PEER-REVIEW ARTICLE PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5501 Characterization of Cellulase from the Rumen Metagenome and Evaluation of its Hydrolytic Potential for Agricultural Wastes Meng Ouyang,a Chanjuan Liu,a Ping Sheng,b Qinghua Qiu,a Kehui Ouyang,a Yanjiao Li,a Yitian Zang,a and Xianghui Zhao,a,* The cellulase RuCel224, derived from the rumen metagenome, was successfully expressed in Escherichia coli BL21(DE3), with a molecular weight of ~43 kDa, as confirmed by sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. Substrate specificity assays revealed the highest activity against sodium carboxymethyl cellulose (CMC-Na) (0.861 ± 0.011 U/mg), followed by wheat straw xylan (0.150 ± 0.050 U/mg). RuCel224 exhibited optimal activity at pH 5.0 and 35 °C, retaining over 70% activity between pH 5.0 and 7.0 and 80% activity within the temperature range of 20 to 40 °C. Thermal stability tests showed that RuCel224 retained 80% activity after 30 min at 50 °C. Metal ion analysis demonstrated that Mn²⁺ significantly enhanced RuCel224 activity by 68.5% and 83.1% at 1 mM and 5 mM concentrations, respectively. Hydrolysis efficiency on lignocellulosic substrates revealed the highest reducing sugar release from corn stalk (206.21 ± 19.11 μg/mL), followed by wheat bran (106.63 ± 20.08 μg/mL) and rapeseed straw (93.83 ± 3.57 μg/mL). Overall, RuCel224 is a highly versatile cellulase under mild conditions, demonstrating strong adaptability to agricultural residues. Its superior performance on corn stalk highlights its potential for bioethanol production and other biomass valorization processes. DOI: 10.15376/biores.20.3.5501-5513 Keywords: Rumen metagenome; Cellulases; Enzymatic properties; Agricultural wastes Contact information: a: Jiangxi Province Key Laboratory of Animal Nutrition/Engineering Research Center of Feed Development, Jiangxi Agricultural University, Nanchang Jiangxi 330045, China; b: Jiangxi Provincial Academy of Sciences, Institute of Microbiology, Nanchang Jiangxi 330096, China; * Corresponding author: zhaoxh001@163.com INTRODUCTION The growing worldwide need for renewable energy and the pressing necessity to decrease reliance on fossil fuels have highlighted lignocellulosic biomass as a key focus in sustainable resource studies. As Earth’s most plentiful renewable organic material, lignocellulose plays a vital role as a feedstock for bioenergy and bioproducts (Isikgor and Becer 2015; Fatma et al. 2018). Structurally, it is composed of three primary components: cellulose, hemicellulose, and lignin, which form a complex and recalcitrant matrix in plant cell walls. These structural features, while providing mechanical strength to plants, present significant challenges for efficient biomass conversion (Chen and Chen 2014; Andlar et al. 2018). Efficiently unlocking the potential of lignocellulose is pivotal for addressing environmental challenges, such as greenhouse gas emissions, and for advancing the development of bio-based economies. Among the diverse lignocellulosic resources, agricultural residues, particularly agricultural wastes, represent a vast and underutilized PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5502 resource (Marriott et al. 2016; Seglah et al. 2019). These residues, characterized by high cellulose and hemicellulose content, are produced in significant quantities globally. However, their dense crystalline structure and close association with lignin pose significant barriers to enzymatic hydrolysis, limiting their direct utilization as a feedstock for bioenergy and biochemical production (Beig et al. 2021). Developing efficient methods to overcome these recalcitrance challenges remains a cornerstone of lignocellulosic biomass research. Enzymatic hydrolysis has emerged as a highly promising approach to lignocellulose bioconversion (Zhang et al. 2012). Cellulases and hemicellulases, as key biocatalysts, play a pivotal role in degrading cellulose and hemicellulose into fermentable sugars under mild reaction conditions (Xiao et al. 2024). Cellulase, including endoglucanase, exoglucanase, and β-glucosidase, catalyzes the depolymerization of cellulose chains, while xylanase specifically targets the xylan backbone of hemicellulose (Beg et al. 2001; Jayasekara and Ratnayake 2019). Despite their potential, the efficiency of enzymatic hydrolysis in real-world applications is often hindered by enzyme instability, substrate heterogeneity, and inhibitory by-products (Agrawal et al. 2021), underscoring the need for robust and highly active enzymes. In nature, the rumen of ruminant animals represents one of the most effective ecosystems for lignocellulose degradation (Gharechahi et al. 2023). This anaerobic fermentation chamber is home to a diverse microbial community that produces a plethora of glycoside hydrolases with remarkable efficiency and specificity (Gharechahi et al. 2023). The exploration of rumen microbiota as a source of novel lignocellulose-degrading enzymes has attracted growing attention, facilitated by advancements in metagenomic and bioinformatic technologies. By mining metagenomic datasets from the rumen environment, it is possible to uncover novel enzymes with enhanced catalytic properties, tailored for the degradation of recalcitrant biomass. In this study, the metagenomic data from beef cattle rumen microbiota (NCBI accession number PRJNA806344) was leveraged to identify and characterize a cellulase, RuCel224 (EC 3.2.1.4), with potential applications in lignocellulose bioconversion. Through comprehensive enzymatic assays, its catalytic properties were investigated, and its efficiency in degrading agricultural straw was assessed. These findings provide valuable insights into the enzymatic degradation of lignocellulose and highlight the potential of RuCel224 as a biocatalyst for sustainable biomass utilization. EXPERIMENTAL Metagenomic Sequencing of Rumen Samples The metagenomic sequencing data of rumen samples were derived from prior assessments (Hu and Zhao 2022), with the NCBI accession number PRJNA806344. Cloning of RuCel224 The RuCel224 gene was identified from rumen metagenomic DNA derived from liquid-phase rumen bacteria. Subsequently, liquid-phase DNA served as a template for the PCR amplification of the RuCel224 gene using the primer pair 5'- CTTTAAGAAGGAGATATACGGATCCATGAAAAAAGAATTAACAGCTC-3' and 5'-AGTGGTGGTGGTGGTGGTGCTCGAGAAGTCCGAATGCTTCGGGGAAT-3'. The amplified fragment was purified and inserted into the pET-28a expression vector using homologous recombination with the Hieff Clone® Plus Multi One Step PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5503 Cloning Kit (Yeasen Biotechnology, Shanghai). The recombinant vector, pET-RuCel224, was then transformed into Escherichia coli Top10 competent cells via heat shock. The pET-RuCel224 plasmid was extracted, verified by PCR amplification, and sequenced. The DNA sequence data are listed in Table S1 (see Appendix). Expression and IMAC of RuCel224 The pET-RuCel224 plasmid was introduced into E. coli BL21 (DE3) cells via heat shock, and transformants were selected on LB agar plates containing kanamycin at 37 °C overnight. Positive colonies were identified by PCR using specific primers. A seed culture was initiated in kanamycin-supplemented LB broth and incubated at 37 ℃ until an OD600 of 0.7, at which point 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added to induce RuCel224 expression. The culture was then subsequently shifted to 20 °C for over 18 h. After cultivation, cells were harvested by centrifugation at 8,000 rpm for 10 min at 4 °C. The cell pellet was resuspended in PBS and lysed ultrasonically, and centrifuged to separate the supernatant. The presence of RuCel224 in the supernatant was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with Coomassie Brilliant Blue staining. The recombinant RuCel224 strain was then cultured and induced with 0.2 mM IPTG to produce sufficient quantities of the enzyme for subsequent experimental procedures. The purification of RuCel224 was performed by affinity chromatography using a 5 mL Bio-Scale Mini Nuvia IMAC Ni-Charged column (BioRad, Hercules, CA, United States) connected to a low-pressure chromatographic system (Biologic LP; Bio-Rad, Hercules, CA, United States). Determination of Substrate Specificity of RuCel224 The substrate specificity of RuCel224 was assessed using five different substrates: CMC-Na (Sinopharm, China, carboxymethyl cellulose), Avicel (Sigma-Aldrich, St. Louis, MO, microcrystalline cellulose), wheat straw xylan (prepared as described by Faryar (Faryar et al. 2015)) and chitosan (Solarbio, Beijing), pachyman (BBI-lifesciences, China). The enzyme was incubated in a 50 mM disodium hydrogen phosphate-citrate buffer (pH 6.0) containing 1% (w/v) substrate and incubated at 40 °C for 30 min. The reducing sugars released were quantified using alkaline 3,5-dinitrosalicylic acid reagent, with xylose or glucose as standards (Ghose 1987). One unit (U) of enzyme activity was defined as the amount of enzyme required to release 1 µmol of reducing sugar per minute under assay conditions. Characteristics of Recombinant RuCel224 The pH-dependent activity of RuCel224 was assessed over a range of pH values (3.0 to 8.0) using 50 mM disodium hydrogen phosphate-citrate buffers. Reactions were carried out at 40 °C for 30 min with 1% (w/v) CMC-Na as the substrate. To determine pH tolerance, RuCel224 was pre-incubated in the same buffer systems without substrate at 35 °C for 30 min. Residual enzyme activity was measured under optimal reaction conditions. The pH stability of RuCel224 was expressed as the percentage of residual activity relative to an untreated enzyme sample, which was set as 100%. The optimal temperature for RuCel224 activity was determined by conducting reactions at temperatures ranging from 20 to 80 °C for 30 min in 50 mM disodium hydrogen phosphate-citrate buffer (pH 5.0) with 1% (w/v) CMC-Na. Thermal stability was evaluated by incubating the enzyme at 50, 60, 70, and 80 °C for varying durations (5, 10, 20, and 30 min) under pH 5.0 conditions, followed by measuring residual activity under PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5504 optimal conditions. Thermal stability was evaluated by comparing the residual activity to that of the untreated enzyme sample, which was set at 100%. The effects of metal ions, including K⁺, Ca²⁺, Na⁺, Mg²⁺, Zn²⁺, Cu²⁺, Mn²⁺, and Ni²⁺, as well as EDTA, SDS, β-mercaptoethanol, and DTT, on enzyme activity were examined at final concentrations of 1 and 5 mM. Additionally, the impact of Tween-20 and Triton X-100 on enzymatic activity was evaluated at final concentrations of 1% (v/v) and 5% (v/v). All reactions were carried out under optimal conditions in a 50 mM disodium hydrogen phosphate-citrate buffer. A reaction mixture without any additives served as the positive control, and its activity was defined as 100%. Hydrolysis of Agricultural Wastes by RuCel224 To evaluate the lignocellulose-degrading potential of RuCel224, substrates including wheat bran, rice straw, wheat straw, corn stalk, soybean straw, rape straw, and Camellia oleifera meal were tested at a final concentration of 1% (w/v). Reactions were performed in 50 mM disodium hydrogen phosphate-citrate buffer (pH 5.0) at 35 °C under optimal enzyme conditions. Control reactions without enzyme were conducted in parallel to establish the baseline hydrolysis of each substrate. Hydrolytic efficiency was assessed by comparing the reducing sugars released from enzyme-treated samples to those of the controls. Statistical Analyses Statistical analysis was performed using a one-way ANOVA in IBM SPSS statistics version 27 (IBM, Chicago, IL, United States). Significance was declared at P ≤ 0.05. RESULTS AND DISCUSSION Expression of the RuCel224 The RuCel224 gene was successfully cloned into the pET-28a expression vector and heterologously expressed in E. coli BL21(DE3) under IPTG induction conditions. Fig. 1. Analysis of RuCel224 by SDS-PAGE. M, protein marker; 1, non-transformed E. coli BL21 (DE3); 2, Uninduced RuCel224; 3, RuCel224 transformants induced with 0.2 mM IPTG; 4, The supernatant after inducing RuCel224; 5, Purified RuCel224. SDS-PAGE analysis revealed that the recombinant protein accumulated with an PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5505 approximate molecular weight of 43 kDa (Fig. 1), which is consistent with the theoretical molecular weight predicted from the amino acid sequence of RuCel224. This result not only confirms the successful expression of the target protein, but it also suggests proper protein folding and absence of major degradation products, as evidenced by the clear single band on the SDS-PAGE gel. Substrate Specificity To evaluate the substrate specificity of RuCel224, its enzymatic activities were measured using five substrates: CMC-Na, wheat straw xylan, Avicel, chitosan, and pachyman. As shown in Table 1, RuCel224 had the highest activity against CMC-Na (0.861 ± 0.011 U/mg), indicating a strong ability to degrade cellulose, particularly amorphous polysaccharides. The enzyme also showed moderate activity on wheat straw xylan (0.150 ± 0.050 U/mg), suggesting some ability to hydrolyze hemicellulose. In contrast, significantly lower activities were observed for Avicel, chitosan, and pachyman. This reduced enzymatic efficiency can be attributed to the substrates’ higher structural complexity and recalcitrance. Lower activity was observed with Avicel, chitosan, and pachyman, which was likely due to their higher structural complexity. For instance, Avicel’s crystalline cellulose is more resistant to hydrolysis than the amorphous CMC-Na (Gao et al. 2014), and pachyman’s unique β-(1,3)- and β-(1,6)-glycosidic linkages may limit enzyme access (Gupta and Lee 2009). These results suggest that RuCel224 primarily targets β-(1,4)-linked glucans, consistent with its classification as a cellulase (EC 3.2.1.4). However, the assay conditions (e.g., temperature, reaction time, pH) were not fully optimized, which could affect the results. Table 1. Substrate Specificity of RuCel143 Substrates Main Linkage Enzyme Activity (U/mg) CMC-Na 1,4-β-(Glucose) 0.861 ± 0.011 Wheat straw xylan 1,4-β-(Xylose) 0.150 ± 0.050 Avicel 1,4-β-(Glucose) 0.025 ± 0.002 Chitosan 1,4-β-(Glucosamine)/1,4-β-(N- acetylglucosamine) 0.019 ± 0.001 Pachyman 1,3-β-(Glucose) 0.047 ± 0.009 Note: Enzyme activity values are expressed as mean ± SD (n = 3). Assays were performed at 40 °C, pH 6.0. Characterization of RuCel224 This study used CMC-Na as a substrate to investigate the cellulase characteristics of RuCel224. As shown in Fig. 2, the enzyme exhibited peak activity at pH 5.0, maintaining over 70% of its activity in the pH range of 5.0 to 7.0. This result aligns with previous studies on enzymes from the rumen microbiome (Cheng et al. 2016; Loaces et al. 2016; Lee et al. 2018). To assess pH stability, RuCel224 was incubated at various pH levels for 30 min, and residual activity was measured. The enzyme retained over 90% of its activity across a wide pH range (4.0 to 8.0), indicating strong stability. However, exposure to pH 3.0 for 30 min resulted in complete inactivation, suggesting RuCel224’s sensitivity to highly acidic conditions. These findings indicate that RuCel224 can tolerate mild acidity but is fully inactivated at pH values below 4.0. PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5506 Fig. 2. (A) Optimal pH and (B) pH stability of RuCel224 Temperature dependence and thermal stability were examined using CMC-Na at pH 5.0. As shown in Fig. 3A, RuCel224 exhibited the highest activity at 35 °C, retaining over 80% of its activity within the 20 to 40 °C range. At 50 °C, activity decreased to 43.1%, and at 60 °C, it was nearly undetectable. The optimal temperature of 35 °C corresponds to the typical bovine rumen temperature of 38 to 39 °C (Wanapat 2000), further supporting the adaptability of RuCel224 to function within the rumen's temperature range. Thermal stability tests revealed RuCel224’s sensitivity to high temperatures (Fig. 3B). At 50 °C, activity decreased gradually over time, retaining around 80% after 30 min. However, at 60 °C, only 3% of activity remained after 5 min, with the enzyme nearly fully inactivated. No detectable activity was observed at 70 or 80 °C, indicating limited tolerance to elevated temperatures. These results suggest that RuCel224 functions best under moderate temperatures and is prone to thermal denaturation at higher temperatures. Fig. 3. Optimum temperature (A) and thermal stability of RuCel224 (B) Mn²⁺ significantly enhanced RuCel224’s cellulase activity, with a pronounced stimulatory effect (Fig. 4A). At concentrations of 1 mM and 5 mM, Mn²⁺ increased activity by 68.5% and 83.1%, respectively. This enhancement is consistent with previous reports showing that manganese ions act as cofactors for glycoside hydrolases, stabilizing their (B) (A) PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5507 tertiary structures and improving catalytic efficiency. Mn²⁺ likely interacts with negatively charged amino acid residues or coordinates with functional groups in the active site, stabilizing the enzyme-substrate complex and lowering the activation energy for catalysis (Huy et al. 2016; Vasconcellos et al. 2016). In contrast, RuCel224 activity was significantly inhibited by Cu²⁺ and Ni²⁺, with Cu²⁺ showing a particularly strong inhibitory effect, reducing activity to 12.3% at 5 mM. This is consistent with the redox activity of Cu²⁺, which can alternate between +1 and +2 oxidation states. At higher concentrations, this redox cycling generates reactive oxygen species (ROS), leading to oxidative damage to the enzyme (Dudev and Lim 2013). Several reports support these findings, showing Cu²⁺ inhibition of various enzymes (Loaces et al. 2016; Tan et al. 2017; López-López et al. 2023). Other metal ions, such as K⁺, Na⁺, Ca²⁺, and Mg²⁺, had negligible effects on RuCel224 activity, indicating that the enzyme is relatively resilient to ionic variations under standard conditions. Additionally, RuCel224 showed significant sensitivity to chelating agents (EDTA), surfactants (SDS), and reducing agents (DTT), as shown in Fig. 4B. DTT at 1 mM and 5 mM reduced activity to about 45%, likely by breaking disulfide bonds and compromising the enzyme’s structural integrity. EDTA, as a potent chelator, may disrupt metal-dependent stabilization of the enzyme (Auld 1988; Bergan et al. 2001), reducing activity to 76.5% and 59.7% at 1 mM and 5 mM, respectively. SDS caused the most dramatic inhibition, reducing activity to 26.8% at 1 mM and almost completely inactivating the enzyme at 5 mM. SDS is known to disrupt non-covalent interactions, such as hydrogen bonding and hydrophobic forces, leading to denaturation (Turner et al. 2003). Interestingly, β- mercaptoethanol also exhibited moderate inhibition, further highlighting the role of disulfide bonds in maintaining the enzyme’s stability. In contrast, nonionic surfactants, namely Tween-20 and Triton X-100 had minimal impact on RuCel224 activity, suggesting the enzyme’s stability in the presence of hydrophilic surface-active agents. This stability points to RuCel224’s potential suitability for industrial applications involving detergents or emulsifiers. Fig. 4. Effects of metal ions (A), inhibitors and detergents (B) (B) (A) PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5508 Hydrolysis of Agricultural Wastes by RuCel224 The hydrolysis efficiency of RuCel224 was evaluated using various lignocellulosic substrates, including wheat bran, rice straw, wheat straw, corn stalk, soybean straw, rape straw, and Camellia oleifera meal. The released reducing sugars were quantified, and the results are summarized in Fig. 5. Among the tested substrates, corn stalk exhibited the highest hydrolysis efficiency, with an average reducing sugar concentration of 206.21 µg/mL and a standard deviation of 19.11 µg/mL. This was followed by wheat bran (106.63 µg/mL, SD = 20.08) and rape straw (93.83 µg/mL, SD = 3.57). In contrast, wheat straw showed the lowest hydrolytic efficiency, releasing only 47.89 µg/mL of reducing sugars with minimal variation (SD = 0.62). Fig. 5. Hydrolysis of agricultural wastes by RuCel224. The results of the hydrolysis were calculated as the difference between the experimental group (with enzyme treatment) and the control group (without enzyme treatment). The observed variation in hydrolytic efficiency can be attributed to differences in lignocellulosic composition and structural complexity among substrates (Mansfield et al. 1999). Corn stalk, which demonstrated the highest reducing sugar release, is known to contain higher levels of hemicellulose and amorphous cellulose, which are more susceptible to enzymatic hydrolysis (Reddy and Yang 2005). Conversely, wheat straw's dense crystalline cellulose and higher lignin content likely hindered enzymatic access, resulting in lower sugar release (Fan et al. 1981). These findings emphasize the potential of RuCel224 in agricultural residue valorization, particularly in the context of bioethanol production, where efficient lignocellulose degradation is crucial. Moreover, the enzyme’s effectiveness on substrates such as tea seed cake and rapeseed cake, indicates its potential value in processing by-products from oilseed crops, further broadening its industrial applications. The authors’ previous studies align with these results, demonstrating the enzyme's wide substrate range under mild conditions. Notably, wheat bran, a by-product of flour milling, exhibited substantial enzymatic hydrolysis, suggesting its suitability as a feedstock for bioprocessing. Due to its relatively lower lignin content, wheat bran presents a promising substrate for the production of high-value sugars. However, despite RuCel224’s significant activity across diverse substrates, its reduced efficiency on lignin- rich materials, such as wheat straw, highlights a key limitation. This limitation underscores the need for optimization strategies to enhance the enzyme's efficacy on such recalcitrant PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5509 substrates. Potential solutions could include enzyme engineering or the synergistic use of auxiliary enzymes, such as laccases or peroxidases, which may improve the breakdown of lignin (Shin et al. 2019). Furthermore, pretreatment methods like steam explosion or alkali treatment could disrupt lignin-cellulose complexes, thereby enhancing the enzyme's access to the cellulose fraction and improving hydrolysis efficiency (Hendriks and Zeeman 2009). These substrate-specific variations in reducing sugar release reinforce the necessity of tailoring enzymatic processes to the unique characteristics of different feedstocks. Beyond enzymatic performance, the cost of RuCel224 production presents another significant challenge. The industrial production of enzymes is inherently expensive due to the requirements for fermentation, purification, and stabilization, which can hinder their widespread application, particularly in cost-sensitive sectors like bioethanol production. Strategies to reduce enzyme production costs are therefore critical. Optimizing microbial fermentation processes, improving strain engineering for higher expression yields, and exploring alternative host systems—such as bacterial or yeast-based recombinant platforms—could substantially enhance the cost-effectiveness of RuCel224 production (Adegboye et al. 2021). Additionally, the enzyme’s stability and availability under varying storage and operational conditions are crucial for its industrial deployment. Enzymes are susceptible to denaturation and activity loss due to prolonged storage, temperature fluctuations, and interactions with inhibitors or stabilizing agents. To mitigate these challenges, enzyme immobilization or chemical modifications could be employed to enhance RuCel224’s structural stability and extend its shelf life, ultimately improving its practicality in continuous industrial processes (Ansari and Husain 2012). In summary, while RuCel224 holds great promise for lignocellulosic biomass conversion, addressing its limitations—including its narrow operational range, high production costs, and sensitivity to lignin-rich substrates—will be critical for maximizing its commercial potential. Advancements in enzyme optimization, synergistic enzymatic applications, and effective pretreatment strategies will play a pivotal role in overcoming these challenges, ultimately enabling the broader adoption of RuCel224 in bioprocessing industries. CONCLUSIONS 1. RuCel224 is a rumen-derived cellulase with broad substrate specificity, capable of degrading both cellulose and hemicellulose. 2. RuCel224 exhibits optimal activity at pH 5.0 and 35 °C, with good pH stability, but it is sensitive to high temperatures and highly acidic environments, making it suitable for operation under mild conditions. 3. Mn²⁺ significantly enhances the cellulase activity of RuCel224. 4. RuCel224 demonstrates good degradation capacity on agricultural wastes such as corn stalks, providing a foundation for the further development of RuCel224-based enzymatic systems in biomass conversion and green biorefining applications. PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5510 ACKNOWLEDGMENTS The current study was funded by the Key Research and Development Projects of Jiangxi Province (20232BBF60010), Natural Science Foundation of Jiangxi Province (20224ACB205007, 20242BAB20309), and Key Research and Development Projects of Jiangxi Province (20232BBF60009). REFERENCES CITED Adegboye, M. F., Ojuederie, O. B., Talia, P. M. , and Babalola, O. O. (2021). “Bioprospecting of microbial strains for biofuel production: Metabolic engineering, applications, and challenges,” Biotechnol. Biofuels 14(1), 5. DOI:10.1186/s13068- 020-01853-2 Agrawal, R., Verma, A., Singhania, R. R., Varjani, S., Di Dong, C., and Patel, A. K. (2021). “Current understanding of the inhibition factors and their mechanism of action for the lignocellulosic biomass hydrolysis,” Bioresource Technology 332, article 125042. DOI: 10.1016/j.biortech.2021.125042 Andlar, M., Rezić, T., Marđetko, N., Kracher, D., Ludwig, R., and Šantek, B. (2018). "Lignocellulose degradation: An overview of fungi and fungal enzymes involved in lignocellulose degradation,” Engineering in Life Sciences 18(11), 768-778. DOI: 10.1002/elsc.201800039 Ansari, S. A., and Husain, Q. (2012). “Potential applications of enzymes immobilized on/in nano materials: A review,” Biotechnology Advances 30(3), 512-523. DOI: 10.1016/j.biotechadv.2011.09.005 Auld, D. S. (1988). “Use of chelating agents to inhibit enzymes,” in: Methods in Enzymology, Elsevier, Amsterdam, pp. 110-114. Beg, Q., Kapoor, M., Mahajan, L., and Hoondal, G. (2001). “Microbial xylanases and their industrial applications: A review,” Applied Microbiology and Biotechnology 56, 326-338. DOI: 10.1016/b978-0-323-99636-5.00015-4 Beig, B., Riaz, M., Naqvi, S. R., Hassan, M., Zheng, Z., Karimi, K., Pugazhendhi, A., Atabani, A., and Chi, N. T. L. (2021). “Current challenges and innovative developments in pretreatment of lignocellulosic residues for biofuel production: A review,” Fuel 287, article 119670. DOI: 10.1016/j.fuel.2020.119670 Bergan, T., Bergan, T., Klaveness, J., Klaveness, J., Aasen, A. J., and Aasen, A. J. (2001). “Chelating agents,” Chemotherapy 47(1), 10-14. DOI: 10.1159/000048495 Chen, H., and Chen, H. (2014). “Chemical composition and structure of natural lignocellulose,” Biotechnology of Lignocellulose: Theory and Practice 25-71. DOI: 10.1007/978-94-007-6898-7_2 Cheng, J., Huang, S., Jiang, H., Zhang, Y., Li, L., Wang, J., and Fan, C. (2016). “Isolation and characterization of a non-specific endoglucanase from a metagenomic library of goat rumen,” World Journal of Microbiology and Biotechnology 32, 1-8. DOI: 10.1007/s11274-015-1957-4 Dudev, T., and Lim, C. (2013). “Competition among metal ions for protein binding sites: Determinants of metal ion selectivity in proteins,” Chemical Reviews 114(1), 538- 556. DOI: 10.1021/cr4004665 Fan, L., Gharpuray, M., and Lee, Y.-H. (1981). “Evaluation of pretreatments for enzymatic conversion of agricultural residues,” in: Biotechnol. Bioeng. Symp, (United https://doi.org/10.1186/s13068-020-01853-2 https://doi.org/10.1186/s13068-020-01853-2 https://doi.org/10.1016/j.biortech.2021.125042 https://doi.org/10.1002/elsc.201800039 https://doi.org/10.1016/j.biotechadv.2011.09.005 https://doi.org/10.1016/b978-0-323-99636-5.00015-4 https://doi.org/10.1016/j.fuel.2020.119670 https://doi.org/10.1007/978-94-007-6898-7_2 https://doi.org/10.1007/s11274-015-1957-4 https://doi.org/10.1021/cr4004665 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5511 States). Faryar, R., Linares-Pastén, J. A., Immerzeel, P., Mamo, G., Andersson, M., Stålbrand, H., Mattiasson, B., and Karlsson, E. N. (2015). “Production of prebiotic xylooligosaccharides from alkaline extracted wheat straw using the K80R-variant of a thermostable alkali-tolerant xylanase,” Food and Bioproducts Processing 93, 1-10. DOI: 10.1016/j.fbp.2014.11.004 Fatma, S., Hameed, A., Noman, M., Ahmed, T., Shahid, M., Tariq, M., Sohail, I., and Tabassum, R. (2018). “Lignocellulosic biomass: A sustainable bioenergy source for the future,” Protein and Peptide Letters 25(2), 148-163. DOI: 10.2174/0929866525666180122144504 Gao, S., You, C., Renneckar, S., Bao, J., and Zhang, Y.-H. P. (2014). “New insights into enzymatic hydrolysis of heterogeneous cellulose by using carbohydrate-binding module 3 containing GFP and carbohydrate-binding module 17 containing CFP,” Biotechnology for Biofuels 7, 1-11. DOI: 10.1186/1754-6834-7-24 Gharechahi, J., Vahidi, M. F., Sharifi, G., Ariaeenejad, S., Ding, X.-Z., Han, J.-L., and Salekdeh, G. H. (2023). “Lignocellulose degradation by rumen bacterial communities: New insights from metagenome analyses,” Environmental Research 229, article 115925. DOI: 10.1016/j.envres.2023.115925 Ghose, T. (1987). “Measurement of cellulase activities,” Pure and Applied Chemistry 59(2), 257-268. DOI: 10.1515/iupac.59.0006 Gupta, R., and Lee, Y. (2009). “Mechanism of cellulase reaction on pure cellulosic substrates,” Biotechnology and Bioengineering 102(6), 1570-1581. DOI: 10.1002/bit.22195 Hendriks, A., and Zeeman, G. (2009). “Pretreatments to enhance the digestibility of lignocellulosic biomass,” Bioresource Technology 100(1), 10-18. DOI: 10.1016/j.biortech.2008.05.027 Hu, D., and Zhao, X. (2022). “Characterization of a new xylanase found in the rumen metagenome and its effects on the hydrolysis of wheat,” Journal of Agricultural and Food Chemistry 70(21), 6493-6502. DOI: 10.1021/acs.jafc.2c00827 Huy, N. D., Le Nguyen, C., Park, H.-S., Loc, N. H., Choi, M.-S., Kim, D.-H., Seo, J.-W., and Park, S.-M. (2016). “Characterization of a novel manganese dependent endoglucanase belongs in GH family 5 from Phanerochaete chrysosporium,” Journal of Bioscience and Bioengineering 121(2), 154-159. DOI: 10.1016/j.jbiosc.2015.06.009 Isikgor, F. H., and Becer, C. R. (2015). “Lignocellulosic biomass: A sustainable platform for the production of bio-based chemicals and polymers,” Polymer Chemistry 6(25), 4497-4559. DOI: 10.1039/c5py00263j Jayasekara, S., and Ratnayake, R. (2019). “Microbial cellulases: An overview and applications,” Cellulose 22(92), 10-5772. DOI: 10.5772/intechopen.84531 Lee, K.-T., Toushik, S. H., Baek, J.-Y., Kim, J.-E., Lee, J.-S., and Kim, K.-S. (2018). “Metagenomic mining and functional characterization of a novel KG51 bifunctional cellulase/hemicellulase from black goat rumen,” Journal of Agricultural and Food Chemistry 66(34), 9034-9041. DOI: 10.1021/acs.jafc.8b01449 Loaces, I., Bottini, G., Moyna, G., Fabiano, E., Martínez, A., and Noya, F. (2016). "EndoG: A novel multifunctional halotolerant glucanase and xylanase isolated from cow rumen,” Journal of Molecular Catalysis B: Enzymatic 126, 1-9. DOI: 10.1016/j.molcatb.2016.01.004 López-López, A., Santiago-Hernández, A., Cayetano-Cruz, M., García-Huante, Y., https://doi.org/10.1016/j.fbp.2014.11.004 https://doi.org/10.2174/0929866525666180122144504 https://doi.org/10.1186/1754-6834-7-24 https://doi.org/10.1016/j.envres.2023.115925 https://doi.org/10.1515/iupac.59.0006 https://doi.org/10.1002/bit.22195 https://doi.org/10.1016/j.biortech.2008.05.027 https://doi.org/10.1021/acs.jafc.2c00827 https://doi.org/10.1016/j.jbiosc.2015.06.009 https://doi.org/10.1039/c5py00263j https://doi.org/10.5772/intechopen.84531 https://doi.org/10.1021/acs.jafc.8b01449 https://doi.org/10.1016/j.molcatb.2016.01.004 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5512 Campos, J. E., Bustos-Jaimes, I., Marsch-Moreno, R., Cano-Ramírez, C., Benitez- Cardoza, C. G., and Hidalgo-Lara, M. E. (2023). “TtCel7A: A native thermophilic bifunctional cellulose/xylanase exogluclanase from the thermophilic biomass- degrading fungus Thielavia terrestris Co3Bag1, and its application in enzymatic hydrolysis of agroindustrial derivatives,” Journal of Fungi 9(2). DOI: 10.3390/jof9020152 Mansfield, S. D., Mooney, C., and Saddler, J. N. (1999). “Substrate and enzyme characteristics that limit cellulose hydrolysis,” Biotechnology Progress 15(5), 804- 816. DOI: 10.1021/bp9900864 Marriott, P. E., Gómez, L. D., and McQueen‐Mason, S. J. (2016). “Unlocking the potential of lignocellulosic biomass through plant science,” New Phytologist 209(4), 1366-1381. DOI: 10.1111/nph.13684 Reddy, N., and Yang, Y. (2005). “Structure and properties of high quality natural cellulose fibers from cornstalks,” Polymer 46(15), 5494-5500. DOI: 10.1016/j.polymer.2005.04.073 Seglah, P. A., Wang, Y., Wang, H., and Bi, Y. (2019). “Estimation and efficient utilization of straw resources in Ghana,” Sustainability 11(15), 4172. DOI: 10.3390/su11154172 Shin, S. K., Ko, Y. J., Hyeon, J. E., and Han, S. O. (2019). “Studies of advanced lignin valorization based on various types of lignolytic enzymes and microbes,” Bioresource Technology 289, article 121728. DOI: 10.1016/j.biortech.2019.121728 Tan, H., Miao, R., Liu, T., Yang, L., Yang, Y., Chen, C., Lei, J., Li, Y., He, J., Sun, Q., Peng, W., Gan, B., and Huang, Z. (2017). “A bifunctional cellulase–xylanase of a new Chryseobacterium strain isolated from the dung of a straw‐fed cattle,” Microbial Biotechnology 11(2), 381-398. DOI: 10.1111/1751-7915.13034 Turner, M. B., Spear, S. K., Huddleston, J. G., Holbrey, J. D., and Rogers, R. D. (2003). "Ionic liquid salt-induced inactivation and unfolding of cellulase from Trichoderma reesei,” Green Chemistry 5(4), 443-447. DOI: 10.1039/b302570e Vasconcellos, V., Tardioli, P., Giordano, R., and Farinas, C. (2016). “Addition of metal ions to a (hemi) cellulolytic enzymatic cocktail produced in-house improves its activity, thermostability, and efficiency in the saccharification of pretreated sugarcane bagasse,” New Biotechnology 33(3), 331-337. DOI: 10.1016/j.nbt.2015.12.002 Wanapat, M. (2000). “Rumen manipulation to increase the efficient use of local feed resources and productivity of ruminants in the tropics,” Asian Australasian Journal of Animal Sciences 13, 59-67. DOI: 10.4314/mejs.v6i2.109618 Xiao, M., Liu, Y.-J., Bayer, E. A., Kosugi, A., Cui, Q., and Feng, Y. (2024). “Cellulosomal hemicellulases: Indispensable players for ensuring effective lignocellulose bioconversion,” Green Carbon 2(1), 57-69. DOI: 10.1016/j.greenca.2024.01.003 Zhang, Z., Donaldson, A. A., and Ma, X. (2012). “Advancements and future directions in enzyme technology for biomass conversion,” Biotechnology Advances 30(4), 913- 919. DOI: 10.1016/j.biotechadv.2012.01.020 Article submitted: Article submitted: January 7, 2025; Peer review completed: February 8, 2025; Revised version received and accepted: March 6, 2025; Published: June 13, 2025. DOI: 10.15376/biores.20.3.5501-5513 https://doi.org/10.3390/jof9020152 https://doi.org/10.1021/bp9900864 https://doi.org/10.1111/nph.13684 https://doi.org/10.1016/j.polymer.2005.04.073 https://doi.org/10.3390/su11154172 https://doi.org/10.1016/j.biortech.2019.121728 https://doi.org/10.1111/1751-7915.13034 https://doi.org/10.1039/b302570e https://doi.org/10.1016/j.nbt.2015.12.002 https://doi.org/10.4314/mejs.v6i2.109618 https://doi.org/10.1016/j.greenca.2024.01.003 https://doi.org/10.1016/j.biotechadv.2012.01.020 PEER-REVIEWED ARTICLE bioresources.cnr.ncsu.edu Ouyang et al. (2025). “Rumen cellulase & Ag waste,” BioResources 20(3), 5501-5513. 5513 APPENDIX Supplementary Information Table S1. Nucleotide Sequence of RuCel224 Item Sequence RuCel224 ATGAAAAAAGAATTAACAGCTCTTGTACCGTTTGCACTCGCCCTGAGTTTGTGCCTGACC GCCTGCGACAACGGCGGCTCCCATAACGCCGTGGCCCCTAAAGAAGATGATTCGACAGC GACGAAGGCTATCGACTATTCCAAGGGTCGCGCCATGAACAAGAGGCTCGGCAAGGGTA TCAACCTTGGCAACTCCTGGGAATCCCAAGGGAGCAGCCTTGACTGCAGCTGGGGTAAC TGCATTGAAGACACCGATTTTGCTGTCGTTAAGGCGGCAGGATTCAATTCTATTCGACTCC CCGTGCGTTGGCAGCAGGATTCCGACTATGGCACCCATACCGTAGACCCTGCCCGTCTC GCCGGCGTGAAAGAAGATATCGAGCTTGCCCTTGCCCAAGGACTCGCTGTCATCGTGAA CTTCCACCACTATGTCGAGCTGAACGAAGCCGGTAACAACTATACGACCGACCCCCAGGC ATACGAAGAGGAAAAGGCTCACTTCTTGAAATTGTGGGAACAGGTCGCCACGGAATTGAA CAAATACCCCGATTCCATGCTCGTGCTTGAAATTTTGAACGAGCCCACCATTTCTAACGCC GAACGCGTAAGCAACCTCATGAATGACGCTTACCAGGTGATCCGTGCAAACGCACCCGG CAAGACAATCATGTTCGAAGCCTACCATGCCGCAAAATTTGCAGACCTTAAGGACTTGAAA CTGCCGGAAGACGGAAACATCATCTATTCCGGGCATTATTACGAACCCTACACCTATAGCC ACCAGGGCCATAGCTACGCCTGCAAGGGCGACGACGCTTACGCCAACACCGCTATTTAC GACATGGCCACCTATTCAAAGATTGCAACGGAGCTCTACCCCGACGTAAATGGCGGACAT GTTCCCATGAACATGGGTGAATTCGGCATTTCGGGCGGCGGCGACTTTGCCAACAGCAG AAGTTGCAACGAAGGCGAATCGCTCCCGTCGGCAAGAATGAAGGCCAAGTGGGCAAAGT TGACAATTCAGGCTGCAGAATCGAACGATATTTCCTGGCACTACTGGGGATTTACGAAAGT AGGCGGATTCGAAGCCTACAGCCGTAATGATGACGCTTGGTACGAAGGATTCCCCGAAG CATTCGGACTT