id	sid	tid	token	lemma	pos
brj-23886	1	1	peer	peer	NOUN
brj-23886	1	2	-	-	PUNCT
brj-23886	1	3	review	review	NOUN
brj-23886	1	4	article	article	NOUN
brj-23886	1	5	peer	peer	NOUN
brj-23886	1	6	-	-	PUNCT
brj-23886	1	7	reviewed	review	VERB
brj-23886	1	8	article	article	NOUN
brj-23886	1	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	1	10	cui	cui	PROPN
brj-23886	1	11	et	et	PROPN
brj-23886	1	12	al	al	PROPN
brj-23886	1	13	.	.	PROPN
brj-23886	2	1	(	(	PUNCT
brj-23886	2	2	2025	2025	NUM
brj-23886	2	3	)	)	PUNCT
brj-23886	2	4	.	.	PUNCT
brj-23886	3	1	“	"	PUNCT
brj-23886	3	2	genome	genome	NOUN
brj-23886	3	3	study	study	NOUN
brj-23886	3	4	of	of	ADP
brj-23886	3	5	c.	c.	PROPN
brj-23886	3	6	thermocellum	thermocellum	PROPN
brj-23886	3	7	,	,	PUNCT
brj-23886	3	8	”	"	PUNCT
brj-23886	3	9	bioresources	bioresource	NOUN
brj-23886	3	10	20(2	20(2	NUM
brj-23886	3	11	)	)	PUNCT
brj-23886	3	12	,	,	PUNCT
brj-23886	3	13	3155	3155	NUM
brj-23886	3	14	-	-	SYM
brj-23886	3	15	3175	3175	NUM
brj-23886	3	16	.	.	PUNCT
brj-23886	4	1	3155	3155	NUM
brj-23886	4	2	genome	genome	NOUN
brj-23886	4	3	-	-	PUNCT
brj-23886	4	4	based	base	VERB
brj-23886	4	5	study	study	NOUN
brj-23886	4	6	on	on	ADP
brj-23886	4	7	the	the	DET
brj-23886	4	8	mechanism	mechanism	NOUN
brj-23886	4	9	of	of	ADP
brj-23886	4	10	rare	rare	ADJ
brj-23886	4	11	earth	earth	NOUN
brj-23886	4	12	neodymium	neodymium	NOUN
brj-23886	4	13	ions	ion	NOUN
brj-23886	4	14	increasing	increase	VERB
brj-23886	4	15	ethanol	ethanol	NOUN
brj-23886	4	16	production	production	NOUN
brj-23886	4	17	from	from	ADP
brj-23886	4	18	clostridium	clostridium	NOUN
brj-23886	4	19	thermocellum	thermocellum	PROPN
brj-23886	4	20	jinna	jinna	PROPN
brj-23886	4	21	cui	cui	PROPN
brj-23886	4	22	,	,	PUNCT
brj-23886	4	23	a	a	DET
brj-23886	4	24	,	,	PUNCT
brj-23886	4	25	b	b	NOUN
brj-23886	4	26	,	,	PUNCT
brj-23886	4	27	c	c	NOUN
brj-23886	4	28	,	,	PUNCT
brj-23886	4	29	d	d	PROPN
brj-23886	4	30	tiantian	tiantian	PROPN
brj-23886	4	31	sun	sun	PROPN
brj-23886	4	32	,	,	PUNCT
brj-23886	4	33	a	a	DET
brj-23886	4	34	,	,	PUNCT
brj-23886	4	35	b	b	NOUN
brj-23886	4	36	,	,	PUNCT
brj-23886	4	37	c	c	X
brj-23886	4	38	,	,	PUNCT
brj-23886	4	39	d	d	PROPN
brj-23886	4	40	lixia	lixia	PROPN
brj-23886	4	41	liu	liu	PROPN
brj-23886	4	42	,	,	PUNCT
brj-23886	4	43	a	a	DET
brj-23886	4	44	,	,	PUNCT
brj-23886	4	45	b	b	NOUN
brj-23886	4	46	,	,	PUNCT
brj-23886	4	47	c	c	NOUN
brj-23886	4	48	,	,	PUNCT
brj-23886	4	49	d	d	PROPN
brj-23886	4	50	zhanying	zhanye	VERB
brj-23886	4	51	liu	liu	PROPN
brj-23886	4	52	a	a	PROPN
brj-23886	4	53	,	,	PUNCT
brj-23886	4	54	b	b	PROPN
brj-23886	4	55	,	,	PUNCT
brj-23886	4	56	c	c	NOUN
brj-23886	4	57	,	,	PUNCT
brj-23886	4	58	d	d	NOUN
brj-23886	4	59	,	,	PUNCT
brj-23886	4	60	*	*	PUNCT
brj-23886	4	61	the	the	DET
brj-23886	4	62	escalating	escalate	VERB
brj-23886	4	63	global	global	ADJ
brj-23886	4	64	demand	demand	NOUN
brj-23886	4	65	for	for	ADP
brj-23886	4	66	energy	energy	NOUN
brj-23886	4	67	,	,	PUNCT
brj-23886	4	68	coupled	couple	VERB
brj-23886	4	69	with	with	ADP
brj-23886	4	70	heightened	heightened	ADJ
brj-23886	4	71	environmental	environmental	ADJ
brj-23886	4	72	concerns	concern	NOUN
brj-23886	4	73	,	,	PUNCT
brj-23886	4	74	has	have	AUX
brj-23886	4	75	rendered	render	VERB
brj-23886	4	76	the	the	DET
brj-23886	4	77	identification	identification	NOUN
brj-23886	4	78	of	of	ADP
brj-23886	4	79	sustainable	sustainable	ADJ
brj-23886	4	80	and	and	CCONJ
brj-23886	4	81	environmentally	environmentally	ADV
brj-23886	4	82	friendly	friendly	ADJ
brj-23886	4	83	alternative	alternative	ADJ
brj-23886	4	84	energy	energy	NOUN
brj-23886	4	85	sources	source	NOUN
brj-23886	4	86	imperative	imperative	ADJ
brj-23886	4	87	.	.	PUNCT
brj-23886	5	1	ethanol	ethanol	NOUN
brj-23886	5	2	derived	derive	VERB
brj-23886	5	3	from	from	ADP
brj-23886	5	4	cellulosic	cellulosic	NOUN
brj-23886	5	5	fibers	fiber	NOUN
brj-23886	5	6	is	be	AUX
brj-23886	5	7	garnering	garner	VERB
brj-23886	5	8	significant	significant	ADJ
brj-23886	5	9	interest	interest	NOUN
brj-23886	5	10	as	as	ADP
brj-23886	5	11	a	a	DET
brj-23886	5	12	clean	clean	ADJ
brj-23886	5	13	and	and	CCONJ
brj-23886	5	14	renewable	renewable	ADJ
brj-23886	5	15	energy	energy	NOUN
brj-23886	5	16	source	source	NOUN
brj-23886	5	17	.	.	PUNCT
brj-23886	6	1	among	among	ADP
brj-23886	6	2	the	the	DET
brj-23886	6	3	various	various	ADJ
brj-23886	6	4	production	production	NOUN
brj-23886	6	5	methods	method	NOUN
brj-23886	6	6	,	,	PUNCT
brj-23886	6	7	consolidated	consolidated	ADJ
brj-23886	6	8	bioprocessing	bioprocessing	NOUN
brj-23886	6	9	(	(	PUNCT
brj-23886	6	10	cbp	cbp	PROPN
brj-23886	6	11	)	)	PUNCT
brj-23886	6	12	stands	stand	VERB
brj-23886	6	13	out	out	ADP
brj-23886	6	14	due	due	ADP
brj-23886	6	15	to	to	ADP
brj-23886	6	16	its	its	PRON
brj-23886	6	17	distinct	distinct	ADJ
brj-23886	6	18	advantages	advantage	NOUN
brj-23886	6	19	.	.	PUNCT
brj-23886	7	1	clostridium	clostridium	NOUN
brj-23886	7	2	thermocellum	thermocellum	PROPN
brj-23886	7	3	is	be	AUX
brj-23886	7	4	considered	consider	VERB
brj-23886	7	5	an	an	DET
brj-23886	7	6	exemplary	exemplary	ADJ
brj-23886	7	7	candidate	candidate	NOUN
brj-23886	7	8	strain	strain	NOUN
brj-23886	7	9	for	for	ADP
brj-23886	7	10	the	the	DET
brj-23886	7	11	cbp	cbp	PROPN
brj-23886	7	12	production	production	NOUN
brj-23886	7	13	of	of	ADP
brj-23886	7	14	cellulosic	cellulosic	NOUN
brj-23886	7	15	ethanol	ethanol	NOUN
brj-23886	7	16	;	;	PUNCT
brj-23886	7	17	however	however	ADV
brj-23886	7	18	,	,	PUNCT
brj-23886	7	19	the	the	DET
brj-23886	7	20	low	low	ADJ
brj-23886	7	21	yield	yield	NOUN
brj-23886	7	22	of	of	ADP
brj-23886	7	23	ethanol	ethanol	NOUN
brj-23886	7	24	remains	remain	VERB
brj-23886	7	25	a	a	DET
brj-23886	7	26	critical	critical	ADJ
brj-23886	7	27	limiting	limiting	NOUN
brj-23886	7	28	factor	factor	NOUN
brj-23886	7	29	.	.	PUNCT
brj-23886	8	1	in	in	ADP
brj-23886	8	2	the	the	DET
brj-23886	8	3	preceding	precede	VERB
brj-23886	8	4	study	study	NOUN
brj-23886	8	5	,	,	PUNCT
brj-23886	8	6	it	it	PRON
brj-23886	8	7	was	be	AUX
brj-23886	8	8	demonstrated	demonstrate	VERB
brj-23886	8	9	that	that	SCONJ
brj-23886	8	10	neodymium	neodymium	NOUN
brj-23886	8	11	ions	ion	NOUN
brj-23886	8	12	could	could	AUX
brj-23886	8	13	enhance	enhance	VERB
brj-23886	8	14	the	the	DET
brj-23886	8	15	ethanol	ethanol	NOUN
brj-23886	8	16	production	production	NOUN
brj-23886	8	17	of	of	ADP
brj-23886	8	18	c.	c.	PROPN
brj-23886	8	19	thermocellum	thermocellum	PROPN
brj-23886	8	20	.	.	PUNCT
brj-23886	9	1	in	in	ADP
brj-23886	9	2	this	this	DET
brj-23886	9	3	study	study	NOUN
brj-23886	9	4	,	,	PUNCT
brj-23886	9	5	the	the	DET
brj-23886	9	6	whole	whole	ADJ
brj-23886	9	7	genome	genome	NOUN
brj-23886	9	8	sequences	sequence	NOUN
brj-23886	9	9	of	of	ADP
brj-23886	9	10	the	the	DET
brj-23886	9	11	original	original	ADJ
brj-23886	9	12	strain	strain	NOUN
brj-23886	9	13	c.	c.	PROPN
brj-23886	9	14	thermocellum	thermocellum	PROPN
brj-23886	9	15	atcc	atcc	PROPN
brj-23886	9	16	27405	27405	NUM
brj-23886	9	17	(	(	PUNCT
brj-23886	9	18	c0	c0	NOUN
brj-23886	9	19	)	)	PUNCT
brj-23886	9	20	and	and	CCONJ
brj-23886	9	21	the	the	DET
brj-23886	9	22	strain	strain	NOUN
brj-23886	9	23	with	with	ADP
brj-23886	9	24	added	add	VERB
brj-23886	9	25	neodymium	neodymium	NOUN
brj-23886	9	26	ions	ion	NOUN
brj-23886	9	27	(	(	PUNCT
brj-23886	9	28	nd3	nd3	NOUN
brj-23886	9	29	+	+	NOUN
brj-23886	9	30	)	)	PUNCT
brj-23886	9	31	(	(	PUNCT
brj-23886	9	32	c1	c1	PROPN
brj-23886	9	33	)	)	PUNCT
brj-23886	9	34	were	be	AUX
brj-23886	9	35	sequenced	sequence	VERB
brj-23886	9	36	and	and	CCONJ
brj-23886	9	37	analyzed	analyze	VERB
brj-23886	9	38	.	.	PUNCT
brj-23886	10	1	the	the	DET
brj-23886	10	2	findings	finding	NOUN
brj-23886	10	3	indicated	indicate	VERB
brj-23886	10	4	that	that	SCONJ
brj-23886	10	5	the	the	DET
brj-23886	10	6	increased	increase	VERB
brj-23886	10	7	expression	expression	NOUN
brj-23886	10	8	of	of	ADP
brj-23886	10	9	pyruvate	pyruvate	NOUN
brj-23886	10	10	-	-	PUNCT
brj-23886	10	11	ferric	ferric	ADJ
brj-23886	10	12	redox	redox	NOUN
brj-23886	10	13	protease	protease	NOUN
brj-23886	10	14	(	(	PUNCT
brj-23886	10	15	pfo	pfo	NOUN
brj-23886	10	16	)	)	PUNCT
brj-23886	10	17	resulted	result	VERB
brj-23886	10	18	from	from	ADP
brj-23886	10	19	mutations	mutation	NOUN
brj-23886	10	20	in	in	ADP
brj-23886	10	21	its	its	PRON
brj-23886	10	22	promoter	promoter	NOUN
brj-23886	10	23	region	region	NOUN
brj-23886	10	24	.	.	PUNCT
brj-23886	11	1	furthermore	furthermore	ADV
brj-23886	11	2	,	,	PUNCT
brj-23886	11	3	an	an	DET
brj-23886	11	4	analysis	analysis	NOUN
brj-23886	11	5	of	of	ADP
brj-23886	11	6	the	the	DET
brj-23886	11	7	sequencing	sequence	VERB
brj-23886	11	8	data	datum	NOUN
brj-23886	11	9	,	,	PUNCT
brj-23886	11	10	along	along	ADP
brj-23886	11	11	with	with	ADP
brj-23886	11	12	the	the	DET
brj-23886	11	13	results	result	NOUN
brj-23886	11	14	from	from	ADP
brj-23886	11	15	single	single	ADJ
brj-23886	11	16	knockout	knockout	NOUN
brj-23886	11	17	experiments	experiment	NOUN
brj-23886	11	18	,	,	PUNCT
brj-23886	11	19	revealed	reveal	VERB
brj-23886	11	20	that	that	SCONJ
brj-23886	11	21	mutations	mutation	NOUN
brj-23886	11	22	in	in	ADP
brj-23886	11	23	the	the	DET
brj-23886	11	24	genes	gene	NOUN
brj-23886	11	25	encoding	encode	VERB
brj-23886	11	26	methyl	methyl	NOUN
brj-23886	11	27	-	-	PUNCT
brj-23886	11	28	accepting	accept	VERB
brj-23886	11	29	chemotaxis	chemotaxis	ADJ
brj-23886	11	30	proteins	protein	NOUN
brj-23886	11	31	(	(	PUNCT
brj-23886	11	32	mcp	mcp	PROPN
brj-23886	11	33	)	)	PUNCT
brj-23886	11	34	and	and	CCONJ
brj-23886	11	35	type	type	NOUN
brj-23886	11	36	3a	3a	NUM
brj-23886	11	37	cellulose	cellulose	NOUN
brj-23886	11	38	-	-	PUNCT
brj-23886	11	39	binding	bind	VERB
brj-23886	11	40	domain	domain	NOUN
brj-23886	11	41	protein	protein	NOUN
brj-23886	11	42	(	(	PUNCT
brj-23886	11	43	type	type	NOUN
brj-23886	11	44	)	)	PUNCT
brj-23886	11	45	genes	gene	NOUN
brj-23886	11	46	were	be	AUX
brj-23886	11	47	correlated	correlate	VERB
brj-23886	11	48	with	with	ADP
brj-23886	11	49	enhanced	enhanced	ADJ
brj-23886	11	50	ethanol	ethanol	NOUN
brj-23886	11	51	production	production	NOUN
brj-23886	11	52	.	.	PUNCT
brj-23886	12	1	this	this	DET
brj-23886	12	2	study	study	NOUN
brj-23886	12	3	serves	serve	VERB
brj-23886	12	4	as	as	ADP
brj-23886	12	5	a	a	DET
brj-23886	12	6	reference	reference	NOUN
brj-23886	12	7	for	for	ADP
brj-23886	12	8	the	the	DET
brj-23886	12	9	targeted	target	VERB
brj-23886	12	10	modification	modification	NOUN
brj-23886	12	11	of	of	ADP
brj-23886	12	12	c.	c.	PROPN
brj-23886	12	13	thermocellum	thermocellum	PROPN
brj-23886	12	14	to	to	PART
brj-23886	12	15	optimize	optimize	VERB
brj-23886	12	16	ethanol	ethanol	NOUN
brj-23886	12	17	production	production	NOUN
brj-23886	12	18	.	.	PUNCT
brj-23886	13	1	doi	doi	NOUN
brj-23886	13	2	:	:	PUNCT
brj-23886	13	3	10.15376	10.15376	NUM
brj-23886	13	4	/	/	SYM
brj-23886	13	5	biores.20.2.3155	biores.20.2.3155	NOUN
brj-23886	13	6	-	-	PUNCT
brj-23886	13	7	3175	3175	NUM
brj-23886	13	8	keywords	keyword	NOUN
brj-23886	13	9	:	:	PUNCT
brj-23886	13	10	rare	rare	ADJ
brj-23886	13	11	earth	earth	NOUN
brj-23886	13	12	;	;	PUNCT
brj-23886	13	13	neodymium	neodymium	NOUN
brj-23886	13	14	ions	ion	NOUN
brj-23886	13	15	;	;	PUNCT
brj-23886	13	16	clostridium	clostridium	NOUN
brj-23886	13	17	thermocellum	thermocellum	PROPN
brj-23886	13	18	;	;	PUNCT
brj-23886	13	19	ethanol	ethanol	NOUN
brj-23886	13	20	;	;	PUNCT
brj-23886	13	21	genome	genome	NOUN
brj-23886	13	22	;	;	PUNCT
brj-23886	13	23	gene	gene	NOUN
brj-23886	13	24	knockout	knockout	NOUN
brj-23886	13	25	contact	contact	NOUN
brj-23886	13	26	information	information	NOUN
brj-23886	13	27	:	:	PUNCT
brj-23886	13	28	a	a	DET
brj-23886	13	29	:	:	PUNCT
brj-23886	13	30	center	center	NOUN
brj-23886	13	31	for	for	ADP
brj-23886	13	32	energy	energy	NOUN
brj-23886	13	33	conservation	conservation	NOUN
brj-23886	13	34	and	and	CCONJ
brj-23886	13	35	emission	emission	NOUN
brj-23886	13	36	reduction	reduction	NOUN
brj-23886	13	37	in	in	ADP
brj-23886	13	38	fermentation	fermentation	NOUN
brj-23886	13	39	industry	industry	NOUN
brj-23886	13	40	in	in	ADP
brj-23886	13	41	inner	inner	ADJ
brj-23886	13	42	mongolia	mongolia	PROPN
brj-23886	13	43	,	,	PUNCT
brj-23886	13	44	inner	inner	PROPN
brj-23886	13	45	mongolia	mongolia	PROPN
brj-23886	13	46	university	university	PROPN
brj-23886	13	47	of	of	ADP
brj-23886	13	48	technology	technology	NOUN
brj-23886	13	49	,	,	PUNCT
brj-23886	13	50	hohhot	hohhot	ADJ
brj-23886	13	51	,	,	PUNCT
brj-23886	13	52	010051	010051	NUM
brj-23886	13	53	,	,	PUNCT
brj-23886	13	54	inner	inner	PROPN
brj-23886	13	55	mongolia	mongolia	PROPN
brj-23886	13	56	,	,	PUNCT
brj-23886	13	57	china	china	PROPN
brj-23886	13	58	;	;	PUNCT
brj-23886	13	59	b	b	X
brj-23886	13	60	:	:	PUNCT
brj-23886	13	61	engineering	engineering	NOUN
brj-23886	13	62	research	research	NOUN
brj-23886	13	63	center	center	NOUN
brj-23886	13	64	of	of	ADP
brj-23886	13	65	inner	inner	PROPN
brj-23886	13	66	mongolia	mongolia	PROPN
brj-23886	13	67	for	for	ADP
brj-23886	13	68	green	green	ADJ
brj-23886	13	69	manufacturing	manufacturing	NOUN
brj-23886	13	70	in	in	ADP
brj-23886	13	71	bio	bio	ADJ
brj-23886	13	72	-	-	ADJ
brj-23886	13	73	fermentation	fermentation	NOUN
brj-23886	13	74	industry	industry	NOUN
brj-23886	13	75	,	,	PUNCT
brj-23886	13	76	inner	inner	PROPN
brj-23886	13	77	mongolia	mongolia	PROPN
brj-23886	13	78	university	university	PROPN
brj-23886	13	79	of	of	ADP
brj-23886	13	80	technology	technology	NOUN
brj-23886	13	81	,	,	PUNCT
brj-23886	13	82	hohhot	hohhot	ADJ
brj-23886	13	83	,	,	PUNCT
brj-23886	13	84	010051	010051	NUM
brj-23886	13	85	,	,	PUNCT
brj-23886	13	86	inner	inner	PROPN
brj-23886	13	87	mongolia	mongolia	PROPN
brj-23886	13	88	,	,	PUNCT
brj-23886	13	89	china	china	PROPN
brj-23886	13	90	;	;	PUNCT
brj-23886	13	91	c	c	X
brj-23886	13	92	:	:	PUNCT
brj-23886	13	93	specialized	specialized	ADJ
brj-23886	13	94	technology	technology	NOUN
brj-23886	13	95	research	research	NOUN
brj-23886	13	96	and	and	CCONJ
brj-23886	13	97	pilot	pilot	VERB
brj-23886	13	98	public	public	ADJ
brj-23886	13	99	service	service	NOUN
brj-23886	13	100	platform	platform	NOUN
brj-23886	13	101	for	for	ADP
brj-23886	13	102	biological	biological	ADJ
brj-23886	13	103	fermentation	fermentation	NOUN
brj-23886	13	104	in	in	ADP
brj-23886	13	105	inner	inner	ADJ
brj-23886	13	106	mongolia	mongolia	PROPN
brj-23886	13	107	,	,	PUNCT
brj-23886	13	108	hohhot	hohhot	ADJ
brj-23886	13	109	,	,	PUNCT
brj-23886	13	110	010051	010051	NUM
brj-23886	13	111	,	,	PUNCT
brj-23886	13	112	inner	inner	PROPN
brj-23886	13	113	mongolia	mongolia	PROPN
brj-23886	13	114	,	,	PUNCT
brj-23886	13	115	china	china	PROPN
brj-23886	13	116	;	;	PUNCT
brj-23886	13	117	d	d	X
brj-23886	13	118	:	:	PUNCT
brj-23886	13	119	college	college	NOUN
brj-23886	13	120	of	of	ADP
brj-23886	13	121	chemical	chemical	PROPN
brj-23886	13	122	engineering	engineering	NOUN
brj-23886	13	123	,	,	PUNCT
brj-23886	13	124	inner	inner	PROPN
brj-23886	13	125	mongolia	mongolia	PROPN
brj-23886	13	126	university	university	PROPN
brj-23886	13	127	of	of	ADP
brj-23886	13	128	technology	technology	NOUN
brj-23886	13	129	,	,	PUNCT
brj-23886	13	130	hohhot	hohhot	ADJ
brj-23886	13	131	,	,	PUNCT
brj-23886	13	132	010051	010051	NUM
brj-23886	13	133	,	,	PUNCT
brj-23886	13	134	inner	inner	PROPN
brj-23886	13	135	mongolia	mongolia	PROPN
brj-23886	13	136	,	,	PUNCT
brj-23886	13	137	china	china	PROPN
brj-23886	13	138	;	;	PUNCT
brj-23886	13	139	*	*	PUNCT
brj-23886	13	140	corresponding	correspond	VERB
brj-23886	13	141	author	author	NOUN
brj-23886	13	142	:	:	PUNCT
brj-23886	13	143	hgxylzy2008@imut	hgxylzy2008@imut	NOUN
brj-23886	13	144	.	.	PUNCT
brj-23886	14	1	edu.cn	edu.cn	NOUN
brj-23886	14	2	introduction	introduction	NOUN
brj-23886	14	3	since	since	SCONJ
brj-23886	14	4	the	the	DET
brj-23886	14	5	industrial	industrial	ADJ
brj-23886	14	6	revolution	revolution	NOUN
brj-23886	14	7	,	,	PUNCT
brj-23886	14	8	fossil	fossil	ADJ
brj-23886	14	9	fuels	fuel	NOUN
brj-23886	14	10	such	such	ADJ
brj-23886	14	11	as	as	ADP
brj-23886	14	12	coal	coal	NOUN
brj-23886	14	13	and	and	CCONJ
brj-23886	14	14	oil	oil	NOUN
brj-23886	14	15	have	have	AUX
brj-23886	14	16	become	become	VERB
brj-23886	14	17	essential	essential	ADJ
brj-23886	14	18	for	for	ADP
brj-23886	14	19	human	human	ADJ
brj-23886	14	20	production	production	NOUN
brj-23886	14	21	and	and	CCONJ
brj-23886	14	22	life	life	NOUN
brj-23886	14	23	(	(	PUNCT
brj-23886	14	24	hosseini	hosseini	PROPN
brj-23886	14	25	et	et	PROPN
brj-23886	14	26	al	al	PROPN
brj-23886	14	27	.	.	PROPN
brj-23886	14	28	2013	2013	NUM
brj-23886	14	29	)	)	PUNCT
brj-23886	14	30	.	.	PUNCT
brj-23886	15	1	while	while	SCONJ
brj-23886	15	2	the	the	DET
brj-23886	15	3	widespread	widespread	ADJ
brj-23886	15	4	use	use	NOUN
brj-23886	15	5	of	of	ADP
brj-23886	15	6	these	these	DET
brj-23886	15	7	energy	energy	NOUN
brj-23886	15	8	sources	source	NOUN
brj-23886	15	9	has	have	AUX
brj-23886	15	10	greatly	greatly	ADV
brj-23886	15	11	boosted	boost	VERB
brj-23886	15	12	productivity	productivity	NOUN
brj-23886	15	13	,	,	PUNCT
brj-23886	15	14	it	it	PRON
brj-23886	15	15	has	have	AUX
brj-23886	15	16	also	also	ADV
brj-23886	15	17	resulted	result	VERB
brj-23886	15	18	in	in	ADP
brj-23886	15	19	significant	significant	ADJ
brj-23886	15	20	greenhouse	greenhouse	NOUN
brj-23886	15	21	gas	gas	NOUN
brj-23886	15	22	emissions	emission	NOUN
brj-23886	15	23	,	,	PUNCT
brj-23886	15	24	contributing	contribute	VERB
brj-23886	15	25	to	to	ADP
brj-23886	15	26	global	global	ADJ
brj-23886	15	27	warming	warming	NOUN
brj-23886	15	28	(	(	PUNCT
brj-23886	15	29	jayakumar	jayakumar	NOUN
brj-23886	15	30	et	et	PROPN
brj-23886	15	31	al	al	PROPN
brj-23886	15	32	.	.	PROPN
brj-23886	15	33	2023	2023	NUM
brj-23886	15	34	)	)	PUNCT
brj-23886	15	35	.	.	PUNCT
brj-23886	16	1	in	in	ADP
brj-23886	16	2	response	response	NOUN
brj-23886	16	3	to	to	ADP
brj-23886	16	4	these	these	DET
brj-23886	16	5	challenges	challenge	NOUN
brj-23886	16	6	,	,	PUNCT
brj-23886	16	7	many	many	ADJ
brj-23886	16	8	countries	country	NOUN
brj-23886	16	9	are	be	AUX
brj-23886	16	10	now	now	ADV
brj-23886	16	11	exploring	explore	VERB
brj-23886	16	12	biomass	biomass	NOUN
brj-23886	16	13	resources	resource	NOUN
brj-23886	16	14	to	to	PART
brj-23886	16	15	create	create	VERB
brj-23886	16	16	biofuels	biofuel	NOUN
brj-23886	16	17	,	,	PUNCT
brj-23886	16	18	which	which	PRON
brj-23886	16	19	offer	offer	VERB
brj-23886	16	20	a	a	DET
brj-23886	16	21	renewable	renewable	ADJ
brj-23886	16	22	energy	energy	NOUN
brj-23886	16	23	alternative	alternative	NOUN
brj-23886	16	24	that	that	PRON
brj-23886	16	25	can	can	AUX
brj-23886	16	26	greatly	greatly	ADV
brj-23886	16	27	reduce	reduce	VERB
brj-23886	16	28	greenhouse	greenhouse	NOUN
brj-23886	16	29	gas	gas	NOUN
brj-23886	16	30	emissions	emission	NOUN
brj-23886	16	31	and	and	CCONJ
brj-23886	16	32	support	support	VERB
brj-23886	16	33	environmentally	environmentally	ADV
brj-23886	16	34	sustainable	sustainable	ADJ
brj-23886	16	35	development	development	NOUN
brj-23886	16	36	(	(	PUNCT
brj-23886	16	37	qiao	qiao	PROPN
brj-23886	16	38	et	et	PROPN
brj-23886	16	39	al	al	PROPN
brj-23886	16	40	.	.	PROPN
brj-23886	16	41	2022	2022	NUM
brj-23886	16	42	;	;	PUNCT
brj-23886	16	43	https://orcid.org/0000-0002-9662-0209	https://orcid.org/0000-0002-9662-0209	NOUN
brj-23886	16	44	peer	peer	NOUN
brj-23886	16	45	-	-	PUNCT
brj-23886	16	46	reviewed	review	VERB
brj-23886	16	47	article	article	NOUN
brj-23886	16	48	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	16	49	cui	cui	PROPN
brj-23886	16	50	et	et	PROPN
brj-23886	16	51	al	al	PROPN
brj-23886	16	52	.	.	PROPN
brj-23886	17	1	(	(	PUNCT
brj-23886	17	2	2025	2025	NUM
brj-23886	17	3	)	)	PUNCT
brj-23886	17	4	.	.	PUNCT
brj-23886	18	1	“	"	PUNCT
brj-23886	18	2	genome	genome	NOUN
brj-23886	18	3	study	study	NOUN
brj-23886	18	4	of	of	ADP
brj-23886	18	5	c.	c.	PROPN
brj-23886	18	6	thermocellum	thermocellum	PROPN
brj-23886	18	7	,	,	PUNCT
brj-23886	18	8	”	"	PUNCT
brj-23886	18	9	bioresources	bioresource	NOUN
brj-23886	18	10	20(2	20(2	NUM
brj-23886	18	11	)	)	PUNCT
brj-23886	18	12	,	,	PUNCT
brj-23886	18	13	3155	3155	NUM
brj-23886	18	14	-	-	SYM
brj-23886	18	15	3175	3175	NUM
brj-23886	18	16	.	.	PUNCT
brj-23886	19	1	3156	3156	NUM
brj-23886	19	2	nawab	nawab	PROPN
brj-23886	19	3	et	et	PROPN
brj-23886	19	4	al	al	PROPN
brj-23886	19	5	.	.	PROPN
brj-23886	19	6	2024	2024	NUM
brj-23886	19	7	)	)	PUNCT
brj-23886	19	8	.	.	PUNCT
brj-23886	20	1	according	accord	VERB
brj-23886	20	2	to	to	ADP
brj-23886	20	3	the	the	DET
brj-23886	20	4	report	report	NOUN
brj-23886	20	5	by	by	ADP
brj-23886	20	6	the	the	DET
brj-23886	20	7	international	international	ADJ
brj-23886	20	8	energy	energy	NOUN
brj-23886	20	9	agency	agency	PROPN
brj-23886	20	10	(	(	PUNCT
brj-23886	20	11	iea	iea	NOUN
brj-23886	20	12	)	)	PUNCT
brj-23886	20	13	,	,	PUNCT
brj-23886	20	14	biofuels	biofuel	NOUN
brj-23886	20	15	are	be	AUX
brj-23886	20	16	currently	currently	ADV
brj-23886	20	17	a	a	DET
brj-23886	20	18	commercially	commercially	ADV
brj-23886	20	19	produced	produce	VERB
brj-23886	20	20	alternative	alternative	ADJ
brj-23886	20	21	fuel	fuel	NOUN
brj-23886	20	22	compared	compare	VERB
brj-23886	20	23	to	to	ADP
brj-23886	20	24	other	other	ADJ
brj-23886	20	25	alternative	alternative	ADJ
brj-23886	20	26	fuels	fuel	NOUN
brj-23886	20	27	,	,	PUNCT
brj-23886	20	28	with	with	ADP
brj-23886	20	29	the	the	DET
brj-23886	20	30	potential	potential	NOUN
brj-23886	20	31	to	to	PART
brj-23886	20	32	replace	replace	VERB
brj-23886	20	33	10	10	NUM
brj-23886	20	34	%	%	NOUN
brj-23886	20	35	of	of	ADP
brj-23886	20	36	global	global	ADJ
brj-23886	20	37	oil	oil	NOUN
brj-23886	20	38	,	,	PUNCT
brj-23886	20	39	based	base	VERB
brj-23886	20	40	on	on	ADP
brj-23886	20	41	fuel	fuel	NOUN
brj-23886	20	42	performance	performance	NOUN
brj-23886	20	43	,	,	PUNCT
brj-23886	20	44	infrastructure	infrastructure	NOUN
brj-23886	20	45	,	,	PUNCT
brj-23886	20	46	and	and	CCONJ
brj-23886	20	47	other	other	ADJ
brj-23886	20	48	factors	factor	NOUN
brj-23886	20	49	.	.	PUNCT
brj-23886	21	1	biofuel	biofuel	NOUN
brj-23886	21	2	represents	represent	VERB
brj-23886	21	3	a	a	DET
brj-23886	21	4	viable	viable	ADJ
brj-23886	21	5	alternative	alternative	ADJ
brj-23886	21	6	fuel	fuel	NOUN
brj-23886	21	7	that	that	PRON
brj-23886	21	8	fulfills	fulfill	VERB
brj-23886	21	9	the	the	DET
brj-23886	21	10	criteria	criterion	NOUN
brj-23886	21	11	of	of	ADP
brj-23886	21	12	being	be	AUX
brj-23886	21	13	renewable	renewable	ADJ
brj-23886	21	14	,	,	PUNCT
brj-23886	21	15	environmentally	environmentally	ADV
brj-23886	21	16	friendly	friendly	ADJ
brj-23886	21	17	,	,	PUNCT
brj-23886	21	18	and	and	CCONJ
brj-23886	21	19	capable	capable	ADJ
brj-23886	21	20	of	of	ADP
brj-23886	21	21	large	large	ADJ
brj-23886	21	22	-	-	PUNCT
brj-23886	21	23	scale	scale	NOUN
brj-23886	21	24	production	production	NOUN
brj-23886	21	25	.	.	PUNCT
brj-23886	22	1	cellulosic	cellulosic	NOUN
brj-23886	22	2	ethanol	ethanol	NOUN
brj-23886	22	3	,	,	PUNCT
brj-23886	22	4	as	as	ADP
brj-23886	22	5	a	a	DET
brj-23886	22	6	typical	typical	ADJ
brj-23886	22	7	biofuel	biofuel	NOUN
brj-23886	22	8	,	,	PUNCT
brj-23886	22	9	is	be	AUX
brj-23886	22	10	fermented	ferment	VERB
brj-23886	22	11	and	and	CCONJ
brj-23886	22	12	converted	convert	VERB
brj-23886	22	13	from	from	ADP
brj-23886	22	14	fibrous	fibrous	ADJ
brj-23886	22	15	materials	material	NOUN
brj-23886	22	16	such	such	ADJ
brj-23886	22	17	as	as	ADP
brj-23886	22	18	straw	straw	NOUN
brj-23886	22	19	,	,	PUNCT
brj-23886	22	20	hulls	hull	NOUN
brj-23886	22	21	,	,	PUNCT
brj-23886	22	22	skins	skin	NOUN
brj-23886	22	23	and	and	CCONJ
brj-23886	22	24	stalks	stalk	NOUN
brj-23886	22	25	of	of	ADP
brj-23886	22	26	crops	crop	NOUN
brj-23886	22	27	,	,	PUNCT
brj-23886	22	28	residues	residue	NOUN
brj-23886	22	29	from	from	ADP
brj-23886	22	30	wood	wood	NOUN
brj-23886	22	31	processing	processing	NOUN
brj-23886	22	32	,	,	PUNCT
brj-23886	22	33	and	and	CCONJ
brj-23886	22	34	organic	organic	ADJ
brj-23886	22	35	wastes	waste	NOUN
brj-23886	22	36	from	from	ADP
brj-23886	22	37	cities	city	NOUN
brj-23886	22	38	and	and	CCONJ
brj-23886	22	39	villages	village	NOUN
brj-23886	22	40	(	(	PUNCT
brj-23886	22	41	myat	myat	INTJ
brj-23886	22	42	et	et	PROPN
brj-23886	22	43	al	al	PROPN
brj-23886	22	44	.	.	PROPN
brj-23886	22	45	2015	2015	NUM
brj-23886	22	46	;	;	PUNCT
brj-23886	22	47	guo	guo	PROPN
brj-23886	22	48	et	et	PROPN
brj-23886	22	49	al	al	PROPN
brj-23886	22	50	.	.	PROPN
brj-23886	22	51	2022	2022	NUM
brj-23886	22	52	)	)	PUNCT
brj-23886	22	53	.	.	PUNCT
brj-23886	23	1	cellulosic	cellulosic	NOUN
brj-23886	23	2	ethanol	ethanol	NOUN
brj-23886	23	3	has	have	VERB
brj-23886	23	4	many	many	ADJ
brj-23886	23	5	advantages	advantage	NOUN
brj-23886	23	6	,	,	PUNCT
brj-23886	23	7	such	such	ADJ
brj-23886	23	8	as	as	ADP
brj-23886	23	9	non	non	ADJ
brj-23886	23	10	-	-	NOUN
brj-23886	23	11	pollution	pollution	ADJ
brj-23886	23	12	,	,	PUNCT
brj-23886	23	13	short	short	ADJ
brj-23886	23	14	regeneration	regeneration	NOUN
brj-23886	23	15	period	period	NOUN
brj-23886	23	16	,	,	PUNCT
brj-23886	23	17	and	and	CCONJ
brj-23886	23	18	no	no	DET
brj-23886	23	19	increase	increase	NOUN
brj-23886	23	20	in	in	ADP
brj-23886	23	21	the	the	DET
brj-23886	23	22	total	total	ADJ
brj-23886	23	23	amount	amount	NOUN
brj-23886	23	24	of	of	ADP
brj-23886	23	25	greenhouse	greenhouse	NOUN
brj-23886	23	26	gases	gas	NOUN
brj-23886	23	27	(	(	PUNCT
brj-23886	23	28	lovett	lovett	PROPN
brj-23886	23	29	et	et	PROPN
brj-23886	23	30	al	al	PROPN
brj-23886	23	31	.	.	PROPN
brj-23886	23	32	2011	2011	NUM
brj-23886	23	33	)	)	PUNCT
brj-23886	23	34	.	.	PUNCT
brj-23886	24	1	the	the	DET
brj-23886	24	2	utilization	utilization	NOUN
brj-23886	24	3	of	of	ADP
brj-23886	24	4	lignocellulosic	lignocellulosic	ADJ
brj-23886	24	5	feedstock	feedstock	NOUN
brj-23886	24	6	for	for	ADP
brj-23886	24	7	ethanol	ethanol	NOUN
brj-23886	24	8	production	production	NOUN
brj-23886	24	9	can	can	AUX
brj-23886	24	10	mitigate	mitigate	VERB
brj-23886	24	11	the	the	DET
brj-23886	24	12	reliance	reliance	NOUN
brj-23886	24	13	on	on	ADP
brj-23886	24	14	food	food	NOUN
brj-23886	24	15	sources	source	NOUN
brj-23886	24	16	for	for	ADP
brj-23886	24	17	ethanol	ethanol	NOUN
brj-23886	24	18	,	,	PUNCT
brj-23886	24	19	thereby	thereby	ADV
brj-23886	24	20	reducing	reduce	VERB
brj-23886	24	21	competition	competition	NOUN
brj-23886	24	22	for	for	ADP
brj-23886	24	23	food	food	NOUN
brj-23886	24	24	resources	resource	NOUN
brj-23886	24	25	among	among	ADP
brj-23886	24	26	populations	population	NOUN
brj-23886	24	27	.	.	PUNCT
brj-23886	25	1	this	this	DET
brj-23886	25	2	approach	approach	NOUN
brj-23886	25	3	not	not	PART
brj-23886	25	4	only	only	ADV
brj-23886	25	5	has	have	VERB
brj-23886	25	6	beneficial	beneficial	ADJ
brj-23886	25	7	implications	implication	NOUN
brj-23886	25	8	for	for	ADP
brj-23886	25	9	environmental	environmental	ADJ
brj-23886	25	10	sustainability	sustainability	NOUN
brj-23886	25	11	,	,	PUNCT
brj-23886	25	12	but	but	CCONJ
brj-23886	25	13	it	it	PRON
brj-23886	25	14	also	also	ADV
brj-23886	25	15	contributes	contribute	VERB
brj-23886	25	16	positively	positively	ADV
brj-23886	25	17	to	to	ADP
brj-23886	25	18	the	the	DET
brj-23886	25	19	overall	overall	ADJ
brj-23886	25	20	sustainable	sustainable	ADJ
brj-23886	25	21	development	development	NOUN
brj-23886	25	22	of	of	ADP
brj-23886	25	23	society	society	NOUN
brj-23886	25	24	(	(	PUNCT
brj-23886	25	25	reijnders	reijnder	NOUN
brj-23886	25	26	et	et	PROPN
brj-23886	25	27	al	al	PROPN
brj-23886	25	28	.	.	PROPN
brj-23886	25	29	2007	2007	NUM
brj-23886	25	30	)	)	PUNCT
brj-23886	25	31	.	.	PUNCT
brj-23886	26	1	for	for	ADP
brj-23886	26	2	example	example	NOUN
brj-23886	26	3	,	,	PUNCT
brj-23886	26	4	yu	yu	PROPN
brj-23886	26	5	et	et	PROPN
brj-23886	26	6	al	al	PROPN
brj-23886	26	7	.	.	PROPN
brj-23886	27	1	(	(	PUNCT
brj-23886	27	2	2014	2014	NUM
brj-23886	27	3	)	)	PUNCT
brj-23886	27	4	obtained	obtain	VERB
brj-23886	27	5	a	a	DET
brj-23886	27	6	theoretical	theoretical	ADJ
brj-23886	27	7	ethanol	ethanol	NOUN
brj-23886	27	8	yield	yield	NOUN
brj-23886	27	9	of	of	ADP
brj-23886	27	10	69.5	69.5	NUM
brj-23886	27	11	%	%	NOUN
brj-23886	27	12	under	under	ADP
brj-23886	27	13	optimal	optimal	ADJ
brj-23886	27	14	conditions	condition	NOUN
brj-23886	27	15	using	use	VERB
brj-23886	27	16	sweet	sweet	ADJ
brj-23886	27	17	sorghum	sorghum	NOUN
brj-23886	27	18	bagasse	bagasse	NOUN
brj-23886	27	19	as	as	ADP
brj-23886	27	20	fermentation	fermentation	NOUN
brj-23886	27	21	substrate	substrate	NOUN
brj-23886	27	22	.	.	PUNCT
brj-23886	28	1	zheng	zheng	PROPN
brj-23886	28	2	et	et	PROPN
brj-23886	28	3	al	al	PROPN
brj-23886	28	4	.	.	PROPN
brj-23886	28	5	(	(	PUNCT
brj-23886	28	6	2021	2021	NUM
brj-23886	28	7	)	)	PUNCT
brj-23886	28	8	produced	produce	VERB
brj-23886	28	9	cellulosic	cellulosic	NOUN
brj-23886	28	10	ethanol	ethanol	NOUN
brj-23886	28	11	from	from	ADP
brj-23886	28	12	sugarcane	sugarcane	NOUN
brj-23886	28	13	bagasse	bagasse	NOUN
brj-23886	28	14	(	(	PUNCT
brj-23886	28	15	scb	scb	PROPN
brj-23886	28	16	)	)	PUNCT
brj-23886	28	17	with	with	ADP
brj-23886	28	18	an	an	DET
brj-23886	28	19	ethanol	ethanol	NOUN
brj-23886	28	20	yield	yield	NOUN
brj-23886	28	21	of	of	ADP
brj-23886	28	22	257	257	NUM
brj-23886	28	23	±	±	NUM
brj-23886	28	24	5.51	5.51	NUM
brj-23886	28	25	mg	mg	PROPN
brj-23886	28	26	/	/	SYM
brj-23886	28	27	g	g	PROPN
brj-23886	28	28	scb	scb	PROPN
brj-23886	28	29	,	,	PUNCT
brj-23886	28	30	which	which	PRON
brj-23886	28	31	was	be	AUX
brj-23886	28	32	produced	produce	VERB
brj-23886	28	33	at	at	ADP
brj-23886	28	34	low	low	ADJ
brj-23886	28	35	cost	cost	NOUN
brj-23886	28	36	and	and	CCONJ
brj-23886	28	37	with	with	ADP
brj-23886	28	38	high	high	ADJ
brj-23886	28	39	energy	energy	NOUN
brj-23886	28	40	efficiency	efficiency	NOUN
brj-23886	28	41	.	.	PUNCT
brj-23886	29	1	the	the	DET
brj-23886	29	2	thermoanaerobacterales	thermoanaerobacterale	NOUN
brj-23886	29	3	,	,	PUNCT
brj-23886	29	4	which	which	PRON
brj-23886	29	5	exhibit	exhibit	VERB
brj-23886	29	6	a	a	DET
brj-23886	29	7	notable	notable	ADJ
brj-23886	29	8	capacity	capacity	NOUN
brj-23886	29	9	for	for	ADP
brj-23886	29	10	ethanol	ethanol	NOUN
brj-23886	29	11	production	production	NOUN
brj-23886	29	12	,	,	PUNCT
brj-23886	29	13	encompass	encompass	VERB
brj-23886	29	14	genera	genera	NOUN
brj-23886	29	15	such	such	ADJ
brj-23886	29	16	as	as	ADP
brj-23886	29	17	geobacinus	geobacinus	PROPN
brj-23886	29	18	,	,	PUNCT
brj-23886	29	19	thermoanaerobacter	thermoanaerobacter	NOUN
brj-23886	29	20	,	,	PUNCT
brj-23886	29	21	and	and	CCONJ
brj-23886	29	22	clostridium	clostridium	NOUN
brj-23886	29	23	.	.	PUNCT
brj-23886	30	1	for	for	ADP
brj-23886	30	2	instance	instance	NOUN
brj-23886	30	3	,	,	PUNCT
brj-23886	30	4	research	research	NOUN
brj-23886	30	5	have	have	AUX
brj-23886	30	6	used	use	VERB
brj-23886	30	7	thermoanaerobacterium	thermoanaerobacterium	ADJ
brj-23886	30	8	aotearoense	aotearoense	NOUN
brj-23886	30	9	(	(	PUNCT
brj-23886	30	10	fu	fu	NOUN
brj-23886	30	11	et	et	PROPN
brj-23886	30	12	al	al	PROPN
brj-23886	30	13	.	.	PROPN
brj-23886	30	14	2019	2019	NUM
brj-23886	30	15	)	)	PUNCT
brj-23886	30	16	or	or	CCONJ
brj-23886	30	17	thermoanaerobacterium	thermoanaerobacterium	PROPN
brj-23886	30	18	saccharolyticum	saccharolyticum	NOUN
brj-23886	30	19	(	(	PUNCT
brj-23886	30	20	desai	desai	PROPN
brj-23886	30	21	et	et	PROPN
brj-23886	30	22	al	al	PROPN
brj-23886	30	23	.	.	PROPN
brj-23886	30	24	2004	2004	NUM
brj-23886	30	25	)	)	PUNCT
brj-23886	30	26	for	for	SCONJ
brj-23886	30	27	fermentation	fermentation	NOUN
brj-23886	30	28	to	to	PART
brj-23886	30	29	produce	produce	VERB
brj-23886	30	30	ethanol	ethanol	NOUN
brj-23886	30	31	and	and	CCONJ
brj-23886	30	32	improved	improve	VERB
brj-23886	30	33	yields	yield	NOUN
brj-23886	30	34	through	through	ADP
brj-23886	30	35	genetic	genetic	ADJ
brj-23886	30	36	engineering	engineering	NOUN
brj-23886	30	37	techniques	technique	NOUN
brj-23886	30	38	.	.	PUNCT
brj-23886	31	1	clostridium	clostridium	NOUN
brj-23886	31	2	thermocellum	thermocellum	PROPN
brj-23886	31	3	(	(	PUNCT
brj-23886	31	4	c.	c.	PROPN
brj-23886	31	5	thermocellum	thermocellum	PROPN
brj-23886	31	6	)	)	PUNCT
brj-23886	31	7	is	be	AUX
brj-23886	31	8	one	one	NUM
brj-23886	31	9	of	of	ADP
brj-23886	31	10	the	the	DET
brj-23886	31	11	few	few	ADJ
brj-23886	31	12	microorganisms	microorganism	NOUN
brj-23886	31	13	that	that	PRON
brj-23886	31	14	can	can	AUX
brj-23886	31	15	directly	directly	ADV
brj-23886	31	16	use	use	VERB
brj-23886	31	17	cellulose	cellulose	NOUN
brj-23886	31	18	fermentation	fermentation	NOUN
brj-23886	31	19	to	to	PART
brj-23886	31	20	produce	produce	VERB
brj-23886	31	21	ethanol	ethanol	NOUN
brj-23886	31	22	in	in	ADP
brj-23886	31	23	the	the	DET
brj-23886	31	24	natural	natural	ADJ
brj-23886	31	25	environment	environment	NOUN
brj-23886	31	26	as	as	ADP
brj-23886	31	27	the	the	DET
brj-23886	31	28	second	second	ADJ
brj-23886	31	29	generation	generation	NOUN
brj-23886	31	30	biofuel	biofuel	NOUN
brj-23886	31	31	with	with	ADP
brj-23886	31	32	its	its	PRON
brj-23886	31	33	unique	unique	ADJ
brj-23886	31	34	advantages	advantage	NOUN
brj-23886	31	35	as	as	ADP
brj-23886	31	36	a	a	DET
brj-23886	31	37	sustainable	sustainable	ADJ
brj-23886	31	38	energy	energy	NOUN
brj-23886	31	39	source	source	NOUN
brj-23886	31	40	(	(	PUNCT
brj-23886	31	41	chang	chang	PROPN
brj-23886	31	42	et	et	PROPN
brj-23886	31	43	al	al	PROPN
brj-23886	31	44	.	.	PROPN
brj-23886	31	45	2013	2013	NUM
brj-23886	31	46	;	;	PUNCT
brj-23886	31	47	qiao	qiao	PROPN
brj-23886	31	48	et	et	PROPN
brj-23886	31	49	al	al	PROPN
brj-23886	31	50	.	.	PROPN
brj-23886	31	51	2022	2022	NUM
brj-23886	31	52	)	)	PUNCT
brj-23886	31	53	.	.	PUNCT
brj-23886	32	1	the	the	DET
brj-23886	32	2	c.	c.	PROPN
brj-23886	32	3	thermocellum	thermocellum	PROPN
brj-23886	32	4	,	,	PUNCT
brj-23886	32	5	a	a	DET
brj-23886	32	6	thermophilic	thermophilic	ADJ
brj-23886	32	7	,	,	PUNCT
brj-23886	32	8	strictly	strictly	ADV
brj-23886	32	9	anaerobic	anaerobic	VERB
brj-23886	32	10	gram	gram	NOUN
brj-23886	32	11	-	-	PUNCT
brj-23886	32	12	positive	positive	ADJ
brj-23886	32	13	bacterium	bacterium	NOUN
brj-23886	32	14	,	,	PUNCT
brj-23886	32	15	is	be	AUX
brj-23886	32	16	one	one	NUM
brj-23886	32	17	of	of	ADP
brj-23886	32	18	the	the	DET
brj-23886	32	19	most	most	ADV
brj-23886	32	20	efficient	efficient	ADJ
brj-23886	32	21	cellulose	cellulose	NOUN
brj-23886	32	22	-	-	PUNCT
brj-23886	32	23	degrading	degrade	VERB
brj-23886	32	24	bacteria	bacteria	NOUN
brj-23886	32	25	available	available	ADJ
brj-23886	32	26	.	.	PUNCT
brj-23886	33	1	it	it	PRON
brj-23886	33	2	metabolizes	metabolize	VERB
brj-23886	33	3	natural	natural	ADJ
brj-23886	33	4	products	product	NOUN
brj-23886	33	5	including	include	VERB
brj-23886	33	6	ethanol	ethanol	NOUN
brj-23886	33	7	,	,	PUNCT
brj-23886	33	8	acetic	acetic	ADJ
brj-23886	33	9	acid	acid	NOUN
brj-23886	33	10	,	,	PUNCT
brj-23886	33	11	lactic	lactic	ADJ
brj-23886	33	12	acid	acid	NOUN
brj-23886	33	13	,	,	PUNCT
brj-23886	33	14	formic	formic	ADJ
brj-23886	33	15	acid	acid	NOUN
brj-23886	33	16	,	,	PUNCT
brj-23886	33	17	and	and	CCONJ
brj-23886	33	18	hydrogen	hydrogen	NOUN
brj-23886	33	19	(	(	PUNCT
brj-23886	33	20	mazzoli	mazzoli	NOUN
brj-23886	33	21	et	et	PROPN
brj-23886	33	22	al	al	PROPN
brj-23886	33	23	.	.	PROPN
brj-23886	33	24	2014	2014	NUM
brj-23886	33	25	;	;	PUNCT
brj-23886	33	26	liu	liu	PROPN
brj-23886	33	27	et	et	PROPN
brj-23886	33	28	al	al	PROPN
brj-23886	33	29	.	.	PROPN
brj-23886	33	30	2020	2020	NUM
brj-23886	33	31	;	;	PUNCT
brj-23886	33	32	xiao	xiao	PROPN
brj-23886	33	33	et	et	PROPN
brj-23886	33	34	al	al	PROPN
brj-23886	33	35	.	.	PROPN
brj-23886	33	36	2023	2023	NUM
brj-23886	33	37	)	)	PUNCT
brj-23886	33	38	.	.	PUNCT
brj-23886	34	1	c.	c.	PROPN
brj-23886	34	2	thermocellum	thermocellum	PROPN
brj-23886	34	3	is	be	AUX
brj-23886	34	4	able	able	ADJ
brj-23886	34	5	to	to	PART
brj-23886	34	6	produce	produce	VERB
brj-23886	34	7	decomposable	decomposable	ADJ
brj-23886	34	8	cellulosic	cellulosic	NOUN
brj-23886	34	9	material	material	NOUN
brj-23886	34	10	(	(	PUNCT
brj-23886	34	11	fibrous	fibrous	ADJ
brj-23886	34	12	vesicles	vesicle	NOUN
brj-23886	34	13	)	)	PUNCT
brj-23886	34	14	due	due	ADP
brj-23886	34	15	to	to	ADP
brj-23886	34	16	its	its	PRON
brj-23886	34	17	own	own	ADJ
brj-23886	34	18	properties	property	NOUN
brj-23886	34	19	,	,	PUNCT
brj-23886	34	20	which	which	PRON
brj-23886	34	21	contain	contain	VERB
brj-23886	34	22	a	a	DET
brj-23886	34	23	variety	variety	NOUN
brj-23886	34	24	of	of	ADP
brj-23886	34	25	hydrolytic	hydrolytic	ADJ
brj-23886	34	26	enzymes	enzyme	NOUN
brj-23886	34	27	,	,	PUNCT
brj-23886	34	28	glycosidases	glycosidase	NOUN
brj-23886	34	29	,	,	PUNCT
brj-23886	34	30	lichen	lichen	NOUN
brj-23886	34	31	polysaccharidases	polysaccharidase	NOUN
brj-23886	34	32	,	,	PUNCT
brj-23886	34	33	hemicellulases	hemicellulase	NOUN
brj-23886	34	34	,	,	PUNCT
brj-23886	34	35	and	and	CCONJ
brj-23886	34	36	so	so	ADV
brj-23886	34	37	on	on	ADV
brj-23886	34	38	(	(	PUNCT
brj-23886	34	39	bayer	bayer	PROPN
brj-23886	34	40	et	et	PROPN
brj-23886	34	41	al	al	PROPN
brj-23886	34	42	.	.	PROPN
brj-23886	34	43	2004	2004	NUM
brj-23886	34	44	;	;	PUNCT
brj-23886	34	45	levin	levin	PROPN
brj-23886	34	46	et	et	PROPN
brj-23886	34	47	al	al	PROPN
brj-23886	34	48	.	.	PROPN
brj-23886	34	49	2006	2006	NUM
brj-23886	34	50	;	;	PUNCT
brj-23886	34	51	zhang	zhang	PROPN
brj-23886	34	52	et	et	PROPN
brj-23886	34	53	al	al	PROPN
brj-23886	34	54	.	.	PROPN
brj-23886	34	55	2017	2017	NUM
brj-23886	34	56	;	;	PUNCT
brj-23886	34	57	jiang	jiang	PROPN
brj-23886	34	58	et	et	PROPN
brj-23886	34	59	al	al	PROPN
brj-23886	34	60	.	.	PROPN
brj-23886	34	61	2021	2021	NUM
brj-23886	34	62	)	)	PUNCT
brj-23886	34	63	.	.	PUNCT
brj-23886	35	1	however	however	ADV
brj-23886	35	2	,	,	PUNCT
brj-23886	35	3	the	the	DET
brj-23886	35	4	low	low	ADJ
brj-23886	35	5	yield	yield	NOUN
brj-23886	35	6	and	and	CCONJ
brj-23886	35	7	low	low	ADJ
brj-23886	35	8	feedstock	feedstock	NOUN
brj-23886	35	9	utilization	utilization	NOUN
brj-23886	35	10	of	of	ADP
brj-23886	35	11	c.	c.	PROPN
brj-23886	35	12	thermocellum	thermocellum	PROPN
brj-23886	35	13	for	for	ADP
brj-23886	35	14	cellulosic	cellulosic	NOUN
brj-23886	35	15	ethanol	ethanol	NOUN
brj-23886	35	16	has	have	AUX
brj-23886	35	17	limited	limit	VERB
brj-23886	35	18	its	its	PRON
brj-23886	35	19	further	further	ADJ
brj-23886	35	20	industrial	industrial	ADJ
brj-23886	35	21	application	application	NOUN
brj-23886	35	22	.	.	PUNCT
brj-23886	36	1	currently	currently	ADV
brj-23886	36	2	,	,	PUNCT
brj-23886	36	3	pretreatment	pretreatment	NOUN
brj-23886	36	4	processes	process	NOUN
brj-23886	36	5	have	have	VERB
brj-23886	36	6	the	the	DET
brj-23886	36	7	capacity	capacity	NOUN
brj-23886	36	8	to	to	PART
brj-23886	36	9	alter	alter	VERB
brj-23886	36	10	the	the	DET
brj-23886	36	11	intricate	intricate	ADJ
brj-23886	36	12	structure	structure	NOUN
brj-23886	36	13	of	of	ADP
brj-23886	36	14	cellulose	cellulose	NOUN
brj-23886	36	15	,	,	PUNCT
brj-23886	36	16	thereby	thereby	ADV
brj-23886	36	17	enhancing	enhance	VERB
brj-23886	36	18	the	the	DET
brj-23886	36	19	efficiency	efficiency	NOUN
brj-23886	36	20	of	of	ADP
brj-23886	36	21	raw	raw	ADJ
brj-23886	36	22	material	material	NOUN
brj-23886	36	23	utilization	utilization	NOUN
brj-23886	36	24	.	.	PUNCT
brj-23886	37	1	various	various	ADJ
brj-23886	37	2	pretreatment	pretreatment	NOUN
brj-23886	37	3	techniques	technique	NOUN
brj-23886	37	4	have	have	AUX
brj-23886	37	5	been	be	AUX
brj-23886	37	6	identified	identify	VERB
brj-23886	37	7	,	,	PUNCT
brj-23886	37	8	including	include	VERB
brj-23886	37	9	mechanical	mechanical	ADJ
brj-23886	37	10	grinding	grinding	NOUN
brj-23886	37	11	(	(	PUNCT
brj-23886	37	12	zeng	zeng	PROPN
brj-23886	37	13	et	et	PROPN
brj-23886	37	14	al	al	PROPN
brj-23886	37	15	.	.	PROPN
brj-23886	37	16	2010	2010	NUM
brj-23886	37	17	)	)	PUNCT
brj-23886	37	18	,	,	PUNCT
brj-23886	37	19	ultrasonics	ultrasonic	NOUN
brj-23886	37	20	(	(	PUNCT
brj-23886	37	21	liyakathali	liyakathali	VERB
brj-23886	37	22	et	et	PROPN
brj-23886	37	23	al	al	PROPN
brj-23886	37	24	.	.	PROPN
brj-23886	37	25	2016	2016	NUM
brj-23886	37	26	)	)	PUNCT
brj-23886	37	27	,	,	PUNCT
brj-23886	37	28	and	and	CCONJ
brj-23886	37	29	acid	acid	NOUN
brj-23886	37	30	or	or	CCONJ
brj-23886	37	31	alkaline	alkaline	NOUN
brj-23886	37	32	hydrolysis	hydrolysis	NOUN
brj-23886	37	33	(	(	PUNCT
brj-23886	37	34	sindhu	sindhu	PROPN
brj-23886	37	35	et	et	PROPN
brj-23886	37	36	al	al	PROPN
brj-23886	37	37	.	.	PROPN
brj-23886	37	38	2014	2014	NUM
brj-23886	37	39	;	;	PUNCT
brj-23886	37	40	nur	nur	VERB
brj-23886	37	41	aimi	aimi	PROPN
brj-23886	37	42	et	et	PROPN
brj-23886	37	43	al	al	PROPN
brj-23886	37	44	.	.	PROPN
brj-23886	37	45	2015	2015	NUM
brj-23886	37	46	)	)	PUNCT
brj-23886	37	47	.	.	PUNCT
brj-23886	38	1	fermentation	fermentation	NOUN
brj-23886	38	2	using	use	VERB
brj-23886	38	3	treated	treat	VERB
brj-23886	38	4	feedstocks	feedstock	NOUN
brj-23886	38	5	can	can	AUX
brj-23886	38	6	improve	improve	VERB
brj-23886	38	7	utilization	utilization	NOUN
brj-23886	38	8	and	and	CCONJ
brj-23886	38	9	yield	yield	NOUN
brj-23886	38	10	.	.	PUNCT
brj-23886	39	1	to	to	PART
brj-23886	39	2	further	far	ADV
brj-23886	39	3	improve	improve	VERB
brj-23886	39	4	ethanol	ethanol	NOUN
brj-23886	39	5	production	production	NOUN
brj-23886	39	6	,	,	PUNCT
brj-23886	39	7	researchers	researcher	NOUN
brj-23886	39	8	have	have	AUX
brj-23886	39	9	conducted	conduct	VERB
brj-23886	39	10	studies	study	NOUN
brj-23886	39	11	related	relate	VERB
brj-23886	39	12	to	to	ADP
brj-23886	39	13	the	the	DET
brj-23886	39	14	conversion	conversion	NOUN
brj-23886	39	15	of	of	ADP
brj-23886	39	16	lignocellulose	lignocellulose	NOUN
brj-23886	39	17	to	to	ADP
brj-23886	39	18	ethanol	ethanol	NOUN
brj-23886	39	19	by	by	ADP
brj-23886	39	20	c.	c.	PROPN
brj-23886	39	21	thermocellum	thermocellum	PROPN
brj-23886	39	22	in	in	ADP
brj-23886	39	23	terms	term	NOUN
brj-23886	39	24	of	of	ADP
brj-23886	39	25	metabolic	metabolic	NOUN
brj-23886	39	26	pathways	pathway	NOUN
brj-23886	39	27	,	,	PUNCT
brj-23886	39	28	cellulose	cellulose	NOUN
brj-23886	39	29	degradation	degradation	NOUN
brj-23886	39	30	mechanisms	mechanism	NOUN
brj-23886	39	31	,	,	PUNCT
brj-23886	39	32	and	and	CCONJ
brj-23886	39	33	ethanol	ethanol	NOUN
brj-23886	39	34	fermentation	fermentation	NOUN
brj-23886	39	35	.	.	PUNCT
brj-23886	40	1	biswas	biswas	PROPN
brj-23886	40	2	et	et	PROPN
brj-23886	40	3	al	al	PROPN
brj-23886	40	4	.	.	PROPN
brj-23886	41	1	(	(	PUNCT
brj-23886	41	2	2015	2015	NUM
brj-23886	41	3	)	)	PUNCT
brj-23886	41	4	obtained	obtain	VERB
brj-23886	41	5	a	a	DET
brj-23886	41	6	mutant	mutant	ADJ
brj-23886	41	7	strain	strain	NOUN
brj-23886	41	8	of	of	ADP
brj-23886	41	9	c.	c.	PROPN
brj-23886	41	10	thermocellum	thermocellum	PROPN
brj-23886	41	11	that	that	PRON
brj-23886	41	12	was	be	AUX
brj-23886	41	13	functionally	functionally	ADV
brj-23886	41	14	deficient	deficient	ADJ
brj-23886	41	15	in	in	ADP
brj-23886	41	16	all	all	DET
brj-23886	41	17	hydrogenases	hydrogenase	NOUN
brj-23886	41	18	by	by	ADP
brj-23886	41	19	gene	gene	NOUN
brj-23886	41	20	knockout	knockout	NOUN
brj-23886	41	21	,	,	PUNCT
brj-23886	41	22	resulting	result	VERB
brj-23886	41	23	in	in	ADP
brj-23886	41	24	64	64	NUM
brj-23886	41	25	%	%	NOUN
brj-23886	41	26	of	of	ADP
brj-23886	41	27	the	the	DET
brj-23886	41	28	maximum	maximum	ADJ
brj-23886	41	29	theoretical	theoretical	ADJ
brj-23886	41	30	yield	yield	NOUN
brj-23886	41	31	of	of	ADP
brj-23886	41	32	ethanol	ethanol	NOUN
brj-23886	41	33	.	.	PUNCT
brj-23886	42	1	kannuchamy	kannuchamy	PROPN
brj-23886	42	2	et	et	PROPN
brj-23886	42	3	al	al	PROPN
brj-23886	42	4	.	.	PROPN
brj-23886	43	1	(	(	PUNCT
brj-23886	43	2	2016	2016	NUM
brj-23886	43	3	)	)	PUNCT
brj-23886	43	4	transformed	transform	VERB
brj-23886	43	5	pyruvate	pyruvate	NOUN
brj-23886	43	6	decarboxylate	decarboxylate	NOUN
brj-23886	43	7	(	(	PUNCT
brj-23886	43	8	pdc	pdc	PROPN
brj-23886	43	9	)	)	PUNCT
brj-23886	43	10	and	and	CCONJ
brj-23886	43	11	alcohol	alcohol	NOUN
brj-23886	43	12	dehydrogenase	dehydrogenase	NOUN
brj-23886	43	13	(	(	PUNCT
brj-23886	43	14	adh	adh	PROPN
brj-23886	43	15	)	)	PUNCT
brj-23886	43	16	peer	peer	NOUN
brj-23886	43	17	-	-	PUNCT
brj-23886	43	18	reviewed	review	VERB
brj-23886	43	19	article	article	NOUN
brj-23886	43	20	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	43	21	cui	cui	PROPN
brj-23886	43	22	et	et	PROPN
brj-23886	43	23	al	al	PROPN
brj-23886	43	24	.	.	PROPN
brj-23886	44	1	(	(	PUNCT
brj-23886	44	2	2025	2025	NUM
brj-23886	44	3	)	)	PUNCT
brj-23886	44	4	.	.	PUNCT
brj-23886	45	1	“	"	PUNCT
brj-23886	45	2	genome	genome	NOUN
brj-23886	45	3	study	study	NOUN
brj-23886	45	4	of	of	ADP
brj-23886	45	5	c.	c.	PROPN
brj-23886	45	6	thermocellum	thermocellum	PROPN
brj-23886	45	7	,	,	PUNCT
brj-23886	45	8	”	"	PUNCT
brj-23886	45	9	bioresources	bioresource	NOUN
brj-23886	45	10	20(2	20(2	NUM
brj-23886	45	11	)	)	PUNCT
brj-23886	45	12	,	,	PUNCT
brj-23886	45	13	3155	3155	NUM
brj-23886	45	14	-	-	SYM
brj-23886	45	15	3175	3175	NUM
brj-23886	45	16	.	.	PUNCT
brj-23886	46	1	3157	3157	NUM
brj-23886	46	2	genes	gene	NOUN
brj-23886	46	3	from	from	ADP
brj-23886	46	4	zymomonas	zymomonas	PROPN
brj-23886	46	5	mobilis	mobili	NOUN
brj-23886	46	6	into	into	ADP
brj-23886	46	7	c.	c.	PROPN
brj-23886	46	8	thermocellum	thermocellum	PROPN
brj-23886	46	9	,	,	PUNCT
brj-23886	46	10	which	which	PRON
brj-23886	46	11	resulted	result	VERB
brj-23886	46	12	in	in	ADP
brj-23886	46	13	a	a	DET
brj-23886	46	14	twofold	twofold	NOUN
brj-23886	46	15	increased	increase	VERB
brj-23886	46	16	pyruvate	pyruvate	NOUN
brj-23886	46	17	decarboxylase	decarboxylase	NOUN
brj-23886	46	18	activity	activity	NOUN
brj-23886	46	19	and	and	CCONJ
brj-23886	46	20	ethanol	ethanol	NOUN
brj-23886	46	21	production	production	NOUN
brj-23886	46	22	.	.	PUNCT
brj-23886	47	1	in	in	ADP
brj-23886	47	2	the	the	DET
brj-23886	47	3	1970s	1970	NOUN
brj-23886	47	4	,	,	PUNCT
brj-23886	47	5	researchers	researcher	NOUN
brj-23886	47	6	identified	identify	VERB
brj-23886	47	7	that	that	SCONJ
brj-23886	47	8	rare	rare	ADJ
brj-23886	47	9	earth	earth	NOUN
brj-23886	47	10	ions	ion	NOUN
brj-23886	47	11	exert	exert	VERB
brj-23886	47	12	an	an	DET
brj-23886	47	13	activating	activating	ADJ
brj-23886	47	14	effect	effect	NOUN
brj-23886	47	15	on	on	ADP
brj-23886	47	16	cellulases	cellulase	NOUN
brj-23886	47	17	,	,	PUNCT
brj-23886	47	18	amylases	amylase	NOUN
brj-23886	47	19	,	,	PUNCT
brj-23886	47	20	and	and	CCONJ
brj-23886	47	21	proteases	protease	NOUN
brj-23886	47	22	(	(	PUNCT
brj-23886	47	23	darnall	darnall	NOUN
brj-23886	47	24	and	and	CCONJ
brj-23886	47	25	birnbaum	birnbaum	PROPN
brj-23886	47	26	1970	1970	NUM
brj-23886	47	27	;	;	PUNCT
brj-23886	47	28	gomez	gomez	PROPN
brj-23886	47	29	et	et	PROPN
brj-23886	47	30	al	al	PROPN
brj-23886	47	31	.	.	PROPN
brj-23886	47	32	1974	1974	NUM
brj-23886	47	33	;	;	PUNCT
brj-23886	47	34	diatloff	diatloff	NOUN
brj-23886	47	35	et	et	PROPN
brj-23886	47	36	al	al	PROPN
brj-23886	47	37	.	.	PROPN
brj-23886	47	38	1995	1995	NUM
brj-23886	47	39	;	;	PUNCT
brj-23886	47	40	zhang	zhang	PROPN
brj-23886	47	41	et	et	PROPN
brj-23886	47	42	al	al	PROPN
brj-23886	47	43	.	.	PROPN
brj-23886	47	44	2009	2009	NUM
brj-23886	47	45	)	)	PUNCT
brj-23886	47	46	.	.	PUNCT
brj-23886	48	1	when	when	SCONJ
brj-23886	48	2	the	the	DET
brj-23886	48	3	catalytic	catalytic	ADJ
brj-23886	48	4	activity	activity	NOUN
brj-23886	48	5	of	of	ADP
brj-23886	48	6	the	the	DET
brj-23886	48	7	same	same	ADJ
brj-23886	48	8	enzyme	enzyme	NOUN
brj-23886	48	9	is	be	AUX
brj-23886	48	10	in	in	ADP
brj-23886	48	11	the	the	DET
brj-23886	48	12	presence	presence	NOUN
brj-23886	48	13	of	of	ADP
brj-23886	48	14	various	various	ADJ
brj-23886	48	15	rare	rare	ADJ
brj-23886	48	16	earth	earth	NOUN
brj-23886	48	17	ions	ion	NOUN
brj-23886	48	18	,	,	PUNCT
brj-23886	48	19	complex	complex	ADJ
brj-23886	48	20	reaction	reaction	NOUN
brj-23886	48	21	phenomena	phenomenon	NOUN
brj-23886	48	22	occur	occur	VERB
brj-23886	48	23	due	due	ADP
brj-23886	48	24	to	to	ADP
brj-23886	48	25	differences	difference	NOUN
brj-23886	48	26	in	in	ADP
brj-23886	48	27	the	the	DET
brj-23886	48	28	composition	composition	NOUN
brj-23886	48	29	and	and	CCONJ
brj-23886	48	30	structure	structure	NOUN
brj-23886	48	31	of	of	ADP
brj-23886	48	32	the	the	DET
brj-23886	48	33	enzyme	enzyme	NOUN
brj-23886	48	34	’s	’s	PART
brj-23886	48	35	active	active	ADJ
brj-23886	48	36	center	center	NOUN
brj-23886	48	37	,	,	PUNCT
brj-23886	48	38	the	the	DET
brj-23886	48	39	active	active	ADJ
brj-23886	48	40	center	center	NOUN
brj-23886	48	41	and	and	CCONJ
brj-23886	48	42	its	its	PRON
brj-23886	48	43	surroundings	surrounding	NOUN
brj-23886	48	44	,	,	PUNCT
brj-23886	48	45	and	and	CCONJ
brj-23886	48	46	the	the	DET
brj-23886	48	47	mode	mode	NOUN
brj-23886	48	48	of	of	ADP
brj-23886	48	49	substrate	substrate	NOUN
brj-23886	48	50	action	action	NOUN
brj-23886	48	51	.	.	PUNCT
brj-23886	49	1	this	this	PRON
brj-23886	49	2	indicates	indicate	VERB
brj-23886	49	3	that	that	SCONJ
brj-23886	49	4	the	the	DET
brj-23886	49	5	relationship	relationship	NOUN
brj-23886	49	6	between	between	ADP
brj-23886	49	7	rare	rare	ADJ
brj-23886	49	8	earth	earth	NOUN
brj-23886	49	9	ions	ion	NOUN
brj-23886	49	10	and	and	CCONJ
brj-23886	49	11	enzyme	enzyme	NOUN
brj-23886	49	12	activity	activity	NOUN
brj-23886	49	13	is	be	AUX
brj-23886	49	14	highly	highly	ADV
brj-23886	49	15	complex	complex	ADJ
brj-23886	49	16	,	,	PUNCT
brj-23886	49	17	necessitating	necessitate	VERB
brj-23886	49	18	further	further	ADJ
brj-23886	49	19	comprehensive	comprehensive	ADJ
brj-23886	49	20	investigations	investigation	NOUN
brj-23886	49	21	to	to	PART
brj-23886	49	22	elucidate	elucidate	VERB
brj-23886	49	23	the	the	DET
brj-23886	49	24	underlying	underlie	VERB
brj-23886	49	25	mechanisms	mechanism	NOUN
brj-23886	49	26	.	.	PUNCT
brj-23886	50	1	inspired	inspire	VERB
brj-23886	50	2	by	by	ADP
brj-23886	50	3	the	the	DET
brj-23886	50	4	idea	idea	NOUN
brj-23886	50	5	of	of	ADP
brj-23886	50	6	rare	rare	ADJ
brj-23886	50	7	earth	earth	NOUN
brj-23886	50	8	ions	ion	NOUN
brj-23886	50	9	to	to	PART
brj-23886	50	10	increase	increase	VERB
brj-23886	50	11	enzyme	enzyme	NOUN
brj-23886	50	12	activity	activity	NOUN
brj-23886	50	13	,	,	PUNCT
brj-23886	50	14	xin	xin	PROPN
brj-23886	50	15	et	et	PROPN
brj-23886	50	16	al	al	PROPN
brj-23886	50	17	.	.	PROPN
brj-23886	51	1	(	(	PUNCT
brj-23886	51	2	1996	1996	NUM
brj-23886	51	3	)	)	PUNCT
brj-23886	51	4	demonstrated	demonstrate	VERB
brj-23886	51	5	that	that	SCONJ
brj-23886	51	6	several	several	ADJ
brj-23886	51	7	low	low	ADJ
brj-23886	51	8	concentrations	concentration	NOUN
brj-23886	51	9	of	of	ADP
brj-23886	51	10	rare	rare	ADJ
brj-23886	51	11	earth	earth	NOUN
brj-23886	51	12	ions	ion	NOUN
brj-23886	51	13	increased	increase	VERB
brj-23886	51	14	the	the	DET
brj-23886	51	15	activity	activity	NOUN
brj-23886	51	16	of	of	ADP
brj-23886	51	17	glutamate	glutamate	ADJ
brj-23886	51	18	dehydrogenase	dehydrogenase	NOUN
brj-23886	51	19	.	.	PUNCT
brj-23886	52	1	since	since	SCONJ
brj-23886	52	2	2012	2012	NUM
brj-23886	52	3	,	,	PUNCT
brj-23886	52	4	the	the	DET
brj-23886	52	5	authors	author	NOUN
brj-23886	52	6	’	’	PART
brj-23886	52	7	research	research	NOUN
brj-23886	52	8	laboratory	laboratory	NOUN
brj-23886	52	9	has	have	AUX
brj-23886	52	10	been	be	AUX
brj-23886	52	11	focused	focus	VERB
brj-23886	52	12	on	on	ADP
brj-23886	52	13	improving	improve	VERB
brj-23886	52	14	bioethanol	bioethanol	NOUN
brj-23886	52	15	production	production	NOUN
brj-23886	52	16	through	through	ADP
brj-23886	52	17	rare	rare	ADJ
brj-23886	52	18	earth	earth	NOUN
brj-23886	52	19	ions	ion	NOUN
brj-23886	52	20	.	.	PUNCT
brj-23886	53	1	although	although	SCONJ
brj-23886	53	2	significant	significant	ADJ
brj-23886	53	3	advancements	advancement	NOUN
brj-23886	53	4	have	have	AUX
brj-23886	53	5	been	be	AUX
brj-23886	53	6	made	make	VERB
brj-23886	53	7	in	in	ADP
brj-23886	53	8	this	this	DET
brj-23886	53	9	area	area	NOUN
brj-23886	53	10	,	,	PUNCT
brj-23886	53	11	the	the	DET
brj-23886	53	12	existing	exist	VERB
brj-23886	53	13	literature	literature	NOUN
brj-23886	53	14	on	on	ADP
brj-23886	53	15	the	the	DET
brj-23886	53	16	application	application	NOUN
brj-23886	53	17	of	of	ADP
brj-23886	53	18	rare	rare	ADJ
brj-23886	53	19	earth	earth	NOUN
brj-23886	53	20	ions	ion	NOUN
brj-23886	53	21	to	to	PART
brj-23886	53	22	enhance	enhance	VERB
brj-23886	53	23	ethanol	ethanol	NOUN
brj-23886	53	24	production	production	NOUN
brj-23886	53	25	via	via	ADP
brj-23886	53	26	microbial	microbial	ADJ
brj-23886	53	27	fermentation	fermentation	NOUN
brj-23886	53	28	remains	remain	VERB
brj-23886	53	29	limited	limited	ADJ
brj-23886	53	30	.	.	PUNCT
brj-23886	54	1	genome	genome	NOUN
brj-23886	54	2	sequencing	sequencing	NOUN
brj-23886	54	3	represents	represent	VERB
brj-23886	54	4	a	a	DET
brj-23886	54	5	critical	critical	ADJ
brj-23886	54	6	step	step	NOUN
brj-23886	54	7	in	in	ADP
brj-23886	54	8	the	the	DET
brj-23886	54	9	correlation	correlation	NOUN
brj-23886	54	10	of	of	ADP
brj-23886	54	11	genotypes	genotype	NOUN
brj-23886	54	12	with	with	ADP
brj-23886	54	13	phenotypic	phenotypic	ADJ
brj-23886	54	14	characteristics	characteristic	NOUN
brj-23886	54	15	.	.	PUNCT
brj-23886	55	1	this	this	DET
brj-23886	55	2	process	process	NOUN
brj-23886	55	3	entails	entail	VERB
brj-23886	55	4	the	the	DET
brj-23886	55	5	submission	submission	NOUN
brj-23886	55	6	of	of	ADP
brj-23886	55	7	the	the	DET
brj-23886	55	8	genome	genome	NOUN
brj-23886	55	9	sequence	sequence	NOUN
brj-23886	55	10	of	of	ADP
brj-23886	55	11	an	an	DET
brj-23886	55	12	unidentified	unidentified	ADJ
brj-23886	55	13	species	specie	NOUN
brj-23886	55	14	to	to	ADP
brj-23886	55	15	a	a	DET
brj-23886	55	16	gene	gene	NOUN
brj-23886	55	17	sequencer	sequencer	NOUN
brj-23886	55	18	,	,	PUNCT
brj-23886	55	19	detecting	detect	VERB
brj-23886	55	20	the	the	DET
brj-23886	55	21	signal	signal	NOUN
brj-23886	55	22	of	of	ADP
brj-23886	55	23	its	its	PRON
brj-23886	55	24	bases	basis	NOUN
brj-23886	55	25	,	,	PUNCT
brj-23886	55	26	and	and	CCONJ
brj-23886	55	27	then	then	ADV
brj-23886	55	28	stitching	stitch	VERB
brj-23886	55	29	it	it	PRON
brj-23886	55	30	together	together	ADV
brj-23886	55	31	(	(	PUNCT
brj-23886	55	32	joan	joan	PROPN
brj-23886	55	33	et	et	PROPN
brj-23886	55	34	al	al	PROPN
brj-23886	55	35	.	.	PROPN
brj-23886	55	36	2019	2019	NUM
brj-23886	55	37	;	;	PUNCT
brj-23886	55	38	singh	singh	PROPN
brj-23886	55	39	et	et	PROPN
brj-23886	55	40	al	al	PROPN
brj-23886	55	41	.	.	PROPN
brj-23886	55	42	2022	2022	NUM
brj-23886	55	43	)	)	PUNCT
brj-23886	55	44	.	.	PUNCT
brj-23886	56	1	in	in	ADP
brj-23886	56	2	particular	particular	ADJ
brj-23886	56	3	,	,	PUNCT
brj-23886	56	4	the	the	DET
brj-23886	56	5	technical	technical	ADJ
brj-23886	56	6	means	mean	NOUN
brj-23886	56	7	of	of	ADP
brj-23886	56	8	triple	triple	ADJ
brj-23886	56	9	sequencing	sequence	VERB
brj-23886	56	10	,	,	PUNCT
brj-23886	56	11	developed	develop	VERB
brj-23886	56	12	on	on	ADP
brj-23886	56	13	the	the	DET
brj-23886	56	14	basis	basis	NOUN
brj-23886	56	15	of	of	ADP
brj-23886	56	16	the	the	DET
brj-23886	56	17	original	original	ADJ
brj-23886	56	18	sequencing	sequencing	NOUN
brj-23886	56	19	technology	technology	NOUN
brj-23886	56	20	,	,	PUNCT
brj-23886	56	21	can	can	AUX
brj-23886	56	22	obtain	obtain	VERB
brj-23886	56	23	higher	high	ADJ
brj-23886	56	24	quality	quality	NOUN
brj-23886	56	25	genome	genome	NOUN
brj-23886	56	26	sequences	sequence	NOUN
brj-23886	56	27	and	and	CCONJ
brj-23886	56	28	provide	provide	VERB
brj-23886	56	29	technical	technical	ADJ
brj-23886	56	30	support	support	NOUN
brj-23886	56	31	for	for	ADP
brj-23886	56	32	in	in	ADP
brj-23886	56	33	-	-	PUNCT
brj-23886	56	34	depth	depth	NOUN
brj-23886	56	35	studies	study	NOUN
brj-23886	56	36	of	of	ADP
brj-23886	56	37	bacteria	bacteria	NOUN
brj-23886	56	38	.	.	PUNCT
brj-23886	57	1	yayo	yayo	PROPN
brj-23886	57	2	et	et	PROPN
brj-23886	57	3	al	al	PROPN
brj-23886	57	4	.	.	PROPN
brj-23886	58	1	(	(	PUNCT
brj-23886	58	2	2021	2021	NUM
brj-23886	58	3	)	)	PUNCT
brj-23886	58	4	identified	identify	VERB
brj-23886	58	5	two	two	NUM
brj-23886	58	6	potential	potential	ADJ
brj-23886	58	7	mutation	mutation	NOUN
brj-23886	58	8	sites	site	NOUN
brj-23886	58	9	by	by	ADP
brj-23886	58	10	genome	genome	NOUN
brj-23886	58	11	sequencing	sequencing	NOUN
brj-23886	58	12	,	,	PUNCT
brj-23886	58	13	gene	gene	NOUN
brj-23886	58	14	editing	editing	NOUN
brj-23886	58	15	,	,	PUNCT
brj-23886	58	16	and	and	CCONJ
brj-23886	58	17	physiological	physiological	ADJ
brj-23886	58	18	characterization	characterization	NOUN
brj-23886	58	19	of	of	ADP
brj-23886	58	20	c.	c.	PROPN
brj-23886	58	21	thermocellum	thermocellum	PROPN
brj-23886	58	22	and	and	CCONJ
brj-23886	58	23	found	find	VERB
brj-23886	58	24	that	that	SCONJ
brj-23886	58	25	these	these	DET
brj-23886	58	26	mutations	mutation	NOUN
brj-23886	58	27	play	play	VERB
brj-23886	58	28	a	a	DET
brj-23886	58	29	role	role	NOUN
brj-23886	58	30	in	in	ADP
brj-23886	58	31	the	the	DET
brj-23886	58	32	transport	transport	NOUN
brj-23886	58	33	or	or	CCONJ
brj-23886	58	34	metabolism	metabolism	NOUN
brj-23886	58	35	of	of	ADP
brj-23886	58	36	hexoses	hexose	NOUN
brj-23886	58	37	.	.	PUNCT
brj-23886	59	1	in	in	ADP
brj-23886	59	2	previous	previous	ADJ
brj-23886	59	3	stages	stage	NOUN
brj-23886	59	4	of	of	ADP
brj-23886	59	5	this	this	DET
brj-23886	59	6	experiment	experiment	NOUN
brj-23886	59	7	,	,	PUNCT
brj-23886	59	8	c.	c.	PROPN
brj-23886	59	9	thermocellum	thermocellum	PROPN
brj-23886	59	10	atcc27405	atcc27405	PROPN
brj-23886	59	11	and	and	CCONJ
brj-23886	59	12	t.	t.	PROPN
brj-23886	59	13	thermosaccharolyticum	thermosaccharolyticum	NOUN
brj-23886	59	14	dsm571	dsm571	PROPN
brj-23886	59	15	were	be	AUX
brj-23886	59	16	used	use	VERB
brj-23886	59	17	to	to	PART
brj-23886	59	18	produce	produce	VERB
brj-23886	59	19	fuel	fuel	NOUN
brj-23886	59	20	ethanol	ethanol	NOUN
brj-23886	59	21	by	by	ADP
brj-23886	59	22	co	co	NOUN
brj-23886	59	23	-	-	NOUN
brj-23886	59	24	fermentation	fermentation	NOUN
brj-23886	59	25	.	.	PUNCT
brj-23886	60	1	the	the	DET
brj-23886	60	2	processes	process	NOUN
brj-23886	60	3	were	be	AUX
brj-23886	60	4	regulated	regulate	VERB
brj-23886	60	5	from	from	ADP
brj-23886	60	6	multiple	multiple	ADJ
brj-23886	60	7	perspectives	perspective	NOUN
brj-23886	60	8	,	,	PUNCT
brj-23886	60	9	including	include	VERB
brj-23886	60	10	inoculation	inoculation	NOUN
brj-23886	60	11	time	time	NOUN
brj-23886	60	12	,	,	PUNCT
brj-23886	60	13	inoculation	inoculation	ADJ
brj-23886	60	14	ratio	ratio	NOUN
brj-23886	60	15	,	,	PUNCT
brj-23886	60	16	substrate	substrate	NOUN
brj-23886	60	17	concentration	concentration	NOUN
brj-23886	60	18	,	,	PUNCT
brj-23886	60	19	fermentation	fermentation	NOUN
brj-23886	60	20	temperature	temperature	NOUN
brj-23886	60	21	,	,	PUNCT
brj-23886	60	22	ph	ph	ADJ
brj-23886	60	23	,	,	PUNCT
brj-23886	60	24	and	and	CCONJ
brj-23886	60	25	metal	metal	NOUN
brj-23886	60	26	ions	ion	NOUN
brj-23886	60	27	,	,	PUNCT
brj-23886	60	28	so	so	SCONJ
brj-23886	60	29	as	as	SCONJ
brj-23886	60	30	to	to	PART
brj-23886	60	31	optimize	optimize	VERB
brj-23886	60	32	the	the	DET
brj-23886	60	33	ethanol	ethanol	NOUN
brj-23886	60	34	yield	yield	NOUN
brj-23886	60	35	(	(	PUNCT
brj-23886	60	36	pang	pang	NOUN
brj-23886	60	37	et	et	PROPN
brj-23886	60	38	al	al	PROPN
brj-23886	60	39	.	.	PROPN
brj-23886	60	40	2018a	2018a	PROPN
brj-23886	60	41	,	,	PUNCT
brj-23886	60	42	b	b	NOUN
brj-23886	60	43	)	)	PUNCT
brj-23886	60	44	.	.	PUNCT
brj-23886	61	1	wang	wang	PROPN
brj-23886	61	2	et	et	PROPN
brj-23886	61	3	al	al	PROPN
brj-23886	61	4	.	.	PROPN
brj-23886	61	5	treated	treat	VERB
brj-23886	61	6	c.	c.	PROPN
brj-23886	61	7	thermocellum	thermocellum	PROPN
brj-23886	61	8	atcc27405	atcc27405	PROPN
brj-23886	61	9	(	(	PUNCT
brj-23886	61	10	c0	c0	NOUN
brj-23886	61	11	)	)	PUNCT
brj-23886	61	12	with	with	ADP
brj-23886	61	13	10	10	NUM
brj-23886	61	14	-	-	SYM
brj-23886	61	15	6	6	NUM
brj-23886	61	16	mol	mol	ADP
brj-23886	61	17	/	/	SYM
brj-23886	61	18	l	l	NOUN
brj-23886	61	19	nd3	nd3	NOUN
brj-23886	61	20	+	+	PROPN
brj-23886	61	21	,	,	PUNCT
brj-23886	61	22	and	and	CCONJ
brj-23886	61	23	the	the	DET
brj-23886	61	24	highest	high	ADJ
brj-23886	61	25	ethanol	ethanol	NOUN
brj-23886	61	26	yield	yield	NOUN
brj-23886	61	27	of	of	ADP
brj-23886	61	28	the	the	DET
brj-23886	61	29	strain	strain	NOUN
brj-23886	61	30	was	be	AUX
brj-23886	61	31	1.05	1.05	NUM
brj-23886	61	32	g	g	NOUN
brj-23886	61	33	/	/	SYM
brj-23886	61	34	l	l	NOUN
brj-23886	61	35	with	with	ADP
brj-23886	61	36	26.6	26.6	NUM
brj-23886	61	37	%	%	NOUN
brj-23886	61	38	ethanol	ethanol	NOUN
brj-23886	61	39	yield	yield	NOUN
brj-23886	61	40	,	,	PUNCT
brj-23886	61	41	which	which	PRON
brj-23886	61	42	was	be	AUX
brj-23886	61	43	97.5	97.5	NUM
brj-23886	61	44	%	%	NOUN
brj-23886	61	45	higher	high	ADJ
brj-23886	61	46	than	than	ADP
brj-23886	61	47	c0	c0	PROPN
brj-23886	61	48	(	(	PUNCT
brj-23886	61	49	wang	wang	PROPN
brj-23886	61	50	et	et	PROPN
brj-23886	61	51	al	al	PROPN
brj-23886	61	52	.	.	PROPN
brj-23886	61	53	2022	2022	NUM
brj-23886	61	54	)	)	PUNCT
brj-23886	61	55	.	.	PUNCT
brj-23886	62	1	however	however	ADV
brj-23886	62	2	,	,	PUNCT
brj-23886	62	3	the	the	DET
brj-23886	62	4	specific	specific	ADJ
brj-23886	62	5	mechanism	mechanism	NOUN
brj-23886	62	6	of	of	ADP
brj-23886	62	7	action	action	NOUN
brj-23886	62	8	of	of	ADP
brj-23886	62	9	neodymium	neodymium	NOUN
brj-23886	62	10	ions	ion	NOUN
brj-23886	62	11	at	at	ADP
brj-23886	62	12	the	the	DET
brj-23886	62	13	genomic	genomic	ADJ
brj-23886	62	14	level	level	NOUN
brj-23886	62	15	is	be	AUX
brj-23886	62	16	not	not	PART
brj-23886	62	17	clear	clear	ADJ
brj-23886	62	18	.	.	PUNCT
brj-23886	63	1	the	the	DET
brj-23886	63	2	enzyme	enzyme	NOUN
brj-23886	63	3	expression	expression	NOUN
brj-23886	63	4	is	be	AUX
brj-23886	63	5	regulated	regulate	VERB
brj-23886	63	6	by	by	ADP
brj-23886	63	7	various	various	ADJ
brj-23886	63	8	factors	factor	NOUN
brj-23886	63	9	such	such	ADJ
brj-23886	63	10	as	as	ADP
brj-23886	63	11	promoter	promoter	NOUN
brj-23886	63	12	sequences	sequence	NOUN
brj-23886	63	13	,	,	PUNCT
brj-23886	63	14	enhancer	enhancer	NOUN
brj-23886	63	15	sequences	sequence	NOUN
brj-23886	63	16	,	,	PUNCT
brj-23886	63	17	and	and	CCONJ
brj-23886	63	18	rna	rna	NOUN
brj-23886	63	19	polymerase	polymerase	NOUN
brj-23886	63	20	activity	activity	NOUN
brj-23886	63	21	,	,	PUNCT
brj-23886	63	22	with	with	ADP
brj-23886	63	23	the	the	DET
brj-23886	63	24	promoter	promoter	NOUN
brj-23886	63	25	being	be	AUX
brj-23886	63	26	the	the	DET
brj-23886	63	27	most	most	ADV
brj-23886	63	28	critical	critical	ADJ
brj-23886	63	29	and	and	CCONJ
brj-23886	63	30	direct	direct	ADJ
brj-23886	63	31	factor	factor	NOUN
brj-23886	63	32	.	.	PUNCT
brj-23886	64	1	if	if	SCONJ
brj-23886	64	2	the	the	DET
brj-23886	64	3	key	key	ADJ
brj-23886	64	4	site	site	NOUN
brj-23886	64	5	of	of	ADP
brj-23886	64	6	the	the	DET
brj-23886	64	7	promoter	promoter	NOUN
brj-23886	64	8	can	can	AUX
brj-23886	64	9	be	be	AUX
brj-23886	64	10	found	find	VERB
brj-23886	64	11	,	,	PUNCT
brj-23886	64	12	then	then	ADV
brj-23886	64	13	the	the	DET
brj-23886	64	14	yield	yield	NOUN
brj-23886	64	15	can	can	AUX
brj-23886	64	16	be	be	AUX
brj-23886	64	17	further	far	ADV
brj-23886	64	18	improved	improve	VERB
brj-23886	64	19	by	by	ADP
brj-23886	64	20	genetic	genetic	ADJ
brj-23886	64	21	engineering	engineering	NOUN
brj-23886	64	22	.	.	PUNCT
brj-23886	65	1	based	base	VERB
brj-23886	65	2	on	on	ADP
brj-23886	65	3	previous	previous	ADJ
brj-23886	65	4	studies	study	NOUN
brj-23886	65	5	,	,	PUNCT
brj-23886	65	6	this	this	DET
brj-23886	65	7	study	study	NOUN
brj-23886	65	8	mainly	mainly	ADV
brj-23886	65	9	analyzed	analyze	VERB
brj-23886	65	10	the	the	DET
brj-23886	65	11	mechanism	mechanism	NOUN
brj-23886	65	12	of	of	ADP
brj-23886	65	13	nd3	nd3	NOUN
brj-23886	65	14	+	+	CCONJ
brj-23886	65	15	to	to	PART
brj-23886	65	16	increase	increase	VERB
brj-23886	65	17	ethanol	ethanol	NOUN
brj-23886	65	18	production	production	NOUN
brj-23886	65	19	of	of	ADP
brj-23886	65	20	c.	c.	PROPN
brj-23886	65	21	thermocellum	thermocellum	PROPN
brj-23886	65	22	c0	c0	PROPN
brj-23886	65	23	from	from	ADP
brj-23886	65	24	the	the	DET
brj-23886	65	25	promoter	promoter	NOUN
brj-23886	65	26	sequence	sequence	NOUN
brj-23886	65	27	and	and	CCONJ
brj-23886	65	28	genome	genome	NOUN
brj-23886	65	29	level	level	NOUN
brj-23886	65	30	of	of	ADP
brj-23886	65	31	key	key	ADJ
brj-23886	65	32	enzymes	enzyme	NOUN
brj-23886	65	33	that	that	PRON
brj-23886	65	34	include	include	VERB
brj-23886	65	35	alcohol	alcohol	NOUN
brj-23886	65	36	dehydrogenase	dehydrogenase	NOUN
brj-23886	65	37	(	(	PUNCT
brj-23886	65	38	adh	adh	PROPN
brj-23886	65	39	)	)	PUNCT
brj-23886	65	40	,	,	PUNCT
brj-23886	65	41	pyruvate	pyruvate	NOUN
brj-23886	65	42	-	-	PUNCT
brj-23886	65	43	ferric	ferric	ADJ
brj-23886	65	44	redox	redox	NOUN
brj-23886	65	45	protease	protease	NOUN
brj-23886	65	46	(	(	PUNCT
brj-23886	65	47	pfo	pfo	NOUN
brj-23886	65	48	)	)	PUNCT
brj-23886	65	49	,	,	PUNCT
brj-23886	65	50	and	and	CCONJ
brj-23886	65	51	6	6	NUM
brj-23886	65	52	-	-	PUNCT
brj-23886	65	53	phosphofructokinase	phosphofructokinase	NOUN
brj-23886	65	54	(	(	PUNCT
brj-23886	65	55	pfk	pfk	PROPN
brj-23886	65	56	)	)	PUNCT
brj-23886	65	57	.	.	PUNCT
brj-23886	66	1	through	through	ADP
brj-23886	66	2	studying	study	VERB
brj-23886	66	3	the	the	DET
brj-23886	66	4	mechanism	mechanism	NOUN
brj-23886	66	5	of	of	ADP
brj-23886	66	6	nd3	nd3	NOUN
brj-23886	66	7	+	+	X
brj-23886	66	8	on	on	ADP
brj-23886	66	9	the	the	DET
brj-23886	66	10	metabolic	metabolic	NOUN
brj-23886	66	11	pathway	pathway	NOUN
brj-23886	66	12	of	of	ADP
brj-23886	66	13	c.	c.	PROPN
brj-23886	66	14	thermocellum	thermocellum	PROPN
brj-23886	66	15	,	,	PUNCT
brj-23886	66	16	the	the	DET
brj-23886	66	17	targeted	target	VERB
brj-23886	66	18	transformation	transformation	NOUN
brj-23886	66	19	of	of	ADP
brj-23886	66	20	the	the	DET
brj-23886	66	21	strain	strain	NOUN
brj-23886	66	22	and	and	CCONJ
brj-23886	66	23	the	the	DET
brj-23886	66	24	analysis	analysis	NOUN
brj-23886	66	25	of	of	ADP
brj-23886	66	26	the	the	DET
brj-23886	66	27	metabolic	metabolic	NOUN
brj-23886	66	28	pathway	pathway	NOUN
brj-23886	66	29	,	,	PUNCT
brj-23886	66	30	this	this	DET
brj-23886	66	31	study	study	NOUN
brj-23886	66	32	serves	serve	VERB
brj-23886	66	33	as	as	ADP
brj-23886	66	34	a	a	DET
brj-23886	66	35	reference	reference	NOUN
brj-23886	66	36	for	for	ADP
brj-23886	66	37	future	future	ADJ
brj-23886	66	38	research	research	NOUN
brj-23886	66	39	aimed	aim	VERB
brj-23886	66	40	at	at	ADP
brj-23886	66	41	enhancing	enhance	VERB
brj-23886	66	42	ethanol	ethanol	NOUN
brj-23886	66	43	yield	yield	NOUN
brj-23886	66	44	.	.	PUNCT
brj-23886	67	1	peer	peer	NOUN
brj-23886	67	2	-	-	PUNCT
brj-23886	67	3	reviewed	review	VERB
brj-23886	67	4	article	article	NOUN
brj-23886	67	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	67	6	cui	cui	PROPN
brj-23886	67	7	et	et	PROPN
brj-23886	67	8	al	al	PROPN
brj-23886	67	9	.	.	PROPN
brj-23886	68	1	(	(	PUNCT
brj-23886	68	2	2025	2025	NUM
brj-23886	68	3	)	)	PUNCT
brj-23886	68	4	.	.	PUNCT
brj-23886	69	1	“	"	PUNCT
brj-23886	69	2	genome	genome	NOUN
brj-23886	69	3	study	study	NOUN
brj-23886	69	4	of	of	ADP
brj-23886	69	5	c.	c.	PROPN
brj-23886	69	6	thermocellum	thermocellum	PROPN
brj-23886	69	7	,	,	PUNCT
brj-23886	69	8	”	"	PUNCT
brj-23886	69	9	bioresources	bioresource	NOUN
brj-23886	69	10	20(2	20(2	NUM
brj-23886	69	11	)	)	PUNCT
brj-23886	69	12	,	,	PUNCT
brj-23886	69	13	3155	3155	NUM
brj-23886	69	14	-	-	SYM
brj-23886	69	15	3175	3175	NUM
brj-23886	69	16	.	.	PUNCT
brj-23886	70	1	3158	3158	NUM
brj-23886	70	2	experimental	experimental	ADJ
brj-23886	70	3	strains	strain	NOUN
brj-23886	70	4	and	and	CCONJ
brj-23886	70	5	culture	culture	NOUN
brj-23886	70	6	media	medium	NOUN
brj-23886	70	7	the	the	DET
brj-23886	70	8	original	original	ADJ
brj-23886	70	9	strain	strain	NOUN
brj-23886	70	10	utilized	utilize	VERB
brj-23886	70	11	in	in	ADP
brj-23886	70	12	this	this	DET
brj-23886	70	13	study	study	NOUN
brj-23886	70	14	was	be	AUX
brj-23886	70	15	c.	c.	PROPN
brj-23886	70	16	thermocellum	thermocellum	PROPN
brj-23886	70	17	atcc27405	atcc27405	PROPN
brj-23886	70	18	,	,	PUNCT
brj-23886	70	19	subsequently	subsequently	ADV
brj-23886	70	20	designated	designate	VERB
brj-23886	70	21	as	as	ADP
brj-23886	70	22	c.	c.	PROPN
brj-23886	70	23	thermocellum	thermocellum	PROPN
brj-23886	70	24	c0	c0	PROPN
brj-23886	70	25	.	.	PUNCT
brj-23886	71	1	the	the	DET
brj-23886	71	2	strain	strain	PROPN
brj-23886	71	3	c.	c.	PROPN
brj-23886	71	4	thermocellum	thermocellum	PROPN
brj-23886	71	5	c1	c1	PROPN
brj-23886	71	6	underwent	underwent	NOUN
brj-23886	71	7	treated	treat	VERB
brj-23886	71	8	with	with	ADP
brj-23886	71	9	nd3	nd3	ADJ
brj-23886	71	10	+	+	PROPN
brj-23886	71	11	,	,	PUNCT
brj-23886	71	12	and	and	CCONJ
brj-23886	71	13	it	it	PRON
brj-23886	71	14	was	be	AUX
brj-23886	71	15	conserved	conserve	VERB
brj-23886	71	16	in	in	ADP
brj-23886	71	17	the	the	DET
brj-23886	71	18	chinese	chinese	ADJ
brj-23886	71	19	center	center	NOUN
brj-23886	71	20	for	for	ADP
brj-23886	71	21	typical	typical	ADJ
brj-23886	71	22	cultures	culture	NOUN
brj-23886	71	23	collection	collection	NOUN
brj-23886	71	24	(	(	PUNCT
brj-23886	71	25	cctcc	cctcc	NOUN
brj-23886	71	26	)	)	PUNCT
brj-23886	71	27	under	under	ADP
brj-23886	71	28	the	the	DET
brj-23886	71	29	conservation	conservation	NOUN
brj-23886	71	30	number	number	NOUN
brj-23886	71	31	cctcc	cctcc	NOUN
brj-23886	71	32	no	no	DET
brj-23886	71	33	:	:	PUNCT
brj-23886	71	34	m2021190	m2021190	NOUN
brj-23886	71	35	.	.	PUNCT
brj-23886	72	1	the	the	DET
brj-23886	72	2	strain	strain	NOUN
brj-23886	72	3	exhibiting	exhibit	VERB
brj-23886	72	4	point	point	NOUN
brj-23886	72	5	mutations	mutation	NOUN
brj-23886	72	6	in	in	ADP
brj-23886	72	7	the	the	DET
brj-23886	72	8	promoter	promoter	NOUN
brj-23886	72	9	sequences	sequence	NOUN
brj-23886	72	10	of	of	ADP
brj-23886	72	11	the	the	DET
brj-23886	72	12	three	three	NUM
brj-23886	72	13	key	key	ADJ
brj-23886	72	14	enzymes	enzyme	NOUN
brj-23886	72	15	has	have	AUX
brj-23886	72	16	been	be	AUX
brj-23886	72	17	designated	designate	VERB
brj-23886	72	18	as	as	ADP
brj-23886	72	19	c.	c.	PROPN
brj-23886	72	20	thermocellum	thermocellum	PROPN
brj-23886	72	21	c3	c3	PROPN
brj-23886	72	22	.	.	PUNCT
brj-23886	73	1	the	the	DET
brj-23886	73	2	medium	medium	NOUN
brj-23886	73	3	was	be	AUX
brj-23886	73	4	prepared	prepare	VERB
brj-23886	73	5	in	in	ADP
brj-23886	73	6	an	an	DET
brj-23886	73	7	anaerobic	anaerobic	ADJ
brj-23886	73	8	cabinet	cabinet	NOUN
brj-23886	73	9	with	with	ADP
brj-23886	73	10	an	an	DET
brj-23886	73	11	atmosphere	atmosphere	NOUN
brj-23886	73	12	of	of	ADP
brj-23886	73	13	n2	n2	NOUN
brj-23886	73	14	,	,	PUNCT
brj-23886	73	15	and	and	CCONJ
brj-23886	73	16	the	the	DET
brj-23886	73	17	medium	medium	ADJ
brj-23886	73	18	composition	composition	NOUN
brj-23886	73	19	and	and	CCONJ
brj-23886	73	20	configuration	configuration	NOUN
brj-23886	73	21	methods	method	NOUN
brj-23886	73	22	were	be	AUX
brj-23886	73	23	according	accord	VERB
brj-23886	73	24	to	to	ADP
brj-23886	73	25	wang	wang	PROPN
brj-23886	73	26	et	et	PROPN
brj-23886	73	27	al	al	PROPN
brj-23886	73	28	.	.	PROPN
brj-23886	74	1	(	(	PUNCT
brj-23886	74	2	2022	2022	NUM
brj-23886	74	3	)	)	PUNCT
brj-23886	74	4	.	.	PUNCT
brj-23886	75	1	the	the	DET
brj-23886	75	2	5	5	NUM
brj-23886	75	3	%	%	NOUN
brj-23886	75	4	(	(	PUNCT
brj-23886	75	5	v	v	NOUN
brj-23886	75	6	/	/	SYM
brj-23886	75	7	v	v	NOUN
brj-23886	75	8	)	)	PUNCT
brj-23886	75	9	inoculum	inoculum	NOUN
brj-23886	75	10	was	be	AUX
brj-23886	75	11	inoculated	inoculate	VERB
brj-23886	75	12	in	in	ADP
brj-23886	75	13	100	100	NUM
brj-23886	75	14	-	-	PUNCT
brj-23886	75	15	ml	ml	NOUN
brj-23886	75	16	serum	serum	NOUN
brj-23886	75	17	bottles	bottle	NOUN
brj-23886	75	18	and	and	CCONJ
brj-23886	75	19	incubated	incubate	VERB
brj-23886	75	20	at	at	ADP
brj-23886	75	21	55	55	NUM
brj-23886	75	22	°	°	ADP
brj-23886	75	23	c	c	NOUN
brj-23886	75	24	and	and	CCONJ
brj-23886	75	25	180	180	NUM
brj-23886	75	26	r	r	NOUN
brj-23886	75	27	/	/	SYM
brj-23886	75	28	min	min	NOUN
brj-23886	75	29	for	for	ADP
brj-23886	75	30	12	12	NUM
brj-23886	75	31	h.	h.	NOUN
brj-23886	75	32	methods	method	NOUN
brj-23886	75	33	the	the	DET
brj-23886	75	34	nd3	nd3	ADJ
brj-23886	75	35	+	+	SYM
brj-23886	75	36	treatment	treatment	NOUN
brj-23886	75	37	method	method	NOUN
brj-23886	75	38	the	the	DET
brj-23886	75	39	medium	medium	NOUN
brj-23886	75	40	was	be	AUX
brj-23886	75	41	supplemented	supplement	VERB
brj-23886	75	42	with	with	ADP
brj-23886	75	43	10	10	NUM
brj-23886	75	44	-	-	SYM
brj-23886	75	45	6	6	NUM
brj-23886	75	46	mol	mol	NOUN
brj-23886	75	47	/	/	SYM
brj-23886	75	48	l	l	NOUN
brj-23886	75	49	of	of	ADP
brj-23886	75	50	nd3	nd3	NOUN
brj-23886	75	51	+	+	CCONJ
brj-23886	75	52	and	and	CCONJ
brj-23886	75	53	incubated	incubate	VERB
brj-23886	75	54	continuously	continuously	ADV
brj-23886	75	55	for	for	ADP
brj-23886	75	56	six	six	NUM
brj-23886	75	57	generations	generation	NOUN
brj-23886	75	58	.	.	PUNCT
brj-23886	76	1	then	then	ADV
brj-23886	76	2	,	,	PUNCT
brj-23886	76	3	5	5	NUM
brj-23886	76	4	%	%	NOUN
brj-23886	76	5	(	(	PUNCT
brj-23886	76	6	v	v	NOUN
brj-23886	76	7	/	/	SYM
brj-23886	76	8	v	v	NOUN
brj-23886	76	9	)	)	PUNCT
brj-23886	76	10	of	of	ADP
brj-23886	76	11	c.	c.	PROPN
brj-23886	76	12	thermocellum	thermocellum	PROPN
brj-23886	76	13	c0	c0	PROPN
brj-23886	76	14	strain	strain	VERB
brj-23886	76	15	containing	contain	VERB
brj-23886	76	16	nd3	nd3	NOUN
brj-23886	76	17	+	+	CCONJ
brj-23886	76	18	was	be	AUX
brj-23886	76	19	inoculated	inoculate	VERB
brj-23886	76	20	into	into	ADP
brj-23886	76	21	solid	solid	ADJ
brj-23886	76	22	medium	medium	NOUN
brj-23886	76	23	and	and	CCONJ
brj-23886	76	24	incubated	incubate	VERB
brj-23886	76	25	at	at	ADP
brj-23886	76	26	55	55	NUM
brj-23886	76	27	c	c	VERB
brj-23886	76	28	with	with	ADP
brj-23886	76	29	stirring	stir	VERB
brj-23886	76	30	at	at	ADP
brj-23886	76	31	180	180	NUM
brj-23886	76	32	r	r	NOUN
brj-23886	76	33	/	/	SYM
brj-23886	76	34	min	min	NOUN
brj-23886	76	35	for	for	ADP
brj-23886	76	36	three	three	NUM
brj-23886	76	37	days	day	NOUN
brj-23886	76	38	.	.	PUNCT
brj-23886	77	1	large	large	ADJ
brj-23886	77	2	colonies	colony	NOUN
brj-23886	77	3	were	be	AUX
brj-23886	77	4	inoculated	inoculate	VERB
brj-23886	77	5	into	into	ADP
brj-23886	77	6	liquid	liquid	ADJ
brj-23886	77	7	medium	medium	NOUN
brj-23886	77	8	and	and	CCONJ
brj-23886	77	9	cultured	cultured	ADJ
brj-23886	77	10	until	until	ADP
brj-23886	77	11	the	the	DET
brj-23886	77	12	logarithmic	logarithmic	ADJ
brj-23886	77	13	phase	phase	NOUN
brj-23886	77	14	,	,	PUNCT
brj-23886	77	15	which	which	PRON
brj-23886	77	16	was	be	AUX
brj-23886	77	17	the	the	DET
brj-23886	77	18	removal	removal	NOUN
brj-23886	77	19	of	of	ADP
brj-23886	77	20	nd3	nd3	NOUN
brj-23886	77	21	+	+	X
brj-23886	77	22	from	from	ADP
brj-23886	77	23	the	the	DET
brj-23886	77	24	medium	medium	NOUN
brj-23886	77	25	.	.	PUNCT
brj-23886	78	1	amplification	amplification	NOUN
brj-23886	78	2	and	and	CCONJ
brj-23886	78	3	sequencing	sequencing	NOUN
brj-23886	78	4	of	of	ADP
brj-23886	78	5	target	target	NOUN
brj-23886	78	6	genes	gene	NOUN
brj-23886	78	7	the	the	DET
brj-23886	78	8	promoter	promoter	NOUN
brj-23886	78	9	sequences	sequence	NOUN
brj-23886	78	10	of	of	ADP
brj-23886	78	11	key	key	ADJ
brj-23886	78	12	enzymes	enzyme	NOUN
brj-23886	78	13	were	be	AUX
brj-23886	78	14	sequenced	sequence	VERB
brj-23886	78	15	by	by	ADP
brj-23886	78	16	constructing	construct	VERB
brj-23886	78	17	recombinant	recombinant	ADJ
brj-23886	78	18	plasmids	plasmid	NOUN
brj-23886	78	19	.	.	PUNCT
brj-23886	79	1	the	the	DET
brj-23886	79	2	pmd19	pmd19	PROPN
brj-23886	79	3	-	-	PUNCT
brj-23886	79	4	t	t	PROPN
brj-23886	79	5	vertor	vertor	NOUN
brj-23886	79	6	(	(	PUNCT
brj-23886	79	7	see	see	VERB
brj-23886	79	8	fig	fig	NOUN
brj-23886	79	9	.	.	PUNCT
brj-23886	80	1	1	1	NUM
brj-23886	80	2	)	)	PUNCT
brj-23886	80	3	was	be	AUX
brj-23886	80	4	used	use	VERB
brj-23886	80	5	for	for	ADP
brj-23886	80	6	the	the	DET
brj-23886	80	7	experiment	experiment	NOUN
brj-23886	80	8	,	,	PUNCT
brj-23886	80	9	and	and	CCONJ
brj-23886	80	10	double	double	ADJ
brj-23886	80	11	digestion	digestion	NOUN
brj-23886	80	12	was	be	AUX
brj-23886	80	13	performed	perform	VERB
brj-23886	80	14	using	use	VERB
brj-23886	80	15	the	the	DET
brj-23886	80	16	enzymatic	enzymatic	ADJ
brj-23886	80	17	sites	site	NOUN
brj-23886	80	18	on	on	ADP
brj-23886	80	19	the	the	DET
brj-23886	80	20	primers	primer	NOUN
brj-23886	80	21	(	(	PUNCT
brj-23886	80	22	see	see	VERB
brj-23886	80	23	table	table	NOUN
brj-23886	80	24	1	1	NUM
brj-23886	80	25	)	)	PUNCT
brj-23886	80	26	.	.	PUNCT
brj-23886	81	1	fig	fig	NOUN
brj-23886	81	2	.	.	PUNCT
brj-23886	82	1	1	1	X
brj-23886	82	2	.	.	X
brj-23886	82	3	pmd19	pmd19	PROPN
brj-23886	82	4	-	-	PUNCT
brj-23886	82	5	t	t	PROPN
brj-23886	82	6	vertor	vertor	NOUN
brj-23886	82	7	cloning	cloning	NOUN
brj-23886	82	8	site	site	NOUN
brj-23886	82	9	first	first	ADV
brj-23886	82	10	,	,	PUNCT
brj-23886	82	11	when	when	SCONJ
brj-23886	82	12	the	the	DET
brj-23886	82	13	c0	c0	NOUN
brj-23886	82	14	and	and	CCONJ
brj-23886	82	15	c1	c1	PROPN
brj-23886	82	16	were	be	AUX
brj-23886	82	17	cultured	cultured	ADJ
brj-23886	82	18	to	to	PART
brj-23886	82	19	logarithmic	logarithmic	ADJ
brj-23886	82	20	phase	phase	NOUN
brj-23886	82	21	,	,	PUNCT
brj-23886	82	22	the	the	DET
brj-23886	82	23	dna	dna	NOUN
brj-23886	82	24	was	be	AUX
brj-23886	82	25	extracted	extract	VERB
brj-23886	82	26	using	use	VERB
brj-23886	82	27	the	the	DET
brj-23886	82	28	tiangen	tiangen	NOUN
brj-23886	82	29	bacterial	bacterial	ADJ
brj-23886	82	30	whole	whole	ADJ
brj-23886	82	31	genome	genome	NOUN
brj-23886	82	32	dna	dna	NOUN
brj-23886	82	33	extraction	extraction	NOUN
brj-23886	82	34	kit	kit	NOUN
brj-23886	82	35	.	.	PUNCT
brj-23886	83	1	the	the	DET
brj-23886	83	2	dna	dna	NOUN
brj-23886	83	3	of	of	ADP
brj-23886	83	4	strains	strain	NOUN
brj-23886	83	5	c0	c0	NOUN
brj-23886	83	6	and	and	CCONJ
brj-23886	83	7	c1	c1	PROPN
brj-23886	83	8	were	be	AUX
brj-23886	83	9	used	use	VERB
brj-23886	83	10	as	as	ADP
brj-23886	83	11	templates	template	NOUN
brj-23886	83	12	to	to	PART
brj-23886	83	13	amplify	amplify	VERB
brj-23886	83	14	promoter	promoter	NOUN
brj-23886	83	15	gene	gene	NOUN
brj-23886	83	16	fragments	fragment	NOUN
brj-23886	83	17	.	.	PUNCT
brj-23886	84	1	the	the	DET
brj-23886	84	2	promoter	promoter	NOUN
brj-23886	84	3	gene	gene	NOUN
brj-23886	84	4	fragments	fragment	NOUN
brj-23886	84	5	of	of	ADP
brj-23886	84	6	the	the	DET
brj-23886	84	7	two	two	NUM
brj-23886	84	8	strains	strain	NOUN
brj-23886	84	9	were	be	AUX
brj-23886	84	10	amplified	amplify	VERB
brj-23886	84	11	separately	separately	ADV
brj-23886	84	12	,	,	PUNCT
brj-23886	84	13	and	and	CCONJ
brj-23886	84	14	the	the	DET
brj-23886	84	15	reaction	reaction	NOUN
brj-23886	84	16	systems	system	NOUN
brj-23886	84	17	included	include	VERB
brj-23886	84	18	10	10	NUM
brj-23886	84	19	μl	μl	ADP
brj-23886	84	20	exq	exq	PROPN
brj-23886	84	21	mix	mix	NOUN
brj-23886	84	22	dye	dye	NOUN
brj-23886	84	23	,	,	PUNCT
brj-23886	84	24	1	1	NUM
brj-23886	84	25	μl	μl	ADP
brj-23886	84	26	dna	dna	PROPN
brj-23886	84	27	template	template	NOUN
brj-23886	84	28	,	,	PUNCT
brj-23886	84	29	0.5	0.5	NUM
brj-23886	84	30	μl	μl	PRON
brj-23886	84	31	upstream	upstream	NOUN
brj-23886	84	32	primer	primer	NOUN
brj-23886	84	33	,	,	PUNCT
brj-23886	84	34	0.5	0.5	NUM
brj-23886	84	35	peer	peer	NOUN
brj-23886	84	36	-	-	PUNCT
brj-23886	84	37	reviewed	review	VERB
brj-23886	84	38	article	article	NOUN
brj-23886	84	39	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	84	40	cui	cui	PROPN
brj-23886	84	41	et	et	PROPN
brj-23886	84	42	al	al	PROPN
brj-23886	84	43	.	.	PROPN
brj-23886	85	1	(	(	PUNCT
brj-23886	85	2	2025	2025	NUM
brj-23886	85	3	)	)	PUNCT
brj-23886	85	4	.	.	PUNCT
brj-23886	86	1	“	"	PUNCT
brj-23886	86	2	genome	genome	NOUN
brj-23886	86	3	study	study	NOUN
brj-23886	86	4	of	of	ADP
brj-23886	86	5	c.	c.	PROPN
brj-23886	86	6	thermocellum	thermocellum	PROPN
brj-23886	86	7	,	,	PUNCT
brj-23886	86	8	”	"	PUNCT
brj-23886	86	9	bioresources	bioresource	NOUN
brj-23886	86	10	20(2	20(2	NUM
brj-23886	86	11	)	)	PUNCT
brj-23886	86	12	,	,	PUNCT
brj-23886	86	13	3155	3155	NUM
brj-23886	86	14	-	-	SYM
brj-23886	86	15	3175	3175	NUM
brj-23886	86	16	.	.	PUNCT
brj-23886	87	1	3159	3159	NUM
brj-23886	87	2	μl	μl	PRON
brj-23886	87	3	downstream	downstream	PROPN
brj-23886	87	4	primer	primer	NOUN
brj-23886	87	5	,	,	PUNCT
brj-23886	87	6	and	and	CCONJ
brj-23886	87	7	8	8	NUM
brj-23886	87	8	μl	μl	NUM
brj-23886	87	9	ddh2o	ddh2o	PROPN
brj-23886	87	10	.	.	PUNCT
brj-23886	88	1	the	the	DET
brj-23886	88	2	polymerase	polymerase	NOUN
brj-23886	88	3	chain	chain	NOUN
brj-23886	88	4	reaction	reaction	NOUN
brj-23886	88	5	(	(	PUNCT
brj-23886	88	6	pcr	pcr	NOUN
brj-23886	88	7	)	)	PUNCT
brj-23886	88	8	reaction	reaction	NOUN
brj-23886	88	9	system	system	NOUN
brj-23886	88	10	was	be	AUX
brj-23886	88	11	as	as	SCONJ
brj-23886	88	12	follows	follow	VERB
brj-23886	88	13	:	:	PUNCT
brj-23886	88	14	95	95	NUM
brj-23886	88	15	°	°	NUM
brj-23886	88	16	c	c	NOUN
brj-23886	88	17	for	for	ADP
brj-23886	88	18	120	120	NUM
brj-23886	88	19	s	s	NOUN
brj-23886	88	20	,	,	PUNCT
brj-23886	88	21	followed	follow	VERB
brj-23886	88	22	by	by	ADP
brj-23886	88	23	30	30	NUM
brj-23886	88	24	cycles	cycle	NOUN
brj-23886	88	25	of	of	ADP
brj-23886	88	26	95	95	NUM
brj-23886	88	27	°	°	ADP
brj-23886	88	28	c	c	NOUN
brj-23886	88	29	for	for	ADP
brj-23886	88	30	30	30	NUM
brj-23886	88	31	s	s	NOUN
brj-23886	88	32	,	,	PUNCT
brj-23886	88	33	45	45	NUM
brj-23886	88	34	to	to	PART
brj-23886	88	35	55	55	NUM
brj-23886	88	36	°	°	NOUN
brj-23886	88	37	c	c	NOUN
brj-23886	88	38	for	for	ADP
brj-23886	88	39	30	30	NUM
brj-23886	88	40	s	s	NOUN
brj-23886	88	41	,	,	PUNCT
brj-23886	88	42	and	and	CCONJ
brj-23886	88	43	72	72	NUM
brj-23886	88	44	°	°	NUM
brj-23886	88	45	c	c	NOUN
brj-23886	88	46	with	with	ADP
brj-23886	88	47	the	the	DET
brj-23886	88	48	time	time	NOUN
brj-23886	88	49	determined	determine	VERB
brj-23886	88	50	by	by	ADP
brj-23886	88	51	the	the	DET
brj-23886	88	52	size	size	NOUN
brj-23886	88	53	of	of	ADP
brj-23886	88	54	the	the	DET
brj-23886	88	55	target	target	NOUN
brj-23886	88	56	fragment	fragment	NOUN
brj-23886	88	57	.	.	PUNCT
brj-23886	89	1	next	next	ADV
brj-23886	89	2	,	,	PUNCT
brj-23886	89	3	the	the	DET
brj-23886	89	4	target	target	NOUN
brj-23886	89	5	fragments	fragment	NOUN
brj-23886	89	6	were	be	AUX
brj-23886	89	7	recovered	recover	VERB
brj-23886	89	8	using	use	VERB
brj-23886	89	9	the	the	DET
brj-23886	89	10	agarose	agarose	NOUN
brj-23886	89	11	gel	gel	NOUN
brj-23886	89	12	recovery	recovery	NOUN
brj-23886	89	13	kit	kit	NOUN
brj-23886	89	14	(	(	PUNCT
brj-23886	89	15	tengen	tengen	PROPN
brj-23886	89	16	biochemical	biochemical	ADJ
brj-23886	89	17	technology	technology	NOUN
brj-23886	89	18	(	(	PUNCT
brj-23886	89	19	beijing	beijing	PROPN
brj-23886	89	20	)	)	PUNCT
brj-23886	89	21	co.	co.	PROPN
brj-23886	89	22	)	)	PUNCT
brj-23886	89	23	.	.	PUNCT
brj-23886	90	1	then	then	ADV
brj-23886	90	2	,	,	PUNCT
brj-23886	90	3	the	the	DET
brj-23886	90	4	target	target	NOUN
brj-23886	90	5	fragment	fragment	NOUN
brj-23886	90	6	was	be	AUX
brj-23886	90	7	ligated	ligate	VERB
brj-23886	90	8	onto	onto	ADP
brj-23886	90	9	the	the	DET
brj-23886	90	10	pmd19	pmd19	PROPN
brj-23886	90	11	-	-	PUNCT
brj-23886	90	12	t	t	NOUN
brj-23886	90	13	vertor	vertor	NOUN
brj-23886	90	14	,	,	PUNCT
brj-23886	90	15	and	and	CCONJ
brj-23886	90	16	the	the	DET
brj-23886	90	17	ligation	ligation	NOUN
brj-23886	90	18	system	system	NOUN
brj-23886	90	19	was	be	AUX
brj-23886	90	20	placed	place	VERB
brj-23886	90	21	in	in	ADP
brj-23886	90	22	the	the	DET
brj-23886	90	23	pcr	pcr	ADJ
brj-23886	90	24	instrument	instrument	NOUN
brj-23886	90	25	at	at	ADP
brj-23886	90	26	16	16	NUM
brj-23886	90	27	°	°	NOUN
brj-23886	90	28	c	c	NOUN
brj-23886	90	29	overnight	overnight	ADV
brj-23886	90	30	.	.	PUNCT
brj-23886	91	1	the	the	DET
brj-23886	91	2	ligation	ligation	NOUN
brj-23886	91	3	system	system	NOUN
brj-23886	91	4	was	be	AUX
brj-23886	91	5	4	4	NUM
brj-23886	91	6	μl	μl	ADP
brj-23886	91	7	target	target	NOUN
brj-23886	91	8	fragment	fragment	NOUN
brj-23886	91	9	,	,	PUNCT
brj-23886	91	10	1	1	NUM
brj-23886	91	11	μl	μl	ADP
brj-23886	91	12	pmd19	pmd19	PROPN
brj-23886	91	13	-	-	PUNCT
brj-23886	91	14	t	t	NOUN
brj-23886	91	15	vertor	vertor	NOUN
brj-23886	91	16	,	,	PUNCT
brj-23886	91	17	and	and	CCONJ
brj-23886	91	18	5	5	NUM
brj-23886	91	19	μl	μl	NOUN
brj-23886	91	20	solution	solution	NOUN
brj-23886	91	21	ⅰ.	ⅰ.	VERB
brj-23886	91	22	finally	finally	ADV
brj-23886	91	23	,	,	PUNCT
brj-23886	91	24	hind	hind	NOUN
brj-23886	91	25	ⅲ	ⅲ	ADJ
brj-23886	91	26	and	and	CCONJ
brj-23886	91	27	bamh	bamh	ADJ
brj-23886	91	28	ⅰ	ⅰ	NUM
brj-23886	91	29	were	be	AUX
brj-23886	91	30	used	use	VERB
brj-23886	91	31	for	for	ADP
brj-23886	91	32	digestion	digestion	NOUN
brj-23886	91	33	,	,	PUNCT
brj-23886	91	34	and	and	CCONJ
brj-23886	91	35	the	the	DET
brj-23886	91	36	recombinant	recombinant	ADJ
brj-23886	91	37	plasmid	plasmid	NOUN
brj-23886	91	38	with	with	ADP
brj-23886	91	39	correct	correct	ADJ
brj-23886	91	40	digestion	digestion	NOUN
brj-23886	91	41	verification	verification	NOUN
brj-23886	91	42	was	be	AUX
brj-23886	91	43	sent	send	VERB
brj-23886	91	44	to	to	PART
brj-23886	91	45	sangon	sangon	VERB
brj-23886	91	46	biotech	biotech	NOUN
brj-23886	91	47	(	(	PUNCT
brj-23886	91	48	shanghai	shanghai	PROPN
brj-23886	91	49	)	)	PUNCT
brj-23886	91	50	co.	co.	PROPN
brj-23886	91	51	,	,	PUNCT
brj-23886	91	52	ltd	ltd	PROPN
brj-23886	91	53	.	.	PROPN
brj-23886	91	54	for	for	ADP
brj-23886	91	55	sequencing	sequence	VERB
brj-23886	91	56	.	.	PUNCT
brj-23886	91	57	table	table	NOUN
brj-23886	91	58	1	1	NUM
brj-23886	91	59	.	.	PUNCT
brj-23886	92	1	the	the	DET
brj-23886	92	2	primer	primer	NOUN
brj-23886	92	3	sequences	sequence	NOUN
brj-23886	92	4	note	note	VERB
brj-23886	92	5	:	:	PUNCT
brj-23886	92	6	the	the	DET
brj-23886	92	7	underlined	underline	VERB
brj-23886	92	8	portion	portion	NOUN
brj-23886	92	9	represents	represent	VERB
brj-23886	92	10	the	the	DET
brj-23886	92	11	enzyme	enzyme	NOUN
brj-23886	92	12	cleavage	cleavage	NOUN
brj-23886	92	13	site	site	NOUN
brj-23886	92	14	,	,	PUNCT
brj-23886	92	15	and	and	CCONJ
brj-23886	92	16	the	the	DET
brj-23886	92	17	bamh	bamh	NOUN
brj-23886	92	18	i	i	PRON
brj-23886	92	19	enzyme	enzyme	VERB
brj-23886	92	20	cleavage	cleavage	NOUN
brj-23886	92	21	site	site	NOUN
brj-23886	92	22	is	be	AUX
brj-23886	92	23	ggatccd	ggatccd	PROPN
brj-23886	92	24	,	,	PUNCT
brj-23886	92	25	the	the	DET
brj-23886	92	26	hind	hind	NOUN
brj-23886	92	27	iii	iii	NUM
brj-23886	92	28	enzyme	enzyme	NOUN
brj-23886	92	29	cleavage	cleavage	NOUN
brj-23886	92	30	site	site	NOUN
brj-23886	92	31	is	be	AUX
brj-23886	92	32	aagctt	aagctt	ADJ
brj-23886	92	33	.	.	PUNCT
brj-23886	93	1	validation	validation	NOUN
brj-23886	93	2	of	of	ADP
brj-23886	93	3	promoter	promoter	NOUN
brj-23886	93	4	site	site	NOUN
brj-23886	93	5	-	-	PUNCT
brj-23886	93	6	directed	direct	VERB
brj-23886	93	7	mutagenesis	mutagenesis	NOUN
brj-23886	93	8	the	the	DET
brj-23886	93	9	c0	c0	NOUN
brj-23886	93	10	genome	genome	NOUN
brj-23886	93	11	was	be	AUX
brj-23886	93	12	used	use	VERB
brj-23886	93	13	as	as	ADP
brj-23886	93	14	the	the	DET
brj-23886	93	15	template	template	NOUN
brj-23886	93	16	to	to	PART
brj-23886	93	17	amplify	amplify	VERB
brj-23886	93	18	the	the	DET
brj-23886	93	19	adh	adh	NOUN
brj-23886	93	20	,	,	PUNCT
brj-23886	93	21	pfk	pfk	PROPN
brj-23886	93	22	,	,	PUNCT
brj-23886	93	23	and	and	CCONJ
brj-23886	93	24	pfo	pfo	NOUN
brj-23886	93	25	promoter	promoter	NOUN
brj-23886	93	26	mutation	mutation	NOUN
brj-23886	93	27	sequences	sequence	NOUN
brj-23886	93	28	,	,	PUNCT
brj-23886	93	29	respectively	respectively	ADV
brj-23886	93	30	.	.	PUNCT
brj-23886	94	1	the	the	DET
brj-23886	94	2	pcr	pcr	ADJ
brj-23886	94	3	amplification	amplification	NOUN
brj-23886	94	4	products	product	NOUN
brj-23886	94	5	were	be	AUX
brj-23886	94	6	sequentially	sequentially	ADV
brj-23886	94	7	subjected	subject	VERB
brj-23886	94	8	to	to	ADP
brj-23886	94	9	gel	gel	NOUN
brj-23886	94	10	electrophoresis	electrophoresis	NOUN
brj-23886	94	11	,	,	PUNCT
brj-23886	94	12	and	and	CCONJ
brj-23886	94	13	the	the	DET
brj-23886	94	14	gel	gel	NOUN
brj-23886	94	15	recovery	recovery	NOUN
brj-23886	94	16	purified	purified	ADJ
brj-23886	94	17	products	product	NOUN
brj-23886	94	18	were	be	AUX
brj-23886	94	19	ligated	ligate	VERB
brj-23886	94	20	with	with	ADP
brj-23886	94	21	pmd19	pmd19	PROPN
brj-23886	94	22	-	-	PUNCT
brj-23886	94	23	t	t	NOUN
brj-23886	94	24	vertor	vertor	NOUN
brj-23886	94	25	to	to	PART
brj-23886	94	26	construct	construct	VERB
brj-23886	94	27	recombinant	recombinant	ADJ
brj-23886	94	28	plasmids	plasmid	NOUN
brj-23886	94	29	,	,	PUNCT
brj-23886	94	30	which	which	PRON
brj-23886	94	31	were	be	AUX
brj-23886	94	32	named	name	VERB
brj-23886	94	33	pmd19	pmd19	NOUN
brj-23886	94	34	-	-	PUNCT
brj-23886	94	35	adh	adh	NOUN
brj-23886	94	36	,	,	PUNCT
brj-23886	94	37	pmd19pfk	pmd19pfk	PROPN
brj-23886	94	38	,	,	PUNCT
brj-23886	94	39	and	and	CCONJ
brj-23886	94	40	pmd19	pmd19	PROPN
brj-23886	94	41	-	-	PUNCT
brj-23886	94	42	pfo	pfo	NOUN
brj-23886	94	43	,	,	PUNCT
brj-23886	94	44	respectively	respectively	ADV
brj-23886	94	45	.	.	PUNCT
brj-23886	95	1	multiple	multiple	ADJ
brj-23886	95	2	rounds	round	NOUN
brj-23886	95	3	of	of	ADP
brj-23886	95	4	pcr	pcr	NOUN
brj-23886	95	5	were	be	AUX
brj-23886	95	6	performed	perform	VERB
brj-23886	95	7	for	for	ADP
brj-23886	95	8	point	point	NOUN
brj-23886	95	9	mutation	mutation	NOUN
brj-23886	95	10	and	and	CCONJ
brj-23886	95	11	transformation	transformation	NOUN
brj-23886	95	12	into	into	ADP
brj-23886	95	13	e.	e.	PROPN
brj-23886	95	14	coli	coli	PROPN
brj-23886	95	15	dh5α	dh5α	PROPN
brj-23886	95	16	receptor	receptor	NOUN
brj-23886	95	17	cells	cell	NOUN
brj-23886	95	18	to	to	PART
brj-23886	95	19	screen	screen	VERB
brj-23886	95	20	positive	positive	ADJ
brj-23886	95	21	clones	clone	NOUN
brj-23886	95	22	with	with	ADP
brj-23886	95	23	ampicillin	ampicillin	NOUN
brj-23886	95	24	.	.	PUNCT
brj-23886	96	1	ultimately	ultimately	ADV
brj-23886	96	2	,	,	PUNCT
brj-23886	96	3	the	the	DET
brj-23886	96	4	recombinant	recombinant	ADJ
brj-23886	96	5	plasmids	plasmid	NOUN
brj-23886	96	6	were	be	AUX
brj-23886	96	7	target	target	NOUN
brj-23886	96	8	sequence	sequence	NOUN
brj-23886	96	9	primer	primer	NOUN
brj-23886	96	10	adh	adh	PROPN
brj-23886	96	11	upstream	upstream	PROPN
brj-23886	96	12	primer	primer	PROPN
brj-23886	96	13	:	:	PUNCT
brj-23886	96	14	cgaagcttgttgtcaatcaaatcgcg	cgaagcttgttgtcaatcaaatcgcg	NOUN
brj-23886	96	15	downstream	downstream	PROPN
brj-23886	96	16	primer	primer	NOUN
brj-23886	96	17	:	:	PUNCT
brj-23886	96	18	cgccggatcctaaaacctcctccttt	cgccggatcctaaaacctcctccttt	ADJ
brj-23886	96	19	pfk	pfk	PROPN
brj-23886	96	20	upstream	upstream	PROPN
brj-23886	96	21	primer	primer	NOUN
brj-23886	96	22	:	:	PUNCT
brj-23886	96	23	cggcgaagcttataataagcgtcagaatgc	cggcgaagcttataataagcgtcagaatgc	ADJ
brj-23886	96	24	downstream	downstream	PROPN
brj-23886	96	25	primer	primer	NOUN
brj-23886	96	26	:	:	PUNCT
brj-23886	96	27	aattggatccctcccctaaatcccgt	aattggatccctcccctaaatcccgt	PROPN
brj-23886	96	28	pfo	pfo	PROPN
brj-23886	96	29	upstream	upstream	PROPN
brj-23886	96	30	primer	primer	PROPN
brj-23886	96	31	:	:	PUNCT
brj-23886	96	32	gcaagcttgatttgcagccggagtt	gcaagcttgatttgcagccggagtt	ADJ
brj-23886	96	33	downstream	downstream	ADJ
brj-23886	96	34	primer	primer	NOUN
brj-23886	96	35	:	:	PUNCT
brj-23886	96	36	cgggatccctctcctattctttcccgtt	cgggatccctctcctattctttcccgtt	PROPN
brj-23886	96	37	adh1	adh1	PROPN
brj-23886	96	38	upstream	upstream	PROPN
brj-23886	96	39	primer	primer	NOUN
brj-23886	96	40	:	:	PUNCT
brj-23886	96	41	gcatggtaaggagaataagcattgtacatatcggag	gcatggtaaggagaataagcattgtacatatcggag	NOUN
brj-23886	96	42	downstream	downstream	ADJ
brj-23886	96	43	primer	primer	NOUN
brj-23886	96	44	:	:	PUNCT
brj-23886	96	45	ggcagcgtaccattcctcttattcgtaacat	ggcagcgtaccattcctcttattcgtaacat	PROPN
brj-23886	96	46	adh2	adh2	VERB
brj-23886	96	47	upstream	upstream	PROPN
brj-23886	96	48	primer	primer	NOUN
brj-23886	96	49	:	:	PUNCT
brj-23886	96	50	gcgccgtggatactacctctacaaagaacgatat	gcgccgtggatactacctctacaaagaacgatat	ADJ
brj-23886	96	51	downstream	downstream	NOUN
brj-23886	96	52	primer	primer	NOUN
brj-23886	96	53	:	:	PUNCT
brj-23886	96	54	ccgtggcaaaaacctatggatggagatt	ccgtggcaaaaacctatggatggagatt	NOUN
brj-23886	96	55	adh3	adh3	PROPN
brj-23886	96	56	upstream	upstream	PROPN
brj-23886	96	57	primer	primer	NOUN
brj-23886	96	58	:	:	PUNCT
brj-23886	96	59	cttgcgagagaatgcaatatggtgacg	cttgcgagagaatgcaatatggtgacg	ADJ
brj-23886	96	60	downstream	downstream	PROPN
brj-23886	96	61	primer	primer	NOUN
brj-23886	96	62	:	:	PUNCT
brj-23886	96	63	ccgcacctaccttattaacgctcttcttacg	ccgcacctaccttattaacgctcttcttacg	NOUN
brj-23886	96	64	pfo1	pfo1	PROPN
brj-23886	96	65	upstream	upstream	PROPN
brj-23886	96	66	primer	primer	NOUN
brj-23886	96	67	:	:	PUNCT
brj-23886	96	68	gccgcagaaaataaatgagtatactccggatgt	gccgcagaaaataaatgagtatactccggatgt	NOUN
brj-23886	96	69	downstream	downstream	PROPN
brj-23886	96	70	primer	primer	NOUN
brj-23886	96	71	:	:	PUNCT
brj-23886	96	72	cgcgccgccactaaaatatgtcttttatttactct	cgcgccgccactaaaatatgtcttttatttactct	ADJ
brj-23886	96	73	pfo2	pfo2	PROPN
brj-23886	96	74	upstream	upstream	PROPN
brj-23886	96	75	primer	primer	NOUN
brj-23886	96	76	:	:	PUNCT
brj-23886	96	77	ccgactccggatgttattgatgaaaatcagaaag	ccgactccggatgttattgatgaaaatcagaaag	NOUN
brj-23886	96	78	downstream	downstream	ADJ
brj-23886	96	79	primer	primer	NOUN
brj-23886	96	80	:	:	PUNCT
brj-23886	96	81	cgccgcactcatatgaggcctacaataactt	cgccgcactcatatgaggcctacaataactt	ADJ
brj-23886	96	82	pfo3	pfo3	PROPN
brj-23886	96	83	upstream	upstream	PROPN
brj-23886	96	84	primer	primer	NOUN
brj-23886	96	85	:	:	PUNCT
brj-23886	96	86	ggcccaggataaattgattgcagagtgcttttac	ggcccaggataaattgattgcagagtgcttttac	ADJ
brj-23886	96	87	downstream	downstream	NOUN
brj-23886	96	88	primer	primer	NOUN
brj-23886	96	89	:	:	PUNCT
brj-23886	96	90	cgccgcctataaacaggataaattgattga	cgccgcctataaacaggataaattgattga	PROPN
brj-23886	96	91	pfo4	pfo4	PROPN
brj-23886	96	92	upstream	upstream	PROPN
brj-23886	96	93	primer	primer	NOUN
brj-23886	96	94	:	:	PUNCT
brj-23886	96	95	cgagtattggatgcagattttatttccgacgaag	cgagtattggatgcagattttatttccgacgaag	ADJ
brj-23886	96	96	downstream	downstream	ADJ
brj-23886	96	97	primer	primer	NOUN
brj-23886	96	98	:	:	PUNCT
brj-23886	96	99	gccgcaataaacccttttcataacctacgtctac	gccgcaataaacccttttcataacctacgtctac	PROPN
brj-23886	96	100	pfk1	pfk1	PROPN
brj-23886	96	101	upstream	upstream	PROPN
brj-23886	96	102	primer	primer	PROPN
brj-23886	96	103	:	:	PUNCT
brj-23886	96	104	aagctcggctatattgaaaaaacgcacatttc	aagctcggctatattgaaaaaacgcacatttc	PROPN
brj-23886	96	105	downstream	downstream	PROPN
brj-23886	96	106	primer	primer	NOUN
brj-23886	96	107	:	:	PUNCT
brj-23886	96	108	taccgcctaaacctcttcgagccgatat	taccgcctaaacctcttcgagccgatat	ADJ
brj-23886	96	109	pfk2	pfk2	ADJ
brj-23886	96	110	upstream	upstream	NOUN
brj-23886	96	111	primer	primer	NOUN
brj-23886	96	112	:	:	PUNCT
brj-23886	96	113	gcgcaaattttatccgacctgacgaact	gcgcaaattttatccgacctgacgaact	ADJ
brj-23886	96	114	downstream	downstream	NOUN
brj-23886	96	115	primer	primer	NOUN
brj-23886	96	116	:	:	PUNCT
brj-23886	96	117	gcttttcagccgcgtttaaaataggctg	gcttttcagccgcgtttaaaataggctg	PROPN
brj-23886	96	118	pfk3	pfk3	PROPN
brj-23886	96	119	upstream	upstream	PROPN
brj-23886	96	120	primer	primer	NOUN
brj-23886	96	121	:	:	PUNCT
brj-23886	96	122	caaatcgttccgcacaacgaacagaca	caaatcgttccgcacaacgaacagaca	ADJ
brj-23886	96	123	downstream	downstream	PROPN
brj-23886	96	124	primer	primer	NOUN
brj-23886	96	125	:	:	PUNCT
brj-23886	96	126	caacttttggcccagcactaggcgtgt	caacttttggcccagcactaggcgtgt	NOUN
brj-23886	96	127	peer	peer	NOUN
brj-23886	96	128	-	-	PUNCT
brj-23886	96	129	reviewed	review	VERB
brj-23886	96	130	article	article	NOUN
brj-23886	96	131	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	96	132	cui	cui	PROPN
brj-23886	96	133	et	et	PROPN
brj-23886	96	134	al	al	PROPN
brj-23886	96	135	.	.	PROPN
brj-23886	97	1	(	(	PUNCT
brj-23886	97	2	2025	2025	NUM
brj-23886	97	3	)	)	PUNCT
brj-23886	97	4	.	.	PUNCT
brj-23886	98	1	“	"	PUNCT
brj-23886	98	2	genome	genome	NOUN
brj-23886	98	3	study	study	NOUN
brj-23886	98	4	of	of	ADP
brj-23886	98	5	c.	c.	PROPN
brj-23886	98	6	thermocellum	thermocellum	PROPN
brj-23886	98	7	,	,	PUNCT
brj-23886	98	8	”	"	PUNCT
brj-23886	98	9	bioresources	bioresource	NOUN
brj-23886	98	10	20(2	20(2	NUM
brj-23886	98	11	)	)	PUNCT
brj-23886	98	12	,	,	PUNCT
brj-23886	98	13	3155	3155	NUM
brj-23886	98	14	-	-	SYM
brj-23886	98	15	3175	3175	NUM
brj-23886	98	16	.	.	PUNCT
brj-23886	99	1	3160	3160	NUM
brj-23886	99	2	extracted	extract	VERB
brj-23886	99	3	in	in	ADP
brj-23886	99	4	limited	limited	ADJ
brj-23886	99	5	quantities	quantity	NOUN
brj-23886	99	6	,	,	PUNCT
brj-23886	99	7	and	and	CCONJ
brj-23886	99	8	the	the	DET
brj-23886	99	9	positive	positive	ADJ
brj-23886	99	10	recombinant	recombinant	ADJ
brj-23886	99	11	plasmids	plasmid	NOUN
brj-23886	99	12	were	be	AUX
brj-23886	99	13	identified	identify	VERB
brj-23886	99	14	through	through	ADP
brj-23886	99	15	double	double	ADJ
brj-23886	99	16	digestion	digestion	NOUN
brj-23886	99	17	before	before	ADP
brj-23886	99	18	being	be	AUX
brj-23886	99	19	sent	send	VERB
brj-23886	99	20	to	to	ADP
brj-23886	99	21	sangon	sangon	VERB
brj-23886	99	22	biotech	biotech	NOUN
brj-23886	99	23	(	(	PUNCT
brj-23886	99	24	shanghai	shanghai	PROPN
brj-23886	99	25	)	)	PUNCT
brj-23886	99	26	co.	co.	PROPN
brj-23886	99	27	,	,	PUNCT
brj-23886	99	28	ltd	ltd	PROPN
brj-23886	99	29	.	.	PROPN
brj-23886	99	30	for	for	ADP
brj-23886	99	31	sequencing	sequence	VERB
brj-23886	99	32	.	.	PUNCT
brj-23886	100	1	the	the	DET
brj-23886	100	2	expression	expression	NOUN
brj-23886	100	3	vector	vector	NOUN
brj-23886	100	4	for	for	ADP
brj-23886	100	5	the	the	DET
brj-23886	100	6	experiment	experiment	NOUN
brj-23886	100	7	was	be	AUX
brj-23886	100	8	pet-28a	pet-28a	NUM
brj-23886	100	9	(	(	PUNCT
brj-23886	100	10	as	as	ADP
brj-23886	100	11	in	in	ADP
brj-23886	100	12	fig	fig	NOUN
brj-23886	100	13	.	.	PUNCT
brj-23886	101	1	2	2	NUM
brj-23886	101	2	)	)	PUNCT
brj-23886	101	3	.	.	PUNCT
brj-23886	102	1	the	the	DET
brj-23886	102	2	pmd19	pmd19	PROPN
brj-23886	102	3	t	t	PROPN
brj-23886	102	4	is	be	AUX
brj-23886	102	5	a	a	DET
brj-23886	102	6	cloning	cloning	NOUN
brj-23886	102	7	vector	vector	NOUN
brj-23886	102	8	,	,	PUNCT
brj-23886	102	9	which	which	PRON
brj-23886	102	10	is	be	AUX
brj-23886	102	11	mainly	mainly	ADV
brj-23886	102	12	used	use	VERB
brj-23886	102	13	for	for	ADP
brj-23886	102	14	gene	gene	NOUN
brj-23886	102	15	cloning	cloning	NOUN
brj-23886	102	16	and	and	CCONJ
brj-23886	102	17	amplification	amplification	NOUN
brj-23886	102	18	,	,	PUNCT
brj-23886	102	19	while	while	SCONJ
brj-23886	102	20	pet28a	pet28a	ADJ
brj-23886	102	21	is	be	AUX
brj-23886	102	22	an	an	DET
brj-23886	102	23	expression	expression	NOUN
brj-23886	102	24	vector	vector	NOUN
brj-23886	102	25	,	,	PUNCT
brj-23886	102	26	which	which	PRON
brj-23886	102	27	is	be	AUX
brj-23886	102	28	used	use	VERB
brj-23886	102	29	to	to	PART
brj-23886	102	30	express	express	VERB
brj-23886	102	31	the	the	DET
brj-23886	102	32	exogenous	exogenous	ADJ
brj-23886	102	33	genes	gene	NOUN
brj-23886	102	34	in	in	ADP
brj-23886	102	35	the	the	DET
brj-23886	102	36	host	host	NOUN
brj-23886	102	37	cells	cell	NOUN
brj-23886	102	38	.	.	PUNCT
brj-23886	103	1	the	the	DET
brj-23886	103	2	pmd	pmd	PROPN
brj-23886	103	3	is	be	AUX
brj-23886	103	4	the	the	DET
brj-23886	103	5	high	high	ADJ
brj-23886	103	6	copy	copy	NOUN
brj-23886	103	7	plasmid	plasmid	NOUN
brj-23886	103	8	,	,	PUNCT
brj-23886	103	9	which	which	PRON
brj-23886	103	10	would	would	AUX
brj-23886	103	11	replicate	replicate	VERB
brj-23886	103	12	a	a	DET
brj-23886	103	13	lot	lot	NOUN
brj-23886	103	14	of	of	ADP
brj-23886	103	15	plasmids	plasmid	NOUN
brj-23886	103	16	,	,	PUNCT
brj-23886	103	17	and	and	CCONJ
brj-23886	103	18	then	then	ADV
brj-23886	103	19	enzymatically	enzymatically	ADV
brj-23886	103	20	cleave	cleave	VERB
brj-23886	103	21	to	to	PART
brj-23886	103	22	propose	propose	VERB
brj-23886	103	23	the	the	DET
brj-23886	103	24	target	target	NOUN
brj-23886	103	25	fragment	fragment	NOUN
brj-23886	103	26	inside	inside	ADV
brj-23886	103	27	,	,	PUNCT
brj-23886	103	28	which	which	PRON
brj-23886	103	29	would	would	AUX
brj-23886	103	30	be	be	AUX
brj-23886	103	31	relatively	relatively	ADV
brj-23886	103	32	easy	easy	ADJ
brj-23886	103	33	to	to	PART
brj-23886	103	34	be	be	AUX
brj-23886	103	35	attached	attach	VERB
brj-23886	103	36	to	to	ADP
brj-23886	103	37	the	the	DET
brj-23886	103	38	pet	pet	NOUN
brj-23886	103	39	.	.	PUNCT
brj-23886	104	1	after	after	ADP
brj-23886	104	2	extracting	extract	VERB
brj-23886	104	3	the	the	DET
brj-23886	104	4	plasmids	plasmid	NOUN
brj-23886	104	5	,	,	PUNCT
brj-23886	104	6	double	double	ADJ
brj-23886	104	7	digestion	digestion	NOUN
brj-23886	104	8	was	be	AUX
brj-23886	104	9	performed	perform	VERB
brj-23886	104	10	using	use	VERB
brj-23886	104	11	the	the	DET
brj-23886	104	12	enzymatic	enzymatic	ADJ
brj-23886	104	13	sites	site	NOUN
brj-23886	104	14	on	on	ADP
brj-23886	104	15	the	the	DET
brj-23886	104	16	primers	primer	NOUN
brj-23886	104	17	(	(	PUNCT
brj-23886	104	18	see	see	VERB
brj-23886	104	19	table	table	NOUN
brj-23886	104	20	1	1	NUM
brj-23886	104	21	)	)	PUNCT
brj-23886	104	22	,	,	PUNCT
brj-23886	104	23	respectively	respectively	ADV
brj-23886	104	24	.	.	PUNCT
brj-23886	105	1	enzymatic	enzymatic	ADJ
brj-23886	105	2	digestion	digestion	NOUN
brj-23886	105	3	was	be	AUX
brj-23886	105	4	performed	perform	VERB
brj-23886	105	5	at	at	ADP
brj-23886	105	6	37	37	NUM
brj-23886	105	7	°	°	NOUN
brj-23886	105	8	c	c	NOUN
brj-23886	105	9	for	for	ADP
brj-23886	105	10	4	4	NUM
brj-23886	105	11	h.	h.	NOUN
brj-23886	105	12	the	the	DET
brj-23886	105	13	results	result	NOUN
brj-23886	105	14	were	be	AUX
brj-23886	105	15	examined	examine	VERB
brj-23886	105	16	by	by	ADP
brj-23886	105	17	1	1	NUM
brj-23886	105	18	%	%	NOUN
brj-23886	105	19	agarose	agarose	NOUN
brj-23886	105	20	gel	gel	NOUN
brj-23886	105	21	electrophoresis	electrophoresis	NOUN
brj-23886	105	22	after	after	SCONJ
brj-23886	105	23	the	the	DET
brj-23886	105	24	reaction	reaction	NOUN
brj-23886	105	25	was	be	AUX
brj-23886	105	26	completed	complete	VERB
brj-23886	105	27	.	.	PUNCT
brj-23886	106	1	the	the	DET
brj-23886	106	2	mutant	mutant	ADJ
brj-23886	106	3	promoter	promoter	NOUN
brj-23886	106	4	and	and	CCONJ
brj-23886	106	5	the	the	DET
brj-23886	106	6	large	large	ADJ
brj-23886	106	7	fragment	fragment	NOUN
brj-23886	106	8	sequence	sequence	NOUN
brj-23886	106	9	of	of	ADP
brj-23886	106	10	the	the	DET
brj-23886	106	11	expression	expression	NOUN
brj-23886	106	12	vector	vector	NOUN
brj-23886	106	13	were	be	AUX
brj-23886	106	14	recovered	recover	VERB
brj-23886	106	15	,	,	PUNCT
brj-23886	106	16	and	and	CCONJ
brj-23886	106	17	the	the	DET
brj-23886	106	18	vector	vector	NOUN
brj-23886	106	19	sequence	sequence	NOUN
brj-23886	106	20	was	be	AUX
brj-23886	106	21	ligated	ligate	VERB
brj-23886	106	22	to	to	ADP
brj-23886	106	23	the	the	DET
brj-23886	106	24	mutant	mutant	ADJ
brj-23886	106	25	promoter	promoter	NOUN
brj-23886	106	26	.	.	PUNCT
brj-23886	107	1	the	the	DET
brj-23886	107	2	reaction	reaction	NOUN
brj-23886	107	3	system	system	NOUN
brj-23886	107	4	consists	consist	VERB
brj-23886	107	5	of	of	ADP
brj-23886	107	6	9	9	NUM
brj-23886	107	7	μl	μl	ADP
brj-23886	107	8	insert	insert	ADJ
brj-23886	107	9	fragment	fragment	NOUN
brj-23886	107	10	,	,	PUNCT
brj-23886	107	11	2	2	NUM
brj-23886	107	12	μl	μl	ADP
brj-23886	107	13	t4	t4	PROPN
brj-23886	107	14	dna	dna	PROPN
brj-23886	107	15	ligase	ligase	PROPN
brj-23886	107	16	buffer	buffer	NOUN
brj-23886	107	17	,	,	PUNCT
brj-23886	107	18	1	1	NUM
brj-23886	107	19	μl	μl	ADP
brj-23886	107	20	t4	t4	PROPN
brj-23886	107	21	dna	dna	PROPN
brj-23886	107	22	ligase	ligase	NOUN
brj-23886	107	23	,	,	PUNCT
brj-23886	107	24	5	5	NUM
brj-23886	107	25	μl	μl	ADP
brj-23886	107	26	ddh2o	ddh2o	PROPN
brj-23886	107	27	,	,	PUNCT
brj-23886	107	28	and	and	CCONJ
brj-23886	107	29	3	3	NUM
brj-23886	107	30	μl	μl	PRON
brj-23886	107	31	vector	vector	PROPN
brj-23886	107	32	pet-28a	pet-28a	NOUN
brj-23886	107	33	.	.	PUNCT
brj-23886	108	1	fig	fig	NOUN
brj-23886	108	2	.	.	PUNCT
brj-23886	109	1	2	2	NUM
brj-23886	109	2	.	.	NOUN
brj-23886	109	3	pet-28a	pet-28a	NUM
brj-23886	109	4	vector	vector	NOUN
brj-23886	109	5	map	map	NOUN
brj-23886	109	6	determining	determine	VERB
brj-23886	109	7	the	the	DET
brj-23886	109	8	expression	expression	NOUN
brj-23886	109	9	of	of	ADP
brj-23886	109	10	key	key	ADJ
brj-23886	109	11	enzymes	enzyme	NOUN
brj-23886	109	12	the	the	DET
brj-23886	109	13	bacterial	bacterial	ADJ
brj-23886	109	14	broth	broth	NOUN
brj-23886	109	15	of	of	ADP
brj-23886	109	16	c0	c0	PROPN
brj-23886	109	17	and	and	CCONJ
brj-23886	109	18	mutant	mutant	ADJ
brj-23886	109	19	strain	strain	NOUN
brj-23886	109	20	(	(	PUNCT
brj-23886	109	21	c3	c3	NOUN
brj-23886	109	22	)	)	PUNCT
brj-23886	109	23	were	be	AUX
brj-23886	109	24	taken	take	VERB
brj-23886	109	25	under	under	ADP
brj-23886	109	26	the	the	DET
brj-23886	109	27	same	same	ADJ
brj-23886	109	28	culture	culture	NOUN
brj-23886	109	29	conditions	condition	NOUN
brj-23886	109	30	,	,	PUNCT
brj-23886	109	31	and	and	CCONJ
brj-23886	109	32	the	the	DET
brj-23886	109	33	same	same	ADJ
brj-23886	109	34	bacterial	bacterial	ADJ
brj-23886	109	35	concentration	concentration	NOUN
brj-23886	109	36	of	of	ADP
brj-23886	109	37	both	both	DET
brj-23886	109	38	strains	strain	NOUN
brj-23886	109	39	was	be	AUX
brj-23886	109	40	ensured	ensure	VERB
brj-23886	109	41	by	by	ADP
brj-23886	109	42	protein	protein	NOUN
brj-23886	109	43	content	content	NOUN
brj-23886	109	44	assay	assay	VERB
brj-23886	109	45	.	.	PUNCT
brj-23886	110	1	the	the	DET
brj-23886	110	2	total	total	ADJ
brj-23886	110	3	rna	rna	NOUN
brj-23886	110	4	of	of	ADP
brj-23886	110	5	each	each	DET
brj-23886	110	6	strain	strain	NOUN
brj-23886	110	7	was	be	AUX
brj-23886	110	8	extracted	extract	VERB
brj-23886	110	9	separately	separately	ADV
brj-23886	110	10	using	use	VERB
brj-23886	110	11	the	the	DET
brj-23886	110	12	bbi	bbi	ADJ
brj-23886	110	13	bacterial	bacterial	ADJ
brj-23886	110	14	total	total	ADJ
brj-23886	110	15	rna	rna	NOUN
brj-23886	110	16	rapid	rapid	ADJ
brj-23886	110	17	extraction	extraction	NOUN
brj-23886	110	18	kit	kit	NOUN
brj-23886	110	19	(	(	PUNCT
brj-23886	110	20	sangon	sangon	NOUN
brj-23886	110	21	biotech	biotech	NOUN
brj-23886	110	22	(	(	PUNCT
brj-23886	110	23	shanghai	shanghai	PROPN
brj-23886	110	24	)	)	PUNCT
brj-23886	110	25	co.	co.	PROPN
brj-23886	110	26	,	,	PUNCT
brj-23886	110	27	ltd	ltd	PROPN
brj-23886	110	28	.	.	PROPN
brj-23886	110	29	,	,	PUNCT
brj-23886	110	30	order	order	VERB
brj-23886	110	31	no.b518625	no.b518625	ADV
brj-23886	110	32	)	)	PUNCT
brj-23886	110	33	.	.	PUNCT
brj-23886	111	1	then	then	ADV
brj-23886	111	2	,	,	PUNCT
brj-23886	111	3	the	the	DET
brj-23886	111	4	first	first	ADJ
brj-23886	111	5	strand	strand	NOUN
brj-23886	111	6	of	of	ADP
brj-23886	111	7	cdna	cdna	PROPN
brj-23886	111	8	was	be	AUX
brj-23886	111	9	synthesized	synthesize	VERB
brj-23886	111	10	using	use	VERB
brj-23886	111	11	the	the	DET
brj-23886	111	12	bbi	bbi	ADJ
brj-23886	111	13	cdna	cdna	PROPN
brj-23886	111	14	first	first	ADJ
brj-23886	111	15	strand	strand	NOUN
brj-23886	111	16	synthesis	synthesis	NOUN
brj-23886	111	17	kit	kit	NOUN
brj-23886	111	18	(	(	PUNCT
brj-23886	111	19	sangon	sangon	NOUN
brj-23886	111	20	biotech	biotech	NOUN
brj-23886	111	21	(	(	PUNCT
brj-23886	111	22	shanghai	shanghai	PROPN
brj-23886	111	23	)	)	PUNCT
brj-23886	111	24	co.	co.	PROPN
brj-23886	111	25	,	,	PUNCT
brj-23886	111	26	ltd	ltd	PROPN
brj-23886	111	27	.	.	PROPN
brj-23886	111	28	,	,	PUNCT
brj-23886	111	29	order	order	NOUN
brj-23886	111	30	no.b639251	no.b639251	PROPN
brj-23886	111	31	)	)	PUNCT
brj-23886	111	32	.	.	PUNCT
brj-23886	112	1	the	the	DET
brj-23886	112	2	cdnas	cdna	NOUN
brj-23886	112	3	of	of	ADP
brj-23886	112	4	c0	c0	PROPN
brj-23886	112	5	and	and	CCONJ
brj-23886	112	6	c3	c3	PROPN
brj-23886	112	7	were	be	AUX
brj-23886	112	8	used	use	VERB
brj-23886	112	9	as	as	ADP
brj-23886	112	10	templates	template	NOUN
brj-23886	112	11	for	for	ADP
brj-23886	112	12	pcr	pcr	ADJ
brj-23886	112	13	reaction	reaction	NOUN
brj-23886	112	14	amplification	amplification	NOUN
brj-23886	112	15	.	.	PUNCT
brj-23886	113	1	the	the	DET
brj-23886	113	2	reaction	reaction	NOUN
brj-23886	113	3	peer	peer	NOUN
brj-23886	113	4	-	-	PUNCT
brj-23886	113	5	reviewed	review	VERB
brj-23886	113	6	article	article	NOUN
brj-23886	113	7	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	113	8	cui	cui	PROPN
brj-23886	113	9	et	et	PROPN
brj-23886	113	10	al	al	PROPN
brj-23886	113	11	.	.	PROPN
brj-23886	114	1	(	(	PUNCT
brj-23886	114	2	2025	2025	NUM
brj-23886	114	3	)	)	PUNCT
brj-23886	114	4	.	.	PUNCT
brj-23886	115	1	“	"	PUNCT
brj-23886	115	2	genome	genome	NOUN
brj-23886	115	3	study	study	NOUN
brj-23886	115	4	of	of	ADP
brj-23886	115	5	c.	c.	PROPN
brj-23886	115	6	thermocellum	thermocellum	PROPN
brj-23886	115	7	,	,	PUNCT
brj-23886	115	8	”	"	PUNCT
brj-23886	115	9	bioresources	bioresource	NOUN
brj-23886	115	10	20(2	20(2	NUM
brj-23886	115	11	)	)	PUNCT
brj-23886	115	12	,	,	PUNCT
brj-23886	115	13	3155	3155	NUM
brj-23886	115	14	-	-	SYM
brj-23886	115	15	3175	3175	NUM
brj-23886	115	16	.	.	PUNCT
brj-23886	116	1	3161	3161	NUM
brj-23886	116	2	system	system	NOUN
brj-23886	116	3	consists	consist	VERB
brj-23886	116	4	of	of	ADP
brj-23886	116	5	10	10	NUM
brj-23886	116	6	μl	μl	INTJ
brj-23886	116	7	exq	exq	NOUN
brj-23886	116	8	mix	mix	NOUN
brj-23886	116	9	dyes	dye	NOUN
brj-23886	116	10	,	,	PUNCT
brj-23886	116	11	2	2	NUM
brj-23886	116	12	μl	μl	ADP
brj-23886	116	13	dna	dna	PROPN
brj-23886	116	14	template	template	NOUN
brj-23886	116	15	,	,	PUNCT
brj-23886	116	16	0.5	0.5	NUM
brj-23886	116	17	μl	μl	PRON
brj-23886	116	18	upstream	upstream	NOUN
brj-23886	116	19	primer	primer	NOUN
brj-23886	116	20	,	,	PUNCT
brj-23886	116	21	0.5	0.5	NUM
brj-23886	116	22	μl	μl	ADP
brj-23886	116	23	downstream	downstream	ADJ
brj-23886	116	24	primer	primer	NOUN
brj-23886	116	25	,	,	PUNCT
brj-23886	116	26	and	and	CCONJ
brj-23886	116	27	7	7	NUM
brj-23886	116	28	μl	μl	ADP
brj-23886	116	29	ddh2o	ddh2o	PROPN
brj-23886	116	30	.	.	PUNCT
brj-23886	117	1	the	the	DET
brj-23886	117	2	pcr	pcr	PROPN
brj-23886	117	3	reaction	reaction	NOUN
brj-23886	117	4	system	system	NOUN
brj-23886	117	5	was	be	AUX
brj-23886	117	6	as	as	SCONJ
brj-23886	117	7	follows	follow	VERB
brj-23886	117	8	:	:	PUNCT
brj-23886	117	9	94	94	NUM
brj-23886	117	10	°	°	NUM
brj-23886	117	11	c	c	NOUN
brj-23886	117	12	for	for	ADP
brj-23886	117	13	120	120	NUM
brj-23886	117	14	s	s	NOUN
brj-23886	117	15	,	,	PUNCT
brj-23886	117	16	followed	follow	VERB
brj-23886	117	17	by	by	ADP
brj-23886	117	18	30	30	NUM
brj-23886	117	19	cycles	cycle	NOUN
brj-23886	117	20	of	of	ADP
brj-23886	117	21	94	94	NUM
brj-23886	117	22	°	°	ADP
brj-23886	117	23	c	c	NOUN
brj-23886	117	24	for	for	ADP
brj-23886	117	25	30	30	NUM
brj-23886	117	26	s	s	NOUN
brj-23886	117	27	,	,	PUNCT
brj-23886	117	28	59	59	NUM
brj-23886	117	29	°	°	NUM
brj-23886	117	30	c	c	NOUN
brj-23886	117	31	for	for	ADP
brj-23886	117	32	30	30	NUM
brj-23886	117	33	s	s	NOUN
brj-23886	117	34	,	,	PUNCT
brj-23886	117	35	and	and	CCONJ
brj-23886	117	36	72	72	NUM
brj-23886	117	37	°	°	NUM
brj-23886	117	38	c	c	NOUN
brj-23886	117	39	for	for	ADP
brj-23886	117	40	600	600	NUM
brj-23886	117	41	s.	s.	PROPN
brj-23886	117	42	the	the	DET
brj-23886	117	43	16s	16s	PROPN
brj-23886	117	44	rrna	rrna	PROPN
brj-23886	117	45	was	be	AUX
brj-23886	117	46	selected	select	VERB
brj-23886	117	47	as	as	ADP
brj-23886	117	48	the	the	DET
brj-23886	117	49	internal	internal	ADJ
brj-23886	117	50	reference	reference	NOUN
brj-23886	117	51	gene	gene	NOUN
brj-23886	117	52	.	.	PUNCT
brj-23886	118	1	the	the	DET
brj-23886	118	2	four	four	NUM
brj-23886	118	3	pairs	pair	NOUN
brj-23886	118	4	of	of	ADP
brj-23886	118	5	primers	primer	NOUN
brj-23886	118	6	are	be	AUX
brj-23886	118	7	shown	show	VERB
brj-23886	118	8	in	in	ADP
brj-23886	118	9	table	table	NOUN
brj-23886	118	10	2	2	NUM
brj-23886	118	11	.	.	PUNCT
brj-23886	118	12	table	table	NOUN
brj-23886	118	13	2	2	NUM
brj-23886	118	14	.	.	PUNCT
brj-23886	118	15	primer	primer	NOUN
brj-23886	118	16	design	design	NOUN
brj-23886	118	17	target	target	NOUN
brj-23886	118	18	sequence	sequence	NOUN
brj-23886	118	19	sequence	sequence	NOUN
brj-23886	118	20	length	length	NOUN
brj-23886	118	21	(	(	PUNCT
brj-23886	118	22	bp	bp	PROPN
brj-23886	118	23	)	)	PUNCT
brj-23886	118	24	primer	primer	NOUN
brj-23886	118	25	16s	16s	PROPN
brj-23886	118	26	rrna	rrna	VERB
brj-23886	118	27	93	93	NUM
brj-23886	118	28	upstream	upstream	NOUN
brj-23886	118	29	primer	primer	NOUN
brj-23886	118	30	:	:	PUNCT
brj-23886	118	31	cgggtgttgcagactctcaggtgt	cgggtgttgcagactctcaggtgt	ADJ
brj-23886	118	32	downstream	downstream	ADJ
brj-23886	118	33	primer	primer	NOUN
brj-23886	118	34	:	:	PUNCT
brj-23886	118	35	agtavggccgcaaggttgaaactca	agtavggccgcaaggttgaaactca	NOUN
brj-23886	118	36	adh	adh	NOUN
brj-23886	118	37	152	152	NUM
brj-23886	118	38	upstream	upstream	NOUN
brj-23886	118	39	primer	primer	NOUN
brj-23886	118	40	:	:	PUNCT
brj-23886	118	41	cgggtgttgcagactctcaggtgt	cgggtgttgcagactctcaggtgt	ADJ
brj-23886	118	42	downstream	downstream	ADJ
brj-23886	118	43	primer	primer	NOUN
brj-23886	118	44	:	:	PUNCT
brj-23886	118	45	agtavggccgcaaggttgaaactca	agtavggccgcaaggttgaaactca	PROPN
brj-23886	118	46	pfk	pfk	PROPN
brj-23886	118	47	252	252	NUM
brj-23886	118	48	upstream	upstream	ADJ
brj-23886	118	49	primer	primer	NOUN
brj-23886	118	50	:	:	PUNCT
brj-23886	118	51	ggagcaagagacatcagcaaact	ggagcaagagacatcagcaaact	NOUN
brj-23886	118	52	downstream	downstream	PROPN
brj-23886	118	53	primer	primer	NOUN
brj-23886	118	54	:	:	PUNCT
brj-23886	118	55	cagaacgacagcctcagcacct	cagaacgacagcctcagcacct	PROPN
brj-23886	118	56	pfo	pfo	NOUN
brj-23886	118	57	165	165	NUM
brj-23886	118	58	upstream	upstream	NOUN
brj-23886	118	59	primer	primer	NOUN
brj-23886	118	60	:	:	PUNCT
brj-23886	118	61	ggacaacaaagatgaggctgaa	ggacaacaaagatgaggctgaa	NOUN
brj-23886	118	62	downstream	downstream	PROPN
brj-23886	118	63	primer	primer	NOUN
brj-23886	118	64	:	:	PUNCT
brj-23886	118	65	gcccatccgtctccaccta	gcccatccgtctccaccta	NOUN
brj-23886	118	66	the	the	DET
brj-23886	118	67	cdna	cdna	PROPN
brj-23886	118	68	synthesized	synthesize	VERB
brj-23886	118	69	by	by	ADP
brj-23886	118	70	reverse	reverse	ADJ
brj-23886	118	71	transcription	transcription	NOUN
brj-23886	118	72	of	of	ADP
brj-23886	118	73	rna	rna	NOUN
brj-23886	118	74	from	from	ADP
brj-23886	118	75	c0	c0	PROPN
brj-23886	118	76	and	and	CCONJ
brj-23886	118	77	c3	c3	PROPN
brj-23886	118	78	was	be	AUX
brj-23886	118	79	used	use	VERB
brj-23886	118	80	as	as	ADP
brj-23886	118	81	template	template	NOUN
brj-23886	118	82	and	and	CCONJ
brj-23886	118	83	amplified	amplify	VERB
brj-23886	118	84	by	by	ADP
brj-23886	118	85	rt	rt	ADJ
brj-23886	118	86	-	-	PUNCT
brj-23886	118	87	pcr	pcr	NOUN
brj-23886	118	88	reaction	reaction	NOUN
brj-23886	118	89	using	use	VERB
brj-23886	118	90	a	a	DET
brj-23886	118	91	fluorescent	fluorescent	ADJ
brj-23886	118	92	quantitative	quantitative	ADJ
brj-23886	118	93	pcr	pcr	NOUN
brj-23886	118	94	instrument	instrument	NOUN
brj-23886	118	95	(	(	PUNCT
brj-23886	118	96	bio	bio	NOUN
brj-23886	118	97	-	-	PROPN
brj-23886	118	98	rad	rad	PROPN
brj-23886	118	99	,	,	PUNCT
brj-23886	118	100	hercules	hercule	NOUN
brj-23886	118	101	,	,	PUNCT
brj-23886	118	102	ca	ca	PROPN
brj-23886	118	103	,	,	PUNCT
brj-23886	118	104	usa	usa	PROPN
brj-23886	118	105	)	)	PUNCT
brj-23886	118	106	,	,	PUNCT
brj-23886	118	107	and	and	CCONJ
brj-23886	118	108	the	the	DET
brj-23886	118	109	pcr	pcr	ADJ
brj-23886	118	110	reaction	reaction	NOUN
brj-23886	118	111	system	system	NOUN
brj-23886	118	112	was	be	AUX
brj-23886	118	113	the	the	DET
brj-23886	118	114	same	same	ADJ
brj-23886	118	115	as	as	ADP
brj-23886	118	116	above	above	ADV
brj-23886	118	117	.	.	PUNCT
brj-23886	119	1	the	the	DET
brj-23886	119	2	reaction	reaction	NOUN
brj-23886	119	3	system	system	NOUN
brj-23886	119	4	consisted	consist	VERB
brj-23886	119	5	of	of	ADP
brj-23886	119	6	10	10	NUM
brj-23886	119	7	μl	μl	ADP
brj-23886	119	8	light	light	ADJ
brj-23886	119	9	cycler	cycler	NOUN
brj-23886	119	10	480	480	NUM
brj-23886	119	11	mix	mix	NOUN
brj-23886	119	12	dyes	dye	NOUN
brj-23886	119	13	,	,	PUNCT
brj-23886	119	14	5	5	NUM
brj-23886	119	15	μl	μl	PRON
brj-23886	119	16	cdna	cdna	PROPN
brj-23886	119	17	template	template	NOUN
brj-23886	119	18	,	,	PUNCT
brj-23886	119	19	1	1	NUM
brj-23886	119	20	μl	μl	PRON
brj-23886	119	21	upstream	upstream	ADJ
brj-23886	119	22	primer	primer	NOUN
brj-23886	119	23	,	,	PUNCT
brj-23886	119	24	1	1	NUM
brj-23886	119	25	μl	μl	ADP
brj-23886	119	26	downstream	downstream	ADJ
brj-23886	119	27	primer	primer	NOUN
brj-23886	119	28	,	,	PUNCT
brj-23886	119	29	and	and	CCONJ
brj-23886	119	30	3	3	NUM
brj-23886	119	31	μl	μl	ADP
brj-23886	119	32	light	light	ADJ
brj-23886	119	33	cycler	cycler	NOUN
brj-23886	119	34	480	480	NUM
brj-23886	119	35	depc	depc	PROPN
brj-23886	119	36	h2o	h2o	PROPN
brj-23886	119	37	.	.	PUNCT
brj-23886	120	1	the	the	DET
brj-23886	120	2	standard	standard	ADJ
brj-23886	120	3	curve	curve	NOUN
brj-23886	120	4	was	be	AUX
brj-23886	120	5	plotted	plot	VERB
brj-23886	120	6	according	accord	VERB
brj-23886	120	7	to	to	ADP
brj-23886	120	8	the	the	DET
brj-23886	120	9	logarithm	logarithm	NOUN
brj-23886	120	10	of	of	ADP
brj-23886	120	11	the	the	DET
brj-23886	120	12	copy	copy	NOUN
brj-23886	120	13	number	number	NOUN
brj-23886	120	14	of	of	ADP
brj-23886	120	15	the	the	DET
brj-23886	120	16	standards	standard	NOUN
brj-23886	120	17	and	and	CCONJ
brj-23886	120	18	the	the	DET
brj-23886	120	19	ct	ct	PROPN
brj-23886	120	20	value	value	NOUN
brj-23886	120	21	.	.	PUNCT
brj-23886	121	1	the	the	DET
brj-23886	121	2	16s	16s	PROPN
brj-23886	121	3	rrna	rrna	PROPN
brj-23886	121	4	genes	gene	NOUN
brj-23886	121	5	were	be	AUX
brj-23886	121	6	used	use	VERB
brj-23886	121	7	as	as	ADP
brj-23886	121	8	internal	internal	ADJ
brj-23886	121	9	reference	reference	NOUN
brj-23886	121	10	genes	gene	NOUN
brj-23886	121	11	to	to	PART
brj-23886	121	12	analyze	analyze	VERB
brj-23886	121	13	the	the	DET
brj-23886	121	14	relative	relative	ADJ
brj-23886	121	15	expression	expression	NOUN
brj-23886	121	16	of	of	ADP
brj-23886	121	17	adh	adh	PROPN
brj-23886	121	18	,	,	PUNCT
brj-23886	121	19	pfo	pfo	NOUN
brj-23886	121	20	,	,	PUNCT
brj-23886	121	21	and	and	CCONJ
brj-23886	121	22	pfk	pfk	PROPN
brj-23886	121	23	gene	gene	NOUN
brj-23886	121	24	mrna	mrna	PROPN
brj-23886	121	25	in	in	ADP
brj-23886	121	26	c0	c0	PROPN
brj-23886	121	27	and	and	CCONJ
brj-23886	121	28	c3	c3	PROPN
brj-23886	121	29	according	accord	VERB
brj-23886	121	30	to	to	ADP
brj-23886	121	31	the	the	DET
brj-23886	121	32	2	2	NUM
brj-23886	121	33	-	-	PUNCT
brj-23886	121	34	δδct	δδct	NOUN
brj-23886	121	35	method	method	NOUN
brj-23886	121	36	.	.	PUNCT
brj-23886	122	1	determination	determination	NOUN
brj-23886	122	2	of	of	ADP
brj-23886	122	3	key	key	ADJ
brj-23886	122	4	enzyme	enzyme	NOUN
brj-23886	122	5	activity	activity	NOUN
brj-23886	122	6	the	the	DET
brj-23886	122	7	supernatant	supernatant	NOUN
brj-23886	122	8	was	be	AUX
brj-23886	122	9	removed	remove	VERB
brj-23886	122	10	through	through	ADP
brj-23886	122	11	the	the	DET
brj-23886	122	12	centrifugation	centrifugation	NOUN
brj-23886	122	13	of	of	ADP
brj-23886	122	14	25	25	NUM
brj-23886	122	15	ml	ml	NOUN
brj-23886	122	16	of	of	ADP
brj-23886	122	17	log	log	NOUN
brj-23886	122	18	-	-	PUNCT
brj-23886	122	19	phase	phase	NOUN
brj-23886	122	20	bacterial	bacterial	ADJ
brj-23886	122	21	suspension	suspension	NOUN
brj-23886	122	22	,	,	PUNCT
brj-23886	122	23	followed	follow	VERB
brj-23886	122	24	by	by	ADP
brj-23886	122	25	multiple	multiple	ADJ
brj-23886	122	26	rinses	rinse	NOUN
brj-23886	122	27	of	of	ADP
brj-23886	122	28	the	the	DET
brj-23886	122	29	bacterial	bacterial	ADJ
brj-23886	122	30	pellet	pellet	NOUN
brj-23886	122	31	with	with	ADP
brj-23886	122	32	a	a	DET
brj-23886	122	33	0.1	0.1	NUM
brj-23886	122	34	mol	mol	ADP
brj-23886	122	35	/	/	SYM
brj-23886	122	36	l	l	NOUN
brj-23886	122	37	tris	tris	PROPN
brj-23886	122	38	-	-	PUNCT
brj-23886	122	39	hcl	hcl	NOUN
brj-23886	122	40	buffer	buffer	NOUN
brj-23886	122	41	solution	solution	NOUN
brj-23886	122	42	(	(	PUNCT
brj-23886	122	43	ph	ph	NOUN
brj-23886	122	44	7.6	7.6	NUM
brj-23886	122	45	)	)	PUNCT
brj-23886	122	46	.	.	PUNCT
brj-23886	123	1	subsequently	subsequently	ADV
brj-23886	123	2	,	,	PUNCT
brj-23886	123	3	1.5	1.5	NUM
brj-23886	123	4	times	time	NOUN
brj-23886	123	5	the	the	DET
brj-23886	123	6	volume	volume	NOUN
brj-23886	123	7	of	of	ADP
brj-23886	123	8	the	the	DET
brj-23886	123	9	precipitate	precipitate	NOUN
brj-23886	123	10	was	be	AUX
brj-23886	123	11	added	add	VERB
brj-23886	123	12	,	,	PUNCT
brj-23886	123	13	and	and	CCONJ
brj-23886	123	14	the	the	DET
brj-23886	123	15	cells	cell	NOUN
brj-23886	123	16	were	be	AUX
brj-23886	123	17	lysed	lyse	VERB
brj-23886	123	18	under	under	ADP
brj-23886	123	19	ice	ice	NOUN
brj-23886	123	20	bath	bath	NOUN
brj-23886	123	21	conditions	condition	NOUN
brj-23886	123	22	.	.	PUNCT
brj-23886	124	1	the	the	DET
brj-23886	124	2	mixture	mixture	NOUN
brj-23886	124	3	was	be	AUX
brj-23886	124	4	then	then	ADV
brj-23886	124	5	centrifuged	centrifuge	VERB
brj-23886	124	6	for	for	ADP
brj-23886	124	7	30	30	NUM
brj-23886	124	8	minutes	minute	NOUN
brj-23886	124	9	,	,	PUNCT
brj-23886	124	10	yielding	yield	VERB
brj-23886	124	11	the	the	DET
brj-23886	124	12	intracellular	intracellular	ADJ
brj-23886	124	13	crude	crude	ADJ
brj-23886	124	14	enzyme	enzyme	NOUN
brj-23886	124	15	solution	solution	NOUN
brj-23886	124	16	as	as	ADP
brj-23886	124	17	the	the	DET
brj-23886	124	18	resulting	result	VERB
brj-23886	124	19	supernatant	supernatant	NOUN
brj-23886	124	20	.	.	PUNCT
brj-23886	125	1	the	the	DET
brj-23886	125	2	enzyme	enzyme	NOUN
brj-23886	125	3	activity	activity	NOUN
brj-23886	125	4	of	of	ADP
brj-23886	125	5	intracellular	intracellular	ADJ
brj-23886	125	6	crude	crude	ADJ
brj-23886	125	7	enzyme	enzyme	NOUN
brj-23886	125	8	solution	solution	NOUN
brj-23886	125	9	was	be	AUX
brj-23886	125	10	determined	determine	VERB
brj-23886	125	11	by	by	ADP
brj-23886	125	12	the	the	DET
brj-23886	125	13	reaction	reaction	NOUN
brj-23886	125	14	system	system	NOUN
brj-23886	125	15	in	in	ADP
brj-23886	125	16	table	table	NOUN
brj-23886	125	17	3	3	NUM
brj-23886	125	18	.	.	PUNCT
brj-23886	125	19	table	table	NOUN
brj-23886	125	20	3	3	NUM
brj-23886	125	21	.	.	PUNCT
brj-23886	125	22	enzyme	enzyme	NOUN
brj-23886	125	23	reaction	reaction	NOUN
brj-23886	125	24	system	system	NOUN
brj-23886	125	25	enzymes	enzyme	NOUN
brj-23886	125	26	reaction	reaction	NOUN
brj-23886	125	27	system	system	NOUN
brj-23886	125	28	adh	adh	X
brj-23886	125	29	0.1	0.1	NUM
brj-23886	125	30	mol	mol	ADP
brj-23886	125	31	/	/	SYM
brj-23886	125	32	l	l	NOUN
brj-23886	125	33	tris	tris	PROPN
brj-23886	125	34	-	-	PUNCT
brj-23886	125	35	hcl	hcl	PROPN
brj-23886	125	36	(	(	PUNCT
brj-23886	125	37	ph	ph	NOUN
brj-23886	125	38	7.6	7.6	NUM
brj-23886	125	39	)	)	PUNCT
brj-23886	125	40	buffer	buffer	NOUN
brj-23886	125	41	,	,	PUNCT
brj-23886	125	42	0.01	0.01	NUM
brj-23886	125	43	mol	mol	NOUN
brj-23886	125	44	/	/	SYM
brj-23886	125	45	l	l	NOUN
brj-23886	125	46	dtt	dtt	NOUN
brj-23886	125	47	buffer	buffer	NOUN
brj-23886	125	48	,	,	PUNCT
brj-23886	125	49	0.5	0.5	NUM
brj-23886	125	50	mmol	mmol	NOUN
brj-23886	125	51	/	/	SYM
brj-23886	125	52	l	l	NOUN
brj-23886	125	53	nad(p)h	nad(p)h	NOUN
brj-23886	125	54	,	,	PUNCT
brj-23886	125	55	0.055	0.055	NUM
brj-23886	125	56	mol	mol	ADP
brj-23886	125	57	/	/	SYM
brj-23886	125	58	l	l	NOUN
brj-23886	125	59	acetaldehyde	acetaldehyde	NOUN
brj-23886	125	60	,	,	PUNCT
brj-23886	125	61	crude	crude	ADJ
brj-23886	125	62	enzyme	enzyme	NOUN
brj-23886	125	63	solution	solution	NOUN
brj-23886	125	64	pfo	pfo	NOUN
brj-23886	125	65	0.1	0.1	NUM
brj-23886	125	66	mol	mol	ADP
brj-23886	125	67	/	/	SYM
brj-23886	125	68	l	l	NOUN
brj-23886	125	69	tris	tris	PROPN
brj-23886	125	70	-	-	PUNCT
brj-23886	125	71	hcl	hcl	PROPN
brj-23886	125	72	(	(	PUNCT
brj-23886	125	73	ph	ph	NOUN
brj-23886	125	74	7.6	7.6	NUM
brj-23886	125	75	)	)	PUNCT
brj-23886	125	76	buffer	buffer	NOUN
brj-23886	125	77	,	,	PUNCT
brj-23886	125	78	0.1	0.1	NUM
brj-23886	125	79	mmol	mmol	NOUN
brj-23886	125	80	/	/	SYM
brj-23886	125	81	l	l	NOUN
brj-23886	125	82	coa	coa	NOUN
brj-23886	125	83	,	,	PUNCT
brj-23886	125	84	0.020	0.020	NUM
brj-23886	125	85	mol	mol	NOUN
brj-23886	125	86	/	/	SYM
brj-23886	125	87	l	l	NOUN
brj-23886	125	88	dtt	dtt	NOUN
brj-23886	125	89	buffer	buffer	NOUN
brj-23886	125	90	,	,	PUNCT
brj-23886	125	91	2	2	NUM
brj-23886	125	92	mmol	mmol	NOUN
brj-23886	125	93	/	/	SYM
brj-23886	125	94	l	l	NOUN
brj-23886	125	95	methylviologen	methylviologen	NOUN
brj-23886	125	96	,	,	PUNCT
brj-23886	125	97	5	5	NUM
brj-23886	125	98	mmol	mmol	NOUN
brj-23886	125	99	/	/	SYM
brj-23886	125	100	l	l	NOUN
brj-23886	125	101	pyruvic	pyruvic	ADJ
brj-23886	125	102	acid	acid	NOUN
brj-23886	125	103	,	,	PUNCT
brj-23886	125	104	crude	crude	ADJ
brj-23886	125	105	enzyme	enzyme	NOUN
brj-23886	125	106	solution	solution	NOUN
brj-23886	125	107	pfk	pfk	PROPN
brj-23886	125	108	0.1	0.1	NUM
brj-23886	125	109	mol	mol	ADP
brj-23886	125	110	/	/	SYM
brj-23886	125	111	l	l	NOUN
brj-23886	125	112	tris	tris	PROPN
brj-23886	125	113	-	-	PUNCT
brj-23886	125	114	hcl	hcl	PROPN
brj-23886	125	115	(	(	PUNCT
brj-23886	125	116	ph	ph	NOUN
brj-23886	125	117	7.6	7.6	NUM
brj-23886	125	118	)	)	PUNCT
brj-23886	125	119	buffer，0.01	buffer，0.01	PRON
brj-23886	125	120	mol	mol	NOUN
brj-23886	125	121	/	/	SYM
brj-23886	125	122	l	l	NOUN
brj-23886	125	123	dtt	dtt	NOUN
brj-23886	125	124	buffer	buffer	NOUN
brj-23886	125	125	,	,	PUNCT
brj-23886	125	126	2	2	NUM
brj-23886	125	127	mmol	mmol	NOUN
brj-23886	125	128	/	/	SYM
brj-23886	125	129	l	l	NOUN
brj-23886	125	130	atp	atp	PROPN
brj-23886	125	131	,	,	PUNCT
brj-23886	125	132	5	5	NUM
brj-23886	125	133	mmol	mmol	NOUN
brj-23886	125	134	/	/	SYM
brj-23886	125	135	l	l	NOUN
brj-23886	125	136	mgso4	mgso4	PROPN
brj-23886	125	137	,	,	PUNCT
brj-23886	125	138	0.3	0.3	NUM
brj-23886	125	139	mmol	mmol	NOUN
brj-23886	125	140	/	/	SYM
brj-23886	125	141	l	l	NOUN
brj-23886	125	142	nadh	nadh	NOUN
brj-23886	125	143	,	,	PUNCT
brj-23886	125	144	0.05	0.05	NUM
brj-23886	125	145	mol	mol	NOUN
brj-23886	125	146	/	/	SYM
brj-23886	125	147	l	l	NOUN
brj-23886	125	148	kcl	kcl	NOUN
brj-23886	125	149	,	,	PUNCT
brj-23886	125	150	2	2	NUM
brj-23886	125	151	u	u	NOUN
brj-23886	125	152	aldolase	aldolase	NOUN
brj-23886	125	153	,	,	PUNCT
brj-23886	125	154	2	2	NUM
brj-23886	125	155	u	u	NOUN
brj-23886	125	156	phosphoglyceraldehyde	phosphoglyceraldehyde	ADJ
brj-23886	125	157	isomerase,10	isomerase,10	NOUN
brj-23886	125	158	u	u	NOUN
brj-23886	125	159	glycerol	glycerol	NOUN
brj-23886	125	160	phosphate	phosphate	NOUN
brj-23886	125	161	,	,	PUNCT
brj-23886	125	162	crude	crude	ADJ
brj-23886	125	163	enzyme	enzyme	NOUN
brj-23886	125	164	solution	solution	NOUN
brj-23886	125	165	peer	peer	NOUN
brj-23886	125	166	-	-	PUNCT
brj-23886	125	167	reviewed	review	VERB
brj-23886	125	168	article	article	NOUN
brj-23886	125	169	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	125	170	cui	cui	PROPN
brj-23886	125	171	et	et	PROPN
brj-23886	125	172	al	al	PROPN
brj-23886	125	173	.	.	PROPN
brj-23886	126	1	(	(	PUNCT
brj-23886	126	2	2025	2025	NUM
brj-23886	126	3	)	)	PUNCT
brj-23886	126	4	.	.	PUNCT
brj-23886	127	1	“	"	PUNCT
brj-23886	127	2	genome	genome	NOUN
brj-23886	127	3	study	study	NOUN
brj-23886	127	4	of	of	ADP
brj-23886	127	5	c.	c.	PROPN
brj-23886	127	6	thermocellum	thermocellum	PROPN
brj-23886	127	7	,	,	PUNCT
brj-23886	127	8	”	"	PUNCT
brj-23886	127	9	bioresources	bioresource	NOUN
brj-23886	127	10	20(2	20(2	NUM
brj-23886	127	11	)	)	PUNCT
brj-23886	127	12	,	,	PUNCT
brj-23886	127	13	3155	3155	NUM
brj-23886	127	14	-	-	SYM
brj-23886	127	15	3175	3175	NUM
brj-23886	127	16	.	.	PUNCT
brj-23886	128	1	3162	3162	NUM
brj-23886	128	2	the	the	DET
brj-23886	128	3	enzymatic	enzymatic	ADJ
brj-23886	128	4	activity	activity	NOUN
brj-23886	128	5	of	of	ADP
brj-23886	128	6	adh	adh	NOUN
brj-23886	128	7	was	be	AUX
brj-23886	128	8	determined	determine	VERB
brj-23886	128	9	by	by	ADP
brj-23886	128	10	reference	reference	NOUN
brj-23886	128	11	to	to	ADP
brj-23886	128	12	the	the	DET
brj-23886	128	13	method	method	NOUN
brj-23886	128	14	of	of	ADP
brj-23886	128	15	brown	brown	PROPN
brj-23886	128	16	et	et	PROPN
brj-23886	128	17	al	al	PROPN
brj-23886	128	18	.	.	PROPN
brj-23886	129	1	(	(	PUNCT
brj-23886	129	2	2011	2011	NUM
brj-23886	129	3	)	)	PUNCT
brj-23886	129	4	.	.	PUNCT
brj-23886	130	1	the	the	DET
brj-23886	130	2	enzymatic	enzymatic	ADJ
brj-23886	130	3	activity	activity	NOUN
brj-23886	130	4	of	of	ADP
brj-23886	130	5	pfo	pfo	PROPN
brj-23886	130	6	was	be	AUX
brj-23886	130	7	determined	determine	VERB
brj-23886	130	8	by	by	ADP
brj-23886	130	9	reference	reference	NOUN
brj-23886	130	10	to	to	ADP
brj-23886	130	11	the	the	DET
brj-23886	130	12	method	method	NOUN
brj-23886	130	13	of	of	ADP
brj-23886	130	14	shaw	shaw	PROPN
brj-23886	130	15	et	et	PROPN
brj-23886	130	16	al	al	PROPN
brj-23886	130	17	.	.	PROPN
brj-23886	131	1	(	(	PUNCT
brj-23886	131	2	2008	2008	NUM
brj-23886	131	3	)	)	PUNCT
brj-23886	131	4	.	.	PUNCT
brj-23886	132	1	the	the	DET
brj-23886	132	2	enzymatic	enzymatic	ADJ
brj-23886	132	3	activity	activity	NOUN
brj-23886	132	4	of	of	ADP
brj-23886	132	5	pfk	pfk	PROPN
brj-23886	132	6	was	be	AUX
brj-23886	132	7	determined	determine	VERB
brj-23886	132	8	by	by	ADP
brj-23886	132	9	reference	reference	NOUN
brj-23886	132	10	to	to	ADP
brj-23886	132	11	the	the	DET
brj-23886	132	12	method	method	NOUN
brj-23886	132	13	of	of	ADP
brj-23886	132	14	sridhar	sridhar	PROPN
brj-23886	132	15	et	et	PROPN
brj-23886	132	16	al	al	PROPN
brj-23886	132	17	.	.	PROPN
brj-23886	133	1	(	(	PUNCT
brj-23886	133	2	2000	2000	NUM
brj-23886	133	3	)	)	PUNCT
brj-23886	133	4	.	.	PUNCT
brj-23886	134	1	comparative	comparative	ADJ
brj-23886	134	2	genomic	genomic	ADJ
brj-23886	134	3	analysis	analysis	NOUN
brj-23886	134	4	c0	c0	NOUN
brj-23886	134	5	and	and	CCONJ
brj-23886	134	6	c1	c1	PROPN
brj-23886	134	7	strains	strain	NOUN
brj-23886	134	8	were	be	AUX
brj-23886	134	9	cultured	cultured	ADJ
brj-23886	134	10	to	to	PART
brj-23886	134	11	logarithmic	logarithmic	ADJ
brj-23886	134	12	phase	phase	NOUN
brj-23886	134	13	,	,	PUNCT
brj-23886	134	14	then	then	ADV
brj-23886	134	15	1	1	NUM
brj-23886	134	16	ml	ml	NOUN
brj-23886	134	17	of	of	ADP
brj-23886	134	18	bacterial	bacterial	ADJ
brj-23886	134	19	broth	broth	NOUN
brj-23886	134	20	was	be	AUX
brj-23886	134	21	taken	take	VERB
brj-23886	134	22	,	,	PUNCT
brj-23886	134	23	and	and	CCONJ
brj-23886	134	24	the	the	DET
brj-23886	134	25	whole	whole	ADJ
brj-23886	134	26	genomic	genomic	ADJ
brj-23886	134	27	dna	dna	NOUN
brj-23886	134	28	of	of	ADP
brj-23886	134	29	both	both	DET
brj-23886	134	30	strains	strain	NOUN
brj-23886	134	31	was	be	AUX
brj-23886	134	32	extracted	extract	VERB
brj-23886	134	33	using	use	VERB
brj-23886	134	34	the	the	DET
brj-23886	134	35	bacterial	bacterial	ADJ
brj-23886	134	36	whole	whole	ADJ
brj-23886	134	37	genome	genome	NOUN
brj-23886	134	38	dna	dna	NOUN
brj-23886	134	39	extraction	extraction	NOUN
brj-23886	134	40	kit	kit	NOUN
brj-23886	134	41	,	,	PUNCT
brj-23886	134	42	and	and	CCONJ
brj-23886	134	43	sequenced	sequence	VERB
brj-23886	134	44	by	by	ADP
brj-23886	134	45	beijing	beijing	PROPN
brj-23886	134	46	novogene	novogene	PROPN
brj-23886	134	47	technology	technology	PROPN
brj-23886	134	48	co.	co.	PROPN
brj-23886	134	49	the	the	DET
brj-23886	134	50	single	single	ADJ
brj-23886	134	51	nucleotide	nucleotide	ADJ
brj-23886	134	52	polymorphism	polymorphism	NOUN
brj-23886	134	53	(	(	PUNCT
brj-23886	134	54	snp	snp	ADJ
brj-23886	134	55	)	)	PUNCT
brj-23886	134	56	,	,	PUNCT
brj-23886	134	57	insertion	insertion	NOUN
brj-23886	134	58	and	and	CCONJ
brj-23886	134	59	deletion	deletion	NOUN
brj-23886	134	60	(	(	PUNCT
brj-23886	134	61	indels	indel	NOUN
brj-23886	134	62	)	)	PUNCT
brj-23886	134	63	,	,	PUNCT
brj-23886	134	64	and	and	CCONJ
brj-23886	134	65	structural	structural	ADJ
brj-23886	134	66	variation	variation	NOUN
brj-23886	134	67	(	(	PUNCT
brj-23886	134	68	sv	sv	NOUN
brj-23886	134	69	)	)	PUNCT
brj-23886	134	70	analyses	analysis	NOUN
brj-23886	134	71	were	be	AUX
brj-23886	134	72	performed	perform	VERB
brj-23886	134	73	on	on	ADP
brj-23886	134	74	the	the	DET
brj-23886	134	75	sequencing	sequence	VERB
brj-23886	134	76	results	result	NOUN
brj-23886	134	77	.	.	PUNCT
brj-23886	135	1	based	base	VERB
brj-23886	135	2	on	on	ADP
brj-23886	135	3	the	the	DET
brj-23886	135	4	positional	positional	ADJ
brj-23886	135	5	relationships	relationship	NOUN
brj-23886	135	6	and	and	CCONJ
brj-23886	135	7	interactions	interaction	NOUN
brj-23886	135	8	between	between	ADP
brj-23886	135	9	snps	snps	PROPN
brj-23886	135	10	and	and	CCONJ
brj-23886	135	11	genes	gene	NOUN
brj-23886	135	12	,	,	PUNCT
brj-23886	135	13	gene	gene	NOUN
brj-23886	135	14	prediction	prediction	NOUN
brj-23886	135	15	and	and	CCONJ
brj-23886	135	16	annotation	annotation	NOUN
brj-23886	135	17	analyses	analysis	NOUN
brj-23886	135	18	were	be	AUX
brj-23886	135	19	performed	perform	VERB
brj-23886	135	20	using	use	VERB
brj-23886	135	21	databases	database	NOUN
brj-23886	135	22	,	,	PUNCT
brj-23886	135	23	such	such	ADJ
brj-23886	135	24	as	as	ADP
brj-23886	135	25	rapid	rapid	ADJ
brj-23886	135	26	annotation	annotation	NOUN
brj-23886	135	27	using	use	VERB
brj-23886	135	28	subsystem	subsystem	NOUN
brj-23886	135	29	technology	technology	NOUN
brj-23886	135	30	(	(	PUNCT
brj-23886	135	31	rast	rast	PROPN
brj-23886	135	32	)	)	PUNCT
brj-23886	135	33	,	,	PUNCT
brj-23886	135	34	kyoto	kyoto	PROPN
brj-23886	135	35	encyclopedia	encyclopedia	NOUN
brj-23886	135	36	of	of	ADP
brj-23886	135	37	genes	gene	NOUN
brj-23886	135	38	and	and	CCONJ
brj-23886	135	39	genomes	genome	NOUN
brj-23886	135	40	(	(	PUNCT
brj-23886	135	41	kegg	kegg	NOUN
brj-23886	135	42	)	)	PUNCT
brj-23886	135	43	,	,	PUNCT
brj-23886	135	44	and	and	CCONJ
brj-23886	135	45	the	the	DET
brj-23886	135	46	protein	protein	NOUN
brj-23886	135	47	sequence	sequence	NOUN
brj-23886	135	48	database	database	NOUN
brj-23886	135	49	(	(	PUNCT
brj-23886	135	50	swissprot	swissprot	NOUN
brj-23886	135	51	)	)	PUNCT
brj-23886	135	52	for	for	ADP
brj-23886	135	53	gene	gene	NOUN
brj-23886	135	54	prediction	prediction	NOUN
brj-23886	135	55	and	and	CCONJ
brj-23886	135	56	annotation	annotation	NOUN
brj-23886	135	57	analysis	analysis	NOUN
brj-23886	135	58	to	to	PART
brj-23886	135	59	resolve	resolve	VERB
brj-23886	135	60	genome	genome	NOUN
brj-23886	135	61	-	-	PUNCT
brj-23886	135	62	level	level	NOUN
brj-23886	135	63	changes	change	NOUN
brj-23886	135	64	in	in	ADP
brj-23886	135	65	the	the	DET
brj-23886	135	66	strains	strain	NOUN
brj-23886	135	67	before	before	ADP
brj-23886	135	68	and	and	CCONJ
brj-23886	135	69	after	after	ADP
brj-23886	135	70	mutagenesis	mutagenesis	NOUN
brj-23886	135	71	.	.	PUNCT
brj-23886	136	1	knocking	knock	VERB
brj-23886	136	2	out	out	ADP
brj-23886	136	3	key	key	ADJ
brj-23886	136	4	enzyme	enzyme	NOUN
brj-23886	136	5	genes	gene	NOUN
brj-23886	136	6	c.	c.	PROPN
brj-23886	136	7	thermocellum	thermocellum	PROPN
brj-23886	136	8	c0	c0	PROPN
brj-23886	136	9	genomic	genomic	PROPN
brj-23886	136	10	dna	dna	PROPN
brj-23886	136	11	was	be	AUX
brj-23886	136	12	used	use	VERB
brj-23886	136	13	as	as	ADP
brj-23886	136	14	the	the	DET
brj-23886	136	15	template	template	NOUN
brj-23886	136	16	to	to	PART
brj-23886	136	17	amplify	amplify	VERB
brj-23886	136	18	the	the	DET
brj-23886	136	19	upstream	upstream	NOUN
brj-23886	136	20	a	a	DET
brj-23886	136	21	fragment	fragment	NOUN
brj-23886	136	22	and	and	CCONJ
brj-23886	136	23	downstream	downstream	ADJ
brj-23886	136	24	b	b	NOUN
brj-23886	136	25	fragment	fragment	NOUN
brj-23886	136	26	of	of	ADP
brj-23886	136	27	the	the	DET
brj-23886	136	28	target	target	NOUN
brj-23886	136	29	gene	gene	NOUN
brj-23886	136	30	,	,	PUNCT
brj-23886	136	31	respectively	respectively	ADV
brj-23886	136	32	.	.	PUNCT
brj-23886	137	1	the	the	DET
brj-23886	137	2	reaction	reaction	NOUN
brj-23886	137	3	system	system	NOUN
brj-23886	137	4	consisted	consist	VERB
brj-23886	137	5	of	of	ADP
brj-23886	137	6	10	10	NUM
brj-23886	137	7	μl	μl	INTJ
brj-23886	137	8	exq	exq	NOUN
brj-23886	137	9	mix	mix	NOUN
brj-23886	137	10	dyes	dye	NOUN
brj-23886	137	11	,	,	PUNCT
brj-23886	137	12	2	2	NUM
brj-23886	137	13	μl	μl	ADP
brj-23886	137	14	dna	dna	PROPN
brj-23886	137	15	template	template	NOUN
brj-23886	137	16	,	,	PUNCT
brj-23886	137	17	0.5	0.5	NUM
brj-23886	137	18	μl	μl	PRON
brj-23886	137	19	upstream	upstream	NOUN
brj-23886	137	20	primer	primer	NOUN
brj-23886	137	21	,	,	PUNCT
brj-23886	137	22	0.5	0.5	NUM
brj-23886	137	23	μl	μl	ADP
brj-23886	137	24	downstream	downstream	ADJ
brj-23886	137	25	primer	primer	NOUN
brj-23886	137	26	,	,	PUNCT
brj-23886	137	27	and	and	CCONJ
brj-23886	137	28	7	7	NUM
brj-23886	137	29	μl	μl	ADP
brj-23886	137	30	ddh2o	ddh2o	PROPN
brj-23886	137	31	.	.	PUNCT
brj-23886	138	1	the	the	DET
brj-23886	138	2	pcr	pcr	PROPN
brj-23886	138	3	reaction	reaction	NOUN
brj-23886	138	4	system	system	NOUN
brj-23886	138	5	was	be	AUX
brj-23886	138	6	as	as	SCONJ
brj-23886	138	7	follows	follow	VERB
brj-23886	138	8	:	:	PUNCT
brj-23886	138	9	94	94	NUM
brj-23886	138	10	°	°	NUM
brj-23886	138	11	c	c	NOUN
brj-23886	138	12	for	for	ADP
brj-23886	138	13	120	120	NUM
brj-23886	138	14	s	s	NOUN
brj-23886	138	15	,	,	PUNCT
brj-23886	138	16	followed	follow	VERB
brj-23886	138	17	by	by	ADP
brj-23886	138	18	30	30	NUM
brj-23886	138	19	cycles	cycle	NOUN
brj-23886	138	20	of	of	ADP
brj-23886	138	21	94	94	NUM
brj-23886	138	22	°	°	ADP
brj-23886	138	23	c	c	NOUN
brj-23886	138	24	for	for	ADP
brj-23886	138	25	30	30	NUM
brj-23886	138	26	s	s	NOUN
brj-23886	138	27	,	,	PUNCT
brj-23886	138	28	59	59	NUM
brj-23886	138	29	°	°	NUM
brj-23886	138	30	c	c	NOUN
brj-23886	138	31	for	for	ADP
brj-23886	138	32	30	30	NUM
brj-23886	138	33	s	s	NOUN
brj-23886	138	34	,	,	PUNCT
brj-23886	138	35	and	and	CCONJ
brj-23886	138	36	72	72	NUM
brj-23886	138	37	°	°	NUM
brj-23886	138	38	c	c	NOUN
brj-23886	138	39	for	for	ADP
brj-23886	138	40	600	600	NUM
brj-23886	138	41	s.	s.	PROPN
brj-23886	138	42	primer	primer	PROPN
brj-23886	138	43	sequences	sequence	NOUN
brj-23886	138	44	are	be	AUX
brj-23886	138	45	shown	show	VERB
brj-23886	138	46	in	in	ADP
brj-23886	138	47	table	table	NOUN
brj-23886	138	48	4	4	NUM
brj-23886	138	49	.	.	PUNCT
brj-23886	139	1	the	the	DET
brj-23886	139	2	amplification	amplification	NOUN
brj-23886	139	3	products	product	NOUN
brj-23886	139	4	were	be	AUX
brj-23886	139	5	identified	identify	VERB
brj-23886	139	6	correctly	correctly	ADV
brj-23886	139	7	by	by	ADP
brj-23886	139	8	agarose	agarose	NOUN
brj-23886	139	9	gel	gel	NOUN
brj-23886	139	10	electrophoresis	electrophoresis	NOUN
brj-23886	139	11	.	.	PUNCT
brj-23886	140	1	the	the	DET
brj-23886	140	2	gel	gel	NOUN
brj-23886	140	3	recovery	recovery	NOUN
brj-23886	140	4	kit	kit	NOUN
brj-23886	140	5	was	be	AUX
brj-23886	140	6	used	use	VERB
brj-23886	140	7	for	for	ADP
brj-23886	140	8	purification	purification	NOUN
brj-23886	140	9	and	and	CCONJ
brj-23886	140	10	the	the	DET
brj-23886	140	11	recovered	recovered	ADJ
brj-23886	140	12	product	product	NOUN
brj-23886	140	13	was	be	AUX
brj-23886	140	14	stored	store	VERB
brj-23886	140	15	at	at	ADP
brj-23886	140	16	-20	-20	NUM
brj-23886	140	17	°	°	PROPN
brj-23886	140	18	c	c	NOUN
brj-23886	140	19	.	.	PUNCT
brj-23886	141	1	table	table	NOUN
brj-23886	141	2	4	4	NUM
brj-23886	141	3	.	.	PUNCT
brj-23886	142	1	arac	arac	PROPN
brj-23886	142	2	,	,	PUNCT
brj-23886	142	3	mcp	mcp	PROPN
brj-23886	142	4	,	,	PUNCT
brj-23886	142	5	and	and	CCONJ
brj-23886	142	6	type	type	VERB
brj-23886	142	7	a	a	DET
brj-23886	142	8	/	/	SYM
brj-23886	142	9	b	b	PROPN
brj-23886	142	10	homology	homology	NOUN
brj-23886	142	11	arm	arm	NOUN
brj-23886	142	12	primer	primer	NOUN
brj-23886	142	13	design	design	NOUN
brj-23886	142	14	enzyme	enzyme	NOUN
brj-23886	142	15	sequence	sequence	NOUN
brj-23886	142	16	length	length	NOUN
brj-23886	142	17	primer	primer	NOUN
brj-23886	142	18	arac	arac	NOUN
brj-23886	142	19	-	-	PUNCT
brj-23886	142	20	a	a	DET
brj-23886	142	21	800	800	NUM
brj-23886	142	22	bp	bp	PROPN
brj-23886	142	23	upstream	upstream	PROPN
brj-23886	142	24	primer	primer	NOUN
brj-23886	142	25	:	:	PUNCT
brj-23886	142	26	cggaattctccgaacagcagcttgattg	cggaattctccgaacagcagcttgattg	PROPN
brj-23886	142	27	downstream	downstream	PROPN
brj-23886	142	28	primer	primer	NOUN
brj-23886	142	29	:	:	PUNCT
brj-23886	142	30	ccgcgcgttaatagtcttttttctttaccggaat	ccgcgcgttaatagtcttttttctttaccggaat	PROPN
brj-23886	142	31	arac	arac	NOUN
brj-23886	142	32	-	-	PUNCT
brj-23886	142	33	b	b	PROPN
brj-23886	142	34	821	821	NUM
brj-23886	142	35	bp	bp	PROPN
brj-23886	142	36	upstream	upstream	PROPN
brj-23886	142	37	primer	primer	NOUN
brj-23886	142	38	:	:	PUNCT
brj-23886	142	39	cgcggatggattctctaagcagaatgaat	cgcggatggattctctaagcagaatgaat	ADJ
brj-23886	142	40	downstream	downstream	PROPN
brj-23886	142	41	primer	primer	NOUN
brj-23886	142	42	:	:	PUNCT
brj-23886	142	43	caagcttcaaacgacctcctttcattatcg	caagcttcaaacgacctcctttcattatcg	VERB
brj-23886	142	44	mcp	mcp	PROPN
brj-23886	142	45	-	-	PUNCT
brj-23886	142	46	a	a	DET
brj-23886	142	47	800	800	NUM
brj-23886	142	48	bp	bp	PROPN
brj-23886	142	49	upstream	upstream	PROPN
brj-23886	142	50	primer	primer	NOUN
brj-23886	142	51	:	:	PUNCT
brj-23886	142	52	ccgaattcgcagcagtatggagtat	ccgaattcgcagcagtatggagtat	PROPN
brj-23886	142	53	downstream	downstream	PROPN
brj-23886	142	54	primer	primer	NOUN
brj-23886	142	55	:	:	PUNCT
brj-23886	142	56	gccaaggaaggtttggtagccgtcttgtc	gccaaggaaggtttggtagccgtcttgtc	PROPN
brj-23886	142	57	mcp	mcp	PROPN
brj-23886	142	58	-	-	PROPN
brj-23886	142	59	b	b	PROPN
brj-23886	142	60	779	779	NUM
brj-23886	142	61	bp	bp	PROPN
brj-23886	142	62	upstream	upstream	PROPN
brj-23886	142	63	primer	primer	PROPN
brj-23886	142	64	:	:	PUNCT
brj-23886	142	65	catgcgagagaacaggcggcatccaaacc	catgcgagagaacaggcggcatccaaacc	ADJ
brj-23886	142	66	downstream	downstream	ADJ
brj-23886	142	67	primer	primer	NOUN
brj-23886	142	68	:	:	PUNCT
brj-23886	142	69	cgaagctttgttccagcctccctaatac	cgaagctttgttccagcctccctaatac	ADJ
brj-23886	142	70	type	type	NOUN
brj-23886	142	71	-	-	PUNCT
brj-23886	142	72	a	a	DET
brj-23886	142	73	768	768	NUM
brj-23886	142	74	bp	bp	PROPN
brj-23886	142	75	upstream	upstream	PROPN
brj-23886	142	76	primer	primer	NOUN
brj-23886	142	77	:	:	PUNCT
brj-23886	142	78	gccgaattccttagcaaaagctccgg	gccgaattccttagcaaaagctccgg	NOUN
brj-23886	142	79	downstream	downstream	PROPN
brj-23886	142	80	primer	primer	NOUN
brj-23886	142	81	:	:	PUNCT
brj-23886	142	82	cctaccgccgtcaccttcaattccttccc	cctaccgccgtcaccttcaattccttccc	PROPN
brj-23886	142	83	type	type	NOUN
brj-23886	142	84	-	-	PUNCT
brj-23886	142	85	b	b	NOUN
brj-23886	142	86	701	701	NUM
brj-23886	142	87	bp	bp	PROPN
brj-23886	142	88	upstream	upstream	PROPN
brj-23886	142	89	primer	primer	PROPN
brj-23886	142	90	:	:	PUNCT
brj-23886	142	91	cgctgtcaacggggaaggaattgaaggtgac	cgctgtcaacggggaaggaattgaaggtgac	NOUN
brj-23886	142	92	downstream	downstream	PROPN
brj-23886	142	93	primer	primer	NOUN
brj-23886	142	94	:	:	PUNCT
brj-23886	142	95	cgcaagcttcggaccttacgccgtcatt	cgcaagcttcggaccttacgccgtcatt	NOUN
brj-23886	142	96	note	note	NOUN
brj-23886	142	97	:	:	PUNCT
brj-23886	142	98	the	the	DET
brj-23886	142	99	underlined	underline	VERB
brj-23886	142	100	portion	portion	NOUN
brj-23886	142	101	represents	represent	VERB
brj-23886	142	102	the	the	DET
brj-23886	142	103	enzyme	enzyme	NOUN
brj-23886	142	104	cleavage	cleavage	NOUN
brj-23886	142	105	site	site	NOUN
brj-23886	142	106	,	,	PUNCT
brj-23886	142	107	and	and	CCONJ
brj-23886	142	108	the	the	DET
brj-23886	142	109	bamh	bamh	NOUN
brj-23886	142	110	i	i	PRON
brj-23886	142	111	enzyme	enzyme	VERB
brj-23886	142	112	cleavage	cleavage	NOUN
brj-23886	142	113	site	site	NOUN
brj-23886	142	114	is	be	AUX
brj-23886	142	115	ggatccd	ggatccd	PROPN
brj-23886	142	116	,	,	PUNCT
brj-23886	142	117	the	the	DET
brj-23886	142	118	hind	hind	NOUN
brj-23886	142	119	iii	iii	NUM
brj-23886	142	120	enzyme	enzyme	NOUN
brj-23886	142	121	cleavage	cleavage	NOUN
brj-23886	142	122	site	site	NOUN
brj-23886	142	123	is	be	AUX
brj-23886	142	124	aagctt	aagctt	ADJ
brj-23886	142	125	.	.	PUNCT
brj-23886	143	1	the	the	DET
brj-23886	143	2	upstream	upstream	ADJ
brj-23886	143	3	and	and	CCONJ
brj-23886	143	4	downstream	downstream	ADJ
brj-23886	143	5	sequences	sequence	NOUN
brj-23886	143	6	of	of	ADP
brj-23886	143	7	the	the	DET
brj-23886	143	8	target	target	NOUN
brj-23886	143	9	gene	gene	NOUN
brj-23886	143	10	were	be	AUX
brj-23886	143	11	fused	fuse	VERB
brj-23886	143	12	and	and	CCONJ
brj-23886	143	13	ligated	ligate	VERB
brj-23886	143	14	by	by	ADP
brj-23886	143	15	pcr	pcr	PROPN
brj-23886	143	16	.	.	PUNCT
brj-23886	144	1	the	the	DET
brj-23886	144	2	purified	purified	ADJ
brj-23886	144	3	upstream	upstream	ADJ
brj-23886	144	4	and	and	CCONJ
brj-23886	144	5	downstream	downstream	ADJ
brj-23886	144	6	homologous	homologous	ADJ
brj-23886	144	7	arm	arm	NOUN
brj-23886	144	8	fragments	fragment	NOUN
brj-23886	144	9	were	be	AUX
brj-23886	144	10	mixed	mix	VERB
brj-23886	144	11	in	in	ADP
brj-23886	144	12	a	a	DET
brj-23886	144	13	molar	molar	ADJ
brj-23886	144	14	ratio	ratio	NOUN
brj-23886	144	15	of	of	ADP
brj-23886	144	16	1:1	1:1	NUM
brj-23886	144	17	,	,	PUNCT
brj-23886	144	18	and	and	CCONJ
brj-23886	144	19	the	the	DET
brj-23886	144	20	mixed	mixed	ADJ
brj-23886	144	21	dna	dna	NOUN
brj-23886	144	22	fragments	fragment	NOUN
brj-23886	144	23	were	be	AUX
brj-23886	144	24	used	use	VERB
brj-23886	144	25	as	as	ADP
brj-23886	144	26	templates	template	NOUN
brj-23886	144	27	for	for	ADP
brj-23886	144	28	fusion	fusion	NOUN
brj-23886	144	29	peer	peer	NOUN
brj-23886	144	30	-	-	PUNCT
brj-23886	144	31	reviewed	review	VERB
brj-23886	144	32	article	article	NOUN
brj-23886	144	33	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	144	34	cui	cui	PROPN
brj-23886	144	35	et	et	PROPN
brj-23886	144	36	al	al	PROPN
brj-23886	144	37	.	.	PROPN
brj-23886	145	1	(	(	PUNCT
brj-23886	145	2	2025	2025	NUM
brj-23886	145	3	)	)	PUNCT
brj-23886	145	4	.	.	PUNCT
brj-23886	146	1	“	"	PUNCT
brj-23886	146	2	genome	genome	NOUN
brj-23886	146	3	study	study	NOUN
brj-23886	146	4	of	of	ADP
brj-23886	146	5	c.	c.	PROPN
brj-23886	146	6	thermocellum	thermocellum	PROPN
brj-23886	146	7	,	,	PUNCT
brj-23886	146	8	”	"	PUNCT
brj-23886	146	9	bioresources	bioresource	NOUN
brj-23886	146	10	20(2	20(2	NUM
brj-23886	146	11	)	)	PUNCT
brj-23886	146	12	,	,	PUNCT
brj-23886	146	13	3155	3155	NUM
brj-23886	146	14	-	-	SYM
brj-23886	146	15	3175	3175	NUM
brj-23886	146	16	.	.	PUNCT
brj-23886	147	1	3163	3163	NUM
brj-23886	147	2	pcr	pcr	NOUN
brj-23886	147	3	with	with	ADP
brj-23886	147	4	primers	primer	NOUN
brj-23886	147	5	af	af	VERB
brj-23886	147	6	and	and	CCONJ
brj-23886	147	7	br	br	PROPN
brj-23886	147	8	.	.	PUNCT
brj-23886	148	1	the	the	DET
brj-23886	148	2	ligated	ligate	VERB
brj-23886	148	3	recombinant	recombinant	ADJ
brj-23886	148	4	fragments	fragment	NOUN
brj-23886	148	5	were	be	AUX
brj-23886	148	6	obtained	obtain	VERB
brj-23886	148	7	,	,	PUNCT
brj-23886	148	8	and	and	CCONJ
brj-23886	148	9	the	the	DET
brj-23886	148	10	pcr	pcr	ADJ
brj-23886	148	11	products	product	NOUN
brj-23886	148	12	were	be	AUX
brj-23886	148	13	purified	purify	VERB
brj-23886	148	14	.	.	PUNCT
brj-23886	149	1	plasmid	plasmid	ADJ
brj-23886	149	2	pk18mobsacb	pk18mobsacb	PROPN
brj-23886	149	3	and	and	CCONJ
brj-23886	149	4	the	the	DET
brj-23886	149	5	target	target	NOUN
brj-23886	149	6	fragment	fragment	NOUN
brj-23886	149	7	were	be	AUX
brj-23886	149	8	digested	digest	VERB
brj-23886	149	9	with	with	ADP
brj-23886	149	10	hind	hind	NOUN
brj-23886	149	11	ⅲ	ⅲ	ADJ
brj-23886	149	12	and	and	CCONJ
brj-23886	149	13	ecor	ecor	VERB
brj-23886	149	14	i.	i.	NOUN
brj-23886	149	15	the	the	DET
brj-23886	149	16	digestion	digestion	NOUN
brj-23886	149	17	system	system	NOUN
brj-23886	149	18	were	be	AUX
brj-23886	149	19	5	5	NUM
brj-23886	149	20	μl	μl	ADV
brj-23886	149	21	plasmid	plasmid	ADJ
brj-23886	149	22	,	,	PUNCT
brj-23886	149	23	0.5	0.5	NUM
brj-23886	149	24	μl	μl	NOUN
brj-23886	149	25	ecor	ecor	VERB
brj-23886	150	1	i	i	PRON
brj-23886	150	2	,	,	PUNCT
brj-23886	150	3	0.5	0.5	NUM
brj-23886	150	4	μl	μl	PRON
brj-23886	150	5	hind	hind	PROPN
brj-23886	150	6	iii	iii	NOUN
brj-23886	150	7	,	,	PUNCT
brj-23886	150	8	0.2	0.2	NUM
brj-23886	150	9	μl	μl	ADP
brj-23886	150	10	buffer	buffer	NOUN
brj-23886	150	11	,	,	PUNCT
brj-23886	150	12	2	2	NUM
brj-23886	150	13	μl	μl	ADP
brj-23886	150	14	mc10	mc10	PROPN
brj-23886	150	15	×	×	NOUN
brj-23886	150	16	buffer	buffer	NOUN
brj-23886	150	17	,	,	PUNCT
brj-23886	150	18	and	and	CCONJ
brj-23886	150	19	11.8	11.8	NUM
brj-23886	150	20	μl	μl	ADP
brj-23886	150	21	ddh2o	ddh2o	PROPN
brj-23886	150	22	.	.	PUNCT
brj-23886	151	1	the	the	DET
brj-23886	151	2	digestion	digestion	NOUN
brj-23886	151	3	was	be	AUX
brj-23886	151	4	performed	perform	VERB
brj-23886	151	5	at	at	ADP
brj-23886	151	6	37	37	NUM
brj-23886	151	7	°	°	NOUN
brj-23886	151	8	c	c	NOUN
brj-23886	151	9	for	for	ADP
brj-23886	151	10	4	4	NUM
brj-23886	151	11	h.	h.	NOUN
brj-23886	151	12	the	the	DET
brj-23886	151	13	cloning	cloning	NOUN
brj-23886	151	14	site	site	NOUN
brj-23886	151	15	of	of	ADP
brj-23886	151	16	plasmid	plasmid	NOUN
brj-23886	151	17	pk18mobsacb	pk18mobsacb	PROPN
brj-23886	151	18	is	be	AUX
brj-23886	151	19	shown	show	VERB
brj-23886	151	20	in	in	ADP
brj-23886	151	21	fig	fig	NOUN
brj-23886	151	22	.	.	PUNCT
brj-23886	152	1	3	3	X
brj-23886	152	2	.	.	X
brj-23886	152	3	the	the	DET
brj-23886	152	4	electro	electro	ADJ
brj-23886	152	5	transformation	transformation	NOUN
brj-23886	152	6	protocol	protocol	NOUN
brj-23886	152	7	referred	refer	VERB
brj-23886	152	8	to	to	ADP
brj-23886	152	9	was	be	AUX
brj-23886	152	10	huang	huang	PROPN
brj-23886	152	11	et	et	PROPN
brj-23886	152	12	al	al	PROPN
brj-23886	152	13	.	.	PROPN
brj-23886	153	1	(	(	PUNCT
brj-23886	153	2	2015	2015	NUM
brj-23886	153	3	)	)	PUNCT
brj-23886	153	4	for	for	ADP
brj-23886	153	5	the	the	DET
brj-23886	153	6	electro	electro	ADJ
brj-23886	153	7	transformation	transformation	NOUN
brj-23886	153	8	conditions	condition	NOUN
brj-23886	153	9	of	of	ADP
brj-23886	153	10	the	the	DET
brj-23886	153	11	shuttle	shuttle	NOUN
brj-23886	153	12	plasmid	plasmid	NOUN
brj-23886	153	13	plukeld	plukeld	PROPN
brj-23886	153	14	thermoanaerobacterium	thermoanaerobacterium	PROPN
brj-23886	153	15	aotearoense	aotearoense	PROPN
brj-23886	153	16	scut27	scut27	NOUN
brj-23886	153	17	.	.	PUNCT
brj-23886	154	1	the	the	DET
brj-23886	154	2	mutant	mutant	NOUN
brj-23886	154	3	was	be	AUX
brj-23886	154	4	activated	activate	VERB
brj-23886	154	5	and	and	CCONJ
brj-23886	154	6	the	the	DET
brj-23886	154	7	plasmid	plasmid	ADJ
brj-23886	154	8	dna	dna	NOUN
brj-23886	154	9	was	be	AUX
brj-23886	154	10	extracted	extract	VERB
brj-23886	154	11	as	as	ADP
brj-23886	154	12	described	describe	VERB
brj-23886	154	13	above	above	ADV
brj-23886	154	14	.	.	PUNCT
brj-23886	155	1	a	a	DET
brj-23886	155	2	total	total	NOUN
brj-23886	155	3	of	of	ADP
brj-23886	155	4	1	1	NUM
brj-23886	155	5	μl	μl	ADP
brj-23886	155	6	of	of	ADP
brj-23886	155	7	template	template	NOUN
brj-23886	155	8	dna	dna	NOUN
brj-23886	155	9	,	,	PUNCT
brj-23886	155	10	0.8	0.8	NUM
brj-23886	155	11	μl	μl	ADP
brj-23886	155	12	of	of	ADP
brj-23886	155	13	upstream	upstream	ADJ
brj-23886	155	14	and	and	CCONJ
brj-23886	155	15	downstream	downstream	ADJ
brj-23886	155	16	primers	primer	NOUN
brj-23886	155	17	,	,	PUNCT
brj-23886	155	18	10	10	NUM
brj-23886	155	19	μl	μl	NOUN
brj-23886	155	20	of	of	ADP
brj-23886	155	21	taq	taq	NOUN
brj-23886	155	22	enzyme	enzyme	NOUN
brj-23886	155	23	,	,	PUNCT
brj-23886	155	24	and	and	CCONJ
brj-23886	155	25	7.4	7.4	NUM
brj-23886	155	26	μl	μl	NOUN
brj-23886	155	27	of	of	ADP
brj-23886	155	28	ddh2o	ddh2o	PROPN
brj-23886	155	29	were	be	AUX
brj-23886	155	30	added	add	VERB
brj-23886	155	31	for	for	ADP
brj-23886	155	32	pcr	pcr	ADJ
brj-23886	155	33	amplification	amplification	NOUN
brj-23886	155	34	.	.	PUNCT
brj-23886	156	1	the	the	DET
brj-23886	156	2	original	original	ADJ
brj-23886	156	3	strain	strain	NOUN
brj-23886	156	4	(	(	PUNCT
brj-23886	156	5	c0	c0	NOUN
brj-23886	156	6	)	)	PUNCT
brj-23886	156	7	and	and	CCONJ
brj-23886	156	8	modified	modify	VERB
brj-23886	156	9	strains	strain	NOUN
brj-23886	156	10	were	be	AUX
brj-23886	156	11	inoculated	inoculate	VERB
brj-23886	156	12	into	into	ADP
brj-23886	156	13	the	the	DET
brj-23886	156	14	culture	culture	NOUN
brj-23886	156	15	medium	medium	NOUN
brj-23886	156	16	respectively	respectively	ADV
brj-23886	156	17	,	,	PUNCT
brj-23886	156	18	and	and	CCONJ
brj-23886	156	19	fermented	ferment	VERB
brj-23886	156	20	at	at	ADP
brj-23886	156	21	180rpm	180rpm	NUM
brj-23886	156	22	and	and	CCONJ
brj-23886	156	23	55	55	NUM
brj-23886	156	24	℃	℃	PROPN
brj-23886	156	25	for	for	ADP
brj-23886	156	26	48h	48h	NOUN
brj-23886	156	27	.	.	PUNCT
brj-23886	157	1	the	the	DET
brj-23886	157	2	ethanol	ethanol	NOUN
brj-23886	157	3	yield	yield	NOUN
brj-23886	157	4	was	be	AUX
brj-23886	157	5	determined	determine	VERB
brj-23886	157	6	at	at	ADP
brj-23886	157	7	the	the	DET
brj-23886	157	8	end	end	NOUN
brj-23886	157	9	of	of	ADP
brj-23886	157	10	fermentation	fermentation	NOUN
brj-23886	157	11	and	and	CCONJ
brj-23886	157	12	c0	c0	NOUN
brj-23886	157	13	was	be	AUX
brj-23886	157	14	used	use	VERB
brj-23886	157	15	as	as	ADP
brj-23886	157	16	a	a	DET
brj-23886	157	17	control	control	NOUN
brj-23886	157	18	.	.	PUNCT
brj-23886	158	1	fig	fig	NOUN
brj-23886	158	2	.	.	PUNCT
brj-23886	159	1	3	3	X
brj-23886	159	2	.	.	X
brj-23886	159	3	suicide	suicide	NOUN
brj-23886	159	4	plasmid	plasmid	NOUN
brj-23886	159	5	pk18mobsacb	pk18mobsacb	PROPN
brj-23886	159	6	map	map	VERB
brj-23886	159	7	peer	peer	NOUN
brj-23886	159	8	-	-	PUNCT
brj-23886	159	9	reviewed	review	VERB
brj-23886	159	10	article	article	NOUN
brj-23886	159	11	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	159	12	cui	cui	PROPN
brj-23886	159	13	et	et	PROPN
brj-23886	159	14	al	al	PROPN
brj-23886	159	15	.	.	PROPN
brj-23886	160	1	(	(	PUNCT
brj-23886	160	2	2025	2025	NUM
brj-23886	160	3	)	)	PUNCT
brj-23886	160	4	.	.	PUNCT
brj-23886	161	1	“	"	PUNCT
brj-23886	161	2	genome	genome	NOUN
brj-23886	161	3	study	study	NOUN
brj-23886	161	4	of	of	ADP
brj-23886	161	5	c.	c.	PROPN
brj-23886	161	6	thermocellum	thermocellum	PROPN
brj-23886	161	7	,	,	PUNCT
brj-23886	161	8	”	"	PUNCT
brj-23886	161	9	bioresources	bioresource	NOUN
brj-23886	161	10	20(2	20(2	NUM
brj-23886	161	11	)	)	PUNCT
brj-23886	161	12	,	,	PUNCT
brj-23886	161	13	3155	3155	NUM
brj-23886	161	14	-	-	SYM
brj-23886	161	15	3175	3175	NUM
brj-23886	161	16	.	.	PUNCT
brj-23886	162	1	3164	3164	NUM
brj-23886	162	2	determination	determination	NOUN
brj-23886	162	3	of	of	ADP
brj-23886	162	4	growth	growth	NOUN
brj-23886	162	5	curve	curve	VERB
brj-23886	162	6	the	the	DET
brj-23886	162	7	wild	wild	ADJ
brj-23886	162	8	and	and	CCONJ
brj-23886	162	9	mutant	mutant	ADJ
brj-23886	162	10	strains	strain	NOUN
brj-23886	162	11	were	be	AUX
brj-23886	162	12	inoculated	inoculate	VERB
brj-23886	162	13	in	in	ADP
brj-23886	162	14	mtc	mtc	NOUN
brj-23886	162	15	medium	medium	NOUN
brj-23886	162	16	and	and	CCONJ
brj-23886	162	17	incubated	incubate	VERB
brj-23886	162	18	at	at	ADP
brj-23886	162	19	55	55	NUM
brj-23886	162	20	°	°	ADP
brj-23886	162	21	c	c	NOUN
brj-23886	162	22	and	and	CCONJ
brj-23886	162	23	180	180	NUM
brj-23886	162	24	r	r	NOUN
brj-23886	162	25	/	/	SYM
brj-23886	162	26	min	min	NOUN
brj-23886	162	27	for	for	ADP
brj-23886	162	28	12	12	NUM
brj-23886	162	29	h.	h.	NOUN
brj-23886	162	30	the	the	DET
brj-23886	162	31	medium	medium	NOUN
brj-23886	162	32	was	be	AUX
brj-23886	162	33	added	add	VERB
brj-23886	162	34	at	at	ADP
brj-23886	162	35	5	5	NUM
brj-23886	162	36	%	%	NOUN
brj-23886	162	37	inoculum	inoculum	NOUN
brj-23886	162	38	.	.	PUNCT
brj-23886	163	1	the	the	DET
brj-23886	163	2	od600	od600	ADJ
brj-23886	163	3	values	value	NOUN
brj-23886	163	4	were	be	AUX
brj-23886	163	5	determined	determine	VERB
brj-23886	163	6	every	every	DET
brj-23886	163	7	2	2	NUM
brj-23886	163	8	h	h	NOUN
brj-23886	163	9	and	and	CCONJ
brj-23886	163	10	the	the	DET
brj-23886	163	11	growth	growth	NOUN
brj-23886	163	12	curve	curve	NOUN
brj-23886	163	13	was	be	AUX
brj-23886	163	14	used	use	VERB
brj-23886	163	15	to	to	PART
brj-23886	163	16	represent	represent	VERB
brj-23886	163	17	the	the	DET
brj-23886	163	18	growth	growth	NOUN
brj-23886	163	19	of	of	ADP
brj-23886	163	20	the	the	DET
brj-23886	163	21	strains	strain	NOUN
brj-23886	163	22	.	.	PUNCT
brj-23886	164	1	determination	determination	NOUN
brj-23886	164	2	of	of	ADP
brj-23886	164	3	ethanol	ethanol	NOUN
brj-23886	164	4	yield	yield	NOUN
brj-23886	164	5	the	the	DET
brj-23886	164	6	ethanol	ethanol	NOUN
brj-23886	164	7	content	content	NOUN
brj-23886	164	8	in	in	ADP
brj-23886	164	9	the	the	DET
brj-23886	164	10	fermentation	fermentation	NOUN
brj-23886	164	11	broth	broth	NOUN
brj-23886	164	12	was	be	AUX
brj-23886	164	13	determined	determine	VERB
brj-23886	164	14	by	by	ADP
brj-23886	164	15	high	high	ADJ
brj-23886	164	16	performance	performance	NOUN
brj-23886	164	17	liquid	liquid	NOUN
brj-23886	164	18	chromatography	chromatography	NOUN
brj-23886	164	19	(	(	PUNCT
brj-23886	164	20	e2695	e2695	NOUN
brj-23886	164	21	;	;	PUNCT
brj-23886	164	22	waters	water	NOUN
brj-23886	164	23	,	,	PUNCT
brj-23886	164	24	ma	ma	PROPN
brj-23886	164	25	,	,	PUNCT
brj-23886	164	26	usa	usa	PROPN
brj-23886	164	27	)	)	PUNCT
brj-23886	164	28	,	,	PUNCT
brj-23886	164	29	and	and	CCONJ
brj-23886	165	1	the	the	DET
brj-23886	165	2	liquid	liquid	ADJ
brj-23886	165	3	phase	phase	NOUN
brj-23886	165	4	detection	detection	NOUN
brj-23886	165	5	conditions	condition	NOUN
brj-23886	165	6	are	be	AUX
brj-23886	165	7	shown	show	VERB
brj-23886	165	8	in	in	ADP
brj-23886	165	9	table	table	NOUN
brj-23886	165	10	5	5	NUM
brj-23886	165	11	.	.	PUNCT
brj-23886	165	12	table	table	NOUN
brj-23886	165	13	5	5	NUM
brj-23886	165	14	.	.	PUNCT
brj-23886	165	15	ethanol	ethanol	NOUN
brj-23886	165	16	content	content	NOUN
brj-23886	165	17	liquid	liquid	ADJ
brj-23886	165	18	chromatography	chromatography	NOUN
brj-23886	165	19	detection	detection	NOUN
brj-23886	165	20	conditions	condition	NOUN
brj-23886	165	21	chromatographic	chromatographic	ADJ
brj-23886	165	22	column	column	NOUN
brj-23886	165	23	type	type	NOUN
brj-23886	165	24	aminex	aminex	PROPN
brj-23886	165	25	hpx-87h	hpx-87h	NUM
brj-23886	166	1	column	column	NOUN
brj-23886	167	1	(	(	PUNCT
brj-23886	168	1	300	300	NUM
brj-23886	168	2	mm	mm	NOUN
brj-23886	168	3	×	×	NOUN
brj-23886	168	4	7.8	7.8	NUM
brj-23886	168	5	mm	mm	INTJ
brj-23886	168	6	i	i	PROPN
brj-23886	168	7	d	d	PROPN
brj-23886	168	8	,	,	PUNCT
brj-23886	168	9	9	9	NUM
brj-23886	168	10	μm	μm	NUM
brj-23886	168	11	)	)	PUNCT
brj-23886	168	12	mobile	mobile	ADJ
brj-23886	168	13	phase	phase	NOUN
brj-23886	168	14	2.5	2.5	NUM
brj-23886	168	15	mm	mm	NOUN
brj-23886	168	16	h2so4	h2so4	PROPN
brj-23886	168	17	detector	detector	NOUN
brj-23886	168	18	waters	water	VERB
brj-23886	168	19	2414	2414	NUM
brj-23886	168	20	ri	ri	PROPN
brj-23886	168	21	differential	differential	ADJ
brj-23886	168	22	detector	detector	NOUN
brj-23886	168	23	flow	flow	NOUN
brj-23886	168	24	rate	rate	NOUN
brj-23886	168	25	0.5	0.5	NUM
brj-23886	168	26	ml	ml	NOUN
brj-23886	168	27	/	/	SYM
brj-23886	168	28	min	min	NOUN
brj-23886	168	29	sampling	sample	VERB
brj-23886	168	30	volume	volume	NOUN
brj-23886	168	31	10	10	NUM
brj-23886	168	32	μl	μl	INTJ
brj-23886	168	33	column	column	NOUN
brj-23886	168	34	temperature	temperature	NOUN
brj-23886	168	35	50	50	NUM
brj-23886	168	36	°	°	PROPN
brj-23886	168	37	c	c	NOUN
brj-23886	168	38	data	datum	NOUN
brj-23886	168	39	analysis	analysis	NOUN
brj-23886	168	40	the	the	DET
brj-23886	168	41	experimental	experimental	ADJ
brj-23886	168	42	data	datum	NOUN
brj-23886	168	43	were	be	AUX
brj-23886	168	44	analyzed	analyze	VERB
brj-23886	168	45	using	use	VERB
brj-23886	168	46	sas	sas	PROPN
brj-23886	168	47	9.2	9.2	NUM
brj-23886	168	48	(	(	PUNCT
brj-23886	168	49	sas	sas	PROPN
brj-23886	168	50	inc	inc	PROPN
brj-23886	168	51	.	.	PROPN
brj-23886	168	52	,	,	PUNCT
brj-23886	168	53	cary	cary	PROPN
brj-23886	168	54	,	,	PUNCT
brj-23886	168	55	nc	nc	PROPN
brj-23886	168	56	,	,	PUNCT
brj-23886	168	57	usa	usa	PROPN
brj-23886	168	58	)	)	PUNCT
brj-23886	168	59	for	for	ADP
brj-23886	168	60	variance	variance	NOUN
brj-23886	168	61	analysis	analysis	NOUN
brj-23886	168	62	under	under	ADP
brj-23886	168	63	p	p	X
brj-23886	168	64	<	<	X
brj-23886	168	65	0.05	0.05	NUM
brj-23886	168	66	and	and	CCONJ
brj-23886	168	67	p	p	X
brj-23886	168	68	<	<	X
brj-23886	168	69	0.01	0.01	NUM
brj-23886	168	70	.	.	PUNCT
brj-23886	169	1	all	all	DET
brj-23886	169	2	data	datum	NOUN
brj-23886	169	3	are	be	AUX
brj-23886	169	4	presented	present	VERB
brj-23886	169	5	as	as	ADP
brj-23886	169	6	the	the	DET
brj-23886	169	7	mean	mean	PROPN
brj-23886	169	8	±	±	NUM
brj-23886	169	9	standard	standard	ADJ
brj-23886	169	10	deviation	deviation	NOUN
brj-23886	169	11	,	,	PUNCT
brj-23886	169	12	ensuring	ensure	VERB
brj-23886	169	13	a	a	DET
brj-23886	169	14	clear	clear	ADJ
brj-23886	169	15	representation	representation	NOUN
brj-23886	169	16	of	of	ADP
brj-23886	169	17	the	the	DET
brj-23886	169	18	variability	variability	NOUN
brj-23886	169	19	and	and	CCONJ
brj-23886	169	20	central	central	ADJ
brj-23886	169	21	tendency	tendency	NOUN
brj-23886	169	22	of	of	ADP
brj-23886	169	23	the	the	DET
brj-23886	169	24	observed	observe	VERB
brj-23886	169	25	values	value	NOUN
brj-23886	169	26	.	.	PUNCT
brj-23886	170	1	results	result	NOUN
brj-23886	170	2	and	and	CCONJ
brj-23886	170	3	discussion	discussion	NOUN
brj-23886	170	4	results	result	NOUN
brj-23886	170	5	of	of	ADP
brj-23886	170	6	promoter	promoter	NOUN
brj-23886	170	7	sequencing	sequence	VERB
brj-23886	170	8	data	datum	NOUN
brj-23886	170	9	analysis	analysis	NOUN
brj-23886	170	10	the	the	DET
brj-23886	170	11	strain	strain	NOUN
brj-23886	170	12	c1	c1	PROPN
brj-23886	170	13	was	be	AUX
brj-23886	170	14	c0	c0	NOUN
brj-23886	170	15	treated	treat	VERB
brj-23886	170	16	with	with	ADP
brj-23886	170	17	the	the	DET
brj-23886	170	18	addition	addition	NOUN
brj-23886	170	19	of	of	ADP
brj-23886	170	20	nd3	nd3	NOUN
brj-23886	170	21	+	+	PROPN
brj-23886	170	22	.	.	PUNCT
brj-23886	171	1	the	the	DET
brj-23886	171	2	differential	differential	ADJ
brj-23886	171	3	gene	gene	NOUN
brj-23886	171	4	sequences	sequence	NOUN
brj-23886	171	5	are	be	AUX
brj-23886	171	6	shown	show	VERB
brj-23886	171	7	in	in	ADP
brj-23886	171	8	table	table	NOUN
brj-23886	171	9	6	6	NUM
brj-23886	171	10	.	.	PUNCT
brj-23886	171	11	by	by	ADP
brj-23886	171	12	comparing	compare	VERB
brj-23886	171	13	the	the	DET
brj-23886	171	14	gene	gene	NOUN
brj-23886	171	15	sequences	sequence	NOUN
brj-23886	171	16	of	of	ADP
brj-23886	171	17	adh	adh	PROPN
brj-23886	171	18	,	,	PUNCT
brj-23886	171	19	pfo	pfo	NOUN
brj-23886	171	20	,	,	PUNCT
brj-23886	171	21	and	and	CCONJ
brj-23886	171	22	pfk	pfk	PROPN
brj-23886	171	23	gene	gene	NOUN
brj-23886	171	24	promoter	promoter	NOUN
brj-23886	171	25	region	region	NOUN
brj-23886	171	26	sequences	sequence	NOUN
brj-23886	171	27	of	of	ADP
brj-23886	171	28	strains	strain	NOUN
brj-23886	171	29	c0	c0	NOUN
brj-23886	171	30	and	and	CCONJ
brj-23886	171	31	c1	c1	PROPN
brj-23886	171	32	,	,	PUNCT
brj-23886	171	33	three	three	NUM
brj-23886	171	34	base	base	NOUN
brj-23886	171	35	mutations	mutation	NOUN
brj-23886	171	36	were	be	AUX
brj-23886	171	37	found	find	VERB
brj-23886	171	38	in	in	ADP
brj-23886	171	39	the	the	DET
brj-23886	171	40	sequence	sequence	NOUN
brj-23886	171	41	of	of	ADP
brj-23886	171	42	the	the	DET
brj-23886	171	43	adh	adh	NOUN
brj-23886	171	44	promoter	promoter	NOUN
brj-23886	171	45	region	region	NOUN
brj-23886	171	46	of	of	ADP
brj-23886	171	47	c1	c1	PROPN
brj-23886	171	48	and	and	CCONJ
brj-23886	171	49	the	the	DET
brj-23886	171	50	types	type	NOUN
brj-23886	171	51	of	of	ADP
brj-23886	171	52	mutations	mutation	NOUN
brj-23886	171	53	were	be	AUX
brj-23886	171	54	substitutions	substitution	NOUN
brj-23886	171	55	and	and	CCONJ
brj-23886	171	56	deletions	deletion	NOUN
brj-23886	171	57	.	.	PUNCT
brj-23886	172	1	the	the	DET
brj-23886	172	2	pfo	pfo	PROPN
brj-23886	172	3	promoter	promoter	NOUN
brj-23886	172	4	region	region	NOUN
brj-23886	172	5	sequence	sequence	NOUN
brj-23886	172	6	had	have	VERB
brj-23886	172	7	four	four	NUM
brj-23886	172	8	base	base	NOUN
brj-23886	172	9	substitution	substitution	NOUN
brj-23886	172	10	mutations	mutation	NOUN
brj-23886	172	11	,	,	PUNCT
brj-23886	172	12	and	and	CCONJ
brj-23886	172	13	the	the	DET
brj-23886	172	14	pfk	pfk	PROPN
brj-23886	172	15	promoter	promoter	NOUN
brj-23886	172	16	region	region	NOUN
brj-23886	172	17	sequence	sequence	NOUN
brj-23886	172	18	had	have	VERB
brj-23886	172	19	three	three	NUM
brj-23886	172	20	mutated	mutate	VERB
brj-23886	172	21	bases	basis	NOUN
brj-23886	172	22	.	.	PUNCT
brj-23886	173	1	the	the	DET
brj-23886	173	2	bases	basis	NOUN
brj-23886	173	3	in	in	ADP
brj-23886	173	4	which	which	PRON
brj-23886	173	5	substitutions	substitution	NOUN
brj-23886	173	6	and	and	CCONJ
brj-23886	173	7	deletions	deletion	NOUN
brj-23886	173	8	occurred	occur	VERB
brj-23886	173	9	contained	contain	VERB
brj-23886	173	10	four	four	NUM
brj-23886	173	11	bases	basis	NOUN
brj-23886	173	12	,	,	PUNCT
brj-23886	173	13	and	and	CCONJ
brj-23886	173	14	almost	almost	ADV
brj-23886	173	15	all	all	PRON
brj-23886	173	16	of	of	ADP
brj-23886	173	17	them	they	PRON
brj-23886	173	18	were	be	AUX
brj-23886	173	19	mutated	mutate	VERB
brj-23886	173	20	in	in	ADP
brj-23886	173	21	a	a	DET
brj-23886	173	22	single	single	ADJ
brj-23886	173	23	base	base	NOUN
brj-23886	173	24	,	,	PUNCT
brj-23886	173	25	indicating	indicate	VERB
brj-23886	173	26	that	that	SCONJ
brj-23886	173	27	neodymium	neodymium	NOUN
brj-23886	173	28	ions	ion	NOUN
brj-23886	173	29	affected	affect	VERB
brj-23886	173	30	the	the	DET
brj-23886	173	31	promoter	promoter	NOUN
brj-23886	173	32	region	region	NOUN
brj-23886	173	33	sequences	sequence	NOUN
brj-23886	173	34	of	of	ADP
brj-23886	173	35	adh	adh	PROPN
brj-23886	173	36	,	,	PUNCT
brj-23886	173	37	pfo	pfo	NOUN
brj-23886	173	38	,	,	PUNCT
brj-23886	173	39	and	and	CCONJ
brj-23886	173	40	pfk	pfk	PROPN
brj-23886	173	41	.	.	PUNCT
brj-23886	174	1	the	the	DET
brj-23886	174	2	initiation	initiation	NOUN
brj-23886	174	3	of	of	ADP
brj-23886	174	4	transcription	transcription	NOUN
brj-23886	174	5	is	be	AUX
brj-23886	174	6	a	a	DET
brj-23886	174	7	critical	critical	ADJ
brj-23886	174	8	stage	stage	NOUN
brj-23886	174	9	of	of	ADP
brj-23886	174	10	gene	gene	NOUN
brj-23886	174	11	expression	expression	NOUN
brj-23886	174	12	,	,	PUNCT
brj-23886	174	13	and	and	CCONJ
brj-23886	174	14	when	when	SCONJ
brj-23886	174	15	the	the	DET
brj-23886	174	16	promoter	promoter	NOUN
brj-23886	174	17	binds	bind	VERB
brj-23886	174	18	to	to	ADP
brj-23886	174	19	rna	rna	NOUN
brj-23886	174	20	polymerase	polymerase	NOUN
brj-23886	174	21	to	to	PART
brj-23886	174	22	start	start	VERB
brj-23886	174	23	transcription	transcription	NOUN
brj-23886	174	24	,	,	PUNCT
brj-23886	174	25	changes	change	NOUN
brj-23886	174	26	in	in	ADP
brj-23886	174	27	the	the	DET
brj-23886	174	28	promoter	promoter	NOUN
brj-23886	174	29	structure	structure	NOUN
brj-23886	174	30	directly	directly	ADV
brj-23886	174	31	affect	affect	VERB
brj-23886	174	32	the	the	DET
brj-23886	174	33	efficiency	efficiency	NOUN
brj-23886	174	34	of	of	ADP
brj-23886	174	35	binding	bind	VERB
brj-23886	174	36	to	to	ADP
brj-23886	174	37	rna	rna	NOUN
brj-23886	174	38	polymerase	polymerase	NOUN
brj-23886	174	39	and	and	CCONJ
brj-23886	174	40	thus	thus	ADV
brj-23886	174	41	the	the	DET
brj-23886	174	42	level	level	NOUN
brj-23886	174	43	of	of	ADP
brj-23886	174	44	gene	gene	NOUN
brj-23886	174	45	expression	expression	NOUN
brj-23886	174	46	(	(	PUNCT
brj-23886	174	47	leacock	leacock	NOUN
brj-23886	174	48	et	et	PROPN
brj-23886	174	49	al	al	PROPN
brj-23886	174	50	.	.	PROPN
brj-23886	174	51	2006	2006	NUM
brj-23886	174	52	)	)	PUNCT
brj-23886	174	53	.	.	PUNCT
brj-23886	175	1	the	the	DET
brj-23886	175	2	analysis	analysis	NOUN
brj-23886	175	3	of	of	ADP
brj-23886	175	4	nd3	nd3	ADJ
brj-23886	175	5	+	+	SYM
brj-23886	175	6	treatment	treatment	NOUN
brj-23886	175	7	to	to	PART
brj-23886	175	8	increase	increase	VERB
brj-23886	175	9	the	the	DET
brj-23886	175	10	expression	expression	NOUN
brj-23886	175	11	level	level	NOUN
brj-23886	175	12	and	and	CCONJ
brj-23886	175	13	enzyme	enzyme	NOUN
brj-23886	175	14	activity	activity	NOUN
brj-23886	175	15	of	of	ADP
brj-23886	175	16	key	key	ADJ
brj-23886	175	17	enzyme	enzyme	NOUN
brj-23886	175	18	genes	gene	NOUN
brj-23886	175	19	may	may	AUX
brj-23886	175	20	be	be	AUX
brj-23886	175	21	due	due	ADJ
brj-23886	175	22	to	to	ADP
brj-23886	175	23	the	the	DET
brj-23886	175	24	enhancement	enhancement	NOUN
brj-23886	175	25	of	of	ADP
brj-23886	175	26	the	the	DET
brj-23886	175	27	transcriptional	transcriptional	ADJ
brj-23886	175	28	function	function	NOUN
brj-23886	175	29	of	of	ADP
brj-23886	175	30	genes	gene	NOUN
brj-23886	175	31	by	by	ADP
brj-23886	175	32	affecting	affect	VERB
brj-23886	175	33	the	the	DET
brj-23886	175	34	sequence	sequence	NOUN
brj-23886	175	35	of	of	ADP
brj-23886	175	36	the	the	DET
brj-23886	175	37	key	key	ADJ
brj-23886	175	38	enzyme	enzyme	NOUN
brj-23886	175	39	promoter	promoter	NOUN
brj-23886	175	40	region	region	NOUN
brj-23886	175	41	(	(	PUNCT
brj-23886	175	42	würleitner	würleitner	NOUN
brj-23886	175	43	et	et	PROPN
brj-23886	175	44	al	al	PROPN
brj-23886	175	45	.	.	PROPN
brj-23886	175	46	2003	2003	NUM
brj-23886	175	47	)	)	PUNCT
brj-23886	175	48	.	.	PUNCT
brj-23886	176	1	peer	peer	NOUN
brj-23886	176	2	-	-	PUNCT
brj-23886	176	3	reviewed	review	VERB
brj-23886	176	4	article	article	NOUN
brj-23886	176	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	176	6	cui	cui	PROPN
brj-23886	176	7	et	et	PROPN
brj-23886	176	8	al	al	PROPN
brj-23886	176	9	.	.	PROPN
brj-23886	177	1	(	(	PUNCT
brj-23886	177	2	2025	2025	NUM
brj-23886	177	3	)	)	PUNCT
brj-23886	177	4	.	.	PUNCT
brj-23886	178	1	“	"	PUNCT
brj-23886	178	2	genome	genome	NOUN
brj-23886	178	3	study	study	NOUN
brj-23886	178	4	of	of	ADP
brj-23886	178	5	c.	c.	PROPN
brj-23886	178	6	thermocellum	thermocellum	PROPN
brj-23886	178	7	,	,	PUNCT
brj-23886	178	8	”	"	PUNCT
brj-23886	178	9	bioresources	bioresource	NOUN
brj-23886	178	10	20(2	20(2	NUM
brj-23886	178	11	)	)	PUNCT
brj-23886	178	12	,	,	PUNCT
brj-23886	178	13	3155	3155	NUM
brj-23886	178	14	-	-	SYM
brj-23886	178	15	3175	3175	NUM
brj-23886	178	16	.	.	PUNCT
brj-23886	179	1	3165	3165	NUM
brj-23886	179	2	table	table	NOUN
brj-23886	179	3	6	6	NUM
brj-23886	179	4	.	.	PUNCT
brj-23886	179	5	differences	difference	NOUN
brj-23886	179	6	in	in	ADP
brj-23886	179	7	promoter	promoter	NOUN
brj-23886	179	8	sequences	sequence	NOUN
brj-23886	179	9	of	of	ADP
brj-23886	179	10	different	different	ADJ
brj-23886	179	11	genes	gene	NOUN
brj-23886	179	12	gene	gene	NOUN
brj-23886	179	13	base	base	NOUN
brj-23886	179	14	site	site	NOUN
brj-23886	179	15	c0	c0	PROPN
brj-23886	179	16	c1	c1	PROPN
brj-23886	179	17	mutation	mutation	PROPN
brj-23886	179	18	type	type	NOUN
brj-23886	179	19	adh	adh	NOUN
brj-23886	179	20	24	24	NUM
brj-23886	179	21	a	a	DET
brj-23886	179	22	t	t	NOUN
brj-23886	179	23	reversal	reversal	NOUN
brj-23886	179	24	536	536	NUM
brj-23886	179	25	c	c	NOUN
brj-23886	179	26	t	t	PROPN
brj-23886	179	27	reversal	reversal	NOUN
brj-23886	179	28	621	621	NUM
brj-23886	179	29	a	a	DET
brj-23886	179	30	deletion	deletion	NOUN
brj-23886	179	31	pfo	pfo	NOUN
brj-23886	179	32	76	76	NUM
brj-23886	179	33	t	t	NOUN
brj-23886	179	34	a	a	DET
brj-23886	179	35	reversal	reversal	NOUN
brj-23886	179	36	96	96	NUM
brj-23886	179	37	t	t	NOUN
brj-23886	179	38	c	c	NOUN
brj-23886	179	39	transition	transition	NOUN
brj-23886	179	40	185	185	NUM
brj-23886	179	41	c	c	NOUN
brj-23886	179	42	a	a	DET
brj-23886	179	43	transition	transition	NOUN
brj-23886	179	44	614	614	NUM
brj-23886	179	45	t	t	NOUN
brj-23886	179	46	c	c	NOUN
brj-23886	179	47	transition	transition	NOUN
brj-23886	179	48	pfk	pfk	PROPN
brj-23886	179	49	16	16	NUM
brj-23886	179	50	a	a	DET
brj-23886	179	51	g	g	NOUN
brj-23886	179	52	transition	transition	NOUN
brj-23886	179	53	211	211	NUM
brj-23886	179	54	c	c	NOUN
brj-23886	179	55	g	g	PROPN
brj-23886	179	56	reversal	reversal	NOUN
brj-23886	179	57	288	288	NUM
brj-23886	179	58	a	a	DET
brj-23886	179	59	t	t	NOUN
brj-23886	179	60	reversal	reversal	NOUN
brj-23886	179	61	effect	effect	NOUN
brj-23886	179	62	of	of	ADP
brj-23886	179	63	point	point	NOUN
brj-23886	179	64	mutations	mutation	NOUN
brj-23886	179	65	of	of	ADP
brj-23886	179	66	promoter	promoter	NOUN
brj-23886	179	67	sequence	sequence	NOUN
brj-23886	179	68	on	on	ADP
brj-23886	179	69	enzyme	enzyme	NOUN
brj-23886	179	70	expression	expression	NOUN
brj-23886	179	71	the	the	DET
brj-23886	179	72	key	key	ADJ
brj-23886	179	73	enzyme	enzyme	NOUN
brj-23886	179	74	adh	adh	NOUN
brj-23886	179	75	,	,	PUNCT
brj-23886	179	76	pfo	pfo	NOUN
brj-23886	179	77	,	,	PUNCT
brj-23886	179	78	and	and	CCONJ
brj-23886	179	79	pfk	pfk	PROPN
brj-23886	179	80	promoter	promoter	NOUN
brj-23886	179	81	region	region	NOUN
brj-23886	179	82	point	point	NOUN
brj-23886	179	83	mutant	mutant	ADJ
brj-23886	179	84	strain	strain	NOUN
brj-23886	179	85	c3	c3	PROPN
brj-23886	179	86	was	be	AUX
brj-23886	179	87	successfully	successfully	ADV
brj-23886	179	88	constructed	construct	VERB
brj-23886	179	89	.	.	PUNCT
brj-23886	180	1	the	the	DET
brj-23886	180	2	experimental	experimental	ADJ
brj-23886	180	3	results	result	NOUN
brj-23886	180	4	indicated	indicate	VERB
brj-23886	180	5	that	that	SCONJ
brj-23886	180	6	mutations	mutation	NOUN
brj-23886	180	7	in	in	ADP
brj-23886	180	8	the	the	DET
brj-23886	180	9	promoter	promoter	NOUN
brj-23886	180	10	region	region	NOUN
brj-23886	180	11	of	of	ADP
brj-23886	180	12	key	key	ADJ
brj-23886	180	13	enzymes	enzyme	NOUN
brj-23886	180	14	can	can	AUX
brj-23886	180	15	have	have	VERB
brj-23886	180	16	an	an	DET
brj-23886	180	17	effect	effect	NOUN
brj-23886	180	18	on	on	ADP
brj-23886	180	19	the	the	DET
brj-23886	180	20	expression	expression	NOUN
brj-23886	180	21	of	of	ADP
brj-23886	180	22	key	key	ADJ
brj-23886	180	23	enzymes	enzyme	NOUN
brj-23886	180	24	.	.	PUNCT
brj-23886	181	1	the	the	DET
brj-23886	181	2	level	level	NOUN
brj-23886	181	3	of	of	ADP
brj-23886	181	4	adh	adh	PROPN
brj-23886	181	5	gene	gene	NOUN
brj-23886	181	6	in	in	ADP
brj-23886	181	7	c3	c3	PROPN
brj-23886	181	8	was	be	AUX
brj-23886	181	9	1.03	1.03	NUM
brj-23886	181	10	times	time	NOUN
brj-23886	181	11	than	than	ADP
brj-23886	181	12	that	that	PRON
brj-23886	181	13	of	of	ADP
brj-23886	181	14	c0	c0	PROPN
brj-23886	181	15	(	(	PUNCT
brj-23886	181	16	p	p	X
brj-23886	181	17	<	<	X
brj-23886	181	18	0.05	0.05	NUM
brj-23886	181	19	)	)	PUNCT
brj-23886	181	20	,	,	PUNCT
brj-23886	181	21	the	the	DET
brj-23886	181	22	expression	expression	NOUN
brj-23886	181	23	of	of	ADP
brj-23886	181	24	pfo	pfo	PROPN
brj-23886	181	25	gene	gene	NOUN
brj-23886	181	26	in	in	ADP
brj-23886	181	27	c3	c3	PROPN
brj-23886	181	28	was	be	AUX
brj-23886	181	29	1.22	1.22	NUM
brj-23886	181	30	times	time	NOUN
brj-23886	181	31	than	than	ADP
brj-23886	181	32	that	that	PRON
brj-23886	181	33	of	of	ADP
brj-23886	181	34	c0	c0	PROPN
brj-23886	181	35	(	(	PUNCT
brj-23886	181	36	p	p	X
brj-23886	181	37	<	<	X
brj-23886	181	38	0.05	0.05	NUM
brj-23886	181	39	)	)	PUNCT
brj-23886	181	40	,	,	PUNCT
brj-23886	181	41	and	and	CCONJ
brj-23886	181	42	the	the	DET
brj-23886	181	43	expression	expression	NOUN
brj-23886	181	44	of	of	ADP
brj-23886	181	45	pfk	pfk	PROPN
brj-23886	181	46	gene	gene	NOUN
brj-23886	181	47	in	in	ADP
brj-23886	181	48	c3	c3	PROPN
brj-23886	181	49	was	be	AUX
brj-23886	181	50	1.08	1.08	NUM
brj-23886	181	51	times	time	NOUN
brj-23886	181	52	than	than	ADP
brj-23886	181	53	that	that	PRON
brj-23886	181	54	of	of	ADP
brj-23886	181	55	c0	c0	PROPN
brj-23886	181	56	(	(	PUNCT
brj-23886	181	57	p	p	X
brj-23886	181	58	<	<	X
brj-23886	181	59	0.05	0.05	NUM
brj-23886	181	60	)	)	PUNCT
brj-23886	181	61	(	(	PUNCT
brj-23886	181	62	fig	fig	NOUN
brj-23886	181	63	.	.	PUNCT
brj-23886	182	1	4	4	NUM
brj-23886	182	2	)	)	PUNCT
brj-23886	182	3	.	.	PUNCT
brj-23886	183	1	fig	fig	NOUN
brj-23886	183	2	.	.	PUNCT
brj-23886	184	1	4	4	X
brj-23886	184	2	.	.	X
brj-23886	184	3	the	the	DET
brj-23886	184	4	expression	expression	NOUN
brj-23886	184	5	level	level	NOUN
brj-23886	184	6	of	of	ADP
brj-23886	184	7	three	three	NUM
brj-23886	184	8	key	key	ADJ
brj-23886	184	9	genes	gene	NOUN
brj-23886	184	10	;	;	PUNCT
brj-23886	184	11	different	different	ADJ
brj-23886	184	12	lowercase	lowercase	NOUN
brj-23886	184	13	letters	letter	NOUN
brj-23886	184	14	p	p	NOUN
brj-23886	184	15	<	<	NOUN
brj-23886	184	16	0.05	0.05	NUM
brj-23886	184	17	,	,	PUNCT
brj-23886	184	18	and	and	CCONJ
brj-23886	184	19	different	different	ADJ
brj-23886	184	20	uppercase	uppercase	ADJ
brj-23886	184	21	letters	letter	NOUN
brj-23886	185	1	p	p	NOUN
brj-23886	185	2	<	<	NOUN
brj-23886	185	3	0.01	0.01	NUM
brj-23886	185	4	effect	effect	NOUN
brj-23886	185	5	of	of	ADP
brj-23886	185	6	promoter	promoter	NOUN
brj-23886	185	7	sequence	sequence	NOUN
brj-23886	185	8	point	point	NOUN
brj-23886	185	9	mutations	mutation	NOUN
brj-23886	185	10	on	on	ADP
brj-23886	185	11	enzyme	enzyme	NOUN
brj-23886	185	12	activity	activity	NOUN
brj-23886	185	13	the	the	DET
brj-23886	185	14	enzyme	enzyme	NOUN
brj-23886	185	15	activities	activity	NOUN
brj-23886	185	16	of	of	ADP
brj-23886	185	17	the	the	DET
brj-23886	185	18	three	three	NUM
brj-23886	185	19	key	key	ADJ
brj-23886	185	20	enzymes	enzyme	NOUN
brj-23886	185	21	of	of	ADP
brj-23886	185	22	c0	c0	PROPN
brj-23886	185	23	and	and	CCONJ
brj-23886	185	24	c3	c3	PROPN
brj-23886	185	25	are	be	AUX
brj-23886	185	26	shown	show	VERB
brj-23886	185	27	in	in	ADP
brj-23886	185	28	fig	fig	NOUN
brj-23886	185	29	.	.	PUNCT
brj-23886	186	1	5	5	X
brj-23886	186	2	.	.	X
brj-23886	186	3	the	the	DET
brj-23886	186	4	enzyme	enzyme	NOUN
brj-23886	186	5	activities	activity	NOUN
brj-23886	186	6	of	of	ADP
brj-23886	186	7	adh	adh	PROPN
brj-23886	186	8	,	,	PUNCT
brj-23886	186	9	pfo	pfo	NOUN
brj-23886	186	10	,	,	PUNCT
brj-23886	186	11	and	and	CCONJ
brj-23886	186	12	pfk	pfk	PROPN
brj-23886	186	13	in	in	ADP
brj-23886	186	14	c3	c3	PROPN
brj-23886	186	15	were	be	AUX
brj-23886	186	16	all	all	ADV
brj-23886	186	17	increased	increase	VERB
brj-23886	186	18	compared	compare	VERB
brj-23886	186	19	to	to	ADP
brj-23886	186	20	these	these	PRON
brj-23886	186	21	in	in	ADP
brj-23886	186	22	c0	c0	NOUN
brj-23886	186	23	,	,	PUNCT
brj-23886	186	24	being	be	AUX
brj-23886	186	25	1.05	1.05	NUM
brj-23886	186	26	times	time	NOUN
brj-23886	186	27	,	,	PUNCT
brj-23886	186	28	1.14	1.14	NUM
brj-23886	186	29	times	time	NOUN
brj-23886	186	30	,	,	PUNCT
brj-23886	186	31	and	and	CCONJ
brj-23886	186	32	1.07	1.07	NUM
brj-23886	186	33	times	time	NOUN
brj-23886	186	34	higher	high	ADJ
brj-23886	186	35	than	than	ADP
brj-23886	186	36	c0	c0	NOUN
brj-23886	186	37	,	,	PUNCT
brj-23886	186	38	respectively	respectively	ADV
brj-23886	186	39	,	,	PUNCT
brj-23886	186	40	but	but	CCONJ
brj-23886	186	41	the	the	DET
brj-23886	186	42	changes	change	NOUN
brj-23886	186	43	of	of	ADP
brj-23886	186	44	enzyme	enzyme	NOUN
brj-23886	186	45	activity	activity	NOUN
brj-23886	186	46	in	in	ADP
brj-23886	186	47	these	these	PRON
brj-23886	186	48	were	be	AUX
brj-23886	186	49	not	not	PART
brj-23886	186	50	significant	significant	ADJ
brj-23886	186	51	.	.	PUNCT
brj-23886	187	1	the	the	DET
brj-23886	187	2	strength	strength	NOUN
brj-23886	187	3	of	of	ADP
brj-23886	187	4	the	the	DET
brj-23886	187	5	enzyme	enzyme	NOUN
brj-23886	187	6	activity	activity	NOUN
brj-23886	187	7	affected	affect	VERB
brj-23886	187	8	the	the	DET
brj-23886	187	9	efficiency	efficiency	NOUN
brj-23886	187	10	of	of	ADP
brj-23886	187	11	the	the	DET
brj-23886	187	12	catalysis	catalysis	NOUN
brj-23886	187	13	,	,	PUNCT
brj-23886	187	14	so	so	SCONJ
brj-23886	187	15	the	the	DET
brj-23886	187	16	absence	absence	NOUN
brj-23886	187	17	of	of	ADP
brj-23886	187	18	significant	significant	ADJ
brj-23886	187	19	changes	change	NOUN
brj-23886	187	20	in	in	ADP
brj-23886	187	21	enzyme	enzyme	NOUN
brj-23886	187	22	activity	activity	NOUN
brj-23886	187	23	indicated	indicate	VERB
brj-23886	187	24	that	that	SCONJ
brj-23886	187	25	the	the	DET
brj-23886	187	26	catalytic	catalytic	ADJ
brj-23886	187	27	capacity	capacity	NOUN
brj-23886	187	28	of	of	ADP
brj-23886	187	29	the	the	DET
brj-23886	187	30	enzyme	enzyme	NOUN
brj-23886	187	31	protein	protein	NOUN
brj-23886	187	32	remained	remain	VERB
brj-23886	187	33	unchanged	unchanged	ADJ
brj-23886	187	34	and	and	CCONJ
brj-23886	187	35	had	have	AUX
brj-23886	187	36	not	not	PART
brj-23886	187	37	affected	affect	VERB
brj-23886	187	38	substrate	substrate	NOUN
brj-23886	187	39	consumption	consumption	NOUN
brj-23886	187	40	and	and	CCONJ
brj-23886	187	41	product	product	NOUN
brj-23886	187	42	synthesis	synthesis	NOUN
brj-23886	187	43	(	(	PUNCT
brj-23886	187	44	petsch	petsch	NOUN
brj-23886	187	45	et	et	PROPN
brj-23886	187	46	al	al	PROPN
brj-23886	187	47	.	.	PROPN
brj-23886	187	48	2012	2012	NUM
brj-23886	187	49	)	)	PUNCT
brj-23886	187	50	.	.	PUNCT
brj-23886	188	1	the	the	DET
brj-23886	188	2	activity	activity	NOUN
brj-23886	188	3	of	of	ADP
brj-23886	188	4	enzymes	enzyme	NOUN
brj-23886	188	5	depends	depend	VERB
brj-23886	188	6	not	not	PART
brj-23886	188	7	only	only	ADV
brj-23886	188	8	on	on	ADP
brj-23886	188	9	the	the	DET
brj-23886	188	10	expression	expression	NOUN
brj-23886	188	11	level	level	NOUN
brj-23886	188	12	of	of	ADP
brj-23886	188	13	their	their	PRON
brj-23886	188	14	genes	gene	NOUN
brj-23886	188	15	,	,	PUNCT
brj-23886	188	16	but	but	CCONJ
brj-23886	188	17	the	the	DET
brj-23886	188	18	three	three	NUM
brj-23886	188	19	key	key	ADJ
brj-23886	188	20	enzymes	enzyme	NOUN
brj-23886	188	21	peer	peer	NOUN
brj-23886	188	22	-	-	PUNCT
brj-23886	188	23	reviewed	review	VERB
brj-23886	188	24	article	article	NOUN
brj-23886	188	25	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	188	26	cui	cui	PROPN
brj-23886	188	27	et	et	PROPN
brj-23886	188	28	al	al	PROPN
brj-23886	188	29	.	.	PROPN
brj-23886	189	1	(	(	PUNCT
brj-23886	189	2	2025	2025	NUM
brj-23886	189	3	)	)	PUNCT
brj-23886	189	4	.	.	PUNCT
brj-23886	190	1	“	"	PUNCT
brj-23886	190	2	genome	genome	NOUN
brj-23886	190	3	study	study	NOUN
brj-23886	190	4	of	of	ADP
brj-23886	190	5	c.	c.	PROPN
brj-23886	190	6	thermocellum	thermocellum	PROPN
brj-23886	190	7	,	,	PUNCT
brj-23886	190	8	”	"	PUNCT
brj-23886	190	9	bioresources	bioresource	NOUN
brj-23886	190	10	20(2	20(2	NUM
brj-23886	190	11	)	)	PUNCT
brj-23886	190	12	,	,	PUNCT
brj-23886	190	13	3155	3155	NUM
brj-23886	190	14	-	-	SYM
brj-23886	190	15	3175	3175	NUM
brj-23886	190	16	.	.	PUNCT
brj-23886	191	1	3166	3166	NUM
brj-23886	191	2	also	also	ADV
brj-23886	191	3	on	on	ADP
brj-23886	191	4	their	their	PRON
brj-23886	191	5	own	own	ADJ
brj-23886	191	6	structure	structure	NOUN
brj-23886	191	7	and	and	CCONJ
brj-23886	191	8	function	function	NOUN
brj-23886	191	9	.	.	PUNCT
brj-23886	192	1	therefore	therefore	ADV
brj-23886	192	2	,	,	PUNCT
brj-23886	192	3	the	the	DET
brj-23886	192	4	point	point	NOUN
brj-23886	192	5	mutations	mutation	NOUN
brj-23886	192	6	in	in	ADP
brj-23886	192	7	promoter	promoter	NOUN
brj-23886	192	8	sequences	sequence	NOUN
brj-23886	192	9	do	do	AUX
brj-23886	192	10	not	not	PART
brj-23886	192	11	necessarily	necessarily	ADV
brj-23886	192	12	cause	cause	VERB
brj-23886	192	13	changes	change	NOUN
brj-23886	192	14	in	in	ADP
brj-23886	192	15	enzyme	enzyme	NOUN
brj-23886	192	16	activity	activity	NOUN
brj-23886	192	17	.	.	PUNCT
brj-23886	193	1	the	the	DET
brj-23886	193	2	high	high	ADJ
brj-23886	193	3	expression	expression	NOUN
brj-23886	193	4	of	of	ADP
brj-23886	193	5	mrna	mrna	PROPN
brj-23886	193	6	did	do	AUX
brj-23886	193	7	not	not	PART
brj-23886	193	8	indicate	indicate	VERB
brj-23886	193	9	high	high	ADJ
brj-23886	193	10	enzyme	enzyme	NOUN
brj-23886	193	11	activity	activity	NOUN
brj-23886	193	12	.	.	PUNCT
brj-23886	194	1	protein	protein	NOUN
brj-23886	194	2	expression	expression	NOUN
brj-23886	194	3	is	be	AUX
brj-23886	194	4	closely	closely	ADV
brj-23886	194	5	related	relate	VERB
brj-23886	194	6	to	to	ADP
brj-23886	194	7	transcription	transcription	NOUN
brj-23886	194	8	and	and	CCONJ
brj-23886	194	9	translation	translation	NOUN
brj-23886	194	10	,	,	PUNCT
brj-23886	194	11	and	and	CCONJ
brj-23886	194	12	its	its	PRON
brj-23886	194	13	expression	expression	NOUN
brj-23886	194	14	is	be	AUX
brj-23886	194	15	determined	determine	VERB
brj-23886	194	16	by	by	ADP
brj-23886	194	17	the	the	DET
brj-23886	194	18	transcription	transcription	NOUN
brj-23886	194	19	level	level	NOUN
brj-23886	194	20	and	and	CCONJ
brj-23886	194	21	translation	translation	NOUN
brj-23886	194	22	process	process	NOUN
brj-23886	194	23	(	(	PUNCT
brj-23886	194	24	mikel	mikel	PROPN
brj-23886	194	25	et	et	PROPN
brj-23886	194	26	al	al	PROPN
brj-23886	194	27	.	.	PROPN
brj-23886	194	28	2021	2021	NUM
brj-23886	194	29	)	)	PUNCT
brj-23886	194	30	.	.	PUNCT
brj-23886	195	1	fig	fig	NOUN
brj-23886	195	2	.	.	PUNCT
brj-23886	196	1	5	5	NUM
brj-23886	196	2	.	.	X
brj-23886	196	3	three	three	NUM
brj-23886	196	4	kinds	kind	NOUN
brj-23886	196	5	of	of	ADP
brj-23886	196	6	key	key	ADJ
brj-23886	196	7	enzyme	enzyme	NOUN
brj-23886	196	8	activity	activity	NOUN
brj-23886	196	9	of	of	ADP
brj-23886	196	10	c0	c0	PROPN
brj-23886	196	11	and	and	CCONJ
brj-23886	196	12	c3	c3	PROPN
brj-23886	196	13	;	;	PUNCT
brj-23886	196	14	different	different	ADJ
brj-23886	196	15	lowercase	lowercase	NOUN
brj-23886	196	16	letters	letter	NOUN
brj-23886	196	17	p	p	X
brj-23886	196	18	<	<	X
brj-23886	196	19	0.05	0.05	NUM
brj-23886	196	20	,	,	PUNCT
brj-23886	196	21	and	and	CCONJ
brj-23886	196	22	different	different	ADJ
brj-23886	196	23	uppercase	uppercase	ADJ
brj-23886	196	24	letters	letter	NOUN
brj-23886	196	25	p	p	X
brj-23886	196	26	<	<	X
brj-23886	196	27	0.01	0.01	NUM
brj-23886	196	28	key	key	ADJ
brj-23886	196	29	enzyme	enzyme	NOUN
brj-23886	196	30	activity	activity	NOUN
brj-23886	196	31	and	and	CCONJ
brj-23886	196	32	expression	expression	NOUN
brj-23886	196	33	both	both	PRON
brj-23886	196	34	directly	directly	ADV
brj-23886	196	35	affect	affect	VERB
brj-23886	196	36	enzyme	enzyme	NOUN
brj-23886	196	37	catalytic	catalytic	ADJ
brj-23886	196	38	performance	performance	NOUN
brj-23886	196	39	and	and	CCONJ
brj-23886	196	40	increase	increase	VERB
brj-23886	196	41	the	the	DET
brj-23886	196	42	flux	flux	NOUN
brj-23886	196	43	increase	increase	NOUN
brj-23886	196	44	in	in	ADP
brj-23886	196	45	metabolic	metabolic	NOUN
brj-23886	196	46	pathways	pathway	NOUN
brj-23886	196	47	(	(	PUNCT
brj-23886	196	48	carere	carere	ADP
brj-23886	196	49	et	et	PROPN
brj-23886	196	50	al	al	PROPN
brj-23886	196	51	.	.	PROPN
brj-23886	196	52	2014	2014	NUM
brj-23886	196	53	;	;	PUNCT
brj-23886	196	54	wang	wang	PROPN
brj-23886	196	55	et	et	PROPN
brj-23886	196	56	al	al	PROPN
brj-23886	196	57	.	.	PROPN
brj-23886	196	58	2022	2022	NUM
brj-23886	196	59	)	)	PUNCT
brj-23886	196	60	.	.	PUNCT
brj-23886	197	1	the	the	DET
brj-23886	197	2	enzyme	enzyme	NOUN
brj-23886	197	3	expression	expression	NOUN
brj-23886	197	4	and	and	CCONJ
brj-23886	197	5	enzyme	enzyme	NOUN
brj-23886	197	6	activity	activity	NOUN
brj-23886	197	7	are	be	AUX
brj-23886	197	8	regulated	regulate	VERB
brj-23886	197	9	by	by	ADP
brj-23886	197	10	transcriptional	transcriptional	ADJ
brj-23886	197	11	level	level	NOUN
brj-23886	197	12	and	and	CCONJ
brj-23886	197	13	gene	gene	NOUN
brj-23886	197	14	level	level	NOUN
brj-23886	197	15	,	,	PUNCT
brj-23886	197	16	etc	etc	X
brj-23886	197	17	.	.	X
brj-23886	198	1	the	the	DET
brj-23886	198	2	previous	previous	ADJ
brj-23886	198	3	study	study	NOUN
brj-23886	198	4	showed	show	VERB
brj-23886	198	5	that	that	SCONJ
brj-23886	198	6	nd3	nd3	NOUN
brj-23886	198	7	+	+	CCONJ
brj-23886	198	8	can	can	AUX
brj-23886	198	9	significantly	significantly	ADV
brj-23886	198	10	increase	increase	VERB
brj-23886	198	11	the	the	DET
brj-23886	198	12	expression	expression	NOUN
brj-23886	198	13	of	of	ADP
brj-23886	198	14	acetaldehyde	acetaldehyde	NOUN
brj-23886	198	15	dehydrogenase	dehydrogenase	NOUN
brj-23886	198	16	(	(	PUNCT
brj-23886	198	17	aldh	aldh	NOUN
brj-23886	198	18	)	)	PUNCT
brj-23886	198	19	,	,	PUNCT
brj-23886	198	20	which	which	PRON
brj-23886	198	21	was	be	AUX
brj-23886	198	22	11.1	11.1	NUM
brj-23886	198	23	times	time	NOUN
brj-23886	198	24	more	more	ADJ
brj-23886	198	25	than	than	ADP
brj-23886	198	26	the	the	DET
brj-23886	198	27	original	original	ADJ
brj-23886	198	28	strain	strain	NOUN
brj-23886	198	29	.	.	PUNCT
brj-23886	199	1	however	however	ADV
brj-23886	199	2	,	,	PUNCT
brj-23886	199	3	nd3	nd3	ADJ
brj-23886	199	4	+	+	PUNCT
brj-23886	199	5	neither	neither	CCONJ
brj-23886	199	6	changed	change	VERB
brj-23886	199	7	the	the	DET
brj-23886	199	8	gene	gene	NOUN
brj-23886	199	9	sequences	sequence	NOUN
brj-23886	199	10	of	of	ADP
brj-23886	199	11	aldh	aldh	NOUN
brj-23886	199	12	and	and	CCONJ
brj-23886	199	13	adh	adh	NOUN
brj-23886	199	14	,	,	PUNCT
brj-23886	199	15	and	and	CCONJ
brj-23886	199	16	nor	nor	CCONJ
brj-23886	199	17	mutated	mutate	VERB
brj-23886	199	18	the	the	DET
brj-23886	199	19	promoter	promoter	NOUN
brj-23886	199	20	gene	gene	NOUN
brj-23886	199	21	sequence	sequence	NOUN
brj-23886	199	22	of	of	ADP
brj-23886	199	23	aldh	aldh	ADJ
brj-23886	199	24	transcription	transcription	NOUN
brj-23886	199	25	initiation	initiation	NOUN
brj-23886	199	26	.	.	PUNCT
brj-23886	200	1	the	the	DET
brj-23886	200	2	enzyme	enzyme	NOUN
brj-23886	200	3	expression	expression	NOUN
brj-23886	200	4	of	of	ADP
brj-23886	200	5	pfk	pfk	PROPN
brj-23886	200	6	and	and	CCONJ
brj-23886	200	7	pfo	pfo	PROPN
brj-23886	200	8	in	in	ADP
brj-23886	200	9	c1	c1	PROPN
brj-23886	200	10	was	be	AUX
brj-23886	200	11	3.35	3.35	NUM
brj-23886	200	12	times	time	NOUN
brj-23886	200	13	and	and	CCONJ
brj-23886	200	14	1.53	1.53	NUM
brj-23886	200	15	times	time	NOUN
brj-23886	200	16	higher	high	ADJ
brj-23886	200	17	than	than	ADP
brj-23886	200	18	that	that	PRON
brj-23886	200	19	in	in	ADP
brj-23886	200	20	c0	c0	PROPN
brj-23886	200	21	and	and	CCONJ
brj-23886	200	22	the	the	DET
brj-23886	200	23	enzyme	enzyme	NOUN
brj-23886	200	24	activity	activity	NOUN
brj-23886	200	25	of	of	ADP
brj-23886	200	26	pfk	pfk	PROPN
brj-23886	200	27	and	and	CCONJ
brj-23886	200	28	pfo	pfo	PROPN
brj-23886	200	29	in	in	ADP
brj-23886	200	30	cx	cx	PROPN
brj-23886	200	31	was	be	AUX
brj-23886	200	32	2.0	2.0	NUM
brj-23886	200	33	times	time	NOUN
brj-23886	200	34	and	and	CCONJ
brj-23886	200	35	1.48	1.48	NUM
brj-23886	200	36	times	time	NOUN
brj-23886	200	37	higher	high	ADJ
brj-23886	200	38	than	than	ADP
brj-23886	200	39	that	that	PRON
brj-23886	200	40	of	of	ADP
brj-23886	200	41	the	the	DET
brj-23886	200	42	original	original	ADJ
brj-23886	200	43	strain	strain	NOUN
brj-23886	200	44	,	,	PUNCT
brj-23886	200	45	respectively	respectively	ADV
brj-23886	200	46	,	,	PUNCT
brj-23886	200	47	and	and	CCONJ
brj-23886	200	48	the	the	DET
brj-23886	200	49	gene	gene	NOUN
brj-23886	200	50	sequences	sequence	NOUN
brj-23886	200	51	of	of	ADP
brj-23886	200	52	these	these	DET
brj-23886	200	53	two	two	NUM
brj-23886	200	54	enzymes	enzyme	NOUN
brj-23886	200	55	were	be	AUX
brj-23886	200	56	altered	alter	VERB
brj-23886	200	57	by	by	ADP
brj-23886	200	58	nd3	nd3	VERB
brj-23886	200	59	+	+	SYM
brj-23886	200	60	(	(	PUNCT
brj-23886	200	61	wang	wang	PROPN
brj-23886	200	62	et	et	PROPN
brj-23886	200	63	al	al	PROPN
brj-23886	200	64	.	.	PROPN
brj-23886	200	65	2022	2022	NUM
brj-23886	200	66	)	)	PUNCT
brj-23886	200	67	.	.	PUNCT
brj-23886	201	1	in	in	ADP
brj-23886	201	2	this	this	DET
brj-23886	201	3	experiment	experiment	NOUN
brj-23886	201	4	,	,	PUNCT
brj-23886	201	5	adh	adh	PROPN
brj-23886	201	6	,	,	PUNCT
brj-23886	201	7	pfo	pfo	NOUN
brj-23886	201	8	,	,	PUNCT
brj-23886	201	9	and	and	CCONJ
brj-23886	201	10	pfk	pfk	PROPN
brj-23886	201	11	promoter	promoter	NOUN
brj-23886	201	12	sequences	sequence	NOUN
brj-23886	201	13	were	be	AUX
brj-23886	201	14	mutated	mutate	VERB
brj-23886	201	15	,	,	PUNCT
brj-23886	201	16	and	and	CCONJ
brj-23886	201	17	the	the	DET
brj-23886	201	18	fixed	fix	VERB
brj-23886	201	19	point	point	NOUN
brj-23886	201	20	mutation	mutation	NOUN
brj-23886	201	21	verified	verify	VERB
brj-23886	201	22	that	that	SCONJ
brj-23886	201	23	the	the	DET
brj-23886	201	24	expression	expression	NOUN
brj-23886	201	25	of	of	ADP
brj-23886	201	26	pfo	pfo	PROPN
brj-23886	201	27	was	be	AUX
brj-23886	201	28	significantly	significantly	ADV
brj-23886	201	29	increased	increase	VERB
brj-23886	201	30	,	,	PUNCT
brj-23886	201	31	which	which	PRON
brj-23886	201	32	was	be	AUX
brj-23886	201	33	1.22fold	1.22fold	NUM
brj-23886	201	34	of	of	ADP
brj-23886	201	35	the	the	DET
brj-23886	201	36	original	original	ADJ
brj-23886	201	37	strain	strain	NOUN
brj-23886	201	38	.	.	PUNCT
brj-23886	202	1	while	while	SCONJ
brj-23886	202	2	the	the	DET
brj-23886	202	3	expression	expression	NOUN
brj-23886	202	4	of	of	ADP
brj-23886	202	5	adh	adh	PROPN
brj-23886	202	6	and	and	CCONJ
brj-23886	202	7	pfk	pfk	PROPN
brj-23886	202	8	and	and	CCONJ
brj-23886	202	9	the	the	DET
brj-23886	202	10	enzyme	enzyme	NOUN
brj-23886	202	11	activity	activity	NOUN
brj-23886	202	12	of	of	ADP
brj-23886	202	13	the	the	DET
brj-23886	202	14	three	three	NUM
brj-23886	202	15	key	key	ADJ
brj-23886	202	16	enzymes	enzyme	NOUN
brj-23886	202	17	were	be	AUX
brj-23886	202	18	not	not	PART
brj-23886	202	19	significantly	significantly	ADV
brj-23886	202	20	changed	change	VERB
brj-23886	202	21	.	.	PUNCT
brj-23886	203	1	this	this	PRON
brj-23886	203	2	indicates	indicate	VERB
brj-23886	203	3	that	that	SCONJ
brj-23886	203	4	the	the	DET
brj-23886	203	5	effects	effect	NOUN
brj-23886	203	6	of	of	ADP
brj-23886	203	7	mutagenesis	mutagenesis	NOUN
brj-23886	203	8	on	on	ADP
brj-23886	203	9	the	the	DET
brj-23886	203	10	structure	structure	NOUN
brj-23886	203	11	,	,	PUNCT
brj-23886	203	12	function	function	NOUN
brj-23886	203	13	,	,	PUNCT
brj-23886	203	14	and	and	CCONJ
brj-23886	203	15	stability	stability	NOUN
brj-23886	203	16	of	of	ADP
brj-23886	203	17	key	key	ADJ
brj-23886	203	18	enzyme	enzyme	NOUN
brj-23886	203	19	sequences	sequence	NOUN
brj-23886	203	20	and	and	CCONJ
brj-23886	203	21	promoters	promoter	NOUN
brj-23886	203	22	in	in	ADP
brj-23886	203	23	the	the	DET
brj-23886	203	24	metabolic	metabolic	NOUN
brj-23886	203	25	pathway	pathway	NOUN
brj-23886	203	26	are	be	AUX
brj-23886	203	27	somewhat	somewhat	ADV
brj-23886	203	28	contingent	contingent	ADJ
brj-23886	203	29	and	and	CCONJ
brj-23886	203	30	random	random	ADJ
brj-23886	203	31	and	and	CCONJ
brj-23886	203	32	involve	involve	VERB
brj-23886	203	33	the	the	DET
brj-23886	203	34	regulation	regulation	NOUN
brj-23886	203	35	of	of	ADP
brj-23886	203	36	other	other	ADJ
brj-23886	203	37	regulatory	regulatory	ADJ
brj-23886	203	38	factors	factor	NOUN
brj-23886	203	39	(	(	PUNCT
brj-23886	203	40	furukawa	furukawa	PROPN
brj-23886	203	41	et	et	PROPN
brj-23886	203	42	al	al	PROPN
brj-23886	203	43	.	.	PROPN
brj-23886	203	44	2009	2009	NUM
brj-23886	203	45	)	)	PUNCT
brj-23886	203	46	.	.	PUNCT
brj-23886	204	1	therefore	therefore	ADV
brj-23886	204	2	,	,	PUNCT
brj-23886	204	3	sequence	sequence	NOUN
brj-23886	204	4	changes	change	NOUN
brj-23886	204	5	in	in	ADP
brj-23886	204	6	key	key	ADJ
brj-23886	204	7	enzyme	enzyme	NOUN
brj-23886	204	8	sequences	sequence	NOUN
brj-23886	204	9	and	and	CCONJ
brj-23886	204	10	promoter	promoter	NOUN
brj-23886	204	11	regions	region	NOUN
brj-23886	204	12	are	be	AUX
brj-23886	204	13	not	not	PART
brj-23886	204	14	the	the	DET
brj-23886	204	15	only	only	ADJ
brj-23886	204	16	reason	reason	NOUN
brj-23886	204	17	for	for	ADP
brj-23886	204	18	affecting	affect	VERB
brj-23886	204	19	the	the	DET
brj-23886	204	20	expression	expression	NOUN
brj-23886	204	21	and	and	CCONJ
brj-23886	204	22	enzyme	enzyme	NOUN
brj-23886	204	23	activity	activity	NOUN
brj-23886	204	24	of	of	ADP
brj-23886	204	25	key	key	ADJ
brj-23886	204	26	enzymes	enzyme	NOUN
brj-23886	204	27	.	.	PUNCT
brj-23886	205	1	peer	peer	NOUN
brj-23886	205	2	-	-	PUNCT
brj-23886	205	3	reviewed	review	VERB
brj-23886	205	4	article	article	NOUN
brj-23886	205	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	205	6	cui	cui	PROPN
brj-23886	205	7	et	et	PROPN
brj-23886	205	8	al	al	PROPN
brj-23886	205	9	.	.	PROPN
brj-23886	206	1	(	(	PUNCT
brj-23886	206	2	2025	2025	NUM
brj-23886	206	3	)	)	PUNCT
brj-23886	206	4	.	.	PUNCT
brj-23886	207	1	“	"	PUNCT
brj-23886	207	2	genome	genome	NOUN
brj-23886	207	3	study	study	NOUN
brj-23886	207	4	of	of	ADP
brj-23886	207	5	c.	c.	PROPN
brj-23886	207	6	thermocellum	thermocellum	PROPN
brj-23886	207	7	,	,	PUNCT
brj-23886	207	8	”	"	PUNCT
brj-23886	207	9	bioresources	bioresource	NOUN
brj-23886	207	10	20(2	20(2	NUM
brj-23886	207	11	)	)	PUNCT
brj-23886	207	12	,	,	PUNCT
brj-23886	207	13	3155	3155	NUM
brj-23886	207	14	-	-	SYM
brj-23886	207	15	3175	3175	NUM
brj-23886	207	16	.	.	PUNCT
brj-23886	208	1	3167	3167	NUM
brj-23886	208	2	results	result	NOUN
brj-23886	208	3	of	of	ADP
brj-23886	208	4	comparative	comparative	ADJ
brj-23886	208	5	genomic	genomic	NOUN
brj-23886	208	6	analysis	analysis	NOUN
brj-23886	208	7	through	through	ADP
brj-23886	208	8	sequencing	sequence	VERB
brj-23886	208	9	the	the	DET
brj-23886	208	10	dna	dna	PROPN
brj-23886	208	11	libraries	library	NOUN
brj-23886	208	12	of	of	ADP
brj-23886	208	13	c1	c1	PROPN
brj-23886	208	14	and	and	CCONJ
brj-23886	208	15	c0	c0	PROPN
brj-23886	208	16	,	,	PUNCT
brj-23886	208	17	the	the	DET
brj-23886	208	18	original	original	ADJ
brj-23886	208	19	strain	strain	NOUN
brj-23886	208	20	sequencing	sequence	VERB
brj-23886	208	21	data	datum	NOUN
brj-23886	208	22	were	be	AUX
brj-23886	208	23	1358	1358	NUM
brj-23886	208	24	and	and	CCONJ
brj-23886	208	25	1458	1458	NUM
brj-23886	208	26	mb	mb	NOUN
brj-23886	208	27	,	,	PUNCT
brj-23886	208	28	respectively	respectively	ADV
brj-23886	208	29	,	,	PUNCT
brj-23886	208	30	with	with	ADP
brj-23886	208	31	a	a	DET
brj-23886	208	32	read	read	NOUN
brj-23886	208	33	length	length	NOUN
brj-23886	208	34	of	of	ADP
brj-23886	208	35	150	150	NUM
brj-23886	208	36	bp	bp	PROPN
brj-23886	208	37	.	.	PUNCT
brj-23886	208	38	table	table	NOUN
brj-23886	208	39	7	7	NUM
brj-23886	208	40	shows	show	VERB
brj-23886	208	41	good	good	ADJ
brj-23886	208	42	sequencing	sequencing	NOUN
brj-23886	208	43	quality	quality	NOUN
brj-23886	208	44	.	.	PUNCT
brj-23886	209	1	the	the	DET
brj-23886	209	2	four	four	NUM
brj-23886	209	3	lines	line	NOUN
brj-23886	209	4	of	of	ADP
brj-23886	209	5	the	the	DET
brj-23886	209	6	results	result	NOUN
brj-23886	209	7	of	of	ADP
brj-23886	209	8	high	high	ADJ
brj-23886	209	9	quality	quality	NOUN
brj-23886	209	10	library	library	NOUN
brj-23886	209	11	construction	construction	NOUN
brj-23886	209	12	and	and	CCONJ
brj-23886	209	13	sequencing	sequencing	NOUN
brj-23886	209	14	were	be	AUX
brj-23886	209	15	good	good	ADJ
brj-23886	209	16	by	by	ADP
brj-23886	209	17	being	be	AUX
brj-23886	209	18	close	close	ADJ
brj-23886	209	19	and	and	CCONJ
brj-23886	209	20	parallel	parallel	ADJ
brj-23886	209	21	,	,	PUNCT
brj-23886	209	22	and	and	CCONJ
brj-23886	209	23	the	the	DET
brj-23886	209	24	gc	gc	PROPN
brj-23886	209	25	and	and	CCONJ
brj-23886	209	26	at	at	ADP
brj-23886	209	27	contents	content	NOUN
brj-23886	209	28	match	match	VERB
brj-23886	209	29	well	well	ADV
brj-23886	209	30	as	as	SCONJ
brj-23886	209	31	seen	see	VERB
brj-23886	209	32	in	in	ADP
brj-23886	209	33	fig	fig	NOUN
brj-23886	209	34	.	.	PUNCT
brj-23886	210	1	6(a	6(a	NUM
brj-23886	210	2	)	)	PUNCT
brj-23886	211	1	and	and	CCONJ
brj-23886	211	2	(	(	PUNCT
brj-23886	211	3	b	b	NOUN
brj-23886	211	4	)	)	PUNCT
brj-23886	211	5	.	.	PUNCT
brj-23886	212	1	as	as	SCONJ
brj-23886	212	2	shown	show	VERB
brj-23886	212	3	by	by	ADP
brj-23886	212	4	the	the	DET
brj-23886	212	5	base	base	ADJ
brj-23886	212	6	quality	quality	NOUN
brj-23886	212	7	distribution	distribution	NOUN
brj-23886	212	8	in	in	ADP
brj-23886	212	9	fig	fig	NOUN
brj-23886	212	10	.	.	PUNCT
brj-23886	213	1	6	6	NUM
brj-23886	213	2	(	(	PUNCT
brj-23886	213	3	c	c	NOUN
brj-23886	213	4	)	)	PUNCT
brj-23886	213	5	and	and	CCONJ
brj-23886	213	6	(	(	PUNCT
brj-23886	213	7	d	d	NOUN
brj-23886	213	8	)	)	PUNCT
brj-23886	213	9	,	,	PUNCT
brj-23886	213	10	the	the	DET
brj-23886	213	11	average	average	ADJ
brj-23886	213	12	error	error	NOUN
brj-23886	213	13	rate	rate	NOUN
brj-23886	213	14	of	of	ADP
brj-23886	213	15	the	the	DET
brj-23886	213	16	bases	basis	NOUN
brj-23886	213	17	was	be	AUX
brj-23886	213	18	all	all	ADV
brj-23886	213	19	below	below	ADP
brj-23886	213	20	0.05	0.05	NUM
brj-23886	213	21	%	%	NOUN
brj-23886	213	22	.	.	PUNCT
brj-23886	214	1	the	the	DET
brj-23886	214	2	results	result	NOUN
brj-23886	214	3	indicate	indicate	VERB
brj-23886	214	4	that	that	SCONJ
brj-23886	214	5	the	the	DET
brj-23886	214	6	genome	genome	NOUN
brj-23886	214	7	resequencing	resequencing	NOUN
brj-23886	214	8	data	datum	NOUN
brj-23886	214	9	have	have	VERB
brj-23886	214	10	good	good	ADJ
brj-23886	214	11	results	result	NOUN
brj-23886	214	12	and	and	CCONJ
brj-23886	214	13	can	can	AUX
brj-23886	214	14	be	be	AUX
brj-23886	214	15	analyzed	analyze	VERB
brj-23886	214	16	in	in	ADP
brj-23886	214	17	the	the	DET
brj-23886	214	18	next	next	ADJ
brj-23886	214	19	step	step	NOUN
brj-23886	214	20	.	.	PUNCT
brj-23886	215	1	table	table	NOUN
brj-23886	215	2	7	7	NUM
brj-23886	215	3	.	.	PUNCT
brj-23886	216	1	sequencing	sequence	VERB
brj-23886	216	2	data	datum	NOUN
brj-23886	216	3	statistics	statistic	NOUN
brj-23886	216	4	sample	sample	NOUN
brj-23886	216	5	i	i	PROPN
brj-23886	216	6	d	d	PROPN
brj-23886	216	7	insert	insert	PROPN
brj-23886	216	8	size	size	NOUN
brj-23886	216	9	(	(	PUNCT
brj-23886	216	10	bp	bp	PROPN
brj-23886	216	11	)	)	PUNCT
brj-23886	216	12	reads	read	VERB
brj-23886	216	13	length	length	NOUN
brj-23886	216	14	(	(	PUNCT
brj-23886	216	15	bp	bp	PROPN
brj-23886	216	16	)	)	PUNCT
brj-23886	216	17	raw	raw	ADJ
brj-23886	216	18	data	datum	NOUN
brj-23886	216	19	(	(	PUNCT
brj-23886	216	20	mb	mb	NOUN
brj-23886	216	21	)	)	PUNCT
brj-23886	216	22	filtered	filter	VERB
brj-23886	216	23	reads	read	NOUN
brj-23886	216	24	(	(	PUNCT
brj-23886	216	25	%	%	INTJ
brj-23886	216	26	)	)	PUNCT
brj-23886	216	27	clean	clean	ADJ
brj-23886	216	28	data	datum	NOUN
brj-23886	216	29	(	(	PUNCT
brj-23886	216	30	mb	mb	NOUN
brj-23886	216	31	)	)	PUNCT
brj-23886	216	32	gc	gc	PROPN
brj-23886	216	33	(	(	PUNCT
brj-23886	216	34	%	%	INTJ
brj-23886	216	35	)	)	PUNCT
brj-23886	216	36	q20	q20	NOUN
brj-23886	216	37	(	(	PUNCT
brj-23886	216	38	%	%	INTJ
brj-23886	216	39	)	)	PUNCT
brj-23886	216	40	q30	q30	PROPN
brj-23886	216	41	(	(	PUNCT
brj-23886	216	42	%	%	INTJ
brj-23886	216	43	)	)	PUNCT
brj-23886	216	44	c1	c1	NOUN
brj-23886	216	45	350	350	NUM
brj-23886	216	46	(	(	PUNCT
brj-23886	216	47	150:150	150:150	NOUN
brj-23886	216	48	)	)	PUNCT
brj-23886	216	49	1,358	1,358	NUM
brj-23886	216	50	7.92	7.92	NUM
brj-23886	216	51	1,250	1,250	NUM
brj-23886	216	52	38.23	38.23	NUM
brj-23886	216	53	95.91	95.91	NUM
brj-23886	216	54	89.76	89.76	NUM
brj-23886	216	55	c0	c0	NOUN
brj-23886	216	56	350	350	NUM
brj-23886	216	57	(	(	PUNCT
brj-23886	216	58	150:150	150:150	NOUN
brj-23886	216	59	)	)	PUNCT
brj-23886	216	60	1,458	1,458	NUM
brj-23886	216	61	7.72	7.72	NUM
brj-23886	216	62	1,346	1,346	NUM
brj-23886	216	63	38.45	38.45	NUM
brj-23886	216	64	95.61	95.61	NUM
brj-23886	216	65	89.19	89.19	NUM
brj-23886	216	66	fig	fig	NOUN
brj-23886	216	67	.	.	PUNCT
brj-23886	217	1	6	6	NUM
brj-23886	217	2	.	.	X
brj-23886	217	3	base	base	NOUN
brj-23886	217	4	content	content	NOUN
brj-23886	217	5	and	and	CCONJ
brj-23886	217	6	base	base	NOUN
brj-23886	217	7	mass	mass	ADJ
brj-23886	217	8	distribution	distribution	NOUN
brj-23886	217	9	of	of	ADP
brj-23886	217	10	c0	c0	PROPN
brj-23886	217	11	,	,	PUNCT
brj-23886	217	12	c1	c1	PROPN
brj-23886	217	13	:	:	PUNCT
brj-23886	217	14	(	(	PUNCT
brj-23886	217	15	a	a	X
brj-23886	217	16	)	)	PUNCT
brj-23886	217	17	c0	c0	PROPN
brj-23886	217	18	base	base	NOUN
brj-23886	217	19	mass	mass	NOUN
brj-23886	217	20	distribution	distribution	NOUN
brj-23886	217	21	map	map	NOUN
brj-23886	217	22	;	;	PUNCT
brj-23886	217	23	(	(	PUNCT
brj-23886	217	24	b	b	X
brj-23886	217	25	)	)	PUNCT
brj-23886	217	26	c1	c1	NOUN
brj-23886	217	27	base	base	NOUN
brj-23886	217	28	mass	mass	NOUN
brj-23886	217	29	distribution	distribution	NOUN
brj-23886	217	30	map	map	NOUN
brj-23886	217	31	;	;	PUNCT
brj-23886	217	32	(	(	PUNCT
brj-23886	217	33	c	c	X
brj-23886	217	34	)	)	PUNCT
brj-23886	217	35	c0	c0	NOUN
brj-23886	217	36	base	base	PROPN
brj-23886	217	37	mass	mass	NOUN
brj-23886	217	38	distribution	distribution	NOUN
brj-23886	217	39	map	map	NOUN
brj-23886	217	40	;	;	PUNCT
brj-23886	217	41	(	(	PUNCT
brj-23886	217	42	d	d	X
brj-23886	217	43	)	)	PUNCT
brj-23886	217	44	is	be	AUX
brj-23886	217	45	c1	c1	PROPN
brj-23886	217	46	base	base	PROPN
brj-23886	217	47	mass	mass	NOUN
brj-23886	217	48	distribution	distribution	NOUN
brj-23886	217	49	map	map	NOUN
brj-23886	217	50	peer	peer	NOUN
brj-23886	217	51	-	-	PUNCT
brj-23886	217	52	reviewed	review	VERB
brj-23886	217	53	article	article	NOUN
brj-23886	217	54	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	217	55	cui	cui	PROPN
brj-23886	217	56	et	et	PROPN
brj-23886	217	57	al	al	PROPN
brj-23886	217	58	.	.	PROPN
brj-23886	218	1	(	(	PUNCT
brj-23886	218	2	2025	2025	NUM
brj-23886	218	3	)	)	PUNCT
brj-23886	218	4	.	.	PUNCT
brj-23886	219	1	“	"	PUNCT
brj-23886	219	2	genome	genome	NOUN
brj-23886	219	3	study	study	NOUN
brj-23886	219	4	of	of	ADP
brj-23886	219	5	c.	c.	PROPN
brj-23886	219	6	thermocellum	thermocellum	PROPN
brj-23886	219	7	,	,	PUNCT
brj-23886	219	8	”	"	PUNCT
brj-23886	219	9	bioresources	bioresource	NOUN
brj-23886	219	10	20(2	20(2	NUM
brj-23886	219	11	)	)	PUNCT
brj-23886	219	12	,	,	PUNCT
brj-23886	219	13	3155	3155	NUM
brj-23886	219	14	-	-	SYM
brj-23886	219	15	3175	3175	NUM
brj-23886	219	16	.	.	PUNCT
brj-23886	220	1	3168	3168	NUM
brj-23886	220	2	there	there	PRON
brj-23886	220	3	were	be	VERB
brj-23886	220	4	3839	3839	NUM
brj-23886	220	5	and	and	CCONJ
brj-23886	220	6	3862	3862	NUM
brj-23886	220	7	base	base	NOUN
brj-23886	220	8	conversions	conversion	NOUN
brj-23886	220	9	,	,	PUNCT
brj-23886	220	10	1261	1261	NUM
brj-23886	220	11	and	and	CCONJ
brj-23886	220	12	1267	1267	NUM
brj-23886	220	13	base	base	NOUN
brj-23886	220	14	reversals	reversal	NOUN
brj-23886	220	15	,	,	PUNCT
brj-23886	220	16	341	341	NUM
brj-23886	220	17	and	and	CCONJ
brj-23886	220	18	386	386	NUM
brj-23886	220	19	heterozygous	heterozygous	ADJ
brj-23886	220	20	snps	snps	NOUN
brj-23886	220	21	,	,	PUNCT
brj-23886	220	22	and	and	CCONJ
brj-23886	220	23	4759	4759	NUM
brj-23886	220	24	and	and	CCONJ
brj-23886	220	25	4743	4743	NUM
brj-23886	220	26	pure	pure	ADJ
brj-23886	220	27	snps	snps	PROPN
brj-23886	220	28	in	in	ADP
brj-23886	220	29	c0	c0	PROPN
brj-23886	220	30	and	and	CCONJ
brj-23886	220	31	c1	c1	PROPN
brj-23886	220	32	,	,	PUNCT
brj-23886	220	33	respectively	respectively	ADV
brj-23886	220	34	.	.	PUNCT
brj-23886	221	1	c0	c0	PROPN
brj-23886	221	2	has	have	VERB
brj-23886	221	3	1639	1639	NUM
brj-23886	221	4	non	non	ADJ
brj-23886	221	5	-	-	ADJ
brj-23886	221	6	synonymous	synonymous	ADJ
brj-23886	221	7	mutations	mutation	NOUN
brj-23886	221	8	and	and	CCONJ
brj-23886	221	9	2449	2449	NUM
brj-23886	221	10	synonymous	synonymous	ADJ
brj-23886	221	11	mutations	mutation	NOUN
brj-23886	221	12	.	.	PUNCT
brj-23886	222	1	c1	c1	PROPN
brj-23886	222	2	has	have	VERB
brj-23886	222	3	1659	1659	NUM
brj-23886	222	4	nonsynonymous	nonsynonymous	ADJ
brj-23886	222	5	mutations	mutation	NOUN
brj-23886	222	6	and	and	CCONJ
brj-23886	222	7	2473	2473	NUM
brj-23886	222	8	synonymous	synonymous	ADJ
brj-23886	222	9	mutations	mutation	NOUN
brj-23886	222	10	.	.	PUNCT
brj-23886	223	1	amino	amino	NOUN
brj-23886	223	2	acid	acid	NOUN
brj-23886	223	3	mutations	mutation	NOUN
brj-23886	223	4	caused	cause	VERB
brj-23886	223	5	by	by	ADP
brj-23886	223	6	nonsynonymous	nonsynonymous	ADJ
brj-23886	223	7	mutations	mutation	NOUN
brj-23886	223	8	can	can	AUX
brj-23886	223	9	further	far	ADV
brj-23886	223	10	affect	affect	VERB
brj-23886	223	11	gene	gene	NOUN
brj-23886	223	12	expression	expression	NOUN
brj-23886	223	13	.	.	PUNCT
brj-23886	224	1	there	there	PRON
brj-23886	224	2	were	be	VERB
brj-23886	224	3	93	93	NUM
brj-23886	224	4	mutations	mutation	NOUN
brj-23886	224	5	involving	involve	VERB
brj-23886	224	6	a	a	DET
brj-23886	224	7	total	total	NOUN
brj-23886	224	8	of	of	ADP
brj-23886	224	9	35	35	NUM
brj-23886	224	10	proteins	protein	NOUN
brj-23886	224	11	or	or	CCONJ
brj-23886	224	12	enzymes	enzyme	NOUN
brj-23886	224	13	with	with	ADP
brj-23886	224	14	mutated	mutate	VERB
brj-23886	224	15	gene	gene	NOUN
brj-23886	224	16	sequences	sequence	NOUN
brj-23886	224	17	.	.	PUNCT
brj-23886	225	1	the	the	DET
brj-23886	225	2	annotation	annotation	NOUN
brj-23886	225	3	analysis	analysis	NOUN
brj-23886	225	4	yielded	yield	VERB
brj-23886	225	5	mutations	mutation	NOUN
brj-23886	225	6	in	in	ADP
brj-23886	225	7	genes	gene	NOUN
brj-23886	225	8	related	relate	VERB
brj-23886	225	9	to	to	ADP
brj-23886	225	10	the	the	DET
brj-23886	225	11	biosynthesis	biosynthesis	NOUN
brj-23886	225	12	of	of	ADP
brj-23886	225	13	cell	cell	NOUN
brj-23886	225	14	walls	wall	NOUN
brj-23886	225	15	and	and	CCONJ
brj-23886	225	16	cell	cell	NOUN
brj-23886	225	17	membranes	membrane	NOUN
brj-23886	225	18	,	,	PUNCT
brj-23886	225	19	methylotropic	methylotropic	ADJ
brj-23886	225	20	receptor	receptor	NOUN
brj-23886	225	21	protein	protein	NOUN
brj-23886	225	22	genes	gene	NOUN
brj-23886	225	23	,	,	PUNCT
brj-23886	225	24	ribonucleases	ribonuclease	NOUN
brj-23886	225	25	,	,	PUNCT
brj-23886	225	26	endonuclease	endonuclease	NOUN
brj-23886	225	27	genes	gene	NOUN
brj-23886	225	28	,	,	PUNCT
brj-23886	225	29	transcriptional	transcriptional	ADJ
brj-23886	225	30	regulators	regulator	NOUN
brj-23886	225	31	,	,	PUNCT
brj-23886	225	32	methyltransferase	methyltransferase	NOUN
brj-23886	225	33	genes	gene	NOUN
brj-23886	225	34	,	,	PUNCT
brj-23886	225	35	and	and	CCONJ
brj-23886	225	36	transposase	transposase	NOUN
brj-23886	225	37	genes	gene	NOUN
brj-23886	225	38	,	,	PUNCT
brj-23886	225	39	in	in	ADP
brj-23886	225	40	addition	addition	NOUN
brj-23886	225	41	to	to	ADP
brj-23886	225	42	mutations	mutation	NOUN
brj-23886	225	43	in	in	ADP
brj-23886	225	44	genes	gene	NOUN
brj-23886	225	45	related	relate	VERB
brj-23886	225	46	to	to	ADP
brj-23886	225	47	putative	putative	ADJ
brj-23886	225	48	proteins	protein	NOUN
brj-23886	225	49	and	and	CCONJ
brj-23886	225	50	proteins	protein	NOUN
brj-23886	225	51	of	of	ADP
brj-23886	225	52	unknown	unknown	ADJ
brj-23886	225	53	function	function	NOUN
brj-23886	225	54	.	.	PUNCT
brj-23886	226	1	these	these	DET
brj-23886	226	2	mutated	mutate	VERB
brj-23886	226	3	genes	gene	NOUN
brj-23886	226	4	may	may	AUX
brj-23886	226	5	be	be	AUX
brj-23886	226	6	associated	associate	VERB
brj-23886	226	7	with	with	ADP
brj-23886	226	8	gene	gene	NOUN
brj-23886	226	9	expression	expression	NOUN
brj-23886	226	10	,	,	PUNCT
brj-23886	226	11	metabolism	metabolism	NOUN
brj-23886	226	12	and	and	CCONJ
brj-23886	226	13	signaling	signaling	NOUN
brj-23886	226	14	,	,	PUNCT
brj-23886	226	15	and	and	CCONJ
brj-23886	226	16	dna	dna	PROPN
brj-23886	226	17	methylation	methylation	NOUN
brj-23886	226	18	.	.	PUNCT
brj-23886	227	1	by	by	ADP
brj-23886	227	2	regulating	regulate	VERB
brj-23886	227	3	the	the	DET
brj-23886	227	4	expression	expression	NOUN
brj-23886	227	5	of	of	ADP
brj-23886	227	6	the	the	DET
brj-23886	227	7	key	key	ADJ
brj-23886	227	8	genes	gene	NOUN
brj-23886	227	9	in	in	ADP
brj-23886	227	10	the	the	DET
brj-23886	227	11	microbial	microbial	ADJ
brj-23886	227	12	metabolic	metabolic	NOUN
brj-23886	227	13	pathway	pathway	NOUN
brj-23886	227	14	,	,	PUNCT
brj-23886	227	15	it	it	PRON
brj-23886	227	16	can	can	AUX
brj-23886	227	17	promote	promote	VERB
brj-23886	227	18	metabolism	metabolism	NOUN
brj-23886	227	19	,	,	PUNCT
brj-23886	227	20	accelerate	accelerate	VERB
brj-23886	227	21	the	the	DET
brj-23886	227	22	influx	influx	NOUN
brj-23886	227	23	of	of	ADP
brj-23886	227	24	nutrients	nutrient	NOUN
brj-23886	227	25	and	and	CCONJ
brj-23886	227	26	produce	produce	VERB
brj-23886	227	27	the	the	DET
brj-23886	227	28	efflux	efflux	NOUN
brj-23886	227	29	of	of	ADP
brj-23886	227	30	inhibitors	inhibitor	NOUN
brj-23886	227	31	,	,	PUNCT
brj-23886	227	32	leading	lead	VERB
brj-23886	227	33	to	to	ADP
brj-23886	227	34	increase	increase	NOUN
brj-23886	227	35	of	of	ADP
brj-23886	227	36	ethanol	ethanol	NOUN
brj-23886	227	37	production	production	NOUN
brj-23886	227	38	(	(	PUNCT
brj-23886	227	39	nataf	nataf	NOUN
brj-23886	227	40	et	et	PROPN
brj-23886	227	41	al	al	PROPN
brj-23886	227	42	.	.	PROPN
brj-23886	227	43	2010	2010	NUM
brj-23886	227	44	)	)	PUNCT
brj-23886	227	45	.	.	PUNCT
brj-23886	228	1	there	there	PRON
brj-23886	228	2	were	be	VERB
brj-23886	228	3	70	70	NUM
brj-23886	228	4	structural	structural	ADJ
brj-23886	228	5	variants	variant	NOUN
brj-23886	228	6	in	in	ADP
brj-23886	228	7	c0	c0	PROPN
brj-23886	228	8	,	,	PUNCT
brj-23886	228	9	including	include	VERB
brj-23886	228	10	7	7	NUM
brj-23886	228	11	intrachromosomal	intrachromosomal	ADJ
brj-23886	228	12	migrations	migration	NOUN
brj-23886	228	13	,	,	PUNCT
brj-23886	228	14	60	60	NUM
brj-23886	228	15	deleted	delete	VERB
brj-23886	228	16	svs	svs	NOUN
brj-23886	228	17	,	,	PUNCT
brj-23886	228	18	and	and	CCONJ
brj-23886	228	19	3	3	NUM
brj-23886	228	20	inverted	invert	VERB
brj-23886	228	21	svs	svs	NOUN
brj-23886	228	22	.	.	PUNCT
brj-23886	229	1	there	there	PRON
brj-23886	229	2	were	be	VERB
brj-23886	229	3	66	66	NUM
brj-23886	229	4	structural	structural	ADJ
brj-23886	229	5	variants	variant	NOUN
brj-23886	229	6	in	in	ADP
brj-23886	229	7	c1	c1	PROPN
brj-23886	229	8	,	,	PUNCT
brj-23886	229	9	including	include	VERB
brj-23886	229	10	6	6	NUM
brj-23886	229	11	intrachromosomal	intrachromosomal	ADJ
brj-23886	229	12	migrations	migration	NOUN
brj-23886	229	13	,	,	PUNCT
brj-23886	229	14	57	57	NUM
brj-23886	229	15	deleted	delete	VERB
brj-23886	229	16	svs	svs	NOUN
brj-23886	229	17	,	,	PUNCT
brj-23886	229	18	and	and	CCONJ
brj-23886	229	19	3	3	NUM
brj-23886	229	20	inverted	invert	VERB
brj-23886	229	21	svs	svs	NOUN
brj-23886	229	22	.	.	PUNCT
brj-23886	230	1	there	there	PRON
brj-23886	230	2	were	be	VERB
brj-23886	230	3	80	80	NUM
brj-23886	230	4	%	%	NOUN
brj-23886	230	5	of	of	ADP
brj-23886	230	6	svs	sv	VERB
brj-23886	230	7	with	with	ADP
brj-23886	230	8	length	length	NOUN
brj-23886	230	9	of	of	ADP
brj-23886	230	10	1000	1000	NUM
brj-23886	230	11	bp	bp	NOUN
brj-23886	230	12	or	or	CCONJ
brj-23886	230	13	more	more	ADJ
brj-23886	230	14	.	.	PUNCT
brj-23886	231	1	the	the	DET
brj-23886	231	2	svs	svs	NOUN
brj-23886	231	3	in	in	ADP
brj-23886	231	4	this	this	DET
brj-23886	231	5	experiment	experiment	NOUN
brj-23886	231	6	mainly	mainly	ADV
brj-23886	231	7	involved	involve	VERB
brj-23886	231	8	integrase	integrase	PROPN
brj-23886	231	9	catalytic	catalytic	ADJ
brj-23886	231	10	region	region	NOUN
brj-23886	231	11	,	,	PUNCT
brj-23886	231	12	transposase	transposase	NOUN
brj-23886	231	13	,	,	PUNCT
brj-23886	231	14	and	and	CCONJ
brj-23886	231	15	transcription	transcription	NOUN
brj-23886	231	16	terminator	terminator	NOUN
brj-23886	231	17	rho	rho	NOUN
brj-23886	231	18	.	.	PUNCT
brj-23886	232	1	the	the	DET
brj-23886	232	2	outermost	outermost	ADJ
brj-23886	232	3	circle	circle	NOUN
brj-23886	232	4	in	in	ADP
brj-23886	232	5	fig	fig	NOUN
brj-23886	232	6	.	.	PUNCT
brj-23886	233	1	7	7	NUM
brj-23886	233	2	shows	show	VERB
brj-23886	233	3	the	the	DET
brj-23886	233	4	coordinates	coordinate	NOUN
brj-23886	233	5	of	of	ADP
brj-23886	233	6	the	the	DET
brj-23886	233	7	reference	reference	NOUN
brj-23886	233	8	sequence	sequence	NOUN
brj-23886	233	9	positions	position	NOUN
brj-23886	233	10	,	,	PUNCT
brj-23886	233	11	and	and	CCONJ
brj-23886	233	12	from	from	ADP
brj-23886	233	13	the	the	DET
brj-23886	233	14	outer	outer	NOUN
brj-23886	233	15	to	to	ADP
brj-23886	233	16	the	the	DET
brj-23886	233	17	inner	inner	NOUN
brj-23886	233	18	,	,	PUNCT
brj-23886	233	19	the	the	DET
brj-23886	233	20	indel	indel	NOUN
brj-23886	233	21	distribution	distribution	NOUN
brj-23886	233	22	,	,	PUNCT
brj-23886	233	23	snp	snp	ADJ
brj-23886	233	24	number	number	NOUN
brj-23886	233	25	distribution	distribution	NOUN
brj-23886	233	26	,	,	PUNCT
brj-23886	233	27	reads	read	VERB
brj-23886	233	28	coverage	coverage	NOUN
brj-23886	233	29	depth	depth	NOUN
brj-23886	233	30	,	,	PUNCT
brj-23886	233	31	reference	reference	NOUN
brj-23886	233	32	sequence	sequence	NOUN
brj-23886	233	33	genomic	genomic	PROPN
brj-23886	233	34	gc	gc	PROPN
brj-23886	233	35	content	content	NOUN
brj-23886	233	36	,	,	PUNCT
brj-23886	233	37	and	and	CCONJ
brj-23886	233	38	reference	reference	NOUN
brj-23886	233	39	sequence	sequence	NOUN
brj-23886	233	40	genomic	genomic	PROPN
brj-23886	233	41	gc	gc	PROPN
brj-23886	233	42	offset	offset	VERB
brj-23886	233	43	value	value	NOUN
brj-23886	233	44	distribution	distribution	NOUN
brj-23886	233	45	of	of	ADP
brj-23886	233	46	c0	c0	PROPN
brj-23886	233	47	and	and	CCONJ
brj-23886	233	48	c1	c1	PROPN
brj-23886	233	49	,	,	PUNCT
brj-23886	233	50	respectively	respectively	ADV
brj-23886	233	51	.	.	PUNCT
brj-23886	234	1	the	the	DET
brj-23886	234	2	data	datum	NOUN
brj-23886	234	3	indicated	indicate	VERB
brj-23886	234	4	that	that	SCONJ
brj-23886	234	5	neodymium	neodymium	NOUN
brj-23886	234	6	(	(	PUNCT
brj-23886	234	7	nd	nd	NOUN
brj-23886	234	8	)	)	PUNCT
brj-23886	234	9	ions	ion	NOUN
brj-23886	234	10	induced	induce	VERB
brj-23886	234	11	multiple	multiple	ADJ
brj-23886	234	12	mutations	mutation	NOUN
brj-23886	234	13	in	in	ADP
brj-23886	234	14	the	the	DET
brj-23886	234	15	genome	genome	NOUN
brj-23886	234	16	of	of	ADP
brj-23886	234	17	c.	c.	PROPN
brj-23886	234	18	thermocellum	thermocellum	PROPN
brj-23886	234	19	atcc	atcc	PROPN
brj-23886	234	20	c0	c0	PROPN
brj-23886	234	21	,	,	PUNCT
brj-23886	234	22	with	with	ADP
brj-23886	234	23	the	the	DET
brj-23886	234	24	single	single	ADJ
brj-23886	234	25	nucleotide	nucleotide	NOUN
brj-23886	234	26	polymorphism	polymorphism	NOUN
brj-23886	234	27	(	(	PUNCT
brj-23886	234	28	snp	snp	ADJ
brj-23886	234	29	)	)	PUNCT
brj-23886	234	30	and	and	CCONJ
brj-23886	234	31	structural	structural	ADJ
brj-23886	234	32	variation	variation	NOUN
brj-23886	234	33	(	(	PUNCT
brj-23886	234	34	sv	sv	NOUN
brj-23886	234	35	)	)	PUNCT
brj-23886	234	36	data	datum	NOUN
brj-23886	234	37	supporting	support	VERB
brj-23886	234	38	one	one	NUM
brj-23886	234	39	another	another	DET
brj-23886	234	40	.	.	PUNCT
brj-23886	235	1	fig	fig	NOUN
brj-23886	235	2	.	.	PUNCT
brj-23886	236	1	7	7	X
brj-23886	236	2	.	.	X
brj-23886	236	3	genome	genome	NOUN
brj-23886	236	4	-	-	PUNCT
brj-23886	236	5	wide	wide	ADJ
brj-23886	236	6	variation	variation	NOUN
brj-23886	236	7	map	map	NOUN
brj-23886	236	8	peer	peer	NOUN
brj-23886	236	9	-	-	PUNCT
brj-23886	236	10	reviewed	review	VERB
brj-23886	236	11	article	article	NOUN
brj-23886	236	12	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	236	13	cui	cui	PROPN
brj-23886	236	14	et	et	PROPN
brj-23886	236	15	al	al	PROPN
brj-23886	236	16	.	.	PROPN
brj-23886	237	1	(	(	PUNCT
brj-23886	237	2	2025	2025	NUM
brj-23886	237	3	)	)	PUNCT
brj-23886	237	4	.	.	PUNCT
brj-23886	238	1	“	"	PUNCT
brj-23886	238	2	genome	genome	NOUN
brj-23886	238	3	study	study	NOUN
brj-23886	238	4	of	of	ADP
brj-23886	238	5	c.	c.	PROPN
brj-23886	238	6	thermocellum	thermocellum	PROPN
brj-23886	238	7	,	,	PUNCT
brj-23886	238	8	”	"	PUNCT
brj-23886	238	9	bioresources	bioresource	NOUN
brj-23886	238	10	20(2	20(2	NUM
brj-23886	238	11	)	)	PUNCT
brj-23886	238	12	,	,	PUNCT
brj-23886	238	13	3155	3155	NUM
brj-23886	238	14	-	-	SYM
brj-23886	238	15	3175	3175	NUM
brj-23886	238	16	.	.	PUNCT
brj-23886	238	17	3169	3169	NUM
brj-23886	238	18	results	result	NOUN
brj-23886	238	19	of	of	ADP
brj-23886	238	20	knockout	knockout	NOUN
brj-23886	238	21	strains	strain	VERB
brj-23886	238	22	growth	growth	NOUN
brj-23886	238	23	measurement	measurement	NOUN
brj-23886	238	24	the	the	DET
brj-23886	238	25	strain	strain	NOUN
brj-23886	238	26	of	of	ADP
brj-23886	238	27	c.	c.	PROPN
brj-23886	238	28	thermocellum	thermocellum	PROPN
brj-23886	238	29	c0	c0	PROPN
brj-23886	238	30	with	with	ADP
brj-23886	238	31	arac	arac	NOUN
brj-23886	238	32	knocked	knock	VERB
brj-23886	238	33	out	out	ADP
brj-23886	238	34	will	will	AUX
brj-23886	238	35	be	be	AUX
brj-23886	238	36	abbreviated	abbreviate	VERB
brj-23886	238	37	as	as	ADP
brj-23886	238	38	cx	cx	PROPN
brj-23886	238	39	,	,	PUNCT
brj-23886	238	40	the	the	DET
brj-23886	238	41	strain	strain	NOUN
brj-23886	238	42	with	with	ADP
brj-23886	238	43	mcp	mcp	PROPN
brj-23886	238	44	knocked	knock	VERB
brj-23886	238	45	out	out	ADP
brj-23886	238	46	as	as	ADP
brj-23886	238	47	cy	cy	PROPN
brj-23886	238	48	,	,	PUNCT
brj-23886	238	49	and	and	CCONJ
brj-23886	238	50	the	the	DET
brj-23886	238	51	strain	strain	NOUN
brj-23886	238	52	with	with	ADP
brj-23886	238	53	type	type	NOUN
brj-23886	238	54	gene	gene	NOUN
brj-23886	238	55	knocked	knock	VERB
brj-23886	238	56	out	out	ADP
brj-23886	238	57	as	as	ADP
brj-23886	238	58	cg	cg	NOUN
brj-23886	238	59	.	.	PUNCT
brj-23886	239	1	the	the	DET
brj-23886	239	2	knockout	knockout	NOUN
brj-23886	239	3	strains	strain	NOUN
brj-23886	239	4	were	be	AUX
brj-23886	239	5	identified	identify	VERB
brj-23886	239	6	and	and	CCONJ
brj-23886	239	7	successfully	successfully	ADV
brj-23886	239	8	constructed	construct	VERB
brj-23886	239	9	.	.	PUNCT
brj-23886	240	1	as	as	SCONJ
brj-23886	240	2	shown	show	VERB
brj-23886	240	3	in	in	ADP
brj-23886	240	4	fig	fig	NOUN
brj-23886	240	5	.	.	PUNCT
brj-23886	241	1	8	8	NUM
brj-23886	241	2	,	,	PUNCT
brj-23886	241	3	the	the	DET
brj-23886	241	4	three	three	NUM
brj-23886	241	5	deletion	deletion	NOUN
brj-23886	241	6	strains	strain	NOUN
brj-23886	241	7	of	of	ADP
brj-23886	241	8	cx	cx	PROPN
brj-23886	241	9	,	,	PUNCT
brj-23886	241	10	cy	cy	PROPN
brj-23886	241	11	,	,	PUNCT
brj-23886	241	12	and	and	CCONJ
brj-23886	241	13	cg	cg	NOUN
brj-23886	241	14	and	and	CCONJ
brj-23886	241	15	the	the	DET
brj-23886	241	16	wild	wild	ADJ
brj-23886	241	17	strain	strain	NOUN
brj-23886	241	18	all	all	PRON
brj-23886	241	19	showed	show	VERB
brj-23886	241	20	a	a	DET
brj-23886	241	21	typical	typical	ADJ
brj-23886	241	22	"	"	PUNCT
brj-23886	241	23	s	s	NOUN
brj-23886	241	24	"	"	PUNCT
brj-23886	241	25	shaped	shape	VERB
brj-23886	241	26	growth	growth	NOUN
brj-23886	241	27	curve	curve	NOUN
brj-23886	241	28	,	,	PUNCT
brj-23886	241	29	and	and	CCONJ
brj-23886	241	30	the	the	DET
brj-23886	241	31	time	time	NOUN
brj-23886	241	32	of	of	ADP
brj-23886	241	33	the	the	DET
brj-23886	241	34	delayed	delay	VERB
brj-23886	241	35	,	,	PUNCT
brj-23886	241	36	logarithmic	logarithmic	ADJ
brj-23886	241	37	growth	growth	NOUN
brj-23886	241	38	period	period	NOUN
brj-23886	241	39	and	and	CCONJ
brj-23886	241	40	stable	stable	ADJ
brj-23886	241	41	period	period	NOUN
brj-23886	241	42	of	of	ADP
brj-23886	241	43	both	both	PRON
brj-23886	241	44	were	be	AUX
brj-23886	241	45	basically	basically	ADV
brj-23886	241	46	the	the	DET
brj-23886	241	47	same	same	ADJ
brj-23886	241	48	.	.	PUNCT
brj-23886	242	1	the	the	DET
brj-23886	242	2	experimental	experimental	ADJ
brj-23886	242	3	results	result	NOUN
brj-23886	242	4	indicated	indicate	VERB
brj-23886	242	5	that	that	SCONJ
brj-23886	242	6	the	the	DET
brj-23886	242	7	knockdown	knockdown	NOUN
brj-23886	242	8	of	of	ADP
brj-23886	242	9	the	the	DET
brj-23886	242	10	three	three	NUM
brj-23886	242	11	genes	gene	NOUN
brj-23886	242	12	respectively	respectively	ADV
brj-23886	242	13	did	do	AUX
brj-23886	242	14	not	not	PART
brj-23886	242	15	produce	produce	VERB
brj-23886	242	16	significant	significant	ADJ
brj-23886	242	17	effects	effect	NOUN
brj-23886	242	18	on	on	ADP
brj-23886	242	19	bacterial	bacterial	ADJ
brj-23886	242	20	growth	growth	NOUN
brj-23886	242	21	and	and	CCONJ
brj-23886	242	22	reproduction	reproduction	NOUN
brj-23886	242	23	.	.	PUNCT
brj-23886	243	1	this	this	DET
brj-23886	243	2	observation	observation	NOUN
brj-23886	243	3	may	may	AUX
brj-23886	243	4	be	be	AUX
brj-23886	243	5	attributed	attribute	VERB
brj-23886	243	6	to	to	ADP
brj-23886	243	7	the	the	DET
brj-23886	243	8	fact	fact	NOUN
brj-23886	243	9	that	that	SCONJ
brj-23886	243	10	the	the	DET
brj-23886	243	11	gene	gene	NOUN
brj-23886	243	12	knockdown	knockdown	NOUN
brj-23886	243	13	did	do	AUX
brj-23886	243	14	not	not	PART
brj-23886	243	15	affect	affect	VERB
brj-23886	243	16	the	the	DET
brj-23886	243	17	biomass	biomass	NOUN
brj-23886	243	18	of	of	ADP
brj-23886	243	19	c.	c.	PROPN
brj-23886	243	20	thermocellum	thermocellum	PROPN
brj-23886	243	21	,	,	PUNCT
brj-23886	243	22	resulting	result	VERB
brj-23886	243	23	in	in	ADP
brj-23886	243	24	similar	similar	ADJ
brj-23886	243	25	growth	growth	NOUN
brj-23886	243	26	trends	trend	NOUN
brj-23886	243	27	among	among	ADP
brj-23886	243	28	the	the	DET
brj-23886	243	29	strains	strain	NOUN
brj-23886	243	30	(	(	PUNCT
brj-23886	243	31	lo	lo	INTJ
brj-23886	243	32	et	et	PROPN
brj-23886	243	33	al	al	PROPN
brj-23886	243	34	.	.	PROPN
brj-23886	243	35	2010	2010	NUM
brj-23886	243	36	)	)	PUNCT
brj-23886	243	37	.	.	PUNCT
brj-23886	244	1	fig	fig	NOUN
brj-23886	244	2	.	.	PUNCT
brj-23886	245	1	8	8	X
brj-23886	245	2	.	.	PUNCT
brj-23886	245	3	growth	growth	NOUN
brj-23886	245	4	curve	curve	NOUN
brj-23886	245	5	of	of	ADP
brj-23886	245	6	original	original	ADJ
brj-23886	245	7	strain	strain	NOUN
brj-23886	245	8	and	and	CCONJ
brj-23886	245	9	knockout	knockout	NOUN
brj-23886	245	10	strains	strain	VERB
brj-23886	245	11	results	result	NOUN
brj-23886	245	12	of	of	ADP
brj-23886	245	13	ethanol	ethanol	NOUN
brj-23886	245	14	yield	yield	NOUN
brj-23886	245	15	measurement	measurement	NOUN
brj-23886	245	16	of	of	ADP
brj-23886	245	17	knockout	knockout	NOUN
brj-23886	245	18	strains	strain	NOUN
brj-23886	245	19	as	as	SCONJ
brj-23886	245	20	shown	show	VERB
brj-23886	245	21	in	in	ADP
brj-23886	245	22	fig	fig	NOUN
brj-23886	245	23	.	.	PUNCT
brj-23886	246	1	9	9	NUM
brj-23886	246	2	,	,	PUNCT
brj-23886	246	3	there	there	PRON
brj-23886	246	4	was	be	VERB
brj-23886	246	5	no	no	DET
brj-23886	246	6	significant	significant	ADJ
brj-23886	246	7	change	change	NOUN
brj-23886	246	8	in	in	ADP
brj-23886	246	9	ethanol	ethanol	NOUN
brj-23886	246	10	production	production	NOUN
brj-23886	246	11	of	of	ADP
brj-23886	246	12	cx	cx	PROPN
brj-23886	246	13	strain	strain	NOUN
brj-23886	246	14	after	after	ADP
brj-23886	246	15	knocking	knock	VERB
brj-23886	246	16	down	down	ADP
brj-23886	246	17	arac	arac	NOUN
brj-23886	246	18	compared	compare	VERB
brj-23886	246	19	to	to	ADP
brj-23886	246	20	the	the	DET
brj-23886	246	21	original	original	ADJ
brj-23886	246	22	strain	strain	NOUN
brj-23886	246	23	.	.	PUNCT
brj-23886	247	1	fig	fig	NOUN
brj-23886	247	2	.	.	PUNCT
brj-23886	248	1	9	9	X
brj-23886	248	2	.	.	X
brj-23886	248	3	ethanol	ethanol	NOUN
brj-23886	248	4	production	production	NOUN
brj-23886	248	5	of	of	ADP
brj-23886	248	6	original	original	ADJ
brj-23886	248	7	strains	strain	NOUN
brj-23886	248	8	and	and	CCONJ
brj-23886	248	9	knockout	knockout	NOUN
brj-23886	248	10	strains	strain	NOUN
brj-23886	248	11	;	;	PUNCT
brj-23886	248	12	different	different	ADJ
brj-23886	248	13	lowercase	lowercase	NOUN
brj-23886	248	14	letters	letter	NOUN
brj-23886	248	15	mean	mean	VERB
brj-23886	248	16	that	that	SCONJ
brj-23886	248	17	p	p	X
brj-23886	248	18	<	<	X
brj-23886	248	19	0.05	0.05	NUM
brj-23886	248	20	,	,	PUNCT
brj-23886	248	21	and	and	CCONJ
brj-23886	248	22	different	different	ADJ
brj-23886	248	23	uppercase	uppercase	ADJ
brj-23886	248	24	letters	letter	NOUN
brj-23886	248	25	mean	mean	VERB
brj-23886	248	26	that	that	SCONJ
brj-23886	248	27	p	p	X
brj-23886	248	28	<	<	X
brj-23886	248	29	0.01	0.01	NUM
brj-23886	248	30	peer	peer	NOUN
brj-23886	248	31	-	-	PUNCT
brj-23886	248	32	reviewed	review	VERB
brj-23886	248	33	article	article	NOUN
brj-23886	248	34	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	248	35	cui	cui	PROPN
brj-23886	248	36	et	et	PROPN
brj-23886	248	37	al	al	PROPN
brj-23886	248	38	.	.	PROPN
brj-23886	249	1	(	(	PUNCT
brj-23886	249	2	2025	2025	NUM
brj-23886	249	3	)	)	PUNCT
brj-23886	249	4	.	.	PUNCT
brj-23886	250	1	“	"	PUNCT
brj-23886	250	2	genome	genome	NOUN
brj-23886	250	3	study	study	NOUN
brj-23886	250	4	of	of	ADP
brj-23886	250	5	c.	c.	PROPN
brj-23886	250	6	thermocellum	thermocellum	PROPN
brj-23886	250	7	,	,	PUNCT
brj-23886	250	8	”	"	PUNCT
brj-23886	250	9	bioresources	bioresource	NOUN
brj-23886	250	10	20(2	20(2	NUM
brj-23886	250	11	)	)	PUNCT
brj-23886	250	12	,	,	PUNCT
brj-23886	250	13	3155	3155	NUM
brj-23886	250	14	-	-	SYM
brj-23886	250	15	3175	3175	NUM
brj-23886	250	16	.	.	PUNCT
brj-23886	251	1	3170	3170	NUM
brj-23886	251	2	the	the	DET
brj-23886	251	3	ethanol	ethanol	NOUN
brj-23886	251	4	production	production	NOUN
brj-23886	251	5	of	of	ADP
brj-23886	251	6	cy	cy	PROPN
brj-23886	251	7	strain	strain	NOUN
brj-23886	251	8	with	with	ADP
brj-23886	251	9	mcp	mcp	PROPN
brj-23886	251	10	knockdown	knockdown	NOUN
brj-23886	251	11	was	be	AUX
brj-23886	251	12	1.07	1.07	NUM
brj-23886	251	13	times	time	NOUN
brj-23886	251	14	higher	high	ADJ
brj-23886	251	15	than	than	ADP
brj-23886	251	16	that	that	PRON
brj-23886	251	17	of	of	ADP
brj-23886	251	18	the	the	DET
brj-23886	251	19	original	original	ADJ
brj-23886	251	20	strain	strain	NOUN
brj-23886	251	21	.	.	PUNCT
brj-23886	252	1	the	the	DET
brj-23886	252	2	ethanol	ethanol	NOUN
brj-23886	252	3	yield	yield	NOUN
brj-23886	252	4	of	of	ADP
brj-23886	252	5	cg	cg	NOUN
brj-23886	252	6	strain	strain	NOUN
brj-23886	252	7	with	with	ADP
brj-23886	252	8	knockout	knockout	NOUN
brj-23886	252	9	of	of	ADP
brj-23886	252	10	type	type	NOUN
brj-23886	252	11	was	be	AUX
brj-23886	252	12	1.32	1.32	NUM
brj-23886	252	13	times	time	NOUN
brj-23886	252	14	higher	high	ADJ
brj-23886	252	15	than	than	ADP
brj-23886	252	16	that	that	PRON
brj-23886	252	17	of	of	ADP
brj-23886	252	18	the	the	DET
brj-23886	252	19	original	original	ADJ
brj-23886	252	20	strain	strain	NOUN
brj-23886	252	21	.	.	PUNCT
brj-23886	253	1	this	this	PRON
brj-23886	253	2	indicates	indicate	VERB
brj-23886	253	3	that	that	SCONJ
brj-23886	253	4	the	the	DET
brj-23886	253	5	arac	arac	NOUN
brj-23886	253	6	gene	gene	NOUN
brj-23886	253	7	is	be	AUX
brj-23886	253	8	not	not	PART
brj-23886	253	9	a	a	DET
brj-23886	253	10	key	key	ADJ
brj-23886	253	11	locus	locus	NOUN
brj-23886	253	12	for	for	ADP
brj-23886	253	13	nd3	nd3	VERB
brj-23886	253	14	+	+	CCONJ
brj-23886	253	15	to	to	PART
brj-23886	253	16	improve	improve	VERB
brj-23886	253	17	ethanol	ethanol	NOUN
brj-23886	253	18	yield	yield	NOUN
brj-23886	253	19	,	,	PUNCT
brj-23886	253	20	while	while	SCONJ
brj-23886	253	21	the	the	DET
brj-23886	253	22	mutations	mutation	NOUN
brj-23886	253	23	in	in	ADP
brj-23886	253	24	mcp	mcp	PROPN
brj-23886	253	25	and	and	CCONJ
brj-23886	253	26	type	type	NOUN
brj-23886	253	27	are	be	AUX
brj-23886	253	28	associated	associate	VERB
brj-23886	253	29	with	with	ADP
brj-23886	253	30	ethanol	ethanol	NOUN
brj-23886	253	31	yield	yield	NOUN
brj-23886	253	32	improvement	improvement	NOUN
brj-23886	253	33	to	to	ADP
brj-23886	253	34	some	some	DET
brj-23886	253	35	extent	extent	NOUN
brj-23886	253	36	.	.	PUNCT
brj-23886	254	1	fu	fu	PROPN
brj-23886	254	2	et	et	PROPN
brj-23886	254	3	al	al	PROPN
brj-23886	254	4	.	.	PROPN
brj-23886	255	1	(	(	PUNCT
brj-23886	255	2	2019	2019	NUM
brj-23886	255	3	)	)	PUNCT
brj-23886	255	4	increased	increase	VERB
brj-23886	255	5	the	the	DET
brj-23886	255	6	ethanol	ethanol	NOUN
brj-23886	255	7	yield	yield	NOUN
brj-23886	255	8	of	of	ADP
brj-23886	255	9	thermoanaerobacterium	thermoanaerobacterium	ADJ
brj-23886	255	10	aotearoense	aotearoense	ADJ
brj-23886	255	11	scut27	scut27	NOUN
brj-23886	255	12	with	with	ADP
brj-23886	255	13	15.8	15.8	NUM
brj-23886	255	14	%	%	NOUN
brj-23886	255	15	by	by	ADP
brj-23886	255	16	gene	gene	NOUN
brj-23886	255	17	knockout	knockout	NOUN
brj-23886	255	18	.	.	PUNCT
brj-23886	256	1	the	the	DET
brj-23886	256	2	ethanol	ethanol	NOUN
brj-23886	256	3	yield	yield	NOUN
brj-23886	256	4	of	of	ADP
brj-23886	256	5	cg	cg	NOUN
brj-23886	256	6	in	in	ADP
brj-23886	256	7	this	this	DET
brj-23886	256	8	experiment	experiment	NOUN
brj-23886	256	9	was	be	AUX
brj-23886	256	10	increased	increase	VERB
brj-23886	256	11	with	with	ADP
brj-23886	256	12	31.9	31.9	NUM
brj-23886	256	13	%	%	NOUN
brj-23886	256	14	,	,	PUNCT
brj-23886	256	15	which	which	PRON
brj-23886	256	16	was	be	AUX
brj-23886	256	17	higher	high	ADJ
brj-23886	256	18	than	than	ADP
brj-23886	256	19	the	the	DET
brj-23886	256	20	cited	cite	VERB
brj-23886	256	21	study	study	NOUN
brj-23886	256	22	.	.	PUNCT
brj-23886	257	1	mutations	mutation	NOUN
brj-23886	257	2	in	in	ADP
brj-23886	257	3	the	the	DET
brj-23886	257	4	arac	arac	NOUN
brj-23886	257	5	gene	gene	NOUN
brj-23886	257	6	did	do	AUX
brj-23886	257	7	not	not	PART
brj-23886	257	8	significantly	significantly	ADV
brj-23886	257	9	impact	impact	VERB
brj-23886	257	10	ethanol	ethanol	NOUN
brj-23886	257	11	production	production	NOUN
brj-23886	257	12	.	.	PUNCT
brj-23886	258	1	however	however	ADV
brj-23886	258	2	,	,	PUNCT
brj-23886	258	3	these	these	DET
brj-23886	258	4	mutations	mutation	NOUN
brj-23886	258	5	may	may	AUX
brj-23886	258	6	influence	influence	VERB
brj-23886	258	7	the	the	DET
brj-23886	258	8	expression	expression	NOUN
brj-23886	258	9	of	of	ADP
brj-23886	258	10	genes	gene	NOUN
brj-23886	258	11	related	relate	VERB
brj-23886	258	12	to	to	ADP
brj-23886	258	13	cell	cell	NOUN
brj-23886	258	14	membrane	membrane	NOUN
brj-23886	258	15	formation	formation	NOUN
brj-23886	258	16	in	in	ADP
brj-23886	258	17	c.	c.	PROPN
brj-23886	258	18	thermocellum	thermocellum	PROPN
brj-23886	258	19	c0	c0	PROPN
brj-23886	258	20	,	,	PUNCT
brj-23886	258	21	potentially	potentially	ADV
brj-23886	258	22	enhancing	enhance	VERB
brj-23886	258	23	the	the	DET
brj-23886	258	24	uptake	uptake	ADJ
brj-23886	258	25	nutrients	nutrient	NOUN
brj-23886	258	26	or	or	CCONJ
brj-23886	258	27	the	the	DET
brj-23886	258	28	excretion	excretion	NOUN
brj-23886	258	29	of	of	ADP
brj-23886	258	30	product	product	NOUN
brj-23886	258	31	inhibitors	inhibitor	NOUN
brj-23886	258	32	(	(	PUNCT
brj-23886	258	33	wang	wang	PROPN
brj-23886	258	34	et	et	PROPN
brj-23886	258	35	al	al	PROPN
brj-23886	258	36	.	.	PROPN
brj-23886	258	37	2022	2022	NUM
brj-23886	258	38	;	;	PUNCT
brj-23886	258	39	santiago	santiago	PROPN
brj-23886	258	40	et	et	PROPN
brj-23886	258	41	al	al	PROPN
brj-23886	258	42	.	.	PROPN
brj-23886	258	43	2016	2016	NUM
brj-23886	258	44	)	)	PUNCT
brj-23886	258	45	.	.	PUNCT
brj-23886	259	1	it	it	PRON
brj-23886	259	2	is	be	AUX
brj-23886	259	3	plausible	plausible	ADJ
brj-23886	259	4	that	that	SCONJ
brj-23886	259	5	this	this	DET
brj-23886	259	6	gene	gene	NOUN
brj-23886	259	7	plays	play	VERB
brj-23886	259	8	a	a	DET
brj-23886	259	9	role	role	NOUN
brj-23886	259	10	in	in	ADP
brj-23886	259	11	the	the	DET
brj-23886	259	12	regulation	regulation	NOUN
brj-23886	259	13	of	of	ADP
brj-23886	259	14	gene	gene	NOUN
brj-23886	259	15	expression	expression	NOUN
brj-23886	259	16	within	within	ADP
brj-23886	259	17	other	other	ADJ
brj-23886	259	18	metabolic	metabolic	NOUN
brj-23886	259	19	pathways	pathway	NOUN
brj-23886	259	20	,	,	PUNCT
brj-23886	259	21	potentially	potentially	ADV
brj-23886	259	22	influencing	influence	VERB
brj-23886	259	23	the	the	DET
brj-23886	259	24	improvement	improvement	NOUN
brj-23886	259	25	of	of	ADP
brj-23886	259	26	ethanol	ethanol	NOUN
brj-23886	259	27	production	production	NOUN
brj-23886	259	28	.	.	PUNCT
brj-23886	260	1	the	the	DET
brj-23886	260	2	primary	primary	ADJ
brj-23886	260	3	function	function	NOUN
brj-23886	260	4	of	of	ADP
brj-23886	260	5	this	this	DET
brj-23886	260	6	gene	gene	NOUN
brj-23886	260	7	type	type	NOUN
brj-23886	260	8	is	be	AUX
brj-23886	260	9	to	to	PART
brj-23886	260	10	bind	bind	VERB
brj-23886	260	11	to	to	ADP
brj-23886	260	12	the	the	DET
brj-23886	260	13	substrate	substrate	NOUN
brj-23886	260	14	cellulose	cellulose	NOUN
brj-23886	260	15	.	.	PUNCT
brj-23886	261	1	variations	variation	NOUN
brj-23886	261	2	in	in	ADP
brj-23886	261	3	the	the	DET
brj-23886	261	4	cellulose	cellulose	NOUN
brj-23886	261	5	degradation	degradation	NOUN
brj-23886	261	6	capacity	capacity	NOUN
brj-23886	261	7	of	of	ADP
brj-23886	261	8	cellulosomes	cellulosome	NOUN
brj-23886	261	9	can	can	AUX
brj-23886	261	10	be	be	AUX
brj-23886	261	11	attributed	attribute	VERB
brj-23886	261	12	to	to	ADP
brj-23886	261	13	differences	difference	NOUN
brj-23886	261	14	in	in	ADP
brj-23886	261	15	structural	structural	ADJ
brj-23886	261	16	components	component	NOUN
brj-23886	261	17	and	and	CCONJ
brj-23886	261	18	assembly	assembly	NOUN
brj-23886	261	19	patterns	pattern	NOUN
brj-23886	261	20	across	across	ADP
brj-23886	261	21	various	various	ADJ
brj-23886	261	22	microbial	microbial	ADJ
brj-23886	261	23	species	specie	NOUN
brj-23886	261	24	.	.	PUNCT
brj-23886	262	1	(	(	PUNCT
brj-23886	262	2	sheng	sheng	NOUN
brj-23886	262	3	et	et	PROPN
brj-23886	262	4	al	al	PROPN
brj-23886	262	5	.	.	PROPN
brj-23886	262	6	2022	2022	NUM
brj-23886	262	7	)	)	PUNCT
brj-23886	262	8	.	.	PUNCT
brj-23886	263	1	conclusions	conclusion	NOUN
brj-23886	263	2	1	1	X
brj-23886	263	3	.	.	PUNCT
brj-23886	264	1	the	the	DET
brj-23886	264	2	analysis	analysis	NOUN
brj-23886	264	3	conducted	conduct	VERB
brj-23886	264	4	through	through	ADP
brj-23886	264	5	sequencing	sequencing	NOUN
brj-23886	264	6	revealed	reveal	VERB
brj-23886	264	7	the	the	DET
brj-23886	264	8	presence	presence	NOUN
brj-23886	264	9	of	of	ADP
brj-23886	264	10	mutations	mutation	NOUN
brj-23886	264	11	in	in	ADP
brj-23886	264	12	the	the	DET
brj-23886	264	13	promoter	promoter	NOUN
brj-23886	264	14	regions	region	NOUN
brj-23886	264	15	of	of	ADP
brj-23886	264	16	the	the	DET
brj-23886	264	17	genes	gene	NOUN
brj-23886	264	18	alcohol	alcohol	NOUN
brj-23886	264	19	dehydrogenase	dehydrogenase	NOUN
brj-23886	264	20	(	(	PUNCT
brj-23886	264	21	adh	adh	PROPN
brj-23886	264	22	)	)	PUNCT
brj-23886	264	23	,	,	PUNCT
brj-23886	264	24	pyruvate	pyruvate	NOUN
brj-23886	264	25	-	-	PUNCT
brj-23886	264	26	ferric	ferric	ADJ
brj-23886	264	27	redox	redox	NOUN
brj-23886	264	28	protease	protease	NOUN
brj-23886	264	29	(	(	PUNCT
brj-23886	264	30	pfo	pfo	NOUN
brj-23886	264	31	)	)	PUNCT
brj-23886	264	32	,	,	PUNCT
brj-23886	264	33	and	and	CCONJ
brj-23886	264	34	6	6	NUM
brj-23886	264	35	-	-	PUNCT
brj-23886	264	36	phosphofructokinase	phosphofructokinase	NOUN
brj-23886	264	37	(	(	PUNCT
brj-23886	264	38	pfk	pfk	PROPN
brj-23886	264	39	)	)	PUNCT
brj-23886	264	40	.	.	PUNCT
brj-23886	265	1	2	2	X
brj-23886	265	2	.	.	X
brj-23886	265	3	the	the	DET
brj-23886	265	4	findings	finding	NOUN
brj-23886	265	5	from	from	ADP
brj-23886	265	6	results	result	NOUN
brj-23886	265	7	of	of	ADP
brj-23886	265	8	the	the	DET
brj-23886	265	9	targeted	target	VERB
brj-23886	265	10	mutation	mutation	NOUN
brj-23886	265	11	assay	assay	NOUN
brj-23886	265	12	suggest	suggest	VERB
brj-23886	265	13	that	that	SCONJ
brj-23886	265	14	the	the	DET
brj-23886	265	15	alteration	alteration	NOUN
brj-23886	265	16	in	in	ADP
brj-23886	265	17	pfo	pfo	NOUN
brj-23886	265	18	enzyme	enzyme	NOUN
brj-23886	265	19	expression	expression	NOUN
brj-23886	265	20	is	be	AUX
brj-23886	265	21	attributable	attributable	ADJ
brj-23886	265	22	to	to	ADP
brj-23886	265	23	a	a	DET
brj-23886	265	24	mutation	mutation	NOUN
brj-23886	265	25	within	within	ADP
brj-23886	265	26	the	the	DET
brj-23886	265	27	promoter	promoter	NOUN
brj-23886	265	28	sequence	sequence	NOUN
brj-23886	265	29	.	.	PUNCT
brj-23886	266	1	3	3	X
brj-23886	266	2	.	.	X
brj-23886	266	3	the	the	DET
brj-23886	266	4	sequencing	sequence	VERB
brj-23886	266	5	results	result	NOUN
brj-23886	266	6	revealed	reveal	VERB
brj-23886	266	7	the	the	DET
brj-23886	266	8	presence	presence	NOUN
brj-23886	266	9	of	of	ADP
brj-23886	266	10	93	93	NUM
brj-23886	266	11	mutations	mutation	NOUN
brj-23886	266	12	in	in	ADP
brj-23886	266	13	c1	c1	NOUN
brj-23886	266	14	,	,	PUNCT
brj-23886	266	15	encompassing	encompass	VERB
brj-23886	266	16	genes	gene	NOUN
brj-23886	266	17	associated	associate	VERB
brj-23886	266	18	with	with	ADP
brj-23886	266	19	cell	cell	NOUN
brj-23886	266	20	membrane	membrane	NOUN
brj-23886	266	21	biosynthesis	biosynthesis	NOUN
brj-23886	266	22	,	,	PUNCT
brj-23886	266	23	methyl	methyl	NOUN
brj-23886	266	24	chemotaxis	chemotaxis	ADJ
brj-23886	266	25	receptor	receptor	NOUN
brj-23886	266	26	proteins	protein	NOUN
brj-23886	266	27	,	,	PUNCT
brj-23886	266	28	ribonucleases	ribonuclease	NOUN
brj-23886	266	29	,	,	PUNCT
brj-23886	266	30	endonucleases	endonuclease	NOUN
brj-23886	266	31	,	,	PUNCT
brj-23886	266	32	transcriptional	transcriptional	ADJ
brj-23886	266	33	regulators	regulator	NOUN
brj-23886	266	34	,	,	PUNCT
brj-23886	266	35	methyltransferases	methyltransferase	NOUN
brj-23886	266	36	,	,	PUNCT
brj-23886	266	37	and	and	CCONJ
brj-23886	266	38	transposases	transposase	NOUN
brj-23886	266	39	.	.	PUNCT
brj-23886	267	1	4	4	X
brj-23886	267	2	.	.	X
brj-23886	267	3	the	the	DET
brj-23886	267	4	knockout	knockout	NOUN
brj-23886	267	5	of	of	ADP
brj-23886	267	6	the	the	DET
brj-23886	267	7	key	key	ADJ
brj-23886	267	8	genes	gene	NOUN
brj-23886	267	9	arac	arac	NOUN
brj-23886	267	10	,	,	PUNCT
brj-23886	267	11	mcp	mcp	PROPN
brj-23886	267	12	,	,	PUNCT
brj-23886	267	13	and	and	CCONJ
brj-23886	267	14	type	type	NOUN
brj-23886	267	15	3a	3a	NUM
brj-23886	267	16	cellulose	cellulose	NOUN
brj-23886	267	17	-	-	PUNCT
brj-23886	267	18	binding	bind	VERB
brj-23886	267	19	domain	domain	NOUN
brj-23886	267	20	protein	protein	NOUN
brj-23886	267	21	(	(	PUNCT
brj-23886	267	22	type	type	NOUN
brj-23886	267	23	)	)	PUNCT
brj-23886	267	24	did	do	AUX
brj-23886	267	25	not	not	PART
brj-23886	267	26	impact	impact	VERB
brj-23886	267	27	the	the	DET
brj-23886	267	28	growth	growth	NOUN
brj-23886	267	29	of	of	ADP
brj-23886	267	30	the	the	DET
brj-23886	267	31	strain	strain	NOUN
brj-23886	267	32	,	,	PUNCT
brj-23886	267	33	however	however	ADV
brj-23886	267	34	,	,	PUNCT
brj-23886	267	35	mutations	mutation	NOUN
brj-23886	267	36	in	in	ADP
brj-23886	267	37	the	the	DET
brj-23886	267	38	methylaccepting	methylaccepting	NOUN
brj-23886	267	39	chemotaxis	chemotaxis	ADJ
brj-23886	267	40	proteins	protein	NOUN
brj-23886	267	41	(	(	PUNCT
brj-23886	267	42	mcp	mcp	PROPN
brj-23886	267	43	)	)	PUNCT
brj-23886	267	44	and	and	CCONJ
brj-23886	267	45	type	type	NOUN
brj-23886	267	46	genes	gene	NOUN
brj-23886	267	47	were	be	AUX
brj-23886	267	48	correlated	correlate	VERB
brj-23886	267	49	with	with	ADP
brj-23886	267	50	enhanced	enhanced	ADJ
brj-23886	267	51	ethanol	ethanol	NOUN
brj-23886	267	52	production	production	NOUN
brj-23886	267	53	.	.	PUNCT
brj-23886	268	1	acknowledgments	acknowledgment	NOUN
brj-23886	268	2	the	the	DET
brj-23886	268	3	authors	author	NOUN
brj-23886	268	4	are	be	AUX
brj-23886	268	5	grateful	grateful	ADJ
brj-23886	268	6	for	for	ADP
brj-23886	268	7	the	the	DET
brj-23886	268	8	support	support	NOUN
brj-23886	268	9	of	of	ADP
brj-23886	268	10	the	the	DET
brj-23886	268	11	inner	inner	ADJ
brj-23886	268	12	mongolia	mongolia	PROPN
brj-23886	268	13	scientific	scientific	PROPN
brj-23886	268	14	research	research	NOUN
brj-23886	268	15	fund	fund	NOUN
brj-23886	268	16	for	for	ADP
brj-23886	268	17	outstanding	outstanding	ADJ
brj-23886	268	18	youth	youth	NOUN
brj-23886	268	19	scholar	scholar	NOUN
brj-23886	268	20	(	(	PUNCT
brj-23886	268	21	2022jq10	2022jq10	NUM
brj-23886	268	22	)	)	PUNCT
brj-23886	268	23	and	and	CCONJ
brj-23886	268	24	the	the	DET
brj-23886	268	25	national	national	ADJ
brj-23886	268	26	natural	natural	PROPN
brj-23886	268	27	science	science	PROPN
brj-23886	268	28	foundation	foundation	PROPN
brj-23886	268	29	of	of	ADP
brj-23886	268	30	china	china	PROPN
brj-23886	268	31	(	(	PUNCT
brj-23886	268	32	32060017	32060017	NUM
brj-23886	268	33	)	)	PUNCT
brj-23886	268	34	.	.	PUNCT
brj-23886	269	1	peer	peer	NOUN
brj-23886	269	2	-	-	PUNCT
brj-23886	269	3	reviewed	review	VERB
brj-23886	269	4	article	article	NOUN
brj-23886	269	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	269	6	cui	cui	PROPN
brj-23886	269	7	et	et	PROPN
brj-23886	269	8	al	al	PROPN
brj-23886	269	9	.	.	PROPN
brj-23886	270	1	(	(	PUNCT
brj-23886	270	2	2025	2025	NUM
brj-23886	270	3	)	)	PUNCT
brj-23886	270	4	.	.	PUNCT
brj-23886	271	1	“	"	PUNCT
brj-23886	271	2	genome	genome	NOUN
brj-23886	271	3	study	study	NOUN
brj-23886	271	4	of	of	ADP
brj-23886	271	5	c.	c.	PROPN
brj-23886	271	6	thermocellum	thermocellum	PROPN
brj-23886	271	7	,	,	PUNCT
brj-23886	271	8	”	"	PUNCT
brj-23886	271	9	bioresources	bioresource	NOUN
brj-23886	271	10	20(2	20(2	NUM
brj-23886	271	11	)	)	PUNCT
brj-23886	271	12	,	,	PUNCT
brj-23886	271	13	3155	3155	NUM
brj-23886	271	14	-	-	SYM
brj-23886	271	15	3175	3175	NUM
brj-23886	271	16	.	.	PUNCT
brj-23886	272	1	3171	3171	NUM
brj-23886	272	2	references	reference	NOUN
brj-23886	272	3	cited	cite	VERB
brj-23886	272	4	bayer	bayer	PROPN
brj-23886	272	5	,	,	PUNCT
brj-23886	272	6	e.	e.	PROPN
brj-23886	272	7	a.	a.	PROPN
brj-23886	272	8	,	,	PUNCT
brj-23886	272	9	belaich	belaich	PROPN
brj-23886	272	10	,	,	PUNCT
brj-23886	272	11	j.	j.	PROPN
brj-23886	272	12	p.	p.	PROPN
brj-23886	272	13	,	,	PUNCT
brj-23886	272	14	shoham	shoham	NOUN
brj-23886	272	15	,	,	PUNCT
brj-23886	272	16	y.	y.	NOUN
brj-23886	272	17	,	,	PUNCT
brj-23886	272	18	and	and	CCONJ
brj-23886	272	19	lamed	lamed	PROPN
brj-23886	272	20	,	,	PUNCT
brj-23886	272	21	r.	r.	PROPN
brj-23886	272	22	(	(	PUNCT
brj-23886	272	23	2004	2004	NUM
brj-23886	272	24	)	)	PUNCT
brj-23886	272	25	.	.	PUNCT
brj-23886	273	1	“	"	PUNCT
brj-23886	273	2	the	the	DET
brj-23886	273	3	cellulosomes	cellulosome	NOUN
brj-23886	273	4	:	:	PUNCT
brj-23886	273	5	multienzyme	multienzyme	NOUN
brj-23886	273	6	machines	machine	NOUN
brj-23886	273	7	for	for	ADP
brj-23886	273	8	degradation	degradation	NOUN
brj-23886	273	9	of	of	ADP
brj-23886	273	10	plant	plant	NOUN
brj-23886	273	11	cell	cell	NOUN
brj-23886	273	12	wall	wall	NOUN
brj-23886	273	13	polysaccharides	polysaccharide	NOUN
brj-23886	273	14	,	,	PUNCT
brj-23886	273	15	”	"	PUNCT
brj-23886	273	16	annual	annual	ADJ
brj-23886	273	17	review	review	NOUN
brj-23886	273	18	of	of	ADP
brj-23886	273	19	microbiology	microbiology	NOUN
brj-23886	273	20	58	58	NUM
brj-23886	273	21	,	,	PUNCT
brj-23886	273	22	521	521	NUM
brj-23886	273	23	-	-	SYM
brj-23886	273	24	554	554	NUM
brj-23886	273	25	.	.	PUNCT
brj-23886	274	1	doi	doi	NOUN
brj-23886	274	2	:	:	PUNCT
brj-23886	274	3	10.1146	10.1146	NUM
brj-23886	274	4	/	/	SYM
brj-23886	274	5	annurev.micro.57.030502.091022	annurev.micro.57.030502.091022	PROPN
brj-23886	274	6	biswas	biswas	PROPN
brj-23886	274	7	,	,	PUNCT
brj-23886	274	8	r.	r.	PROPN
brj-23886	274	9	,	,	PUNCT
brj-23886	274	10	zheng	zheng	PROPN
brj-23886	274	11	,	,	PUNCT
brj-23886	274	12	t.	t.	PROPN
brj-23886	274	13	,	,	PUNCT
brj-23886	274	14	olson	olson	PROPN
brj-23886	274	15	,	,	PUNCT
brj-23886	274	16	d.	d.	PROPN
brj-23886	274	17	g.	g.	PROPN
brj-23886	274	18	,	,	PUNCT
brj-23886	274	19	lynd	lynd	PROPN
brj-23886	274	20	,	,	PUNCT
brj-23886	274	21	l.	l.	PROPN
brj-23886	274	22	r.	r.	PROPN
brj-23886	274	23	,	,	PUNCT
brj-23886	274	24	and	and	CCONJ
brj-23886	274	25	guss	guss	ADJ
brj-23886	274	26	,	,	PUNCT
brj-23886	274	27	a.	a.	NOUN
brj-23886	274	28	m.	m.	NOUN
brj-23886	274	29	(	(	PUNCT
brj-23886	274	30	2015	2015	NUM
brj-23886	274	31	)	)	PUNCT
brj-23886	274	32	.	.	PUNCT
brj-23886	275	1	“	"	PUNCT
brj-23886	275	2	elimination	elimination	NOUN
brj-23886	275	3	of	of	ADP
brj-23886	275	4	hydrogenase	hydrogenase	ADJ
brj-23886	275	5	active	active	ADJ
brj-23886	275	6	site	site	NOUN
brj-23886	275	7	assembly	assembly	NOUN
brj-23886	275	8	blocks	block	VERB
brj-23886	275	9	h2	h2	NOUN
brj-23886	275	10	production	production	NOUN
brj-23886	275	11	and	and	CCONJ
brj-23886	275	12	increases	increase	VERB
brj-23886	275	13	ethanol	ethanol	NOUN
brj-23886	275	14	yield	yield	NOUN
brj-23886	275	15	in	in	ADP
brj-23886	275	16	clostridium	clostridium	NOUN
brj-23886	275	17	thermocellum	thermocellum	PROPN
brj-23886	275	18	,	,	PUNCT
brj-23886	275	19	”	"	PUNCT
brj-23886	275	20	biotechnology	biotechnology	NOUN
brj-23886	275	21	for	for	ADP
brj-23886	275	22	biofuels	biofuel	NOUN
brj-23886	275	23	8	8	NUM
brj-23886	275	24	,	,	PUNCT
brj-23886	275	25	article	article	NOUN
brj-23886	275	26	20	20	NUM
brj-23886	275	27	.	.	PUNCT
brj-23886	276	1	doi	doi	NOUN
brj-23886	276	2	:	:	PUNCT
brj-23886	276	3	10.1186	10.1186	NUM
brj-23886	276	4	/	/	SYM
brj-23886	276	5	s13068	s13068	PROPN
brj-23886	276	6	-	-	PUNCT
brj-23886	276	7	015	015	NUM
brj-23886	276	8	-	-	PUNCT
brj-23886	276	9	0204	0204	NUM
brj-23886	276	10	-	-	SYM
brj-23886	276	11	4	4	NUM
brj-23886	276	12	brown	brown	ADJ
brj-23886	276	13	,	,	PUNCT
brj-23886	276	14	s.	s.	PROPN
brj-23886	276	15	d.	d.	PROPN
brj-23886	276	16	,	,	PUNCT
brj-23886	276	17	guss	guss	PROPN
brj-23886	276	18	,	,	PUNCT
brj-23886	276	19	a.	a.	NOUN
brj-23886	276	20	m.	m.	NOUN
brj-23886	276	21	,	,	PUNCT
brj-23886	276	22	karpinets	karpinet	NOUN
brj-23886	276	23	,	,	PUNCT
brj-23886	276	24	t.	t.	PROPN
brj-23886	276	25	v.	v.	PROPN
brj-23886	276	26	,	,	PUNCT
brj-23886	276	27	parks	park	NOUN
brj-23886	276	28	,	,	PUNCT
brj-23886	276	29	j.	j.	PROPN
brj-23886	276	30	m.	m.	PROPN
brj-23886	276	31	,	,	PUNCT
brj-23886	276	32	smolin	smolin	PROPN
brj-23886	276	33	,	,	PUNCT
brj-23886	276	34	n.	n.	PROPN
brj-23886	276	35	,	,	PUNCT
brj-23886	276	36	yang	yang	PROPN
brj-23886	276	37	,	,	PUNCT
brj-23886	276	38	s.	s.	PROPN
brj-23886	276	39	,	,	PUNCT
brj-23886	276	40	land	land	NOUN
brj-23886	276	41	,	,	PUNCT
brj-23886	276	42	m.	m.	NOUN
brj-23886	276	43	l.	l.	PROPN
brj-23886	276	44	,	,	PUNCT
brj-23886	276	45	klingeman	klingeman	PROPN
brj-23886	276	46	,	,	PUNCT
brj-23886	276	47	d.	d.	PROPN
brj-23886	276	48	m.	m.	PROPN
brj-23886	276	49	,	,	PUNCT
brj-23886	276	50	bhandiwad	bhandiwad	NOUN
brj-23886	276	51	,	,	PUNCT
brj-23886	276	52	a.	a.	NOUN
brj-23886	276	53	,	,	PUNCT
brj-23886	276	54	rodriguez	rodriguez	PROPN
brj-23886	276	55	,	,	PUNCT
brj-23886	276	56	jr	jr	PROPN
brj-23886	276	57	.	.	PROPN
brj-23886	276	58	,	,	PUNCT
brj-23886	276	59	m.	m.	NOUN
brj-23886	276	60	,	,	PUNCT
brj-23886	276	61	et	et	PROPN
brj-23886	276	62	al	al	PROPN
brj-23886	276	63	.	.	PUNCT
brj-23886	277	1	(	(	PUNCT
brj-23886	277	2	2011	2011	NUM
brj-23886	277	3	)	)	PUNCT
brj-23886	277	4	.	.	PUNCT
brj-23886	278	1	“	"	PUNCT
brj-23886	278	2	mutant	mutant	ADJ
brj-23886	278	3	alcohol	alcohol	NOUN
brj-23886	278	4	dehydrogenase	dehydrogenase	NOUN
brj-23886	278	5	leads	lead	VERB
brj-23886	278	6	to	to	ADP
brj-23886	278	7	improved	improved	ADJ
brj-23886	278	8	ethanol	ethanol	NOUN
brj-23886	278	9	tolerance	tolerance	NOUN
brj-23886	278	10	in	in	ADP
brj-23886	278	11	clostridium	clostridium	NOUN
brj-23886	278	12	thermocellum	thermocellum	PROPN
brj-23886	278	13	,	,	PUNCT
brj-23886	278	14	”	"	PUNCT
brj-23886	278	15	proceedings	proceeding	NOUN
brj-23886	278	16	of	of	ADP
brj-23886	278	17	the	the	DET
brj-23886	278	18	national	national	PROPN
brj-23886	278	19	academy	academy	PROPN
brj-23886	278	20	of	of	ADP
brj-23886	278	21	sciences	sciences	PROPN
brj-23886	278	22	of	of	ADP
brj-23886	278	23	the	the	DET
brj-23886	278	24	united	united	PROPN
brj-23886	278	25	states	states	PROPN
brj-23886	278	26	of	of	ADP
brj-23886	278	27	america	america	PROPN
brj-23886	278	28	108(33	108(33	NUM
brj-23886	278	29	)	)	PUNCT
brj-23886	278	30	,	,	PUNCT
brj-23886	278	31	13752	13752	NUM
brj-23886	278	32	-	-	SYM
brj-23886	278	33	13757	13757	NUM
brj-23886	278	34	.	.	PUNCT
brj-23886	279	1	doi	doi	NOUN
brj-23886	279	2	:	:	PUNCT
brj-23886	279	3	10.1073	10.1073	NUM
brj-23886	279	4	/	/	SYM
brj-23886	279	5	pnas.1102444108	pnas.1102444108	PROPN
brj-23886	279	6	carere	carere	NOUN
brj-23886	279	7	,	,	PUNCT
brj-23886	279	8	c.	c.	PROPN
brj-23886	279	9	o.	o.	PROPN
brj-23886	279	10	,	,	PUNCT
brj-23886	279	11	rydzak	rydzak	NOUN
brj-23886	279	12	,	,	PUNCT
brj-23886	279	13	t.	t.	PROPN
brj-23886	279	14	,	,	PUNCT
brj-23886	279	15	cicek	cicek	PROPN
brj-23886	279	16	,	,	PUNCT
brj-23886	279	17	n.	n.	PROPN
brj-23886	279	18	,	,	PUNCT
brj-23886	279	19	levin	levin	PROPN
brj-23886	279	20	,	,	PUNCT
brj-23886	279	21	d.	d.	PROPN
brj-23886	279	22	b.	b.	PROPN
brj-23886	279	23	,	,	PUNCT
brj-23886	279	24	and	and	CCONJ
brj-23886	279	25	sparling	sparling	PROPN
brj-23886	279	26	,	,	PUNCT
brj-23886	279	27	r.	r.	PROPN
brj-23886	279	28	,	,	PUNCT
brj-23886	279	29	(	(	PUNCT
brj-23886	279	30	2014	2014	NUM
brj-23886	279	31	)	)	PUNCT
brj-23886	279	32	.	.	PUNCT
brj-23886	280	1	“	"	PUNCT
brj-23886	280	2	role	role	NOUN
brj-23886	280	3	of	of	ADP
brj-23886	280	4	transcription	transcription	NOUN
brj-23886	280	5	and	and	CCONJ
brj-23886	280	6	enzyme	enzyme	NOUN
brj-23886	280	7	activities	activity	NOUN
brj-23886	280	8	in	in	ADP
brj-23886	280	9	redistribution	redistribution	NOUN
brj-23886	280	10	of	of	ADP
brj-23886	280	11	carbon	carbon	NOUN
brj-23886	280	12	and	and	CCONJ
brj-23886	280	13	electron	electron	NOUN
brj-23886	280	14	flux	flux	NOUN
brj-23886	280	15	in	in	ADP
brj-23886	280	16	response	response	NOUN
brj-23886	280	17	to	to	ADP
brj-23886	280	18	n2	n2	ADJ
brj-23886	280	19	and	and	CCONJ
brj-23886	280	20	h2	h2	NOUN
brj-23886	280	21	sparging	sparging	NOUN
brj-23886	280	22	of	of	ADP
brj-23886	280	23	open	open	ADJ
brj-23886	280	24	-	-	PUNCT
brj-23886	280	25	batch	batch	NOUN
brj-23886	280	26	cultures	culture	NOUN
brj-23886	280	27	of	of	ADP
brj-23886	280	28	clostridium	clostridium	NOUN
brj-23886	280	29	thermocellum	thermocellum	PROPN
brj-23886	280	30	atcc	atcc	PROPN
brj-23886	280	31	27405	27405	NUM
brj-23886	280	32	,	,	PUNCT
brj-23886	280	33	”	"	PUNCT
brj-23886	280	34	applied	apply	VERB
brj-23886	280	35	microbiology	microbiology	NOUN
brj-23886	280	36	&	&	CCONJ
brj-23886	280	37	biotechnology	biotechnology	PROPN
brj-23886	280	38	98(6	98(6	PROPN
brj-23886	280	39	)	)	PUNCT
brj-23886	280	40	,	,	PUNCT
brj-23886	280	41	2829	2829	NUM
brj-23886	280	42	-	-	SYM
brj-23886	280	43	2840	2840	NUM
brj-23886	280	44	.	.	PUNCT
brj-23886	281	1	doi	doi	NOUN
brj-23886	281	2	:	:	PUNCT
brj-23886	281	3	10.1007	10.1007	NUM
brj-23886	281	4	/	/	SYM
brj-23886	281	5	s00253	s00253	NOUN
brj-23886	281	6	-	-	PUNCT
brj-23886	281	7	013	013	NUM
brj-23886	281	8	-	-	PUNCT
brj-23886	281	9	5500	5500	NUM
brj-23886	281	10	-	-	PUNCT
brj-23886	281	11	y	y	PROPN
brj-23886	281	12	chang	chang	PROPN
brj-23886	281	13	,	,	PUNCT
brj-23886	281	14	y.-c	y.-c	PROPN
brj-23886	281	15	.	.	PROPN
brj-23886	281	16	,	,	PUNCT
brj-23886	281	17	lee	lee	PROPN
brj-23886	281	18	,	,	PUNCT
brj-23886	281	19	w.-j	w.-j	PROPN
brj-23886	281	20	.	.	PROPN
brj-23886	281	21	,	,	PUNCT
brj-23886	281	22	lin	lin	PROPN
brj-23886	281	23	,	,	PUNCT
brj-23886	281	24	s.-l	s.-l	NOUN
brj-23886	281	25	.	.	PUNCT
brj-23886	281	26	,	,	PUNCT
brj-23886	281	27	and	and	CCONJ
brj-23886	281	28	wang	wang	PROPN
brj-23886	281	29	,	,	PUNCT
brj-23886	281	30	l.-c	l.-c	PROPN
brj-23886	281	31	.	.	PUNCT
brj-23886	282	1	(	(	PUNCT
brj-23886	282	2	2013	2013	NUM
brj-23886	282	3	)	)	PUNCT
brj-23886	282	4	.	.	PUNCT
brj-23886	283	1	“	"	PUNCT
brj-23886	283	2	green	green	ADJ
brj-23886	283	3	energy	energy	NOUN
brj-23886	283	4	:	:	PUNCT
brj-23886	283	5	watercontaining	watercontaine	VERB
brj-23886	283	6	acetone	acetone	NOUN
brj-23886	283	7	–	–	PUNCT
brj-23886	283	8	butanol	butanol	NOUN
brj-23886	283	9	–	–	PUNCT
brj-23886	283	10	ethanol	ethanol	NOUN
brj-23886	283	11	diesel	diesel	NOUN
brj-23886	283	12	blends	blend	NOUN
brj-23886	283	13	fueled	fuel	VERB
brj-23886	283	14	in	in	ADP
brj-23886	283	15	diesel	diesel	NOUN
brj-23886	283	16	engines	engine	NOUN
brj-23886	283	17	,	,	PUNCT
brj-23886	283	18	”	"	PUNCT
brj-23886	283	19	applied	apply	VERB
brj-23886	283	20	energy	energy	NOUN
brj-23886	283	21	109	109	NUM
brj-23886	283	22	,	,	PUNCT
brj-23886	283	23	182	182	NUM
brj-23886	283	24	-	-	SYM
brj-23886	283	25	191	191	NUM
brj-23886	283	26	.	.	PUNCT
brj-23886	284	1	doi	doi	NOUN
brj-23886	284	2	:	:	PUNCT
brj-23886	284	3	10.1016	10.1016	NUM
brj-23886	284	4	/	/	SYM
brj-23886	284	5	j.apenergy.2013.03.086	j.apenergy.2013.03.086	PROPN
brj-23886	284	6	darnall	darnall	PROPN
brj-23886	284	7	,	,	PUNCT
brj-23886	284	8	d.	d.	PROPN
brj-23886	284	9	w.	w.	PROPN
brj-23886	284	10	,	,	PUNCT
brj-23886	284	11	and	and	CCONJ
brj-23886	284	12	birnbaum	birnbaum	PROPN
brj-23886	284	13	,	,	PUNCT
brj-23886	284	14	e.	e.	PROPN
brj-23886	284	15	r.	r.	PROPN
brj-23886	284	16	(	(	PUNCT
brj-23886	284	17	1970	1970	NUM
brj-23886	284	18	)	)	PUNCT
brj-23886	284	19	.	.	PUNCT
brj-23886	285	1	“	"	PUNCT
brj-23886	285	2	rare	rare	ADJ
brj-23886	285	3	earth	earth	NOUN
brj-23886	285	4	metal	metal	NOUN
brj-23886	285	5	ions	ion	NOUN
brj-23886	285	6	as	as	ADP
brj-23886	285	7	probes	probe	NOUN
brj-23886	285	8	of	of	ADP
brj-23886	285	9	calcium	calcium	NOUN
brj-23886	285	10	ion	ion	NOUN
brj-23886	285	11	binding	bind	VERB
brj-23886	285	12	sites	site	NOUN
brj-23886	285	13	in	in	ADP
brj-23886	285	14	proteins	protein	NOUN
brj-23886	285	15	,	,	PUNCT
brj-23886	285	16	”	"	PUNCT
brj-23886	285	17	journal	journal	NOUN
brj-23886	285	18	of	of	ADP
brj-23886	285	19	biological	biological	ADJ
brj-23886	285	20	chemistry	chemistry	NOUN
brj-23886	285	21	245(23	245(23	NOUN
brj-23886	285	22	)	)	PUNCT
brj-23886	285	23	,	,	PUNCT
brj-23886	285	24	6484	6484	NUM
brj-23886	285	25	-	-	SYM
brj-23886	285	26	6486	6486	NUM
brj-23886	285	27	.	.	PUNCT
brj-23886	286	1	doi:10.1016	doi:10.1016	PROPN
brj-23886	286	2	/	/	SYM
brj-23886	286	3	b978	b978	PROPN
brj-23886	286	4	-	-	PUNCT
brj-23886	286	5	0	0	NUM
brj-23886	286	6	-	-	PUNCT
brj-23886	286	7	444	444	NUM
brj-23886	286	8	-	-	PUNCT
brj-23886	286	9	53159	53159	NUM
brj-23886	286	10	-	-	PUNCT
brj-23886	286	11	9.00012	9.00012	NUM
brj-23886	286	12	-	-	PUNCT
brj-23886	286	13	7	7	NUM
brj-23886	286	14	desai	desai	PROPN
brj-23886	286	15	,	,	PUNCT
brj-23886	286	16	s.	s.	PROPN
brj-23886	286	17	g.	g.	PROPN
brj-23886	286	18	,	,	PUNCT
brj-23886	286	19	guerinot	guerinot	PROPN
brj-23886	286	20	,	,	PUNCT
brj-23886	286	21	m.	m.	NOUN
brj-23886	286	22	l.	l.	PROPN
brj-23886	286	23	,	,	PUNCT
brj-23886	286	24	and	and	CCONJ
brj-23886	286	25	lynd	lynd	PROPN
brj-23886	286	26	,	,	PUNCT
brj-23886	286	27	l.	l.	PROPN
brj-23886	286	28	r.	r.	PROPN
brj-23886	286	29	(	(	PUNCT
brj-23886	286	30	2004	2004	NUM
brj-23886	286	31	)	)	PUNCT
brj-23886	286	32	.	.	PUNCT
brj-23886	287	1	“	"	PUNCT
brj-23886	287	2	cloning	cloning	NOUN
brj-23886	287	3	of	of	ADP
brj-23886	287	4	l	l	NOUN
brj-23886	287	5	-lactate	-lactate	ADJ
brj-23886	287	6	dehydrogenase	dehydrogenase	NOUN
brj-23886	287	7	and	and	CCONJ
brj-23886	287	8	elimination	elimination	NOUN
brj-23886	287	9	of	of	ADP
brj-23886	287	10	lactic	lactic	ADJ
brj-23886	287	11	acid	acid	NOUN
brj-23886	287	12	production	production	NOUN
brj-23886	287	13	via	via	ADP
brj-23886	287	14	gene	gene	NOUN
brj-23886	287	15	knockout	knockout	NOUN
brj-23886	287	16	in	in	ADP
brj-23886	287	17	thermoanaerobacterium	thermoanaerobacterium	PROPN
brj-23886	287	18	saccharolyticum	saccharolyticum	PROPN
brj-23886	287	19	jw	jw	PROPN
brj-23886	287	20	/	/	SYM
brj-23886	287	21	sl	sl	PROPN
brj-23886	287	22	-	-	PUNCT
brj-23886	287	23	ys485	ys485	PROPN
brj-23886	287	24	,	,	PUNCT
brj-23886	287	25	”	"	PUNCT
brj-23886	287	26	applied	apply	VERB
brj-23886	287	27	microbiology	microbiology	NOUN
brj-23886	287	28	&	&	CCONJ
brj-23886	287	29	biotechnology	biotechnology	NOUN
brj-23886	287	30	65(5	65(5	PROPN
brj-23886	287	31	)	)	PUNCT
brj-23886	287	32	,	,	PUNCT
brj-23886	287	33	600	600	NUM
brj-23886	287	34	-	-	SYM
brj-23886	287	35	605	605	NUM
brj-23886	287	36	.	.	PUNCT
brj-23886	288	1	doi10.1007	doi10.1007	NOUN
brj-23886	288	2	/	/	SYM
brj-23886	288	3	s00253	s00253	NOUN
brj-23886	288	4	-	-	PUNCT
brj-23886	288	5	004	004	VERB
brj-23886	288	6	-	-	PUNCT
brj-23886	288	7	1575	1575	NUM
brj-23886	288	8	-	-	SYM
brj-23886	288	9	9	9	NUM
brj-23886	288	10	diatloff	diatloff	NOUN
brj-23886	288	11	,	,	PUNCT
brj-23886	288	12	e.	e.	PROPN
brj-23886	288	13	,	,	PUNCT
brj-23886	288	14	smith	smith	PROPN
brj-23886	288	15	,	,	PUNCT
brj-23886	288	16	f.	f.	PROPN
brj-23886	288	17	w.	w.	PROPN
brj-23886	288	18	,	,	PUNCT
brj-23886	288	19	and	and	CCONJ
brj-23886	288	20	asher	asher	PROPN
brj-23886	288	21	,	,	PUNCT
brj-23886	288	22	c.	c.	PROPN
brj-23886	288	23	j.	j.	PROPN
brj-23886	288	24	(	(	PUNCT
brj-23886	288	25	1995	1995	NUM
brj-23886	288	26	)	)	PUNCT
brj-23886	288	27	.	.	PUNCT
brj-23886	289	1	“	"	PUNCT
brj-23886	289	2	rare	rare	ADJ
brj-23886	289	3	earth	earth	NOUN
brj-23886	289	4	elements	element	NOUN
brj-23886	289	5	and	and	CCONJ
brj-23886	289	6	plant	plant	NOUN
brj-23886	289	7	growth	growth	NOUN
brj-23886	289	8	:	:	PUNCT
brj-23886	289	9	i.	i.	NOUN
brj-23886	289	10	effects	effect	NOUN
brj-23886	289	11	of	of	ADP
brj-23886	289	12	lanthanum	lanthanum	NOUN
brj-23886	289	13	and	and	CCONJ
brj-23886	289	14	cerium	cerium	NOUN
brj-23886	289	15	on	on	ADP
brj-23886	289	16	root	root	NOUN
brj-23886	289	17	elongation	elongation	NOUN
brj-23886	289	18	of	of	ADP
brj-23886	289	19	corn	corn	NOUN
brj-23886	289	20	and	and	CCONJ
brj-23886	289	21	mungbean	mungbean	NOUN
brj-23886	289	22	,	,	PUNCT
brj-23886	289	23	”	"	PUNCT
brj-23886	289	24	journal	journal	NOUN
brj-23886	289	25	of	of	ADP
brj-23886	289	26	plant	plant	NOUN
brj-23886	289	27	nutrition	nutrition	NOUN
brj-23886	289	28	18	18	NUM
brj-23886	289	29	,	,	PUNCT
brj-23886	289	30	1963	1963	NUM
brj-23886	289	31	-	-	SYM
brj-23886	289	32	1976	1976	NUM
brj-23886	289	33	.	.	PUNCT
brj-23886	290	1	doi	doi	NOUN
brj-23886	290	2	:	:	PUNCT
brj-23886	290	3	10.1080/01904169509365037	10.1080/01904169509365037	NUM
brj-23886	290	4	fu	fu	NOUN
brj-23886	290	5	,	,	PUNCT
brj-23886	290	6	h.	h.	PROPN
brj-23886	290	7	,	,	PUNCT
brj-23886	290	8	yang	yang	PROPN
brj-23886	290	9	,	,	PUNCT
brj-23886	290	10	x.	x.	PROPN
brj-23886	290	11	,	,	PUNCT
brj-23886	290	12	qu	qu	PROPN
brj-23886	290	13	,	,	PUNCT
brj-23886	290	14	c.	c.	PROPN
brj-23886	290	15	,	,	PUNCT
brj-23886	290	16	and	and	CCONJ
brj-23886	290	17	wang	wang	PROPN
brj-23886	290	18	,	,	PUNCT
brj-23886	290	19	j.	j.	PROPN
brj-23886	290	20	f.	f.	PROPN
brj-23886	290	21	(	(	PUNCT
brj-23886	290	22	2019	2019	NUM
brj-23886	290	23	)	)	PUNCT
brj-23886	290	24	.	.	PUNCT
brj-23886	291	1	“	"	PUNCT
brj-23886	291	2	enhanced	enhance	VERB
brj-23886	291	3	ethanol	ethanol	NOUN
brj-23886	291	4	production	production	NOUN
brj-23886	291	5	from	from	ADP
brj-23886	291	6	lignocellulosic	lignocellulosic	ADJ
brj-23886	291	7	hydrolysates	hydrolysate	NOUN
brj-23886	291	8	by	by	ADP
brj-23886	291	9	inhibiting	inhibit	VERB
brj-23886	291	10	the	the	DET
brj-23886	291	11	hydrogen	hydrogen	NOUN
brj-23886	291	12	synthesis	synthesis	NOUN
brj-23886	291	13	in	in	ADP
brj-23886	291	14	thermoanaerobacterium	thermoanaerobacterium	ADJ
brj-23886	291	15	aotearoense	aotearoense	NOUN
brj-23886	291	16	scut27(δidh	scut27(δidh	PROPN
brj-23886	291	17	)	)	PUNCT
brj-23886	291	18	,	,	PUNCT
brj-23886	291	19	”	"	PUNCT
brj-23886	291	20	journal	journal	NOUN
brj-23886	291	21	of	of	ADP
brj-23886	291	22	chemical	chemical	PROPN
brj-23886	291	23	technology	technology	PROPN
brj-23886	291	24	&	&	CCONJ
brj-23886	291	25	biotechnology	biotechnology	NOUN
brj-23886	291	26	94	94	NUM
brj-23886	291	27	,	,	PUNCT
brj-23886	291	28	3305	3305	NUM
brj-23886	291	29	-	-	SYM
brj-23886	291	30	3314	3314	NUM
brj-23886	291	31	.	.	PUNCT
brj-23886	292	1	doi:10.1002	doi:10.1002	NOUN
brj-23886	292	2	/	/	SYM
brj-23886	292	3	jctb.6141	jctb.6141	PROPN
brj-23886	292	4	furukawa	furukawa	PROPN
brj-23886	292	5	,	,	PUNCT
brj-23886	292	6	t.	t.	PROPN
brj-23886	292	7	,	,	PUNCT
brj-23886	292	8	shida	shida	PROPN
brj-23886	292	9	y.	y.	PROPN
brj-23886	292	10	,	,	PUNCT
brj-23886	292	11	kitagami	kitagami	PROPN
brj-23886	292	12	n.	n.	PROPN
brj-23886	292	13	,	,	PUNCT
brj-23886	292	14	mori	mori	PROPN
brj-23886	292	15	k.	k.	PROPN
brj-23886	292	16	,	,	PUNCT
brj-23886	292	17	kato	kato	PROPN
brj-23886	292	18	m.	m.	PROPN
brj-23886	292	19	,	,	PUNCT
brj-23886	292	20	kobayashi	kobayashi	PROPN
brj-23886	292	21	t.	t.	PROPN
brj-23886	292	22	,	,	PUNCT
brj-23886	292	23	okada	okada	PROPN
brj-23886	292	24	h.	h.	PROPN
brj-23886	292	25	,	,	PUNCT
brj-23886	292	26	ogasawara	ogasawara	PROPN
brj-23886	292	27	w.	w.	PROPN
brj-23886	292	28	,	,	PUNCT
brj-23886	292	29	and	and	CCONJ
brj-23886	292	30	morikawa	morikawa	PROPN
brj-23886	292	31	y.	y.	PROPN
brj-23886	292	32	(	(	PUNCT
brj-23886	292	33	2009	2009	NUM
brj-23886	292	34	)	)	PUNCT
brj-23886	292	35	.	.	PUNCT
brj-23886	293	1	“	"	PUNCT
brj-23886	293	2	identification	identification	NOUN
brj-23886	293	3	of	of	ADP
brj-23886	293	4	specific	specific	ADJ
brj-23886	293	5	binding	bind	VERB
brj-23886	293	6	sites	site	NOUN
brj-23886	293	7	for	for	ADP
brj-23886	293	8	xyr1	xyr1	PROPN
brj-23886	293	9	,	,	PUNCT
brj-23886	293	10	a	a	DET
brj-23886	293	11	transcriptional	transcriptional	ADJ
brj-23886	293	12	activator	activator	NOUN
brj-23886	293	13	of	of	ADP
brj-23886	293	14	cellulolytic	cellulolytic	ADJ
brj-23886	293	15	and	and	CCONJ
brj-23886	293	16	xylanolytic	xylanolytic	ADJ
brj-23886	293	17	genes	gene	NOUN
brj-23886	293	18	in	in	ADP
brj-23886	293	19	trichoderma	trichoderma	PROPN
brj-23886	293	20	reesei	reesei	ADJ
brj-23886	293	21	,	,	PUNCT
brj-23886	293	22	”	"	PUNCT
brj-23886	293	23	fungal	fungal	ADJ
brj-23886	293	24	genetics	genetic	NOUN
brj-23886	293	25	&	&	CCONJ
brj-23886	293	26	biology	biology	NOUN
brj-23886	293	27	46(8	46(8	NOUN
brj-23886	293	28	)	)	PUNCT
brj-23886	293	29	,	,	PUNCT
brj-23886	293	30	564	564	NUM
brj-23886	293	31	-	-	SYM
brj-23886	293	32	574	574	NUM
brj-23886	293	33	.	.	PUNCT
brj-23886	294	1	doi	doi	NOUN
brj-23886	294	2	:	:	PUNCT
brj-23886	294	3	10.1016	10.1016	NUM
brj-23886	294	4	/	/	SYM
brj-23886	294	5	j.fgb.2009.04.001	j.fgb.2009.04.001	NOUN
brj-23886	294	6	.	.	PUNCT
brj-23886	295	1	gomez	gomez	PROPN
brj-23886	295	2	,	,	PUNCT
brj-23886	295	3	j.	j.	PROPN
brj-23886	295	4	e.	e.	PROPN
brj-23886	295	5	,	,	PUNCT
brj-23886	295	6	birnbaum	birnbaum	PROPN
brj-23886	295	7	,	,	PUNCT
brj-23886	295	8	e.	e.	PROPN
brj-23886	295	9	r.	r.	PROPN
brj-23886	295	10	,	,	PUNCT
brj-23886	295	11	and	and	CCONJ
brj-23886	295	12	darnall	darnall	PROPN
brj-23886	295	13	,	,	PUNCT
brj-23886	295	14	d.	d.	PROPN
brj-23886	295	15	w.	w.	PROPN
brj-23886	295	16	(	(	PUNCT
brj-23886	295	17	1974	1974	NUM
brj-23886	295	18	)	)	PUNCT
brj-23886	295	19	.	.	PUNCT
brj-23886	296	1	“	"	PUNCT
brj-23886	296	2	the	the	DET
brj-23886	296	3	metal	metal	NOUN
brj-23886	296	4	ion	ion	NOUN
brj-23886	296	5	acceleration	acceleration	NOUN
brj-23886	296	6	of	of	ADP
brj-23886	296	7	the	the	DET
brj-23886	296	8	conversion	conversion	NOUN
brj-23886	296	9	of	of	ADP
brj-23886	296	10	trypsinogen	trypsinogen	NOUN
brj-23886	296	11	to	to	ADP
brj-23886	296	12	trypsin	trypsin	VERB
brj-23886	296	13	.	.	PUNCT
brj-23886	297	1	lanthanide	lanthanide	ADJ
brj-23886	297	2	ions	ion	NOUN
brj-23886	297	3	as	as	ADP
brj-23886	297	4	calcium	calcium	NOUN
brj-23886	297	5	ion	ion	NOUN
brj-23886	297	6	substitutes	substitute	NOUN
brj-23886	297	7	,	,	PUNCT
brj-23886	297	8	”	"	PUNCT
brj-23886	297	9	biochemistry	biochemistry	NOUN
brj-23886	297	10	13(18	13(18	NUM
brj-23886	297	11	)	)	PUNCT
brj-23886	297	12	,	,	PUNCT
brj-23886	297	13	3745	3745	NUM
brj-23886	297	14	-	-	SYM
brj-23886	297	15	3750	3750	NUM
brj-23886	297	16	.	.	PUNCT
brj-23886	298	1	doi:10.1021	doi:10.1021	ADJ
brj-23886	298	2	/	/	SYM
brj-23886	298	3	bi00715a020	bi00715a020	PROPN
brj-23886	298	4	peer	peer	NOUN
brj-23886	298	5	-	-	PUNCT
brj-23886	298	6	reviewed	review	VERB
brj-23886	298	7	article	article	NOUN
brj-23886	298	8	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	298	9	cui	cui	PROPN
brj-23886	298	10	et	et	PROPN
brj-23886	298	11	al	al	PROPN
brj-23886	298	12	.	.	PROPN
brj-23886	299	1	(	(	PUNCT
brj-23886	299	2	2025	2025	NUM
brj-23886	299	3	)	)	PUNCT
brj-23886	299	4	.	.	PUNCT
brj-23886	300	1	“	"	PUNCT
brj-23886	300	2	genome	genome	NOUN
brj-23886	300	3	study	study	NOUN
brj-23886	300	4	of	of	ADP
brj-23886	300	5	c.	c.	PROPN
brj-23886	300	6	thermocellum	thermocellum	PROPN
brj-23886	300	7	,	,	PUNCT
brj-23886	300	8	”	"	PUNCT
brj-23886	300	9	bioresources	bioresource	NOUN
brj-23886	300	10	20(2	20(2	NUM
brj-23886	300	11	)	)	PUNCT
brj-23886	300	12	,	,	PUNCT
brj-23886	300	13	3155	3155	NUM
brj-23886	300	14	-	-	SYM
brj-23886	300	15	3175	3175	NUM
brj-23886	300	16	.	.	PUNCT
brj-23886	301	1	3172	3172	NUM
brj-23886	301	2	guo	guo	PROPN
brj-23886	301	3	,	,	PUNCT
brj-23886	301	4	y.	y.	PROPN
brj-23886	301	5	,	,	PUNCT
brj-23886	301	6	liu	liu	PROPN
brj-23886	301	7	,	,	PUNCT
brj-23886	301	8	g.	g.	PROPN
brj-23886	301	9	,	,	PUNCT
brj-23886	301	10	ning	ning	PROPN
brj-23886	301	11	,	,	PUNCT
brj-23886	301	12	y.	y.	PROPN
brj-23886	301	13	,	,	PUNCT
brj-23886	301	14	li	li	PROPN
brj-23886	301	15	,	,	PUNCT
brj-23886	301	16	x.	x.	PROPN
brj-23886	301	17	,	,	PUNCT
brj-23886	301	18	hu	hu	PROPN
brj-23886	301	19	,	,	PUNCT
brj-23886	301	20	s.	s.	PROPN
brj-23886	301	21	,	,	PUNCT
brj-23886	301	22	zhao	zhao	PROPN
brj-23886	301	23	,	,	PUNCT
brj-23886	301	24	j.	j.	PROPN
brj-23886	301	25	,	,	PUNCT
brj-23886	301	26	and	and	CCONJ
brj-23886	301	27	qu	qu	PROPN
brj-23886	301	28	,	,	PUNCT
brj-23886	301	29	y.	y.	PROPN
brj-23886	301	30	(	(	PUNCT
brj-23886	301	31	2022	2022	NUM
brj-23886	301	32	)	)	PUNCT
brj-23886	301	33	.	.	PUNCT
brj-23886	302	1	“	"	PUNCT
brj-23886	302	2	production	production	NOUN
brj-23886	302	3	of	of	ADP
brj-23886	302	4	cellulosic	cellulosic	NOUN
brj-23886	302	5	ethanol	ethanol	NOUN
brj-23886	302	6	and	and	CCONJ
brj-23886	302	7	value	value	NOUN
brj-23886	302	8	-	-	PUNCT
brj-23886	302	9	added	add	VERB
brj-23886	302	10	products	product	NOUN
brj-23886	302	11	from	from	ADP
brj-23886	302	12	corn	corn	NOUN
brj-23886	302	13	fiber	fiber	NOUN
brj-23886	302	14	,	,	PUNCT
brj-23886	302	15	”	"	PUNCT
brj-23886	302	16	bioresources	bioresource	NOUN
brj-23886	302	17	and	and	CCONJ
brj-23886	302	18	bioprocessing	bioprocesse	VERB
brj-23886	302	19	9	9	NUM
brj-23886	302	20	,	,	PUNCT
brj-23886	302	21	article	article	NOUN
brj-23886	302	22	81	81	NUM
brj-23886	302	23	.	.	PUNCT
brj-23886	303	1	doi	doi	NOUN
brj-23886	303	2	:	:	PUNCT
brj-23886	303	3	10.1186	10.1186	NUM
brj-23886	303	4	/	/	SYM
brj-23886	303	5	s40643	s40643	PROPN
brj-23886	303	6	-	-	PUNCT
brj-23886	303	7	022	022	NUM
brj-23886	303	8	-	-	PUNCT
brj-23886	303	9	00573	00573	NUM
brj-23886	303	10	-	-	SYM
brj-23886	303	11	9	9	NUM
brj-23886	303	12	hosseini	hosseini	PROPN
brj-23886	303	13	,	,	PUNCT
brj-23886	303	14	s.	s.	PROPN
brj-23886	303	15	e.	e.	PROPN
brj-23886	303	16	,	,	PUNCT
brj-23886	303	17	and	and	CCONJ
brj-23886	303	18	wahid	wahid	PROPN
brj-23886	303	19	,	,	PUNCT
brj-23886	303	20	m.	m.	NOUN
brj-23886	303	21	a.	a.	NOUN
brj-23886	303	22	(	(	PUNCT
brj-23886	303	23	2013	2013	NUM
brj-23886	303	24	)	)	PUNCT
brj-23886	303	25	.	.	PUNCT
brj-23886	304	1	“	"	PUNCT
brj-23886	304	2	feasibility	feasibility	NOUN
brj-23886	304	3	study	study	NOUN
brj-23886	304	4	of	of	ADP
brj-23886	304	5	biogas	biogas	NOUN
brj-23886	304	6	production	production	NOUN
brj-23886	304	7	and	and	CCONJ
brj-23886	304	8	utilization	utilization	NOUN
brj-23886	304	9	as	as	ADP
brj-23886	304	10	a	a	DET
brj-23886	304	11	source	source	NOUN
brj-23886	304	12	of	of	ADP
brj-23886	304	13	renewable	renewable	ADJ
brj-23886	304	14	energy	energy	NOUN
brj-23886	304	15	in	in	ADP
brj-23886	304	16	malaysia	malaysia	PROPN
brj-23886	304	17	,	,	PUNCT
brj-23886	304	18	”	"	PUNCT
brj-23886	304	19	renewable	renewable	ADJ
brj-23886	304	20	and	and	CCONJ
brj-23886	304	21	sustainable	sustainable	ADJ
brj-23886	304	22	energy	energy	NOUN
brj-23886	304	23	reviews	review	NOUN
brj-23886	304	24	19(5	19(5	NUM
brj-23886	304	25	)	)	PUNCT
brj-23886	304	26	,	,	PUNCT
brj-23886	304	27	454	454	NUM
brj-23886	304	28	-	-	SYM
brj-23886	304	29	462	462	NUM
brj-23886	304	30	.	.	PUNCT
brj-23886	305	1	doi	doi	NOUN
brj-23886	305	2	:	:	PUNCT
brj-23886	305	3	10.1016	10.1016	NUM
brj-23886	305	4	/	/	SYM
brj-23886	305	5	j.rser.2012.11.008	j.rser.2012.11.008	PROPN
brj-23886	305	6	huang	huang	PROPN
brj-23886	305	7	,	,	PUNCT
brj-23886	305	8	x.	x.	PROPN
brj-23886	305	9	,	,	PUNCT
brj-23886	305	10	li	li	PROPN
brj-23886	305	11	,	,	PUNCT
brj-23886	305	12	z.	z.	PROPN
brj-23886	305	13	,	,	PUNCT
brj-23886	305	14	du	du	PROPN
brj-23886	305	15	,	,	PUNCT
brj-23886	305	16	c.	c.	PROPN
brj-23886	305	17	,	,	PUNCT
brj-23886	305	18	wang	wang	PROPN
brj-23886	305	19	,	,	PUNCT
brj-23886	305	20	j.	j.	PROPN
brj-23886	305	21	,	,	PUNCT
brj-23886	305	22	and	and	CCONJ
brj-23886	305	23	li	li	PROPN
brj-23886	305	24	,	,	PUNCT
brj-23886	305	25	s.	s.	PROPN
brj-23886	305	26	(	(	PUNCT
brj-23886	305	27	2015	2015	NUM
brj-23886	305	28	)	)	PUNCT
brj-23886	305	29	.	.	PUNCT
brj-23886	306	1	“	"	PUNCT
brj-23886	306	2	improved	improve	VERB
brj-23886	306	3	expression	expression	NOUN
brj-23886	306	4	and	and	CCONJ
brj-23886	306	5	characterization	characterization	NOUN
brj-23886	306	6	of	of	ADP
brj-23886	306	7	a	a	DET
brj-23886	306	8	multidomain	multidomain	NOUN
brj-23886	306	9	xylanase	xylanase	PROPN
brj-23886	306	10	from	from	ADP
brj-23886	306	11	thermoanaerobacterium	thermoanaerobacterium	ADJ
brj-23886	306	12	aotearoense	aotearoense	ADJ
brj-23886	306	13	scut27	scut27	NOUN
brj-23886	306	14	in	in	ADP
brj-23886	306	15	bacillus	bacillus	NOUN
brj-23886	306	16	subtilis	subtili	NOUN
brj-23886	306	17	,	,	PUNCT
brj-23886	306	18	”	"	PUNCT
brj-23886	306	19	journal	journal	NOUN
brj-23886	306	20	of	of	ADP
brj-23886	306	21	agricultural	agricultural	ADJ
brj-23886	306	22	and	and	CCONJ
brj-23886	306	23	food	food	NOUN
brj-23886	306	24	chemistry	chemistry	NOUN
brj-23886	306	25	63(28	63(28	NOUN
brj-23886	306	26	)	)	PUNCT
brj-23886	306	27	,	,	PUNCT
brj-23886	306	28	6430	6430	NUM
brj-23886	306	29	-	-	SYM
brj-23886	306	30	6439	6439	NUM
brj-23886	306	31	.	.	PUNCT
brj-23886	307	1	doi	doi	NOUN
brj-23886	307	2	:	:	PUNCT
brj-23886	307	3	10.1021	10.1021	NUM
brj-23886	307	4	/	/	SYM
brj-23886	307	5	acs	acs	NOUN
brj-23886	307	6	.	.	PUNCT
brj-23886	308	1	jafc.5b01259	jafc.5b01259	PROPN
brj-23886	308	2	jayakumar	jayakumar	PROPN
brj-23886	308	3	,	,	PUNCT
brj-23886	308	4	m.	m.	NOUN
brj-23886	308	5	,	,	PUNCT
brj-23886	308	6	gebeyehu	gebeyehu	PROPN
brj-23886	308	7	,	,	PUNCT
brj-23886	308	8	k.	k.	PROPN
brj-23886	308	9	b.	b.	PROPN
brj-23886	308	10	,	,	PUNCT
brj-23886	308	11	abo	abo	PROPN
brj-23886	308	12	,	,	PUNCT
brj-23886	308	13	l.	l.	PROPN
brj-23886	308	14	d.	d.	PROPN
brj-23886	308	15	,	,	PUNCT
brj-23886	308	16	tadesse	tadesse	ADV
brj-23886	308	17	,	,	PUNCT
brj-23886	308	18	a.	a.	PROPN
brj-23886	308	19	w.	w.	PROPN
brj-23886	308	20	,	,	PUNCT
brj-23886	308	21	vivekanandan	vivekanandan	PROPN
brj-23886	308	22	,	,	PUNCT
brj-23886	308	23	b.	b.	PROPN
brj-23886	308	24	,	,	PUNCT
brj-23886	308	25	sundramurthy	sundramurthy	ADJ
brj-23886	308	26	,	,	PUNCT
brj-23886	308	27	v.	v.	PROPN
brj-23886	308	28	p.	p.	PROPN
brj-23886	308	29	,	,	PUNCT
brj-23886	308	30	bacha	bacha	PROPN
brj-23886	308	31	,	,	PUNCT
brj-23886	308	32	w.	w.	PROPN
brj-23886	308	33	,	,	PUNCT
brj-23886	308	34	ashokkumar	ashokkumar	PROPN
brj-23886	308	35	,	,	PUNCT
brj-23886	308	36	v.	v.	ADV
brj-23886	308	37	,	,	PUNCT
brj-23886	308	38	and	and	CCONJ
brj-23886	308	39	baskar	baskar	NOUN
brj-23886	308	40	,	,	PUNCT
brj-23886	308	41	g.	g.	PROPN
brj-23886	308	42	(	(	PUNCT
brj-23886	308	43	2023	2023	NUM
brj-23886	308	44	)	)	PUNCT
brj-23886	308	45	.	.	PUNCT
brj-23886	309	1	“	"	PUNCT
brj-23886	309	2	a	a	DET
brj-23886	309	3	comprehensive	comprehensive	ADJ
brj-23886	309	4	outlook	outlook	NOUN
brj-23886	309	5	on	on	ADP
brj-23886	309	6	topical	topical	ADJ
brj-23886	309	7	processing	processing	NOUN
brj-23886	309	8	methods	method	NOUN
brj-23886	309	9	for	for	ADP
brj-23886	309	10	biofuel	biofuel	NOUN
brj-23886	309	11	production	production	NOUN
brj-23886	309	12	and	and	CCONJ
brj-23886	309	13	its	its	PRON
brj-23886	309	14	thermal	thermal	ADJ
brj-23886	309	15	applications	application	NOUN
brj-23886	309	16	:	:	PUNCT
brj-23886	309	17	current	current	ADJ
brj-23886	309	18	advances	advance	NOUN
brj-23886	309	19	,	,	PUNCT
brj-23886	309	20	sustainability	sustainability	NOUN
brj-23886	309	21	and	and	CCONJ
brj-23886	309	22	challenges	challenge	NOUN
brj-23886	309	23	,	,	PUNCT
brj-23886	309	24	”	"	PUNCT
brj-23886	309	25	fuel	fuel	NOUN
brj-23886	309	26	349	349	NUM
brj-23886	309	27	,	,	PUNCT
brj-23886	309	28	article	article	NOUN
brj-23886	309	29	i	i	PROPN
brj-23886	309	30	d	d	PROPN
brj-23886	309	31	128690	128690	NUM
brj-23886	309	32	.	.	PUNCT
brj-23886	310	1	doi	doi	NOUN
brj-23886	310	2	:	:	PUNCT
brj-23886	310	3	10.1016	10.1016	NUM
brj-23886	310	4	/	/	SYM
brj-23886	310	5	j.fuel.2023.128690	j.fuel.2023.128690	PROPN
brj-23886	310	6	jiang	jiang	PROPN
brj-23886	310	7	,	,	PUNCT
brj-23886	310	8	y.	y.	PROPN
brj-23886	310	9	z.	z.	PROPN
brj-23886	310	10	,	,	PUNCT
brj-23886	310	11	yuan	yuan	PROPN
brj-23886	310	12	,	,	PUNCT
brj-23886	310	13	x.	x.	PROPN
brj-23886	310	14	y.	y.	PROPN
brj-23886	310	15	,	,	PUNCT
brj-23886	310	16	huang	huang	PROPN
brj-23886	310	17	,	,	PUNCT
brj-23886	310	18	h.	h.	PROPN
brj-23886	310	19	b.	b.	PROPN
brj-23886	310	20	,	,	PUNCT
brj-23886	310	21	wang	wang	PROPN
brj-23886	310	22	,	,	PUNCT
brj-23886	310	23	d.	d.	PROPN
brj-23886	310	24	,	,	PUNCT
brj-23886	310	25	liu	liu	PROPN
brj-23886	310	26	,	,	PUNCT
brj-23886	310	27	r.	r.	PROPN
brj-23886	310	28	m.	m.	PROPN
brj-23886	310	29	,	,	PUNCT
brj-23886	310	30	wang	wang	PROPN
brj-23886	310	31	,	,	PUNCT
brj-23886	310	32	h.	h.	PROPN
brj-23886	310	33	l.	l.	PROPN
brj-23886	310	34	,	,	PUNCT
brj-23886	310	35	and	and	CCONJ
brj-23886	310	36	teng	teng	PROPN
brj-23886	310	37	,	,	PUNCT
brj-23886	310	38	f.	f.	PROPN
brj-23886	310	39	(	(	PUNCT
brj-23886	310	40	2021	2021	NUM
brj-23886	310	41	)	)	PUNCT
brj-23886	310	42	.	.	PUNCT
brj-23886	311	1	“	"	PUNCT
brj-23886	311	2	research	research	NOUN
brj-23886	311	3	progress	progress	NOUN
brj-23886	311	4	and	and	CCONJ
brj-23886	311	5	the	the	DET
brj-23886	311	6	biotechnological	biotechnological	ADJ
brj-23886	311	7	applications	application	NOUN
brj-23886	311	8	of	of	ADP
brj-23886	311	9	multienzyme	multienzyme	NOUN
brj-23886	311	10	complex	complex	ADJ
brj-23886	311	11	,	,	PUNCT
brj-23886	311	12	”	"	PUNCT
brj-23886	311	13	applied	apply	VERB
brj-23886	311	14	microbiology	microbiology	NOUN
brj-23886	311	15	and	and	CCONJ
brj-23886	311	16	biotechnology	biotechnology	NOUN
brj-23886	311	17	105(5	105(5	NUM
brj-23886	311	18	)	)	PUNCT
brj-23886	311	19	,	,	PUNCT
brj-23886	311	20	1759	1759	NUM
brj-23886	311	21	-	-	SYM
brj-23886	311	22	1777	1777	NUM
brj-23886	311	23	.	.	PUNCT
brj-23886	312	1	doi	doi	NOUN
brj-23886	312	2	:	:	PUNCT
brj-23886	312	3	10.1007	10.1007	NUM
brj-23886	312	4	/	/	SYM
brj-23886	312	5	s00253	s00253	NOUN
brj-23886	312	6	-	-	PUNCT
brj-23886	312	7	021	021	NUM
brj-23886	312	8	-	-	PUNCT
brj-23886	312	9	11121	11121	NUM
brj-23886	312	10	-	-	SYM
brj-23886	312	11	4	4	NUM
brj-23886	312	12	joan	joan	NOUN
brj-23886	312	13	,	,	PUNCT
brj-23886	312	14	g.	g.	PROPN
brj-23886	312	15	,	,	PUNCT
brj-23886	312	16	marcano	marcano	PROPN
brj-23886	312	17	-	-	PUNCT
brj-23886	312	18	velazquez	velazquez	PROPN
brj-23886	312	19	,	,	PUNCT
brj-23886	312	20	j.	j.	PROPN
brj-23886	312	21	,	,	PUNCT
brj-23886	312	22	lo	lo	PROPN
brj-23886	312	23	,	,	PUNCT
brj-23886	312	24	a.	a.	NOUN
brj-23886	312	25	,	,	PUNCT
brj-23886	312	26	maness	maness	NOUN
brj-23886	312	27	,	,	PUNCT
brj-23886	312	28	p.-c	p.-c	NOUN
brj-23886	312	29	.	.	PUNCT
brj-23886	312	30	,	,	PUNCT
brj-23886	312	31	and	and	CCONJ
brj-23886	312	32	chou	chou	NOUN
brj-23886	312	33	,	,	PUNCT
brj-23886	312	34	k.	k.	PROPN
brj-23886	312	35	j.	j.	PROPN
brj-23886	312	36	(	(	PUNCT
brj-23886	312	37	2019	2019	NUM
brj-23886	312	38	)	)	PUNCT
brj-23886	312	39	.	.	PUNCT
brj-23886	313	1	“	"	PUNCT
brj-23886	313	2	developing	develop	VERB
brj-23886	313	3	riboswitch	riboswitch	NOUN
brj-23886	313	4	-	-	PUNCT
brj-23886	313	5	mediated	mediate	VERB
brj-23886	313	6	gene	gene	NOUN
brj-23886	313	7	regulatory	regulatory	ADJ
brj-23886	313	8	controls	control	NOUN
brj-23886	313	9	in	in	ADP
brj-23886	313	10	thermophilic	thermophilic	ADJ
brj-23886	313	11	bacteria	bacteria	NOUN
brj-23886	313	12	,	,	PUNCT
brj-23886	313	13	”	"	PUNCT
brj-23886	313	14	acs	acs	NOUN
brj-23886	313	15	synthetic	synthetic	ADJ
brj-23886	313	16	biology	biology	NOUN
brj-23886	313	17	8(4	8(4	NOUN
brj-23886	313	18	)	)	PUNCT
brj-23886	313	19	,	,	PUNCT
brj-23886	313	20	633	633	NUM
brj-23886	313	21	-	-	SYM
brj-23886	313	22	640	640	NUM
brj-23886	313	23	.	.	PUNCT
brj-23886	314	1	doi	doi	NOUN
brj-23886	314	2	:	:	PUNCT
brj-23886	314	3	10.1021	10.1021	NUM
brj-23886	314	4	/	/	SYM
brj-23886	314	5	acssynbio.8b00487	acssynbio.8b00487	PROPN
brj-23886	314	6	kannuchamy	kannuchamy	PROPN
brj-23886	314	7	,	,	PUNCT
brj-23886	314	8	s.	s.	PROPN
brj-23886	314	9	,	,	PUNCT
brj-23886	314	10	mukund	mukund	PROPN
brj-23886	314	11	,	,	PUNCT
brj-23886	314	12	n.	n.	NOUN
brj-23886	314	13	,	,	PUNCT
brj-23886	314	14	and	and	CCONJ
brj-23886	314	15	saleena	saleena	PROPN
brj-23886	314	16	,	,	PUNCT
brj-23886	314	17	l.	l.	PROPN
brj-23886	314	18	m.	m.	PROPN
brj-23886	314	19	(	(	PUNCT
brj-23886	314	20	2016	2016	NUM
brj-23886	314	21	)	)	PUNCT
brj-23886	314	22	.	.	PUNCT
brj-23886	315	1	“	"	PUNCT
brj-23886	315	2	genetic	genetic	ADJ
brj-23886	315	3	engineering	engineering	NOUN
brj-23886	315	4	of	of	ADP
brj-23886	315	5	clostridium	clostridium	PROPN
brj-23886	315	6	thermocellum	thermocellum	PROPN
brj-23886	315	7	dsm1313	dsm1313	VERB
brj-23886	315	8	for	for	ADP
brj-23886	315	9	enhanced	enhanced	ADJ
brj-23886	315	10	ethanol	ethanol	NOUN
brj-23886	315	11	production	production	NOUN
brj-23886	315	12	,	,	PUNCT
brj-23886	315	13	”	"	PUNCT
brj-23886	315	14	bmc	bmc	NOUN
brj-23886	315	15	biotechnology	biotechnology	NOUN
brj-23886	315	16	16(1	16(1	NUM
brj-23886	315	17	)	)	PUNCT
brj-23886	315	18	,	,	PUNCT
brj-23886	315	19	article	article	NOUN
brj-23886	315	20	34	34	NUM
brj-23886	315	21	.	.	PUNCT
brj-23886	316	1	doi	doi	PROPN
brj-23886	316	2	:	:	PUNCT
brj-23886	316	3	10.1186	10.1186	NUM
brj-23886	316	4	/	/	SYM
brj-23886	316	5	s12896	s12896	NOUN
brj-23886	316	6	-	-	PUNCT
brj-23886	316	7	016	016	NUM
brj-23886	316	8	-	-	PUNCT
brj-23886	316	9	0260	0260	NUM
brj-23886	316	10	-	-	SYM
brj-23886	316	11	2	2	NUM
brj-23886	316	12	leacock	leacock	NOUN
brj-23886	316	13	,	,	PUNCT
brj-23886	316	14	s.	s.	PROPN
brj-23886	316	15	w.	w.	PROPN
brj-23886	316	16	,	,	PUNCT
brj-23886	316	17	and	and	CCONJ
brj-23886	316	18	reinke	reinke	NOUN
brj-23886	316	19	,	,	PUNCT
brj-23886	316	20	v.	v.	CCONJ
brj-23886	316	21	(	(	PUNCT
brj-23886	316	22	2006	2006	NUM
brj-23886	316	23	)	)	PUNCT
brj-23886	316	24	.	.	PUNCT
brj-23886	317	1	“	"	PUNCT
brj-23886	317	2	expression	expression	NOUN
brj-23886	317	3	profiling	profiling	NOUN
brj-23886	317	4	of	of	ADP
brj-23886	317	5	map	map	NOUN
brj-23886	317	6	kinase	kinase	PROPN
brj-23886	317	7	–	–	PUNCT
brj-23886	317	8	mediated	mediate	VERB
brj-23886	317	9	meiotic	meiotic	ADJ
brj-23886	317	10	progression	progression	NOUN
brj-23886	317	11	in	in	ADP
brj-23886	317	12	caenorhabditis	caenorhabditis	PROPN
brj-23886	317	13	elegans	elegan	NOUN
brj-23886	317	14	,	,	PUNCT
brj-23886	317	15	”	"	PUNCT
brj-23886	317	16	plos	plos	PROPN
brj-23886	317	17	genetics	genetics	PROPN
brj-23886	317	18	2(11	2(11	NUM
brj-23886	317	19	)	)	PUNCT
brj-23886	317	20	,	,	PUNCT
brj-23886	317	21	article	article	NOUN
brj-23886	317	22	e174	e174	PROPN
brj-23886	317	23	.	.	PUNCT
brj-23886	317	24	doi	doi	PROPN
brj-23886	317	25	:	:	PUNCT
brj-23886	317	26	10.1371	10.1371	NUM
brj-23886	317	27	/	/	SYM
brj-23886	317	28	journal.pgen.0020174	journal.pgen.0020174	PROPN
brj-23886	317	29	levin	levin	PROPN
brj-23886	317	30	,	,	PUNCT
brj-23886	317	31	d.	d.	PROPN
brj-23886	317	32	b.	b.	PROPN
brj-23886	317	33	,	,	PUNCT
brj-23886	317	34	islam	islam	PROPN
brj-23886	317	35	,	,	PUNCT
brj-23886	317	36	r.	r.	PROPN
brj-23886	317	37	,	,	PUNCT
brj-23886	317	38	cicek	cicek	PROPN
brj-23886	317	39	,	,	PUNCT
brj-23886	317	40	n.	n.	NOUN
brj-23886	317	41	,	,	PUNCT
brj-23886	317	42	and	and	CCONJ
brj-23886	317	43	sparling	sparling	PROPN
brj-23886	317	44	,	,	PUNCT
brj-23886	317	45	r.	r.	PROPN
brj-23886	317	46	(	(	PUNCT
brj-23886	317	47	2006	2006	NUM
brj-23886	317	48	)	)	PUNCT
brj-23886	317	49	.	.	PUNCT
brj-23886	318	1	“	"	PUNCT
brj-23886	318	2	hydrogen	hydrogen	NOUN
brj-23886	318	3	production	production	NOUN
brj-23886	318	4	by	by	ADP
brj-23886	318	5	clostridium	clostridium	NOUN
brj-23886	318	6	thermocellum	thermocellum	PROPN
brj-23886	318	7	27405	27405	NUM
brj-23886	318	8	from	from	ADP
brj-23886	318	9	cellulosic	cellulosic	NOUN
brj-23886	318	10	biomass	biomass	NOUN
brj-23886	318	11	substrates	substrate	NOUN
brj-23886	318	12	,	,	PUNCT
brj-23886	318	13	”	"	PUNCT
brj-23886	318	14	international	international	ADJ
brj-23886	318	15	journal	journal	NOUN
brj-23886	318	16	of	of	ADP
brj-23886	318	17	hydrogen	hydrogen	PROPN
brj-23886	318	18	energy	energy	NOUN
brj-23886	318	19	31(11	31(11	NUM
brj-23886	318	20	)	)	PUNCT
brj-23886	318	21	,	,	PUNCT
brj-23886	318	22	1496	1496	NUM
brj-23886	318	23	-	-	SYM
brj-23886	318	24	1503	1503	NUM
brj-23886	318	25	.	.	PUNCT
brj-23886	319	1	doi	doi	NOUN
brj-23886	319	2	:	:	PUNCT
brj-23886	319	3	10.1016	10.1016	NUM
brj-23886	319	4	/	/	SYM
brj-23886	319	5	j.ijhydene.2006.06.015	j.ijhydene.2006.06.015	PROPN
brj-23886	319	6	liu	liu	PROPN
brj-23886	319	7	,	,	PUNCT
brj-23886	319	8	y.	y.	PROPN
brj-23886	319	9	j.	j.	PROPN
brj-23886	319	10	,	,	PUNCT
brj-23886	319	11	li	li	PROPN
brj-23886	319	12	,	,	PUNCT
brj-23886	319	13	b.	b.	PROPN
brj-23886	319	14	,	,	PUNCT
brj-23886	319	15	feng	feng	PROPN
brj-23886	319	16	,	,	PUNCT
brj-23886	319	17	y.	y.	PROPN
brj-23886	319	18	g.	g.	PROPN
brj-23886	319	19	,	,	PUNCT
brj-23886	319	20	and	and	CCONJ
brj-23886	319	21	cui	cui	PROPN
brj-23886	319	22	,	,	PUNCT
brj-23886	319	23	q.	q.	PROPN
brj-23886	319	24	(	(	PUNCT
brj-23886	319	25	2020	2020	NUM
brj-23886	319	26	)	)	PUNCT
brj-23886	319	27	.	.	PUNCT
brj-23886	320	1	“	"	PUNCT
brj-23886	320	2	consolidated	consolidate	VERB
brj-23886	320	3	bio	bio	NOUN
brj-23886	320	4	-	-	NOUN
brj-23886	320	5	saccharification	saccharification	NOUN
brj-23886	320	6	:	:	PUNCT
brj-23886	320	7	leading	lead	VERB
brj-23886	320	8	lignocellulose	lignocellulose	ADJ
brj-23886	320	9	bioconversion	bioconversion	NOUN
brj-23886	320	10	into	into	ADP
brj-23886	320	11	the	the	DET
brj-23886	320	12	real	real	ADJ
brj-23886	320	13	world	world	NOUN
brj-23886	320	14	,	,	PUNCT
brj-23886	320	15	”	"	PUNCT
brj-23886	320	16	biotechnology	biotechnology	NOUN
brj-23886	320	17	advances	advance	VERB
brj-23886	320	18	40	40	NUM
brj-23886	320	19	,	,	PUNCT
brj-23886	320	20	article	article	NOUN
brj-23886	320	21	i	i	PROPN
brj-23886	320	22	d	d	PROPN
brj-23886	320	23	107535	107535	NUM
brj-23886	320	24	.	.	PUNCT
brj-23886	321	1	doi	doi	NOUN
brj-23886	321	2	:	:	PUNCT
brj-23886	321	3	10.1016	10.1016	NUM
brj-23886	321	4	/	/	SYM
brj-23886	321	5	j.biotechadv.2020.107535	j.biotechadv.2020.107535	PROPN
brj-23886	321	6	liyakathali	liyakathali	VERB
brj-23886	321	7	,	,	PUNCT
brj-23886	321	8	n.	n.	NOUN
brj-23886	321	9	a.	a.	NOUN
brj-23886	321	10	m.	m.	PROPN
brj-23886	321	11	,	,	PUNCT
brj-23886	321	12	muley	muley	NOUN
brj-23886	321	13	,	,	PUNCT
brj-23886	321	14	p.	p.	PROPN
brj-23886	321	15	d.	d.	PROPN
brj-23886	321	16	,	,	PUNCT
brj-23886	321	17	aita	aita	PROPN
brj-23886	321	18	,	,	PUNCT
brj-23886	321	19	g.	g.	PROPN
brj-23886	321	20	,	,	PUNCT
brj-23886	321	21	and	and	CCONJ
brj-23886	321	22	boldor	boldor	PROPN
brj-23886	321	23	,	,	PUNCT
brj-23886	321	24	d.	d.	PROPN
brj-23886	321	25	(	(	PUNCT
brj-23886	321	26	2016	2016	NUM
brj-23886	321	27	)	)	PUNCT
brj-23886	321	28	.	.	PUNCT
brj-23886	322	1	“	"	PUNCT
brj-23886	322	2	effect	effect	NOUN
brj-23886	322	3	of	of	ADP
brj-23886	322	4	frequency	frequency	NOUN
brj-23886	322	5	and	and	CCONJ
brj-23886	322	6	reaction	reaction	NOUN
brj-23886	322	7	time	time	NOUN
brj-23886	322	8	in	in	ADP
brj-23886	322	9	focused	focused	ADJ
brj-23886	322	10	ultrasonic	ultrasonic	ADJ
brj-23886	322	11	pretreatment	pretreatment	NOUN
brj-23886	322	12	of	of	ADP
brj-23886	322	13	energy	energy	NOUN
brj-23886	322	14	cane	cane	NOUN
brj-23886	322	15	bagasse	bagasse	NOUN
brj-23886	322	16	for	for	ADP
brj-23886	322	17	bioethanol	bioethanol	NOUN
brj-23886	322	18	production	production	NOUN
brj-23886	322	19	,	,	PUNCT
brj-23886	322	20	”	"	PUNCT
brj-23886	322	21	bioresource	bioresource	ADJ
brj-23886	322	22	technology	technology	NOUN
brj-23886	322	23	200	200	NUM
brj-23886	322	24	,	,	PUNCT
brj-23886	322	25	262	262	NUM
brj-23886	322	26	-	-	SYM
brj-23886	322	27	271	271	NUM
brj-23886	322	28	.	.	PUNCT
brj-23886	323	1	doi	doi	NOUN
brj-23886	323	2	:	:	PUNCT
brj-23886	323	3	10.1016	10.1016	NUM
brj-23886	323	4	/	/	SYM
brj-23886	323	5	j.biortech.2015.10.028	j.biortech.2015.10.028	PROPN
brj-23886	323	6	lo	lo	PROPN
brj-23886	323	7	,	,	PUNCT
brj-23886	323	8	j.	j.	PROPN
brj-23886	323	9	,	,	PUNCT
brj-23886	323	10	zheng	zheng	PROPN
brj-23886	323	11	,	,	PUNCT
brj-23886	323	12	t.	t.	PROPN
brj-23886	323	13	,	,	PUNCT
brj-23886	323	14	hon	hon	PROPN
brj-23886	323	15	,	,	PUNCT
brj-23886	323	16	s.	s.	PROPN
brj-23886	323	17	,	,	PUNCT
brj-23886	323	18	olson	olson	PROPN
brj-23886	323	19	,	,	PUNCT
brj-23886	323	20	d.	d.	PROPN
brj-23886	323	21	g.	g.	PROPN
brj-23886	323	22	,	,	PUNCT
brj-23886	323	23	lynd	lynd	PROPN
brj-23886	323	24	,	,	PUNCT
brj-23886	323	25	l.	l.	PROPN
brj-23886	323	26	r.	r.	PROPN
brj-23886	323	27	,	,	PUNCT
brj-23886	323	28	and	and	CCONJ
brj-23886	323	29	metcalf	metcalf	PROPN
brj-23886	323	30	,	,	PUNCT
brj-23886	323	31	w.	w.	PROPN
brj-23886	323	32	w.	w.	PROPN
brj-23886	323	33	(	(	PUNCT
brj-23886	323	34	2015	2015	NUM
brj-23886	323	35	)	)	PUNCT
brj-23886	323	36	.	.	PUNCT
brj-23886	324	1	“	"	PUNCT
brj-23886	324	2	the	the	DET
brj-23886	324	3	bifunctional	bifunctional	ADJ
brj-23886	324	4	alcohol	alcohol	NOUN
brj-23886	324	5	and	and	CCONJ
brj-23886	324	6	aldehyde	aldehyde	NOUN
brj-23886	324	7	dehydrogenase	dehydrogenase	NOUN
brj-23886	324	8	gene	gene	NOUN
brj-23886	324	9	,	,	PUNCT
brj-23886	324	10	adhe	adhe	ADV
brj-23886	324	11	,	,	PUNCT
brj-23886	324	12	is	be	AUX
brj-23886	324	13	necessary	necessary	ADJ
brj-23886	324	14	for	for	ADP
brj-23886	324	15	ethanol	ethanol	NOUN
brj-23886	324	16	production	production	NOUN
brj-23886	324	17	in	in	ADP
brj-23886	324	18	clostridium	clostridium	NOUN
brj-23886	324	19	thermocellum	thermocellum	PROPN
brj-23886	324	20	and	and	CCONJ
brj-23886	324	21	thermoanaerobacterium	thermoanaerobacterium	ADJ
brj-23886	324	22	saccharolyticum	saccharolyticum	NOUN
brj-23886	324	23	,	,	PUNCT
brj-23886	324	24	”	"	PUNCT
brj-23886	324	25	journal	journal	NOUN
brj-23886	324	26	of	of	ADP
brj-23886	324	27	bacteriology	bacteriology	NOUN
brj-23886	324	28	197(8	197(8	NUM
brj-23886	324	29	)	)	PUNCT
brj-23886	324	30	,	,	PUNCT
brj-23886	324	31	1386	1386	NUM
brj-23886	324	32	-	-	SYM
brj-23886	324	33	1393	1393	NUM
brj-23886	324	34	.	.	PUNCT
brj-23886	325	1	doi	doi	NOUN
brj-23886	325	2	:	:	PUNCT
brj-23886	325	3	10.1128	10.1128	NUM
brj-23886	325	4	/	/	SYM
brj-23886	325	5	jb.02450	jb.02450	PROPN
brj-23886	325	6	-	-	PUNCT
brj-23886	325	7	14	14	NUM
brj-23886	325	8	lovett	lovett	PROPN
brj-23886	325	9	,	,	PUNCT
brj-23886	325	10	j.	j.	PROPN
brj-23886	325	11	c.	c.	PROPN
brj-23886	325	12	,	,	PUNCT
brj-23886	325	13	hards	hard	NOUN
brj-23886	325	14	,	,	PUNCT
brj-23886	325	15	s.	s.	PROPN
brj-23886	325	16	,	,	PUNCT
brj-23886	325	17	clancy	clancy	PROPN
brj-23886	325	18	,	,	PUNCT
brj-23886	325	19	j.	j.	PROPN
brj-23886	325	20	,	,	PUNCT
brj-23886	325	21	and	and	CCONJ
brj-23886	325	22	snell	snell	PROPN
brj-23886	325	23	,	,	PUNCT
brj-23886	325	24	c.	c.	PROPN
brj-23886	325	25	(	(	PUNCT
brj-23886	325	26	2011	2011	NUM
brj-23886	325	27	)	)	PUNCT
brj-23886	325	28	.	.	PUNCT
brj-23886	326	1	“	"	PUNCT
brj-23886	326	2	multiple	multiple	ADJ
brj-23886	326	3	objectives	objective	NOUN
brj-23886	326	4	in	in	ADP
brj-23886	326	5	biofuels	biofuel	NOUN
brj-23886	326	6	sustainability	sustainability	NOUN
brj-23886	326	7	policy	policy	NOUN
brj-23886	326	8	,	,	PUNCT
brj-23886	326	9	”	"	PUNCT
brj-23886	326	10	energy	energy	NOUN
brj-23886	326	11	&	&	CCONJ
brj-23886	326	12	environmental	environmental	ADJ
brj-23886	326	13	science	science	NOUN
brj-23886	326	14	4	4	NUM
brj-23886	326	15	,	,	PUNCT
brj-23886	326	16	261	261	NUM
brj-23886	326	17	-	-	SYM
brj-23886	326	18	268	268	NUM
brj-23886	326	19	.	.	PUNCT
brj-23886	327	1	doi	doi	NOUN
brj-23886	327	2	:	:	PUNCT
brj-23886	327	3	10.1039	10.1039	NUM
brj-23886	327	4	/	/	SYM
brj-23886	327	5	c0ee00041h	c0ee00041h	PROPN
brj-23886	327	6	peer	peer	NOUN
brj-23886	327	7	-	-	PUNCT
brj-23886	327	8	reviewed	review	VERB
brj-23886	327	9	article	article	NOUN
brj-23886	327	10	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	327	11	cui	cui	PROPN
brj-23886	327	12	et	et	PROPN
brj-23886	327	13	al	al	PROPN
brj-23886	327	14	.	.	PROPN
brj-23886	327	15	(	(	PUNCT
brj-23886	327	16	2025	2025	NUM
brj-23886	327	17	)	)	PUNCT
brj-23886	327	18	.	.	PUNCT
brj-23886	328	1	“	"	PUNCT
brj-23886	328	2	genome	genome	NOUN
brj-23886	328	3	study	study	NOUN
brj-23886	328	4	of	of	ADP
brj-23886	328	5	c.	c.	PROPN
brj-23886	328	6	thermocellum	thermocellum	PROPN
brj-23886	328	7	,	,	PUNCT
brj-23886	328	8	”	"	PUNCT
brj-23886	328	9	bioresources	bioresource	NOUN
brj-23886	328	10	20(2	20(2	NUM
brj-23886	328	11	)	)	PUNCT
brj-23886	328	12	,	,	PUNCT
brj-23886	328	13	3155	3155	NUM
brj-23886	328	14	-	-	SYM
brj-23886	328	15	3175	3175	NUM
brj-23886	328	16	.	.	PUNCT
brj-23886	329	1	3173	3173	NUM
brj-23886	329	2	mazzoli	mazzoli	NOUN
brj-23886	329	3	,	,	PUNCT
brj-23886	329	4	r.	r.	PROPN
brj-23886	329	5	,	,	PUNCT
brj-23886	329	6	and	and	CCONJ
brj-23886	329	7	olson	olson	NOUN
brj-23886	329	8	,	,	PUNCT
brj-23886	329	9	d.	d.	PROPN
brj-23886	329	10	g.	g.	PROPN
brj-23886	329	11	(	(	PUNCT
brj-23886	329	12	2020	2020	NUM
brj-23886	329	13	)	)	PUNCT
brj-23886	329	14	.	.	PUNCT
brj-23886	330	1	“	"	PUNCT
brj-23886	330	2	clostridium	clostridium	NOUN
brj-23886	330	3	thermocellum	thermocellum	PROPN
brj-23886	330	4	:	:	PUNCT
brj-23886	330	5	a	a	DET
brj-23886	330	6	microbial	microbial	ADJ
brj-23886	330	7	platform	platform	NOUN
brj-23886	330	8	for	for	ADP
brj-23886	330	9	highvalue	highvalue	NOUN
brj-23886	330	10	chemical	chemical	NOUN
brj-23886	330	11	production	production	NOUN
brj-23886	330	12	from	from	ADP
brj-23886	330	13	lignocellulose	lignocellulose	PROPN
brj-23886	330	14	,	,	PUNCT
brj-23886	330	15	”	"	PUNCT
brj-23886	330	16	advances	advance	NOUN
brj-23886	330	17	in	in	ADP
brj-23886	330	18	applied	apply	VERB
brj-23886	330	19	microbiology	microbiology	NOUN
brj-23886	330	20	07	07	NUM
brj-23886	330	21	,	,	PUNCT
brj-23886	330	22	111	111	NUM
brj-23886	330	23	-	-	SYM
brj-23886	330	24	161	161	NUM
brj-23886	330	25	.	.	PUNCT
brj-23886	331	1	doi	doi	NOUN
brj-23886	331	2	:	:	PUNCT
brj-23886	331	3	10.1016	10.1016	NUM
brj-23886	331	4	/	/	SYM
brj-23886	331	5	bs.aambs.2020.07.004	bs.aambs.2020.07.004	ADJ
brj-23886	331	6	mikel	mikel	PROPN
brj-23886	331	7	,	,	PUNCT
brj-23886	331	8	i.	i.	PROPN
brj-23886	331	9	o.	o.	PROPN
brj-23886	331	10	,	,	PUNCT
brj-23886	331	11	and	and	CCONJ
brj-23886	331	12	orna	orna	PROPN
brj-23886	331	13	,	,	PUNCT
brj-23886	331	14	a.	a.	PROPN
brj-23886	331	15	c.	c.	PROPN
brj-23886	331	16	(	(	PUNCT
brj-23886	331	17	2021	2021	NUM
brj-23886	331	18	)	)	PUNCT
brj-23886	331	19	.	.	PUNCT
brj-23886	332	1	“	"	PUNCT
brj-23886	332	2	coupled	couple	VERB
brj-23886	332	3	transcription	transcription	NOUN
brj-23886	332	4	-	-	PUNCT
brj-23886	332	5	translation	translation	NOUN
brj-23886	332	6	in	in	ADP
brj-23886	332	7	prokaryotes	prokaryote	NOUN
brj-23886	332	8	:	:	PUNCT
brj-23886	332	9	an	an	DET
brj-23886	332	10	old	old	ADJ
brj-23886	332	11	couple	couple	NOUN
brj-23886	332	12	with	with	ADP
brj-23886	332	13	new	new	ADJ
brj-23886	332	14	surprises	surprise	NOUN
brj-23886	332	15	,	,	PUNCT
brj-23886	332	16	”	"	PUNCT
brj-23886	332	17	frontiers	frontier	NOUN
brj-23886	332	18	in	in	ADP
brj-23886	332	19	microbiology	microbiology	NOUN
brj-23886	332	20	11	11	NUM
brj-23886	332	21	.	.	PUNCT
brj-23886	333	1	doi	doi	NOUN
brj-23886	333	2	:	:	PUNCT
brj-23886	333	3	10.3389	10.3389	NUM
brj-23886	333	4	/	/	SYM
brj-23886	333	5	fmicb.2020.624830	fmicb.2020.624830	PROPN
brj-23886	333	6	.	.	PUNCT
brj-23886	333	7	myat	myat	PROPN
brj-23886	333	8	,	,	PUNCT
brj-23886	333	9	l.	l.	PROPN
brj-23886	333	10	,	,	PUNCT
brj-23886	333	11	and	and	CCONJ
brj-23886	333	12	ryu	ryu	ADJ
brj-23886	333	13	,	,	PUNCT
brj-23886	333	14	g.-h	g.-h	PROPN
brj-23886	333	15	.	.	PUNCT
brj-23886	334	1	“	"	PUNCT
brj-23886	334	2	thermomechanical	thermomechanical	ADJ
brj-23886	334	3	extrusion	extrusion	NOUN
brj-23886	334	4	and	and	CCONJ
brj-23886	334	5	sodium	sodium	NOUN
brj-23886	334	6	hydroxide	hydroxide	NOUN
brj-23886	334	7	pretreatments	pretreatment	NOUN
brj-23886	334	8	for	for	ADP
brj-23886	334	9	ethanol	ethanol	NOUN
brj-23886	334	10	production	production	NOUN
brj-23886	334	11	from	from	ADP
brj-23886	334	12	destarched	destarche	VERB
brj-23886	334	13	corn	corn	NOUN
brj-23886	334	14	fiber	fiber	NOUN
brj-23886	334	15	,	,	PUNCT
brj-23886	334	16	”	"	PUNCT
brj-23886	334	17	environmental	environmental	ADJ
brj-23886	334	18	progress	progress	NOUN
brj-23886	334	19	&	&	CCONJ
brj-23886	334	20	sustainable	sustainable	ADJ
brj-23886	334	21	energy	energy	NOUN
brj-23886	334	22	34	34	NUM
brj-23886	334	23	,	,	PUNCT
brj-23886	334	24	article	article	NOUN
brj-23886	334	25	i	i	PROPN
brj-23886	334	26	d	d	PROPN
brj-23886	334	27	12059	12059	NUM
brj-23886	334	28	.	.	PUNCT
brj-23886	335	1	doi	doi	NOUN
brj-23886	335	2	:	:	PUNCT
brj-23886	335	3	10.1002	10.1002	NUM
brj-23886	335	4	/	/	SYM
brj-23886	335	5	ep.12059	ep.12059	PROPN
brj-23886	335	6	nataf	nataf	NOUN
brj-23886	335	7	,	,	PUNCT
brj-23886	335	8	y.	y.	PROPN
brj-23886	335	9	,	,	PUNCT
brj-23886	335	10	bahari	bahari	PROPN
brj-23886	335	11	,	,	PUNCT
brj-23886	335	12	l.	l.	PROPN
brj-23886	335	13	,	,	PUNCT
brj-23886	335	14	kahel	kahel	NOUN
brj-23886	335	15	-	-	PUNCT
brj-23886	335	16	raifer	raifer	NOUN
brj-23886	335	17	,	,	PUNCT
brj-23886	335	18	h.	h.	PROPN
brj-23886	335	19	,	,	PUNCT
brj-23886	335	20	borovok	borovok	NOUN
brj-23886	335	21	,	,	PUNCT
brj-23886	335	22	i.	i.	PROPN
brj-23886	335	23	,	,	PUNCT
brj-23886	335	24	lamed	lamed	PROPN
brj-23886	335	25	,	,	PUNCT
brj-23886	335	26	r.	r.	PROPN
brj-23886	335	27	,	,	PUNCT
brj-23886	335	28	bayer	bayer	PROPN
brj-23886	335	29	,	,	PUNCT
brj-23886	335	30	e.	e.	PROPN
brj-23886	335	31	a.	a.	PROPN
brj-23886	335	32	,	,	PUNCT
brj-23886	335	33	sonenshein	sonenshein	ADJ
brj-23886	335	34	,	,	PUNCT
brj-23886	335	35	a.	a.	NOUN
brj-23886	335	36	l.	l.	PROPN
brj-23886	335	37	,	,	PUNCT
brj-23886	335	38	and	and	CCONJ
brj-23886	335	39	shoham	shoham	NOUN
brj-23886	335	40	,	,	PUNCT
brj-23886	335	41	y.	y.	PROPN
brj-23886	335	42	(	(	PUNCT
brj-23886	335	43	2010	2010	NUM
brj-23886	335	44	)	)	PUNCT
brj-23886	335	45	.	.	PUNCT
brj-23886	336	1	“	"	PUNCT
brj-23886	336	2	clostridium	clostridium	NOUN
brj-23886	336	3	thermocellum	thermocellum	ADJ
brj-23886	336	4	cellulosomal	cellulosomal	ADJ
brj-23886	336	5	genes	gene	NOUN
brj-23886	336	6	are	be	AUX
brj-23886	336	7	regulated	regulate	VERB
brj-23886	336	8	by	by	ADP
brj-23886	336	9	extracytoplasmic	extracytoplasmic	ADJ
brj-23886	336	10	polysaccharides	polysaccharide	NOUN
brj-23886	336	11	via	via	ADP
brj-23886	336	12	alternative	alternative	ADJ
brj-23886	336	13	sigma	sigma	ADJ
brj-23886	336	14	factors	factor	NOUN
brj-23886	336	15	,	,	PUNCT
brj-23886	336	16	”	"	PUNCT
brj-23886	336	17	proceedings	proceeding	NOUN
brj-23886	336	18	of	of	ADP
brj-23886	336	19	the	the	DET
brj-23886	336	20	national	national	PROPN
brj-23886	336	21	academy	academy	PROPN
brj-23886	336	22	of	of	ADP
brj-23886	336	23	science	science	PROPN
brj-23886	336	24	107(43	107(43	NUM
brj-23886	336	25	)	)	PUNCT
brj-23886	336	26	,	,	PUNCT
brj-23886	336	27	18646	18646	NUM
brj-23886	336	28	-	-	SYM
brj-23886	336	29	18651	18651	NUM
brj-23886	336	30	.	.	PUNCT
brj-23886	337	1	doi	doi	NOUN
brj-23886	337	2	:	:	PUNCT
brj-23886	337	3	10.1073	10.1073	NUM
brj-23886	337	4	/	/	SYM
brj-23886	337	5	pnas.1012175107	pnas.1012175107	PROPN
brj-23886	337	6	nawab	nawab	PROPN
brj-23886	337	7	,	,	PUNCT
brj-23886	337	8	s.	s.	PROPN
brj-23886	337	9	,	,	PUNCT
brj-23886	337	10	zhang	zhang	PROPN
brj-23886	337	11	,	,	PUNCT
brj-23886	337	12	y.	y.	PROPN
brj-23886	337	13	f.	f.	PROPN
brj-23886	337	14	,	,	PUNCT
brj-23886	337	15	ullah	ullah	PROPN
brj-23886	337	16	,	,	PUNCT
brj-23886	337	17	m.	m.	PROPN
brj-23886	337	18	w.	w.	PROPN
brj-23886	337	19	,	,	PUNCT
brj-23886	337	20	lodhi	lodhi	PROPN
brj-23886	337	21	,	,	PUNCT
brj-23886	337	22	a.	a.	PROPN
brj-23886	337	23	f.	f.	PROPN
brj-23886	337	24	,	,	PUNCT
brj-23886	337	25	shah	shah	PROPN
brj-23886	337	26	,	,	PUNCT
brj-23886	337	27	s.	s.	PROPN
brj-23886	337	28	b.	b.	PROPN
brj-23886	337	29	,	,	PUNCT
brj-23886	337	30	rahman	rahman	PROPN
brj-23886	337	31	,	,	PUNCT
brj-23886	337	32	m.	m.	NOUN
brj-23886	337	33	u.	u.	PROPN
brj-23886	337	34	,	,	PUNCT
brj-23886	337	35	and	and	CCONJ
brj-23886	337	36	yong	yong	PROPN
brj-23886	337	37	,	,	PUNCT
brj-23886	337	38	y.	y.	PROPN
brj-23886	337	39	c.	c.	PROPN
brj-23886	337	40	(	(	PUNCT
brj-23886	337	41	2024	2024	NUM
brj-23886	337	42	)	)	PUNCT
brj-23886	337	43	.	.	PUNCT
brj-23886	338	1	“	"	PUNCT
brj-23886	338	2	microbial	microbial	ADJ
brj-23886	338	3	host	host	NOUN
brj-23886	338	4	engineering	engineering	NOUN
brj-23886	338	5	for	for	ADP
brj-23886	338	6	sustainable	sustainable	ADJ
brj-23886	338	7	isobutanol	isobutanol	ADJ
brj-23886	338	8	production	production	NOUN
brj-23886	338	9	from	from	ADP
brj-23886	338	10	renewable	renewable	ADJ
brj-23886	338	11	resources	resource	NOUN
brj-23886	338	12	,	,	PUNCT
brj-23886	338	13	”	"	PUNCT
brj-23886	338	14	applied	apply	VERB
brj-23886	338	15	microbiology	microbiology	NOUN
brj-23886	338	16	and	and	CCONJ
brj-23886	338	17	biotechnology	biotechnology	NOUN
brj-23886	338	18	108	108	NUM
brj-23886	338	19	,	,	PUNCT
brj-23886	338	20	16	16	NUM
brj-23886	338	21	-	-	SYM
brj-23886	338	22	18	18	NUM
brj-23886	338	23	.	.	PUNCT
brj-23886	339	1	doi	doi	NOUN
brj-23886	339	2	:	:	PUNCT
brj-23886	339	3	10.1007/	10.1007/	NUM
brj-23886	339	4	s00253	s00253	NOUN
brj-23886	339	5	-	-	PUNCT
brj-23886	339	6	023	023	NUM
brj-23886	339	7	-	-	PUNCT
brj-23886	339	8	12821	12821	NUM
brj-23886	339	9	-	-	SYM
brj-23886	339	10	9	9	NUM
brj-23886	339	11	nur	nur	NOUN
brj-23886	339	12	aimi	aimi	PROPN
brj-23886	339	13	,	,	PUNCT
brj-23886	339	14	m.	m.	NOUN
brj-23886	339	15	n.	n.	PROPN
brj-23886	339	16	,	,	PUNCT
brj-23886	339	17	anuar	anuar	PROPN
brj-23886	339	18	,	,	PUNCT
brj-23886	339	19	h.	h.	PROPN
brj-23886	339	20	,	,	PUNCT
brj-23886	339	21	nurhafizah	nurhafizah	NOUN
brj-23886	339	22	,	,	PUNCT
brj-23886	339	23	s.	s.	PROPN
brj-23886	339	24	m.	m.	PROPN
brj-23886	339	25	,	,	PUNCT
brj-23886	339	26	and	and	CCONJ
brj-23886	339	27	zakaria	zakaria	PROPN
brj-23886	339	28	,	,	PUNCT
brj-23886	339	29	s.	s.	PROPN
brj-23886	339	30	(	(	PUNCT
brj-23886	339	31	2015	2015	NUM
brj-23886	339	32	)	)	PUNCT
brj-23886	339	33	.	.	PUNCT
brj-23886	340	1	“	"	PUNCT
brj-23886	340	2	effects	effect	NOUN
brj-23886	340	3	of	of	ADP
brj-23886	340	4	dilute	dilute	NOUN
brj-23886	340	5	acid	acid	NOUN
brj-23886	340	6	pretreatment	pretreatment	NOUN
brj-23886	340	7	on	on	ADP
brj-23886	340	8	chemical	chemical	NOUN
brj-23886	340	9	and	and	CCONJ
brj-23886	340	10	physical	physical	ADJ
brj-23886	340	11	properties	property	NOUN
brj-23886	340	12	of	of	ADP
brj-23886	340	13	kenaf	kenaf	PROPN
brj-23886	340	14	biomass	biomass	NOUN
brj-23886	340	15	,	,	PUNCT
brj-23886	340	16	”	"	PUNCT
brj-23886	340	17	journal	journal	NOUN
brj-23886	340	18	of	of	ADP
brj-23886	340	19	natural	natural	ADJ
brj-23886	340	20	fibers	fiber	NOUN
brj-23886	340	21	12(3	12(3	NUM
brj-23886	340	22	)	)	PUNCT
brj-23886	340	23	,	,	PUNCT
brj-23886	340	24	256	256	NUM
brj-23886	340	25	-	-	SYM
brj-23886	340	26	264	264	NUM
brj-23886	340	27	.	.	PUNCT
brj-23886	341	1	doi	doi	NOUN
brj-23886	341	2	:	:	PUNCT
brj-23886	341	3	10.1080/15440478.2014.919894	10.1080/15440478.2014.919894	NUM
brj-23886	341	4	pang	pang	NOUN
brj-23886	341	5	,	,	PUNCT
brj-23886	341	6	j.	j.	PROPN
brj-23886	341	7	,	,	PUNCT
brj-23886	341	8	hao	hao	PROPN
brj-23886	341	9	,	,	PUNCT
brj-23886	341	10	m.	m.	NOUN
brj-23886	341	11	,	,	PUNCT
brj-23886	341	12	li	li	PROPN
brj-23886	341	13	,	,	PUNCT
brj-23886	341	14	y.	y.	PROPN
brj-23886	341	15	l.	l.	PROPN
brj-23886	341	16	,	,	PUNCT
brj-23886	341	17	liu	liu	PROPN
brj-23886	341	18	,	,	PUNCT
brj-23886	341	19	j.	j.	PROPN
brj-23886	341	20	g.	g.	PROPN
brj-23886	341	21	,	,	PUNCT
brj-23886	341	22	lan	lan	PROPN
brj-23886	341	23	,	,	PUNCT
brj-23886	341	24	h.	h.	PROPN
brj-23886	341	25	,	,	PUNCT
brj-23886	341	26	zhang	zhang	PROPN
brj-23886	341	27	,	,	PUNCT
brj-23886	341	28	y.	y.	PROPN
brj-23886	341	29	f.	f.	PROPN
brj-23886	341	30	,	,	PUNCT
brj-23886	341	31	and	and	CCONJ
brj-23886	341	32	liu	liu	PROPN
brj-23886	341	33	,	,	PUNCT
brj-23886	341	34	z.	z.	PROPN
brj-23886	341	35	y.	y.	PROPN
brj-23886	341	36	(	(	PUNCT
brj-23886	341	37	2018a	2018a	NUM
brj-23886	341	38	)	)	PUNCT
brj-23886	341	39	.	.	PUNCT
brj-23886	342	1	“	"	PUNCT
brj-23886	342	2	consolidated	consolidated	ADJ
brj-23886	342	3	bioprocessing	bioprocesse	VERB
brj-23886	342	4	using	use	VERB
brj-23886	342	5	clostridium	clostridium	NOUN
brj-23886	342	6	thermocellum	thermocellum	PROPN
brj-23886	342	7	and	and	CCONJ
brj-23886	342	8	thermoanaerobacterium	thermoanaerobacterium	PROPN
brj-23886	342	9	thermosaccharolyticum	thermosaccharolyticum	PROPN
brj-23886	342	10	co	co	NOUN
brj-23886	342	11	-	-	NOUN
brj-23886	342	12	culture	culture	NOUN
brj-23886	342	13	for	for	ADP
brj-23886	342	14	enhancing	enhance	VERB
brj-23886	342	15	ethanol	ethanol	NOUN
brj-23886	342	16	production	production	NOUN
brj-23886	342	17	from	from	ADP
brj-23886	342	18	corn	corn	NOUN
brj-23886	342	19	straw	straw	NOUN
brj-23886	342	20	,	,	PUNCT
brj-23886	342	21	”	"	PUNCT
brj-23886	342	22	bioresources	bioresource	NOUN
brj-23886	342	23	13(4	13(4	NUM
brj-23886	342	24	)	)	PUNCT
brj-23886	342	25	,	,	PUNCT
brj-23886	342	26	8209	8209	NUM
brj-23886	342	27	-	-	SYM
brj-23886	342	28	8221	8221	NUM
brj-23886	342	29	.	.	PUNCT
brj-23886	343	1	doi	doi	NOUN
brj-23886	343	2	:	:	PUNCT
brj-23886	343	3	10.15376	10.15376	NUM
brj-23886	343	4	/	/	SYM
brj-23886	343	5	biores.13.4.8209	biores.13.4.8209	NOUN
brj-23886	343	6	-	-	PUNCT
brj-23886	343	7	8221	8221	NUM
brj-23886	343	8	pang	pang	NOUN
brj-23886	343	9	,	,	PUNCT
brj-23886	343	10	j.	j.	PROPN
brj-23886	343	11	,	,	PUNCT
brj-23886	343	12	hao	hao	PROPN
brj-23886	343	13	,	,	PUNCT
brj-23886	343	14	m.	m.	NOUN
brj-23886	343	15	,	,	PUNCT
brj-23886	343	16	shi	shi	PROPN
brj-23886	343	17	,	,	PUNCT
brj-23886	343	18	y.	y.	PROPN
brj-23886	343	19	l.	l.	PROPN
brj-23886	343	20	,	,	PUNCT
brj-23886	343	21	li	li	PROPN
brj-23886	343	22	,	,	PUNCT
brj-23886	343	23	y.	y.	PROPN
brj-23886	343	24	l.	l.	PROPN
brj-23886	343	25	,	,	PUNCT
brj-23886	343	26	zhu	zhu	PROPN
brj-23886	343	27	,	,	PUNCT
brj-23886	343	28	m.	m.	PROPN
brj-23886	343	29	d.	d.	PROPN
brj-23886	343	30	,	,	PUNCT
brj-23886	343	31	hu	hu	PROPN
brj-23886	343	32	,	,	PUNCT
brj-23886	343	33	j.	j.	PROPN
brj-23886	343	34	h.	h.	PROPN
brj-23886	343	35	,	,	PUNCT
brj-23886	343	36	zhang	zhang	PROPN
brj-23886	343	37	,	,	PUNCT
brj-23886	343	38	q.	q.	PROPN
brj-23886	343	39	c.	c.	PROPN
brj-23886	343	40	,	,	PUNCT
brj-23886	343	41	and	and	CCONJ
brj-23886	343	42	liu	liu	PROPN
brj-23886	343	43	,	,	PUNCT
brj-23886	343	44	z.	z.	PROPN
brj-23886	343	45	y.	y.	PROPN
brj-23886	343	46	(	(	PUNCT
brj-23886	343	47	2018b	2018b	NUM
brj-23886	343	48	)	)	PUNCT
brj-23886	343	49	.	.	PUNCT
brj-23886	344	1	“	"	PUNCT
brj-23886	344	2	enhancing	enhance	VERB
brj-23886	344	3	the	the	DET
brj-23886	344	4	ethanol	ethanol	NOUN
brj-23886	344	5	yield	yield	NOUN
brj-23886	344	6	from	from	ADP
brj-23886	344	7	salix	salix	NOUN
brj-23886	344	8	using	use	VERB
brj-23886	344	9	a	a	DET
brj-23886	344	10	clostridium	clostridium	NOUN
brj-23886	344	11	thermocellum	thermocellum	NOUN
brj-23886	344	12	and	and	CCONJ
brj-23886	344	13	thermoanaerobacterium	thermoanaerobacterium	PROPN
brj-23886	344	14	thermosaccharolyticum	thermosaccharolyticum	PROPN
brj-23886	344	15	co	co	NOUN
brj-23886	344	16	-	-	NOUN
brj-23886	344	17	culture	culture	ADJ
brj-23886	344	18	system	system	NOUN
brj-23886	344	19	,	,	PUNCT
brj-23886	344	20	”	"	PUNCT
brj-23886	344	21	bioresources	bioresource	NOUN
brj-23886	344	22	13(3	13(3	NUM
brj-23886	344	23	)	)	PUNCT
brj-23886	344	24	,	,	PUNCT
brj-23886	344	25	5377	5377	NUM
brj-23886	344	26	-	-	SYM
brj-23886	344	27	5393	5393	NUM
brj-23886	344	28	.	.	PUNCT
brj-23886	345	1	doi	doi	NOUN
brj-23886	345	2	:	:	PUNCT
brj-23886	345	3	10	10	NUM
brj-23886	345	4	.	.	X
brj-23886	345	5	15376	15376	NUM
brj-23886	345	6	/	/	SYM
brj-23886	345	7	biores.13.3.5377	biores.13.3.5377	ADP
brj-23886	345	8	-	-	PUNCT
brj-23886	345	9	5393	5393	NUM
brj-23886	345	10	petsch	petsch	PROPN
brj-23886	345	11	,	,	PUNCT
brj-23886	345	12	b.	b.	PROPN
brj-23886	345	13	,	,	PUNCT
brj-23886	345	14	schnee	schnee	PROPN
brj-23886	345	15	,	,	PUNCT
brj-23886	345	16	m.	m.	NOUN
brj-23886	345	17	,	,	PUNCT
brj-23886	345	18	vogel	vogel	NOUN
brj-23886	345	19	,	,	PUNCT
brj-23886	345	20	a.	a.	PROPN
brj-23886	345	21	b.	b.	PROPN
brj-23886	345	22	,	,	PUNCT
brj-23886	345	23	lange	lange	PROPN
brj-23886	345	24	,	,	PUNCT
brj-23886	345	25	e.	e.	PROPN
brj-23886	345	26	,	,	PUNCT
brj-23886	345	27	hoffmann	hoffmann	PROPN
brj-23886	345	28	,	,	PUNCT
brj-23886	345	29	b.	b.	PROPN
brj-23886	345	30	,	,	PUNCT
brj-23886	345	31	voss	voss	PROPN
brj-23886	345	32	,	,	PUNCT
brj-23886	345	33	d.	d.	PROPN
brj-23886	345	34	,	,	PUNCT
brj-23886	345	35	schlake	schlake	NOUN
brj-23886	345	36	,	,	PUNCT
brj-23886	345	37	t.	t.	PROPN
brj-23886	345	38	,	,	PUNCT
brj-23886	345	39	thess	thess	ADJ
brj-23886	345	40	,	,	PUNCT
brj-23886	345	41	a.	a.	NOUN
brj-23886	345	42	,	,	PUNCT
brj-23886	345	43	kallen	kallen	PROPN
brj-23886	345	44	,	,	PUNCT
brj-23886	345	45	k.	k.	PROPN
brj-23886	345	46	j.	j.	PROPN
brj-23886	345	47	,	,	PUNCT
brj-23886	345	48	stitz	stitz	PROPN
brj-23886	345	49	,	,	PUNCT
brj-23886	345	50	l.	l.	PROPN
brj-23886	345	51	,	,	PUNCT
brj-23886	345	52	et	et	PROPN
brj-23886	345	53	al	al	PROPN
brj-23886	345	54	.	.	PUNCT
brj-23886	345	55	(	(	PUNCT
brj-23886	345	56	2012	2012	NUM
brj-23886	345	57	)	)	PUNCT
brj-23886	345	58	.	.	PUNCT
brj-23886	346	1	“	"	PUNCT
brj-23886	346	2	protective	protective	ADJ
brj-23886	346	3	efficacy	efficacy	NOUN
brj-23886	346	4	of	of	ADP
brj-23886	346	5	in	in	ADP
brj-23886	346	6	vitro	vitro	X
brj-23886	346	7	synthesized	synthesize	VERB
brj-23886	346	8	,	,	PUNCT
brj-23886	346	9	specific	specific	ADJ
brj-23886	346	10	mrna	mrna	NOUN
brj-23886	346	11	vaccines	vaccine	NOUN
brj-23886	346	12	against	against	ADP
brj-23886	346	13	influenza	influenza	NOUN
brj-23886	346	14	a	a	DET
brj-23886	346	15	virus	virus	NOUN
brj-23886	346	16	infection	infection	NOUN
brj-23886	346	17	,	,	PUNCT
brj-23886	346	18	”	"	PUNCT
brj-23886	346	19	nature	nature	NOUN
brj-23886	346	20	biotechnology	biotechnology	NOUN
brj-23886	346	21	30(12	30(12	NUM
brj-23886	346	22	)	)	PUNCT
brj-23886	346	23	,	,	PUNCT
brj-23886	346	24	1210	1210	NUM
brj-23886	346	25	-	-	SYM
brj-23886	346	26	1216	1216	NUM
brj-23886	346	27	.	.	PUNCT
brj-23886	347	1	doi	doi	NOUN
brj-23886	347	2	:	:	PUNCT
brj-23886	347	3	10.1038	10.1038	NUM
brj-23886	347	4	/	/	SYM
brj-23886	347	5	nbt.2436	nbt.2436	PROPN
brj-23886	347	6	qiao	qiao	PROPN
brj-23886	347	7	,	,	PUNCT
brj-23886	347	8	j.	j.	PROPN
brj-23886	347	9	,	,	PUNCT
brj-23886	347	10	cui	cui	PROPN
brj-23886	347	11	,	,	PUNCT
brj-23886	347	12	h.	h.	PROPN
brj-23886	347	13	y.	y.	PROPN
brj-23886	347	14	,	,	PUNCT
brj-23886	347	15	wang	wang	PROPN
brj-23886	347	16	,	,	PUNCT
brj-23886	347	17	m.	m.	PROPN
brj-23886	347	18	h.	h.	PROPN
brj-23886	347	19	,	,	PUNCT
brj-23886	347	20	fu	fu	PROPN
brj-23886	347	21	,	,	PUNCT
brj-23886	347	22	x.	x.	PROPN
brj-23886	347	23	s.	s.	PROPN
brj-23886	347	24	,	,	PUNCT
brj-23886	347	25	wang	wang	PROPN
brj-23886	347	26	,	,	PUNCT
brj-23886	347	27	x.	x.	PROPN
brj-23886	347	28	y.	y.	PROPN
brj-23886	347	29	,	,	PUNCT
brj-23886	347	30	li	li	PROPN
brj-23886	347	31	,	,	PUNCT
brj-23886	347	32	x.	x.	PROPN
brj-23886	347	33	j.	j.	PROPN
brj-23886	347	34	,	,	PUNCT
brj-23886	347	35	and	and	CCONJ
brj-23886	347	36	huang	huang	PROPN
brj-23886	347	37	,	,	PUNCT
brj-23886	347	38	h.	h.	PROPN
brj-23886	347	39	(	(	PUNCT
brj-23886	347	40	2022	2022	NUM
brj-23886	347	41	)	)	PUNCT
brj-23886	347	42	.	.	PUNCT
brj-23886	348	1	“	"	PUNCT
brj-23886	348	2	integrated	integrate	VERB
brj-23886	348	3	biorefinery	biorefinery	NOUN
brj-23886	348	4	approaches	approach	VERB
brj-23886	348	5	for	for	ADP
brj-23886	348	6	the	the	DET
brj-23886	348	7	industrialization	industrialization	NOUN
brj-23886	348	8	of	of	ADP
brj-23886	348	9	cellulosic	cellulosic	NOUN
brj-23886	348	10	ethanol	ethanol	NOUN
brj-23886	348	11	fuel	fuel	NOUN
brj-23886	348	12	,	,	PUNCT
brj-23886	348	13	”	"	PUNCT
brj-23886	348	14	bioresource	bioresource	ADP
brj-23886	348	15	technology	technology	NOUN
brj-23886	348	16	360	360	NUM
brj-23886	348	17	,	,	PUNCT
brj-23886	348	18	article	article	NOUN
brj-23886	348	19	i	i	PROPN
brj-23886	348	20	d	d	PROPN
brj-23886	348	21	127516	127516	NUM
brj-23886	348	22	.	.	PUNCT
brj-23886	349	1	doi	doi	NOUN
brj-23886	349	2	:	:	PUNCT
brj-23886	349	3	10.1016	10.1016	NUM
brj-23886	349	4	/	/	SYM
brj-23886	349	5	j.biortech.2022.127516	j.biortech.2022.127516	PROPN
brj-23886	349	6	reijnders	reijnder	NOUN
brj-23886	349	7	,	,	PUNCT
brj-23886	349	8	l.	l.	PROPN
brj-23886	349	9	,	,	PUNCT
brj-23886	349	10	and	and	CCONJ
brj-23886	349	11	huijbregts	huijbregts	PROPN
brj-23886	349	12	,	,	PUNCT
brj-23886	349	13	m.	m.	NOUN
brj-23886	349	14	a.	a.	PROPN
brj-23886	349	15	j.	j.	PROPN
brj-23886	349	16	(	(	PUNCT
brj-23886	349	17	2007	2007	NUM
brj-23886	349	18	)	)	PUNCT
brj-23886	349	19	.	.	PUNCT
brj-23886	350	1	“	"	PUNCT
brj-23886	350	2	life	life	NOUN
brj-23886	350	3	cycle	cycle	NOUN
brj-23886	350	4	greenhouse	greenhouse	NOUN
brj-23886	350	5	gas	gas	NOUN
brj-23886	350	6	emissions	emission	NOUN
brj-23886	350	7	,	,	PUNCT
brj-23886	350	8	fossil	fossil	NOUN
brj-23886	350	9	fuel	fuel	NOUN
brj-23886	350	10	demand	demand	NOUN
brj-23886	350	11	and	and	CCONJ
brj-23886	350	12	solar	solar	ADJ
brj-23886	350	13	energy	energy	NOUN
brj-23886	350	14	conversion	conversion	NOUN
brj-23886	350	15	efficiency	efficiency	NOUN
brj-23886	350	16	in	in	ADP
brj-23886	350	17	european	european	ADJ
brj-23886	350	18	bioethanol	bioethanol	NOUN
brj-23886	350	19	production	production	NOUN
brj-23886	350	20	for	for	ADP
brj-23886	350	21	automotive	automotive	ADJ
brj-23886	350	22	purposes	purpose	NOUN
brj-23886	350	23	,	,	PUNCT
brj-23886	350	24	”	"	PUNCT
brj-23886	350	25	journal	journal	NOUN
brj-23886	350	26	of	of	ADP
brj-23886	350	27	cleaner	clean	ADJ
brj-23886	350	28	production	production	NOUN
brj-23886	350	29	15(18	15(18	NUM
brj-23886	350	30	)	)	PUNCT
brj-23886	350	31	,	,	PUNCT
brj-23886	350	32	18061812	18061812	NUM
brj-23886	350	33	.	.	PUNCT
brj-23886	351	1	doi	doi	NOUN
brj-23886	351	2	:	:	PUNCT
brj-23886	351	3	10.1016	10.1016	NUM
brj-23886	351	4	/	/	SYM
brj-23886	351	5	j.jclepro.2006.05.007	j.jclepro.2006.05.007	PROPN
brj-23886	351	6	santiago	santiago	PROPN
brj-23886	351	7	,	,	PUNCT
brj-23886	351	8	a.	a.	PROPN
brj-23886	351	9	e.	e.	PROPN
brj-23886	351	10	,	,	PUNCT
brj-23886	351	11	yan	yan	PROPN
brj-23886	351	12	,	,	PUNCT
brj-23886	351	13	m.	m.	PROPN
brj-23886	351	14	b.	b.	PROPN
brj-23886	351	15	,	,	PUNCT
brj-23886	351	16	tran	tran	PROPN
brj-23886	351	17	,	,	PUNCT
brj-23886	351	18	m.	m.	NOUN
brj-23886	351	19	,	,	PUNCT
brj-23886	351	20	wright	wright	PROPN
brj-23886	351	21	,	,	PUNCT
brj-23886	351	22	n.	n.	NOUN
brj-23886	351	23	,	,	PUNCT
brj-23886	351	24	luzader	luzader	NOUN
brj-23886	351	25	,	,	PUNCT
brj-23886	351	26	d.	d.	PROPN
brj-23886	351	27	h	h	PROPN
brj-23886	351	28	,	,	PUNCT
brj-23886	351	29	kendall	kendall	PROPN
brj-23886	351	30	,	,	PUNCT
brj-23886	351	31	m.	m.	NOUN
brj-23886	351	32	m.	m.	NOUN
brj-23886	351	33	,	,	PUNCT
brj-23886	351	34	ruizperez	ruizperez	PROPN
brj-23886	351	35	,	,	PUNCT
brj-23886	351	36	f.	f.	PROPN
brj-23886	351	37	,	,	PUNCT
brj-23886	351	38	and	and	CCONJ
brj-23886	351	39	nataro	nataro	NOUN
brj-23886	351	40	,	,	PUNCT
brj-23886	351	41	j.	j.	PROPN
brj-23886	351	42	p.	p.	PROPN
brj-23886	351	43	(	(	PUNCT
brj-23886	351	44	2016	2016	NUM
brj-23886	351	45	)	)	PUNCT
brj-23886	351	46	.	.	PUNCT
brj-23886	352	1	“	"	PUNCT
brj-23886	352	2	a	a	DET
brj-23886	352	3	large	large	ADJ
brj-23886	352	4	family	family	NOUN
brj-23886	352	5	of	of	ADP
brj-23886	352	6	anti	anti	ADJ
brj-23886	352	7	-	-	ADJ
brj-23886	352	8	activators	activator	NOUN
brj-23886	352	9	accompanying	accompany	VERB
brj-23886	352	10	xyls	xyls	PROPN
brj-23886	352	11	/	/	SYM
brj-23886	352	12	arac	arac	NOUN
brj-23886	352	13	family	family	NOUN
brj-23886	352	14	regulatory	regulatory	ADJ
brj-23886	352	15	proteins	protein	NOUN
brj-23886	352	16	,	,	PUNCT
brj-23886	352	17	”	"	PUNCT
brj-23886	352	18	molecular	molecular	ADJ
brj-23886	352	19	microbiology	microbiology	NOUN
brj-23886	352	20	101(2	101(2	NUM
brj-23886	352	21	)	)	PUNCT
brj-23886	352	22	,	,	PUNCT
brj-23886	352	23	314	314	NUM
brj-23886	352	24	-	-	SYM
brj-23886	352	25	332	332	NUM
brj-23886	352	26	.	.	PUNCT
brj-23886	353	1	doi	doi	NOUN
brj-23886	353	2	:	:	PUNCT
brj-23886	353	3	10.1111	10.1111	NUM
brj-23886	353	4	/	/	SYM
brj-23886	353	5	mmi.13392	mmi.13392	NOUN
brj-23886	353	6	shaw	shaw	PROPN
brj-23886	353	7	,	,	PUNCT
brj-23886	353	8	a.	a.	PROPN
brj-23886	353	9	j.	j.	PROPN
brj-23886	353	10	,	,	PUNCT
brj-23886	353	11	jenney	jenney	PROPN
brj-23886	353	12	,	,	PUNCT
brj-23886	353	13	f.	f.	PROPN
brj-23886	353	14	e.	e.	PROPN
brj-23886	353	15	,	,	PUNCT
brj-23886	353	16	adams	adams	PROPN
brj-23886	353	17	,	,	PUNCT
brj-23886	353	18	m.	m.	PROPN
brj-23886	353	19	w.	w.	PROPN
brj-23886	353	20	w.	w.	PROPN
brj-23886	353	21	,	,	PUNCT
brj-23886	353	22	and	and	CCONJ
brj-23886	353	23	lynd	lynd	PROPN
brj-23886	353	24	,	,	PUNCT
brj-23886	353	25	l.	l.	PROPN
brj-23886	353	26	r.	r.	PROPN
brj-23886	353	27	(	(	PUNCT
brj-23886	353	28	2008	2008	NUM
brj-23886	353	29	)	)	PUNCT
brj-23886	353	30	.	.	PUNCT
brj-23886	354	1	“	"	PUNCT
brj-23886	354	2	end	end	NOUN
brj-23886	354	3	-	-	PUNCT
brj-23886	354	4	product	product	NOUN
brj-23886	354	5	pathways	pathway	NOUN
brj-23886	354	6	in	in	ADP
brj-23886	354	7	the	the	DET
brj-23886	354	8	xylose	xylose	PROPN
brj-23886	354	9	fermenting	fermenting	NOUN
brj-23886	354	10	bacterium	bacterium	NOUN
brj-23886	354	11	,	,	PUNCT
brj-23886	354	12	thermoanaerobacterium	thermoanaerobacterium	PROPN
brj-23886	354	13	peer	peer	NOUN
brj-23886	354	14	-	-	PUNCT
brj-23886	354	15	reviewed	review	VERB
brj-23886	354	16	article	article	NOUN
brj-23886	354	17	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	354	18	cui	cui	PROPN
brj-23886	354	19	et	et	PROPN
brj-23886	354	20	al	al	PROPN
brj-23886	354	21	.	.	PROPN
brj-23886	355	1	(	(	PUNCT
brj-23886	355	2	2025	2025	NUM
brj-23886	355	3	)	)	PUNCT
brj-23886	355	4	.	.	PUNCT
brj-23886	356	1	“	"	PUNCT
brj-23886	356	2	genome	genome	NOUN
brj-23886	356	3	study	study	NOUN
brj-23886	356	4	of	of	ADP
brj-23886	356	5	c.	c.	PROPN
brj-23886	356	6	thermocellum	thermocellum	PROPN
brj-23886	356	7	,	,	PUNCT
brj-23886	356	8	”	"	PUNCT
brj-23886	356	9	bioresources	bioresource	NOUN
brj-23886	356	10	20(2	20(2	NUM
brj-23886	356	11	)	)	PUNCT
brj-23886	356	12	,	,	PUNCT
brj-23886	356	13	3155	3155	NUM
brj-23886	356	14	-	-	SYM
brj-23886	356	15	3175	3175	NUM
brj-23886	356	16	.	.	PUNCT
brj-23886	357	1	3174	3174	NUM
brj-23886	357	2	saccharolyticum	saccharolyticum	NOUN
brj-23886	357	3	,	,	PUNCT
brj-23886	357	4	”	"	PUNCT
brj-23886	357	5	enzyme	enzyme	NOUN
brj-23886	357	6	and	and	CCONJ
brj-23886	357	7	microbial	microbial	ADJ
brj-23886	357	8	technology	technology	NOUN
brj-23886	357	9	42(6	42(6	NOUN
brj-23886	357	10	)	)	PUNCT
brj-23886	357	11	,	,	PUNCT
brj-23886	357	12	453	453	NUM
brj-23886	357	13	-	-	SYM
brj-23886	357	14	458	458	NUM
brj-23886	357	15	.	.	PUNCT
brj-23886	358	1	doi	doi	NOUN
brj-23886	358	2	:	:	PUNCT
brj-23886	358	3	10.1016	10.1016	NUM
brj-23886	358	4	/	/	SYM
brj-23886	358	5	j.enzmictec.2008.01.005	j.enzmictec.2008.01.005	PROPN
brj-23886	358	6	sheng	sheng	PROPN
brj-23886	358	7	,	,	PUNCT
brj-23886	358	8	t.	t.	PROPN
brj-23886	358	9	,	,	PUNCT
brj-23886	358	10	meng	meng	PROPN
brj-23886	358	11	,	,	PUNCT
brj-23886	358	12	q.	q.	PROPN
brj-23886	358	13	b.	b.	PROPN
brj-23886	358	14	,	,	PUNCT
brj-23886	358	15	li	li	PROPN
brj-23886	358	16	,	,	PUNCT
brj-23886	358	17	z.	z.	PROPN
brj-23886	358	18	l.	l.	PROPN
brj-23886	358	19	,	,	PUNCT
brj-23886	358	20	sun	sun	PROPN
brj-23886	358	21	,	,	PUNCT
brj-23886	358	22	c.	c.	PROPN
brj-23886	358	23	y.	y.	PROPN
brj-23886	358	24	,	,	PUNCT
brj-23886	358	25	li	li	PROPN
brj-23886	358	26	,	,	PUNCT
brj-23886	358	27	l.	l.	PROPN
brj-23886	358	28	x.	x.	PROPN
brj-23886	358	29	,	,	PUNCT
brj-23886	358	30	and	and	CCONJ
brj-23886	358	31	liu	liu	PROPN
brj-23886	358	32	,	,	PUNCT
brj-23886	358	33	l.	l.	PROPN
brj-23886	358	34	l.	l.	PROPN
brj-23886	358	35	(	(	PUNCT
brj-23886	358	36	2022	2022	NUM
brj-23886	358	37	)	)	PUNCT
brj-23886	358	38	.	.	PUNCT
brj-23886	359	1	“	"	PUNCT
brj-23886	359	2	comparative	comparative	ADJ
brj-23886	359	3	genomics	genomic	NOUN
brj-23886	359	4	reveals	reveal	VERB
brj-23886	359	5	cellobiose	cellobiose	VERB
brj-23886	359	6	hydrolysis	hydrolysis	NOUN
brj-23886	359	7	mechanism	mechanism	NOUN
brj-23886	359	8	of	of	ADP
brj-23886	359	9	ruminiclostridium	ruminiclostridium	NOUN
brj-23886	359	10	thermocellum	thermocellum	PROPN
brj-23886	359	11	m3	m3	PROPN
brj-23886	359	12	,	,	PUNCT
brj-23886	359	13	a	a	DET
brj-23886	359	14	cellulosic	cellulosic	NOUN
brj-23886	359	15	saccharification	saccharification	NOUN
brj-23886	359	16	bacterium	bacterium	NOUN
brj-23886	359	17	,	,	PUNCT
brj-23886	359	18	”	"	PUNCT
brj-23886	359	19	frontiers	frontier	NOUN
brj-23886	359	20	in	in	ADP
brj-23886	359	21	microbiology	microbiology	NOUN
brj-23886	359	22	13	13	NUM
brj-23886	359	23	,	,	PUNCT
brj-23886	359	24	article	article	NOUN
brj-23886	359	25	i	i	PROPN
brj-23886	359	26	d	d	PROPN
brj-23886	359	27	1079279	1079279	NUM
brj-23886	359	28	.	.	PUNCT
brj-23886	360	1	doi	doi	NOUN
brj-23886	360	2	:	:	PUNCT
brj-23886	360	3	10.3389	10.3389	NUM
brj-23886	360	4	/	/	SYM
brj-23886	360	5	fmi	fmi	PROPN
brj-23886	360	6	cb.2022.1079279	cb.2022.1079279	PROPN
brj-23886	360	7	sindhu	sindhu	PROPN
brj-23886	360	8	r.	r.	PROPN
brj-23886	360	9	,	,	PUNCT
brj-23886	360	10	kuttiraja	kuttiraja	PROPN
brj-23886	360	11	m.	m.	PROPN
brj-23886	360	12	,	,	PUNCT
brj-23886	360	13	binod	binod	PROPN
brj-23886	360	14	p.	p.	PROPN
brj-23886	360	15	,	,	PUNCT
brj-23886	360	16	sukumaran	sukumaran	PROPN
brj-23886	360	17	r.	r.	PROPN
brj-23886	360	18	k.	k.	PROPN
brj-23886	360	19	,	,	PUNCT
brj-23886	360	20	and	and	CCONJ
brj-23886	360	21	pandey	pandey	PROPN
brj-23886	360	22	a.	a.	PROPN
brj-23886	360	23	(	(	PUNCT
brj-23886	360	24	2014	2014	NUM
brj-23886	360	25	)	)	PUNCT
brj-23886	360	26	.	.	PUNCT
brj-23886	361	1	“	"	PUNCT
brj-23886	361	2	physicochemical	physicochemical	ADJ
brj-23886	361	3	characterization	characterization	NOUN
brj-23886	361	4	of	of	ADP
brj-23886	361	5	alkali	alkali	ADJ
brj-23886	361	6	pretreated	pretreate	VERB
brj-23886	361	7	sugarcane	sugarcane	NOUN
brj-23886	361	8	tops	top	NOUN
brj-23886	361	9	and	and	CCONJ
brj-23886	361	10	optimization	optimization	NOUN
brj-23886	361	11	of	of	ADP
brj-23886	361	12	enzymatic	enzymatic	ADJ
brj-23886	361	13	saccharification	saccharification	NOUN
brj-23886	361	14	using	use	VERB
brj-23886	361	15	response	response	NOUN
brj-23886	361	16	surface	surface	NOUN
brj-23886	361	17	methodology	methodology	NOUN
brj-23886	361	18	,	,	PUNCT
brj-23886	361	19	”	"	PUNCT
brj-23886	361	20	renewable	renewable	ADJ
brj-23886	361	21	energy	energy	NOUN
brj-23886	361	22	62	62	NUM
brj-23886	361	23	,	,	PUNCT
brj-23886	361	24	362	362	NUM
brj-23886	361	25	-	-	SYM
brj-23886	361	26	368	368	NUM
brj-23886	361	27	.	.	PUNCT
brj-23886	362	1	doi	doi	NOUN
brj-23886	362	2	:	:	PUNCT
brj-23886	362	3	10.1016	10.1016	NUM
brj-23886	362	4	/	/	SYM
brj-23886	362	5	j.renene.2013.07.041	j.renene.2013.07.041	PROPN
brj-23886	362	6	singh	singh	PROPN
brj-23886	362	7	,	,	PUNCT
brj-23886	362	8	s.	s.	PROPN
brj-23886	362	9	,	,	PUNCT
brj-23886	362	10	kumar	kumar	PROPN
brj-23886	362	11	,	,	PUNCT
brj-23886	362	12	a.	a.	PROPN
brj-23886	362	13	,	,	PUNCT
brj-23886	362	14	sivakumar	sivakumar	PROPN
brj-23886	362	15	,	,	PUNCT
brj-23886	362	16	n.	n.	NOUN
brj-23886	362	17	,	,	PUNCT
brj-23886	362	18	and	and	CCONJ
brj-23886	362	19	verma	verma	PROPN
brj-23886	362	20	,	,	PUNCT
brj-23886	362	21	j.	j.	PROPN
brj-23886	362	22	p.	p.	PROPN
brj-23886	362	23	(	(	PUNCT
brj-23886	362	24	2022	2022	NUM
brj-23886	362	25	)	)	PUNCT
brj-23886	362	26	.	.	PUNCT
brj-23886	363	1	“	"	PUNCT
brj-23886	363	2	deconstruction	deconstruction	NOUN
brj-23886	363	3	of	of	ADP
brj-23886	363	4	lignocellulosic	lignocellulosic	ADJ
brj-23886	363	5	biomass	biomass	NOUN
brj-23886	363	6	for	for	ADP
brj-23886	363	7	bioethanol	bioethanol	NOUN
brj-23886	363	8	production	production	NOUN
brj-23886	363	9	:	:	PUNCT
brj-23886	363	10	recent	recent	ADJ
brj-23886	363	11	advances	advance	NOUN
brj-23886	363	12	and	and	CCONJ
brj-23886	363	13	future	future	ADJ
brj-23886	363	14	prospects	prospect	NOUN
brj-23886	363	15	,	,	PUNCT
brj-23886	363	16	”	"	PUNCT
brj-23886	363	17	fuel	fuel	NOUN
brj-23886	363	18	327	327	NUM
brj-23886	363	19	,	,	PUNCT
brj-23886	363	20	article	article	NOUN
brj-23886	363	21	i	i	PROPN
brj-23886	363	22	d	d	PROPN
brj-23886	363	23	125109	125109	NUM
brj-23886	363	24	.	.	PUNCT
brj-23886	364	1	doi	doi	NOUN
brj-23886	364	2	:	:	PUNCT
brj-23886	364	3	10.1016	10.1016	NUM
brj-23886	364	4	/j.fuel.2022.125109	/j.fuel.2022.125109	PROPN
brj-23886	364	5	sridhar	sridhar	PROPN
brj-23886	364	6	,	,	PUNCT
brj-23886	364	7	j.	j.	PROPN
brj-23886	364	8	,	,	PUNCT
brj-23886	364	9	eiteman	eiteman	NOUN
brj-23886	364	10	,	,	PUNCT
brj-23886	364	11	m.	m.	NOUN
brj-23886	364	12	a.	a.	NOUN
brj-23886	364	13	,	,	PUNCT
brj-23886	364	14	and	and	CCONJ
brj-23886	364	15	wiegel	wiegel	NOUN
brj-23886	364	16	,	,	PUNCT
brj-23886	364	17	j.	j.	PROPN
brj-23886	364	18	w.	w.	PROPN
brj-23886	364	19	(	(	PUNCT
brj-23886	364	20	2000	2000	NUM
brj-23886	364	21	)	)	PUNCT
brj-23886	364	22	.	.	PUNCT
brj-23886	365	1	“	"	PUNCT
brj-23886	365	2	elucidation	elucidation	NOUN
brj-23886	365	3	of	of	ADP
brj-23886	365	4	enzymes	enzyme	NOUN
brj-23886	365	5	in	in	ADP
brj-23886	365	6	fermentation	fermentation	NOUN
brj-23886	365	7	pathways	pathway	NOUN
brj-23886	365	8	used	use	VERB
brj-23886	365	9	by	by	ADP
brj-23886	365	10	clostridium	clostridium	NOUN
brj-23886	365	11	thermosuccino	thermosuccino	NOUN
brj-23886	365	12	genes	gene	NOUN
brj-23886	365	13	growing	grow	VERB
brj-23886	365	14	on	on	ADP
brj-23886	365	15	inulin	inulin	NOUN
brj-23886	365	16	,	,	PUNCT
brj-23886	365	17	”	"	PUNCT
brj-23886	365	18	applied	apply	VERB
brj-23886	365	19	and	and	CCONJ
brj-23886	365	20	environmental	environmental	ADJ
brj-23886	365	21	microbiology	microbiology	NOUN
brj-23886	365	22	66(1	66(1	NOUN
brj-23886	365	23	)	)	PUNCT
brj-23886	365	24	,	,	PUNCT
brj-23886	365	25	246	246	NUM
brj-23886	365	26	-	-	SYM
brj-23886	365	27	251	251	NUM
brj-23886	365	28	.	.	PUNCT
brj-23886	366	1	doi	doi	NOUN
brj-23886	366	2	:	:	PUNCT
brj-23886	366	3	10.1128	10.1128	NUM
brj-23886	366	4	/	/	SYM
brj-23886	366	5	aem.66.1.246	aem.66.1.246	NOUN
brj-23886	366	6	-	-	PUNCT
brj-23886	366	7	251.2000	251.2000	NUM
brj-23886	366	8	wang	wang	NOUN
brj-23886	366	9	,	,	PUNCT
brj-23886	366	10	y.	y.	PROPN
brj-23886	366	11	b.	b.	PROPN
brj-23886	366	12	,	,	PUNCT
brj-23886	366	13	hu	hu	PROPN
brj-23886	366	14	,	,	PUNCT
brj-23886	366	15	j.	j.	PROPN
brj-23886	366	16	h.	h.	PROPN
brj-23886	366	17	,	,	PUNCT
brj-23886	366	18	li	li	PROPN
brj-23886	366	19	,	,	PUNCT
brj-23886	366	20	y.	y.	PROPN
brj-23886	366	21	l.	l.	PROPN
brj-23886	366	22	,	,	PUNCT
brj-23886	366	23	and	and	CCONJ
brj-23886	366	24	liu	liu	PROPN
brj-23886	366	25	,	,	PUNCT
brj-23886	366	26	z.	z.	PROPN
brj-23886	366	27	y.	y.	PROPN
brj-23886	366	28	(	(	PUNCT
brj-23886	366	29	2022	2022	NUM
brj-23886	366	30	)	)	PUNCT
brj-23886	366	31	.	.	PUNCT
brj-23886	367	1	“	"	PUNCT
brj-23886	367	2	rare	rare	ADJ
brj-23886	367	3	earth	earth	NOUN
brj-23886	367	4	ion	ion	NOUN
brj-23886	367	5	nd3	nd3	NOUN
brj-23886	367	6	+	+	CCONJ
brj-23886	367	7	promotes	promote	VERB
brj-23886	367	8	production	production	NOUN
brj-23886	367	9	of	of	ADP
brj-23886	367	10	cellulose	cellulose	NOUN
brj-23886	367	11	ethanol	ethanol	NOUN
brj-23886	367	12	by	by	ADP
brj-23886	367	13	clostridium	clostridium	NOUN
brj-23886	367	14	thermocellum	thermocellum	PROPN
brj-23886	367	15	atcc	atcc	PROPN
brj-23886	367	16	27405	27405	NUM
brj-23886	367	17	,	,	PUNCT
brj-23886	367	18	”	"	PUNCT
brj-23886	367	19	polyhedron	polyhedron	NOUN
brj-23886	367	20	211	211	NUM
brj-23886	367	21	,	,	PUNCT
brj-23886	367	22	article	article	NOUN
brj-23886	367	23	i	i	PROPN
brj-23886	367	24	d	d	PROPN
brj-23886	367	25	115555	115555	NUM
brj-23886	367	26	.	.	PUNCT
brj-23886	368	1	doi	doi	NOUN
brj-23886	368	2	:	:	PUNCT
brj-23886	368	3	10.1016	10.1016	NUM
brj-23886	368	4	/	/	SYM
brj-23886	368	5	j.poly.2021.115555	j.poly.2021.115555	NOUN
brj-23886	368	6	würleitner	würleitner	NOUN
brj-23886	368	7	,	,	PUNCT
brj-23886	368	8	e.	e.	PROPN
brj-23886	368	9	,	,	PUNCT
brj-23886	368	10	pera	pera	PROPN
brj-23886	368	11	,	,	PUNCT
brj-23886	368	12	l.	l.	PROPN
brj-23886	368	13	,	,	PUNCT
brj-23886	368	14	wacenovsky	wacenovsky	NOUN
brj-23886	368	15	,	,	PUNCT
brj-23886	368	16	c.	c.	NOUN
brj-23886	368	17	,	,	PUNCT
brj-23886	368	18	cziferszky	cziferszky	ADJ
brj-23886	368	19	,	,	PUNCT
brj-23886	368	20	a.	a.	NOUN
brj-23886	368	21	,	,	PUNCT
brj-23886	368	22	zeilinger	zeilinger	NOUN
brj-23886	368	23	,	,	PUNCT
brj-23886	368	24	s.	s.	PROPN
brj-23886	368	25	,	,	PUNCT
brj-23886	368	26	kubicek	kubicek	PROPN
brj-23886	368	27	,	,	PUNCT
brj-23886	368	28	c.	c.	PROPN
brj-23886	368	29	p.	p.	PROPN
brj-23886	368	30	,	,	PUNCT
brj-23886	368	31	and	and	CCONJ
brj-23886	368	32	mach	mach	PRON
brj-23886	368	33	,	,	PUNCT
brj-23886	368	34	r.	r.	PROPN
brj-23886	368	35	l.	l.	PROPN
brj-23886	368	36	(	(	PUNCT
brj-23886	368	37	2003	2003	NUM
brj-23886	368	38	)	)	PUNCT
brj-23886	368	39	.	.	PUNCT
brj-23886	369	1	“	"	PUNCT
brj-23886	369	2	transcriptional	transcriptional	ADJ
brj-23886	369	3	regulation	regulation	NOUN
brj-23886	369	4	of	of	ADP
brj-23886	369	5	xyn2	xyn2	NOUN
brj-23886	369	6	in	in	ADP
brj-23886	369	7	hypocrea	hypocrea	PROPN
brj-23886	369	8	jecorina	jecorina	PROPN
brj-23886	369	9	,	,	PUNCT
brj-23886	369	10	”	"	PUNCT
brj-23886	369	11	eukaryotic	eukaryotic	ADJ
brj-23886	369	12	cell	cell	NOUN
brj-23886	369	13	2	2	NUM
brj-23886	369	14	,	,	PUNCT
brj-23886	369	15	150	150	NUM
brj-23886	369	16	-	-	SYM
brj-23886	369	17	158	158	NUM
brj-23886	369	18	.	.	PUNCT
brj-23886	370	1	doi	doi	NOUN
brj-23886	370	2	:	:	PUNCT
brj-23886	370	3	10.1128	10.1128	NUM
brj-23886	370	4	/	/	SYM
brj-23886	370	5	ec.2.1.150	ec.2.1.150	NOUN
brj-23886	370	6	-	-	PUNCT
brj-23886	370	7	158.2003	158.2003	NUM
brj-23886	370	8	xiao	xiao	PROPN
brj-23886	370	9	,	,	PUNCT
brj-23886	370	10	y.	y.	PROPN
brj-23886	370	11	,	,	PUNCT
brj-23886	370	12	dong	dong	PROPN
brj-23886	370	13	,	,	PUNCT
brj-23886	370	14	s.	s.	PROPN
brj-23886	370	15	,	,	PUNCT
brj-23886	370	16	liu	liu	PROPN
brj-23886	370	17	,	,	PUNCT
brj-23886	370	18	y.	y.	PROPN
brj-23886	370	19	j.	j.	PROPN
brj-23886	370	20	,	,	PUNCT
brj-23886	370	21	you	you	PRON
brj-23886	370	22	,	,	PUNCT
brj-23886	370	23	c.	c.	PROPN
brj-23886	370	24	,	,	PUNCT
brj-23886	370	25	feng	feng	PROPN
brj-23886	370	26	,	,	PUNCT
brj-23886	370	27	y.	y.	PROPN
brj-23886	370	28	g.	g.	PROPN
brj-23886	370	29	,	,	PUNCT
brj-23886	370	30	and	and	CCONJ
brj-23886	370	31	cui	cui	PROPN
brj-23886	370	32	,	,	PUNCT
brj-23886	370	33	q.	q.	PROPN
brj-23886	370	34	(	(	PUNCT
brj-23886	370	35	2023	2023	NUM
brj-23886	370	36	)	)	PUNCT
brj-23886	370	37	.	.	PUNCT
brj-23886	371	1	“	"	PUNCT
brj-23886	371	2	key	key	ADJ
brj-23886	371	3	roles	role	NOUN
brj-23886	371	4	of	of	ADP
brj-23886	371	5	βglucosidase	βglucosidase	ADJ
brj-23886	371	6	bgla	bgla	PROPN
brj-23886	371	7	for	for	ADP
brj-23886	371	8	the	the	DET
brj-23886	371	9	catabolism	catabolism	NOUN
brj-23886	371	10	of	of	ADP
brj-23886	371	11	both	both	CCONJ
brj-23886	371	12	laminaribiose	laminaribiose	ADJ
brj-23886	371	13	and	and	CCONJ
brj-23886	371	14	cellobiose	cellobiose	VERB
brj-23886	371	15	in	in	ADP
brj-23886	371	16	the	the	DET
brj-23886	371	17	lignocellulolytic	lignocellulolytic	ADJ
brj-23886	371	18	bacterium	bacterium	NOUN
brj-23886	371	19	clostridium	clostridium	NOUN
brj-23886	371	20	thermocellum	thermocellum	PROPN
brj-23886	371	21	,	,	PUNCT
brj-23886	371	22	”	"	PUNCT
brj-23886	371	23	international	international	ADJ
brj-23886	371	24	journal	journal	NOUN
brj-23886	371	25	of	of	ADP
brj-23886	371	26	biological	biological	ADJ
brj-23886	371	27	250	250	NUM
brj-23886	371	28	,	,	PUNCT
brj-23886	371	29	article	article	NOUN
brj-23886	371	30	i	i	PROPN
brj-23886	371	31	d	d	PROPN
brj-23886	371	32	126226	126226	NUM
brj-23886	371	33	.	.	PUNCT
brj-23886	372	1	doi	doi	NOUN
brj-23886	372	2	:	:	PUNCT
brj-23886	372	3	10.1016/	10.1016/	NUM
brj-23886	372	4	j.ijbiomac.2023.126226	j.ijbiomac.2023.126226	PROPN
brj-23886	372	5	xin	xin	PROPN
brj-23886	372	6	,	,	PUNCT
brj-23886	372	7	w.	w.	PROPN
brj-23886	372	8	k.	k.	PROPN
brj-23886	372	9	,	,	PUNCT
brj-23886	372	10	and	and	CCONJ
brj-23886	372	11	gao	gao	PROPN
brj-23886	372	12	,	,	PUNCT
brj-23886	372	13	x.	x.	NOUN
brj-23886	372	14	x.	x.	NOUN
brj-23886	373	1	(	(	PUNCT
brj-23886	373	2	1996	1996	NUM
brj-23886	373	3	)	)	PUNCT
brj-23886	373	4	.	.	PUNCT
brj-23886	374	1	“	"	PUNCT
brj-23886	374	2	study	study	NOUN
brj-23886	374	3	of	of	ADP
brj-23886	374	4	the	the	DET
brj-23886	374	5	effect	effect	NOUN
brj-23886	374	6	of	of	ADP
brj-23886	374	7	lanthanide	lanthanide	ADJ
brj-23886	374	8	ions	ion	NOUN
brj-23886	374	9	on	on	ADP
brj-23886	374	10	the	the	DET
brj-23886	374	11	kinetics	kinetic	NOUN
brj-23886	374	12	of	of	ADP
brj-23886	374	13	glutamate	glutamate	ADJ
brj-23886	374	14	dehydrogenase	dehydrogenase	NOUN
brj-23886	374	15	by	by	ADP
brj-23886	374	16	a	a	DET
brj-23886	374	17	chronoamperometric	chronoamperometric	ADJ
brj-23886	374	18	method	method	NOUN
brj-23886	374	19	,	,	PUNCT
brj-23886	374	20	”	"	PUNCT
brj-23886	374	21	analyst	analyst	NOUN
brj-23886	374	22	121(5	121(5	NUM
brj-23886	374	23	)	)	PUNCT
brj-23886	374	24	,	,	PUNCT
brj-23886	374	25	687690	687690	NUM
brj-23886	374	26	.	.	PUNCT
brj-23886	375	1	doi	doi	NOUN
brj-23886	375	2	:	:	PUNCT
brj-23886	375	3	10.1039	10.1039	NUM
brj-23886	375	4	/	/	SYM
brj-23886	375	5	a	a	DET
brj-23886	375	6	n9962100687	n9962100687	PROPN
brj-23886	375	7	yayo	yayo	NOUN
brj-23886	375	8	,	,	PUNCT
brj-23886	375	9	j.	j.	PROPN
brj-23886	375	10	,	,	PUNCT
brj-23886	375	11	kuil	kuil	PROPN
brj-23886	375	12	,	,	PUNCT
brj-23886	375	13	t.	t.	PROPN
brj-23886	375	14	,	,	PUNCT
brj-23886	375	15	olson	olson	PROPN
brj-23886	375	16	,	,	PUNCT
brj-23886	375	17	d.	d.	PROPN
brj-23886	375	18	g.	g.	PROPN
brj-23886	375	19	,	,	PUNCT
brj-23886	375	20	lynd	lynd	PROPN
brj-23886	375	21	,	,	PUNCT
brj-23886	375	22	l.	l.	PROPN
brj-23886	375	23	r.	r.	PROPN
brj-23886	375	24	,	,	PUNCT
brj-23886	375	25	and	and	CCONJ
brj-23886	375	26	maris	maris	PROPN
brj-23886	375	27	,	,	PUNCT
brj-23886	375	28	a.	a.	PROPN
brj-23886	375	29	j.	j.	PROPN
brj-23886	375	30	a.	a.	PROPN
brj-23886	375	31	v.	v.	PROPN
brj-23886	375	32	(	(	PUNCT
brj-23886	375	33	2021	2021	NUM
brj-23886	375	34	)	)	PUNCT
brj-23886	375	35	.	.	PUNCT
brj-23886	376	1	“	"	PUNCT
brj-23886	376	2	laboratory	laboratory	NOUN
brj-23886	376	3	evolution	evolution	NOUN
brj-23886	376	4	and	and	CCONJ
brj-23886	376	5	reverse	reverse	ADJ
brj-23886	376	6	engineering	engineering	NOUN
brj-23886	376	7	of	of	ADP
brj-23886	376	8	clostridium	clostridium	NOUN
brj-23886	376	9	thermocellum	thermocellum	PROPN
brj-23886	376	10	for	for	ADP
brj-23886	376	11	growth	growth	NOUN
brj-23886	376	12	on	on	ADP
brj-23886	376	13	glucose	glucose	NOUN
brj-23886	376	14	and	and	CCONJ
brj-23886	376	15	fructose	fructose	NOUN
brj-23886	376	16	,	,	PUNCT
brj-23886	376	17	”	"	PUNCT
brj-23886	376	18	applied	apply	VERB
brj-23886	376	19	and	and	CCONJ
brj-23886	376	20	environmental	environmental	ADJ
brj-23886	376	21	microbiology	microbiology	NOUN
brj-23886	376	22	87(9	87(9	NOUN
brj-23886	376	23	)	)	PUNCT
brj-23886	376	24	,	,	PUNCT
brj-23886	376	25	article	article	NOUN
brj-23886	376	26	i	i	PROPN
brj-23886	376	27	d	d	PROPN
brj-23886	376	28	e03017	e03017	PROPN
brj-23886	376	29	-	-	PUNCT
brj-23886	376	30	20	20	NUM
brj-23886	376	31	.	.	PUNCT
brj-23886	377	1	doi	doi	NOUN
brj-23886	377	2	:	:	PUNCT
brj-23886	377	3	10.1128	10.1128	NUM
brj-23886	377	4	/	/	SYM
brj-23886	377	5	aem.03017	aem.03017	NUM
brj-23886	377	6	-	-	PUNCT
brj-23886	377	7	20	20	NUM
brj-23886	377	8	yu	yu	PROPN
brj-23886	377	9	,	,	PUNCT
brj-23886	377	10	m.	m.	NOUN
brj-23886	377	11	,	,	PUNCT
brj-23886	377	12	li	li	PROPN
brj-23886	377	13	,	,	PUNCT
brj-23886	377	14	j.	j.	PROPN
brj-23886	377	15	,	,	PUNCT
brj-23886	377	16	li	li	PROPN
brj-23886	377	17	,	,	PUNCT
brj-23886	377	18	s.	s.	PROPN
brj-23886	377	19	,	,	PUNCT
brj-23886	377	20	du	du	PROPN
brj-23886	377	21	,	,	PUNCT
brj-23886	377	22	r.	r.	PROPN
brj-23886	377	23	,	,	PUNCT
brj-23886	377	24	jiang	jiang	PROPN
brj-23886	377	25	,	,	PUNCT
brj-23886	377	26	y.	y.	PROPN
brj-23886	377	27	,	,	PUNCT
brj-23886	377	28	fan	fan	PROPN
brj-23886	377	29	,	,	PUNCT
brj-23886	377	30	g.	g.	PROPN
brj-23886	377	31	,	,	PUNCT
brj-23886	377	32	and	and	CCONJ
brj-23886	377	33	chang	chang	PROPN
brj-23886	377	34	s.	s.	PROPN
brj-23886	377	35	(	(	PUNCT
brj-23886	377	36	2014	2014	NUM
brj-23886	377	37	)	)	PUNCT
brj-23886	377	38	.	.	PUNCT
brj-23886	378	1	“	"	PUNCT
brj-23886	378	2	a	a	DET
brj-23886	378	3	cost	cost	NOUN
brj-23886	378	4	-	-	PUNCT
brj-23886	378	5	effective	effective	ADJ
brj-23886	378	6	integrated	integrate	VERB
brj-23886	378	7	process	process	NOUN
brj-23886	378	8	to	to	PART
brj-23886	378	9	convert	convert	VERB
brj-23886	378	10	solid	solid	ADJ
brj-23886	378	11	-	-	PUNCT
brj-23886	378	12	state	state	NOUN
brj-23886	378	13	fermented	ferment	VERB
brj-23886	378	14	sweet	sweet	ADJ
brj-23886	378	15	sorghum	sorghum	NOUN
brj-23886	378	16	bagasse	bagasse	NOUN
brj-23886	378	17	into	into	ADP
brj-23886	378	18	cellulosic	cellulosic	NOUN
brj-23886	378	19	ethanol	ethanol	NOUN
brj-23886	378	20	,	,	PUNCT
brj-23886	378	21	”	"	PUNCT
brj-23886	378	22	applied	apply	VERB
brj-23886	378	23	energy	energy	NOUN
brj-23886	378	24	115(15	115(15	NUM
brj-23886	378	25	)	)	PUNCT
brj-23886	378	26	,	,	PUNCT
brj-23886	378	27	331	331	NUM
brj-23886	378	28	-	-	SYM
brj-23886	378	29	336	336	NUM
brj-23886	378	30	.	.	PUNCT
brj-23886	379	1	doi	doi	NOUN
brj-23886	379	2	:	:	PUNCT
brj-23886	379	3	10.1016	10.1016	NUM
brj-23886	379	4	/	/	SYM
brj-23886	379	5	j.apenergy.2013.11.020	j.apenergy.2013.11.020	PROPN
brj-23886	379	6	zeng	zeng	PROPN
brj-23886	379	7	,	,	PUNCT
brj-23886	379	8	m.	m.	NOUN
brj-23886	379	9	,	,	PUNCT
brj-23886	379	10	mosier	mosier	PROPN
brj-23886	379	11	,	,	PUNCT
brj-23886	379	12	n.	n.	PROPN
brj-23886	379	13	s.	s.	PROPN
brj-23886	379	14	,	,	PUNCT
brj-23886	379	15	huang	huang	PROPN
brj-23886	379	16	,	,	PUNCT
brj-23886	379	17	c.	c.	PROPN
brj-23886	379	18	p.	p.	PROPN
brj-23886	379	19	,	,	PUNCT
brj-23886	379	20	sherman	sherman	PROPN
brj-23886	379	21	,	,	PUNCT
brj-23886	379	22	d.	d.	PROPN
brj-23886	379	23	m.	m.	PROPN
brj-23886	379	24	,	,	PUNCT
brj-23886	379	25	and	and	CCONJ
brj-23886	379	26	ladisch	ladisch	PROPN
brj-23886	379	27	,	,	PUNCT
brj-23886	379	28	m.	m.	PROPN
brj-23886	379	29	r.	r.	PROPN
brj-23886	379	30	(	(	PUNCT
brj-23886	379	31	2010	2010	NUM
brj-23886	379	32	)	)	PUNCT
brj-23886	379	33	.	.	PUNCT
brj-23886	380	1	“	"	PUNCT
brj-23886	380	2	microscopic	microscopic	ADJ
brj-23886	380	3	examination	examination	NOUN
brj-23886	380	4	of	of	ADP
brj-23886	380	5	changes	change	NOUN
brj-23886	380	6	of	of	ADP
brj-23886	380	7	plant	plant	NOUN
brj-23886	380	8	cell	cell	NOUN
brj-23886	380	9	structure	structure	NOUN
brj-23886	380	10	in	in	ADP
brj-23886	380	11	corn	corn	NOUN
brj-23886	380	12	stover	stover	NOUN
brj-23886	380	13	due	due	ADP
brj-23886	380	14	to	to	ADP
brj-23886	380	15	hot	hot	ADJ
brj-23886	380	16	water	water	NOUN
brj-23886	380	17	pretreatment	pretreatment	NOUN
brj-23886	380	18	and	and	CCONJ
brj-23886	380	19	enzymatic	enzymatic	ADJ
brj-23886	380	20	hydrolysis	hydrolysis	NOUN
brj-23886	380	21	,	,	PUNCT
brj-23886	380	22	”	"	PUNCT
brj-23886	380	23	biotechnology	biotechnology	NOUN
brj-23886	380	24	&	&	CCONJ
brj-23886	380	25	bioengineering	bioengineering	PROPN
brj-23886	380	26	97(2	97(2	NUM
brj-23886	380	27	)	)	PUNCT
brj-23886	380	28	,	,	PUNCT
brj-23886	380	29	265	265	NUM
brj-23886	380	30	-	-	SYM
brj-23886	380	31	278	278	NUM
brj-23886	380	32	.	.	PUNCT
brj-23886	381	1	doi:10.1002	doi:10.1002	NOUN
brj-23886	381	2	/	/	SYM
brj-23886	381	3	bit.21298	bit.21298	X
brj-23886	381	4	zhang	zhang	PROPN
brj-23886	381	5	,	,	PUNCT
brj-23886	381	6	d.	d.	PROPN
brj-23886	381	7	y.	y.	PROPN
brj-23886	381	8	,	,	PUNCT
brj-23886	381	9	hu	hu	PROPN
brj-23886	381	10	,	,	PUNCT
brj-23886	381	11	j.	j.	PROPN
brj-23886	381	12	h.	h.	PROPN
brj-23886	381	13	,	,	PUNCT
brj-23886	381	14	bater	bater	PROPN
brj-23886	381	15	siqin	siqin	PROPN
brj-23886	381	16	,	,	PUNCT
brj-23886	381	17	zhang	zhang	PROPN
brj-23886	381	18	,	,	PUNCT
brj-23886	381	19	t.	t.	PROPN
brj-23886	381	20	,	,	PUNCT
brj-23886	381	21	and	and	CCONJ
brj-23886	381	22	chang	chang	PROPN
brj-23886	381	23	,	,	PUNCT
brj-23886	381	24	y.	y.	PROPN
brj-23886	381	25	(	(	PUNCT
brj-23886	381	26	2009	2009	NUM
brj-23886	381	27	)	)	PUNCT
brj-23886	381	28	.	.	PUNCT
brj-23886	382	1	“	"	PUNCT
brj-23886	382	2	dy3	dy3	X
brj-23886	382	3	+	+	NOUN
brj-23886	382	4	and	and	CCONJ
brj-23886	382	5	nd3	nd3	ADJ
brj-23886	382	6	+	+	CCONJ
brj-23886	382	7	induced	induced	ADJ
brj-23886	382	8	genetic	genetic	ADJ
brj-23886	382	9	mutation	mutation	NOUN
brj-23886	382	10	of	of	ADP
brj-23886	382	11	bacillus	bacillus	NOUN
brj-23886	382	12	α	α	NOUN
brj-23886	382	13	-	-	NOUN
brj-23886	382	14	amylase	amylase	NOUN
brj-23886	382	15	,	,	PUNCT
brj-23886	382	16	”	"	PUNCT
brj-23886	382	17	journal	journal	NOUN
brj-23886	382	18	of	of	ADP
brj-23886	382	19	inorganic	inorganic	ADJ
brj-23886	382	20	biochemistry	biochemistry	NOUN
brj-23886	382	21	103(7	103(7	NUM
brj-23886	382	22	)	)	PUNCT
brj-23886	382	23	,	,	PUNCT
brj-23886	382	24	935	935	NUM
brj-23886	382	25	-	-	SYM
brj-23886	382	26	939	939	NUM
brj-23886	382	27	.	.	PUNCT
brj-23886	383	1	doi	doi	NOUN
brj-23886	383	2	:	:	PUNCT
brj-23886	383	3	10.1016	10.1016	NUM
brj-23886	383	4	/	/	SYM
brj-23886	383	5	j.jinorgbio.2008.12.002	j.jinorgbio.2008.12.002	PROPN
brj-23886	383	6	zhang	zhang	PROPN
brj-23886	383	7	,	,	PUNCT
brj-23886	383	8	j.	j.	PROPN
brj-23886	383	9	,	,	PUNCT
brj-23886	383	10	liu	liu	PROPN
brj-23886	383	11	,	,	PUNCT
brj-23886	383	12	s.	s.	PROPN
brj-23886	383	13	,	,	PUNCT
brj-23886	383	14	li	li	PROPN
brj-23886	383	15	,	,	PUNCT
brj-23886	383	16	r.	r.	PROPN
brj-23886	383	17	,	,	PUNCT
brj-23886	383	18	hong	hong	PROPN
brj-23886	383	19	,	,	PUNCT
brj-23886	383	20	w.	w.	PROPN
brj-23886	383	21	,	,	PUNCT
brj-23886	383	22	xiao	xiao	PROPN
brj-23886	383	23	,	,	PUNCT
brj-23886	383	24	y.	y.	PROPN
brj-23886	383	25	,	,	PUNCT
brj-23886	383	26	feng	feng	PROPN
brj-23886	383	27	,	,	PUNCT
brj-23886	383	28	y.	y.	PROPN
brj-23886	383	29	,	,	PUNCT
brj-23886	383	30	cui	cui	PROPN
brj-23886	383	31	,	,	PUNCT
brj-23886	383	32	q.	q.	PROPN
brj-23886	383	33	,	,	PUNCT
brj-23886	383	34	and	and	CCONJ
brj-23886	383	35	liu	liu	PROPN
brj-23886	383	36	,	,	PUNCT
brj-23886	383	37	y.	y.	PROPN
brj-23886	383	38	j.	j.	PROPN
brj-23886	383	39	(	(	PUNCT
brj-23886	383	40	2017	2017	NUM
brj-23886	383	41	)	)	PUNCT
brj-23886	383	42	.	.	PUNCT
brj-23886	384	1	“	"	PUNCT
brj-23886	384	2	efficient	efficient	ADJ
brj-23886	384	3	wholecell	wholecell	NOUN
brj-23886	384	4	-	-	PUNCT
brj-23886	384	5	catalyzing	catalyze	VERB
brj-23886	384	6	cellulose	cellulose	NOUN
brj-23886	384	7	saccharification	saccharification	NOUN
brj-23886	384	8	using	use	VERB
brj-23886	384	9	engineered	engineer	VERB
brj-23886	384	10	peer	peer	NOUN
brj-23886	384	11	-	-	PUNCT
brj-23886	384	12	reviewed	review	VERB
brj-23886	384	13	article	article	NOUN
brj-23886	384	14	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	VERB
brj-23886	384	15	cui	cui	PROPN
brj-23886	384	16	et	et	PROPN
brj-23886	384	17	al	al	PROPN
brj-23886	384	18	.	.	PROPN
brj-23886	385	1	(	(	PUNCT
brj-23886	385	2	2025	2025	NUM
brj-23886	385	3	)	)	PUNCT
brj-23886	385	4	.	.	PUNCT
brj-23886	386	1	“	"	PUNCT
brj-23886	386	2	genome	genome	NOUN
brj-23886	386	3	study	study	NOUN
brj-23886	386	4	of	of	ADP
brj-23886	386	5	c.	c.	PROPN
brj-23886	386	6	thermocellum	thermocellum	PROPN
brj-23886	386	7	,	,	PUNCT
brj-23886	386	8	”	"	PUNCT
brj-23886	386	9	bioresources	bioresource	NOUN
brj-23886	386	10	20(2	20(2	NUM
brj-23886	386	11	)	)	PUNCT
brj-23886	386	12	,	,	PUNCT
brj-23886	386	13	3155	3155	NUM
brj-23886	386	14	-	-	SYM
brj-23886	386	15	3175	3175	NUM
brj-23886	386	16	.	.	PUNCT
brj-23886	387	1	3175	3175	NUM
brj-23886	387	2	clostridium	clostridium	PROPN
brj-23886	387	3	thermocellum	thermocellum	PROPN
brj-23886	387	4	,	,	PUNCT
brj-23886	387	5	”	"	PUNCT
brj-23886	387	6	biotechnology	biotechnology	NOUN
brj-23886	387	7	for	for	ADP
brj-23886	387	8	biofuels	biofuel	NOUN
brj-23886	387	9	10	10	NUM
brj-23886	387	10	,	,	PUNCT
brj-23886	387	11	124	124	NUM
brj-23886	387	12	-	-	SYM
brj-23886	387	13	138	138	NUM
brj-23886	387	14	.	.	PUNCT
brj-23886	388	1	doi	doi	NOUN
brj-23886	388	2	:	:	PUNCT
brj-23886	388	3	10.1186	10.1186	NUM
brj-23886	388	4	/	/	SYM
brj-23886	388	5	s13068	s13068	VERB
brj-23886	388	6	-	-	PUNCT
brj-23886	388	7	017	017	NUM
brj-23886	388	8	-	-	PUNCT
brj-23886	388	9	0796	0796	NUM
brj-23886	388	10	-	-	PUNCT
brj-23886	388	11	y	y	PROPN
brj-23886	388	12	zheng	zheng	PROPN
brj-23886	388	13	,	,	PUNCT
brj-23886	388	14	x.	x.	PROPN
brj-23886	388	15	,	,	PUNCT
brj-23886	388	16	xian	xian	PROPN
brj-23886	388	17	,	,	PUNCT
brj-23886	388	18	x.	x.	PROPN
brj-23886	388	19	,	,	PUNCT
brj-23886	388	20	hu	hu	PROPN
brj-23886	388	21	,	,	PUNCT
brj-23886	388	22	l.	l.	PROPN
brj-23886	388	23	,	,	PUNCT
brj-23886	388	24	tao	tao	PROPN
brj-23886	388	25	,	,	PUNCT
brj-23886	388	26	s.	s.	PROPN
brj-23886	388	27	,	,	PUNCT
brj-23886	388	28	zhang	zhang	PROPN
brj-23886	388	29	,	,	PUNCT
brj-23886	388	30	x.	x.	PROPN
brj-23886	388	31	,	,	PUNCT
brj-23886	388	32	liu	liu	PROPN
brj-23886	388	33	,	,	PUNCT
brj-23886	388	34	y.	y.	PROPN
brj-23886	388	35	,	,	PUNCT
brj-23886	388	36	and	and	CCONJ
brj-23886	388	37	lin	lin	PROPN
brj-23886	388	38	,	,	PUNCT
brj-23886	388	39	x.	x.	NOUN
brj-23886	388	40	(	(	PUNCT
brj-23886	388	41	2021	2021	NUM
brj-23886	388	42	)	)	PUNCT
brj-23886	388	43	.	.	PUNCT
brj-23886	389	1	“	"	PUNCT
brj-23886	389	2	efficient	efficient	ADJ
brj-23886	389	3	short	short	ADJ
brj-23886	389	4	-	-	PUNCT
brj-23886	389	5	time	time	NOUN
brj-23886	389	6	hydrothermal	hydrothermal	NOUN
brj-23886	389	7	depolymerization	depolymerization	NOUN
brj-23886	389	8	of	of	ADP
brj-23886	389	9	sugarcane	sugarcane	NOUN
brj-23886	389	10	bagasse	bagasse	NOUN
brj-23886	389	11	in	in	ADP
brj-23886	389	12	one	one	NUM
brj-23886	389	13	-	-	PUNCT
brj-23886	389	14	pot	pot	NOUN
brj-23886	389	15	for	for	ADP
brj-23886	389	16	cellulosic	cellulosic	NOUN
brj-23886	389	17	ethanol	ethanol	NOUN
brj-23886	389	18	production	production	NOUN
brj-23886	389	19	without	without	ADP
brj-23886	389	20	solid	solid	ADJ
brj-23886	389	21	-	-	PUNCT
brj-23886	389	22	liquid	liquid	ADJ
brj-23886	389	23	separation	separation	NOUN
brj-23886	389	24	,	,	PUNCT
brj-23886	389	25	water	water	NOUN
brj-23886	389	26	washing	washing	NOUN
brj-23886	389	27	,	,	PUNCT
brj-23886	389	28	and	and	CCONJ
brj-23886	389	29	detoxification	detoxification	NOUN
brj-23886	389	30	,	,	PUNCT
brj-23886	389	31	”	"	PUNCT
brj-23886	389	32	bioresource	bioresource	ADJ
brj-23886	389	33	technology	technology	NOUN
brj-23886	389	34	339	339	NUM
brj-23886	389	35	,	,	PUNCT
brj-23886	389	36	article	article	NOUN
brj-23886	389	37	i	i	PROPN
brj-23886	389	38	d	d	PROPN
brj-23886	389	39	125575	125575	NUM
brj-23886	389	40	.	.	PUNCT
brj-23886	390	1	doi	doi	NOUN
brj-23886	390	2	:	:	PUNCT
brj-23886	390	3	10.1016	10.1016	NUM
brj-23886	390	4	/	/	SYM
brj-23886	390	5	j.biortech.2021.125575	j.biortech.2021.125575	ADJ
brj-23886	390	6	article	article	NOUN
brj-23886	390	7	submitted	submit	VERB
brj-23886	390	8	:	:	PUNCT
brj-23886	390	9	august	august	PROPN
brj-23886	390	10	08	08	NUM
brj-23886	390	11	,	,	PUNCT
brj-23886	390	12	2024	2024	NUM
brj-23886	390	13	;	;	PUNCT
brj-23886	390	14	peer	peer	NOUN
brj-23886	390	15	review	review	NOUN
brj-23886	390	16	completed	complete	VERB
brj-23886	390	17	:	:	PUNCT
brj-23886	390	18	november	november	PROPN
brj-23886	390	19	15	15	NUM
brj-23886	390	20	,	,	PUNCT
brj-23886	390	21	2024	2024	NUM
brj-23886	390	22	;	;	PUNCT
brj-23886	390	23	revised	revise	VERB
brj-23886	390	24	version	version	NOUN
brj-23886	390	25	received	receive	VERB
brj-23886	390	26	:	:	PUNCT
brj-23886	390	27	january	january	PROPN
brj-23886	390	28	5	5	NUM
brj-23886	390	29	,	,	PUNCT
brj-23886	390	30	2025	2025	NUM
brj-23886	390	31	;	;	PUNCT
brj-23886	390	32	accepted	accept	VERB
brj-23886	390	33	:	:	PUNCT
brj-23886	390	34	february	february	PROPN
brj-23886	390	35	23	23	NUM
brj-23886	390	36	,	,	PUNCT
brj-23886	390	37	2025	2025	NUM
brj-23886	390	38	;	;	PUNCT
brj-23886	390	39	published	publish	VERB
brj-23886	390	40	:	:	PUNCT
brj-23886	390	41	march	march	PROPN
brj-23886	390	42	7	7	NUM
brj-23886	390	43	,	,	PUNCT
brj-23886	390	44	2025	2025	NUM
brj-23886	390	45	.	.	PUNCT
brj-23886	391	1	doi	doi	NOUN
brj-23886	391	2	:	:	PUNCT
brj-23886	391	3	10.15376	10.15376	NUM
brj-23886	391	4	/	/	SYM
brj-23886	391	5	biores.20.2.3155	biores.20.2.3155	NOUN
brj-23886	391	6	-	-	NOUN
brj-23886	391	7	3175	3175	NUM