BIOTROPIA NO

BIOTROPIA NO. 16, 2001 : 10 -17

A NOVEL INTEGRON IN THE GENOME OF ESCHERICHIA COLI
ISOLATED FROM INDONESIAN MONITOR LIZARD (VARANUS SPP).

ESTI PUSPITASARI2, ANTONIUS SUWANTO1'2 * , AMARILA MALIK3, AND
WALTER ERDELEN"

'Dept. of Biology, Faculty of Science and Mathematics and IVC Biotechnology, Bogor, Agricultural
University, Bogor, Indonesia;

2 South East Asian Regional Center for Tropical Biology (SEAMEO - BIOTROP), Bogor: Indonesia
3 Dept. of Pharmacy, Faculty of Science and Mathematics, University of Indonesia, Jakarta, Indonesia; 'Dept.

of Biology, Faculty of Science and Mathematics, Bandung Institute of Technology, Bandung,
Indonesia

ABSTRACT
The genotype of antibiotic resistance in natural isolates of Escherichia coli was determined through

integron detection and characterization of the associated antibiotic resistance. E. coli SG2 isolated from
Varanus salvator of Java demonstrated resistance to spectinomycin (50ng/ml) and streptomycin
(SOng/ml). Integron detection indicated that eight isolates out of nine E. coli isolates possessed a
conserved segment of the integron. Amplification of the inserted cassette of the integron in this SG2
isolate yielded a 1-kb DNA fragment. Sequence analyses indicated that this fragment was homologous with
aad gene, which confirmed the resistance to spectinomycin/streptomycin. This is the first report on the
presence of integron in the E. coli isolated from the environment.

Key words: Integron / antibiotic resistance / Escherichia coli

INTRODUCTION

Antibiotic is a substance produced by a microorganism as protection from
another microorganism (Madigan et al. 1997). Antibiotics have a specific target site in
the cell. For example, in trying to get hold of protein synthesis targeted to 30S
ribosom, the presence of tetracycline, spectinomycin and streptomycin results in an
invalid codon-anticodon reaction and therefore, the synthesized amino acid is also
invalid ( Schumm 1992).

Currently, there is concern on the spread of antibiotic resistance among bacteria.
Such dissemination is partly a consequence of the antibiotic-resistant genes mobility
which reside in mobile genetic elements such as plasmids, transposons, and integrons
(Francia et al. 1999).

Integron is a new type of mobile element which has evolved by a site-specific
recombination mechanism. Integrons consist of two conserved segments of DNA
separated by a variable region containing one or more genes integrated as cassettes
(Levesque et al. 1995). The 5'conserved segment contained in the int gene, which
encodes a polypeptide of 337 amino acids, has been shown to be homologous to
other members of the integrase family and on the opposite strand, a common
promoter region P1-P2 is directed toward the site of integration. The 3' conserved
segment contains the qacE&\, suR genes, and an open reading frame (Fig.l).

* Corresponding author : e-mail address : asuwanto@indo.net.id 10

Figure 1. Integron structure (Levesque et al. 1995)

Genetic changes in bacterial genome could contribute to antibiotic resistance in
some bacteria. There are three mechanisms of antibiotic inactivation: (i) modification
of antibiotic structure; (ii) prevention of antibiotic to get into the target site; or (iii)
change in antibiotic target site (Neu 1992).

Resistance to aminoglycoside antibiotics such as spectinomycin and strep-
tomycin, could be due to the penetration failure, the low affinity of antibiotic to
ribosom, or the inactivation of the antibiotic by enzymes such as phosphorylase,
adenylase and acetylase produced by the bacteria (Gian and Gian 1995).

Desselberger (1998) reported that data on antibiotic-resistant genes in the
environment were rare, whereas antibiotic-resistant genes among bacterial strains
were increasing at an alarming rate. Biawak monitors (Varanus spp.) are reptilians
lacking venomous gland, although there are some reports on Biawak bites resulting in
bacterial infection (Auffenberg 1981). Probably, this infection is caused by toxic
substances produced by microbiota living in the oral of Varanus spp. Auffenberg
(1981) identified five bacteria species that could cause infection. Yogiara (1998)
reported that many of E. coli isolates living in the buccal of Varanus spp. are
resistant to ampicillin. This study was conducted in order to understand the
mechanism of the antibiotic resistance of E. coli in the digestive system of Varanus spp.
In this experiment, an antibiotic-resistant gene from E. coli was isolated and further
characterized by DNA sequence analysis.

A novel integron in ther genome of Escherichia coli – Esti Puspitasari et al.

MATERIAL AND MOTHODS

Bacterial Strains and Plasmids

The bacterial strains and p;asmids used in this research are shown in Table 1.

Table 1. Bacterial strains plasmida

Growth Conditions

Antibiotic-resistant bacteria were cultured aerobic (100 rpm) at 37°C and kept
overnight in Luria Bertani (LB) medium supplemented with one, or a combination of
the following antibiotics: ampicillin (100 u.g/ml), streptomycin (50 ng/ml),
spectinomycin (50 ng/ml).

DNA Extraction

Bacterial isolates were grown in 10 ml LB in the presence of a selective antibiotic
at 37°C overnight. Alkaline lysis method (Sambrook et al. 1989) was used for plasmid
DNA extraction, and Wizard®Genomic DNA Purification Kit (Promega, Madison,
WI) was used according to manufacturer protocol for genomic DNA extraction.

BIOTROPIA NO. 16, 2001

PCR Amplification

PCR were performed in Gene Amp® PCR System 2400 (Perkin Elmer,
Branchburg, New Jersey). Ready To Go™ PCR Beads (Pharmacia Biotech,
Uppsala, Sweden) was used for each PCR reaction. Each of 25 ul reaction mixtures
contained PCR beads, 4 ng/ul of genomic DNA, 10 ng/ul of primers (5'cs:
GGCATCCAAGCAGCA AG, 3'cs: AAGCAGACTTGACCTGA, qac: ATCGCA-
ATAGTTGGCGAAGT, sul: GCAAGGCGGAAACCCGCGCC) and distilled water up
to 25 ul.

PCR condition for the integron was amplified in 35 thermal cycles at 94°C for 1
minute, 55°C for 1 minute, and 72°C for 3 minutes. A final extension step for 7
minutes at 72°C was also included. The primers used were 5'cs and 3'cs that
amplify variable regions of integron, qac and sitll primers to amplify the conserved
region. PCR product was purified using Gene Clean Kit (Bio 101, La Jolla,
California).

Cloning and Transformation

Amplified DNA was ligated into pAS900 (KmR) and pGEM-T Easy (ApR )
vector. The approximate ratio of pAS900 vector to insert DNA were 1:4 and that of
pGEM-T Easy to insert DNA was 1 to 16. Ligation reaction consisted of vector-
insert mixture 1 ul of T4- ligase, Ix ligation buffer, and distilled water up to 20 ul.
Ligation mixture was incubated at 7°C for 16-18 h.

The ligation mixture was transformed into 250 ul of chemically competent E. coli
TOP10, followed by heat shocked at 42°C for 45 seconds. After the addition of 3 ml
LB, the culture was incubated with vigorous shaking at 37°C for 90 minutes
(Sambrook et al. 1989). Transformants were then selected on Luria Bertani Agar
(LBA) supplemented with X-gal (40ug/ml) and appropriate antibiotic/s.

DNA Sequencing

pS2T double - stranded templates were derived from cloning of STI in pGEM-T
Easy. Sequencing reaction consisted of 8 ul Big Dye-Terminator, 360 ng of DNA
template, 8 ng/ul of primer and distilled water up to 20 ul Cycle sequencing was
performed using PCR machine with three-step profile for 25 cycles: a 10-second
denaturation at 96°C, a 5-second annealing at 50°C, and a 4-minute extension at
60°C.

Cycle sequencing product was purified by ethanol-sodium acetate precipitation
method. A 1.5 ml microcentrifuge tube was filled with 2 ul of sodium acetate (pH
4.6), 50 ul of ethanol 95%, and 20 ul of the cycle sequencing mixture, and then
incubated at room temperature for 30 minutes. The mixture was centrifuged at
maximum speed for 20 minutes. The supernatant was removed from the tube, and 250
ul of 70% ethanol was added into the tube. The mixture was centrifuged again for 5
minutes. The supernatant was removed and the DNA pellet was vacuum-dried at 50 cm
Hg for 10 minutes.

A novel integron in the genome of Escherichia coli - Esti Puspitasari et al.

The DNA was electrophoresed according to Sambrook et al. (1989). Prior to
electrophoresis, DNA was denatured with 6 ul of loading buffer containing Blue
Dextran and 25 mM of EDTA in formamide at 95°C for 2 minutes, and quickly
placed on ice. Approximately 1.5 ul of DNA sample was loaded to each well and
ran for 10 hours. The DNA was compared with those in the GenBank and EMBL
databases.

RESULTS AND DISCUSSIONS

Integron Detection by PCR

Amplification of DNA sequence experiments using qac-sul primers indicated that
there were eight out of nine E.coli isolates possessing 3'- conserved segment of the
integron (Table 2). E. coli TOP 10 containing recombinant plasmid pEPIO did not
show integron amplification, although it carries a 10-kb DNA fragment originated
from genomic DNA of E.coli SG2 isolated from Varanus spp. (Table 1). We
suspected that parts of the integron have been deleted when it was digested by
restriction enzymes. PCR product using 5'cs-3'cs primers generated a single
amplified DNA band of about 1-kb. It was generated from genomic DNA of E. coli
SG2 isolate, which was designated as STI (Table 2 and Fig.2 lane 3).

At the downstream end of each resistant gene cassette inserted in the variable
region of integrons, there is a short imperfect inverted repeat element called the 59-
base element. Each inserted gene has its own version of this element (Levesque et al.
1995). The STI was also thought to have a 59-base element, although it was not
demonstrated in this study. These 59-base elements are known to be important in the
recombination events observed in the evolution of the integron. For example, in
plasmid pVSI, which possesses the 5' and 3' conserved segment but no inserted
gene between the conserved segments, there is no 59-base element (Levesque et al.
1995).

The other isolates used in this study were found to be similar to pVSI (Table 2).
It was reported that pVSI, a plasmid derived from Pseudomonas aeruginosa,
possessed integron type InO which has an unoccupied integration site and hence may be
an ancestor of the more complex integrons (Bissonnette and Roy 1992).

Cloning of STI in pAS900 (KmR) vector yielded recombinant plasmid called
pCRAS. The purpose of cloning was to detect ampicillin-resistant gene in STI. E. coli
TOP 10 harbouring the recombinant plasmid pCRAS was sensitive to ampicillin. This
result indicated that STI was not an ampicillin-resistant gene, or it was an
ampicillin-resistant gene which could not be expressed.

Expression of antibiotic-resistant genes in the integrated cassettes of integrons
depends on cassette position. In all cases, the resistance level was the highest when the
gene was present in the first cassette (Collis and Hall 1995). Therefore, there is a need to
sequence the STI for gene characterization.

BIOTROOPIA NO. 15, 2001

Figure 2. Integron PCR product from total DNA of pVHAl isolate (lane 1), SG2 isolate (lane 3), and Kb-

Ladder as marker (lane 2).

A novel integron in the genome of Escherichia coli — Esti Puspitasari et al.

Sequencing

Cloning of STI in pGEM-T Easy vector yielded recombinant plasmid
designated as pS2T. Transformant was isolated, and then sequenced. The result
indicated that the STI sequence was homologous to aadA gene encoding amino-
glycoside adenyltransferase, which was responsible for streptomycin and spectino-
mycin resistance in E. coli. BLAST Search analysis of the STI sequence indicated
that the 700 nucleotides of 3'STI are integron type 3 (Int 3) as in the IncL/M
plasmid from Salmonella typhimurium (96% identity) and pNCCSOl plasmid from
Enterococcus faecalis (96% identity).

The other 600 nucleotides of 5'STI were similar to the pNCCSOl plasmid from E,
faecalis (97% identity) and the R100.1 plasmid from bacteriophage T4 (97%
identity).

In summary, there were eight isolates out of nine E. coli isolates possessing a
conserved segment of integron and only one possessed inserted gene between the
conserved segments of the integron. The sequencing analysis indicated that
spectinomycin- and streptomycin-resistant gene was present in the 1-kb DNA
fragment.

ACKNOWLEDGMENTS

This work was supported by DIP project for BIOTROP 1999 / 2000 to
Antonius Suwanto. We thank Yeo Chew Chieng from Department of Microbiology,
National University of Singapore for conducting DNA sequencing.

REFERENCES

Auffenberg,W. 1981.The Behavioral Ecology of the Komodo Monitor. University Press of Florida,
Florida

Bissonnette, L. and P.H. Roy. 1992. Characterization of InO of Pseudomonas aeruginosa plasmid pVSl, an
ancestor of integrons of multiresistance plasmids and transposons of Gram-negative bacteria. J.
Bacteriol. 174:1248-1257.

Collis, C.M. and R.M.Hall. 1995. Expression of antibiotic resistance genes in the integrated cassettes of
integrons. Antimicrob. Agents. Chemother. 39: 155-162.

Desselberger, U. 1998. Resistance to antibiotics and other antimicrobiol agents. SGM Quarterly. 25:94-95.
Francia, MV., J.C. Zabala, F. Cruz, J.M.G. Lobo. 1999. The Intl integron integrase preferentially binds

single-stranded DNA of the attC site. J. Bacteriol. 181: 6844-6849.
Gian, G.S. dan V.H.S.Gian. 1995. Farmakologi dan Terapi: Aminoglikosid. Ed. ke-4. Gaya Baru, Jakarta.

Jacoby, G. 1992. Exploring new strategies to fight drug-resistant microbes. Science. 257:1036-1038.
Levesque, C., L. Piche, C. Larose, and P.H. Roy. 1995. PCR mapping of integrons reveals several novel

combinations of resistant genes. Antimicrob. Agents. Chemother. 39:185-191.

BIOTROPIA NO. 16, 2001

Madigan, M.T., J.M. Martinko, and J. Parker, 1997. Biology of Microorganisms. 8"1 ed. Prentice Hall, New
Jersey.

Neu, H.C. 1992. The crisis in antibiotic resistance. Science. 257:1064-1072.
Sambrook, J., E.K. Frisch, T. Maniatis. 1989. Molecular Cloning, A Laboratory Manual. Ed. ke-2. Cold

Spring Harbor Laboratory Press. Cold spring Harbor, USA.
Schumm, D.E. 1992. Intisari Biokimia. Terjemahan Moch. Sadikin. Binarupa Aksara, Jakarta.
Yogiara. 1998. Keragaman genetik isolat Escherichia coli dari rongga mulut biawak (Varanus) dan

kloning gen penyandi resistensi ampisilin. Skripsi. Jurusan Biologi FMIPA IPB, Bogor.