id	sid	tid	token	lemma	pos
brj-24352	1	1	peer	peer	NOUN
brj-24352	1	2	-	-	PUNCT
brj-24352	1	3	review	review	NOUN
brj-24352	1	4	article	article	NOUN
brj-24352	1	5	peer	peer	NOUN
brj-24352	1	6	-	-	PUNCT
brj-24352	1	7	reviewed	review	VERB
brj-24352	1	8	article	article	NOUN
brj-24352	1	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	1	10	ouyang	ouyang	PROPN
brj-24352	1	11	et	et	PROPN
brj-24352	1	12	al	al	PROPN
brj-24352	1	13	.	.	PROPN
brj-24352	2	1	(	(	PUNCT
brj-24352	2	2	2025	2025	NUM
brj-24352	2	3	)	)	PUNCT
brj-24352	2	4	.	.	PUNCT
brj-24352	3	1	“	"	PUNCT
brj-24352	3	2	rumen	ruman	NOUN
brj-24352	3	3	cellulase	cellulase	NOUN
brj-24352	3	4	&	&	CCONJ
brj-24352	3	5	ag	ag	PROPN
brj-24352	3	6	waste	waste	PROPN
brj-24352	3	7	,	,	PUNCT
brj-24352	3	8	”	"	PUNCT
brj-24352	3	9	bioresources	bioresource	NOUN
brj-24352	3	10	20(3	20(3	NOUN
brj-24352	3	11	)	)	PUNCT
brj-24352	3	12	,	,	PUNCT
brj-24352	3	13	5501	5501	NUM
brj-24352	3	14	-	-	SYM
brj-24352	3	15	5513	5513	NUM
brj-24352	3	16	.	.	PUNCT
brj-24352	4	1	5501	5501	NUM
brj-24352	4	2	characterization	characterization	NOUN
brj-24352	4	3	of	of	ADP
brj-24352	4	4	cellulase	cellulase	NOUN
brj-24352	4	5	from	from	ADP
brj-24352	4	6	the	the	DET
brj-24352	4	7	rumen	ruman	NOUN
brj-24352	4	8	metagenome	metagenome	ADJ
brj-24352	4	9	and	and	CCONJ
brj-24352	4	10	evaluation	evaluation	NOUN
brj-24352	4	11	of	of	ADP
brj-24352	4	12	its	its	PRON
brj-24352	4	13	hydrolytic	hydrolytic	ADJ
brj-24352	4	14	potential	potential	NOUN
brj-24352	4	15	for	for	ADP
brj-24352	4	16	agricultural	agricultural	ADJ
brj-24352	4	17	wastes	waste	NOUN
brj-24352	4	18	meng	meng	PROPN
brj-24352	4	19	ouyang	ouyang	PROPN
brj-24352	4	20	,	,	PUNCT
brj-24352	4	21	a	a	DET
brj-24352	4	22	chanjuan	chanjuan	PROPN
brj-24352	4	23	liu	liu	PROPN
brj-24352	4	24	,	,	PUNCT
brj-24352	4	25	a	a	DET
brj-24352	4	26	ping	ping	PROPN
brj-24352	4	27	sheng	sheng	PROPN
brj-24352	4	28	,	,	PUNCT
brj-24352	4	29	b	b	PROPN
brj-24352	4	30	qinghua	qinghua	PROPN
brj-24352	4	31	qiu	qiu	PROPN
brj-24352	4	32	,	,	PUNCT
brj-24352	4	33	a	a	DET
brj-24352	4	34	kehui	kehui	NOUN
brj-24352	4	35	ouyang	ouyang	PROPN
brj-24352	4	36	,	,	PUNCT
brj-24352	4	37	a	a	DET
brj-24352	4	38	yanjiao	yanjiao	NOUN
brj-24352	4	39	li	li	PROPN
brj-24352	4	40	,	,	PUNCT
brj-24352	4	41	a	a	DET
brj-24352	4	42	yitian	yitian	PROPN
brj-24352	4	43	zang	zang	PROPN
brj-24352	4	44	,	,	PUNCT
brj-24352	4	45	a	a	PRON
brj-24352	4	46	and	and	CCONJ
brj-24352	4	47	xianghui	xianghui	PROPN
brj-24352	4	48	zhao	zhao	PROPN
brj-24352	4	49	,	,	PUNCT
brj-24352	4	50	a	a	PRON
brj-24352	4	51	,	,	PUNCT
brj-24352	4	52	*	*	PUNCT
brj-24352	4	53	the	the	DET
brj-24352	4	54	cellulase	cellulase	NOUN
brj-24352	4	55	rucel224	rucel224	PROPN
brj-24352	4	56	,	,	PUNCT
brj-24352	4	57	derived	derive	VERB
brj-24352	4	58	from	from	ADP
brj-24352	4	59	the	the	DET
brj-24352	4	60	rumen	ruman	NOUN
brj-24352	4	61	metagenome	metagenome	PROPN
brj-24352	4	62	,	,	PUNCT
brj-24352	4	63	was	be	AUX
brj-24352	4	64	successfully	successfully	ADV
brj-24352	4	65	expressed	express	VERB
brj-24352	4	66	in	in	ADP
brj-24352	4	67	escherichia	escherichia	NOUN
brj-24352	4	68	coli	coli	NOUN
brj-24352	4	69	bl21(de3	bl21(de3	NOUN
brj-24352	4	70	)	)	PUNCT
brj-24352	4	71	,	,	PUNCT
brj-24352	4	72	with	with	ADP
brj-24352	4	73	a	a	DET
brj-24352	4	74	molecular	molecular	ADJ
brj-24352	4	75	weight	weight	NOUN
brj-24352	4	76	of	of	ADP
brj-24352	4	77	~43	~43	NOUN
brj-24352	4	78	kda	kda	NOUN
brj-24352	4	79	,	,	PUNCT
brj-24352	4	80	as	as	SCONJ
brj-24352	4	81	confirmed	confirm	VERB
brj-24352	4	82	by	by	ADP
brj-24352	4	83	sulfate	sulfate	NOUN
brj-24352	4	84	-	-	PUNCT
brj-24352	4	85	polyacrylamide	polyacrylamide	NOUN
brj-24352	4	86	gel	gel	NOUN
brj-24352	4	87	electrophoresis	electrophoresis	NOUN
brj-24352	4	88	(	(	PUNCT
brj-24352	4	89	sds	sds	NOUN
brj-24352	4	90	-	-	PUNCT
brj-24352	4	91	page	page	NOUN
brj-24352	4	92	)	)	PUNCT
brj-24352	4	93	analysis	analysis	NOUN
brj-24352	4	94	.	.	PUNCT
brj-24352	5	1	substrate	substrate	NOUN
brj-24352	5	2	specificity	specificity	NOUN
brj-24352	5	3	assays	assay	NOUN
brj-24352	5	4	revealed	reveal	VERB
brj-24352	5	5	the	the	DET
brj-24352	5	6	highest	high	ADJ
brj-24352	5	7	activity	activity	NOUN
brj-24352	5	8	against	against	ADP
brj-24352	5	9	sodium	sodium	NOUN
brj-24352	5	10	carboxymethyl	carboxymethyl	NOUN
brj-24352	5	11	cellulose	cellulose	NOUN
brj-24352	5	12	(	(	PUNCT
brj-24352	5	13	cmc	cmc	NOUN
brj-24352	5	14	-	-	PUNCT
brj-24352	5	15	na	na	NOUN
brj-24352	5	16	)	)	PUNCT
brj-24352	5	17	(	(	PUNCT
brj-24352	5	18	0.861	0.861	NUM
brj-24352	5	19	±	±	NUM
brj-24352	5	20	0.011	0.011	NUM
brj-24352	5	21	u	u	NOUN
brj-24352	5	22	/	/	SYM
brj-24352	5	23	mg	mg	PROPN
brj-24352	5	24	)	)	PUNCT
brj-24352	5	25	,	,	PUNCT
brj-24352	5	26	followed	follow	VERB
brj-24352	5	27	by	by	ADP
brj-24352	5	28	wheat	wheat	NOUN
brj-24352	5	29	straw	straw	NOUN
brj-24352	5	30	xylan	xylan	PROPN
brj-24352	5	31	(	(	PUNCT
brj-24352	5	32	0.150	0.150	NUM
brj-24352	5	33	±	±	NUM
brj-24352	5	34	0.050	0.050	NUM
brj-24352	5	35	u	u	NOUN
brj-24352	5	36	/	/	SYM
brj-24352	5	37	mg	mg	PROPN
brj-24352	5	38	)	)	PUNCT
brj-24352	5	39	.	.	PUNCT
brj-24352	6	1	rucel224	rucel224	PROPN
brj-24352	6	2	exhibited	exhibit	VERB
brj-24352	6	3	optimal	optimal	ADJ
brj-24352	6	4	activity	activity	NOUN
brj-24352	6	5	at	at	ADP
brj-24352	6	6	ph	ph	PROPN
brj-24352	6	7	5.0	5.0	NUM
brj-24352	6	8	and	and	CCONJ
brj-24352	6	9	35	35	NUM
brj-24352	6	10	°	°	NOUN
brj-24352	6	11	c	c	NOUN
brj-24352	6	12	,	,	PUNCT
brj-24352	6	13	retaining	retain	VERB
brj-24352	6	14	over	over	ADP
brj-24352	6	15	70	70	NUM
brj-24352	6	16	%	%	NOUN
brj-24352	6	17	activity	activity	NOUN
brj-24352	6	18	between	between	ADP
brj-24352	6	19	ph	ph	PROPN
brj-24352	6	20	5.0	5.0	NUM
brj-24352	6	21	and	and	CCONJ
brj-24352	6	22	7.0	7.0	NUM
brj-24352	6	23	and	and	CCONJ
brj-24352	6	24	80	80	NUM
brj-24352	6	25	%	%	NOUN
brj-24352	6	26	activity	activity	NOUN
brj-24352	6	27	within	within	ADP
brj-24352	6	28	the	the	DET
brj-24352	6	29	temperature	temperature	NOUN
brj-24352	6	30	range	range	NOUN
brj-24352	6	31	of	of	ADP
brj-24352	6	32	20	20	NUM
brj-24352	6	33	to	to	PART
brj-24352	6	34	40	40	NUM
brj-24352	6	35	°	°	NOUN
brj-24352	6	36	c	c	X
brj-24352	6	37	.	.	PUNCT
brj-24352	7	1	thermal	thermal	ADJ
brj-24352	7	2	stability	stability	NOUN
brj-24352	7	3	tests	test	NOUN
brj-24352	7	4	showed	show	VERB
brj-24352	7	5	that	that	SCONJ
brj-24352	7	6	rucel224	rucel224	PROPN
brj-24352	7	7	retained	retain	VERB
brj-24352	7	8	80	80	NUM
brj-24352	7	9	%	%	NOUN
brj-24352	7	10	activity	activity	NOUN
brj-24352	7	11	after	after	ADP
brj-24352	7	12	30	30	NUM
brj-24352	7	13	min	min	NOUN
brj-24352	7	14	at	at	ADP
brj-24352	7	15	50	50	NUM
brj-24352	7	16	°	°	NOUN
brj-24352	7	17	c	c	NOUN
brj-24352	7	18	.	.	PUNCT
brj-24352	8	1	metal	metal	NOUN
brj-24352	8	2	ion	ion	NOUN
brj-24352	8	3	analysis	analysis	NOUN
brj-24352	8	4	demonstrated	demonstrate	VERB
brj-24352	8	5	that	that	SCONJ
brj-24352	8	6	mn²⁺	mn²⁺	NOUN
brj-24352	8	7	significantly	significantly	ADV
brj-24352	8	8	enhanced	enhance	VERB
brj-24352	8	9	rucel224	rucel224	PROPN
brj-24352	8	10	activity	activity	NOUN
brj-24352	8	11	by	by	ADP
brj-24352	8	12	68.5	68.5	NUM
brj-24352	8	13	%	%	NOUN
brj-24352	8	14	and	and	CCONJ
brj-24352	8	15	83.1	83.1	NUM
brj-24352	8	16	%	%	NOUN
brj-24352	8	17	at	at	ADP
brj-24352	8	18	1	1	NUM
brj-24352	8	19	mm	mm	NOUN
brj-24352	8	20	and	and	CCONJ
brj-24352	8	21	5	5	NUM
brj-24352	8	22	mm	mm	NOUN
brj-24352	8	23	concentrations	concentration	NOUN
brj-24352	8	24	,	,	PUNCT
brj-24352	8	25	respectively	respectively	ADV
brj-24352	8	26	.	.	PUNCT
brj-24352	9	1	hydrolysis	hydrolysis	NOUN
brj-24352	9	2	efficiency	efficiency	NOUN
brj-24352	9	3	on	on	ADP
brj-24352	9	4	lignocellulosic	lignocellulosic	ADJ
brj-24352	9	5	substrates	substrate	NOUN
brj-24352	9	6	revealed	reveal	VERB
brj-24352	9	7	the	the	DET
brj-24352	9	8	highest	high	ADJ
brj-24352	9	9	reducing	reduce	VERB
brj-24352	9	10	sugar	sugar	NOUN
brj-24352	9	11	release	release	NOUN
brj-24352	9	12	from	from	ADP
brj-24352	9	13	corn	corn	NOUN
brj-24352	9	14	stalk	stalk	NOUN
brj-24352	9	15	(	(	PUNCT
brj-24352	9	16	206.21	206.21	NUM
brj-24352	9	17	±	±	NUM
brj-24352	9	18	19.11	19.11	NUM
brj-24352	9	19	μg	μg	NOUN
brj-24352	9	20	/	/	SYM
brj-24352	9	21	ml	ml	NOUN
brj-24352	9	22	)	)	PUNCT
brj-24352	9	23	,	,	PUNCT
brj-24352	9	24	followed	follow	VERB
brj-24352	9	25	by	by	ADP
brj-24352	9	26	wheat	wheat	NOUN
brj-24352	9	27	bran	bran	NOUN
brj-24352	9	28	(	(	PUNCT
brj-24352	9	29	106.63	106.63	NUM
brj-24352	9	30	±	±	NUM
brj-24352	9	31	20.08	20.08	NUM
brj-24352	9	32	μg	μg	NOUN
brj-24352	9	33	/	/	SYM
brj-24352	9	34	ml	ml	NOUN
brj-24352	9	35	)	)	PUNCT
brj-24352	9	36	and	and	CCONJ
brj-24352	9	37	rapeseed	rapeseed	NOUN
brj-24352	9	38	straw	straw	NOUN
brj-24352	9	39	(	(	PUNCT
brj-24352	9	40	93.83	93.83	NUM
brj-24352	9	41	±	±	NUM
brj-24352	9	42	3.57	3.57	NUM
brj-24352	9	43	μg	μg	PROPN
brj-24352	9	44	/	/	SYM
brj-24352	9	45	ml	ml	NOUN
brj-24352	9	46	)	)	PUNCT
brj-24352	9	47	.	.	PUNCT
brj-24352	10	1	overall	overall	ADV
brj-24352	10	2	,	,	PUNCT
brj-24352	10	3	rucel224	rucel224	PROPN
brj-24352	10	4	is	be	AUX
brj-24352	10	5	a	a	DET
brj-24352	10	6	highly	highly	ADV
brj-24352	10	7	versatile	versatile	ADJ
brj-24352	10	8	cellulase	cellulase	NOUN
brj-24352	10	9	under	under	ADP
brj-24352	10	10	mild	mild	ADJ
brj-24352	10	11	conditions	condition	NOUN
brj-24352	10	12	,	,	PUNCT
brj-24352	10	13	demonstrating	demonstrate	VERB
brj-24352	10	14	strong	strong	ADJ
brj-24352	10	15	adaptability	adaptability	NOUN
brj-24352	10	16	to	to	ADP
brj-24352	10	17	agricultural	agricultural	ADJ
brj-24352	10	18	residues	residue	NOUN
brj-24352	10	19	.	.	PUNCT
brj-24352	11	1	its	its	PRON
brj-24352	11	2	superior	superior	ADJ
brj-24352	11	3	performance	performance	NOUN
brj-24352	11	4	on	on	ADP
brj-24352	11	5	corn	corn	NOUN
brj-24352	11	6	stalk	stalk	NOUN
brj-24352	11	7	highlights	highlight	NOUN
brj-24352	11	8	its	its	PRON
brj-24352	11	9	potential	potential	NOUN
brj-24352	11	10	for	for	ADP
brj-24352	11	11	bioethanol	bioethanol	NOUN
brj-24352	11	12	production	production	NOUN
brj-24352	11	13	and	and	CCONJ
brj-24352	11	14	other	other	ADJ
brj-24352	11	15	biomass	biomass	NOUN
brj-24352	11	16	valorization	valorization	NOUN
brj-24352	11	17	processes	process	NOUN
brj-24352	11	18	.	.	PUNCT
brj-24352	12	1	doi	doi	NOUN
brj-24352	12	2	:	:	PUNCT
brj-24352	12	3	10.15376	10.15376	NUM
brj-24352	12	4	/	/	SYM
brj-24352	12	5	biores.20.3.5501	biores.20.3.5501	ADJ
brj-24352	12	6	-	-	PUNCT
brj-24352	12	7	5513	5513	NUM
brj-24352	12	8	keywords	keyword	NOUN
brj-24352	12	9	:	:	PUNCT
brj-24352	12	10	rumen	ruman	NOUN
brj-24352	12	11	metagenome	metagenome	ADJ
brj-24352	12	12	;	;	PUNCT
brj-24352	12	13	cellulases	cellulase	NOUN
brj-24352	12	14	;	;	PUNCT
brj-24352	12	15	enzymatic	enzymatic	ADJ
brj-24352	12	16	properties	property	NOUN
brj-24352	12	17	;	;	PUNCT
brj-24352	12	18	agricultural	agricultural	ADJ
brj-24352	12	19	wastes	waste	NOUN
brj-24352	12	20	contact	contact	NOUN
brj-24352	12	21	information	information	NOUN
brj-24352	12	22	:	:	PUNCT
brj-24352	12	23	a	a	DET
brj-24352	12	24	:	:	PUNCT
brj-24352	12	25	jiangxi	jiangxi	PROPN
brj-24352	12	26	province	province	PROPN
brj-24352	12	27	key	key	PROPN
brj-24352	12	28	laboratory	laboratory	NOUN
brj-24352	12	29	of	of	ADP
brj-24352	12	30	animal	animal	NOUN
brj-24352	12	31	nutrition	nutrition	NOUN
brj-24352	12	32	/	/	SYM
brj-24352	12	33	engineering	engineering	NOUN
brj-24352	12	34	research	research	NOUN
brj-24352	12	35	center	center	NOUN
brj-24352	12	36	of	of	ADP
brj-24352	12	37	feed	feed	NOUN
brj-24352	12	38	development	development	NOUN
brj-24352	12	39	,	,	PUNCT
brj-24352	12	40	jiangxi	jiangxi	PROPN
brj-24352	12	41	agricultural	agricultural	PROPN
brj-24352	12	42	university	university	PROPN
brj-24352	12	43	,	,	PUNCT
brj-24352	12	44	nanchang	nanchang	PROPN
brj-24352	12	45	jiangxi	jiangxi	PROPN
brj-24352	12	46	330045	330045	NUM
brj-24352	12	47	,	,	PUNCT
brj-24352	12	48	china	china	PROPN
brj-24352	12	49	;	;	PUNCT
brj-24352	12	50	b	b	X
brj-24352	12	51	:	:	PUNCT
brj-24352	12	52	jiangxi	jiangxi	PROPN
brj-24352	12	53	provincial	provincial	PROPN
brj-24352	12	54	academy	academy	PROPN
brj-24352	12	55	of	of	ADP
brj-24352	12	56	sciences	sciences	PROPN
brj-24352	12	57	,	,	PUNCT
brj-24352	12	58	institute	institute	NOUN
brj-24352	12	59	of	of	ADP
brj-24352	12	60	microbiology	microbiology	NOUN
brj-24352	12	61	,	,	PUNCT
brj-24352	12	62	nanchang	nanchang	PROPN
brj-24352	12	63	jiangxi	jiangxi	PROPN
brj-24352	12	64	330096	330096	NUM
brj-24352	12	65	,	,	PUNCT
brj-24352	12	66	china	china	PROPN
brj-24352	12	67	;	;	PUNCT
brj-24352	12	68	*	*	PUNCT
brj-24352	12	69	corresponding	correspond	VERB
brj-24352	12	70	author	author	NOUN
brj-24352	12	71	:	:	PUNCT
brj-24352	12	72	zhaoxh001@163.com	zhaoxh001@163.com	NOUN
brj-24352	13	1	introduction	introduction	NOUN
brj-24352	13	2	the	the	DET
brj-24352	13	3	growing	grow	VERB
brj-24352	13	4	worldwide	worldwide	ADJ
brj-24352	13	5	need	need	NOUN
brj-24352	13	6	for	for	ADP
brj-24352	13	7	renewable	renewable	ADJ
brj-24352	13	8	energy	energy	NOUN
brj-24352	13	9	and	and	CCONJ
brj-24352	13	10	the	the	DET
brj-24352	13	11	pressing	press	VERB
brj-24352	13	12	necessity	necessity	NOUN
brj-24352	13	13	to	to	PART
brj-24352	13	14	decrease	decrease	VERB
brj-24352	13	15	reliance	reliance	NOUN
brj-24352	13	16	on	on	ADP
brj-24352	13	17	fossil	fossil	ADJ
brj-24352	13	18	fuels	fuel	NOUN
brj-24352	13	19	have	have	AUX
brj-24352	13	20	highlighted	highlight	VERB
brj-24352	13	21	lignocellulosic	lignocellulosic	ADJ
brj-24352	13	22	biomass	biomass	NOUN
brj-24352	13	23	as	as	ADP
brj-24352	13	24	a	a	DET
brj-24352	13	25	key	key	ADJ
brj-24352	13	26	focus	focus	NOUN
brj-24352	13	27	in	in	ADP
brj-24352	13	28	sustainable	sustainable	ADJ
brj-24352	13	29	resource	resource	NOUN
brj-24352	13	30	studies	study	NOUN
brj-24352	13	31	.	.	PUNCT
brj-24352	14	1	as	as	ADP
brj-24352	14	2	earth	earth	NOUN
brj-24352	14	3	’s	’s	PART
brj-24352	14	4	most	most	ADV
brj-24352	14	5	plentiful	plentiful	ADJ
brj-24352	14	6	renewable	renewable	ADJ
brj-24352	14	7	organic	organic	ADJ
brj-24352	14	8	material	material	NOUN
brj-24352	14	9	,	,	PUNCT
brj-24352	14	10	lignocellulose	lignocellulose	VERB
brj-24352	14	11	plays	play	VERB
brj-24352	14	12	a	a	DET
brj-24352	14	13	vital	vital	ADJ
brj-24352	14	14	role	role	NOUN
brj-24352	14	15	as	as	ADP
brj-24352	14	16	a	a	DET
brj-24352	14	17	feedstock	feedstock	NOUN
brj-24352	14	18	for	for	ADP
brj-24352	14	19	bioenergy	bioenergy	NOUN
brj-24352	14	20	and	and	CCONJ
brj-24352	14	21	bioproducts	bioproduct	NOUN
brj-24352	14	22	(	(	PUNCT
brj-24352	14	23	isikgor	isikgor	ADJ
brj-24352	14	24	and	and	CCONJ
brj-24352	14	25	becer	becer	NOUN
brj-24352	14	26	2015	2015	NUM
brj-24352	14	27	;	;	PUNCT
brj-24352	14	28	fatma	fatma	PROPN
brj-24352	14	29	et	et	PROPN
brj-24352	14	30	al	al	PROPN
brj-24352	14	31	.	.	PROPN
brj-24352	14	32	2018	2018	NUM
brj-24352	14	33	)	)	PUNCT
brj-24352	14	34	.	.	PUNCT
brj-24352	15	1	structurally	structurally	ADV
brj-24352	15	2	,	,	PUNCT
brj-24352	15	3	it	it	PRON
brj-24352	15	4	is	be	AUX
brj-24352	15	5	composed	compose	VERB
brj-24352	15	6	of	of	ADP
brj-24352	15	7	three	three	NUM
brj-24352	15	8	primary	primary	ADJ
brj-24352	15	9	components	component	NOUN
brj-24352	15	10	:	:	PUNCT
brj-24352	15	11	cellulose	cellulose	NOUN
brj-24352	15	12	,	,	PUNCT
brj-24352	15	13	hemicellulose	hemicellulose	NOUN
brj-24352	15	14	,	,	PUNCT
brj-24352	15	15	and	and	CCONJ
brj-24352	15	16	lignin	lignin	PROPN
brj-24352	15	17	,	,	PUNCT
brj-24352	15	18	which	which	PRON
brj-24352	15	19	form	form	VERB
brj-24352	15	20	a	a	DET
brj-24352	15	21	complex	complex	ADJ
brj-24352	15	22	and	and	CCONJ
brj-24352	15	23	recalcitrant	recalcitrant	ADJ
brj-24352	15	24	matrix	matrix	NOUN
brj-24352	15	25	in	in	ADP
brj-24352	15	26	plant	plant	NOUN
brj-24352	15	27	cell	cell	NOUN
brj-24352	15	28	walls	wall	NOUN
brj-24352	15	29	.	.	PUNCT
brj-24352	16	1	these	these	DET
brj-24352	16	2	structural	structural	ADJ
brj-24352	16	3	features	feature	NOUN
brj-24352	16	4	,	,	PUNCT
brj-24352	16	5	while	while	SCONJ
brj-24352	16	6	providing	provide	VERB
brj-24352	16	7	mechanical	mechanical	ADJ
brj-24352	16	8	strength	strength	NOUN
brj-24352	16	9	to	to	ADP
brj-24352	16	10	plants	plant	NOUN
brj-24352	16	11	,	,	PUNCT
brj-24352	16	12	present	present	ADJ
brj-24352	16	13	significant	significant	ADJ
brj-24352	16	14	challenges	challenge	NOUN
brj-24352	16	15	for	for	ADP
brj-24352	16	16	efficient	efficient	ADJ
brj-24352	16	17	biomass	biomass	NOUN
brj-24352	16	18	conversion	conversion	NOUN
brj-24352	16	19	(	(	PUNCT
brj-24352	16	20	chen	chen	PROPN
brj-24352	16	21	and	and	CCONJ
brj-24352	16	22	chen	chen	PROPN
brj-24352	16	23	2014	2014	NUM
brj-24352	16	24	;	;	PUNCT
brj-24352	16	25	andlar	andlar	PROPN
brj-24352	16	26	et	et	PROPN
brj-24352	16	27	al	al	PROPN
brj-24352	16	28	.	.	PROPN
brj-24352	16	29	2018	2018	NUM
brj-24352	16	30	)	)	PUNCT
brj-24352	16	31	.	.	PUNCT
brj-24352	17	1	efficiently	efficiently	ADV
brj-24352	17	2	unlocking	unlock	VERB
brj-24352	17	3	the	the	DET
brj-24352	17	4	potential	potential	NOUN
brj-24352	17	5	of	of	ADP
brj-24352	17	6	lignocellulose	lignocellulose	ADJ
brj-24352	17	7	is	be	AUX
brj-24352	17	8	pivotal	pivotal	ADJ
brj-24352	17	9	for	for	ADP
brj-24352	17	10	addressing	address	VERB
brj-24352	17	11	environmental	environmental	ADJ
brj-24352	17	12	challenges	challenge	NOUN
brj-24352	17	13	,	,	PUNCT
brj-24352	17	14	such	such	ADJ
brj-24352	17	15	as	as	ADP
brj-24352	17	16	greenhouse	greenhouse	NOUN
brj-24352	17	17	gas	gas	NOUN
brj-24352	17	18	emissions	emission	NOUN
brj-24352	17	19	,	,	PUNCT
brj-24352	17	20	and	and	CCONJ
brj-24352	17	21	for	for	ADP
brj-24352	17	22	advancing	advance	VERB
brj-24352	17	23	the	the	DET
brj-24352	17	24	development	development	NOUN
brj-24352	17	25	of	of	ADP
brj-24352	17	26	bio	bio	NOUN
brj-24352	17	27	-	-	PUNCT
brj-24352	17	28	based	base	VERB
brj-24352	17	29	economies	economy	NOUN
brj-24352	17	30	.	.	PUNCT
brj-24352	18	1	among	among	ADP
brj-24352	18	2	the	the	DET
brj-24352	18	3	diverse	diverse	ADJ
brj-24352	18	4	lignocellulosic	lignocellulosic	ADJ
brj-24352	18	5	resources	resource	NOUN
brj-24352	18	6	,	,	PUNCT
brj-24352	18	7	agricultural	agricultural	ADJ
brj-24352	18	8	residues	residue	NOUN
brj-24352	18	9	,	,	PUNCT
brj-24352	18	10	particularly	particularly	ADV
brj-24352	18	11	agricultural	agricultural	ADJ
brj-24352	18	12	wastes	waste	NOUN
brj-24352	18	13	,	,	PUNCT
brj-24352	18	14	represent	represent	VERB
brj-24352	18	15	a	a	DET
brj-24352	18	16	vast	vast	ADJ
brj-24352	18	17	and	and	CCONJ
brj-24352	18	18	underutilized	underutilized	ADJ
brj-24352	18	19	peer	peer	NOUN
brj-24352	18	20	-	-	PUNCT
brj-24352	18	21	reviewed	review	VERB
brj-24352	18	22	article	article	NOUN
brj-24352	18	23	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	18	24	ouyang	ouyang	PROPN
brj-24352	18	25	et	et	PROPN
brj-24352	18	26	al	al	PROPN
brj-24352	18	27	.	.	PROPN
brj-24352	19	1	(	(	PUNCT
brj-24352	19	2	2025	2025	NUM
brj-24352	19	3	)	)	PUNCT
brj-24352	19	4	.	.	PUNCT
brj-24352	20	1	“	"	PUNCT
brj-24352	20	2	rumen	ruman	NOUN
brj-24352	20	3	cellulase	cellulase	NOUN
brj-24352	20	4	&	&	CCONJ
brj-24352	20	5	ag	ag	PROPN
brj-24352	20	6	waste	waste	PROPN
brj-24352	20	7	,	,	PUNCT
brj-24352	20	8	”	"	PUNCT
brj-24352	20	9	bioresources	bioresource	NOUN
brj-24352	20	10	20(3	20(3	NOUN
brj-24352	20	11	)	)	PUNCT
brj-24352	20	12	,	,	PUNCT
brj-24352	20	13	5501	5501	NUM
brj-24352	20	14	-	-	SYM
brj-24352	20	15	5513	5513	NUM
brj-24352	20	16	.	.	PUNCT
brj-24352	21	1	5502	5502	NUM
brj-24352	21	2	resource	resource	NOUN
brj-24352	21	3	(	(	PUNCT
brj-24352	21	4	marriott	marriott	PROPN
brj-24352	21	5	et	et	PROPN
brj-24352	21	6	al	al	PROPN
brj-24352	21	7	.	.	PROPN
brj-24352	21	8	2016	2016	NUM
brj-24352	21	9	;	;	PUNCT
brj-24352	21	10	seglah	seglah	VERB
brj-24352	21	11	et	et	PROPN
brj-24352	21	12	al	al	PROPN
brj-24352	21	13	.	.	PROPN
brj-24352	21	14	2019	2019	NUM
brj-24352	21	15	)	)	PUNCT
brj-24352	21	16	.	.	PUNCT
brj-24352	22	1	these	these	DET
brj-24352	22	2	residues	residue	NOUN
brj-24352	22	3	,	,	PUNCT
brj-24352	22	4	characterized	characterize	VERB
brj-24352	22	5	by	by	ADP
brj-24352	22	6	high	high	ADJ
brj-24352	22	7	cellulose	cellulose	NOUN
brj-24352	22	8	and	and	CCONJ
brj-24352	22	9	hemicellulose	hemicellulose	NOUN
brj-24352	22	10	content	content	NOUN
brj-24352	22	11	,	,	PUNCT
brj-24352	22	12	are	be	AUX
brj-24352	22	13	produced	produce	VERB
brj-24352	22	14	in	in	ADP
brj-24352	22	15	significant	significant	ADJ
brj-24352	22	16	quantities	quantity	NOUN
brj-24352	22	17	globally	globally	ADV
brj-24352	22	18	.	.	PUNCT
brj-24352	23	1	however	however	ADV
brj-24352	23	2	,	,	PUNCT
brj-24352	23	3	their	their	PRON
brj-24352	23	4	dense	dense	ADJ
brj-24352	23	5	crystalline	crystalline	NOUN
brj-24352	23	6	structure	structure	NOUN
brj-24352	23	7	and	and	CCONJ
brj-24352	23	8	close	close	ADJ
brj-24352	23	9	association	association	NOUN
brj-24352	23	10	with	with	ADP
brj-24352	23	11	lignin	lignin	PROPN
brj-24352	23	12	pose	pose	VERB
brj-24352	23	13	significant	significant	ADJ
brj-24352	23	14	barriers	barrier	NOUN
brj-24352	23	15	to	to	ADP
brj-24352	23	16	enzymatic	enzymatic	ADJ
brj-24352	23	17	hydrolysis	hydrolysis	NOUN
brj-24352	23	18	,	,	PUNCT
brj-24352	23	19	limiting	limit	VERB
brj-24352	23	20	their	their	PRON
brj-24352	23	21	direct	direct	ADJ
brj-24352	23	22	utilization	utilization	NOUN
brj-24352	23	23	as	as	ADP
brj-24352	23	24	a	a	DET
brj-24352	23	25	feedstock	feedstock	NOUN
brj-24352	23	26	for	for	ADP
brj-24352	23	27	bioenergy	bioenergy	NOUN
brj-24352	23	28	and	and	CCONJ
brj-24352	23	29	biochemical	biochemical	ADJ
brj-24352	23	30	production	production	NOUN
brj-24352	23	31	(	(	PUNCT
brj-24352	23	32	beig	beig	PROPN
brj-24352	23	33	et	et	PROPN
brj-24352	23	34	al	al	PROPN
brj-24352	23	35	.	.	PROPN
brj-24352	23	36	2021	2021	NUM
brj-24352	23	37	)	)	PUNCT
brj-24352	23	38	.	.	PUNCT
brj-24352	24	1	developing	develop	VERB
brj-24352	24	2	efficient	efficient	ADJ
brj-24352	24	3	methods	method	NOUN
brj-24352	24	4	to	to	PART
brj-24352	24	5	overcome	overcome	VERB
brj-24352	24	6	these	these	DET
brj-24352	24	7	recalcitrance	recalcitrance	NOUN
brj-24352	24	8	challenges	challenge	NOUN
brj-24352	24	9	remains	remain	VERB
brj-24352	24	10	a	a	DET
brj-24352	24	11	cornerstone	cornerstone	NOUN
brj-24352	24	12	of	of	ADP
brj-24352	24	13	lignocellulosic	lignocellulosic	ADJ
brj-24352	24	14	biomass	biomass	NOUN
brj-24352	24	15	research	research	NOUN
brj-24352	24	16	.	.	PUNCT
brj-24352	25	1	enzymatic	enzymatic	ADJ
brj-24352	25	2	hydrolysis	hydrolysis	NOUN
brj-24352	25	3	has	have	AUX
brj-24352	25	4	emerged	emerge	VERB
brj-24352	25	5	as	as	ADP
brj-24352	25	6	a	a	DET
brj-24352	25	7	highly	highly	ADV
brj-24352	25	8	promising	promising	ADJ
brj-24352	25	9	approach	approach	NOUN
brj-24352	25	10	to	to	PART
brj-24352	25	11	lignocellulose	lignocellulose	VERB
brj-24352	25	12	bioconversion	bioconversion	NOUN
brj-24352	25	13	(	(	PUNCT
brj-24352	25	14	zhang	zhang	PROPN
brj-24352	25	15	et	et	PROPN
brj-24352	25	16	al	al	PROPN
brj-24352	25	17	.	.	PROPN
brj-24352	25	18	2012	2012	NUM
brj-24352	25	19	)	)	PUNCT
brj-24352	25	20	.	.	PUNCT
brj-24352	26	1	cellulases	cellulase	NOUN
brj-24352	26	2	and	and	CCONJ
brj-24352	26	3	hemicellulases	hemicellulase	NOUN
brj-24352	26	4	,	,	PUNCT
brj-24352	26	5	as	as	ADP
brj-24352	26	6	key	key	ADJ
brj-24352	26	7	biocatalysts	biocatalyst	NOUN
brj-24352	26	8	,	,	PUNCT
brj-24352	26	9	play	play	VERB
brj-24352	26	10	a	a	DET
brj-24352	26	11	pivotal	pivotal	ADJ
brj-24352	26	12	role	role	NOUN
brj-24352	26	13	in	in	ADP
brj-24352	26	14	degrading	degrade	VERB
brj-24352	26	15	cellulose	cellulose	NOUN
brj-24352	26	16	and	and	CCONJ
brj-24352	26	17	hemicellulose	hemicellulose	NOUN
brj-24352	26	18	into	into	ADP
brj-24352	26	19	fermentable	fermentable	ADJ
brj-24352	26	20	sugars	sugar	NOUN
brj-24352	26	21	under	under	ADP
brj-24352	26	22	mild	mild	ADJ
brj-24352	26	23	reaction	reaction	NOUN
brj-24352	26	24	conditions	condition	NOUN
brj-24352	26	25	(	(	PUNCT
brj-24352	26	26	xiao	xiao	PROPN
brj-24352	26	27	et	et	PROPN
brj-24352	26	28	al	al	PROPN
brj-24352	26	29	.	.	PROPN
brj-24352	26	30	2024	2024	NUM
brj-24352	26	31	)	)	PUNCT
brj-24352	26	32	.	.	PUNCT
brj-24352	27	1	cellulase	cellulase	NOUN
brj-24352	27	2	,	,	PUNCT
brj-24352	27	3	including	include	VERB
brj-24352	27	4	endoglucanase	endoglucanase	NOUN
brj-24352	27	5	,	,	PUNCT
brj-24352	27	6	exoglucanase	exoglucanase	NOUN
brj-24352	27	7	,	,	PUNCT
brj-24352	27	8	and	and	CCONJ
brj-24352	27	9	β	β	X
brj-24352	27	10	-	-	NOUN
brj-24352	27	11	glucosidase	glucosidase	ADJ
brj-24352	27	12	,	,	PUNCT
brj-24352	27	13	catalyzes	catalyze	VERB
brj-24352	27	14	the	the	DET
brj-24352	27	15	depolymerization	depolymerization	NOUN
brj-24352	27	16	of	of	ADP
brj-24352	27	17	cellulose	cellulose	NOUN
brj-24352	27	18	chains	chain	NOUN
brj-24352	27	19	,	,	PUNCT
brj-24352	27	20	while	while	SCONJ
brj-24352	27	21	xylanase	xylanase	PRON
brj-24352	27	22	specifically	specifically	ADV
brj-24352	27	23	targets	target	VERB
brj-24352	27	24	the	the	DET
brj-24352	27	25	xylan	xylan	NOUN
brj-24352	27	26	backbone	backbone	NOUN
brj-24352	27	27	of	of	ADP
brj-24352	27	28	hemicellulose	hemicellulose	NOUN
brj-24352	27	29	(	(	PUNCT
brj-24352	27	30	beg	beg	VERB
brj-24352	27	31	et	et	PROPN
brj-24352	27	32	al	al	PROPN
brj-24352	27	33	.	.	PROPN
brj-24352	27	34	2001	2001	NUM
brj-24352	27	35	;	;	PUNCT
brj-24352	27	36	jayasekara	jayasekara	PROPN
brj-24352	27	37	and	and	CCONJ
brj-24352	27	38	ratnayake	ratnayake	VERB
brj-24352	27	39	2019	2019	NUM
brj-24352	27	40	)	)	PUNCT
brj-24352	27	41	.	.	PUNCT
brj-24352	28	1	despite	despite	SCONJ
brj-24352	28	2	their	their	PRON
brj-24352	28	3	potential	potential	NOUN
brj-24352	28	4	,	,	PUNCT
brj-24352	28	5	the	the	DET
brj-24352	28	6	efficiency	efficiency	NOUN
brj-24352	28	7	of	of	ADP
brj-24352	28	8	enzymatic	enzymatic	ADJ
brj-24352	28	9	hydrolysis	hydrolysis	NOUN
brj-24352	28	10	in	in	ADP
brj-24352	28	11	real	real	ADJ
brj-24352	28	12	-	-	PUNCT
brj-24352	28	13	world	world	NOUN
brj-24352	28	14	applications	application	NOUN
brj-24352	28	15	is	be	AUX
brj-24352	28	16	often	often	ADV
brj-24352	28	17	hindered	hinder	VERB
brj-24352	28	18	by	by	ADP
brj-24352	28	19	enzyme	enzyme	NOUN
brj-24352	28	20	instability	instability	NOUN
brj-24352	28	21	,	,	PUNCT
brj-24352	28	22	substrate	substrate	NOUN
brj-24352	28	23	heterogeneity	heterogeneity	NOUN
brj-24352	28	24	,	,	PUNCT
brj-24352	28	25	and	and	CCONJ
brj-24352	28	26	inhibitory	inhibitory	ADJ
brj-24352	28	27	by	by	ADP
brj-24352	28	28	-	-	PUNCT
brj-24352	28	29	products	product	NOUN
brj-24352	28	30	(	(	PUNCT
brj-24352	28	31	agrawal	agrawal	PROPN
brj-24352	28	32	et	et	PROPN
brj-24352	28	33	al	al	PROPN
brj-24352	28	34	.	.	PROPN
brj-24352	28	35	2021	2021	NUM
brj-24352	28	36	)	)	PUNCT
brj-24352	28	37	,	,	PUNCT
brj-24352	28	38	underscoring	underscore	VERB
brj-24352	28	39	the	the	DET
brj-24352	28	40	need	need	NOUN
brj-24352	28	41	for	for	ADP
brj-24352	28	42	robust	robust	ADJ
brj-24352	28	43	and	and	CCONJ
brj-24352	28	44	highly	highly	ADV
brj-24352	28	45	active	active	ADJ
brj-24352	28	46	enzymes	enzyme	NOUN
brj-24352	28	47	.	.	PUNCT
brj-24352	29	1	in	in	ADP
brj-24352	29	2	nature	nature	NOUN
brj-24352	29	3	,	,	PUNCT
brj-24352	29	4	the	the	DET
brj-24352	29	5	rumen	ruman	NOUN
brj-24352	29	6	of	of	ADP
brj-24352	29	7	ruminant	ruminant	NOUN
brj-24352	29	8	animals	animal	NOUN
brj-24352	29	9	represents	represent	VERB
brj-24352	29	10	one	one	NUM
brj-24352	29	11	of	of	ADP
brj-24352	29	12	the	the	DET
brj-24352	29	13	most	most	ADV
brj-24352	29	14	effective	effective	ADJ
brj-24352	29	15	ecosystems	ecosystem	NOUN
brj-24352	29	16	for	for	ADP
brj-24352	29	17	lignocellulose	lignocellulose	VERB
brj-24352	29	18	degradation	degradation	NOUN
brj-24352	29	19	(	(	PUNCT
brj-24352	29	20	gharechahi	gharechahi	NOUN
brj-24352	29	21	et	et	NOUN
brj-24352	29	22	al	al	PROPN
brj-24352	29	23	.	.	PROPN
brj-24352	29	24	2023	2023	NUM
brj-24352	29	25	)	)	PUNCT
brj-24352	29	26	.	.	PUNCT
brj-24352	30	1	this	this	DET
brj-24352	30	2	anaerobic	anaerobic	ADJ
brj-24352	30	3	fermentation	fermentation	NOUN
brj-24352	30	4	chamber	chamber	NOUN
brj-24352	30	5	is	be	AUX
brj-24352	30	6	home	home	NOUN
brj-24352	30	7	to	to	ADP
brj-24352	30	8	a	a	DET
brj-24352	30	9	diverse	diverse	ADJ
brj-24352	30	10	microbial	microbial	ADJ
brj-24352	30	11	community	community	NOUN
brj-24352	30	12	that	that	PRON
brj-24352	30	13	produces	produce	VERB
brj-24352	30	14	a	a	DET
brj-24352	30	15	plethora	plethora	NOUN
brj-24352	30	16	of	of	ADP
brj-24352	30	17	glycoside	glycoside	NOUN
brj-24352	30	18	hydrolases	hydrolase	NOUN
brj-24352	30	19	with	with	ADP
brj-24352	30	20	remarkable	remarkable	ADJ
brj-24352	30	21	efficiency	efficiency	NOUN
brj-24352	30	22	and	and	CCONJ
brj-24352	30	23	specificity	specificity	NOUN
brj-24352	30	24	(	(	PUNCT
brj-24352	30	25	gharechahi	gharechahi	NOUN
brj-24352	30	26	et	et	PROPN
brj-24352	30	27	al	al	PROPN
brj-24352	30	28	.	.	PROPN
brj-24352	30	29	2023	2023	NUM
brj-24352	30	30	)	)	PUNCT
brj-24352	30	31	.	.	PUNCT
brj-24352	31	1	the	the	DET
brj-24352	31	2	exploration	exploration	NOUN
brj-24352	31	3	of	of	ADP
brj-24352	31	4	rumen	ruman	NOUN
brj-24352	31	5	microbiota	microbiota	NOUN
brj-24352	31	6	as	as	ADP
brj-24352	31	7	a	a	DET
brj-24352	31	8	source	source	NOUN
brj-24352	31	9	of	of	ADP
brj-24352	31	10	novel	novel	ADJ
brj-24352	31	11	lignocellulose	lignocellulose	NOUN
brj-24352	31	12	-	-	PUNCT
brj-24352	31	13	degrading	degrade	VERB
brj-24352	31	14	enzymes	enzyme	NOUN
brj-24352	31	15	has	have	AUX
brj-24352	31	16	attracted	attract	VERB
brj-24352	31	17	growing	grow	VERB
brj-24352	31	18	attention	attention	NOUN
brj-24352	31	19	,	,	PUNCT
brj-24352	31	20	facilitated	facilitate	VERB
brj-24352	31	21	by	by	ADP
brj-24352	31	22	advancements	advancement	NOUN
brj-24352	31	23	in	in	ADP
brj-24352	31	24	metagenomic	metagenomic	ADJ
brj-24352	31	25	and	and	CCONJ
brj-24352	31	26	bioinformatic	bioinformatic	ADJ
brj-24352	31	27	technologies	technology	NOUN
brj-24352	31	28	.	.	PUNCT
brj-24352	32	1	by	by	ADP
brj-24352	32	2	mining	mine	VERB
brj-24352	32	3	metagenomic	metagenomic	ADJ
brj-24352	32	4	datasets	dataset	NOUN
brj-24352	32	5	from	from	ADP
brj-24352	32	6	the	the	DET
brj-24352	32	7	rumen	ruman	NOUN
brj-24352	32	8	environment	environment	NOUN
brj-24352	32	9	,	,	PUNCT
brj-24352	32	10	it	it	PRON
brj-24352	32	11	is	be	AUX
brj-24352	32	12	possible	possible	ADJ
brj-24352	32	13	to	to	PART
brj-24352	32	14	uncover	uncover	VERB
brj-24352	32	15	novel	novel	ADJ
brj-24352	32	16	enzymes	enzyme	NOUN
brj-24352	32	17	with	with	ADP
brj-24352	32	18	enhanced	enhanced	ADJ
brj-24352	32	19	catalytic	catalytic	ADJ
brj-24352	32	20	properties	property	NOUN
brj-24352	32	21	,	,	PUNCT
brj-24352	32	22	tailored	tailor	VERB
brj-24352	32	23	for	for	ADP
brj-24352	32	24	the	the	DET
brj-24352	32	25	degradation	degradation	NOUN
brj-24352	32	26	of	of	ADP
brj-24352	32	27	recalcitrant	recalcitrant	ADJ
brj-24352	32	28	biomass	biomass	NOUN
brj-24352	32	29	.	.	PUNCT
brj-24352	33	1	in	in	ADP
brj-24352	33	2	this	this	DET
brj-24352	33	3	study	study	NOUN
brj-24352	33	4	,	,	PUNCT
brj-24352	33	5	the	the	DET
brj-24352	33	6	metagenomic	metagenomic	ADJ
brj-24352	33	7	data	datum	NOUN
brj-24352	33	8	from	from	ADP
brj-24352	33	9	beef	beef	NOUN
brj-24352	33	10	cattle	cattle	NOUN
brj-24352	33	11	rumen	ruman	NOUN
brj-24352	33	12	microbiota	microbiota	NOUN
brj-24352	33	13	(	(	PUNCT
brj-24352	33	14	ncbi	ncbi	NOUN
brj-24352	33	15	accession	accession	NOUN
brj-24352	33	16	number	number	NOUN
brj-24352	33	17	prjna806344	prjna806344	PROPN
brj-24352	33	18	)	)	PUNCT
brj-24352	33	19	was	be	AUX
brj-24352	33	20	leveraged	leverage	VERB
brj-24352	33	21	to	to	PART
brj-24352	33	22	identify	identify	VERB
brj-24352	33	23	and	and	CCONJ
brj-24352	33	24	characterize	characterize	VERB
brj-24352	33	25	a	a	DET
brj-24352	33	26	cellulase	cellulase	NOUN
brj-24352	33	27	,	,	PUNCT
brj-24352	33	28	rucel224	rucel224	PROPN
brj-24352	33	29	(	(	PUNCT
brj-24352	33	30	ec	ec	PROPN
brj-24352	33	31	3.2.1.4	3.2.1.4	NUM
brj-24352	33	32	)	)	PUNCT
brj-24352	33	33	,	,	PUNCT
brj-24352	33	34	with	with	ADP
brj-24352	33	35	potential	potential	ADJ
brj-24352	33	36	applications	application	NOUN
brj-24352	33	37	in	in	ADP
brj-24352	33	38	lignocellulose	lignocellulose	ADJ
brj-24352	33	39	bioconversion	bioconversion	NOUN
brj-24352	33	40	.	.	PUNCT
brj-24352	34	1	through	through	ADP
brj-24352	34	2	comprehensive	comprehensive	ADJ
brj-24352	34	3	enzymatic	enzymatic	ADJ
brj-24352	34	4	assays	assay	NOUN
brj-24352	34	5	,	,	PUNCT
brj-24352	34	6	its	its	PRON
brj-24352	34	7	catalytic	catalytic	ADJ
brj-24352	34	8	properties	property	NOUN
brj-24352	34	9	were	be	AUX
brj-24352	34	10	investigated	investigate	VERB
brj-24352	34	11	,	,	PUNCT
brj-24352	34	12	and	and	CCONJ
brj-24352	34	13	its	its	PRON
brj-24352	34	14	efficiency	efficiency	NOUN
brj-24352	34	15	in	in	ADP
brj-24352	34	16	degrading	degrade	VERB
brj-24352	34	17	agricultural	agricultural	ADJ
brj-24352	34	18	straw	straw	NOUN
brj-24352	34	19	was	be	AUX
brj-24352	34	20	assessed	assess	VERB
brj-24352	34	21	.	.	PUNCT
brj-24352	35	1	these	these	DET
brj-24352	35	2	findings	finding	NOUN
brj-24352	35	3	provide	provide	VERB
brj-24352	35	4	valuable	valuable	ADJ
brj-24352	35	5	insights	insight	NOUN
brj-24352	35	6	into	into	ADP
brj-24352	35	7	the	the	DET
brj-24352	35	8	enzymatic	enzymatic	ADJ
brj-24352	35	9	degradation	degradation	NOUN
brj-24352	35	10	of	of	ADP
brj-24352	35	11	lignocellulose	lignocellulose	NOUN
brj-24352	35	12	and	and	CCONJ
brj-24352	35	13	highlight	highlight	VERB
brj-24352	35	14	the	the	DET
brj-24352	35	15	potential	potential	NOUN
brj-24352	35	16	of	of	ADP
brj-24352	35	17	rucel224	rucel224	PROPN
brj-24352	35	18	as	as	ADP
brj-24352	35	19	a	a	DET
brj-24352	35	20	biocatalyst	biocatalyst	NOUN
brj-24352	35	21	for	for	ADP
brj-24352	35	22	sustainable	sustainable	ADJ
brj-24352	35	23	biomass	biomass	NOUN
brj-24352	35	24	utilization	utilization	NOUN
brj-24352	35	25	.	.	PUNCT
brj-24352	36	1	experimental	experimental	ADJ
brj-24352	36	2	metagenomic	metagenomic	ADJ
brj-24352	36	3	sequencing	sequencing	NOUN
brj-24352	36	4	of	of	ADP
brj-24352	36	5	rumen	ruman	NOUN
brj-24352	36	6	samples	sample	VERB
brj-24352	36	7	the	the	DET
brj-24352	36	8	metagenomic	metagenomic	ADJ
brj-24352	36	9	sequencing	sequence	VERB
brj-24352	36	10	data	datum	NOUN
brj-24352	36	11	of	of	ADP
brj-24352	36	12	rumen	ruman	NOUN
brj-24352	36	13	samples	sample	NOUN
brj-24352	36	14	were	be	AUX
brj-24352	36	15	derived	derive	VERB
brj-24352	36	16	from	from	ADP
brj-24352	36	17	prior	prior	ADJ
brj-24352	36	18	assessments	assessment	NOUN
brj-24352	36	19	(	(	PUNCT
brj-24352	36	20	hu	hu	PROPN
brj-24352	36	21	and	and	CCONJ
brj-24352	36	22	zhao	zhao	PROPN
brj-24352	36	23	2022	2022	NUM
brj-24352	36	24	)	)	PUNCT
brj-24352	36	25	,	,	PUNCT
brj-24352	36	26	with	with	ADP
brj-24352	36	27	the	the	DET
brj-24352	36	28	ncbi	ncbi	PROPN
brj-24352	36	29	accession	accession	NOUN
brj-24352	36	30	number	number	NOUN
brj-24352	36	31	prjna806344	prjna806344	PROPN
brj-24352	36	32	.	.	PUNCT
brj-24352	37	1	cloning	cloning	NOUN
brj-24352	37	2	of	of	ADP
brj-24352	37	3	rucel224	rucel224	PROPN
brj-24352	37	4	the	the	DET
brj-24352	37	5	rucel224	rucel224	PROPN
brj-24352	37	6	gene	gene	NOUN
brj-24352	37	7	was	be	AUX
brj-24352	37	8	identified	identify	VERB
brj-24352	37	9	from	from	ADP
brj-24352	37	10	rumen	ruman	NOUN
brj-24352	37	11	metagenomic	metagenomic	ADJ
brj-24352	37	12	dna	dna	PROPN
brj-24352	37	13	derived	derive	VERB
brj-24352	37	14	from	from	ADP
brj-24352	37	15	liquid	liquid	ADJ
brj-24352	37	16	-	-	PUNCT
brj-24352	37	17	phase	phase	NOUN
brj-24352	37	18	rumen	ruman	NOUN
brj-24352	37	19	bacteria	bacteria	NOUN
brj-24352	37	20	.	.	PUNCT
brj-24352	38	1	subsequently	subsequently	ADV
brj-24352	38	2	,	,	PUNCT
brj-24352	38	3	liquid	liquid	ADJ
brj-24352	38	4	-	-	PUNCT
brj-24352	38	5	phase	phase	NOUN
brj-24352	38	6	dna	dna	NOUN
brj-24352	38	7	served	serve	VERB
brj-24352	38	8	as	as	ADP
brj-24352	38	9	a	a	DET
brj-24352	38	10	template	template	NOUN
brj-24352	38	11	for	for	ADP
brj-24352	38	12	the	the	DET
brj-24352	38	13	pcr	pcr	ADJ
brj-24352	38	14	amplification	amplification	NOUN
brj-24352	38	15	of	of	ADP
brj-24352	38	16	the	the	DET
brj-24352	38	17	rucel224	rucel224	PROPN
brj-24352	38	18	gene	gene	NOUN
brj-24352	38	19	using	use	VERB
brj-24352	38	20	the	the	DET
brj-24352	38	21	primer	primer	NOUN
brj-24352	38	22	pair	pair	NOUN
brj-24352	38	23	5'ctttaagaaggagatatacggatccatgaaaaaagaattaacagctc-3	5'ctttaagaaggagatatacggatccatgaaaaaagaattaacagctc-3	NOUN
brj-24352	38	24	'	'	PUNCT
brj-24352	38	25	and	and	CCONJ
brj-24352	38	26	5'-agtggtggtggtggtggtgctcgagaagtccgaatgcttcggggaat-3	5'-agtggtggtggtggtggtgctcgagaagtccgaatgcttcggggaat-3	NUM
brj-24352	38	27	'	'	PUNCT
brj-24352	38	28	.	.	PUNCT
brj-24352	39	1	the	the	DET
brj-24352	39	2	amplified	amplify	VERB
brj-24352	39	3	fragment	fragment	NOUN
brj-24352	39	4	was	be	AUX
brj-24352	39	5	purified	purify	VERB
brj-24352	39	6	and	and	CCONJ
brj-24352	39	7	inserted	insert	VERB
brj-24352	39	8	into	into	ADP
brj-24352	39	9	the	the	DET
brj-24352	39	10	pet-28a	pet-28a	NUM
brj-24352	39	11	expression	expression	NOUN
brj-24352	39	12	vector	vector	NOUN
brj-24352	39	13	using	use	VERB
brj-24352	39	14	homologous	homologous	ADJ
brj-24352	39	15	recombination	recombination	NOUN
brj-24352	39	16	with	with	ADP
brj-24352	39	17	the	the	DET
brj-24352	39	18	hieff	hieff	NOUN
brj-24352	39	19	clone	clone	NOUN
brj-24352	39	20	®	®	PROPN
brj-24352	39	21	plus	plus	CCONJ
brj-24352	39	22	multi	multi	ADJ
brj-24352	39	23	one	one	NUM
brj-24352	39	24	step	step	NOUN
brj-24352	39	25	peer	peer	NOUN
brj-24352	39	26	-	-	PUNCT
brj-24352	39	27	reviewed	review	VERB
brj-24352	39	28	article	article	NOUN
brj-24352	39	29	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	39	30	ouyang	ouyang	PROPN
brj-24352	39	31	et	et	PROPN
brj-24352	39	32	al	al	PROPN
brj-24352	39	33	.	.	PROPN
brj-24352	40	1	(	(	PUNCT
brj-24352	40	2	2025	2025	NUM
brj-24352	40	3	)	)	PUNCT
brj-24352	40	4	.	.	PUNCT
brj-24352	41	1	“	"	PUNCT
brj-24352	41	2	rumen	ruman	NOUN
brj-24352	41	3	cellulase	cellulase	NOUN
brj-24352	41	4	&	&	CCONJ
brj-24352	41	5	ag	ag	PROPN
brj-24352	41	6	waste	waste	PROPN
brj-24352	41	7	,	,	PUNCT
brj-24352	41	8	”	"	PUNCT
brj-24352	41	9	bioresources	bioresource	NOUN
brj-24352	41	10	20(3	20(3	NOUN
brj-24352	41	11	)	)	PUNCT
brj-24352	41	12	,	,	PUNCT
brj-24352	41	13	5501	5501	NUM
brj-24352	41	14	-	-	SYM
brj-24352	41	15	5513	5513	NUM
brj-24352	41	16	.	.	PUNCT
brj-24352	42	1	5503	5503	NUM
brj-24352	42	2	cloning	cloning	NOUN
brj-24352	42	3	kit	kit	NOUN
brj-24352	42	4	(	(	PUNCT
brj-24352	42	5	yeasen	yeasen	PROPN
brj-24352	42	6	biotechnology	biotechnology	NOUN
brj-24352	42	7	,	,	PUNCT
brj-24352	42	8	shanghai	shanghai	PROPN
brj-24352	42	9	)	)	PUNCT
brj-24352	42	10	.	.	PUNCT
brj-24352	43	1	the	the	DET
brj-24352	43	2	recombinant	recombinant	ADJ
brj-24352	43	3	vector	vector	NOUN
brj-24352	43	4	,	,	PUNCT
brj-24352	43	5	pet	pet	NOUN
brj-24352	43	6	-	-	PUNCT
brj-24352	43	7	rucel224	rucel224	PROPN
brj-24352	43	8	,	,	PUNCT
brj-24352	43	9	was	be	AUX
brj-24352	43	10	then	then	ADV
brj-24352	43	11	transformed	transform	VERB
brj-24352	43	12	into	into	ADP
brj-24352	43	13	escherichia	escherichia	NOUN
brj-24352	43	14	coli	coli	NOUN
brj-24352	43	15	top10	top10	PROPN
brj-24352	43	16	competent	competent	ADJ
brj-24352	43	17	cells	cell	NOUN
brj-24352	43	18	via	via	ADP
brj-24352	43	19	heat	heat	NOUN
brj-24352	43	20	shock	shock	NOUN
brj-24352	43	21	.	.	PUNCT
brj-24352	44	1	the	the	DET
brj-24352	44	2	pet	pet	NOUN
brj-24352	44	3	-	-	PUNCT
brj-24352	44	4	rucel224	rucel224	PROPN
brj-24352	44	5	plasmid	plasmid	NOUN
brj-24352	44	6	was	be	AUX
brj-24352	44	7	extracted	extract	VERB
brj-24352	44	8	,	,	PUNCT
brj-24352	44	9	verified	verify	VERB
brj-24352	44	10	by	by	ADP
brj-24352	44	11	pcr	pcr	ADJ
brj-24352	44	12	amplification	amplification	NOUN
brj-24352	44	13	,	,	PUNCT
brj-24352	44	14	and	and	CCONJ
brj-24352	44	15	sequenced	sequence	VERB
brj-24352	44	16	.	.	PUNCT
brj-24352	45	1	the	the	DET
brj-24352	45	2	dna	dna	PROPN
brj-24352	45	3	sequence	sequence	NOUN
brj-24352	45	4	data	datum	NOUN
brj-24352	45	5	are	be	AUX
brj-24352	45	6	listed	list	VERB
brj-24352	45	7	in	in	ADP
brj-24352	45	8	table	table	NOUN
brj-24352	45	9	s1	s1	NOUN
brj-24352	45	10	(	(	PUNCT
brj-24352	45	11	see	see	VERB
brj-24352	45	12	appendix	appendix	NOUN
brj-24352	45	13	)	)	PUNCT
brj-24352	45	14	.	.	PUNCT
brj-24352	46	1	expression	expression	NOUN
brj-24352	46	2	and	and	CCONJ
brj-24352	46	3	imac	imac	NOUN
brj-24352	46	4	of	of	ADP
brj-24352	46	5	rucel224	rucel224	PROPN
brj-24352	46	6	the	the	DET
brj-24352	46	7	pet	pet	NOUN
brj-24352	46	8	-	-	PUNCT
brj-24352	46	9	rucel224	rucel224	PROPN
brj-24352	46	10	plasmid	plasmid	NOUN
brj-24352	46	11	was	be	AUX
brj-24352	46	12	introduced	introduce	VERB
brj-24352	46	13	into	into	ADP
brj-24352	46	14	e.	e.	PROPN
brj-24352	46	15	coli	coli	NOUN
brj-24352	47	1	bl21	bl21	PROPN
brj-24352	47	2	(	(	PUNCT
brj-24352	47	3	de3	de3	NOUN
brj-24352	47	4	)	)	PUNCT
brj-24352	47	5	cells	cell	NOUN
brj-24352	47	6	via	via	ADP
brj-24352	47	7	heat	heat	NOUN
brj-24352	47	8	shock	shock	NOUN
brj-24352	47	9	,	,	PUNCT
brj-24352	47	10	and	and	CCONJ
brj-24352	47	11	transformants	transformant	NOUN
brj-24352	47	12	were	be	AUX
brj-24352	47	13	selected	select	VERB
brj-24352	47	14	on	on	ADP
brj-24352	47	15	lb	lb	DET
brj-24352	47	16	agar	agar	NOUN
brj-24352	47	17	plates	plate	NOUN
brj-24352	47	18	containing	contain	VERB
brj-24352	47	19	kanamycin	kanamycin	PRON
brj-24352	47	20	at	at	ADP
brj-24352	47	21	37	37	NUM
brj-24352	47	22	°	°	NOUN
brj-24352	47	23	c	c	NOUN
brj-24352	47	24	overnight	overnight	ADV
brj-24352	47	25	.	.	PUNCT
brj-24352	48	1	positive	positive	ADJ
brj-24352	48	2	colonies	colony	NOUN
brj-24352	48	3	were	be	AUX
brj-24352	48	4	identified	identify	VERB
brj-24352	48	5	by	by	ADP
brj-24352	48	6	pcr	pcr	NOUN
brj-24352	48	7	using	use	VERB
brj-24352	48	8	specific	specific	ADJ
brj-24352	48	9	primers	primer	NOUN
brj-24352	48	10	.	.	PUNCT
brj-24352	49	1	a	a	DET
brj-24352	49	2	seed	seed	NOUN
brj-24352	49	3	culture	culture	NOUN
brj-24352	49	4	was	be	AUX
brj-24352	49	5	initiated	initiate	VERB
brj-24352	49	6	in	in	ADP
brj-24352	49	7	kanamycin	kanamycin	NOUN
brj-24352	49	8	-	-	PUNCT
brj-24352	49	9	supplemented	supplement	VERB
brj-24352	49	10	lb	lb	DET
brj-24352	49	11	broth	broth	NOUN
brj-24352	49	12	and	and	CCONJ
brj-24352	49	13	incubated	incubate	VERB
brj-24352	49	14	at	at	ADP
brj-24352	49	15	37	37	NUM
brj-24352	49	16	℃	℃	PROPN
brj-24352	49	17	until	until	ADP
brj-24352	49	18	an	an	DET
brj-24352	49	19	od600	od600	NOUN
brj-24352	49	20	of	of	ADP
brj-24352	49	21	0.7	0.7	NUM
brj-24352	49	22	,	,	PUNCT
brj-24352	49	23	at	at	ADP
brj-24352	49	24	which	which	DET
brj-24352	49	25	point	point	NOUN
brj-24352	49	26	0.2	0.2	NUM
brj-24352	49	27	mm	mm	NOUN
brj-24352	49	28	isopropyl	isopropyl	NOUN
brj-24352	49	29	-	-	PUNCT
brj-24352	49	30	β	β	NOUN
brj-24352	49	31	-	-	PUNCT
brj-24352	49	32	d	d	NOUN
brj-24352	49	33	-	-	NOUN
brj-24352	49	34	thiogalactopyranoside	thiogalactopyranoside	NOUN
brj-24352	49	35	(	(	PUNCT
brj-24352	49	36	iptg	iptg	PROPN
brj-24352	49	37	)	)	PUNCT
brj-24352	49	38	was	be	AUX
brj-24352	49	39	added	add	VERB
brj-24352	49	40	to	to	PART
brj-24352	49	41	induce	induce	VERB
brj-24352	49	42	rucel224	rucel224	PROPN
brj-24352	49	43	expression	expression	NOUN
brj-24352	49	44	.	.	PUNCT
brj-24352	50	1	the	the	DET
brj-24352	50	2	culture	culture	NOUN
brj-24352	50	3	was	be	AUX
brj-24352	50	4	then	then	ADV
brj-24352	50	5	subsequently	subsequently	ADV
brj-24352	50	6	shifted	shift	VERB
brj-24352	50	7	to	to	ADP
brj-24352	50	8	20	20	NUM
brj-24352	50	9	°	°	NOUN
brj-24352	50	10	c	c	NOUN
brj-24352	50	11	for	for	ADP
brj-24352	50	12	over	over	ADP
brj-24352	50	13	18	18	NUM
brj-24352	50	14	h.	h.	NOUN
brj-24352	50	15	after	after	ADP
brj-24352	50	16	cultivation	cultivation	NOUN
brj-24352	50	17	,	,	PUNCT
brj-24352	50	18	cells	cell	NOUN
brj-24352	50	19	were	be	AUX
brj-24352	50	20	harvested	harvest	VERB
brj-24352	50	21	by	by	ADP
brj-24352	50	22	centrifugation	centrifugation	NOUN
brj-24352	50	23	at	at	ADP
brj-24352	50	24	8,000	8,000	NUM
brj-24352	50	25	rpm	rpm	NOUN
brj-24352	50	26	for	for	ADP
brj-24352	50	27	10	10	NUM
brj-24352	50	28	min	min	NOUN
brj-24352	50	29	at	at	ADP
brj-24352	50	30	4	4	NUM
brj-24352	50	31	°	°	NOUN
brj-24352	50	32	c	c	NOUN
brj-24352	50	33	.	.	PUNCT
brj-24352	51	1	the	the	DET
brj-24352	51	2	cell	cell	NOUN
brj-24352	51	3	pellet	pellet	NOUN
brj-24352	51	4	was	be	AUX
brj-24352	51	5	resuspended	resuspend	VERB
brj-24352	51	6	in	in	ADP
brj-24352	51	7	pbs	pbs	PROPN
brj-24352	51	8	and	and	CCONJ
brj-24352	51	9	lysed	lyse	VERB
brj-24352	51	10	ultrasonically	ultrasonically	NOUN
brj-24352	51	11	,	,	PUNCT
brj-24352	51	12	and	and	CCONJ
brj-24352	51	13	centrifuged	centrifuge	VERB
brj-24352	51	14	to	to	PART
brj-24352	51	15	separate	separate	VERB
brj-24352	51	16	the	the	DET
brj-24352	51	17	supernatant	supernatant	NOUN
brj-24352	51	18	.	.	PUNCT
brj-24352	52	1	the	the	DET
brj-24352	52	2	presence	presence	NOUN
brj-24352	52	3	of	of	ADP
brj-24352	52	4	rucel224	rucel224	PROPN
brj-24352	52	5	in	in	ADP
brj-24352	52	6	the	the	DET
brj-24352	52	7	supernatant	supernatant	NOUN
brj-24352	52	8	was	be	AUX
brj-24352	52	9	confirmed	confirm	VERB
brj-24352	52	10	by	by	ADP
brj-24352	52	11	sodium	sodium	NOUN
brj-24352	52	12	dodecyl	dodecyl	PROPN
brj-24352	52	13	sulfate	sulfate	NOUN
brj-24352	52	14	-	-	PUNCT
brj-24352	52	15	polyacrylamide	polyacrylamide	NOUN
brj-24352	52	16	gel	gel	NOUN
brj-24352	52	17	electrophoresis	electrophoresis	NOUN
brj-24352	52	18	(	(	PUNCT
brj-24352	52	19	sds	sds	NOUN
brj-24352	52	20	-	-	PUNCT
brj-24352	52	21	page	page	NOUN
brj-24352	52	22	)	)	PUNCT
brj-24352	52	23	with	with	ADP
brj-24352	52	24	coomassie	coomassie	ADJ
brj-24352	52	25	brilliant	brilliant	ADJ
brj-24352	52	26	blue	blue	ADJ
brj-24352	52	27	staining	staining	NOUN
brj-24352	52	28	.	.	PUNCT
brj-24352	53	1	the	the	DET
brj-24352	53	2	recombinant	recombinant	ADJ
brj-24352	53	3	rucel224	rucel224	PROPN
brj-24352	53	4	strain	strain	NOUN
brj-24352	53	5	was	be	AUX
brj-24352	53	6	then	then	ADV
brj-24352	53	7	cultured	cultured	ADJ
brj-24352	53	8	and	and	CCONJ
brj-24352	53	9	induced	induce	VERB
brj-24352	53	10	with	with	ADP
brj-24352	53	11	0.2	0.2	NUM
brj-24352	53	12	mm	mm	NUM
brj-24352	53	13	iptg	iptg	NOUN
brj-24352	53	14	to	to	PART
brj-24352	53	15	produce	produce	VERB
brj-24352	53	16	sufficient	sufficient	ADJ
brj-24352	53	17	quantities	quantity	NOUN
brj-24352	53	18	of	of	ADP
brj-24352	53	19	the	the	DET
brj-24352	53	20	enzyme	enzyme	NOUN
brj-24352	53	21	for	for	ADP
brj-24352	53	22	subsequent	subsequent	ADJ
brj-24352	53	23	experimental	experimental	ADJ
brj-24352	53	24	procedures	procedure	NOUN
brj-24352	53	25	.	.	PUNCT
brj-24352	54	1	the	the	DET
brj-24352	54	2	purification	purification	NOUN
brj-24352	54	3	of	of	ADP
brj-24352	54	4	rucel224	rucel224	PROPN
brj-24352	54	5	was	be	AUX
brj-24352	54	6	performed	perform	VERB
brj-24352	54	7	by	by	ADP
brj-24352	54	8	affinity	affinity	NOUN
brj-24352	54	9	chromatography	chromatography	NOUN
brj-24352	54	10	using	use	VERB
brj-24352	54	11	a	a	DET
brj-24352	54	12	5	5	NUM
brj-24352	54	13	ml	ml	NOUN
brj-24352	54	14	bio	bio	ADJ
brj-24352	54	15	-	-	NOUN
brj-24352	54	16	scale	scale	ADJ
brj-24352	54	17	mini	mini	ADJ
brj-24352	54	18	nuvia	nuvia	PROPN
brj-24352	54	19	imac	imac	PROPN
brj-24352	54	20	ni	ni	PROPN
brj-24352	54	21	-	-	PUNCT
brj-24352	54	22	charged	charge	VERB
brj-24352	54	23	column	column	NOUN
brj-24352	54	24	(	(	PUNCT
brj-24352	54	25	biorad	biorad	NOUN
brj-24352	54	26	,	,	PUNCT
brj-24352	54	27	hercules	hercule	NOUN
brj-24352	54	28	,	,	PUNCT
brj-24352	54	29	ca	ca	PROPN
brj-24352	54	30	,	,	PUNCT
brj-24352	54	31	united	united	PROPN
brj-24352	54	32	states	states	PROPN
brj-24352	54	33	)	)	PUNCT
brj-24352	54	34	connected	connect	VERB
brj-24352	54	35	to	to	ADP
brj-24352	54	36	a	a	DET
brj-24352	54	37	low	low	ADJ
brj-24352	54	38	-	-	PUNCT
brj-24352	54	39	pressure	pressure	NOUN
brj-24352	54	40	chromatographic	chromatographic	ADJ
brj-24352	54	41	system	system	NOUN
brj-24352	54	42	(	(	PUNCT
brj-24352	54	43	biologic	biologic	NOUN
brj-24352	54	44	lp	lp	NOUN
brj-24352	54	45	;	;	PUNCT
brj-24352	54	46	bio	bio	NOUN
brj-24352	54	47	-	-	PROPN
brj-24352	54	48	rad	rad	PROPN
brj-24352	54	49	,	,	PUNCT
brj-24352	54	50	hercules	hercule	NOUN
brj-24352	54	51	,	,	PUNCT
brj-24352	54	52	ca	ca	PROPN
brj-24352	54	53	,	,	PUNCT
brj-24352	54	54	united	united	PROPN
brj-24352	54	55	states	states	PROPN
brj-24352	54	56	)	)	PUNCT
brj-24352	54	57	.	.	PUNCT
brj-24352	55	1	determination	determination	NOUN
brj-24352	55	2	of	of	ADP
brj-24352	55	3	substrate	substrate	NOUN
brj-24352	55	4	specificity	specificity	NOUN
brj-24352	55	5	of	of	ADP
brj-24352	55	6	rucel224	rucel224	PROPN
brj-24352	55	7	the	the	DET
brj-24352	55	8	substrate	substrate	NOUN
brj-24352	55	9	specificity	specificity	NOUN
brj-24352	55	10	of	of	ADP
brj-24352	55	11	rucel224	rucel224	PROPN
brj-24352	55	12	was	be	AUX
brj-24352	55	13	assessed	assess	VERB
brj-24352	55	14	using	use	VERB
brj-24352	55	15	five	five	NUM
brj-24352	55	16	different	different	ADJ
brj-24352	55	17	substrates	substrate	NOUN
brj-24352	55	18	:	:	PUNCT
brj-24352	55	19	cmc	cmc	NOUN
brj-24352	55	20	-	-	PUNCT
brj-24352	55	21	na	na	PROPN
brj-24352	55	22	(	(	PUNCT
brj-24352	55	23	sinopharm	sinopharm	PROPN
brj-24352	55	24	,	,	PUNCT
brj-24352	55	25	china	china	PROPN
brj-24352	55	26	,	,	PUNCT
brj-24352	55	27	carboxymethyl	carboxymethyl	NOUN
brj-24352	55	28	cellulose	cellulose	NOUN
brj-24352	55	29	)	)	PUNCT
brj-24352	55	30	,	,	PUNCT
brj-24352	55	31	avicel	avicel	PROPN
brj-24352	55	32	(	(	PUNCT
brj-24352	55	33	sigma	sigma	PROPN
brj-24352	55	34	-	-	PUNCT
brj-24352	55	35	aldrich	aldrich	PROPN
brj-24352	55	36	,	,	PUNCT
brj-24352	55	37	st	st	PROPN
brj-24352	55	38	.	.	PROPN
brj-24352	55	39	louis	louis	PROPN
brj-24352	55	40	,	,	PUNCT
brj-24352	55	41	mo	mo	NOUN
brj-24352	55	42	,	,	PUNCT
brj-24352	55	43	microcrystalline	microcrystalline	NOUN
brj-24352	55	44	cellulose	cellulose	NOUN
brj-24352	55	45	)	)	PUNCT
brj-24352	55	46	,	,	PUNCT
brj-24352	55	47	wheat	wheat	NOUN
brj-24352	55	48	straw	straw	PROPN
brj-24352	55	49	xylan	xylan	PROPN
brj-24352	55	50	(	(	PUNCT
brj-24352	55	51	prepared	prepare	VERB
brj-24352	55	52	as	as	SCONJ
brj-24352	55	53	described	describe	VERB
brj-24352	55	54	by	by	ADP
brj-24352	55	55	faryar	faryar	PROPN
brj-24352	55	56	(	(	PUNCT
brj-24352	55	57	faryar	faryar	INTJ
brj-24352	55	58	et	et	PROPN
brj-24352	55	59	al	al	PROPN
brj-24352	55	60	.	.	PROPN
brj-24352	55	61	2015	2015	NUM
brj-24352	55	62	)	)	PUNCT
brj-24352	55	63	)	)	PUNCT
brj-24352	55	64	and	and	CCONJ
brj-24352	55	65	chitosan	chitosan	NOUN
brj-24352	55	66	(	(	PUNCT
brj-24352	55	67	solarbio	solarbio	NOUN
brj-24352	55	68	,	,	PUNCT
brj-24352	55	69	beijing	beijing	PROPN
brj-24352	55	70	)	)	PUNCT
brj-24352	55	71	,	,	PUNCT
brj-24352	55	72	pachyman	pachyman	NOUN
brj-24352	55	73	(	(	PUNCT
brj-24352	55	74	bbi	bbi	ADJ
brj-24352	55	75	-	-	PUNCT
brj-24352	55	76	lifesciences	lifescience	NOUN
brj-24352	55	77	,	,	PUNCT
brj-24352	55	78	china	china	PROPN
brj-24352	55	79	)	)	PUNCT
brj-24352	55	80	.	.	PUNCT
brj-24352	56	1	the	the	DET
brj-24352	56	2	enzyme	enzyme	NOUN
brj-24352	56	3	was	be	AUX
brj-24352	56	4	incubated	incubate	VERB
brj-24352	56	5	in	in	ADP
brj-24352	56	6	a	a	DET
brj-24352	56	7	50	50	NUM
brj-24352	56	8	mm	mm	NOUN
brj-24352	56	9	disodium	disodium	NOUN
brj-24352	56	10	hydrogen	hydrogen	NOUN
brj-24352	56	11	phosphate	phosphate	NOUN
brj-24352	56	12	-	-	PUNCT
brj-24352	56	13	citrate	citrate	NOUN
brj-24352	56	14	buffer	buffer	NOUN
brj-24352	56	15	(	(	PUNCT
brj-24352	56	16	ph	ph	NOUN
brj-24352	56	17	6.0	6.0	NUM
brj-24352	56	18	)	)	PUNCT
brj-24352	56	19	containing	contain	VERB
brj-24352	56	20	1	1	NUM
brj-24352	56	21	%	%	NOUN
brj-24352	56	22	(	(	PUNCT
brj-24352	56	23	w	w	NOUN
brj-24352	56	24	/	/	SYM
brj-24352	56	25	v	v	NOUN
brj-24352	56	26	)	)	PUNCT
brj-24352	56	27	substrate	substrate	NOUN
brj-24352	56	28	and	and	CCONJ
brj-24352	56	29	incubated	incubate	VERB
brj-24352	56	30	at	at	ADP
brj-24352	56	31	40	40	NUM
brj-24352	56	32	°	°	NOUN
brj-24352	56	33	c	c	NOUN
brj-24352	56	34	for	for	ADP
brj-24352	56	35	30	30	NUM
brj-24352	56	36	min	min	NOUN
brj-24352	56	37	.	.	PUNCT
brj-24352	57	1	the	the	DET
brj-24352	57	2	reducing	reduce	VERB
brj-24352	57	3	sugars	sugar	NOUN
brj-24352	57	4	released	release	VERB
brj-24352	57	5	were	be	AUX
brj-24352	57	6	quantified	quantify	VERB
brj-24352	57	7	using	use	VERB
brj-24352	57	8	alkaline	alkaline	NOUN
brj-24352	57	9	3,5	3,5	NUM
brj-24352	57	10	-	-	PUNCT
brj-24352	57	11	dinitrosalicylic	dinitrosalicylic	ADJ
brj-24352	57	12	acid	acid	NOUN
brj-24352	57	13	reagent	reagent	NOUN
brj-24352	57	14	,	,	PUNCT
brj-24352	57	15	with	with	ADP
brj-24352	57	16	xylose	xylose	PROPN
brj-24352	57	17	or	or	CCONJ
brj-24352	57	18	glucose	glucose	NOUN
brj-24352	57	19	as	as	ADP
brj-24352	57	20	standards	standard	NOUN
brj-24352	57	21	(	(	PUNCT
brj-24352	57	22	ghose	ghose	NOUN
brj-24352	57	23	1987	1987	NUM
brj-24352	57	24	)	)	PUNCT
brj-24352	57	25	.	.	PUNCT
brj-24352	58	1	one	one	NUM
brj-24352	58	2	unit	unit	NOUN
brj-24352	58	3	(	(	PUNCT
brj-24352	58	4	u	u	NOUN
brj-24352	58	5	)	)	PUNCT
brj-24352	58	6	of	of	ADP
brj-24352	58	7	enzyme	enzyme	NOUN
brj-24352	58	8	activity	activity	NOUN
brj-24352	58	9	was	be	AUX
brj-24352	58	10	defined	define	VERB
brj-24352	58	11	as	as	ADP
brj-24352	58	12	the	the	DET
brj-24352	58	13	amount	amount	NOUN
brj-24352	58	14	of	of	ADP
brj-24352	58	15	enzyme	enzyme	NOUN
brj-24352	58	16	required	require	VERB
brj-24352	58	17	to	to	PART
brj-24352	58	18	release	release	VERB
brj-24352	58	19	1	1	NUM
brj-24352	58	20	µmol	µmol	ADV
brj-24352	58	21	of	of	ADP
brj-24352	58	22	reducing	reduce	VERB
brj-24352	58	23	sugar	sugar	NOUN
brj-24352	58	24	per	per	ADP
brj-24352	58	25	minute	minute	NOUN
brj-24352	58	26	under	under	ADP
brj-24352	58	27	assay	assay	NOUN
brj-24352	58	28	conditions	condition	NOUN
brj-24352	58	29	.	.	PUNCT
brj-24352	59	1	characteristics	characteristic	NOUN
brj-24352	59	2	of	of	ADP
brj-24352	59	3	recombinant	recombinant	ADJ
brj-24352	59	4	rucel224	rucel224	PROPN
brj-24352	59	5	the	the	DET
brj-24352	59	6	ph	ph	ADJ
brj-24352	59	7	-	-	ADJ
brj-24352	59	8	dependent	dependent	ADJ
brj-24352	59	9	activity	activity	NOUN
brj-24352	59	10	of	of	ADP
brj-24352	59	11	rucel224	rucel224	PROPN
brj-24352	59	12	was	be	AUX
brj-24352	59	13	assessed	assess	VERB
brj-24352	59	14	over	over	ADP
brj-24352	59	15	a	a	DET
brj-24352	59	16	range	range	NOUN
brj-24352	59	17	of	of	ADP
brj-24352	59	18	ph	ph	ADJ
brj-24352	59	19	values	value	NOUN
brj-24352	59	20	(	(	PUNCT
brj-24352	59	21	3.0	3.0	NUM
brj-24352	59	22	to	to	PART
brj-24352	59	23	8.0	8.0	NUM
brj-24352	59	24	)	)	PUNCT
brj-24352	59	25	using	use	VERB
brj-24352	59	26	50	50	NUM
brj-24352	59	27	mm	mm	NOUN
brj-24352	59	28	disodium	disodium	NOUN
brj-24352	59	29	hydrogen	hydrogen	NOUN
brj-24352	59	30	phosphate	phosphate	NOUN
brj-24352	59	31	-	-	PUNCT
brj-24352	59	32	citrate	citrate	NOUN
brj-24352	59	33	buffers	buffer	NOUN
brj-24352	59	34	.	.	PUNCT
brj-24352	60	1	reactions	reaction	NOUN
brj-24352	60	2	were	be	AUX
brj-24352	60	3	carried	carry	VERB
brj-24352	60	4	out	out	ADP
brj-24352	60	5	at	at	ADP
brj-24352	60	6	40	40	NUM
brj-24352	60	7	°	°	NOUN
brj-24352	60	8	c	c	NOUN
brj-24352	60	9	for	for	ADP
brj-24352	60	10	30	30	NUM
brj-24352	60	11	min	min	NOUN
brj-24352	60	12	with	with	ADP
brj-24352	60	13	1	1	NUM
brj-24352	60	14	%	%	NOUN
brj-24352	60	15	(	(	PUNCT
brj-24352	60	16	w	w	NOUN
brj-24352	60	17	/	/	SYM
brj-24352	60	18	v	v	NOUN
brj-24352	60	19	)	)	PUNCT
brj-24352	60	20	cmc	cmc	NOUN
brj-24352	60	21	-	-	PUNCT
brj-24352	60	22	na	na	PROPN
brj-24352	60	23	as	as	ADP
brj-24352	60	24	the	the	DET
brj-24352	60	25	substrate	substrate	NOUN
brj-24352	60	26	.	.	PUNCT
brj-24352	61	1	to	to	PART
brj-24352	61	2	determine	determine	VERB
brj-24352	61	3	ph	ph	ADJ
brj-24352	61	4	tolerance	tolerance	NOUN
brj-24352	61	5	,	,	PUNCT
brj-24352	61	6	rucel224	rucel224	PROPN
brj-24352	61	7	was	be	AUX
brj-24352	61	8	pre	pre	VERB
brj-24352	61	9	-	-	VERB
brj-24352	61	10	incubated	incubate	VERB
brj-24352	61	11	in	in	ADP
brj-24352	61	12	the	the	DET
brj-24352	61	13	same	same	ADJ
brj-24352	61	14	buffer	buffer	NOUN
brj-24352	61	15	systems	system	NOUN
brj-24352	61	16	without	without	ADP
brj-24352	61	17	substrate	substrate	NOUN
brj-24352	61	18	at	at	ADP
brj-24352	61	19	35	35	NUM
brj-24352	61	20	°	°	NOUN
brj-24352	61	21	c	c	NOUN
brj-24352	61	22	for	for	ADP
brj-24352	61	23	30	30	NUM
brj-24352	61	24	min	min	NOUN
brj-24352	61	25	.	.	NOUN
brj-24352	61	26	residual	residual	ADJ
brj-24352	61	27	enzyme	enzyme	NOUN
brj-24352	61	28	activity	activity	NOUN
brj-24352	61	29	was	be	AUX
brj-24352	61	30	measured	measure	VERB
brj-24352	61	31	under	under	ADP
brj-24352	61	32	optimal	optimal	ADJ
brj-24352	61	33	reaction	reaction	NOUN
brj-24352	61	34	conditions	condition	NOUN
brj-24352	61	35	.	.	PUNCT
brj-24352	62	1	the	the	DET
brj-24352	62	2	ph	ph	ADJ
brj-24352	62	3	stability	stability	NOUN
brj-24352	62	4	of	of	ADP
brj-24352	62	5	rucel224	rucel224	PROPN
brj-24352	62	6	was	be	AUX
brj-24352	62	7	expressed	express	VERB
brj-24352	62	8	as	as	ADP
brj-24352	62	9	the	the	DET
brj-24352	62	10	percentage	percentage	NOUN
brj-24352	62	11	of	of	ADP
brj-24352	62	12	residual	residual	ADJ
brj-24352	62	13	activity	activity	NOUN
brj-24352	62	14	relative	relative	ADJ
brj-24352	62	15	to	to	ADP
brj-24352	62	16	an	an	DET
brj-24352	62	17	untreated	untreated	ADJ
brj-24352	62	18	enzyme	enzyme	NOUN
brj-24352	62	19	sample	sample	NOUN
brj-24352	62	20	,	,	PUNCT
brj-24352	62	21	which	which	PRON
brj-24352	62	22	was	be	AUX
brj-24352	62	23	set	set	VERB
brj-24352	62	24	as	as	ADP
brj-24352	62	25	100	100	NUM
brj-24352	62	26	%	%	NOUN
brj-24352	62	27	.	.	PUNCT
brj-24352	63	1	the	the	DET
brj-24352	63	2	optimal	optimal	ADJ
brj-24352	63	3	temperature	temperature	NOUN
brj-24352	63	4	for	for	ADP
brj-24352	63	5	rucel224	rucel224	PROPN
brj-24352	63	6	activity	activity	NOUN
brj-24352	63	7	was	be	AUX
brj-24352	63	8	determined	determine	VERB
brj-24352	63	9	by	by	ADP
brj-24352	63	10	conducting	conduct	VERB
brj-24352	63	11	reactions	reaction	NOUN
brj-24352	63	12	at	at	ADP
brj-24352	63	13	temperatures	temperature	NOUN
brj-24352	63	14	ranging	range	VERB
brj-24352	63	15	from	from	ADP
brj-24352	63	16	20	20	NUM
brj-24352	63	17	to	to	PART
brj-24352	63	18	80	80	NUM
brj-24352	63	19	°	°	NOUN
brj-24352	63	20	c	c	NOUN
brj-24352	63	21	for	for	ADP
brj-24352	63	22	30	30	NUM
brj-24352	63	23	min	min	NOUN
brj-24352	63	24	in	in	ADP
brj-24352	63	25	50	50	NUM
brj-24352	63	26	mm	mm	NOUN
brj-24352	63	27	disodium	disodium	NOUN
brj-24352	63	28	hydrogen	hydrogen	NOUN
brj-24352	63	29	phosphate	phosphate	NOUN
brj-24352	63	30	-	-	PUNCT
brj-24352	63	31	citrate	citrate	NOUN
brj-24352	63	32	buffer	buffer	NOUN
brj-24352	63	33	(	(	PUNCT
brj-24352	63	34	ph	ph	NOUN
brj-24352	63	35	5.0	5.0	NUM
brj-24352	63	36	)	)	PUNCT
brj-24352	63	37	with	with	ADP
brj-24352	63	38	1	1	NUM
brj-24352	63	39	%	%	NOUN
brj-24352	63	40	(	(	PUNCT
brj-24352	63	41	w	w	NOUN
brj-24352	63	42	/	/	SYM
brj-24352	63	43	v	v	NOUN
brj-24352	63	44	)	)	PUNCT
brj-24352	63	45	cmc	cmc	NOUN
brj-24352	63	46	-	-	PUNCT
brj-24352	63	47	na	na	PROPN
brj-24352	63	48	.	.	PUNCT
brj-24352	63	49	thermal	thermal	ADJ
brj-24352	63	50	stability	stability	NOUN
brj-24352	63	51	was	be	AUX
brj-24352	63	52	evaluated	evaluate	VERB
brj-24352	63	53	by	by	ADP
brj-24352	63	54	incubating	incubate	VERB
brj-24352	63	55	the	the	DET
brj-24352	63	56	enzyme	enzyme	NOUN
brj-24352	63	57	at	at	ADP
brj-24352	63	58	50	50	NUM
brj-24352	63	59	,	,	PUNCT
brj-24352	63	60	60	60	NUM
brj-24352	63	61	,	,	PUNCT
brj-24352	63	62	70	70	NUM
brj-24352	63	63	,	,	PUNCT
brj-24352	63	64	and	and	CCONJ
brj-24352	63	65	80	80	NUM
brj-24352	63	66	°	°	NUM
brj-24352	63	67	c	c	NOUN
brj-24352	63	68	for	for	ADP
brj-24352	63	69	varying	vary	VERB
brj-24352	63	70	durations	duration	NOUN
brj-24352	63	71	(	(	PUNCT
brj-24352	63	72	5	5	NUM
brj-24352	63	73	,	,	PUNCT
brj-24352	63	74	10	10	NUM
brj-24352	63	75	,	,	PUNCT
brj-24352	63	76	20	20	NUM
brj-24352	63	77	,	,	PUNCT
brj-24352	63	78	and	and	CCONJ
brj-24352	63	79	30	30	NUM
brj-24352	63	80	min	min	NOUN
brj-24352	63	81	)	)	PUNCT
brj-24352	63	82	under	under	ADP
brj-24352	63	83	ph	ph	ADJ
brj-24352	63	84	5.0	5.0	NUM
brj-24352	63	85	conditions	condition	NOUN
brj-24352	63	86	,	,	PUNCT
brj-24352	63	87	followed	follow	VERB
brj-24352	63	88	by	by	ADP
brj-24352	63	89	measuring	measure	VERB
brj-24352	63	90	residual	residual	ADJ
brj-24352	63	91	activity	activity	NOUN
brj-24352	63	92	under	under	ADP
brj-24352	63	93	peer	peer	NOUN
brj-24352	63	94	-	-	PUNCT
brj-24352	63	95	reviewed	review	VERB
brj-24352	63	96	article	article	NOUN
brj-24352	63	97	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	63	98	ouyang	ouyang	PROPN
brj-24352	63	99	et	et	PROPN
brj-24352	63	100	al	al	PROPN
brj-24352	63	101	.	.	PROPN
brj-24352	64	1	(	(	PUNCT
brj-24352	64	2	2025	2025	NUM
brj-24352	64	3	)	)	PUNCT
brj-24352	64	4	.	.	PUNCT
brj-24352	65	1	“	"	PUNCT
brj-24352	65	2	rumen	ruman	NOUN
brj-24352	65	3	cellulase	cellulase	NOUN
brj-24352	65	4	&	&	CCONJ
brj-24352	65	5	ag	ag	PROPN
brj-24352	65	6	waste	waste	PROPN
brj-24352	65	7	,	,	PUNCT
brj-24352	65	8	”	"	PUNCT
brj-24352	65	9	bioresources	bioresource	NOUN
brj-24352	65	10	20(3	20(3	NOUN
brj-24352	65	11	)	)	PUNCT
brj-24352	65	12	,	,	PUNCT
brj-24352	65	13	5501	5501	NUM
brj-24352	65	14	-	-	SYM
brj-24352	65	15	5513	5513	NUM
brj-24352	65	16	.	.	PUNCT
brj-24352	66	1	5504	5504	NUM
brj-24352	66	2	optimal	optimal	ADJ
brj-24352	66	3	conditions	condition	NOUN
brj-24352	66	4	.	.	PUNCT
brj-24352	67	1	thermal	thermal	ADJ
brj-24352	67	2	stability	stability	NOUN
brj-24352	67	3	was	be	AUX
brj-24352	67	4	evaluated	evaluate	VERB
brj-24352	67	5	by	by	ADP
brj-24352	67	6	comparing	compare	VERB
brj-24352	67	7	the	the	DET
brj-24352	67	8	residual	residual	ADJ
brj-24352	67	9	activity	activity	NOUN
brj-24352	67	10	to	to	ADP
brj-24352	67	11	that	that	PRON
brj-24352	67	12	of	of	ADP
brj-24352	67	13	the	the	DET
brj-24352	67	14	untreated	untreated	ADJ
brj-24352	67	15	enzyme	enzyme	NOUN
brj-24352	67	16	sample	sample	NOUN
brj-24352	67	17	,	,	PUNCT
brj-24352	67	18	which	which	PRON
brj-24352	67	19	was	be	AUX
brj-24352	67	20	set	set	VERB
brj-24352	67	21	at	at	ADP
brj-24352	67	22	100	100	NUM
brj-24352	67	23	%	%	NOUN
brj-24352	67	24	.	.	PUNCT
brj-24352	68	1	the	the	DET
brj-24352	68	2	effects	effect	NOUN
brj-24352	68	3	of	of	ADP
brj-24352	68	4	metal	metal	NOUN
brj-24352	68	5	ions	ion	NOUN
brj-24352	68	6	,	,	PUNCT
brj-24352	68	7	including	include	VERB
brj-24352	68	8	k⁺	k⁺	PROPN
brj-24352	68	9	,	,	PUNCT
brj-24352	68	10	ca²⁺	ca²⁺	PROPN
brj-24352	68	11	,	,	PUNCT
brj-24352	68	12	na⁺	na⁺	NOUN
brj-24352	68	13	,	,	PUNCT
brj-24352	68	14	mg²⁺	mg²⁺	NUM
brj-24352	68	15	,	,	PUNCT
brj-24352	68	16	zn²⁺	zn²⁺	NOUN
brj-24352	68	17	,	,	PUNCT
brj-24352	68	18	cu²⁺	cu²⁺	NOUN
brj-24352	68	19	,	,	PUNCT
brj-24352	68	20	mn²⁺	mn²⁺	NOUN
brj-24352	68	21	,	,	PUNCT
brj-24352	68	22	and	and	CCONJ
brj-24352	68	23	ni²⁺	ni²⁺	NOUN
brj-24352	68	24	,	,	PUNCT
brj-24352	68	25	as	as	ADV
brj-24352	68	26	well	well	ADV
brj-24352	68	27	as	as	ADP
brj-24352	68	28	edta	edta	PROPN
brj-24352	68	29	,	,	PUNCT
brj-24352	68	30	sds	sds	PROPN
brj-24352	68	31	,	,	PUNCT
brj-24352	68	32	β	β	NOUN
brj-24352	68	33	-	-	NOUN
brj-24352	68	34	mercaptoethanol	mercaptoethanol	NOUN
brj-24352	68	35	,	,	PUNCT
brj-24352	68	36	and	and	CCONJ
brj-24352	68	37	dtt	dtt	VERB
brj-24352	68	38	,	,	PUNCT
brj-24352	68	39	on	on	ADP
brj-24352	68	40	enzyme	enzyme	NOUN
brj-24352	68	41	activity	activity	NOUN
brj-24352	68	42	were	be	AUX
brj-24352	68	43	examined	examine	VERB
brj-24352	68	44	at	at	ADP
brj-24352	68	45	final	final	ADJ
brj-24352	68	46	concentrations	concentration	NOUN
brj-24352	68	47	of	of	ADP
brj-24352	68	48	1	1	NUM
brj-24352	68	49	and	and	CCONJ
brj-24352	68	50	5	5	NUM
brj-24352	68	51	mm	mm	NOUN
brj-24352	68	52	.	.	PUNCT
brj-24352	69	1	additionally	additionally	ADV
brj-24352	69	2	,	,	PUNCT
brj-24352	69	3	the	the	DET
brj-24352	69	4	impact	impact	NOUN
brj-24352	69	5	of	of	ADP
brj-24352	69	6	tween-20	tween-20	PROPN
brj-24352	69	7	and	and	CCONJ
brj-24352	69	8	triton	triton	PROPN
brj-24352	69	9	x-100	x-100	PROPN
brj-24352	69	10	on	on	ADP
brj-24352	69	11	enzymatic	enzymatic	ADJ
brj-24352	69	12	activity	activity	NOUN
brj-24352	69	13	was	be	AUX
brj-24352	69	14	evaluated	evaluate	VERB
brj-24352	69	15	at	at	ADP
brj-24352	69	16	final	final	ADJ
brj-24352	69	17	concentrations	concentration	NOUN
brj-24352	69	18	of	of	ADP
brj-24352	69	19	1	1	NUM
brj-24352	69	20	%	%	NOUN
brj-24352	69	21	(	(	PUNCT
brj-24352	69	22	v	v	NOUN
brj-24352	69	23	/	/	SYM
brj-24352	69	24	v	v	NOUN
brj-24352	69	25	)	)	PUNCT
brj-24352	69	26	and	and	CCONJ
brj-24352	69	27	5	5	NUM
brj-24352	69	28	%	%	NOUN
brj-24352	69	29	(	(	PUNCT
brj-24352	69	30	v	v	NOUN
brj-24352	69	31	/	/	SYM
brj-24352	69	32	v	v	NOUN
brj-24352	69	33	)	)	PUNCT
brj-24352	69	34	.	.	PUNCT
brj-24352	70	1	all	all	DET
brj-24352	70	2	reactions	reaction	NOUN
brj-24352	70	3	were	be	AUX
brj-24352	70	4	carried	carry	VERB
brj-24352	70	5	out	out	ADP
brj-24352	70	6	under	under	ADP
brj-24352	70	7	optimal	optimal	ADJ
brj-24352	70	8	conditions	condition	NOUN
brj-24352	70	9	in	in	ADP
brj-24352	70	10	a	a	DET
brj-24352	70	11	50	50	NUM
brj-24352	70	12	mm	mm	NOUN
brj-24352	70	13	disodium	disodium	NOUN
brj-24352	70	14	hydrogen	hydrogen	NOUN
brj-24352	70	15	phosphate	phosphate	NOUN
brj-24352	70	16	-	-	PUNCT
brj-24352	70	17	citrate	citrate	NOUN
brj-24352	70	18	buffer	buffer	NOUN
brj-24352	70	19	.	.	PUNCT
brj-24352	71	1	a	a	DET
brj-24352	71	2	reaction	reaction	NOUN
brj-24352	71	3	mixture	mixture	NOUN
brj-24352	71	4	without	without	ADP
brj-24352	71	5	any	any	DET
brj-24352	71	6	additives	additive	NOUN
brj-24352	71	7	served	serve	VERB
brj-24352	71	8	as	as	ADP
brj-24352	71	9	the	the	DET
brj-24352	71	10	positive	positive	ADJ
brj-24352	71	11	control	control	NOUN
brj-24352	71	12	,	,	PUNCT
brj-24352	71	13	and	and	CCONJ
brj-24352	71	14	its	its	PRON
brj-24352	71	15	activity	activity	NOUN
brj-24352	71	16	was	be	AUX
brj-24352	71	17	defined	define	VERB
brj-24352	71	18	as	as	ADP
brj-24352	71	19	100	100	NUM
brj-24352	71	20	%	%	NOUN
brj-24352	71	21	.	.	PUNCT
brj-24352	72	1	hydrolysis	hydrolysis	NOUN
brj-24352	72	2	of	of	ADP
brj-24352	72	3	agricultural	agricultural	ADJ
brj-24352	72	4	wastes	waste	NOUN
brj-24352	72	5	by	by	ADP
brj-24352	72	6	rucel224	rucel224	PROPN
brj-24352	72	7	to	to	PART
brj-24352	72	8	evaluate	evaluate	VERB
brj-24352	72	9	the	the	DET
brj-24352	72	10	lignocellulose	lignocellulose	NOUN
brj-24352	72	11	-	-	PUNCT
brj-24352	72	12	degrading	degrade	VERB
brj-24352	72	13	potential	potential	NOUN
brj-24352	72	14	of	of	ADP
brj-24352	72	15	rucel224	rucel224	PROPN
brj-24352	72	16	,	,	PUNCT
brj-24352	72	17	substrates	substrate	NOUN
brj-24352	72	18	including	include	VERB
brj-24352	72	19	wheat	wheat	NOUN
brj-24352	72	20	bran	bran	NOUN
brj-24352	72	21	,	,	PUNCT
brj-24352	72	22	rice	rice	NOUN
brj-24352	72	23	straw	straw	NOUN
brj-24352	72	24	,	,	PUNCT
brj-24352	72	25	wheat	wheat	NOUN
brj-24352	72	26	straw	straw	NOUN
brj-24352	72	27	,	,	PUNCT
brj-24352	72	28	corn	corn	NOUN
brj-24352	72	29	stalk	stalk	NOUN
brj-24352	72	30	,	,	PUNCT
brj-24352	72	31	soybean	soybean	NOUN
brj-24352	72	32	straw	straw	NOUN
brj-24352	72	33	,	,	PUNCT
brj-24352	72	34	rape	rape	NOUN
brj-24352	72	35	straw	straw	NOUN
brj-24352	72	36	,	,	PUNCT
brj-24352	72	37	and	and	CCONJ
brj-24352	72	38	camellia	camellia	NOUN
brj-24352	72	39	oleifera	oleifera	NOUN
brj-24352	72	40	meal	meal	NOUN
brj-24352	72	41	were	be	AUX
brj-24352	72	42	tested	test	VERB
brj-24352	72	43	at	at	ADP
brj-24352	72	44	a	a	DET
brj-24352	72	45	final	final	ADJ
brj-24352	72	46	concentration	concentration	NOUN
brj-24352	72	47	of	of	ADP
brj-24352	72	48	1	1	NUM
brj-24352	72	49	%	%	NOUN
brj-24352	72	50	(	(	PUNCT
brj-24352	72	51	w	w	NOUN
brj-24352	72	52	/	/	SYM
brj-24352	72	53	v	v	NOUN
brj-24352	72	54	)	)	PUNCT
brj-24352	72	55	.	.	PUNCT
brj-24352	73	1	reactions	reaction	NOUN
brj-24352	73	2	were	be	AUX
brj-24352	73	3	performed	perform	VERB
brj-24352	73	4	in	in	ADP
brj-24352	73	5	50	50	NUM
brj-24352	73	6	mm	mm	NOUN
brj-24352	73	7	disodium	disodium	NOUN
brj-24352	73	8	hydrogen	hydrogen	NOUN
brj-24352	73	9	phosphate	phosphate	NOUN
brj-24352	73	10	-	-	PUNCT
brj-24352	73	11	citrate	citrate	NOUN
brj-24352	73	12	buffer	buffer	NOUN
brj-24352	73	13	(	(	PUNCT
brj-24352	73	14	ph	ph	NOUN
brj-24352	73	15	5.0	5.0	NUM
brj-24352	73	16	)	)	PUNCT
brj-24352	73	17	at	at	ADP
brj-24352	73	18	35	35	NUM
brj-24352	73	19	°	°	ADP
brj-24352	73	20	c	c	NOUN
brj-24352	73	21	under	under	ADP
brj-24352	73	22	optimal	optimal	ADJ
brj-24352	73	23	enzyme	enzyme	NOUN
brj-24352	73	24	conditions	condition	NOUN
brj-24352	73	25	.	.	PUNCT
brj-24352	74	1	control	control	NOUN
brj-24352	74	2	reactions	reaction	NOUN
brj-24352	74	3	without	without	ADP
brj-24352	74	4	enzyme	enzyme	NOUN
brj-24352	74	5	were	be	AUX
brj-24352	74	6	conducted	conduct	VERB
brj-24352	74	7	in	in	ADP
brj-24352	74	8	parallel	parallel	NOUN
brj-24352	74	9	to	to	PART
brj-24352	74	10	establish	establish	VERB
brj-24352	74	11	the	the	DET
brj-24352	74	12	baseline	baseline	ADJ
brj-24352	74	13	hydrolysis	hydrolysis	NOUN
brj-24352	74	14	of	of	ADP
brj-24352	74	15	each	each	DET
brj-24352	74	16	substrate	substrate	NOUN
brj-24352	74	17	.	.	PUNCT
brj-24352	75	1	hydrolytic	hydrolytic	ADJ
brj-24352	75	2	efficiency	efficiency	NOUN
brj-24352	75	3	was	be	AUX
brj-24352	75	4	assessed	assess	VERB
brj-24352	75	5	by	by	ADP
brj-24352	75	6	comparing	compare	VERB
brj-24352	75	7	the	the	DET
brj-24352	75	8	reducing	reduce	VERB
brj-24352	75	9	sugars	sugar	NOUN
brj-24352	75	10	released	release	VERB
brj-24352	75	11	from	from	ADP
brj-24352	75	12	enzyme	enzyme	NOUN
brj-24352	75	13	-	-	PUNCT
brj-24352	75	14	treated	treat	VERB
brj-24352	75	15	samples	sample	NOUN
brj-24352	75	16	to	to	ADP
brj-24352	75	17	those	those	PRON
brj-24352	75	18	of	of	ADP
brj-24352	75	19	the	the	DET
brj-24352	75	20	controls	control	NOUN
brj-24352	75	21	.	.	PUNCT
brj-24352	76	1	statistical	statistical	ADJ
brj-24352	76	2	analyses	analysis	NOUN
brj-24352	76	3	statistical	statistical	ADJ
brj-24352	76	4	analysis	analysis	NOUN
brj-24352	76	5	was	be	AUX
brj-24352	76	6	performed	perform	VERB
brj-24352	76	7	using	use	VERB
brj-24352	76	8	a	a	DET
brj-24352	76	9	one	one	NUM
brj-24352	76	10	-	-	PUNCT
brj-24352	76	11	way	way	NOUN
brj-24352	76	12	anova	anova	PROPN
brj-24352	76	13	in	in	ADP
brj-24352	76	14	ibm	ibm	PROPN
brj-24352	76	15	spss	spss	PROPN
brj-24352	76	16	statistics	statistics	PROPN
brj-24352	76	17	version	version	PROPN
brj-24352	76	18	27	27	NUM
brj-24352	76	19	(	(	PUNCT
brj-24352	76	20	ibm	ibm	PROPN
brj-24352	76	21	,	,	PUNCT
brj-24352	76	22	chicago	chicago	PROPN
brj-24352	76	23	,	,	PUNCT
brj-24352	76	24	il	il	PROPN
brj-24352	76	25	,	,	PUNCT
brj-24352	76	26	united	united	PROPN
brj-24352	76	27	states	states	PROPN
brj-24352	76	28	)	)	PUNCT
brj-24352	76	29	.	.	PUNCT
brj-24352	77	1	significance	significance	NOUN
brj-24352	77	2	was	be	AUX
brj-24352	77	3	declared	declare	VERB
brj-24352	77	4	at	at	ADP
brj-24352	77	5	p	p	NOUN
brj-24352	77	6	≤	≤	NUM
brj-24352	77	7	0.05	0.05	NUM
brj-24352	77	8	.	.	PUNCT
brj-24352	78	1	results	result	NOUN
brj-24352	78	2	and	and	CCONJ
brj-24352	78	3	discussion	discussion	NOUN
brj-24352	78	4	expression	expression	NOUN
brj-24352	78	5	of	of	ADP
brj-24352	78	6	the	the	DET
brj-24352	78	7	rucel224	rucel224	PROPN
brj-24352	78	8	the	the	DET
brj-24352	78	9	rucel224	rucel224	PROPN
brj-24352	78	10	gene	gene	NOUN
brj-24352	78	11	was	be	AUX
brj-24352	78	12	successfully	successfully	ADV
brj-24352	78	13	cloned	clone	VERB
brj-24352	78	14	into	into	ADP
brj-24352	78	15	the	the	DET
brj-24352	78	16	pet-28a	pet-28a	NUM
brj-24352	78	17	expression	expression	NOUN
brj-24352	78	18	vector	vector	NOUN
brj-24352	78	19	and	and	CCONJ
brj-24352	78	20	heterologously	heterologously	ADV
brj-24352	78	21	expressed	express	VERB
brj-24352	78	22	in	in	ADP
brj-24352	78	23	e.	e.	PROPN
brj-24352	78	24	coli	coli	PROPN
brj-24352	78	25	bl21(de3	bl21(de3	NOUN
brj-24352	78	26	)	)	PUNCT
brj-24352	78	27	under	under	ADP
brj-24352	78	28	iptg	iptg	NOUN
brj-24352	78	29	induction	induction	NOUN
brj-24352	78	30	conditions	condition	NOUN
brj-24352	78	31	.	.	PUNCT
brj-24352	79	1	fig	fig	NOUN
brj-24352	79	2	.	.	PUNCT
brj-24352	80	1	1	1	X
brj-24352	80	2	.	.	X
brj-24352	80	3	analysis	analysis	NOUN
brj-24352	80	4	of	of	ADP
brj-24352	80	5	rucel224	rucel224	PROPN
brj-24352	80	6	by	by	ADP
brj-24352	80	7	sds	sds	PROPN
brj-24352	80	8	-	-	PUNCT
brj-24352	80	9	page	page	NOUN
brj-24352	80	10	.	.	PUNCT
brj-24352	81	1	m	m	PROPN
brj-24352	81	2	,	,	PUNCT
brj-24352	81	3	protein	protein	NOUN
brj-24352	81	4	marker	marker	NOUN
brj-24352	81	5	;	;	PUNCT
brj-24352	81	6	1	1	NUM
brj-24352	81	7	,	,	PUNCT
brj-24352	81	8	non	non	ADJ
brj-24352	81	9	-	-	ADJ
brj-24352	81	10	transformed	transform	VERB
brj-24352	81	11	e.	e.	PROPN
brj-24352	81	12	coli	coli	NOUN
brj-24352	82	1	bl21	bl21	PROPN
brj-24352	82	2	(	(	PUNCT
brj-24352	82	3	de3	de3	PROPN
brj-24352	82	4	)	)	PUNCT
brj-24352	82	5	;	;	PUNCT
brj-24352	82	6	2	2	NUM
brj-24352	82	7	,	,	PUNCT
brj-24352	82	8	uninduced	uninduced	ADJ
brj-24352	82	9	rucel224	rucel224	PROPN
brj-24352	82	10	;	;	PUNCT
brj-24352	82	11	3	3	NUM
brj-24352	82	12	,	,	PUNCT
brj-24352	82	13	rucel224	rucel224	PROPN
brj-24352	82	14	transformants	transformant	NOUN
brj-24352	82	15	induced	induce	VERB
brj-24352	82	16	with	with	ADP
brj-24352	82	17	0.2	0.2	NUM
brj-24352	82	18	mm	mm	NOUN
brj-24352	82	19	iptg	iptg	NOUN
brj-24352	82	20	;	;	PUNCT
brj-24352	82	21	4	4	NUM
brj-24352	82	22	,	,	PUNCT
brj-24352	82	23	the	the	DET
brj-24352	82	24	supernatant	supernatant	NOUN
brj-24352	82	25	after	after	ADP
brj-24352	82	26	inducing	induce	VERB
brj-24352	82	27	rucel224	rucel224	PROPN
brj-24352	82	28	;	;	PUNCT
brj-24352	82	29	5	5	NUM
brj-24352	82	30	,	,	PUNCT
brj-24352	82	31	purified	purified	ADJ
brj-24352	82	32	rucel224	rucel224	PROPN
brj-24352	82	33	.	.	PUNCT
brj-24352	82	34	sds	sds	PROPN
brj-24352	82	35	-	-	PUNCT
brj-24352	82	36	page	page	NOUN
brj-24352	82	37	analysis	analysis	NOUN
brj-24352	82	38	revealed	reveal	VERB
brj-24352	82	39	that	that	SCONJ
brj-24352	82	40	the	the	DET
brj-24352	82	41	recombinant	recombinant	ADJ
brj-24352	82	42	protein	protein	NOUN
brj-24352	82	43	accumulated	accumulate	VERB
brj-24352	82	44	with	with	ADP
brj-24352	82	45	an	an	DET
brj-24352	82	46	peer	peer	NOUN
brj-24352	82	47	-	-	PUNCT
brj-24352	82	48	reviewed	review	VERB
brj-24352	82	49	article	article	NOUN
brj-24352	82	50	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	82	51	ouyang	ouyang	PROPN
brj-24352	82	52	et	et	PROPN
brj-24352	82	53	al	al	PROPN
brj-24352	82	54	.	.	PROPN
brj-24352	83	1	(	(	PUNCT
brj-24352	83	2	2025	2025	NUM
brj-24352	83	3	)	)	PUNCT
brj-24352	83	4	.	.	PUNCT
brj-24352	84	1	“	"	PUNCT
brj-24352	84	2	rumen	ruman	NOUN
brj-24352	84	3	cellulase	cellulase	NOUN
brj-24352	84	4	&	&	CCONJ
brj-24352	84	5	ag	ag	PROPN
brj-24352	84	6	waste	waste	PROPN
brj-24352	84	7	,	,	PUNCT
brj-24352	84	8	”	"	PUNCT
brj-24352	84	9	bioresources	bioresource	NOUN
brj-24352	84	10	20(3	20(3	NOUN
brj-24352	84	11	)	)	PUNCT
brj-24352	84	12	,	,	PUNCT
brj-24352	84	13	5501	5501	NUM
brj-24352	84	14	-	-	SYM
brj-24352	84	15	5513	5513	NUM
brj-24352	84	16	.	.	PUNCT
brj-24352	85	1	5505	5505	NUM
brj-24352	85	2	approximate	approximate	ADJ
brj-24352	85	3	molecular	molecular	ADJ
brj-24352	85	4	weight	weight	NOUN
brj-24352	85	5	of	of	ADP
brj-24352	85	6	43	43	NUM
brj-24352	85	7	kda	kda	NOUN
brj-24352	85	8	(	(	PUNCT
brj-24352	85	9	fig	fig	NOUN
brj-24352	85	10	.	.	PUNCT
brj-24352	85	11	1	1	NUM
brj-24352	85	12	)	)	PUNCT
brj-24352	85	13	,	,	PUNCT
brj-24352	85	14	which	which	PRON
brj-24352	85	15	is	be	AUX
brj-24352	85	16	consistent	consistent	ADJ
brj-24352	85	17	with	with	ADP
brj-24352	85	18	the	the	DET
brj-24352	85	19	theoretical	theoretical	ADJ
brj-24352	85	20	molecular	molecular	ADJ
brj-24352	85	21	weight	weight	NOUN
brj-24352	85	22	predicted	predict	VERB
brj-24352	85	23	from	from	ADP
brj-24352	85	24	the	the	DET
brj-24352	85	25	amino	amino	NOUN
brj-24352	85	26	acid	acid	NOUN
brj-24352	85	27	sequence	sequence	NOUN
brj-24352	85	28	of	of	ADP
brj-24352	85	29	rucel224	rucel224	PROPN
brj-24352	85	30	.	.	PUNCT
brj-24352	86	1	this	this	DET
brj-24352	86	2	result	result	VERB
brj-24352	86	3	not	not	PART
brj-24352	86	4	only	only	ADV
brj-24352	86	5	confirms	confirm	VERB
brj-24352	86	6	the	the	DET
brj-24352	86	7	successful	successful	ADJ
brj-24352	86	8	expression	expression	NOUN
brj-24352	86	9	of	of	ADP
brj-24352	86	10	the	the	DET
brj-24352	86	11	target	target	NOUN
brj-24352	86	12	protein	protein	NOUN
brj-24352	86	13	,	,	PUNCT
brj-24352	86	14	but	but	CCONJ
brj-24352	86	15	it	it	PRON
brj-24352	86	16	also	also	ADV
brj-24352	86	17	suggests	suggest	VERB
brj-24352	86	18	proper	proper	ADJ
brj-24352	86	19	protein	protein	NOUN
brj-24352	86	20	folding	folding	NOUN
brj-24352	86	21	and	and	CCONJ
brj-24352	86	22	absence	absence	NOUN
brj-24352	86	23	of	of	ADP
brj-24352	86	24	major	major	ADJ
brj-24352	86	25	degradation	degradation	NOUN
brj-24352	86	26	products	product	NOUN
brj-24352	86	27	,	,	PUNCT
brj-24352	86	28	as	as	SCONJ
brj-24352	86	29	evidenced	evidence	VERB
brj-24352	86	30	by	by	ADP
brj-24352	86	31	the	the	DET
brj-24352	86	32	clear	clear	ADJ
brj-24352	86	33	single	single	ADJ
brj-24352	86	34	band	band	NOUN
brj-24352	86	35	on	on	ADP
brj-24352	86	36	the	the	DET
brj-24352	86	37	sds	sds	NOUN
brj-24352	86	38	-	-	PUNCT
brj-24352	86	39	page	page	NOUN
brj-24352	86	40	gel	gel	NOUN
brj-24352	86	41	.	.	PUNCT
brj-24352	87	1	substrate	substrate	NOUN
brj-24352	87	2	specificity	specificity	NOUN
brj-24352	87	3	to	to	PART
brj-24352	87	4	evaluate	evaluate	VERB
brj-24352	87	5	the	the	DET
brj-24352	87	6	substrate	substrate	NOUN
brj-24352	87	7	specificity	specificity	NOUN
brj-24352	87	8	of	of	ADP
brj-24352	87	9	rucel224	rucel224	PROPN
brj-24352	87	10	,	,	PUNCT
brj-24352	87	11	its	its	PRON
brj-24352	87	12	enzymatic	enzymatic	ADJ
brj-24352	87	13	activities	activity	NOUN
brj-24352	87	14	were	be	AUX
brj-24352	87	15	measured	measure	VERB
brj-24352	87	16	using	use	VERB
brj-24352	87	17	five	five	NUM
brj-24352	87	18	substrates	substrate	NOUN
brj-24352	87	19	:	:	PUNCT
brj-24352	87	20	cmc	cmc	NOUN
brj-24352	87	21	-	-	PUNCT
brj-24352	87	22	na	na	PROPN
brj-24352	87	23	,	,	PUNCT
brj-24352	87	24	wheat	wheat	NOUN
brj-24352	87	25	straw	straw	PROPN
brj-24352	87	26	xylan	xylan	PROPN
brj-24352	87	27	,	,	PUNCT
brj-24352	87	28	avicel	avicel	PROPN
brj-24352	87	29	,	,	PUNCT
brj-24352	87	30	chitosan	chitosan	NOUN
brj-24352	87	31	,	,	PUNCT
brj-24352	87	32	and	and	CCONJ
brj-24352	87	33	pachyman	pachyman	NOUN
brj-24352	87	34	.	.	PUNCT
brj-24352	88	1	as	as	SCONJ
brj-24352	88	2	shown	show	VERB
brj-24352	88	3	in	in	ADP
brj-24352	88	4	table	table	NOUN
brj-24352	88	5	1	1	NUM
brj-24352	88	6	,	,	PUNCT
brj-24352	88	7	rucel224	rucel224	PROPN
brj-24352	88	8	had	have	VERB
brj-24352	88	9	the	the	DET
brj-24352	88	10	highest	high	ADJ
brj-24352	88	11	activity	activity	NOUN
brj-24352	88	12	against	against	ADP
brj-24352	88	13	cmc	cmc	NOUN
brj-24352	88	14	-	-	PUNCT
brj-24352	88	15	na	na	PROPN
brj-24352	88	16	(	(	PUNCT
brj-24352	88	17	0.861	0.861	NUM
brj-24352	88	18	±	±	NUM
brj-24352	88	19	0.011	0.011	NUM
brj-24352	88	20	u	u	NOUN
brj-24352	88	21	/	/	SYM
brj-24352	88	22	mg	mg	PROPN
brj-24352	88	23	)	)	PUNCT
brj-24352	88	24	,	,	PUNCT
brj-24352	88	25	indicating	indicate	VERB
brj-24352	88	26	a	a	DET
brj-24352	88	27	strong	strong	ADJ
brj-24352	88	28	ability	ability	NOUN
brj-24352	88	29	to	to	PART
brj-24352	88	30	degrade	degrade	VERB
brj-24352	88	31	cellulose	cellulose	NOUN
brj-24352	88	32	,	,	PUNCT
brj-24352	88	33	particularly	particularly	ADV
brj-24352	88	34	amorphous	amorphous	ADJ
brj-24352	88	35	polysaccharides	polysaccharide	NOUN
brj-24352	88	36	.	.	PUNCT
brj-24352	89	1	the	the	DET
brj-24352	89	2	enzyme	enzyme	NOUN
brj-24352	89	3	also	also	ADV
brj-24352	89	4	showed	show	VERB
brj-24352	89	5	moderate	moderate	ADJ
brj-24352	89	6	activity	activity	NOUN
brj-24352	89	7	on	on	ADP
brj-24352	89	8	wheat	wheat	NOUN
brj-24352	89	9	straw	straw	NOUN
brj-24352	89	10	xylan	xylan	PROPN
brj-24352	89	11	(	(	PUNCT
brj-24352	89	12	0.150	0.150	NUM
brj-24352	89	13	±	±	NUM
brj-24352	89	14	0.050	0.050	NUM
brj-24352	89	15	u	u	NOUN
brj-24352	89	16	/	/	SYM
brj-24352	89	17	mg	mg	PROPN
brj-24352	89	18	)	)	PUNCT
brj-24352	89	19	,	,	PUNCT
brj-24352	89	20	suggesting	suggest	VERB
brj-24352	89	21	some	some	DET
brj-24352	89	22	ability	ability	NOUN
brj-24352	89	23	to	to	PART
brj-24352	89	24	hydrolyze	hydrolyze	VERB
brj-24352	89	25	hemicellulose	hemicellulose	NOUN
brj-24352	89	26	.	.	PUNCT
brj-24352	90	1	in	in	ADP
brj-24352	90	2	contrast	contrast	NOUN
brj-24352	90	3	,	,	PUNCT
brj-24352	90	4	significantly	significantly	ADV
brj-24352	90	5	lower	low	ADJ
brj-24352	90	6	activities	activity	NOUN
brj-24352	90	7	were	be	AUX
brj-24352	90	8	observed	observe	VERB
brj-24352	90	9	for	for	ADP
brj-24352	90	10	avicel	avicel	PROPN
brj-24352	90	11	,	,	PUNCT
brj-24352	90	12	chitosan	chitosan	NOUN
brj-24352	90	13	,	,	PUNCT
brj-24352	90	14	and	and	CCONJ
brj-24352	90	15	pachyman	pachyman	NOUN
brj-24352	90	16	.	.	PUNCT
brj-24352	91	1	this	this	DET
brj-24352	91	2	reduced	reduce	VERB
brj-24352	91	3	enzymatic	enzymatic	ADJ
brj-24352	91	4	efficiency	efficiency	NOUN
brj-24352	91	5	can	can	AUX
brj-24352	91	6	be	be	AUX
brj-24352	91	7	attributed	attribute	VERB
brj-24352	91	8	to	to	ADP
brj-24352	91	9	the	the	DET
brj-24352	91	10	substrates	substrate	NOUN
brj-24352	91	11	’	'	PUNCT
brj-24352	91	12	higher	high	ADJ
brj-24352	91	13	structural	structural	ADJ
brj-24352	91	14	complexity	complexity	NOUN
brj-24352	91	15	and	and	CCONJ
brj-24352	91	16	recalcitrance	recalcitrance	NOUN
brj-24352	91	17	.	.	PUNCT
brj-24352	92	1	lower	low	ADJ
brj-24352	92	2	activity	activity	NOUN
brj-24352	92	3	was	be	AUX
brj-24352	92	4	observed	observe	VERB
brj-24352	92	5	with	with	ADP
brj-24352	92	6	avicel	avicel	PROPN
brj-24352	92	7	,	,	PUNCT
brj-24352	92	8	chitosan	chitosan	NOUN
brj-24352	92	9	,	,	PUNCT
brj-24352	92	10	and	and	CCONJ
brj-24352	92	11	pachyman	pachyman	NOUN
brj-24352	92	12	,	,	PUNCT
brj-24352	92	13	which	which	PRON
brj-24352	92	14	was	be	AUX
brj-24352	92	15	likely	likely	ADJ
brj-24352	92	16	due	due	ADP
brj-24352	92	17	to	to	ADP
brj-24352	92	18	their	their	PRON
brj-24352	92	19	higher	high	ADJ
brj-24352	92	20	structural	structural	ADJ
brj-24352	92	21	complexity	complexity	NOUN
brj-24352	92	22	.	.	PUNCT
brj-24352	93	1	for	for	ADP
brj-24352	93	2	instance	instance	NOUN
brj-24352	93	3	,	,	PUNCT
brj-24352	93	4	avicel	avicel	PROPN
brj-24352	93	5	’s	’s	PART
brj-24352	93	6	crystalline	crystalline	NOUN
brj-24352	93	7	cellulose	cellulose	NOUN
brj-24352	93	8	is	be	AUX
brj-24352	93	9	more	more	ADV
brj-24352	93	10	resistant	resistant	ADJ
brj-24352	93	11	to	to	ADP
brj-24352	93	12	hydrolysis	hydrolysis	NOUN
brj-24352	93	13	than	than	ADP
brj-24352	93	14	the	the	DET
brj-24352	93	15	amorphous	amorphous	ADJ
brj-24352	93	16	cmc	cmc	NOUN
brj-24352	93	17	-	-	PUNCT
brj-24352	93	18	na	na	PROPN
brj-24352	93	19	(	(	PUNCT
brj-24352	93	20	gao	gao	PROPN
brj-24352	93	21	et	et	PROPN
brj-24352	93	22	al	al	PROPN
brj-24352	93	23	.	.	PROPN
brj-24352	93	24	2014	2014	NUM
brj-24352	93	25	)	)	PUNCT
brj-24352	93	26	,	,	PUNCT
brj-24352	93	27	and	and	CCONJ
brj-24352	93	28	pachyman	pachyman	NOUN
brj-24352	93	29	’s	’s	PART
brj-24352	93	30	unique	unique	ADJ
brj-24352	93	31	β-(1,3)and	β-(1,3)and	NUM
brj-24352	93	32	β-(1,6)-glycosidic	β-(1,6)-glycosidic	ADJ
brj-24352	93	33	linkages	linkage	NOUN
brj-24352	93	34	may	may	AUX
brj-24352	93	35	limit	limit	VERB
brj-24352	93	36	enzyme	enzyme	NOUN
brj-24352	93	37	access	access	NOUN
brj-24352	93	38	(	(	PUNCT
brj-24352	93	39	gupta	gupta	PROPN
brj-24352	93	40	and	and	CCONJ
brj-24352	93	41	lee	lee	PROPN
brj-24352	93	42	2009	2009	NUM
brj-24352	93	43	)	)	PUNCT
brj-24352	93	44	.	.	PUNCT
brj-24352	94	1	these	these	DET
brj-24352	94	2	results	result	NOUN
brj-24352	94	3	suggest	suggest	VERB
brj-24352	94	4	that	that	SCONJ
brj-24352	94	5	rucel224	rucel224	PROPN
brj-24352	94	6	primarily	primarily	ADV
brj-24352	94	7	targets	target	VERB
brj-24352	94	8	β-(1,4)-linked	β-(1,4)-linked	NUM
brj-24352	94	9	glucans	glucan	NOUN
brj-24352	94	10	,	,	PUNCT
brj-24352	94	11	consistent	consistent	ADJ
brj-24352	94	12	with	with	ADP
brj-24352	94	13	its	its	PRON
brj-24352	94	14	classification	classification	NOUN
brj-24352	94	15	as	as	ADP
brj-24352	94	16	a	a	DET
brj-24352	94	17	cellulase	cellulase	NOUN
brj-24352	94	18	(	(	PUNCT
brj-24352	94	19	ec	ec	PROPN
brj-24352	94	20	3.2.1.4	3.2.1.4	NUM
brj-24352	94	21	)	)	PUNCT
brj-24352	94	22	.	.	PUNCT
brj-24352	95	1	however	however	ADV
brj-24352	95	2	,	,	PUNCT
brj-24352	95	3	the	the	DET
brj-24352	95	4	assay	assay	NOUN
brj-24352	95	5	conditions	condition	NOUN
brj-24352	95	6	(	(	PUNCT
brj-24352	95	7	e.g.	e.g.	ADV
brj-24352	95	8	,	,	PUNCT
brj-24352	95	9	temperature	temperature	NOUN
brj-24352	95	10	,	,	PUNCT
brj-24352	95	11	reaction	reaction	NOUN
brj-24352	95	12	time	time	NOUN
brj-24352	95	13	,	,	PUNCT
brj-24352	95	14	ph	ph	VERB
brj-24352	95	15	)	)	PUNCT
brj-24352	95	16	were	be	AUX
brj-24352	95	17	not	not	PART
brj-24352	95	18	fully	fully	ADV
brj-24352	95	19	optimized	optimize	VERB
brj-24352	95	20	,	,	PUNCT
brj-24352	95	21	which	which	PRON
brj-24352	95	22	could	could	AUX
brj-24352	95	23	affect	affect	VERB
brj-24352	95	24	the	the	DET
brj-24352	95	25	results	result	NOUN
brj-24352	95	26	.	.	PUNCT
brj-24352	96	1	table	table	NOUN
brj-24352	96	2	1	1	NUM
brj-24352	96	3	.	.	PUNCT
brj-24352	96	4	substrate	substrate	NOUN
brj-24352	96	5	specificity	specificity	NOUN
brj-24352	96	6	of	of	ADP
brj-24352	96	7	rucel143	rucel143	PROPN
brj-24352	96	8	substrates	substrate	VERB
brj-24352	96	9	main	main	ADJ
brj-24352	96	10	linkage	linkage	NOUN
brj-24352	96	11	enzyme	enzyme	NOUN
brj-24352	96	12	activity	activity	NOUN
brj-24352	96	13	(	(	PUNCT
brj-24352	96	14	u	u	NOUN
brj-24352	96	15	/	/	SYM
brj-24352	96	16	mg	mg	NOUN
brj-24352	96	17	)	)	PUNCT
brj-24352	96	18	cmc	cmc	NOUN
brj-24352	96	19	-	-	PUNCT
brj-24352	96	20	na	na	NOUN
brj-24352	96	21	1,4	1,4	NUM
brj-24352	96	22	-	-	PUNCT
brj-24352	96	23	β-(glucose	β-(glucose	NUM
brj-24352	96	24	)	)	PUNCT
brj-24352	96	25	0.861	0.861	NUM
brj-24352	96	26	±	±	NUM
brj-24352	96	27	0.011	0.011	NUM
brj-24352	96	28	wheat	wheat	NOUN
brj-24352	96	29	straw	straw	NOUN
brj-24352	96	30	xylan	xylan	PROPN
brj-24352	96	31	1,4	1,4	PROPN
brj-24352	96	32	-	-	SYM
brj-24352	96	33	β-(xylose	β-(xylose	NUM
brj-24352	96	34	)	)	PUNCT
brj-24352	96	35	0.150	0.150	NUM
brj-24352	96	36	±	±	NUM
brj-24352	96	37	0.050	0.050	NUM
brj-24352	96	38	avicel	avicel	PROPN
brj-24352	96	39	1,4	1,4	NUM
brj-24352	96	40	-	-	PUNCT
brj-24352	96	41	β-(glucose	β-(glucose	NUM
brj-24352	96	42	)	)	PUNCT
brj-24352	96	43	0.025	0.025	NUM
brj-24352	96	44	±	±	NUM
brj-24352	96	45	0.002	0.002	NUM
brj-24352	96	46	chitosan	chitosan	NOUN
brj-24352	96	47	1,4	1,4	ADV
brj-24352	96	48	-	-	PUNCT
brj-24352	96	49	β-(glucosamine)/1,4	β-(glucosamine)/1,4	ADV
brj-24352	96	50	-	-	PUNCT
brj-24352	96	51	β-(nacetylglucosamine	β-(nacetylglucosamine	NUM
brj-24352	96	52	)	)	PUNCT
brj-24352	96	53	0.019	0.019	NUM
brj-24352	96	54	±	±	NUM
brj-24352	96	55	0.001	0.001	NUM
brj-24352	96	56	pachyman	pachyman	NOUN
brj-24352	96	57	1,3	1,3	NUM
brj-24352	96	58	-	-	PUNCT
brj-24352	96	59	β-(glucose	β-(glucose	NUM
brj-24352	96	60	)	)	PUNCT
brj-24352	96	61	0.047	0.047	NUM
brj-24352	96	62	±	±	NUM
brj-24352	96	63	0.009	0.009	NUM
brj-24352	96	64	note	note	NOUN
brj-24352	96	65	:	:	PUNCT
brj-24352	96	66	enzyme	enzyme	NOUN
brj-24352	96	67	activity	activity	NOUN
brj-24352	96	68	values	value	NOUN
brj-24352	96	69	are	be	AUX
brj-24352	96	70	expressed	express	VERB
brj-24352	96	71	as	as	ADP
brj-24352	96	72	mean	mean	NOUN
brj-24352	96	73	±	±	NUM
brj-24352	96	74	sd	sd	NOUN
brj-24352	96	75	(	(	PUNCT
brj-24352	96	76	n	n	NOUN
brj-24352	96	77	=	=	SYM
brj-24352	96	78	3	3	NUM
brj-24352	96	79	)	)	PUNCT
brj-24352	96	80	.	.	PUNCT
brj-24352	97	1	assays	assay	NOUN
brj-24352	97	2	were	be	AUX
brj-24352	97	3	performed	perform	VERB
brj-24352	97	4	at	at	ADP
brj-24352	97	5	40	40	NUM
brj-24352	97	6	°	°	NOUN
brj-24352	97	7	c	c	NOUN
brj-24352	97	8	,	,	PUNCT
brj-24352	97	9	ph	ph	X
brj-24352	97	10	6.0	6.0	NUM
brj-24352	97	11	.	.	PUNCT
brj-24352	98	1	characterization	characterization	NOUN
brj-24352	98	2	of	of	ADP
brj-24352	98	3	rucel224	rucel224	PROPN
brj-24352	98	4	this	this	DET
brj-24352	98	5	study	study	NOUN
brj-24352	98	6	used	use	VERB
brj-24352	98	7	cmc	cmc	PROPN
brj-24352	98	8	-	-	PUNCT
brj-24352	98	9	na	na	NOUN
brj-24352	98	10	as	as	ADP
brj-24352	98	11	a	a	DET
brj-24352	98	12	substrate	substrate	NOUN
brj-24352	98	13	to	to	PART
brj-24352	98	14	investigate	investigate	VERB
brj-24352	98	15	the	the	DET
brj-24352	98	16	cellulase	cellulase	NOUN
brj-24352	98	17	characteristics	characteristic	NOUN
brj-24352	98	18	of	of	ADP
brj-24352	98	19	rucel224	rucel224	PROPN
brj-24352	98	20	.	.	PROPN
brj-24352	99	1	as	as	SCONJ
brj-24352	99	2	shown	show	VERB
brj-24352	99	3	in	in	ADP
brj-24352	99	4	fig	fig	NOUN
brj-24352	99	5	.	.	PUNCT
brj-24352	100	1	2	2	NUM
brj-24352	100	2	,	,	PUNCT
brj-24352	100	3	the	the	DET
brj-24352	100	4	enzyme	enzyme	NOUN
brj-24352	100	5	exhibited	exhibit	VERB
brj-24352	100	6	peak	peak	NOUN
brj-24352	100	7	activity	activity	NOUN
brj-24352	100	8	at	at	ADP
brj-24352	100	9	ph	ph	ADJ
brj-24352	100	10	5.0	5.0	NUM
brj-24352	100	11	,	,	PUNCT
brj-24352	100	12	maintaining	maintain	VERB
brj-24352	100	13	over	over	ADP
brj-24352	100	14	70	70	NUM
brj-24352	100	15	%	%	NOUN
brj-24352	100	16	of	of	ADP
brj-24352	100	17	its	its	PRON
brj-24352	100	18	activity	activity	NOUN
brj-24352	100	19	in	in	ADP
brj-24352	100	20	the	the	DET
brj-24352	100	21	ph	ph	ADJ
brj-24352	100	22	range	range	NOUN
brj-24352	100	23	of	of	ADP
brj-24352	100	24	5.0	5.0	NUM
brj-24352	100	25	to	to	PART
brj-24352	100	26	7.0	7.0	NUM
brj-24352	100	27	.	.	PUNCT
brj-24352	101	1	this	this	DET
brj-24352	101	2	result	result	NOUN
brj-24352	101	3	aligns	align	VERB
brj-24352	101	4	with	with	ADP
brj-24352	101	5	previous	previous	ADJ
brj-24352	101	6	studies	study	NOUN
brj-24352	101	7	on	on	ADP
brj-24352	101	8	enzymes	enzyme	NOUN
brj-24352	101	9	from	from	ADP
brj-24352	101	10	the	the	DET
brj-24352	101	11	rumen	ruman	NOUN
brj-24352	101	12	microbiome	microbiome	NOUN
brj-24352	101	13	(	(	PUNCT
brj-24352	101	14	cheng	cheng	PROPN
brj-24352	101	15	et	et	PROPN
brj-24352	101	16	al	al	PROPN
brj-24352	101	17	.	.	PROPN
brj-24352	101	18	2016	2016	NUM
brj-24352	101	19	;	;	PUNCT
brj-24352	101	20	loaces	loace	NOUN
brj-24352	101	21	et	et	PROPN
brj-24352	101	22	al	al	PROPN
brj-24352	101	23	.	.	PROPN
brj-24352	101	24	2016	2016	NUM
brj-24352	101	25	;	;	PUNCT
brj-24352	101	26	lee	lee	PROPN
brj-24352	101	27	et	et	PROPN
brj-24352	101	28	al	al	PROPN
brj-24352	101	29	.	.	PROPN
brj-24352	101	30	2018	2018	NUM
brj-24352	101	31	)	)	PUNCT
brj-24352	101	32	.	.	PUNCT
brj-24352	102	1	to	to	PART
brj-24352	102	2	assess	assess	VERB
brj-24352	102	3	ph	ph	ADJ
brj-24352	102	4	stability	stability	NOUN
brj-24352	102	5	,	,	PUNCT
brj-24352	102	6	rucel224	rucel224	PROPN
brj-24352	102	7	was	be	AUX
brj-24352	102	8	incubated	incubate	VERB
brj-24352	102	9	at	at	ADP
brj-24352	102	10	various	various	ADJ
brj-24352	102	11	ph	ph	ADJ
brj-24352	102	12	levels	level	NOUN
brj-24352	102	13	for	for	ADP
brj-24352	102	14	30	30	NUM
brj-24352	102	15	min	min	NOUN
brj-24352	102	16	,	,	PUNCT
brj-24352	102	17	and	and	CCONJ
brj-24352	102	18	residual	residual	ADJ
brj-24352	102	19	activity	activity	NOUN
brj-24352	102	20	was	be	AUX
brj-24352	102	21	measured	measure	VERB
brj-24352	102	22	.	.	PUNCT
brj-24352	103	1	the	the	DET
brj-24352	103	2	enzyme	enzyme	NOUN
brj-24352	103	3	retained	retain	VERB
brj-24352	103	4	over	over	ADP
brj-24352	103	5	90	90	NUM
brj-24352	103	6	%	%	NOUN
brj-24352	103	7	of	of	ADP
brj-24352	103	8	its	its	PRON
brj-24352	103	9	activity	activity	NOUN
brj-24352	103	10	across	across	ADP
brj-24352	103	11	a	a	DET
brj-24352	103	12	wide	wide	ADJ
brj-24352	103	13	ph	ph	ADJ
brj-24352	103	14	range	range	NOUN
brj-24352	103	15	(	(	PUNCT
brj-24352	103	16	4.0	4.0	NUM
brj-24352	103	17	to	to	PART
brj-24352	103	18	8.0	8.0	NUM
brj-24352	103	19	)	)	PUNCT
brj-24352	103	20	,	,	PUNCT
brj-24352	103	21	indicating	indicate	VERB
brj-24352	103	22	strong	strong	ADJ
brj-24352	103	23	stability	stability	NOUN
brj-24352	103	24	.	.	PUNCT
brj-24352	104	1	however	however	ADV
brj-24352	104	2	,	,	PUNCT
brj-24352	104	3	exposure	exposure	NOUN
brj-24352	104	4	to	to	ADP
brj-24352	104	5	ph	ph	PROPN
brj-24352	104	6	3.0	3.0	NUM
brj-24352	104	7	for	for	ADP
brj-24352	104	8	30	30	NUM
brj-24352	104	9	min	min	NOUN
brj-24352	104	10	resulted	result	VERB
brj-24352	104	11	in	in	ADP
brj-24352	104	12	complete	complete	ADJ
brj-24352	104	13	inactivation	inactivation	NOUN
brj-24352	104	14	,	,	PUNCT
brj-24352	104	15	suggesting	suggest	VERB
brj-24352	104	16	rucel224	rucel224	PROPN
brj-24352	104	17	’s	’s	PART
brj-24352	104	18	sensitivity	sensitivity	NOUN
brj-24352	104	19	to	to	ADP
brj-24352	104	20	highly	highly	ADV
brj-24352	104	21	acidic	acidic	ADJ
brj-24352	104	22	conditions	condition	NOUN
brj-24352	104	23	.	.	PUNCT
brj-24352	105	1	these	these	DET
brj-24352	105	2	findings	finding	NOUN
brj-24352	105	3	indicate	indicate	VERB
brj-24352	105	4	that	that	SCONJ
brj-24352	105	5	rucel224	rucel224	PROPN
brj-24352	105	6	can	can	AUX
brj-24352	105	7	tolerate	tolerate	VERB
brj-24352	105	8	mild	mild	ADJ
brj-24352	105	9	acidity	acidity	NOUN
brj-24352	105	10	but	but	CCONJ
brj-24352	105	11	is	be	AUX
brj-24352	105	12	fully	fully	ADV
brj-24352	105	13	inactivated	inactivated	ADJ
brj-24352	105	14	at	at	ADP
brj-24352	105	15	ph	ph	ADJ
brj-24352	105	16	values	value	NOUN
brj-24352	105	17	below	below	ADP
brj-24352	105	18	4.0	4.0	NUM
brj-24352	105	19	.	.	PUNCT
brj-24352	106	1	peer	peer	NOUN
brj-24352	106	2	-	-	PUNCT
brj-24352	106	3	reviewed	review	VERB
brj-24352	106	4	article	article	NOUN
brj-24352	106	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	106	6	ouyang	ouyang	PROPN
brj-24352	106	7	et	et	PROPN
brj-24352	106	8	al	al	PROPN
brj-24352	106	9	.	.	PROPN
brj-24352	106	10	(	(	PUNCT
brj-24352	106	11	2025	2025	NUM
brj-24352	106	12	)	)	PUNCT
brj-24352	106	13	.	.	PUNCT
brj-24352	107	1	“	"	PUNCT
brj-24352	107	2	rumen	ruman	NOUN
brj-24352	107	3	cellulase	cellulase	NOUN
brj-24352	107	4	&	&	CCONJ
brj-24352	107	5	ag	ag	PROPN
brj-24352	107	6	waste	waste	PROPN
brj-24352	107	7	,	,	PUNCT
brj-24352	107	8	”	"	PUNCT
brj-24352	107	9	bioresources	bioresource	NOUN
brj-24352	107	10	20(3	20(3	NOUN
brj-24352	107	11	)	)	PUNCT
brj-24352	107	12	,	,	PUNCT
brj-24352	107	13	5501	5501	NUM
brj-24352	107	14	-	-	SYM
brj-24352	107	15	5513	5513	NUM
brj-24352	107	16	.	.	PUNCT
brj-24352	108	1	5506	5506	NUM
brj-24352	108	2	fig	fig	NOUN
brj-24352	108	3	.	.	PUNCT
brj-24352	109	1	2	2	X
brj-24352	109	2	.	.	X
brj-24352	109	3	(	(	PUNCT
brj-24352	109	4	a	a	X
brj-24352	109	5	)	)	PUNCT
brj-24352	109	6	optimal	optimal	ADJ
brj-24352	109	7	ph	ph	NOUN
brj-24352	109	8	and	and	CCONJ
brj-24352	109	9	(	(	PUNCT
brj-24352	109	10	b	b	NOUN
brj-24352	109	11	)	)	PUNCT
brj-24352	109	12	ph	ph	ADJ
brj-24352	109	13	stability	stability	NOUN
brj-24352	109	14	of	of	ADP
brj-24352	109	15	rucel224	rucel224	PROPN
brj-24352	109	16	temperature	temperature	NOUN
brj-24352	109	17	dependence	dependence	NOUN
brj-24352	109	18	and	and	CCONJ
brj-24352	109	19	thermal	thermal	ADJ
brj-24352	109	20	stability	stability	NOUN
brj-24352	109	21	were	be	AUX
brj-24352	109	22	examined	examine	VERB
brj-24352	109	23	using	use	VERB
brj-24352	109	24	cmc	cmc	NOUN
brj-24352	109	25	-	-	PUNCT
brj-24352	109	26	na	na	PROPN
brj-24352	109	27	at	at	ADP
brj-24352	109	28	ph	ph	PROPN
brj-24352	109	29	5.0	5.0	NUM
brj-24352	109	30	.	.	PUNCT
brj-24352	110	1	as	as	SCONJ
brj-24352	110	2	shown	show	VERB
brj-24352	110	3	in	in	ADP
brj-24352	110	4	fig	fig	NOUN
brj-24352	110	5	.	.	PUNCT
brj-24352	111	1	3a	3a	NUM
brj-24352	111	2	,	,	PUNCT
brj-24352	111	3	rucel224	rucel224	PROPN
brj-24352	111	4	exhibited	exhibit	VERB
brj-24352	111	5	the	the	DET
brj-24352	111	6	highest	high	ADJ
brj-24352	111	7	activity	activity	NOUN
brj-24352	111	8	at	at	ADP
brj-24352	111	9	35	35	NUM
brj-24352	111	10	°	°	NOUN
brj-24352	111	11	c	c	NOUN
brj-24352	111	12	,	,	PUNCT
brj-24352	111	13	retaining	retain	VERB
brj-24352	111	14	over	over	ADP
brj-24352	111	15	80	80	NUM
brj-24352	111	16	%	%	NOUN
brj-24352	111	17	of	of	ADP
brj-24352	111	18	its	its	PRON
brj-24352	111	19	activity	activity	NOUN
brj-24352	111	20	within	within	ADP
brj-24352	111	21	the	the	DET
brj-24352	111	22	20	20	NUM
brj-24352	111	23	to	to	PART
brj-24352	111	24	40	40	NUM
brj-24352	111	25	°	°	NOUN
brj-24352	111	26	c	c	NOUN
brj-24352	111	27	range	range	NOUN
brj-24352	111	28	.	.	PUNCT
brj-24352	112	1	at	at	ADP
brj-24352	112	2	50	50	NUM
brj-24352	112	3	°	°	NOUN
brj-24352	112	4	c	c	NOUN
brj-24352	112	5	,	,	PUNCT
brj-24352	112	6	activity	activity	NOUN
brj-24352	112	7	decreased	decrease	VERB
brj-24352	112	8	to	to	ADP
brj-24352	112	9	43.1	43.1	NUM
brj-24352	112	10	%	%	NOUN
brj-24352	112	11	,	,	PUNCT
brj-24352	112	12	and	and	CCONJ
brj-24352	112	13	at	at	ADP
brj-24352	112	14	60	60	NUM
brj-24352	112	15	°	°	NOUN
brj-24352	112	16	c	c	NOUN
brj-24352	112	17	,	,	PUNCT
brj-24352	112	18	it	it	PRON
brj-24352	112	19	was	be	AUX
brj-24352	112	20	nearly	nearly	ADV
brj-24352	112	21	undetectable	undetectable	ADJ
brj-24352	112	22	.	.	PUNCT
brj-24352	113	1	the	the	DET
brj-24352	113	2	optimal	optimal	ADJ
brj-24352	113	3	temperature	temperature	NOUN
brj-24352	113	4	of	of	ADP
brj-24352	113	5	35	35	NUM
brj-24352	113	6	°	°	NOUN
brj-24352	113	7	c	c	NOUN
brj-24352	113	8	corresponds	correspond	NOUN
brj-24352	113	9	to	to	ADP
brj-24352	113	10	the	the	DET
brj-24352	113	11	typical	typical	ADJ
brj-24352	113	12	bovine	bovine	NOUN
brj-24352	113	13	rumen	ruman	NOUN
brj-24352	113	14	temperature	temperature	NOUN
brj-24352	113	15	of	of	ADP
brj-24352	113	16	38	38	NUM
brj-24352	113	17	to	to	PART
brj-24352	113	18	39	39	NUM
brj-24352	113	19	°	°	NOUN
brj-24352	113	20	c	c	NOUN
brj-24352	113	21	(	(	PUNCT
brj-24352	113	22	wanapat	wanapat	NOUN
brj-24352	113	23	2000	2000	NUM
brj-24352	113	24	)	)	PUNCT
brj-24352	113	25	,	,	PUNCT
brj-24352	113	26	further	far	ADV
brj-24352	113	27	supporting	support	VERB
brj-24352	113	28	the	the	DET
brj-24352	113	29	adaptability	adaptability	NOUN
brj-24352	113	30	of	of	ADP
brj-24352	113	31	rucel224	rucel224	PROPN
brj-24352	113	32	to	to	PART
brj-24352	113	33	function	function	VERB
brj-24352	113	34	within	within	ADP
brj-24352	113	35	the	the	DET
brj-24352	113	36	rumen	ruman	NOUN
brj-24352	113	37	's	's	PART
brj-24352	113	38	temperature	temperature	NOUN
brj-24352	113	39	range	range	NOUN
brj-24352	113	40	.	.	PUNCT
brj-24352	114	1	thermal	thermal	ADJ
brj-24352	114	2	stability	stability	NOUN
brj-24352	114	3	tests	test	NOUN
brj-24352	114	4	revealed	reveal	VERB
brj-24352	114	5	rucel224	rucel224	PROPN
brj-24352	114	6	’s	’s	PART
brj-24352	114	7	sensitivity	sensitivity	NOUN
brj-24352	114	8	to	to	ADP
brj-24352	114	9	high	high	ADJ
brj-24352	114	10	temperatures	temperature	NOUN
brj-24352	114	11	(	(	PUNCT
brj-24352	114	12	fig	fig	NOUN
brj-24352	114	13	.	.	PUNCT
brj-24352	115	1	3b	3b	NUM
brj-24352	115	2	)	)	PUNCT
brj-24352	115	3	.	.	PUNCT
brj-24352	116	1	at	at	ADP
brj-24352	116	2	50	50	NUM
brj-24352	116	3	°	°	NOUN
brj-24352	116	4	c	c	NOUN
brj-24352	116	5	,	,	PUNCT
brj-24352	116	6	activity	activity	NOUN
brj-24352	116	7	decreased	decrease	VERB
brj-24352	116	8	gradually	gradually	ADV
brj-24352	116	9	over	over	ADP
brj-24352	116	10	time	time	NOUN
brj-24352	116	11	,	,	PUNCT
brj-24352	116	12	retaining	retain	VERB
brj-24352	116	13	around	around	ADP
brj-24352	116	14	80	80	NUM
brj-24352	116	15	%	%	NOUN
brj-24352	116	16	after	after	ADP
brj-24352	116	17	30	30	NUM
brj-24352	116	18	min	min	NOUN
brj-24352	116	19	.	.	PROPN
brj-24352	116	20	however	however	ADV
brj-24352	116	21	,	,	PUNCT
brj-24352	116	22	at	at	ADP
brj-24352	116	23	60	60	NUM
brj-24352	116	24	°	°	NOUN
brj-24352	116	25	c	c	NOUN
brj-24352	116	26	,	,	PUNCT
brj-24352	116	27	only	only	ADV
brj-24352	116	28	3	3	NUM
brj-24352	116	29	%	%	NOUN
brj-24352	116	30	of	of	ADP
brj-24352	116	31	activity	activity	NOUN
brj-24352	116	32	remained	remain	VERB
brj-24352	116	33	after	after	ADP
brj-24352	116	34	5	5	NUM
brj-24352	116	35	min	min	NOUN
brj-24352	116	36	,	,	PUNCT
brj-24352	116	37	with	with	SCONJ
brj-24352	116	38	the	the	DET
brj-24352	116	39	enzyme	enzyme	NOUN
brj-24352	116	40	nearly	nearly	ADV
brj-24352	116	41	fully	fully	ADV
brj-24352	116	42	inactivated	inactivate	VERB
brj-24352	116	43	.	.	PUNCT
brj-24352	117	1	no	no	DET
brj-24352	117	2	detectable	detectable	ADJ
brj-24352	117	3	activity	activity	NOUN
brj-24352	117	4	was	be	AUX
brj-24352	117	5	observed	observe	VERB
brj-24352	117	6	at	at	ADP
brj-24352	117	7	70	70	NUM
brj-24352	117	8	or	or	CCONJ
brj-24352	117	9	80	80	NUM
brj-24352	117	10	°	°	NOUN
brj-24352	117	11	c	c	NOUN
brj-24352	117	12	,	,	PUNCT
brj-24352	117	13	indicating	indicate	VERB
brj-24352	117	14	limited	limited	ADJ
brj-24352	117	15	tolerance	tolerance	NOUN
brj-24352	117	16	to	to	ADP
brj-24352	117	17	elevated	elevated	ADJ
brj-24352	117	18	temperatures	temperature	NOUN
brj-24352	117	19	.	.	PUNCT
brj-24352	118	1	these	these	DET
brj-24352	118	2	results	result	NOUN
brj-24352	118	3	suggest	suggest	VERB
brj-24352	118	4	that	that	SCONJ
brj-24352	118	5	rucel224	rucel224	PROPN
brj-24352	118	6	functions	function	VERB
brj-24352	118	7	best	well	ADV
brj-24352	118	8	under	under	ADP
brj-24352	118	9	moderate	moderate	ADJ
brj-24352	118	10	temperatures	temperature	NOUN
brj-24352	118	11	and	and	CCONJ
brj-24352	118	12	is	be	AUX
brj-24352	118	13	prone	prone	ADJ
brj-24352	118	14	to	to	ADP
brj-24352	118	15	thermal	thermal	ADJ
brj-24352	118	16	denaturation	denaturation	NOUN
brj-24352	118	17	at	at	ADP
brj-24352	118	18	higher	high	ADJ
brj-24352	118	19	temperatures	temperature	NOUN
brj-24352	118	20	.	.	PUNCT
brj-24352	119	1	fig	fig	NOUN
brj-24352	119	2	.	.	PUNCT
brj-24352	120	1	3	3	X
brj-24352	120	2	.	.	X
brj-24352	120	3	optimum	optimum	ADJ
brj-24352	120	4	temperature	temperature	NOUN
brj-24352	120	5	(	(	PUNCT
brj-24352	120	6	a	a	NOUN
brj-24352	120	7	)	)	PUNCT
brj-24352	120	8	and	and	CCONJ
brj-24352	120	9	thermal	thermal	ADJ
brj-24352	120	10	stability	stability	NOUN
brj-24352	120	11	of	of	ADP
brj-24352	120	12	rucel224	rucel224	PROPN
brj-24352	120	13	(	(	PUNCT
brj-24352	120	14	b	b	X
brj-24352	120	15	)	)	PUNCT
brj-24352	120	16	mn²⁺	mn²⁺	NOUN
brj-24352	120	17	significantly	significantly	ADV
brj-24352	120	18	enhanced	enhance	VERB
brj-24352	120	19	rucel224	rucel224	PROPN
brj-24352	120	20	’s	’s	PART
brj-24352	120	21	cellulase	cellulase	NOUN
brj-24352	120	22	activity	activity	NOUN
brj-24352	120	23	,	,	PUNCT
brj-24352	120	24	with	with	ADP
brj-24352	120	25	a	a	DET
brj-24352	120	26	pronounced	pronounce	VERB
brj-24352	120	27	stimulatory	stimulatory	ADJ
brj-24352	120	28	effect	effect	NOUN
brj-24352	120	29	(	(	PUNCT
brj-24352	120	30	fig	fig	NOUN
brj-24352	120	31	.	.	PUNCT
brj-24352	120	32	4a	4a	NUM
brj-24352	120	33	)	)	PUNCT
brj-24352	120	34	.	.	PUNCT
brj-24352	121	1	at	at	ADP
brj-24352	121	2	concentrations	concentration	NOUN
brj-24352	121	3	of	of	ADP
brj-24352	121	4	1	1	NUM
brj-24352	121	5	mm	mm	NOUN
brj-24352	121	6	and	and	CCONJ
brj-24352	121	7	5	5	NUM
brj-24352	121	8	mm	mm	NOUN
brj-24352	121	9	,	,	PUNCT
brj-24352	121	10	mn²⁺	mn²⁺	NOUN
brj-24352	121	11	increased	increase	VERB
brj-24352	121	12	activity	activity	NOUN
brj-24352	121	13	by	by	ADP
brj-24352	121	14	68.5	68.5	NUM
brj-24352	121	15	%	%	NOUN
brj-24352	121	16	and	and	CCONJ
brj-24352	121	17	83.1	83.1	NUM
brj-24352	121	18	%	%	NOUN
brj-24352	121	19	,	,	PUNCT
brj-24352	121	20	respectively	respectively	ADV
brj-24352	121	21	.	.	PUNCT
brj-24352	122	1	this	this	DET
brj-24352	122	2	enhancement	enhancement	NOUN
brj-24352	122	3	is	be	AUX
brj-24352	122	4	consistent	consistent	ADJ
brj-24352	122	5	with	with	ADP
brj-24352	122	6	previous	previous	ADJ
brj-24352	122	7	reports	report	NOUN
brj-24352	122	8	showing	show	VERB
brj-24352	122	9	that	that	SCONJ
brj-24352	122	10	manganese	manganese	ADJ
brj-24352	122	11	ions	ion	NOUN
brj-24352	122	12	act	act	VERB
brj-24352	122	13	as	as	ADP
brj-24352	122	14	cofactors	cofactor	NOUN
brj-24352	122	15	for	for	ADP
brj-24352	122	16	glycoside	glycoside	NOUN
brj-24352	122	17	hydrolases	hydrolase	NOUN
brj-24352	122	18	,	,	PUNCT
brj-24352	122	19	stabilizing	stabilize	VERB
brj-24352	122	20	their	their	PRON
brj-24352	122	21	(	(	PUNCT
brj-24352	122	22	b	b	NOUN
brj-24352	122	23	)	)	PUNCT
brj-24352	122	24	(	(	PUNCT
brj-24352	122	25	a	a	PRON
brj-24352	122	26	)	)	PUNCT
brj-24352	122	27	peer	peer	NOUN
brj-24352	122	28	-	-	PUNCT
brj-24352	122	29	reviewed	review	VERB
brj-24352	122	30	article	article	NOUN
brj-24352	122	31	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	122	32	ouyang	ouyang	PROPN
brj-24352	122	33	et	et	PROPN
brj-24352	122	34	al	al	PROPN
brj-24352	122	35	.	.	PROPN
brj-24352	123	1	(	(	PUNCT
brj-24352	123	2	2025	2025	NUM
brj-24352	123	3	)	)	PUNCT
brj-24352	123	4	.	.	PUNCT
brj-24352	124	1	“	"	PUNCT
brj-24352	124	2	rumen	ruman	NOUN
brj-24352	124	3	cellulase	cellulase	NOUN
brj-24352	124	4	&	&	CCONJ
brj-24352	124	5	ag	ag	PROPN
brj-24352	124	6	waste	waste	PROPN
brj-24352	124	7	,	,	PUNCT
brj-24352	124	8	”	"	PUNCT
brj-24352	124	9	bioresources	bioresource	NOUN
brj-24352	124	10	20(3	20(3	NOUN
brj-24352	124	11	)	)	PUNCT
brj-24352	124	12	,	,	PUNCT
brj-24352	124	13	5501	5501	NUM
brj-24352	124	14	-	-	SYM
brj-24352	124	15	5513	5513	NUM
brj-24352	124	16	.	.	PUNCT
brj-24352	125	1	5507	5507	NUM
brj-24352	125	2	tertiary	tertiary	ADJ
brj-24352	125	3	structures	structure	NOUN
brj-24352	125	4	and	and	CCONJ
brj-24352	125	5	improving	improve	VERB
brj-24352	125	6	catalytic	catalytic	ADJ
brj-24352	125	7	efficiency	efficiency	NOUN
brj-24352	125	8	.	.	PUNCT
brj-24352	126	1	mn²⁺	mn²⁺	NOUN
brj-24352	126	2	likely	likely	ADV
brj-24352	126	3	interacts	interact	VERB
brj-24352	126	4	with	with	ADP
brj-24352	126	5	negatively	negatively	ADV
brj-24352	126	6	charged	charge	VERB
brj-24352	126	7	amino	amino	NOUN
brj-24352	126	8	acid	acid	NOUN
brj-24352	126	9	residues	residue	NOUN
brj-24352	126	10	or	or	CCONJ
brj-24352	126	11	coordinates	coordinate	NOUN
brj-24352	126	12	with	with	ADP
brj-24352	126	13	functional	functional	ADJ
brj-24352	126	14	groups	group	NOUN
brj-24352	126	15	in	in	ADP
brj-24352	126	16	the	the	DET
brj-24352	126	17	active	active	ADJ
brj-24352	126	18	site	site	NOUN
brj-24352	126	19	,	,	PUNCT
brj-24352	126	20	stabilizing	stabilize	VERB
brj-24352	126	21	the	the	DET
brj-24352	126	22	enzyme	enzyme	NOUN
brj-24352	126	23	-	-	PUNCT
brj-24352	126	24	substrate	substrate	NOUN
brj-24352	126	25	complex	complex	NOUN
brj-24352	126	26	and	and	CCONJ
brj-24352	126	27	lowering	lower	VERB
brj-24352	126	28	the	the	DET
brj-24352	126	29	activation	activation	NOUN
brj-24352	126	30	energy	energy	NOUN
brj-24352	126	31	for	for	ADP
brj-24352	126	32	catalysis	catalysis	NOUN
brj-24352	126	33	(	(	PUNCT
brj-24352	126	34	huy	huy	PROPN
brj-24352	126	35	et	et	PROPN
brj-24352	126	36	al	al	PROPN
brj-24352	126	37	.	.	PROPN
brj-24352	126	38	2016	2016	NUM
brj-24352	126	39	;	;	PUNCT
brj-24352	126	40	vasconcellos	vasconcellos	PROPN
brj-24352	126	41	et	et	PROPN
brj-24352	126	42	al	al	PROPN
brj-24352	126	43	.	.	PROPN
brj-24352	126	44	2016	2016	NUM
brj-24352	126	45	)	)	PUNCT
brj-24352	126	46	.	.	PUNCT
brj-24352	127	1	in	in	ADP
brj-24352	127	2	contrast	contrast	NOUN
brj-24352	127	3	,	,	PUNCT
brj-24352	127	4	rucel224	rucel224	PROPN
brj-24352	127	5	activity	activity	NOUN
brj-24352	127	6	was	be	AUX
brj-24352	127	7	significantly	significantly	ADV
brj-24352	127	8	inhibited	inhibit	VERB
brj-24352	127	9	by	by	ADP
brj-24352	127	10	cu²⁺	cu²⁺	PROPN
brj-24352	127	11	and	and	CCONJ
brj-24352	127	12	ni²⁺	ni²⁺	NOUN
brj-24352	127	13	,	,	PUNCT
brj-24352	127	14	with	with	ADP
brj-24352	127	15	cu²⁺	cu²⁺	NOUN
brj-24352	127	16	showing	show	VERB
brj-24352	127	17	a	a	DET
brj-24352	127	18	particularly	particularly	ADV
brj-24352	127	19	strong	strong	ADJ
brj-24352	127	20	inhibitory	inhibitory	ADJ
brj-24352	127	21	effect	effect	NOUN
brj-24352	127	22	,	,	PUNCT
brj-24352	127	23	reducing	reduce	VERB
brj-24352	127	24	activity	activity	NOUN
brj-24352	127	25	to	to	ADP
brj-24352	127	26	12.3	12.3	NUM
brj-24352	127	27	%	%	NOUN
brj-24352	127	28	at	at	ADP
brj-24352	127	29	5	5	NUM
brj-24352	127	30	mm	mm	NOUN
brj-24352	127	31	.	.	PUNCT
brj-24352	128	1	this	this	PRON
brj-24352	128	2	is	be	AUX
brj-24352	128	3	consistent	consistent	ADJ
brj-24352	128	4	with	with	ADP
brj-24352	128	5	the	the	DET
brj-24352	128	6	redox	redox	ADJ
brj-24352	128	7	activity	activity	NOUN
brj-24352	128	8	of	of	ADP
brj-24352	128	9	cu²⁺	cu²⁺	PROPN
brj-24352	128	10	,	,	PUNCT
brj-24352	128	11	which	which	PRON
brj-24352	128	12	can	can	AUX
brj-24352	128	13	alternate	alternate	VERB
brj-24352	128	14	between	between	ADP
brj-24352	128	15	+1	+1	PROPN
brj-24352	128	16	and	and	CCONJ
brj-24352	128	17	+2	+2	PRON
brj-24352	128	18	oxidation	oxidation	NOUN
brj-24352	128	19	states	state	NOUN
brj-24352	128	20	.	.	PUNCT
brj-24352	129	1	at	at	ADP
brj-24352	129	2	higher	high	ADJ
brj-24352	129	3	concentrations	concentration	NOUN
brj-24352	129	4	,	,	PUNCT
brj-24352	129	5	this	this	DET
brj-24352	129	6	redox	redox	ADJ
brj-24352	129	7	cycling	cycling	NOUN
brj-24352	129	8	generates	generate	VERB
brj-24352	129	9	reactive	reactive	ADJ
brj-24352	129	10	oxygen	oxygen	NOUN
brj-24352	129	11	species	specie	NOUN
brj-24352	129	12	(	(	PUNCT
brj-24352	129	13	ros	ros	PROPN
brj-24352	129	14	)	)	PUNCT
brj-24352	129	15	,	,	PUNCT
brj-24352	129	16	leading	lead	VERB
brj-24352	129	17	to	to	ADP
brj-24352	129	18	oxidative	oxidative	ADJ
brj-24352	129	19	damage	damage	NOUN
brj-24352	129	20	to	to	ADP
brj-24352	129	21	the	the	DET
brj-24352	129	22	enzyme	enzyme	NOUN
brj-24352	129	23	(	(	PUNCT
brj-24352	129	24	dudev	dudev	NOUN
brj-24352	129	25	and	and	CCONJ
brj-24352	129	26	lim	lim	PROPN
brj-24352	129	27	2013	2013	NUM
brj-24352	129	28	)	)	PUNCT
brj-24352	129	29	.	.	PUNCT
brj-24352	130	1	several	several	ADJ
brj-24352	130	2	reports	report	NOUN
brj-24352	130	3	support	support	VERB
brj-24352	130	4	these	these	DET
brj-24352	130	5	findings	finding	NOUN
brj-24352	130	6	,	,	PUNCT
brj-24352	130	7	showing	show	VERB
brj-24352	130	8	cu²⁺	cu²⁺	ADJ
brj-24352	130	9	inhibition	inhibition	NOUN
brj-24352	130	10	of	of	ADP
brj-24352	130	11	various	various	ADJ
brj-24352	130	12	enzymes	enzyme	NOUN
brj-24352	130	13	(	(	PUNCT
brj-24352	130	14	loaces	loace	NOUN
brj-24352	130	15	et	et	PROPN
brj-24352	130	16	al	al	PROPN
brj-24352	130	17	.	.	PROPN
brj-24352	130	18	2016	2016	NUM
brj-24352	130	19	;	;	PUNCT
brj-24352	130	20	tan	tan	PROPN
brj-24352	130	21	et	et	PROPN
brj-24352	130	22	al	al	PROPN
brj-24352	130	23	.	.	PROPN
brj-24352	130	24	2017	2017	NUM
brj-24352	130	25	;	;	PUNCT
brj-24352	130	26	lópez	lópez	NOUN
brj-24352	130	27	-	-	PUNCT
brj-24352	130	28	lópez	lópez	NOUN
brj-24352	130	29	et	et	NOUN
brj-24352	130	30	al	al	PROPN
brj-24352	130	31	.	.	PROPN
brj-24352	130	32	2023	2023	NUM
brj-24352	130	33	)	)	PUNCT
brj-24352	130	34	.	.	PUNCT
brj-24352	131	1	other	other	ADJ
brj-24352	131	2	metal	metal	NOUN
brj-24352	131	3	ions	ion	NOUN
brj-24352	131	4	,	,	PUNCT
brj-24352	131	5	such	such	ADJ
brj-24352	131	6	as	as	ADP
brj-24352	131	7	k⁺	k⁺	PROPN
brj-24352	131	8	,	,	PUNCT
brj-24352	131	9	na⁺	na⁺	NOUN
brj-24352	131	10	,	,	PUNCT
brj-24352	131	11	ca²⁺	ca²⁺	PROPN
brj-24352	131	12	,	,	PUNCT
brj-24352	131	13	and	and	CCONJ
brj-24352	131	14	mg²⁺	mg²⁺	NUM
brj-24352	131	15	,	,	PUNCT
brj-24352	131	16	had	have	VERB
brj-24352	131	17	negligible	negligible	ADJ
brj-24352	131	18	effects	effect	NOUN
brj-24352	131	19	on	on	ADP
brj-24352	131	20	rucel224	rucel224	PROPN
brj-24352	131	21	activity	activity	NOUN
brj-24352	131	22	,	,	PUNCT
brj-24352	131	23	indicating	indicate	VERB
brj-24352	131	24	that	that	SCONJ
brj-24352	131	25	the	the	DET
brj-24352	131	26	enzyme	enzyme	NOUN
brj-24352	131	27	is	be	AUX
brj-24352	131	28	relatively	relatively	ADV
brj-24352	131	29	resilient	resilient	ADJ
brj-24352	131	30	to	to	ADP
brj-24352	131	31	ionic	ionic	ADJ
brj-24352	131	32	variations	variation	NOUN
brj-24352	131	33	under	under	ADP
brj-24352	131	34	standard	standard	ADJ
brj-24352	131	35	conditions	condition	NOUN
brj-24352	131	36	.	.	PUNCT
brj-24352	132	1	additionally	additionally	ADV
brj-24352	132	2	,	,	PUNCT
brj-24352	132	3	rucel224	rucel224	PROPN
brj-24352	132	4	showed	show	VERB
brj-24352	132	5	significant	significant	ADJ
brj-24352	132	6	sensitivity	sensitivity	NOUN
brj-24352	132	7	to	to	ADP
brj-24352	132	8	chelating	chelate	VERB
brj-24352	132	9	agents	agent	NOUN
brj-24352	132	10	(	(	PUNCT
brj-24352	132	11	edta	edta	NOUN
brj-24352	132	12	)	)	PUNCT
brj-24352	132	13	,	,	PUNCT
brj-24352	132	14	surfactants	surfactant	NOUN
brj-24352	132	15	(	(	PUNCT
brj-24352	132	16	sds	sds	NOUN
brj-24352	132	17	)	)	PUNCT
brj-24352	132	18	,	,	PUNCT
brj-24352	132	19	and	and	CCONJ
brj-24352	132	20	reducing	reduce	VERB
brj-24352	132	21	agents	agent	NOUN
brj-24352	132	22	(	(	PUNCT
brj-24352	132	23	dtt	dtt	NOUN
brj-24352	132	24	)	)	PUNCT
brj-24352	132	25	,	,	PUNCT
brj-24352	132	26	as	as	SCONJ
brj-24352	132	27	shown	show	VERB
brj-24352	132	28	in	in	ADP
brj-24352	132	29	fig	fig	NOUN
brj-24352	132	30	.	.	PUNCT
brj-24352	133	1	4b	4b	PROPN
brj-24352	133	2	.	.	PUNCT
brj-24352	133	3	dtt	dtt	PROPN
brj-24352	133	4	at	at	ADP
brj-24352	133	5	1	1	NUM
brj-24352	133	6	mm	mm	NUM
brj-24352	133	7	and	and	CCONJ
brj-24352	133	8	5	5	NUM
brj-24352	133	9	mm	mm	NOUN
brj-24352	133	10	reduced	reduce	VERB
brj-24352	133	11	activity	activity	NOUN
brj-24352	133	12	to	to	ADP
brj-24352	133	13	about	about	ADV
brj-24352	133	14	45	45	NUM
brj-24352	133	15	%	%	NOUN
brj-24352	133	16	,	,	PUNCT
brj-24352	133	17	likely	likely	ADJ
brj-24352	133	18	by	by	ADP
brj-24352	133	19	breaking	break	VERB
brj-24352	133	20	disulfide	disulfide	NOUN
brj-24352	133	21	bonds	bond	NOUN
brj-24352	133	22	and	and	CCONJ
brj-24352	133	23	compromising	compromise	VERB
brj-24352	133	24	the	the	DET
brj-24352	133	25	enzyme	enzyme	NOUN
brj-24352	133	26	’s	’s	PART
brj-24352	133	27	structural	structural	ADJ
brj-24352	133	28	integrity	integrity	NOUN
brj-24352	133	29	.	.	PUNCT
brj-24352	134	1	edta	edta	PROPN
brj-24352	134	2	,	,	PUNCT
brj-24352	134	3	as	as	ADP
brj-24352	134	4	a	a	DET
brj-24352	134	5	potent	potent	ADJ
brj-24352	134	6	chelator	chelator	NOUN
brj-24352	134	7	,	,	PUNCT
brj-24352	134	8	may	may	AUX
brj-24352	134	9	disrupt	disrupt	VERB
brj-24352	134	10	metal	metal	NOUN
brj-24352	134	11	-	-	PUNCT
brj-24352	134	12	dependent	dependent	ADJ
brj-24352	134	13	stabilization	stabilization	NOUN
brj-24352	134	14	of	of	ADP
brj-24352	134	15	the	the	DET
brj-24352	134	16	enzyme	enzyme	NOUN
brj-24352	134	17	(	(	PUNCT
brj-24352	134	18	auld	auld	NOUN
brj-24352	134	19	1988	1988	NUM
brj-24352	134	20	;	;	PUNCT
brj-24352	134	21	bergan	bergan	PROPN
brj-24352	134	22	et	et	PROPN
brj-24352	134	23	al	al	PROPN
brj-24352	134	24	.	.	PROPN
brj-24352	134	25	2001	2001	NUM
brj-24352	134	26	)	)	PUNCT
brj-24352	134	27	,	,	PUNCT
brj-24352	134	28	reducing	reduce	VERB
brj-24352	134	29	activity	activity	NOUN
brj-24352	134	30	to	to	ADP
brj-24352	134	31	76.5	76.5	NUM
brj-24352	134	32	%	%	NOUN
brj-24352	134	33	and	and	CCONJ
brj-24352	134	34	59.7	59.7	NUM
brj-24352	134	35	%	%	NOUN
brj-24352	134	36	at	at	ADP
brj-24352	134	37	1	1	NUM
brj-24352	134	38	mm	mm	NUM
brj-24352	134	39	and	and	CCONJ
brj-24352	134	40	5	5	NUM
brj-24352	134	41	mm	mm	NOUN
brj-24352	134	42	,	,	PUNCT
brj-24352	134	43	respectively	respectively	ADV
brj-24352	134	44	.	.	PUNCT
brj-24352	135	1	sds	sds	PROPN
brj-24352	135	2	caused	cause	VERB
brj-24352	135	3	the	the	DET
brj-24352	135	4	most	most	ADV
brj-24352	135	5	dramatic	dramatic	ADJ
brj-24352	135	6	inhibition	inhibition	NOUN
brj-24352	135	7	,	,	PUNCT
brj-24352	135	8	reducing	reduce	VERB
brj-24352	135	9	activity	activity	NOUN
brj-24352	135	10	to	to	ADP
brj-24352	135	11	26.8	26.8	NUM
brj-24352	135	12	%	%	NOUN
brj-24352	135	13	at	at	ADP
brj-24352	135	14	1	1	NUM
brj-24352	135	15	mm	mm	NOUN
brj-24352	135	16	and	and	CCONJ
brj-24352	135	17	almost	almost	ADV
brj-24352	135	18	completely	completely	ADV
brj-24352	135	19	inactivating	inactivate	VERB
brj-24352	135	20	the	the	DET
brj-24352	135	21	enzyme	enzyme	NOUN
brj-24352	135	22	at	at	ADP
brj-24352	135	23	5	5	NUM
brj-24352	135	24	mm	mm	NOUN
brj-24352	135	25	.	.	PUNCT
brj-24352	136	1	sds	sds	PROPN
brj-24352	136	2	is	be	AUX
brj-24352	136	3	known	know	VERB
brj-24352	136	4	to	to	PART
brj-24352	136	5	disrupt	disrupt	VERB
brj-24352	136	6	non	non	ADJ
brj-24352	136	7	-	-	ADJ
brj-24352	136	8	covalent	covalent	ADJ
brj-24352	136	9	interactions	interaction	NOUN
brj-24352	136	10	,	,	PUNCT
brj-24352	136	11	such	such	ADJ
brj-24352	136	12	as	as	ADP
brj-24352	136	13	hydrogen	hydrogen	NOUN
brj-24352	136	14	bonding	bonding	NOUN
brj-24352	136	15	and	and	CCONJ
brj-24352	136	16	hydrophobic	hydrophobic	NOUN
brj-24352	136	17	forces	force	NOUN
brj-24352	136	18	,	,	PUNCT
brj-24352	136	19	leading	lead	VERB
brj-24352	136	20	to	to	ADP
brj-24352	136	21	denaturation	denaturation	NOUN
brj-24352	136	22	(	(	PUNCT
brj-24352	136	23	turner	turner	PROPN
brj-24352	136	24	et	et	PROPN
brj-24352	136	25	al	al	PROPN
brj-24352	136	26	.	.	PROPN
brj-24352	136	27	2003	2003	NUM
brj-24352	136	28	)	)	PUNCT
brj-24352	136	29	.	.	PUNCT
brj-24352	137	1	interestingly	interestingly	ADV
brj-24352	137	2	,	,	PUNCT
brj-24352	137	3	βmercaptoethanol	βmercaptoethanol	PROPN
brj-24352	137	4	also	also	ADV
brj-24352	137	5	exhibited	exhibit	VERB
brj-24352	137	6	moderate	moderate	ADJ
brj-24352	137	7	inhibition	inhibition	NOUN
brj-24352	137	8	,	,	PUNCT
brj-24352	137	9	further	far	ADV
brj-24352	137	10	highlighting	highlight	VERB
brj-24352	137	11	the	the	DET
brj-24352	137	12	role	role	NOUN
brj-24352	137	13	of	of	ADP
brj-24352	137	14	disulfide	disulfide	NOUN
brj-24352	137	15	bonds	bond	NOUN
brj-24352	137	16	in	in	ADP
brj-24352	137	17	maintaining	maintain	VERB
brj-24352	137	18	the	the	DET
brj-24352	137	19	enzyme	enzyme	NOUN
brj-24352	137	20	’s	’s	PART
brj-24352	137	21	stability	stability	NOUN
brj-24352	137	22	.	.	PUNCT
brj-24352	138	1	in	in	ADP
brj-24352	138	2	contrast	contrast	NOUN
brj-24352	138	3	,	,	PUNCT
brj-24352	138	4	nonionic	nonionic	ADJ
brj-24352	138	5	surfactants	surfactant	NOUN
brj-24352	138	6	,	,	PUNCT
brj-24352	138	7	namely	namely	ADV
brj-24352	138	8	tween-20	tween-20	PROPN
brj-24352	138	9	and	and	CCONJ
brj-24352	138	10	triton	triton	PROPN
brj-24352	138	11	x-100	x-100	PROPN
brj-24352	138	12	had	have	VERB
brj-24352	138	13	minimal	minimal	ADJ
brj-24352	138	14	impact	impact	NOUN
brj-24352	138	15	on	on	ADP
brj-24352	138	16	rucel224	rucel224	PROPN
brj-24352	138	17	activity	activity	NOUN
brj-24352	138	18	,	,	PUNCT
brj-24352	138	19	suggesting	suggest	VERB
brj-24352	138	20	the	the	DET
brj-24352	138	21	enzyme	enzyme	NOUN
brj-24352	138	22	’s	’s	PART
brj-24352	138	23	stability	stability	NOUN
brj-24352	138	24	in	in	ADP
brj-24352	138	25	the	the	DET
brj-24352	138	26	presence	presence	NOUN
brj-24352	138	27	of	of	ADP
brj-24352	138	28	hydrophilic	hydrophilic	ADJ
brj-24352	138	29	surface	surface	NOUN
brj-24352	138	30	-	-	PUNCT
brj-24352	138	31	active	active	ADJ
brj-24352	138	32	agents	agent	NOUN
brj-24352	138	33	.	.	PUNCT
brj-24352	139	1	this	this	DET
brj-24352	139	2	stability	stability	NOUN
brj-24352	139	3	points	point	VERB
brj-24352	139	4	to	to	ADP
brj-24352	139	5	rucel224	rucel224	PROPN
brj-24352	139	6	’s	’s	PART
brj-24352	139	7	potential	potential	ADJ
brj-24352	139	8	suitability	suitability	NOUN
brj-24352	139	9	for	for	ADP
brj-24352	139	10	industrial	industrial	ADJ
brj-24352	139	11	applications	application	NOUN
brj-24352	139	12	involving	involve	VERB
brj-24352	139	13	detergents	detergent	NOUN
brj-24352	139	14	or	or	CCONJ
brj-24352	139	15	emulsifiers	emulsifier	NOUN
brj-24352	139	16	.	.	PUNCT
brj-24352	140	1	fig	fig	NOUN
brj-24352	140	2	.	.	PUNCT
brj-24352	141	1	4	4	X
brj-24352	141	2	.	.	X
brj-24352	141	3	effects	effect	NOUN
brj-24352	141	4	of	of	ADP
brj-24352	141	5	metal	metal	NOUN
brj-24352	141	6	ions	ion	NOUN
brj-24352	141	7	(	(	PUNCT
brj-24352	141	8	a	a	X
brj-24352	141	9	)	)	PUNCT
brj-24352	141	10	,	,	PUNCT
brj-24352	141	11	inhibitors	inhibitor	NOUN
brj-24352	141	12	and	and	CCONJ
brj-24352	141	13	detergents	detergent	NOUN
brj-24352	141	14	(	(	PUNCT
brj-24352	141	15	b	b	NOUN
brj-24352	141	16	)	)	PUNCT
brj-24352	141	17	(	(	PUNCT
brj-24352	141	18	b	b	X
brj-24352	141	19	)	)	PUNCT
brj-24352	141	20	(	(	PUNCT
brj-24352	141	21	a	a	PRON
brj-24352	141	22	)	)	PUNCT
brj-24352	141	23	peer	peer	NOUN
brj-24352	141	24	-	-	PUNCT
brj-24352	141	25	reviewed	review	VERB
brj-24352	141	26	article	article	NOUN
brj-24352	141	27	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	141	28	ouyang	ouyang	PROPN
brj-24352	141	29	et	et	PROPN
brj-24352	141	30	al	al	PROPN
brj-24352	141	31	.	.	PROPN
brj-24352	142	1	(	(	PUNCT
brj-24352	142	2	2025	2025	NUM
brj-24352	142	3	)	)	PUNCT
brj-24352	142	4	.	.	PUNCT
brj-24352	143	1	“	"	PUNCT
brj-24352	143	2	rumen	ruman	NOUN
brj-24352	143	3	cellulase	cellulase	NOUN
brj-24352	143	4	&	&	CCONJ
brj-24352	143	5	ag	ag	PROPN
brj-24352	143	6	waste	waste	PROPN
brj-24352	143	7	,	,	PUNCT
brj-24352	143	8	”	"	PUNCT
brj-24352	143	9	bioresources	bioresource	NOUN
brj-24352	143	10	20(3	20(3	NOUN
brj-24352	143	11	)	)	PUNCT
brj-24352	143	12	,	,	PUNCT
brj-24352	143	13	5501	5501	NUM
brj-24352	143	14	-	-	SYM
brj-24352	143	15	5513	5513	NUM
brj-24352	143	16	.	.	PUNCT
brj-24352	144	1	5508	5508	NUM
brj-24352	144	2	hydrolysis	hydrolysis	NOUN
brj-24352	144	3	of	of	ADP
brj-24352	144	4	agricultural	agricultural	ADJ
brj-24352	144	5	wastes	waste	NOUN
brj-24352	144	6	by	by	ADP
brj-24352	144	7	rucel224	rucel224	PROPN
brj-24352	144	8	the	the	DET
brj-24352	144	9	hydrolysis	hydrolysis	NOUN
brj-24352	144	10	efficiency	efficiency	NOUN
brj-24352	144	11	of	of	ADP
brj-24352	144	12	rucel224	rucel224	PROPN
brj-24352	144	13	was	be	AUX
brj-24352	144	14	evaluated	evaluate	VERB
brj-24352	144	15	using	use	VERB
brj-24352	144	16	various	various	ADJ
brj-24352	144	17	lignocellulosic	lignocellulosic	ADJ
brj-24352	144	18	substrates	substrate	NOUN
brj-24352	144	19	,	,	PUNCT
brj-24352	144	20	including	include	VERB
brj-24352	144	21	wheat	wheat	NOUN
brj-24352	144	22	bran	bran	NOUN
brj-24352	144	23	,	,	PUNCT
brj-24352	144	24	rice	rice	NOUN
brj-24352	144	25	straw	straw	NOUN
brj-24352	144	26	,	,	PUNCT
brj-24352	144	27	wheat	wheat	NOUN
brj-24352	144	28	straw	straw	NOUN
brj-24352	144	29	,	,	PUNCT
brj-24352	144	30	corn	corn	NOUN
brj-24352	144	31	stalk	stalk	NOUN
brj-24352	144	32	,	,	PUNCT
brj-24352	144	33	soybean	soybean	NOUN
brj-24352	144	34	straw	straw	NOUN
brj-24352	144	35	,	,	PUNCT
brj-24352	144	36	rape	rape	NOUN
brj-24352	144	37	straw	straw	NOUN
brj-24352	144	38	,	,	PUNCT
brj-24352	144	39	and	and	CCONJ
brj-24352	144	40	camellia	camellia	NOUN
brj-24352	144	41	oleifera	oleifera	PROPN
brj-24352	144	42	meal	meal	NOUN
brj-24352	144	43	.	.	PUNCT
brj-24352	145	1	the	the	DET
brj-24352	145	2	released	release	VERB
brj-24352	145	3	reducing	reduce	VERB
brj-24352	145	4	sugars	sugar	NOUN
brj-24352	145	5	were	be	AUX
brj-24352	145	6	quantified	quantify	VERB
brj-24352	145	7	,	,	PUNCT
brj-24352	145	8	and	and	CCONJ
brj-24352	145	9	the	the	DET
brj-24352	145	10	results	result	NOUN
brj-24352	145	11	are	be	AUX
brj-24352	145	12	summarized	summarize	VERB
brj-24352	145	13	in	in	ADP
brj-24352	145	14	fig	fig	NOUN
brj-24352	145	15	.	.	PUNCT
brj-24352	146	1	5	5	NUM
brj-24352	146	2	.	.	X
brj-24352	147	1	among	among	ADP
brj-24352	147	2	the	the	DET
brj-24352	147	3	tested	test	VERB
brj-24352	147	4	substrates	substrate	NOUN
brj-24352	147	5	,	,	PUNCT
brj-24352	147	6	corn	corn	NOUN
brj-24352	147	7	stalk	stalk	NOUN
brj-24352	147	8	exhibited	exhibit	VERB
brj-24352	147	9	the	the	DET
brj-24352	147	10	highest	high	ADJ
brj-24352	147	11	hydrolysis	hydrolysis	NOUN
brj-24352	147	12	efficiency	efficiency	NOUN
brj-24352	147	13	,	,	PUNCT
brj-24352	147	14	with	with	ADP
brj-24352	147	15	an	an	DET
brj-24352	147	16	average	average	ADJ
brj-24352	147	17	reducing	reduce	VERB
brj-24352	147	18	sugar	sugar	NOUN
brj-24352	147	19	concentration	concentration	NOUN
brj-24352	147	20	of	of	ADP
brj-24352	147	21	206.21	206.21	NUM
brj-24352	147	22	µg	µg	NOUN
brj-24352	147	23	/	/	SYM
brj-24352	147	24	ml	ml	NOUN
brj-24352	147	25	and	and	CCONJ
brj-24352	147	26	a	a	DET
brj-24352	147	27	standard	standard	ADJ
brj-24352	147	28	deviation	deviation	NOUN
brj-24352	147	29	of	of	ADP
brj-24352	147	30	19.11	19.11	NUM
brj-24352	147	31	µg	µg	NOUN
brj-24352	147	32	/	/	SYM
brj-24352	147	33	ml	ml	NOUN
brj-24352	147	34	.	.	PUNCT
brj-24352	148	1	this	this	PRON
brj-24352	148	2	was	be	AUX
brj-24352	148	3	followed	follow	VERB
brj-24352	148	4	by	by	ADP
brj-24352	148	5	wheat	wheat	NOUN
brj-24352	148	6	bran	bran	NOUN
brj-24352	148	7	(	(	PUNCT
brj-24352	148	8	106.63	106.63	NUM
brj-24352	148	9	µg	µg	NOUN
brj-24352	148	10	/	/	SYM
brj-24352	148	11	ml	ml	NOUN
brj-24352	148	12	,	,	PUNCT
brj-24352	148	13	sd	sd	ADP
brj-24352	148	14	=	=	SYM
brj-24352	148	15	20.08	20.08	NUM
brj-24352	148	16	)	)	PUNCT
brj-24352	148	17	and	and	CCONJ
brj-24352	148	18	rape	rape	NOUN
brj-24352	148	19	straw	straw	NOUN
brj-24352	148	20	(	(	PUNCT
brj-24352	148	21	93.83	93.83	NUM
brj-24352	148	22	µg	µg	NOUN
brj-24352	148	23	/	/	SYM
brj-24352	148	24	ml	ml	NOUN
brj-24352	148	25	,	,	PUNCT
brj-24352	148	26	sd	sd	ADP
brj-24352	148	27	=	=	SYM
brj-24352	148	28	3.57	3.57	NUM
brj-24352	148	29	)	)	PUNCT
brj-24352	148	30	.	.	PUNCT
brj-24352	149	1	in	in	ADP
brj-24352	149	2	contrast	contrast	NOUN
brj-24352	149	3	,	,	PUNCT
brj-24352	149	4	wheat	wheat	NOUN
brj-24352	149	5	straw	straw	NOUN
brj-24352	149	6	showed	show	VERB
brj-24352	149	7	the	the	DET
brj-24352	149	8	lowest	low	ADJ
brj-24352	149	9	hydrolytic	hydrolytic	ADJ
brj-24352	149	10	efficiency	efficiency	NOUN
brj-24352	149	11	,	,	PUNCT
brj-24352	149	12	releasing	release	VERB
brj-24352	149	13	only	only	ADV
brj-24352	149	14	47.89	47.89	NUM
brj-24352	149	15	µg	µg	NOUN
brj-24352	149	16	/	/	SYM
brj-24352	149	17	ml	ml	NOUN
brj-24352	149	18	of	of	ADP
brj-24352	149	19	reducing	reduce	VERB
brj-24352	149	20	sugars	sugar	NOUN
brj-24352	149	21	with	with	ADP
brj-24352	149	22	minimal	minimal	ADJ
brj-24352	149	23	variation	variation	NOUN
brj-24352	149	24	(	(	PUNCT
brj-24352	149	25	sd	sd	NOUN
brj-24352	149	26	=	=	NOUN
brj-24352	149	27	0.62	0.62	NUM
brj-24352	149	28	)	)	PUNCT
brj-24352	149	29	.	.	PUNCT
brj-24352	150	1	fig	fig	NOUN
brj-24352	150	2	.	.	PUNCT
brj-24352	151	1	5	5	X
brj-24352	151	2	.	.	X
brj-24352	151	3	hydrolysis	hydrolysis	NOUN
brj-24352	151	4	of	of	ADP
brj-24352	151	5	agricultural	agricultural	ADJ
brj-24352	151	6	wastes	waste	NOUN
brj-24352	151	7	by	by	ADP
brj-24352	151	8	rucel224	rucel224	PROPN
brj-24352	151	9	.	.	PUNCT
brj-24352	152	1	the	the	DET
brj-24352	152	2	results	result	NOUN
brj-24352	152	3	of	of	ADP
brj-24352	152	4	the	the	DET
brj-24352	152	5	hydrolysis	hydrolysis	NOUN
brj-24352	152	6	were	be	AUX
brj-24352	152	7	calculated	calculate	VERB
brj-24352	152	8	as	as	ADP
brj-24352	152	9	the	the	DET
brj-24352	152	10	difference	difference	NOUN
brj-24352	152	11	between	between	ADP
brj-24352	152	12	the	the	DET
brj-24352	152	13	experimental	experimental	ADJ
brj-24352	152	14	group	group	NOUN
brj-24352	152	15	(	(	PUNCT
brj-24352	152	16	with	with	ADP
brj-24352	152	17	enzyme	enzyme	NOUN
brj-24352	152	18	treatment	treatment	NOUN
brj-24352	152	19	)	)	PUNCT
brj-24352	152	20	and	and	CCONJ
brj-24352	152	21	the	the	DET
brj-24352	152	22	control	control	NOUN
brj-24352	152	23	group	group	NOUN
brj-24352	152	24	(	(	PUNCT
brj-24352	152	25	without	without	ADP
brj-24352	152	26	enzyme	enzyme	NOUN
brj-24352	152	27	treatment	treatment	NOUN
brj-24352	152	28	)	)	PUNCT
brj-24352	152	29	.	.	PUNCT
brj-24352	153	1	the	the	DET
brj-24352	153	2	observed	observe	VERB
brj-24352	153	3	variation	variation	NOUN
brj-24352	153	4	in	in	ADP
brj-24352	153	5	hydrolytic	hydrolytic	ADJ
brj-24352	153	6	efficiency	efficiency	NOUN
brj-24352	153	7	can	can	AUX
brj-24352	153	8	be	be	AUX
brj-24352	153	9	attributed	attribute	VERB
brj-24352	153	10	to	to	ADP
brj-24352	153	11	differences	difference	NOUN
brj-24352	153	12	in	in	ADP
brj-24352	153	13	lignocellulosic	lignocellulosic	ADJ
brj-24352	153	14	composition	composition	NOUN
brj-24352	153	15	and	and	CCONJ
brj-24352	153	16	structural	structural	ADJ
brj-24352	153	17	complexity	complexity	NOUN
brj-24352	153	18	among	among	ADP
brj-24352	153	19	substrates	substrate	NOUN
brj-24352	153	20	(	(	PUNCT
brj-24352	153	21	mansfield	mansfield	PROPN
brj-24352	153	22	et	et	PROPN
brj-24352	153	23	al	al	PROPN
brj-24352	153	24	.	.	PROPN
brj-24352	153	25	1999	1999	NUM
brj-24352	153	26	)	)	PUNCT
brj-24352	153	27	.	.	PUNCT
brj-24352	154	1	corn	corn	NOUN
brj-24352	154	2	stalk	stalk	NOUN
brj-24352	154	3	,	,	PUNCT
brj-24352	154	4	which	which	PRON
brj-24352	154	5	demonstrated	demonstrate	VERB
brj-24352	154	6	the	the	DET
brj-24352	154	7	highest	high	ADJ
brj-24352	154	8	reducing	reduce	VERB
brj-24352	154	9	sugar	sugar	NOUN
brj-24352	154	10	release	release	NOUN
brj-24352	154	11	,	,	PUNCT
brj-24352	154	12	is	be	AUX
brj-24352	154	13	known	know	VERB
brj-24352	154	14	to	to	PART
brj-24352	154	15	contain	contain	VERB
brj-24352	154	16	higher	high	ADJ
brj-24352	154	17	levels	level	NOUN
brj-24352	154	18	of	of	ADP
brj-24352	154	19	hemicellulose	hemicellulose	NOUN
brj-24352	154	20	and	and	CCONJ
brj-24352	154	21	amorphous	amorphous	ADJ
brj-24352	154	22	cellulose	cellulose	NOUN
brj-24352	154	23	,	,	PUNCT
brj-24352	154	24	which	which	PRON
brj-24352	154	25	are	be	AUX
brj-24352	154	26	more	more	ADV
brj-24352	154	27	susceptible	susceptible	ADJ
brj-24352	154	28	to	to	ADP
brj-24352	154	29	enzymatic	enzymatic	ADJ
brj-24352	154	30	hydrolysis	hydrolysis	NOUN
brj-24352	154	31	(	(	PUNCT
brj-24352	154	32	reddy	reddy	NOUN
brj-24352	154	33	and	and	CCONJ
brj-24352	154	34	yang	yang	PROPN
brj-24352	154	35	2005	2005	NUM
brj-24352	154	36	)	)	PUNCT
brj-24352	154	37	.	.	PUNCT
brj-24352	155	1	conversely	conversely	ADV
brj-24352	155	2	,	,	PUNCT
brj-24352	155	3	wheat	wheat	NOUN
brj-24352	155	4	straw	straw	NOUN
brj-24352	155	5	's	's	PART
brj-24352	155	6	dense	dense	ADJ
brj-24352	155	7	crystalline	crystalline	NOUN
brj-24352	155	8	cellulose	cellulose	NOUN
brj-24352	155	9	and	and	CCONJ
brj-24352	155	10	higher	high	ADJ
brj-24352	155	11	lignin	lignin	NOUN
brj-24352	155	12	content	content	NOUN
brj-24352	155	13	likely	likely	ADV
brj-24352	155	14	hindered	hinder	VERB
brj-24352	155	15	enzymatic	enzymatic	ADJ
brj-24352	155	16	access	access	NOUN
brj-24352	155	17	,	,	PUNCT
brj-24352	155	18	resulting	result	VERB
brj-24352	155	19	in	in	ADP
brj-24352	155	20	lower	low	ADJ
brj-24352	155	21	sugar	sugar	NOUN
brj-24352	155	22	release	release	NOUN
brj-24352	155	23	(	(	PUNCT
brj-24352	155	24	fan	fan	NOUN
brj-24352	155	25	et	et	PROPN
brj-24352	155	26	al	al	PROPN
brj-24352	155	27	.	.	PROPN
brj-24352	155	28	1981	1981	NUM
brj-24352	155	29	)	)	PUNCT
brj-24352	155	30	.	.	PUNCT
brj-24352	156	1	these	these	DET
brj-24352	156	2	findings	finding	NOUN
brj-24352	156	3	emphasize	emphasize	VERB
brj-24352	156	4	the	the	DET
brj-24352	156	5	potential	potential	NOUN
brj-24352	156	6	of	of	ADP
brj-24352	156	7	rucel224	rucel224	PROPN
brj-24352	156	8	in	in	ADP
brj-24352	156	9	agricultural	agricultural	ADJ
brj-24352	156	10	residue	residue	NOUN
brj-24352	156	11	valorization	valorization	NOUN
brj-24352	156	12	,	,	PUNCT
brj-24352	156	13	particularly	particularly	ADV
brj-24352	156	14	in	in	ADP
brj-24352	156	15	the	the	DET
brj-24352	156	16	context	context	NOUN
brj-24352	156	17	of	of	ADP
brj-24352	156	18	bioethanol	bioethanol	NOUN
brj-24352	156	19	production	production	NOUN
brj-24352	156	20	,	,	PUNCT
brj-24352	156	21	where	where	SCONJ
brj-24352	156	22	efficient	efficient	ADJ
brj-24352	156	23	lignocellulose	lignocellulose	ADJ
brj-24352	156	24	degradation	degradation	NOUN
brj-24352	156	25	is	be	AUX
brj-24352	156	26	crucial	crucial	ADJ
brj-24352	156	27	.	.	PUNCT
brj-24352	157	1	moreover	moreover	ADV
brj-24352	157	2	,	,	PUNCT
brj-24352	157	3	the	the	DET
brj-24352	157	4	enzyme	enzyme	NOUN
brj-24352	157	5	’s	’s	PART
brj-24352	157	6	effectiveness	effectiveness	NOUN
brj-24352	157	7	on	on	ADP
brj-24352	157	8	substrates	substrate	NOUN
brj-24352	157	9	such	such	ADJ
brj-24352	157	10	as	as	ADP
brj-24352	157	11	tea	tea	NOUN
brj-24352	157	12	seed	seed	NOUN
brj-24352	157	13	cake	cake	NOUN
brj-24352	157	14	and	and	CCONJ
brj-24352	157	15	rapeseed	rapeseed	NOUN
brj-24352	157	16	cake	cake	NOUN
brj-24352	157	17	,	,	PUNCT
brj-24352	157	18	indicates	indicate	VERB
brj-24352	157	19	its	its	PRON
brj-24352	157	20	potential	potential	ADJ
brj-24352	157	21	value	value	NOUN
brj-24352	157	22	in	in	ADP
brj-24352	157	23	processing	processing	NOUN
brj-24352	157	24	by	by	ADP
brj-24352	157	25	-	-	PUNCT
brj-24352	157	26	products	product	NOUN
brj-24352	157	27	from	from	ADP
brj-24352	157	28	oilseed	oilseed	NOUN
brj-24352	157	29	crops	crop	NOUN
brj-24352	157	30	,	,	PUNCT
brj-24352	157	31	further	far	ADV
brj-24352	157	32	broadening	broaden	VERB
brj-24352	157	33	its	its	PRON
brj-24352	157	34	industrial	industrial	ADJ
brj-24352	157	35	applications	application	NOUN
brj-24352	157	36	.	.	PUNCT
brj-24352	158	1	the	the	DET
brj-24352	158	2	authors	author	NOUN
brj-24352	158	3	’	’	PART
brj-24352	158	4	previous	previous	ADJ
brj-24352	158	5	studies	study	NOUN
brj-24352	158	6	align	align	VERB
brj-24352	158	7	with	with	ADP
brj-24352	158	8	these	these	DET
brj-24352	158	9	results	result	NOUN
brj-24352	158	10	,	,	PUNCT
brj-24352	158	11	demonstrating	demonstrate	VERB
brj-24352	158	12	the	the	DET
brj-24352	158	13	enzyme	enzyme	NOUN
brj-24352	158	14	's	's	PART
brj-24352	158	15	wide	wide	ADJ
brj-24352	158	16	substrate	substrate	NOUN
brj-24352	158	17	range	range	NOUN
brj-24352	158	18	under	under	ADP
brj-24352	158	19	mild	mild	ADJ
brj-24352	158	20	conditions	condition	NOUN
brj-24352	158	21	.	.	PUNCT
brj-24352	159	1	notably	notably	ADV
brj-24352	159	2	,	,	PUNCT
brj-24352	159	3	wheat	wheat	NOUN
brj-24352	159	4	bran	bran	NOUN
brj-24352	159	5	,	,	PUNCT
brj-24352	159	6	a	a	DET
brj-24352	159	7	by	by	NOUN
brj-24352	159	8	-	-	PUNCT
brj-24352	159	9	product	product	NOUN
brj-24352	159	10	of	of	ADP
brj-24352	159	11	flour	flour	NOUN
brj-24352	159	12	milling	milling	NOUN
brj-24352	159	13	,	,	PUNCT
brj-24352	159	14	exhibited	exhibit	VERB
brj-24352	159	15	substantial	substantial	ADJ
brj-24352	159	16	enzymatic	enzymatic	ADJ
brj-24352	159	17	hydrolysis	hydrolysis	NOUN
brj-24352	159	18	,	,	PUNCT
brj-24352	159	19	suggesting	suggest	VERB
brj-24352	159	20	its	its	PRON
brj-24352	159	21	suitability	suitability	NOUN
brj-24352	159	22	as	as	ADP
brj-24352	159	23	a	a	DET
brj-24352	159	24	feedstock	feedstock	NOUN
brj-24352	159	25	for	for	ADP
brj-24352	159	26	bioprocessing	bioprocesse	VERB
brj-24352	159	27	.	.	PUNCT
brj-24352	160	1	due	due	ADP
brj-24352	160	2	to	to	ADP
brj-24352	160	3	its	its	PRON
brj-24352	160	4	relatively	relatively	ADV
brj-24352	160	5	lower	low	ADJ
brj-24352	160	6	lignin	lignin	NOUN
brj-24352	160	7	content	content	NOUN
brj-24352	160	8	,	,	PUNCT
brj-24352	160	9	wheat	wheat	NOUN
brj-24352	160	10	bran	bran	NOUN
brj-24352	160	11	presents	present	VERB
brj-24352	160	12	a	a	DET
brj-24352	160	13	promising	promising	ADJ
brj-24352	160	14	substrate	substrate	NOUN
brj-24352	160	15	for	for	ADP
brj-24352	160	16	the	the	DET
brj-24352	160	17	production	production	NOUN
brj-24352	160	18	of	of	ADP
brj-24352	160	19	high	high	ADJ
brj-24352	160	20	-	-	PUNCT
brj-24352	160	21	value	value	NOUN
brj-24352	160	22	sugars	sugar	NOUN
brj-24352	160	23	.	.	PUNCT
brj-24352	161	1	however	however	ADV
brj-24352	161	2	,	,	PUNCT
brj-24352	161	3	despite	despite	SCONJ
brj-24352	161	4	rucel224	rucel224	PROPN
brj-24352	161	5	’s	’s	PART
brj-24352	161	6	significant	significant	ADJ
brj-24352	161	7	activity	activity	NOUN
brj-24352	161	8	across	across	ADP
brj-24352	161	9	diverse	diverse	ADJ
brj-24352	161	10	substrates	substrate	NOUN
brj-24352	161	11	,	,	PUNCT
brj-24352	161	12	its	its	PRON
brj-24352	161	13	reduced	reduce	VERB
brj-24352	161	14	efficiency	efficiency	NOUN
brj-24352	161	15	on	on	ADP
brj-24352	161	16	ligninrich	ligninrich	ADJ
brj-24352	161	17	materials	material	NOUN
brj-24352	161	18	,	,	PUNCT
brj-24352	161	19	such	such	ADJ
brj-24352	161	20	as	as	ADP
brj-24352	161	21	wheat	wheat	NOUN
brj-24352	161	22	straw	straw	NOUN
brj-24352	161	23	,	,	PUNCT
brj-24352	161	24	highlights	highlight	VERB
brj-24352	161	25	a	a	DET
brj-24352	161	26	key	key	ADJ
brj-24352	161	27	limitation	limitation	NOUN
brj-24352	161	28	.	.	PUNCT
brj-24352	162	1	this	this	DET
brj-24352	162	2	limitation	limitation	NOUN
brj-24352	162	3	underscores	underscore	VERB
brj-24352	162	4	the	the	DET
brj-24352	162	5	need	need	NOUN
brj-24352	162	6	for	for	ADP
brj-24352	162	7	optimization	optimization	NOUN
brj-24352	162	8	strategies	strategy	NOUN
brj-24352	162	9	to	to	PART
brj-24352	162	10	enhance	enhance	VERB
brj-24352	162	11	the	the	DET
brj-24352	162	12	enzyme	enzyme	NOUN
brj-24352	162	13	's	's	PART
brj-24352	162	14	efficacy	efficacy	NOUN
brj-24352	162	15	on	on	ADP
brj-24352	162	16	such	such	ADJ
brj-24352	162	17	recalcitrant	recalcitrant	ADJ
brj-24352	162	18	peer	peer	NOUN
brj-24352	162	19	-	-	PUNCT
brj-24352	162	20	reviewed	review	VERB
brj-24352	162	21	article	article	NOUN
brj-24352	162	22	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	162	23	ouyang	ouyang	PROPN
brj-24352	162	24	et	et	PROPN
brj-24352	162	25	al	al	PROPN
brj-24352	162	26	.	.	PROPN
brj-24352	163	1	(	(	PUNCT
brj-24352	163	2	2025	2025	NUM
brj-24352	163	3	)	)	PUNCT
brj-24352	163	4	.	.	PUNCT
brj-24352	164	1	“	"	PUNCT
brj-24352	164	2	rumen	ruman	NOUN
brj-24352	164	3	cellulase	cellulase	NOUN
brj-24352	164	4	&	&	CCONJ
brj-24352	164	5	ag	ag	PROPN
brj-24352	164	6	waste	waste	PROPN
brj-24352	164	7	,	,	PUNCT
brj-24352	164	8	”	"	PUNCT
brj-24352	164	9	bioresources	bioresource	NOUN
brj-24352	164	10	20(3	20(3	NOUN
brj-24352	164	11	)	)	PUNCT
brj-24352	164	12	,	,	PUNCT
brj-24352	164	13	5501	5501	NUM
brj-24352	164	14	-	-	SYM
brj-24352	164	15	5513	5513	NUM
brj-24352	164	16	.	.	PUNCT
brj-24352	165	1	5509	5509	NUM
brj-24352	165	2	substrates	substrate	NOUN
brj-24352	165	3	.	.	PUNCT
brj-24352	166	1	potential	potential	ADJ
brj-24352	166	2	solutions	solution	NOUN
brj-24352	166	3	could	could	AUX
brj-24352	166	4	include	include	VERB
brj-24352	166	5	enzyme	enzyme	NOUN
brj-24352	166	6	engineering	engineering	NOUN
brj-24352	166	7	or	or	CCONJ
brj-24352	166	8	the	the	DET
brj-24352	166	9	synergistic	synergistic	ADJ
brj-24352	166	10	use	use	NOUN
brj-24352	166	11	of	of	ADP
brj-24352	166	12	auxiliary	auxiliary	ADJ
brj-24352	166	13	enzymes	enzyme	NOUN
brj-24352	166	14	,	,	PUNCT
brj-24352	166	15	such	such	ADJ
brj-24352	166	16	as	as	ADP
brj-24352	166	17	laccases	laccase	NOUN
brj-24352	166	18	or	or	CCONJ
brj-24352	166	19	peroxidases	peroxidase	NOUN
brj-24352	166	20	,	,	PUNCT
brj-24352	166	21	which	which	PRON
brj-24352	166	22	may	may	AUX
brj-24352	166	23	improve	improve	VERB
brj-24352	166	24	the	the	DET
brj-24352	166	25	breakdown	breakdown	NOUN
brj-24352	166	26	of	of	ADP
brj-24352	166	27	lignin	lignin	NOUN
brj-24352	166	28	(	(	PUNCT
brj-24352	166	29	shin	shin	NOUN
brj-24352	166	30	et	et	PROPN
brj-24352	166	31	al	al	PROPN
brj-24352	166	32	.	.	PROPN
brj-24352	166	33	2019	2019	NUM
brj-24352	166	34	)	)	PUNCT
brj-24352	166	35	.	.	PUNCT
brj-24352	167	1	furthermore	furthermore	ADV
brj-24352	167	2	,	,	PUNCT
brj-24352	167	3	pretreatment	pretreatment	NOUN
brj-24352	167	4	methods	method	NOUN
brj-24352	167	5	like	like	ADP
brj-24352	167	6	steam	steam	NOUN
brj-24352	167	7	explosion	explosion	NOUN
brj-24352	167	8	or	or	CCONJ
brj-24352	167	9	alkali	alkali	ADJ
brj-24352	167	10	treatment	treatment	NOUN
brj-24352	167	11	could	could	AUX
brj-24352	167	12	disrupt	disrupt	VERB
brj-24352	167	13	lignin	lignin	NOUN
brj-24352	167	14	-	-	PUNCT
brj-24352	167	15	cellulose	cellulose	NOUN
brj-24352	167	16	complexes	complex	NOUN
brj-24352	167	17	,	,	PUNCT
brj-24352	167	18	thereby	thereby	ADV
brj-24352	167	19	enhancing	enhance	VERB
brj-24352	167	20	the	the	DET
brj-24352	167	21	enzyme	enzyme	NOUN
brj-24352	167	22	's	's	PART
brj-24352	167	23	access	access	NOUN
brj-24352	167	24	to	to	ADP
brj-24352	167	25	the	the	DET
brj-24352	167	26	cellulose	cellulose	NOUN
brj-24352	167	27	fraction	fraction	NOUN
brj-24352	167	28	and	and	CCONJ
brj-24352	167	29	improving	improve	VERB
brj-24352	167	30	hydrolysis	hydrolysis	NOUN
brj-24352	167	31	efficiency	efficiency	NOUN
brj-24352	167	32	(	(	PUNCT
brj-24352	167	33	hendriks	hendriks	NOUN
brj-24352	167	34	and	and	CCONJ
brj-24352	167	35	zeeman	zeeman	PROPN
brj-24352	167	36	2009	2009	NUM
brj-24352	167	37	)	)	PUNCT
brj-24352	167	38	.	.	PUNCT
brj-24352	168	1	these	these	DET
brj-24352	168	2	substrate	substrate	NOUN
brj-24352	168	3	-	-	PUNCT
brj-24352	168	4	specific	specific	ADJ
brj-24352	168	5	variations	variation	NOUN
brj-24352	168	6	in	in	ADP
brj-24352	168	7	reducing	reduce	VERB
brj-24352	168	8	sugar	sugar	NOUN
brj-24352	168	9	release	release	NOUN
brj-24352	168	10	reinforce	reinforce	VERB
brj-24352	168	11	the	the	DET
brj-24352	168	12	necessity	necessity	NOUN
brj-24352	168	13	of	of	ADP
brj-24352	168	14	tailoring	tailor	VERB
brj-24352	168	15	enzymatic	enzymatic	ADJ
brj-24352	168	16	processes	process	NOUN
brj-24352	168	17	to	to	ADP
brj-24352	168	18	the	the	DET
brj-24352	168	19	unique	unique	ADJ
brj-24352	168	20	characteristics	characteristic	NOUN
brj-24352	168	21	of	of	ADP
brj-24352	168	22	different	different	ADJ
brj-24352	168	23	feedstocks	feedstock	NOUN
brj-24352	168	24	.	.	PUNCT
brj-24352	169	1	beyond	beyond	ADP
brj-24352	169	2	enzymatic	enzymatic	ADJ
brj-24352	169	3	performance	performance	NOUN
brj-24352	169	4	,	,	PUNCT
brj-24352	169	5	the	the	DET
brj-24352	169	6	cost	cost	NOUN
brj-24352	169	7	of	of	ADP
brj-24352	169	8	rucel224	rucel224	PROPN
brj-24352	169	9	production	production	NOUN
brj-24352	169	10	presents	present	VERB
brj-24352	169	11	another	another	DET
brj-24352	169	12	significant	significant	ADJ
brj-24352	169	13	challenge	challenge	NOUN
brj-24352	169	14	.	.	PUNCT
brj-24352	170	1	the	the	DET
brj-24352	170	2	industrial	industrial	ADJ
brj-24352	170	3	production	production	NOUN
brj-24352	170	4	of	of	ADP
brj-24352	170	5	enzymes	enzyme	NOUN
brj-24352	170	6	is	be	AUX
brj-24352	170	7	inherently	inherently	ADV
brj-24352	170	8	expensive	expensive	ADJ
brj-24352	170	9	due	due	ADP
brj-24352	170	10	to	to	ADP
brj-24352	170	11	the	the	DET
brj-24352	170	12	requirements	requirement	NOUN
brj-24352	170	13	for	for	ADP
brj-24352	170	14	fermentation	fermentation	NOUN
brj-24352	170	15	,	,	PUNCT
brj-24352	170	16	purification	purification	NOUN
brj-24352	170	17	,	,	PUNCT
brj-24352	170	18	and	and	CCONJ
brj-24352	170	19	stabilization	stabilization	NOUN
brj-24352	170	20	,	,	PUNCT
brj-24352	170	21	which	which	PRON
brj-24352	170	22	can	can	AUX
brj-24352	170	23	hinder	hinder	VERB
brj-24352	170	24	their	their	PRON
brj-24352	170	25	widespread	widespread	ADJ
brj-24352	170	26	application	application	NOUN
brj-24352	170	27	,	,	PUNCT
brj-24352	170	28	particularly	particularly	ADV
brj-24352	170	29	in	in	ADP
brj-24352	170	30	cost	cost	NOUN
brj-24352	170	31	-	-	PUNCT
brj-24352	170	32	sensitive	sensitive	ADJ
brj-24352	170	33	sectors	sector	NOUN
brj-24352	170	34	like	like	ADP
brj-24352	170	35	bioethanol	bioethanol	NOUN
brj-24352	170	36	production	production	NOUN
brj-24352	170	37	.	.	PUNCT
brj-24352	171	1	strategies	strategy	NOUN
brj-24352	171	2	to	to	PART
brj-24352	171	3	reduce	reduce	VERB
brj-24352	171	4	enzyme	enzyme	NOUN
brj-24352	171	5	production	production	NOUN
brj-24352	171	6	costs	cost	NOUN
brj-24352	171	7	are	be	AUX
brj-24352	171	8	therefore	therefore	ADV
brj-24352	171	9	critical	critical	ADJ
brj-24352	171	10	.	.	PUNCT
brj-24352	172	1	optimizing	optimize	VERB
brj-24352	172	2	microbial	microbial	ADJ
brj-24352	172	3	fermentation	fermentation	NOUN
brj-24352	172	4	processes	process	NOUN
brj-24352	172	5	,	,	PUNCT
brj-24352	172	6	improving	improve	VERB
brj-24352	172	7	strain	strain	NOUN
brj-24352	172	8	engineering	engineering	NOUN
brj-24352	172	9	for	for	ADP
brj-24352	172	10	higher	high	ADJ
brj-24352	172	11	expression	expression	NOUN
brj-24352	172	12	yields	yield	NOUN
brj-24352	172	13	,	,	PUNCT
brj-24352	172	14	and	and	CCONJ
brj-24352	172	15	exploring	explore	VERB
brj-24352	172	16	alternative	alternative	ADJ
brj-24352	172	17	host	host	NOUN
brj-24352	172	18	systems	system	NOUN
brj-24352	172	19	—	—	PUNCT
brj-24352	172	20	such	such	ADJ
brj-24352	172	21	as	as	ADP
brj-24352	172	22	bacterial	bacterial	ADJ
brj-24352	172	23	or	or	CCONJ
brj-24352	172	24	yeast	yeast	NOUN
brj-24352	172	25	-	-	PUNCT
brj-24352	172	26	based	base	VERB
brj-24352	172	27	recombinant	recombinant	ADJ
brj-24352	172	28	platforms	platform	NOUN
brj-24352	172	29	—	—	PUNCT
brj-24352	172	30	could	could	AUX
brj-24352	172	31	substantially	substantially	ADV
brj-24352	172	32	enhance	enhance	VERB
brj-24352	172	33	the	the	DET
brj-24352	172	34	cost	cost	NOUN
brj-24352	172	35	-	-	PUNCT
brj-24352	172	36	effectiveness	effectiveness	NOUN
brj-24352	172	37	of	of	ADP
brj-24352	172	38	rucel224	rucel224	PROPN
brj-24352	172	39	production	production	NOUN
brj-24352	172	40	(	(	PUNCT
brj-24352	172	41	adegboye	adegboye	VERB
brj-24352	172	42	et	et	PROPN
brj-24352	172	43	al	al	PROPN
brj-24352	172	44	.	.	PROPN
brj-24352	172	45	2021	2021	NUM
brj-24352	172	46	)	)	PUNCT
brj-24352	172	47	.	.	PUNCT
brj-24352	173	1	additionally	additionally	ADV
brj-24352	173	2	,	,	PUNCT
brj-24352	173	3	the	the	DET
brj-24352	173	4	enzyme	enzyme	NOUN
brj-24352	173	5	’s	’s	PART
brj-24352	173	6	stability	stability	NOUN
brj-24352	173	7	and	and	CCONJ
brj-24352	173	8	availability	availability	NOUN
brj-24352	173	9	under	under	ADP
brj-24352	173	10	varying	vary	VERB
brj-24352	173	11	storage	storage	NOUN
brj-24352	173	12	and	and	CCONJ
brj-24352	173	13	operational	operational	ADJ
brj-24352	173	14	conditions	condition	NOUN
brj-24352	173	15	are	be	AUX
brj-24352	173	16	crucial	crucial	ADJ
brj-24352	173	17	for	for	ADP
brj-24352	173	18	its	its	PRON
brj-24352	173	19	industrial	industrial	ADJ
brj-24352	173	20	deployment	deployment	NOUN
brj-24352	173	21	.	.	PUNCT
brj-24352	174	1	enzymes	enzyme	NOUN
brj-24352	174	2	are	be	AUX
brj-24352	174	3	susceptible	susceptible	ADJ
brj-24352	174	4	to	to	ADP
brj-24352	174	5	denaturation	denaturation	NOUN
brj-24352	174	6	and	and	CCONJ
brj-24352	174	7	activity	activity	NOUN
brj-24352	174	8	loss	loss	NOUN
brj-24352	174	9	due	due	ADJ
brj-24352	174	10	to	to	ADP
brj-24352	174	11	prolonged	prolonged	ADJ
brj-24352	174	12	storage	storage	NOUN
brj-24352	174	13	,	,	PUNCT
brj-24352	174	14	temperature	temperature	NOUN
brj-24352	174	15	fluctuations	fluctuation	NOUN
brj-24352	174	16	,	,	PUNCT
brj-24352	174	17	and	and	CCONJ
brj-24352	174	18	interactions	interaction	NOUN
brj-24352	174	19	with	with	ADP
brj-24352	174	20	inhibitors	inhibitor	NOUN
brj-24352	174	21	or	or	CCONJ
brj-24352	174	22	stabilizing	stabilize	VERB
brj-24352	174	23	agents	agent	NOUN
brj-24352	174	24	.	.	PUNCT
brj-24352	175	1	to	to	PART
brj-24352	175	2	mitigate	mitigate	VERB
brj-24352	175	3	these	these	DET
brj-24352	175	4	challenges	challenge	NOUN
brj-24352	175	5	,	,	PUNCT
brj-24352	175	6	enzyme	enzyme	NOUN
brj-24352	175	7	immobilization	immobilization	NOUN
brj-24352	175	8	or	or	CCONJ
brj-24352	175	9	chemical	chemical	NOUN
brj-24352	175	10	modifications	modification	NOUN
brj-24352	175	11	could	could	AUX
brj-24352	175	12	be	be	AUX
brj-24352	175	13	employed	employ	VERB
brj-24352	175	14	to	to	PART
brj-24352	175	15	enhance	enhance	VERB
brj-24352	175	16	rucel224	rucel224	PROPN
brj-24352	175	17	’s	’s	PART
brj-24352	175	18	structural	structural	ADJ
brj-24352	175	19	stability	stability	NOUN
brj-24352	175	20	and	and	CCONJ
brj-24352	175	21	extend	extend	VERB
brj-24352	175	22	its	its	PRON
brj-24352	175	23	shelf	shelf	NOUN
brj-24352	175	24	life	life	NOUN
brj-24352	175	25	,	,	PUNCT
brj-24352	175	26	ultimately	ultimately	ADV
brj-24352	175	27	improving	improve	VERB
brj-24352	175	28	its	its	PRON
brj-24352	175	29	practicality	practicality	NOUN
brj-24352	175	30	in	in	ADP
brj-24352	175	31	continuous	continuous	ADJ
brj-24352	175	32	industrial	industrial	ADJ
brj-24352	175	33	processes	process	NOUN
brj-24352	175	34	(	(	PUNCT
brj-24352	175	35	ansari	ansari	ADJ
brj-24352	175	36	and	and	CCONJ
brj-24352	175	37	husain	husain	PROPN
brj-24352	175	38	2012	2012	NUM
brj-24352	175	39	)	)	PUNCT
brj-24352	175	40	.	.	PUNCT
brj-24352	176	1	in	in	ADP
brj-24352	176	2	summary	summary	NOUN
brj-24352	176	3	,	,	PUNCT
brj-24352	176	4	while	while	SCONJ
brj-24352	176	5	rucel224	rucel224	PROPN
brj-24352	176	6	holds	hold	VERB
brj-24352	176	7	great	great	ADJ
brj-24352	176	8	promise	promise	NOUN
brj-24352	176	9	for	for	ADP
brj-24352	176	10	lignocellulosic	lignocellulosic	ADJ
brj-24352	176	11	biomass	biomass	NOUN
brj-24352	176	12	conversion	conversion	NOUN
brj-24352	176	13	,	,	PUNCT
brj-24352	176	14	addressing	address	VERB
brj-24352	176	15	its	its	PRON
brj-24352	176	16	limitations	limitation	NOUN
brj-24352	176	17	—	—	PUNCT
brj-24352	176	18	including	include	VERB
brj-24352	176	19	its	its	PRON
brj-24352	176	20	narrow	narrow	ADJ
brj-24352	176	21	operational	operational	ADJ
brj-24352	176	22	range	range	NOUN
brj-24352	176	23	,	,	PUNCT
brj-24352	176	24	high	high	ADJ
brj-24352	176	25	production	production	NOUN
brj-24352	176	26	costs	cost	NOUN
brj-24352	176	27	,	,	PUNCT
brj-24352	176	28	and	and	CCONJ
brj-24352	176	29	sensitivity	sensitivity	NOUN
brj-24352	176	30	to	to	ADP
brj-24352	176	31	lignin	lignin	NOUN
brj-24352	176	32	-	-	PUNCT
brj-24352	176	33	rich	rich	ADJ
brj-24352	176	34	substrates	substrate	NOUN
brj-24352	176	35	—	—	PUNCT
brj-24352	176	36	will	will	AUX
brj-24352	176	37	be	be	AUX
brj-24352	176	38	critical	critical	ADJ
brj-24352	176	39	for	for	ADP
brj-24352	176	40	maximizing	maximize	VERB
brj-24352	176	41	its	its	PRON
brj-24352	176	42	commercial	commercial	ADJ
brj-24352	176	43	potential	potential	NOUN
brj-24352	176	44	.	.	PUNCT
brj-24352	177	1	advancements	advancement	NOUN
brj-24352	177	2	in	in	ADP
brj-24352	177	3	enzyme	enzyme	NOUN
brj-24352	177	4	optimization	optimization	NOUN
brj-24352	177	5	,	,	PUNCT
brj-24352	177	6	synergistic	synergistic	ADJ
brj-24352	177	7	enzymatic	enzymatic	ADJ
brj-24352	177	8	applications	application	NOUN
brj-24352	177	9	,	,	PUNCT
brj-24352	177	10	and	and	CCONJ
brj-24352	177	11	effective	effective	ADJ
brj-24352	177	12	pretreatment	pretreatment	NOUN
brj-24352	177	13	strategies	strategy	NOUN
brj-24352	177	14	will	will	AUX
brj-24352	177	15	play	play	VERB
brj-24352	177	16	a	a	DET
brj-24352	177	17	pivotal	pivotal	ADJ
brj-24352	177	18	role	role	NOUN
brj-24352	177	19	in	in	ADP
brj-24352	177	20	overcoming	overcome	VERB
brj-24352	177	21	these	these	DET
brj-24352	177	22	challenges	challenge	NOUN
brj-24352	177	23	,	,	PUNCT
brj-24352	177	24	ultimately	ultimately	ADV
brj-24352	177	25	enabling	enable	VERB
brj-24352	177	26	the	the	DET
brj-24352	177	27	broader	broad	ADJ
brj-24352	177	28	adoption	adoption	NOUN
brj-24352	177	29	of	of	ADP
brj-24352	177	30	rucel224	rucel224	PROPN
brj-24352	177	31	in	in	ADP
brj-24352	177	32	bioprocessing	bioprocesse	VERB
brj-24352	177	33	industries	industry	NOUN
brj-24352	177	34	.	.	PUNCT
brj-24352	178	1	conclusions	conclusion	NOUN
brj-24352	178	2	1	1	X
brj-24352	178	3	.	.	PUNCT
brj-24352	179	1	rucel224	rucel224	PROPN
brj-24352	179	2	is	be	AUX
brj-24352	179	3	a	a	DET
brj-24352	179	4	rumen	ruman	NOUN
brj-24352	179	5	-	-	PUNCT
brj-24352	179	6	derived	derive	VERB
brj-24352	179	7	cellulase	cellulase	NOUN
brj-24352	179	8	with	with	ADP
brj-24352	179	9	broad	broad	ADJ
brj-24352	179	10	substrate	substrate	NOUN
brj-24352	179	11	specificity	specificity	NOUN
brj-24352	179	12	,	,	PUNCT
brj-24352	179	13	capable	capable	ADJ
brj-24352	179	14	of	of	ADP
brj-24352	179	15	degrading	degrade	VERB
brj-24352	179	16	both	both	CCONJ
brj-24352	179	17	cellulose	cellulose	NOUN
brj-24352	179	18	and	and	CCONJ
brj-24352	179	19	hemicellulose	hemicellulose	NOUN
brj-24352	179	20	.	.	PUNCT
brj-24352	180	1	2	2	NUM
brj-24352	180	2	.	.	X
brj-24352	180	3	rucel224	rucel224	PROPN
brj-24352	180	4	exhibits	exhibit	VERB
brj-24352	180	5	optimal	optimal	ADJ
brj-24352	180	6	activity	activity	NOUN
brj-24352	180	7	at	at	ADP
brj-24352	180	8	ph	ph	PROPN
brj-24352	180	9	5.0	5.0	NUM
brj-24352	180	10	and	and	CCONJ
brj-24352	180	11	35	35	NUM
brj-24352	180	12	°	°	NOUN
brj-24352	180	13	c	c	NOUN
brj-24352	180	14	,	,	PUNCT
brj-24352	180	15	with	with	ADP
brj-24352	180	16	good	good	ADJ
brj-24352	180	17	ph	ph	ADJ
brj-24352	180	18	stability	stability	NOUN
brj-24352	180	19	,	,	PUNCT
brj-24352	180	20	but	but	CCONJ
brj-24352	180	21	it	it	PRON
brj-24352	180	22	is	be	AUX
brj-24352	180	23	sensitive	sensitive	ADJ
brj-24352	180	24	to	to	ADP
brj-24352	180	25	high	high	ADJ
brj-24352	180	26	temperatures	temperature	NOUN
brj-24352	180	27	and	and	CCONJ
brj-24352	180	28	highly	highly	ADV
brj-24352	180	29	acidic	acidic	ADJ
brj-24352	180	30	environments	environment	NOUN
brj-24352	180	31	,	,	PUNCT
brj-24352	180	32	making	make	VERB
brj-24352	180	33	it	it	PRON
brj-24352	180	34	suitable	suitable	ADJ
brj-24352	180	35	for	for	ADP
brj-24352	180	36	operation	operation	NOUN
brj-24352	180	37	under	under	ADP
brj-24352	180	38	mild	mild	ADJ
brj-24352	180	39	conditions	condition	NOUN
brj-24352	180	40	.	.	PUNCT
brj-24352	181	1	3	3	X
brj-24352	181	2	.	.	X
brj-24352	181	3	mn²⁺	mn²⁺	NOUN
brj-24352	181	4	significantly	significantly	ADV
brj-24352	181	5	enhances	enhance	VERB
brj-24352	181	6	the	the	DET
brj-24352	181	7	cellulase	cellulase	NOUN
brj-24352	181	8	activity	activity	NOUN
brj-24352	181	9	of	of	ADP
brj-24352	181	10	rucel224	rucel224	PROPN
brj-24352	181	11	.	.	PROPN
brj-24352	182	1	4	4	NUM
brj-24352	182	2	.	.	X
brj-24352	182	3	rucel224	rucel224	PROPN
brj-24352	182	4	demonstrates	demonstrate	VERB
brj-24352	182	5	good	good	ADJ
brj-24352	182	6	degradation	degradation	NOUN
brj-24352	182	7	capacity	capacity	NOUN
brj-24352	182	8	on	on	ADP
brj-24352	182	9	agricultural	agricultural	ADJ
brj-24352	182	10	wastes	waste	NOUN
brj-24352	182	11	such	such	ADJ
brj-24352	182	12	as	as	ADP
brj-24352	182	13	corn	corn	NOUN
brj-24352	182	14	stalks	stalk	NOUN
brj-24352	182	15	,	,	PUNCT
brj-24352	182	16	providing	provide	VERB
brj-24352	182	17	a	a	DET
brj-24352	182	18	foundation	foundation	NOUN
brj-24352	182	19	for	for	ADP
brj-24352	182	20	the	the	DET
brj-24352	182	21	further	further	ADJ
brj-24352	182	22	development	development	NOUN
brj-24352	182	23	of	of	ADP
brj-24352	182	24	rucel224	rucel224	PROPN
brj-24352	182	25	-	-	PUNCT
brj-24352	182	26	based	base	VERB
brj-24352	182	27	enzymatic	enzymatic	ADJ
brj-24352	182	28	systems	system	NOUN
brj-24352	182	29	in	in	ADP
brj-24352	182	30	biomass	biomass	NOUN
brj-24352	182	31	conversion	conversion	NOUN
brj-24352	182	32	and	and	CCONJ
brj-24352	182	33	green	green	ADJ
brj-24352	182	34	biorefining	biorefining	NOUN
brj-24352	182	35	applications	application	NOUN
brj-24352	182	36	.	.	PUNCT
brj-24352	183	1	peer	peer	NOUN
brj-24352	183	2	-	-	PUNCT
brj-24352	183	3	reviewed	review	VERB
brj-24352	183	4	article	article	NOUN
brj-24352	183	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	183	6	ouyang	ouyang	PROPN
brj-24352	183	7	et	et	PROPN
brj-24352	183	8	al	al	PROPN
brj-24352	183	9	.	.	PROPN
brj-24352	183	10	(	(	PUNCT
brj-24352	183	11	2025	2025	NUM
brj-24352	183	12	)	)	PUNCT
brj-24352	183	13	.	.	PUNCT
brj-24352	184	1	“	"	PUNCT
brj-24352	184	2	rumen	ruman	NOUN
brj-24352	184	3	cellulase	cellulase	NOUN
brj-24352	184	4	&	&	CCONJ
brj-24352	184	5	ag	ag	PROPN
brj-24352	184	6	waste	waste	PROPN
brj-24352	184	7	,	,	PUNCT
brj-24352	184	8	”	"	PUNCT
brj-24352	184	9	bioresources	bioresource	NOUN
brj-24352	184	10	20(3	20(3	NOUN
brj-24352	184	11	)	)	PUNCT
brj-24352	184	12	,	,	PUNCT
brj-24352	184	13	5501	5501	NUM
brj-24352	184	14	-	-	SYM
brj-24352	184	15	5513	5513	NUM
brj-24352	184	16	.	.	PUNCT
brj-24352	185	1	5510	5510	NUM
brj-24352	185	2	acknowledgments	acknowledgment	NOUN
brj-24352	185	3	the	the	DET
brj-24352	185	4	current	current	ADJ
brj-24352	185	5	study	study	NOUN
brj-24352	185	6	was	be	AUX
brj-24352	185	7	funded	fund	VERB
brj-24352	185	8	by	by	ADP
brj-24352	185	9	the	the	DET
brj-24352	185	10	key	key	ADJ
brj-24352	185	11	research	research	NOUN
brj-24352	185	12	and	and	CCONJ
brj-24352	185	13	development	development	NOUN
brj-24352	185	14	projects	project	NOUN
brj-24352	185	15	of	of	ADP
brj-24352	185	16	jiangxi	jiangxi	PROPN
brj-24352	185	17	province	province	PROPN
brj-24352	185	18	(	(	PUNCT
brj-24352	185	19	20232bbf60010	20232bbf60010	NUM
brj-24352	185	20	)	)	PUNCT
brj-24352	185	21	,	,	PUNCT
brj-24352	185	22	natural	natural	ADJ
brj-24352	185	23	science	science	NOUN
brj-24352	185	24	foundation	foundation	PROPN
brj-24352	185	25	of	of	ADP
brj-24352	185	26	jiangxi	jiangxi	PROPN
brj-24352	185	27	province	province	PROPN
brj-24352	185	28	(	(	PUNCT
brj-24352	185	29	20224acb205007	20224acb205007	NUM
brj-24352	185	30	,	,	PUNCT
brj-24352	185	31	20242bab20309	20242bab20309	NUM
brj-24352	185	32	)	)	PUNCT
brj-24352	185	33	,	,	PUNCT
brj-24352	185	34	and	and	CCONJ
brj-24352	185	35	key	key	ADJ
brj-24352	185	36	research	research	NOUN
brj-24352	185	37	and	and	CCONJ
brj-24352	185	38	development	development	NOUN
brj-24352	185	39	projects	project	NOUN
brj-24352	185	40	of	of	ADP
brj-24352	185	41	jiangxi	jiangxi	PROPN
brj-24352	185	42	province	province	PROPN
brj-24352	185	43	(	(	PUNCT
brj-24352	185	44	20232bbf60009	20232bbf60009	NUM
brj-24352	185	45	)	)	PUNCT
brj-24352	185	46	.	.	PUNCT
brj-24352	186	1	references	reference	NOUN
brj-24352	186	2	cited	cite	VERB
brj-24352	186	3	adegboye	adegboye	PROPN
brj-24352	186	4	,	,	PUNCT
brj-24352	186	5	m.	m.	PROPN
brj-24352	186	6	f.	f.	PROPN
brj-24352	186	7	,	,	PUNCT
brj-24352	186	8	ojuederie	ojuederie	ADJ
brj-24352	186	9	,	,	PUNCT
brj-24352	186	10	o.	o.	PROPN
brj-24352	186	11	b.	b.	PROPN
brj-24352	186	12	,	,	PUNCT
brj-24352	186	13	talia	talia	PROPN
brj-24352	186	14	,	,	PUNCT
brj-24352	186	15	p.	p.	NOUN
brj-24352	186	16	m.	m.	NOUN
brj-24352	186	17	,	,	PUNCT
brj-24352	186	18	and	and	CCONJ
brj-24352	186	19	babalola	babalola	NOUN
brj-24352	186	20	,	,	PUNCT
brj-24352	186	21	o.	o.	NOUN
brj-24352	186	22	o.	o.	PROPN
brj-24352	186	23	(	(	PUNCT
brj-24352	186	24	2021	2021	NUM
brj-24352	186	25	)	)	PUNCT
brj-24352	186	26	.	.	PUNCT
brj-24352	187	1	“	"	PUNCT
brj-24352	187	2	bioprospecting	bioprospecte	VERB
brj-24352	187	3	of	of	ADP
brj-24352	187	4	microbial	microbial	ADJ
brj-24352	187	5	strains	strain	NOUN
brj-24352	187	6	for	for	ADP
brj-24352	187	7	biofuel	biofuel	NOUN
brj-24352	187	8	production	production	NOUN
brj-24352	187	9	:	:	PUNCT
brj-24352	187	10	metabolic	metabolic	NOUN
brj-24352	187	11	engineering	engineering	NOUN
brj-24352	187	12	,	,	PUNCT
brj-24352	187	13	applications	application	NOUN
brj-24352	187	14	,	,	PUNCT
brj-24352	187	15	and	and	CCONJ
brj-24352	187	16	challenges	challenge	NOUN
brj-24352	187	17	,	,	PUNCT
brj-24352	187	18	”	"	PUNCT
brj-24352	187	19	biotechnol	biotechnol	NOUN
brj-24352	187	20	.	.	PUNCT
brj-24352	188	1	biofuels	biofuel	NOUN
brj-24352	188	2	14(1	14(1	NUM
brj-24352	188	3	)	)	PUNCT
brj-24352	188	4	,	,	PUNCT
brj-24352	188	5	5	5	NUM
brj-24352	188	6	.	.	PUNCT
brj-24352	188	7	doi:10.1186	doi:10.1186	PROPN
brj-24352	188	8	/	/	SYM
brj-24352	188	9	s13068020	s13068020	PROPN
brj-24352	188	10	-	-	PUNCT
brj-24352	188	11	01853	01853	NUM
brj-24352	188	12	-	-	SYM
brj-24352	188	13	2	2	NUM
brj-24352	188	14	agrawal	agrawal	NOUN
brj-24352	188	15	,	,	PUNCT
brj-24352	188	16	r.	r.	PROPN
brj-24352	188	17	,	,	PUNCT
brj-24352	188	18	verma	verma	PROPN
brj-24352	188	19	,	,	PUNCT
brj-24352	188	20	a.	a.	NOUN
brj-24352	188	21	,	,	PUNCT
brj-24352	188	22	singhania	singhania	PROPN
brj-24352	188	23	,	,	PUNCT
brj-24352	188	24	r.	r.	PROPN
brj-24352	188	25	r.	r.	PROPN
brj-24352	188	26	,	,	PUNCT
brj-24352	188	27	varjani	varjani	PROPN
brj-24352	188	28	,	,	PUNCT
brj-24352	188	29	s.	s.	PROPN
brj-24352	188	30	,	,	PUNCT
brj-24352	188	31	di	di	PROPN
brj-24352	188	32	dong	dong	PROPN
brj-24352	188	33	,	,	PUNCT
brj-24352	188	34	c.	c.	PROPN
brj-24352	188	35	,	,	PUNCT
brj-24352	188	36	and	and	CCONJ
brj-24352	188	37	patel	patel	PROPN
brj-24352	188	38	,	,	PUNCT
brj-24352	188	39	a.	a.	PROPN
brj-24352	188	40	k.	k.	PROPN
brj-24352	188	41	(	(	PUNCT
brj-24352	188	42	2021	2021	NUM
brj-24352	188	43	)	)	PUNCT
brj-24352	188	44	.	.	PUNCT
brj-24352	189	1	“	"	PUNCT
brj-24352	189	2	current	current	ADJ
brj-24352	189	3	understanding	understanding	NOUN
brj-24352	189	4	of	of	ADP
brj-24352	189	5	the	the	DET
brj-24352	189	6	inhibition	inhibition	NOUN
brj-24352	189	7	factors	factor	NOUN
brj-24352	189	8	and	and	CCONJ
brj-24352	189	9	their	their	PRON
brj-24352	189	10	mechanism	mechanism	NOUN
brj-24352	189	11	of	of	ADP
brj-24352	189	12	action	action	NOUN
brj-24352	189	13	for	for	ADP
brj-24352	189	14	the	the	DET
brj-24352	189	15	lignocellulosic	lignocellulosic	ADJ
brj-24352	189	16	biomass	biomass	NOUN
brj-24352	189	17	hydrolysis	hydrolysis	NOUN
brj-24352	189	18	,	,	PUNCT
brj-24352	189	19	”	"	PUNCT
brj-24352	189	20	bioresource	bioresource	ADP
brj-24352	189	21	technology	technology	NOUN
brj-24352	189	22	332	332	NUM
brj-24352	189	23	,	,	PUNCT
brj-24352	189	24	article	article	NOUN
brj-24352	189	25	125042	125042	NUM
brj-24352	189	26	.	.	PUNCT
brj-24352	190	1	doi	doi	NOUN
brj-24352	190	2	:	:	PUNCT
brj-24352	190	3	10.1016	10.1016	NUM
brj-24352	190	4	/	/	SYM
brj-24352	190	5	j.biortech.2021.125042	j.biortech.2021.125042	NOUN
brj-24352	190	6	andlar	andlar	ADJ
brj-24352	190	7	,	,	PUNCT
brj-24352	190	8	m.	m.	NOUN
brj-24352	190	9	,	,	PUNCT
brj-24352	190	10	rezić	rezić	NOUN
brj-24352	190	11	,	,	PUNCT
brj-24352	190	12	t.	t.	PROPN
brj-24352	190	13	,	,	PUNCT
brj-24352	190	14	marđetko	marđetko	PROPN
brj-24352	190	15	,	,	PUNCT
brj-24352	190	16	n.	n.	NOUN
brj-24352	190	17	,	,	PUNCT
brj-24352	190	18	kracher	kracher	PROPN
brj-24352	190	19	,	,	PUNCT
brj-24352	190	20	d.	d.	PROPN
brj-24352	190	21	,	,	PUNCT
brj-24352	190	22	ludwig	ludwig	PROPN
brj-24352	190	23	,	,	PUNCT
brj-24352	190	24	r.	r.	PROPN
brj-24352	190	25	,	,	PUNCT
brj-24352	190	26	and	and	CCONJ
brj-24352	190	27	šantek	šantek	PROPN
brj-24352	190	28	,	,	PUNCT
brj-24352	190	29	b.	b.	PROPN
brj-24352	190	30	(	(	PUNCT
brj-24352	190	31	2018	2018	NUM
brj-24352	190	32	)	)	PUNCT
brj-24352	190	33	.	.	PUNCT
brj-24352	191	1	"	"	PUNCT
brj-24352	191	2	lignocellulose	lignocellulose	VERB
brj-24352	191	3	degradation	degradation	NOUN
brj-24352	191	4	:	:	PUNCT
brj-24352	191	5	an	an	DET
brj-24352	191	6	overview	overview	NOUN
brj-24352	191	7	of	of	ADP
brj-24352	191	8	fungi	fungus	NOUN
brj-24352	191	9	and	and	CCONJ
brj-24352	191	10	fungal	fungal	ADJ
brj-24352	191	11	enzymes	enzyme	NOUN
brj-24352	191	12	involved	involve	VERB
brj-24352	191	13	in	in	ADP
brj-24352	191	14	lignocellulose	lignocellulose	ADJ
brj-24352	191	15	degradation	degradation	NOUN
brj-24352	191	16	,	,	PUNCT
brj-24352	191	17	”	"	PUNCT
brj-24352	191	18	engineering	engineering	NOUN
brj-24352	191	19	in	in	ADP
brj-24352	191	20	life	life	NOUN
brj-24352	191	21	sciences	science	NOUN
brj-24352	191	22	18(11	18(11	NUM
brj-24352	191	23	)	)	PUNCT
brj-24352	191	24	,	,	PUNCT
brj-24352	191	25	768	768	NUM
brj-24352	191	26	-	-	SYM
brj-24352	191	27	778	778	NUM
brj-24352	191	28	.	.	PUNCT
brj-24352	192	1	doi	doi	NOUN
brj-24352	192	2	:	:	PUNCT
brj-24352	192	3	10.1002	10.1002	NUM
brj-24352	192	4	/	/	SYM
brj-24352	192	5	elsc.201800039	elsc.201800039	NOUN
brj-24352	192	6	ansari	ansari	X
brj-24352	192	7	,	,	PUNCT
brj-24352	192	8	s.	s.	PROPN
brj-24352	192	9	a.	a.	PROPN
brj-24352	192	10	,	,	PUNCT
brj-24352	192	11	and	and	CCONJ
brj-24352	192	12	husain	husain	PROPN
brj-24352	192	13	,	,	PUNCT
brj-24352	192	14	q.	q.	PROPN
brj-24352	192	15	(	(	PUNCT
brj-24352	192	16	2012	2012	NUM
brj-24352	192	17	)	)	PUNCT
brj-24352	192	18	.	.	PUNCT
brj-24352	193	1	“	"	PUNCT
brj-24352	193	2	potential	potential	ADJ
brj-24352	193	3	applications	application	NOUN
brj-24352	193	4	of	of	ADP
brj-24352	193	5	enzymes	enzyme	NOUN
brj-24352	193	6	immobilized	immobilize	VERB
brj-24352	193	7	on	on	ADP
brj-24352	193	8	/	/	SYM
brj-24352	193	9	in	in	ADP
brj-24352	193	10	nano	nano	NOUN
brj-24352	193	11	materials	material	NOUN
brj-24352	193	12	:	:	PUNCT
brj-24352	193	13	a	a	DET
brj-24352	193	14	review	review	NOUN
brj-24352	193	15	,	,	PUNCT
brj-24352	193	16	”	"	PUNCT
brj-24352	193	17	biotechnology	biotechnology	NOUN
brj-24352	193	18	advances	advance	VERB
brj-24352	193	19	30(3	30(3	NOUN
brj-24352	193	20	)	)	PUNCT
brj-24352	193	21	,	,	PUNCT
brj-24352	193	22	512	512	NUM
brj-24352	193	23	-	-	SYM
brj-24352	193	24	523	523	NUM
brj-24352	193	25	.	.	PUNCT
brj-24352	194	1	doi	doi	NOUN
brj-24352	194	2	:	:	PUNCT
brj-24352	194	3	10.1016	10.1016	NUM
brj-24352	194	4	/	/	SYM
brj-24352	194	5	j.biotechadv.2011.09.005	j.biotechadv.2011.09.005	PROPN
brj-24352	194	6	auld	auld	PROPN
brj-24352	194	7	,	,	PUNCT
brj-24352	194	8	d.	d.	PROPN
brj-24352	194	9	s.	s.	PROPN
brj-24352	194	10	(	(	PUNCT
brj-24352	194	11	1988	1988	NUM
brj-24352	194	12	)	)	PUNCT
brj-24352	194	13	.	.	PUNCT
brj-24352	195	1	“	"	PUNCT
brj-24352	195	2	use	use	NOUN
brj-24352	195	3	of	of	ADP
brj-24352	195	4	chelating	chelate	VERB
brj-24352	195	5	agents	agent	NOUN
brj-24352	195	6	to	to	PART
brj-24352	195	7	inhibit	inhibit	VERB
brj-24352	195	8	enzymes	enzyme	NOUN
brj-24352	195	9	,	,	PUNCT
brj-24352	195	10	”	"	PUNCT
brj-24352	195	11	in	in	ADP
brj-24352	195	12	:	:	PUNCT
brj-24352	195	13	methods	method	NOUN
brj-24352	195	14	in	in	ADP
brj-24352	195	15	enzymology	enzymology	NOUN
brj-24352	195	16	,	,	PUNCT
brj-24352	195	17	elsevier	elsevier	NOUN
brj-24352	195	18	,	,	PUNCT
brj-24352	195	19	amsterdam	amsterdam	PROPN
brj-24352	195	20	,	,	PUNCT
brj-24352	195	21	pp	pp	ADJ
brj-24352	195	22	.	.	PUNCT
brj-24352	196	1	110	110	NUM
brj-24352	196	2	-	-	SYM
brj-24352	196	3	114	114	NUM
brj-24352	196	4	.	.	PUNCT
brj-24352	197	1	beg	beg	INTJ
brj-24352	197	2	,	,	PUNCT
brj-24352	197	3	q.	q.	PROPN
brj-24352	197	4	,	,	PUNCT
brj-24352	197	5	kapoor	kapoor	PROPN
brj-24352	197	6	,	,	PUNCT
brj-24352	197	7	m.	m.	NOUN
brj-24352	197	8	,	,	PUNCT
brj-24352	197	9	mahajan	mahajan	PROPN
brj-24352	197	10	,	,	PUNCT
brj-24352	197	11	l.	l.	PROPN
brj-24352	197	12	,	,	PUNCT
brj-24352	197	13	and	and	CCONJ
brj-24352	197	14	hoondal	hoondal	ADJ
brj-24352	197	15	,	,	PUNCT
brj-24352	197	16	g.	g.	PROPN
brj-24352	197	17	(	(	PUNCT
brj-24352	197	18	2001	2001	NUM
brj-24352	197	19	)	)	PUNCT
brj-24352	197	20	.	.	PUNCT
brj-24352	198	1	“	"	PUNCT
brj-24352	198	2	microbial	microbial	ADJ
brj-24352	198	3	xylanases	xylanase	NOUN
brj-24352	198	4	and	and	CCONJ
brj-24352	198	5	their	their	PRON
brj-24352	198	6	industrial	industrial	ADJ
brj-24352	198	7	applications	application	NOUN
brj-24352	198	8	:	:	PUNCT
brj-24352	198	9	a	a	DET
brj-24352	198	10	review	review	NOUN
brj-24352	198	11	,	,	PUNCT
brj-24352	198	12	”	"	PUNCT
brj-24352	198	13	applied	apply	VERB
brj-24352	198	14	microbiology	microbiology	NOUN
brj-24352	198	15	and	and	CCONJ
brj-24352	198	16	biotechnology	biotechnology	NOUN
brj-24352	198	17	56	56	NUM
brj-24352	198	18	,	,	PUNCT
brj-24352	198	19	326	326	NUM
brj-24352	198	20	-	-	SYM
brj-24352	198	21	338	338	NUM
brj-24352	198	22	.	.	PUNCT
brj-24352	199	1	doi	doi	NOUN
brj-24352	199	2	:	:	PUNCT
brj-24352	199	3	10.1016	10.1016	NUM
brj-24352	199	4	/	/	SYM
brj-24352	199	5	b978	b978	NUM
brj-24352	199	6	-	-	PUNCT
brj-24352	199	7	0	0	NUM
brj-24352	199	8	-	-	PUNCT
brj-24352	199	9	323	323	NUM
brj-24352	199	10	-	-	PUNCT
brj-24352	199	11	99636	99636	NUM
brj-24352	199	12	-	-	PUNCT
brj-24352	199	13	5.00015	5.00015	NUM
brj-24352	199	14	-	-	PUNCT
brj-24352	199	15	4	4	NUM
brj-24352	199	16	beig	beig	ADJ
brj-24352	199	17	,	,	PUNCT
brj-24352	199	18	b.	b.	PROPN
brj-24352	199	19	,	,	PUNCT
brj-24352	199	20	riaz	riaz	PROPN
brj-24352	199	21	,	,	PUNCT
brj-24352	199	22	m.	m.	NOUN
brj-24352	199	23	,	,	PUNCT
brj-24352	199	24	naqvi	naqvi	NOUN
brj-24352	199	25	,	,	PUNCT
brj-24352	199	26	s.	s.	PROPN
brj-24352	199	27	r.	r.	PROPN
brj-24352	199	28	,	,	PUNCT
brj-24352	199	29	hassan	hassan	PROPN
brj-24352	199	30	,	,	PUNCT
brj-24352	199	31	m.	m.	NOUN
brj-24352	199	32	,	,	PUNCT
brj-24352	199	33	zheng	zheng	PROPN
brj-24352	199	34	,	,	PUNCT
brj-24352	199	35	z.	z.	PROPN
brj-24352	199	36	,	,	PUNCT
brj-24352	199	37	karimi	karimi	PROPN
brj-24352	199	38	,	,	PUNCT
brj-24352	199	39	k.	k.	PROPN
brj-24352	199	40	,	,	PUNCT
brj-24352	199	41	pugazhendhi	pugazhendhi	PROPN
brj-24352	199	42	,	,	PUNCT
brj-24352	199	43	a.	a.	NOUN
brj-24352	199	44	,	,	PUNCT
brj-24352	199	45	atabani	atabani	NOUN
brj-24352	199	46	,	,	PUNCT
brj-24352	199	47	a.	a.	NOUN
brj-24352	199	48	,	,	PUNCT
brj-24352	199	49	and	and	CCONJ
brj-24352	199	50	chi	chi	NOUN
brj-24352	199	51	,	,	PUNCT
brj-24352	199	52	n.	n.	NOUN
brj-24352	199	53	t.	t.	PROPN
brj-24352	199	54	l.	l.	PROPN
brj-24352	199	55	(	(	PUNCT
brj-24352	199	56	2021	2021	NUM
brj-24352	199	57	)	)	PUNCT
brj-24352	199	58	.	.	PUNCT
brj-24352	200	1	“	"	PUNCT
brj-24352	200	2	current	current	ADJ
brj-24352	200	3	challenges	challenge	NOUN
brj-24352	200	4	and	and	CCONJ
brj-24352	200	5	innovative	innovative	ADJ
brj-24352	200	6	developments	development	NOUN
brj-24352	200	7	in	in	ADP
brj-24352	200	8	pretreatment	pretreatment	NOUN
brj-24352	200	9	of	of	ADP
brj-24352	200	10	lignocellulosic	lignocellulosic	ADJ
brj-24352	200	11	residues	residue	NOUN
brj-24352	200	12	for	for	ADP
brj-24352	200	13	biofuel	biofuel	NOUN
brj-24352	200	14	production	production	NOUN
brj-24352	200	15	:	:	PUNCT
brj-24352	200	16	a	a	DET
brj-24352	200	17	review	review	NOUN
brj-24352	200	18	,	,	PUNCT
brj-24352	200	19	”	"	PUNCT
brj-24352	200	20	fuel	fuel	NOUN
brj-24352	200	21	287	287	NUM
brj-24352	200	22	,	,	PUNCT
brj-24352	200	23	article	article	NOUN
brj-24352	200	24	119670	119670	NUM
brj-24352	200	25	.	.	PUNCT
brj-24352	201	1	doi	doi	NOUN
brj-24352	201	2	:	:	PUNCT
brj-24352	201	3	10.1016	10.1016	NUM
brj-24352	201	4	/	/	SYM
brj-24352	201	5	j.fuel.2020.119670	j.fuel.2020.119670	PROPN
brj-24352	201	6	bergan	bergan	NOUN
brj-24352	201	7	,	,	PUNCT
brj-24352	201	8	t.	t.	PROPN
brj-24352	201	9	,	,	PUNCT
brj-24352	201	10	bergan	bergan	NOUN
brj-24352	201	11	,	,	PUNCT
brj-24352	201	12	t.	t.	PROPN
brj-24352	201	13	,	,	PUNCT
brj-24352	201	14	klaveness	klaveness	PROPN
brj-24352	201	15	,	,	PUNCT
brj-24352	201	16	j.	j.	PROPN
brj-24352	201	17	,	,	PUNCT
brj-24352	201	18	klaveness	klaveness	PROPN
brj-24352	201	19	,	,	PUNCT
brj-24352	201	20	j.	j.	PROPN
brj-24352	201	21	,	,	PUNCT
brj-24352	201	22	aasen	aasen	PROPN
brj-24352	201	23	,	,	PUNCT
brj-24352	201	24	a.	a.	PROPN
brj-24352	201	25	j.	j.	PROPN
brj-24352	201	26	,	,	PUNCT
brj-24352	201	27	and	and	CCONJ
brj-24352	201	28	aasen	aasen	PROPN
brj-24352	201	29	,	,	PUNCT
brj-24352	201	30	a.	a.	PROPN
brj-24352	201	31	j.	j.	PROPN
brj-24352	201	32	(	(	PUNCT
brj-24352	201	33	2001	2001	NUM
brj-24352	201	34	)	)	PUNCT
brj-24352	201	35	.	.	PUNCT
brj-24352	202	1	“	"	PUNCT
brj-24352	202	2	chelating	chelate	VERB
brj-24352	202	3	agents	agent	NOUN
brj-24352	202	4	,	,	PUNCT
brj-24352	202	5	”	"	PUNCT
brj-24352	202	6	chemotherapy	chemotherapy	NOUN
brj-24352	202	7	47(1	47(1	NUM
brj-24352	202	8	)	)	PUNCT
brj-24352	202	9	,	,	PUNCT
brj-24352	202	10	10	10	NUM
brj-24352	202	11	-	-	SYM
brj-24352	202	12	14	14	NUM
brj-24352	202	13	.	.	PUNCT
brj-24352	203	1	doi	doi	NOUN
brj-24352	203	2	:	:	PUNCT
brj-24352	203	3	10.1159/000048495	10.1159/000048495	NUM
brj-24352	203	4	chen	chen	PROPN
brj-24352	203	5	,	,	PUNCT
brj-24352	203	6	h.	h.	PROPN
brj-24352	203	7	,	,	PUNCT
brj-24352	203	8	and	and	CCONJ
brj-24352	203	9	chen	chen	PROPN
brj-24352	203	10	,	,	PUNCT
brj-24352	203	11	h.	h.	PROPN
brj-24352	203	12	(	(	PUNCT
brj-24352	203	13	2014	2014	NUM
brj-24352	203	14	)	)	PUNCT
brj-24352	203	15	.	.	PUNCT
brj-24352	204	1	“	"	PUNCT
brj-24352	204	2	chemical	chemical	ADJ
brj-24352	204	3	composition	composition	NOUN
brj-24352	204	4	and	and	CCONJ
brj-24352	204	5	structure	structure	NOUN
brj-24352	204	6	of	of	ADP
brj-24352	204	7	natural	natural	ADJ
brj-24352	204	8	lignocellulose	lignocellulose	NOUN
brj-24352	204	9	,	,	PUNCT
brj-24352	204	10	”	"	PUNCT
brj-24352	204	11	biotechnology	biotechnology	NOUN
brj-24352	204	12	of	of	ADP
brj-24352	204	13	lignocellulose	lignocellulose	NOUN
brj-24352	204	14	:	:	PUNCT
brj-24352	204	15	theory	theory	NOUN
brj-24352	204	16	and	and	CCONJ
brj-24352	204	17	practice	practice	VERB
brj-24352	204	18	25	25	NUM
brj-24352	204	19	-	-	SYM
brj-24352	204	20	71	71	NUM
brj-24352	204	21	.	.	PUNCT
brj-24352	205	1	doi	doi	NOUN
brj-24352	205	2	:	:	PUNCT
brj-24352	205	3	10.1007/978	10.1007/978	NUM
brj-24352	205	4	-	-	SYM
brj-24352	205	5	94	94	NUM
brj-24352	205	6	-	-	PUNCT
brj-24352	205	7	007	007	NUM
brj-24352	205	8	-	-	PUNCT
brj-24352	205	9	6898	6898	NUM
brj-24352	205	10	-	-	SYM
brj-24352	205	11	7_2	7_2	NUM
brj-24352	205	12	cheng	cheng	PROPN
brj-24352	205	13	,	,	PUNCT
brj-24352	205	14	j.	j.	PROPN
brj-24352	205	15	,	,	PUNCT
brj-24352	205	16	huang	huang	PROPN
brj-24352	205	17	,	,	PUNCT
brj-24352	205	18	s.	s.	PROPN
brj-24352	205	19	,	,	PUNCT
brj-24352	205	20	jiang	jiang	PROPN
brj-24352	205	21	,	,	PUNCT
brj-24352	205	22	h.	h.	PROPN
brj-24352	205	23	,	,	PUNCT
brj-24352	205	24	zhang	zhang	PROPN
brj-24352	205	25	,	,	PUNCT
brj-24352	205	26	y.	y.	PROPN
brj-24352	205	27	,	,	PUNCT
brj-24352	205	28	li	li	PROPN
brj-24352	205	29	,	,	PUNCT
brj-24352	205	30	l.	l.	PROPN
brj-24352	205	31	,	,	PUNCT
brj-24352	205	32	wang	wang	PROPN
brj-24352	205	33	,	,	PUNCT
brj-24352	205	34	j.	j.	PROPN
brj-24352	205	35	,	,	PUNCT
brj-24352	205	36	and	and	CCONJ
brj-24352	205	37	fan	fan	PROPN
brj-24352	205	38	,	,	PUNCT
brj-24352	205	39	c.	c.	PROPN
brj-24352	205	40	(	(	PUNCT
brj-24352	205	41	2016	2016	NUM
brj-24352	205	42	)	)	PUNCT
brj-24352	205	43	.	.	PUNCT
brj-24352	206	1	“	"	PUNCT
brj-24352	206	2	isolation	isolation	NOUN
brj-24352	206	3	and	and	CCONJ
brj-24352	206	4	characterization	characterization	NOUN
brj-24352	206	5	of	of	ADP
brj-24352	206	6	a	a	DET
brj-24352	206	7	non	non	ADJ
brj-24352	206	8	-	-	ADJ
brj-24352	206	9	specific	specific	ADJ
brj-24352	206	10	endoglucanase	endoglucanase	NOUN
brj-24352	206	11	from	from	ADP
brj-24352	206	12	a	a	DET
brj-24352	206	13	metagenomic	metagenomic	ADJ
brj-24352	206	14	library	library	NOUN
brj-24352	206	15	of	of	ADP
brj-24352	206	16	goat	goat	PROPN
brj-24352	206	17	rumen	ruman	NOUN
brj-24352	206	18	,	,	PUNCT
brj-24352	206	19	”	"	PUNCT
brj-24352	206	20	world	world	NOUN
brj-24352	206	21	journal	journal	NOUN
brj-24352	206	22	of	of	ADP
brj-24352	206	23	microbiology	microbiology	NOUN
brj-24352	206	24	and	and	CCONJ
brj-24352	206	25	biotechnology	biotechnology	NOUN
brj-24352	206	26	32	32	NUM
brj-24352	206	27	,	,	PUNCT
brj-24352	206	28	1	1	NUM
brj-24352	206	29	-	-	SYM
brj-24352	206	30	8	8	NUM
brj-24352	206	31	.	.	PUNCT
brj-24352	206	32	doi	doi	NOUN
brj-24352	206	33	:	:	PUNCT
brj-24352	206	34	10.1007	10.1007	NUM
brj-24352	206	35	/	/	SYM
brj-24352	206	36	s11274	s11274	ADJ
brj-24352	206	37	-	-	PUNCT
brj-24352	206	38	015	015	NUM
brj-24352	206	39	-	-	PUNCT
brj-24352	206	40	1957	1957	NUM
brj-24352	206	41	-	-	SYM
brj-24352	206	42	4	4	NUM
brj-24352	206	43	dudev	dudev	NOUN
brj-24352	206	44	,	,	PUNCT
brj-24352	206	45	t.	t.	PROPN
brj-24352	206	46	,	,	PUNCT
brj-24352	206	47	and	and	CCONJ
brj-24352	206	48	lim	lim	PROPN
brj-24352	206	49	,	,	PUNCT
brj-24352	206	50	c.	c.	PROPN
brj-24352	206	51	(	(	PUNCT
brj-24352	206	52	2013	2013	NUM
brj-24352	206	53	)	)	PUNCT
brj-24352	206	54	.	.	PUNCT
brj-24352	207	1	“	"	PUNCT
brj-24352	207	2	competition	competition	NOUN
brj-24352	207	3	among	among	ADP
brj-24352	207	4	metal	metal	NOUN
brj-24352	207	5	ions	ion	NOUN
brj-24352	207	6	for	for	ADP
brj-24352	207	7	protein	protein	NOUN
brj-24352	207	8	binding	bind	VERB
brj-24352	207	9	sites	site	NOUN
brj-24352	207	10	:	:	PUNCT
brj-24352	207	11	determinants	determinant	NOUN
brj-24352	207	12	of	of	ADP
brj-24352	207	13	metal	metal	NOUN
brj-24352	207	14	ion	ion	NOUN
brj-24352	207	15	selectivity	selectivity	NOUN
brj-24352	207	16	in	in	ADP
brj-24352	207	17	proteins	protein	NOUN
brj-24352	207	18	,	,	PUNCT
brj-24352	207	19	”	"	PUNCT
brj-24352	207	20	chemical	chemical	NOUN
brj-24352	207	21	reviews	review	NOUN
brj-24352	207	22	114(1	114(1	NUM
brj-24352	207	23	)	)	PUNCT
brj-24352	207	24	,	,	PUNCT
brj-24352	207	25	538556	538556	NUM
brj-24352	207	26	.	.	PUNCT
brj-24352	208	1	doi	doi	NOUN
brj-24352	208	2	:	:	PUNCT
brj-24352	208	3	10.1021	10.1021	NUM
brj-24352	208	4	/	/	SYM
brj-24352	208	5	cr4004665	cr4004665	PROPN
brj-24352	208	6	fan	fan	PROPN
brj-24352	208	7	,	,	PUNCT
brj-24352	208	8	l.	l.	PROPN
brj-24352	208	9	,	,	PUNCT
brj-24352	208	10	gharpuray	gharpuray	PROPN
brj-24352	208	11	,	,	PUNCT
brj-24352	208	12	m.	m.	NOUN
brj-24352	208	13	,	,	PUNCT
brj-24352	208	14	and	and	CCONJ
brj-24352	208	15	lee	lee	PROPN
brj-24352	208	16	,	,	PUNCT
brj-24352	208	17	y.-h	y.-h	PROPN
brj-24352	208	18	.	.	PUNCT
brj-24352	209	1	(	(	PUNCT
brj-24352	209	2	1981	1981	NUM
brj-24352	209	3	)	)	PUNCT
brj-24352	209	4	.	.	PUNCT
brj-24352	210	1	“	"	PUNCT
brj-24352	210	2	evaluation	evaluation	NOUN
brj-24352	210	3	of	of	ADP
brj-24352	210	4	pretreatments	pretreatment	NOUN
brj-24352	210	5	for	for	ADP
brj-24352	210	6	enzymatic	enzymatic	ADJ
brj-24352	210	7	conversion	conversion	NOUN
brj-24352	210	8	of	of	ADP
brj-24352	210	9	agricultural	agricultural	ADJ
brj-24352	210	10	residues	residue	NOUN
brj-24352	210	11	,	,	PUNCT
brj-24352	210	12	”	"	PUNCT
brj-24352	210	13	in	in	ADP
brj-24352	210	14	:	:	PUNCT
brj-24352	210	15	biotechnol	biotechnol	NOUN
brj-24352	210	16	.	.	PUNCT
brj-24352	211	1	bioeng	bioeng	PROPN
brj-24352	211	2	.	.	PUNCT
brj-24352	211	3	symp	symp	PROPN
brj-24352	211	4	,	,	PUNCT
brj-24352	211	5	(	(	PUNCT
brj-24352	211	6	united	united	PROPN
brj-24352	211	7	https://doi.org/10.1186/s13068-020-01853-2	https://doi.org/10.1186/s13068-020-01853-2	PROPN
brj-24352	211	8	https://doi.org/10.1186/s13068-020-01853-2	https://doi.org/10.1186/s13068-020-01853-2	PROPN
brj-24352	212	1	https://doi.org/10.1016/j.biortech.2021.125042	https://doi.org/10.1016/j.biortech.2021.125042	NOUN
brj-24352	212	2	https://doi.org/10.1002/elsc.201800039	https://doi.org/10.1002/elsc.201800039	NOUN
brj-24352	212	3	https://doi.org/10.1016/j.biotechadv.2011.09.005	https://doi.org/10.1016/j.biotechadv.2011.09.005	VERB
brj-24352	212	4	https://doi.org/10.1016/b978-0-323-99636-5.00015-4	https://doi.org/10.1016/b978-0-323-99636-5.00015-4	PROPN
brj-24352	212	5	https://doi.org/10.1016/j.fuel.2020.119670	https://doi.org/10.1016/j.fuel.2020.119670	PROPN
brj-24352	212	6	https://doi.org/10.1007/978-94-007-6898-7_2	https://doi.org/10.1007/978-94-007-6898-7_2	PROPN
brj-24352	212	7	https://doi.org/10.1007/s11274-015-1957-4	https://doi.org/10.1007/s11274-015-1957-4	NUM
brj-24352	212	8	https://doi.org/10.1021/cr4004665	https://doi.org/10.1021/cr4004665	ADJ
brj-24352	212	9	peer	peer	NOUN
brj-24352	212	10	-	-	PUNCT
brj-24352	212	11	reviewed	review	VERB
brj-24352	212	12	article	article	NOUN
brj-24352	212	13	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	212	14	ouyang	ouyang	PROPN
brj-24352	212	15	et	et	PROPN
brj-24352	212	16	al	al	PROPN
brj-24352	212	17	.	.	PROPN
brj-24352	213	1	(	(	PUNCT
brj-24352	213	2	2025	2025	NUM
brj-24352	213	3	)	)	PUNCT
brj-24352	213	4	.	.	PUNCT
brj-24352	214	1	“	"	PUNCT
brj-24352	214	2	rumen	ruman	NOUN
brj-24352	214	3	cellulase	cellulase	NOUN
brj-24352	214	4	&	&	CCONJ
brj-24352	214	5	ag	ag	PROPN
brj-24352	214	6	waste	waste	PROPN
brj-24352	214	7	,	,	PUNCT
brj-24352	214	8	”	"	PUNCT
brj-24352	214	9	bioresources	bioresource	NOUN
brj-24352	214	10	20(3	20(3	NOUN
brj-24352	214	11	)	)	PUNCT
brj-24352	214	12	,	,	PUNCT
brj-24352	214	13	5501	5501	NUM
brj-24352	214	14	-	-	SYM
brj-24352	214	15	5513	5513	NUM
brj-24352	214	16	.	.	PUNCT
brj-24352	215	1	5511	5511	NUM
brj-24352	215	2	states	state	NOUN
brj-24352	215	3	)	)	PUNCT
brj-24352	215	4	.	.	PUNCT
brj-24352	216	1	faryar	faryar	PROPN
brj-24352	216	2	,	,	PUNCT
brj-24352	216	3	r.	r.	PROPN
brj-24352	216	4	,	,	PUNCT
brj-24352	216	5	linares	linare	NOUN
brj-24352	216	6	-	-	PUNCT
brj-24352	216	7	pastén	pastén	NOUN
brj-24352	216	8	,	,	PUNCT
brj-24352	216	9	j.	j.	PROPN
brj-24352	216	10	a.	a.	PROPN
brj-24352	216	11	,	,	PUNCT
brj-24352	216	12	immerzeel	immerzeel	NOUN
brj-24352	216	13	,	,	PUNCT
brj-24352	216	14	p.	p.	NOUN
brj-24352	216	15	,	,	PUNCT
brj-24352	216	16	mamo	mamo	PROPN
brj-24352	216	17	,	,	PUNCT
brj-24352	216	18	g.	g.	PROPN
brj-24352	216	19	,	,	PUNCT
brj-24352	216	20	andersson	andersson	PROPN
brj-24352	216	21	,	,	PUNCT
brj-24352	216	22	m.	m.	NOUN
brj-24352	216	23	,	,	PUNCT
brj-24352	216	24	stålbrand	stålbrand	PROPN
brj-24352	216	25	,	,	PUNCT
brj-24352	216	26	h.	h.	PROPN
brj-24352	216	27	,	,	PUNCT
brj-24352	216	28	mattiasson	mattiasson	PROPN
brj-24352	216	29	,	,	PUNCT
brj-24352	216	30	b.	b.	PROPN
brj-24352	216	31	,	,	PUNCT
brj-24352	216	32	and	and	CCONJ
brj-24352	216	33	karlsson	karlsson	PROPN
brj-24352	216	34	,	,	PUNCT
brj-24352	216	35	e.	e.	PROPN
brj-24352	216	36	n.	n.	PROPN
brj-24352	216	37	(	(	PUNCT
brj-24352	216	38	2015	2015	NUM
brj-24352	216	39	)	)	PUNCT
brj-24352	216	40	.	.	PUNCT
brj-24352	217	1	“	"	PUNCT
brj-24352	217	2	production	production	NOUN
brj-24352	217	3	of	of	ADP
brj-24352	217	4	prebiotic	prebiotic	ADJ
brj-24352	217	5	xylooligosaccharides	xylooligosaccharide	NOUN
brj-24352	217	6	from	from	ADP
brj-24352	217	7	alkaline	alkaline	NOUN
brj-24352	217	8	extracted	extract	VERB
brj-24352	217	9	wheat	wheat	NOUN
brj-24352	217	10	straw	straw	NOUN
brj-24352	217	11	using	use	VERB
brj-24352	217	12	the	the	DET
brj-24352	217	13	k80r	k80r	NOUN
brj-24352	217	14	-	-	NOUN
brj-24352	217	15	variant	variant	NOUN
brj-24352	217	16	of	of	ADP
brj-24352	217	17	a	a	DET
brj-24352	217	18	thermostable	thermostable	ADJ
brj-24352	217	19	alkali	alkali	ADJ
brj-24352	217	20	-	-	ADJ
brj-24352	217	21	tolerant	tolerant	ADJ
brj-24352	217	22	xylanase	xylanase	NOUN
brj-24352	217	23	,	,	PUNCT
brj-24352	217	24	”	"	PUNCT
brj-24352	217	25	food	food	NOUN
brj-24352	217	26	and	and	CCONJ
brj-24352	217	27	bioproducts	bioproduct	VERB
brj-24352	217	28	processing	process	VERB
brj-24352	217	29	93	93	NUM
brj-24352	217	30	,	,	PUNCT
brj-24352	217	31	1	1	NUM
brj-24352	217	32	-	-	SYM
brj-24352	217	33	10	10	NUM
brj-24352	217	34	.	.	PUNCT
brj-24352	218	1	doi	doi	NOUN
brj-24352	218	2	:	:	PUNCT
brj-24352	218	3	10.1016	10.1016	NUM
brj-24352	218	4	/	/	SYM
brj-24352	218	5	j.fbp.2014.11.004	j.fbp.2014.11.004	PROPN
brj-24352	218	6	fatma	fatma	PROPN
brj-24352	218	7	,	,	PUNCT
brj-24352	218	8	s.	s.	PROPN
brj-24352	218	9	,	,	PUNCT
brj-24352	218	10	hameed	hameed	PROPN
brj-24352	218	11	,	,	PUNCT
brj-24352	218	12	a.	a.	PROPN
brj-24352	218	13	,	,	PUNCT
brj-24352	218	14	noman	noman	PROPN
brj-24352	218	15	,	,	PUNCT
brj-24352	218	16	m.	m.	NOUN
brj-24352	218	17	,	,	PUNCT
brj-24352	218	18	ahmed	ahmed	PROPN
brj-24352	218	19	,	,	PUNCT
brj-24352	218	20	t.	t.	PROPN
brj-24352	218	21	,	,	PUNCT
brj-24352	218	22	shahid	shahid	PROPN
brj-24352	218	23	,	,	PUNCT
brj-24352	218	24	m.	m.	NOUN
brj-24352	218	25	,	,	PUNCT
brj-24352	218	26	tariq	tariq	NOUN
brj-24352	218	27	,	,	PUNCT
brj-24352	218	28	m.	m.	NOUN
brj-24352	218	29	,	,	PUNCT
brj-24352	218	30	sohail	sohail	PROPN
brj-24352	218	31	,	,	PUNCT
brj-24352	218	32	i.	i.	PROPN
brj-24352	218	33	,	,	PUNCT
brj-24352	218	34	and	and	CCONJ
brj-24352	218	35	tabassum	tabassum	NOUN
brj-24352	218	36	,	,	PUNCT
brj-24352	218	37	r.	r.	PROPN
brj-24352	218	38	(	(	PUNCT
brj-24352	218	39	2018	2018	NUM
brj-24352	218	40	)	)	PUNCT
brj-24352	218	41	.	.	PUNCT
brj-24352	219	1	“	"	PUNCT
brj-24352	219	2	lignocellulosic	lignocellulosic	ADJ
brj-24352	219	3	biomass	biomass	NOUN
brj-24352	219	4	:	:	PUNCT
brj-24352	219	5	a	a	DET
brj-24352	219	6	sustainable	sustainable	ADJ
brj-24352	219	7	bioenergy	bioenergy	NOUN
brj-24352	219	8	source	source	NOUN
brj-24352	219	9	for	for	ADP
brj-24352	219	10	the	the	DET
brj-24352	219	11	future	future	NOUN
brj-24352	219	12	,	,	PUNCT
brj-24352	219	13	”	"	PUNCT
brj-24352	219	14	protein	protein	NOUN
brj-24352	219	15	and	and	CCONJ
brj-24352	219	16	peptide	peptide	ADJ
brj-24352	219	17	letters	letter	NOUN
brj-24352	219	18	25(2	25(2	NUM
brj-24352	219	19	)	)	PUNCT
brj-24352	219	20	,	,	PUNCT
brj-24352	219	21	148	148	NUM
brj-24352	219	22	-	-	SYM
brj-24352	219	23	163	163	NUM
brj-24352	219	24	.	.	PUNCT
brj-24352	220	1	doi	doi	NOUN
brj-24352	220	2	:	:	PUNCT
brj-24352	220	3	10.2174/0929866525666180122144504	10.2174/0929866525666180122144504	NUM
brj-24352	220	4	gao	gao	PROPN
brj-24352	220	5	,	,	PUNCT
brj-24352	220	6	s.	s.	PROPN
brj-24352	220	7	,	,	PUNCT
brj-24352	220	8	you	you	PRON
brj-24352	220	9	,	,	PUNCT
brj-24352	220	10	c.	c.	PROPN
brj-24352	220	11	,	,	PUNCT
brj-24352	220	12	renneckar	renneckar	PROPN
brj-24352	220	13	,	,	PUNCT
brj-24352	220	14	s.	s.	PROPN
brj-24352	220	15	,	,	PUNCT
brj-24352	220	16	bao	bao	PROPN
brj-24352	220	17	,	,	PUNCT
brj-24352	220	18	j.	j.	PROPN
brj-24352	220	19	,	,	PUNCT
brj-24352	220	20	and	and	CCONJ
brj-24352	220	21	zhang	zhang	PROPN
brj-24352	220	22	,	,	PUNCT
brj-24352	220	23	y.-h	y.-h	PROPN
brj-24352	220	24	.	.	PUNCT
brj-24352	221	1	p.	p.	NOUN
brj-24352	221	2	(	(	PUNCT
brj-24352	221	3	2014	2014	NUM
brj-24352	221	4	)	)	PUNCT
brj-24352	221	5	.	.	PUNCT
brj-24352	222	1	“	"	PUNCT
brj-24352	222	2	new	new	ADJ
brj-24352	222	3	insights	insight	NOUN
brj-24352	222	4	into	into	ADP
brj-24352	222	5	enzymatic	enzymatic	ADJ
brj-24352	222	6	hydrolysis	hydrolysis	NOUN
brj-24352	222	7	of	of	ADP
brj-24352	222	8	heterogeneous	heterogeneous	ADJ
brj-24352	222	9	cellulose	cellulose	NOUN
brj-24352	222	10	by	by	ADP
brj-24352	222	11	using	use	VERB
brj-24352	222	12	carbohydrate	carbohydrate	NOUN
brj-24352	222	13	-	-	PUNCT
brj-24352	222	14	binding	bind	VERB
brj-24352	222	15	module	module	NOUN
brj-24352	222	16	3	3	NUM
brj-24352	222	17	containing	contain	VERB
brj-24352	222	18	gfp	gfp	NOUN
brj-24352	222	19	and	and	CCONJ
brj-24352	222	20	carbohydrate	carbohydrate	NOUN
brj-24352	222	21	-	-	PUNCT
brj-24352	222	22	binding	bind	VERB
brj-24352	222	23	module	module	NOUN
brj-24352	222	24	17	17	NUM
brj-24352	222	25	containing	contain	VERB
brj-24352	222	26	cfp	cfp	NOUN
brj-24352	222	27	,	,	PUNCT
brj-24352	222	28	”	"	PUNCT
brj-24352	222	29	biotechnology	biotechnology	NOUN
brj-24352	222	30	for	for	ADP
brj-24352	222	31	biofuels	biofuel	NOUN
brj-24352	222	32	7	7	NUM
brj-24352	222	33	,	,	PUNCT
brj-24352	222	34	1	1	NUM
brj-24352	222	35	-	-	SYM
brj-24352	222	36	11	11	NUM
brj-24352	222	37	.	.	PUNCT
brj-24352	223	1	doi	doi	NOUN
brj-24352	223	2	:	:	PUNCT
brj-24352	223	3	10.1186/1754	10.1186/1754	NUM
brj-24352	223	4	-	-	PUNCT
brj-24352	223	5	6834	6834	NUM
brj-24352	223	6	-	-	PUNCT
brj-24352	223	7	7	7	NUM
brj-24352	223	8	-	-	SYM
brj-24352	223	9	24	24	NUM
brj-24352	223	10	gharechahi	gharechahi	NOUN
brj-24352	223	11	,	,	PUNCT
brj-24352	223	12	j.	j.	PROPN
brj-24352	223	13	,	,	PUNCT
brj-24352	223	14	vahidi	vahidi	PROPN
brj-24352	223	15	,	,	PUNCT
brj-24352	223	16	m.	m.	PROPN
brj-24352	223	17	f.	f.	PROPN
brj-24352	223	18	,	,	PUNCT
brj-24352	223	19	sharifi	sharifi	PROPN
brj-24352	223	20	,	,	PUNCT
brj-24352	223	21	g.	g.	PROPN
brj-24352	223	22	,	,	PUNCT
brj-24352	223	23	ariaeenejad	ariaeenejad	PROPN
brj-24352	223	24	,	,	PUNCT
brj-24352	223	25	s.	s.	PROPN
brj-24352	223	26	,	,	PUNCT
brj-24352	223	27	ding	ding	NOUN
brj-24352	223	28	,	,	PUNCT
brj-24352	223	29	x.-z	x.-z	PROPN
brj-24352	223	30	.	.	PUNCT
brj-24352	223	31	,	,	PUNCT
brj-24352	223	32	han	han	PROPN
brj-24352	223	33	,	,	PUNCT
brj-24352	223	34	j.-l	j.-l	PROPN
brj-24352	223	35	.	.	PUNCT
brj-24352	223	36	,	,	PUNCT
brj-24352	223	37	and	and	CCONJ
brj-24352	223	38	salekdeh	salekdeh	PROPN
brj-24352	223	39	,	,	PUNCT
brj-24352	223	40	g.	g.	PROPN
brj-24352	223	41	h.	h.	PROPN
brj-24352	223	42	(	(	PUNCT
brj-24352	223	43	2023	2023	NUM
brj-24352	223	44	)	)	PUNCT
brj-24352	223	45	.	.	PUNCT
brj-24352	224	1	“	"	PUNCT
brj-24352	224	2	lignocellulose	lignocellulose	VERB
brj-24352	224	3	degradation	degradation	NOUN
brj-24352	224	4	by	by	ADP
brj-24352	224	5	rumen	ruman	NOUN
brj-24352	224	6	bacterial	bacterial	ADJ
brj-24352	224	7	communities	community	NOUN
brj-24352	224	8	:	:	PUNCT
brj-24352	224	9	new	new	ADJ
brj-24352	224	10	insights	insight	NOUN
brj-24352	224	11	from	from	ADP
brj-24352	224	12	metagenome	metagenome	ADJ
brj-24352	224	13	analyses	analysis	NOUN
brj-24352	224	14	,	,	PUNCT
brj-24352	224	15	”	"	PUNCT
brj-24352	224	16	environmental	environmental	ADJ
brj-24352	224	17	research	research	NOUN
brj-24352	224	18	229	229	NUM
brj-24352	224	19	,	,	PUNCT
brj-24352	224	20	article	article	NOUN
brj-24352	224	21	115925	115925	NUM
brj-24352	224	22	.	.	PUNCT
brj-24352	225	1	doi	doi	NOUN
brj-24352	225	2	:	:	PUNCT
brj-24352	225	3	10.1016	10.1016	NUM
brj-24352	225	4	/	/	SYM
brj-24352	225	5	j.envres.2023.115925	j.envres.2023.115925	PROPN
brj-24352	225	6	ghose	ghose	PROPN
brj-24352	225	7	,	,	PUNCT
brj-24352	225	8	t.	t.	PROPN
brj-24352	225	9	(	(	PUNCT
brj-24352	225	10	1987	1987	NUM
brj-24352	225	11	)	)	PUNCT
brj-24352	225	12	.	.	PUNCT
brj-24352	226	1	“	"	PUNCT
brj-24352	226	2	measurement	measurement	NOUN
brj-24352	226	3	of	of	ADP
brj-24352	226	4	cellulase	cellulase	NOUN
brj-24352	226	5	activities	activity	NOUN
brj-24352	226	6	,	,	PUNCT
brj-24352	226	7	”	"	PUNCT
brj-24352	226	8	pure	pure	ADJ
brj-24352	226	9	and	and	CCONJ
brj-24352	226	10	applied	apply	VERB
brj-24352	226	11	chemistry	chemistry	NOUN
brj-24352	226	12	59(2	59(2	NOUN
brj-24352	226	13	)	)	PUNCT
brj-24352	226	14	,	,	PUNCT
brj-24352	226	15	257	257	NUM
brj-24352	226	16	-	-	SYM
brj-24352	226	17	268	268	NUM
brj-24352	226	18	.	.	PUNCT
brj-24352	227	1	doi	doi	NOUN
brj-24352	227	2	:	:	PUNCT
brj-24352	227	3	10.1515	10.1515	NUM
brj-24352	227	4	/	/	SYM
brj-24352	227	5	iupac.59.0006	iupac.59.0006	ADJ
brj-24352	227	6	gupta	gupta	PROPN
brj-24352	227	7	,	,	PUNCT
brj-24352	227	8	r.	r.	PROPN
brj-24352	227	9	,	,	PUNCT
brj-24352	227	10	and	and	CCONJ
brj-24352	227	11	lee	lee	PROPN
brj-24352	227	12	,	,	PUNCT
brj-24352	227	13	y.	y.	PROPN
brj-24352	227	14	(	(	PUNCT
brj-24352	227	15	2009	2009	NUM
brj-24352	227	16	)	)	PUNCT
brj-24352	227	17	.	.	PUNCT
brj-24352	228	1	“	"	PUNCT
brj-24352	228	2	mechanism	mechanism	NOUN
brj-24352	228	3	of	of	ADP
brj-24352	228	4	cellulase	cellulase	NOUN
brj-24352	228	5	reaction	reaction	NOUN
brj-24352	228	6	on	on	ADP
brj-24352	228	7	pure	pure	ADJ
brj-24352	228	8	cellulosic	cellulosic	NOUN
brj-24352	228	9	substrates	substrate	NOUN
brj-24352	228	10	,	,	PUNCT
brj-24352	228	11	”	"	PUNCT
brj-24352	228	12	biotechnology	biotechnology	NOUN
brj-24352	228	13	and	and	CCONJ
brj-24352	228	14	bioengineering	bioengineering	NOUN
brj-24352	228	15	102(6	102(6	NUM
brj-24352	228	16	)	)	PUNCT
brj-24352	228	17	,	,	PUNCT
brj-24352	228	18	1570	1570	NUM
brj-24352	228	19	-	-	SYM
brj-24352	228	20	1581	1581	NUM
brj-24352	228	21	.	.	PUNCT
brj-24352	229	1	doi	doi	NOUN
brj-24352	229	2	:	:	PUNCT
brj-24352	229	3	10.1002	10.1002	NUM
brj-24352	229	4	/	/	SYM
brj-24352	229	5	bit.22195	bit.22195	X
brj-24352	229	6	hendriks	hendriks	PROPN
brj-24352	229	7	,	,	PUNCT
brj-24352	229	8	a.	a.	PROPN
brj-24352	229	9	,	,	PUNCT
brj-24352	229	10	and	and	CCONJ
brj-24352	229	11	zeeman	zeeman	PROPN
brj-24352	229	12	,	,	PUNCT
brj-24352	229	13	g.	g.	PROPN
brj-24352	229	14	(	(	PUNCT
brj-24352	229	15	2009	2009	NUM
brj-24352	229	16	)	)	PUNCT
brj-24352	229	17	.	.	PUNCT
brj-24352	230	1	“	"	PUNCT
brj-24352	230	2	pretreatments	pretreatment	NOUN
brj-24352	230	3	to	to	PART
brj-24352	230	4	enhance	enhance	VERB
brj-24352	230	5	the	the	DET
brj-24352	230	6	digestibility	digestibility	NOUN
brj-24352	230	7	of	of	ADP
brj-24352	230	8	lignocellulosic	lignocellulosic	ADJ
brj-24352	230	9	biomass	biomass	NOUN
brj-24352	230	10	,	,	PUNCT
brj-24352	230	11	”	"	PUNCT
brj-24352	230	12	bioresource	bioresource	ADP
brj-24352	230	13	technology	technology	NOUN
brj-24352	230	14	100(1	100(1	NUM
brj-24352	230	15	)	)	PUNCT
brj-24352	230	16	,	,	PUNCT
brj-24352	230	17	10	10	NUM
brj-24352	230	18	-	-	SYM
brj-24352	230	19	18	18	NUM
brj-24352	230	20	.	.	PUNCT
brj-24352	231	1	doi	doi	NOUN
brj-24352	231	2	:	:	PUNCT
brj-24352	231	3	10.1016	10.1016	NUM
brj-24352	231	4	/	/	SYM
brj-24352	231	5	j.biortech.2008.05.027	j.biortech.2008.05.027	ADV
brj-24352	231	6	hu	hu	PROPN
brj-24352	231	7	,	,	PUNCT
brj-24352	231	8	d.	d.	PROPN
brj-24352	231	9	,	,	PUNCT
brj-24352	231	10	and	and	CCONJ
brj-24352	231	11	zhao	zhao	NOUN
brj-24352	231	12	,	,	PUNCT
brj-24352	231	13	x.	x.	NOUN
brj-24352	231	14	(	(	PUNCT
brj-24352	231	15	2022	2022	NUM
brj-24352	231	16	)	)	PUNCT
brj-24352	231	17	.	.	PUNCT
brj-24352	232	1	“	"	PUNCT
brj-24352	232	2	characterization	characterization	NOUN
brj-24352	232	3	of	of	ADP
brj-24352	232	4	a	a	DET
brj-24352	232	5	new	new	ADJ
brj-24352	232	6	xylanase	xylanase	NOUN
brj-24352	232	7	found	find	VERB
brj-24352	232	8	in	in	ADP
brj-24352	232	9	the	the	DET
brj-24352	232	10	rumen	ruman	NOUN
brj-24352	232	11	metagenome	metagenome	ADJ
brj-24352	232	12	and	and	CCONJ
brj-24352	232	13	its	its	PRON
brj-24352	232	14	effects	effect	NOUN
brj-24352	232	15	on	on	ADP
brj-24352	232	16	the	the	DET
brj-24352	232	17	hydrolysis	hydrolysis	NOUN
brj-24352	232	18	of	of	ADP
brj-24352	232	19	wheat	wheat	NOUN
brj-24352	232	20	,	,	PUNCT
brj-24352	232	21	”	"	PUNCT
brj-24352	232	22	journal	journal	NOUN
brj-24352	232	23	of	of	ADP
brj-24352	232	24	agricultural	agricultural	ADJ
brj-24352	232	25	and	and	CCONJ
brj-24352	232	26	food	food	NOUN
brj-24352	232	27	chemistry	chemistry	NOUN
brj-24352	232	28	70(21	70(21	NOUN
brj-24352	232	29	)	)	PUNCT
brj-24352	232	30	,	,	PUNCT
brj-24352	232	31	6493	6493	NUM
brj-24352	232	32	-	-	SYM
brj-24352	232	33	6502	6502	NUM
brj-24352	232	34	.	.	PUNCT
brj-24352	233	1	doi	doi	NOUN
brj-24352	233	2	:	:	PUNCT
brj-24352	233	3	10.1021	10.1021	NUM
brj-24352	233	4	/	/	SYM
brj-24352	233	5	acs.jafc.2c00827	acs.jafc.2c00827	PROPN
brj-24352	233	6	huy	huy	PROPN
brj-24352	233	7	,	,	PUNCT
brj-24352	233	8	n.	n.	PROPN
brj-24352	233	9	d.	d.	PROPN
brj-24352	233	10	,	,	PUNCT
brj-24352	233	11	le	le	PROPN
brj-24352	233	12	nguyen	nguyen	PROPN
brj-24352	233	13	,	,	PUNCT
brj-24352	233	14	c.	c.	PROPN
brj-24352	233	15	,	,	PUNCT
brj-24352	233	16	park	park	NOUN
brj-24352	233	17	,	,	PUNCT
brj-24352	233	18	h.-s	h.-s	PROPN
brj-24352	233	19	.	.	PROPN
brj-24352	233	20	,	,	PUNCT
brj-24352	233	21	loc	loc	PROPN
brj-24352	233	22	,	,	PUNCT
brj-24352	233	23	n.	n.	PROPN
brj-24352	233	24	h.	h.	PROPN
brj-24352	233	25	,	,	PUNCT
brj-24352	233	26	choi	choi	NOUN
brj-24352	233	27	,	,	PUNCT
brj-24352	233	28	m.-s	m.-s	PROPN
brj-24352	233	29	.	.	PROPN
brj-24352	233	30	,	,	PUNCT
brj-24352	233	31	kim	kim	PROPN
brj-24352	233	32	,	,	PUNCT
brj-24352	233	33	d.-h	d.-h	PROPN
brj-24352	233	34	.	.	PUNCT
brj-24352	233	35	,	,	PUNCT
brj-24352	233	36	seo	seo	PROPN
brj-24352	233	37	,	,	PUNCT
brj-24352	233	38	j.-w	j.-w	PROPN
brj-24352	233	39	.	.	PROPN
brj-24352	233	40	,	,	PUNCT
brj-24352	233	41	and	and	CCONJ
brj-24352	233	42	park	park	NOUN
brj-24352	233	43	,	,	PUNCT
brj-24352	233	44	s.-m	s.-m	PROPN
brj-24352	233	45	.	.	PUNCT
brj-24352	234	1	(	(	PUNCT
brj-24352	234	2	2016	2016	NUM
brj-24352	234	3	)	)	PUNCT
brj-24352	234	4	.	.	PUNCT
brj-24352	235	1	“	"	PUNCT
brj-24352	235	2	characterization	characterization	NOUN
brj-24352	235	3	of	of	ADP
brj-24352	235	4	a	a	DET
brj-24352	235	5	novel	novel	ADJ
brj-24352	235	6	manganese	manganese	NOUN
brj-24352	235	7	dependent	dependent	ADJ
brj-24352	235	8	endoglucanase	endoglucanase	NOUN
brj-24352	235	9	belongs	belong	VERB
brj-24352	235	10	in	in	ADP
brj-24352	235	11	gh	gh	PROPN
brj-24352	235	12	family	family	NOUN
brj-24352	235	13	5	5	NUM
brj-24352	235	14	from	from	ADP
brj-24352	235	15	phanerochaete	phanerochaete	ADJ
brj-24352	235	16	chrysosporium	chrysosporium	NOUN
brj-24352	235	17	,	,	PUNCT
brj-24352	235	18	”	"	PUNCT
brj-24352	235	19	journal	journal	NOUN
brj-24352	235	20	of	of	ADP
brj-24352	235	21	bioscience	bioscience	NOUN
brj-24352	235	22	and	and	CCONJ
brj-24352	235	23	bioengineering	bioengineere	VERB
brj-24352	235	24	121(2	121(2	NUM
brj-24352	235	25	)	)	PUNCT
brj-24352	235	26	,	,	PUNCT
brj-24352	235	27	154	154	NUM
brj-24352	235	28	-	-	SYM
brj-24352	235	29	159	159	NUM
brj-24352	235	30	.	.	PUNCT
brj-24352	236	1	doi	doi	NOUN
brj-24352	236	2	:	:	PUNCT
brj-24352	236	3	10.1016	10.1016	NUM
brj-24352	236	4	/	/	SYM
brj-24352	236	5	j.jbiosc.2015.06.009	j.jbiosc.2015.06.009	PROPN
brj-24352	236	6	isikgor	isikgor	PROPN
brj-24352	236	7	,	,	PUNCT
brj-24352	236	8	f.	f.	PROPN
brj-24352	236	9	h.	h.	PROPN
brj-24352	236	10	,	,	PUNCT
brj-24352	236	11	and	and	CCONJ
brj-24352	236	12	becer	becer	NOUN
brj-24352	236	13	,	,	PUNCT
brj-24352	236	14	c.	c.	PROPN
brj-24352	236	15	r.	r.	PROPN
brj-24352	236	16	(	(	PUNCT
brj-24352	236	17	2015	2015	NUM
brj-24352	236	18	)	)	PUNCT
brj-24352	236	19	.	.	PUNCT
brj-24352	237	1	“	"	PUNCT
brj-24352	237	2	lignocellulosic	lignocellulosic	ADJ
brj-24352	237	3	biomass	biomass	NOUN
brj-24352	237	4	:	:	PUNCT
brj-24352	237	5	a	a	DET
brj-24352	237	6	sustainable	sustainable	ADJ
brj-24352	237	7	platform	platform	NOUN
brj-24352	237	8	for	for	ADP
brj-24352	237	9	the	the	DET
brj-24352	237	10	production	production	NOUN
brj-24352	237	11	of	of	ADP
brj-24352	237	12	bio	bio	NOUN
brj-24352	237	13	-	-	PUNCT
brj-24352	237	14	based	base	VERB
brj-24352	237	15	chemicals	chemical	NOUN
brj-24352	237	16	and	and	CCONJ
brj-24352	237	17	polymers	polymer	NOUN
brj-24352	237	18	,	,	PUNCT
brj-24352	237	19	”	"	PUNCT
brj-24352	237	20	polymer	polymer	NOUN
brj-24352	237	21	chemistry	chemistry	NOUN
brj-24352	237	22	6(25	6(25	NOUN
brj-24352	237	23	)	)	PUNCT
brj-24352	237	24	,	,	PUNCT
brj-24352	237	25	4497	4497	NUM
brj-24352	237	26	-	-	SYM
brj-24352	237	27	4559	4559	NUM
brj-24352	237	28	.	.	PUNCT
brj-24352	238	1	doi	doi	NOUN
brj-24352	238	2	:	:	PUNCT
brj-24352	238	3	10.1039	10.1039	NUM
brj-24352	238	4	/	/	SYM
brj-24352	238	5	c5py00263j	c5py00263j	PROPN
brj-24352	238	6	jayasekara	jayasekara	PROPN
brj-24352	238	7	,	,	PUNCT
brj-24352	238	8	s.	s.	PROPN
brj-24352	238	9	,	,	PUNCT
brj-24352	238	10	and	and	CCONJ
brj-24352	238	11	ratnayake	ratnayake	NOUN
brj-24352	238	12	,	,	PUNCT
brj-24352	238	13	r.	r.	PROPN
brj-24352	238	14	(	(	PUNCT
brj-24352	238	15	2019	2019	NUM
brj-24352	238	16	)	)	PUNCT
brj-24352	238	17	.	.	PUNCT
brj-24352	239	1	“	"	PUNCT
brj-24352	239	2	microbial	microbial	ADJ
brj-24352	239	3	cellulases	cellulase	NOUN
brj-24352	239	4	:	:	PUNCT
brj-24352	239	5	an	an	DET
brj-24352	239	6	overview	overview	NOUN
brj-24352	239	7	and	and	CCONJ
brj-24352	239	8	applications	application	NOUN
brj-24352	239	9	,	,	PUNCT
brj-24352	239	10	”	"	PUNCT
brj-24352	239	11	cellulose	cellulose	NOUN
brj-24352	239	12	22(92	22(92	NUM
brj-24352	239	13	)	)	PUNCT
brj-24352	239	14	,	,	PUNCT
brj-24352	239	15	10	10	NUM
brj-24352	239	16	-	-	SYM
brj-24352	239	17	5772	5772	NUM
brj-24352	239	18	.	.	PUNCT
brj-24352	240	1	doi	doi	NOUN
brj-24352	240	2	:	:	PUNCT
brj-24352	240	3	10.5772	10.5772	NUM
brj-24352	240	4	/	/	SYM
brj-24352	240	5	intechopen.84531	intechopen.84531	PROPN
brj-24352	240	6	lee	lee	PROPN
brj-24352	240	7	,	,	PUNCT
brj-24352	240	8	k.-t	k.-t	PROPN
brj-24352	240	9	.	.	PUNCT
brj-24352	240	10	,	,	PUNCT
brj-24352	240	11	toushik	toushik	PROPN
brj-24352	240	12	,	,	PUNCT
brj-24352	240	13	s.	s.	PROPN
brj-24352	240	14	h.	h.	PROPN
brj-24352	240	15	,	,	PUNCT
brj-24352	240	16	baek	baek	PROPN
brj-24352	240	17	,	,	PUNCT
brj-24352	240	18	j.-y	j.-y	PROPN
brj-24352	240	19	.	.	PUNCT
brj-24352	240	20	,	,	PUNCT
brj-24352	240	21	kim	kim	PROPN
brj-24352	240	22	,	,	PUNCT
brj-24352	240	23	j.-e	j.-e	PROPN
brj-24352	240	24	.	.	PROPN
brj-24352	240	25	,	,	PUNCT
brj-24352	240	26	lee	lee	PROPN
brj-24352	240	27	,	,	PUNCT
brj-24352	240	28	j.-s	j.-s	PROPN
brj-24352	240	29	.	.	PUNCT
brj-24352	240	30	,	,	PUNCT
brj-24352	240	31	and	and	CCONJ
brj-24352	240	32	kim	kim	PROPN
brj-24352	240	33	,	,	PUNCT
brj-24352	240	34	k.-s	k.-s	PROPN
brj-24352	240	35	.	.	PUNCT
brj-24352	241	1	(	(	PUNCT
brj-24352	241	2	2018	2018	NUM
brj-24352	241	3	)	)	PUNCT
brj-24352	241	4	.	.	PUNCT
brj-24352	242	1	“	"	PUNCT
brj-24352	242	2	metagenomic	metagenomic	ADJ
brj-24352	242	3	mining	mining	NOUN
brj-24352	242	4	and	and	CCONJ
brj-24352	242	5	functional	functional	ADJ
brj-24352	242	6	characterization	characterization	NOUN
brj-24352	242	7	of	of	ADP
brj-24352	242	8	a	a	DET
brj-24352	242	9	novel	novel	ADJ
brj-24352	242	10	kg51	kg51	PROPN
brj-24352	242	11	bifunctional	bifunctional	ADJ
brj-24352	242	12	cellulase	cellulase	NOUN
brj-24352	242	13	/	/	SYM
brj-24352	242	14	hemicellulase	hemicellulase	NOUN
brj-24352	242	15	from	from	ADP
brj-24352	242	16	black	black	ADJ
brj-24352	242	17	goat	goat	PROPN
brj-24352	242	18	rumen	ruman	NOUN
brj-24352	242	19	,	,	PUNCT
brj-24352	242	20	”	"	PUNCT
brj-24352	242	21	journal	journal	NOUN
brj-24352	242	22	of	of	ADP
brj-24352	242	23	agricultural	agricultural	ADJ
brj-24352	242	24	and	and	CCONJ
brj-24352	242	25	food	food	NOUN
brj-24352	242	26	chemistry	chemistry	NOUN
brj-24352	242	27	66(34	66(34	NOUN
brj-24352	242	28	)	)	PUNCT
brj-24352	242	29	,	,	PUNCT
brj-24352	242	30	9034	9034	NUM
brj-24352	242	31	-	-	SYM
brj-24352	242	32	9041	9041	NUM
brj-24352	242	33	.	.	PUNCT
brj-24352	243	1	doi	doi	NOUN
brj-24352	243	2	:	:	PUNCT
brj-24352	243	3	10.1021	10.1021	NUM
brj-24352	243	4	/	/	SYM
brj-24352	243	5	acs.jafc.8b01449	acs.jafc.8b01449	NOUN
brj-24352	243	6	loaces	loace	NOUN
brj-24352	243	7	,	,	PUNCT
brj-24352	243	8	i.	i.	NOUN
brj-24352	243	9	,	,	PUNCT
brj-24352	243	10	bottini	bottini	PROPN
brj-24352	243	11	,	,	PUNCT
brj-24352	243	12	g.	g.	PROPN
brj-24352	243	13	,	,	PUNCT
brj-24352	243	14	moyna	moyna	NOUN
brj-24352	243	15	,	,	PUNCT
brj-24352	243	16	g.	g.	PROPN
brj-24352	243	17	,	,	PUNCT
brj-24352	243	18	fabiano	fabiano	PROPN
brj-24352	243	19	,	,	PUNCT
brj-24352	243	20	e.	e.	PROPN
brj-24352	243	21	,	,	PUNCT
brj-24352	243	22	martínez	martínez	PROPN
brj-24352	243	23	,	,	PUNCT
brj-24352	243	24	a.	a.	NOUN
brj-24352	243	25	,	,	PUNCT
brj-24352	243	26	and	and	CCONJ
brj-24352	243	27	noya	noya	NOUN
brj-24352	243	28	,	,	PUNCT
brj-24352	243	29	f.	f.	PROPN
brj-24352	243	30	(	(	PUNCT
brj-24352	243	31	2016	2016	NUM
brj-24352	243	32	)	)	PUNCT
brj-24352	243	33	.	.	PUNCT
brj-24352	244	1	"	"	PUNCT
brj-24352	244	2	endog	endog	NOUN
brj-24352	244	3	:	:	PUNCT
brj-24352	244	4	a	a	DET
brj-24352	244	5	novel	novel	ADJ
brj-24352	244	6	multifunctional	multifunctional	ADJ
brj-24352	244	7	halotolerant	halotolerant	NOUN
brj-24352	244	8	glucanase	glucanase	PROPN
brj-24352	244	9	and	and	CCONJ
brj-24352	244	10	xylanase	xylanase	NOUN
brj-24352	244	11	isolated	isolate	VERB
brj-24352	244	12	from	from	ADP
brj-24352	244	13	cow	cow	NOUN
brj-24352	244	14	rumen	ruman	NOUN
brj-24352	244	15	,	,	PUNCT
brj-24352	244	16	”	"	PUNCT
brj-24352	244	17	journal	journal	NOUN
brj-24352	244	18	of	of	ADP
brj-24352	244	19	molecular	molecular	ADJ
brj-24352	244	20	catalysis	catalysis	NOUN
brj-24352	244	21	b	b	NOUN
brj-24352	244	22	:	:	PUNCT
brj-24352	244	23	enzymatic	enzymatic	ADJ
brj-24352	244	24	126	126	NUM
brj-24352	244	25	,	,	PUNCT
brj-24352	244	26	1	1	NUM
brj-24352	244	27	-	-	SYM
brj-24352	244	28	9	9	NUM
brj-24352	244	29	.	.	PUNCT
brj-24352	244	30	doi	doi	NOUN
brj-24352	244	31	:	:	PUNCT
brj-24352	244	32	10.1016	10.1016	NUM
brj-24352	244	33	/	/	SYM
brj-24352	244	34	j.molcatb.2016.01.004	j.molcatb.2016.01.004	PROPN
brj-24352	244	35	lópez	lópez	NOUN
brj-24352	244	36	-	-	PUNCT
brj-24352	244	37	lópez	lópez	PROPN
brj-24352	244	38	,	,	PUNCT
brj-24352	244	39	a.	a.	NOUN
brj-24352	244	40	,	,	PUNCT
brj-24352	244	41	santiago	santiago	PROPN
brj-24352	244	42	-	-	PUNCT
brj-24352	244	43	hernández	hernández	PROPN
brj-24352	244	44	,	,	PUNCT
brj-24352	244	45	a.	a.	NOUN
brj-24352	244	46	,	,	PUNCT
brj-24352	244	47	cayetano	cayetano	NOUN
brj-24352	244	48	-	-	PUNCT
brj-24352	244	49	cruz	cruz	NOUN
brj-24352	244	50	,	,	PUNCT
brj-24352	244	51	m.	m.	NOUN
brj-24352	244	52	,	,	PUNCT
brj-24352	244	53	garcía	garcía	NOUN
brj-24352	244	54	-	-	PUNCT
brj-24352	244	55	huante	huante	NOUN
brj-24352	244	56	,	,	PUNCT
brj-24352	244	57	y.	y.	PROPN
brj-24352	244	58	,	,	PUNCT
brj-24352	244	59	https://doi.org/10.1016/j.fbp.2014.11.004	https://doi.org/10.1016/j.fbp.2014.11.004	PROPN
brj-24352	244	60	https://doi.org/10.2174/0929866525666180122144504	https://doi.org/10.2174/0929866525666180122144504	VERB
brj-24352	244	61	https://doi.org/10.1186/1754-6834-7-24	https://doi.org/10.1186/1754-6834-7-24	VERB
brj-24352	244	62	https://doi.org/10.1016/j.envres.2023.115925	https://doi.org/10.1016/j.envres.2023.115925	PROPN
brj-24352	244	63	https://doi.org/10.1515/iupac.59.0006	https://doi.org/10.1515/iupac.59.0006	NOUN
brj-24352	244	64	https://doi.org/10.1002/bit.22195	https://doi.org/10.1002/bit.22195	PROPN
brj-24352	244	65	https://doi.org/10.1016/j.biortech.2008.05.027	https://doi.org/10.1016/j.biortech.2008.05.027	PROPN
brj-24352	244	66	https://doi.org/10.1021/acs.jafc.2c00827	https://doi.org/10.1021/acs.jafc.2c00827	NOUN
brj-24352	244	67	https://doi.org/10.1016/j.jbiosc.2015.06.009	https://doi.org/10.1016/j.jbiosc.2015.06.009	VERB
brj-24352	244	68	https://doi.org/10.1039/c5py00263j	https://doi.org/10.1039/c5py00263j	PUNCT
brj-24352	244	69	https://doi.org/10.5772/intechopen.84531	https://doi.org/10.5772/intechopen.84531	ADJ
brj-24352	244	70	https://doi.org/10.1021/acs.jafc.8b01449	https://doi.org/10.1021/acs.jafc.8b01449	PROPN
brj-24352	244	71	https://doi.org/10.1016/j.molcatb.2016.01.004	https://doi.org/10.1016/j.molcatb.2016.01.004	PROPN
brj-24352	244	72	peer	peer	NOUN
brj-24352	244	73	-	-	PUNCT
brj-24352	244	74	reviewed	review	VERB
brj-24352	244	75	article	article	NOUN
brj-24352	244	76	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	244	77	ouyang	ouyang	PROPN
brj-24352	244	78	et	et	PROPN
brj-24352	244	79	al	al	PROPN
brj-24352	244	80	.	.	PROPN
brj-24352	245	1	(	(	PUNCT
brj-24352	245	2	2025	2025	NUM
brj-24352	245	3	)	)	PUNCT
brj-24352	245	4	.	.	PUNCT
brj-24352	246	1	“	"	PUNCT
brj-24352	246	2	rumen	ruman	NOUN
brj-24352	246	3	cellulase	cellulase	NOUN
brj-24352	246	4	&	&	CCONJ
brj-24352	246	5	ag	ag	PROPN
brj-24352	246	6	waste	waste	PROPN
brj-24352	246	7	,	,	PUNCT
brj-24352	246	8	”	"	PUNCT
brj-24352	246	9	bioresources	bioresource	NOUN
brj-24352	246	10	20(3	20(3	NOUN
brj-24352	246	11	)	)	PUNCT
brj-24352	246	12	,	,	PUNCT
brj-24352	246	13	5501	5501	NUM
brj-24352	246	14	-	-	SYM
brj-24352	246	15	5513	5513	NUM
brj-24352	246	16	.	.	PUNCT
brj-24352	247	1	5512	5512	NUM
brj-24352	247	2	campos	campos	PROPN
brj-24352	247	3	,	,	PUNCT
brj-24352	247	4	j.	j.	PROPN
brj-24352	247	5	e.	e.	PROPN
brj-24352	247	6	,	,	PUNCT
brj-24352	247	7	bustos	bustos	PROPN
brj-24352	247	8	-	-	PUNCT
brj-24352	247	9	jaimes	jaime	NOUN
brj-24352	247	10	,	,	PUNCT
brj-24352	247	11	i.	i.	PROPN
brj-24352	247	12	,	,	PUNCT
brj-24352	247	13	marsch	marsch	PROPN
brj-24352	247	14	-	-	PUNCT
brj-24352	247	15	moreno	moreno	PROPN
brj-24352	247	16	,	,	PUNCT
brj-24352	247	17	r.	r.	PROPN
brj-24352	247	18	,	,	PUNCT
brj-24352	247	19	cano	cano	PROPN
brj-24352	247	20	-	-	PUNCT
brj-24352	247	21	ramírez	ramírez	PROPN
brj-24352	247	22	,	,	PUNCT
brj-24352	247	23	c.	c.	PROPN
brj-24352	247	24	,	,	PUNCT
brj-24352	247	25	benitezcardoza	benitezcardoza	PROPN
brj-24352	247	26	,	,	PUNCT
brj-24352	247	27	c.	c.	PROPN
brj-24352	247	28	g.	g.	PROPN
brj-24352	247	29	,	,	PUNCT
brj-24352	247	30	and	and	CCONJ
brj-24352	247	31	hidalgo	hidalgo	PROPN
brj-24352	247	32	-	-	PUNCT
brj-24352	247	33	lara	lara	PROPN
brj-24352	247	34	,	,	PUNCT
brj-24352	247	35	m.	m.	PROPN
brj-24352	247	36	e.	e.	PROPN
brj-24352	247	37	(	(	PUNCT
brj-24352	247	38	2023	2023	NUM
brj-24352	247	39	)	)	PUNCT
brj-24352	247	40	.	.	PUNCT
brj-24352	248	1	“	"	PUNCT
brj-24352	248	2	ttcel7a	ttcel7a	NOUN
brj-24352	248	3	:	:	PUNCT
brj-24352	248	4	a	a	DET
brj-24352	248	5	native	native	ADJ
brj-24352	248	6	thermophilic	thermophilic	ADJ
brj-24352	248	7	bifunctional	bifunctional	ADJ
brj-24352	248	8	cellulose	cellulose	NOUN
brj-24352	248	9	/	/	SYM
brj-24352	248	10	xylanase	xylanase	PROPN
brj-24352	248	11	exogluclanase	exogluclanase	NOUN
brj-24352	248	12	from	from	ADP
brj-24352	248	13	the	the	DET
brj-24352	248	14	thermophilic	thermophilic	ADJ
brj-24352	248	15	biomassdegrading	biomassdegrading	NOUN
brj-24352	248	16	fungus	fungus	NOUN
brj-24352	248	17	thielavia	thielavia	PROPN
brj-24352	248	18	terrestris	terrestris	PROPN
brj-24352	248	19	co3bag1	co3bag1	PROPN
brj-24352	248	20	,	,	PUNCT
brj-24352	248	21	and	and	CCONJ
brj-24352	248	22	its	its	PRON
brj-24352	248	23	application	application	NOUN
brj-24352	248	24	in	in	ADP
brj-24352	248	25	enzymatic	enzymatic	ADJ
brj-24352	248	26	hydrolysis	hydrolysis	NOUN
brj-24352	248	27	of	of	ADP
brj-24352	248	28	agroindustrial	agroindustrial	ADJ
brj-24352	248	29	derivatives	derivative	NOUN
brj-24352	248	30	,	,	PUNCT
brj-24352	248	31	”	"	PUNCT
brj-24352	248	32	journal	journal	NOUN
brj-24352	248	33	of	of	ADP
brj-24352	248	34	fungi	fungi	PROPN
brj-24352	248	35	9(2	9(2	NUM
brj-24352	248	36	)	)	PUNCT
brj-24352	248	37	.	.	PUNCT
brj-24352	249	1	doi	doi	NOUN
brj-24352	249	2	:	:	PUNCT
brj-24352	249	3	10.3390	10.3390	NUM
brj-24352	249	4	/	/	SYM
brj-24352	249	5	jof9020152	jof9020152	PROPN
brj-24352	249	6	mansfield	mansfield	PROPN
brj-24352	249	7	,	,	PUNCT
brj-24352	249	8	s.	s.	PROPN
brj-24352	249	9	d.	d.	PROPN
brj-24352	249	10	,	,	PUNCT
brj-24352	249	11	mooney	mooney	PROPN
brj-24352	249	12	,	,	PUNCT
brj-24352	249	13	c.	c.	PROPN
brj-24352	249	14	,	,	PUNCT
brj-24352	249	15	and	and	CCONJ
brj-24352	249	16	saddler	saddler	NOUN
brj-24352	249	17	,	,	PUNCT
brj-24352	249	18	j.	j.	PROPN
brj-24352	249	19	n.	n.	PROPN
brj-24352	249	20	(	(	PUNCT
brj-24352	249	21	1999	1999	NUM
brj-24352	249	22	)	)	PUNCT
brj-24352	249	23	.	.	PUNCT
brj-24352	250	1	“	"	PUNCT
brj-24352	250	2	substrate	substrate	NOUN
brj-24352	250	3	and	and	CCONJ
brj-24352	250	4	enzyme	enzyme	NOUN
brj-24352	250	5	characteristics	characteristic	NOUN
brj-24352	250	6	that	that	PRON
brj-24352	250	7	limit	limit	VERB
brj-24352	250	8	cellulose	cellulose	NOUN
brj-24352	250	9	hydrolysis	hydrolysis	NOUN
brj-24352	250	10	,	,	PUNCT
brj-24352	250	11	”	"	PUNCT
brj-24352	250	12	biotechnology	biotechnology	NOUN
brj-24352	250	13	progress	progress	NOUN
brj-24352	250	14	15(5	15(5	NUM
brj-24352	250	15	)	)	PUNCT
brj-24352	250	16	,	,	PUNCT
brj-24352	250	17	804816	804816	NUM
brj-24352	250	18	.	.	PUNCT
brj-24352	251	1	doi	doi	NOUN
brj-24352	251	2	:	:	PUNCT
brj-24352	251	3	10.1021	10.1021	NUM
brj-24352	251	4	/	/	SYM
brj-24352	251	5	bp9900864	bp9900864	PROPN
brj-24352	251	6	marriott	marriott	PROPN
brj-24352	251	7	,	,	PUNCT
brj-24352	251	8	p.	p.	PROPN
brj-24352	251	9	e.	e.	PROPN
brj-24352	251	10	,	,	PUNCT
brj-24352	251	11	gómez	gómez	NOUN
brj-24352	251	12	,	,	PUNCT
brj-24352	251	13	l.	l.	PROPN
brj-24352	251	14	d.	d.	PROPN
brj-24352	251	15	,	,	PUNCT
brj-24352	251	16	and	and	CCONJ
brj-24352	251	17	mcqueen‐mason	mcqueen‐mason	ADV
brj-24352	251	18	,	,	PUNCT
brj-24352	251	19	s.	s.	PROPN
brj-24352	251	20	j.	j.	PROPN
brj-24352	251	21	(	(	PUNCT
brj-24352	251	22	2016	2016	NUM
brj-24352	251	23	)	)	PUNCT
brj-24352	251	24	.	.	PUNCT
brj-24352	252	1	“	"	PUNCT
brj-24352	252	2	unlocking	unlock	VERB
brj-24352	252	3	the	the	DET
brj-24352	252	4	potential	potential	NOUN
brj-24352	252	5	of	of	ADP
brj-24352	252	6	lignocellulosic	lignocellulosic	ADJ
brj-24352	252	7	biomass	biomass	NOUN
brj-24352	252	8	through	through	ADP
brj-24352	252	9	plant	plant	NOUN
brj-24352	252	10	science	science	NOUN
brj-24352	252	11	,	,	PUNCT
brj-24352	252	12	”	"	PUNCT
brj-24352	252	13	new	new	ADJ
brj-24352	252	14	phytologist	phytologist	NOUN
brj-24352	252	15	209(4	209(4	NUM
brj-24352	252	16	)	)	PUNCT
brj-24352	252	17	,	,	PUNCT
brj-24352	252	18	1366	1366	NUM
brj-24352	252	19	-	-	SYM
brj-24352	252	20	1381	1381	NUM
brj-24352	252	21	.	.	PUNCT
brj-24352	253	1	doi	doi	NOUN
brj-24352	253	2	:	:	PUNCT
brj-24352	253	3	10.1111	10.1111	NUM
brj-24352	253	4	/	/	SYM
brj-24352	253	5	nph.13684	nph.13684	PROPN
brj-24352	253	6	reddy	reddy	NOUN
brj-24352	253	7	,	,	PUNCT
brj-24352	253	8	n.	n.	NOUN
brj-24352	253	9	,	,	PUNCT
brj-24352	253	10	and	and	CCONJ
brj-24352	253	11	yang	yang	PROPN
brj-24352	253	12	,	,	PUNCT
brj-24352	253	13	y.	y.	PROPN
brj-24352	253	14	(	(	PUNCT
brj-24352	253	15	2005	2005	NUM
brj-24352	253	16	)	)	PUNCT
brj-24352	253	17	.	.	PUNCT
brj-24352	254	1	“	"	PUNCT
brj-24352	254	2	structure	structure	NOUN
brj-24352	254	3	and	and	CCONJ
brj-24352	254	4	properties	property	NOUN
brj-24352	254	5	of	of	ADP
brj-24352	254	6	high	high	ADJ
brj-24352	254	7	quality	quality	NOUN
brj-24352	254	8	natural	natural	ADJ
brj-24352	254	9	cellulose	cellulose	NOUN
brj-24352	254	10	fibers	fiber	NOUN
brj-24352	254	11	from	from	ADP
brj-24352	254	12	cornstalks	cornstalk	NOUN
brj-24352	254	13	,	,	PUNCT
brj-24352	254	14	”	"	PUNCT
brj-24352	254	15	polymer	polymer	NOUN
brj-24352	254	16	46(15	46(15	PROPN
brj-24352	254	17	)	)	PUNCT
brj-24352	254	18	,	,	PUNCT
brj-24352	254	19	5494	5494	NUM
brj-24352	254	20	-	-	SYM
brj-24352	254	21	5500	5500	NUM
brj-24352	254	22	.	.	PUNCT
brj-24352	255	1	doi	doi	NOUN
brj-24352	255	2	:	:	PUNCT
brj-24352	255	3	10.1016	10.1016	NUM
brj-24352	255	4	/	/	SYM
brj-24352	255	5	j.polymer.2005.04.073	j.polymer.2005.04.073	NOUN
brj-24352	255	6	seglah	seglah	NOUN
brj-24352	255	7	,	,	PUNCT
brj-24352	255	8	p.	p.	NOUN
brj-24352	255	9	a.	a.	NOUN
brj-24352	255	10	,	,	PUNCT
brj-24352	255	11	wang	wang	PROPN
brj-24352	255	12	,	,	PUNCT
brj-24352	255	13	y.	y.	PROPN
brj-24352	255	14	,	,	PUNCT
brj-24352	255	15	wang	wang	PROPN
brj-24352	255	16	,	,	PUNCT
brj-24352	255	17	h.	h.	PROPN
brj-24352	255	18	,	,	PUNCT
brj-24352	255	19	and	and	CCONJ
brj-24352	255	20	bi	bi	NOUN
brj-24352	255	21	,	,	PUNCT
brj-24352	255	22	y.	y.	PROPN
brj-24352	255	23	(	(	PUNCT
brj-24352	255	24	2019	2019	NUM
brj-24352	255	25	)	)	PUNCT
brj-24352	255	26	.	.	PUNCT
brj-24352	256	1	“	"	PUNCT
brj-24352	256	2	estimation	estimation	NOUN
brj-24352	256	3	and	and	CCONJ
brj-24352	256	4	efficient	efficient	ADJ
brj-24352	256	5	utilization	utilization	NOUN
brj-24352	256	6	of	of	ADP
brj-24352	256	7	straw	straw	NOUN
brj-24352	256	8	resources	resource	NOUN
brj-24352	256	9	in	in	ADP
brj-24352	256	10	ghana	ghana	PROPN
brj-24352	256	11	,	,	PUNCT
brj-24352	256	12	”	"	PUNCT
brj-24352	256	13	sustainability	sustainability	NOUN
brj-24352	256	14	11(15	11(15	NUM
brj-24352	256	15	)	)	PUNCT
brj-24352	256	16	,	,	PUNCT
brj-24352	256	17	4172	4172	NUM
brj-24352	256	18	.	.	PUNCT
brj-24352	257	1	doi	doi	NOUN
brj-24352	257	2	:	:	PUNCT
brj-24352	257	3	10.3390	10.3390	NUM
brj-24352	257	4	/	/	SYM
brj-24352	257	5	su11154172	su11154172	NOUN
brj-24352	257	6	shin	shin	NOUN
brj-24352	257	7	,	,	PUNCT
brj-24352	257	8	s.	s.	PROPN
brj-24352	257	9	k.	k.	PROPN
brj-24352	257	10	,	,	PUNCT
brj-24352	257	11	ko	ko	PROPN
brj-24352	257	12	,	,	PUNCT
brj-24352	257	13	y.	y.	PROPN
brj-24352	257	14	j.	j.	PROPN
brj-24352	257	15	,	,	PUNCT
brj-24352	257	16	hyeon	hyeon	PROPN
brj-24352	257	17	,	,	PUNCT
brj-24352	257	18	j.	j.	PROPN
brj-24352	257	19	e.	e.	PROPN
brj-24352	257	20	,	,	PUNCT
brj-24352	257	21	and	and	CCONJ
brj-24352	257	22	han	han	PROPN
brj-24352	257	23	,	,	PUNCT
brj-24352	257	24	s.	s.	PROPN
brj-24352	257	25	o.	o.	PROPN
brj-24352	257	26	(	(	PUNCT
brj-24352	257	27	2019	2019	NUM
brj-24352	257	28	)	)	PUNCT
brj-24352	257	29	.	.	PUNCT
brj-24352	258	1	“	"	PUNCT
brj-24352	258	2	studies	study	NOUN
brj-24352	258	3	of	of	ADP
brj-24352	258	4	advanced	advanced	ADJ
brj-24352	258	5	lignin	lignin	NOUN
brj-24352	258	6	valorization	valorization	NOUN
brj-24352	258	7	based	base	VERB
brj-24352	258	8	on	on	ADP
brj-24352	258	9	various	various	ADJ
brj-24352	258	10	types	type	NOUN
brj-24352	258	11	of	of	ADP
brj-24352	258	12	lignolytic	lignolytic	ADJ
brj-24352	258	13	enzymes	enzyme	NOUN
brj-24352	258	14	and	and	CCONJ
brj-24352	258	15	microbes	microbe	NOUN
brj-24352	258	16	,	,	PUNCT
brj-24352	258	17	”	"	PUNCT
brj-24352	258	18	bioresource	bioresource	ADP
brj-24352	258	19	technology	technology	NOUN
brj-24352	258	20	289	289	NUM
brj-24352	258	21	,	,	PUNCT
brj-24352	258	22	article	article	NOUN
brj-24352	258	23	121728	121728	NUM
brj-24352	258	24	.	.	PUNCT
brj-24352	259	1	doi	doi	NOUN
brj-24352	259	2	:	:	PUNCT
brj-24352	259	3	10.1016	10.1016	NUM
brj-24352	259	4	/	/	SYM
brj-24352	259	5	j.biortech.2019.121728	j.biortech.2019.121728	PROPN
brj-24352	259	6	tan	tan	PROPN
brj-24352	259	7	,	,	PUNCT
brj-24352	259	8	h.	h.	PROPN
brj-24352	259	9	,	,	PUNCT
brj-24352	259	10	miao	miao	PROPN
brj-24352	259	11	,	,	PUNCT
brj-24352	259	12	r.	r.	PROPN
brj-24352	259	13	,	,	PUNCT
brj-24352	259	14	liu	liu	PROPN
brj-24352	259	15	,	,	PUNCT
brj-24352	259	16	t.	t.	PROPN
brj-24352	259	17	,	,	PUNCT
brj-24352	259	18	yang	yang	PROPN
brj-24352	259	19	,	,	PUNCT
brj-24352	259	20	l.	l.	PROPN
brj-24352	259	21	,	,	PUNCT
brj-24352	259	22	yang	yang	PROPN
brj-24352	259	23	,	,	PUNCT
brj-24352	259	24	y.	y.	PROPN
brj-24352	259	25	,	,	PUNCT
brj-24352	259	26	chen	chen	PROPN
brj-24352	259	27	,	,	PUNCT
brj-24352	259	28	c.	c.	PROPN
brj-24352	259	29	,	,	PUNCT
brj-24352	259	30	lei	lei	PROPN
brj-24352	259	31	,	,	PUNCT
brj-24352	259	32	j.	j.	PROPN
brj-24352	259	33	,	,	PUNCT
brj-24352	259	34	li	li	PROPN
brj-24352	259	35	,	,	PUNCT
brj-24352	259	36	y.	y.	PROPN
brj-24352	259	37	,	,	PUNCT
brj-24352	259	38	he	he	PRON
brj-24352	259	39	,	,	PUNCT
brj-24352	259	40	j.	j.	PROPN
brj-24352	259	41	,	,	PUNCT
brj-24352	259	42	sun	sun	PROPN
brj-24352	259	43	,	,	PUNCT
brj-24352	259	44	q.	q.	PROPN
brj-24352	259	45	,	,	PUNCT
brj-24352	259	46	peng	peng	PROPN
brj-24352	259	47	,	,	PUNCT
brj-24352	259	48	w.	w.	PROPN
brj-24352	259	49	,	,	PUNCT
brj-24352	259	50	gan	gan	PROPN
brj-24352	259	51	,	,	PUNCT
brj-24352	259	52	b.	b.	PROPN
brj-24352	259	53	,	,	PUNCT
brj-24352	259	54	and	and	CCONJ
brj-24352	259	55	huang	huang	PROPN
brj-24352	259	56	,	,	PUNCT
brj-24352	259	57	z.	z.	PROPN
brj-24352	259	58	(	(	PUNCT
brj-24352	259	59	2017	2017	NUM
brj-24352	259	60	)	)	PUNCT
brj-24352	259	61	.	.	PUNCT
brj-24352	260	1	“	"	PUNCT
brj-24352	260	2	a	a	DET
brj-24352	260	3	bifunctional	bifunctional	ADJ
brj-24352	260	4	cellulase	cellulase	NOUN
brj-24352	260	5	–	–	PUNCT
brj-24352	260	6	xylanase	xylanase	NOUN
brj-24352	260	7	of	of	ADP
brj-24352	260	8	a	a	DET
brj-24352	260	9	new	new	ADJ
brj-24352	260	10	chryseobacterium	chryseobacterium	NOUN
brj-24352	260	11	strain	strain	NOUN
brj-24352	260	12	isolated	isolate	VERB
brj-24352	260	13	from	from	ADP
brj-24352	260	14	the	the	DET
brj-24352	260	15	dung	dung	NOUN
brj-24352	260	16	of	of	ADP
brj-24352	260	17	a	a	DET
brj-24352	260	18	straw‐fed	straw‐fe	VERB
brj-24352	260	19	cattle	cattle	NOUN
brj-24352	260	20	,	,	PUNCT
brj-24352	260	21	”	"	PUNCT
brj-24352	260	22	microbial	microbial	ADJ
brj-24352	260	23	biotechnology	biotechnology	NOUN
brj-24352	260	24	11(2	11(2	NOUN
brj-24352	260	25	)	)	PUNCT
brj-24352	260	26	,	,	PUNCT
brj-24352	260	27	381	381	NUM
brj-24352	260	28	-	-	SYM
brj-24352	260	29	398	398	NUM
brj-24352	260	30	.	.	PUNCT
brj-24352	261	1	doi	doi	NOUN
brj-24352	261	2	:	:	PUNCT
brj-24352	261	3	10.1111/1751	10.1111/1751	NUM
brj-24352	261	4	-	-	SYM
brj-24352	261	5	7915.13034	7915.13034	NUM
brj-24352	261	6	turner	turner	NOUN
brj-24352	261	7	,	,	PUNCT
brj-24352	261	8	m.	m.	PROPN
brj-24352	261	9	b.	b.	PROPN
brj-24352	261	10	,	,	PUNCT
brj-24352	261	11	spear	spear	NOUN
brj-24352	261	12	,	,	PUNCT
brj-24352	261	13	s.	s.	PROPN
brj-24352	261	14	k.	k.	PROPN
brj-24352	261	15	,	,	PUNCT
brj-24352	261	16	huddleston	huddleston	PROPN
brj-24352	261	17	,	,	PUNCT
brj-24352	261	18	j.	j.	PROPN
brj-24352	261	19	g.	g.	PROPN
brj-24352	261	20	,	,	PUNCT
brj-24352	261	21	holbrey	holbrey	PROPN
brj-24352	261	22	,	,	PUNCT
brj-24352	261	23	j.	j.	PROPN
brj-24352	261	24	d.	d.	PROPN
brj-24352	261	25	,	,	PUNCT
brj-24352	261	26	and	and	CCONJ
brj-24352	261	27	rogers	rogers	PROPN
brj-24352	261	28	,	,	PUNCT
brj-24352	261	29	r.	r.	PROPN
brj-24352	261	30	d.	d.	PROPN
brj-24352	261	31	(	(	PUNCT
brj-24352	261	32	2003	2003	NUM
brj-24352	261	33	)	)	PUNCT
brj-24352	261	34	.	.	PUNCT
brj-24352	262	1	"	"	PUNCT
brj-24352	262	2	ionic	ionic	ADJ
brj-24352	262	3	liquid	liquid	ADJ
brj-24352	262	4	salt	salt	NOUN
brj-24352	262	5	-	-	PUNCT
brj-24352	262	6	induced	induce	VERB
brj-24352	262	7	inactivation	inactivation	NOUN
brj-24352	262	8	and	and	CCONJ
brj-24352	262	9	unfolding	unfolding	NOUN
brj-24352	262	10	of	of	ADP
brj-24352	262	11	cellulase	cellulase	NOUN
brj-24352	262	12	from	from	ADP
brj-24352	262	13	trichoderma	trichoderma	PROPN
brj-24352	262	14	reesei	reesei	ADJ
brj-24352	262	15	,	,	PUNCT
brj-24352	262	16	”	"	PUNCT
brj-24352	262	17	green	green	ADJ
brj-24352	262	18	chemistry	chemistry	NOUN
brj-24352	262	19	5(4	5(4	NOUN
brj-24352	262	20	)	)	PUNCT
brj-24352	262	21	,	,	PUNCT
brj-24352	262	22	443	443	NUM
brj-24352	262	23	-	-	SYM
brj-24352	262	24	447	447	NUM
brj-24352	262	25	.	.	PUNCT
brj-24352	263	1	doi	doi	NOUN
brj-24352	263	2	:	:	PUNCT
brj-24352	263	3	10.1039	10.1039	NUM
brj-24352	263	4	/	/	SYM
brj-24352	263	5	b302570e	b302570e	PRON
brj-24352	263	6	vasconcellos	vasconcello	NOUN
brj-24352	263	7	,	,	PUNCT
brj-24352	263	8	v.	v.	ADV
brj-24352	263	9	,	,	PUNCT
brj-24352	263	10	tardioli	tardioli	NOUN
brj-24352	263	11	,	,	PUNCT
brj-24352	263	12	p.	p.	PROPN
brj-24352	263	13	,	,	PUNCT
brj-24352	263	14	giordano	giordano	PROPN
brj-24352	263	15	,	,	PUNCT
brj-24352	263	16	r.	r.	PROPN
brj-24352	263	17	,	,	PUNCT
brj-24352	263	18	and	and	CCONJ
brj-24352	263	19	farinas	farina	NOUN
brj-24352	263	20	,	,	PUNCT
brj-24352	263	21	c.	c.	PROPN
brj-24352	263	22	(	(	PUNCT
brj-24352	263	23	2016	2016	NUM
brj-24352	263	24	)	)	PUNCT
brj-24352	263	25	.	.	PUNCT
brj-24352	264	1	“	"	PUNCT
brj-24352	264	2	addition	addition	NOUN
brj-24352	264	3	of	of	ADP
brj-24352	264	4	metal	metal	NOUN
brj-24352	264	5	ions	ion	NOUN
brj-24352	264	6	to	to	ADP
brj-24352	264	7	a	a	DET
brj-24352	264	8	(	(	PUNCT
brj-24352	264	9	hemi	hemi	NOUN
brj-24352	264	10	)	)	PUNCT
brj-24352	264	11	cellulolytic	cellulolytic	ADJ
brj-24352	264	12	enzymatic	enzymatic	ADJ
brj-24352	264	13	cocktail	cocktail	NOUN
brj-24352	264	14	produced	produce	VERB
brj-24352	264	15	in	in	ADP
brj-24352	264	16	-	-	PUNCT
brj-24352	264	17	house	house	NOUN
brj-24352	264	18	improves	improve	VERB
brj-24352	264	19	its	its	PRON
brj-24352	264	20	activity	activity	NOUN
brj-24352	264	21	,	,	PUNCT
brj-24352	264	22	thermostability	thermostability	NOUN
brj-24352	264	23	,	,	PUNCT
brj-24352	264	24	and	and	CCONJ
brj-24352	264	25	efficiency	efficiency	NOUN
brj-24352	264	26	in	in	ADP
brj-24352	264	27	the	the	DET
brj-24352	264	28	saccharification	saccharification	NOUN
brj-24352	264	29	of	of	ADP
brj-24352	264	30	pretreated	pretreate	VERB
brj-24352	264	31	sugarcane	sugarcane	NOUN
brj-24352	264	32	bagasse	bagasse	NOUN
brj-24352	264	33	,	,	PUNCT
brj-24352	264	34	”	"	PUNCT
brj-24352	264	35	new	new	ADJ
brj-24352	264	36	biotechnology	biotechnology	NOUN
brj-24352	264	37	33(3	33(3	NOUN
brj-24352	264	38	)	)	PUNCT
brj-24352	264	39	,	,	PUNCT
brj-24352	264	40	331	331	NUM
brj-24352	264	41	-	-	SYM
brj-24352	264	42	337	337	NUM
brj-24352	264	43	.	.	PUNCT
brj-24352	265	1	doi	doi	NOUN
brj-24352	265	2	:	:	PUNCT
brj-24352	265	3	10.1016	10.1016	NUM
brj-24352	265	4	/	/	SYM
brj-24352	265	5	j.nbt.2015.12.002	j.nbt.2015.12.002	NOUN
brj-24352	265	6	wanapat	wanapat	NOUN
brj-24352	265	7	,	,	PUNCT
brj-24352	265	8	m.	m.	NOUN
brj-24352	265	9	(	(	PUNCT
brj-24352	265	10	2000	2000	NUM
brj-24352	265	11	)	)	PUNCT
brj-24352	265	12	.	.	PUNCT
brj-24352	266	1	“	"	PUNCT
brj-24352	266	2	rumen	ruman	NOUN
brj-24352	266	3	manipulation	manipulation	NOUN
brj-24352	266	4	to	to	PART
brj-24352	266	5	increase	increase	VERB
brj-24352	266	6	the	the	DET
brj-24352	266	7	efficient	efficient	ADJ
brj-24352	266	8	use	use	NOUN
brj-24352	266	9	of	of	ADP
brj-24352	266	10	local	local	ADJ
brj-24352	266	11	feed	feed	NOUN
brj-24352	266	12	resources	resource	NOUN
brj-24352	266	13	and	and	CCONJ
brj-24352	266	14	productivity	productivity	NOUN
brj-24352	266	15	of	of	ADP
brj-24352	266	16	ruminants	ruminant	NOUN
brj-24352	266	17	in	in	ADP
brj-24352	266	18	the	the	DET
brj-24352	266	19	tropics	tropic	NOUN
brj-24352	266	20	,	,	PUNCT
brj-24352	266	21	”	"	PUNCT
brj-24352	266	22	asian	asian	ADJ
brj-24352	266	23	australasian	australasian	ADJ
brj-24352	266	24	journal	journal	NOUN
brj-24352	266	25	of	of	ADP
brj-24352	266	26	animal	animal	NOUN
brj-24352	266	27	sciences	science	NOUN
brj-24352	266	28	13	13	NUM
brj-24352	266	29	,	,	PUNCT
brj-24352	266	30	59	59	NUM
brj-24352	266	31	-	-	SYM
brj-24352	266	32	67	67	NUM
brj-24352	266	33	.	.	PUNCT
brj-24352	267	1	doi	doi	NOUN
brj-24352	267	2	:	:	PUNCT
brj-24352	267	3	10.4314	10.4314	NUM
brj-24352	267	4	/	/	SYM
brj-24352	267	5	mejs.v6i2.109618	mejs.v6i2.109618	NUM
brj-24352	267	6	xiao	xiao	PROPN
brj-24352	267	7	,	,	PUNCT
brj-24352	267	8	m.	m.	NOUN
brj-24352	267	9	,	,	PUNCT
brj-24352	267	10	liu	liu	PROPN
brj-24352	267	11	,	,	PUNCT
brj-24352	267	12	y.-j	y.-j	PROPN
brj-24352	267	13	.	.	PROPN
brj-24352	267	14	,	,	PUNCT
brj-24352	267	15	bayer	bayer	PROPN
brj-24352	267	16	,	,	PUNCT
brj-24352	267	17	e.	e.	PROPN
brj-24352	267	18	a.	a.	PROPN
brj-24352	267	19	,	,	PUNCT
brj-24352	267	20	kosugi	kosugi	PROPN
brj-24352	267	21	,	,	PUNCT
brj-24352	267	22	a.	a.	NOUN
brj-24352	267	23	,	,	PUNCT
brj-24352	267	24	cui	cui	PROPN
brj-24352	267	25	,	,	PUNCT
brj-24352	267	26	q.	q.	PROPN
brj-24352	267	27	,	,	PUNCT
brj-24352	267	28	and	and	CCONJ
brj-24352	267	29	feng	feng	PROPN
brj-24352	267	30	,	,	PUNCT
brj-24352	267	31	y.	y.	PROPN
brj-24352	267	32	(	(	PUNCT
brj-24352	267	33	2024	2024	NUM
brj-24352	267	34	)	)	PUNCT
brj-24352	267	35	.	.	PUNCT
brj-24352	268	1	“	"	PUNCT
brj-24352	268	2	cellulosomal	cellulosomal	ADJ
brj-24352	268	3	hemicellulases	hemicellulase	NOUN
brj-24352	268	4	:	:	PUNCT
brj-24352	268	5	indispensable	indispensable	ADJ
brj-24352	268	6	players	player	NOUN
brj-24352	268	7	for	for	ADP
brj-24352	268	8	ensuring	ensure	VERB
brj-24352	268	9	effective	effective	ADJ
brj-24352	268	10	lignocellulose	lignocellulose	ADJ
brj-24352	268	11	bioconversion	bioconversion	NOUN
brj-24352	268	12	,	,	PUNCT
brj-24352	268	13	”	"	PUNCT
brj-24352	268	14	green	green	ADJ
brj-24352	268	15	carbon	carbon	NOUN
brj-24352	268	16	2(1	2(1	NUM
brj-24352	268	17	)	)	PUNCT
brj-24352	268	18	,	,	PUNCT
brj-24352	268	19	57	57	NUM
brj-24352	268	20	-	-	SYM
brj-24352	268	21	69	69	NUM
brj-24352	268	22	.	.	PUNCT
brj-24352	269	1	doi	doi	NOUN
brj-24352	269	2	:	:	PUNCT
brj-24352	269	3	10.1016	10.1016	NUM
brj-24352	269	4	/	/	SYM
brj-24352	269	5	j.greenca.2024.01.003	j.greenca.2024.01.003	PROPN
brj-24352	269	6	zhang	zhang	PROPN
brj-24352	269	7	,	,	PUNCT
brj-24352	269	8	z.	z.	PROPN
brj-24352	269	9	,	,	PUNCT
brj-24352	269	10	donaldson	donaldson	PROPN
brj-24352	269	11	,	,	PUNCT
brj-24352	269	12	a.	a.	NOUN
brj-24352	269	13	a.	a.	PROPN
brj-24352	269	14	,	,	PUNCT
brj-24352	269	15	and	and	CCONJ
brj-24352	269	16	ma	ma	PROPN
brj-24352	269	17	,	,	PUNCT
brj-24352	269	18	x.	x.	NOUN
brj-24352	269	19	(	(	PUNCT
brj-24352	269	20	2012	2012	NUM
brj-24352	269	21	)	)	PUNCT
brj-24352	269	22	.	.	PUNCT
brj-24352	270	1	“	"	PUNCT
brj-24352	270	2	advancements	advancement	NOUN
brj-24352	270	3	and	and	CCONJ
brj-24352	270	4	future	future	ADJ
brj-24352	270	5	directions	direction	NOUN
brj-24352	270	6	in	in	ADP
brj-24352	270	7	enzyme	enzyme	NOUN
brj-24352	270	8	technology	technology	NOUN
brj-24352	270	9	for	for	ADP
brj-24352	270	10	biomass	biomass	NOUN
brj-24352	270	11	conversion	conversion	NOUN
brj-24352	270	12	,	,	PUNCT
brj-24352	270	13	”	"	PUNCT
brj-24352	270	14	biotechnology	biotechnology	NOUN
brj-24352	270	15	advances	advance	VERB
brj-24352	270	16	30(4	30(4	NUM
brj-24352	270	17	)	)	PUNCT
brj-24352	270	18	,	,	PUNCT
brj-24352	270	19	913919	913919	NUM
brj-24352	270	20	.	.	PUNCT
brj-24352	271	1	doi	doi	NOUN
brj-24352	271	2	:	:	PUNCT
brj-24352	271	3	10.1016	10.1016	NUM
brj-24352	271	4	/	/	SYM
brj-24352	271	5	j.biotechadv.2012.01.020	j.biotechadv.2012.01.020	PROPN
brj-24352	271	6	article	article	NOUN
brj-24352	271	7	submitted	submit	VERB
brj-24352	271	8	:	:	PUNCT
brj-24352	271	9	article	article	NOUN
brj-24352	271	10	submitted	submit	VERB
brj-24352	271	11	:	:	PUNCT
brj-24352	271	12	january	january	PROPN
brj-24352	271	13	7	7	NUM
brj-24352	271	14	,	,	PUNCT
brj-24352	271	15	2025	2025	NUM
brj-24352	271	16	;	;	PUNCT
brj-24352	271	17	peer	peer	NOUN
brj-24352	271	18	review	review	NOUN
brj-24352	271	19	completed	complete	VERB
brj-24352	271	20	:	:	PUNCT
brj-24352	271	21	february	february	NOUN
brj-24352	271	22	8	8	NUM
brj-24352	271	23	,	,	PUNCT
brj-24352	271	24	2025	2025	NUM
brj-24352	271	25	;	;	PUNCT
brj-24352	271	26	revised	revise	VERB
brj-24352	271	27	version	version	NOUN
brj-24352	271	28	received	receive	VERB
brj-24352	271	29	and	and	CCONJ
brj-24352	271	30	accepted	accept	VERB
brj-24352	271	31	:	:	PUNCT
brj-24352	271	32	march	march	PROPN
brj-24352	271	33	6	6	NUM
brj-24352	271	34	,	,	PUNCT
brj-24352	271	35	2025	2025	NUM
brj-24352	271	36	;	;	PUNCT
brj-24352	271	37	published	publish	VERB
brj-24352	271	38	:	:	PUNCT
brj-24352	271	39	june	june	PROPN
brj-24352	271	40	13	13	NUM
brj-24352	271	41	,	,	PUNCT
brj-24352	271	42	2025	2025	NUM
brj-24352	271	43	.	.	PUNCT
brj-24352	272	1	doi	doi	NOUN
brj-24352	272	2	:	:	PUNCT
brj-24352	272	3	10.15376	10.15376	NUM
brj-24352	272	4	/	/	SYM
brj-24352	272	5	biores.20.3.5501	biores.20.3.5501	PROPN
brj-24352	272	6	-	-	PUNCT
brj-24352	272	7	5513	5513	NUM
brj-24352	272	8	https://doi.org/10.3390/jof9020152	https://doi.org/10.3390/jof9020152	NOUN
brj-24352	273	1	https://doi.org/10.1021/bp9900864	https://doi.org/10.1021/bp9900864	X
brj-24352	273	2	https://doi.org/10.1111/nph.13684	https://doi.org/10.1111/nph.13684	PROPN
brj-24352	273	3	https://doi.org/10.1016/j.polymer.2005.04.073	https://doi.org/10.1016/j.polymer.2005.04.073	NOUN
brj-24352	273	4	https://doi.org/10.3390/su11154172	https://doi.org/10.3390/su11154172	ADJ
brj-24352	273	5	https://doi.org/10.1016/j.biortech.2019.121728	https://doi.org/10.1016/j.biortech.2019.121728	PROPN
brj-24352	273	6	https://doi.org/10.1111/1751-7915.13034	https://doi.org/10.1111/1751-7915.13034	NOUN
brj-24352	273	7	https://doi.org/10.1039/b302570e	https://doi.org/10.1039/b302570e	VERB
brj-24352	273	8	https://doi.org/10.1016/j.nbt.2015.12.002	https://doi.org/10.1016/j.nbt.2015.12.002	NOUN
brj-24352	273	9	https://doi.org/10.4314/mejs.v6i2.109618	https://doi.org/10.4314/mejs.v6i2.109618	PROPN
brj-24352	273	10	https://doi.org/10.1016/j.greenca.2024.01.003	https://doi.org/10.1016/j.greenca.2024.01.003	PROPN
brj-24352	273	11	https://doi.org/10.1016/j.biotechadv.2012.01.020	https://doi.org/10.1016/j.biotechadv.2012.01.020	VERB
brj-24352	273	12	peer	peer	NOUN
brj-24352	273	13	-	-	PUNCT
brj-24352	273	14	reviewed	review	VERB
brj-24352	273	15	article	article	NOUN
brj-24352	273	16	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24352	273	17	ouyang	ouyang	PROPN
brj-24352	273	18	et	et	PROPN
brj-24352	273	19	al	al	PROPN
brj-24352	273	20	.	.	PROPN
brj-24352	274	1	(	(	PUNCT
brj-24352	274	2	2025	2025	NUM
brj-24352	274	3	)	)	PUNCT
brj-24352	274	4	.	.	PUNCT
brj-24352	275	1	“	"	PUNCT
brj-24352	275	2	rumen	ruman	NOUN
brj-24352	275	3	cellulase	cellulase	NOUN
brj-24352	275	4	&	&	CCONJ
brj-24352	275	5	ag	ag	PROPN
brj-24352	275	6	waste	waste	PROPN
brj-24352	275	7	,	,	PUNCT
brj-24352	275	8	”	"	PUNCT
brj-24352	275	9	bioresources	bioresource	NOUN
brj-24352	275	10	20(3	20(3	NOUN
brj-24352	275	11	)	)	PUNCT
brj-24352	275	12	,	,	PUNCT
brj-24352	275	13	5501	5501	NUM
brj-24352	275	14	-	-	SYM
brj-24352	275	15	5513	5513	NUM
brj-24352	275	16	.	.	PUNCT
brj-24352	275	17	5513	5513	NUM
brj-24352	275	18	appendix	appendix	PROPN
brj-24352	275	19	supplementary	supplementary	ADJ
brj-24352	275	20	information	information	NOUN
brj-24352	275	21	table	table	NOUN
brj-24352	275	22	s1	s1	PROPN
brj-24352	275	23	.	.	PUNCT
brj-24352	276	1	nucleotide	nucleotide	ADJ
brj-24352	276	2	sequence	sequence	NOUN
brj-24352	276	3	of	of	ADP
brj-24352	276	4	rucel224	rucel224	PROPN
brj-24352	276	5	item	item	NOUN
brj-24352	276	6	sequence	sequence	NOUN
brj-24352	276	7	rucel224	rucel224	PROPN
brj-24352	276	8	atgaaaaaagaattaacagctcttgtaccgtttgcactcgccctgagtttgtgcctgacc	atgaaaaaagaattaacagctcttgtaccgtttgcactcgccctgagtttgtgcctgacc	ADV
brj-24352	276	9	gcctgcgacaacggcggctcccataacgccgtggcccctaaagaagatgattcgacagc	gcctgcgacaacggcggctcccataacgccgtggcccctaaagaagatgattcgacagc	NOUN
brj-24352	276	10	gacgaaggctatcgactattccaagggtcgcgccatgaacaagaggctcggcaagggta	gacgaaggctatcgactattccaagggtcgcgccatgaacaagaggctcggcaagggta	PROPN
brj-24352	276	11	tcaaccttggcaactcctgggaatcccaagggagcagccttgactgcagctggggtaac	tcaaccttggcaactcctgggaatcccaagggagcagccttgactgcagctggggtaac	PROPN
brj-24352	276	12	tgcattgaagacaccgattttgctgtcgttaaggcggcaggattcaattctattcgactcc	tgcattgaagacaccgattttgctgtcgttaaggcggcaggattcaattctattcgactcc	PROPN
brj-24352	276	13	ccgtgcgttggcagcaggattccgactatggcacccataccgtagaccctgcccgtctc	ccgtgcgttggcagcaggattccgactatggcacccataccgtagaccctgcccgtctc	PROPN
brj-24352	276	14	gccggcgtgaaagaagatatcgagcttgcccttgcccaaggactcgctgtcatcgtgaa	gccggcgtgaaagaagatatcgagcttgcccttgcccaaggactcgctgtcatcgtgaa	PROPN
brj-24352	276	15	cttccaccactatgtcgagctgaacgaagccggtaacaactatacgaccgacccccaggc	cttccaccactatgtcgagctgaacgaagccggtaacaactatacgaccgacccccaggc	VERB
brj-24352	276	16	atacgaagaggaaaaggctcacttcttgaaattgtgggaacaggtcgccacggaattgaa	atacgaagaggaaaaggctcacttcttgaaattgtgggaacaggtcgccacggaattgaa	NOUN
brj-24352	276	17	caaataccccgattccatgctcgtgcttgaaattttgaacgagcccaccatttctaacgcc	caaataccccgattccatgctcgtgcttgaaattttgaacgagcccaccatttctaacgcc	NOUN
brj-24352	276	18	gaacgcgtaagcaacctcatgaatgacgcttaccaggtgatccgtgcaaacgcacccgg	gaacgcgtaagcaacctcatgaatgacgcttaccaggtgatccgtgcaaacgcacccgg	PROPN
brj-24352	276	19	caagacaatcatgttcgaagcctaccatgccgcaaaatttgcagaccttaaggacttgaaa	caagacaatcatgttcgaagcctaccatgccgcaaaatttgcagaccttaaggacttgaaa	NOUN
brj-24352	276	20	ctgccggaagacggaaacatcatctattccgggcattattacgaaccctacacctatagcc	ctgccggaagacggaaacatcatctattccgggcattattacgaaccctacacctatagcc	NOUN
brj-24352	276	21	accagggccatagctacgcctgcaagggcgacgacgcttacgccaacaccgctatttac	accagggccatagctacgcctgcaagggcgacgacgcttacgccaacaccgctatttac	NOUN
brj-24352	276	22	gacatggccacctattcaaagattgcaacggagctctaccccgacgtaaatggcggacat	gacatggccacctattcaaagattgcaacggagctctaccccgacgtaaatggcggacat	PROPN
brj-24352	276	23	gttcccatgaacatgggtgaattcggcatttcgggcggcggcgactttgccaacagcag	gttcccatgaacatgggtgaattcggcatttcgggcggcggcgactttgccaacagcag	PROPN
brj-24352	276	24	aagttgcaacgaaggcgaatcgctcccgtcggcaagaatgaaggccaagtgggcaaagt	aagttgcaacgaaggcgaatcgctcccgtcggcaagaatgaaggccaagtgggcaaagt	PROPN
brj-24352	276	25	tgacaattcaggctgcagaatcgaacgatatttcctggcactactggggatttacgaaagt	tgacaattcaggctgcagaatcgaacgatatttcctggcactactggggatttacgaaagt	PROPN
brj-24352	276	26	aggcggattcgaagcctacagccgtaatgatgacgcttggtacgaaggattccccgaag	aggcggattcgaagcctacagccgtaatgatgacgcttggtacgaaggattccccgaag	VERB
brj-24352	276	27	cattcggactt	cattcggactt	ADJ