1 Volume 22 2023 e237697 Original Article Braz J Oral Sci. 2023;22:e237697http://dx.doi.org/10.20396/bjos.v22i00.8667697 1 Hematology and Hemotherapy Foundation of Amazonas State, Manaus, AM, Brazil. 2 National Institute of Amazonian Research, Manaus, AM, Brazil. 3 Superior School of Health Sciences, University of Amazonas State, Manaus, AM, Brazil. 4 Hematology and Hemotherapy Center, University of Campinas, Campinas, SP, Brazil. Corresponding author: Daniel Saito Email: dsaito@uea.edu.br, danielsaito@yahoo.com Address: Escola Superior de Ciências da Saúde, Universidade do Estado do Amazonas Av. Carvalho Leal, 1777, Cachoeirinha, Manaus, Amazonas, Brasil CEP 69.065-001 (+55 92) 99110-0005 Editor: Dr. Altair A. Del Bel Cury Received: November 28, 2021 Accepted: June 10, 2022 Oral mucositis and microbial status in acute lymphoblastic leukemia subjects undergoing high-dose chemotherapy Ana Cláudia Nunes Duarte1 , Anderson Nogueira Barbosa2 , Cristiane Pereira Borges Saito3 , Erich Vinicius de Paula4 , Daniel Saito3,* Aim: To assess oral microbial status in patients with acute lymphoblastic leukemia (ALL) undergoing high-dose chemotherapy and to unravel possible associations between nosocomial pathogens and the establishment of chemotherapy-induced oral mucositis (CIOM). Methods: Oral mucosa, saliva, and peripheral blood samples were collected from 46 ALL subjects one day prior to chemotherapy (D0) and 2 weeks after treatment initiation (D14). Clinical intraoral inspection was performed by a single practitioner, with mucositis classification performed according to the WHO oral toxicity scale. Blood components were quantified by automatic flow cytometry, while oral Staphylococcus aureus and Pseudomonas aeruginosa were detected by Polymerase Chain Reaction with species-specific primers. Associations among bacteria and clinical findings were determined by Fisher’s Exact test, longitudinal bacterial changes by paired Macnemar, and correlations among blood parameters and mucositis status or bacteria via Mann-Whitney. Results: S. aureus displayed higher detection rates at D14 (p < 0.05) and was positively associated with mucositis, adoption of a non-solid diet (all p < 0.001), nausea and fever (all p < 0.05). Conversely, P. aeruginosa did not correlate to CIOM clinical parameters. At the systemic standpoint, lower hemoglobin levels associated with CIOM and fever events (all p < 0.01). Conclusion: The study evidences S. aureus as a potential pathogen in ALL-CIOM, reaffirming microbial control as an important preventive measure during high-dose immunosuppressive therapy. The weight of non-white-blood-cell parameters should be validated as novel CIOM biomarkers in prospective research. Keywords: Oral mucositis. Acute Lymphoblastic Leukemia. Antineoplastic agents. Polymerase chain reaction. Bacteria. https://orcid.org/0000-0003-1492-2930 https://orcid.org/0000-0001-6112-6190 https://orcid.org/0000-0002-6250-4795 https://orcid.org/0000-0003-1539-7912 https://orcid.org/0000-0001-5820-9892 2 Duarte et al. Braz J Oral Sci. 2023;22:e237697 Introduction Acute lymphoblastic leukemia (ALL) is the most prevalent cancer in childhood and the second most common leukemia variant in adults1,2. For decades, the admin- istration of chemotherapeutic agents (chemotherapy) has been the gold standard treatment approach for ALL, offering high success rates that may vary according to patient age, disease subtype, clinical profile and country of origin2-4. Although immu- nosuppressive therapy represents a pillar strategy in cancer, it frequently engen- ders a serious side-effect known as mucositis, with prevalence ranging from 30% to 98% of patients5-8. Indeed, oral mucositis (OM) is considered the most debilitating isolated condition during antineoplastic therapy9, bearing significant impact on the patient’s quality of life, treatment adherence, and prognosis10,11. It is especially sig- nificant in cases requiring hematopoietic stem cell transplantation, where high-dose therapeutic regimens are more commonly required11. In this reality, a significant portion of leukemia patients is expected to develop at least some degree of OM in the first weeks of hospitalization8 and, therefore, caregivers must be prepared to be involved responsibly. Despite its undeniable relevance for adherence and prognosis of cancer treatment, the pathobiological mechanisms that govern OM have not been fully disclosed, often leading caregivers to commit to multi-agent therapy in the hope of increasing favor- able outcome12. OM is currently regarded as a cascade result of biologically com- plex host-related events10,13 with proinflammatory mediators harboring important predisposing effects10,11,14. At the cellular level, chemical toxicity to epithelial cells is believed to be the prevailing factor12, leading to cellular alterations, apoptosis and dose-dependent enlargement of the intercellular space15. On the other hand, over the past two decades, research on the role of the oral microbiome in OM has yielded contrasting results. Although the reduction of anaerobic Gram-negatives and fungi by broad-spectrum antimicrobials has yielded positive impact on radiotherapy-induced oral mucositis (RIOM)16,17, the taxonomic identity of bacteria at the species level has not yet reached clear consensus. More recently, oral dysbiosis has been highlighted as a key factor in the establishment and duration of both chemotherapy-induced oral mucositis (CIOM) and RIOM, with the potential involvement of periodontopathogen groups revealed by molecular-based methodologies18,19. Moreover, upregulation of chemotherapy-induced mucosal inflammatory factors by specific bacterial species was observed in an in vitro model of CIOM, suggesting a mechanism of drug and microbe collusion15. Nevertheless, the relevance of unconventional and non-oral bac- terial consortia in the onset and severity of CIOM remains unattended7, reaffirming the importance of complementary disease association initiatives20. Considering the existing evidence and the prolonged period of hospitalization rec- ommended by ALL treatment guidelines, the involvement of nosocomial pathogens in CIOM should not be ruled out. In this sense, we evaluated 14-day longitudinal changes in OM status, peripheral blood components, and presence of the opportu- nistic pathogens S. aureus and P. aeruginosa in ALL patients undergoing a high-dose canonical chemotherapy regimen, to shed additional light into the biological factors governing CIOM. 3 Duarte et al. Braz J Oral Sci. 2023;22:e237697 Materials and Methods Ethical considerations: The study was approved by the Human Research Ethics Com- mittee of the Amazonas State University (UEA, Manaus, Amazonas, Brazil, CAAE num- ber 46295215.0.0000.5016) in compliance with the 196/96 Resolution of the National Health Council of the Brazilian Health Ministry and the 7th version of the Declaration of Helsinki (2013). Written informed consent was obtained from all the participants, parents, or legal guardians, prior to sample collection. Patient selection: The study population consisted of acute lymphoblastic leuke- mia (ALL) patients regularly attended at the Hematology and Hemotherapy Hos- pital Foundation (FHEMOAM, Manaus, Amazonas, Brazil). Diagnosis was made by clinical and laboratorial analysis, including complete blood count, myelogram and immunophenotyping by flow cytometry, according to the guidelines of the Brazil- ian Cooperative Group for Treatment of Childhood ALL (GBTLI ALL-99)12. Volun- teers were recruited from patients referred for chemotherapy, regardless of gen- der and age. Individuals previously submitted to antibiotic therapy in the 3-month period prior to sample collection, as well as those with systemic comorbidities, were not included. Samples were collected within the “remission induction phase” of the GBTLI ALL-99 protocol, in which low and high risk subjects were treated with a unified drug cocktail. The chemotherapy regimen consisted of a combina- tion of prednisone (40 mg/m2/day), vincristine (1.5 mg/m2/week), L-asparaginase (5000 UI/m2/day), and daunorubicin (25 mg/m2/week) coupled with intrathecally delivered methotrexate, cytarabine and dexamethasone with doses adjusted by age group21. Whole blood collection and cell flow cytometry analysis: Peripheral blood samples were collected by venipuncture as part of the routine follow-up of ALL treatment. Sam- ples were collected using 5.0 mL EDTA vacuum tubes at two distinct time points: 1 day prior to chemotherapy (D0) and 14 days after chemotherapy initiation (D14). Hemoglobin levels and platelet, leukocyte and neutrophil counts were quantified in a flow cell hematology analyzer (ADVIA 2120i, Siemens). Intraoral examination and specimen collection: Clinical examination was per- formed by a single practitioner to ensure maximum consistency. Classification of mucositis was performed according to the World Health Organization (WHO) oral toxicity scale system: Grade I (mild: oral soreness, erythema), Grade II (moder- ate: oral erythema, ulcers, solid diet tolerated), Grade III (severe: oral ulcers, liquid diet only), Grade IV (life-threatening: oral feeding impossible). Oral pain was con- sidered positive when the patient reported spontaneous oral discomfort or pain when speaking or swallowing. For maximum representation of the oral microbi- ota, samples were composed of a pool of saliva and mucosa swab samples, col- lected on D0 and D14. Samples were obtained by intraoral saliva accumulation for 1 minute, followed by displacement into 25 mL collection tubes containing Tris-EDTA buffer (TE) pH 8.0 as nucleic acid preserver. Mucosal swab samples were obtained by scratching the buccal mucosa, hard palate, buccal vestibule and mouth floor with a sterile cotton swab, followed by placement of the swab tip in the collection tubes. 4 Duarte et al. Braz J Oral Sci. 2023;22:e237697 Reference bacteria growth: Staphylococcus aureus and Pseudomonas aeruginosa reference strains were gently provided by the Oswaldo Cruz Foundation (Fiocruz, Manaus, Brazil). Bacterial cells were initially reactivated by streaking on trypticase soy agar plates at 37oC under aerobic conditions. After initial bacterial growth, one colony per species was transferred to a tube containing trypticase soy broth, and incubated in an orbital shaker at 37oC at 150 rpm for 24 hours, aiming for optimal cell growth. PCR amplification of bacterial DNA: Samples and reference bacteria were vor- texed for 1 min, sedimented by centrifugation at 10,000 x g, and the supernatant was discarded. DNA extraction was conducted with PureLink® Genomic DNA Mini Kit according to the manufacturer’s instructions, with addition of lysozyme and proteinase K to ensure lysis of Gram-negative and Gram-positive bacteria. Genomic DNA was quantified by Qubit 3.0 colorimetric assay (Invitrogen, Carls- bad, USA), and nucleic acid quality was assessed by the A260/A280 ratio, with accepted values ranging from 1.8 to 2.0. The polymerase chain reaction (PCR) was performed in 20 µL total volume in Veriti® thermocycler (ThermoFisher, Waltham, USA) with species-specific oligonucleotide primers (Table 1)22,23, according to the following conditions: 1 x PCR buffer, 1.5 mM MgCl2 (1,5 mM), 0.2 mM dNTPs, 0.2 µM each primer, 1.0 U Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, USA) and 5.0 ng sample DNA. The thermocycling profile for P. aeruginosa was: initial denaturation at a 94oC for 2 min, followed by 25 cycles of DNA denaturation at 94oC for 1 min, primer annealing at 60oC for 40 sec, DNA extension at 72oC for 30 sec, and a final extension step at 72oC for 2 min. The thermocycling profile for S. aureus was: initial denaturation at a 94oC for 2 min, followed by 25 cycles of DNA denaturation at 94oC for 1 min, primer annealing at 55oC for 30 sec, DNA extension at 72oC for 30 sec, and a final extension step at 72oC for 2 min. PCR amplicons from reference bacteria (positive controls) and clinical samples were subjected to agarose gel electrophoresis. For this purpose, 3.0 µL of the amplified DNA was loaded into a 1.5 % agarose gel prepared with 1x TBE buffer (0.002 M EDTA, 0.089 M Tris, 0.089 M Boric acid) and Gelred stain (Biotium). Samples were electrophoretically shifted under 700 mA for 60 min, using 1 Kb Plus DNA Ladder (Invitrogen) as the amplicon size reference. The DNA was then visualized under UV for validation of PCR efficiency and specificity, and digitally registered via tran- silluminator (L-PIX, Loccus Biotecnologia). Statistical analysis: The Shappiro-Wilk test was used as preliminary tool to ver- ify data distribution. Associations among oral bacteria and clinical findings were assessed by Fisher’s Exact test, or by the Chi-square test with Yates correc- tion when applicable. Associations among blood parameters and mucositis or oral bacteria were evaluated with the Mann-Whitney test. Differences in bacteria detection frequencies between timeframes were assessed using paired-sample McNemar test. Results Overall, 46 ALL patients, 27 males (58.7%) and 19 females (41.3%) ranging from 2 to 59 years-old (median 7.5 years-old) were analyzed. Patient clinical, hematological 5 Duarte et al. Braz J Oral Sci. 2023;22:e237697 and dietary features are summarized in Table 2. In terms of oral health status, 19 subjects (41.3%) developed at least some degree of OM after 14 days of chemo- therapy initiation, with the majority of cases represented by grade 1. PCR detection of bacteria revealed P. aeruginosa in 5/46 (10.9%) and 9/46 (19.6%) subjects, and S. aureus in 11/46 (23.9%) and 20/46 (43.6%) subjects (D0 and D14 respectively), with a paired sample Mcnemar test indicating significantly increased detection rates at D14 for S. aureus (p = 0.035), but not for P. aeruginosa (p = 0.344). Moreover, S. aureus was significantly associated with mucositis, fever, nausea, and adoption of semi-solid or liquid diet, whereas P. aeruginosa did not correlate with clinical or dietary parameters (Table 3). At the systemic standpoint, the application of the Mann-Whitney non-parametric test among blood component levels (hemoglobin, platelets, neutrophils and leucocytes), OM status and bacterial detection unveiled significant associations between lower hemoglobin levels (at D0 and D14) and OM onset, as well as between lower hemoglobin levels (at D14) and P. aeruginosa, as described in Figure 1. Table 1. Species-specific oligonucleotide PCR primers used in the study. Target species gene Oligonucleotide sequence Amplicon size Pseudomonas aeruginosa oprL Forward 5’–ATGGAAATGCTGAAATTCGGC–3’ 504 bp Reverse 5’–CTTCTTCAGCTCGACGCGACG–3’ Staphylococcus aureus nuc Foward 5’–GCGATTGATGGTGATACGGTT–3’ 447 bp Reverse 5’–AGCCAAGCCTTGACGAACTAAAGC–3’ Table 2. Clinical, dietary, and blood parameters of 46 ALL subjects submitted to high-dose chemotherapy regimen. Clinical features (n) D0 D14 Systemic features Fever 17 (37.0%) 16 (34.8%) Nausea 12 (26.1%) 12 (26.1%) Diarrhea 8 (17.4%) 3 (6.5%) Oral mucositis Grade 0 (no mucositis) 46 (100%) 27 (58.7%) Grade 1 (mild) 0 12 (26.1%) Grade 2 (moderate) 0 3 (6.6%) Grade 3 (severe) 0 2 (4.3%) Grade 4 (life-threatening) 0 2 (4.3%) Continue 6 Duarte et al. Braz J Oral Sci. 2023;22:e237697 Continuation Diet type and administration (n) Free diet, oral 46 (100%) 27 (58.7%) Semi-solid, oral 0 14 (30.4%) Liquid, oral 0 5 (10.9%) Liquid, nasogastric tube 0 0 Liquid, parenteral 0 0 Blood parameters (median, IQR) D0 D14 Leukocyte (cells/mL) 10,965 (19,617) 9,003 (19,022) Neutrophil (cells/mL) 4,008 (7,494) 3,143 (7,393) Platelets (per mL) 85,156 (67,593) 84,451 (64,509) Hemoglobin (g/dL) 8.55 (3.48) 7.70 (3.41) Table 3. PCR detection of P. aeruginosa and S. aureus in 46 acute lymphoblastic leukemia patients 14 days after high-dose chemotherapy initiation (D14), according to clinical and dietary parameters. Parameter Parameter status/type Positive for P. aeruginosa Positive for S. aureus Mucositis observed 26.3% (5/19) † 78.9% (15/19) † ** not observed 14.8% (4/27) 18.5% (5/27) Oral pain observed 40.0% (2/5) † 80.0% (4/5) † not observed 17.1% (7/41) 22.0% (9/41) Fever observed 31.3% (5/16) † 68.8% (11/16) † * not observed 13.3% (4/30) 30.0% (9/30) Nausea observed 16.7% (2/12) † 75.0% (9/12) † * not observed 58.8% (20/34) 29.4% (10/34) Diet type I 14.8% (4/27) † 18.5% (5/27) † ** type II 26.3% (5/19) 78.9% (15/19) † Chi-square Test with Yates correction; † Fisher Exact Test (* p < 0.05; ** p < 0.001). Diet type I = free consistency; Diet type II = liquid or semi-solid 7 Duarte et al. Braz J Oral Sci. 2023;22:e237697 D0 D14 12.5 10.0 7.5 5.0 A H em og lo bi n (g /d L) ** ** 150000 100000 50000 Pl at el et s/ m m 3 Le uk oc yt es /m m 3 60000 40000 20000 0 B C 20000 10000 0 D N eu tro ph ils /m m 3 Mucosistis: Absence Presence Absence Presence Absence Presence D0 D14 D0 D14 D0 D14 D0 D14 10.0 7.5 5.0 A H em og lo bi n (g /d L) 150000 100000 50000 Pl at el et s/ m m 3 Le uk oc yt es /m m 3 60000 40000 20000 0 B C 20000 10000 0 D N eu tro ph ils /m m 3 S._aureus: D0 D14 D0 D14 D0 D14 D0 D14 12.5 10.0 7.5 5.0 A H em og lo bi n (g /d L) 150000 100000 50000 Pl at el et s/ m m 3 Le uk oc yt es /m m 3 60000 40000 20000 0 B C 20000 10000 0 D N eu tro ph ils /m m 3 P._aeruginosa: D0 D14 D0 D14 D0 D14 Figure 1. Hemoglobin (A) levels and platelet (B), leucocyte (C) and neutrophil (D) counts according to presence of mucositis and oral bacteria in 46 acute lymphoblastic leukemia patients, at baseline (D0) and 14 days after high-dose chemotherapy initiation (D14). Mann-Whitney test (* p < 0.05, ** p < 0.01). Discussion This study was conducted to assess the influence of high dose immunosuppressive chemotherapy on oral mucositis and bacterial status, and to investigate potential relationships among the detected bacteria, oral health and systemic parameters. We chose a 14-day timeframe based on a previous report, according to which OM clinical signs peak at around 7 and 14 days after chemotherapy installment, with spontaneous resolution around a week after10. Overall, the prevalence of chemo- therapy-induced OM fell within the expected 30%-75% range reported by earlier studies24,25, but lower than those disclosed by recent research on various cancer types5,7,8. In respect to OM severity, most cases belonged to the mild grade 1 OM WHO type, with few occurrences of grade 2, and very rare cases of grades 3 and 4. 8 Duarte et al. Braz J Oral Sci. 2023;22:e237697 As the severity-based subcategorization resulted in excess of data stratification, OM was considered binomially, with statistical analysis performed regardless of clinical levels, also considering the fact that bacterial abundances are generally comparable among different OM grades20. The weight imposed by oral bacteria on OM establishment and progression has been a long-lasting concern in hematology, and the preventive effect of oral hygiene on cancer patients brings incisive clues to a pathological role in CIOM8. Although the advent of 16S rDNA-based methodologies has revealed higher rela- tive abundances of Gram-negative anaerobic bacilli and periodontopathic bacte- ria in CIOM and head-and-neck cancer RIOM18,20, the influence of non-indigenous oral species on OM rests undetermined. In this study, S. aureus and P. aeruginosa were chosen as target species due to their well-established virulence arsenal and nosocomial transmission patterns. Truthfully, both species have been described as opportunistic pathogens of the skin, open wounds, lungs and the bloodstream26,27, with S. aureus contributing to higher cancer mortality rates28, and P. aeruginosa to antibiotic-resistance related deaths in acute leukemia29, leading to the assumption of a potential role in OM. Overall, our results revealed S. aureus as a putative pathogen in CIOM, presenting significant correlation with mucositis, nausea, and adoption of non-solid diet (all p < 0.05). In accordance, S. aureus lays among the most prevalent genera in saliva, buccal mucosa and lateral tongue of radio and chemotheray-treated subjects20,30 and has been previously detected in intra and extra-oral complications, including apical periodontitis and panstomatitis30-33. Here, oral microbiome disruption promoted by chemotherapeutic agents34 could be the prevailing determinant for S. aureus higher proliferation rates at D14, but prospective research based on broad microbial detec- tion techniques should be conducted to validate such hypothesis. Furthermore, the association between blood stream detection of S. aureus and severe cases of CIOM has already been pointed out previously33, partially accrediting our observations and, at the same time, suggesting the oral-to-bloodstream route as a potential path- way to bacteremia. On the other hand, although an increase in the number of sub- jects harboring P. aeruginosa was detected at D14 when compared to D0, we could not disclose relevant associations between this species and the establishment of OM, bestowing the results of a 16S rDNA-based study on CIOM in various cancer types34. Taken together, the results, along with the evident ubiquity of S. aureus in chemo and radiotherapy-treated cancer patients20,30, stress the need for thorough oral microbial characterization in ALL prior to chemotherapy installment as CIOM risk-assessment measure. We also believe that judicious administration of antimi- crobials is an important preventive step towards mitigation of OM, as previously illustrated by the positive outcomes obtained with broad-spectrum antibiotics such as tobramycin16,17. This holds greater importance for neutropenic subjects, whom are susceptible to bacteremia by S. aureus, thus prone to life-threatening risk30. It is worth noting that, even though our results indicate S. aureus as a putative pathogen in CIOM, dysbiosis could still be playing a relevant role18,27 and, in this reality, efforts should be taken in assessing the ecological interactions that, together, could boost the cytotoxic effects elicited by chemotherapy34. 9 Duarte et al. Braz J Oral Sci. 2023;22:e237697 Finally, the results also revealed a positive correlation between S. aureus and fever in ALL (D14) (p < 0.05). Nonetheless, since the presence of S. aureus was not directly assessed in peripheral blood, a systemic culprit could not be defined. In addition, as lower peripheral hemoglobin and platelet levels (both at D0 and D14) related to pyrexia (at D14) (Mann-Whitney, p < 0.01 and p < 0.05, respectively) (figure 1), the results point to underlying host-related mechanisms that may deserve further consideration. At the systemic standpoint, our results revealed that curtailed hemo- globin levels (at D0 and D14) are predictive of OM onset at D14 (Mann Whitney, p < 0.01) (figure 1) and are generally in line with the recent observations obtained in severe OM associated with head and neck cancer radiotherapy35, suggesting non-white-blood-cell (non-WBC) parameters as promising variables for future inves- tigations. On the other hand, we did not detect significant associations among neutrophil and leukocyte counts with systemic or intraoral clinical parameters, partially contrasting the findings of the same study. Regarding the association of peripheral blood components and bacteria, an inverse correlation was observed between hemoglobin levels and PCR detection of P. aeruginosa in saliva and muco- sal samples. All other blood parameters had no relevant influence on either P. aeru- ginosa or S. aureus detection rates. In conclusion, this study suggests S. aureus as a putative pathogen in ALL-CIOM and emphasizes the importance of preventive measures during the early stages of high-dose immunosuppressive therapy, including the adoption of higher oral hygiene standards and intrahospital professional oral assistance. Finally, the pre- dictive power of non-WBC peripheral blood components in ALL-CIOM should be appraised in prospective research, aiming for more precise diagnosis and risk-di- rected case management. Acknowledgements We would like to thank the Brazilian funding agencies Fundação de Amparo à Pesquisa do Estado do Amazonas - FAPEAM (024/2014) and Conselho Nacional de Desenvolvi- mento Científico e Tecnológico - CNPq (485568/2012) for financial support, and the FHEMOAM staff for clinical and technical assistance. Conflicts of interest The authors declare that there are no conflicts of interest in this work. Author contribution ACN Duarte: Study conception, sample collection, laboratory analysis; AN Barbosa: Laboratory analysis; CPB Saito: Stylistic manuscript revision; EV de Paula: Study Design, manuscript revision; D Saito: Study Design, manuscript drafting; All authors have revised and approved the final version of the manuscript. 10 Duarte et al. Braz J Oral Sci. 2023;22:e237697 References 1. Mohseni M, Uludag H, Brandwein JM. Advances in biology of acute lymphoblastic leukemia (ALL) and therapeutic implications. Am J Blood Res. 2018 Dec 10;8(4):29-56. 2. Terwilliger T, Abdul-Hay M. Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer J. 2017 Jun;7(6):e577. doi: 10.1038/bcj.2017.53. 3. Pui C-H, Yang JJ, Bhakta N, Rodriguez-Galindo C. Global efforts toward the cure of childhood acute lymphoblastic leukemia. Lancet Child Adolesc Health. 2018 Jun;2(6):440-54. doi: 10.1016/S2352-4642(18)30066-X. 4. Kato M, Manabe A. Treatment and biology of pediatric acute lymphoblastic leukemia. Pediatr Int. 2018 Jan;60(1):4-12. doi: 10.1111/ped.13457. 5. He M, Zhang B, Shen N, Wu N, Sun J. A systematic review and meta-analysis of the effect of low-level laser therapy (LLLT) on chemotherapy-induced oral mucositis in pediatric and young patients. Eur J Pediatr. 2018 Jan;177(1):7-17. doi: 10.1007/s00431-017-3043-4. 6. Spielberger R, Stiff P, Bensinger W, Gentile T, Weisdorf D, Kewalramani T, et al. Palifermin for oral mucositis after intensive therapy for hematologic cancers. N Engl J Med. 2004 Dec;351(25):2590-8. doi: 10.1056/NEJMoa040125. 7. Vozza I, Caldarazzo V, Ottolenghi L. Changes in microflora in dental plaque from cancer patients undergoing chemotherapy and the relationship of these changes with mucositis: a pilot study. Med Oral Patol Oral Cir Bucal. 2015 May;20(3):e259-66. doi: 10.4317/medoral.19934. 8. Legert KG, Remberger M, Ringdén O, Heimdahl A, Dahllöf G. Reduced intensity conditioning and oral care measures prevent oral mucositis and reduces days of hospitalization in allogeneic stem cell transplantation recipients. Support Care Cancer. 2014 Aug;22(8):2133-40. doi: 10.1007/s00520-014-2190-7. 9. Bellm LA, Epstein JB, Rose-Ped A, Martin P, Fuchs HJ. Patient reports of complications of bone marrow transplantation. Support Care Cancer. 2000 Jan;8(1):33-9. doi: 10.1007/s005209900095. 10. Villa A, Sonis ST. Mucositis: pathobiology and management. Curr Opin Oncol. 2015 May;27(3):159-64. doi: 10.1097/CCO.0000000000000180. 11. Lalla RV, Sonis ST, Peterson DE. Management of oral mucositis in patients with cancer. Dent Clin North Am. 2008 Jan;52(1):61-77, viii. doi: 10.1016/j.cden.2007.10.002. 12. Hong CHL, Gueiros LA, Fulton JS, Cheng KKF, Kandwal A, Galiti D, et al. Systematic review of basic oral care for the management of oral mucositis in cancer patients and clinical practice guidelines. Support Care Cancer. 2019 Oct;27(10):3949-67. doi: 10.1007/s00520-019-04848-4. 13. Sonis ST. Mucositis: The impact, biology and therapeutic opportunities of oral mucositis. Oral Oncology. 2009 Dec;45(12):1015-20. doi: 10.1016/j.oraloncology.2009.08.006. 14. Ye Y, Carlsson G, Agholme MB, Karlsson-Sjöberg J, Yucel-Lindberg T, Pütsep K, et al. Pretherapeutic plasma pro- and anti- inflammatory mediators are related to high risk of oral mucositis in pediatric patients with acute leukemia: a prospective cohort study. PLoS One. 2013 May;8(5):e64918. doi: 10.1371/journal.pone.0064918. 15. Sobue T, Bertolini M, Thompson A, Peterson DE, Diaz PI, Dongari-Bagtzoglou A. Chemotherapy- induced oral mucositis and associated infections in a novel organotypic model. Mol Oral Microbiol. 2018 Jun;33(3):212-23. doi: 10.1111/omi.12214. 16. Symonds RP, McIlroy P, Khorrami J, Paul J, Pyper E, Alcock SR, et al. The reduction of radiation mucositis by selective decontamination antibiotic pastilles: a placebo-controlled double-blind trial. Br J Cancer. 1996 Jul;74(2):312-7. doi: 10.1038/bjc.1996.359. 11 Duarte et al. Braz J Oral Sci. 2023;22:e237697 17. Spijkervet FK, Van Saene HK, Van Saene JJ, Panders AK, Vermey A, Mehta DM, et al. Effect of selective elimination of the oral flora on mucositis in irradiated head and neck cancer patients. J Surg Oncol. 1991 Mar;46(3):167-73. doi: 10.1002/jso.2930460309. 18. Hou J, Zheng H, Li P, Liu H, Zhou H, Yang X. Distinct shifts in the oral microbiota are associated with the progression and aggravation of mucositis during radiotherapy. Radiother Oncol. 2018 Oct;129(1):44-51. doi: 10.1016/j.radonc.2018.04.023. 19. Vanlancker E, Vanhoecke B, Sieprath T, Bourgeois J, Beterams A, De Moerloose B, et al. Oral microbiota reduce wound healing capacity of epithelial monolayers, irrespective of the presence of 5-fluorouracil. Exp Biol Med (Maywood). 2018 Feb;243(4):350-60. doi: 10.1177/1535370217753842. 20. Vesty A, Gear K, Biswas K, Mackenzie BW, Taylor MW, Douglas RG. Oral microbial influences on oral mucositis during radiotherapy treatment of head and neck cancer. Support Care Cancer. 2020 Jun;28(6):2683-91. doi: 10.1007/s00520-019-05084-6. 21. Cazé MO, Bueno D, dos Santos MEF. [Referential study of a chemotherapy protocol for acute lymphocytic leukemia in childhood]. Rev HCPA. 2010;30(1):5-12. Portuguese. 22. De Vos D, Lim A, Pirnay JP, Struelens M, Vandenvelde C, Duinslaeger L, et al. Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, oprI and oprL. J Clin Microbiol. 1997 Jun;35(6):1295-9. doi: 10.1128/jcm.35.6.1295-1299.1997. 23. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol. 1992 Jul;30(7):1654-60. doi: 10.1128/ jcm.30.7.1654-1660.1992. 24. Dodd MJ, Facione NC, Dibble SL, MacPhail L. Comparison of methods to determine the prevalence and nature of oral mucositis. Cancer Pract. 1996 Dec;4(6):312-8. 25. Epstein JB, Schubert MM. Oropharyngeal mucositis in cancer therapy. Review of pathogenesis, diagnosis, and management. Oncology (Williston Park). 2003 Dec;17(12):1767-79; discussion 1779-1782, 1791-2. 26. Dayan GH, Mohamed N, Scully IL, Cooper D, Begier E, Eiden J, et al. Staphylococcus aureus: the current state of disease, pathophysiology and strategies for prevention. Expert Rev Vaccines. 2016 Nov;15(11):1373-92. doi: 10.1080/14760584.2016.1179583. 27. Wu DC, Chan WW, Metelitsa AI, Fiorillo L, Lin AN. Pseudomonas skin infection: clinical features, epidemiology, and management. Am J Clin Dermatol. 2011 Jun;12(3):157-69. doi: 10.2165/11539770-000000000-00000. 28. Kang C-I, Song J-H, Chung DR, Peck KR, Yeom J-S, Son JS, et al. Bloodstream infections in adult patients with cancer: clinical features and pathogenic significance of Staphylococcus aureus bacteremia. Support Care Cancer. 2012 Oct;20(10):2371-8. doi: 10.1007/s00520-011-1353-z. 29. Zhao Y, Lin Q, Liu L, Ma R, Chen J, Shen Y, et al. Risk Factors and Outcomes of Antibiotic-resistant Pseudomonas aeruginosa Bloodstream Infection in Adult Patients With Acute Leukemia. Clin Infect Dis. 2020 Dec 23;71(Suppl 4):S386-93. doi: 10.1093/cid/ciaa1522. 30. Mathews J, Patel M. Bacterial endotoxins and microorganisms in the oral cavities of patients on cancer therapy. Microb Pathog. 2018 Oct;123:190-5. doi: 10.1016/j.micpath.2018.07.014. 31. Sunde PT, Olsen I, Debelian GJ, Tronstad L. Microbiota of periapical lesions refractory to endodontic therapy. J Endod. 2002 Apr;28(4):304-10. doi: 10.1097/00004770-200204000-00011. 32. Gibson J, Wray D, Bagg J. Oral staphylococcal mucositis: A new clinical entity in orofacial granulomatosis and Crohn’s disease. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2000 Feb;89(2):171-6. doi: 10.1067/moe.2000.101810. 12 Duarte et al. Braz J Oral Sci. 2023;22:e237697 33. González-Barca E, Carratalà J, Mykietiuk A, Fernández-Sevilla A, Gudiol F. Predisposing factors and outcome of Staphylococcus aureus bacteremia in neutropenic patients with cancer. Eur J Clin Microbiol Infect Dis. 2001 Feb;20(2):117-9. doi: 10.1007/pl00011241. 34. Ye Y, Carlsson G, Agholme MB, Wilson J a. L, Roos A, Henriques-Normark B, et al. Oral bacterial community dynamics in paediatric patients with malignancies in relation to chemotherapy-related oral mucositis: a prospective study. Clin Microbiol Infect. 2013 Dec;19(12):E559-67. doi: 10.1111/1469-0691.12287. 35. Nishii M, Soutome S, Kawakita A, Yutori H, Iwata E, Akashi M, et al. Factors associated with severe oral mucositis and candidiasis in patients undergoing radiotherapy for oral and oropharyngeal carcinomas: a retrospective multicenter study of 326 patients. Support Care Cancer. 2020 Mar;28(3):1069-75. doi: 10.1007/s00520-019-04885-z.