id	sid	tid	token	lemma	pos
brj-24894	1	1	peer	peer	NOUN
brj-24894	1	2	-	-	PUNCT
brj-24894	1	3	review	review	NOUN
brj-24894	1	4	article	article	NOUN
brj-24894	1	5	peer	peer	NOUN
brj-24894	1	6	-	-	PUNCT
brj-24894	1	7	reviewed	review	VERB
brj-24894	1	8	article	article	NOUN
brj-24894	1	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	1	10	li	li	PROPN
brj-24894	1	11	et	et	PROPN
brj-24894	1	12	al	al	PROPN
brj-24894	1	13	.	.	PROPN
brj-24894	2	1	(	(	PUNCT
brj-24894	2	2	2026	2026	NUM
brj-24894	2	3	)	)	PUNCT
brj-24894	2	4	.	.	PUNCT
brj-24894	3	1	“	"	PUNCT
brj-24894	3	2	endoglucanase	endoglucanase	VERB
brj-24894	3	3	tpcel12a	tpcel12a	NOUN
brj-24894	3	4	traits	trait	NOUN
brj-24894	3	5	,	,	PUNCT
brj-24894	3	6	”	"	PUNCT
brj-24894	3	7	bioresources	bioresource	NOUN
brj-24894	3	8	21(1	21(1	NUM
brj-24894	3	9	)	)	PUNCT
brj-24894	3	10	,	,	PUNCT
brj-24894	3	11	547	547	NUM
brj-24894	3	12	-	-	SYM
brj-24894	3	13	569	569	NUM
brj-24894	3	14	.	.	PUNCT
brj-24894	4	1	547	547	NUM
brj-24894	4	2	characterization	characterization	NOUN
brj-24894	4	3	of	of	ADP
brj-24894	4	4	a	a	DET
brj-24894	4	5	novel	novel	ADJ
brj-24894	4	6	glycosyl	glycosyl	NOUN
brj-24894	4	7	hydrolase	hydrolase	NOUN
brj-24894	4	8	12	12	NUM
brj-24894	4	9	family	family	NOUN
brj-24894	4	10	endoglucanase	endoglucanase	VERB
brj-24894	4	11	from	from	ADP
brj-24894	4	12	talaromyces	talaromyce	NOUN
brj-24894	4	13	pinophilus	pinophilus	X
brj-24894	4	14	y117	y117	PROPN
brj-24894	4	15	peng	peng	PROPN
brj-24894	4	16	li	li	PROPN
brj-24894	4	17	,	,	PUNCT
brj-24894	4	18	#	#	PROPN
brj-24894	4	19	cheng	cheng	PROPN
brj-24894	4	20	zhang	zhang	PROPN
brj-24894	4	21	,	,	PUNCT
brj-24894	4	22	#	#	PROPN
brj-24894	4	23	junhui	junhui	PROPN
brj-24894	4	24	nie	nie	PROPN
brj-24894	4	25	,	,	PUNCT
brj-24894	4	26	dawei	dawei	PROPN
brj-24894	4	27	xiong	xiong	PROPN
brj-24894	4	28	,	,	PUNCT
brj-24894	4	29	shuaiwen	shuaiwen	PROPN
brj-24894	4	30	zhang	zhang	PROPN
brj-24894	4	31	,	,	PUNCT
brj-24894	4	32	siyuan	siyuan	PROPN
brj-24894	4	33	yue	yue	PROPN
brj-24894	4	34	,	,	PUNCT
brj-24894	4	35	jing	jing	PROPN
brj-24894	4	36	zeng	zeng	PROPN
brj-24894	4	37	,	,	PUNCT
brj-24894	4	38	and	and	CCONJ
brj-24894	4	39	lin	lin	PROPN
brj-24894	4	40	yuan	yuan	PROPN
brj-24894	4	41	,	,	PUNCT
brj-24894	4	42	*	*	PROPN
brj-24894	4	43	endoglucanase	endoglucanase	PROPN
brj-24894	4	44	plays	play	VERB
brj-24894	4	45	a	a	DET
brj-24894	4	46	vital	vital	ADJ
brj-24894	4	47	role	role	NOUN
brj-24894	4	48	in	in	ADP
brj-24894	4	49	lignocellulose	lignocellulose	ADJ
brj-24894	4	50	degradation	degradation	NOUN
brj-24894	4	51	,	,	PUNCT
brj-24894	4	52	yet	yet	CCONJ
brj-24894	4	53	the	the	DET
brj-24894	4	54	functional	functional	ADJ
brj-24894	4	55	diversity	diversity	NOUN
brj-24894	4	56	of	of	ADP
brj-24894	4	57	glycosyl	glycosyl	NOUN
brj-24894	4	58	hydrolase	hydrolase	NOUN
brj-24894	4	59	12	12	NUM
brj-24894	4	60	(	(	PUNCT
brj-24894	4	61	gh12	gh12	PROPN
brj-24894	4	62	)	)	PUNCT
brj-24894	4	63	endoglucanases	endoglucanase	NOUN
brj-24894	4	64	remains	remain	VERB
brj-24894	4	65	underexplored	underexplored	ADJ
brj-24894	4	66	.	.	PUNCT
brj-24894	5	1	in	in	ADP
brj-24894	5	2	this	this	DET
brj-24894	5	3	study	study	NOUN
brj-24894	5	4	,	,	PUNCT
brj-24894	5	5	tpcel12a	tpcel12a	NOUN
brj-24894	5	6	,	,	PUNCT
brj-24894	5	7	a	a	DET
brj-24894	5	8	novel	novel	ADJ
brj-24894	5	9	gh12	gh12	PROPN
brj-24894	5	10	endoglucanase	endoglucanase	VERB
brj-24894	5	11	from	from	ADP
brj-24894	5	12	talaromyces	talaromyce	NOUN
brj-24894	5	13	pinophilus	pinophilus	ADJ
brj-24894	5	14	y117	y117	NUM
brj-24894	5	15	was	be	AUX
brj-24894	5	16	identified	identify	VERB
brj-24894	5	17	and	and	CCONJ
brj-24894	5	18	characterized	characterize	VERB
brj-24894	5	19	.	.	PUNCT
brj-24894	6	1	it	it	PRON
brj-24894	6	2	exhibited	exhibit	VERB
brj-24894	6	3	optimal	optimal	ADJ
brj-24894	6	4	activity	activity	NOUN
brj-24894	6	5	at	at	ADP
brj-24894	6	6	ph	ph	PROPN
brj-24894	6	7	4.0	4.0	NUM
brj-24894	6	8	and	and	CCONJ
brj-24894	6	9	40	40	NUM
brj-24894	6	10	°	°	NOUN
brj-24894	6	11	c	c	NOUN
brj-24894	6	12	with	with	ADP
brj-24894	6	13	a	a	DET
brj-24894	6	14	preference	preference	NOUN
brj-24894	6	15	for	for	ADP
brj-24894	6	16	xyloglucan	xyloglucan	ADJ
brj-24894	6	17	.	.	PUNCT
brj-24894	7	1	size	size	NOUN
brj-24894	7	2	exclusion	exclusion	NOUN
brj-24894	7	3	chromatography	chromatography	NOUN
brj-24894	7	4	revealed	reveal	VERB
brj-24894	7	5	a	a	DET
brj-24894	7	6	monomeric	monomeric	ADJ
brj-24894	7	7	state	state	NOUN
brj-24894	7	8	of	of	ADP
brj-24894	7	9	tpcel12a	tpcel12a	NOUN
brj-24894	7	10	.	.	PUNCT
brj-24894	8	1	despite	despite	SCONJ
brj-24894	8	2	classification	classification	NOUN
brj-24894	8	3	into	into	ADP
brj-24894	8	4	the	the	DET
brj-24894	8	5	promiscuous	promiscuous	ADJ
brj-24894	8	6	subfamily	subfamily	NOUN
brj-24894	8	7	i	i	PRON
brj-24894	8	8	,	,	PUNCT
brj-24894	8	9	tpcel12a	tpcel12a	PROPN
brj-24894	8	10	showed	show	VERB
brj-24894	8	11	strict	strict	ADJ
brj-24894	8	12	specificity	specificity	NOUN
brj-24894	8	13	for	for	ADP
brj-24894	8	14	xyloglucan	xyloglucan	NOUN
brj-24894	8	15	and	and	CCONJ
brj-24894	8	16	carboxymethyl	carboxymethyl	NOUN
brj-24894	8	17	cellulose	cellulose	NOUN
brj-24894	8	18	,	,	PUNCT
brj-24894	8	19	yielding	yield	VERB
brj-24894	8	20	xxxg	xxxg	NOUN
brj-24894	8	21	-	-	PUNCT
brj-24894	8	22	type	type	NOUN
brj-24894	8	23	oligosaccharides	oligosaccharide	NOUN
brj-24894	8	24	and	and	CCONJ
brj-24894	8	25	glucose	glucose	NOUN
brj-24894	8	26	/	/	SYM
brj-24894	8	27	cellobiose	cellobiose	NOUN
brj-24894	8	28	,	,	PUNCT
brj-24894	8	29	respectively	respectively	ADV
brj-24894	8	30	.	.	PUNCT
brj-24894	9	1	a	a	DET
brj-24894	9	2	loop	loop	NOUN
brj-24894	9	3	3	3	NUM
brj-24894	9	4	insertion	insertion	NOUN
brj-24894	9	5	mutant	mutant	NOUN
brj-24894	9	6	,	,	PUNCT
brj-24894	9	7	designated	designate	VERB
brj-24894	9	8	as	as	ADP
brj-24894	9	9	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	9	10	)	)	PUNCT
brj-24894	9	11	,	,	PUNCT
brj-24894	9	12	enhanced	enhance	VERB
brj-24894	9	13	substrate	substrate	NOUN
brj-24894	9	14	affinity	affinity	NOUN
brj-24894	9	15	(	(	PUNCT
brj-24894	9	16	5	5	NUM
brj-24894	9	17	-	-	ADJ
brj-24894	9	18	fold	fold	ADJ
brj-24894	9	19	lower	low	ADJ
brj-24894	9	20	km	km	NOUN
brj-24894	9	21	)	)	PUNCT
brj-24894	9	22	but	but	CCONJ
brj-24894	9	23	reduced	reduced	ADJ
brj-24894	9	24	activity	activity	NOUN
brj-24894	9	25	,	,	PUNCT
brj-24894	9	26	suggesting	suggest	VERB
brj-24894	9	27	a	a	DET
brj-24894	9	28	trade	trade	NOUN
brj-24894	9	29	-	-	PUNCT
brj-24894	9	30	off	off	NOUN
brj-24894	9	31	between	between	ADP
brj-24894	9	32	binding	bind	VERB
brj-24894	9	33	and	and	CCONJ
brj-24894	9	34	catalysis	catalysis	NOUN
brj-24894	9	35	.	.	PUNCT
brj-24894	10	1	surprisingly	surprisingly	ADV
brj-24894	10	2	,	,	PUNCT
brj-24894	10	3	tpcel12a	tpcel12a	VERB
brj-24894	10	4	inhibited	inhibit	VERB
brj-24894	10	5	the	the	DET
brj-24894	10	6	hydrolytic	hydrolytic	ADJ
brj-24894	10	7	efficiency	efficiency	NOUN
brj-24894	10	8	of	of	ADP
brj-24894	10	9	native	native	ADJ
brj-24894	10	10	t.	t.	PROPN
brj-24894	10	11	pinophilus	pinophilus	ADJ
brj-24894	10	12	crude	crude	ADJ
brj-24894	10	13	cellulase	cellulase	NOUN
brj-24894	10	14	on	on	ADP
brj-24894	10	15	corn	corn	NOUN
brj-24894	10	16	cob	cob	NOUN
brj-24894	10	17	powder	powder	NOUN
brj-24894	10	18	,	,	PUNCT
brj-24894	10	19	coinciding	coincide	VERB
brj-24894	10	20	with	with	ADP
brj-24894	10	21	its	its	PRON
brj-24894	10	22	undetectable	undetectable	ADJ
brj-24894	10	23	secretion	secretion	NOUN
brj-24894	10	24	under	under	ADP
brj-24894	10	25	microcrystalline	microcrystalline	NOUN
brj-24894	10	26	cellulose	cellulose	NOUN
brj-24894	10	27	induction	induction	NOUN
brj-24894	10	28	.	.	PUNCT
brj-24894	11	1	this	this	DET
brj-24894	11	2	study	study	NOUN
brj-24894	11	3	highlights	highlight	NOUN
brj-24894	11	4	tpcel12a	tpcel12a	VERB
brj-24894	11	5	’s	’s	PART
brj-24894	11	6	unique	unique	ADJ
brj-24894	11	7	biochemical	biochemical	ADJ
brj-24894	11	8	properties	property	NOUN
brj-24894	11	9	and	and	CCONJ
brj-24894	11	10	its	its	PRON
brj-24894	11	11	unexpected	unexpected	ADJ
brj-24894	11	12	antagonistic	antagonistic	ADJ
brj-24894	11	13	role	role	NOUN
brj-24894	11	14	in	in	ADP
brj-24894	11	15	native	native	ADJ
brj-24894	11	16	cellulase	cellulase	NOUN
brj-24894	11	17	systems	system	NOUN
brj-24894	11	18	,	,	PUNCT
brj-24894	11	19	offering	offer	VERB
brj-24894	11	20	insights	insight	NOUN
brj-24894	11	21	for	for	ADP
brj-24894	11	22	engineering	engineer	VERB
brj-24894	11	23	fungal	fungal	ADJ
brj-24894	11	24	enzyme	enzyme	NOUN
brj-24894	11	25	cocktails	cocktail	NOUN
brj-24894	11	26	.	.	PUNCT
brj-24894	12	1	doi	doi	NOUN
brj-24894	12	2	:	:	PUNCT
brj-24894	12	3	10.15376	10.15376	NUM
brj-24894	12	4	/	/	SYM
brj-24894	12	5	biores.21.1.547	biores.21.1.547	NOUN
brj-24894	12	6	-	-	PUNCT
brj-24894	12	7	569	569	NUM
brj-24894	12	8	keywords	keyword	NOUN
brj-24894	12	9	:	:	PUNCT
brj-24894	12	10	gh12	gh12	PROPN
brj-24894	12	11	endoglucanase	endoglucanase	VERB
brj-24894	12	12	;	;	PUNCT
brj-24894	12	13	talaromyces	talaromyce	NOUN
brj-24894	12	14	pinophilus	pinophilus	NOUN
brj-24894	12	15	;	;	PUNCT
brj-24894	12	16	enzyme	enzyme	NOUN
brj-24894	12	17	inhibition	inhibition	NOUN
brj-24894	12	18	;	;	PUNCT
brj-24894	12	19	loop	loop	NOUN
brj-24894	12	20	3	3	NUM
brj-24894	12	21	mutation	mutation	NOUN
brj-24894	12	22	;	;	PUNCT
brj-24894	12	23	lignocellulose	lignocellulose	VERB
brj-24894	12	24	degradation	degradation	NOUN
brj-24894	12	25	contact	contact	NOUN
brj-24894	12	26	information	information	NOUN
brj-24894	12	27	:	:	PUNCT
brj-24894	12	28	institute	institute	NOUN
brj-24894	12	29	of	of	ADP
brj-24894	12	30	microbiology	microbiology	NOUN
brj-24894	12	31	,	,	PUNCT
brj-24894	12	32	jiangxi	jiangxi	PROPN
brj-24894	12	33	academy	academy	PROPN
brj-24894	12	34	of	of	ADP
brj-24894	12	35	sciences	sciences	PROPN
brj-24894	12	36	,	,	PUNCT
brj-24894	12	37	jiangxi	jiangxi	PROPN
brj-24894	12	38	,	,	PUNCT
brj-24894	12	39	nanchang	nanchang	PROPN
brj-24894	12	40	,	,	PUNCT
brj-24894	12	41	china	china	PROPN
brj-24894	12	42	;	;	PUNCT
brj-24894	12	43	#	#	NOUN
brj-24894	12	44	these	these	DET
brj-24894	12	45	authors	author	NOUN
brj-24894	12	46	contribute	contribute	VERB
brj-24894	12	47	equally	equally	ADV
brj-24894	12	48	to	to	ADP
brj-24894	12	49	the	the	DET
brj-24894	12	50	article	article	NOUN
brj-24894	12	51	;	;	PUNCT
brj-24894	12	52	*	*	PUNCT
brj-24894	12	53	corresponding	correspond	VERB
brj-24894	12	54	author	author	NOUN
brj-24894	12	55	:	:	PUNCT
brj-24894	12	56	yuanlin2003cn@aliyun.com	yuanlin2003cn@aliyun.com	PROPN
brj-24894	12	57	introduction	introduction	NOUN
brj-24894	12	58	lignocellulosic	lignocellulosic	ADJ
brj-24894	12	59	biomass	biomass	NOUN
brj-24894	12	60	,	,	PUNCT
brj-24894	12	61	such	such	ADJ
brj-24894	12	62	as	as	ADP
brj-24894	12	63	forestry	forestry	NOUN
brj-24894	12	64	residues	residue	NOUN
brj-24894	12	65	(	(	PUNCT
brj-24894	12	66	cotana	cotana	ADV
brj-24894	12	67	et	et	PROPN
brj-24894	12	68	al	al	PROPN
brj-24894	12	69	.	.	PROPN
brj-24894	12	70	2014	2014	NUM
brj-24894	12	71	)	)	PUNCT
brj-24894	12	72	and	and	CCONJ
brj-24894	12	73	agricultural	agricultural	ADJ
brj-24894	12	74	waste	waste	NOUN
brj-24894	12	75	(	(	PUNCT
brj-24894	12	76	yuan	yuan	NOUN
brj-24894	12	77	et	et	PROPN
brj-24894	12	78	al	al	PROPN
brj-24894	12	79	.	.	PROPN
brj-24894	12	80	2018	2018	NUM
brj-24894	12	81	)	)	PUNCT
brj-24894	12	82	,	,	PUNCT
brj-24894	12	83	represents	represent	VERB
brj-24894	12	84	the	the	DET
brj-24894	12	85	most	most	ADV
brj-24894	12	86	abundant	abundant	ADJ
brj-24894	12	87	renewable	renewable	ADJ
brj-24894	12	88	organic	organic	ADJ
brj-24894	12	89	resource	resource	NOUN
brj-24894	12	90	on	on	ADP
brj-24894	12	91	earth	earth	NOUN
brj-24894	12	92	(	(	PUNCT
brj-24894	12	93	saldarriaga	saldarriaga	PROPN
brj-24894	12	94	-	-	PUNCT
brj-24894	12	95	hernández	hernández	PROPN
brj-24894	12	96	et	et	PROPN
brj-24894	12	97	al	al	PROPN
brj-24894	12	98	.	.	PROPN
brj-24894	12	99	2020	2020	NUM
brj-24894	12	100	)	)	PUNCT
brj-24894	12	101	.	.	PUNCT
brj-24894	13	1	lignocellulosic	lignocellulosic	ADJ
brj-24894	13	2	biomass	biomass	NOUN
brj-24894	13	3	is	be	AUX
brj-24894	13	4	mainly	mainly	ADV
brj-24894	13	5	composed	compose	VERB
brj-24894	13	6	of	of	ADP
brj-24894	13	7	cellulose	cellulose	NOUN
brj-24894	13	8	,	,	PUNCT
brj-24894	13	9	hemicellulose	hemicellulose	NOUN
brj-24894	13	10	(	(	PUNCT
brj-24894	13	11	including	include	VERB
brj-24894	13	12	xyloglucan	xyloglucan	NOUN
brj-24894	13	13	and	and	CCONJ
brj-24894	13	14	xylan	xylan	PROPN
brj-24894	13	15	)	)	PUNCT
brj-24894	13	16	,	,	PUNCT
brj-24894	13	17	and	and	CCONJ
brj-24894	13	18	lignin	lignin	NOUN
brj-24894	13	19	,	,	PUNCT
brj-24894	13	20	with	with	ADP
brj-24894	13	21	cellulose	cellulose	NOUN
brj-24894	13	22	being	be	AUX
brj-24894	13	23	the	the	DET
brj-24894	13	24	most	most	ADV
brj-24894	13	25	abundant	abundant	ADJ
brj-24894	13	26	,	,	PUNCT
brj-24894	13	27	representing	represent	VERB
brj-24894	13	28	about	about	ADP
brj-24894	13	29	40	40	NUM
brj-24894	13	30	%	%	NOUN
brj-24894	13	31	to	to	PART
brj-24894	13	32	60	60	NUM
brj-24894	13	33	%	%	NOUN
brj-24894	13	34	in	in	ADP
brj-24894	13	35	weight	weight	NOUN
brj-24894	13	36	(	(	PUNCT
brj-24894	13	37	sharma	sharma	PROPN
brj-24894	13	38	et	et	PROPN
brj-24894	13	39	al	al	PROPN
brj-24894	13	40	.	.	PROPN
brj-24894	13	41	2019	2019	NUM
brj-24894	13	42	)	)	PUNCT
brj-24894	13	43	.	.	PUNCT
brj-24894	14	1	cellulose	cellulose	NOUN
brj-24894	14	2	is	be	AUX
brj-24894	14	3	a	a	DET
brj-24894	14	4	linear	linear	ADJ
brj-24894	14	5	polymer	polymer	NOUN
brj-24894	14	6	with	with	ADP
brj-24894	14	7	d	d	NOUN
brj-24894	14	8	-	-	NOUN
brj-24894	14	9	glucose	glucose	NOUN
brj-24894	14	10	as	as	ADP
brj-24894	14	11	its	its	PRON
brj-24894	14	12	monomeric	monomeric	ADJ
brj-24894	14	13	unit	unit	NOUN
brj-24894	14	14	linked	link	VERB
brj-24894	14	15	by	by	ADP
brj-24894	14	16	β1,4	β1,4	ADJ
brj-24894	14	17	-	-	PUNCT
brj-24894	14	18	glycosidic	glycosidic	ADJ
brj-24894	14	19	bonds	bond	NOUN
brj-24894	14	20	.	.	PUNCT
brj-24894	15	1	in	in	ADP
brj-24894	15	2	fungi	fungi	PROPN
brj-24894	15	3	,	,	PUNCT
brj-24894	15	4	typical	typical	ADJ
brj-24894	15	5	cellulose	cellulose	NOUN
brj-24894	15	6	degradation	degradation	NOUN
brj-24894	15	7	is	be	AUX
brj-24894	15	8	thought	think	VERB
brj-24894	15	9	to	to	PART
brj-24894	15	10	be	be	AUX
brj-24894	15	11	accomplished	accomplish	VERB
brj-24894	15	12	by	by	ADP
brj-24894	15	13	an	an	DET
brj-24894	15	14	enzymatic	enzymatic	ADJ
brj-24894	15	15	cocktail	cocktail	NOUN
brj-24894	15	16	,	,	PUNCT
brj-24894	15	17	collectively	collectively	ADV
brj-24894	15	18	referred	refer	VERB
brj-24894	15	19	to	to	ADP
brj-24894	15	20	as	as	ADP
brj-24894	15	21	cellulase	cellulase	NOUN
brj-24894	15	22	,	,	PUNCT
brj-24894	15	23	in	in	ADP
brj-24894	15	24	a	a	DET
brj-24894	15	25	synergistic	synergistic	ADJ
brj-24894	15	26	manner	manner	NOUN
brj-24894	15	27	.	.	PUNCT
brj-24894	16	1	cellulase	cellulase	NOUN
brj-24894	16	2	consists	consist	VERB
brj-24894	16	3	of	of	ADP
brj-24894	16	4	three	three	NUM
brj-24894	16	5	major	major	ADJ
brj-24894	16	6	types	type	NOUN
brj-24894	16	7	of	of	ADP
brj-24894	16	8	enzymes	enzyme	NOUN
brj-24894	16	9	:	:	PUNCT
brj-24894	16	10	cellobiohydrolases	cellobiohydrolase	NOUN
brj-24894	16	11	(	(	PUNCT
brj-24894	16	12	cbhs	cbhs	PROPN
brj-24894	16	13	,	,	PUNCT
brj-24894	16	14	cbh	cbh	PROPN
brj-24894	17	1	i	i	PRON
brj-24894	17	2	:	:	PUNCT
brj-24894	17	3	ec	ec	PROPN
brj-24894	17	4	3.2.1.91	3.2.1.91	NUM
brj-24894	17	5	and	and	CCONJ
brj-24894	17	6	cbh	cbh	PROPN
brj-24894	17	7	ii	ii	PROPN
brj-24894	17	8	:	:	PUNCT
brj-24894	17	9	ec	ec	PROPN
brj-24894	17	10	3.2.1.176	3.2.1.176	PROPN
brj-24894	17	11	)	)	PUNCT
brj-24894	17	12	,	,	PUNCT
brj-24894	17	13	which	which	PRON
brj-24894	17	14	cleave	cleave	VERB
brj-24894	17	15	cellulose	cellulose	NOUN
brj-24894	17	16	from	from	ADP
brj-24894	17	17	the	the	DET
brj-24894	17	18	reducing	reducing	NOUN
brj-24894	17	19	and	and	CCONJ
brj-24894	17	20	nonreducing	nonreduce	VERB
brj-24894	17	21	ends	end	NOUN
brj-24894	17	22	,	,	PUNCT
brj-24894	17	23	respectively	respectively	ADV
brj-24894	17	24	,	,	PUNCT
brj-24894	17	25	resulting	result	VERB
brj-24894	17	26	in	in	ADP
brj-24894	17	27	the	the	DET
brj-24894	17	28	release	release	NOUN
brj-24894	17	29	of	of	ADP
brj-24894	17	30	cellobiose	cellobiose	NOUN
brj-24894	17	31	;	;	PUNCT
brj-24894	17	32	endo	endo	NOUN
brj-24894	17	33	-	-	PUNCT
brj-24894	17	34	β-1,4	β-1,4	NOUN
brj-24894	17	35	-	-	PUNCT
brj-24894	17	36	glucanases	glucanase	NOUN
brj-24894	17	37	(	(	PUNCT
brj-24894	17	38	ec	ec	PROPN
brj-24894	17	39	3.2.1.4	3.2.1.4	NUM
brj-24894	17	40	)	)	PUNCT
brj-24894	17	41	,	,	PUNCT
brj-24894	17	42	which	which	PRON
brj-24894	17	43	randomly	randomly	ADV
brj-24894	17	44	cleave	cleave	VERB
brj-24894	17	45	the	the	DET
brj-24894	17	46	internal	internal	ADJ
brj-24894	17	47	bonds	bond	NOUN
brj-24894	17	48	of	of	ADP
brj-24894	17	49	cellulose	cellulose	NOUN
brj-24894	17	50	;	;	PUNCT
brj-24894	17	51	and	and	CCONJ
brj-24894	18	1	β	β	X
brj-24894	18	2	-	-	NOUN
brj-24894	18	3	glucosidases	glucosidase	NOUN
brj-24894	18	4	https://orcid.org/0000-0002-4692-9611	https://orcid.org/0000-0002-4692-9611	NOUN
brj-24894	18	5	https://orcid.org/0009-0008-9645-9831	https://orcid.org/0009-0008-9645-9831	ADP
brj-24894	18	6	peer	peer	NOUN
brj-24894	18	7	-	-	PUNCT
brj-24894	18	8	reviewed	review	VERB
brj-24894	18	9	article	article	NOUN
brj-24894	18	10	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	18	11	li	li	PROPN
brj-24894	18	12	et	et	PROPN
brj-24894	18	13	al	al	PROPN
brj-24894	18	14	.	.	PROPN
brj-24894	19	1	(	(	PUNCT
brj-24894	19	2	2026	2026	NUM
brj-24894	19	3	)	)	PUNCT
brj-24894	19	4	.	.	PUNCT
brj-24894	20	1	“	"	PUNCT
brj-24894	20	2	endoglucanase	endoglucanase	VERB
brj-24894	20	3	tpcel12a	tpcel12a	NOUN
brj-24894	20	4	traits	trait	NOUN
brj-24894	20	5	,	,	PUNCT
brj-24894	20	6	”	"	PUNCT
brj-24894	20	7	bioresources	bioresource	NOUN
brj-24894	20	8	21(1	21(1	NUM
brj-24894	20	9	)	)	PUNCT
brj-24894	20	10	,	,	PUNCT
brj-24894	20	11	547	547	NUM
brj-24894	20	12	-	-	SYM
brj-24894	20	13	569	569	NUM
brj-24894	20	14	.	.	NOUN
brj-24894	21	1	548	548	NUM
brj-24894	21	2	(	(	PUNCT
brj-24894	21	3	ec	ec	PROPN
brj-24894	21	4	3.2.1.21	3.2.1.21	PROPN
brj-24894	21	5	)	)	PUNCT
brj-24894	21	6	,	,	PUNCT
brj-24894	21	7	which	which	PRON
brj-24894	21	8	hydrolyze	hydrolyze	VERB
brj-24894	21	9	cellobiose	cellobiose	VERB
brj-24894	21	10	,	,	PUNCT
brj-24894	21	11	resulting	result	VERB
brj-24894	21	12	in	in	ADP
brj-24894	21	13	the	the	DET
brj-24894	21	14	release	release	NOUN
brj-24894	21	15	of	of	ADP
brj-24894	21	16	glucose	glucose	NOUN
brj-24894	21	17	monomers	monomer	NOUN
brj-24894	21	18	(	(	PUNCT
brj-24894	21	19	ohmiya	ohmiya	NOUN
brj-24894	21	20	et	et	PROPN
brj-24894	21	21	al	al	PROPN
brj-24894	21	22	.	.	PROPN
brj-24894	21	23	1997	1997	NUM
brj-24894	21	24	)	)	PUNCT
brj-24894	21	25	.	.	PUNCT
brj-24894	22	1	in	in	ADP
brj-24894	22	2	addition	addition	NOUN
brj-24894	22	3	to	to	ADP
brj-24894	22	4	cellulase	cellulase	VERB
brj-24894	22	5	,	,	PUNCT
brj-24894	22	6	lytic	lytic	ADJ
brj-24894	22	7	polysaccharide	polysaccharide	NOUN
brj-24894	22	8	monooxygenases	monooxygenase	NOUN
brj-24894	22	9	(	(	PUNCT
brj-24894	22	10	lpmos	lpmos	PROPN
brj-24894	22	11	)	)	PUNCT
brj-24894	22	12	from	from	ADP
brj-24894	22	13	auxiliary	auxiliary	ADJ
brj-24894	22	14	activity	activity	NOUN
brj-24894	22	15	families	family	NOUN
brj-24894	22	16	9	9	NUM
brj-24894	22	17	and	and	CCONJ
brj-24894	22	18	10	10	NUM
brj-24894	22	19	(	(	PUNCT
brj-24894	22	20	aa9	aa9	NOUN
brj-24894	22	21	and	and	CCONJ
brj-24894	22	22	aa10	aa10	PROPN
brj-24894	22	23	)	)	PUNCT
brj-24894	22	24	have	have	AUX
brj-24894	22	25	been	be	AUX
brj-24894	22	26	demonstrated	demonstrate	VERB
brj-24894	22	27	to	to	PART
brj-24894	22	28	boost	boost	VERB
brj-24894	22	29	cellulase	cellulase	NOUN
brj-24894	22	30	activity	activity	NOUN
brj-24894	22	31	by	by	ADP
brj-24894	22	32	deconstructing	deconstruct	VERB
brj-24894	22	33	cellulose	cellulose	NOUN
brj-24894	22	34	(	(	PUNCT
brj-24894	22	35	villares	villare	NOUN
brj-24894	22	36	et	et	PROPN
brj-24894	22	37	al	al	PROPN
brj-24894	22	38	.	.	PROPN
brj-24894	22	39	2017	2017	NUM
brj-24894	22	40	;	;	PUNCT
brj-24894	22	41	guo	guo	PROPN
brj-24894	22	42	et	et	PROPN
brj-24894	22	43	al	al	PROPN
brj-24894	22	44	.	.	PROPN
brj-24894	22	45	2022	2022	NUM
brj-24894	22	46	)	)	PUNCT
brj-24894	22	47	.	.	PUNCT
brj-24894	23	1	it	it	PRON
brj-24894	23	2	has	have	AUX
brj-24894	23	3	been	be	AUX
brj-24894	23	4	shown	show	VERB
brj-24894	23	5	that	that	SCONJ
brj-24894	23	6	cellulases	cellulase	NOUN
brj-24894	23	7	with	with	ADP
brj-24894	23	8	endoglucanases	endoglucanase	NOUN
brj-24894	23	9	as	as	SCONJ
brj-24894	23	10	the	the	DET
brj-24894	23	11	major	major	ADJ
brj-24894	23	12	component	component	NOUN
brj-24894	23	13	have	have	VERB
brj-24894	23	14	diverse	diverse	ADJ
brj-24894	23	15	industrial	industrial	ADJ
brj-24894	23	16	applications	application	NOUN
brj-24894	23	17	,	,	PUNCT
brj-24894	23	18	such	such	ADJ
brj-24894	23	19	as	as	ADP
brj-24894	23	20	in	in	ADP
brj-24894	23	21	cotton	cotton	NOUN
brj-24894	23	22	and	and	CCONJ
brj-24894	23	23	fruit	fruit	NOUN
brj-24894	23	24	juice	juice	NOUN
brj-24894	23	25	processing	processing	NOUN
brj-24894	23	26	(	(	PUNCT
brj-24894	23	27	sharma	sharma	PROPN
brj-24894	23	28	et	et	PROPN
brj-24894	23	29	al	al	PROPN
brj-24894	23	30	.	.	PROPN
brj-24894	23	31	2017	2017	NUM
brj-24894	23	32	)	)	PUNCT
brj-24894	23	33	,	,	PUNCT
brj-24894	23	34	brewing	brewing	NOUN
brj-24894	23	35	and	and	CCONJ
brj-24894	23	36	oil	oil	NOUN
brj-24894	23	37	extraction	extraction	NOUN
brj-24894	23	38	(	(	PUNCT
brj-24894	23	39	ejaz	ejaz	PROPN
brj-24894	23	40	et	et	PROPN
brj-24894	23	41	al	al	PROPN
brj-24894	23	42	.	.	PROPN
brj-24894	23	43	2021	2021	NUM
brj-24894	23	44	)	)	PUNCT
brj-24894	23	45	.	.	PUNCT
brj-24894	24	1	importantly	importantly	ADV
brj-24894	24	2	,	,	PUNCT
brj-24894	24	3	endoglucanases	endoglucanase	NOUN
brj-24894	24	4	play	play	VERB
brj-24894	24	5	a	a	DET
brj-24894	24	6	vital	vital	ADJ
brj-24894	24	7	role	role	NOUN
brj-24894	24	8	in	in	ADP
brj-24894	24	9	the	the	DET
brj-24894	24	10	bioconversion	bioconversion	NOUN
brj-24894	24	11	of	of	ADP
brj-24894	24	12	cellulosic	cellulosic	NOUN
brj-24894	24	13	biomass	biomass	NOUN
brj-24894	24	14	into	into	ADP
brj-24894	24	15	fermentable	fermentable	ADJ
brj-24894	24	16	sugars	sugar	NOUN
brj-24894	24	17	(	(	PUNCT
brj-24894	24	18	periyasamy	periyasamy	NOUN
brj-24894	24	19	et	et	PROPN
brj-24894	24	20	al	al	PROPN
brj-24894	24	21	.	.	PROPN
brj-24894	24	22	2023	2023	NUM
brj-24894	24	23	)	)	PUNCT
brj-24894	24	24	,	,	PUNCT
brj-24894	24	25	which	which	PRON
brj-24894	24	26	can	can	AUX
brj-24894	24	27	be	be	AUX
brj-24894	24	28	further	far	ADV
brj-24894	24	29	used	use	VERB
brj-24894	24	30	to	to	PART
brj-24894	24	31	produce	produce	VERB
brj-24894	24	32	bioethanol	bioethanol	NOUN
brj-24894	24	33	.	.	PUNCT
brj-24894	25	1	therefore	therefore	ADV
brj-24894	25	2	,	,	PUNCT
brj-24894	25	3	there	there	PRON
brj-24894	25	4	has	have	AUX
brj-24894	25	5	been	be	AUX
brj-24894	25	6	a	a	DET
brj-24894	25	7	growing	grow	VERB
brj-24894	25	8	demand	demand	NOUN
brj-24894	25	9	for	for	ADP
brj-24894	25	10	endoglucanases	endoglucanase	NOUN
brj-24894	25	11	in	in	ADP
brj-24894	25	12	recent	recent	ADJ
brj-24894	25	13	years	year	NOUN
brj-24894	25	14	.	.	PUNCT
brj-24894	26	1	currently	currently	ADV
brj-24894	26	2	,	,	PUNCT
brj-24894	26	3	endoglucanases	endoglucanase	NOUN
brj-24894	26	4	are	be	AUX
brj-24894	26	5	mainly	mainly	ADV
brj-24894	26	6	produced	produce	VERB
brj-24894	26	7	by	by	ADP
brj-24894	26	8	cellulolytic	cellulolytic	ADJ
brj-24894	26	9	microorganisms	microorganism	NOUN
brj-24894	26	10	,	,	PUNCT
brj-24894	26	11	especially	especially	ADV
brj-24894	26	12	fungi	fungus	NOUN
brj-24894	26	13	,	,	PUNCT
brj-24894	26	14	such	such	ADJ
brj-24894	26	15	as	as	ADP
brj-24894	26	16	fomitopsis	fomitopsis	NOUN
brj-24894	26	17	species	specie	NOUN
brj-24894	26	18	(	(	PUNCT
brj-24894	26	19	patel	patel	NOUN
brj-24894	26	20	and	and	CCONJ
brj-24894	26	21	shah	shah	NOUN
brj-24894	26	22	2021	2021	NUM
brj-24894	26	23	)	)	PUNCT
brj-24894	26	24	,	,	PUNCT
brj-24894	26	25	aspergillus	aspergillus	NOUN
brj-24894	26	26	species	specie	NOUN
brj-24894	26	27	(	(	PUNCT
brj-24894	26	28	dobrev	dobrev	PROPN
brj-24894	26	29	and	and	CCONJ
brj-24894	26	30	zhekova	zhekova	PROPN
brj-24894	26	31	2012	2012	NUM
brj-24894	26	32	)	)	PUNCT
brj-24894	26	33	,	,	PUNCT
brj-24894	26	34	fusarium	fusarium	NOUN
brj-24894	26	35	species	specie	NOUN
brj-24894	26	36	(	(	PUNCT
brj-24894	26	37	de	de	PROPN
brj-24894	26	38	almeida	almeida	PROPN
brj-24894	26	39	et	et	PROPN
brj-24894	26	40	al	al	PROPN
brj-24894	26	41	.	.	PROPN
brj-24894	26	42	2013	2013	NUM
brj-24894	26	43	)	)	PUNCT
brj-24894	26	44	,	,	PUNCT
brj-24894	26	45	gloeophyllum	gloeophyllum	ADJ
brj-24894	26	46	species	specie	NOUN
brj-24894	26	47	(	(	PUNCT
brj-24894	26	48	cohen	cohen	PROPN
brj-24894	26	49	et	et	PROPN
brj-24894	26	50	al	al	PROPN
brj-24894	26	51	.	.	PROPN
brj-24894	26	52	2005	2005	NUM
brj-24894	26	53	)	)	PUNCT
brj-24894	26	54	,	,	PUNCT
brj-24894	26	55	and	and	CCONJ
brj-24894	26	56	trichoderma	trichoderma	PROPN
brj-24894	26	57	species	specie	NOUN
brj-24894	26	58	(	(	PUNCT
brj-24894	26	59	zheng	zheng	X
brj-24894	26	60	et	et	PROPN
brj-24894	26	61	al	al	PROPN
brj-24894	26	62	.	.	PROPN
brj-24894	26	63	2024	2024	NUM
brj-24894	26	64	)	)	PUNCT
brj-24894	26	65	.	.	PUNCT
brj-24894	27	1	among	among	ADP
brj-24894	27	2	these	these	PRON
brj-24894	27	3	,	,	PUNCT
brj-24894	27	4	trichoderma	trichoderma	X
brj-24894	27	5	reesei	reesei	PROPN
brj-24894	27	6	has	have	AUX
brj-24894	27	7	been	be	AUX
brj-24894	27	8	the	the	DET
brj-24894	27	9	predominant	predominant	ADJ
brj-24894	27	10	cellulase	cellulase	NOUN
brj-24894	27	11	producer	producer	NOUN
brj-24894	27	12	for	for	ADP
brj-24894	27	13	industrial	industrial	ADJ
brj-24894	27	14	applications	application	NOUN
brj-24894	27	15	over	over	ADP
brj-24894	27	16	the	the	DET
brj-24894	27	17	past	past	ADJ
brj-24894	27	18	decades	decade	NOUN
brj-24894	27	19	.	.	PUNCT
brj-24894	28	1	endoglucanases	endoglucanase	NOUN
brj-24894	28	2	are	be	AUX
brj-24894	28	3	grouped	group	VERB
brj-24894	28	4	into	into	ADP
brj-24894	28	5	various	various	ADJ
brj-24894	28	6	glycoside	glycoside	NOUN
brj-24894	28	7	hydrolase	hydrolase	NOUN
brj-24894	28	8	families	family	NOUN
brj-24894	28	9	based	base	VERB
brj-24894	28	10	on	on	ADP
brj-24894	28	11	amino	amino	NOUN
brj-24894	28	12	acid	acid	NOUN
brj-24894	28	13	sequence	sequence	NOUN
brj-24894	28	14	similarity	similarity	NOUN
brj-24894	28	15	and	and	CCONJ
brj-24894	28	16	mode	mode	NOUN
brj-24894	28	17	of	of	ADP
brj-24894	28	18	action	action	NOUN
brj-24894	28	19	in	in	ADP
brj-24894	28	20	the	the	DET
brj-24894	28	21	cazy	cazy	ADJ
brj-24894	28	22	database	database	NOUN
brj-24894	28	23	(	(	PUNCT
brj-24894	28	24	drula	drula	ADP
brj-24894	28	25	et	et	PROPN
brj-24894	28	26	al	al	PROPN
brj-24894	28	27	.	.	PROPN
brj-24894	28	28	2022	2022	NUM
brj-24894	28	29	)	)	PUNCT
brj-24894	28	30	,	,	PUNCT
brj-24894	28	31	including	include	VERB
brj-24894	28	32	gh5	gh5	PROPN
brj-24894	28	33	,	,	PUNCT
brj-24894	28	34	gh6	gh6	NOUN
brj-24894	28	35	,	,	PUNCT
brj-24894	28	36	gh7	gh7	NOUN
brj-24894	28	37	,	,	PUNCT
brj-24894	28	38	gh8	gh8	NOUN
brj-24894	28	39	,	,	PUNCT
brj-24894	28	40	gh9	gh9	PROPN
brj-24894	28	41	,	,	PUNCT
brj-24894	28	42	gh10	gh10	PROPN
brj-24894	28	43	,	,	PUNCT
brj-24894	28	44	gh12	gh12	PROPN
brj-24894	28	45	,	,	PUNCT
brj-24894	28	46	gh26	gh26	PROPN
brj-24894	28	47	,	,	PUNCT
brj-24894	28	48	gh44	gh44	PROPN
brj-24894	28	49	,	,	PUNCT
brj-24894	28	50	gh45	gh45	PROPN
brj-24894	28	51	,	,	PUNCT
brj-24894	28	52	gh48	gh48	PROPN
brj-24894	28	53	,	,	PUNCT
brj-24894	28	54	gh51	gh51	PROPN
brj-24894	28	55	,	,	PUNCT
brj-24894	28	56	gh74	gh74	PROPN
brj-24894	28	57	,	,	PUNCT
brj-24894	28	58	and	and	CCONJ
brj-24894	28	59	gh124	gh124	PROPN
brj-24894	28	60	.	.	PUNCT
brj-24894	29	1	distinct	distinct	ADJ
brj-24894	29	2	from	from	ADP
brj-24894	29	3	other	other	ADJ
brj-24894	29	4	endoglucanases	endoglucanase	NOUN
brj-24894	29	5	,	,	PUNCT
brj-24894	29	6	all	all	DET
brj-24894	29	7	characterized	characterize	VERB
brj-24894	29	8	gh12	gh12	PROPN
brj-24894	29	9	family	family	NOUN
brj-24894	29	10	members	member	NOUN
brj-24894	29	11	exclusively	exclusively	ADV
brj-24894	29	12	possess	possess	VERB
brj-24894	29	13	a	a	DET
brj-24894	29	14	single	single	ADJ
brj-24894	29	15	catalytic	catalytic	ADJ
brj-24894	29	16	domain	domain	NOUN
brj-24894	29	17	without	without	ADP
brj-24894	29	18	cbm	cbm	PROPN
brj-24894	29	19	,	,	PUNCT
brj-24894	29	20	resulting	result	VERB
brj-24894	29	21	in	in	ADP
brj-24894	29	22	their	their	PRON
brj-24894	29	23	relatively	relatively	ADV
brj-24894	29	24	low	low	ADJ
brj-24894	29	25	molecular	molecular	ADJ
brj-24894	29	26	mass	mass	NOUN
brj-24894	29	27	.	.	PUNCT
brj-24894	30	1	the	the	DET
brj-24894	30	2	relatively	relatively	ADV
brj-24894	30	3	low	low	ADJ
brj-24894	30	4	molecular	molecular	ADJ
brj-24894	30	5	mass	mass	ADJ
brj-24894	30	6	characteristic	characteristic	NOUN
brj-24894	30	7	of	of	ADP
brj-24894	30	8	gh12	gh12	PROPN
brj-24894	30	9	family	family	NOUN
brj-24894	30	10	endoglucanases	endoglucanase	NOUN
brj-24894	30	11	is	be	AUX
brj-24894	30	12	thought	think	VERB
brj-24894	30	13	to	to	PART
brj-24894	30	14	promote	promote	VERB
brj-24894	30	15	their	their	PRON
brj-24894	30	16	diffusion	diffusion	NOUN
brj-24894	30	17	into	into	ADP
brj-24894	30	18	plant	plant	NOUN
brj-24894	30	19	cell	cell	NOUN
brj-24894	30	20	wall	wall	NOUN
brj-24894	30	21	matrices	matrix	NOUN
brj-24894	30	22	,	,	PUNCT
brj-24894	30	23	thereby	thereby	ADV
brj-24894	30	24	improving	improve	VERB
brj-24894	30	25	cellulose	cellulose	NOUN
brj-24894	30	26	depolymerization	depolymerization	NOUN
brj-24894	30	27	(	(	PUNCT
brj-24894	30	28	cohen	cohen	PROPN
brj-24894	30	29	et	et	PROPN
brj-24894	30	30	al	al	PROPN
brj-24894	30	31	.	.	PROPN
brj-24894	30	32	2005	2005	NUM
brj-24894	30	33	;	;	PUNCT
brj-24894	30	34	miotto	miotto	PROPN
brj-24894	30	35	et	et	PROPN
brj-24894	30	36	al	al	PROPN
brj-24894	30	37	.	.	PROPN
brj-24894	30	38	2014	2014	NUM
brj-24894	30	39	)	)	PUNCT
brj-24894	30	40	.	.	PUNCT
brj-24894	31	1	numerous	numerous	ADJ
brj-24894	31	2	gh12	gh12	PROPN
brj-24894	31	3	enzymes	enzyme	NOUN
brj-24894	31	4	have	have	AUX
brj-24894	31	5	been	be	AUX
brj-24894	31	6	identified	identify	VERB
brj-24894	31	7	and	and	CCONJ
brj-24894	31	8	functionally	functionally	ADV
brj-24894	31	9	characterized	characterize	VERB
brj-24894	31	10	,	,	PUNCT
brj-24894	31	11	exhibiting	exhibit	VERB
brj-24894	31	12	diverse	diverse	ADJ
brj-24894	31	13	enzymatic	enzymatic	ADJ
brj-24894	31	14	activities	activity	NOUN
brj-24894	31	15	,	,	PUNCT
brj-24894	31	16	including	include	VERB
brj-24894	31	17	endoglucanase	endoglucanase	PROPN
brj-24894	31	18	(	(	PUNCT
brj-24894	31	19	wang	wang	PROPN
brj-24894	31	20	et	et	PROPN
brj-24894	31	21	al	al	PROPN
brj-24894	31	22	.	.	PROPN
brj-24894	31	23	2017	2017	NUM
brj-24894	31	24	)	)	PUNCT
brj-24894	31	25	,	,	PUNCT
brj-24894	31	26	xyloglucanase	xyloglucanase	PROPN
brj-24894	32	1	(	(	PUNCT
brj-24894	32	2	matsuzawa	matsuzawa	PROPN
brj-24894	32	3	et	et	PROPN
brj-24894	32	4	al	al	PROPN
brj-24894	32	5	.	.	PROPN
brj-24894	32	6	2020	2020	NUM
brj-24894	32	7	)	)	PUNCT
brj-24894	32	8	,	,	PUNCT
brj-24894	32	9	and	and	CCONJ
brj-24894	32	10	β-1,3	β-1,3	PROPN
brj-24894	32	11	-	-	PUNCT
brj-24894	32	12	1,4	1,4	NUM
brj-24894	32	13	-	-	PUNCT
brj-24894	32	14	glucanase	glucanase	ADJ
brj-24894	32	15	activities	activity	NOUN
brj-24894	32	16	(	(	PUNCT
brj-24894	32	17	miotto	miotto	PROPN
brj-24894	32	18	et	et	PROPN
brj-24894	32	19	al	al	PROPN
brj-24894	32	20	.	.	PROPN
brj-24894	32	21	2014	2014	NUM
brj-24894	32	22	)	)	PUNCT
brj-24894	32	23	.	.	PUNCT
brj-24894	33	1	the	the	DET
brj-24894	33	2	functional	functional	ADJ
brj-24894	33	3	diversity	diversity	NOUN
brj-24894	33	4	underscored	underscore	VERB
brj-24894	33	5	the	the	DET
brj-24894	33	6	versatility	versatility	NOUN
brj-24894	33	7	and	and	CCONJ
brj-24894	33	8	potential	potential	ADJ
brj-24894	33	9	applications	application	NOUN
brj-24894	33	10	of	of	ADP
brj-24894	33	11	gh12	gh12	PROPN
brj-24894	33	12	enzymes	enzyme	NOUN
brj-24894	33	13	in	in	ADP
brj-24894	33	14	various	various	ADJ
brj-24894	33	15	biotechnology	biotechnology	NOUN
brj-24894	33	16	processes	process	NOUN
brj-24894	33	17	.	.	PUNCT
brj-24894	34	1	talaromyces	talaromyce	NOUN
brj-24894	34	2	pinophilus	pinophilus	ADJ
brj-24894	34	3	(	(	PUNCT
brj-24894	34	4	formerly	formerly	ADV
brj-24894	34	5	classified	classify	VERB
brj-24894	34	6	as	as	ADP
brj-24894	34	7	penicillium	penicillium	NOUN
brj-24894	34	8	pinophilum	pinophilum	NOUN
brj-24894	34	9	)	)	PUNCT
brj-24894	34	10	is	be	AUX
brj-24894	34	11	a	a	DET
brj-24894	34	12	filamentous	filamentous	ADJ
brj-24894	34	13	fungal	fungal	ADJ
brj-24894	34	14	species	specie	NOUN
brj-24894	34	15	known	know	VERB
brj-24894	34	16	for	for	ADP
brj-24894	34	17	its	its	PRON
brj-24894	34	18	robust	robust	ADJ
brj-24894	34	19	ability	ability	NOUN
brj-24894	34	20	to	to	PART
brj-24894	34	21	produce	produce	VERB
brj-24894	34	22	biomass	biomass	NOUN
brj-24894	34	23	-	-	PUNCT
brj-24894	34	24	degrading	degrade	VERB
brj-24894	34	25	enzymes	enzyme	NOUN
brj-24894	34	26	(	(	PUNCT
brj-24894	34	27	yamanobe	yamanobe	INTJ
brj-24894	34	28	et	et	PROPN
brj-24894	34	29	al	al	PROPN
brj-24894	34	30	.	.	PROPN
brj-24894	34	31	1987	1987	NUM
brj-24894	34	32	;	;	PUNCT
brj-24894	34	33	visser	visser	PROPN
brj-24894	34	34	et	et	PROPN
brj-24894	34	35	al	al	PROPN
brj-24894	34	36	.	.	PROPN
brj-24894	34	37	2013	2013	NUM
brj-24894	34	38	;	;	PUNCT
brj-24894	34	39	xian	xian	NOUN
brj-24894	34	40	et	et	PROPN
brj-24894	34	41	al	al	PROPN
brj-24894	34	42	.	.	PROPN
brj-24894	34	43	2015	2015	NUM
brj-24894	34	44	)	)	PUNCT
brj-24894	34	45	.	.	PUNCT
brj-24894	35	1	due	due	ADP
brj-24894	35	2	to	to	ADP
brj-24894	35	3	this	this	DET
brj-24894	35	4	capacity	capacity	NOUN
brj-24894	35	5	,	,	PUNCT
brj-24894	35	6	it	it	PRON
brj-24894	35	7	has	have	AUX
brj-24894	35	8	emerged	emerge	VERB
brj-24894	35	9	as	as	ADP
brj-24894	35	10	a	a	DET
brj-24894	35	11	promising	promising	ADJ
brj-24894	35	12	alternative	alternative	ADJ
brj-24894	35	13	microbial	microbial	ADJ
brj-24894	35	14	platform	platform	NOUN
brj-24894	35	15	for	for	ADP
brj-24894	35	16	efficient	efficient	ADJ
brj-24894	35	17	cellulase	cellulase	NOUN
brj-24894	35	18	production	production	NOUN
brj-24894	35	19	and	and	CCONJ
brj-24894	35	20	biomass	biomass	NOUN
brj-24894	35	21	degradation	degradation	NOUN
brj-24894	35	22	.	.	PUNCT
brj-24894	36	1	however	however	ADV
brj-24894	36	2	,	,	PUNCT
brj-24894	36	3	gh12	gh12	PROPN
brj-24894	36	4	enzymes	enzyme	NOUN
brj-24894	36	5	derived	derive	VERB
brj-24894	36	6	from	from	ADP
brj-24894	36	7	talaromyces	talaromyce	NOUN
brj-24894	36	8	species	specie	NOUN
brj-24894	36	9	have	have	AUX
brj-24894	36	10	been	be	AUX
brj-24894	36	11	rarely	rarely	ADV
brj-24894	36	12	documented	document	VERB
brj-24894	36	13	in	in	ADP
brj-24894	36	14	existing	exist	VERB
brj-24894	36	15	studies	study	NOUN
brj-24894	36	16	.	.	PUNCT
brj-24894	37	1	in	in	ADP
brj-24894	37	2	previous	previous	ADJ
brj-24894	37	3	work	work	NOUN
brj-24894	37	4	,	,	PUNCT
brj-24894	37	5	the	the	DET
brj-24894	37	6	authors	author	NOUN
brj-24894	37	7	successfully	successfully	ADV
brj-24894	37	8	isolated	isolate	VERB
brj-24894	37	9	a	a	DET
brj-24894	37	10	strain	strain	NOUN
brj-24894	37	11	,	,	PUNCT
brj-24894	37	12	named	name	VERB
brj-24894	37	13	y117	y117	NUM
brj-24894	37	14	,	,	PUNCT
brj-24894	37	15	of	of	ADP
brj-24894	37	16	t.	t.	NOUN
brj-24894	37	17	pinophilus	pinophilus	NOUN
brj-24894	37	18	with	with	ADP
brj-24894	37	19	high	high	ADJ
brj-24894	37	20	cellulase	cellulase	NOUN
brj-24894	37	21	production	production	NOUN
brj-24894	37	22	.	.	PUNCT
brj-24894	38	1	here	here	ADV
brj-24894	38	2	,	,	PUNCT
brj-24894	38	3	a	a	DET
brj-24894	38	4	novel	novel	ADJ
brj-24894	38	5	gh12	gh12	PROPN
brj-24894	38	6	family	family	NOUN
brj-24894	38	7	endoglucanase	endoglucanase	NOUN
brj-24894	38	8	,	,	PUNCT
brj-24894	38	9	designated	designate	VERB
brj-24894	38	10	tpcel12a	tpcel12a	NOUN
brj-24894	38	11	,	,	PUNCT
brj-24894	38	12	was	be	AUX
brj-24894	38	13	identified	identify	VERB
brj-24894	38	14	in	in	ADP
brj-24894	38	15	t.	t.	NOUN
brj-24894	38	16	pinophilus	pinophilus	ADJ
brj-24894	38	17	strain	strain	VERB
brj-24894	38	18	y117	y117	NUM
brj-24894	38	19	genome	genome	NOUN
brj-24894	38	20	.	.	PUNCT
brj-24894	39	1	the	the	DET
brj-24894	39	2	recombinant	recombinant	ADJ
brj-24894	39	3	tpcel12a	tpcel12a	NOUN
brj-24894	39	4	was	be	AUX
brj-24894	39	5	successfully	successfully	ADV
brj-24894	39	6	expressed	express	VERB
brj-24894	39	7	in	in	ADP
brj-24894	39	8	its	its	PRON
brj-24894	39	9	native	native	ADJ
brj-24894	39	10	host	host	NOUN
brj-24894	39	11	by	by	ADP
brj-24894	39	12	integrating	integrate	VERB
brj-24894	39	13	the	the	DET
brj-24894	39	14	tpcel12a	tpcel12a	NOUN
brj-24894	39	15	coding	code	VERB
brj-24894	39	16	sequence	sequence	NOUN
brj-24894	39	17	under	under	ADP
brj-24894	39	18	the	the	DET
brj-24894	39	19	cbh1	cbh1	PROPN
brj-24894	39	20	promoter	promoter	NOUN
brj-24894	39	21	.	.	PUNCT
brj-24894	40	1	the	the	DET
brj-24894	40	2	enzymatic	enzymatic	ADJ
brj-24894	40	3	action	action	NOUN
brj-24894	40	4	of	of	ADP
brj-24894	40	5	tpcel12a	tpcel12a	NOUN
brj-24894	40	6	on	on	ADP
brj-24894	40	7	xyloglucan	xyloglucan	NOUN
brj-24894	40	8	and	and	CCONJ
brj-24894	40	9	cmc	cmc	PROPN
brj-24894	40	10	were	be	AUX
brj-24894	40	11	investigated	investigate	VERB
brj-24894	40	12	.	.	PUNCT
brj-24894	41	1	in	in	ADP
brj-24894	41	2	addition	addition	NOUN
brj-24894	41	3	,	,	PUNCT
brj-24894	41	4	the	the	DET
brj-24894	41	5	synergistic	synergistic	ADJ
brj-24894	41	6	action	action	NOUN
brj-24894	41	7	of	of	ADP
brj-24894	41	8	tpcel12a	tpcel12a	NOUN
brj-24894	41	9	coupled	couple	VERB
brj-24894	41	10	with	with	ADP
brj-24894	41	11	the	the	DET
brj-24894	41	12	crude	crude	ADJ
brj-24894	41	13	cellulase	cellulase	NOUN
brj-24894	41	14	was	be	AUX
brj-24894	41	15	evaluated	evaluate	VERB
brj-24894	41	16	on	on	ADP
brj-24894	41	17	the	the	DET
brj-24894	41	18	degradation	degradation	NOUN
brj-24894	41	19	of	of	ADP
brj-24894	41	20	a	a	DET
brj-24894	41	21	natural	natural	ADJ
brj-24894	41	22	lignocellulosic	lignocellulosic	ADJ
brj-24894	41	23	substrate	substrate	NOUN
brj-24894	41	24	,	,	PUNCT
brj-24894	41	25	corn	corn	NOUN
brj-24894	41	26	cob	cob	NOUN
brj-24894	41	27	powder	powder	NOUN
brj-24894	41	28	.	.	PUNCT
brj-24894	42	1	peer	peer	NOUN
brj-24894	42	2	-	-	PUNCT
brj-24894	42	3	reviewed	review	VERB
brj-24894	42	4	article	article	NOUN
brj-24894	42	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	42	6	li	li	PROPN
brj-24894	42	7	et	et	PROPN
brj-24894	42	8	al	al	PROPN
brj-24894	42	9	.	.	PROPN
brj-24894	43	1	(	(	PUNCT
brj-24894	43	2	2026	2026	NUM
brj-24894	43	3	)	)	PUNCT
brj-24894	43	4	.	.	PUNCT
brj-24894	44	1	“	"	PUNCT
brj-24894	44	2	endoglucanase	endoglucanase	VERB
brj-24894	44	3	tpcel12a	tpcel12a	NOUN
brj-24894	44	4	traits	trait	NOUN
brj-24894	44	5	,	,	PUNCT
brj-24894	44	6	”	"	PUNCT
brj-24894	44	7	bioresources	bioresource	NOUN
brj-24894	44	8	21(1	21(1	NUM
brj-24894	44	9	)	)	PUNCT
brj-24894	44	10	,	,	PUNCT
brj-24894	44	11	547	547	NUM
brj-24894	44	12	-	-	SYM
brj-24894	44	13	569	569	NUM
brj-24894	44	14	.	.	PUNCT
brj-24894	45	1	549	549	NUM
brj-24894	45	2	experimental	experimental	ADJ
brj-24894	45	3	materials	material	NOUN
brj-24894	45	4	strains	strain	NOUN
brj-24894	45	5	and	and	CCONJ
brj-24894	45	6	plasmids	plasmid	NOUN
brj-24894	45	7	used	use	VERB
brj-24894	45	8	in	in	ADP
brj-24894	45	9	the	the	DET
brj-24894	45	10	study	study	NOUN
brj-24894	45	11	are	be	AUX
brj-24894	45	12	listed	list	VERB
brj-24894	45	13	in	in	ADP
brj-24894	45	14	appendix	appendix	ADJ
brj-24894	45	15	i.	i.	PROPN
brj-24894	45	16	escherichia	escherichia	PROPN
brj-24894	45	17	coli	coli	NOUN
brj-24894	45	18	top10	top10	PROPN
brj-24894	45	19	strain	strain	NOUN
brj-24894	45	20	,	,	PUNCT
brj-24894	45	21	employed	employ	VERB
brj-24894	45	22	as	as	ADP
brj-24894	45	23	the	the	DET
brj-24894	45	24	host	host	NOUN
brj-24894	45	25	for	for	ADP
brj-24894	45	26	vector	vector	NOUN
brj-24894	45	27	construction	construction	NOUN
brj-24894	45	28	and	and	CCONJ
brj-24894	45	29	propagation	propagation	NOUN
brj-24894	45	30	,	,	PUNCT
brj-24894	45	31	was	be	AUX
brj-24894	45	32	cultured	cultured	ADJ
brj-24894	45	33	in	in	ADP
brj-24894	45	34	lb	lb	DET
brj-24894	45	35	medium	medium	NOUN
brj-24894	45	36	supplemented	supplement	VERB
brj-24894	45	37	with	with	ADP
brj-24894	45	38	appropriate	appropriate	ADJ
brj-24894	45	39	antibiotics	antibiotic	NOUN
brj-24894	45	40	when	when	SCONJ
brj-24894	45	41	required	require	VERB
brj-24894	45	42	.	.	PUNCT
brj-24894	46	1	t.	t.	NOUN
brj-24894	46	2	pinophilus	pinophilus	ADJ
brj-24894	46	3	strain	strain	NOUN
brj-24894	46	4	y117	y117	NUM
brj-24894	46	5	was	be	AUX
brj-24894	46	6	cultured	cultured	ADJ
brj-24894	46	7	in	in	ADP
brj-24894	46	8	the	the	DET
brj-24894	46	9	medium	medium	NOUN
brj-24894	46	10	according	accord	VERB
brj-24894	46	11	to	to	ADP
brj-24894	46	12	the	the	DET
brj-24894	46	13	protocol	protocol	NOUN
brj-24894	46	14	described	describe	VERB
brj-24894	46	15	by	by	ADP
brj-24894	46	16	fang	fang	PROPN
brj-24894	46	17	et	et	PROPN
brj-24894	46	18	al	al	PROPN
brj-24894	46	19	.	.	PROPN
brj-24894	47	1	(	(	PUNCT
brj-24894	47	2	2008	2008	NUM
brj-24894	47	3	)	)	PUNCT
brj-24894	47	4	.	.	PUNCT
brj-24894	48	1	the	the	DET
brj-24894	48	2	preculture	preculture	NOUN
brj-24894	48	3	medium	medium	NOUN
brj-24894	48	4	for	for	ADP
brj-24894	48	5	t.	t.	NOUN
brj-24894	48	6	pinophilus	pinophilus	ADJ
brj-24894	48	7	strain	strain	NOUN
brj-24894	48	8	y117	y117	NUM
brj-24894	48	9	contained	contain	VERB
brj-24894	48	10	40	40	NUM
brj-24894	48	11	g	g	NOUN
brj-24894	48	12	/	/	SYM
brj-24894	48	13	l	l	NOUN
brj-24894	48	14	microcrystalline	microcrystalline	NOUN
brj-24894	48	15	cellulose	cellulose	NOUN
brj-24894	48	16	,	,	PUNCT
brj-24894	48	17	24	24	NUM
brj-24894	48	18	g	g	NOUN
brj-24894	48	19	/	/	SYM
brj-24894	48	20	l	l	NOUN
brj-24894	48	21	kh2po4	kh2po4	NOUN
brj-24894	48	22	,	,	PUNCT
brj-24894	48	23	5	5	NUM
brj-24894	48	24	g	g	NOUN
brj-24894	48	25	/	/	SYM
brj-24894	48	26	l	l	NOUN
brj-24894	48	27	(	(	PUNCT
brj-24894	48	28	nh4)2so4	nh4)2so4	ADV
brj-24894	48	29	,	,	PUNCT
brj-24894	48	30	1.2	1.2	NUM
brj-24894	48	31	g	g	NOUN
brj-24894	48	32	/	/	SYM
brj-24894	48	33	l	l	NOUN
brj-24894	48	34	mgso4·7h2o	mgso4·7h2o	NOUN
brj-24894	48	35	,	,	PUNCT
brj-24894	48	36	10	10	NUM
brj-24894	48	37	mg	mg	NUM
brj-24894	48	38	/	/	SYM
brj-24894	48	39	l	l	NOUN
brj-24894	48	40	znso4·7h2o	znso4·7h2o	NOUN
brj-24894	48	41	,	,	PUNCT
brj-24894	48	42	10	10	NUM
brj-24894	48	43	mg	mg	NUM
brj-24894	48	44	/	/	SYM
brj-24894	48	45	l	l	NOUN
brj-24894	48	46	mnso4·6h2o	mnso4·6h2o	NOUN
brj-24894	48	47	,	,	PUNCT
brj-24894	48	48	10	10	NUM
brj-24894	48	49	mg	mg	NUM
brj-24894	48	50	/	/	SYM
brj-24894	48	51	l	l	NOUN
brj-24894	48	52	cuso4·7h2o	cuso4·7h2o	NOUN
brj-24894	48	53	,	,	PUNCT
brj-24894	48	54	and	and	CCONJ
brj-24894	48	55	2	2	NUM
brj-24894	48	56	g	g	NOUN
brj-24894	48	57	/	/	SYM
brj-24894	48	58	l	l	NOUN
brj-24894	48	59	urea	urea	NOUN
brj-24894	48	60	.	.	PUNCT
brj-24894	49	1	the	the	DET
brj-24894	49	2	cellulase	cellulase	NOUN
brj-24894	49	3	production	production	NOUN
brj-24894	49	4	and	and	CCONJ
brj-24894	49	5	protein	protein	NOUN
brj-24894	49	6	overexpression	overexpression	NOUN
brj-24894	49	7	medium	medium	NOUN
brj-24894	49	8	consisted	consist	VERB
brj-24894	49	9	of	of	ADP
brj-24894	49	10	50	50	NUM
brj-24894	49	11	g	g	NOUN
brj-24894	49	12	/	/	SYM
brj-24894	49	13	l	l	NOUN
brj-24894	49	14	microcrystalline	microcrystalline	NOUN
brj-24894	49	15	cellulose	cellulose	NOUN
brj-24894	49	16	,	,	PUNCT
brj-24894	49	17	24	24	NUM
brj-24894	49	18	g	g	NOUN
brj-24894	49	19	/	/	SYM
brj-24894	49	20	l	l	NOUN
brj-24894	49	21	kh2po4	kh2po4	NOUN
brj-24894	49	22	,	,	PUNCT
brj-24894	49	23	5	5	NUM
brj-24894	49	24	g	g	NOUN
brj-24894	49	25	/	/	SYM
brj-24894	49	26	l	l	NOUN
brj-24894	49	27	(	(	PUNCT
brj-24894	49	28	nh4)2so4	nh4)2so4	ADV
brj-24894	49	29	,	,	PUNCT
brj-24894	49	30	1.2	1.2	NUM
brj-24894	49	31	g	g	NOUN
brj-24894	49	32	/	/	SYM
brj-24894	49	33	l	l	NOUN
brj-24894	49	34	mgso4·7h2o	mgso4·7h2o	NOUN
brj-24894	49	35	,	,	PUNCT
brj-24894	49	36	10	10	NUM
brj-24894	49	37	mg	mg	NUM
brj-24894	49	38	/	/	SYM
brj-24894	49	39	l	l	NOUN
brj-24894	49	40	znso4·7h2o	znso4·7h2o	NOUN
brj-24894	49	41	,	,	PUNCT
brj-24894	49	42	10	10	NUM
brj-24894	49	43	mg	mg	NUM
brj-24894	49	44	/	/	SYM
brj-24894	49	45	l	l	NOUN
brj-24894	49	46	mnso4·6h2o	mnso4·6h2o	NOUN
brj-24894	49	47	,	,	PUNCT
brj-24894	49	48	10	10	NUM
brj-24894	49	49	mg	mg	NUM
brj-24894	49	50	/	/	SYM
brj-24894	49	51	l	l	NOUN
brj-24894	49	52	cuso4·7h2o	cuso4·7h2o	NOUN
brj-24894	49	53	,	,	PUNCT
brj-24894	49	54	and	and	CCONJ
brj-24894	49	55	4	4	NUM
brj-24894	49	56	g	g	NOUN
brj-24894	49	57	/	/	SYM
brj-24894	49	58	l	l	NOUN
brj-24894	49	59	urea	urea	NOUN
brj-24894	49	60	.	.	PUNCT
brj-24894	50	1	the	the	DET
brj-24894	50	2	ph	ph	PROPN
brj-24894	50	3	was	be	AUX
brj-24894	50	4	adjusted	adjust	VERB
brj-24894	50	5	to	to	ADP
brj-24894	50	6	4.0	4.0	NUM
brj-24894	50	7	with	with	ADP
brj-24894	50	8	h2so4	h2so4	PROPN
brj-24894	50	9	and	and	CCONJ
brj-24894	50	10	koh	koh	PROPN
brj-24894	50	11	before	before	ADP
brj-24894	50	12	sterilization	sterilization	NOUN
brj-24894	50	13	.	.	PUNCT
brj-24894	51	1	a	a	DET
brj-24894	51	2	100×trace	100×trace	NUM
brj-24894	51	3	element	element	NOUN
brj-24894	51	4	stock	stock	NOUN
brj-24894	51	5	solution	solution	NOUN
brj-24894	51	6	(	(	PUNCT
brj-24894	51	7	1.0	1.0	NUM
brj-24894	51	8	g	g	NOUN
brj-24894	51	9	/	/	SYM
brj-24894	51	10	l	l	NOUN
brj-24894	51	11	znso4·7h2o	znso4·7h2o	NOUN
brj-24894	51	12	,	,	PUNCT
brj-24894	51	13	1.0	1.0	NUM
brj-24894	51	14	g	g	NOUN
brj-24894	51	15	/	/	SYM
brj-24894	51	16	l	l	NOUN
brj-24894	51	17	mnso4·6h2o	mnso4·6h2o	NOUN
brj-24894	51	18	,	,	PUNCT
brj-24894	51	19	1.0	1.0	NUM
brj-24894	51	20	g	g	NOUN
brj-24894	51	21	/	/	SYM
brj-24894	51	22	l	l	NOUN
brj-24894	51	23	cuso4·7h2o	cuso4·7h2o	NOUN
brj-24894	51	24	)	)	PUNCT
brj-24894	51	25	was	be	AUX
brj-24894	51	26	prepared	prepare	VERB
brj-24894	51	27	and	and	CCONJ
brj-24894	51	28	sterilized	sterilize	VERB
brj-24894	51	29	individually	individually	ADV
brj-24894	51	30	.	.	PUNCT
brj-24894	52	1	the	the	DET
brj-24894	52	2	urea	urea	NOUN
brj-24894	52	3	was	be	AUX
brj-24894	52	4	dissolved	dissolve	VERB
brj-24894	52	5	in	in	ADP
brj-24894	52	6	distilled	distil	VERB
brj-24894	52	7	water	water	NOUN
brj-24894	52	8	,	,	PUNCT
brj-24894	52	9	sterilized	sterilize	VERB
brj-24894	52	10	,	,	PUNCT
brj-24894	52	11	and	and	CCONJ
brj-24894	52	12	filtered	filter	VERB
brj-24894	52	13	through	through	ADP
brj-24894	52	14	a	a	DET
brj-24894	52	15	0.22	0.22	NUM
brj-24894	52	16	μm	μm	NUM
brj-24894	52	17	filter	filter	NOUN
brj-24894	52	18	membrane	membrane	NOUN
brj-24894	52	19	.	.	PUNCT
brj-24894	53	1	the	the	DET
brj-24894	53	2	other	other	ADJ
brj-24894	53	3	components	component	NOUN
brj-24894	53	4	of	of	ADP
brj-24894	53	5	the	the	DET
brj-24894	53	6	medium	medium	NOUN
brj-24894	53	7	were	be	AUX
brj-24894	53	8	dissolved	dissolve	VERB
brj-24894	53	9	in	in	ADP
brj-24894	53	10	distilled	distil	VERB
brj-24894	53	11	water	water	NOUN
brj-24894	53	12	and	and	CCONJ
brj-24894	53	13	sterilized	sterilize	VERB
brj-24894	53	14	at	at	ADP
brj-24894	53	15	121	121	NUM
brj-24894	53	16	°	°	ADP
brj-24894	53	17	c	c	NOUN
brj-24894	53	18	for	for	ADP
brj-24894	53	19	20	20	NUM
brj-24894	53	20	min	min	NOUN
brj-24894	53	21	.	.	PUNCT
brj-24894	54	1	the	the	DET
brj-24894	54	2	puc57	puc57	NOUN
brj-24894	54	3	plasmid	plasmid	NOUN
brj-24894	54	4	served	serve	VERB
brj-24894	54	5	as	as	ADP
brj-24894	54	6	the	the	DET
brj-24894	54	7	backbone	backbone	NOUN
brj-24894	54	8	for	for	ADP
brj-24894	54	9	constructing	construct	VERB
brj-24894	54	10	the	the	DET
brj-24894	54	11	tpcel12a	tpcel12a	NOUN
brj-24894	54	12	and	and	CCONJ
brj-24894	54	13	its	its	PRON
brj-24894	54	14	mutant	mutant	ADJ
brj-24894	54	15	expression	expression	NOUN
brj-24894	54	16	vector	vector	NOUN
brj-24894	54	17	.	.	PUNCT
brj-24894	55	1	carboxymethyl	carboxymethyl	PROPN
brj-24894	55	2	cellulose	cellulose	PROPN
brj-24894	55	3	(	(	PUNCT
brj-24894	55	4	cmc	cmc	PROPN
brj-24894	55	5	,	,	PUNCT
brj-24894	55	6	medium	medium	ADJ
brj-24894	55	7	viscosity	viscosity	NOUN
brj-24894	55	8	)	)	PUNCT
brj-24894	55	9	was	be	AUX
brj-24894	55	10	obtained	obtain	VERB
brj-24894	55	11	from	from	ADP
brj-24894	55	12	sigma	sigma	PROPN
brj-24894	55	13	-	-	PUNCT
brj-24894	55	14	aldrich	aldrich	PROPN
brj-24894	55	15	(	(	PUNCT
brj-24894	55	16	st	st	PROPN
brj-24894	55	17	.	.	PROPN
brj-24894	55	18	louis	louis	PROPN
brj-24894	55	19	,	,	PUNCT
brj-24894	55	20	mo	mo	PROPN
brj-24894	55	21	,	,	PUNCT
brj-24894	55	22	usa	usa	PROPN
brj-24894	55	23	)	)	PUNCT
brj-24894	55	24	.	.	PUNCT
brj-24894	56	1	tamarind	tamarind	NOUN
brj-24894	56	2	xyloglucan	xyloglucan	NOUN
brj-24894	56	3	,	,	PUNCT
brj-24894	56	4	β-1,3	β-1,3	PROPN
brj-24894	56	5	-	-	PUNCT
brj-24894	56	6	1,4	1,4	NUM
brj-24894	56	7	-	-	PUNCT
brj-24894	56	8	glucan	glucan	NOUN
brj-24894	56	9	,	,	PUNCT
brj-24894	56	10	d	d	ADJ
brj-24894	56	11	-	-	PUNCT
brj-24894	56	12	galactosyl	galactosyl	ADJ
brj-24894	56	13	-	-	PUNCT
brj-24894	56	14	d	d	NOUN
brj-24894	56	15	-	-	PUNCT
brj-24894	56	16	mannan	mannan	NOUN
brj-24894	56	17	,	,	PUNCT
brj-24894	56	18	β	β	NOUN
brj-24894	56	19	-	-	PUNCT
brj-24894	56	20	dmannan	dmannan	NOUN
brj-24894	56	21	,	,	PUNCT
brj-24894	56	22	xylan	xylan	PROPN
brj-24894	56	23	,	,	PUNCT
brj-24894	56	24	arabinogalactan	arabinogalactan	PROPN
brj-24894	56	25	,	,	PUNCT
brj-24894	56	26	pectin	pectin	NOUN
brj-24894	56	27	,	,	PUNCT
brj-24894	56	28	and	and	CCONJ
brj-24894	56	29	standards	standard	NOUN
brj-24894	56	30	(	(	PUNCT
brj-24894	56	31	glucose	glucose	NOUN
brj-24894	56	32	,	,	PUNCT
brj-24894	56	33	cellobiose	cellobiose	NOUN
brj-24894	56	34	,	,	PUNCT
brj-24894	56	35	cellotriose	cellotriose	PROPN
brj-24894	56	36	,	,	PUNCT
brj-24894	56	37	cellotetraose	cellotetraose	ADV
brj-24894	56	38	,	,	PUNCT
brj-24894	56	39	cellopentaose	cellopentaose	VERB
brj-24894	56	40	,	,	PUNCT
brj-24894	56	41	and	and	CCONJ
brj-24894	56	42	cellohexaose	cellohexaose	NOUN
brj-24894	56	43	)	)	PUNCT
brj-24894	56	44	were	be	AUX
brj-24894	56	45	acquired	acquire	VERB
brj-24894	56	46	from	from	ADP
brj-24894	56	47	psaitong	psaitong	PROPN
brj-24894	56	48	biotechnology	biotechnology	PROPN
brj-24894	56	49	co.	co.	PROPN
brj-24894	56	50	,	,	PUNCT
brj-24894	56	51	ltd	ltd	PROPN
brj-24894	56	52	(	(	PUNCT
brj-24894	56	53	beijing	beijing	PROPN
brj-24894	56	54	,	,	PUNCT
brj-24894	56	55	china	china	PROPN
brj-24894	56	56	)	)	PUNCT
brj-24894	56	57	.	.	PUNCT
brj-24894	57	1	primers	primer	NOUN
brj-24894	57	2	used	use	VERB
brj-24894	57	3	in	in	ADP
brj-24894	57	4	this	this	DET
brj-24894	57	5	study	study	NOUN
brj-24894	57	6	were	be	AUX
brj-24894	57	7	listed	list	VERB
brj-24894	57	8	in	in	ADP
brj-24894	57	9	appendix	appendix	PROPN
brj-24894	57	10	ii	ii	PROPN
brj-24894	57	11	.	.	PUNCT
brj-24894	58	1	methods	method	NOUN
brj-24894	58	2	plasmid	plasmid	VERB
brj-24894	58	3	construction	construction	NOUN
brj-24894	58	4	the	the	DET
brj-24894	58	5	plasmid	plasmid	ADJ
brj-24894	58	6	pbip	pbip	NOUN
brj-24894	58	7	-	-	PUNCT
brj-24894	58	8	tpcel12a	tpcel12a	NOUN
brj-24894	58	9	for	for	ADP
brj-24894	58	10	overexpressing	overexpresse	VERB
brj-24894	58	11	tpcel12a	tpcel12a	NOUN
brj-24894	58	12	was	be	AUX
brj-24894	58	13	constructed	construct	VERB
brj-24894	58	14	as	as	SCONJ
brj-24894	58	15	follows	follow	VERB
brj-24894	58	16	.	.	PUNCT
brj-24894	59	1	the	the	DET
brj-24894	59	2	terminator	terminator	NOUN
brj-24894	59	3	region	region	NOUN
brj-24894	59	4	of	of	ADP
brj-24894	59	5	the	the	DET
brj-24894	59	6	cbh1	cbh1	PROPN
brj-24894	59	7	gene	gene	NOUN
brj-24894	59	8	from	from	ADP
brj-24894	59	9	talaromyces	talaromyce	NOUN
brj-24894	59	10	rugulosus	rugulosus	PROPN
brj-24894	59	11	strain	strain	NOUN
brj-24894	59	12	w13939	w13939	PROPN
brj-24894	59	13	(	(	PUNCT
brj-24894	59	14	genbank	genbank	NOUN
brj-24894	59	15	accession	accession	NOUN
brj-24894	59	16	:	:	PUNCT
brj-24894	59	17	gca_013368755	gca_013368755	NUM
brj-24894	59	18	,	,	PUNCT
brj-24894	59	19	chromosome	chromosome	NOUN
brj-24894	59	20	i	i	PRON
brj-24894	59	21	:	:	PUNCT
brj-24894	59	22	839,585–839,934	839,585–839,934	NUM
brj-24894	59	23	nt	not	PART
brj-24894	59	24	)	)	PUNCT
brj-24894	59	25	was	be	AUX
brj-24894	59	26	synthesized	synthesize	VERB
brj-24894	59	27	,	,	PUNCT
brj-24894	59	28	and	and	CCONJ
brj-24894	59	29	the	the	DET
brj-24894	59	30	corresponding	corresponding	ADJ
brj-24894	59	31	homologous	homologous	ADJ
brj-24894	59	32	sequence	sequence	NOUN
brj-24894	59	33	was	be	AUX
brj-24894	59	34	inserted	insert	VERB
brj-24894	59	35	using	use	VERB
brj-24894	59	36	primers	primer	NOUN
brj-24894	59	37	trcbh1	trcbh1	NOUN
brj-24894	59	38	-	-	PUNCT
brj-24894	59	39	ter	ter	NOUN
brj-24894	59	40	-	-	PUNCT
brj-24894	59	41	f	f	NOUN
brj-24894	59	42	/	/	SYM
brj-24894	59	43	r	r	NOUN
brj-24894	59	44	(	(	PUNCT
brj-24894	59	45	appendix	appendix	NOUN
brj-24894	59	46	ii	ii	NOUN
brj-24894	59	47	)	)	PUNCT
brj-24894	59	48	.	.	PUNCT
brj-24894	60	1	the	the	DET
brj-24894	60	2	promoter	promoter	NOUN
brj-24894	60	3	region	region	NOUN
brj-24894	60	4	of	of	ADP
brj-24894	60	5	the	the	DET
brj-24894	60	6	cbh1	cbh1	PROPN
brj-24894	60	7	gene	gene	NOUN
brj-24894	60	8	(	(	PUNCT
brj-24894	60	9	2	2	NUM
brj-24894	60	10	kb	kb	PROPN
brj-24894	60	11	)	)	PUNCT
brj-24894	60	12	from	from	ADP
brj-24894	60	13	t.	t.	NOUN
brj-24894	60	14	pinophilus	pinophilus	ADJ
brj-24894	60	15	strain	strain	NOUN
brj-24894	60	16	y117	y117	NUM
brj-24894	60	17	,	,	PUNCT
brj-24894	60	18	serving	serve	VERB
brj-24894	60	19	as	as	ADP
brj-24894	60	20	a	a	DET
brj-24894	60	21	homologous	homologous	ADJ
brj-24894	60	22	arm	arm	NOUN
brj-24894	60	23	,	,	PUNCT
brj-24894	60	24	along	along	ADP
brj-24894	60	25	with	with	ADP
brj-24894	60	26	the	the	DET
brj-24894	60	27	coding	code	VERB
brj-24894	60	28	sequence	sequence	NOUN
brj-24894	60	29	of	of	ADP
brj-24894	60	30	tpcel12a	tpcel12a	NOUN
brj-24894	60	31	,	,	PUNCT
brj-24894	60	32	were	be	AUX
brj-24894	60	33	amplified	amplify	VERB
brj-24894	60	34	from	from	ADP
brj-24894	60	35	t.	t.	PROPN
brj-24894	60	36	pinophilus	pinophilus	ADJ
brj-24894	60	37	y117	y117	NUM
brj-24894	60	38	genomic	genomic	NOUN
brj-24894	60	39	dna	dna	NOUN
brj-24894	60	40	using	use	VERB
brj-24894	60	41	primer	primer	NOUN
brj-24894	60	42	pairs	pair	NOUN
brj-24894	60	43	tpcbh1	tpcbh1	NOUN
brj-24894	60	44	-	-	PUNCT
brj-24894	60	45	prom	prom	PROPN
brj-24894	60	46	-	-	PUNCT
brj-24894	60	47	f	f	NOUN
brj-24894	60	48	/	/	SYM
brj-24894	60	49	r	r	NOUN
brj-24894	60	50	and	and	CCONJ
brj-24894	60	51	tpcel12a	tpcel12a	NOUN
brj-24894	60	52	-	-	PUNCT
brj-24894	60	53	f	f	NOUN
brj-24894	60	54	/	/	SYM
brj-24894	60	55	r	r	NOUN
brj-24894	60	56	(	(	PUNCT
brj-24894	60	57	appendix	appendix	NOUN
brj-24894	60	58	ii	ii	NOUN
brj-24894	60	59	)	)	PUNCT
brj-24894	60	60	,	,	PUNCT
brj-24894	60	61	respectively	respectively	ADV
brj-24894	60	62	.	.	PUNCT
brj-24894	61	1	subsequently	subsequently	ADV
brj-24894	61	2	,	,	PUNCT
brj-24894	61	3	splicing	splice	VERB
brj-24894	61	4	by	by	ADP
brj-24894	61	5	overlap	overlap	NOUN
brj-24894	61	6	extension	extension	NOUN
brj-24894	61	7	pcr	pcr	NOUN
brj-24894	61	8	(	(	PUNCT
brj-24894	61	9	soe	soe	ADJ
brj-24894	61	10	-	-	PUNCT
brj-24894	61	11	pcr	pcr	NOUN
brj-24894	61	12	)	)	PUNCT
brj-24894	61	13	was	be	AUX
brj-24894	61	14	performed	perform	VERB
brj-24894	61	15	with	with	ADP
brj-24894	61	16	primers	primer	NOUN
brj-24894	61	17	tpcbh1	tpcbh1	PROPN
brj-24894	61	18	-	-	PUNCT
brj-24894	61	19	prom	prom	PROPN
brj-24894	61	20	-	-	PUNCT
brj-24894	61	21	f	f	NOUN
brj-24894	61	22	/	/	SYM
brj-24894	61	23	trcbh1ter	trcbh1ter	ADJ
brj-24894	61	24	-	-	PUNCT
brj-24894	61	25	r	r	NOUN
brj-24894	61	26	(	(	PUNCT
brj-24894	61	27	appendix	appendix	NOUN
brj-24894	61	28	ii	ii	NOUN
brj-24894	61	29	)	)	PUNCT
brj-24894	61	30	to	to	PART
brj-24894	61	31	assemble	assemble	VERB
brj-24894	61	32	the	the	DET
brj-24894	61	33	three	three	NUM
brj-24894	61	34	fragments	fragment	NOUN
brj-24894	61	35	into	into	ADP
brj-24894	61	36	a	a	DET
brj-24894	61	37	single	single	ADJ
brj-24894	61	38	construct	construct	NOUN
brj-24894	61	39	,	,	PUNCT
brj-24894	61	40	designated	designate	VERB
brj-24894	61	41	tpcbh1prom	tpcbh1prom	NOUN
brj-24894	61	42	-	-	PUNCT
brj-24894	61	43	tpcel12a	tpcel12a	NOUN
brj-24894	61	44	-	-	PUNCT
brj-24894	61	45	trcbh1ter	trcbh1ter	NOUN
brj-24894	61	46	.	.	PUNCT
brj-24894	62	1	this	this	DET
brj-24894	62	2	fragment	fragment	NOUN
brj-24894	62	3	was	be	AUX
brj-24894	62	4	then	then	ADV
brj-24894	62	5	cloned	clone	VERB
brj-24894	62	6	between	between	ADP
brj-24894	62	7	the	the	DET
brj-24894	62	8	ecori	ecori	NOUN
brj-24894	62	9	and	and	CCONJ
brj-24894	62	10	saci	saci	NOUN
brj-24894	62	11	sites	site	NOUN
brj-24894	62	12	of	of	ADP
brj-24894	62	13	the	the	DET
brj-24894	62	14	puc57	puc57	NOUN
brj-24894	62	15	vector	vector	NOUN
brj-24894	62	16	using	use	VERB
brj-24894	62	17	a	a	DET
brj-24894	62	18	seamless	seamless	ADJ
brj-24894	62	19	cloning	cloning	NOUN
brj-24894	62	20	kit	kit	NOUN
brj-24894	62	21	(	(	PUNCT
brj-24894	62	22	vazyme	vazyme	NOUN
brj-24894	62	23	,	,	PUNCT
brj-24894	62	24	china	china	PROPN
brj-24894	62	25	)	)	PUNCT
brj-24894	62	26	,	,	PUNCT
brj-24894	62	27	yielding	yield	VERB
brj-24894	62	28	the	the	DET
brj-24894	62	29	intermediate	intermediate	ADJ
brj-24894	62	30	plasmid	plasmid	ADJ
brj-24894	62	31	puc	puc	NOUN
brj-24894	62	32	-	-	PUNCT
brj-24894	62	33	tpcbh1prom	tpcbh1prom	NOUN
brj-24894	62	34	-	-	PUNCT
brj-24894	62	35	tpcel12a	tpcel12a	NOUN
brj-24894	62	36	-	-	PUNCT
brj-24894	62	37	trcbh1ter	trcbh1ter	NOUN
brj-24894	62	38	.	.	PUNCT
brj-24894	63	1	additionally	additionally	ADV
brj-24894	63	2	,	,	PUNCT
brj-24894	63	3	the	the	DET
brj-24894	63	4	promoter	promoter	NOUN
brj-24894	63	5	region	region	NOUN
brj-24894	63	6	of	of	ADP
brj-24894	63	7	the	the	DET
brj-24894	63	8	housekeeping	housekeeping	NOUN
brj-24894	63	9	gene	gene	NOUN
brj-24894	63	10	pyruvate	pyruvate	NOUN
brj-24894	63	11	kinase	kinase	NOUN
brj-24894	63	12	from	from	ADP
brj-24894	63	13	t.	t.	PROPN
brj-24894	63	14	rugulosus	rugulosus	PROPN
brj-24894	63	15	w13939	w13939	PROPN
brj-24894	63	16	(	(	PUNCT
brj-24894	63	17	gca_013368755	gca_013368755	X
brj-24894	63	18	,	,	PUNCT
brj-24894	63	19	chromosome	chromosome	VERB
brj-24894	63	20	i	i	PRON
brj-24894	63	21	:	:	PUNCT
brj-24894	63	22	2,479,882–2,480,381	2,479,882–2,480,381	NUM
brj-24894	63	23	nt	not	PART
brj-24894	63	24	)	)	PUNCT
brj-24894	63	25	,	,	PUNCT
brj-24894	63	26	and	and	CCONJ
brj-24894	63	27	the	the	DET
brj-24894	63	28	cbh1	cbh1	PROPN
brj-24894	63	29	terminator	terminator	NOUN
brj-24894	63	30	from	from	ADP
brj-24894	63	31	t.	t.	PROPN
brj-24894	63	32	stipitatus	stipitatus	PROPN
brj-24894	63	33	atcc	atcc	PROPN
brj-24894	63	34	10500	10500	NUM
brj-24894	63	35	(	(	PUNCT
brj-24894	63	36	gca_000003125	gca_000003125	PROPN
brj-24894	63	37	,	,	PUNCT
brj-24894	63	38	scaffold	scaffold	NOUN
brj-24894	63	39	scf_110550729515	scf_110550729515	NOUN
brj-24894	63	40	:	:	PUNCT
brj-24894	63	41	901,690	901,690	NUM
brj-24894	63	42	–	–	PUNCT
brj-24894	63	43	902,039	902,039	NUM
brj-24894	63	44	nt	not	PART
brj-24894	63	45	)	)	PUNCT
brj-24894	63	46	were	be	AUX
brj-24894	63	47	synthesized	synthesize	VERB
brj-24894	63	48	,	,	PUNCT
brj-24894	63	49	with	with	ADP
brj-24894	63	50	homologous	homologous	ADJ
brj-24894	63	51	sequences	sequence	NOUN
brj-24894	63	52	inserted	insert	VERB
brj-24894	63	53	using	use	VERB
brj-24894	63	54	primers	primer	NOUN
brj-24894	64	1	trpkprom	trpkprom	NOUN
brj-24894	64	2	-	-	PUNCT
brj-24894	64	3	f	f	PROPN
brj-24894	64	4	/	/	SYM
brj-24894	64	5	r	r	NOUN
brj-24894	64	6	and	and	CCONJ
brj-24894	64	7	tscbh1	tscbh1	PROPN
brj-24894	64	8	-	-	PUNCT
brj-24894	64	9	ter	ter	NOUN
brj-24894	64	10	-	-	PUNCT
brj-24894	64	11	f	f	NOUN
brj-24894	64	12	/	/	SYM
brj-24894	64	13	r	r	NOUN
brj-24894	64	14	(	(	PUNCT
brj-24894	64	15	appendix	appendix	NOUN
brj-24894	64	16	ii	ii	NOUN
brj-24894	64	17	)	)	PUNCT
brj-24894	64	18	,	,	PUNCT
brj-24894	64	19	respectively	respectively	ADV
brj-24894	64	20	.	.	PUNCT
brj-24894	65	1	peer	peer	NOUN
brj-24894	65	2	-	-	PUNCT
brj-24894	65	3	reviewed	review	VERB
brj-24894	65	4	article	article	NOUN
brj-24894	65	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	65	6	li	li	PROPN
brj-24894	65	7	et	et	PROPN
brj-24894	65	8	al	al	PROPN
brj-24894	65	9	.	.	PROPN
brj-24894	66	1	(	(	PUNCT
brj-24894	66	2	2026	2026	NUM
brj-24894	66	3	)	)	PUNCT
brj-24894	66	4	.	.	PUNCT
brj-24894	67	1	“	"	PUNCT
brj-24894	67	2	endoglucanase	endoglucanase	VERB
brj-24894	67	3	tpcel12a	tpcel12a	NOUN
brj-24894	67	4	traits	trait	NOUN
brj-24894	67	5	,	,	PUNCT
brj-24894	67	6	”	"	PUNCT
brj-24894	67	7	bioresources	bioresource	NOUN
brj-24894	67	8	21(1	21(1	NUM
brj-24894	67	9	)	)	PUNCT
brj-24894	67	10	,	,	PUNCT
brj-24894	67	11	547	547	NUM
brj-24894	67	12	-	-	SYM
brj-24894	67	13	569	569	NUM
brj-24894	67	14	.	.	PUNCT
brj-24894	68	1	550	550	NUM
brj-24894	68	2	the	the	DET
brj-24894	68	3	coding	code	VERB
brj-24894	68	4	sequence	sequence	NOUN
brj-24894	68	5	of	of	ADP
brj-24894	68	6	the	the	DET
brj-24894	68	7	hygromycin	hygromycin	PROPN
brj-24894	68	8	b	b	PROPN
brj-24894	68	9	phosphotransferase	phosphotransferase	NOUN
brj-24894	68	10	gene	gene	NOUN
brj-24894	68	11	(	(	PUNCT
brj-24894	68	12	hph	hph	PROPN
brj-24894	68	13	)	)	PUNCT
brj-24894	68	14	,	,	PUNCT
brj-24894	68	15	conferring	confer	VERB
brj-24894	68	16	hygromycin	hygromycin	PRON
brj-24894	68	17	resistance	resistance	NOUN
brj-24894	68	18	,	,	PUNCT
brj-24894	68	19	was	be	AUX
brj-24894	68	20	amplified	amplify	VERB
brj-24894	68	21	from	from	ADP
brj-24894	68	22	the	the	DET
brj-24894	68	23	plasmid	plasmid	ADJ
brj-24894	68	24	plko.1	plko.1	NOUN
brj-24894	68	25	-	-	PUNCT
brj-24894	68	26	hygro	hygro	NOUN
brj-24894	68	27	.	.	PUNCT
brj-24894	68	28	soepcr	soepcr	PROPN
brj-24894	68	29	was	be	AUX
brj-24894	68	30	conducted	conduct	VERB
brj-24894	68	31	with	with	ADP
brj-24894	68	32	primers	primer	NOUN
brj-24894	68	33	trpk	trpk	ADJ
brj-24894	68	34	-	-	PUNCT
brj-24894	68	35	prom	prom	NOUN
brj-24894	68	36	-	-	PUNCT
brj-24894	68	37	f	f	PROPN
brj-24894	68	38	/	/	SYM
brj-24894	68	39	tscbh1	tscbh1	NOUN
brj-24894	68	40	-	-	PUNCT
brj-24894	68	41	ter	ter	NOUN
brj-24894	68	42	-	-	PUNCT
brj-24894	68	43	r	r	NOUN
brj-24894	68	44	(	(	PUNCT
brj-24894	68	45	appendix	appendix	NOUN
brj-24894	68	46	ii	ii	NOUN
brj-24894	68	47	)	)	PUNCT
brj-24894	68	48	to	to	PART
brj-24894	68	49	fuse	fuse	VERB
brj-24894	68	50	these	these	DET
brj-24894	68	51	three	three	NUM
brj-24894	68	52	fragments	fragment	NOUN
brj-24894	68	53	into	into	ADP
brj-24894	68	54	a	a	DET
brj-24894	68	55	single	single	ADJ
brj-24894	68	56	unit	unit	NOUN
brj-24894	68	57	,	,	PUNCT
brj-24894	68	58	trpkprom	trpkprom	PROPN
brj-24894	68	59	-	-	PUNCT
brj-24894	68	60	hyg	hyg	PROPN
brj-24894	68	61	-	-	PUNCT
brj-24894	68	62	tscbh1ter	tscbh1ter	NOUN
brj-24894	68	63	,	,	PUNCT
brj-24894	68	64	which	which	PRON
brj-24894	68	65	was	be	AUX
brj-24894	68	66	subsequently	subsequently	ADV
brj-24894	68	67	cloned	clone	VERB
brj-24894	68	68	between	between	ADP
brj-24894	68	69	the	the	DET
brj-24894	68	70	smai	smai	NOUN
brj-24894	68	71	and	and	CCONJ
brj-24894	68	72	psti	psti	NOUN
brj-24894	68	73	sites	site	NOUN
brj-24894	68	74	of	of	ADP
brj-24894	68	75	the	the	DET
brj-24894	68	76	intermediate	intermediate	ADJ
brj-24894	68	77	plasmid	plasmid	ADJ
brj-24894	68	78	puc	puc	NOUN
brj-24894	68	79	-	-	PUNCT
brj-24894	68	80	tpcbh1promtpcel12a	tpcbh1promtpcel12a	PROPN
brj-24894	68	81	-	-	PUNCT
brj-24894	68	82	trcbh1ter	trcbh1ter	NOUN
brj-24894	68	83	using	use	VERB
brj-24894	68	84	a	a	DET
brj-24894	68	85	seamless	seamless	ADJ
brj-24894	68	86	cloning	cloning	NOUN
brj-24894	68	87	kit	kit	NOUN
brj-24894	68	88	.	.	PUNCT
brj-24894	69	1	finally	finally	ADV
brj-24894	69	2	,	,	PUNCT
brj-24894	69	3	the	the	DET
brj-24894	69	4	expression	expression	NOUN
brj-24894	69	5	plasmid	plasmid	NOUN
brj-24894	69	6	pbiptpcel12a	pbiptpcel12a	NOUN
brj-24894	69	7	was	be	AUX
brj-24894	69	8	generated	generate	VERB
brj-24894	69	9	.	.	PUNCT
brj-24894	70	1	inverse	inverse	PROPN
brj-24894	70	2	pcr	pcr	PROPN
brj-24894	70	3	with	with	ADP
brj-24894	70	4	site	site	NOUN
brj-24894	70	5	-	-	PUNCT
brj-24894	70	6	directed	direct	VERB
brj-24894	70	7	primers	primer	NOUN
brj-24894	70	8	tpcel12a	tpcel12a	NOUN
brj-24894	70	9	-	-	PUNCT
brj-24894	70	10	intqa	intqa	NOUN
brj-24894	70	11	-	-	PUNCT
brj-24894	70	12	f	f	NOUN
brj-24894	70	13	/	/	SYM
brj-24894	70	14	r	r	NOUN
brj-24894	70	15	(	(	PUNCT
brj-24894	70	16	appendix	appendix	NOUN
brj-24894	70	17	ii	ii	NOUN
brj-24894	70	18	)	)	PUNCT
brj-24894	70	19	was	be	AUX
brj-24894	70	20	performed	perform	VERB
brj-24894	70	21	to	to	PART
brj-24894	70	22	introduce	introduce	VERB
brj-24894	70	23	a	a	DET
brj-24894	70	24	tqa	tqa	NOUN
brj-24894	70	25	insertion	insertion	NOUN
brj-24894	70	26	into	into	ADP
brj-24894	70	27	loop	loop	NOUN
brj-24894	70	28	3	3	NUM
brj-24894	70	29	of	of	ADP
brj-24894	70	30	tpcel12a	tpcel12a	NOUN
brj-24894	70	31	.	.	PUNCT
brj-24894	71	1	all	all	DET
brj-24894	71	2	constructs	construct	NOUN
brj-24894	71	3	were	be	AUX
brj-24894	71	4	verified	verify	VERB
brj-24894	71	5	by	by	ADP
brj-24894	71	6	dna	dna	NOUN
brj-24894	71	7	sequencing	sequencing	NOUN
brj-24894	71	8	.	.	PUNCT
brj-24894	72	1	construction	construction	NOUN
brj-24894	72	2	of	of	ADP
brj-24894	72	3	tpcel12a	tpcel12a	NOUN
brj-24894	72	4	overexpression	overexpression	NOUN
brj-24894	72	5	mutant	mutant	NOUN
brj-24894	72	6	tpcel12a	tpcel12a	NOUN
brj-24894	72	7	overexpression	overexpression	NOUN
brj-24894	72	8	mutant	mutant	NOUN
brj-24894	72	9	was	be	AUX
brj-24894	72	10	constructed	construct	VERB
brj-24894	72	11	as	as	ADP
brj-24894	72	12	illustrated	illustrate	VERB
brj-24894	72	13	in	in	ADP
brj-24894	72	14	appendix	appendix	NOUN
brj-24894	72	15	iv	iv	NUM
brj-24894	72	16	.	.	PUNCT
brj-24894	73	1	briefly	briefly	PROPN
brj-24894	73	2	,	,	PUNCT
brj-24894	73	3	the	the	DET
brj-24894	73	4	plasmid	plasmid	ADJ
brj-24894	73	5	pbip	pbip	NOUN
brj-24894	73	6	-	-	PUNCT
brj-24894	73	7	tpcel12a	tpcel12a	NOUN
brj-24894	73	8	was	be	AUX
brj-24894	73	9	linearized	linearize	VERB
brj-24894	73	10	by	by	ADP
brj-24894	73	11	noti	noti	PROPN
brj-24894	73	12	and	and	CCONJ
brj-24894	73	13	then	then	ADV
brj-24894	73	14	introduced	introduce	VERB
brj-24894	73	15	into	into	ADP
brj-24894	73	16	t.	t.	PROPN
brj-24894	73	17	pinophilus	pinophilus	NOUN
brj-24894	73	18	y117	y117	NUM
brj-24894	73	19	by	by	ADP
brj-24894	73	20	protoplast	protoplast	NOUN
brj-24894	73	21	transformation	transformation	NOUN
brj-24894	73	22	.	.	PUNCT
brj-24894	74	1	the	the	DET
brj-24894	74	2	protoplast	protoplast	NOUN
brj-24894	74	3	preparation	preparation	NOUN
brj-24894	74	4	and	and	CCONJ
brj-24894	74	5	transformation	transformation	NOUN
brj-24894	74	6	were	be	AUX
brj-24894	74	7	performed	perform	VERB
brj-24894	74	8	as	as	ADP
brj-24894	74	9	previously	previously	ADV
brj-24894	74	10	described	describe	VERB
brj-24894	74	11	(	(	PUNCT
brj-24894	74	12	zhao	zhao	PROPN
brj-24894	74	13	et	et	PROPN
brj-24894	74	14	al	al	PROPN
brj-24894	74	15	.	.	PROPN
brj-24894	74	16	2016	2016	NUM
brj-24894	74	17	)	)	PUNCT
brj-24894	74	18	.	.	PUNCT
brj-24894	75	1	hygromycinresistant	hygromycinresistant	ADJ
brj-24894	75	2	transformants	transformant	NOUN
brj-24894	75	3	were	be	AUX
brj-24894	75	4	selected	select	VERB
brj-24894	75	5	and	and	CCONJ
brj-24894	75	6	expression	expression	NOUN
brj-24894	75	7	of	of	ADP
brj-24894	75	8	tpcel12a	tpcel12a	NOUN
brj-24894	75	9	was	be	AUX
brj-24894	75	10	confirmed	confirm	VERB
brj-24894	75	11	by	by	ADP
brj-24894	75	12	western	western	ADJ
brj-24894	75	13	blot	blot	NOUN
brj-24894	75	14	.	.	PUNCT
brj-24894	76	1	sequence	sequence	NOUN
brj-24894	76	2	analysis	analysis	NOUN
brj-24894	76	3	the	the	DET
brj-24894	76	4	potential	potential	ADJ
brj-24894	76	5	signal	signal	NOUN
brj-24894	76	6	peptide	peptide	NOUN
brj-24894	76	7	and	and	CCONJ
brj-24894	76	8	n	n	CCONJ
brj-24894	76	9	-	-	PUNCT
brj-24894	76	10	glycosylation	glycosylation	NOUN
brj-24894	76	11	sites	site	NOUN
brj-24894	76	12	of	of	ADP
brj-24894	76	13	tpcel12a	tpcel12a	NOUN
brj-24894	76	14	were	be	AUX
brj-24894	76	15	predicted	predict	VERB
brj-24894	76	16	using	use	VERB
brj-24894	76	17	signalp	signalp	NOUN
brj-24894	76	18	6.0	6.0	NUM
brj-24894	76	19	(	(	PUNCT
brj-24894	76	20	teufel	teufel	X
brj-24894	76	21	et	et	PROPN
brj-24894	76	22	al	al	PROPN
brj-24894	76	23	.	.	PROPN
brj-24894	76	24	2022	2022	NUM
brj-24894	76	25	)	)	PUNCT
brj-24894	76	26	and	and	CCONJ
brj-24894	76	27	netnglyc	netnglyc	PROPN
brj-24894	76	28	1.0	1.0	NUM
brj-24894	76	29	(	(	PUNCT
brj-24894	76	30	gupta	gupta	NOUN
brj-24894	76	31	and	and	CCONJ
brj-24894	76	32	brunak	brunak	NOUN
brj-24894	76	33	2002	2002	NUM
brj-24894	76	34	)	)	PUNCT
brj-24894	76	35	servers	server	NOUN
brj-24894	76	36	,	,	PUNCT
brj-24894	76	37	respectively	respectively	ADV
brj-24894	76	38	.	.	PUNCT
brj-24894	77	1	the	the	DET
brj-24894	77	2	model	model	NOUN
brj-24894	77	3	structure	structure	NOUN
brj-24894	77	4	of	of	ADP
brj-24894	77	5	tpcel12a	tpcel12a	NOUN
brj-24894	77	6	was	be	AUX
brj-24894	77	7	constructed	construct	VERB
brj-24894	77	8	by	by	ADP
brj-24894	77	9	alphafold	alphafold	ADJ
brj-24894	77	10	3.0	3.0	NUM
brj-24894	77	11	(	(	PUNCT
brj-24894	77	12	abramson	abramson	PROPN
brj-24894	77	13	et	et	PROPN
brj-24894	77	14	al	al	PROPN
brj-24894	77	15	.	.	PROPN
brj-24894	77	16	2024	2024	NUM
brj-24894	77	17	)	)	PUNCT
brj-24894	77	18	.	.	PUNCT
brj-24894	78	1	multiple	multiple	ADJ
brj-24894	78	2	sequence	sequence	NOUN
brj-24894	78	3	alignment	alignment	NOUN
brj-24894	78	4	was	be	AUX
brj-24894	78	5	performed	perform	VERB
brj-24894	78	6	using	use	VERB
brj-24894	78	7	the	the	DET
brj-24894	78	8	clustal	clustal	ADJ
brj-24894	78	9	omega	omega	NOUN
brj-24894	78	10	online	online	NOUN
brj-24894	78	11	server	server	NOUN
brj-24894	78	12	(	(	PUNCT
brj-24894	78	13	sievers	siever	NOUN
brj-24894	78	14	and	and	CCONJ
brj-24894	78	15	higgins	higgins	PROPN
brj-24894	78	16	2014	2014	NUM
brj-24894	78	17	)	)	PUNCT
brj-24894	78	18	,	,	PUNCT
brj-24894	78	19	and	and	CCONJ
brj-24894	78	20	the	the	DET
brj-24894	78	21	results	result	NOUN
brj-24894	78	22	were	be	AUX
brj-24894	78	23	visualized	visualize	VERB
brj-24894	78	24	using	use	VERB
brj-24894	78	25	espript	espript	ADJ
brj-24894	78	26	3.0	3.0	NUM
brj-24894	78	27	server	server	NOUN
brj-24894	78	28	(	(	PUNCT
brj-24894	78	29	gouet	gouet	NOUN
brj-24894	78	30	et	et	PROPN
brj-24894	78	31	al	al	PROPN
brj-24894	78	32	.	.	PROPN
brj-24894	78	33	2003	2003	NUM
brj-24894	78	34	)	)	PUNCT
brj-24894	78	35	.	.	PUNCT
brj-24894	79	1	phylogenetic	phylogenetic	ADJ
brj-24894	79	2	analysis	analysis	NOUN
brj-24894	79	3	of	of	ADP
brj-24894	79	4	tpcel12a	tpcel12a	NOUN
brj-24894	79	5	was	be	AUX
brj-24894	79	6	conducted	conduct	VERB
brj-24894	79	7	using	use	VERB
brj-24894	79	8	mega	mega	ADJ
brj-24894	79	9	x	x	NOUN
brj-24894	79	10	software	software	NOUN
brj-24894	79	11	with	with	ADP
brj-24894	79	12	the	the	DET
brj-24894	79	13	maximum	maximum	ADJ
brj-24894	79	14	likelihood	likelihood	NOUN
brj-24894	79	15	method	method	NOUN
brj-24894	79	16	,	,	PUNCT
brj-24894	79	17	employing	employ	VERB
brj-24894	79	18	500	500	NUM
brj-24894	79	19	bootstrap	bootstrap	NOUN
brj-24894	79	20	replicates	replicate	NOUN
brj-24894	79	21	to	to	PART
brj-24894	79	22	assess	assess	VERB
brj-24894	79	23	node	node	NOUN
brj-24894	79	24	support	support	NOUN
brj-24894	79	25	(	(	PUNCT
brj-24894	79	26	kumar	kumar	PROPN
brj-24894	79	27	et	et	PROPN
brj-24894	79	28	al	al	PROPN
brj-24894	79	29	.	.	PROPN
brj-24894	79	30	2018	2018	NUM
brj-24894	79	31	)	)	PUNCT
brj-24894	79	32	.	.	PUNCT
brj-24894	80	1	expression	expression	NOUN
brj-24894	80	2	and	and	CCONJ
brj-24894	80	3	purification	purification	NOUN
brj-24894	80	4	of	of	ADP
brj-24894	80	5	tpcel12a	tpcel12a	NOUN
brj-24894	80	6	in	in	ADP
brj-24894	80	7	t.	t.	NOUN
brj-24894	80	8	pinophilus	pinophilus	ADJ
brj-24894	80	9	strain	strain	NOUN
brj-24894	80	10	y117	y117	NUM
brj-24894	80	11	the	the	DET
brj-24894	80	12	tpcel12a	tpcel12a	ADJ
brj-24894	80	13	overexpression	overexpression	NOUN
brj-24894	80	14	mutant	mutant	NOUN
brj-24894	80	15	was	be	AUX
brj-24894	80	16	inoculated	inoculate	VERB
brj-24894	80	17	into	into	ADP
brj-24894	80	18	50	50	NUM
brj-24894	80	19	ml	ml	NOUN
brj-24894	80	20	of	of	ADP
brj-24894	80	21	fresh	fresh	ADJ
brj-24894	80	22	preculture	preculture	NOUN
brj-24894	80	23	medium	medium	NOUN
brj-24894	80	24	and	and	CCONJ
brj-24894	80	25	incubated	incubate	VERB
brj-24894	80	26	for	for	ADP
brj-24894	80	27	5	5	NUM
brj-24894	80	28	days	day	NOUN
brj-24894	80	29	to	to	PART
brj-24894	80	30	prepare	prepare	VERB
brj-24894	80	31	seed	seed	NOUN
brj-24894	80	32	cultures	culture	NOUN
brj-24894	80	33	.	.	PUNCT
brj-24894	81	1	for	for	ADP
brj-24894	81	2	tpcel12a	tpcel12a	NOUN
brj-24894	81	3	production	production	NOUN
brj-24894	81	4	,	,	PUNCT
brj-24894	81	5	10	10	NUM
brj-24894	81	6	%	%	NOUN
brj-24894	81	7	(	(	PUNCT
brj-24894	81	8	v	v	NOUN
brj-24894	81	9	/	/	SYM
brj-24894	81	10	v	v	NOUN
brj-24894	81	11	)	)	PUNCT
brj-24894	81	12	of	of	ADP
brj-24894	81	13	the	the	DET
brj-24894	81	14	seed	seed	NOUN
brj-24894	81	15	culture	culture	NOUN
brj-24894	81	16	was	be	AUX
brj-24894	81	17	transferred	transfer	VERB
brj-24894	81	18	into	into	ADP
brj-24894	81	19	100	100	NUM
brj-24894	81	20	ml	ml	NOUN
brj-24894	81	21	of	of	ADP
brj-24894	81	22	production	production	NOUN
brj-24894	81	23	medium	medium	NOUN
brj-24894	81	24	in	in	ADP
brj-24894	81	25	1	1	NUM
brj-24894	81	26	l	l	NOUN
brj-24894	81	27	erlenmeyer	erlenmeyer	NOUN
brj-24894	81	28	flasks	flask	NOUN
brj-24894	81	29	and	and	CCONJ
brj-24894	81	30	cultivated	cultivate	VERB
brj-24894	81	31	at	at	ADP
brj-24894	81	32	28	28	NUM
brj-24894	81	33	°	°	ADP
brj-24894	81	34	c	c	NOUN
brj-24894	81	35	with	with	ADP
brj-24894	81	36	agitation	agitation	NOUN
brj-24894	81	37	at	at	ADP
brj-24894	81	38	250	250	NUM
brj-24894	81	39	rpm	rpm	NOUN
brj-24894	81	40	for	for	ADP
brj-24894	81	41	7	7	NUM
brj-24894	81	42	days	day	NOUN
brj-24894	81	43	.	.	PUNCT
brj-24894	82	1	the	the	DET
brj-24894	82	2	culture	culture	NOUN
brj-24894	82	3	supernatant	supernatant	NOUN
brj-24894	82	4	was	be	AUX
brj-24894	82	5	collected	collect	VERB
brj-24894	82	6	following	follow	VERB
brj-24894	82	7	centrifugation	centrifugation	NOUN
brj-24894	82	8	at	at	ADP
brj-24894	82	9	12,000	12,000	NUM
brj-24894	82	10	×	×	NOUN
brj-24894	82	11	g	g	NOUN
brj-24894	82	12	and	and	CCONJ
brj-24894	82	13	4	4	NUM
brj-24894	82	14	°	°	NOUN
brj-24894	82	15	c	c	NOUN
brj-24894	82	16	for	for	ADP
brj-24894	82	17	30	30	NUM
brj-24894	82	18	min	min	NOUN
brj-24894	82	19	.	.	PUNCT
brj-24894	83	1	the	the	DET
brj-24894	83	2	supernatant	supernatant	NOUN
brj-24894	83	3	was	be	AUX
brj-24894	83	4	applied	apply	VERB
brj-24894	83	5	to	to	ADP
brj-24894	83	6	a	a	DET
brj-24894	83	7	ni	ni	PROPN
brj-24894	83	8	-	-	PUNCT
brj-24894	83	9	nta	nta	PROPN
brj-24894	83	10	column	column	NOUN
brj-24894	83	11	(	(	PUNCT
brj-24894	83	12	cytiva	cytiva	PROPN
brj-24894	83	13	,	,	PUNCT
brj-24894	83	14	sweden	sweden	PROPN
brj-24894	83	15	)	)	PUNCT
brj-24894	83	16	pre	pre	VERB
brj-24894	83	17	-	-	VERB
brj-24894	83	18	equilibrated	equilibrated	ADJ
brj-24894	83	19	with	with	ADP
brj-24894	83	20	binding	bind	VERB
brj-24894	83	21	buffer	buffer	NOUN
brj-24894	83	22	(	(	PUNCT
brj-24894	83	23	20	20	NUM
brj-24894	83	24	mm	mm	PROPN
brj-24894	83	25	tris	tris	NOUN
brj-24894	83	26	,	,	PUNCT
brj-24894	83	27	300	300	NUM
brj-24894	83	28	mm	mm	NOUN
brj-24894	83	29	nacl	nacl	NOUN
brj-24894	83	30	,	,	PUNCT
brj-24894	83	31	20	20	NUM
brj-24894	83	32	mm	mm	NOUN
brj-24894	83	33	imidazole	imidazole	NOUN
brj-24894	83	34	,	,	PUNCT
brj-24894	83	35	ph	ph	NOUN
brj-24894	83	36	8.0	8.0	NUM
brj-24894	83	37	)	)	PUNCT
brj-24894	83	38	,	,	PUNCT
brj-24894	83	39	and	and	CCONJ
brj-24894	83	40	the	the	DET
brj-24894	83	41	proteins	protein	NOUN
brj-24894	83	42	were	be	AUX
brj-24894	83	43	eluted	elute	VERB
brj-24894	83	44	with	with	ADP
brj-24894	83	45	20	20	NUM
brj-24894	83	46	ml	ml	NOUN
brj-24894	83	47	elution	elution	NOUN
brj-24894	83	48	buffer	buffer	NOUN
brj-24894	83	49	(	(	PUNCT
brj-24894	83	50	20	20	NUM
brj-24894	83	51	mm	mm	PROPN
brj-24894	83	52	tris	tris	PROPN
brj-24894	83	53	-	-	PUNCT
brj-24894	83	54	hcl	hcl	NOUN
brj-24894	83	55	,	,	PUNCT
brj-24894	83	56	300	300	NUM
brj-24894	83	57	mm	mm	NOUN
brj-24894	83	58	imidazole	imidazole	NOUN
brj-24894	83	59	and	and	CCONJ
brj-24894	83	60	300	300	NUM
brj-24894	83	61	mm	mm	NOUN
brj-24894	83	62	nacl	nacl	NOUN
brj-24894	83	63	,	,	PUNCT
brj-24894	83	64	ph	ph	NOUN
brj-24894	83	65	8.0	8.0	NUM
brj-24894	83	66	)	)	PUNCT
brj-24894	83	67	after	after	ADP
brj-24894	83	68	washing	washing	NOUN
brj-24894	83	69	.	.	PUNCT
brj-24894	84	1	the	the	DET
brj-24894	84	2	eluted	eluted	ADJ
brj-24894	84	3	protein	protein	NOUN
brj-24894	84	4	was	be	AUX
brj-24894	84	5	further	far	ADV
brj-24894	84	6	desalted	desalt	VERB
brj-24894	84	7	by	by	ADP
brj-24894	84	8	ultrafiltration	ultrafiltration	NOUN
brj-24894	84	9	with	with	ADP
brj-24894	84	10	buffer	buffer	NOUN
brj-24894	84	11	(	(	PUNCT
brj-24894	84	12	20	20	NUM
brj-24894	84	13	mm	mm	PROPN
brj-24894	84	14	tris	tris	PROPN
brj-24894	84	15	-	-	PUNCT
brj-24894	84	16	hcl	hcl	NOUN
brj-24894	84	17	,	,	PUNCT
brj-24894	84	18	10	10	NUM
brj-24894	84	19	%	%	NOUN
brj-24894	84	20	glycerol	glycerol	NOUN
brj-24894	84	21	and	and	CCONJ
brj-24894	84	22	150	150	NUM
brj-24894	84	23	mm	mm	NOUN
brj-24894	84	24	nacl	nacl	NOUN
brj-24894	84	25	,	,	PUNCT
brj-24894	84	26	ph	ph	NOUN
brj-24894	84	27	8.0	8.0	NUM
brj-24894	84	28	)	)	PUNCT
brj-24894	84	29	.	.	PUNCT
brj-24894	85	1	the	the	DET
brj-24894	85	2	purified	purified	ADJ
brj-24894	85	3	protein	protein	NOUN
brj-24894	85	4	was	be	AUX
brj-24894	85	5	then	then	ADV
brj-24894	85	6	visualized	visualize	VERB
brj-24894	85	7	by	by	ADP
brj-24894	85	8	sodium	sodium	NOUN
brj-24894	85	9	dodecyl	dodecyl	PROPN
brj-24894	85	10	sulfate	sulfate	NOUN
brj-24894	85	11	-	-	PUNCT
brj-24894	85	12	polyacrylamide	polyacrylamide	NOUN
brj-24894	85	13	gel	gel	NOUN
brj-24894	85	14	electrophoresis	electrophoresis	NOUN
brj-24894	85	15	(	(	PUNCT
brj-24894	85	16	sdspage	sdspage	NOUN
brj-24894	85	17	)	)	PUNCT
brj-24894	85	18	.	.	PUNCT
brj-24894	86	1	the	the	DET
brj-24894	86	2	concentration	concentration	NOUN
brj-24894	86	3	was	be	AUX
brj-24894	86	4	determined	determine	VERB
brj-24894	86	5	using	use	VERB
brj-24894	86	6	a	a	DET
brj-24894	86	7	bradford	bradford	NOUN
brj-24894	86	8	protein	protein	NOUN
brj-24894	86	9	assay	assay	NOUN
brj-24894	86	10	kit	kit	NOUN
brj-24894	86	11	(	(	PUNCT
brj-24894	86	12	beyotime	beyotime	NOUN
brj-24894	86	13	,	,	PUNCT
brj-24894	86	14	china	china	PROPN
brj-24894	86	15	)	)	PUNCT
brj-24894	86	16	.	.	PUNCT
brj-24894	87	1	finally	finally	ADV
brj-24894	87	2	,	,	PUNCT
brj-24894	87	3	the	the	DET
brj-24894	87	4	oligomeric	oligomeric	ADJ
brj-24894	87	5	state	state	NOUN
brj-24894	87	6	of	of	ADP
brj-24894	87	7	tpcel12a	tpcel12a	NOUN
brj-24894	87	8	was	be	AUX
brj-24894	87	9	analyzed	analyze	VERB
brj-24894	87	10	by	by	ADP
brj-24894	87	11	size	size	NOUN
brj-24894	87	12	-	-	PUNCT
brj-24894	87	13	exclusion	exclusion	NOUN
brj-24894	87	14	chromatography	chromatography	NOUN
brj-24894	87	15	(	(	PUNCT
brj-24894	87	16	sec	sec	PROPN
brj-24894	87	17	)	)	PUNCT
brj-24894	87	18	using	use	VERB
brj-24894	87	19	a	a	DET
brj-24894	87	20	low	low	ADJ
brj-24894	87	21	molecular	molecular	ADJ
brj-24894	87	22	weight	weight	NOUN
brj-24894	87	23	(	(	PUNCT
brj-24894	87	24	lmw	lmw	ADJ
brj-24894	87	25	,	,	PUNCT
brj-24894	87	26	molecular	molecular	ADJ
brj-24894	87	27	weight	weight	NOUN
brj-24894	87	28	of	of	ADP
brj-24894	87	29	standard	standard	ADJ
brj-24894	87	30	proteins	protein	NOUN
brj-24894	87	31	range	range	VERB
brj-24894	87	32	from	from	ADP
brj-24894	87	33	6.5	6.5	NUM
brj-24894	87	34	to	to	PART
brj-24894	87	35	75.0	75.0	NUM
brj-24894	87	36	kda	kda	NOUN
brj-24894	87	37	)	)	PUNCT
brj-24894	87	38	calibration	calibration	NOUN
brj-24894	87	39	kit	kit	NOUN
brj-24894	87	40	(	(	PUNCT
brj-24894	87	41	cytiva	cytiva	PROPN
brj-24894	87	42	,	,	PUNCT
brj-24894	87	43	sweden	sweden	PROPN
brj-24894	87	44	)	)	PUNCT
brj-24894	87	45	.	.	PUNCT
brj-24894	88	1	peer	peer	NOUN
brj-24894	88	2	-	-	PUNCT
brj-24894	88	3	reviewed	review	VERB
brj-24894	88	4	article	article	NOUN
brj-24894	88	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	88	6	li	li	PROPN
brj-24894	88	7	et	et	PROPN
brj-24894	88	8	al	al	PROPN
brj-24894	88	9	.	.	PROPN
brj-24894	89	1	(	(	PUNCT
brj-24894	89	2	2026	2026	NUM
brj-24894	89	3	)	)	PUNCT
brj-24894	89	4	.	.	PUNCT
brj-24894	90	1	“	"	PUNCT
brj-24894	90	2	endoglucanase	endoglucanase	VERB
brj-24894	90	3	tpcel12a	tpcel12a	NOUN
brj-24894	90	4	traits	trait	NOUN
brj-24894	90	5	,	,	PUNCT
brj-24894	90	6	”	"	PUNCT
brj-24894	90	7	bioresources	bioresource	NOUN
brj-24894	90	8	21(1	21(1	NUM
brj-24894	90	9	)	)	PUNCT
brj-24894	90	10	,	,	PUNCT
brj-24894	90	11	547	547	NUM
brj-24894	90	12	-	-	SYM
brj-24894	90	13	569	569	NUM
brj-24894	90	14	.	.	NOUN
brj-24894	91	1	551	551	NUM
brj-24894	91	2	identification	identification	NOUN
brj-24894	91	3	and	and	CCONJ
brj-24894	91	4	sequencing	sequencing	NOUN
brj-24894	91	5	of	of	ADP
brj-24894	91	6	tpcel12a	tpcel12a	NOUN
brj-24894	91	7	n	n	CCONJ
brj-24894	91	8	-	-	PUNCT
brj-24894	91	9	terminus	terminus	NOUN
brj-24894	91	10	by	by	ADP
brj-24894	91	11	liquid	liquid	ADJ
brj-24894	91	12	chromatography	chromatography	NOUN
brj-24894	91	13	-	-	PUNCT
brj-24894	91	14	tandem	tandem	NOUN
brj-24894	91	15	mass	mass	ADJ
brj-24894	91	16	spectrometry	spectrometry	NOUN
brj-24894	91	17	(	(	PUNCT
brj-24894	91	18	lc	lc	PROPN
brj-24894	91	19	-	-	PUNCT
brj-24894	91	20	ms	ms	PROPN
brj-24894	91	21	/	/	SYM
brj-24894	91	22	ms	ms	PROPN
brj-24894	91	23	)	)	PUNCT
brj-24894	91	24	lc	lc	PROPN
brj-24894	91	25	-	-	PUNCT
brj-24894	91	26	ms	ms	PROPN
brj-24894	91	27	/	/	PROPN
brj-24894	91	28	ms	ms	PROPN
brj-24894	91	29	was	be	AUX
brj-24894	91	30	applied	apply	VERB
brj-24894	91	31	to	to	PART
brj-24894	91	32	determine	determine	VERB
brj-24894	91	33	the	the	DET
brj-24894	91	34	n	n	CCONJ
brj-24894	91	35	-	-	PUNCT
brj-24894	91	36	terminal	terminal	ADJ
brj-24894	91	37	sequence	sequence	NOUN
brj-24894	91	38	of	of	ADP
brj-24894	91	39	tpcel12a	tpcel12a	NOUN
brj-24894	91	40	.	.	PUNCT
brj-24894	92	1	generally	generally	ADV
brj-24894	92	2	,	,	PUNCT
brj-24894	92	3	the	the	DET
brj-24894	92	4	purified	purified	ADJ
brj-24894	92	5	tpcel12a	tpcel12a	NOUN
brj-24894	92	6	were	be	AUX
brj-24894	92	7	reduced	reduce	VERB
brj-24894	92	8	with	with	ADP
brj-24894	92	9	10	10	NUM
brj-24894	92	10	mm	mm	NUM
brj-24894	92	11	dtt	dtt	NOUN
brj-24894	92	12	,	,	PUNCT
brj-24894	92	13	alkylated	alkylate	VERB
brj-24894	92	14	with	with	ADP
brj-24894	92	15	iodoacetaminde	iodoacetaminde	NOUN
brj-24894	92	16	in	in	ADP
brj-24894	92	17	the	the	DET
brj-24894	92	18	dark	dark	NOUN
brj-24894	92	19	at	at	ADP
brj-24894	92	20	room	room	NOUN
brj-24894	92	21	temperature	temperature	NOUN
brj-24894	92	22	,	,	PUNCT
brj-24894	92	23	and	and	CCONJ
brj-24894	92	24	digested	digest	VERB
brj-24894	92	25	with	with	ADP
brj-24894	92	26	endoproteinase	endoproteinase	PROPN
brj-24894	92	27	glu	glu	PROPN
brj-24894	92	28	-	-	PUNCT
brj-24894	92	29	c	c	NOUN
brj-24894	92	30	using	use	VERB
brj-24894	92	31	a	a	DET
brj-24894	92	32	standard	standard	ADJ
brj-24894	92	33	protocol	protocol	NOUN
brj-24894	92	34	.	.	PUNCT
brj-24894	93	1	detailed	detailed	ADJ
brj-24894	93	2	procedures	procedure	NOUN
brj-24894	93	3	are	be	AUX
brj-24894	93	4	described	describe	VERB
brj-24894	93	5	in	in	ADP
brj-24894	93	6	the	the	DET
brj-24894	93	7	appendix	appendix	ADJ
brj-24894	93	8	iii	iii	NOUN
brj-24894	93	9	.	.	PUNCT
brj-24894	93	10	prior	prior	ADV
brj-24894	93	11	to	to	ADP
brj-24894	93	12	analysis	analysis	NOUN
brj-24894	93	13	,	,	PUNCT
brj-24894	93	14	the	the	DET
brj-24894	93	15	peptides	peptide	NOUN
brj-24894	93	16	were	be	AUX
brj-24894	93	17	reconstituted	reconstitute	VERB
brj-24894	93	18	in	in	ADP
brj-24894	93	19	10	10	NUM
brj-24894	93	20	μl	μl	ADP
brj-24894	93	21	of	of	ADP
brj-24894	93	22	0.1	0.1	NUM
brj-24894	93	23	%	%	NOUN
brj-24894	93	24	(	(	PUNCT
brj-24894	93	25	v	v	NOUN
brj-24894	93	26	/	/	SYM
brj-24894	93	27	v	v	NOUN
brj-24894	93	28	)	)	PUNCT
brj-24894	93	29	formic	formic	ADJ
brj-24894	93	30	acid	acid	NOUN
brj-24894	93	31	.	.	PUNCT
brj-24894	94	1	then	then	ADV
brj-24894	94	2	lcms	lcms	PROPN
brj-24894	94	3	/	/	SYM
brj-24894	94	4	ms	ms	PROPN
brj-24894	94	5	was	be	AUX
brj-24894	94	6	performed	perform	VERB
brj-24894	94	7	to	to	PART
brj-24894	94	8	analyze	analyze	VERB
brj-24894	94	9	the	the	DET
brj-24894	94	10	digests	digest	NOUN
brj-24894	94	11	.	.	PUNCT
brj-24894	95	1	detailed	detailed	ADJ
brj-24894	95	2	procedures	procedure	NOUN
brj-24894	95	3	were	be	AUX
brj-24894	95	4	provided	provide	VERB
brj-24894	95	5	in	in	ADP
brj-24894	95	6	the	the	DET
brj-24894	95	7	appendix	appendix	PROPN
brj-24894	95	8	iii	iii	PROPN
brj-24894	95	9	.	.	PUNCT
brj-24894	95	10	tpcel12a	tpcel12a	NOUN
brj-24894	95	11	activity	activity	NOUN
brj-24894	95	12	assay	assay	VERB
brj-24894	95	13	and	and	CCONJ
brj-24894	95	14	substrate	substrate	NOUN
brj-24894	95	15	specificity	specificity	NOUN
brj-24894	95	16	endoglucanase	endoglucanase	NOUN
brj-24894	95	17	activity	activity	NOUN
brj-24894	95	18	of	of	ADP
brj-24894	95	19	tpcel12a	tpcel12a	NOUN
brj-24894	95	20	was	be	AUX
brj-24894	95	21	determined	determine	VERB
brj-24894	95	22	by	by	ADP
brj-24894	95	23	measuring	measure	VERB
brj-24894	95	24	the	the	DET
brj-24894	95	25	amount	amount	NOUN
brj-24894	95	26	of	of	ADP
brj-24894	95	27	reducing	reduce	VERB
brj-24894	95	28	sugars	sugar	NOUN
brj-24894	95	29	produced	produce	VERB
brj-24894	95	30	from	from	ADP
brj-24894	95	31	xyloglucan	xyloglucan	NOUN
brj-24894	95	32	or	or	CCONJ
brj-24894	95	33	cmc	cmc	NOUN
brj-24894	95	34	with	with	ADP
brj-24894	95	35	the	the	DET
brj-24894	95	36	3,5	3,5	NUM
brj-24894	95	37	-	-	PUNCT
brj-24894	95	38	dinitrosalicylic	dinitrosalicylic	ADJ
brj-24894	95	39	acid	acid	NOUN
brj-24894	95	40	(	(	PUNCT
brj-24894	95	41	dns	dns	NOUN
brj-24894	95	42	)	)	PUNCT
brj-24894	95	43	method	method	NOUN
brj-24894	95	44	(	(	PUNCT
brj-24894	95	45	miller	miller	PROPN
brj-24894	95	46	1959	1959	NUM
brj-24894	95	47	)	)	PUNCT
brj-24894	95	48	.	.	PUNCT
brj-24894	96	1	the	the	DET
brj-24894	96	2	reaction	reaction	NOUN
brj-24894	96	3	mixture	mixture	NOUN
brj-24894	96	4	was	be	AUX
brj-24894	96	5	prepared	prepare	VERB
brj-24894	96	6	by	by	ADP
brj-24894	96	7	mixing	mix	VERB
brj-24894	96	8	10	10	NUM
brj-24894	96	9	μl	μl	ADP
brj-24894	96	10	purified	purified	ADJ
brj-24894	96	11	tpcelo12a	tpcelo12a	NOUN
brj-24894	96	12	of	of	ADP
brj-24894	96	13	appropriately	appropriately	ADV
brj-24894	96	14	diluted	dilute	VERB
brj-24894	96	15	enzyme	enzyme	NOUN
brj-24894	96	16	solution	solution	NOUN
brj-24894	96	17	with	with	ADP
brj-24894	96	18	90	90	NUM
brj-24894	96	19	μl	μl	NUM
brj-24894	96	20	of	of	ADP
brj-24894	96	21	10	10	NUM
brj-24894	96	22	mg	mg	NUM
brj-24894	96	23	/	/	SYM
brj-24894	96	24	ml	ml	NOUN
brj-24894	96	25	xyloglucan	xyloglucan	NOUN
brj-24894	96	26	or	or	CCONJ
brj-24894	96	27	cmc	cmc	NOUN
brj-24894	96	28	dissolved	dissolve	VERB
brj-24894	96	29	in	in	ADP
brj-24894	96	30	50	50	NUM
brj-24894	96	31	mm	mm	NUM
brj-24894	96	32	sodium	sodium	NOUN
brj-24894	96	33	citrate	citrate	NOUN
brj-24894	96	34	buffer	buffer	NOUN
brj-24894	96	35	(	(	PUNCT
brj-24894	96	36	ph	ph	NOUN
brj-24894	96	37	4.0	4.0	NUM
brj-24894	96	38	)	)	PUNCT
brj-24894	96	39	at	at	ADP
brj-24894	96	40	50	50	NUM
brj-24894	96	41	℃	℃	PROPN
brj-24894	96	42	for	for	ADP
brj-24894	96	43	30	30	NUM
brj-24894	96	44	min	min	NOUN
brj-24894	96	45	.	.	PROPN
brj-24894	97	1	about	about	ADV
brj-24894	97	2	0.1	0.1	NUM
brj-24894	97	3	ml	ml	NOUN
brj-24894	97	4	dns	dns	NOUN
brj-24894	97	5	was	be	AUX
brj-24894	97	6	added	add	VERB
brj-24894	97	7	to	to	PART
brj-24894	97	8	stop	stop	VERB
brj-24894	97	9	the	the	DET
brj-24894	97	10	hydrolysis	hydrolysis	NOUN
brj-24894	97	11	reaction	reaction	NOUN
brj-24894	97	12	.	.	PUNCT
brj-24894	98	1	the	the	DET
brj-24894	98	2	tubes	tube	NOUN
brj-24894	98	3	were	be	AUX
brj-24894	98	4	placed	place	VERB
brj-24894	98	5	in	in	ADP
brj-24894	98	6	the	the	DET
brj-24894	98	7	boiling	boiling	NOUN
brj-24894	98	8	water	water	NOUN
brj-24894	98	9	for	for	ADP
brj-24894	98	10	5	5	NUM
brj-24894	98	11	min	min	NOUN
brj-24894	98	12	,	,	PUNCT
brj-24894	98	13	and	and	CCONJ
brj-24894	98	14	then	then	ADV
brj-24894	98	15	they	they	PRON
brj-24894	98	16	were	be	AUX
brj-24894	98	17	immediately	immediately	ADV
brj-24894	98	18	cooled	cool	VERB
brj-24894	98	19	to	to	ADP
brj-24894	98	20	room	room	NOUN
brj-24894	98	21	temperature	temperature	NOUN
brj-24894	98	22	.	.	PUNCT
brj-24894	99	1	after	after	ADP
brj-24894	99	2	diluting	dilute	VERB
brj-24894	99	3	the	the	DET
brj-24894	99	4	reaction	reaction	NOUN
brj-24894	99	5	mixtures	mixture	NOUN
brj-24894	99	6	with	with	ADP
brj-24894	99	7	0.8	0.8	NUM
brj-24894	99	8	ml	ml	PART
brj-24894	99	9	dd	dd	VERB
brj-24894	99	10	-	-	PUNCT
brj-24894	99	11	h2o	h2o	NOUN
brj-24894	99	12	,	,	PUNCT
brj-24894	99	13	the	the	DET
brj-24894	99	14	absorbance	absorbance	NOUN
brj-24894	99	15	was	be	AUX
brj-24894	99	16	measured	measure	VERB
brj-24894	99	17	at	at	ADP
brj-24894	99	18	540	540	NUM
brj-24894	99	19	nm	nm	NOUN
brj-24894	99	20	.	.	PUNCT
brj-24894	100	1	one	one	NUM
brj-24894	100	2	unit	unit	NOUN
brj-24894	100	3	(	(	PUNCT
brj-24894	100	4	u	u	NOUN
brj-24894	100	5	)	)	PUNCT
brj-24894	100	6	activity	activity	NOUN
brj-24894	100	7	was	be	AUX
brj-24894	100	8	defined	define	VERB
brj-24894	100	9	as	as	ADP
brj-24894	100	10	the	the	DET
brj-24894	100	11	amount	amount	NOUN
brj-24894	100	12	of	of	ADP
brj-24894	100	13	enzyme	enzyme	NOUN
brj-24894	100	14	that	that	PRON
brj-24894	100	15	produced	produce	VERB
brj-24894	100	16	1.0	1.0	NUM
brj-24894	100	17	μmol	μmol	NOUN
brj-24894	100	18	of	of	ADP
brj-24894	100	19	glucose	glucose	NOUN
brj-24894	100	20	equivalent	equivalent	ADJ
brj-24894	100	21	per	per	ADP
brj-24894	100	22	minute	minute	NOUN
brj-24894	100	23	under	under	ADP
brj-24894	100	24	standard	standard	ADJ
brj-24894	100	25	assay	assay	NOUN
brj-24894	100	26	conditions	condition	NOUN
brj-24894	100	27	.	.	PUNCT
brj-24894	101	1	tpcel12a	tpcel12a	PROPN
brj-24894	101	2	content	content	NOUN
brj-24894	101	3	was	be	AUX
brj-24894	101	4	determined	determine	VERB
brj-24894	101	5	by	by	ADP
brj-24894	101	6	the	the	DET
brj-24894	101	7	bradford	bradford	PROPN
brj-24894	101	8	method	method	NOUN
brj-24894	101	9	using	use	VERB
brj-24894	101	10	bovine	bovine	NOUN
brj-24894	101	11	serum	serum	NOUN
brj-24894	101	12	albumin	albumin	PROPN
brj-24894	101	13	(	(	PUNCT
brj-24894	101	14	bsa	bsa	PROPN
brj-24894	101	15	)	)	PUNCT
brj-24894	101	16	as	as	ADP
brj-24894	101	17	a	a	DET
brj-24894	101	18	standard	standard	NOUN
brj-24894	101	19	.	.	PUNCT
brj-24894	102	1	substrate	substrate	NOUN
brj-24894	102	2	specificity	specificity	NOUN
brj-24894	102	3	was	be	AUX
brj-24894	102	4	examined	examine	VERB
brj-24894	102	5	in	in	ADP
brj-24894	102	6	assays	assay	NOUN
brj-24894	102	7	using	use	VERB
brj-24894	102	8	a	a	DET
brj-24894	102	9	range	range	NOUN
brj-24894	102	10	of	of	ADP
brj-24894	102	11	substrates	substrate	NOUN
brj-24894	102	12	.	.	PUNCT
brj-24894	103	1	substrates	substrate	NOUN
brj-24894	103	2	were	be	AUX
brj-24894	103	3	prepared	prepare	VERB
brj-24894	103	4	as	as	ADP
brj-24894	103	5	10	10	NUM
brj-24894	103	6	mg	mg	NUM
brj-24894	103	7	/	/	SYM
brj-24894	103	8	ml	ml	X
brj-24894	103	9	in	in	ADP
brj-24894	103	10	citrate	citrate	NOUN
brj-24894	103	11	buffer	buffer	NOUN
brj-24894	103	12	(	(	PUNCT
brj-24894	103	13	ph	ph	NOUN
brj-24894	103	14	4.0	4.0	NUM
brj-24894	103	15	)	)	PUNCT
brj-24894	103	16	.	.	PUNCT
brj-24894	104	1	the	the	DET
brj-24894	104	2	tested	test	VERB
brj-24894	104	3	substrates	substrate	NOUN
brj-24894	104	4	were	be	AUX
brj-24894	104	5	xyloglucan	xyloglucan	ADJ
brj-24894	104	6	,	,	PUNCT
brj-24894	104	7	cmc	cmc	PROPN
brj-24894	104	8	,	,	PUNCT
brj-24894	104	9	β-1,3	β-1,3	PROPN
brj-24894	104	10	-	-	PUNCT
brj-24894	104	11	1,4	1,4	NUM
brj-24894	104	12	-	-	PUNCT
brj-24894	104	13	glucan	glucan	NOUN
brj-24894	104	14	,	,	PUNCT
brj-24894	104	15	d	d	ADJ
brj-24894	104	16	-	-	PUNCT
brj-24894	104	17	galactosyl	galactosyl	ADJ
brj-24894	104	18	-	-	PUNCT
brj-24894	104	19	d	d	NOUN
brj-24894	104	20	-	-	PUNCT
brj-24894	104	21	mannan	mannan	NOUN
brj-24894	104	22	,	,	PUNCT
brj-24894	104	23	β	β	NOUN
brj-24894	104	24	-	-	ADJ
brj-24894	104	25	d	d	NOUN
brj-24894	104	26	-	-	PUNCT
brj-24894	104	27	mannan	mannan	NOUN
brj-24894	104	28	,	,	PUNCT
brj-24894	104	29	xylan	xylan	PROPN
brj-24894	104	30	,	,	PUNCT
brj-24894	104	31	arabinogalactan	arabinogalactan	PROPN
brj-24894	104	32	,	,	PUNCT
brj-24894	104	33	and	and	CCONJ
brj-24894	104	34	pectin	pectin	NOUN
brj-24894	104	35	.	.	PUNCT
brj-24894	105	1	the	the	DET
brj-24894	105	2	reaction	reaction	NOUN
brj-24894	105	3	mixtures	mixture	NOUN
brj-24894	105	4	were	be	AUX
brj-24894	105	5	prepared	prepare	VERB
brj-24894	105	6	as	as	ADP
brj-24894	105	7	described	describe	VERB
brj-24894	105	8	above	above	ADV
brj-24894	105	9	.	.	PUNCT
brj-24894	106	1	the	the	DET
brj-24894	106	2	maximum	maximum	ADJ
brj-24894	106	3	activity	activity	NOUN
brj-24894	106	4	of	of	ADP
brj-24894	106	5	substrate	substrate	NOUN
brj-24894	106	6	was	be	AUX
brj-24894	106	7	defined	define	VERB
brj-24894	106	8	as	as	ADP
brj-24894	106	9	100	100	NUM
brj-24894	106	10	%	%	NOUN
brj-24894	106	11	,	,	PUNCT
brj-24894	106	12	tpcel12a	tpcel12a	NOUN
brj-24894	106	13	activity	activity	NOUN
brj-24894	106	14	towards	towards	ADP
brj-24894	106	15	other	other	ADJ
brj-24894	106	16	substrates	substrate	NOUN
brj-24894	106	17	was	be	AUX
brj-24894	106	18	calculated	calculate	VERB
brj-24894	106	19	according	accord	VERB
brj-24894	106	20	to	to	ADP
brj-24894	106	21	the	the	DET
brj-24894	106	22	maximum	maximum	ADJ
brj-24894	106	23	activity	activity	NOUN
brj-24894	106	24	.	.	PUNCT
brj-24894	107	1	biochemical	biochemical	ADJ
brj-24894	107	2	characterization	characterization	NOUN
brj-24894	107	3	of	of	ADP
brj-24894	107	4	tpcel12a	tpcel12a	NOUN
brj-24894	107	5	and	and	CCONJ
brj-24894	107	6	its	its	PRON
brj-24894	107	7	mutant	mutant	NOUN
brj-24894	107	8	the	the	DET
brj-24894	107	9	optimum	optimum	ADJ
brj-24894	107	10	conditions	condition	NOUN
brj-24894	107	11	for	for	ADP
brj-24894	107	12	activity	activity	NOUN
brj-24894	107	13	of	of	ADP
brj-24894	107	14	tpcel12a	tpcel12a	NOUN
brj-24894	107	15	were	be	AUX
brj-24894	107	16	determined	determine	VERB
brj-24894	107	17	by	by	ADP
brj-24894	107	18	assaying	assay	VERB
brj-24894	107	19	the	the	DET
brj-24894	107	20	enzyme	enzyme	NOUN
brj-24894	107	21	activity	activity	NOUN
brj-24894	107	22	in	in	ADP
brj-24894	107	23	a	a	DET
brj-24894	107	24	wide	wide	ADJ
brj-24894	107	25	range	range	NOUN
brj-24894	107	26	of	of	ADP
brj-24894	107	27	ph	ph	NOUN
brj-24894	107	28	and	and	CCONJ
brj-24894	107	29	temperatures	temperature	NOUN
brj-24894	107	30	with	with	ADP
brj-24894	107	31	xyloglucan	xyloglucan	NOUN
brj-24894	107	32	as	as	ADP
brj-24894	107	33	substrate	substrate	NOUN
brj-24894	107	34	.	.	PUNCT
brj-24894	108	1	in	in	ADP
brj-24894	108	2	order	order	NOUN
brj-24894	108	3	to	to	PART
brj-24894	108	4	determine	determine	VERB
brj-24894	108	5	the	the	DET
brj-24894	108	6	optimal	optimal	ADJ
brj-24894	108	7	ph	ph	NOUN
brj-24894	108	8	for	for	ADP
brj-24894	108	9	activity	activity	NOUN
brj-24894	108	10	,	,	PUNCT
brj-24894	108	11	the	the	DET
brj-24894	108	12	following	follow	VERB
brj-24894	108	13	buffers	buffer	NOUN
brj-24894	108	14	(	(	PUNCT
brj-24894	108	15	each	each	DET
brj-24894	108	16	50	50	NUM
brj-24894	108	17	mm	mm	NOUN
brj-24894	108	18	)	)	PUNCT
brj-24894	108	19	were	be	AUX
brj-24894	108	20	used	use	VERB
brj-24894	108	21	:	:	PUNCT
brj-24894	108	22	glycine	glycine	NOUN
brj-24894	108	23	-	-	PUNCT
brj-24894	108	24	hcl	hcl	PROPN
brj-24894	108	25	buffer	buffer	NOUN
brj-24894	108	26	for	for	ADP
brj-24894	108	27	ph	ph	PROPN
brj-24894	108	28	2.0	2.0	NUM
brj-24894	108	29	and	and	CCONJ
brj-24894	108	30	3.0	3.0	NUM
brj-24894	108	31	,	,	PUNCT
brj-24894	108	32	sodium	sodium	NOUN
brj-24894	108	33	citrate	citrate	NOUN
brj-24894	108	34	buffer	buffer	NOUN
brj-24894	108	35	for	for	ADP
brj-24894	108	36	ph	ph	ADJ
brj-24894	108	37	3.0	3.0	NUM
brj-24894	108	38	and	and	CCONJ
brj-24894	108	39	4.0	4.0	NUM
brj-24894	108	40	,	,	PUNCT
brj-24894	108	41	sodium	sodium	NOUN
brj-24894	108	42	acetate	acetate	NOUN
brj-24894	108	43	buffer	buffer	NOUN
brj-24894	108	44	for	for	ADP
brj-24894	108	45	ph	ph	ADJ
brj-24894	108	46	4.0	4.0	NUM
brj-24894	108	47	,	,	PUNCT
brj-24894	108	48	5.0	5.0	NUM
brj-24894	108	49	and	and	CCONJ
brj-24894	108	50	6.0	6.0	NUM
brj-24894	108	51	,	,	PUNCT
brj-24894	108	52	sodium	sodium	NOUN
brj-24894	108	53	phosphate	phosphate	NOUN
brj-24894	108	54	buffer	buffer	NOUN
brj-24894	108	55	for	for	ADP
brj-24894	108	56	ph	ph	ADJ
brj-24894	108	57	6.0	6.0	NUM
brj-24894	108	58	,	,	PUNCT
brj-24894	108	59	7.0	7.0	NUM
brj-24894	108	60	and	and	CCONJ
brj-24894	108	61	8.0	8.0	NUM
brj-24894	108	62	.	.	PUNCT
brj-24894	109	1	the	the	DET
brj-24894	109	2	reaction	reaction	NOUN
brj-24894	109	3	mixture	mixture	NOUN
brj-24894	109	4	was	be	AUX
brj-24894	109	5	incubated	incubate	VERB
brj-24894	109	6	at	at	ADP
brj-24894	109	7	50	50	NUM
brj-24894	109	8	℃	℃	PROPN
brj-24894	109	9	for	for	ADP
brj-24894	109	10	30	30	NUM
brj-24894	109	11	min	min	NOUN
brj-24894	109	12	.	.	PROPN
brj-24894	110	1	and	and	CCONJ
brj-24894	110	2	then	then	ADV
brj-24894	110	3	the	the	DET
brj-24894	110	4	reducing	reduce	VERB
brj-24894	110	5	sugars	sugar	NOUN
brj-24894	110	6	were	be	AUX
brj-24894	110	7	quantified	quantify	VERB
brj-24894	110	8	with	with	ADP
brj-24894	110	9	the	the	DET
brj-24894	110	10	described	describe	VERB
brj-24894	110	11	above	above	ADP
brj-24894	110	12	method	method	NOUN
brj-24894	110	13	.	.	PUNCT
brj-24894	111	1	ph	ph	ADJ
brj-24894	111	2	stability	stability	NOUN
brj-24894	111	3	of	of	ADP
brj-24894	111	4	tpcel12a	tpcel12a	NOUN
brj-24894	111	5	was	be	AUX
brj-24894	111	6	assessed	assess	VERB
brj-24894	111	7	by	by	ADP
brj-24894	111	8	measuring	measure	VERB
brj-24894	111	9	the	the	DET
brj-24894	111	10	residual	residual	ADJ
brj-24894	111	11	activity	activity	NOUN
brj-24894	111	12	after	after	ADP
brj-24894	111	13	incubation	incubation	NOUN
brj-24894	111	14	in	in	ADP
brj-24894	111	15	the	the	DET
brj-24894	111	16	described	describe	VERB
brj-24894	111	17	above	above	ADP
brj-24894	111	18	buffers	buffer	NOUN
brj-24894	111	19	for	for	ADP
brj-24894	111	20	1	1	NUM
brj-24894	111	21	h	h	NOUN
brj-24894	111	22	at	at	ADP
brj-24894	111	23	room	room	NOUN
brj-24894	111	24	temperature	temperature	NOUN
brj-24894	111	25	without	without	ADP
brj-24894	111	26	substrate	substrate	NOUN
brj-24894	111	27	.	.	PUNCT
brj-24894	112	1	to	to	PART
brj-24894	112	2	investigate	investigate	VERB
brj-24894	112	3	the	the	DET
brj-24894	112	4	optimal	optimal	ADJ
brj-24894	112	5	temperature	temperature	NOUN
brj-24894	112	6	for	for	ADP
brj-24894	112	7	tpcel12a	tpcel12a	NOUN
brj-24894	112	8	activity	activity	NOUN
brj-24894	112	9	,	,	PUNCT
brj-24894	112	10	the	the	DET
brj-24894	112	11	citrate	citrate	NOUN
brj-24894	112	12	buffer	buffer	NOUN
brj-24894	112	13	with	with	ADP
brj-24894	112	14	ph	ph	ADJ
brj-24894	112	15	4.0	4.0	NUM
brj-24894	112	16	was	be	AUX
brj-24894	112	17	used	use	VERB
brj-24894	112	18	.	.	PUNCT
brj-24894	113	1	the	the	DET
brj-24894	113	2	reaction	reaction	NOUN
brj-24894	113	3	mixtures	mixture	NOUN
brj-24894	113	4	were	be	AUX
brj-24894	113	5	incubated	incubate	VERB
brj-24894	113	6	at	at	ADP
brj-24894	113	7	different	different	ADJ
brj-24894	113	8	temperatures	temperature	NOUN
brj-24894	113	9	(	(	PUNCT
brj-24894	113	10	30	30	NUM
brj-24894	113	11	℃	℃	PROPN
brj-24894	113	12	to	to	ADP
brj-24894	113	13	90	90	NUM
brj-24894	113	14	℃	℃	PROPN
brj-24894	113	15	)	)	PUNCT
brj-24894	113	16	for	for	ADP
brj-24894	113	17	30	30	NUM
brj-24894	113	18	min	min	NOUN
brj-24894	113	19	.	.	PROPN
brj-24894	113	20	tpcel12a	tpcel12a	PROPN
brj-24894	113	21	thermostability	thermostability	PROPN
brj-24894	113	22	was	be	AUX
brj-24894	113	23	analyzed	analyze	VERB
brj-24894	113	24	by	by	ADP
brj-24894	113	25	detecting	detect	VERB
brj-24894	113	26	the	the	DET
brj-24894	113	27	residual	residual	ADJ
brj-24894	113	28	activity	activity	NOUN
brj-24894	113	29	after	after	ADP
brj-24894	113	30	incubation	incubation	NOUN
brj-24894	113	31	at	at	ADP
brj-24894	113	32	30	30	NUM
brj-24894	113	33	to	to	PART
brj-24894	113	34	80	80	NUM
brj-24894	113	35	℃	℃	PROPN
brj-24894	113	36	for	for	ADP
brj-24894	113	37	1	1	NUM
brj-24894	113	38	h	h	NOUN
brj-24894	113	39	without	without	ADP
brj-24894	113	40	substrate	substrate	NOUN
brj-24894	113	41	.	.	PUNCT
brj-24894	114	1	kinetic	kinetic	ADJ
brj-24894	114	2	parameters	parameter	NOUN
brj-24894	114	3	of	of	ADP
brj-24894	114	4	tpcel12a	tpcel12a	NOUN
brj-24894	114	5	and	and	CCONJ
brj-24894	114	6	its	its	PRON
brj-24894	114	7	mutant	mutant	ADJ
brj-24894	114	8	km	km	NOUN
brj-24894	114	9	and	and	CCONJ
brj-24894	114	10	vmax	vmax	PROPN
brj-24894	114	11	values	value	NOUN
brj-24894	114	12	of	of	ADP
brj-24894	114	13	tpcel12a	tpcel12a	NOUN
brj-24894	114	14	and	and	CCONJ
brj-24894	114	15	its	its	PRON
brj-24894	114	16	mutant	mutant	NOUN
brj-24894	114	17	were	be	AUX
brj-24894	114	18	determined	determine	VERB
brj-24894	114	19	in	in	ADP
brj-24894	114	20	sodium	sodium	NOUN
brj-24894	114	21	acetate	acetate	NOUN
brj-24894	114	22	buffer	buffer	NOUN
brj-24894	114	23	(	(	PUNCT
brj-24894	114	24	ph	ph	NOUN
brj-24894	114	25	4.0	4.0	NUM
brj-24894	114	26	,	,	PUNCT
brj-24894	114	27	50	50	NUM
brj-24894	114	28	mm	mm	NOUN
brj-24894	114	29	)	)	PUNCT
brj-24894	114	30	containing	contain	VERB
brj-24894	114	31	1.0	1.0	NUM
brj-24894	114	32	to	to	PART
brj-24894	114	33	10	10	NUM
brj-24894	114	34	mg	mg	NOUN
brj-24894	114	35	/	/	SYM
brj-24894	114	36	ml	ml	NOUN
brj-24894	114	37	xyloglucan	xyloglucan	NOUN
brj-24894	114	38	at	at	ADP
brj-24894	114	39	40	40	NUM
brj-24894	114	40	℃	℃	PROPN
brj-24894	114	41	(	(	PUNCT
brj-24894	114	42	tpcel12a	tpcel12a	NOUN
brj-24894	114	43	)	)	PUNCT
brj-24894	114	44	or	or	CCONJ
brj-24894	114	45	50	50	NUM
brj-24894	114	46	peer	peer	NOUN
brj-24894	114	47	-	-	PUNCT
brj-24894	114	48	reviewed	review	VERB
brj-24894	114	49	article	article	NOUN
brj-24894	114	50	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	114	51	li	li	PROPN
brj-24894	114	52	et	et	PROPN
brj-24894	114	53	al	al	PROPN
brj-24894	114	54	.	.	PROPN
brj-24894	115	1	(	(	PUNCT
brj-24894	115	2	2026	2026	NUM
brj-24894	115	3	)	)	PUNCT
brj-24894	115	4	.	.	PUNCT
brj-24894	116	1	“	"	PUNCT
brj-24894	116	2	endoglucanase	endoglucanase	VERB
brj-24894	116	3	tpcel12a	tpcel12a	NOUN
brj-24894	116	4	traits	trait	NOUN
brj-24894	116	5	,	,	PUNCT
brj-24894	116	6	”	"	PUNCT
brj-24894	116	7	bioresources	bioresource	NOUN
brj-24894	116	8	21(1	21(1	NUM
brj-24894	116	9	)	)	PUNCT
brj-24894	116	10	,	,	PUNCT
brj-24894	116	11	547	547	NUM
brj-24894	116	12	-	-	SYM
brj-24894	116	13	569	569	NUM
brj-24894	116	14	.	.	PUNCT
brj-24894	117	1	552	552	NUM
brj-24894	117	2	℃	℃	PROPN
brj-24894	117	3	(	(	PUNCT
brj-24894	117	4	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	117	5	)	)	PUNCT
brj-24894	117	6	)	)	PUNCT
brj-24894	117	7	for	for	ADP
brj-24894	117	8	5	5	NUM
brj-24894	117	9	min	min	NOUN
brj-24894	117	10	.	.	PUNCT
brj-24894	118	1	the	the	DET
brj-24894	118	2	set	set	NOUN
brj-24894	118	3	of	of	ADP
brj-24894	118	4	experiments	experiment	NOUN
brj-24894	118	5	was	be	AUX
brj-24894	118	6	carried	carry	VERB
brj-24894	118	7	out	out	ADP
brj-24894	118	8	three	three	NUM
brj-24894	118	9	times	time	NOUN
brj-24894	118	10	,	,	PUNCT
brj-24894	118	11	and	and	CCONJ
brj-24894	118	12	each	each	DET
brj-24894	118	13	individual	individual	ADJ
brj-24894	118	14	experiment	experiment	NOUN
brj-24894	118	15	included	include	VERB
brj-24894	118	16	triplicate	triplicate	NOUN
brj-24894	118	17	tests	test	NOUN
brj-24894	118	18	.	.	PUNCT
brj-24894	119	1	the	the	DET
brj-24894	119	2	kinetic	kinetic	ADJ
brj-24894	119	3	parameters	parameter	NOUN
brj-24894	119	4	were	be	AUX
brj-24894	119	5	calculated	calculate	VERB
brj-24894	119	6	based	base	VERB
brj-24894	119	7	on	on	ADP
brj-24894	119	8	the	the	DET
brj-24894	119	9	lineweaver	lineweaver	ADJ
brj-24894	119	10	-	-	PUNCT
brj-24894	119	11	burk	burk	NOUN
brj-24894	119	12	or	or	CCONJ
brj-24894	119	13	michaelis	michaeli	NOUN
brj-24894	119	14	-	-	PUNCT
brj-24894	119	15	menten	menten	ADJ
brj-24894	119	16	plotting	plotting	NOUN
brj-24894	119	17	using	use	VERB
brj-24894	119	18	graphpad	graphpad	NOUN
brj-24894	119	19	.	.	PUNCT
brj-24894	120	1	effects	effect	NOUN
brj-24894	120	2	of	of	ADP
brj-24894	120	3	additives	additive	NOUN
brj-24894	120	4	on	on	ADP
brj-24894	120	5	the	the	DET
brj-24894	120	6	activity	activity	NOUN
brj-24894	120	7	of	of	ADP
brj-24894	120	8	tpcel12a	tpcel12a	VERB
brj-24894	120	9	the	the	DET
brj-24894	120	10	influence	influence	NOUN
brj-24894	120	11	of	of	ADP
brj-24894	120	12	metal	metal	NOUN
brj-24894	120	13	ions	ion	NOUN
brj-24894	120	14	(	(	PUNCT
brj-24894	120	15	na+	na+	NOUN
brj-24894	120	16	,	,	PUNCT
brj-24894	120	17	k+	k+	NOUN
brj-24894	120	18	,	,	PUNCT
brj-24894	120	19	nh4	nh4	NOUN
brj-24894	121	1	+	+	NOUN
brj-24894	121	2	,	,	PUNCT
brj-24894	121	3	cu2	cu2	NOUN
brj-24894	121	4	+	+	PROPN
brj-24894	121	5	,	,	PUNCT
brj-24894	121	6	fe3	fe3	PROPN
brj-24894	121	7	+	+	PROPN
brj-24894	121	8	,	,	PUNCT
brj-24894	121	9	ca2	ca2	PROPN
brj-24894	121	10	+	+	PROPN
brj-24894	121	11	,	,	PUNCT
brj-24894	121	12	zn2	zn2	PROPN
brj-24894	121	13	+	+	PUNCT
brj-24894	121	14	and	and	CCONJ
brj-24894	121	15	mn2	mn2	VERB
brj-24894	121	16	+	+	NOUN
brj-24894	121	17	)	)	PUNCT
brj-24894	121	18	and	and	CCONJ
brj-24894	121	19	chemical	chemical	NOUN
brj-24894	121	20	reagents	reagent	NOUN
brj-24894	121	21	(	(	PUNCT
brj-24894	121	22	sds	sds	NOUN
brj-24894	121	23	,	,	PUNCT
brj-24894	121	24	dmso	dmso	NOUN
brj-24894	121	25	,	,	PUNCT
brj-24894	121	26	edta	edta	NOUN
brj-24894	121	27	,	,	PUNCT
brj-24894	121	28	glycerol	glycerol	NOUN
brj-24894	121	29	,	,	PUNCT
brj-24894	121	30	triton	triton	PROPN
brj-24894	121	31	x-100	x-100	PROPN
brj-24894	121	32	,	,	PUNCT
brj-24894	121	33	isopropanol	isopropanol	NOUN
brj-24894	121	34	and	and	CCONJ
brj-24894	121	35	methanol	methanol	NOUN
brj-24894	121	36	)	)	PUNCT
brj-24894	121	37	on	on	ADP
brj-24894	121	38	tpcel12a	tpcel12a	NOUN
brj-24894	121	39	activity	activity	NOUN
brj-24894	121	40	were	be	AUX
brj-24894	121	41	analyzed	analyze	VERB
brj-24894	121	42	.	.	PUNCT
brj-24894	122	1	different	different	ADJ
brj-24894	122	2	reagents	reagent	NOUN
brj-24894	122	3	with	with	ADP
brj-24894	122	4	final	final	ADJ
brj-24894	122	5	concentration	concentration	NOUN
brj-24894	122	6	5	5	NUM
brj-24894	122	7	mm	mm	NOUN
brj-24894	122	8	or	or	CCONJ
brj-24894	122	9	10	10	NUM
brj-24894	122	10	%	%	NOUN
brj-24894	122	11	(	(	PUNCT
brj-24894	122	12	v	v	NOUN
brj-24894	122	13	/	/	SYM
brj-24894	122	14	v	v	NOUN
brj-24894	122	15	)	)	PUNCT
brj-24894	122	16	were	be	AUX
brj-24894	122	17	added	add	VERB
brj-24894	122	18	into	into	ADP
brj-24894	122	19	the	the	DET
brj-24894	122	20	reaction	reaction	NOUN
brj-24894	122	21	mixtures	mixture	NOUN
brj-24894	122	22	.	.	PUNCT
brj-24894	123	1	and	and	CCONJ
brj-24894	123	2	the	the	DET
brj-24894	123	3	reaction	reaction	NOUN
brj-24894	123	4	was	be	AUX
brj-24894	123	5	carried	carry	VERB
brj-24894	123	6	out	out	ADP
brj-24894	123	7	in	in	ADP
brj-24894	123	8	optimal	optimal	ADJ
brj-24894	123	9	activity	activity	NOUN
brj-24894	123	10	conditions	condition	NOUN
brj-24894	123	11	for	for	ADP
brj-24894	123	12	30	30	NUM
brj-24894	123	13	min	min	NOUN
brj-24894	123	14	.	.	PUNCT
brj-24894	124	1	the	the	DET
brj-24894	124	2	reducing	reduce	VERB
brj-24894	124	3	sugars	sugar	NOUN
brj-24894	124	4	were	be	AUX
brj-24894	124	5	determined	determine	VERB
brj-24894	124	6	using	use	VERB
brj-24894	124	7	the	the	DET
brj-24894	124	8	described	describe	VERB
brj-24894	124	9	above	above	ADP
brj-24894	124	10	method	method	NOUN
brj-24894	124	11	.	.	PUNCT
brj-24894	125	1	reaction	reaction	NOUN
brj-24894	125	2	mixture	mixture	NOUN
brj-24894	125	3	without	without	ADP
brj-24894	125	4	any	any	DET
brj-24894	125	5	additives	additive	NOUN
brj-24894	125	6	were	be	AUX
brj-24894	125	7	defined	define	VERB
brj-24894	125	8	as	as	ADP
brj-24894	125	9	control	control	NOUN
brj-24894	125	10	.	.	PUNCT
brj-24894	126	1	all	all	DET
brj-24894	126	2	assays	assay	NOUN
brj-24894	126	3	were	be	AUX
brj-24894	126	4	performed	perform	VERB
brj-24894	126	5	in	in	ADP
brj-24894	126	6	triplicate	triplicate	NOUN
brj-24894	126	7	.	.	PUNCT
brj-24894	127	1	analysis	analysis	NOUN
brj-24894	127	2	of	of	ADP
brj-24894	127	3	xyloglucan	xyloglucan	NOUN
brj-24894	127	4	and	and	CCONJ
brj-24894	127	5	cmc	cmc	NOUN
brj-24894	127	6	hydrolysis	hydrolysis	NOUN
brj-24894	127	7	products	product	NOUN
brj-24894	127	8	catalyzed	catalyze	VERB
brj-24894	127	9	by	by	ADP
brj-24894	127	10	tpcel12a	tpcel12a	NOUN
brj-24894	127	11	matrix	matrix	NOUN
brj-24894	127	12	-	-	PUNCT
brj-24894	127	13	assisted	assist	VERB
brj-24894	127	14	laser	laser	NOUN
brj-24894	127	15	desorption	desorption	NOUN
brj-24894	127	16	/	/	SYM
brj-24894	127	17	ionization	ionization	NOUN
brj-24894	127	18	time	time	NOUN
brj-24894	127	19	-	-	PUNCT
brj-24894	127	20	of	of	ADP
brj-24894	127	21	-	-	PUNCT
brj-24894	127	22	flight	flight	NOUN
brj-24894	127	23	mass	mass	NOUN
brj-24894	127	24	spectroscopy	spectroscopy	NOUN
brj-24894	127	25	(	(	PUNCT
brj-24894	127	26	maldi	maldi	NOUN
brj-24894	127	27	-	-	PUNCT
brj-24894	127	28	tof	tof	PRON
brj-24894	127	29	ms	ms	NOUN
brj-24894	127	30	)	)	PUNCT
brj-24894	127	31	analysis	analysis	NOUN
brj-24894	127	32	was	be	AUX
brj-24894	127	33	performed	perform	VERB
brj-24894	127	34	to	to	PART
brj-24894	127	35	determine	determine	VERB
brj-24894	127	36	the	the	DET
brj-24894	127	37	final	final	ADJ
brj-24894	127	38	hydrolysis	hydrolysis	NOUN
brj-24894	127	39	products	product	NOUN
brj-24894	127	40	of	of	ADP
brj-24894	127	41	xyloglucan	xyloglucan	NOUN
brj-24894	127	42	or	or	CCONJ
brj-24894	127	43	cmc	cmc	NOUN
brj-24894	127	44	catalyzed	catalyze	VERB
brj-24894	127	45	by	by	ADP
brj-24894	127	46	tpcel12a	tpcel12a	NOUN
brj-24894	127	47	.	.	PUNCT
brj-24894	128	1	detailed	detailed	ADJ
brj-24894	128	2	procedure	procedure	NOUN
brj-24894	128	3	could	could	AUX
brj-24894	128	4	be	be	AUX
brj-24894	128	5	found	find	VERB
brj-24894	128	6	in	in	ADP
brj-24894	128	7	appendix	appendix	ADJ
brj-24894	128	8	i.	i.	NOUN
brj-24894	128	9	for	for	ADP
brj-24894	128	10	determination	determination	NOUN
brj-24894	128	11	of	of	ADP
brj-24894	128	12	the	the	DET
brj-24894	128	13	final	final	ADJ
brj-24894	128	14	hydrolysis	hydrolysis	NOUN
brj-24894	128	15	products	product	NOUN
brj-24894	128	16	of	of	ADP
brj-24894	128	17	cmc	cmc	NOUN
brj-24894	128	18	or	or	CCONJ
brj-24894	128	19	corncob	corncob	NOUN
brj-24894	128	20	powder	powder	NOUN
brj-24894	128	21	catalyzed	catalyze	VERB
brj-24894	128	22	by	by	ADP
brj-24894	128	23	tpcel12a	tpcel12a	NOUN
brj-24894	128	24	,	,	PUNCT
brj-24894	128	25	high	high	ADJ
brj-24894	128	26	performance	performance	NOUN
brj-24894	128	27	liquid	liquid	NOUN
brj-24894	128	28	chromatography	chromatography	NOUN
brj-24894	128	29	(	(	PUNCT
brj-24894	128	30	hplc	hplc	PROPN
brj-24894	128	31	)	)	PUNCT
brj-24894	128	32	was	be	AUX
brj-24894	128	33	carried	carry	VERB
brj-24894	128	34	out	out	ADP
brj-24894	128	35	as	as	SCONJ
brj-24894	128	36	described	describe	VERB
brj-24894	128	37	in	in	ADP
brj-24894	128	38	the	the	DET
brj-24894	128	39	supplementary	supplementary	ADJ
brj-24894	128	40	materials	material	NOUN
brj-24894	128	41	.	.	PUNCT
brj-24894	129	1	glucose	glucose	NOUN
brj-24894	129	2	,	,	PUNCT
brj-24894	129	3	cellobiose	cellobiose	NOUN
brj-24894	129	4	,	,	PUNCT
brj-24894	129	5	cellotriose	cellotriose	PROPN
brj-24894	129	6	,	,	PUNCT
brj-24894	129	7	cellotetraose	cellotetraose	ADV
brj-24894	129	8	,	,	PUNCT
brj-24894	129	9	cellopentaose	cellopentaose	VERB
brj-24894	129	10	,	,	PUNCT
brj-24894	129	11	and	and	CCONJ
brj-24894	129	12	cellohexaose	cellohexaose	NOUN
brj-24894	129	13	were	be	AUX
brj-24894	129	14	used	use	VERB
brj-24894	129	15	as	as	ADP
brj-24894	129	16	standards	standard	NOUN
brj-24894	129	17	.	.	PUNCT
brj-24894	130	1	synergistic	synergistic	ADJ
brj-24894	130	2	action	action	NOUN
brj-24894	130	3	between	between	ADP
brj-24894	130	4	tpcel12a	tpcel12a	NOUN
brj-24894	130	5	and	and	CCONJ
brj-24894	130	6	crude	crude	ADJ
brj-24894	130	7	cellulase	cellulase	NOUN
brj-24894	130	8	the	the	DET
brj-24894	130	9	crude	crude	ADJ
brj-24894	130	10	cellulolytic	cellulolytic	ADJ
brj-24894	130	11	enzyme	enzyme	NOUN
brj-24894	130	12	was	be	AUX
brj-24894	130	13	prepared	prepare	VERB
brj-24894	130	14	from	from	ADP
brj-24894	130	15	t.	t.	NOUN
brj-24894	130	16	pinophilus	pinophilus	ADJ
brj-24894	130	17	strain	strain	NOUN
brj-24894	130	18	y117	y117	NUM
brj-24894	130	19	under	under	ADP
brj-24894	130	20	microcrystalline	microcrystalline	NOUN
brj-24894	130	21	cellulose	cellulose	NOUN
brj-24894	130	22	induction	induction	NOUN
brj-24894	130	23	conditions	condition	NOUN
brj-24894	130	24	,	,	PUNCT
brj-24894	130	25	in	in	ADP
brj-24894	130	26	which	which	PRON
brj-24894	130	27	tpcel12a	tpcel12a	NOUN
brj-24894	130	28	was	be	AUX
brj-24894	130	29	not	not	PART
brj-24894	130	30	detected	detect	VERB
brj-24894	130	31	by	by	ADP
brj-24894	130	32	secretome	secretome	NOUN
brj-24894	130	33	proteomics	proteomic	NOUN
brj-24894	130	34	(	(	PUNCT
brj-24894	130	35	unpublished	unpublished	ADJ
brj-24894	130	36	)	)	PUNCT
brj-24894	130	37	.	.	PUNCT
brj-24894	131	1	the	the	DET
brj-24894	131	2	synergistic	synergistic	ADJ
brj-24894	131	3	effect	effect	NOUN
brj-24894	131	4	of	of	ADP
brj-24894	131	5	tpcel12a	tpcel12a	NOUN
brj-24894	131	6	and	and	CCONJ
brj-24894	131	7	the	the	DET
brj-24894	131	8	crude	crude	ADJ
brj-24894	131	9	cellulase	cellulase	NOUN
brj-24894	131	10	was	be	AUX
brj-24894	131	11	evaluated	evaluate	VERB
brj-24894	131	12	by	by	ADP
brj-24894	131	13	comparing	compare	VERB
brj-24894	131	14	the	the	DET
brj-24894	131	15	degradation	degradation	NOUN
brj-24894	131	16	efficiency	efficiency	NOUN
brj-24894	131	17	of	of	ADP
brj-24894	131	18	their	their	PRON
brj-24894	131	19	mixture	mixture	NOUN
brj-24894	131	20	to	to	ADP
brj-24894	131	21	that	that	PRON
brj-24894	131	22	of	of	ADP
brj-24894	131	23	either	either	DET
brj-24894	131	24	component	component	NOUN
brj-24894	131	25	alone	alone	ADJ
brj-24894	131	26	at	at	ADP
brj-24894	131	27	ph	ph	PROPN
brj-24894	131	28	4	4	NUM
brj-24894	131	29	and	and	CCONJ
brj-24894	131	30	at	at	ADP
brj-24894	131	31	40	40	NUM
brj-24894	131	32	°	°	NOUN
brj-24894	131	33	c	c	NOUN
brj-24894	131	34	.	.	PUNCT
brj-24894	132	1	the	the	DET
brj-24894	132	2	degradation	degradation	NOUN
brj-24894	132	3	reactions	reaction	NOUN
brj-24894	132	4	were	be	AUX
brj-24894	132	5	performed	perform	VERB
brj-24894	132	6	for	for	ADP
brj-24894	132	7	48	48	NUM
brj-24894	132	8	h	h	NOUN
brj-24894	132	9	with	with	ADP
brj-24894	132	10	orbital	orbital	ADJ
brj-24894	132	11	shaking	shaking	NOUN
brj-24894	132	12	(	(	PUNCT
brj-24894	132	13	240	240	NUM
brj-24894	132	14	rpm	rpm	NOUN
brj-24894	132	15	)	)	PUNCT
brj-24894	132	16	.	.	PUNCT
brj-24894	133	1	tpcel12a	tpcel12a	NOUN
brj-24894	133	2	(	(	PUNCT
brj-24894	133	3	20	20	NUM
brj-24894	133	4	u	u	NOUN
brj-24894	133	5	)	)	PUNCT
brj-24894	133	6	and	and	CCONJ
brj-24894	133	7	crude	crude	ADJ
brj-24894	133	8	cellulose	cellulose	NOUN
brj-24894	133	9	(	(	PUNCT
brj-24894	133	10	0.4	0.4	NUM
brj-24894	133	11	mg	mg	NOUN
brj-24894	133	12	)	)	PUNCT
brj-24894	133	13	were	be	AUX
brj-24894	133	14	co	co	VERB
brj-24894	133	15	-	-	VERB
brj-24894	133	16	incubated	incubate	VERB
brj-24894	133	17	in	in	ADP
brj-24894	133	18	reaction	reaction	NOUN
brj-24894	133	19	mixtures	mixture	NOUN
brj-24894	133	20	containing	contain	VERB
brj-24894	133	21	0.2	0.2	NUM
brj-24894	133	22	g	g	NOUN
brj-24894	133	23	of	of	ADP
brj-24894	133	24	untreated	untreated	ADJ
brj-24894	133	25	corn	corn	NOUN
brj-24894	133	26	cob	cob	NOUN
brj-24894	133	27	powder	powder	NOUN
brj-24894	133	28	in	in	ADP
brj-24894	133	29	a	a	DET
brj-24894	133	30	final	final	ADJ
brj-24894	133	31	volume	volume	NOUN
brj-24894	133	32	of	of	ADP
brj-24894	133	33	3	3	NUM
brj-24894	133	34	ml	ml	NOUN
brj-24894	133	35	sodium	sodium	NOUN
brj-24894	133	36	acetate	acetate	NOUN
brj-24894	133	37	buffer	buffer	NOUN
brj-24894	133	38	(	(	PUNCT
brj-24894	133	39	50	50	NUM
brj-24894	133	40	mm	mm	NOUN
brj-24894	133	41	,	,	PUNCT
brj-24894	133	42	ph	ph	NOUN
brj-24894	133	43	4	4	NUM
brj-24894	133	44	)	)	PUNCT
brj-24894	133	45	at	at	ADP
brj-24894	133	46	40	40	NUM
brj-24894	133	47	°	°	ADP
brj-24894	133	48	c	c	NOUN
brj-24894	133	49	for	for	ADP
brj-24894	133	50	48	48	NUM
brj-24894	133	51	h	h	NOUN
brj-24894	133	52	with	with	ADP
brj-24894	133	53	orbital	orbital	ADJ
brj-24894	133	54	shaking	shaking	NOUN
brj-24894	133	55	(	(	PUNCT
brj-24894	133	56	240	240	NUM
brj-24894	133	57	rpm	rpm	NOUN
brj-24894	133	58	)	)	PUNCT
brj-24894	133	59	.	.	PUNCT
brj-24894	134	1	the	the	DET
brj-24894	134	2	reducing	reduce	VERB
brj-24894	134	3	sugars	sugar	NOUN
brj-24894	134	4	released	release	VERB
brj-24894	134	5	in	in	ADP
brj-24894	134	6	the	the	DET
brj-24894	134	7	supernatant	supernatant	NOUN
brj-24894	134	8	were	be	AUX
brj-24894	134	9	quantified	quantify	VERB
brj-24894	134	10	using	use	VERB
brj-24894	134	11	the	the	DET
brj-24894	134	12	dns	dns	NOUN
brj-24894	134	13	method	method	NOUN
brj-24894	134	14	,	,	PUNCT
brj-24894	134	15	with	with	ADP
brj-24894	134	16	glucose	glucose	NOUN
brj-24894	134	17	as	as	ADP
brj-24894	134	18	the	the	DET
brj-24894	134	19	standard	standard	NOUN
brj-24894	134	20	,	,	PUNCT
brj-24894	134	21	as	as	SCONJ
brj-24894	134	22	described	describe	VERB
brj-24894	134	23	previously	previously	ADV
brj-24894	134	24	.	.	PUNCT
brj-24894	135	1	all	all	DET
brj-24894	135	2	assays	assay	NOUN
brj-24894	135	3	were	be	AUX
brj-24894	135	4	conducted	conduct	VERB
brj-24894	135	5	in	in	ADP
brj-24894	135	6	triplicate	triplicate	PROPN
brj-24894	135	7	.	.	PUNCT
brj-24894	136	1	results	result	NOUN
brj-24894	136	2	and	and	CCONJ
brj-24894	136	3	discussion	discussion	NOUN
brj-24894	136	4	identification	identification	NOUN
brj-24894	136	5	and	and	CCONJ
brj-24894	136	6	sequence	sequence	NOUN
brj-24894	136	7	analysis	analysis	NOUN
brj-24894	136	8	of	of	ADP
brj-24894	136	9	endoglucanase	endoglucanase	NOUN
brj-24894	136	10	tpcel12a	tpcel12a	NOUN
brj-24894	136	11	of	of	ADP
brj-24894	136	12	t.	t.	NOUN
brj-24894	136	13	pinophilus	pinophilus	ADJ
brj-24894	136	14	strain	strain	NOUN
brj-24894	136	15	y117	y117	NUM
brj-24894	136	16	the	the	DET
brj-24894	136	17	draft	draft	NOUN
brj-24894	136	18	genome	genome	NOUN
brj-24894	136	19	of	of	ADP
brj-24894	136	20	t.	t.	NOUN
brj-24894	136	21	pinophilus	pinophilus	ADJ
brj-24894	136	22	strain	strain	NOUN
brj-24894	136	23	y117	y117	NUM
brj-24894	136	24	(	(	PUNCT
brj-24894	136	25	accession	accession	NOUN
brj-24894	136	26	no	no	INTJ
brj-24894	136	27	.	.	PUNCT
brj-24894	136	28	:	:	PUNCT
brj-24894	137	1	jbkfbr000000000	jbkfbr000000000	PROPN
brj-24894	137	2	)	)	PUNCT
brj-24894	137	3	was	be	AUX
brj-24894	137	4	analyzed	analyze	VERB
brj-24894	137	5	for	for	ADP
brj-24894	137	6	cazy	cazy	ADJ
brj-24894	137	7	family	family	NOUN
brj-24894	137	8	assignments	assignment	NOUN
brj-24894	137	9	using	use	VERB
brj-24894	137	10	the	the	DET
brj-24894	137	11	cazy	cazy	ADJ
brj-24894	137	12	database	database	NOUN
brj-24894	137	13	,	,	PUNCT
brj-24894	137	14	identifying	identify	VERB
brj-24894	137	15	a	a	DET
brj-24894	137	16	gene	gene	NOUN
brj-24894	137	17	encoding	encode	VERB
brj-24894	137	18	a	a	DET
brj-24894	137	19	putative	putative	ADJ
brj-24894	137	20	endoglucanase	endoglucanase	NOUN
brj-24894	137	21	.	.	PUNCT
brj-24894	138	1	the	the	DET
brj-24894	138	2	mrna	mrna	PROPN
brj-24894	138	3	sequence	sequence	NOUN
brj-24894	138	4	of	of	ADP
brj-24894	138	5	this	this	DET
brj-24894	138	6	gene	gene	NOUN
brj-24894	138	7	was	be	AUX
brj-24894	138	8	deposited	deposit	VERB
brj-24894	138	9	in	in	ADP
brj-24894	138	10	the	the	DET
brj-24894	138	11	genbank	genbank	PROPN
brj-24894	138	12	database	database	NOUN
brj-24894	138	13	under	under	ADP
brj-24894	138	14	accession	accession	NOUN
brj-24894	138	15	number	number	NOUN
brj-24894	138	16	pp913528	pp913528	NOUN
brj-24894	138	17	.	.	PUNCT
brj-24894	139	1	based	base	VERB
brj-24894	139	2	on	on	ADP
brj-24894	139	3	the	the	DET
brj-24894	139	4	deduced	deduce	VERB
brj-24894	139	5	amino	amino	NOUN
brj-24894	139	6	acid	acid	NOUN
brj-24894	139	7	sequence	sequence	NOUN
brj-24894	139	8	,	,	PUNCT
brj-24894	139	9	the	the	DET
brj-24894	139	10	endoglucanase	endoglucanase	NOUN
brj-24894	139	11	was	be	AUX
brj-24894	139	12	classified	classify	VERB
brj-24894	139	13	into	into	ADP
brj-24894	139	14	the	the	DET
brj-24894	139	15	glycoside	glycoside	NOUN
brj-24894	139	16	hydrolase	hydrolase	NOUN
brj-24894	139	17	family	family	NOUN
brj-24894	139	18	12	12	NUM
brj-24894	139	19	and	and	CCONJ
brj-24894	139	20	designated	designate	VERB
brj-24894	139	21	as	as	ADP
brj-24894	139	22	tpcel12a	tpcel12a	NOUN
brj-24894	139	23	.	.	PUNCT
brj-24894	140	1	the	the	DET
brj-24894	140	2	tpcel12a	tpcel12a	NOUN
brj-24894	140	3	gene	gene	NOUN
brj-24894	140	4	comprised	comprise	VERB
brj-24894	140	5	834	834	NUM
brj-24894	140	6	bp	bp	NOUN
brj-24894	140	7	,	,	PUNCT
brj-24894	140	8	including	include	VERB
brj-24894	140	9	two	two	NUM
brj-24894	140	10	introns	intron	NOUN
brj-24894	140	11	of	of	ADP
brj-24894	140	12	59	59	NUM
brj-24894	140	13	and	and	CCONJ
brj-24894	140	14	64	64	NUM
brj-24894	140	15	nucleotides	nucleotide	NOUN
brj-24894	140	16	,	,	PUNCT
brj-24894	140	17	respectively	respectively	ADV
brj-24894	140	18	.	.	PUNCT
brj-24894	141	1	the	the	DET
brj-24894	141	2	open	open	ADJ
brj-24894	141	3	reading	reading	NOUN
brj-24894	141	4	frame	frame	NOUN
brj-24894	141	5	was	be	AUX
brj-24894	141	6	peer	peer	NOUN
brj-24894	141	7	-	-	PUNCT
brj-24894	141	8	reviewed	review	VERB
brj-24894	141	9	article	article	NOUN
brj-24894	141	10	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	141	11	li	li	PROPN
brj-24894	141	12	et	et	PROPN
brj-24894	141	13	al	al	PROPN
brj-24894	141	14	.	.	PROPN
brj-24894	142	1	(	(	PUNCT
brj-24894	142	2	2026	2026	NUM
brj-24894	142	3	)	)	PUNCT
brj-24894	142	4	.	.	PUNCT
brj-24894	143	1	“	"	PUNCT
brj-24894	143	2	endoglucanase	endoglucanase	VERB
brj-24894	143	3	tpcel12a	tpcel12a	NOUN
brj-24894	143	4	traits	trait	NOUN
brj-24894	143	5	,	,	PUNCT
brj-24894	143	6	”	"	PUNCT
brj-24894	143	7	bioresources	bioresource	NOUN
brj-24894	143	8	21(1	21(1	NUM
brj-24894	143	9	)	)	PUNCT
brj-24894	143	10	,	,	PUNCT
brj-24894	143	11	547	547	NUM
brj-24894	143	12	-	-	SYM
brj-24894	143	13	569	569	NUM
brj-24894	143	14	.	.	PUNCT
brj-24894	144	1	553	553	NUM
brj-24894	144	2	711	711	NUM
brj-24894	144	3	bp	bp	NOUN
brj-24894	144	4	in	in	ADP
brj-24894	144	5	length	length	NOUN
brj-24894	144	6	and	and	CCONJ
brj-24894	144	7	encoded	encode	VERB
brj-24894	144	8	236	236	NUM
brj-24894	144	9	amino	amino	NOUN
brj-24894	144	10	acid	acid	NOUN
brj-24894	144	11	residues	residue	NOUN
brj-24894	144	12	.	.	PUNCT
brj-24894	145	1	a	a	DET
brj-24894	145	2	putative	putative	ADJ
brj-24894	145	3	sec	sec	PROPN
brj-24894	145	4	/	/	SYM
brj-24894	145	5	spi	spi	NOUN
brj-24894	145	6	type	type	NOUN
brj-24894	145	7	signal	signal	NOUN
brj-24894	145	8	peptide	peptide	NOUN
brj-24894	145	9	(	(	PUNCT
brj-24894	145	10	mkltfllnlavaasa	mkltfllnlavaasa	NOUN
brj-24894	145	11	)	)	PUNCT
brj-24894	145	12	was	be	AUX
brj-24894	145	13	predicted	predict	VERB
brj-24894	145	14	in	in	ADP
brj-24894	145	15	tpcel12a	tpcel12a	NOUN
brj-24894	145	16	.	.	PUNCT
brj-24894	146	1	the	the	DET
brj-24894	146	2	theoretical	theoretical	ADJ
brj-24894	146	3	molecular	molecular	ADJ
brj-24894	146	4	weight	weight	NOUN
brj-24894	146	5	(	(	PUNCT
brj-24894	146	6	mw	mw	NOUN
brj-24894	146	7	)	)	PUNCT
brj-24894	146	8	and	and	CCONJ
brj-24894	146	9	isoelectric	isoelectric	ADJ
brj-24894	146	10	point	point	NOUN
brj-24894	146	11	(	(	PUNCT
brj-24894	146	12	pi	pi	NOUN
brj-24894	146	13	)	)	PUNCT
brj-24894	146	14	of	of	ADP
brj-24894	146	15	mature	mature	ADJ
brj-24894	146	16	tpcel12a	tpcel12a	NOUN
brj-24894	146	17	were	be	AUX
brj-24894	146	18	23.96	23.96	NUM
brj-24894	146	19	kda	kda	NOUN
brj-24894	146	20	and	and	CCONJ
brj-24894	146	21	ph	ph	ADJ
brj-24894	146	22	5.04	5.04	NUM
brj-24894	146	23	,	,	PUNCT
brj-24894	146	24	respectively	respectively	ADV
brj-24894	146	25	.	.	PUNCT
brj-24894	147	1	two	two	NUM
brj-24894	147	2	potential	potential	ADJ
brj-24894	147	3	n	n	CCONJ
brj-24894	147	4	-	-	PUNCT
brj-24894	147	5	glycosylation	glycosylation	NOUN
brj-24894	147	6	sequons	sequon	NOUN
brj-24894	147	7	(	(	PUNCT
brj-24894	147	8	n43	n43	PROPN
brj-24894	147	9	-	-	PUNCT
brj-24894	147	10	w44	w44	NOUN
brj-24894	147	11	-	-	PUNCT
brj-24894	147	12	s45	s45	NOUN
brj-24894	147	13	and	and	CCONJ
brj-24894	147	14	n145	n145	PROPN
brj-24894	147	15	-	-	PUNCT
brj-24894	147	16	g146s147	g146s147	NOUN
brj-24894	147	17	)	)	PUNCT
brj-24894	147	18	was	be	AUX
brj-24894	147	19	predicted	predict	VERB
brj-24894	147	20	within	within	ADP
brj-24894	147	21	tpcel12a	tpcel12a	X
brj-24894	147	22	(	(	PUNCT
brj-24894	147	23	fig	fig	NOUN
brj-24894	147	24	.	.	NOUN
brj-24894	148	1	1	1	NUM
brj-24894	148	2	)	)	PUNCT
brj-24894	148	3	.	.	PUNCT
brj-24894	149	1	fig	fig	NOUN
brj-24894	149	2	.	.	PUNCT
brj-24894	150	1	1	1	X
brj-24894	150	2	.	.	X
brj-24894	150	3	multi	multi	ADJ
brj-24894	150	4	sequence	sequence	NOUN
brj-24894	150	5	alignment	alignment	NOUN
brj-24894	150	6	among	among	ADP
brj-24894	150	7	tpcel12a	tpcel12a	NOUN
brj-24894	150	8	and	and	CCONJ
brj-24894	150	9	the	the	DET
brj-24894	150	10	known	know	VERB
brj-24894	150	11	gh12	gh12	PROPN
brj-24894	150	12	endoglucanases	endoglucanase	NOUN
brj-24894	150	13	.	.	PUNCT
brj-24894	151	1	amino	amino	NOUN
brj-24894	151	2	acid	acid	NOUN
brj-24894	151	3	sequences	sequence	NOUN
brj-24894	151	4	of	of	ADP
brj-24894	151	5	tpcel12a	tpcel12a	NOUN
brj-24894	151	6	and	and	CCONJ
brj-24894	151	7	other	other	ADJ
brj-24894	151	8	known	know	VERB
brj-24894	151	9	gh12	gh12	PROPN
brj-24894	151	10	endoglucanases	endoglucanase	NOUN
brj-24894	151	11	including	include	VERB
brj-24894	151	12	q0clb5_asptn	q0clb5_asptn	NOUN
brj-24894	151	13	(	(	PUNCT
brj-24894	151	14	1	1	NUM
brj-24894	151	15	)	)	PUNCT
brj-24894	151	16	and	and	CCONJ
brj-24894	151	17	ategld	ategld	ADJ
brj-24894	151	18	(	(	PUNCT
brj-24894	151	19	q0c8u0_asptn	q0c8u0_asptn	PROPN
brj-24894	151	20	,	,	PUNCT
brj-24894	151	21	2	2	NUM
brj-24894	151	22	)	)	PUNCT
brj-24894	151	23	of	of	ADP
brj-24894	151	24	aspergillus	aspergillus	NOUN
brj-24894	151	25	terreus	terreus	NOUN
brj-24894	151	26	,	,	PUNCT
brj-24894	151	27	bgh12a	bgh12a	X
brj-24894	151	28	(	(	PUNCT
brj-24894	151	29	a0a3g2c3i4_9euro	a0a3g2c3i4_9euro	NOUN
brj-24894	151	30	)	)	PUNCT
brj-24894	151	31	of	of	ADP
brj-24894	151	32	aspergillus	aspergillus	PROPN
brj-24894	151	33	cervinus	cervinus	NOUN
brj-24894	151	34	,	,	PUNCT
brj-24894	151	35	aclaxega	aclaxega	NOUN
brj-24894	151	36	(	(	PUNCT
brj-24894	151	37	xgea_aspcl	xgea_aspcl	PROPN
brj-24894	151	38	)	)	PUNCT
brj-24894	151	39	of	of	ADP
brj-24894	151	40	aspergillus	aspergillus	ADJ
brj-24894	151	41	clavatus	clavatus	NOUN
brj-24894	151	42	,	,	PUNCT
brj-24894	151	43	nfgh12a	nfgh12a	NOUN
brj-24894	151	44	(	(	PUNCT
brj-24894	151	45	a0a1l6ce30	a0a1l6ce30	NOUN
brj-24894	151	46	_	_	NOUN
brj-24894	151	47	9euro	9euro	NUM
brj-24894	151	48	)	)	PUNCT
brj-24894	151	49	of	of	ADP
brj-24894	151	50	aspergillus	aspergillus	PROPN
brj-24894	151	51	fischeri	fischeri	NOUN
brj-24894	151	52	,	,	PUNCT
brj-24894	151	53	a0a100ikg6_aspng	a0a100ikg6_aspng	X
brj-24894	151	54	(	(	PUNCT
brj-24894	151	55	1	1	NUM
brj-24894	151	56	)	)	PUNCT
brj-24894	151	57	and	and	CCONJ
brj-24894	151	58	a0a100i2e1_aspng	a0a100i2e1_aspng	PROPN
brj-24894	151	59	(	(	PUNCT
brj-24894	151	60	2	2	NUM
brj-24894	151	61	)	)	PUNCT
brj-24894	151	62	of	of	ADP
brj-24894	151	63	aspergillus	aspergillus	NOUN
brj-24894	151	64	niger	niger	NOUN
brj-24894	151	65	and	and	CCONJ
brj-24894	151	66	xgea_aspfu	xgea_aspfu	PROPN
brj-24894	151	67	of	of	ADP
brj-24894	151	68	aspergillus	aspergillus	ADJ
brj-24894	151	69	fumigatus	fumigatus	NOUN
brj-24894	151	70	were	be	AUX
brj-24894	151	71	aligned	align	VERB
brj-24894	151	72	using	use	VERB
brj-24894	151	73	clustal	clustal	ADJ
brj-24894	151	74	and	and	CCONJ
brj-24894	151	75	visualized	visualize	VERB
brj-24894	151	76	with	with	ADP
brj-24894	151	77	espript	espript	NOUN
brj-24894	151	78	.	.	PUNCT
brj-24894	152	1	the	the	DET
brj-24894	152	2	secondary	secondary	ADJ
brj-24894	152	3	structural	structural	ADJ
brj-24894	152	4	features	feature	NOUN
brj-24894	152	5	of	of	ADP
brj-24894	152	6	tpcel12a	tpcel12a	NOUN
brj-24894	152	7	were	be	AUX
brj-24894	152	8	presented	present	VERB
brj-24894	152	9	as	as	ADP
brj-24894	152	10	the	the	DET
brj-24894	152	11	model	model	NOUN
brj-24894	152	12	structure	structure	NOUN
brj-24894	152	13	created	create	VERB
brj-24894	152	14	by	by	ADP
brj-24894	152	15	alphafold	alphafold	ADJ
brj-24894	152	16	3	3	NUM
brj-24894	152	17	.	.	PUNCT
brj-24894	153	1	the	the	DET
brj-24894	153	2	asterisk	asterisk	NOUN
brj-24894	153	3	indicates	indicate	VERB
brj-24894	153	4	the	the	DET
brj-24894	153	5	conserved	conserved	ADJ
brj-24894	153	6	catalytic	catalytic	ADJ
brj-24894	153	7	sites	site	NOUN
brj-24894	153	8	e110	e110	PROPN
brj-24894	153	9	and	and	CCONJ
brj-24894	153	10	e194	e194	PROPN
brj-24894	153	11	.	.	PUNCT
brj-24894	154	1	the	the	DET
brj-24894	154	2	solid	solid	ADJ
brj-24894	154	3	triangle	triangle	NOUN
brj-24894	154	4	indicates	indicate	VERB
brj-24894	154	5	the	the	DET
brj-24894	154	6	potential	potential	ADJ
brj-24894	154	7	glycosylation	glycosylation	NOUN
brj-24894	154	8	site	site	NOUN
brj-24894	154	9	.	.	PUNCT
brj-24894	155	1	the	the	DET
brj-24894	155	2	dashed	dash	VERB
brj-24894	155	3	rectangular	rectangular	PROPN
brj-24894	155	4	box	box	PROPN
brj-24894	155	5	outlines	outline	VERB
brj-24894	155	6	the	the	DET
brj-24894	155	7	typical	typical	ADJ
brj-24894	155	8	features	feature	NOUN
brj-24894	155	9	ysg	ysg	NOUN
brj-24894	155	10	and	and	CCONJ
brj-24894	155	11	sst	sst	NOUN
brj-24894	155	12	motif	motif	NOUN
brj-24894	155	13	of	of	ADP
brj-24894	155	14	xyloglucanase	xyloglucanase	NOUN
brj-24894	155	15	and	and	CCONJ
brj-24894	155	16	promiscuous	promiscuous	ADJ
brj-24894	155	17	endoglucanase	endoglucanase	NOUN
brj-24894	155	18	.	.	PUNCT
brj-24894	156	1	the	the	DET
brj-24894	156	2	solid	solid	PROPN
brj-24894	156	3	box	box	PROPN
brj-24894	156	4	marks	mark	VERB
brj-24894	156	5	the	the	DET
brj-24894	156	6	loop3	loop3	NOUN
brj-24894	156	7	region	region	NOUN
brj-24894	156	8	of	of	ADP
brj-24894	156	9	gh12	gh12	PROPN
brj-24894	156	10	endoglucanases	endoglucanase	NOUN
brj-24894	156	11	.	.	PUNCT
brj-24894	157	1	peer	peer	NOUN
brj-24894	157	2	-	-	PUNCT
brj-24894	157	3	reviewed	review	VERB
brj-24894	157	4	article	article	NOUN
brj-24894	157	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	157	6	li	li	PROPN
brj-24894	157	7	et	et	PROPN
brj-24894	157	8	al	al	PROPN
brj-24894	157	9	.	.	PROPN
brj-24894	158	1	(	(	PUNCT
brj-24894	158	2	2026	2026	NUM
brj-24894	158	3	)	)	PUNCT
brj-24894	158	4	.	.	PUNCT
brj-24894	159	1	“	"	PUNCT
brj-24894	159	2	endoglucanase	endoglucanase	VERB
brj-24894	159	3	tpcel12a	tpcel12a	NOUN
brj-24894	159	4	traits	trait	NOUN
brj-24894	159	5	,	,	PUNCT
brj-24894	159	6	”	"	PUNCT
brj-24894	159	7	bioresources	bioresource	NOUN
brj-24894	159	8	21(1	21(1	NUM
brj-24894	159	9	)	)	PUNCT
brj-24894	159	10	,	,	PUNCT
brj-24894	159	11	547	547	NUM
brj-24894	159	12	-	-	SYM
brj-24894	159	13	569	569	NUM
brj-24894	159	14	.	.	PUNCT
brj-24894	160	1	554	554	NUM
brj-24894	160	2	multiple	multiple	ADJ
brj-24894	160	3	sequence	sequence	NOUN
brj-24894	160	4	alignments	alignment	NOUN
brj-24894	160	5	revealed	reveal	VERB
brj-24894	160	6	that	that	SCONJ
brj-24894	160	7	tpcel12a	tpcel12a	VERB
brj-24894	160	8	shared	share	VERB
brj-24894	160	9	considerable	considerable	ADJ
brj-24894	160	10	sequence	sequence	NOUN
brj-24894	160	11	identity	identity	NOUN
brj-24894	160	12	with	with	ADP
brj-24894	160	13	reported	report	VERB
brj-24894	160	14	gh12	gh12	PROPN
brj-24894	160	15	endoglucanases	endoglucanase	NOUN
brj-24894	160	16	:	:	PUNCT
brj-24894	160	17	69.23	69.23	NUM
brj-24894	160	18	%	%	NOUN
brj-24894	160	19	with	with	ADP
brj-24894	160	20	bgh12a	bgh12a	NOUN
brj-24894	160	21	,	,	PUNCT
brj-24894	160	22	67	67	NUM
brj-24894	160	23	%	%	NOUN
brj-24894	160	24	with	with	ADP
brj-24894	160	25	ategld	ategld	ADJ
brj-24894	160	26	,	,	PUNCT
brj-24894	160	27	and	and	CCONJ
brj-24894	160	28	43	43	NUM
brj-24894	160	29	%	%	NOUN
brj-24894	160	30	with	with	ADP
brj-24894	160	31	aclaxega	aclaxega	NOUN
brj-24894	160	32	,	,	PUNCT
brj-24894	160	33	indicating	indicate	VERB
brj-24894	160	34	that	that	SCONJ
brj-24894	160	35	these	these	DET
brj-24894	160	36	enzymes	enzyme	NOUN
brj-24894	160	37	may	may	AUX
brj-24894	160	38	originate	originate	VERB
brj-24894	160	39	from	from	ADP
brj-24894	160	40	a	a	DET
brj-24894	160	41	common	common	ADJ
brj-24894	160	42	ancestor	ancestor	NOUN
brj-24894	160	43	and	and	CCONJ
brj-24894	160	44	have	have	AUX
brj-24894	160	45	retained	retain	VERB
brj-24894	160	46	their	their	PRON
brj-24894	160	47	core	core	ADJ
brj-24894	160	48	functional	functional	ADJ
brj-24894	160	49	regions	region	NOUN
brj-24894	160	50	during	during	ADP
brj-24894	160	51	long	long	ADJ
brj-24894	160	52	-	-	PUNCT
brj-24894	160	53	term	term	NOUN
brj-24894	160	54	evolution	evolution	NOUN
brj-24894	160	55	.	.	PUNCT
brj-24894	161	1	like	like	ADP
brj-24894	161	2	other	other	ADJ
brj-24894	161	3	gh12	gh12	PROPN
brj-24894	161	4	enzymes	enzyme	NOUN
brj-24894	161	5	,	,	PUNCT
brj-24894	161	6	tpcel12a	tpcel12a	NOUN
brj-24894	161	7	adopted	adopt	VERB
brj-24894	161	8	a	a	DET
brj-24894	161	9	β	β	NOUN
brj-24894	161	10	-	-	ADJ
brj-24894	161	11	sandwich	sandwich	ADJ
brj-24894	161	12	structure	structure	NOUN
brj-24894	161	13	.	.	PUNCT
brj-24894	162	1	additionally	additionally	ADV
brj-24894	162	2	,	,	PUNCT
brj-24894	162	3	amino	amino	NOUN
brj-24894	162	4	acid	acid	NOUN
brj-24894	162	5	residues	residue	NOUN
brj-24894	162	6	(	(	PUNCT
brj-24894	162	7	e110	e110	PROPN
brj-24894	162	8	and	and	CCONJ
brj-24894	162	9	e194	e194	PROPN
brj-24894	162	10	)	)	PUNCT
brj-24894	162	11	responsible	responsible	ADJ
brj-24894	162	12	for	for	ADP
brj-24894	162	13	the	the	DET
brj-24894	162	14	catalytic	catalytic	ADJ
brj-24894	162	15	activity	activity	NOUN
brj-24894	162	16	of	of	ADP
brj-24894	162	17	gh12	gh12	PROPN
brj-24894	162	18	endoglucanases	endoglucanase	NOUN
brj-24894	162	19	were	be	AUX
brj-24894	162	20	conserved	conserve	VERB
brj-24894	162	21	in	in	ADP
brj-24894	162	22	the	the	DET
brj-24894	162	23	β9	β9	ADJ
brj-24894	162	24	and	and	CCONJ
brj-24894	162	25	β14	β14	NOUN
brj-24894	162	26	regions	region	NOUN
brj-24894	162	27	of	of	ADP
brj-24894	162	28	tpcel12a	tpcel12a	NOUN
brj-24894	162	29	,	,	PUNCT
brj-24894	162	30	respectively	respectively	ADV
brj-24894	162	31	(	(	PUNCT
brj-24894	162	32	fig	fig	NOUN
brj-24894	162	33	.	.	NOUN
brj-24894	163	1	1	1	NUM
brj-24894	163	2	)	)	PUNCT
brj-24894	163	3	,	,	PUNCT
brj-24894	163	4	illustrating	illustrate	VERB
brj-24894	163	5	that	that	SCONJ
brj-24894	163	6	tpcel12a	tpcel12a	NOUN
brj-24894	163	7	follows	follow	VERB
brj-24894	163	8	the	the	DET
brj-24894	163	9	typical	typical	ADJ
brj-24894	163	10	catalysis	catalysis	NOUN
brj-24894	163	11	mechanism	mechanism	NOUN
brj-24894	163	12	of	of	ADP
brj-24894	163	13	the	the	DET
brj-24894	163	14	gh12	gh12	PROPN
brj-24894	163	15	family	family	NOUN
brj-24894	163	16	.	.	PUNCT
brj-24894	164	1	overexpression	overexpression	NOUN
brj-24894	164	2	and	and	CCONJ
brj-24894	164	3	purification	purification	NOUN
brj-24894	164	4	of	of	ADP
brj-24894	164	5	tpcel12a	tpcel12a	NOUN
brj-24894	164	6	in	in	ADP
brj-24894	164	7	t.	t.	NOUN
brj-24894	164	8	pinophilus	pinophilus	ADJ
brj-24894	164	9	strain	strain	NOUN
brj-24894	164	10	y117	y117	NUM
brj-24894	164	11	given	give	VERB
brj-24894	164	12	the	the	DET
brj-24894	164	13	robust	robust	ADJ
brj-24894	164	14	cellulase	cellulase	NOUN
brj-24894	164	15	biosynthesis	biosynthesis	NOUN
brj-24894	164	16	and	and	CCONJ
brj-24894	164	17	secretory	secretory	ADJ
brj-24894	164	18	capacity	capacity	NOUN
brj-24894	164	19	of	of	ADP
brj-24894	164	20	t.	t.	NOUN
brj-24894	164	21	pinophilus	pinophilus	ADJ
brj-24894	164	22	strain	strain	NOUN
brj-24894	164	23	y117	y117	NUM
brj-24894	164	24	,	,	PUNCT
brj-24894	164	25	tpcel12a	tpcel12a	NOUN
brj-24894	164	26	was	be	AUX
brj-24894	164	27	overexpressed	overexpresse	VERB
brj-24894	164	28	with	with	ADP
brj-24894	164	29	its	its	PRON
brj-24894	164	30	native	native	ADJ
brj-24894	164	31	signal	signal	NOUN
brj-24894	164	32	peptide	peptide	NOUN
brj-24894	164	33	in	in	ADP
brj-24894	164	34	the	the	DET
brj-24894	164	35	native	native	ADJ
brj-24894	164	36	host	host	NOUN
brj-24894	164	37	under	under	ADP
brj-24894	164	38	the	the	DET
brj-24894	164	39	control	control	NOUN
brj-24894	164	40	of	of	ADP
brj-24894	164	41	the	the	DET
brj-24894	164	42	cbh1	cbh1	PROPN
brj-24894	164	43	promoter	promoter	NOUN
brj-24894	164	44	(	(	PUNCT
brj-24894	164	45	appendix	appendix	NOUN
brj-24894	164	46	iv	iv	NUM
brj-24894	164	47	)	)	PUNCT
brj-24894	164	48	.	.	PUNCT
brj-24894	165	1	the	the	DET
brj-24894	165	2	tpcel12a	tpcel12a	ADJ
brj-24894	165	3	overexpression	overexpression	NOUN
brj-24894	165	4	mutant	mutant	NOUN
brj-24894	165	5	oetpcel12a	oetpcel12a	NOUN
brj-24894	165	6	was	be	AUX
brj-24894	165	7	constructed	construct	VERB
brj-24894	165	8	as	as	SCONJ
brj-24894	165	9	described	describe	VERB
brj-24894	165	10	in	in	ADP
brj-24894	165	11	the	the	DET
brj-24894	165	12	methods	method	NOUN
brj-24894	165	13	section	section	NOUN
brj-24894	165	14	.	.	PUNCT
brj-24894	166	1	tpcel12a	tpcel12a	NOUN
brj-24894	166	2	expression	expression	NOUN
brj-24894	166	3	was	be	AUX
brj-24894	166	4	induced	induce	VERB
brj-24894	166	5	using	use	VERB
brj-24894	166	6	microcrystalline	microcrystalline	NOUN
brj-24894	166	7	cellulose	cellulose	NOUN
brj-24894	166	8	as	as	ADP
brj-24894	166	9	the	the	DET
brj-24894	166	10	sole	sole	ADJ
brj-24894	166	11	carbon	carbon	NOUN
brj-24894	166	12	source	source	NOUN
brj-24894	166	13	.	.	PUNCT
brj-24894	167	1	after	after	ADP
brj-24894	167	2	purification	purification	NOUN
brj-24894	167	3	by	by	ADP
brj-24894	167	4	ni	ni	PROPN
brj-24894	167	5	-	-	PUNCT
brj-24894	167	6	nta	nta	PROPN
brj-24894	167	7	affinity	affinity	NOUN
brj-24894	167	8	chromatography	chromatography	NOUN
brj-24894	167	9	,	,	PUNCT
brj-24894	167	10	fig	fig	NOUN
brj-24894	167	11	.	.	PUNCT
brj-24894	168	1	2	2	NUM
brj-24894	168	2	.	.	X
brj-24894	168	3	over	over	ADP
brj-24894	168	4	-	-	PUNCT
brj-24894	168	5	expression	expression	NOUN
brj-24894	168	6	and	and	CCONJ
brj-24894	168	7	purification	purification	NOUN
brj-24894	168	8	of	of	ADP
brj-24894	168	9	tpcel12a	tpcel12a	NOUN
brj-24894	168	10	and	and	CCONJ
brj-24894	168	11	the	the	DET
brj-24894	168	12	mutant	mutant	ADJ
brj-24894	168	13	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	168	14	)	)	PUNCT
brj-24894	168	15	with	with	ADP
brj-24894	168	16	a	a	DET
brj-24894	168	17	cterminal	cterminal	ADJ
brj-24894	168	18	his	his	PRON
brj-24894	168	19	-	-	PUNCT
brj-24894	168	20	tag	tag	NOUN
brj-24894	168	21	in	in	ADP
brj-24894	168	22	t.	t.	NOUN
brj-24894	168	23	pinophilus	pinophilus	ADJ
brj-24894	168	24	strain	strain	NOUN
brj-24894	168	25	y117	y117	NUM
brj-24894	168	26	.	.	PUNCT
brj-24894	169	1	a	a	DET
brj-24894	169	2	)	)	PUNCT
brj-24894	169	3	recombinant	recombinant	ADJ
brj-24894	169	4	tpcel12a	tpcel12a	NOUN
brj-24894	169	5	was	be	AUX
brj-24894	169	6	over	over	ADV
brj-24894	169	7	-	-	PUNCT
brj-24894	169	8	expressed	express	VERB
brj-24894	169	9	in	in	ADP
brj-24894	169	10	t.	t.	PROPN
brj-24894	169	11	pinophilus	pinophilus	X
brj-24894	169	12	y117	y117	PROPN
brj-24894	169	13	and	and	CCONJ
brj-24894	169	14	purified	purify	VERB
brj-24894	169	15	by	by	ADP
brj-24894	169	16	ni	ni	PROPN
brj-24894	169	17	-	-	PUNCT
brj-24894	169	18	column	column	NOUN
brj-24894	169	19	affinity	affinity	NOUN
brj-24894	169	20	chromatography	chromatography	NOUN
brj-24894	169	21	.	.	PUNCT
brj-24894	170	1	lane	lane	PROPN
brj-24894	170	2	m	m	PROPN
brj-24894	170	3	:	:	PUNCT
brj-24894	170	4	protein	protein	NOUN
brj-24894	170	5	marker	marker	NOUN
brj-24894	170	6	,	,	PUNCT
brj-24894	170	7	lane	lane	NOUN
brj-24894	170	8	1	1	NUM
brj-24894	170	9	:	:	PUNCT
brj-24894	170	10	total	total	ADJ
brj-24894	170	11	proteins	protein	NOUN
brj-24894	170	12	of	of	ADP
brj-24894	170	13	t.	t.	NOUN
brj-24894	170	14	pinophilus	pinophilus	NOUN
brj-24894	170	15	without	without	ADP
brj-24894	170	16	tpcel12a	tpcel12a	NOUN
brj-24894	170	17	expression	expression	NOUN
brj-24894	170	18	plasmid	plasmid	NOUN
brj-24894	170	19	,	,	PUNCT
brj-24894	170	20	lane	lane	NOUN
brj-24894	170	21	2	2	NUM
brj-24894	170	22	:	:	PUNCT
brj-24894	170	23	total	total	ADJ
brj-24894	170	24	proteins	protein	NOUN
brj-24894	170	25	of	of	ADP
brj-24894	170	26	t.	t.	NOUN
brj-24894	170	27	pinophilus	pinophilus	NOUN
brj-24894	170	28	with	with	ADP
brj-24894	170	29	tpcel12a	tpcel12a	NOUN
brj-24894	170	30	expression	expression	NOUN
brj-24894	170	31	plasmid	plasmid	NOUN
brj-24894	170	32	,	,	PUNCT
brj-24894	170	33	lane	lane	NOUN
brj-24894	170	34	3	3	NUM
brj-24894	170	35	:	:	PUNCT
brj-24894	170	36	purified	purified	ADJ
brj-24894	170	37	recombinant	recombinant	ADJ
brj-24894	170	38	tpcel12a	tpcel12a	NOUN
brj-24894	170	39	.	.	PUNCT
brj-24894	171	1	b	b	X
brj-24894	171	2	)	)	PUNCT
brj-24894	171	3	nterminal	nterminal	ADJ
brj-24894	171	4	sequence	sequence	NOUN
brj-24894	171	5	of	of	ADP
brj-24894	171	6	mature	mature	ADJ
brj-24894	171	7	tpcel12a	tpcel12a	NOUN
brj-24894	171	8	was	be	AUX
brj-24894	171	9	determined	determine	VERB
brj-24894	171	10	by	by	ADP
brj-24894	171	11	do	do	AUX
brj-24894	171	12	novo	novo	NOUN
brj-24894	171	13	nterminal	nterminal	ADJ
brj-24894	171	14	sequencing	sequencing	NOUN
brj-24894	171	15	.	.	PUNCT
brj-24894	172	1	c	c	X
brj-24894	172	2	)	)	PUNCT
brj-24894	172	3	size	size	NOUN
brj-24894	172	4	-	-	PUNCT
brj-24894	172	5	exclusion	exclusion	NOUN
brj-24894	172	6	chromatography	chromatography	NOUN
brj-24894	172	7	was	be	AUX
brj-24894	172	8	carried	carry	VERB
brj-24894	172	9	out	out	ADP
brj-24894	172	10	to	to	PART
brj-24894	172	11	detect	detect	VERB
brj-24894	172	12	the	the	DET
brj-24894	172	13	oligomeric	oligomeric	ADJ
brj-24894	172	14	state	state	NOUN
brj-24894	172	15	of	of	ADP
brj-24894	172	16	recombinant	recombinant	ADJ
brj-24894	172	17	tpcel12a	tpcel12a	NOUN
brj-24894	172	18	.	.	PUNCT
brj-24894	173	1	dashed	dash	VERB
brj-24894	173	2	lines	line	NOUN
brj-24894	173	3	represent	represent	VERB
brj-24894	173	4	the	the	DET
brj-24894	173	5	elution	elution	NOUN
brj-24894	173	6	volumes	volume	NOUN
brj-24894	173	7	of	of	ADP
brj-24894	173	8	protein	protein	NOUN
brj-24894	173	9	standards	standard	NOUN
brj-24894	173	10	(	(	PUNCT
brj-24894	173	11	provided	provide	VERB
brj-24894	173	12	in	in	ADP
brj-24894	173	13	lmw	lmw	ADJ
brj-24894	173	14	(	(	PUNCT
brj-24894	173	15	low	low	ADJ
brj-24894	173	16	molecular	molecular	ADJ
brj-24894	173	17	weight	weight	NOUN
brj-24894	173	18	)	)	PUNCT
brj-24894	173	19	calibration	calibration	NOUN
brj-24894	173	20	kit	kit	NOUN
brj-24894	173	21	,	,	PUNCT
brj-24894	173	22	molecular	molecular	ADJ
brj-24894	173	23	weight	weight	NOUN
brj-24894	173	24	of	of	ADP
brj-24894	173	25	lmw	lmw	ADJ
brj-24894	173	26	standard	standard	ADJ
brj-24894	173	27	proteins	protein	NOUN
brj-24894	173	28	ranges	range	VERB
brj-24894	173	29	from	from	ADP
brj-24894	173	30	6.5	6.5	NUM
brj-24894	173	31	to	to	PART
brj-24894	173	32	75.0	75.0	NUM
brj-24894	173	33	kda	kda	NOUN
brj-24894	173	34	)	)	PUNCT
brj-24894	173	35	,	,	PUNCT
brj-24894	173	36	with	with	ADP
brj-24894	173	37	the	the	DET
brj-24894	173	38	numbers	number	NOUN
brj-24894	173	39	above	above	ADP
brj-24894	173	40	the	the	DET
brj-24894	173	41	peaks	peak	NOUN
brj-24894	173	42	indicating	indicate	VERB
brj-24894	173	43	the	the	DET
brj-24894	173	44	retention	retention	NOUN
brj-24894	173	45	volume	volume	NOUN
brj-24894	173	46	.	.	PUNCT
brj-24894	174	1	d	d	X
brj-24894	174	2	)	)	PUNCT
brj-24894	174	3	overexpression	overexpression	NOUN
brj-24894	174	4	and	and	CCONJ
brj-24894	174	5	purification	purification	NOUN
brj-24894	174	6	of	of	ADP
brj-24894	174	7	the	the	DET
brj-24894	174	8	mutant	mutant	ADJ
brj-24894	174	9	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	174	10	)	)	PUNCT
brj-24894	174	11	.	.	PUNCT
brj-24894	175	1	peer	peer	NOUN
brj-24894	175	2	-	-	PUNCT
brj-24894	175	3	reviewed	review	VERB
brj-24894	175	4	article	article	NOUN
brj-24894	175	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	175	6	li	li	PROPN
brj-24894	175	7	et	et	PROPN
brj-24894	175	8	al	al	PROPN
brj-24894	175	9	.	.	PROPN
brj-24894	176	1	(	(	PUNCT
brj-24894	176	2	2026	2026	NUM
brj-24894	176	3	)	)	PUNCT
brj-24894	176	4	.	.	PUNCT
brj-24894	177	1	“	"	PUNCT
brj-24894	177	2	endoglucanase	endoglucanase	VERB
brj-24894	177	3	tpcel12a	tpcel12a	NOUN
brj-24894	177	4	traits	trait	NOUN
brj-24894	177	5	,	,	PUNCT
brj-24894	177	6	”	"	PUNCT
brj-24894	177	7	bioresources	bioresource	NOUN
brj-24894	177	8	21(1	21(1	NUM
brj-24894	177	9	)	)	PUNCT
brj-24894	177	10	,	,	PUNCT
brj-24894	177	11	547	547	NUM
brj-24894	177	12	-	-	SYM
brj-24894	177	13	569	569	NUM
brj-24894	177	14	.	.	PUNCT
brj-24894	178	1	555	555	NUM
brj-24894	178	2	sds	sds	NOUN
brj-24894	178	3	-	-	PUNCT
brj-24894	178	4	page	page	NOUN
brj-24894	178	5	analysis	analysis	NOUN
brj-24894	178	6	revealed	reveal	VERB
brj-24894	178	7	a	a	DET
brj-24894	178	8	single	single	ADJ
brj-24894	178	9	protein	protein	NOUN
brj-24894	178	10	band	band	NOUN
brj-24894	178	11	corresponding	correspond	VERB
brj-24894	178	12	to	to	ADP
brj-24894	178	13	the	the	DET
brj-24894	178	14	theoretical	theoretical	ADJ
brj-24894	178	15	molecular	molecular	ADJ
brj-24894	178	16	weight	weight	NOUN
brj-24894	178	17	of	of	ADP
brj-24894	178	18	tpcel12a	tpcel12a	NOUN
brj-24894	178	19	(	(	PUNCT
brj-24894	178	20	fig	fig	NOUN
brj-24894	178	21	.	.	PUNCT
brj-24894	178	22	2a	2a	NUM
brj-24894	178	23	)	)	PUNCT
brj-24894	178	24	.	.	PUNCT
brj-24894	179	1	the	the	DET
brj-24894	179	2	successful	successful	ADJ
brj-24894	179	3	expression	expression	NOUN
brj-24894	179	4	of	of	ADP
brj-24894	179	5	tpcel12a	tpcel12a	NOUN
brj-24894	179	6	in	in	ADP
brj-24894	179	7	t.	t.	NOUN
brj-24894	179	8	pinophilus	pinophilus	ADJ
brj-24894	179	9	strain	strain	NOUN
brj-24894	179	10	y117	y117	NUM
brj-24894	179	11	suggests	suggest	VERB
brj-24894	179	12	that	that	SCONJ
brj-24894	179	13	this	this	DET
brj-24894	179	14	strain	strain	NOUN
brj-24894	179	15	has	have	VERB
brj-24894	179	16	potential	potential	NOUN
brj-24894	179	17	to	to	PART
brj-24894	179	18	be	be	AUX
brj-24894	179	19	engineered	engineer	VERB
brj-24894	179	20	into	into	ADP
brj-24894	179	21	a	a	DET
brj-24894	179	22	biosynthetic	biosynthetic	ADJ
brj-24894	179	23	platform	platform	NOUN
brj-24894	179	24	for	for	ADP
brj-24894	179	25	enzyme	enzyme	NOUN
brj-24894	179	26	production	production	NOUN
brj-24894	179	27	from	from	ADP
brj-24894	179	28	cost	cost	NOUN
brj-24894	179	29	-	-	PUNCT
brj-24894	179	30	effective	effective	ADJ
brj-24894	179	31	lignocellulosic	lignocellulosic	ADJ
brj-24894	179	32	biomass	biomass	NOUN
brj-24894	179	33	,	,	PUNCT
brj-24894	179	34	pending	pende	VERB
brj-24894	179	35	further	further	ADJ
brj-24894	179	36	optimization	optimization	NOUN
brj-24894	179	37	of	of	ADP
brj-24894	179	38	key	key	ADJ
brj-24894	179	39	elements	element	NOUN
brj-24894	179	40	such	such	ADJ
brj-24894	179	41	as	as	ADP
brj-24894	179	42	promoters	promoter	NOUN
brj-24894	179	43	and	and	CCONJ
brj-24894	179	44	signal	signal	ADJ
brj-24894	179	45	peptides	peptide	NOUN
brj-24894	179	46	.	.	PUNCT
brj-24894	180	1	de	de	PROPN
brj-24894	180	2	novo	novo	PROPN
brj-24894	180	3	n	n	CCONJ
brj-24894	180	4	-	-	PUNCT
brj-24894	180	5	terminal	terminal	NOUN
brj-24894	180	6	sequencing	sequencing	NOUN
brj-24894	180	7	further	far	ADV
brj-24894	180	8	identified	identify	VERB
brj-24894	180	9	the	the	DET
brj-24894	180	10	cleavage	cleavage	NOUN
brj-24894	180	11	site	site	NOUN
brj-24894	180	12	of	of	ADP
brj-24894	180	13	the	the	DET
brj-24894	180	14	signal	signal	NOUN
brj-24894	180	15	peptide	peptide	NOUN
brj-24894	180	16	,	,	PUNCT
brj-24894	180	17	yielding	yield	VERB
brj-24894	180	18	the	the	DET
brj-24894	180	19	n	n	CCONJ
brj-24894	180	20	-	-	PUNCT
brj-24894	180	21	terminal	terminal	ADJ
brj-24894	180	22	sequence	sequence	NOUN
brj-24894	180	23	ssytsgqysvnnnlwge	ssytsgqysvnnnlwge	NOUN
brj-24894	180	24	(	(	PUNCT
brj-24894	180	25	fig	fig	NOUN
brj-24894	180	26	.	.	PUNCT
brj-24894	180	27	2b	2b	NUM
brj-24894	180	28	)	)	PUNCT
brj-24894	180	29	.	.	PUNCT
brj-24894	181	1	this	this	DET
brj-24894	181	2	result	result	NOUN
brj-24894	181	3	confirmed	confirm	VERB
brj-24894	181	4	the	the	DET
brj-24894	181	5	presence	presence	NOUN
brj-24894	181	6	of	of	ADP
brj-24894	181	7	a	a	DET
brj-24894	181	8	23	23	NUM
brj-24894	181	9	-	-	PUNCT
brj-24894	181	10	amino	amino	NOUN
brj-24894	181	11	acid	acid	NOUN
brj-24894	181	12	signal	signal	NOUN
brj-24894	181	13	peptide	peptide	NOUN
brj-24894	181	14	,	,	PUNCT
brj-24894	181	15	which	which	PRON
brj-24894	181	16	was	be	AUX
brj-24894	181	17	notably	notably	ADV
brj-24894	181	18	longer	long	ADJ
brj-24894	181	19	than	than	ADP
brj-24894	181	20	the	the	DET
brj-24894	181	21	bioinformatically	bioinformatically	ADV
brj-24894	181	22	predicted	predict	VERB
brj-24894	181	23	15	15	NUM
brj-24894	181	24	-	-	PUNCT
brj-24894	181	25	amino	amino	NOUN
brj-24894	181	26	acid	acid	NOUN
brj-24894	181	27	signal	signal	NOUN
brj-24894	181	28	peptide	peptide	NOUN
brj-24894	181	29	.	.	PUNCT
brj-24894	182	1	to	to	PART
brj-24894	182	2	determine	determine	VERB
brj-24894	182	3	the	the	DET
brj-24894	182	4	oligomeric	oligomeric	ADJ
brj-24894	182	5	state	state	NOUN
brj-24894	182	6	of	of	ADP
brj-24894	182	7	recombinant	recombinant	ADJ
brj-24894	182	8	tpcel12a	tpcel12a	NOUN
brj-24894	182	9	,	,	PUNCT
brj-24894	182	10	we	we	PRON
brj-24894	182	11	performed	perform	VERB
brj-24894	182	12	size	size	NOUN
brj-24894	182	13	-	-	PUNCT
brj-24894	182	14	exclusion	exclusion	NOUN
brj-24894	182	15	chromatography	chromatography	NOUN
brj-24894	182	16	.	.	PUNCT
brj-24894	183	1	recombinant	recombinant	ADJ
brj-24894	183	2	tpcel12a	tpcel12a	NOUN
brj-24894	183	3	was	be	AUX
brj-24894	183	4	eluted	elute	VERB
brj-24894	183	5	at	at	ADP
brj-24894	183	6	18.24	18.24	NUM
brj-24894	183	7	ml	ml	NOUN
brj-24894	183	8	(	(	PUNCT
brj-24894	183	9	fig	fig	NOUN
brj-24894	183	10	.	.	PUNCT
brj-24894	184	1	2c	2c	NUM
brj-24894	184	2	)	)	PUNCT
brj-24894	184	3	.	.	PUNCT
brj-24894	185	1	based	base	VERB
brj-24894	185	2	on	on	ADP
brj-24894	185	3	the	the	DET
brj-24894	185	4	calibration	calibration	NOUN
brj-24894	185	5	curve	curve	NOUN
brj-24894	185	6	(	(	PUNCT
brj-24894	185	7	appendix	appendix	NOUN
brj-24894	185	8	v	v	NOUN
brj-24894	185	9	)	)	PUNCT
brj-24894	185	10	,	,	PUNCT
brj-24894	185	11	the	the	DET
brj-24894	185	12	apparent	apparent	ADJ
brj-24894	185	13	mw	mw	NOUN
brj-24894	185	14	of	of	ADP
brj-24894	185	15	recombinant	recombinant	ADJ
brj-24894	185	16	tpcel12a	tpcel12a	NOUN
brj-24894	185	17	was	be	AUX
brj-24894	185	18	determined	determine	VERB
brj-24894	185	19	to	to	PART
brj-24894	185	20	be	be	AUX
brj-24894	185	21	24.44	24.44	NUM
brj-24894	185	22	kda	kda	NOUN
brj-24894	185	23	,	,	PUNCT
brj-24894	185	24	which	which	PRON
brj-24894	185	25	is	be	AUX
brj-24894	185	26	consistent	consistent	ADJ
brj-24894	185	27	with	with	ADP
brj-24894	185	28	the	the	DET
brj-24894	185	29	theoretical	theoretical	ADJ
brj-24894	185	30	mw	mw	NOUN
brj-24894	185	31	(	(	PUNCT
brj-24894	185	32	24.1	24.1	NUM
brj-24894	185	33	kda	kda	NOUN
brj-24894	185	34	)	)	PUNCT
brj-24894	185	35	of	of	ADP
brj-24894	185	36	the	the	DET
brj-24894	185	37	mature	mature	ADJ
brj-24894	185	38	tpcel12a	tpcel12a	NOUN
brj-24894	185	39	protein	protein	NOUN
brj-24894	185	40	fused	fuse	VERB
brj-24894	185	41	with	with	ADP
brj-24894	185	42	a	a	DET
brj-24894	185	43	c	c	NOUN
brj-24894	185	44	-	-	PUNCT
brj-24894	185	45	terminal	terminal	ADJ
brj-24894	185	46	8×his	8×his	NUM
brj-24894	185	47	-	-	PUNCT
brj-24894	185	48	tag	tag	NOUN
brj-24894	185	49	.	.	PUNCT
brj-24894	186	1	this	this	DET
brj-24894	186	2	result	result	NOUN
brj-24894	186	3	suggests	suggest	VERB
brj-24894	186	4	that	that	SCONJ
brj-24894	186	5	recombinant	recombinant	ADJ
brj-24894	186	6	tpcel12a	tpcel12a	NOUN
brj-24894	186	7	exists	exist	NOUN
brj-24894	186	8	as	as	ADP
brj-24894	186	9	a	a	DET
brj-24894	186	10	monomer	monomer	NOUN
brj-24894	186	11	in	in	ADP
brj-24894	186	12	solution	solution	NOUN
brj-24894	186	13	and	and	CCONJ
brj-24894	186	14	tpcel12a	tpcel12a	NOUN
brj-24894	186	15	was	be	AUX
brj-24894	186	16	not	not	PART
brj-24894	186	17	glycosylation	glycosylation	NOUN
brj-24894	186	18	modified	modify	VERB
brj-24894	186	19	at	at	ADP
brj-24894	186	20	the	the	DET
brj-24894	186	21	putative	putative	ADJ
brj-24894	186	22	glycosylation	glycosylation	NOUN
brj-24894	186	23	site	site	NOUN
brj-24894	186	24	.	.	PUNCT
brj-24894	187	1	fig	fig	NOUN
brj-24894	187	2	.	.	PUNCT
brj-24894	188	1	3	3	X
brj-24894	188	2	.	.	X
brj-24894	188	3	phylogenetic	phylogenetic	ADJ
brj-24894	188	4	analysis	analysis	NOUN
brj-24894	188	5	of	of	ADP
brj-24894	188	6	gh12	gh12	PROPN
brj-24894	188	7	family	family	NOUN
brj-24894	188	8	endoglucanases	endoglucanase	NOUN
brj-24894	188	9	.	.	PUNCT
brj-24894	189	1	the	the	DET
brj-24894	189	2	phylogenetic	phylogenetic	ADJ
brj-24894	189	3	tree	tree	NOUN
brj-24894	189	4	was	be	AUX
brj-24894	189	5	constructed	construct	VERB
brj-24894	189	6	using	use	VERB
brj-24894	189	7	the	the	DET
brj-24894	189	8	maximum	maximum	ADJ
brj-24894	189	9	likelihood	likelihood	NOUN
brj-24894	189	10	method	method	NOUN
brj-24894	189	11	with	with	ADP
brj-24894	189	12	mega	mega	ADJ
brj-24894	189	13	x.	x.	NOUN
brj-24894	189	14	the	the	DET
brj-24894	189	15	percentages	percentage	NOUN
brj-24894	189	16	of	of	ADP
brj-24894	189	17	replicate	replicate	VERB
brj-24894	189	18	trees	tree	NOUN
brj-24894	189	19	in	in	ADP
brj-24894	189	20	which	which	PRON
brj-24894	189	21	the	the	DET
brj-24894	189	22	associated	associated	ADJ
brj-24894	189	23	taxa	taxa	NOUN
brj-24894	189	24	clustered	cluster	VERB
brj-24894	189	25	together	together	ADV
brj-24894	189	26	in	in	ADP
brj-24894	189	27	the	the	DET
brj-24894	189	28	bootstrap	bootstrap	NOUN
brj-24894	189	29	test	test	NOUN
brj-24894	189	30	(	(	PUNCT
brj-24894	189	31	500	500	NUM
brj-24894	189	32	)	)	PUNCT
brj-24894	189	33	are	be	AUX
brj-24894	189	34	shown	show	VERB
brj-24894	189	35	next	next	ADV
brj-24894	189	36	to	to	ADP
brj-24894	189	37	the	the	DET
brj-24894	189	38	branches	branch	NOUN
brj-24894	189	39	.	.	PUNCT
brj-24894	190	1	the	the	DET
brj-24894	190	2	amino	amino	NOUN
brj-24894	190	3	acid	acid	NOUN
brj-24894	190	4	sequences	sequence	NOUN
brj-24894	190	5	of	of	ADP
brj-24894	190	6	gh12	gh12	PROPN
brj-24894	190	7	family	family	NOUN
brj-24894	190	8	endoglucanases	endoglucanase	NOUN
brj-24894	190	9	were	be	AUX
brj-24894	190	10	retrieved	retrieve	VERB
brj-24894	190	11	from	from	ADP
brj-24894	190	12	uniprotkb	uniprotkb	ADJ
brj-24894	190	13	database	database	NOUN
brj-24894	190	14	(	(	PUNCT
brj-24894	190	15	lussi	lussi	VERB
brj-24894	190	16	et	et	PROPN
brj-24894	190	17	al	al	PROPN
brj-24894	190	18	.	.	PROPN
brj-24894	190	19	2023	2023	NUM
brj-24894	190	20	)	)	PUNCT
brj-24894	190	21	,	,	PUNCT
brj-24894	190	22	including	include	VERB
brj-24894	190	23	xgea_aspcl	xgea_aspcl	PROPN
brj-24894	190	24	(	(	PUNCT
brj-24894	190	25	aspergillus	aspergillus	NOUN
brj-24894	190	26	clavatus	clavatus	NOUN
brj-24894	190	27	atcc1007	atcc1007	PROPN
brj-24894	190	28	)	)	PUNCT
brj-24894	190	29	,	,	PUNCT
brj-24894	190	30	xgea_aspfu	xgea_aspfu	PROPN
brj-24894	190	31	(	(	PUNCT
brj-24894	190	32	aspergillus	aspergillus	NOUN
brj-24894	190	33	fumigatus	fumigatus	NOUN
brj-24894	190	34	(	(	PUNCT
brj-24894	190	35	atcc	atcc	ADJ
brj-24894	190	36	mya-4609	mya-4609	NOUN
brj-24894	190	37	)	)	PUNCT
brj-24894	190	38	)	)	PUNCT
brj-24894	190	39	,	,	PUNCT
brj-24894	190	40	xgea_aspac	xgea_aspac	PROPN
brj-24894	190	41	(	(	PUNCT
brj-24894	190	42	aspergillus	aspergillus	NOUN
brj-24894	190	43	aculeatus	aculeatus	NOUN
brj-24894	190	44	ksm510	ksm510	PROPN
brj-24894	190	45	)	)	PUNCT
brj-24894	190	46	,	,	PUNCT
brj-24894	190	47	a0a100i2e1_aspng	a0a100i2e1_aspng	PROPN
brj-24894	190	48	(	(	PUNCT
brj-24894	190	49	aspergillus	aspergillus	NOUN
brj-24894	190	50	nigeran76	nigeran76	NOUN
brj-24894	190	51	)	)	PUNCT
brj-24894	190	52	,	,	PUNCT
brj-24894	190	53	xgea_emeni	xgea_emeni	PROPN
brj-24894	190	54	(	(	PUNCT
brj-24894	190	55	emericella	emericella	NOUN
brj-24894	190	56	nidulans	nidulans	ADP
brj-24894	190	57	atcc38163	atcc38163	PROPN
brj-24894	190	58	)	)	PUNCT
brj-24894	190	59	,	,	PUNCT
brj-24894	190	60	xgea_aspor	xgea_aspor	PROPN
brj-24894	190	61	(	(	PUNCT
brj-24894	190	62	aspergillus	aspergillus	NOUN
brj-24894	190	63	oryzae	oryzae	NOUN
brj-24894	190	64	atcc42149	atcc42149	PROPN
brj-24894	190	65	)	)	PUNCT
brj-24894	190	66	,	,	PUNCT
brj-24894	190	67	xgea_asptn	xgea_asptn	PROPN
brj-24894	190	68	(	(	PUNCT
brj-24894	190	69	aspergillus	aspergillus	NOUN
brj-24894	190	70	terreus	terreus	NOUN
brj-24894	190	71	nih2624	nih2624	NOUN
brj-24894	190	72	)	)	PUNCT
brj-24894	190	73	,	,	PUNCT
brj-24894	190	74	q0c8u0_asptn	q0c8u0_asptn	PROPN
brj-24894	190	75	(	(	PUNCT
brj-24894	190	76	aspergillus	aspergillus	NOUN
brj-24894	190	77	terreus	terreus	NOUN
brj-24894	190	78	nih2624	nih2624	NOUN
brj-24894	190	79	)	)	PUNCT
brj-24894	190	80	,	,	PUNCT
brj-24894	190	81	a0a3g2c3i4_9euro	a0a3g2c3i4_9euro	PROPN
brj-24894	190	82	(	(	PUNCT
brj-24894	190	83	aspergillus	aspergillus	PROPN
brj-24894	190	84	cervinus	cervinus	PROPN
brj-24894	190	85	vkpm	vkpm	PROPN
brj-24894	190	86	f-612	f-612	PROPN
brj-24894	190	87	)	)	PUNCT
brj-24894	190	88	,	,	PUNCT
brj-24894	190	89	q2ufr8_aspor	q2ufr8_aspor	NOUN
brj-24894	190	90	(	(	PUNCT
brj-24894	190	91	aspergillus	aspergillus	NOUN
brj-24894	190	92	oryzae	oryzae	NOUN
brj-24894	190	93	atcc42149	atcc42149	PROPN
brj-24894	190	94	)	)	PUNCT
brj-24894	190	95	,	,	PUNCT
brj-24894	190	96	guna_aspkw	guna_aspkw	NOUN
brj-24894	190	97	(	(	PUNCT
brj-24894	190	98	aspergillus	aspergillus	NOUN
brj-24894	190	99	kawachii	kawachii	PROPN
brj-24894	190	100	nbrc4308	nbrc4308	PROPN
brj-24894	190	101	)	)	PUNCT
brj-24894	190	102	,	,	PUNCT
brj-24894	190	103	g1etn1_aspus	g1etn1_aspus	PROPN
brj-24894	190	104	(	(	PUNCT
brj-24894	190	105	aspergillus	aspergillus	NOUN
brj-24894	190	106	usamii	usamii	NOUN
brj-24894	190	107	atcc11364	atcc11364	PROPN
brj-24894	190	108	)	)	PUNCT
brj-24894	190	109	and	and	CCONJ
brj-24894	190	110	guna_acet2	guna_acet2	PROPN
brj-24894	190	111	(	(	PUNCT
brj-24894	190	112	acetivibrio	acetivibrio	PROPN
brj-24894	190	113	thermocellus	thermocellus	PROPN
brj-24894	190	114	atcc27405	atcc27405	PROPN
brj-24894	190	115	)	)	PUNCT
brj-24894	190	116	of	of	ADP
brj-24894	190	117	gh8	gh8	NOUN
brj-24894	190	118	family	family	NOUN
brj-24894	190	119	,	,	PUNCT
brj-24894	190	120	which	which	PRON
brj-24894	190	121	was	be	AUX
brj-24894	190	122	used	use	VERB
brj-24894	190	123	as	as	ADP
brj-24894	190	124	outgroup	outgroup	NOUN
brj-24894	190	125	.	.	PUNCT
brj-24894	191	1	the	the	DET
brj-24894	191	2	black	black	ADJ
brj-24894	191	3	arrow	arrow	NOUN
brj-24894	191	4	indicates	indicate	VERB
brj-24894	191	5	the	the	DET
brj-24894	191	6	target	target	NOUN
brj-24894	191	7	sequence	sequence	NOUN
brj-24894	191	8	tpcel12a	tpcel12a	NOUN
brj-24894	191	9	.	.	PUNCT
brj-24894	192	1	two	two	NUM
brj-24894	192	2	distinct	distinct	ADJ
brj-24894	192	3	subfamilies	subfamily	NOUN
brj-24894	192	4	representing	represent	VERB
brj-24894	192	5	xyloglucanase	xyloglucanase	NOUN
brj-24894	192	6	and	and	CCONJ
brj-24894	192	7	promiscuous	promiscuous	ADJ
brj-24894	192	8	endoglucanase	endoglucanase	NOUN
brj-24894	192	9	were	be	AUX
brj-24894	192	10	marked	mark	VERB
brj-24894	192	11	by	by	ADP
brj-24894	192	12	gray	gray	ADJ
brj-24894	192	13	and	and	CCONJ
brj-24894	192	14	black	black	ADJ
brj-24894	192	15	lines	line	NOUN
brj-24894	192	16	,	,	PUNCT
brj-24894	192	17	respectively	respectively	ADV
brj-24894	192	18	.	.	PUNCT
brj-24894	193	1	peer	peer	NOUN
brj-24894	193	2	-	-	PUNCT
brj-24894	193	3	reviewed	review	VERB
brj-24894	193	4	article	article	NOUN
brj-24894	193	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	193	6	li	li	PROPN
brj-24894	193	7	et	et	PROPN
brj-24894	193	8	al	al	PROPN
brj-24894	193	9	.	.	PROPN
brj-24894	194	1	(	(	PUNCT
brj-24894	194	2	2026	2026	NUM
brj-24894	194	3	)	)	PUNCT
brj-24894	194	4	.	.	PUNCT
brj-24894	195	1	“	"	PUNCT
brj-24894	195	2	endoglucanase	endoglucanase	VERB
brj-24894	195	3	tpcel12a	tpcel12a	NOUN
brj-24894	195	4	traits	trait	NOUN
brj-24894	195	5	,	,	PUNCT
brj-24894	195	6	”	"	PUNCT
brj-24894	195	7	bioresources	bioresource	NOUN
brj-24894	195	8	21(1	21(1	NUM
brj-24894	195	9	)	)	PUNCT
brj-24894	195	10	,	,	PUNCT
brj-24894	195	11	547	547	NUM
brj-24894	195	12	-	-	SYM
brj-24894	195	13	569	569	NUM
brj-24894	195	14	.	.	PUNCT
brj-24894	195	15	556	556	NUM
brj-24894	195	16	substrate	substrate	NOUN
brj-24894	195	17	specificity	specificity	NOUN
brj-24894	195	18	of	of	ADP
brj-24894	195	19	recombinant	recombinant	ADJ
brj-24894	195	20	tpcel12a	tpcel12a	NOUN
brj-24894	195	21	previous	previous	ADJ
brj-24894	195	22	studies	study	NOUN
brj-24894	195	23	revealed	reveal	VERB
brj-24894	195	24	that	that	SCONJ
brj-24894	195	25	gh12	gh12	PROPN
brj-24894	195	26	enzymes	enzyme	NOUN
brj-24894	195	27	from	from	ADP
brj-24894	195	28	eurotiomycetes	eurotiomycete	NOUN
brj-24894	195	29	were	be	AUX
brj-24894	195	30	divided	divide	VERB
brj-24894	195	31	into	into	ADP
brj-24894	195	32	two	two	NUM
brj-24894	195	33	distinct	distinct	ADJ
brj-24894	195	34	subgroups	subgroup	NOUN
brj-24894	195	35	,	,	PUNCT
brj-24894	195	36	subgroup	subgroup	NOUN
brj-24894	195	37	i	i	PROPN
brj-24894	195	38	and	and	CCONJ
brj-24894	195	39	ii	ii	PROPN
brj-24894	195	40	:	:	PUNCT
brj-24894	195	41	subfamily	subfamily	ADV
brj-24894	195	42	i	i	PRON
brj-24894	195	43	exhibits	exhibit	VERB
brj-24894	195	44	general	general	ADJ
brj-24894	195	45	endoglucanase	endoglucanase	NOUN
brj-24894	195	46	activity	activity	NOUN
brj-24894	195	47	,	,	PUNCT
brj-24894	195	48	while	while	SCONJ
brj-24894	195	49	subfamily	subfamily	ADV
brj-24894	195	50	ii	ii	NOUN
brj-24894	195	51	demonstrates	demonstrate	VERB
brj-24894	195	52	xyloglucan	xyloglucan	ADJ
brj-24894	195	53	-	-	PUNCT
brj-24894	195	54	specific	specific	ADJ
brj-24894	195	55	activity	activity	NOUN
brj-24894	195	56	(	(	PUNCT
brj-24894	195	57	rykov	rykov	PROPN
brj-24894	195	58	et	et	PROPN
brj-24894	195	59	al	al	PROPN
brj-24894	195	60	.	.	PROPN
brj-24894	195	61	2019	2019	NUM
brj-24894	195	62	)	)	PUNCT
brj-24894	195	63	.	.	PUNCT
brj-24894	196	1	phylogenetic	phylogenetic	ADJ
brj-24894	196	2	analysis	analysis	NOUN
brj-24894	196	3	revealed	reveal	VERB
brj-24894	196	4	that	that	SCONJ
brj-24894	196	5	tpcel12a	tpcel12a	VERB
brj-24894	196	6	clusters	cluster	NOUN
brj-24894	196	7	within	within	ADP
brj-24894	196	8	subfamily	subfamily	ADV
brj-24894	196	9	i	i	PRON
brj-24894	196	10	(	(	PUNCT
brj-24894	196	11	fig	fig	NOUN
brj-24894	196	12	.	.	PUNCT
brj-24894	197	1	3	3	NUM
brj-24894	197	2	)	)	PUNCT
brj-24894	197	3	.	.	PUNCT
brj-24894	198	1	in	in	ADP
brj-24894	198	2	addition	addition	NOUN
brj-24894	198	3	,	,	PUNCT
brj-24894	198	4	typical	typical	ADJ
brj-24894	198	5	sequence	sequence	NOUN
brj-24894	198	6	features	feature	NOUN
brj-24894	198	7	,	,	PUNCT
brj-24894	198	8	presence	presence	NOUN
brj-24894	198	9	of	of	ADP
brj-24894	198	10	the	the	DET
brj-24894	198	11	ysg	ysg	NOUN
brj-24894	198	12	motif	motif	NOUN
brj-24894	198	13	and	and	CCONJ
brj-24894	198	14	absence	absence	NOUN
brj-24894	198	15	of	of	ADP
brj-24894	198	16	the	the	DET
brj-24894	198	17	sst	sst	NOUN
brj-24894	198	18	motif	motif	NOUN
brj-24894	198	19	(	(	PUNCT
brj-24894	198	20	damásio	damásio	PROPN
brj-24894	198	21	et	et	PROPN
brj-24894	198	22	al	al	PROPN
brj-24894	198	23	.	.	PROPN
brj-24894	198	24	2014	2014	NUM
brj-24894	198	25	)	)	PUNCT
brj-24894	198	26	,	,	PUNCT
brj-24894	198	27	were	be	AUX
brj-24894	198	28	observed	observe	VERB
brj-24894	198	29	in	in	ADP
brj-24894	198	30	tpcel12a	tpcel12a	X
brj-24894	198	31	(	(	PUNCT
brj-24894	198	32	fig	fig	NOUN
brj-24894	198	33	.	.	NOUN
brj-24894	199	1	1	1	NUM
brj-24894	199	2	)	)	PUNCT
brj-24894	199	3	.	.	PUNCT
brj-24894	200	1	the	the	DET
brj-24894	200	2	analysis	analysis	NOUN
brj-24894	200	3	suggests	suggest	VERB
brj-24894	200	4	that	that	SCONJ
brj-24894	200	5	tpcel12a	tpcel12a	NOUN
brj-24894	200	6	might	might	AUX
brj-24894	200	7	function	function	VERB
brj-24894	200	8	as	as	ADP
brj-24894	200	9	a	a	DET
brj-24894	200	10	promiscuous	promiscuous	ADJ
brj-24894	200	11	endoglucanase	endoglucanase	NOUN
brj-24894	200	12	.	.	PUNCT
brj-24894	201	1	to	to	PART
brj-24894	201	2	investigate	investigate	VERB
brj-24894	201	3	the	the	DET
brj-24894	201	4	substrate	substrate	NOUN
brj-24894	201	5	specificity	specificity	NOUN
brj-24894	201	6	,	,	PUNCT
brj-24894	201	7	the	the	DET
brj-24894	201	8	recombinant	recombinant	ADJ
brj-24894	201	9	tpcel12a	tpcel12a	NOUN
brj-24894	201	10	was	be	AUX
brj-24894	201	11	performed	perform	VERB
brj-24894	201	12	to	to	PART
brj-24894	201	13	hydrolyze	hydrolyze	VERB
brj-24894	201	14	various	various	ADJ
brj-24894	201	15	isolated	isolated	ADJ
brj-24894	201	16	polysaccharides	polysaccharide	NOUN
brj-24894	201	17	.	.	PUNCT
brj-24894	202	1	the	the	DET
brj-24894	202	2	results	result	NOUN
brj-24894	202	3	demonstrated	demonstrate	VERB
brj-24894	202	4	that	that	SCONJ
brj-24894	202	5	tpcel12a	tpcel12a	NOUN
brj-24894	202	6	can	can	AUX
brj-24894	202	7	hydrolyze	hydrolyze	VERB
brj-24894	202	8	both	both	DET
brj-24894	202	9	cmc	cmc	NOUN
brj-24894	202	10	and	and	CCONJ
brj-24894	202	11	xyloglucan	xyloglucan	ADJ
brj-24894	202	12	.	.	PUNCT
brj-24894	203	1	and	and	CCONJ
brj-24894	203	2	tpcel12a	tpcel12a	NOUN
brj-24894	203	3	exhibited	exhibit	VERB
brj-24894	203	4	the	the	DET
brj-24894	203	5	maximum	maximum	ADJ
brj-24894	203	6	activity	activity	NOUN
brj-24894	203	7	toward	toward	ADP
brj-24894	203	8	xyloglucan	xyloglucan	NOUN
brj-24894	203	9	,	,	PUNCT
brj-24894	203	10	with	with	ADP
brj-24894	203	11	approximately	approximately	ADV
brj-24894	203	12	30	30	NUM
brj-24894	203	13	%	%	NOUN
brj-24894	203	14	of	of	ADP
brj-24894	203	15	that	that	DET
brj-24894	203	16	activity	activity	NOUN
brj-24894	203	17	observed	observe	VERB
brj-24894	203	18	on	on	ADP
brj-24894	203	19	cmc	cmc	PROPN
brj-24894	203	20	.	.	PUNCT
brj-24894	204	1	however	however	ADV
brj-24894	204	2	,	,	PUNCT
brj-24894	204	3	tpcel12a	tpcel12a	NOUN
brj-24894	204	4	showed	show	VERB
brj-24894	204	5	almost	almost	ADV
brj-24894	204	6	no	no	PRON
brj-24894	204	7	activity	activity	NOUN
brj-24894	204	8	towards	towards	ADP
brj-24894	204	9	insoluble	insoluble	ADJ
brj-24894	204	10	microcrystalline	microcrystalline	NOUN
brj-24894	204	11	cellulose	cellulose	NOUN
brj-24894	204	12	(	(	PUNCT
brj-24894	204	13	mcc	mcc	NOUN
brj-24894	204	14	)	)	PUNCT
brj-24894	204	15	.	.	PUNCT
brj-24894	205	1	this	this	DET
brj-24894	205	2	phenomenon	phenomenon	NOUN
brj-24894	205	3	can	can	AUX
brj-24894	205	4	be	be	AUX
brj-24894	205	5	explained	explain	VERB
brj-24894	205	6	by	by	ADP
brj-24894	205	7	the	the	DET
brj-24894	205	8	dense	dense	ADJ
brj-24894	205	9	,	,	PUNCT
brj-24894	205	10	highly	highly	ADV
brj-24894	205	11	aggregated	aggregate	VERB
brj-24894	205	12	crystalline	crystalline	ADJ
brj-24894	205	13	structure	structure	NOUN
brj-24894	205	14	of	of	ADP
brj-24894	205	15	mcc	mcc	NOUN
brj-24894	205	16	,	,	PUNCT
brj-24894	205	17	which	which	PRON
brj-24894	205	18	physically	physically	ADV
brj-24894	205	19	prevents	prevent	VERB
brj-24894	205	20	tpcel12a	tpcel12a	NOUN
brj-24894	205	21	from	from	ADP
brj-24894	205	22	accessing	access	VERB
brj-24894	205	23	the	the	DET
brj-24894	205	24	β-1,4	β-1,4	ADJ
brj-24894	205	25	-	-	ADJ
brj-24894	205	26	glycosidic	glycosidic	ADJ
brj-24894	205	27	bonds	bond	NOUN
brj-24894	205	28	in	in	ADP
brj-24894	205	29	the	the	DET
brj-24894	205	30	glucan	glucan	NOUN
brj-24894	205	31	backbone	backbone	NOUN
brj-24894	205	32	and	and	CCONJ
brj-24894	205	33	thus	thus	ADV
brj-24894	205	34	inhibits	inhibit	VERB
brj-24894	205	35	catalytic	catalytic	ADJ
brj-24894	205	36	activity	activity	NOUN
brj-24894	205	37	.	.	PUNCT
brj-24894	206	1	it	it	PRON
brj-24894	206	2	was	be	AUX
brj-24894	206	3	therefore	therefore	ADV
brj-24894	206	4	hypothesized	hypothesize	VERB
brj-24894	206	5	that	that	SCONJ
brj-24894	206	6	tpcel12a	tpcel12a	NOUN
brj-24894	206	7	would	would	AUX
brj-24894	206	8	display	display	VERB
brj-24894	206	9	intermediate	intermediate	ADJ
brj-24894	206	10	activity	activity	NOUN
brj-24894	206	11	on	on	ADP
brj-24894	206	12	amorphous	amorphous	ADJ
brj-24894	206	13	cellulose	cellulose	NOUN
brj-24894	206	14	,	,	PUNCT
brj-24894	206	15	which	which	PRON
brj-24894	206	16	offers	offer	VERB
brj-24894	206	17	greater	great	ADJ
brj-24894	206	18	accessibility	accessibility	NOUN
brj-24894	206	19	than	than	ADP
brj-24894	206	20	mcc	mcc	NOUN
brj-24894	206	21	but	but	CCONJ
brj-24894	206	22	less	less	ADJ
brj-24894	206	23	than	than	ADP
brj-24894	206	24	fully	fully	ADV
brj-24894	206	25	soluble	soluble	ADJ
brj-24894	206	26	polymers	polymer	NOUN
brj-24894	206	27	.	.	PUNCT
brj-24894	207	1	furthermore	furthermore	ADV
brj-24894	207	2	,	,	PUNCT
brj-24894	207	3	to	to	PART
brj-24894	207	4	precisely	precisely	ADV
brj-24894	207	5	delineate	delineate	VERB
brj-24894	207	6	the	the	DET
brj-24894	207	7	substrate	substrate	NOUN
brj-24894	207	8	specificity	specificity	NOUN
brj-24894	207	9	and	and	CCONJ
brj-24894	207	10	cellulolytic	cellulolytic	ADJ
brj-24894	207	11	activity	activity	NOUN
brj-24894	207	12	of	of	ADP
brj-24894	207	13	tpcel12a	tpcel12a	NOUN
brj-24894	207	14	,	,	PUNCT
brj-24894	207	15	future	future	ADJ
brj-24894	207	16	work	work	NOUN
brj-24894	207	17	will	will	AUX
brj-24894	207	18	include	include	VERB
brj-24894	207	19	assays	assay	NOUN
brj-24894	207	20	using	use	VERB
brj-24894	207	21	highly	highly	ADV
brj-24894	207	22	pure	pure	ADJ
brj-24894	207	23	cellulosic	cellulosic	NOUN
brj-24894	207	24	substrates	substrate	NOUN
brj-24894	207	25	with	with	ADP
brj-24894	207	26	minimal	minimal	ADJ
brj-24894	207	27	hemicellulose	hemicellulose	NOUN
brj-24894	207	28	content	content	NOUN
brj-24894	207	29	,	,	PUNCT
brj-24894	207	30	such	such	ADJ
brj-24894	207	31	as	as	ADP
brj-24894	207	32	cotton	cotton	NOUN
brj-24894	207	33	fibers	fiber	NOUN
brj-24894	207	34	or	or	CCONJ
brj-24894	207	35	bleached	bleach	VERB
brj-24894	207	36	kraft	kraft	NOUN
brj-24894	207	37	pulps	pulp	NOUN
brj-24894	207	38	.	.	PUNCT
brj-24894	208	1	interestingly	interestingly	ADV
brj-24894	208	2	,	,	PUNCT
brj-24894	208	3	tpcel12a	tpcel12a	NOUN
brj-24894	208	4	showed	show	VERB
brj-24894	208	5	no	no	DET
brj-24894	208	6	observable	observable	ADJ
brj-24894	208	7	hydrolysis	hydrolysis	NOUN
brj-24894	208	8	activity	activity	NOUN
brj-24894	208	9	against	against	ADP
brj-24894	208	10	β-1,31,4	β-1,31,4	ADV
brj-24894	208	11	-	-	PUNCT
brj-24894	208	12	glucan	glucan	NOUN
brj-24894	208	13	substrates	substrate	NOUN
brj-24894	208	14	,	,	PUNCT
brj-24894	208	15	which	which	PRON
brj-24894	208	16	serve	serve	VERB
brj-24894	208	17	as	as	ADP
brj-24894	208	18	common	common	ADJ
brj-24894	208	19	substrates	substrate	NOUN
brj-24894	208	20	for	for	ADP
brj-24894	208	21	many	many	ADJ
brj-24894	208	22	gh12	gh12	PROPN
brj-24894	208	23	subfamily	subfamily	ADV
brj-24894	208	24	i	i	PRON
brj-24894	208	25	enzymes	enzyme	VERB
brj-24894	208	26	.	.	PUNCT
brj-24894	209	1	compared	compare	VERB
brj-24894	209	2	with	with	ADP
brj-24894	209	3	gh12	gh12	PROPN
brj-24894	209	4	enzymes	enzyme	NOUN
brj-24894	209	5	capable	capable	ADJ
brj-24894	209	6	of	of	ADP
brj-24894	209	7	binding	bind	VERB
brj-24894	209	8	β-1,3	β-1,3	PROPN
brj-24894	209	9	-	-	PUNCT
brj-24894	209	10	1,4	1,4	NUM
brj-24894	209	11	-	-	PUNCT
brj-24894	209	12	glucan	glucan	NOUN
brj-24894	209	13	(	(	PUNCT
brj-24894	209	14	ma	ma	PROPN
brj-24894	209	15	et	et	PROPN
brj-24894	209	16	al	al	PROPN
brj-24894	209	17	.	.	PROPN
brj-24894	209	18	2021	2021	NUM
brj-24894	209	19	)	)	PUNCT
brj-24894	209	20	,	,	PUNCT
brj-24894	209	21	tpcel12a	tpcel12a	VERB
brj-24894	209	22	’s	’s	PART
brj-24894	209	23	substrate	substrate	NOUN
brj-24894	209	24	-	-	PUNCT
brj-24894	209	25	binding	bind	VERB
brj-24894	209	26	pocket	pocket	NOUN
brj-24894	209	27	may	may	AUX
brj-24894	209	28	be	be	AUX
brj-24894	209	29	unable	unable	ADJ
brj-24894	209	30	to	to	PART
brj-24894	209	31	accommodate	accommodate	VERB
brj-24894	209	32	the	the	DET
brj-24894	209	33	conformational	conformational	ADJ
brj-24894	209	34	changes	change	NOUN
brj-24894	209	35	of	of	ADP
brj-24894	209	36	the	the	DET
brj-24894	209	37	polysaccharide	polysaccharide	NOUN
brj-24894	209	38	chain	chain	NOUN
brj-24894	209	39	caused	cause	VERB
brj-24894	209	40	by	by	ADP
brj-24894	209	41	the	the	DET
brj-24894	209	42	β-1,3	β-1,3	PROPN
brj-24894	209	43	glycosidic	glycosidic	ADJ
brj-24894	209	44	bond	bond	NOUN
brj-24894	209	45	.	.	PUNCT
brj-24894	210	1	additionally	additionally	ADV
brj-24894	210	2	,	,	PUNCT
brj-24894	210	3	tpcel12a	tpcel12a	NOUN
brj-24894	210	4	exhibited	exhibit	VERB
brj-24894	210	5	no	no	DET
brj-24894	210	6	detectable	detectable	ADJ
brj-24894	210	7	hydrolytic	hydrolytic	ADJ
brj-24894	210	8	activity	activity	NOUN
brj-24894	210	9	against	against	ADP
brj-24894	210	10	other	other	ADJ
brj-24894	210	11	polysaccharides	polysaccharide	NOUN
brj-24894	210	12	,	,	PUNCT
brj-24894	210	13	such	such	ADJ
brj-24894	210	14	as	as	ADP
brj-24894	210	15	d	d	NOUN
brj-24894	210	16	-	-	PUNCT
brj-24894	210	17	galactosyl	galactosyl	ADJ
brj-24894	210	18	-	-	PUNCT
brj-24894	210	19	d	d	NOUN
brj-24894	210	20	-	-	PUNCT
brj-24894	210	21	mannan	mannan	NOUN
brj-24894	210	22	,	,	PUNCT
brj-24894	210	23	β	β	NOUN
brj-24894	210	24	-	-	ADJ
brj-24894	210	25	d	d	NOUN
brj-24894	210	26	-	-	PUNCT
brj-24894	210	27	mannan	mannan	NOUN
brj-24894	210	28	,	,	PUNCT
brj-24894	210	29	xylan	xylan	PROPN
brj-24894	210	30	,	,	PUNCT
brj-24894	210	31	arabinogalactan	arabinogalactan	PROPN
brj-24894	210	32	,	,	PUNCT
brj-24894	210	33	and	and	CCONJ
brj-24894	210	34	pectin	pectin	NOUN
brj-24894	210	35	.	.	PUNCT
brj-24894	211	1	this	this	DET
brj-24894	211	2	substrate	substrate	NOUN
brj-24894	211	3	preference	preference	NOUN
brj-24894	211	4	not	not	PART
brj-24894	211	5	only	only	ADV
brj-24894	211	6	conforms	conform	VERB
brj-24894	211	7	to	to	ADP
brj-24894	211	8	the	the	DET
brj-24894	211	9	functional	functional	ADJ
brj-24894	211	10	characteristics	characteristic	NOUN
brj-24894	211	11	of	of	ADP
brj-24894	211	12	gh12	gh12	PROPN
brj-24894	211	13	subfamily	subfamily	ADV
brj-24894	211	14	i	i	NOUN
brj-24894	211	15	,	,	PUNCT
brj-24894	211	16	but	but	CCONJ
brj-24894	211	17	also	also	ADV
brj-24894	211	18	exhibits	exhibit	VERB
brj-24894	211	19	a	a	DET
brj-24894	211	20	certain	certain	ADJ
brj-24894	211	21	degree	degree	NOUN
brj-24894	211	22	of	of	ADP
brj-24894	211	23	specificity	specificity	NOUN
brj-24894	211	24	,	,	PUNCT
brj-24894	211	25	providing	provide	VERB
brj-24894	211	26	theoretical	theoretical	ADJ
brj-24894	211	27	support	support	NOUN
brj-24894	211	28	for	for	ADP
brj-24894	211	29	its	its	PRON
brj-24894	211	30	application	application	NOUN
brj-24894	211	31	in	in	ADP
brj-24894	211	32	specific	specific	ADJ
brj-24894	211	33	polysaccharide	polysaccharide	NOUN
brj-24894	211	34	degradation	degradation	NOUN
brj-24894	211	35	(	(	PUNCT
brj-24894	211	36	such	such	ADJ
brj-24894	211	37	as	as	ADP
brj-24894	211	38	the	the	DET
brj-24894	211	39	degradation	degradation	NOUN
brj-24894	211	40	of	of	ADP
brj-24894	211	41	mixed	mixed	ADJ
brj-24894	211	42	substrates	substrate	NOUN
brj-24894	211	43	of	of	ADP
brj-24894	211	44	xyloglucan	xyloglucan	NOUN
brj-24894	211	45	and	and	CCONJ
brj-24894	211	46	cellulose	cellulose	NOUN
brj-24894	211	47	)	)	PUNCT
brj-24894	211	48	.	.	PUNCT
brj-24894	212	1	biochemical	biochemical	ADJ
brj-24894	212	2	characterization	characterization	NOUN
brj-24894	212	3	and	and	CCONJ
brj-24894	212	4	enzymatic	enzymatic	ADJ
brj-24894	212	5	kinetics	kinetic	NOUN
brj-24894	212	6	of	of	ADP
brj-24894	212	7	tpcel12a	tpcel12a	NOUN
brj-24894	212	8	tpcel12a	tpcel12a	NOUN
brj-24894	212	9	showed	show	VERB
brj-24894	212	10	the	the	DET
brj-24894	212	11	highest	high	ADJ
brj-24894	212	12	hydrolytic	hydrolytic	ADJ
brj-24894	212	13	activity	activity	NOUN
brj-24894	212	14	toward	toward	ADP
brj-24894	212	15	xyloglucan	xyloglucan	NOUN
brj-24894	212	16	.	.	PUNCT
brj-24894	213	1	therefore	therefore	ADV
brj-24894	213	2	,	,	PUNCT
brj-24894	213	3	the	the	DET
brj-24894	213	4	optimal	optimal	ADJ
brj-24894	213	5	conditions	condition	NOUN
brj-24894	213	6	for	for	ADP
brj-24894	213	7	activity	activity	NOUN
brj-24894	213	8	were	be	AUX
brj-24894	213	9	investigated	investigate	VERB
brj-24894	213	10	with	with	ADP
brj-24894	213	11	xyloglucan	xyloglucan	NOUN
brj-24894	213	12	as	as	ADP
brj-24894	213	13	the	the	DET
brj-24894	213	14	substrate	substrate	NOUN
brj-24894	213	15	.	.	PUNCT
brj-24894	214	1	the	the	DET
brj-24894	214	2	optimal	optimal	ADJ
brj-24894	214	3	temperature	temperature	NOUN
brj-24894	214	4	and	and	CCONJ
brj-24894	214	5	ph	ph	NOUN
brj-24894	214	6	were	be	AUX
brj-24894	214	7	determined	determine	VERB
brj-24894	214	8	to	to	PART
brj-24894	214	9	be	be	AUX
brj-24894	214	10	40	40	NUM
brj-24894	214	11	℃	℃	PROPN
brj-24894	214	12	and	and	CCONJ
brj-24894	214	13	ph	ph	ADJ
brj-24894	214	14	4	4	NUM
brj-24894	214	15	,	,	PUNCT
brj-24894	214	16	respectively	respectively	ADV
brj-24894	214	17	(	(	PUNCT
brj-24894	214	18	figs	fig	NOUN
brj-24894	214	19	.	.	PUNCT
brj-24894	214	20	4a	4a	NOUN
brj-24894	214	21	and	and	CCONJ
brj-24894	214	22	4b	4b	NUM
brj-24894	214	23	)	)	PUNCT
brj-24894	214	24	.	.	PUNCT
brj-24894	215	1	comparative	comparative	ADJ
brj-24894	215	2	analysis	analysis	NOUN
brj-24894	215	3	of	of	ADP
brj-24894	215	4	buffer	buffer	NOUN
brj-24894	215	5	systems	system	NOUN
brj-24894	215	6	revealed	reveal	VERB
brj-24894	215	7	that	that	SCONJ
brj-24894	215	8	tpcel12a	tpcel12a	NOUN
brj-24894	215	9	displayed	display	VERB
brj-24894	215	10	higher	high	ADJ
brj-24894	215	11	enzymatic	enzymatic	ADJ
brj-24894	215	12	activity	activity	NOUN
brj-24894	215	13	in	in	ADP
brj-24894	215	14	acetate	acetate	NOUN
brj-24894	215	15	buffer	buffer	NOUN
brj-24894	215	16	than	than	ADP
brj-24894	215	17	in	in	ADP
brj-24894	215	18	citrate	citrate	NOUN
brj-24894	215	19	buffer	buffer	NOUN
brj-24894	215	20	at	at	ADP
brj-24894	215	21	equivalent	equivalent	ADJ
brj-24894	215	22	ph	ph	ADJ
brj-24894	215	23	values	value	NOUN
brj-24894	215	24	(	(	PUNCT
brj-24894	215	25	fig	fig	NOUN
brj-24894	215	26	.	.	PUNCT
brj-24894	216	1	4b	4b	PROPN
brj-24894	216	2	)	)	PUNCT
brj-24894	216	3	,	,	PUNCT
brj-24894	216	4	suggesting	suggest	VERB
brj-24894	216	5	that	that	SCONJ
brj-24894	216	6	in	in	ADP
brj-24894	216	7	industrial	industrial	ADJ
brj-24894	216	8	applications	application	NOUN
brj-24894	216	9	,	,	PUNCT
brj-24894	216	10	the	the	DET
brj-24894	216	11	catalytic	catalytic	ADJ
brj-24894	216	12	efficiency	efficiency	NOUN
brj-24894	216	13	of	of	ADP
brj-24894	216	14	enzymes	enzyme	NOUN
brj-24894	216	15	can	can	AUX
brj-24894	216	16	be	be	AUX
brj-24894	216	17	further	far	ADV
brj-24894	216	18	improved	improve	VERB
brj-24894	216	19	by	by	ADP
brj-24894	216	20	optimizing	optimize	VERB
brj-24894	216	21	the	the	DET
brj-24894	216	22	type	type	NOUN
brj-24894	216	23	of	of	ADP
brj-24894	216	24	buffers	buffer	NOUN
brj-24894	216	25	in	in	ADP
brj-24894	216	26	the	the	DET
brj-24894	216	27	reaction	reaction	NOUN
brj-24894	216	28	system	system	NOUN
brj-24894	216	29	.	.	PUNCT
brj-24894	217	1	the	the	DET
brj-24894	217	2	enzyme	enzyme	NOUN
brj-24894	217	3	exhibited	exhibit	VERB
brj-24894	217	4	stability	stability	NOUN
brj-24894	217	5	across	across	ADP
brj-24894	217	6	a	a	DET
brj-24894	217	7	broad	broad	ADJ
brj-24894	217	8	ph	ph	ADJ
brj-24894	217	9	range	range	NOUN
brj-24894	217	10	(	(	PUNCT
brj-24894	217	11	3.0	3.0	NUM
brj-24894	217	12	to	to	PART
brj-24894	217	13	8.0	8.0	NUM
brj-24894	217	14	)	)	PUNCT
brj-24894	217	15	,	,	PUNCT
brj-24894	217	16	retaining	retain	VERB
brj-24894	217	17	>	>	ADP
brj-24894	217	18	90	90	NUM
brj-24894	217	19	%	%	NOUN
brj-24894	217	20	of	of	ADP
brj-24894	217	21	its	its	PRON
brj-24894	217	22	initial	initial	ADJ
brj-24894	217	23	activity	activity	NOUN
brj-24894	217	24	after	after	ADP
brj-24894	217	25	1	1	NUM
brj-24894	217	26	h	h	NOUN
brj-24894	217	27	incubation	incubation	NOUN
brj-24894	217	28	at	at	ADP
brj-24894	217	29	room	room	NOUN
brj-24894	217	30	temperature	temperature	NOUN
brj-24894	217	31	(	(	PUNCT
brj-24894	217	32	fig	fig	NOUN
brj-24894	217	33	.	.	PUNCT
brj-24894	217	34	4d	4d	NUM
brj-24894	217	35	)	)	PUNCT
brj-24894	217	36	.	.	PUNCT
brj-24894	218	1	the	the	DET
brj-24894	218	2	ph	ph	ADJ
brj-24894	218	3	stability	stability	NOUN
brj-24894	218	4	of	of	ADP
brj-24894	218	5	tpcel12a	tpcel12a	NOUN
brj-24894	218	6	is	be	AUX
brj-24894	218	7	comparable	comparable	ADJ
brj-24894	218	8	to	to	ADP
brj-24894	218	9	that	that	PRON
brj-24894	218	10	of	of	ADP
brj-24894	218	11	xgh12b	xgh12b	PROPN
brj-24894	218	12	(	(	PUNCT
brj-24894	218	13	rykov	rykov	PROPN
brj-24894	218	14	et	et	PROPN
brj-24894	218	15	al	al	PROPN
brj-24894	218	16	.	.	PROPN
brj-24894	218	17	2019	2019	NUM
brj-24894	218	18	)	)	PUNCT
brj-24894	218	19	,	,	PUNCT
brj-24894	218	20	but	but	CCONJ
brj-24894	218	21	superior	superior	ADJ
brj-24894	218	22	to	to	ADP
brj-24894	218	23	that	that	PRON
brj-24894	218	24	of	of	ADP
brj-24894	218	25	tacel12	tacel12	NOUN
brj-24894	218	26	from	from	ADP
brj-24894	218	27	trichoderma	trichoderma	PROPN
brj-24894	218	28	asperellum	asperellum	NOUN
brj-24894	218	29	nd-1	nd-1	X
brj-24894	218	30	(	(	PUNCT
brj-24894	218	31	zheng	zheng	PROPN
brj-24894	218	32	et	et	PROPN
brj-24894	218	33	al	al	PROPN
brj-24894	218	34	.	.	PROPN
brj-24894	218	35	2024	2024	NUM
brj-24894	218	36	)	)	PUNCT
brj-24894	218	37	.	.	PUNCT
brj-24894	219	1	the	the	DET
brj-24894	219	2	wide	wide	ADJ
brj-24894	219	3	ph	ph	ADJ
brj-24894	219	4	stability	stability	NOUN
brj-24894	219	5	might	might	AUX
brj-24894	219	6	allow	allow	VERB
brj-24894	219	7	tpcel12a	tpcel12a	PRON
brj-24894	219	8	adapt	adapt	NOUN
brj-24894	219	9	to	to	ADP
brj-24894	219	10	the	the	DET
brj-24894	219	11	ph	ph	ADJ
brj-24894	219	12	ranges	range	NOUN
brj-24894	219	13	of	of	ADP
brj-24894	219	14	various	various	ADJ
brj-24894	219	15	industrial	industrial	ADJ
brj-24894	219	16	systems	system	NOUN
brj-24894	219	17	reducing	reduce	VERB
brj-24894	219	18	the	the	DET
brj-24894	219	19	loss	loss	NOUN
brj-24894	219	20	of	of	ADP
brj-24894	219	21	enzyme	enzyme	NOUN
brj-24894	219	22	activity	activity	NOUN
brj-24894	219	23	caused	cause	VERB
brj-24894	219	24	by	by	ADP
brj-24894	219	25	ph	ph	ADJ
brj-24894	219	26	fluctuations	fluctuation	NOUN
brj-24894	219	27	.	.	PUNCT
brj-24894	220	1	thermal	thermal	ADJ
brj-24894	220	2	stability	stability	NOUN
brj-24894	220	3	assays	assay	NOUN
brj-24894	220	4	showed	show	VERB
brj-24894	220	5	complete	complete	ADJ
brj-24894	220	6	retention	retention	NOUN
brj-24894	220	7	of	of	ADP
brj-24894	220	8	activity	activity	NOUN
brj-24894	220	9	peer	peer	NOUN
brj-24894	220	10	-	-	PUNCT
brj-24894	220	11	reviewed	review	VERB
brj-24894	220	12	article	article	NOUN
brj-24894	220	13	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	220	14	li	li	PROPN
brj-24894	220	15	et	et	PROPN
brj-24894	220	16	al	al	PROPN
brj-24894	220	17	.	.	PROPN
brj-24894	221	1	(	(	PUNCT
brj-24894	221	2	2026	2026	NUM
brj-24894	221	3	)	)	PUNCT
brj-24894	221	4	.	.	PUNCT
brj-24894	222	1	“	"	PUNCT
brj-24894	222	2	endoglucanase	endoglucanase	VERB
brj-24894	222	3	tpcel12a	tpcel12a	NOUN
brj-24894	222	4	traits	trait	NOUN
brj-24894	222	5	,	,	PUNCT
brj-24894	222	6	”	"	PUNCT
brj-24894	222	7	bioresources	bioresource	NOUN
brj-24894	222	8	21(1	21(1	NUM
brj-24894	222	9	)	)	PUNCT
brj-24894	222	10	,	,	PUNCT
brj-24894	222	11	547	547	NUM
brj-24894	222	12	-	-	SYM
brj-24894	222	13	569	569	NUM
brj-24894	222	14	.	.	PUNCT
brj-24894	222	15	557	557	NUM
brj-24894	222	16	following	follow	VERB
brj-24894	222	17	1.0	1.0	NUM
brj-24894	222	18	h	h	NOUN
brj-24894	222	19	treatments	treatment	NOUN
brj-24894	222	20	at	at	ADP
brj-24894	222	21	30	30	NUM
brj-24894	222	22	°	°	NOUN
brj-24894	222	23	c	c	NOUN
brj-24894	222	24	and	and	CCONJ
brj-24894	222	25	40	40	NUM
brj-24894	222	26	°	°	NOUN
brj-24894	222	27	c	c	VERB
brj-24894	222	28	.	.	PUNCT
brj-24894	223	1	however	however	ADV
brj-24894	223	2	,	,	PUNCT
brj-24894	223	3	the	the	DET
brj-24894	223	4	enzyme	enzyme	NOUN
brj-24894	223	5	was	be	AUX
brj-24894	223	6	completely	completely	ADV
brj-24894	223	7	inactivated	inactivated	ADJ
brj-24894	223	8	at	at	ADP
brj-24894	223	9	temperatures	temperature	NOUN
brj-24894	223	10	≥50	≥50	NUM
brj-24894	223	11	℃	℃	PROPN
brj-24894	223	12	(	(	PUNCT
brj-24894	223	13	fig	fig	NOUN
brj-24894	223	14	.	.	PUNCT
brj-24894	224	1	4c	4c	NOUN
brj-24894	224	2	)	)	PUNCT
brj-24894	224	3	,	,	PUNCT
brj-24894	224	4	revealing	reveal	VERB
brj-24894	224	5	the	the	DET
brj-24894	224	6	limited	limited	ADJ
brj-24894	224	7	thermostability	thermostability	NOUN
brj-24894	224	8	of	of	ADP
brj-24894	224	9	recombinant	recombinant	ADJ
brj-24894	224	10	tpcel12a	tpcel12a	NOUN
brj-24894	224	11	.	.	PUNCT
brj-24894	225	1	the	the	DET
brj-24894	225	2	absence	absence	NOUN
brj-24894	225	3	of	of	ADP
brj-24894	225	4	glycosylation	glycosylation	NOUN
brj-24894	225	5	modification	modification	NOUN
brj-24894	225	6	in	in	ADP
brj-24894	225	7	tpcel12a	tpcel12a	NOUN
brj-24894	225	8	may	may	AUX
brj-24894	225	9	affect	affect	VERB
brj-24894	225	10	its	its	PRON
brj-24894	225	11	thermal	thermal	ADJ
brj-24894	225	12	stability	stability	NOUN
brj-24894	225	13	(	(	PUNCT
brj-24894	225	14	anbarasan	anbarasan	NOUN
brj-24894	225	15	et	et	PROPN
brj-24894	225	16	al	al	PROPN
brj-24894	225	17	.	.	PROPN
brj-24894	225	18	2010	2010	NUM
brj-24894	225	19	)	)	PUNCT
brj-24894	225	20	.	.	PUNCT
brj-24894	226	1	therefore	therefore	ADV
brj-24894	226	2	,	,	PUNCT
brj-24894	226	3	introducing	introduce	VERB
brj-24894	226	4	new	new	ADJ
brj-24894	226	5	glycosylation	glycosylation	NOUN
brj-24894	226	6	sites	site	NOUN
brj-24894	226	7	or	or	CCONJ
brj-24894	226	8	exposing	expose	VERB
brj-24894	226	9	potential	potential	ADJ
brj-24894	226	10	ones	one	NOUN
brj-24894	226	11	would	would	AUX
brj-24894	226	12	improve	improve	VERB
brj-24894	226	13	the	the	DET
brj-24894	226	14	thermal	thermal	ADJ
brj-24894	226	15	stability	stability	NOUN
brj-24894	226	16	.	.	PUNCT
brj-24894	227	1	fig	fig	NOUN
brj-24894	227	2	.	.	PUNCT
brj-24894	228	1	4	4	X
brj-24894	228	2	.	.	X
brj-24894	228	3	the	the	DET
brj-24894	228	4	optimal	optimal	ADJ
brj-24894	228	5	conditions	condition	NOUN
brj-24894	228	6	of	of	ADP
brj-24894	228	7	recombinant	recombinant	ADJ
brj-24894	228	8	tpcel12a	tpcel12a	NOUN
brj-24894	228	9	and	and	CCONJ
brj-24894	228	10	its	its	PRON
brj-24894	228	11	mutant	mutant	ADJ
brj-24894	228	12	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	228	13	)	)	PUNCT
brj-24894	228	14	.	.	PUNCT
brj-24894	229	1	a	a	DET
brj-24894	229	2	)	)	PUNCT
brj-24894	229	3	optimal	optimal	ADJ
brj-24894	229	4	temperature	temperature	NOUN
brj-24894	229	5	of	of	ADP
brj-24894	229	6	tpcel12a	tpcel12a	NOUN
brj-24894	229	7	and	and	CCONJ
brj-24894	229	8	its	its	PRON
brj-24894	229	9	mutant	mutant	ADJ
brj-24894	229	10	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	229	11	)	)	PUNCT
brj-24894	229	12	.	.	PUNCT
brj-24894	230	1	solid	solid	ADJ
brj-24894	230	2	squares	square	NOUN
brj-24894	230	3	(	(	PUNCT
brj-24894	230	4	■	■	NOUN
brj-24894	230	5	)	)	PUNCT
brj-24894	230	6	and	and	CCONJ
brj-24894	230	7	circles	circle	NOUN
brj-24894	230	8	(	(	PUNCT
brj-24894	230	9	●	●	NOUN
brj-24894	230	10	)	)	PUNCT
brj-24894	230	11	represent	represent	VERB
brj-24894	230	12	tpcel12a	tpcel12a	NOUN
brj-24894	230	13	and	and	CCONJ
brj-24894	230	14	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	230	15	)	)	PUNCT
brj-24894	230	16	,	,	PUNCT
brj-24894	230	17	respectively	respectively	ADV
brj-24894	230	18	.	.	PUNCT
brj-24894	231	1	b	b	X
brj-24894	231	2	)	)	PUNCT
brj-24894	231	3	optimal	optimal	ADJ
brj-24894	231	4	ph	ph	NOUN
brj-24894	231	5	of	of	ADP
brj-24894	231	6	tpcel12a	tpcel12a	NOUN
brj-24894	231	7	and	and	CCONJ
brj-24894	231	8	its	its	PRON
brj-24894	231	9	mutant	mutant	ADJ
brj-24894	231	10	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	231	11	)	)	PUNCT
brj-24894	231	12	.	.	PUNCT
brj-24894	232	1	glycine	glycine	NOUN
brj-24894	232	2	(	(	PUNCT
brj-24894	232	3	■	■	NOUN
brj-24894	232	4	)	)	PUNCT
brj-24894	232	5	,	,	PUNCT
brj-24894	232	6	citrate	citrate	NOUN
brj-24894	232	7	(	(	PUNCT
brj-24894	232	8	●	●	NOUN
brj-24894	232	9	)	)	PUNCT
brj-24894	232	10	,	,	PUNCT
brj-24894	232	11	acetate	acetate	NOUN
brj-24894	232	12	(	(	PUNCT
brj-24894	232	13	▲	▲	NOUN
brj-24894	232	14	)	)	PUNCT
brj-24894	232	15	,	,	PUNCT
brj-24894	232	16	and	and	CCONJ
brj-24894	232	17	phosphate	phosphate	VERB
brj-24894	232	18	(	(	PUNCT
brj-24894	232	19	▼	▼	NOUN
brj-24894	232	20	)	)	PUNCT
brj-24894	232	21	buffers	buffer	NOUN
brj-24894	232	22	are	be	AUX
brj-24894	232	23	indicated	indicate	VERB
brj-24894	232	24	by	by	ADP
brj-24894	232	25	different	different	ADJ
brj-24894	232	26	symbols	symbol	NOUN
brj-24894	232	27	.	.	PUNCT
brj-24894	233	1	the	the	DET
brj-24894	233	2	black	black	ADJ
brj-24894	233	3	solid	solid	ADJ
brj-24894	233	4	line	line	NOUN
brj-24894	233	5	represents	represent	VERB
brj-24894	233	6	tpcel12a	tpcel12a	NOUN
brj-24894	233	7	,	,	PUNCT
brj-24894	233	8	while	while	SCONJ
brj-24894	233	9	the	the	DET
brj-24894	233	10	green	green	NOUN
brj-24894	233	11	dashed	dash	VERB
brj-24894	233	12	line	line	NOUN
brj-24894	233	13	denotes	denote	NOUN
brj-24894	233	14	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	233	15	)	)	PUNCT
brj-24894	233	16	.	.	PUNCT
brj-24894	234	1	relative	relative	ADJ
brj-24894	234	2	activities	activity	NOUN
brj-24894	234	3	are	be	AUX
brj-24894	234	4	expressed	express	VERB
brj-24894	234	5	as	as	ADP
brj-24894	234	6	percentages	percentage	NOUN
brj-24894	234	7	of	of	ADP
brj-24894	234	8	the	the	DET
brj-24894	234	9	maximum	maximum	ADJ
brj-24894	234	10	activity	activity	NOUN
brj-24894	234	11	(	(	PUNCT
brj-24894	234	12	set	set	VERB
brj-24894	234	13	as	as	ADP
brj-24894	234	14	100	100	NUM
brj-24894	234	15	%	%	NOUN
brj-24894	234	16	)	)	PUNCT
brj-24894	234	17	.	.	PUNCT
brj-24894	235	1	c	c	X
brj-24894	235	2	)	)	PUNCT
brj-24894	235	3	thermostability	thermostability	NOUN
brj-24894	235	4	profile	profile	NOUN
brj-24894	235	5	of	of	ADP
brj-24894	235	6	tpcel12a	tpcel12a	NOUN
brj-24894	235	7	.	.	PUNCT
brj-24894	236	1	d	d	X
brj-24894	236	2	)	)	PUNCT
brj-24894	236	3	ph	ph	ADJ
brj-24894	236	4	stability	stability	NOUN
brj-24894	236	5	profile	profile	NOUN
brj-24894	236	6	of	of	ADP
brj-24894	236	7	tpcel12a	tpcel12a	NOUN
brj-24894	236	8	.	.	PUNCT
brj-24894	237	1	relative	relative	ADJ
brj-24894	237	2	activities	activity	NOUN
brj-24894	237	3	are	be	AUX
brj-24894	237	4	expressed	express	VERB
brj-24894	237	5	as	as	ADP
brj-24894	237	6	percentages	percentage	NOUN
brj-24894	237	7	of	of	ADP
brj-24894	237	8	the	the	DET
brj-24894	237	9	untreated	untreated	ADJ
brj-24894	237	10	control	control	NOUN
brj-24894	237	11	(	(	PUNCT
brj-24894	237	12	set	set	VERB
brj-24894	237	13	as	as	ADP
brj-24894	237	14	100	100	NUM
brj-24894	237	15	%	%	NOUN
brj-24894	237	16	)	)	PUNCT
brj-24894	237	17	.	.	PUNCT
brj-24894	238	1	data	datum	NOUN
brj-24894	238	2	represent	represent	VERB
brj-24894	238	3	mean	mean	NOUN
brj-24894	238	4	values	value	NOUN
brj-24894	238	5	±	±	NOUN
brj-24894	238	6	sd	sd	ADP
brj-24894	238	7	(	(	PUNCT
brj-24894	238	8	n	n	NOUN
brj-24894	238	9	=	=	SYM
brj-24894	238	10	3	3	NUM
brj-24894	238	11	)	)	PUNCT
brj-24894	238	12	.	.	PUNCT
brj-24894	239	1	to	to	PART
brj-24894	239	2	investigate	investigate	VERB
brj-24894	239	3	the	the	DET
brj-24894	239	4	effects	effect	NOUN
brj-24894	239	5	of	of	ADP
brj-24894	239	6	metal	metal	NOUN
brj-24894	239	7	ions	ion	NOUN
brj-24894	239	8	and	and	CCONJ
brj-24894	239	9	chemical	chemical	NOUN
brj-24894	239	10	reagents	reagent	NOUN
brj-24894	239	11	on	on	ADP
brj-24894	239	12	tpcel12a	tpcel12a	NOUN
brj-24894	239	13	activity	activity	NOUN
brj-24894	239	14	,	,	PUNCT
brj-24894	239	15	reactions	reaction	NOUN
brj-24894	239	16	were	be	AUX
brj-24894	239	17	supplemented	supplement	VERB
brj-24894	239	18	with	with	ADP
brj-24894	239	19	either	either	CCONJ
brj-24894	239	20	5	5	NUM
brj-24894	239	21	mm	mm	NOUN
brj-24894	239	22	metal	metal	NOUN
brj-24894	239	23	ions	ion	NOUN
brj-24894	239	24	or	or	CCONJ
brj-24894	239	25	10	10	NUM
brj-24894	239	26	%	%	NOUN
brj-24894	239	27	(	(	PUNCT
brj-24894	239	28	v	v	NOUN
brj-24894	239	29	/	/	SYM
brj-24894	239	30	v	v	NOUN
brj-24894	239	31	)	)	PUNCT
brj-24894	239	32	chemical	chemical	NOUN
brj-24894	239	33	reagents	reagent	NOUN
brj-24894	239	34	.	.	PUNCT
brj-24894	240	1	as	as	SCONJ
brj-24894	240	2	shown	show	VERB
brj-24894	240	3	in	in	ADP
brj-24894	240	4	fig	fig	NOUN
brj-24894	240	5	.	.	PUNCT
brj-24894	241	1	5a	5a	NUM
brj-24894	241	2	,	,	PUNCT
brj-24894	241	3	most	most	ADV
brj-24894	241	4	tested	test	VERB
brj-24894	241	5	metal	metal	NOUN
brj-24894	241	6	ions	ion	NOUN
brj-24894	241	7	showed	show	VERB
brj-24894	241	8	little	little	ADJ
brj-24894	241	9	or	or	CCONJ
brj-24894	241	10	no	no	PRON
brj-24894	241	11	effect	effect	NOUN
brj-24894	241	12	on	on	ADP
brj-24894	241	13	enzymatic	enzymatic	ADJ
brj-24894	241	14	activity	activity	NOUN
brj-24894	241	15	,	,	PUNCT
brj-24894	241	16	with	with	ADP
brj-24894	241	17	the	the	DET
brj-24894	241	18	exception	exception	NOUN
brj-24894	241	19	of	of	ADP
brj-24894	241	20	mn²⁺	mn²⁺	NOUN
brj-24894	241	21	,	,	PUNCT
brj-24894	241	22	which	which	PRON
brj-24894	241	23	reduced	reduce	VERB
brj-24894	241	24	activity	activity	NOUN
brj-24894	241	25	to	to	ADP
brj-24894	241	26	below	below	ADP
brj-24894	241	27	60	60	NUM
brj-24894	241	28	%	%	NOUN
brj-24894	241	29	of	of	ADP
brj-24894	241	30	the	the	DET
brj-24894	241	31	control	control	NOUN
brj-24894	241	32	.	.	PUNCT
brj-24894	242	1	in	in	ADP
brj-24894	242	2	contrast	contrast	NOUN
brj-24894	242	3	,	,	PUNCT
brj-24894	242	4	chemical	chemical	NOUN
brj-24894	242	5	reagents	reagent	NOUN
brj-24894	242	6	exhibited	exhibit	VERB
brj-24894	242	7	more	more	ADV
brj-24894	242	8	pronounced	pronounced	ADJ
brj-24894	242	9	inhibitory	inhibitory	ADJ
brj-24894	242	10	effects	effect	NOUN
brj-24894	242	11	(	(	PUNCT
brj-24894	242	12	fig	fig	NOUN
brj-24894	242	13	.	.	PUNCT
brj-24894	243	1	5b	5b	NUM
brj-24894	243	2	)	)	PUNCT
brj-24894	243	3	.	.	PUNCT
brj-24894	244	1	sds	sds	PROPN
brj-24894	244	2	and	and	CCONJ
brj-24894	244	3	edta	edta	PROPN
brj-24894	244	4	almost	almost	ADV
brj-24894	244	5	completely	completely	ADV
brj-24894	244	6	abolished	abolish	VERB
brj-24894	244	7	tpcel12a	tpcel12a	NOUN
brj-24894	244	8	activity	activity	NOUN
brj-24894	244	9	,	,	PUNCT
brj-24894	244	10	while	while	SCONJ
brj-24894	244	11	glycerol	glycerol	NOUN
brj-24894	244	12	and	and	CCONJ
brj-24894	244	13	triton	triton	PROPN
brj-24894	244	14	x-100	x-100	PROPN
brj-24894	244	15	preserved	preserve	VERB
brj-24894	244	16	approximately	approximately	ADV
brj-24894	244	17	80	80	NUM
brj-24894	244	18	%	%	NOUN
brj-24894	244	19	of	of	ADP
brj-24894	244	20	the	the	DET
brj-24894	244	21	original	original	ADJ
brj-24894	244	22	activity	activity	NOUN
brj-24894	244	23	.	.	PUNCT
brj-24894	245	1	peer	peer	NOUN
brj-24894	245	2	-	-	PUNCT
brj-24894	245	3	reviewed	review	VERB
brj-24894	245	4	article	article	NOUN
brj-24894	245	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	245	6	li	li	PROPN
brj-24894	245	7	et	et	PROPN
brj-24894	245	8	al	al	PROPN
brj-24894	245	9	.	.	PROPN
brj-24894	246	1	(	(	PUNCT
brj-24894	246	2	2026	2026	NUM
brj-24894	246	3	)	)	PUNCT
brj-24894	246	4	.	.	PUNCT
brj-24894	247	1	“	"	PUNCT
brj-24894	247	2	endoglucanase	endoglucanase	VERB
brj-24894	247	3	tpcel12a	tpcel12a	NOUN
brj-24894	247	4	traits	trait	NOUN
brj-24894	247	5	,	,	PUNCT
brj-24894	247	6	”	"	PUNCT
brj-24894	247	7	bioresources	bioresource	NOUN
brj-24894	247	8	21(1	21(1	NUM
brj-24894	247	9	)	)	PUNCT
brj-24894	247	10	,	,	PUNCT
brj-24894	247	11	547	547	NUM
brj-24894	247	12	-	-	SYM
brj-24894	247	13	569	569	NUM
brj-24894	247	14	.	.	PUNCT
brj-24894	247	15	558	558	NUM
brj-24894	247	16	fig	fig	NOUN
brj-24894	247	17	.	.	PUNCT
brj-24894	248	1	5	5	X
brj-24894	248	2	.	.	X
brj-24894	248	3	effects	effect	NOUN
brj-24894	248	4	of	of	ADP
brj-24894	248	5	metal	metal	NOUN
brj-24894	248	6	ions	ion	NOUN
brj-24894	248	7	and	and	CCONJ
brj-24894	248	8	chemical	chemical	NOUN
brj-24894	248	9	reagents	reagent	NOUN
brj-24894	248	10	on	on	ADP
brj-24894	248	11	the	the	DET
brj-24894	248	12	activity	activity	NOUN
brj-24894	248	13	of	of	ADP
brj-24894	248	14	tpcel12a	tpcel12a	NOUN
brj-24894	248	15	.	.	PUNCT
brj-24894	249	1	a	a	DET
brj-24894	249	2	)	)	PUNCT
brj-24894	249	3	influence	influence	NOUN
brj-24894	249	4	of	of	ADP
brj-24894	249	5	metal	metal	NOUN
brj-24894	249	6	ions	ion	NOUN
brj-24894	249	7	on	on	ADP
brj-24894	249	8	enzymatic	enzymatic	ADJ
brj-24894	249	9	activity	activity	NOUN
brj-24894	249	10	.	.	PUNCT
brj-24894	250	1	b	b	X
brj-24894	250	2	)	)	PUNCT
brj-24894	250	3	influence	influence	NOUN
brj-24894	250	4	of	of	ADP
brj-24894	250	5	chemical	chemical	ADJ
brj-24894	250	6	reagents	reagent	NOUN
brj-24894	250	7	on	on	ADP
brj-24894	250	8	enzymatic	enzymatic	ADJ
brj-24894	250	9	activity	activity	NOUN
brj-24894	250	10	.	.	PUNCT
brj-24894	251	1	relative	relative	ADJ
brj-24894	251	2	activities	activity	NOUN
brj-24894	251	3	are	be	AUX
brj-24894	251	4	expressed	express	VERB
brj-24894	251	5	as	as	ADP
brj-24894	251	6	percentages	percentage	NOUN
brj-24894	251	7	of	of	ADP
brj-24894	251	8	the	the	DET
brj-24894	251	9	untreated	untreated	ADJ
brj-24894	251	10	control	control	NOUN
brj-24894	251	11	(	(	PUNCT
brj-24894	251	12	set	set	VERB
brj-24894	251	13	as	as	ADP
brj-24894	251	14	100	100	NUM
brj-24894	251	15	%	%	NOUN
brj-24894	251	16	)	)	PUNCT
brj-24894	251	17	.	.	PUNCT
brj-24894	252	1	data	datum	NOUN
brj-24894	252	2	represent	represent	VERB
brj-24894	252	3	mean	mean	NOUN
brj-24894	252	4	values	value	NOUN
brj-24894	252	5	±	±	NOUN
brj-24894	252	6	sd	sd	ADP
brj-24894	252	7	(	(	PUNCT
brj-24894	252	8	n	n	NOUN
brj-24894	252	9	=	=	SYM
brj-24894	252	10	3	3	NUM
brj-24894	252	11	)	)	PUNCT
brj-24894	252	12	.	.	PUNCT
brj-24894	253	1	moderate	moderate	ADJ
brj-24894	253	2	inhibition	inhibition	NOUN
brj-24894	253	3	was	be	AUX
brj-24894	253	4	observed	observe	VERB
brj-24894	253	5	with	with	ADP
brj-24894	253	6	dmso	dmso	NOUN
brj-24894	253	7	,	,	PUNCT
brj-24894	253	8	isopropanol	isopropanol	NOUN
brj-24894	253	9	or	or	CCONJ
brj-24894	253	10	methanol	methanol	NOUN
brj-24894	253	11	,	,	PUNCT
brj-24894	253	12	each	each	PRON
brj-24894	253	13	maintaining	maintain	VERB
brj-24894	253	14	about	about	ADP
brj-24894	253	15	50	50	NUM
brj-24894	253	16	%	%	NOUN
brj-24894	253	17	residual	residual	ADJ
brj-24894	253	18	activity	activity	NOUN
brj-24894	253	19	.	.	PUNCT
brj-24894	254	1	the	the	DET
brj-24894	254	2	kinetic	kinetic	ADJ
brj-24894	254	3	parameters	parameter	NOUN
brj-24894	254	4	of	of	ADP
brj-24894	254	5	tpcel12a	tpcel12a	NOUN
brj-24894	254	6	acting	act	VERB
brj-24894	254	7	on	on	ADP
brj-24894	254	8	xyloglucan	xyloglucan	PROPN
brj-24894	254	9	were	be	AUX
brj-24894	254	10	measured	measure	VERB
brj-24894	254	11	at	at	ADP
brj-24894	254	12	the	the	DET
brj-24894	254	13	optimal	optimal	ADJ
brj-24894	254	14	condition	condition	NOUN
brj-24894	254	15	and	and	CCONJ
brj-24894	254	16	determined	determine	VERB
brj-24894	254	17	using	use	VERB
brj-24894	254	18	lineweaverburk	lineweaverburk	ADJ
brj-24894	254	19	plots	plot	NOUN
brj-24894	254	20	.	.	PUNCT
brj-24894	255	1	the	the	DET
brj-24894	255	2	enzyme	enzyme	NOUN
brj-24894	255	3	exhibited	exhibit	VERB
brj-24894	255	4	a	a	DET
brj-24894	255	5	km	km	NOUN
brj-24894	255	6	of	of	ADP
brj-24894	255	7	27.13±1.54	27.13±1.54	NUM
brj-24894	255	8	mg	mg	PROPN
brj-24894	255	9	/	/	SYM
brj-24894	255	10	ml	ml	PROPN
brj-24894	255	11	and	and	CCONJ
brj-24894	255	12	a	a	DET
brj-24894	255	13	vmax	vmax	NOUN
brj-24894	255	14	of	of	ADP
brj-24894	255	15	559.02±5.32	559.02±5.32	NUM
brj-24894	255	16	μmol/(mg·min	μmol/(mg·min	NUM
brj-24894	255	17	)	)	PUNCT
brj-24894	255	18	.	.	PUNCT
brj-24894	256	1	the	the	DET
brj-24894	256	2	km	km	NOUN
brj-24894	256	3	value	value	NOUN
brj-24894	256	4	was	be	AUX
brj-24894	256	5	much	much	ADV
brj-24894	256	6	higher	high	ADJ
brj-24894	256	7	than	than	ADP
brj-24894	256	8	those	those	PRON
brj-24894	256	9	of	of	ADP
brj-24894	256	10	previously	previously	ADV
brj-24894	256	11	reported	report	VERB
brj-24894	256	12	gh12	gh12	PROPN
brj-24894	256	13	endoglucanase	endoglucanase	VERB
brj-24894	256	14	,	,	PUNCT
brj-24894	256	15	such	such	ADJ
brj-24894	256	16	as	as	ADP
brj-24894	256	17	2.81±0.17	2.81±0.17	NUM
brj-24894	256	18	mg	mg	PROPN
brj-24894	256	19	/	/	SYM
brj-24894	256	20	ml	ml	X
brj-24894	256	21	of	of	ADP
brj-24894	256	22	xgh12b	xgh12b	NOUN
brj-24894	256	23	(	(	PUNCT
brj-24894	256	24	rykov	rykov	PROPN
brj-24894	256	25	et	et	PROPN
brj-24894	256	26	al	al	PROPN
brj-24894	256	27	.	.	PROPN
brj-24894	256	28	2019	2019	NUM
brj-24894	256	29	)	)	PUNCT
brj-24894	257	1	and	and	CCONJ
brj-24894	257	2	0.174±0.008	0.174±0.008	NOUN
brj-24894	257	3	mg	mg	PROPN
brj-24894	257	4	/	/	SYM
brj-24894	257	5	ml	ml	PROPN
brj-24894	257	6	of	of	ADP
brj-24894	257	7	xeg12a	xeg12a	PROPN
brj-24894	257	8	(	(	PUNCT
brj-24894	257	9	matsuzawa	matsuzawa	PROPN
brj-24894	257	10	et	et	PROPN
brj-24894	257	11	al	al	PROPN
brj-24894	257	12	.	.	PROPN
brj-24894	257	13	2020	2020	NUM
brj-24894	257	14	)	)	PUNCT
brj-24894	258	1	,	,	PUNCT
brj-24894	258	2	suggesting	suggest	VERB
brj-24894	258	3	a	a	DET
brj-24894	258	4	weaker	weak	ADJ
brj-24894	258	5	substrate	substrate	NOUN
brj-24894	258	6	affinity	affinity	NOUN
brj-24894	258	7	.	.	PUNCT
brj-24894	259	1	however	however	ADV
brj-24894	259	2	,	,	PUNCT
brj-24894	259	3	the	the	DET
brj-24894	259	4	vmax	vmax	PROPN
brj-24894	259	5	of	of	ADP
brj-24894	259	6	tpcel12a	tpcel12a	NOUN
brj-24894	259	7	was	be	AUX
brj-24894	259	8	much	much	ADV
brj-24894	259	9	higher	high	ADJ
brj-24894	259	10	that	that	SCONJ
brj-24894	259	11	of	of	ADP
brj-24894	259	12	xeg12a	xeg12a	PROPN
brj-24894	259	13	(	(	PUNCT
brj-24894	259	14	270±3	270±3	NUM
brj-24894	259	15	μmol/(mg·min	μmol/(mg·min	NUM
brj-24894	259	16	)	)	PUNCT
brj-24894	259	17	)	)	PUNCT
brj-24894	260	1	(	(	PUNCT
brj-24894	260	2	matsuzawa	matsuzawa	PROPN
brj-24894	260	3	et	et	PROPN
brj-24894	260	4	al	al	PROPN
brj-24894	260	5	.	.	PROPN
brj-24894	260	6	2020	2020	NUM
brj-24894	260	7	)	)	PUNCT
brj-24894	260	8	.	.	PUNCT
brj-24894	261	1	the	the	DET
brj-24894	261	2	combination	combination	NOUN
brj-24894	261	3	of	of	ADP
brj-24894	261	4	high	high	ADJ
brj-24894	261	5	km	km	NOUN
brj-24894	261	6	and	and	CCONJ
brj-24894	261	7	vmax	vmax	PROPN
brj-24894	261	8	indicated	indicate	VERB
brj-24894	261	9	tpcel12a	tpcel12a	NOUN
brj-24894	261	10	as	as	ADP
brj-24894	261	11	a	a	DET
brj-24894	261	12	potential	potential	ADJ
brj-24894	261	13	candidate	candidate	NOUN
brj-24894	261	14	for	for	ADP
brj-24894	261	15	xyloglucan	xyloglucan	ADJ
brj-24894	261	16	degradation	degradation	NOUN
brj-24894	261	17	in	in	ADP
brj-24894	261	18	biomass	biomass	NOUN
brj-24894	261	19	refining	refining	NOUN
brj-24894	261	20	processes	process	NOUN
brj-24894	261	21	.	.	PUNCT
brj-24894	262	1	enzymatic	enzymatic	ADJ
brj-24894	262	2	hydrolysis	hydrolysis	NOUN
brj-24894	262	3	patterns	pattern	NOUN
brj-24894	262	4	of	of	ADP
brj-24894	262	5	tpcel12a	tpcel12a	NOUN
brj-24894	262	6	on	on	ADP
brj-24894	262	7	xyloglucan	xyloglucan	NOUN
brj-24894	262	8	and	and	CCONJ
brj-24894	262	9	cmc	cmc	PROPN
brj-24894	262	10	to	to	PART
brj-24894	262	11	analyze	analyze	VERB
brj-24894	262	12	the	the	DET
brj-24894	262	13	hydrolysis	hydrolysis	NOUN
brj-24894	262	14	pattern	pattern	NOUN
brj-24894	262	15	of	of	ADP
brj-24894	262	16	tpcel12a	tpcel12a	NOUN
brj-24894	262	17	on	on	ADP
brj-24894	262	18	xyloglucan	xyloglucan	ADJ
brj-24894	262	19	degradation	degradation	NOUN
brj-24894	262	20	,	,	PUNCT
brj-24894	262	21	maldi	maldi	NOUN
brj-24894	262	22	-	-	PUNCT
brj-24894	262	23	tof	tof	PROPN
brj-24894	262	24	ms	ms	PROPN
brj-24894	262	25	was	be	AUX
brj-24894	262	26	used	use	VERB
brj-24894	262	27	to	to	PART
brj-24894	262	28	examine	examine	VERB
brj-24894	262	29	the	the	DET
brj-24894	262	30	final	final	ADJ
brj-24894	262	31	hydrolysis	hydrolysis	NOUN
brj-24894	262	32	products	product	NOUN
brj-24894	262	33	of	of	ADP
brj-24894	262	34	xyloglucan	xyloglucan	PROPN
brj-24894	262	35	treated	treat	VERB
brj-24894	262	36	with	with	ADP
brj-24894	262	37	tpcel12a	tpcel12a	NOUN
brj-24894	262	38	.	.	PUNCT
brj-24894	263	1	the	the	DET
brj-24894	263	2	results	result	NOUN
brj-24894	263	3	demonstrated	demonstrate	VERB
brj-24894	263	4	that	that	SCONJ
brj-24894	263	5	after	after	ADP
brj-24894	263	6	6	6	NUM
brj-24894	263	7	h	h	NOUN
brj-24894	263	8	of	of	ADP
brj-24894	263	9	enzymatic	enzymatic	ADJ
brj-24894	263	10	hydrolysis	hydrolysis	NOUN
brj-24894	263	11	,	,	PUNCT
brj-24894	263	12	as	as	SCONJ
brj-24894	263	13	monitored	monitor	VERB
brj-24894	263	14	by	by	ADP
brj-24894	263	15	reducing	reduce	VERB
brj-24894	263	16	sugar	sugar	NOUN
brj-24894	263	17	quantification	quantification	NOUN
brj-24894	263	18	to	to	PART
brj-24894	263	19	confirm	confirm	VERB
brj-24894	263	20	reaction	reaction	NOUN
brj-24894	263	21	completion	completion	NOUN
brj-24894	263	22	,	,	PUNCT
brj-24894	263	23	four	four	NUM
brj-24894	263	24	oligosaccharides	oligosaccharide	NOUN
brj-24894	263	25	including	include	VERB
brj-24894	263	26	xxxg	xxxg	PROPN
brj-24894	263	27	,	,	PUNCT
brj-24894	263	28	xlxg	xlxg	PROPN
brj-24894	263	29	,	,	PUNCT
brj-24894	263	30	xxlg	xxlg	PROPN
brj-24894	263	31	,	,	PUNCT
brj-24894	263	32	and	and	CCONJ
brj-24894	263	33	xllg	xllg	NOUN
brj-24894	263	34	were	be	AUX
brj-24894	263	35	generated	generate	VERB
brj-24894	263	36	(	(	PUNCT
brj-24894	263	37	figs	fig	NOUN
brj-24894	263	38	.	.	PUNCT
brj-24894	264	1	6a	6a	NOUN
brj-24894	264	2	and	and	CCONJ
brj-24894	264	3	6b	6b	NUM
brj-24894	264	4	)	)	PUNCT
brj-24894	264	5	.	.	PUNCT
brj-24894	265	1	this	this	DET
brj-24894	265	2	cleavage	cleavage	NOUN
brj-24894	265	3	pattern	pattern	NOUN
brj-24894	265	4	aligns	align	VERB
brj-24894	265	5	with	with	ADP
brj-24894	265	6	the	the	DET
brj-24894	265	7	previously	previously	ADV
brj-24894	265	8	reported	report	VERB
brj-24894	265	9	mode	mode	NOUN
brj-24894	265	10	of	of	ADP
brj-24894	265	11	xyloglucan	xyloglucan	ADJ
brj-24894	265	12	degradation	degradation	NOUN
brj-24894	265	13	by	by	ADP
brj-24894	265	14	gh12	gh12	PROPN
brj-24894	265	15	family	family	NOUN
brj-24894	265	16	members	member	NOUN
brj-24894	265	17	,	,	PUNCT
brj-24894	265	18	but	but	CCONJ
brj-24894	265	19	differs	differ	VERB
brj-24894	265	20	from	from	ADP
brj-24894	265	21	that	that	PRON
brj-24894	265	22	of	of	ADP
brj-24894	265	23	gh5	gh5	PROPN
brj-24894	265	24	family	family	NOUN
brj-24894	265	25	enzymes	enzyme	NOUN
brj-24894	265	26	,	,	PUNCT
brj-24894	265	27	which	which	PRON
brj-24894	265	28	typically	typically	ADV
brj-24894	265	29	produce	produce	VERB
brj-24894	265	30	shorter	short	ADJ
brj-24894	265	31	oligosaccharide	oligosaccharide	NOUN
brj-24894	265	32	units	unit	NOUN
brj-24894	265	33	(	(	PUNCT
brj-24894	265	34	matsuzawa	matsuzawa	PROPN
brj-24894	265	35	et	et	PROPN
brj-24894	265	36	al	al	PROPN
brj-24894	265	37	.	.	PROPN
brj-24894	265	38	2020	2020	NUM
brj-24894	265	39	)	)	PUNCT
brj-24894	265	40	.	.	PUNCT
brj-24894	266	1	similarly	similarly	ADV
brj-24894	266	2	,	,	PUNCT
brj-24894	266	3	the	the	DET
brj-24894	266	4	end	end	NOUN
brj-24894	266	5	products	product	NOUN
brj-24894	266	6	of	of	ADP
brj-24894	266	7	cmc	cmc	NOUN
brj-24894	266	8	hydrolysis	hydrolysis	NOUN
brj-24894	266	9	by	by	ADP
brj-24894	266	10	tpcel12a	tpcel12a	NOUN
brj-24894	266	11	were	be	AUX
brj-24894	266	12	analyzed	analyze	VERB
brj-24894	266	13	and	and	CCONJ
brj-24894	266	14	identified	identify	VERB
brj-24894	266	15	glucose	glucose	NOUN
brj-24894	266	16	,	,	PUNCT
brj-24894	266	17	cellobiose	cellobiose	NOUN
brj-24894	266	18	,	,	PUNCT
brj-24894	266	19	and	and	CCONJ
brj-24894	266	20	cellotriose	cellotriose	VERB
brj-24894	266	21	as	as	ADP
brj-24894	266	22	the	the	DET
brj-24894	266	23	major	major	ADJ
brj-24894	266	24	products	product	NOUN
brj-24894	266	25	,	,	PUNCT
brj-24894	266	26	with	with	SCONJ
brj-24894	266	27	trace	trace	NOUN
brj-24894	266	28	amounts	amount	NOUN
brj-24894	266	29	of	of	ADP
brj-24894	266	30	cellotetraose	cellotetraose	NOUN
brj-24894	266	31	and	and	CCONJ
brj-24894	266	32	cellopentaose	cellopentaose	VERB
brj-24894	266	33	also	also	ADV
brj-24894	266	34	detected	detect	VERB
brj-24894	266	35	(	(	PUNCT
brj-24894	266	36	appendix	appendix	NOUN
brj-24894	266	37	vi	vi	NOUN
brj-24894	266	38	)	)	PUNCT
brj-24894	266	39	.	.	PUNCT
brj-24894	267	1	the	the	DET
brj-24894	267	2	authors	author	NOUN
brj-24894	267	3	further	far	ADV
brj-24894	267	4	investigated	investigate	VERB
brj-24894	267	5	the	the	DET
brj-24894	267	6	hydrolytic	hydrolytic	ADJ
brj-24894	267	7	products	product	NOUN
brj-24894	267	8	of	of	ADP
brj-24894	267	9	tpcel12a	tpcel12a	NOUN
brj-24894	267	10	on	on	ADP
brj-24894	267	11	cmc	cmc	NOUN
brj-24894	267	12	using	use	VERB
brj-24894	267	13	hplc	hplc	NOUN
brj-24894	267	14	.	.	PUNCT
brj-24894	268	1	by	by	ADP
brj-24894	268	2	comparing	compare	VERB
brj-24894	268	3	retention	retention	NOUN
brj-24894	268	4	times	time	NOUN
brj-24894	268	5	with	with	ADP
brj-24894	268	6	known	know	VERB
brj-24894	268	7	standards	standard	NOUN
brj-24894	268	8	,	,	PUNCT
brj-24894	268	9	it	it	PRON
brj-24894	268	10	was	be	AUX
brj-24894	268	11	determined	determine	VERB
brj-24894	268	12	that	that	SCONJ
brj-24894	268	13	tpcel12a	tpcel12a	VERB
brj-24894	268	14	mainly	mainly	ADV
brj-24894	268	15	generates	generate	VERB
brj-24894	268	16	glucose	glucose	NOUN
brj-24894	268	17	and	and	CCONJ
brj-24894	268	18	cellobiose	cellobiose	VERB
brj-24894	268	19	as	as	ADP
brj-24894	268	20	the	the	DET
brj-24894	268	21	final	final	ADJ
brj-24894	268	22	hydrolysis	hydrolysis	NOUN
brj-24894	268	23	products	product	NOUN
brj-24894	268	24	(	(	PUNCT
brj-24894	268	25	fig	fig	NOUN
brj-24894	268	26	.	.	PUNCT
brj-24894	269	1	6c	6c	NOUN
brj-24894	269	2	)	)	PUNCT
brj-24894	269	3	,	,	PUNCT
brj-24894	269	4	which	which	PRON
brj-24894	269	5	differs	differ	VERB
brj-24894	269	6	from	from	ADP
brj-24894	269	7	the	the	DET
brj-24894	269	8	product	product	NOUN
brj-24894	269	9	profile	profile	NOUN
brj-24894	269	10	of	of	ADP
brj-24894	269	11	processive	processive	ADJ
brj-24894	269	12	endoglucanases	endoglucanase	NOUN
brj-24894	269	13	(	(	PUNCT
brj-24894	269	14	schiano	schiano	PROPN
brj-24894	269	15	-	-	PUNCT
brj-24894	269	16	di	di	NOUN
brj-24894	269	17	-	-	PUNCT
brj-24894	269	18	cola	cola	NOUN
brj-24894	269	19	et	et	PROPN
brj-24894	269	20	al	al	PROPN
brj-24894	269	21	.	.	PROPN
brj-24894	269	22	2020	2020	NUM
brj-24894	269	23	)	)	PUNCT
brj-24894	269	24	,	,	PUNCT
brj-24894	269	25	implying	imply	VERB
brj-24894	269	26	the	the	DET
brj-24894	269	27	weak	weak	ADJ
brj-24894	269	28	processivity	processivity	NOUN
brj-24894	269	29	of	of	ADP
brj-24894	269	30	tpcel12a	tpcel12a	NOUN
brj-24894	269	31	.	.	PUNCT
brj-24894	269	32	peer	peer	NOUN
brj-24894	269	33	-	-	PUNCT
brj-24894	269	34	reviewed	review	VERB
brj-24894	269	35	article	article	NOUN
brj-24894	269	36	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	269	37	li	li	PROPN
brj-24894	269	38	et	et	PROPN
brj-24894	269	39	al	al	PROPN
brj-24894	269	40	.	.	PROPN
brj-24894	270	1	(	(	PUNCT
brj-24894	270	2	2026	2026	NUM
brj-24894	270	3	)	)	PUNCT
brj-24894	270	4	.	.	PUNCT
brj-24894	271	1	“	"	PUNCT
brj-24894	271	2	endoglucanase	endoglucanase	VERB
brj-24894	271	3	tpcel12a	tpcel12a	NOUN
brj-24894	271	4	traits	trait	NOUN
brj-24894	271	5	,	,	PUNCT
brj-24894	271	6	”	"	PUNCT
brj-24894	271	7	bioresources	bioresource	NOUN
brj-24894	271	8	21(1	21(1	NUM
brj-24894	271	9	)	)	PUNCT
brj-24894	271	10	,	,	PUNCT
brj-24894	271	11	547	547	NUM
brj-24894	271	12	-	-	SYM
brj-24894	271	13	569	569	NUM
brj-24894	271	14	.	.	PUNCT
brj-24894	272	1	559	559	NUM
brj-24894	272	2	fig	fig	NOUN
brj-24894	272	3	.	.	PUNCT
brj-24894	273	1	6	6	NUM
brj-24894	273	2	.	.	PUNCT
brj-24894	274	1	the	the	DET
brj-24894	274	2	final	final	ADJ
brj-24894	274	3	hydrolysis	hydrolysis	NOUN
brj-24894	274	4	products	product	NOUN
brj-24894	274	5	of	of	ADP
brj-24894	274	6	xyloglucan	xyloglucan	NOUN
brj-24894	274	7	and	and	CCONJ
brj-24894	274	8	cmc	cmc	PROPN
brj-24894	274	9	catalyzed	catalyze	VERB
brj-24894	274	10	by	by	ADP
brj-24894	274	11	tpcel12a	tpcel12a	NOUN
brj-24894	274	12	.	.	PUNCT
brj-24894	275	1	a	a	PRON
brj-24894	275	2	)	)	PUNCT
brj-24894	275	3	malditof	malditof	VERB
brj-24894	275	4	ms	ms	ADJ
brj-24894	275	5	determination	determination	NOUN
brj-24894	275	6	of	of	ADP
brj-24894	275	7	final	final	ADJ
brj-24894	275	8	products	product	NOUN
brj-24894	275	9	of	of	ADP
brj-24894	275	10	xyloglucan	xyloglucan	NOUN
brj-24894	275	11	catalyzed	catalyze	VERB
brj-24894	275	12	by	by	ADP
brj-24894	275	13	tpcel12a	tpcel12a	NOUN
brj-24894	275	14	.	.	PUNCT
brj-24894	276	1	the	the	DET
brj-24894	276	2	xxxg	xxxg	NOUN
brj-24894	276	3	-	-	PUNCT
brj-24894	276	4	type	type	NOUN
brj-24894	276	5	oligosaccharides	oligosaccharide	NOUN
brj-24894	276	6	with	with	ADP
brj-24894	276	7	their	their	PRON
brj-24894	276	8	molecular	molecular	ADJ
brj-24894	276	9	weight	weight	NOUN
brj-24894	276	10	were	be	AUX
brj-24894	276	11	indicated	indicate	VERB
brj-24894	276	12	above	above	ADP
brj-24894	276	13	their	their	PRON
brj-24894	276	14	corresponding	correspond	VERB
brj-24894	276	15	peaks	peak	NOUN
brj-24894	276	16	.	.	PUNCT
brj-24894	277	1	b	b	X
brj-24894	277	2	)	)	PUNCT
brj-24894	277	3	the	the	DET
brj-24894	277	4	hydrolysis	hydrolysis	NOUN
brj-24894	277	5	mode	mode	NOUN
brj-24894	277	6	of	of	ADP
brj-24894	277	7	tpcel12a	tpcel12a	NOUN
brj-24894	277	8	on	on	ADP
brj-24894	277	9	xyloglucan	xyloglucan	ADJ
brj-24894	277	10	.	.	PUNCT
brj-24894	278	1	c	c	X
brj-24894	278	2	)	)	PUNCT
brj-24894	278	3	hplc	hplc	NOUN
brj-24894	278	4	determination	determination	NOUN
brj-24894	278	5	of	of	ADP
brj-24894	278	6	final	final	ADJ
brj-24894	278	7	products	product	NOUN
brj-24894	278	8	of	of	ADP
brj-24894	278	9	cmc	cmc	NOUN
brj-24894	278	10	catalyzed	catalyze	VERB
brj-24894	278	11	by	by	ADP
brj-24894	278	12	tpcel12a	tpcel12a	NOUN
brj-24894	278	13	.	.	PUNCT
brj-24894	279	1	g1	g1	PROPN
brj-24894	279	2	and	and	CCONJ
brj-24894	279	3	g2	g2	PROPN
brj-24894	279	4	indicate	indicate	VERB
brj-24894	279	5	glucose	glucose	NOUN
brj-24894	279	6	and	and	CCONJ
brj-24894	279	7	cellobiose	cellobiose	VERB
brj-24894	279	8	,	,	PUNCT
brj-24894	279	9	respectively	respectively	ADV
brj-24894	279	10	.	.	PUNCT
brj-24894	280	1	in	in	ADP
brj-24894	280	2	te	te	ADP
brj-24894	280	3	n	n	PROPN
brj-24894	280	4	s	s	PRON
brj-24894	280	5	it	it	PRON
brj-24894	280	6	y	y	INTJ
brj-24894	280	7	(	(	PUNCT
brj-24894	280	8	x	x	SYM
brj-24894	280	9	1	1	NUM
brj-24894	280	10	0	0	NUM
brj-24894	280	11	3	3	NUM
brj-24894	280	12	)	)	PUNCT
brj-24894	280	13	retention	retention	NOUN
brj-24894	280	14	time	time	NOUN
brj-24894	280	15	(	(	PUNCT
brj-24894	280	16	min	min	NOUN
brj-24894	280	17	)	)	PUNCT
brj-24894	280	18	peer	peer	NOUN
brj-24894	280	19	-	-	PUNCT
brj-24894	280	20	reviewed	review	VERB
brj-24894	280	21	article	article	NOUN
brj-24894	280	22	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	280	23	li	li	PROPN
brj-24894	280	24	et	et	PROPN
brj-24894	280	25	al	al	PROPN
brj-24894	280	26	.	.	PROPN
brj-24894	281	1	(	(	PUNCT
brj-24894	281	2	2026	2026	NUM
brj-24894	281	3	)	)	PUNCT
brj-24894	281	4	.	.	PUNCT
brj-24894	282	1	“	"	PUNCT
brj-24894	282	2	endoglucanase	endoglucanase	VERB
brj-24894	282	3	tpcel12a	tpcel12a	NOUN
brj-24894	282	4	traits	trait	NOUN
brj-24894	282	5	,	,	PUNCT
brj-24894	282	6	”	"	PUNCT
brj-24894	282	7	bioresources	bioresource	NOUN
brj-24894	282	8	21(1	21(1	NUM
brj-24894	282	9	)	)	PUNCT
brj-24894	282	10	,	,	PUNCT
brj-24894	282	11	547	547	NUM
brj-24894	282	12	-	-	SYM
brj-24894	282	13	569	569	NUM
brj-24894	282	14	.	.	PUNCT
brj-24894	283	1	560	560	NUM
brj-24894	283	2	mutation	mutation	NOUN
brj-24894	283	3	of	of	ADP
brj-24894	283	4	loop3	loop3	NOUN
brj-24894	283	5	significantly	significantly	ADV
brj-24894	283	6	increased	increase	VERB
brj-24894	283	7	the	the	DET
brj-24894	283	8	tpcel12a	tpcel12a	NOUN
brj-24894	283	9	’s	’s	PART
brj-24894	283	10	affinity	affinity	NOUN
brj-24894	283	11	for	for	ADP
brj-24894	283	12	xyloglucan	xyloglucan	NOUN
brj-24894	283	13	the	the	DET
brj-24894	283	14	loop3	loop3	NOUN
brj-24894	283	15	region	region	NOUN
brj-24894	283	16	of	of	ADP
brj-24894	283	17	gh12	gh12	PROPN
brj-24894	283	18	endoglucanases	endoglucanase	NOUN
brj-24894	283	19	has	have	AUX
brj-24894	283	20	been	be	AUX
brj-24894	283	21	shown	show	VERB
brj-24894	283	22	to	to	PART
brj-24894	283	23	play	play	VERB
brj-24894	283	24	a	a	DET
brj-24894	283	25	critical	critical	ADJ
brj-24894	283	26	role	role	NOUN
brj-24894	283	27	in	in	ADP
brj-24894	283	28	modulating	modulate	VERB
brj-24894	283	29	catalytic	catalytic	ADJ
brj-24894	283	30	efficiency	efficiency	NOUN
brj-24894	283	31	.	.	PUNCT
brj-24894	284	1	insertion	insertion	NOUN
brj-24894	284	2	mutation	mutation	NOUN
brj-24894	284	3	of	of	ADP
brj-24894	284	4	loop3	loop3	NOUN
brj-24894	284	5	was	be	AUX
brj-24894	284	6	found	find	VERB
brj-24894	284	7	to	to	PART
brj-24894	284	8	enhance	enhance	VERB
brj-24894	284	9	the	the	DET
brj-24894	284	10	catalysis	catalysis	NOUN
brj-24894	284	11	efficiency	efficiency	NOUN
brj-24894	284	12	of	of	ADP
brj-24894	284	13	nfeg12a	nfeg12a	NOUN
brj-24894	284	14	(	(	PUNCT
brj-24894	284	15	yang	yang	PROPN
brj-24894	284	16	et	et	PROPN
brj-24894	284	17	al	al	PROPN
brj-24894	284	18	.	.	PROPN
brj-24894	284	19	2017	2017	NUM
brj-24894	284	20	)	)	PUNCT
brj-24894	284	21	.	.	PUNCT
brj-24894	285	1	multiple	multiple	ADJ
brj-24894	285	2	sequence	sequence	NOUN
brj-24894	285	3	alignment	alignment	NOUN
brj-24894	285	4	revealed	reveal	VERB
brj-24894	285	5	that	that	SCONJ
brj-24894	285	6	tpcel12a	tpcel12a	NOUN
brj-24894	285	7	also	also	ADV
brj-24894	285	8	possesses	possess	VERB
brj-24894	285	9	a	a	DET
brj-24894	285	10	short	short	ADJ
brj-24894	285	11	loop3	loop3	NOUN
brj-24894	285	12	as	as	ADP
brj-24894	285	13	nfeg12a	nfeg12a	NOUN
brj-24894	285	14	.	.	PUNCT
brj-24894	285	15	to	to	PART
brj-24894	285	16	examine	examine	VERB
brj-24894	285	17	whether	whether	SCONJ
brj-24894	285	18	extending	extend	VERB
brj-24894	285	19	loop3	loop3	NOUN
brj-24894	285	20	could	could	AUX
brj-24894	285	21	enhance	enhance	VERB
brj-24894	285	22	the	the	DET
brj-24894	285	23	catalytic	catalytic	ADJ
brj-24894	285	24	efficiency	efficiency	NOUN
brj-24894	285	25	of	of	ADP
brj-24894	285	26	tpcel12a	tpcel12a	NOUN
brj-24894	285	27	,	,	PUNCT
brj-24894	285	28	a	a	DET
brj-24894	285	29	three	three	NUM
brj-24894	285	30	-	-	PUNCT
brj-24894	285	31	amino	amino	NOUN
brj-24894	285	32	-	-	PUNCT
brj-24894	285	33	acid	acid	NOUN
brj-24894	285	34	sequence	sequence	NOUN
brj-24894	285	35	(	(	PUNCT
brj-24894	285	36	tqa	tqa	NOUN
brj-24894	285	37	)	)	PUNCT
brj-24894	285	38	was	be	AUX
brj-24894	285	39	inserted	insert	VERB
brj-24894	285	40	between	between	ADP
brj-24894	285	41	residues	residue	NOUN
brj-24894	285	42	n154	n154	PROPN
brj-24894	285	43	and	and	CCONJ
brj-24894	285	44	g155	g155	PROPN
brj-24894	285	45	,	,	PUNCT
brj-24894	285	46	generating	generate	VERB
brj-24894	285	47	the	the	DET
brj-24894	285	48	mutant	mutant	ADJ
brj-24894	285	49	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	285	50	)	)	PUNCT
brj-24894	285	51	.	.	PUNCT
brj-24894	286	1	this	this	DET
brj-24894	286	2	variant	variant	NOUN
brj-24894	286	3	was	be	AUX
brj-24894	286	4	overexpressed	overexpresse	VERB
brj-24894	286	5	and	and	CCONJ
brj-24894	286	6	purified	purified	ADJ
brj-24894	286	7	using	use	VERB
brj-24894	286	8	the	the	DET
brj-24894	286	9	same	same	ADJ
brj-24894	286	10	protocol	protocol	NOUN
brj-24894	286	11	as	as	ADP
brj-24894	286	12	wild	wild	ADJ
brj-24894	286	13	-	-	PUNCT
brj-24894	286	14	type	type	NOUN
brj-24894	286	15	tpcel12a	tpcel12a	NOUN
brj-24894	286	16	(	(	PUNCT
brj-24894	286	17	fig	fig	NOUN
brj-24894	286	18	.	.	PUNCT
brj-24894	287	1	2d	2d	NOUN
brj-24894	287	2	)	)	PUNCT
brj-24894	287	3	.	.	PUNCT
brj-24894	288	1	the	the	DET
brj-24894	288	2	mutation	mutation	NOUN
brj-24894	288	3	shifted	shift	VERB
brj-24894	288	4	the	the	DET
brj-24894	288	5	optimal	optimal	ADJ
brj-24894	288	6	temperature	temperature	NOUN
brj-24894	288	7	from	from	ADP
brj-24894	288	8	40	40	NUM
brj-24894	288	9	to	to	PART
brj-24894	288	10	50	50	NUM
brj-24894	288	11	°	°	NOUN
brj-24894	288	12	c	c	X
brj-24894	288	13	(	(	PUNCT
brj-24894	288	14	fig	fig	NOUN
brj-24894	288	15	.	.	PUNCT
brj-24894	288	16	4a	4a	NUM
brj-24894	288	17	)	)	PUNCT
brj-24894	288	18	,	,	PUNCT
brj-24894	288	19	but	but	CCONJ
brj-24894	288	20	there	there	PRON
brj-24894	288	21	was	be	VERB
brj-24894	288	22	no	no	DET
brj-24894	288	23	discernible	discernible	ADJ
brj-24894	288	24	effect	effect	NOUN
brj-24894	288	25	on	on	ADP
brj-24894	288	26	thermostability	thermostability	NOUN
brj-24894	288	27	(	(	PUNCT
brj-24894	288	28	not	not	PART
brj-24894	288	29	shown	show	VERB
brj-24894	288	30	)	)	PUNCT
brj-24894	288	31	.	.	PUNCT
brj-24894	289	1	the	the	DET
brj-24894	289	2	optimal	optimal	ADJ
brj-24894	289	3	ph	ph	ADJ
brj-24894	289	4	and	and	CCONJ
brj-24894	289	5	ph	ph	ADJ
brj-24894	289	6	stability	stability	NOUN
brj-24894	289	7	of	of	ADP
brj-24894	289	8	tpcel12a	tpcel12a	NOUN
brj-24894	289	9	and	and	CCONJ
brj-24894	289	10	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	289	11	)	)	PUNCT
brj-24894	289	12	were	be	AUX
brj-24894	289	13	nearly	nearly	ADV
brj-24894	289	14	identical	identical	ADJ
brj-24894	289	15	,	,	PUNCT
brj-24894	289	16	except	except	SCONJ
brj-24894	289	17	that	that	DET
brj-24894	289	18	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	289	19	)	)	PUNCT
brj-24894	289	20	exhibited	exhibit	VERB
brj-24894	289	21	higher	high	ADJ
brj-24894	289	22	activity	activity	NOUN
brj-24894	289	23	in	in	ADP
brj-24894	289	24	citrate	citrate	NOUN
brj-24894	289	25	buffer	buffer	NOUN
brj-24894	289	26	(	(	PUNCT
brj-24894	289	27	ph	ph	NOUN
brj-24894	289	28	4.0	4.0	NUM
brj-24894	289	29	)	)	PUNCT
brj-24894	289	30	compared	compare	VERB
brj-24894	289	31	to	to	ADP
brj-24894	289	32	acetate	acetate	NOUN
brj-24894	289	33	buffer	buffer	NOUN
brj-24894	289	34	(	(	PUNCT
brj-24894	289	35	ph	ph	NOUN
brj-24894	289	36	4.0	4.0	NUM
brj-24894	289	37	)	)	PUNCT
brj-24894	289	38	(	(	PUNCT
brj-24894	289	39	fig	fig	NOUN
brj-24894	289	40	.	.	PUNCT
brj-24894	289	41	4b	4b	PROPN
brj-24894	289	42	)	)	PUNCT
brj-24894	289	43	.	.	PUNCT
brj-24894	290	1	kinetic	kinetic	ADJ
brj-24894	290	2	analysis	analysis	NOUN
brj-24894	290	3	based	base	VERB
brj-24894	290	4	on	on	ADP
brj-24894	290	5	michaelis	michaeli	NOUN
brj-24894	290	6	-	-	PUNCT
brj-24894	290	7	menten	menten	ADJ
brj-24894	290	8	plots	plot	NOUN
brj-24894	290	9	revealed	reveal	VERB
brj-24894	290	10	a	a	DET
brj-24894	290	11	km	km	NOUN
brj-24894	290	12	of	of	ADP
brj-24894	290	13	3.94	3.94	NUM
brj-24894	290	14	±	±	NUM
brj-24894	290	15	0.15	0.15	NUM
brj-24894	290	16	mg	mg	PROPN
brj-24894	290	17	/	/	SYM
brj-24894	290	18	ml	ml	PROPN
brj-24894	290	19	and	and	CCONJ
brj-24894	290	20	a	a	DET
brj-24894	290	21	vmax	vmax	NOUN
brj-24894	290	22	of	of	ADP
brj-24894	290	23	198.58	198.58	NUM
brj-24894	290	24	±	±	NUM
brj-24894	290	25	4.32	4.32	NUM
brj-24894	290	26	μmol/(min·mg	μmol/(min·mg	NUM
brj-24894	290	27	)	)	PUNCT
brj-24894	290	28	.	.	PUNCT
brj-24894	291	1	the	the	DET
brj-24894	291	2	affinity	affinity	NOUN
brj-24894	291	3	for	for	ADP
brj-24894	291	4	xyloglucan	xyloglucan	NOUN
brj-24894	291	5	increased	increase	VERB
brj-24894	291	6	5	5	NUM
brj-24894	291	7	-	-	NOUN
brj-24894	291	8	fold	fold	ADJ
brj-24894	291	9	,	,	PUNCT
brj-24894	291	10	as	as	SCONJ
brj-24894	291	11	indicated	indicate	VERB
brj-24894	291	12	by	by	ADP
brj-24894	291	13	the	the	DET
brj-24894	291	14	decrease	decrease	NOUN
brj-24894	291	15	in	in	ADP
brj-24894	291	16	km	km	PROPN
brj-24894	291	17	.	.	PUNCT
brj-24894	292	1	however	however	ADV
brj-24894	292	2	,	,	PUNCT
brj-24894	292	3	the	the	DET
brj-24894	292	4	enzymatic	enzymatic	ADJ
brj-24894	292	5	activity	activity	NOUN
brj-24894	292	6	was	be	AUX
brj-24894	292	7	reduced	reduce	VERB
brj-24894	292	8	,	,	PUNCT
brj-24894	292	9	indicating	indicate	VERB
brj-24894	292	10	a	a	DET
brj-24894	292	11	trade	trade	NOUN
brj-24894	292	12	-	-	PUNCT
brj-24894	292	13	off	off	ADP
brj-24894	292	14	relationship	relationship	NOUN
brj-24894	292	15	between	between	ADP
brj-24894	292	16	affinity	affinity	NOUN
brj-24894	292	17	and	and	CCONJ
brj-24894	292	18	catalytic	catalytic	ADJ
brj-24894	292	19	activity	activity	NOUN
brj-24894	292	20	.	.	PUNCT
brj-24894	293	1	synergistic	synergistic	ADJ
brj-24894	293	2	action	action	NOUN
brj-24894	293	3	in	in	ADP
brj-24894	293	4	saccharification	saccharification	NOUN
brj-24894	293	5	of	of	ADP
brj-24894	293	6	untreated	untreated	ADJ
brj-24894	293	7	corn	corn	NOUN
brj-24894	293	8	cob	cob	NOUN
brj-24894	293	9	powder	powder	NOUN
brj-24894	293	10	between	between	ADP
brj-24894	293	11	tpcel12a	tpcel12a	NOUN
brj-24894	293	12	and	and	CCONJ
brj-24894	293	13	crude	crude	NOUN
brj-24894	293	14	cellulase	cellulase	NOUN
brj-24894	293	15	the	the	DET
brj-24894	293	16	synergistic	synergistic	ADJ
brj-24894	293	17	action	action	NOUN
brj-24894	293	18	of	of	ADP
brj-24894	293	19	exoglucanase	exoglucanase	NOUN
brj-24894	293	20	,	,	PUNCT
brj-24894	293	21	endoglucanase	endoglucanase	VERB
brj-24894	293	22	,	,	PUNCT
brj-24894	293	23	β	β	NOUN
brj-24894	293	24	-	-	NOUN
brj-24894	293	25	glucosidase	glucosidase	ADJ
brj-24894	293	26	,	,	PUNCT
brj-24894	293	27	and	and	CCONJ
brj-24894	293	28	even	even	ADV
brj-24894	293	29	auxiliary	auxiliary	ADJ
brj-24894	293	30	enzyme	enzyme	NOUN
brj-24894	293	31	such	such	ADJ
brj-24894	293	32	as	as	ADP
brj-24894	293	33	lpmo	lpmo	NOUN
brj-24894	293	34	in	in	ADP
brj-24894	293	35	cellulase	cellulase	NOUN
brj-24894	293	36	is	be	AUX
brj-24894	293	37	essential	essential	ADJ
brj-24894	293	38	for	for	ADP
brj-24894	293	39	the	the	DET
brj-24894	293	40	efficient	efficient	ADJ
brj-24894	293	41	degradation	degradation	NOUN
brj-24894	293	42	of	of	ADP
brj-24894	293	43	lignocellulose	lignocellulose	NOUN
brj-24894	293	44	into	into	ADP
brj-24894	293	45	soluble	soluble	ADJ
brj-24894	293	46	sugars	sugar	NOUN
brj-24894	293	47	.	.	PUNCT
brj-24894	294	1	previous	previous	ADJ
brj-24894	294	2	studies	study	NOUN
brj-24894	294	3	have	have	AUX
brj-24894	294	4	shown	show	VERB
brj-24894	294	5	that	that	SCONJ
brj-24894	294	6	certain	certain	ADJ
brj-24894	294	7	gh12	gh12	PROPN
brj-24894	294	8	endoglucanases	endoglucanase	NOUN
brj-24894	294	9	can	can	AUX
brj-24894	294	10	enhance	enhance	VERB
brj-24894	294	11	hydrolysis	hydrolysis	NOUN
brj-24894	294	12	efficiency	efficiency	NOUN
brj-24894	294	13	when	when	SCONJ
brj-24894	294	14	combined	combine	VERB
brj-24894	294	15	with	with	ADP
brj-24894	294	16	crude	crude	ADJ
brj-24894	294	17	cellulase	cellulase	NOUN
brj-24894	294	18	(	(	PUNCT
brj-24894	294	19	narra	narra	NOUN
brj-24894	294	20	et	et	PROPN
brj-24894	294	21	al	al	PROPN
brj-24894	294	22	.	.	PROPN
brj-24894	294	23	2014	2014	NUM
brj-24894	294	24	)	)	PUNCT
brj-24894	294	25	.	.	PUNCT
brj-24894	295	1	therefore	therefore	ADV
brj-24894	295	2	,	,	PUNCT
brj-24894	295	3	to	to	PART
brj-24894	295	4	examine	examine	VERB
brj-24894	295	5	the	the	DET
brj-24894	295	6	potential	potential	ADJ
brj-24894	295	7	synergistic	synergistic	ADJ
brj-24894	295	8	effect	effect	NOUN
brj-24894	295	9	between	between	ADP
brj-24894	295	10	tpcel12a	tpcel12a	NOUN
brj-24894	295	11	and	and	CCONJ
brj-24894	295	12	crude	crude	NOUN
brj-24894	295	13	cellulase	cellulase	NOUN
brj-24894	295	14	,	,	PUNCT
brj-24894	295	15	tpcel12a	tpcel12a	NOUN
brj-24894	295	16	was	be	AUX
brj-24894	295	17	combined	combine	VERB
brj-24894	295	18	with	with	ADP
brj-24894	295	19	the	the	DET
brj-24894	295	20	crude	crude	ADJ
brj-24894	295	21	cellulase	cellulase	NOUN
brj-24894	295	22	from	from	ADP
brj-24894	295	23	its	its	PRON
brj-24894	295	24	native	native	ADJ
brj-24894	295	25	host	host	NOUN
brj-24894	295	26	t.	t.	NOUN
brj-24894	295	27	pinophilus	pinophilus	X
brj-24894	295	28	y117	y117	NUM
brj-24894	295	29	in	in	ADP
brj-24894	295	30	a	a	DET
brj-24894	295	31	reaction	reaction	NOUN
brj-24894	295	32	mixture	mixture	NOUN
brj-24894	295	33	containing	contain	VERB
brj-24894	295	34	untreated	untreated	ADJ
brj-24894	295	35	corn	corn	NOUN
brj-24894	295	36	cob	cob	NOUN
brj-24894	295	37	powder	powder	NOUN
brj-24894	295	38	as	as	ADP
brj-24894	295	39	substrate	substrate	NOUN
brj-24894	295	40	.	.	PUNCT
brj-24894	296	1	hydrolysis	hydrolysis	NOUN
brj-24894	296	2	was	be	AUX
brj-24894	296	3	performed	perform	VERB
brj-24894	296	4	at	at	ADP
brj-24894	296	5	40	40	NUM
brj-24894	296	6	°	°	NOUN
brj-24894	296	7	c	c	NOUN
brj-24894	296	8	and	and	CCONJ
brj-24894	296	9	ph	ph	X
brj-24894	296	10	4.0	4.0	NUM
brj-24894	296	11	.	.	PUNCT
brj-24894	297	1	fig	fig	NOUN
brj-24894	297	2	.	.	PUNCT
brj-24894	298	1	7	7	X
brj-24894	298	2	.	.	X
brj-24894	298	3	no	no	DET
brj-24894	298	4	synergistic	synergistic	ADJ
brj-24894	298	5	effect	effect	NOUN
brj-24894	298	6	was	be	AUX
brj-24894	298	7	observed	observe	VERB
brj-24894	298	8	between	between	ADP
brj-24894	298	9	tpcel12a	tpcel12a	NOUN
brj-24894	298	10	and	and	CCONJ
brj-24894	298	11	crude	crude	ADJ
brj-24894	298	12	cellulose	cellulose	NOUN
brj-24894	298	13	from	from	ADP
brj-24894	298	14	its	its	PRON
brj-24894	298	15	native	native	ADJ
brj-24894	298	16	host	host	NOUN
brj-24894	298	17	t.	t.	NOUN
brj-24894	298	18	pinophilus	pinophilus	NOUN
brj-24894	299	1	y117	y117	NUM
brj-24894	299	2	:	:	PUNCT
brj-24894	299	3	a	a	X
brj-24894	299	4	:	:	PUNCT
brj-24894	299	5	tpcel12a	tpcel12a	NOUN
brj-24894	299	6	only	only	ADV
brj-24894	299	7	;	;	PUNCT
brj-24894	299	8	b	b	X
brj-24894	299	9	:	:	PUNCT
brj-24894	299	10	crude	crude	ADJ
brj-24894	299	11	cellulase	cellulase	NOUN
brj-24894	299	12	only	only	ADV
brj-24894	299	13	;	;	PUNCT
brj-24894	299	14	and	and	CCONJ
brj-24894	299	15	c	c	X
brj-24894	299	16	:	:	PUNCT
brj-24894	299	17	combination	combination	NOUN
brj-24894	299	18	of	of	ADP
brj-24894	299	19	tpcel12a	tpcel12a	NOUN
brj-24894	299	20	and	and	CCONJ
brj-24894	299	21	crude	crude	ADJ
brj-24894	299	22	cellulase	cellulase	NOUN
brj-24894	299	23	.	.	PUNCT
brj-24894	300	1	peer	peer	NOUN
brj-24894	300	2	-	-	PUNCT
brj-24894	300	3	reviewed	review	VERB
brj-24894	300	4	article	article	NOUN
brj-24894	300	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	300	6	li	li	PROPN
brj-24894	300	7	et	et	PROPN
brj-24894	300	8	al	al	PROPN
brj-24894	300	9	.	.	PROPN
brj-24894	301	1	(	(	PUNCT
brj-24894	301	2	2026	2026	NUM
brj-24894	301	3	)	)	PUNCT
brj-24894	301	4	.	.	PUNCT
brj-24894	302	1	“	"	PUNCT
brj-24894	302	2	endoglucanase	endoglucanase	VERB
brj-24894	302	3	tpcel12a	tpcel12a	NOUN
brj-24894	302	4	traits	trait	NOUN
brj-24894	302	5	,	,	PUNCT
brj-24894	302	6	”	"	PUNCT
brj-24894	302	7	bioresources	bioresource	NOUN
brj-24894	302	8	21(1	21(1	NUM
brj-24894	302	9	)	)	PUNCT
brj-24894	302	10	,	,	PUNCT
brj-24894	302	11	547	547	NUM
brj-24894	302	12	-	-	SYM
brj-24894	302	13	569	569	NUM
brj-24894	302	14	.	.	PUNCT
brj-24894	303	1	561	561	NUM
brj-24894	303	2	while	while	SCONJ
brj-24894	303	3	tpcel12a	tpcel12a	NOUN
brj-24894	303	4	alone	alone	ADV
brj-24894	303	5	showed	show	VERB
brj-24894	303	6	limited	limited	ADJ
brj-24894	303	7	activity	activity	NOUN
brj-24894	303	8	on	on	ADP
brj-24894	303	9	untreated	untreated	ADJ
brj-24894	303	10	corn	corn	NOUN
brj-24894	303	11	cob	cob	NOUN
brj-24894	303	12	powder	powder	NOUN
brj-24894	303	13	compared	compare	VERB
brj-24894	303	14	to	to	ADP
brj-24894	303	15	the	the	DET
brj-24894	303	16	crude	crude	ADJ
brj-24894	303	17	cellulase	cellulase	NOUN
brj-24894	303	18	alone	alone	ADV
brj-24894	303	19	(	(	PUNCT
brj-24894	303	20	fig	fig	NOUN
brj-24894	303	21	.	.	PUNCT
brj-24894	304	1	7	7	NUM
brj-24894	304	2	)	)	PUNCT
brj-24894	304	3	,	,	PUNCT
brj-24894	304	4	the	the	DET
brj-24894	304	5	combination	combination	NOUN
brj-24894	304	6	of	of	ADP
brj-24894	304	7	tpcel12a	tpcel12a	NOUN
brj-24894	304	8	with	with	ADP
brj-24894	304	9	crude	crude	ADJ
brj-24894	304	10	cellulase	cellulase	NOUN
brj-24894	304	11	unexpectedly	unexpectedly	ADV
brj-24894	304	12	resulted	result	VERB
brj-24894	304	13	in	in	ADP
brj-24894	304	14	significantly	significantly	ADV
brj-24894	304	15	reduced	reduce	VERB
brj-24894	304	16	hydrolysis	hydrolysis	NOUN
brj-24894	304	17	efficiency	efficiency	NOUN
brj-24894	304	18	(	(	PUNCT
brj-24894	304	19	fig	fig	NOUN
brj-24894	304	20	.	.	PUNCT
brj-24894	305	1	7	7	NUM
brj-24894	305	2	)	)	PUNCT
brj-24894	305	3	.	.	PUNCT
brj-24894	306	1	this	this	PRON
brj-24894	306	2	suggests	suggest	VERB
brj-24894	306	3	that	that	SCONJ
brj-24894	306	4	tpcel12a	tpcel12a	AUX
brj-24894	306	5	not	not	PART
brj-24894	306	6	only	only	ADV
brj-24894	306	7	failed	fail	VERB
brj-24894	306	8	to	to	PART
brj-24894	306	9	synergize	synergize	VERB
brj-24894	306	10	with	with	ADP
brj-24894	306	11	the	the	DET
brj-24894	306	12	crude	crude	ADJ
brj-24894	306	13	cellulase	cellulase	NOUN
brj-24894	306	14	,	,	PUNCT
brj-24894	306	15	but	but	CCONJ
brj-24894	306	16	that	that	SCONJ
brj-24894	306	17	it	it	PRON
brj-24894	306	18	also	also	ADV
brj-24894	306	19	might	might	AUX
brj-24894	306	20	inhibit	inhibit	VERB
brj-24894	306	21	the	the	DET
brj-24894	306	22	hydrolytic	hydrolytic	ADJ
brj-24894	306	23	activity	activity	NOUN
brj-24894	306	24	of	of	ADP
brj-24894	306	25	the	the	DET
brj-24894	306	26	t.	t.	PROPN
brj-24894	306	27	pinophilus	pinophilus	ADJ
brj-24894	306	28	y117	y117	NUM
brj-24894	306	29	crude	crude	ADJ
brj-24894	306	30	cellulase	cellulase	NOUN
brj-24894	306	31	.	.	PUNCT
brj-24894	307	1	the	the	DET
brj-24894	307	2	inhibition	inhibition	NOUN
brj-24894	307	3	might	might	AUX
brj-24894	307	4	be	be	AUX
brj-24894	307	5	explained	explain	VERB
brj-24894	307	6	by	by	ADP
brj-24894	307	7	the	the	DET
brj-24894	307	8	fact	fact	NOUN
brj-24894	307	9	that	that	PRON
brj-24894	307	10	cellobiose	cellobiose	VERB
brj-24894	307	11	—	—	PUNCT
brj-24894	307	12	a	a	DET
brj-24894	307	13	major	major	ADJ
brj-24894	307	14	product	product	NOUN
brj-24894	307	15	of	of	ADP
brj-24894	307	16	tpcel12a	tpcel12a	NOUN
brj-24894	307	17	—	—	PUNCT
brj-24894	307	18	is	be	AUX
brj-24894	307	19	a	a	DET
brj-24894	307	20	well	well	ADV
brj-24894	307	21	-	-	PUNCT
brj-24894	307	22	known	know	VERB
brj-24894	307	23	inhibitor	inhibitor	NOUN
brj-24894	307	24	of	of	ADP
brj-24894	307	25	exoglucanases	exoglucanase	NOUN
brj-24894	307	26	and	and	CCONJ
brj-24894	307	27	endoglucanases	endoglucanase	NOUN
brj-24894	307	28	in	in	ADP
brj-24894	307	29	crude	crude	ADJ
brj-24894	307	30	cellulase	cellulase	NOUN
brj-24894	307	31	mixtures	mixture	NOUN
brj-24894	307	32	(	(	PUNCT
brj-24894	307	33	yue	yue	PROPN
brj-24894	307	34	et	et	PROPN
brj-24894	307	35	al	al	PROPN
brj-24894	307	36	.	.	PROPN
brj-24894	307	37	2004	2004	NUM
brj-24894	307	38	)	)	PUNCT
brj-24894	307	39	.	.	PUNCT
brj-24894	308	1	moreover	moreover	ADV
brj-24894	308	2	,	,	PUNCT
brj-24894	308	3	this	this	DET
brj-24894	308	4	finding	finding	NOUN
brj-24894	308	5	may	may	AUX
brj-24894	308	6	explain	explain	VERB
brj-24894	308	7	why	why	SCONJ
brj-24894	308	8	lc	lc	NOUN
brj-24894	308	9	-	-	PUNCT
brj-24894	308	10	ms	ms	NOUN
brj-24894	308	11	analysis	analysis	NOUN
brj-24894	308	12	failed	fail	VERB
brj-24894	308	13	to	to	PART
brj-24894	308	14	detect	detect	VERB
brj-24894	308	15	secretory	secretory	ADJ
brj-24894	308	16	expression	expression	NOUN
brj-24894	308	17	of	of	ADP
brj-24894	308	18	tpcel12a	tpcel12a	NOUN
brj-24894	308	19	when	when	SCONJ
brj-24894	308	20	induced	induce	VERB
brj-24894	308	21	by	by	ADP
brj-24894	308	22	microcrystalline	microcrystalline	NOUN
brj-24894	308	23	cellulose	cellulose	NOUN
brj-24894	308	24	(	(	PUNCT
brj-24894	308	25	not	not	PART
brj-24894	308	26	shown	show	VERB
brj-24894	308	27	)	)	PUNCT
brj-24894	308	28	.	.	PUNCT
brj-24894	309	1	further	further	ADJ
brj-24894	309	2	experiments	experiment	NOUN
brj-24894	309	3	are	be	AUX
brj-24894	309	4	needed	need	VERB
brj-24894	309	5	to	to	PART
brj-24894	309	6	determine	determine	VERB
brj-24894	309	7	whether	whether	SCONJ
brj-24894	309	8	tpcel12a	tpcel12a	NOUN
brj-24894	309	9	shows	show	VERB
brj-24894	309	10	synergistic	synergistic	ADJ
brj-24894	309	11	activity	activity	NOUN
brj-24894	309	12	with	with	ADP
brj-24894	309	13	other	other	ADJ
brj-24894	309	14	enzymes	enzyme	NOUN
brj-24894	309	15	including	include	VERB
brj-24894	309	16	xylanases	xylanase	NOUN
brj-24894	309	17	,	,	PUNCT
brj-24894	309	18	mannanases	mannanase	NOUN
brj-24894	309	19	,	,	PUNCT
brj-24894	309	20	or	or	CCONJ
brj-24894	309	21	cellulases	cellulase	NOUN
brj-24894	309	22	of	of	ADP
brj-24894	309	23	different	different	ADJ
brj-24894	309	24	origins	origin	NOUN
brj-24894	309	25	.	.	PUNCT
brj-24894	310	1	conclusions	conclusion	NOUN
brj-24894	310	2	1	1	NUM
brj-24894	310	3	.	.	PUNCT
brj-24894	311	1	a	a	DET
brj-24894	311	2	novel	novel	ADJ
brj-24894	311	3	gh12	gh12	PROPN
brj-24894	311	4	endoglucanase	endoglucanase	VERB
brj-24894	311	5	tpcel12a	tpcel12a	VERB
brj-24894	311	6	from	from	ADP
brj-24894	311	7	t.	t.	NOUN
brj-24894	311	8	pinophilus	pinophilus	ADJ
brj-24894	311	9	strain	strain	NOUN
brj-24894	311	10	y117	y117	NUM
brj-24894	311	11	was	be	AUX
brj-24894	311	12	identified	identify	VERB
brj-24894	311	13	and	and	CCONJ
brj-24894	311	14	characterized	characterize	VERB
brj-24894	311	15	.	.	PUNCT
brj-24894	312	1	2	2	X
brj-24894	312	2	.	.	X
brj-24894	312	3	despite	despite	SCONJ
brj-24894	312	4	the	the	DET
brj-24894	312	5	fact	fact	NOUN
brj-24894	312	6	that	that	SCONJ
brj-24894	312	7	tpcel12a	tpcel12a	NOUN
brj-24894	312	8	belongs	belong	VERB
brj-24894	312	9	to	to	ADP
brj-24894	312	10	promiscuous	promiscuous	ADJ
brj-24894	312	11	phylogenetic	phylogenetic	ADJ
brj-24894	312	12	subfamily	subfamily	ADV
brj-24894	313	1	i	i	PRON
brj-24894	313	2	,	,	PUNCT
brj-24894	313	3	tpcel12a	tpcel12a	VERB
brj-24894	313	4	exhibited	exhibit	VERB
brj-24894	313	5	substrate	substrate	NOUN
brj-24894	313	6	specificity	specificity	NOUN
brj-24894	313	7	for	for	ADP
brj-24894	313	8	xyloglucan	xyloglucan	ADJ
brj-24894	313	9	/	/	SYM
brj-24894	313	10	cmc	cmc	NOUN
brj-24894	313	11	,	,	PUNCT
brj-24894	313	12	and	and	CCONJ
brj-24894	313	13	no	no	DET
brj-24894	313	14	detected	detect	VERB
brj-24894	313	15	activity	activity	NOUN
brj-24894	313	16	towards	towards	ADP
brj-24894	313	17	β-1,3	β-1,3	PROPN
brj-24894	313	18	-	-	PUNCT
brj-24894	313	19	1,4	1,4	NUM
brj-24894	313	20	-	-	PUNCT
brj-24894	313	21	glucan	glucan	NOUN
brj-24894	313	22	and	and	CCONJ
brj-24894	313	23	other	other	ADJ
brj-24894	313	24	polysaccharides	polysaccharide	NOUN
brj-24894	313	25	.	.	PUNCT
brj-24894	314	1	3	3	X
brj-24894	314	2	.	.	NUM
brj-24894	314	3	tpcel12a	tpcel12a	VERB
brj-24894	314	4	hydrolyzed	hydrolyzed	ADJ
brj-24894	314	5	xyloglucan	xyloglucan	NOUN
brj-24894	314	6	into	into	ADP
brj-24894	314	7	xxxg	xxxg	NOUN
brj-24894	314	8	-	-	PUNCT
brj-24894	314	9	type	type	NOUN
brj-24894	314	10	oligosaccharides	oligosaccharide	NOUN
brj-24894	314	11	and	and	CCONJ
brj-24894	314	12	cmc	cmc	NOUN
brj-24894	314	13	into	into	ADP
brj-24894	314	14	glucose	glucose	NOUN
brj-24894	314	15	/	/	SYM
brj-24894	314	16	cellobiose	cellobiose	NOUN
brj-24894	314	17	,	,	PUNCT
brj-24894	314	18	respectively	respectively	ADV
brj-24894	314	19	.	.	PUNCT
brj-24894	315	1	4	4	X
brj-24894	315	2	.	.	X
brj-24894	315	3	through	through	ADP
brj-24894	315	4	insertion	insertion	NOUN
brj-24894	315	5	mutagenesis	mutagenesis	NOUN
brj-24894	315	6	in	in	ADP
brj-24894	315	7	loop	loop	NOUN
brj-24894	315	8	3	3	NUM
brj-24894	315	9	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	315	10	)	)	PUNCT
brj-24894	315	11	,	,	PUNCT
brj-24894	315	12	a	a	DET
brj-24894	315	13	5	5	NUM
brj-24894	315	14	-	-	ADJ
brj-24894	315	15	fold	fold	ADJ
brj-24894	315	16	reduction	reduction	NOUN
brj-24894	315	17	was	be	AUX
brj-24894	315	18	achieved	achieve	VERB
brj-24894	315	19	in	in	ADP
brj-24894	315	20	the	the	DET
brj-24894	315	21	kinetic	kinetic	ADJ
brj-24894	315	22	parameter	parameter	NOUN
brj-24894	315	23	km	km	PROPN
brj-24894	315	24	(	(	PUNCT
brj-24894	315	25	27.13	27.13	NUM
brj-24894	315	26	mg	mg	NUM
brj-24894	315	27	/	/	SYM
brj-24894	315	28	ml	ml	NOUN
brj-24894	315	29	to	to	ADP
brj-24894	315	30	3.94	3.94	NUM
brj-24894	315	31	mg	mg	NOUN
brj-24894	315	32	/	/	SYM
brj-24894	315	33	ml	ml	NOUN
brj-24894	315	34	)	)	PUNCT
brj-24894	315	35	,	,	PUNCT
brj-24894	315	36	significantly	significantly	ADV
brj-24894	315	37	improving	improve	VERB
brj-24894	315	38	substrate	substrate	NOUN
brj-24894	315	39	binding	binding	ADJ
brj-24894	315	40	affinity	affinity	NOUN
brj-24894	315	41	,	,	PUNCT
brj-24894	315	42	albeit	albeit	SCONJ
brj-24894	315	43	at	at	ADP
brj-24894	315	44	the	the	DET
brj-24894	315	45	cost	cost	NOUN
brj-24894	315	46	of	of	ADP
brj-24894	315	47	reduced	reduce	VERB
brj-24894	315	48	enzymatic	enzymatic	ADJ
brj-24894	315	49	activity	activity	NOUN
brj-24894	315	50	.	.	PUNCT
brj-24894	316	1	5	5	X
brj-24894	316	2	.	.	X
brj-24894	316	3	unexpectedly	unexpectedly	ADV
brj-24894	316	4	,	,	PUNCT
brj-24894	316	5	tpcel12a	tpcel12a	PRON
brj-24894	316	6	showed	show	VERB
brj-24894	316	7	no	no	DET
brj-24894	316	8	synergistic	synergistic	ADJ
brj-24894	316	9	effect	effect	NOUN
brj-24894	316	10	with	with	ADP
brj-24894	316	11	crude	crude	ADJ
brj-24894	316	12	cellulase	cellulase	NOUN
brj-24894	316	13	during	during	ADP
brj-24894	316	14	untreated	untreated	ADJ
brj-24894	316	15	corn	corn	NOUN
brj-24894	316	16	cob	cob	NOUN
brj-24894	316	17	powder	powder	NOUN
brj-24894	316	18	saccharification	saccharification	NOUN
brj-24894	316	19	,	,	PUNCT
brj-24894	316	20	instead	instead	ADV
brj-24894	316	21	,	,	PUNCT
brj-24894	316	22	it	it	PRON
brj-24894	316	23	exhibited	exhibit	VERB
brj-24894	316	24	inhibitory	inhibitory	ADJ
brj-24894	316	25	effects	effect	NOUN
brj-24894	316	26	on	on	ADP
brj-24894	316	27	crude	crude	ADJ
brj-24894	316	28	cellulase	cellulase	NOUN
brj-24894	316	29	activity	activity	NOUN
brj-24894	316	30	.	.	PUNCT
brj-24894	317	1	acknowledgments	acknowledgment	NOUN
brj-24894	317	2	the	the	DET
brj-24894	317	3	authors	author	NOUN
brj-24894	317	4	are	be	AUX
brj-24894	317	5	grateful	grateful	ADJ
brj-24894	317	6	for	for	ADP
brj-24894	317	7	the	the	DET
brj-24894	317	8	support	support	NOUN
brj-24894	317	9	of	of	ADP
brj-24894	317	10	the	the	DET
brj-24894	317	11	gan	gan	PROPN
brj-24894	317	12	po	po	PROPN
brj-24894	317	13	juncai	juncai	PROPN
brj-24894	317	14	support	support	PROPN
brj-24894	317	15	program	program	NOUN
brj-24894	317	16	(	(	PUNCT
brj-24894	317	17	20243bce51054	20243bce51054	NUM
brj-24894	317	18	)	)	PUNCT
brj-24894	317	19	,	,	PUNCT
brj-24894	317	20	jiangxi	jiangxi	PROPN
brj-24894	317	21	key	key	PROPN
brj-24894	317	22	r&d	r&d	NOUN
brj-24894	317	23	program	program	NOUN
brj-24894	317	24	(	(	PUNCT
brj-24894	317	25	20223aag02023	20223aag02023	NUM
brj-24894	317	26	and	and	CCONJ
brj-24894	317	27	20223bbf61015	20223bbf61015	NUM
brj-24894	317	28	)	)	PUNCT
brj-24894	317	29	,	,	PUNCT
brj-24894	317	30	jiangxi	jiangxi	PROPN
brj-24894	317	31	natural	natural	PROPN
brj-24894	317	32	science	science	PROPN
brj-24894	317	33	foundation	foundation	PROPN
brj-24894	317	34	youth	youth	PROPN
brj-24894	317	35	fund	fund	NOUN
brj-24894	317	36	project	project	NOUN
brj-24894	317	37	(	(	PUNCT
brj-24894	317	38	20242bab202533	20242bab202533	NUM
brj-24894	317	39	)	)	PUNCT
brj-24894	317	40	,	,	PUNCT
brj-24894	317	41	provincial	provincial	ADJ
brj-24894	317	42	scientific	scientific	ADJ
brj-24894	317	43	research	research	NOUN
brj-24894	317	44	project	project	NOUN
brj-24894	317	45	(	(	PUNCT
brj-24894	317	46	s2021gdqn2403	s2021gdqn2403	NOUN
brj-24894	317	47	)	)	PUNCT
brj-24894	317	48	,	,	PUNCT
brj-24894	317	49	jiangxi	jiangxi	PROPN
brj-24894	317	50	early	early	ADJ
brj-24894	317	51	-	-	PUNCT
brj-24894	317	52	career	career	NOUN
brj-24894	317	53	scientist	scientist	NOUN
brj-24894	317	54	cultivation	cultivation	NOUN
brj-24894	317	55	program	program	NOUN
brj-24894	317	56	(	(	PUNCT
brj-24894	317	57	20244bce52262	20244bce52262	NUM
brj-24894	317	58	)	)	PUNCT
brj-24894	317	59	,	,	PUNCT
brj-24894	317	60	and	and	CCONJ
brj-24894	317	61	national	national	ADJ
brj-24894	317	62	natural	natural	ADJ
brj-24894	317	63	science	science	PROPN
brj-24894	317	64	foundation	foundation	PROPN
brj-24894	317	65	of	of	ADP
brj-24894	317	66	china	china	PROPN
brj-24894	317	67	(	(	PUNCT
brj-24894	317	68	32160579	32160579	NUM
brj-24894	317	69	)	)	PUNCT
brj-24894	317	70	.	.	PUNCT
brj-24894	318	1	references	reference	NOUN
brj-24894	318	2	cited	cite	VERB
brj-24894	318	3	abramson	abramson	PROPN
brj-24894	318	4	,	,	PUNCT
brj-24894	318	5	j.	j.	PROPN
brj-24894	318	6	,	,	PUNCT
brj-24894	318	7	adler	adler	PROPN
brj-24894	318	8	,	,	PUNCT
brj-24894	318	9	j.	j.	PROPN
brj-24894	318	10	,	,	PUNCT
brj-24894	318	11	dunger	dunger	NOUN
brj-24894	318	12	,	,	PUNCT
brj-24894	318	13	j.	j.	PROPN
brj-24894	318	14	,	,	PUNCT
brj-24894	318	15	evans	evans	PROPN
brj-24894	318	16	,	,	PUNCT
brj-24894	318	17	r.	r.	PROPN
brj-24894	318	18	,	,	PUNCT
brj-24894	318	19	green	green	ADJ
brj-24894	318	20	,	,	PUNCT
brj-24894	318	21	t.	t.	PROPN
brj-24894	318	22	,	,	PUNCT
brj-24894	318	23	pritzel	pritzel	NOUN
brj-24894	318	24	,	,	PUNCT
brj-24894	318	25	a.	a.	NOUN
brj-24894	318	26	,	,	PUNCT
brj-24894	318	27	ronneberger	ronneberger	NOUN
brj-24894	318	28	,	,	PUNCT
brj-24894	318	29	o.	o.	PROPN
brj-24894	318	30	,	,	PUNCT
brj-24894	318	31	willmore	willmore	NOUN
brj-24894	318	32	,	,	PUNCT
brj-24894	318	33	l.	l.	PROPN
brj-24894	318	34	,	,	PUNCT
brj-24894	318	35	ballard	ballard	PROPN
brj-24894	318	36	,	,	PUNCT
brj-24894	318	37	a.	a.	PROPN
brj-24894	318	38	j.	j.	PROPN
brj-24894	318	39	,	,	PUNCT
brj-24894	318	40	bambrick	bambrick	PROPN
brj-24894	318	41	,	,	PUNCT
brj-24894	318	42	j.	j.	PROPN
brj-24894	318	43	,	,	PUNCT
brj-24894	318	44	et	et	PROPN
brj-24894	318	45	al	al	PROPN
brj-24894	318	46	.	.	PUNCT
brj-24894	319	1	(	(	PUNCT
brj-24894	319	2	2024	2024	NUM
brj-24894	319	3	)	)	PUNCT
brj-24894	319	4	.	.	PUNCT
brj-24894	320	1	“	"	PUNCT
brj-24894	320	2	accurate	accurate	ADJ
brj-24894	320	3	structure	structure	NOUN
brj-24894	320	4	peer	peer	NOUN
brj-24894	320	5	-	-	PUNCT
brj-24894	320	6	reviewed	review	VERB
brj-24894	320	7	article	article	NOUN
brj-24894	320	8	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	320	9	li	li	PROPN
brj-24894	320	10	et	et	PROPN
brj-24894	320	11	al	al	PROPN
brj-24894	320	12	.	.	PROPN
brj-24894	321	1	(	(	PUNCT
brj-24894	321	2	2026	2026	NUM
brj-24894	321	3	)	)	PUNCT
brj-24894	321	4	.	.	PUNCT
brj-24894	322	1	“	"	PUNCT
brj-24894	322	2	endoglucanase	endoglucanase	VERB
brj-24894	322	3	tpcel12a	tpcel12a	NOUN
brj-24894	322	4	traits	trait	NOUN
brj-24894	322	5	,	,	PUNCT
brj-24894	322	6	”	"	PUNCT
brj-24894	322	7	bioresources	bioresource	NOUN
brj-24894	322	8	21(1	21(1	NUM
brj-24894	322	9	)	)	PUNCT
brj-24894	322	10	,	,	PUNCT
brj-24894	322	11	547	547	NUM
brj-24894	322	12	-	-	SYM
brj-24894	322	13	569	569	NUM
brj-24894	322	14	.	.	PUNCT
brj-24894	323	1	562	562	NUM
brj-24894	323	2	prediction	prediction	NOUN
brj-24894	323	3	of	of	ADP
brj-24894	323	4	biomolecular	biomolecular	ADJ
brj-24894	323	5	interactions	interaction	NOUN
brj-24894	323	6	with	with	ADP
brj-24894	323	7	alphafold	alphafold	ADJ
brj-24894	323	8	3	3	NUM
brj-24894	323	9	,	,	PUNCT
brj-24894	323	10	”	"	PUNCT
brj-24894	323	11	nature	nature	NOUN
brj-24894	323	12	630(8016	630(8016	NUM
brj-24894	323	13	)	)	PUNCT
brj-24894	323	14	,	,	PUNCT
brj-24894	323	15	493500	493500	NUM
brj-24894	323	16	.	.	PUNCT
brj-24894	324	1	https://doi.org/10.1038/s41586-024-07487-w	https://doi.org/10.1038/s41586-024-07487-w	PROPN
brj-24894	324	2	anbarasan	anbarasan	PROPN
brj-24894	324	3	,	,	PUNCT
brj-24894	324	4	s.	s.	PROPN
brj-24894	324	5	,	,	PUNCT
brj-24894	324	6	jänis	jänis	PROPN
brj-24894	324	7	,	,	PUNCT
brj-24894	324	8	j.	j.	PROPN
brj-24894	324	9	,	,	PUNCT
brj-24894	324	10	paloheimo	paloheimo	ADJ
brj-24894	324	11	,	,	PUNCT
brj-24894	324	12	m.	m.	NOUN
brj-24894	324	13	,	,	PUNCT
brj-24894	324	14	laitaoja	laitaoja	NOUN
brj-24894	324	15	,	,	PUNCT
brj-24894	324	16	m.	m.	NOUN
brj-24894	324	17	,	,	PUNCT
brj-24894	324	18	vuolanto	vuolanto	NOUN
brj-24894	324	19	,	,	PUNCT
brj-24894	324	20	m.	m.	NOUN
brj-24894	324	21	,	,	PUNCT
brj-24894	324	22	karimäki	karimäki	PROPN
brj-24894	324	23	,	,	PUNCT
brj-24894	324	24	j.	j.	PROPN
brj-24894	324	25	,	,	PUNCT
brj-24894	324	26	vainiotalo	vainiotalo	PROPN
brj-24894	324	27	,	,	PUNCT
brj-24894	324	28	p.	p.	NOUN
brj-24894	324	29	,	,	PUNCT
brj-24894	324	30	leisola	leisola	PROPN
brj-24894	324	31	,	,	PUNCT
brj-24894	324	32	m.	m.	NOUN
brj-24894	324	33	,	,	PUNCT
brj-24894	324	34	and	and	CCONJ
brj-24894	324	35	turunen	turunen	NOUN
brj-24894	324	36	,	,	PUNCT
brj-24894	324	37	o.	o.	PROPN
brj-24894	324	38	(	(	PUNCT
brj-24894	324	39	2010	2010	NUM
brj-24894	324	40	)	)	PUNCT
brj-24894	324	41	.	.	PUNCT
brj-24894	325	1	“	"	PUNCT
brj-24894	325	2	effect	effect	NOUN
brj-24894	325	3	of	of	ADP
brj-24894	325	4	glycosylation	glycosylation	NOUN
brj-24894	325	5	and	and	CCONJ
brj-24894	325	6	additional	additional	ADJ
brj-24894	325	7	domains	domain	NOUN
brj-24894	325	8	on	on	ADP
brj-24894	325	9	the	the	DET
brj-24894	325	10	thermostability	thermostability	NOUN
brj-24894	325	11	of	of	ADP
brj-24894	325	12	a	a	DET
brj-24894	325	13	family	family	NOUN
brj-24894	325	14	10	10	NUM
brj-24894	325	15	xylanase	xylanase	NOUN
brj-24894	325	16	produced	produce	VERB
brj-24894	325	17	by	by	ADP
brj-24894	325	18	thermopolyspora	thermopolyspora	PROPN
brj-24894	325	19	flexuosa	flexuosa	PROPN
brj-24894	325	20	,	,	PUNCT
brj-24894	325	21	”	"	PUNCT
brj-24894	325	22	appl	appl	NOUN
brj-24894	325	23	.	.	PUNCT
brj-24894	326	1	environ	environ	PROPN
brj-24894	326	2	.	.	PUNCT
brj-24894	326	3	microbiol	microbiol	PROPN
brj-24894	326	4	.	.	PUNCT
brj-24894	327	1	76(1	76(1	NUM
brj-24894	327	2	)	)	PUNCT
brj-24894	327	3	,	,	PUNCT
brj-24894	327	4	356	356	NUM
brj-24894	327	5	-	-	SYM
brj-24894	327	6	360	360	NUM
brj-24894	327	7	.	.	PUNCT
brj-24894	328	1	https://doi.org/10.1128/aem.00357-09	https://doi.org/10.1128/aem.00357-09	NOUN
brj-24894	328	2	cohen	cohen	PROPN
brj-24894	328	3	,	,	PUNCT
brj-24894	328	4	r.	r.	PROPN
brj-24894	328	5	,	,	PUNCT
brj-24894	328	6	suzuki	suzuki	PROPN
brj-24894	328	7	,	,	PUNCT
brj-24894	328	8	m.	m.	PROPN
brj-24894	328	9	r.	r.	PROPN
brj-24894	328	10	,	,	PUNCT
brj-24894	328	11	and	and	CCONJ
brj-24894	328	12	hammel	hammel	PROPN
brj-24894	328	13	,	,	PUNCT
brj-24894	328	14	k.	k.	PROPN
brj-24894	328	15	e.	e.	PROPN
brj-24894	328	16	(	(	PUNCT
brj-24894	328	17	2005	2005	NUM
brj-24894	328	18	)	)	PUNCT
brj-24894	328	19	.	.	PUNCT
brj-24894	329	1	“	"	PUNCT
brj-24894	329	2	processive	processive	ADJ
brj-24894	329	3	endoglucanase	endoglucanase	NOUN
brj-24894	329	4	active	active	ADJ
brj-24894	329	5	in	in	ADP
brj-24894	329	6	crystalline	crystalline	NOUN
brj-24894	329	7	cellulose	cellulose	NOUN
brj-24894	329	8	hydrolysis	hydrolysis	NOUN
brj-24894	329	9	by	by	ADP
brj-24894	329	10	the	the	DET
brj-24894	329	11	brown	brown	ADJ
brj-24894	329	12	rot	rot	VERB
brj-24894	329	13	basidiomycete	basidiomycete	PROPN
brj-24894	329	14	gloeophyllum	gloeophyllum	NOUN
brj-24894	329	15	trabeum	trabeum	NOUN
brj-24894	329	16	,	,	PUNCT
brj-24894	329	17	”	"	PUNCT
brj-24894	329	18	appl	appl	NOUN
brj-24894	329	19	.	.	PUNCT
brj-24894	330	1	environ	environ	PROPN
brj-24894	330	2	.	.	PUNCT
brj-24894	330	3	microbiol	microbiol	PROPN
brj-24894	330	4	.	.	PUNCT
brj-24894	331	1	71(5	71(5	NUM
brj-24894	331	2	)	)	PUNCT
brj-24894	331	3	,	,	PUNCT
brj-24894	331	4	2412	2412	NUM
brj-24894	331	5	-	-	SYM
brj-24894	331	6	2417	2417	NUM
brj-24894	331	7	.	.	PUNCT
brj-24894	332	1	https://doi.org/	https://doi.org/	VERB
brj-24894	332	2	10.1128	10.1128	NUM
brj-24894	332	3	/	/	SYM
brj-24894	332	4	aem.71.5.2412	aem.71.5.2412	ADJ
brj-24894	332	5	-	-	ADJ
brj-24894	332	6	2417.2005	2417.2005	ADJ
brj-24894	332	7	cotana	cotana	PROPN
brj-24894	332	8	,	,	PUNCT
brj-24894	332	9	f.	f.	PROPN
brj-24894	332	10	,	,	PUNCT
brj-24894	332	11	cavalaglio	cavalaglio	PROPN
brj-24894	332	12	,	,	PUNCT
brj-24894	332	13	g.	g.	PROPN
brj-24894	332	14	,	,	PUNCT
brj-24894	332	15	gelosia	gelosia	NOUN
brj-24894	332	16	,	,	PUNCT
brj-24894	332	17	m.	m.	NOUN
brj-24894	332	18	,	,	PUNCT
brj-24894	332	19	nicolini	nicolini	PROPN
brj-24894	332	20	,	,	PUNCT
brj-24894	332	21	a.	a.	NOUN
brj-24894	332	22	,	,	PUNCT
brj-24894	332	23	coccia	coccia	NOUN
brj-24894	332	24	,	,	PUNCT
brj-24894	332	25	v.	v.	ADV
brj-24894	332	26	,	,	PUNCT
brj-24894	332	27	and	and	CCONJ
brj-24894	332	28	petrozzi	petrozzi	PROPN
brj-24894	332	29	,	,	PUNCT
brj-24894	332	30	a.	a.	NOUN
brj-24894	332	31	(	(	PUNCT
brj-24894	332	32	2014	2014	NUM
brj-24894	332	33	)	)	PUNCT
brj-24894	332	34	.	.	PUNCT
brj-24894	333	1	“	"	PUNCT
brj-24894	333	2	production	production	NOUN
brj-24894	333	3	of	of	ADP
brj-24894	333	4	bioethanol	bioethanol	NOUN
brj-24894	333	5	in	in	ADP
brj-24894	333	6	a	a	DET
brj-24894	333	7	second	second	ADJ
brj-24894	333	8	generation	generation	NOUN
brj-24894	333	9	prototype	prototype	NOUN
brj-24894	333	10	from	from	ADP
brj-24894	333	11	pine	pine	ADJ
brj-24894	333	12	wood	wood	NOUN
brj-24894	333	13	chips	chip	NOUN
brj-24894	333	14	,	,	PUNCT
brj-24894	333	15	”	"	PUNCT
brj-24894	333	16	energy	energy	NOUN
brj-24894	333	17	procedia	procedia	NOUN
brj-24894	333	18	45	45	NUM
brj-24894	333	19	,	,	PUNCT
brj-24894	333	20	42	42	NUM
brj-24894	333	21	-	-	SYM
brj-24894	333	22	51	51	NUM
brj-24894	333	23	.	.	PUNCT
brj-24894	334	1	https://doi.org/10.1016/j.egypro.2014.01.006	https://doi.org/10.1016/j.egypro.2014.01.006	ADJ
brj-24894	334	2	damásio	damásio	NOUN
brj-24894	334	3	,	,	PUNCT
brj-24894	334	4	a.	a.	PROPN
brj-24894	334	5	r.	r.	PROPN
brj-24894	334	6	,	,	PUNCT
brj-24894	334	7	rubio	rubio	NOUN
brj-24894	334	8	,	,	PUNCT
brj-24894	334	9	m.	m.	NOUN
brj-24894	335	1	v.	v.	PROPN
brj-24894	335	2	,	,	PUNCT
brj-24894	335	3	oliveira	oliveira	PROPN
brj-24894	335	4	,	,	PUNCT
brj-24894	335	5	l.	l.	PROPN
brj-24894	335	6	c.	c.	PROPN
brj-24894	335	7	,	,	PUNCT
brj-24894	335	8	segato	segato	PROPN
brj-24894	335	9	,	,	PUNCT
brj-24894	335	10	f.	f.	PROPN
brj-24894	335	11	,	,	PUNCT
brj-24894	335	12	dias	dias	PROPN
brj-24894	335	13	,	,	PUNCT
brj-24894	335	14	b.	b.	PROPN
brj-24894	335	15	a.	a.	PROPN
brj-24894	335	16	,	,	PUNCT
brj-24894	335	17	citadini	citadini	PROPN
brj-24894	335	18	,	,	PUNCT
brj-24894	335	19	a.	a.	NOUN
brj-24894	335	20	p.	p.	NOUN
brj-24894	335	21	,	,	PUNCT
brj-24894	335	22	paixão	paixão	PROPN
brj-24894	335	23	,	,	PUNCT
brj-24894	335	24	d.	d.	PROPN
brj-24894	335	25	a.	a.	PROPN
brj-24894	335	26	,	,	PUNCT
brj-24894	335	27	and	and	CCONJ
brj-24894	335	28	squina	squina	PROPN
brj-24894	335	29	,	,	PUNCT
brj-24894	335	30	f.	f.	PROPN
brj-24894	335	31	m.	m.	PROPN
brj-24894	335	32	(	(	PUNCT
brj-24894	335	33	2014	2014	NUM
brj-24894	335	34	)	)	PUNCT
brj-24894	335	35	.	.	PUNCT
brj-24894	336	1	“	"	PUNCT
brj-24894	336	2	understanding	understand	VERB
brj-24894	336	3	the	the	DET
brj-24894	336	4	function	function	NOUN
brj-24894	336	5	of	of	ADP
brj-24894	336	6	conserved	conserved	ADJ
brj-24894	336	7	variations	variation	NOUN
brj-24894	336	8	in	in	ADP
brj-24894	336	9	the	the	DET
brj-24894	336	10	catalytic	catalytic	ADJ
brj-24894	336	11	loops	loop	NOUN
brj-24894	336	12	of	of	ADP
brj-24894	336	13	fungal	fungal	ADJ
brj-24894	336	14	glycoside	glycoside	NOUN
brj-24894	336	15	hydrolase	hydrolase	NOUN
brj-24894	336	16	family	family	NOUN
brj-24894	336	17	12	12	NUM
brj-24894	336	18	,	,	PUNCT
brj-24894	336	19	”	"	PUNCT
brj-24894	336	20	biotechnol	biotechnol	NOUN
brj-24894	336	21	.	.	PUNCT
brj-24894	337	1	bioeng	bioeng	PROPN
brj-24894	337	2	.	.	PUNCT
brj-24894	338	1	111(8	111(8	NUM
brj-24894	338	2	)	)	PUNCT
brj-24894	338	3	,	,	PUNCT
brj-24894	338	4	1494	1494	NUM
brj-24894	338	5	-	-	SYM
brj-24894	338	6	1505	1505	NUM
brj-24894	338	7	.	.	PUNCT
brj-24894	339	1	https://doi.org/10.1002/bit.25209	https://doi.org/10.1002/bit.25209	PROPN
brj-24894	339	2	de	de	PROPN
brj-24894	339	3	almeida	almeida	PROPN
brj-24894	339	4	,	,	PUNCT
brj-24894	339	5	m.	m.	NOUN
brj-24894	339	6	n.	n.	PROPN
brj-24894	339	7	,	,	PUNCT
brj-24894	339	8	falkoski	falkoski	PROPN
brj-24894	339	9	,	,	PUNCT
brj-24894	339	10	d.	d.	PROPN
brj-24894	339	11	l.	l.	PROPN
brj-24894	339	12	,	,	PUNCT
brj-24894	339	13	guimarães	guimarães	PROPN
brj-24894	339	14	,	,	PUNCT
brj-24894	339	15	v.	v.	ADP
brj-24894	339	16	m.	m.	PROPN
brj-24894	339	17	,	,	PUNCT
brj-24894	339	18	ramos	ramos	PROPN
brj-24894	339	19	,	,	PUNCT
brj-24894	339	20	h.	h.	PROPN
brj-24894	339	21	j.	j.	PROPN
brj-24894	339	22	,	,	PUNCT
brj-24894	339	23	visser	visser	PROPN
brj-24894	339	24	,	,	PUNCT
brj-24894	339	25	e.	e.	PROPN
brj-24894	339	26	m.	m.	PROPN
brj-24894	339	27	,	,	PUNCT
brj-24894	339	28	maitan	maitan	PROPN
brj-24894	339	29	-	-	PUNCT
brj-24894	339	30	alfenas	alfenas	PROPN
brj-24894	339	31	,	,	PUNCT
brj-24894	339	32	g.	g.	PROPN
brj-24894	339	33	p.	p.	PROPN
brj-24894	339	34	,	,	PUNCT
brj-24894	339	35	and	and	CCONJ
brj-24894	339	36	de	de	ADP
brj-24894	339	37	rezende	rezende	PROPN
brj-24894	339	38	,	,	PUNCT
brj-24894	339	39	s.	s.	PROPN
brj-24894	339	40	t.	t.	PROPN
brj-24894	339	41	(	(	PUNCT
brj-24894	339	42	2013	2013	NUM
brj-24894	339	43	)	)	PUNCT
brj-24894	339	44	.	.	PUNCT
brj-24894	340	1	"	"	PUNCT
brj-24894	340	2	characteristics	characteristic	NOUN
brj-24894	340	3	of	of	ADP
brj-24894	340	4	free	free	ADJ
brj-24894	340	5	endoglucanase	endoglucanase	NOUN
brj-24894	340	6	and	and	CCONJ
brj-24894	340	7	glycosidases	glycosidase	VERB
brj-24894	340	8	multienzyme	multienzyme	NOUN
brj-24894	340	9	complex	complex	ADJ
brj-24894	340	10	from	from	ADP
brj-24894	340	11	fusarium	fusarium	NOUN
brj-24894	340	12	verticillioides	verticillioide	NOUN
brj-24894	340	13	,	,	PUNCT
brj-24894	340	14	"	"	PUNCT
brj-24894	340	15	bioresour	bioresour	PROPN
brj-24894	340	16	.	.	PUNCT
brj-24894	340	17	technol	technol	PROPN
brj-24894	340	18	.	.	PUNCT
brj-24894	340	19	143	143	NUM
brj-24894	340	20	,	,	PUNCT
brj-24894	340	21	413	413	NUM
brj-24894	340	22	-	-	SYM
brj-24894	340	23	22	22	NUM
brj-24894	340	24	.	.	PUNCT
brj-24894	341	1	https://doi.org/10.1016/j.biortech.2013.06.021	https://doi.org/10.1016/j.biortech.2013.06.021	PROPN
brj-24894	341	2	dobrev	dobrev	PROPN
brj-24894	341	3	,	,	PUNCT
brj-24894	341	4	g.	g.	PROPN
brj-24894	341	5	t.	t.	PROPN
brj-24894	341	6	,	,	PUNCT
brj-24894	341	7	and	and	CCONJ
brj-24894	341	8	zhekova	zhekova	PROPN
brj-24894	341	9	,	,	PUNCT
brj-24894	341	10	b.	b.	PROPN
brj-24894	341	11	y.	y.	PROPN
brj-24894	341	12	(	(	PUNCT
brj-24894	341	13	2012	2012	NUM
brj-24894	341	14	)	)	PUNCT
brj-24894	341	15	.	.	PUNCT
brj-24894	342	1	“	"	PUNCT
brj-24894	342	2	biosynthesis	biosynthesis	NOUN
brj-24894	342	3	,	,	PUNCT
brj-24894	342	4	purification	purification	NOUN
brj-24894	342	5	and	and	CCONJ
brj-24894	342	6	characterization	characterization	NOUN
brj-24894	342	7	of	of	ADP
brj-24894	342	8	endoglucanase	endoglucanase	NOUN
brj-24894	342	9	from	from	ADP
brj-24894	342	10	a	a	DET
brj-24894	342	11	xylanase	xylanase	NOUN
brj-24894	342	12	producing	produce	VERB
brj-24894	342	13	strain	strain	NOUN
brj-24894	342	14	aspergillus	aspergillus	NOUN
brj-24894	342	15	niger	niger	NOUN
brj-24894	342	16	b03	b03	NOUN
brj-24894	342	17	,	,	PUNCT
brj-24894	342	18	”	"	PUNCT
brj-24894	342	19	braz	braz	PROPN
brj-24894	342	20	.	.	PUNCT
brj-24894	343	1	j.	j.	PROPN
brj-24894	343	2	microbiol	microbiol	PROPN
brj-24894	343	3	.	.	PUNCT
brj-24894	344	1	43(1	43(1	X
brj-24894	344	2	)	)	PUNCT
brj-24894	344	3	,	,	PUNCT
brj-24894	344	4	70	70	NUM
brj-24894	344	5	-	-	SYM
brj-24894	344	6	77	77	NUM
brj-24894	344	7	.	.	PUNCT
brj-24894	345	1	https://doi.org/10.1590/s151783822012000100008	https://doi.org/10.1590/s151783822012000100008	NOUN
brj-24894	345	2	drula	drula	NOUN
brj-24894	345	3	,	,	PUNCT
brj-24894	345	4	e.	e.	PROPN
brj-24894	345	5	,	,	PUNCT
brj-24894	345	6	garron	garron	NOUN
brj-24894	345	7	,	,	PUNCT
brj-24894	345	8	m.	m.	NOUN
brj-24894	345	9	l.	l.	PROPN
brj-24894	345	10	,	,	PUNCT
brj-24894	345	11	dogan	dogan	PROPN
brj-24894	345	12	,	,	PUNCT
brj-24894	345	13	s.	s.	PROPN
brj-24894	345	14	,	,	PUNCT
brj-24894	345	15	lombard	lombard	PROPN
brj-24894	345	16	,	,	PUNCT
brj-24894	345	17	v.	v.	ADV
brj-24894	345	18	,	,	PUNCT
brj-24894	345	19	henrissat	henrissat	NOUN
brj-24894	345	20	,	,	PUNCT
brj-24894	345	21	b.	b.	PROPN
brj-24894	345	22	,	,	PUNCT
brj-24894	345	23	and	and	CCONJ
brj-24894	345	24	terrapon	terrapon	ADV
brj-24894	345	25	,	,	PUNCT
brj-24894	345	26	n.	n.	NOUN
brj-24894	345	27	(	(	PUNCT
brj-24894	345	28	2022	2022	NUM
brj-24894	345	29	)	)	PUNCT
brj-24894	345	30	.	.	PUNCT
brj-24894	346	1	“	"	PUNCT
brj-24894	346	2	the	the	DET
brj-24894	346	3	carbohydrate	carbohydrate	NOUN
brj-24894	346	4	-	-	PUNCT
brj-24894	346	5	active	active	ADJ
brj-24894	346	6	enzyme	enzyme	NOUN
brj-24894	346	7	database	database	NOUN
brj-24894	346	8	:	:	PUNCT
brj-24894	346	9	functions	function	NOUN
brj-24894	346	10	and	and	CCONJ
brj-24894	346	11	literature	literature	NOUN
brj-24894	346	12	,	,	PUNCT
brj-24894	346	13	”	"	PUNCT
brj-24894	346	14	nucleic	nucleic	ADJ
brj-24894	346	15	acids	acid	NOUN
brj-24894	346	16	res	re	NOUN
brj-24894	346	17	.	.	PROPN
brj-24894	346	18	50(d1	50(d1	NUM
brj-24894	346	19	)	)	PUNCT
brj-24894	346	20	,	,	PUNCT
brj-24894	346	21	d571	d571	PROPN
brj-24894	346	22	-	-	PUNCT
brj-24894	346	23	d577	d577	PROPN
brj-24894	346	24	.	.	PUNCT
brj-24894	347	1	https://doi.org/10.1093/nar/gkab1045	https://doi.org/10.1093/nar/gkab1045	PROPN
brj-24894	347	2	ejaz	ejaz	PROPN
brj-24894	347	3	,	,	PUNCT
brj-24894	347	4	u.	u.	PROPN
brj-24894	347	5	,	,	PUNCT
brj-24894	347	6	sohail	sohail	PROPN
brj-24894	347	7	,	,	PUNCT
brj-24894	347	8	m.	m.	NOUN
brj-24894	347	9	,	,	PUNCT
brj-24894	347	10	and	and	CCONJ
brj-24894	347	11	ghanemi	ghanemi	PROPN
brj-24894	347	12	,	,	PUNCT
brj-24894	347	13	a.	a.	NOUN
brj-24894	347	14	(	(	PUNCT
brj-24894	347	15	2021	2021	NUM
brj-24894	347	16	)	)	PUNCT
brj-24894	347	17	.	.	PUNCT
brj-24894	348	1	“	"	PUNCT
brj-24894	348	2	cellulases	cellulase	NOUN
brj-24894	348	3	:	:	PUNCT
brj-24894	348	4	from	from	ADP
brj-24894	348	5	bioactivity	bioactivity	NOUN
brj-24894	348	6	to	to	ADP
brj-24894	348	7	a	a	DET
brj-24894	348	8	variety	variety	NOUN
brj-24894	348	9	of	of	ADP
brj-24894	348	10	industrial	industrial	ADJ
brj-24894	348	11	applications	application	NOUN
brj-24894	348	12	,	,	PUNCT
brj-24894	348	13	”	"	PUNCT
brj-24894	348	14	biomimetics	biomimetic	NOUN
brj-24894	348	15	6(3	6(3	NUM
brj-24894	348	16	)	)	PUNCT
brj-24894	348	17	,	,	PUNCT
brj-24894	348	18	article	article	NOUN
brj-24894	348	19	44	44	NUM
brj-24894	348	20	.	.	PUNCT
brj-24894	349	1	https://doi.org/10.3390/biomimetics6030044	https://doi.org/10.3390/biomimetics6030044	PROPN
brj-24894	349	2	fang	fang	PROPN
brj-24894	349	3	,	,	PUNCT
brj-24894	349	4	x.	x.	PROPN
brj-24894	349	5	,	,	PUNCT
brj-24894	349	6	yano	yano	PROPN
brj-24894	349	7	,	,	PUNCT
brj-24894	349	8	s.	s.	PROPN
brj-24894	349	9	,	,	PUNCT
brj-24894	349	10	inoue	inoue	PROPN
brj-24894	349	11	,	,	PUNCT
brj-24894	349	12	h.	h.	PROPN
brj-24894	349	13	,	,	PUNCT
brj-24894	349	14	and	and	CCONJ
brj-24894	349	15	sawayama	sawayama	PROPN
brj-24894	349	16	,	,	PUNCT
brj-24894	349	17	s.	s.	PROPN
brj-24894	349	18	(	(	PUNCT
brj-24894	349	19	2008	2008	NUM
brj-24894	349	20	)	)	PUNCT
brj-24894	349	21	.	.	PUNCT
brj-24894	350	1	“	"	PUNCT
brj-24894	350	2	lactose	lactose	NOUN
brj-24894	350	3	enhances	enhance	VERB
brj-24894	350	4	cellulase	cellulase	NOUN
brj-24894	350	5	production	production	NOUN
brj-24894	350	6	by	by	ADP
brj-24894	350	7	the	the	DET
brj-24894	350	8	filamentous	filamentous	ADJ
brj-24894	350	9	fungus	fungus	NOUN
brj-24894	350	10	acremonium	acremonium	NOUN
brj-24894	350	11	cellulolyticus	cellulolyticus	NOUN
brj-24894	350	12	,	,	PUNCT
brj-24894	350	13	”	"	PUNCT
brj-24894	350	14	j.	j.	PROPN
brj-24894	350	15	biosci	biosci	PROPN
brj-24894	350	16	.	.	PUNCT
brj-24894	351	1	bioeng	bioeng	PROPN
brj-24894	351	2	.	.	PUNCT
brj-24894	352	1	106(2	106(2	NUM
brj-24894	352	2	)	)	PUNCT
brj-24894	352	3	,	,	PUNCT
brj-24894	352	4	115	115	NUM
brj-24894	352	5	-	-	SYM
brj-24894	352	6	120	120	NUM
brj-24894	352	7	.	.	PUNCT
brj-24894	353	1	https://doi.org/10.1263/jbb.106.115	https://doi.org/10.1263/jbb.106.115	PROPN
brj-24894	353	2	gouet	gouet	PROPN
brj-24894	353	3	,	,	PUNCT
brj-24894	353	4	p.	p.	PROPN
brj-24894	353	5	,	,	PUNCT
brj-24894	353	6	robert	robert	PROPN
brj-24894	353	7	,	,	PUNCT
brj-24894	353	8	x.	x.	NOUN
brj-24894	353	9	,	,	PUNCT
brj-24894	353	10	and	and	CCONJ
brj-24894	353	11	courcelle	courcelle	NOUN
brj-24894	353	12	,	,	PUNCT
brj-24894	353	13	e.	e.	PROPN
brj-24894	353	14	(	(	PUNCT
brj-24894	353	15	2003	2003	NUM
brj-24894	353	16	)	)	PUNCT
brj-24894	353	17	.	.	PUNCT
brj-24894	354	1	“	"	PUNCT
brj-24894	354	2	espript	espript	ADJ
brj-24894	354	3	/	/	SYM
brj-24894	354	4	endscript	endscript	NOUN
brj-24894	354	5	:	:	PUNCT
brj-24894	354	6	extracting	extract	VERB
brj-24894	354	7	and	and	CCONJ
brj-24894	354	8	rendering	render	VERB
brj-24894	354	9	sequence	sequence	NOUN
brj-24894	354	10	and	and	CCONJ
brj-24894	354	11	3d	3d	NUM
brj-24894	354	12	information	information	NOUN
brj-24894	354	13	from	from	ADP
brj-24894	354	14	atomic	atomic	ADJ
brj-24894	354	15	structures	structure	NOUN
brj-24894	354	16	of	of	ADP
brj-24894	354	17	proteins	protein	NOUN
brj-24894	354	18	,	,	PUNCT
brj-24894	354	19	”	"	PUNCT
brj-24894	354	20	nucleic	nucleic	ADJ
brj-24894	354	21	acids	acid	NOUN
brj-24894	354	22	res	re	NOUN
brj-24894	354	23	.	.	PUNCT
brj-24894	355	1	31(13	31(13	NUM
brj-24894	355	2	)	)	PUNCT
brj-24894	355	3	,	,	PUNCT
brj-24894	355	4	3320	3320	NUM
brj-24894	355	5	-	-	SYM
brj-24894	355	6	3323	3323	NUM
brj-24894	355	7	.	.	PUNCT
brj-24894	356	1	https://doi.org/10.1093/nar/gkg556	https://doi.org/10.1093/nar/gkg556	NOUN
brj-24894	356	2	guo	guo	PROPN
brj-24894	356	3	,	,	PUNCT
brj-24894	356	4	x.	x.	PROPN
brj-24894	356	5	,	,	PUNCT
brj-24894	356	6	an	an	PRON
brj-24894	356	7	,	,	PUNCT
brj-24894	356	8	y.	y.	PROPN
brj-24894	356	9	,	,	PUNCT
brj-24894	356	10	jiang	jiang	PROPN
brj-24894	356	11	,	,	PUNCT
brj-24894	356	12	l.	l.	PROPN
brj-24894	356	13	,	,	PUNCT
brj-24894	356	14	zhang	zhang	PROPN
brj-24894	356	15	,	,	PUNCT
brj-24894	356	16	j.	j.	PROPN
brj-24894	356	17	,	,	PUNCT
brj-24894	356	18	lu	lu	PROPN
brj-24894	356	19	,	,	PUNCT
brj-24894	356	20	f.	f.	PROPN
brj-24894	356	21	,	,	PUNCT
brj-24894	356	22	and	and	CCONJ
brj-24894	356	23	liu	liu	PROPN
brj-24894	356	24	,	,	PUNCT
brj-24894	356	25	f.	f.	PROPN
brj-24894	356	26	(	(	PUNCT
brj-24894	356	27	2022	2022	NUM
brj-24894	356	28	)	)	PUNCT
brj-24894	356	29	.	.	PUNCT
brj-24894	357	1	“	"	PUNCT
brj-24894	357	2	the	the	DET
brj-24894	357	3	discovery	discovery	NOUN
brj-24894	357	4	and	and	CCONJ
brj-24894	357	5	enzymatic	enzymatic	ADJ
brj-24894	357	6	characterization	characterization	NOUN
brj-24894	357	7	of	of	ADP
brj-24894	357	8	a	a	DET
brj-24894	357	9	novel	novel	NOUN
brj-24894	357	10	aa10	aa10	PROPN
brj-24894	357	11	lpmo	lpmo	NOUN
brj-24894	357	12	from	from	ADP
brj-24894	357	13	bacillus	bacillus	NOUN
brj-24894	357	14	amyloliquefaciens	amyloliquefacien	NOUN
brj-24894	357	15	with	with	ADP
brj-24894	357	16	dual	dual	ADJ
brj-24894	357	17	substrate	substrate	NOUN
brj-24894	357	18	specificity	specificity	NOUN
brj-24894	357	19	,	,	PUNCT
brj-24894	357	20	”	"	PUNCT
brj-24894	357	21	int	int	NOUN
brj-24894	357	22	.	.	PUNCT
brj-24894	358	1	j.	j.	PROPN
brj-24894	358	2	biol	biol	PROPN
brj-24894	358	3	.	.	PUNCT
brj-24894	359	1	macromol	macromol	PROPN
brj-24894	359	2	.	.	PROPN
brj-24894	359	3	203	203	NUM
brj-24894	359	4	,	,	PUNCT
brj-24894	359	5	457	457	NUM
brj-24894	359	6	-	-	SYM
brj-24894	359	7	465	465	NUM
brj-24894	359	8	.	.	PUNCT
brj-24894	360	1	https://doi.org/10.1016/j.ijbiomac.2022.01.110	https://doi.org/10.1016/j.ijbiomac.2022.01.110	PROPN
brj-24894	360	2	gupta	gupta	PROPN
brj-24894	360	3	,	,	PUNCT
brj-24894	360	4	r.	r.	PROPN
brj-24894	360	5	,	,	PUNCT
brj-24894	360	6	and	and	CCONJ
brj-24894	360	7	brunak	brunak	NOUN
brj-24894	360	8	,	,	PUNCT
brj-24894	360	9	s.	s.	PROPN
brj-24894	360	10	(	(	PUNCT
brj-24894	360	11	2002	2002	NUM
brj-24894	360	12	)	)	PUNCT
brj-24894	360	13	.	.	PUNCT
brj-24894	361	1	“	"	PUNCT
brj-24894	361	2	prediction	prediction	NOUN
brj-24894	361	3	of	of	ADP
brj-24894	361	4	glycosylation	glycosylation	NOUN
brj-24894	361	5	across	across	ADP
brj-24894	361	6	the	the	DET
brj-24894	361	7	human	human	ADJ
brj-24894	361	8	proteome	proteome	NOUN
brj-24894	361	9	and	and	CCONJ
brj-24894	361	10	the	the	DET
brj-24894	361	11	correlation	correlation	NOUN
brj-24894	361	12	to	to	ADP
brj-24894	361	13	protein	protein	NOUN
brj-24894	361	14	function	function	NOUN
brj-24894	361	15	,	,	PUNCT
brj-24894	361	16	”	"	PUNCT
brj-24894	361	17	pac	pac	PROPN
brj-24894	361	18	.	.	PROPN
brj-24894	361	19	symp	symp	PROPN
brj-24894	361	20	.	.	PUNCT
brj-24894	362	1	biocomput	biocomput	NOUN
brj-24894	362	2	.	.	PUNCT
brj-24894	363	1	310	310	NUM
brj-24894	363	2	-	-	SYM
brj-24894	363	3	322	322	NUM
brj-24894	363	4	.	.	PUNCT
brj-24894	364	1	https://doi.org/10.1038/s41586-024-07487-w	https://doi.org/10.1038/s41586-024-07487-w	NOUN
brj-24894	364	2	https://doi.org/10.1128/aem.00357-09	https://doi.org/10.1128/aem.00357-09	PROPN
brj-24894	364	3	https://doi.org/10.1016/j.egypro.2014.01.006	https://doi.org/10.1016/j.egypro.2014.01.006	ADJ
brj-24894	364	4	https://doi.org/10.1002/bit.25209	https://doi.org/10.1002/bit.25209	PROPN
brj-24894	364	5	https://doi.org/10.1016/j.biortech.2013.06.021	https://doi.org/10.1016/j.biortech.2013.06.021	PROPN
brj-24894	364	6	https://doi.org/10.1590/s1517-83822012000100008	https://doi.org/10.1590/s1517-83822012000100008	NOUN
brj-24894	364	7	https://doi.org/10.1590/s1517-83822012000100008	https://doi.org/10.1590/s1517-83822012000100008	PROPN
brj-24894	364	8	https://doi.org/10.1093/nar/gkab1045	https://doi.org/10.1093/nar/gkab1045	PROPN
brj-24894	364	9	https://doi.org/10.3390/biomimetics6030044	https://doi.org/10.3390/biomimetics6030044	PROPN
brj-24894	364	10	https://doi.org/10.1263/jbb.106.115	https://doi.org/10.1263/jbb.106.115	PROPN
brj-24894	364	11	https://doi.org/10.1093/nar/gkg556	https://doi.org/10.1093/nar/gkg556	PROPN
brj-24894	364	12	https://doi.org/10.1016/j.ijbiomac.2022.01.110	https://doi.org/10.1016/j.ijbiomac.2022.01.110	PROPN
brj-24894	364	13	peer	peer	NOUN
brj-24894	364	14	-	-	PUNCT
brj-24894	364	15	reviewed	review	VERB
brj-24894	364	16	article	article	NOUN
brj-24894	364	17	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	364	18	li	li	PROPN
brj-24894	364	19	et	et	PROPN
brj-24894	364	20	al	al	PROPN
brj-24894	364	21	.	.	PROPN
brj-24894	365	1	(	(	PUNCT
brj-24894	365	2	2026	2026	NUM
brj-24894	365	3	)	)	PUNCT
brj-24894	365	4	.	.	PUNCT
brj-24894	366	1	“	"	PUNCT
brj-24894	366	2	endoglucanase	endoglucanase	VERB
brj-24894	366	3	tpcel12a	tpcel12a	NOUN
brj-24894	366	4	traits	trait	NOUN
brj-24894	366	5	,	,	PUNCT
brj-24894	366	6	”	"	PUNCT
brj-24894	366	7	bioresources	bioresource	NOUN
brj-24894	366	8	21(1	21(1	NUM
brj-24894	366	9	)	)	PUNCT
brj-24894	366	10	,	,	PUNCT
brj-24894	366	11	547	547	NUM
brj-24894	366	12	-	-	SYM
brj-24894	366	13	569	569	NUM
brj-24894	366	14	.	.	PUNCT
brj-24894	367	1	563	563	NUM
brj-24894	367	2	kumar	kumar	PROPN
brj-24894	367	3	,	,	PUNCT
brj-24894	367	4	s.	s.	PROPN
brj-24894	367	5	,	,	PUNCT
brj-24894	367	6	stecher	stecher	NOUN
brj-24894	367	7	,	,	PUNCT
brj-24894	367	8	g.	g.	PROPN
brj-24894	367	9	,	,	PUNCT
brj-24894	367	10	li	li	PROPN
brj-24894	367	11	,	,	PUNCT
brj-24894	367	12	m.	m.	NOUN
brj-24894	367	13	,	,	PUNCT
brj-24894	367	14	knyaz	knyaz	NOUN
brj-24894	367	15	,	,	PUNCT
brj-24894	367	16	c.	c.	PROPN
brj-24894	367	17	,	,	PUNCT
brj-24894	367	18	and	and	CCONJ
brj-24894	367	19	tamura	tamura	PROPN
brj-24894	367	20	,	,	PUNCT
brj-24894	367	21	k.	k.	PROPN
brj-24894	367	22	(	(	PUNCT
brj-24894	367	23	2018	2018	NUM
brj-24894	367	24	)	)	PUNCT
brj-24894	367	25	.	.	PUNCT
brj-24894	368	1	“	"	PUNCT
brj-24894	368	2	mega	mega	ADJ
brj-24894	368	3	x	x	NOUN
brj-24894	368	4	:	:	PUNCT
brj-24894	368	5	molecular	molecular	ADJ
brj-24894	368	6	evolutionary	evolutionary	ADJ
brj-24894	368	7	genetics	genetic	NOUN
brj-24894	368	8	analysis	analysis	NOUN
brj-24894	368	9	across	across	ADP
brj-24894	368	10	computing	computing	NOUN
brj-24894	368	11	platforms	platform	NOUN
brj-24894	368	12	,	,	PUNCT
brj-24894	368	13	”	"	PUNCT
brj-24894	368	14	mol	mol	NOUN
brj-24894	368	15	.	.	PUNCT
brj-24894	368	16	biol	biol	PROPN
brj-24894	368	17	.	.	PUNCT
brj-24894	369	1	evol	evol	NOUN
brj-24894	369	2	.	.	PUNCT
brj-24894	370	1	35(6	35(6	NUM
brj-24894	370	2	)	)	PUNCT
brj-24894	370	3	,	,	PUNCT
brj-24894	370	4	1547	1547	NUM
brj-24894	370	5	-	-	SYM
brj-24894	370	6	1549	1549	NUM
brj-24894	370	7	.	.	PUNCT
brj-24894	371	1	https://doi.org/10.1093/molbev/msy096	https://doi.org/10.1093/molbev/msy096	NOUN
brj-24894	371	2	lussi	lussi	NOUN
brj-24894	371	3	,	,	PUNCT
brj-24894	371	4	y.	y.	PROPN
brj-24894	371	5	c.	c.	PROPN
brj-24894	371	6	,	,	PUNCT
brj-24894	371	7	magrane	magrane	NOUN
brj-24894	371	8	,	,	PUNCT
brj-24894	371	9	m.	m.	NOUN
brj-24894	371	10	,	,	PUNCT
brj-24894	371	11	martin	martin	PROPN
brj-24894	371	12	,	,	PUNCT
brj-24894	371	13	m.	m.	NOUN
brj-24894	371	14	j.	j.	PROPN
brj-24894	371	15	,	,	PUNCT
brj-24894	371	16	and	and	CCONJ
brj-24894	371	17	orchard	orchard	NOUN
brj-24894	371	18	,	,	PUNCT
brj-24894	371	19	s.	s.	PROPN
brj-24894	371	20	(	(	PUNCT
brj-24894	371	21	2023	2023	NUM
brj-24894	371	22	)	)	PUNCT
brj-24894	371	23	.	.	PUNCT
brj-24894	372	1	“	"	PUNCT
brj-24894	372	2	searching	search	VERB
brj-24894	372	3	and	and	CCONJ
brj-24894	372	4	navigating	navigate	VERB
brj-24894	372	5	uniprot	uniprot	ADJ
brj-24894	372	6	databases	database	NOUN
brj-24894	372	7	,	,	PUNCT
brj-24894	372	8	”	"	PUNCT
brj-24894	372	9	curr	curr	X
brj-24894	372	10	.	.	PUNCT
brj-24894	373	1	protoc	protoc	VERB
brj-24894	373	2	.	.	PUNCT
brj-24894	374	1	3(3	3(3	NUM
brj-24894	374	2	)	)	PUNCT
brj-24894	374	3	,	,	PUNCT
brj-24894	374	4	article	article	NOUN
brj-24894	374	5	e700	e700	PROPN
brj-24894	374	6	.	.	PUNCT
brj-24894	374	7	https://doi.org/10.1002/cpz1.700	https://doi.org/10.1002/cpz1.700	PROPN
brj-24894	374	8	ma	ma	PROPN
brj-24894	374	9	,	,	PUNCT
brj-24894	374	10	j.	j.	PROPN
brj-24894	374	11	,	,	PUNCT
brj-24894	374	12	li	li	PROPN
brj-24894	374	13	,	,	PUNCT
brj-24894	374	14	y.	y.	PROPN
brj-24894	374	15	,	,	PUNCT
brj-24894	374	16	han	han	PROPN
brj-24894	374	17	,	,	PUNCT
brj-24894	374	18	s.	s.	PROPN
brj-24894	374	19	,	,	PUNCT
brj-24894	374	20	jiang	jiang	PROPN
brj-24894	374	21	,	,	PUNCT
brj-24894	374	22	z.	z.	PROPN
brj-24894	374	23	,	,	PUNCT
brj-24894	374	24	yan	yan	PROPN
brj-24894	374	25	,	,	PUNCT
brj-24894	374	26	q.	q.	PROPN
brj-24894	374	27	,	,	PUNCT
brj-24894	374	28	and	and	CCONJ
brj-24894	374	29	yang	yang	PROPN
brj-24894	374	30	,	,	PUNCT
brj-24894	374	31	s.	s.	PROPN
brj-24894	374	32	(	(	PUNCT
brj-24894	374	33	2021	2021	NUM
brj-24894	374	34	)	)	PUNCT
brj-24894	374	35	.	.	PUNCT
brj-24894	375	1	“	"	PUNCT
brj-24894	375	2	structural	structural	ADJ
brj-24894	375	3	and	and	CCONJ
brj-24894	375	4	biochemical	biochemical	ADJ
brj-24894	375	5	insights	insight	NOUN
brj-24894	375	6	into	into	ADP
brj-24894	375	7	the	the	DET
brj-24894	375	8	substrate	substrate	NOUN
brj-24894	375	9	-	-	PUNCT
brj-24894	375	10	binding	bind	VERB
brj-24894	375	11	mechanism	mechanism	NOUN
brj-24894	375	12	of	of	ADP
brj-24894	375	13	a	a	DET
brj-24894	375	14	glycoside	glycoside	NOUN
brj-24894	375	15	hydrolase	hydrolase	NOUN
brj-24894	375	16	family	family	NOUN
brj-24894	375	17	12	12	NUM
brj-24894	375	18	β-1,3	β-1,3	PROPN
brj-24894	375	19	-	-	PUNCT
brj-24894	375	20	1,4	1,4	NUM
brj-24894	375	21	-	-	NOUN
brj-24894	375	22	glucanase	glucanase	NOUN
brj-24894	375	23	from	from	ADP
brj-24894	375	24	chaetomium	chaetomium	NOUN
brj-24894	375	25	sp	sp	PROPN
brj-24894	375	26	.	.	PROPN
brj-24894	375	27	,	,	PUNCT
brj-24894	375	28	”	"	PUNCT
brj-24894	375	29	j.	j.	PROPN
brj-24894	375	30	struct	struct	NOUN
brj-24894	375	31	.	.	PUNCT
brj-24894	376	1	biol	biol	PROPN
brj-24894	376	2	.	.	PUNCT
brj-24894	377	1	213(3	213(3	NUM
brj-24894	377	2	)	)	PUNCT
brj-24894	377	3	,	,	PUNCT
brj-24894	377	4	article	article	NOUN
brj-24894	377	5	107774	107774	NUM
brj-24894	377	6	.	.	PUNCT
brj-24894	378	1	https://doi.org/10.1016/j.jsb.2021.107774	https://doi.org/10.1016/j.jsb.2021.107774	PROPN
brj-24894	378	2	matsuzawa	matsuzawa	PROPN
brj-24894	378	3	,	,	PUNCT
brj-24894	378	4	t.	t.	PROPN
brj-24894	378	5	,	,	PUNCT
brj-24894	378	6	kameyama	kameyama	PROPN
brj-24894	378	7	,	,	PUNCT
brj-24894	378	8	a.	a.	PROPN
brj-24894	378	9	,	,	PUNCT
brj-24894	378	10	nakamichi	nakamichi	NOUN
brj-24894	378	11	,	,	PUNCT
brj-24894	378	12	y.	y.	NOUN
brj-24894	378	13	,	,	PUNCT
brj-24894	378	14	and	and	CCONJ
brj-24894	378	15	yaoi	yaoi	PROPN
brj-24894	378	16	,	,	PUNCT
brj-24894	378	17	k.	k.	PROPN
brj-24894	378	18	(	(	PUNCT
brj-24894	378	19	2020	2020	NUM
brj-24894	378	20	)	)	PUNCT
brj-24894	378	21	.	.	PUNCT
brj-24894	379	1	“	"	PUNCT
brj-24894	379	2	identification	identification	NOUN
brj-24894	379	3	and	and	CCONJ
brj-24894	379	4	characterization	characterization	NOUN
brj-24894	379	5	of	of	ADP
brj-24894	379	6	two	two	NUM
brj-24894	379	7	xyloglucan	xyloglucan	ADJ
brj-24894	379	8	-	-	PUNCT
brj-24894	379	9	specific	specific	ADJ
brj-24894	379	10	endo-1,4	endo-1,4	NOUN
brj-24894	379	11	-	-	PUNCT
brj-24894	379	12	glucanases	glucanase	NOUN
brj-24894	379	13	in	in	ADP
brj-24894	379	14	aspergillus	aspergillus	ADJ
brj-24894	379	15	oryzae	oryzae	NOUN
brj-24894	379	16	,	,	PUNCT
brj-24894	379	17	”	"	PUNCT
brj-24894	379	18	appl	appl	NOUN
brj-24894	379	19	.	.	PUNCT
brj-24894	380	1	microbiol	microbiol	PROPN
brj-24894	380	2	.	.	PUNCT
brj-24894	381	1	biotechnol	biotechnol	NOUN
brj-24894	381	2	.	.	PUNCT
brj-24894	382	1	104(20	104(20	NUM
brj-24894	382	2	)	)	PUNCT
brj-24894	382	3	,	,	PUNCT
brj-24894	382	4	8761	8761	NUM
brj-24894	382	5	-	-	SYM
brj-24894	382	6	8773	8773	NUM
brj-24894	382	7	.	.	PUNCT
brj-24894	383	1	https://doi.org/10.1007/s00253-020-10883-7	https://doi.org/10.1007/s00253-020-10883-7	PROPN
brj-24894	383	2	miller	miller	PROPN
brj-24894	383	3	,	,	PUNCT
brj-24894	383	4	g.	g.	PROPN
brj-24894	383	5	l.	l.	PROPN
brj-24894	383	6	(	(	PUNCT
brj-24894	383	7	1959	1959	NUM
brj-24894	383	8	)	)	PUNCT
brj-24894	383	9	.	.	PUNCT
brj-24894	384	1	“	"	PUNCT
brj-24894	384	2	use	use	NOUN
brj-24894	384	3	of	of	ADP
brj-24894	384	4	dinitrosalicylic	dinitrosalicylic	ADJ
brj-24894	384	5	acid	acid	NOUN
brj-24894	384	6	reagent	reagent	NOUN
brj-24894	384	7	for	for	ADP
brj-24894	384	8	determination	determination	NOUN
brj-24894	384	9	of	of	ADP
brj-24894	384	10	reducing	reduce	VERB
brj-24894	384	11	sugar	sugar	NOUN
brj-24894	384	12	,	,	PUNCT
brj-24894	384	13	”	"	PUNCT
brj-24894	384	14	analytical	analytical	ADJ
brj-24894	384	15	chemistry	chemistry	NOUN
brj-24894	384	16	31(3	31(3	NUM
brj-24894	384	17	)	)	PUNCT
brj-24894	384	18	,	,	PUNCT
brj-24894	384	19	426	426	NUM
brj-24894	384	20	-	-	SYM
brj-24894	384	21	428	428	NUM
brj-24894	384	22	.	.	PUNCT
brj-24894	385	1	https://doi.org/10.1021/ac60147a030	https://doi.org/10.1021/ac60147a030	PROPN
brj-24894	385	2	miotto	miotto	NOUN
brj-24894	385	3	,	,	PUNCT
brj-24894	385	4	l.	l.	PROPN
brj-24894	385	5	s.	s.	PROPN
brj-24894	385	6	,	,	PUNCT
brj-24894	385	7	de	de	PROPN
brj-24894	385	8	rezende	rezende	PROPN
brj-24894	385	9	,	,	PUNCT
brj-24894	385	10	c.	c.	PROPN
brj-24894	385	11	a.	a.	PROPN
brj-24894	385	12	,	,	PUNCT
brj-24894	385	13	bernardes	bernarde	NOUN
brj-24894	385	14	,	,	PUNCT
brj-24894	385	15	a.	a.	PROPN
brj-24894	385	16	,	,	PUNCT
brj-24894	385	17	serpa	serpa	PROPN
brj-24894	385	18	,	,	PUNCT
brj-24894	385	19	v.	v.	PROPN
brj-24894	385	20	i.	i.	PROPN
brj-24894	385	21	,	,	PUNCT
brj-24894	385	22	tsang	tsang	PROPN
brj-24894	385	23	,	,	PUNCT
brj-24894	385	24	a.	a.	PROPN
brj-24894	385	25	,	,	PUNCT
brj-24894	385	26	and	and	CCONJ
brj-24894	385	27	polikarpov	polikarpov	PROPN
brj-24894	385	28	,	,	PUNCT
brj-24894	385	29	i.	i.	PROPN
brj-24894	385	30	(	(	PUNCT
brj-24894	385	31	2014	2014	NUM
brj-24894	385	32	)	)	PUNCT
brj-24894	385	33	.	.	PUNCT
brj-24894	386	1	“	"	PUNCT
brj-24894	386	2	the	the	DET
brj-24894	386	3	characterization	characterization	NOUN
brj-24894	386	4	of	of	ADP
brj-24894	386	5	the	the	DET
brj-24894	386	6	endoglucanase	endoglucanase	NOUN
brj-24894	386	7	cel12a	cel12a	ADJ
brj-24894	386	8	from	from	ADP
brj-24894	386	9	gloeophyllum	gloeophyllum	ADJ
brj-24894	386	10	trabeum	trabeum	NOUN
brj-24894	386	11	reveals	reveal	VERB
brj-24894	386	12	an	an	DET
brj-24894	386	13	enzyme	enzyme	NOUN
brj-24894	386	14	highly	highly	ADV
brj-24894	386	15	active	active	ADJ
brj-24894	386	16	on	on	ADP
brj-24894	386	17	β	β	NOUN
brj-24894	386	18	-	-	NOUN
brj-24894	386	19	glucan	glucan	NOUN
brj-24894	386	20	,	,	PUNCT
brj-24894	386	21	”	"	PUNCT
brj-24894	386	22	plos	plos	PROPN
brj-24894	386	23	one	one	NUM
brj-24894	386	24	9(9	9(9	NUM
brj-24894	386	25	)	)	PUNCT
brj-24894	386	26	,	,	PUNCT
brj-24894	386	27	article	article	NOUN
brj-24894	386	28	e108393	e108393	PROPN
brj-24894	386	29	.	.	PUNCT
brj-24894	387	1	https://doi.org/10.1371/journal.pone.0108393	https://doi.org/10.1371/journal.pone.0108393	PROPN
brj-24894	387	2	narra	narra	PROPN
brj-24894	387	3	,	,	PUNCT
brj-24894	387	4	m.	m.	NOUN
brj-24894	387	5	,	,	PUNCT
brj-24894	387	6	dixit	dixit	PROPN
brj-24894	387	7	,	,	PUNCT
brj-24894	387	8	g.	g.	PROPN
brj-24894	387	9	,	,	PUNCT
brj-24894	387	10	divecha	divecha	PROPN
brj-24894	387	11	,	,	PUNCT
brj-24894	387	12	j.	j.	PROPN
brj-24894	387	13	,	,	PUNCT
brj-24894	387	14	kumar	kumar	PROPN
brj-24894	387	15	,	,	PUNCT
brj-24894	387	16	k.	k.	PROPN
brj-24894	387	17	,	,	PUNCT
brj-24894	387	18	madamwar	madamwar	PROPN
brj-24894	387	19	,	,	PUNCT
brj-24894	387	20	d.	d.	PROPN
brj-24894	387	21	,	,	PUNCT
brj-24894	387	22	and	and	CCONJ
brj-24894	387	23	shah	shah	NOUN
brj-24894	387	24	,	,	PUNCT
brj-24894	387	25	a.	a.	PROPN
brj-24894	387	26	r.	r.	PROPN
brj-24894	387	27	(	(	PUNCT
brj-24894	387	28	2014	2014	NUM
brj-24894	387	29	)	)	PUNCT
brj-24894	387	30	.	.	PUNCT
brj-24894	388	1	“	"	PUNCT
brj-24894	388	2	production	production	NOUN
brj-24894	388	3	,	,	PUNCT
brj-24894	388	4	purification	purification	NOUN
brj-24894	388	5	and	and	CCONJ
brj-24894	388	6	characterization	characterization	NOUN
brj-24894	388	7	of	of	ADP
brj-24894	388	8	a	a	DET
brj-24894	388	9	novel	novel	NOUN
brj-24894	388	10	gh	gh	PROPN
brj-24894	388	11	12	12	NUM
brj-24894	388	12	family	family	NOUN
brj-24894	388	13	endoglucanase	endoglucanase	VERB
brj-24894	388	14	from	from	ADP
brj-24894	388	15	aspergillus	aspergillus	PROPN
brj-24894	388	16	terreus	terreus	NOUN
brj-24894	388	17	and	and	CCONJ
brj-24894	388	18	its	its	PRON
brj-24894	388	19	application	application	NOUN
brj-24894	388	20	in	in	ADP
brj-24894	388	21	enzymatic	enzymatic	ADJ
brj-24894	388	22	degradation	degradation	NOUN
brj-24894	388	23	of	of	ADP
brj-24894	388	24	delignified	delignifie	VERB
brj-24894	388	25	rice	rice	NOUN
brj-24894	388	26	straw	straw	NOUN
brj-24894	388	27	,	,	PUNCT
brj-24894	388	28	”	"	PUNCT
brj-24894	388	29	international	international	ADJ
brj-24894	388	30	biodeterioration	biodeterioration	NOUN
brj-24894	388	31	and	and	CCONJ
brj-24894	388	32	biodegradation	biodegradation	NOUN
brj-24894	388	33	88	88	NUM
brj-24894	388	34	,	,	PUNCT
brj-24894	388	35	150	150	NUM
brj-24894	388	36	-	-	SYM
brj-24894	388	37	161	161	NUM
brj-24894	388	38	.	.	PUNCT
brj-24894	389	1	https://doi.org/10.1016/j.ibiod.2013.12.016	https://doi.org/10.1016/j.ibiod.2013.12.016	PROPN
brj-24894	389	2	ohmiya	ohmiya	PROPN
brj-24894	389	3	,	,	PUNCT
brj-24894	389	4	k.	k.	PROPN
brj-24894	389	5	,	,	PUNCT
brj-24894	389	6	sakka	sakka	NOUN
brj-24894	389	7	,	,	PUNCT
brj-24894	389	8	k.	k.	PROPN
brj-24894	389	9	,	,	PUNCT
brj-24894	389	10	karita	karita	PROPN
brj-24894	389	11	,	,	PUNCT
brj-24894	389	12	s.	s.	PROPN
brj-24894	389	13	,	,	PUNCT
brj-24894	389	14	and	and	CCONJ
brj-24894	389	15	kimura	kimura	NOUN
brj-24894	389	16	,	,	PUNCT
brj-24894	389	17	t.	t.	PROPN
brj-24894	389	18	(	(	PUNCT
brj-24894	389	19	1997	1997	NUM
brj-24894	389	20	)	)	PUNCT
brj-24894	389	21	.	.	PUNCT
brj-24894	390	1	“	"	PUNCT
brj-24894	390	2	structure	structure	NOUN
brj-24894	390	3	of	of	ADP
brj-24894	390	4	cellulases	cellulase	NOUN
brj-24894	390	5	and	and	CCONJ
brj-24894	390	6	their	their	PRON
brj-24894	390	7	applications	application	NOUN
brj-24894	390	8	,	,	PUNCT
brj-24894	390	9	”	"	PUNCT
brj-24894	390	10	biotechnol	biotechnol	NOUN
brj-24894	390	11	.	.	PUNCT
brj-24894	391	1	genet	genet	NOUN
brj-24894	391	2	.	.	PUNCT
brj-24894	392	1	eng	eng	PROPN
brj-24894	392	2	.	.	PROPN
brj-24894	392	3	rev	rev	PROPN
brj-24894	392	4	.	.	PROPN
brj-24894	392	5	14	14	NUM
brj-24894	392	6	,	,	PUNCT
brj-24894	392	7	365	365	NUM
brj-24894	392	8	-	-	SYM
brj-24894	392	9	414	414	NUM
brj-24894	392	10	.	.	PUNCT
brj-24894	393	1	https://doi.org/10.1080/02648725.1997.10647949	https://doi.org/10.1080/02648725.1997.10647949	PROPN
brj-24894	393	2	patel	patel	PROPN
brj-24894	393	3	,	,	PUNCT
brj-24894	393	4	a.	a.	NOUN
brj-24894	393	5	,	,	PUNCT
brj-24894	393	6	and	and	CCONJ
brj-24894	393	7	shah	shah	NOUN
brj-24894	393	8	,	,	PUNCT
brj-24894	393	9	a.	a.	NOUN
brj-24894	393	10	(	(	PUNCT
brj-24894	393	11	2021	2021	NUM
brj-24894	393	12	)	)	PUNCT
brj-24894	393	13	.	.	PUNCT
brj-24894	394	1	“	"	PUNCT
brj-24894	394	2	purification	purification	NOUN
brj-24894	394	3	and	and	CCONJ
brj-24894	394	4	characterization	characterization	NOUN
brj-24894	394	5	of	of	ADP
brj-24894	394	6	novel	novel	NOUN
brj-24894	394	7	,	,	PUNCT
brj-24894	394	8	thermostable	thermostable	NOUN
brj-24894	394	9	and	and	CCONJ
brj-24894	394	10	non	non	ADJ
brj-24894	394	11	-	-	ADJ
brj-24894	394	12	processive	processive	ADJ
brj-24894	394	13	gh5	gh5	NOUN
brj-24894	394	14	family	family	NOUN
brj-24894	394	15	endoglucanase	endoglucanase	VERB
brj-24894	394	16	from	from	ADP
brj-24894	394	17	fomitopsis	fomitopsis	NOUN
brj-24894	394	18	meliae	meliae	PROPN
brj-24894	394	19	cfa	cfa	PROPN
brj-24894	394	20	2	2	NUM
brj-24894	394	21	,	,	PUNCT
brj-24894	394	22	”	"	PUNCT
brj-24894	394	23	int	int	NOUN
brj-24894	394	24	.	.	PUNCT
brj-24894	395	1	j.	j.	PROPN
brj-24894	395	2	biol	biol	PROPN
brj-24894	395	3	.	.	PUNCT
brj-24894	396	1	macromol	macromol	PROPN
brj-24894	396	2	.	.	PROPN
brj-24894	396	3	182	182	NUM
brj-24894	396	4	,	,	PUNCT
brj-24894	396	5	1161	1161	NUM
brj-24894	396	6	-	-	SYM
brj-24894	396	7	1169	1169	NUM
brj-24894	396	8	.	.	PUNCT
brj-24894	397	1	https://doi.org/10.1016/j.ijbiomac.2021.04.110	https://doi.org/10.1016/j.ijbiomac.2021.04.110	PROPN
brj-24894	397	2	periyasamy	periyasamy	NOUN
brj-24894	397	3	,	,	PUNCT
brj-24894	397	4	s.	s.	PROPN
brj-24894	397	5	,	,	PUNCT
brj-24894	397	6	isabel	isabel	PROPN
brj-24894	397	7	,	,	PUNCT
brj-24894	397	8	j.	j.	PROPN
brj-24894	397	9	b.	b.	PROPN
brj-24894	397	10	,	,	PUNCT
brj-24894	397	11	kavitha	kavitha	PROPN
brj-24894	397	12	,	,	PUNCT
brj-24894	397	13	s.	s.	PROPN
brj-24894	397	14	,	,	PUNCT
brj-24894	397	15	karthik	karthik	PROPN
brj-24894	397	16	,	,	PUNCT
brj-24894	397	17	v.	v.	PROPN
brj-24894	397	18	,	,	PUNCT
brj-24894	397	19	mohamed	mohamed	PROPN
brj-24894	397	20	,	,	PUNCT
brj-24894	397	21	b.	b.	PROPN
brj-24894	397	22	a.	a.	PROPN
brj-24894	397	23	,	,	PUNCT
brj-24894	397	24	gizaw	gizaw	PROPN
brj-24894	397	25	,	,	PUNCT
brj-24894	397	26	d.	d.	PROPN
brj-24894	397	27	g.	g.	PROPN
brj-24894	397	28	,	,	PUNCT
brj-24894	397	29	sivashanmugam	sivashanmugam	NOUN
brj-24894	397	30	,	,	PUNCT
brj-24894	397	31	p.	p.	NOUN
brj-24894	397	32	,	,	PUNCT
brj-24894	397	33	and	and	CCONJ
brj-24894	397	34	aminabhavi	aminabhavi	VERB
brj-24894	397	35	,	,	PUNCT
brj-24894	397	36	t.	t.	NOUN
brj-24894	397	37	m.	m.	NOUN
brj-24894	397	38	(	(	PUNCT
brj-24894	397	39	2023	2023	NUM
brj-24894	397	40	)	)	PUNCT
brj-24894	397	41	.	.	PUNCT
brj-24894	398	1	“	"	PUNCT
brj-24894	398	2	recent	recent	ADJ
brj-24894	398	3	advances	advance	NOUN
brj-24894	398	4	in	in	ADP
brj-24894	398	5	consolidated	consolidated	ADJ
brj-24894	398	6	bioprocessing	bioprocessing	NOUN
brj-24894	398	7	for	for	ADP
brj-24894	398	8	conversion	conversion	NOUN
brj-24894	398	9	of	of	ADP
brj-24894	398	10	lignocellulosic	lignocellulosic	ADJ
brj-24894	398	11	biomass	biomass	NOUN
brj-24894	398	12	into	into	ADP
brj-24894	398	13	bioethanol	bioethanol	NOUN
brj-24894	398	14	–	–	PUNCT
brj-24894	398	15	a	a	DET
brj-24894	398	16	review	review	NOUN
brj-24894	398	17	,	,	PUNCT
brj-24894	398	18	”	"	PUNCT
brj-24894	398	19	chemical	chemical	NOUN
brj-24894	398	20	engineering	engineering	NOUN
brj-24894	398	21	journal	journal	PROPN
brj-24894	398	22	453	453	NUM
brj-24894	398	23	,	,	PUNCT
brj-24894	398	24	article	article	NOUN
brj-24894	398	25	139783	139783	NUM
brj-24894	398	26	.	.	PUNCT
brj-24894	399	1	https://doi.org/10.1016/j.cej.2022.139783	https://doi.org/10.1016/j.cej.2022.139783	PROPN
brj-24894	399	2	rykov	rykov	PROPN
brj-24894	399	3	,	,	PUNCT
brj-24894	399	4	s.	s.	PROPN
brj-24894	399	5	v.	v.	PROPN
brj-24894	399	6	,	,	PUNCT
brj-24894	399	7	kornberger	kornberger	NOUN
brj-24894	399	8	,	,	PUNCT
brj-24894	399	9	p.	p.	NOUN
brj-24894	399	10	,	,	PUNCT
brj-24894	399	11	herlet	herlet	NOUN
brj-24894	399	12	,	,	PUNCT
brj-24894	399	13	j.	j.	PROPN
brj-24894	399	14	,	,	PUNCT
brj-24894	399	15	tsurin	tsurin	PROPN
brj-24894	399	16	,	,	PUNCT
brj-24894	399	17	n.	n.	PROPN
brj-24894	399	18	v.	v.	PROPN
brj-24894	399	19	,	,	PUNCT
brj-24894	399	20	zorov	zorov	NOUN
brj-24894	399	21	,	,	PUNCT
brj-24894	399	22	i.	i.	PROPN
brj-24894	399	23	n.	n.	PROPN
brj-24894	399	24	,	,	PUNCT
brj-24894	399	25	zverlov	zverlov	PROPN
brj-24894	399	26	,	,	PUNCT
brj-24894	399	27	v.	v.	PROPN
brj-24894	399	28	v.	v.	ADP
brj-24894	399	29	,	,	PUNCT
brj-24894	399	30	liebl	liebl	PROPN
brj-24894	399	31	,	,	PUNCT
brj-24894	399	32	w.	w.	PROPN
brj-24894	399	33	,	,	PUNCT
brj-24894	399	34	schwarz	schwarz	PROPN
brj-24894	399	35	,	,	PUNCT
brj-24894	399	36	w.	w.	PROPN
brj-24894	399	37	h.	h.	PROPN
brj-24894	399	38	,	,	PUNCT
brj-24894	399	39	yarotsky	yarotsky	PROPN
brj-24894	399	40	,	,	PUNCT
brj-24894	399	41	s.	s.	PROPN
brj-24894	399	42	v.	v.	PROPN
brj-24894	399	43	,	,	PUNCT
brj-24894	399	44	and	and	CCONJ
brj-24894	399	45	berezina	berezina	PROPN
brj-24894	399	46	,	,	PUNCT
brj-24894	399	47	o.	o.	PROPN
brj-24894	399	48	v.	v.	PROPN
brj-24894	399	49	(	(	PUNCT
brj-24894	399	50	2019	2019	NUM
brj-24894	399	51	)	)	PUNCT
brj-24894	399	52	.	.	PUNCT
brj-24894	400	1	“	"	PUNCT
brj-24894	400	2	novel	novel	VERB
brj-24894	400	3	endo-(1,4)-β	endo-(1,4)-β	ADV
brj-24894	400	4	-	-	PUNCT
brj-24894	400	5	glucanase	glucanase	NOUN
brj-24894	400	6	bgh12a	bgh12a	NOUN
brj-24894	400	7	and	and	CCONJ
brj-24894	400	8	xyloglucanase	xyloglucanase	NOUN
brj-24894	400	9	xgh12b	xgh12b	NUM
brj-24894	400	10	from	from	ADP
brj-24894	400	11	aspergillus	aspergillus	PROPN
brj-24894	400	12	cervinus	cervinus	NOUN
brj-24894	400	13	belong	belong	VERB
brj-24894	400	14	to	to	ADP
brj-24894	400	15	gh12	gh12	PROPN
brj-24894	400	16	subgroup	subgroup	NOUN
brj-24894	400	17	i	i	PROPN
brj-24894	400	18	and	and	CCONJ
brj-24894	400	19	ii	ii	PROPN
brj-24894	400	20	,	,	PUNCT
brj-24894	400	21	respectively	respectively	ADV
brj-24894	400	22	,	,	PUNCT
brj-24894	400	23	”	"	PUNCT
brj-24894	400	24	appl	appl	NOUN
brj-24894	400	25	.	.	PUNCT
brj-24894	400	26	microbiol	microbiol	PROPN
brj-24894	400	27	.	.	PUNCT
brj-24894	401	1	biotechnol	biotechnol	PROPN
brj-24894	401	2	.	.	PUNCT
brj-24894	402	1	103(18	103(18	NUM
brj-24894	402	2	)	)	PUNCT
brj-24894	402	3	,	,	PUNCT
brj-24894	402	4	7553	7553	NUM
brj-24894	402	5	-	-	SYM
brj-24894	402	6	7566	7566	NUM
brj-24894	402	7	.	.	PUNCT
brj-24894	403	1	https://doi.org/10.1007/s00253-019-10006-x	https://doi.org/10.1007/s00253-019-10006-x	PROPN
brj-24894	403	2	saldarriaga	saldarriaga	PROPN
brj-24894	403	3	-	-	PUNCT
brj-24894	403	4	hernández	hernández	PROPN
brj-24894	403	5	,	,	PUNCT
brj-24894	403	6	s.	s.	PROPN
brj-24894	403	7	,	,	PUNCT
brj-24894	403	8	velasco	velasco	PROPN
brj-24894	403	9	-	-	PUNCT
brj-24894	403	10	ayala	ayala	PROPN
brj-24894	403	11	,	,	PUNCT
brj-24894	403	12	c.	c.	PROPN
brj-24894	403	13	,	,	PUNCT
brj-24894	403	14	leal	leal	PROPN
brj-24894	403	15	-	-	PUNCT
brj-24894	403	16	isla	isla	PROPN
brj-24894	403	17	flores	flore	NOUN
brj-24894	403	18	,	,	PUNCT
brj-24894	403	19	p.	p.	NOUN
brj-24894	403	20	,	,	PUNCT
brj-24894	403	21	de	de	PROPN
brj-24894	403	22	jesús	jesús	PROPN
brj-24894	403	23	rostroalanis	rostroalanis	PROPN
brj-24894	403	24	,	,	PUNCT
brj-24894	403	25	m.	m.	NOUN
brj-24894	403	26	,	,	PUNCT
brj-24894	403	27	parra	parra	PROPN
brj-24894	403	28	-	-	PUNCT
brj-24894	403	29	saldivar	saldivar	PROPN
brj-24894	403	30	,	,	PUNCT
brj-24894	403	31	r.	r.	PROPN
brj-24894	403	32	,	,	PUNCT
brj-24894	403	33	iqbal	iqbal	PROPN
brj-24894	403	34	,	,	PUNCT
brj-24894	403	35	h.	h.	PROPN
brj-24894	403	36	m.	m.	PROPN
brj-24894	403	37	n.	n.	PROPN
brj-24894	403	38	,	,	PUNCT
brj-24894	403	39	and	and	CCONJ
brj-24894	403	40	carrillo	carrillo	PROPN
brj-24894	403	41	-	-	PUNCT
brj-24894	403	42	nieves	nieve	NOUN
brj-24894	403	43	,	,	PUNCT
brj-24894	403	44	d.	d.	PROPN
brj-24894	403	45	(	(	PUNCT
brj-24894	403	46	2020	2020	NUM
brj-24894	403	47	)	)	PUNCT
brj-24894	403	48	.	.	PUNCT
brj-24894	404	1	“	"	PUNCT
brj-24894	404	2	biotransformation	biotransformation	NOUN
brj-24894	404	3	of	of	ADP
brj-24894	404	4	lignocellulosic	lignocellulosic	ADJ
brj-24894	404	5	biomass	biomass	NOUN
brj-24894	404	6	into	into	ADP
brj-24894	404	7	industrially	industrially	ADV
brj-24894	404	8	relevant	relevant	ADJ
brj-24894	404	9	products	product	NOUN
brj-24894	404	10	with	with	ADP
brj-24894	404	11	the	the	DET
brj-24894	404	12	aid	aid	NOUN
brj-24894	404	13	of	of	ADP
brj-24894	404	14	fungi	fungus	NOUN
brj-24894	404	15	-	-	PUNCT
brj-24894	404	16	derived	derive	VERB
brj-24894	404	17	lignocellulolytic	lignocellulolytic	ADJ
brj-24894	404	18	enzymes	enzyme	NOUN
brj-24894	404	19	,	,	PUNCT
brj-24894	404	20	”	"	PUNCT
brj-24894	404	21	int	int	NOUN
brj-24894	404	22	.	.	PUNCT
brj-24894	405	1	j.	j.	PROPN
brj-24894	405	2	biol	biol	PROPN
brj-24894	405	3	.	.	PUNCT
brj-24894	406	1	macromol	macromol	PROPN
brj-24894	406	2	.	.	PROPN
brj-24894	406	3	161	161	NUM
brj-24894	406	4	,	,	PUNCT
brj-24894	406	5	1099	1099	NUM
brj-24894	406	6	-	-	SYM
brj-24894	406	7	1116	1116	NUM
brj-24894	406	8	.	.	PUNCT
brj-24894	407	1	https://doi.org/10.1016/j.ijbiomac.2020.06.047	https://doi.org/10.1016/j.ijbiomac.2020.06.047	NOUN
brj-24894	407	2	https://doi.org/10.1093/molbev/msy096	https://doi.org/10.1093/molbev/msy096	NOUN
brj-24894	407	3	https://doi.org/10.1002/cpz1.700	https://doi.org/10.1002/cpz1.700	NOUN
brj-24894	407	4	https://doi.org/10.1016/j.jsb.2021.107774	https://doi.org/10.1016/j.jsb.2021.107774	PUNCT
brj-24894	407	5	https://doi.org/10.1007/s00253-020-10883-7	https://doi.org/10.1007/s00253-020-10883-7	PROPN
brj-24894	407	6	https://doi.org/10.1021/ac60147a030	https://doi.org/10.1021/ac60147a030	PROPN
brj-24894	407	7	https://doi.org/10.1371/journal.pone.0108393	https://doi.org/10.1371/journal.pone.0108393	VERB
brj-24894	407	8	https://doi.org/10.1016/j.ibiod.2013.12.016	https://doi.org/10.1016/j.ibiod.2013.12.016	PROPN
brj-24894	407	9	https://doi.org/10.1080/02648725.1997.10647949	https://doi.org/10.1080/02648725.1997.10647949	PROPN
brj-24894	408	1	https://doi.org/10.1016/j.ijbiomac.2021.04.110	https://doi.org/10.1016/j.ijbiomac.2021.04.110	PROPN
brj-24894	408	2	https://doi.org/10.1016/j.cej.2022.139783	https://doi.org/10.1016/j.cej.2022.139783	PROPN
brj-24894	408	3	https://doi.org/10.1007/s00253-019-10006-x	https://doi.org/10.1007/s00253-019-10006-x	NOUN
brj-24894	408	4	https://doi.org/10.1016/j.ijbiomac.2020.06.047	https://doi.org/10.1016/j.ijbiomac.2020.06.047	NUM
brj-24894	408	5	peer	peer	NOUN
brj-24894	408	6	-	-	PUNCT
brj-24894	408	7	reviewed	review	VERB
brj-24894	408	8	article	article	NOUN
brj-24894	408	9	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	408	10	li	li	PROPN
brj-24894	408	11	et	et	PROPN
brj-24894	408	12	al	al	PROPN
brj-24894	408	13	.	.	PROPN
brj-24894	409	1	(	(	PUNCT
brj-24894	409	2	2026	2026	NUM
brj-24894	409	3	)	)	PUNCT
brj-24894	409	4	.	.	PUNCT
brj-24894	410	1	“	"	PUNCT
brj-24894	410	2	endoglucanase	endoglucanase	VERB
brj-24894	410	3	tpcel12a	tpcel12a	NOUN
brj-24894	410	4	traits	trait	NOUN
brj-24894	410	5	,	,	PUNCT
brj-24894	410	6	”	"	PUNCT
brj-24894	410	7	bioresources	bioresource	NOUN
brj-24894	410	8	21(1	21(1	NUM
brj-24894	410	9	)	)	PUNCT
brj-24894	410	10	,	,	PUNCT
brj-24894	410	11	547	547	NUM
brj-24894	410	12	-	-	SYM
brj-24894	410	13	569	569	NUM
brj-24894	410	14	.	.	PUNCT
brj-24894	411	1	564	564	NUM
brj-24894	411	2	schiano	schiano	NOUN
brj-24894	411	3	-	-	PUNCT
brj-24894	411	4	di	di	NOUN
brj-24894	411	5	-	-	PUNCT
brj-24894	411	6	cola	cola	PROPN
brj-24894	411	7	,	,	PUNCT
brj-24894	411	8	c.	c.	PROPN
brj-24894	411	9	,	,	PUNCT
brj-24894	411	10	kołaczkowski	kołaczkowski	PROPN
brj-24894	411	11	,	,	PUNCT
brj-24894	411	12	b.	b.	PROPN
brj-24894	411	13	,	,	PUNCT
brj-24894	411	14	sørensen	sørensen	NOUN
brj-24894	411	15	,	,	PUNCT
brj-24894	411	16	t.	t.	PROPN
brj-24894	411	17	h.	h.	PROPN
brj-24894	411	18	,	,	PUNCT
brj-24894	411	19	christensen	christensen	PROPN
brj-24894	411	20	,	,	PUNCT
brj-24894	411	21	s.	s.	PROPN
brj-24894	411	22	j.	j.	PROPN
brj-24894	411	23	,	,	PUNCT
brj-24894	411	24	cavaleiro	cavaleiro	PROPN
brj-24894	411	25	,	,	PUNCT
brj-24894	411	26	a.	a.	NOUN
brj-24894	411	27	m.	m.	NOUN
brj-24894	411	28	,	,	PUNCT
brj-24894	411	29	windahl	windahl	PROPN
brj-24894	411	30	,	,	PUNCT
brj-24894	411	31	m.	m.	NOUN
brj-24894	411	32	s.	s.	PROPN
brj-24894	411	33	,	,	PUNCT
brj-24894	411	34	borch	borch	PROPN
brj-24894	411	35	,	,	PUNCT
brj-24894	411	36	k.	k.	PROPN
brj-24894	411	37	,	,	PUNCT
brj-24894	411	38	morth	morth	NOUN
brj-24894	411	39	,	,	PUNCT
brj-24894	411	40	j.	j.	PROPN
brj-24894	411	41	p.	p.	PROPN
brj-24894	411	42	,	,	PUNCT
brj-24894	411	43	and	and	CCONJ
brj-24894	411	44	westh	westh	PROPN
brj-24894	411	45	,	,	PUNCT
brj-24894	411	46	p.	p.	NOUN
brj-24894	411	47	(	(	PUNCT
brj-24894	411	48	2020	2020	NUM
brj-24894	411	49	)	)	PUNCT
brj-24894	411	50	.	.	PUNCT
brj-24894	412	1	“	"	PUNCT
brj-24894	412	2	structural	structural	ADJ
brj-24894	412	3	and	and	CCONJ
brj-24894	412	4	biochemical	biochemical	ADJ
brj-24894	412	5	characterization	characterization	NOUN
brj-24894	412	6	of	of	ADP
brj-24894	412	7	a	a	DET
brj-24894	412	8	family	family	NOUN
brj-24894	412	9	7	7	NUM
brj-24894	412	10	highly	highly	ADV
brj-24894	412	11	thermostable	thermostable	ADJ
brj-24894	412	12	endoglucanase	endoglucanase	NOUN
brj-24894	412	13	from	from	ADP
brj-24894	412	14	the	the	DET
brj-24894	412	15	fungus	fungus	NOUN
brj-24894	412	16	rasamsonia	rasamsonia	NOUN
brj-24894	412	17	emersonii	emersonii	PROPN
brj-24894	412	18	,	,	PUNCT
brj-24894	412	19	”	"	PUNCT
brj-24894	412	20	febs	febs	NOUN
brj-24894	412	21	j.	j.	PROPN
brj-24894	412	22	287(12	287(12	NUM
brj-24894	412	23	)	)	PUNCT
brj-24894	412	24	,	,	PUNCT
brj-24894	412	25	2577	2577	NUM
brj-24894	412	26	-	-	SYM
brj-24894	412	27	2596	2596	NUM
brj-24894	412	28	.	.	PUNCT
brj-24894	413	1	https://doi.org/10.1111/febs.15151	https://doi.org/10.1111/febs.15151	PROPN
brj-24894	413	2	sharma	sharma	PROPN
brj-24894	413	3	,	,	PUNCT
brj-24894	413	4	h.	h.	PROPN
brj-24894	413	5	k.	k.	PROPN
brj-24894	413	6	,	,	PUNCT
brj-24894	413	7	xu	xu	PROPN
brj-24894	413	8	,	,	PUNCT
brj-24894	413	9	c.	c.	PROPN
brj-24894	413	10	,	,	PUNCT
brj-24894	413	11	and	and	CCONJ
brj-24894	413	12	qin	qin	INTJ
brj-24894	413	13	,	,	PUNCT
brj-24894	413	14	w.	w.	PROPN
brj-24894	413	15	(	(	PUNCT
brj-24894	413	16	2019	2019	NUM
brj-24894	413	17	)	)	PUNCT
brj-24894	413	18	.	.	PUNCT
brj-24894	414	1	“	"	PUNCT
brj-24894	414	2	biological	biological	ADJ
brj-24894	414	3	pretreatment	pretreatment	NOUN
brj-24894	414	4	of	of	ADP
brj-24894	414	5	lignocellulosic	lignocellulosic	ADJ
brj-24894	414	6	biomass	biomass	NOUN
brj-24894	414	7	for	for	ADP
brj-24894	414	8	biofuels	biofuel	NOUN
brj-24894	414	9	and	and	CCONJ
brj-24894	414	10	bioproducts	bioproduct	NOUN
brj-24894	414	11	:	:	PUNCT
brj-24894	414	12	an	an	DET
brj-24894	414	13	overview	overview	NOUN
brj-24894	414	14	,	,	PUNCT
brj-24894	414	15	”	"	PUNCT
brj-24894	414	16	waste	waste	NOUN
brj-24894	414	17	and	and	CCONJ
brj-24894	414	18	biomass	biomass	NOUN
brj-24894	414	19	valorization	valorization	NOUN
brj-24894	414	20	10	10	NUM
brj-24894	414	21	,	,	PUNCT
brj-24894	414	22	235	235	NUM
brj-24894	414	23	-	-	SYM
brj-24894	414	24	251	251	NUM
brj-24894	414	25	.	.	PUNCT
brj-24894	415	1	https://doi.org/10.1007/s12649-017-0059-y	https://doi.org/10.1007/s12649-017-0059-y	PROPN
brj-24894	415	2	sharma	sharma	PROPN
brj-24894	415	3	,	,	PUNCT
brj-24894	415	4	h.	h.	PROPN
brj-24894	415	5	p.	p.	PROPN
brj-24894	415	6	,	,	PUNCT
brj-24894	415	7	patel	patel	PROPN
brj-24894	415	8	,	,	PUNCT
brj-24894	415	9	h.	h.	PROPN
brj-24894	415	10	,	,	PUNCT
brj-24894	415	11	and	and	CCONJ
brj-24894	415	12	sugandha	sugandha	NOUN
brj-24894	415	13	.	.	PUNCT
brj-24894	416	1	(	(	PUNCT
brj-24894	416	2	2017	2017	NUM
brj-24894	416	3	)	)	PUNCT
brj-24894	416	4	.	.	PUNCT
brj-24894	417	1	“	"	PUNCT
brj-24894	417	2	enzymatic	enzymatic	ADJ
brj-24894	417	3	added	add	VERB
brj-24894	417	4	extraction	extraction	NOUN
brj-24894	417	5	and	and	CCONJ
brj-24894	417	6	clarification	clarification	NOUN
brj-24894	417	7	of	of	ADP
brj-24894	417	8	fruit	fruit	NOUN
brj-24894	417	9	juices	juice	NOUN
brj-24894	417	10	–	–	PUNCT
brj-24894	417	11	a	a	DET
brj-24894	417	12	review	review	NOUN
brj-24894	417	13	,	,	PUNCT
brj-24894	417	14	”	"	PUNCT
brj-24894	417	15	crit	crit	PROPN
brj-24894	417	16	.	.	PUNCT
brj-24894	417	17	rev	rev	PROPN
brj-24894	417	18	.	.	PROPN
brj-24894	417	19	food	food	PROPN
brj-24894	417	20	sci	sci	PROPN
brj-24894	417	21	.	.	PUNCT
brj-24894	417	22	nutr	nutr	PROPN
brj-24894	417	23	.	.	PUNCT
brj-24894	418	1	57(6	57(6	NUM
brj-24894	418	2	)	)	PUNCT
brj-24894	418	3	,	,	PUNCT
brj-24894	418	4	1215	1215	NUM
brj-24894	418	5	-	-	SYM
brj-24894	418	6	1227	1227	NUM
brj-24894	418	7	.	.	PUNCT
brj-24894	419	1	https://doi.org/10.1080/10408398.2014.977434	https://doi.org/10.1080/10408398.2014.977434	PROPN
brj-24894	419	2	sievers	sievers	PROPN
brj-24894	419	3	,	,	PUNCT
brj-24894	419	4	f.	f.	PROPN
brj-24894	419	5	,	,	PUNCT
brj-24894	419	6	and	and	CCONJ
brj-24894	419	7	higgins	higgins	PROPN
brj-24894	419	8	,	,	PUNCT
brj-24894	419	9	d.	d.	PROPN
brj-24894	419	10	g.	g.	PROPN
brj-24894	419	11	(	(	PUNCT
brj-24894	419	12	2014	2014	NUM
brj-24894	419	13	)	)	PUNCT
brj-24894	419	14	.	.	PUNCT
brj-24894	420	1	“	"	PUNCT
brj-24894	420	2	clustal	clustal	ADJ
brj-24894	420	3	omega	omega	NOUN
brj-24894	420	4	,	,	PUNCT
brj-24894	420	5	”	"	PUNCT
brj-24894	420	6	curr	curr	X
brj-24894	420	7	.	.	PUNCT
brj-24894	420	8	protoc	protoc	VERB
brj-24894	420	9	.	.	PUNCT
brj-24894	421	1	bioinformatics	bioinformatic	NOUN
brj-24894	421	2	48	48	NUM
brj-24894	421	3	,	,	PUNCT
brj-24894	421	4	3.13.1	3.13.1	NUM
brj-24894	421	5	-	-	SYM
brj-24894	421	6	3.13.16	3.13.16	NUM
brj-24894	421	7	.	.	PUNCT
brj-24894	422	1	https://doi.org/10.1002/0471250953.bi0313s48	https://doi.org/10.1002/0471250953.bi0313s48	PROPN
brj-24894	422	2	teufel	teufel	PROPN
brj-24894	422	3	,	,	PUNCT
brj-24894	422	4	f.	f.	PROPN
brj-24894	422	5	,	,	PUNCT
brj-24894	422	6	almagro	almagro	PROPN
brj-24894	422	7	armenteros	armenteros	PROPN
brj-24894	422	8	,	,	PUNCT
brj-24894	422	9	j.	j.	PROPN
brj-24894	422	10	j.	j.	PROPN
brj-24894	422	11	,	,	PUNCT
brj-24894	422	12	johansen	johansen	PROPN
brj-24894	422	13	,	,	PUNCT
brj-24894	422	14	a.	a.	PROPN
brj-24894	422	15	r.	r.	PROPN
brj-24894	422	16	,	,	PUNCT
brj-24894	422	17	gíslason	gíslason	PROPN
brj-24894	422	18	,	,	PUNCT
brj-24894	422	19	m.	m.	PROPN
brj-24894	422	20	h.	h.	PROPN
brj-24894	422	21	,	,	PUNCT
brj-24894	422	22	pihl	pihl	PROPN
brj-24894	422	23	,	,	PUNCT
brj-24894	422	24	s.	s.	PROPN
brj-24894	422	25	i.	i.	PROPN
brj-24894	422	26	,	,	PUNCT
brj-24894	422	27	tsirigos	tsirigo	NOUN
brj-24894	422	28	,	,	PUNCT
brj-24894	422	29	k.	k.	PROPN
brj-24894	422	30	d.	d.	PROPN
brj-24894	422	31	,	,	PUNCT
brj-24894	422	32	winther	winther	PROPN
brj-24894	422	33	,	,	PUNCT
brj-24894	422	34	o.	o.	PROPN
brj-24894	422	35	,	,	PUNCT
brj-24894	422	36	brunak	brunak	NOUN
brj-24894	422	37	,	,	PUNCT
brj-24894	422	38	s.	s.	PROPN
brj-24894	422	39	,	,	PUNCT
brj-24894	422	40	von	von	PROPN
brj-24894	422	41	heijne	heijne	PROPN
brj-24894	422	42	,	,	PUNCT
brj-24894	422	43	g.	g.	PROPN
brj-24894	422	44	,	,	PUNCT
brj-24894	422	45	and	and	CCONJ
brj-24894	422	46	nielsen	nielsen	PROPN
brj-24894	422	47	,	,	PUNCT
brj-24894	422	48	h.	h.	PROPN
brj-24894	422	49	(	(	PUNCT
brj-24894	422	50	2022	2022	NUM
brj-24894	422	51	)	)	PUNCT
brj-24894	422	52	.	.	PUNCT
brj-24894	423	1	“	"	PUNCT
brj-24894	423	2	signalp	signalp	NOUN
brj-24894	423	3	6.0	6.0	NUM
brj-24894	423	4	predicts	predict	NOUN
brj-24894	423	5	all	all	DET
brj-24894	423	6	five	five	NUM
brj-24894	423	7	types	type	NOUN
brj-24894	423	8	of	of	ADP
brj-24894	423	9	signal	signal	ADJ
brj-24894	423	10	peptides	peptide	NOUN
brj-24894	423	11	using	use	VERB
brj-24894	423	12	protein	protein	NOUN
brj-24894	423	13	language	language	NOUN
brj-24894	423	14	models	model	NOUN
brj-24894	423	15	,	,	PUNCT
brj-24894	423	16	”	"	PUNCT
brj-24894	423	17	nat	nat	PROPN
brj-24894	423	18	biotechnol	biotechnol	PROPN
brj-24894	423	19	40(7	40(7	NOUN
brj-24894	423	20	)	)	PUNCT
brj-24894	423	21	,	,	PUNCT
brj-24894	423	22	1023	1023	NUM
brj-24894	423	23	-	-	SYM
brj-24894	423	24	1025	1025	NUM
brj-24894	423	25	.	.	PUNCT
brj-24894	424	1	https://doi.org/10.1038/s41587-021-01156-3	https://doi.org/10.1038/s41587-021-01156-3	NUM
brj-24894	424	2	villares	villare	NOUN
brj-24894	424	3	,	,	PUNCT
brj-24894	424	4	a.	a.	NOUN
brj-24894	424	5	,	,	PUNCT
brj-24894	424	6	moreau	moreau	PROPN
brj-24894	424	7	,	,	PUNCT
brj-24894	424	8	c.	c.	PROPN
brj-24894	424	9	,	,	PUNCT
brj-24894	424	10	bennati	bennati	NOUN
brj-24894	424	11	-	-	PUNCT
brj-24894	424	12	granier	grani	ADJ
brj-24894	424	13	,	,	PUNCT
brj-24894	424	14	c.	c.	PROPN
brj-24894	424	15	,	,	PUNCT
brj-24894	424	16	garajova	garajova	PROPN
brj-24894	424	17	,	,	PUNCT
brj-24894	424	18	s.	s.	PROPN
brj-24894	424	19	,	,	PUNCT
brj-24894	424	20	foucat	foucat	PROPN
brj-24894	424	21	,	,	PUNCT
brj-24894	424	22	l.	l.	PROPN
brj-24894	424	23	,	,	PUNCT
brj-24894	424	24	falourd	falourd	PROPN
brj-24894	424	25	,	,	PUNCT
brj-24894	424	26	x.	x.	NOUN
brj-24894	424	27	,	,	PUNCT
brj-24894	424	28	saake	saake	NOUN
brj-24894	424	29	,	,	PUNCT
brj-24894	424	30	b.	b.	PROPN
brj-24894	424	31	,	,	PUNCT
brj-24894	424	32	berrin	berrin	PROPN
brj-24894	424	33	,	,	PUNCT
brj-24894	424	34	j.	j.	PROPN
brj-24894	424	35	g.	g.	PROPN
brj-24894	424	36	,	,	PUNCT
brj-24894	424	37	and	and	CCONJ
brj-24894	424	38	cathala	cathala	NOUN
brj-24894	424	39	,	,	PUNCT
brj-24894	424	40	b.	b.	PROPN
brj-24894	424	41	(	(	PUNCT
brj-24894	424	42	2017	2017	NUM
brj-24894	424	43	)	)	PUNCT
brj-24894	424	44	.	.	PUNCT
brj-24894	425	1	“	"	PUNCT
brj-24894	425	2	lytic	lytic	ADJ
brj-24894	425	3	polysaccharide	polysaccharide	NOUN
brj-24894	425	4	monooxygenases	monooxygenase	NOUN
brj-24894	425	5	disrupt	disrupt	VERB
brj-24894	425	6	the	the	DET
brj-24894	425	7	cellulose	cellulose	NOUN
brj-24894	425	8	fibers	fiber	NOUN
brj-24894	425	9	structure	structure	NOUN
brj-24894	425	10	,	,	PUNCT
brj-24894	425	11	”	"	PUNCT
brj-24894	425	12	sci	sci	PROPN
brj-24894	425	13	.	.	PUNCT
brj-24894	425	14	rep	rep	PROPN
brj-24894	425	15	.	.	PROPN
brj-24894	425	16	7	7	NUM
brj-24894	425	17	,	,	PUNCT
brj-24894	425	18	article	article	NOUN
brj-24894	425	19	40262	40262	NUM
brj-24894	425	20	.	.	PUNCT
brj-24894	426	1	https://doi.org/10.1038/srep40262	https://doi.org/10.1038/srep40262	PROPN
brj-24894	426	2	visser	visser	PROPN
brj-24894	426	3	,	,	PUNCT
brj-24894	426	4	e.	e.	PROPN
brj-24894	426	5	m.	m.	PROPN
brj-24894	426	6	,	,	PUNCT
brj-24894	426	7	falkoski	falkoski	PROPN
brj-24894	426	8	,	,	PUNCT
brj-24894	426	9	d.	d.	PROPN
brj-24894	426	10	l.	l.	PROPN
brj-24894	426	11	,	,	PUNCT
brj-24894	426	12	de	de	PROPN
brj-24894	426	13	almeida	almeida	PROPN
brj-24894	426	14	,	,	PUNCT
brj-24894	426	15	m.	m.	NOUN
brj-24894	426	16	n.	n.	PROPN
brj-24894	426	17	,	,	PUNCT
brj-24894	426	18	maitan	maitan	PROPN
brj-24894	426	19	-	-	PUNCT
brj-24894	426	20	alfenas	alfenas	ADJ
brj-24894	426	21	,	,	PUNCT
brj-24894	426	22	g.	g.	PROPN
brj-24894	426	23	p.	p.	PROPN
brj-24894	426	24	,	,	PUNCT
brj-24894	426	25	and	and	CCONJ
brj-24894	426	26	guimarães	guimarães	NOUN
brj-24894	426	27	,	,	PUNCT
brj-24894	426	28	v.	v.	ADP
brj-24894	426	29	m.	m.	NOUN
brj-24894	426	30	(	(	PUNCT
brj-24894	426	31	2013	2013	NUM
brj-24894	426	32	)	)	PUNCT
brj-24894	426	33	.	.	PUNCT
brj-24894	427	1	“	"	PUNCT
brj-24894	427	2	production	production	NOUN
brj-24894	427	3	and	and	CCONJ
brj-24894	427	4	application	application	NOUN
brj-24894	427	5	of	of	ADP
brj-24894	427	6	an	an	DET
brj-24894	427	7	enzyme	enzyme	NOUN
brj-24894	427	8	blend	blend	NOUN
brj-24894	427	9	from	from	ADP
brj-24894	427	10	chrysoporthe	chrysoporthe	ADJ
brj-24894	427	11	cubensis	cubensis	NOUN
brj-24894	427	12	and	and	CCONJ
brj-24894	427	13	penicillium	penicillium	NOUN
brj-24894	427	14	pinophilum	pinophilum	NOUN
brj-24894	427	15	with	with	ADP
brj-24894	427	16	potential	potential	NOUN
brj-24894	427	17	for	for	ADP
brj-24894	427	18	hydrolysis	hydrolysis	NOUN
brj-24894	427	19	of	of	ADP
brj-24894	427	20	sugarcane	sugarcane	NOUN
brj-24894	427	21	bagasse	bagasse	NOUN
brj-24894	427	22	,	,	PUNCT
brj-24894	427	23	”	"	PUNCT
brj-24894	427	24	bioresour	bioresour	NOUN
brj-24894	427	25	.	.	PUNCT
brj-24894	428	1	technol	technol	PROPN
brj-24894	428	2	.	.	PUNCT
brj-24894	429	1	144	144	NUM
brj-24894	429	2	,	,	PUNCT
brj-24894	429	3	587	587	NUM
brj-24894	429	4	-	-	SYM
brj-24894	429	5	94	94	NUM
brj-24894	429	6	.	.	PUNCT
brj-24894	430	1	https://doi.org/10.1016/j.biortech.2013.07.015	https://doi.org/10.1016/j.biortech.2013.07.015	PROPN
brj-24894	430	2	wang	wang	PROPN
brj-24894	430	3	,	,	PUNCT
brj-24894	430	4	z.	z.	PROPN
brj-24894	430	5	,	,	PUNCT
brj-24894	430	6	hu	hu	PROPN
brj-24894	430	7	,	,	PUNCT
brj-24894	430	8	y.	y.	PROPN
brj-24894	430	9	,	,	PUNCT
brj-24894	430	10	long	long	ADV
brj-24894	430	11	,	,	PUNCT
brj-24894	430	12	l.	l.	PROPN
brj-24894	430	13	,	,	PUNCT
brj-24894	430	14	and	and	CCONJ
brj-24894	430	15	ding	ding	NOUN
brj-24894	430	16	,	,	PUNCT
brj-24894	430	17	s.	s.	PROPN
brj-24894	430	18	(	(	PUNCT
brj-24894	430	19	2017	2017	NUM
brj-24894	430	20	)	)	PUNCT
brj-24894	430	21	.	.	PUNCT
brj-24894	431	1	“	"	PUNCT
brj-24894	431	2	characterization	characterization	NOUN
brj-24894	431	3	of	of	ADP
brj-24894	431	4	a	a	DET
brj-24894	431	5	gh12	gh12	PROPN
brj-24894	431	6	endoglucanase	endoglucanase	NOUN
brj-24894	431	7	from	from	ADP
brj-24894	431	8	volvariella	volvariella	NOUN
brj-24894	431	9	volvacea	volvacea	PROPN
brj-24894	431	10	exhibiting	exhibit	VERB
brj-24894	431	11	broad	broad	ADJ
brj-24894	431	12	substrate	substrate	NOUN
brj-24894	431	13	specificity	specificity	NOUN
brj-24894	431	14	and	and	CCONJ
brj-24894	431	15	potential	potential	ADJ
brj-24894	431	16	synergy	synergy	NOUN
brj-24894	431	17	with	with	ADP
brj-24894	431	18	crude	crude	ADJ
brj-24894	431	19	cellulase	cellulase	NOUN
brj-24894	431	20	,	,	PUNCT
brj-24894	431	21	”	"	PUNCT
brj-24894	431	22	bioresources	bioresource	NOUN
brj-24894	431	23	12(4	12(4	NUM
brj-24894	431	24	)	)	PUNCT
brj-24894	431	25	,	,	PUNCT
brj-24894	431	26	9437	9437	NUM
brj-24894	431	27	-	-	SYM
brj-24894	431	28	9451	9451	NUM
brj-24894	431	29	.	.	PUNCT
brj-24894	432	1	https://doi.org/10.15376/biores.12.4.9437-9451	https://doi.org/10.15376/biores.12.4.9437-9451	ADJ
brj-24894	432	2	xian	xian	PROPN
brj-24894	432	3	,	,	PUNCT
brj-24894	432	4	l.	l.	PROPN
brj-24894	432	5	,	,	PUNCT
brj-24894	432	6	wang	wang	PROPN
brj-24894	432	7	,	,	PUNCT
brj-24894	432	8	f.	f.	PROPN
brj-24894	432	9	,	,	PUNCT
brj-24894	432	10	luo	luo	PROPN
brj-24894	432	11	,	,	PUNCT
brj-24894	432	12	x.	x.	PROPN
brj-24894	432	13	,	,	PUNCT
brj-24894	432	14	feng	feng	PROPN
brj-24894	432	15	,	,	PUNCT
brj-24894	432	16	y.	y.	PROPN
brj-24894	432	17	l.	l.	PROPN
brj-24894	432	18	,	,	PUNCT
brj-24894	432	19	and	and	CCONJ
brj-24894	432	20	feng	feng	PROPN
brj-24894	432	21	,	,	PUNCT
brj-24894	432	22	j.	j.	PROPN
brj-24894	432	23	x.	x.	PROPN
brj-24894	432	24	(	(	PUNCT
brj-24894	432	25	2015	2015	NUM
brj-24894	432	26	)	)	PUNCT
brj-24894	432	27	.	.	PUNCT
brj-24894	433	1	“	"	PUNCT
brj-24894	433	2	purification	purification	NOUN
brj-24894	433	3	and	and	CCONJ
brj-24894	433	4	characterization	characterization	NOUN
brj-24894	433	5	of	of	ADP
brj-24894	433	6	a	a	DET
brj-24894	433	7	highly	highly	ADV
brj-24894	433	8	efficient	efficient	ADJ
brj-24894	433	9	calcium	calcium	NOUN
brj-24894	433	10	-	-	PUNCT
brj-24894	433	11	independent	independent	ADJ
brj-24894	433	12	α	α	NOUN
brj-24894	433	13	-	-	NOUN
brj-24894	433	14	amylase	amylase	NOUN
brj-24894	433	15	from	from	ADP
brj-24894	433	16	talaromyces	talaromyce	NOUN
brj-24894	433	17	pinophilus	pinophilus	ADJ
brj-24894	433	18	1	1	NUM
brj-24894	433	19	-	-	SYM
brj-24894	433	20	95	95	NUM
brj-24894	433	21	,	,	PUNCT
brj-24894	433	22	”	"	PUNCT
brj-24894	433	23	plos	plos	PROPN
brj-24894	433	24	one	one	NUM
brj-24894	433	25	10(3	10(3	NUM
brj-24894	433	26	)	)	PUNCT
brj-24894	433	27	,	,	PUNCT
brj-24894	433	28	article	article	NOUN
brj-24894	433	29	e0121531	e0121531	PROPN
brj-24894	433	30	.	.	PUNCT
brj-24894	434	1	https://doi.org/10.1371/journal.pone.0121531	https://doi.org/10.1371/journal.pone.0121531	PROPN
brj-24894	434	2	yamanobe	yamanobe	PROPN
brj-24894	434	3	,	,	PUNCT
brj-24894	434	4	t.	t.	PROPN
brj-24894	434	5	,	,	PUNCT
brj-24894	434	6	mitsuishi	mitsuishi	PROPN
brj-24894	434	7	,	,	PUNCT
brj-24894	434	8	y.	y.	NOUN
brj-24894	434	9	,	,	PUNCT
brj-24894	434	10	and	and	CCONJ
brj-24894	434	11	takasaki	takasaki	ADJ
brj-24894	434	12	,	,	PUNCT
brj-24894	434	13	y.	y.	NOUN
brj-24894	434	14	(	(	PUNCT
brj-24894	434	15	1987	1987	NUM
brj-24894	434	16	)	)	PUNCT
brj-24894	434	17	.	.	PUNCT
brj-24894	435	1	“	"	PUNCT
brj-24894	435	2	isolation	isolation	NOUN
brj-24894	435	3	of	of	ADP
brj-24894	435	4	a	a	DET
brj-24894	435	5	cellulolytic	cellulolytic	ADJ
brj-24894	435	6	enzyme	enzyme	NOUN
brj-24894	435	7	producing	produce	VERB
brj-24894	435	8	microorganism	microorganism	NOUN
brj-24894	435	9	,	,	PUNCT
brj-24894	435	10	culture	culture	NOUN
brj-24894	435	11	conditions	condition	NOUN
brj-24894	435	12	and	and	CCONJ
brj-24894	435	13	some	some	DET
brj-24894	435	14	properties	property	NOUN
brj-24894	435	15	of	of	ADP
brj-24894	435	16	the	the	DET
brj-24894	435	17	enzymes	enzyme	NOUN
brj-24894	435	18	,	,	PUNCT
brj-24894	435	19	”	"	PUNCT
brj-24894	435	20	agricultural	agricultural	ADJ
brj-24894	435	21	and	and	CCONJ
brj-24894	435	22	biological	biological	ADJ
brj-24894	435	23	chemistry	chemistry	NOUN
brj-24894	435	24	51(1	51(1	NUM
brj-24894	435	25	)	)	PUNCT
brj-24894	435	26	,	,	PUNCT
brj-24894	435	27	65	65	NUM
brj-24894	435	28	-	-	SYM
brj-24894	435	29	74	74	NUM
brj-24894	435	30	.	.	PUNCT
brj-24894	436	1	https://doi.org/10.1080/00021369.1987.10867998	https://doi.org/10.1080/00021369.1987.10867998	PROPN
brj-24894	436	2	yang	yang	PROPN
brj-24894	436	3	,	,	PUNCT
brj-24894	436	4	h.	h.	PROPN
brj-24894	436	5	,	,	PUNCT
brj-24894	436	6	shi	shi	PROPN
brj-24894	436	7	,	,	PUNCT
brj-24894	436	8	p.	p.	PROPN
brj-24894	436	9	,	,	PUNCT
brj-24894	436	10	liu	liu	PROPN
brj-24894	436	11	,	,	PUNCT
brj-24894	436	12	y.	y.	PROPN
brj-24894	436	13	,	,	PUNCT
brj-24894	436	14	xia	xia	PROPN
brj-24894	436	15	,	,	PUNCT
brj-24894	436	16	w.	w.	PROPN
brj-24894	436	17	,	,	PUNCT
brj-24894	436	18	wang	wang	PROPN
brj-24894	436	19	,	,	PUNCT
brj-24894	436	20	x.	x.	PROPN
brj-24894	436	21	,	,	PUNCT
brj-24894	436	22	cao	cao	PROPN
brj-24894	436	23	,	,	PUNCT
brj-24894	436	24	h.	h.	PROPN
brj-24894	436	25	,	,	PUNCT
brj-24894	436	26	ma	ma	PROPN
brj-24894	436	27	,	,	PUNCT
brj-24894	436	28	r.	r.	PROPN
brj-24894	436	29	,	,	PUNCT
brj-24894	436	30	luo	luo	PROPN
brj-24894	436	31	,	,	PUNCT
brj-24894	436	32	h.	h.	PROPN
brj-24894	436	33	,	,	PUNCT
brj-24894	436	34	bai	bai	PROPN
brj-24894	436	35	,	,	PUNCT
brj-24894	436	36	y.	y.	NOUN
brj-24894	436	37	,	,	PUNCT
brj-24894	436	38	and	and	CCONJ
brj-24894	436	39	yao	yao	PROPN
brj-24894	436	40	,	,	PUNCT
brj-24894	436	41	b.	b.	PROPN
brj-24894	436	42	(	(	PUNCT
brj-24894	436	43	2017	2017	NUM
brj-24894	436	44	)	)	PUNCT
brj-24894	436	45	.	.	PUNCT
brj-24894	437	1	“	"	PUNCT
brj-24894	437	2	loop	loop	NOUN
brj-24894	437	3	3	3	NUM
brj-24894	437	4	of	of	ADP
brj-24894	437	5	fungal	fungal	ADJ
brj-24894	437	6	endoglucanases	endoglucanase	NOUN
brj-24894	437	7	of	of	ADP
brj-24894	437	8	glycoside	glycoside	NOUN
brj-24894	437	9	hydrolase	hydrolase	NOUN
brj-24894	437	10	family	family	NOUN
brj-24894	437	11	12	12	NUM
brj-24894	437	12	modulates	modulate	NOUN
brj-24894	437	13	catalytic	catalytic	ADJ
brj-24894	437	14	efficiency	efficiency	NOUN
brj-24894	437	15	,	,	PUNCT
brj-24894	437	16	”	"	PUNCT
brj-24894	437	17	appl	appl	NOUN
brj-24894	437	18	.	.	PUNCT
brj-24894	438	1	environ	environ	PROPN
brj-24894	438	2	.	.	PUNCT
brj-24894	438	3	microbiol	microbiol	PROPN
brj-24894	438	4	.	.	PUNCT
brj-24894	439	1	83(6	83(6	PROPN
brj-24894	439	2	)	)	PUNCT
brj-24894	439	3	.	.	PUNCT
brj-24894	440	1	https://doi.org/10.1128/aem.03123-16	https://doi.org/10.1128/aem.03123-16	PROPN
brj-24894	440	2	yuan	yuan	PROPN
brj-24894	440	3	,	,	PUNCT
brj-24894	440	4	z.	z.	PROPN
brj-24894	440	5	,	,	PUNCT
brj-24894	440	6	wen	wen	PROPN
brj-24894	440	7	,	,	PUNCT
brj-24894	440	8	y.	y.	PROPN
brj-24894	440	9	,	,	PUNCT
brj-24894	440	10	and	and	CCONJ
brj-24894	440	11	li	li	PROPN
brj-24894	440	12	,	,	PUNCT
brj-24894	440	13	g.	g.	PROPN
brj-24894	440	14	(	(	PUNCT
brj-24894	440	15	2018	2018	NUM
brj-24894	440	16	)	)	PUNCT
brj-24894	440	17	.	.	PUNCT
brj-24894	441	1	“	"	PUNCT
brj-24894	441	2	production	production	NOUN
brj-24894	441	3	of	of	ADP
brj-24894	441	4	bioethanol	bioethanol	NOUN
brj-24894	441	5	and	and	CCONJ
brj-24894	441	6	value	value	NOUN
brj-24894	441	7	added	add	VERB
brj-24894	441	8	compounds	compound	NOUN
brj-24894	441	9	from	from	ADP
brj-24894	441	10	wheat	wheat	NOUN
brj-24894	441	11	straw	straw	NOUN
brj-24894	441	12	through	through	ADP
brj-24894	441	13	combined	combined	ADJ
brj-24894	441	14	alkaline	alkaline	NOUN
brj-24894	441	15	/	/	SYM
brj-24894	441	16	alkaline	alkaline	NOUN
brj-24894	441	17	-	-	PUNCT
brj-24894	441	18	peroxide	peroxide	NOUN
brj-24894	441	19	pretreatment	pretreatment	NOUN
brj-24894	441	20	,	,	PUNCT
brj-24894	441	21	”	"	PUNCT
brj-24894	441	22	bioresour	bioresour	NOUN
brj-24894	441	23	.	.	PUNCT
brj-24894	441	24	technol	technol	NOUN
brj-24894	441	25	.	.	PUNCT
brj-24894	441	26	259	259	NUM
brj-24894	441	27	,	,	PUNCT
brj-24894	441	28	228	228	NUM
brj-24894	441	29	-	-	SYM
brj-24894	441	30	236	236	NUM
brj-24894	441	31	.	.	PUNCT
brj-24894	442	1	https://doi.org/10.1016/j.biortech.2018.03.044	https://doi.org/10.1016/j.biortech.2018.03.044	PROPN
brj-24894	442	2	https://doi.org/10.1111/febs.15151	https://doi.org/10.1111/febs.15151	NOUN
brj-24894	442	3	https://doi.org/10.1007/s12649-017-0059-y	https://doi.org/10.1007/s12649-017-0059-y	PROPN
brj-24894	442	4	https://doi.org/10.1080/10408398.2014.977434	https://doi.org/10.1080/10408398.2014.977434	PUNCT
brj-24894	443	1	https://doi.org/10.1002/0471250953.bi0313s48	https://doi.org/10.1002/0471250953.bi0313s48	PROPN
brj-24894	443	2	https://doi.org/10.1038/s41587-021-01156-3	https://doi.org/10.1038/s41587-021-01156-3	NUM
brj-24894	443	3	https://doi.org/10.1038/srep40262	https://doi.org/10.1038/srep40262	NOUN
brj-24894	443	4	https://doi.org/10.1016/j.biortech.2013.07.015	https://doi.org/10.1016/j.biortech.2013.07.015	VERB
brj-24894	443	5	https://doi.org/10.15376/biores.12.4.9437-9451	https://doi.org/10.15376/biores.12.4.9437-9451	NOUN
brj-24894	443	6	https://doi.org/10.1371/journal.pone.0121531	https://doi.org/10.1371/journal.pone.0121531	PROPN
brj-24894	443	7	https://doi.org/10.1080/00021369.1987.10867998	https://doi.org/10.1080/00021369.1987.10867998	PROPN
brj-24894	443	8	https://doi.org/10.1128/aem.03123-16	https://doi.org/10.1128/aem.03123-16	PROPN
brj-24894	443	9	https://doi.org/10.1016/j.biortech.2018.03.044	https://doi.org/10.1016/j.biortech.2018.03.044	PROPN
brj-24894	443	10	peer	peer	NOUN
brj-24894	443	11	-	-	PUNCT
brj-24894	443	12	reviewed	review	VERB
brj-24894	443	13	article	article	NOUN
brj-24894	443	14	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	443	15	li	li	PROPN
brj-24894	443	16	et	et	PROPN
brj-24894	443	17	al	al	PROPN
brj-24894	443	18	.	.	PROPN
brj-24894	444	1	(	(	PUNCT
brj-24894	444	2	2026	2026	NUM
brj-24894	444	3	)	)	PUNCT
brj-24894	444	4	.	.	PUNCT
brj-24894	445	1	“	"	PUNCT
brj-24894	445	2	endoglucanase	endoglucanase	VERB
brj-24894	445	3	tpcel12a	tpcel12a	NOUN
brj-24894	445	4	traits	trait	NOUN
brj-24894	445	5	,	,	PUNCT
brj-24894	445	6	”	"	PUNCT
brj-24894	445	7	bioresources	bioresource	NOUN
brj-24894	445	8	21(1	21(1	NUM
brj-24894	445	9	)	)	PUNCT
brj-24894	445	10	,	,	PUNCT
brj-24894	445	11	547	547	NUM
brj-24894	445	12	-	-	SYM
brj-24894	445	13	569	569	NUM
brj-24894	445	14	.	.	NOUN
brj-24894	445	15	565	565	NUM
brj-24894	445	16	yue	yue	NOUN
brj-24894	445	17	,	,	PUNCT
brj-24894	445	18	z.	z.	PROPN
brj-24894	445	19	,	,	PUNCT
brj-24894	445	20	bin	bin	PROPN
brj-24894	445	21	,	,	PUNCT
brj-24894	445	22	w.	w.	PROPN
brj-24894	445	23	,	,	PUNCT
brj-24894	445	24	baixu	baixu	NOUN
brj-24894	445	25	,	,	PUNCT
brj-24894	445	26	y.	y.	NOUN
brj-24894	445	27	,	,	PUNCT
brj-24894	445	28	and	and	CCONJ
brj-24894	445	29	peiji	peiji	NOUN
brj-24894	445	30	,	,	PUNCT
brj-24894	445	31	g.	g.	PROPN
brj-24894	445	32	(	(	PUNCT
brj-24894	445	33	2004	2004	NUM
brj-24894	445	34	)	)	PUNCT
brj-24894	445	35	.	.	PUNCT
brj-24894	446	1	“	"	PUNCT
brj-24894	446	2	mechanism	mechanism	NOUN
brj-24894	446	3	of	of	ADP
brj-24894	446	4	cellobiose	cellobiose	NOUN
brj-24894	446	5	inhibition	inhibition	NOUN
brj-24894	446	6	in	in	ADP
brj-24894	446	7	cellulose	cellulose	NOUN
brj-24894	446	8	hydrolysis	hydrolysis	NOUN
brj-24894	446	9	by	by	ADP
brj-24894	446	10	cellobiohydrolase	cellobiohydrolase	NOUN
brj-24894	446	11	,	,	PUNCT
brj-24894	446	12	”	"	PUNCT
brj-24894	446	13	sci	sci	PROPN
brj-24894	446	14	.	.	PUNCT
brj-24894	447	1	china	china	PROPN
brj-24894	447	2	c	c	PROPN
brj-24894	447	3	life	life	PROPN
brj-24894	447	4	sci	sci	PROPN
brj-24894	447	5	.	.	PUNCT
brj-24894	447	6	47(1	47(1	PROPN
brj-24894	447	7	)	)	PUNCT
brj-24894	447	8	,	,	PUNCT
brj-24894	447	9	18	18	NUM
brj-24894	447	10	-	-	SYM
brj-24894	447	11	24	24	NUM
brj-24894	447	12	.	.	PUNCT
brj-24894	448	1	https://doi.org/10.1360/02yc0163	https://doi.org/10.1360/02yc0163	PROPN
brj-24894	448	2	zhao	zhao	PROPN
brj-24894	448	3	,	,	PUNCT
brj-24894	448	4	s.	s.	PROPN
brj-24894	448	5	,	,	PUNCT
brj-24894	448	6	yan	yan	PROPN
brj-24894	448	7	,	,	PUNCT
brj-24894	448	8	y.	y.	PROPN
brj-24894	448	9	s.	s.	PROPN
brj-24894	448	10	,	,	PUNCT
brj-24894	448	11	he	he	PRON
brj-24894	448	12	,	,	PUNCT
brj-24894	448	13	q.	q.	PROPN
brj-24894	448	14	p.	p.	PROPN
brj-24894	448	15	,	,	PUNCT
brj-24894	448	16	yang	yang	PROPN
brj-24894	448	17	,	,	PUNCT
brj-24894	448	18	l.	l.	PROPN
brj-24894	448	19	,	,	PUNCT
brj-24894	448	20	yin	yin	PROPN
brj-24894	448	21	,	,	PUNCT
brj-24894	448	22	x.	x.	PROPN
brj-24894	448	23	,	,	PUNCT
brj-24894	448	24	li	li	PROPN
brj-24894	448	25	,	,	PUNCT
brj-24894	448	26	c.	c.	PROPN
brj-24894	448	27	x.	x.	PROPN
brj-24894	448	28	,	,	PUNCT
brj-24894	448	29	mao	mao	PROPN
brj-24894	448	30	,	,	PUNCT
brj-24894	448	31	l.	l.	PROPN
brj-24894	448	32	c.	c.	PROPN
brj-24894	448	33	,	,	PUNCT
brj-24894	448	34	liao	liao	PROPN
brj-24894	448	35	,	,	PUNCT
brj-24894	448	36	l.	l.	PROPN
brj-24894	448	37	s.	s.	PROPN
brj-24894	448	38	,	,	PUNCT
brj-24894	448	39	huang	huang	PROPN
brj-24894	448	40	,	,	PUNCT
brj-24894	448	41	j.	j.	PROPN
brj-24894	448	42	q.	q.	PROPN
brj-24894	448	43	,	,	PUNCT
brj-24894	448	44	xie	xie	PROPN
brj-24894	448	45	,	,	PUNCT
brj-24894	448	46	s.	s.	PROPN
brj-24894	448	47	b.	b.	PROPN
brj-24894	448	48	,	,	PUNCT
brj-24894	448	49	et	et	PROPN
brj-24894	448	50	al	al	PROPN
brj-24894	448	51	.	.	PUNCT
brj-24894	448	52	(	(	PUNCT
brj-24894	448	53	2016	2016	NUM
brj-24894	448	54	)	)	PUNCT
brj-24894	448	55	.	.	PUNCT
brj-24894	449	1	“	"	PUNCT
brj-24894	449	2	comparative	comparative	ADJ
brj-24894	449	3	genomic	genomic	NOUN
brj-24894	449	4	,	,	PUNCT
brj-24894	449	5	transcriptomic	transcriptomic	ADJ
brj-24894	449	6	and	and	CCONJ
brj-24894	449	7	secretomic	secretomic	ADJ
brj-24894	449	8	profiling	profiling	NOUN
brj-24894	449	9	of	of	ADP
brj-24894	449	10	penicillium	penicillium	NOUN
brj-24894	449	11	oxalicum	oxalicum	NOUN
brj-24894	449	12	hp7	hp7	PROPN
brj-24894	449	13	-	-	PUNCT
brj-24894	449	14	1	1	NUM
brj-24894	449	15	and	and	CCONJ
brj-24894	449	16	its	its	PRON
brj-24894	449	17	cellulase	cellulase	NOUN
brj-24894	449	18	and	and	CCONJ
brj-24894	449	19	xylanase	xylanase	NOUN
brj-24894	449	20	hyper	hyper	ADV
brj-24894	449	21	-	-	ADJ
brj-24894	449	22	producing	produce	VERB
brj-24894	449	23	mutant	mutant	NOUN
brj-24894	449	24	eu2106	eu2106	NOUN
brj-24894	449	25	,	,	PUNCT
brj-24894	449	26	and	and	CCONJ
brj-24894	449	27	identification	identification	NOUN
brj-24894	449	28	of	of	ADP
brj-24894	449	29	two	two	NUM
brj-24894	449	30	novel	novel	ADJ
brj-24894	449	31	regulatory	regulatory	ADJ
brj-24894	449	32	genes	gene	NOUN
brj-24894	449	33	of	of	ADP
brj-24894	449	34	cellulase	cellulase	NOUN
brj-24894	449	35	and	and	CCONJ
brj-24894	449	36	xylanase	xylanase	NOUN
brj-24894	449	37	gene	gene	NOUN
brj-24894	449	38	expression	expression	NOUN
brj-24894	449	39	,	,	PUNCT
brj-24894	449	40	”	"	PUNCT
brj-24894	449	41	biotechnol	biotechnol	NOUN
brj-24894	449	42	biofuels	biofuel	NOUN
brj-24894	449	43	9	9	NUM
brj-24894	449	44	,	,	PUNCT
brj-24894	449	45	article	article	NOUN
brj-24894	449	46	203	203	NUM
brj-24894	449	47	.	.	PUNCT
brj-24894	450	1	https://doi.org/10.1186/s13068-016-0616-9	https://doi.org/10.1186/s13068-016-0616-9	PROPN
brj-24894	450	2	zheng	zheng	PROPN
brj-24894	450	3	,	,	PUNCT
brj-24894	450	4	f.	f.	PROPN
brj-24894	450	5	,	,	PUNCT
brj-24894	450	6	basit	basit	PROPN
brj-24894	450	7	,	,	PUNCT
brj-24894	450	8	a.	a.	PROPN
brj-24894	450	9	,	,	PUNCT
brj-24894	450	10	wang	wang	PROPN
brj-24894	450	11	,	,	PUNCT
brj-24894	450	12	j.	j.	PROPN
brj-24894	450	13	,	,	PUNCT
brj-24894	450	14	zhuang	zhuang	PROPN
brj-24894	450	15	,	,	PUNCT
brj-24894	450	16	h.	h.	PROPN
brj-24894	450	17	,	,	PUNCT
brj-24894	450	18	chen	chen	PROPN
brj-24894	450	19	,	,	PUNCT
brj-24894	450	20	j.	j.	PROPN
brj-24894	450	21	,	,	PUNCT
brj-24894	450	22	and	and	CCONJ
brj-24894	450	23	zhang	zhang	PROPN
brj-24894	450	24	,	,	PUNCT
brj-24894	450	25	j.	j.	PROPN
brj-24894	450	26	(	(	PUNCT
brj-24894	450	27	2024	2024	NUM
brj-24894	450	28	)	)	PUNCT
brj-24894	450	29	.	.	PUNCT
brj-24894	451	1	“	"	PUNCT
brj-24894	451	2	characterization	characterization	NOUN
brj-24894	451	3	of	of	ADP
brj-24894	451	4	a	a	DET
brj-24894	451	5	novel	novel	ADJ
brj-24894	451	6	acidophilic	acidophilic	ADJ
brj-24894	451	7	,	,	PUNCT
brj-24894	451	8	ethanol	ethanol	NOUN
brj-24894	451	9	tolerant	tolerant	ADJ
brj-24894	451	10	and	and	CCONJ
brj-24894	451	11	halophilic	halophilic	ADJ
brj-24894	451	12	gh12	gh12	PROPN
brj-24894	451	13	β-1,4endoglucanase	β-1,4endoglucanase	ADV
brj-24894	451	14	from	from	ADP
brj-24894	451	15	trichoderma	trichoderma	PROPN
brj-24894	451	16	asperellum	asperellum	NOUN
brj-24894	451	17	nd-1	nd-1	X
brj-24894	451	18	and	and	CCONJ
brj-24894	451	19	its	its	PRON
brj-24894	451	20	synergistic	synergistic	ADJ
brj-24894	451	21	hydrolysis	hydrolysis	NOUN
brj-24894	451	22	of	of	ADP
brj-24894	451	23	lignocellulosic	lignocellulosic	ADJ
brj-24894	451	24	biomass	biomass	NOUN
brj-24894	451	25	,	,	PUNCT
brj-24894	451	26	”	"	PUNCT
brj-24894	451	27	int	int	NOUN
brj-24894	451	28	.	.	PUNCT
brj-24894	452	1	j.	j.	PROPN
brj-24894	452	2	biol	biol	PROPN
brj-24894	452	3	.	.	PUNCT
brj-24894	453	1	macromol	macromol	PROPN
brj-24894	453	2	.	.	PUNCT
brj-24894	454	1	254(pt	254(pt	NUM
brj-24894	454	2	1	1	NUM
brj-24894	454	3	)	)	PUNCT
brj-24894	454	4	,	,	PUNCT
brj-24894	454	5	127650	127650	NUM
brj-24894	454	6	.	.	PUNCT
brj-24894	455	1	https://doi.org/10.1016/j.ijbiomac.2023.127650	https://doi.org/10.1016/j.ijbiomac.2023.127650	NOUN
brj-24894	455	2	article	article	NOUN
brj-24894	455	3	submitted	submit	VERB
brj-24894	455	4	:	:	PUNCT
brj-24894	455	5	july	july	PROPN
brj-24894	455	6	31	31	NUM
brj-24894	455	7	,	,	PUNCT
brj-24894	455	8	2025	2025	NUM
brj-24894	455	9	;	;	PUNCT
brj-24894	455	10	peer	peer	NOUN
brj-24894	455	11	review	review	NOUN
brj-24894	455	12	completed	complete	VERB
brj-24894	455	13	:	:	PUNCT
brj-24894	455	14	september	september	PROPN
brj-24894	455	15	16	16	NUM
brj-24894	455	16	,	,	PUNCT
brj-24894	455	17	2025	2025	NUM
brj-24894	455	18	;	;	PUNCT
brj-24894	455	19	revised	revise	VERB
brj-24894	455	20	version	version	NOUN
brj-24894	455	21	received	receive	VERB
brj-24894	455	22	:	:	PUNCT
brj-24894	455	23	november	november	PROPN
brj-24894	455	24	17	17	NUM
brj-24894	455	25	,	,	PUNCT
brj-24894	455	26	2025	2025	NUM
brj-24894	455	27	;	;	PUNCT
brj-24894	455	28	published	publish	VERB
brj-24894	455	29	:	:	PUNCT
brj-24894	455	30	december	december	PROPN
brj-24894	455	31	1	1	NUM
brj-24894	455	32	,	,	PUNCT
brj-24894	455	33	2025	2025	NUM
brj-24894	455	34	.	.	PUNCT
brj-24894	456	1	doi	doi	NOUN
brj-24894	456	2	:	:	PUNCT
brj-24894	456	3	10.15376	10.15376	NUM
brj-24894	456	4	/	/	SYM
brj-24894	456	5	biores.21.1.547	biores.21.1.547	NOUN
brj-24894	456	6	-	-	PUNCT
brj-24894	456	7	569	569	NUM
brj-24894	456	8	https://doi.org/10.1360/02yc0163	https://doi.org/10.1360/02yc0163	X
brj-24894	456	9	https://doi.org/10.1186/s13068-016-0616-9	https://doi.org/10.1186/s13068-016-0616-9	PROPN
brj-24894	456	10	https://doi.org/10.1016/j.ijbiomac.2023.127650	https://doi.org/10.1016/j.ijbiomac.2023.127650	NOUN
brj-24894	456	11	peer	peer	NOUN
brj-24894	456	12	-	-	PUNCT
brj-24894	456	13	reviewed	review	VERB
brj-24894	456	14	article	article	NOUN
brj-24894	456	15	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	456	16	li	li	PROPN
brj-24894	456	17	et	et	PROPN
brj-24894	456	18	al	al	PROPN
brj-24894	456	19	.	.	PROPN
brj-24894	457	1	(	(	PUNCT
brj-24894	457	2	2026	2026	NUM
brj-24894	457	3	)	)	PUNCT
brj-24894	457	4	.	.	PUNCT
brj-24894	458	1	“	"	PUNCT
brj-24894	458	2	endoglucanase	endoglucanase	VERB
brj-24894	458	3	tpcel12a	tpcel12a	NOUN
brj-24894	458	4	traits	trait	NOUN
brj-24894	458	5	,	,	PUNCT
brj-24894	458	6	”	"	PUNCT
brj-24894	458	7	bioresources	bioresource	NOUN
brj-24894	458	8	21(1	21(1	NUM
brj-24894	458	9	)	)	PUNCT
brj-24894	458	10	,	,	PUNCT
brj-24894	458	11	547	547	NUM
brj-24894	458	12	-	-	SYM
brj-24894	458	13	569	569	NUM
brj-24894	458	14	.	.	PUNCT
brj-24894	459	1	566	566	NUM
brj-24894	459	2	appendix	appendix	ADJ
brj-24894	459	3	appendix	appendix	ADJ
brj-24894	459	4	i.	i.	NOUN
brj-24894	459	5	strains	strain	NOUN
brj-24894	459	6	and	and	CCONJ
brj-24894	459	7	plasmids	plasmid	NOUN
brj-24894	459	8	used	use	VERB
brj-24894	459	9	in	in	ADP
brj-24894	459	10	this	this	DET
brj-24894	459	11	study	study	NOUN
brj-24894	459	12	strains	strain	VERB
brj-24894	459	13	/	/	SYM
brj-24894	459	14	plasmids	plasmid	NOUN
brj-24894	459	15	features	feature	VERB
brj-24894	459	16	origin	origin	NOUN
brj-24894	459	17	e.	e.	PROPN
brj-24894	459	18	coli	coli	PROPN
brj-24894	459	19	top10	top10	PROPN
brj-24894	459	20	f	f	NOUN
brj-24894	459	21	-	-	PUNCT
brj-24894	459	22	mcra	mcra	VERB
brj-24894	459	23	δ(mrr	δ(mrr	ADJ
brj-24894	459	24	-	-	PUNCT
brj-24894	459	25	hsdrms	hsdrm	NOUN
brj-24894	459	26	-	-	PUNCT
brj-24894	459	27	mcrbc	mcrbc	NOUN
brj-24894	459	28	)	)	PUNCT
brj-24894	459	29	φ80laczδm15	φ80laczδm15	NOUN
brj-24894	459	30	δlacx74	δlacx74	NOUN
brj-24894	459	31	reca1	reca1	NOUN
brj-24894	459	32	arad139	arad139	PROPN
brj-24894	459	33	δ(ara	δ(ara	PROPN
brj-24894	459	34	,	,	PUNCT
brj-24894	459	35	leu)7697	leu)7697	PUNCT
brj-24894	459	36	galu	galu	NOUN
brj-24894	459	37	galk	galk	NOUN
brj-24894	459	38	rpsl	rpsl	NOUN
brj-24894	459	39	(	(	PUNCT
brj-24894	459	40	strr	strr	NOUN
brj-24894	459	41	)	)	PUNCT
brj-24894	459	42	enda1	enda1	NOUN
brj-24894	459	43	nupg	nupg	PROPN
brj-24894	459	44	thermo	thermo	PROPN
brj-24894	459	45	fisher	fisher	PROPN
brj-24894	459	46	scientific	scientific	ADJ
brj-24894	459	47	t.	t.	NOUN
brj-24894	459	48	pinophilus	pinophilus	ADJ
brj-24894	459	49	strain	strain	VERB
brj-24894	459	50	y117	y117	NUM
brj-24894	459	51	cellulase	cellulase	NOUN
brj-24894	459	52	high	high	ADV
brj-24894	459	53	-	-	PUNCT
brj-24894	459	54	yielding	yield	VERB
brj-24894	459	55	strain	strain	NOUN
brj-24894	459	56	lab	lab	NOUN
brj-24894	459	57	oetpcel12a	oetpcel12a	ADJ
brj-24894	459	58	tpcel12a	tpcel12a	NOUN
brj-24894	459	59	overexpression	overexpression	NOUN
brj-24894	459	60	mutant	mutant	NOUN
brj-24894	459	61	this	this	DET
brj-24894	459	62	study	study	NOUN
brj-24894	459	63	oetpcel12a(+tqa	oetpcel12a(+tqa	PROPN
brj-24894	459	64	)	)	PUNCT
brj-24894	459	65	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	459	66	)	)	PUNCT
brj-24894	459	67	overexpression	overexpression	NOUN
brj-24894	459	68	mutant	mutant	NOUN
brj-24894	459	69	this	this	DET
brj-24894	459	70	study	study	NOUN
brj-24894	459	71	puc57	puc57	PROPN
brj-24894	459	72	cole1	cole1	PROPN
brj-24894	459	73	origin	origin	NOUN
brj-24894	459	74	,	,	PUNCT
brj-24894	459	75	ampr	ampr	ADP
brj-24894	459	76	lab	lab	NOUN
brj-24894	459	77	plko.1	plko.1	VERB
brj-24894	459	78	-	-	PUNCT
brj-24894	459	79	hygro	hygro	ADJ
brj-24894	459	80	f1	f1	NOUN
brj-24894	459	81	origin	origin	NOUN
brj-24894	459	82	,	,	PUNCT
brj-24894	459	83	ampr	ampr	NOUN
brj-24894	459	84	,	,	PUNCT
brj-24894	459	85	hygr	hygr	ADJ
brj-24894	459	86	lab	lab	NOUN
brj-24894	459	87	pbip	pbip	NOUN
brj-24894	459	88	-	-	PUNCT
brj-24894	459	89	tpcel12a	tpcel12a	NOUN
brj-24894	459	90	overexpressing	overexpresse	VERB
brj-24894	459	91	recombinant	recombinant	ADJ
brj-24894	459	92	tpcel12a	tpcel12a	NOUN
brj-24894	459	93	this	this	DET
brj-24894	459	94	study	study	NOUN
brj-24894	459	95	pbip	pbip	NOUN
brj-24894	459	96	-	-	PUNCT
brj-24894	459	97	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	459	98	)	)	PUNCT
brj-24894	459	99	overexpressing	overexpresse	VERB
brj-24894	459	100	tpcel12a	tpcel12a	NOUN
brj-24894	459	101	mutant	mutant	ADJ
brj-24894	459	102	tpcel12a(+tqa	tpcel12a(+tqa	PROPN
brj-24894	459	103	)	)	PUNCT
brj-24894	459	104	this	this	DET
brj-24894	459	105	study	study	NOUN
brj-24894	459	106	appendix	appendix	PROPN
brj-24894	459	107	ii	ii	PROPN
brj-24894	459	108	.	.	PUNCT
brj-24894	460	1	oligonucleotides	oligonucleotide	NOUN
brj-24894	460	2	used	use	VERB
brj-24894	460	3	in	in	ADP
brj-24894	460	4	this	this	DET
brj-24894	460	5	study	study	NOUN
brj-24894	460	6	primer	primer	NOUN
brj-24894	460	7	sequence	sequence	NOUN
brj-24894	460	8	(	(	PUNCT
brj-24894	460	9	5’→3	5’→3	NOUN
brj-24894	460	10	’	'	PUNCT
brj-24894	460	11	)	)	PUNCT
brj-24894	460	12	tpcbh1	tpcbh1	PROPN
brj-24894	460	13	-	-	PUNCT
brj-24894	460	14	prom	prom	PROPN
brj-24894	460	15	-	-	PUNCT
brj-24894	460	16	f	f	NOUN
brj-24894	460	17	aaacgacggccagtgaattcgcggccgcggtcgaatagctgcgacata	aaacgacggccagtgaattcgcggccgcggtcgaatagctgcgacata	NOUN
brj-24894	460	18	ta	ta	ADP
brj-24894	460	19	tpcbh1	tpcbh1	PROPN
brj-24894	460	20	-	-	PUNCT
brj-24894	460	21	prom	prom	PROPN
brj-24894	460	22	-	-	PUNCT
brj-24894	460	23	r	r	NOUN
brj-24894	460	24	aaaagttagcttcattgtgtcgattgcttctgactgt	aaaagttagcttcattgtgtcgattgcttctgactgt	NOUN
brj-24894	460	25	tpcel12a	tpcel12a	NOUN
brj-24894	460	26	-	-	PUNCT
brj-24894	460	27	f	f	NOUN
brj-24894	461	1	gaagcaatcgacacaatgaagctaacttttctcctga	gaagcaatcgacacaatgaagctaacttttctcctga	PROPN
brj-24894	461	2	tpcel12a	tpcel12a	NOUN
brj-24894	461	3	-	-	PUNCT
brj-24894	461	4	r	r	NOUN
brj-24894	461	5	attgcgtatatggaattaatggtggtgatggtgatggtggtgattgac	attgcgtatatggaattaatggtggtgatggtgatggtggtgattgac	NOUN
brj-24894	461	6	agatgcagaccaatg	agatgcagaccaatg	NOUN
brj-24894	461	7	trcbh1	trcbh1	PROPN
brj-24894	461	8	-	-	PUNCT
brj-24894	461	9	ter	ter	NOUN
brj-24894	461	10	-	-	PUNCT
brj-24894	461	11	f	f	NOUN
brj-24894	461	12	catcaccaccattaattccatatacgcaatagtattc	catcaccaccattaattccatatacgcaatagtattc	NOUN
brj-24894	461	13	trcbh1	trcbh1	NOUN
brj-24894	461	14	-	-	PUNCT
brj-24894	461	15	ter	ter	NOUN
brj-24894	461	16	-	-	PUNCT
brj-24894	461	17	r	r	NOUN
brj-24894	461	18	gcgaggtaccgagctctcgaacaaagcaagtcgggcga	gcgaggtaccgagctctcgaacaaagcaagtcgggcga	ADJ
brj-24894	461	19	trpk	trpk	NOUN
brj-24894	461	20	-	-	PUNCT
brj-24894	461	21	prom	prom	NOUN
brj-24894	461	22	-	-	PUNCT
brj-24894	461	23	f	f	PROPN
brj-24894	461	24	tagatatcggatcccgggagcctgctggctgtttcgccag	tagatatcggatcccgggagcctgctggctgtttcgccag	PROPN
brj-24894	461	25	trpk	trpk	PROPN
brj-24894	461	26	-	-	PUNCT
brj-24894	461	27	prom	prom	NOUN
brj-24894	461	28	-	-	PUNCT
brj-24894	461	29	r	r	NOUN
brj-24894	461	30	ttcaggcttcttcatcttggaagttgctgcggggaag	ttcaggcttcttcatcttggaagttgctgcggggaag	NOUN
brj-24894	461	31	hyg	hyg	PROPN
brj-24894	461	32	-	-	PUNCT
brj-24894	461	33	f	f	PROPN
brj-24894	461	34	gcagcaacttccaagatgaagaagcctgaactcaccg	gcagcaacttccaagatgaagaagcctgaactcaccg	PROPN
brj-24894	461	35	hyg	hyg	PROPN
brj-24894	461	36	-	-	PUNCT
brj-24894	461	37	r	r	NOUN
brj-24894	461	38	accgatatcaaccatctattcctttgccctcggacga	accgatatcaaccatctattcctttgccctcggacga	NOUN
brj-24894	461	39	tscbh1	tscbh1	NOUN
brj-24894	461	40	-	-	PUNCT
brj-24894	461	41	ter	ter	NOUN
brj-24894	461	42	-	-	PUNCT
brj-24894	461	43	f	f	PROPN
brj-24894	461	44	agggcaaaggaatagatggttgatatcggttggatgg	agggcaaaggaatagatggttgatatcggttggatgg	NOUN
brj-24894	461	45	tscbh1	tscbh1	PROPN
brj-24894	461	46	-	-	PUNCT
brj-24894	461	47	ter	ter	NOUN
brj-24894	461	48	-	-	PUNCT
brj-24894	461	49	r	r	NOUN
brj-24894	461	50	atgcaggcctctgcaggcggccgcggtaatcaattgtctttttttttag	atgcaggcctctgcaggcggccgcggtaatcaattgtctttttttttag	NOUN
brj-24894	461	51	g	g	PROPN
brj-24894	461	52	tpcel12a	tpcel12a	NOUN
brj-24894	461	53	-	-	PUNCT
brj-24894	461	54	intqa	intqa	NOUN
brj-24894	461	55	-	-	PUNCT
brj-24894	461	56	f	f	NOUN
brj-24894	461	57	gtaaacacccaagccggatcccaaaaaacgtacag	gtaaacacccaagccggatcccaaaaaacgtacag	VERB
brj-24894	461	58	tpcel12a	tpcel12a	NOUN
brj-24894	461	59	-	-	PUNCT
brj-24894	461	60	intqa	intqa	NOUN
brj-24894	461	61	-	-	PUNCT
brj-24894	461	62	r	r	NOUN
brj-24894	461	63	ggatccggcttgggtgtttacgccataccacag	ggatccggcttgggtgtttacgccataccacag	NOUN
brj-24894	461	64	bold	bold	ADJ
brj-24894	461	65	and	and	CCONJ
brj-24894	461	66	underlined	underline	VERB
brj-24894	461	67	nucleotides	nucleotide	NOUN
brj-24894	461	68	indicate	indicate	VERB
brj-24894	461	69	the	the	DET
brj-24894	461	70	recognition	recognition	NOUN
brj-24894	461	71	site	site	NOUN
brj-24894	461	72	of	of	ADP
brj-24894	461	73	noti	noti	PROPN
brj-24894	461	74	and	and	CCONJ
brj-24894	461	75	codons	codon	NOUN
brj-24894	461	76	of	of	ADP
brj-24894	461	77	8×histag	8×histag	NUM
brj-24894	461	78	,	,	PUNCT
brj-24894	461	79	respectively	respectively	ADV
brj-24894	461	80	appendix	appendix	ADJ
brj-24894	461	81	iii	iii	NUM
brj-24894	461	82	:	:	PUNCT
brj-24894	461	83	methods	method	NOUN
brj-24894	461	84	sample	sample	NOUN
brj-24894	461	85	preparation	preparation	NOUN
brj-24894	461	86	for	for	ADP
brj-24894	461	87	liquid	liquid	ADJ
brj-24894	461	88	chromatography	chromatography	NOUN
brj-24894	461	89	-	-	PUNCT
brj-24894	461	90	tandem	tandem	NOUN
brj-24894	461	91	mass	mass	ADJ
brj-24894	461	92	spectrometry	spectrometry	NOUN
brj-24894	461	93	(	(	PUNCT
brj-24894	461	94	lc	lc	PROPN
brj-24894	461	95	-	-	PUNCT
brj-24894	461	96	ms	ms	PROPN
brj-24894	461	97	/	/	SYM
brj-24894	461	98	ms	ms	PROPN
brj-24894	461	99	)	)	PUNCT
brj-24894	461	100	the	the	DET
brj-24894	461	101	purified	purified	ADJ
brj-24894	461	102	tpcel12a	tpcel12a	NOUN
brj-24894	461	103	was	be	AUX
brj-24894	461	104	treated	treat	VERB
brj-24894	461	105	with	with	ADP
brj-24894	461	106	10	10	NUM
brj-24894	461	107	mmol	mmol	NOUN
brj-24894	461	108	/	/	SYM
brj-24894	461	109	l	l	NOUN
brj-24894	461	110	dithiothreitol	dithiothreitol	NOUN
brj-24894	461	111	(	(	PUNCT
brj-24894	461	112	dtt	dtt	NOUN
brj-24894	461	113	)	)	PUNCT
brj-24894	461	114	at	at	ADP
brj-24894	461	115	56	56	NUM
brj-24894	461	116	°	°	NOUN
brj-24894	461	117	c	c	NOUN
brj-24894	461	118	for	for	SCONJ
brj-24894	461	119	1	1	NUM
brj-24894	461	120	h	h	NOUN
brj-24894	461	121	to	to	PART
brj-24894	461	122	reduce	reduce	VERB
brj-24894	461	123	its	its	PRON
brj-24894	461	124	disulfide	disulfide	NOUN
brj-24894	461	125	bonds	bond	NOUN
brj-24894	461	126	.	.	PUNCT
brj-24894	462	1	subsequently	subsequently	ADV
brj-24894	462	2	,	,	PUNCT
brj-24894	462	3	the	the	DET
brj-24894	462	4	reduced	reduce	VERB
brj-24894	462	5	thiol	thiol	ADJ
brj-24894	462	6	groups	group	NOUN
brj-24894	462	7	were	be	AUX
brj-24894	462	8	alkylated	alkylate	VERB
brj-24894	462	9	by	by	ADP
brj-24894	462	10	adding	add	VERB
brj-24894	462	11	iodoacetamide	iodoacetamide	NOUN
brj-24894	462	12	(	(	PUNCT
brj-24894	462	13	iaa	iaa	NOUN
brj-24894	462	14	)	)	PUNCT
brj-24894	462	15	at	at	ADP
brj-24894	462	16	a	a	DET
brj-24894	462	17	final	final	ADJ
brj-24894	462	18	concentration	concentration	NOUN
brj-24894	462	19	of	of	ADP
brj-24894	462	20	20	20	NUM
brj-24894	462	21	mmol	mmol	NOUN
brj-24894	462	22	/	/	SYM
brj-24894	462	23	l	l	NOUN
brj-24894	462	24	in	in	ADP
brj-24894	462	25	the	the	DET
brj-24894	462	26	dark	dark	NOUN
brj-24894	462	27	at	at	ADP
brj-24894	462	28	room	room	NOUN
brj-24894	462	29	temperature	temperature	NOUN
brj-24894	462	30	.	.	PUNCT
brj-24894	463	1	the	the	DET
brj-24894	463	2	alkylated	alkylate	VERB
brj-24894	463	3	tpcel12a	tpcel12a	NOUN
brj-24894	463	4	was	be	AUX
brj-24894	463	5	then	then	ADV
brj-24894	463	6	subjected	subject	VERB
brj-24894	463	7	to	to	ADP
brj-24894	463	8	enzymatic	enzymatic	ADJ
brj-24894	463	9	digestion	digestion	NOUN
brj-24894	463	10	using	use	VERB
brj-24894	463	11	gluc	gluc	NOUN
brj-24894	463	12	protease	protease	NOUN
brj-24894	463	13	under	under	ADP
brj-24894	463	14	sealed	seal	VERB
brj-24894	463	15	conditions	condition	NOUN
brj-24894	463	16	at	at	ADP
brj-24894	463	17	37	37	NUM
brj-24894	463	18	°	°	NOUN
brj-24894	463	19	c	c	NOUN
brj-24894	463	20	for	for	ADP
brj-24894	463	21	16	16	NUM
brj-24894	463	22	h.	h.	NOUN
brj-24894	463	23	after	after	ADP
brj-24894	463	24	digestion	digestion	NOUN
brj-24894	463	25	,	,	PUNCT
brj-24894	463	26	a	a	DET
brj-24894	463	27	peptide	peptide	NOUN
brj-24894	463	28	extraction	extraction	NOUN
brj-24894	463	29	solution	solution	NOUN
brj-24894	463	30	(	(	PUNCT
brj-24894	463	31	5	5	NUM
brj-24894	463	32	%	%	NOUN
brj-24894	463	33	trifluoroacetic	trifluoroacetic	ADJ
brj-24894	463	34	acid	acid	NOUN
brj-24894	464	1	[	[	X
brj-24894	464	2	tfa	tfa	X
brj-24894	464	3	]	]	X
brj-24894	464	4	,	,	PUNCT
brj-24894	464	5	50	50	NUM
brj-24894	464	6	%	%	NOUN
brj-24894	464	7	acetonitrile	acetonitrile	NOUN
brj-24894	465	1	[	[	X
brj-24894	465	2	acn	acn	PROPN
brj-24894	465	3	]	]	X
brj-24894	465	4	,	,	PUNCT
brj-24894	465	5	and	and	CCONJ
brj-24894	465	6	45	45	NUM
brj-24894	465	7	%	%	NOUN
brj-24894	465	8	water	water	NOUN
brj-24894	465	9	)	)	PUNCT
brj-24894	465	10	was	be	AUX
brj-24894	465	11	added	add	VERB
brj-24894	465	12	,	,	PUNCT
brj-24894	465	13	followed	follow	VERB
brj-24894	465	14	by	by	ADP
brj-24894	465	15	incubation	incubation	NOUN
brj-24894	465	16	in	in	ADP
brj-24894	465	17	a	a	DET
brj-24894	465	18	37	37	NUM
brj-24894	465	19	°	°	NOUN
brj-24894	465	20	c	c	NOUN
brj-24894	465	21	water	water	NOUN
brj-24894	465	22	bath	bath	NOUN
brj-24894	465	23	for	for	ADP
brj-24894	465	24	1	1	NUM
brj-24894	465	25	h.	h.	NOUN
brj-24894	465	26	the	the	DET
brj-24894	465	27	mixture	mixture	NOUN
brj-24894	465	28	was	be	AUX
brj-24894	465	29	then	then	ADV
brj-24894	465	30	ultrasonicated	ultrasonicated	ADJ
brj-24894	465	31	for	for	ADP
brj-24894	465	32	5	5	NUM
brj-24894	465	33	min	min	NOUN
brj-24894	465	34	and	and	CCONJ
brj-24894	465	35	centrifuged	centrifuge	VERB
brj-24894	465	36	for	for	SCONJ
brj-24894	465	37	5	5	NUM
brj-24894	465	38	min	min	NOUN
brj-24894	465	39	to	to	PART
brj-24894	465	40	obtain	obtain	VERB
brj-24894	465	41	the	the	DET
brj-24894	465	42	peptide	peptide	ADJ
brj-24894	465	43	extract	extract	NOUN
brj-24894	465	44	.	.	PUNCT
brj-24894	466	1	finally	finally	ADV
brj-24894	466	2	,	,	PUNCT
brj-24894	466	3	the	the	DET
brj-24894	466	4	digested	digested	ADJ
brj-24894	466	5	peptides	peptide	NOUN
brj-24894	466	6	of	of	ADP
brj-24894	466	7	tpcel12a	tpcel12a	NOUN
brj-24894	466	8	were	be	AUX
brj-24894	466	9	desalted	desalt	VERB
brj-24894	466	10	and	and	CCONJ
brj-24894	466	11	prepared	prepare	VERB
brj-24894	466	12	for	for	ADP
brj-24894	466	13	further	further	ADJ
brj-24894	466	14	analysis	analysis	NOUN
brj-24894	466	15	.	.	PUNCT
brj-24894	467	1	peer	peer	NOUN
brj-24894	467	2	-	-	PUNCT
brj-24894	467	3	reviewed	review	VERB
brj-24894	467	4	article	article	NOUN
brj-24894	467	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	467	6	li	li	PROPN
brj-24894	467	7	et	et	PROPN
brj-24894	467	8	al	al	PROPN
brj-24894	467	9	.	.	PROPN
brj-24894	468	1	(	(	PUNCT
brj-24894	468	2	2026	2026	NUM
brj-24894	468	3	)	)	PUNCT
brj-24894	468	4	.	.	PUNCT
brj-24894	469	1	“	"	PUNCT
brj-24894	469	2	endoglucanase	endoglucanase	VERB
brj-24894	469	3	tpcel12a	tpcel12a	NOUN
brj-24894	469	4	traits	trait	NOUN
brj-24894	469	5	,	,	PUNCT
brj-24894	469	6	”	"	PUNCT
brj-24894	469	7	bioresources	bioresource	NOUN
brj-24894	469	8	21(1	21(1	NUM
brj-24894	469	9	)	)	PUNCT
brj-24894	469	10	,	,	PUNCT
brj-24894	469	11	547	547	NUM
brj-24894	469	12	-	-	SYM
brj-24894	469	13	569	569	NUM
brj-24894	469	14	.	.	PUNCT
brj-24894	470	1	567	567	NUM
brj-24894	470	2	lc	lc	PROPN
brj-24894	470	3	-	-	PUNCT
brj-24894	470	4	ms	ms	PROPN
brj-24894	470	5	/	/	SYM
brj-24894	470	6	ms	ms	NOUN
brj-24894	470	7	analysis	analysis	NOUN
brj-24894	470	8	of	of	ADP
brj-24894	470	9	digests	digest	NOUN
brj-24894	470	10	lc	lc	PROPN
brj-24894	470	11	-	-	PUNCT
brj-24894	470	12	ms	ms	NOUN
brj-24894	470	13	/	/	SYM
brj-24894	470	14	ms	ms	PROPN
brj-24894	470	15	was	be	AUX
brj-24894	470	16	conducted	conduct	VERB
brj-24894	470	17	using	use	VERB
brj-24894	470	18	an	an	DET
brj-24894	470	19	orbitrap	orbitrap	ADJ
brj-24894	470	20	eclipse	eclipse	NOUN
brj-24894	470	21	mass	mass	NOUN
brj-24894	470	22	spectrometer	spectrometer	NOUN
brj-24894	470	23	(	(	PUNCT
brj-24894	470	24	thermo	thermo	NOUN
brj-24894	470	25	scientific	scientific	PROPN
brj-24894	470	26	,	,	PUNCT
brj-24894	470	27	usa	usa	PROPN
brj-24894	470	28	)	)	PUNCT
brj-24894	470	29	coupled	couple	VERB
brj-24894	470	30	with	with	ADP
brj-24894	470	31	an	an	DET
brj-24894	470	32	ultimate	ultimate	ADJ
brj-24894	470	33	3000	3000	NUM
brj-24894	470	34	nano	nano	NOUN
brj-24894	470	35	-	-	PUNCT
brj-24894	470	36	lc	lc	NOUN
brj-24894	470	37	system	system	NOUN
brj-24894	470	38	.	.	PUNCT
brj-24894	471	1	for	for	ADP
brj-24894	471	2	each	each	DET
brj-24894	471	3	injection	injection	NOUN
brj-24894	471	4	,	,	PUNCT
brj-24894	471	5	5	5	NUM
brj-24894	471	6	μl	μl	NOUN
brj-24894	471	7	of	of	ADP
brj-24894	471	8	the	the	DET
brj-24894	471	9	sample	sample	NOUN
brj-24894	471	10	was	be	AUX
brj-24894	471	11	loaded	load	VERB
brj-24894	471	12	onto	onto	ADP
brj-24894	471	13	a	a	DET
brj-24894	471	14	c18	c18	NOUN
brj-24894	471	15	pepmap100	pepmap100	PROPN
brj-24894	471	16	trap	trap	NOUN
brj-24894	471	17	column	column	NOUN
brj-24894	471	18	(	(	PUNCT
brj-24894	471	19	300	300	NUM
brj-24894	471	20	μm	μm	NUM
brj-24894	471	21	×	×	NOUN
brj-24894	471	22	5	5	NUM
brj-24894	471	23	mm	mm	NOUN
brj-24894	471	24	,	,	PUNCT
brj-24894	471	25	thermo	thermo	NOUN
brj-24894	471	26	scientific	scientific	NOUN
brj-24894	471	27	,	,	PUNCT
brj-24894	471	28	usa	usa	PROPN
brj-24894	471	29	)	)	PUNCT
brj-24894	471	30	and	and	CCONJ
brj-24894	471	31	subsequently	subsequently	ADV
brj-24894	471	32	separated	separate	VERB
brj-24894	471	33	on	on	ADP
brj-24894	471	34	an	an	DET
brj-24894	471	35	analytical	analytical	ADJ
brj-24894	471	36	column	column	NOUN
brj-24894	471	37	(	(	PUNCT
brj-24894	471	38	acclaim	acclaim	PROPN
brj-24894	471	39	pepmap	pepmap	NOUN
brj-24894	471	40	rplc	rplc	NOUN
brj-24894	471	41	,	,	PUNCT
brj-24894	471	42	150	150	NUM
brj-24894	471	43	μm	μm	NUM
brj-24894	471	44	×	×	NOUN
brj-24894	471	45	15	15	NUM
brj-24894	471	46	cm	cm	NOUN
brj-24894	471	47	,	,	PUNCT
brj-24894	471	48	thermo	thermo	NOUN
brj-24894	471	49	scientific	scientific	NOUN
brj-24894	471	50	,	,	PUNCT
brj-24894	471	51	usa	usa	PROPN
brj-24894	471	52	)	)	PUNCT
brj-24894	471	53	using	use	VERB
brj-24894	471	54	a	a	DET
brj-24894	471	55	72	72	NUM
brj-24894	471	56	-	-	PUNCT
brj-24894	471	57	min	min	NOUN
brj-24894	471	58	linear	linear	PROPN
brj-24894	471	59	gradient	gradient	NOUN
brj-24894	471	60	.	.	PUNCT
brj-24894	472	1	the	the	DET
brj-24894	472	2	gradient	gradient	NOUN
brj-24894	472	3	profile	profile	NOUN
brj-24894	472	4	was	be	AUX
brj-24894	472	5	as	as	SCONJ
brj-24894	472	6	follows	follow	VERB
brj-24894	472	7	:	:	PUNCT
brj-24894	472	8	4%–9	4%–9	NUM
brj-24894	472	9	%	%	NOUN
brj-24894	472	10	solvent	solvent	PROPN
brj-24894	472	11	b	b	PROPN
brj-24894	472	12	(	(	PUNCT
brj-24894	472	13	0.1	0.1	NUM
brj-24894	472	14	%	%	NOUN
brj-24894	472	15	formic	formic	NOUN
brj-24894	472	16	acid	acid	NOUN
brj-24894	472	17	in	in	ADP
brj-24894	472	18	90	90	NUM
brj-24894	472	19	%	%	NOUN
brj-24894	472	20	acetonitrile	acetonitrile	NOUN
brj-24894	472	21	)	)	PUNCT
brj-24894	472	22	over	over	ADP
brj-24894	472	23	3	3	NUM
brj-24894	472	24	min	min	NOUN
brj-24894	472	25	,	,	PUNCT
brj-24894	472	26	9%–22	9%–22	NUM
brj-24894	472	27	%	%	NOUN
brj-24894	472	28	b	b	NOUN
brj-24894	472	29	over	over	ADP
brj-24894	472	30	22	22	NUM
brj-24894	472	31	min	min	NOUN
brj-24894	472	32	,	,	PUNCT
brj-24894	472	33	22%–32	22%–32	NUM
brj-24894	472	34	%	%	NOUN
brj-24894	472	35	b	b	NOUN
brj-24894	472	36	over	over	ADP
brj-24894	472	37	22	22	NUM
brj-24894	472	38	min	min	NOUN
brj-24894	472	39	,	,	PUNCT
brj-24894	472	40	32%–42	32%–42	NUM
brj-24894	472	41	%	%	NOUN
brj-24894	472	42	b	b	NOUN
brj-24894	472	43	over	over	ADP
brj-24894	472	44	13	13	NUM
brj-24894	472	45	min	min	NOUN
brj-24894	472	46	,	,	PUNCT
brj-24894	472	47	42%–95	42%–95	PROPN
brj-24894	472	48	%	%	NOUN
brj-24894	472	49	b	b	NOUN
brj-24894	472	50	over	over	ADP
brj-24894	472	51	4	4	NUM
brj-24894	472	52	min	min	NOUN
brj-24894	472	53	,	,	PUNCT
brj-24894	472	54	followed	follow	VERB
brj-24894	472	55	by	by	ADP
brj-24894	472	56	a	a	DET
brj-24894	472	57	8	8	NUM
brj-24894	472	58	-	-	PUNCT
brj-24894	472	59	min	min	NOUN
brj-24894	472	60	hold	hold	NOUN
brj-24894	472	61	at	at	ADP
brj-24894	472	62	95	95	NUM
brj-24894	472	63	%	%	NOUN
brj-24894	472	64	b	b	NOUN
brj-24894	472	65	(	(	PUNCT
brj-24894	472	66	solvent	solvent	NOUN
brj-24894	472	67	a	a	DET
brj-24894	472	68	:	:	SYM
brj-24894	472	69	0.1	0.1	NUM
brj-24894	472	70	%	%	NOUN
brj-24894	472	71	formic	formic	ADJ
brj-24894	472	72	acid	acid	NOUN
brj-24894	472	73	in	in	ADP
brj-24894	472	74	water	water	NOUN
brj-24894	472	75	)	)	PUNCT
brj-24894	472	76	.	.	PUNCT
brj-24894	473	1	the	the	DET
brj-24894	473	2	flow	flow	NOUN
brj-24894	473	3	rate	rate	NOUN
brj-24894	473	4	was	be	AUX
brj-24894	473	5	maintained	maintain	VERB
brj-24894	473	6	at	at	ADP
brj-24894	473	7	0.3	0.3	NUM
brj-24894	473	8	μl	μl	PROPN
brj-24894	473	9	/	/	SYM
brj-24894	473	10	min	min	PROPN
brj-24894	473	11	.	.	PROPN
brj-24894	473	12	mass	mass	PROPN
brj-24894	473	13	spectrometry	spectrometry	NOUN
brj-24894	473	14	analysis	analysis	NOUN
brj-24894	473	15	was	be	AUX
brj-24894	473	16	performed	perform	VERB
brj-24894	473	17	in	in	ADP
brj-24894	473	18	data	data	NOUN
brj-24894	473	19	-	-	PUNCT
brj-24894	473	20	dependent	dependent	ADJ
brj-24894	473	21	acquisition	acquisition	NOUN
brj-24894	473	22	(	(	PUNCT
brj-24894	473	23	dda	dda	ADJ
brj-24894	473	24	)	)	PUNCT
brj-24894	473	25	mode	mode	NOUN
brj-24894	473	26	.	.	PUNCT
brj-24894	474	1	full	full	ADJ
brj-24894	474	2	-	-	PUNCT
brj-24894	474	3	scan	scan	NOUN
brj-24894	474	4	ms	ms	PROPN
brj-24894	474	5	spectra	spectra	PROPN
brj-24894	474	6	(	(	PUNCT
brj-24894	474	7	350	350	NUM
brj-24894	474	8	to	to	PART
brj-24894	474	9	1500	1500	NUM
brj-24894	474	10	m	m	NOUN
brj-24894	474	11	/	/	SYM
brj-24894	474	12	z	z	NOUN
brj-24894	474	13	)	)	PUNCT
brj-24894	474	14	were	be	AUX
brj-24894	474	15	acquired	acquire	VERB
brj-24894	474	16	at	at	ADP
brj-24894	474	17	a	a	DET
brj-24894	474	18	resolution	resolution	NOUN
brj-24894	474	19	of	of	ADP
brj-24894	474	20	60,000	60,000	NUM
brj-24894	474	21	(	(	PUNCT
brj-24894	474	22	at	at	ADP
brj-24894	474	23	200	200	NUM
brj-24894	474	24	m	m	NOUN
brj-24894	474	25	/	/	SYM
brj-24894	474	26	z	z	NOUN
brj-24894	474	27	)	)	PUNCT
brj-24894	474	28	,	,	PUNCT
brj-24894	474	29	with	with	ADP
brj-24894	474	30	an	an	DET
brj-24894	474	31	automatic	automatic	ADJ
brj-24894	474	32	gain	gain	NOUN
brj-24894	474	33	control	control	NOUN
brj-24894	474	34	(	(	PUNCT
brj-24894	474	35	agc	agc	NOUN
brj-24894	474	36	)	)	PUNCT
brj-24894	474	37	target	target	NOUN
brj-24894	474	38	of	of	ADP
brj-24894	474	39	4×105	4×105	NUM
brj-24894	474	40	ions	ion	NOUN
brj-24894	474	41	and	and	CCONJ
brj-24894	474	42	a	a	DET
brj-24894	474	43	maximum	maximum	ADJ
brj-24894	474	44	injection	injection	NOUN
brj-24894	474	45	time	time	NOUN
brj-24894	474	46	of	of	ADP
brj-24894	474	47	50	50	NUM
brj-24894	474	48	ms	ms	NOUN
brj-24894	474	49	.	.	PUNCT
brj-24894	475	1	the	the	DET
brj-24894	475	2	top	top	ADJ
brj-24894	475	3	15	15	NUM
brj-24894	475	4	or	or	CCONJ
brj-24894	475	5	20	20	NUM
brj-24894	475	6	most	most	ADV
brj-24894	475	7	intense	intense	ADJ
brj-24894	475	8	precursor	precursor	NOUN
brj-24894	475	9	ions	ion	NOUN
brj-24894	475	10	were	be	AUX
brj-24894	475	11	selected	select	VERB
brj-24894	475	12	for	for	ADP
brj-24894	475	13	fragmentation	fragmentation	NOUN
brj-24894	475	14	via	via	ADP
brj-24894	475	15	higher	high	ADJ
brj-24894	475	16	-	-	PUNCT
brj-24894	475	17	energy	energy	NOUN
brj-24894	475	18	collisional	collisional	ADJ
brj-24894	475	19	dissociation	dissociation	NOUN
brj-24894	475	20	(	(	PUNCT
brj-24894	475	21	hcd	hcd	ADJ
brj-24894	475	22	)	)	PUNCT
brj-24894	475	23	at	at	ADP
brj-24894	475	24	a	a	DET
brj-24894	475	25	normalized	normalize	VERB
brj-24894	475	26	collision	collision	NOUN
brj-24894	475	27	energy	energy	NOUN
brj-24894	475	28	(	(	PUNCT
brj-24894	475	29	nce	nce	NOUN
brj-24894	475	30	)	)	PUNCT
brj-24894	475	31	of	of	ADP
brj-24894	475	32	30	30	NUM
brj-24894	475	33	%	%	NOUN
brj-24894	475	34	.	.	PUNCT
brj-24894	476	1	ms	ms	PROPN
brj-24894	476	2	/	/	SYM
brj-24894	476	3	ms	ms	PROPN
brj-24894	476	4	spectra	spectra	PROPN
brj-24894	476	5	were	be	AUX
brj-24894	476	6	collected	collect	VERB
brj-24894	476	7	at	at	ADP
brj-24894	476	8	a	a	DET
brj-24894	476	9	resolution	resolution	NOUN
brj-24894	476	10	of	of	ADP
brj-24894	476	11	15,000	15,000	NUM
brj-24894	476	12	,	,	PUNCT
brj-24894	476	13	with	with	ADP
brj-24894	476	14	an	an	DET
brj-24894	476	15	agc	agc	NOUN
brj-24894	476	16	target	target	NOUN
brj-24894	476	17	of	of	ADP
brj-24894	476	18	5×104	5×104	NUM
brj-24894	476	19	ions	ion	NOUN
brj-24894	476	20	and	and	CCONJ
brj-24894	476	21	a	a	DET
brj-24894	476	22	maximum	maximum	ADJ
brj-24894	476	23	injection	injection	NOUN
brj-24894	476	24	time	time	NOUN
brj-24894	476	25	of	of	ADP
brj-24894	476	26	22	22	NUM
brj-24894	476	27	ms	ms	PROPN
brj-24894	476	28	.	.	PUNCT
brj-24894	477	1	the	the	DET
brj-24894	477	2	peptide	peptide	NOUN
brj-24894	477	3	identification	identification	NOUN
brj-24894	477	4	was	be	AUX
brj-24894	477	5	finally	finally	ADV
brj-24894	477	6	achieved	achieve	VERB
brj-24894	477	7	by	by	ADP
brj-24894	477	8	searching	search	VERB
brj-24894	477	9	the	the	DET
brj-24894	477	10	ms	ms	PROPN
brj-24894	477	11	/	/	SYM
brj-24894	477	12	ms	ms	PROPN
brj-24894	477	13	spectra	spectra	NOUN
brj-24894	477	14	against	against	ADP
brj-24894	477	15	the	the	DET
brj-24894	477	16	target	target	NOUN
brj-24894	477	17	sequence	sequence	NOUN
brj-24894	477	18	.	.	PUNCT
brj-24894	478	1	maldi	maldi	NOUN
brj-24894	478	2	-	-	PUNCT
brj-24894	478	3	tof	tof	PRON
brj-24894	478	4	ms	ms	NOUN
brj-24894	478	5	analysis	analysis	NOUN
brj-24894	478	6	of	of	ADP
brj-24894	478	7	final	final	ADJ
brj-24894	478	8	products	product	NOUN
brj-24894	478	9	of	of	ADP
brj-24894	478	10	xyloglucan	xyloglucan	NOUN
brj-24894	478	11	catalyzed	catalyze	VERB
brj-24894	478	12	by	by	ADP
brj-24894	478	13	tpcel12a	tpcel12a	NOUN
brj-24894	478	14	maldi	maldi	NOUN
brj-24894	478	15	-	-	PUNCT
brj-24894	478	16	tof	tof	PROPN
brj-24894	478	17	ms	ms	PROPN
brj-24894	478	18	was	be	AUX
brj-24894	478	19	conducted	conduct	VERB
brj-24894	478	20	on	on	ADP
brj-24894	478	21	a	a	DET
brj-24894	478	22	bruker	bruker	ADJ
brj-24894	478	23	autoflex	autoflex	NOUN
brj-24894	478	24	speed	speed	NOUN
brj-24894	478	25	maldi	maldi	NOUN
brj-24894	478	26	-	-	PUNCT
brj-24894	478	27	tof	tof	PROPN
brj-24894	478	28	ms	ms	PROPN
brj-24894	478	29	spectrometer	spectrometer	NOUN
brj-24894	478	30	equipped	equip	VERB
brj-24894	478	31	with	with	ADP
brj-24894	478	32	a	a	DET
brj-24894	478	33	337	337	NUM
brj-24894	478	34	nm	nm	ADJ
brj-24894	478	35	nitrogen	nitrogen	NOUN
brj-24894	478	36	laser	laser	NOUN
brj-24894	478	37	.	.	PUNCT
brj-24894	479	1	generally	generally	ADV
brj-24894	479	2	,	,	PUNCT
brj-24894	479	3	the	the	DET
brj-24894	479	4	enzymatic	enzymatic	ADJ
brj-24894	479	5	hydrolysates	hydrolysate	NOUN
brj-24894	479	6	were	be	AUX
brj-24894	479	7	dissolved	dissolve	VERB
brj-24894	479	8	in	in	ADP
brj-24894	479	9	ultrapure	ultrapure	ADJ
brj-24894	479	10	water	water	NOUN
brj-24894	479	11	.	.	PUNCT
brj-24894	480	1	a	a	DET
brj-24894	480	2	saturated	saturate	VERB
brj-24894	480	3	matrix	matrix	NOUN
brj-24894	480	4	solution	solution	NOUN
brj-24894	480	5	was	be	AUX
brj-24894	480	6	prepared	prepare	VERB
brj-24894	480	7	by	by	ADP
brj-24894	480	8	dissolving	dissolve	VERB
brj-24894	480	9	2,5	2,5	NUM
brj-24894	480	10	-	-	PUNCT
brj-24894	480	11	dihydroxybenzoic	dihydroxybenzoic	ADJ
brj-24894	480	12	acid	acid	NOUN
brj-24894	480	13	(	(	PUNCT
brj-24894	480	14	dhb	dhb	PROPN
brj-24894	480	15	)	)	PUNCT
brj-24894	480	16	in	in	ADP
brj-24894	480	17	50	50	NUM
brj-24894	480	18	%	%	NOUN
brj-24894	480	19	(	(	PUNCT
brj-24894	480	20	v	v	NOUN
brj-24894	480	21	/	/	SYM
brj-24894	480	22	v	v	NOUN
brj-24894	480	23	)	)	PUNCT
brj-24894	480	24	methanol	methanol	NOUN
brj-24894	480	25	aqueous	aqueous	ADJ
brj-24894	480	26	solution	solution	NOUN
brj-24894	480	27	containing	contain	VERB
brj-24894	480	28	0.1	0.1	NUM
brj-24894	480	29	%	%	NOUN
brj-24894	480	30	(	(	PUNCT
brj-24894	480	31	v	v	NOUN
brj-24894	480	32	/	/	SYM
brj-24894	480	33	v	v	NOUN
brj-24894	480	34	)	)	PUNCT
brj-24894	480	35	trifluoroacetic	trifluoroacetic	ADJ
brj-24894	480	36	acid	acid	NOUN
brj-24894	480	37	(	(	PUNCT
brj-24894	480	38	tfa	tfa	NOUN
brj-24894	480	39	)	)	PUNCT
brj-24894	480	40	.	.	PUNCT
brj-24894	481	1	for	for	ADP
brj-24894	481	2	maldi	maldi	NOUN
brj-24894	481	3	target	target	NOUN
brj-24894	481	4	preparation	preparation	NOUN
brj-24894	481	5	,	,	PUNCT
brj-24894	481	6	1	1	NUM
brj-24894	481	7	μl	μl	ADP
brj-24894	481	8	of	of	ADP
brj-24894	481	9	the	the	DET
brj-24894	481	10	aqueous	aqueous	ADJ
brj-24894	481	11	hydrolysate	hydrolysate	NOUN
brj-24894	481	12	solution	solution	NOUN
brj-24894	481	13	was	be	AUX
brj-24894	481	14	first	first	ADV
brj-24894	481	15	spotted	spot	VERB
brj-24894	481	16	onto	onto	ADP
brj-24894	481	17	a	a	DET
brj-24894	481	18	polished	polished	ADJ
brj-24894	481	19	stainless	stainless	ADJ
brj-24894	481	20	steel	steel	NOUN
brj-24894	481	21	target	target	NOUN
brj-24894	481	22	plate	plate	NOUN
brj-24894	481	23	and	and	CCONJ
brj-24894	481	24	allowed	allow	VERB
brj-24894	481	25	to	to	PART
brj-24894	481	26	air	air	NOUN
brj-24894	481	27	-	-	PUNCT
brj-24894	481	28	dry	dry	ADJ
brj-24894	481	29	at	at	ADP
brj-24894	481	30	room	room	NOUN
brj-24894	481	31	temperature	temperature	NOUN
brj-24894	481	32	.	.	PUNCT
brj-24894	482	1	subsequently	subsequently	ADV
brj-24894	482	2	,	,	PUNCT
brj-24894	482	3	1	1	NUM
brj-24894	482	4	μl	μl	ADP
brj-24894	482	5	of	of	ADP
brj-24894	482	6	the	the	DET
brj-24894	482	7	dhb	dhb	PROPN
brj-24894	482	8	matrix	matrix	NOUN
brj-24894	482	9	solution	solution	NOUN
brj-24894	482	10	was	be	AUX
brj-24894	482	11	carefully	carefully	ADV
brj-24894	482	12	overlaid	overlay	VERB
brj-24894	482	13	onto	onto	ADP
brj-24894	482	14	the	the	DET
brj-24894	482	15	dried	dry	VERB
brj-24894	482	16	sample	sample	NOUN
brj-24894	482	17	spot	spot	NOUN
brj-24894	482	18	and	and	CCONJ
brj-24894	482	19	similarly	similarly	ADV
brj-24894	482	20	air	air	NOUN
brj-24894	482	21	-	-	PUNCT
brj-24894	482	22	dried	dry	VERB
brj-24894	482	23	.	.	PUNCT
brj-24894	483	1	mass	mass	PROPN
brj-24894	483	2	spectrometric	spectrometric	ADJ
brj-24894	483	3	analysis	analysis	NOUN
brj-24894	483	4	was	be	AUX
brj-24894	483	5	performed	perform	VERB
brj-24894	483	6	in	in	ADP
brj-24894	483	7	positive	positive	ADJ
brj-24894	483	8	ion	ion	NOUN
brj-24894	483	9	reflection	reflection	NOUN
brj-24894	483	10	mode	mode	NOUN
brj-24894	483	11	.	.	PUNCT
brj-24894	484	1	the	the	DET
brj-24894	484	2	instrument	instrument	NOUN
brj-24894	484	3	parameters	parameter	NOUN
brj-24894	484	4	were	be	AUX
brj-24894	484	5	optimized	optimize	VERB
brj-24894	484	6	for	for	ADP
brj-24894	484	7	optimal	optimal	ADJ
brj-24894	484	8	signal	signal	NOUN
brj-24894	484	9	-	-	PUNCT
brj-24894	484	10	to	to	ADP
brj-24894	484	11	-	-	PUNCT
brj-24894	484	12	noise	noise	NOUN
brj-24894	484	13	ratio	ratio	NOUN
brj-24894	484	14	in	in	ADP
brj-24894	484	15	the	the	DET
brj-24894	484	16	target	target	NOUN
brj-24894	484	17	mass	mass	NOUN
brj-24894	484	18	range	range	NOUN
brj-24894	484	19	.	.	PUNCT
brj-24894	485	1	raw	raw	ADJ
brj-24894	485	2	spectral	spectral	ADJ
brj-24894	485	3	data	datum	NOUN
brj-24894	485	4	were	be	AUX
brj-24894	485	5	processed	process	VERB
brj-24894	485	6	and	and	CCONJ
brj-24894	485	7	analyzed	analyze	VERB
brj-24894	485	8	using	use	VERB
brj-24894	485	9	flexanalysis	flexanalysis	NOUN
brj-24894	485	10	software	software	NOUN
brj-24894	485	11	(	(	PUNCT
brj-24894	485	12	bruker	bruker	NOUN
brj-24894	485	13	daltonics	daltonic	NOUN
brj-24894	485	14	)	)	PUNCT
brj-24894	485	15	with	with	ADP
brj-24894	485	16	appropriate	appropriate	ADJ
brj-24894	485	17	baseline	baseline	NOUN
brj-24894	485	18	subtraction	subtraction	NOUN
brj-24894	485	19	and	and	CCONJ
brj-24894	485	20	noise	noise	NOUN
brj-24894	485	21	reduction	reduction	NOUN
brj-24894	485	22	algorithms	algorithm	NOUN
brj-24894	485	23	applied	apply	VERB
brj-24894	485	24	.	.	PUNCT
brj-24894	486	1	peer	peer	NOUN
brj-24894	486	2	-	-	PUNCT
brj-24894	486	3	reviewed	review	VERB
brj-24894	486	4	article	article	NOUN
brj-24894	486	5	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	486	6	li	li	PROPN
brj-24894	486	7	et	et	PROPN
brj-24894	486	8	al	al	PROPN
brj-24894	486	9	.	.	PROPN
brj-24894	487	1	(	(	PUNCT
brj-24894	487	2	2026	2026	NUM
brj-24894	487	3	)	)	PUNCT
brj-24894	487	4	.	.	PUNCT
brj-24894	488	1	“	"	PUNCT
brj-24894	488	2	endoglucanase	endoglucanase	VERB
brj-24894	488	3	tpcel12a	tpcel12a	NOUN
brj-24894	488	4	traits	trait	NOUN
brj-24894	488	5	,	,	PUNCT
brj-24894	488	6	”	"	PUNCT
brj-24894	488	7	bioresources	bioresource	NOUN
brj-24894	488	8	21(1	21(1	NUM
brj-24894	488	9	)	)	PUNCT
brj-24894	488	10	,	,	PUNCT
brj-24894	488	11	547	547	NUM
brj-24894	488	12	-	-	SYM
brj-24894	488	13	569	569	NUM
brj-24894	488	14	.	.	PUNCT
brj-24894	489	1	568	568	NUM
brj-24894	489	2	appendix	appendix	NOUN
brj-24894	489	3	iv	iv	NOUN
brj-24894	489	4	.	.	PUNCT
brj-24894	490	1	construction	construction	NOUN
brj-24894	490	2	of	of	ADP
brj-24894	490	3	tpcel12a	tpcel12a	NOUN
brj-24894	490	4	overexpression	overexpression	NOUN
brj-24894	490	5	mutant	mutant	NOUN
brj-24894	490	6	oetpcel12a	oetpcel12a	ADJ
brj-24894	490	7	plasmid	plasmid	NOUN
brj-24894	490	8	pbip	pbip	NOUN
brj-24894	490	9	-	-	PUNCT
brj-24894	490	10	tpcel12a	tpcel12a	NOUN
brj-24894	490	11	was	be	AUX
brj-24894	490	12	linearization	linearization	NOUN
brj-24894	490	13	by	by	ADP
brj-24894	490	14	noti	noti	PROPN
brj-24894	490	15	.	.	PUNCT
brj-24894	491	1	then	then	ADV
brj-24894	491	2	the	the	DET
brj-24894	491	3	linear	linear	ADJ
brj-24894	491	4	fragment	fragment	NOUN
brj-24894	491	5	was	be	AUX
brj-24894	491	6	introduced	introduce	VERB
brj-24894	491	7	into	into	ADP
brj-24894	491	8	t.	t.	PROPN
brj-24894	491	9	pinophilus	pinophilus	NOUN
brj-24894	491	10	y117	y117	NUM
brj-24894	491	11	by	by	ADP
brj-24894	491	12	protoplast	protoplast	NOUN
brj-24894	491	13	transformation	transformation	NOUN
brj-24894	491	14	.	.	PUNCT
brj-24894	492	1	hygromycin	hygromycin	PROPN
brj-24894	492	2	resistance	resistance	NOUN
brj-24894	492	3	clones	clone	NOUN
brj-24894	492	4	were	be	AUX
brj-24894	492	5	selected	select	VERB
brj-24894	492	6	and	and	CCONJ
brj-24894	492	7	the	the	DET
brj-24894	492	8	expression	expression	NOUN
brj-24894	492	9	of	of	ADP
brj-24894	492	10	tpcel12a	tpcel12a	NOUN
brj-24894	492	11	was	be	AUX
brj-24894	492	12	confirmed	confirm	VERB
brj-24894	492	13	by	by	ADP
brj-24894	492	14	western	western	ADJ
brj-24894	492	15	blot	blot	NOUN
brj-24894	492	16	.	.	PUNCT
brj-24894	493	1	appendix	appendix	NOUN
brj-24894	493	2	v.	v.	ADP
brj-24894	493	3	calibration	calibration	NOUN
brj-24894	493	4	curve	curve	NOUN
brj-24894	493	5	of	of	ADP
brj-24894	493	6	kav	kav	NOUN
brj-24894	493	7	for	for	ADP
brj-24894	493	8	the	the	DET
brj-24894	493	9	standard	standard	ADJ
brj-24894	493	10	proteins	protein	NOUN
brj-24894	493	11	(	(	PUNCT
brj-24894	493	12	low	low	ADJ
brj-24894	493	13	molecular	molecular	ADJ
brj-24894	493	14	kit	kit	NOUN
brj-24894	493	15	)	)	PUNCT
brj-24894	493	16	peer	peer	NOUN
brj-24894	493	17	-	-	PUNCT
brj-24894	493	18	reviewed	review	VERB
brj-24894	493	19	article	article	NOUN
brj-24894	493	20	bioresources.cnr.ncsu.edu	bioresources.cnr.ncsu.edu	ADP
brj-24894	493	21	li	li	PROPN
brj-24894	493	22	et	et	PROPN
brj-24894	493	23	al	al	PROPN
brj-24894	493	24	.	.	PROPN
brj-24894	494	1	(	(	PUNCT
brj-24894	494	2	2026	2026	NUM
brj-24894	494	3	)	)	PUNCT
brj-24894	494	4	.	.	PUNCT
brj-24894	495	1	“	"	PUNCT
brj-24894	495	2	endoglucanase	endoglucanase	VERB
brj-24894	495	3	tpcel12a	tpcel12a	NOUN
brj-24894	495	4	traits	trait	NOUN
brj-24894	495	5	,	,	PUNCT
brj-24894	495	6	”	"	PUNCT
brj-24894	495	7	bioresources	bioresource	NOUN
brj-24894	495	8	21(1	21(1	NUM
brj-24894	495	9	)	)	PUNCT
brj-24894	495	10	,	,	PUNCT
brj-24894	495	11	547	547	NUM
brj-24894	495	12	-	-	SYM
brj-24894	495	13	569	569	NUM
brj-24894	495	14	.	.	PUNCT
brj-24894	496	1	569	569	NUM
brj-24894	496	2	appendix	appendix	PROPN
brj-24894	496	3	vi	vi	PROPN
brj-24894	496	4	.	.	PUNCT
brj-24894	496	5	maldi	maldi	NOUN
brj-24894	496	6	-	-	PUNCT
brj-24894	496	7	tof	tof	PRON
brj-24894	496	8	ms	ms	NOUN
brj-24894	496	9	analysis	analysis	NOUN
brj-24894	496	10	of	of	ADP
brj-24894	496	11	hydrolysis	hydrolysis	NOUN
brj-24894	496	12	products	product	NOUN
brj-24894	496	13	of	of	ADP
brj-24894	496	14	cmc	cmc	NOUN
brj-24894	496	15	degraded	degrade	VERB
brj-24894	496	16	by	by	ADP
brj-24894	496	17	tpcel12a	tpcel12a	NOUN
brj-24894	496	18	in	in	ADP
brj-24894	496	19	te	te	ADP
brj-24894	496	20	n	n	PROPN
brj-24894	496	21	s	s	NOUN
brj-24894	496	22	it	it	PRON
brj-24894	496	23	y	y	INTJ
brj-24894	496	24	(	(	PUNCT
brj-24894	496	25	x	x	PROPN
brj-24894	496	26	1	1	NUM
brj-24894	496	27	0	0	NUM
brj-24894	496	28	4	4	NUM
brj-24894	496	29	)	)	PUNCT