PEER-REVIEW ARTICLE PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3155 Genome-based Study on the Mechanism of Rare Earth Neodymium Ions Increasing Ethanol Production from Clostridium thermocellum Jinna Cui,a,b,c,d Tiantian Sun,a,b,c,d Lixia Liu,a,b,c,d Zhanying Liu a,b,c,d,* The escalating global demand for energy, coupled with heightened environmental concerns, has rendered the identification of sustainable and environmentally friendly alternative energy sources imperative. Ethanol derived from cellulosic fibers is garnering significant interest as a clean and renewable energy source. Among the various production methods, consolidated bioprocessing (CBP) stands out due to its distinct advantages. Clostridium thermocellum is considered an exemplary candidate strain for the CBP production of cellulosic ethanol; however, the low yield of ethanol remains a critical limiting factor. In the preceding study, it was demonstrated that neodymium ions could enhance the ethanol production of C. thermocellum. In this study, the whole genome sequences of the original strain C. thermocellum ATCC 27405 (C0) and the strain with added neodymium ions (Nd3+) (C1) were sequenced and analyzed. The findings indicated that the increased expression of pyruvate-ferric redox protease (PFO) resulted from mutations in its promoter region. Furthermore, an analysis of the sequencing data, along with the results from single knockout experiments, revealed that mutations in the genes encoding methyl-accepting chemotaxis proteins (MCP) and type 3a cellulose-binding domain protein (Type) genes were correlated with enhanced ethanol production. This study serves as a reference for the targeted modification of C. thermocellum to optimize ethanol production. DOI: 10.15376/biores.20.2.3155-3175 Keywords: Rare earth; Neodymium ions; Clostridium thermocellum; Ethanol; Genome; Gene knockout Contact information: a: Center for Energy Conservation and Emission Reduction in Fermentation Industry in Inner Mongolia, Inner Mongolia University of Technology, Hohhot, 010051, Inner Mongolia, China; b: Engineering Research Center of Inner Mongolia for Green Manufacturing in Bio-fermentation Industry, Inner Mongolia University of Technology, Hohhot, 010051, Inner Mongolia, China; c: Specialized Technology Research and Pilot Public Service Platform for Biological Fermentation in Inner Mongolia, Hohhot, 010051, Inner Mongolia, China; d: College of Chemical Engineering, Inner Mongolia University of Technology, Hohhot, 010051, Inner Mongolia, China; * Corresponding author: hgxylzy2008@imut. edu.cn INTRODUCTION Since the industrial revolution, fossil fuels such as coal and oil have become essential for human production and life (Hosseini et al. 2013). While the widespread use of these energy sources has greatly boosted productivity, it has also resulted in significant greenhouse gas emissions, contributing to global warming (Jayakumar et al. 2023). In response to these challenges, many countries are now exploring biomass resources to create biofuels, which offer a renewable energy alternative that can greatly reduce greenhouse gas emissions and support environmentally sustainable development (Qiao et al. 2022; https://orcid.org/0000-0002-9662-0209 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3156 Nawab et al. 2024). According to the report by the International Energy Agency (IEA), biofuels are currently a commercially produced alternative fuel compared to other alternative fuels, with the potential to replace 10% of global oil, based on fuel performance, infrastructure, and other factors. Biofuel represents a viable alternative fuel that fulfills the criteria of being renewable, environmentally friendly, and capable of large-scale production. Cellulosic ethanol, as a typical biofuel, is fermented and converted from fibrous materials such as straw, hulls, skins and stalks of crops, residues from wood processing, and organic wastes from cities and villages (Myat et al. 2015; Guo et al. 2022). Cellulosic ethanol has many advantages, such as non-pollution, short regeneration period, and no increase in the total amount of greenhouse gases (Lovett et al. 2011). The utilization of lignocellulosic feedstock for ethanol production can mitigate the reliance on food sources for ethanol, thereby reducing competition for food resources among populations. This approach not only has beneficial implications for environmental sustainability, but it also contributes positively to the overall sustainable development of society (Reijnders et al. 2007). For example, Yu et al. (2014) obtained a theoretical ethanol yield of 69.5% under optimal conditions using sweet sorghum bagasse as fermentation substrate. Zheng et al. (2021) produced cellulosic ethanol from sugarcane bagasse (SCB) with an ethanol yield of 257 ± 5.51 mg/g SCB, which was produced at low cost and with high energy efficiency. The Thermoanaerobacterales, which exhibit a notable capacity for ethanol production, encompass genera such as Geobacinus, Thermoanaerobacter, and Clostridium. For instance, research have used Thermoanaerobacterium aotearoense (Fu et al. 2019) or Thermoanaerobacterium saccharolyticum (Desai et al. 2004) for fermentation to produce ethanol and improved yields through genetic engineering techniques. Clostridium thermocellum (C. thermocellum) is one of the few microorganisms that can directly use cellulose fermentation to produce ethanol in the natural environment as the second generation biofuel with its unique advantages as a sustainable energy source (Chang et al. 2013; Qiao et al. 2022). The C. thermocellum, a thermophilic, strictly anaerobic gram-positive bacterium, is one of the most efficient cellulose-degrading bacteria available. It metabolizes natural products including ethanol, acetic acid, lactic acid, formic acid, and hydrogen (Mazzoli et al. 2014; Liu et al. 2020; Xiao et al. 2023). C. thermocellum is able to produce decomposable cellulosic material (fibrous vesicles) due to its own properties, which contain a variety of hydrolytic enzymes, glycosidases, lichen polysaccharidases, hemicellulases, and so on (Bayer et al. 2004; Levin et al. 2006; Zhang et al. 2017; Jiang et al. 2021). However, the low yield and low feedstock utilization of C. thermocellum for cellulosic ethanol has limited its further industrial application. Currently, pretreatment processes have the capacity to alter the intricate structure of cellulose, thereby enhancing the efficiency of raw material utilization. Various pretreatment techniques have been identified, including mechanical grinding (Zeng et al. 2010), ultrasonics (Liyakathali et al. 2016), and acid or alkaline hydrolysis (Sindhu et al. 2014; Nur Aimi et al. 2015). Fermentation using treated feedstocks can improve utilization and yield. To further improve ethanol production, researchers have conducted studies related to the conversion of lignocellulose to ethanol by C. thermocellum in terms of metabolic pathways, cellulose degradation mechanisms, and ethanol fermentation. Biswas et al. (2015) obtained a mutant strain of C. thermocellum that was functionally deficient in all hydrogenases by gene knockout, resulting in 64% of the maximum theoretical yield of ethanol. Kannuchamy et al. (2016) transformed pyruvate decarboxylate (PDC) and alcohol dehydrogenase (ADH) PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3157 genes from Zymomonas mobilis into C. thermocellum, which resulted in a twofold increased pyruvate decarboxylase activity and ethanol production. In the 1970s, researchers identified that rare earth ions exert an activating effect on cellulases, amylases, and proteases (Darnall and Birnbaum 1970; Gomez et al. 1974; Diatloff et al. 1995; Zhang et al. 2009). When the catalytic activity of the same enzyme is in the presence of various rare earth ions, complex reaction phenomena occur due to differences in the composition and structure of the enzyme’s active center, the active center and its surroundings, and the mode of substrate action. This indicates that the relationship between rare earth ions and enzyme activity is highly complex, necessitating further comprehensive investigations to elucidate the underlying mechanisms. Inspired by the idea of rare earth ions to increase enzyme activity, Xin et al. (1996) demonstrated that several low concentrations of rare earth ions increased the activity of glutamate dehydrogenase. Since 2012, the authors’ research laboratory has been focused on improving bioethanol production through rare earth ions. Although significant advancements have been made in this area, the existing literature on the application of rare earth ions to enhance ethanol production via microbial fermentation remains limited. Genome sequencing represents a critical step in the correlation of genotypes with phenotypic characteristics. This process entails the submission of the genome sequence of an unidentified species to a gene sequencer, detecting the signal of its bases, and then stitching it together (Joan et al. 2019; Singh et al. 2022). In particular, the technical means of triple sequencing, developed on the basis of the original sequencing technology, can obtain higher quality genome sequences and provide technical support for in-depth studies of bacteria. Yayo et al. (2021) identified two potential mutation sites by genome sequencing, gene editing, and physiological characterization of C. thermocellum and found that these mutations play a role in the transport or metabolism of hexoses. In previous stages of this experiment, C. thermocellum ATCC27405 and T. thermosaccharolyticum DSM571 were used to produce fuel ethanol by co-fermentation. The processes were regulated from multiple perspectives, including inoculation time, inoculation ratio, substrate concentration, fermentation temperature, pH, and metal ions, so as to optimize the ethanol yield (Pang et al. 2018a,b). Wang et al. treated C. thermocellum ATCC27405 (C0) with 10-6 mol/L Nd3+, and the highest ethanol yield of the strain was 1.05 g/L with 26.6% ethanol yield, which was 97.5% higher than C0 (Wang et al. 2022). However, the specific mechanism of action of neodymium ions at the genomic level is not clear. The enzyme expression is regulated by various factors such as promoter sequences, enhancer sequences, and RNA polymerase activity, with the promoter being the most critical and direct factor. If the key site of the promoter can be found, then the yield can be further improved by genetic engineering. Based on previous studies, this study mainly analyzed the mechanism of Nd3+ to increase ethanol production of C. thermocellum C0 from the promoter sequence and genome level of key enzymes that include alcohol dehydrogenase (ADH), pyruvate-ferric redox protease (PFO), and 6-phosphofructokinase (PFK). Through studying the mechanism of Nd3+ on the metabolic pathway of C. thermocellum, the targeted transformation of the strain and the analysis of the metabolic pathway, this study serves as a reference for future research aimed at enhancing ethanol yield. PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3158 EXPERIMENTAL Strains and Culture Media The original strain utilized in this study was C. thermocellum ATCC27405, subsequently designated as C. thermocellum C0. The strain C. thermocellum C1 underwent treated with Nd3+, and it was conserved in the Chinese Center for Typical Cultures Collection (CCTCC) under the conservation number CCTCC NO: M2021190. The strain exhibiting point mutations in the promoter sequences of the three key enzymes has been designated as C. thermocellum C3. The medium was prepared in an anaerobic cabinet with an atmosphere of N2, and the medium composition and configuration methods were according to Wang et al. (2022). The 5% (v/v) inoculum was inoculated in 100-mL serum bottles and incubated at 55 °C and 180 r/min for 12 h. Methods The Nd3+ treatment method The medium was supplemented with 10-6 mol/L of Nd3+ and incubated continuously for six generations. Then, 5% (v/v) of C. thermocellum C0 strain containing Nd3+ was inoculated into solid medium and incubated at 55 C with stirring at 180 r/min for three days. Large colonies were inoculated into liquid medium and cultured until the logarithmic phase, which was the removal of Nd3+ from the medium. Amplification and sequencing of target genes The promoter sequences of key enzymes were sequenced by constructing recombinant plasmids. The pMD19-T Vertor (see Fig. 1) was used for the experiment, and double digestion was performed using the enzymatic sites on the primers (see Table 1). Fig. 1. pMD19-T Vertor cloning site First, when the C0 and C1 were cultured to logarithmic phase, the DNA was extracted using the TIANGEN bacterial whole genome DNA extraction kit. The DNA of strains C0 and C1 were used as templates to amplify promoter gene fragments. The promoter gene fragments of the two strains were amplified separately, and the reaction systems included 10 μL Exq mix dye, 1 μL DNA template, 0.5 μL upstream primer, 0.5 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3159 μL downstream primer, and 8 μL ddH2O. The polymerase chain reaction (PCR) reaction system was as follows: 95 °C for 120 s, followed by 30 cycles of 95 °C for 30 s, 45 to 55 °C for 30 s, and 72 °C with the time determined by the size of the target fragment. Next, the target fragments were recovered using the Agarose Gel Recovery Kit (Tengen Biochemical Technology (Beijing) Co.). Then, the target fragment was ligated onto the pMD19-T Vertor, and the ligation system was placed in the PCR instrument at 16 °C overnight. The ligation system was 4 μL target fragment, 1 μL pMD19-T Vertor, and 5 μL Solution Ⅰ. Finally, Hind Ⅲ and BamH Ⅰ were used for digestion, and the recombinant plasmid with correct digestion verification was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Table 1. The Primer Sequences Note: The underlined portion represents the enzyme cleavage site, and the BamH I enzyme cleavage site is GGATCCD, the Hind III enzyme cleavage site is AAGCTT. Validation of promoter site-directed mutagenesis The C0 genome was used as the template to amplify the ADH, PFK, and PFO promoter mutation sequences, respectively. The PCR amplification products were sequentially subjected to gel electrophoresis, and the gel recovery purified products were ligated with pMD19-T Vertor to construct recombinant plasmids, which were named pMD19-ADH, pMD19- PFK, and pMD19-PFO, respectively. Multiple rounds of PCR were performed for point mutation and transformation into E. coli DH5α receptor cells to screen positive clones with ampicillin. Ultimately, the recombinant plasmids were Target Sequence Primer ADH Upstream primer: CGAAGCTTGTTGTCAATCAAATCGCG Downstream primer: CGCCGGATCCTAAAACCTCCTCCTTT PFK Upstream primer: CGGCGAAGCTTATAATAAGCGTCAGAATGC Downstream primer: AATTGGATCCCTCCCCTAAATCCCGT PFO Upstream primer: GCAAGCTTGATTTGCAGCCGGAGTT Downstream primer: CGGGATCCCTCTCCTATTCTTTCCCGTT ADH1 Upstream primer: GCATGGTAAGGAGAATAAGCATTGTACATATCGGAG Downstream primer: GGCAGCGTACCATTCCTCTTATTCGTAACAT ADH2 Upstream primer: GCGCCGTGGATACTACCTCTACAAAGAACGATAT Downstream primer: CCGTGGCAAAAACCTATGGATGGAGATT ADH3 Upstream primer: CTTGCGAGAGAATGCAATATGGTGACG Downstream primer: CCGCACCTACCTTATTAACGCTCTTCTTACG PFO1 Upstream primer: GCCGCAGAAAATAAATGAGTATACTCCGGATGT Downstream primer: CGCGCCGCCACTAAAATATGTCTTTTATTTACTCT PFO2 Upstream primer: CCGACTCCGGATGTTATTGATGAAAATCAGAAAG Downstream primer: CGCCGCACTCATATGAGGCCTACAATAACTT PFO3 Upstream primer: GGCCCAGGATAAATTGATTGCAGAGTGCTTTTAC Downstream primer: CGCCGCCTATAAACAGGATAAATTGATTGA PFO4 Upstream primer: CGAGTATTGGATGCAGATTTTATTTCCGACGAAG Downstream primer: GCCGCAATAAACCCTTTTCATAACCTACGTCTAC PFK1 Upstream primer: AAGCTCGGCTATATTGAAAAAACGCACATTTC Downstream primer: TACCGCCTAAACCTCTTCGAGCCGATAT PFK2 Upstream primer: GCGCAAATTTTATCCGACCTGACGAACT Downstream primer: GCTTTTCAGCCGCGTTTAAAATAGGCTG PFK3 Upstream primer: CAAATCGTTCCGCACAACGAACAGACA Downstream primer: CAACTTTTGGCCCAGCACTAGGCGTGT PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3160 extracted in limited quantities, and the positive recombinant plasmids were identified through double digestion before being sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The expression vector for the experiment was pET-28a (as in Fig. 2). The pMD19- T is a cloning vector, which is mainly used for gene cloning and amplification, while pET- 28a is an expression vector, which is used to express the exogenous genes in the host cells. The pMD is the high copy plasmid, which would replicate a lot of plasmids, and then enzymatically cleave to propose the target fragment inside, which would be relatively easy to be attached to the PET. After extracting the plasmids, double digestion was performed using the enzymatic sites on the primers (see Table 1), respectively. Enzymatic digestion was performed at 37 °C for 4 h. The results were examined by 1% agarose gel electrophoresis after the reaction was completed. The mutant promoter and the large fragment sequence of the expression vector were recovered, and the vector sequence was ligated to the mutant promoter. The reaction system consists of 9 μL Insert fragment, 2 μL T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase, 5 μL ddH2O, and 3 μL Vector pET-28a. Fig. 2. pET-28a Vector map Determining the expression of key enzymes The bacterial broth of C0 and mutant strain (C3) were taken under the same culture conditions, and the same bacterial concentration of both strains was ensured by protein content assay. The total RNA of each strain was extracted separately using the BBI Bacterial Total RNA Rapid Extraction Kit (Sangon Biotech (Shanghai) Co., Ltd., Order NO.B518625). Then, the first strand of cDNA was synthesized using the BBI cDNA First Strand Synthesis Kit (Sangon Biotech (Shanghai) Co., Ltd., Order NO.B639251). The cDNAs of C0 and C3 were used as templates for PCR reaction amplification. The reaction PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3161 system consists of 10 μL Exq mix Dyes, 2 μL DNA template, 0.5 μL upstream primer, 0.5 μL downstream primer, and 7 μL ddH2O. The PCR reaction system was as follows: 94 °C for 120 s, followed by 30 cycles of 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 600 s. The 16S rRNA was selected as the internal reference gene. The four pairs of primers are shown in Table 2. Table 2. Primer Design Target Sequence Sequence Length (bp) Primer 16S rRNA 93 Upstream primer: CGGGTGTTGCAGACTCTCAGGTGT Downstream primer: AGTAVGGCCGCAAGGTTGAAACTCA ADH 152 Upstream primer: CGGGTGTTGCAGACTCTCAGGTGT Downstream primer: AGTAVGGCCGCAAGGTTGAAACTCA PFK 252 Upstream primer: GGAGCAAGAGACATCAGCAAACT Downstream primer: CAGAACGACAGCCTCAGCACCT PFO 165 Upstream primer: GGACAACAAAGATGAGGCTGAA Downstream primer: GCCCATCCGTCTCCACCTA The cDNA synthesized by reverse transcription of RNA from C0 and C3 was used as template and amplified by RT-PCR reaction using a fluorescent quantitative PCR instrument (BIO-RAD, Hercules, CA, USA), and the PCR reaction system was the same as above. The reaction system consisted of 10 μL Light Cycler 480 mix Dyes, 5 μL cDNA template, 1 μL upstream primer, 1 μL downstream primer, and 3 μL Light Cycler 480 DEPC H2O. The standard curve was plotted according to the logarithm of the copy number of the standards and the Ct value. The 16S rRNA genes were used as internal reference genes to analyze the relative expression of ADH, PFO, and PFK gene mRNA in C0 and C3 according to the 2-ΔΔCt method. Determination of key enzyme activity The supernatant was removed through the centrifugation of 25 mL of log-phase bacterial suspension, followed by multiple rinses of the bacterial pellet with a 0.1 mol/L Tris-HCl buffer solution (pH 7.6). Subsequently, 1.5 times the volume of the precipitate was added, and the cells were lysed under ice bath conditions. The mixture was then centrifuged for 30 minutes, yielding the intracellular crude enzyme solution as the resulting supernatant. The enzyme activity of intracellular crude enzyme solution was determined by the reaction system in Table 3. Table 3. Enzyme Reaction System Enzymes Reaction System ADH 0.1 mol/L Tris-HCl (pH 7.6) buffer, 0.01 mol/L DTT buffer, 0.5 mmol/L NAD(P)H, 0.055 mol/L acetaldehyde, Crude enzyme solution PFO 0.1 mol/L Tris-HCl (pH 7.6) buffer, 0.1 mmol/L CoA, 0.020 mol/L DTT buffer, 2 mmol/L methylviologen, 5 mmol/L Pyruvic acid, Crude enzyme solution PFK 0.1 mol/L Tris-HCl (pH 7.6) buffer,0.01 mol/L DTT buffer, 2 mmol/L ATP, 5 mmol/L MgSO4, 0.3 mmol/L NADH, 0.05 mol/L KCl, 2 U aldolase, 2 U Phosphoglyceraldehyde isomerase,10 U Glycerol phosphate, Crude enzyme solution PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3162 The enzymatic activity of ADH was determined by reference to the method of Brown et al. (2011). The enzymatic activity of PFO was determined by reference to the method of Shaw et al. (2008). The enzymatic activity of PFK was determined by reference to the method of Sridhar et al. (2000). Comparative genomic analysis C0 and C1 strains were cultured to logarithmic phase, then 1 mL of bacterial broth was taken, and the whole genomic DNA of both strains was extracted using the Bacterial Whole Genome DNA Extraction Kit, and sequenced by Beijing Novogene Technology Co. The single nucleotide polymorphism (SNP), insertion and deletion (InDels), and Structural variation (SV) analyses were performed on the sequencing results. Based on the positional relationships and interactions between SNPs and genes, gene prediction and annotation analyses were performed using databases, such as Rapid Annotation using Subsystem Technology (RAST), Kyoto Encyclopedia of Genes and Genomes (KEGG), and the Protein Sequence Database (SwissProt) for gene prediction and annotation analysis to resolve genome-level changes in the strains before and after mutagenesis. Knocking out key enzyme genes C. thermocellum C0 genomic DNA was used as the template to amplify the upstream A fragment and downstream B fragment of the target gene, respectively. The reaction system consisted of 10 μL Exq mix Dyes, 2 μL DNA template, 0.5 μL upstream primer, 0.5 μL downstream primer, and 7 μL ddH2O. The PCR reaction system was as follows: 94 °C for 120 s, followed by 30 cycles of 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 600 s. Primer sequences are shown in Table 4. The amplification products were identified correctly by agarose gel electrophoresis. The gel recovery kit was used for purification and the recovered product was stored at -20 °C. Table 4. Arac, MCP, and Type A/B Homology Arm Primer Design Enzyme Sequence Length Primer Arac-A 800 bp Upstream primer: CGGAATTCTCCGAACAGCAGCTTGATTG Downstream primer: CCGCGCGTTAATAGTCTTTTTTCTTTACCGGAAT Arac-B 821 bp Upstream primer: CGCGGATGGATTCTCTAAGCAGAATGAAT Downstream primer: CAAGCTTCAAACGACCTCCTTTCATTATCG MCP-A 800 bp Upstream primer: CCGAATTCGCAGCAGTATGGAGTAT Downstream primer: GCCAAGGAAGGTTTGGTAGCCGTCTTGTC MCP-B 779 bp Upstream primer: CATGCGAGAGAACAGGCGGCATCCAAACC Downstream primer: CGAAGCTTTGTTCCAGCCTCCCTAATAC Type-A 768 bp Upstream primer: GCCGAATTCCTTAGCAAAAGCTCCGG Downstream primer: CCTACCGCCGTCACCTTCAATTCCTTCCC Type-B 701 bp Upstream primer: CGCTGTCAACGGGGAAGGAATTGAAGGTGAC Downstream primer: CGCAAGCTTCGGACCTTACGCCGTCATT Note: The underlined portion represents the enzyme cleavage site, and the BamH I enzyme cleavage site is GGATCCD, the Hind III enzyme cleavage site is AAGCTT. The upstream and downstream sequences of the target gene were fused and ligated by PCR. The purified upstream and downstream homologous arm fragments were mixed in a molar ratio of 1:1, and the mixed DNA fragments were used as templates for fusion PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3163 PCR with primers AF and BR. The ligated recombinant fragments were obtained, and the PCR products were purified. Plasmid pK18mobSacB and the target fragment were digested with Hind Ⅲ and EcoR I. The digestion system were 5 μL plasmid, 0.5 μL EcoR I, 0.5 μL Hind III, 0.2 μL Buffer, 2 μL MC10 × Buffer, and 11.8 μL ddH2O. The digestion was performed at 37 °C for 4 h. The cloning site of plasmid pK18mobSacB is shown in Fig. 3. The electro transformation protocol referred to was Huang et al. (2015) for the electro transformation conditions of the shuttle plasmid pLuKELd Thermoanaerobacterium aotearoense SCUT27. The mutant was activated and the plasmid DNA was extracted as described above. A total of 1 μL of template DNA, 0.8 μL of upstream and downstream primers, 10 μL of Taq enzyme, and 7.4 μL of ddH2O were added for PCR amplification. The original strain (C0) and modified strains were inoculated into the culture medium respectively, and fermented at 180rpm and 55℃ for 48h. The ethanol yield was determined at the end of fermentation and C0 was used as a control. Fig. 3. Suicide plasmid pK18mobSacB map PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3164 Determination of growth curve The wild and mutant strains were inoculated in MTC medium and incubated at 55 °C and 180 r/min for 12 h. The medium was added at 5% inoculum. The OD600 values were determined every 2 h and the growth curve was used to represent the growth of the strains. Determination of ethanol yield The ethanol content in the fermentation broth was determined by high performance liquid chromatography (e2695; Waters, MA, USA), and the liquid phase detection conditions are shown in Table 5. Table 5. Ethanol Content Liquid Chromatography Detection Conditions Chromatographic column type Aminex HPX-87H column (300 mm × 7.8 mm id, 9 μm) Mobile phase 2.5 mM H2SO4 Detector Waters 2414 RI Differential detector Flow Rate 0.5 mL/min Sampling volume 10 μL Column temperature 50 °C Data analysis The experimental data were analyzed using SAS 9.2 (SAS Inc., Cary, NC, USA) for variance analysis under p < 0.05 and p < 0.01. All data are presented as the mean ± standard deviation, ensuring a clear representation of the variability and central tendency of the observed values. RESULTS AND DISCUSSION Results of Promoter Sequencing Data Analysis The strain C1 was C0 treated with the addition of Nd3+. The differential gene sequences are shown in Table 6. By comparing the gene sequences of ADH, PFO, and PFK gene promoter region sequences of strains C0 and C1, three base mutations were found in the sequence of the ADH promoter region of C1 and the types of mutations were substitutions and deletions. The PFO promoter region sequence had four base substitution mutations, and the PFK promoter region sequence had three mutated bases. The bases in which substitutions and deletions occurred contained four bases, and almost all of them were mutated in a single base, indicating that neodymium ions affected the promoter region sequences of ADH, PFO, and PFK. The initiation of transcription is a critical stage of gene expression, and when the promoter binds to RNA polymerase to start transcription, changes in the promoter structure directly affect the efficiency of binding to RNA polymerase and thus the level of gene expression (Leacock et al. 2006). The analysis of Nd3+ treatment to increase the expression level and enzyme activity of key enzyme genes may be due to the enhancement of the transcriptional function of genes by affecting the sequence of the key enzyme promoter region (Würleitner et al. 2003). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3165 Table 6. Differences in Promoter Sequences of Different Genes Gene Base Site C0 C1 Mutation Type ADH 24 A T Reversal 536 C T Reversal 621 A - Deletion PFO 76 T A Reversal 96 T C Transition 185 C A Transition 614 T C Transition PFK 16 A G Transition 211 C G Reversal 288 A T Reversal Effect of Point Mutations of Promoter Sequence on Enzyme Expression The key enzyme ADH, PFO, and PFK promoter region point mutant strain C3 was successfully constructed. The experimental results indicated that mutations in the promoter region of key enzymes can have an effect on the expression of key enzymes. The level of ADH gene in C3 was 1.03 times than that of C0 (P < 0.05), the expression of PFO gene in C3 was 1.22 times than that of C0 (P < 0.05), and the expression of PFK gene in C3 was 1.08 times than that of C0 (P < 0.05) (Fig. 4). Fig. 4. The expression level of three key genes; Different lowercase letters p <0.05, and different uppercase letters p <0.01 Effect of Promoter Sequence Point Mutations on Enzyme Activity The enzyme activities of the three key enzymes of C0 and C3 are shown in Fig. 5. The enzyme activities of ADH, PFO, and PFK in C3 were all increased compared to these in C0, being 1.05 times, 1.14 times, and 1.07 times higher than C0, respectively, but the changes of enzyme activity in these were not significant. The strength of the enzyme activity affected the efficiency of the catalysis, so the absence of significant changes in enzyme activity indicated that the catalytic capacity of the enzyme protein remained unchanged and had not affected substrate consumption and product synthesis (Petsch et al. 2012). The activity of enzymes depends not only on the expression level of their genes, but The Three Key Enzymes PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3166 also on their own structure and function. Therefore, the point mutations in promoter sequences do not necessarily cause changes in enzyme activity. The high expression of mRNA did not indicate high enzyme activity. Protein expression is closely related to transcription and translation, and its expression is determined by the transcription level and translation process (Mikel et al. 2021). Fig. 5. Three kinds of key enzyme activity of C0 and C3; Different lowercase letters p < 0.05, and different uppercase letters p < 0.01 Key enzyme activity and expression both directly affect enzyme catalytic performance and increase the flux increase in metabolic pathways (Carere et al. 2014; Wang et al. 2022). The enzyme expression and enzyme activity are regulated by transcriptional level and gene level, etc. The previous study showed that Nd3+ can significantly increase the expression of acetaldehyde dehydrogenase (ALDH), which was 11.1 times more than the original strain. However, Nd3+ neither changed the gene sequences of ALDH and ADH, and nor mutated the promoter gene sequence of ALDH transcription initiation. The enzyme expression of PFK and PFO in C1 was 3.35 times and 1.53 times higher than that in C0 and the enzyme activity of PFK and PFO in CX was 2.0 times and 1.48 times higher than that of the original strain, respectively, and the gene sequences of these two enzymes were altered by Nd3+ (Wang et al. 2022). In this experiment, ADH, PFO, and PFK promoter sequences were mutated, and the fixed point mutation verified that the expression of PFO was significantly increased, which was 1.22- fold of the original strain. While the expression of ADH and PFK and the enzyme activity of the three key enzymes were not significantly changed. This indicates that the effects of mutagenesis on the structure, function, and stability of key enzyme sequences and promoters in the metabolic pathway are somewhat contingent and random and involve the regulation of other regulatory factors (Furukawa et al. 2009). Therefore, sequence changes in key enzyme sequences and promoter regions are not the only reason for affecting the expression and enzyme activity of key enzymes. PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3167 Results of Comparative Genomic Analysis Through sequencing the DNA libraries of C1 and C0, the original strain sequencing data were 1358 and 1458 Mb, respectively, with a read length of 150 bp. Table 7 shows good sequencing quality. The four lines of the results of high quality library construction and sequencing were good by being close and parallel, and the GC and AT contents match well as seen in Fig. 6(a) and (b). As shown by the base quality distribution in Fig. 6 (c) and (d), the average error rate of the bases was all below 0.05%. The results indicate that the genome resequencing data have good results and can be analyzed in the next step. Table 7. Sequencing Data Statistics Sample ID Insert Size (bp) Reads Length (bp) Raw Data (Mb) Filtered Reads (%) Clean Data (Mb) GC (%) Q20 (%) Q30 (%) C1 350 (150:150) 1,358 7.92 1,250 38.23 95.91 89.76 C0 350 (150:150) 1,458 7.72 1,346 38.45 95.61 89.19 Fig. 6. Base content and base mass distribution of C0, C1: (a) C0 base mass distribution map; (b) C1 base mass distribution map; (c) C0 base mass distribution map; (d) is C1 base mass distribution map PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3168 There were 3839 and 3862 base conversions, 1261 and 1267 base reversals, 341 and 386 heterozygous SNPs, and 4759 and 4743 pure SNPs in C0 and C1, respectively. C0 has 1639 non-synonymous mutations and 2449 synonymous mutations. C1 has 1659 non- synonymous mutations and 2473 synonymous mutations. Amino acid mutations caused by nonsynonymous mutations can further affect gene expression. There were 93 mutations involving a total of 35 proteins or enzymes with mutated gene sequences. The annotation analysis yielded mutations in genes related to the biosynthesis of cell walls and cell membranes, methylotropic receptor protein genes, ribonucleases, endonuclease genes, transcriptional regulators, methyltransferase genes, and transposase genes, in addition to mutations in genes related to putative proteins and proteins of unknown function. These mutated genes may be associated with gene expression, metabolism and signaling, and DNA methylation. By regulating the expression of the key genes in the microbial metabolic pathway, it can promote metabolism, accelerate the influx of nutrients and produce the efflux of inhibitors, leading to increase of ethanol production (Nataf et al. 2010). There were 70 structural variants in C0, including 7 intrachromosomal migrations, 60 deleted SVs, and 3 inverted SVs. There were 66 structural variants in C1, including 6 intrachromosomal migrations, 57 deleted SVs, and 3 inverted SVs. There were 80% of SVs with length of 1000 bp or more. The SVs in this experiment mainly involved integrase catalytic region, transposase, and transcription terminator Rho. The outermost circle in Fig. 7 shows the coordinates of the reference sequence positions, and from the outer to the inner, the InDel distribution, SNP number distribution, reads coverage depth, reference sequence genomic GC content, and reference sequence genomic GC offset value distribution of C0 and C1, respectively. The data indicated that neodymium (Nd) ions induced multiple mutations in the genome of C. thermocellum ATCC C0, with the single nucleotide polymorphism (SNP) and structural variation (SV) data supporting one another. Fig. 7. Genome-wide variation map PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3169 Results of Knockout Strains Growth Measurement The strain of C. thermocellum C0 with arac knocked out will be abbreviated as CX, the strain with mcp knocked out as CY, and the strain with Type gene knocked out as CG. The knockout strains were identified and successfully constructed. As shown in Fig. 8, the three deletion strains of CX, CY, and CG and the wild strain all showed a typical "S" shaped growth curve, and the time of the delayed, logarithmic growth period and stable period of both were basically the same. The experimental results indicated that the knockdown of the three genes respectively did not produce significant effects on bacterial growth and reproduction. This observation may be attributed to the fact that the gene knockdown did not affect the biomass of C. thermocellum, resulting in similar growth trends among the strains (Lo et al. 2010). Fig. 8. Growth curve of original strain and knockout strains Results of Ethanol Yield Measurement of Knockout Strains As shown in Fig. 9, there was no significant change in ethanol production of CX strain after knocking down arac compared to the original strain. Fig. 9. Ethanol production of original strains and knockout strains; Different lowercase letters mean that p < 0.05, and different uppercase letters mean that p < 0.01 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3170 The ethanol production of CY strain with MCP knockdown was 1.07 times higher than that of the original strain. The ethanol yield of CG strain with knockout of Type was 1.32 times higher than that of the original strain. This indicates that the Arac gene is not a key locus for Nd3+ to improve ethanol yield, while the mutations in MCP and Type are associated with ethanol yield improvement to some extent. Fu et al. (2019) increased the ethanol yield of Thermoanaerobacterium aotearoense SCUT27 with 15.8% by gene knockout. The ethanol yield of CG in this experiment was increased with 31.9%, which was higher than the cited study. Mutations in the AraC gene did not significantly impact ethanol production. However, these mutations may influence the expression of genes related to cell membrane formation in C. thermocellum C0, potentially enhancing the uptake nutrients or the excretion of product inhibitors (Wang et al. 2022; Santiago et al. 2016). It is plausible that this gene plays a role in the regulation of gene expression within other metabolic pathways, potentially influencing the improvement of ethanol production. The primary function of this gene type is to bind to the substrate cellulose. Variations in the cellulose degradation capacity of cellulosomes can be attributed to differences in structural components and assembly patterns across various microbial species. (Sheng et al. 2022). CONCLUSIONS 1. The analysis conducted through sequencing revealed the presence of mutations in the promoter regions of the genes alcohol dehydrogenase (ADH), pyruvate-ferric redox protease (PFO), and 6-phosphofructokinase (PFK). 2. The findings from results of the targeted mutation assay suggest that the alteration in PFO enzyme expression is attributable to a mutation within the promoter sequence. 3. The sequencing results revealed the presence of 93 mutations in C1, encompassing genes associated with cell membrane biosynthesis, methyl chemotaxis receptor proteins, ribonucleases, endonucleases, transcriptional regulators, methyltransferases, and transposases. 4. The knockout of the key genes arac, mcp, and type 3a cellulose-binding domain protein (Type) did not impact the growth of the strain, however, mutations in the methyl- accepting chemotaxis proteins (MCP) and Type genes were correlated with enhanced ethanol production. ACKNOWLEDGMENTS The authors are grateful for the support of the Inner Mongolia Scientific Research Fund for Outstanding Youth Scholar (2022JQ10) and the National Natural Science Foundation of China (32060017). PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3171 REFERENCES CITED Bayer, E. A., Belaich, J. P., Shoham, Y., and Lamed, R. (2004). “The cellulosomes: Multienzyme machines for degradation of plant cell wall polysaccharides,” Annual Review of Microbiology 58, 521-554. DOI: 10.1146/annurev.micro.57.030502.091022 Biswas, R., Zheng, T., Olson, D. G., Lynd, L. R., and Guss, A. M. (2015). “Elimination of hydrogenase active site assembly blocks H2 production and increases ethanol yield in Clostridium thermocellum,” Biotechnology for Biofuels 8, article 20. DOI: 10.1186/s13068-015-0204-4 Brown, S. D., Guss, A. M., Karpinets, T. V., Parks, J. M., Smolin, N., Yang, S., Land, M. L., Klingeman, D. M., Bhandiwad, A., Rodriguez, Jr., M., et al. (2011). “Mutant alcohol dehydrogenase leads to improved ethanol tolerance in Clostridium thermocellum,” Proceedings of the National Academy of Sciences of the United States of America 108(33), 13752-13757. DOI: 10.1073/pnas.1102444108 Carere, C. O., Rydzak, T., Cicek, N., Levin, D. B., and Sparling, R., (2014). “Role of transcription and enzyme activities in redistribution of carbon and electron flux in response to N2 and H2 sparging of open-batch cultures of Clostridium thermocellum ATCC 27405,” Applied Microbiology & Biotechnology 98(6), 2829-2840. DOI: 10.1007/s00253-013-5500-y Chang, Y.-C., Lee, W.-J., Lin, S.-L., and Wang, L.-C. (2013). “Green energy: Water- containing acetone–butanol–ethanol diesel blends fueled in diesel engines,” Applied Energy 109, 182-191. DOI: 10.1016/j.apenergy.2013.03.086 Darnall, D. W., and Birnbaum, E. R. (1970). “Rare earth metal ions as probes of calcium ion binding sites in proteins,” Journal of Biological Chemistry 245(23), 6484-6486. DOI:10.1016/B978-0-444-53159-9.00012-7 Desai, S. G., Guerinot, M. L., and Lynd, L. R. (2004). “Cloning of l -lactate dehydrogenase and elimination of lactic acid production via gene knockout in Thermoanaerobacterium saccharolyticum JW/SL-YS485,” Applied Microbiology & Biotechnology 65(5), 600-605. DOI10.1007/s00253-004-1575-9 Diatloff, E., Smith, F. W., and Asher, C. J. (1995). “Rare earth elements and plant growth: I. Effects of lanthanum and cerium on root elongation of corn and mungbean,” Journal of Plant Nutrition 18, 1963-1976. DOI: 10.1080/01904169509365037 Fu, H., Yang, X., Qu, C., and Wang, J. F. (2019). “Enhanced ethanol production from lignocellulosic hydrolysates by inhibiting the hydrogen synthesis in Thermoanaerobacterium aotearoense SCUT27(ΔIdh),” Journal of Chemical Technology & Biotechnology 94, 3305-3314. DOI:10.1002/jctb.6141 Furukawa, T., Shida Y., Kitagami N., Mori K., Kato M., Kobayashi T., Okada H., Ogasawara W., and Morikawa Y. (2009). “Identification of specific binding sites for XYR1, a transcriptional activator of cellulolytic and xylanolytic genes in Trichoderma reesei,” Fungal Genetics & Biology 46(8), 564-574. DOI: 10.1016/j.fgb.2009.04.001. Gomez, J. E., Birnbaum, E. R., and Darnall, D. W. (1974). “The metal ion acceleration of the conversion of trypsinogen to trypsin. Lanthanide ions as calcium ion substitutes,” Biochemistry 13(18), 3745-3750. DOI:10.1021/bi00715a020 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3172 Guo, Y., Liu, G., Ning, Y., Li, X., Hu, S., Zhao, J., and Qu, Y. (2022). “Production of cellulosic ethanol and value-added products from corn fiber,” Bioresources and Bioprocessing 9, article 81. DOI: 10.1186/s40643-022-00573-9 Hosseini, S. E., and Wahid, M. A. (2013). “Feasibility study of biogas production and utilization as a source of renewable energy in Malaysia,” Renewable and Sustainable Energy Reviews 19(5), 454-462. DOI: 10.1016/j.rser.2012.11.008 Huang, X., Li, Z., Du, C., Wang, J., and Li, S. (2015). “Improved expression and characterization of a multidomain xylanase from Thermoanaerobacterium aotearoense SCUT27 in Bacillus subtilis,” Journal of Agricultural and Food Chemistry 63(28), 6430-6439. DOI: 10.1021/acs. jafc.5b01259 Jayakumar, M., Gebeyehu, K. B., Abo, L. D., Tadesse, A. W., Vivekanandan, B., Sundramurthy, V. P., Bacha, W., Ashokkumar, V., and Baskar, G. (2023). “A comprehensive outlook on topical processing methods for biofuel production and its thermal applications: Current advances, sustainability and challenges,” Fuel 349, article ID 128690. DOI: 10.1016/j.fuel.2023.128690 Jiang, Y. Z., Yuan, X. Y., Huang, H. B., Wang, D., Liu, R. M., Wang, H. L., and Teng, F. (2021). “Research progress and the biotechnological applications of multienzyme complex,” Applied Microbiology and Biotechnology 105(5), 1759-1777. DOI: 10.1007/s00253-021-11121-4 Joan, G., Marcano-Velazquez, J., Lo, A., Maness, P.-C., and Chou, K. J. (2019). “Developing riboswitch-mediated gene regulatory controls in thermophilic bacteria,” ACS Synthetic Biology 8(4), 633-640. DOI: 10.1021/acssynbio.8b00487 Kannuchamy, S., Mukund, N., and Saleena, L. M. (2016). “Genetic engineering of Clostridium thermocellum DSM1313 for enhanced ethanol production,” BMC Biotechnology 16(1), article 34. DOI: 10.1186/s12896-016-0260-2 Leacock, S. W., and Reinke, V. (2006). “Expression profiling of MAP kinase–mediated meiotic progression in Caenorhabditis elegans,” Plos Genetics 2(11), article e174. DOI: 10.1371/journal.pgen.0020174 Levin, D. B., Islam, R., Cicek, N., and Sparling, R. (2006). “Hydrogen production by Clostridium thermocellum 27405 from cellulosic biomass substrates,” International Journal of Hydrogen Energy 31(11), 1496-1503. DOI: 10.1016/j.ijhydene.2006.06.015 Liu, Y. J., Li, B., Feng, Y. G., and Cui, Q. (2020). “Consolidated bio-saccharification: Leading lignocellulose bioconversion into the real world,” Biotechnology Advances 40, article ID 107535. DOI: 10.1016/j.biotechadv.2020.107535 Liyakathali, N. A. M., Muley, P. D., Aita, G., and Boldor, D. (2016). “Effect of frequency and reaction time in focused ultrasonic pretreatment of energy cane bagasse for bioethanol production,” Bioresource Technology 200, 262-271. DOI: 10.1016/j.biortech.2015.10.028 Lo, J., Zheng, T., Hon, S., Olson, D. G., Lynd, L. R., and Metcalf, W. W. (2015). “The bifunctional alcohol and aldehyde dehydrogenase gene, adhE, is necessary for ethanol production in Clostridium thermocellum and Thermoanaerobacterium saccharolyticum,” Journal of Bacteriology 197(8), 1386-1393. DOI: 10.1128/JB.02450-14 Lovett, J. C., Hards, S., Clancy, J., and Snell, C. (2011). “Multiple objectives in biofuels sustainability policy,” Energy & Environmental Science 4, 261-268. DOI: 10.1039/c0ee00041h PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3173 Mazzoli, R., and Olson, D. G. (2020). “Clostridium thermocellum: A microbial platform for high- value chemical production from lignocellulose,” Advances in Applied Microbiology 07, 111-161. DOI: 10.1016/bs.aambs.2020.07.004 Mikel, I. O., and Orna, A. C. (2021). “Coupled transcription-translation in prokaryotes: An old couple with new surprises,” Frontiers in Microbiology 11. DOI: 10.3389/fmicb.2020.624830. Myat, L., and Ryu, G.-H. “Thermomechanical extrusion and sodium hydroxide pretreatments for ethanol production from destarched corn fiber,” Environmental Progress & Sustainable Energy 34, article ID 12059. DOI: 10.1002/ep.12059 Nataf, Y., Bahari, L., Kahel-Raifer, H., Borovok, I., Lamed, R., Bayer, E. A., Sonenshein, A. L., and Shoham, Y. (2010). “Clostridium thermocellum cellulosomal genes are regulated by extracytoplasmic polysaccharides via alternative sigma factors,” Proceedings of the National Academy of Science 107(43), 18646-18651. DOI: 10.1073/pnas.1012175107 Nawab, S., Zhang, Y. F., Ullah, M. W., Lodhi, A. F., Shah, S. B., Rahman, M. U., and Yong, Y. C. (2024). “Microbial host engineering for sustainable isobutanol production from renewable resources,” Applied Microbiology and Biotechnology 108, 16-18. DOI: 10.1007/ s00253-023-12821-9 Nur Aimi, M. N., Anuar, H., Nurhafizah, S. M., and Zakaria, S. (2015). “Effects of dilute acid pretreatment on chemical and physical properties of kenaf biomass,” Journal of Natural Fibers 12(3), 256-264. DOI: 10.1080/15440478.2014.919894 Pang, J., Hao, M., Li, Y. L., Liu, J. G., Lan, H., Zhang, Y. F., and Liu, Z. Y. (2018a). “Consolidated bioprocessing using Clostridium thermocellum and Thermoanaerobacterium thermosaccharolyticum co-culture for enhancing ethanol production from corn straw,” BioResources 13(4), 8209-8221. DOI: 10.15376/biores.13.4.8209-8221 Pang, J., Hao, M., Shi, Y. L., Li, Y. L., Zhu, M. D., Hu, J. H., Zhang, Q. C., and Liu, Z. Y. (2018b). “Enhancing the ethanol yield from salix using a Clostridium thermocellum and Thermoanaerobacterium thermosaccharolyticum co-culture system,” BioResources 13(3), 5377-5393. DOI: 10. 15376/BIORES.13.3.5377-5393 Petsch, B., Schnee, M., Vogel, A. B., Lange, E., Hoffmann, B., Voss, D., Schlake, T., Thess, A., Kallen, K. J., Stitz, L., et al. (2012). “Protective efficacy of in vitro synthesized, specific mRNA vaccines against influenza A virus infection,” Nature Biotechnology 30(12), 1210-1216. DOI: 10.1038/nbt.2436 Qiao, J., Cui, H. Y., Wang, M. H., Fu, X. S., Wang, X. Y., Li, X. J., and Huang, H. (2022). “Integrated biorefinery approaches for the industrialization of cellulosic ethanol fuel,” Bioresource Technology 360, article ID 127516. DOI: 10.1016/j.biortech.2022.127516 Reijnders, L., and Huijbregts, M. A. J. (2007). “Life cycle greenhouse gas emissions, fossil fuel demand and solar energy conversion efficiency in European bioethanol production for automotive purposes,” Journal of Cleaner Production 15(18), 1806- 1812. DOI: 10.1016/j.jclepro.2006.05.007 Santiago, A. E., Yan, M. B., Tran, M., Wright, N., Luzader, D. H, Kendall, M. M., Ruiz- Perez, F., and Nataro, J. P. (2016). “A large family of anti-activators accompanying XylS/AraC family regulatory proteins,” Molecular Microbiology 101(2), 314-332. DOI: 10.1111/mmi.13392 Shaw, A. J., Jenney, F. E., Adams, M. W. W., and Lynd, L. R. (2008). “End-product pathways in the xylose fermenting bacterium, Thermoanaerobacterium PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3174 saccharolyticum,” Enzyme and Microbial Technology 42(6), 453-458. DOI: 10.1016/j.enzmictec.2008.01.005 Sheng, T., Meng, Q. B., Li, Z. L., Sun, C. Y., Li, L. X., and Liu, L. L. (2022). “Comparative genomics reveals cellobiose hydrolysis mechanism of Ruminiclostridium thermocellum M3, a cellulosic saccharification bacterium,” Frontiers in Microbiology 13, article ID 1079279. DOI: 10.3389/fmi cb.2022.1079279 Sindhu R., Kuttiraja M., Binod P., Sukumaran R. K., and Pandey A. (2014). “Physicochemical characterization of alkali pretreated sugarcane tops and optimization of enzymatic saccharification using response surface methodology,” Renewable Energy 62, 362-368. DOI: 10.1016/j.renene.2013.07.041 Singh, S., Kumar, A., Sivakumar, N., and Verma, J. P. (2022). “Deconstruction of lignocellulosic biomass for bioethanol production: Recent advances and future prospects,” Fuel 327, article ID 125109. DOI: 10.1016 /j.fuel.2022.125109 Sridhar, J., Eiteman, M. A., and Wiegel, J. W. (2000). “Elucidation of enzymes in fermentation pathways used by Clostridium thermosuccino genes growing on inulin,” Applied and Environmental Microbiology 66(1), 246-251. DOI: 10.1128/AEM.66.1.246-251.2000 Wang, Y. B., Hu, J. H., Li, Y. L., and Liu, Z. Y. (2022). “Rare earth ion Nd3+ promotes production of cellulose ethanol by Clostridium thermocellum ATCC 27405,” Polyhedron 211, article ID 115555. DOI: 10.1016/j.poly.2021.115555 Würleitner, E., Pera, L., Wacenovsky, C., Cziferszky, A., Zeilinger, S., Kubicek, C. P., and Mach, R. L. (2003). “Transcriptional regulation of xyn2 in Hypocrea jecorina,” Eukaryotic Cell 2, 150-158. DOI: 10.1128/EC.2.1.150-158.2003 Xiao, Y., Dong, S., Liu, Y. J., You, C., Feng, Y. G., and Cui, Q. (2023). “Key roles of β- glucosidase BglA for the catabolism of both laminaribiose and cellobiose in the lignocellulolytic bacterium Clostridium thermocellum,” International Journal of Biological 250, article ID 126226. DOI: 10.1016/ j.ijbiomac.2023.126226 Xin, W. K., and Gao, X. X. (1996). “Study of the effect of lanthanide ions on the kinetics of glutamate dehydrogenase by a chronoamperometric method,” Analyst 121(5), 687- 690. DOI: 10.1039/A N9962100687 Yayo, J., Kuil, T., Olson, D. G., Lynd, L. R., and Maris, A. J. A. V. (2021). “Laboratory evolution and reverse engineering of Clostridium thermocellum for growth on glucose and fructose,” Applied and Environmental Microbiology 87(9), article ID e03017-20. DOI: 10.1128/AEM.03017-20 Yu, M., Li, J., Li, S., Du, R., Jiang, Y., Fan, G., and Chang S. (2014). “A cost-effective integrated process to convert solid-state fermented sweet sorghum bagasse into cellulosic ethanol,” Applied Energy 115(15), 331-336. DOI: 10.1016/j.apenergy.2013.11.020 Zeng, M., Mosier, N. S., Huang, C. P., Sherman, D. M., and Ladisch, M. R. (2010). “Microscopic examination of changes of plant cell structure in corn stover due to hot water pretreatment and enzymatic hydrolysis,” Biotechnology & Bioengineering 97(2), 265-278. DOI:10.1002/bit.21298 Zhang, D. Y., Hu, J. H., Bater Siqin, Zhang, T., and Chang, Y. (2009). “Dy3+ and Nd3+ induced genetic mutation of bacillus α-amylase,” Journal of Inorganic Biochemistry 103(7), 935-939. DOI: 10.1016/j.jinorgbio.2008.12.002 Zhang, J., Liu, S., Li, R., Hong, W., Xiao, Y., Feng, Y., Cui, Q., and Liu, Y. J. (2017). “Efficient whole- cell-catalyzing cellulose saccharification using engineered PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Cui et al. (2025). “Genome study of C. thermocellum,” BioResources 20(2), 3155-3175. 3175 Clostridium thermocellum,” Biotechnology for Biofuels 10, 124-138. DOI: 10.1186/s13068-017-0796-y Zheng, X., Xian, X., Hu, L., Tao, S., Zhang, X., Liu, Y., and Lin, X. (2021). “Efficient short-time hydrothermal depolymerization of sugarcane bagasse in one-pot for cellulosic ethanol production without solid-liquid separation, water washing, and detoxification,” Bioresource Technology 339, article ID 125575. DOI: 10.1016/j.biortech.2021.125575 Article submitted: August 08, 2024; Peer review completed: November 15, 2024; Revised version received: January 5, 2025; Accepted: February 23, 2025; Published: March 7, 2025. DOI: 10.15376/biores.20.2.3155-3175