PEER-REVIEW ARTICLE PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6377 Transcriptome Analysis Reveals the Molecular Patterns Regulating Prickle Reduction in Grafted Zanthoxylum armatum Yi Wang,a,1 Fayu Feng,b,1 Xiaolong Yuan,a Jiabo Hao,a Yongqing Guo,a and Bin Lu a,* Grafting has been found to effectively reduce the prickly nature of Zanthoxylum armatum seedlings, but the molecular mechanisms are unclear. A comparative transcriptome analysis was performed on stems (JJ) and leaves (JY) of grafted stems (SJ) and leaves (SY) of non-grafted Zanthoxylum armatum seedlings. The authors obtained 3097, 2124, 5995, and 5043 differentially expressed genes from JJ vs. SJ, JY vs. SY, JY vs. JJ, and SY vs. SJ with 17 co-expressed genes. The RNA-seq results were confirmed by qRT-PCR analysis. Function annotations showed that many DEGs enriched plant hormone signal transduction, phenylpropanoid biosynthesis, and plant-pathogen interaction. Secondary metabolites associated with stress-related hormones and defense were noticeably up- regulated in grafted plants. However, key enzymes regulating lignin synthesis were slightly down-regulated in grafted plants. Additionally, grafted plants had several noticeable up-regulated stress-response TFs (transcription factors), including NAC (NAM, ATAF1/2, CUC1/2), ERF (ethylene response factor), MYB (v-myb avian myeloblastosis viral oncogene homolog), bHLH (basic helix-loop-helix), and WRKY. This study generated abundant sequences for elucidating the genetic differences between grafted and non-grafted Z. armatum. DOI: 10.15376/biores.17.4.6377-6396 Keywords: Grafting; Zanthoxylum armatum; Transcriptome; Gene expression analysis Contact information: a: Laboratory of Forest Plant Cultivation and Utilization, The Key Laboratory of Rare and Endangered Forest Plants of State Forestry Administration, Yunnan Academy of Forestry and Grassland, Kunming, 650201, China; b: Yibin Forestry and Bamboo Industry Research Institute, Yibin, 644000, China; 1These authors equally contributed to this work; * Corresponding authors: dog_608@qq.com INTRODUCTION Grafting, an ancient asexual plant propagation technology, is widely used in fruits, vegetables, ornamental plants, and other crop species (Li et al. 2019). The process involves cutting and adhering the scion and rootstock to each other. The attached rootstock and scion share water, mineral elements, and organic nutrient resources and co-influence their physiological metabolism. The interaction improves scion growth (Kumar et al. 2015), enhances plant resistance to pests and diseases (Rouphael et al. 2012; Spanò et al. 2020), and promotes flowering (Mubayiwa et al. 2016) and fruiting (Aslam et al. 2020). Additionally, grafting is essential for changing the phenotype of dwarf plants and extending the fruiting period in economically important tree species (Lee et al. 2010; Albacete et al. 2015). Graft-union formation is a complex process involving phloem reconnection, restarting of root growth, and finally, xylem reconnection (Melnyk et al. 2015). Moreover, PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6378 the growth of grafted plants involves various molecular mechanisms. For example, multiple grafting combinations have demonstrated the transportation of macromolecules such as plant hormones, proteins, genetic material, and nutrients (Albacete et al. 2015). Auxin is the most crucial hormone besides cytokinin, ethylene, jasmonic acid (JA), and gibberellin for regulating the stress response after grafting (Nanda and Melnyk 2018). In citrus, most of the differentially expressed genes (DEGs) in “shatangju” leaves are involved in the auxin signal transduction and gibberellin biosynthesis pathways in grafted plants (Liu et al. 2017). However, most research on the molecules produced from grafting mainly focused on the molecular mechanisms at the healing site, with few studies on the quality and morphological changes post-grafting. Plant growth and morphology are genetically controlled, and rootstocks can regulate the growth, development, and morphological characteristics of grafted trees by influencing the gene expression pattern in the scion (Prassinos et al. 2009; Jensen et al. 2010). For instance, the size, shape, secondary metabolites, and DNA methylation patterns in the scion of same-sex and hetero-grafted zucchini fruits are different from non-grafted controls (Xanthopoulou et al. 2019). Some studies also report that combining the rootstock and scion of two different pepper genotypes changed the fruit shape, indicating that intraspecific grafting of pepper rootstock and scion affects fruit shape. Moreover, the hormone levels and genes involved in hormone regulation vary between grafted and non- grafted plants (Rouphael et al. 2010; Liu et al. 2016), thus influencing the phenotype of grafted plants. In eggplants, grafting increased yield and reduced the appearance of calyx prickles (Nina et al. 2014). Grafting also reduces the prickles on the main branch of acacia trees by 75 to 88% (Mohamed et al. 2014). These examples above confirm that grafting alters plant phenotypes. Zanthoxylum armatum is a small prickly tree of the Rutaceae family. It is usually distributed in shrubs at an altitude of 1000 to 2500 m, and is planted in China, India, Nepal, Vietnam, Myanmar, and other regions (Kashyap et al. 2021). Z. armatum has important edible and medicinal value. Because of its special sesame flavor and aroma, it is considered as an important spice and condiment in China (Xu et al. 2019). Z. armatum peel, root, and tender leaves can be used as medicines, which are commonly used in the treatment of stomachache, respiratory diseases, diarrhea, and toothache (Phuyal et al. 2020). The prickle in Z. armatum hamper picking and restrict the development of mechanized Z. armatum picking systems (Yang et al. 2017). Therefore, many breeding experts are developing thornless Z. armatum varieties. Many studies and patents have shown that grafting reduces the prickles in Z. armatum Maxim (Dang et al. 2020). For example, the ‘Yunlin No.1’ scion becomes less pricked when grafted onto the Z. acanthopodium var. timbor rootstock. Combining prickly-free traits with other important traits through multiple grafting is a time-consuming and expensive process. Moreover, there are no reports on the molecular mechanisms of prickle reduction in Z. armatum post- grafting. Transcriptome analysis of grafted plants may reveal specific genes regulating graft-induced physiological responses (Zhao et al. 2013). Therefore, the authors sequenced the transcriptome of the tender stems and leaves from grafted and non-grafted trees and seedlings to determine the gene expression and metabolic activities between grafted and non-grafted trees. A quantitative real-time polymerase chain reaction (qRT-PCR) verified the transcriptome results. This study laid the foundation for elucidating the molecular mechanism of less prickle after grafting of Z. armatum. PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6379 EXPERIMENTAL Plant Materials Plant materials were planted in Z. armatum Planting Base (E102°44′42.57′′, N25°08′50.67′′), Botanical Garden, Yunnan Academy of Forestry and Grassland Sciences (Kunming, China). The scions of Z. armatum 'Yunlin No.1' were grafted onto the 5-year- old Z. acanthopodium var. timbor rootstock (grafted plants), and the non-grafted control was 5-year-old Z. armatum 'Yunlin No.1'. Three grafted plants and three non-grafted plants (three replicates) with good growth status and uniform growth environment were selected respectively. Three samples of grafted tender stems (JJ), three samples of leaves (JY), three samples of non-grafted tender stems (SJ) and three samples of leaves (SY) with uniform growth status were taken respectively. A total of 12 samples were frozen in liquid nitrogen and stored in a refrigerator at -80 °C until RNA was extracted. RNA Extraction and Sequencing Library Construction Total RNA was extracted using the TransZol Up Plus RNA Kit (Transgen Biotech, Beijing, China). The extracted RNA quality was assayed on a 1.5% agarose gel to determine the RNA quality. Further, RNA purity and quantity were determined using the Thermo Nanodrop 2000 (OD260/280 ratio) and Qubit (Thermo Fisher Scientific, Waltham, MA, USA), while the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) detected the RNA integrity. Three biological replicates were purified to construct cDNA libraries. Then, Shanghai Personalbio Biotechnology Co., Ltd. (Shanghai, China) sequenced the libraries on the Illumina HiSeqTM 2500 platform (Illumina Inc., Hayward, CA, USA) following the paired-end (PE) protocol (PE150, and the independent sample sequencing depth was 6G). De novo Assembly and Functional Annotation of the Transcriptome Raw data (raw reads) of fastq format were firstly processed through in-house Perl scripts. In this step, clean data (clean reads) were obtained by removing reads containing adapter, ploy-N, and low-quality reads. The counts of clean reads, total length, Q20, N%, and GC% were determined accordingly. All cleans reads were de novo assembled using the Trinity assembly program with default parameters to form contigs (Grabherr et al. 2011). The functions of Z. armatum unigenes were annotated using NCBI non-redundant protein sequences (Nr), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), eggNOG and Swiss-Prot alignments (E-value < 10-5). Functional Analysis of the DEGs The clean reads sequenced from each sample were mapped back to the unigene library to calculate the abundance of unigenes. To quantify the gene expression level, FPKM (fragments per kilobase of exon per million mapped reads) was calculated in each sample by RSEM (RNA-Seq by Expect-Maximization). The DEseq approach was used for differential analysis at this threshold |qvalue < 0.001 and log2Ratio≥1|. Enrichment analysis of the DEGs was performed on the GO database using the topGO R package. Essentially, the enrichment factor was used to determine DEGs enrichment levels on each enriched pathway, and the Fisher’s exact test established the significance of the enrichment. Hypergeometric tests determined the most noticeably enriched KEGG pathways by the DEGs. PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6380 qRT-PCR Analysis of the Differentially Expressed Genes Eleven DEGs were selected for plant hormone signal transduction, ribosome, phenylpropanoid biosynthesis, and plant-pathogen interaction pathways to verify the transcriptome data. The eleven genes were analyzed using real-time quantitative PCR (qRT-PCR) of the stem and leaf samples from grafted and seedling plants. The primers (Table S1) were designed according to the sequences from transcriptome data, and an elongation factor gene was the internal reference. Reverse transcription was performed using the transScript II one-step gDNA removal and cDNA synthesis superMix kit (Takara Bio, Dalian, China) and subjected to SYBR Green I qRT-PCR analysis on the CFX96 Real- Time PCR detection system (BioRad, Hercules, CA, USA). The SYBR Green I reagent was TransStart Top Green qPCR SuperMix (Transgen Biotech, Beijing, China). The data were standardized using the 2-ΔΔCt method with three replicate experiments. RESULTS AND DISCUSSION De novo Assembly of Z. armatum Transcriptome Sequences The transcriptomes of Z. armatum leaves and tender stems were sequenced using the Illumina HiSeq high-throughput sequencing platform, and the data obtained were processed as shown in Table S2. The results showed that the average number of Raw Reads in each sample was 43,760,958, and the average number of Clean Reads obtained after filtering was 43,519,333. The Trinity software for de novo assembly generated 490,624 transcripts (N50: 1137) and 209,507 unigenes (N50: 886). The sequences exceeding N50 accounted for 98,039 and 40,629. The overall unigenes GC content was 41.02% (Table S2). These data show that the high-throughput sequencing platform produced high-quality data for the transcriptome sequencing of Z. armatum, which can be analysed in the next step. Unigene Functional Annotation, Classification, and Metabolic Pathway Analysis The 209,507 unigenes were compared with the available protein database using the BLASTx algorithm at E-value 10-5 to obtain comprehensive gene function information. Up to 88,175 (42.09% of the total) unigenes were annotated in the NR database, 49,331 (23.55%) in GO, 6,422 (3.07%) in KEGG, 81,051 (38.69%) in eggNOG, 72,551 (34.63%) in Swissprot, and 5,415 (2.58%) in all the databases. Several unigenes were not mapped to any currently known protein database, suggesting that they represent new genes in Z. armatum Maxim (Table 1). Table 1. Functional Annotation of Unigenes Gene in Z. armatum Database Number Percentage (%) NR 88175 42.09 GO 49331 23.55 KEGG 6422 3.07 eggNOG 81051 38.69 Swissprot 72551 34.63 In all database 5415 2.58 PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6381 The 49,331 Z. armatum unigenes (23.55% of the total annotations) matched at least one of the 67 enriched functional GO terms under biological process, cellular component, and molecular function. The most substantially enriched biological processes are ‘metabolic process’ and ‘cellular process’, 'binding' and 'catalytic activity' under molecular function, and ‘cell’ and ‘cell part’ under the cellular component. The enriching unigenes exceeded 20,000 (Fig. S1). The 6,422 unigenes enriched 35 KEGG metabolic pathways (Fig. S2) related to metabolism, genetic information processing, environmental information processing, cellular processes, and organismal systems. The five most enriched KEGG pathways included carbohydrate metabolism (438), translation (557), signal transduction (453), transport and catabolism (270), and carbohydrate metabolism (442). KEGG Metabolic Pathway Enrichment after Grafting Z. armatum The fragments per kilobase of transcript per million mapped reads (FPKM) method was used to calculate the abundance of the screened differential genes, and 16,259 differential genes were identified (Fig. S3). A total of 3,097 DEGs were identified from the JJ vs. SJ transcriptome analysis, including 2,061 up-regulated and 1,036 down-regulated genes. The JY vs. SY transcriptome generated 2,124 DEGs (1,674 up-regulated and 450 down-regulated), JY vs. JJ had 5,995 DEGs (4,010 up-regulated and 1,985 down-regulated), and SY vs. SJ generated 5,043 DEGs (2,856 up-regulated and 2,187 down-regulated). The JJ vs. SJ and JY vs. SY comparisons had 1,629 DEGs, and 17 DEGs were detected across all comparisons (Fig. 1). Thus, different tissues of grafted materials deferred more than different seedlings, suggesting that grafting affects gene expression in stems and leaves, increasing the number of DEGs in the different tissues. Fig. 1. Venn diagram showing the number of DEGs between four different comparisons The noticeably enriched KEGG pathways, including ribosome, plant hormone signal transduction, phenylpropanoid biosynthesis, plant-pathogen interaction, and carbon metabolism were in the JJ vs. SJ comparison (Table 2). Oxidative phosphorylation, plant- pathogenic interaction, and photosynthesis were the most enriched pathways between PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6382 leaves of grafted and non-grafted trees. In addition, plant hormone signal transduction, phenylpropanoid biosynthesis, and plant-pathogen interaction pathways were enriched in the four different comparison combinations. The DEGs for the plant hormone signal transduction and phenylpropanoid biosynthesis pathways were up-regulated in most grafted materials, suggesting that grafting greatly impacted the hormone transduction and lignin synthesis pathways of Z. armatum. However, the DEGs for photosynthesis pathways were all down-regulated in the JY vs. JJ (23 down-regulated DEGs) and SY vs. SJ (28 down-regulated DEGs) comparisons. Therefore, the transcriptome sequencing was accurate as leaves are the main site of photosynthesis (Table 2). Table 2. Five Most Obvious KEGG Pathways for DEG Enrichment among Different Comparisons The DEGs Involved in Plant Hormone Signal Transduction Plant hormones regulate various aspects of plant development and response to biotic and abiotic stresses (Santner and Estelle 2009). Studies have shown that changing plant hormone contents is one mechanism by which grafting affects physiological processes (Nanda and Melnyk 2018). The transcriptome analysis revealed that the DEGs for plant hormone signal transduction differed between the same tissues of grafted and seedling materials and between different tissues of the same material. Grafting activates the auxin signaling pathway. Auxin is central in plant growth and development by controlling vascular bundle formation. This study revealed seven differentially expressed proteins: auxin-responsive protein IAA (8, 13, and 26), auxin transporter-like protein 2, ARF6 auxin response factor 6, auxin-induced protein AUX28, JJ vs. SJ KEGG Pathway Up_ Number Down_ Number DEG_ number Total_ number Ribosome 13 2 15 240 Plant hormone signal transduction 7 6 13 169 Phenylpropanoid biosynthesis 4 5 9 60 Plant-pathogen interaction 4 3 7 92 Carbon metabolism 2 5 7 188 JY vs. SY Oxidative phosphorylation 7 4 11 109 Plant-pathogen interaction 0 9 9 92 Photosynthesis 7 0 7 56 Phenylpropanoid biosynthesis 2 5 7 60 Starch and sucrose metabolism 2 4 6 112 JY vs. JJ Plant hormone signal transduction 22 19 41 169 Ribosome 2 26 28 240 Photosynthesis 0 23 23 56 Plant-pathogen interaction 1 16 17 92 Phenylpropanoid biosynthesis 4 12 16 60 SY vs. SJ Plant hormone signal transduction 17 14 31 169 Photosynthesis 0 28 28 56 Phenylpropanoid biosynthesis 7 7 14 71 Carbon metabolism 3 13 16 90 Plant-pathogen interaction 4 11 15 41 PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6383 and auxin-induced protein PCNT115. These auxins participated in the IAA signal transduction or IAA biosynthesis pathways and their expression was up-regulated in the grafted material. The expression of IAA8 (DN108930_c0_g1) and ARF6 (DN105277_ c0_g1) was twice as high in grafted than in seedling stems. Generally, high auxin levels increase cell numbers in the xylem and phloem tissues of plants (Smetana et al. 2019). In this study, multiple auxin signal-related genes were highly expressed in grafted materials, indicating that auxin has a crucial regulatory role in grafted Z. armatum (Fig. 2). Moreover, the expression patterns of abscisic acid, jasmonic acid, gibberellin, and ethylene signal-related genes were similar to the auxin pathway, which were up-regulated in grafted materials. The genes include abscisic acid receptor PYL4(DN101476_c1_g3), allene oxide cyclase 4 (DN100412_c0_g3), aminocyclopropane-1-carboxylate synthase (DN107216_c0_g1), and gibberellin receptor GID1C (DN110971_c3_g1). These results suggest that grafting activates the Z. armatum defense mechanism. Moreover, the number of DEGs in the different tissues of grafted plants was higher than in the tissues of seedling materials, indicating that grafting affected the hormone transduction pathways in tender stems and leaves of Z. armatum. Meanwhile, the expression of phytohormone-related genes in the shoots and leaves of grafted seedling materials was higher than that of non- grafted materials, indicating that grafting had an effect on the hormone transduction pathway in both shoots and leaves of Z. armatum (Fig. 2). Fig. 2. Heat map of differentially expressed genes related to plant hormone transduction pathway. Horizontally represent genes, and each column represents a sample. Red represents high expression genes, and blue represents low expression genes. The DEGs Involved in Phenylpropanoid Biosynthesis Phenylpropane biosynthesis is an important secondary metabolic pathway in plants, producing lignin, flavonoids, lignans, etc. This process is widely involved in plant growth PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6384 and development and helps to cope with external stress (Vogt 2010). In this study, 60 Z. armatum unigenes were annotated to phenylpropanoid biosynthesis. The JJ vs. SJ comparison had more DEGs than JY vs. SY, indicating that grafting greatly impacted the phenylpropanoid biosynthesis pathway in tender Z. armatum stems. The DEGs enriched the phenylpropanoid biosynthesis pathway in grafted and non- grafted young stems. In the JJ vs. SJ treatment, five genes were down-regulated, including two genes encoded by phenylalanine ammonia-lyase (PAL) (DN111284_c0_g1, DN88468_c0_g1), two COMT1 genes (DN109847_c2_g1, DN94980_c1_g1), one 4CL gene (DN102970_c2_g1), and one HST gene (DN107945 _c1_g1). There was upregulation of two genes encoding peroxidase (PER) (DN109806_c1_g1, DN98068_c1_g1) (Fig. 3). The genes mainly involved in lignin synthesis included p-Hydroxyphenyl lignin (H type), guaiacyl lignin (G type), 5-Hydroxyguaiacyl lignin, and syringyl lignin (S type) (Chio et al. 2019). The PAL and 4CL genes from the precursor pathway were highly expressed in grafted and non-grafted materials, indicating that these genes were transcriptionally regulated in both plant materials. Fig. 3. Heat map of differentially expressed genes related to phenylpropanoid biosynthesis pathway. Horizontally represent genes, and each column represents a sample. Red represents high expression genes, whereas blue represents low expression genes. Differential Expression of Specific Transcription Factors A total of 20 highly expressed transcription factors were screened between grafted and non-grafted materials, including family transcription factors such as WRKY, ERF, NAC, MYB, BH, NFYA, AP2, and TCP. Among them, NAC29, NAC35, WRKY16, WRKY33, WRKY40, WRKY70, ERF80, ERF100, MYB26, BH14, and BH92 were up- regulated in grafting materials, and AP2-4, ICE1, GAT21, TCP4, GTE12, and NFYA9 were down-regulated in grafting materials (Fig. 4). PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6385 Fig. 4. Differential transcription factor expression heat map. Horizontally represent genes, and each column represents a sample. Red represents high expression genes, whereas blue represents low expression genes. qRT-PCR Verification Analysis of DEGs Eleven candidate genes were selected randomly for qRT-PCR analysis to validate the results of RNA-Seq. They represented various functional classes or pathways, including plant hormone signal transduction, phenylpropanoid biosynthesis, plant-pathogen interaction, and TFs. The results showed that the patterns of expression of both methods were consistent, confirming the reliability of the transcriptome results (Fig. 5). PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6386 Fig. 5. qRT-PCR verification results of 11 differential genes. x-coordinate is different treatment group; and the ordinate is DEGs expression changes. Error bars: standard error of mean. PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6387 Z. armatum is spiny, especially the stem and leaf back, which are difficult to harvest. Previous studies have found that the scions of Z. armatum 'Yunlin1 ' were grafted onto Z. acanthopodium var. timbor rootstocks, and the prickles were reduced by 50 to 60%. After repeated grafting for 2 to 3 generations, the prickles were reduced by 80 to 90% (Pan et al. 2014). It is well known that grafting effectively improves fruit quality, scion phenotypic characteristics, and plant resistance to pests and diseases (Tsaballa et al. 2021). In the study of Acacia Species (Mohamed et al. 2014), and Rose (Kazaz et al. 2013), it was also found that grafting led to a decrease in prickles. Some researcher proposed the decrease is because after grafting, rootstocks regulate growth by transferring metabolites and signaling substances to aboveground parts (Li et al. 2019). This phenotypic change in grafted plants implies that the molecular patterns of gene expression have also changed (Tsaballa et al. 2021). However, the molecular mechanism of prickle reduction after grafting is still unclear. In this study, transcriptome sequencing of tender stems and leaves of grafted and non- grafted plants was performed by next-generation sequencing technology to explore the differences in gene expression between grafted and non-grafted plants. Hormonal changes in grafted plants (Rouphael et al. 2010; Liu et al. 2016) affect their phenotype. In the study of Z. bungeanum, the stem apex nodes of differentiated spines and internode samples of undifferentiated spines in tender stems were compared and analyzed by transcriptome sequencing. The results showed that the genes related to auxin and YABBY genes involved in polar axis differentiation were differentially expressed in shoot tips and stem nodes. Among them, the expression levels of YABBY1, YABBY2, and YABBY4 in the shoot tips of prickle differentiation were much higher than those in the internodes of undifferentiated prickle. Therefore, the YABBY gene is considered to be a candidate gene involved in prickle differentiation of Z. bungeanum. This study found that auxin response genes such as auxin response protein IAA, auxin transporter-like protein 2, ARF6 auxin response factor 6 were differentially expressed between grafted and non- grafted plants. After grafting, the expression of the axial regulator YABBY1 (DN100270_c0_g1) and the axial regulator YABBY2 (DN106863_c2_g1) genes was down-regulated in the tender stems, and the decrease in the expression level of the YABBY gene may result in a decrease in spines. In citrus, the expression of genes related to auxin and gibberellin biosynthesis pathway was high in rootstocks of grafted plants, thereby regulating hormone levels and their signaling pathways (Liu et al. 2017). Plant hormones, such as gibberellin, auxin, cytokinin, abscisic acid, and ethylene, function through complex interaction and feedback regulation networks (Vanstraelen and Benková 2012). In the study of Z. armatum, several DEGs related to the above five hormones were identified. The authors found that DEGs related to hormone signal transduction (such as auxin-responsive protein IAA, Auxin- responsive protein SAU, and ethylene receptor ETR) were more different genes than those related to hormone synthesis pathways (such as gibberellin 20 oxidase, cytokinin, and dehydrogenase). This means that the enhancement of hormone signal transmission and crosstalk may be the main result of grafting of Z. armatum, rather than the increase of hormone content. The prickle is considered effective for resisting herbivore and abiotic stress in plants (Barton 2014). The transcriptome of tender stems and leaves from grafted and seedling materials showed that the expression of two defense-related hormones, ethylene, and salicylic acid, is higher in grafted than non-grafted plants. Usually, ethylene and salicylic acid are synthesized in infected and injured tissues of plants for defense (Bari and Jones 2009). Thus, the increased expression of genes for these defense-related hormones may PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6388 reduce the necessity of prickling growth. Abscisic acid receptor PYL4 is also important in ABA-responsive-element stress response (Park et al. 2009; Bolt et al. 2017). The ABA signaling pathway inhibits the activity of PP2Cs proteins through its receptor PYL protein family (Fuentes et al. 2019). In this study, PP2C and PYL4 genes were differentially expressed between grafted and non-grafted materials, consistent with the transcriptome results of peony grafting (Li et al. 2019). The expression of PYL4 in grafted young stems was four times higher in young stems of non-grafted plants, indicating that grafting triggered stress in Z. armatum. Phenylpropanoid biosynthesis is one of the most important secondary metabolic pathways in plants, which is mainly used for lignin biosynthesis and flavonoids biosynthesis (Vogt 2010). This study found that some key enzymes in lignin biosynthesis, such as phenylalanine ammonia-lyase (PAL1, PAL2), cinnamoyl-CoA reductase (CCR1, CCR2), cinnamyl alcohol dehydrogenase (CAD1), were down-regulated in grafted plants. The difference is that some genes encoding peroxidase (PER) are up-regulated in graft materials. In addition, most of the calcium-binding protein CML was up-regulated in grafted materials. Among them, the gene annotated as CML41 was 5 times higher in grafted tender stems than in non-grafted tender stems, and 3 times higher in leaves than in non- grafted leaves. The CML gene family is usually considered to be a specific sensor of plant Ca2+ and plays an important role in adapting to the environment and responding to various stress responses (Ranty et al. 2016). The up-regulation of CML and PER gene expression levels and the down-regulation of some key enzymes in lignin synthesis may have a complex relationship with the reduction of Z. armatum spines. Comparative transcriptome analysis of Solanum viarum, eggplant, and raspberry showed that MADS-box, MYB, AP2/ERF, WRKY, and NAC TFs possibly regulate prickle development (Pandey et al. 2018; Khadgi and Weber 2020; Zhang et al. 2021). In this study, 20 highly expressed transcription factors in grafted and non-grafted materials were identified by homology search and differential expression analysis. Among them, WRKY transcription factors are one of the largest families of transcriptional regulators in plants and form integral parts of signaling webs that modulate many plant processes (Rushton et al. 2010). The WRKY family members play important roles in diverse stress responses (Li et al. 2020). This study found that genes annotated as WRKY16, WRKY33, WRKY40, and WRKY70 were up-regulated in grafting materials. In addition, some stress-related TFs, such as NAC29, NAC35, ERF80, ERF100, and BH92 (Wang et al. 2016; Heyman et al. 2018), were also up-regulated in the grafted materials. The increase in the expression level of these transcription factors in the grafted materials may be complicatedly related to the reduction of prickle. In summary, grafted Z. armatum undergoes complex gene network regulation involving multiple signaling pathways. Some genes related to plant hormones and phenylpropanoid metabolism seemingly interacted with specific TFs to reduce prickle formation after grafting. Moreover, some defense-related genes were up-regulated in grafted plants, probably leading to prickle loss. This report is the first to explore the molecular mechanism in grafted Z. armatum with abundant sequence resources for elucidating the genetic differences between grafted and non-grafted Z. armatum. PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6389 CONCLUSIONS 1. In this study, the Illumina HiSeq platform was used for transcriptome sequencing of grafted and non-grafted Z. armatum samples. A comprehensive reference transcriptome database was obtained by deep sequencing and assembly. 2. The sequencing data were analyzed to identify several differentially expressed genes (DEGs) in grafted and non-grafted materials, including plant hormone signal transduction, phenylpropanoid metabolism-related genes, and some transcription factors (TFs). 3. This study revealed the differences between grafted and non-grafted Z. armatum at the molecular level, providing abundant sequence resources for further determining the molecular mechanism of less pricking after grafting. ACKNOWLEDGMENTS The authors are grateful for the support of Yunnan Key Research and Development Project (202102AE090013) and the Reserve Talents for Young and Middle-aged Academic and Technical Leaders of the Yunnan Province (202205AC160044). REFERENCES CITED Albacete, A., Martínez-Andújar, C., Martínez-Pérez, A., Thompson, A. J., Dodd, I. C., and Pérez-Alfocea, F. (2015). “Unravelling rootstock×scion interactions to improve food security,” Journal of Experimental Botany 66(8), 2211-2226. DOI: 10.1093/jxb/erv027 Aslam, A., Zhao, S., Azam, M., Lu, X., He, N., Li, B., Dou, J., Zhu, H., and Liu, W. (2022). “Comparative analysis of primary metabolites and transcriptome changes between ungrafted and pumpkin-grafted watermelon during fruit development,” PeerJ 8(12), article ID e8259. DOI: 10.7717/peerj.8259 Bari, R., and Jones, J. D. G. (2009). “Role of plant hormones in plant defense responses,” Plant Molecular Biology 69(4), 473-488. DOI: 10.1007/s11103-008-9435-0 Barton, K. E. (2014). “Prickles, latex, and tolerance in the endemic Hawaiian prickly poppy (Argemone glauca): Variation between populations, across ontogeny, and in response to abiotic factors,” Oecologia 174(4), 1273-1281. DOI: 10.1007/s00442- 013-2836-z Bolt, S., Zuther, E., Zintl, S., Dirk, K., Hincha, D., and Schmülling, T. (2017). “ERF105 is a transcription factor gene of Arabidopsis thaliana required for freezing tolerance and cold acclimation,” Plant, Cell & Environment 40(1), 108-120. DOI: 10.1111/pce.12838 Chio, C., Sain, M., and Qin, W. (2019). “Lignin utilization: A review of lignin depolymerization from various aspects,” Renewable and Sustainable Energy Reviews 107, 232-249. DOI: 10.1016/j.rser.2019.03.008 Dang, G. G., Guo, J. C., Zhuang, L. J., An, W. D., and Ren, F. (2020). “Techniques of grafting and raising seedlings of no-thorn Zanthoxylum bungeanum Maxim,” Protection Forest Science Technology 4(12), 44-46. PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6390 Fuentes, L., Figueroa, C. R., and Valdenegro, M. (2019). “Recent advances in hormonal regulation and cross-talk during non-climacteric fruit development and ripening,” Horticulturae 5(2), article no. 45. DOI: 10.3390/horticulturae5020045 Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q. D., et al. (2011). “Trinity: Reconstructing a full-length transcriptome without a genome from RNA-Seq data,” Nature Biotechnology 29(7), 644-652. DOI: 10.1038/nbt.1883 Heyman, J., Canher, B., Bisht, A., Christiaens, F., and De Veylder, L. (2018). “Emerging role of the plant ERF transcription factors in coordinating wound defense responses and repair,” Journal of Cell Science 131(2), article ID jcs208215. DOI: 10.1242/jcs.208215 Jensen, P. J., Makalowska, I., Altman, N., Fazio, G., Praul, C., Maximova, S. N., Crassweller, R. M., Travis, J., and McNellis, T. W. (2010). “Rootstock-regulated gene expression patterns in apple tree scions,” Tree Genetics & Genomes 6(1), 57-72. DOI: 10.1007/s11295-009-0228-7 Kashyap, M., Garla, V., and Dogra, A. (2021). “Zanthoxylum armatum,” in: Himalayan Medicinal Plants: Advances in Botany, Production & Research, N. Malhorta, and M. Singh (Eds.), Academic Press, Cambridge, MA, USA, pp. 327-365. DOI: 10.1016/B978-0-12-823151-7.00008-8 Kazaz, S., Karagüzel, Ö., and Baktir, İ. (2013). “Güllerde yeni trend: Baston güller [The new trend in roses: Cane roses],” Süleyman Demirel Üniversitesi Fen Bilimleri Enstitüsü Dergisi 17(2), 1-3. Khadgi, A., and Weber, C. A. (2020). “RNA-Seq analysis of prickled and prickle-free epidermis provides insight into the genetics of prickle development in red raspberry (Rubus ideaus L.),” Agronomy 10(12), article no. 1904. DOI: 10.3390/agronomy10121904 Kumar, P., Lucini, L., Rouphael, Y., Cardarelli, M., Kalunke, R. M., and Colla, G. (2015). “Insight into the role of grafting and arbuscular mycorrhiza on cadmium stress tolerance in tomato,” Frontiers in Plant Science 6, 477. DOI: 10.3389/fpls.2015.00477 Lee, J. M., Kubota, C., Tsao, S. J., Bie, Z., Echevarria, P. H., Morra, L., and Oda, M. (2010). “Current status of vegetable grafting: Diffusion, grafting techniques, automation,” Scientia Horticulturae 127(2), 93-105. DOI: 10.1016/j.scienta.2010.08.003 Li, Y., Chang, Y., Lu, J., Wang, R., He, D., Yang, Q., and Li, Y. (2019). “Comparative transcriptome analysis of tree peony petals on two different rootstocks,” Journal of Plant Growth Regulation 38(4), 1287-1299. DOI: 10.1007/s00344-019-09933-w Li, W., Pang, S., Lu, Z., and Jin, B. (2020). “Function and mechanism of WRKY transcription factors in abiotic stress responses of plants,” Plants 9(11), article no. 1515. DOI: 10.3390/plants9111515 Liu, N., Yang, J., Fu, X., Zhang, L., Tang, K., Guy, K. M., Hu, Z., Guo, S., Xu, Y., and Zhang, M. (2016). “Genome-wide identification and comparative analysis of grafting- responsive mRNA in watermelon grafted onto bottle gourd and squash rootstocks by high-throughput sequencing,” Molecular Genetics and Genomics 291(2), 621-633. DOI: 10.1007/s00438-015-1132-5 Liu, X. Y., Li, J., Liu, M. M., Yao, Q., and Chen, J. Z. (2017). “Transcriptome profiling to understand the effect of citrus rootstocks on the growth of 'Shatangju' mandarin,” PLOS One 12(1), article ID e0169897. DOI: 10.1371/journal.pone.0169897 PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6391 Melnyk, C. W., Schuster, C., Leyser, O., and Meyerowitz, E. (2015). “A developmental framework for graft formation and vascular reconnection in Arabidopsis thaliana,” Current Biology 25(10), 1306-1318. DOI: 10.1016/j.cub.2015.03.032 Mohamed, T., Talaat, D., Anas, A., and Adil, M. (2014). “Effect of grafting (rootstock) on morphological changes of scions in some acacia species,” Journal of Forest Products & Industries 3(1), 27-36. Mubayiwa, M., Mutasa, W., Gasura, E., and Mabasaa, S. (2016). “Grafting and 2.4- dichlorophenoxyacetic acid induced flowering in non-flowering sweet potato in sub- tropics,” South African Journal of Botany 106, 153-157. DOI: 10.1016/j.sajb.2016.07.005 Nanda, A. K., and Melnyk, C. W. (2018). “The role of plant hormones during grafting,” Journal of Plant Research 131(1), 49-58. DOI: 10.1007/s10265-017-0994-5 Nina, K. M., Maja, M. P., and Stampar, F. (2014). “Grafting influences phenolic profile and carpometric traits of fruits of greenhouse-grown eggplant (Solanum melongena L.),” Journal of Agricultural & Food Chemistry 62(43), 10504-10514. DOI: 10.1021/jf503338m Pan, H. L., and Zhou, G. Z. (2014). “Effect of multiple grafting on prickly ash and its growth results,” Forestry Practical Technology 4(12), 44-46. Pandey, S., Goel, R., Bhardwaj, A., Asif, M. H., Sawant, S. V., and Misra, P. (2018). “Transcriptome analysis provides insight into prickle development and its link to defense and secondary metabolism in Solanum viarum Dunal,” Scientific Reports 8(1), article no. 17092. DOI: 10.1038/s41598-018-35304-8 Park, S. Y., Fung, P., Nishimura, N., Jensen, D. R., Fujii, H., Zhao, Y., Lumba, S., Santiago, J., Rodrigues, A., Chow, T. F., et al. (2009). “Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins,” Science 324(5930), 1068-1071. DOI: 10.1126/science.1173041 Phuyal, N., Jha, P. K., Raturi, P. P., and Rajbhandary, S. (2020) “In vitro antibacterial activities of methanolic extracts of fruits, seeds, and bark of Zanthoxylum armatum DC,” Journal of Tropical Medicine 2020, article ID 2803063. DOI: 10.1155/2020/2803063 Prassinos, C., Ko, J. H., Li, G., Iezzoni, A. F., Iezzoni, A. F., and Han, K. H. (2009). “Rootstock-induced dwarfing in cherries is caused by differential cessation of terminal meristem growth and is triggered by rootstock-specific gene regulation,” Tree Physiology 29(7), 927-936. DOI: 10.1093/treephys/tpp027 Ranty, B., Aldon, D., Cotelle, V., Galaud, J. P., Thuleau, P., and Mazars, C. (2016). “Calcium sensors as key hubs in plant responses to biotic and abiotic stresses,” Frontiers in Plant Science 7, 327. DOI: 10.3389/fpls.2016.00327 Rouphael, Y., Schwarz, D., Krumbein, A., and Colla, G. (2010). “Impact of grafting on product quality of fruit vegetables,” Scientia Horticulturae 127(2), 172-179. DOI: 10.1016/j.scienta.2010.09.001 Rouphael, Y., Cardarelli, M., Rea, E., and Colla, G. (2012). “Improving melon and cucumber photosynthetic activity, mineral composition, and growth performance under salinity stress by grafting onto Cucurbita hybrid rootstocks” Photosynthetica 50(2), 180-188. DOI: 10.1007/s11099-012-0002-1 Rushton, P. J., Somssich, I. E., Ringler, P., and Shen, Q. J. (2010). “WRKY transcription factors,” Trends in Plant Science 15(5), 247-258. DOI: 10.1016/j.tplants.2010.02.006 Santner, A., and Estelle, M. (2009). “Recent advances and emerging trends in plant hormone signaling,” Nature 459(7250), 1071-1078. DOI: 10.1038/nature08122 PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6392 Smetana, O., Mäkilä, R., Lyu, M., Amiryousefi, A., Sánchez Rodríguez, F., Wu, M. F., and Mähönen, A. P. (2019). “High levels of auxin signalling define the stem-cell organizer of the vascular cambium,” Nature 565(7740), 485-489. DOI: 10.1038/s41586-018-0837-0 Spanò, R., Ferrara, M., Montemurro, C., Mulè, G., Gallitelli, D., and Mascia, T. (2020). “Grafting alters tomato transcriptome and enhances tolerance to an airborne virus infection,” Scientific Reports 10, article no. 2538. DOI: 10.1038/s41598-020-59421-5 Tsaballa, A., Xanthopoulou, A., Madesis, P., Tsaftaris, A., and Nianiou-Obeidat, I. (2021). “Vegetable grafting from a molecular point of view: The involvement of epigenetics in rootstock-scion interactions,” Frontiers in Plant Science 11, article ID 621999. DOI: 10.3389/fpls.2020.621999 Vanstraelen, M., and Benková, E. (2012). “Hormonal interactions in the regulation of plant development,” Annual Review of Cell and Developmental Biology 28, 463-487. DOI: 10.1146/annurev-cellbio-101011-155741 Vogt, T. (2010). “Phenylpropanoid biosynthesis,” Molecular Plant 3(1), 2-20. DOI: 10.1093/mp/ssp106 Wang, G., Zhang, S., Ma, X., Wang, Y., Kong, F., and Meng, Q. (2016). “A stress‐ associated NAC transcription factor (SlNAC35) from tomato plays a positive role in biotic and abiotic stresses,” Physiologia Plantarum 158(1), 45-64. DOI: 10.1111/ppl.12444 Xanthopoulou, A., Tsaballa, A., Ganopoulos, I., Kapazoglou, A., Avramidou, E., Aravanopoulos, F. A., Moysiadis, T., Osathanunkul, M., Tsaftaris, A., Madesis, P., et al. (2019). “Ιntra-species grafting induces epigenetic and metabolic changes accompanied by alterations in fruit size and shape of Cucurbita pepo L.,” Plant Growth Regulation 87(1), 93-108. DOI: 10.1007/s10725-018-0456-7 Xu, D., Zhuo, Z., Wang, R., Ye, M., and Pu, B. (2019). “Modeling the distribution of Zanthoxylum armatum in China with MaxEnt modeling,” Global Ecology and Conservation 19, article ID e00691. DOI: 10.1016/j.gecco.2019.e00691 Yang, J., Ren, M., Ruie, L., Zhang, X. J., and Cao, Y. H. (2017). “Comparison of two superior prickless clones of Longnan Dahongpao in Zanthoxylum bungeanum,” Non- wood Forest Research 35(03), 30-34. Zhang, L., Sun, H., Xu, T., Shi, T., Li, Z., and Hou, W. (2021). “Comparative transcriptome analysis reveals key genes and pathways involved in prickle development in eggplant,” Genes 12(3), 341-354. DOI: 10.3390/genes12030341 Zhao, Q., Nakashima, J., Chen, F., Yin, Y., Fu, C., Yun, J., Shao, H., Wang, X., Wang, Z. Y., and Richard, A. (2013). “Laccase is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in Arabidopsis,” The Plant Cell 25(10), 3976-3987. DOI: 10.1105/tpc.113.117770 Article submitted: Aug. 15, 2022; Peer review completed: September 18, 2022; Revised version received and accepted: September 23, 2022; Published: September 28, 2022. DOI: 10.15376/biores.17.4.6377-6396 PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6393 SUPPLEMENTARY INFORMATION Table S1. Primer Sequences Table S2. Statistical Results Sample Reads Clean Reads Q20 (%) Transcript N50 (bp) Unigenes N50 (bp) GC (%) JJ1 42380248 42150734 96.98 490642 1137 209507 886 41.02 JJ2 44897428 44643408 96.80 JJ3 46046566 45793464 96.94 JY1 41530950 41270742 96.79 JY2 40948210 40695792 96.81 JY3 45338796 45130884 97.20 SJ1 43844494 43617910 97.00 SJ2 40515352 40284680 96.98 SJ3 46311494 46079062 97.07 SY1 45451618 45171938 96.76 SY2 44270696 44006124 96.81 SY3 43595646 43387268 97.13 Primer Name Sequence (5'-3') DN105277_c0_G1F CACAGATGACCTTACAGCCA DN105277_c0_G1R TCCTCCATGAGTACTTGTGT DN101476_c1_G3F CTCAAGCATACAAACACTTC DN101476_c1_G3R TTCGCCAGCCTGTGATCGCC DN100412_c0_G3F AGATCAATGAGCGAGACAGA DN100412_c0_G3R AGTGACGGCTAAATAAGTGT DN107216_c0_G1F ATCCAGGATTCGATCGAGAT DN107216_c0_G1R TATTATCTCCGCGATGCTAA DN111284_c0_G1F AAGCAAGGTGGTGCTTTGCA DN111284_c0_G1R GGAGGTGATCGTGCCACGGA DN107945_c1_g1F AGATTGATTGTAACGCTGAG DN107945_c1_g1R CACACCAAGTGAGACTCCAC DN100270_c0_g1F CAGCTTCACTTGGGACATCC DN100270_c0_g1R TGATGATCAACTCCAGGAAC DN100948_c2_g1F AGCAGCACTGTGGAGTCTTC DN100948_c2_g1R GCGTGGGTCACACAACCAAC DN111627_c1_g2F ATTCAACCAACACAGACTCA DN111627_c1_g2R TCAAGGTCAATACGTTACTC DN100249_c3_g4F GGACAAGAGAGGCTGTTACA DN100249_c3_g4R TGTGTACACCTATAGTAACT DN100459_c2_g2F GAGCCTAAACGTATAATCGG DN100459_c2_g2R TCTTCCTCCATTGCAGCCCT Elongation factor F CCCTATTGGGAAGGTTCCAG Elongation factor R CCTTGAGAGATTAGCATCGA PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6394 Fig. S1. GO functional classification of Z. armatum unigenes Number D e s c ri p ti o n PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6395 Fig. S2. KEGG annotation statistics of unigenes of Z. armatum Maxim Number K E G G P a th w a y PEER-REVIEWED ARTICLE bioresources.com Wang et al. (2022). “Transcriptome & Z. armatum,” BioResources 17(4), 6377-6396. 6396 Fig. S3. Volcano plots of DEGs in different comparisons during the girdling process in Z. armatum