651 Zainal (DNA Barcode).cdr DNA BARCODE CHARACTERIZATION OF MISTLETOE INFESTATION IN TEAK CLONAL SEED ORCHARD (CSO) IN PADANGAN, EAST JAVA PROVINCE, INDONESIA 1,2* 2 2 3 ZAINAL MUTTAQIN , SRI WILARSO BUDI R. , BASUKI WASIS , CORRYANTI 2and ISKANDAR Z. SIREGAR 1Faculty of Forestry, Universitas Nusa Bangsa, Bogor 16161, Indonesia 2 Department of Silviculture, Faculty of Forestry, Institut Pertanian Bogor, Bogor 16680, Indonesia 3Center of Research and Development of Perum Perhutani, Cepu 58302, Indonesia Received 4 May 2016/Accepted: 1 March 2017 ABSTRACT For effective teak plantation management, early detection system in controlling teak mistletoe requires various basic information, including degree of infestation and accuracy of the species names. Mistletoe infestations in teak and mistletoe species name have been reported, but there are still problems in identifying the correct species or subspecies due to morphological similarity. The objective of this study was to clarify the species identity of hemi- parasitic mistletoe plants, which were found in teak Clonal Seed Orchard (CSO) in Padangan, East Java Province, Indonesia using DNA barcodes. Species identification of teak mistletoe based on leaf morphological characteristics and universal DNA barcode regions (i.e. matK and rbcL) were carried out. The results showed that the Canonical Discriminant Analysis (CDA) could differentiate Dendrophthoe pentandra and Macrosolen tetragonus based on leaf morphological characteristics. Variables having high correlation to distinguish both species were length of petiole, width of the widest leaf, number of secondary leaf veins, leaf base shape, aspect ratio, form factor and perimeter ratio of diameter. The results of DNA barcoding showed that the two DNA barcode regions presented good amplification and sequence results. Both DNA barcode regions successfully differentiated two species i.e. D. pentandra and M. tetragonus which belong to Loranthaceae family and have similar leaf morphological characteristics. Those regions were also able to identify Viscum articulatum and other species belonging to Santalaceae family. These results suggested that the two DNA regions could become recommended universal DNA barcode for identifying teak mistletoe. Keywords: Clonal Seed Orchard, DNA barcode, matK, rbcL, teak mistletoe BIOTROPIA 4 2 7 140 152 Vol. 2 No. , 201 : - DOI: 10.11598/btb.201 .2 . .7 4 2 651 * Corresponding author : s znldeg@yahoo.com INTRODUCTION Mistletoe infestation in the Clonal Seed Orchard (CSO) of Perum Perhutani, in Padangan teak plantation forests causes the decrease on quantity and quality of seed and wood production. Mistletoe infestation level in CSO Padangan was reported by Muttaqin et al. (2016) by describing the ratio of infected trees to the total number of trees as assessed in Observation Sample Plot (OSP). The ratios were divided into several ranges i.e. 1. range of 0.32 – 0.43 indicating light intensity which corresponded to TMR value (True Mistletoe Rating) of 0.86 – 1.21 (rather light); 2. range of 0.50 – 0.65 indicating light- rather moderate which corresponded to TMR value of 1.29 -3.27 (light-rather moderate); and 3. range of 0.74 – 0.83 indicating heavy intensity which corresponded to TMR value of 1.80 – 3.58 (light-rather moderate). Total TMR value was in the range of 0.86 – 3.58. There was no heavy intensity (TMR 5 – 7). Preventive parasites control program in Perum Perhutani are carried out through early detection system to anticipate the widespread of the parasites. The first attempt to assess parasite attack patterns and distribution in sampled compartments of teak stands and a Clonal Seed Orchard (CSO) was conducted by Muttaqin et al. 140 the treatment of certain diseases should have a specific barcode DNA marker to guarantee the correctness of medical treatment (Kwanda . et al 2013). Also, Purushothaman (2014) and et al. Mishra (2016) affirm that DNA barcoding is et al. an efficient and authentic tool to differentiate medicinal plant. Several studies showed that rbcL (ribulase-1, 5- biphosphate carboxylase) and matK (maturase K) regions are the two-locus barcode generally used in plants due to their easiness in sequencing and high amplification for many plant species (Hollingsworth et al. 2011). Thus, the objective of this study was mainly to clarify the identity of hemi-parasitic mistletoe plant, which are now found in teak Clonal Seed Orchard (CSO) Padangan, Perum Perhutani, East Java Province, Indonesia, using DNA barcodes. MATERIALS AND METHODS Plant Materials Leaf samples (young or old leaves) of mistletoe that grow on branch or twig of teak crown were collected from compartments of teak stands in Padangan Clonal Seed Orchard (CSO). Those compartments were assigned as Observation Sample Plot (OSP) and Observation Measurement Plot (OMP). Four OMPs (50 x 50 m for each plot) were established inside the OSP units that were classified based on the level of (2016). In addition, dominant mistletoe species have also been identified. However, correct identification of the species is still problematic due to morphological similarities. Hasanbahri et al. (2014) reported that there were two mistletoe species of and Scurrula parasitica Dendrophthoe pentandra belonging to Loranthaceae family in the teak plantation of Krandegan Ranger Resort, Begal Forest Sub-District, Ngawi Forest District. However, it is quite difficult to distinguish mistletoe species in the field. Currently, the identification is based on a reference to herbarium collection which usually requires complete parts of plants. In certain cases, leaves are the only available part of the plants that can be used for identification. This situation could lead to incorrect classification of the targeted mistletoe species. Species identification based on morphological characteristics frequently resulted to incorrect identification due to cryptic species phenomenon and species siblings. This phenomenon can cause synonymous substitution in the name of the species or vice versa. This study was carried out by employing DNA barcode method to complement the traditional plant identification. This method is more rapid and accurate than the morphological marker. Usually, DNA barcoding is based on short sequences (< 800 bp) (Valentini 2009) that can identify and characterize different species which cannot be distinguished morphologically (Tudge 2000). Moreover, each mistletoe species that has potential as medicinal plant and is widely used for C L M H OSP OMP 1 2 3 4 Figure 1 Design of OSP and OMP positions in an OSP unit, modified from CRC990/EFForTS (Drescher et al. 2016; Muttaqin et al. 2016) (Note: 1, 2, 3, 4 = number of each OMP, respectively; C = control, L = low, M = medium, H = high) DNA barcode characterization of mistletoe infestation in teak – Muttaqin et al. 141 parasite attacks i.e. low, medium, high and control (no parasite attacks) (Barbu 2012). If there were no samples obtained for the assigned criteria, the sample collection was then conducted around the corresponding OMP. In this study, OSP and OMP were designed by modifying plots presented in the guidelines of EFForTS/CRC990 project (Drescher 2016) (Fig. 1 & 2). Molecular et al. analysis was carried out in the Laboratory of Plant Biotechnology, Center of Research Biological Resources and Biotechnology, Institut Pertanian Bogor (IPB) as well as in the Laboratory of Genetics and Forestry Molecular, Silviculture Department, Faculty of Forestry, IPB. Leaf Morphology Based on a preliminary study of the voucher specimen identification on teak mistletoe in the field and verification through the herbarium identification in Herbarium Bogoriense (BO), Research Center for Biology LIPI, Bogor, three species were known, namely Dendrophthoe pentandra (Loranthaceae), Macrosolen tetragonus (Loranthaceae) and Viscum articulatum (Santalaceae). In this study, 62 individual leaf samples were collected for D. pentandra. Thirty seven (37) samples of M. tetragonus were collected from five host trees (sub-OMPs) in 12 OMPs for further identification of leaf morphology. Specimens collected for each of D. pentandra and M. tetragonus were twigs in which each twig has three to five mistletoe leaves. The specimens were directly sterilized by swabbing 70% ethanol onto the leaves using cotton balls. The sterilized specimens were then covered with newspaper. Each sterilized specimen was tagged using a hanging label. Information written on the hanging label was sequential number of the sample, name of mistletoe species, sampling date and sequential number of the host tree. Leaf morphology identification was conducted at unit sample of three leaves having sufficient phenotype in reference to Kremer et al. (2002) with several modifications following simplified procedures of Gembong (2001), Wu et al. (2007), Ellis et al. (2009) and Kadir et al. (2012). Measured variables for each leaf samples were dimensional characteristics such as lamina length (LL), petiole length (PL), the width of the widest part of leaf (WL), the length of the largest leaf to the base of the leaf (LB), arch of leaf veins (SD), angle between the midvein with the right or left branch of leaf veins. The number of secondary leaf veins (NV) was also recorded. The number of leaves (NL) was not used as variables in this study, because the calculation of the number of mistletoe leaves was inconsistent due to the loss of some leaves. Figure 2 Design of sub-OSPs in an OSP unit (Drescher et al. 2016; Muttaqin et al. 2016); A, B, C, D, E and 1, 2, 3, 4, 5 as order of column and row of sub-OSPs A B C D E 1 2 3 4 5 50 m 10 m 50 m 1 2 3 4 5 BIOTROPIA Vol. 24 No. 2, 2017 142 Other observed variables were apex shape (AS) and base shape (BS), which were observed with visual assessment from 1 to 8 (Ellis et al. 2009). Calculated variables were: 1. leaf area (LA), which was calculated using the ellipse area formula: ½ x (3.14) x (WL x LL); 2. leaf circumference (LC), which was calculated using the ellipse circumference formula: ½ x (3.14) x (WL + LL); 3. aspect ratio (AR), defined as the ratio of leaf length and width that is used to estimate the shape of the leaf blade; 4. form factor (FF), describes the shape of leaf the roundness of the leaf blade, which form factor (FF) was calculated by the 2 formula: 4π x LA/LC ; 5. perimeter ratio of diameter (PR), determines the ovalness of the leaf, which can be calculated by the formula: LC/WL (Wu et al. 2007). The 13 leaf morphological variables were then analyzed using three different multivariate analyses, namely Principal Component Analysis (PCA), Canonical Discriminant Analysis (CDA), Multiple Correspondence Analysis (MCA) (Kremer et al. 2002; Anwar 2015) of the SPSS 17 program (SPSS Inc. 2007). Furthermore, t-test analysis was performed on the average of the 13 variables of D. pentandra and M. tetragonus using Minitab 15 software (Minitab Inc. 2007). DNA Barcode For DNA barcode, three replications were applied and analyzed for both matK and rbcL regions of D. pentandra, M. tetragonus and V. articulatum, respectively. Thus, there were nine host trees. There were 18 samples examined for DNA barcode analysis (Table 1). For each mistletoe species, a sample unit consisted of three leaves. Those leaves were directly sterilized by swabbing 70% ethanol onto the leaves using cotton balls. Each sample unit was then cut into pieces of 2 x 2 cm. The cuttings of each sample unit were then put inside a tea bag of 9 x 7 cm. One tea bag was designated for one sample unit. Silica gel granules were put inside the respective tea bags to keep the samples dried in field condition (Fazekaz et al. 2012). Three tea bags representing the three replications for each mistletoe species for each DNA marker were put into one airtight plastic bag which was then labeled according to the sample code. The sample code consisted of sequential number of sample, name of mistletoe species, sampling date and sequential number of the host tree. Subsequently, all samples were carefully packed and transported to the laboratory for DNA extraction. Total genomic DNA was extracted from each sampled leaf using DNeasy Plant Mini Kit protocol (http://www.qiagen.com) with catalog number 6235. Two DNA barcode regions (matK and rbcL), which are recommended as universal DNA barcodes for land plants, were used for PCR amplification (Hollingsworth et al. 2009). The PCR amplification was carried out using PCR TM machine of AB Applied Biosystem Veriti Thermal Cycler (www.appliedbiosystem.com). Primer sequences used in this study are shown in Table 2. The process of PCR begins with the dilution of DNA and primer. Firstly, DNA extract was diluted 100 times using double-distilled water (Bidest. water). Secondly, primer dilution was conducted by directly taking 10 µL of high concentrated K and L primers, respectively, mat rbc which was then added with 90 µL nuclease free water. Substance composition for PCR reaction consisted of 2.5 µL H O, 7.5 µL green go taq 2 master mix, 1.5 µL primer F and R and 2 µL diluted DNA (Fazekaz 2012). The DNA et al. amplification results were sent to Genetika Science Indonesia (http://www.base-asia.com) for automated sequencing. Additional sequence data of K and L regions for each species mat rbc including Out Group were collected from NCBI Table 1 List of leaf samples of teak mistletoe used in this study No. Species Number of samples collected for Leaf morphology characteristics determination DNA barcode determination matK rbcL 1 Dendrophthoe pentandra 62 3 3 2 Macrosolen tetragonus 37 3 3 3 Viscum articulatum - 3 3 143 DNA barcode characterization of mistletoe infestation in teak – Muttaqin et al. Table 3 Differences in morphological characteristics of leaf sampled from three species of teak mistletoe GenBank database (National Center for Biotechnology Information) (http://www.ncbi. nlm.nih.gov) and BOLD System (http:// boldsystems.org/). DNA sequences i.e. the length of sequence data (bp) and nucleotide composition were checked visually, edited manually based on chromatogram and aligned manually using ClustalW implemented in MEGA 6.06 program (Tamura et al. 2013). Sequence data were then analyzed using BLAST in NCBI database to identify the three targeted species. Furthermore, barcoding gap and phylogeny trees were checked using MEGA 6.06 program. Phylogeny trees were constructed using Neighbor Joining (NJ) method with 1,000 replicates of bootstrap based on Kimura-2-parameter (K2P) distance. RESULTS AND DISCUSSION Characteristic of Leaf Morphology Results of species identification based on observation and leaf dimension measurement supported by standard reference and complete identity verification using herbarium specimen are presented in Table 3. Table 2 Nucleotide sequence of the primers used in this study No. Region Primer name Sequence (5’ – 3’) Length of PCR product (bp) Temperature (oC) Reference 1 matK [matK-3F, matK-3R] F: AAGATGCCTCTTCTTTGCAT R: GATCCGCTGTGATAATGAGA 620 50 Marazzi et al. (2006) 2 rbcL [rbcL-barP-1F, rbcL-barP- 724R] F: ATGTCACCACAAACAGAAAC R: TCGCATGTACCTGCAGTAGC 677 50 Dev et al. (2014) Morphological Loranthaceae Santalaceae characteristics Dendrophthoe pentandra Macrosolen tetragonus Viscum articulatum Leaf arrangement leaves alternate and small leaves subopposite leaves opposite leaves rudimenter and resemble small bractea, leaves alternate and subopposite Leaf length 8.42±1.65 cm 8.56±1.36 cm 2.60±0.60 cm Leaf width 4.15±0.87 cm 3.77±0.73 cm 0.30±0.10 cm Petiole length 1.37±0.29 cm 0.28±0.26 cm - Amount of secondary veins 8.98±0.86 12.03±1.44 - Shape of leaf base developed-rounded (scale 2.54±0.32) rounded (scale 2.84±0.28) slightly convex Shape of leaves (aspect ratio) lengthwise (scale 2.06±0.29) lengthwise (scale 2.32±0.31) spatulate Shape of leaf rounded (form factor) round (1.76±0.09) slightly round (1.68±0.08) 0.8±0.20 Leaf ovalness (perimeter ratio of diameter) slightly oval (4.81±0.47) oval (5.22±0.48) very oval (15.6±4.60) 144 BIOTROPIA Vol. 24 No. 2, 2017 Variation in Leaf Morphology In this study, the three multivariate analyses (PCA, MCA, and CDA) were conducted using the first synthesis variables, which were expected to contribute the highest rate of total variance, followed by the second synthesis variables, as presented in Table 4. Table 4 shows that the three multivariate analyses (PCA, MCA, and CDA) were able to explain more than 50% of the total variance, representing the wide distribution of leaf morphology grouping of D. pentandra and M. tetragonus (Loranthaceae). Furthermore, the results of three multivariate analyses (PCA, MCA, and CDA) are shown in Figure 3. Total variance explained by each multivariate analysis (%) PCA MCA CDA Synthesis variable 1 37.40 41.32 100 Synthesis variable 2 29.00 33.44 0 Total 66.40 74.76 100 Figure 3 Results of multivariate analysis (a) scatter plot of PCA; (b) histogram of PCA; (c) scatter plot of MCA; (d) histogram of MCA and (e) histogram of CDA (Note: A = D. pentandra; B = M. tetragonus) Table 4 Proportion of total variance explained by the first and second synthesis variable of three multivariate analyses (PCA, MCA, CDA) in grouping D. pentandra and M. tetragonus 145 DNA barcode characterization of mistletoe infestation in teak – Muttaqin et al. Results of these three multivariate analyses showed that only CDA analysis could differentiate D. pentandra and M. tetragonus based on leaf morphological characteristics. Figure 3b and 3d (PCA and MCA), however, show that there were some samples, which were not included in the D. pentandra and M. tetragonus groups. Those are unstable as transition group between the two mistletoe species. Based on correlation analysis between the leaf dimensional variable and the synthesis 1 (global analysis) of D. pentandra and M. tetragonus (Loranthaceae), it was found out that variables having high correlation to distinguish both species using CDA analysis were long petiole, width of the widest leaf, number of secondary leaf veins, leaf base shape, aspect ratio, form factor and perimeter ratio of diameter (Fig. 3e). Characteristics of Leaf Variables for D. pentandra and M. tetragonus Results of t-test for each leaf morphological variable of D. pentandra and M. tetragonus showed that several variables having significant difference were PL, NV, BS, AR, FF, PR (p < 0.01) and WL (p < 0.05). DNA Barcode Amplification and sequence results Obtaining optimum annealing temperature is necessary in order to get a successful PCR amplification process. This study indicated that oannealing temperature of 50 C was the best temperature for matK and rbcL, which showed a very clear single band when visualized by agarose gel. This temperature was lower than the temperature suggested by Stoeckle et al. (2011) ofor matK and rbcL markers, which was 52 C and o 56 C, respectively. The results showed that 17 samples were successfully amplified and sequenced with primers matK and rbcL. However, one sample could not be well amplified in matK for Viscum articulatum. DNA analysis and nucleotide base composition Size of matK and rbcL regions were 744 – 764 bp and 738 – 740 bp, respectively (Table 5). The result of sequence bases showed that the average percentage of nucleotides C + G on the three teak mistletoe species was 30.0 - 44.4%. Moreover, it is known that matK region has a longer average sequence length than rbcL region. Study reported by Trang et al. (2015) showed that sequence alignment can be used for examining the evolution process from the common ancestor, and thus, can be used for the three mistletoes species in the present study. The sequence length difference is helpful as early identification for species difference and correlated with differences in the composition of nucleotide bases (Dick & Kress 2009). Calculation of base substitution among three species in the same family was done after sequence alignment. In this study, an average sequence length of rbcL region was 738 - 740 bp. This value was higher than the length reported by Kwanda et al. (2013) who used the same rbcL region, but different primer base pairs (5'- ATGTCACCACAAACAGAGACTAAAGC-3' and 5'-GTAAAATCAAGTCCACCRCG-3'), showing 550 bp for Loranthaceae family (D. pentandra, D. lanosa, Scurrula atropurpurea, M. cochinchinensis, M. bradisianus, Helixanthera parasitica) and Santalaceae family (V. articulatum and V. ovalifolium). Barcoding gap Barcoding gap is defined when the interspecific diversity is higher than intraspecific diversity. Ideal barcode of genetic locus can be determined by looking at smaller intraspecific Table 5 Sequence length (bp) in matK and rbcL for the three studied mistletoe species No. Species matK rbcL na bpb n bp 1 D. pentandra 3 760, 761, 760 3 738, 740, 739 2 M. tetragonus 3 763, 764, 763 3 738, 739, 739 3 V. articulatum 2 745, 744 3 739, 739, 737 Mean 757.5 738 a Note: n = number of sequence, exception of 1 sample which could not be amplified well in matK for Viscum articulatum b bp = base pair 146 BIOTROPIA Vol. 24 No. 2, 2017 diversity compared to the interspecific diversity (Lahaye et al. 2008). On sequence total, gap is marked with dotted line due to insertion or deletion. Variance of intraspecific and interspecific must be compared depending on the determined barcode of genetic locus (Tamura et al. 2013). Thus, barcoding gap between intra and interspesific diversities was determined using graphic and distribution of intra and interspesific diversities on Kimura-2-parameter (K2P) distance. Generally, Table 6 shows that the average value of interspecific distances are higher than intraspecific distances in accordance with previous study of Lahaye et al. (2008). The present study showed that the average value of interspecific and intraspecific distances were higher for the matK region than that for rbcL region. Furthermore, the intraspecific variation of matK region for Loranthaceae was 0.012, slightly different from Santalaceae (0.010). Intraspecific variation of rbcL region for Loranthaceae was 0.003 and slightly different from Santalaceae (0.010). Interspecific variations of matK region were 0.128 and 0.156 for Loranthaceae and Santalaceae, respectively. On the other hand, interspecific variations of rbcL region were 0.064 and 0.042 for Loranthaceae and Santalaceae, respectively. Value of interspecific distances of rbcL region for Loranthaceae and Santalaceae reported in this study were similar to the results reported by Kwanda et al. (2013), which was 0.032 - 0.067. The present study showed that nucleotide variations in intraspecific and interspecific species were applicable whenever the tags were compared. Analysis of intra and interspecific distances showed a barcoding gap in Santalaceae (V. articulatum) using matK region (Fig. 4) and Loranthaceae using rbcL region (Fig. 5). However, the finding of barcoding gap using genetic locus of matK and rbcL still needs improved accuracy by increasing the number of samples. According to Liu et al. (2011), the more overlap occurs between intraspecific and interspecific distances, the less effective of barcode region that can be chosen as a candidate DNA barcode due to the condition of the region. Only the region that has a smaller intraspecific variation than interspecific can be a candidate DNA barcode. In the case of interspesific variety, matK and rbcL regions used in this study for Loranthaceae and Santalaceae were considered to have good distinctive ability, as shown from the gap. Table 6 Average value of intraspecific and interspecific distances calculated using a Kimura-2-parameter model Family Average of intraspecific distance Average of interspecific distance matK rbcL matK rbcL Loranthaceae 0.012±0.017 0.003±0.006 0.128±0.091 0.064±0.029 Santalaceae 0.010±0.013 0.010±0.013 0.156±0.087 0.042±0.013 Note: Data are presented as mean±SD Figure 4 Distibutions of intraspecific K2P and interspecific K2P in matK region showing barcoding gap in Santalaceae family 147 DNA barcode characterization of mistletoe infestation in teak – Muttaqin et al. Phylogenetic Analysis The aim of phylogenetic analysis is to confirm the kinship of individual samples. It is expected that the individual samples can be grouped based on taxonomical similarity, at the species, genus or family levels and be confirmed with high value of Consistency Index (CI). The present study showed that preliminary results of BLAST sequences matched with the same DNA sequence or has a close resemblance to teak mistletoe species (Table 7). Results of species identification conducted using BLAST analysis (Table 7) were different from results of species identification conducted based on morphological characteristics (Table 3); for example Dendrophthoe curvata (Table 7) is Table 7 Identification results of teak mistletoe using DNA barcode No. Codea Region BLAST analysis result Identification (%) Accession code (NCBI) 1 D1 matK Dendrophthoe curvata 99 EU544424.1 rbcL Dendrophthoe pentandra 100 HQ317759.1 2 M1 matK Macrosolen cochinchinensis 99 KP093836.1 rbcL Macrosolen cochinchinensis 99 HQ317768.1 3 V1 matK Viscum articulatum 99 EF464496.1 rbcL Viscum articulatum 99 KF496504.1 4 D2 matK Dendrophthoe pentandra 99 AB924787.1 rbcL Dendrophthoe pentandra 100 HQ317759.1 5 M2 matK Macrosolen cochinchinensis 99 KP093836.1 rbcL Macrosolen cochinchinensis 99 HQ317768.1 6 V2 matK Viscum articulatum 99 EF464496.1 rbcL Viscum liquidambaricola 99 GQ436640.1 7 D3 matK Dendrophthoe curvata 99 EU544424.1 rbcL Dendrophthoe pentandra 100 HQ317759.1 8 M3 matK Macrosolen cochinchinensis 99 KP093836.1 rbcL Macrosolen cochinchinensis 99 HQ317768.1 9 V3 matKb Viscum articulatum - - rbcL Viscum liquidambaricola 99 EQ436640.1 aNote: refers to species code: D1 = Dendrophthoe pentandra – first replication, M1 = Macrosolen tetragonus – first replication, V1 = Viscum articulatum – first replication and so on b indicates that the amplification was not successful in matK region (primer matK-3F, matK-3R) Figure 5 Distibutions of intraspecific K2P and interspecific K2P in rbcL region showing barcoding gap in Loranthaceae family 148 BIOTROPIA Vol. 24 No. 2, 2017 different from Dendrophthoe pentandra (Table 3), Viscum liquidambaricola (Table 7) is different from Viscum articulatum (Table 3). Table 7 also shows different species name from the samples, i.e. D1 and D3 at matK region and V2 and V3 at rbcL region. Degree of accuracy of species identification using BLAST analysis is presented in Table 8. Analysis of DNA barcode using matK region could identify D. pentandra up to species level (one individual) with homology value of 99% and up to genus level (two individuals) with homology value of 99%. matK region could also identify M. tetragonus up to genus level (three individuals) with homology value of 99%, but could not identify M. tetragonus up to species level due to unavailable sequence data of M. tetragonus in the Gen Bank database and BOLD system which were used as the references. Furthermore, this region could identify V. articulatum up to species level (two individuals) with homology value of 99%. On the other hand, analysis of DNA barcode using rbcL region could identify D. pentandra up to species level (three individuals) with homology value of 100%, M. tetragonus up to genus level (three individuals) with homology value of 99% and V. articulatum up to species level (one individual) and genus level (two individuals) with the same homology values of 99%. Thus, Table 8 shows the degree of similarity (homology) obtained from BLAST analysis having homology values ranged from 99 to 100%. Scientific names of the three mistletoe species are listed in the Plant List (http://www.theplantlist. org) in which Dendrophthoe pentandra has 'accepted' status with confidence level **; Macrosolen tetragonus has 'unresolved' status with confidence level *; Viscum articulatum has 'accepted' status with confidence level **. Table 8 also shows that DNA barcoding using matK and rbcL regions is more accurate to distinguish samples up to genus and species levels compared to morphological characteristics. However, the present study showed that matK region has better ability to discriminate than rbcL region. This finding is consistent with studies reported by Hollingsworth et al. (2009) and Novianty (2016). rbcL region has high amplification success and is easily sequenced for many species. On the other hand, matK region is difficult to amplify, but has high accuracy to distinguish up to species level (Koch et al. 2008; Trang et al. 2015). The present study showed that amplification of sample V3 was not successfully conducted using matK region (Table 7). Table 8 Degree of accuracy of species identification based on matK and rbcL regions using BLAST analysis No. Codea Region BLAST analysis result Identification (%) Accession code (NCBI) 1 D1 matK Dendrophthoe curvata 99 EU544424.1 rbcL Dendrophthoe pentandra 100 HQ317759.1 2 M1 matK Macrosolen cochinchinensis 99 KP093836.1 rbcL Macrosolen cochinchinensis 99 HQ317768.1 3 V1 matK Viscum articulatum 99 EF464496.1 rbcL Viscum articulatum 99 KF496504.1 4 D2 matK Dendrophthoe pentandra 99 AB924787.1 rbcL Dendrophthoe pentandra 100 HQ317759.1 5 M2 matK Macrosolen cochinchinensis 99 KP093836.1 rbcL Macrosolen cochinchinensis 99 HQ317768.1 6 V2 matK Viscum articulatum 99 EF464496.1 rbcL Viscum liquidambaricola 99 GQ436640.1 7 D3 matK Dendrophthoe curvata 99 EU544424.1 rbcL Dendrophthoe pentandra 100 HQ317759.1 8 M3 matK Macrosolen cochinchinensis 99 KP093836.1 rbcL Macrosolen cochinchinensis 99 HQ317768.1 9 V3 matKb Viscum articulatum - - rbcL Viscum liquidambaricola 99 EQ436640.1 aNote: refers to species code: D1 = Dendrophthoe pentandra – first replication, M1 = Macrosolen tetragonus – first replication, V1 = Viscum articulatum – first replication, and so on. b indicates that the amplification was not successful in matK region (primer matK-3F, matK-3R) 149 DNA barcode characterization of mistletoe infestation in teak – Muttaqin et al. Figure 6 Phylogeny tree based on matK region at family level using Neighbor-Joining (NJ) tree method (Note: (a) Loranthaceae family; (b) Santalaceae family; GB = GenBank; OG = Out group) Studying family of certain species can be explained by reconstructing phylogeny tree of the family. In the cladogram, species belong to one family are located in an adjacent clade. Small clade is suspected of having very small differences in base sequence (Zuazo & Agnarson 2010). Phylogenetic trees of Loranthaceae and Santalaceae families are presented in Figure 6 and 7. Both figures show consistency value of bootstrap that diverse on every locus of phylogeny tree. matK region has bootstrap value range of 33 – 100 for Loranthaceae family and range of 47 – 100 for Santalaceae family. rbcL region has bootstrap value range of 28 – 100 for Loranthaceae family and range of 69 – 100 for Santalaceae family. Higher bootstrap value indicates higher stability of phylogeny tree branch. matK and rbcL regions of the three samples of the respective D. pentandra and M. tetragonus (Loranthaceae) form separate clades of both species and it is called monophyletic. The same result interpretation can also be applied on the two samples of V. articulatum (Santalaceae) which included as monophyletic. Figure 6a & 7a shows that D. pentandra and M. tetragonus form separate clades. These figures also show that the two mistletoe species were truly different species based on both matK and rbcL regions. 150 (a) (b) BIOTROPIA Vol. 24 No. 2, 2017 Figure 7 Phylogeny tree based on rbcL region at family level using Neighbor-Joining (NJ) tree method (Note: (a) Loranthaceae family; (b) Santalaceae family; GB = GenBank; OG = Out group) CONCLUSIONS DNA barcoding gap results obtained in this study showed that matK and rbcL regions had an average value of interspecific distances that were higher than intraspecific one. The results suggested that those regions could be accurate candidates of DNA barcode for distinguishing the two mistletoe species i.e. Dendrophthoe pentandra and Macrosolen tetragonus having similar leaf morphological characteristics and belonging to Loranthaceae family. These regions could also identify Viscum articulatum and other species belonging to Santalaceae family. Application of matK and rbcL regions was able to distinguish those three mistletoe species up to species and genus levels. ACKNOWLEDGEMENTS This study was funded by DIPA SEAMEO BIOTROP 2015 (No. 045.17/PSRP/SC/SPK- PNLT/III/2015). The authors thank Mr Suwarno, Head of Research and Development Center Perhutani and the technical staff for their kind assistance in sample collections. REFERENCES Anwar A. 2015. Variasi morfologi daun dan sekuens ITS2 pada jelutung darat (Dyera costulata (Miq.)Hook.f) dan jelutung rawa (Dyera polyphylla (Miq.) Steenis) [Master Thesis]. Bogor (ID): Institut Pertanian Bogor. Barbu C. 2012. Impact of white mistletoe (Viscum album ssp. Abietis) infection on needles and crown morphology of Silver fir (Abies alba Mill.). Not Bot Horti Agrobo 40(2):152-8. Dev SA, Muralidharan EM, Sujanapal P, Balasundaran M. 2014. Identification of market adulterants in East Indian sandalwood using DNA barcoding. Ann For Sci 71:517–22. Dick CW, Kress WJ. 2009. Dissecting tropical plant diversity with forest plots and a molecular toolkit. J Biosci 59:745-55. 151 (a) (b) DNA barcode characterization of mistletoe infestation in teak – Muttaqin et al. Drescher J, Rembold K, Allen K, Beckschäfer P, Buchori D, Clough Y, …, Scheu S. 2016. Ecological and socio-economic functions across tropical land use systems after rainforest conversion. Phil. Trans. R. Soc. B 371:20150275. doi: 10.1098/ rstb.2015.0275. Ellis B, Douglas CD, Leo JH, Kirk RJ, John DM, Peter W, Scott LW. 2009. Manual of leaf architecture. Ithaca (US): Cornell University Press. 200 p. Fazekaz AJ, Kuzmina ML, Newmaster SG, Hollingsworth PM. 2012. DNA barcoding methods for land plants. Methods Mol Biol 858:223-52. doi: 10.1007/978-1-61779-591-6-11. Gembong T. 2001. Morfologi Tumbuhan. Yogyakarta (ID): Gadjah Mada University Press. 262 p. Hasanbahri S, Marsono Dj, Hardiwinoto S, Sadono R. 2014. Infestation of mistletoe on several ages of teak plantation in Begal Forest Sub-District, Ngawi Forest District, East Java. J. Human and Environ 21(2):195-201. Hollingsworth PM, Forrest LL, Spouge JL, Haji babaei M, Ratnasingham S, van der Bank M, Chase MW, Cowan RS, Erickson DL, Faazekas AJ et.al. 2009. DNA barcode for land plants. Proc Natl Acad Sci USA 106:12794-7. Hollingsworth PM, Graham SW, Little DP. 2011. Choosing and using a plant DNA barcode. Plos One 5(6):e19254. Kadir A, Lukito E, Adhi S, Insap S. 2012. Experiments of zernike moments for leaf identification. JATIT 41(1):82-93. Koch MA, Calonje M, Gong W. 2008. Non-Coding nuclear DNA markers in Phylogenetics reconstruction. Plant Syst Evol. 282:257-80. Kremer A, Dupouey JL, Deans JD, Cottrell J, Csaikl U, Finkeldey R, …, Badeau V. 2002. Leaf morphological differentiation between Quercus robour and Querqus petraea is stable across western European mixed Oak stands. Ann For Sci 59: 777-87. Kwanda N, Kowit N, Runglawan S, Tawatchai T, Arunrat C. 2013. Medicinal parasitic plants on diverse hosts with their usages and barcodes. J Nat Med 67:438-45. Available from: http://kpi.msu.ac.th/upload/ ag_tor_ref_byval/ag_14_in_3.2.2_35(2556).pdf.doi 10.1007/s11418-012-0695-2. Retrieved on 18 March 2016. Lahaye R, Van der BM, Bogarin D, Warner J, Pupulin F, Gigot G, Maurin O, Duthoit S, Barraclough TG, Savolainen V. 2008. DNA barcoding the floras of biodiversity hotspots. Proc. Natl. Acad. Sci. U.S.A. 105(8):2923-8. Liu J, Moller M, Gao LM, Zhang DQ, Li DJ. 2011. DNA barcoding for the discrimination of Eurisian yews (Taxus L.; Taxaceae) and discovery of cryptic species. Mol Ecol Resour 11(1): 89–100. doi:10.1111/j.1755-0998.2010.02907. Marazzi B, Endress PK, de Queiroz LP, Conti E. 2006. Phylogenetic relationships within senna (Leguminosae, Cassiinae) based on three chloroplast DNA regions: patterns in the evolution of floral symmetry and extrafloral nectaries. Am J Bot 93(2):288-303. Mishra P, Kumar A, Nagireddy A, Mani DN, Shukla AK, Tiwari R, Sundaresan V. 2016. DNA barcoding an efficient tool to overcome authentication challenges in the herbal market. Plant Biotech J 14(1):8-21. Minitab Inc. 2007. Meet Minitab 15 for Windows. US: Minitab Inc. Muttaqin Z, Budi SWR, Wasis B, Siregar IZ, Corryanti. 2016. Assessing intensity of mistletoe infestation in teak clonal seed orchard (CSO) Padangan, East Java. Procedia Environmental Sciences 33:404-15. doi: 10.1016/j.proenv.2016.03.091. Novianty L. 2016. Karakterisasi DNA barcode pada lima jenis pohon langka di PT. Restorasi Ekosistem Indonesia (Jambi) [Master Thesis]. Bogor (ID): Institut Pertanian Bogor. Purushothaman N, Newmaster SG, Ragupathy S, Stalin N, Suresh D, Arunraj DR, … , Parani M. 2014. A tiered barcode authentication tool to differentiate medicinal Cassia species in India. Genet Mol Res 13(2):2959-68. SPSS Inc. 2007. SPSS Statistics Base 17.0 User's Guide. Chicago (US): SPSS Inc. Stoeckle MY, Gamble CC, Kirpekar R, Young G, Ahmed S, Little DP. 2011. Commercial teas highlight plant DNA barcode identification successes and obstacles. Sci Rep 1(42):1-7. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725-9. Trang NTP, Duc NM, Sinh NV, Triest L. 2015. Application of DNA barcoding markers to the identification of Hopea species. Genet. Mol. Res. 14(3):9181-90. Tudge C. 2000. The variety of life: a survey and a celebration of all the creatures that have ever lived. New York (US): Oxford University Press. 704 p. Valentini A, Pompanon F, Taberlet P. 2009. DNA barcoding for Ecologists. Trends Ecol Evol 24(2):110-7. Wu SG, Forrest SB, Eric YX, Yu-Xuan W, Yi-Fan C, Qiao- Liang X. 2007. A leaf recognition algorithm for plant classification using probabilistic neural network. In signal processing and Information technology. 11-16. Zuazo XV, Agnarson I. 2010. Shark tales: a molecular species-level phylogeny of sharks (Selachimorpha, Chondrichthyes). San Juan (PR): Department of Biology, University of Puerto Rico. 152 BIOTROPIA Vol. 24 No. 2, 2017 Page 1 Page 2 Page 3 Page 4 Page 5 Page 6 Page 7 Page 8 Page 9 Page 10 Page 11 Page 12 Page 13