Microsoft Word - 31-Bio_42463 619 Bioscience Journal Original Article Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 EXPRESSION OF SYNTHETIC PHYTOCHELATIN EC20 IN E. COLI INCREASES ITS BIOSORPTION CAPACITY AND CADMIUM RESISTANCE EXPRESSÃO DA FITOQUELATINA SINTÉTICA EC20 EM E. COLI AUMENTA SUA CAPACIDADE DE BIOSSORÇÃO E RESISTÊNCIA AO CÁDMIO. Cleide Barbieri de SOUZA1; Elisabete José VICENTE2 1. Doutora Biotecnologia, Laboratório de Genética de Microrganismos, Instituto de Ciências Biomédicas-ICB, Universidade de São Paulo-USP, Cidade Universitária, SP, Brasil. cleidebarbieri@gmail.com; 2. Departamento de Microbiologia, Instituto de Ciências Biomédicas-ICB, Universidade de São Paulo-USP, Cidade Universitária, SP, Brasil. ABSTRACT: In this study E. coli recombinant clones that express the EC20 synthetic phytochelatin intracellularly were constructed. The increasement of Cd2+ biosorption capacity, and, also, the increasement of resistance to this toxic metal were analyzed. A gene that encodes the synthetic phytochelatin EC20 was synthesized in vitro. The EC20 synthetic gene was amplified by PCR, inserted into the DNA cloning vectors pBluescript®KS+ and pGEM®-TEasy, and also into the expression vectors pTE [pET-28(a)® derivative] and pGEX-T4-2®. The obtained recombinant plasmids were employed for genetic transformation of E. coli: pBsKS- EC20 and pGEM-EC20, they were introduced into DH10B and DH5α strains, similarly to pTE-EC20 and pGEX-EC20 that were introduced into BL21 strain. The EC20 expression was confirmed by SDS-PAGE analysis. The recombinant clones’ resistances to Cd2+ were determined by MIC analyses. The MIC for Cd2+ of DH10B/pBKS-EC20 and DH10B/pGEM-EC20 were 2.5 mM (EC20 induced), and 0.312 mM (EC20 repressed); respectively, 16 and 2 times higher than the control DH10B/pBsKS (0.156 mM). The MIC for Cd2+ of BL21/pTE-EC20 was 10.0 mM (EC20 induced) and 2.5 mM (EC20 repressed), compared with the control BL21/pTE which was only 1.25 mM. Analysis of ICP-AES showed that BL21/pGEX-EC20, after growth on the condition of EC20 expression, absorbed 37.5% of Cd2+, and even when cultured into the non-induction condition of EC20 expression, it absorbed 11.5%. These results allow the conclusion that recombinant E. coli clones expressing the synthetic phytochelatin EC20 show increased capacity for Cd2+ biosorption and enhanced resistance to this toxic ion. KEYWORDS: Escherichia coli. Phytochelatin. Biosorption. Bioremediation. Cadmium. INTRODUCTION Recently, industrial and other human activities have been generating environmental pollution in a never observed amounts, creating demands for the development of new remediation techniques. Polluting organic materials can, in most cases, be completely degraded, and that is called bioremediation (GAYLARDE; BELLINASO; MANFIO, 2005; PERELO, 2010). However, metal pollutants tend to persist indefinitely in the environment thus threatening ecosystems as they accumulate along the food chain (AKPOR; MUCHIE, 2010). The speciation of a metal (different chemical forms/species metal can exist in nature) determines its bioavailability, mobility and destination (REEDER; SCHOONEN; LANZIROTTI, 2006; LADEIRA et al., 2014). Conventional chemical or physical wastewater treatment are often inappropriate to reduce metal concentrations to the acceptable regulatory standards, and in general, they are cost- expensive and result on hazardous products (AKPOR; MUCHIE, 2010; GIRIPUNJE; FULKE; MESHRAM, 2015). A promising alternative that grows on demand and development is the use of biomaterials for biosorption of toxic heavy metals. These biomaterials are named as biosorbents (VOLESKY; HOLAN, 1995; GAVRILESCU, 2004; GADD, 2009; WANG; CHEN, 2009; GUPTA; NAYAK; AGARWAL, 2015), they are beginning to be used in bioremediation of metal contaminated waters (GAVRILESCU, 2004; AKPOR; MUCHIE, 2010; AYANGBENRO; BABALOLA, 2017). Compared to traditional physicochemical techniques, bioremediation of toxic metals presents advantages such as lower costs, superior performance and safety, besides being environmentally friendly (GADD, 2009; WANG; CHEN, 2009; GUPTA; NAYAK; AGARWAL, 2015; AYANGBENRO; BABALOLA, 2017). There are a wide variety of microorganisms (bacteria, fungi, yeasts and algae) that have good potential for use in bioremediation processes as Received: 06/05/18 Accepted: 20/11/19 620 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 biosorbents for heavy metals (VOLESKY; HOLAN, 1995; WANG; CHEN, 2009; AYANGBENRO; BABALOLA, 2017). As most heavy metals are cationic, this determinate their sorption into negatively charged functional hydroxides (-OH) or thiol (-SH) groups present on the surfaces of the biosorbents. In the cells, several groups interact with metal species allowing its capture, including cysteine SH group (GADD, 2009; WANG; CHEN, 2009). All living cells, in the presence of toxic heavy metals, produce cysteine-rich peptides such as glutathione (GSH), phytochelatins (PCs), and metallothioneins (MTs) that bind metal ions (such as Cd2+, Cu2+, Cr3+, Cr5+, Hg2+, Mn2, Pb2+), turning them into biologically inactive forms (STILLMAN, 1995; COBBETT; GOLDSBROUGH, 2002). The best-efficient heavy metal-binding molecules are the phytochelatins (PCs) which are repetitions of the γ-GluCys dipeptide followed by a terminal Gly [(γ-GluCys)n-Gly; n=2-11)]. So, PCs are oligomers of glutathione enzymatically linked by gama-type ligation (MEHRA; MULCHANDANI, 1995; COBBETT; GOLDSBROUGH, 2002). Considering the advantage PCs offer as they are short cysteine-rich peptides, Bae et al. (2000) constructed recombinant E. coli strains expressing synthetic phytochelatins (ECs; αGlu-Cys)nGly, n=8- 20) by the normal bacterial transcription ribosomal machinery. These ECs were expressed in fusion with the outer membrane protein A (OmpA) and became linked onto the bacterial cell surface. The resulting recombinants accumulate a substantially higher amount of Cd2+ than the wild-type cells (BAE et al., 2000). After that, genetic engineered bacteria expressing phytochelatin biosynthesis genes (SAUGE-MERLE et al., 2003; WAWRZYŃSKA et al., 2005) or synthetic phytochelatin genes are emerging as new tools for environmental remediation of heavy metals (BAE; MEHRA; MULCHANDANI; 2001; BIONDO et al., 2012; CHATURVEDI; ARCHANA, 2014; YANG et al., 2017). On this study, the construction of recombinant Escherichia coli strains expressing the synthetic phytochelatin EC20 intracellularly was described, as well as the consequent increases on the capacity of Cd2+ biosorption and the resistance to this toxic ion of these recombinant clones in comparison to the original phenotypes of non- transformed strains. MATERIAL AND METHODS Bacterial strains and growth conditions In this study we used the E. coli strains DH5α, DH10B (SAMBROOK; RUSSELL, 2001) and BL21-DE3 (Novagen®). The cell growth was carried out at 37 °C in liquid Luria Bertani medium - LB and in low-phosphate medium - MJS (UEKI et al, 2003). When required, the mediums were supplemented with 60 μg/mL carbenicillin or 50 μg/mL kanamycin (SAMBROOK; RUSSELL, 2001). All mediums were elaborated with components and microbiological grade salts supplied, respectively, by Difco® and Sigma- Aldrich/Merck®. Cultures in solid and liquid media were incubated at 37 °C in incubator chamber and in shaker (180 rpm), respectively. In vitro construction of the synthetic phytochelatin EC20 codifying gene The EC20 synthetic gene was constructed employing the strategy described by Bae et al. (2000) and standard molecular protocols (SAMBROOK; RUSSELL, 2001). Some GAA and TGT codons were changed for GAG and TGC, to prevent unwanted hybridization. The oligonucleotides EC-A: 5’TTTGGATCCATGGAATGTGAATGTGAATGT GAATGTGAATGTGAATGTGAATGTGAGTGT GAATGTGAGTGCGAATGCGAA3’ (site BamHI-italicized), and EC-B: 5’TTTAAGCTTTTAACCACATTCACATTCACAT TCACATTCACATTCACATTCGCATTCACATT CGCATTCGCATTCGCACTC3’ (site HindIII- italicized) were mixed, boiled, and cooled for hybridization of the bold sequences. The mixture was treated with the Klenow fragment of DNA polymerase enzyme. This double strand was used as template in a PCR reaction with the primers ec-a (5’-tttggatcca-3’) and ec-b (5’-tttaagcttt-3’), and the enzyme taq-DNA polymerase, resulting in the DNA fragment BamHIHind III (EC20 synthetic gene, 141bp) (Figure 1-a). All nucleotides and enzymes were purchased from Promega® and Fermentas®, respectively. The thermocycler machine used was “MJ Research-model PTC-200”. Cloning the EC20 synthetic gene The EC20 synthetic gene and the plasmid pGEM-TEasy (Promega®) were mixed with T4- DNA ligase, and that ligation mixture (SAMBROOK; RUSSELL, 2001) was used on the genetic transformation of E. coli DH10B strain. Plasmids isolated from some randomly selected recombinant clones were digested with BamHI and EcoRI (site present in the pGEM-TEasy plasmid) and analyzed in a gel submitted to electrophoresis, 621 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 to select the plasmid pGEM-EC20 (Figure 1-b). For the subsequent plasmids’ constructions, the EC20 DNA fragment was obtained by PCR using as template PGEM-EC20, primers T3 and T7 (Promega®), as well as the enzyme High Fidelity DNA polymerase. The amplicon was digested with BamHI-HindIII (Figure 1-c) and linked to the cloning plasmid pBsKS [pBluescriptKS(+)] (Stratagene®) and to the expression vector pTE [a pET-28(a) - Novagen® derivative without the His- tag codifying region: the original plasmid was digested with NcoI and BamHI, treated with Klenow DNA polymerase, and relinked using DNA T4 ligase], both pre-digested with the same enzymes, using DNA T4 ligase. The PCR EC20 amplicon flanked by BamHI and EcoRI (Figure 1-c) was also linked to vector pGEX-T4-2 (Promega®) previously digested with the same enzymes, using DNA T4 ligase (Figure 1-d). The plasmids pGEM-EC20 and pBsKS- EC20 were used on the genetic transformations of E. coli DH5α and DH10B strains, respectively. The expression recombinant plasmids pTE-EC20 and pGEX-EC20 were used for genetic transformations of E. coli BL21-DE3 (Merck®) strain. This resulted into recombinant clones DH5α/pGEM-EC20, DH10/pBsKS-EC20, BL21/pTE-EC20 and BL21/pGEX-EC20. DNA sequencing For DNA sequencing, we used T3 and T7 (Promega®) primers, BigDye® sequencing-Kit, sequencing machine ¨ABI 3730 DNA Analyzer¨, and the software ¨Sequencing Analysis 5.3.1 with the Base Caller KB¨ from Applied Biosystems®. Protein expression methods The recombinant clones BL21/pTE-EC20 and BL21/pGEX-EC20 were cultured in LB medium+IPTG (final concentration 800 µM), at 37 oC, in shaker (180 rpm), until Abs600nm 1.0. The total amount of protein was extracted and analyzed by SDS-PAGE. Since EC20 protein has only 4.6 kDa, 17.5% acrylamide was used (LAEMMLI, 1970; SAMBROOK; RUSSELL, 2001). Heavy Metals Resistance Determination Analytical-grade CdCl2.2.5H2O (Merck®) was used to prepare 0.1 M stock solution and was sterilized by membrane filtration (0.22 μm, Millipore®). Deionized water was used throughout the study. Recombinant clones were pre-cultured in 3.0 mL of LB medium plus antibiotic, incubated at 200 rpm, at 37 ºC, for 24 hours. For EC20 expression induction it was added 2 mM IPTG (final concentration 800 µ M), and for its repression it was added 2% glucose (SAMBROOK; RUSSELL, 2001). From those pre-cultures, 25 μL was inoculated into 25 mL of fresh liquid MJS medium with the same supplement additions. Each one of those cultures were distributed in 10 tubes: 4.0 mL were poured into the first tube and 2.0 mL in the remaining tubes. To the first tube it was added CdCl2 to a final concentration of 10 mM, and from that, 2.0 mL were transferred to the next tube, successively. The tubes were incubated at 37 °C, 200 rpm, for 24 hours. The minimal inhibitory concentration (MIC) of Cd2+ for the clones was determined by visual observation of the turbidity (ANDREWS, 2001). All experiments were performed in duplicates. Heavy Metals Bioaccumulation In duplicates, recombinant clones were cultured in 5.0 mL of LB medium plus antibiotic and incubated at 37 °C, 200 rpm, for 16 hours. 30 μL were inoculated in 30 mL of fresh medium with the same composition. The initial cell concentration was standardized at Abs600nm 0.15. After 1-hour incubation, IPTG (final concentration 800 µM) was added for the EC20 expression induction. The cultures were incubated until Abs600nm 0.5. The cells were harvested by centrifugation (4 ºC, 6000 g, 20 min). The pellet cells were suspended in 50 mL CdCl2 1.000 μM, incubated at 37 °C, 200 rpm, for 2 hours, and centrifuged (4 oC, 6.000 g, 20 min). The remaining Cd2+ in the supernatant was determined by Inductively Coupled Plasma Atomic Emission Spectrometry - ICP-AES (ESPECTRO®-ARCOS), the calibration curve was made with a 1000 ppm cadmium mono-element standard solution. RESULTS The DNA fragment codifying EC20 synthetic phytochelatin was constructed in vitro and amplified by PCR (Figure 1-a). The EC20 synthetic gene was inserted into two cloning plasmids pGEM- TEasy (Promega®) and pBluescriptKS(+) (Stratagene®) resulting in the recombinant plasmids pGEM-EC20 (Figure 1-b) and pBsKS-EC20 (Figure 1-c). These recombinant plasmids were used in the genetic transformation of E. coli DH10B and DH5α strains. EC20 (Figure 1-c) was also inserted into the expression vectors pTE (a pET-28(a)- Novagen® derivative constructed in this research) and pGEX-T4-2-(Promega®) (Figure 1-d) resulting in the recombinant plasmids pTE-EC20 and pGEX- EC20. 622 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 Figure 1. Migration profiles of DNA fragments on 1.0% agarose gels after electrophoresis and subsequent staining with 0.02% ethidium bromide: (a) 1-Molecular marker 100 pb (Invitrogen®), 0.8 μg; 2- DNA fragment synthetic phytochelatin EC20 after PCR amplification. (b) 1- Molecular marker 1 kb (Invitrogen®), 0.8 μg; 2-PGEM-EC20 digested with BamHI and EcoRI. (c) 1- Molecular marker 100 pb (Invitrogen®), 0.8 μg; 2- Amplicon obtained by PCR (EC20 synthetic gene) using as template the plasmid PGEM-EC20 and the primers T3 and T7 (Promega®); 3- EC20 synthetic gene amplicon digested with BamHI and HindIII; 4- EC20 synthetic gene amplicon digested with BamHI and EcoRI. (d) 1- Molecular marker 1 kb (Invitrogen®), 0.8 μg; 2- pGEX-EC20 digested with BamHI and EcoRI; 3- Molecular Marker 100 bp DNA (Invitrogen®), 0.8 μg. The synthetic phytochelatin EC20 expression was analyzed by SDS-PAGE. The clones BL21/pTE-EC20 expressed a 4.6 kDa protein, the corresponding expected weight for the EC20 protein (data not show). The clone BL21/pGEX-EC20 expressed a protein band with 30.6 kDa corresponding to the fusion protein EC20-GST (4.6 kDa / EC20 plus 26 kDa / GST) (Figure 2-b). Figure 2. Expression analysis of the fusion protein EC20-GST by SDS-PAGE (17.5% acrylamide): (a) Protein molecular weight standard SM043 (Fermentas®). (b) 1- Molecular weight standard SM0431 protein (Fermentas®); 2 and 3- total proteins expressed by the negative control BL21(DE3)/pGEX-4T-2; 4 and 5- total proteins expressed by the recombinant clone BL21/pGEX-EC20: (2, 4) after growth in the induction condition of EC20 expression (2.0 mM IPTG) and (3, 5) of EC20 repression expression (with glucose). The E. coli recombinant clones resistance (or tolerance) to heavy metal were analyzed by determination of the MIC (minimum inhibitory concentration) of Cd2+ for the clones. The MICs of Cd2+ for the recombinant clones came from E. coli DH5α or DH10B strains harboring the plasmids pGEM-EC20 (data not show) or pBsKS-EC20, the results were 2.5 mM and 0.312 mM after cells 623 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 growth, respectively, under the inducing and the repressing condition of EC20 expression, compared to 0.156 mM for the corresponding untransformed E. coli strains that do not express the EC20 protein (negative controls) (Figure 3-a). The Cd2+ MICs for the recombinant clones derived from E. coli BL31 harboring the plasmid pTE-EC20 or pGEX-EC20 were 10 mM and 2.5 mM after growing the cells, respectively, under condition of induction and repression of EC20 expression; compared with 1.25 mM for the E. coli BL31 strain which does not express the EC20 protein (negative control) (Figure 3-b). Figure 3. MIC of Cd2+ showed by the E. coli recombinant clones. The cells were grown in MJS liquid medium supplemented with CdCl2, 37 ºC, with agitation in shaker: (a) Recombinant clones: DH10B/pBsKS (negative controls without EC20), DH10B/pBsKS-EC20 cultured with glucose (repressed condition of EC20 expression), DH10B/pBsKS-EC20 cultured with IPTG (induction condition of EC20 expression). (b) Recombinant clones: BL21/pTE (negative controls without EC20), BL21/pTE-EC20 cultured with glucose (repressed condition for EC20 expression), BL21/pTE-EC20 cultured with IPTG (induction condition for EC20 expression). The heavy metal biosorption capacity of the recombinant E. coli clones were settled. Cells from the bacterial recombinant clones were incubated in aqueous solution of Cd2+ and, after removing the cells from the solutions, the amount of remaining Cd2+ was quantified by ICP-AES (Inductively Coupled Plasma - Atomic Emission Spectroscopy). The Recombinant clone BL21/pGEX-EC20 cells, after growth in the EC20 protein expression repression condition, absorbed 11.5% of the total amount of Cd2+ present in water; and these cells, after growth in the induction condition of the EC20 expression, absorbed 37.5% of the total amount of Cd2+ present in water (Figure 4). Figure 4. Absorption capacity of Cd2+ from E. coli recombinant clones. A 1.000 µM CdCl2 water solution was incubated with bacterial cells. After the treatment, the total amount of Cd2+ was determined by ICP ICP-AES. A- Untreated solution and B- treated solution with: BL21/pGEX-EC20 clone cells grown on glucose-medium (repressed condition for EC20 expression); and C- treated solution with: BL21/pGEX-EC20 clone cells grown on medium supplemented with IPTG (induced condition for EC20 expression). 624 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 DISCUSSION In this study, the construction of recombinant E. coli clones expressing the EC20 synthetic phytochelatin was demonstrated, consequently, we could notice the clones increasement in their capacities for Cd2+ biosorption and resistance to this toxic ion. To accomplish that, a double-stranded synthetic DNA fragment encoding for the EC20 synthetic phytochelatin (EC20 gene) was constructed in vitro (Figure 1-a), amplified by PCR,inserted into the cloning plasmids (pBluescript®KS+ and pGEM®-TEasy) and into the expression plasmids pET-28a(+)® [derivative without His-tag constructed in this work] and pGEX-4T-2®. The molecular constructions (pGEM-EC20, pBsKS-EC20, pTE-EC20 and pGEX-EC20) were confirmed by restriction analysis, amplification by PCR (Figure 1-b, c, d) and DNA sequencing. The recombinant plasmids pGEM-EC20, pBsKS-EC20 were inserted into E. coli DH5α and DH10B strains. The recombinant plasmids pTE-EC20 and pGEX- EC20 were inserted into E. coli BL21-DE3 strain, as it offers valuable benefits of maximal expression of a cloned gene. As expected, the recombinant clone BL21/pGEX-EC20, after growth in the inducing condition of EC20 expression, produced a 30.6 kDa recombinant protein corresponding to a fusion of glutathione-S-transferase (GST, 26 kDa) and EC20 synthetic phytochelatin (4.6 kDa), as shown in SDS- PAGE analysis (Figure 2-b). We were able to observe that the expression of EC20 also grants a great increasement on the resistance to Cd2+ of the recombinant clones. Clones harboring plasmids pBsKS-EC20 or pGEM-EC20, after growth in the condition of EC20 expression induction, became 16 times more resistant to Cd2+, and even after growth in the condition of EC20 repressed expression, they remain 8 times more resistant to Cd2+ in comparison with the original untransformed strains (Figure 3-a). The clones E. coli BL21 harboring the plasmid pTE-EC20 or pGEX-EC20 (BL21/pTE-EC20 and BL21/pGEX- EC20), after growth in the condition of induction and repression, EC20 expression showed, respectively, MICs to Cd2+ 8 and 2 times higher than the MIC of the original BL21 strain (without EC20) (Figure 3-b). The observed increasement on resistance to Cd2+ showed by the clones expressing EC20 is particularly relevant because it is a desired and valuable phenotype for a bacterium that must perform bioaccumulation of toxic heavy metal as a strategy for environmental bioremediation. As far as we know, the only previous study describing increasement to metal resistance resulting from EC20 expression was seen in D. radiodurans, and in that case, the 2.5-fold increasement was considered an amazing result (CHATURVEDI; ARCHANA, 2014). The ICP-AES analysis was used to quantify the remaining amount of Cd2+ present in water after treatment with a 1.000 μM Cd2+ solution with bacterial cells. Cells of the recombinant clone BL21/pGEX-EC20, after growth in the condition of induction of EC20 protein expression, showed capacity for removing 37.5% of the total amount of Cd2+ present in that solution and, even when these cells were grown in the condition of EC20 protein expression repression, they removed 11.5% of the total amount of Cd2+ (Figure 4). So, induction of EC20 protein expression promotes 26% increasement in Cd2+ bioaccumulation of the recombinant clone cells (Figure 4). These are satisfactory results that can be comparable to those previously described with recombinant clones expressing EC20 (BAE et al., 2000), C. metallidurans (BIONDO et al., 2012) and D. radiodurans (CHATURVEDI; ARCHANA, 2014). This indicates that this approach offers a good potential for the construction of new bacterial strains useful for bioremediation of wastewaters containing heavy metals or to recover valuable metals that still remains in those waters. CONCLUSION It was successfully describe the construction and characterization of recombinant E. coli clones expressing intracellularly the synthetic phytochelatin EC20. As expected, the recombinant clones, in comparison to untransformed cells, showed an increased biosorption capacities of Cd2+, and this confirms that this approach offers good and new prospects for future applications in bioremediation procedures of water contaminated with heavy metals as cadmium or even for recovery of valuable heavy metals present in water. Moreover, in this research, it was demonstrated that EC20 expression also promotes an increasement on the bacterial resistance to Cd2+. 625 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 RESUMO: Foram construídos clones recombinantes de E. coli que expressam intracelularmente a fitoquelatina sintética EC20. Foi analisado o aumento na capacidade de biossorção de Cd2+ e o aumento da resistência a este metal tóxico. Foi sintetizado in vitro um gene codificante da fitoquelatina sintética EC20. O gene EC20 sintético foi amplificado por PCR, inserido nos vetores de clonagem pBluescript®KS+ e pGEM®- TEasy, e nos vetores de expressão pTE [derivado de pET-28(a)®] e pGEX-T4-2®. Os plasmídeos recombinantes foram empregados na transformação genética de E. coli: pBsKS-EC20 e pGEM-EC20 foram introduzidos nas linhagens DH10B e DH5α; e, pTE-EC20 e pGEX-EC20 na linhagem BL21-DE3. A expressão EC20 foi analisada por SDS-PAGE. As resistências a Cd2+ dos clones recombinantes foram determinadas por análises de MIC. A MIC para Cd2+ de DH10B/pBsKS-EC20 e de DH10B/pGEM-EC20 foi 2,5 mM (EC20 induzido) e 0,312 mM (EC20 reprimido); respectivamente, 16 e 2 vezes superiores às do controle DH10B/pBsKS (0,156 mM). A MIC para Cd2+ de BL21/pTE-EC20 foi 10,0 mM (EC20 induzido) e 2,5 mM (EC20 reprimido), comparado a do controle BL21/pTE que foi apenas 1,25 mM. A análise de ICP-AES mostrou que BL21/pGEX-EC20, após crescimento na condição de expressão de EC20, absorveu 37,5% de Cd2+ e, mesmo quando cultivado na condição de não-indução de expressão EC20, absorveu 11,5% de Cd2+. Estes resultados permitem a conclusão de que os clones recombinantes de E. coli que expressam a fitoquelatina sintética EC20 apresentam aumento da capacidade de biossorção de Cd2+ e de resistência a este íon tóxico. PALAVRAS-CHAVES: Escherichia coli. Fitoquelatina. Biossorção. Biorremediação. Cádmio. REFERENCES AKPOR, O. B.; MUCHIE, M. Review. Remediation of heavy metals in drinking water and wastewater treatment systems: Processes and applications. Int. J. Phys. Sci., v. 5, n. 12, p. 1807-1817, 2010. Available in: http://www.academicjournals.org/journal/IJPS/article-abstract/00E529A31916. Access in: 28 March 2018. ANDREWS, J. M. Determination of minimum inhibitory concentrations. J. Antimicrob. Chemother., v. 48, Issue suppl. 1, p. 5-16, 2001. Available in: https://doi. org/10.1093/jac/48.suppl_1.5. Access in: 11 February 2018. AYANGBENRO, A. S.; BABALOLA, O. O. Review: A new strategy for heavy metal polluted environments: A review of microbial biosorbents. Int. J. Environ. Res. Public Health, v. 14, n. 94, p. 1-16, 2017. Available in: https://doi. 10.3390/ijerph14010094. Access in: 10 April 2018. BAE, W.; CHEN, W.; MULCHANDANI, A.; MEHRA, R. K. Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol. Bioeng., v. 70, n. 5, p. 518-524, 2000. Available in: https://doi.org/10.1002/1097-0290(20001205)70:5%3C518::AID-BIT6%3E3.0.CO;2-5. Access in: 15 January 2018. BAE, W.; MEHRA, R. K.; MULCHANDANI, A.; CHEN, W. Genetic engineering of Escherichia coli for enhanced uptake and bioaccumulation of mercury. Appl. Environ. Microbiol., v. 67, n. 11, p. 5335-5338, 2001. Available in: https://doi.org/10.1128/AEM.67.11.5335-5338.2001. Access in: 12 March 2018. BIONDO, R.; DA SILVA F. A.; VICENTE, E. J.; SARKIS, J. E. S; SCHENBERG, A. C. G. Synthetic phytochelatin surface display in Cupriavidus metallidurans CH34 for enhanced metals bioremediation. Environ. Sci. Technol., v. 46, n. 15, p. 8325-8332, 2012. Available in: https://doi.org/10.1021/es3006207. Access in: 20 January 2018. CHATURVEDI, R.; ARCHANA, G. Cytosolic expression of synthetic phytochelatin and bacterial metallothionein genes in Deinococcus radiodurans R1 for enhanced tolerance and bioaccumulation of cadmium. Biometals. v. 27, n. 3, p. 471-482, 2014. Available in: https://doi.org/10.1007/s10534-014-9721-z. Access in: 15 March 2018. 626 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 COBBETT, C.; GOLDSBROUGH, P. Phytochelatins and Metallothioneins: Roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant Biol., v. 53, p. 159-182, 2002. Available in: https://doi.org/10.1146/annurev.arplant.53.100301.135154. Access in: 18 February 2018. GADD, G. M. Biosorption: critical review of scientific rationale, environmental importance and significance for pollution treatment. J. Chem. Technol. Biotechnol., v. 84, p. 13-28, 2009. Available in: https://doi.org/10.1002/jctb.1999. Access in: 27 December 2017. GAVRILESCU, M. Removal of heavy metals from the environment by biosorption. Eng. Life Sci., v. 4, n. 3, p. 219-232, 2004. Available in: https://doi.org/10.1002/elsc.200420026. Access in: 22 March 2018. GAYLARDE, C. C.; BELLINASO, M. L.; MANFIO, G. P. Biorremediação. Biotecnologia, Ciência e Desenvolvimento. v. 34, p. 36-43, 2005. Available in: http://www1.esb.ucp.pt/twt/olimpiadasbio07/MyFiles/MyAutoSiteFiles/FontesInformacao253906202/samorais/ Biorremediacao.pdf. Access in: 14 April 2018. GIRIPUNJE, M. D.; FULKE, A. B.; MESHRAM, P. U. Remediation techniques for heavy-metals contamination in lakes: A mini-review. Clean-Soil, Air, Water., v. 43, n. 9, p. 1350-1354, 2015. Available in: https://doi.org/10.1002/clen.201400419. Access in: 16 September 2017. GUPTA, V. K.; NAYAK, A.; AGARWAL, S. Bioadsorbents for remediation of heavy metals: Current status and their future prospects. Environ. Eng. Res. v. 20, n. 1, p. 1-18, 2015. Available in: http://dx.doi.org/10.4491/eer.2015.018. Access in: 21 August 2017. LADEIRA, A. C. Q.; PANIAGO, E. B.; DUARTE, H. A.; CALDEIRA, C. L. Especiação química e sua importância nos processos de extração mineral e de remediação ambiental. Cadernos Temáticos de Química Nova na Escola, v. 8, p. 18-23, 2014. Available in: http://qnesc.sbq.org.br/online/cadernos/08/05-CTN3.pdf. Access in: 06 May 2017. LAEMMLI, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, v. 227, n. 5259, p. 680-685, 1970. Available in: https://doi.org/10.1038/227680a0. Access in: 09 June 2017. MEHRA, R. K.; MULCHANDANI, P. Glutathione-mediated transfer of Cu(I) into phytochelatins. Biochem. J., v. 307, n. Pt3, p. 697-705, 1995. Available in: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1136707/. Access in: 26 September 2017. https://doi.org/10.1042/bj3070697 PERELO, L. W. Review: In situ and bioremediation of organic pollutants in aquatic sediments. J. Hazard. Mater, v. 177, issues 1-3, p. 81-89, 2010. Available in: https://doi.org/10.1016/j.jhazmat.2009.12.090. Access in: 12 March 2018. REEDER, R. J.; SCHOONEN, M. A. A.; LANZIROTTI, A. Metal speciation and its role in bioaccessibility and bioavailability. Rev. Mineral. Geochem., v. 64, n. 1, p. 59-113, 2006. Available in: https://doi.org/10.2138/rmg.2006.64.3. Access in: 15 March 2018. SAMBROOK, J.; RUSSELL, D. W. Molecular Cloning: A Laboratory Manual. 3th ed. Cold Spring Harbor Press: New York, 2001, vols 1, 2 and 3, 2100 p. SAUGE-MERLE, S.; CUINÉ, S.; CARRIER, P.; LECOMTE-PRADINES, C.; LUU, D-T., PELTIER, G. Enhanced toxic metal accumulation in engineered bacterial cells expressing Arabidopsis thaliana phytochelatin synthase. Appl. Environ. Microbiol., v. 69, n. 1, p. 490-494, 2003. Available in: https://dx.doi.org/10.1128%2FAEM.69.1.490-494.2003. Access in: 14 April 2018. STILLMAN., M. J. Metallothioneins. Coord. Chem. Rev., v. 144, p. 461-511, 1995. Available in: https://doi.org/10.1002/chin.199613288. Access in: 20 April 2018. 627 Expression of synthetic... SOUZA, C. B.; VICENTE, E. J. Biosci. J., Uberlândia, v. 36, n. 2, p. 619-627, Mar./Apr. 2020 http://dx.doi.org/10.14393/BJ-v36n2a2020-42463 UEKI, T.; SAKAMOTO, Y.; YAMAGUCHI, N.; MICHIBATA, H. Bioaccumulation of copper ions by E. coli expressing vanabin genes from the vanadium-rich ascidian Ascidia sydneiensis samea. Appl. Environ. Microbiol., v. 69, n. 11, p. 6442-6446, 2003. Available in: https://dx.doi.org/10.1128%2FAEM.69.11.6442- 6446.2003. Access in: 10 January 2017. VOLESKY, B.; HOLAN, Z. R. Review: Biosorption of heavy metals. Biotechnol. Prog., v. 11, n. 3, p. 235- 250, 1995. Available in: https://doi.org/10.1021/bp00033a001. Access in: 22 February 2018. WANG, J.; CHEN, C. Biosorbents for heavy metals removal and their future. Biotechnol. Adv., v. 27, n. 2, p. 195-226, 2009. Available in: https://doi.org/10.1016/j.biotechadv.2008.11.002. Access in: 03 May 2018. WAWRZYŃSKA, A.; WAWRZYŃSKI, A.; GAGANIDZE, D.; KOPERA, E.; PIATEK, K.; BAL, W.; SIRKO, A. Overexpression of genes involved in phytochelatin biosynthesis in Escherichia coli: effects on growth, cadmium accumulation and thiol level. Acta Biochim. Pol., v. 52, n. 1, p. 109-116, 2005. Availainble in: https://www.researchgate.net/profile/Agnieszka_Sirko/publication/7908640_Overexpression_of_genes_involve d_in_phytochelatin_biosynthesis_in_Escherichia_coli_Effects_on_growth_cadmium_accumulation_and_thiol_ level/links/09e415100e65955ef8000000.pdf. Access in: 29 March 2018. https://doi.org/10.18388/abp.2005_3494 YANG, C-E., CHU, I-M., WEI, Y-H., TSAI, S-L. Surface display of synthetic phytochelatins on Saccharomyces cerevisiae for enhanced ethanol production in heavy metal- contaminated substrates, Bioresour. Technol., 245, p. 1455-1460, 2017. Available in: http://dx.doi.org/10.1016/j.biortech.2017.05.127. Access in: 27 August 2019.