id	sid	tid	token	lemma	pos
biotropia-173	1	1	microsoft	microsoft	PROPN
biotropia-173	1	2	word	word	NOUN
biotropia-173	1	3	62	62	NUM
biotropia-173	1	4	biotropia	biotropia	NOUN
biotropia-173	1	5	no	no	NOUN
biotropia-173	1	6	.	.	PROPN
biotropia-173	1	7	24	24	NUM
biotropia-173	1	8	,	,	PUNCT
biotropia-173	1	9	2005	2005	NUM
biotropia-173	1	10	:	:	PUNCT
biotropia-173	1	11	62	62	NUM
biotropia-173	1	12	68	68	NUM
biotropia-173	1	13	molecular	molecular	ADJ
biotropia-173	1	14	phylogenetic	phylogenetic	ADJ
biotropia-173	1	15	analysis	analysis	NOUN
biotropia-173	1	16	of	of	ADP
biotropia-173	1	17	monascus	monascus	ADJ
biotropia-173	1	18	fungi	fungus	NOUN
biotropia-173	1	19	based	base	VERB
biotropia-173	1	20	on	on	ADP
biotropia-173	1	21	internal	internal	ADJ
biotropia-173	1	22	transcribed	transcribe	VERB
biotropia-173	1	23	spacer	spacer	NOUN
biotropia-173	1	24	region	region	PROPN
biotropia-173	1	25	n.	n.	PROPN
biotropia-173	1	26	suharna1	suharna1	PROPN
biotropia-173	1	27	,	,	PUNCT
biotropia-173	1	28	y.	y.	PROPN
biotropia-173	1	29	kikuchi2'3	kikuchi2'3	PROPN
biotropia-173	1	30	and	and	CCONJ
biotropia-173	1	31	t.	t.	PROPN
biotropia-173	1	32	fukatsu3	fukatsu3	NOUN
biotropia-173	1	33	'	'	PUNCT
biotropia-173	1	34	research	research	NOUN
biotropia-173	1	35	center	center	NOUN
biotropia-173	1	36	for	for	ADP
biotropia-173	1	37	biology	biology	NOUN
biotropia-173	1	38	,	,	PUNCT
biotropia-173	1	39	indonesian	indonesian	PROPN
biotropia-173	1	40	institute	institute	PROPN
biotropia-173	1	41	of	of	ADP
biotropia-173	1	42	sciences	sciences	PROPN
biotropia-173	1	43	,	,	PUNCT
biotropia-173	1	44	bogor	bogor	PROPN
biotropia-173	1	45	,	,	PUNCT
biotropia-173	1	46	indonesia	indonesia	PROPN
biotropia-173	1	47	2natural	2natural	NUM
biotropia-173	1	48	history	history	NOUN
biotropia-173	1	49	laboratory	laboratory	NOUN
biotropia-173	1	50	,	,	PUNCT
biotropia-173	1	51	faculty	faculty	NOUN
biotropia-173	1	52	of	of	ADP
biotropia-173	1	53	science	science	NOUN
biotropia-173	1	54	,	,	PUNCT
biotropia-173	1	55	ibaraki	ibaraki	PROPN
biotropia-173	1	56	university	university	PROPN
biotropia-173	1	57	,	,	PUNCT
biotropia-173	1	58	mito	mito	PROPN
biotropia-173	1	59	310	310	NUM
biotropia-173	1	60	-	-	SYM
biotropia-173	1	61	8512	8512	NUM
biotropia-173	1	62	,	,	PUNCT
biotropia-173	1	63	japan	japan	PROPN
biotropia-173	1	64	3national	3national	PROPN
biotropia-173	1	65	institute	institute	PROPN
biotropia-173	1	66	of	of	ADP
biotropia-173	1	67	biological	biological	ADJ
biotropia-173	1	68	functions	function	NOUN
biotropia-173	1	69	and	and	CCONJ
biotropia-173	1	70	resources	resource	NOUN
biotropia-173	1	71	,	,	PUNCT
biotropia-173	1	72	advanced	advanced	ADJ
biotropia-173	1	73	industrial	industrial	ADJ
biotropia-173	1	74	science	science	NOUN
biotropia-173	1	75	and	and	CCONJ
biotropia-173	1	76	technology	technology	NOUN
biotropia-173	1	77	(	(	PUNCT
biotropia-173	1	78	aist	aist	PROPN
biotropia-173	1	79	)	)	PUNCT
biotropia-173	1	80	,	,	PUNCT
biotropia-173	1	81	tsukuba	tsukuba	PROPN
biotropia-173	1	82	305	305	NUM
biotropia-173	1	83	-	-	SYM
biotropia-173	1	84	8566	8566	NUM
biotropia-173	1	85	,	,	PUNCT
biotropia-173	1	86	japan	japan	PROPN
biotropia-173	1	87	abstract	abstract	ADJ
biotropia-173	1	88	a	a	DET
biotropia-173	1	89	molecular	molecular	ADJ
biotropia-173	1	90	analysis	analysis	NOUN
biotropia-173	1	91	of	of	ADP
biotropia-173	1	92	internal	internal	ADJ
biotropia-173	1	93	transcribed	transcribe	VERB
biotropia-173	1	94	spacer	spacer	NOUN
biotropia-173	1	95	region	region	NOUN
biotropia-173	1	96	has	have	AUX
biotropia-173	1	97	been	be	AUX
biotropia-173	1	98	carried	carry	VERB
biotropia-173	1	99	out	out	ADP
biotropia-173	1	100	to	to	PART
biotropia-173	1	101	reveal	reveal	VERB
biotropia-173	1	102	the	the	DET
biotropia-173	1	103	relationship	relationship	NOUN
biotropia-173	1	104	among	among	ADP
biotropia-173	1	105	16	16	NUM
biotropia-173	1	106	strains	strain	NOUN
biotropia-173	1	107	of	of	ADP
biotropia-173	1	108	monascus	monascus	NOUN
biotropia-173	1	109	spp	spp	NOUN
biotropia-173	1	110	.	.	PUNCT
biotropia-173	2	1	a	a	DET
biotropia-173	2	2	primer	primer	NOUN
biotropia-173	2	3	set	set	VERB
biotropia-173	2	4	comprised	comprise	VERB
biotropia-173	2	5	primer	primer	NOUN
biotropia-173	2	6	its1	its1	PROPN
biotropia-173	2	7	and	and	CCONJ
biotropia-173	2	8	its4	its4	PROPN
biotropia-173	2	9	was	be	AUX
biotropia-173	2	10	used	use	VERB
biotropia-173	2	11	to	to	PART
biotropia-173	2	12	amplify	amplify	VERB
biotropia-173	2	13	this	this	DET
biotropia-173	2	14	region	region	NOUN
biotropia-173	2	15	in	in	ADP
biotropia-173	2	16	which	which	PRON
biotropia-173	2	17	they	they	PRON
biotropia-173	2	18	were	be	AUX
biotropia-173	2	19	cloned	clone	VERB
biotropia-173	2	20	and	and	CCONJ
biotropia-173	2	21	scqucnccd	scqucnccd	NOUN
biotropia-173	2	22	.	.	PUNCT
biotropia-173	3	1	we	we	PRON
biotropia-173	3	2	also	also	ADV
biotropia-173	3	3	compared	compare	VERB
biotropia-173	3	4	the	the	DET
biotropia-173	3	5	sequence	sequence	NOUN
biotropia-173	3	6	result	result	NOUN
biotropia-173	3	7	with	with	ADP
biotropia-173	3	8	m.	m.	NOUN
biotropia-173	3	9	purpureus	purpureus	NOUN
biotropia-173	3	10	af458473	af458473	PROPN
biotropia-173	3	11	,	,	PUNCT
biotropia-173	3	12	m.ruber	m.ruber	NOUN
biotropia-173	3	13	af458470	af458470	PROPN
biotropia-173	3	14	,	,	PUNCT
biotropia-173	3	15	m.	m.	PROPN
biotropia-173	3	16	kaoliang	kaoliang	PROPN
biotropia-173	3	17	af451859	af451859	PROPN
biotropia-173	3	18	,	,	PUNCT
biotropia-173	3	19	m.	m.	NOUN
biotropia-173	3	20	araneous	araneous	ADJ
biotropia-173	3	21	af458471	af458471	PROPN
biotropia-173	3	22	and	and	CCONJ
biotropia-173	3	23	m.	m.	PROPN
biotropia-173	3	24	pilosus	pilosus	PROPN
biotropia-173	3	25	af451856	af451856	PROPN
biotropia-173	3	26	and	and	CCONJ
biotropia-173	3	27	one	one	NUM
biotropia-173	3	28	outgroup	outgroup	NOUN
biotropia-173	3	29	species	specie	NOUN
biotropia-173	3	30	thermoascus	thermoascus	PROPN
biotropia-173	3	31	crustaceus	crustaceus	PROPN
biotropia-173	3	32	u18353	u18353	PROPN
biotropia-173	3	33	.	.	PUNCT
biotropia-173	4	1	the	the	DET
biotropia-173	4	2	result	result	NOUN
biotropia-173	4	3	showed	show	VERB
biotropia-173	4	4	that	that	SCONJ
biotropia-173	4	5	16	16	NUM
biotropia-173	4	6	monascus	monascus	NOUN
biotropia-173	4	7	spp	spp	NOUN
biotropia-173	4	8	.	.	PUNCT
biotropia-173	4	9	were	be	AUX
biotropia-173	4	10	divided	divide	VERB
biotropia-173	4	11	into	into	ADP
biotropia-173	4	12	two	two	NUM
biotropia-173	4	13	large	large	ADJ
biotropia-173	4	14	clades	clade	NOUN
biotropia-173	4	15	while	while	SCONJ
biotropia-173	4	16	m.	m.	NOUN
biotropia-173	4	17	ruber	ruber	PROPN
biotropia-173	4	18	af458470	af458470	PROPN
biotropia-173	4	19	was	be	AUX
biotropia-173	4	20	basically	basically	ADV
biotropia-173	4	21	separated	separate	VERB
biotropia-173	4	22	from	from	ADP
biotropia-173	4	23	all	all	DET
biotropia-173	4	24	those	those	DET
biotropia-173	4	25	monascus	monascus	NOUN
biotropia-173	4	26	.	.	PUNCT
biotropia-173	5	1	one	one	NUM
biotropia-173	5	2	of	of	ADP
biotropia-173	5	3	the	the	DET
biotropia-173	5	4	two	two	NUM
biotropia-173	5	5	large	large	ADJ
biotropia-173	5	6	clades	clade	NOUN
biotropia-173	5	7	included	include	VERB
biotropia-173	5	8	the	the	DET
biotropia-173	5	9	seven	seven	NUM
biotropia-173	5	10	m.	m.	NOUN
biotropia-173	5	11	purpureus	purpureus	NOUN
biotropia-173	5	12	strains	strain	NOUN
biotropia-173	5	13	,	,	PUNCT
biotropia-173	5	14	m.	m.	NOUN
biotropia-173	5	15	purpureus	purpureus	NOUN
biotropia-173	5	16	af458473	af458473	PROPN
biotropia-173	5	17	,	,	PUNCT
biotropia-173	5	18	m.	m.	NOUN
biotropia-173	5	19	araneosus	araneosus	PROPN
biotropia-173	5	20	af458471	af458471	PROPN
biotropia-173	5	21	and	and	CCONJ
biotropia-173	5	22	m.	m.	PROPN
biotropia-173	5	23	kaoliang	kaoliang	PROPN
biotropia-173	5	24	af451859	af451859	PROPN
biotropia-173	5	25	.	.	PUNCT
biotropia-173	6	1	another	another	DET
biotropia-173	6	2	large	large	ADJ
biotropia-173	6	3	cladc	cladc	NOUN
biotropia-173	6	4	included	include	VERB
biotropia-173	6	5	the	the	DET
biotropia-173	6	6	six	six	NUM
biotropia-173	6	7	monascus	monascus	NOUN
biotropia-173	6	8	sp	sp	NOUN
biotropia-173	6	9	.	.	NOUN
biotropia-173	6	10	strains	strain	NOUN
biotropia-173	6	11	which	which	PRON
biotropia-173	6	12	typically	typically	ADV
biotropia-173	6	13	have	have	VERB
biotropia-173	6	14	whitish	whitish	ADJ
biotropia-173	6	15	colonies	colony	NOUN
biotropia-173	6	16	,	,	PUNCT
biotropia-173	6	17	the	the	DET
biotropia-173	6	18	three	three	NUM
biotropia-173	6	19	m.	m.	NOUN
biotropia-173	6	20	ruber	ruber	NOUN
biotropia-173	6	21	strains	strain	NOUN
biotropia-173	6	22	and	and	CCONJ
biotropia-173	6	23	m.pilosus	m.pilosus	NOUN
biotropia-173	6	24	af451856	af451856	PROPN
biotropia-173	6	25	.	.	PUNCT
biotropia-173	7	1	however	however	ADV
biotropia-173	7	2	,	,	PUNCT
biotropia-173	7	3	even	even	ADV
biotropia-173	7	4	outstanding	outstanding	ADJ
biotropia-173	7	5	morphological	morphological	ADJ
biotropia-173	7	6	differences	difference	NOUN
biotropia-173	7	7	possessed	possess	VERB
biotropia-173	7	8	by	by	ADP
biotropia-173	7	9	several	several	ADJ
biotropia-173	7	10	white	white	ADJ
biotropia-173	7	11	monascus	monascus	NOUN
biotropia-173	7	12	and	and	CCONJ
biotropia-173	7	13	one	one	NUM
biotropia-173	7	14	whitish	whitish	ADJ
biotropia-173	7	15	m.	m.	NOUN
biotropia-173	7	16	purpureus	purpureus	NOUN
biotropia-173	7	17	strain	strain	VERB
biotropia-173	7	18	,	,	PUNCT
biotropia-173	7	19	all	all	DET
biotropia-173	7	20	monascus	monascus	NOUN
biotropia-173	7	21	strains	strain	NOUN
biotropia-173	7	22	were	be	AUX
biotropia-173	7	23	suggested	suggest	VERB
biotropia-173	7	24	to	to	PART
biotropia-173	7	25	be	be	AUX
biotropia-173	7	26	very	very	ADV
biotropia-173	7	27	closely	closely	ADV
biotropia-173	7	28	related	relate	VERB
biotropia-173	7	29	with	with	ADP
biotropia-173	7	30	similarity	similarity	NOUN
biotropia-173	7	31	>	>	X
biotropia-173	7	32	99	99	NUM
biotropia-173	7	33	%	%	NOUN
biotropia-173	7	34	almost	almost	ADV
biotropia-173	7	35	100	100	NUM
biotropia-173	7	36	%	%	NOUN
biotropia-173	7	37	.	.	PUNCT
biotropia-173	8	1	although	although	SCONJ
biotropia-173	8	2	this	this	DET
biotropia-173	8	3	its	its	PRON
biotropia-173	8	4	analysis	analysis	NOUN
biotropia-173	8	5	could	could	AUX
biotropia-173	8	6	not	not	PART
biotropia-173	8	7	discriminate	discriminate	VERB
biotropia-173	8	8	cultural	cultural	ADJ
biotropia-173	8	9	and	and	CCONJ
biotropia-173	8	10	morphological	morphological	ADJ
biotropia-173	8	11	differentiation	differentiation	NOUN
biotropia-173	8	12	of	of	ADP
biotropia-173	8	13	monascus	monascus	NOUN
biotropia-173	8	14	strains	strain	NOUN
biotropia-173	8	15	studied	study	VERB
biotropia-173	8	16	,	,	PUNCT
biotropia-173	8	17	yet	yet	CCONJ
biotropia-173	8	18	there	there	PRON
biotropia-173	8	19	is	be	VERB
biotropia-173	8	20	still	still	ADV
biotropia-173	8	21	little	little	ADJ
biotropia-173	8	22	genetic	genetic	ADJ
biotropia-173	8	23	variation	variation	NOUN
biotropia-173	8	24	within	within	ADP
biotropia-173	8	25	these	these	DET
biotropia-173	8	26	strains	strain	NOUN
biotropia-173	8	27	.	.	PUNCT
biotropia-173	9	1	key	key	ADJ
biotropia-173	9	2	words	word	NOUN
biotropia-173	9	3	:	:	PUNCT
biotropia-173	9	4	molecular	molecular	ADJ
biotropia-173	9	5	genetics	genetic	NOUN
biotropia-173	9	6	/	/	SYM
biotropia-173	9	7	monascus	monascus	NOUN
biotropia-173	9	8	spp./fungi	spp./fungi	PROPN
biotropia-173	9	9	introduction	introduction	NOUN
biotropia-173	9	10	hawksworth	hawksworth	NOUN
biotropia-173	9	11	and	and	CCONJ
biotropia-173	9	12	pitt	pitt	PROPN
biotropia-173	9	13	(	(	PUNCT
biotropia-173	9	14	1983	1983	NUM
biotropia-173	9	15	)	)	PUNCT
biotropia-173	9	16	cited	cite	VERB
biotropia-173	9	17	that	that	SCONJ
biotropia-173	9	18	monascus	monascus	NOUN
biotropia-173	9	19	species	specie	NOUN
biotropia-173	9	20	(	(	PUNCT
biotropia-173	9	21	monascaceae	monascaceae	X
biotropia-173	9	22	)	)	PUNCT
biotropia-173	9	23	are	be	AUX
biotropia-173	9	24	important	important	ADJ
biotropia-173	9	25	for	for	ADP
biotropia-173	9	26	producing	produce	VERB
biotropia-173	9	27	asian	asian	ADJ
biotropia-173	9	28	fermented	ferment	VERB
biotropia-173	9	29	foods	food	NOUN
biotropia-173	9	30	particularly	particularly	ADV
biotropia-173	9	31	red	red	ADJ
biotropia-173	9	32	rice	rice	NOUN
biotropia-173	9	33	(	(	PUNCT
biotropia-173	9	34	ang	ang	PROPN
biotropia-173	9	35	-	-	PUNCT
biotropia-173	9	36	kak	kak	PROPN
biotropia-173	9	37	)	)	PUNCT
biotropia-173	9	38	,	,	PUNCT
biotropia-173	9	39	rice	rice	NOUN
biotropia-173	9	40	wine	wine	NOUN
biotropia-173	9	41	and	and	CCONJ
biotropia-173	9	42	kaoliang	kaoliang	PROPN
biotropia-173	9	43	brandy	brandy	PROPN
biotropia-173	9	44	,	,	PUNCT
biotropia-173	9	45	soy	soy	NOUN
biotropia-173	9	46	bean	bean	NOUN
biotropia-173	9	47	cheese	cheese	NOUN
biotropia-173	9	48	and	and	CCONJ
biotropia-173	9	49	food	food	NOUN
biotropia-173	9	50	colorants	colorant	NOUN
biotropia-173	9	51	;	;	PUNCT
biotropia-173	9	52	for	for	ADP
biotropia-173	9	53	their	their	PRON
biotropia-173	9	54	antibacterial	antibacterial	ADJ
biotropia-173	9	55	properties	property	NOUN
biotropia-173	9	56	;	;	PUNCT
biotropia-173	9	57	production	production	NOUN
biotropia-173	9	58	of	of	ADP
biotropia-173	9	59	mycotoxin	mycotoxin	PRON
biotropia-173	9	60	;	;	PUNCT
biotropia-173	9	61	and	and	CCONJ
biotropia-173	9	62	a	a	DET
biotropia-173	9	63	major	major	ADJ
biotropia-173	9	64	component	component	NOUN
biotropia-173	9	65	of	of	ADP
biotropia-173	9	66	silage	silage	NOUN
biotropia-173	9	67	mycofloras	mycoflora	NOUN
biotropia-173	9	68	.	.	PUNCT
biotropia-173	10	1	lakrodi	lakrodi	PROPN
biotropia-173	10	2	et	et	PROPN
biotropia-173	10	3	al	al	PROPN
biotropia-173	10	4	.	.	PROPN
biotropia-173	11	1	(	(	PUNCT
biotropia-173	11	2	200	200	NUM
biotropia-173	11	3	)	)	PUNCT
biotropia-173	11	4	cited	cite	VERB
biotropia-173	11	5	that	that	SCONJ
biotropia-173	11	6	one	one	NUM
biotropia-173	11	7	of	of	ADP
biotropia-173	11	8	these	these	DET
biotropia-173	11	9	world	world	NOUN
biotropia-173	11	10	wide	wide	ADV
biotropia-173	11	11	distributed	distribute	VERB
biotropia-173	11	12	fungi	fungus	NOUN
biotropia-173	11	13	,	,	PUNCT
biotropia-173	11	14	m.	m.	NOUN
biotropia-173	11	15	purpureus	purpureus	NOUN
biotropia-173	11	16	is	be	AUX
biotropia-173	11	17	known	know	VERB
biotropia-173	11	18	as	as	ADP
biotropia-173	11	19	the	the	DET
biotropia-173	11	20	red	red	PROPN
biotropia-173	11	21	rice	rice	PROPN
biotropia-173	11	22	fungus	fungus	NOUN
biotropia-173	11	23	that	that	PRON
biotropia-173	11	24	has	have	AUX
biotropia-173	11	25	been	be	AUX
biotropia-173	11	26	used	use	VERB
biotropia-173	11	27	for	for	ADP
biotropia-173	11	28	over	over	ADP
biotropia-173	11	29	a	a	DET
biotropia-173	11	30	thousand	thousand	NUM
biotropia-173	11	31	years	year	NOUN
biotropia-173	11	32	by	by	ADP
biotropia-173	11	33	the	the	DET
biotropia-173	11	34	chinese	chinese	PROPN
biotropia-173	11	35	as	as	ADP
biotropia-173	11	36	a	a	DET
biotropia-173	11	37	traditional	traditional	ADJ
biotropia-173	11	38	herbal	herbal	ADJ
biotropia-173	11	39	medicine	medicine	NOUN
biotropia-173	11	40	.	.	PUNCT
biotropia-173	12	1	however	however	ADV
biotropia-173	12	2	,	,	PUNCT
biotropia-173	12	3	this	this	DET
biotropia-173	12	4	fungus	fungus	NOUN
biotropia-173	12	5	was	be	AUX
biotropia-173	12	6	firstly	firstly	ADV
biotropia-173	12	7	isolated	isolate	VERB
biotropia-173	12	8	from	from	ADP
biotropia-173	12	9	chinese	chinese	ADJ
biotropia-173	12	10	red	red	ADJ
biotropia-173	12	11	rice	rice	NOUN
biotropia-173	12	12	(	(	PUNCT
biotropia-173	12	13	ang	ang	PROPN
biotropia-173	12	14	-	-	PUNCT
biotropia-173	12	15	kak	kak	PROPN
biotropia-173	12	16	)	)	PUNCT
biotropia-173	12	17	in	in	ADP
biotropia-173	12	18	java	java	PROPN
biotropia-173	12	19	.	.	PUNCT
biotropia-173	13	1	in	in	ADP
biotropia-173	13	2	indonesia	indonesia	PROPN
biotropia-173	13	3	,	,	PUNCT
biotropia-173	13	4	we	we	PRON
biotropia-173	13	5	isolated	isolate	VERB
biotropia-173	13	6	and	and	CCONJ
biotropia-173	13	7	collected	collect	VERB
biotropia-173	13	8	m.	m.	NOUN
biotropia-173	13	9	purpureus	purpureus	NOUN
biotropia-173	13	10	from	from	ADP
biotropia-173	13	11	ang	ang	PROPN
biotropia-173	13	12	-	-	PUNCT
biotropia-173	13	13	kak	kak	PROPN
biotropia-173	13	14	in	in	ADP
biotropia-173	13	15	java	java	PROPN
biotropia-173	13	16	and	and	CCONJ
biotropia-173	13	17	sumatra	sumatra	PROPN
biotropia-173	13	18	and	and	CCONJ
biotropia-173	13	19	from	from	ADP
biotropia-173	13	20	other	other	ADJ
biotropia-173	13	21	several	several	ADJ
biotropia-173	13	22	monascus	monascus	NOUN
biotropia-173	13	23	species	specie	NOUN
biotropia-173	13	24	isolated	isolate	VERB
biotropia-173	13	25	from	from	ADP
biotropia-173	13	26	deteriorated	deteriorate	VERB
biotropia-173	13	27	invertebrate	invertebrate	ADJ
biotropia-173	13	28	specimens	specimen	NOUN
biotropia-173	13	29	.	.	PUNCT
biotropia-173	14	1	based	base	VERB
biotropia-173	14	2	on	on	ADP
biotropia-173	14	3	morphological	morphological	ADJ
biotropia-173	14	4	observation	observation	NOUN
biotropia-173	14	5	on	on	ADP
biotropia-173	14	6	growth	growth	NOUN
biotropia-173	14	7	in	in	ADP
biotropia-173	14	8	agar	agar	NOUN
biotropia-173	14	9	media	medium	NOUN
biotropia-173	14	10	,	,	PUNCT
biotropia-173	14	11	we	we	PRON
biotropia-173	14	12	found	find	VERB
biotropia-173	14	13	some	some	DET
biotropia-173	14	14	interesting	interesting	ADJ
biotropia-173	14	15	not	not	PART
biotropia-173	14	16	ordinary	ordinary	ADJ
biotropia-173	14	17	properties	property	NOUN
biotropia-173	14	18	in	in	ADP
biotropia-173	14	19	m.	m.	NOUN
biotropia-173	14	20	purpureus	purpureus	NOUN
biotropia-173	14	21	such	such	ADJ
biotropia-173	14	22	as	as	ADP
biotropia-173	14	23	two	two	NUM
biotropia-173	14	24	m.	m.	NOUN
biotropia-173	14	25	purpureus	purpureus	NOUN
biotropia-173	14	26	isolates	isolate	VERB
biotropia-173	14	27	one	one	NUM
biotropia-173	14	28	of	of	ADP
biotropia-173	14	29	which	which	PRON
biotropia-173	14	30	has	have	VERB
biotropia-173	14	31	unique	unique	ADJ
biotropia-173	14	32	character	character	NOUN
biotropia-173	14	33	such	such	ADJ
biotropia-173	14	34	as	as	ADP
biotropia-173	14	35	bigger	big	ADJ
biotropia-173	14	36	ascomata	ascomata	NOUN
biotropia-173	14	37	and	and	CCONJ
biotropia-173	14	38	the	the	DET
biotropia-173	14	39	other	other	ADJ
biotropia-173	14	40	one	one	NOUN
biotropia-173	14	41	has	have	VERB
biotropia-173	14	42	white	white	ADJ
biotropia-173	14	43	colony	colony	NOUN
biotropia-173	14	44	.	.	PUNCT
biotropia-173	15	1	while	while	SCONJ
biotropia-173	15	2	the	the	DET
biotropia-173	15	3	other	other	ADJ
biotropia-173	15	4	four	four	NUM
biotropia-173	15	5	monascus	monascus	NOUN
biotropia-173	15	6	62	62	NUM
biotropia-173	15	7	biotropia	biotropia	NOUN
biotropia-173	15	8	no	no	NOUN
biotropia-173	15	9	.	.	PROPN
biotropia-173	15	10	24	24	NUM
biotropia-173	15	11	,	,	PUNCT
biotropia-173	15	12	2005	2005	NUM
biotropia-173	15	13	isolates	isolate	NOUN
biotropia-173	15	14	have	have	VERB
biotropia-173	15	15	very	very	ADV
biotropia-173	15	16	remarkable	remarkable	ADJ
biotropia-173	15	17	properties	property	NOUN
biotropia-173	15	18	such	such	ADJ
biotropia-173	15	19	as	as	SCONJ
biotropia-173	15	20	they	they	PRON
biotropia-173	15	21	resist	resist	VERB
biotropia-173	15	22	ethanol	ethanol	NOUN
biotropia-173	15	23	at	at	ADP
biotropia-173	15	24	very	very	ADV
biotropia-173	15	25	extreme	extreme	ADJ
biotropia-173	15	26	concentration	concentration	NOUN
biotropia-173	15	27	and	and	CCONJ
biotropia-173	15	28	their	their	PRON
biotropia-173	15	29	morphological	morphological	ADJ
biotropia-173	15	30	characters	character	NOUN
biotropia-173	15	31	are	be	AUX
biotropia-173	15	32	also	also	ADV
biotropia-173	15	33	unique	unique	ADJ
biotropia-173	15	34	.	.	PUNCT
biotropia-173	16	1	so	so	ADV
biotropia-173	16	2	,	,	PUNCT
biotropia-173	16	3	it	it	PRON
biotropia-173	16	4	is	be	AUX
biotropia-173	16	5	of	of	ADP
biotropia-173	16	6	interest	interest	NOUN
biotropia-173	16	7	to	to	PART
biotropia-173	16	8	know	know	VERB
biotropia-173	16	9	the	the	DET
biotropia-173	16	10	genetic	genetic	ADJ
biotropia-173	16	11	relationship	relationship	NOUN
biotropia-173	16	12	rather	rather	ADV
biotropia-173	16	13	than	than	ADP
biotropia-173	16	14	morphological	morphological	ADJ
biotropia-173	16	15	relationship	relationship	NOUN
biotropia-173	16	16	among	among	ADP
biotropia-173	16	17	those	those	DET
biotropia-173	16	18	isolates	isolate	NOUN
biotropia-173	16	19	within	within	ADP
biotropia-173	16	20	monascus	monascus	NOUN
biotropia-173	16	21	species	specie	NOUN
biotropia-173	16	22	.	.	PUNCT
biotropia-173	17	1	actually	actually	ADV
biotropia-173	17	2	,	,	PUNCT
biotropia-173	17	3	dna	dna	PROPN
biotropia-173	17	4	sequence	sequence	NOUN
biotropia-173	17	5	analysis	analysis	NOUN
biotropia-173	17	6	based	base	VERB
biotropia-173	17	7	on	on	ADP
biotropia-173	17	8	the	the	DET
biotropia-173	17	9	d1	d1	PROPN
biotropia-173	17	10	/	/	SYM
biotropia-173	17	11	d2	d2	NOUN
biotropia-173	17	12	regions	region	NOUN
biotropia-173	17	13	of	of	ADP
biotropia-173	17	14	lsu	lsu	NOUN
biotropia-173	17	15	rrna	rrna	NOUN
biotropia-173	17	16	genes	gene	NOUN
biotropia-173	17	17	of	of	ADP
biotropia-173	17	18	monascus	monascus	NOUN
biotropia-173	17	19	species	specie	NOUN
biotropia-173	17	20	have	have	AUX
biotropia-173	17	21	been	be	AUX
biotropia-173	17	22	conducted	conduct	VERB
biotropia-173	17	23	by	by	ADP
biotropia-173	17	24	park	park	NOUN
biotropia-173	17	25	and	and	CCONJ
biotropia-173	17	26	jong	jong	PROPN
biotropia-173	17	27	(	(	PUNCT
biotropia-173	17	28	2003	2003	NUM
biotropia-173	17	29	)	)	PUNCT
biotropia-173	17	30	.	.	PUNCT
biotropia-173	18	1	they	they	PRON
biotropia-173	18	2	suggested	suggest	VERB
biotropia-173	18	3	that	that	SCONJ
biotropia-173	18	4	m.	m.	NOUN
biotropia-173	18	5	lunispora	lunispora	PROPN
biotropia-173	18	6	,	,	PUNCT
biotropia-173	18	7	m.	m.	NOUN
biotropia-173	18	8	floridanus	floridanus	PROPN
biotropia-173	18	9	,	,	PUNCT
biotropia-173	18	10	and	and	CCONJ
biotropia-173	18	11	m	m	PROPN
biotropia-173	18	12	pallens	pallen	NOUN
biotropia-173	18	13	were	be	AUX
biotropia-173	18	14	separated	separate	VERB
biotropia-173	18	15	in	in	ADP
biotropia-173	18	16	different	different	ADJ
biotropia-173	18	17	clades	clade	NOUN
biotropia-173	18	18	.	.	PUNCT
biotropia-173	19	1	however	however	ADV
biotropia-173	19	2	,	,	PUNCT
biotropia-173	19	3	five	five	NUM
biotropia-173	19	4	monascus	monascus	NOUN
biotropia-173	19	5	species	specie	NOUN
biotropia-173	19	6	such	such	ADJ
biotropia-173	19	7	as	as	ADP
biotropia-173	19	8	m	m	PROPN
biotropia-173	19	9	pilosus	pilosus	NOUN
biotropia-173	19	10	,	,	PUNCT
biotropia-173	19	11	m.	m.	NOUN
biotropia-173	19	12	purpureus	purpureus	NOUN
biotropia-173	19	13	,	,	PUNCT
biotropia-173	19	14	m.	m.	NOUN
biotropia-173	19	15	ruber	ruber	PROPN
biotropia-173	19	16	,	,	PUNCT
biotropia-173	19	17	m.	m.	NOUN
biotropia-173	19	18	eremophilus	eremophilus	NOUN
biotropia-173	19	19	and	and	CCONJ
biotropia-173	19	20	m.	m.	PROPN
biotropia-173	19	21	sanguineus	sanguineus	PROPN
biotropia-173	19	22	were	be	AUX
biotropia-173	19	23	reflected	reflect	VERB
biotropia-173	19	24	in	in	ADP
biotropia-173	19	25	monophyletic	monophyletic	ADJ
biotropia-173	19	26	relationship	relationship	NOUN
biotropia-173	19	27	(	(	PUNCT
biotropia-173	19	28	park	park	NOUN
biotropia-173	19	29	and	and	CCONJ
biotropia-173	19	30	jong	jong	PROPN
biotropia-173	19	31	2003	2003	NUM
biotropia-173	19	32	)	)	PUNCT
biotropia-173	19	33	.	.	PUNCT
biotropia-173	20	1	these	these	DET
biotropia-173	20	2	five	five	NUM
biotropia-173	20	3	species	specie	NOUN
biotropia-173	20	4	were	be	AUX
biotropia-173	20	5	definitely	definitely	ADV
biotropia-173	20	6	different	different	ADJ
biotropia-173	20	7	species	specie	NOUN
biotropia-173	20	8	based	base	VERB
biotropia-173	20	9	on	on	ADP
biotropia-173	20	10	morphological	morphological	ADJ
biotropia-173	20	11	characters	character	NOUN
biotropia-173	20	12	on	on	ADP
biotropia-173	20	13	agar	agar	NOUN
biotropia-173	20	14	media	medium	NOUN
biotropia-173	20	15	by	by	ADP
biotropia-173	20	16	hawksworth	hawksworth	NOUN
biotropia-173	20	17	and	and	CCONJ
biotropia-173	20	18	pitt	pitt	PROPN
biotropia-173	20	19	(	(	PUNCT
biotropia-173	20	20	1983	1983	NUM
biotropia-173	20	21	)	)	PUNCT
biotropia-173	20	22	(	(	PUNCT
biotropia-173	20	23	m.	m.	NOUN
biotropia-173	20	24	pilosus	pilosus	PROPN
biotropia-173	20	25	,	,	PUNCT
biotropia-173	20	26	m.	m.	NOUN
biotropia-173	20	27	purpureus	purpureus	NOUN
biotropia-173	20	28	,	,	PUNCT
biotropia-173	20	29	m.	m.	NOUN
biotropia-173	20	30	ruber	ruber	PROPN
biotropia-173	20	31	)	)	PUNCT
biotropia-173	20	32	,	,	PUNCT
biotropia-173	20	33	hocking	hocking	NOUN
biotropia-173	20	34	and	and	CCONJ
biotropia-173	20	35	pitt	pitt	PROPN
biotropia-173	20	36	(	(	PUNCT
biotropia-173	20	37	1988	1988	NUM
biotropia-173	20	38	)	)	PUNCT
biotropia-173	20	39	(	(	PUNCT
biotropia-173	20	40	m	m	NOUN
biotropia-173	20	41	eremophilus	eremophilus	NOUN
biotropia-173	20	42	)	)	PUNCT
biotropia-173	20	43	and	and	CCONJ
biotropia-173	20	44	cannon	cannon	NOUN
biotropia-173	20	45	et	et	PROPN
biotropia-173	20	46	al	al	PROPN
biotropia-173	20	47	.	.	PROPN
biotropia-173	21	1	(	(	PUNCT
biotropia-173	21	2	1995	1995	NUM
biotropia-173	21	3	)	)	PUNCT
biotropia-173	21	4	(	(	PUNCT
biotropia-173	21	5	m	m	PROPN
biotropia-173	21	6	sanguineus	sanguineus	NOUN
biotropia-173	21	7	)	)	PUNCT
biotropia-173	21	8	.	.	PUNCT
biotropia-173	22	1	as	as	SCONJ
biotropia-173	22	2	park	park	NOUN
biotropia-173	22	3	and	and	CCONJ
biotropia-173	22	4	jong	jong	PROPN
biotropia-173	22	5	(	(	PUNCT
biotropia-173	22	6	2003	2003	NUM
biotropia-173	22	7	)	)	PUNCT
biotropia-173	22	8	have	have	AUX
biotropia-173	22	9	suggested	suggest	VERB
biotropia-173	22	10	no	no	DET
biotropia-173	22	11	separation	separation	NOUN
biotropia-173	22	12	among	among	ADP
biotropia-173	22	13	the	the	DET
biotropia-173	22	14	five	five	NUM
biotropia-173	22	15	species	specie	NOUN
biotropia-173	22	16	of	of	ADP
biotropia-173	22	17	monascus	monascus	NOUN
biotropia-173	22	18	,	,	PUNCT
biotropia-173	22	19	we	we	PRON
biotropia-173	22	20	intended	intend	VERB
biotropia-173	22	21	to	to	PART
biotropia-173	22	22	do	do	VERB
biotropia-173	22	23	analysis	analysis	NOUN
biotropia-173	22	24	on	on	ADP
biotropia-173	22	25	internal	internal	ADJ
biotropia-173	22	26	transcribed	transcribe	VERB
biotropia-173	22	27	spacer	spacer	NOUN
biotropia-173	22	28	region	region	NOUN
biotropia-173	22	29	of	of	ADP
biotropia-173	22	30	monascus	monascus	NOUN
biotropia-173	22	31	.	.	PUNCT
biotropia-173	23	1	this	this	DET
biotropia-173	23	2	region	region	NOUN
biotropia-173	23	3	is	be	AUX
biotropia-173	23	4	known	know	VERB
biotropia-173	23	5	for	for	ADP
biotropia-173	23	6	its	its	PRON
biotropia-173	23	7	various	various	ADJ
biotropia-173	23	8	nucleotides	nucleotide	NOUN
biotropia-173	23	9	sequences	sequence	NOUN
biotropia-173	23	10	so	so	SCONJ
biotropia-173	23	11	it	it	PRON
biotropia-173	23	12	might	might	AUX
biotropia-173	23	13	be	be	AUX
biotropia-173	23	14	more	more	ADJ
biotropia-173	23	15	perspective	perspective	NOUN
biotropia-173	23	16	rather	rather	ADV
biotropia-173	23	17	than	than	ADP
biotropia-173	23	18	on	on	ADP
biotropia-173	23	19	lsu	lsu	NOUN
biotropia-173	23	20	rrna	rrna	NOUN
biotropia-173	23	21	genes	gene	NOUN
biotropia-173	23	22	.	.	PUNCT
biotropia-173	24	1	this	this	DET
biotropia-173	24	2	similar	similar	ADJ
biotropia-173	24	3	work	work	NOUN
biotropia-173	24	4	was	be	AUX
biotropia-173	24	5	not	not	PART
biotropia-173	24	6	only	only	ADV
biotropia-173	24	7	to	to	PART
biotropia-173	24	8	reveal	reveal	VERB
biotropia-173	24	9	genetic	genetic	ADJ
biotropia-173	24	10	diversity	diversity	NOUN
biotropia-173	24	11	of	of	ADP
biotropia-173	24	12	monascus	monascus	NOUN
biotropia-173	24	13	in	in	ADP
biotropia-173	24	14	indonesia	indonesia	PROPN
biotropia-173	24	15	,	,	PUNCT
biotropia-173	24	16	but	but	CCONJ
biotropia-173	24	17	also	also	ADV
biotropia-173	24	18	to	to	PART
biotropia-173	24	19	understand	understand	VERB
biotropia-173	24	20	the	the	DET
biotropia-173	24	21	relationship	relationship	NOUN
biotropia-173	24	22	among	among	ADP
biotropia-173	24	23	monascus	monascus	NOUN
biotropia-173	24	24	species	specie	NOUN
biotropia-173	24	25	and	and	CCONJ
biotropia-173	24	26	direction	direction	NOUN
biotropia-173	24	27	of	of	ADP
biotropia-173	24	28	mutation	mutation	NOUN
biotropia-173	24	29	by	by	ADP
biotropia-173	24	30	analysis	analysis	NOUN
biotropia-173	24	31	materials	material	NOUN
biotropia-173	24	32	and	and	CCONJ
biotropia-173	24	33	methods	method	NOUN
biotropia-173	24	34	monascus	monascus	VERB
biotropia-173	24	35	strains	strain	VERB
biotropia-173	24	36	a	a	DET
biotropia-173	24	37	number	number	NOUN
biotropia-173	24	38	of	of	ADP
biotropia-173	24	39	16	16	NUM
biotropia-173	24	40	monascus	monascus	NOUN
biotropia-173	24	41	strains	strain	NOUN
biotropia-173	24	42	used	use	VERB
biotropia-173	24	43	in	in	ADP
biotropia-173	24	44	this	this	DET
biotropia-173	24	45	study	study	NOUN
biotropia-173	24	46	were	be	AUX
biotropia-173	24	47	isolated	isolate	VERB
biotropia-173	24	48	and	and	CCONJ
biotropia-173	24	49	identified	identify	VERB
biotropia-173	24	50	by	by	ADP
biotropia-173	24	51	suharna	suharna	NOUN
biotropia-173	24	52	in	in	ADP
biotropia-173	24	53	2002	2002	NUM
biotropia-173	24	54	and	and	CCONJ
biotropia-173	24	55	2003	2003	NUM
biotropia-173	24	56	(	(	PUNCT
biotropia-173	24	57	table	table	NOUN
biotropia-173	24	58	1	1	NUM
biotropia-173	24	59	)	)	PUNCT
biotropia-173	24	60	.	.	PUNCT
biotropia-173	25	1	molecular	molecular	ADJ
biotropia-173	25	2	phylogenctic	phylogenctic	ADJ
biotropia-173	25	3	analysis	analysis	NOUN
biotropia-173	25	4	of	of	ADP
biotropia-173	25	5	monascus	monascus	ADJ
biotropia-173	25	6	fungi	fungus	NOUN
biotropia-173	25	7	—	—	PUNCT
biotropia-173	25	8	n.	n.	PROPN
biotropia-173	25	9	suharna	suharna	PROPN
biotropia-173	25	10	et	et	PROPN
biotropia-173	25	11	al	al	PROPN
biotropia-173	25	12	.	.	PUNCT
biotropia-173	25	13	cultivation	cultivation	NOUN
biotropia-173	25	14	and	and	CCONJ
biotropia-173	25	15	purification	purification	NOUN
biotropia-173	25	16	of	of	ADP
biotropia-173	25	17	monascus	monascus	NOUN
biotropia-173	25	18	strains	strain	NOUN
biotropia-173	25	19	all	all	DET
biotropia-173	25	20	fungi	fungus	NOUN
biotropia-173	25	21	were	be	AUX
biotropia-173	25	22	cultivated	cultivate	VERB
biotropia-173	25	23	on	on	ADP
biotropia-173	25	24	ym	ym	PROPN
biotropia-173	25	25	agar	agar	NOUN
biotropia-173	25	26	plate	plate	NOUN
biotropia-173	25	27	and	and	CCONJ
biotropia-173	25	28	for	for	ADP
biotropia-173	25	29	purification	purification	NOUN
biotropia-173	25	30	of	of	ADP
biotropia-173	25	31	cultures	culture	NOUN
biotropia-173	25	32	water	water	NOUN
biotropia-173	25	33	agar	agar	NOUN
biotropia-173	25	34	2	2	NUM
biotropia-173	25	35	%	%	NOUN
biotropia-173	25	36	was	be	AUX
biotropia-173	25	37	used	use	VERB
biotropia-173	25	38	.	.	PUNCT
biotropia-173	26	1	incubation	incubation	NOUN
biotropia-173	26	2	was	be	AUX
biotropia-173	26	3	carried	carry	VERB
biotropia-173	26	4	out	out	ADP
biotropia-173	26	5	at	at	ADP
biotropia-173	26	6	room	room	NOUN
biotropia-173	26	7	temperature	temperature	NOUN
biotropia-173	26	8	(	(	PUNCT
biotropia-173	26	9	25	25	NUM
biotropia-173	26	10	°	°	NUM
biotropia-173	26	11	c	c	NOUN
biotropia-173	26	12	)	)	PUNCT
biotropia-173	26	13	for	for	ADP
biotropia-173	26	14	three	three	NUM
biotropia-173	26	15	days	day	NOUN
biotropia-173	26	16	.	.	PUNCT
biotropia-173	27	1	a	a	DET
biotropia-173	27	2	little	little	ADJ
biotropia-173	27	3	amount	amount	NOUN
biotropia-173	27	4	of	of	ADP
biotropia-173	27	5	mycelial	mycelial	ADJ
biotropia-173	27	6	mass	mass	NOUN
biotropia-173	27	7	of	of	ADP
biotropia-173	27	8	each	each	DET
biotropia-173	27	9	fungus	fungus	NOUN
biotropia-173	27	10	was	be	AUX
biotropia-173	27	11	picked	pick	VERB
biotropia-173	27	12	up	up	ADP
biotropia-173	27	13	using	use	VERB
biotropia-173	27	14	toothpick	toothpick	NOUN
biotropia-173	27	15	then	then	ADV
biotropia-173	27	16	transferred	transfer	VERB
biotropia-173	27	17	into	into	ADP
biotropia-173	27	18	centrifuge	centrifuge	NOUN
biotropia-173	27	19	tube	tube	NOUN
biotropia-173	27	20	containing	contain	VERB
biotropia-173	27	21	10	10	NUM
biotropia-173	27	22	ml	ml	NOUN
biotropia-173	27	23	of	of	ADP
biotropia-173	27	24	ym	ym	PROPN
biotropia-173	27	25	broth	broth	ADJ
biotropia-173	27	26	medium	medium	NOUN
biotropia-173	27	27	and	and	CCONJ
biotropia-173	27	28	incubated	incubate	VERB
biotropia-173	27	29	at	at	ADP
biotropia-173	27	30	30	30	NUM
biotropia-173	27	31	°	°	ADP
biotropia-173	27	32	c	c	NOUN
biotropia-173	27	33	for	for	ADP
biotropia-173	27	34	three	three	NUM
biotropia-173	27	35	days	day	NOUN
biotropia-173	27	36	.	.	PUNCT
biotropia-173	28	1	the	the	DET
biotropia-173	28	2	mycelial	mycelial	ADJ
biotropia-173	28	3	mass	mass	NOUN
biotropia-173	28	4	of	of	ADP
biotropia-173	28	5	each	each	DET
biotropia-173	28	6	fungus	fungus	NOUN
biotropia-173	28	7	was	be	AUX
biotropia-173	28	8	then	then	ADV
biotropia-173	28	9	harvested	harvest	VERB
biotropia-173	28	10	for	for	ADP
biotropia-173	28	11	dna	dna	PROPN
biotropia-173	28	12	extraction	extraction	NOUN
biotropia-173	28	13	.	.	PUNCT
biotropia-173	29	1	dna	dna	PROPN
biotropia-173	29	2	extraction	extraction	VERB
biotropia-173	29	3	the	the	DET
biotropia-173	29	4	harvested	harvest	VERB
biotropia-173	29	5	mycelial	mycelial	ADJ
biotropia-173	29	6	mass	mass	NOUN
biotropia-173	29	7	of	of	ADP
biotropia-173	29	8	each	each	DET
biotropia-173	29	9	fungus	fungus	NOUN
biotropia-173	29	10	was	be	AUX
biotropia-173	29	11	put	put	VERB
biotropia-173	29	12	onto	onto	ADP
biotropia-173	29	13	paper	paper	NOUN
biotropia-173	29	14	to	to	PART
biotropia-173	29	15	remove	remove	VERB
biotropia-173	29	16	excess	excess	NOUN
biotropia-173	29	17	of	of	ADP
biotropia-173	29	18	medium	medium	NOUN
biotropia-173	29	19	then	then	ADV
biotropia-173	29	20	subsequently	subsequently	ADV
biotropia-173	29	21	put	put	VERB
biotropia-173	29	22	onto	onto	ADP
biotropia-173	29	23	mortar	mortar	NOUN
biotropia-173	29	24	before	before	ADP
biotropia-173	29	25	freezing	freeze	VERB
biotropia-173	29	26	by	by	ADP
biotropia-173	29	27	pouring	pour	VERB
biotropia-173	29	28	liquid	liquid	ADJ
biotropia-173	29	29	nitrogen	nitrogen	NOUN
biotropia-173	29	30	and	and	CCONJ
biotropia-173	29	31	grounded	ground	VERB
biotropia-173	29	32	by	by	ADP
biotropia-173	29	33	mortar	mortar	NOUN
biotropia-173	29	34	and	and	CCONJ
biotropia-173	29	35	pestle	pestle	NOUN
biotropia-173	29	36	.	.	PUNCT
biotropia-173	30	1	the	the	DET
biotropia-173	30	2	following	follow	VERB
biotropia-173	30	3	step	step	NOUN
biotropia-173	30	4	of	of	ADP
biotropia-173	30	5	dna	dna	PROPN
biotropia-173	30	6	extraction	extraction	NOUN
biotropia-173	30	7	was	be	AUX
biotropia-173	30	8	carried	carry	VERB
biotropia-173	30	9	out	out	ADP
biotropia-173	30	10	using	use	VERB
biotropia-173	30	11	qiaamp	qiaamp	ADJ
biotropia-173	30	12	tissue	tissue	NOUN
biotropia-173	30	13	kit	kit	NOUN
biotropia-173	30	14	(	(	PUNCT
biotropia-173	30	15	qiagen	qiagen	PROPN
biotropia-173	30	16	)	)	PUNCT
biotropia-173	30	17	.	.	PUNCT
biotropia-173	31	1	the	the	DET
biotropia-173	31	2	yield	yield	NOUN
biotropia-173	31	3	of	of	ADP
biotropia-173	31	4	dna	dna	PROPN
biotropia-173	31	5	samples	sample	NOUN
biotropia-173	31	6	was	be	AUX
biotropia-173	31	7	quantified	quantify	VERB
biotropia-173	31	8	and	and	CCONJ
biotropia-173	31	9	qualified	qualify	VERB
biotropia-173	31	10	by	by	ADP
biotropia-173	31	11	both	both	PRON
biotropia-173	31	12	spectrophotometer	spectrophotometer	NOUN
biotropia-173	31	13	and	and	CCONJ
biotropia-173	31	14	gel	gel	NOUN
biotropia-173	31	15	electrophoresis	electrophoresis	NOUN
biotropia-173	31	16	.	.	PUNCT
biotropia-173	32	1	pcr	pcr	ADJ
biotropia-173	32	2	,	,	PUNCT
biotropia-173	32	3	cloning	cloning	NOUN
biotropia-173	32	4	and	and	CCONJ
biotropia-173	32	5	sequencing	sequencing	NOUN
biotropia-173	32	6	of	of	ADP
biotropia-173	32	7	its	its	PRON
biotropia-173	32	8	region	region	NOUN
biotropia-173	32	9	its	its	PRON
biotropia-173	32	10	region	region	NOUN
biotropia-173	32	11	was	be	AUX
biotropia-173	32	12	amplified	amplify	VERB
biotropia-173	32	13	by	by	ADP
biotropia-173	32	14	pcr	pcr	PROPN
biotropia-173	32	15	with	with	ADP
biotropia-173	32	16	specific	specific	ADJ
biotropia-173	32	17	primer	primer	NOUN
biotropia-173	32	18	set	set	NOUN
biotropia-173	32	19	,	,	PUNCT
biotropia-173	32	20	its1	its1	PROPN
biotropia-173	32	21	(	(	PUNCT
biotropia-173	32	22	5'tccgtaggtgaacctgcgg-3	5'tccgtaggtgaacctgcgg-3	NUM
biotropia-173	32	23	'	'	NUM
biotropia-173	32	24	)	)	PUNCT
biotropia-173	32	25	and	and	CCONJ
biotropia-173	32	26	its4	its4	PROPN
biotropia-173	32	27	(	(	PUNCT
biotropia-173	32	28	5'-tcctccgcttattgatatgc-3	5'-tcctccgcttattgatatgc-3	NOUN
biotropia-173	32	29	'	'	PUNCT
biotropia-173	32	30	)	)	PUNCT
biotropia-173	32	31	(	(	PUNCT
biotropia-173	32	32	white	white	PROPN
biotropia-173	32	33	et	et	PROPN
biotropia-173	32	34	al	al	PROPN
biotropia-173	32	35	.	.	PROPN
biotropia-173	32	36	1990	1990	NUM
biotropia-173	32	37	)	)	PUNCT
biotropia-173	32	38	.	.	PUNCT
biotropia-173	33	1	pcr	pcr	PROPN
biotropia-173	33	2	was	be	AUX
biotropia-173	33	3	conducted	conduct	VERB
biotropia-173	33	4	using	use	VERB
biotropia-173	33	5	amplitaq	amplitaq	PROPN
biotropia-173	33	6	dna	dna	PROPN
biotropia-173	33	7	polymerase	polymerase	NOUN
biotropia-173	33	8	(	(	PUNCT
biotropia-173	33	9	roche	roche	PROPN
biotropia-173	33	10	,	,	PUNCT
biotropia-173	33	11	basel	basel	PROPN
biotropia-173	33	12	,	,	PUNCT
biotropia-173	33	13	switzerland	switzerland	PROPN
biotropia-173	33	14	)	)	PUNCT
biotropia-173	33	15	and	and	CCONJ
biotropia-173	33	16	supplemented	supplement	VERB
biotropia-173	33	17	with	with	ADP
biotropia-173	33	18	buffer	buffer	NOUN
biotropia-173	33	19	system	system	NOUN
biotropia-173	33	20	under	under	ADP
biotropia-173	33	21	a	a	DET
biotropia-173	33	22	temperature	temperature	NOUN
biotropia-173	33	23	profile	profile	NOUN
biotropia-173	33	24	of	of	ADP
biotropia-173	33	25	94	94	NUM
biotropia-173	33	26	°	°	ADP
biotropia-173	33	27	c	c	NOUN
biotropia-173	33	28	for	for	ADP
biotropia-173	33	29	4	4	NUM
biotropia-173	33	30	min	min	NOUN
biotropia-173	33	31	.	.	PROPN
biotropia-173	33	32	followed	follow	VERB
biotropia-173	33	33	by	by	ADP
biotropia-173	33	34	30	30	NUM
biotropia-173	33	35	cycles	cycle	NOUN
biotropia-173	33	36	of	of	ADP
biotropia-173	33	37	94	94	NUM
biotropia-173	33	38	°	°	ADP
biotropia-173	33	39	c	c	NOUN
biotropia-173	33	40	for	for	ADP
biotropia-173	33	41	30	30	NUM
biotropia-173	33	42	sec	sec	PROPN
biotropia-173	33	43	,	,	PUNCT
biotropia-173	33	44	55	55	NUM
biotropia-173	33	45	°	°	NOUN
biotropia-173	33	46	c	c	NOUN
biotropia-173	33	47	for	for	ADP
biotropia-173	33	48	1	1	NUM
biotropia-173	33	49	min	min	NOUN
biotropia-173	33	50	.	.	PROPN
biotropia-173	33	51	and	and	CCONJ
biotropia-173	33	52	72	72	NUM
biotropia-173	33	53	°	°	NOUN
biotropia-173	33	54	c	c	NOUN
biotropia-173	33	55	for	for	ADP
biotropia-173	33	56	1	1	NUM
biotropia-173	33	57	min	min	NOUN
biotropia-173	33	58	.	.	PUNCT
biotropia-173	34	1	the	the	DET
biotropia-173	34	2	pcr	pcr	PROPN
biotropia-173	34	3	products	product	NOUN
biotropia-173	34	4	were	be	AUX
biotropia-173	34	5	directly	directly	ADV
biotropia-173	34	6	cloned	clone	VERB
biotropia-173	34	7	with	with	ADP
biotropia-173	34	8	ta	ta	AUX
biotropia-173	34	9	-	-	PUNCT
biotropia-173	34	10	cloning	clone	VERB
biotropia-173	34	11	vector	vector	NOUN
biotropia-173	34	12	pt7blue	pt7blue	NOUN
biotropia-173	34	13	(	(	PUNCT
biotropia-173	34	14	takara	takara	PROPN
biotropia-173	34	15	)	)	PUNCT
biotropia-173	34	16	and	and	CCONJ
biotropia-173	34	17	escherichia	escherichia	NOUN
biotropia-173	34	18	coli	coli	NOUN
biotropia-173	34	19	dh5a	dh5a	NOUN
biotropia-173	34	20	competent	competent	ADJ
biotropia-173	34	21	cells	cell	NOUN
biotropia-173	34	22	(	(	PUNCT
biotropia-173	34	23	takara	takara	X
biotropia-173	34	24	)	)	PUNCT
biotropia-173	34	25	using	use	VERB
biotropia-173	34	26	ampicillin	ampicillin	NOUN
biotropia-173	34	27	and	and	CCONJ
biotropia-173	34	28	x	x	ADJ
biotropia-173	34	29	-	-	ADJ
biotropia-173	34	30	gal	gal	ADJ
biotropia-173	34	31	blue	blue	ADJ
biotropia-173	34	32	-	-	PUNCT
biotropia-173	34	33	white	white	ADJ
biotropia-173	34	34	selection	selection	NOUN
biotropia-173	34	35	system	system	NOUN
biotropia-173	34	36	.	.	PUNCT
biotropia-173	35	1	to	to	PART
biotropia-173	35	2	check	check	VERB
biotropia-173	35	3	the	the	DET
biotropia-173	35	4	length	length	NOUN
biotropia-173	35	5	of	of	ADP
biotropia-173	35	6	the	the	DET
biotropia-173	35	7	inserted	insert	VERB
biotropia-173	35	8	dna	dna	NOUN
biotropia-173	35	9	fragment	fragment	NOUN
biotropia-173	35	10	,	,	PUNCT
biotropia-173	35	11	white	white	ADJ
biotropia-173	35	12	colonies	colony	NOUN
biotropia-173	35	13	expected	expect	VERB
biotropia-173	35	14	to	to	PART
biotropia-173	35	15	contain	contain	VERB
biotropia-173	35	16	inserted	insert	VERB
biotropia-173	35	17	plasmid	plasmid	NOUN
biotropia-173	35	18	were	be	AUX
biotropia-173	35	19	directly	directly	ADV
biotropia-173	35	20	subjected	subject	VERB
biotropia-173	35	21	to	to	ADP
biotropia-173	35	22	pcr	pcr	NOUN
biotropia-173	35	23	using	use	VERB
biotropia-173	35	24	the	the	DET
biotropia-173	35	25	primers	primer	NOUN
biotropia-173	35	26	univl9	univl9	X
biotropia-173	36	1	(	(	PUNCT
biotropia-173	36	2	5'-gttttcccagtcacgacgt-3	5'-gttttcccagtcacgacgt-3	NUM
biotropia-173	36	3	'	'	NUM
biotropia-173	36	4	)	)	PUNCT
biotropia-173	36	5	and	and	CCONJ
biotropia-173	36	6	rev20(5'agctatgaccatgattacgc	rev20(5'agctatgaccatgattacgc	NOUN
biotropia-173	36	7	-3	-3	PUNCT
biotropia-173	36	8	'	'	NUM
biotropia-173	36	9	)	)	PUNCT
biotropia-173	36	10	.	.	PUNCT
biotropia-173	37	1	when	when	SCONJ
biotropia-173	37	2	a	a	DET
biotropia-173	37	3	pcr	pcr	ADJ
biotropia-173	37	4	product	product	NOUN
biotropia-173	37	5	of	of	ADP
biotropia-173	37	6	expected	expect	VERB
biotropia-173	37	7	size	size	NOUN
biotropia-173	37	8	(	(	PUNCT
biotropia-173	37	9	600	600	NUM
biotropia-173	37	10	bp	bp	NOUN
biotropia-173	37	11	)	)	PUNCT
biotropia-173	37	12	was	be	AUX
biotropia-173	37	13	obtained	obtain	VERB
biotropia-173	37	14	,	,	PUNCT
biotropia-173	37	15	two	two	NUM
biotropia-173	37	16	clones	clone	NOUN
biotropia-173	37	17	of	of	ADP
biotropia-173	37	18	which	which	PRON
biotropia-173	37	19	were	be	AUX
biotropia-173	37	20	cultured	culture	VERB
biotropia-173	37	21	overnight	overnight	ADV
biotropia-173	37	22	in	in	ADP
biotropia-173	37	23	3	3	NUM
biotropia-173	37	24	ml	ml	NOUN
biotropia-173	37	25	of	of	ADP
biotropia-173	37	26	lb	lb	DET
biotropia-173	37	27	medium	medium	ADJ
biotropia-173	37	28	containing	contain	VERB
biotropia-173	37	29	ampicillin	ampicillin	NOUN
biotropia-173	37	30	,	,	PUNCT
biotropia-173	37	31	and	and	CCONJ
biotropia-173	37	32	subjected	subject	VERB
biotropia-173	37	33	to	to	ADP
biotropia-173	37	34	plasmid	plasmid	ADJ
biotropia-173	37	35	extraction	extraction	NOUN
biotropia-173	37	36	using	use	VERB
biotropia-173	37	37	qiaprep	qiaprep	PROPN
biotropia-173	37	38	-	-	PUNCT
biotropia-173	37	39	spin	spin	NOUN
biotropia-173	37	40	miniprep	miniprep	NOUN
biotropia-173	37	41	kit	kit	NOUN
biotropia-173	37	42	(	(	PUNCT
biotropia-173	37	43	qiagen	qiagen	PROPN
biotropia-173	37	44	)	)	PUNCT
biotropia-173	37	45	.	.	PUNCT
biotropia-173	38	1	the	the	DET
biotropia-173	38	2	purified	purified	ADJ
biotropia-173	38	3	plasmids	plasmid	NOUN
biotropia-173	38	4	were	be	AUX
biotropia-173	38	5	eluted	elute	VERB
biotropia-173	38	6	with	with	ADP
biotropia-173	38	7	50	50	NUM
biotropia-173	38	8	ul	ul	INTJ
biotropia-173	38	9	distilled	distil	VERB
biotropia-173	38	10	-	-	PUNCT
biotropia-173	38	11	water	water	NOUN
biotropia-173	38	12	and	and	CCONJ
biotropia-173	38	13	used	use	VERB
biotropia-173	38	14	for	for	ADP
biotropia-173	38	15	sequencing	sequence	VERB
biotropia-173	38	16	.	.	PUNCT
biotropia-173	39	1	dye	dye	NOUN
biotropia-173	39	2	terminator	terminator	NOUN
biotropia-173	39	3	-	-	PUNCT
biotropia-173	39	4	labelled	label	VERB
biotropia-173	39	5	cycle	cycle	NOUN
biotropia-173	39	6	sequencing	sequencing	NOUN
biotropia-173	39	7	reaction	reaction	NOUN
biotropia-173	39	8	was	be	AUX
biotropia-173	39	9	conducted	conduct	VERB
biotropia-173	39	10	with	with	ADP
biotropia-173	39	11	dna	dna	NOUN
biotropia-173	39	12	sequencing	sequence	VERB
biotropia-173	39	13	kit	kit	NOUN
biotropia-173	39	14	fs	fs	X
biotropia-173	39	15	(	(	PUNCT
biotropia-173	39	16	perkin	perkin	PROPN
biotropia-173	39	17	elmer	elmer	PROPN
biotropia-173	39	18	)	)	PUNCT
biotropia-173	39	19	and	and	CCONJ
biotropia-173	39	20	four	four	NUM
biotropia-173	39	21	sequencing	sequence	VERB
biotropia-173	39	22	primers	primer	NOUN
biotropia-173	39	23	univl9	univl9	NOUN
biotropia-173	40	1	and	and	CCONJ
biotropia-173	40	2	rev20	rev20	VERB
biotropia-173	40	3	under	under	ADP
biotropia-173	40	4	a	a	DET
biotropia-173	40	5	temperature	temperature	NOUN
biotropia-173	40	6	profile	profile	NOUN
biotropia-173	40	7	of	of	ADP
biotropia-173	40	8	94	94	NUM
biotropia-173	40	9	°	°	ADP
biotropia-173	40	10	c	c	NOUN
biotropia-173	40	11	for	for	ADP
biotropia-173	40	12	4	4	NUM
biotropia-173	40	13	min	min	NOUN
biotropia-173	40	14	.	.	PROPN
biotropia-173	40	15	followed	follow	VERB
biotropia-173	40	16	by	by	ADP
biotropia-173	40	17	30	30	NUM
biotropia-173	40	18	cycles	cycle	NOUN
biotropia-173	40	19	of	of	ADP
biotropia-173	40	20	94	94	NUM
biotropia-173	40	21	°	°	ADP
biotropia-173	40	22	c	c	NOUN
biotropia-173	40	23	for	for	ADP
biotropia-173	40	24	30	30	NUM
biotropia-173	40	25	sec	sec	PROPN
biotropia-173	40	26	,	,	PUNCT
biotropia-173	40	27	50	50	NUM
biotropia-173	40	28	°	°	NOUN
biotropia-173	40	29	c	c	NOUN
biotropia-173	40	30	for	for	ADP
biotropia-173	40	31	1	1	NUM
biotropia-173	40	32	min	min	NOUN
biotropia-173	40	33	.	.	PROPN
biotropia-173	40	34	and	and	CCONJ
biotropia-173	41	1	60	60	NUM
biotropia-173	41	2	°	°	NOUN
biotropia-173	41	3	c	c	NOUN
biotropia-173	41	4	for	for	ADP
biotropia-173	41	5	4	4	NUM
biotropia-173	41	6	min	min	NOUN
biotropia-173	41	7	.	.	PUNCT
biotropia-173	42	1	the	the	DET
biotropia-173	42	2	products	product	NOUN
biotropia-173	42	3	were	be	AUX
biotropia-173	42	4	analyzed	analyze	VERB
biotropia-173	42	5	by	by	ADP
biotropia-173	42	6	abi	abi	PROPN
biotropia-173	42	7	prism	prism	NOUN
biotropia-173	42	8	377	377	NUM
biotropia-173	42	9	dna	dna	PROPN
biotropia-173	42	10	sequencer	sequencer	NOUN
biotropia-173	42	11	(	(	PUNCT
biotropia-173	42	12	perkin	perkin	PROPN
biotropia-173	42	13	elmer	elmer	PROPN
biotropia-173	42	14	)	)	PUNCT
biotropia-173	42	15	.	.	PUNCT
biotropia-173	43	1	64	64	NUM
biotropia-173	43	2	biotropia	biotropia	NOUN
biotropia-173	43	3	no	no	NOUN
biotropia-173	43	4	.	.	PROPN
biotropia-173	43	5	24	24	NUM
biotropia-173	43	6	,	,	PUNCT
biotropia-173	43	7	2005	2005	NUM
biotropia-173	43	8	molecular	molecular	ADJ
biotropia-173	43	9	phylogenetic	phylogenetic	ADJ
biotropia-173	43	10	analysis	analysis	NOUN
biotropia-173	43	11	the	the	DET
biotropia-173	43	12	its	its	PRON
biotropia-173	43	13	region	region	NOUN
biotropia-173	43	14	sequences	sequence	NOUN
biotropia-173	43	15	determined	determine	VERB
biotropia-173	43	16	were	be	AUX
biotropia-173	43	17	subjected	subject	VERB
biotropia-173	43	18	to	to	ADP
biotropia-173	43	19	molecular	molecular	ADJ
biotropia-173	43	20	phylogenetic	phylogenetic	ADJ
biotropia-173	43	21	analysis	analysis	NOUN
biotropia-173	43	22	together	together	ADV
biotropia-173	43	23	with	with	ADP
biotropia-173	43	24	those	those	PRON
biotropia-173	43	25	retrieved	retrieve	VERB
biotropia-173	43	26	from	from	ADP
biotropia-173	43	27	the	the	DET
biotropia-173	43	28	ddbj	ddbj	ADJ
biotropia-173	43	29	nucleotide	nucleotide	NOUN
biotropia-173	43	30	sequence	sequence	NOUN
biotropia-173	43	31	database	database	NOUN
biotropia-173	43	32	.	.	PUNCT
biotropia-173	44	1	a	a	DET
biotropia-173	44	2	multiple	multiple	ADJ
biotropia-173	44	3	alignment	alignment	NOUN
biotropia-173	44	4	of	of	ADP
biotropia-173	44	5	the	the	DET
biotropia-173	44	6	its	its	PRON
biotropia-173	44	7	region	region	NOUN
biotropia-173	44	8	sequences	sequence	NOUN
biotropia-173	44	9	was	be	AUX
biotropia-173	44	10	generated	generate	VERB
biotropia-173	44	11	by	by	ADP
biotropia-173	44	12	the	the	DET
biotropia-173	44	13	program	program	NOUN
biotropia-173	44	14	package	package	NOUN
biotropia-173	44	15	clustal	clustal	ADJ
biotropia-173	44	16	w	w	PROPN
biotropia-173	44	17	(	(	PUNCT
biotropia-173	44	18	thompson	thompson	PROPN
biotropia-173	44	19	et	et	PROPN
biotropia-173	44	20	al	al	PROPN
biotropia-173	44	21	.	.	PROPN
biotropia-173	44	22	1994	1994	NUM
biotropia-173	44	23	)	)	PUNCT
biotropia-173	44	24	.	.	PUNCT
biotropia-173	45	1	phylogenetic	phylogenetic	ADJ
biotropia-173	45	2	trees	tree	NOUN
biotropia-173	45	3	were	be	AUX
biotropia-173	45	4	constructed	construct	VERB
biotropia-173	45	5	by	by	ADP
biotropia-173	45	6	the	the	DET
biotropia-173	45	7	neighbor	neighbor	NOUN
biotropia-173	45	8	-	-	PUNCT
biotropia-173	45	9	joining	join	VERB
biotropia-173	45	10	method	method	NOUN
biotropia-173	45	11	using	use	VERB
biotropia-173	45	12	clustal	clustal	ADJ
biotropia-173	45	13	w	w	PROPN
biotropia-173	45	14	(	(	PUNCT
biotropia-173	45	15	thompson	thompson	PROPN
biotropia-173	45	16	et	et	PROPN
biotropia-173	45	17	al	al	PROPN
biotropia-173	45	18	.	.	PROPN
biotropia-173	45	19	1994	1994	NUM
biotropia-173	45	20	)	)	PUNCT
biotropia-173	45	21	.	.	PUNCT
biotropia-173	46	1	bootstrap	bootstrap	NOUN
biotropia-173	46	2	tests	test	NOUN
biotropia-173	46	3	(	(	PUNCT
biotropia-173	46	4	felsenstein	felsenstein	ADJ
biotropia-173	46	5	1981	1981	NUM
biotropia-173	46	6	)	)	PUNCT
biotropia-173	46	7	were	be	AUX
biotropia-173	46	8	performed	perform	VERB
biotropia-173	46	9	with	with	ADP
biotropia-173	46	10	1000	1000	NUM
biotropia-173	46	11	replications	replication	NOUN
biotropia-173	46	12	.	.	PUNCT
biotropia-173	47	1	results	result	NOUN
biotropia-173	47	2	figure	figure	VERB
biotropia-173	47	3	1	1	NUM
biotropia-173	47	4	shows	show	VERB
biotropia-173	47	5	that	that	SCONJ
biotropia-173	47	6	amplification	amplification	NOUN
biotropia-173	47	7	by	by	ADP
biotropia-173	47	8	primer	primer	NOUN
biotropia-173	47	9	set	set	VERB
biotropia-173	47	10	comprised	comprise	VERB
biotropia-173	47	11	its1	its1	PROPN
biotropia-173	47	12	and	and	CCONJ
biotropia-173	47	13	its4	its4	PROPN
biotropia-173	47	14	were	be	AUX
biotropia-173	47	15	successful	successful	ADJ
biotropia-173	47	16	for	for	SCONJ
biotropia-173	47	17	all	all	DET
biotropia-173	47	18	monascus	monascus	NOUN
biotropia-173	47	19	strain	strain	NOUN
biotropia-173	47	20	tested	test	VERB
biotropia-173	47	21	.	.	PUNCT
biotropia-173	48	1	the	the	DET
biotropia-173	48	2	size	size	NOUN
biotropia-173	48	3	of	of	ADP
biotropia-173	48	4	amplified	amplify	VERB
biotropia-173	48	5	dna	dna	NOUN
biotropia-173	48	6	products	product	NOUN
biotropia-173	48	7	of	of	ADP
biotropia-173	48	8	all	all	DET
biotropia-173	48	9	monascus	monascus	NOUN
biotropia-173	48	10	isolates	isolate	NOUN
biotropia-173	48	11	by	by	ADP
biotropia-173	48	12	the	the	DET
biotropia-173	48	13	primer	primer	NOUN
biotropia-173	48	14	set	set	VERB
biotropia-173	48	15	was	be	AUX
biotropia-173	48	16	700	700	NUM
biotropia-173	48	17	base	base	NOUN
biotropia-173	48	18	pair	pair	NOUN
biotropia-173	48	19	each	each	PRON
biotropia-173	48	20	as	as	SCONJ
biotropia-173	48	21	shown	show	VERB
biotropia-173	48	22	in	in	ADP
biotropia-173	48	23	figure	figure	NOUN
biotropia-173	48	24	1	1	NUM
biotropia-173	48	25	.	.	PUNCT
biotropia-173	48	26	molecular	molecular	ADJ
biotropia-173	48	27	phytogeny	phytogeny	NOUN
biotropia-173	48	28	figure	figure	NOUN
biotropia-173	48	29	2	2	NUM
biotropia-173	48	30	shows	show	VERB
biotropia-173	48	31	that	that	SCONJ
biotropia-173	48	32	thermoascus	thermoascus	PROPN
biotropia-173	48	33	crustaceus	crustaceus	PROPN
biotropia-173	48	34	u18353	u18353	PROPN
biotropia-173	48	35	used	use	VERB
biotropia-173	48	36	as	as	ADP
biotropia-173	48	37	outgroup	outgroup	NOUN
biotropia-173	48	38	was	be	AUX
biotropia-173	48	39	significantly	significantly	ADV
biotropia-173	48	40	separated	separate	VERB
biotropia-173	48	41	from	from	ADP
biotropia-173	48	42	all	all	DET
biotropia-173	48	43	monascus	monascus	NOUN
biotropia-173	48	44	species	specie	NOUN
biotropia-173	48	45	that	that	PRON
biotropia-173	48	46	integrated	integrate	VERB
biotropia-173	48	47	in	in	ADP
biotropia-173	48	48	one	one	NUM
biotropia-173	48	49	main	main	ADJ
biotropia-173	48	50	clade	clade	NOUN
biotropia-173	48	51	.	.	PUNCT
biotropia-173	49	1	this	this	DET
biotropia-173	49	2	monascus	monascus	NOUN
biotropia-173	49	3	clade	clade	NOUN
biotropia-173	49	4	consists	consist	VERB
biotropia-173	49	5	of	of	ADP
biotropia-173	49	6	very	very	ADV
biotropia-173	49	7	similar	similar	ADJ
biotropia-173	49	8	two	two	NUM
biotropia-173	49	9	large	large	ADJ
biotropia-173	49	10	clades	clade	NOUN
biotropia-173	49	11	,	,	PUNCT
biotropia-173	49	12	while	while	SCONJ
biotropia-173	49	13	m.	m.	NOUN
biotropia-173	49	14	ruber	ruber	PROPN
biotropia-173	49	15	af458470	af458470	PROPN
biotropia-173	49	16	was	be	AUX
biotropia-173	49	17	basically	basically	ADV
biotropia-173	49	18	separated	separate	VERB
biotropia-173	49	19	from	from	ADP
biotropia-173	49	20	all	all	DET
biotropia-173	49	21	those	those	DET
biotropia-173	49	22	monascus	monascus	NOUN
biotropia-173	49	23	.	.	PUNCT
biotropia-173	50	1	one	one	NUM
biotropia-173	50	2	of	of	ADP
biotropia-173	50	3	the	the	DET
biotropia-173	50	4	two	two	NUM
biotropia-173	50	5	large	large	ADJ
biotropia-173	50	6	65	65	NUM
biotropia-173	50	7	molecular	molecular	ADJ
biotropia-173	50	8	phylogenetic	phylogenetic	ADJ
biotropia-173	50	9	analysis	analysis	NOUN
biotropia-173	50	10	of	of	ADP
biotropia-173	50	11	monascus	monascus	ADJ
biotropia-173	50	12	fungi	fungi	PROPN
biotropia-173	50	13	n.	n.	NOUN
biotropia-173	50	14	suhama	suhama	PROPN
biotropia-173	50	15	el	el	PROPN
biotropia-173	50	16	al	al	PROPN
biotropia-173	50	17	.	.	PUNCT
biotropia-173	50	18	clades	clade	NOUN
biotropia-173	50	19	includes	include	VERB
biotropia-173	50	20	the	the	DET
biotropia-173	50	21	seven	seven	NUM
biotropia-173	50	22	m.	m.	NOUN
biotropia-173	50	23	purpureus	purpureus	NOUN
biotropia-173	50	24	strains	strain	NOUN
biotropia-173	50	25	,	,	PUNCT
biotropia-173	50	26	m.	m.	NOUN
biotropia-173	50	27	purpureus	purpureus	NOUN
biotropia-173	50	28	af458473	af458473	PROPN
biotropia-173	50	29	,	,	PUNCT
biotropia-173	50	30	a	a	DET
biotropia-173	50	31	araneosus	araneosus	NOUN
biotropia-173	50	32	af458471	af458471	PROPN
biotropia-173	50	33	and	and	CCONJ
biotropia-173	50	34	m.	m.	PROPN
biotropia-173	50	35	kaoliang	kaoliang	PROPN
biotropia-173	50	36	af451859	af451859	PROPN
biotropia-173	50	37	.	.	PUNCT
biotropia-173	51	1	another	another	DET
biotropia-173	51	2	large	large	ADJ
biotropia-173	51	3	clade	clade	NOUN
biotropia-173	51	4	includes	include	VERB
biotropia-173	51	5	th	th	NUM
biotropia-173	51	6	six	six	NUM
biotropia-173	51	7	monascus	monascus	NOUN
biotropia-173	51	8	sp	sp	NOUN
biotropia-173	51	9	.	.	NOUN
biotropia-173	51	10	strains	strain	NOUN
biotropia-173	51	11	which	which	PRON
biotropia-173	51	12	typically	typically	ADV
biotropia-173	51	13	have	have	VERB
biotropia-173	51	14	whitish	whitish	ADJ
biotropia-173	51	15	colonies	colony	NOUN
biotropia-173	51	16	,	,	PUNCT
biotropia-173	51	17	the	the	DET
biotropia-173	51	18	three	three	NUM
biotropia-173	51	19	m.	m.	NOUN
biotropia-173	51	20	rube	rube	NOUN
biotropia-173	51	21	strains	strain	NOUN
biotropia-173	51	22	and	and	CCONJ
biotropia-173	51	23	m.pilosus	m.pilosus	NOUN
biotropia-173	51	24	af451856	af451856	PROPN
biotropia-173	51	25	.	.	PUNCT
biotropia-173	52	1	the	the	DET
biotropia-173	52	2	similarities	similarity	NOUN
biotropia-173	52	3	within	within	ADP
biotropia-173	52	4	the	the	DET
biotropia-173	52	5	seven	seven	NUM
biotropia-173	52	6	m.	m.	NOUN
biotropia-173	52	7	purpurei	purpurei	ADJ
biotropia-173	52	8	>	>	X
biotropia-173	52	9	strains	strain	NOUN
biotropia-173	52	10	and	and	CCONJ
biotropia-173	52	11	m.	m.	NOUN
biotropia-173	52	12	purpureus	purpureus	NOUN
biotropia-173	52	13	af458473	af458473	PROPN
biotropia-173	52	14	,	,	PUNCT
biotropia-173	52	15	m.	m.	NOUN
biotropia-173	52	16	araneosus	araneosus	PROPN
biotropia-173	52	17	af458471	af458471	PROPN
biotropia-173	52	18	and	and	CCONJ
biotropia-173	52	19	m.	m.	PROPN
biotropia-173	52	20	kaolian	kaolian	PROPN
biotropia-173	52	21	af451859	af451859	PROPN
biotropia-173	52	22	are	be	AUX
biotropia-173	52	23	very	very	ADV
biotropia-173	52	24	high	high	ADJ
biotropia-173	52	25	more	more	ADJ
biotropia-173	52	26	than	than	ADP
biotropia-173	52	27	99	99	NUM
biotropia-173	52	28	%	%	NOUN
biotropia-173	52	29	or	or	CCONJ
biotropia-173	52	30	almost	almost	ADV
biotropia-173	52	31	100	100	NUM
biotropia-173	52	32	%	%	NOUN
biotropia-173	52	33	.	.	PUNCT
biotropia-173	53	1	however	however	ADV
biotropia-173	53	2	,	,	PUNCT
biotropia-173	53	3	m.	m.	NOUN
biotropia-173	53	4	purpure^	purpure^	ADP
biotropia-173	53	5	pkb5	pkb5	PROPN
biotropia-173	53	6	shows	show	VERB
biotropia-173	53	7	a	a	DET
biotropia-173	53	8	little	little	ADV
biotropia-173	53	9	more	more	ADV
biotropia-173	53	10	different	different	ADJ
biotropia-173	53	11	.	.	PUNCT
biotropia-173	54	1	the	the	DET
biotropia-173	54	2	six	six	NUM
biotropia-173	54	3	monascus	monascus	NOUN
biotropia-173	54	4	sp	sp	NOUN
biotropia-173	54	5	.	.	NOUN
biotropia-173	54	6	strains	strain	NOUN
biotropia-173	54	7	,	,	PUNCT
biotropia-173	54	8	the	the	DET
biotropia-173	54	9	three	three	NUM
biotropia-173	54	10	m.	m.	NOUN
biotropia-173	54	11	rube	rube	NOUN
biotropia-173	54	12	and	and	CCONJ
biotropia-173	54	13	m.	m.	NOUN
biotropia-173	54	14	pilosus	pilosus	PROPN
biotropia-173	54	15	af451856	af451856	PROPN
biotropia-173	54	16	also	also	ADV
biotropia-173	54	17	showed	show	VERB
biotropia-173	54	18	very	very	ADV
biotropia-173	54	19	high	high	ADJ
biotropia-173	54	20	similarity	similarity	NOUN
biotropia-173	54	21	.	.	PUNCT
biotropia-173	55	1	but	but	CCONJ
biotropia-173	55	2	lesser	less	ADJ
biotropia-173	55	3	difference	difference	NOUN
biotropia-173	55	4	i	i	PRON
biotropia-173	55	5	shown	show	VERB
biotropia-173	55	6	by	by	ADP
biotropia-173	55	7	monascus	monascus	PROPN
biotropia-173	55	8	sp	sp	PROPN
biotropia-173	55	9	.	.	PUNCT
biotropia-173	56	1	ka30.1	ka30.1	PROPN
biotropia-173	56	2	.	.	PUNCT
biotropia-173	57	1	discussions	discussion	NOUN
biotropia-173	57	2	with	with	ADP
biotropia-173	57	3	regard	regard	NOUN
biotropia-173	57	4	to	to	ADP
biotropia-173	57	5	the	the	DET
biotropia-173	57	6	level	level	NOUN
biotropia-173	57	7	of	of	ADP
biotropia-173	57	8	very	very	ADV
biotropia-173	57	9	high	high	ADJ
biotropia-173	57	10	similarity	similarity	NOUN
biotropia-173	57	11	more	more	ADJ
biotropia-173	57	12	than	than	ADP
biotropia-173	57	13	99	99	NUM
biotropia-173	57	14	%	%	NOUN
biotropia-173	57	15	almost	almost	ADV
biotropia-173	57	16	nearl	nearl	ADJ
biotropia-173	57	17	;	;	PUNCT
biotropia-173	57	18	100	100	NUM
biotropia-173	57	19	%	%	NOUN
biotropia-173	57	20	among	among	ADP
biotropia-173	57	21	all	all	DET
biotropia-173	57	22	monascus	monascus	NOUN
biotropia-173	57	23	fungi	fungus	NOUN
biotropia-173	57	24	we	we	PRON
biotropia-173	57	25	analyzed	analyze	VERB
biotropia-173	57	26	,	,	PUNCT
biotropia-173	57	27	indicated	indicate	VERB
biotropia-173	57	28	that	that	SCONJ
biotropia-173	57	29	there	there	PRON
biotropia-173	57	30	is	be	VERB
biotropia-173	57	31	little	little	ADJ
biotropia-173	57	32	mutatioi	mutatioi	NOUN
biotropia-173	57	33	on	on	ADP
biotropia-173	57	34	its	its	PRON
biotropia-173	57	35	region	region	NOUN
biotropia-173	57	36	of	of	ADP
biotropia-173	57	37	monascus	monascus	NOUN
biotropia-173	57	38	species	specie	NOUN
biotropia-173	57	39	.	.	PUNCT
biotropia-173	58	1	concerning	concern	VERB
biotropia-173	58	2	genetic	genetic	ADJ
biotropia-173	58	3	diversity	diversity	NOUN
biotropia-173	58	4	it	it	PRON
biotropia-173	58	5	seemed	seem	VERB
biotropia-173	58	6	tha	tha	INTJ
biotropia-173	58	7	there	there	PRON
biotropia-173	58	8	is	be	VERB
biotropia-173	58	9	a	a	DET
biotropia-173	58	10	diverse	diverse	ADJ
biotropia-173	58	11	mutation	mutation	NOUN
biotropia-173	58	12	tendency	tendency	NOUN
biotropia-173	58	13	as	as	SCONJ
biotropia-173	58	14	several	several	ADJ
biotropia-173	58	15	monascus	monascus	NOUN
biotropia-173	58	16	strains	strain	VERB
biotropia-173	58	17	such	such	DET
biotropia-173	58	18	a	a	DET
biotropia-173	58	19	66	66	NUM
biotropia-173	58	20	biotropia	biotropia	NOUN
biotropia-173	58	21	no	no	NOUN
biotropia-173	58	22	.	.	PROPN
biotropia-173	58	23	24	24	NUM
biotropia-173	58	24	,	,	PUNCT
biotropia-173	58	25	2005	2005	NUM
biotropia-173	58	26	m.purpureus	m.purpureus	PROPN
biotropia-173	58	27	pkb1	pkb1	PROPN
biotropia-173	58	28	,	,	PUNCT
biotropia-173	58	29	m.purpureus	m.purpureus	NOUN
biotropia-173	58	30	prba	prba	NOUN
biotropia-173	58	31	,	,	PUNCT
biotropia-173	58	32	m.purpureus	m.purpureus	PROPN
biotropia-173	58	33	jms	jms	PROPN
biotropia-173	58	34	,	,	PUNCT
biotropia-173	58	35	m.purpureus	m.purpureus	NOUN
biotropia-173	58	36	af458473	af458473	NOUN
biotropia-173	58	37	,	,	PUNCT
biotropia-173	58	38	m.	m.	NOUN
biotropia-173	58	39	rubber	rubber	NOUN
biotropia-173	58	40	cka1	cka1	PROPN
biotropia-173	58	41	and	and	CCONJ
biotropia-173	58	42	monascus	monascus	ADJ
biotropia-173	58	43	sp	sp	PROPN
biotropia-173	58	44	.	.	PUNCT
biotropia-173	59	1	ka30.1	ka30.1	PROPN
biotropia-173	59	2	appeared	appear	VERB
biotropia-173	59	3	more	more	ADV
biotropia-173	59	4	different	different	ADJ
biotropia-173	59	5	though	though	SCONJ
biotropia-173	59	6	these	these	DET
biotropia-173	59	7	differences	difference	NOUN
biotropia-173	59	8	were	be	AUX
biotropia-173	59	9	so	so	ADV
biotropia-173	59	10	slight	slight	ADJ
biotropia-173	59	11	.	.	PUNCT
biotropia-173	60	1	therefore	therefore	ADV
biotropia-173	60	2	,	,	PUNCT
biotropia-173	60	3	this	this	DET
biotropia-173	60	4	phylogenetic	phylogenetic	ADJ
biotropia-173	60	5	analysis	analysis	NOUN
biotropia-173	60	6	revealed	reveal	VERB
biotropia-173	60	7	very	very	ADV
biotropia-173	60	8	close	close	ADJ
biotropia-173	60	9	relationship	relationship	NOUN
biotropia-173	60	10	among	among	ADP
biotropia-173	60	11	monascus	monascus	NOUN
biotropia-173	60	12	strains	strain	NOUN
biotropia-173	60	13	so	so	SCONJ
biotropia-173	60	14	we	we	PRON
biotropia-173	60	15	suggested	suggest	VERB
biotropia-173	60	16	that	that	SCONJ
biotropia-173	60	17	all	all	DET
biotropia-173	60	18	m.purpureus	m.purpureus	NOUN
biotropia-173	60	19	were	be	AUX
biotropia-173	60	20	identical	identical	ADJ
biotropia-173	60	21	to	to	ADP
biotropia-173	60	22	each	each	DET
biotropia-173	60	23	other	other	ADJ
biotropia-173	60	24	as	as	SCONJ
biotropia-173	60	25	shown	show	VERB
biotropia-173	60	26	by	by	ADP
biotropia-173	60	27	m.purpureus	m.purpureus	PROPN
biotropia-173	60	28	ngk	ngk	PROPN
biotropia-173	60	29	-	-	PUNCT
biotropia-173	60	30	j	j	PROPN
biotropia-173	60	31	,	,	PUNCT
biotropia-173	60	32	m.purpureus	m.purpureus	PROPN
biotropia-173	60	33	jmba	jmba	PROPN
biotropia-173	60	34	,	,	PUNCT
biotropia-173	60	35	m.purpureus	m.purpureus	PROPN
biotropia-173	60	36	pkb1	pkb1	PROPN
biotropia-173	60	37	,	,	PUNCT
biotropia-173	60	38	m.purpureus	m.purpureus	PROPN
biotropia-173	60	39	pkb5	pkb5	PROPN
biotropia-173	60	40	,	,	PUNCT
biotropia-173	60	41	m.purpureus	m.purpureus	NOUN
biotropia-173	60	42	srba	srba	NOUN
biotropia-173	60	43	,	,	PUNCT
biotropia-173	60	44	m.purpureus	m.purpureus	NOUN
biotropia-173	60	45	af458473	af458473	NOUN
biotropia-173	60	46	and	and	CCONJ
biotropia-173	60	47	m.	m.	NOUN
biotropia-173	60	48	araneosus	araneosus	PROPN
biotropia-173	60	49	af458471	af458471	PROPN
biotropia-173	60	50	in	in	ADP
biotropia-173	60	51	the	the	DET
biotropia-173	60	52	same	same	ADJ
biotropia-173	60	53	clade	clade	NOUN
biotropia-173	60	54	.	.	PUNCT
biotropia-173	61	1	in	in	ADP
biotropia-173	61	2	another	another	DET
biotropia-173	61	3	clade	clade	NOUN
biotropia-173	61	4	,	,	PUNCT
biotropia-173	61	5	all	all	DET
biotropia-173	61	6	indonesian	indonesian	ADJ
biotropia-173	61	7	m.	m.	NOUN
biotropia-173	61	8	ruber	ruber	PROPN
biotropia-173	61	9	strains	strain	NOUN
biotropia-173	61	10	and	and	CCONJ
biotropia-173	61	11	m.	m.	NOUN
biotropia-173	61	12	pilosus	pilosus	PROPN
biotropia-173	61	13	were	be	AUX
biotropia-173	61	14	identical	identical	ADJ
biotropia-173	61	15	to	to	ADP
biotropia-173	61	16	each	each	DET
biotropia-173	61	17	other	other	ADJ
biotropia-173	61	18	.	.	PUNCT
biotropia-173	62	1	however	however	ADV
biotropia-173	62	2	,	,	PUNCT
biotropia-173	62	3	m.	m.	NOUN
biotropia-173	62	4	ruber	ruber	PROPN
biotropia-173	62	5	af458470	af458470	PROPN
biotropia-173	62	6	was	be	AUX
biotropia-173	62	7	separated	separate	VERB
biotropia-173	62	8	in	in	ADP
biotropia-173	62	9	another	another	DET
biotropia-173	62	10	clade	clade	NOUN
biotropia-173	62	11	.	.	PUNCT
biotropia-173	63	1	this	this	DET
biotropia-173	63	2	work	work	NOUN
biotropia-173	63	3	also	also	ADV
biotropia-173	63	4	confirmed	confirm	VERB
biotropia-173	63	5	that	that	SCONJ
biotropia-173	63	6	m.	m.	NOUN
biotropia-173	63	7	araneosus	araneosus	PROPN
biotropia-173	63	8	af458471	af458471	PROPN
biotropia-173	63	9	and	and	CCONJ
biotropia-173	63	10	m.	m.	PROPN
biotropia-173	63	11	kaoliang	kaoliang	PROPN
biotropia-173	63	12	af451859	af451859	PROPN
biotropia-173	63	13	are	be	AUX
biotropia-173	63	14	the	the	DET
biotropia-173	63	15	same	same	ADJ
biotropia-173	63	16	species	specie	NOUN
biotropia-173	63	17	with	with	ADP
biotropia-173	63	18	m.	m.	NOUN
biotropia-173	63	19	purpureus	purpureus	NOUN
biotropia-173	63	20	.	.	PUNCT
biotropia-173	64	1	previously	previously	ADV
biotropia-173	64	2	,	,	PUNCT
biotropia-173	64	3	hawkswoth	hawkswoth	NOUN
biotropia-173	64	4	and	and	CCONJ
biotropia-173	64	5	pitt	pitt	PROPN
biotropia-173	64	6	(	(	PUNCT
biotropia-173	64	7	1983	1983	NUM
biotropia-173	64	8	)	)	PUNCT
biotropia-173	64	9	have	have	AUX
biotropia-173	64	10	included	include	VERB
biotropia-173	64	11	m.	m.	NOUN
biotropia-173	64	12	araneosus	araneosus	PROPN
biotropia-173	64	13	and	and	CCONJ
biotropia-173	64	14	m.	m.	PROPN
biotropia-173	64	15	kaoliang	kaoliang	PROPN
biotropia-173	64	16	as	as	ADP
biotropia-173	64	17	m.	m.	NOUN
biotropia-173	64	18	purpureus	purpureus	PROPN
biotropia-173	64	19	synonym	synonym	NOUN
biotropia-173	64	20	based	base	VERB
biotropia-173	64	21	on	on	ADP
biotropia-173	64	22	morphological	morphological	ADJ
biotropia-173	64	23	characteristics	characteristic	NOUN
biotropia-173	64	24	.	.	PUNCT
biotropia-173	65	1	it	it	PRON
biotropia-173	65	2	is	be	AUX
biotropia-173	65	3	also	also	ADV
biotropia-173	65	4	of	of	ADP
biotropia-173	65	5	interest	interest	NOUN
biotropia-173	65	6	to	to	PART
biotropia-173	65	7	note	note	VERB
biotropia-173	65	8	that	that	SCONJ
biotropia-173	65	9	m.	m.	NOUN
biotropia-173	65	10	purpureus	purpureus	NOUN
biotropia-173	65	11	srba	srba	NOUN
biotropia-173	65	12	has	have	VERB
biotropia-173	65	13	a	a	DET
biotropia-173	65	14	uniqueness	uniqueness	NOUN
biotropia-173	65	15	of	of	ADP
biotropia-173	65	16	its	its	PRON
biotropia-173	65	17	morphological	morphological	ADJ
biotropia-173	65	18	features	feature	NOUN
biotropia-173	65	19	such	such	ADJ
biotropia-173	65	20	as	as	ADP
biotropia-173	65	21	having	have	VERB
biotropia-173	65	22	bigger	big	ADJ
biotropia-173	65	23	ascomata	ascomata	NOUN
biotropia-173	65	24	(	(	PUNCT
biotropia-173	65	25	generally	generally	ADV
biotropia-173	65	26	90	90	NUM
biotropia-173	65	27	um	um	INTJ
biotropia-173	65	28	in	in	ADP
biotropia-173	65	29	diameter	diameter	NOUN
biotropia-173	65	30	)	)	PUNCT
biotropia-173	65	31	than	than	ADP
biotropia-173	65	32	"	"	PUNCT
biotropia-173	65	33	normal	normal	ADJ
biotropia-173	65	34	"	"	PUNCT
biotropia-173	65	35	m.	m.	NOUN
biotropia-173	65	36	purpureus	purpureus	NOUN
biotropia-173	65	37	.	.	PUNCT
biotropia-173	66	1	the	the	DET
biotropia-173	66	2	normal	normal	ADJ
biotropia-173	66	3	m.	m.	NOUN
biotropia-173	66	4	purpureus	purpureus	NOUN
biotropia-173	66	5	has	have	AUX
biotropia-173	66	6	ascomata	ascomata	VERB
biotropia-173	66	7	up	up	ADP
biotropia-173	66	8	to	to	PART
biotropia-173	66	9	70	70	NUM
biotropia-173	66	10	um	um	INTJ
biotropia-173	66	11	in	in	ADP
biotropia-173	66	12	diameter	diameter	NOUN
biotropia-173	66	13	.	.	PUNCT
biotropia-173	67	1	the	the	DET
biotropia-173	67	2	other	other	ADJ
biotropia-173	67	3	white	white	ADJ
biotropia-173	67	4	isolates	isolate	NOUN
biotropia-173	67	5	such	such	ADJ
biotropia-173	67	6	as	as	ADP
biotropia-173	67	7	monascus	monascus	NOUN
biotropia-173	67	8	sp	sp	NOUN
biotropia-173	67	9	.	.	PROPN
biotropia-173	67	10	mm	mm	PROPN
biotropia-173	67	11	,	,	PUNCT
biotropia-173	67	12	monascus	monascus	PROPN
biotropia-173	67	13	sp	sp	PROPN
biotropia-173	67	14	.	.	PROPN
biotropia-173	67	15	coel	coel	PROPN
biotropia-173	67	16	,	,	PUNCT
biotropia-173	67	17	monascus	monascus	NOUN
biotropia-173	67	18	sp	sp	PROPN
biotropia-173	67	19	.	.	PROPN
biotropia-173	67	20	ktb	ktb	PROPN
biotropia-173	67	21	,	,	PUNCT
biotropia-173	67	22	monascus	monascus	PROPN
biotropia-173	67	23	sp	sp	PROPN
biotropia-173	67	24	.	.	PROPN
biotropia-173	67	25	myom	myom	PROPN
biotropia-173	67	26	and	and	CCONJ
biotropia-173	67	27	monascus	monascus	ADJ
biotropia-173	67	28	sp	sp	NOUN
biotropia-173	67	29	.	.	PUNCT
biotropia-173	67	30	myot	myot	PROPN
biotropia-173	67	31	have	have	VERB
biotropia-173	67	32	different	different	ADJ
biotropia-173	67	33	morphological	morphological	ADJ
biotropia-173	67	34	characters	character	NOUN
biotropia-173	67	35	.	.	PUNCT
biotropia-173	68	1	these	these	DET
biotropia-173	68	2	white	white	ADJ
biotropia-173	68	3	isolates	isolate	NOUN
biotropia-173	68	4	at	at	ADP
biotropia-173	68	5	least	least	ADJ
biotropia-173	68	6	have	have	VERB
biotropia-173	68	7	two	two	NUM
biotropia-173	68	8	different	different	ADJ
biotropia-173	68	9	morphological	morphological	ADJ
biotropia-173	68	10	characters	character	NOUN
biotropia-173	68	11	compared	compare	VERB
biotropia-173	68	12	to	to	ADP
biotropia-173	68	13	m.	m.	NOUN
biotropia-173	68	14	ruber	ruber	PROPN
biotropia-173	68	15	such	such	ADJ
biotropia-173	68	16	as	as	ADP
biotropia-173	68	17	shorter	short	ADJ
biotropia-173	68	18	ascospores	ascospore	NOUN
biotropia-173	68	19	,	,	PUNCT
biotropia-173	68	20	cleisthothecium	cleisthothecium	NOUN
biotropia-173	68	21	wall	wall	NOUN
biotropia-173	68	22	transparent	transparent	ADJ
biotropia-173	68	23	.	.	PUNCT
biotropia-173	69	1	moreover	moreover	ADV
biotropia-173	69	2	,	,	PUNCT
biotropia-173	69	3	monascus	monascus	PROPN
biotropia-173	69	4	sp	sp	PROPN
biotropia-173	69	5	.	.	PROPN
biotropia-173	69	6	myom	myom	PROPN
biotropia-173	69	7	and	and	CCONJ
biotropia-173	69	8	monascus	monascus	ADJ
biotropia-173	69	9	sp	sp	PROPN
biotropia-173	69	10	.	.	PUNCT
biotropia-173	69	11	myot	myot	PROPN
biotropia-173	69	12	have	have	VERB
biotropia-173	69	13	fusiform	fusiform	NOUN
biotropia-173	69	14	aleurispores	aleurispore	NOUN
biotropia-173	69	15	,	,	PUNCT
biotropia-173	69	16	while	while	SCONJ
biotropia-173	69	17	m.	m.	NOUN
biotropia-173	69	18	ruber	ruber	PROPN
biotropia-173	69	19	has	have	VERB
biotropia-173	69	20	no	no	PRON
biotropia-173	69	21	this	this	DET
biotropia-173	69	22	spore	spore	ADJ
biotropia-173	69	23	form(suharna	form(suharna	NOUN
biotropia-173	69	24	1999	1999	NUM
biotropia-173	69	25	)	)	PUNCT
biotropia-173	69	26	.	.	PUNCT
biotropia-173	70	1	besides	besides	SCONJ
biotropia-173	70	2	d1	d1	NOUN
biotropia-173	70	3	/	/	SYM
biotropia-173	70	4	d2	d2	NOUN
biotropia-173	70	5	regions	region	NOUN
biotropia-173	70	6	of	of	ADP
biotropia-173	70	7	lsu	lsu	NOUN
biotropia-173	70	8	rrna	rrna	NOUN
biotropia-173	70	9	genes	gene	NOUN
biotropia-173	70	10	,	,	PUNCT
biotropia-173	70	11	phylogenetic	phylogenetic	ADJ
biotropia-173	70	12	analysis	analysis	NOUN
biotropia-173	70	13	on	on	ADP
biotropia-173	70	14	its	its	PRON
biotropia-173	70	15	region	region	NOUN
biotropia-173	70	16	was	be	AUX
biotropia-173	70	17	also	also	ADV
biotropia-173	70	18	made	make	VERB
biotropia-173	70	19	by	by	ADP
biotropia-173	70	20	park	park	NOUN
biotropia-173	70	21	and	and	CCONJ
biotropia-173	70	22	jong	jong	PROPN
biotropia-173	70	23	(	(	PUNCT
biotropia-173	70	24	2003	2003	NUM
biotropia-173	70	25	)	)	PUNCT
biotropia-173	70	26	to	to	PART
biotropia-173	70	27	know	know	VERB
biotropia-173	70	28	the	the	DET
biotropia-173	70	29	relationship	relationship	NOUN
biotropia-173	70	30	among	among	ADP
biotropia-173	70	31	monascus	monascus	NOUN
biotropia-173	70	32	strains	strain	NOUN
biotropia-173	70	33	accessed	access	VERB
biotropia-173	70	34	from	from	ADP
biotropia-173	70	35	genebank	genebank	NOUN
biotropia-173	70	36	.	.	PUNCT
biotropia-173	71	1	the	the	DET
biotropia-173	71	2	phylogenetic	phylogenetic	ADJ
biotropia-173	71	3	tree	tree	NOUN
biotropia-173	71	4	constructed	construct	VERB
biotropia-173	71	5	showed	show	VERB
biotropia-173	71	6	similar	similar	ADJ
biotropia-173	71	7	result	result	NOUN
biotropia-173	71	8	with	with	ADP
biotropia-173	71	9	our	our	PRON
biotropia-173	71	10	analysis	analysis	NOUN
biotropia-173	71	11	on	on	ADP
biotropia-173	71	12	its	its	PRON
biotropia-173	71	13	sequence	sequence	NOUN
biotropia-173	71	14	of	of	ADP
biotropia-173	71	15	monascus	monascus	NOUN
biotropia-173	71	16	where	where	SCONJ
biotropia-173	71	17	m.	m.	NOUN
biotropia-173	71	18	ruber	ruber	NOUN
biotropia-173	71	19	and	and	CCONJ
biotropia-173	71	20	m.	m.	NOUN
biotropia-173	71	21	pilosus	pilosus	PROPN
biotropia-173	71	22	were	be	AUX
biotropia-173	71	23	very	very	ADV
biotropia-173	71	24	closely	closely	ADV
biotropia-173	71	25	related	relate	VERB
biotropia-173	71	26	and	and	CCONJ
biotropia-173	71	27	all	all	DET
biotropia-173	71	28	m.	m.	NOUN
biotropia-173	71	29	purpureus	purpureus	NOUN
biotropia-173	71	30	strains	strain	NOUN
biotropia-173	71	31	were	be	AUX
biotropia-173	71	32	included	include	VERB
biotropia-173	71	33	together	together	ADV
biotropia-173	71	34	in	in	ADP
biotropia-173	71	35	the	the	DET
biotropia-173	71	36	same	same	ADJ
biotropia-173	71	37	clade	clade	NOUN
biotropia-173	71	38	.	.	PUNCT
biotropia-173	72	1	though	though	SCONJ
biotropia-173	72	2	it	it	PRON
biotropia-173	72	3	is	be	AUX
biotropia-173	72	4	still	still	ADV
biotropia-173	72	5	suggested	suggest	VERB
biotropia-173	72	6	that	that	SCONJ
biotropia-173	72	7	the	the	DET
biotropia-173	72	8	two	two	NUM
biotropia-173	72	9	clades	clade	NOUN
biotropia-173	72	10	were	be	AUX
biotropia-173	72	11	very	very	ADV
biotropia-173	72	12	closely	closely	ADV
biotropia-173	72	13	related	relate	VERB
biotropia-173	72	14	,	,	PUNCT
biotropia-173	72	15	interestingly	interestingly	ADV
biotropia-173	72	16	,	,	PUNCT
biotropia-173	72	17	all	all	DET
biotropia-173	72	18	indonesian	indonesian	ADJ
biotropia-173	72	19	m.	m.	NOUN
biotropia-173	72	20	ruber	ruber	PROPN
biotropia-173	72	21	strains	strain	NOUN
biotropia-173	72	22	were	be	AUX
biotropia-173	72	23	in	in	ADP
biotropia-173	72	24	the	the	DET
biotropia-173	72	25	same	same	ADJ
biotropia-173	72	26	clade	clade	NOUN
biotropia-173	72	27	with	with	ADP
biotropia-173	72	28	m.	m.	NOUN
biotropia-173	72	29	pilosus	pilosus	PROPN
biotropia-173	72	30	af451856	af451856	PROPN
biotropia-173	72	31	.	.	PUNCT
biotropia-173	73	1	while	while	SCONJ
biotropia-173	73	2	m.	m.	NOUN
biotropia-173	73	3	ruber	ruber	NOUN
biotropia-173	73	4	with	with	ADP
biotropia-173	73	5	accession	accession	NOUN
biotropia-173	73	6	number	number	NOUN
biotropia-173	73	7	af458470	af458470	PROPN
biotropia-173	73	8	retrieved	retrieve	VERB
biotropia-173	73	9	from	from	ADP
biotropia-173	73	10	ddbj	ddbj	PROPN
biotropia-173	73	11	was	be	AUX
biotropia-173	73	12	separated	separate	VERB
biotropia-173	73	13	in	in	ADP
biotropia-173	73	14	another	another	DET
biotropia-173	73	15	clade	clade	NOUN
biotropia-173	73	16	.	.	PUNCT
biotropia-173	74	1	this	this	PRON
biotropia-173	74	2	indicated	indicate	VERB
biotropia-173	74	3	that	that	SCONJ
biotropia-173	74	4	three	three	NUM
biotropia-173	74	5	m.	m.	NOUN
biotropia-173	74	6	ruber	ruber	ADJ
biotropia-173	74	7	isolates	isolate	NOUN
biotropia-173	74	8	and	and	CCONJ
biotropia-173	74	9	six	six	NUM
biotropia-173	74	10	white	white	ADJ
biotropia-173	74	11	monascus	monascus	NOUN
biotropia-173	74	12	isolates	isolate	NOUN
biotropia-173	74	13	showed	show	VERB
biotropia-173	74	14	little	little	ADJ
biotropia-173	74	15	difference	difference	NOUN
biotropia-173	74	16	from	from	ADP
biotropia-173	74	17	m.	m.	NOUN
biotropia-173	74	18	ruber	ruber	PROPN
biotropia-173	74	19	af458470	af458470	PROPN
biotropia-173	74	20	,	,	PUNCT
biotropia-173	74	21	but	but	CCONJ
biotropia-173	74	22	identical	identical	ADJ
biotropia-173	74	23	to	to	AUX
biotropia-173	74	24	m.	m.	PROPN
biotropia-173	74	25	pilosus	pilosus	PROPN
biotropia-173	74	26	af451856	af451856	PROPN
biotropia-173	74	27	except	except	SCONJ
biotropia-173	74	28	for	for	ADP
biotropia-173	74	29	monascus	monascus	NOUN
biotropia-173	74	30	sp	sp	NOUN
biotropia-173	74	31	.	.	PUNCT
biotropia-173	75	1	ka30.1	ka30.1	PROPN
biotropia-173	75	2	and	and	CCONJ
biotropia-173	75	3	m.	m.	NOUN
biotropia-173	75	4	ruber	ruber	ADJ
biotropia-173	75	5	cka3	cka3	NOUN
biotropia-173	75	6	with	with	ADP
biotropia-173	75	7	genetically	genetically	ADV
biotropia-173	75	8	little	little	ADJ
biotropia-173	75	9	difference	difference	NOUN
biotropia-173	75	10	.	.	PUNCT
biotropia-173	76	1	however	however	ADV
biotropia-173	76	2	,	,	PUNCT
biotropia-173	76	3	despite	despite	SCONJ
biotropia-173	76	4	of	of	ADP
biotropia-173	76	5	this	this	DET
biotropia-173	76	6	finding	finding	NOUN
biotropia-173	76	7	,	,	PUNCT
biotropia-173	76	8	it	it	PRON
biotropia-173	76	9	is	be	AUX
biotropia-173	76	10	still	still	ADV
biotropia-173	76	11	much	much	ADV
biotropia-173	76	12	surprising	surprising	ADJ
biotropia-173	76	13	in	in	ADP
biotropia-173	76	14	regard	regard	NOUN
biotropia-173	76	15	with	with	ADP
biotropia-173	76	16	the	the	DET
biotropia-173	76	17	outstanding	outstanding	ADJ
biotropia-173	76	18	morphological	morphological	ADJ
biotropia-173	76	19	differences	difference	NOUN
biotropia-173	76	20	of	of	ADP
biotropia-173	76	21	several	several	ADJ
biotropia-173	76	22	strains	strain	NOUN
biotropia-173	76	23	as	as	SCONJ
biotropia-173	76	24	mainly	mainly	ADV
biotropia-173	76	25	possessed	possess	VERB
biotropia-173	76	26	by	by	ADP
biotropia-173	76	27	whitish	whitish	ADJ
biotropia-173	76	28	strains	strain	NOUN
biotropia-173	76	29	such	such	ADJ
biotropia-173	76	30	as	as	ADP
biotropia-173	76	31	monascus	monascus	NOUN
biotropia-173	76	32	sp	sp	NOUN
biotropia-173	76	33	.	.	PUNCT
biotropia-173	77	1	ka30.1	ka30.1	PROPN
biotropia-173	77	2	,	,	PUNCT
biotropia-173	77	3	monascus	monascus	NOUN
biotropia-173	77	4	sp	sp	PROPN
biotropia-173	77	5	.	.	PROPN
biotropia-173	77	6	myom	myom	PROPN
biotropia-173	77	7	,	,	PUNCT
biotropia-173	77	8	monascus	monascus	PROPN
biotropia-173	77	9	sp	sp	PROPN
biotropia-173	77	10	.	.	PROPN
biotropia-173	77	11	ktb	ktb	PROPN
biotropia-173	77	12	,	,	PUNCT
biotropia-173	77	13	monascus	monascus	PROPN
biotropia-173	77	14	sp	sp	PROPN
biotropia-173	77	15	.	.	PUNCT
biotropia-173	77	16	myot	myot	ADJ
biotropia-173	77	17	,	,	PUNCT
biotropia-173	77	18	monascus	monascus	ADJ
biotropia-173	77	19	sp	sp	NOUN
biotropia-173	77	20	.	.	PROPN
biotropia-173	77	21	mm	mm	PROPN
biotropia-173	77	22	,	,	PUNCT
biotropia-173	77	23	monascus	monascus	PROPN
biotropia-173	77	24	sp	sp	PROPN
biotropia-173	77	25	.	.	PUNCT
biotropia-173	77	26	coel	coel	PROPN
biotropia-173	77	27	.	.	PUNCT
biotropia-173	78	1	park	park	NOUN
biotropia-173	78	2	and	and	CCONJ
biotropia-173	78	3	jong	jong	PROPN
biotropia-173	78	4	(	(	PUNCT
biotropia-173	78	5	2003	2003	NUM
biotropia-173	78	6	)	)	PUNCT
biotropia-173	78	7	also	also	ADV
biotropia-173	78	8	reported	report	VERB
biotropia-173	78	9	similar	similar	ADJ
biotropia-173	78	10	result	result	NOUN
biotropia-173	78	11	as	as	ADP
biotropia-173	78	12	their	their	PRON
biotropia-173	78	13	comparison	comparison	NOUN
biotropia-173	78	14	of	of	ADP
biotropia-173	78	15	two	two	NUM
biotropia-173	78	16	very	very	ADV
biotropia-173	78	17	distinct	distinct	ADJ
biotropia-173	78	18	species	specie	NOUN
biotropia-173	78	19	based	base	VERB
biotropia-173	78	20	on	on	ADP
biotropia-173	78	21	morphological	morphological	ADJ
biotropia-173	78	22	observation	observation	NOUN
biotropia-173	78	23	such	such	ADJ
biotropia-173	78	24	as	as	ADP
biotropia-173	78	25	m.	m.	NOUN
biotropia-173	78	26	ruber	ruber	NOUN
biotropia-173	78	27	and	and	CCONJ
biotropia-173	78	28	m.	m.	NOUN
biotropia-173	78	29	pilosus	pilosus	PROPN
biotropia-173	78	30	.	.	PUNCT
biotropia-173	79	1	therefore	therefore	ADV
biotropia-173	79	2	,	,	PUNCT
biotropia-173	79	3	we	we	PRON
biotropia-173	79	4	are	be	AUX
biotropia-173	79	5	in	in	ADP
biotropia-173	79	6	concordance	concordance	NOUN
biotropia-173	79	7	with	with	ADP
biotropia-173	79	8	park	park	NOUN
biotropia-173	79	9	and	and	CCONJ
biotropia-173	79	10	jo	jo	PROPN
biotropia-173	79	11	(	(	PUNCT
biotropia-173	79	12	2003	2003	NUM
biotropia-173	79	13	)	)	PUNCT
biotropia-173	79	14	that	that	SCONJ
biotropia-173	79	15	it	it	PRON
biotropia-173	79	16	is	be	AUX
biotropia-173	79	17	needed	need	VERB
biotropia-173	79	18	to	to	PART
biotropia-173	79	19	reveal	reveal	VERB
biotropia-173	79	20	in	in	ADP
biotropia-173	79	21	more	more	ADJ
biotropia-173	79	22	details	detail	NOUN
biotropia-173	79	23	about	about	ADP
biotropia-173	79	24	molecular	molecular	ADJ
biotropia-173	79	25	phytogeny	phytogeny	NOUN
biotropia-173	79	26	to	to	PART
biotropia-173	79	27	elucidate	elucidate	VERB
biotropia-173	79	28	molecular	molecular	ADJ
biotropia-173	79	29	taxonomy	taxonomy	NOUN
biotropia-173	79	30	included	include	VERB
biotropia-173	79	31	in	in	ADP
biotropia-173	79	32	the	the	DET
biotropia-173	79	33	identification	identification	NOUN
biotropia-173	79	34	of	of	ADP
biotropia-173	79	35	monascus	monascus	NOUN
biotropia-173	79	36	species	specie	NOUN
biotropia-173	79	37	.	.	PUNCT
biotropia-173	80	1	67	67	NUM
biotropia-173	80	2	molecular	molecular	ADJ
biotropia-173	80	3	phylogenctic	phylogenctic	ADJ
biotropia-173	80	4	analysis	analysis	NOUN
biotropia-173	80	5	of	of	ADP
biotropia-173	80	6	monascus	monascus	ADJ
biotropia-173	80	7	fungi	fungus	NOUN
biotropia-173	80	8	—	—	PUNCT
biotropia-173	80	9	n.	n.	PROPN
biotropia-173	80	10	suharna	suharna	PROPN
biotropia-173	80	11	et	et	PROPN
biotropia-173	80	12	al	al	PROPN
biotropia-173	80	13	.	.	PUNCT
biotropia-173	81	1	acknowledgments	acknowledgment	NOUN
biotropia-173	81	2	this	this	DET
biotropia-173	81	3	research	research	NOUN
biotropia-173	81	4	was	be	AUX
biotropia-173	81	5	funded	fund	VERB
biotropia-173	81	6	by	by	ADP
biotropia-173	81	7	the	the	DET
biotropia-173	81	8	general	general	PROPN
biotropia-173	81	9	exchange	exchange	PROPN
biotropia-173	81	10	program	program	NOUN
biotropia-173	81	11	,	,	PUNCT
biotropia-173	81	12	japan	japan	PROPN
biotropia-173	81	13	societ	societ	PROPN
biotropia-173	81	14	the	the	DET
biotropia-173	81	15	promotion	promotion	NOUN
biotropia-173	81	16	of	of	ADP
biotropia-173	81	17	science	science	NOUN
biotropia-173	81	18	and	and	CCONJ
biotropia-173	81	19	conducted	conduct	VERB
biotropia-173	81	20	in	in	ADP
biotropia-173	81	21	early	early	ADJ
biotropia-173	81	22	2004	2004	NUM
biotropia-173	81	23	at	at	ADP
biotropia-173	81	24	the	the	DET
biotropia-173	81	25	national	national	ADJ
biotropia-173	81	26	institu	institu	ADJ
biotropia-173	81	27	biological	biological	ADJ
biotropia-173	81	28	functions	function	NOUN
biotropia-173	81	29	and	and	CCONJ
biotropia-173	81	30	resources	resource	NOUN
biotropia-173	81	31	,	,	PUNCT
biotropia-173	81	32	advanced	advanced	ADJ
biotropia-173	81	33	industrial	industrial	ADJ
biotropia-173	81	34	science	science	NOUN
biotropia-173	81	35	and	and	CCONJ
biotropia-173	81	36	techno	techno	NOUN
biotropia-173	81	37	(	(	PUNCT
biotropia-173	81	38	aist	aist	PROPN
biotropia-173	81	39	)	)	PUNCT
biotropia-173	81	40	,	,	PUNCT
biotropia-173	81	41	tsukuba	tsukuba	PROPN
biotropia-173	81	42	305	305	NUM
biotropia-173	81	43	-	-	SYM
biotropia-173	81	44	8566	8566	NUM
biotropia-173	81	45	,	,	PUNCT
biotropia-173	81	46	japan	japan	PROPN
biotropia-173	81	47	.	.	PUNCT
biotropia-173	82	1	references	reference	NOUN
biotropia-173	82	2	cannon	cannon	NOUN
biotropia-173	82	3	,	,	PUNCT
biotropia-173	82	4	p.p	p.p	PROPN
biotropia-173	82	5	.	.	PROPN
biotropia-173	82	6	,	,	PUNCT
biotropia-173	82	7	s.k	s.k	PROPN
biotropia-173	82	8	.	.	PROPN
biotropia-173	82	9	abdullah	abdullah	PROPN
biotropia-173	82	10	and	and	CCONJ
biotropia-173	82	11	b.a	b.a	PROPN
biotropia-173	82	12	.	.	PROPN
biotropia-173	82	13	abbas	abbas	PROPN
biotropia-173	82	14	.	.	PUNCT
biotropia-173	83	1	1995	1995	NUM
biotropia-173	83	2	.	.	PUNCT
biotropia-173	84	1	two	two	NUM
biotropia-173	84	2	new	new	ADJ
biotropia-173	84	3	species	specie	NOUN
biotropia-173	84	4	of	of	ADP
biotropia-173	84	5	monascus	monascus	NOUN
biotropia-173	84	6	from	from	ADP
biotropia-173	84	7	iraq	iraq	PROPN
biotropia-173	84	8	,	,	PUNCT
biotropia-173	84	9	\	\	PROPN
biotropia-173	84	10	key	key	NOUN
biotropia-173	84	11	to	to	ADP
biotropia-173	84	12	known	know	VERB
biotropia-173	84	13	species	specie	NOUN
biotropia-173	84	14	of	of	ADP
biotropia-173	84	15	the	the	DET
biotropia-173	84	16	genus	genus	NOUN
biotropia-173	84	17	.	.	PUNCT
biotropia-173	85	1	mycol	mycol	PROPN
biotropia-173	85	2	.	.	PUNCT
biotropia-173	86	1	res	re	NOUN
biotropia-173	86	2	.	.	PUNCT
biotropia-173	87	1	99	99	NUM
biotropia-173	87	2	:	:	PUNCT
biotropia-173	87	3	659	659	NUM
biotropia-173	87	4	-	-	SYM
biotropia-173	87	5	662	662	NUM
biotropia-173	87	6	fclsenstcin	fclsenstcin	NOUN
biotropia-173	87	7	,	,	PUNCT
biotropia-173	87	8	j.	j.	PROPN
biotropia-173	87	9	1981	1981	NUM
biotropia-173	87	10	.	.	PUNCT
biotropia-173	88	1	evolutionary	evolutionary	ADJ
biotropia-173	88	2	trees	tree	NOUN
biotropia-173	88	3	from	from	ADP
biotropia-173	88	4	dna	dna	PROPN
biotropia-173	88	5	sequences	sequence	NOUN
biotropia-173	88	6	:	:	PUNCT
biotropia-173	88	7	a	a	DET
biotropia-173	88	8	maximum	maximum	ADJ
biotropia-173	88	9	likchood	likchood	NOUN
biotropia-173	88	10	approach	approach	NOUN
biotropia-173	88	11	.	.	PUNCT
biotropia-173	89	1	j.	j.	PROPN
biotropia-173	89	2	evol	evol	PROPN
biotropia-173	89	3	17	17	NUM
biotropia-173	89	4	:	:	PUNCT
biotropia-173	89	5	368	368	NUM
biotropia-173	89	6	-	-	SYM
biotropia-173	89	7	376	376	NUM
biotropia-173	89	8	hawskworth	hawskworth	NOUN
biotropia-173	89	9	,	,	PUNCT
biotropia-173	89	10	d.l	d.l	PROPN
biotropia-173	89	11	.	.	PROPN
biotropia-173	89	12	&	&	CCONJ
biotropia-173	89	13	j.i	j.i	PROPN
biotropia-173	89	14	.	.	PROPN
biotropia-173	89	15	pitt	pitt	PROPN
biotropia-173	89	16	.	.	PUNCT
biotropia-173	89	17	1983	1983	NUM
biotropia-173	89	18	.	.	PUNCT
biotropia-173	90	1	a	a	DET
biotropia-173	90	2	new	new	ADJ
biotropia-173	90	3	taxonomy	taxonomy	NOUN
biotropia-173	90	4	for	for	ADP
biotropia-173	90	5	monascus	monascus	NOUN
biotropia-173	90	6	based	base	VERB
biotropia-173	90	7	on	on	ADP
biotropia-173	90	8	cultural	cultural	ADJ
biotropia-173	90	9	and	and	CCONJ
biotropia-173	90	10	micros	micro	NOUN
biotropia-173	90	11	characters	character	NOUN
biotropia-173	90	12	.	.	PUNCT
biotropia-173	91	1	aust	aust	PROPN
biotropia-173	91	2	.	.	PUNCT
biotropia-173	92	1	j.	j.	PROPN
biotropia-173	92	2	bot	bot	PROPN
biotropia-173	92	3	.	.	PUNCT
biotropia-173	93	1	31	31	NUM
biotropia-173	93	2	:	:	PUNCT
biotropia-173	93	3	51	51	NUM
biotropia-173	93	4	-	-	SYM
biotropia-173	93	5	61	61	NUM
biotropia-173	93	6	lakrodi	lakrodi	NOUN
biotropia-173	93	7	,	,	PUNCT
biotropia-173	93	8	k.	k.	PROPN
biotropia-173	93	9	,	,	PUNCT
biotropia-173	93	10	c.	c.	PROPN
biotropia-173	93	11	chaisrisook	chaisrisook	PROPN
biotropia-173	93	12	,	,	PUNCT
biotropia-173	93	13	b.	b.	PROPN
biotropia-173	93	14	yongsmith	yongsmith	PROPN
biotropia-173	93	15	and	and	CCONJ
biotropia-173	93	16	d.z	d.z	PROPN
biotropia-173	93	17	.	.	PROPN
biotropia-173	93	18	skinner	skinner	PROPN
biotropia-173	93	19	.	.	PUNCT
biotropia-173	93	20	2000	2000	NUM
biotropia-173	93	21	.	.	PUNCT
biotropia-173	94	1	rapd	rapd	VERB
biotropia-173	94	2	analysis	analysis	NOUN
biotropia-173	94	3	of	of	ADP
biotropia-173	94	4	genetic	genetic	ADJ
biotropia-173	94	5	vari	vari	NOUN
biotropia-173	94	6	within	within	ADP
biotropia-173	94	7	a	a	DET
biotropia-173	94	8	collection	collection	NOUN
biotropia-173	94	9	of	of	ADP
biotropia-173	94	10	monascus	monascus	PROPN
biotropia-173	94	11	spp	spp	PROPN
biotropia-173	94	12	.	.	PUNCT
biotropia-173	95	1	isolated	isolate	VERB
biotropia-173	95	2	from	from	ADP
biotropia-173	95	3	red	red	ADJ
biotropia-173	95	4	rice	rice	NOUN
biotropia-173	95	5	(	(	PUNCT
biotropia-173	95	6	ang	ang	PROPN
biotropia-173	95	7	-	-	PUNCT
biotropia-173	95	8	kak	kak	PROPN
biotropia-173	95	9	)	)	PUNCT
biotropia-173	95	10	and	and	CCONJ
biotropia-173	95	11	sofu	sofu	PROPN
biotropia-173	95	12	.	.	PUNCT
biotropia-173	96	1	mycol	mycol	PROPN
biotropia-173	96	2	.	.	PUNCT
biotropia-173	97	1	res	re	NOUN
biotropia-173	97	2	(	(	PUNCT
biotropia-173	97	3	4	4	NUM
biotropia-173	97	4	):	):	PUNCT
biotropia-173	97	5	403	403	NUM
biotropia-173	97	6	-	-	SYM
biotropia-173	97	7	408	408	NUM
biotropia-173	97	8	park	park	NOUN
biotropia-173	97	9	,	,	PUNCT
biotropia-173	97	10	hg	hg	PROPN
biotropia-173	97	11	.	.	PROPN
biotropia-173	97	12	,	,	PUNCT
biotropia-173	97	13	jong	jong	PROPN
biotropia-173	97	14	,	,	PUNCT
biotropia-173	97	15	s	s	PROPN
biotropia-173	97	16	-	-	PROPN
biotropia-173	97	17	c.	c.	NOUN
biotropia-173	97	18	2003	2003	NUM
biotropia-173	97	19	.	.	PUNCT
biotropia-173	98	1	molecular	molecular	ADJ
biotropia-173	98	2	characterization	characterization	NOUN
biotropia-173	98	3	of	of	ADP
biotropia-173	98	4	monascus	monascus	NOUN
biotropia-173	98	5	strains	strain	NOUN
biotropia-173	98	6	based	base	VERB
biotropia-173	98	7	on	on	ADP
biotropia-173	98	8	the	the	DET
biotropia-173	98	9	d1	d1	PROPN
biotropia-173	98	10	/	/	SYM
biotropia-173	98	11	d2	d2	PROPN
biotropia-173	98	12	re	re	X
biotropia-173	98	13	of	of	ADP
biotropia-173	98	14	lsu	lsu	NOUN
biotropia-173	98	15	rrna	rrna	NOUN
biotropia-173	98	16	genes	gene	NOUN
biotropia-173	98	17	.	.	PUNCT
biotropia-173	99	1	mycoscicnce	mycoscicnce	NOUN
biotropia-173	99	2	44	44	NUM
biotropia-173	99	3	:	:	PUNCT
biotropia-173	99	4	25	25	NUM
biotropia-173	99	5	-	-	SYM
biotropia-173	99	6	32	32	NUM
biotropia-173	99	7	thompson	thompson	PROPN
biotropia-173	99	8	,	,	PUNCT
biotropia-173	99	9	j.d	j.d	PROPN
biotropia-173	99	10	.	.	PROPN
biotropia-173	99	11	,	,	PUNCT
biotropia-173	99	12	d.g	d.g	PROPN
biotropia-173	99	13	.	.	PROPN
biotropia-173	99	14	higgins	higgins	PROPN
biotropia-173	99	15	,	,	PUNCT
biotropia-173	99	16	and	and	CCONJ
biotropia-173	99	17	j.j	j.j	PROPN
biotropia-173	99	18	.	.	PROPN
biotropia-173	99	19	gibson	gibson	PROPN
biotropia-173	99	20	.	.	PUNCT
biotropia-173	99	21	1994	1994	NUM
biotropia-173	99	22	.	.	PUNCT
biotropia-173	100	1	clustal	clustal	PROPN
biotropia-173	100	2	w	w	NOUN
biotropia-173	100	3	:	:	PUNCT
biotropia-173	100	4	improving	improve	VERB
biotropia-173	100	5	the	the	DET
biotropia-173	100	6	sensitivity	sensitivity	NOUN
biotropia-173	100	7	of	of	ADP
biotropia-173	100	8	progrc	progrc	NOUN
biotropia-173	100	9	multiple	multiple	ADJ
biotropia-173	100	10	alignment	alignment	NOUN
biotropia-173	100	11	through	through	ADP
biotropia-173	100	12	sequence	sequence	NOUN
biotropia-173	100	13	weighting	weighting	NOUN
biotropia-173	100	14	,	,	PUNCT
biotropia-173	100	15	position	position	NOUN
biotropia-173	100	16	-	-	PUNCT
biotropia-173	100	17	specific	specific	ADJ
biotropia-173	100	18	gap	gap	NOUN
biotropia-173	100	19	penalties	penalty	NOUN
biotropia-173	100	20	and	and	CCONJ
biotropia-173	100	21	weight	weight	NOUN
biotropia-173	100	22	it	it	PRON
biotropia-173	100	23	choice	choice	ADV
biotropia-173	100	24	.	.	PUNCT
biotropia-173	101	1	nucleic	nucleic	ADJ
biotropia-173	101	2	acids	acid	NOUN
biotropia-173	101	3	res	re	NOUN
biotropia-173	101	4	.	.	PUNCT
biotropia-173	102	1	22:4673	22:4673	X
biotropia-173	102	2	-	-	PUNCT
biotropia-173	102	3	4680	4680	NUM
biotropia-173	102	4	white	white	NOUN
biotropia-173	102	5	,	,	PUNCT
biotropia-173	102	6	t.	t.	PROPN
biotropia-173	102	7	j.	j.	PROPN
biotropia-173	102	8	,	,	PUNCT
biotropia-173	102	9	t.	t.	PROPN
biotropia-173	102	10	bruns	bruns	PROPN
biotropia-173	102	11	,	,	PUNCT
biotropia-173	102	12	s.	s.	PROPN
biotropia-173	102	13	lee	lee	PROPN
biotropia-173	102	14	,	,	PUNCT
biotropia-173	102	15	and	and	CCONJ
biotropia-173	102	16	j.	j.	PROPN
biotropia-173	102	17	w.	w.	PROPN
biotropia-173	102	18	taylor	taylor	PROPN
biotropia-173	102	19	.	.	PROPN
biotropia-173	103	1	1990	1990	NUM
biotropia-173	103	2	.	.	PUNCT
biotropia-173	104	1	amplification	amplification	NOUN
biotropia-173	104	2	and	and	CCONJ
biotropia-173	104	3	direct	direct	ADJ
biotropia-173	104	4	sequencing	sequencing	NOUN
biotropia-173	104	5	of	of	ADP
biotropia-173	104	6	fi	fi	NOUN
biotropia-173	104	7	ribosomal	ribosomal	NOUN
biotropia-173	104	8	rna	rna	NOUN
biotropia-173	104	9	genes	gene	NOUN
biotropia-173	104	10	for	for	ADP
biotropia-173	104	11	phylogcnctics	phylogcnctic	NOUN
biotropia-173	104	12	.	.	PUNCT
biotropia-173	105	1	pp	pp	ADJ
biotropia-173	105	2	.	.	PUNCT
biotropia-173	106	1	315	315	NUM
biotropia-173	106	2	-	-	SYM
biotropia-173	106	3	322	322	NUM
biotropia-173	106	4	in	in	ADP
biotropia-173	106	5	:	:	PUNCT
biotropia-173	106	6	pcr	pcr	ADJ
biotropia-173	106	7	protocols	protocol	NOUN
biotropia-173	106	8	:	:	PUNCT
biotropia-173	106	9	a	a	DET
biotropia-173	106	10	guide	guide	NOUN
biotropia-173	106	11	to	to	PART
biotropia-173	106	12	method	method	VERB
biotropia-173	106	13	:	:	PUNCT
biotropia-173	106	14	applications	application	NOUN
biotropia-173	106	15	,	,	PUNCT
biotropia-173	106	16	eds	eds	PROPN
biotropia-173	106	17	.	.	PUNCT
biotropia-173	106	18	innis	innis	PROPN
biotropia-173	106	19	,	,	PUNCT
biotropia-173	106	20	m.	m.	NOUN
biotropia-173	106	21	a.	a.	PROPN
biotropia-173	106	22	,	,	PUNCT
biotropia-173	106	23	d.	d.	PROPN
biotropia-173	106	24	h.	h.	PROPN
biotropia-173	106	25	gelfand	gelfand	PROPN
biotropia-173	106	26	,	,	PUNCT
biotropia-173	106	27	j.	j.	PROPN
biotropia-173	106	28	j.	j.	PROPN
biotropia-173	106	29	sninsky	sninsky	PROPN
biotropia-173	106	30	,	,	PUNCT
biotropia-173	106	31	and	and	CCONJ
biotropia-173	106	32	t.	t.	PROPN
biotropia-173	106	33	j.	j.	PROPN
biotropia-173	106	34	white	white	PROPN
biotropia-173	106	35	.	.	PUNCT
biotropia-173	107	1	academic	academic	ADJ
biotropia-173	107	2	press	press	NOUN
biotropia-173	107	3	,	,	PUNCT
biotropia-173	107	4	new	new	PROPN
biotropia-173	107	5	york	york	PROPN
biotropia-173	107	6	.	.	PUNCT
biotropia-173	108	1	suharna	suharna	PROPN
biotropia-173	108	2	,	,	PUNCT
biotropia-173	108	3	n.	n.	PROPN
biotropia-173	108	4	1999	1999	NUM
biotropia-173	108	5	.	.	PUNCT
biotropia-173	109	1	a	a	DET
biotropia-173	109	2	study	study	NOUN
biotropia-173	109	3	on	on	ADP
biotropia-173	109	4	the	the	DET
biotropia-173	109	5	fungal	fungal	ADJ
biotropia-173	109	6	occurrences	occurrence	NOUN
biotropia-173	109	7	in	in	ADP
biotropia-173	109	8	several	several	ADJ
biotropia-173	109	9	animal	animal	NOUN
biotropia-173	109	10	specimens	specimen	NOUN
biotropia-173	109	11	preserved	preserve	VERB
biotropia-173	109	12	in	in	ADP
biotropia-173	109	13	alcohc	alcohc	NOUN
biotropia-173	109	14	gakuryoku	gakuryoku	NOUN
biotropia-173	109	15	5	5	NUM
biotropia-173	109	16	(	(	PUNCT
biotropia-173	109	17	3	3	NUM
biotropia-173	109	18	):	):	PUNCT
biotropia-173	109	19	139	139	NUM
biotropia-173	109	20	-	-	SYM
biotropia-173	109	21	144	144	NUM
biotropia-173	109	22	68	68	NUM
biotropia-173	109	23	62.pdf	62.pdf	PROPN
biotropia-173	109	24	63.pdf	63.pdf	PROPN
biotropia-173	109	25	64.pdf	64.pdf	PROPN
biotropia-173	109	26	65.pdf	65.pdf	PROPN
biotropia-173	109	27	66.pdf	66.pdf	PROPN
biotropia-173	109	28	67.pdf	67.pdf	PROPN
biotropia-173	109	29	68.pdf	68.pdf	PROPN