PEER-REVIEW ARTICLE PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7673 Bioassay-guided Fractionation and Biological Activities of Antimycin A and 4-Hydroxybenzoic Acid Isolated from Nocardiopsis sp. Strain LC-9 Rozario Sagaya Jansi,a Ameer Khusro,b,* Paul Agastian,c,* Mikhlid H. Almutairi,d and Bader O. Almutairi d Nocardiopsis sp. strain LC-9 was isolated from freshwater sediments and explored for its varied bioactive traits. Initially, ethyl acetate extract of strain LC-9 at varied concentrations showed pronounced antibacterial activities. After column chromatography, fraction F2 and F3 of the extract were identified as prominent fractions in terms of antimicrobial activities with low minimum inhibitory concentration values. Antioxidant activities of fraction F2 and F3 revealed remarkable scavenging of free radicals with low IC50 values (DPPH - 417.86 ± 0.24 μg/mL, ABTS - 431.6 ± 0.90 μg/mL, and FRAP - 404.36 ± 0.18 μg/mL). Fractions F2 and F3 were further characterized by UV spectrum, Fourier transform infrared spectroscopy, nuclear magnetic resonance, and liquid chromatography-mass spectrometry, and were identified as Antimycin A and 4-hydroxybenzoic acid. The compounds were further tested for anticancer activity against MCF-7 cells. The MTT assay showed reduced viability of MCF-7 cells with an increase in concentration of compounds. The IC50 values for Antimycin A and 4-hydroxybenzoic acid were 9.6 ± 0.7 μg/mL and 20.8 ± 0.4 μg/mL, respectively. Staining techniques confirmed the apoptosis mechanism. Finally, molecular docking (against targeted proteins of bacteria, fungus, and cancer cells) and molecular dynamics confirmed the pharmaceutical efficacy of the purified compounds. DOI: 10.15376/biores.19.4.7673-7697 Keywords: Nocardiopsis sp.; Antimycin A; 4-Hydroxybenzoic acid; MCF-7; Molecular docking; Molecular dynamics Contact information: a: Department of Bioinformatics, Stella Maris College, Chennai-600086, Tamil Nadu, India; b: Department of Research Analytics, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai – 600077, India; c: Research Department of Plant Biology and Biotechnology, Loyola College, Chennai-600034, Tamil Nadu, India; d: Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Riyadh, Saudi Arabia; *Corresponding author: armankhan0301@gmail.com; agastianloyolacollege@gmail.com INTRODUCTION Research in discovering actinomycetes and screening their biological activity is a major field of interest in India. Over the past three decades, actinomycetes have substantiated themselves as dependable sources of therapeutically useful bioactive metabolites (Saraswathi et al. 2020). The compounds display a comprehensive scale of bioactivities, such as antimicrobial, anticancer, cytotoxic, neurotoxic, antiviral, and antineoplastic activities (Selim et al. 2021). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7674 It has been reported that of the entire microbial metabolites in the globe, 70% is contributed by actinomycetes, while 20% by fungi, 7% by Bacillus sp., and 1 to 2% by Pseudomonas sp. This substantiates that actinomycetes stand out exclusively in the production of an array of biologically active metabolites for clinical research (Hauhan and Gohel 2020). Of the antibiotic-producing microorganisms, actinomycetes still remain the major constituent of diverse bioactive and pharmaceutically distinct metabolites. Different classes of antibiotics with varying target mechanisms and unique mode of action, such as amino-glycosides, polyketides, chloramphenicols, tetracyclines, etc., are produced by the class Actinobacteria. Molecular data, such as 16S rRNA sequencing, have been beneficial in actinomycetes classification and identification (Salwana and Sharma 2020). Soil inhabiting Nocardiopsis sp. belongs to the phylum Actinobacteria, containing a large repository of unique bioactive compounds. The genus Nocardiopsis (Nocardiopsaceae) was first defined by J. Meyer in 1976. Morphological characters, phylogeny, and chemotaxonomic properties of the species articulate a discrete ancestry from the order ‘Actinomycetales’. This genus comprises of Gram positive aerobic actinomycetes with aerial mycelium that fragments into spores and form wrinkled/folded colonies on organic media (Abdel-Razek et al. 2020; Dror et al. 2020) Nocardiopsis is reported to contain 24 species and two subspecies, mostly thriving in alkaliphilic or halophilic environments. The prominent features of the cell wall of this genus include: meso-2,6-diaminopimelic acid (cell-wall chemotype III), phosphatidyl- choline as a characteristic phospholipid (phospholipid type III), menaquinones, absence of madurose and nocardomycolic acids, and novel teichoic acid compositions. The members of this species generally have genomes with a high load of G+C (64 to 71%) composition (Ngema et al. 2023). Nocardiopsis spp. are reported in diverse regions including saline, hypersaline, desert, and alkaline environments (Ramalingam et al. 2022; Kumar et al. 2023). Microbial metabolites account for 45% of the world market of pharmaceuticals. The marketing of the different classes of products reaches millions of dollars each year. In recent times, discovery of novel compounds with bioactive potential has become rare and remains a great challenge. This provokes recent researchers to find new species (genera or families) with altered and novel genes to produce distinct metabolites of new purpose. In this investigation, a significant attempt was undertaken to assess the biological activities of bioactive metabolites isolated from Nocardiopsis sp. strain LC-9. EXPERIMENTAL Sample Site, Sampling Procedure, and Isolation Freshwater soil sediments were collected from Chembarambakkam lake at a latitude of 13° 00' 41.69" N and longitude of 80° 03' 38.27" E Chennai, Tamil Nadu, India. Actinomycetes were isolated from the collected soil samples using serial dilution technique on Actinomycetes Isolation Agar (AIA) medium augmented with actidione (20 mg/L) and nalidixic acid (100 mg/L). Plates were incubated at 28 ± 2 °C for 7 to 10 days. After the required incubation period, pure culture of isolates was obtained using the streaking method and stored at 4 °C (Fig. 1). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7675 Fig. 1. a) Freshwater soil sediments collection site (Chembarambakkam lake), b) Actinomycetes colonies isolated on AIA medium using serial dilution method, and c) Pure culture of isolate Preliminary Screening by Perpendicular Streak Method Primary screening was performed by the cross-streak method on Mueller Hinton Agar media against 11 bacterial pathogens. This was done by inoculating a single streak of the pure culture of isolates in the center of the Petri plates and stored at 28 ± 2 °C for 5 days. Successively, the test pathogens were streaked at 90° angle and incubated at 37 °C overnight. Lack of growth of pathogens indicates antibacterial activity of isolates. Morphological and Molecular Characterization of Potent Isolate Morphological and cultural features of the potent isolate was observed by inoculating and incubating the culture in various media including AIA, MNGA, SCA, NA, M5, ISP1, ISP2, ISP3, and ISP4 aseptically at 28 °C for 7 to 14 days. The isolate was subjected to smear preparation for Gram staining. The spore chain characteristic of the selected isolate was observed by scanning electron microscopy (SEM; JSM5600LV, JEOL, Japan). For efficient genomic DNA isolation, Hipura Streptomyces DNA Purification Kit (Hi-media, India) was used. DNA was eluted and visualized by 1% agarose gel electrophoresis. Polymerase chain reaction (PCR) amplification was performed using the following universal primers: 27F (5`AGTTTGATCCTGGCTCAG3`) and 1492R (5`ACGGCTACCTTGTTACGACTT3`). Sequencing was achieved using Applied Biosystems, (Foster City, CA) USA, and the standard quality of the sequence was checked using sequence Scanner Software v1 (Applied Biosystems, Foster City, CA, USA). Similarly, the sequence alignment and editing were carried out by Geneious Pro v5.6 (http://www.geneious.com). Finally, a phylogenetic tree was constructed using MEGA X software (https://www.megasoftware.net/) for the target sequence. Antibacterial Activity of Crude Extract The isolate was inoculated into modified nutrient glucose broth medium and allowed to ferment for 7 days at 28 °C at 180 rpm. After fermentation, the culture filtrates were extracted by liquid-liquid extraction method using ethyl acetate. Antibacterial activity of the extract at varied concentrations (1.25 to 5 mg/mL) was tested using the disc diffusion method. Streptomycin was used as a positive control. Bioactive Metabolites Extraction by Column Chromatography The crude ethyl acetate extract was separated by silica gel column (4.5 to 60 cm) chromatography. A total of 10 g of the extract were used for the column preparation along with silica gel (65 to 70 g). The column initially used ethyl acetate and was gradually added PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7676 with increasing the polarity mixtures of solvents of hexane and ethyl acetate (0 to 100%). Four fractions (F1, F2, F3, and F4) were collected at regular intervals and spotted in TLC plates with the same solvent proportion to find the Retention factor (Rf) values. Concurrently, fractions with the same Rf values were combined and evaporated to remove the solvents at appropriate conditions. Minimum Inhibitory Concentration (MIC) Determination The collected fractions were tested for antimicrobial activity against 11 bacterial pathogens [Bacillus subtilis (MTCC 441), Staphylococcus aureus (ATCC 25923), MRSA Clinical pathogen (15DR), S. aureus (Methicillin sensitive), Enterobacter faecalis (MTCC 29212), Escherichia coli (MTCC 40), Klebsiella pneumoniae (MTCC 109), Enterobacter aerogenes (MTCC 111), Vibrio parahaemolyticus (MTCC 451), Yersinia enterocolitica (MTCC 840), and Pseudomonas aeruginosa (ATCC 15380)] and 5 fungal cultures [Aspergillus flavus (MTCC 9390), Aspergillus niger (MTCC 478), Botrytis cinerea (MTCC 359), Candida albicans (MTCC 227), and Candida lunata (MTCC 2098)] via the microdilution method (Venkatadri et al. 2017). All the pathogens were obtained from Entomology Research Institute, Loyola College, Chennai, India. Standard streptomycin and fluconazole were used as bacterial and fungal positive control, respectively. Antioxidant Properties of Active Fractions The DPPH (2, 2, diphenyl-1-picryl hydrazyl) radical scavenging, ABTS [2, 2'- azinobis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging, FRAP (ferric reducing antioxidant power) activity, and total reducing power assay of the most active fractions (F2 and F3) were determined as per the methodology of Oyaizu (1986), Benzie and Strain (1996), Jia et al. (1999), Kekuda et al. (2010), and Prasathkumar et al. (2021). The IC50 values were calculated by online linear regression curve. Structure Elucidation of Active Fractions Based on the antimicrobial and antioxidant results of fractions, fraction F2 and F3 were selected and further characterized by UV spectrum (JASCO, model V-750, Japan), Fourier transform infrared (FT-IR) spectrum (Bruker, Alpha-T ATR-FTIR Spectrometer model, TENSOR 27, Germany) with the spectra characteristics detected at 20000 to 500 cm-1 range, 1H and 13C nuclear magnetic resonance (NMR) (Bruker, model AVANCE III 500 NMR, Germany), and liquid chromatography-mass spectrometry (LC-MS). Cytotoxicity Assay of Isolated Compounds In vitro cytotoxic activity of the compounds was tested against human breast cancer cell line (MCF-7) procured from the National Center for Cell Sciences (NCCS), Pune, India. The cells were incubated at 37 °C with 5% CO2 in a humidified CO2 chamber. The cytotoxicity was determined using MTT [3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl- tetrazolium bromide] assay as per the methodology of Mosmann (1983). The percentage of viability was calculated as: % viability = [Absorbance of sample/Absorbance of control] × 100 Apoptotic Cell Death Analysis The apoptotic cells were observed by staining the cells with 1 µL of 100 mg/mL of acridine orange (AO) and 100 mg/mL of ethidium bromide (EtBr) in distilled water. To PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7677 this, 90 µL of cell suspension (1 × 105 cells/mL) were added. Finally, after staining with 10 μL of DAPI (4′, 6-diamidino-2-phenylindole), the samples were observed under fluorescent microscope (Nikon Eclipse, Inc. Tokyo, Japan) (Clarance et al. 2020). Molecular Docking Analysis and ADME Prediction N-myristoyl transferase (1IYL) and 14-α-demethylase (5FSA) were used as targeted proteins for fungi. Dihydropteroate synthetase (2VEG), Isoleucyl- tRNA Synthetase (1ILE), Alanine racemase (2RJG), Penicillin-binding protein 1a (3UDI), and Dihydrofolate Reductase (3SRW) were used as targeted proteins for bacteria. In contrast, vascular endothelial growth factor receptor 2 (5EW3), B-cell lymphoma 2 (5VAX), DNA topoisomerases II (1ZXM), HER2-human epidermal growth factor receptor 2 (5O4G), and EGFR (Epidermal Growth Factor Receptor; 2J6M) were used as targeted proteins of cancer cell line. Docking was performed between the compound and selected proteins using Schrödinger software (version 2020-1; Maestro, Schrödinger, LLC, New York, NY, USA). The ADME (absorption, distribution, metabolism, and excretion) likelihood was estimated using the Qik prop tool to evaluate the lead likeliness and Lipinski violations. Molecular Dynamics (MD) Simulations Molecular dynamics simulations were run by Desmond v3.6 Package (Schrödinger, New York, NY, USA) to determine the stable conformation of the protein-ligand complex and effectiveness of the compound against the target protein. The studies were performed for 100 ns simulation to determine the interactions and calculate the Root Mean Square Deviation (RMSD), Root Mean Square Fluctuation (RMSF), and contact points. Statistical Analysis All the experiments were performed in triplicate and results were recorded as Mean ± SD. ANOVA was used to analyze the statistical significance and values with P≤0.05 were considered significant. Fig. 2. Screening for antibacterial activity of isolate LC-9. The isolate showed inhibition of pathogen growth. 1 – B. subtilis (MTCC 441), 2 – S. aureus (ATCC 25923), 3 – MRSA Clinical pathogen (15DR), 4 – S. aureus (Methicillin sensitive), 5 – E. faecalis (MTCC 29212), 6 – E. coli (MTCC 40), 7 – K. pneumoniae (MTCC 109), 8 – E. aerogenes (MTCC 111), 9 – V. parahaemolyticus (MTCC 451), 10 – Y. enterocolitica (MTCC 840), 11 – P. aeruginosa (ATCC 15380). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7678 RESULTS AND DISCUSSION Screening and Identification of Nocardiopsis sp. Figure 2 illustrates primary screening for antibacterial activity of isolate LC-9. Results showed that the growth of all the tested bacterial pathogens (horizontally streaked towards the circumference of the petriplate) was inhibited in the presence of isolate LC-9 (longitudinally streaked at the center of the petriplate), indicating prominent antibacterial activity of isolate LC-9. Further, the morphological characteristic of isolate LC-9 by Gram staining and SEM analysis showed aerial mycelium and hyphae of various lengths (Fig. 3). Fig. 3. A) Gram staining and B) SEM analysis of isolate LC-9 Molecular characterization, followed by phylogenetic tree analysis indicated that the isolate belonged to the genus Nocardiopsis, and the strain was designated as Nocardiopsis sp. strain LC-9 (Accession No. - MH266471). The optimal tree with the branch length of 499.08910173 is shown in Fig. 4. The tree was inferred from bootstrap consensus analysis (100 replicates) with a total of 1535 positions. The genus Nocardiopsis from Actinobacteria plays a significant role in the production of secondary metabolites, especially of pharmacological importance. They thrive in extreme environments with high metabolic activity, thereby withstanding and resisting attacks of other pathogens. Several studies showed that extracts of Nocardiopsis have the capability to produce natural products with unveiled cytotoxic (Siddharth et al. 2021) and antimicrobial competence (Goel et al. 2021). Ethyl acetate extract of strain LC-9 presented potential antibacterial activity against the test pathogens. The extract at 5 mg/mL concentration revealed a maximum zone of inhibition of 18.5 ± 0.16, 18.5 ± 0.28, 18.16 ± 0.57, 17.5 ± 0.28, and 17.16 ± 0.88 mm against B. subtilis, Y. enterocolitica, V. parahaemolyticus, E. aerogenes, and S. aureus (Methicillin sensitive), respectively (Table 1). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7679 Fig. 4. Phylogenetic tree of strain LC-9 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7680 Antibacterial Activity of Strain LC-9 Extract Table 1. Antibacterial Activity of Ethyl Acetate Extract of Strain LC-9 Bacterial Strains 1.25 (mg/mL) 2.5 (mg/mL) 5 (mg/mL) Streptomycin Gram Positive Bacteria B. subtilis (MTCC 441) - 16.33 ± 0.5b 18.5 ± 0.16a 15.16 ± 0.72c S. aureus (ATCC 25923) - - 16.21 ± 0.72a 15.5 ± 0.28b MRSA Clinical pathogen (15DR) 14.83 ± 1.01b 12.33 ± 1.16d 16.33 ± 0.33a 13.83 ± 0.44c S. aureus (Methicillin sensitive) - 14.67 ± 0.88b 17.16 ± 0.88a 11.83 ± 1.01c E. faecalis (MTCC 29212) - - 16.36 ± 0.57a 11.5 ± 0.28b Gram Negative Bacteria E. coli (MTCC 40) - 14.33 ± 0.6b 15.16 ± 0.33a 12.5 ± 0.28c K. pneumoniae (MTCC 109) - 15.66 ± 0.44b 16.33 ± 1.16a 14.83 ± 0.44c E. aerogenes (MTCC 111) - 15.33 ± 0.33b 17.5 ± 0.28a 9.16 ± 0.44c V. parahaemolyticus (MTCC 451) - - 18.16 ± 0.57a 13.3 ± 0.33b Y. enterocolitica (MTCC 840) - 14.3 ± 0.5b 18.5 ± 0.28a 13.17 ± 0.16c P. aeruginosa (ATCC 15380) - - 15.83 ± 1.15a 15.8 ± 0.28a Each value represents the mean ± SD of triplicate experiments. abcdValues are significantly different (P<0.05). ‘-‘: Indicates lack of antibacterial activity. MIC Determination of Strain LC-9 fractions Among 4 fractions tested, fraction F2 of strain LC-9 exhibited promising antimicrobial activities against the indicator pathogens with minimum MIC value of 15.625 μg/mL (against MRSA clinical pathogen and K. pneumoniae) and 31.25 μg/mL (against Curvularia lunata). Likewise, fraction F3 showed potential MIC value of 31.25 μg/mL against MRSA clinical pathogen, S. aureus (Methicillin sensitive), K. pneumoniae, V. parahaemolyticus, Y. enterocolitica, and Aspergillus niger (Table 2). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7681 Antioxidant Activity of Strain LC-9 Fractions Antioxidant activities of fractions F2 and F3 are shown in Fig. 5. With increasing concentration (200 to 1000 μg/mL), the fractions showed approximately 38 to 80% of scavenging activities compared to the standards. IC50 values of fraction F2 were estimated as 417.86 ± 0.24, 431.6 ± 0.90, 404.36 ± 0.18, and 416.16 ± 1.54 μg/mL towards DPPH scavenging, ABTS scavenging, FRAP assay, and total reducing power assay, respectively. In contrast, IC50 values of fraction F3 were estimated as 321.72 ± 0.18, 333.71 ± 1.54, 414.67 ± 1.36, and 401.67 ± 1.39 μg/mL towards DPPH scavenging, ABTS scavenging, FRAP assay, and total reducing power assay, respectively. Table 2. MIC Values of Fractions (F1, F2, F3, and F4) Test Pathogens MIC (μg/mL) F1 F2 F3 F4 Standard Gram Positive Bacteria B. subtilis (MTCC 441) - > 62.5 > 125 - > 15.625 S. aureus (ATCC 25923) - > 31.25 > 62.5 > 15.625 > 62.5 MRSA Clinical pathogen (15DR) - > 15.625 > 31.25 - > 125 S. aureus (Methicillin sensitive) - > 62.5 > 31.25 - > 62.5 E. faecalis (MTCC 29212) - > 125 > 62.5 > 31.25 > 125 Gram Negative Bacteria E. coli (MTCC 40) - > 62.5 > 125 - > 250 K. pneumoniae (MTCC 109) - > 15.625 > 31.25 - > 250 E. aerogenes (MTCC 111) - > 125 > 125 - > 125 V. parahaemolyticus (MTCC 451) - > 125 > 31.25 - > 62.5 Y. enterocolitica (MTCC 840) > 31.25 > 62.5 > 31.25 - > 62.5 P. aeruginosa (ATCC 15380) - > 125 > 250 - > 125 Fungal Cultures Aspergillus flavus (MTCC 9390) > 31.25 > 62.5 > 125 - > 25 A. niger (MTCC 478) - > 62.5 > 31.25 - > 62.5 Botrytis cinerea (MTCC 359) - > 125 > 62.5 - > 62.5 Candida albicans (MTCC 227) - > 62.5 > 125 - > 15.625 C. lunata (MTCC 2098) - > 31.25 > 125 > 31.25 > 25 ‘-’: No activity Characterization of fraction F2 and F3 The UV spectrum of the fraction F2 (compound 1) showed peak at 219 to 226 nm (Fig. 6A). Similarly, the FT-IR spectrum at 3419 cm-1 revealed the presence of O-H or N- H groups. The peak at 2927 to 2974 cm-1 showed C-H stretching in -CH3 or -CH2. The peak at 1746 cm-1 described the C=O stretching, peak at 1534 to 1540 cm-1 indicated the presence of C-O-C of aromatic ring, and the peak at 1050 cm-1 specified alkyl group (Fig. 6B). The 1H NMR spectra of compound 1 had the following spectrum: at 0.874 ppm is the (3H, t), 1.116 to 1.207 ppm (2H, m), 1.305 to 1.318 ppm (3H, d), 2.493 to 3.326 ppm (CH3, 3H, s), 4.856 to 4.996 ppm (aromatic, 1H, m), 5.311 to 5.342 ppm (aromatic, 1H, d), 5.565 to 5.618 ppm (aromatic, 1H, d), 6.901 to 6.931 (NH, 1H, d), 7.870 to 7.854 (NH, 1H, PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7682 d), 8.237 to 8.326 ppm (CHO, 1H, d), 12.765 ppm (OH, 1H, s), respectively. The 13C NMR spectra showed the presence of methyl (CH3) group in the upfield region between 39.538 and 40.540 ppm. The splitting patterns of both the NMR studies designated good evidence that compound 1 was identified as Antimycin A (Fig. 7A and 7B). Through the mass spectrum, the molecular weight (549.28 g/mol) and molecular formula (C28H40N2O9) of the compound were deduced in the study. The structure of the compound was elucidated and predicted to be Antimycin A of the subtype Antimycin A1ab (Fig. 8). Fig. 5. a) DPPH, b) ABTS, c) FRAP, and d) Total reducing power activity of standard and fractions (F2 and F3) at varied concentrations. Each value presents the mean ± SD of triplicate experiments. Antimycin A is an antibiotic made of nine-membered dilactone ring. In 1949, it was first isolated and categorized as a fungicide from Streptomyces sp. (Han et al. 2012). So far, more than 20 Antimycin A derivatives have been reported. Class of Antimycin compounds generally express antibacterial and antifungal properties due to the presence of biosynthetic gene clusters like non-ribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) in actinomycete strains. Detection methods like PCR amplification (for PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7683 PKSs and NRPSs genes), NMR, and LC-MS were used to identify and categorize the different types of antimycin (Hytti et al. 2019). Antimycin A plays an important role in the electron transport chain by inhibiting complex III. It also increases cell death and is the reason for the downfall of oxidative phosphorylation (Kauppinen 2018). In this study, Antimycin A isolated from strain LC-9 showed good antimicrobial and high antioxidant potential. Previously, two novel antimycins, Urauchimycins A and B, were obtained from Streptomyces sp. strain Ni-80, which showed antifungal activity against C. albicans. Likewise, there was an effective antifungal activity of Antimycins A19 and A20 from S. antibioticus H74-18 against C. albicans. Wherein, Antimycin B2 from S. lusitanus XM52 showed antibacterial activity against S. aureus and L. hongkongensis (Imamura et al. 1993; Han et al. 2012). Fig. 6. A) UV visible spectroscopy and B) FT-IR spectroscopy of Antimycin A A B PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7684 Fig. 7. A) 1H NMR spectrum and B) 13C NMR spectrum of Antimycin A A B PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7685 Fig. 8. LC-MS analysis of Antimycin A Observations for the UV spectrum of fraction F3 (compound 2) recorded peaks at 227, 230, and 231 nm (Fig. 9A). The FT-IR spectrum showed an acidic stretching peak at 3386 cm-1, indicating the presence of -OH group of carboxylic acid. Peaks at 1675 and 1594 cm-1 specified the presence of C=O stretching and -OH stretching in phenol group, respectively (Fig. 9B). The 1H NMR spectra of the compound 2 projects the following: peaks at 6.808 to 6.829 ppm (2H, d, Ar-H) due to aromatic protons, at 7.776 to 7.799 ppm (2H, d, Ar-H), in the downfield 10.214 ppm (1H, s, -OH) and 12.417 ppm (1H, s, -COOH) were observed. Peaks between 2 to 4 ppm indicate the presence of alkene protons. Similarly, it was observed that the 13C NMR spectra showed downfield carbon signals at 115.586 ppm in the aromatic region (meta position) and at 121.855 ppm in the para position. The peak at 131.994 ppm signifies C=O group, i.e., carbon of aromatic ring close to the carboxylic acid. The C-O of (OH) phenolic group was illustrated at 162.060 ppm and finally at 167.636 ppm (C=O) a carboxylic acid was shown. The other carbon signals were in the upfield region from 39.418 to 40.420 ppm (Fig. 10A and 10B). The mass spectrum showed an M+ ion peak at 139 amu and therefore it clearly revealed that the compound was 4- hydroxybenzoic acid with a molecular weight of 139.04 g/mol and molecular formula of C7H6O3 (Fig. 11). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7686 Fig. 9. A) UV visible spectroscopy and B) FT-IR spectroscopy of 4-hydroxybenzoic acid 4-hydroxybenzoic acid and its esterified forms are a well-known preservative in cosmetics, pharmaceuticals, and food industries. This compound continues to add other biological traits such as antibacterial, antiviral, antioxidant, anti-inflammatory, and hypoglycemic properties. In industries, its manufacturing parameters require high temperature and high-pressure conditions, with an addition of toxic catalysts. Therefore, the present way of producing the compounds by cultivating microbes in large quantities and extraction adds advantage over chemical synthesis (Maki and Takeda 2000). In bacteria, 4-hydroxybenzoic acid naturally occurs as a precursor for ubiquinone synthesis (Barker and Frost 2001). In this context, strain LC-9 naturally produced the compound 4- hydroxybenzoic acid with potential antimicrobial and antioxidant activities. Apoptosis and Cytotoxicity Assay The apoptosis and cytotoxicity effect of Antimycin A (Fig. 12) and 4- hydroxybenzoic acid (Fig. 13) were studied against MCF-7 cancer cell lines. Antimycin A and 4-hydroxybenzoic acid showed 30 to 95% of cell viability compared to the standard (20 to 97%). The IC50 values for Antimycin A and 4-hydroxybenzoic acid were found to be 9.6 ± 0.7 and 20.8 ± 0.4 μg/mL, respectively. The standard (Doxorubicin) showed IC50 value of 7.6 ± 1.3 μg/mL. A B PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7687 A B PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7688 Fig. 10. A) 1H NMR spectrum and B) 13C NMR spectrum of 4-hydroxybenzoic acid Fig. 11. LC-MS analysis of 4-hydroxybenzoic acid Fig. 12. Apoptosis and cytotoxicity assay of Antimycin A 1) AO/EtBr staining of MCF-7 cells treated with Antimycin A 2) DAPI staining of MCF-7 cells treated with Antimycin A 3) Antimycin A-treated MCF-7 cancer cells (MTT assay) 4) Cytotoxicity of Antimycin A and Doxorubicin at varied concentrations. Concentration (µM) C e ll V ia b il it y ( % ) PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7689 a) Control (Untreated), b) 10 µM-treated cells, c) 25 µM-treated cells, and d) 50 µM-treated cells The cell morphology was observed for the MCF-7 apoptotic and necrotic cells by fluorescence microscopy upon treatment with the extracted compounds. In AO/EtBr staining method, the orange colour indicated apoptotic bodies, the red colour denoted cell necrosis, and the green colour was the reference of untreated samples with viable cells. The colouring pattern was a tool to identify apoptosis-associated changes in cell membranes. Similarly, after DAPI staining, the sample excited blue fluorescence. Fig. 13. Apoptosis and cytotoxicity assay of 4-hydroxybenzoic acid 1) AO/EtBr staining of MCF-7 cells treated with 4-hydroxybenzoic acid 2) DAPI staining of MCF-7 cells treated with 4-hydroxybenzoic acid 3) 4-hydroxybenzoic acid-treated MCF-7 cancer cells (MTT assay) 4) Cytotoxicity of 4-hydroxybenzoic acid and Doxorubicin at varied concentrations a) Control (Untreated), b) 10 µM-treated cells, c) 25 µM-treated cells, and d) 50 µM-treated cells Amongst actinomycetes, members of Nocardiopsis have been recently identified as excellent producers of bioactive metabolites (Shady et al. 2022). Additionally, it was found that the major cytotoxic compounds belong to the class dilactones. Antimycin analogues are dilactones naturally present in Streptomyces sp. and the metabolite is produced by actinomycetes from different origins (soil, marine, etc.). Subsequently, the anticancer property of antimycin have been tested for lung cancer, breast cancer, and glioblastoma cells for cytotoxic effects (Quinn et al. 2020). In this investigation, the compounds Antimycin A and 4-hydroxybenzoic acid were tested for cytotoxic activity against MCF-7 C e ll V ia b il it y ( % ) Concentration (µM) PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7690 cell lines. The findings indicated that the assays employed in the study were well known for screening anticancer agents with cytotoxic activities. Molecular Docking and ADME Analysis Several drug targets have been identified for microbial activity from varying pathogens and targets of the cancers remain in the onset of discovery (Parasuraman et al. 2014; Pundarikakshudu and Kanaki 2019; Khusro et al. 2020). In the present study, known drug targets with credential and validation were selected to determine the interaction of the protein and the compounds of the study. Therefore, the small molecules identified from strain LC-9, i.e. Antimycin A and 4-hydroxybenzoic acid were screened computationally against the bacterial, fungal, and cancer targets. Antimycin A showed maximum docking scores of -7.122 and -9.111 kcal/mol against N-myristoyl transferase and 14-α-demethylase antifungal targets, respectively. The active site residue interactions and the hydrogen bond distance were measured and summarized (Table 3). Among different targets of bacteria, a docking score of -5.881 kcal/mol was reported against isoleucyl-tRNA synthetase. Similarly, the compound showed a docking score of -6.243 kcal/mol against HER2-human epidermal growth factor receptor 2 (Fig. 14). Table 3. Docking Analysis of Antimycin A against the Target Proteins of Bacteria, Fungi, and MCF-7 Cancer Cell Line PDB ID Docking Score Glide g- Score Glide Energy Glide e- Model Interacting Residues H-bond Distance Antifungal 1IYL -7.122 -7.178 -47.341 -57.657 ASP 412 GLY 413 TYR 225 TYR 354 2.11 2.40 1.89 2.30 5FSA -9.111 -9.167 -55.933 -79.387 PRO 462 PRO 462 TYR 132 TYR 132 1.73 1.70 1.97 1.92 Antibacterial 2VEG -3.972 -4.028 -47.479 -53.478 LYS 237 MET 135 2.17 2.63 1ILE -5.881 -5.937 -50.529 -68.54 LYS 25 GLN 28 ASP 142 2.57 1.82 1.99 2RJG -3.374 -3.43 -41.962 -47.706 LYS 339 2.43 3UDI -3.932 -3.99 -41.56 -49.66 LYS 255 1.9 Anticancer 5VAX -2.77 -2.826 -42.829 -45.789 ARG A12 2.6 1ZXM -3.883 -3.939 -39.163 -42.509 THR 147 2.27 5O4G -6.243 -6.299 -60.386 -79.287 GLU A165 SER A165 PRO A40 PRO A40 2.06 2.60 2.34 1.91 2J6M -3.259 -3.315 -40.918 -49.126 NA NA NA: Not available 4-hydroxybenzoic acid exhibited binding energy values of -5.171, -6.218, -6.851, 6.322, -7.095, and -9.567 kcal/mol against N-myristoyl transferase, isoleucyl-tRNA synthetase, alanine racemase, dihydrofolate reductase, vascular endothelial growth factor receptor 2, and DNA topoisomerases II, respectively (Table 4 and Fig. 15). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7691 Fig. 14. Best binding mode and hydrogen bond interactions of Antimycin A with binding pockets of antifungal target (PDB ID: 5FSA), antibacterial target (PDB ID: 1ILE), anticancer target (PDB ID: 5O4G): a, b, and c represent 2D interactions, 3D interactions, and docked poses, respectively Table 4. Docking Analysis of 4-hydroxybenzoic Acid Against Target Proteins of Bacteria, Fungi, and MCF-7 Cancer Cell Line PDB ID Docking Score Glide g- Score Glide Energy Glide e- Model Interacting Residues H-bond Distance Antifungal 1IYL -5.171 -5.171 -20.577 -27.217 LEU 450 1.99 5FSA -4.229 -4.229 -19.824 -22.443 THR 315, PRO 462 2.06, 1.98 Antibacterial 2VEG -5.125 -5.125 -18.645 -30.746 ARG 282, LYS 237, ASN 17 1.83, 1.72, 2.14 1ILE -6.218 -6.218 -20.315 -32.705 VAL 141 1.68 2RJG -6.851 -6.851 -21.604 -27.306 ALA 342 1.91 3UDI -4.934 -4.934 -19.24 -27.72 PHE 554 1.84 3SRW -6.322 -6.322 -22.303 -32.964 THR 47, ALA 8 2.18, 1.95 Anticancer 5EW3 -7.095 -7.095 -23.063 -36.823 ASP 1046, CYS 919 2.66, 2.18 5VAX -5.969 -5.969 -15.182 -22.235 ASP 171, ARG D12 1.80, 1.84 1ZXM -9.567 -9.567 -37.996 -93.422 ALA 167 2.04 5O4G -5.508 -5.508 -23.663 -42.368 ALA 43, LYS 39, LYS 45 1.70, 1.80, 2.21 2J6M -6.152 -6.152 -21.876 -30.332 MET 793 2.04 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7692 Fig. 15. Best binding mode and hydrogen bond interactions of 4-hydroxybenzoic acid with binding pockets of antifungal target (PDB ID: 1IYL), antibacterial target (PDB ID: 2RJG), anticancer target (PDB ID: 1ZXM): a, b, and c represent 2D i, 3D interactions, and docked poses, respectively Fig. 16. (A) RMSD and (B) RMSF plot of protein 5FSA and Antimycin A during 100 ns MD trajectory. (C) The hydrogen, hydrophobic, and water bridges of Antimycin A with respect to residues of 5FSA during 100 ns MD simulation. (D) Two-dimensional interaction of Antimycin A- 5FSA complex PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7693 Both compounds were evaluated for ADME properties, and the results are summarized in Table 6. The current research focus intends to encompass the information on target proteins and the mechanism of action of selected metabolites for therapeutic purposes. Antimycin A proved to have better binding efficiency as inhibitors of fungal proteins. Meanwhile, 4-hydroxybenzoic acid showed higher values for microbial targets, including dihydropteroate synthetase, isoleucyl-tRNA synthetase, alanine racemase, penicillin-binding protein, and dihydrofolate reductase. These targets involved in the study include regulators that create changes in DNA structure, modify DNA replication, and alter transcription, recombination, and chromatin remodeling mechanisms (Kumar et al. 2018; Crisci et al. 2019). Molecular Dynamics Antimycin A exhibited the highest interaction energy with the antifungal protein 14-α-demethylase. Both RMSD and RMSF plots were presented, and ligand-protein contacts showed hydrophobic interaction of 85% of the simulated time in the trajectory (Fig. 16). 4-Hydroxybenzoic acid possessed the highest docking score with the cancer target DNA topoisomerases II. The hydrogen bond interactions of 4-hydroxybenzoic acid with respect to residues of 1ZXM (OH-ASN 95) presented 43% of the simulated time in the trajectory (Fig. 17). Fig. 17. (A) RMSD and (B) RMSF plot of protein 1ZXM and 4-hydroxybenzoic acid during 100 ns MD trajectory. (C) The hydrogen, hydrophobic, and water bridges of 4-hydroxybenzoic acid with respect to residues of 1ZXM during 100 ns MD simulation. (D) Two-dimensional interaction of 4- hydroxybenzoic acid-1ZXM complex PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7694 CONCLUSIONS 1. Bioactive compounds (Antimycin A and 4-hydroxybenzoic acid) were isolated from Nocardiopsis sp. strain LC-9. 2. Antimycin A and 4-hydroxybenzoic acid showed potential antimicrobial activities against bacterial and fungal pathogens. 3. Both compounds exhibited antioxidant activities with prominent IC50 values. 4. Antimycin A and 4-hydroxybenzoic acid revealed anticancer activities against MCF-7 cancer cells with an IC50 value of 9.6 ± 0.7 and 20.8 ± 0.4 μg/mL, respectively. 5. Antimycin A and 4-hydroxybenzoic acid showed remarkable interaction with microbial and cancer targeted proteins, thereby confirming the pharmaceutical efficacy of these compounds. ACKNOWLEDGMENTS Authors are grateful to Researchers Supporting Project number (RSP2024R414), King Saud University, Riyadh, Saudi Arabia. UV-Vis spectrophotometer and ATR-FT-IR Spectroscopy were utilized from DST-FIST instrumentation centre, Stella Maris College, Chennai. The instrumentation facility for NMR and LC-MS was procured from SAIF IITM. REFERENCES CITED Abdel-Razek, A. S., El-Naggar, M. E., Allam, A., Morsy, O. M., and Othman, S. I. (2020). “Microbial natural products in drug discovery,” Processes 8(4), article 470. DOI: 10.3390/pr8040470 Barker, J. L., and Frost, J. W. (2001). “Microbial synthesis of p-hydroxybenzoic acid from glucose,” Biotechnology and Bioengineering 76(4), 376-390. DOI: 10.1002/bit.10160 Benzie, I. F., and Strain, J. J. (1996). “The ferric reducing ability of plasma (FRAP) as a measure of antioxidant power: The FRAP assay,” Analytical Biochemistry 239(1), 70- 76. Clarance, P., Luvankar, B., Sales, J., Khusro, A., Agastian, P., Tack, J. C., Al-Khulaifi, M. M., Al-Shwaiman, H. A., Elgorban, A. M., Syed, A., et al. (2020). “Green synthesis and characterization of gold nanoparticles using endophytic fungi Fusarium solani and its in-vitro anticancer and biomedical applications,” Saudi Journal of Biological Sciences 27, 706-712. DOI: 10.1016/j.sjbs.2019.12.026 Crisci, S., Amitrano, F., Saggese, M., Muto, T., Sarno, S., Mele, S., Vitale, P., Ronga, G., Berretta, M., and Di Francia, R. (2019). “Overview of current targeted anti-cancer drugs for therapy in onco-hematology,” Medicina 55(8), article 414. DOI: 10.3390/medicina55080414 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7695 Dror, B., Jurkevitch, E., and Cytryn, E. (2020). “State-of-the-art methodologies to identify antimicrobial secondary metabolites in soil bacterial communities – A review,” Soil Biology and Biochemistry 147, article ID 107838. DOI: 10.1016/j.soilbio.2020.107838 Goel, N., Fatima, S. W., Kumar, S., Sinha, R., and Khare, S. K. (2021). “Antimicrobial resistance in biofilms: Exploring marine actinobacteria as a potential source of antibiotics and biofilm inhibitors,” Biotechnology Reports 30, article e00613. DOI: 10.1016/j.btre.2021.e00613 Han, Z., Xu, Y., McConnell, O., Liu, L., Li, Y., Qi, S., Huang, X., and Qian, P. (2012). “Two antimycin A analogues from marine-derived actinomycete Streptomyces lusitanus,” Marine Drugs 10(3), 668-676. DOI: 10.3390/md10030668 Hauhan, J. V., and Gohel, S. D. (2020). “Molecular diversity and pharmaceutical applications of free-living and Rhizospheric marine Actinobacteria,” in: Marine Niche: Applications in Pharmaceutical Sciences, Springer, Singapore, pp. 111-131. Hytti, M., Korhonen, E., Hyttinen, J. M. T., Roehrich, H., Kaarniranta, K., Ferrington, D. A., and Kauppinen, A. (2019). “Antimycin A-induced mitochondrial damage causes human RPE cell death despite activation of autophagy,” Oxidative Medicine and Cellular Longevity 2019, article ID 1583656. DOI: 10.1155/2019/1583656 Imamura, N., Nishijima, M., Adachi, K., and Sano, H. (1993). “Novel antimycin antibiotics, urauchimycins A and B, produced by marine actinomycete,” The Journal of Antibiotics 46(2), 241-246. DOI: 10.7164/antibiotics.46.241 Jia, Z.-S., Tang, M.-C., and Wu, J.-M. (1999). “The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals,” Food Chemistry 64(4), 555-559. DOI: 10.1016/s0308-8146(98)00102-2 Kauppinen, A. (2018). “Mitochondria-associated inflammasome activation and its impact on aging and age-related diseases,” in: Handbook of Immunosenescence, T. Fulop, C. Franceschi, K. Hirokawa, G. Pawelec, (eds.), Springer, Cham, Switzerland, pp. 1-20. DOI: 10.1007/978-3-319-64597-1_107-1 Kekuda, T., Shobha, K. S., and Onkarappa, R. (2010). “Studies on antioxidant and antihelmintic activity of two Streptomyces species isolated from Western Ghat soils of Agumbe, Karnataka,” Karnataka Journal of Pharmaceutical Research, 3, 26-29. Khusro, A., Aarti, C., and Agastian, P. (2020). “Computational modelling and docking insight of bacterial peptide as ideal anti-tubercular and anticancer agents,” Biocatalysis and Agricultural Biotechnology 26, article ID 101644. DOI: 10.1016/j.bcab.2020.101644 Kumar, B., Singh, S., Skvortsova, I., and Kumar, V. (2018). “Promising targets in anti- cancer drug development: Recent updates,” Current Medicinal Chemistry 24(42), 4729-4752. DOI: 10.2174/0929867324666170331123648 Kumar, K. D., Vigneshwari, J., Gnanasekaran, A., Selvamani, V., and Senthilkumar, P. (2023). “Multipotential secondary metabolites from Nocardiopsis dassonovillei of marine Actinomycetes and their in silico studies,” Bioscience Biotechnology Research Asia 20(1), 173-187. DOI: 10.13005/bbra/3079 Maki, T., and Takeda, K. (2000). “Benzoic acid and derivatives,” Ullmann’s Encyclopedia of Industrial Chemistry 3, pp, 329-342. Mosmann, T. (1983). “Rapid colorimetric assay for cellular grow and survival: Application to proliferation and cytotoxicity assays,” Journal of Immunological Methods 65, 55-63. DOI: 10.1016/0022-1759(83)90303-4 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7696 Ngema, S. S., Khumalo, S. H., Ojo, M. C., Pooe, O. J., Malilehe, T. S., Basson, A. K., and Madoroba, E. (2023). “Evaluation of antimicrobial activity by marine Nocardiopsis dassonvillei against foodborne Listeria monocytogenes and Shiga toxin- producing Escherichia coli,” Microorganisms 11(10), article 2539. DOI: 10.3390/microorganisms11102539 Oyaizu, M. (1986). “Studies on product of browning reaction prepared from glucose amine,” Japanese Journal of Nutrition 44, 307-315. Parasuraman, S., Thing, G., and Dhanaraj, S. (2014). “Polyherbal formulation: Concept of ayurveda,” Pharmacognosy Reviews 8(16), 73-80. DOI: 10.4103/0973- 7847.134229 Prasathkumar, M., Raja, K., Vasanth, K., Khusro, A., Sadhasivam, S., Sahibzada, M. U. K., Gawwad, M. R. A., Al Farraj, D. A., and Elshikh, M. S. (2021). “Phytochemical screening and in vitro antibacterial, antioxidant, anti-inflammatory, anti-diabetic, and wound healing attributes of Senna auriculata (L.) Roxb. Leaves,” Arabian Journal of Chemistry 14, article ID 103345. DOI: 10.1016/j.arabjc.2021.103345 Pundarikakshudu, K., and Kanaki, N. S. (2019). “Analysis and regulation of traditional Indian medicines (TIM),” Journal of AOAC International 102(4), 977-978. DOI: 10.5740/jaoacint.18-0376 Quinn, G. A., Banat, A. M., Abdelhameed, A. M., and Banat, I. M. (2020). “Streptomyces from traditional medicine: Sources of new innovations in antibiotic discovery,” Journal of Medical Microbiology 69(8), 1040-1048. DOI: 10.1099/jmm.0.001232 Ramalingam, V., Rajaram, R., Archunan, G., Padmanabhan, P., and Gulyás, B. (2022). “Structural characterization, antimicrobial, antibiofilm, antioxidant, anticancer and acute toxicity properties of N-(2-hydroxyphenyl)-2-phenazinamine from Nocardiopsis exhalans (KP149558),” Frontiers in Cellular and Infection Microbiology 12, article ID 794338. DOI: 10.3389/fcimb.2022.794338 Salwan, R., and Sharma, V. (2020). “Molecular and biotechnological aspects of secondary metabolites in actinobacteria,” Microbiological Research 231, article ID 126374. DOI: 10.1016/j.micres.2019.126374 Saraswathi, K., Mahalakshmi, S., Khusro, A., Arumugam, P., Al Farraj, D. A., and Alkufeidy, R. M. (2020). “In vitro biological properties of Streptomyces cangkringensis isolated from the floral rhizosphere regions,” Saudi Journal of Biological Sciences 27, 3249-3257. DOI: 10.1016/j.sjbs.2020.09.035 Selim, M. S. M., Abdelhamid, S. A., and Mohamed, S. S. (2021). “Secondary metabolites and biodiversity of actinomycetes,” Journal, Genetic Engineering & Biotechnology 19(1), article 72. DOI: 10.1186/s43141-021-00156-9 Shady, N. H., Tawfike, A. F., Yahia, R., Fouad, M. A., Brachmann, A. O., Piel, J., Abdelmohsen, U. R., and Kamel, M. S. (2022). “Cytotoxic activity of actinomycetes Nocardia sp. and Nocardiopsis sp. associated with marine sponge Amphimedon sp.,” Natural Product Research 36(11), 2917-2922. DOI: 10.1080/14786419.2021.1931865 Siddharth, S., Aswathanarayan, J. B., Kuruburu, M. G., Madhunapantula, S. R. V., and Vittal, R. R. (2021). “Diketopiperazine derivative from marine actinomycetes Nocardiopsis sp. SCA30 with antimicrobial activity against MRSA,” Archives of Microbiology 203(10), 6173-6181. DOI: 10.1007/s00203-021-02582-2 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Jansi et al. (2024). “Bioactive traits of Nocardiopsis,” BioResources 19(4), 7673-7697. 7697 Venkatadri, B., Khusro, A., Aarti, C., Rameshkumar, M. R., and Agastian, P. (2017). “In vitro assessment on medicinal properties and chemical composition of Michelia nilagirica bark,” Asian Pacific Journal of Tropical Biomedicine 7(9), 782-790. DOI: 10.1016/j.apjtb.2017.08.003 Article submitted: May 23, 2024; Peer review completed: June 26, 2024; Revised version received: July 8, 2024; Accepted: August 3, 2024; Published: August 28, 2024. DOI: 10.15376/biores.19.4.7673-7697