PEER-REVIEW ARTICLE PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3938 The Transcriptome and Metabolic Pathways of Persea americana under Drought and Low-temperature Stress Yi Zhang,a,b,1 Maniya Luo,c,1 Xiaolong Yuan,b Zhijuan Yang,a Yi Wang,b,* and Yuan Zheng a,* Persea americana Mill. is an important cash crop that contains effective ingredients to reduce cholesterol and protect the cardiovascular system. Presently, the gene regulation mechanism and signal pathway of stress response in P. americana are unclear. To explore the gene expression changes of P. americana under drought and low-temperature stress, the transcripts of P. americana were sequenced under these conditions. The results produced 42,815,960 bp raw reads. Analysis of the related metabolic pathways and differentially expressed genes showed that under drought stress, the gene expression of beta-amylase 3, glyceraldehyde-3- phosphate dehydrogenase and hexokinase were upregulated, while the gene expression of UDP-glycosyltransferase superfamily protein isoform, glucose-1-phosphate adenylyltransferase, and glucose-6-phosphate 1- epimerase were downregulated. Under low-temperature stress, the expression of beta-amylase and shikimate O-hydroxycinnamoyl transferase genes was downregulated. In addition, WRKY, MYB, bHLH, and NAC transcription factors were expressed under drought and low- temperature stress. Finally, the RNA-Seq data were validated using real- time fluorescence quantitative analysis to identify the key genes of P. americana regulated at the transcriptional level under drought and low- temperature stress. This study provides a theoretical basis for the selection of drought-resistant and low-temperature tolerant P. americana varieties. DOI: 10.15376/biores.18.2.3938-3960 Keywords: Persea americana; Drought stress; Low-temperature stress; Metabolic pathways; Transcriptome; qRT-PCR Contact information: a: College of Forestry, Southwest Forestry University, Kunming, 650224, China b: Laboratory of Forest Plant Cultivation and Utilization, The Key Laboratory of Rare and Endangered Forest Plants of State Forestry Administration, Yunnan Academy of Forestry and Grassland, Kunming, 650201, China; c: National Culture Research Institute of Jinggu Dai and Yi Autonomous County, Puer, 666400, China; 1 These authors equally contributed to this work; * Corresponding authors: dog_608@qq.com; zhengyuan_001@126.com INTRODUCTION Persea americana Mill., also known as the ‘alligator pear,’ is a Lauraceae native to Mexico and Central America (Chanderbali et al. 2008; Bhuyan et al. 2019). It is one of the world’s most important tropical/subtropical fruit crops and has high economic value (Kuhn et al. 2019). Its fruit is not only rich in protein and fat-soluble vitamins but also in tocopherols, lutein, and other carotenoids, which are widely used in the pharmaceutical and cosmetic industries (Duarte et al. 2016; Tabeshpour et al. 2017). In addition, the oil extracted from P. americana seeds can be used as an alternative biodiesel source for the PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3939 biofuel industry (Ge et al. 2021). Because P. americana fruit benefits human health, there is an increased demand for its functional compounds in the market. Alkhalaf et al. (2019) evaluated the antioxidant, anti-inflammatory, and anti-cancer potential of each extract of P. americana fruit and seed. Tremocoldi et al. (2018) used HPLC-MS/MS to conduct a real-time analysis of phenolic compounds obtained from green extraction of P. americana by-products to determine their contribution to the total biological activity of P. americana by-products. Ibarra-Laclette et al. (2015) used a high-throughput sequencing platform to develop a gene expression map of the P. americana transcriptome. Specifically, they analyzed the expression of genes involved in acyl lipid metabolism, maturation process, and organ specificity, aiding further research on P. americana basic biology. Ge et al. (2019a) used molecular identification methods to study the different geographical sources of P. americana germplasm resources in southern China and conducted a supplementary analysis. Due to its high economic value, P. americana is widely cultivated and developed in some provinces in southern China, including Taiwan, Hainan, Guangxi, and Yunnan (Ge et al. 2017, 2019b). Yunnan Province is in the southwest of China, has a complex terrain, is affected by two Asian summer monsoons, and is extremely sensitive to climate change. According to previous research, extreme weather events (such as floods, low temperatures, and droughts) have often occurred in this province in recent decades (Shi and Chen 2018), so breeding P. americana with strong resistance is a key factor for the success of introduction. Abiotic stresses such as drought and low temperature affect plant growth, development, and secondary metabolism (Li et al. 2021). Stress reduces net photosynthetic rate, destroys chloroplast structure, reduces reactive oxygen species clearance, and reduces carbohydrate metabolism (Valliyodan and Nguyen 2006; Maestrini et al. 2009; Abdel- Ghany et al. 2020). Moreover, it leads to changes in functional genes and transcription factors (TFs) involved in metabolic and physiological processes during transcription (Wang et al. 2017). Xu et al. (2021) used Illumina sequencing technology to analyze the transcriptome of Salix cupularis Rehd under drought stress and identified 4,289 differentially expressed genes (DEGs) – 2,340 were upregulated, and 1,949 were downregulated. Li et al. (2021) found that Larix kaempferi (Lamb.) Carr had 27 DEGs involved in drought stress. Under drought stress, Prunus mahaleb L is mainly involved in carbohydrate metabolism and hormone signal transduction (Feng et al. 2017). Pugionium cornutum (L.) Gaertn was found to be mainly involved in photosynthesis, nitrogen metabolism, and hormone signal transduction pathways (Wang et al. 2017). Under low- temperature stress, Populus tomentosa Carr is mainly involved in metabolic pathways such as sugar metabolism, antioxidant defense system, hormone signaling and photosynthesis (Yang et al. 2019). Populus simonii Carr is mainly involved in photosynthesis, abscisic acid (ABA) transport, and antioxidant defense system (Song et al. 2013). Wang et al. (2013) identified 1,770 DEGs from the whole genome of Camellia sinensis (L.) Kuntze, of which 1,168 genes were upregulated, mainly involved in carbohydrate metabolism and calcium signaling pathways, and 58 TFs families responded to low-temperature stress. Gong et al. (2018) identified 239 TFs that responded to low-temperature stress from the whole genome of Hevea brasiliensis (Willd. ex A. Juss.) Muell. Arg. Those TFs are involved in flavonoid biosynthesis, phenylalanine biosynthesis and metabolism, plant hormone signal transduction, and starch and sucrose metabolism. Therefore, this study was conducted to investigate the molecular response mechanisms made by P. americana under different stresses. PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3940 In this study, NovaSeq technology was used to sequence the participating transcriptome of P. americana and excavate the key genes and TFs related to the metabolic pathway of drought and low-temperature stress; the results were verified by qRT PCR. The results lay the foundation for the in-depth study of P. americana and provide a theoretical basis for breeding drought and low-temperature resistant varieties. EXPERIMENTAL Plant Materials Annual P. americana seedlings with good growth conditions were planted in the greenhouse at the Bailong Campus of Southwest Forestry University (Kunming, China). In line with the material treatment reference (Wang et al. 2014; Wu et al. 2015), the treatment conditions of the control group (PAMZ) were as follows: the relative soil water content was kept at 80% of the field water capacity, and normal watering (five times/d) at room temperature (25 ℃). Drought treatment (PAMG): watering of seedlings at room temperature was terminated after sufficient water has been applied to saturate the soil with water, allowing the relative soil moisture content to fall to 40% of the field holding capacity, and sampling after the leaves had curled. Low temperature treatment: P. americana seedlings were placed in a low temperature incubator at a low temperature of 4 ℃ (PAM4), a low temperature of 15 ℃ (PAM5), and the rest of the incubation conditions were the same. Sampling was carried out after 6 h of normal watering, and the collected leaves were immediately snap-frozen in liquid nitrogen, stored at -80 ℃, and sent to Personalbio (Shanghai, China) for transcriptome sequencing. RNA Extraction and Sequencing Total RNA extracted from mature leaves tissue of P. americana was determined under different treatments using the Ultrapure RNA Kit (CWBIO, China). The concentration and quality of RNA were detected by NanoDrop 2000 (NanoDrop; Thermo Fisher Scientific, Inc., Wilmington, DE, USA) and 1.5% agarose gel electrophoresis, respectively. The mRNA with polyA structure was enriched by Oligo (dT) magnetic beads and broken into fragments of approximately 300 bp in length by ion interruption. The first strand of cDNA was synthesized with RNA as a template, using 6-base random primers, and reverse transcriptase. The second strand of cDNA was synthesized with the first cDNA as a template. The cDNA fragment with a specific length of 450 bp was recovered for PCR amplification and sequenced using the Illumina NovaSeq platform. Transcriptome Data Processing, Gene Ontology (GO) Annotation, and KEGG Enrichment Analysis The obtained raw data were filtered using Cutadapt v1.12 online software to remove joints at the 3’ end and read with average mass fraction below Q20 to obtain Clean Reads, and the resulting Clean Reads were annotated in the following databases: NCBI Non-Redundant Protein Sequences (Nr), eggNOG, Swissport, Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Ontology (GO). GO and KEGG enrichment analyses were performed using topGO and clusterprofiler to identify GO terms and KEGG pathways that are significantly enriched for differential genes by calculating P-values (the criterion for significant enrichment is P < 0.05) by the hypergeometric distribution method. PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3941 Screening of Differentially Expressed Genes HTSeq statistics were used to compare to Read Count values on each gene as the original expression of the gene, normalized gene expression using FPKM values (FPKM >1), and performed differentially expressed gene analysis by DESeq, screening differentially expressed genes with the following conditions: expression difference fold |log2FoldChange|>1, significant P- value<0.05. Quantitative Real-Time PCR (qRT-PCR) Analysis To verify the results of transcriptome sequencing and the expression pattern of target genes, ten differentially expressed genes were randomly selected, and their gene expression was detected by qRT-PCR. Using the transcriptome data, primers were designed (Table 1) with 1-alpha (EF1a) gene as the internal regulator of gene normal expression. In addition, SYBR Green (Invitrogen Beijing) was used to detect the PCR products of specific primers in the ABI 7300 Real -Time PCR System (Applied Biosystems, Foster City, USA). The conditions of the PCR reactions were as follows: denaturation (94 °C, 2min), 40 cycles of quantitative amplification (94 °C - 15s; 60 °C - 15s; 72 °C - 45s), with a final extension step (72 °C, 7min). Table 1. Primer Sequences Primer name Sequence (5'-3') PaEF1aF CTGAGATGAACAAGCGTT PaEF1aR GAATCAATAATAAGGACA Pa0068F ACGATCAGTACAAAGATGCA Pa0068R TTCACAAGTTACAATCTCAA Pa0058F ATAAGGAACTCTAGACATGA Pa0058R CATCAACCATCACACCTTCA Pa0027F AGATTGCTACAGCAGTGGCA Pa0027R AGGTTGAACAGCCATCAGAA Pa0537F CAAGTTCAAGTCGATTACAC Pa0537R CCTTGCTGATAGTTACCAGA Pa0039F GCCAACAGAATGCAAGAGCG Pa0039R TGATCTGTAAAGAAGATATC Pa0005F TCTACCAGTCCACCATCGAC Pa0005R AGCAGCCTCTTTCACTGCAA Pa0674F GAAACAAGTAGAGAGATGCA Pa0674R AGGTTCGTGGGGTCATGTGT Pa0168F GATTATGCATGAATATAGGC Pa0168R TCATTTCTGG GAGAGATTCG Pa0149F CTTGGTGCCAGAAGCATTGG Pa0149R TTGTATTCCTTGAACTTGAC PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3942 RESULTS AND DISCUSSION Gene Sequence Assembly and Function Annotation P. americana leaves after different treatments were analyzed using the platform Illumina NovaSeq platform, and the obtained data were uploaded to NCBI (https://www.ncbi.nlm.nih.gov/sra/SRX19802688). The results showed that the raw reads generated from each set of samples were at least 42,815,960 bp, and the clean reads obtained after filtering were at least 38,591,384 bp, and the total sequence comparison rate with the reference genome (GCA_003546025.1) was higher than 84.88%, Q20> 96.33% and Q30> 90.88%(Table 2). The above data indicated that the obtained P. americana transcriptome data were of high quality and could be analyzed in the next step. Table 2. Statistical Results Sample Raw Reads Clean Reads Total Mapped Q20(%) Q30(%) PAM4 46483170 41983952 37209140 (88.63%) 97.16 92.47 PAM5 45429866 41106282 34893004 (84.88%) 96.33 90.88 PAMG 46405380 42079586 37268575 (88.57%) 96.91 91.9 PAMZ 42815960 38591384 34285115 (88.84%) 97.26 92.65 The obtained Unigenes were subjected to BLASTx comparison of the following databases and the results showed (Fig. 1 and Table S1) that 38,178 genes were annotated in the NR database, 17,970 in the GO database, 17,816 in the KEGG database, 37,873 in the eggNOG database and 3,960 in the Swissprot database, with annotation in the NR database being the most numerous. Fig. 1. Gene function annotation Analysis of Metabolic Pathways The results of GO analysis (Fig. 2 and Table S2) show that a total of 17,970 genes were divided into 92 functional groups, which came from three major categories: molecular function (MF), cellular component (CC), and biological process (BP). Most genes annotated for the PAMZ-PAMG comparison group were related to photosystem I and ion transport pathways: a total of 1,354 genes – including 406 MF (30%), 123 CC (9.1%), and 825 BP (60.9%). A total of 1341 genes were annotated for the PAMZ-PAM4 group, including 397 MF (29.6%), 170 (12.7%) CC, and 882 BP (65.8%) – mainly related to the inositol bisdiphosphate PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3943 tetrakisphosphate diphosphatase activity, inositol diphosphate pentakisphosphate diphosphatase activity, and photosynthesis metabolic pathways. A total of 1,508 genes were annotated for the PAMZ-PAM5 comparison group, including 456 MF (30.2%), 170 CC (11.3%), and 882 BP (58.5%). The gamma-aminobutyric acid transmembrane transporter activity was the latter group’s most enriched metabolic pathway. A total of 1,387 genes were annotated in the PAMG-PAM4 comparison group, including 416 MF (30%), 149 CC (10.7%), and 912 BP (65.8%). The most enriched metabolic pathways for PAMG-PAM4 were xyloglucan: xyloglucosyl transferase activity and hemicellulose metabolic process. For the PAMG-PAM5 comparison group, 1,477 genes were annotated, including 416 MF (28.2%), 149 CC (10.1%), and 912 BP (61.7%). PAMG-PAM15 most enriched metabolic pathway was the xyloglucan metabolic process. A total of 1 ,581 genes were annotated in the PAM15-PAM4 comparison group, including 469 MF (29.7%), 160 CC (10.1%), and 952 BP (60.2%). The latter group's most enriched metabolic pathways were inositol bisdiphosphate tetrakisphosphate diphosphatase activity and photosynthesis. Fig. 2. GO enrichment of P. americana unigenes. The x-coordinate represents the GO term, and the ordinate is the -log10 (p-value) enriched by the GO Term. The KEGG pathway analysis identified that a total of 23,224 genes were enriched into 10 KEGG metabolic pathways (Fig. 3 and Table S3). In addition, 1,442 DEGs were involved in metabolism, genetic information processing, environmental information processing, cell processes, and biological system pathways. Among those, the three most significantly enriched KEGG metabolic pathways were starch and sucrose metabolism, glycolysis/gluconeogenesis, and flavonoid biosynthesis. Therefore, it is speculated that drought and low-temperature stress impact P. americana gene expression. PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3944 Fig. 3. KEGG enrichment of P. americana unigenes. The x-coordinate is KEGG Term, and the ordinate is -log10 (p-value) enriched by KEGG Term. Identification of Differentially Expressed Genes Differential analysis of gene expression using DESeq identified a total of 5,171 differential genes (Table 3), of which 800 were identified for PAMG_vs_PAM4 (280 upregulated, 520 downregulated), 797 for PAMG_vs._PAM5 (203 upregulated, 594 downregulated), 991 for PAM5_vs_PAM4 (714 upregulated, 277 downregulated), 850 for PAMZ_vs_PAM5 (271 upregulated, 579 downregulated), 866 for PAMZ_vs_PAMG (556 upregulated, 310 downregulated) and 867 for PAMZ_vs_PAM4 (458 upregulated, 409 downregulated). Table 3. The Number of Differentially Expressed Genes (DEGs) Control_vs_Treat Up regulated Downregulated Total PAMG_vs_PAM4 280 520 800 PAMG_vs_PAM5 203 594 797 PAM5_vs_PAM4 714 277 991 PAMZ_vs_PAM5 271 579 850 PAMZ_vs_PAMG 556 310 866 PAMZ_vs_PAM4 458 409 867 Three treatment groups, PAMZ-vs-PAMG, PAMZ-vs-PAM4 and PAMG-vs- PAM4, were selected to produce a Venn diagram (Fig. 4), which showed that the number of shared unique differential genes between the three treatment groups was 27 (22 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3945 upregulated and 5 downregulated), further revealing that drought and low temperature stress affects gene expression in P. americana and regulates it through DEGs. Fig. 4. Venn diagrams showing the number of differentially expressed genes (DEGs). (a) Venn diagram showing the upregulated DEGs; (b) Venn diagram showing the downregulated DEGs Transcription Factors with High Transcript Levels Under drought and low-temperature stress, 5,290 differentially expressed genes were found in P. americana, belonging to 53 TF families, of which the bHLH family was the largest, with 525 participating genes, followed by NAC and ERF, with 406 and 347 genes involved, respectively (Fig. 5). Moreover, C2H2, MYB, and WRKY family members were also involved in different biological stress responses. Taking the normal treatment as the control, at least 28 TF families were identified to be differentially expressed under drought and low-temperature stress. It was found that 25 DEGs of ERF were upregulated under drought and low-temperature stress, MYB was concentrated under drought stress, and WRKY was concentrated under low-temperature stress. Analysis of Gene Expression in P. americana under Drought And Low-Temperature Stress The online software heatmap (V1.0.8) was used to draw gene expression heat maps, and to evaluate the effects of drought and low-temperature stress on preliminary analysis of gene expression of the americana metabolic pathway and transcription factor family (Fig. 6 and Table. S4, Table. S5). The results revealed that three metabolic pathways, starch and sucrose metabolism, sugar degradation and sugar metabolic synthesis and flavonoid biosynthesis were the most significantly enriched under drought and low temperature stress, with a total of 19 genes differentially expressed. The expression of Pa0058, Pa0202 and Pa0748 genes, which were significantly enriched in starch and sucrose metabolism and sugar degradation and sugar metabolism anabolic pathways, were upregulated under drought stress, while Pa0001, Pa0068, Pa0249 and Pa0571 genes were downregulated. The expression of Pa0822 gene, which was significantly enriched in flavonoid biosynthesis, was upregulated and Pa0005, Pa0058 and Pa1187 genes were downregulated under low temperature stress, presumably the flavonoid biosynthesis pathway was the main biosynthetic pathway in avocados under low temperature stress. a b PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3946 Fig. 5. Analysis of differentially expressed transcription factor genes in P. americana under drought and cold stress. (a) Distribution of P. americana transcription factor family. (b) PAMZ_vs_PAMG; (c) PAMZ_vs_PAM4. The x-coordinate is a different transcription factor family, and the ordinate is the number of different genes falling into this transcription factor family. A total of 28 transcription factors in the transcription factor family were highly expressed under drought and low temperature stress, including the bHLH, NAC, ERF, MYB and WRKY transcription factor families. 40 DEGs encoding highly expressed transcription factors were selected for heat map analysis. The results showed that under drought stress, the expression of eight genes encoding ERF (pa0027, pa0035, pa0039, pa0157, pa0822) and NAC (pa0036, pa0168, pa0553) was upregulated, and the expression of genes encoding ERF (pa0149), NAC (pa0005, pa1027) and WRKY (pa0674) was downregulated. Under low-temperature stress, the expression of 5 DEGs of bHLH (pa0131, pa00204, pa0335), WRKY (pa0537, pa0889), and ERF (pa0822) transcription factors a b c PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3947 were upregulated, of which the expression of bHLH and WRKY transcription factor family was significantly different, and the expression of 3 DEGs of ERF (pa0027, pa0035) and NAC (pa0014) transcription factors was downregulated. Fig. 6. (a): Heat map of 19 differentially expressed genes; (b): Heat map of transcription factor family gene expression. Horizontally represent genes, and each column represents a sample. Green and pink color marks indicate up-regulation and down-regulation of gene expression, respectively Validation of Transcriptome Data by qRT-PCR Analyses To verify the accuracy of the transcriptome data, nine differential genes were randomly selected for qRT-PCR analysis (Fig. 7). The results showed that the expression of Pa0058, Pa0027, Pa0039 and Pa0168 genes were upregulated, Pa0068 and Pa0005 genes were downregulated under drought stress; the expression of Pa0068, Pa0537 and Pa0005 genes were upregulated; and Pa0149 gene expression was downregulated under low temperature stress. The P. americana data indicates that several key genes related to drought and low temperature stress in P. americana were regulated at the transcriptional level. The gene expression levels obtained by qRT-PCR analysis were generally consistent with the trend of transcriptome expression profiling, indicating that the transcriptome sequencing results were reliable. When plants are under stress, genes’ expression type and expression level will change significantly at the transcriptional level. The response mechanism of plants to drought and low temperature is a complex process in which multiple genes and metabolic pathways participate in regulation and interact with each other (Hwang et al. 2018). To further understand the gene expression of P. americana under drought and low-temperature stress, this study used Illumina high-throughput sequencing technology to sequence the transcriptome of P. americana leaves with different drought and low-temperature treatments. A total of 24,616 genes were obtained, and 5,171 differential genes were screened, including 2,482 upregulated genes and 2,689 downregulated genes. Based on KEGG pathway analysis, it was shown that starch and sucrose metabolism, flavonoid biosynthesis, and transcription factors are critically involved in the response of P. americana to drought and low temperature. Meanwhile, the expression changes of these a b PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3948 genes and their putative functions were analyzed to provide new insights into the molecular mechanisms of P. americana related resistance. Fig. 7. The expression profiles of nine transcripts in P. americana by qRT-PCR. The x-coordinate is a different treatment group, and the ordinate is DEGs expression changes. Starch is the main carbohydrate in plants, releasing energy, sugars, and secondary metabolites through its own starch reserves under abiotic forcing (Thalmann and Santelia 2017). When subjected to drought and low-temperature stress, plants receive external stress signals for physiological resistance responses. As drought and low-temperature stress intensify, the production of intracellular reactive oxygen species and extracellular electrolyte leakage increase, causing damage to their biomolecules. Therefore, plants alleviate osmotic stress by increasing the content of small molecules or soluble proteins, while reducing the intensity of respiration, slowing down metabolic activity, increasing photosynthesis, and accumulating sugars, thus reducing the negative effects of stress (Thalmann et al. 2016; Zanella et al. 2016; Li et al. 2017). β-amylase (BAM) is the main enzyme of starch catabolism metabolism and is involved in the response of different plants to a variety of abiotic stresses (Sørensen et al. 2012). For example, the expression of the gene encoding BAM was upregulated under drought stress in Millet (Cao et al. 2022), and the gene encoding BAM, VvBAM1, was significantly upregulated under low-temperature stress in tomato (Liang et al. 2021). In the study of Pyrus bretschneideri, three genes encoding BAM were upregulated in expression under both drought and low temperature stresses (Zhao et al. 2019). In the present study, the gene encoding BAM, Pa0058, was upregulated under drought stress and downregulated under low-temperature stress, in general agreement with the results of the former study under drought stress. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is an essential enzyme in the PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3949 glycolytic metabolic pathway and plays an important role in carbon metabolism, plant development, and stress tolerance (Wei et al. 2022). In the present study, Pa0202, the gene encoding GAPDH, was expressed upregulated under both drought and low-temperature stress, which is similar to the results of upregulated of the expression of genes encoding GAPDH in banana under mild and moderate low-temperature stress (Liu et al. 2020), and upregulated of the expression of most genes encoding GAPDH in Triticum aestivum roots under drought stress (Zeng et al. 2016), suggesting that GAPDH is a key factor in plant response to abiotic stresses. Flavonoids, as important components of plant secondary metabolites, have important roles in microbial signaling, protection against pathogens and pests, UV protection, growth hormone transport regulation, and pigmentation (Han et al. 2019). The flavonoid biosynthetic pathway is one of the best known secondary metabolic pathways in plants, and many key genes have been studied in response to environmental stresses (Saito et al. 2013). Flavanone 3-hydroxylase (F3H) is a key enzyme in the flavonoids biosynthesis pathway and plays an important role in biotic and abiotic stress (Ma et al. 2014). It was reported that the transcript of F3H was significantly enhanced in Reaumuria soongorica under drought stress (Liu et al. 2013), and in the present study, one gene encoding F3H was also significantly enhanced under drought stress, and the results of both studies were generally consistent. Chalcone synthase (CHS) is the key enzyme in the first committed step of the flavonoid biosynthetic pathway and catalyzes the stepwise condensation of 4- coumaroyl-CoA and malonyl-CoA to naringenin chalcone (Deng et al. 2014). In the study of Hybrid Poplar (P. tremula × P. alba), the expression of PtCHS, a gene encoding CHS, gradually increased with increasing time of drought stress (Ahmed et al. 2021), and in the present study, the expression of two genes encoding CHS was upregulated under drought stress, in agreement with the previous study the results were consistent with the previous study. In the study of tobacco, the gene Nitab4.5_0001066g0070 encoding CHS in cultivars Xiangyan7 was downregulated under low-temperature stress (Hu et al. 2022), and in the present study, the gene encoding CHS was downregulated under low-temperature stress, and both results were consistent. The above results suggest that flavonoids have protective effects against drought and low temperature stresses, and different varieties may have different response mechanisms to different stresses. Transcription factors play an important regulatory role in plant growth, development, metabolism, and other functions (Fan et al. 2021). They regulate transcription through the expression of other transcription factors, synthesizing the corresponding proteins to guide the generation of metabolites and respond to drought and low-temperature stress. In the present work, 53 transcription factor families were identified related to drought and cold stress response through genome-wide analysis, of which bHLH, NAC, ERF, MYB, and WRKY family members were the most representative. At present, a large number of studies have shown that transcription factor families such as the bZIP, AP2/ERE, WRKY, NAC, and MYB are closely related to the expression and regulation of genes under drought and low-temperature stress (Xu et al. 2011; Wang et al. 2020). Among them, the present study found that the expression of 25 DEGs in the ERF family was significantly altered: five DEGs were upregulated, one DEG was downregulated under drought stress, and two DEGs were downregulated under low-temperature stress. For WRKY members, 13 DEGs were upregulated under low-temperature stress. In a study of Ammopiptanthus nanus, Cao et al. (2020) found that DREB responds to low-temperature and drought stress by binding to WRKY. In a study of Salix matsudana leaves, Xu et al. (2021) found that the expression of five genes encoding WRKY transcription factors was PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3950 upregulated under drought stress. In a study of tea, Wang et al. (2013) found that the expression of five genes encoding WRKY transcription factors was upregulated in three and downregulated in two under low temperature stress. Chen et al. (2014) found that under low-temperature stress, the expression of DEGs encoding AP2/ERF, WRKY, and NAC transcription factors in Populus euphratica was upregulated, indicating that the three transcription factor families play a key role in the low-temperature response of P. euphratica. The results of the transcription factors in this study were generally consistent with those of previous studies, which strongly suggest that ERF and WRKY transcription factors are associated with drought and low temperature in plants and play important roles in drought and low-temperature stresses. This study preliminarily explored the key genes and transcription factor families of P. americana-related metabolic pathways under drought and low-temperature stress, laying the foundation for further research on biosynthesis, secondary metabolic pathways, and transcriptome. Moreover, it provides a theoretical basis for breeding P. americana varieties with drought and low-temperature resistance. Further functional characterization of DEGs and their pathways are needed because they potentially serve as targets for marker-assisted selection or transgenes to enhance stress tolerance. CONCLUSIONS Abiotic stresses such as drought and low temperature limit the acreage of P. americana in Yunnan, China. In this study, transcriptome analysis of P. americana was performed under drought and low-temperature stress. The result of transcriptome analysis showed that the three most significantly enriched KEGG metabolic pathways responded to drought and low temperature were starch and sucrose metabolism, glycolysis/gluconeogenesis, and flavonoid biosynthesis. The gene expression of beta-amylase, glyceraldehyde-3-phosphate dehydrogenase and hexokinase were upregulated under drought stress, while the gene expression of UDP-glycosyltransferase superfamily protein isoform, glucose-1-phosphate adenylyltransferase and glucose-6-phosphate 1-epimerase were downregulated. The gene expression of beta-amylase and shikimate O-hydroxycinnamoyl transferase was downregulated under low-temperature stress. WRKY, MYB, bHLH, and NAC transcription factors also were involved in responding to drought and low-temperature stress. ACKNOWLEDGMENTS This work was supported by National Natural Science Foundation of China (No. 32160736, 31860177); Major Project of Agricultural Basic Research Program in Yunnan Province (202101BD070001-020); General Project of Basic Research Program in Yunnan Province (202101AT070218, 202101AT070044); and the Reserve Talents for Young and Middle-aged Academic and Technical Leaders of Yunnan Province (202205AC160044). PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3951 REFERENCES CITED Abdel-Ghany, S. E., Ullah, F., Ben-Hur, A., and Reddy, A. S. (2020). “Transcriptome analysis of drought-resistant and drought-sensitive sorghum (Sorghum bicolor) genotypes in response to PEG-induced drought stress,” International Journal of Molecular Sciences 21(3), 772. DOI: 10.3390/ijms21030772 Ahmed, U., Rao, M. J., Qi, C., Xie, Q., Noushahi, H. A., Yaseen, M., Shi, X., and Zheng, B. (2021). “Expression profiling of flavonoid biosynthesis genes and secondary metabolites accumulation in populus under drought stress,” Molecules 26(18), 5546. Doi: 10.3390/molecules26185546 Alkhalaf, M. I., Alansari, W. S., Ibrahim, E. A., and ELhalwagy, M. E. (2019). “Anti- oxidant, anti-inflammatory and anti-cancer activities of avocado (Persea americana) fruit and seed extract,” Journal of King Saud University-Science 31(4), 1358-1362. DOI: 10.1016/j.jksus.2018.10.010 Bhuyan, D. J., Alsherbiny, M. A., Perera, S., Low, M., Basu, A., Devi, O. A., Barooah, M. S., Li, C. G., and Papoutsis, K. (2019). “The odyssey of bioactive compounds in avocado (Persea americana) and their health benefits,” Antioxidants 8(10), 426. DOI: 10.3390/antiox8100426 Cao, S., Wang, Y., Li, X., Gao, F., Feng, J., and Zhou, Y. (2020). “Characterization of the AP2/ERF transcription factor family and expression profiling of DREB subfamily under cold and osmotic stresses in Ammopiptanthus nanus,” Plants 9(4), 455. DOI: 10.3390/plants9040455 Cao, X., Hu, Y., Song, J., Feng, H., Wang, J., Chen, L., Wang, L., Diao, X., Wan, Y., Liu, S., et al. (2022). “Transcriptome sequencing and metabolome analysis reveals the molecular mechanism of drought stress in Millet,” International Journal of Molecular Sciences 23(18), article 10792. DOI: 10.3390/ijms231810792 Chanderbali, A. S., Albert, V. A., Ashworth, V. E., Clegg, M. T., Litz, R. E., Soltis, D. E., and Soltis, P. S. (2008). “Persea americana (avocado): Bringing ancient flowers to fruit in the genomics era,” BioEssays 30(4), 386-396. DOI: 10.1002/bies.20721 Chen, J., Tian, Q., Pang, T., Jiang, L., Wu, R., Xia, X., and Yin, W. (2014). “Deep- sequencing transcriptome analysis of low temperature perception in a desert tree, Populus euphratica,” BMC Genomics 15(1), 1-15. DOI: 10.1186/1471-2164-15-326 Deng, X., Bashandy, H., Ainasoja, M., Kontturi, J., Pietiäinen, M., Laitinen, R. A., Albert, V., Valkonen, J. T., Elomaa, P., and Teeri, T. H. (2014). “Functional diversification of duplicated chalcone synthase genes in anthocyanin biosynthesis of Gerbera hybrida,” New Phytologist 201(4), 1469-1483. Doi: 10.1111/nph.12610 Duarte, P. F., Chaves, M. A., Borges, C. D., and Mendonça, C. R. B. (2016). “Avocado: Characteristics, health benefits and uses,” Ciencia Rural 46, 747-754. DOI: 10.1590/0103-8478cr20141516 Fan, Y., Yang, H., Lai, D., He, A., Xue, G., Feng, L., Chen, L., Cheng, X., Ruan, J., Yan. J., et al. (2021). “Genome-wide identification and expression analysis of the bHLH transcription factor family and its response to abiotic stress in sorghum [Sorghum bicolor (L.) Moench],” BMC Genomics 22(1), 1-18. DOI: 10.21203/rs.3.rs-150639/v1 Feng, Y., Liang, C., Li, B., Wan, T., Liu, T., and Cai, Y. (2017). “Differential expression profiles and pathways of genes in drought resistant tree species Prunus mahaleb roots and leaves in response to drought stress,” Scientia Horticulturae 226, 75-84. DOI: 10.1016/j.scienta.2017.07.057 Ge, Y., Dong, X., Liu, Y., Yang, Y., and Zhan, R. (2021). “Molecular and biochemical PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3952 analyses of avocado (Persea americana) reveal differences in the oil accumulation pattern between the mesocarp and seed during the fruit developmental period,” Scientia Horticulturae 276, article 109717. DOI: 10.1016/j.scienta.2020.109717 Ge, Y., Hu, F., Tan, L., Wu, B., Wang, T., Zhang, T., Ma, F., Cao, J., Xu, Z., and Zhan, R. (2019a). “Molecular diversity in a germplasm collection of avocado accessions from the tropical and subtropical regions of China,” Crop Breeding and Applied Biotechnology 19, 153-160. DOI: 10.1590/1984-70332019v19n2a22 Ge, Y., Si, X.Y., Lin, X.E., Wang, J.S., Zang, X.P., and Ma, W. H. (2017). “Advances in avocado (Persea americana Mill.),” South China Fruit 46, 63-70. DOI: 10.13938/j.issn.1007-1431.20160156 Ge, Y., Zang, X., Tan, L., Wang, J., Liu, Y., Li, Y., Wang, N., Chen, D., Zhan, R., and Ma, W. (2019b). “Single-molecule long-read sequencing of avocado generates microsatellite markers for analyzing the genetic diversity in avocado germplasm,” Agronomy 9(9), 512.DOI: 10.3390/agronomy9090512 Gong, X. X., Yan, B. Y., Hu, J., Yang, C. P., Li, Y. J., Liu, J. P., and Liao, W. B. (2018). “Transcriptome profiling of rubber tree (Hevea brasiliensis) discovers candidate regulators of the cold stress response,” Genes & Genomics 40(11), 1181-1197. DOI: 10.1007/s13258-018-0681-5 Hu, Z., Yan, W., Yang, C., Huang, X., Hu, X., Li, Y., Yang, J., Xiang, S., Yi, P., and Hu, R. (2022). “Integrative analysis of transcriptome and metabolome provides insights into the underlying mechanism of cold stress response and recovery in two tobacco cultivars,” Environmental and Experimental Botany 200, article 104920. DOI: 10.1016/j.envexpbot.2022.104920 Hwang, J. E., Kim, Y. J., Shin, M. H., Hyun, H. J., Bohnert, H. J., and Park, H. C. (2018). “A comprehensive analysis of the Korean fir (Abies koreana) genes expressed under heat stress using transcriptome analysis,” Scientific Reports 8(1), 1-11. DOI: 10.1038/s41598-018-28552-1 Ibarra-Laclette, E., Mendez-Bravo, A., Perez-Torres, C. A., Albert, V. A., Mockaitis, K., Kilaru, A., López-Gómez, R., Cervantes-Luevano, J. I., and Herrera-Estrella, L. (2015). “Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids,” BMC Genomics 16(1), 1-18. DOI: 10.1186/s12864-015-1775-y Kuhn, D. N., Livingstone III, D. S., Richards, J. H., Manosalva, P., Van den Berg, N., and Chambers, A. H. (2019). “Application of genomic tools to avocado (Persea americana) breeding: SNP discovery for genotyping and germplasm characterization,” Scientia Horticulturae 246, 1-11. DOI: 10.1016/j.scienta.2018.10.011 Li, N., Zheng, Y. Q., Ding, H. M., Liu, X. H., Sheng, W. T., Jiang, B., and Li, H. B. (2017). “Analysis on differential expression of cold resistance related genes of Casuarina equisetifolia under low temperature stress,” Scientia Silvae Sinicae 53(7), 62-71. DOI: 10.11707/j.1001-7488.20170707 Li, W., Lee, J., Yu, S., Wang, F., Lv, W., Zhang, X., Li, C., and Yang, J. (2021). “Characterization and analysis of the transcriptome response to drought in Larix kaempferi using PacBio full-length cDNA sequencing integrated with de novo RNA- seq reads,” Planta 253(2), 1-13. DOI: 10.1007/s00425-020-03555-3 Liang, G., He, H., Nai, G., Feng, L., Li, Y., Zhou, Q., Ma, Z., Yue, Y., Chen, B., and Mao, J. (2021). “Genome-wide identification of BAM genes in grapevine (Vitis vinifera L.) and ectopic expression of VvBAM1 modulating soluble sugar levels to improve low- PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3953 temperature tolerance in tomato,” BMC Plant Biology 21, 1-15. DOI: 10.1186/s12870-021-02916-8 Liu, J., Takáč, T., Yi, G., Chen, H., Wang, Y., Meng, J., Yuan, W., Tan, Y., Ning, T., He, Z., et al. (2020). “Acceleration of carbon fixation in chilling-sensitive banana under mild and moderate chilling stresses,” International Journal of Molecular Sciences 21(23), 9326. DOI: 10.3390/ijms21239326 Liu, M., Li, X., Liu, Y., and Cao, B. (2013). “Regulation of flavanone 3-hydroxylase gene involved in the flavonoid biosynthesis pathway in response to UV-B radiation and drought stress in the desert plant, Reaumuria soongorica,” Plant Physiology and Biochemistry 73, 161-167. DOI: 10.1016/j.plaphy.2013.09.016 Ma, D., Sun, D., Wang, C., Li, Y., and Guo, T. (2014). “Expression of flavonoid biosynthesis genes and accumulation of flavonoid in wheat leaves in response to drought stress,” Plant Physiology and Biochemistry 80, 60-66. DOI: 10.1016/j.plaphy.2014.03.024 Maestrini, P., Cavallini, A., Rizzo, M., Giordani, T., Bernardi, R., Durante, M., and Natali, L. (2009). “Isolation and expression analysis of low temperature-induced genes in white poplar (Populus alba),” Journal of Plant Physiology 166(14), 1544- 1556. DOI: 10.1016/j.jplph.2009.03.014 Saito, K., Yonekura-Sakakibara, K., Nakabayashi, R., Higashi, Y., Yamazaki, M., Tohge, T., and Fernie, A. R. (2013). “The flavonoid biosynthetic pathway in Arabidopsis: Structural and genetic diversity,” Plant Physiology and Biochemistry 72, 21-34. DOI: 10.1016/j.plaphy.2013.02.001 Shi, H., and Chen, J. (2018). “Characteristics of climate change and its relationship with land use/cover change in Yunnan Province, China,” International Journal of Climatology 38(5), 2520-2537. DOI: 10.1002/joc.5404 Song, Y., Chen, Q., Ci, D., and Zhang, D. (2013). “Transcriptome profiling reveals differential transcript abundance in response to chilling stress in Populus simonii,” Plant Cell Reports 32(9), 1407-1425. DOI: 10.1007/s00299-013-1454-x Sorensen, A., Ahring, B. K., Lubeck, M., Ubhayasekera, W., Bruno, K. S., Culley, D. E., and Lübeck, P. S. (2012). “Identifying and characterizing the most significant β- glucosidase of the novel species Aspergillus saccharolyticus,” Canadian Journal of Microbiology 58(9), 1035-1046. DOI: 10.1139/w2012-076 Tabeshpour, J., Razavi, B. M., and Hosseinzadeh, H. (2017). “Effects of avocado (Persea americana) on metabolic syndrome: A comprehensive systematic review,” Phytotherapy Research 31(6), 819-837. DOI:10.1002/ptr.5805 Thalmann, M., and Santelia, D. (2017). “Starch as a determinant of plant fitness under abiotic stress,” New Phytologist 214(3), 943-951. DOI: 10.1111/nph.14491 Thalmann, M., Pazmino, D., Seung, D., Horrer, D., Nigro, A., Meier, T., Kolling, K., Pfeifhofer, H. W., Zeeman, S. C., and Santelia, D. (2016). “Regulation of leaf starch degradation by abscisic acid is important for osmotic stress tolerance in plants,” The Plant Cell 28(8), 1860-1878. DOI: 10.1105/tpc.16.00143 Tremocoldi, M. A., Rosalen, P. L., Franchin, M., Massarioli, A. P., Denny, C., Daiuto, É. R., Paschoal, J. A. R., Melo, P. S., and Alencar, S. M. D. (2018). “Exploration of avocado by-products as natural sources of bioactive compounds,” PloS One 13(2), e0192577. DOI: 10.1371/journal.pone.0192577 Valliyodan, B., and Nguyen, H. T. (2006). “Understanding regulatory networks and engineering for enhanced drought tolerance in plants,” Current Opinion in Plant Biology 9(2), 189-195. DOI: 10.1016/j.pbi.2006.01.019 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3954 Wang, X. C., Zhao, Q. Y., Ma, C. L., Zhang, Z. H., Cao, H. L., Kong, Y. M., Yue, C., Hao, X. Y., Chen, L., Ma, J. Q., et al. (2013). “Global transcriptome profiles of Camellia sinensis during cold acclimation,” BMC Genomics 14(1), 1-15. DOI: 10.1186/1471- 2164-14-415 Wang, N., Yao, F., Yuan, M. Li., and Su, J. L. (2014). “Analysis on cold tolerance of five camphor tree species during the natural drop in temperature process,” Journal of Henan Agricultural University 48(03), 302-309. DOI: CNKI:SUN:NNXB.0.2014-03- 008 Wang, P., Wang, F., and Yang, J. (2017). “De novo assembly and analysis of the Pugionium cornutum (L.) Gaertn. transcriptome and identification of genes involved in the drought response,” Gene 626, 290-297. DOI: 10.1016/j.gene.2017.05.053 Wang, B., Chen, M. D., Lin, L., Ye, X. R., Zhu, H. H., and Wen, Q. F. (2020). “Signaling pathways and related transcription factors of drought stress in plants,” Acta Botanica Boreali-Occidentalia Sinica 40(10), 1792-1806. DOI: 10.7606/j.issn.1000- 4025.2020.10.1792 Wei, H., Movahedi, A., Yang, J., Zhang, Y., Liu, G., Zhu, S., Yu, C., Chen, Y., Zhong, F., and Zhang, J. (2022). “Characteristics and molecular identification of glyceraldehyde- 3-phosphate dehydrogenases in poplar,” International Journal of Biological Macromolecules 219, 185-198. DOI: 10.1016/j.ijbiomac.2022.08.001 Wu, F. Z., Wang, H. X., Xu, G. H., and Zhang, Z. C. (2015). “Research progress on the physiological and molecular mechanisms of woody plants under low temperature stress,” Scientia Silvae Sinicae 51(07), 116-128. DOI: 10.11707/j.1001- 7488.20150713 Xu, D., Li, J., Zhu, T., Yang, H., and Zhuo, Z. (2021). “Comparative transcriptome analysis of Salix cupularis under drought stress,” Global Ecology and Conservation 27, e01532. DOI: 10.1016/j.gecco.2021.e01532 Xu, Z. S., Chen, M., Li, L. C., and Ma, Y. Z. (2011). “Functions and application of the AP2/ERF transcription factor family in crop improvement F,” Journal of Integrative Plant Biology 53(7), 570-585. DOI: 10.1016/S0735-1097(13)61853-7 Yang, X., Zhao, T., Rao, P., Gao, K., Yang, X., Chen, Z., and An, X. (2019). “Transcriptome profiling of Populus tomentosa under cold stress,” Industrial Crops and Products 135, 283-293. DOI: 10.1016/j.indcrop.2019.04.056 Zanella, M., Borghi, G. L., Pirone, C., Thalmann, M., Pazmino, D., Costa, A., Santelia, D., Trost, P., and Sparla, F. (2016). “β-amylase 1 (BAM1) degrades transitory starch to sustain proline biosynthesis during drought stress,” Journal of Experimental Botany, 67(6), 1819-1826. DOI: 10.1093/jxb/erv572 Zeng, L., Deng, R., Guo, Z., Yang, S., and Deng, X. (2016). “Genome-wide identification and characterization of Glyceraldehyde-3-phosphate dehydrogenase genes family in wheat (Triticum aestivum),” BMC Genomics 17(1), 1-10. DOI: 10.1186/s12864-016- 2527-3 Zhao, L., Gong, X., Gao, J., Dong, H., Zhang, S., Tao, S., and Huang, X. (2019). “Transcriptomic and evolutionary analyses of white pear (Pyrus bretschneideri) β- amylase genes reveals their importance for cold and drought stress responses,” Gene 689, 102-113. DOI: 10.1016/j.gene.2018.11.092 Article submitted: October 26, 2022; Peer review completed: March 18, 2023; Revised version received and accepted: April 3, 2023; Published: April 20, 2023. DOI: 10.15376/biores.18.2.3938-3960 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3955 APPENDIX Supplemental Material Table S1. Statistics of Gene Function Annotation Annotation Genes GO KEGG eggNOG Swissprot Nr 24616 17970 17816 37873 31960 38178 Table S2. GO Enrichment of Unigenes PG GO.ID Category Term Up Down DEG PAMZ-vs- PAMG GO:0006811 BP ion transport 12 19 31 GO:0051082 MF unfolded protein binding 10 0 10 GO:0005975 BP carbohydrate metabolic process 27 10 37 GO:0048878 BP chemical homeostasis 8 4 12 GO:0009522 CC photosystem I 0 6 6 GO:0031226 CC intrinsic component of plasma membrane 8 4 12 GO:0055082 BP cellular chemical homeostasis 6 3 9 GO:0009534 CC chloroplast thylakoid 3 8 11 GO:0042592 BP homeostatic process 10 6 16 GO:0031976 CC plastid thylakoid 3 8 11 GO:0034220 BP ion transmembrane transport 6 15 21 GO:0006812 BP cation transport 8 12 20 GO:0016168 MF chlorophyll binding 0 5 5 GO:1901505 MF carbohydrate derivative transmembrane transporter activity 2 3 5 GO:0015880 BP coenzyme A transport 0 3 3 GO:0035349 BP coenzyme A transmembrane transport 0 3 3 GO:0071106 BP adenosine 3',5'-bisphosphate transmembrane transport 0 3 3 GO:0000295 MF adenine nucleotide transmembrane transporter activity 0 3 3 GO:0005346 MF purine ribonucleotide transmembrane transporter activity 0 3 3 GO:0008429 MF phosphatidylethanolamine binding 0 3 3 PAMG-vs- PAM4 GO:0048046 CC apoplast 0 13 13 GO:0010410 BP hemicellulose metabolic process 0 9 9 GO:0044036 BP cell wall macromolecule metabolic process 0 11 11 GO:0071944 CC cell periphery 11 32 43 GO:0016762 MF xyloglucan:xyloglucosyl transferase activity 0 7 7 GO:0010411 BP xyloglucan metabolic process 0 7 7 GO:0042546 BP cell wall biogenesis 0 10 10 GO:0010383 BP cell wall polysaccharide metabolic process 0 9 9 GO:0005975 BP carbohydrate metabolic process 7 30 37 GO:0071554 BP cell wall organization or biogenesis 1 18 19 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3956 GO:0044262 BP cellular carbohydrate metabolic process 2 17 19 GO:0051082 MF unfolded protein binding 0 10 10 GO:0005576 CC extracellular region 2 15 17 GO:0071555 BP cell wall organization 1 13 14 GO:0052841 MF inositol bisdiphosphate tetrakisphosphate diphosphatase activity 3 0 3 GO:0052842 MF inositol diphosphate pentakisphosphate diphosphatase activity 3 0 3 GO:0005886 CC plasma membrane 9 22 31 GO:0045229 BP external encapsulating structure organization 1 13 14 GO:0009812 BP flavonoid metabolic process 0 9 9 GO:0031226 CC intrinsic component of plasma membrane 2 9 11 Table S3. KEGG Enrichment of Unigenes PG PathwayID Pathway Level1 level2 Up Down DEG PAMZ- vs-PAMG ko04016 MAPK signaling pathway - plant Environmental Information Processing Signal transduction 19 0 19 ko00196 Photosynthesis - antenna proteins Metabolism Energy metabolism 0 6 6 ko00520 Amino sugar and nucleotide sugar metabolism Metabolism Carbohydrat e metabolism 15 3 18 ko04712 Circadian rhythm - plant Organismal Systems Environment al adaptation 1 8 9 ko00500 Starch and sucrose metabolism Metabolism Carbohydrat e metabolism 9 7 16 ko04075 Plant hormone signal transduction Environmental Information Processing Signal transduction 19 2 21 ko00051 Fructose and mannose metabolism Metabolism Carbohydrat e metabolism 8 2 10 ko04141 Protein processing in endoplasmic reticulum Genetic Information Processing Folding, sorting and degradation 17 1 18 ko00906 Carotenoid biosynthesis Metabolism Metabolism of terpenoids and polyketides 4 2 6 ko00053 Ascorbate and aldarate metabolism Metabolism Carbohydrat e metabolism 5 1 6 ko00052 Galactose metabolism Metabolism Carbohydrat e metabolism 7 0 7 ko00904 Diterpenoid biosynthesis Metabolism Metabolism of terpenoids 2 2 4 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3957 and polyketides ko04626 Plant-pathogen interaction Organismal Systems Environment al adaptation 12 1 13 ko00010 Glycolysis / Gluconeogenesi s Metabolism Carbohydrat e metabolism 8 2 10 ko00380 Tryptophan metabolism Metabolism Amino acid metabolism 3 2 5 ko00410 beta-Alanine metabolism Metabolism Metabolism of other amino acids 3 2 5 ko00910 Nitrogen metabolism Metabolism Energy metabolism 1 3 4 ko00940 Phenylpropanoid biosynthesis Metabolism Biosynthesis of other secondary metabolites 7 4 11 ko00310 Lysine degradation Metabolism Amino acid metabolism 4 0 4 ko00340 Histidine metabolism Metabolism Amino acid metabolism 3 0 3 PAMG- vs-PAM4 ko00941 Flavonoid biosynthesis Metabolism Biosynthesis of other secondary metabolites 1 11 12 ko04712 Circadian rhythm - plant Organismal Systems Environment al adaptation 8 3 11 ko04075 Plant hormone signal transduction Environmental Information Processing Signal transduction 10 11 21 ko00910 Nitrogen metabolism Metabolism Energy metabolism 3 4 7 ko04141 Protein processing in endoplasmic reticulum Genetic Information Processing Folding, sorting and degradation 1 17 18 ko04016 MAPK signaling pathway - plant Environmental Information Processing Signal transduction 5 6 11 ko00360 Phenylalanine metabolism Metabolism Amino acid metabolism 1 4 5 ko00945 Stilbenoid, diarylheptanoid and gingerol biosynthesis Metabolism Biosynthesis of other secondary metabolites 1 3 4 ko04626 Plant-pathogen interaction Organismal Systems Environment al adaptation 5 7 12 ko00906 Carotenoid biosynthesis Metabolism Metabolism of terpenoids and polyketides 1 4 5 ko00052 Galactose metabolism Metabolism Carbohydrat e metabolism 1 5 6 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3958 ko00195 Photosynthesis Metabolism Energy metabolism 0 5 5 ko00940 Phenylpropanoid biosynthesis Metabolism Biosynthesis of other secondary metabolites 3 7 10 ko00520 Amino sugar and nucleotide sugar metabolism Metabolism Carbohydrat e metabolism 5 4 9 ko00920 Sulfur metabolism Metabolism Energy metabolism 1 2 3 ko00010 Glycolysis / Gluconeogenesi s Metabolism Carbohydrat e metabolism 1 7 8 ko00670 One carbon pool by folate Metabolism Metabolism of cofactors and vitamins 0 2 2 ko00051 Fructose and mannose metabolism Metabolism Carbohydrat e metabolism 1 4 5 ko00710 Carbon fixation in photosynthetic organisms Metabolism Energy metabolism 1 4 5 ko00330 Arginine and proline metabolism Metabolism Amino acid metabolism 3 1 4 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3959 Table S4. Cross-expression of 19 Genes Gene_ID PAMZ:fpkm PAMG:fpkm PAM5:fpkm PAM4:fpkm Pa0068 113.76 3.65 119.39 135.55 Pa0058 9.96 509.68 1.47 0.28 Pa0202 8.14 32.35 13.91 9.52 Pa0748 15.46 69.74 17.58 15.59 Pa0001 421.76 129.33 253.32 256.66 Pa0249 212.77 80.03 238.81 190.63 Pa0571 121.27 33.63 88.60 65.51 Pa0822 35.70 51.19 25.65 226.52 Pa0005 1770.23 634.71 1903.05 476.11 Pa1187 89.73 32.50 44.64 8.18 Pa0413 11.30 80.94 0.00 1.56 Pa0104 88.43 167.59 1.33 25.25 Pa0304 143.72 155.85 43.39 43.45 Pa0151 77.40 22.20 0.17 1.66 Pa0116 47.32 71.45 0.67 5.04 Pa0113 44.57 10.19 5.37 3.82 Pa3359 19.21 27.38 99.41 34.10 Pa1189 23.61 106.03 60.52 90.00 Pa0685 270.93 1250.54 927.08 721.12 PEER-REVIEWED ARTICLE bioresources.com Zhang et al. (2023). “Transcriptome/paths of Persea,” BioResources 18(2), 3938-3960. 3960 Table S5. Analysis of Differentially Expressed Transcription Factor Genes in Avocado under Drought and Cold Stress Gene ID PAMZ:fpkm PAMG:fpkm PAM15:fpkm PAM4:fpkm Pa3886 ERF 101.91 18.78 178.70 Pa1164 ERF 189.93 76.89 508.97 Pa0837 ERF 114.44 4.89 160.50 Pa0822 ERF 51.19 25.65 226.52 Pa0685 ERF 1250.54 927.08 721.12 Pa0453 ERF 489.55 77.19 1578.76 Pa0250 ERF 711.61 1552.07 769.75 Pa0157 ERF 244.50 19.60 15.96 Pa0149 ERF 335.52 931.95 662.97 Pa0058 ERF 170.64 63.90 305.76 Pa0039 ERF 1111.26 172.40 344.90 Pa0035 ERF 454.25 91.38 50.25 Pa0027 ERF 1101.20 323.48 198.80 Pa3400 bHLH 81.46 17.66 74.89 Pa1690 bHLH 83.61 2.33 17.66 Pa0500 bHLH 183.35 156.02 250.19 Pa0335 bHLH 34.51 18.22 100.80 Pa0281 bHLH 33.00 82.59 112.59 Pa0204 bHLH 36.33 24.19 109.68 Pa0131 bHLH 71.43 70.50 185.26 Pa1008 MYB 47.60 15.86 7.42 Pa0288 MYB 34.66 62.53 57.22 Pa0231 MYB 95.84 28.17 158.08 Pa0098 MYB 131.07 18.25 39.62 Pa0065 MYB 126.14 21.80 132.60 Pa0032 MYB 266.37 143.89 298.55 Pa1027 NAC 55.13 100.73 355.91 Pa0553 NAC 466.04 72.87 163.09 Pa0544 NAC 717.84 31.25 387.33 Pa0168 NAC 511.64 16.10 46.01 Pa0036 NAC 125.94 21.70 25.73 Pa0014 NAC 787.77 591.41 298.68 Pa0005 NAC 11.70 321.98 261.69 Pa1375 WRKY 143.72 29.48 227.64 Pa0899 WRKY 40.35 12.81 139.64 Pa0846 WRKY 61.56 22.32 415.69 Pa0674 WRKY 47.56 306.47 321.74 Pa0537 WRKY 139.66 63.55 923.38 Pa0198 WRKY 79.45 17.79 44.62 Pa0049 WRKY 18.18 6.20 62.54