJ
brj-23453	308	3	differentiation	differentiation	NOUN
brj-23453	308	4	went	go	VERB
brj-23453	308	5	unnoticed	unnoticed	ADJ
brj-23453	308	6	as	as	ADP
brj-23453	308	7	the	the	DET
brj-23453	308	8	pcoa	pcoa	NOUN
brj-23453	308	9	assemblage	assemblage	PROPN
brj-23453	308	10	’s	’s	PART
brj-23453	308	11	location	location	NOUN
brj-23453	308	12	prevented	prevent	VERB
brj-23453	308	13	it	it	PRON
brj-23453	308	14	from	from	ADP
brj-23453	308	15	displaying	display	VERB
brj-23453	308	16	a	a	DET
brj-23453	308	17	vibrant	vibrant	ADJ
brj-23453	308	18	clustering	clustering	ADJ
brj-23453	308	19	outline	outline	NOUN
brj-23453	308	20	.	.	PUNCT
brj-23453	309	1	nevertheless	nevertheless	ADV
brj-23453	309	2	,	,	PUNCT
brj-23453	309	3	the	the	DET
brj-23453	309	4	pcoa	pcoa	NOUN
brj-23453	309	5	structure	structure	NOUN
brj-23453	309	6	analysis	analysis	NOUN
brj-23453	309	7	undergoes	undergo	VERB
brj-23453	309	8	some	some	DET
brj-23453	309	9	minor	minor	ADJ
brj-23453	309	10	modifications	modification	NOUN
brj-23453	309	11	as	as	ADP
brj-23453	309	12	a	a	DET
brj-23453	309	13	result	result	NOUN
brj-23453	309	14	of	of	ADP
brj-23453	309	15	the	the	DET
brj-23453	309	16	implementation	implementation	NOUN
brj-23453	309	17	of	of	ADP
brj-23453	309	18	distinct	distinct	ADJ
brj-23453	309	19	algorithms	algorithm	NOUN
brj-23453	309	20	.	.	PUNCT
brj-23453	310	1	this	this	DET
brj-23453	310	2	finding	finding	NOUN
brj-23453	310	3	is	be	AUX
brj-23453	310	4	consistent	consistent	ADJ
brj-23453	310	5	with	with	ADP
brj-23453	310	6	the	the	DET
brj-23453	310	7	research	research	NOUN
brj-23453	310	8	conducted	conduct	VERB
brj-23453	310	9	by	by	ADP
brj-23453	310	10	ahmad	ahmad	PROPN
brj-23453	310	11	et	et	PROPN
brj-23453	310	12	al	al	PROPN
brj-23453	310	13	.	.	PROPN
brj-23453	311	1	(	(	PUNCT
brj-23453	311	2	2012	2012	NUM
brj-23453	311	3	)	)	PUNCT
brj-23453	311	4	,	,	PUNCT
brj-23453	311	5	who	who	PRON
brj-23453	311	6	observed	observe	VERB
brj-23453	311	7	similarities	similarity	NOUN
brj-23453	311	8	in	in	ADP
brj-23453	311	9	walnut	walnut	NOUN
brj-23453	311	10	cultivars	cultivar	NOUN
brj-23453	311	11	originating	originate	VERB
brj-23453	311	12	from	from	ADP
brj-23453	311	13	turkey	turkey	NOUN
brj-23453	311	14	by	by	ADP
brj-23453	311	15	employing	employ	VERB
brj-23453	311	16	ssr	ssr	ADJ
brj-23453	311	17	markers	marker	NOUN
brj-23453	311	18	.	.	PUNCT
brj-23453	312	1	consistent	consistent	ADJ
brj-23453	312	2	findings	finding	NOUN
brj-23453	312	3	were	be	AUX
brj-23453	312	4	reported	report	VERB
brj-23453	312	5	by	by	ADP
brj-23453	312	6	shah	shah	PROPN
brj-23453	312	7	et	et	PROPN
brj-23453	312	8	al	al	PROPN
brj-23453	312	9	.	.	PROPN
brj-23453	313	1	(	(	PUNCT
brj-23453	313	2	2018	2018	NUM
brj-23453	313	3	)	)	PUNCT
brj-23453	313	4	for	for	ADP
brj-23453	313	5	walnut	walnut	ADJ
brj-23453	313	6	genotypes	genotype	NOUN
brj-23453	313	7	exposed	expose	VERB
brj-23453	313	8	to	to	ADP
brj-23453	313	9	ssr	ssr	PROPN
brj-23453	313	10	markers	marker	NOUN
brj-23453	313	11	,	,	PUNCT
brj-23453	313	12	dar	dar	PROPN
brj-23453	313	13	et	et	PROPN
brj-23453	313	14	al	al	PROPN
brj-23453	313	15	.	.	PROPN
brj-23453	314	1	(	(	PUNCT
brj-23453	314	2	2017	2017	NUM
brj-23453	314	3	)	)	PUNCT
brj-23453	314	4	,	,	PUNCT
brj-23453	314	5	for	for	ADP
brj-23453	314	6	common	common	ADJ
brj-23453	314	7	bean	bean	NOUN
brj-23453	314	8	genotypes	genotype	NOUN
brj-23453	314	9	exposed	expose	VERB
brj-23453	314	10	to	to	ADP
brj-23453	314	11	ssr	ssr	NOUN
brj-23453	314	12	markers	marker	NOUN
brj-23453	314	13	,	,	PUNCT
brj-23453	314	14	and	and	CCONJ
brj-23453	314	15	ebrahimi	ebrahimi	PROPN
brj-23453	314	16	et	et	PROPN
brj-23453	314	17	al	al	PROPN
brj-23453	314	18	.	.	PROPN
brj-23453	315	1	(	(	PUNCT
brj-23453	315	2	2016	2016	NUM
brj-23453	315	3	)	)	PUNCT
brj-23453	315	4	for	for	ADP
brj-23453	315	5	walnut	walnut	ADJ
brj-23453	315	6	genotypes	genotype	NOUN
brj-23453	315	7	exposed	expose	VERB
brj-23453	315	8	to	to	ADP
brj-23453	315	9	ssr	ssr	PROPN
brj-23453	315	10	markers	marker	NOUN
brj-23453	315	11	.	.	PUNCT
brj-23453	316	1	comparable	comparable	ADJ
brj-23453	316	2	results	result	NOUN
brj-23453	316	3	were	be	AUX
brj-23453	316	4	obtained	obtain	VERB
brj-23453	316	5	from	from	ADP
brj-23453	316	6	the	the	DET
brj-23453	316	7	population	population	NOUN
brj-23453	316	8	structure	structure	NOUN
brj-23453	316	9	analysis	analysis	NOUN
brj-23453	316	10	,	,	PUNCT
brj-23453	316	11	dendrogram	dendrogram	NOUN
brj-23453	316	12	,	,	PUNCT
brj-23453	316	13	and	and	CCONJ
brj-23453	316	14	pcoa	pcoa	NOUN
brj-23453	316	15	.	.	PUNCT
brj-23453	317	1	the	the	DET
brj-23453	317	2	structure	structure	NOUN
brj-23453	317	3	study	study	NOUN
brj-23453	317	4	did	do	AUX
brj-23453	317	5	not	not	PART
brj-23453	317	6	differentiate	differentiate	VERB
brj-23453	317	7	between	between	ADP
brj-23453	317	8	populations	population	NOUN
brj-23453	317	9	based	base	VERB
brj-23453	317	10	on	on	ADP
brj-23453	317	11	their	their	PRON
brj-23453	317	12	residential	residential	ADJ
brj-23453	317	13	location	location	NOUN
brj-23453	317	14	.	.	PUNCT
brj-23453	318	1	based	base	VERB
brj-23453	318	2	on	on	ADP
brj-23453	318	3	the	the	DET
brj-23453	318	4	maximal	maximal	ADJ
brj-23453	318	5	natural	natural	ADJ
brj-23453	318	6	log	log	NOUN
brj-23453	318	7	probability	probability	NOUN
brj-23453	318	8	and	and	CCONJ
brj-23453	318	9	the	the	DET
brj-23453	318	10	utmost	utmost	ADJ
brj-23453	318	11	average	average	ADJ
brj-23453	318	12	possibility	possibility	NOUN
brj-23453	318	13	of	of	ADP
brj-23453	318	14	likelihood	likelihood	NOUN
brj-23453	318	15	value	value	NOUN
brj-23453	318	16	l	l	NOUN
brj-23453	318	17	(	(	PUNCT
brj-23453	318	18	k	k	NOUN
brj-23453	318	19	)	)	PUNCT
brj-23453	318	20	=	=	SYM
brj-23453	318	21	0.672	0.672	NUM
brj-23453	318	22	derived	derive	VERB
brj-23453	318	23	from	from	ADP
brj-23453	318	24	structure	structure	NOUN
brj-23453	318	25	over	over	ADP
brj-23453	318	26	individual	individual	ADJ
brj-23453	318	27	association	association	NOUN
brj-23453	318	28	coefficient	coefficient	NOUN
brj-23453	318	29	at	at	ADP
brj-23453	318	30	k	k	PROPN
brj-23453	318	31	=	=	SYM
brj-23453	318	32	5	5	NUM
brj-23453	318	33	,	,	PUNCT
brj-23453	318	34	five	five	NUM
brj-23453	318	35	(	(	PUNCT
brj-23453	318	36	k	k	NOUN
brj-23453	318	37	=	=	SYM
brj-23453	318	38	5	5	NUM
brj-23453	318	39	)	)	PUNCT
brj-23453	318	40	subpopulations	subpopulation	NOUN
brj-23453	318	41	were	be	AUX
brj-23453	318	42	confirmed	confirm	VERB
brj-23453	318	43	in	in	ADP
brj-23453	318	44	twenty	twenty	NUM
brj-23453	318	45	-	-	PUNCT
brj-23453	318	46	one	one	NUM
brj-23453	318	47	walnut	walnut	NOUN
brj-23453	318	48	genotypes	genotype	NOUN
brj-23453	318	49	.	.	PUNCT
brj-23453	319	1	the	the	DET
brj-23453	319	2	findings	finding	NOUN
brj-23453	319	3	of	of	ADP
brj-23453	319	4	the	the	DET
brj-23453	319	5	structure	structure	NOUN
brj-23453	319	6	study	study	NOUN
brj-23453	319	7	,	,	PUNCT
brj-23453	319	8	which	which	PRON
brj-23453	319	9	identified	identify	VERB
brj-23453	319	10	five	five	NUM
brj-23453	319	11	distinct	distinct	ADJ
brj-23453	319	12	populations	population	NOUN
brj-23453	319	13	from	from	ADP
brj-23453	319	14	twenty	twenty	NUM
brj-23453	319	15	-	-	PUNCT
brj-23453	319	16	one	one	NUM
brj-23453	319	17	walnut	walnut	NOUN
brj-23453	319	18	accessions	accession	NOUN
brj-23453	319	19	with	with	ADP
brj-23453	319	20	high	high	ADJ
brj-23453	319	21	levels	level	NOUN
brj-23453	319	22	of	of	ADP
brj-23453	319	23	admixtures	admixture	NOUN
brj-23453	319	24	,	,	PUNCT
brj-23453	319	25	indicate	indicate	VERB
brj-23453	319	26	that	that	SCONJ
brj-23453	319	27	walnuts	walnut	NOUN
brj-23453	319	28	are	be	AUX
brj-23453	319	29	inherently	inherently	ADV
brj-23453	319	30	diverse	diverse	ADJ
brj-23453	319	31	by	by	ADP
brj-23453	319	32	random	random	ADJ
brj-23453	319	33	mating	mating	NOUN
brj-23453	319	34	(	(	PUNCT
brj-23453	319	35	cross	cross	NOUN
brj-23453	319	36	-	-	NOUN
brj-23453	319	37	pollination	pollination	NOUN
brj-23453	319	38	)	)	PUNCT
brj-23453	319	39	and	and	CCONJ
brj-23453	319	40	the	the	DET
brj-23453	319	41	absence	absence	NOUN
brj-23453	319	42	of	of	ADP
brj-23453	319	43	a	a	DET
brj-23453	319	44	zygotic	zygotic	ADJ
brj-23453	319	45	barrier	barrier	NOUN
brj-23453	319	46	.	.	PUNCT
brj-23453	320	1	the	the	DET
brj-23453	320	2	range	range	NOUN
brj-23453	320	3	of	of	ADP
brj-23453	320	4	population	population	NOUN
brj-23453	320	5	divergence	divergence	NOUN
brj-23453	320	6	(	(	PUNCT
brj-23453	320	7	fst	fst	NOUN
brj-23453	320	8	)	)	PUNCT
brj-23453	320	9	values	value	NOUN
brj-23453	320	10	observed	observe	VERB
brj-23453	320	11	in	in	ADP
brj-23453	320	12	the	the	DET
brj-23453	320	13	first	first	ADJ
brj-23453	320	14	subpopulation	subpopulation	NOUN
brj-23453	320	15	is	be	AUX
brj-23453	320	16	0.261	0.261	NUM
brj-23453	320	17	in	in	ADP
brj-23453	320	18	the	the	DET
brj-23453	320	19	4th	4th	ADJ
brj-23453	320	20	subpopulation	subpopulation	NOUN
brj-23453	320	21	and	and	CCONJ
brj-23453	320	22	0.176	0.176	NUM
brj-23453	320	23	in	in	ADP
brj-23453	320	24	the	the	DET
brj-23453	320	25	3rd	3rd	ADJ
brj-23453	320	26	subpopulation	subpopulation	NOUN
brj-23453	320	27	.	.	PUNCT
brj-23453	321	1	the	the	DET
brj-23453	321	2	genetic	genetic	ADJ
brj-23453	321	3	differentiation	differentiation	NOUN
brj-23453	321	4	between	between	ADP
brj-23453	321	5	the	the	DET
brj-23453	321	6	groups	group	NOUN
brj-23453	321	7	from	from	ADP
brj-23453	321	8	the	the	DET
brj-23453	321	9	caserta	caserta	PROPN
brj-23453	321	10	and	and	CCONJ
brj-23453	321	11	sorrento	sorrento	PROPN
brj-23453	321	12	peninsulas	peninsula	NOUN
brj-23453	321	13	in	in	ADP
brj-23453	321	14	sorrento	sorrento	PROPN
brj-23453	321	15	walnut	walnut	NOUN
brj-23453	321	16	was	be	AUX
brj-23453	321	17	detected	detect	VERB
brj-23453	321	18	using	use	VERB
brj-23453	321	19	microsatellite	microsatellite	ADJ
brj-23453	321	20	primers	primer	NOUN
brj-23453	321	21	.	.	PUNCT
brj-23453	322	1	this	this	PRON
brj-23453	322	2	resulted	result	VERB
brj-23453	322	3	in	in	ADP
brj-23453	322	4	the	the	DET
brj-23453	322	5	formation	formation	NOUN
brj-23453	322	6	of	of	ADP
brj-23453	322	7	two	two	NUM
brj-23453	322	8	distinct	distinct	ADJ
brj-23453	322	9	clusters	cluster	NOUN
brj-23453	322	10	,	,	PUNCT
brj-23453	322	11	which	which	PRON
brj-23453	322	12	were	be	AUX
brj-23453	322	13	peer	peer	NOUN
brj-23453	322	14	-	-	PUNCT
brj-23453	322	15	reviewed	review	VERB
brj-23453	322	16	article	article	NOUN
brj-23453	322	17	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	322	18	wani	wani	PROPN
brj-23453	322	19	et	et	PROPN
brj-23453	322	20	al	al	PROPN
brj-23453	322	21	.	.	PROPN
brj-23453	323	1	(	(	PUNCT
brj-23453	323	2	2024	2024	NUM
brj-23453	323	3	)	)	PUNCT
brj-23453	323	4	.	.	PUNCT
brj-23453	324	1	“	"	PUNCT
brj-23453	324	2	walnut	walnut	ADJ
brj-23453	324	3	population	population	NOUN
brj-23453	324	4	&	&	CCONJ
brj-23453	324	5	diversity	diversity	NOUN
brj-23453	324	6	,	,	PUNCT
brj-23453	324	7	”	"	PUNCT
brj-23453	324	8	bioresources	bioresource	NOUN
brj-23453	324	9	19(3	19(3	NUM
brj-23453	324	10	)	)	PUNCT
brj-23453	324	11	,	,	PUNCT
brj-23453	324	12	4213	4213	NUM
brj-23453	324	13	-	-	SYM
brj-23453	324	14	4237	4237	NUM
brj-23453	324	15	.	.	PUNCT
brj-23453	325	1	4226	4226	NUM
brj-23453	325	2	closely	closely	ADV
brj-23453	325	3	but	but	CCONJ
brj-23453	325	4	not	not	PART
brj-23453	325	5	precisely	precisely	ADV
brj-23453	325	6	associated	associate	VERB
brj-23453	325	7	with	with	ADP
brj-23453	325	8	the	the	DET
brj-23453	325	9	geographic	geographic	ADJ
brj-23453	325	10	origin	origin	NOUN
brj-23453	325	11	of	of	ADP
brj-23453	325	12	each	each	DET
brj-23453	325	13	sample	sample	NOUN
brj-23453	325	14	(	(	PUNCT
brj-23453	325	15	foroni	foroni	NOUN
brj-23453	325	16	et	et	PROPN
brj-23453	325	17	al	al	PROPN
brj-23453	325	18	.	.	PROPN
brj-23453	325	19	2007	2007	NUM
brj-23453	325	20	)	)	PUNCT
brj-23453	325	21	.	.	PUNCT
brj-23453	326	1	the	the	DET
brj-23453	326	2	present	present	ADJ
brj-23453	326	3	study	study	NOUN
brj-23453	326	4	employed	employ	VERB
brj-23453	326	5	structure	structure	NOUN
brj-23453	326	6	analysis	analysis	NOUN
brj-23453	326	7	to	to	PART
brj-23453	326	8	illustrate	illustrate	VERB
brj-23453	326	9	genetic	genetic	ADJ
brj-23453	326	10	divergence	divergence	NOUN
brj-23453	326	11	or	or	CCONJ
brj-23453	326	12	differentiation	differentiation	NOUN
brj-23453	326	13	among	among	ADP
brj-23453	326	14	walnut	walnut	ADJ
brj-23453	326	15	genotypes	genotype	NOUN
brj-23453	326	16	originating	originate	VERB
brj-23453	326	17	from	from	ADP
brj-23453	326	18	various	various	ADJ
brj-23453	326	19	topographical	topographical	ADJ
brj-23453	326	20	regions	region	NOUN
brj-23453	326	21	.	.	PUNCT
brj-23453	327	1	this	this	DET
brj-23453	327	2	regional	regional	ADJ
brj-23453	327	3	disparity	disparity	NOUN
brj-23453	327	4	might	might	AUX
brj-23453	327	5	have	have	AUX
brj-23453	327	6	been	be	AUX
brj-23453	327	7	the	the	DET
brj-23453	327	8	consequence	consequence	NOUN
brj-23453	327	9	of	of	ADP
brj-23453	327	10	selection	selection	NOUN
brj-23453	327	11	pressure	pressure	NOUN
brj-23453	327	12	exerted	exert	VERB
brj-23453	327	13	by	by	ADP
brj-23453	327	14	the	the	DET
brj-23453	327	15	reproduction	reproduction	NOUN
brj-23453	327	16	and	and	CCONJ
brj-23453	327	17	selection	selection	NOUN
brj-23453	327	18	process	process	NOUN
brj-23453	327	19	.	.	PUNCT
brj-23453	328	1	in	in	ADP
brj-23453	328	2	the	the	DET
brj-23453	328	3	future	future	NOUN
brj-23453	328	4	,	,	PUNCT
brj-23453	328	5	the	the	DET
brj-23453	328	6	insights	insight	NOUN
brj-23453	328	7	obtained	obtain	VERB
brj-23453	328	8	from	from	ADP
brj-23453	328	9	population	population	NOUN
brj-23453	328	10	structure	structure	NOUN
brj-23453	328	11	analysis	analysis	NOUN
brj-23453	328	12	will	will	AUX
brj-23453	328	13	prove	prove	VERB
brj-23453	328	14	to	to	PART
brj-23453	328	15	be	be	AUX
brj-23453	328	16	advantageous	advantageous	ADJ
brj-23453	328	17	when	when	SCONJ
brj-23453	328	18	conducting	conduct	VERB
brj-23453	328	19	association	association	NOUN
brj-23453	328	20	mapping	mapping	NOUN
brj-23453	328	21	in	in	ADP
brj-23453	328	22	walnuts	walnut	NOUN
brj-23453	328	23	across	across	ADP
brj-23453	328	24	various	various	ADJ
brj-23453	328	25	attributes	attribute	NOUN
brj-23453	328	26	.	.	PUNCT
brj-23453	329	1	conversely	conversely	ADV
brj-23453	329	2	,	,	PUNCT
brj-23453	329	3	prior	prior	ADJ
brj-23453	329	4	investigations	investigation	NOUN
brj-23453	329	5	have	have	AUX
brj-23453	329	6	delineated	delineate	VERB
brj-23453	329	7	apricot	apricot	NOUN
brj-23453	329	8	populations	population	NOUN
brj-23453	329	9	into	into	ADP
brj-23453	329	10	two	two	NUM
brj-23453	329	11	to	to	PART
brj-23453	329	12	four	four	NUM
brj-23453	329	13	subpopulations	subpopulation	NOUN
brj-23453	329	14	(	(	PUNCT
brj-23453	329	15	khadivi	khadivi	NOUN
brj-23453	329	16	-	-	PUNCT
brj-23453	329	17	khub	khub	NOUN
brj-23453	329	18	et	et	PROPN
brj-23453	329	19	al	al	PROPN
brj-23453	329	20	.	.	PROPN
brj-23453	329	21	2015	2015	NUM
brj-23453	329	22	;	;	PUNCT
brj-23453	329	23	li	li	PROPN
brj-23453	329	24	et	et	PROPN
brj-23453	329	25	al	al	PROPN
brj-23453	329	26	.	.	PROPN
brj-23453	329	27	2020	2020	NUM
brj-23453	329	28	)	)	PUNCT
brj-23453	329	29	.	.	PUNCT
brj-23453	330	1	the	the	DET
brj-23453	330	2	blending	blending	NOUN
brj-23453	330	3	of	of	ADP
brj-23453	330	4	walnut	walnut	ADJ
brj-23453	330	5	genotypes	genotype	NOUN
brj-23453	330	6	may	may	AUX
brj-23453	330	7	take	take	VERB
brj-23453	330	8	into	into	ADP
brj-23453	330	9	account	account	NOUN
brj-23453	330	10	the	the	DET
brj-23453	330	11	cross	cross	ADJ
brj-23453	330	12	-	-	ADJ
brj-23453	330	13	cultural	cultural	ADJ
brj-23453	330	14	and	and	CCONJ
brj-23453	330	15	geographical	geographical	ADJ
brj-23453	330	16	barriers	barrier	NOUN
brj-23453	330	17	that	that	PRON
brj-23453	330	18	hinder	hinder	VERB
brj-23453	330	19	commercial	commercial	ADJ
brj-23453	330	20	objectives	objective	NOUN
brj-23453	330	21	.	.	PUNCT
brj-23453	331	1	moreover	moreover	ADV
brj-23453	331	2	,	,	PUNCT
brj-23453	331	3	the	the	DET
brj-23453	331	4	findings	finding	NOUN
brj-23453	331	5	indicate	indicate	VERB
brj-23453	331	6	that	that	SCONJ
brj-23453	331	7	the	the	DET
brj-23453	331	8	sixteen	sixteen	PROPN
brj-23453	331	9	ssrs	ssr	NOUN
brj-23453	331	10	employed	employ	VERB
brj-23453	331	11	in	in	ADP
brj-23453	331	12	this	this	DET
brj-23453	331	13	study	study	NOUN
brj-23453	331	14	have	have	VERB
brj-23453	331	15	the	the	DET
brj-23453	331	16	potential	potential	NOUN
brj-23453	331	17	to	to	PART
brj-23453	331	18	facilitate	facilitate	VERB
brj-23453	331	19	a	a	DET
brj-23453	331	20	rational	rational	ADJ
brj-23453	331	21	evaluation	evaluation	NOUN
brj-23453	331	22	of	of	ADP
brj-23453	331	23	genetic	genetic	ADJ
brj-23453	331	24	diversity	diversity	NOUN
brj-23453	331	25	,	,	PUNCT
brj-23453	331	26	which	which	PRON
brj-23453	331	27	would	would	AUX
brj-23453	331	28	be	be	AUX
brj-23453	331	29	beneficial	beneficial	ADJ
brj-23453	331	30	for	for	ADP
brj-23453	331	31	marker	marker	NOUN
brj-23453	331	32	-	-	PUNCT
brj-23453	331	33	assisted	assist	VERB
brj-23453	331	34	reproduction	reproduction	NOUN
brj-23453	331	35	and	and	CCONJ
brj-23453	331	36	parental	parental	ADJ
brj-23453	331	37	crossing	crossing	NOUN
brj-23453	331	38	-	-	PUNCT
brj-23453	331	39	line	line	NOUN
brj-23453	331	40	identification	identification	NOUN
brj-23453	331	41	.	.	PUNCT
brj-23453	332	1	the	the	DET
brj-23453	332	2	amova	amova	NOUN
brj-23453	332	3	demonstrated	demonstrate	VERB
brj-23453	332	4	that	that	SCONJ
brj-23453	332	5	substantial	substantial	ADJ
brj-23453	332	6	variations	variation	NOUN
brj-23453	332	7	exist	exist	VERB
brj-23453	332	8	both	both	CCONJ
brj-23453	332	9	among	among	ADP
brj-23453	332	10	and	and	CCONJ
brj-23453	332	11	within	within	ADP
brj-23453	332	12	groups	group	NOUN
brj-23453	332	13	.	.	PUNCT
brj-23453	333	1	the	the	DET
brj-23453	333	2	proportion	proportion	NOUN
brj-23453	333	3	of	of	ADP
brj-23453	333	4	variation	variation	NOUN
brj-23453	333	5	present	present	ADJ
brj-23453	333	6	within	within	ADP
brj-23453	333	7	a	a	DET
brj-23453	333	8	given	give	VERB
brj-23453	333	9	population	population	NOUN
brj-23453	333	10	was	be	AUX
brj-23453	333	11	significantly	significantly	ADV
brj-23453	333	12	greater	great	ADJ
brj-23453	333	13	(	(	PUNCT
brj-23453	333	14	91	91	NUM
brj-23453	333	15	%	%	NOUN
brj-23453	333	16	)	)	PUNCT
brj-23453	333	17	,	,	PUNCT
brj-23453	333	18	in	in	ADP
brj-23453	333	19	contrast	contrast	NOUN
brj-23453	333	20	to	to	ADP
brj-23453	333	21	the	the	DET
brj-23453	333	22	mere	mere	ADJ
brj-23453	333	23	9	9	NUM
brj-23453	333	24	%	%	NOUN
brj-23453	333	25	variation	variation	NOUN
brj-23453	333	26	observed	observe	VERB
brj-23453	333	27	between	between	ADP
brj-23453	333	28	populations	population	NOUN
brj-23453	333	29	.	.	PUNCT
brj-23453	334	1	similar	similar	ADJ
brj-23453	334	2	conclusions	conclusion	NOUN
brj-23453	334	3	were	be	AUX
brj-23453	334	4	reached	reach	VERB
brj-23453	334	5	by	by	ADP
brj-23453	334	6	hu	hu	PROPN
brj-23453	334	7	et	et	PROPN
brj-23453	334	8	al	al	PROPN
brj-23453	334	9	.	.	PROPN
brj-23453	335	1	(	(	PUNCT
brj-23453	335	2	2018	2018	NUM
brj-23453	335	3	)	)	PUNCT
brj-23453	335	4	and	and	CCONJ
brj-23453	335	5	bourguiba	bourguiba	NOUN
brj-23453	335	6	et	et	PROPN
brj-23453	335	7	al	al	PROPN
brj-23453	335	8	.	.	PROPN
brj-23453	336	1	(	(	PUNCT
brj-23453	336	2	2012	2012	NUM
brj-23453	336	3	)	)	PUNCT
brj-23453	336	4	,	,	PUNCT
brj-23453	336	5	who	who	PRON
brj-23453	336	6	discovered	discover	VERB
brj-23453	336	7	that	that	SCONJ
brj-23453	336	8	molecular	molecular	ADJ
brj-23453	336	9	variation	variation	NOUN
brj-23453	336	10	was	be	AUX
brj-23453	336	11	less	less	ADV
brj-23453	336	12	within	within	ADP
brj-23453	336	13	populations	population	NOUN
brj-23453	336	14	than	than	ADP
brj-23453	336	15	between	between	ADP
brj-23453	336	16	populations	population	NOUN
brj-23453	336	17	.	.	PUNCT
brj-23453	337	1	furthermore	furthermore	ADV
brj-23453	337	2	,	,	PUNCT
brj-23453	337	3	aradhya	aradhya	PROPN
brj-23453	337	4	et	et	PROPN
brj-23453	337	5	al	al	PROPN
brj-23453	337	6	.	.	PROPN
brj-23453	337	7	(	(	PUNCT
brj-23453	337	8	2010	2010	NUM
brj-23453	337	9	)	)	PUNCT
brj-23453	337	10	discovered	discover	VERB
brj-23453	337	11	that	that	SCONJ
brj-23453	337	12	walnut	walnut	NOUN
brj-23453	337	13	genotypes	genotype	NOUN
brj-23453	337	14	exhibit	exhibit	VERB
brj-23453	337	15	a	a	DET
brj-23453	337	16	greater	great	ADJ
brj-23453	337	17	degree	degree	NOUN
brj-23453	337	18	of	of	ADP
brj-23453	337	19	population	population	NOUN
brj-23453	337	20	variance	variance	NOUN
brj-23453	337	21	(	(	PUNCT
brj-23453	337	22	86	86	NUM
brj-23453	337	23	%	%	NOUN
brj-23453	337	24	)	)	PUNCT
brj-23453	337	25	compared	compare	VERB
brj-23453	337	26	to	to	ADP
brj-23453	337	27	alternative	alternative	ADJ
brj-23453	337	28	genotypes	genotype	NOUN
brj-23453	337	29	.	.	PUNCT
brj-23453	338	1	similar	similar	ADJ
brj-23453	338	2	results	result	NOUN
brj-23453	338	3	were	be	AUX
brj-23453	338	4	reported	report	VERB
brj-23453	338	5	by	by	ADP
brj-23453	338	6	wang	wang	PROPN
brj-23453	338	7	et	et	PROPN
brj-23453	338	8	al	al	PROPN
brj-23453	338	9	.	.	PROPN
brj-23453	339	1	(	(	PUNCT
brj-23453	339	2	2008	2008	NUM
brj-23453	339	3	)	)	PUNCT
brj-23453	339	4	regarding	regard	VERB
brj-23453	339	5	the	the	DET
brj-23453	339	6	diversity	diversity	NOUN
brj-23453	339	7	of	of	ADP
brj-23453	339	8	chinese	chinese	ADJ
brj-23453	339	9	walnut	walnut	NOUN
brj-23453	339	10	populations	population	NOUN
brj-23453	339	11	,	,	PUNCT
brj-23453	339	12	89	89	NUM
brj-23453	339	13	%	%	NOUN
brj-23453	339	14	and	and	CCONJ
brj-23453	339	15	81	81	NUM
brj-23453	339	16	%	%	NOUN
brj-23453	339	17	,	,	PUNCT
brj-23453	339	18	respectively	respectively	ADV
brj-23453	339	19	,	,	PUNCT
brj-23453	339	20	within	within	ADP
brj-23453	339	21	populations	population	NOUN
brj-23453	339	22	.	.	PUNCT
brj-23453	340	1	further	further	ADJ
brj-23453	340	2	research	research	NOUN
brj-23453	340	3	objectives	objective	NOUN
brj-23453	340	4	and	and	CCONJ
brj-23453	340	5	management	management	NOUN
brj-23453	340	6	operations	operation	NOUN
brj-23453	340	7	about	about	ADP
brj-23453	340	8	walnuts	walnut	NOUN
brj-23453	340	9	will	will	AUX
brj-23453	340	10	be	be	AUX
brj-23453	340	11	significantly	significantly	ADV
brj-23453	340	12	enhanced	enhance	VERB
brj-23453	340	13	by	by	ADP
brj-23453	340	14	the	the	DET
brj-23453	340	15	results	result	NOUN
brj-23453	340	16	obtained	obtain	VERB
brj-23453	340	17	from	from	ADP
brj-23453	340	18	these	these	DET
brj-23453	340	19	inquiries	inquiry	NOUN
brj-23453	340	20	.	.	PUNCT
brj-23453	341	1	in	in	ADP
brj-23453	341	2	addition	addition	NOUN
brj-23453	341	3	to	to	ADP
brj-23453	341	4	its	its	PRON
brj-23453	341	5	implications	implication	NOUN
brj-23453	341	6	for	for	ADP
brj-23453	341	7	walnut	walnut	ADJ
brj-23453	341	8	genetic	genetic	ADJ
brj-23453	341	9	diversity	diversity	NOUN
brj-23453	341	10	,	,	PUNCT
brj-23453	341	11	this	this	DET
brj-23453	341	12	research	research	NOUN
brj-23453	341	13	may	may	AUX
brj-23453	341	14	also	also	ADV
brj-23453	341	15	have	have	VERB
brj-23453	341	16	implications	implication	NOUN
brj-23453	341	17	for	for	ADP
brj-23453	341	18	the	the	DET
brj-23453	341	19	practical	practical	ADJ
brj-23453	341	20	properties	property	NOUN
brj-23453	341	21	of	of	ADP
brj-23453	341	22	walnut	walnut	ADJ
brj-23453	341	23	wood	wood	NOUN
brj-23453	341	24	.	.	PUNCT
brj-23453	342	1	while	while	SCONJ
brj-23453	342	2	the	the	DET
brj-23453	342	3	primary	primary	ADJ
brj-23453	342	4	focus	focus	NOUN
brj-23453	342	5	of	of	ADP
brj-23453	342	6	this	this	DET
brj-23453	342	7	study	study	NOUN
brj-23453	342	8	was	be	AUX
brj-23453	342	9	on	on	ADP
brj-23453	342	10	the	the	DET
brj-23453	342	11	population	population	NOUN
brj-23453	342	12	structure	structure	NOUN
brj-23453	342	13	and	and	CCONJ
brj-23453	342	14	molecular	molecular	ADJ
brj-23453	342	15	genetic	genetic	ADJ
brj-23453	342	16	diversity	diversity	NOUN
brj-23453	342	17	of	of	ADP
brj-23453	342	18	walnut	walnut	ADJ
brj-23453	342	19	genotypes	genotype	NOUN
brj-23453	342	20	,	,	PUNCT
brj-23453	342	21	the	the	DET
brj-23453	342	22	genetic	genetic	ADJ
brj-23453	342	23	variability	variability	NOUN
brj-23453	342	24	observed	observe	VERB
brj-23453	342	25	among	among	ADP
brj-23453	342	26	the	the	DET
brj-23453	342	27	studied	study	VERB
brj-23453	342	28	genotypes	genotype	NOUN
brj-23453	342	29	could	could	AUX
brj-23453	342	30	potentially	potentially	ADV
brj-23453	342	31	influence	influence	VERB
brj-23453	342	32	various	various	ADJ
brj-23453	342	33	wood	wood	NOUN
brj-23453	342	34	traits	trait	NOUN
brj-23453	342	35	,	,	PUNCT
brj-23453	342	36	such	such	ADJ
brj-23453	342	37	as	as	ADP
brj-23453	342	38	density	density	NOUN
brj-23453	342	39	,	,	PUNCT
brj-23453	342	40	strength	strength	NOUN
brj-23453	342	41	,	,	PUNCT
brj-23453	342	42	and	and	CCONJ
brj-23453	342	43	color	color	NOUN
brj-23453	342	44	.	.	PUNCT
brj-23453	343	1	understanding	understand	VERB
brj-23453	343	2	the	the	DET
brj-23453	343	3	genetic	genetic	ADJ
brj-23453	343	4	basis	basis	NOUN
brj-23453	343	5	of	of	ADP
brj-23453	343	6	these	these	DET
brj-23453	343	7	traits	trait	NOUN
brj-23453	343	8	could	could	AUX
brj-23453	343	9	inform	inform	VERB
brj-23453	343	10	breeding	breeding	NOUN
brj-23453	343	11	programs	program	NOUN
brj-23453	343	12	aimed	aim	VERB
brj-23453	343	13	at	at	ADP
brj-23453	343	14	developing	develop	VERB
brj-23453	343	15	walnut	walnut	ADJ
brj-23453	343	16	varieties	variety	NOUN
brj-23453	343	17	with	with	ADP
brj-23453	343	18	desired	desire	VERB
brj-23453	343	19	wood	wood	NOUN
brj-23453	343	20	characteristics	characteristic	NOUN
brj-23453	343	21	for	for	ADP
brj-23453	343	22	applications	application	NOUN
brj-23453	343	23	in	in	ADP
brj-23453	343	24	furniture	furniture	NOUN
brj-23453	343	25	making	making	NOUN
brj-23453	343	26	,	,	PUNCT
brj-23453	343	27	construction	construction	NOUN
brj-23453	343	28	,	,	PUNCT
brj-23453	343	29	and	and	CCONJ
brj-23453	343	30	woodworking	woodworking	NOUN
brj-23453	343	31	industries	industry	NOUN
brj-23453	343	32	.	.	PUNCT
brj-23453	344	1	further	further	ADJ
brj-23453	344	2	research	research	NOUN
brj-23453	344	3	exploring	explore	VERB
brj-23453	344	4	the	the	DET
brj-23453	344	5	relationship	relationship	NOUN
brj-23453	344	6	between	between	ADP
brj-23453	344	7	genetic	genetic	ADJ
brj-23453	344	8	variation	variation	NOUN
brj-23453	344	9	and	and	CCONJ
brj-23453	344	10	wood	wood	NOUN
brj-23453	344	11	properties	property	NOUN
brj-23453	344	12	in	in	ADP
brj-23453	344	13	walnut	walnut	NOUN
brj-23453	344	14	trees	tree	NOUN
brj-23453	344	15	could	could	AUX
brj-23453	344	16	provide	provide	VERB
brj-23453	344	17	valuable	valuable	ADJ
brj-23453	344	18	insights	insight	NOUN
brj-23453	344	19	into	into	ADP
brj-23453	344	20	optimizing	optimize	VERB
brj-23453	344	21	walnut	walnut	ADJ
brj-23453	344	22	cultivation	cultivation	NOUN
brj-23453	344	23	for	for	ADP
brj-23453	344	24	both	both	PRON
brj-23453	344	25	timber	timber	NOUN
brj-23453	344	26	and	and	CCONJ
brj-23453	344	27	nut	nut	NOUN
brj-23453	344	28	production	production	NOUN
brj-23453	344	29	,	,	PUNCT
brj-23453	344	30	thereby	thereby	ADV
brj-23453	344	31	enhancing	enhance	VERB
brj-23453	344	32	the	the	DET
brj-23453	344	33	economic	economic	ADJ
brj-23453	344	34	viability	viability	NOUN
brj-23453	344	35	and	and	CCONJ
brj-23453	344	36	sustainability	sustainability	NOUN
brj-23453	344	37	of	of	ADP
brj-23453	344	38	walnut	walnut	ADJ
brj-23453	344	39	farming	farming	NOUN
brj-23453	344	40	in	in	ADP
brj-23453	344	41	the	the	DET
brj-23453	344	42	region	region	NOUN
brj-23453	344	43	.	.	PUNCT
brj-23453	345	1	conclusions	conclusion	NOUN
brj-23453	345	2	in	in	ADP
brj-23453	345	3	conclusion	conclusion	NOUN
brj-23453	345	4	,	,	PUNCT
brj-23453	345	5	this	this	DET
brj-23453	345	6	study	study	NOUN
brj-23453	345	7	utilized	utilize	VERB
brj-23453	345	8	16	16	NUM
brj-23453	345	9	simple	simple	ADJ
brj-23453	345	10	sequence	sequence	NOUN
brj-23453	345	11	repeat	repeat	NOUN
brj-23453	345	12	(	(	PUNCT
brj-23453	345	13	ssr	ssr	ADJ
brj-23453	345	14	)	)	PUNCT
brj-23453	345	15	markers	marker	NOUN
brj-23453	345	16	to	to	PART
brj-23453	345	17	evaluate	evaluate	VERB
brj-23453	345	18	the	the	DET
brj-23453	345	19	genetic	genetic	ADJ
brj-23453	345	20	relatedness	relatedness	NOUN
brj-23453	345	21	of	of	ADP
brj-23453	345	22	21	21	NUM
brj-23453	345	23	exceptional	exceptional	ADJ
brj-23453	345	24	persian	persian	ADJ
brj-23453	345	25	walnut	walnut	NOUN
brj-23453	345	26	(	(	PUNCT
brj-23453	345	27	juglans	juglan	NOUN
brj-23453	345	28	regia	regia	NOUN
brj-23453	345	29	)	)	PUNCT
brj-23453	345	30	genotypes	genotype	NOUN
brj-23453	345	31	.	.	PUNCT
brj-23453	346	1	the	the	DET
brj-23453	346	2	analysis	analysis	NOUN
brj-23453	346	3	revealed	reveal	VERB
brj-23453	346	4	a	a	DET
brj-23453	346	5	significant	significant	ADJ
brj-23453	346	6	degree	degree	NOUN
brj-23453	346	7	of	of	ADP
brj-23453	346	8	genetic	genetic	ADJ
brj-23453	346	9	diversity	diversity	NOUN
brj-23453	346	10	within	within	ADP
brj-23453	346	11	the	the	DET
brj-23453	346	12	population	population	NOUN
brj-23453	346	13	,	,	PUNCT
brj-23453	346	14	with	with	ADP
brj-23453	346	15	alleles	allele	NOUN
brj-23453	346	16	per	per	ADP
brj-23453	346	17	locus	locus	NOUN
brj-23453	346	18	ranging	range	VERB
brj-23453	346	19	from	from	ADP
brj-23453	346	20	2	2	NUM
brj-23453	346	21	to	to	ADP
brj-23453	346	22	4	4	NUM
brj-23453	346	23	.	.	PUNCT
brj-23453	346	24	notably	notably	ADV
brj-23453	346	25	,	,	PUNCT
brj-23453	346	26	wga-1	wga-1	ADV
brj-23453	346	27	,	,	PUNCT
brj-23453	346	28	wga-4	wga-4	ADP
brj-23453	346	29	,	,	PUNCT
brj-23453	346	30	and	and	CCONJ
brj-23453	346	31	wga-79	wga-79	NOUN
brj-23453	346	32	exhibited	exhibit	VERB
brj-23453	346	33	the	the	DET
brj-23453	346	34	greatest	great	ADJ
brj-23453	346	35	number	number	NOUN
brj-23453	346	36	of	of	ADP
brj-23453	346	37	alleles	allele	NOUN
brj-23453	346	38	(	(	PUNCT
brj-23453	346	39	4	4	NUM
brj-23453	346	40	)	)	PUNCT
brj-23453	346	41	,	,	PUNCT
brj-23453	346	42	while	while	SCONJ
brj-23453	346	43	wga-27	wga-27	NUM
brj-23453	346	44	,	,	PUNCT
brj-23453	346	45	wga-69	wga-69	PROPN
brj-23453	346	46	,	,	PUNCT
brj-23453	346	47	and	and	CCONJ
brj-23453	346	48	wga-32	wga-32	NUM
brj-23453	346	49	contained	contain	VERB
brj-23453	346	50	the	the	DET
brj-23453	346	51	fewest	few	ADJ
brj-23453	346	52	.	.	PUNCT
brj-23453	347	1	the	the	DET
brj-23453	347	2	range	range	NOUN
brj-23453	347	3	of	of	ADP
brj-23453	347	4	the	the	DET
brj-23453	347	5	polymorphic	polymorphic	ADJ
brj-23453	347	6	information	information	NOUN
brj-23453	347	7	content	content	NOUN
brj-23453	347	8	(	(	PUNCT
brj-23453	347	9	pic	pic	NOUN
brj-23453	347	10	)	)	PUNCT
brj-23453	347	11	value	value	NOUN
brj-23453	347	12	was	be	AUX
brj-23453	347	13	0.11	0.11	NUM
brj-23453	347	14	to	to	ADP
brj-23453	347	15	0.38	0.38	NUM
brj-23453	347	16	.	.	PUNCT
brj-23453	348	1	model	model	NOUN
brj-23453	348	2	-	-	PUNCT
brj-23453	348	3	based	base	VERB
brj-23453	348	4	cluster	cluster	NOUN
brj-23453	348	5	analysis	analysis	NOUN
brj-23453	348	6	and	and	CCONJ
brj-23453	348	7	structure	structure	NOUN
brj-23453	348	8	harvester	harvester	NOUN
brj-23453	348	9	categorized	categorize	VERB
brj-23453	348	10	all	all	DET
brj-23453	348	11	genotypes	genotype	NOUN
brj-23453	348	12	into	into	ADP
brj-23453	348	13	two	two	NUM
brj-23453	348	14	primary	primary	ADJ
brj-23453	348	15	clusters	cluster	NOUN
brj-23453	348	16	and	and	CCONJ
brj-23453	348	17	six	six	NUM
brj-23453	348	18	genetically	genetically	ADV
brj-23453	348	19	distant	distant	ADJ
brj-23453	348	20	subpopulations	subpopulation	NOUN
brj-23453	348	21	,	,	PUNCT
brj-23453	348	22	respectively	respectively	ADV
brj-23453	348	23	,	,	PUNCT
brj-23453	348	24	reflecting	reflect	VERB
brj-23453	348	25	their	their	PRON
brj-23453	348	26	distinct	distinct	ADJ
brj-23453	348	27	genetic	genetic	ADJ
brj-23453	348	28	makeup	makeup	NOUN
brj-23453	348	29	and	and	CCONJ
brj-23453	348	30	variable	variable	ADJ
brj-23453	348	31	degrees	degree	NOUN
brj-23453	348	32	peer	peer	NOUN
brj-23453	348	33	-	-	PUNCT
brj-23453	348	34	reviewed	review	VERB
brj-23453	348	35	article	article	NOUN
brj-23453	348	36	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	348	37	wani	wani	PROPN
brj-23453	348	38	et	et	PROPN
brj-23453	348	39	al	al	PROPN
brj-23453	348	40	.	.	PROPN
brj-23453	349	1	(	(	PUNCT
brj-23453	349	2	2024	2024	NUM
brj-23453	349	3	)	)	PUNCT
brj-23453	349	4	.	.	PUNCT
brj-23453	350	1	“	"	PUNCT
brj-23453	350	2	walnut	walnut	ADJ
brj-23453	350	3	population	population	NOUN
brj-23453	350	4	&	&	CCONJ
brj-23453	350	5	diversity	diversity	NOUN
brj-23453	350	6	,	,	PUNCT
brj-23453	350	7	”	"	PUNCT
brj-23453	350	8	bioresources	bioresource	NOUN
brj-23453	350	9	19(3	19(3	NUM
brj-23453	350	10	)	)	PUNCT
brj-23453	350	11	,	,	PUNCT
brj-23453	350	12	4213	4213	NUM
brj-23453	350	13	-	-	SYM
brj-23453	350	14	4237	4237	NUM
brj-23453	350	15	.	.	PUNCT
brj-23453	351	1	4227	4227	NUM
brj-23453	351	2	of	of	ADP
brj-23453	351	3	admixture	admixture	NOUN
brj-23453	351	4	.	.	PUNCT
brj-23453	352	1	anticipated	anticipate	VERB
brj-23453	352	2	heterozygosity	heterozygosity	NOUN
brj-23453	352	3	ranged	range	VERB
brj-23453	352	4	from	from	ADP
brj-23453	352	5	0.563	0.563	NUM
brj-23453	352	6	to	to	ADP
brj-23453	352	7	0.741	0.741	NUM
brj-23453	352	8	,	,	PUNCT
brj-23453	352	9	while	while	SCONJ
brj-23453	352	10	population	population	NOUN
brj-23453	352	11	differentiation	differentiation	NOUN
brj-23453	352	12	(	(	PUNCT
brj-23453	352	13	fst	fst	NOUN
brj-23453	352	14	)	)	PUNCT
brj-23453	352	15	ranged	range	VERB
brj-23453	352	16	between	between	ADP
brj-23453	352	17	0.176	0.176	NUM
brj-23453	352	18	and	and	CCONJ
brj-23453	352	19	0.261	0.261	NUM
brj-23453	352	20	.	.	PUNCT
brj-23453	353	1	these	these	DET
brj-23453	353	2	results	result	NOUN
brj-23453	353	3	are	be	AUX
brj-23453	353	4	anticipated	anticipate	VERB
brj-23453	353	5	to	to	PART
brj-23453	353	6	aid	aid	VERB
brj-23453	353	7	in	in	ADP
brj-23453	353	8	the	the	DET
brj-23453	353	9	development	development	NOUN
brj-23453	353	10	of	of	ADP
brj-23453	353	11	association	association	NOUN
brj-23453	353	12	mapping	mapping	NOUN
brj-23453	353	13	studies	study	NOUN
brj-23453	353	14	for	for	ADP
brj-23453	353	15	walnut	walnut	NOUN
brj-23453	353	16	characteristics	characteristic	NOUN
brj-23453	353	17	.	.	PUNCT
brj-23453	354	1	moreover	moreover	ADV
brj-23453	354	2	,	,	PUNCT
brj-23453	354	3	our	our	PRON
brj-23453	354	4	findings	finding	NOUN
brj-23453	354	5	underscore	underscore	VERB
brj-23453	354	6	the	the	DET
brj-23453	354	7	importance	importance	NOUN
brj-23453	354	8	of	of	ADP
brj-23453	354	9	considering	consider	VERB
brj-23453	354	10	germplasm	germplasm	NOUN
brj-23453	354	11	diversity	diversity	NOUN
brj-23453	354	12	in	in	ADP
brj-23453	354	13	persian	persian	ADJ
brj-23453	354	14	walnut	walnut	NOUN
brj-23453	354	15	breeding	breeding	NOUN
brj-23453	354	16	programs	program	NOUN
brj-23453	354	17	and	and	CCONJ
brj-23453	354	18	conservation	conservation	NOUN
brj-23453	354	19	efforts	effort	NOUN
brj-23453	354	20	to	to	PART
brj-23453	354	21	enhance	enhance	VERB
brj-23453	354	22	walnut	walnut	ADJ
brj-23453	354	23	cultivation	cultivation	NOUN
brj-23453	354	24	in	in	ADP
brj-23453	354	25	the	the	DET
brj-23453	354	26	region	region	NOUN
brj-23453	354	27	.	.	PUNCT
brj-23453	355	1	overall	overall	ADV
brj-23453	355	2	,	,	PUNCT
brj-23453	355	3	this	this	DET
brj-23453	355	4	study	study	NOUN
brj-23453	355	5	significantly	significantly	ADV
brj-23453	355	6	contributes	contribute	VERB
brj-23453	355	7	to	to	ADP
brj-23453	355	8	our	our	PRON
brj-23453	355	9	understanding	understanding	NOUN
brj-23453	355	10	of	of	ADP
brj-23453	355	11	persian	persian	ADJ
brj-23453	355	12	walnut	walnut	NOUN
brj-23453	355	13	genetic	genetic	ADJ
brj-23453	355	14	diversity	diversity	NOUN
brj-23453	355	15	in	in	ADP
brj-23453	355	16	the	the	DET
brj-23453	355	17	northwestern	northwestern	ADJ
brj-23453	355	18	himalayan	himalayan	ADJ
brj-23453	355	19	region	region	NOUN
brj-23453	355	20	of	of	ADP
brj-23453	355	21	jammu	jammu	PROPN
brj-23453	355	22	and	and	CCONJ
brj-23453	355	23	kashmir	kashmir	PROPN
brj-23453	355	24	,	,	PUNCT
brj-23453	355	25	providing	provide	VERB
brj-23453	355	26	valuable	valuable	ADJ
brj-23453	355	27	insights	insight	NOUN
brj-23453	355	28	for	for	ADP
brj-23453	355	29	future	future	ADJ
brj-23453	355	30	breeding	breeding	NOUN
brj-23453	355	31	and	and	CCONJ
brj-23453	355	32	conservation	conservation	NOUN
brj-23453	355	33	strategies	strategy	NOUN
brj-23453	355	34	.	.	PUNCT
brj-23453	356	1	acknowledgments	acknowledgment	NOUN
brj-23453	356	2	the	the	DET
brj-23453	356	3	authors	author	NOUN
brj-23453	356	4	would	would	AUX
brj-23453	356	5	like	like	VERB
brj-23453	356	6	to	to	PART
brj-23453	356	7	extend	extend	VERB
brj-23453	356	8	their	their	PRON
brj-23453	356	9	sincere	sincere	ADJ
brj-23453	356	10	appreciation	appreciation	NOUN
brj-23453	356	11	to	to	ADP
brj-23453	356	12	the	the	DET
brj-23453	356	13	researchers	researcher	NOUN
brj-23453	356	14	supporting	support	VERB
brj-23453	356	15	project	project	NOUN
brj-23453	356	16	number	number	NOUN
brj-23453	356	17	(	(	PUNCT
brj-23453	356	18	rsp2024r347	rsp2024r347	ADJ
brj-23453	356	19	)	)	PUNCT
brj-23453	356	20	,	,	PUNCT
brj-23453	356	21	king	king	PROPN
brj-23453	356	22	saud	saud	PROPN
brj-23453	356	23	university	university	PROPN
brj-23453	356	24	,	,	PUNCT
brj-23453	356	25	riyadh	riyadh	PROPN
brj-23453	356	26	,	,	PUNCT
brj-23453	356	27	saudi	saudi	PROPN
brj-23453	356	28	arabia	arabia	PROPN
brj-23453	356	29	.	.	PUNCT
brj-23453	357	1	references	reference	NOUN
brj-23453	357	2	cited	cite	VERB
brj-23453	357	3	ahmed	ahme	VERB
brj-23453	357	4	,	,	PUNCT
brj-23453	357	5	n.	n.	NOUN
brj-23453	357	6	,	,	PUNCT
brj-23453	357	7	mir	mir	PROPN
brj-23453	357	8	,	,	PUNCT
brj-23453	357	9	j.	j.	PROPN
brj-23453	357	10	i.	i.	PROPN
brj-23453	357	11	,	,	PUNCT
brj-23453	357	12	mir	mir	PROPN
brj-23453	357	13	,	,	PUNCT
brj-23453	357	14	r.	r.	PROPN
brj-23453	357	15	r.	r.	PROPN
brj-23453	357	16	,	,	PUNCT
brj-23453	357	17	rather	rather	ADV
brj-23453	357	18	,	,	PUNCT
brj-23453	357	19	n.	n.	PROPN
brj-23453	357	20	a.	a.	PROPN
brj-23453	357	21	,	,	PUNCT
brj-23453	357	22	rashid	rashid	PROPN
brj-23453	357	23	,	,	PUNCT
brj-23453	357	24	r.	r.	PROPN
brj-23453	357	25	,	,	PUNCT
brj-23453	357	26	wani	wani	PROPN
brj-23453	357	27	,	,	PUNCT
brj-23453	357	28	s.	s.	PROPN
brj-23453	357	29	h.	h.	PROPN
brj-23453	357	30	,	,	PUNCT
brj-23453	357	31	shafi	shafi	PROPN
brj-23453	357	32	,	,	PUNCT
brj-23453	357	33	w.	w.	PROPN
brj-23453	357	34	,	,	PUNCT
brj-23453	357	35	mir	mir	PROPN
brj-23453	357	36	,	,	PUNCT
brj-23453	357	37	h.	h.	PROPN
brj-23453	357	38	,	,	PUNCT
brj-23453	357	39	and	and	CCONJ
brj-23453	357	40	sheikh	sheikh	NOUN
brj-23453	357	41	,	,	PUNCT
brj-23453	357	42	m.	m.	NOUN
brj-23453	357	43	a.	a.	NOUN
brj-23453	357	44	(	(	PUNCT
brj-23453	357	45	2012	2012	NUM
brj-23453	357	46	)	)	PUNCT
brj-23453	357	47	.	.	PUNCT
brj-23453	358	1	“	"	PUNCT
brj-23453	358	2	ssr	ssr	X
brj-23453	358	3	and	and	CCONJ
brj-23453	358	4	rapd	rapd	VERB
brj-23453	358	5	analysis	analysis	NOUN
brj-23453	358	6	of	of	ADP
brj-23453	358	7	genetic	genetic	ADJ
brj-23453	358	8	diversity	diversity	NOUN
brj-23453	358	9	in	in	ADP
brj-23453	358	10	walnut	walnut	NOUN
brj-23453	358	11	(	(	PUNCT
brj-23453	358	12	juglans	juglan	NOUN
brj-23453	358	13	regia	regia	NOUN
brj-23453	358	14	l.	l.	PROPN
brj-23453	358	15	)	)	PUNCT
brj-23453	358	16	genotypes	genotype	NOUN
brj-23453	358	17	from	from	ADP
brj-23453	358	18	jammu	jammu	PROPN
brj-23453	358	19	and	and	CCONJ
brj-23453	358	20	kashmir	kashmir	PROPN
brj-23453	358	21	,	,	PUNCT
brj-23453	358	22	india	india	PROPN
brj-23453	358	23	,	,	PUNCT
brj-23453	358	24	”	"	PUNCT
brj-23453	358	25	physiology	physiology	NOUN
brj-23453	358	26	and	and	CCONJ
brj-23453	358	27	molecular	molecular	ADJ
brj-23453	358	28	biology	biology	NOUN
brj-23453	358	29	of	of	ADP
brj-23453	358	30	plants	plant	NOUN
brj-23453	358	31	18	18	NUM
brj-23453	358	32	,	,	PUNCT
brj-23453	358	33	149	149	NUM
brj-23453	358	34	-	-	SYM
brj-23453	358	35	160	160	NUM
brj-23453	358	36	.	.	PUNCT
brj-23453	359	1	doi	doi	NOUN
brj-23453	359	2	:	:	PUNCT
brj-23453	359	3	10.1007	10.1007	NUM
brj-23453	359	4	/	/	SYM
brj-23453	359	5	s12298	s12298	PROPN
brj-23453	359	6	-	-	PUNCT
brj-23453	359	7	012	012	NUM
brj-23453	359	8	-	-	PUNCT
brj-23453	359	9	0104	0104	NUM
brj-23453	359	10	-	-	PUNCT
brj-23453	359	11	z	z	NOUN
brj-23453	359	12	akca	akca	NOUN
brj-23453	359	13	,	,	PUNCT
brj-23453	359	14	y.	y.	NOUN
brj-23453	359	15	,	,	PUNCT
brj-23453	359	16	yuldaşulu	yuldaşulu	PROPN
brj-23453	359	17	,	,	PUNCT
brj-23453	359	18	y.	y.	PROPN
brj-23453	359	19	b.	b.	PROPN
brj-23453	359	20	,	,	PUNCT
brj-23453	359	21	murad	murad	PROPN
brj-23453	359	22	,	,	PUNCT
brj-23453	359	23	e.	e.	PROPN
brj-23453	359	24	,	,	PUNCT
brj-23453	359	25	and	and	CCONJ
brj-23453	359	26	vahdati	vahdati	NOUN
brj-23453	359	27	,	,	PUNCT
brj-23453	359	28	k.	k.	PROPN
brj-23453	359	29	(	(	PUNCT
brj-23453	359	30	2020	2020	NUM
brj-23453	359	31	)	)	PUNCT
brj-23453	359	32	.	.	PUNCT
brj-23453	360	1	“	"	PUNCT
brj-23453	360	2	investigation	investigation	NOUN
brj-23453	360	3	into	into	ADP
brj-23453	360	4	the	the	DET
brj-23453	360	5	genetic	genetic	ADJ
brj-23453	360	6	resources	resource	NOUN
brj-23453	360	7	of	of	ADP
brj-23453	360	8	walnut	walnut	NOUN
brj-23453	360	9	in	in	ADP
brj-23453	360	10	kazakhstan	kazakhstan	PROPN
brj-23453	360	11	and	and	CCONJ
brj-23453	360	12	assessment	assessment	NOUN
brj-23453	360	13	of	of	ADP
brj-23453	360	14	prospective	prospective	ADJ
brj-23453	360	15	selections	selection	NOUN
brj-23453	360	16	,	,	PUNCT
brj-23453	360	17	”	"	PUNCT
brj-23453	360	18	international	international	ADJ
brj-23453	360	19	journal	journal	NOUN
brj-23453	360	20	of	of	ADP
brj-23453	360	21	horticultural	horticultural	ADJ
brj-23453	360	22	science	science	NOUN
brj-23453	360	23	and	and	CCONJ
brj-23453	360	24	technology	technology	NOUN
brj-23453	360	25	7(2	7(2	NOUN
brj-23453	360	26	)	)	PUNCT
brj-23453	360	27	,	,	PUNCT
brj-23453	360	28	93	93	NUM
brj-23453	360	29	-	-	SYM
brj-23453	360	30	102	102	NUM
brj-23453	360	31	.	.	PUNCT
brj-23453	361	1	aradhya	aradhya	NOUN
brj-23453	361	2	,	,	PUNCT
brj-23453	361	3	m.	m.	NOUN
brj-23453	361	4	,	,	PUNCT
brj-23453	361	5	woeste	woeste	NOUN
brj-23453	361	6	,	,	PUNCT
brj-23453	361	7	k.	k.	PROPN
brj-23453	361	8	,	,	PUNCT
brj-23453	361	9	and	and	CCONJ
brj-23453	361	10	velasco	velasco	PROPN
brj-23453	361	11	,	,	PUNCT
brj-23453	361	12	d.	d.	PROPN
brj-23453	361	13	(	(	PUNCT
brj-23453	361	14	2010	2010	NUM
brj-23453	361	15	)	)	PUNCT
brj-23453	361	16	.	.	PUNCT
brj-23453	362	1	“	"	PUNCT
brj-23453	362	2	structure	structure	NOUN
brj-23453	362	3	,	,	PUNCT
brj-23453	362	4	genetic	genetic	ADJ
brj-23453	362	5	diversity	diversity	NOUN
brj-23453	362	6	,	,	PUNCT
brj-23453	362	7	and	and	CCONJ
brj-23453	362	8	differentiation	differentiation	NOUN
brj-23453	362	9	in	in	ADP
brj-23453	362	10	walnut	walnut	NOUN
brj-23453	362	11	(	(	PUNCT
brj-23453	362	12	juglans	juglan	NOUN
brj-23453	362	13	regia	regia	PROPN
brj-23453	362	14	l.	l.	PROPN
brj-23453	362	15	)	)	PUNCT
brj-23453	362	16	that	that	PRON
brj-23453	362	17	has	have	AUX
brj-23453	362	18	been	be	AUX
brj-23453	362	19	cultivated	cultivate	VERB
brj-23453	362	20	,	,	PUNCT
brj-23453	362	21	”	"	PUNCT
brj-23453	362	22	horticulturae	horticulturae	PROPN
brj-23453	362	23	acta	acta	PROPN
brj-23453	362	24	861(16	861(16	NUM
brj-23453	362	25	)	)	PUNCT
brj-23453	362	26	,	,	PUNCT
brj-23453	362	27	127	127	NUM
brj-23453	362	28	-	-	SYM
brj-23453	362	29	133	133	NUM
brj-23453	362	30	.	.	PUNCT
brj-23453	362	31	bakir	bakir	NOUN
brj-23453	362	32	,	,	PUNCT
brj-23453	362	33	m.	m.	NOUN
brj-23453	362	34	,	,	PUNCT
brj-23453	362	35	dumanoğlu	dumanoğlu	PROPN
brj-23453	362	36	,	,	PUNCT
brj-23453	362	37	h.	h.	NOUN
brj-23453	362	38	,	,	PUNCT
brj-23453	362	39	erdoğan	erdoğan	PROPN
brj-23453	362	40	,	,	PUNCT
brj-23453	362	41	v.	v.	PROPN
brj-23453	362	42	,	,	PUNCT
brj-23453	362	43	ernim	ernim	PROPN
brj-23453	362	44	,	,	PUNCT
brj-23453	362	45	c.	c.	PROPN
brj-23453	362	46	,	,	PUNCT
brj-23453	362	47	and	and	CCONJ
brj-23453	362	48	macit	macit	ADJ
brj-23453	362	49	,	,	PUNCT
brj-23453	362	50	t.	t.	NOUN
brj-23453	362	51	(	(	PUNCT
brj-23453	362	52	2019	2019	NUM
brj-23453	362	53	)	)	PUNCT
brj-23453	362	54	.	.	PUNCT
brj-23453	363	1	“	"	PUNCT
brj-23453	363	2	characterization	characterization	NOUN
brj-23453	363	3	of	of	ADP
brj-23453	363	4	wild	wild	ADJ
brj-23453	363	5	apricot	apricot	NOUN
brj-23453	363	6	(	(	PUNCT
brj-23453	363	7	prunus	prunus	NOUN
brj-23453	363	8	armeniaca	armeniaca	PROPN
brj-23453	363	9	l.	l.	PROPN
brj-23453	363	10	)	)	PUNCT
brj-23453	363	11	genotypes	genotype	NOUN
brj-23453	363	12	selected	select	VERB
brj-23453	363	13	from	from	ADP
brj-23453	363	14	cappadocia	cappadocia	PROPN
brj-23453	363	15	region	region	NOUN
brj-23453	363	16	(	(	PUNCT
brj-23453	363	17	nevşehir	nevşehir	NOUN
brj-23453	363	18	-	-	PUNCT
brj-23453	363	19	turkey	turkey	NOUN
brj-23453	363	20	)	)	PUNCT
brj-23453	363	21	by	by	ADP
brj-23453	363	22	ssr	ssr	PROPN
brj-23453	363	23	markers	marker	NOUN
brj-23453	363	24	,	,	PUNCT
brj-23453	363	25	”	"	PUNCT
brj-23453	363	26	journal	journal	NOUN
brj-23453	363	27	of	of	ADP
brj-23453	363	28	agricultural	agricultural	ADJ
brj-23453	363	29	sciences	science	NOUN
brj-23453	363	30	25(4	25(4	NOUN
brj-23453	363	31	)	)	PUNCT
brj-23453	363	32	,	,	PUNCT
brj-23453	363	33	498	498	NUM
brj-23453	363	34	-	-	SYM
brj-23453	363	35	507	507	NUM
brj-23453	363	36	.	.	PUNCT
brj-23453	364	1	doi	doi	NOUN
brj-23453	364	2	:	:	PUNCT
brj-23453	364	3	10.15832	10.15832	NUM
brj-23453	364	4	/	/	SYM
brj-23453	364	5	ankutbd.457850	ankutbd.457850	NOUN
brj-23453	364	6	balapanov	balapanov	NOUN
brj-23453	364	7	,	,	PUNCT
brj-23453	364	8	i.	i.	NOUN
brj-23453	364	9	,	,	PUNCT
brj-23453	364	10	suprun	suprun	ADJ
brj-23453	364	11	,	,	PUNCT
brj-23453	364	12	i.	i.	NOUN
brj-23453	364	13	,	,	PUNCT
brj-23453	364	14	stepanov	stepanov	PROPN
brj-23453	364	15	,	,	PUNCT
brj-23453	364	16	i.	i.	PROPN
brj-23453	364	17	,	,	PUNCT
brj-23453	364	18	tokmakov	tokmakov	PROPN
brj-23453	364	19	,	,	PUNCT
brj-23453	364	20	s.	s.	PROPN
brj-23453	364	21	,	,	PUNCT
brj-23453	364	22	and	and	CCONJ
brj-23453	364	23	lugovskoy	lugovskoy	PROPN
brj-23453	364	24	,	,	PUNCT
brj-23453	364	25	a.	a.	NOUN
brj-23453	364	26	(	(	PUNCT
brj-23453	364	27	2019	2019	NUM
brj-23453	364	28	)	)	PUNCT
brj-23453	364	29	.	.	PUNCT
brj-23453	365	1	“	"	PUNCT
brj-23453	365	2	comparative	comparative	ADJ
brj-23453	365	3	analysis	analysis	NOUN
brj-23453	365	4	crimean	crimean	PROPN
brj-23453	365	5	,	,	PUNCT
brj-23453	365	6	moldavian	moldavian	ADJ
brj-23453	365	7	and	and	CCONJ
brj-23453	365	8	kuban	kuban	ADJ
brj-23453	365	9	persian	persian	ADJ
brj-23453	365	10	walnut	walnut	NOUN
brj-23453	365	11	collections	collection	NOUN
brj-23453	365	12	genetic	genetic	ADJ
brj-23453	365	13	variability	variability	NOUN
brj-23453	365	14	by	by	ADP
brj-23453	365	15	ssr	ssr	ADJ
brj-23453	365	16	-	-	PUNCT
brj-23453	365	17	markers	marker	NOUN
brj-23453	365	18	,	,	PUNCT
brj-23453	365	19	”	"	PUNCT
brj-23453	365	20	scientia	scientia	PROPN
brj-23453	365	21	horticulturae	horticulturae	PROPN
brj-23453	365	22	253	253	NUM
brj-23453	365	23	,	,	PUNCT
brj-23453	365	24	322	322	NUM
brj-23453	365	25	-	-	SYM
brj-23453	365	26	326	326	NUM
brj-23453	365	27	.	.	PUNCT
brj-23453	366	1	doi	doi	NOUN
brj-23453	366	2	:	:	PUNCT
brj-23453	366	3	10.1016	10.1016	NUM
brj-23453	366	4	/	/	SYM
brj-23453	366	5	j.scienta.2019.04.014	j.scienta.2019.04.014	PROPN
brj-23453	366	6	bernard	bernard	PROPN
brj-23453	366	7	,	,	PUNCT
brj-23453	366	8	a.	a.	NOUN
brj-23453	366	9	,	,	PUNCT
brj-23453	366	10	barreneche	barreneche	NOUN
brj-23453	366	11	,	,	PUNCT
brj-23453	366	12	t.	t.	PROPN
brj-23453	366	13	,	,	PUNCT
brj-23453	366	14	lheureux	lheureux	PROPN
brj-23453	366	15	,	,	PUNCT
brj-23453	366	16	f.	f.	PROPN
brj-23453	366	17	,	,	PUNCT
brj-23453	366	18	and	and	CCONJ
brj-23453	366	19	dirlewanger	dirlewang	ADJ
brj-23453	366	20	,	,	PUNCT
brj-23453	366	21	e.	e.	PROPN
brj-23453	366	22	(	(	PUNCT
brj-23453	366	23	2018	2018	NUM
brj-23453	366	24	)	)	PUNCT
brj-23453	366	25	.	.	PUNCT
brj-23453	367	1	“	"	PUNCT
brj-23453	367	2	analysis	analysis	NOUN
brj-23453	367	3	of	of	ADP
brj-23453	367	4	genetic	genetic	ADJ
brj-23453	367	5	diversity	diversity	NOUN
brj-23453	367	6	and	and	CCONJ
brj-23453	367	7	structure	structure	NOUN
brj-23453	367	8	in	in	ADP
brj-23453	367	9	a	a	DET
brj-23453	367	10	worldwide	worldwide	ADJ
brj-23453	367	11	walnut	walnut	NOUN
brj-23453	367	12	(	(	PUNCT
brj-23453	367	13	juglans	juglan	NOUN
brj-23453	367	14	regia	regia	PROPN
brj-23453	367	15	l.	l.	PROPN
brj-23453	367	16	)	)	PUNCT
brj-23453	367	17	germplasm	germplasm	NOUN
brj-23453	367	18	using	use	VERB
brj-23453	367	19	ssr	ssr	ADJ
brj-23453	367	20	markers	marker	NOUN
brj-23453	367	21	,	,	PUNCT
brj-23453	367	22	”	"	PUNCT
brj-23453	367	23	plos	plos	PROPN
brj-23453	367	24	one	one	NUM
brj-23453	367	25	13(11	13(11	NUM
brj-23453	367	26	)	)	PUNCT
brj-23453	367	27	,	,	PUNCT
brj-23453	367	28	article	article	NOUN
brj-23453	367	29	i	i	PROPN
brj-23453	367	30	d	d	PROPN
brj-23453	367	31	e0208021	e0208021	PROPN
brj-23453	367	32	.	.	PUNCT
brj-23453	368	1	doi	doi	NOUN
brj-23453	368	2	:	:	PUNCT
brj-23453	368	3	10.1371	10.1371	NUM
brj-23453	368	4	/	/	SYM
brj-23453	368	5	journal.pone.0208021	journal.pone.0208021	PROPN
brj-23453	368	6	bourguiba	bourguiba	PROPN
brj-23453	368	7	,	,	PUNCT
brj-23453	368	8	h.	h.	PROPN
brj-23453	368	9	,	,	PUNCT
brj-23453	368	10	audergon	audergon	PROPN
brj-23453	368	11	,	,	PUNCT
brj-23453	368	12	jean	jean	PROPN
brj-23453	368	13	-	-	PUNCT
brj-23453	368	14	marc	marc	PROPN
brj-23453	368	15	.	.	PROPN
brj-23453	368	16	,	,	PUNCT
brj-23453	369	1	krichen	krichen	PROPN
brj-23453	369	2	,	,	PUNCT
brj-23453	369	3	l.	l.	PROPN
brj-23453	369	4	,	,	PUNCT
brj-23453	369	5	trifi	trifi	PROPN
brj-23453	369	6	-	-	PUNCT
brj-23453	369	7	farah	farah	PROPN
brj-23453	369	8	,	,	PUNCT
brj-23453	369	9	n.	n.	NOUN
brj-23453	369	10	,	,	PUNCT
brj-23453	369	11	mamouni	mamouni	PROPN
brj-23453	369	12	,	,	PUNCT
brj-23453	369	13	a.	a.	NOUN
brj-23453	369	14	,	,	PUNCT
brj-23453	369	15	trabelsi	trabelsi	NOUN
brj-23453	369	16	,	,	PUNCT
brj-23453	369	17	s.	s.	PROPN
brj-23453	369	18	,	,	PUNCT
brj-23453	369	19	d’onofrio	d’onofrio	PROPN
brj-23453	369	20	,	,	PUNCT
brj-23453	369	21	c.	c.	PROPN
brj-23453	369	22	,	,	PUNCT
brj-23453	369	23	asma	asma	PROPN
brj-23453	369	24	,	,	PUNCT
brj-23453	369	25	b.m	b.m	PROPN
brj-23453	369	26	.	.	PROPN
brj-23453	369	27	,	,	PUNCT
brj-23453	369	28	santoni	santoni	PROPN
brj-23453	369	29	,	,	PUNCT
brj-23453	369	30	s.	s.	PROPN
brj-23453	369	31	,	,	PUNCT
brj-23453	369	32	and	and	CCONJ
brj-23453	369	33	khadari	khadari	PROPN
brj-23453	369	34	,	,	PUNCT
brj-23453	369	35	b.	b.	PROPN
brj-23453	369	36	(	(	PUNCT
brj-23453	369	37	2012	2012	NUM
brj-23453	369	38	)	)	PUNCT
brj-23453	369	39	.	.	PUNCT
brj-23453	370	1	“	"	PUNCT
brj-23453	370	2	loss	loss	NOUN
brj-23453	370	3	of	of	ADP
brj-23453	370	4	genetic	genetic	ADJ
brj-23453	370	5	diversity	diversity	NOUN
brj-23453	370	6	as	as	ADP
brj-23453	370	7	a	a	DET
brj-23453	370	8	signature	signature	NOUN
brj-23453	370	9	of	of	ADP
brj-23453	370	10	apricot	apricot	PROPN
brj-23453	370	11	domestication	domestication	NOUN
brj-23453	370	12	and	and	CCONJ
brj-23453	370	13	diffusion	diffusion	NOUN
brj-23453	370	14	into	into	ADP
brj-23453	370	15	the	the	DET
brj-23453	370	16	mediterranean	mediterranean	PROPN
brj-23453	370	17	basin	basin	NOUN
brj-23453	370	18	,	,	PUNCT
brj-23453	370	19	”	"	PUNCT
brj-23453	370	20	bmc	bmc	ADJ
brj-23453	370	21	plant	plant	NOUN
brj-23453	370	22	biology	biology	NOUN
brj-23453	370	23	12	12	NUM
brj-23453	370	24	,	,	PUNCT
brj-23453	370	25	49	49	NUM
brj-23453	370	26	.	.	PUNCT
brj-23453	370	27	bourguiba	bourguiba	PROPN
brj-23453	370	28	,	,	PUNCT
brj-23453	370	29	h.	h.	PROPN
brj-23453	370	30	,	,	PUNCT
brj-23453	370	31	krichen	krichen	PROPN
brj-23453	370	32	,	,	PUNCT
brj-23453	370	33	l.	l.	PROPN
brj-23453	370	34	,	,	PUNCT
brj-23453	370	35	audergon	audergon	PROPN
brj-23453	370	36	,	,	PUNCT
brj-23453	370	37	j.	j.	PROPN
brj-23453	370	38	m.	m.	PROPN
brj-23453	370	39	,	,	PUNCT
brj-23453	370	40	khadari	khadari	PROPN
brj-23453	370	41	,	,	PUNCT
brj-23453	370	42	b.	b.	PROPN
brj-23453	370	43	,	,	PUNCT
brj-23453	370	44	and	and	CCONJ
brj-23453	370	45	trifi	trifi	PROPN
brj-23453	370	46	-	-	PUNCT
brj-23453	370	47	farah	farah	PROPN
brj-23453	370	48	,	,	PUNCT
brj-23453	370	49	n.	n.	PROPN
brj-23453	370	50	(	(	PUNCT
brj-23453	370	51	2010	2010	NUM
brj-23453	370	52	)	)	PUNCT
brj-23453	370	53	.	.	PUNCT
brj-23453	371	1	“	"	PUNCT
brj-23453	371	2	impact	impact	NOUN
brj-23453	371	3	of	of	ADP
brj-23453	371	4	mapped	map	VERB
brj-23453	371	5	ssr	ssr	ADJ
brj-23453	371	6	markers	marker	NOUN
brj-23453	371	7	on	on	ADP
brj-23453	371	8	the	the	DET
brj-23453	371	9	genetic	genetic	ADJ
brj-23453	371	10	diversity	diversity	NOUN
brj-23453	371	11	of	of	ADP
brj-23453	371	12	apricot	apricot	PROPN
brj-23453	371	13	(	(	PUNCT
brj-23453	371	14	prunus	prunus	NOUN
brj-23453	371	15	armeniaca	armeniaca	PROPN
brj-23453	371	16	l.	l.	PROPN
brj-23453	371	17	)	)	PUNCT
brj-23453	371	18	in	in	ADP
brj-23453	371	19	tunisia	tunisia	NOUN
brj-23453	371	20	,	,	PUNCT
brj-23453	371	21	”	"	PUNCT
brj-23453	371	22	plant	plant	NOUN
brj-23453	371	23	molecular	molecular	ADJ
brj-23453	371	24	biology	biology	NOUN
brj-23453	371	25	reporter	reporter	NOUN
brj-23453	371	26	28	28	NUM
brj-23453	371	27	,	,	PUNCT
brj-23453	371	28	578	578	NUM
brj-23453	371	29	-	-	SYM
brj-23453	371	30	587	587	NUM
brj-23453	371	31	.	.	PUNCT
brj-23453	372	1	doi	doi	NOUN
brj-23453	372	2	:	:	PUNCT
brj-23453	372	3	10.1007	10.1007	NUM
brj-23453	372	4	/	/	SYM
brj-23453	372	5	s11105	s11105	NOUN
brj-23453	372	6	-	-	PUNCT
brj-23453	372	7	010	010	NUM
brj-23453	372	8	-	-	PUNCT
brj-23453	372	9	0189	0189	NUM
brj-23453	372	10	-	-	PUNCT
brj-23453	372	11	x	x	SYM
brj-23453	372	12	https://doi.org/10.1371/journal.pone.0208021	https://doi.org/10.1371/journal.pone.0208021	NOUN
brj-23453	372	13	peer	peer	NOUN
brj-23453	372	14	-	-	PUNCT
brj-23453	372	15	reviewed	review	VERB
brj-23453	372	16	article	article	NOUN
brj-23453	372	17	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	372	18	wani	wani	PROPN
brj-23453	372	19	et	et	PROPN
brj-23453	372	20	al	al	PROPN
brj-23453	372	21	.	.	PROPN
brj-23453	372	22	(	(	PUNCT
brj-23453	372	23	2024	2024	NUM
brj-23453	372	24	)	)	PUNCT
brj-23453	372	25	.	.	PUNCT
brj-23453	373	1	“	"	PUNCT
brj-23453	373	2	walnut	walnut	ADJ
brj-23453	373	3	population	population	NOUN
brj-23453	373	4	&	&	CCONJ
brj-23453	373	5	diversity	diversity	NOUN
brj-23453	373	6	,	,	PUNCT
brj-23453	373	7	”	"	PUNCT
brj-23453	373	8	bioresources	bioresource	NOUN
brj-23453	373	9	19(3	19(3	NUM
brj-23453	373	10	)	)	PUNCT
brj-23453	373	11	,	,	PUNCT
brj-23453	373	12	4213	4213	NUM
brj-23453	373	13	-	-	SYM
brj-23453	373	14	4237	4237	NUM
brj-23453	373	15	.	.	PUNCT
brj-23453	374	1	4228	4228	NUM
brj-23453	374	2	buyuksolak	buyuksolak	PROPN
brj-23453	374	3	,	,	PUNCT
brj-23453	374	4	z.	z.	PROPN
brj-23453	374	5	n.	n.	PROPN
brj-23453	374	6	,	,	PUNCT
brj-23453	374	7	askin	askin	PROPN
brj-23453	374	8	,	,	PUNCT
brj-23453	374	9	m.	m.	NOUN
brj-23453	374	10	a.	a.	PROPN
brj-23453	374	11	,	,	PUNCT
brj-23453	374	12	kahramanoglu	kahramanoglu	PROPN
brj-23453	374	13	,	,	PUNCT
brj-23453	374	14	i.	i.	NOUN
brj-23453	374	15	,	,	PUNCT
brj-23453	374	16	and	and	CCONJ
brj-23453	374	17	okatan	okatan	PROPN
brj-23453	374	18	,	,	PUNCT
brj-23453	374	19	v.	v.	PROPN
brj-23453	374	20	(	(	PUNCT
brj-23453	374	21	2020	2020	NUM
brj-23453	374	22	)	)	PUNCT
brj-23453	374	23	.	.	PUNCT
brj-23453	375	1	“	"	PUNCT
brj-23453	375	2	effects	effect	NOUN
brj-23453	375	3	of	of	ADP
brj-23453	375	4	altitude	altitude	NOUN
brj-23453	375	5	on	on	ADP
brj-23453	375	6	the	the	DET
brj-23453	375	7	pomological	pomological	ADJ
brj-23453	375	8	characteristics	characteristic	NOUN
brj-23453	375	9	and	and	CCONJ
brj-23453	375	10	chemical	chemical	NOUN
brj-23453	375	11	properties	property	NOUN
brj-23453	375	12	of	of	ADP
brj-23453	375	13	‘	'	PUNCT
brj-23453	375	14	chandler	chandler	NOUN
brj-23453	375	15	’	'	PUNCT
brj-23453	375	16	walnuts	walnut	NOUN
brj-23453	375	17	:	:	PUNCT
brj-23453	375	18	a	a	DET
brj-23453	375	19	case	case	NOUN
brj-23453	375	20	study	study	NOUN
brj-23453	375	21	in	in	ADP
brj-23453	375	22	uşak	uşak	PROPN
brj-23453	375	23	province	province	NOUN
brj-23453	375	24	,	,	PUNCT
brj-23453	375	25	”	"	PUNCT
brj-23453	375	26	acta	acta	PROPN
brj-23453	375	27	agrobotanica	agrobotanica	PROPN
brj-23453	375	28	73(3	73(3	NUM
brj-23453	375	29	)	)	PUNCT
brj-23453	375	30	,	,	PUNCT
brj-23453	375	31	article	article	NOUN
brj-23453	375	32	i	i	PROPN
brj-23453	375	33	d	d	PROPN
brj-23453	375	34	7333	7333	NUM
brj-23453	375	35	.	.	PUNCT
brj-23453	376	1	doi	doi	NOUN
brj-23453	376	2	:	:	PUNCT
brj-23453	376	3	10.5586	10.5586	NUM
brj-23453	376	4	/	/	SYM
brj-23453	376	5	aa.7333	aa.7333	PROPN
brj-23453	376	6	cervera	cervera	NOUN
brj-23453	376	7	,	,	PUNCT
brj-23453	376	8	m.	m.	NOUN
brj-23453	376	9	t.	t.	PROPN
brj-23453	376	10	,	,	PUNCT
brj-23453	376	11	plomion	plomion	PROPN
brj-23453	376	12	,	,	PUNCT
brj-23453	376	13	c.	c.	PROPN
brj-23453	376	14	,	,	PUNCT
brj-23453	376	15	and	and	CCONJ
brj-23453	376	16	malpica	malpica	PROPN
brj-23453	376	17	,	,	PUNCT
brj-23453	376	18	c.	c.	PROPN
brj-23453	376	19	(	(	PUNCT
brj-23453	376	20	2000	2000	NUM
brj-23453	376	21	)	)	PUNCT
brj-23453	376	22	.	.	PUNCT
brj-23453	377	1	“	"	PUNCT
brj-23453	377	2	molecular	molecular	ADJ
brj-23453	377	3	markers	marker	NOUN
brj-23453	377	4	and	and	CCONJ
brj-23453	377	5	genome	genome	NOUN
brj-23453	377	6	mapping	mapping	NOUN
brj-23453	377	7	in	in	ADP
brj-23453	377	8	woody	woody	NOUN
brj-23453	377	9	plants	plant	NOUN
brj-23453	377	10	,	,	PUNCT
brj-23453	377	11	”	"	PUNCT
brj-23453	377	12	in	in	ADP
brj-23453	377	13	:	:	PUNCT
brj-23453	377	14	molecular	molecular	ADJ
brj-23453	377	15	biology	biology	NOUN
brj-23453	377	16	of	of	ADP
brj-23453	377	17	woody	woody	NOUN
brj-23453	377	18	plants	plant	NOUN
brj-23453	377	19	:	:	PUNCT
brj-23453	377	20	volume	volume	NOUN
brj-23453	377	21	1	1	NUM
brj-23453	377	22	,	,	PUNCT
brj-23453	377	23	springer	springer	NOUN
brj-23453	377	24	,	,	PUNCT
brj-23453	377	25	dordrecht	dordrecht	PROPN
brj-23453	377	26	,	,	PUNCT
brj-23453	377	27	netherlands	netherlands	PROPN
brj-23453	377	28	,	,	PUNCT
brj-23453	377	29	pp	pp	X
brj-23453	377	30	.	.	PUNCT
brj-23453	378	1	375	375	NUM
brj-23453	378	2	-	-	SYM
brj-23453	378	3	394	394	NUM
brj-23453	378	4	.	.	PUNCT
brj-23453	379	1	crespel	crespel	PROPN
brj-23453	379	2	,	,	PUNCT
brj-23453	379	3	l.	l.	PROPN
brj-23453	379	4	,	,	PUNCT
brj-23453	379	5	chirollet	chirollet	NOUN
brj-23453	379	6	,	,	PUNCT
brj-23453	379	7	m.	m.	NOUN
brj-23453	379	8	,	,	PUNCT
brj-23453	379	9	durel	durel	NOUN
brj-23453	379	10	,	,	PUNCT
brj-23453	379	11	c.	c.	PROPN
brj-23453	379	12	,	,	PUNCT
brj-23453	379	13	zhang	zhang	PROPN
brj-23453	379	14	,	,	PUNCT
brj-23453	379	15	d.	d.	PROPN
brj-23453	379	16	,	,	PUNCT
brj-23453	379	17	meynet	meynet	PROPN
brj-23453	379	18	,	,	PUNCT
brj-23453	379	19	j.	j.	PROPN
brj-23453	379	20	,	,	PUNCT
brj-23453	379	21	and	and	CCONJ
brj-23453	379	22	gudin	gudin	NOUN
brj-23453	379	23	,	,	PUNCT
brj-23453	379	24	s.	s.	PROPN
brj-23453	379	25	(	(	PUNCT
brj-23453	379	26	2002	2002	NUM
brj-23453	379	27	)	)	PUNCT
brj-23453	379	28	.	.	PUNCT
brj-23453	380	1	“	"	PUNCT
brj-23453	380	2	mapping	mapping	NOUN
brj-23453	380	3	of	of	ADP
brj-23453	380	4	qualitative	qualitative	ADJ
brj-23453	380	5	and	and	CCONJ
brj-23453	380	6	quantitative	quantitative	ADJ
brj-23453	380	7	phenotypic	phenotypic	ADJ
brj-23453	380	8	traits	trait	NOUN
brj-23453	380	9	in	in	ADP
brj-23453	380	10	rosa	rosa	PROPN
brj-23453	380	11	using	use	VERB
brj-23453	380	12	aflp	aflp	PROPN
brj-23453	380	13	markers	marker	NOUN
brj-23453	380	14	,	,	PUNCT
brj-23453	380	15	”	"	PUNCT
brj-23453	380	16	theoretical	theoretical	ADJ
brj-23453	380	17	and	and	CCONJ
brj-23453	380	18	applied	apply	VERB
brj-23453	380	19	genetics	genetic	NOUN
brj-23453	380	20	105	105	NUM
brj-23453	380	21	,	,	PUNCT
brj-23453	380	22	1207	1207	NUM
brj-23453	380	23	-	-	SYM
brj-23453	380	24	1214	1214	NUM
brj-23453	380	25	.	.	PUNCT
brj-23453	381	1	doi	doi	NOUN
brj-23453	381	2	:	:	PUNCT
brj-23453	381	3	10.1007	10.1007	NUM
brj-23453	381	4	/	/	SYM
brj-23453	381	5	s00122002	s00122002	NOUN
brj-23453	381	6	-	-	PUNCT
brj-23453	381	7	1102	1102	NUM
brj-23453	381	8	-	-	SYM
brj-23453	381	9	2	2	NUM
brj-23453	381	10	dangl	dangl	NOUN
brj-23453	381	11	,	,	PUNCT
brj-23453	381	12	g.	g.	PROPN
brj-23453	381	13	s.	s.	PROPN
brj-23453	381	14	,	,	PUNCT
brj-23453	381	15	woeste	woeste	NOUN
brj-23453	381	16	,	,	PUNCT
brj-23453	381	17	k.	k.	PROPN
brj-23453	381	18	,	,	PUNCT
brj-23453	381	19	aradhya	aradhya	PROPN
brj-23453	381	20	,	,	PUNCT
brj-23453	381	21	m.	m.	PROPN
brj-23453	381	22	k.	k.	PROPN
brj-23453	381	23	,	,	PUNCT
brj-23453	381	24	koehmstedt	koehmstedt	PROPN
brj-23453	381	25	,	,	PUNCT
brj-23453	381	26	a.	a.	NOUN
brj-23453	381	27	,	,	PUNCT
brj-23453	381	28	simon	simon	PROPN
brj-23453	381	29	,	,	PUNCT
brj-23453	381	30	c.	c.	PROPN
brj-23453	381	31	,	,	PUNCT
brj-23453	381	32	potter	potter	NOUN
brj-23453	381	33	,	,	PUNCT
brj-23453	381	34	d.	d.	PROPN
brj-23453	381	35	,	,	PUNCT
brj-23453	381	36	and	and	CCONJ
brj-23453	381	37	mcgranahan	mcgranahan	PROPN
brj-23453	381	38	,	,	PUNCT
brj-23453	381	39	g.	g.	PROPN
brj-23453	381	40	(	(	PUNCT
brj-23453	381	41	2005	2005	NUM
brj-23453	381	42	)	)	PUNCT
brj-23453	381	43	.	.	PUNCT
brj-23453	382	1	“	"	PUNCT
brj-23453	382	2	characterization	characterization	NOUN
brj-23453	382	3	of	of	ADP
brj-23453	382	4	14	14	NUM
brj-23453	382	5	microsatellite	microsatellite	ADJ
brj-23453	382	6	markers	marker	NOUN
brj-23453	382	7	for	for	ADP
brj-23453	382	8	genetic	genetic	ADJ
brj-23453	382	9	analysis	analysis	NOUN
brj-23453	382	10	and	and	CCONJ
brj-23453	382	11	cultivar	cultivar	NOUN
brj-23453	382	12	identification	identification	NOUN
brj-23453	382	13	of	of	ADP
brj-23453	382	14	walnut	walnut	NOUN
brj-23453	382	15	,	,	PUNCT
brj-23453	382	16	”	"	PUNCT
brj-23453	382	17	journal	journal	NOUN
brj-23453	382	18	of	of	ADP
brj-23453	382	19	the	the	DET
brj-23453	382	20	american	american	ADJ
brj-23453	382	21	society	society	NOUN
brj-23453	382	22	for	for	ADP
brj-23453	382	23	horticultural	horticultural	ADJ
brj-23453	382	24	science	science	NOUN
brj-23453	382	25	130(3	130(3	NUM
brj-23453	382	26	)	)	PUNCT
brj-23453	382	27	,	,	PUNCT
brj-23453	382	28	348	348	NUM
brj-23453	382	29	-	-	SYM
brj-23453	382	30	354	354	NUM
brj-23453	382	31	.	.	PUNCT
brj-23453	383	1	doi	doi	NOUN
brj-23453	383	2	:	:	PUNCT
brj-23453	383	3	10.1007	10.1007	NUM
brj-23453	383	4	/	/	SYM
brj-23453	383	5	s11676	s11676	NUM
brj-23453	383	6	-	-	PUNCT
brj-23453	383	7	020	020	NUM
brj-23453	383	8	-	-	PUNCT
brj-23453	383	9	01254	01254	NUM
brj-23453	383	10	-	-	PUNCT
brj-23453	383	11	z	z	NOUN
brj-23453	383	12	dar	dar	NOUN
brj-23453	383	13	,	,	PUNCT
brj-23453	383	14	a.	a.	NOUN
brj-23453	383	15	a.	a.	PROPN
brj-23453	383	16	,	,	PUNCT
brj-23453	383	17	mahajan	mahajan	PROPN
brj-23453	383	18	,	,	PUNCT
brj-23453	383	19	r.	r.	PROPN
brj-23453	383	20	,	,	PUNCT
brj-23453	383	21	lay	lay	VERB
brj-23453	383	22	,	,	PUNCT
brj-23453	383	23	p.	p.	NOUN
brj-23453	383	24	,	,	PUNCT
brj-23453	383	25	and	and	CCONJ
brj-23453	383	26	sharma	sharma	PROPN
brj-23453	383	27	,	,	PUNCT
brj-23453	383	28	s.	s.	PROPN
brj-23453	383	29	(	(	PUNCT
brj-23453	383	30	2017	2017	NUM
brj-23453	383	31	)	)	PUNCT
brj-23453	383	32	.	.	PUNCT
brj-23453	384	1	“	"	PUNCT
brj-23453	384	2	the	the	DET
brj-23453	384	3	population	population	NOUN
brj-23453	384	4	structure	structure	NOUN
brj-23453	384	5	and	and	CCONJ
brj-23453	384	6	genetic	genetic	ADJ
brj-23453	384	7	diversity	diversity	NOUN
brj-23453	384	8	of	of	ADP
brj-23453	384	9	cucumis	cucumis	PROPN
brj-23453	384	10	sativus	sativus	PROPN
brj-23453	384	11	l.	l.	PROPN
brj-23453	384	12	through	through	ADP
brj-23453	384	13	the	the	DET
brj-23453	384	14	use	use	NOUN
brj-23453	384	15	of	of	ADP
brj-23453	384	16	ssr	ssr	ADJ
brj-23453	384	17	indicators	indicator	NOUN
brj-23453	384	18	,	,	PUNCT
brj-23453	384	19	”	"	PUNCT
brj-23453	384	20	biotech	biotech	NOUN
brj-23453	384	21	7	7	NUM
brj-23453	384	22	,	,	PUNCT
brj-23453	384	23	50	50	NUM
brj-23453	384	24	-	-	SYM
brj-23453	384	25	55	55	NUM
brj-23453	384	26	.	.	PUNCT
brj-23453	385	1	doi	doi	NOUN
brj-23453	385	2	:	:	PUNCT
brj-23453	385	3	10.1007	10.1007	NUM
brj-23453	385	4	/	/	SYM
brj-23453	385	5	s13205	s13205	NOUN
brj-23453	385	6	-	-	PUNCT
brj-23453	385	7	017	017	NUM
brj-23453	385	8	-	-	PUNCT
brj-23453	385	9	0944	0944	NUM
brj-23453	385	10	-	-	PUNCT
brj-23453	385	11	x	x	SYM
brj-23453	385	12	doyle	doyle	NOUN
brj-23453	385	13	,	,	PUNCT
brj-23453	385	14	j.	j.	PROPN
brj-23453	385	15	l.	l.	PROPN
brj-23453	385	16	,	,	PUNCT
brj-23453	385	17	and	and	CCONJ
brj-23453	385	18	doyle	doyle	PROPN
brj-23453	385	19	j.	j.	PROPN
brj-23453	385	20	j.	j.	PROPN
brj-23453	385	21	(	(	PUNCT
brj-23453	385	22	1990	1990	NUM
brj-23453	385	23	)	)	PUNCT
brj-23453	385	24	.	.	PUNCT
brj-23453	386	1	“	"	PUNCT
brj-23453	386	2	dna	dna	NOUN
brj-23453	386	3	isolation	isolation	NOUN
brj-23453	386	4	from	from	ADP
brj-23453	386	5	newly	newly	ADV
brj-23453	386	6	harvested	harvest	VERB
brj-23453	386	7	plant	plant	NOUN
brj-23453	386	8	tissue	tissue	NOUN
brj-23453	386	9	,	,	PUNCT
brj-23453	386	10	”	"	PUNCT
brj-23453	386	11	concentrate	concentrate	VERB
brj-23453	386	12	12	12	NUM
brj-23453	386	13	,	,	PUNCT
brj-23453	386	14	13	13	NUM
brj-23453	386	15	-	-	SYM
brj-23453	386	16	15	15	NUM
brj-23453	386	17	.	.	PUNCT
brj-23453	387	1	ebrahimi	ebrahimi	PROPN
brj-23453	387	2	,	,	PUNCT
brj-23453	387	3	a.	a.	NOUN
brj-23453	387	4	,	,	PUNCT
brj-23453	387	5	fatahi	fatahi	PROPN
brj-23453	387	6	,	,	PUNCT
brj-23453	387	7	r.	r.	NOUN
brj-23453	387	8	,	,	PUNCT
brj-23453	387	9	and	and	CCONJ
brj-23453	387	10	zamani	zamani	PROPN
brj-23453	387	11	,	,	PUNCT
brj-23453	387	12	z.	z.	PROPN
brj-23453	387	13	(	(	PUNCT
brj-23453	387	14	2011	2011	NUM
brj-23453	387	15	)	)	PUNCT
brj-23453	387	16	.	.	PUNCT
brj-23453	388	1	“	"	PUNCT
brj-23453	388	2	analysis	analysis	NOUN
brj-23453	388	3	of	of	ADP
brj-23453	388	4	genetic	genetic	ADJ
brj-23453	388	5	diversity	diversity	NOUN
brj-23453	388	6	among	among	ADP
brj-23453	388	7	some	some	DET
brj-23453	388	8	persian	persian	ADJ
brj-23453	388	9	walnut	walnut	NOUN
brj-23453	388	10	genotypes	genotype	NOUN
brj-23453	388	11	(	(	PUNCT
brj-23453	388	12	juglans	juglan	NOUN
brj-23453	388	13	regia	regia	NOUN
brj-23453	388	14	l.	l.	PROPN
brj-23453	388	15	)	)	PUNCT
brj-23453	388	16	using	use	VERB
brj-23453	388	17	morphological	morphological	ADJ
brj-23453	388	18	traits	trait	NOUN
brj-23453	388	19	and	and	CCONJ
brj-23453	388	20	ssrs	ssr	NOUN
brj-23453	388	21	markers	marker	NOUN
brj-23453	388	22	,	,	PUNCT
brj-23453	388	23	”	"	PUNCT
brj-23453	388	24	scientia	scientia	PROPN
brj-23453	388	25	horticulturae	horticulturae	PROPN
brj-23453	388	26	130(1	130(1	NUM
brj-23453	388	27	)	)	PUNCT
brj-23453	388	28	,	,	PUNCT
brj-23453	388	29	146	146	NUM
brj-23453	388	30	-	-	SYM
brj-23453	388	31	151	151	NUM
brj-23453	388	32	.	.	PUNCT
brj-23453	389	1	doi	doi	NOUN
brj-23453	389	2	:	:	PUNCT
brj-23453	389	3	10.1016	10.1016	NUM
brj-23453	389	4	/	/	SYM
brj-23453	389	5	j.scienta.2011.06.028	j.scienta.2011.06.028	PROPN
brj-23453	389	6	ebrahimi	ebrahimi	PROPN
brj-23453	389	7	,	,	PUNCT
brj-23453	389	8	a.	a.	NOUN
brj-23453	389	9	,	,	PUNCT
brj-23453	389	10	khadivi	khadivi	NOUN
brj-23453	389	11	-	-	PUNCT
brj-23453	389	12	khub	khub	NOUN
brj-23453	389	13	,	,	PUNCT
brj-23453	389	14	a.	a.	NOUN
brj-23453	389	15	,	,	PUNCT
brj-23453	389	16	nosrati	nosrati	PROPN
brj-23453	389	17	,	,	PUNCT
brj-23453	389	18	z.	z.	PROPN
brj-23453	389	19	,	,	PUNCT
brj-23453	389	20	and	and	CCONJ
brj-23453	389	21	karimi	karimi	PROPN
brj-23453	389	22	,	,	PUNCT
brj-23453	389	23	r.	r.	PROPN
brj-23453	389	24	(	(	PUNCT
brj-23453	389	25	2015	2015	NUM
brj-23453	389	26	)	)	PUNCT
brj-23453	389	27	.	.	PUNCT
brj-23453	390	1	“	"	PUNCT
brj-23453	390	2	identification	identification	NOUN
brj-23453	390	3	of	of	ADP
brj-23453	390	4	superior	superior	ADJ
brj-23453	390	5	walnut	walnut	NOUN
brj-23453	390	6	(	(	PUNCT
brj-23453	390	7	juglans	juglan	NOUN
brj-23453	390	8	regia	regia	NOUN
brj-23453	390	9	)	)	PUNCT
brj-23453	390	10	genotypes	genotype	NOUN
brj-23453	390	11	with	with	ADP
brj-23453	390	12	late	late	ADJ
brj-23453	390	13	leafing	leafing	NOUN
brj-23453	390	14	and	and	CCONJ
brj-23453	390	15	high	high	ADJ
brj-23453	390	16	kernel	kernel	NOUN
brj-23453	390	17	quality	quality	NOUN
brj-23453	390	18	in	in	ADP
brj-23453	390	19	iran	iran	PROPN
brj-23453	390	20	,	,	PUNCT
brj-23453	390	21	”	"	PUNCT
brj-23453	390	22	scientia	scientia	PROPN
brj-23453	390	23	horticulturae	horticulturae	PROPN
brj-23453	390	24	193	193	NUM
brj-23453	390	25	,	,	PUNCT
brj-23453	390	26	195	195	NUM
brj-23453	390	27	-	-	PUNCT
brj-23453	390	28	201	201	NUM
brj-23453	390	29	.	.	PUNCT
brj-23453	391	1	doi	doi	NOUN
brj-23453	391	2	:	:	PUNCT
brj-23453	391	3	10.1016	10.1016	NUM
brj-23453	391	4	/	/	SYM
brj-23453	391	5	j.scienta.2015.06.049	j.scienta.2015.06.049	PROPN
brj-23453	391	6	ebrahimi	ebrahimi	PROPN
brj-23453	391	7	,	,	PUNCT
brj-23453	391	8	a.	a.	NOUN
brj-23453	391	9	,	,	PUNCT
brj-23453	391	10	zarei	zarei	ADV
brj-23453	391	11	,	,	PUNCT
brj-23453	391	12	a.	a.	NOUN
brj-23453	391	13	,	,	PUNCT
brj-23453	391	14	lawson	lawson	PROPN
brj-23453	391	15	,	,	PUNCT
brj-23453	391	16	s.	s.	PROPN
brj-23453	391	17	,	,	PUNCT
brj-23453	391	18	woeste	woeste	NOUN
brj-23453	391	19	,	,	PUNCT
brj-23453	391	20	k.	k.	PROPN
brj-23453	391	21	e.	e.	PROPN
brj-23453	391	22	,	,	PUNCT
brj-23453	391	23	and	and	CCONJ
brj-23453	391	24	smulders	smulder	NOUN
brj-23453	391	25	,	,	PUNCT
brj-23453	391	26	m.	m.	NOUN
brj-23453	391	27	j.	j.	PROPN
brj-23453	391	28	m.	m.	PROPN
brj-23453	391	29	(	(	PUNCT
brj-23453	391	30	2016	2016	NUM
brj-23453	391	31	)	)	PUNCT
brj-23453	391	32	.	.	PUNCT
brj-23453	392	1	“	"	PUNCT
brj-23453	392	2	genetic	genetic	ADJ
brj-23453	392	3	diversity	diversity	NOUN
brj-23453	392	4	and	and	CCONJ
brj-23453	392	5	genetic	genetic	ADJ
brj-23453	392	6	structure	structure	NOUN
brj-23453	392	7	of	of	ADP
brj-23453	392	8	persian	persian	ADJ
brj-23453	392	9	walnut	walnut	NOUN
brj-23453	392	10	(	(	PUNCT
brj-23453	392	11	juglans	juglan	NOUN
brj-23453	392	12	regia	regia	NOUN
brj-23453	392	13	)	)	PUNCT
brj-23453	392	14	accessions	accession	NOUN
brj-23453	392	15	from	from	ADP
brj-23453	392	16	14	14	NUM
brj-23453	392	17	european	european	ADJ
brj-23453	392	18	,	,	PUNCT
brj-23453	392	19	african	african	ADJ
brj-23453	392	20	,	,	PUNCT
brj-23453	392	21	and	and	CCONJ
brj-23453	392	22	asian	asian	ADJ
brj-23453	392	23	countries	country	NOUN
brj-23453	392	24	using	use	VERB
brj-23453	392	25	ssr	ssr	ADJ
brj-23453	392	26	markers	marker	NOUN
brj-23453	392	27	,	,	PUNCT
brj-23453	392	28	”	"	PUNCT
brj-23453	392	29	tree	tree	NOUN
brj-23453	392	30	genetics	genetic	NOUN
brj-23453	392	31	&	&	CCONJ
brj-23453	392	32	genomes	genome	NOUN
brj-23453	392	33	12	12	NUM
brj-23453	392	34	,	,	PUNCT
brj-23453	392	35	1	1	NUM
brj-23453	392	36	-	-	SYM
brj-23453	392	37	12	12	NUM
brj-23453	392	38	.	.	PUNCT
brj-23453	393	1	doi	doi	NOUN
brj-23453	393	2	:	:	PUNCT
brj-23453	393	3	10.1007	10.1007	NUM
brj-23453	393	4	/	/	SYM
brj-23453	393	5	s11295	s11295	NOUN
brj-23453	393	6	-	-	PUNCT
brj-23453	393	7	016	016	NUM
brj-23453	393	8	-	-	PUNCT
brj-23453	393	9	1075	1075	NUM
brj-23453	393	10	-	-	PUNCT
brj-23453	393	11	y	y	NOUN
brj-23453	393	12	evanno	evanno	NOUN
brj-23453	393	13	,	,	PUNCT
brj-23453	393	14	g.	g.	PROPN
brj-23453	393	15	,	,	PUNCT
brj-23453	393	16	regnaut	regnaut	PROPN
brj-23453	393	17	,	,	PUNCT
brj-23453	393	18	s.	s.	PROPN
brj-23453	393	19	,	,	PUNCT
brj-23453	393	20	and	and	CCONJ
brj-23453	393	21	goudet	goudet	NOUN
brj-23453	393	22	,	,	PUNCT
brj-23453	393	23	j.	j.	PROPN
brj-23453	393	24	(	(	PUNCT
brj-23453	393	25	2005	2005	NUM
brj-23453	393	26	)	)	PUNCT
brj-23453	393	27	.	.	PUNCT
brj-23453	394	1	“	"	PUNCT
brj-23453	394	2	detecting	detect	VERB
brj-23453	394	3	the	the	DET
brj-23453	394	4	number	number	NOUN
brj-23453	394	5	of	of	ADP
brj-23453	394	6	clusters	cluster	NOUN
brj-23453	394	7	of	of	ADP
brj-23453	394	8	individuals	individual	NOUN
brj-23453	394	9	using	use	VERB
brj-23453	394	10	the	the	DET
brj-23453	394	11	software	software	NOUN
brj-23453	394	12	structure	structure	NOUN
brj-23453	394	13	:	:	PUNCT
brj-23453	394	14	a	a	DET
brj-23453	394	15	simulation	simulation	NOUN
brj-23453	394	16	study	study	NOUN
brj-23453	394	17	,	,	PUNCT
brj-23453	394	18	”	"	PUNCT
brj-23453	394	19	molecular	molecular	ADJ
brj-23453	394	20	ecology	ecology	NOUN
brj-23453	394	21	14(8	14(8	NUM
brj-23453	394	22	)	)	PUNCT
brj-23453	394	23	,	,	PUNCT
brj-23453	394	24	2611	2611	NUM
brj-23453	394	25	-	-	SYM
brj-23453	394	26	2620	2620	NUM
brj-23453	394	27	.	.	PUNCT
brj-23453	395	1	doi	doi	NOUN
brj-23453	395	2	:	:	PUNCT
brj-23453	395	3	10.1111	10.1111	NUM
brj-23453	395	4	/	/	SYM
brj-23453	395	5	j.1365	j.1365	NOUN
brj-23453	395	6	-	-	PUNCT
brj-23453	395	7	294x.2005	294x.2005	NUM
brj-23453	395	8	.	.	PUNCT
brj-23453	396	1	02553.x	02553.x	DET
brj-23453	396	2	foroni	foroni	PROPN
brj-23453	396	3	,	,	PUNCT
brj-23453	396	4	i.	i.	NOUN
brj-23453	396	5	,	,	PUNCT
brj-23453	396	6	woeste	woeste	NOUN
brj-23453	396	7	,	,	PUNCT
brj-23453	396	8	k.	k.	PROPN
brj-23453	396	9	,	,	PUNCT
brj-23453	396	10	and	and	CCONJ
brj-23453	396	11	monti	monti	PROPN
brj-23453	396	12	.	.	PUNCT
brj-23453	397	1	l.m	l.m	PROPN
brj-23453	397	2	.	.	PROPN
brj-23453	397	3	,	,	PUNCT
brj-23453	397	4	and	and	CCONJ
brj-23453	397	5	rao	rao	PROPN
brj-23453	397	6	,	,	PUNCT
brj-23453	397	7	r.	r.	PROPN
brj-23453	397	8	(	(	PUNCT
brj-23453	397	9	2007	2007	NUM
brj-23453	397	10	)	)	PUNCT
brj-23453	397	11	.	.	PUNCT
brj-23453	398	1	“	"	PUNCT
brj-23453	398	2	sorrento	sorrento	PROPN
brj-23453	398	3	’	'	PUNCT
brj-23453	398	4	walnut	walnut	NOUN
brj-23453	398	5	identification	identification	NOUN
brj-23453	398	6	through	through	ADP
brj-23453	398	7	the	the	DET
brj-23453	398	8	utilization	utilization	NOUN
brj-23453	398	9	of	of	ADP
brj-23453	398	10	simple	simple	ADJ
brj-23453	398	11	sequence	sequence	NOUN
brj-23453	398	12	repeats	repeat	NOUN
brj-23453	398	13	(	(	PUNCT
brj-23453	398	14	ssrs	ssr	NOUN
brj-23453	398	15	)	)	PUNCT
brj-23453	398	16	,	,	PUNCT
brj-23453	398	17	”	"	PUNCT
brj-23453	398	18	genetic	genetic	ADJ
brj-23453	398	19	resources	resource	NOUN
brj-23453	398	20	and	and	CCONJ
brj-23453	398	21	crop	crop	NOUN
brj-23453	398	22	evolution	evolution	NOUN
brj-23453	398	23	54	54	NUM
brj-23453	398	24	,	,	PUNCT
brj-23453	398	25	1081	1081	NUM
brj-23453	398	26	-	-	SYM
brj-23453	398	27	1094	1094	NUM
brj-23453	398	28	.	.	PUNCT
brj-23453	399	1	doi	doi	NOUN
brj-23453	399	2	:	:	PUNCT
brj-23453	399	3	10.1007	10.1007	NUM
brj-23453	399	4	/	/	SYM
brj-23453	399	5	s10722	s10722	NOUN
brj-23453	399	6	-	-	PUNCT
brj-23453	399	7	006	006	NUM
brj-23453	399	8	-	-	PUNCT
brj-23453	399	9	9187	9187	NUM
brj-23453	399	10	-	-	SYM
brj-23453	399	11	0	0	NUM
brj-23453	399	12	gupta	gupta	PROPN
brj-23453	399	13	,	,	PUNCT
brj-23453	399	14	p.	p.	NOUN
brj-23453	399	15	k.	k.	PROPN
brj-23453	399	16	,	,	PUNCT
brj-23453	399	17	and	and	CCONJ
brj-23453	399	18	varshney	varshney	NOUN
brj-23453	399	19	,	,	PUNCT
brj-23453	399	20	r.	r.	PROPN
brj-23453	399	21	k.	k.	PROPN
brj-23453	400	1	(	(	PUNCT
brj-23453	400	2	2000	2000	NUM
brj-23453	400	3	)	)	PUNCT
brj-23453	400	4	.	.	PUNCT
brj-23453	401	1	“	"	PUNCT
brj-23453	401	2	the	the	DET
brj-23453	401	3	development	development	NOUN
brj-23453	401	4	and	and	CCONJ
brj-23453	401	5	use	use	NOUN
brj-23453	401	6	of	of	ADP
brj-23453	401	7	microsatellite	microsatellite	ADJ
brj-23453	401	8	markers	marker	NOUN
brj-23453	401	9	for	for	ADP
brj-23453	401	10	genetic	genetic	ADJ
brj-23453	401	11	analysis	analysis	NOUN
brj-23453	401	12	and	and	CCONJ
brj-23453	401	13	plant	plant	NOUN
brj-23453	401	14	breeding	breed	VERB
brj-23453	401	15	with	with	ADP
brj-23453	401	16	emphasis	emphasis	NOUN
brj-23453	401	17	on	on	ADP
brj-23453	401	18	bread	bread	NOUN
brj-23453	401	19	wheat	wheat	NOUN
brj-23453	401	20	,	,	PUNCT
brj-23453	401	21	”	"	PUNCT
brj-23453	401	22	euphytica	euphytica	PROPN
brj-23453	401	23	113(3	113(3	NUM
brj-23453	401	24	)	)	PUNCT
brj-23453	401	25	,	,	PUNCT
brj-23453	401	26	163	163	NUM
brj-23453	401	27	-	-	SYM
brj-23453	401	28	185	185	NUM
brj-23453	401	29	.	.	PUNCT
brj-23453	402	1	doi	doi	NOUN
brj-23453	402	2	:	:	PUNCT
brj-23453	402	3	10.1023	10.1023	NUM
brj-23453	402	4	/	/	SYM
brj-23453	402	5	a:1003910819967	a:1003910819967	PROPN
brj-23453	402	6	hamza	hamza	PROPN
brj-23453	402	7	,	,	PUNCT
brj-23453	402	8	s.	s.	PROPN
brj-23453	402	9	,	,	PUNCT
brj-23453	402	10	ben	ben	PROPN
brj-23453	402	11	hamida	hamida	PROPN
brj-23453	402	12	,	,	PUNCT
brj-23453	402	13	w.	w.	PROPN
brj-23453	402	14	,	,	PUNCT
brj-23453	402	15	rebaï	rebaï	PROPN
brj-23453	402	16	,	,	PUNCT
brj-23453	402	17	a.	a.	NOUN
brj-23453	402	18	,	,	PUNCT
brj-23453	402	19	and	and	CCONJ
brj-23453	402	20	harrabi	harrabi	NOUN
brj-23453	402	21	,	,	PUNCT
brj-23453	402	22	m.	m.	NOUN
brj-23453	402	23	(	(	PUNCT
brj-23453	402	24	2004	2004	NUM
brj-23453	402	25	)	)	PUNCT
brj-23453	402	26	.	.	PUNCT
brj-23453	403	1	“	"	PUNCT
brj-23453	403	2	ssr	ssr	NOUN
brj-23453	403	3	-	-	PUNCT
brj-23453	403	4	based	base	VERB
brj-23453	403	5	genetic	genetic	ADJ
brj-23453	403	6	diversity	diversity	NOUN
brj-23453	403	7	assessment	assessment	NOUN
brj-23453	403	8	among	among	ADP
brj-23453	403	9	tunisian	tunisian	ADJ
brj-23453	403	10	winter	winter	NOUN
brj-23453	403	11	barley	barley	NOUN
brj-23453	403	12	and	and	CCONJ
brj-23453	403	13	relationship	relationship	NOUN
brj-23453	403	14	with	with	ADP
brj-23453	403	15	morphological	morphological	ADJ
brj-23453	403	16	traits	trait	NOUN
brj-23453	403	17	,	,	PUNCT
brj-23453	403	18	”	"	PUNCT
brj-23453	403	19	euphytica	euphytica	PROPN
brj-23453	403	20	135(1	135(1	NUM
brj-23453	403	21	)	)	PUNCT
brj-23453	403	22	,	,	PUNCT
brj-23453	403	23	107	107	NUM
brj-23453	403	24	-	-	SYM
brj-23453	403	25	118	118	NUM
brj-23453	403	26	.	.	PUNCT
brj-23453	404	1	doi	doi	NOUN
brj-23453	404	2	:	:	PUNCT
brj-23453	404	3	10.1023	10.1023	NUM
brj-23453	404	4	/	/	SYM
brj-23453	404	5	b	b	NOUN
brj-23453	404	6	:	:	PUNCT
brj-23453	404	7	euph.0000009547.65808.bf	euph.0000009547.65808.bf	PROPN
brj-23453	404	8	https://doi.org/10.1111/j.1365-294x.2005.02553.x	https://doi.org/10.1111/j.1365-294x.2005.02553.x	PROPN
brj-23453	404	9	peer	peer	NOUN
brj-23453	404	10	-	-	PUNCT
brj-23453	404	11	reviewed	review	VERB
brj-23453	404	12	article	article	NOUN
brj-23453	404	13	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	404	14	wani	wani	PROPN
brj-23453	404	15	et	et	PROPN
brj-23453	404	16	al	al	PROPN
brj-23453	404	17	.	.	PROPN
brj-23453	404	18	(	(	PUNCT
brj-23453	404	19	2024	2024	NUM
brj-23453	404	20	)	)	PUNCT
brj-23453	404	21	.	.	PUNCT
brj-23453	405	1	“	"	PUNCT
brj-23453	405	2	walnut	walnut	ADJ
brj-23453	405	3	population	population	NOUN
brj-23453	405	4	&	&	CCONJ
brj-23453	405	5	diversity	diversity	NOUN
brj-23453	405	6	,	,	PUNCT
brj-23453	405	7	”	"	PUNCT
brj-23453	405	8	bioresources	bioresource	NOUN
brj-23453	405	9	19(3	19(3	NUM
brj-23453	405	10	)	)	PUNCT
brj-23453	405	11	,	,	PUNCT
brj-23453	405	12	4213	4213	NUM
brj-23453	405	13	-	-	SYM
brj-23453	405	14	4237	4237	NUM
brj-23453	405	15	.	.	PUNCT
brj-23453	406	1	4229	4229	NUM
brj-23453	406	2	hassani	hassani	PROPN
brj-23453	406	3	,	,	PUNCT
brj-23453	406	4	d.	d.	PROPN
brj-23453	406	5	,	,	PUNCT
brj-23453	406	6	sarikhani	sarikhani	PROPN
brj-23453	406	7	,	,	PUNCT
brj-23453	406	8	s.	s.	PROPN
brj-23453	406	9	,	,	PUNCT
brj-23453	406	10	dastjerdi	dastjerdi	PROPN
brj-23453	406	11	,	,	PUNCT
brj-23453	406	12	r.	r.	PROPN
brj-23453	406	13	,	,	PUNCT
brj-23453	406	14	mahmoudi	mahmoudi	NOUN
brj-23453	406	15	,	,	PUNCT
brj-23453	406	16	r.	r.	PROPN
brj-23453	406	17	,	,	PUNCT
brj-23453	406	18	soleimani	soleimani	PROPN
brj-23453	406	19	,	,	PUNCT
brj-23453	406	20	a.	a.	NOUN
brj-23453	406	21	,	,	PUNCT
brj-23453	406	22	and	and	CCONJ
brj-23453	406	23	vahdati	vahdati	NOUN
brj-23453	406	24	,	,	PUNCT
brj-23453	406	25	k.	k.	PROPN
brj-23453	406	26	(	(	PUNCT
brj-23453	406	27	2020	2020	NUM
brj-23453	406	28	)	)	PUNCT
brj-23453	406	29	.	.	PUNCT
brj-23453	407	1	“	"	PUNCT
brj-23453	407	2	situation	situation	NOUN
brj-23453	407	3	and	and	CCONJ
brj-23453	407	4	recent	recent	ADJ
brj-23453	407	5	trends	trend	NOUN
brj-23453	407	6	on	on	ADP
brj-23453	407	7	cultivation	cultivation	NOUN
brj-23453	407	8	and	and	CCONJ
brj-23453	407	9	breeding	breeding	NOUN
brj-23453	407	10	of	of	ADP
brj-23453	407	11	persian	persian	ADJ
brj-23453	407	12	walnut	walnut	NOUN
brj-23453	407	13	in	in	ADP
brj-23453	407	14	iran	iran	PROPN
brj-23453	407	15	,	,	PUNCT
brj-23453	407	16	”	"	PUNCT
brj-23453	407	17	scientia	scientia	PROPN
brj-23453	407	18	horticulturae	horticulturae	PROPN
brj-23453	407	19	270	270	NUM
brj-23453	407	20	,	,	PUNCT
brj-23453	407	21	article	article	NOUN
brj-23453	407	22	i	i	PROPN
brj-23453	407	23	d	d	PROPN
brj-23453	407	24	109369	109369	NUM
brj-23453	407	25	.	.	PUNCT
brj-23453	408	1	doi	doi	NOUN
brj-23453	408	2	:	:	PUNCT
brj-23453	408	3	10.1016	10.1016	NUM
brj-23453	408	4	/	/	SYM
brj-23453	408	5	j.scienta.2020.109369	j.scienta.2020.109369	PROPN
brj-23453	408	6	hu	hu	PROPN
brj-23453	408	7	,	,	PUNCT
brj-23453	408	8	x.	x.	PROPN
brj-23453	408	9	,	,	PUNCT
brj-23453	408	10	zheng	zheng	PROPN
brj-23453	408	11	,	,	PUNCT
brj-23453	408	12	p.	p.	PROPN
brj-23453	408	13	,	,	PUNCT
brj-23453	408	14	ni	ni	PROPN
brj-23453	408	15	,	,	PUNCT
brj-23453	408	16	b.	b.	PROPN
brj-23453	408	17	,	,	PUNCT
brj-23453	408	18	miao	miao	PROPN
brj-23453	408	19	,	,	PUNCT
brj-23453	408	20	x.	x.	NOUN
brj-23453	408	21	,	,	PUNCT
brj-23453	408	22	zhao	zhao	PROPN
brj-23453	408	23	,	,	PUNCT
brj-23453	408	24	z.	z.	PROPN
brj-23453	408	25	,	,	PUNCT
brj-23453	408	26	and	and	CCONJ
brj-23453	408	27	li	li	PROPN
brj-23453	408	28	,	,	PUNCT
brj-23453	408	29	m.	m.	NOUN
brj-23453	408	30	(	(	PUNCT
brj-23453	408	31	2018	2018	NUM
brj-23453	408	32	)	)	PUNCT
brj-23453	408	33	.	.	PUNCT
brj-23453	409	1	“	"	PUNCT
brj-23453	409	2	population	population	NOUN
brj-23453	409	3	genetic	genetic	ADJ
brj-23453	409	4	diversity	diversity	NOUN
brj-23453	409	5	and	and	CCONJ
brj-23453	409	6	structure	structure	NOUN
brj-23453	409	7	analysis	analysis	NOUN
brj-23453	409	8	of	of	ADP
brj-23453	409	9	wild	wild	ADJ
brj-23453	409	10	apricot	apricot	NOUN
brj-23453	409	11	(	(	PUNCT
brj-23453	409	12	prunus	prunus	NOUN
brj-23453	409	13	armeniaca	armeniaca	PROPN
brj-23453	409	14	l.	l.	PROPN
brj-23453	409	15	)	)	PUNCT
brj-23453	409	16	revealed	reveal	VERB
brj-23453	409	17	by	by	ADP
brj-23453	409	18	ssr	ssr	PROPN
brj-23453	409	19	markers	marker	NOUN
brj-23453	409	20	in	in	ADP
brj-23453	409	21	the	the	DET
brj-23453	409	22	tien	tien	PROPN
brj-23453	409	23	-	-	PUNCT
brj-23453	409	24	shan	shan	PROPN
brj-23453	409	25	mountains	mountain	NOUN
brj-23453	409	26	of	of	ADP
brj-23453	409	27	china	china	PROPN
brj-23453	409	28	,	,	PUNCT
brj-23453	409	29	”	"	PUNCT
brj-23453	409	30	pakistan	pakistan	PROPN
brj-23453	409	31	journal	journal	NOUN
brj-23453	409	32	of	of	ADP
brj-23453	409	33	botany	botany	NOUN
brj-23453	409	34	50(2	50(2	NUM
brj-23453	409	35	)	)	PUNCT
brj-23453	409	36	,	,	PUNCT
brj-23453	409	37	609	609	NUM
brj-23453	409	38	-	-	SYM
brj-23453	409	39	615	615	NUM
brj-23453	409	40	.	.	PUNCT
brj-23453	410	1	jacobs	jacobs	PROPN
brj-23453	410	2	,	,	PUNCT
brj-23453	410	3	d.	d.	PROPN
brj-23453	410	4	r.	r.	PROPN
brj-23453	410	5	,	,	PUNCT
brj-23453	410	6	blomhoff	blomhoff	PROPN
brj-23453	410	7	,	,	PUNCT
brj-23453	410	8	r.	r.	PROPN
brj-23453	410	9	,	,	PUNCT
brj-23453	410	10	carlsen	carlsen	PROPN
brj-23453	410	11	,	,	PUNCT
brj-23453	410	12	m.	m.	PROPN
brj-23453	410	13	h.	h.	PROPN
brj-23453	410	14	,	,	PUNCT
brj-23453	410	15	and	and	CCONJ
brj-23453	410	16	andersen	andersen	PROPN
brj-23453	410	17	,	,	PUNCT
brj-23453	410	18	l.	l.	PROPN
brj-23453	410	19	f.	f.	PROPN
brj-23453	410	20	(	(	PUNCT
brj-23453	410	21	2006	2006	NUM
brj-23453	410	22	)	)	PUNCT
brj-23453	410	23	.	.	PUNCT
brj-23453	411	1	“	"	PUNCT
brj-23453	411	2	the	the	DET
brj-23453	411	3	potential	potential	ADJ
brj-23453	411	4	function	function	NOUN
brj-23453	411	5	of	of	ADP
brj-23453	411	6	antioxidants	antioxidant	NOUN
brj-23453	411	7	in	in	ADP
brj-23453	411	8	the	the	DET
brj-23453	411	9	health	health	NOUN
brj-23453	411	10	benefits	benefit	NOUN
brj-23453	411	11	of	of	ADP
brj-23453	411	12	nuts	nut	NOUN
brj-23453	411	13	,	,	PUNCT
brj-23453	411	14	”	"	PUNCT
brj-23453	411	15	british	british	ADJ
brj-23453	411	16	journal	journal	NOUN
brj-23453	411	17	of	of	ADP
brj-23453	411	18	nutrition	nutrition	NOUN
brj-23453	411	19	96	96	NUM
brj-23453	411	20	,	,	PUNCT
brj-23453	411	21	52	52	NUM
brj-23453	411	22	-	-	SYM
brj-23453	411	23	60	60	NUM
brj-23453	411	24	.	.	PUNCT
brj-23453	412	1	doi	doi	NOUN
brj-23453	412	2	:	:	PUNCT
brj-23453	412	3	10.1017	10.1017	NUM
brj-23453	412	4	/	/	SYM
brj-23453	412	5	bjn20061864	bjn20061864	NOUN
brj-23453	412	6	khadivi	khadivi	NOUN
brj-23453	412	7	-	-	PUNCT
brj-23453	412	8	khub	khub	NOUN
brj-23453	412	9	,	,	PUNCT
brj-23453	412	10	a.	a.	PROPN
brj-23453	412	11	,	,	PUNCT
brj-23453	412	12	ebrahimi	ebrahimi	PROPN
brj-23453	412	13	,	,	PUNCT
brj-23453	412	14	a.	a.	NOUN
brj-23453	412	15	,	,	PUNCT
brj-23453	412	16	mohammadi	mohammadi	NOUN
brj-23453	412	17	,	,	PUNCT
brj-23453	412	18	a.	a.	NOUN
brj-23453	412	19	,	,	PUNCT
brj-23453	412	20	and	and	CCONJ
brj-23453	412	21	kari	kari	X
brj-23453	412	22	,	,	PUNCT
brj-23453	412	23	a.	a.	NOUN
brj-23453	412	24	(	(	PUNCT
brj-23453	412	25	2015	2015	NUM
brj-23453	412	26	)	)	PUNCT
brj-23453	412	27	.	.	PUNCT
brj-23453	413	1	“	"	PUNCT
brj-23453	413	2	characterization	characterization	NOUN
brj-23453	413	3	and	and	CCONJ
brj-23453	413	4	selection	selection	NOUN
brj-23453	413	5	of	of	ADP
brj-23453	413	6	walnut	walnut	NOUN
brj-23453	413	7	(	(	PUNCT
brj-23453	413	8	juglans	juglan	NOUN
brj-23453	413	9	regia	regia	NOUN
brj-23453	413	10	l.	l.	PROPN
brj-23453	413	11	)	)	PUNCT
brj-23453	413	12	genotypes	genotype	NOUN
brj-23453	413	13	from	from	ADP
brj-23453	413	14	seedling	seedle	VERB
brj-23453	413	15	origin	origin	NOUN
brj-23453	413	16	trees	tree	NOUN
brj-23453	413	17	,	,	PUNCT
brj-23453	413	18	”	"	PUNCT
brj-23453	413	19	tree	tree	NOUN
brj-23453	413	20	genetics	genetic	NOUN
brj-23453	413	21	&	&	CCONJ
brj-23453	413	22	genomes	genome	NOUN
brj-23453	413	23	11	11	NUM
brj-23453	413	24	,	,	PUNCT
brj-23453	413	25	1	1	NUM
brj-23453	413	26	-	-	SYM
brj-23453	413	27	10	10	NUM
brj-23453	413	28	.	.	PUNCT
brj-23453	414	1	doi	doi	NOUN
brj-23453	414	2	:	:	PUNCT
brj-23453	414	3	10.1007	10.1007	NUM
brj-23453	414	4	/	/	SYM
brj-23453	414	5	s11295	s11295	NOUN
brj-23453	414	6	-	-	PUNCT
brj-23453	414	7	015	015	NUM
brj-23453	414	8	-	-	PUNCT
brj-23453	414	9	0882	0882	NUM
brj-23453	414	10	-	-	PUNCT
brj-23453	414	11	x	x	SYM
brj-23453	414	12	hartel	hartel	PROPN
brj-23453	414	13	,	,	PUNCT
brj-23453	414	14	l.	l.	PROPN
brj-23453	414	15	,	,	PUNCT
brj-23453	414	16	and	and	CCONJ
brj-23453	414	17	clark	clark	PROPN
brj-23453	414	18	,	,	PUNCT
brj-23453	414	19	a.	a.	NOUN
brj-23453	414	20	g.	g.	PROPN
brj-23453	414	21	(	(	PUNCT
brj-23453	414	22	2007	2007	NUM
brj-23453	414	23	)	)	PUNCT
brj-23453	414	24	.	.	PUNCT
brj-23453	415	1	principles	principle	NOUN
brj-23453	415	2	of	of	ADP
brj-23453	415	3	population	population	NOUN
brj-23453	415	4	genetics	genetic	NOUN
brj-23453	415	5	,	,	PUNCT
brj-23453	415	6	sinauer	sinauer	PROPN
brj-23453	415	7	associates	associates	PROPN
brj-23453	415	8	inc	inc	PROPN
brj-23453	415	9	.	.	PROPN
brj-23453	415	10	,	,	PUNCT
brj-23453	415	11	sunderland	sunderland	PROPN
brj-23453	415	12	,	,	PUNCT
brj-23453	415	13	ma	ma	PROPN
brj-23453	415	14	,	,	PUNCT
brj-23453	415	15	usa	usa	PROPN
brj-23453	415	16	.	.	PROPN
brj-23453	415	17	lamia	lamia	PROPN
brj-23453	415	18	,	,	PUNCT
brj-23453	415	19	k.	k.	PROPN
brj-23453	415	20	,	,	PUNCT
brj-23453	415	21	hedia	hedia	PROPN
brj-23453	415	22	,	,	PUNCT
brj-23453	415	23	b.	b.	PROPN
brj-23453	415	24	,	,	PUNCT
brj-23453	415	25	jean	jean	PROPN
brj-23453	415	26	-	-	PUNCT
brj-23453	415	27	marc	marc	PROPN
brj-23453	415	28	,	,	PUNCT
brj-23453	415	29	a.	a.	NOUN
brj-23453	415	30	,	,	PUNCT
brj-23453	415	31	and	and	CCONJ
brj-23453	415	32	neila	neila	NOUN
brj-23453	415	33	,	,	PUNCT
brj-23453	415	34	t.	t.	PROPN
brj-23453	415	35	f.	f.	PROPN
brj-23453	415	36	(	(	PUNCT
brj-23453	415	37	2010	2010	NUM
brj-23453	415	38	)	)	PUNCT
brj-23453	415	39	.	.	PUNCT
brj-23453	416	1	“	"	PUNCT
brj-23453	416	2	comparative	comparative	ADJ
brj-23453	416	3	analysis	analysis	NOUN
brj-23453	416	4	of	of	ADP
brj-23453	416	5	genetic	genetic	ADJ
brj-23453	416	6	diversity	diversity	NOUN
brj-23453	416	7	in	in	ADP
brj-23453	416	8	tunisian	tunisian	ADJ
brj-23453	416	9	apricot	apricot	PROPN
brj-23453	416	10	germplasm	germplasm	NOUN
brj-23453	416	11	using	use	VERB
brj-23453	416	12	aflp	aflp	PROPN
brj-23453	416	13	and	and	CCONJ
brj-23453	416	14	ssr	ssr	PROPN
brj-23453	416	15	markers	marker	NOUN
brj-23453	416	16	,	,	PUNCT
brj-23453	416	17	”	"	PUNCT
brj-23453	416	18	scientia	scientia	PROPN
brj-23453	416	19	horticulturae	horticulturae	PROPN
brj-23453	416	20	127(1	127(1	NUM
brj-23453	416	21	)	)	PUNCT
brj-23453	416	22	,	,	PUNCT
brj-23453	416	23	54	54	NUM
brj-23453	416	24	-	-	SYM
brj-23453	416	25	63	63	NUM
brj-23453	416	26	.	.	PUNCT
brj-23453	417	1	doi	doi	NOUN
brj-23453	417	2	:	:	PUNCT
brj-23453	417	3	10.1016	10.1016	NUM
brj-23453	417	4	/	/	SYM
brj-23453	417	5	j.scienta.2010.09.012	j.scienta.2010.09.012	PROPN
brj-23453	417	6	li	li	PROPN
brj-23453	417	7	,	,	PUNCT
brj-23453	417	8	w.	w.	PROPN
brj-23453	417	9	,	,	PUNCT
brj-23453	417	10	liu	liu	PROPN
brj-23453	417	11	,	,	PUNCT
brj-23453	417	12	l.	l.	PROPN
brj-23453	417	13	,	,	PUNCT
brj-23453	417	14	wang	wang	PROPN
brj-23453	417	15	,	,	PUNCT
brj-23453	417	16	y.	y.	PROPN
brj-23453	417	17	,	,	PUNCT
brj-23453	417	18	zhang	zhang	PROPN
brj-23453	417	19	,	,	PUNCT
brj-23453	417	20	q.	q.	PROPN
brj-23453	417	21	,	,	PUNCT
brj-23453	417	22	fan	fan	PROPN
brj-23453	417	23	,	,	PUNCT
brj-23453	417	24	g.	g.	PROPN
brj-23453	417	25	,	,	PUNCT
brj-23453	417	26	zhang	zhang	PROPN
brj-23453	417	27	,	,	PUNCT
brj-23453	417	28	s.	s.	PROPN
brj-23453	417	29	,	,	PUNCT
brj-23453	417	30	and	and	CCONJ
brj-23453	417	31	liao	liao	PROPN
brj-23453	417	32	,	,	PUNCT
brj-23453	417	33	k.	k.	PROPN
brj-23453	417	34	(	(	PUNCT
brj-23453	417	35	2020	2020	NUM
brj-23453	417	36	)	)	PUNCT
brj-23453	417	37	.	.	PUNCT
brj-23453	418	1	“	"	PUNCT
brj-23453	418	2	genetic	genetic	ADJ
brj-23453	418	3	diversity	diversity	NOUN
brj-23453	418	4	,	,	PUNCT
brj-23453	418	5	population	population	NOUN
brj-23453	418	6	structure	structure	NOUN
brj-23453	418	7	,	,	PUNCT
brj-23453	418	8	and	and	CCONJ
brj-23453	418	9	relationships	relationship	NOUN
brj-23453	418	10	of	of	ADP
brj-23453	418	11	apricot	apricot	PROPN
brj-23453	418	12	(	(	PUNCT
brj-23453	418	13	prunus	prunus	NOUN
brj-23453	418	14	)	)	PUNCT
brj-23453	418	15	based	base	VERB
brj-23453	418	16	on	on	ADP
brj-23453	418	17	restriction	restriction	NOUN
brj-23453	418	18	site	site	NOUN
brj-23453	418	19	-	-	PUNCT
brj-23453	418	20	associated	associate	VERB
brj-23453	418	21	dna	dna	NOUN
brj-23453	418	22	sequencing	sequencing	NOUN
brj-23453	418	23	,	,	PUNCT
brj-23453	418	24	”	"	PUNCT
brj-23453	418	25	horticulture	horticulture	NOUN
brj-23453	418	26	research	research	NOUN
brj-23453	418	27	7	7	NUM
brj-23453	418	28	,	,	PUNCT
brj-23453	418	29	article	article	NOUN
brj-23453	418	30	69	69	NUM
brj-23453	418	31	.	.	PUNCT
brj-23453	419	1	doi	doi	NOUN
brj-23453	419	2	:	:	PUNCT
brj-23453	419	3	10.1038	10.1038	NUM
brj-23453	419	4	/	/	SYM
brj-23453	419	5	s41438	s41438	NUM
brj-23453	419	6	-	-	PUNCT
brj-23453	419	7	020	020	NUM
brj-23453	419	8	-	-	PUNCT
brj-23453	419	9	0284	0284	NUM
brj-23453	419	10	-	-	SYM
brj-23453	419	11	6	6	NUM
brj-23453	419	12	litt	litt	VERB
brj-23453	419	13	,	,	PUNCT
brj-23453	419	14	m.	m.	NOUN
brj-23453	419	15	,	,	PUNCT
brj-23453	419	16	and	and	CCONJ
brj-23453	419	17	luty	luty	NOUN
brj-23453	419	18	,	,	PUNCT
brj-23453	419	19	j.	j.	PROPN
brj-23453	419	20	a.	a.	PROPN
brj-23453	419	21	(	(	PUNCT
brj-23453	419	22	1989	1989	NUM
brj-23453	419	23	)	)	PUNCT
brj-23453	419	24	.	.	PUNCT
brj-23453	420	1	“	"	PUNCT
brj-23453	420	2	a	a	DET
brj-23453	420	3	hypervariable	hypervariable	ADJ
brj-23453	420	4	microsatellite	microsatellite	NOUN
brj-23453	420	5	revealed	reveal	VERB
brj-23453	420	6	by	by	ADP
brj-23453	420	7	in	in	ADP
brj-23453	420	8	vitro	vitro	X
brj-23453	420	9	amplification	amplification	NOUN
brj-23453	420	10	of	of	ADP
brj-23453	420	11	a	a	DET
brj-23453	420	12	dinucleotide	dinucleotide	NOUN
brj-23453	420	13	repeat	repeat	NOUN
brj-23453	420	14	within	within	ADP
brj-23453	420	15	the	the	DET
brj-23453	420	16	cardiac	cardiac	ADJ
brj-23453	420	17	muscle	muscle	NOUN
brj-23453	420	18	actin	actin	NOUN
brj-23453	420	19	gene	gene	NOUN
brj-23453	420	20	,	,	PUNCT
brj-23453	420	21	”	"	PUNCT
brj-23453	420	22	american	american	ADJ
brj-23453	420	23	journal	journal	PROPN
brj-23453	420	24	of	of	ADP
brj-23453	420	25	human	human	PROPN
brj-23453	420	26	genetics	genetic	NOUN
brj-23453	420	27	44(3	44(3	PROPN
brj-23453	420	28	)	)	PUNCT
brj-23453	420	29	,	,	PUNCT
brj-23453	420	30	article	article	NOUN
brj-23453	420	31	397	397	NUM
brj-23453	420	32	.	.	PUNCT
brj-23453	421	1	lorenzo	lorenzo	PROPN
brj-23453	421	2	,	,	PUNCT
brj-23453	421	3	d.	d.	PROPN
brj-23453	421	4	g.	g.	PROPN
brj-23453	421	5	,	,	PUNCT
brj-23453	421	6	and	and	CCONJ
brj-23453	421	7	michelangelo	michelangelo	NOUN
brj-23453	421	8	,	,	PUNCT
brj-23453	421	9	m.	m.	NOUN
brj-23453	421	10	(	(	PUNCT
brj-23453	421	11	2020	2020	NUM
brj-23453	421	12	)	)	PUNCT
brj-23453	421	13	.	.	PUNCT
brj-23453	422	1	“	"	PUNCT
brj-23453	422	2	a	a	DET
brj-23453	422	3	real	real	ADJ
brj-23453	422	4	-	-	PUNCT
brj-23453	422	5	life	life	NOUN
brj-23453	422	6	case	case	NOUN
brj-23453	422	7	study	study	NOUN
brj-23453	422	8	of	of	ADP
brj-23453	422	9	cocoa	cocoa	NOUN
brj-23453	422	10	beans	bean	NOUN
brj-23453	422	11	and	and	CCONJ
brj-23453	422	12	alcoholic	alcoholic	ADJ
brj-23453	422	13	beverages	beverage	NOUN
brj-23453	422	14	utilizing	utilize	VERB
brj-23453	422	15	ssr	ssr	ADJ
brj-23453	422	16	profiling	profiling	NOUN
brj-23453	422	17	of	of	ADP
brj-23453	422	18	the	the	DET
brj-23453	422	19	‘	'	PUNCT
brj-23453	422	20	nacional	nacional	ADJ
brj-23453	422	21	’	'	PUNCT
brj-23453	422	22	and	and	CCONJ
brj-23453	422	23	‘	'	PUNCT
brj-23453	422	24	ccn51	ccn51	NOUN
brj-23453	422	25	’	'	PUNCT
brj-23453	422	26	varieties	variety	NOUN
brj-23453	422	27	,	,	PUNCT
brj-23453	422	28	”	"	PUNCT
brj-23453	422	29	food	food	NOUN
brj-23453	422	30	control	control	NOUN
brj-23453	422	31	118	118	NUM
brj-23453	422	32	,	,	PUNCT
brj-23453	422	33	article	article	NOUN
brj-23453	422	34	i	i	PROPN
brj-23453	422	35	d	d	PROPN
brj-23453	422	36	107392	107392	NUM
brj-23453	422	37	.	.	PUNCT
brj-23453	423	1	mahmoodi	mahmoodi	PROPN
brj-23453	423	2	,	,	PUNCT
brj-23453	423	3	r.	r.	PROPN
brj-23453	423	4	,	,	PUNCT
brj-23453	423	5	rahmani	rahmani	PROPN
brj-23453	423	6	,	,	PUNCT
brj-23453	423	7	f.	f.	PROPN
brj-23453	423	8	,	,	PUNCT
brj-23453	423	9	and	and	CCONJ
brj-23453	423	10	rezaee	rezaee	PROPN
brj-23453	423	11	,	,	PUNCT
brj-23453	423	12	r.	r.	PROPN
brj-23453	423	13	(	(	PUNCT
brj-23453	423	14	2013	2013	NUM
brj-23453	423	15	)	)	PUNCT
brj-23453	423	16	.	.	PUNCT
brj-23453	424	1	“	"	PUNCT
brj-23453	424	2	genetic	genetic	ADJ
brj-23453	424	3	diversity	diversity	NOUN
brj-23453	424	4	among	among	ADP
brj-23453	424	5	juglans	juglan	NOUN
brj-23453	424	6	regia	regia	NOUN
brj-23453	424	7	l.	l.	NOUN
brj-23453	424	8	genotypes	genotype	NOUN
brj-23453	424	9	assessed	assess	VERB
brj-23453	424	10	by	by	ADP
brj-23453	424	11	morphological	morphological	ADJ
brj-23453	424	12	traits	trait	NOUN
brj-23453	424	13	and	and	CCONJ
brj-23453	424	14	microsatellite	microsatellite	ADJ
brj-23453	424	15	markers	marker	NOUN
brj-23453	424	16	,	,	PUNCT
brj-23453	424	17	”	"	PUNCT
brj-23453	424	18	spanish	spanish	ADJ
brj-23453	424	19	journal	journal	NOUN
brj-23453	424	20	of	of	ADP
brj-23453	424	21	agricultural	agricultural	ADJ
brj-23453	424	22	research	research	NOUN
brj-23453	424	23	11(2	11(2	NUM
brj-23453	424	24	)	)	PUNCT
brj-23453	424	25	,	,	PUNCT
brj-23453	424	26	431	431	NUM
brj-23453	424	27	-	-	SYM
brj-23453	424	28	437	437	NUM
brj-23453	424	29	.	.	PUNCT
brj-23453	425	1	doi	doi	NOUN
brj-23453	425	2	:	:	PUNCT
brj-23453	425	3	10.5424	10.5424	NUM
brj-23453	425	4	/	/	SYM
brj-23453	425	5	sjar/2013112	sjar/2013112	ADJ
brj-23453	425	6	-	-	PUNCT
brj-23453	425	7	3445	3445	NUM
brj-23453	425	8	messina	messina	PROPN
brj-23453	425	9	,	,	PUNCT
brj-23453	425	10	r.	r.	PROPN
brj-23453	425	11	,	,	PUNCT
brj-23453	425	12	lain	lain	PROPN
brj-23453	425	13	,	,	PUNCT
brj-23453	425	14	o.	o.	PROPN
brj-23453	425	15	,	,	PUNCT
brj-23453	425	16	marrazzo	marrazzo	PROPN
brj-23453	425	17	,	,	PUNCT
brj-23453	425	18	m.	m.	NOUN
brj-23453	425	19	t.	t.	PROPN
brj-23453	425	20	,	,	PUNCT
brj-23453	425	21	cipriani	cipriani	PROPN
brj-23453	425	22	,	,	PUNCT
brj-23453	425	23	g.	g.	PROPN
brj-23453	425	24	,	,	PUNCT
brj-23453	425	25	and	and	CCONJ
brj-23453	425	26	testolin	testolin	PROPN
brj-23453	425	27	,	,	PUNCT
brj-23453	425	28	r.	r.	PROPN
brj-23453	425	29	(	(	PUNCT
brj-23453	425	30	2004	2004	NUM
brj-23453	425	31	)	)	PUNCT
brj-23453	425	32	.	.	PUNCT
brj-23453	426	1	“	"	PUNCT
brj-23453	426	2	new	new	ADJ
brj-23453	426	3	set	set	NOUN
brj-23453	426	4	of	of	ADP
brj-23453	426	5	microsatellite	microsatellite	ADJ
brj-23453	426	6	loci	locus	NOUN
brj-23453	426	7	isolated	isolate	VERB
brj-23453	426	8	in	in	ADP
brj-23453	426	9	apricot	apricot	PROPN
brj-23453	426	10	,	,	PUNCT
brj-23453	426	11	”	"	PUNCT
brj-23453	426	12	molecular	molecular	ADJ
brj-23453	426	13	ecology	ecology	NOUN
brj-23453	426	14	notes	note	VERB
brj-23453	426	15	4(3	4(3	NUM
brj-23453	426	16	)	)	PUNCT
brj-23453	426	17	,	,	PUNCT
brj-23453	426	18	432	432	NUM
brj-23453	426	19	-	-	SYM
brj-23453	426	20	434	434	NUM
brj-23453	426	21	.	.	PUNCT
brj-23453	427	1	nei	nei	PROPN
brj-23453	427	2	,	,	PUNCT
brj-23453	427	3	m.	m.	NOUN
brj-23453	427	4	(	(	PUNCT
brj-23453	427	5	1973	1973	NUM
brj-23453	427	6	)	)	PUNCT
brj-23453	427	7	.	.	PUNCT
brj-23453	428	1	“	"	PUNCT
brj-23453	428	2	analysis	analysis	NOUN
brj-23453	428	3	of	of	ADP
brj-23453	428	4	gene	gene	NOUN
brj-23453	428	5	diversity	diversity	NOUN
brj-23453	428	6	in	in	ADP
brj-23453	428	7	subdivided	subdivided	ADJ
brj-23453	428	8	populations	population	NOUN
brj-23453	428	9	,	,	PUNCT
brj-23453	428	10	”	"	PUNCT
brj-23453	428	11	proceedings	proceeding	NOUN
brj-23453	428	12	of	of	ADP
brj-23453	428	13	the	the	DET
brj-23453	428	14	national	national	PROPN
brj-23453	428	15	academy	academy	PROPN
brj-23453	428	16	of	of	ADP
brj-23453	428	17	sciences	science	NOUN
brj-23453	428	18	70(12	70(12	NUM
brj-23453	428	19	)	)	PUNCT
brj-23453	428	20	,	,	PUNCT
brj-23453	428	21	3321	3321	NUM
brj-23453	428	22	-	-	SYM
brj-23453	428	23	3323	3323	NUM
brj-23453	428	24	.	.	PUNCT
brj-23453	429	1	doi	doi	NOUN
brj-23453	429	2	:	:	PUNCT
brj-23453	429	3	10.1073	10.1073	NUM
brj-23453	429	4	/	/	SYM
brj-23453	429	5	pnas.70.12.3321	pnas.70.12.3321	NOUN
brj-23453	429	6	peakall	peakall	NOUN
brj-23453	429	7	,	,	PUNCT
brj-23453	429	8	r.	r.	PROPN
brj-23453	429	9	o.	o.	PROPN
brj-23453	429	10	d.	d.	PROPN
brj-23453	429	11	,	,	PUNCT
brj-23453	429	12	and	and	CCONJ
brj-23453	429	13	smouse	smouse	NOUN
brj-23453	429	14	,	,	PUNCT
brj-23453	429	15	p.	p.	PROPN
brj-23453	429	16	e.	e.	PROPN
brj-23453	430	1	(	(	PUNCT
brj-23453	430	2	2006	2006	NUM
brj-23453	430	3	)	)	PUNCT
brj-23453	430	4	.	.	PUNCT
brj-23453	431	1	“	"	PUNCT
brj-23453	431	2	genalex	genalex	PROPN
brj-23453	431	3	6	6	NUM
brj-23453	431	4	:	:	PUNCT
brj-23453	431	5	genetic	genetic	ADJ
brj-23453	431	6	analysis	analysis	NOUN
brj-23453	431	7	in	in	ADP
brj-23453	431	8	excel	excel	NOUN
brj-23453	431	9	.	.	PUNCT
brj-23453	432	1	population	population	NOUN
brj-23453	432	2	genetic	genetic	ADJ
brj-23453	432	3	software	software	NOUN
brj-23453	432	4	for	for	ADP
brj-23453	432	5	teaching	teaching	NOUN
brj-23453	432	6	and	and	CCONJ
brj-23453	432	7	research	research	NOUN
brj-23453	432	8	,	,	PUNCT
brj-23453	432	9	”	"	PUNCT
brj-23453	432	10	molecular	molecular	ADJ
brj-23453	432	11	ecology	ecology	NOUN
brj-23453	432	12	notes	note	VERB
brj-23453	432	13	6(1	6(1	NUM
brj-23453	432	14	)	)	PUNCT
brj-23453	432	15	,	,	PUNCT
brj-23453	432	16	288	288	NUM
brj-23453	432	17	-	-	SYM
brj-23453	432	18	295	295	NUM
brj-23453	432	19	.	.	PUNCT
brj-23453	433	1	doi	doi	NOUN
brj-23453	433	2	:	:	PUNCT
brj-23453	433	3	10.1111	10.1111	NUM
brj-23453	433	4	/	/	SYM
brj-23453	433	5	j.1471	j.1471	PROPN
brj-23453	433	6	-	-	PUNCT
brj-23453	433	7	8286.2005	8286.2005	NUM
brj-23453	433	8	.	.	PUNCT
brj-23453	434	1	01155.x	01155.x	NUM
brj-23453	434	2	pop	pop	NOUN
brj-23453	434	3	,	,	PUNCT
brj-23453	434	4	i.	i.	PROPN
brj-23453	434	5	f.	f.	PROPN
brj-23453	434	6	,	,	PUNCT
brj-23453	434	7	vicol	vicol	PROPN
brj-23453	434	8	,	,	PUNCT
brj-23453	434	9	a.	a.	PROPN
brj-23453	434	10	c.	c.	PROPN
brj-23453	434	11	,	,	PUNCT
brj-23453	434	12	botu	botu	NOUN
brj-23453	434	13	,	,	PUNCT
brj-23453	434	14	m.	m.	NOUN
brj-23453	434	15	,	,	PUNCT
brj-23453	434	16	raica	raica	PROPN
brj-23453	434	17	,	,	PUNCT
brj-23453	434	18	p.	p.	NOUN
brj-23453	434	19	a.	a.	PROPN
brj-23453	434	20	,	,	PUNCT
brj-23453	434	21	vahdati	vahdati	PROPN
brj-23453	434	22	,	,	PUNCT
brj-23453	434	23	k.	k.	PROPN
brj-23453	434	24	,	,	PUNCT
brj-23453	434	25	and	and	CCONJ
brj-23453	434	26	pamfil	pamfil	PROPN
brj-23453	434	27	,	,	PUNCT
brj-23453	434	28	d.	d.	PROPN
brj-23453	434	29	(	(	PUNCT
brj-23453	434	30	2013	2013	NUM
brj-23453	434	31	)	)	PUNCT
brj-23453	434	32	.	.	PUNCT
brj-23453	435	1	“	"	PUNCT
brj-23453	435	2	relationships	relationship	NOUN
brj-23453	435	3	of	of	ADP
brj-23453	435	4	walnut	walnut	NOUN
brj-23453	435	5	cultivars	cultivar	NOUN
brj-23453	435	6	in	in	ADP
brj-23453	435	7	a	a	DET
brj-23453	435	8	germplasm	germplasm	NOUN
brj-23453	435	9	collection	collection	NOUN
brj-23453	435	10	:	:	PUNCT
brj-23453	435	11	comparative	comparative	ADJ
brj-23453	435	12	analysis	analysis	NOUN
brj-23453	435	13	of	of	ADP
brj-23453	435	14	phenotypic	phenotypic	ADJ
brj-23453	435	15	and	and	CCONJ
brj-23453	435	16	molecular	molecular	ADJ
brj-23453	435	17	data	datum	NOUN
brj-23453	435	18	,	,	PUNCT
brj-23453	435	19	”	"	PUNCT
brj-23453	435	20	scientia	scientia	PROPN
brj-23453	435	21	horticulturae	horticulturae	PROPN
brj-23453	435	22	153	153	NUM
brj-23453	435	23	,	,	PUNCT
brj-23453	435	24	124	124	NUM
brj-23453	435	25	-	-	SYM
brj-23453	435	26	135	135	NUM
brj-23453	435	27	.	.	PUNCT
brj-23453	436	1	doi	doi	NOUN
brj-23453	436	2	:	:	PUNCT
brj-23453	436	3	10.1016	10.1016	NUM
brj-23453	436	4	/	/	SYM
brj-23453	436	5	j.scienta.2013.02.013	j.scienta.2013.02.013	PROPN
brj-23453	436	6	potter	potter	NOUN
brj-23453	436	7	,	,	PUNCT
brj-23453	436	8	d.	d.	PROPN
brj-23453	436	9	,	,	PUNCT
brj-23453	436	10	gao	gao	PROPN
brj-23453	436	11	,	,	PUNCT
brj-23453	436	12	f.	f.	PROPN
brj-23453	436	13	,	,	PUNCT
brj-23453	436	14	aiello	aiello	PROPN
brj-23453	436	15	,	,	PUNCT
brj-23453	436	16	g.	g.	PROPN
brj-23453	436	17	,	,	PUNCT
brj-23453	436	18	leslie	leslie	PROPN
brj-23453	436	19	,	,	PUNCT
brj-23453	436	20	c.	c.	PROPN
brj-23453	436	21	,	,	PUNCT
brj-23453	436	22	and	and	CCONJ
brj-23453	436	23	mcgranahan	mcgranahan	PROPN
brj-23453	436	24	,	,	PUNCT
brj-23453	436	25	g.	g.	PROPN
brj-23453	436	26	(	(	PUNCT
brj-23453	436	27	2002	2002	NUM
brj-23453	436	28	)	)	PUNCT
brj-23453	436	29	.	.	PUNCT
brj-23453	437	1	“	"	PUNCT
brj-23453	437	2	intersimple	intersimple	ADJ
brj-23453	437	3	sequence	sequence	NOUN
brj-23453	437	4	repeat	repeat	NOUN
brj-23453	437	5	markers	marker	NOUN
brj-23453	437	6	for	for	ADP
brj-23453	437	7	fingerprinting	fingerprint	VERB
brj-23453	437	8	and	and	CCONJ
brj-23453	437	9	determining	determine	VERB
brj-23453	437	10	genetic	genetic	ADJ
brj-23453	437	11	relationships	relationship	NOUN
brj-23453	437	12	of	of	ADP
brj-23453	437	13	walnut	walnut	NOUN
brj-23453	437	14	(	(	PUNCT
brj-23453	437	15	juglans	juglan	NOUN
brj-23453	437	16	regia	regia	NOUN
brj-23453	437	17	)	)	PUNCT
brj-23453	437	18	cultivars	cultivar	NOUN
brj-23453	437	19	,	,	PUNCT
brj-23453	437	20	”	"	PUNCT
brj-23453	437	21	journal	journal	NOUN
brj-23453	437	22	of	of	ADP
brj-23453	437	23	the	the	DET
brj-23453	437	24	american	american	ADJ
brj-23453	437	25	society	society	NOUN
brj-23453	437	26	for	for	ADP
brj-23453	437	27	horticultural	horticultural	ADJ
brj-23453	437	28	science	science	NOUN
brj-23453	437	29	127(1	127(1	NUM
brj-23453	437	30	)	)	PUNCT
brj-23453	437	31	,	,	PUNCT
brj-23453	437	32	75	75	NUM
brj-23453	437	33	-	-	SYM
brj-23453	437	34	81	81	NUM
brj-23453	437	35	.	.	PUNCT
brj-23453	438	1	https://doi.org/10.1016/j.scienta.2020.109369	https://doi.org/10.1016/j.scienta.2020.109369	PROPN
brj-23453	438	2	https://doi.org/10.1016/j.scienta.2010.09.012	https://doi.org/10.1016/j.scienta.2010.09.012	PROPN
brj-23453	438	3	https://doi.org/10.1038/s41438-020-0284-6	https://doi.org/10.1038/s41438-020-0284-6	PROPN
brj-23453	438	4	https://doi.org/10.1073/pnas.70.12.3321	https://doi.org/10.1073/pnas.70.12.3321	PROPN
brj-23453	438	5	peer	peer	NOUN
brj-23453	438	6	-	-	PUNCT
brj-23453	438	7	reviewed	review	VERB
brj-23453	438	8	article	article	NOUN
brj-23453	438	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	438	10	wani	wani	PROPN
brj-23453	438	11	et	et	PROPN
brj-23453	438	12	al	al	PROPN
brj-23453	438	13	.	.	PROPN
brj-23453	439	1	(	(	PUNCT
brj-23453	439	2	2024	2024	NUM
brj-23453	439	3	)	)	PUNCT
brj-23453	439	4	.	.	PUNCT
brj-23453	440	1	“	"	PUNCT
brj-23453	440	2	walnut	walnut	ADJ
brj-23453	440	3	population	population	NOUN
brj-23453	440	4	&	&	CCONJ
brj-23453	440	5	diversity	diversity	NOUN
brj-23453	440	6	,	,	PUNCT
brj-23453	440	7	”	"	PUNCT
brj-23453	440	8	bioresources	bioresource	NOUN
brj-23453	440	9	19(3	19(3	NUM
brj-23453	440	10	)	)	PUNCT
brj-23453	440	11	,	,	PUNCT
brj-23453	440	12	4213	4213	NUM
brj-23453	440	13	-	-	SYM
brj-23453	440	14	4237	4237	NUM
brj-23453	440	15	.	.	PUNCT
brj-23453	441	1	4230	4230	NUM
brj-23453	441	2	pritchard	pritchard	PROPN
brj-23453	441	3	,	,	PUNCT
brj-23453	441	4	j.	j.	PROPN
brj-23453	441	5	k.	k.	PROPN
brj-23453	441	6	,	,	PUNCT
brj-23453	441	7	stephens	stephens	PROPN
brj-23453	441	8	,	,	PUNCT
brj-23453	441	9	m.	m.	NOUN
brj-23453	441	10	,	,	PUNCT
brj-23453	441	11	and	and	CCONJ
brj-23453	441	12	donnelly	donnelly	ADV
brj-23453	441	13	,	,	PUNCT
brj-23453	441	14	p.	p.	NOUN
brj-23453	441	15	(	(	PUNCT
brj-23453	441	16	2000	2000	NUM
brj-23453	441	17	)	)	PUNCT
brj-23453	441	18	.	.	PUNCT
brj-23453	442	1	“	"	PUNCT
brj-23453	442	2	inference	inference	NOUN
brj-23453	442	3	of	of	ADP
brj-23453	442	4	population	population	NOUN
brj-23453	442	5	structure	structure	NOUN
brj-23453	442	6	using	use	VERB
brj-23453	442	7	multilocus	multilocus	NOUN
brj-23453	442	8	genotype	genotype	NOUN
brj-23453	442	9	data	datum	NOUN
brj-23453	442	10	,	,	PUNCT
brj-23453	442	11	”	"	PUNCT
brj-23453	442	12	genetics	genetic	NOUN
brj-23453	442	13	155(2	155(2	NUM
brj-23453	442	14	)	)	PUNCT
brj-23453	442	15	,	,	PUNCT
brj-23453	442	16	945	945	NUM
brj-23453	442	17	-	-	SYM
brj-23453	442	18	959	959	NUM
brj-23453	442	19	.	.	PUNCT
brj-23453	442	20	rohlf	rohlf	VERB
brj-23453	442	21	,	,	PUNCT
brj-23453	442	22	f.	f.	PROPN
brj-23453	442	23	j.	j.	PROPN
brj-23453	442	24	(	(	PUNCT
brj-23453	442	25	1988	1988	NUM
brj-23453	442	26	)	)	PUNCT
brj-23453	442	27	.	.	PUNCT
brj-23453	443	1	ntsys	ntsy	NOUN
brj-23453	443	2	-	-	VERB
brj-23453	443	3	pc	pc	ADJ
brj-23453	443	4	:	:	PUNCT
brj-23453	443	5	numerical	numerical	ADJ
brj-23453	443	6	taxonomy	taxonomy	NOUN
brj-23453	443	7	and	and	CCONJ
brj-23453	443	8	multivariate	multivariate	VERB
brj-23453	443	9	analysis	analysis	NOUN
brj-23453	443	10	system	system	NOUN
brj-23453	443	11	,	,	PUNCT
brj-23453	443	12	exeter	exeter	NOUN
brj-23453	443	13	publishing	publishing	NOUN
brj-23453	443	14	,	,	PUNCT
brj-23453	443	15	setauket	setauket	PROPN
brj-23453	443	16	,	,	PUNCT
brj-23453	443	17	new	new	PROPN
brj-23453	443	18	york	york	PROPN
brj-23453	443	19	,	,	PUNCT
brj-23453	443	20	ny	ny	PROPN
brj-23453	443	21	,	,	PUNCT
brj-23453	443	22	usa	usa	PROPN
brj-23453	443	23	.	.	PROPN
brj-23453	443	24	salieh	salieh	PROPN
brj-23453	443	25	,	,	PUNCT
brj-23453	443	26	f.	f.	PROPN
brj-23453	443	27	,	,	PUNCT
brj-23453	443	28	tahir	tahir	PROPN
brj-23453	443	29	,	,	PUNCT
brj-23453	443	30	n.	n.	NOUN
brj-23453	443	31	,	,	PUNCT
brj-23453	443	32	and	and	CCONJ
brj-23453	443	33	faraj	faraj	PROPN
brj-23453	443	34	,	,	PUNCT
brj-23453	443	35	j.	j.	PROPN
brj-23453	443	36	(	(	PUNCT
brj-23453	443	37	2013	2013	NUM
brj-23453	443	38	)	)	PUNCT
brj-23453	443	39	.	.	PUNCT
brj-23453	444	1	“	"	PUNCT
brj-23453	444	2	assessment	assessment	NOUN
brj-23453	444	3	of	of	ADP
brj-23453	444	4	genetic	genetic	ADJ
brj-23453	444	5	relationship	relationship	NOUN
brj-23453	444	6	among	among	ADP
brj-23453	444	7	some	some	DET
brj-23453	444	8	iraqi	iraqi	ADJ
brj-23453	444	9	walnut	walnut	NOUN
brj-23453	444	10	genotypes	genotype	NOUN
brj-23453	444	11	(	(	PUNCT
brj-23453	444	12	juglans	juglan	NOUN
brj-23453	444	13	regia	regia	NOUN
brj-23453	444	14	l.	l.	PROPN
brj-23453	444	15	)	)	PUNCT
brj-23453	444	16	in	in	ADP
brj-23453	444	17	sulaimani	sulaimani	PROPN
brj-23453	444	18	region	region	NOUN
brj-23453	444	19	using	use	VERB
brj-23453	444	20	rapd	rapd	NOUN
brj-23453	444	21	and	and	CCONJ
brj-23453	444	22	ssr	ssr	ADJ
brj-23453	444	23	molecular	molecular	ADJ
brj-23453	444	24	markers	marker	NOUN
brj-23453	444	25	,	,	PUNCT
brj-23453	444	26	”	"	PUNCT
brj-23453	444	27	jordan	jordan	PROPN
brj-23453	444	28	journal	journal	PROPN
brj-23453	444	29	of	of	ADP
brj-23453	444	30	agricultural	agricultural	ADJ
brj-23453	444	31	sciences	science	NOUN
brj-23453	444	32	9(3	9(3	NUM
brj-23453	444	33	)	)	PUNCT
brj-23453	444	34	,	,	PUNCT
brj-23453	444	35	1506	1506	NUM
brj-23453	444	36	-	-	SYM
brj-23453	444	37	1517	1517	NUM
brj-23453	444	38	.	.	PUNCT
brj-23453	445	1	shah	shah	NOUN
brj-23453	445	2	,	,	PUNCT
brj-23453	445	3	u.	u.	PROPN
brj-23453	445	4	n.	n.	PROPN
brj-23453	445	5	,	,	PUNCT
brj-23453	445	6	mir	mir	PROPN
brj-23453	445	7	,	,	PUNCT
brj-23453	445	8	j.	j.	PROPN
brj-23453	445	9	i.	i.	PROPN
brj-23453	445	10	,	,	PUNCT
brj-23453	445	11	ahmed	ahmed	PROPN
brj-23453	445	12	,	,	PUNCT
brj-23453	445	13	n.	n.	NOUN
brj-23453	445	14	,	,	PUNCT
brj-23453	445	15	and	and	CCONJ
brj-23453	445	16	fazili	fazili	NOUN
brj-23453	445	17	,	,	PUNCT
brj-23453	445	18	k.	k.	PROPN
brj-23453	445	19	m.	m.	PROPN
brj-23453	445	20	(	(	PUNCT
brj-23453	445	21	2018	2018	NUM
brj-23453	445	22	)	)	PUNCT
brj-23453	445	23	.	.	PUNCT
brj-23453	446	1	“	"	PUNCT
brj-23453	446	2	assessment	assessment	NOUN
brj-23453	446	3	of	of	ADP
brj-23453	446	4	germplasm	germplasm	NOUN
brj-23453	446	5	diversity	diversity	NOUN
brj-23453	446	6	and	and	CCONJ
brj-23453	446	7	genetic	genetic	ADJ
brj-23453	446	8	relationships	relationship	NOUN
brj-23453	446	9	among	among	ADP
brj-23453	446	10	walnut	walnut	NOUN
brj-23453	446	11	(	(	PUNCT
brj-23453	446	12	juglans	juglan	NOUN
brj-23453	446	13	regia	regia	NOUN
brj-23453	446	14	l.	l.	PROPN
brj-23453	446	15	)	)	PUNCT
brj-23453	446	16	genotypes	genotype	NOUN
brj-23453	446	17	through	through	ADP
brj-23453	446	18	microsatellite	microsatellite	ADJ
brj-23453	446	19	markers	marker	NOUN
brj-23453	446	20	,	,	PUNCT
brj-23453	446	21	”	"	PUNCT
brj-23453	446	22	journal	journal	NOUN
brj-23453	446	23	of	of	ADP
brj-23453	446	24	the	the	DET
brj-23453	446	25	saudi	saudi	ADJ
brj-23453	446	26	society	society	NOUN
brj-23453	446	27	of	of	ADP
brj-23453	446	28	agricultural	agricultural	ADJ
brj-23453	446	29	science	science	NOUN
brj-23453	446	30	17(4	17(4	NUM
brj-23453	446	31	)	)	PUNCT
brj-23453	446	32	,	,	PUNCT
brj-23453	446	33	339	339	NUM
brj-23453	446	34	-	-	SYM
brj-23453	446	35	350	350	NUM
brj-23453	446	36	.	.	PUNCT
brj-23453	447	1	doi	doi	NOUN
brj-23453	447	2	:	:	PUNCT
brj-23453	447	3	10.1016	10.1016	NUM
brj-23453	447	4	/	/	SYM
brj-23453	447	5	j.jssas.2016.07.005	j.jssas.2016.07.005	PROPN
brj-23453	447	6	shahi	shahi	PROPN
brj-23453	447	7	shavvon	shavvon	PROPN
brj-23453	447	8	,	,	PUNCT
brj-23453	447	9	r.	r.	PROPN
brj-23453	447	10	,	,	PUNCT
brj-23453	447	11	qi	qi	PROPN
brj-23453	447	12	,	,	PUNCT
brj-23453	447	13	h.	h.	PROPN
brj-23453	447	14	l.	l.	PROPN
brj-23453	447	15	,	,	PUNCT
brj-23453	447	16	mafakheri	mafakheri	PROPN
brj-23453	447	17	,	,	PUNCT
brj-23453	447	18	m.	m.	NOUN
brj-23453	447	19	,	,	PUNCT
brj-23453	447	20	fan	fan	PROPN
brj-23453	447	21	,	,	PUNCT
brj-23453	447	22	p.	p.	PROPN
brj-23453	447	23	z.	z.	PROPN
brj-23453	447	24	,	,	PUNCT
brj-23453	447	25	wu	wu	PROPN
brj-23453	447	26	,	,	PUNCT
brj-23453	447	27	h.	h.	PROPN
brj-23453	447	28	y.	y.	PROPN
brj-23453	447	29	,	,	PUNCT
brj-23453	447	30	bazdid	bazdid	VERB
brj-23453	447	31	vahdati	vahdati	NOUN
brj-23453	447	32	,	,	PUNCT
brj-23453	447	33	f.	f.	PROPN
brj-23453	447	34	,	,	PUNCT
brj-23453	447	35	and	and	CCONJ
brj-23453	447	36	liu	liu	PROPN
brj-23453	447	37	,	,	PUNCT
brj-23453	447	38	j.	j.	PROPN
brj-23453	447	39	(	(	PUNCT
brj-23453	447	40	2023	2023	NUM
brj-23453	447	41	)	)	PUNCT
brj-23453	447	42	.	.	PUNCT
brj-23453	448	1	“	"	PUNCT
brj-23453	448	2	unravelling	unravel	VERB
brj-23453	448	3	the	the	DET
brj-23453	448	4	genetic	genetic	ADJ
brj-23453	448	5	diversity	diversity	NOUN
brj-23453	448	6	and	and	CCONJ
brj-23453	448	7	population	population	NOUN
brj-23453	448	8	structure	structure	NOUN
brj-23453	448	9	of	of	ADP
brj-23453	448	10	common	common	ADJ
brj-23453	448	11	walnut	walnut	NOUN
brj-23453	448	12	in	in	ADP
brj-23453	448	13	the	the	DET
brj-23453	448	14	iranian	iranian	ADJ
brj-23453	448	15	plateau	plateau	NOUN
brj-23453	448	16	,	,	PUNCT
brj-23453	448	17	”	"	PUNCT
brj-23453	448	18	bmc	bmc	ADJ
brj-23453	448	19	plant	plant	NOUN
brj-23453	448	20	biology	biology	NOUN
brj-23453	448	21	23(1	23(1	ADV
brj-23453	448	22	)	)	PUNCT
brj-23453	448	23	,	,	PUNCT
brj-23453	448	24	article	article	NOUN
brj-23453	448	25	201	201	NUM
brj-23453	448	26	.	.	PUNCT
brj-23453	449	1	doi	doi	NOUN
brj-23453	449	2	:	:	PUNCT
brj-23453	449	3	10.1186	10.1186	NUM
brj-23453	449	4	/	/	SYM
brj-23453	449	5	s12870	s12870	NOUN
brj-23453	449	6	-	-	PUNCT
brj-23453	449	7	023	023	NUM
brj-23453	449	8	-	-	PUNCT
brj-23453	449	9	04190	04190	NUM
brj-23453	449	10	-	-	SYM
brj-23453	449	11	2	2	NUM
brj-23453	449	12	simsek	simsek	NOUN
brj-23453	449	13	,	,	PUNCT
brj-23453	449	14	m.	m.	NOUN
brj-23453	449	15	,	,	PUNCT
brj-23453	449	16	yilmaz	yilmaz	PROPN
brj-23453	449	17	,	,	PUNCT
brj-23453	449	18	k.	k.	PROPN
brj-23453	449	19	u.	u.	PROPN
brj-23453	449	20	,	,	PUNCT
brj-23453	449	21	and	and	CCONJ
brj-23453	449	22	demirkiran	demirkiran	PROPN
brj-23453	449	23	,	,	PUNCT
brj-23453	449	24	a.	a.	PROPN
brj-23453	449	25	r.	r.	PROPN
brj-23453	449	26	(	(	PUNCT
brj-23453	449	27	2010	2010	NUM
brj-23453	449	28	)	)	PUNCT
brj-23453	449	29	.	.	PUNCT
brj-23453	450	1	“	"	PUNCT
brj-23453	450	2	selection	selection	NOUN
brj-23453	450	3	and	and	CCONJ
brj-23453	450	4	determination	determination	NOUN
brj-23453	450	5	of	of	ADP
brj-23453	450	6	some	some	DET
brj-23453	450	7	significant	significant	ADJ
brj-23453	450	8	properties	property	NOUN
brj-23453	450	9	of	of	ADP
brj-23453	450	10	superior	superior	ADJ
brj-23453	450	11	walnut	walnut	NOUN
brj-23453	450	12	genotypes	genotype	NOUN
brj-23453	450	13	,	,	PUNCT
brj-23453	450	14	”	"	PUNCT
brj-23453	450	15	scientific	scientific	ADJ
brj-23453	450	16	research	research	NOUN
brj-23453	450	17	and	and	CCONJ
brj-23453	450	18	essays	essay	NOUN
brj-23453	450	19	5(19	5(19	NUM
brj-23453	450	20	)	)	PUNCT
brj-23453	450	21	,	,	PUNCT
brj-23453	450	22	2987	2987	NUM
brj-23453	450	23	-	-	SYM
brj-23453	450	24	2996	2996	NUM
brj-23453	450	25	.	.	PUNCT
brj-23453	451	1	torokeldiev	torokeldiev	PROPN
brj-23453	451	2	,	,	PUNCT
brj-23453	451	3	n.	n.	PROPN
brj-23453	451	4	,	,	PUNCT
brj-23453	451	5	ziehe	ziehe	PROPN
brj-23453	451	6	,	,	PUNCT
brj-23453	451	7	m.	m.	NOUN
brj-23453	451	8	,	,	PUNCT
brj-23453	451	9	gailing	gailing	NOUN
brj-23453	451	10	,	,	PUNCT
brj-23453	451	11	o.	o.	NOUN
brj-23453	451	12	,	,	PUNCT
brj-23453	451	13	and	and	CCONJ
brj-23453	451	14	finkeldey	finkeldey	PROPN
brj-23453	451	15	,	,	PUNCT
brj-23453	451	16	r.	r.	PROPN
brj-23453	451	17	(	(	PUNCT
brj-23453	451	18	2018	2018	NUM
brj-23453	451	19	)	)	PUNCT
brj-23453	451	20	.	.	PUNCT
brj-23453	452	1	“	"	PUNCT
brj-23453	452	2	genetic	genetic	ADJ
brj-23453	452	3	diversity	diversity	NOUN
brj-23453	452	4	and	and	CCONJ
brj-23453	452	5	structure	structure	NOUN
brj-23453	452	6	of	of	ADP
brj-23453	452	7	natural	natural	ADJ
brj-23453	452	8	juglans	juglan	NOUN
brj-23453	452	9	regia	regia	NOUN
brj-23453	452	10	l.	l.	NOUN
brj-23453	452	11	populations	population	NOUN
brj-23453	452	12	in	in	ADP
brj-23453	452	13	the	the	DET
brj-23453	452	14	southern	southern	PROPN
brj-23453	452	15	kyrgyz	kyrgyz	PROPN
brj-23453	452	16	republic	republic	PROPN
brj-23453	452	17	revealed	reveal	VERB
brj-23453	452	18	by	by	ADP
brj-23453	452	19	nuclear	nuclear	ADJ
brj-23453	452	20	ssr	ssr	NOUN
brj-23453	452	21	and	and	CCONJ
brj-23453	452	22	est	est	ADJ
brj-23453	452	23	-	-	PUNCT
brj-23453	452	24	ssr	ssr	ADJ
brj-23453	452	25	markers	marker	NOUN
brj-23453	452	26	,	,	PUNCT
brj-23453	452	27	”	"	PUNCT
brj-23453	452	28	tree	tree	NOUN
brj-23453	452	29	genetics	genetic	NOUN
brj-23453	452	30	&	&	CCONJ
brj-23453	452	31	genomes	genome	NOUN
brj-23453	452	32	15(1	15(1	NUM
brj-23453	452	33	)	)	PUNCT
brj-23453	452	34	,	,	PUNCT
brj-23453	452	35	article	article	NOUN
brj-23453	452	36	5	5	NUM
brj-23453	452	37	.	.	PUNCT
brj-23453	452	38	doi	doi	NOUN
brj-23453	452	39	:	:	PUNCT
brj-23453	452	40	10.1007	10.1007	NUM
brj-23453	452	41	/	/	SYM
brj-23453	452	42	s11295	s11295	NOUN
brj-23453	452	43	-	-	PUNCT
brj-23453	452	44	018	018	NUM
brj-23453	452	45	-	-	PUNCT
brj-23453	452	46	1311	1311	NUM
brj-23453	452	47	-	-	PUNCT
brj-23453	452	48	8	8	NUM
brj-23453	452	49	vahdati	vahdati	NOUN
brj-23453	452	50	,	,	PUNCT
brj-23453	452	51	k.	k.	PROPN
brj-23453	452	52	,	,	PUNCT
brj-23453	452	53	mohseni	mohseni	NOUN
brj-23453	452	54	pourtaklu	pourtaklu	PROPN
brj-23453	452	55	,	,	PUNCT
brj-23453	452	56	s.	s.	PROPN
brj-23453	452	57	,	,	PUNCT
brj-23453	452	58	karimi	karimi	PROPN
brj-23453	452	59	,	,	PUNCT
brj-23453	452	60	r.	r.	PROPN
brj-23453	452	61	,	,	PUNCT
brj-23453	452	62	barzehkar	barzehkar	PROPN
brj-23453	452	63	,	,	PUNCT
brj-23453	452	64	r.	r.	PROPN
brj-23453	452	65	,	,	PUNCT
brj-23453	452	66	amiri	amiri	PROPN
brj-23453	452	67	,	,	PUNCT
brj-23453	452	68	r.	r.	PROPN
brj-23453	452	69	,	,	PUNCT
brj-23453	452	70	mozaffari	mozaffari	ADJ
brj-23453	452	71	,	,	PUNCT
brj-23453	452	72	m.	m.	NOUN
brj-23453	452	73	,	,	PUNCT
brj-23453	452	74	and	and	CCONJ
brj-23453	452	75	woeste	woeste	NOUN
brj-23453	452	76	,	,	PUNCT
brj-23453	452	77	k.	k.	PROPN
brj-23453	452	78	(	(	PUNCT
brj-23453	452	79	2015	2015	NUM
brj-23453	452	80	)	)	PUNCT
brj-23453	452	81	.	.	PUNCT
brj-23453	453	1	“	"	PUNCT
brj-23453	453	2	genetic	genetic	ADJ
brj-23453	453	3	diversity	diversity	NOUN
brj-23453	453	4	and	and	CCONJ
brj-23453	453	5	gene	gene	NOUN
brj-23453	453	6	flow	flow	NOUN
brj-23453	453	7	of	of	ADP
brj-23453	453	8	some	some	DET
brj-23453	453	9	persian	persian	ADJ
brj-23453	453	10	walnut	walnut	NOUN
brj-23453	453	11	populations	population	NOUN
brj-23453	453	12	in	in	ADP
brj-23453	453	13	southeast	southeast	NOUN
brj-23453	453	14	of	of	ADP
brj-23453	453	15	iran	iran	PROPN
brj-23453	453	16	revealed	reveal	VERB
brj-23453	453	17	by	by	ADP
brj-23453	453	18	ssr	ssr	PROPN
brj-23453	453	19	markers	marker	NOUN
brj-23453	453	20	,	,	PUNCT
brj-23453	453	21	”	"	PUNCT
brj-23453	453	22	plant	plant	NOUN
brj-23453	453	23	systematics	systematic	NOUN
brj-23453	453	24	and	and	CCONJ
brj-23453	453	25	evolution	evolution	NOUN
brj-23453	453	26	301	301	NUM
brj-23453	453	27	,	,	PUNCT
brj-23453	453	28	691	691	NUM
brj-23453	453	29	-	-	SYM
brj-23453	453	30	699	699	NUM
brj-23453	453	31	.	.	PUNCT
brj-23453	454	1	doi	doi	NOUN
brj-23453	454	2	:	:	PUNCT
brj-23453	454	3	10.1007	10.1007	NUM
brj-23453	454	4	/	/	SYM
brj-23453	454	5	s00606	s00606	ADJ
brj-23453	454	6	-	-	PUNCT
brj-23453	454	7	014	014	NUM
brj-23453	454	8	-	-	PUNCT
brj-23453	454	9	1107	1107	NUM
brj-23453	454	10	-	-	SYM
brj-23453	454	11	8	8	NUM
brj-23453	454	12	victory	victory	NOUN
brj-23453	454	13	,	,	PUNCT
brj-23453	454	14	e.	e.	PROPN
brj-23453	454	15	r.	r.	PROPN
brj-23453	454	16	,	,	PUNCT
brj-23453	454	17	glaubitz	glaubitz	PROPN
brj-23453	454	18	,	,	PUNCT
brj-23453	454	19	j.	j.	PROPN
brj-23453	454	20	c.	c.	PROPN
brj-23453	454	21	,	,	PUNCT
brj-23453	454	22	rhodes	rhodes	PROPN
brj-23453	454	23	,	,	PUNCT
brj-23453	454	24	jr	jr	PROPN
brj-23453	454	25	,	,	PUNCT
brj-23453	454	26	o.	o.	PROPN
brj-23453	454	27	e.	e.	PROPN
brj-23453	454	28	,	,	PUNCT
brj-23453	454	29	and	and	CCONJ
brj-23453	454	30	woeste	woeste	NOUN
brj-23453	454	31	,	,	PUNCT
brj-23453	454	32	k.	k.	PROPN
brj-23453	454	33	e.	e.	PROPN
brj-23453	454	34	(	(	PUNCT
brj-23453	454	35	2006	2006	NUM
brj-23453	454	36	)	)	PUNCT
brj-23453	454	37	.	.	PUNCT
brj-23453	455	1	“	"	PUNCT
brj-23453	455	2	genetic	genetic	ADJ
brj-23453	455	3	homogeneity	homogeneity	NOUN
brj-23453	455	4	in	in	ADP
brj-23453	455	5	juglans	juglan	NOUN
brj-23453	455	6	nigra	nigra	NOUN
brj-23453	455	7	(	(	PUNCT
brj-23453	455	8	juglandaceae	juglandaceae	PROPN
brj-23453	455	9	)	)	PUNCT
brj-23453	455	10	at	at	ADP
brj-23453	455	11	nuclear	nuclear	ADJ
brj-23453	455	12	microsatellites	microsatellite	NOUN
brj-23453	455	13	,	,	PUNCT
brj-23453	455	14	”	"	PUNCT
brj-23453	455	15	american	american	ADJ
brj-23453	455	16	journal	journal	NOUN
brj-23453	455	17	of	of	ADP
brj-23453	455	18	botany	botany	NOUN
brj-23453	455	19	93(1	93(1	NUM
brj-23453	455	20	)	)	PUNCT
brj-23453	455	21	,	,	PUNCT
brj-23453	455	22	118	118	NUM
brj-23453	455	23	-	-	SYM
brj-23453	455	24	126	126	NUM
brj-23453	455	25	.	.	PUNCT
brj-23453	456	1	doi	doi	NOUN
brj-23453	456	2	:	:	PUNCT
brj-23453	456	3	10.3732	10.3732	NUM
brj-23453	456	4	/	/	SYM
brj-23453	456	5	ajb.93.1.118	ajb.93.1.118	PROPN
brj-23453	456	6	wang	wang	PROPN
brj-23453	456	7	,	,	PUNCT
brj-23453	456	8	h.	h.	PROPN
brj-23453	456	9	,	,	PUNCT
brj-23453	456	10	pei	pei	PROPN
brj-23453	456	11	,	,	PUNCT
brj-23453	456	12	d.	d.	PROPN
brj-23453	456	13	,	,	PUNCT
brj-23453	456	14	gu	gu	PROPN
brj-23453	456	15	,	,	PUNCT
brj-23453	456	16	r.	r.	PROPN
brj-23453	456	17	s.	s.	PROPN
brj-23453	456	18	,	,	PUNCT
brj-23453	456	19	and	and	CCONJ
brj-23453	456	20	wang	wang	PROPN
brj-23453	456	21	,	,	PUNCT
brj-23453	456	22	b.	b.	PROPN
brj-23453	456	23	q.	q.	PROPN
brj-23453	456	24	(	(	PUNCT
brj-23453	456	25	2008	2008	NUM
brj-23453	456	26	)	)	PUNCT
brj-23453	456	27	.	.	PUNCT
brj-23453	457	1	“	"	PUNCT
brj-23453	457	2	genetic	genetic	ADJ
brj-23453	457	3	diversity	diversity	NOUN
brj-23453	457	4	and	and	CCONJ
brj-23453	457	5	structure	structure	NOUN
brj-23453	457	6	of	of	ADP
brj-23453	457	7	walnut	walnut	ADJ
brj-23453	457	8	populations	population	NOUN
brj-23453	457	9	in	in	ADP
brj-23453	457	10	central	central	ADJ
brj-23453	457	11	and	and	CCONJ
brj-23453	457	12	southwestern	southwestern	ADJ
brj-23453	457	13	china	china	PROPN
brj-23453	457	14	revealed	reveal	VERB
brj-23453	457	15	by	by	ADP
brj-23453	457	16	microsatellite	microsatellite	ADJ
brj-23453	457	17	markers	marker	NOUN
brj-23453	457	18	,	,	PUNCT
brj-23453	457	19	”	"	PUNCT
brj-23453	457	20	journal	journal	NOUN
brj-23453	457	21	of	of	ADP
brj-23453	457	22	the	the	DET
brj-23453	457	23	american	american	ADJ
brj-23453	457	24	society	society	NOUN
brj-23453	457	25	for	for	ADP
brj-23453	457	26	horticultural	horticultural	ADJ
brj-23453	457	27	science	science	NOUN
brj-23453	457	28	133(2	133(2	NUM
brj-23453	457	29	)	)	PUNCT
brj-23453	457	30	,	,	PUNCT
brj-23453	457	31	197	197	NUM
brj-23453	457	32	-	-	SYM
brj-23453	457	33	203	203	NUM
brj-23453	457	34	.	.	PUNCT
brj-23453	458	1	doi	doi	NOUN
brj-23453	458	2	:	:	PUNCT
brj-23453	458	3	10.21273	10.21273	NUM
brj-23453	458	4	/	/	SYM
brj-23453	458	5	jashs.133.2.197	jashs.133.2.197	PROPN
brj-23453	458	6	wani	wani	PROPN
brj-23453	458	7	,	,	PUNCT
brj-23453	458	8	a.	a.	PROPN
brj-23453	458	9	b.	b.	PROPN
brj-23453	458	10	,	,	PUNCT
brj-23453	458	11	bhat	bhat	PROPN
brj-23453	458	12	,	,	PUNCT
brj-23453	458	13	m.	m.	NOUN
brj-23453	458	14	a.	a.	PROPN
brj-23453	458	15	,	,	PUNCT
brj-23453	458	16	husaini	husaini	PROPN
brj-23453	458	17	,	,	PUNCT
brj-23453	458	18	a.	a.	NOUN
brj-23453	458	19	m.	m.	NOUN
brj-23453	458	20	,	,	PUNCT
brj-23453	458	21	and	and	CCONJ
brj-23453	458	22	sidiqi	sidiqi	NOUN
brj-23453	458	23	,	,	PUNCT
brj-23453	458	24	i.	i.	NOUN
brj-23453	458	25	(	(	PUNCT
brj-23453	458	26	2017	2017	NUM
brj-23453	458	27	)	)	PUNCT
brj-23453	458	28	.	.	PUNCT
brj-23453	459	1	“	"	PUNCT
brj-23453	459	2	screening	screen	VERB
brj-23453	459	3	of	of	ADP
brj-23453	459	4	important	important	ADJ
brj-23453	459	5	bean	bean	NOUN
brj-23453	459	6	genotypes	genotype	NOUN
brj-23453	459	7	/	/	SYM
brj-23453	459	8	collections	collection	NOUN
brj-23453	459	9	for	for	ADP
brj-23453	459	10	resistance	resistance	NOUN
brj-23453	459	11	against	against	ADP
brj-23453	459	12	common	common	ADJ
brj-23453	459	13	bean	bean	NOUN
brj-23453	459	14	mosaic	mosaic	PROPN
brj-23453	459	15	virus	virus	NOUN
brj-23453	459	16	using	use	VERB
brj-23453	459	17	molecular	molecular	ADJ
brj-23453	459	18	markers	marker	NOUN
brj-23453	459	19	,	,	PUNCT
brj-23453	459	20	”	"	PUNCT
brj-23453	459	21	journal	journal	NOUN
brj-23453	459	22	of	of	ADP
brj-23453	459	23	pharmacognosy	pharmacognosy	NOUN
brj-23453	459	24	and	and	CCONJ
brj-23453	459	25	phytochemistry	phytochemistry	NOUN
brj-23453	459	26	6(4	6(4	PROPN
brj-23453	459	27	)	)	PUNCT
brj-23453	459	28	,	,	PUNCT
brj-23453	459	29	343	343	NUM
brj-23453	459	30	-	-	SYM
brj-23453	459	31	347	347	NUM
brj-23453	459	32	.	.	PUNCT
brj-23453	459	33	woeste	woeste	NOUN
brj-23453	459	34	,	,	PUNCT
brj-23453	459	35	k.	k.	PROPN
brj-23453	459	36	,	,	PUNCT
brj-23453	459	37	burns	burn	NOUN
brj-23453	459	38	,	,	PUNCT
brj-23453	459	39	r.	r.	PROPN
brj-23453	459	40	,	,	PUNCT
brj-23453	459	41	rhodes	rhode	NOUN
brj-23453	459	42	,	,	PUNCT
brj-23453	459	43	o.	o.	NOUN
brj-23453	459	44	,	,	PUNCT
brj-23453	459	45	and	and	CCONJ
brj-23453	459	46	michler	michler	NOUN
brj-23453	459	47	,	,	PUNCT
brj-23453	459	48	c.	c.	PROPN
brj-23453	459	49	(	(	PUNCT
brj-23453	459	50	2002	2002	NUM
brj-23453	459	51	)	)	PUNCT
brj-23453	459	52	.	.	PUNCT
brj-23453	460	1	“	"	PUNCT
brj-23453	460	2	thirty	thirty	NUM
brj-23453	460	3	polymorphic	polymorphic	ADJ
brj-23453	460	4	nuclear	nuclear	ADJ
brj-23453	460	5	microsatellite	microsatellite	NOUN
brj-23453	460	6	loci	locus	NOUN
brj-23453	460	7	from	from	ADP
brj-23453	460	8	black	black	ADJ
brj-23453	460	9	walnut	walnut	NOUN
brj-23453	460	10	,	,	PUNCT
brj-23453	460	11	”	"	PUNCT
brj-23453	460	12	journal	journal	NOUN
brj-23453	460	13	of	of	ADP
brj-23453	460	14	heredity	heredity	NOUN
brj-23453	460	15	93(1	93(1	NUM
brj-23453	460	16	)	)	PUNCT
brj-23453	460	17	,	,	PUNCT
brj-23453	460	18	58	58	NUM
brj-23453	460	19	-	-	SYM
brj-23453	460	20	60	60	NUM
brj-23453	460	21	.	.	PUNCT
brj-23453	461	1	doi	doi	NOUN
brj-23453	461	2	:	:	PUNCT
brj-23453	461	3	10.1093	10.1093	NUM
brj-23453	461	4	/	/	SYM
brj-23453	461	5	jhered/93.1.58	jhered/93.1.58	PROPN
brj-23453	461	6	wu	wu	PROPN
brj-23453	461	7	,	,	PUNCT
brj-23453	461	8	y.	y.	PROPN
brj-23453	461	9	,	,	PUNCT
brj-23453	461	10	pei	pei	PROPN
brj-23453	461	11	,	,	PUNCT
brj-23453	461	12	d.	d.	PROPN
brj-23453	461	13	,	,	PUNCT
brj-23453	461	14	xi	xi	PROPN
brj-23453	461	15	,	,	PUNCT
brj-23453	461	16	s.	s.	PROPN
brj-23453	461	17	,	,	PUNCT
brj-23453	461	18	and	and	CCONJ
brj-23453	461	19	li	li	PROPN
brj-23453	461	20	,	,	PUNCT
brj-23453	461	21	j.	j.	PROPN
brj-23453	461	22	(	(	PUNCT
brj-23453	461	23	2000	2000	NUM
brj-23453	461	24	)	)	PUNCT
brj-23453	461	25	.	.	PUNCT
brj-23453	462	1	“	"	PUNCT
brj-23453	462	2	a	a	DET
brj-23453	462	3	study	study	NOUN
brj-23453	462	4	on	on	ADP
brj-23453	462	5	the	the	DET
brj-23453	462	6	genetic	genetic	ADJ
brj-23453	462	7	relationship	relationship	NOUN
brj-23453	462	8	among	among	ADP
brj-23453	462	9	species	specie	NOUN
brj-23453	462	10	in	in	ADP
brj-23453	462	11	juglans	juglan	NOUN
brj-23453	462	12	l.	l.	PROPN
brj-23453	462	13	using	use	VERB
brj-23453	462	14	rapd	rapd	NOUN
brj-23453	462	15	markers	marker	NOUN
brj-23453	462	16	,	,	PUNCT
brj-23453	462	17	”	"	PUNCT
brj-23453	462	18	acta	acta	PROPN
brj-23453	462	19	horticulturae	horticulturae	PROPN
brj-23453	462	20	sinica	sinica	PROPN
brj-23453	462	21	27(1	27(1	NUM
brj-23453	462	22	)	)	PUNCT
brj-23453	462	23	,	,	PUNCT
brj-23453	462	24	17	17	NUM
brj-23453	462	25	-	-	SYM
brj-23453	462	26	22	22	NUM
brj-23453	462	27	.	.	PUNCT
brj-23453	463	1	yang	yang	PROPN
brj-23453	463	2	,	,	PUNCT
brj-23453	463	3	l.	l.	PROPN
brj-23453	463	4	and	and	CCONJ
brj-23453	463	5	xue	xue	PROPN
brj-23453	463	6	,	,	PUNCT
brj-23453	463	7	y.	y.	PROPN
brj-23453	463	8	l.	l.	PROPN
brj-23453	463	9	(	(	PUNCT
brj-23453	463	10	2005	2005	NUM
brj-23453	463	11	)	)	PUNCT
brj-23453	463	12	.	.	PUNCT
brj-23453	464	1	“	"	PUNCT
brj-23453	464	2	effect	effect	NOUN
brj-23453	464	3	of	of	ADP
brj-23453	464	4	water	water	NOUN
brj-23453	464	5	extracts	extract	NOUN
brj-23453	464	6	of	of	ADP
brj-23453	464	7	larch	larch	NOUN
brj-23453	464	8	on	on	ADP
brj-23453	464	9	growth	growth	NOUN
brj-23453	464	10	of	of	ADP
brj-23453	464	11	manchurian	manchurian	ADJ
brj-23453	464	12	walnut	walnut	NOUN
brj-23453	464	13	seedlings	seedling	NOUN
brj-23453	464	14	,	,	PUNCT
brj-23453	464	15	”	"	PUNCT
brj-23453	464	16	journal	journal	NOUN
brj-23453	464	17	of	of	ADP
brj-23453	464	18	forestry	forestry	NOUN
brj-23453	464	19	research	research	PROPN
brj-23453	464	20	16(4	16(4	NUM
brj-23453	464	21	)	)	PUNCT
brj-23453	464	22	,	,	PUNCT
brj-23453	464	23	285	285	NUM
brj-23453	464	24	-	-	SYM
brj-23453	464	25	288	288	NUM
brj-23453	464	26	.	.	PUNCT
brj-23453	465	1	yilmaz	yilmaz	PROPN
brj-23453	465	2	,	,	PUNCT
brj-23453	465	3	k.	k.	PROPN
brj-23453	465	4	u.	u.	PROPN
brj-23453	465	5	,	,	PUNCT
brj-23453	465	6	paydas	paydas	PROPN
brj-23453	465	7	-	-	PUNCT
brj-23453	465	8	kargi	kargi	PROPN
brj-23453	465	9	,	,	PUNCT
brj-23453	465	10	s.	s.	PROPN
brj-23453	465	11	e.	e.	PROPN
brj-23453	466	1	v.	v.	PROPN
brj-23453	466	2	g.	g.	PROPN
brj-23453	466	3	i̇.	i̇.	PROPN
brj-23453	466	4	,	,	PUNCT
brj-23453	466	5	dogan	dogan	PROPN
brj-23453	466	6	,	,	PUNCT
brj-23453	466	7	y.	y.	PROPN
brj-23453	466	8	,	,	PUNCT
brj-23453	466	9	and	and	CCONJ
brj-23453	466	10	kafkas	kafkas	PROPN
brj-23453	466	11	,	,	PUNCT
brj-23453	466	12	s.	s.	PROPN
brj-23453	466	13	a.	a.	PROPN
brj-23453	466	14	l.	l.	PROPN
brj-23453	466	15	i̇.	i̇.	PROPN
brj-23453	466	16	h.	h.	PROPN
brj-23453	466	17	(	(	PUNCT
brj-23453	466	18	2012	2012	NUM
brj-23453	466	19	)	)	PUNCT
brj-23453	466	20	.	.	PUNCT
brj-23453	467	1	“	"	PUNCT
brj-23453	467	2	genetic	genetic	ADJ
brj-23453	467	3	diversity	diversity	NOUN
brj-23453	467	4	analysis	analysis	NOUN
brj-23453	467	5	based	base	VERB
brj-23453	467	6	on	on	ADP
brj-23453	467	7	issr	issr	PROPN
brj-23453	467	8	,	,	PUNCT
brj-23453	467	9	rapd	rapd	NOUN
brj-23453	467	10	and	and	CCONJ
brj-23453	467	11	ssr	ssr	NOUN
brj-23453	467	12	among	among	ADP
brj-23453	467	13	turkish	turkish	ADJ
brj-23453	467	14	apricot	apricot	PROPN
brj-23453	467	15	germplasms	germplasms	PROPN
brj-23453	467	16	in	in	ADP
brj-23453	467	17	iran	iran	PROPN
brj-23453	467	18	caucasian	caucasian	PROPN
brj-23453	467	19	eco	eco	PROPN
brj-23453	467	20	-	-	PUNCT
brj-23453	467	21	geographical	geographical	ADJ
brj-23453	467	22	group	group	NOUN
brj-23453	467	23	,	,	PUNCT
brj-23453	467	24	”	"	PUNCT
brj-23453	467	25	scientia	scientia	PROPN
brj-23453	467	26	horticulturae	horticulturae	PROPN
brj-23453	467	27	138	138	NUM
brj-23453	467	28	,	,	PUNCT
brj-23453	467	29	138	138	NUM
brj-23453	467	30	-	-	SYM
brj-23453	467	31	143	143	NUM
brj-23453	467	32	.	.	PUNCT
brj-23453	468	1	doi	doi	NOUN
brj-23453	468	2	:	:	PUNCT
brj-23453	468	3	10.1016	10.1016	NUM
brj-23453	468	4	/	/	SYM
brj-23453	468	5	j.scienta.2012.02.017	j.scienta.2012.02.017	X
brj-23453	468	6	https://doi.org/10.3732/ajb.93.1.118	https://doi.org/10.3732/ajb.93.1.118	VERB
brj-23453	468	7	https://doi.org/10.21273/jashs.133.2.197	https://doi.org/10.21273/jashs.133.2.197	PROPN
brj-23453	468	8	https://doi.org/10.1093/jhered/93.1.58	https://doi.org/10.1093/jhered/93.1.58	NOUN
brj-23453	468	9	peer	peer	NOUN
brj-23453	468	10	-	-	PUNCT
brj-23453	468	11	reviewed	review	VERB
brj-23453	468	12	article	article	NOUN
brj-23453	468	13	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	468	14	wani	wani	PROPN
brj-23453	468	15	et	et	PROPN
brj-23453	468	16	al	al	PROPN
brj-23453	468	17	.	.	PROPN
brj-23453	469	1	(	(	PUNCT
brj-23453	469	2	2024	2024	NUM
brj-23453	469	3	)	)	PUNCT
brj-23453	469	4	.	.	PUNCT
brj-23453	470	1	“	"	PUNCT
brj-23453	470	2	walnut	walnut	ADJ
brj-23453	470	3	population	population	NOUN
brj-23453	470	4	&	&	CCONJ
brj-23453	470	5	diversity	diversity	NOUN
brj-23453	470	6	,	,	PUNCT
brj-23453	470	7	”	"	PUNCT
brj-23453	470	8	bioresources	bioresource	NOUN
brj-23453	470	9	19(3	19(3	NUM
brj-23453	470	10	)	)	PUNCT
brj-23453	470	11	,	,	PUNCT
brj-23453	470	12	4213	4213	NUM
brj-23453	470	13	-	-	SYM
brj-23453	470	14	4237	4237	NUM
brj-23453	470	15	.	.	PUNCT
brj-23453	470	16	4231	4231	NUM
brj-23453	470	17	yuan	yuan	NOUN
brj-23453	470	18	,	,	PUNCT
brj-23453	470	19	x.	x.	PROPN
brj-23453	470	20	y.	y.	PROPN
brj-23453	470	21	,	,	PUNCT
brj-23453	470	22	sun	sun	PROPN
brj-23453	470	23	,	,	PUNCT
brj-23453	470	24	y.	y.	PROPN
brj-23453	470	25	w.	w.	PROPN
brj-23453	470	26	,	,	PUNCT
brj-23453	470	27	bai	bai	PROPN
brj-23453	470	28	,	,	PUNCT
brj-23453	470	29	x.	x.	PROPN
brj-23453	470	30	r.	r.	PROPN
brj-23453	470	31	,	,	PUNCT
brj-23453	470	32	dang	dang	PROPN
brj-23453	470	33	,	,	PUNCT
brj-23453	470	34	m.	m.	NOUN
brj-23453	470	35	,	,	PUNCT
brj-23453	470	36	feng	feng	PROPN
brj-23453	470	37	,	,	PUNCT
brj-23453	470	38	x.	x.	PROPN
brj-23453	470	39	j.	j.	PROPN
brj-23453	470	40	,	,	PUNCT
brj-23453	470	41	zulfiqar	zulfiqar	PROPN
brj-23453	470	42	,	,	PUNCT
brj-23453	470	43	s.	s.	PROPN
brj-23453	470	44	,	,	PUNCT
brj-23453	470	45	and	and	CCONJ
brj-23453	470	46	zhao	zhao	PROPN
brj-23453	470	47	,	,	PUNCT
brj-23453	470	48	p.	p.	NOUN
brj-23453	470	49	(	(	PUNCT
brj-23453	470	50	2018	2018	NUM
brj-23453	470	51	)	)	PUNCT
brj-23453	470	52	.	.	PUNCT
brj-23453	471	1	“	"	PUNCT
brj-23453	471	2	population	population	NOUN
brj-23453	471	3	structure	structure	NOUN
brj-23453	471	4	,	,	PUNCT
brj-23453	471	5	genetic	genetic	ADJ
brj-23453	471	6	diversity	diversity	NOUN
brj-23453	471	7	,	,	PUNCT
brj-23453	471	8	and	and	CCONJ
brj-23453	471	9	gene	gene	NOUN
brj-23453	471	10	introgression	introgression	NOUN
brj-23453	471	11	of	of	ADP
brj-23453	471	12	two	two	NUM
brj-23453	471	13	closely	closely	ADV
brj-23453	471	14	related	relate	VERB
brj-23453	471	15	walnuts	walnut	NOUN
brj-23453	471	16	(	(	PUNCT
brj-23453	471	17	juglans	juglan	NOUN
brj-23453	471	18	regia	regia	NOUN
brj-23453	471	19	and	and	CCONJ
brj-23453	471	20	j.	j.	PROPN
brj-23453	471	21	sigillata	sigillata	PROPN
brj-23453	471	22	)	)	PUNCT
brj-23453	471	23	in	in	ADP
brj-23453	471	24	southwestern	southwestern	ADJ
brj-23453	471	25	china	china	PROPN
brj-23453	471	26	revealed	reveal	VERB
brj-23453	471	27	by	by	ADP
brj-23453	471	28	est	est	X
brj-23453	471	29	-	-	PUNCT
brj-23453	471	30	ssr	ssr	ADJ
brj-23453	471	31	markers	marker	NOUN
brj-23453	471	32	,	,	PUNCT
brj-23453	471	33	”	"	PUNCT
brj-23453	471	34	forests	forest	NOUN
brj-23453	471	35	9(10	9(10	NUM
brj-23453	471	36	)	)	PUNCT
brj-23453	471	37	,	,	PUNCT
brj-23453	471	38	article	article	NOUN
brj-23453	471	39	number	number	NOUN
brj-23453	471	40	646	646	NUM
brj-23453	471	41	.	.	PUNCT
brj-23453	472	1	doi	doi	NOUN
brj-23453	472	2	:	:	PUNCT
brj-23453	472	3	10.3390	10.3390	NUM
brj-23453	472	4	/	/	SYM
brj-23453	472	5	f9100646	f9100646	NOUN
brj-23453	472	6	article	article	NOUN
brj-23453	472	7	submitted	submit	VERB
brj-23453	472	8	:	:	PUNCT
brj-23453	472	9	march	march	PROPN
brj-23453	472	10	18	18	NUM
brj-23453	472	11	,	,	PUNCT
brj-23453	472	12	2024	2024	NUM
brj-23453	472	13	;	;	PUNCT
brj-23453	472	14	peer	peer	NOUN
brj-23453	472	15	review	review	NOUN
brj-23453	472	16	completed	complete	VERB
brj-23453	472	17	:	:	PUNCT
brj-23453	472	18	april	april	PROPN
brj-23453	472	19	30	30	NUM
brj-23453	472	20	,	,	PUNCT
brj-23453	472	21	2024	2024	NUM
brj-23453	472	22	;	;	PUNCT
brj-23453	472	23	revised	revise	VERB
brj-23453	472	24	version	version	NOUN
brj-23453	472	25	received	receive	VERB
brj-23453	472	26	:	:	PUNCT
brj-23453	472	27	april	april	PROPN
brj-23453	472	28	27	27	NUM
brj-23453	472	29	,	,	PUNCT
brj-23453	472	30	2024	2024	NUM
brj-23453	472	31	;	;	PUNCT
brj-23453	472	32	accepted	accept	VERB
brj-23453	472	33	:	:	PUNCT
brj-23453	472	34	may	may	AUX
brj-23453	472	35	3	3	NUM
brj-23453	472	36	,	,	PUNCT
brj-23453	472	37	2024	2024	NUM
brj-23453	472	38	;	;	PUNCT
brj-23453	472	39	published	publish	VERB
brj-23453	472	40	:	:	PUNCT
brj-23453	472	41	may	may	AUX
brj-23453	472	42	8	8	NUM
brj-23453	472	43	,	,	PUNCT
brj-23453	472	44	2024	2024	NUM
brj-23453	472	45	.	.	PUNCT
brj-23453	473	1	doi	doi	NOUN
brj-23453	473	2	:	:	PUNCT
brj-23453	473	3	10.15376	10.15376	NUM
brj-23453	473	4	/	/	SYM
brj-23453	473	5	biores.19.3.4213	biores.19.3.4213	NOUN
brj-23453	473	6	-	-	SYM
brj-23453	473	7	4237	4237	NUM
brj-23453	473	8	https://doi.org/10.3390/f9100646	https://doi.org/10.3390/f9100646	NUM
brj-23453	473	9	peer	peer	NOUN
brj-23453	473	10	-	-	PUNCT
brj-23453	473	11	reviewed	review	VERB
brj-23453	473	12	article	article	NOUN
brj-23453	473	13	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	473	14	wani	wani	PROPN
brj-23453	473	15	et	et	PROPN
brj-23453	473	16	al	al	PROPN
brj-23453	473	17	.	.	PROPN
brj-23453	473	18	(	(	PUNCT
brj-23453	473	19	2024	2024	NUM
brj-23453	473	20	)	)	PUNCT
brj-23453	473	21	.	.	PUNCT
brj-23453	474	1	“	"	PUNCT
brj-23453	474	2	walnut	walnut	ADJ
brj-23453	474	3	population	population	NOUN
brj-23453	474	4	&	&	CCONJ
brj-23453	474	5	diversity	diversity	NOUN
brj-23453	474	6	,	,	PUNCT
brj-23453	474	7	”	"	PUNCT
brj-23453	474	8	bioresources	bioresource	NOUN
brj-23453	474	9	19(3	19(3	NUM
brj-23453	474	10	)	)	PUNCT
brj-23453	474	11	,	,	PUNCT
brj-23453	474	12	4213	4213	NUM
brj-23453	474	13	-	-	SYM
brj-23453	474	14	4237	4237	NUM
brj-23453	474	15	.	.	PUNCT
brj-23453	475	1	4232	4232	NUM
brj-23453	475	2	appendix	appendix	VERB
brj-23453	475	3	supplementary	supplementary	ADJ
brj-23453	475	4	tables	table	NOUN
brj-23453	475	5	table	table	NOUN
brj-23453	475	6	s1	s1	NOUN
brj-23453	475	7	.	.	PUNCT
brj-23453	476	1	thermal	thermal	ADJ
brj-23453	476	2	profiles	profile	NOUN
brj-23453	476	3	used	use	VERB
brj-23453	476	4	for	for	ADP
brj-23453	476	5	dna	dna	ADJ
brj-23453	476	6	amplification	amplification	NOUN
brj-23453	476	7	step	step	NOUN
brj-23453	476	8	temperature	temperature	NOUN
brj-23453	476	9	(	(	PUNCT
brj-23453	476	10	°	°	ADP
brj-23453	476	11	c	c	NOUN
brj-23453	476	12	)	)	PUNCT
brj-23453	476	13	time	time	NOUN
brj-23453	476	14	no	no	INTJ
brj-23453	476	15	.	.	PUNCT
brj-23453	476	16	of	of	ADP
brj-23453	476	17	cycles	cycle	NOUN
brj-23453	476	18	initial	initial	ADJ
brj-23453	476	19	denaturation	denaturation	NOUN
brj-23453	476	20	95	95	NUM
brj-23453	476	21	5	5	NUM
brj-23453	476	22	min	min	NOUN
brj-23453	476	23	1	1	NUM
brj-23453	476	24	denaturation	denaturation	NOUN
brj-23453	476	25	94	94	NUM
brj-23453	476	26	1min	1min	NUM
brj-23453	476	27	35	35	NUM
brj-23453	476	28	annealing	anneal	VERB
brj-23453	476	29	53	53	NUM
brj-23453	476	30	to	to	PART
brj-23453	476	31	60	60	NUM
brj-23453	476	32	1	1	NUM
brj-23453	476	33	min	min	NOUN
brj-23453	476	34	40	40	NUM
brj-23453	476	35	s	s	NOUN
brj-23453	476	36	elongation	elongation	NOUN
brj-23453	476	37	72	72	NUM
brj-23453	476	38	40	40	NUM
brj-23453	476	39	s	s	NOUN
brj-23453	476	40	final	final	ADJ
brj-23453	476	41	extension	extension	NOUN
brj-23453	476	42	72	72	NUM
brj-23453	476	43	5	5	NUM
brj-23453	476	44	min	min	NOUN
brj-23453	476	45	1	1	NUM
brj-23453	476	46	peer	peer	NOUN
brj-23453	476	47	-	-	PUNCT
brj-23453	476	48	reviewed	review	VERB
brj-23453	476	49	article	article	NOUN
brj-23453	476	50	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	476	51	wani	wani	PROPN
brj-23453	476	52	et	et	PROPN
brj-23453	476	53	al	al	PROPN
brj-23453	476	54	.	.	PROPN
brj-23453	477	1	(	(	PUNCT
brj-23453	477	2	2024	2024	NUM
brj-23453	477	3	)	)	PUNCT
brj-23453	477	4	.	.	PUNCT
brj-23453	478	1	“	"	PUNCT
brj-23453	478	2	walnut	walnut	ADJ
brj-23453	478	3	population	population	NOUN
brj-23453	478	4	&	&	CCONJ
brj-23453	478	5	diversity	diversity	NOUN
brj-23453	478	6	,	,	PUNCT
brj-23453	478	7	”	"	PUNCT
brj-23453	478	8	bioresources	bioresource	NOUN
brj-23453	478	9	19(3	19(3	NUM
brj-23453	478	10	)	)	PUNCT
brj-23453	478	11	,	,	PUNCT
brj-23453	478	12	4213	4213	NUM
brj-23453	478	13	-	-	SYM
brj-23453	478	14	4237	4237	NUM
brj-23453	478	15	.	.	PUNCT
brj-23453	479	1	4233	4233	NUM
brj-23453	479	2	table	table	NOUN
brj-23453	479	3	s2	s2	PROPN
brj-23453	479	4	.	.	PUNCT
brj-23453	480	1	ssr	ssr	ADJ
brj-23453	480	2	primers	primer	NOUN
brj-23453	480	3	used	use	VERB
brj-23453	480	4	for	for	ADP
brj-23453	480	5	dna	dna	ADJ
brj-23453	480	6	amplification	amplification	NOUN
brj-23453	480	7	where	where	SCONJ
brj-23453	480	8	na	na	NOUN
brj-23453	480	9	–	–	PUNCT
brj-23453	480	10	number	number	NOUN
brj-23453	480	11	of	of	ADP
brj-23453	480	12	alleles	allele	NOUN
brj-23453	480	13	,	,	PUNCT
brj-23453	480	14	ne	ne	X
brj-23453	480	15	no	no	INTJ
brj-23453	480	16	.	.	PUNCT
brj-23453	481	1	effective	effective	ADJ
brj-23453	481	2	alleles	allele	NOUN
brj-23453	481	3	,	,	PUNCT
brj-23453	481	4	i	i	PRON
brj-23453	481	5	primer	primer	VERB
brj-23453	481	6	forward	forward	ADV
brj-23453	481	7	primer	primer	NOUN
brj-23453	481	8	(	(	PUNCT
brj-23453	481	9	5'-3	5'-3	NOUN
brj-23453	481	10	'	'	PUNCT
brj-23453	481	11	)	)	PUNCT
brj-23453	481	12	reverse	reverse	ADJ
brj-23453	481	13	primer	primer	NOUN
brj-23453	481	14	(	(	PUNCT
brj-23453	481	15	5'-3	5'-3	NOUN
brj-23453	481	16	'	'	PUNCT
brj-23453	481	17	)	)	PUNCT
brj-23453	481	18	annealing	anneal	VERB
brj-23453	481	19	temperature	temperature	NOUN
brj-23453	481	20	(	(	PUNCT
brj-23453	481	21	°	°	ADP
brj-23453	481	22	c	c	NOUN
brj-23453	481	23	)	)	PUNCT
brj-23453	481	24	expected	expect	VERB
brj-23453	481	25	amplicon	amplicon	NOUN
brj-23453	481	26	size	size	NOUN
brj-23453	481	27	(	(	PUNCT
brj-23453	481	28	bp	bp	PROPN
brj-23453	481	29	)	)	PUNCT
brj-23453	481	30	wga42	wga42	NOUN
brj-23453	482	1	f	f	NOUN
brj-23453	482	2	:	:	PUNCT
brj-23453	482	3	gtgggttcgaccgtgaac	gtgggttcgaccgtgaac	VERB
brj-23453	482	4	r	r	NOUN
brj-23453	482	5	:	:	PUNCT
brj-23453	482	6	aactttgcaccacatccaca	aactttgcaccacatccaca	NOUN
brj-23453	482	7	55	55	NUM
brj-23453	482	8	100	100	NUM
brj-23453	482	9	to	to	ADP
brj-23453	482	10	380	380	NUM
brj-23453	482	11	wga1	wga1	NOUN
brj-23453	482	12	f	f	NOUN
brj-23453	482	13	:	:	PUNCT
brj-23453	482	14	attggaagggaagggaaatg	attggaagggaagggaaatg	PROPN
brj-23453	483	1	r	r	NOUN
brj-23453	483	2	:	:	PUNCT
brj-23453	483	3	cgcgcacatacgtaaatcac	cgcgcacatacgtaaatcac	NOUN
brj-23453	483	4	56	56	NUM
brj-23453	483	5	180	180	NUM
brj-23453	483	6	to	to	PART
brj-23453	483	7	310	310	NUM
brj-23453	483	8	wga-376	wga-376	NOUN
brj-23453	483	9	f	f	NOUN
brj-23453	483	10	:	:	PUNCT
brj-23453	483	11	gccctcaaagtgatgaacgt	gccctcaaagtgatgaacgt	PROPN
brj-23453	483	12	r	r	NOUN
brj-23453	483	13	:	:	PUNCT
brj-23453	483	14	tcatccatatttacccctttcg	tcatccatatttacccctttcg	NOUN
brj-23453	483	15	56	56	NUM
brj-23453	483	16	850	850	NUM
brj-23453	483	17	wga-71	wga-71	PROPN
brj-23453	483	18	f	f	NOUN
brj-23453	483	19	:	:	PUNCT
brj-23453	483	20	acccgagagatttctgggat	acccgagagatttctgggat	ADJ
brj-23453	483	21	r	r	NOUN
brj-23453	483	22	:	:	PUNCT
brj-23453	483	23	ggacccagctcctcttctct	ggacccagctcctcttctct	NOUN
brj-23453	483	24	57	57	NUM
brj-23453	483	25	310	310	NUM
brj-23453	483	26	to	to	ADP
brj-23453	483	27	600	600	NUM
brj-23453	483	28	wga-276	wga-276	ADJ
brj-23453	483	29	f	f	PROPN
brj-23453	483	30	:	:	PUNCT
brj-23453	483	31	ctcactttctcggctcttcc	ctcactttctcggctcttcc	PROPN
brj-23453	483	32	r	r	NOUN
brj-23453	483	33	:	:	PUNCT
brj-23453	483	34	ggtcttatgtgggcagtcgt	ggtcttatgtgggcagtcgt	VERB
brj-23453	483	35	60	60	NUM
brj-23453	483	36	230	230	NUM
brj-23453	483	37	to	to	ADP
brj-23453	483	38	420	420	NUM
brj-23453	483	39	wga-72	wga-72	NUM
brj-23453	483	40	f	f	NOUN
brj-23453	483	41	:	:	PUNCT
brj-23453	483	42	aaaccacctaaaaccctgca	aaaccacctaaaaccctgca	PROPN
brj-23453	483	43	r	r	NOUN
brj-23453	483	44	:	:	PUNCT
brj-23453	483	45	acccatccatgatcttccaa	acccatccatgatcttccaa	NOUN
brj-23453	483	46	55	55	NUM
brj-23453	483	47	300	300	NUM
brj-23453	483	48	to	to	ADP
brj-23453	483	49	480	480	NUM
brj-23453	483	50	wga-79	wga-79	PROPN
brj-23453	483	51	f	f	PROPN
brj-23453	483	52	:	:	PUNCT
brj-23453	483	53	cactgtggcactgctcatct	cactgtggcactgctcatct	NOUN
brj-23453	483	54	r	r	NOUN
brj-23453	483	55	:	:	PUNCT
brj-23453	483	56	ttcgagctctggaccacc	ttcgagctctggaccacc	ADV
brj-23453	484	1	55	55	NUM
brj-23453	484	2	420	420	NUM
brj-23453	484	3	to	to	ADP
brj-23453	484	4	580	580	NUM
brj-23453	484	5	wga-76	wga-76	NOUN
brj-23453	484	6	f	f	X
brj-23453	484	7	:	:	PUNCT
brj-23453	484	8	agggcactcccttatgaggt	agggcactcccttatgaggt	NOUN
brj-23453	484	9	r	r	NOUN
brj-23453	484	10	:	:	PUNCT
brj-23453	484	11	cagtctcattccctttttcc	cagtctcattccctttttcc	NOUN
brj-23453	484	12	58	58	NUM
brj-23453	484	13	100	100	NUM
brj-23453	484	14	to	to	ADP
brj-23453	484	15	180	180	NUM
brj-23453	484	16	wga-202	wga-202	NOUN
brj-23453	485	1	f	f	NOUN
brj-23453	485	2	:	:	PUNCT
brj-23453	485	3	cccatctaccgttgcacttt	cccatctaccgttgcacttt	NOUN
brj-23453	485	4	r	r	NOUN
brj-23453	485	5	:	:	PUNCT
brj-23453	485	6	gctggtggttctatcatggg	gctggtggttctatcatggg	NOUN
brj-23453	485	7	62	62	NUM
brj-23453	485	8	150	150	NUM
brj-23453	485	9	to	to	ADP
brj-23453	485	10	380	380	NUM
brj-23453	485	11	wga-4	wga-4	NOUN
brj-23453	485	12	f	f	NOUN
brj-23453	485	13	:	:	PUNCT
brj-23453	485	14	tgttgcattgacccacttgt	tgttgcattgacccacttgt	NOUN
brj-23453	485	15	r	r	NOUN
brj-23453	485	16	:	:	PUNCT
brj-23453	485	17	taagccaacatggtatgcca	taagccaacatggtatgcca	NOUN
brj-23453	485	18	62	62	NUM
brj-23453	485	19	180	180	NUM
brj-23453	485	20	to	to	ADP
brj-23453	485	21	200	200	NUM
brj-23453	485	22	wga-69	wga-69	NOUN
brj-23453	485	23	f	f	NOUN
brj-23453	485	24	:	:	PUNCT
brj-23453	485	25	ttagattgcaaacccacccg	ttagattgcaaacccacccg	NOUN
brj-23453	485	26	r	r	NOUN
brj-23453	485	27	:	:	PUNCT
brj-23453	485	28	agatgcacagaccaaccctc	agatgcacagaccaaccctc	VERB
brj-23453	485	29	55	55	NUM
brj-23453	485	30	180	180	NUM
brj-23453	485	31	to	to	ADP
brj-23453	485	32	300	300	NUM
brj-23453	485	33	wga-32	wga-32	NOUN
brj-23453	485	34	f	f	PROPN
brj-23453	485	35	:	:	PUNCT
brj-23453	485	36	cagtttgtcccacacctcct	cagtttgtcccacacctcct	PROPN
brj-23453	485	37	r	r	NOUN
brj-23453	485	38	:	:	PUNCT
brj-23453	485	39	aacccatggtgagagagtgagc	aacccatggtgagagagtgagc	NOUN
brj-23453	485	40	62	62	NUM
brj-23453	485	41	100	100	NUM
brj-23453	485	42	to	to	PART
brj-23453	485	43	1100	1100	NUM
brj-23453	485	44	wga-118	wga-118	VERB
brj-23453	485	45	f	f	NOUN
brj-23453	485	46	:	:	PUNCT
brj-23453	485	47	tgtgctctgatctgcctccc	tgtgctctgatctgcctccc	ADJ
brj-23453	486	1	r	r	NOUN
brj-23453	486	2	:	:	PUNCT
brj-23453	486	3	gggtgggtgaaaagtagca	gggtgggtgaaaagtagca	NOUN
brj-23453	486	4	60	60	NUM
brj-23453	486	5	175	175	NUM
brj-23453	486	6	to	to	ADP
brj-23453	486	7	490	490	NUM
brj-23453	486	8	wga-332	wga-332	NOUN
brj-23453	486	9	f	f	NOUN
brj-23453	486	10	:	:	PUNCT
brj-23453	486	11	acgtcgttctgcactcctct	acgtcgttctgcactcctct	NOUN
brj-23453	486	12	r	r	NOUN
brj-23453	486	13	:	:	PUNCT
brj-23453	486	14	gccacaggaacgagtgct	gccacaggaacgagtgct	VERB
brj-23453	486	15	57	57	NUM
brj-23453	486	16	320	320	NUM
brj-23453	486	17	to	to	ADP
brj-23453	486	18	580	580	NUM
brj-23453	486	19	wga27	wga27	NOUN
brj-23453	486	20	f	f	NOUN
brj-23453	486	21	:	:	PUNCT
brj-23453	486	22	aacctcacgccttgatg	aacctcacgccttgatg	PROPN
brj-23453	487	1	r	r	NOUN
brj-23453	487	2	:	:	PUNCT
brj-23453	487	3	tgc	tgc	PROPN
brj-23453	487	4	tca	tca	PROPN
brj-23453	487	5	ggc	ggc	PROPN
brj-23453	487	6	tcc	tcc	PROPN
brj-23453	487	7	act	act	PROPN
brj-23453	487	8	tcc	tcc	PROPN
brj-23453	487	9	57	57	NUM
brj-23453	487	10	580	580	NUM
brj-23453	487	11	to	to	PART
brj-23453	487	12	600	600	NUM
brj-23453	487	13	wga225	wga225	NOUN
brj-23453	487	14	f	f	NOUN
brj-23453	487	15	:	:	PUNCT
brj-23453	487	16	aatccctctcctgggcag	aatccctctcctgggcag	PROPN
brj-23453	487	17	r	r	PROPN
brj-23453	487	18	:	:	PUNCT
brj-23453	487	19	tgttccactgaccacttcca	tgttccactgaccacttcca	NOUN
brj-23453	487	20	58	58	NUM
brj-23453	487	21	800	800	NUM
brj-23453	487	22	peer	peer	NOUN
brj-23453	487	23	-	-	PUNCT
brj-23453	487	24	reviewed	review	VERB
brj-23453	487	25	article	article	NOUN
brj-23453	487	26	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	487	27	wani	wani	PROPN
brj-23453	487	28	et	et	PROPN
brj-23453	487	29	al	al	PROPN
brj-23453	487	30	.	.	PROPN
brj-23453	488	1	(	(	PUNCT
brj-23453	488	2	2024	2024	NUM
brj-23453	488	3	)	)	PUNCT
brj-23453	488	4	.	.	PUNCT
brj-23453	489	1	“	"	PUNCT
brj-23453	489	2	walnut	walnut	ADJ
brj-23453	489	3	population	population	NOUN
brj-23453	489	4	&	&	CCONJ
brj-23453	489	5	diversity	diversity	NOUN
brj-23453	489	6	,	,	PUNCT
brj-23453	489	7	”	"	PUNCT
brj-23453	489	8	bioresources	bioresource	NOUN
brj-23453	489	9	19(3	19(3	NUM
brj-23453	489	10	)	)	PUNCT
brj-23453	489	11	,	,	PUNCT
brj-23453	489	12	4213	4213	NUM
brj-23453	489	13	-	-	SYM
brj-23453	489	14	4237	4237	NUM
brj-23453	489	15	.	.	PUNCT
brj-23453	490	1	4234	4234	NUM
brj-23453	490	2	table	table	NOUN
brj-23453	490	3	s3	s3	PROPN
brj-23453	490	4	.	.	PUNCT
brj-23453	490	5	detail	detail	NOUN
brj-23453	490	6	of	of	ADP
brj-23453	490	7	genetic	genetic	ADJ
brj-23453	490	8	diversity	diversity	NOUN
brj-23453	490	9	after	after	ADP
brj-23453	490	10	subjecting	subject	VERB
brj-23453	490	11	walnut	walnut	ADJ
brj-23453	490	12	genotypes	genotype	NOUN
brj-23453	490	13	to	to	ADP
brj-23453	490	14	ssr	ssr	ADJ
brj-23453	490	15	marker	marker	NOUN
brj-23453	490	16	analysis	analysis	NOUN
brj-23453	490	17	locus	locus	NOUN
brj-23453	490	18	na	na	ADP
brj-23453	490	19	ne	ne	NOUN
brj-23453	490	20	ho	ho	PROPN
brj-23453	490	21	he	he	PRON
brj-23453	491	1	i	i	PRON
brj-23453	491	2	pic	pic	PROPN
brj-23453	491	3	npa	npa	PROPN
brj-23453	491	4	fst	fst	NOUN
brj-23453	491	5	wga-69	wga-69	PROPN
brj-23453	491	6	2	2	NUM
brj-23453	491	7	1.31	1.31	NUM
brj-23453	491	8	0.21	0.21	NUM
brj-23453	491	9	0.71	0.71	NUM
brj-23453	491	10	1.36	1.36	NUM
brj-23453	491	11	0.38	0.38	NUM
brj-23453	491	12	1.5	1.5	NUM
brj-23453	491	13	0.168	0.168	NUM
brj-23453	491	14	wga-118	wga-118	VERB
brj-23453	491	15	3	3	NUM
brj-23453	491	16	1.43	1.43	NUM
brj-23453	491	17	0.14	0.14	NUM
brj-23453	491	18	0.68	0.68	NUM
brj-23453	491	19	1.27	1.27	NUM
brj-23453	491	20	0.29	0.29	NUM
brj-23453	491	21	1.3	1.3	NUM
brj-23453	491	22	0.300	0.300	NUM
brj-23453	491	23	wga32	wga32	PROPN
brj-23453	491	24	2	2	NUM
brj-23453	491	25	1.80	1.80	NUM
brj-23453	491	26	0.08	0.08	NUM
brj-23453	491	27	0.58	0.58	NUM
brj-23453	491	28	1.30	1.30	NUM
brj-23453	491	29	0.27	0.27	NUM
brj-23453	491	30	1.07	1.07	NUM
brj-23453	491	31	0.331	0.331	NUM
brj-23453	491	32	wga-202	wga-202	NOUN
brj-23453	491	33	3	3	NUM
brj-23453	491	34	1.38	1.38	NUM
brj-23453	491	35	0.23	0.23	NUM
brj-23453	491	36	0.75	0.75	NUM
brj-23453	491	37	1.55	1.55	NUM
brj-23453	491	38	0.11	0.11	NUM
brj-23453	491	39	0.47	0.47	NUM
brj-23453	491	40	0.176	0.176	NUM
brj-23453	491	41	wga-1	wga-1	NUM
brj-23453	491	42	4	4	NUM
brj-23453	491	43	1.51	1.51	NUM
brj-23453	491	44	0.22	0.22	NUM
brj-23453	491	45	0.72	0.72	NUM
brj-23453	491	46	1.56	1.56	NUM
brj-23453	491	47	0.33	0.33	NUM
brj-23453	491	48	1.3	1.3	NUM
brj-23453	491	49	0.178	0.178	NUM
brj-23453	491	50	wga-4	wga-4	NUM
brj-23453	491	51	4	4	NUM
brj-23453	491	52	1.48	1.48	NUM
brj-23453	491	53	0.44	0.44	NUM
brj-23453	491	54	0.89	0.89	NUM
brj-23453	491	55	1.68	1.68	NUM
brj-23453	491	56	0.12	0.12	NUM
brj-23453	491	57	1.12	1.12	NUM
brj-23453	491	58	0.156	0.156	NUM
brj-23453	491	59	wga-27	wga-27	NUM
brj-23453	491	60	2	2	NUM
brj-23453	491	61	1.26	1.26	NUM
brj-23453	491	62	0.03	0.03	NUM
brj-23453	491	63	0.83	0.83	NUM
brj-23453	491	64	1.63	1.63	NUM
brj-23453	491	65	0.19	0.19	NUM
brj-23453	491	66	0.46	0.46	NUM
brj-23453	491	67	0.178	0.178	NUM
brj-23453	491	68	wga-76	wga-76	X
brj-23453	491	69	2	2	NUM
brj-23453	491	70	1.32	1.32	NUM
brj-23453	491	71	0.16	0.16	NUM
brj-23453	491	72	0.68	0.68	NUM
brj-23453	491	73	1.27	1.27	NUM
brj-23453	491	74	0.17	0.17	NUM
brj-23453	491	75	0.41	0.41	NUM
brj-23453	491	76	0.343	0.343	NUM
brj-23453	491	77	wga-42	wga-42	NOUN
brj-23453	491	78	3	3	NUM
brj-23453	491	79	1.42	1.42	NUM
brj-23453	491	80	0.12	0.12	NUM
brj-23453	491	81	0.60	0.60	NUM
brj-23453	491	82	1.57	1.57	NUM
brj-23453	491	83	0.22	0.22	NUM
brj-23453	491	84	1.21	1.21	NUM
brj-23453	491	85	0.215	0.215	NUM
brj-23453	491	86	wga-79	wga-79	PROPN
brj-23453	491	87	4	4	NUM
brj-23453	491	88	1.52	1.52	NUM
brj-23453	491	89	0.11	0.11	NUM
brj-23453	491	90	0.61	0.61	NUM
brj-23453	491	91	1.54	1.54	NUM
brj-23453	491	92	0.21	0.21	NUM
brj-23453	491	93	0.54	0.54	NUM
brj-23453	491	94	0.208	0.208	NUM
brj-23453	491	95	wg-72	wg-72	NUM
brj-23453	491	96	2	2	NUM
brj-23453	491	97	1.13	1.13	NUM
brj-23453	491	98	0.07	0.07	NUM
brj-23453	491	99	0.52	0.52	NUM
brj-23453	491	100	1.30	1.30	NUM
brj-23453	491	101	0.28	0.28	NUM
brj-23453	491	102	1.31	1.31	NUM
brj-23453	491	103	0.266	0.266	NUM
brj-23453	491	104	wga-71	wga-71	PROPN
brj-23453	491	105	3	3	NUM
brj-23453	491	106	1.43	1.43	NUM
brj-23453	491	107	0.12	0.12	NUM
brj-23453	491	108	0.64	0.64	NUM
brj-23453	491	109	1.24	1.24	NUM
brj-23453	491	110	0.13	0.13	NUM
brj-23453	491	111	0.48	0.48	NUM
brj-23453	491	112	0.199	0.199	NUM
brj-23453	491	113	wga-276	wga-276	ADJ
brj-23453	491	114	2	2	NUM
brj-23453	491	115	1.00	1.00	NUM
brj-23453	491	116	0.09	0.09	NUM
brj-23453	491	117	0.62	0.62	NUM
brj-23453	491	118	1.53	1.53	NUM
brj-23453	491	119	0.29	0.29	NUM
brj-23453	491	120	1.12	1.12	NUM
brj-23453	491	121	0.242	0.242	NUM
brj-23453	491	122	wga-225	wga-225	VERB
brj-23453	491	123	3	3	NUM
brj-23453	491	124	1.39	1.39	NUM
brj-23453	491	125	0.08	0.08	NUM
brj-23453	491	126	0.59	0.59	NUM
brj-23453	491	127	1.34	1.34	NUM
brj-23453	491	128	0.14	0.14	NUM
brj-23453	491	129	2.12	2.12	NUM
brj-23453	491	130	0.158	0.158	NUM
brj-23453	491	131	wga-376	wga-376	NOUN
brj-23453	491	132	2	2	NUM
brj-23453	491	133	1.34	1.34	NUM
brj-23453	491	134	0.14	0.14	NUM
brj-23453	491	135	0.65	0.65	NUM
brj-23453	491	136	1.53	1.53	NUM
brj-23453	491	137	0.23	0.23	NUM
brj-23453	491	138	3.11	3.11	NUM
brj-23453	491	139	0.179	0.179	NUM
brj-23453	491	140	wga-332	wga-332	NOUN
brj-23453	491	141	3	3	NUM
brj-23453	491	142	1.18	1.18	NUM
brj-23453	491	143	0.23	0.23	NUM
brj-23453	491	144	0.72	0.72	NUM
brj-23453	491	145	1.57	1.57	NUM
brj-23453	491	146	0.16	0.16	NUM
brj-23453	491	147	1.31	1.31	NUM
brj-23453	491	148	0.198	0.198	NUM
brj-23453	491	149	mean±sd	mean±sd	ADP
brj-23453	491	150	2.94	2.94	NUM
brj-23453	491	151	±	±	NUM
brj-23453	491	152	1.52	1.52	NUM
brj-23453	491	153	1.37	1.37	NUM
brj-23453	491	154	±	±	NOUN
brj-23453	491	155	0.21	0.21	NUM
brj-23453	491	156	0.63	0.63	NUM
brj-23453	491	157	±	±	NUM
brj-23453	491	158	0.08	0.08	NUM
brj-23453	491	159	0.68	0.68	NUM
brj-23453	491	160	±	±	NUM
brj-23453	491	161	0.08	0.08	NUM
brj-23453	491	162	1.45	1.45	NUM
brj-23453	491	163	±	±	NUM
brj-23453	491	164	0.25	0.25	NUM
brj-23453	491	165	0.22	0.22	NUM
brj-23453	491	166	±	±	NUM
brj-23453	491	167	0.04	0.04	NUM
brj-23453	491	168	1.17	1.17	NUM
brj-23453	491	169	±	±	NUM
brj-23453	491	170	1.72	1.72	NUM
brj-23453	491	171	0.219	0.219	NUM
brj-23453	491	172	±	±	NUM
brj-23453	491	173	0.07	0.07	NUM
brj-23453	491	174	se	se	X
brj-23453	491	175	0.18	0.18	NUM
brj-23453	491	176	0.13	0.13	NUM
brj-23453	491	177	0.03	0.03	NUM
brj-23453	491	178	0.01	0.01	NUM
brj-23453	491	179	0.12	0.12	NUM
brj-23453	491	180	0.01	0.01	NUM
brj-23453	491	181	0.81	0.81	NUM
brj-23453	491	182	0.015	0.015	NUM
brj-23453	491	183	information	information	NOUN
brj-23453	491	184	index	index	NOUN
brj-23453	491	185	,	,	PUNCT
brj-23453	491	186	hoobserved	hoobserve	VERB
brj-23453	491	187	heterozygosity	heterozygosity	NOUN
brj-23453	491	188	,	,	PUNCT
brj-23453	491	189	heexpected	heexpected	ADJ
brj-23453	491	190	heterozygosity	heterozygosity	NOUN
brj-23453	491	191	,	,	PUNCT
brj-23453	491	192	picpolymorphic	picpolymorphic	ADJ
brj-23453	491	193	information	information	NOUN
brj-23453	491	194	content	content	NOUN
brj-23453	491	195	,	,	PUNCT
brj-23453	491	196	npanumber	npanumber	NOUN
brj-23453	491	197	of	of	ADP
brj-23453	491	198	private	private	ADJ
brj-23453	491	199	alleles	allele	NOUN
brj-23453	491	200	,	,	PUNCT
brj-23453	491	201	fstatics	fstatic	NOUN
brj-23453	491	202	per	per	ADP
brj-23453	491	203	locus	locus	NOUN
brj-23453	491	204	(	(	PUNCT
brj-23453	491	205	fst	fst	NOUN
brj-23453	491	206	)	)	PUNCT
brj-23453	491	207	,	,	PUNCT
brj-23453	491	208	se	se	ADJ
brj-23453	491	209	-	-	NOUN
brj-23453	491	210	standard	standard	ADJ
brj-23453	491	211	error	error	NOUN
brj-23453	491	212	.	.	PUNCT
brj-23453	492	1	peer	peer	NOUN
brj-23453	492	2	-	-	PUNCT
brj-23453	492	3	reviewed	review	VERB
brj-23453	492	4	article	article	NOUN
brj-23453	492	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	492	6	wani	wani	PROPN
brj-23453	492	7	et	et	PROPN
brj-23453	492	8	al	al	PROPN
brj-23453	492	9	.	.	PROPN
brj-23453	493	1	(	(	PUNCT
brj-23453	493	2	2024	2024	NUM
brj-23453	493	3	)	)	PUNCT
brj-23453	493	4	.	.	PUNCT
brj-23453	494	1	“	"	PUNCT
brj-23453	494	2	walnut	walnut	ADJ
brj-23453	494	3	population	population	NOUN
brj-23453	494	4	&	&	CCONJ
brj-23453	494	5	diversity	diversity	NOUN
brj-23453	494	6	,	,	PUNCT
brj-23453	494	7	”	"	PUNCT
brj-23453	494	8	bioresources	bioresource	NOUN
brj-23453	494	9	19(3	19(3	NUM
brj-23453	494	10	)	)	PUNCT
brj-23453	494	11	,	,	PUNCT
brj-23453	494	12	4213	4213	NUM
brj-23453	494	13	-	-	SYM
brj-23453	494	14	4237	4237	NUM
brj-23453	494	15	.	.	PUNCT
brj-23453	495	1	4235	4235	NUM
brj-23453	495	2	table	table	NOUN
brj-23453	495	3	s4	s4	NOUN
brj-23453	495	4	.	.	PUNCT
brj-23453	496	1	statistics	statistic	NOUN
brj-23453	496	2	of	of	ADP
brj-23453	496	3	genetic	genetic	ADJ
brj-23453	496	4	structure	structure	NOUN
brj-23453	496	5	and	and	CCONJ
brj-23453	496	6	gene	gene	NOUN
brj-23453	496	7	flow	flow	NOUN
brj-23453	496	8	for	for	ADP
brj-23453	496	9	the	the	DET
brj-23453	496	10	16	16	NUM
brj-23453	496	11	polymorphic	polymorphic	ADJ
brj-23453	496	12	loci	loci	NOUN
brj-23453	496	13	in	in	ADP
brj-23453	496	14	walnut	walnut	NOUN
brj-23453	496	15	populations	population	NOUN
brj-23453	496	16	all	all	DET
brj-23453	496	17	pops	pop	NOUN
brj-23453	496	18	.	.	PUNCT
brj-23453	497	1	locus	locus	NOUN
brj-23453	497	2	fisa	fisa	NOUN
brj-23453	497	3	fitb	fitb	NOUN
brj-23453	497	4	fstc	fstc	NOUN
brj-23453	497	5	nmd	nmd	PROPN
brj-23453	497	6	wga-69	wga-69	PROPN
brj-23453	497	7	0.165	0.165	NUM
brj-23453	497	8	0.453	0.453	NUM
brj-23453	497	9	0.168	0.168	NUM
brj-23453	497	10	1.240	1.240	NUM
brj-23453	497	11	wga-118	wga-118	VERB
brj-23453	497	12	0.193	0.193	NUM
brj-23453	497	13	0.435	0.435	NUM
brj-23453	497	14	0.300	0.300	NUM
brj-23453	497	15	0.582	0.582	NUM
brj-23453	497	16	wga-32	wga-32	NUM
brj-23453	497	17	0.182	0.182	NUM
brj-23453	497	18	0.305	0.305	NUM
brj-23453	497	19	0.331	0.331	NUM
brj-23453	497	20	0.504	0.504	NUM
brj-23453	497	21	wga-202	wga-202	NOUN
brj-23453	497	22	0.045	0.045	NUM
brj-23453	497	23	0.213	0.213	NUM
brj-23453	497	24	0.176	0.176	NUM
brj-23453	497	25	1.171	1.171	NUM
brj-23453	497	26	wga-1	wga-1	NUM
brj-23453	497	27	0.103	0.103	NUM
brj-23453	497	28	0.263	0.263	NUM
brj-23453	497	29	0.178	0.178	NUM
brj-23453	497	30	1.155	1.155	NUM
brj-23453	497	31	wga-4	wga-4	ADP
brj-23453	497	32	0.691	0.691	NUM
brj-23453	497	33	0.756	0.756	NUM
brj-23453	497	34	0.156	0.156	NUM
brj-23453	497	35	1.352	1.352	NUM
brj-23453	497	36	wga-27	wga-27	NUM
brj-23453	497	37	0.116	0.116	NUM
brj-23453	497	38	0.274	0.274	NUM
brj-23453	497	39	0.178	0.178	NUM
brj-23453	497	40	1.155	1.155	NUM
brj-23453	497	41	wga-76	wga-76	NUM
brj-23453	497	42	0.013	0.013	NUM
brj-23453	497	43	0.167	0.167	NUM
brj-23453	497	44	0.343	0.343	NUM
brj-23453	497	45	0.479	0.479	NUM
brj-23453	497	46	wga-42	wga-42	NOUN
brj-23453	497	47	0.051	0.051	NUM
brj-23453	497	48	0.201	0.201	NUM
brj-23453	497	49	0.215	0.215	NUM
brj-23453	497	50	0.913	0.913	NUM
brj-23453	497	51	wga-79	wga-79	NOUN
brj-23453	497	52	0.124	0.124	NUM
brj-23453	497	53	0.424	0.424	NUM
brj-23453	497	54	0.208	0.208	NUM
brj-23453	497	55	0.949	0.949	NUM
brj-23453	497	56	wg-72	wg-72	NUM
brj-23453	497	57	0.102	0.102	NUM
brj-23453	497	58	0.341	0.341	NUM
brj-23453	497	59	0.266	0.266	NUM
brj-23453	497	60	0.688	0.688	NUM
brj-23453	497	61	wga-71	wga-71	PROPN
brj-23453	497	62	0.289	0.289	NUM
brj-23453	497	63	0.430	0.430	NUM
brj-23453	497	64	0.199	0.199	NUM
brj-23453	497	65	1.005	1.005	NUM
brj-23453	497	66	wga-276	wga-276	ADP
brj-23453	497	67	0.151	0.151	NUM
brj-23453	497	68	0.356	0.356	NUM
brj-23453	497	69	0.242	0.242	NUM
brj-23453	497	70	0.783	0.783	NUM
brj-23453	497	71	wga-225	wga-225	VERB
brj-23453	497	72	0.431	0.431	NUM
brj-23453	497	73	0.553	0.553	NUM
brj-23453	497	74	0.158	0.158	NUM
brj-23453	497	75	1.332	1.332	NUM
brj-23453	497	76	wga-376	wga-376	VERB
brj-23453	497	77	0.238	0.238	NUM
brj-23453	497	78	0.375	0.375	NUM
brj-23453	497	79	0.179	0.179	NUM
brj-23453	497	80	1.144	1.144	NUM
brj-23453	497	81	wga-332	wga-332	NOUN
brj-23453	497	82	0.113	0.113	NUM
brj-23453	497	83	0.288	0.288	NUM
brj-23453	497	84	0.198	0.198	NUM
brj-23453	497	85	1.012	1.012	NUM
brj-23453	497	86	average	average	NOUN
brj-23453	497	87	0.188	0.188	NUM
brj-23453	497	88	0.365	0.365	NUM
brj-23453	497	89	0.219	0.219	NUM
brj-23453	497	90	0.966	0.966	NUM
brj-23453	497	91	se	se	X
brj-23453	497	92	±	±	PROPN
brj-23453	497	93	0.042	0.042	NUM
brj-23453	497	94	0.037	0.037	NUM
brj-23453	497	95	0.015	0.015	NUM
brj-23453	497	96	0.071	0.071	NUM
brj-23453	497	97	a	a	DET
brj-23453	497	98	level	level	NOUN
brj-23453	497	99	of	of	ADP
brj-23453	497	100	inbreeding	inbreede	VERB
brj-23453	497	101	due	due	ADP
brj-23453	497	102	to	to	ADP
brj-23453	497	103	non	non	ADJ
brj-23453	497	104	-	-	ADJ
brj-23453	497	105	random	random	ADJ
brj-23453	497	106	mating	mating	NOUN
brj-23453	497	107	within	within	ADP
brj-23453	497	108	the	the	DET
brj-23453	497	109	population	population	NOUN
brj-23453	497	110	b	b	NOUN
brj-23453	497	111	overall	overall	ADJ
brj-23453	497	112	inbreeding	inbreede	VERB
brj-23453	497	113	coefficient	coefficient	NOUN
brj-23453	497	114	;	;	PUNCT
brj-23453	497	115	c	c	X
brj-23453	497	116	population	population	NOUN
brj-23453	497	117	sub	sub	NOUN
brj-23453	497	118	-	-	NOUN
brj-23453	497	119	division	division	NOUN
brj-23453	497	120	;	;	PUNCT
brj-23453	497	121	d	d	ADP
brj-23453	497	122	gene	gene	NOUN
brj-23453	497	123	flow	flow	NOUN
brj-23453	497	124	peer	peer	NOUN
brj-23453	497	125	-	-	PUNCT
brj-23453	497	126	reviewed	review	VERB
brj-23453	497	127	article	article	NOUN
brj-23453	497	128	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	497	129	wani	wani	PROPN
brj-23453	497	130	et	et	PROPN
brj-23453	497	131	al	al	PROPN
brj-23453	497	132	.	.	PROPN
brj-23453	498	1	(	(	PUNCT
brj-23453	498	2	2024	2024	NUM
brj-23453	498	3	)	)	PUNCT
brj-23453	498	4	.	.	PUNCT
brj-23453	499	1	“	"	PUNCT
brj-23453	499	2	walnut	walnut	ADJ
brj-23453	499	3	population	population	NOUN
brj-23453	499	4	&	&	CCONJ
brj-23453	499	5	diversity	diversity	NOUN
brj-23453	499	6	,	,	PUNCT
brj-23453	499	7	”	"	PUNCT
brj-23453	499	8	bioresources	bioresource	NOUN
brj-23453	499	9	19(3	19(3	NUM
brj-23453	499	10	)	)	PUNCT
brj-23453	499	11	,	,	PUNCT
brj-23453	499	12	4213	4213	NUM
brj-23453	499	13	-	-	SYM
brj-23453	499	14	4237	4237	NUM
brj-23453	499	15	.	.	PUNCT
brj-23453	500	1	4236	4236	NUM
brj-23453	500	2	supplementary	supplementary	ADJ
brj-23453	500	3	figures	figure	NOUN
brj-23453	500	4	fig	fig	NOUN
brj-23453	500	5	.	.	PUNCT
brj-23453	501	1	s1	s1	PROPN
brj-23453	501	2	.	.	PUNCT
brj-23453	502	1	pcr	pcr	PROPN
brj-23453	502	2	amplified	amplify	VERB
brj-23453	502	3	pattern	pattern	NOUN
brj-23453	502	4	of	of	ADP
brj-23453	502	5	walnut	walnut	NOUN
brj-23453	502	6	using	use	VERB
brj-23453	502	7	primer	primer	NOUN
brj-23453	502	8	wga	wga	PROPN
brj-23453	502	9	32	32	NUM
brj-23453	502	10	and	and	CCONJ
brj-23453	502	11	wga	wga	PROPN
brj-23453	502	12	69	69	NUM
brj-23453	502	13	.	.	PUNCT
brj-23453	503	1	l:100	l:100	PROPN
brj-23453	503	2	bp	bp	PROPN
brj-23453	503	3	ladder	ladder	NOUN
brj-23453	503	4	.	.	PUNCT
brj-23453	504	1	lanes	lane	NOUN
brj-23453	504	2	1	1	NUM
brj-23453	504	3	to	to	PART
brj-23453	504	4	21	21	NUM
brj-23453	504	5	represent	represent	VERB
brj-23453	504	6	genotypes	genotype	NOUN
brj-23453	504	7	peer	peer	NOUN
brj-23453	504	8	-	-	PUNCT
brj-23453	504	9	reviewed	review	VERB
brj-23453	504	10	article	article	NOUN
brj-23453	504	11	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-23453	504	12	wani	wani	PROPN
brj-23453	504	13	et	et	PROPN
brj-23453	504	14	al	al	PROPN
brj-23453	504	15	.	.	PROPN
brj-23453	505	1	(	(	PUNCT
brj-23453	505	2	2024	2024	NUM
brj-23453	505	3	)	)	PUNCT
brj-23453	505	4	.	.	PUNCT
brj-23453	506	1	“	"	PUNCT
brj-23453	506	2	walnut	walnut	ADJ
brj-23453	506	3	population	population	NOUN
brj-23453	506	4	&	&	CCONJ
brj-23453	506	5	diversity	diversity	NOUN
brj-23453	506	6	,	,	PUNCT
brj-23453	506	7	”	"	PUNCT
brj-23453	506	8	bioresources	bioresource	NOUN
brj-23453	506	9	19(3	19(3	NUM
brj-23453	506	10	)	)	PUNCT
brj-23453	506	11	,	,	PUNCT
brj-23453	506	12	4213	4213	NUM
brj-23453	506	13	-	-	SYM
brj-23453	506	14	4237	4237	NUM
brj-23453	506	15	.	.	PUNCT
brj-23453	507	1	4237	4237	NUM
brj-23453	507	2	fig	fig	NOUN
brj-23453	507	3	.	.	PUNCT
brj-23453	508	1	s2	s2	PROPN
brj-23453	508	2	.	.	PUNCT
brj-23453	509	1	pcr	pcr	PROPN
brj-23453	509	2	amplified	amplify	VERB
brj-23453	509	3	pattern	pattern	NOUN
brj-23453	509	4	of	of	ADP
brj-23453	509	5	walnut	walnut	NOUN
brj-23453	509	6	using	use	VERB
brj-23453	509	7	primer	primer	NOUN
brj-23453	509	8	wga	wga	PROPN
brj-23453	509	9	118	118	NUM
brj-23453	509	10	and	and	CCONJ
brj-23453	509	11	wga	wga	PROPN
brj-23453	509	12	321	321	NUM
brj-23453	509	13	.	.	PUNCT
brj-23453	510	1	l:100	l:100	PROPN
brj-23453	510	2	bp	bp	PROPN
brj-23453	510	3	ladder	ladder	NOUN
brj-23453	510	4	.	.	PUNCT
brj-23453	511	1	lanes	lane	NOUN
brj-23453	511	2	1	1	NUM
brj-23453	511	3	to	to	PART
brj-23453	511	4	21	21	NUM
brj-23453	511	5	represent	represent	VERB
brj-23453	511	6	genotypes	genotype	NOUN
brj-23453	511	7	fig	fig	NOUN
brj-23453	511	8	.	.	PUNCT
brj-23453	512	1	s3	s3	PROPN
brj-23453	512	2	.	.	PUNCT
brj-23453	513	1	pcr	pcr	PROPN
brj-23453	513	2	amplified	amplify	VERB
brj-23453	513	3	pattern	pattern	NOUN
brj-23453	513	4	of	of	ADP
brj-23453	513	5	walnut	walnut	NOUN
brj-23453	513	6	using	use	VERB
brj-23453	513	7	primer	primer	NOUN
brj-23453	513	8	wga202	wga202	PROPN
brj-23453	513	9	and	and	CCONJ
brj-23453	513	10	wga1	wga1	PROPN
brj-23453	513	11	.	.	PUNCT
brj-23453	514	1	l:100	l:100	PROPN
brj-23453	514	2	bp	bp	PROPN
brj-23453	514	3	ladder	ladder	NOUN
brj-23453	514	4	.	.	PUNCT
brj-23453	515	1	lanes	lane	NOUN
brj-23453	515	2	1	1	NUM
brj-23453	515	3	to	to	PART
brj-23453	515	4	21	21	NUM
brj-23453	515	5	represent	represent	VERB
brj-23453	515	6	genotypes	genotype	NOUN