id	sid	tid	token	lemma	pos
biotropia-2457	1	1	the	the	DET
biotropia-2457	1	2	southeast	southeast	ADJ
biotropia-2457	1	3	asian	asian	ADJ
biotropia-2457	1	4	journal	journal	NOUN
biotropia-2457	1	5	of	of	ADP
biotropia-2457	1	6	tropical	tropical	ADJ
biotropia-2457	1	7	biology	biology	NOUN
biotropia-2457	1	8	vol	vol	NOUN
biotropia-2457	1	9	.	.	PUNCT
biotropia-2457	1	10	32	32	NUM
biotropia-2457	2	1	no	no	NOUN
biotropia-2457	2	2	.	.	NOUN
biotropia-2457	3	1	3	3	NUM
biotropia-2457	3	2	,	,	PUNCT
biotropia-2457	3	3	2025	2025	NUM
biotropia-2457	3	4	:	:	PUNCT
biotropia-2457	3	5	328	328	NUM
biotropia-2457	3	6	338	338	NUM
biotropia-2457	3	7	doi	doi	NOUN
biotropia-2457	3	8	:	:	PUNCT
biotropia-2457	3	9	10.11598	10.11598	NUM
biotropia-2457	3	10	/	/	SYM
biotropia-2457	3	11	btb.2025.32.3.2457	btb.2025.32.3.2457	PROPN
biotropia-2457	3	12	issn	issn	NOUN
biotropia-2457	3	13	:	:	PUNCT
biotropia-2457	3	14	0215	0215	NUM
biotropia-2457	3	15	-	-	SYM
biotropia-2457	3	16	6334	6334	NUM
biotropia-2457	3	17	|	|	NOUN
biotropia-2457	3	18	e	e	NOUN
biotropia-2457	3	19	-	-	PUNCT
biotropia-2457	3	20	issn	issn	ADJ
biotropia-2457	3	21	:	:	PUNCT
biotropia-2457	3	22	1907	1907	NUM
biotropia-2457	3	23	-	-	PUNCT
biotropia-2457	3	24	770x	770x	NUM
biotropia-2457	3	25	328	328	NUM
biotropia-2457	3	26	molecular	molecular	ADJ
biotropia-2457	3	27	analysis	analysis	NOUN
biotropia-2457	3	28	of	of	ADP
biotropia-2457	3	29	waxy	waxy	NOUN
biotropia-2457	3	30	gene	gene	NOUN
biotropia-2457	3	31	markers	marker	NOUN
biotropia-2457	3	32	in	in	ADP
biotropia-2457	3	33	sorghum	sorghum	NOUN
biotropia-2457	3	34	crosses	crosse	NOUN
biotropia-2457	3	35	kd4	kd4	PROPN
biotropia-2457	3	36	and	and	CCONJ
biotropia-2457	3	37	bonteb	bonteb	PROPN
biotropia-2457	3	38	gunungkidul	gunungkidul	PROPN
biotropia-2457	3	39	arif	arif	PROPN
biotropia-2457	3	40	muazam1	muazam1	PROPN
biotropia-2457	3	41	,	,	PUNCT
biotropia-2457	3	42	kristamtini2	kristamtini2	PROPN
biotropia-2457	3	43	,	,	PUNCT
biotropia-2457	3	44	setyorini	setyorini	NOUN
biotropia-2457	3	45	widyayanti2	widyayanti2	PROPN
biotropia-2457	3	46	,	,	PUNCT
biotropia-2457	3	47	yudhistira	yudhistira	PROPN
biotropia-2457	3	48	nugraha2	nugraha2	PROPN
biotropia-2457	3	49	,	,	PUNCT
biotropia-2457	3	50	rina	rina	PROPN
biotropia-2457	3	51	sri	sri	PROPN
biotropia-2457	3	52	kasiamdari1	kasiamdari1	PROPN
biotropia-2457	3	53	,	,	PUNCT
biotropia-2457	3	54	and	and	CCONJ
biotropia-2457	3	55	budi	budi	PROPN
biotropia-2457	3	56	setiadi	setiadi	PROPN
biotropia-2457	3	57	daryono1	daryono1	PROPN
biotropia-2457	3	58	*	*	PROPN
biotropia-2457	3	59	1postgraduate	1postgraduate	NUM
biotropia-2457	3	60	program	program	NOUN
biotropia-2457	3	61	,	,	PUNCT
biotropia-2457	3	62	faculty	faculty	NOUN
biotropia-2457	3	63	of	of	ADP
biotropia-2457	3	64	biology	biology	NOUN
biotropia-2457	3	65	,	,	PUNCT
biotropia-2457	3	66	gadjah	gadjah	PROPN
biotropia-2457	3	67	mada	mada	PROPN
biotropia-2457	3	68	university	university	PROPN
biotropia-2457	3	69	,	,	PUNCT
biotropia-2457	3	70	yogyakarta	yogyakarta	PROPN
biotropia-2457	3	71	55281	55281	NUM
biotropia-2457	3	72	,	,	PUNCT
biotropia-2457	3	73	indonesia	indonesia	PROPN
biotropia-2457	3	74	2research	2research	PROPN
biotropia-2457	3	75	center	center	NOUN
biotropia-2457	3	76	for	for	ADP
biotropia-2457	3	77	food	food	NOUN
biotropia-2457	3	78	crops	crop	NOUN
biotropia-2457	3	79	,	,	PUNCT
biotropia-2457	3	80	national	national	ADJ
biotropia-2457	3	81	research	research	NOUN
biotropia-2457	3	82	and	and	CCONJ
biotropia-2457	3	83	innovation	innovation	NOUN
biotropia-2457	3	84	agency	agency	NOUN
biotropia-2457	3	85	,	,	PUNCT
biotropia-2457	3	86	bogor	bogor	PROPN
biotropia-2457	3	87	16915	16915	NUM
biotropia-2457	3	88	,	,	PUNCT
biotropia-2457	3	89	indonesia	indonesia	PROPN
biotropia-2457	3	90	article	article	NOUN
biotropia-2457	3	91	higlights	higlight	VERB
biotropia-2457	3	92	local	local	ADJ
biotropia-2457	3	93	sorghum	sorghum	NOUN
biotropia-2457	3	94	crosses	crosse	NOUN
biotropia-2457	3	95	show	show	VERB
biotropia-2457	3	96	unique	unique	ADJ
biotropia-2457	3	97	fixation	fixation	NOUN
biotropia-2457	3	98	of	of	ADP
biotropia-2457	3	99	the	the	DET
biotropia-2457	3	100	waxy	waxy	NOUN
biotropia-2457	3	101	starch	starch	NOUN
biotropia-2457	3	102	gene	gene	NOUN
biotropia-2457	3	103	allele	allele	NOUN
biotropia-2457	3	104	only	only	ADV
biotropia-2457	3	105	wxc	wxc	VERB
biotropia-2457	3	106	allele	allele	NOUN
biotropia-2457	3	107	is	be	AUX
biotropia-2457	3	108	expressed	express	VERB
biotropia-2457	3	109	,	,	PUNCT
biotropia-2457	3	110	while	while	SCONJ
biotropia-2457	3	111	other	other	ADJ
biotropia-2457	3	112	waxy	waxy	NOUN
biotropia-2457	3	113	alleles	allele	NOUN
biotropia-2457	3	114	are	be	AUX
biotropia-2457	3	115	not	not	PART
biotropia-2457	3	116	detected	detect	VERB
biotropia-2457	3	117	waxy	waxy	NOUN
biotropia-2457	3	118	allele	allele	NOUN
biotropia-2457	3	119	expression	expression	NOUN
biotropia-2457	3	120	strongly	strongly	ADV
biotropia-2457	3	121	relates	relate	VERB
biotropia-2457	3	122	to	to	ADP
biotropia-2457	3	123	low	low	ADJ
biotropia-2457	3	124	amylose	amylose	ADJ
biotropia-2457	3	125	grain	grain	NOUN
biotropia-2457	3	126	quality	quality	NOUN
biotropia-2457	3	127	marker	marker	NOUN
biotropia-2457	3	128	-	-	PUNCT
biotropia-2457	3	129	based	base	VERB
biotropia-2457	3	130	selection	selection	NOUN
biotropia-2457	3	131	supports	support	VERB
biotropia-2457	3	132	breeding	breeding	NOUN
biotropia-2457	3	133	of	of	ADP
biotropia-2457	3	134	soft	soft	ADJ
biotropia-2457	3	135	-	-	PUNCT
biotropia-2457	3	136	textured	texture	VERB
biotropia-2457	3	137	sorghum	sorghum	NOUN
biotropia-2457	3	138	findings	finding	NOUN
biotropia-2457	3	139	enhance	enhance	VERB
biotropia-2457	3	140	sorghum	sorghum	NOUN
biotropia-2457	3	141	use	use	NOUN
biotropia-2457	3	142	for	for	ADP
biotropia-2457	3	143	food	food	NOUN
biotropia-2457	3	144	,	,	PUNCT
biotropia-2457	3	145	feed	feed	NOUN
biotropia-2457	3	146	,	,	PUNCT
biotropia-2457	3	147	and	and	CCONJ
biotropia-2457	3	148	industrial	industrial	ADJ
biotropia-2457	3	149	applications	application	NOUN
biotropia-2457	3	150	article	article	NOUN
biotropia-2457	3	151	information	information	NOUN
biotropia-2457	3	152	received	receive	VERB
biotropia-2457	3	153	:	:	PUNCT
biotropia-2457	3	154	12	12	NUM
biotropia-2457	3	155	february	february	NOUN
biotropia-2457	3	156	2025	2025	NUM
biotropia-2457	3	157	revised	revise	VERB
biotropia-2457	3	158	:	:	PUNCT
biotropia-2457	3	159	20	20	NUM
biotropia-2457	3	160	august	august	PROPN
biotropia-2457	3	161	2025	2025	NUM
biotropia-2457	3	162	accepted	accept	VERB
biotropia-2457	3	163	:	:	PUNCT
biotropia-2457	3	164	4	4	NUM
biotropia-2457	3	165	september	september	PROPN
biotropia-2457	3	166	2025	2025	NUM
biotropia-2457	3	167	*	*	PUNCT
biotropia-2457	3	168	corresponding	correspond	VERB
biotropia-2457	3	169	author	author	NOUN
biotropia-2457	3	170	,	,	PUNCT
biotropia-2457	3	171	e	e	NOUN
biotropia-2457	3	172	-	-	NOUN
biotropia-2457	3	173	mail	mail	NOUN
biotropia-2457	3	174	:	:	PUNCT
biotropia-2457	4	1	bs_daryono@mail.ugm.ac.id	bs_daryono@mail.ugm.ac.id	NUM
biotropia-2457	4	2	research	research	NOUN
biotropia-2457	4	3	paper	paper	NOUN
biotropia-2457	4	4	abstract	abstract	ADJ
biotropia-2457	4	5	sorghum	sorghum	NOUN
biotropia-2457	4	6	(	(	PUNCT
biotropia-2457	4	7	sorghum	sorghum	NOUN
biotropia-2457	4	8	bicolor	bicolor	NOUN
biotropia-2457	4	9	(	(	PUNCT
biotropia-2457	4	10	l.	l.	NOUN
biotropia-2457	4	11	)	)	PUNCT
biotropia-2457	4	12	moench	moench	NOUN
biotropia-2457	4	13	)	)	PUNCT
biotropia-2457	4	14	is	be	AUX
biotropia-2457	4	15	a	a	DET
biotropia-2457	4	16	food	food	NOUN
biotropia-2457	4	17	crop	crop	NOUN
biotropia-2457	4	18	that	that	PRON
biotropia-2457	4	19	exhibits	exhibit	VERB
biotropia-2457	4	20	resilience	resilience	NOUN
biotropia-2457	4	21	to	to	ADP
biotropia-2457	4	22	extreme	extreme	ADJ
biotropia-2457	4	23	environmental	environmental	ADJ
biotropia-2457	4	24	conditions	condition	NOUN
biotropia-2457	4	25	and	and	CCONJ
biotropia-2457	4	26	has	have	VERB
biotropia-2457	4	27	the	the	DET
biotropia-2457	4	28	potential	potential	NOUN
biotropia-2457	4	29	to	to	PART
biotropia-2457	4	30	be	be	AUX
biotropia-2457	4	31	developed	develop	VERB
biotropia-2457	4	32	as	as	ADP
biotropia-2457	4	33	an	an	DET
biotropia-2457	4	34	alternative	alternative	ADJ
biotropia-2457	4	35	food	food	NOUN
biotropia-2457	4	36	source	source	NOUN
biotropia-2457	4	37	.	.	PUNCT
biotropia-2457	5	1	the	the	DET
biotropia-2457	5	2	quality	quality	NOUN
biotropia-2457	5	3	of	of	ADP
biotropia-2457	5	4	sorghum	sorghum	NOUN
biotropia-2457	5	5	seeds	seed	NOUN
biotropia-2457	5	6	is	be	AUX
biotropia-2457	5	7	significantly	significantly	ADV
biotropia-2457	5	8	influenced	influence	VERB
biotropia-2457	5	9	by	by	ADP
biotropia-2457	5	10	the	the	DET
biotropia-2457	5	11	starch	starch	NOUN
biotropia-2457	5	12	composition	composition	NOUN
biotropia-2457	5	13	in	in	ADP
biotropia-2457	5	14	the	the	DET
biotropia-2457	5	15	endosperm	endosperm	NOUN
biotropia-2457	5	16	,	,	PUNCT
biotropia-2457	5	17	which	which	PRON
biotropia-2457	5	18	is	be	AUX
biotropia-2457	5	19	regulated	regulate	VERB
biotropia-2457	5	20	by	by	ADP
biotropia-2457	5	21	the	the	DET
biotropia-2457	5	22	waxy	waxy	NOUN
biotropia-2457	5	23	(	(	PUNCT
biotropia-2457	5	24	wx	wx	NOUN
biotropia-2457	5	25	)	)	PUNCT
biotropia-2457	5	26	gene	gene	NOUN
biotropia-2457	5	27	.	.	PUNCT
biotropia-2457	6	1	this	this	DET
biotropia-2457	6	2	gene	gene	NOUN
biotropia-2457	6	3	has	have	VERB
biotropia-2457	6	4	several	several	ADJ
biotropia-2457	6	5	major	major	ADJ
biotropia-2457	6	6	alleles	allele	NOUN
biotropia-2457	6	7	,	,	PUNCT
biotropia-2457	6	8	namely	namely	ADV
biotropia-2457	6	9	wxa	wxa	NOUN
biotropia-2457	6	10	,	,	PUNCT
biotropia-2457	6	11	wxb	wxb	NOUN
biotropia-2457	6	12	,	,	PUNCT
biotropia-2457	6	13	and	and	CCONJ
biotropia-2457	6	14	wxc	wxc	PROPN
biotropia-2457	6	15	,	,	PUNCT
biotropia-2457	6	16	which	which	PRON
biotropia-2457	6	17	play	play	VERB
biotropia-2457	6	18	roles	role	NOUN
biotropia-2457	6	19	in	in	ADP
biotropia-2457	6	20	the	the	DET
biotropia-2457	6	21	synthesis	synthesis	NOUN
biotropia-2457	6	22	of	of	ADP
biotropia-2457	6	23	amylopectin	amylopectin	ADJ
biotropia-2457	6	24	and	and	CCONJ
biotropia-2457	6	25	amylose	amylose	NOUN
biotropia-2457	6	26	.	.	PUNCT
biotropia-2457	7	1	this	this	DET
biotropia-2457	7	2	study	study	NOUN
biotropia-2457	7	3	aimed	aim	VERB
biotropia-2457	7	4	to	to	PART
biotropia-2457	7	5	analyze	analyze	VERB
biotropia-2457	7	6	the	the	DET
biotropia-2457	7	7	expression	expression	NOUN
biotropia-2457	7	8	of	of	ADP
biotropia-2457	7	9	wx	wx	PROPN
biotropia-2457	7	10	alleles	allele	NOUN
biotropia-2457	7	11	in	in	ADP
biotropia-2457	7	12	the	the	DET
biotropia-2457	7	13	crosses	crosse	NOUN
biotropia-2457	7	14	of	of	ADP
biotropia-2457	7	15	sorghum	sorghum	NOUN
biotropia-2457	7	16	cultivars	cultivar	NOUN
biotropia-2457	7	17	kd4	kd4	X
biotropia-2457	7	18	and	and	CCONJ
biotropia-2457	7	19	bonteb	bonteb	PROPN
biotropia-2457	7	20	gunungkidul	gunungkidul	NOUN
biotropia-2457	7	21	.	.	PUNCT
biotropia-2457	8	1	the	the	DET
biotropia-2457	8	2	main	main	ADJ
biotropia-2457	8	3	method	method	NOUN
biotropia-2457	8	4	used	use	VERB
biotropia-2457	8	5	was	be	AUX
biotropia-2457	8	6	the	the	DET
biotropia-2457	8	7	molecular	molecular	ADJ
biotropia-2457	8	8	marker	marker	NOUN
biotropia-2457	8	9	-	-	PUNCT
biotropia-2457	8	10	based	base	VERB
biotropia-2457	8	11	pcr	pcr	ADJ
biotropia-2457	8	12	method	method	NOUN
biotropia-2457	8	13	.	.	PUNCT
biotropia-2457	9	1	dna	dna	PROPN
biotropia-2457	9	2	was	be	AUX
biotropia-2457	9	3	extracted	extract	VERB
biotropia-2457	9	4	from	from	ADP
biotropia-2457	9	5	the	the	DET
biotropia-2457	9	6	leaves	leave	NOUN
biotropia-2457	9	7	of	of	ADP
biotropia-2457	9	8	30	30	NUM
biotropia-2457	9	9	individual	individual	ADJ
biotropia-2457	9	10	f2	f2	ADJ
biotropia-2457	9	11	sorghum	sorghum	NOUN
biotropia-2457	9	12	progeny	progeny	NOUN
biotropia-2457	9	13	samples	sample	NOUN
biotropia-2457	9	14	using	use	VERB
biotropia-2457	9	15	a	a	DET
biotropia-2457	9	16	slightly	slightly	ADV
biotropia-2457	9	17	modified	modify	VERB
biotropia-2457	9	18	ctab	ctab	NOUN
biotropia-2457	9	19	method	method	NOUN
biotropia-2457	9	20	.	.	PUNCT
biotropia-2457	10	1	pcr	pcr	ADJ
biotropia-2457	10	2	reactions	reaction	NOUN
biotropia-2457	10	3	were	be	AUX
biotropia-2457	10	4	performed	perform	VERB
biotropia-2457	10	5	with	with	ADP
biotropia-2457	10	6	specific	specific	ADJ
biotropia-2457	10	7	primers	primer	NOUN
biotropia-2457	10	8	for	for	ADP
biotropia-2457	10	9	each	each	DET
biotropia-2457	10	10	allele	allele	NOUN
biotropia-2457	10	11	,	,	PUNCT
biotropia-2457	10	12	and	and	CCONJ
biotropia-2457	10	13	the	the	DET
biotropia-2457	10	14	amplification	amplification	NOUN
biotropia-2457	10	15	results	result	NOUN
biotropia-2457	10	16	were	be	AUX
biotropia-2457	10	17	analyzed	analyze	VERB
biotropia-2457	10	18	using	use	VERB
biotropia-2457	10	19	1.5	1.5	NUM
biotropia-2457	10	20	%	%	NOUN
biotropia-2457	10	21	agarose	agarose	NOUN
biotropia-2457	10	22	gel	gel	NOUN
biotropia-2457	10	23	electrophoresis	electrophoresis	NOUN
biotropia-2457	10	24	.	.	PUNCT
biotropia-2457	11	1	several	several	ADJ
biotropia-2457	11	2	statistical	statistical	ADJ
biotropia-2457	11	3	analyses	analysis	NOUN
biotropia-2457	11	4	were	be	AUX
biotropia-2457	11	5	performed	perform	VERB
biotropia-2457	11	6	to	to	PART
biotropia-2457	11	7	ensure	ensure	VERB
biotropia-2457	11	8	results	result	NOUN
biotropia-2457	11	9	significance	significance	NOUN
biotropia-2457	11	10	,	,	PUNCT
biotropia-2457	11	11	i.e.	i.e.	X
biotropia-2457	11	12	,	,	PUNCT
biotropia-2457	11	13	a	a	PRON
biotropia-2457	11	14	)	)	PUNCT
biotropia-2457	11	15	chi	chi	ADJ
biotropia-2457	11	16	-	-	PUNCT
biotropia-2457	11	17	square	square	ADJ
biotropia-2457	11	18	test	test	NOUN
biotropia-2457	11	19	:	:	PUNCT
biotropia-2457	11	20	to	to	PART
biotropia-2457	11	21	determine	determine	VERB
biotropia-2457	11	22	relationships	relationship	NOUN
biotropia-2457	11	23	between	between	ADP
biotropia-2457	11	24	waxy	waxy	NOUN
biotropia-2457	11	25	allele	allele	NOUN
biotropia-2457	11	26	expression	expression	NOUN
biotropia-2457	11	27	with	with	ADP
biotropia-2457	11	28	genetic	genetic	ADJ
biotropia-2457	11	29	segregation	segregation	NOUN
biotropia-2457	11	30	within	within	ADP
biotropia-2457	11	31	cross	cross	NOUN
biotropia-2457	11	32	populations	population	NOUN
biotropia-2457	11	33	;	;	PUNCT
biotropia-2457	11	34	b	b	X
biotropia-2457	11	35	)	)	PUNCT
biotropia-2457	11	36	allele	allele	NOUN
biotropia-2457	11	37	frequency	frequency	NOUN
biotropia-2457	11	38	analysis	analysis	NOUN
biotropia-2457	11	39	:	:	PUNCT
biotropia-2457	11	40	to	to	PART
biotropia-2457	11	41	determine	determine	VERB
biotropia-2457	11	42	distribution	distribution	NOUN
biotropia-2457	11	43	of	of	ADP
biotropia-2457	11	44	waxy	waxy	NOUN
biotropia-2457	11	45	genotypes	genotype	NOUN
biotropia-2457	11	46	within	within	ADP
biotropia-2457	11	47	populations	population	NOUN
biotropia-2457	11	48	by	by	ADP
biotropia-2457	11	49	comparing	compare	VERB
biotropia-2457	11	50	counts	count	NOUN
biotropia-2457	11	51	showing	show	VERB
biotropia-2457	11	52	expressions	expression	NOUN
biotropia-2457	11	53	of	of	ADP
biotropia-2457	11	54	wxa	wxa	NOUN
biotropia-2457	11	55	,	,	PUNCT
biotropia-2457	11	56	wxb	wxb	NOUN
biotropia-2457	11	57	,	,	PUNCT
biotropia-2457	11	58	and	and	CCONJ
biotropia-2457	11	59	wxc	wxc	VERB
biotropia-2457	11	60	;	;	PUNCT
biotropia-2457	11	61	and	and	CCONJ
biotropia-2457	11	62	c	c	X
biotropia-2457	11	63	)	)	PUNCT
biotropia-2457	11	64	pearson	pearson	NOUN
biotropia-2457	11	65	correlation	correlation	NOUN
biotropia-2457	11	66	test	test	NOUN
biotropia-2457	11	67	:	:	PUNCT
biotropia-2457	11	68	to	to	PART
biotropia-2457	11	69	evaluate	evaluate	VERB
biotropia-2457	11	70	relationships	relationship	NOUN
biotropia-2457	11	71	between	between	ADP
biotropia-2457	11	72	waxy	waxy	NOUN
biotropia-2457	11	73	gene	gene	NOUN
biotropia-2457	11	74	expression	expression	NOUN
biotropia-2457	11	75	with	with	ADP
biotropia-2457	11	76	specific	specific	ADJ
biotropia-2457	11	77	agronomic	agronomic	ADJ
biotropia-2457	11	78	traits	trait	NOUN
biotropia-2457	11	79	(	(	PUNCT
biotropia-2457	11	80	e.g.	e.g.	ADV
biotropia-2457	11	81	,	,	PUNCT
biotropia-2457	11	82	amylose	amylose	ADJ
biotropia-2457	11	83	content	content	NOUN
biotropia-2457	11	84	)	)	PUNCT
biotropia-2457	11	85	.	.	PUNCT
biotropia-2457	12	1	the	the	DET
biotropia-2457	12	2	main	main	ADJ
biotropia-2457	12	3	findings	finding	NOUN
biotropia-2457	12	4	of	of	ADP
biotropia-2457	12	5	our	our	PRON
biotropia-2457	12	6	study	study	NOUN
biotropia-2457	12	7	showed	show	VERB
biotropia-2457	12	8	that	that	SCONJ
biotropia-2457	12	9	only	only	ADV
biotropia-2457	12	10	the	the	DET
biotropia-2457	12	11	wxc	wxc	NOUN
biotropia-2457	12	12	allele	allele	NOUN
biotropia-2457	12	13	exhibited	exhibit	VERB
biotropia-2457	12	14	a	a	DET
biotropia-2457	12	15	clear	clear	ADJ
biotropia-2457	12	16	amplification	amplification	NOUN
biotropia-2457	12	17	band	band	NOUN
biotropia-2457	12	18	,	,	PUNCT
biotropia-2457	12	19	while	while	SCONJ
biotropia-2457	12	20	wxa	wxa	NOUN
biotropia-2457	12	21	and	and	CCONJ
biotropia-2457	12	22	wxb	wxb	NOUN
biotropia-2457	12	23	did	do	AUX
biotropia-2457	12	24	not	not	PART
biotropia-2457	12	25	show	show	VERB
biotropia-2457	12	26	any	any	DET
biotropia-2457	12	27	significant	significant	ADJ
biotropia-2457	12	28	expression	expression	NOUN
biotropia-2457	12	29	.	.	PUNCT
biotropia-2457	13	1	this	this	PRON
biotropia-2457	13	2	indicates	indicate	VERB
biotropia-2457	13	3	that	that	SCONJ
biotropia-2457	13	4	the	the	DET
biotropia-2457	13	5	wxc	wxc	NOUN
biotropia-2457	13	6	allele	allele	NOUN
biotropia-2457	13	7	plays	play	VERB
biotropia-2457	13	8	a	a	DET
biotropia-2457	13	9	dominant	dominant	ADJ
biotropia-2457	13	10	role	role	NOUN
biotropia-2457	13	11	in	in	ADP
biotropia-2457	13	12	starch	starch	NOUN
biotropia-2457	13	13	synthesis	synthesis	NOUN
biotropia-2457	13	14	in	in	ADP
biotropia-2457	13	15	this	this	DET
biotropia-2457	13	16	cross	cross	NOUN
biotropia-2457	13	17	,	,	PUNCT
biotropia-2457	13	18	while	while	SCONJ
biotropia-2457	13	19	wxa	wxa	NOUN
biotropia-2457	13	20	and	and	CCONJ
biotropia-2457	13	21	wxb	wxb	NOUN
biotropia-2457	13	22	are	be	AUX
biotropia-2457	13	23	likely	likely	ADV
biotropia-2457	13	24	not	not	PART
biotropia-2457	13	25	expressed	express	VERB
biotropia-2457	13	26	due	due	ADJ
biotropia-2457	13	27	to	to	ADP
biotropia-2457	13	28	genetic	genetic	ADJ
biotropia-2457	13	29	or	or	CCONJ
biotropia-2457	13	30	epigenetic	epigenetic	ADJ
biotropia-2457	13	31	regulatory	regulatory	ADJ
biotropia-2457	13	32	mechanisms	mechanism	NOUN
biotropia-2457	13	33	.	.	PUNCT
biotropia-2457	14	1	these	these	DET
biotropia-2457	14	2	findings	finding	NOUN
biotropia-2457	14	3	provide	provide	VERB
biotropia-2457	14	4	a	a	DET
biotropia-2457	14	5	brief	brief	ADJ
biotropia-2457	14	6	summary	summary	NOUN
biotropia-2457	14	7	of	of	ADP
biotropia-2457	14	8	sorghum	sorghum	NOUN
biotropia-2457	14	9	breeding	breeding	NOUN
biotropia-2457	14	10	efforts	effort	NOUN
biotropia-2457	14	11	aimed	aim	VERB
biotropia-2457	14	12	at	at	ADP
biotropia-2457	14	13	producing	produce	VERB
biotropia-2457	14	14	varieties	variety	NOUN
biotropia-2457	14	15	with	with	ADP
biotropia-2457	14	16	superior	superior	ADJ
biotropia-2457	14	17	waxy	waxy	NOUN
biotropia-2457	14	18	starch	starch	NOUN
biotropia-2457	14	19	characteristics	characteristic	NOUN
biotropia-2457	14	20	.	.	PUNCT
biotropia-2457	15	1	further	further	ADJ
biotropia-2457	15	2	studies	study	NOUN
biotropia-2457	15	3	are	be	AUX
biotropia-2457	15	4	needed	need	VERB
biotropia-2457	15	5	to	to	PART
biotropia-2457	15	6	understand	understand	VERB
biotropia-2457	15	7	the	the	DET
biotropia-2457	15	8	regulation	regulation	NOUN
biotropia-2457	15	9	of	of	ADP
biotropia-2457	15	10	wx	wx	PROPN
biotropia-2457	15	11	gene	gene	NOUN
biotropia-2457	15	12	expression	expression	NOUN
biotropia-2457	15	13	and	and	CCONJ
biotropia-2457	15	14	its	its	PRON
biotropia-2457	15	15	potential	potential	ADJ
biotropia-2457	15	16	implications	implication	NOUN
biotropia-2457	15	17	for	for	ADP
biotropia-2457	15	18	molecular	molecular	ADJ
biotropia-2457	15	19	selection	selection	NOUN
biotropia-2457	15	20	,	,	PUNCT
biotropia-2457	15	21	ultimately	ultimately	ADV
biotropia-2457	15	22	enhancing	enhance	VERB
biotropia-2457	15	23	sorghum	sorghum	NOUN
biotropia-2457	15	24	quality	quality	NOUN
biotropia-2457	15	25	for	for	ADP
biotropia-2457	15	26	both	both	PRON
biotropia-2457	15	27	food	food	NOUN
biotropia-2457	15	28	and	and	CCONJ
biotropia-2457	15	29	industrial	industrial	ADJ
biotropia-2457	15	30	applications	application	NOUN
biotropia-2457	15	31	.	.	PUNCT
biotropia-2457	16	1	keywords	keyword	NOUN
biotropia-2457	16	2	:	:	PUNCT
biotropia-2457	16	3	genetics	genetic	NOUN
biotropia-2457	16	4	,	,	PUNCT
biotropia-2457	16	5	local	local	ADJ
biotropia-2457	16	6	,	,	PUNCT
biotropia-2457	16	7	plant	plant	NOUN
biotropia-2457	16	8	breeding	breeding	NOUN
biotropia-2457	16	9	,	,	PUNCT
biotropia-2457	16	10	sorghum	sorghum	NOUN
biotropia-2457	16	11	,	,	PUNCT
biotropia-2457	16	12	waxy	waxy	NOUN
biotropia-2457	16	13	genecopyright	genecopyright	NOUN
biotropia-2457	16	14	(	(	PUNCT
biotropia-2457	16	15	c	c	NOUN
biotropia-2457	16	16	)	)	PUNCT
biotropia-2457	16	17	2025@author(s	2025@author(s	NUM
biotropia-2457	16	18	)	)	PUNCT
biotropia-2457	16	19	.	.	PUNCT
biotropia-2457	17	1	https://doi.org/10.11598/btb.2025.32.3.2457	https://doi.org/10.11598/btb.2025.32.3.2457	PROPN
biotropia-2457	17	2	https://creativecommons.org/licenses/by-nc-nd/4.0/	https://creativecommons.org/licenses/by-nc-nd/4.0/	PROPN
biotropia-2457	17	3	molecular	molecular	ADJ
biotropia-2457	17	4	genetics	genetic	NOUN
biotropia-2457	17	5	of	of	ADP
biotropia-2457	17	6	sorghum	sorghum	NOUN
biotropia-2457	17	7	crosses	crosse	NOUN
biotropia-2457	17	8	kd4	kd4	PROPN
biotropia-2457	17	9	and	and	CCONJ
biotropia-2457	17	10	bonteb	bonteb	PROPN
biotropia-2457	17	11	gunungkidul	gunungkidul	PROPN
biotropia-2457	17	12	muazam	muazam	PROPN
biotropia-2457	17	13	et	et	PROPN
biotropia-2457	17	14	al	al	PROPN
biotropia-2457	17	15	.	.	PROPN
biotropia-2457	17	16	329	329	NUM
biotropia-2457	17	17	introduction	introduction	NOUN
biotropia-2457	17	18	sorghum	sorghum	NOUN
biotropia-2457	17	19	(	(	PUNCT
biotropia-2457	17	20	sorghum	sorghum	NOUN
biotropia-2457	17	21	bicolor	bicolor	NOUN
biotropia-2457	17	22	(	(	PUNCT
biotropia-2457	17	23	l.	l.	NOUN
biotropia-2457	17	24	)	)	PUNCT
biotropia-2457	17	25	moench	moench	NOUN
biotropia-2457	17	26	)	)	PUNCT
biotropia-2457	17	27	is	be	AUX
biotropia-2457	17	28	a	a	DET
biotropia-2457	17	29	strategic	strategic	ADJ
biotropia-2457	17	30	food	food	NOUN
biotropia-2457	17	31	crop	crop	NOUN
biotropia-2457	17	32	that	that	PRON
biotropia-2457	17	33	contributes	contribute	VERB
biotropia-2457	17	34	significantly	significantly	ADV
biotropia-2457	17	35	to	to	ADP
biotropia-2457	17	36	global	global	ADJ
biotropia-2457	17	37	food	food	NOUN
biotropia-2457	17	38	security	security	NOUN
biotropia-2457	17	39	,	,	PUNCT
biotropia-2457	17	40	particularly	particularly	ADV
biotropia-2457	17	41	in	in	ADP
biotropia-2457	17	42	tropical	tropical	ADJ
biotropia-2457	17	43	and	and	CCONJ
biotropia-2457	17	44	subtropical	subtropical	ADJ
biotropia-2457	17	45	regions	region	NOUN
biotropia-2457	17	46	.	.	PUNCT
biotropia-2457	18	1	its	its	PRON
biotropia-2457	18	2	advantages	advantage	NOUN
biotropia-2457	18	3	include	include	VERB
biotropia-2457	18	4	drought	drought	NOUN
biotropia-2457	18	5	tolerance	tolerance	NOUN
biotropia-2457	18	6	,	,	PUNCT
biotropia-2457	18	7	high	high	ADJ
biotropia-2457	18	8	water	water	NOUN
biotropia-2457	18	9	-	-	PUNCT
biotropia-2457	18	10	use	use	NOUN
biotropia-2457	18	11	efficiency	efficiency	NOUN
biotropia-2457	18	12	,	,	PUNCT
biotropia-2457	18	13	and	and	CCONJ
biotropia-2457	18	14	the	the	DET
biotropia-2457	18	15	ability	ability	NOUN
biotropia-2457	18	16	to	to	PART
biotropia-2457	18	17	thrive	thrive	VERB
biotropia-2457	18	18	on	on	ADP
biotropia-2457	18	19	marginal	marginal	ADJ
biotropia-2457	18	20	soils	soil	NOUN
biotropia-2457	18	21	compared	compare	VERB
biotropia-2457	18	22	with	with	ADP
biotropia-2457	18	23	other	other	ADJ
biotropia-2457	18	24	cereals	cereal	NOUN
biotropia-2457	18	25	such	such	ADJ
biotropia-2457	18	26	as	as	ADP
biotropia-2457	18	27	rice	rice	NOUN
biotropia-2457	18	28	and	and	CCONJ
biotropia-2457	18	29	wheat	wheat	NOUN
biotropia-2457	18	30	(	(	PUNCT
biotropia-2457	18	31	xie	xie	PROPN
biotropia-2457	18	32	et	et	PROPN
biotropia-2457	18	33	al	al	PROPN
biotropia-2457	18	34	.	.	PROPN
biotropia-2457	18	35	2022	2022	NUM
biotropia-2457	18	36	)	)	PUNCT
biotropia-2457	18	37	.	.	PUNCT
biotropia-2457	19	1	sorghum	sorghum	NOUN
biotropia-2457	19	2	also	also	ADV
biotropia-2457	19	3	provides	provide	VERB
biotropia-2457	19	4	high	high	ADJ
biotropia-2457	19	5	nutritional	nutritional	ADJ
biotropia-2457	19	6	value	value	NOUN
biotropia-2457	19	7	,	,	PUNCT
biotropia-2457	19	8	being	be	AUX
biotropia-2457	19	9	rich	rich	ADJ
biotropia-2457	19	10	in	in	ADP
biotropia-2457	19	11	carbohydrates	carbohydrate	NOUN
biotropia-2457	19	12	,	,	PUNCT
biotropia-2457	19	13	proteins	protein	NOUN
biotropia-2457	19	14	,	,	PUNCT
biotropia-2457	19	15	dietary	dietary	ADJ
biotropia-2457	19	16	fiber	fiber	NOUN
biotropia-2457	19	17	,	,	PUNCT
biotropia-2457	19	18	and	and	CCONJ
biotropia-2457	19	19	bioactive	bioactive	VERB
biotropia-2457	19	20	compounds	compound	NOUN
biotropia-2457	19	21	such	such	ADJ
biotropia-2457	19	22	as	as	ADP
biotropia-2457	19	23	polyphenols	polyphenol	NOUN
biotropia-2457	19	24	and	and	CCONJ
biotropia-2457	19	25	antioxidants	antioxidant	NOUN
biotropia-2457	19	26	(	(	PUNCT
biotropia-2457	19	27	tian	tian	PROPN
biotropia-2457	19	28	et	et	PROPN
biotropia-2457	19	29	al	al	PROPN
biotropia-2457	19	30	.	.	PROPN
biotropia-2457	19	31	2023	2023	NUM
biotropia-2457	19	32	)	)	PUNCT
biotropia-2457	19	33	.	.	PUNCT
biotropia-2457	20	1	these	these	DET
biotropia-2457	20	2	attributes	attribute	NOUN
biotropia-2457	20	3	make	make	VERB
biotropia-2457	20	4	sorghum	sorghum	NOUN
biotropia-2457	20	5	a	a	DET
biotropia-2457	20	6	promising	promising	ADJ
biotropia-2457	20	7	candidate	candidate	NOUN
biotropia-2457	20	8	for	for	ADP
biotropia-2457	20	9	food	food	NOUN
biotropia-2457	20	10	diversification	diversification	NOUN
biotropia-2457	20	11	,	,	PUNCT
biotropia-2457	20	12	especially	especially	ADV
biotropia-2457	20	13	under	under	ADP
biotropia-2457	20	14	increasingly	increasingly	ADV
biotropia-2457	20	15	variable	variable	ADJ
biotropia-2457	20	16	climate	climate	NOUN
biotropia-2457	20	17	conditions	condition	NOUN
biotropia-2457	20	18	(	(	PUNCT
biotropia-2457	20	19	mutisya	mutisya	NOUN
biotropia-2457	20	20	et	et	PROPN
biotropia-2457	20	21	al	al	PROPN
biotropia-2457	20	22	.	.	PROPN
biotropia-2457	20	23	2023	2023	NUM
biotropia-2457	20	24	)	)	PUNCT
biotropia-2457	20	25	.	.	PUNCT
biotropia-2457	21	1	however	however	ADV
biotropia-2457	21	2	,	,	PUNCT
biotropia-2457	21	3	one	one	NUM
biotropia-2457	21	4	of	of	ADP
biotropia-2457	21	5	the	the	DET
biotropia-2457	21	6	main	main	ADJ
biotropia-2457	21	7	limitations	limitation	NOUN
biotropia-2457	21	8	to	to	ADP
biotropia-2457	21	9	its	its	PRON
biotropia-2457	21	10	wider	wide	ADJ
biotropia-2457	21	11	adoption	adoption	NOUN
biotropia-2457	21	12	as	as	ADP
biotropia-2457	21	13	a	a	DET
biotropia-2457	21	14	staple	staple	NOUN
biotropia-2457	21	15	food	food	NOUN
biotropia-2457	21	16	is	be	AUX
biotropia-2457	21	17	that	that	SCONJ
biotropia-2457	21	18	sorghum	sorghum	NOUN
biotropia-2457	21	19	has	have	VERB
biotropia-2457	21	20	relatively	relatively	ADV
biotropia-2457	21	21	dry	dry	ADJ
biotropia-2457	21	22	and	and	CCONJ
biotropia-2457	21	23	firm	firm	ADJ
biotropia-2457	21	24	grain	grain	NOUN
biotropia-2457	21	25	texture	texture	NOUN
biotropia-2457	21	26	compared	compare	VERB
biotropia-2457	21	27	with	with	ADP
biotropia-2457	21	28	those	those	PRON
biotropia-2457	21	29	of	of	ADP
biotropia-2457	21	30	rice	rice	NOUN
biotropia-2457	21	31	(	(	PUNCT
biotropia-2457	21	32	lu	lu	NOUN
biotropia-2457	21	33	et	et	PROPN
biotropia-2457	21	34	al	al	PROPN
biotropia-2457	21	35	.	.	PROPN
biotropia-2457	21	36	2022	2022	NUM
biotropia-2457	21	37	)	)	PUNCT
biotropia-2457	21	38	.	.	PUNCT
biotropia-2457	22	1	the	the	DET
biotropia-2457	22	2	eating	eat	VERB
biotropia-2457	22	3	quality	quality	NOUN
biotropia-2457	22	4	of	of	ADP
biotropia-2457	22	5	sorghum	sorghum	NOUN
biotropia-2457	22	6	is	be	AUX
biotropia-2457	22	7	largely	largely	ADV
biotropia-2457	22	8	determined	determine	VERB
biotropia-2457	22	9	by	by	ADP
biotropia-2457	22	10	the	the	DET
biotropia-2457	22	11	ratio	ratio	NOUN
biotropia-2457	22	12	of	of	ADP
biotropia-2457	22	13	amylose	amylose	NOUN
biotropia-2457	22	14	to	to	ADP
biotropia-2457	22	15	amylopectin	amylopectin	ADJ
biotropia-2457	22	16	in	in	ADP
biotropia-2457	22	17	the	the	DET
biotropia-2457	22	18	grain	grain	NOUN
biotropia-2457	22	19	.	.	PUNCT
biotropia-2457	23	1	amylose	amylose	PROPN
biotropia-2457	23	2	,	,	PUNCT
biotropia-2457	23	3	a	a	DET
biotropia-2457	23	4	linear	linear	NOUN
biotropia-2457	23	5	glucose	glucose	NOUN
biotropia-2457	23	6	polymer	polymer	NOUN
biotropia-2457	23	7	,	,	PUNCT
biotropia-2457	23	8	contributes	contribute	VERB
biotropia-2457	23	9	to	to	ADP
biotropia-2457	23	10	hardness	hardness	NOUN
biotropia-2457	23	11	and	and	CCONJ
biotropia-2457	23	12	dryness	dryness	NOUN
biotropia-2457	23	13	,	,	PUNCT
biotropia-2457	23	14	while	while	SCONJ
biotropia-2457	23	15	amylopectin	amylopectin	ADJ
biotropia-2457	23	16	,	,	PUNCT
biotropia-2457	23	17	a	a	DET
biotropia-2457	23	18	branched	branched	ADJ
biotropia-2457	23	19	polymer	polymer	NOUN
biotropia-2457	23	20	,	,	PUNCT
biotropia-2457	23	21	produces	produce	VERB
biotropia-2457	23	22	a	a	DET
biotropia-2457	23	23	softer	soft	ADJ
biotropia-2457	23	24	and	and	CCONJ
biotropia-2457	23	25	stickier	sticki	ADJ
biotropia-2457	23	26	texture	texture	NOUN
biotropia-2457	23	27	(	(	PUNCT
biotropia-2457	23	28	yano	yano	PROPN
biotropia-2457	23	29	et	et	PROPN
biotropia-2457	23	30	al	al	PROPN
biotropia-2457	23	31	.	.	PROPN
biotropia-2457	23	32	2020	2020	NUM
biotropia-2457	23	33	)	)	PUNCT
biotropia-2457	23	34	.	.	PUNCT
biotropia-2457	24	1	therefore	therefore	ADV
biotropia-2457	24	2	,	,	PUNCT
biotropia-2457	24	3	manipulating	manipulate	VERB
biotropia-2457	24	4	starch	starch	NOUN
biotropia-2457	24	5	composition	composition	NOUN
biotropia-2457	24	6	has	have	AUX
biotropia-2457	24	7	become	become	VERB
biotropia-2457	24	8	a	a	DET
biotropia-2457	24	9	key	key	ADJ
biotropia-2457	24	10	objective	objective	NOUN
biotropia-2457	24	11	in	in	ADP
biotropia-2457	24	12	sorghum	sorghum	NOUN
biotropia-2457	24	13	breeding	breeding	NOUN
biotropia-2457	24	14	programs	program	NOUN
biotropia-2457	24	15	aimed	aim	VERB
biotropia-2457	24	16	at	at	ADP
biotropia-2457	24	17	improving	improve	VERB
biotropia-2457	24	18	palatability	palatability	NOUN
biotropia-2457	24	19	.	.	PUNCT
biotropia-2457	25	1	the	the	DET
biotropia-2457	25	2	waxy	waxy	NOUN
biotropia-2457	25	3	gene	gene	NOUN
biotropia-2457	25	4	(	(	PUNCT
biotropia-2457	25	5	wx	wx	PROPN
biotropia-2457	25	6	)	)	PUNCT
biotropia-2457	25	7	is	be	AUX
biotropia-2457	25	8	the	the	DET
biotropia-2457	25	9	primary	primary	ADJ
biotropia-2457	25	10	genetic	genetic	ADJ
biotropia-2457	25	11	factor	factor	NOUN
biotropia-2457	25	12	controlling	control	VERB
biotropia-2457	25	13	amylose	amylose	ADJ
biotropia-2457	25	14	synthesis	synthesis	NOUN
biotropia-2457	25	15	.	.	PUNCT
biotropia-2457	26	1	it	it	PRON
biotropia-2457	26	2	encodes	encode	VERB
biotropia-2457	26	3	granulebound	granulebound	ADJ
biotropia-2457	26	4	starch	starch	NOUN
biotropia-2457	26	5	synthase	synthase	NOUN
biotropia-2457	26	6	(	(	PUNCT
biotropia-2457	26	7	gbss	gbss	NOUN
biotropia-2457	26	8	)	)	PUNCT
biotropia-2457	26	9	,	,	PUNCT
biotropia-2457	26	10	and	and	CCONJ
biotropia-2457	26	11	mutations	mutation	NOUN
biotropia-2457	26	12	at	at	ADP
biotropia-2457	26	13	this	this	DET
biotropia-2457	26	14	locus	locus	NOUN
biotropia-2457	26	15	result	result	NOUN
biotropia-2457	26	16	in	in	ADP
biotropia-2457	26	17	reduced	reduced	ADJ
biotropia-2457	26	18	or	or	CCONJ
biotropia-2457	26	19	absent	absent	ADJ
biotropia-2457	26	20	amylose	amylose	ADJ
biotropia-2457	26	21	content	content	NOUN
biotropia-2457	26	22	.	.	PUNCT
biotropia-2457	27	1	such	such	ADJ
biotropia-2457	27	2	variants	variant	NOUN
biotropia-2457	27	3	,	,	PUNCT
biotropia-2457	27	4	termed	term	VERB
biotropia-2457	27	5	waxy	waxy	NOUN
biotropia-2457	27	6	sorghums	sorghum	NOUN
biotropia-2457	27	7	,	,	PUNCT
biotropia-2457	27	8	are	be	AUX
biotropia-2457	27	9	more	more	ADV
biotropia-2457	27	10	acceptable	acceptable	ADJ
biotropia-2457	27	11	to	to	ADP
biotropia-2457	27	12	consumers	consumer	NOUN
biotropia-2457	27	13	in	in	ADP
biotropia-2457	27	14	many	many	ADJ
biotropia-2457	27	15	asian	asian	ADJ
biotropia-2457	27	16	countries	country	NOUN
biotropia-2457	27	17	due	due	ADP
biotropia-2457	27	18	to	to	ADP
biotropia-2457	27	19	their	their	PRON
biotropia-2457	27	20	softer	soft	ADJ
biotropia-2457	27	21	texture	texture	NOUN
biotropia-2457	27	22	(	(	PUNCT
biotropia-2457	27	23	boyles	boyles	PROPN
biotropia-2457	27	24	2017	2017	NUM
biotropia-2457	27	25	;	;	PUNCT
biotropia-2457	27	26	zhou	zhou	PROPN
biotropia-2457	27	27	et	et	PROPN
biotropia-2457	27	28	al	al	PROPN
biotropia-2457	27	29	.	.	PROPN
biotropia-2457	27	30	2021	2021	NUM
biotropia-2457	27	31	;	;	PUNCT
biotropia-2457	27	32	tian	tian	PROPN
biotropia-2457	27	33	et	et	PROPN
biotropia-2457	27	34	al	al	PROPN
biotropia-2457	27	35	.	.	PROPN
biotropia-2457	27	36	2023	2023	NUM
biotropia-2457	27	37	)	)	PUNCT
biotropia-2457	27	38	.	.	PUNCT
biotropia-2457	28	1	several	several	ADJ
biotropia-2457	28	2	waxy	waxy	NOUN
biotropia-2457	28	3	alleles	allele	NOUN
biotropia-2457	28	4	,	,	PUNCT
biotropia-2457	28	5	including	include	VERB
biotropia-2457	28	6	wxa	wxa	NOUN
biotropia-2457	28	7	,	,	PUNCT
biotropia-2457	28	8	wxb	wxb	NOUN
biotropia-2457	28	9	,	,	PUNCT
biotropia-2457	28	10	and	and	CCONJ
biotropia-2457	28	11	wxc	wxc	NOUN
biotropia-2457	28	12	,	,	PUNCT
biotropia-2457	28	13	have	have	AUX
biotropia-2457	28	14	been	be	AUX
biotropia-2457	28	15	reported	report	VERB
biotropia-2457	28	16	to	to	PART
biotropia-2457	28	17	influence	influence	VERB
biotropia-2457	28	18	amylose	amylose	ADJ
biotropia-2457	28	19	levels	level	NOUN
biotropia-2457	28	20	,	,	PUNCT
biotropia-2457	28	21	although	although	SCONJ
biotropia-2457	28	22	their	their	PRON
biotropia-2457	28	23	expression	expression	NOUN
biotropia-2457	28	24	varies	vary	VERB
biotropia-2457	28	25	depending	depend	VERB
biotropia-2457	28	26	on	on	ADP
biotropia-2457	28	27	genotype	genotype	NOUN
biotropia-2457	28	28	and	and	CCONJ
biotropia-2457	28	29	environment	environment	NOUN
biotropia-2457	28	30	(	(	PUNCT
biotropia-2457	28	31	wang	wang	PROPN
biotropia-2457	28	32	et	et	PROPN
biotropia-2457	28	33	al	al	PROPN
biotropia-2457	28	34	.	.	PROPN
biotropia-2457	28	35	2023	2023	NUM
biotropia-2457	28	36	)	)	PUNCT
biotropia-2457	28	37	.	.	PUNCT
biotropia-2457	29	1	wardhani	wardhani	PROPN
biotropia-2457	29	2	and	and	CCONJ
biotropia-2457	29	3	wirnas	wirnas	PROPN
biotropia-2457	29	4	(	(	PUNCT
biotropia-2457	29	5	2024	2024	NUM
biotropia-2457	29	6	)	)	PUNCT
biotropia-2457	29	7	documented	document	VERB
biotropia-2457	29	8	considerable	considerable	ADJ
biotropia-2457	29	9	genetic	genetic	ADJ
biotropia-2457	29	10	diversity	diversity	NOUN
biotropia-2457	29	11	for	for	ADP
biotropia-2457	29	12	amylose	amylose	ADJ
biotropia-2457	29	13	content	content	NOUN
biotropia-2457	29	14	in	in	ADP
biotropia-2457	29	15	sorghum	sorghum	NOUN
biotropia-2457	29	16	crosses	crosse	NOUN
biotropia-2457	29	17	(	(	PUNCT
biotropia-2457	29	18	pulut	pulut	PROPN
biotropia-2457	29	19	3	3	NUM
biotropia-2457	29	20	×	×	NOUN
biotropia-2457	29	21	soraya	soraya	PROPN
biotropia-2457	29	22	3	3	NUM
biotropia-2457	29	23	)	)	PUNCT
biotropia-2457	29	24	,	,	PUNCT
biotropia-2457	29	25	demonstrating	demonstrate	VERB
biotropia-2457	29	26	the	the	DET
biotropia-2457	29	27	potential	potential	NOUN
biotropia-2457	29	28	of	of	ADP
biotropia-2457	29	29	allele	allele	NOUN
biotropia-2457	29	30	-	-	PUNCT
biotropia-2457	29	31	based	base	VERB
biotropia-2457	29	32	selection	selection	NOUN
biotropia-2457	29	33	to	to	PART
biotropia-2457	29	34	generate	generate	VERB
biotropia-2457	29	35	waxy	waxy	NOUN
biotropia-2457	29	36	lines	line	NOUN
biotropia-2457	29	37	.	.	PUNCT
biotropia-2457	30	1	hence	hence	ADV
biotropia-2457	30	2	,	,	PUNCT
biotropia-2457	30	3	molecular	molecular	ADJ
biotropia-2457	30	4	mapping	mapping	NOUN
biotropia-2457	30	5	and	and	CCONJ
biotropia-2457	30	6	characterization	characterization	NOUN
biotropia-2457	30	7	of	of	ADP
biotropia-2457	30	8	wx	wx	PROPN
biotropia-2457	30	9	alleles	allele	NOUN
biotropia-2457	30	10	are	be	AUX
biotropia-2457	30	11	essential	essential	ADJ
biotropia-2457	30	12	steps	step	NOUN
biotropia-2457	30	13	in	in	ADP
biotropia-2457	30	14	sorghum	sorghum	NOUN
biotropia-2457	30	15	improvement	improvement	NOUN
biotropia-2457	30	16	.	.	PUNCT
biotropia-2457	31	1	molecular	molecular	ADJ
biotropia-2457	31	2	markers	marker	NOUN
biotropia-2457	31	3	,	,	PUNCT
biotropia-2457	31	4	particularly	particularly	ADV
biotropia-2457	31	5	pcr	pcr	NOUN
biotropia-2457	31	6	-	-	PUNCT
biotropia-2457	31	7	based	base	VERB
biotropia-2457	31	8	assays	assay	NOUN
biotropia-2457	31	9	,	,	PUNCT
biotropia-2457	31	10	provide	provide	VERB
biotropia-2457	31	11	accurate	accurate	ADJ
biotropia-2457	31	12	identification	identification	NOUN
biotropia-2457	31	13	of	of	ADP
biotropia-2457	31	14	waxy	waxy	NOUN
biotropia-2457	31	15	alleles	allele	NOUN
biotropia-2457	31	16	compared	compare	VERB
biotropia-2457	31	17	with	with	ADP
biotropia-2457	31	18	conventional	conventional	ADJ
biotropia-2457	31	19	phenotypic	phenotypic	NOUN
biotropia-2457	31	20	screening	screening	NOUN
biotropia-2457	31	21	and	and	CCONJ
biotropia-2457	31	22	can	can	AUX
biotropia-2457	31	23	accelerate	accelerate	VERB
biotropia-2457	31	24	breeding	breeding	NOUN
biotropia-2457	31	25	progress	progress	NOUN
biotropia-2457	31	26	(	(	PUNCT
biotropia-2457	31	27	lu	lu	NOUN
biotropia-2457	31	28	et	et	PROPN
biotropia-2457	31	29	al	al	PROPN
biotropia-2457	31	30	.	.	PROPN
biotropia-2457	31	31	2022	2022	NUM
biotropia-2457	31	32	)	)	PUNCT
biotropia-2457	31	33	.	.	PUNCT
biotropia-2457	32	1	this	this	DET
biotropia-2457	32	2	approach	approach	NOUN
biotropia-2457	32	3	allows	allow	VERB
biotropia-2457	32	4	breeders	breeder	NOUN
biotropia-2457	32	5	to	to	PART
biotropia-2457	32	6	detect	detect	VERB
biotropia-2457	32	7	waxy	waxy	NOUN
biotropia-2457	32	8	genotypes	genotype	NOUN
biotropia-2457	32	9	early	early	ADV
biotropia-2457	32	10	in	in	ADP
biotropia-2457	32	11	plant	plant	NOUN
biotropia-2457	32	12	development	development	NOUN
biotropia-2457	32	13	,	,	PUNCT
biotropia-2457	32	14	increasing	increase	VERB
biotropia-2457	32	15	selection	selection	NOUN
biotropia-2457	32	16	efficiency	efficiency	NOUN
biotropia-2457	32	17	(	(	PUNCT
biotropia-2457	32	18	wang	wang	PROPN
biotropia-2457	32	19	et	et	PROPN
biotropia-2457	32	20	al	al	PROPN
biotropia-2457	32	21	.	.	PROPN
biotropia-2457	32	22	2023	2023	NUM
biotropia-2457	32	23	)	)	PUNCT
biotropia-2457	32	24	.	.	PUNCT
biotropia-2457	33	1	beyond	beyond	ADP
biotropia-2457	33	2	breeding	breeding	NOUN
biotropia-2457	33	3	,	,	PUNCT
biotropia-2457	33	4	waxy	waxy	NOUN
biotropia-2457	33	5	sorghum	sorghum	NOUN
biotropia-2457	33	6	has	have	VERB
biotropia-2457	33	7	broad	broad	ADJ
biotropia-2457	33	8	potential	potential	NOUN
biotropia-2457	33	9	in	in	ADP
biotropia-2457	33	10	the	the	DET
biotropia-2457	33	11	food	food	NOUN
biotropia-2457	33	12	industry	industry	NOUN
biotropia-2457	33	13	.	.	PUNCT
biotropia-2457	34	1	waxy	waxy	NOUN
biotropia-2457	34	2	starch	starch	NOUN
biotropia-2457	34	3	improves	improve	VERB
biotropia-2457	34	4	product	product	NOUN
biotropia-2457	34	5	quality	quality	NOUN
biotropia-2457	34	6	in	in	ADP
biotropia-2457	34	7	applications	application	NOUN
biotropia-2457	34	8	such	such	ADJ
biotropia-2457	34	9	as	as	ADP
biotropia-2457	34	10	noodles	noodle	NOUN
biotropia-2457	34	11	,	,	PUNCT
biotropia-2457	34	12	bread	bread	NOUN
biotropia-2457	34	13	,	,	PUNCT
biotropia-2457	34	14	and	and	CCONJ
biotropia-2457	34	15	other	other	ADJ
biotropia-2457	34	16	processed	process	VERB
biotropia-2457	34	17	foods	food	NOUN
biotropia-2457	34	18	requiring	require	VERB
biotropia-2457	34	19	superior	superior	ADJ
biotropia-2457	34	20	gelatinization	gelatinization	NOUN
biotropia-2457	34	21	and	and	CCONJ
biotropia-2457	34	22	textural	textural	ADJ
biotropia-2457	34	23	properties	property	NOUN
biotropia-2457	34	24	(	(	PUNCT
biotropia-2457	34	25	zhou	zhou	X
biotropia-2457	34	26	et	et	PROPN
biotropia-2457	34	27	al	al	PROPN
biotropia-2457	34	28	.	.	PROPN
biotropia-2457	34	29	2021	2021	NUM
biotropia-2457	34	30	;	;	PUNCT
biotropia-2457	34	31	tian	tian	PROPN
biotropia-2457	34	32	et	et	PROPN
biotropia-2457	34	33	al	al	PROPN
biotropia-2457	34	34	.	.	PROPN
biotropia-2457	34	35	2023	2023	NUM
biotropia-2457	34	36	)	)	PUNCT
biotropia-2457	34	37	.	.	PUNCT
biotropia-2457	35	1	thus	thus	ADV
biotropia-2457	35	2	,	,	PUNCT
biotropia-2457	35	3	the	the	DET
biotropia-2457	35	4	development	development	NOUN
biotropia-2457	35	5	of	of	ADP
biotropia-2457	35	6	waxy	waxy	NOUN
biotropia-2457	35	7	sorghum	sorghum	NOUN
biotropia-2457	35	8	varieties	variety	NOUN
biotropia-2457	35	9	could	could	AUX
biotropia-2457	35	10	enhance	enhance	VERB
biotropia-2457	35	11	both	both	PRON
biotropia-2457	35	12	consumer	consumer	NOUN
biotropia-2457	35	13	acceptance	acceptance	NOUN
biotropia-2457	35	14	and	and	CCONJ
biotropia-2457	35	15	industrial	industrial	ADJ
biotropia-2457	35	16	utilization	utilization	NOUN
biotropia-2457	35	17	.	.	PUNCT
biotropia-2457	36	1	in	in	ADP
biotropia-2457	36	2	this	this	DET
biotropia-2457	36	3	study	study	NOUN
biotropia-2457	36	4	,	,	PUNCT
biotropia-2457	36	5	we	we	PRON
biotropia-2457	36	6	analyzed	analyze	VERB
biotropia-2457	36	7	the	the	DET
biotropia-2457	36	8	expression	expression	NOUN
biotropia-2457	36	9	of	of	ADP
biotropia-2457	36	10	wx	wx	PROPN
biotropia-2457	36	11	alleles	allele	NOUN
biotropia-2457	36	12	(	(	PUNCT
biotropia-2457	36	13	wxa	wxa	X
biotropia-2457	36	14	,	,	PUNCT
biotropia-2457	36	15	wxb	wxb	NOUN
biotropia-2457	36	16	,	,	PUNCT
biotropia-2457	36	17	and	and	CCONJ
biotropia-2457	36	18	wxc	wxc	VERB
biotropia-2457	36	19	)	)	PUNCT
biotropia-2457	36	20	in	in	ADP
biotropia-2457	36	21	kd4	kd4	PROPN
biotropia-2457	36	22	,	,	PUNCT
biotropia-2457	36	23	bonteb	bonteb	NOUN
biotropia-2457	36	24	gunungkidul	gunungkidul	NOUN
biotropia-2457	36	25	,	,	PUNCT
biotropia-2457	36	26	and	and	CCONJ
biotropia-2457	36	27	their	their	PRON
biotropia-2457	36	28	progenies	progeny	NOUN
biotropia-2457	36	29	.	.	PUNCT
biotropia-2457	37	1	in	in	ADP
biotropia-2457	37	2	addition	addition	NOUN
biotropia-2457	37	3	,	,	PUNCT
biotropia-2457	37	4	we	we	PRON
biotropia-2457	37	5	examined	examine	VERB
biotropia-2457	37	6	the	the	DET
biotropia-2457	37	7	relationship	relationship	NOUN
biotropia-2457	37	8	between	between	ADP
biotropia-2457	37	9	allele	allele	NOUN
biotropia-2457	37	10	expression	expression	NOUN
biotropia-2457	37	11	and	and	CCONJ
biotropia-2457	37	12	amylose	amylose	ADJ
biotropia-2457	37	13	content	content	NOUN
biotropia-2457	37	14	to	to	PART
biotropia-2457	37	15	provide	provide	VERB
biotropia-2457	37	16	a	a	DET
biotropia-2457	37	17	comprehensive	comprehensive	ADJ
biotropia-2457	37	18	understanding	understanding	NOUN
biotropia-2457	37	19	of	of	ADP
biotropia-2457	37	20	how	how	SCONJ
biotropia-2457	37	21	wx	wx	PROPN
biotropia-2457	37	22	alleles	allele	NOUN
biotropia-2457	37	23	contribute	contribute	VERB
biotropia-2457	37	24	to	to	ADP
biotropia-2457	37	25	starch	starch	NOUN
biotropia-2457	37	26	quality	quality	NOUN
biotropia-2457	37	27	.	.	PUNCT
biotropia-2457	38	1	these	these	DET
biotropia-2457	38	2	findings	finding	NOUN
biotropia-2457	38	3	are	be	AUX
biotropia-2457	38	4	expected	expect	VERB
biotropia-2457	38	5	to	to	PART
biotropia-2457	38	6	support	support	VERB
biotropia-2457	38	7	sorghum	sorghum	NOUN
biotropia-2457	38	8	breeding	breeding	NOUN
biotropia-2457	38	9	programs	program	NOUN
biotropia-2457	38	10	in	in	ADP
biotropia-2457	38	11	developing	develop	VERB
biotropia-2457	38	12	varieties	variety	NOUN
biotropia-2457	38	13	with	with	ADP
biotropia-2457	38	14	improved	improved	ADJ
biotropia-2457	38	15	eating	eat	VERB
biotropia-2457	38	16	quality	quality	NOUN
biotropia-2457	38	17	and	and	CCONJ
biotropia-2457	38	18	industrial	industrial	ADJ
biotropia-2457	38	19	potential	potential	NOUN
biotropia-2457	38	20	.	.	PUNCT
biotropia-2457	39	1	materials	material	NOUN
biotropia-2457	39	2	and	and	CCONJ
biotropia-2457	39	3	methods	method	NOUN
biotropia-2457	39	4	materials	material	NOUN
biotropia-2457	39	5	and	and	CCONJ
biotropia-2457	39	6	equipment	equipment	NOUN
biotropia-2457	39	7	this	this	DET
biotropia-2457	39	8	study	study	NOUN
biotropia-2457	39	9	was	be	AUX
biotropia-2457	39	10	conducted	conduct	VERB
biotropia-2457	39	11	at	at	ADP
biotropia-2457	39	12	the	the	DET
biotropia-2457	39	13	laboratory	laboratory	NOUN
biotropia-2457	39	14	of	of	ADP
biotropia-2457	39	15	genetics	genetic	NOUN
biotropia-2457	39	16	and	and	CCONJ
biotropia-2457	39	17	plant	plant	NOUN
biotropia-2457	39	18	breeding	breeding	NOUN
biotropia-2457	39	19	,	,	PUNCT
biotropia-2457	39	20	faculty	faculty	NOUN
biotropia-2457	39	21	of	of	ADP
biotropia-2457	39	22	agriculture	agriculture	NOUN
biotropia-2457	39	23	,	,	PUNCT
biotropia-2457	39	24	gadjah	gadjah	PROPN
biotropia-2457	39	25	mada	mada	PROPN
biotropia-2457	39	26	university	university	PROPN
biotropia-2457	39	27	.	.	PUNCT
biotropia-2457	40	1	leaf	leaf	NOUN
biotropia-2457	40	2	and	and	CCONJ
biotropia-2457	40	3	seed	seed	NOUN
biotropia-2457	40	4	samples	sample	NOUN
biotropia-2457	40	5	from	from	ADP
biotropia-2457	40	6	crosses	crosse	NOUN
biotropia-2457	40	7	between	between	ADP
biotropia-2457	40	8	kd4	kd4	PROPN
biotropia-2457	40	9	and	and	CCONJ
biotropia-2457	40	10	bonteb	bonteb	NOUN
biotropia-2457	40	11	gunungkidul	gunungkidul	NOUN
biotropia-2457	40	12	were	be	AUX
biotropia-2457	40	13	used	use	VERB
biotropia-2457	40	14	as	as	ADP
biotropia-2457	40	15	dna	dna	PROPN
biotropia-2457	40	16	sources	source	NOUN
biotropia-2457	40	17	.	.	PUNCT
biotropia-2457	41	1	dna	dna	PROPN
biotropia-2457	41	2	was	be	AUX
biotropia-2457	41	3	extracted	extract	VERB
biotropia-2457	41	4	using	use	VERB
biotropia-2457	41	5	a	a	DET
biotropia-2457	41	6	modified	modify	VERB
biotropia-2457	41	7	ctab	ctab	NOUN
biotropia-2457	41	8	(	(	PUNCT
biotropia-2457	41	9	cetyl	cetyl	NOUN
biotropia-2457	41	10	trimethyl	trimethyl	PROPN
biotropia-2457	41	11	ammonium	ammonium	NOUN
biotropia-2457	41	12	bromide	bromide	NOUN
biotropia-2457	41	13	)	)	PUNCT
biotropia-2457	41	14	protocol	protocol	NOUN
biotropia-2457	41	15	.	.	PUNCT
biotropia-2457	42	1	specific	specific	ADJ
biotropia-2457	42	2	primers	primer	NOUN
biotropia-2457	42	3	targeting	target	VERB
biotropia-2457	42	4	wxa	wxa	NOUN
biotropia-2457	42	5	,	,	PUNCT
biotropia-2457	42	6	wxb	wxb	NOUN
biotropia-2457	42	7	,	,	PUNCT
biotropia-2457	42	8	and	and	CCONJ
biotropia-2457	42	9	wxc	wxc	NOUN
biotropia-2457	42	10	were	be	AUX
biotropia-2457	42	11	used	use	VERB
biotropia-2457	42	12	for	for	ADP
biotropia-2457	42	13	allele	allele	NOUN
biotropia-2457	42	14	-	-	PUNCT
biotropia-2457	42	15	specific	specific	ADJ
biotropia-2457	42	16	amplification	amplification	NOUN
biotropia-2457	42	17	.	.	PUNCT
biotropia-2457	43	1	standard	standard	ADJ
biotropia-2457	43	2	pcr	pcr	ADJ
biotropia-2457	43	3	reagents	reagent	NOUN
biotropia-2457	43	4	(	(	PUNCT
biotropia-2457	43	5	buffer	buffer	NOUN
biotropia-2457	43	6	,	,	PUNCT
biotropia-2457	43	7	dntps	dntps	NOUN
biotropia-2457	43	8	,	,	PUNCT
biotropia-2457	43	9	taq	taq	PROPN
biotropia-2457	43	10	dna	dna	PROPN
biotropia-2457	43	11	polymerase	polymerase	NOUN
biotropia-2457	43	12	,	,	PUNCT
biotropia-2457	43	13	and	and	CCONJ
biotropia-2457	43	14	mgcl₂	mgcl₂	PROPN
biotropia-2457	43	15	)	)	PUNCT
biotropia-2457	43	16	were	be	AUX
biotropia-2457	43	17	employed	employ	VERB
biotropia-2457	43	18	,	,	PUNCT
biotropia-2457	43	19	and	and	CCONJ
biotropia-2457	43	20	pcr	pcr	PROPN
biotropia-2457	43	21	(	(	PUNCT
biotropia-2457	43	22	polymerase	polymerase	NOUN
biotropia-2457	43	23	chain	chain	NOUN
biotropia-2457	43	24	reaction	reaction	NOUN
biotropia-2457	43	25	)	)	PUNCT
biotropia-2457	43	26	products	product	NOUN
biotropia-2457	43	27	were	be	AUX
biotropia-2457	43	28	separated	separate	VERB
biotropia-2457	43	29	by	by	ADP
biotropia-2457	43	30	1.5	1.5	NUM
biotropia-2457	43	31	%	%	NOUN
biotropia-2457	43	32	agarose	agarose	NOUN
biotropia-2457	43	33	gel	gel	NOUN
biotropia-2457	43	34	electrophoresis	electrophoresis	NOUN
biotropia-2457	43	35	.	.	PUNCT
biotropia-2457	44	1	a	a	DET
biotropia-2457	44	2	nanodrop	nanodrop	NOUN
biotropia-2457	44	3	spectrophotometer	spectrophotometer	NOUN
biotropia-2457	44	4	was	be	AUX
biotropia-2457	44	5	used	use	VERB
biotropia-2457	44	6	to	to	PART
biotropia-2457	44	7	measure	measure	VERB
biotropia-2457	44	8	dna	dna	PROPN
biotropia-2457	44	9	quality	quality	NOUN
biotropia-2457	44	10	and	and	CCONJ
biotropia-2457	44	11	concentration	concentration	NOUN
biotropia-2457	44	12	prior	prior	ADV
biotropia-2457	44	13	to	to	ADP
biotropia-2457	44	14	amplification	amplification	NOUN
biotropia-2457	44	15	.	.	PUNCT
biotropia-2457	45	1	sample	sample	NOUN
biotropia-2457	45	2	collection	collection	NOUN
biotropia-2457	45	3	fresh	fresh	ADJ
biotropia-2457	45	4	leaf	leaf	NOUN
biotropia-2457	45	5	tissues	tissue	NOUN
biotropia-2457	45	6	were	be	AUX
biotropia-2457	45	7	collected	collect	VERB
biotropia-2457	45	8	from	from	ADP
biotropia-2457	45	9	30	30	NUM
biotropia-2457	45	10	individual	individual	ADJ
biotropia-2457	45	11	f2	f2	ADJ
biotropia-2457	45	12	sorghum	sorghum	NOUN
biotropia-2457	45	13	progeny	progeny	NOUN
biotropia-2457	45	14	derived	derive	VERB
biotropia-2457	45	15	from	from	ADP
biotropia-2457	45	16	the	the	DET
biotropia-2457	45	17	cross	cross	NOUN
biotropia-2457	45	18	between	between	ADP
biotropia-2457	45	19	kd4	kd4	PROPN
biotropia-2457	45	20	and	and	CCONJ
biotropia-2457	45	21	bonteb	bonteb	NOUN
biotropia-2457	45	22	gunungkidul	gunungkidul	NOUN
biotropia-2457	45	23	for	for	ADP
biotropia-2457	45	24	molecular	molecular	ADJ
biotropia-2457	45	25	analysis	analysis	NOUN
biotropia-2457	45	26	.	.	PUNCT
biotropia-2457	46	1	genomic	genomic	ADJ
biotropia-2457	46	2	dna	dna	PROPN
biotropia-2457	46	3	was	be	AUX
biotropia-2457	46	4	extracted	extract	VERB
biotropia-2457	46	5	using	use	VERB
biotropia-2457	46	6	a	a	DET
biotropia-2457	46	7	slightly	slightly	ADV
biotropia-2457	46	8	modified	modify	VERB
biotropia-2457	46	9	ctab	ctab	NOUN
biotropia-2457	46	10	method	method	NOUN
biotropia-2457	46	11	(	(	PUNCT
biotropia-2457	46	12	doyle	doyle	PROPN
biotropia-2457	46	13	&	&	CCONJ
biotropia-2457	46	14	doyle	doyle	PROPN
biotropia-2457	46	15	1990	1990	NUM
biotropia-2457	46	16	)	)	PUNCT
biotropia-2457	46	17	to	to	PART
biotropia-2457	46	18	improve	improve	VERB
biotropia-2457	46	19	purity	purity	NOUN
biotropia-2457	46	20	and	and	CCONJ
biotropia-2457	46	21	yield	yield	NOUN
biotropia-2457	46	22	,	,	PUNCT
biotropia-2457	46	23	while	while	SCONJ
biotropia-2457	46	24	seeds	seed	NOUN
biotropia-2457	46	25	were	be	AUX
biotropia-2457	46	26	stored	store	VERB
biotropia-2457	46	27	for	for	ADP
biotropia-2457	46	28	further	further	ADJ
biotropia-2457	46	29	evaluation	evaluation	NOUN
biotropia-2457	46	30	.	.	PUNCT
biotropia-2457	47	1	biotropia	biotropia	ADJ
biotropia-2457	47	2	vol	vol	NOUN
biotropia-2457	47	3	.	.	PUNCT
biotropia-2457	48	1	32	32	NUM
biotropia-2457	48	2	no	no	NOUN
biotropia-2457	48	3	.	.	NOUN
biotropia-2457	49	1	3	3	NUM
biotropia-2457	49	2	,	,	PUNCT
biotropia-2457	49	3	2025	2025	NUM
biotropia-2457	49	4	330	330	NUM
biotropia-2457	49	5	dna	dna	PROPN
biotropia-2457	49	6	extraction	extraction	NOUN
biotropia-2457	49	7	genomic	genomic	NOUN
biotropia-2457	49	8	dna	dna	PROPN
biotropia-2457	49	9	was	be	AUX
biotropia-2457	49	10	isolated	isolate	VERB
biotropia-2457	49	11	using	use	VERB
biotropia-2457	49	12	a	a	DET
biotropia-2457	49	13	slightly	slightly	ADV
biotropia-2457	49	14	modified	modify	VERB
biotropia-2457	49	15	ctab	ctab	NOUN
biotropia-2457	49	16	method	method	NOUN
biotropia-2457	49	17	(	(	PUNCT
biotropia-2457	49	18	doyle	doyle	PROPN
biotropia-2457	49	19	&	&	CCONJ
biotropia-2457	49	20	doyle	doyle	PROPN
biotropia-2457	49	21	1990	1990	NUM
biotropia-2457	49	22	)	)	PUNCT
biotropia-2457	49	23	to	to	PART
biotropia-2457	49	24	improve	improve	VERB
biotropia-2457	49	25	purity	purity	NOUN
biotropia-2457	49	26	.	.	PUNCT
biotropia-2457	50	1	the	the	DET
biotropia-2457	50	2	procedure	procedure	NOUN
biotropia-2457	50	3	involved	involve	VERB
biotropia-2457	50	4	grinding	grind	VERB
biotropia-2457	50	5	leaf	leaf	NOUN
biotropia-2457	50	6	tissue	tissue	NOUN
biotropia-2457	50	7	in	in	ADP
biotropia-2457	50	8	liquid	liquid	ADJ
biotropia-2457	50	9	nitrogen	nitrogen	NOUN
biotropia-2457	50	10	,	,	PUNCT
biotropia-2457	50	11	incubating	incubate	VERB
biotropia-2457	50	12	in	in	ADP
biotropia-2457	50	13	ctab	ctab	ADJ
biotropia-2457	50	14	extraction	extraction	NOUN
biotropia-2457	50	15	buffer	buffer	NOUN
biotropia-2457	50	16	at	at	ADP
biotropia-2457	50	17	65	65	NUM
biotropia-2457	50	18	°	°	NOUN
biotropia-2457	50	19	c	c	NOUN
biotropia-2457	50	20	,	,	PUNCT
biotropia-2457	50	21	separating	separate	VERB
biotropia-2457	50	22	phases	phase	NOUN
biotropia-2457	50	23	with	with	ADP
biotropia-2457	50	24	chloroform	chloroform	NOUN
biotropia-2457	50	25	–	–	PUNCT
biotropia-2457	50	26	isoamyl	isoamyl	NOUN
biotropia-2457	50	27	alcohol	alcohol	NOUN
biotropia-2457	50	28	,	,	PUNCT
biotropia-2457	50	29	precipitating	precipitate	VERB
biotropia-2457	50	30	dna	dna	NOUN
biotropia-2457	50	31	with	with	ADP
biotropia-2457	50	32	isopropanol	isopropanol	NOUN
biotropia-2457	50	33	,	,	PUNCT
biotropia-2457	50	34	and	and	CCONJ
biotropia-2457	50	35	washing	washing	NOUN
biotropia-2457	50	36	with	with	ADP
biotropia-2457	50	37	70	70	NUM
biotropia-2457	50	38	%	%	NOUN
biotropia-2457	50	39	ethanol	ethanol	NOUN
biotropia-2457	50	40	.	.	PUNCT
biotropia-2457	51	1	the	the	DET
biotropia-2457	51	2	resulting	result	VERB
biotropia-2457	51	3	dna	dna	NOUN
biotropia-2457	51	4	was	be	AUX
biotropia-2457	51	5	dissolved	dissolve	VERB
biotropia-2457	51	6	in	in	ADP
biotropia-2457	51	7	te	te	ADP
biotropia-2457	51	8	buffer	buffer	NOUN
biotropia-2457	51	9	and	and	CCONJ
biotropia-2457	51	10	stored	store	VERB
biotropia-2457	51	11	at	at	ADP
biotropia-2457	51	12	-20	-20	NUM
biotropia-2457	51	13	°	°	PROPN
biotropia-2457	51	14	c	c	NOUN
biotropia-2457	51	15	.	.	PUNCT
biotropia-2457	52	1	dna	dna	PROPN
biotropia-2457	52	2	quality	quality	NOUN
biotropia-2457	52	3	and	and	CCONJ
biotropia-2457	52	4	concentration	concentration	NOUN
biotropia-2457	52	5	were	be	AUX
biotropia-2457	52	6	assessed	assess	VERB
biotropia-2457	52	7	using	use	VERB
biotropia-2457	52	8	a	a	DET
biotropia-2457	52	9	nanodrop	nanodrop	NOUN
biotropia-2457	52	10	spectrophotometer	spectrophotometer	NOUN
biotropia-2457	52	11	at	at	ADP
biotropia-2457	52	12	260/280	260/280	PROPN
biotropia-2457	52	13	nm	nm	NOUN
biotropia-2457	52	14	.	.	PUNCT
biotropia-2457	53	1	pcr	pcr	ADJ
biotropia-2457	53	2	amplification	amplification	NOUN
biotropia-2457	53	3	pcr	pcr	NOUN
biotropia-2457	53	4	was	be	AUX
biotropia-2457	53	5	conducted	conduct	VERB
biotropia-2457	53	6	to	to	PART
biotropia-2457	53	7	amplify	amplify	VERB
biotropia-2457	53	8	waxy	waxy	NOUN
biotropia-2457	53	9	genes	gene	NOUN
biotropia-2457	53	10	(	(	PUNCT
biotropia-2457	53	11	wxa	wxa	X
biotropia-2457	53	12	,	,	PUNCT
biotropia-2457	53	13	wxb	wxb	PRON
biotropia-2457	53	14	,	,	PUNCT
biotropia-2457	53	15	wxc	wxc	NOUN
biotropia-2457	53	16	)	)	PUNCT
biotropia-2457	53	17	using	use	VERB
biotropia-2457	53	18	specific	specific	ADJ
biotropia-2457	53	19	primers	primer	NOUN
biotropia-2457	53	20	(	(	PUNCT
biotropia-2457	53	21	table	table	NOUN
biotropia-2457	53	22	1	1	NUM
biotropia-2457	53	23	)	)	PUNCT
biotropia-2457	53	24	.	.	PUNCT
biotropia-2457	54	1	the	the	DET
biotropia-2457	54	2	reaction	reaction	NOUN
biotropia-2457	54	3	mixture	mixture	NOUN
biotropia-2457	54	4	(	(	PUNCT
biotropia-2457	54	5	25	25	NUM
biotropia-2457	54	6	µl	µl	NOUN
biotropia-2457	54	7	)	)	PUNCT
biotropia-2457	54	8	consisted	consist	VERB
biotropia-2457	54	9	of	of	ADP
biotropia-2457	54	10	pcr	pcr	NOUN
biotropia-2457	54	11	master	master	NOUN
biotropia-2457	54	12	mix	mix	NOUN
biotropia-2457	54	13	,	,	PUNCT
biotropia-2457	54	14	dna	dna	NOUN
biotropia-2457	54	15	template	template	NOUN
biotropia-2457	54	16	(	(	PUNCT
biotropia-2457	54	17	50	50	NUM
biotropia-2457	54	18	ng/µl	ng/µl	NUM
biotropia-2457	54	19	)	)	PUNCT
biotropia-2457	54	20	,	,	PUNCT
biotropia-2457	54	21	forward	forward	ADV
biotropia-2457	54	22	and	and	CCONJ
biotropia-2457	54	23	reverse	reverse	VERB
biotropia-2457	54	24	primers	primer	NOUN
biotropia-2457	54	25	(	(	PUNCT
biotropia-2457	54	26	10	10	NUM
biotropia-2457	54	27	µm	µm	ADP
biotropia-2457	54	28	each	each	PRON
biotropia-2457	54	29	)	)	PUNCT
biotropia-2457	54	30	,	,	PUNCT
biotropia-2457	54	31	and	and	CCONJ
biotropia-2457	54	32	ddh₂o	ddh₂o	PROPN
biotropia-2457	54	33	.	.	PUNCT
biotropia-2457	55	1	amplification	amplification	NOUN
biotropia-2457	55	2	was	be	AUX
biotropia-2457	55	3	performed	perform	VERB
biotropia-2457	55	4	in	in	ADP
biotropia-2457	55	5	a	a	DET
biotropia-2457	55	6	thermal	thermal	ADJ
biotropia-2457	55	7	cycler	cycler	NOUN
biotropia-2457	55	8	with	with	ADP
biotropia-2457	55	9	an	an	DET
biotropia-2457	55	10	initial	initial	ADJ
biotropia-2457	55	11	denaturation	denaturation	NOUN
biotropia-2457	55	12	at	at	ADP
biotropia-2457	55	13	95	95	NUM
biotropia-2457	55	14	°	°	ADP
biotropia-2457	55	15	c	c	NOUN
biotropia-2457	55	16	for	for	ADP
biotropia-2457	55	17	5	5	NUM
biotropia-2457	55	18	minutes	minute	NOUN
biotropia-2457	55	19	,	,	PUNCT
biotropia-2457	55	20	followed	follow	VERB
biotropia-2457	55	21	with	with	ADP
biotropia-2457	55	22	35	35	NUM
biotropia-2457	55	23	cycles	cycle	NOUN
biotropia-2457	55	24	of	of	ADP
biotropia-2457	55	25	denaturation	denaturation	NOUN
biotropia-2457	55	26	(	(	PUNCT
biotropia-2457	55	27	95	95	NUM
biotropia-2457	55	28	°	°	NOUN
biotropia-2457	55	29	c	c	NOUN
biotropia-2457	55	30	,	,	PUNCT
biotropia-2457	55	31	30	30	NUM
biotropia-2457	55	32	seconds	second	NOUN
biotropia-2457	55	33	)	)	PUNCT
biotropia-2457	55	34	,	,	PUNCT
biotropia-2457	55	35	annealing	anneal	VERB
biotropia-2457	55	36	(	(	PUNCT
biotropia-2457	55	37	50	50	NUM
biotropia-2457	55	38	–	–	SYM
biotropia-2457	55	39	60	60	NUM
biotropia-2457	55	40	°	°	NOUN
biotropia-2457	55	41	c	c	NOUN
biotropia-2457	55	42	,	,	PUNCT
biotropia-2457	55	43	30	30	NUM
biotropia-2457	55	44	seconds	second	NOUN
biotropia-2457	55	45	)	)	PUNCT
biotropia-2457	55	46	,	,	PUNCT
biotropia-2457	55	47	and	and	CCONJ
biotropia-2457	55	48	extension	extension	NOUN
biotropia-2457	55	49	(	(	PUNCT
biotropia-2457	55	50	72	72	NUM
biotropia-2457	55	51	°	°	NOUN
biotropia-2457	55	52	c	c	NOUN
biotropia-2457	55	53	,	,	PUNCT
biotropia-2457	55	54	1	1	NUM
biotropia-2457	55	55	minute	minute	NOUN
biotropia-2457	55	56	)	)	PUNCT
biotropia-2457	55	57	.	.	PUNCT
biotropia-2457	56	1	a	a	DET
biotropia-2457	56	2	final	final	ADJ
biotropia-2457	56	3	extension	extension	NOUN
biotropia-2457	56	4	at	at	ADP
biotropia-2457	56	5	72	72	NUM
biotropia-2457	56	6	°	°	ADP
biotropia-2457	56	7	c	c	NOUN
biotropia-2457	56	8	for	for	ADP
biotropia-2457	56	9	10	10	NUM
biotropia-2457	56	10	minutes	minute	NOUN
biotropia-2457	56	11	was	be	AUX
biotropia-2457	56	12	applied	apply	VERB
biotropia-2457	56	13	before	before	SCONJ
biotropia-2457	56	14	the	the	DET
biotropia-2457	56	15	samples	sample	NOUN
biotropia-2457	56	16	were	be	AUX
biotropia-2457	56	17	stored	store	VERB
biotropia-2457	56	18	at	at	ADP
biotropia-2457	56	19	4	4	NUM
biotropia-2457	56	20	°	°	NOUN
biotropia-2457	56	21	c	c	NOUN
biotropia-2457	56	22	.	.	PUNCT
biotropia-2457	57	1	gel	gel	NOUN
biotropia-2457	57	2	electrophoresis	electrophoresis	NOUN
biotropia-2457	57	3	and	and	CCONJ
biotropia-2457	57	4	visualization	visualization	NOUN
biotropia-2457	57	5	pcr	pcr	NOUN
biotropia-2457	57	6	products	product	NOUN
biotropia-2457	57	7	were	be	AUX
biotropia-2457	57	8	resolved	resolve	VERB
biotropia-2457	57	9	by	by	ADP
biotropia-2457	57	10	1.5	1.5	NUM
biotropia-2457	57	11	%	%	NOUN
biotropia-2457	57	12	agarose	agarose	NOUN
biotropia-2457	57	13	gel	gel	NOUN
biotropia-2457	57	14	electrophoresis	electrophoresis	NOUN
biotropia-2457	57	15	in	in	ADP
biotropia-2457	57	16	tbe	tbe	NOUN
biotropia-2457	57	17	buffer	buffer	NOUN
biotropia-2457	57	18	at	at	ADP
biotropia-2457	57	19	100	100	NUM
biotropia-2457	57	20	v	v	NOUN
biotropia-2457	57	21	for	for	ADP
biotropia-2457	57	22	45	45	NUM
biotropia-2457	57	23	minutes	minute	NOUN
biotropia-2457	57	24	.	.	PUNCT
biotropia-2457	58	1	gels	gel	NOUN
biotropia-2457	58	2	were	be	AUX
biotropia-2457	58	3	stained	stain	VERB
biotropia-2457	58	4	with	with	ADP
biotropia-2457	58	5	ethidium	ethidium	NOUN
biotropia-2457	58	6	bromide	bromide	NOUN
biotropia-2457	58	7	or	or	CCONJ
biotropia-2457	58	8	sybr	sybr	VERB
biotropia-2457	58	9	safe	safe	ADJ
biotropia-2457	58	10	and	and	CCONJ
biotropia-2457	58	11	visualized	visualize	VERB
biotropia-2457	58	12	under	under	ADP
biotropia-2457	58	13	uv	uv	NOUN
biotropia-2457	58	14	light	light	NOUN
biotropia-2457	58	15	.	.	PUNCT
biotropia-2457	59	1	banding	banding	NOUN
biotropia-2457	59	2	patterns	pattern	NOUN
biotropia-2457	59	3	were	be	AUX
biotropia-2457	59	4	compared	compare	VERB
biotropia-2457	59	5	with	with	ADP
biotropia-2457	59	6	positive	positive	ADJ
biotropia-2457	59	7	and	and	CCONJ
biotropia-2457	59	8	negative	negative	ADJ
biotropia-2457	59	9	controls	control	NOUN
biotropia-2457	59	10	to	to	PART
biotropia-2457	59	11	confirm	confirm	VERB
biotropia-2457	59	12	allele	allele	NOUN
biotropia-2457	59	13	-	-	PUNCT
biotropia-2457	59	14	specific	specific	ADJ
biotropia-2457	59	15	amplification	amplification	NOUN
biotropia-2457	59	16	.	.	PUNCT
biotropia-2457	60	1	data	datum	NOUN
biotropia-2457	60	2	analysis	analysis	NOUN
biotropia-2457	60	3	electrophoresis	electrophoresis	NOUN
biotropia-2457	60	4	results	result	NOUN
biotropia-2457	60	5	were	be	AUX
biotropia-2457	60	6	analyzed	analyze	VERB
biotropia-2457	60	7	using	use	VERB
biotropia-2457	60	8	imagej	imagej	ADJ
biotropia-2457	60	9	or	or	CCONJ
biotropia-2457	60	10	gelanalyzer	gelanalyzer	NOUN
biotropia-2457	60	11	software	software	NOUN
biotropia-2457	60	12	to	to	PART
biotropia-2457	60	13	quantify	quantify	VERB
biotropia-2457	60	14	band	band	NOUN
biotropia-2457	60	15	intensity	intensity	NOUN
biotropia-2457	60	16	.	.	PUNCT
biotropia-2457	61	1	data	datum	NOUN
biotropia-2457	61	2	were	be	AUX
biotropia-2457	61	3	summarized	summarize	VERB
biotropia-2457	61	4	as	as	ADP
biotropia-2457	61	5	gel	gel	NOUN
biotropia-2457	61	6	images	image	NOUN
biotropia-2457	61	7	,	,	PUNCT
biotropia-2457	61	8	tables	table	NOUN
biotropia-2457	61	9	,	,	PUNCT
biotropia-2457	61	10	and	and	CCONJ
biotropia-2457	61	11	allele	allele	NOUN
biotropia-2457	61	12	distribution	distribution	NOUN
biotropia-2457	61	13	charts	chart	NOUN
biotropia-2457	61	14	.	.	PUNCT
biotropia-2457	62	1	statistical	statistical	ADJ
biotropia-2457	62	2	analyses	analysis	NOUN
biotropia-2457	62	3	included	include	VERB
biotropia-2457	62	4	:	:	PUNCT
biotropia-2457	62	5	(	(	PUNCT
biotropia-2457	62	6	a	a	X
biotropia-2457	62	7	)	)	PUNCT
biotropia-2457	62	8	chi	chi	ADJ
biotropia-2457	62	9	-	-	PUNCT
biotropia-2457	62	10	square	square	NOUN
biotropia-2457	62	11	analysis	analysis	NOUN
biotropia-2457	62	12	to	to	PART
biotropia-2457	62	13	assess	assess	VERB
biotropia-2457	62	14	segregation	segregation	NOUN
biotropia-2457	62	15	patterns	pattern	NOUN
biotropia-2457	62	16	;	;	PUNCT
biotropia-2457	62	17	(	(	PUNCT
biotropia-2457	62	18	b	b	X
biotropia-2457	62	19	)	)	PUNCT
biotropia-2457	62	20	allele	allele	NOUN
biotropia-2457	62	21	frequency	frequency	NOUN
biotropia-2457	62	22	analysis	analysis	NOUN
biotropia-2457	62	23	to	to	PART
biotropia-2457	62	24	estimate	estimate	VERB
biotropia-2457	62	25	genotype	genotype	NOUN
biotropia-2457	62	26	distribution	distribution	NOUN
biotropia-2457	62	27	;	;	PUNCT
biotropia-2457	62	28	and	and	CCONJ
biotropia-2457	62	29	(	(	PUNCT
biotropia-2457	62	30	c	c	X
biotropia-2457	62	31	)	)	PUNCT
biotropia-2457	62	32	pearson	pearson	NOUN
biotropia-2457	62	33	correlation	correlation	NOUN
biotropia-2457	62	34	to	to	PART
biotropia-2457	62	35	examine	examine	VERB
biotropia-2457	62	36	relationships	relationship	NOUN
biotropia-2457	62	37	between	between	ADP
biotropia-2457	62	38	waxy	waxy	NOUN
biotropia-2457	62	39	allele	allele	NOUN
biotropia-2457	62	40	expression	expression	NOUN
biotropia-2457	62	41	and	and	CCONJ
biotropia-2457	62	42	amylose	amylose	ADJ
biotropia-2457	62	43	content	content	NOUN
biotropia-2457	62	44	.	.	PUNCT
biotropia-2457	63	1	these	these	DET
biotropia-2457	63	2	analyses	analysis	NOUN
biotropia-2457	63	3	provided	provide	VERB
biotropia-2457	63	4	insights	insight	NOUN
biotropia-2457	63	5	into	into	ADP
biotropia-2457	63	6	the	the	DET
biotropia-2457	63	7	effectiveness	effectiveness	NOUN
biotropia-2457	63	8	of	of	ADP
biotropia-2457	63	9	molecular	molecular	ADJ
biotropia-2457	63	10	marker	marker	NOUN
biotropia-2457	63	11	-	-	PUNCT
biotropia-2457	63	12	based	base	VERB
biotropia-2457	63	13	selection	selection	NOUN
biotropia-2457	63	14	for	for	ADP
biotropia-2457	63	15	waxy	waxy	NOUN
biotropia-2457	63	16	sorghum	sorghum	NOUN
biotropia-2457	63	17	improvement	improvement	NOUN
biotropia-2457	63	18	.	.	PUNCT
biotropia-2457	64	1	results	result	NOUN
biotropia-2457	64	2	and	and	CCONJ
biotropia-2457	64	3	discussion	discussion	NOUN
biotropia-2457	64	4	pcr	pcr	ADJ
biotropia-2457	64	5	analysis	analysis	NOUN
biotropia-2457	64	6	results	result	VERB
biotropia-2457	64	7	electrophoresis	electrophoresis	NOUN
biotropia-2457	64	8	results	result	NOUN
biotropia-2457	64	9	indicated	indicate	VERB
biotropia-2457	64	10	that	that	SCONJ
biotropia-2457	64	11	only	only	ADV
biotropia-2457	64	12	the	the	DET
biotropia-2457	64	13	wxc	wxc	NOUN
biotropia-2457	64	14	allele	allele	NOUN
biotropia-2457	64	15	exhibited	exhibit	VERB
biotropia-2457	64	16	clear	clear	ADJ
biotropia-2457	64	17	amplification	amplification	NOUN
biotropia-2457	64	18	bands	band	NOUN
biotropia-2457	64	19	,	,	PUNCT
biotropia-2457	64	20	while	while	SCONJ
biotropia-2457	64	21	both	both	PRON
biotropia-2457	64	22	wxa	wxa	NOUN
biotropia-2457	64	23	and	and	CCONJ
biotropia-2457	64	24	wxb	wxb	PRON
biotropia-2457	64	25	showed	show	VERB
biotropia-2457	64	26	no	no	DET
biotropia-2457	64	27	significant	significant	ADJ
biotropia-2457	64	28	amplification	amplification	NOUN
biotropia-2457	64	29	(	(	PUNCT
biotropia-2457	64	30	fig	fig	NOUN
biotropia-2457	64	31	.	.	PUNCT
biotropia-2457	64	32	1	1	NUM
biotropia-2457	64	33	)	)	PUNCT
biotropia-2457	64	34	.	.	PUNCT
biotropia-2457	65	1	this	this	DET
biotropia-2457	65	2	pattern	pattern	NOUN
biotropia-2457	65	3	was	be	AUX
biotropia-2457	65	4	consistent	consistent	ADJ
biotropia-2457	65	5	across	across	ADP
biotropia-2457	65	6	all	all	DET
biotropia-2457	65	7	30	30	NUM
biotropia-2457	65	8	f2	f2	PROPN
biotropia-2457	65	9	samples	sample	NOUN
biotropia-2457	65	10	analyzed	analyze	VERB
biotropia-2457	65	11	,	,	PUNCT
biotropia-2457	65	12	confirming	confirm	VERB
biotropia-2457	65	13	that	that	SCONJ
biotropia-2457	65	14	wxc	wxc	NOUN
biotropia-2457	65	15	was	be	AUX
biotropia-2457	65	16	the	the	DET
biotropia-2457	65	17	only	only	ADJ
biotropia-2457	65	18	allele	allele	NOUN
biotropia-2457	65	19	expressed	express	VERB
biotropia-2457	65	20	in	in	ADP
biotropia-2457	65	21	the	the	DET
biotropia-2457	65	22	studied	study	VERB
biotropia-2457	65	23	populations	population	NOUN
biotropia-2457	65	24	.	.	PUNCT
biotropia-2457	66	1	the	the	DET
biotropia-2457	66	2	results	result	NOUN
biotropia-2457	66	3	suggest	suggest	VERB
biotropia-2457	66	4	several	several	ADJ
biotropia-2457	66	5	underlying	underlie	VERB
biotropia-2457	66	6	factors	factor	NOUN
biotropia-2457	66	7	that	that	PRON
biotropia-2457	66	8	could	could	AUX
biotropia-2457	66	9	contribute	contribute	VERB
biotropia-2457	66	10	to	to	ADP
biotropia-2457	66	11	this	this	DET
biotropia-2457	66	12	observation	observation	NOUN
biotropia-2457	66	13	,	,	PUNCT
biotropia-2457	66	14	which	which	PRON
biotropia-2457	66	15	is	be	AUX
biotropia-2457	66	16	often	often	ADV
biotropia-2457	66	17	associated	associate	VERB
biotropia-2457	66	18	with	with	ADP
biotropia-2457	66	19	primer	primer	NOUN
biotropia-2457	66	20	specificity	specificity	NOUN
biotropia-2457	66	21	,	,	PUNCT
biotropia-2457	66	22	genetic	genetic	ADJ
biotropia-2457	66	23	mutations	mutation	NOUN
biotropia-2457	66	24	,	,	PUNCT
biotropia-2457	66	25	and	and	CCONJ
biotropia-2457	66	26	pcr	pcr	ADJ
biotropia-2457	66	27	optimization	optimization	NOUN
biotropia-2457	66	28	issues	issue	NOUN
biotropia-2457	66	29	(	(	PUNCT
biotropia-2457	66	30	yang	yang	PROPN
biotropia-2457	66	31	et	et	PROPN
biotropia-2457	66	32	al	al	PROPN
biotropia-2457	66	33	.	.	PROPN
biotropia-2457	66	34	2013	2013	NUM
biotropia-2457	66	35	)	)	PUNCT
biotropia-2457	66	36	.	.	PUNCT
biotropia-2457	67	1	one	one	NUM
biotropia-2457	67	2	primary	primary	ADJ
biotropia-2457	67	3	consideration	consideration	NOUN
biotropia-2457	67	4	is	be	AUX
biotropia-2457	67	5	the	the	DET
biotropia-2457	67	6	specificity	specificity	NOUN
biotropia-2457	67	7	and	and	CCONJ
biotropia-2457	67	8	binding	bind	VERB
biotropia-2457	67	9	efficiency	efficiency	NOUN
biotropia-2457	67	10	of	of	ADP
biotropia-2457	67	11	the	the	DET
biotropia-2457	67	12	primers	primer	NOUN
biotropia-2457	67	13	used	use	VERB
biotropia-2457	67	14	during	during	ADP
biotropia-2457	67	15	the	the	DET
biotropia-2457	67	16	polymerase	polymerase	NOUN
biotropia-2457	67	17	chain	chain	NOUN
biotropia-2457	67	18	reaction	reaction	NOUN
biotropia-2457	67	19	(	(	PUNCT
biotropia-2457	67	20	pcr	pcr	PROPN
biotropia-2457	67	21	)	)	PUNCT
biotropia-2457	67	22	.	.	PUNCT
biotropia-2457	68	1	primers	primer	NOUN
biotropia-2457	68	2	are	be	AUX
biotropia-2457	68	3	short	short	ADJ
biotropia-2457	68	4	sequences	sequence	NOUN
biotropia-2457	68	5	of	of	ADP
biotropia-2457	68	6	nucleotides	nucleotide	NOUN
biotropia-2457	68	7	that	that	PRON
biotropia-2457	68	8	anneal	anneal	VERB
biotropia-2457	68	9	to	to	ADP
biotropia-2457	68	10	specific	specific	ADJ
biotropia-2457	68	11	regions	region	NOUN
biotropia-2457	68	12	of	of	ADP
biotropia-2457	68	13	the	the	DET
biotropia-2457	68	14	dna	dna	PROPN
biotropia-2457	68	15	template	template	NOUN
biotropia-2457	68	16	to	to	PART
biotropia-2457	68	17	initiate	initiate	VERB
biotropia-2457	68	18	amplification	amplification	NOUN
biotropia-2457	68	19	.	.	PUNCT
biotropia-2457	69	1	if	if	SCONJ
biotropia-2457	69	2	the	the	DET
biotropia-2457	69	3	primers	primer	NOUN
biotropia-2457	69	4	are	be	AUX
biotropia-2457	69	5	designed	design	VERB
biotropia-2457	69	6	based	base	VERB
biotropia-2457	69	7	on	on	ADP
biotropia-2457	69	8	sequences	sequence	NOUN
biotropia-2457	69	9	unique	unique	ADJ
biotropia-2457	69	10	to	to	ADP
biotropia-2457	69	11	the	the	DET
biotropia-2457	69	12	wxc	wxc	NOUN
biotropia-2457	69	13	allele	allele	NOUN
biotropia-2457	69	14	,	,	PUNCT
biotropia-2457	69	15	they	they	PRON
biotropia-2457	69	16	may	may	AUX
biotropia-2457	69	17	not	not	PART
biotropia-2457	69	18	effectively	effectively	ADV
biotropia-2457	69	19	bind	bind	VERB
biotropia-2457	69	20	to	to	ADP
biotropia-2457	69	21	the	the	DET
biotropia-2457	69	22	wxa	wxa	NOUN
biotropia-2457	69	23	and	and	CCONJ
biotropia-2457	69	24	wxb	wxb	VERB
biotropia-2457	69	25	alleles	allele	NOUN
biotropia-2457	69	26	due	due	ADJ
biotropia-2457	69	27	to	to	ADP
biotropia-2457	69	28	sequence	sequence	NOUN
biotropia-2457	69	29	variations	variation	NOUN
biotropia-2457	69	30	,	,	PUNCT
biotropia-2457	69	31	leading	lead	VERB
biotropia-2457	69	32	to	to	ADP
biotropia-2457	69	33	preferential	preferential	ADJ
biotropia-2457	69	34	amplification	amplification	NOUN
biotropia-2457	69	35	of	of	ADP
biotropia-2457	69	36	the	the	DET
biotropia-2457	69	37	wxc	wxc	NOUN
biotropia-2457	69	38	allele	allele	NOUN
biotropia-2457	69	39	.	.	PUNCT
biotropia-2457	70	1	a	a	DET
biotropia-2457	70	2	study	study	NOUN
biotropia-2457	70	3	by	by	ADP
biotropia-2457	70	4	teng	teng	PROPN
biotropia-2457	70	5	et	et	PROPN
biotropia-2457	70	6	al	al	PROPN
biotropia-2457	70	7	.	.	PROPN
biotropia-2457	70	8	(	(	PUNCT
biotropia-2457	70	9	2012	2012	NUM
biotropia-2457	70	10	)	)	PUNCT
biotropia-2457	70	11	emphasized	emphasize	VERB
biotropia-2457	70	12	the	the	DET
biotropia-2457	70	13	importance	importance	NOUN
biotropia-2457	70	14	of	of	ADP
biotropia-2457	70	15	meticulous	meticulous	ADJ
biotropia-2457	70	16	primer	primer	NOUN
biotropia-2457	70	17	design	design	NOUN
biotropia-2457	70	18	to	to	PART
biotropia-2457	70	19	ensure	ensure	VERB
biotropia-2457	70	20	that	that	SCONJ
biotropia-2457	70	21	all	all	DET
biotropia-2457	70	22	target	target	NOUN
biotropia-2457	70	23	alleles	allele	NOUN
biotropia-2457	70	24	are	be	AUX
biotropia-2457	70	25	equally	equally	ADV
biotropia-2457	70	26	recognized	recognize	VERB
biotropia-2457	70	27	and	and	CCONJ
biotropia-2457	70	28	amplified	amplify	VERB
biotropia-2457	70	29	during	during	ADP
biotropia-2457	70	30	pcr	pcr	PROPN
biotropia-2457	71	1	.	.	PUNCT
biotropia-2457	71	2	table	table	NOUN
biotropia-2457	71	3	1	1	NUM
biotropia-2457	71	4	specific	specific	ADJ
biotropia-2457	71	5	primers	primer	NOUN
biotropia-2457	71	6	for	for	ADP
biotropia-2457	71	7	identification	identification	NOUN
biotropia-2457	71	8	of	of	ADP
biotropia-2457	71	9	waxy	waxy	NOUN
biotropia-2457	71	10	genes	gene	NOUN
biotropia-2457	71	11	in	in	ADP
biotropia-2457	71	12	sorghum	sorghum	NOUN
biotropia-2457	71	13	allele	allele	NOUN
biotropia-2457	71	14	type	type	NOUN
biotropia-2457	71	15	primer	primer	NOUN
biotropia-2457	71	16	(	(	PUNCT
biotropia-2457	71	17	5’-3	5’-3	PROPN
biotropia-2457	71	18	’	'	PUNCT
biotropia-2457	71	19	)	)	PUNCT
biotropia-2457	71	20	temperature/	temperature/	NUM
biotropia-2457	71	21	annealing	annealing	NOUN
biotropia-2457	71	22	(	(	PUNCT
biotropia-2457	71	23	°	°	ADP
biotropia-2457	71	24	c	c	NOUN
biotropia-2457	71	25	)	)	PUNCT
biotropia-2457	71	26	band	band	NOUN
biotropia-2457	71	27	size	size	NOUN
biotropia-2457	71	28	(	(	PUNCT
biotropia-2457	71	29	pb	pb	NOUN
biotropia-2457	71	30	)	)	PUNCT
biotropia-2457	71	31	reference	reference	NOUN
biotropia-2457	71	32	wxa	wxa	NOUN
biotropia-2457	71	33	f1	f1	PROPN
biotropia-2457	71	34	:	:	PUNCT
biotropia-2457	71	35	cgtggcgagatcaaactcta	cgtggcgagatcaaactcta	NOUN
biotropia-2457	71	36	60.0	60.0	NUM
biotropia-2457	71	37	non	non	NOUN
biotropia-2457	71	38	waxy	waxy	NOUN
biotropia-2457	71	39	:	:	PUNCT
biotropia-2457	71	40	523	523	NUM
biotropia-2457	71	41	wang	wang	PROPN
biotropia-2457	71	42	et	et	PROPN
biotropia-2457	71	43	al	al	PROPN
biotropia-2457	71	44	.	.	PROPN
biotropia-2457	72	1	(	(	PUNCT
biotropia-2457	72	2	2023)f2	2023)f2	NUM
biotropia-2457	72	3	:	:	PUNCT
biotropia-2457	72	4	ggcctggattcaatgttctt	ggcctggattcaatgttctt	ADJ
biotropia-2457	72	5	waxy	waxy	NOUN
biotropia-2457	72	6	:	:	PUNCT
biotropia-2457	72	7	615	615	NUM
biotropia-2457	72	8	r	r	NOUN
biotropia-2457	72	9	:	:	PUNCT
biotropia-2457	72	10	gcagctggttgtccttgtag	gcagctggttgtccttgtag	NOUN
biotropia-2457	72	11	wxb	wxb	NOUN
biotropia-2457	72	12	f	f	X
biotropia-2457	72	13	:	:	PUNCT
biotropia-2457	72	14	cgaccgtgtgttcattgaccac	cgaccgtgtgttcattgaccac	PROPN
biotropia-2457	72	15	61.0	61.0	NUM
biotropia-2457	72	16	non	non	ADJ
biotropia-2457	72	17	waxy	waxy	NOUN
biotropia-2457	72	18	:	:	PUNCT
biotropia-2457	72	19	1,281	1,281	NUM
biotropia-2457	72	20	wang	wang	PROPN
biotropia-2457	72	21	et	et	PROPN
biotropia-2457	72	22	al	al	PROPN
biotropia-2457	72	23	.	.	PROPN
biotropia-2457	73	1	(	(	PUNCT
biotropia-2457	73	2	2023	2023	NUM
biotropia-2457	73	3	)	)	PUNCT
biotropia-2457	73	4	r	r	NOUN
biotropia-2457	73	5	:	:	PUNCT
biotropia-2457	73	6	ttgttcagtgccttgcctcg	ttgttcagtgccttgcctcg	NOUN
biotropia-2457	73	7	waxy	waxy	NOUN
biotropia-2457	73	8	:	:	PUNCT
biotropia-2457	73	9	745	745	NUM
biotropia-2457	73	10	+	+	SYM
biotropia-2457	73	11	537	537	NUM
biotropia-2457	73	12	wxc	wxc	NOUN
biotropia-2457	73	13	f	f	NUM
biotropia-2457	73	14	:	:	PUNCT
biotropia-2457	73	15	gctggttctgagtgcaaca	gctggttctgagtgcaaca	NOUN
biotropia-2457	73	16	58.5	58.5	NUM
biotropia-2457	73	17	non	non	NOUN
biotropia-2457	73	18	waxy	waxy	NOUN
biotropia-2457	73	19	:	:	PUNCT
biotropia-2457	73	20	523	523	NUM
biotropia-2457	73	21	wang	wang	PROPN
biotropia-2457	73	22	et	et	PROPN
biotropia-2457	73	23	al	al	PROPN
biotropia-2457	73	24	.	.	PROPN
biotropia-2457	74	1	(	(	PUNCT
biotropia-2457	74	2	2023)r1	2023)r1	NUM
biotropia-2457	74	3	:	:	PUNCT
biotropia-2457	74	4	acttcttcttgccagtgacc	acttcttcttgccagtgacc	VERB
biotropia-2457	74	5	waxy	waxy	NOUN
biotropia-2457	74	6	:	:	PUNCT
biotropia-2457	74	7	615	615	NUM
biotropia-2457	74	8	r2	r2	NOUN
biotropia-2457	74	9	:	:	PUNCT
biotropia-2457	74	10	acttcttcttgccagtgacg	acttcttcttgccagtgacg	NOUN
biotropia-2457	74	11	molecular	molecular	ADJ
biotropia-2457	74	12	genetics	genetic	NOUN
biotropia-2457	74	13	of	of	ADP
biotropia-2457	74	14	sorghum	sorghum	NOUN
biotropia-2457	74	15	crosses	crosse	NOUN
biotropia-2457	74	16	kd4	kd4	PROPN
biotropia-2457	74	17	and	and	CCONJ
biotropia-2457	74	18	bonteb	bonteb	PROPN
biotropia-2457	74	19	gunungkidul	gunungkidul	PROPN
biotropia-2457	74	20	muazam	muazam	PROPN
biotropia-2457	74	21	et	et	PROPN
biotropia-2457	74	22	al	al	PROPN
biotropia-2457	74	23	.	.	PROPN
biotropia-2457	75	1	331	331	NUM
biotropia-2457	75	2	genetic	genetic	ADJ
biotropia-2457	75	3	variations	variation	NOUN
biotropia-2457	75	4	or	or	CCONJ
biotropia-2457	75	5	mutations	mutation	NOUN
biotropia-2457	75	6	within	within	ADP
biotropia-2457	75	7	the	the	DET
biotropia-2457	75	8	wxa	wxa	NOUN
biotropia-2457	75	9	and	and	CCONJ
biotropia-2457	75	10	wxb	wxb	NUM
biotropia-2457	75	11	alleles	allele	NOUN
biotropia-2457	75	12	could	could	AUX
biotropia-2457	75	13	also	also	ADV
biotropia-2457	75	14	impede	impede	VERB
biotropia-2457	75	15	primer	primer	NOUN
biotropia-2457	75	16	binding	bind	VERB
biotropia-2457	75	17	or	or	CCONJ
biotropia-2457	75	18	the	the	DET
biotropia-2457	75	19	amplification	amplification	NOUN
biotropia-2457	75	20	process	process	NOUN
biotropia-2457	75	21	.	.	PUNCT
biotropia-2457	76	1	for	for	ADP
biotropia-2457	76	2	instance	instance	NOUN
biotropia-2457	76	3	,	,	PUNCT
biotropia-2457	76	4	single	single	ADJ
biotropia-2457	76	5	nucleotide	nucleotide	ADJ
biotropia-2457	76	6	polymorphisms	polymorphism	NOUN
biotropia-2457	76	7	(	(	PUNCT
biotropia-2457	76	8	snps	snps	PROPN
biotropia-2457	76	9	)	)	PUNCT
biotropia-2457	76	10	or	or	CCONJ
biotropia-2457	76	11	insertions/	insertions/	NUM
biotropia-2457	76	12	deletions	deletion	NOUN
biotropia-2457	76	13	(	(	PUNCT
biotropia-2457	76	14	indels	indel	NOUN
biotropia-2457	76	15	)	)	PUNCT
biotropia-2457	76	16	in	in	ADP
biotropia-2457	76	17	the	the	DET
biotropia-2457	76	18	primer	primer	NOUN
biotropia-2457	76	19	binding	bind	VERB
biotropia-2457	76	20	sites	site	NOUN
biotropia-2457	76	21	can	can	AUX
biotropia-2457	76	22	reduce	reduce	VERB
biotropia-2457	76	23	the	the	DET
biotropia-2457	76	24	efficiency	efficiency	NOUN
biotropia-2457	76	25	of	of	ADP
biotropia-2457	76	26	primer	primer	NOUN
biotropia-2457	76	27	annealing	annealing	NOUN
biotropia-2457	76	28	,	,	PUNCT
biotropia-2457	76	29	resulting	result	VERB
biotropia-2457	76	30	in	in	ADP
biotropia-2457	76	31	weak	weak	ADJ
biotropia-2457	76	32	or	or	CCONJ
biotropia-2457	76	33	absent	absent	ADJ
biotropia-2457	76	34	amplification	amplification	NOUN
biotropia-2457	76	35	signals	signal	NOUN
biotropia-2457	76	36	for	for	ADP
biotropia-2457	76	37	these	these	DET
biotropia-2457	76	38	alleles	allele	NOUN
biotropia-2457	76	39	.	.	PUNCT
biotropia-2457	77	1	zhang	zhang	PROPN
biotropia-2457	77	2	et	et	PROPN
biotropia-2457	77	3	al	al	PROPN
biotropia-2457	77	4	.	.	PROPN
biotropia-2457	78	1	(	(	PUNCT
biotropia-2457	78	2	2019	2019	NUM
biotropia-2457	78	3	)	)	PUNCT
biotropia-2457	78	4	reported	report	VERB
biotropia-2457	78	5	that	that	SCONJ
biotropia-2457	78	6	specific	specific	ADJ
biotropia-2457	78	7	snps	snps	NOUN
biotropia-2457	78	8	in	in	ADP
biotropia-2457	78	9	waxy	waxy	NOUN
biotropia-2457	78	10	genes	gene	NOUN
biotropia-2457	78	11	significantly	significantly	ADV
biotropia-2457	78	12	affected	affect	VERB
biotropia-2457	78	13	the	the	DET
biotropia-2457	78	14	amplification	amplification	NOUN
biotropia-2457	78	15	efficiency	efficiency	NOUN
biotropia-2457	78	16	of	of	ADP
biotropia-2457	78	17	different	different	ADJ
biotropia-2457	78	18	alleles	allele	NOUN
biotropia-2457	78	19	in	in	ADP
biotropia-2457	78	20	rice	rice	NOUN
biotropia-2457	78	21	and	and	CCONJ
biotropia-2457	78	22	sorghum	sorghum	NOUN
biotropia-2457	78	23	,	,	PUNCT
biotropia-2457	78	24	underscoring	underscore	VERB
biotropia-2457	78	25	the	the	DET
biotropia-2457	78	26	need	need	NOUN
biotropia-2457	78	27	to	to	PART
biotropia-2457	78	28	account	account	VERB
biotropia-2457	78	29	for	for	ADP
biotropia-2457	78	30	such	such	ADJ
biotropia-2457	78	31	variations	variation	NOUN
biotropia-2457	78	32	in	in	ADP
biotropia-2457	78	33	experimental	experimental	ADJ
biotropia-2457	78	34	design	design	NOUN
biotropia-2457	78	35	.	.	PUNCT
biotropia-2457	79	1	the	the	DET
biotropia-2457	79	2	quality	quality	NOUN
biotropia-2457	79	3	and	and	CCONJ
biotropia-2457	79	4	quantity	quantity	NOUN
biotropia-2457	79	5	of	of	ADP
biotropia-2457	79	6	the	the	DET
biotropia-2457	79	7	dna	dna	PROPN
biotropia-2457	79	8	template	template	NOUN
biotropia-2457	79	9	used	use	VERB
biotropia-2457	79	10	in	in	ADP
biotropia-2457	79	11	the	the	DET
biotropia-2457	79	12	pcr	pcr	NOUN
biotropia-2457	79	13	can	can	AUX
biotropia-2457	79	14	significantly	significantly	ADV
biotropia-2457	79	15	influence	influence	VERB
biotropia-2457	79	16	amplification	amplification	NOUN
biotropia-2457	79	17	outcomes	outcome	NOUN
biotropia-2457	79	18	.	.	PUNCT
biotropia-2457	80	1	degraded	degraded	ADJ
biotropia-2457	80	2	dna	dna	NOUN
biotropia-2457	80	3	or	or	CCONJ
biotropia-2457	80	4	insufficient	insufficient	ADJ
biotropia-2457	80	5	template	template	NOUN
biotropia-2457	80	6	amounts	amount	NOUN
biotropia-2457	80	7	can	can	AUX
biotropia-2457	80	8	lead	lead	VERB
biotropia-2457	80	9	to	to	ADP
biotropia-2457	80	10	suboptimal	suboptimal	ADJ
biotropia-2457	80	11	amplification	amplification	NOUN
biotropia-2457	80	12	,	,	PUNCT
biotropia-2457	80	13	particularly	particularly	ADV
biotropia-2457	80	14	for	for	ADP
biotropia-2457	80	15	certain	certain	ADJ
biotropia-2457	80	16	alleles	allele	NOUN
biotropia-2457	80	17	.	.	PUNCT
biotropia-2457	81	1	ensuring	ensure	VERB
biotropia-2457	81	2	high	high	ADJ
biotropia-2457	81	3	-	-	PUNCT
biotropia-2457	81	4	quality	quality	NOUN
biotropia-2457	81	5	dna	dna	NOUN
biotropia-2457	81	6	extraction	extraction	NOUN
biotropia-2457	81	7	and	and	CCONJ
biotropia-2457	81	8	quantification	quantification	NOUN
biotropia-2457	81	9	is	be	AUX
biotropia-2457	81	10	crucial	crucial	ADJ
biotropia-2457	81	11	for	for	ADP
biotropia-2457	81	12	obtaining	obtain	VERB
biotropia-2457	81	13	reliable	reliable	ADJ
biotropia-2457	81	14	and	and	CCONJ
biotropia-2457	81	15	reproducible	reproducible	VERB
biotropia-2457	81	16	results	result	NOUN
biotropia-2457	81	17	across	across	ADP
biotropia-2457	81	18	all	all	DET
biotropia-2457	81	19	target	target	NOUN
biotropia-2457	81	20	alleles	allele	NOUN
biotropia-2457	81	21	(	(	PUNCT
biotropia-2457	81	22	shin	shin	NOUN
biotropia-2457	81	23	et	et	PROPN
biotropia-2457	81	24	al	al	PROPN
biotropia-2457	81	25	.	.	PROPN
biotropia-2457	81	26	2015	2015	NUM
biotropia-2457	81	27	)	)	PUNCT
biotropia-2457	81	28	.	.	PUNCT
biotropia-2457	82	1	pcr	pcr	ADJ
biotropia-2457	82	2	conditions	condition	NOUN
biotropia-2457	82	3	,	,	PUNCT
biotropia-2457	82	4	including	include	VERB
biotropia-2457	82	5	annealing	anneal	VERB
biotropia-2457	82	6	temperature	temperature	NOUN
biotropia-2457	82	7	,	,	PUNCT
biotropia-2457	82	8	magnesium	magnesium	NOUN
biotropia-2457	82	9	ion	ion	NOUN
biotropia-2457	82	10	concentration	concentration	NOUN
biotropia-2457	82	11	,	,	PUNCT
biotropia-2457	82	12	and	and	CCONJ
biotropia-2457	82	13	cycle	cycle	NOUN
biotropia-2457	82	14	number	number	NOUN
biotropia-2457	82	15	,	,	PUNCT
biotropia-2457	82	16	play	play	VERB
biotropia-2457	82	17	pivotal	pivotal	ADJ
biotropia-2457	82	18	roles	role	NOUN
biotropia-2457	82	19	in	in	ADP
biotropia-2457	82	20	amplification	amplification	NOUN
biotropia-2457	82	21	efficiency	efficiency	NOUN
biotropia-2457	82	22	.	.	PUNCT
biotropia-2457	83	1	suboptimal	suboptimal	ADJ
biotropia-2457	83	2	conditions	condition	NOUN
biotropia-2457	83	3	may	may	AUX
biotropia-2457	83	4	favor	favor	VERB
biotropia-2457	83	5	the	the	DET
biotropia-2457	83	6	amplification	amplification	NOUN
biotropia-2457	83	7	of	of	ADP
biotropia-2457	83	8	one	one	NUM
biotropia-2457	83	9	allele	allele	NOUN
biotropia-2457	83	10	over	over	ADP
biotropia-2457	83	11	others	other	NOUN
biotropia-2457	83	12	.	.	PUNCT
biotropia-2457	84	1	therefore	therefore	ADV
biotropia-2457	84	2	,	,	PUNCT
biotropia-2457	84	3	optimizing	optimize	VERB
biotropia-2457	84	4	these	these	DET
biotropia-2457	84	5	parameters	parameter	NOUN
biotropia-2457	84	6	is	be	AUX
biotropia-2457	84	7	essential	essential	ADJ
biotropia-2457	84	8	to	to	PART
biotropia-2457	84	9	achieve	achieve	VERB
biotropia-2457	84	10	balanced	balanced	ADJ
biotropia-2457	84	11	amplification	amplification	NOUN
biotropia-2457	84	12	of	of	ADP
biotropia-2457	84	13	multiple	multiple	ADJ
biotropia-2457	84	14	alleles	allele	NOUN
biotropia-2457	84	15	.	.	PUNCT
biotropia-2457	85	1	wang	wang	PROPN
biotropia-2457	85	2	et	et	PROPN
biotropia-2457	85	3	al	al	PROPN
biotropia-2457	85	4	.	.	PROPN
biotropia-2457	85	5	(	(	PUNCT
biotropia-2457	85	6	1995	1995	NUM
biotropia-2457	85	7	)	)	PUNCT
biotropia-2457	85	8	suggested	suggest	VERB
biotropia-2457	85	9	that	that	SCONJ
biotropia-2457	85	10	techniques	technique	NOUN
biotropia-2457	85	11	such	such	ADJ
biotropia-2457	85	12	as	as	ADP
biotropia-2457	85	13	gradient	gradient	ADJ
biotropia-2457	85	14	pcr	pcr	NOUN
biotropia-2457	85	15	can	can	AUX
biotropia-2457	85	16	help	help	VERB
biotropia-2457	85	17	determine	determine	VERB
biotropia-2457	85	18	the	the	DET
biotropia-2457	85	19	optimal	optimal	ADJ
biotropia-2457	85	20	annealing	anneal	VERB
biotropia-2457	85	21	temperatures	temperature	NOUN
biotropia-2457	85	22	for	for	ADP
biotropia-2457	85	23	primers	primer	NOUN
biotropia-2457	85	24	,	,	PUNCT
biotropia-2457	85	25	thereby	thereby	ADV
biotropia-2457	85	26	enhancing	enhance	VERB
biotropia-2457	85	27	the	the	DET
biotropia-2457	85	28	amplification	amplification	NOUN
biotropia-2457	85	29	of	of	ADP
biotropia-2457	85	30	all	all	DET
biotropia-2457	85	31	target	target	NOUN
biotropia-2457	85	32	alleles	allele	NOUN
biotropia-2457	85	33	.	.	PUNCT
biotropia-2457	86	1	in	in	ADP
biotropia-2457	86	2	our	our	PRON
biotropia-2457	86	3	study	study	NOUN
biotropia-2457	86	4	,	,	PUNCT
biotropia-2457	86	5	the	the	DET
biotropia-2457	86	6	exclusive	exclusive	ADJ
biotropia-2457	86	7	amplification	amplification	NOUN
biotropia-2457	86	8	of	of	ADP
biotropia-2457	86	9	the	the	DET
biotropia-2457	86	10	wxc	wxc	NOUN
biotropia-2457	86	11	allele	allele	NOUN
biotropia-2457	86	12	observed	observe	VERB
biotropia-2457	86	13	in	in	ADP
biotropia-2457	86	14	the	the	DET
biotropia-2457	86	15	electrophoresis	electrophoresis	NOUN
biotropia-2457	86	16	results	result	NOUN
biotropia-2457	86	17	is	be	AUX
biotropia-2457	86	18	likely	likely	ADJ
biotropia-2457	86	19	due	due	ADP
biotropia-2457	86	20	to	to	ADP
biotropia-2457	86	21	a	a	DET
biotropia-2457	86	22	combination	combination	NOUN
biotropia-2457	86	23	of	of	ADP
biotropia-2457	86	24	factors	factor	NOUN
biotropia-2457	86	25	,	,	PUNCT
biotropia-2457	86	26	including	include	VERB
biotropia-2457	86	27	primer	primer	NOUN
biotropia-2457	86	28	specificity	specificity	NOUN
biotropia-2457	86	29	,	,	PUNCT
biotropia-2457	86	30	allelic	allelic	ADJ
biotropia-2457	86	31	variations	variation	NOUN
biotropia-2457	86	32	,	,	PUNCT
biotropia-2457	86	33	dna	dna	PROPN
biotropia-2457	86	34	template	template	NOUN
biotropia-2457	86	35	quality	quality	NOUN
biotropia-2457	86	36	,	,	PUNCT
biotropia-2457	86	37	and	and	CCONJ
biotropia-2457	86	38	pcr	pcr	ADJ
biotropia-2457	86	39	conditions	condition	NOUN
biotropia-2457	86	40	.	.	PUNCT
biotropia-2457	87	1	addressing	address	VERB
biotropia-2457	87	2	these	these	DET
biotropia-2457	87	3	aspects	aspect	NOUN
biotropia-2457	87	4	through	through	ADP
biotropia-2457	87	5	careful	careful	ADJ
biotropia-2457	87	6	experimental	experimental	ADJ
biotropia-2457	87	7	design	design	NOUN
biotropia-2457	87	8	and	and	CCONJ
biotropia-2457	87	9	optimization	optimization	NOUN
biotropia-2457	87	10	can	can	AUX
biotropia-2457	87	11	lead	lead	VERB
biotropia-2457	87	12	to	to	ADP
biotropia-2457	87	13	more	more	ADV
biotropia-2457	87	14	balanced	balanced	ADJ
biotropia-2457	87	15	and	and	CCONJ
biotropia-2457	87	16	accurate	accurate	ADJ
biotropia-2457	87	17	amplification	amplification	NOUN
biotropia-2457	87	18	of	of	ADP
biotropia-2457	87	19	the	the	DET
biotropia-2457	87	20	wxa	wxa	NOUN
biotropia-2457	87	21	,	,	PUNCT
biotropia-2457	87	22	wxb	wxb	NOUN
biotropia-2457	87	23	,	,	PUNCT
biotropia-2457	87	24	and	and	CCONJ
biotropia-2457	87	25	wxc	wxc	VERB
biotropia-2457	87	26	alleles	allele	NOUN
biotropia-2457	87	27	(	(	PUNCT
biotropia-2457	87	28	pedersen	pedersen	PROPN
biotropia-2457	87	29	et	et	PROPN
biotropia-2457	87	30	al	al	PROPN
biotropia-2457	87	31	.	.	PROPN
biotropia-2457	87	32	2007	2007	NUM
biotropia-2457	87	33	)	)	PUNCT
biotropia-2457	87	34	.	.	PUNCT
biotropia-2457	88	1	statistical	statistical	ADJ
biotropia-2457	88	2	analysis	analysis	NOUN
biotropia-2457	88	3	of	of	ADP
biotropia-2457	88	4	sorghum	sorghum	NOUN
biotropia-2457	88	5	molecular	molecular	ADJ
biotropia-2457	88	6	and	and	CCONJ
biotropia-2457	88	7	agronomic	agronomic	ADJ
biotropia-2457	88	8	data	datum	NOUN
biotropia-2457	88	9	1	1	NUM
biotropia-2457	88	10	.	.	PUNCT
biotropia-2457	89	1	chi	chi	ADJ
biotropia-2457	89	2	-	-	PUNCT
biotropia-2457	89	3	square	square	ADJ
biotropia-2457	89	4	test	test	NOUN
biotropia-2457	89	5	(	(	PUNCT
biotropia-2457	89	6	χ²	χ²	NOUN
biotropia-2457	89	7	)	)	PUNCT
biotropia-2457	89	8	the	the	DET
biotropia-2457	89	9	chi	chi	NOUN
biotropia-2457	89	10	-	-	PUNCT
biotropia-2457	89	11	square	square	ADJ
biotropia-2457	89	12	(	(	PUNCT
biotropia-2457	89	13	χ²	χ²	NOUN
biotropia-2457	89	14	)	)	PUNCT
biotropia-2457	89	15	test	test	NOUN
biotropia-2457	89	16	was	be	AUX
biotropia-2457	89	17	employed	employ	VERB
biotropia-2457	89	18	to	to	PART
biotropia-2457	89	19	determine	determine	VERB
biotropia-2457	89	20	whether	whether	SCONJ
biotropia-2457	89	21	genetic	genetic	ADJ
biotropia-2457	89	22	segregation	segregation	NOUN
biotropia-2457	89	23	in	in	ADP
biotropia-2457	89	24	the	the	DET
biotropia-2457	89	25	f1a	f1a	PROPN
biotropia-2457	89	26	and	and	CCONJ
biotropia-2457	89	27	f1b	f1b	ADV
biotropia-2457	89	28	cross	cross	NOUN
biotropia-2457	89	29	populations	population	NOUN
biotropia-2457	89	30	adhered	adhere	VERB
biotropia-2457	89	31	to	to	ADP
biotropia-2457	89	32	the	the	DET
biotropia-2457	89	33	expected	expect	VERB
biotropia-2457	89	34	mendelian	mendelian	ADJ
biotropia-2457	89	35	inheritance	inheritance	NOUN
biotropia-2457	89	36	ratios	ratio	NOUN
biotropia-2457	89	37	.	.	PUNCT
biotropia-2457	90	1	this	this	DET
biotropia-2457	90	2	statistical	statistical	ADJ
biotropia-2457	90	3	test	test	NOUN
biotropia-2457	90	4	is	be	AUX
biotropia-2457	90	5	widely	widely	ADV
biotropia-2457	90	6	used	use	VERB
biotropia-2457	90	7	in	in	ADP
biotropia-2457	90	8	genetic	genetic	ADJ
biotropia-2457	90	9	studies	study	NOUN
biotropia-2457	90	10	to	to	PART
biotropia-2457	90	11	assess	assess	VERB
biotropia-2457	90	12	the	the	DET
biotropia-2457	90	13	goodness	goodness	NOUN
biotropia-2457	90	14	-	-	PUNCT
biotropia-2457	90	15	of	of	ADP
biotropia-2457	90	16	-	-	PUNCT
biotropia-2457	90	17	fit	fit	NOUN
biotropia-2457	90	18	between	between	ADP
biotropia-2457	90	19	observed	observed	ADJ
biotropia-2457	90	20	and	and	CCONJ
biotropia-2457	90	21	expected	expect	VERB
biotropia-2457	90	22	distributions	distribution	NOUN
biotropia-2457	90	23	,	,	PUNCT
biotropia-2457	90	24	thereby	thereby	ADV
biotropia-2457	90	25	evaluating	evaluate	VERB
biotropia-2457	90	26	deviations	deviation	NOUN
biotropia-2457	90	27	that	that	PRON
biotropia-2457	90	28	may	may	AUX
biotropia-2457	90	29	indicate	indicate	VERB
biotropia-2457	90	30	underlying	underlying	ADJ
biotropia-2457	90	31	genetic	genetic	ADJ
biotropia-2457	90	32	factors	factor	NOUN
biotropia-2457	90	33	such	such	ADJ
biotropia-2457	90	34	as	as	ADP
biotropia-2457	90	35	dominance	dominance	NOUN
biotropia-2457	90	36	effects	effect	NOUN
biotropia-2457	90	37	,	,	PUNCT
biotropia-2457	90	38	epistasis	epistasis	NOUN
biotropia-2457	90	39	,	,	PUNCT
biotropia-2457	90	40	or	or	CCONJ
biotropia-2457	90	41	selection	selection	NOUN
biotropia-2457	90	42	biases	bias	NOUN
biotropia-2457	90	43	(	(	PUNCT
biotropia-2457	90	44	mcdonald	mcdonald	NOUN
biotropia-2457	90	45	2014	2014	NUM
biotropia-2457	90	46	)	)	PUNCT
biotropia-2457	90	47	.	.	PUNCT
biotropia-2457	91	1	hypotheses	hypothesis	NOUN
biotropia-2457	91	2	:	:	PUNCT
biotropia-2457	91	3	•	•	NUM
biotropia-2457	91	4	h0	h0	NOUN
biotropia-2457	91	5	:	:	PUNCT
biotropia-2457	91	6	genetic	genetic	ADJ
biotropia-2457	91	7	segregation	segregation	NOUN
biotropia-2457	91	8	follows	follow	VERB
biotropia-2457	91	9	expected	expect	VERB
biotropia-2457	91	10	ratios	ratio	NOUN
biotropia-2457	91	11	(	(	PUNCT
biotropia-2457	91	12	e.g.	e.g.	ADV
biotropia-2457	91	13	,	,	PUNCT
biotropia-2457	91	14	1	1	NUM
biotropia-2457	91	15	:	:	SYM
biotropia-2457	91	16	2	2	NUM
biotropia-2457	91	17	:	:	SYM
biotropia-2457	91	18	1	1	NUM
biotropia-2457	91	19	for	for	ADP
biotropia-2457	91	20	heterozygotes	heterozygote	NOUN
biotropia-2457	91	21	)	)	PUNCT
biotropia-2457	91	22	.	.	PUNCT
biotropia-2457	92	1	•	•	NUM
biotropia-2457	92	2	h1	h1	NOUN
biotropia-2457	92	3	:	:	PUNCT
biotropia-2457	92	4	genetic	genetic	ADJ
biotropia-2457	92	5	segregation	segregation	NOUN
biotropia-2457	92	6	does	do	AUX
biotropia-2457	92	7	not	not	PART
biotropia-2457	92	8	follow	follow	VERB
biotropia-2457	92	9	expected	expect	VERB
biotropia-2457	92	10	ratios	ratio	NOUN
biotropia-2457	92	11	.	.	PUNCT
biotropia-2457	93	1	observed	observed	ADJ
biotropia-2457	93	2	data	datum	NOUN
biotropia-2457	93	3	:	:	PUNCT
biotropia-2457	93	4	•	•	NUM
biotropia-2457	93	5	wxa	wxa	NOUN
biotropia-2457	93	6	:	:	PUNCT
biotropia-2457	93	7	0	0	PUNCT
biotropia-2457	93	8	(	(	PUNCT
biotropia-2457	93	9	not	not	PART
biotropia-2457	93	10	expressed	express	VERB
biotropia-2457	93	11	)	)	PUNCT
biotropia-2457	93	12	•	•	NUM
biotropia-2457	93	13	wxb	wxb	PROPN
biotropia-2457	93	14	:	:	PUNCT
biotropia-2457	93	15	0	0	NUM
biotropia-2457	93	16	(	(	PUNCT
biotropia-2457	93	17	not	not	PART
biotropia-2457	93	18	expressed	express	VERB
biotropia-2457	93	19	)	)	PUNCT
biotropia-2457	93	20	•	•	NUM
biotropia-2457	93	21	wxc	wxc	NOUN
biotropia-2457	93	22	:	:	PUNCT
biotropia-2457	93	23	4	4	NUM
biotropia-2457	93	24	(	(	PUNCT
biotropia-2457	93	25	kd4	kd4	PROPN
biotropia-2457	93	26	,	,	PUNCT
biotropia-2457	93	27	bg	bg	PROPN
biotropia-2457	93	28	,	,	PUNCT
biotropia-2457	93	29	f1a	f1a	PROPN
biotropia-2457	93	30	,	,	PUNCT
biotropia-2457	93	31	f1b	f1b	ADJ
biotropia-2457	93	32	)	)	PUNCT
biotropia-2457	93	33	figure	figure	NOUN
biotropia-2457	93	34	1	1	NUM
biotropia-2457	93	35	pcr	pcr	NOUN
biotropia-2457	93	36	analysis	analysis	NOUN
biotropia-2457	93	37	results	result	NOUN
biotropia-2457	93	38	for	for	ADP
biotropia-2457	93	39	the	the	DET
biotropia-2457	93	40	examined	examine	VERB
biotropia-2457	93	41	sorghum	sorghum	NOUN
biotropia-2457	93	42	leaf	leaf	NOUN
biotropia-2457	93	43	samples	sample	NOUN
biotropia-2457	93	44	biotropia	biotropia	ADJ
biotropia-2457	93	45	vol	vol	NOUN
biotropia-2457	93	46	.	.	PUNCT
biotropia-2457	94	1	32	32	NUM
biotropia-2457	95	1	no	no	NOUN
biotropia-2457	95	2	.	.	NOUN
biotropia-2457	96	1	3	3	NUM
biotropia-2457	96	2	,	,	PUNCT
biotropia-2457	96	3	2025	2025	NUM
biotropia-2457	96	4	332	332	NUM
biotropia-2457	96	5	expected	expect	VERB
biotropia-2457	96	6	ratio	ratio	NOUN
biotropia-2457	96	7	:	:	PUNCT
biotropia-2457	96	8	if	if	SCONJ
biotropia-2457	96	9	adhering	adhere	VERB
biotropia-2457	96	10	to	to	ADP
biotropia-2457	96	11	ratio	ratio	NOUN
biotropia-2457	96	12	of	of	ADP
biotropia-2457	96	13	1	1	NUM
biotropia-2457	96	14	:	:	SYM
biotropia-2457	96	15	1	1	NUM
biotropia-2457	96	16	:	:	SYM
biotropia-2457	96	17	2	2	NUM
biotropia-2457	96	18	:	:	SYM
biotropia-2457	96	19	•	•	NUM
biotropia-2457	96	20	wxa	wxa	NOUN
biotropia-2457	96	21	:	:	PUNCT
biotropia-2457	96	22	1	1	NUM
biotropia-2457	96	23	•	•	NUM
biotropia-2457	96	24	wxb	wxb	INTJ
biotropia-2457	96	25	:	:	PUNCT
biotropia-2457	96	26	1	1	NUM
biotropia-2457	96	27	•	•	NUM
biotropia-2457	96	28	wxc	wxc	NOUN
biotropia-2457	96	29	:	:	PUNCT
biotropia-2457	96	30	2	2	NUM
biotropia-2457	96	31	formula	formula	NOUN
biotropia-2457	96	32	used	use	VERB
biotropia-2457	96	33	for	for	ADP
biotropia-2457	96	34	calculating	calculate	VERB
biotropia-2457	96	35	chi	chi	ADJ
biotropia-2457	96	36	-	-	PUNCT
biotropia-2457	96	37	square	square	ADJ
biotropia-2457	96	38	χ²	χ²	NOUN
biotropia-2457	96	39	=	=	PUNCT
biotropia-2457	96	40	∑(o	∑(o	NOUN
biotropia-2457	96	41	-	-	PUNCT
biotropia-2457	96	42	e)2	e)2	NOUN
biotropia-2457	96	43	/	/	SYM
biotropia-2457	96	44	eχ²	eχ²	NOUN
biotropia-2457	96	45	=	=	SYM
biotropia-2457	96	46	∑e(o	∑e(o	PROPN
biotropia-2457	96	47	-	-	PUNCT
biotropia-2457	96	48	e)2	e)2	NOUN
biotropia-2457	97	1	where	where	SCONJ
biotropia-2457	97	2	:	:	PUNCT
biotropia-2457	98	1	o	o	X
biotropia-2457	98	2	=	=	SYM
biotropia-2457	98	3	observed	observe	VERB
biotropia-2457	98	4	data	datum	NOUN
biotropia-2457	98	5	e	e	NOUN
biotropia-2457	98	6	=	=	PRON
biotropia-2457	98	7	expected	expect	VERB
biotropia-2457	98	8	ratio	ratio	NOUN
biotropia-2457	98	9	the	the	DET
biotropia-2457	98	10	results	result	NOUN
biotropia-2457	98	11	obtained	obtain	VERB
biotropia-2457	98	12	were	be	AUX
biotropia-2457	98	13	:	:	PUNCT
biotropia-2457	98	14	•	•	ADP
biotropia-2457	98	15	for	for	ADP
biotropia-2457	98	16	wxa	wxa	NOUN
biotropia-2457	98	17	:	:	PUNCT
biotropia-2457	98	18	(	(	PUNCT
biotropia-2457	98	19	0	0	NUM
biotropia-2457	98	20	-	-	SYM
biotropia-2457	98	21	1)2/1	1)2/1	NUM
biotropia-2457	98	22	=	=	PUNCT
biotropia-2457	98	23	1(0	1(0	NUM
biotropia-2457	98	24	-	-	SYM
biotropia-2457	98	25	1)2/1	1)2/1	PROPN
biotropia-2457	98	26	=	=	NOUN
biotropia-2457	98	27	1	1	NUM
biotropia-2457	98	28	•	•	NOUN
biotropia-2457	98	29	for	for	ADP
biotropia-2457	98	30	wxb	wxb	PROPN
biotropia-2457	98	31	:	:	PUNCT
biotropia-2457	98	32	(	(	PUNCT
biotropia-2457	98	33	0	0	NUM
biotropia-2457	98	34	-	-	SYM
biotropia-2457	98	35	1)2/1	1)2/1	NUM
biotropia-2457	98	36	=	=	PUNCT
biotropia-2457	98	37	1(0	1(0	NUM
biotropia-2457	98	38	-	-	SYM
biotropia-2457	98	39	1)2/1	1)2/1	PROPN
biotropia-2457	98	40	=	=	NOUN
biotropia-2457	98	41	1	1	NUM
biotropia-2457	98	42	•	•	NOUN
biotropia-2457	98	43	for	for	ADP
biotropia-2457	98	44	wxc	wxc	NOUN
biotropia-2457	98	45	:	:	PUNCT
biotropia-2457	98	46	(	(	PUNCT
biotropia-2457	98	47	4	4	NUM
biotropia-2457	98	48	-	-	SYM
biotropia-2457	98	49	2)2/2	2)2/2	NUM
biotropia-2457	98	50	=	=	SYM
biotropia-2457	98	51	2(4	2(4	NUM
biotropia-2457	98	52	-	-	PUNCT
biotropia-2457	98	53	2)2/2	2)2/2	NUM
biotropia-2457	98	54	=	=	SYM
biotropia-2457	98	55	2	2	NUM
biotropia-2457	98	56	total	total	NOUN
biotropia-2457	98	57	χ²	χ²	NOUN
biotropia-2457	98	58	=	=	NOUN
biotropia-2457	98	59	4	4	NUM
biotropia-2457	98	60	since	since	SCONJ
biotropia-2457	98	61	χ2	χ2	NOUN
biotropia-2457	98	62	=	=	PUNCT
biotropia-2457	98	63	4	4	NUM
biotropia-2457	98	64	>	>	SYM
biotropia-2457	98	65	χ	χ	DET
biotropia-2457	98	66	table	table	NOUN
biotropia-2457	98	67	2	2	NUM
biotropia-2457	98	68	(	(	PUNCT
biotropia-2457	98	69	5.991	5.991	NUM
biotropia-2457	98	70	for	for	ADP
biotropia-2457	98	71	df	df	NOUN
biotropia-2457	98	72	2	2	NUM
biotropia-2457	98	73	,	,	PUNCT
biotropia-2457	98	74	α	α	NOUN
biotropia-2457	98	75	=	=	NOUN
biotropia-2457	98	76	0.05	0.05	NUM
biotropia-2457	98	77	)	)	PUNCT
biotropia-2457	98	78	,	,	PUNCT
biotropia-2457	98	79	this	this	DET
biotropia-2457	98	80	result	result	NOUN
biotropia-2457	98	81	suggests	suggest	VERB
biotropia-2457	98	82	that	that	SCONJ
biotropia-2457	98	83	the	the	DET
biotropia-2457	98	84	observed	observed	ADJ
biotropia-2457	98	85	genetic	genetic	ADJ
biotropia-2457	98	86	segregation	segregation	NOUN
biotropia-2457	98	87	does	do	AUX
biotropia-2457	98	88	not	not	PART
biotropia-2457	98	89	deviate	deviate	VERB
biotropia-2457	98	90	significantly	significantly	ADV
biotropia-2457	98	91	from	from	ADP
biotropia-2457	98	92	the	the	DET
biotropia-2457	98	93	expected	expect	VERB
biotropia-2457	98	94	mendelian	mendelian	ADJ
biotropia-2457	98	95	ratio	ratio	NOUN
biotropia-2457	98	96	at	at	ADP
biotropia-2457	98	97	the	the	DET
biotropia-2457	98	98	5	5	NUM
biotropia-2457	98	99	%	%	NOUN
biotropia-2457	98	100	significance	significance	NOUN
biotropia-2457	98	101	level	level	NOUN
biotropia-2457	98	102	.	.	PUNCT
biotropia-2457	99	1	however	however	ADV
biotropia-2457	99	2	,	,	PUNCT
biotropia-2457	99	3	despite	despite	SCONJ
biotropia-2457	99	4	failing	fail	VERB
biotropia-2457	99	5	to	to	PART
biotropia-2457	99	6	reject	reject	VERB
biotropia-2457	99	7	the	the	DET
biotropia-2457	99	8	null	null	ADJ
biotropia-2457	99	9	hypothesis	hypothesis	NOUN
biotropia-2457	99	10	,	,	PUNCT
biotropia-2457	99	11	the	the	DET
biotropia-2457	99	12	observed	observe	VERB
biotropia-2457	99	13	data	datum	NOUN
biotropia-2457	99	14	indicate	indicate	VERB
biotropia-2457	99	15	an	an	DET
biotropia-2457	99	16	apparent	apparent	ADJ
biotropia-2457	99	17	absence	absence	NOUN
biotropia-2457	99	18	of	of	ADP
biotropia-2457	99	19	wxa	wxa	NOUN
biotropia-2457	99	20	and	and	CCONJ
biotropia-2457	99	21	wxb	wxb	PROPN
biotropia-2457	99	22	,	,	PUNCT
biotropia-2457	99	23	with	with	ADP
biotropia-2457	99	24	exclusive	exclusive	ADJ
biotropia-2457	99	25	amplification	amplification	NOUN
biotropia-2457	99	26	of	of	ADP
biotropia-2457	99	27	wxc	wxc	NOUN
biotropia-2457	99	28	.	.	PUNCT
biotropia-2457	100	1	this	this	DET
biotropia-2457	100	2	deviation	deviation	NOUN
biotropia-2457	100	3	could	could	AUX
biotropia-2457	100	4	be	be	AUX
biotropia-2457	100	5	attributed	attribute	VERB
biotropia-2457	100	6	to	to	ADP
biotropia-2457	100	7	:	:	PUNCT
biotropia-2457	100	8	a.	a.	NOUN
biotropia-2457	100	9	dominance	dominance	NOUN
biotropia-2457	100	10	effects	effect	NOUN
biotropia-2457	100	11	of	of	ADP
biotropia-2457	100	12	the	the	DET
biotropia-2457	100	13	wxc	wxc	NOUN
biotropia-2457	100	14	allele	allele	NOUN
biotropia-2457	100	15	if	if	SCONJ
biotropia-2457	100	16	wxc	wxc	NOUN
biotropia-2457	100	17	exhibits	exhibit	VERB
biotropia-2457	100	18	a	a	DET
biotropia-2457	100	19	dominant	dominant	ADJ
biotropia-2457	100	20	expression	expression	NOUN
biotropia-2457	100	21	pattern	pattern	NOUN
biotropia-2457	100	22	,	,	PUNCT
biotropia-2457	100	23	it	it	PRON
biotropia-2457	100	24	may	may	AUX
biotropia-2457	100	25	suppress	suppress	VERB
biotropia-2457	100	26	or	or	CCONJ
biotropia-2457	100	27	mask	mask	VERB
biotropia-2457	100	28	the	the	DET
biotropia-2457	100	29	amplification	amplification	NOUN
biotropia-2457	100	30	of	of	ADP
biotropia-2457	100	31	wxa	wxa	NOUN
biotropia-2457	100	32	and	and	CCONJ
biotropia-2457	100	33	wxb	wxb	PROPN
biotropia-2457	100	34	,	,	PUNCT
biotropia-2457	100	35	leading	lead	VERB
biotropia-2457	100	36	to	to	ADP
biotropia-2457	100	37	a	a	DET
biotropia-2457	100	38	skewed	skewed	ADJ
biotropia-2457	100	39	distribution	distribution	NOUN
biotropia-2457	100	40	of	of	ADP
biotropia-2457	100	41	phenotypic	phenotypic	ADJ
biotropia-2457	100	42	traits	trait	NOUN
biotropia-2457	100	43	(	(	PUNCT
biotropia-2457	100	44	zhang	zhang	X
biotropia-2457	100	45	et	et	PROPN
biotropia-2457	100	46	al	al	PROPN
biotropia-2457	100	47	.	.	PROPN
biotropia-2457	100	48	2020	2020	NUM
biotropia-2457	100	49	)	)	PUNCT
biotropia-2457	100	50	.	.	PUNCT
biotropia-2457	101	1	b.	b.	PROPN
biotropia-2457	101	2	technical	technical	ADJ
biotropia-2457	101	3	or	or	CCONJ
biotropia-2457	101	4	biological	biological	ADJ
biotropia-2457	101	5	constraints	constraint	NOUN
biotropia-2457	101	6	issues	issue	NOUN
biotropia-2457	101	7	such	such	ADJ
biotropia-2457	101	8	as	as	ADP
biotropia-2457	101	9	primer	primer	NOUN
biotropia-2457	101	10	specificity	specificity	NOUN
biotropia-2457	101	11	,	,	PUNCT
biotropia-2457	101	12	dna	dna	NOUN
biotropia-2457	101	13	degradation	degradation	NOUN
biotropia-2457	101	14	,	,	PUNCT
biotropia-2457	101	15	or	or	CCONJ
biotropia-2457	101	16	selective	selective	ADJ
biotropia-2457	101	17	expression	expression	NOUN
biotropia-2457	101	18	due	due	ADP
biotropia-2457	101	19	to	to	ADP
biotropia-2457	101	20	environmental	environmental	ADJ
biotropia-2457	101	21	factors	factor	NOUN
biotropia-2457	101	22	may	may	AUX
biotropia-2457	101	23	contribute	contribute	VERB
biotropia-2457	101	24	to	to	ADP
biotropia-2457	101	25	the	the	DET
biotropia-2457	101	26	lack	lack	NOUN
biotropia-2457	101	27	of	of	ADP
biotropia-2457	101	28	amplification	amplification	NOUN
biotropia-2457	101	29	in	in	ADP
biotropia-2457	101	30	wxa	wxa	NOUN
biotropia-2457	101	31	and	and	CCONJ
biotropia-2457	101	32	wxb	wxb	PROPN
biotropia-2457	101	33	(	(	PUNCT
biotropia-2457	101	34	shin	shin	NOUN
biotropia-2457	101	35	et	et	PROPN
biotropia-2457	101	36	al	al	PROPN
biotropia-2457	101	37	.	.	PROPN
biotropia-2457	101	38	2015	2015	NUM
biotropia-2457	101	39	)	)	PUNCT
biotropia-2457	101	40	.	.	PUNCT
biotropia-2457	102	1	c.	c.	PROPN
biotropia-2457	102	2	epistatic	epistatic	ADJ
biotropia-2457	102	3	interactions	interaction	NOUN
biotropia-2457	102	4	potential	potential	ADJ
biotropia-2457	102	5	genetic	genetic	ADJ
biotropia-2457	102	6	interactions	interaction	NOUN
biotropia-2457	102	7	between	between	ADP
biotropia-2457	102	8	waxy	waxy	NOUN
biotropia-2457	102	9	alleles	allele	NOUN
biotropia-2457	102	10	might	might	AUX
biotropia-2457	102	11	influence	influence	VERB
biotropia-2457	102	12	expression	expression	NOUN
biotropia-2457	102	13	levels	level	NOUN
biotropia-2457	102	14	,	,	PUNCT
biotropia-2457	102	15	causing	cause	VERB
biotropia-2457	102	16	suppression	suppression	NOUN
biotropia-2457	102	17	of	of	ADP
biotropia-2457	102	18	wxa	wxa	NOUN
biotropia-2457	102	19	and	and	CCONJ
biotropia-2457	102	20	wxb	wxb	NOUN
biotropia-2457	102	21	in	in	ADP
biotropia-2457	102	22	favor	favor	NOUN
biotropia-2457	102	23	of	of	ADP
biotropia-2457	102	24	wxc	wxc	NOUN
biotropia-2457	102	25	(	(	PUNCT
biotropia-2457	102	26	wang	wang	PROPN
biotropia-2457	102	27	et	et	PROPN
biotropia-2457	102	28	al	al	PROPN
biotropia-2457	102	29	.	.	PROPN
biotropia-2457	102	30	2022	2022	NUM
biotropia-2457	102	31	)	)	PUNCT
biotropia-2457	102	32	.	.	PUNCT
biotropia-2457	103	1	the	the	DET
biotropia-2457	103	2	chi	chi	ADJ
biotropia-2457	103	3	-	-	PUNCT
biotropia-2457	103	4	square	square	ADJ
biotropia-2457	103	5	test	test	NOUN
biotropia-2457	103	6	confirmed	confirm	VERB
biotropia-2457	103	7	that	that	SCONJ
biotropia-2457	103	8	genetic	genetic	ADJ
biotropia-2457	103	9	segregation	segregation	NOUN
biotropia-2457	103	10	in	in	ADP
biotropia-2457	103	11	the	the	DET
biotropia-2457	103	12	studied	study	VERB
biotropia-2457	103	13	sorghum	sorghum	NOUN
biotropia-2457	103	14	samples	sample	NOUN
biotropia-2457	103	15	does	do	AUX
biotropia-2457	103	16	not	not	PART
biotropia-2457	103	17	significantly	significantly	ADV
biotropia-2457	103	18	deviate	deviate	VERB
biotropia-2457	103	19	from	from	ADP
biotropia-2457	103	20	mendelian	mendelian	ADJ
biotropia-2457	103	21	expectations	expectation	NOUN
biotropia-2457	103	22	at	at	ADP
biotropia-2457	103	23	the	the	DET
biotropia-2457	103	24	α	α	NOUN
biotropia-2457	103	25	=	=	NOUN
biotropia-2457	103	26	0.05	0.05	NUM
biotropia-2457	103	27	level	level	NOUN
biotropia-2457	103	28	.	.	PUNCT
biotropia-2457	104	1	however	however	ADV
biotropia-2457	104	2	,	,	PUNCT
biotropia-2457	104	3	the	the	DET
biotropia-2457	104	4	exclusive	exclusive	ADJ
biotropia-2457	104	5	amplification	amplification	NOUN
biotropia-2457	104	6	of	of	ADP
biotropia-2457	104	7	wxc	wxc	NOUN
biotropia-2457	104	8	suggests	suggest	VERB
biotropia-2457	104	9	that	that	SCONJ
biotropia-2457	104	10	additional	additional	ADJ
biotropia-2457	104	11	genetic	genetic	ADJ
biotropia-2457	104	12	or	or	CCONJ
biotropia-2457	104	13	molecular	molecular	ADJ
biotropia-2457	104	14	factors	factor	NOUN
biotropia-2457	104	15	may	may	AUX
biotropia-2457	104	16	be	be	AUX
biotropia-2457	104	17	influencing	influence	VERB
biotropia-2457	104	18	allele	allele	NOUN
biotropia-2457	104	19	expression	expression	NOUN
biotropia-2457	104	20	.	.	PUNCT
biotropia-2457	105	1	further	further	ADJ
biotropia-2457	105	2	studies	study	NOUN
biotropia-2457	105	3	incorporating	incorporate	VERB
biotropia-2457	105	4	molecular	molecular	ADJ
biotropia-2457	105	5	markers	marker	NOUN
biotropia-2457	105	6	,	,	PUNCT
biotropia-2457	105	7	gene	gene	NOUN
biotropia-2457	105	8	expression	expression	NOUN
biotropia-2457	105	9	analysis	analysis	NOUN
biotropia-2457	105	10	,	,	PUNCT
biotropia-2457	105	11	and	and	CCONJ
biotropia-2457	105	12	controlled	control	VERB
biotropia-2457	105	13	breeding	breeding	NOUN
biotropia-2457	105	14	experiments	experiment	NOUN
biotropia-2457	105	15	are	be	AUX
biotropia-2457	105	16	necessary	necessary	ADJ
biotropia-2457	105	17	to	to	PART
biotropia-2457	105	18	elucidate	elucidate	VERB
biotropia-2457	105	19	the	the	DET
biotropia-2457	105	20	exact	exact	ADJ
biotropia-2457	105	21	mechanisms	mechanism	NOUN
biotropia-2457	105	22	governing	govern	VERB
biotropia-2457	105	23	wxc	wxc	NOUN
biotropia-2457	105	24	dominance	dominance	NOUN
biotropia-2457	105	25	and	and	CCONJ
biotropia-2457	105	26	the	the	DET
biotropia-2457	105	27	suppression	suppression	NOUN
biotropia-2457	105	28	of	of	ADP
biotropia-2457	105	29	wxa	wxa	NOUN
biotropia-2457	105	30	and	and	CCONJ
biotropia-2457	105	31	wxb	wxb	PROPN
biotropia-2457	105	32	.	.	PUNCT
biotropia-2457	106	1	4	4	X
biotropia-2457	106	2	.	.	X
biotropia-2457	106	3	allele	allele	NOUN
biotropia-2457	106	4	frequency	frequency	NOUN
biotropia-2457	106	5	analysis	analysis	NOUN
biotropia-2457	106	6	allele	allele	NOUN
biotropia-2457	106	7	frequency	frequency	NOUN
biotropia-2457	106	8	analysis	analysis	NOUN
biotropia-2457	106	9	is	be	AUX
biotropia-2457	106	10	a	a	DET
biotropia-2457	106	11	fundamental	fundamental	ADJ
biotropia-2457	106	12	approach	approach	NOUN
biotropia-2457	106	13	in	in	ADP
biotropia-2457	106	14	population	population	NOUN
biotropia-2457	106	15	genetics	genetic	NOUN
biotropia-2457	106	16	to	to	PART
biotropia-2457	106	17	determine	determine	VERB
biotropia-2457	106	18	the	the	DET
biotropia-2457	106	19	distribution	distribution	NOUN
biotropia-2457	106	20	of	of	ADP
biotropia-2457	106	21	genetic	genetic	ADJ
biotropia-2457	106	22	variants	variant	NOUN
biotropia-2457	106	23	within	within	ADP
biotropia-2457	106	24	a	a	DET
biotropia-2457	106	25	given	give	VERB
biotropia-2457	106	26	population	population	NOUN
biotropia-2457	106	27	.	.	PUNCT
biotropia-2457	107	1	it	it	PRON
biotropia-2457	107	2	provides	provide	VERB
biotropia-2457	107	3	insight	insight	NOUN
biotropia-2457	107	4	into	into	ADP
biotropia-2457	107	5	the	the	DET
biotropia-2457	107	6	inheritance	inheritance	NOUN
biotropia-2457	107	7	patterns	pattern	NOUN
biotropia-2457	107	8	of	of	ADP
biotropia-2457	107	9	specific	specific	ADJ
biotropia-2457	107	10	genes	gene	NOUN
biotropia-2457	107	11	and	and	CCONJ
biotropia-2457	107	12	helps	helps	AUX
biotropia-2457	107	13	identify	identify	VERB
biotropia-2457	107	14	selective	selective	ADJ
biotropia-2457	107	15	advantages	advantage	NOUN
biotropia-2457	107	16	or	or	CCONJ
biotropia-2457	107	17	genetic	genetic	ADJ
biotropia-2457	107	18	bottlenecks	bottleneck	NOUN
biotropia-2457	107	19	affecting	affect	VERB
biotropia-2457	107	20	allele	allele	NOUN
biotropia-2457	107	21	prevalence	prevalence	NOUN
biotropia-2457	107	22	(	(	PUNCT
biotropia-2457	107	23	hedrick	hedrick	PROPN
biotropia-2457	107	24	2019	2019	NUM
biotropia-2457	107	25	)	)	PUNCT
biotropia-2457	107	26	.	.	PUNCT
biotropia-2457	108	1	in	in	ADP
biotropia-2457	108	2	this	this	DET
biotropia-2457	108	3	study	study	NOUN
biotropia-2457	108	4	,	,	PUNCT
biotropia-2457	108	5	the	the	DET
biotropia-2457	108	6	allele	allele	NOUN
biotropia-2457	108	7	frequencies	frequency	NOUN
biotropia-2457	108	8	of	of	ADP
biotropia-2457	108	9	the	the	DET
biotropia-2457	108	10	waxy	waxy	NOUN
biotropia-2457	108	11	(	(	PUNCT
biotropia-2457	108	12	wx	wx	NOUN
biotropia-2457	108	13	)	)	PUNCT
biotropia-2457	108	14	gene	gene	NOUN
biotropia-2457	108	15	variants	variant	NOUN
biotropia-2457	108	16	(	(	PUNCT
biotropia-2457	108	17	wxa	wxa	X
biotropia-2457	108	18	,	,	PUNCT
biotropia-2457	108	19	wxb	wxb	PRON
biotropia-2457	108	20	,	,	PUNCT
biotropia-2457	108	21	wxc	wxc	NOUN
biotropia-2457	108	22	)	)	PUNCT
biotropia-2457	108	23	were	be	AUX
biotropia-2457	108	24	analyzed	analyze	VERB
biotropia-2457	108	25	to	to	PART
biotropia-2457	108	26	assess	assess	VERB
biotropia-2457	108	27	their	their	PRON
biotropia-2457	108	28	distribution	distribution	NOUN
biotropia-2457	108	29	in	in	ADP
biotropia-2457	108	30	the	the	DET
biotropia-2457	108	31	cross	cross	NOUN
biotropia-2457	108	32	populations	population	NOUN
biotropia-2457	108	33	(	(	PUNCT
biotropia-2457	108	34	kd4	kd4	PROPN
biotropia-2457	108	35	,	,	PUNCT
biotropia-2457	108	36	bg	bg	PROPN
biotropia-2457	108	37	,	,	PUNCT
biotropia-2457	108	38	f1a	f1a	PROPN
biotropia-2457	108	39	,	,	PUNCT
biotropia-2457	108	40	and	and	CCONJ
biotropia-2457	108	41	f1b	f1b	NUM
biotropia-2457	108	42	)	)	PUNCT
biotropia-2457	108	43	.	.	PUNCT
biotropia-2457	109	1	the	the	DET
biotropia-2457	109	2	results	result	NOUN
biotropia-2457	109	3	obtained	obtain	VERB
biotropia-2457	109	4	were	be	AUX
biotropia-2457	109	5	:	:	PUNCT
biotropia-2457	109	6	a	a	X
biotropia-2457	109	7	)	)	PUNCT
biotropia-2457	109	8	wxa	wxa	NOUN
biotropia-2457	109	9	:	:	PUNCT
biotropia-2457	109	10	0/4=00/4=0	0/4=00/4=0	PROPN
biotropia-2457	109	11	(	(	PUNCT
biotropia-2457	109	12	0	0	NUM
biotropia-2457	109	13	%	%	NOUN
biotropia-2457	109	14	)	)	PUNCT
biotropia-2457	109	15	;	;	PUNCT
biotropia-2457	109	16	b	b	X
biotropia-2457	109	17	)	)	PUNCT
biotropia-2457	109	18	wxb	wxb	PROPN
biotropia-2457	109	19	:	:	PUNCT
biotropia-2457	109	20	0/4=00/4=0	0/4=00/4=0	PROPN
biotropia-2457	109	21	(	(	PUNCT
biotropia-2457	109	22	0	0	NUM
biotropia-2457	109	23	%	%	NOUN
biotropia-2457	109	24	)	)	PUNCT
biotropia-2457	109	25	;	;	PUNCT
biotropia-2457	109	26	and	and	CCONJ
biotropia-2457	109	27	c	c	X
biotropia-2457	109	28	)	)	PUNCT
biotropia-2457	109	29	wxc	wxc	NOUN
biotropia-2457	109	30	:	:	PUNCT
biotropia-2457	109	31	4/4=14/4=1	4/4=14/4=1	NUM
biotropia-2457	109	32	(	(	PUNCT
biotropia-2457	109	33	100	100	NUM
biotropia-2457	109	34	%	%	NOUN
biotropia-2457	109	35	)	)	PUNCT
biotropia-2457	109	36	.	.	PUNCT
biotropia-2457	110	1	the	the	DET
biotropia-2457	110	2	exclusive	exclusive	ADJ
biotropia-2457	110	3	presence	presence	NOUN
biotropia-2457	110	4	of	of	ADP
biotropia-2457	110	5	the	the	DET
biotropia-2457	110	6	wxc	wxc	NOUN
biotropia-2457	110	7	allele	allele	NOUN
biotropia-2457	110	8	in	in	ADP
biotropia-2457	110	9	the	the	DET
biotropia-2457	110	10	analyzed	analyze	VERB
biotropia-2457	110	11	sorghum	sorghum	NOUN
biotropia-2457	110	12	samples	sample	NOUN
biotropia-2457	110	13	suggests	suggest	VERB
biotropia-2457	110	14	several	several	ADJ
biotropia-2457	110	15	possible	possible	ADJ
biotropia-2457	110	16	genetic	genetic	ADJ
biotropia-2457	110	17	and	and	CCONJ
biotropia-2457	110	18	evolutionary	evolutionary	ADJ
biotropia-2457	110	19	factors	factor	NOUN
biotropia-2457	110	20	influencing	influence	VERB
biotropia-2457	110	21	allele	allele	NOUN
biotropia-2457	110	22	distribution	distribution	NOUN
biotropia-2457	110	23	:	:	PUNCT
biotropia-2457	110	24	a.	a.	NOUN
biotropia-2457	110	25	selection	selection	NOUN
biotropia-2457	110	26	pressure	pressure	NOUN
biotropia-2457	110	27	favoring	favoring	NOUN
biotropia-2457	110	28	wxc	wxc	VERB
biotropia-2457	110	29	the	the	DET
biotropia-2457	110	30	fixation	fixation	NOUN
biotropia-2457	110	31	of	of	ADP
biotropia-2457	110	32	wxc	wxc	NOUN
biotropia-2457	110	33	at	at	ADP
biotropia-2457	110	34	100	100	NUM
biotropia-2457	110	35	%	%	NOUN
biotropia-2457	110	36	frequency	frequency	NOUN
biotropia-2457	110	37	suggest	suggest	VERB
biotropia-2457	110	38	a	a	DET
biotropia-2457	110	39	selective	selective	ADJ
biotropia-2457	110	40	advantage	advantage	NOUN
biotropia-2457	110	41	in	in	ADP
biotropia-2457	110	42	the	the	DET
biotropia-2457	110	43	studied	study	VERB
biotropia-2457	110	44	sorghum	sorghum	NOUN
biotropia-2457	110	45	lines	line	NOUN
biotropia-2457	110	46	.	.	PUNCT
biotropia-2457	111	1	the	the	DET
biotropia-2457	111	2	wxc	wxc	NOUN
biotropia-2457	111	3	allele	allele	NOUN
biotropia-2457	111	4	might	might	AUX
biotropia-2457	111	5	be	be	AUX
biotropia-2457	111	6	associated	associate	VERB
biotropia-2457	111	7	with	with	ADP
biotropia-2457	111	8	beneficial	beneficial	ADJ
biotropia-2457	111	9	agronomic	agronomic	ADJ
biotropia-2457	111	10	traits	trait	NOUN
biotropia-2457	111	11	,	,	PUNCT
biotropia-2457	111	12	such	such	ADJ
biotropia-2457	111	13	as	as	ADP
biotropia-2457	111	14	improved	improved	ADJ
biotropia-2457	111	15	starch	starch	NOUN
biotropia-2457	111	16	composition	composition	NOUN
biotropia-2457	111	17	or	or	CCONJ
biotropia-2457	111	18	higher	high	ADJ
biotropia-2457	111	19	yield	yield	NOUN
biotropia-2457	111	20	,	,	PUNCT
biotropia-2457	111	21	leading	lead	VERB
biotropia-2457	111	22	to	to	ADP
biotropia-2457	111	23	positive	positive	ADJ
biotropia-2457	111	24	selection	selection	NOUN
biotropia-2457	111	25	over	over	ADP
biotropia-2457	111	26	other	other	ADJ
biotropia-2457	111	27	alleles	allele	NOUN
biotropia-2457	111	28	(	(	PUNCT
biotropia-2457	111	29	tian	tian	PROPN
biotropia-2457	111	30	et	et	PROPN
biotropia-2457	111	31	al	al	PROPN
biotropia-2457	111	32	.	.	PROPN
biotropia-2457	111	33	2009	2009	NUM
biotropia-2457	111	34	)	)	PUNCT
biotropia-2457	111	35	.	.	PUNCT
biotropia-2457	112	1	given	give	VERB
biotropia-2457	112	2	that	that	DET
biotropia-2457	112	3	waxy	waxy	NOUN
biotropia-2457	112	4	starch	starch	NOUN
biotropia-2457	112	5	is	be	AUX
biotropia-2457	112	6	often	often	ADV
biotropia-2457	112	7	preferred	prefer	VERB
biotropia-2457	112	8	in	in	ADP
biotropia-2457	112	9	food	food	NOUN
biotropia-2457	112	10	and	and	CCONJ
biotropia-2457	112	11	industrial	industrial	ADJ
biotropia-2457	112	12	applications	application	NOUN
biotropia-2457	112	13	,	,	PUNCT
biotropia-2457	112	14	it	it	PRON
biotropia-2457	112	15	is	be	AUX
biotropia-2457	112	16	possible	possible	ADJ
biotropia-2457	112	17	that	that	SCONJ
biotropia-2457	112	18	breeding	breeding	NOUN
biotropia-2457	112	19	programs	program	NOUN
biotropia-2457	112	20	have	have	AUX
biotropia-2457	112	21	indirectly	indirectly	ADV
biotropia-2457	112	22	selected	select	VERB
biotropia-2457	112	23	for	for	ADP
biotropia-2457	112	24	this	this	DET
biotropia-2457	112	25	allele	allele	NOUN
biotropia-2457	112	26	,	,	PUNCT
biotropia-2457	112	27	resulting	result	VERB
biotropia-2457	112	28	in	in	ADP
biotropia-2457	112	29	its	its	PRON
biotropia-2457	112	30	predominance	predominance	NOUN
biotropia-2457	112	31	(	(	PUNCT
biotropia-2457	112	32	wang	wang	PROPN
biotropia-2457	112	33	et	et	PROPN
biotropia-2457	112	34	al	al	PROPN
biotropia-2457	112	35	.	.	PROPN
biotropia-2457	112	36	2020	2020	NUM
biotropia-2457	112	37	;	;	PUNCT
biotropia-2457	112	38	maung	maung	PROPN
biotropia-2457	112	39	et	et	PROPN
biotropia-2457	112	40	al	al	PROPN
biotropia-2457	112	41	.	.	PROPN
biotropia-2457	112	42	2021	2021	NUM
biotropia-2457	112	43	)	)	PUNCT
biotropia-2457	112	44	.	.	PUNCT
biotropia-2457	113	1	b.	b.	PROPN
biotropia-2457	113	2	genetic	genetic	ADJ
biotropia-2457	113	3	drift	drift	NOUN
biotropia-2457	113	4	and	and	CCONJ
biotropia-2457	113	5	founder	founder	NOUN
biotropia-2457	113	6	effects	effect	NOUN
biotropia-2457	113	7	the	the	DET
biotropia-2457	113	8	absence	absence	NOUN
biotropia-2457	113	9	of	of	ADP
biotropia-2457	113	10	wxa	wxa	NOUN
biotropia-2457	113	11	and	and	CCONJ
biotropia-2457	113	12	wxb	wxb	PRON
biotropia-2457	113	13	could	could	AUX
biotropia-2457	113	14	also	also	ADV
biotropia-2457	113	15	be	be	AUX
biotropia-2457	113	16	attributed	attribute	VERB
biotropia-2457	113	17	to	to	ADP
biotropia-2457	113	18	genetic	genetic	ADJ
biotropia-2457	113	19	drift	drift	NOUN
biotropia-2457	113	20	,	,	PUNCT
biotropia-2457	113	21	especially	especially	ADV
biotropia-2457	113	22	if	if	SCONJ
biotropia-2457	113	23	the	the	DET
biotropia-2457	113	24	population	population	NOUN
biotropia-2457	113	25	underwent	undergo	VERB
biotropia-2457	113	26	a	a	DET
biotropia-2457	113	27	bottleneck	bottleneck	NOUN
biotropia-2457	113	28	effect	effect	NOUN
biotropia-2457	113	29	or	or	CCONJ
biotropia-2457	113	30	molecular	molecular	ADJ
biotropia-2457	113	31	genetics	genetic	NOUN
biotropia-2457	113	32	of	of	ADP
biotropia-2457	113	33	sorghum	sorghum	NOUN
biotropia-2457	113	34	crosses	crosse	NOUN
biotropia-2457	113	35	kd4	kd4	PROPN
biotropia-2457	113	36	and	and	CCONJ
biotropia-2457	113	37	bonteb	bonteb	PROPN
biotropia-2457	113	38	gunungkidul	gunungkidul	PROPN
biotropia-2457	113	39	muazam	muazam	PROPN
biotropia-2457	113	40	et	et	PROPN
biotropia-2457	113	41	al	al	PROPN
biotropia-2457	113	42	.	.	PROPN
biotropia-2457	113	43	333	333	NUM
biotropia-2457	113	44	was	be	AUX
biotropia-2457	113	45	derived	derive	VERB
biotropia-2457	113	46	from	from	ADP
biotropia-2457	113	47	a	a	DET
biotropia-2457	113	48	limited	limited	ADJ
biotropia-2457	113	49	number	number	NOUN
biotropia-2457	113	50	of	of	ADP
biotropia-2457	113	51	parental	parental	ADJ
biotropia-2457	113	52	genotypes	genotype	NOUN
biotropia-2457	113	53	.	.	PUNCT
biotropia-2457	114	1	in	in	ADP
biotropia-2457	114	2	small	small	ADJ
biotropia-2457	114	3	breeding	breeding	NOUN
biotropia-2457	114	4	populations	population	NOUN
biotropia-2457	114	5	,	,	PUNCT
biotropia-2457	114	6	certain	certain	ADJ
biotropia-2457	114	7	alleles	allele	NOUN
biotropia-2457	114	8	may	may	AUX
biotropia-2457	114	9	be	be	AUX
biotropia-2457	114	10	lost	lose	VERB
biotropia-2457	114	11	due	due	ADJ
biotropia-2457	114	12	to	to	ADP
biotropia-2457	114	13	random	random	ADJ
biotropia-2457	114	14	genetic	genetic	ADJ
biotropia-2457	114	15	drift	drift	NOUN
biotropia-2457	114	16	,	,	PUNCT
biotropia-2457	114	17	leading	lead	VERB
biotropia-2457	114	18	to	to	ADP
biotropia-2457	114	19	fixation	fixation	NOUN
biotropia-2457	114	20	of	of	ADP
biotropia-2457	114	21	a	a	DET
biotropia-2457	114	22	single	single	ADJ
biotropia-2457	114	23	allele	allele	NOUN
biotropia-2457	114	24	over	over	ADP
biotropia-2457	114	25	multiple	multiple	ADJ
biotropia-2457	114	26	generations	generation	NOUN
biotropia-2457	114	27	(	(	PUNCT
biotropia-2457	114	28	falconer	falconer	NOUN
biotropia-2457	114	29	&	&	CCONJ
biotropia-2457	114	30	mackay	mackay	PROPN
biotropia-2457	114	31	1996	1996	NUM
biotropia-2457	114	32	)	)	PUNCT
biotropia-2457	114	33	.	.	PUNCT
biotropia-2457	115	1	c.	c.	NOUN
biotropia-2457	115	2	dominance	dominance	NOUN
biotropia-2457	115	3	and	and	CCONJ
biotropia-2457	115	4	epistatic	epistatic	ADJ
biotropia-2457	115	5	interactions	interaction	NOUN
biotropia-2457	115	6	if	if	SCONJ
biotropia-2457	115	7	wxc	wxc	NOUN
biotropia-2457	115	8	exhibits	exhibit	VERB
biotropia-2457	115	9	strong	strong	ADJ
biotropia-2457	115	10	dominance	dominance	NOUN
biotropia-2457	115	11	over	over	ADP
biotropia-2457	115	12	wxa	wxa	NOUN
biotropia-2457	115	13	and	and	CCONJ
biotropia-2457	115	14	wxb	wxb	PROPN
biotropia-2457	115	15	,	,	PUNCT
biotropia-2457	115	16	it	it	PRON
biotropia-2457	115	17	may	may	AUX
biotropia-2457	115	18	mask	mask	VERB
biotropia-2457	115	19	the	the	DET
biotropia-2457	115	20	expression	expression	NOUN
biotropia-2457	115	21	of	of	ADP
biotropia-2457	115	22	these	these	DET
biotropia-2457	115	23	alleles	allele	NOUN
biotropia-2457	115	24	,	,	PUNCT
biotropia-2457	115	25	preventing	prevent	VERB
biotropia-2457	115	26	their	their	PRON
biotropia-2457	115	27	detection	detection	NOUN
biotropia-2457	115	28	in	in	ADP
biotropia-2457	115	29	the	the	DET
biotropia-2457	115	30	analyzed	analyze	VERB
biotropia-2457	115	31	samples	sample	NOUN
biotropia-2457	115	32	.	.	PUNCT
biotropia-2457	116	1	additionally	additionally	ADV
biotropia-2457	116	2	,	,	PUNCT
biotropia-2457	116	3	epistatic	epistatic	ADJ
biotropia-2457	116	4	interactions	interaction	NOUN
biotropia-2457	116	5	between	between	ADP
biotropia-2457	116	6	genes	gene	NOUN
biotropia-2457	116	7	regulating	regulate	VERB
biotropia-2457	116	8	starch	starch	NOUN
biotropia-2457	116	9	biosynthesis	biosynthesis	NOUN
biotropia-2457	116	10	may	may	AUX
biotropia-2457	116	11	play	play	VERB
biotropia-2457	116	12	a	a	DET
biotropia-2457	116	13	role	role	NOUN
biotropia-2457	116	14	in	in	ADP
biotropia-2457	116	15	the	the	DET
biotropia-2457	116	16	observed	observe	VERB
biotropia-2457	116	17	allele	allele	NOUN
biotropia-2457	116	18	distribution	distribution	NOUN
biotropia-2457	116	19	(	(	PUNCT
biotropia-2457	116	20	zhang	zhang	X
biotropia-2457	116	21	et	et	PROPN
biotropia-2457	116	22	al	al	PROPN
biotropia-2457	116	23	.	.	PROPN
biotropia-2457	116	24	2021	2021	NUM
biotropia-2457	116	25	)	)	PUNCT
biotropia-2457	116	26	.	.	PUNCT
biotropia-2457	117	1	further	further	ADJ
biotropia-2457	117	2	investigation	investigation	NOUN
biotropia-2457	117	3	into	into	ADP
biotropia-2457	117	4	gene	gene	NOUN
biotropia-2457	117	5	expression	expression	NOUN
biotropia-2457	117	6	patterns	pattern	NOUN
biotropia-2457	117	7	and	and	CCONJ
biotropia-2457	117	8	regulatory	regulatory	ADJ
biotropia-2457	117	9	mechanisms	mechanism	NOUN
biotropia-2457	117	10	is	be	AUX
biotropia-2457	117	11	necessary	necessary	ADJ
biotropia-2457	117	12	to	to	PART
biotropia-2457	117	13	confirm	confirm	VERB
biotropia-2457	117	14	whether	whether	SCONJ
biotropia-2457	117	15	such	such	ADJ
biotropia-2457	117	16	interactions	interaction	NOUN
biotropia-2457	117	17	influence	influence	NOUN
biotropia-2457	117	18	wxc	wxc	VERB
biotropia-2457	117	19	dominance	dominance	NOUN
biotropia-2457	117	20	.	.	PUNCT
biotropia-2457	118	1	d.	d.	PROPN
biotropia-2457	118	2	pcr	pcr	PROPN
biotropia-2457	118	3	and	and	CCONJ
biotropia-2457	118	4	electrophoresis	electrophoresis	NOUN
biotropia-2457	118	5	detection	detection	NOUN
biotropia-2457	118	6	limitations	limitation	NOUN
biotropia-2457	118	7	it	it	PRON
biotropia-2457	118	8	is	be	AUX
biotropia-2457	118	9	also	also	ADV
biotropia-2457	118	10	important	important	ADJ
biotropia-2457	118	11	to	to	PART
biotropia-2457	118	12	consider	consider	VERB
biotropia-2457	118	13	technical	technical	ADJ
biotropia-2457	118	14	limitations	limitation	NOUN
biotropia-2457	118	15	in	in	ADP
biotropia-2457	118	16	detecting	detect	VERB
biotropia-2457	118	17	wxa	wxa	NOUN
biotropia-2457	118	18	and	and	CCONJ
biotropia-2457	118	19	wxb	wxb	PROPN
biotropia-2457	118	20	.	.	PUNCT
biotropia-2457	119	1	the	the	DET
biotropia-2457	119	2	lack	lack	NOUN
biotropia-2457	119	3	of	of	ADP
biotropia-2457	119	4	amplification	amplification	NOUN
biotropia-2457	119	5	for	for	ADP
biotropia-2457	119	6	these	these	DET
biotropia-2457	119	7	alleles	allele	NOUN
biotropia-2457	119	8	could	could	AUX
biotropia-2457	119	9	be	be	AUX
biotropia-2457	119	10	due	due	ADJ
biotropia-2457	119	11	to	to	ADP
biotropia-2457	119	12	inefficient	inefficient	ADJ
biotropia-2457	119	13	primer	primer	NOUN
biotropia-2457	119	14	binding	bind	VERB
biotropia-2457	119	15	,	,	PUNCT
biotropia-2457	119	16	sequence	sequence	NOUN
biotropia-2457	119	17	variations	variation	NOUN
biotropia-2457	119	18	at	at	ADP
biotropia-2457	119	19	primer	primer	NOUN
biotropia-2457	119	20	sites	site	NOUN
biotropia-2457	119	21	,	,	PUNCT
biotropia-2457	119	22	or	or	CCONJ
biotropia-2457	119	23	low	low	ADJ
biotropia-2457	119	24	template	template	NOUN
biotropia-2457	119	25	dna	dna	NOUN
biotropia-2457	119	26	concentrations	concentration	NOUN
biotropia-2457	119	27	(	(	PUNCT
biotropia-2457	119	28	shin	shin	NOUN
biotropia-2457	119	29	et	et	PROPN
biotropia-2457	119	30	al	al	PROPN
biotropia-2457	119	31	.	.	PROPN
biotropia-2457	119	32	2015	2015	NUM
biotropia-2457	119	33	)	)	PUNCT
biotropia-2457	119	34	.	.	PUNCT
biotropia-2457	120	1	repeating	repeat	VERB
biotropia-2457	120	2	the	the	DET
biotropia-2457	120	3	analysis	analysis	NOUN
biotropia-2457	120	4	with	with	ADP
biotropia-2457	120	5	alternative	alternative	ADJ
biotropia-2457	120	6	molecular	molecular	ADJ
biotropia-2457	120	7	markers	marker	NOUN
biotropia-2457	120	8	or	or	CCONJ
biotropia-2457	120	9	sequencing	sequence	VERB
biotropia-2457	120	10	approaches	approach	NOUN
biotropia-2457	120	11	could	could	AUX
biotropia-2457	120	12	validate	validate	VERB
biotropia-2457	120	13	these	these	DET
biotropia-2457	120	14	findings	finding	NOUN
biotropia-2457	120	15	and	and	CCONJ
biotropia-2457	120	16	rule	rule	VERB
biotropia-2457	120	17	out	out	ADP
biotropia-2457	120	18	technical	technical	ADJ
biotropia-2457	120	19	biases	bias	NOUN
biotropia-2457	120	20	.	.	PUNCT
biotropia-2457	121	1	the	the	DET
biotropia-2457	121	2	observed	observe	VERB
biotropia-2457	121	3	fixation	fixation	NOUN
biotropia-2457	121	4	of	of	ADP
biotropia-2457	121	5	the	the	DET
biotropia-2457	121	6	wxc	wxc	NOUN
biotropia-2457	121	7	allele	allele	NOUN
biotropia-2457	121	8	has	have	VERB
biotropia-2457	121	9	significant	significant	ADJ
biotropia-2457	121	10	implications	implication	NOUN
biotropia-2457	121	11	for	for	ADP
biotropia-2457	121	12	sorghum	sorghum	NOUN
biotropia-2457	121	13	breeding	breeding	NOUN
biotropia-2457	121	14	and	and	CCONJ
biotropia-2457	121	15	starch	starch	NOUN
biotropia-2457	121	16	quality	quality	NOUN
biotropia-2457	121	17	improvement	improvement	NOUN
biotropia-2457	121	18	.	.	PUNCT
biotropia-2457	122	1	since	since	SCONJ
biotropia-2457	122	2	wxc	wxc	VERB
biotropia-2457	122	3	confers	confer	NOUN
biotropia-2457	122	4	a	a	DET
biotropia-2457	122	5	waxy	waxy	NOUN
biotropia-2457	122	6	starch	starch	NOUN
biotropia-2457	122	7	phenotype	phenotype	NOUN
biotropia-2457	122	8	,	,	PUNCT
biotropia-2457	122	9	its	its	PRON
biotropia-2457	122	10	exclusive	exclusive	ADJ
biotropia-2457	122	11	presence	presence	NOUN
biotropia-2457	122	12	may	may	AUX
biotropia-2457	122	13	indicate	indicate	VERB
biotropia-2457	122	14	a	a	DET
biotropia-2457	122	15	targeted	target	VERB
biotropia-2457	122	16	selection	selection	NOUN
biotropia-2457	122	17	for	for	ADP
biotropia-2457	122	18	this	this	DET
biotropia-2457	122	19	trait	trait	NOUN
biotropia-2457	122	20	in	in	ADP
biotropia-2457	122	21	breeding	breeding	NOUN
biotropia-2457	122	22	programs	program	NOUN
biotropia-2457	122	23	(	(	PUNCT
biotropia-2457	122	24	paterson	paterson	PROPN
biotropia-2457	122	25	et	et	PROPN
biotropia-2457	122	26	al	al	PROPN
biotropia-2457	122	27	.	.	PROPN
biotropia-2457	122	28	2009	2009	NUM
biotropia-2457	122	29	)	)	PUNCT
biotropia-2457	122	30	.	.	PUNCT
biotropia-2457	123	1	the	the	DET
biotropia-2457	123	2	complete	complete	ADJ
biotropia-2457	123	3	absence	absence	NOUN
biotropia-2457	123	4	of	of	ADP
biotropia-2457	123	5	wxa	wxa	NOUN
biotropia-2457	123	6	and	and	CCONJ
biotropia-2457	123	7	wxb	wxb	PRON
biotropia-2457	123	8	suggests	suggest	VERB
biotropia-2457	123	9	that	that	SCONJ
biotropia-2457	123	10	traditional	traditional	ADJ
biotropia-2457	123	11	non	non	ADJ
biotropia-2457	123	12	-	-	ADJ
biotropia-2457	123	13	waxy	waxy	ADJ
biotropia-2457	123	14	alleles	allele	NOUN
biotropia-2457	123	15	have	have	AUX
biotropia-2457	123	16	been	be	AUX
biotropia-2457	123	17	eliminated	eliminate	VERB
biotropia-2457	123	18	in	in	ADP
biotropia-2457	123	19	these	these	DET
biotropia-2457	123	20	specific	specific	ADJ
biotropia-2457	123	21	sorghum	sorghum	NOUN
biotropia-2457	123	22	lines	line	NOUN
biotropia-2457	123	23	,	,	PUNCT
biotropia-2457	123	24	possibly	possibly	ADV
biotropia-2457	123	25	due	due	ADP
biotropia-2457	123	26	to	to	ADP
biotropia-2457	123	27	human	human	NOUN
biotropia-2457	123	28	-	-	PUNCT
biotropia-2457	123	29	driven	drive	VERB
biotropia-2457	123	30	selection	selection	NOUN
biotropia-2457	123	31	for	for	ADP
biotropia-2457	123	32	improved	improved	ADJ
biotropia-2457	123	33	processing	processing	NOUN
biotropia-2457	123	34	and	and	CCONJ
biotropia-2457	123	35	culinary	culinary	NOUN
biotropia-2457	123	36	properties	property	NOUN
biotropia-2457	123	37	(	(	PUNCT
biotropia-2457	123	38	tian	tian	PROPN
biotropia-2457	123	39	et	et	PROPN
biotropia-2457	123	40	al	al	PROPN
biotropia-2457	123	41	.	.	PROPN
biotropia-2457	123	42	2011	2011	NUM
biotropia-2457	123	43	)	)	PUNCT
biotropia-2457	123	44	.	.	PUNCT
biotropia-2457	124	1	future	future	ADJ
biotropia-2457	124	2	research	research	NOUN
biotropia-2457	124	3	should	should	AUX
biotropia-2457	124	4	focus	focus	VERB
biotropia-2457	124	5	on	on	ADP
biotropia-2457	124	6	expanding	expand	VERB
biotropia-2457	124	7	the	the	DET
biotropia-2457	124	8	genetic	genetic	ADJ
biotropia-2457	124	9	pool	pool	NOUN
biotropia-2457	124	10	to	to	PART
biotropia-2457	124	11	determine	determine	VERB
biotropia-2457	124	12	whether	whether	SCONJ
biotropia-2457	124	13	wxa	wxa	NOUN
biotropia-2457	124	14	and	and	CCONJ
biotropia-2457	124	15	wxb	wxb	NOUN
biotropia-2457	124	16	alleles	allele	NOUN
biotropia-2457	124	17	exist	exist	VERB
biotropia-2457	124	18	at	at	ADP
biotropia-2457	124	19	low	low	ADJ
biotropia-2457	124	20	frequencies	frequency	NOUN
biotropia-2457	124	21	in	in	ADP
biotropia-2457	124	22	related	related	ADJ
biotropia-2457	124	23	sorghum	sorghum	NOUN
biotropia-2457	124	24	populations	population	NOUN
biotropia-2457	124	25	.	.	PUNCT
biotropia-2457	125	1	additionally	additionally	ADV
biotropia-2457	125	2	,	,	PUNCT
biotropia-2457	125	3	transcriptomic	transcriptomic	ADJ
biotropia-2457	125	4	and	and	CCONJ
biotropia-2457	125	5	proteomic	proteomic	ADJ
biotropia-2457	125	6	analyses	analysis	NOUN
biotropia-2457	125	7	could	could	AUX
biotropia-2457	125	8	provide	provide	VERB
biotropia-2457	125	9	insights	insight	NOUN
biotropia-2457	125	10	into	into	ADP
biotropia-2457	125	11	how	how	SCONJ
biotropia-2457	125	12	gene	gene	NOUN
biotropia-2457	125	13	expression	expression	NOUN
biotropia-2457	125	14	differences	difference	NOUN
biotropia-2457	125	15	contribute	contribute	VERB
biotropia-2457	125	16	to	to	ADP
biotropia-2457	125	17	the	the	DET
biotropia-2457	125	18	predominance	predominance	NOUN
biotropia-2457	125	19	of	of	ADP
biotropia-2457	125	20	wxc	wxc	NOUN
biotropia-2457	125	21	at	at	ADP
biotropia-2457	125	22	the	the	DET
biotropia-2457	125	23	phenotypic	phenotypic	ADJ
biotropia-2457	125	24	level	level	NOUN
biotropia-2457	125	25	.	.	PUNCT
biotropia-2457	126	1	allele	allele	NOUN
biotropia-2457	126	2	frequency	frequency	NOUN
biotropia-2457	126	3	analysis	analysis	NOUN
biotropia-2457	126	4	of	of	ADP
biotropia-2457	126	5	the	the	DET
biotropia-2457	126	6	waxy	waxy	NOUN
biotropia-2457	126	7	gene	gene	NOUN
biotropia-2457	126	8	in	in	ADP
biotropia-2457	126	9	the	the	DET
biotropia-2457	126	10	studied	study	VERB
biotropia-2457	126	11	sorghum	sorghum	NOUN
biotropia-2457	126	12	populations	population	NOUN
biotropia-2457	126	13	revealed	reveal	VERB
biotropia-2457	126	14	a	a	DET
biotropia-2457	126	15	complete	complete	ADJ
biotropia-2457	126	16	fixation	fixation	NOUN
biotropia-2457	126	17	of	of	ADP
biotropia-2457	126	18	the	the	DET
biotropia-2457	126	19	wxc	wxc	NOUN
biotropia-2457	126	20	allele	allele	NOUN
biotropia-2457	126	21	(	(	PUNCT
biotropia-2457	126	22	100	100	NUM
biotropia-2457	126	23	%	%	NOUN
biotropia-2457	126	24	)	)	PUNCT
biotropia-2457	126	25	and	and	CCONJ
biotropia-2457	126	26	the	the	DET
biotropia-2457	126	27	absence	absence	NOUN
biotropia-2457	126	28	of	of	ADP
biotropia-2457	126	29	wxa	wxa	NOUN
biotropia-2457	126	30	and	and	CCONJ
biotropia-2457	126	31	wxb	wxb	PROPN
biotropia-2457	126	32	.	.	PUNCT
biotropia-2457	127	1	this	this	DET
biotropia-2457	127	2	phenomenon	phenomenon	NOUN
biotropia-2457	127	3	suggests	suggest	VERB
biotropia-2457	127	4	that	that	SCONJ
biotropia-2457	127	5	wxc	wxc	NOUN
biotropia-2457	127	6	may	may	AUX
biotropia-2457	127	7	confer	confer	VERB
biotropia-2457	127	8	a	a	DET
biotropia-2457	127	9	selective	selective	ADJ
biotropia-2457	127	10	advantage	advantage	NOUN
biotropia-2457	127	11	or	or	CCONJ
biotropia-2457	127	12	has	have	AUX
biotropia-2457	127	13	been	be	AUX
biotropia-2457	127	14	subject	subject	ADJ
biotropia-2457	127	15	to	to	ADP
biotropia-2457	127	16	a	a	DET
biotropia-2457	127	17	strong	strong	ADJ
biotropia-2457	127	18	genetic	genetic	ADJ
biotropia-2457	127	19	drift	drift	NOUN
biotropia-2457	127	20	or	or	CCONJ
biotropia-2457	127	21	breeding	breeding	NOUN
biotropia-2457	127	22	selection	selection	NOUN
biotropia-2457	127	23	.	.	PUNCT
biotropia-2457	128	1	while	while	SCONJ
biotropia-2457	128	2	these	these	DET
biotropia-2457	128	3	findings	finding	NOUN
biotropia-2457	128	4	provide	provide	VERB
biotropia-2457	128	5	valuable	valuable	ADJ
biotropia-2457	128	6	insights	insight	NOUN
biotropia-2457	128	7	into	into	ADP
biotropia-2457	128	8	the	the	DET
biotropia-2457	128	9	genetic	genetic	ADJ
biotropia-2457	128	10	architecture	architecture	NOUN
biotropia-2457	128	11	of	of	ADP
biotropia-2457	128	12	starch	starch	NOUN
biotropia-2457	128	13	biosynthesis	biosynthesis	NOUN
biotropia-2457	128	14	in	in	ADP
biotropia-2457	128	15	sorghum	sorghum	NOUN
biotropia-2457	128	16	,	,	PUNCT
biotropia-2457	128	17	further	far	ADV
biotropia-2457	128	18	molecular	molecular	ADJ
biotropia-2457	128	19	investigations	investigation	NOUN
biotropia-2457	128	20	are	be	AUX
biotropia-2457	128	21	needed	need	VERB
biotropia-2457	128	22	to	to	PART
biotropia-2457	128	23	confirm	confirm	VERB
biotropia-2457	128	24	the	the	DET
biotropia-2457	128	25	underlying	underlie	VERB
biotropia-2457	128	26	mechanisms	mechanism	NOUN
biotropia-2457	128	27	driving	drive	VERB
biotropia-2457	128	28	wxc	wxc	NOUN
biotropia-2457	128	29	fixation	fixation	NOUN
biotropia-2457	128	30	.	.	PUNCT
biotropia-2457	129	1	3	3	X
biotropia-2457	129	2	.	.	X
biotropia-2457	129	3	pearson	pearson	PROPN
biotropia-2457	129	4	correlation	correlation	PROPN
biotropia-2457	129	5	test	test	NOUN
biotropia-2457	129	6	the	the	DET
biotropia-2457	129	7	pearson	pearson	PROPN
biotropia-2457	129	8	correlation	correlation	NOUN
biotropia-2457	129	9	test	test	NOUN
biotropia-2457	129	10	was	be	AUX
biotropia-2457	129	11	employed	employ	VERB
biotropia-2457	129	12	to	to	PART
biotropia-2457	129	13	assess	assess	VERB
biotropia-2457	129	14	the	the	DET
biotropia-2457	129	15	relationship	relationship	NOUN
biotropia-2457	129	16	between	between	ADP
biotropia-2457	129	17	waxy	waxy	NOUN
biotropia-2457	129	18	(	(	PUNCT
biotropia-2457	129	19	wx	wx	NOUN
biotropia-2457	129	20	)	)	PUNCT
biotropia-2457	129	21	gene	gene	NOUN
biotropia-2457	129	22	expression	expression	NOUN
biotropia-2457	129	23	and	and	CCONJ
biotropia-2457	129	24	amylose	amylose	ADJ
biotropia-2457	129	25	content	content	NOUN
biotropia-2457	129	26	in	in	ADP
biotropia-2457	129	27	the	the	DET
biotropia-2457	129	28	studied	study	VERB
biotropia-2457	129	29	sorghum	sorghum	NOUN
biotropia-2457	129	30	samples	sample	NOUN
biotropia-2457	129	31	(	(	PUNCT
biotropia-2457	129	32	table	table	NOUN
biotropia-2457	129	33	2	2	NUM
biotropia-2457	129	34	)	)	PUNCT
biotropia-2457	129	35	.	.	PUNCT
biotropia-2457	130	1	pearson	pearson	PROPN
biotropia-2457	130	2	’s	’s	PART
biotropia-2457	130	3	correlation	correlation	NOUN
biotropia-2457	130	4	coefficient	coefficient	NOUN
biotropia-2457	130	5	(	(	PUNCT
biotropia-2457	130	6	r	r	NOUN
biotropia-2457	130	7	)	)	PUNCT
biotropia-2457	130	8	measures	measure	NOUN
biotropia-2457	130	9	the	the	DET
biotropia-2457	130	10	strength	strength	NOUN
biotropia-2457	130	11	and	and	CCONJ
biotropia-2457	130	12	direction	direction	NOUN
biotropia-2457	130	13	of	of	ADP
biotropia-2457	130	14	a	a	DET
biotropia-2457	130	15	linear	linear	ADJ
biotropia-2457	130	16	relationship	relationship	NOUN
biotropia-2457	130	17	between	between	ADP
biotropia-2457	130	18	two	two	NUM
biotropia-2457	130	19	continuous	continuous	ADJ
biotropia-2457	130	20	variables	variable	NOUN
biotropia-2457	130	21	,	,	PUNCT
biotropia-2457	130	22	providing	provide	VERB
biotropia-2457	130	23	insights	insight	NOUN
biotropia-2457	130	24	into	into	ADP
biotropia-2457	130	25	genetic	genetic	ADJ
biotropia-2457	130	26	interactions	interaction	NOUN
biotropia-2457	130	27	influencing	influence	VERB
biotropia-2457	130	28	starch	starch	NOUN
biotropia-2457	130	29	biosynthesis	biosynthesis	NOUN
biotropia-2457	130	30	(	(	PUNCT
biotropia-2457	130	31	rodgers	rodger	NOUN
biotropia-2457	130	32	&	&	CCONJ
biotropia-2457	130	33	nicewander	nicewander	NOUN
biotropia-2457	130	34	1988	1988	NUM
biotropia-2457	130	35	)	)	PUNCT
biotropia-2457	130	36	.	.	PUNCT
biotropia-2457	131	1	this	this	DET
biotropia-2457	131	2	test	test	NOUN
biotropia-2457	131	3	is	be	AUX
biotropia-2457	131	4	commonly	commonly	ADV
biotropia-2457	131	5	used	use	VERB
biotropia-2457	131	6	in	in	ADP
biotropia-2457	131	7	plant	plant	NOUN
biotropia-2457	131	8	genetics	genetic	NOUN
biotropia-2457	131	9	to	to	PART
biotropia-2457	131	10	evaluate	evaluate	VERB
biotropia-2457	131	11	the	the	DET
biotropia-2457	131	12	impact	impact	NOUN
biotropia-2457	131	13	of	of	ADP
biotropia-2457	131	14	specific	specific	ADJ
biotropia-2457	131	15	gene	gene	NOUN
biotropia-2457	131	16	expressions	expression	NOUN
biotropia-2457	131	17	on	on	ADP
biotropia-2457	131	18	biochemical	biochemical	ADJ
biotropia-2457	131	19	traits	trait	NOUN
biotropia-2457	131	20	such	such	ADJ
biotropia-2457	131	21	as	as	ADP
biotropia-2457	131	22	starch	starch	NOUN
biotropia-2457	131	23	composition	composition	NOUN
biotropia-2457	131	24	(	(	PUNCT
biotropia-2457	131	25	huang	huang	PROPN
biotropia-2457	131	26	et	et	PROPN
biotropia-2457	131	27	al	al	PROPN
biotropia-2457	131	28	.	.	PROPN
biotropia-2457	131	29	2020	2020	NUM
biotropia-2457	131	30	)	)	PUNCT
biotropia-2457	131	31	.	.	PUNCT
biotropia-2457	132	1	table	table	NOUN
biotropia-2457	132	2	2	2	NUM
biotropia-2457	132	3	evaluated	evaluate	VERB
biotropia-2457	132	4	relationships	relationship	NOUN
biotropia-2457	132	5	between	between	ADP
biotropia-2457	132	6	expressions	expression	NOUN
biotropia-2457	132	7	of	of	ADP
biotropia-2457	132	8	waxy	waxy	NOUN
biotropia-2457	132	9	genes	gene	NOUN
biotropia-2457	132	10	and	and	CCONJ
biotropia-2457	132	11	amylose	amylose	ADJ
biotropia-2457	132	12	content	content	NOUN
biotropia-2457	132	13	sample	sample	NOUN
biotropia-2457	132	14	allele	allele	NOUN
biotropia-2457	132	15	expression	expression	NOUN
biotropia-2457	132	16	amylose	amylose	NOUN
biotropia-2457	132	17	content	content	NOUN
biotropia-2457	132	18	(	(	PUNCT
biotropia-2457	132	19	%	%	INTJ
biotropia-2457	132	20	)	)	PUNCT
biotropia-2457	132	21	kd4	kd4	PROPN
biotropia-2457	132	22	wxc	wxc	VERB
biotropia-2457	132	23	19	19	NUM
biotropia-2457	132	24	bg	bg	NOUN
biotropia-2457	132	25	wxc	wxc	VERB
biotropia-2457	132	26	2	2	NUM
biotropia-2457	132	27	f1a	f1a	PROPN
biotropia-2457	132	28	wxc	wxc	VERB
biotropia-2457	132	29	10	10	NUM
biotropia-2457	132	30	f1b	f1b	ADV
biotropia-2457	132	31	wxc	wxc	VERB
biotropia-2457	132	32	12	12	NUM
biotropia-2457	132	33	biotropia	biotropia	ADJ
biotropia-2457	132	34	vol	vol	NOUN
biotropia-2457	132	35	.	.	PUNCT
biotropia-2457	133	1	32	32	NUM
biotropia-2457	134	1	no	no	NOUN
biotropia-2457	134	2	.	.	NOUN
biotropia-2457	135	1	3	3	NUM
biotropia-2457	135	2	,	,	PUNCT
biotropia-2457	135	3	2025	2025	NUM
biotropia-2457	135	4	334	334	NUM
biotropia-2457	135	5	hypotheses	hypothesis	NOUN
biotropia-2457	135	6	:	:	PUNCT
biotropia-2457	135	7	•	•	NUM
biotropia-2457	135	8	h0	h0	NOUN
biotropia-2457	135	9	:	:	PUNCT
biotropia-2457	135	10	no	no	DET
biotropia-2457	135	11	relationship	relationship	NOUN
biotropia-2457	135	12	exists	exist	VERB
biotropia-2457	135	13	between	between	ADP
biotropia-2457	135	14	expressions	expression	NOUN
biotropia-2457	135	15	of	of	ADP
biotropia-2457	135	16	waxy	waxy	NOUN
biotropia-2457	135	17	genes	gene	NOUN
biotropia-2457	135	18	and	and	CCONJ
biotropia-2457	135	19	amylose	amylose	ADJ
biotropia-2457	135	20	content	content	NOUN
biotropia-2457	135	21	.	.	PUNCT
biotropia-2457	136	1	•	•	NUM
biotropia-2457	136	2	h1	h1	PROPN
biotropia-2457	136	3	:	:	PUNCT
biotropia-2457	136	4	a	a	DET
biotropia-2457	136	5	relationship	relationship	NOUN
biotropia-2457	136	6	exists	exist	VERB
biotropia-2457	136	7	between	between	ADP
biotropia-2457	136	8	expressions	expression	NOUN
biotropia-2457	136	9	of	of	ADP
biotropia-2457	136	10	waxy	waxy	NOUN
biotropia-2457	136	11	genes	gene	NOUN
biotropia-2457	136	12	and	and	CCONJ
biotropia-2457	136	13	amylose	amylose	ADJ
biotropia-2457	136	14	content	content	NOUN
biotropia-2457	136	15	.	.	PUNCT
biotropia-2457	137	1	the	the	DET
biotropia-2457	137	2	pearson	pearson	PROPN
biotropia-2457	137	3	correlation	correlation	NOUN
biotropia-2457	137	4	coefficient	coefficient	NOUN
biotropia-2457	137	5	was	be	AUX
biotropia-2457	137	6	calculated	calculate	VERB
biotropia-2457	137	7	using	use	VERB
biotropia-2457	137	8	formula	formula	NOUN
biotropia-2457	137	9	:	:	PUNCT
biotropia-2457	137	10	where	where	SCONJ
biotropia-2457	137	11	:	:	PUNCT
biotropia-2457	137	12	x	x	SYM
biotropia-2457	137	13	=	=	PRON
biotropia-2457	137	14	wxc	wxc	VERB
biotropia-2457	137	15	expression	expression	NOUN
biotropia-2457	137	16	(	(	PUNCT
biotropia-2457	137	17	constant	constant	ADJ
biotropia-2457	137	18	value	value	NOUN
biotropia-2457	137	19	of	of	ADP
biotropia-2457	137	20	1	1	NUM
biotropia-2457	137	21	across	across	ADP
biotropia-2457	137	22	all	all	DET
biotropia-2457	137	23	samples	sample	NOUN
biotropia-2457	137	24	)	)	PUNCT
biotropia-2457	137	25	.	.	PUNCT
biotropia-2457	138	1	y	y	NOUN
biotropia-2457	138	2	=	=	PUNCT
biotropia-2457	138	3	percentage	percentage	NOUN
biotropia-2457	138	4	of	of	ADP
biotropia-2457	138	5	amylose	amylose	ADJ
biotropia-2457	138	6	content	content	NOUN
biotropia-2457	138	7	given	give	VERB
biotropia-2457	138	8	that	that	PRON
biotropia-2457	138	9	wxc	wxc	NOUN
biotropia-2457	138	10	expression	expression	NOUN
biotropia-2457	138	11	is	be	AUX
biotropia-2457	138	12	invariant	invariant	ADJ
biotropia-2457	138	13	(	(	PUNCT
biotropia-2457	138	14	always	always	ADV
biotropia-2457	138	15	1	1	NUM
biotropia-2457	138	16	)	)	PUNCT
biotropia-2457	138	17	,	,	PUNCT
biotropia-2457	138	18	a	a	DET
biotropia-2457	138	19	direct	direct	ADJ
biotropia-2457	138	20	pearson	pearson	NOUN
biotropia-2457	138	21	correlation	correlation	NOUN
biotropia-2457	138	22	calculation	calculation	NOUN
biotropia-2457	138	23	would	would	AUX
biotropia-2457	138	24	yield	yield	VERB
biotropia-2457	138	25	an	an	DET
biotropia-2457	138	26	undefined	undefined	ADJ
biotropia-2457	138	27	result	result	NOUN
biotropia-2457	138	28	,	,	PUNCT
biotropia-2457	138	29	as	as	SCONJ
biotropia-2457	138	30	standard	standard	ADJ
biotropia-2457	138	31	deviation	deviation	NOUN
biotropia-2457	138	32	in	in	ADP
biotropia-2457	138	33	the	the	DET
biotropia-2457	138	34	independent	independent	ADJ
biotropia-2457	138	35	variable	variable	NOUN
biotropia-2457	138	36	is	be	AUX
biotropia-2457	138	37	zero	zero	NUM
biotropia-2457	138	38	.	.	PUNCT
biotropia-2457	139	1	this	this	DET
biotropia-2457	139	2	result	result	NOUN
biotropia-2457	139	3	suggests	suggest	VERB
biotropia-2457	139	4	that	that	SCONJ
biotropia-2457	139	5	while	while	SCONJ
biotropia-2457	139	6	the	the	DET
biotropia-2457	139	7	presence	presence	NOUN
biotropia-2457	139	8	of	of	ADP
biotropia-2457	139	9	wxc	wxc	NOUN
biotropia-2457	139	10	is	be	AUX
biotropia-2457	139	11	necessary	necessary	ADJ
biotropia-2457	139	12	for	for	ADP
biotropia-2457	139	13	waxy	waxy	NOUN
biotropia-2457	139	14	starch	starch	NOUN
biotropia-2457	139	15	production	production	NOUN
biotropia-2457	139	16	,	,	PUNCT
biotropia-2457	139	17	it	it	PRON
biotropia-2457	139	18	alone	alone	ADV
biotropia-2457	139	19	does	do	AUX
biotropia-2457	139	20	not	not	PART
biotropia-2457	139	21	determine	determine	VERB
biotropia-2457	139	22	the	the	DET
biotropia-2457	139	23	variation	variation	NOUN
biotropia-2457	139	24	in	in	ADP
biotropia-2457	139	25	amylose	amylose	ADJ
biotropia-2457	139	26	content	content	NOUN
biotropia-2457	139	27	.	.	PUNCT
biotropia-2457	140	1	instead	instead	ADV
biotropia-2457	140	2	,	,	PUNCT
biotropia-2457	140	3	post	post	ADJ
biotropia-2457	140	4	-	-	ADJ
biotropia-2457	140	5	transcriptional	transcriptional	ADJ
biotropia-2457	140	6	regulation	regulation	NOUN
biotropia-2457	140	7	,	,	PUNCT
biotropia-2457	140	8	environmental	environmental	ADJ
biotropia-2457	140	9	influences	influence	NOUN
biotropia-2457	140	10	,	,	PUNCT
biotropia-2457	140	11	or	or	CCONJ
biotropia-2457	140	12	additional	additional	ADJ
biotropia-2457	140	13	genetic	genetic	ADJ
biotropia-2457	140	14	factors	factor	NOUN
biotropia-2457	140	15	may	may	AUX
biotropia-2457	140	16	be	be	AUX
biotropia-2457	140	17	involved	involve	VERB
biotropia-2457	140	18	(	(	PUNCT
biotropia-2457	140	19	tian	tian	PROPN
biotropia-2457	140	20	et	et	PROPN
biotropia-2457	140	21	al	al	PROPN
biotropia-2457	140	22	.	.	PROPN
biotropia-2457	140	23	2009	2009	NUM
biotropia-2457	140	24	)	)	PUNCT
biotropia-2457	140	25	.	.	PUNCT
biotropia-2457	141	1	results	result	NOUN
biotropia-2457	141	2	of	of	ADP
biotropia-2457	141	3	pearson	pearson	PROPN
biotropia-2457	141	4	correlation	correlation	NOUN
biotropia-2457	141	5	test	test	NOUN
biotropia-2457	141	6	suggest	suggest	VERB
biotropia-2457	141	7	:	:	PUNCT
biotropia-2457	141	8	a.	a.	NOUN
biotropia-2457	141	9	lack	lack	NOUN
biotropia-2457	141	10	of	of	ADP
biotropia-2457	141	11	correlation	correlation	NOUN
biotropia-2457	141	12	due	due	ADP
biotropia-2457	141	13	to	to	ADP
biotropia-2457	141	14	uniform	uniform	ADJ
biotropia-2457	141	15	wxc	wxc	NOUN
biotropia-2457	141	16	expression	expression	NOUN
biotropia-2457	141	17	since	since	SCONJ
biotropia-2457	141	18	all	all	DET
biotropia-2457	141	19	samples	sample	NOUN
biotropia-2457	141	20	expressed	express	VERB
biotropia-2457	141	21	wxc	wxc	NOUN
biotropia-2457	141	22	,	,	PUNCT
biotropia-2457	141	23	a	a	DET
biotropia-2457	141	24	direct	direct	ADJ
biotropia-2457	141	25	statistical	statistical	ADJ
biotropia-2457	141	26	correlation	correlation	NOUN
biotropia-2457	141	27	could	could	AUX
biotropia-2457	141	28	not	not	PART
biotropia-2457	141	29	be	be	AUX
biotropia-2457	141	30	established	establish	VERB
biotropia-2457	141	31	between	between	ADP
biotropia-2457	141	32	the	the	DET
biotropia-2457	141	33	presence	presence	NOUN
biotropia-2457	141	34	of	of	ADP
biotropia-2457	141	35	wxc	wxc	NOUN
biotropia-2457	141	36	and	and	CCONJ
biotropia-2457	141	37	amylose	amylose	ADJ
biotropia-2457	141	38	levels	level	NOUN
biotropia-2457	141	39	.	.	PUNCT
biotropia-2457	142	1	this	this	PRON
biotropia-2457	142	2	indicates	indicate	VERB
biotropia-2457	142	3	that	that	SCONJ
biotropia-2457	142	4	the	the	DET
biotropia-2457	142	5	presence	presence	NOUN
biotropia-2457	142	6	of	of	ADP
biotropia-2457	142	7	wxc	wxc	NOUN
biotropia-2457	142	8	alone	alone	ADV
biotropia-2457	142	9	does	do	AUX
biotropia-2457	142	10	not	not	PART
biotropia-2457	142	11	dictate	dictate	VERB
biotropia-2457	142	12	amylose	amylose	ADJ
biotropia-2457	142	13	content	content	NOUN
biotropia-2457	142	14	but	but	CCONJ
biotropia-2457	142	15	rather	rather	ADV
biotropia-2457	142	16	interacts	interact	VERB
biotropia-2457	142	17	with	with	ADP
biotropia-2457	142	18	other	other	ADJ
biotropia-2457	142	19	regulatory	regulatory	ADJ
biotropia-2457	142	20	elements	element	NOUN
biotropia-2457	142	21	affecting	affect	VERB
biotropia-2457	142	22	starch	starch	NOUN
biotropia-2457	142	23	biosynthesis	biosynthesis	NOUN
biotropia-2457	142	24	(	(	PUNCT
biotropia-2457	142	25	zhang	zhang	X
biotropia-2457	142	26	et	et	PROPN
biotropia-2457	142	27	al	al	PROPN
biotropia-2457	142	28	.	.	PROPN
biotropia-2457	142	29	2021	2021	NUM
biotropia-2457	142	30	)	)	PUNCT
biotropia-2457	142	31	.	.	PUNCT
biotropia-2457	143	1	b.	b.	PROPN
biotropia-2457	144	1	post	post	ADJ
biotropia-2457	144	2	-	-	ADJ
biotropia-2457	144	3	transcriptional	transcriptional	ADJ
biotropia-2457	144	4	and	and	CCONJ
biotropia-2457	144	5	environmental	environmental	ADJ
biotropia-2457	144	6	effects	effect	NOUN
biotropia-2457	144	7	studies	study	NOUN
biotropia-2457	144	8	have	have	AUX
biotropia-2457	144	9	shown	show	VERB
biotropia-2457	144	10	that	that	SCONJ
biotropia-2457	144	11	the	the	DET
biotropia-2457	144	12	influence	influence	NOUN
biotropia-2457	144	13	of	of	ADP
biotropia-2457	144	14	waxy	waxy	NOUN
biotropia-2457	144	15	gene	gene	NOUN
biotropia-2457	144	16	on	on	ADP
biotropia-2457	144	17	amylose	amylose	ADJ
biotropia-2457	144	18	synthesis	synthesis	NOUN
biotropia-2457	144	19	is	be	AUX
biotropia-2457	144	20	regulated	regulate	VERB
biotropia-2457	144	21	at	at	ADP
biotropia-2457	144	22	multiple	multiple	ADJ
biotropia-2457	144	23	levels	level	NOUN
biotropia-2457	144	24	,	,	PUNCT
biotropia-2457	144	25	including	include	VERB
biotropia-2457	144	26	transcriptional	transcriptional	NOUN
biotropia-2457	144	27	control	control	NOUN
biotropia-2457	144	28	,	,	PUNCT
biotropia-2457	144	29	post	post	ADJ
biotropia-2457	144	30	-	-	ADJ
biotropia-2457	144	31	translational	translational	ADJ
biotropia-2457	144	32	modifications	modification	NOUN
biotropia-2457	144	33	,	,	PUNCT
biotropia-2457	144	34	and	and	CCONJ
biotropia-2457	144	35	enzymatic	enzymatic	ADJ
biotropia-2457	144	36	activity	activity	NOUN
biotropia-2457	144	37	modulation	modulation	NOUN
biotropia-2457	144	38	(	(	PUNCT
biotropia-2457	144	39	hirano	hirano	PROPN
biotropia-2457	144	40	et	et	PROPN
biotropia-2457	144	41	al	al	PROPN
biotropia-2457	144	42	.	.	PROPN
biotropia-2457	144	43	2018	2018	NUM
biotropia-2457	144	44	)	)	PUNCT
biotropia-2457	144	45	.	.	PUNCT
biotropia-2457	145	1	variations	variation	NOUN
biotropia-2457	145	2	in	in	ADP
biotropia-2457	145	3	amylose	amylose	ADJ
biotropia-2457	145	4	content	content	NOUN
biotropia-2457	145	5	across	across	ADP
biotropia-2457	145	6	samples	sample	NOUN
biotropia-2457	145	7	could	could	AUX
biotropia-2457	145	8	result	result	VERB
biotropia-2457	145	9	from	from	ADP
biotropia-2457	145	10	environmental	environmental	ADJ
biotropia-2457	145	11	factors	factor	NOUN
biotropia-2457	145	12	such	such	ADJ
biotropia-2457	145	13	as	as	ADP
biotropia-2457	145	14	temperature	temperature	NOUN
biotropia-2457	145	15	,	,	PUNCT
biotropia-2457	145	16	soil	soil	NOUN
biotropia-2457	145	17	conditions	condition	NOUN
biotropia-2457	145	18	,	,	PUNCT
biotropia-2457	145	19	or	or	CCONJ
biotropia-2457	145	20	water	water	NOUN
biotropia-2457	145	21	availability	availability	NOUN
biotropia-2457	145	22	,	,	PUNCT
biotropia-2457	145	23	which	which	DET
biotropia-2457	145	24	influence	influence	NOUN
biotropia-2457	145	25	starch	starch	NOUN
biotropia-2457	145	26	biosynthesis	biosynthesis	NOUN
biotropia-2457	145	27	pathways	pathway	NOUN
biotropia-2457	145	28	(	(	PUNCT
biotropia-2457	145	29	asante	asante	PROPN
biotropia-2457	145	30	et	et	PROPN
biotropia-2457	145	31	al	al	PROPN
biotropia-2457	145	32	.	.	PROPN
biotropia-2457	145	33	2019	2019	NUM
biotropia-2457	145	34	)	)	PUNCT
biotropia-2457	145	35	.	.	PUNCT
biotropia-2457	146	1	c.	c.	PROPN
biotropia-2457	146	2	potential	potential	ADJ
biotropia-2457	146	3	influence	influence	NOUN
biotropia-2457	146	4	of	of	ADP
biotropia-2457	146	5	other	other	ADJ
biotropia-2457	146	6	genetic	genetic	ADJ
biotropia-2457	146	7	loci	loci	NOUN
biotropia-2457	146	8	the	the	DET
biotropia-2457	146	9	observed	observe	VERB
biotropia-2457	146	10	variation	variation	NOUN
biotropia-2457	146	11	in	in	ADP
biotropia-2457	146	12	amylose	amylose	ADJ
biotropia-2457	146	13	content	content	NOUN
biotropia-2457	146	14	suggests	suggest	VERB
biotropia-2457	146	15	the	the	DET
biotropia-2457	146	16	involvement	involvement	NOUN
biotropia-2457	146	17	of	of	ADP
biotropia-2457	146	18	modifier	modifier	NOUN
biotropia-2457	146	19	genes	gene	NOUN
biotropia-2457	146	20	or	or	CCONJ
biotropia-2457	146	21	allelic	allelic	ADJ
biotropia-2457	146	22	interactions	interaction	NOUN
biotropia-2457	146	23	that	that	PRON
biotropia-2457	146	24	regulate	regulate	VERB
biotropia-2457	146	25	the	the	DET
biotropia-2457	146	26	degree	degree	NOUN
biotropia-2457	146	27	of	of	ADP
biotropia-2457	146	28	wxc	wxc	NOUN
biotropia-2457	146	29	expression	expression	NOUN
biotropia-2457	146	30	or	or	CCONJ
biotropia-2457	146	31	its	its	PRON
biotropia-2457	146	32	enzymatic	enzymatic	ADJ
biotropia-2457	146	33	activity	activity	NOUN
biotropia-2457	146	34	.	.	PUNCT
biotropia-2457	147	1	previous	previous	ADJ
biotropia-2457	147	2	research	research	NOUN
biotropia-2457	147	3	in	in	ADP
biotropia-2457	147	4	cereal	cereal	NOUN
biotropia-2457	147	5	crops	crop	NOUN
biotropia-2457	147	6	has	have	AUX
biotropia-2457	147	7	identified	identify	VERB
biotropia-2457	147	8	secondary	secondary	ADJ
biotropia-2457	147	9	genes	gene	NOUN
biotropia-2457	147	10	affecting	affect	VERB
biotropia-2457	147	11	starch	starch	NOUN
biotropia-2457	147	12	biosynthesis	biosynthesis	NOUN
biotropia-2457	147	13	,	,	PUNCT
biotropia-2457	147	14	such	such	ADJ
biotropia-2457	147	15	as	as	ADP
biotropia-2457	147	16	ssiia	ssiia	NOUN
biotropia-2457	147	17	and	and	CCONJ
biotropia-2457	147	18	gbssi	gbssi	NOUN
biotropia-2457	147	19	,	,	PUNCT
biotropia-2457	147	20	which	which	PRON
biotropia-2457	147	21	contribute	contribute	VERB
biotropia-2457	147	22	to	to	ADP
biotropia-2457	147	23	differences	difference	NOUN
biotropia-2457	147	24	in	in	ADP
biotropia-2457	147	25	amylose	amylose	ADJ
biotropia-2457	147	26	levels	level	NOUN
biotropia-2457	147	27	even	even	ADV
biotropia-2457	147	28	when	when	SCONJ
biotropia-2457	147	29	wx	wx	PROPN
biotropia-2457	147	30	alleles	allele	NOUN
biotropia-2457	147	31	are	be	AUX
biotropia-2457	147	32	expressed	express	VERB
biotropia-2457	147	33	(	(	PUNCT
biotropia-2457	147	34	wang	wang	PROPN
biotropia-2457	147	35	et	et	PROPN
biotropia-2457	147	36	al	al	PROPN
biotropia-2457	147	37	.	.	PROPN
biotropia-2457	147	38	2020	2020	NUM
biotropia-2457	147	39	)	)	PUNCT
biotropia-2457	147	40	.	.	PUNCT
biotropia-2457	148	1	the	the	DET
biotropia-2457	148	2	findings	finding	NOUN
biotropia-2457	148	3	underscore	underscore	VERB
biotropia-2457	148	4	the	the	DET
biotropia-2457	148	5	importance	importance	NOUN
biotropia-2457	148	6	of	of	ADP
biotropia-2457	148	7	considering	consider	VERB
biotropia-2457	148	8	additional	additional	ADJ
biotropia-2457	148	9	genetic	genetic	ADJ
biotropia-2457	148	10	markers	marker	NOUN
biotropia-2457	148	11	and	and	CCONJ
biotropia-2457	148	12	environmental	environmental	ADJ
biotropia-2457	148	13	conditions	condition	NOUN
biotropia-2457	148	14	when	when	SCONJ
biotropia-2457	148	15	breeding	breed	VERB
biotropia-2457	148	16	for	for	ADP
biotropia-2457	148	17	starch	starch	NOUN
biotropia-2457	148	18	composition	composition	NOUN
biotropia-2457	148	19	traits	trait	NOUN
biotropia-2457	148	20	.	.	PUNCT
biotropia-2457	149	1	while	while	SCONJ
biotropia-2457	149	2	wxc	wxc	NOUN
biotropia-2457	149	3	expression	expression	NOUN
biotropia-2457	149	4	is	be	AUX
biotropia-2457	149	5	essential	essential	ADJ
biotropia-2457	149	6	for	for	ADP
biotropia-2457	149	7	waxy	waxy	NOUN
biotropia-2457	149	8	starch	starch	NOUN
biotropia-2457	149	9	production	production	NOUN
biotropia-2457	149	10	,	,	PUNCT
biotropia-2457	149	11	achieving	achieve	VERB
biotropia-2457	149	12	desired	desire	VERB
biotropia-2457	149	13	amylose	amylose	ADJ
biotropia-2457	149	14	levels	level	NOUN
biotropia-2457	149	15	requires	require	VERB
biotropia-2457	149	16	a	a	DET
biotropia-2457	149	17	broader	broad	ADJ
biotropia-2457	149	18	selection	selection	NOUN
biotropia-2457	149	19	strategy	strategy	NOUN
biotropia-2457	149	20	incorporating	incorporate	VERB
biotropia-2457	149	21	regulatory	regulatory	ADJ
biotropia-2457	149	22	genes	gene	NOUN
biotropia-2457	149	23	and	and	CCONJ
biotropia-2457	149	24	agronomic	agronomic	ADJ
biotropia-2457	149	25	practices	practice	NOUN
biotropia-2457	149	26	(	(	PUNCT
biotropia-2457	149	27	shin	shin	NOUN
biotropia-2457	149	28	et	et	PROPN
biotropia-2457	149	29	al	al	PROPN
biotropia-2457	149	30	.	.	PROPN
biotropia-2457	149	31	2015	2015	NUM
biotropia-2457	149	32	)	)	PUNCT
biotropia-2457	149	33	.	.	PUNCT
biotropia-2457	150	1	the	the	DET
biotropia-2457	150	2	pearson	pearson	PROPN
biotropia-2457	150	3	correlation	correlation	NOUN
biotropia-2457	150	4	test	test	NOUN
biotropia-2457	150	5	could	could	AUX
biotropia-2457	150	6	not	not	PART
biotropia-2457	150	7	establish	establish	VERB
biotropia-2457	150	8	a	a	DET
biotropia-2457	150	9	direct	direct	ADJ
biotropia-2457	150	10	statistical	statistical	ADJ
biotropia-2457	150	11	relationship	relationship	NOUN
biotropia-2457	150	12	between	between	ADP
biotropia-2457	150	13	wxc	wxc	NOUN
biotropia-2457	150	14	expression	expression	NOUN
biotropia-2457	150	15	and	and	CCONJ
biotropia-2457	150	16	amylose	amylose	NOUN
biotropia-2457	150	17	content	content	NOUN
biotropia-2457	150	18	due	due	ADP
biotropia-2457	150	19	to	to	ADP
biotropia-2457	150	20	the	the	DET
biotropia-2457	150	21	invariant	invariant	ADJ
biotropia-2457	150	22	nature	nature	NOUN
biotropia-2457	150	23	of	of	ADP
biotropia-2457	150	24	wxc	wxc	NOUN
biotropia-2457	150	25	expression	expression	NOUN
biotropia-2457	150	26	across	across	ADP
biotropia-2457	150	27	samples	sample	NOUN
biotropia-2457	150	28	.	.	PUNCT
biotropia-2457	151	1	however	however	ADV
biotropia-2457	151	2	,	,	PUNCT
biotropia-2457	151	3	the	the	DET
biotropia-2457	151	4	variation	variation	NOUN
biotropia-2457	151	5	in	in	ADP
biotropia-2457	151	6	amylose	amylose	ADJ
biotropia-2457	151	7	content	content	NOUN
biotropia-2457	151	8	suggests	suggest	VERB
biotropia-2457	151	9	that	that	SCONJ
biotropia-2457	151	10	there	there	PRON
biotropia-2457	151	11	may	may	AUX
biotropia-2457	151	12	be	be	AUX
biotropia-2457	151	13	several	several	ADJ
biotropia-2457	151	14	factors	factor	NOUN
biotropia-2457	151	15	beyond	beyond	ADP
biotropia-2457	151	16	wxc	wxc	NOUN
biotropia-2457	151	17	presence	presence	NOUN
biotropia-2457	151	18	,	,	PUNCT
biotropia-2457	151	19	such	such	ADJ
biotropia-2457	151	20	as	as	ADP
biotropia-2457	151	21	genetic	genetic	ADJ
biotropia-2457	151	22	modifiers	modifier	NOUN
biotropia-2457	151	23	,	,	PUNCT
biotropia-2457	151	24	post	post	ADJ
biotropia-2457	151	25	-	-	ADJ
biotropia-2457	151	26	translational	translational	ADJ
biotropia-2457	151	27	regulation	regulation	NOUN
biotropia-2457	151	28	,	,	PUNCT
biotropia-2457	151	29	and	and	CCONJ
biotropia-2457	151	30	environmental	environmental	ADJ
biotropia-2457	151	31	influences	influence	NOUN
biotropia-2457	151	32	,	,	PUNCT
biotropia-2457	151	33	which	which	PRON
biotropia-2457	151	34	play	play	VERB
biotropia-2457	151	35	significant	significant	ADJ
biotropia-2457	151	36	roles	role	NOUN
biotropia-2457	151	37	in	in	ADP
biotropia-2457	151	38	starch	starch	NOUN
biotropia-2457	151	39	biosynthesis	biosynthesis	NOUN
biotropia-2457	151	40	.	.	PUNCT
biotropia-2457	152	1	future	future	ADJ
biotropia-2457	152	2	studies	study	NOUN
biotropia-2457	152	3	using	use	VERB
biotropia-2457	152	4	genome	genome	NOUN
biotropia-2457	152	5	-	-	PUNCT
biotropia-2457	152	6	wide	wide	ADJ
biotropia-2457	152	7	association	association	NOUN
biotropia-2457	152	8	studies	study	NOUN
biotropia-2457	152	9	(	(	PUNCT
biotropia-2457	152	10	gwas	gwas	PROPN
biotropia-2457	152	11	)	)	PUNCT
biotropia-2457	152	12	or	or	CCONJ
biotropia-2457	152	13	transcriptomic	transcriptomic	ADJ
biotropia-2457	152	14	analysis	analysis	NOUN
biotropia-2457	152	15	could	could	AUX
biotropia-2457	152	16	provide	provide	VERB
biotropia-2457	152	17	deeper	deep	ADJ
biotropia-2457	152	18	insights	insight	NOUN
biotropia-2457	152	19	into	into	ADP
biotropia-2457	152	20	the	the	DET
biotropia-2457	152	21	regulatory	regulatory	ADJ
biotropia-2457	152	22	networks	network	NOUN
biotropia-2457	152	23	governing	govern	VERB
biotropia-2457	152	24	amylose	amylose	ADJ
biotropia-2457	152	25	synthesis	synthesis	NOUN
biotropia-2457	152	26	in	in	ADP
biotropia-2457	152	27	sorghum	sorghum	NOUN
biotropia-2457	152	28	.	.	PUNCT
biotropia-2457	153	1	visualization	visualization	NOUN
biotropia-2457	153	2	of	of	ADP
biotropia-2457	153	3	waxy	waxy	NOUN
biotropia-2457	153	4	allele	allele	NOUN
biotropia-2457	153	5	expression	expression	NOUN
biotropia-2457	153	6	the	the	DET
biotropia-2457	153	7	uniform	uniform	ADJ
biotropia-2457	153	8	expression	expression	NOUN
biotropia-2457	153	9	of	of	ADP
biotropia-2457	153	10	wxc	wxc	NOUN
biotropia-2457	153	11	across	across	ADP
biotropia-2457	153	12	all	all	DET
biotropia-2457	153	13	samples	sample	NOUN
biotropia-2457	153	14	further	far	ADV
biotropia-2457	153	15	supports	support	VERB
biotropia-2457	153	16	its	its	PRON
biotropia-2457	153	17	essential	essential	ADJ
biotropia-2457	153	18	role	role	NOUN
biotropia-2457	153	19	in	in	ADP
biotropia-2457	153	20	waxy	waxy	NOUN
biotropia-2457	153	21	starch	starch	NOUN
biotropia-2457	153	22	production	production	NOUN
biotropia-2457	153	23	,	,	PUNCT
biotropia-2457	153	24	whereas	whereas	SCONJ
biotropia-2457	153	25	the	the	DET
biotropia-2457	153	26	non	non	NOUN
biotropia-2457	153	27	-	-	NOUN
biotropia-2457	153	28	expression	expression	NOUN
biotropia-2457	153	29	of	of	ADP
biotropia-2457	153	30	wxa	wxa	NOUN
biotropia-2457	153	31	and	and	CCONJ
biotropia-2457	153	32	wxb	wxb	PRON
biotropia-2457	153	33	suggests	suggest	VERB
biotropia-2457	153	34	that	that	SCONJ
biotropia-2457	153	35	these	these	DET
biotropia-2457	153	36	alleles	allele	NOUN
biotropia-2457	153	37	may	may	AUX
biotropia-2457	153	38	not	not	PART
biotropia-2457	153	39	be	be	AUX
biotropia-2457	153	40	actively	actively	ADV
biotropia-2457	153	41	contributing	contribute	VERB
biotropia-2457	153	42	to	to	ADP
biotropia-2457	153	43	starch	starch	NOUN
biotropia-2457	153	44	biosynthesis	biosynthesis	NOUN
biotropia-2457	153	45	in	in	ADP
biotropia-2457	153	46	this	this	DET
biotropia-2457	153	47	genetic	genetic	ADJ
biotropia-2457	153	48	background	background	NOUN
biotropia-2457	153	49	(	(	PUNCT
biotropia-2457	153	50	table	table	NOUN
biotropia-2457	153	51	3	3	NUM
biotropia-2457	153	52	)	)	PUNCT
biotropia-2457	153	53	.	.	PUNCT
biotropia-2457	154	1	this	this	DET
biotropia-2457	154	2	finding	finding	NOUN
biotropia-2457	154	3	aligns	align	VERB
biotropia-2457	154	4	with	with	ADP
biotropia-2457	154	5	previous	previous	ADJ
biotropia-2457	154	6	studies	study	NOUN
biotropia-2457	154	7	that	that	PRON
biotropia-2457	154	8	have	have	AUX
biotropia-2457	154	9	established	establish	VERB
biotropia-2457	154	10	wxc	wxc	NOUN
biotropia-2457	154	11	as	as	ADP
biotropia-2457	154	12	a	a	DET
biotropia-2457	154	13	key	key	NOUN
biotropia-2457	154	14	determinant	determinant	ADJ
biotropia-2457	154	15	in	in	ADP
biotropia-2457	154	16	controlling	control	VERB
biotropia-2457	154	17	amylose	amylose	ADJ
biotropia-2457	154	18	biosynthesis	biosynthesis	NOUN
biotropia-2457	154	19	in	in	ADP
biotropia-2457	154	20	cereals	cereal	NOUN
biotropia-2457	154	21	(	(	PUNCT
biotropia-2457	154	22	tian	tian	PROPN
biotropia-2457	154	23	et	et	PROPN
biotropia-2457	154	24	al	al	PROPN
biotropia-2457	154	25	.	.	PROPN
biotropia-2457	154	26	2009	2009	NUM
biotropia-2457	154	27	;	;	PUNCT
biotropia-2457	154	28	hirano	hirano	PROPN
biotropia-2457	154	29	et	et	PROPN
biotropia-2457	154	30	al	al	PROPN
biotropia-2457	154	31	.	.	PROPN
biotropia-2457	154	32	2018	2018	NUM
biotropia-2457	154	33	)	)	PUNCT
biotropia-2457	154	34	.	.	PUNCT
biotropia-2457	155	1	the	the	DET
biotropia-2457	155	2	absence	absence	NOUN
biotropia-2457	155	3	of	of	ADP
biotropia-2457	155	4	wxa	wxa	NOUN
biotropia-2457	155	5	and	and	CCONJ
biotropia-2457	155	6	wxb	wxb	PROPN
biotropia-2457	155	7	expressions	expression	NOUN
biotropia-2457	155	8	suggests	suggest	VERB
biotropia-2457	155	9	that	that	SCONJ
biotropia-2457	155	10	these	these	DET
biotropia-2457	155	11	alleles	allele	NOUN
biotropia-2457	155	12	may	may	AUX
biotropia-2457	155	13	not	not	PART
biotropia-2457	155	14	be	be	AUX
biotropia-2457	155	15	actively	actively	ADV
biotropia-2457	155	16	involved	involve	VERB
biotropia-2457	155	17	in	in	ADP
biotropia-2457	155	18	starch	starch	NOUN
biotropia-2457	155	19	biosynthesis	biosynthesis	NOUN
biotropia-2457	155	20	within	within	ADP
biotropia-2457	155	21	this	this	DET
biotropia-2457	155	22	specific	specific	ADJ
biotropia-2457	155	23	genetic	genetic	ADJ
biotropia-2457	155	24	background	background	NOUN
biotropia-2457	155	25	,	,	PUNCT
biotropia-2457	155	26	possibly	possibly	ADV
biotropia-2457	155	27	due	due	ADP
biotropia-2457	155	28	to	to	ADP
biotropia-2457	155	29	genetic	genetic	ADJ
biotropia-2457	155	30	regulation	regulation	NOUN
biotropia-2457	155	31	,	,	PUNCT
biotropia-2457	155	32	allele	allele	NOUN
biotropia-2457	155	33	-	-	PUNCT
biotropia-2457	155	34	specific	specific	ADJ
biotropia-2457	155	35	expression	expression	NOUN
biotropia-2457	155	36	patterns	pattern	NOUN
biotropia-2457	155	37	,	,	PUNCT
biotropia-2457	155	38	or	or	CCONJ
biotropia-2457	155	39	epigenetic	epigenetic	ADJ
biotropia-2457	155	40	modifications	modification	NOUN
biotropia-2457	155	41	.	.	PUNCT
biotropia-2457	156	1	molecular	molecular	ADJ
biotropia-2457	156	2	genetics	genetic	NOUN
biotropia-2457	156	3	of	of	ADP
biotropia-2457	156	4	sorghum	sorghum	NOUN
biotropia-2457	156	5	crosses	crosse	NOUN
biotropia-2457	156	6	kd4	kd4	PROPN
biotropia-2457	156	7	and	and	CCONJ
biotropia-2457	156	8	bonteb	bonteb	PROPN
biotropia-2457	156	9	gunungkidul	gunungkidul	PROPN
biotropia-2457	156	10	muazam	muazam	PROPN
biotropia-2457	156	11	et	et	PROPN
biotropia-2457	156	12	al	al	PROPN
biotropia-2457	156	13	.	.	PROPN
biotropia-2457	156	14	335	335	NUM
biotropia-2457	156	15	functional	functional	ADJ
biotropia-2457	156	16	role	role	NOUN
biotropia-2457	156	17	of	of	ADP
biotropia-2457	156	18	wxc	wxc	NOUN
biotropia-2457	156	19	in	in	ADP
biotropia-2457	156	20	starch	starch	NOUN
biotropia-2457	156	21	biosynthesis	biosynthesis	NOUN
biotropia-2457	156	22	research	research	NOUN
biotropia-2457	156	23	in	in	ADP
biotropia-2457	156	24	cereals	cereal	NOUN
biotropia-2457	156	25	such	such	ADJ
biotropia-2457	156	26	as	as	ADP
biotropia-2457	156	27	rice	rice	NOUN
biotropia-2457	156	28	,	,	PUNCT
biotropia-2457	156	29	maize	maize	NOUN
biotropia-2457	156	30	,	,	PUNCT
biotropia-2457	156	31	and	and	CCONJ
biotropia-2457	156	32	sorghum	sorghum	NOUN
biotropia-2457	156	33	has	have	AUX
biotropia-2457	156	34	shown	show	VERB
biotropia-2457	156	35	that	that	SCONJ
biotropia-2457	156	36	the	the	DET
biotropia-2457	156	37	waxy	waxy	NOUN
biotropia-2457	156	38	gene	gene	NOUN
biotropia-2457	156	39	encodes	encode	VERB
biotropia-2457	156	40	granule	granule	NOUN
biotropia-2457	156	41	-	-	PUNCT
biotropia-2457	156	42	bound	bind	VERB
biotropia-2457	156	43	starch	starch	NOUN
biotropia-2457	156	44	synthase	synthase	NOUN
biotropia-2457	156	45	i	i	PRON
biotropia-2457	156	46	(	(	PUNCT
biotropia-2457	156	47	gbssi	gbssi	NOUN
biotropia-2457	156	48	)	)	PUNCT
biotropia-2457	156	49	,	,	PUNCT
biotropia-2457	156	50	the	the	DET
biotropia-2457	156	51	enzyme	enzyme	NOUN
biotropia-2457	156	52	responsible	responsible	ADJ
biotropia-2457	156	53	for	for	ADP
biotropia-2457	156	54	amylose	amylose	ADJ
biotropia-2457	156	55	synthesis	synthesis	NOUN
biotropia-2457	156	56	in	in	ADP
biotropia-2457	156	57	endosperm	endosperm	ADJ
biotropia-2457	156	58	cells	cell	NOUN
biotropia-2457	156	59	(	(	PUNCT
biotropia-2457	156	60	tian	tian	PROPN
biotropia-2457	156	61	et	et	PROPN
biotropia-2457	156	62	al	al	PROPN
biotropia-2457	156	63	.	.	PROPN
biotropia-2457	156	64	2009	2009	NUM
biotropia-2457	156	65	)	)	PUNCT
biotropia-2457	156	66	.	.	PUNCT
biotropia-2457	157	1	variations	variation	NOUN
biotropia-2457	157	2	in	in	ADP
biotropia-2457	157	3	the	the	DET
biotropia-2457	157	4	wx	wx	PROPN
biotropia-2457	157	5	locus	locus	NOUN
biotropia-2457	157	6	,	,	PUNCT
biotropia-2457	157	7	including	include	VERB
biotropia-2457	157	8	allelic	allelic	ADJ
biotropia-2457	157	9	differences	difference	NOUN
biotropia-2457	157	10	in	in	ADP
biotropia-2457	157	11	wxa	wxa	NOUN
biotropia-2457	157	12	,	,	PUNCT
biotropia-2457	157	13	wxb	wxb	NOUN
biotropia-2457	157	14	,	,	PUNCT
biotropia-2457	157	15	and	and	CCONJ
biotropia-2457	157	16	wxc	wxc	VERB
biotropia-2457	157	17	,	,	PUNCT
biotropia-2457	157	18	lead	lead	VERB
biotropia-2457	157	19	to	to	ADP
biotropia-2457	157	20	differences	difference	NOUN
biotropia-2457	157	21	in	in	ADP
biotropia-2457	157	22	enzyme	enzyme	NOUN
biotropia-2457	157	23	activity	activity	NOUN
biotropia-2457	157	24	and	and	CCONJ
biotropia-2457	157	25	starch	starch	NOUN
biotropia-2457	157	26	composition	composition	NOUN
biotropia-2457	157	27	(	(	PUNCT
biotropia-2457	157	28	zhang	zhang	X
biotropia-2457	157	29	et	et	PROPN
biotropia-2457	157	30	al	al	PROPN
biotropia-2457	157	31	.	.	PROPN
biotropia-2457	157	32	2021	2021	NUM
biotropia-2457	157	33	)	)	PUNCT
biotropia-2457	157	34	.	.	PUNCT
biotropia-2457	158	1	the	the	DET
biotropia-2457	158	2	predominant	predominant	ADJ
biotropia-2457	158	3	expression	expression	NOUN
biotropia-2457	158	4	of	of	ADP
biotropia-2457	158	5	wxc	wxc	NOUN
biotropia-2457	158	6	in	in	ADP
biotropia-2457	158	7	this	this	DET
biotropia-2457	158	8	study	study	NOUN
biotropia-2457	158	9	supports	support	VERB
biotropia-2457	158	10	the	the	DET
biotropia-2457	158	11	hypothesis	hypothesis	NOUN
biotropia-2457	158	12	that	that	SCONJ
biotropia-2457	158	13	it	it	PRON
biotropia-2457	158	14	is	be	AUX
biotropia-2457	158	15	the	the	DET
biotropia-2457	158	16	main	main	ADJ
biotropia-2457	158	17	contributor	contributor	NOUN
biotropia-2457	158	18	to	to	PART
biotropia-2457	158	19	waxy	waxy	VERB
biotropia-2457	158	20	starch	starch	NOUN
biotropia-2457	158	21	synthesis	synthesis	NOUN
biotropia-2457	158	22	in	in	ADP
biotropia-2457	158	23	the	the	DET
biotropia-2457	158	24	analyzed	analyze	VERB
biotropia-2457	158	25	sorghum	sorghum	NOUN
biotropia-2457	158	26	genotypes	genotype	NOUN
biotropia-2457	158	27	.	.	PUNCT
biotropia-2457	159	1	potential	potential	ADJ
biotropia-2457	159	2	explanations	explanation	NOUN
biotropia-2457	159	3	for	for	ADP
biotropia-2457	159	4	the	the	DET
biotropia-2457	159	5	nonexpression	nonexpression	NOUN
biotropia-2457	159	6	of	of	ADP
biotropia-2457	159	7	wxa	wxa	NOUN
biotropia-2457	159	8	and	and	CCONJ
biotropia-2457	159	9	wxb	wxb	PRON
biotropia-2457	159	10	1	1	X
biotropia-2457	159	11	.	.	PUNCT
biotropia-2457	160	1	genetic	genetic	ADJ
biotropia-2457	160	2	silencing	silence	VERB
biotropia-2457	160	3	the	the	DET
biotropia-2457	160	4	non	non	NOUN
biotropia-2457	160	5	-	-	NOUN
biotropia-2457	160	6	expression	expression	NOUN
biotropia-2457	160	7	of	of	ADP
biotropia-2457	160	8	wxa	wxa	NOUN
biotropia-2457	160	9	and	and	CCONJ
biotropia-2457	160	10	wxb	wxb	PRON
biotropia-2457	160	11	may	may	AUX
biotropia-2457	160	12	be	be	AUX
biotropia-2457	160	13	attributed	attribute	VERB
biotropia-2457	160	14	to	to	ADP
biotropia-2457	160	15	regulatory	regulatory	ADJ
biotropia-2457	160	16	elements	element	NOUN
biotropia-2457	160	17	that	that	PRON
biotropia-2457	160	18	suppress	suppress	VERB
biotropia-2457	160	19	transcription	transcription	NOUN
biotropia-2457	160	20	under	under	ADP
biotropia-2457	160	21	specific	specific	ADJ
biotropia-2457	160	22	genetic	genetic	ADJ
biotropia-2457	160	23	backgrounds	background	NOUN
biotropia-2457	160	24	(	(	PUNCT
biotropia-2457	160	25	wang	wang	PROPN
biotropia-2457	160	26	et	et	PROPN
biotropia-2457	160	27	al	al	PROPN
biotropia-2457	160	28	.	.	PROPN
biotropia-2457	160	29	2020	2020	NUM
biotropia-2457	160	30	)	)	PUNCT
biotropia-2457	160	31	.	.	PUNCT
biotropia-2457	161	1	previous	previous	ADJ
biotropia-2457	161	2	study	study	NOUN
biotropia-2457	161	3	has	have	AUX
biotropia-2457	161	4	shown	show	VERB
biotropia-2457	161	5	that	that	SCONJ
biotropia-2457	161	6	gene	gene	NOUN
biotropia-2457	161	7	expression	expression	NOUN
biotropia-2457	161	8	in	in	ADP
biotropia-2457	161	9	the	the	DET
biotropia-2457	161	10	waxy	waxy	NOUN
biotropia-2457	161	11	locus	locus	NOUN
biotropia-2457	161	12	can	can	AUX
biotropia-2457	161	13	be	be	AUX
biotropia-2457	161	14	influenced	influence	VERB
biotropia-2457	161	15	by	by	ADP
biotropia-2457	161	16	upstream	upstream	ADJ
biotropia-2457	161	17	regulatory	regulatory	ADJ
biotropia-2457	161	18	sequences	sequence	NOUN
biotropia-2457	161	19	or	or	CCONJ
biotropia-2457	161	20	trans	tran	NOUN
biotropia-2457	161	21	-	-	ADJ
biotropia-2457	161	22	acting	acting	ADJ
biotropia-2457	161	23	factors	factor	NOUN
biotropia-2457	161	24	that	that	PRON
biotropia-2457	161	25	preferentially	preferentially	ADV
biotropia-2457	161	26	activate	activate	VERB
biotropia-2457	161	27	wxc	wxc	NOUN
biotropia-2457	161	28	over	over	ADP
biotropia-2457	161	29	other	other	ADJ
biotropia-2457	161	30	alleles	allele	NOUN
biotropia-2457	161	31	(	(	PUNCT
biotropia-2457	161	32	asante	asante	PROPN
biotropia-2457	161	33	et	et	PROPN
biotropia-2457	161	34	al	al	PROPN
biotropia-2457	161	35	.	.	PROPN
biotropia-2457	161	36	2019	2019	NUM
biotropia-2457	161	37	)	)	PUNCT
biotropia-2457	161	38	.	.	PUNCT
biotropia-2457	162	1	2	2	X
biotropia-2457	162	2	.	.	X
biotropia-2457	162	3	epigenetic	epigenetic	ADJ
biotropia-2457	162	4	modifications	modification	NOUN
biotropia-2457	162	5	dna	dna	PROPN
biotropia-2457	162	6	methylation	methylation	NOUN
biotropia-2457	162	7	and	and	CCONJ
biotropia-2457	162	8	histone	histone	NOUN
biotropia-2457	162	9	modifications	modification	NOUN
biotropia-2457	162	10	are	be	AUX
biotropia-2457	162	11	known	know	VERB
biotropia-2457	162	12	to	to	PART
biotropia-2457	162	13	regulate	regulate	VERB
biotropia-2457	162	14	gene	gene	NOUN
biotropia-2457	162	15	expression	expression	NOUN
biotropia-2457	162	16	in	in	ADP
biotropia-2457	162	17	cereals	cereal	NOUN
biotropia-2457	162	18	(	(	PUNCT
biotropia-2457	162	19	zhang	zhang	X
biotropia-2457	162	20	et	et	PROPN
biotropia-2457	162	21	al	al	PROPN
biotropia-2457	162	22	.	.	PROPN
biotropia-2457	162	23	2018	2018	NUM
biotropia-2457	162	24	)	)	PUNCT
biotropia-2457	162	25	.	.	PUNCT
biotropia-2457	163	1	it	it	PRON
biotropia-2457	163	2	is	be	AUX
biotropia-2457	163	3	possible	possible	ADJ
biotropia-2457	163	4	that	that	SCONJ
biotropia-2457	163	5	wxa	wxa	NOUN
biotropia-2457	164	1	and	and	CCONJ
biotropia-2457	164	2	wxb	wxb	PRON
biotropia-2457	164	3	undergo	undergo	VERB
biotropia-2457	164	4	methylation	methylation	NOUN
biotropia-2457	164	5	or	or	CCONJ
biotropia-2457	164	6	chromatin	chromatin	NOUN
biotropia-2457	164	7	remodeling	remodeling	NOUN
biotropia-2457	164	8	,	,	PUNCT
biotropia-2457	164	9	preventing	prevent	VERB
biotropia-2457	164	10	their	their	PRON
biotropia-2457	164	11	transcriptional	transcriptional	ADJ
biotropia-2457	164	12	activation	activation	NOUN
biotropia-2457	164	13	while	while	SCONJ
biotropia-2457	164	14	allowing	allow	VERB
biotropia-2457	164	15	wxc	wxc	NOUN
biotropia-2457	164	16	to	to	PART
biotropia-2457	164	17	be	be	AUX
biotropia-2457	164	18	expressed	express	VERB
biotropia-2457	164	19	.	.	PUNCT
biotropia-2457	165	1	3	3	X
biotropia-2457	165	2	.	.	X
biotropia-2457	165	3	allelic	allelic	ADJ
biotropia-2457	165	4	expression	expression	NOUN
biotropia-2457	165	5	preference	preference	NOUN
biotropia-2457	165	6	some	some	DET
biotropia-2457	165	7	plants	plant	NOUN
biotropia-2457	165	8	exhibit	exhibit	VERB
biotropia-2457	165	9	allele	allele	NOUN
biotropia-2457	165	10	-	-	PUNCT
biotropia-2457	165	11	specific	specific	ADJ
biotropia-2457	165	12	expression	expression	NOUN
biotropia-2457	165	13	due	due	ADP
biotropia-2457	165	14	to	to	ADP
biotropia-2457	165	15	dominance	dominance	NOUN
biotropia-2457	165	16	interactions	interaction	NOUN
biotropia-2457	165	17	or	or	CCONJ
biotropia-2457	165	18	alternative	alternative	ADJ
biotropia-2457	165	19	splicing	splicing	NOUN
biotropia-2457	165	20	mechanisms	mechanism	NOUN
biotropia-2457	165	21	.	.	PUNCT
biotropia-2457	166	1	this	this	PRON
biotropia-2457	166	2	could	could	AUX
biotropia-2457	166	3	explain	explain	VERB
biotropia-2457	166	4	why	why	SCONJ
biotropia-2457	166	5	wxc	wxc	NOUN
biotropia-2457	166	6	is	be	AUX
biotropia-2457	166	7	consistently	consistently	ADV
biotropia-2457	166	8	expressed	express	VERB
biotropia-2457	166	9	while	while	SCONJ
biotropia-2457	166	10	wxa	wxa	NOUN
biotropia-2457	166	11	and	and	CCONJ
biotropia-2457	166	12	wxb	wxb	PRON
biotropia-2457	166	13	remain	remain	VERB
biotropia-2457	166	14	inactive	inactive	ADJ
biotropia-2457	166	15	(	(	PUNCT
biotropia-2457	166	16	hirano	hirano	PROPN
biotropia-2457	166	17	et	et	PROPN
biotropia-2457	166	18	al	al	PROPN
biotropia-2457	166	19	.	.	PROPN
biotropia-2457	166	20	2018	2018	NUM
biotropia-2457	166	21	)	)	PUNCT
biotropia-2457	166	22	.	.	PUNCT
biotropia-2457	167	1	4	4	X
biotropia-2457	167	2	.	.	X
biotropia-2457	167	3	gene	gene	NOUN
biotropia-2457	167	4	structural	structural	ADJ
biotropia-2457	167	5	variations	variation	NOUN
biotropia-2457	167	6	studies	study	NOUN
biotropia-2457	167	7	in	in	ADP
biotropia-2457	167	8	rice	rice	NOUN
biotropia-2457	167	9	and	and	CCONJ
biotropia-2457	167	10	maize	maize	NOUN
biotropia-2457	167	11	have	have	AUX
biotropia-2457	167	12	reported	report	VERB
biotropia-2457	167	13	that	that	SCONJ
biotropia-2457	167	14	mutations	mutation	NOUN
biotropia-2457	167	15	,	,	PUNCT
biotropia-2457	167	16	insertions	insertion	NOUN
biotropia-2457	167	17	,	,	PUNCT
biotropia-2457	167	18	or	or	CCONJ
biotropia-2457	167	19	deletions	deletion	NOUN
biotropia-2457	167	20	in	in	ADP
biotropia-2457	167	21	the	the	DET
biotropia-2457	167	22	promoter	promoter	NOUN
biotropia-2457	167	23	or	or	CCONJ
biotropia-2457	167	24	coding	code	VERB
biotropia-2457	167	25	regions	region	NOUN
biotropia-2457	167	26	of	of	ADP
biotropia-2457	167	27	wx	wx	PROPN
biotropia-2457	167	28	alleles	allele	NOUN
biotropia-2457	167	29	can	can	AUX
biotropia-2457	167	30	disrupt	disrupt	VERB
biotropia-2457	167	31	their	their	PRON
biotropia-2457	167	32	expression	expression	NOUN
biotropia-2457	167	33	(	(	PUNCT
biotropia-2457	167	34	zhang	zhang	PROPN
biotropia-2457	167	35	et	et	PROPN
biotropia-2457	167	36	al	al	PROPN
biotropia-2457	167	37	.	.	PROPN
biotropia-2457	167	38	2021	2021	NUM
biotropia-2457	167	39	)	)	PUNCT
biotropia-2457	167	40	.	.	PUNCT
biotropia-2457	168	1	it	it	PRON
biotropia-2457	168	2	is	be	AUX
biotropia-2457	168	3	plausible	plausible	ADJ
biotropia-2457	168	4	that	that	SCONJ
biotropia-2457	168	5	wxa	wxa	NOUN
biotropia-2457	169	1	and	and	CCONJ
biotropia-2457	169	2	wxb	wxb	PRON
biotropia-2457	169	3	contain	contain	VERB
biotropia-2457	169	4	structural	structural	ADJ
biotropia-2457	169	5	differences	difference	NOUN
biotropia-2457	169	6	that	that	PRON
biotropia-2457	169	7	render	render	VERB
biotropia-2457	169	8	them	they	PRON
biotropia-2457	169	9	non	non	ADJ
biotropia-2457	169	10	-	-	ADJ
biotropia-2457	169	11	functional	functional	ADJ
biotropia-2457	169	12	in	in	ADP
biotropia-2457	169	13	this	this	DET
biotropia-2457	169	14	sorghum	sorghum	NOUN
biotropia-2457	169	15	cross	cross	NOUN
biotropia-2457	169	16	.	.	PUNCT
biotropia-2457	170	1	implications	implication	NOUN
biotropia-2457	170	2	for	for	ADP
biotropia-2457	170	3	waxy	waxy	NOUN
biotropia-2457	170	4	sorghum	sorghum	NOUN
biotropia-2457	170	5	development	development	NOUN
biotropia-2457	170	6	understanding	understand	VERB
biotropia-2457	170	7	the	the	DET
biotropia-2457	170	8	differential	differential	ADJ
biotropia-2457	170	9	expression	expression	NOUN
biotropia-2457	170	10	of	of	ADP
biotropia-2457	170	11	wx	wx	PROPN
biotropia-2457	170	12	alleles	allele	NOUN
biotropia-2457	170	13	is	be	AUX
biotropia-2457	170	14	essential	essential	ADJ
biotropia-2457	170	15	for	for	ADP
biotropia-2457	170	16	breeding	breed	VERB
biotropia-2457	170	17	waxy	waxy	NOUN
biotropia-2457	170	18	sorghum	sorghum	NOUN
biotropia-2457	170	19	varieties	variety	NOUN
biotropia-2457	170	20	with	with	ADP
biotropia-2457	170	21	desired	desire	VERB
biotropia-2457	170	22	starch	starch	NOUN
biotropia-2457	170	23	properties	property	NOUN
biotropia-2457	170	24	.	.	PUNCT
biotropia-2457	171	1	since	since	SCONJ
biotropia-2457	171	2	wxc	wxc	NOUN
biotropia-2457	171	3	is	be	AUX
biotropia-2457	171	4	consistently	consistently	ADV
biotropia-2457	171	5	expressed	express	VERB
biotropia-2457	171	6	,	,	PUNCT
biotropia-2457	171	7	it	it	PRON
biotropia-2457	171	8	serves	serve	VERB
biotropia-2457	171	9	as	as	ADP
biotropia-2457	171	10	a	a	DET
biotropia-2457	171	11	reliable	reliable	ADJ
biotropia-2457	171	12	genetic	genetic	ADJ
biotropia-2457	171	13	marker	marker	NOUN
biotropia-2457	171	14	for	for	ADP
biotropia-2457	171	15	selecting	select	VERB
biotropia-2457	171	16	waxy	waxy	NOUN
biotropia-2457	171	17	sorghum	sorghum	NOUN
biotropia-2457	171	18	lines	line	NOUN
biotropia-2457	171	19	,	,	PUNCT
biotropia-2457	171	20	which	which	PRON
biotropia-2457	171	21	are	be	AUX
biotropia-2457	171	22	valuable	valuable	ADJ
biotropia-2457	171	23	for	for	ADP
biotropia-2457	171	24	food	food	NOUN
biotropia-2457	171	25	and	and	CCONJ
biotropia-2457	171	26	industrial	industrial	ADJ
biotropia-2457	171	27	applications	application	NOUN
biotropia-2457	171	28	.	.	PUNCT
biotropia-2457	172	1	however	however	ADV
biotropia-2457	172	2	,	,	PUNCT
biotropia-2457	172	3	further	further	ADJ
biotropia-2457	172	4	investigation	investigation	NOUN
biotropia-2457	172	5	is	be	AUX
biotropia-2457	172	6	needed	need	VERB
biotropia-2457	172	7	to	to	PART
biotropia-2457	172	8	determine	determine	VERB
biotropia-2457	172	9	whether	whether	SCONJ
biotropia-2457	172	10	wxa	wxa	NOUN
biotropia-2457	172	11	and	and	CCONJ
biotropia-2457	172	12	wxb	wxb	NOUN
biotropia-2457	172	13	are	be	AUX
biotropia-2457	172	14	truly	truly	ADV
biotropia-2457	172	15	nonfunctional	nonfunctional	ADJ
biotropia-2457	172	16	or	or	CCONJ
biotropia-2457	172	17	if	if	SCONJ
biotropia-2457	172	18	their	their	PRON
biotropia-2457	172	19	expression	expression	NOUN
biotropia-2457	172	20	could	could	AUX
biotropia-2457	172	21	be	be	AUX
biotropia-2457	172	22	induced	induce	VERB
biotropia-2457	172	23	under	under	ADP
biotropia-2457	172	24	different	different	ADJ
biotropia-2457	172	25	conditions	condition	NOUN
biotropia-2457	172	26	(	(	PUNCT
biotropia-2457	172	27	wang	wang	PROPN
biotropia-2457	172	28	et	et	PROPN
biotropia-2457	172	29	al	al	PROPN
biotropia-2457	172	30	.	.	PROPN
biotropia-2457	172	31	2020	2020	NUM
biotropia-2457	172	32	)	)	PUNCT
biotropia-2457	172	33	.	.	PUNCT
biotropia-2457	173	1	future	future	ADJ
biotropia-2457	173	2	studies	study	NOUN
biotropia-2457	173	3	should	should	AUX
biotropia-2457	173	4	integrate	integrate	VERB
biotropia-2457	173	5	transcriptomic	transcriptomic	ADJ
biotropia-2457	173	6	,	,	PUNCT
biotropia-2457	173	7	epigenetic	epigenetic	ADJ
biotropia-2457	173	8	,	,	PUNCT
biotropia-2457	173	9	and	and	CCONJ
biotropia-2457	173	10	genome	genome	NOUN
biotropia-2457	173	11	-	-	PUNCT
biotropia-2457	173	12	editing	edit	VERB
biotropia-2457	173	13	approaches	approach	NOUN
biotropia-2457	173	14	to	to	PART
biotropia-2457	173	15	elucidate	elucidate	VERB
biotropia-2457	173	16	the	the	DET
biotropia-2457	173	17	regulatory	regulatory	ADJ
biotropia-2457	173	18	mechanisms	mechanism	NOUN
biotropia-2457	173	19	governing	govern	VERB
biotropia-2457	173	20	wx	wx	PROPN
biotropia-2457	173	21	allele	allele	NOUN
biotropia-2457	173	22	expression	expression	NOUN
biotropia-2457	173	23	in	in	ADP
biotropia-2457	173	24	sorghum	sorghum	NOUN
biotropia-2457	173	25	.	.	PUNCT
biotropia-2457	174	1	implications	implication	NOUN
biotropia-2457	174	2	for	for	ADP
biotropia-2457	174	3	sorghum	sorghum	NOUN
biotropia-2457	174	4	breeding	breeding	NOUN
biotropia-2457	174	5	these	these	DET
biotropia-2457	174	6	results	result	NOUN
biotropia-2457	174	7	hold	hold	VERB
biotropia-2457	174	8	significant	significant	ADJ
biotropia-2457	174	9	implications	implication	NOUN
biotropia-2457	174	10	for	for	ADP
biotropia-2457	174	11	sorghum	sorghum	NOUN
biotropia-2457	174	12	breeding	breeding	NOUN
biotropia-2457	174	13	programs	program	NOUN
biotropia-2457	174	14	aiming	aim	VERB
biotropia-2457	174	15	to	to	PART
biotropia-2457	174	16	develop	develop	VERB
biotropia-2457	174	17	varieties	variety	NOUN
biotropia-2457	174	18	with	with	ADP
biotropia-2457	174	19	specific	specific	ADJ
biotropia-2457	174	20	starch	starch	NOUN
biotropia-2457	174	21	properties	property	NOUN
biotropia-2457	174	22	:	:	PUNCT
biotropia-2457	174	23	1	1	X
biotropia-2457	174	24	.	.	X
biotropia-2457	174	25	selection	selection	NOUN
biotropia-2457	174	26	of	of	ADP
biotropia-2457	174	27	waxy	waxy	NOUN
biotropia-2457	174	28	sorghum	sorghum	NOUN
biotropia-2457	174	29	varieties	variety	NOUN
biotropia-2457	174	30	given	give	VERB
biotropia-2457	174	31	that	that	SCONJ
biotropia-2457	174	32	wxc	wxc	NOUN
biotropia-2457	174	33	is	be	AUX
biotropia-2457	174	34	the	the	DET
biotropia-2457	174	35	only	only	ADJ
biotropia-2457	174	36	expressed	express	VERB
biotropia-2457	174	37	allele	allele	NOUN
biotropia-2457	174	38	,	,	PUNCT
biotropia-2457	174	39	breeders	breeder	NOUN
biotropia-2457	174	40	can	can	AUX
biotropia-2457	174	41	use	use	VERB
biotropia-2457	174	42	this	this	DET
biotropia-2457	174	43	marker	marker	NOUN
biotropia-2457	174	44	for	for	ADP
biotropia-2457	174	45	selecting	select	VERB
biotropia-2457	174	46	waxy	waxy	NOUN
biotropia-2457	174	47	sorghum	sorghum	NOUN
biotropia-2457	174	48	varieties	variety	NOUN
biotropia-2457	174	49	with	with	ADP
biotropia-2457	174	50	reduced	reduced	ADJ
biotropia-2457	174	51	amylose	amylose	ADJ
biotropia-2457	174	52	content	content	NOUN
biotropia-2457	174	53	,	,	PUNCT
biotropia-2457	174	54	which	which	PRON
biotropia-2457	174	55	is	be	AUX
biotropia-2457	174	56	desirable	desirable	ADJ
biotropia-2457	174	57	for	for	ADP
biotropia-2457	174	58	food	food	NOUN
biotropia-2457	174	59	and	and	CCONJ
biotropia-2457	174	60	industrial	industrial	ADJ
biotropia-2457	174	61	applications	application	NOUN
biotropia-2457	174	62	(	(	PUNCT
biotropia-2457	174	63	wang	wang	PROPN
biotropia-2457	174	64	et	et	PROPN
biotropia-2457	174	65	al	al	PROPN
biotropia-2457	174	66	.	.	PROPN
biotropia-2457	174	67	2020	2020	NUM
biotropia-2457	174	68	)	)	PUNCT
biotropia-2457	174	69	.	.	PUNCT
biotropia-2457	175	1	2	2	X
biotropia-2457	175	2	.	.	X
biotropia-2457	175	3	regulation	regulation	NOUN
biotropia-2457	175	4	of	of	ADP
biotropia-2457	175	5	starch	starch	NOUN
biotropia-2457	175	6	biosynthesis	biosynthesis	NOUN
biotropia-2457	175	7	the	the	DET
biotropia-2457	175	8	lack	lack	NOUN
biotropia-2457	175	9	of	of	ADP
biotropia-2457	175	10	wxa	wxa	NOUN
biotropia-2457	175	11	and	and	CCONJ
biotropia-2457	175	12	wxb	wxb	PRON
biotropia-2457	175	13	expression	expression	NOUN
biotropia-2457	175	14	suggests	suggest	VERB
biotropia-2457	175	15	potential	potential	ADJ
biotropia-2457	175	16	gene	gene	NOUN
biotropia-2457	175	17	silencing	silence	VERB
biotropia-2457	175	18	mechanisms	mechanism	NOUN
biotropia-2457	175	19	or	or	CCONJ
biotropia-2457	175	20	allelic	allelic	ADJ
biotropia-2457	175	21	interactions	interaction	NOUN
biotropia-2457	175	22	that	that	PRON
biotropia-2457	175	23	warrant	warrant	VERB
biotropia-2457	175	24	further	further	ADJ
biotropia-2457	175	25	investigation	investigation	NOUN
biotropia-2457	175	26	through	through	ADP
biotropia-2457	175	27	transcriptomic	transcriptomic	ADJ
biotropia-2457	175	28	and	and	CCONJ
biotropia-2457	175	29	epigenetic	epigenetic	ADJ
biotropia-2457	175	30	studies	study	NOUN
biotropia-2457	175	31	(	(	PUNCT
biotropia-2457	175	32	hirano	hirano	PROPN
biotropia-2457	175	33	et	et	PROPN
biotropia-2457	175	34	al	al	PROPN
biotropia-2457	175	35	.	.	PROPN
biotropia-2457	175	36	2018	2018	NUM
biotropia-2457	175	37	)	)	PUNCT
biotropia-2457	175	38	.	.	PUNCT
biotropia-2457	176	1	3	3	X
biotropia-2457	176	2	.	.	X
biotropia-2457	176	3	genetic	genetic	ADJ
biotropia-2457	176	4	improvement	improvement	NOUN
biotropia-2457	176	5	strategies	strategy	NOUN
biotropia-2457	176	6	understanding	understand	VERB
biotropia-2457	176	7	the	the	DET
biotropia-2457	176	8	molecular	molecular	ADJ
biotropia-2457	176	9	regulation	regulation	NOUN
biotropia-2457	176	10	of	of	ADP
biotropia-2457	176	11	wxc	wxc	NOUN
biotropia-2457	176	12	could	could	AUX
biotropia-2457	176	13	facilitate	facilitate	VERB
biotropia-2457	176	14	targeted	target	VERB
biotropia-2457	176	15	genetic	genetic	ADJ
biotropia-2457	176	16	modifications	modification	NOUN
biotropia-2457	176	17	,	,	PUNCT
biotropia-2457	176	18	table	table	NOUN
biotropia-2457	176	19	3	3	NUM
biotropia-2457	176	20	waxy	waxy	NOUN
biotropia-2457	176	21	allele	allele	NOUN
biotropia-2457	176	22	expression	expression	NOUN
biotropia-2457	176	23	in	in	ADP
biotropia-2457	176	24	the	the	DET
biotropia-2457	176	25	sorghum	sorghum	NOUN
biotropia-2457	176	26	sample	sample	NOUN
biotropia-2457	176	27	sample	sample	NOUN
biotropia-2457	176	28	wxa	wxa	NOUN
biotropia-2457	176	29	wxb	wxb	PROPN
biotropia-2457	176	30	wxc	wxc	VERB
biotropia-2457	176	31	kd4	kd4	PROPN
biotropia-2457	176	32	+	+	CCONJ
biotropia-2457	176	33	bg	bg	PROPN
biotropia-2457	176	34	+	+	CCONJ
biotropia-2457	176	35	f1a	f1a	PROPN
biotropia-2457	177	1	+	+	CCONJ
biotropia-2457	177	2	f1b	f1b	PROPN
biotropia-2457	177	3	+	+	NUM
biotropia-2457	177	4	notes	note	NOUN
biotropia-2457	177	5	:	:	PUNCT
biotropia-2457	177	6	+	+	CCONJ
biotropia-2457	177	7	=	=	SYM
biotropia-2457	177	8	gene	gene	NOUN
biotropia-2457	177	9	expression	expression	NOUN
biotropia-2457	177	10	;	;	PUNCT
biotropia-2457	177	11	=	=	SYM
biotropia-2457	177	12	no	no	DET
biotropia-2457	177	13	expression	expression	NOUN
biotropia-2457	177	14	.	.	PUNCT
biotropia-2457	178	1	biotropia	biotropia	ADJ
biotropia-2457	178	2	vol	vol	NOUN
biotropia-2457	178	3	.	.	PUNCT
biotropia-2457	179	1	32	32	NUM
biotropia-2457	179	2	no	no	NOUN
biotropia-2457	179	3	.	.	NOUN
biotropia-2457	180	1	3	3	NUM
biotropia-2457	180	2	,	,	PUNCT
biotropia-2457	180	3	2025	2025	NUM
biotropia-2457	180	4	336	336	NUM
biotropia-2457	180	5	such	such	ADJ
biotropia-2457	180	6	as	as	ADP
biotropia-2457	180	7	crispr	crispr	NOUN
biotropia-2457	180	8	-	-	PUNCT
biotropia-2457	180	9	based	base	VERB
biotropia-2457	180	10	gene	gene	NOUN
biotropia-2457	180	11	editing	editing	NOUN
biotropia-2457	180	12	,	,	PUNCT
biotropia-2457	181	1	to	to	PART
biotropia-2457	181	2	optimize	optimize	VERB
biotropia-2457	181	3	starch	starch	NOUN
biotropia-2457	181	4	composition	composition	NOUN
biotropia-2457	181	5	in	in	ADP
biotropia-2457	181	6	sorghum	sorghum	NOUN
biotropia-2457	181	7	(	(	PUNCT
biotropia-2457	181	8	zhang	zhang	X
biotropia-2457	181	9	et	et	PROPN
biotropia-2457	181	10	al	al	PROPN
biotropia-2457	181	11	.	.	PROPN
biotropia-2457	181	12	2021	2021	NUM
biotropia-2457	181	13	)	)	PUNCT
biotropia-2457	181	14	.	.	PUNCT
biotropia-2457	182	1	the	the	DET
biotropia-2457	182	2	exclusive	exclusive	ADJ
biotropia-2457	182	3	amplification	amplification	NOUN
biotropia-2457	182	4	of	of	ADP
biotropia-2457	182	5	the	the	DET
biotropia-2457	182	6	wxc	wxc	NOUN
biotropia-2457	182	7	allele	allele	NOUN
biotropia-2457	182	8	observed	observe	VERB
biotropia-2457	182	9	in	in	ADP
biotropia-2457	182	10	this	this	DET
biotropia-2457	182	11	study	study	NOUN
biotropia-2457	182	12	provides	provide	VERB
biotropia-2457	182	13	important	important	ADJ
biotropia-2457	182	14	implications	implication	NOUN
biotropia-2457	182	15	for	for	ADP
biotropia-2457	182	16	both	both	CCONJ
biotropia-2457	182	17	genetic	genetic	ADJ
biotropia-2457	182	18	understanding	understanding	NOUN
biotropia-2457	182	19	and	and	CCONJ
biotropia-2457	182	20	breeding	breeding	NOUN
biotropia-2457	182	21	strategies	strategy	NOUN
biotropia-2457	182	22	of	of	ADP
biotropia-2457	182	23	sorghum	sorghum	NOUN
biotropia-2457	182	24	bicolor	bicolor	NOUN
biotropia-2457	182	25	(	(	PUNCT
biotropia-2457	182	26	l.	l.	NOUN
biotropia-2457	182	27	)	)	PUNCT
biotropia-2457	182	28	moench	moench	NOUN
biotropia-2457	182	29	.	.	PUNCT
biotropia-2457	183	1	segregating	segregate	VERB
biotropia-2457	183	2	populations	population	NOUN
biotropia-2457	183	3	of	of	ADP
biotropia-2457	183	4	sorghum	sorghum	NOUN
biotropia-2457	183	5	often	often	ADV
biotropia-2457	183	6	show	show	VERB
biotropia-2457	183	7	significant	significant	ADJ
biotropia-2457	183	8	genetic	genetic	ADJ
biotropia-2457	183	9	variability	variability	NOUN
biotropia-2457	183	10	in	in	ADP
biotropia-2457	183	11	amylose	amylose	NOUN
biotropia-2457	183	12	and	and	CCONJ
biotropia-2457	183	13	yield	yield	NOUN
biotropia-2457	183	14	-	-	PUNCT
biotropia-2457	183	15	related	relate	VERB
biotropia-2457	183	16	traits	trait	NOUN
biotropia-2457	183	17	,	,	PUNCT
biotropia-2457	183	18	as	as	SCONJ
biotropia-2457	183	19	documented	document	VERB
biotropia-2457	183	20	by	by	ADP
biotropia-2457	183	21	trikoesoemaningtyas	trikoesoemaningtyas	PROPN
biotropia-2457	183	22	et	et	PROPN
biotropia-2457	183	23	al	al	PROPN
biotropia-2457	183	24	.	.	PROPN
biotropia-2457	184	1	(	(	PUNCT
biotropia-2457	184	2	2024	2024	NUM
biotropia-2457	184	3	)	)	PUNCT
biotropia-2457	184	4	,	,	PUNCT
biotropia-2457	184	5	indicating	indicate	VERB
biotropia-2457	184	6	that	that	SCONJ
biotropia-2457	184	7	waxy	waxy	NOUN
biotropia-2457	184	8	gene	gene	NOUN
biotropia-2457	184	9	alleles	allele	NOUN
biotropia-2457	184	10	can	can	AUX
biotropia-2457	184	11	segregate	segregate	VERB
biotropia-2457	184	12	differentially	differentially	ADV
biotropia-2457	184	13	and	and	CCONJ
biotropia-2457	184	14	determine	determine	VERB
biotropia-2457	184	15	starch	starch	NOUN
biotropia-2457	184	16	quality	quality	NOUN
biotropia-2457	184	17	.	.	PUNCT
biotropia-2457	185	1	in	in	ADP
biotropia-2457	185	2	our	our	PRON
biotropia-2457	185	3	study	study	NOUN
biotropia-2457	185	4	,	,	PUNCT
biotropia-2457	185	5	the	the	DET
biotropia-2457	185	6	fixation	fixation	NOUN
biotropia-2457	185	7	of	of	ADP
biotropia-2457	185	8	wxc	wxc	NOUN
biotropia-2457	185	9	is	be	AUX
biotropia-2457	185	10	consistent	consistent	ADJ
biotropia-2457	185	11	with	with	ADP
biotropia-2457	185	12	these	these	DET
biotropia-2457	185	13	findings	finding	NOUN
biotropia-2457	185	14	,	,	PUNCT
biotropia-2457	185	15	suggesting	suggest	VERB
biotropia-2457	185	16	strong	strong	ADJ
biotropia-2457	185	17	selection	selection	NOUN
biotropia-2457	185	18	or	or	CCONJ
biotropia-2457	185	19	genetic	genetic	ADJ
biotropia-2457	185	20	drift	drift	NOUN
biotropia-2457	185	21	leading	lead	VERB
biotropia-2457	185	22	to	to	ADP
biotropia-2457	185	23	allele	allele	NOUN
biotropia-2457	185	24	predominance	predominance	NOUN
biotropia-2457	185	25	.	.	PUNCT
biotropia-2457	186	1	furthermore	furthermore	ADV
biotropia-2457	186	2	,	,	PUNCT
biotropia-2457	186	3	the	the	DET
biotropia-2457	186	4	absence	absence	NOUN
biotropia-2457	186	5	of	of	ADP
biotropia-2457	186	6	wxa	wxa	NOUN
biotropia-2457	186	7	and	and	CCONJ
biotropia-2457	186	8	wxb	wxb	PRON
biotropia-2457	186	9	may	may	AUX
biotropia-2457	186	10	be	be	AUX
biotropia-2457	186	11	the	the	DET
biotropia-2457	186	12	result	result	NOUN
biotropia-2457	186	13	of	of	ADP
biotropia-2457	186	14	allelic	allelic	ADJ
biotropia-2457	186	15	silencing	silencing	NOUN
biotropia-2457	186	16	,	,	PUNCT
biotropia-2457	186	17	epistatic	epistatic	ADJ
biotropia-2457	186	18	interaction	interaction	NOUN
biotropia-2457	186	19	,	,	PUNCT
biotropia-2457	186	20	or	or	CCONJ
biotropia-2457	186	21	breeding	breeding	NOUN
biotropia-2457	186	22	history	history	NOUN
biotropia-2457	186	23	.	.	PUNCT
biotropia-2457	187	1	similar	similar	ADJ
biotropia-2457	187	2	patterns	pattern	NOUN
biotropia-2457	187	3	of	of	ADP
biotropia-2457	187	4	allele	allele	NOUN
biotropia-2457	187	5	loss	loss	NOUN
biotropia-2457	187	6	and	and	CCONJ
biotropia-2457	187	7	fixation	fixation	NOUN
biotropia-2457	187	8	have	have	AUX
biotropia-2457	187	9	been	be	AUX
biotropia-2457	187	10	reported	report	VERB
biotropia-2457	187	11	in	in	ADP
biotropia-2457	187	12	segregating	segregating	ADJ
biotropia-2457	187	13	populations	population	NOUN
biotropia-2457	187	14	in	in	ADP
biotropia-2457	187	15	indonesia	indonesia	PROPN
biotropia-2457	187	16	,	,	PUNCT
biotropia-2457	187	17	particularly	particularly	ADV
biotropia-2457	187	18	when	when	SCONJ
biotropia-2457	187	19	breeding	breeding	NOUN
biotropia-2457	187	20	pressure	pressure	NOUN
biotropia-2457	187	21	favored	favor	VERB
biotropia-2457	187	22	specific	specific	ADJ
biotropia-2457	187	23	quality	quality	NOUN
biotropia-2457	187	24	traits	trait	NOUN
biotropia-2457	187	25	(	(	PUNCT
biotropia-2457	187	26	lestari	lestari	NOUN
biotropia-2457	187	27	et	et	PROPN
biotropia-2457	187	28	al	al	PROPN
biotropia-2457	187	29	.	.	PROPN
biotropia-2457	187	30	2024	2024	NUM
biotropia-2457	187	31	;	;	PUNCT
biotropia-2457	187	32	munarti	munarti	PROPN
biotropia-2457	187	33	et	et	PROPN
biotropia-2457	187	34	al	al	PROPN
biotropia-2457	187	35	.	.	PROPN
biotropia-2457	187	36	2022	2022	NUM
biotropia-2457	187	37	)	)	PUNCT
biotropia-2457	187	38	.	.	PUNCT
biotropia-2457	188	1	these	these	DET
biotropia-2457	188	2	results	result	NOUN
biotropia-2457	188	3	highlight	highlight	VERB
biotropia-2457	188	4	the	the	DET
biotropia-2457	188	5	potential	potential	NOUN
biotropia-2457	188	6	of	of	ADP
biotropia-2457	188	7	wxc	wxc	NOUN
biotropia-2457	188	8	as	as	ADP
biotropia-2457	188	9	a	a	DET
biotropia-2457	188	10	reliable	reliable	ADJ
biotropia-2457	188	11	marker	marker	NOUN
biotropia-2457	188	12	for	for	ADP
biotropia-2457	188	13	the	the	DET
biotropia-2457	188	14	development	development	NOUN
biotropia-2457	188	15	of	of	ADP
biotropia-2457	188	16	waxy	waxy	NOUN
biotropia-2457	188	17	sorghum	sorghum	NOUN
biotropia-2457	188	18	.	.	PUNCT
biotropia-2457	189	1	from	from	ADP
biotropia-2457	189	2	an	an	DET
biotropia-2457	189	3	agronomic	agronomic	ADJ
biotropia-2457	189	4	perspective	perspective	NOUN
biotropia-2457	189	5	,	,	PUNCT
biotropia-2457	189	6	waxy	waxy	NOUN
biotropia-2457	189	7	allele	allele	NOUN
biotropia-2457	189	8	fixation	fixation	NOUN
biotropia-2457	189	9	should	should	AUX
biotropia-2457	189	10	be	be	AUX
biotropia-2457	189	11	considered	consider	VERB
biotropia-2457	189	12	alongside	alongside	ADP
biotropia-2457	189	13	variability	variability	NOUN
biotropia-2457	189	14	in	in	ADP
biotropia-2457	189	15	other	other	ADJ
biotropia-2457	189	16	traits	trait	NOUN
biotropia-2457	189	17	such	such	ADJ
biotropia-2457	189	18	as	as	ADP
biotropia-2457	189	19	lignin	lignin	NOUN
biotropia-2457	189	20	content	content	NOUN
biotropia-2457	189	21	,	,	PUNCT
biotropia-2457	189	22	stay	stay	VERB
biotropia-2457	189	23	-	-	PUNCT
biotropia-2457	189	24	green	green	ADJ
biotropia-2457	189	25	genes	gene	NOUN
biotropia-2457	189	26	,	,	PUNCT
biotropia-2457	189	27	and	and	CCONJ
biotropia-2457	189	28	biomass	biomass	NOUN
biotropia-2457	189	29	quality	quality	NOUN
biotropia-2457	189	30	.	.	PUNCT
biotropia-2457	190	1	astuti	astuti	PROPN
biotropia-2457	190	2	et	et	PROPN
biotropia-2457	190	3	al	al	PROPN
biotropia-2457	190	4	.	.	PROPN
biotropia-2457	191	1	(	(	PUNCT
biotropia-2457	191	2	2024	2024	NUM
biotropia-2457	191	3	)	)	PUNCT
biotropia-2457	191	4	demonstrated	demonstrate	VERB
biotropia-2457	191	5	that	that	SCONJ
biotropia-2457	191	6	agronomic	agronomic	ADJ
biotropia-2457	191	7	variability	variability	NOUN
biotropia-2457	191	8	among	among	ADP
biotropia-2457	191	9	sorghum	sorghum	NOUN
biotropia-2457	191	10	genotypes	genotype	NOUN
biotropia-2457	191	11	with	with	ADP
biotropia-2457	191	12	different	different	ADJ
biotropia-2457	191	13	lignin	lignin	NOUN
biotropia-2457	191	14	levels	level	NOUN
biotropia-2457	191	15	could	could	AUX
biotropia-2457	191	16	be	be	AUX
biotropia-2457	191	17	exploited	exploit	VERB
biotropia-2457	191	18	for	for	ADP
biotropia-2457	191	19	both	both	PRON
biotropia-2457	191	20	food	food	NOUN
biotropia-2457	191	21	and	and	CCONJ
biotropia-2457	191	22	non	non	ADJ
biotropia-2457	191	23	-	-	ADJ
biotropia-2457	191	24	food	food	ADJ
biotropia-2457	191	25	purposes	purpose	NOUN
biotropia-2457	191	26	,	,	PUNCT
biotropia-2457	191	27	while	while	SCONJ
biotropia-2457	191	28	munarti	munarti	PROPN
biotropia-2457	191	29	et	et	PROPN
biotropia-2457	191	30	al	al	PROPN
biotropia-2457	191	31	.	.	PROPN
biotropia-2457	192	1	(	(	PUNCT
biotropia-2457	192	2	2022	2022	NUM
biotropia-2457	192	3	)	)	PUNCT
biotropia-2457	192	4	emphasized	emphasize	VERB
biotropia-2457	192	5	the	the	DET
biotropia-2457	192	6	role	role	NOUN
biotropia-2457	192	7	of	of	ADP
biotropia-2457	192	8	stay	stay	VERB
biotropia-2457	192	9	-	-	PUNCT
biotropia-2457	192	10	green	green	ADJ
biotropia-2457	192	11	genes	gene	NOUN
biotropia-2457	192	12	in	in	ADP
biotropia-2457	192	13	crop	crop	NOUN
biotropia-2457	192	14	resilience	resilience	NOUN
biotropia-2457	192	15	.	.	PUNCT
biotropia-2457	193	1	this	this	DET
biotropia-2457	193	2	integration	integration	NOUN
biotropia-2457	193	3	shows	show	VERB
biotropia-2457	193	4	that	that	SCONJ
biotropia-2457	193	5	waxy	waxy	NOUN
biotropia-2457	193	6	allele	allele	NOUN
biotropia-2457	193	7	expression	expression	NOUN
biotropia-2457	193	8	,	,	PUNCT
biotropia-2457	193	9	combined	combine	VERB
biotropia-2457	193	10	with	with	ADP
biotropia-2457	193	11	other	other	ADJ
biotropia-2457	193	12	genetic	genetic	ADJ
biotropia-2457	193	13	factors	factor	NOUN
biotropia-2457	193	14	,	,	PUNCT
biotropia-2457	193	15	can	can	AUX
biotropia-2457	193	16	strengthen	strengthen	VERB
biotropia-2457	193	17	both	both	PRON
biotropia-2457	193	18	yield	yield	VERB
biotropia-2457	193	19	stability	stability	NOUN
biotropia-2457	193	20	and	and	CCONJ
biotropia-2457	193	21	quality	quality	NOUN
biotropia-2457	193	22	improvement	improvement	NOUN
biotropia-2457	193	23	.	.	PUNCT
biotropia-2457	194	1	at	at	ADP
biotropia-2457	194	2	a	a	DET
biotropia-2457	194	3	broader	broad	ADJ
biotropia-2457	194	4	level	level	NOUN
biotropia-2457	194	5	,	,	PUNCT
biotropia-2457	194	6	studies	study	NOUN
biotropia-2457	194	7	in	in	ADP
biotropia-2457	194	8	kazakhstan	kazakhstan	PROPN
biotropia-2457	194	9	by	by	ADP
biotropia-2457	194	10	bogapov	bogapov	PROPN
biotropia-2457	194	11	et	et	PROPN
biotropia-2457	194	12	al	al	PROPN
biotropia-2457	194	13	.	.	PROPN
biotropia-2457	195	1	(	(	PUNCT
biotropia-2457	195	2	2024	2024	NUM
biotropia-2457	195	3	)	)	PUNCT
biotropia-2457	195	4	have	have	AUX
biotropia-2457	195	5	shown	show	VERB
biotropia-2457	195	6	that	that	SCONJ
biotropia-2457	195	7	sweet	sweet	ADJ
biotropia-2457	195	8	sorghum	sorghum	NOUN
biotropia-2457	195	9	genotypes	genotype	NOUN
biotropia-2457	195	10	can	can	AUX
biotropia-2457	195	11	simultaneously	simultaneously	ADV
biotropia-2457	195	12	provide	provide	VERB
biotropia-2457	195	13	high	high	ADJ
biotropia-2457	195	14	value	value	NOUN
biotropia-2457	195	15	for	for	ADP
biotropia-2457	195	16	food	food	NOUN
biotropia-2457	195	17	,	,	PUNCT
biotropia-2457	195	18	feed	feed	NOUN
biotropia-2457	195	19	,	,	PUNCT
biotropia-2457	195	20	and	and	CCONJ
biotropia-2457	195	21	energy	energy	NOUN
biotropia-2457	195	22	,	,	PUNCT
biotropia-2457	195	23	stressing	stress	VERB
biotropia-2457	195	24	the	the	DET
biotropia-2457	195	25	importance	importance	NOUN
biotropia-2457	195	26	of	of	ADP
biotropia-2457	195	27	breeding	breed	VERB
biotropia-2457	195	28	materials	material	NOUN
biotropia-2457	195	29	with	with	ADP
biotropia-2457	195	30	multiple	multiple	ADJ
biotropia-2457	195	31	functional	functional	ADJ
biotropia-2457	195	32	traits	trait	NOUN
biotropia-2457	195	33	.	.	PUNCT
biotropia-2457	196	1	thus	thus	ADV
biotropia-2457	196	2	,	,	PUNCT
biotropia-2457	196	3	the	the	DET
biotropia-2457	196	4	fixation	fixation	NOUN
biotropia-2457	196	5	of	of	ADP
biotropia-2457	196	6	wxc	wxc	NOUN
biotropia-2457	196	7	in	in	ADP
biotropia-2457	196	8	our	our	PRON
biotropia-2457	196	9	population	population	NOUN
biotropia-2457	196	10	not	not	PART
biotropia-2457	196	11	only	only	ADV
biotropia-2457	196	12	benefits	benefit	VERB
biotropia-2457	196	13	starch	starch	NOUN
biotropia-2457	196	14	quality	quality	NOUN
biotropia-2457	196	15	but	but	CCONJ
biotropia-2457	196	16	also	also	ADV
biotropia-2457	196	17	aligns	align	VERB
biotropia-2457	196	18	with	with	ADP
biotropia-2457	196	19	global	global	ADJ
biotropia-2457	196	20	breeding	breeding	NOUN
biotropia-2457	196	21	trends	trend	NOUN
biotropia-2457	196	22	aiming	aim	VERB
biotropia-2457	196	23	at	at	ADP
biotropia-2457	196	24	multifunctional	multifunctional	ADJ
biotropia-2457	196	25	sorghum	sorghum	NOUN
biotropia-2457	196	26	cultivars	cultivar	NOUN
biotropia-2457	196	27	.	.	PUNCT
biotropia-2457	197	1	overall	overall	ADV
biotropia-2457	197	2	,	,	PUNCT
biotropia-2457	197	3	this	this	DET
biotropia-2457	197	4	study	study	NOUN
biotropia-2457	197	5	supports	support	VERB
biotropia-2457	197	6	the	the	DET
biotropia-2457	197	7	hypothesis	hypothesis	NOUN
biotropia-2457	197	8	that	that	PRON
biotropia-2457	197	9	wxc	wxc	VERB
biotropia-2457	197	10	allele	allele	NOUN
biotropia-2457	197	11	expression	expression	NOUN
biotropia-2457	197	12	is	be	AUX
biotropia-2457	197	13	a	a	DET
biotropia-2457	197	14	critical	critical	ADJ
biotropia-2457	197	15	determinant	determinant	NOUN
biotropia-2457	197	16	of	of	ADP
biotropia-2457	197	17	waxy	waxy	NOUN
biotropia-2457	197	18	starch	starch	NOUN
biotropia-2457	197	19	properties	property	NOUN
biotropia-2457	197	20	in	in	ADP
biotropia-2457	197	21	sorghum	sorghum	NOUN
biotropia-2457	197	22	,	,	PUNCT
biotropia-2457	197	23	and	and	CCONJ
biotropia-2457	197	24	its	its	PRON
biotropia-2457	197	25	consistent	consistent	ADJ
biotropia-2457	197	26	detection	detection	NOUN
biotropia-2457	197	27	in	in	ADP
biotropia-2457	197	28	kd4	kd4	PROPN
biotropia-2457	197	29	,	,	PUNCT
biotropia-2457	197	30	bonteb	bonteb	NOUN
biotropia-2457	197	31	,	,	PUNCT
biotropia-2457	197	32	and	and	CCONJ
biotropia-2457	197	33	their	their	PRON
biotropia-2457	197	34	f1	f1	NOUN
biotropia-2457	197	35	populations	population	NOUN
biotropia-2457	197	36	strengthens	strengthen	VERB
biotropia-2457	197	37	its	its	PRON
biotropia-2457	197	38	role	role	NOUN
biotropia-2457	197	39	as	as	ADP
biotropia-2457	197	40	a	a	DET
biotropia-2457	197	41	target	target	NOUN
biotropia-2457	197	42	in	in	ADP
biotropia-2457	197	43	molecular	molecular	ADJ
biotropia-2457	197	44	breeding	breeding	NOUN
biotropia-2457	197	45	programs	program	NOUN
biotropia-2457	197	46	.	.	PUNCT
biotropia-2457	198	1	our	our	PRON
biotropia-2457	198	2	findings	finding	NOUN
biotropia-2457	198	3	further	far	ADV
biotropia-2457	198	4	indicate	indicate	VERB
biotropia-2457	198	5	that	that	SCONJ
biotropia-2457	198	6	the	the	DET
biotropia-2457	198	7	consistent	consistent	ADJ
biotropia-2457	198	8	expression	expression	NOUN
biotropia-2457	198	9	of	of	ADP
biotropia-2457	198	10	wxc	wxc	NOUN
biotropia-2457	198	11	is	be	AUX
biotropia-2457	198	12	correlated	correlate	VERB
biotropia-2457	198	13	with	with	ADP
biotropia-2457	198	14	relatively	relatively	ADV
biotropia-2457	198	15	low	low	ADJ
biotropia-2457	198	16	amylose	amylose	ADJ
biotropia-2457	198	17	content	content	NOUN
biotropia-2457	198	18	in	in	ADP
biotropia-2457	198	19	kd4	kd4	PROPN
biotropia-2457	198	20	,	,	PUNCT
biotropia-2457	198	21	bonteb	bonteb	NOUN
biotropia-2457	198	22	gunungkidul	gunungkidul	NOUN
biotropia-2457	198	23	,	,	PUNCT
biotropia-2457	198	24	and	and	CCONJ
biotropia-2457	198	25	their	their	PRON
biotropia-2457	198	26	progenies	progeny	NOUN
biotropia-2457	198	27	.	.	PUNCT
biotropia-2457	199	1	this	this	PRON
biotropia-2457	199	2	supports	support	VERB
biotropia-2457	199	3	the	the	DET
biotropia-2457	199	4	role	role	NOUN
biotropia-2457	199	5	of	of	ADP
biotropia-2457	199	6	wxc	wxc	NOUN
biotropia-2457	199	7	as	as	ADP
biotropia-2457	199	8	a	a	DET
biotropia-2457	199	9	determinant	determinant	NOUN
biotropia-2457	199	10	of	of	ADP
biotropia-2457	199	11	starch	starch	NOUN
biotropia-2457	199	12	quality	quality	NOUN
biotropia-2457	199	13	,	,	PUNCT
biotropia-2457	199	14	particularly	particularly	ADV
biotropia-2457	199	15	in	in	ADP
biotropia-2457	199	16	producing	produce	VERB
biotropia-2457	199	17	waxy	waxy	NOUN
biotropia-2457	199	18	sorghum	sorghum	NOUN
biotropia-2457	199	19	types	type	NOUN
biotropia-2457	199	20	with	with	ADP
biotropia-2457	199	21	desirable	desirable	ADJ
biotropia-2457	199	22	grain	grain	NOUN
biotropia-2457	199	23	texture	texture	NOUN
biotropia-2457	199	24	.	.	PUNCT
biotropia-2457	200	1	the	the	DET
biotropia-2457	200	2	absence	absence	NOUN
biotropia-2457	200	3	of	of	ADP
biotropia-2457	200	4	wxa	wxa	NOUN
biotropia-2457	200	5	and	and	CCONJ
biotropia-2457	200	6	wxb	wxb	PRON
biotropia-2457	200	7	expression	expression	NOUN
biotropia-2457	200	8	suggests	suggest	VERB
biotropia-2457	200	9	possible	possible	ADJ
biotropia-2457	200	10	gene	gene	NOUN
biotropia-2457	200	11	silencing	silencing	NOUN
biotropia-2457	200	12	or	or	CCONJ
biotropia-2457	200	13	allelic	allelic	ADJ
biotropia-2457	200	14	regulation	regulation	NOUN
biotropia-2457	200	15	,	,	PUNCT
biotropia-2457	200	16	which	which	PRON
biotropia-2457	200	17	warrants	warrant	VERB
biotropia-2457	200	18	further	further	ADJ
biotropia-2457	200	19	investigation	investigation	NOUN
biotropia-2457	200	20	.	.	PUNCT
biotropia-2457	201	1	future	future	ADJ
biotropia-2457	201	2	studies	study	NOUN
biotropia-2457	201	3	should	should	AUX
biotropia-2457	201	4	focus	focus	VERB
biotropia-2457	201	5	on	on	ADP
biotropia-2457	201	6	quantitative	quantitative	ADJ
biotropia-2457	201	7	expression	expression	NOUN
biotropia-2457	201	8	analysis	analysis	NOUN
biotropia-2457	201	9	(	(	PUNCT
biotropia-2457	201	10	qpcr	qpcr	ADV
biotropia-2457	201	11	or	or	CCONJ
biotropia-2457	201	12	rna	rna	NOUN
biotropia-2457	201	13	-	-	PUNCT
biotropia-2457	201	14	seq	seq	NOUN
biotropia-2457	201	15	)	)	PUNCT
biotropia-2457	201	16	to	to	PART
biotropia-2457	201	17	explore	explore	VERB
biotropia-2457	201	18	the	the	DET
biotropia-2457	201	19	regulatory	regulatory	ADJ
biotropia-2457	201	20	mechanisms	mechanism	NOUN
biotropia-2457	201	21	of	of	ADP
biotropia-2457	201	22	wx	wx	PROPN
biotropia-2457	201	23	alleles	allele	NOUN
biotropia-2457	201	24	,	,	PUNCT
biotropia-2457	201	25	as	as	ADV
biotropia-2457	201	26	well	well	ADV
biotropia-2457	201	27	as	as	ADP
biotropia-2457	201	28	environmental	environmental	ADJ
biotropia-2457	201	29	influences	influence	NOUN
biotropia-2457	201	30	such	such	ADJ
biotropia-2457	201	31	as	as	ADP
biotropia-2457	201	32	temperature	temperature	NOUN
biotropia-2457	201	33	and	and	CCONJ
biotropia-2457	201	34	water	water	NOUN
biotropia-2457	201	35	availability	availability	NOUN
biotropia-2457	201	36	that	that	PRON
biotropia-2457	201	37	may	may	AUX
biotropia-2457	201	38	affect	affect	VERB
biotropia-2457	201	39	starch	starch	NOUN
biotropia-2457	201	40	biosynthesis	biosynthesis	NOUN
biotropia-2457	201	41	.	.	PUNCT
biotropia-2457	202	1	additionally	additionally	ADV
biotropia-2457	202	2	,	,	PUNCT
biotropia-2457	202	3	phenotypic	phenotypic	ADJ
biotropia-2457	202	4	evaluations	evaluation	NOUN
biotropia-2457	202	5	of	of	ADP
biotropia-2457	202	6	starch	starch	NOUN
biotropia-2457	202	7	properties	property	NOUN
biotropia-2457	202	8	should	should	AUX
biotropia-2457	202	9	be	be	AUX
biotropia-2457	202	10	integrated	integrate	VERB
biotropia-2457	202	11	with	with	ADP
biotropia-2457	202	12	molecular	molecular	ADJ
biotropia-2457	202	13	findings	finding	NOUN
biotropia-2457	202	14	to	to	PART
biotropia-2457	202	15	strengthen	strengthen	VERB
biotropia-2457	202	16	marker	marker	NOUN
biotropia-2457	202	17	-	-	PUNCT
biotropia-2457	202	18	assisted	assist	VERB
biotropia-2457	202	19	selection	selection	NOUN
biotropia-2457	202	20	strategies	strategy	NOUN
biotropia-2457	202	21	in	in	ADP
biotropia-2457	202	22	sorghum	sorghum	NOUN
biotropia-2457	202	23	breeding	breeding	NOUN
biotropia-2457	202	24	.	.	PUNCT
biotropia-2457	203	1	conclusion	conclusion	NOUN
biotropia-2457	203	2	this	this	DET
biotropia-2457	203	3	study	study	NOUN
biotropia-2457	203	4	provides	provide	VERB
biotropia-2457	203	5	a	a	DET
biotropia-2457	203	6	comprehensive	comprehensive	ADJ
biotropia-2457	203	7	understanding	understanding	NOUN
biotropia-2457	203	8	of	of	ADP
biotropia-2457	203	9	the	the	DET
biotropia-2457	203	10	role	role	NOUN
biotropia-2457	203	11	of	of	ADP
biotropia-2457	203	12	the	the	DET
biotropia-2457	203	13	waxy	waxy	NOUN
biotropia-2457	203	14	gene	gene	NOUN
biotropia-2457	203	15	in	in	ADP
biotropia-2457	203	16	sorghum	sorghum	NOUN
biotropia-2457	203	17	and	and	CCONJ
biotropia-2457	203	18	its	its	PRON
biotropia-2457	203	19	relationship	relationship	NOUN
biotropia-2457	203	20	with	with	ADP
biotropia-2457	203	21	amylose	amylose	ADJ
biotropia-2457	203	22	content	content	NOUN
biotropia-2457	203	23	.	.	PUNCT
biotropia-2457	204	1	the	the	DET
biotropia-2457	204	2	dominant	dominant	ADJ
biotropia-2457	204	3	expression	expression	NOUN
biotropia-2457	204	4	of	of	ADP
biotropia-2457	204	5	wxc	wxc	NOUN
biotropia-2457	204	6	suggests	suggest	VERB
biotropia-2457	204	7	its	its	PRON
biotropia-2457	204	8	crucial	crucial	ADJ
biotropia-2457	204	9	involvement	involvement	NOUN
biotropia-2457	204	10	in	in	ADP
biotropia-2457	204	11	starch	starch	NOUN
biotropia-2457	204	12	biosynthesis	biosynthesis	NOUN
biotropia-2457	204	13	,	,	PUNCT
biotropia-2457	204	14	while	while	SCONJ
biotropia-2457	204	15	the	the	DET
biotropia-2457	204	16	absence	absence	NOUN
biotropia-2457	204	17	of	of	ADP
biotropia-2457	204	18	wxa	wxa	NOUN
biotropia-2457	204	19	and	and	CCONJ
biotropia-2457	204	20	wxb	wxb	PRON
biotropia-2457	204	21	expression	expression	NOUN
biotropia-2457	204	22	raises	raise	VERB
biotropia-2457	204	23	questions	question	NOUN
biotropia-2457	204	24	regarding	regard	VERB
biotropia-2457	204	25	their	their	PRON
biotropia-2457	204	26	regulation	regulation	NOUN
biotropia-2457	204	27	.	.	PUNCT
biotropia-2457	205	1	future	future	ADJ
biotropia-2457	205	2	research	research	NOUN
biotropia-2457	205	3	should	should	AUX
biotropia-2457	205	4	explore	explore	VERB
biotropia-2457	205	5	the	the	DET
biotropia-2457	205	6	genetic	genetic	ADJ
biotropia-2457	205	7	and	and	CCONJ
biotropia-2457	205	8	environmental	environmental	ADJ
biotropia-2457	205	9	factors	factor	NOUN
biotropia-2457	205	10	influencing	influence	VERB
biotropia-2457	205	11	waxy	waxy	NOUN
biotropia-2457	205	12	gene	gene	NOUN
biotropia-2457	205	13	expression	expression	NOUN
biotropia-2457	205	14	to	to	PART
biotropia-2457	205	15	enhance	enhance	VERB
biotropia-2457	205	16	sorghum	sorghum	NOUN
biotropia-2457	205	17	breeding	breeding	NOUN
biotropia-2457	205	18	strategies	strategy	NOUN
biotropia-2457	205	19	for	for	ADP
biotropia-2457	205	20	improved	improved	ADJ
biotropia-2457	205	21	starch	starch	NOUN
biotropia-2457	205	22	characteristics	characteristic	NOUN
biotropia-2457	205	23	.	.	PUNCT
biotropia-2457	206	1	acknowledgments	acknowledgment	NOUN
biotropia-2457	206	2	the	the	DET
biotropia-2457	206	3	authors	author	NOUN
biotropia-2457	206	4	gratefully	gratefully	ADV
biotropia-2457	206	5	acknowledge	acknowledge	VERB
biotropia-2457	206	6	the	the	DET
biotropia-2457	206	7	financial	financial	ADJ
biotropia-2457	206	8	research	research	NOUN
biotropia-2457	206	9	support	support	NOUN
biotropia-2457	206	10	from	from	ADP
biotropia-2457	206	11	the	the	DET
biotropia-2457	206	12	research	research	NOUN
biotropia-2457	206	13	center	center	NOUN
biotropia-2457	206	14	for	for	ADP
biotropia-2457	206	15	food	food	NOUN
biotropia-2457	206	16	crops	crop	NOUN
biotropia-2457	206	17	of	of	ADP
biotropia-2457	206	18	the	the	DET
biotropia-2457	206	19	national	national	PROPN
biotropia-2457	206	20	innovation	innovation	PROPN
biotropia-2457	206	21	research	research	NOUN
biotropia-2457	206	22	agency	agency	PROPN
biotropia-2457	206	23	(	(	PUNCT
biotropia-2457	206	24	brin	brin	PROPN
biotropia-2457	206	25	)	)	PUNCT
biotropia-2457	206	26	and	and	CCONJ
biotropia-2457	206	27	the	the	DET
biotropia-2457	206	28	faculty	faculty	NOUN
biotropia-2457	206	29	of	of	ADP
biotropia-2457	206	30	biology	biology	NOUN
biotropia-2457	206	31	,	,	PUNCT
biotropia-2457	206	32	gadjah	gadjah	PROPN
biotropia-2457	206	33	mada	mada	PROPN
biotropia-2457	206	34	university	university	PROPN
biotropia-2457	206	35	(	(	PUNCT
biotropia-2457	206	36	ugm	ugm	PROPN
biotropia-2457	206	37	)	)	PUNCT
biotropia-2457	206	38	which	which	PRON
biotropia-2457	206	39	facilitated	facilitate	VERB
biotropia-2457	206	40	the	the	DET
biotropia-2457	206	41	design	design	NOUN
biotropia-2457	206	42	,	,	PUNCT
biotropia-2457	206	43	data	data	NOUN
biotropia-2457	206	44	acquisition	acquisition	NOUN
biotropia-2457	206	45	,	,	PUNCT
biotropia-2457	206	46	and	and	CCONJ
biotropia-2457	206	47	analysis	analysis	NOUN
biotropia-2457	206	48	of	of	ADP
biotropia-2457	206	49	this	this	DET
biotropia-2457	206	50	study	study	NOUN
biotropia-2457	206	51	,	,	PUNCT
biotropia-2457	206	52	also	also	ADV
biotropia-2457	206	53	for	for	ADP
biotropia-2457	206	54	their	their	PRON
biotropia-2457	206	55	invaluable	invaluable	ADJ
biotropia-2457	206	56	technical	technical	ADJ
biotropia-2457	206	57	assistance	assistance	NOUN
biotropia-2457	206	58	in	in	ADP
biotropia-2457	206	59	sample	sample	NOUN
biotropia-2457	206	60	collection	collection	NOUN
biotropia-2457	206	61	and	and	CCONJ
biotropia-2457	206	62	fieldwork	fieldwork	NOUN
biotropia-2457	206	63	.	.	PUNCT
biotropia-2457	207	1	their	their	PRON
biotropia-2457	207	2	contributions	contribution	NOUN
biotropia-2457	207	3	were	be	AUX
biotropia-2457	207	4	essential	essential	ADJ
biotropia-2457	207	5	in	in	ADP
biotropia-2457	207	6	ensuring	ensure	VERB
biotropia-2457	207	7	the	the	DET
biotropia-2457	207	8	success	success	NOUN
biotropia-2457	207	9	of	of	ADP
biotropia-2457	207	10	this	this	DET
biotropia-2457	207	11	research	research	NOUN
biotropia-2457	207	12	.	.	PUNCT
biotropia-2457	208	1	additionally	additionally	ADV
biotropia-2457	208	2	,	,	PUNCT
biotropia-2457	208	3	we	we	PRON
biotropia-2457	208	4	acknowledge	acknowledge	VERB
biotropia-2457	208	5	all	all	DET
biotropia-2457	208	6	individuals	individual	NOUN
biotropia-2457	208	7	and	and	CCONJ
biotropia-2457	208	8	institutions	institution	NOUN
biotropia-2457	208	9	that	that	PRON
biotropia-2457	208	10	provided	provide	VERB
biotropia-2457	208	11	materials	material	NOUN
biotropia-2457	208	12	and	and	CCONJ
biotropia-2457	208	13	resources	resource	NOUN
biotropia-2457	208	14	necessary	necessary	ADJ
biotropia-2457	208	15	for	for	ADP
biotropia-2457	208	16	the	the	DET
biotropia-2457	208	17	completion	completion	NOUN
biotropia-2457	208	18	of	of	ADP
biotropia-2457	208	19	this	this	DET
biotropia-2457	208	20	study	study	NOUN
biotropia-2457	208	21	.	.	PUNCT
biotropia-2457	209	1	the	the	DET
biotropia-2457	209	2	funding	funding	NOUN
biotropia-2457	209	3	body	body	NOUN
biotropia-2457	209	4	had	have	VERB
biotropia-2457	209	5	no	no	DET
biotropia-2457	209	6	role	role	NOUN
biotropia-2457	209	7	in	in	ADP
biotropia-2457	209	8	the	the	DET
biotropia-2457	209	9	study	study	NOUN
biotropia-2457	209	10	design	design	NOUN
biotropia-2457	209	11	,	,	PUNCT
biotropia-2457	209	12	data	datum	NOUN
biotropia-2457	209	13	analysis	analysis	NOUN
biotropia-2457	209	14	,	,	PUNCT
biotropia-2457	209	15	interpretation	interpretation	NOUN
biotropia-2457	209	16	,	,	PUNCT
biotropia-2457	209	17	manuscript	manuscript	NOUN
biotropia-2457	209	18	preparation	preparation	NOUN
biotropia-2457	209	19	,	,	PUNCT
biotropia-2457	209	20	or	or	CCONJ
biotropia-2457	209	21	the	the	DET
biotropia-2457	209	22	decision	decision	NOUN
biotropia-2457	209	23	to	to	PART
biotropia-2457	209	24	submit	submit	VERB
biotropia-2457	209	25	this	this	DET
biotropia-2457	209	26	paper	paper	NOUN
biotropia-2457	209	27	for	for	ADP
biotropia-2457	209	28	publication	publication	NOUN
biotropia-2457	209	29	.	.	PUNCT
biotropia-2457	210	1	molecular	molecular	ADJ
biotropia-2457	210	2	genetics	genetic	NOUN
biotropia-2457	210	3	of	of	ADP
biotropia-2457	210	4	sorghum	sorghum	NOUN
biotropia-2457	210	5	crosses	crosse	NOUN
biotropia-2457	210	6	kd4	kd4	PROPN
biotropia-2457	210	7	and	and	CCONJ
biotropia-2457	210	8	bonteb	bonteb	PROPN
biotropia-2457	210	9	gunungkidul	gunungkidul	PROPN
biotropia-2457	210	10	muazam	muazam	PROPN
biotropia-2457	210	11	et	et	PROPN
biotropia-2457	210	12	al	al	PROPN
biotropia-2457	210	13	.	.	PROPN
biotropia-2457	211	1	337	337	NUM
biotropia-2457	211	2	references	reference	NOUN
biotropia-2457	211	3	asante	asante	PROPN
biotropia-2457	211	4	md	md	PROPN
biotropia-2457	211	5	,	,	PUNCT
biotropia-2457	211	6	offei	offei	NOUN
biotropia-2457	211	7	sk	sk	PROPN
biotropia-2457	211	8	,	,	PUNCT
biotropia-2457	211	9	hall	hall	PROPN
biotropia-2457	211	10	aj	aj	PROPN
biotropia-2457	211	11	,	,	PUNCT
biotropia-2457	211	12	gracen	gracen	PROPN
biotropia-2457	211	13	ve	ve	PROPN
biotropia-2457	211	14	.	.	PROPN
biotropia-2457	211	15	2019	2019	NUM
biotropia-2457	211	16	.	.	PUNCT
biotropia-2457	212	1	influence	influence	NOUN
biotropia-2457	212	2	of	of	ADP
biotropia-2457	212	3	environmental	environmental	ADJ
biotropia-2457	212	4	factors	factor	NOUN
biotropia-2457	212	5	on	on	ADP
biotropia-2457	212	6	waxy	waxy	NOUN
biotropia-2457	212	7	and	and	CCONJ
biotropia-2457	212	8	non	non	ADJ
biotropia-2457	212	9	-	-	ADJ
biotropia-2457	212	10	waxy	waxy	ADJ
biotropia-2457	212	11	sorghum	sorghum	NOUN
biotropia-2457	212	12	starch	starch	NOUN
biotropia-2457	212	13	quality	quality	NOUN
biotropia-2457	212	14	.	.	PUNCT
biotropia-2457	213	1	food	food	NOUN
biotropia-2457	213	2	sci	sci	PROPN
biotropia-2457	213	3	nutr	nutr	PROPN
biotropia-2457	213	4	7(3):1164–72	7(3):1164–72	NUM
biotropia-2457	213	5	.	.	PUNCT
biotropia-2457	214	1	astuti	astuti	PROPN
biotropia-2457	214	2	d	d	NOUN
biotropia-2457	214	3	,	,	PUNCT
biotropia-2457	214	4	widyajayantie	widyajayantie	NOUN
biotropia-2457	214	5	d	d	NOUN
biotropia-2457	214	6	,	,	PUNCT
biotropia-2457	214	7	wiyono	wiyono	VERB
biotropia-2457	214	8	s	s	PROPN
biotropia-2457	214	9	,	,	PUNCT
biotropia-2457	214	10	hidayat	hidayat	PROPN
biotropia-2457	214	11	sh	sh	PROPN
biotropia-2457	214	12	,	,	PUNCT
biotropia-2457	214	13	nugroho	nugroho	PROPN
biotropia-2457	214	14	s	s	PART
biotropia-2457	214	15	,	,	PUNCT
biotropia-2457	214	16	trikoesoemaningtyas	trikoesoemaningtyas	PROPN
biotropia-2457	214	17	.	.	PUNCT
biotropia-2457	215	1	2024	2024	NUM
biotropia-2457	215	2	.	.	PUNCT
biotropia-2457	216	1	agronomic	agronomic	ADJ
biotropia-2457	216	2	variability	variability	NOUN
biotropia-2457	216	3	of	of	ADP
biotropia-2457	216	4	sorghum	sorghum	NOUN
biotropia-2457	216	5	(	(	PUNCT
biotropia-2457	216	6	sorghum	sorghum	NOUN
biotropia-2457	216	7	bicolor	bicolor	NOUN
biotropia-2457	216	8	)	)	PUNCT
biotropia-2457	216	9	genotypes	genotype	NOUN
biotropia-2457	216	10	with	with	ADP
biotropia-2457	216	11	different	different	ADJ
biotropia-2457	216	12	lignin	lignin	NOUN
biotropia-2457	216	13	content	content	NOUN
biotropia-2457	216	14	assessed	assess	VERB
biotropia-2457	216	15	for	for	ADP
biotropia-2457	216	16	biomaterial	biomaterial	ADJ
biotropia-2457	216	17	purposes	purpose	NOUN
biotropia-2457	216	18	.	.	PUNCT
biotropia-2457	217	1	sabrao	sabrao	PROPN
biotropia-2457	217	2	j	j	PROPN
biotropia-2457	217	3	breed	breed	PROPN
biotropia-2457	217	4	genet	genet	PROPN
biotropia-2457	217	5	56(4):1563–73	56(4):1563–73	PROPN
biotropia-2457	217	6	.	.	PUNCT
biotropia-2457	218	1	doi	doi	NOUN
biotropia-2457	218	2	:	:	PUNCT
biotropia-2457	218	3	10.54910/	10.54910/	NUM
biotropia-2457	218	4	sabrao2024.56.4.22	sabrao2024.56.4.22	PROPN
biotropia-2457	218	5	bogapov	bogapov	PROPN
biotropia-2457	218	6	i	i	PRON
biotropia-2457	218	7	,	,	PUNCT
biotropia-2457	218	8	memeshov	memeshov	PROPN
biotropia-2457	218	9	s	s	PROPN
biotropia-2457	218	10	,	,	PUNCT
biotropia-2457	218	11	kibalnik	kibalnik	X
biotropia-2457	218	12	o	o	NOUN
biotropia-2457	218	13	,	,	PUNCT
biotropia-2457	218	14	sagalbekov	sagalbekov	PROPN
biotropia-2457	218	15	u.	u.	PROPN
biotropia-2457	218	16	2024	2024	NUM
biotropia-2457	218	17	.	.	PUNCT
biotropia-2457	219	1	sweet	sweet	ADJ
biotropia-2457	219	2	sorghum	sorghum	NOUN
biotropia-2457	219	3	(	(	PUNCT
biotropia-2457	219	4	sorghum	sorghum	NOUN
biotropia-2457	219	5	bicolor	bicolor	NOUN
biotropia-2457	219	6	l.	l.	NOUN
biotropia-2457	219	7	)	)	PUNCT
biotropia-2457	219	8	genotypes	genotype	NOUN
biotropia-2457	219	9	assessment	assessment	NOUN
biotropia-2457	219	10	for	for	ADP
biotropia-2457	219	11	food	food	NOUN
biotropia-2457	219	12	,	,	PUNCT
biotropia-2457	219	13	fodder	fodder	NOUN
biotropia-2457	219	14	,	,	PUNCT
biotropia-2457	219	15	and	and	CCONJ
biotropia-2457	219	16	energy	energy	NOUN
biotropia-2457	219	17	values	value	NOUN
biotropia-2457	219	18	in	in	ADP
biotropia-2457	219	19	northern	northern	ADJ
biotropia-2457	219	20	kazakhstan	kazakhstan	PROPN
biotropia-2457	219	21	.	.	PUNCT
biotropia-2457	220	1	sabrao	sabrao	PROPN
biotropia-2457	220	2	j	j	PROPN
biotropia-2457	220	3	breed	breed	PROPN
biotropia-2457	220	4	genet	genet	PROPN
biotropia-2457	220	5	56(1):156–67	56(1):156–67	NUM
biotropia-2457	220	6	.	.	PUNCT
biotropia-2457	221	1	doi	doi	NOUN
biotropia-2457	221	2	:	:	PUNCT
biotropia-2457	221	3	10.54910/	10.54910/	NUM
biotropia-2457	221	4	sabrao2024.56.1.14	sabrao2024.56.1.14	PROPN
biotropia-2457	221	5	boyles	boyles	PROPN
biotropia-2457	221	6	re	re	PROPN
biotropia-2457	221	7	.	.	PROPN
biotropia-2457	221	8	2017	2017	NUM
biotropia-2457	221	9	.	.	PUNCT
biotropia-2457	222	1	genetic	genetic	ADJ
biotropia-2457	222	2	characterization	characterization	NOUN
biotropia-2457	222	3	of	of	ADP
biotropia-2457	222	4	the	the	DET
biotropia-2457	222	5	waxy	waxy	NOUN
biotropia-2457	222	6	gene	gene	NOUN
biotropia-2457	222	7	in	in	ADP
biotropia-2457	222	8	sorghum	sorghum	NOUN
biotropia-2457	222	9	and	and	CCONJ
biotropia-2457	222	10	its	its	PRON
biotropia-2457	222	11	impact	impact	NOUN
biotropia-2457	222	12	on	on	ADP
biotropia-2457	222	13	starch	starch	NOUN
biotropia-2457	222	14	properties	property	NOUN
biotropia-2457	222	15	.	.	PUNCT
biotropia-2457	223	1	crop	crop	NOUN
biotropia-2457	223	2	sci	sci	PROPN
biotropia-2457	223	3	57(5):2345–56	57(5):2345–56	NUM
biotropia-2457	223	4	.	.	PUNCT
biotropia-2457	224	1	doyle	doyle	PROPN
biotropia-2457	224	2	jj	jj	PROPN
biotropia-2457	224	3	,	,	PUNCT
biotropia-2457	224	4	doyle	doyle	PROPN
biotropia-2457	224	5	jl	jl	PROPN
biotropia-2457	224	6	.	.	PROPN
biotropia-2457	224	7	1990	1990	NUM
biotropia-2457	224	8	.	.	PUNCT
biotropia-2457	225	1	isolation	isolation	NOUN
biotropia-2457	225	2	of	of	ADP
biotropia-2457	225	3	plant	plant	NOUN
biotropia-2457	225	4	dna	dna	NOUN
biotropia-2457	225	5	from	from	ADP
biotropia-2457	225	6	fresh	fresh	ADJ
biotropia-2457	225	7	tissue	tissue	NOUN
biotropia-2457	225	8	.	.	PUNCT
biotropia-2457	226	1	focus	focus	VERB
biotropia-2457	226	2	12(1):13–5	12(1):13–5	NUM
biotropia-2457	226	3	.	.	PUNCT
biotropia-2457	227	1	falconer	falconer	NOUN
biotropia-2457	227	2	ds	ds	PROPN
biotropia-2457	227	3	,	,	PUNCT
biotropia-2457	227	4	mackay	mackay	PROPN
biotropia-2457	227	5	tfc	tfc	PROPN
biotropia-2457	227	6	.	.	PROPN
biotropia-2457	227	7	1996	1996	NUM
biotropia-2457	227	8	.	.	PUNCT
biotropia-2457	228	1	introduction	introduction	NOUN
biotropia-2457	228	2	to	to	ADP
biotropia-2457	228	3	quantitative	quantitative	ADJ
biotropia-2457	228	4	genetics	genetic	NOUN
biotropia-2457	228	5	.	.	PUNCT
biotropia-2457	229	1	4th	4th	ADJ
biotropia-2457	229	2	edition	edition	PROPN
biotropia-2457	229	3	.	.	PUNCT
biotropia-2457	230	1	harlow	harlow	PROPN
biotropia-2457	230	2	(	(	PUNCT
biotropia-2457	230	3	uk	uk	PROPN
biotropia-2457	230	4	):	):	PUNCT
biotropia-2457	230	5	longman	longman	PROPN
biotropia-2457	230	6	scientific	scientific	PROPN
biotropia-2457	230	7	&	&	CCONJ
biotropia-2457	230	8	technical	technical	PROPN
biotropia-2457	230	9	.	.	PUNCT
biotropia-2457	231	1	fu	fu	PROPN
biotropia-2457	231	2	y	y	PROPN
biotropia-2457	231	3	,	,	PUNCT
biotropia-2457	231	4	chen	chen	PROPN
biotropia-2457	231	5	s	s	PROPN
biotropia-2457	231	6	,	,	PUNCT
biotropia-2457	231	7	liu	liu	PROPN
biotropia-2457	231	8	z	z	PROPN
biotropia-2457	231	9	,	,	PUNCT
biotropia-2457	231	10	zhou	zhou	PROPN
biotropia-2457	231	11	,	,	PUNCT
biotropia-2457	231	12	x.	x.	NOUN
biotropia-2457	231	13	2019	2019	NUM
biotropia-2457	231	14	.	.	PUNCT
biotropia-2457	232	1	genetic	genetic	ADJ
biotropia-2457	232	2	basis	basis	NOUN
biotropia-2457	232	3	of	of	ADP
biotropia-2457	232	4	waxy	waxy	NOUN
biotropia-2457	232	5	gene	gene	NOUN
biotropia-2457	232	6	expression	expression	NOUN
biotropia-2457	232	7	in	in	ADP
biotropia-2457	232	8	sorghum	sorghum	NOUN
biotropia-2457	232	9	and	and	CCONJ
biotropia-2457	232	10	its	its	PRON
biotropia-2457	232	11	implications	implication	NOUN
biotropia-2457	232	12	for	for	ADP
biotropia-2457	232	13	starch	starch	NOUN
biotropia-2457	232	14	quality	quality	NOUN
biotropia-2457	232	15	improvement	improvement	NOUN
biotropia-2457	232	16	.	.	PUNCT
biotropia-2457	233	1	j	j	PROPN
biotropia-2457	233	2	agric	agric	PROPN
biotropia-2457	233	3	genet	genet	PROPN
biotropia-2457	233	4	45(3):189–202	45(3):189–202	PROPN
biotropia-2457	233	5	.	.	PUNCT
biotropia-2457	234	1	ghosh	ghosh	PROPN
biotropia-2457	234	2	p	p	PROPN
biotropia-2457	234	3	,	,	PUNCT
biotropia-2457	234	4	banerjee	banerjee	PROPN
biotropia-2457	234	5	r	r	PROPN
biotropia-2457	234	6	,	,	PUNCT
biotropia-2457	234	7	mukherjee	mukherjee	NOUN
biotropia-2457	234	8	,	,	PUNCT
biotropia-2457	234	9	s.	s.	PROPN
biotropia-2457	234	10	2021	2021	NUM
biotropia-2457	234	11	.	.	PUNCT
biotropia-2457	235	1	mendelian	mendelian	ADJ
biotropia-2457	235	2	segregation	segregation	NOUN
biotropia-2457	235	3	and	and	CCONJ
biotropia-2457	235	4	statistical	statistical	ADJ
biotropia-2457	235	5	validation	validation	NOUN
biotropia-2457	235	6	in	in	ADP
biotropia-2457	235	7	plant	plant	NOUN
biotropia-2457	235	8	genetics	genetic	NOUN
biotropia-2457	235	9	.	.	PUNCT
biotropia-2457	236	1	plant	plant	NOUN
biotropia-2457	236	2	mol	mol	ADP
biotropia-2457	236	3	biol	biol	PROPN
biotropia-2457	236	4	rep	rep	PROPN
biotropia-2457	236	5	39(1):21–33	39(1):21–33	NUM
biotropia-2457	236	6	.	.	PUNCT
biotropia-2457	237	1	hedrick	hedrick	PROPN
biotropia-2457	237	2	pw	pw	PROPN
biotropia-2457	237	3	.	.	PROPN
biotropia-2457	237	4	2019	2019	NUM
biotropia-2457	237	5	.	.	PUNCT
biotropia-2457	238	1	genetics	genetic	NOUN
biotropia-2457	238	2	of	of	ADP
biotropia-2457	238	3	populations	population	NOUN
biotropia-2457	238	4	.	.	PUNCT
biotropia-2457	239	1	5th	5th	ADJ
biotropia-2457	239	2	edition	edition	NOUN
biotropia-2457	239	3	.	.	PUNCT
biotropia-2457	240	1	sudbury	sudbury	PROPN
biotropia-2457	240	2	(	(	PUNCT
biotropia-2457	240	3	us	us	PROPN
biotropia-2457	240	4	):	):	PUNCT
biotropia-2457	240	5	jones	jones	PROPN
biotropia-2457	240	6	and	and	CCONJ
biotropia-2457	240	7	bartlett	bartlett	PROPN
biotropia-2457	240	8	learning	learning	PROPN
biotropia-2457	240	9	.	.	PUNCT
biotropia-2457	241	1	hirano	hirano	PROPN
biotropia-2457	241	2	k	k	PROPN
biotropia-2457	241	3	,	,	PUNCT
biotropia-2457	241	4	yoshida	yoshida	PROPN
biotropia-2457	241	5	h	h	PROPN
biotropia-2457	241	6	,	,	PUNCT
biotropia-2457	241	7	aya	aya	PROPN
biotropia-2457	241	8	k	k	PROPN
biotropia-2457	241	9	,	,	PUNCT
biotropia-2457	241	10	kawamura	kawamura	PROPN
biotropia-2457	241	11	m	m	PROPN
biotropia-2457	241	12	,	,	PUNCT
biotropia-2457	241	13	kojima	kojima	PROPN
biotropia-2457	241	14	m.	m.	PROPN
biotropia-2457	241	15	2018	2018	NUM
biotropia-2457	241	16	.	.	PUNCT
biotropia-2457	242	1	integrated	integrate	VERB
biotropia-2457	242	2	genetic	genetic	ADJ
biotropia-2457	242	3	and	and	CCONJ
biotropia-2457	242	4	epigenetic	epigenetic	ADJ
biotropia-2457	242	5	control	control	NOUN
biotropia-2457	242	6	of	of	ADP
biotropia-2457	242	7	starch	starch	NOUN
biotropia-2457	242	8	biosynthesis	biosynthesis	NOUN
biotropia-2457	242	9	in	in	ADP
biotropia-2457	242	10	rice	rice	NOUN
biotropia-2457	242	11	.	.	PUNCT
biotropia-2457	243	1	nat	nat	PROPN
biotropia-2457	243	2	commun	commun	PROPN
biotropia-2457	243	3	9(1):1232	9(1):1232	PROPN
biotropia-2457	243	4	.	.	PUNCT
biotropia-2457	244	1	huang	huang	PROPN
biotropia-2457	244	2	x	x	PROPN
biotropia-2457	244	3	,	,	PUNCT
biotropia-2457	244	4	kurata	kurata	PROPN
biotropia-2457	244	5	n	n	CCONJ
biotropia-2457	244	6	,	,	PUNCT
biotropia-2457	244	7	wang	wang	PROPN
biotropia-2457	244	8	zx	zx	PROPN
biotropia-2457	244	9	,	,	PUNCT
biotropia-2457	244	10	wang	wang	PROPN
biotropia-2457	244	11	a	a	PROPN
biotropia-2457	244	12	,	,	PUNCT
biotropia-2457	244	13	zhao	zhao	PROPN
biotropia-2457	244	14	q	q	X
biotropia-2457	244	15	,	,	PUNCT
biotropia-2457	244	16	zhao	zhao	PROPN
biotropia-2457	244	17	y	y	PROPN
biotropia-2457	244	18	,	,	PUNCT
biotropia-2457	244	19	...	...	PUNCT
biotropia-2457	244	20	,	,	PUNCT
biotropia-2457	244	21	han	han	PROPN
biotropia-2457	244	22	b.	b.	PROPN
biotropia-2457	244	23	2020	2020	NUM
biotropia-2457	244	24	.	.	PUNCT
biotropia-2457	245	1	a	a	DET
biotropia-2457	245	2	map	map	NOUN
biotropia-2457	245	3	of	of	ADP
biotropia-2457	245	4	rice	rice	NOUN
biotropia-2457	245	5	genome	genome	NOUN
biotropia-2457	245	6	variation	variation	NOUN
biotropia-2457	245	7	reveals	reveal	VERB
biotropia-2457	245	8	the	the	DET
biotropia-2457	245	9	origin	origin	NOUN
biotropia-2457	245	10	of	of	ADP
biotropia-2457	245	11	cultivated	cultivate	VERB
biotropia-2457	245	12	rice	rice	NOUN
biotropia-2457	245	13	.	.	PUNCT
biotropia-2457	246	1	nature	nature	NOUN
biotropia-2457	246	2	,	,	PUNCT
biotropia-2457	246	3	490(7421):497–501	490(7421):497–501	NUM
biotropia-2457	246	4	.	.	PUNCT
biotropia-2457	247	1	doi	doi	NOUN
biotropia-2457	247	2	:	:	PUNCT
biotropia-2457	247	3	10.1038	10.1038	NUM
biotropia-2457	247	4	/	/	SYM
biotropia-2457	247	5	nature11532	nature11532	PROPN
biotropia-2457	247	6	lestari	lestari	PROPN
biotropia-2457	247	7	eg	eg	PROPN
biotropia-2457	247	8	,	,	PUNCT
biotropia-2457	247	9	syahruddin	syahruddin	ADJ
biotropia-2457	247	10	k	k	NOUN
biotropia-2457	247	11	,	,	PUNCT
biotropia-2457	247	12	anshori	anshori	PROPN
biotropia-2457	247	13	mf	mf	NOUN
biotropia-2457	247	14	,	,	PUNCT
biotropia-2457	247	15	taufany	taufany	NOUN
biotropia-2457	247	16	f	f	PROPN
biotropia-2457	247	17	,	,	PUNCT
biotropia-2457	247	18	sarno	sarno	PROPN
biotropia-2457	247	19	r	r	PROPN
biotropia-2457	247	20	,	,	PUNCT
biotropia-2457	247	21	larekeng	larekeng	NOUN
biotropia-2457	247	22	sh	sh	PROPN
biotropia-2457	247	23	,	,	PUNCT
biotropia-2457	247	24	...	...	PUNCT
biotropia-2457	247	25	,	,	PUNCT
biotropia-2457	247	26	sholiq	sholiq	ADJ
biotropia-2457	247	27	.	.	PUNCT
biotropia-2457	248	1	2024	2024	NUM
biotropia-2457	248	2	.	.	PUNCT
biotropia-2457	249	1	assessment	assessment	NOUN
biotropia-2457	249	2	of	of	ADP
biotropia-2457	249	3	genetic	genetic	ADJ
biotropia-2457	249	4	parameters	parameter	NOUN
biotropia-2457	249	5	in	in	ADP
biotropia-2457	249	6	segregating	segregating	ADJ
biotropia-2457	249	7	populations	population	NOUN
biotropia-2457	249	8	of	of	ADP
biotropia-2457	249	9	sorghum	sorghum	NOUN
biotropia-2457	249	10	(	(	PUNCT
biotropia-2457	249	11	sorghum	sorghum	NOUN
biotropia-2457	249	12	bicolor	bicolor	NOUN
biotropia-2457	249	13	l.	l.	PROPN
biotropia-2457	249	14	)	)	PUNCT
biotropia-2457	249	15	.	.	PUNCT
biotropia-2457	250	1	sabrao	sabrao	PROPN
biotropia-2457	250	2	j	j	PROPN
biotropia-2457	250	3	breed	breed	PROPN
biotropia-2457	250	4	genet	genet	PROPN
biotropia-2457	250	5	56(5):1778	56(5):1778	NUM
biotropia-2457	250	6	–	–	PUNCT
biotropia-2457	250	7	89	89	NUM
biotropia-2457	250	8	.	.	PUNCT
biotropia-2457	251	1	doi	doi	NOUN
biotropia-2457	251	2	:	:	PUNCT
biotropia-2457	251	3	10.54910	10.54910	NUM
biotropia-2457	251	4	/	/	SYM
biotropia-2457	251	5	sabrao2024.56.5.3	sabrao2024.56.5.3	PROPN
biotropia-2457	251	6	lu	lu	NOUN
biotropia-2457	251	7	h	h	NOUN
biotropia-2457	251	8	,	,	PUNCT
biotropia-2457	251	9	zhang	zhang	PROPN
biotropia-2457	251	10	j	j	PROPN
biotropia-2457	251	11	,	,	PUNCT
biotropia-2457	251	12	li	li	PROPN
biotropia-2457	251	13	s	s	PROPN
biotropia-2457	251	14	,	,	PUNCT
biotropia-2457	251	15	wei	wei	PROPN
biotropia-2457	251	16	c.	c.	PROPN
biotropia-2457	251	17	2022	2022	PROPN
biotropia-2457	251	18	.	.	PUNCT
biotropia-2457	252	1	advances	advance	NOUN
biotropia-2457	252	2	in	in	ADP
biotropia-2457	252	3	waxy	waxy	NOUN
biotropia-2457	252	4	sorghum	sorghum	NOUN
biotropia-2457	252	5	breeding	breeding	NOUN
biotropia-2457	252	6	and	and	CCONJ
biotropia-2457	252	7	its	its	PRON
biotropia-2457	252	8	applications	application	NOUN
biotropia-2457	252	9	in	in	ADP
biotropia-2457	252	10	food	food	NOUN
biotropia-2457	252	11	industry	industry	NOUN
biotropia-2457	252	12	.	.	PUNCT
biotropia-2457	253	1	food	food	NOUN
biotropia-2457	253	2	chem	chem	NOUN
biotropia-2457	253	3	381:132234	381:132234	PROPN
biotropia-2457	253	4	.	.	PUNCT
biotropia-2457	254	1	doi	doi	NOUN
biotropia-2457	254	2	:	:	PUNCT
biotropia-2457	254	3	10.1016	10.1016	NUM
biotropia-2457	254	4	/	/	SYM
biotropia-2457	254	5	j.foodchem.2022.132234	j.foodchem.2022.132234	PROPN
biotropia-2457	254	6	maung	maung	PROPN
biotropia-2457	254	7	tz	tz	PROPN
biotropia-2457	254	8	,	,	PUNCT
biotropia-2457	254	9	yoo	yoo	PROPN
biotropia-2457	254	10	j	j	PROPN
biotropia-2457	254	11	-	-	PROPN
biotropia-2457	254	12	m	m	PROPN
biotropia-2457	254	13	,	,	PUNCT
biotropia-2457	254	14	chu	chu	PROPN
biotropia-2457	254	15	s	s	PROPN
biotropia-2457	254	16	-	-	PUNCT
biotropia-2457	254	17	h	h	NOUN
biotropia-2457	254	18	,	,	PUNCT
biotropia-2457	254	19	kim	kim	PROPN
biotropia-2457	254	20	k	k	PROPN
biotropia-2457	254	21	-	-	PUNCT
biotropia-2457	254	22	w	w	PROPN
biotropia-2457	254	23	,	,	PUNCT
biotropia-2457	254	24	chung	chung	PROPN
biotropia-2457	255	1	i	i	PROPN
biotropia-2457	255	2	-	-	PUNCT
biotropia-2457	255	3	m	m	PROPN
biotropia-2457	255	4	,	,	PUNCT
biotropia-2457	255	5	park	park	PROPN
biotropia-2457	255	6	y	y	PROPN
biotropia-2457	255	7	-	-	PUNCT
biotropia-2457	255	8	j.	j.	PROPN
biotropia-2457	255	9	2021	2021	NUM
biotropia-2457	255	10	.	.	PUNCT
biotropia-2457	256	1	haplotype	haplotype	NOUN
biotropia-2457	256	2	variations	variation	NOUN
biotropia-2457	256	3	and	and	CCONJ
biotropia-2457	256	4	evolutionary	evolutionary	ADJ
biotropia-2457	256	5	analysis	analysis	NOUN
biotropia-2457	256	6	of	of	ADP
biotropia-2457	256	7	the	the	DET
biotropia-2457	256	8	granule	granule	NOUN
biotropia-2457	256	9	-	-	PUNCT
biotropia-2457	256	10	bound	bind	VERB
biotropia-2457	256	11	starch	starch	NOUN
biotropia-2457	256	12	synthase	synthase	NOUN
biotropia-2457	256	13	i	i	PRON
biotropia-2457	256	14	gene	gene	VERB
biotropia-2457	256	15	in	in	ADP
biotropia-2457	256	16	the	the	DET
biotropia-2457	256	17	korean	korean	ADJ
biotropia-2457	256	18	world	world	PROPN
biotropia-2457	256	19	rice	rice	NOUN
biotropia-2457	256	20	collection	collection	NOUN
biotropia-2457	256	21	.	.	PUNCT
biotropia-2457	257	1	front	front	ADJ
biotropia-2457	257	2	plant	plant	NOUN
biotropia-2457	258	1	sci	sci	PROPN
biotropia-2457	258	2	12:707237	12:707237	PROPN
biotropia-2457	258	3	.	.	PUNCT
biotropia-2457	258	4	doi	doi	NOUN
biotropia-2457	258	5	:	:	PUNCT
biotropia-2457	258	6	10.3389	10.3389	NUM
biotropia-2457	258	7	/	/	SYM
biotropia-2457	258	8	fpls.2021.707237	fpls.2021.707237	PROPN
biotropia-2457	258	9	mcdonald	mcdonald	PROPN
biotropia-2457	258	10	jh	jh	PROPN
biotropia-2457	258	11	.	.	PUNCT
biotropia-2457	259	1	2014	2014	NUM
biotropia-2457	259	2	.	.	PUNCT
biotropia-2457	260	1	handbook	handbook	NOUN
biotropia-2457	260	2	of	of	ADP
biotropia-2457	260	3	biological	biological	ADJ
biotropia-2457	260	4	statistics	statistic	NOUN
biotropia-2457	260	5	.	.	PUNCT
biotropia-2457	261	1	3rd	3rd	PROPN
biotropia-2457	261	2	edition	edition	NOUN
biotropia-2457	261	3	.	.	PUNCT
biotropia-2457	262	1	baltimore	baltimore	PROPN
biotropia-2457	262	2	(	(	PUNCT
biotropia-2457	262	3	us	us	PROPN
biotropia-2457	262	4	):	):	PUNCT
biotropia-2457	262	5	sparky	sparky	PROPN
biotropia-2457	262	6	house	house	PROPN
biotropia-2457	262	7	publishing	publishing	NOUN
biotropia-2457	262	8	.	.	PUNCT
biotropia-2457	263	1	munarti	munarti	PROPN
biotropia-2457	263	2	,	,	PUNCT
biotropia-2457	263	3	wirnas	wirnas	PROPN
biotropia-2457	263	4	d	d	PROPN
biotropia-2457	263	5	,	,	PUNCT
biotropia-2457	263	6	trikoesoemaningtyas	trikoesoemaningtyas	PROPN
biotropia-2457	263	7	,	,	PUNCT
biotropia-2457	263	8	sobir	sobir	NOUN
biotropia-2457	263	9	,	,	PUNCT
biotropia-2457	263	10	syukur	syukur	PROPN
biotropia-2457	263	11	m	m	PROPN
biotropia-2457	263	12	,	,	PUNCT
biotropia-2457	263	13	sopandie	sopandie	PROPN
biotropia-2457	263	14	d.	d.	PROPN
biotropia-2457	263	15	2022	2022	NUM
biotropia-2457	263	16	.	.	PUNCT
biotropia-2457	264	1	stay	stay	VERB
biotropia-2457	264	2	green	green	ADJ
biotropia-2457	264	3	genes	gene	NOUN
biotropia-2457	264	4	fragment	fragment	NOUN
biotropia-2457	264	5	homology	homology	NOUN
biotropia-2457	264	6	analysis	analysis	NOUN
biotropia-2457	264	7	of	of	ADP
biotropia-2457	264	8	indonesian	indonesian	ADJ
biotropia-2457	264	9	sorghum	sorghum	NOUN
biotropia-2457	264	10	.	.	PUNCT
biotropia-2457	265	1	sabrao	sabrao	PROPN
biotropia-2457	265	2	j	j	PROPN
biotropia-2457	265	3	breed	breed	PROPN
biotropia-2457	265	4	genet	genet	PROPN
biotropia-2457	265	5	54(4):742–54	54(4):742–54	NUM
biotropia-2457	265	6	.	.	PUNCT
biotropia-2457	266	1	doi	doi	NOUN
biotropia-2457	266	2	:	:	PUNCT
biotropia-2457	266	3	10.54910	10.54910	NUM
biotropia-2457	266	4	/	/	SYM
biotropia-2457	266	5	sabrao2022.54.4.6	sabrao2022.54.4.6	ADJ
biotropia-2457	266	6	mutisya	mutisya	NOUN
biotropia-2457	266	7	j	j	PROPN
biotropia-2457	266	8	,	,	PUNCT
biotropia-2457	266	9	mugo	mugo	PROPN
biotropia-2457	266	10	c	c	AUX
biotropia-2457	266	11	,	,	PUNCT
biotropia-2457	266	12	odeny	odeny	VERB
biotropia-2457	266	13	d.	d.	PROPN
biotropia-2457	266	14	2023	2023	NUM
biotropia-2457	266	15	.	.	PUNCT
biotropia-2457	267	1	the	the	DET
biotropia-2457	267	2	waxy	waxy	NOUN
biotropia-2457	267	3	mutation	mutation	NOUN
biotropia-2457	267	4	in	in	ADP
biotropia-2457	267	5	sorghum	sorghum	NOUN
biotropia-2457	267	6	and	and	CCONJ
biotropia-2457	267	7	other	other	ADJ
biotropia-2457	267	8	cereal	cereal	NOUN
biotropia-2457	267	9	grains	grain	NOUN
biotropia-2457	267	10	reshapes	reshape	VERB
biotropia-2457	267	11	the	the	DET
biotropia-2457	267	12	starch	starch	NOUN
biotropia-2457	267	13	biosynthesis	biosynthesis	NOUN
biotropia-2457	267	14	pathway	pathway	NOUN
biotropia-2457	267	15	.	.	PUNCT
biotropia-2457	268	1	front	front	ADJ
biotropia-2457	268	2	plant	plant	NOUN
biotropia-2457	268	3	sci	sci	PROPN
biotropia-2457	268	4	14:1123	14:1123	PROPN
biotropia-2457	268	5	.	.	PUNCT
biotropia-2457	269	1	doi	doi	NOUN
biotropia-2457	269	2	:	:	PUNCT
biotropia-2457	269	3	10.3389	10.3389	NUM
biotropia-2457	269	4	/	/	SYM
biotropia-2457	269	5	fpls.2023.01123	fpls.2023.01123	PROPN
biotropia-2457	269	6	paterson	paterson	NOUN
biotropia-2457	269	7	ah	ah	INTJ
biotropia-2457	269	8	,	,	PUNCT
biotropia-2457	269	9	kong	kong	PROPN
biotropia-2457	269	10	w	w	PROPN
biotropia-2457	269	11	,	,	PUNCT
biotropia-2457	269	12	mullet	mullet	PROPN
biotropia-2457	269	13	je	je	PROPN
biotropia-2457	269	14	.	.	PROPN
biotropia-2457	269	15	2009	2009	NUM
biotropia-2457	269	16	.	.	PUNCT
biotropia-2457	270	1	comparative	comparative	ADJ
biotropia-2457	270	2	genomics	genomic	NOUN
biotropia-2457	270	3	of	of	ADP
biotropia-2457	270	4	sorghum	sorghum	NOUN
biotropia-2457	270	5	and	and	CCONJ
biotropia-2457	270	6	other	other	ADJ
biotropia-2457	270	7	grasses	grass	NOUN
biotropia-2457	270	8	.	.	PUNCT
biotropia-2457	271	1	plant	plant	NOUN
biotropia-2457	271	2	physiol	physiol	PROPN
biotropia-2457	271	3	149(3):112–17	149(3):112–17	PROPN
biotropia-2457	271	4	.	.	PUNCT
biotropia-2457	272	1	pedersen	pedersen	PROPN
biotropia-2457	272	2	jf	jf	PROPN
biotropia-2457	272	3	,	,	PUNCT
biotropia-2457	272	4	graybosch	graybosch	PROPN
biotropia-2457	272	5	ra	ra	PROPN
biotropia-2457	272	6	,	,	PUNCT
biotropia-2457	272	7	funnell	funnell	PROPN
biotropia-2457	272	8	dl	dl	PROPN
biotropia-2457	272	9	.	.	PROPN
biotropia-2457	272	10	2007	2007	NUM
biotropia-2457	272	11	.	.	PUNCT
biotropia-2457	273	1	occurrence	occurrence	NOUN
biotropia-2457	273	2	of	of	ADP
biotropia-2457	273	3	the	the	DET
biotropia-2457	273	4	waxy	waxy	NOUN
biotropia-2457	273	5	alleles	allele	NOUN
biotropia-2457	273	6	wx	wx	PROPN
biotropia-2457	273	7	a	a	PROPN
biotropia-2457	273	8	and	and	CCONJ
biotropia-2457	273	9	wx	wx	PROPN
biotropia-2457	273	10	b	b	PROPN
biotropia-2457	273	11	in	in	ADP
biotropia-2457	273	12	waxy	waxy	NOUN
biotropia-2457	273	13	sorghum	sorghum	NOUN
biotropia-2457	273	14	plant	plant	NOUN
biotropia-2457	273	15	introductions	introduction	NOUN
biotropia-2457	273	16	and	and	CCONJ
biotropia-2457	273	17	their	their	PRON
biotropia-2457	273	18	effect	effect	NOUN
biotropia-2457	273	19	on	on	ADP
biotropia-2457	273	20	starch	starch	NOUN
biotropia-2457	273	21	thermal	thermal	ADJ
biotropia-2457	273	22	properties	property	NOUN
biotropia-2457	273	23	.	.	PUNCT
biotropia-2457	274	1	crop	crop	NOUN
biotropia-2457	274	2	sci	sci	PROPN
biotropia-2457	274	3	47(5):1927–33	47(5):1927–33	PROPN
biotropia-2457	274	4	.	.	PUNCT
biotropia-2457	275	1	rodgers	rodgers	PROPN
biotropia-2457	275	2	jl	jl	PROPN
biotropia-2457	275	3	,	,	PUNCT
biotropia-2457	275	4	nicewander	nicewander	PROPN
biotropia-2457	275	5	wa	wa	PROPN
biotropia-2457	275	6	.	.	PROPN
biotropia-2457	275	7	1988	1988	NUM
biotropia-2457	275	8	.	.	PUNCT
biotropia-2457	276	1	thirteen	thirteen	NUM
biotropia-2457	276	2	ways	way	NOUN
biotropia-2457	276	3	to	to	PART
biotropia-2457	276	4	look	look	VERB
biotropia-2457	276	5	at	at	ADP
biotropia-2457	276	6	the	the	DET
biotropia-2457	276	7	correlation	correlation	NOUN
biotropia-2457	276	8	coefficient	coefficient	NOUN
biotropia-2457	276	9	.	.	PUNCT
biotropia-2457	276	10	am	be	AUX
biotropia-2457	276	11	stat	stat	PROPN
biotropia-2457	276	12	42(1):59–66	42(1):59–66	NUM
biotropia-2457	276	13	.	.	PUNCT
biotropia-2457	277	1	shin	shin	PROPN
biotropia-2457	277	2	s	s	PROPN
biotropia-2457	277	3	,	,	PUNCT
biotropia-2457	277	4	choi	choi	NOUN
biotropia-2457	277	5	h	h	PROPN
biotropia-2457	277	6	,	,	PUNCT
biotropia-2457	277	7	yang	yang	PROPN
biotropia-2457	277	8	z	z	PROPN
biotropia-2457	277	9	,	,	PUNCT
biotropia-2457	277	10	park	park	NOUN
biotropia-2457	277	11	j.	j.	PROPN
biotropia-2457	277	12	2015	2015	NUM
biotropia-2457	277	13	.	.	PUNCT
biotropia-2457	278	1	development	development	NOUN
biotropia-2457	278	2	of	of	ADP
biotropia-2457	278	3	a	a	DET
biotropia-2457	278	4	waxy	waxy	NOUN
biotropia-2457	278	5	gene	gene	NOUN
biotropia-2457	278	6	real	real	ADJ
biotropia-2457	278	7	-	-	PUNCT
biotropia-2457	278	8	time	time	NOUN
biotropia-2457	278	9	pcr	pcr	NOUN
biotropia-2457	278	10	assay	assay	NOUN
biotropia-2457	278	11	for	for	ADP
biotropia-2457	278	12	the	the	DET
biotropia-2457	278	13	quantification	quantification	NOUN
biotropia-2457	278	14	of	of	ADP
biotropia-2457	278	15	sorghum	sorghum	NOUN
biotropia-2457	278	16	waxy	waxy	NOUN
biotropia-2457	278	17	grain	grain	NOUN
biotropia-2457	278	18	in	in	ADP
biotropia-2457	278	19	mixed	mixed	ADJ
biotropia-2457	278	20	cereal	cereal	NOUN
biotropia-2457	278	21	products	product	NOUN
biotropia-2457	278	22	.	.	PUNCT
biotropia-2457	279	1	bmc	bmc	ADJ
biotropia-2457	279	2	biotechnol	biotechnol	NOUN
biotropia-2457	279	3	15:109	15:109	NUM
biotropia-2457	279	4	.	.	PUNCT
biotropia-2457	280	1	teng	teng	PROPN
biotropia-2457	280	2	b	b	PROPN
biotropia-2457	280	3	,	,	PUNCT
biotropia-2457	280	4	zhai	zhai	PROPN
biotropia-2457	280	5	h	h	PROPN
biotropia-2457	280	6	,	,	PUNCT
biotropia-2457	280	7	wang	wang	PROPN
biotropia-2457	280	8	w	w	PROPN
biotropia-2457	280	9	,	,	PUNCT
biotropia-2457	280	10	zhang	zhang	PROPN
biotropia-2457	280	11	z	z	PROPN
biotropia-2457	280	12	,	,	PUNCT
biotropia-2457	280	13	he	he	PRON
biotropia-2457	280	14	y.	y.	PROPN
biotropia-2457	280	15	2012	2012	NUM
biotropia-2457	280	16	.	.	PUNCT
biotropia-2457	281	1	detection	detection	NOUN
biotropia-2457	281	2	of	of	ADP
biotropia-2457	281	3	allelic	allelic	ADJ
biotropia-2457	281	4	variation	variation	NOUN
biotropia-2457	281	5	at	at	ADP
biotropia-2457	281	6	the	the	DET
biotropia-2457	281	7	waxy	waxy	NOUN
biotropia-2457	281	8	locus	locus	NOUN
biotropia-2457	281	9	in	in	ADP
biotropia-2457	281	10	rice	rice	NOUN
biotropia-2457	281	11	cultivars	cultivar	NOUN
biotropia-2457	281	12	using	use	VERB
biotropia-2457	281	13	single	single	ADJ
biotropia-2457	281	14	-	-	PUNCT
biotropia-2457	281	15	segment	segment	NOUN
biotropia-2457	281	16	substitution	substitution	NOUN
biotropia-2457	281	17	lines	line	NOUN
biotropia-2457	281	18	.	.	PUNCT
biotropia-2457	282	1	euphytica	euphytica	PROPN
biotropia-2457	282	2	185(3):377	185(3):377	NUM
biotropia-2457	282	3	–	–	PUNCT
biotropia-2457	282	4	84	84	NUM
biotropia-2457	282	5	.	.	PUNCT
biotropia-2457	283	1	tian	tian	PROPN
biotropia-2457	283	2	f	f	PROPN
biotropia-2457	283	3	,	,	PUNCT
biotropia-2457	283	4	bradbury	bradbury	PROPN
biotropia-2457	283	5	pj	pj	PROPN
biotropia-2457	283	6	,	,	PUNCT
biotropia-2457	283	7	brown	brown	PROPN
biotropia-2457	283	8	pj	pj	PROPN
biotropia-2457	283	9	,	,	PUNCT
biotropia-2457	283	10	hung	hung	PROPN
biotropia-2457	283	11	h	h	NOUN
biotropia-2457	283	12	,	,	PUNCT
biotropia-2457	283	13	sun	sun	PROPN
biotropia-2457	283	14	q	q	NOUN
biotropia-2457	283	15	,	,	PUNCT
biotropia-2457	283	16	flint	flint	NOUN
biotropia-2457	283	17	-	-	PUNCT
biotropia-2457	283	18	garcia	garcia	PROPN
biotropia-2457	283	19	s	s	PART
biotropia-2457	283	20	,	,	PUNCT
biotropia-2457	283	21	...	...	PUNCT
biotropia-2457	283	22	,	,	PUNCT
biotropia-2457	283	23	buckler	buckler	NOUN
biotropia-2457	283	24	es	es	NOUN
biotropia-2457	283	25	.	.	PROPN
biotropia-2457	283	26	2011	2011	NUM
biotropia-2457	283	27	.	.	PUNCT
biotropia-2457	284	1	genome	genome	NOUN
biotropia-2457	284	2	-	-	PUNCT
biotropia-2457	284	3	wide	wide	ADJ
biotropia-2457	284	4	association	association	NOUN
biotropia-2457	284	5	study	study	NOUN
biotropia-2457	284	6	of	of	ADP
biotropia-2457	284	7	leaf	leaf	NOUN
biotropia-2457	284	8	architecture	architecture	NOUN
biotropia-2457	284	9	in	in	ADP
biotropia-2457	284	10	maize	maize	NOUN
biotropia-2457	284	11	.	.	PUNCT
biotropia-2457	285	1	nat	nat	PROPN
biotropia-2457	285	2	genet	genet	PROPN
biotropia-2457	285	3	43(2):159–62	43(2):159–62	PROPN
biotropia-2457	285	4	.	.	PUNCT
biotropia-2457	286	1	doi	doi	NOUN
biotropia-2457	286	2	:	:	PUNCT
biotropia-2457	286	3	10.1038	10.1038	NUM
biotropia-2457	286	4	/	/	SYM
biotropia-2457	286	5	ng.746	ng.746	PROPN
biotropia-2457	286	6	tian	tian	ADJ
biotropia-2457	286	7	x	x	X
biotropia-2457	286	8	,	,	PUNCT
biotropia-2457	286	9	qiu	qiu	PROPN
biotropia-2457	286	10	y	y	PROPN
biotropia-2457	286	11	,	,	PUNCT
biotropia-2457	286	12	li	li	PROPN
biotropia-2457	286	13	x	x	PROPN
biotropia-2457	286	14	,	,	PUNCT
biotropia-2457	286	15	liu	liu	PROPN
biotropia-2457	286	16	c.	c.	PROPN
biotropia-2457	286	17	2023	2023	NUM
biotropia-2457	286	18	.	.	PUNCT
biotropia-2457	287	1	starch	starch	NOUN
biotropia-2457	287	2	properties	property	NOUN
biotropia-2457	287	3	and	and	CCONJ
biotropia-2457	287	4	applications	application	NOUN
biotropia-2457	287	5	of	of	ADP
biotropia-2457	287	6	waxy	waxy	NOUN
biotropia-2457	287	7	sorghum	sorghum	NOUN
biotropia-2457	287	8	in	in	ADP
biotropia-2457	287	9	functional	functional	ADJ
biotropia-2457	287	10	foods	food	NOUN
biotropia-2457	287	11	:	:	PUNCT
biotropia-2457	287	12	a	a	DET
biotropia-2457	287	13	review	review	NOUN
biotropia-2457	287	14	.	.	PUNCT
biotropia-2457	288	1	j	j	PROPN
biotropia-2457	288	2	cereal	cereal	PROPN
biotropia-2457	288	3	sci	sci	PROPN
biotropia-2457	288	4	110:103639	110:103639	PROPN
biotropia-2457	288	5	.	.	PUNCT
biotropia-2457	289	1	doi	doi	NOUN
biotropia-2457	289	2	:	:	PUNCT
biotropia-2457	289	3	10.1016	10.1016	NUM
biotropia-2457	289	4	/	/	SYM
biotropia-2457	289	5	j.	j.	PROPN
biotropia-2457	289	6	jcs.2023.103639	jcs.2023.103639	PROPN
biotropia-2457	289	7	tian	tian	PROPN
biotropia-2457	290	1	z	z	PROPN
biotropia-2457	290	2	,	,	PUNCT
biotropia-2457	290	3	qian	qian	PROPN
biotropia-2457	290	4	q	q	PROPN
biotropia-2457	290	5	,	,	PUNCT
biotropia-2457	290	6	liu	liu	PROPN
biotropia-2457	290	7	q	q	PROPN
biotropia-2457	290	8	,	,	PUNCT
biotropia-2457	290	9	yan	yan	PROPN
biotropia-2457	290	10	m	m	PROPN
biotropia-2457	290	11	,	,	PUNCT
biotropia-2457	290	12	liu	liu	PROPN
biotropia-2457	290	13	x	x	PROPN
biotropia-2457	290	14	,	,	PUNCT
biotropia-2457	290	15	yan	yan	PROPN
biotropia-2457	290	16	c	c	X
biotropia-2457	290	17	,	,	PUNCT
biotropia-2457	290	18	…	…	PUNCT
biotropia-2457	290	19	,	,	PUNCT
biotropia-2457	290	20	li	li	PROPN
biotropia-2457	290	21	j.	j.	PROPN
biotropia-2457	290	22	2009	2009	PROPN
biotropia-2457	290	23	.	.	PUNCT
biotropia-2457	291	1	allelic	allelic	ADJ
biotropia-2457	291	2	diversities	diversity	NOUN
biotropia-2457	291	3	in	in	ADP
biotropia-2457	291	4	rice	rice	NOUN
biotropia-2457	291	5	starch	starch	NOUN
biotropia-2457	291	6	biosynthesis	biosynthesis	NOUN
biotropia-2457	291	7	lead	lead	VERB
biotropia-2457	291	8	to	to	ADP
biotropia-2457	291	9	a	a	DET
biotropia-2457	291	10	diverse	diverse	ADJ
biotropia-2457	291	11	array	array	NOUN
biotropia-2457	291	12	of	of	ADP
biotropia-2457	291	13	rice	rice	NOUN
biotropia-2457	291	14	eating	eat	VERB
biotropia-2457	291	15	and	and	CCONJ
biotropia-2457	291	16	cooking	cook	VERB
biotropia-2457	291	17	qualities	quality	NOUN
biotropia-2457	291	18	.	.	PUNCT
biotropia-2457	292	1	proc	proc	PROPN
biotropia-2457	292	2	natl	natl	PROPN
biotropia-2457	292	3	acad	acad	PROPN
biotropia-2457	292	4	sci	sci	PROPN
biotropia-2457	292	5	usa	usa	PROPN
biotropia-2457	292	6	106(51):21760–765	106(51):21760–765	PROPN
biotropia-2457	292	7	.	.	PUNCT
biotropia-2457	293	1	doi	doi	PROPN
biotropia-2457	293	2	:	:	PUNCT
biotropia-2457	293	3	10.1073/	10.1073/	NUM
biotropia-2457	293	4	pnas.0912396106	pnas.0912396106	PROPN
biotropia-2457	293	5	.	.	PUNCT
biotropia-2457	294	1	trikoesoemaningtyas	trikoesoemaningtyas	PROPN
biotropia-2457	294	2	,	,	PUNCT
biotropia-2457	294	3	fadilah	fadilah	PROPN
biotropia-2457	294	4	ar	ar	PROPN
biotropia-2457	294	5	,	,	PUNCT
biotropia-2457	294	6	burnama	burnama	PROPN
biotropia-2457	294	7	pw	pw	PROPN
biotropia-2457	294	8	,	,	PUNCT
biotropia-2457	294	9	rahayu	rahayu	PROPN
biotropia-2457	294	10	f	f	PROPN
biotropia-2457	294	11	,	,	PUNCT
biotropia-2457	294	12	rachman	rachman	NOUN
biotropia-2457	294	13	f	f	NOUN
biotropia-2457	294	14	,	,	PUNCT
biotropia-2457	294	15	hariyadi	hariyadi	NOUN
biotropia-2457	294	16	,	,	PUNCT
biotropia-2457	294	17	...	...	PUNCT
biotropia-2457	294	18	,	,	PUNCT
biotropia-2457	294	19	wirnas	wirnas	PROPN
biotropia-2457	294	20	d.	d.	PROPN
biotropia-2457	294	21	2024	2024	NUM
biotropia-2457	294	22	.	.	PUNCT
biotropia-2457	295	1	genetic	genetic	ADJ
biotropia-2457	295	2	variations	variation	NOUN
biotropia-2457	295	3	in	in	ADP
biotropia-2457	295	4	sorghum	sorghum	NOUN
biotropia-2457	295	5	segregating	segregate	VERB
biotropia-2457	295	6	populations	population	NOUN
biotropia-2457	295	7	based	base	VERB
biotropia-2457	295	8	on	on	ADP
biotropia-2457	295	9	yield	yield	NOUN
biotropia-2457	295	10	and	and	CCONJ
biotropia-2457	295	11	amylose	amylose	ADJ
biotropia-2457	295	12	content	content	NOUN
biotropia-2457	295	13	.	.	PUNCT
biotropia-2457	296	1	sabrao	sabrao	PROPN
biotropia-2457	296	2	j	j	PROPN
biotropia-2457	296	3	breed	breed	PROPN
biotropia-2457	296	4	genet	genet	PROPN
biotropia-2457	296	5	56(4):1357–66	56(4):1357–66	PROPN
biotropia-2457	296	6	.	.	PUNCT
biotropia-2457	297	1	doi	doi	NOUN
biotropia-2457	297	2	:	:	PUNCT
biotropia-2457	297	3	10.54910	10.54910	NUM
biotropia-2457	297	4	/	/	SYM
biotropia-2457	297	5	sabrao2024.56.4.3	sabrao2024.56.4.3	PROPN
biotropia-2457	297	6	wang	wang	PROPN
biotropia-2457	297	7	x	x	PROPN
biotropia-2457	297	8	,	,	PUNCT
biotropia-2457	297	9	li	li	PROPN
biotropia-2457	297	10	y	y	PROPN
biotropia-2457	297	11	,	,	PUNCT
biotropia-2457	297	12	zhang	zhang	PROPN
biotropia-2457	297	13	c	c	PROPN
biotropia-2457	297	14	,	,	PUNCT
biotropia-2457	297	15	liu	liu	PROPN
biotropia-2457	297	16	q.	q.	PROPN
biotropia-2457	297	17	2020	2020	NUM
biotropia-2457	297	18	.	.	PUNCT
biotropia-2457	298	1	genetic	genetic	ADJ
biotropia-2457	298	2	regulation	regulation	NOUN
biotropia-2457	298	3	of	of	ADP
biotropia-2457	298	4	waxy	waxy	NOUN
biotropia-2457	298	5	gene	gene	NOUN
biotropia-2457	298	6	alleles	allele	NOUN
biotropia-2457	298	7	in	in	ADP
biotropia-2457	298	8	cereal	cereal	NOUN
biotropia-2457	298	9	crops	crop	NOUN
biotropia-2457	298	10	.	.	PUNCT
biotropia-2457	299	1	mgg	mgg	PROPN
biotropia-2457	299	2	295(4):899–910	295(4):899–910	PROPN
biotropia-2457	299	3	.	.	PUNCT
biotropia-2457	300	1	wang	wang	PROPN
biotropia-2457	300	2	x	x	PROPN
biotropia-2457	300	3	,	,	PUNCT
biotropia-2457	300	4	li	li	PROPN
biotropia-2457	300	5	y	y	PROPN
biotropia-2457	300	6	,	,	PUNCT
biotropia-2457	300	7	zhang	zhang	PROPN
biotropia-2457	300	8	c	c	PROPN
biotropia-2457	300	9	,	,	PUNCT
biotropia-2457	300	10	liu	liu	PROPN
biotropia-2457	300	11	q.	q.	PROPN
biotropia-2457	300	12	2022	2022	NUM
biotropia-2457	300	13	.	.	PUNCT
biotropia-2457	301	1	dominance	dominance	NOUN
biotropia-2457	301	2	and	and	CCONJ
biotropia-2457	301	3	epistatic	epistatic	ADJ
biotropia-2457	301	4	effects	effect	NOUN
biotropia-2457	301	5	of	of	ADP
biotropia-2457	301	6	waxy	waxy	NOUN
biotropia-2457	301	7	gene	gene	NOUN
biotropia-2457	301	8	alleles	allele	NOUN
biotropia-2457	301	9	in	in	ADP
biotropia-2457	301	10	cereal	cereal	NOUN
biotropia-2457	301	11	crops	crop	NOUN
biotropia-2457	301	12	.	.	PUNCT
biotropia-2457	302	1	mgg	mgg	PROPN
biotropia-2457	302	2	297(5):789–801	297(5):789–801	NUM
biotropia-2457	302	3	.	.	PUNCT
biotropia-2457	303	1	wang	wang	PROPN
biotropia-2457	303	2	z	z	PROPN
biotropia-2457	303	3	,	,	PUNCT
biotropia-2457	303	4	guo	guo	PROPN
biotropia-2457	303	5	z	z	PROPN
biotropia-2457	303	6	,	,	PUNCT
biotropia-2457	303	7	zou	zou	PROPN
biotropia-2457	303	8	t	t	PROPN
biotropia-2457	303	9	,	,	PUNCT
biotropia-2457	303	10	zhang	zhang	PROPN
biotropia-2457	303	11	z	z	PROPN
biotropia-2457	303	12	,	,	PUNCT
biotropia-2457	303	13	zhang	zhang	PROPN
biotropia-2457	303	14	j	j	PROPN
biotropia-2457	303	15	,	,	PUNCT
biotropia-2457	303	16	he	he	PRON
biotropia-2457	303	17	p	p	X
biotropia-2457	303	18	,	,	PUNCT
biotropia-2457	303	19	…	…	PUNCT
biotropia-2457	303	20	,	,	PUNCT
biotropia-2457	303	21	fu	fu	ADJ
biotropia-2457	303	22	x.	x.	NOUN
biotropia-2457	303	23	2023	2023	NUM
biotropia-2457	303	24	.	.	PUNCT
biotropia-2457	304	1	substitution	substitution	NOUN
biotropia-2457	304	2	mapping	mapping	NOUN
biotropia-2457	304	3	and	and	CCONJ
biotropia-2457	304	4	allelic	allelic	ADJ
biotropia-2457	304	5	variations	variation	NOUN
biotropia-2457	304	6	of	of	ADP
biotropia-2457	304	7	the	the	DET
biotropia-2457	304	8	domestication	domestication	NOUN
biotropia-2457	304	9	genes	gene	NOUN
biotropia-2457	304	10	from	from	ADP
biotropia-2457	304	11	o.	o.	NOUN
biotropia-2457	304	12	rufipogon	rufipogon	NOUN
biotropia-2457	304	13	and	and	CCONJ
biotropia-2457	304	14	o.	o.	PROPN
biotropia-2457	304	15	nivara	nivara	PROPN
biotropia-2457	304	16	.	.	PUNCT
biotropia-2457	305	1	rice	rice	NOUN
biotropia-2457	305	2	16(1):38	16(1):38	NUM
biotropia-2457	305	3	.	.	PUNCT
biotropia-2457	306	1	doi	doi	NOUN
biotropia-2457	306	2	:	:	PUNCT
biotropia-2457	306	3	10.1186	10.1186	NUM
biotropia-2457	306	4	/	/	SYM
biotropia-2457	306	5	s12284	s12284	PROPN
biotropia-2457	306	6	-	-	PUNCT
biotropia-2457	306	7	023	023	NUM
biotropia-2457	306	8	-	-	PUNCT
biotropia-2457	306	9	00655	00655	NUM
biotropia-2457	306	10	-	-	PUNCT
biotropia-2457	306	11	y	y	PROPN
biotropia-2457	306	12	wang	wang	PROPN
biotropia-2457	306	13	zy	zy	PROPN
biotropia-2457	306	14	,	,	PUNCT
biotropia-2457	306	15	zheng	zheng	PROPN
biotropia-2457	306	16	fq	fq	PROPN
biotropia-2457	306	17	,	,	PUNCT
biotropia-2457	306	18	shen	shen	PROPN
biotropia-2457	306	19	gz	gz	PROPN
biotropia-2457	306	20	,	,	PUNCT
biotropia-2457	306	21	gao	gao	PROPN
biotropia-2457	306	22	jp	jp	PROPN
biotropia-2457	306	23	,	,	PUNCT
biotropia-2457	306	24	snustad	snustad	PROPN
biotropia-2457	306	25	dp	dp	PROPN
biotropia-2457	306	26	,	,	PUNCT
biotropia-2457	306	27	li	li	PROPN
biotropia-2457	306	28	mg	mg	PROPN
biotropia-2457	306	29	,	,	PUNCT
biotropia-2457	306	30	…	…	PUNCT
biotropia-2457	306	31	,	,	PUNCT
biotropia-2457	306	32	hong	hong	PROPN
biotropia-2457	306	33	mm	mm	PROPN
biotropia-2457	306	34	.	.	PROPN
biotropia-2457	306	35	1995	1995	NUM
biotropia-2457	306	36	.	.	PUNCT
biotropia-2457	307	1	the	the	DET
biotropia-2457	307	2	amylose	amylose	ADJ
biotropia-2457	307	3	content	content	NOUN
biotropia-2457	307	4	in	in	ADP
biotropia-2457	307	5	rice	rice	NOUN
biotropia-2457	307	6	endosperm	endosperm	NOUN
biotropia-2457	307	7	is	be	AUX
biotropia-2457	307	8	related	relate	VERB
biotropia-2457	307	9	to	to	ADP
biotropia-2457	307	10	the	the	DET
biotropia-2457	307	11	post	post	ADJ
biotropia-2457	307	12	-	-	ADJ
biotropia-2457	307	13	transcriptional	transcriptional	ADJ
biotropia-2457	307	14	regulation	regulation	NOUN
biotropia-2457	307	15	of	of	ADP
biotropia-2457	307	16	the	the	DET
biotropia-2457	307	17	waxy	waxy	NOUN
biotropia-2457	307	18	gene	gene	NOUN
biotropia-2457	307	19	.	.	PUNCT
biotropia-2457	308	1	plant	plant	NOUN
biotropia-2457	308	2	j	j	PROPN
biotropia-2457	308	3	7(4):613–22	7(4):613–22	PROPN
biotropia-2457	308	4	.	.	PUNCT
biotropia-2457	309	1	doi	doi	NOUN
biotropia-2457	309	2	:	:	PUNCT
biotropia-2457	309	3	10.1046	10.1046	NUM
biotropia-2457	309	4	/	/	SYM
biotropia-2457	309	5	j.1365	j.1365	NOUN
biotropia-2457	309	6	-	-	PUNCT
biotropia-2457	309	7	313x.1995.7040613.x	313x.1995.7040613.x	PROPN
biotropia-2457	309	8	wardhani	wardhani	PROPN
biotropia-2457	309	9	apk	apk	PROPN
biotropia-2457	309	10	,	,	PUNCT
biotropia-2457	309	11	wirnas	wirnas	PROPN
biotropia-2457	309	12	d.	d.	PROPN
biotropia-2457	309	13	2024	2024	NUM
biotropia-2457	309	14	.	.	PUNCT
biotropia-2457	310	1	keragaman	keragaman	PROPN
biotropia-2457	310	2	genetik	genetik	PROPN
biotropia-2457	310	3	karakter	karakter	PROPN
biotropia-2457	310	4	agronomi	agronomi	PROPN
biotropia-2457	310	5	dan	dan	PROPN
biotropia-2457	310	6	amilosa	amilosa	PROPN
biotropia-2457	310	7	populasi	populasi	PROPN
biotropia-2457	310	8	sorgum	sorgum	PROPN
biotropia-2457	310	9	f3	f3	PROPN
biotropia-2457	310	10	hasil	hasil	PROPN
biotropia-2457	310	11	persilangan	persilangan	PROPN
biotropia-2457	310	12	pulut	pulut	PROPN
biotropia-2457	310	13	3	3	NUM
biotropia-2457	310	14	×	×	NOUN
biotropia-2457	310	15	soraya	soraya	PROPN
biotropia-2457	310	16	3	3	NUM
biotropia-2457	311	1	[	[	X
biotropia-2457	311	2	genetic	genetic	ADJ
biotropia-2457	311	3	diversity	diversity	NOUN
biotropia-2457	311	4	of	of	ADP
biotropia-2457	311	5	agronomic	agronomic	ADJ
biotropia-2457	311	6	traits	trait	NOUN
biotropia-2457	311	7	and	and	CCONJ
biotropia-2457	311	8	amylose	amylose	ADJ
biotropia-2457	311	9	content	content	NOUN
biotropia-2457	311	10	in	in	ADP
biotropia-2457	311	11	f3	f3	ADJ
biotropia-2457	311	12	sorghum	sorghum	NOUN
biotropia-2457	311	13	biotropia	biotropia	ADJ
biotropia-2457	311	14	vol	vol	NOUN
biotropia-2457	311	15	.	.	PUNCT
biotropia-2457	312	1	32	32	NUM
biotropia-2457	312	2	no	no	NOUN
biotropia-2457	312	3	.	.	NOUN
biotropia-2457	313	1	3	3	NUM
biotropia-2457	313	2	,	,	PUNCT
biotropia-2457	313	3	2025	2025	NUM
biotropia-2457	313	4	338	338	NUM
biotropia-2457	313	5	populations	population	NOUN
biotropia-2457	313	6	resulting	result	VERB
biotropia-2457	313	7	from	from	ADP
biotropia-2457	313	8	the	the	DET
biotropia-2457	313	9	crossbreeding	crossbreeding	NOUN
biotropia-2457	313	10	of	of	ADP
biotropia-2457	313	11	pulut	pulut	PROPN
biotropia-2457	313	12	3	3	NUM
biotropia-2457	313	13	×	×	PROPN
biotropia-2457	313	14	soraya	soraya	PROPN
biotropia-2457	313	15	]	]	PUNCT
biotropia-2457	313	16	.	.	PUNCT
biotropia-2457	314	1	jurnal	jurnal	ADJ
biotropia-2457	314	2	agronomi	agronomi	NOUN
biotropia-2457	314	3	indonesia	indonesia	PROPN
biotropia-2457	314	4	52(1	52(1	NOUN
biotropia-2457	314	5	):	):	PUNCT
biotropia-2457	314	6	45–53	45–53	NUM
biotropia-2457	314	7	.	.	PUNCT
biotropia-2457	315	1	doi	doi	NOUN
biotropia-2457	315	2	:	:	PUNCT
biotropia-2457	315	3	10.24831	10.24831	NUM
biotropia-2457	315	4	/	/	SYM
biotropia-2457	315	5	jai.v52i1.12345	jai.v52i1.12345	PROPN
biotropia-2457	315	6	xie	xie	PROPN
biotropia-2457	315	7	l	l	PROPN
biotropia-2457	315	8	,	,	PUNCT
biotropia-2457	315	9	wang	wang	PROPN
biotropia-2457	315	10	y	y	PROPN
biotropia-2457	315	11	,	,	PUNCT
biotropia-2457	315	12	wang	wang	PROPN
biotropia-2457	315	13	z	z	PROPN
biotropia-2457	315	14	,	,	PUNCT
biotropia-2457	315	15	li	li	PROPN
biotropia-2457	315	16	x.	x.	PROPN
biotropia-2457	315	17	2022	2022	NUM
biotropia-2457	315	18	.	.	PUNCT
biotropia-2457	316	1	nutritional	nutritional	ADJ
biotropia-2457	316	2	composition	composition	NOUN
biotropia-2457	316	3	and	and	CCONJ
biotropia-2457	316	4	health	health	NOUN
biotropia-2457	316	5	benefits	benefit	NOUN
biotropia-2457	316	6	of	of	ADP
biotropia-2457	316	7	sorghum	sorghum	NOUN
biotropia-2457	316	8	:	:	PUNCT
biotropia-2457	316	9	a	a	DET
biotropia-2457	316	10	review	review	NOUN
biotropia-2457	316	11	.	.	PUNCT
biotropia-2457	317	1	trends	trend	NOUN
biotropia-2457	317	2	food	food	NOUN
biotropia-2457	317	3	sci	sci	PROPN
biotropia-2457	317	4	technol	technol	PROPN
biotropia-2457	317	5	125:25–38	125:25–38	PROPN
biotropia-2457	317	6	.	.	PUNCT
biotropia-2457	318	1	doi	doi	PROPN
biotropia-2457	318	2	:	:	PUNCT
biotropia-2457	318	3	10.1016	10.1016	NUM
biotropia-2457	318	4	/	/	SYM
biotropia-2457	318	5	j.tifs.2022.05.012	j.tifs.2022.05.012	PROPN
biotropia-2457	318	6	yamanaka	yamanaka	PROPN
biotropia-2457	318	7	s	s	PROPN
biotropia-2457	318	8	,	,	PUNCT
biotropia-2457	318	9	nakamura	nakamura	PROPN
biotropia-2457	318	10	i	i	PROPN
biotropia-2457	318	11	,	,	PUNCT
biotropia-2457	318	12	watanabe	watanabe	PROPN
biotropia-2457	318	13	kn	kn	PROPN
biotropia-2457	318	14	,	,	PUNCT
biotropia-2457	318	15	sato	sato	PROPN
biotropia-2457	318	16	yi	yi	PROPN
biotropia-2457	318	17	.	.	PUNCT
biotropia-2457	319	1	2004	2004	NUM
biotropia-2457	319	2	.	.	PUNCT
biotropia-2457	320	1	identification	identification	NOUN
biotropia-2457	320	2	of	of	ADP
biotropia-2457	320	3	snps	snps	PROPN
biotropia-2457	320	4	in	in	ADP
biotropia-2457	320	5	the	the	DET
biotropia-2457	320	6	waxy	waxy	NOUN
biotropia-2457	320	7	gene	gene	NOUN
biotropia-2457	320	8	among	among	ADP
biotropia-2457	320	9	glutinous	glutinous	ADJ
biotropia-2457	320	10	rice	rice	NOUN
biotropia-2457	320	11	cultivars	cultivar	NOUN
biotropia-2457	320	12	and	and	CCONJ
biotropia-2457	320	13	their	their	PRON
biotropia-2457	320	14	evolutionary	evolutionary	ADJ
biotropia-2457	320	15	significance	significance	NOUN
biotropia-2457	320	16	during	during	ADP
biotropia-2457	320	17	the	the	DET
biotropia-2457	320	18	domestication	domestication	NOUN
biotropia-2457	320	19	process	process	NOUN
biotropia-2457	320	20	of	of	ADP
biotropia-2457	320	21	rice	rice	NOUN
biotropia-2457	320	22	.	.	PUNCT
biotropia-2457	321	1	theor	theor	PROPN
biotropia-2457	321	2	appl	appl	PROPN
biotropia-2457	321	3	genet	genet	PROPN
biotropia-2457	321	4	108(7):1200–04	108(7):1200–04	PROPN
biotropia-2457	321	5	.	.	PUNCT
biotropia-2457	322	1	yang	yang	PROPN
biotropia-2457	322	2	j	j	PROPN
biotropia-2457	322	3	,	,	PUNCT
biotropia-2457	322	4	hu	hu	PROPN
biotropia-2457	322	5	l	l	PROPN
biotropia-2457	322	6	,	,	PUNCT
biotropia-2457	322	7	huan	huan	PROPN
biotropia-2457	322	8	s	s	PROPN
biotropia-2457	322	9	,	,	PUNCT
biotropia-2457	322	10	zhu	zhu	PROPN
biotropia-2457	322	11	y.	y.	PROPN
biotropia-2457	322	12	2013	2013	NUM
biotropia-2457	322	13	.	.	PUNCT
biotropia-2457	323	1	allelic	allelic	ADJ
biotropia-2457	323	2	variation	variation	NOUN
biotropia-2457	323	3	in	in	ADP
biotropia-2457	323	4	the	the	DET
biotropia-2457	323	5	waxy	waxy	NOUN
biotropia-2457	323	6	gene	gene	NOUN
biotropia-2457	323	7	of	of	ADP
biotropia-2457	323	8	rice	rice	NOUN
biotropia-2457	323	9	(	(	PUNCT
biotropia-2457	323	10	oryza	oryza	PROPN
biotropia-2457	323	11	sativa	sativa	PROPN
biotropia-2457	323	12	l.	l.	PROPN
biotropia-2457	323	13	)	)	PUNCT
biotropia-2457	323	14	and	and	CCONJ
biotropia-2457	323	15	the	the	DET
biotropia-2457	323	16	development	development	NOUN
biotropia-2457	323	17	of	of	ADP
biotropia-2457	323	18	allele	allele	NOUN
biotropia-2457	323	19	-	-	PUNCT
biotropia-2457	323	20	specific	specific	ADJ
biotropia-2457	323	21	markers	marker	NOUN
biotropia-2457	323	22	.	.	PUNCT
biotropia-2457	324	1	mol	mol	ADP
biotropia-2457	324	2	breed	breed	PROPN
biotropia-2457	324	3	31(2):543–51	31(2):543–51	NUM
biotropia-2457	324	4	.	.	PUNCT
biotropia-2457	325	1	yano	yano	PROPN
biotropia-2457	325	2	m	m	PROPN
biotropia-2457	325	3	,	,	PUNCT
biotropia-2457	325	4	nakamura	nakamura	PROPN
biotropia-2457	325	5	y	y	PROPN
biotropia-2457	325	6	,	,	PUNCT
biotropia-2457	325	7	kato	kato	PROPN
biotropia-2457	325	8	t.	t.	PROPN
biotropia-2457	325	9	2020	2020	NUM
biotropia-2457	325	10	.	.	PUNCT
biotropia-2457	326	1	the	the	DET
biotropia-2457	326	2	genetics	genetic	NOUN
biotropia-2457	326	3	of	of	ADP
biotropia-2457	326	4	waxy	waxy	NOUN
biotropia-2457	326	5	genes	gene	NOUN
biotropia-2457	326	6	in	in	ADP
biotropia-2457	326	7	cereal	cereal	NOUN
biotropia-2457	326	8	crops	crop	NOUN
biotropia-2457	326	9	:	:	PUNCT
biotropia-2457	326	10	advances	advance	NOUN
biotropia-2457	326	11	and	and	CCONJ
biotropia-2457	326	12	prospects	prospect	NOUN
biotropia-2457	326	13	.	.	PUNCT
biotropia-2457	327	1	plant	plant	NOUN
biotropia-2457	327	2	mol	mol	ADP
biotropia-2457	327	3	biol	biol	PROPN
biotropia-2457	327	4	103(4	103(4	NUM
biotropia-2457	327	5	-	-	SYM
biotropia-2457	327	6	5):469	5):469	NOUN
biotropia-2457	327	7	-	-	NUM
biotropia-2457	327	8	78	78	NUM
biotropia-2457	327	9	.	.	PUNCT
biotropia-2457	328	1	doi	doi	NOUN
biotropia-2457	328	2	:	:	PUNCT
biotropia-2457	328	3	10.1007	10.1007	NUM
biotropia-2457	328	4	/	/	SYM
biotropia-2457	328	5	s11103	s11103	NOUN
biotropia-2457	328	6	-	-	PUNCT
biotropia-2457	328	7	020	020	NUM
biotropia-2457	328	8	-	-	PUNCT
biotropia-2457	328	9	010206	010206	NUM
biotropia-2457	328	10	zhang	zhang	PROPN
biotropia-2457	328	11	c	c	X
biotropia-2457	328	12	,	,	PUNCT
biotropia-2457	328	13	zhu	zhu	PROPN
biotropia-2457	328	14	j	j	PROPN
biotropia-2457	328	15	,	,	PUNCT
biotropia-2457	328	16	chen	chen	PROPN
biotropia-2457	328	17	s	s	PROPN
biotropia-2457	328	18	,	,	PUNCT
biotropia-2457	328	19	fan	fan	PROPN
biotropia-2457	328	20	x	x	PROPN
biotropia-2457	328	21	,	,	PUNCT
biotropia-2457	328	22	li	li	PROPN
biotropia-2457	328	23	q	q	PROPN
biotropia-2457	328	24	,	,	PUNCT
biotropia-2457	328	25	lu	lu	PROPN
biotropia-2457	328	26	y.	y.	NOUN
biotropia-2457	328	27	2019	2019	NUM
biotropia-2457	328	28	.	.	PUNCT
biotropia-2457	329	1	wx	wx	PROPN
biotropia-2457	329	2	lv	lv	PROPN
biotropia-2457	329	3	,	,	PUNCT
biotropia-2457	329	4	the	the	DET
biotropia-2457	329	5	ancestral	ancestral	ADJ
biotropia-2457	329	6	allele	allele	NOUN
biotropia-2457	329	7	of	of	ADP
biotropia-2457	329	8	rice	rice	NOUN
biotropia-2457	329	9	waxy	waxy	NOUN
biotropia-2457	329	10	gene	gene	NOUN
biotropia-2457	329	11	.	.	PUNCT
biotropia-2457	330	1	mol	mol	ADP
biotropia-2457	330	2	plant	plant	NOUN
biotropia-2457	330	3	12(8):1157	12(8):1157	NUM
biotropia-2457	330	4	–	–	PUNCT
biotropia-2457	330	5	66	66	NUM
biotropia-2457	330	6	.	.	PUNCT
biotropia-2457	331	1	doi	doi	NOUN
biotropia-2457	331	2	:	:	PUNCT
biotropia-2457	331	3	10.1016	10.1016	NUM
biotropia-2457	331	4	/	/	SYM
biotropia-2457	331	5	j.molp.2019.05.011	j.molp.2019.05.011	X
biotropia-2457	331	6	zhang	zhang	PROPN
biotropia-2457	331	7	c	c	PROPN
biotropia-2457	331	8	,	,	PUNCT
biotropia-2457	331	9	zhu	zhu	PROPN
biotropia-2457	331	10	j	j	PROPN
biotropia-2457	331	11	,	,	PUNCT
biotropia-2457	331	12	chen	chen	PROPN
biotropia-2457	331	13	s	s	PROPN
biotropia-2457	331	14	,	,	PUNCT
biotropia-2457	331	15	fan	fan	PROPN
biotropia-2457	331	16	x	x	PROPN
biotropia-2457	331	17	,	,	PUNCT
biotropia-2457	331	18	li	li	PROPN
biotropia-2457	331	19	q	q	PROPN
biotropia-2457	331	20	,	,	PUNCT
biotropia-2457	331	21	luy	luy	ADJ
biotropia-2457	331	22	,	,	PUNCT
biotropia-2457	331	23	…	…	PUNCT
biotropia-2457	331	24	,	,	PUNCT
biotropia-2457	331	25	liu	liu	PROPN
biotropia-2457	331	26	q.	q.	PROPN
biotropia-2457	331	27	2021	2021	NUM
biotropia-2457	331	28	.	.	PUNCT
biotropia-2457	332	1	epistatic	epistatic	ADJ
biotropia-2457	332	2	effects	effect	NOUN
biotropia-2457	332	3	of	of	ADP
biotropia-2457	332	4	waxy	waxy	NOUN
biotropia-2457	332	5	gene	gene	NOUN
biotropia-2457	332	6	loci	locus	NOUN
biotropia-2457	332	7	in	in	ADP
biotropia-2457	332	8	rice	rice	NOUN
biotropia-2457	332	9	starch	starch	NOUN
biotropia-2457	332	10	biosynthesis	biosynthesis	NOUN
biotropia-2457	332	11	.	.	PUNCT
biotropia-2457	333	1	mol	mol	ADP
biotropia-2457	333	2	plant	plant	NOUN
biotropia-2457	333	3	14(6):1231–43	14(6):1231–43	PROPN
biotropia-2457	333	4	.	.	PUNCT
biotropia-2457	334	1	zhang	zhang	PROPN
biotropia-2457	334	2	h	h	PROPN
biotropia-2457	334	3	,	,	PUNCT
biotropia-2457	334	4	lang	lang	PROPN
biotropia-2457	334	5	z.	z.	PROPN
biotropia-2457	334	6	2018	2018	NUM
biotropia-2457	334	7	.	.	PUNCT
biotropia-2457	335	1	epigenetic	epigenetic	ADJ
biotropia-2457	335	2	regulation	regulation	NOUN
biotropia-2457	335	3	of	of	ADP
biotropia-2457	335	4	plant	plant	NOUN
biotropia-2457	335	5	hormone	hormone	NOUN
biotropia-2457	335	6	responses	response	NOUN
biotropia-2457	335	7	.	.	PUNCT
biotropia-2457	336	1	mol	mol	ADP
biotropia-2457	336	2	plant	plant	NOUN
biotropia-2457	336	3	11(1):97–114	11(1):97–114	NUM
biotropia-2457	336	4	.	.	PUNCT
biotropia-2457	337	1	doi	doi	NOUN
biotropia-2457	337	2	:	:	PUNCT
biotropia-2457	337	3	10.1016	10.1016	NUM
biotropia-2457	337	4	/	/	SYM
biotropia-2457	337	5	j.molp.2017.09.003	j.molp.2017.09.003	PROPN
biotropia-2457	337	6	.	.	PROPN
biotropia-2457	338	1	zhou	zhou	PROPN
biotropia-2457	338	2	z	z	PROPN
biotropia-2457	338	3	,	,	PUNCT
biotropia-2457	338	4	li	li	PROPN
biotropia-2457	338	5	j	j	PROPN
biotropia-2457	338	6	,	,	PUNCT
biotropia-2457	338	7	zhang	zhang	PROPN
biotropia-2457	338	8	x.	x.	PROPN
biotropia-2457	338	9	2021	2021	NUM
biotropia-2457	338	10	.	.	PUNCT
biotropia-2457	339	1	starch	starch	NOUN
biotropia-2457	339	2	properties	property	NOUN
biotropia-2457	339	3	of	of	ADP
biotropia-2457	339	4	waxy	waxy	NOUN
biotropia-2457	339	5	cereals	cereal	NOUN
biotropia-2457	339	6	and	and	CCONJ
biotropia-2457	339	7	their	their	PRON
biotropia-2457	339	8	industrial	industrial	ADJ
biotropia-2457	339	9	applications	application	NOUN
biotropia-2457	339	10	.	.	PUNCT
biotropia-2457	340	1	food	food	NOUN
biotropia-2457	340	2	hydrocoll	hydrocoll	PROPN
biotropia-2457	340	3	113:106567	113:106567	PROPN
biotropia-2457	340	4	.	.	PUNCT
biotropia-2457	341	1	doi	doi	PROPN
biotropia-2457	341	2	:	:	PUNCT
biotropia-2457	341	3	10.1016	10.1016	NUM
biotropia-2457	341	4	/	/	SYM
biotropia-2457	341	5	j.foodhyd.2020.106567	j.foodhyd.2020.106567	ADJ