2. Topik Hidayat (Utility).cdr BIOTROPIA Vol. 18 No. 2, 2011: 74 - 80 UTILITY OF K GENE TO ASSESS EVOLUTIONARY RELATIONSHIP OF GENUS (ANACARDIACEAE) IN INDONESIA AND THAILAND MAT MANGIFERA TOPIK HIDAYAT , ADI PANCORO , and DIAH KUSUMAWATY MaturaseK ( K) gene of chloroplast DNA has served as an appropriate candidate to be a DNA marker in angiosperms. Using this marker, 19 species of genus , one of the ecologically important crop, collected from Indonesia and Thailand were analyzed. Phylogenetic analysis using parsimony method revealed that the gene could clasify into three major groups, namely group I, II, and III. Moreover, the K gene can identify species originated from Thailand. Although this classification system is different with the previous classification system, it can provide a new information on the current status of taxonomy. Further result exhibited that DNA sequences of the K of two species ( dan ) are different between Indonesia and Thailand specimens. : DNA barcode, , K gene, parsimony, phylogenetic analysis 1,2,* 3 2 1 2 3 Department of Biological Science, Faculty of Bioscience and Bioengineering, Universiti Teknologi Malaysia (UTM), Malaysia Department of Biology Education, Indonesia University of Education (UPI), Bandung, Indonesia School of Life Sciences and Technology, Institute Technology of Bandung, Indonesia mat Mangifera Mangifera mat Mangifera Mangifera mat Mangifera M. laurina M. macrocarpa Mangifera mat Received 24 November 2010/Accepted 28 October 2011 ABSTRACT INTRODUCTION Keywords The genus L., one of the most important plant groups in deciduous forest and wet tropical rainforests including mountain forests, is one of the largest genera of the family Anacardiaceae to which approximately 69 species have already been described. The genus is mostly distributed in the tropical parts of Asia (India, Burma, Sri Lanka, Thailand, South Tropical China, Malaysia, Indonesia, Papua New Guinea, the Philippines, the Solomon Islands) but also in the Pacific Islands (Kostermans & Bompard 1993). In spite of their economical importance, phylogenetic relationships among species within the genus have been poorly understood due to their extremely complicated vegetative and reproductive organs. Mangifera 74 E-mail: topik28@yahoo.com or topik@fbb.utm.my BIOTROPIA Vol. 18 No. 2, 2011 Previously, Marchand (1869), Pierre (1897), and Kostermans and Bompard (1993) have revealed classification systems for the genus based upon floral characters. However, these characters were extremely complicated in the genus and subjected to parallelism (Yonemori . 2002), suggesting many taxonomic and phylogenetic problems still remain unresolved. Given the shortcomings of these characters, data obtained from nucleotide substitutions of appropriate molecules are preferable for clarifying phylogenetic relationships (e.g., Moritz & Hillis 1996). Methods for clarifying relationships in species or group organisms by using DNA sequences have been proposed and initiated recent years (Kress . 2005). MaturaseK gene of chloroplast genome served as potentially usable DNA regions to flowering plants. The K gene is frequently choosen by plant systematists because the region is a single copy gene and has enough variable sites of nucleotide substitution. Recently, the K gene has been widely used in phylogenetic inferences of various groups of plant (e.g. Ito . 1999; Ferguson Sang 2001; Raymond . 2002; Ebihara . 2005; Hidayat . 2005). Phylogenetic analysis to clarify phylogenetic relationships among members of genus have been carried out using DNA sequences of the K gene. A total of 19 species of was collected from Indonesia and Thailand, plus two species of . Two members of genus (M9 and M13) were used as outgroup in phylogenetic analysis based on previous research this genus was sister group to (Yonemori . 2002). Detailed information of the plant is summarized in Table 1. DNA genome was extracted from fresh materials (young leaf) using QIAGEN Dneasy Mini Plant Kit with slight modification. Amplification was conducted using four primers as shown in Figure 1. Table 2 provides detailed information on sequences of primer pairs. et al et al mat mat et al et al et al et al Mangifera mat Mangifera Bouea Bouea Mangifera et al & An understanding of the evolutionary relationships in this group may contribute to the field of plant systematics or ecology. MATERIALS AND METHODS 75 matK genetrnK trnK A B C D Figure 1. Strategy of amplification and sequencing of the K gene. A= K-5F, B=TAA-09F, C=TAA- 09R, dan D= K-2R. Two internal primers (B and C) were designed for this study. mat trn trn Utility of matK gene to assess evolutionary relationship - Topik Hidayat .et al Table 1. Plant materials, their geographic origins and codes used in this study Species Origin Code Mangifera altissima Blanco var bingloe Indonesia M18 Mangifera applanata Kosterm. Indonesia M14 Mangifera foetida Lour. Indonesia M17 Mangifera gedebe Miq. Indonesia M10 Mangifera indica L. Indonesia M11 Mangifera laurina Bl. Indonesia M7 Mangifera macrocarpa Bl. Indonesia M3 Mangifera odorata Griff. Indonesia M16 Mangifera spp Indonesia M12 Mangifera rufocostata Kosterm. Indonesia M8 Mangifera similis Auct. Indonesia M2 Mangifera caesia Jack ex Wall Indonesia M5 Mangifera casturi Kosterm. Indonesia M15 Mangifera macrocarpa Bl. Thailand S1 Mangifera conchinchinensis Englar Thailand S6 Mangifera flava Evrard Thailand S3 Mangifera gracilipes Hook.f. Thailand S2 Mangifera caloneura Auct. Thailand S5 Mangifera laurina Bl. Thailand S7 Bouea oppositifolia (Roxb.) Meiss Indonesia M13 Bouea macrophylla Griff. Indonesia M9 76 Table 2. Primers used in this study Name Sequences trnK-5F 5’ TGGGTTGCTAACTCATGG 3’ trnK-2R 5’ AACTAGTCGGATGGAGTAG 3’ TAA-09F 5’GGTTTTCCCATGAGTAGATTATCG 3’ TAA-09R 5’ CGAAGTAGACGAAGCTCTTGG 3’ For amplification, we used primer pairs A and D, whereas all primers used once sequencing. PCR (Polymerase Chain Reaction) reaction included buffer PCR (1x), MgCl (2-3mM), primers (@ 0,5 mM), enzyme Taq polymerase (1 U/uL), dNTPs Mix (1,6 mM), and DNA template (100-150 ng/uL). PCR was conducted according to Hidayat . (2005). PCR cycles include 1 cycle at 94 C (predenaturation) for 5 minutes; 30 cycles at 94 C (denaturation) for 30 seconds, 49 C ( ) for 30 seconds, and 72 C (extension) for 2 minutes; and ended with 1 cycle at 72 C (final extension) for 8 minutes. PCR products were cloned into pGEM-T Easy (Promega) before sending them to Macrogen (Korea) for sequencing. DNA sequences obtained from the K gene were aligned with Clustal X (Thompson . 1997) and then adjusted manually. Phylogenetic analyses based on the maximum parsimony criterion was performed using PAUP* version 4.0b10 (Swofford 1998). All characters were equally weighted and unordered (Fitch 1971). All the data sets were analysed by the heuristic search method with tree bisection-reconnection (TBR) branch swapping and the MULTREES option ON, ten replications of random addition sequences with the stepwise addition option, and all most parsimonious trees (MPTs) were saved. Evaluation of internal support of clades was conducted by the bootstrap analysis (Felsenstein 1985) utilizing 1000 replicates with TBR branch 2 et al annealing mat et al o o o o o BIOTROPIA Vol. 18 No. 2, 2011 77 swapping and the MULTREES option OFF. Number of steps, consistency indices (CI) and retention indices (RI) were calculated on one of the MPTs in each analysis with the TREE SCORES command in PAUP*. DNA extraction can be done using various types of DNA sources such as leaf, stem, flower, and seed. In this research, young leaf was used for DNA extraction to minimize contamination that can inhibit PCR amplification. High level of concentration (600 ng/uL in average) with good ratio ( 1.750) was obtained. Size and border of K gene for were determined through comparative analysis in genebank (www.ncbi.nlm.nig.gov). The results indicated that size of K gene in is about 1500 bp. Multiple alignment analysis was performed by using ClustalX (Thompson . 1997). The aligned K comprised 1,601 characters (Fig. 2). Of these, 1,429 were constant and 51 were potentially informative. Reconstruction of phylogenetic tree (Fig. 2) using PAUP resulted in 23 MPTs with a length of 121 steps, CI of 0.852, and RI of 0.739. The tree (Fig. 3) demonstrated that the genus was monophyletic and split into three major groups. Monophyletic nature of was supported by character of stoma, anomositic (Hidayat, unpublished data). The three major groups found in this study is not consistent with previous classification system by Mukherjee (1953), Kostermans and Bompard (1993) based upon morphological characters, and even Yonemori . (2002) on the basis of DNA sequences of internal transcribed spacer (ITS) region. The number of plant materials used in this study is likely to be insufficient (only 19 out of 69 recognized species). Further phylogenetic analysis is, therefore, needed using more extensive sampling. However, this study has provided new information on taxonomy of . As depicted in Figure 2 , (from Indonesia), and were united (Group I), whereas (form Thailand), and were closely related (Group II). Group III was housed by the rest of species, and species which is originated from Thailand was placed within Group III (Fig. 2). Unfortunately, no single synapomorphic character is found to support each group. Moreover, this research has revealed that there are variations of K in and which come from Indonesia and Thailand. As seen in Figure 2, (from Thailand) was separated from that of Indonesia (Group III; Thailand specimen in Group II). Similar situation has been found in : Thailand in Group III and Indonesia in Group I. Different nature between these two countries has driven the mutation in K, but this does not lead to shift the morphology. These are related with the ability of plant to adapt to the environment changes (Evans 1975). As mentioned, K gene is highly conserved (e.g. Ebihara . 2005; Hidayat . 2005). Mutation rate in this kind of gene is very slow. This is reflected by the small number of informative characters (only 51 from a total 1,601 characters) to build the RESULTS AND DISCUSSION + mat Mangifera mat Mangifera et al mat Mangifera et al Mangifera M. applanata M. macrocarpa M. altissima M. laurina M. casturi, M. odorata, M. indica Mangifera mat M. laurina M. macrocarpa M. laurina M. macrocarpa mat mat et al et al 78 Utility of matK gene to assess evolutionary relationship - Topik Hidayat .et al tree. As a consequence, bootstrap value in most branches of the tree are less than 50. Similar condition was found in other angiosperms (e.g. Raymond . 2002; Ebihara . 2005; Hidayat . 2005). Further analysis based on the phylogenetic scheme presented here will shed more light on overlooked characters. et al et al et al Figure 2. Alignment process using ClustalX shows the level of homology (*) BIOTROPIA Vol. 18 No. 2, 2011 79 Outgroup Figure 3. One of the 23 MPTs of based on K gene. Bootstrap value of >50 are shown above each branch. * = Indonesia specimen; **= Thailand specimen. Species inside the box are originated from Thailand. Mangifera mat B. oppositifolia B. macrophylla M. applanata M. Macrocarpa* M. altissima M. spp M. Laurina** M. kasturi M. odorata M. indica M. caesia M. foetida M. rufacostata M. gedebe M. macrocarpa** M. similis M. laurina* M. conchinensis M. flava M. gracilipes M. caloneura Group I Group II Group III 100 77 55 84 61 86 CONCLUSIONS This study demonstrated that the K gene classified the into three major groups. Furthermore, the K identified species that is originated from Thailand. The K gene in the two species, namely and , was different between Indonesia and Thailand specimens. This study is subjected to be preliminary, so it is suggested that further researches employing another DNA region with more extensive sampling should be conducted in the future. mat Mangifera mat Mangifera mat M. laurina M. macrocarpa 80 Utility of matK gene to assess evolutionary relationship - Topik Hidayat .et al ACKNOWLEDGMENT REFERENCES We gratefully acknowledge Nisa, Puri, and Asri of Institute Technology Bandung for their kind assistance during the completion of the study, and Wichan Eiadthong of Kasetsart University for his kindness to provide plant materials from Thailand. We would like to thank Campbell Webb of Harvard University for fruitful discussion during preparation of this manuscript. Ebihara A, H Ishikawa, S Matsumoto, SJ Lin, K Iwatsuki, M Takamiya, Y Watano Y, M Ito. 2005. Nuclear DNA, Chloroplast DNA, and ploidy analysis clarified biological complexity of the Complex (Hymenophyllaceae) in Japan and adjacent areas. American Journal of Botany, 92:1535-1547. vans LT. 1975. The physiological basis of crop yield. Cambridge University Press, London, UK elsenstein J. 1985. Confidence limit on phylogenies: an approach using the bootstrap. Evolution, 39:783-791. Ferguson D, T Sang. 2001. Speciation through homoploid hybridization between allotetraploids in peonies (Paeonia). Proceeding National Academic of Science, 98:3915-3919. Fitch WM. 1971. Toward defining the course of evolution: minimum change for a specific tree topology. Systematic Zoology, 20:406-416. Hidayat T, T Yukawa, M Ito. 2005. Molecular phylogenetics of subtribe Aeridinae (Orchidaceae): insight from plastid K and nuclear ribosomal ITS sequences. Journal of Plant Research, 118:271-284. Ito M, A Kamawoto, Y Kita, T Yukawa, S. Kurita. 1999. Phylogenetic relationships of Amaryllidaceae based on K sequences data. Journal of Plant Research, 112:207-216. Kostermans AJGH, Bompard JM. 1993. The mangoes: Their botany, nomenclature, horticulture and utilization. IBPGR Academic Press, London. Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DA. 2005. Use of DNA barcodes to identify flowering plants. Proceeding National Academic of Science, 102:8369-8374. Marchand L. 1869. Revision du Groupe des Anacardiacees. J.B. Bailliere, Paris. Moritz C, Hillis DM. 1996. Molecular Systematics: context and controversies.In: Hillis DM, Moritz C, Mable BK (Eds) Molecular Systematic, 2 edn. Sinauer Associates, Sunderland, MA. Mukherjee SK. 1953. Origin, distribution and phylogenetic affinity of the species of L. Journal of Linnaues Society London (Bot), 55:65-83. Pierre L. 1897. Flore Forestiere de la Cochinchine. Doin, Paris. Raymond O, Piola F, Sanlaville-Boisson C. 2002. Inference of reticulation in outcrossing allopolyploid taxa: caveats, likelihood and perspectives. Trend in Ecology and Evolution, 17:3-6. Swofford DL. 1998. PAUP*4.0b10. Phylogenetic analysis using parsimony (*and other methods). Version 4. Sinauer Associates, Sunderland, Massachussets. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The ClusstalX windows interface: flexible strategies for multiple sequences alignment aided by quality analysis tools. Nucleat Acid Research, 24:4876-4882. Yonemori K, C Honsho, S Kanzaki, W Eidthong, A. Sugiura. 2002. Phylogenetic relationships of Mangifera species revealed by ITS sequences of nuclear ribosomal DNA and a possibility of their hybrid origin. Plant Systematic and Evolution, 231:59-75 Vandenboschia radicans mat mat Mangifera E . F nd