item: #1 of 297 id: binhm-100 author: Afrasiab, Saman R.; Mohammad, Mohammad K.; Ali, Hasan H.; Al-Moussawi, Azhar A.; Abdul-Rassoul, M. S. title: FAUNA AND FLORA OF HAWRAMAN MOUNTAIN (Part one) HAWRAMAN LOWEST ZONE, KURDISTAN PROVINCE NORTH EAST OF IRAQ date: 2013-12-01 words: 3701 flesch: 76 summary: Dendrocopos syriacus (Emprich and Ehrenberg, 1833) Syrian Woodpeckers Pica pica (L. 1850) Magpie. Two pares were seen in 25 April Clamator glandarius, L. 1758, Great spotted Cuckoo. keywords: 2010; afrasiab; amygadalus; anderson; april; arabia; area; ashkawte; baghdad; beautiful; biodiversity; birds; boiss; campanula; cave; chukar; cold; collection; common; daray; east; ecological; et al; famous; fauna; fig; fire; flora; flowers; fruit; genus; guest; hawraman; hawraman mountain; high; history; identification; important; iran; iraq; kurdistan; lahony; large; lists; mammals; mar; mohamad; mountain; mus; museum; natural; new; north; owl; papaver; plant; population; quercus; rare; rechinger; resident; rock; secondary; snake; species; step; study; succession; tawera; time; tit; trees; university; valley; variation; village; vol; water; wild; winter; yellow; انواع; بعض; نوع cache: binhm-100.pdf plain text: binhm-100.txt item: #2 of 297 id: binhm-101 author: Naser, Murtada D.; Alkhafaji, Khalid KH. S.; Yasser, Amaal GH.; Darweesh, Haider SH. title: NEW RECORD OF NANOSESARMA SARII (NADERLOO AND YURKAY, 2009) (CRUSTACEA: DECAPODA: BRACHYURA: SESARMIDAE) FROM KNOR AL-ZUBAIR, SOUTH OF IRAQ date: 2013-12-01 words: 1207 flesch: 68 summary: The current in the Khor is characterized by one direction throughout the tidal cycle towards the southern end (Arabian Gulf), with velocity exceeding 2m/sec during ebb tide and 0.66 m/sec in flood tide. Earlier records of the genus from the Arabian Gulf area was from Kuwait by Jones (1986) and Apel (2001) as Nanosesarma minutum De Man, 1887, while were referred to it as new species by Naderloo and Türkay (2009). keywords: arabian; area; basrah; brachyura; centre; decapoda; fig; figs; gulf; intertidal; iraq; khor; male; marine; naderloo; nanosesarma; naser; new; record; sarii; science; sec; species; türkay; zubair cache: binhm-101.pdf plain text: binhm-101.txt item: #3 of 297 id: binhm-102 author: Khormizi, Zare M.; Biranvand, A.; Shakarami, J. title: THE FAUNISTIC SURVEY OF LADY BEETLES (COLEOPTERA, COCCINELLIDAE) IN THE MEHRIZ REGION(YAZD PROVINCE), IRAN date: 2013-12-01 words: 2642 flesch: 60 summary: Locations of coccinellid species collected in the Mehriz region. Coccinellid species collected from the Mehriz region. keywords: alfalfa; altitudes; anterior; beetles; black; brown; coccinella; coccinellidae; coleoptera; collected; convex; different; dorsal; elytron; exochomus; family; fauna; faunistic; head; insects; iran; khormizi; lady; length; light; linnaeus; localities; majerus; margin; mehriz; mulsant; oenopia; oval; peach; plant; pronotum; region; septempunctata; site; species; spot; study; surface; survey; walnut; wheat; width; yellow; zare cache: binhm-102.pdf plain text: binhm-102.txt item: #4 of 297 id: binhm-103 author: Abdul-Ameer, Kefah N.; Al-Saadi, Abid Ali J. title: ON THE OCCURRENCE OF THE[ MONOGENEAN GYRODACTYLUS TAIMENI ERGENS, 1971 FOR THE FIRST TIME IN IRAQ ON GILLS OF THE COMMON CARP CYPRINUS CARPIO date: 2013-07-01 words: 3374 flesch: 77 summary: The first study in Iraq concerning Gyrodactylus was that on G. elegans (Ali and Shaaban, 1984), after which several studies were carried out, among which some reported new records of Gyrodactylus species in Iraq (Ali et al., 1988b; Salih et al., 1988; Abdul-Ameer, 1989; Mhaisen et al., 1990; Al-Zubaidy, 1998; Abdullah, 2002; Jori, 2006; Al-Zubaidy, 2007; Mama, 2012; Abdul-Ameer and Al-Saadi 2013, Abdullah, 2013). The other seven hosts known in Iraq are: Acanthobrama centisquama (Balasem et al., 2003), Barbus sharpeyi (Mhaisen et al., 1997), Carasobarbus luteus (Ali et al., 1988a), Carassius auratus (Asmar et al., 2003), Chondrostomum regium (Mhaisen et al., 1995), Cyprinion macrostomum (Ali et al., 1988a) and Liza abu (Mhaisen et al., 1995). keywords: 2013; abdul; abdullah; ali; ameer; arabic; asmar; baghdad; balasem; barbus; biol; carassius; carpio; common; ergens; et al; fauna; fishes; freshwater; gyrodactylus; hosts; iraq; mhaisen; monogenean; occurrence; parasite; parasitic; river; saadi; sa’adi; sci; species; study; taimeni; thesis; time; univ; zubaidy cache: binhm-103.pdf plain text: binhm-103.txt item: #5 of 297 id: binhm-104 author: Hassan, Hassan F. title: ZOOPHTHORA PHYTONOMI (ZYGOMYCETES: ENTOMOPHTHORACEAE) A NEW RECORD IN IRAQ date: 2013-07-01 words: 3014 flesch: 59 summary: On the new genera: Zoophthora gen. nov., Triposolium (Thaxter) gen. nov. and Entomophaga gen. nov. The black fluid contains rough-walled spores, black in gross observation, yet yellowish-brown to dark brown when viewed singly under a compound microscope at (320x) magnification (Fig. 1F). keywords: 1980; 320x; alfalfa; batko; ben; black; brown; bull; cadavers; classification; compound; conidia; development; different; discharged; disease; entomophthoraceae; environ; epizootic; erynia; field; fig; fungus; hassan; host; infection; kenneth; larvae; magnification; microscope; mycotaxon; new; nov; nowakowski; pathogen; percent; phytonomi; primary; species; spores; stage; symptoms; weevil; zeev; zoophthora; zygomycetes cache: binhm-104.pdf plain text: binhm-104.txt item: #6 of 297 id: binhm-105 author: Mohammad, Mohammad K.; Ali, Hassan H. title: THE BIODIVERSITY OF BAHR AL-NAJAF DEPRESSION, AL-NAJAF AL-ASHRAF PROVINCE date: 2018-10-13 words: 2695 flesch: 63 summary: Family Gekkonidae Ophisops elegans Family Boidae 10- Eryx jaculus Family Colubridae 11- Malpolon moilensis keywords: 2006; analysis; aquatic; arabian; arabic; area; awadi; baghdad; bahr; bahr al; biodiversity; birds; bull; chemical; class; depression; desert; et al; euphraticus; family; fauna; field; fishes; habitat; high; hist; iraq; km2; lake; mammals; mohammad; mus; najaf; najaf depression; nat; natrix; natural; nature; number; plants; salinity; semi; species; table; tessellata; turtle; vertebrate; water; west cache: binhm-105.pdf plain text: binhm-105.txt item: #7 of 297 id: binhm-106 author: Mohammad, Mohammad K.; Al-Moussawi, Azhar A. title: RAILLIETINA ECHINOBOTHRIDA (MEGNIN,1881) (CESTODA: CYCLOPHYLLIDEA) FROM THE HOUSE SPARROW PASSER DOMESTICUS BIBLICUS HARTRET, 1881 COLLECTED IN BAGHDAD CITY, CENTRAL IRAQ date: 2013-07-01 words: 1663 flesch: 62 summary: Examining of house sparrow for the cestode parasites revealed that 25 specimens of 56 were infected with Raillietina echinobothrida. RESULTS Results of examining 56 house sparrows for the cestode parasites would show that 25 specimens (44.6%) were infected with one cestode species, Raillietina echinobothrida (Megnin, 1881). keywords: baghdad; birds; bull; central; cestode; city; domesticus; echinobothrida; hist; hosts; house; human; infected; intensity; iraq; mohammad; moussawi; mus; nat; new; parasites; passer; raillietina; results; saxena; smith; sparrow; species; summers; university cache: binhm-106.pdf plain text: binhm-106.txt item: #8 of 297 id: binhm-108 author: Abdul-Rassoul, M. S.; Al-Jalely, Basman H.; Al-Nuaim, Khawla Taha; Al-Ani, Luay khahtan title: First record of red-back spider Latrodectus scelio thorell, 1870 (Araneae: theridiidae) in Baghdad, Iraq date: 2012-12-01 words: 1343 flesch: 70 summary: The invasive Australian red back spider, Latrodectus hasseltii Thorell 1870 (Araneae: Theridiidae): current and potential distributions, and likely impacts. The black widow spider genus Latrodectus (Araneae : Theridiidae): phylogeny, biogeography, and invasion history. keywords: abdomen; abdul; araneae; areas; backs; baghdad; black; body; female; genus; iraq; latrodectus; legs; med; rassoul; red; scelio; specimen; spider; stripe; theridiidae; thorell; upper; widow cache: binhm-108.pdf plain text: binhm-108.txt item: #9 of 297 id: binhm-109 author: Augul, Razzaq SH.; Mzhr, Nassreen N.; Abdul-Rassoul, M. S. title: OCCURRENCE OF HEMIPTERAN SPECIES ON ALFALFA PLANT IN BAGHDAD date: 2012-12-01 words: 1894 flesch: 67 summary: MATERIAL AND METHODS Specimens were collected from alfalfa field of Abu-Ghraib in April, May, October (2010) by standard sweeping net and held aspirator, Insect specimens of large and medium size were mounted on pin while small insects were preserved in 70% alcohol. This bugs feeds upon smaller insects, butterflies eggs, the nymphs of phytophagous bugs, aphids and mites Geocorius sp., are among the most abundant and important predaceous insects in many cropping systems Geocorius sp. are known to feed on plants, however they rarely cause economic damage, their most distinguishing characteristic is their large, bulging eyes. keywords: 1995; alfalfa; anthocoridae; apterus; augul; baghdad; bugs; bull; campylomma; deracoris; families; family; field; genera; geocoris; head; held; hemiptera; heteroptera; important; insects; iran; iraq; large; lygaeus; medium; miridae; natural; occurrence; oval; pandurus; plant; population; pyrrhocorius; segmented; small; species; study cache: binhm-109.pdf plain text: binhm-109.txt item: #10 of 297 id: binhm-110 author: Jan, Saadi K.; Al-Zubaidi, Aqeel A.; Al-Dulaimi, Salam I. title: MICROFACIES ANALYSIS OF SHIRANISH FORMATION AT HIJRAN SECTION- NE IRAQ date: 2012-12-01 words: 1601 flesch: 63 summary: It is exposed in most areas of north and north east Iraq, and also at subsurface sections when the drilled wells reaching the Upper Cretaceous rock units (Bellen et al., 1959) particularly at Ain Zala Oil Field (Daniel, 1954; Dunnington, 1958). It is deposited at basional environment far away from beach during transgressive cycle (Bellen et al., 1959; Buday, 1980; Aba-Hussain, 1983). keywords: analysis; bellen; buday; carbonate; cretaceous; deep; environment; facies; flugel; foraminifera; formation; high; hijran; iraq; jan; lower; marine; micrite; microfacies; mudstone; planktonic; plate; pyrite; rock; section; shiranish; thickness; thin; upper; water cache: binhm-110.pdf plain text: binhm-110.txt item: #11 of 297 id: binhm-111 author: Mohammad, Mohammad K.; Al-Moussawi, Azhar A. title: GIZZARD NEMATODES OF THE HOUSE SPARROW PASSER DOMESTICUS BIBLICUS HARTERT COLLECTED IN BAGHDAD CITY, CENTRAL IRAQ date: 2012-12-01 words: 2942 flesch: 65 summary: Paroaria coronata (Passeriformes) (Mascarenhas et al., 2009; Calegaro-Marques and Amato, 2010); in Ring-necked Pheasant (Galliformes) (Pinto et al., 2004); in Guira Cuckoos Guira guira and Smooth-billed Ani Crotophaga ani (Cuculiformes) (Bartmann and Amato, 2009); and reported from Costa Rica in Thrauois episcopus, Turdus grayi, Caryothrau stespoliogaster, Platyrinchus cancrominus, Ramphocaenus melanurus, Vemivora peregrine and Geothlypis poliocephala (Passeriformes) (Zhang et al., 2004). It was reported in USA from pigeon Columba livia (Columbiformes) causing severe pathological changes in proventriculus (Hwang et al., 1961); in captive Princess Parrot Polytelis alexandrae (Psittaciformes) (Bollette, 1998); in California Quail Callipepla californica (Galliformes) (Moore et al., 1988); in African Jacanas Actophilornis africana http://www.issg.org/database/species/ecology) 29 M. K. Mohammad & A. A. Al-Moussawi (Charadriiformes) (Yvonne Schulman, 1992); in Ruffed Grouse Bonasa umbellus, Ring- necked Pheasant Phasianus colchicus, Peafowl Pavo cristatus, Hungarian Partridge Perdix p. perdix, Eastern Bobwhite Collinus v. virginianus, prairie grouse Tympanuchus spp., greater prairie chickens Tympanuchus cupido pinnatus, Attwater's prairie chicken Tympanuchus cupido attwateri, wild turkeys Meleagris gallopavo (Galliformes), Eastern Crow Corvus b. brachyrhynchos, Catbird Dumetella carolinensis, Eastern Robin Turdus m. migratorius, Eastern Bluebird Sialia s. sialia, Starling Sturnus v. vulgaris, House sparrow Passer domesticus and Eeastern Cowbird Molothrus a. ater (Passeriformes) (Goble and Kutz, 1945; Maxfield et al., 1963; Harper et al., 1967; Kellogg and Prestwood, 1968; Moore and Simberloff, 1990; Peterson, 1996, 2004; Williams et al., 2000); in Bleeding Heart Pigeon Gallicolumba luzonica (Columbiformes) (Lindquist and Strafuss, 1988); in red-bellied woodpeckers Melanerpes carolinus (Piciformes) (Foster et al., 2002). keywords: 2004; 2010; acuaria; amato; anterior; avian; baghdad; birds; body; dispharynx; domesticus; end; esophagus; female; fig; galliformes; gallus; gizzard; helminths; hosts; house; infection; iraq; length; long; males; mohammad; moussawi; nasuta; nematoda; nematodes; parasites; parasitol; passer; passeriformes; passerine; posterior; prairie; skrjabini; sparrow; species; spirurid; stage; table; width; wildlife cache: binhm-111.pdf plain text: binhm-111.txt item: #12 of 297 id: binhm-112 author: Al-Saffar, Hanaa H.; Augul, Razzaq SH.; Ali, Hayder B.; Abdul-Rassoul, M. S. title: OCCURANCE OF ADULT MUSCID FLIES ON STICKY TRAPS IN SOME IRAQI PROVINCES date: 2012-07-01 words: 2624 flesch: 68 summary: Essa, N. A. and El-Sibae., M. M. 1993. The high numbers of M. domestica recorded in the current study was similar to previous studies of flies associated with waste in other countries (Imai, 1985; Essa & El Sibae, 1993, Nurita et al. 2008). keywords: abdul; adult; atherigona; babylon; baghdad; biseta; bull; collected; crassirostris; diptera; domestica; fall; figure; flies; fly; iraq; khalaf; limnophora; list; missan; musca; muscid; muscina; new; occurance; orientalis; percentage; provinces; quaterna; rassoul; results; saffar; sorbens; species; stabulans; stein; sticky; study; table; traps cache: binhm-112.pdf plain text: binhm-112.txt item: #13 of 297 id: binhm-113 author: Hamodi, Awatif Abdul-Fatah title: NEW RECORD OF PREDATOR MELANTHRIPS PALLIDIOR PRIESNER (THYSANOPTERA: MELANTHRIPIDAE) IN BAGHDAD - IRAQ date: 2012-07-01 words: 1423 flesch: 65 summary: Distribution of Thysanoptera species and their host plant in Croatia. The collected insects by the net were brought to laboratory for isolating, thrips mounted on a slides for identification by using keys for higher category as suborders , super families , families , genera and species ( Mound and Walker, 1982; Mound & Marullo. 1996; Priesner, 1936, 1949). keywords: antenna; april; area; awatif; baghdad; body; collected; family; fore; hamodi; insects; iraq; melanthripidae; melanthrips; morris; mound; new; number; pallidior; posterior; predator; priesner; record; seats; segments; sensory; setae; species; specimens; thysanoptera; wing cache: binhm-113.pdf plain text: binhm-113.txt item: #14 of 297 id: binhm-114 author: Hasan, Wazeer A.; Assaf, Lazgeen Haji; Abdullah, Samir Khalaf title: OCCURRENCE OF ENTOMOPATHOGENIC AND OTHER OPPORTUNISTIC FUNGI IN SOIL COLLECTED FROM INSECT HIBERNATION SITES AND EVALUATION OF THEIR ENTOMOPATHOGENIC POTENTIAL date: 2012-07-01 words: 3157 flesch: 58 summary: Key words: Entomopathogenic fungi, Soil, Iraq. Correspondence; Samer_abdalh@yahoo.com INTRODUCTION Entomopathogenic fungi were occurred naturally as infections in insect or arachid hosts, and several of these fungi only occurred as infections in living hosts for a relatively short period of time during their life cycle. These two methods of germination are manipulated for isolation of entomopathogenic fungi from the soil ( Goettel and Inglis,1997). keywords: 2002; 2006; abdullah; aphid; assaf; bally; bassiana; beauveria; control; days; different; distribution; entomopathogenic; entomopathogenic fungi; et al; flavus; fungal; fungi; fungus; glabrum; hasan; hibernation; host; insect; iraq; isaria; isolate; isolation; javanica; jones; method; meyling; mohamed; mortality; occurrence; opportunistic; paecilomyces; pathogenicity; penicillium; percentage; plant; plates; pomi; present; pruni; s.k; samples; samson; sas; shtayeh; sites; soil; species; spp; study; sun; tzean cache: binhm-114.pdf plain text: binhm-114.txt item: #15 of 297 id: binhm-115 author: Mohammad, Mohammad K.; Al-Moussawi, Azhar A. title: BLOOD PARASITES OF SOME PASSERIFORM BIRDS IN BAGHDAD AREA, CENTRAL IRAQ date: 2012-07-01 words: 2161 flesch: 55 summary: [Principles of the distribution of avian blood parasites in relation to the ecology of their hosts]. *email: amarmkm82@yahoo.com ABSTRACT Examining of passeriform birds collected in Baghdad area revealed presence of seven species of blood parasites belonging to three genera, Haemoproteus, Leucocytozoon, and Plasmodium. keywords: avian; baghdad; bennett; birds; blood; blood parasites; bull; central; common; families; family; fig; haematozoa; haemoproteus; hist; hosts; house; hypocolius; infection; iraq; lark; leucocytozoon; microfilariae; mohammad; moussawi; nat; parasites; passeriform; passerine; plasmodium; present; rate; records; relictum; results; shamsuddin; shrike; sparrow; species; zool cache: binhm-115.pdf plain text: binhm-115.txt item: #16 of 297 id: binhm-116 author: Abdul-Rassoul, M. S. title: SOME ORMYRIDAE (HYMENOPTERA , CHALCIDOIDEA) FROM IRAQ date: 2011-12-01 words: 1964 flesch: 76 summary: April, 1973, ex. galls of Isocolous sp. (Cynipidae) on Carthamus tinctorius (Compositae); Arbil, kora, 1♀, 1♂, 21. iv. 1977; Merawa, 1♀, 28. v. 1979, (Leg. Pankir, 1♀, em. 26. i. 1977, ex. galls of Synergus sp. on oak; Tal al-Anab, 1♀, em. keywords: 1977; abdul; andricus; baghdad; boucek; erdos; galls; history; iraq; leg; long; longer; museum; natural; oak; ormyridae; ormyrus; parasite; paratypes; rassoul; second; segment; species; specimens; wide; ♂ ♂ cache: binhm-116.pdf plain text: binhm-116.txt item: #17 of 297 id: binhm-117 author: Ali, Wand Kh. title: THE LEVEL OF SUNN PEST OOPHAGOUS PARASITOIDS (HYMENOPTERA: SCELIONIDAE) IN INFESTED WHEAT FIELDS OF NORTHERN GOVERNORATE IN IRAQ WITH AN IDENTIFICATION KEY OF TRISSOLCUS SPECIS date: 2011-12-01 words: 2299 flesch: 66 summary: A Taxonomical survy and biological study of Sunn Pest egg parasitoids and the search for sources of resistance to Euryqaster integriceps Puton (Hemiptera: Scutelleridae). Kocak, E. and N. Kilincer (2001) Trissolcus species (Hymenoptera: Scelionidae) parasitoids on the eggs of Sunn Pest Eurygaster spp., across Turkey. keywords: ali; area; biological; control; egg; eggs; erbil; eurygaster; fao; female; fields; governorate; grandis; high; hill; hymenoptera; identification; integriceps; iraq; javahery; level; longer; nees; northern; oophagous; parasitism; parasitoids; pest; plain; region; results; scelionidae; species; study; sunn; sunn pest; table; telenomus; times; trissolcus; villages; wand; wheat; width cache: binhm-117.pdf plain text: binhm-117.txt item: #18 of 297 id: binhm-118 author: Hadi, Afkar M. title: ISOLATION AND IDENTIFICATION OF INTESTINAL PARASITES FROM VEGETABLES FROM DIFFERENT MARKETS OF IRAQ. date: 2011-12-01 words: 1981 flesch: 67 summary: Oxyuris equi Habronema sp. Parascaris equorum Strongyloides westeri Toxocara sp. Ascaris lumbricoides Hymenolepis sp 97 67.3% 47 32.6% Total Table.3: Measurements and brief description of parasites eggs from vegetables. Study shows high rates of pollution with Echinococcus sp and Toxocara sp. eggs of dogs and cats which means high risk to community since Holly (2008) indicated that they may not only be most pathogenic to their specific host, they may also be the major causes of zoonosis. keywords: afkar; area; ascaris; baghdad; dogs; echinococcus; eggs; equi; groups; habronema; hadi; health; horse; hymenolepis; infection; intestinal; iraq; lumbricoides; middle; north; oxyuris; parascaris; parasites; reuse; species; strongyloides; study; thick; total; toxocara; vegetable; vet; wastewater cache: binhm-118.pdf plain text: binhm-118.txt item: #19 of 297 id: binhm-119 author: Mohammad, Mohammad K.; Jassim, Suhad Y. title: DISTRIBUTION OF HARD TICK SPECIES AMONG SHEEP OVIS ARIES L. IN AL-ANBAR PROVINCE, WESTERN DESERT OF IRAQ date: 2011-12-01 words: 1843 flesch: 66 summary: 29 M. K. Mohammad & S. Y. Jassim Kolonin (2009) in his book fauna of ixodid ticks of the world stated that the genus Hyalomma is a small flourishing group of ixodid ticks well adapted to living in arid biotopes, and a high degree of adaptation to hot and dry open habitats becomes apparent in the morphology (well developed spherical eyes, high legs), physiology (successful metamorphosis under reduced humidity) and behavior (active search of host) of species of this genus, he added also that ticks of this genus occur only in dry areas of the Old World. They found that 88.6% of sheep in whole Iraq were infested with six species of hard ticks belonging to Hyalomma, Rhipicephalus and Boophilus genera. keywords: anatolicum; anbar; animals; desert; domestic; ent; genus; hard; hyalomma; infestation; iraq; ixodid; ixodoidea; med; mohammad; province; rhipicephalus; robb; robson; sheep; species; study; ticks; turanicus; western cache: binhm-119.pdf plain text: binhm-119.txt item: #20 of 297 id: binhm-120 author: Abdul-Ameer, Kefah N.; Obaid, Aisha S. title: RECORDING OF THE MONOGENETIC TREMATODE SILURODISCOIDESMEDIACANTHUS (ACHMEROW, 1952) FOR THE FIRST TIME IN IRAQ ON THE GILLS OF THE CYPRINID FISH BARBUS LUTEUS date: 2011-07-01 words: 1270 flesch: 65 summary: In addition, key for the identification of the three species of Silurodiscoides, so far recorded from freshwater fishes of Iraq, is included. These monogenean parasites which complete their life cycles on one host are common gill parasites infecting freshwater fishes (Dujin, 1973). keywords: achmerow; ameer; bar; copulatory; diyala; dorsal; fishes; freshwater; gills; hooks; iraq; luteus; mediacanthus; median; mhaisen; monogenetic; organ; parasites; province; silurodiscoides; species; trematode; tube cache: binhm-120.pdf plain text: binhm-120.txt item: #21 of 297 id: binhm-122 author: Afrasiab, Saman R. title: CAVE DWELLING ANIMALS IN IRAQ PART 2: SYSTEMATIC NOTES ON THE NUTHATCH OF THE FAMILY SITTIDAE (AVESPASSERIFORMES) IN IRAQ WITH ADDING SOME IMPORTANT KNOWLEDGE TO THE NEST BUILDING OF SITTATEPHRONOTA SHARPE, FROM BESAN VALE HAWRAMAN SLOPE, IRAQI KURDISTAN date: 2011-07-01 words: 1526 flesch: 75 summary: مت التعرف على مخس و S. europaea و S. neumayr و Sitta kurdistanicaأنواع تابعة هلذه الفصيلة وهي S. dresseri و S. tephronota This nuthatch was classified by Ticehurst 1923 as S. neumayer kurdistanica, but Mlikovsky, 2007. keywords: animals; baghdad; besan; birds; building; cave; collection; dwelling; europaea; family; figure; hawraman; iraq; kurdistanica; lahony; mountain; museum; nest; neumayer; north; nuthatch; saman; sitta; species; specimens; study; sulaymanyah; tail; tawera; tephronota; valley cache: binhm-122.pdf plain text: binhm-122.txt item: #22 of 297 id: binhm-123 author: Mawlood, N. A.; Abdul-Rassoul, M. S. title: A NEW SPECIES OF RHYNCOMYAROB.-DESVOIDY, 1830 (DIPTERA : CALLIPHORIDAE) FROM IRAQ date: 2011-07-01 words: 1674 flesch: 71 summary: 4c) is composed essentialy of two oval longitudinal plates, which may be widely separated, fused at their posterior medial ends, which provided with a row of short bristles; Sternite 7 (fig. 4d) with oval shaped basal, its surface with moderate dense of short bristles; Tergite 8 (fig 4 e) consist of two cup shaped plates which flanks the ovipositor, their surface without bristles; Sternite 8 (fig. 4f) triangle shaped, with numerous of short bristles; Epiproct (fig. 4 h) triangular shaped, with fine brown pubescent, its surface with 12-10 short bristles and four long bristles; Hypoproct (fig 4i) triangular shaped, with fine brown pubescent, its surface with 36-34 short bristles, Anal cerci (fig. 4j) oval shaped, its half apical with moderate dense of bristles; Spermatheca yellow, oval shaped, 0.26- 0.21 mm length, without a nipple-like projection. Legs: Yellow, fore femure with a pair rows of long bristles on the posterodorsal surface, a row of long bristles on the posteroventral surface; fore tibia with a row of moderate dense bristles on anterodorsal surface, 1bristle on the anteroventral surface; mid femure with a row of bristles on the posteroventral surface; mid tibia (fig. keywords: alar; ali; anterodorsal; apical; black; bristles; brown; calliphoridae; dark; dense; diptera; dust; fig; genus; grey; iraq; length; long; male; margin; moderate; oval; rhyncomya; row; setae; shaped; short; slivery; surface; tergite; wand; yellow cache: binhm-123.pdf plain text: binhm-123.txt item: #23 of 297 id: binhm-125 author: Abdul-Rassoul, M. S. title: TUMBLING FLOWER BEETLES (COLEOPTERA, MORDELLIDAE) OF IRAQ date: 2010-12-01 words: 1351 flesch: 62 summary: Results show that the tumbling flower beetles (Mordellidae) are represented with a total of 13 species belonging to four genera of three tribes, two of these species were described by Dr. Horak (1985,1990) as new species for Iraq Mediimorda maceki HoraK and Mordellistena bolognaHorak; two were previously reported Stenalia escherichi Schilsk and Mordellistena pumila (Gyllenhal) and ten are new records for Iraq. DISCUSSION As a result of the specimens collected by the author and the literature cited on Iraqi tumbling flower beetles (Coleoptera, Mordellidae) , the number of the species has been increased to thirteen ; of these two are new species (described by Horak, 1985,1990) for the country. keywords: abdul; arbil; baghdad; beetles; blair; coleoptera; dohuk; ermisch; family; flower; horak; iraq; maceki; mordellidae; mordellistena; new; pumila; rassoul; sarsang; species; specimens; stenalia; tumbling; variimorda cache: binhm-125.pdf plain text: binhm-125.txt item: #24 of 297 id: binhm-127 author: Ali, Wand Kh. title: CONTRIBUTION TO THE KNOWLEDGE OF THE GENUS CHALCOPHORELLA KERR. 1903(COLEOPTERA: BUPRESTIDAE) IN THE NORTH OF IRAQ (KURDISTAN REGION) date: 2010-12-01 words: 2123 flesch: 70 summary: Distribution in Iraq: Dohuk, Mousl and Sulaminyia during May and June (Kheri,1974 ; Al- Ali,1977),Erbil during June (Mohammed et al.,2006) also specimens were collected by the author from Erbil (Choman, Koesinjac,Nazanin and Shaqlawa ) during June and July, Sulaimanyia (Doukan ) during June. RESULTS AND DISCUSION Genus Chalcophorella Kerr. keywords: ali; apex; april; author; bull; buprestidae; buprestis; chalcophorella; coleoptera; coleopterorum; contribution; distribution; dohuk; erbil; fauna; genus; hist; insect; iraq; june; junk; knowledge; kurdistan; list; mus; nat; near; obenberger; schenkling; species; specimens; stigmatica; study; swailem; wand cache: binhm-127.pdf plain text: binhm-127.txt item: #25 of 297 id: binhm-128 author: Al-Moussawi, Azhar A. title: FIRST RECORD IN IRAQ OF TANQUA ANOMALA (LINSTOW, 1904) FROM THE DICE SNAKE, NATRIX TESSELLATA TESSELLATA (LAURENTI, 1768) date: 2010-12-01 words: 3285 flesch: 65 summary: Reporting of Tanqua anomala from this snake represents the first record for Iraq as well as a new host record. Tanqua anomala (v.Linst.) keywords: 1989; afrasiab; amphibians; anomala; baghdad; baylis; blanchard; body; bull; dewi; elegans; end; females; flaviviridis; genus; head; hemidactylus; hist; history; host; india; iraq; journal; linstow; males; measurements; mohammad; moussawi; mus; museum; natrix; natural; nematode; new; oochoristica; parasites; posterior; record; reptiles; research; scaberium; snake; species; t. anomala; tanqua; tanqua anomala; tessellata; thelandros; tiara; tract; turcicus; university; vol; von; wall cache: binhm-128.pdf plain text: binhm-128.txt item: #26 of 297 id: binhm-129 author: Al-Salim, Nadirah K.; Ali, Atheer H. title: FIRST RECORD OF FIVE NEMATODE SPECIES IN SOME WATER BIRDS FROM AL-HAMMAR MARSH, SOUTH OF IRAQ date: 2010-12-01 words: 5194 flesch: 59 summary: Male (10 specimens) Body length 3339-4644 (4133), maximum width 126-198 (172) in midbody, width of body 61-81 (68) at nerve ring level, and 74-90 (82) at cloaca level, nerve ring and excretory pore 115-137 (124) and 160-306 (207) respectively from anterior end, vestibule 20-27 (24) in length and 7-11 (9) in width, muscular esophagus 94-151 (124) in length and 18-34 (25) in width, glandular esophagus 369-459 (387) in length and 40-72 (55) in width, ratio of 41 N. K. Al-Salim and A. H. Ali muscular esophagus to glandular esophagus 1:2.5-3.6 (1:3.1), whole esophagus length represented 10.9-13.2 (12.2) % from body length, valve 11-13 (12) in length and 30-39 (34) in width, spicules dissimilar and unequal (fig. 1-2), longer spicule (right) slender with pointed sharp distal end, shorter spicule (left) twisted with ventrally curved distal end. Length of right spicule 207-416 (355) about 6.2-10.8 % from body length, left spicule 110-160 (135) in length about 2.9-4.2 % from body length, ratio of spicules 1:1.9-3 (2.5) %. keywords: abr; anterior; avioserpens; baruscapillaria; basrah; birds; body; body length; bursa; cloacal; description; distal; end; esophagus; extremity; female; fig; final; fishes; freshwater; genera; genus; glandular; grey; hammar; heron; host; iraq; length; level; male; maximum; mid; moravec; muscular; nematode; nerve; new; north; papillae; parasite; parasitic; parasitol; parts; posterior; presence; present; proximal; record; ring; salim; schistocytes; shape; short; small; species; specimens; spicule; tail; tip; water; width cache: binhm-129.pdf plain text: binhm-129.txt item: #27 of 297 id: binhm-130 author: Hamodi, Awatif Abdul-fatah; Abdul-Rassoul, M. S. title: ON SOME SPECIES OF TUBULIFEROUS THRIPS (THYSANOPTERA: PHLAEOTHRIPIDAE) FROM BAGHDAD, IRAQ date: 2010-12-01 words: 1246 flesch: 62 summary: Two of these were reported previously, Haplothrips cerealis Priesner, by El- Haidari and Daoud 1971.and Haplothrips tritici kurdjumov by Al -Ali 1977, and the rest were recorded for the first time : these are Haplothrips hukkineni Priesner; Haplothrips subtilissimus (Haliday) ؛ Haplothrips reuteri Karny; Haplothrips jasonis Priesner; Haplothrips sallloumensis Priesner ; Haplothrips pharao Priesner ; Phlaeothrips sycomri Priesner; Karnyothrips flavipus (Jones); Karnyothrips melaleucus (Bagnall) ; Dolicholepta micrurus (Bagnall). Haplothrips hukkineni Priesner. keywords: abu; baghdad; bagnall; bull; distribution; egypt; europe; feeding; females; gharib; ghraib; graminivorous; habitat; haplothrips; hist; iraq; karnyothrips; material; mound; mus; nat; new; phlaeothripidae; plant; priesner; record; region; species; sudan; thysanoptera; tubuliferous; بغداد cache: binhm-130.pdf plain text: binhm-130.txt item: #28 of 297 id: binhm-131 author: Shaker, Goner A. title: IDENTIFICATION OF PATHOGENIC FUNGI ASSOCIATED WITH WATER HYACINTH IN SELECTED REGIONS IN THE MIDDLE AND SOUTH OF IRAQ date: 2010-12-01 words: 1358 flesch: 62 summary: 62 Identification of Pathogenic Fungi Associated Pathogenicity test: Based on Koch postulate healthy leaves of water hyacinth plants, cleaned spotless of similar size leaves were collected, washed with tap water and placed on surface of wet-cotton in perti-dish, a (5 mm diam.)inoculum's plugs of each fungi culture placed reversely on the bottom of the leaf, each fungus isolate was replicated three times and the control treatment used (PDA) plug only, and then left in room temperature until the symptoms were appeared, the data had been recorded, and the treated specimens were ranked on the basis of the disease severity and assessed as follows: 0= leaves healthy ,1= a few spots or slight necrosis as (1-25%) from leaf size, 2= Survey and Evaluation of Mexican Native fungi for Potential Biocontrol of water hyacinth – Journal Aquat. keywords: acremonium; alternaria; associated; baghdad; eupyrena; fungal; fungi; hyacinth; identification; iraq; leaf; leaves; middle; pathogenic; phoma; plant; river; shaker; solms; south; species; water cache: binhm-131.pdf plain text: binhm-131.txt item: #29 of 297 id: binhm-133 author: Al-Joborae, Fadhil F.; Mhaisen, Furhan T.; Al-Awadi, Haytham M. H. title: PARASITIC FAUNA OF FISHES IN BAHR AL-NAJAF DEPRESSION, MID IRAQ date: 2010-07-01 words: 3588 flesch: 75 summary: During a period of two years, from January 1995 till December 1996, the first survey on fish parasites in Bahr Al-Najaf depression, mid Iraq, was achieved. Infection distribution of fish parasites in Basrah province and pathological effects of Saprolegnia sp. and its susceptibility to some plant extracts. keywords: abdullah; abu; affinis; ali; arabic; awadi; baghdad; bahr; balasem; barbus; basrah; contracaecum; depression; different; dispar; diyala; et al; f.t; family; fauna; fish; fishes; fossilis; freshwater; heckel; host; infection; iraq; iraqensis; lake; liza; luteus; mhaisen; najaf; new; parasites; parasitic; present; record; river; sci; sharpeyi; skin; species; study; survey; thesis; univ; xanthopterus cache: binhm-133.pdf plain text: binhm-133.txt item: #30 of 297 id: binhm-134 author: AL-Malo, Iman Mohammed; Abdul-Rassoul, M. S. title: NOTES ON SOME ARMORED SCALE INSECTS (HEMIPTERA:DIASPIDIDAE) OF IRAQ date: 2010-07-01 words: 1608 flesch: 58 summary: RESULTS List of species reported in this study: Abgrallaspis cyanophylli (Signoret,1869) Materials examined : 20 female,Grayait (Baghdad),10.V.2004,on leaves of Centaurea cyanus L. 10 female Grayait, Mansoor (Baghdad) 10.V.2004, 21.IX.2004,on leavesof Matthiola incana L. Five female, Grayait and new Baghdad ,10.V.2004, 21.IX.2004 on leaves of Diospyros kaki L.F. Distribution in Iraq : Baghdad Aonidiella aurantii (Maskell,1879) Materialss examined : 10 female, Al-Rashidia(Baghdad), new Baghdad ,Al- Yarmok,20.V.2004, 10.V.2004, 10.X.2004, on leaves and stem of Rosa spp. keywords: abdul; aonidiella; armored; baghdad; bull; chrysomphalus; citrus; diaspididae; diaspidiotus; distribution; female; fruits; grayait; insects; iraq; leaves; lepidosaphes; linnaeus,1758; malo; mansoor; materialss; new; notes; parlatoria; plants; ramadi; rassoul; rosa; scale; signoret; species; spp; study cache: binhm-134.pdf plain text: binhm-134.txt item: #31 of 297 id: binhm-135 author: Hamodi, Awatif Abdul-Fatah; Abdul-Rassoul, M. S. title: FOUR NEW SPECIES OF THRIPS (THYSANOPTERA: THRIPIDAE) FROM MIDDLE OF IRAQ date: 2010-07-01 words: 2312 flesch: 76 summary: Abdomen long, cylindrical, constricted toward the tip, Posterior margin of abdominal segments 2- 8 provided with structure like teeth, comb absent on eighth segment, with a pair of setae on the tergium, inner seta 16-17 μ in length, outer 20-22 μ, the sense pore upper the inner setae, four pairs setae on ninth segment, that’s on posterior margin 41-43 μ, the lateral 49-50 μ in length. Male: (Fig.2) Apterous, small in size, 0.7 mm, color of mouth part, prothorax, pterothorax, legs, abdominal segments 1-8 and antennal segments 1- 4 pale yellow, with rest body brown, setae dark. keywords: 3rd; 400x; abdomen; antennae; anterior; apex; brown; cone; dark; eyes; head; inner; iraq; length; long; margin; middle; new; nov; pairs; pale; palp; posterior; segments; sense; setae; short; species; width; wing; yellow cache: binhm-135.pdf plain text: binhm-135.txt item: #32 of 297 id: binhm-138 author: Kaka, Sadi Kan Jan title: SEDIMENTO LOGICAL STUDY OF SHIRANISH FORMATION WELL DD-1 (N-IRAQ) date: 2010-07-01 words: 1349 flesch: 61 summary: The thickness of an ideal section in Shiranish formation near shiranish village in north east of zakho is about (225) m. and the average of this thickness is changed in other areas from (100) m to (400) m. (Van Bellen, etal.,1959) has described shiranish formation and divided it into two parts: bottom part that consists of marly limestone and is rich with fossils, and upper part that consists of blue marls considering the formation as an open environment. 48 Sediment Logical Study of Shiranish MICROFACIES The rocks of shiranish formation in the Northern Iraq, west of Erbil is divided into two micro sedimentary facies after examining (238) thin sections by polarized microscope depending on (Dunham 1962) specification which modified by (Wilson 1975) keywords: autogenic; blue; dolomite; east; environment; facies; foraminifera; formation; fossils; globotruncana; iraq; kaka; limestone; logical; lower; marly; matrix; microfacies; north; northern; plate; sediment; sedimentary; shiranish; stone; study; thickness; upper; zone cache: binhm-138.pdf plain text: binhm-138.txt item: #33 of 297 id: binhm-139 author: Lahony, Saman S.; Al-Rawy, Mohamad A. title: NEW SUB-SPECIES OF CHUKAR PARTRIDGE ALECTORIS CHUKAR (GRAY 1830) (PHASIANIDAE, GALLIFORMES) FROM NORTH EAST OF IRAQ WITH BIOLOGICAL OBSERVATIONS date: 2010-07-01 words: 2722 flesch: 65 summary: A.c. asoica lives on rocky mountain slopes of the Irano-turanian biogeographical zone altitude 1800m., of BeSan valley of Hawraman mountain, which covered with grasses trees and bushes (Prunus, Quercus, Pistacia, Crategus) (Fig. 3). The taxonomic status of the population of the new subspecies A.c. asoica in the Irano-toranian zone depends on which species concept applies in this case. keywords: a.c; alectoris; altitude; asoica; baghdad; birds; bsc; chukar; chukukkwa; concept; cracraft; east; egg; fig; gray; hawraman; history; irano; iraq; kurdestanica; lahony; mayr; migration; morphological; mountain; museum; new; partridge; populations; press; psc; rally; rawy; size; species; status; study; subspecies; taxonomic; toranian; university; voice; werae; white; zone; نويع cache: binhm-139.pdf plain text: binhm-139.txt item: #34 of 297 id: binhm-140 author: Shubber, Habeeb Waseel Kadhum title: DISTRIBUTION OF HADJELIA TRUNCATA CREPLIN, 1825 (HABRONEMATIDAE,SPIRURIDEA) AMONG MEMBERS OF THE AVIAN FAMILY COLUMBIDAE IN AL-DIWANIYA PROVINCE, CENTRAL IRAQ date: 2010-07-01 words: 1381 flesch: 68 summary: Reporting Hadjelia truncata from Streptopelia decaocto in this study considered to be first time for the parasite to be reported from this host, therefore it constitutes a new host record. The present results on the distribution of Hadjelia truncata among columbid birds suggests that this parasite is more frequently infect members of Columba spp. keywords: birds; columba; columbidae; creplin; decaocto; distribution; diwaniya; family; hadjelia; host; infection; iraq; livia; members; nematode; new; parasite; province; range; streptopelia; truncata cache: binhm-140.pdf plain text: binhm-140.txt item: #35 of 297 id: binhm-142 author: Abdul-Rassoul, M. S.; Augul, Razzaq SH.; Al-Saffar, Hanaa H. title: SEASONAL ABUNDANCE OF THIRD INSTAR LARVAE OF FLIES (ORDER: DIPTERA) ON THE EXPOSED CARCASSES date: 2009-12-01 words: 3274 flesch: 65 summary: The study aims to identify the third instar larvae of fly species (Order : Diptera) feeding on carcasses (Fishes and Rabbits). Studies on carrion-breeding Diptera (Order of fly species) showed that species specialize along niche dimensions of season, carcass size, or state of decomposition (Kneidel, 1984). keywords: 1996; abdul; abundance; albiceps; appearance; april; august; calliphoridae; carcasses; carrion; chrysomya; december; diptera; entomol; et al; february; flies; fly; forensic; greenberg; highest; insects; instar; iraq; january; july; larvae; lowest; lucilia; march; max; megacephala; min; months; november; october; r.h; rabbits; rassoul; rate; results; sarcophaga; sarcophagidae; seasonal; september; sericata; soc; species; study; tantawi; temperature; vicina; األول cache: binhm-142.pdf plain text: binhm-142.txt item: #36 of 297 id: binhm-143 author: Balasem, Abbas N.; Mhaisen, Furhan T.; Asmar, Kasim R.; Al-Jawda, Jawdat M.; Adday, Thamir K. title: RECORD OF TWO SPECIES OF THE MONOGENETIC TREMATODES GENUS DACTYLOGYRUS FOR THE FIRST TIME IN IRAQ ON GILLS OF THE CYPRINID FISH ALBURNUS CAERULEUS date: 2009-12-01 words: 2033 flesch: 72 summary: With the present record, the total number of Dactylogyrus species in freshwater fishes of Iraq reached 51 species. In Iraq, monogeneans are considered as the major group of parasites of freshwater fishes (Mhaisen, 2006). keywords: asmar; baghdad; balasem; bykhovskaya; caeruleus; copulatory; dactylogyrus; et al; farm; fishes; freshwater; gills; gussev; hooklets; inner; iraq; length; long; marginal; median; mhaisen; monogeneans; monogenetic; nasiri; organ; pair; parasites; pavlovskaya; present; record; species; sphyrna; time; univ cache: binhm-143.pdf plain text: binhm-143.txt item: #37 of 297 id: binhm-144 author: Glaiim, Murtadha K. title: HUNTING BEHAVIOR OF THE ORIENTAL HORNET, VESPA ORIENTALIS L., AND DEFENSE BEHAVIOR OF THE HONEY BEE, Apis mellifera L., IN IRAQ date: 2009-12-01 words: 4684 flesch: 78 summary: These studies revealed that different species and races of honey bees exhibit different types of behavior of counterattack against different species of hornets. It is worth mentioning that Brother Adam believes that the native race of honey bee in Iraq is a sub- division of A. M. syriaca (Abdellatifet al. 1977). keywords: activity; alert; apis; apis mellifera; attack; bees; behavior; board; capture; cases; cerana; chasing; close; clump; colonies; counterattack; dead; defense; dense; different; entrance; figure; find; flight; glaiim; ground; hive; honey; honey bee; hornet; hovering; hunting; iraq; ishayet; japanese; legs; mellifera; oriental hornet; orientalis; persistent; pests; place; prey; race; rest; retreat; sakagami; sources; species; studies; time; vespa; wasps; water; wings; worker; التجمع; الزنبور; النحالت; اليت; تلك; حالة; على cache: binhm-144.pdf plain text: binhm-144.txt item: #38 of 297 id: binhm-145 author: Hamodi, Awatif Abdul-Fatah; Abdul-Rassoul, M. S. title: NEW RECORD OF THRIPS SPECIES (THYSANOPTERA: THRIPIDAE) FROM MIDDLE OF IRAQ date: 2009-12-01 words: 2115 flesch: 74 summary: Brief descriptions of new Thysanoptera. Brief descriptions of new Thysanoptera. keywords: abdul; ann; baghdad; bagnall; bull; chirothrips; crawford; egypt; ent; females; frankliniella; genera; genus; hist; insects; iraq; london; mag; marchal; mayet; meridionalis; mound; mus; nat; new; priesner; retithrips; scolothrips; sexmaculatus; soc; species; syriacus; tabaci; taeniothrips; thripidae; thrips; thysanoptera; trybom cache: binhm-145.pdf plain text: binhm-145.txt item: #39 of 297 id: binhm-146 author: Jan, Sadi Kan title: MICROFCIES OF TEL HAJAR FORMATION IN SOUTH-WEST IRAQ date: 2009-12-01 words: 1164 flesch: 62 summary: in the Matrix-Micritc plate (2-2), thcre is metal of precipitate pyrite in fractures and pores .This facies equivalent to standard microfitcies (S.M.F.3) zone (F.Z.3)’ which indicated to quiet open marine environment below the wave base. The sedimentary microfacies were as follow: 1) Fine biogenic dolomite facies This facies lies in the upper formation and consists of line ciystal of dolomite platc (1-1), some pores which appear arc resultant from the melting as the passing of the 40 Microfcies of Tel Hajar Formation unsaturated liquids. keywords: baghdad; base; dolomite; environment; facies; fine; formation; fossils; hajar; iraq; jan; kaddouri; lower; matrix; microfacies; plate; quartz; rich; sandy; tel; tide; upper; west; zone cache: binhm-146.pdf plain text: binhm-146.txt item: #40 of 297 id: binhm-147 author: Jan, Sadi Kan title: MICROFACIES STUDY OF HADIENE FORMATION (NORTH IRAQ) date: 2009-12-01 words: 1558 flesch: 68 summary: This facies was equivalent to the standard microfacies (S.M.F.11) in the zone facies (F.Z.6). CONCLUSION The limestone were divided into seven micro sedimentary facies so as to from a Hadiena formation they are: 1) Dolostone facies. keywords: addition; bioclastic; chambers; dolomite; energy; environment; facies; formation; grains; hadiene; iraq; jan; micrite; microfacies; packstone; planktonic; plate; standard; study; water; zone; حنة cache: binhm-147.pdf plain text: binhm-147.txt item: #41 of 297 id: binhm-148 author: Mawlood, N. A.; Abdul-Rassoul, M. S. title: A NEW SPECIES OF THE GENUS POLLENIA ROB.-DESVOIDY, 1830 (DIPTERA : CALLIPHORIDAE) FROM IRAQ date: 2009-12-01 words: 1472 flesch: 64 summary: Frontal stripe black with eight bristles; parafrontal black with densely silvery pollen and numerous of setae; face redish with yellow pollen and numerous black and yellow setae; parafacial brown-black with silvery pollen with a few of yellow setae; facial groove concave with prominent carina; facial ridge with seven bristles; epistoma; redish; vibrissae well developed; gena reddish, with yellow setae; Antenna (fig.lb) with three segments, first segment deeply brown with 6-5 setae second segment reddish with 14-12 setae, and long bristles, third segment reddish, all segments with silvery pollen; Maxillary palp reddish, clavate shaped, its apical half with different length of moderate densely bristles; Mentum (fig.1c) dark brown, oval shaped with different length of setae and two long bristles; Labrum-epipharynx cone shaped, its apodeme rod, strongly sclerotized, 0.59-0.52mm length; Oral lobes dark brown, its surface with different length of densely of yellow bristles and setae; Prestomal teeth yellow and very short Head in female similar to that of the male except outer vertical bristles well developed, frons wide with 2 proclinate and 1 reclinate Fronto-Orbital bristles. Legs: dark brown, with slivery pollen, fore tibia with a row of bristles on anterodorsal surface and 1 bristle on posteroventral surface; mid tibia (fig.2a,b) with 4-3 bristles on each posterodorsal and anteroventral surface; hind tibia with 2 bristles on each anterodorsal and anteroventral surface. keywords: abdul; apical; black; bristles; brown; calliphoridae; dark; densely; diptera; fine; iraq; length; long; mawlood; oval; paraphallus; pollenia; rassoul; rognes; setae; shaped; short; silvery; species; surface; yellow cache: binhm-148.pdf plain text: binhm-148.txt item: #42 of 297 id: binhm-149 author: Swail, M. A. title: DISTINCTION BETWEEN TWO SPECIES OF THE GENUS EXOCHOMUS REDTENB. (COLEOPTERA : COCCINELLIDAE) IN IRAQ date: 2009-12-01 words: 1127 flesch: 68 summary: (COLEOPTERA : COCCINELLIDAE) IN IRAQ M. A. Swail College of Scince, University of Wasit, Wasit ABSTRACT The present paper attempts to establish a distinction between Exochomus negripennis (Er.) and E. quadripustulatus L., depending on the characters of femoral line, male genitalia and spermatheca. The species E. negripennis and E. quadripustulastus are a predators of the aphids Thelaxes suberis Delgo. keywords: anterior; apex; black; brown; coccinellidae; distinction; exochomus; femoral; genitalia; half; iraq; length; line; male; negripennis; posterior; quadripustulatus; reaching; reddish; siphon; species; spermatheca cache: binhm-149.pdf plain text: binhm-149.txt item: #43 of 297 id: binhm-150 author: Al-Moussawi, Azhar A. title: FIRST RECORD IN IRAQ OF TWO NEMATODE PARASITES FROM THE BLUE-CHEEKED BEE-EATER MEROPS SUPERCILIOSUS PERSICUS PALLAS, 1773 date: 2008-07-01 words: 1879 flesch: 70 summary: (2002) studied the breeding biology as well as some ecological aspects of this bird in central Iraq. This paper deals with recording of two nematodes from the alimentary tract of this bird for the first time in Iraq and they also constitute new host records as well. keywords: bee; bird; blue; capensis; central; cheeked; eater; genus; hadjelia; helminth; host; iraq; long; merops; mohammad; moussawi; nematodes; new; parasites; record; species; specimens; superciliosus; syphaciella; truncata; wide; york cache: binhm-150.pdf plain text: binhm-150.txt item: #44 of 297 id: binhm-151 author: Augul, Razzaq SH. title: DESCRIPTION OF THE THIRD INSTAR LARVA OF SARCOPHAGA AFRICA (= S. HAEMORRHOIDALIS) FALL. (DIPTERA: SARCOPHAGIDAE) date: 2008-07-01 words: 1793 flesch: 68 summary: J. forensic Sci.; 46(5): 1098- 1102. Comparative micromorphology of third instar larvae and the breeding biology of some Afrotropical Sarcophaga (Diptera : Sarcophagidae ). keywords: 1998; anterior; augul; cephalopharyngeal; characters; description; diptera; dorsal; entomology; figure; flies; forensic; instar; iraq; larvae; lateral; posterior; sarcophaga; sarcophagidae; sclerite; segments; similar; size; species; spines; spiracles; tubercles; ventral; view; zumpt cache: binhm-151.pdf plain text: binhm-151.txt item: #45 of 297 id: binhm-152 author: Glaiim, Murtadha K.; Mahdi, Huda A.; Ibrahim, Hassan A. title: TESTING THE EFFICACY OF SOME METHODS RECOMMENDED ABROAD FOR CONTROLLING THE ORIENTAL HORNET, VESPA ORIENTALIS L., ATTACKING HONEY BEE, APIS MELLIFERA L., COLONIES IN IRAQ date: 2008-07-01 words: 3745 flesch: 72 summary: By the end of November, there was a loss of one-third of bee colonies in the cone-supplied hives, i.e. 5 out of 15 colonies. Scientific studies on hornets including their control are rare when compared with those on other pests and diseases attacking honey bees. keywords: activity; ahmed; apiary; apis; application; attack; bees; board; colonies; colony; cone; control; data; different; effect; effective; efficacy; entrance; entry; flight; gathering; glaiim; hive; hive entrance; honey; honey bees; hornet; iraq; mellifera; method; narrow; orientalis; passage; presence; queen; species; stand; strip; study; testing; traps; tube; unpublished; use; vespa; vinegar; wasps; wire; worker; اخللية; الزنبور cache: binhm-152.pdf plain text: binhm-152.txt item: #46 of 297 id: binhm-153 author: Hamodi, Awatif Abdul-Fatah; Abdul-Rassoul, M. S. title: KEYS FOR IDENTIFICATION FOR GENERA AND SPECIES OF THRIPS (THYSANOPTERA : THRIPIDAE) FROM MIDDLE OF IRAQ date: 2008-07-01 words: 2407 flesch: 67 summary: 3- One short pair seta on hind angel of Pronotum, 4-5 pairs microseta’s on posterior margin, 1-8 chitin structure on posterior abdomenal margins, wing seta few, distance at arranged, brown-yellowish in color. 4- Antennae segmented carried microseta, maxillary palp 3 segmented, comb present, abdomenal segment cylindrical in shape, wild distribution (Fig.3)..………...…Thrips Linn. - Antennae segmented without microseta, maxillary palp 2 segment, 3 brown spots on fore wing, comb absent, posterior abdomenal margin not slightly, pale brown in color, predator a anther small insects. keywords: abdomenal; antennae; bagnall; brown; bull; chirothrips; color; comb; cone; different; fore; frankliniella; genera; genus; head; hind; iraq; key; long; margin; microseta; mound; nov; posterior; pronotum; retithrips; segmented; sense; seta; simple; soc; species; taeniothrips; thripidae; thrips; thysanoptera; trybom; vein; wing cache: binhm-153.pdf plain text: binhm-153.txt item: #47 of 297 id: binhm-154 author: Jasim, Suhad Y. title: SOME NEMATODE PARASITES OF THE GREEN TOAD BUFO VIRIDIS LAURENTI, 1768 IN BAGHDAD AREA, CENTRAL IRAQ date: 2008-07-01 words: 1766 flesch: 65 summary: Laurenti, 1768 collected from Baghdad area,central Iraq. This study will be devoted for nematode parasites and the results on the cestodes will be discussed in a separate paper. keywords: amphibians; anderson; baghdad; body; bufo; cosmocercidae; cosmocercoides; esophagus; filiformis; green; hosts; infection; iraq; jasim; length; nematode; oswaldocruzia; parasites; range; sex; species; specimens; tail; toad; variabilis; viridis; zool cache: binhm-154.pdf plain text: binhm-154.txt item: #48 of 297 id: binhm-155 author: Lahony, Saman R.; Mohammad, Mohammad K.; Al-Ali, Hussian A. title: A NEW RECORD OF GOSH HAWK (BAZ) ACCIPITER GENTILIS (AVES-FALCONIFORMES) WITH SHORT NOTES ON DISTRIBUTION OF LAUGHING DOVE SLREPTOPELIA SENEGALENSIS (AVES. COLUMBIFORMES) IN IRAQ date: 2008-07-01 words: 978 flesch: 78 summary: Iraq nat. Iraq nat. keywords: accipiter; baghdad; bird; bull; bunni; com; common; dove; east; gosh; hawk; hist; iraq; jordan; mus; nat; north; rare; senegalensis; streptopelia; study cache: binhm-155.pdf plain text: binhm-155.txt item: #49 of 297 id: binhm-156 author: Mawlood, N. A.; Abdul-Rassoul, M. S. title: A NEW SPECIES OF COSMINA ROB.-DESVOIDY, 1830 IRAQ (DIPTERA : CALLIPHORIDAE) date: 2008-07-01 words: 1380 flesch: 70 summary: Male terminalia:- Tergite 6 (fig.3a) dark brown, its hind margin with a row of bristles; sternite 6 (fig.3b) ring shaped, its right arm long with short and dose not join edith right inferior of syntergosternite 7+8; syntergosternite (fig.3c) dark brown with moderate densely different length black bristles; tergite 9 (fig.3d) elongated ovaly shaped, its half basal surface with hieght densely of bristles, one-fourth of apical without bristles; sternite 9 (fig.3e) with hind margin deeply emarginated, its apodeme moderately bend, the distance among its apical 0.26-0.21mm paralobs (fig.4a) nearly cylindrical shaped, its basal half with moderate dense of setae; anal cerci (fig.4b) slightly curved, united together in half region, basal half with densely long setae, Phallus (fig.4c,d,e) 0.80-0.66 length, basiphallus nearly sequare shaped, 0.3 1-0.24 mm; Epiphallus tubely shaped, 0.28-0.21mm; paraphallus 0.49-0.42mm with pin and curved apex; hypophallus oval shaped, its outer margin toothed, acrophallus short; pregonite (fig.4f) hook-like, its outer margin with a row of short dark brown bristles; postgonite (fig.4i) cylinderical shaped, its apical with long bristle; phalloapodeme (fig.4h) nearly cylindrical shaped, its anterior surface with chitinous band which occupying half of the region; Ejaculatory sclerite (fig.4i) nearly cup shaped, 0.52- 0.42mm length. Thorax: Scutum shinnying dark brown, with slightly silver pollen; Chaetotaxy acrostichal bristles 0+2; dorsocentral bristles 0+2; Notopleural bristles 2; humeral bristles 2; posthumeral bristle 1; intra-alar bristles 0+2; post-alar bristles 2; supra-alar bristles 3; scutellum bristles 4+1; propleural bristle 1; stigmatal bristle 1; sternopleural bristles 1:1; Pleuron dark green with slightly silver pollen; Mesothracic spiracles circular dark brown-black; Anal ridge of mesopleural plate with a row of bristles and densely of * Part of Ph.D. Thesis 50 A New Species of Cosmina long, fine golden setae; pteropleuron with acomb of long, thick black setae; Hypopleuron with a row of long bristles; Mctathoracic spiracles dark brown- black ;circular shaped; Subanal knob dark brown, kidney shaped with slightly sliver pollen and without setae. keywords: abdul; apical; black; bristles; brown; calliphoridae; cosmina; dark; diptera; green; half; hind; iraq; length; long; male; margin; mawlood; new; pollen; rassoul; setae; shaped; species; sternite; surface cache: binhm-156.pdf plain text: binhm-156.txt item: #50 of 297 id: binhm-157 author: Nasser, Ali K. K.; Jan, Sadi K. title: THE STUDY OF MINERALOGICAL AND MICROFACIES ANALYSIS SHIRANISH FORMATION WELL (KH-6) ANSAB AREA IN SOUTHERN IRAQ date: 2008-07-01 words: 1994 flesch: 61 summary: The study of Shiranish Formation rocks in southern part of Iraq at Ansab area well (KH-6) were carried out. 61 A. K. Nasser and S. K. Jan Fig.1: Location map of stuied well 62 The Study of Mineralogical 63 A. K. Nasser and S. K. Jan 64 The Study of Mineralogical 65 A. K. Nasser and S. K. Jan 66 The Study of Mineralogical 67 A. K. Nasser and S. K. Jan 68 The Study of Mineralogical Bull. keywords: area; baghdad; depth; diagenesis; dolomite; dolostone; environment; existence; facies; formation; fossils; geol; iraq; jan; jour; kassab; lower; marine; microfacies; mineralogical; nasser; north; plate; process; rocks; sedimentary; shelf; shiranish; soc; southern; study; thickness; tongue; type; university; upper; wilson cache: binhm-157.pdf plain text: binhm-157.txt item: #51 of 297 id: binhm-158 author: AI-Jboory, Ibrahim I.; Abdul-Rassoul, M. S.; Saleh, Seba J. title: NEW RECORD OF SOME BIOLOGICAL ENEMIES OF CITRUS LEAFMINER Phyllocnistis citrella Stainton (Lepidoptera: Gracillaridae) IN IRAQ date: 2004-07-01 words: 1658 flesch: 68 summary: Seba J.Saleh University of Baghdad ,College of Agriculture, Baghdad ,Iraq Iraq Natural History Museum ABSTRACT An extensive survey of citrus leaf miner (CLM) , Phyllocnistis citrella Stainton parasites and predators was conducted during 1998 and 1999 in citrus orchards and nursuries in Baghdad, Diyala and Wasit .Five eulophid parasites were recorded for the first time on citrus leaf miner larvae , prepupae and pupae viz. The survey of citrus leaf miner in Baghdad, Diyala and Waist showed presence of some parasitoids and predators feeding on CLM. keywords: baghdad; biological; cirrospilus; citrella; citrus; clm; control; diyala; enemies; florida; gracillaridae; hoy; iraq; jboory; larvae; leaf; lepidoptera; miner; natural; new; nursuries; orchards; parasitism; parasitoids; pena; phyllocnistis; pnigalio; predators; stainton; survey cache: binhm-158.pdf plain text: binhm-158.txt item: #52 of 297 id: binhm-159 author: Hamodi, Awatif Abdul-Fattah; Abdul-Rassoul, M. S. title: KEYS FOR IDENTIFICATION OF GENERA AND SPECIES OF THRIPS (THYSANOPTERA: THRIPIDAE) FROM MIDLE OF IRAQ date: 2004-07-01 words: 2786 flesch: 69 summary: 7- One seta at each hind angel of Pronotum or none, comb present, different in size and color……………………………………………8 - 2 seta at each hind angel of Pronotum, no micro seta at abdomenal segment, brown- yellowish in color (Fig.6)………Taeniothrips Amyot & Serville 8- One seta at each hind angel of Pronotum, abdomen covered with micro seta, seta on abdomenal segments 9 and 10 long, pale (Fig.7)…………….…Scirtothrips Shull ( as Scir.mangiferae Pri ) - Hind angels of Pronotum without seta, that’s on abdomenal segmented 9-10 strong and long (Fig.8)………….Anaphothrips 3- Hind angel of Pronotum with One pair of short seta, posterior margin with 4-5 pairs of micro seta , posterior margins of abdomenal segment 1-8 with chitin structure, wings seta few, distance at arranged, brown-yellowish in color. keywords: 400x; abdomenal; antennae; bagnall; brown; bull; chirothrips; color; comb; cone; different; egypt; fore; frankliniella; genera; genus; hamodi; head; hind; identification; iraq; key; long; margin; micro; mound; nov; pale; posterior; pronotum; retithrips; segmented; segments; sense; seta; simple; species; taeniothrips; thripidae; thrips; thysanoptera; trybom; vein; wing cache: binhm-159.pdf plain text: binhm-159.txt item: #53 of 297 id: binhm-160 author: Jan, Sadi Kan title: MICROFACIE STUDY OF SUBSURFACE SECTION OF BEKHME FORMATION (NORTH IRAQ) date: 2004-07-01 words: 1126 flesch: 60 summary: The separation limit between Bekhme formation and shiranish formation is estimated at the depth 5540 ft; and between Bekhme formation and kometan formation at the depth of 5708 ft. 3. This work proves the absence of Bekhme formation in Dernir Dagh Well- 1 as a tongue as reported by the Oil Exploration Company. keywords: bekhme; diagenetic; dolomite; echinoderms; facies; formation; fossils; fragments; glauconite; iraq; jan; limestone; microfacie; packstone; present; processes; rudists; section; sedimentary; study; stylolite; subsurface cache: binhm-160.pdf plain text: binhm-160.txt item: #54 of 297 id: binhm-161 author: Jan, Sadi Kan; Al-Zubaidi, Aqeel A. title: MICROFACIES ANALYSIS OF GHAR FORMATION (WESTERN DESERT OF IRAQ) date: 2004-07-01 words: 1597 flesch: 63 summary: The upper part was deposited at shallow marine environment of low circulation . ENVIRONMENT OF DEPOSITION Microfacies study of ghar Formation showed that the lower part composed of bioclastic wackestone facies ( 1 ) which reflect shallow marine environment (open circulation ) followed by mudstone facies( 2 ) . keywords: aggregate; analysis; baghdad; broken; calcite; circulation; diagenesis; energy; environment; facies; formation; ghar; grains; iraq; jan; limestone; lower; main; marine; microfacies; miliolids; open; precipitation; processes; shallow; shell; thickness; total; wackestone; water; zone; zubaidi cache: binhm-161.pdf plain text: binhm-161.txt item: #55 of 297 id: binhm-162 author: Mohammad, Mohammad K. title: THE HAEMOPROTEIDS OF THE AVIAN FAMILY SCOLOPACIDAE IN IRAQ WITH DESCRIPTION OF A NEW SPECIES date: 2004-07-01 words: 1987 flesch: 68 summary: Internationally, the infection rate was less than 1% in North America (Griener et al., 1975), 2.9% in the neotropics (White et al., 1979), 2.1% in southeast Asia (McClure et al., 1978). Area 10.1(0.8) 10.9(0.2) % area of total cell 18.1 19.3 Erythrocyte parasitized by macrogametocyte N 25 20 Length 12.7(0.7) 12.9(1.1) Width 6.6(0.3) 7.3(0.4) Area 62.1(7.4) 70.8(6.8) keywords: area; avian; bennett; birds; cell; erythrocyte; family; haemoproteids; host; infected; infection; iraq; length; measurements; mohammad; new; nucleus; parasite; scolopacidae; species; table; width cache: binhm-162.pdf plain text: binhm-162.txt item: #56 of 297 id: binhm-163 author: Mohammad, Mohammad K. title: THE PARASITIC FAUNA AND THE FOOD HABITS OF THE WILD JUNGLE CAT FELIS CHAUS FURAX DE WINTON, 1898 IN IRAQ date: 2004-07-01 words: 4952 flesch: 66 summary: No reports were available on endoparasites of wild jungle cat in Iraq, but only few studies concerning helminths in the gastrointestinal canal of domestic cat, Felis catus L. had been carried out (Shaheen et al., 1962; Babero et al., 1963; Al-Berwari and Nassir, 1983; Al-Saeed, 1983; Daoud et al., 1988). Toxocara canis was reported from wild cat Felis silvestris, F. onca, Iberian lynx Lynx pardinus, red fox Vulpes vulpes, wolf Canis lupus and jackal Canis aureus (York and Maplestone, 1962; Papadopoulos et al., 1997; Pfeiffer et al., 1997; Lassing et al., 1998; Rodriguez & Carbonell, 1998). keywords: animal; author; baghdad; birds; carnivores; cat; cats; cestodes; chabaud; chaus; class; contents; ctenocephalides; different; domestic; ectoparasites; end; family; fauna; felis; filaria; fishes; flea; food; francolinus; harrison; high; hist; history; hosts; infection; infestation; insects; iraq; jungle; list; mammals; meal; mohammad; mus; nat; natural; nematodes; new; order; parasites; parasitic; percentage; present; publ; rate; red; results; rhipicephalus; sarcoptes; scabiei; species; specimens; stomach; study; systematic; table; ticks; total; vulpes; wide; wild; yamaguti cache: binhm-163.pdf plain text: binhm-163.txt item: #57 of 297 id: binhm-164 author: Zaynal, Mohammad S. title: DETECTION OF SUBSURFACE CAVITIES BY THE ELECTROMAGNETIC METHOD (Case Study at Haditha Area) date: 2004-07-01 words: 2252 flesch: 68 summary: The survey has been executed with EM terrain conductivity and VLF-Radiohm EM resistivity measurements 81 M. S. Zaynal respectively. The application of EM methods for rapid mapping of shallow conductive clay layer. keywords: angle; applied; area; baker; cavities; coil; conductivity; current; depth; electromagnetic; field; geonics; geophysics; ground; h.a; high; horizontal; instrument; iraq; layer; measurements; method; phase; research; resistivity; scientific; study; subsurface; survey; techniques; terrain; vlf; vol; water; zaynal cache: binhm-164.pdf plain text: binhm-164.txt item: #58 of 297 id: binhm-165 author: Al-Asady, H. S.; Al-Gailany, H. B. D. title: EXTERNAL MORPHOLOGICAL STUDY OF THE LEAFHOPPER NEOALITARUS FENESTRATUS HERRICH-SCHAEFFER 1964(HOMOPTERA: CICADELLIDAE) FROM IRAQ date: 2003-07-01 words: 1023 flesch: 66 summary: Mesonotum (Fig. 4) Mostly light brown; apex rounded and slightly protruded interiorly; lateral median margins distinctly pointed; parapsidal sutures distinct, their posterior ends close together; prescutum rounded and interiorly protruded; scutellum deep brown. Body small, slender; general coloration deep brown with red tinge; total length of males and females 3.9 to 4.5 mm. keywords: 1969; alasady; alghailany; apex; b.d; brown; bull; deep; fenestratus; fig; forewing; genital; herrich; iraq; lateral; margin; neoalitarus; posterior; schäeffer; species; tinge; veins; vertex; vol cache: binhm-165.pdf plain text: binhm-165.txt item: #59 of 297 id: binhm-166 author: Ali, H. A.; Abd Ali, Basim A.; Shaker, Goner A. title: DIAGNOSIS OF SOME PATHOGENIC FUNGI ON SELECTED LOCAL WOODS date: 2003-07-01 words: 1562 flesch: 71 summary: It is shown in table (3) that maximum disease index was obtained on Juglans wood by Penicillium. While Penicillium was the dominant fungus on Morus, it could not be isolated from Eucalyptus wood. keywords: ali; aspergillus; degree; diagnosis; different; disease; eucalyptus; factors; fungi; fungus; index; infection; juglans; morus; pathogenicity; penicillium; period; piece; results; samples; seasoning; size; species; storage; table; test; wood cache: binhm-166.pdf plain text: binhm-166.txt item: #60 of 297 id: binhm-167 author: Al-Sandouk, N. M. title: THE ABDOMINAL NERVE GANGLIA OF SOME CARABIDAE (COLEOPTERA) OF IRAQ date: 2003-07-01 words: 1325 flesch: 70 summary: The position of this tribe among the sub-family Carabinae is uncertain since the number of free abdominal ganglia is reduced to three and the reproductive organs are peculiar. It is found that the number of abdominal ganglia is reduced in some genera among this family and this reduction may be correlated with evolutionary status of these tribes. keywords: abdominal; abdominal ganglia; ali; bembidiini; carabidae; cord; family; free; ganglia; ganglion; genera; iraq; nerve; number; posterior; present; species; system; thoracic; tribe cache: binhm-167.pdf plain text: binhm-167.txt item: #61 of 297 id: binhm-168 author: Mahmood, Souhaila H. title: NEW RECORDS OF SOME MITE SPECIES INHABITING SOIL IN BAGHDAD date: 2003-07-01 words: 1572 flesch: 65 summary: Investigation on soil acari fauna in Iraq is scarce. It consisted of a 6.3 cm diameter cylinder narrowing to 5.8 cm at the cutting edge, to avoid compression of soil sample. keywords: abundant; acari; baghdad; berl; citrus; family; fauna; groups; iraq; longisetis; luxton; mahmood; microphytophagus; mites; new; orchards; order; pachylaelaps; predacious; records; samples; soil; species; stratiolaelaps; total; trophic; tyrophagus cache: binhm-168.pdf plain text: binhm-168.txt item: #62 of 297 id: binhm-169 author: Mawlood, N. A.; Abdul-Rassoul, M. S. title: DESCRIPTION OF THREE NEW SPECIES OF THE GENUS ANTHRENUS GEOFFORY (COLOEOPTERA, DERMESTIDAE) FROM IRAQ date: 2003-07-01 words: 1023 flesch: 75 summary: Hist Mus. (2003) 10 (1): 25-30 DESCRIPTION OF THREE NEW SPECIES OF THE GENUS ANTHRENUS GEOFFORY (COLOEOPTERA, DERMESTIDAE) FROM IRAQ* N. A. Mawlood** and M. S. Abdul Rassoul*** **Department of Community Health, Diyala, Iraq. 4.7.1983 (Leg. N. A. Mawlood). keywords: antennal; anthrenus; club; fig; iraq; longer; margin; mawlood; nov; phallobase; scales; segments; species cache: binhm-169.pdf plain text: binhm-169.txt item: #63 of 297 id: binhm-170 author: Mhaisen, Furhan T.; Balasem, Abbas N.; Al–Khateeb, Ghassan H.; Asmar, Kasim R. title: RECORDING OF FIVE MONOGENETIC TREMATODES FOR THE FIRST TIME FROM FISHES OF IRAQ date: 2003-07-01 words: 2829 flesch: 74 summary: These included reports from C. carpio (Adday et al., 1999; Al-Aubaidi, 1999; Al-Aubaidi et al., 1999; Mhaisen et al., 1999; Mohammad- Ali et al., 1999; Sadek, 1999; Salih et al., 2000; Al-Tamimi, 2001; Al-Tamimi et al., 2001), from Aspius vorax (Mohammad-Ali et al., 1999), from Carassius auratus (Salih et al., 2000) and from C. carassius (Mhaisen et al., 1999; Mohammad-Ali et al., 1999; Salih et al., 2000). These included reports from C. carpio (Al-Zubaidy, 1998; Adday et al., 1999; Al-Aubaidi, 1999; Al-Aubaidi et al., 1999; Asmar et al., 1999; Mohammad-Ali et al., 1999; Sadek, 1999; Al-Nasiri, 2000; Balasem et al., 2000; Salih et al., 2000; Al-Tamimi, 2001; Al-Tamimi et al., 2001; Al-Nasiri et al., 2002), from A. vorax and B. esocinus (Mohammad - Ali et al., 1999), from B. grypus (Salih et al., 2000), from B. xanthopterus (Al- Nasiri, 2000; Salih et al., 2000), from C. auratus (Salih et al., 2000), from C. carassius (Mohammad-Ali et al., 1999), from C. idella (Mohammad- Ali et al., 1999; Salih et al., 2000) and from L. abu (Salih et al., 2000). keywords: a.n; abu; arabic; aubaidi; baghdad; balasem; barbus; body; carpio; cyprinus; dam; et al; f.t; fishes; gills; gomitus; heckel; hooks; ibn; iraq; lake; length; marginal; median; mhaisen; mohammad; monogenetic; pairs; parasites; present; province; river; sagittata; salih; small; species; tigris; total; trematodes; zaafaraniya; عند cache: binhm-170.pdf plain text: binhm-170.txt item: #64 of 297 id: binhm-171 author: Mhaisen, Furhan T.; Al-Khateeb, Ghassan H.; Balasem, Abbas N.; Al-Shaikh, Sadik M. J.; Al-Jawda, Jawdat M.; Mohammad-Ali, Najah R. title: OCCURRENCE OF SOME FISH PARASITES IN AL-MADAEN DRAINAGE NETWORK, SOUTH OF BAGHDAD date: 2003-07-01 words: 3433 flesch: 76 summary: Mhaisen et al. threat to farm fishes as it can enter fish farms even through outlet water via the drainage network and hence can carry some parasites to farm fishes. Natural enemies of farm fishes with special emphasis on fish farms of Iraq. keywords: a.n; abu; ali; arabic; asmar; baghdad; balasem; caeruleus; carassius; carpio; chloromyxum; drainage; et al; f.t; farms; fish; fishes; freshwater; fungus; gills; host; investigation; iraq; jawda; k.r; l. abu; luteus; madaen; mhaisen; myxobolus; network; new; occurrence; parasite; parasitic; present; present study; press; previous; river; species; study; table; univ; wardi; wild cache: binhm-171.pdf plain text: binhm-171.txt item: #65 of 297 id: binhm-172 author: Al-Asady, H. S. title: EXTERNAL MORPHOLOGICAL STUDY OF THE LEAFHOPPER EMPOASCA DECEDENS PAOLI (HOMOPTERA: CICADELLIDAE) FROM IRAQ date: 2002-12-01 words: 954 flesch: 58 summary: Pronotum (Fig.3) bright yellow; apex truncate; lateral margins converging gradually from the posterior margin toward apical margin to make the later narrower than former; posterior lateral angles obliquely truncate. Forewing (Fig.5) uniformely green with yellowish tinge; costal margin curved; apex rounded; median and inner apical veins are approximately of same length but both are longer 2 Morphology of Empoasca decedens Morphology of Empoasca decedens than outer apical vein; radial vein ended nearly at the middle while median vein ended at the apical third. keywords: apex; apical; asady; base; bright; brown; bull; decedens; empoasca; green; homoptera; iraq; lateral; margin; morphology; paoli; small; truncate; typhlocybinae; vein; yellow cache: binhm-172.pdf plain text: binhm-172.txt item: #66 of 297 id: binhm-173 author: Al-Dulaimi, Sabah I. title: PREDATION BY THE MITE MACROCHELES GLABER (MÜLLER) (ACARINA: MACROCHELIDAE) ON THE HOUSE FLY MUSCA DOMESTICA L. WITH SOME NOTES ON ITS BIOLOGY date: 2002-12-01 words: 2021 flesch: 75 summary: To determine the number of house fly eggs destroyed per mite, the same rearing cells were used. Twenty-three of known age mite eggs of each treatment were transferred carefully into rearing cell using a small-flattened needle. keywords: acarina; adult; axtell; cell; c±1; daily; days; domestica; dulaimi; eggs; ent; female; fly; frozen; glaber; house; humidity; larvae; life; macrocheles; macrochelidae; mahmood; mean; mites; muscaedomesticae; number; predation; range; relative; small; stages; table cache: binhm-173.pdf plain text: binhm-173.txt item: #67 of 297 id: binhm-174 author: El-Wailly, Alwan J. title: SEASONAL CHANGES OF THE TESTES IN THE MARSH FROGE RANA RIDIBUNDA PALLAS, 1771 date: 2002-12-01 words: 1785 flesch: 78 summary: Differences in mean testis weights of all animals were evaluated by the student (t) test at level of 0.05 (significant). Mean testis weights collected in October to December do not differ from those of male obtained during hibernation (January and February) and during the breeding season (March and April) keywords: annual; anurans; april; august; baghdad; body; bufo; changes; cycle; december; esculenta; fat; frog; jorgensen; marsh; mean; minimum; rana; ridibunda; seasonal; spawning; testis; weight cache: binhm-174.pdf plain text: binhm-174.txt item: #68 of 297 id: binhm-175 author: Mawlood, Nabeel Abdul-Kader title: DESCRIPTION OF A NEW SPECIES OF LEUCOSTOMA MEIGEN (DIPTERA: TACHINIDAE) FROM IRAQ date: 2002-12-01 words: 1764 flesch: 72 summary: Parafrontal black, with bright shining whitish pollinose and with single row of short bristles outside the frontal row. Antenna (fig. 1b) black, first segment short with 3-4 short bristles anteriorly, second segment is cup in shape with cleft on the outer surface and bear long bristle with 6 -7 setae,the third segment is oval in shape does not reach to the oral margin and about two times as long as of second antennal segment , arista bare, thickened on basal one-fifth, about two times as long as of third antennal segment , ¼ of its basal part black and remaining part is red brown. keywords: antennal; bare; basal; black; bristles; brown; dark; fifth; fig; fourth; frontal; iraq; length; leucostoma; long; mawlood; oval; pairs; pollinose; red; second; segment; shape; short; species; sternite; strong; surface; tergite; times; whitish cache: binhm-175.pdf plain text: binhm-175.txt item: #69 of 297 id: binhm-177 author: Mekhlif, A. F. title: EFFICIENCY OF PARASITOIDS OF PEA LEAFMINER PHYTOMYZA HORTICOLA GOUREAU AND THEIR APPEARANCE TIME IN THE FIELD date: 2002-12-01 words: 1859 flesch: 69 summary: Drea et al., (1982) and Sugimoto, (1979) reported that larval parasites were vary aggressive for some agromyzid leafminers, which one of them P. horticola. Diglyphus iseae Walker and Cirrospilus vittatus Walker were dominant larval parasites. keywords: a.f; acantha; agromyzidae; april; chrysocharis; diptera; drea; end; feeding; female; horticola; host; immature; instar; iraq; iseae; kamijo; larvae; leafminer; mekhlif; mortality; opius; parasites; pea; pentheus; phytomyza; pupal; table; vittatus; walker cache: binhm-177.pdf plain text: binhm-177.txt item: #70 of 297 id: binhm-178 author: Mohammad, Mohammad K. title: BLOOD PARASITES OF THE BABBLERS OF IRAQ date: 2002-12-01 words: 2111 flesch: 64 summary: Mus. (2002) 9 (4): 33-40 BLOOD PARASITES OF THE BABBLERS OF IRAQ Mohammad K. Mohammad Iraq Natural History Museum, University of Baghdad, Bab Al-Muadham, Baghdad, Iraq ABSTRACT A survey of blood parasites among members of two species of Iraqi babblers Timaliidae, Turodoides caudatus salvadori (de Fillipi, 1865) and Turdoides alterostris (Hartert, 1909) was carried out in the middle and south of Iraq. (1982) reported that 127 of them were examined for blood parasites in different areas of the world. keywords: 1982; 7th; avian; babblers; baghdad; bennett; birds; blood; cell; erythrocyte; fallisi; haemoproteus; host; inf; infection; iraq; middle; mohammad; nov; nucleus; number; parasites; plasmodium; project; relictum; species; timaliidae; turdoidus cache: binhm-178.pdf plain text: binhm-178.txt item: #71 of 297 id: binhm-179 author: Mohammad, Mohammad K.; Al-Moussawi, Azhar A.; Jasim, Mohammad K. title: THE PARASITIC FAUNA OF THE MOORHEN GALLINULA CHLOROPUS CHLOROPUS L. IN THE MIDDLE OF IRAQ date: 2002-12-01 words: 2706 flesch: 68 summary: Mus. (2002) 9 (4): 41–49 THE PARASITIC FAUNA OF THE MOORHEN GALLINULA CHLOROPUS CHLOROPUS L. IN THE MIDDLE OF IRAQ Mohammad K. Mohammad Azhar A. Al-Moussawi Mohammad K. Jasim Iraq Natural History Table 1: Parasite species, intensity infection and range number of parasites. keywords: 1999; amidostomum; area; atra; avian; baghdad; baghdadensis; birds; blood; bull; cestode; chloropus; common; coot; cyclocoelum; diorchis; food; fulica; gallinulae; haemoproteus; hist; host; infection; inflata; iraq; ligula; mahmoud; mcrae; middle; mohammad; moorhen; mosul; mus; nat; new; parasites; rallidae; range; species; study; table; university; wide; yamaguti cache: binhm-179.pdf plain text: binhm-179.txt item: #72 of 297 id: binhm-18 author: Al-Tameme, Huda Jasim M. title: ESTIMATION OF GENETIC VARIATIONS IN DIFFERENT TAXA IN BRASSICACEAE BY RAPD AND ISSR ANALYSIS date: 2018-07-01 words: 3953 flesch: 60 summary: Furthermore, Kurane et al. (2009) have emphasis the ISSR markers proved to be very useful for accurate plant identification by recognized the intra and interspecies difference; ISSR strategies are almost indistinguishable to RAPD strategies exclude that sequences of ISSR primer are non-randomly outlined from microsatellite regions and the annealing temperatures applied are higher than utilized for RAPD markers. A difference of results was normal since just seven ISSR primers were utilized against five primers in the RAPD data analysis; notwithstanding, the average number of bands amplified per ISSR primer was higher. 7 Huda Jasim M. Al-Tameme Table (4): RAPD and ISSR amplifications in twelve species and varieties in Brassicaceae. keywords: aga; amplification; analysis; bands; bh10; bh11; bh14; brassicaceae; broccoli; cabbage; cress; different; dna; estimation; family; fragments; gag; genera; genetic; genomic; green; group; huda; issr; jasim; markers; molecular; number; oleracea; opb18; opc14; opc2; opc8; ornamental; ornamental cabbage; pcr; plant; polymorphic; primer; radish; rapd; red; results; shehbaz; similarity; species; studies; study; table; tameme; taxa; techniques; temp; time; total; tribes; ubc; variations; varieties cache: binhm-18.pdf plain text: binhm-18.txt item: #73 of 297 id: binhm-180 author: Shaheed, Abdullah Ibrahim title: CORRELATIVE INFLUENCE OF SEEDLING AGE, COTYLEDONS AND TERMINAL BUDS ON ADVENTITIOUS ROOT FORMATION IN STEM CUTTINGS OF MUNG BEAN date: 2002-12-01 words: 3497 flesch: 67 summary: The promotory effect of leaves and buds on adventitious root formation (ARF) has been published earilier by Van der Lek (1925).In contrast, decapitation and disbudding of terminal bud in Pea cuttings have inhibitory effect on root formation (Eriksen, 1973).These organs are considered as a source of IAA biosynthesis (Moore, 1969). Ph. D. thesis, University of Sheffield, U. K. Shaheed, A. I. 1995 Testing of four experimental systems to detect the role of cotyledons in adventitious root formation of mung bean cuttings. keywords: absence; acid; adventitious; age; aureus; auxin; bean; buds; control; cotyledons; cuttings; day; development; different; effect; endogenous; excision; factors; figure; formation; growth; hypocotyl; iaa; iba; influence; jarvis; leaves; mung; number; old; phaseolus; physiol; plant; presence; primary; response; root; rooting; seedling; shaheed; stem; terminal; time; treatment cache: binhm-180.pdf plain text: binhm-180.txt item: #74 of 297 id: binhm-181 author: Al-Chalabi, Badia’a M. title: INHERITANCE OF DARK HEAD AND SIPHON IN THE LARVAE OF CULEXQUINQEFASCIATUS SAY date: 2001-07-01 words: 1590 flesch: 70 summary: Vandehey, R. C. 1967 Inheritance of pigmented larval head capsules in Culex pipiens. Among mosquito species, Culex quinquefasciatus is one of the wildly distributed one in the world. keywords: adak; barr; chalabi; crosses; culex; dark; eye; generation; genetic; head; individuals; inheritance; larvae; mosquito; mutants; news; normal; ouda; phenotype; pipiens; quinquefasciatus; siphon; slightly; species; wild cache: binhm-181.pdf plain text: binhm-181.txt item: #75 of 297 id: binhm-182 author: Al-Ni’ma, B. A. Basheer; Al-Khay’yat, Abdul Husain title: CHECK LIST OF IRAQI BRYOFLORA date: 2001-07-01 words: 3334 flesch: 86 summary: B. S. G. [A&V; MRO] 2.2- D. capillaceum var. B. S. G. [S19: MJS;Han:*;A&V: MRO,MSU,FNI,MJS,FUJ] 13.1- Weissia controversa var amblydon (Brid.) keywords: 1st; a&v; agnew; alni’ma; author; b.a; b.s.g; baghdad; brid; bryoflora; district:; dlj; dsd; dwd; family; fki; flora; fni; fpf; fro; fuj; han; hedw; iii; iraq; jur; khay’yat; lca; lea; lindb; mam; milde; mitt; mjs; mosul; mro; msu; order; river; s19; schiffn; schimp; smith; synonym; v62; var; vondracek cache: binhm-182.pdf plain text: binhm-182.txt item: #76 of 297 id: binhm-183 author: Al-Shukur, M. A.R.Y. title: CHANGES OF CUTICULAR PROPERTIES IN ADULT EPHESTIA CAUTELLA(WALKER) LEPIDOPTERA: PYRALIDAE, DEVELOPED AFTER CESSATION OF EGGS GROWTH date: 2001-07-01 words: 1683 flesch: 66 summary: These insects showed low rates of water contents and an active response to water loss. Therefore, the decrease in water content and the increase in water loss are both an indication of a weak building-up of the cuticle, which became more permeable to water. keywords: ability; adult; cautella; cessation; content; control; cuticular; days; desiccation; eggs; ephestia; females; growth; hatched; humidity; insects; loss; low; relative; role; specimens; study; walker; water; water content; windawi; work cache: binhm-183.pdf plain text: binhm-183.txt item: #77 of 297 id: binhm-185 author: Arif, Saad M.; Ibrahim, Zaman A. A. title: SURVEY ON THE PREVALENCE OF INTESTINAL PARASITES AMONG ORPHAN CHILDREN INHABIT TWO STATEHOMES IN BAGHDAD CITY date: 2001-07-01 words: 1939 flesch: 75 summary: (2001) 9 (3): 23-27 SURVEY ON THE PREVALENCE OF INTESTINAL PARASITES AMONG ORPHAN CHILDREN INHABIT TWO STATEHOMES IN BAGHDAD CITY Saad M. Arif and Zaman A. A. Ibrahim Technical Institute/ Al-Mansur/ Baghdad ABSTRACT 230 stool samples were collected from 2 state homes for (males and females) to investigate the infection of different intestinal parasites (pathogenic and non-pathogenic). 24 Survey on the prevalence of intestinal parasites RESULTS AND DISCUSSION From table (1 and 2) the study show that orphan child could be infected with different intestinal pathogenic and non-pathogenic parasites at different ages and sexes with different rates. keywords: age; ali; baghdad; children; city; concentration; different; dwiach; females; ibrahim; infection; intestinal; iraq; jeboori; males; med; method; nana; parasites; pathogenic; press; prevalence; primary; rate; samples; school; shafiq; statehomes; stool; tech; total cache: binhm-185.pdf plain text: binhm-185.txt item: #78 of 297 id: binhm-186 author: El-Wailly, Alwan J. title: ANNUAL CYCLE IN LIVER WEIGHT OF MARSH FROG RANA RIDIBUNDA PALLAS, 1771 date: 2001-07-08 words: 1605 flesch: 73 summary: The decrease in liver weight during the hibernation months may be attributed to the utilization of liver glycogen. The literature provides several works concerning the seasonal changes of liver weight (Maruyama, 1979; Morton, 1981), liver metabolism (Schlaghecke and Blum, 1978), lipid composition and protein content of the liver (Milone et al., 1978, 1983), and cyclic changes in liver glycogen (Byrne and White, 1975). keywords: april; baghdad; body; changes; december; dry; females; frog; glycogen; hibernation; increase; iraq; january; july; lipid; liver; liver weight; marsh; mean; months; october; rana; ridibunda; seasonal; significant; smith; weight; أوزان; اىل; وزن cache: binhm-186.pdf plain text: binhm-186.txt item: #79 of 297 id: binhm-189 author: Hassan, Husain F.; Saeed, Isam S. title: Light and electron microscope studies of the adult of Plearogenoides medians (Olsson, 1876) (Trematoda: Lecithodendriidae) form Iraqi marsh frog Rana ridibunda date: 2001-07-01 words: 1884 flesch: 67 summary: The differences noted above appear to be sufficient to treat the form described here as a new variety of P. medians for which the name Pleurogenoides medians var. Frogs infection with P. medians has been reported worldwide and this trematode is the most common encountered frog intestinal parasite in Europe and Asia (Dawes, 1968; Cox, 1971; Hristovski and Less, 1973; Brooks, 1976; Gupta and Chopra, 1985). keywords: adult; amphibians; body; bull; electron; fig; frogs; genital; hassan; host; iraq; left; level; light; measures; medians; microscope; parasitol; pleurogenoides; pore; rana; ridibunda; saeed; situated; smyth; species; spines; studies; sucker; surface; trematodes; university; ventral cache: binhm-189.pdf plain text: binhm-189.txt item: #80 of 297 id: binhm-190 author: Mawlood, N. A.; Abdul-Rassoul, M. S. title: A new species of Wohlfahrtia Brauer and Bergenstam (Dipetera: Sarcophagidae) from Iraq date: 2001-07-01 words: 1416 flesch: 69 summary: Middle femura with anterior row of short bristles extending towards middle; middle tibia (fig 2c) with one anteroventral bristle and two posterodorsal bristles; hind tibia with three anterodorsal and posterodorsal bristles. Male: Head (fig 1a) usually narrower than its height; vrtex narrow with pairs of inner vertical bristles; outer vertical bristles absent; post vertical bristles weak and about 1/3 length of inner vertical bristles;ocellar triangle often slightly raised, with a pair of ocellar bristles; lower pair twice as longer as upper ones; ocelli brown in color; frons dark brown-black with golden pollinose, frons semi-narrow, without proclinate orbital bristles, with 10-11 pairs of frontal bristles; parafrontal, facial and parafacial dark to brown-black and covered with densely whitish pollinose; lower half of parafacial posses a row of setae; facial groove concave without carina; facial ridge with 4 -5 bristles in its 1/5 basal part; epistoma dark brown; antenna (fig 1b) with the three segments reddish brown in color, length o third segment about twice as long as second segment; arista pubescent, thicked at the base then gradually tapering toward apex; its basal half covered with very short hairs. keywords: abdul; apical; basal; black; bristles; brown; color; dark; densely; diptera; fig; grey; half; iraq; long; male; mawlood; new; pape; pollinose; rassoul; setae; shape; short; similar; species; sternite; surface; tergite; vertical; whitish; wohlfahrtia cache: binhm-190.pdf plain text: binhm-190.txt item: #81 of 297 id: binhm-191 author: Mohammad, Mohammad K. title: HAEMOPROTEIDS OF THE AVIAN FAMILY RALLIDAE IN IRAQ WITH DESCRIPTION OF A NEW SPECIES date: 2001-07-01 words: 1518 flesch: 60 summary: (2001) 9 (3): 51-56 HAEMOPROTEIDS OF THE AVIAN FAMILY RALLIDAE IN IRAQ WITH DESCRIPTION OF A NEW SPECIES Mohammad K. Mohammad Iraq Natural History Museum, University of Baghdad, Bab Al-Muadham, Baghdad, Iraq ABSTRACT A survey of haemoproteids among the eight species of Iraq rallids were carried out in the middle, south, and west of Iraq. It is of interest to study the haemoproteid parasites of Iraq rallids as a good number of specimens were available through the filed trips achieved by the staff of Iraq Natural History Museum. keywords: area; atra; avian; baghdadensis; bennett; birds; blood; crex; erythrocytes; family; fulica; gallinulae; haemoproteus; iraq; measurements; middle; mohammad; new; nov; nucleus; parasite; porzana; rallidae; rallids; size; species; table cache: binhm-191.pdf plain text: binhm-191.txt item: #82 of 297 id: binhm-192 author: Mohammad, Mohammad K.; Jasim, Mohammad K.; Al-Moussawi, Azhar A. title: HAEMATOZO`A OF THE AVIAN FAMILY PHASIANIDAE IN IRAQ date: 2001-07-01 words: 1335 flesch: 62 summary: Absence of Leucocytozoon infection is surprising since this parasite ranks third of the total infection in many studies in Iraq and abroad (McClure et al., 1978; Shamsuddin and Mohammad, 1981; Bennett et al., 1982; Mohammad, 1991). Surprisingly, although their helminths are rather well studied (Sawada and Mohammad, 1989; Mohammad, 1990, 1996; Mahmoud et al., 2000) keywords: avian; bennett; birds; blood; bull; family; francolinus; haematozoa; haemoproteus; hist; infection; iraq; mohammad; mus; nat; north; parasites; partridge; phasianidae; seesee; shamsuddin; species; total cache: binhm-192.pdf plain text: binhm-192.txt item: #83 of 297 id: binhm-193 author: Mohsen, Zohair H.; Mahmood, Suhaila H.; Al-Dulaimi, Sabah I.; Hashim, Abdul-Kareem title: FIELD EFFICACY OF THREE TYPES OF INSECTICIDES AGAINST LARVAE OF MUSCADOMESTICABREEDING IN EQUINE MANURE AND THEIR EFFECTS ON PREDATORY MITES date: 2001-07-01 words: 2041 flesch: 64 summary: With the large numbers of predator mites present in horse dung samples it is expected that the decline in numbers of M. domestica larvae is largely due to a combined activity of insecticides and predator mites (Families Macrochelidae, Parasitidae and Uropodidae). The efficacy of insecticides against larvae of M. domestica and their effects on predator mites were assessed by counting the number of larvae and mites at periods of pretreatment, 1-d, 7-d, 14-d and 21-d posttreatment in 250 g of surface (depth of 5-10 cm) horse dung samples. keywords: actellic; application; axtell; control; domestica; dung; econ; effects; efficacy; ent; ficam; field; fly; horse; insecticides; larvae; macrocheles; mahmood; manure; mites; mohsen; muscaedomesticae; neporex; numbers; populations; predator; present; samples; species; study; table; treatment cache: binhm-193.pdf plain text: binhm-193.txt item: #84 of 297 id: binhm-194 author: Sheriiff, H. A.; Delool, R. A. title: A COMPARATIVE STUDY OF ECOLOGICAL AND GENETICAL ADAPTATION OF THREE IRAQI FRESH WATER SNAILS IN RESPECT TO HEAVY METAL POLLUTION date: 2001-07-01 words: 2967 flesch: 62 summary: Delool Table 3: Metal concentrations in the original habitats. A comparative study was carried out on ecological and genetical adaptation of three Iraqi freshwater snails, Physa acuta, Melanopsis buccinoidea and Melanoides tuberculata, in respect to acute toxicity of heavy metals (Zn, Cd and Hg). keywords: acuta; adaptation; altamor; average; biology; buccinoidea; canal; comparative; concentrations; delool; distribution; drainage; ecological; effects; experimental; exposure; factors; freshwater; genetical; habitats; heavy; higher; hikmat; iraq; lt100; lt50; melanoides; melanopsis; metals; molluscs; new; organisms; original; physa; pollution; ppm; range; respect; results; sheriff; snails; species; studies; study; table; temperature; time; tolerance; toxicity; tuberculata; vernberg; water; zinc cache: binhm-194.pdf plain text: binhm-194.txt item: #85 of 297 id: binhm-195 author: Swail, Mahdi Abbas title: APHID PREDATORS OF THE GENUS COCCINELLAL. (COLEOPTERA: COCCINELLIDAE) date: 2001-07-01 words: 1827 flesch: 69 summary: As the abovementioned list of Aphids preyed upon by Coccinella L. shows, the most predominant species of predators are C. septempunctata L., C. repandaThanb. 80 Aphid predators of Coccinella 10 C. septempunctata L. Awadalla & Khalil, 1970 Saxena et al., 1970 Rautapaa, 1972 Stary & Kaddou, 1975 Radike et al., 1977 Gumovskaya, 1982 Mohammad & Abdullah, 1985 Nakamata & Saito, 1985 Hammam Al- Alil, Iraq New Delhi Finland Iraq India U.S.S.R. keywords: agric; aphid; appl; carroll; central; coccinella; coccinellidae; egypt; ento; field; franzman; genus; hoyt; india; iraq; j.of; kaddou; list; new; north; pisum; poland; predators; queensland; res; rev; septempunctata; species; stary; station; studies; study; swail; washington cache: binhm-195.pdf plain text: binhm-195.txt item: #86 of 297 id: binhm-196 author: Abdul-Rassoul, M. S.; Aziz, F. I. title: New record of ground pearls, Porphyrophora tritici (Bod.) (Homoptera, Margarodidae) as a pest of wheat in Iraq date: 2001-07-01 words: 759 flesch: 80 summary: A survey of the literature concerning wheat pests, shows that there are two species of ground pearls, Porphyrophora tritici (Bod.) and Porphyrophora polonica (L.) distributed throughout the wheat and barely growing areas of western and central Asia (Miller,1991). (2001) 9 (3): 85-87 New record of ground pearls, Porphyrophora tritici (Bod.) keywords: aziz; bodenheimer; bull; ground; hist; insects; iraq; new; pearls; pest; plant; porphyrophora; red; roots; species; tritici; wheat cache: binhm-196.pdf plain text: binhm-196.txt item: #87 of 297 id: binhm-198 author: Abdul-Rassoul, M. S. title: A NEW SPECIES OF LIODONTOMERUS GAH. FROM IRAQ (HYMENOPTERA, TORYMIDAE) date: 2000-07-01 words: 606 flesch: 72 summary: Liodontomerus longicorpus sp. n. differs from all the known members of the genus (see Szelenyi, 1959: Gaster distinctly longer than thorax and head combined, nearly bare above, finely and densely reticulate at sides , first tergite deeply incised at hind margin . keywords: broad; bull; dark; green; head; hind; iraq; long; longicorpus; margin; new; rassoul; segments; thorax cache: binhm-198.pdf plain text: binhm-198.txt item: #88 of 297 id: binhm-199 author: Al-Douri, Zahida title: NOTES ON SOME MITES UNDER CERTAIN FIELD CROPS IN CENTRAL IRAQ date: 2000-07-01 words: 911 flesch: 67 summary: M.S. {Ed} {Identification Key of soil inhabiting mites. [ Key of soil inhabiting mites. keywords: acaridae; alfalfa; baghdad; barley; berlese; central; douri; family; fauna; iraq; mites; new; scutacarus; soil; species; study; tarsonemidae; trombidiformes; wheat cache: binhm-199.pdf plain text: binhm-199.txt item: #89 of 297 id: binhm-200 author: Ali, H. A. title: A NEW SPECIES OF CARABIDAE (NSECTA: COLEOPTERA) FROM IRAQ date: 2018-10-27 words: 725 flesch: 72 summary: Andrewes (1927) identified 18 species in a collection from Arabian Gulf Ali (1966) made an extensive work on Iraqi carabidae identified and Keyed in the Department of Entomology of British Museum (N.H.). The genitalia were preserved in glycerin in a microvial and pinned with the type specimen which have been Kept in the British Museum (N.H.). keywords: british; bull; carabidae; genitalia; head; iraq; margin; median; museum; nat; new; setae; species cache: binhm-200.pdf plain text: binhm-200.txt item: #90 of 297 id: binhm-201 author: Mohammad, Mohammad K. title: ON A NEW CESTODE FROM THE AVOCET RECUR VIROSTRA AVOCETTA L. COLLECTED IN IRAQ date: 2000-07-01 words: 1121 flesch: 65 summary: They also analysed the description of H. blanksoni from the duodenum of H. h. himantopus in Ghana, and consider the family Diploposthidae to be synonymous with Hymenolepididae, Although there is some confusion in regard to generic position of some taxa of Diploposthidae, the present cestode is clearly belonged to genus Himantocestus and the present species differs from the genotype H. blanksoni in attaining larger size of strobilae; larger size of testes, almost double ( diameter 0.113 mm); less number of testes with mean of 44 instead of 60 in H. blanksoni ; cirrus situated in the middle of mature segment instead of anterior third and slightly posterior to the middle in the gravid segment instead of the middle; ovary and vitelline gland are larger; and fmally it has more uterus branches. This cestode is related to H. blanksoni Ukoli 1965 but easily differentiated from it in having longer and wider strobila, larger size of testes but lesser in number, cirrus situated in the middle of mature segment histead of anterior third and slightly posterior to the middle in gravid segment instead of the middle , ovary and vitelline gland are larger , and the uterus has more branches. keywords: avocet; baghdad; birds; blanksoni; cestode; cirrus; diploposthidae; fig; genus; himantocestus; himantopus; iraq; larger; mature; middle; new; posterior; segment cache: binhm-201.pdf plain text: binhm-201.txt item: #91 of 297 id: binhm-202 author: Al-Malo, I. M.; Abdul-Rassoul, M. S. title: A NEW SPECIES OF GENUS TRIALEURODES COCKERE FORM IRAQ (HOMOPTERA, ALEYRODIDAE) date: 2000-07-01 words: 806 flesch: 71 summary: Trialeurodes irakensis sp. n. is closely allied to T ricini but differs from it by the following character: operculum rectangular in shape fills half or less than of vasiform orifice: lingula exposed and extending up to tip of vasiform orifice or more. Submarginal papillae nearly triangular in shape, with shape tip (Fig. 3)…………………………… I rara Singh.1931 - Subdorsal papillae large and rounded in shape, usually four pairs or more (Fig.4)…………………. keywords: aleyrodidae; baghdad; half; irakensis; iraq; orifice; papillae; pupal; shape; species; trialeurodes; university; vasiform; westwood cache: binhm-202.pdf plain text: binhm-202.txt item: #92 of 297 id: binhm-203 author: AL-Sandouk, N. M. title: AN ABNORMAL GENITALIA IN CIOJNDELA AULICE DEJ. (COLEOPTERA: CICINDELIDAE) FROM IRAQ date: 2000-07-01 words: 955 flesch: 74 summary: Male genitalia, the male genital tube of Cicindelid as figured here for comparison (Fig. 3) and to illustructures. swollen along the distal two thirds and narrowed toward basal end: median orifice being as a slit along ventral side of the distal end the lobe, while the median foramen as a circular opening receiving the ejaculatory duct at basal end of the median lobe (aedeagus). keywords: basal; bull; carabidae; coleoptera; distal; end; female; genitalia; iraq; lateral; lobe; male; median; species; specimens; tube cache: binhm-203.pdf plain text: binhm-203.txt item: #93 of 297 id: binhm-204 author: Daoud, Y. T. title: COMPARATIVE ECOLOY OF TWO SPECIES OF BIVALVE CORBICULA FL UMINEA AND CORBICULE FL UMINALIS IN SHATT AL-ARAB date: 2000-07-01 words: 1414 flesch: 65 summary: Al - Chalabi each of Corbicula species may possess intrinsically different life cycles. Arab River. keywords: age; arab; area; c.flurninea; clams; corbicula; densities; group; growth; history; iraq; life; morton; muller; number; population; press; river; sampling; shatt; shell; species; study; water; year cache: binhm-204.pdf plain text: binhm-204.txt item: #94 of 297 id: binhm-205 author: El-Wailly, Alwan J.; Al-Jawhary, Ehsan F. title: UTTILIZATION OF LIPIDS AS SOURCE OF ENERGY DURING HIBERNATION OF RANA RIDIBUNDA PALLAS, 1771 date: 2000-07-01 words: 2732 flesch: 79 summary: In March, however, on difference in fat body lipid weight was observed between the sexes (0.973% +- 0.3379 in males and 0.83 l%+-0.3975 in females). the content of fat body lipid was higher in males (3.73% +- 0.5073) than in females (1.56% +- 0.3436). keywords: air; baghdad; bodies; body; body lipid; body tissue; body weight; bufo; cal; changes; content; day; december; dry; dry body; energy; fat; fat bodies; fat body; february; females; frog; hibernation; january; lipid; lipid content; losses; march; mean; metabolism; october; percent; period; rana; ridibunda; seasonal; table; temperature; tissue; total; water; weight cache: binhm-205.pdf plain text: binhm-205.txt item: #95 of 297 id: binhm-206 author: Mahmoud, S. S.; Mohammad, Mohammad K.; Yasin, Suhad title: INTENSITY AND HISTOPATHOLOGICAL EFFECTS OF THE NEMATODE HARTERTIA GALLINARUM(THEILER, 1919) ON SEESEE PARTRIDGE, AMMOPERDIX GRISEOGULARIS ( BRANDT, 1843)COLLECTED FROM QA’ RA AREA, WEST OF IRAQ date: 2000-07-01 words: 1878 flesch: 68 summary: The tissue reaction to nematode parasites probably have not been studied as extensively as the reactions to other infective agents ( Poynter, 1966) although the nematodes constitute the most important group of helminth parasites ( Ruff. 1978 ) . which constitute the most important group of helminth parasites. keywords: area; birds; c.s; chalabi; damage; effects; fibrosis; fig; gallinarurn; gizzard; hartertia; histopathological; host; infected; infiltration; intensity; intestine; iraq; lining; liver; necrosis; nematode; new; parasites; partridge; proventriculus; reaction; seesee; worms cache: binhm-206.pdf plain text: binhm-206.txt item: #96 of 297 id: binhm-207 author: Mawlood, N. A.; Abdul-Rassoul, M. S. title: NOTES ON TROGODERMA SPECIES (COLEOPTERA, DERMESTIDAE) OF IRAQ date: 2000-07-01 words: 1958 flesch: 75 summary: Lateral part of bridge joining paramers in male genetalia broader than its transversal part (Fig.11) ………………………... Lateral part of bridge joining paramers about as broad as its transversal part ………………………………………. keywords: abdominal; anterior; baghdad; black; broader; brown; club; dark; eye; facets; fig; head; inner; iraq; lateral; long; male; margin; ninth; paramers; punctures; reddish; segments; species; striae; tenth; tergite cache: binhm-207.pdf plain text: binhm-207.txt item: #97 of 297 id: binhm-208 author: Mekhlif, Atellah F. title: RECORDS OF HOST PLANTS OF PEA LEAF MINER, P1-f YTOMYZA HORTICOLA GOUREAU (DIPTERA: AGROMYZIDE) IN IRAQ date: 2000-07-01 words: 876 flesch: 69 summary: Mus. (2000) 9 (2): 67-70 RECORDS OF HOST PLANTS OF PEA LEAF MINER, P1-f YTOMYZA HORTICOLA GOUREAU (DIPTERA: AGROMYZIDE) IN IRAQ Atellah F. Mekhlif Department of Biology, College of Education. Number of host plants of P. hosticola which are recorded in present and preceding studies in Iraq. keywords: azawi; bull; compositae; cruciferae; diptera; families; family; goureau; horticola; host; iraq; leaf; mekhlif(1984; monocotyledons; mosul; pea; phytomyza; plants; species; spencer; study; table cache: binhm-208.pdf plain text: binhm-208.txt item: #98 of 297 id: binhm-209 author: Mohammad, Mohammad K.; Al-Neaimi, Taha M. title: BLOOD PARASITES OF TWO BEE-EATERS iN IRAQ date: 2000-07-01 words: 2119 flesch: 63 summary: Comparing the morphometric measurements of Haemoproteus meropis recorded by Bennett (1978) from Asian and African meropids with those of the present study revealed that the Iraqi specimens are more allied to African ones (table 2), while the differences noted between some morphometric parameters among the specimens of the present study and that reported by Bennett (1978) may be due to, in part, to their presence in different species of host birds. Al - Chalabi Table 1: Bird species, no. of examined and infected birds and percentage of infection. keywords: apiaster; baghdad; bee; bennett; birds; blood; blue; cell; eater; european; family; haemoproteus; host; hudaidensis; infected; infection; iraq; length; manwelli; merops; mohammad; new; nov; nucleus; parasite; persian; persicus; sample; species; specimens; study; table; total; width cache: binhm-209.pdf plain text: binhm-209.txt item: #99 of 297 id: binhm-21 author: Al-Hashmi, Asmaa Hassan; Al-Safar, H. H.; Augul, Razzaq Shalan title: KEY TO THE SPECIES OF THE ORTHETRUM NEWMAN, 1833 (ODONATA, LIBELLULIDAE) WITH A NEW RECORD SPECIES IN IRAQ date: 2018-07-01 words: 2551 flesch: 60 summary: Triangular cell MA : Median arculus VS : Vulvar scale 17 Asmaa Hassan Al-Hashmi et al. RESULTS AND DISCUSSION In the present study, an identification key to species was made depending on the morphological characters, and followed by geographical distribution; these species included: O. anceps, O. brunneum, O. sabina, O. taeniolatum, O. chrysostigma and O. trinacria ; the first one is registered as a new record in Iraq. From the other hand, Augul et al. (2016) were re-description of O. chrysostigma (Burmeister, 1839) and referred to it as a new record from Iraq, although previously is none DOI: http://dx.doi.org/10.26842/binhm.7.2018.15.1.0015 https://en.wikipedia.org/wiki/Old_World 16 Key to the Species of the Orthetrum Newman, 1833 specifically mentioned by Askew (1988); therefore, this paper was conducted to design a key to species under the genus of Orthetrum in Iraq. keywords: 2012; 2013; anceps; asmaa; baghdad; cell; chrysostigma; cubital; discoidal; distribution; dragonflies; genus; hashmi; hassan; hind; iraq; key; libellulidae; materials; morphological; newman; o. anceps; o. sabina; o.brunneum; odonata; orthetrum; plate; province; radius; record; sabina; scale; schneider; species; specimens; suture; taeniolatum; trinacria; university; vein; wing cache: binhm-21.pdf plain text: binhm-21.txt item: #100 of 297 id: binhm-210 author: Radhi, Flassan HA.; Jan, Sadi K.; Azsiez, Ahmid M. title: EFFICIENCY OF AL-RUSTAMITYAH SEWAGE PLANT AND THEIR CONSEQUENCES ON THE POLLUTION OF DIYALA RIVER date: 2000-07-01 words: 2128 flesch: 71 summary: One major of pollution is the organic load of final sewage effluents. DISCUSSION The main removal mechanisms for pollutants acrose wastewater treatment plant are solatili,ation. keywords: cod; concentration; content; dichromate; effluent; fig; final; gas; grease; high; iraq; metals; no2; oil; organic; percent; plant; pollution; ppm; present; purification; quality; raw; river; samples; sewage; sludge; so4; solids; standard; sulphate; suspended; total; treatment; unit; wastewater cache: binhm-210.pdf plain text: binhm-210.txt item: #101 of 297 id: binhm-211 author: Abdul-Rassoul, M. S. title: Hydrophilidae of Iraq (insect , Coleopterws) date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-211.pdf plain text: binhm-211.txt item: #102 of 297 id: binhm-213 author: Abdul-Rassoul, M. S.; Mohammad, Mohammad K.; Kadhim, F. S. title: parasites of the house fly Musca domestica L. (Distera , Muscidae) in Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-213.pdf plain text: binhm-213.txt item: #103 of 297 id: binhm-214 author: Abid, Abd Al-Nabi Jwaied title: Effect of juvenile hormone analogue and precoene II on the growth and metamorphosis of house fly Musca domwstica date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-214.pdf plain text: binhm-214.txt item: #104 of 297 id: binhm-215 author: AL-Aciharni, M. A.; AL-Bakri, N. A. title: Development of thyroid gland in common carp Cyprinus carpio L. (Cyprinidae) date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-215.pdf plain text: binhm-215.txt item: #105 of 297 id: binhm-217 author: Ali, H. A. title: new species of ground beetles (Coleptera : Carabidae) from Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-217.pdf plain text: binhm-217.txt item: #106 of 297 id: binhm-218 author: Al-Rubai, Hadi M.; Al-Azawi, Abdulla F. title: Some leaf hopper and a plant hopper with their populations in Abu-Ghraib, Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-218.pdf plain text: binhm-218.txt item: #107 of 297 id: binhm-219 author: Al-Zubaidi, Aqeel A.; Jan, Sadi K.; Al-Amiry, Jabbar A. H. title: Grain size and sorting as indicators of depositional environment of ghar formation (late lower Miocene), Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-219.pdf plain text: binhm-219.txt item: #108 of 297 id: binhm-22 author: Al-Zubaidi, Aqeel Abbas title: FACIES ANALYSIS AND NEW DISCOVERY OF A MASTODONT FROM INJANA FORMATION (LATE MIOCENE) NEAR THARTHAR LAKE- MIDDLE OF IRAQ date: 2018-07-01 words: 3347 flesch: 62 summary: This study depends on sedimentologic and facies analysis to recognize paleoenvironment and recognize the kinds of vertebrate bone fossils during Late Miocene. Some mastodont species, of order proboscidea were DOI: http://dx.doi.org/10.26842/binhm.7.2018.15.1.0031 32 Facies Analysis and New Discovery of a Mastodont recognized beside 20 types of vertebrate bone fossils within sandstone beds of Injana Formation (Thomas et al., 1981). keywords: abbas; analysis; aqeel; area; baghdad; bar; basi; bone; city; claystone; cross; diag; discovery; environment; facies; fine; flood; flow; fluvial; formation; fossils; geological; hills; injana; injana formation; iraq; lake; large; late; mastodont; materials; meandering; miall; middle; miocene; mudstone; nearby; new; north; point; proboscidea; river; sammarraa; sandstone; small; studied; study; sub; surface; tharthar; university; upper; vertebrate; zubaidi; الى cache: binhm-22.pdf plain text: binhm-22.txt item: #109 of 297 id: binhm-220 author: Hassan, Hassaia F. title: Role of Bathyplectes curulionis (Thomson) (Hymenoptera : Ichneumoidae) in controlling alfalfa weevil in central Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-220.pdf plain text: binhm-220.txt item: #110 of 297 id: binhm-221 author: Jan, Sadi K. title: Biostratigraphy of shirranish formation, well DD.1 (N. Iraq) date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-221.pdf plain text: binhm-221.txt item: #111 of 297 id: binhm-222 author: Matani, Jameel S. title: Insects associated with inflorescence rot disease of date in Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-222.pdf plain text: binhm-222.txt item: #112 of 297 id: binhm-223 author: Mekhlif, Atallah F. title: Records of some leaf miners of Anthomylidae, (Diptera) and their host plants in Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-223.pdf plain text: binhm-223.txt item: #113 of 297 id: binhm-224 author: Mohammad, Mohammad K. title: Helminth parasites of the kestrel Falco tinnunculus L. 1758 in Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-224.pdf plain text: binhm-224.txt item: #114 of 297 id: binhm-225 author: Mohammad, Mohammad K. title: Species the soft tck genus Argas (Acarina ,Ixodoidea) in Iraq date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-225.pdf plain text: binhm-225.txt item: #115 of 297 id: binhm-23 author: Shugran, Ahmed Hamed Mahde; Augul, Razzaq Shalan; Al-Khesraji, Talib Owaid title: LIST OF INSECTS ASSOCIATED WITH MACROFUNGI IN TIKRIT CITY, SALAHADIN GOVERNORATE, IRAQ date: 2018-07-01 words: 3889 flesch: 52 summary: Zootaxa, 1755: 35–46. Martin, M. M. 1979. Augul, R. S., Al-Saffar, H. H., Ali, H. B. and Abdul-Rassoul, M. S. 2015. keywords: ahmed; alam; antennae; anterior; available; beetles; body; british; cis; coleoptera; color; diagnosis; difsha; diptera; distribution; district; dorsal; et al; europe; families; family; farm; fauna; fungus; genera; genus; hackston; hamed; history; identification; insects; iran; iraq; key; larvae; length; list; london; macrofungi; mahde; male; margin; materials; museum; mycetophilidae; natural; north; plate; pronotum; research; shugran; small; species; specimens; staphylinidae; tikrit; university; ventral; view cache: binhm-23.pdf plain text: binhm-23.txt item: #116 of 297 id: binhm-230 author: Abdul-Rassoul, M. S. title: INSECT PESTS INFESTING ANIMAL MUSEUM COLLECTIONS IN IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-230.pdf plain text: binhm-230.txt item: #117 of 297 id: binhm-231 author: Abdul-Rassoul, M. S.; Ali, H. A. title: SOME CHRYSOMELIDAE ( COLEOPTERA ) FROM IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-231.pdf plain text: binhm-231.txt item: #118 of 297 id: binhm-233 author: Afrasiab, Saman R.; Ali, H. A. title: NOTES ON SCOLECOPHIDIANS (BLIND SNARES) REPT1LIA SERPENTES, OF IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-233.pdf plain text: binhm-233.txt item: #119 of 297 id: binhm-234 author: Ali, H. A. title: ACUPALPUS WLESOPOTAMTCUS SP. NOV. (COLEOPTERA: CARARIDAE) FROM IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-234.pdf plain text: binhm-234.txt item: #120 of 297 id: binhm-235 author: El-Behadli, Ali Hussain title: PATHOGENIC FUNGI IN PEAT MOSS AND SOIL AND THEIR IMPACTION ON COVERED FARM VEGETAB¬LE CROPS date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-235.pdf plain text: binhm-235.txt item: #121 of 297 id: binhm-236 author: Hassan, Kadhim S.; Matani, Jameel S. title: TWO PRIMITIVE ORIBATIDS: FIRST RECORD IN IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-236.pdf plain text: binhm-236.txt item: #122 of 297 id: binhm-238 author: Mahmood, Souhaila H.; Al-Rubaii, Khalaff; Aldulaimi, Sabah I. title: SOME ACARINE ECTOPARASITES ON BATS IN MIDDLE IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-238.pdf plain text: binhm-238.txt item: #123 of 297 id: binhm-24 author: Augul, Razzaq Shalan title: STUDY ON DIVERSITY OF BEES (HYMENOPTERA, APOIDEA) FROM DIFFERENT REGIONS OF IRAQ date: 2018-07-01 words: 6270 flesch: 58 summary: Global distribution: Iraq (Derwesh, 1965); Europe, North Africa, Turkey, China, Nepal, India and Uzbekistan (Huan–li and Tadauchi, 2008). Andrena vetula Lepeletier, 1841 Global distribution: Iraq (Derwesh, 1965); Greece, Turkey, Cyprus, Syria, Lebanon, Israel, Palestine, Egypt and Libya (Grace, 2010). keywords: 2014; 2017; 2018; africa; algeria; andrena; anthophora; apidae; apoidea; ascher; asia; augul; available; baghdad; bees; central; china; coelioxys; cyprus; derwesh; different; ebmer; egypt; et al; eucera; europe; fabricius; families; fauna; france; genus; global distribution; grace; greece; halictidae; halictus; hawizeh; hymenoptera; india; iran; iraq; israel; jordan; journal; khalaf; lasioglossum; latreille; lebanon; lepeletier; libya; list; materials; maysan; megachile; megachilidae; morawitz; morocco; new; ni'aaj; north; omar; pakistan; pauly; pickering; province; rasmont; razzaq; shalan; smith; spain; species; specimens; study; syria; turkey; turkmenistan; umm; university; warncke; wasit; xylocopa cache: binhm-24.pdf plain text: binhm-24.txt item: #124 of 297 id: binhm-240 author: Mohammad, Mohammad K. title: HAEMOPROTEUS BURHINUSA NEW SPECIES FROM THE STONE CURLEW, BU RHINUS OEDICN EMUS SAHARAE (REICHENOW) IN IRAQ date: 1996-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-240.pdf plain text: binhm-240.txt item: #125 of 297 id: binhm-243 author: Abdul-Rassoul, M. S. title: A New Species of Systole Walker (Hymenoptera, Eurytomidae) date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-243.pdf plain text: binhm-243.txt item: #126 of 297 id: binhm-244 author: Abdul-Rassoul, M. S. title: CHALCIDOID (HYMENOPTERA.) PARASITES OF THE BRUCHID BEETLES IN IRAQ WITH A DESCRIPTION OF A NEW SPECIES) date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-244.pdf plain text: binhm-244.txt item: #127 of 297 id: binhm-246 author: Al-Alawy, Sadi A.; Abdul-Rassoul, M. S.; Al-Azawi, A. F. title: DESCRIPTION OF NEW SPECIES OF TERMITES (INSECTA, ISOPTERA) FROM IRAQ date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-246.pdf plain text: binhm-246.txt item: #128 of 297 id: binhm-248 author: Ali, H. A.; Abdul-Rassoul, M. S.; Swail, M. A. title: SYSTEMATIC LIST OF COCCINELLIDAE RECORDED FOR IRAQ date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-248.pdf plain text: binhm-248.txt item: #129 of 297 id: binhm-25 author: Afrasiab, Saman R.; Al-Moussawi, Azhar A.; Hadi, Hind D. title: ANNOTATED CHECKLIST OF REPTILIAN FAUNA OF BASRAH, SOUTH OF IRAQ date: 2018-07-01 words: 3630 flesch: 64 summary: Afrasiab et al. (2016) described Dolichophis mesopotamicus, as a new species of the same genus from upper Mesopotamia, so the Dolichophis population of Basrah province requires more collection and more taxonomic study. This situation gave Basrah province a topographic specific opportunity for raising its own faunal diversity including reptiles; in this study Basrah province was divided into four main zones: the cities and orchards, marshes and wetlands (sabkha), the true dessert, the seashore and Shat Al-Arab. keywords: 1989a; 1992; afrasiab; afrasiab et; ali; arabia; area; authors; baghdad; basrah; basrah province; black; boulenger; checklist; collection; colubridae; common; desert; dorsal; et al; family; fauna; history; inhrcm; iraq; journal; leviton; lizards; mohamad; morgani; museum; natural; new; north; plate; province; rastegar; reptiles; reptilian; research; rows; rumaila; saman; scales; sea; snake; south; species; specific; specimens; squamata; stenodactylus; study; turtles; university; west cache: binhm-25.pdf plain text: binhm-25.txt item: #130 of 297 id: binhm-252 author: Baqir, Abdul W. title: MEDIUM OPTIMIZATION FOR BIOMASS PRODUCTION AND PROTEIN CONTENT OF CANDIDA UTILES K50 date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-252.pdf plain text: binhm-252.txt item: #131 of 297 id: binhm-255 author: Hassan, Kadhim S. title: THE INFLUENCE OF TEMPERATURE AND HUMIDITY ON THE BIOLOGY OF THE HOUSE DUST MITE DERMATOPHAGOIDES PTERONYSSINUS TROUESSART 1897 (ACARI : PYROGLYPHIDAE) date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-255.pdf plain text: binhm-255.txt item: #132 of 297 id: binhm-259 author: abdul-Wahab, Wail; Ibraheem, Naima; Shaker, Parween title: NATURAL ENEMIES OF WHITEFLIES IN IRAQ date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-259.pdf plain text: binhm-259.txt item: #133 of 297 id: binhm-26 author: Abdul-Rassoul, M. S. title: FIRST RECORD OF AENASIUS ARIZONENSIS (GIRAULT, 1915) (HYMENOPTERA, ENCYRTIDAE), A PARASITOID OF PHENACOCCUS SOLENOPSIS TINSLY, 1898 (HEMIPTERA, PSEUDOCOCCIDAE) IN IRAQ date: 2018-07-01 words: 2494 flesch: 52 summary: Preliminary studies on field parasitisation and biology of solenopsis mealybug parasitoid Aenasius bambawalei Hayat, (Encyrtidae:Hymenoptera). ABSTRACT This article reports the first record of Aenasius arizonensis (Girault, 1915) (Hymenoptera, Encyrtidae) parasitizing the recently introduced species of cotton mealybug, Phenacoccus solenopsis Tinsly (Hemiptera, Psedococcidae) infesting Lantana camara L. (Verbeneceae) as well as other ornamental plants in Baghdad province, Iraq. keywords: abdul; aenasius; arizonensis; baghdad; bambawalei; camara; cotton; encyrtidae; et al; female; girault; hayat; hemiptera; host; hymenoptera; iraq; lantana; long; mealybug; new; noyes; parasitoid; phenacoccus; phenacoccus solenopsis; plants; portulaca; pseudococcidae; rassoul; record; solenopsis; species; tinsley; verbenaceae cache: binhm-26.pdf plain text: binhm-26.txt item: #134 of 297 id: binhm-260 author: Al-Jabery, Ibrahim A. R. title: New Records And Some Notes On The Broad Bean Root Aphids and Their Natural Enemies in Hammam Al-Alil date: 1999-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-260.pdf plain text: binhm-260.txt item: #135 of 297 id: binhm-261 author: Al-Maliky, Sadika K.; Al-lzzi, Mohammed A. J. title: APANTELES ANGALETI (MUSEBECK). HYMENOPTERA BRACONIDAE A NEW RECORD SPECIES IN IRAQ date: 1990-07-01 words: 3 flesch: 119 summary: Full page photo keywords: photo cache: binhm-261.pdf plain text: binhm-261.txt item: #136 of 297 id: binhm-268 author: Al-Saffar, Hanaa H. title: REVISION OF THE FAMILY CHLOROPIDAE (DIPTERA) IN IRAQ date: 2018-12-24 words: 2926 flesch: 63 summary: The aim of this study is to survey and make to revision the genera and species of Chloropidae fauna of Iraq. Revision of Chloropidae of the collection of B. A. Gimmerthal and a check- list of Latvian Chloropidae (Diptera). keywords: 2002; 2013; 2015; baghdad; black; body; characters; chloropidae; deeming; dhafer; diagnostic; diptera; distribution; elachiptera; entomology; et al; eye; families; family; fauna; flies; frit; genera; genus; global; grass; hanaa; insects; iran; iraq; journal; key; khameneh; meigen; meromyza; museum; nartshuk; new; oscinella; peninsula; records; research; revision; saffar; species; specimens; subfamilies; yellow cache: binhm-268.pdf plain text: binhm-268.txt item: #137 of 297 id: binhm-269 author: Khamees, N. R.; Adday, T. K.; Abed, J. M. title: OCCURRENCE AND REDESCRIPTION OF THRYSSA SETIROSTRIS (BROUSSONET, 1782) (CLUPIFORMES, ENGRAULIDAE) FROM IRAQI MARINE WATER date: 2018-12-24 words: 3096 flesch: 77 summary: In most Thryssa species the first supramaxilla is minute or lost while the second supramaxilla is prominent (Ganga, 2015), those with or without first supramaxilla, and the level of tip of snout with a line drawn through mid-eye as in Plate 1, comprises some species including T. setirostris (Whitehead et al., 1988), T. setirostris differ from other species in this group by having very long maxilla. The identification of Thryssa species is usually based on combination of some characters such as the length of maxilla which may either being short (reach the preopercular), or medium (reach gill slits), or long (reach base of pectoral fins), or some even very long (reach pelvic fin base or beyond) (Whitehead et al., 1988). keywords: 2013; 2015; anal; arabian; base; body; broussonet; caudal; characters; depth; dorsal; dorsal fin; engraulidae; et al; fin; fishes; gulf; head; i+12; identification; iraq; jaw; kuwait; length; long; marine; maxilla; occurrence; pauly; pectoral; pelvic; pre; present; rays; setirostris; species; specimens; stan; standard; study; thryssa; total cache: binhm-269.pdf plain text: binhm-269.txt item: #138 of 297 id: binhm-27 author: Abed, Ibrahim J.; Abdulhasan, Ghusoon A.; Najem, Ali M. title: GENOTYPE VERSUS PHENOTYPE TO DETERMINE THE DEFINITIVE IDENTIFICATION OF THE GENERA CHLORELLA BEIJERINCK, 1890 (CHLORELLACEAE) AND COELASTRELLA CHODAT, 1922 (SCENDESMACEAE) date: 2018-07-01 words: 3211 flesch: 49 summary: Chloroplast parietal cup or merely plate, with or without a pyrenoid; this small alga may be confused with species of Chlorococcum, a soil or subaerial genus and it is very simalr also to many other unicellular coccoid green algae and may be confused with motionless zoospores of some genera. In another study, George et al. (2014) demonstrated several changes in shape and size of cells growing in culture medium under 150 mmol photons; Chokshi et al.(2015) have recorded that cells morphology varied due to the introduction of glucose to algae culture medium and the size of these cells increased 1-2 folds regardless of microalgae species. keywords: 18s; abed; algae; amplification; analysis; beijerinck; bootstrap; cell; characteristics; chlorella; chlorophyta; chodat; classification; coccoid; coccoid green; coelastrella; conditions; definitive; dna; environmental; et al; freshwater; genbank; genera; genotype; genus; green; green algae; hegewald; ibrahim; identification; iraq; isolates; krauss; light; medium; molecular; morphological; morphology; new; pcr; phenotype; phylogenetic; rrna; scenedesmaceae; sequences; shape; shihira; size; sorokiniana; species; specimens; studies; study; value; vulgaris cache: binhm-27.pdf plain text: binhm-27.txt item: #139 of 297 id: binhm-271 author: Ali, Mansour Jadaan; Abd Alfatlawi, Monyer Abdulameir; Karawan, Azhar Chafat title: MOLECULAR IDENTIFICATION AND PHYLOGENETIC-TREE ANALYSIS OF MONIEZIA SPECIES FROM SHEEP IN AL-DIWANIYAH CITY date: 2018-12-24 words: 2551 flesch: 69 summary: To study the evolution history of Moniezia species in the city of Diwaniyah, Iraq, the present study was initiated to evaluate the identity matching or mismatching of the city species with global species that belonging to this genus. Genetic characterization of Moniezia species in Senegal and Ethiopia. keywords: 18s; al r; artial; city; diwaniyah; expansa; genus; gland; identification; infestation; intestines; iraq; iso; journal; late; m al; m o; molecular; moniezia; n e; o n; parasitology; pcr; phylogenetic; r n; rib; seq; sequencing; sheep; species; spp; study; tapeworms; tree; veterinary cache: binhm-271.pdf plain text: binhm-271.txt item: #140 of 297 id: binhm-272 author: Abdul-Ameer, Kefah Naser; Atwan, Fatima Khalaf title: RECORDING OF TWO SPECIES OF THE GENUS DIPARTIELLA (RAABE, 1959) STEIN, 1961 (CLIOPHORA: TRICHODINIDAE) FOR THE FIRST TIME IN IRAQ FROM GILLS OF THE COMMON CARP CYPRINUS CARPIO date: 2018-12-24 words: 1934 flesch: 63 summary: More than 300 trichodinid ciliophoran species, representing 11 genera have been reported from the gills, skin, fins, urinary bladder as well as reproductive system of different fish species in the world (Asmat, 2014; Özer et al., 2015). Differential diagnosis of the genera in the family Trichodinidae (Ciliophora: Peritrichida) with the description of a new genus ectoparasitic on freshwater fish from southern Africa. keywords: 1989; adhesive; baghdad; bandyopadhyay; basson; blade; carpio; ciliophora; denticles; description; diameter; dipartiella; disc; fishes; genus; gills; indiana; iraq; kazubski; measurements; mitra; parasites; raabe; record; river; saha; species; specimens; stein; tigris; trichodinidae; van cache: binhm-272.pdf plain text: binhm-272.txt item: #141 of 297 id: binhm-273 author: Ali, Hayder Badry; Kamal, Ruia Safwan title: FAUNISTIC REVIEW OF THE GENUS CHAITOPHORUS KOCH, 1854 (APHIDIDAE, CHAITOPHORINAE, CHAITOPHORINI) WITH NEW RECORD SPECIES FOR IRAQ APHID FAUNA date: 2018-12-24 words: 2055 flesch: 62 summary: During the current investigation, four species of the genus Chaitophorus Koch have been recorded to Iraq aphid fauna; the records information for these species is compared with previous checklists as above in addition to our collection; the key to the species of this genus is designed as follows: Key to Chaitophorus species on Iraq popular trees (apterous viviparae in spring): Most of the species of the tribe Chaitophorini are monoecious holocyclic and infest plant families which belong to Salicaceae (Populus and Salix) and Aceraceae (Blackman and Eastop, 1994), there is a difficulty to distinguish between species of Chaitophorinae based on their morphological characteristics, although the tribe Chaitophorini has clear morphological differences between genera; separating between Chaitophorus species using morphology has always been problematic because of the fact that the morphological differences between species within these genera are relatively slight (Hille Ris Lambers, 1960; Pintera, 1987; Zhu et al., 2017). keywords: ali; antennal; aphid; aphididae; baghdad; base; blackman; body; chaitophorinae; chaitophorus; distribution; eastop; fauna; genus; green; hairs; hemiptera; hind; homoptera; iraq; koch; long; new; pale; pintera; populialbae; review; segment; species; tarsus cache: binhm-273.pdf plain text: binhm-273.txt item: #142 of 297 id: binhm-274 author: Al-Rawi, Altaf; Alwash, Bushra M. J.; Al-Essa, Nagham E.; Hassan, Fikrat M. title: A NEW RECORD OF COELASTRELLA TERRESTRIS (REISIGL) HEGEWALD & N. HANAGATA, 2002 (SPHAEROPLEALES, SCENEDESMACEAE) IN IRAQ date: 2018-12-24 words: 2685 flesch: 59 summary: 6Mo7O24.4H2O 0.028 ZnSO4.7H2O 0.224 CuSO4.5H2O 0.08 COCl2.6H2O 0.0004 H3BO3 0.288 9 Na2 SiO3 5.7 156 A new record of Coelastrella terrestris 158 A new record of Coelastrella terrestris Diagram (1): Phylogenetic tree of Coelastrella terrestris based on 18S rRNA gene sequences conferred by GeneBank data base, aligned together with algae available in the NCBI were analyzed and aligned through BLAST from NCBI using the Neighbor-Joining Analyses of 532 bp of corresponding position of 18S rRNA gene sequence. keywords: 18s; algae; altaf; analysis; baghdad; chlorella; classification; coelastrella; dna; et al; gene; genus; hanagata; hassan; hegewald; identification; iraq; isolated; light; microscope; molecular; ncbi; new; number; pcr; phylogenetic; rawi; record; reisigl; ribs; river; rrna; scenedesmaceae; science; sediment; sequence; similarity; soil; species; studies; study; terrestris; tschaikner; uzunov cache: binhm-274.pdf plain text: binhm-274.txt item: #143 of 297 id: binhm-275 author: Al-Faisal, Abbas J.; Mutlak, Falah M. title: SURVEY OF THE MARINE FISHES IN IRAQ date: 2018-12-24 words: 3265 flesch: 4 summary: A survey of fish species in the Iraqi marine waters was carried out for the period from November 2014 to March 2018. Key words: Checklist, fish species, Iraq, marine waters, survey. keywords: 1995; abbas; abe; ali; arabian; arabian gulf; assemblage; basrah; bishop; bleeker; bloch; carangidae; carangoides; carpenter; cuvier; day; different; dussumieri; epinephelus; et al; faisal; falah; families; fish; fish species; fishes; fishing; forsskål; gulf; haemulidae; hamilton; http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatget.asp?genid=2100; http://researcharchive.calacademy.org/research/ichthyology/catalog/getref.asp?id=1351; hussain; ichthyofauna; iraqi; iraqi marine; j. al; khor; kuronuma; lacepède; linnaeus; list; lutjanus; mahdi; marine; marine fishes; marine waters; mohamed; mutlak; naama; nets; northwest; number; order; period; pomadasys; present; randall; river; rüppell; schneider; serranidae; shatt; sparidae; species; studies; study; survey; thryssa; valenciennes; waters; younis; zubair cache: binhm-275.pdf plain text: binhm-275.txt item: #144 of 297 id: binhm-276 author: Al-khazali, Azhar Mohammed; Najim, Shurouq Abdullah title: FIRST RECORDS OF PHOLCIDAE (ARACHNIDA, ARANEAE) FROM IRAQ date: 2018-12-24 words: 1836 flesch: 64 summary: A. doriae could be a common species in southern Iraq, found in different regions of two provinces and maybemore widely distributed across Iraq and other neighbour countries. The genus Artema was described by Walckenaer (1837) from a single species, and it currently encompasses eight species most of them distributed from northern Africa to the Middle East including A. doriae. keywords: abdullah; araneae; artema; azhar; basrah; catalog; dhi; doriae; families; family; history; huber; iraq; khazali; length; mohammed; museum; najim; new; pholcidae; qar; records; regions; shurouq; southern; species; specimens; spiders; view; world cache: binhm-276.pdf plain text: binhm-276.txt item: #145 of 297 id: binhm-277 author: Al-Jaberi, Mohanad H.; Al-Dabbas, Moutaz A.; Jaber, Munaf Q. title: MINERALOGY AND GEOCHEMISTRY OF CORAL REEF IN IRAQI MARINE ENVIRONMENT IN THE NORTH PART OF ARABIAN GULF date: 2018-12-24 words: 5691 flesch: 62 summary: There are some special pattern of distribution for major and trace elements in coral reef area based on calcium content. The interesting in the geochemical analysis of marine sediments in coral reef area is the larger percentages of calcium oxide than the other calcium contents in Iraqi marine sediments; Al-Jaberi (2015) gave important information about the content of major and trace elements in Iraqi marine sediments; stated that calcium oxide range in these sediments between 13.1-23%. keywords: 2013; 2015; al2o3; arabian; arabian gulf; aragonite; area; basrah; burt; calcite; calcium; cao; carbonate; chlorite; clay; communities; composition; content; coral; coral reefs; distribution; elements; et al; fe2o3; geochemistry; gulf; high; iraqi; iraqi marine; jaberi; journal; k2o; magnesium; main; major; map; marine; marine sediments; mean; menella; mgo; mineralogy; minerals; na2o; octocoral; oxide; p2o5; phengite; pini; quartz; range; reefs; science; sea; sediments; silica; sio2; site; species; specimens; study; table; talc; tio2; trace; university; v2o5; water cache: binhm-277.pdf plain text: binhm-277.txt item: #146 of 297 id: binhm-278 author: Thanh, Phi Truong; Thinh, Phi Hong; Ha, Nguyen Viet title: ROCK SLOPE FAILURE BLOCKS AND THEIR RELATION TO TECTONIC ACTIVITY: A CASE STUDY IN 3B HIGHWAY, XUATHOA AREA, BACKAN PROVINCE, VIETNAM date: 2018-12-24 words: 4837 flesch: 66 summary: Method of slope failure analysis The analyses of plane failure, wedge failure, toppling failure and circular failure were carried out by Hoek and Bray’s application (2004), based on the fracture orientation; the analytical results will indicate the types of plane failure, wedge failure, toppling failure and circular failure on the rock slope surface as shown in the figures below. Recently, the other authors of Vietnam have http://dx.doi.org/10.26842/binhm.7.2018.15.2.0207 208 Rock Slope Failure Blocks and their Relation developed the Block Theory of Goodman and Shi (1985) to analyze slope failure based on fracture orientation and slope surface direction (Nguyen and Phi, 2014). keywords: 3th; activity; analytical; application; area; backan; backan province; bk-72; blocks; bray; d1ml2; diagram; direction; et al; failure; failure blocks; fault; fracture; highway; hoek; map; nguyen; number; orientation; percentage; plane failure; province; red; relation; results; river; rock; rock slope; sites; slope; slope failure; statistical; study; surface; survey; survey sites; system; t. t.; tectonic; vietnam; vietnamese; wedge failure; xuathoa; xuathoa area cache: binhm-278.pdf plain text: binhm-278.txt item: #147 of 297 id: binhm-28 author: Afrasiab, Saman R.; Al-Moussawi, Azhar A.; Mohammad, Mohammad K. title: COLOR VARIATION OF STREPTOPELIA DECAOCTO (AVIS, COLUMBIDAE) WITH SOME NOTES ON ENDOPARASITES date: 2017-12-01 words: 1952 flesch: 65 summary: Nature Iraq and Birdlife international (Edit.), 284 pp. Raillietina echinobothrida (Megnin,1881) (Cestoda: Cyclophyllidea) from the house sparrow Passer domesticus biblicus Hartret, 1881 collected in Baghdad city, central Iraq. keywords: afrasiab; baghdad; birds; black; bulletin; collared; collection; color; dark; decaocto; different; dorsal; dove; echinobothrida; face; history; iraq; light; mohammad; museum; natural; north; northern; parasite; population; race; raillietina; saman; south; specimens; streptopelia; study; variation; ventral; white cache: binhm-28.pdf plain text: binhm-28.txt item: #148 of 297 id: binhm-29 author: Zaid, Nazih Wayes title: SEASONAL CHANGES ON EPIDIDYMAL HISTOLOGY AND TESTOSTERONE RECEPTORS IN IRAQI DOGS date: 2017-12-01 words: 3100 flesch: 56 summary: The length of stereocilia also exhibits significant difference (P<0.01) between caput and corpus during winter, as well as, summer season was decrease significantly (P<0.01) than other seasons in dogs epididymis (Tab. 3). The study concluded that there were seasonal variations in dogs' epididymis being highest reproductive activity during spring and lowest during summer. keywords: activity; arrows; autumn; caput; cauda; cells; changes; coat; corpus; decrease; diameters; differences; different; dogs; epididymis; epithelial; error; h&e; height; histology; iraq; july; letters; luminal; march; means; muscular; numbers; p<0.01; principal; receptors; reproductive; seasonal; seasons; section; segments; significant; similar; small; spring; standard; stereocilia; study; summer; testosterone; total; winter; zaid; خالل cache: binhm-29.pdf plain text: binhm-29.txt item: #149 of 297 id: binhm-30 author: Afrasiab, Saman R.; Mohammad, Mohammad K.; Hussain, Amer M. title: RESEARCH NOTES ON RECORDING SOME RARE VERTEBRATES FROM KURDISTAN, IRAQ date: 2017-12-01 words: 3055 flesch: 64 summary: Nature Iraq, Sulaimani, Kurdistan-Iraq, 11pp. Nature Iraq, 2013. keywords: 2013; 2015; a.s.l; afrasiab; alpine; baghdad; birds; black; body; bulletin; chukar; collection; color; east; ecozone; erbil; erminea; et al; halgurd; helgen; history; hyla; iraq; kurdistan; mammals; mountain; museum; mustela; natural; north; notes; picata; present; rare; record; reid; research; river; saman; savignyi; sheikhly; south; species; stoat; tail; tip; university; vertebrates; weasel; white cache: binhm-30.pdf plain text: binhm-30.txt item: #150 of 297 id: binhm-307 author: Adday, Thamir K.; Jassim, Abdul Al-Amer R.; Al-Waely, Akeel A. A. title: RECORD OF THE BARNACLE OCTOLASMIS ANGULATA (AURIVILLIUS, 1894) FROM THE GILLS OF THE CRAB PORTUNUS SEGNIS (FORSKÅL, 1775) OFF IRAQI MARINE WATERS date: 2019-06-27 words: 3484 flesch: 63 summary: The current study represents the first record of the barnacle O. angulata in the Arabian Gulf. The present study represents the first record of the barnacle species O. angulata that found attached on the gill crab P. segnis off the Iraqi waters of the Arabian Gulf. keywords: 2017; adday; angulata; arabian; barnacle; basrah; biology; capitular; carina; cirripedia; crabs; crustaceans; distribution; et al; forskål; gill; gulf; ihwan; iraq; jeffries; journal; length; marine; mean; octolasmis; plates; portunus; present; record; region; science; scutum; segnis; shape; species; specimens; study; university; voris; waters; width cache: binhm-307.pdf plain text: binhm-307.txt item: #151 of 297 id: binhm-308 author: Al-Helli, Ammar M. S.; Ali, Atheer H.; Resen, Amjad K. title: FIRST RECORD OF SOLOSTAMENIDES PAUCITESTICULATUS KRITSKY & ÖKTENER, 2015 (MONOGENOIDEA, MICROCOTYLIDAE) FROM GILLS OF ABU MULLET PLANILIZA ABU (HECKEL, 1843) FROM EUPHRATES RIVER OF SAMAWA CITY, SOUTHERN IRAQ date: 2019-06-27 words: 3597 flesch: 63 summary: Fish taxonomy followed Coad (2010) and the common and scientific name of fish species were followed Froese and Pauly (2018). During extensive survey of parasites of freshwater fishes belong to ten families from two stations along Euphrates River near Samawa city, Al-Muthanna province, southwestern Iraq, unknown microcotylid specimens were detected from gills of P. abu in both stations. keywords: 2017; abu; agriculture; ali; arabic; asmar; atrium; basrah; city; clamps; college; description; diyala; et al; euphrates; fishes; freshwater; genital; haptor; heckel; helli; iraq; iraqensis; kritsky; mhaisen; microcotyle; microcotylidae; monogenoidea; mullet; nasiri; number; parasites; parasitic; paucitesticulatus; planiliza; province; record; river; solostamenides; south; species; specimens; stations; thesis; tigris; turkey; university; öktener cache: binhm-308.pdf plain text: binhm-308.txt item: #152 of 297 id: binhm-309 author: Al-Zaidy, Aiad Ali Hussien title: MICROFACIES ANALYSIS AND BASIN DEVELOPMENT OF THE CENOMANIAN - EARLY TURONIAN SEQUENCE IN THE RAFAI, NOOR AND HALFAYA OIL FIELDS, SOUTHEASTERN IRAQ date: 2019-06-27 words: 3427 flesch: 53 summary: 251 Aiad Ali Hussien Al-Zaidy Plate (1): The major microfacies of Mishrif Formation in the studied sections; (A) Basinal facies, with abundant of Calcispheres (XPL), 255 Aiad Ali Hussien Al-Zaidy Stratigraphic Cenomanian- early Turonian sequence: The Cenomanian-early Turonian Megasequence started by transgressive system tract (Ahmadi Formation), and terminated in the high stand system tract (Mishrif Formation); the studied sequence is subdivided into three main cycles as coarsening upward cycles. keywords: ahmadi; aiad; ali; analysis; area; association; basin; basinal; biostrome; carbonate; cenomanian; change; cycle; depositional; depth; development; diagram; diags; early; environment; facies; foraminifera; formation; grains; high; hussien; iraq; marine; microfacies; mishrif; mishrif formation; noor-1; open; plate; posamentier; rudist; rudistid; rumaila; sediments; sequence; shallow; shoal; southeastern; stage; stratigraphic; studied; study; succession; system; tectonic; tract; turonian; unit; water; wells; zaidy cache: binhm-309.pdf plain text: binhm-309.txt item: #153 of 297 id: binhm-31 author: Al-malo, Iman M.; Abdul-Rassoul, M. S. title: HOST PLANTS AND DISTRIBUTION OF SOME WHITEFLIES SPECIES (HEMIPTERA, ALEYRODIDAE) IN THE MIDDLE OF IRAQ date: 2017-12-01 words: 1955 flesch: 65 summary: (=T. rara Signh, 1931) Materials Examined:43 pupal case, Baghdad, 4, 9.IV.1988 on Zizyphus spina-christi (Linne.) Wild. The infected leaves by the whitefly were examined by a binocular dissecting microscope to distinguish the pupal case with a fine needle, pupal cases were mounted on slides according to Bink (1979), and examined under a compound microscope by using an ocular micrometer to measure length of the insect. keywords: abdul; aleyrodidae; asteraceae; baghdad; bemisia; case; case baghdad; citrus; hosny; host; iraq; karbala; leaves; linne; malvaceae; materials; mound; plants; priesner; pupal; pupal case; rassoul; rosa; rosaceae; rutaceae; solanaceae; species; trialeurodes; whiteflies; wild cache: binhm-31.pdf plain text: binhm-31.txt item: #154 of 297 id: binhm-310 author: Albushabaa, Suhad Hameed H.; Al-Zurfi, Sadiq Kadhum Lafta; Tsear, Anam Ali title: BIODIVERSITY STUDY OF ZOOPLANKTON IN SELECTED BAHR Al-NAJAF DEPRESSION, NAJAF GOVERNORATE, IRAQ date: 2019-06-27 words: 4393 flesch: 64 summary: R R R R R A A Ac A A Cyclops navus - - R R - - - Ac A A Diaptomus sp - - - R - - - Ac - - Diaptomus gracilis R - - R - Ac - - A - Diaptomus sarsi R R - - - A A - - - Ectocyclops sp. R R R R R A A Ac Ac Ac Ergasilus sp. - R - - - - Ac - - - Eucyclops agalis R - R - - Ac - A - - Eucyclops sp. R R R R R Ac Ac A Ac A Nauplii stage (Lang, 1980) keywords: abundance; abundant; ac ac; albushabaa; april; aquatic; area; august; bahr; bahr al; biodiversity; cladocera; community; constancy; copepoda; copepodite; current; cyclops; daphnia; density; depression; diagram; diversity; environmental; et al; factors; food; group; harpacticoid; hexarthra; highest; ind./m; index; iraq; journal; lake; march; mira; najaf; nauplii; new; number; period; r ac; r la; r r; recorded; relative; results; river; rotifera; shannon; site; sp r; species; study; taxa; total; uniformity; value; water; zooplankton; النجف cache: binhm-310.pdf plain text: binhm-310.txt item: #155 of 297 id: binhm-311 author: Abdulzahra, Ameer Ibrahim title: TWO NEW RECORDS OF THE GENUS APHODIUS ILLIGE, 1798 (COLEOPTERA: APHODIIDAE) IN IRAQTWO NEW RECORDS OF THE GENUS APHODIUS ILLIGE, 1798 (COLEOPTERA: APHODIIDAE) IN IRAQ date: 2019-06-27 words: 1683 flesch: 58 summary: MATERIALS AND METHODS Many specimens of genus Aphodius species were collected from agricultural regions where livestock are represent (Presence of dung) from different regions in the middle of Iraq (Babylon, Najaf and Karbala) by light trap containing ethyl alcohol (concentration of about 70%). Species of the subgenus Bodilus (genus Aphodius) from Russia and adjacent countries (Coleoptera: Scarabaeidae). keywords: abdulzahra; aedeagus; akhmetova; ameer; aphodiidae; aphodius; babylon; beetles; bodilus; coleoptera; dellacasa; derwesh; dung; elytron; entomological; frolov; genus; ibrahim; ictericus; iraq; larvae; lateral; male; new; records; regions; research; scarabaeidae; scarabaeoidea; species; view; vittatus cache: binhm-311.pdf plain text: binhm-311.txt item: #156 of 297 id: binhm-314 author: Sheyaa, Fatima Abd Razak; Abdul-Ameer, Kefah Naser title: RECORD OF GYRODACTYLUS BYCHOWSKIANUS BOGOLEPOVA, 1950 (MONOGENEA, GYRODACTYLIDAE) FOR THE FIRST TIME IN IRAQ FROM GILLS OF THE CYPRINID FISH ARABIBARBUS GRYBUS date: 2019-06-27 words: 1502 flesch: 58 summary: Therefore, more surveys on fish parasites are needed to identify more species and to match the growing information on the parasitic fauna of freshwater fishes of Iraq. 289 Fatima Abd Razak Sheyaa and Kefah Naser Abdul-Ameer In Iraq, many species belonging to the genus Gyrodactylus were so far reported from freshwater fishes from various water bodies, among which some were reported from A. grypus; the following is list of these species with the mention of only the first record for each Gyrodactylus species from A. grypus: Gyrodactylus elegans Nordmann, 1832 from Diyala River (Ali et al., 1986), Gyrodactylus markevitschi Kulakovskaya, 1952 from the Euphrates River in Al-Musaib City (Al-Sa’adi, 2007), Gyrodactylus sprostonae Ling, 1962 and Gyrodactylus tincae Malmberg,1957 from Al-Graiat region at Tigris River at Baghdad province (Abdul-Ameer and Atwan, 2017), with the present record of G. bychowskianus, five of Gyrodactylus species so far reported from A. grypus in Iraq and the number of Gyrodactylus species from fishes of Iraq so far reaches 52 species in comparison with 25 Gyrodactylus species which were known from fishes of Iraq till 2013 according to Mhaisen and Abdul-Ameer (2013). keywords: abdul; ameer; arabibarbus; baghdad; bakke; bogolepova; bychowskianus; fishes; freshwater; genus; gills; grypus; gyrodactylidae; gyrodactylus; iraq; monogenea; nordmann; parasites; present; record; river; species; tigris cache: binhm-314.pdf plain text: binhm-314.txt item: #157 of 297 id: binhm-315 author: Mhaisen, Furhan T.; Al-Mayali, Hadi M. H.; Al-Abodi, Hiba R. J. title: CHECKLISTS OF PARASITES OF FISHES OF AL-DIWANIYAH PROVINCE, IRAQ date: 2019-06-27 words: 10656 flesch: 62 summary: Checklists of fish parasites of Al-Najaf Al-Ashraf province, Iraq. Checklists of fish parasites of Babylon province of Iraq, exclusive of farm fishes. keywords: abdul; abu; acanthocephala; acheilognathi; addition; arabic; argulus; babylon; baghdad; biological; c. carpio; c. luteus; carasobarbus; carpio; cestode; checklists; ciliophora; class; college; contracaecum; crustacea; cyprinacea; cyprinus; dactylogyrus; diplostomum; diwaniyah; domerguei; ergasilus; et al; extensus; family; farm; fauna; fish; fish host; fish species; fishes; following; gbif; genus; gills; groups; grypus; host; host species; intestinalis; intestine; iraq; jadoaa; journal; lernaea; luteus; macrostomum; mahi; mesopotamichthys; mhaisen; molitrix; monogenea; myxobolus; names; nematoda; neoechinorhynchus; order; parasite species; parasites; parasitic; pelusius; phylum; planiliza; province; record; research; river; scheme; science; shakir; sharpeyi; skin; species; systematic; tigris; time; trichodina; unidentified; university; vorax; waaly; worms; xanthopterus; zillii cache: binhm-315.pdf plain text: binhm-315.txt item: #158 of 297 id: binhm-316 author: Akrawi, Halgurd Rashed Ismael; Mahmoud, Talal Tahir title: A SURVEY OF WEEVILS (COLEOPTERA, CURCULIONOIDEA) FROM SOME LOCALITES OF KURDISTAN REGION- IRAQ, WITH NEW RECORDS TO THE ENTOMOFAUNA OF IRAQ date: 2019-06-27 words: 5239 flesch: 44 summary: Subfamily: Apioninae Schoenherr, 1823 Tribe: Apionini Schoenherr, 1823 Apion frumentarium (Linnaeus, 1758) Materials examined: Duhok: Sumel, June and July 2016, on Rumex crispus. Tribe: Aspidapiini Alonso-Zarazaga, 1990 Aspidapion radiolus (Marsham, 1802) Materials examined: Duhok :Atrish ; Sulaymaniyah :Dukan, July 2016 and 2017, on Malva neglecta, Alcea setosa and A. kurdica. keywords: albania; algeria; alonso; april; armenia; austria; azerbaijan; beating; belgium; bosnia; britain; bulgaria; coleoptera; collecting; croatia; curculionidae; curculionoidea; cyprus; czech; distribution; duhok; erbil; european; france; general; general distribution; georgia; germany; great; greece; hand; herzegovina; hungary; iran; iraq; italy; jordan; june; kazakhstan; kurdistan; lebanon; luxembourg; macedonia; malta; materials; methods; moldavia; morocco; net; netherlands; palaearctic; picking; poland; portugal; record; republic; romania; russia; serbia; slovakia; slovenia; spain; species; sweeping; switzerland; syria; tribe; tunisia; turkey; ukraine; weevils; zarazaga cache: binhm-316.pdf plain text: binhm-316.txt item: #159 of 297 id: binhm-317 author: Afrasiab, Saman R.; Al-Moussawi, Azhar A.; Hadi, Hind D.; Mohamad, Sarbaz Ibrahim title: REVIEW OF OPISTHOGLYPHOUS SNAKES (REPTILIA, OPHIDIA ) OF IRAQ date: 2019-06-27 words: 2411 flesch: 67 summary: Snakes and snake bite in Iraq. The study depended on a collection of opisthoglyphous snakes of the Iraq Natural History Research Center and Museum, University of Baghdad (INHRCM); the Kurdistan Natural History Museum, University of Salahaddin, Erbil province, Gafoor (Pers. Comm.) keywords: 1992; afrasiab; amphibians; amr; authors; baghdad; basrah; body; collection; corkill; disi; distribution; dorsal; erbil; et al; head; history; iraq; kurdistan; leviton; malpolon; mohamad; museum; natural; neck; opisthoglyphous; plate; province; reptiles; scales; schmidt; snakes; south; species; specimens; study; telescopus cache: binhm-317.pdf plain text: binhm-317.txt item: #160 of 297 id: binhm-318 author: Augul, Razzaq Shalan; Al-Saffar, Hanaa H. title: SURVEY WITH CHECKLIST OF THE INVASIVE INSECTS TO IRAQ date: 2019-06-27 words: 6917 flesch: 60 summary: White, I. M. and Elson-Harris, M. M. 1994. Moanas, A. M. H. and Abdul –Rassoul, M. S. 1989. keywords: 2002; 2004; 2006; 2007; 2010; 2012; 2014; 2015; 2017; abdul; absoluta; africa; agricultural; america; arabia; asia; augul; australia; available; bactrocera; baghdad; beetle; bezziana; bulletin; ceratitis; checklist; citrus; coccoidea; coleoptera; common; control; crops; cryptus; dacus; date; department; diptera; distribution; district; east; egypt; entomological; entomology; eppo; et al; family; fauna; fly; fruit; genus; h. al; hanaa; hemiptera; history; hosts; hymenoptera; india; indianus; insects; invasive; iran; iraq; journal; larvae; maladera; materials; mealybug; mediterranean; museum; names; natural; new; notes; pakistan; palm; pest; phenacoccus; plant; protection; province; pseudococcidae; rassoul; razzaq; record; saffar; saudi; scale; scarabaeidae; sciences; shalan; society; solenopsis; south; species; specimens; survey; synonyms; tephritidae; thrips; tinsley; tomato; tropical; tuta; university; weevil; white; world; zaprionus; zonata cache: binhm-318.pdf plain text: binhm-318.txt item: #161 of 297 id: binhm-32 author: Abdul-Rassoul, M. S.; Mohammed, S. M. title: FIRST RECORD OF ADONTOMERUS AMYGDALI (BOUCEK, 1958) (HYMENOPTERA, TORYMIDAE): A PARASITOID OF THE ALMOND FRUIT WASP, EURYTOMA AMYGDALI ENDERLEIN, 1907 (HYMENOPTERA, EURYTOMIDAE) IN ERBIL PROVENCE, IRAQ date: 2017-12-01 words: 1819 flesch: 55 summary: Four species belonging to three families of Hymenoptera: Eulophidae, Pteromalidae and Torymidae and two belonging to Acarina family Pyemotidae have been recorded to parasitize almond fruit wasp throughout the world (Noyes, 2017). Key wards: Adotomerus amygdali, Almond pest, Eurytoma amygdali, Iraq, Parasitoid. keywords: abdomen; abdul; abo; adontomerus; adontomerus amygdali; almond; alsel; amygdali; boucek; chalcidoidea; doganlar; dulcis; enderlein; erbil; eurytoma; eurytoma amygdali; eurytomidae; fruit; hymenoptera; iran; iraq; long; mahunka; middle; mohammed; natural; new; parasitoid; prunus; record; research; species; syria; torymidae; turkey; wasp cache: binhm-32.pdf plain text: binhm-32.txt item: #162 of 297 id: binhm-33 author: Hadi, Afkar M.; Taher, Ahlam J. title: NEW RECORD OF PROTOZOAN NYCTOTHERUS HARDWICKII (JANAKIDEVI, 1961) FROM ROUGH-TAILED GECKO CYRTOPODION SCABRUM IN BAGHDAD, IRAQ date: 2017-12-01 words: 1740 flesch: 58 summary: The current study describes the ciliate species of N. hardwickii isolated from the gut of Rough-tailed gecko Cyrtopodion scabrum for the first time in Baghdad capital of Iraq. Type of the specimens: Permanent preparation belonging to this species are kept in the Department of Parasitology, Iraq Natural History Researches Center and Museum, University of Baghdad, Iraq. keywords: afkar; ahlam; anterior; baghdad; body; ciliate; cyrtopodion; gecko; glycogen; hadi; hardwickii; history; infection; iraq; janakidevi; length; macronucleus; museum; natural; new; nyctotherus; posterior; protozoan; record; rough; scabrum; shape; species; stellio; study; taher; width cache: binhm-33.pdf plain text: binhm-33.txt item: #163 of 297 id: binhm-34 author: Ali, Hayder B. title: SEASONAL POPULATION ABUNDANCE OF THE CHRYSANTHEMUM APHIDS (HOMOPTERA, APHIDIDAE) IN THE MIDDLE OF IRAQ WITH PICTORIAL KEY TO SPECIES date: 2017-12-01 words: 2952 flesch: 63 summary: This study was based on the determination of aphid species that infested Chrysanthemum sp. A summary of the main taxonomic characters is presented here and a pictorial key which was designed to separate aphid species colonizing Chrysanthemum sp. is also presented. keywords: abundance; alate; ali; ant(i; aphid; aphididae; apterous; baghdad; blackman; body; cauda; characters; chrysanthemum; coloradoa; comparisons; eastop; fabae; gossypii; hairs; hayder; iii; infection; iraq; key; length; longest; middle; myzus; new; persicae; plants; population; sanborni; seasonal; siph; species; study; urs cache: binhm-34.pdf plain text: binhm-34.txt item: #164 of 297 id: binhm-35 author: Abdul-Rassoul, M. S.; Mahmoud, T. T. title: NEW RECORD OF THE PARASITOID WASP MONODONTOMERUS OBSCURUS WESTWOOD, 1833 (HYMENOPTERA, TORYMIDAE) IN IRAQ date: 2017-12-01 words: 1601 flesch: 55 summary: Mud nest of Sceliphron sp. Plate (1): Female of M. obscurus 1 332 New Record of the Parasitoid Wasp Monodontomerus obscurus Plate (2): Male of M. obscurus ACKNOWLEDGMENTS I would like to express my sincere thanks to my colleague Prof. Dr. Razzaq Shalan Augul of Iraq Natural History Research Center and Museum for his help in photographing the specimens. INTRODUCTION Monodontomerus obscures Westwood, 1833 (Hymenoptera, Torymidae) was first described by Westwood (1833) from Britain; it is now widely distributed in the Palaearctic, Nearctic, Neotropical and Oriental regions (Grissell, 1995; Zerova and Seryogina, 2002; Noyes, 2017). keywords: abdul; dohuk; family; gaster; grissell; hind; hymenoptera; iraq; length; long; mahmoud; megachilidae; monodontomerus; mud; museum; nests; new; obscurus; ovipositor; parasitoid; province; rassoul; record; sceliphron; scutellum; smooth; species; specimens; sphecidae; sphecoid; stigma; torymidae; turkey; united; wasp; westwood; wide cache: binhm-35.pdf plain text: binhm-35.txt item: #165 of 297 id: binhm-362 author: Al-Mousawi, Ula M. Noor; Al-Waheeb, Alla N.; Al-Saadi, Sahar A.A. Malik title: ANATOMICAL STUDY OF SOME SPECIES BELONGING TO THE PAPAVERACEAE FAMILY IN NORTH OF IRAQ date: 2019-12-26 words: 4276 flesch: 63 summary: The results showed that the anticlinal cell walls of the adaxial surface were more thickened in P. fugax, H. pendulum, P. macrostomum and R.refracta, while it was thin in P. rhoeas. The current investigation finds three types of the stomata (i.e., anomocytic, paracytic and hemiparacytic), and the number of stomata on the adaxial epidermis ranged between 22.11 stomata mm 2 in P. rhoeas and 69.30 stomata/mm 2 in P. fugax; the stomatal index percentage on the adaxial surface was 15.04% in P. macrostomum and 4.14% in P. rhoeas. keywords: 2009; adaxial; anatomical; anatomy; anticlinal; bercu; bracteosa; bundles; cells; characteristics; cortex; cuticle; epidermal; epidermis; esau; et al; family; fugax; fumaria; glandular; glaucium; grandiflorum; hairs; iran; iraq; journal; layers; leaves; long; macrostomum; mousawi; non; number; p. fugax; p. rhoeas; papaveraceae; pendulum; plate; refracta; results; rhoeas; shape; short; species; stem; stomata; study; surface; tab; thickness; trichomes; type; vascular; walls; wood cache: binhm-362.pdf plain text: binhm-362.txt item: #166 of 297 id: binhm-363 author: Al-Sheikhly, Omar F.; Al-Azawi, Ahmad J. title: THE DIURNAL BIRDS OF PREY (RAPTORS) IN THE MESOPOTAMIAN MARSHES OF SOUTHERN IRAQ WITH NOTES ON THEIR CONSERVATION STATUS date: 2019-12-26 words: 8849 flesch: 59 summary: Peregrine Falcon Falco peregrines (Tunstall, 1771) (LC) https://en.wikipedia.org/wiki/Johann_Gottlieb_Fleischer https://en.wikipedia.org/wiki/Coenraad_Jacob_Temminck https://en.wikipedia.org/wiki/Marmaduke_Tunstall 390 The diurnal birds of prey (Raptors) in the Mesopotamian marshes Uncommon winter visitor and passage migrant to the marshy lakes and open shallow seasonal wetlands of Mesopotamian marshes where large flocks of water birds are congregating; it has been recorded in southern marshes by Cumming (1918), Donald (1919), Ticehurst et al. (1922), and Scott and Carp (1982). Mus. (2019) 15 (4): 381-402 THE DIURNAL BIRDS OF PREY (RAPTORS) IN THE MESOPOTAMIAN MARSHES OF SOUTHERN IRAQ WITH NOTES ON THEIR CONSERVATION STATUS Omar F. Al-Sheikhly* and Ahmad J. Al-Azawi Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq *Corresponding author: E-mail: alsheikhlyomar@gmail.com Received Date: 15 July 2019, Accepted Date: 11 September 2019, Published Date: 26 December 2019 ABSTRACT Birds of prey (Raptors) are top predator avian species that many migrate annually through Mesopotamian marshes in southern Iraq toward their wintering grounds in Arabia and Africa, while others are breeding residents; however, information on their current status is scarce. keywords: 1922; 2005; 2012; 2017; abed; adult; ahmad; april; aquila; azawi; basra; birds; black; boswell; breeding; carp; central; central marshes; common; conservation; cumming; current; diurnal; donald; eagle; eastern; edge; et al; eurasian; f. al; falcon; fazaa; field; geographical; greater; hammar; harrier; hawizeh; https://en.wikipedia.org/wiki/carl_linnaeus; imperial; international; iraq; iucn; j. al; january; kite; lakes; linnaeus; list; march; marshes; marshy; mesopotamian marshes; migrant; migratory; nature; observations; omar; open; passage; plains; populations; prey; province; qar; raptors; rare; records; red; salim; salim et; scott; sheikhly; sites; southern; southern iraq; southern marshes; species; status; steppes; study; surveys; thi; threatened; ticehurst; ticehurst et; total; vagrant; visitor; vulture; western; wetlands; white; widespread; winter; winter visitor; wintering; zone cache: binhm-363.pdf plain text: binhm-363.txt item: #167 of 297 id: binhm-364 author: Baker, Ishraq Mohammed; Ali, Hayder Badry; Fadhil, Hula Younis title: FIRST RECORD OF THE CELLAR SPIDER GENUS NITA HUBER & EL-HENNAWY, 2007 (ARANEAE, PHOLCIDAE) FROM IRAQ date: 2019-12-26 words: 2627 flesch: 62 summary: A short morphological description is also presented for cellar spiders listed in Iraq; including this species in addition to Artema Atlanta Walckenaer, 1837. INTRODUCTION Family Pholicidae C. L Koch, 1850 is commonly known as cellar spiders or daddy long- legs, vibrating spiders, and other common names, according to their distribution which consists of a large number of manly tropical web-weaving spiders. keywords: abdomen; arachnida; araneae; artema; atlanta; baghdad; baker; carapace; cellar; clypeus; coi; data; dna; elsaff; et al; eyes; family; female; gene; genus; hairs; hennawy; huber; identification; iraq; journal; karbala; khazali; legs; length; long; middle; molecular; morphological; museum; new; nita; pholcidae; record; species; specimens; spiders; walckenaer; world cache: binhm-364.pdf plain text: binhm-364.txt item: #168 of 297 id: binhm-365 author: Jalil, Pshtiwan A.; Ali, Wand K. title: RE-DESCRIPTION OF THE LAST INSTAR LARVAE OF CAPNODIS TENEBRIONIS (LINNAEUS, 1760) (COLEOPTERA, BUPRESTIDAE) DEPENDING ON SCANNING ELECTRON MICROSCOPE date: 2019-12-26 words: 3994 flesch: 57 summary: First description of larval stages of Aleochara pseudochrysorroa Caron, Mise & Klimaszewski, 2008. Notes sur le genre Capnodis (Col. Buprestidae). keywords: 2015; abdominal; ali; anterior; apical; basal; body; buprestidae; bílý; campaniform; capnodis; coleoptera; dense; description; doi; dorsal; electron; epistome; fig; flat; host; identification; instar; iraq; jalil; journal; labrum; larvae; lateral; length; linnaeus; long; margin; microscope; microspinulae; morphological; palatine; parts; plant; plate; posterior; pronotal; prosternal; pshtiwan; round; scanning; sciences; sclerite; sclerotized; segment; sem; sensillae; sensillum; setae; shape; short; species; stage; study; surface; tenebrionis; times; university; volkovitsh; wand; width cache: binhm-365.pdf plain text: binhm-365.txt item: #169 of 297 id: binhm-366 author: Akoul, Marwa Azeez; AL-Jowari, Suha Abdul-Khaliq title: COMPARATIVE ANATOMICAL AND HISTOLOGICAL STUDY OF SOME ORGANS IN TWO FISH SPECIES CYPRINUS CARPIO LINNAEUS, 1758 AND MESOPOTAMICHTHYS SHARPEYI (GÜNTHER, 1874)(CYPRINIFORMES, CYPRINIDAE) date: 2019-12-26 words: 4542 flesch: 56 summary: 432 Comparative anatomical and histological study of some organs in two fish species Pancreas of C. carpio within liver tissue showed: exocrine acinar cell, islet of Langerhans and hepatic portal vein; intralobular pancreatic duct and interlobular pancreatic duct (Pl. 8). 434 Comparative anatomical and histological study of some organs in two fish species Plate (10): Pancreas of M. sharpeyi; (A) Within liver tissue (hepatopancreas) showed exocrine acinar cell (black arrow), islet of Langerhans (arrow head) and hepatic portal vein (double arrow), hepatocyte (yellow arrow), intralobular pancreatic duct (green arrow), (B) keywords: 2011; 2014; 2016; abdul; anatomical; anatomy; arrow; barbus; bile; body; c. carpio; carpio; cavity; cells; color; comparative; cyprinus; diffuse; digestive; duct; endocrine; et al; exocrine; fish; gallbladder; h&e; hamilton; hepatic; hepatopancreas; histological; histology; international; journal; jowari; khaliq; large; layer; linnaeus; liver; marwa; mesopotamichthys; mokhtar; morphology; organs; pancreas; pancreatic; plate; portal; results; right; science; shape; sharpeyi; similar; species; spleen; studies; study; suha; system; tissue; tract; tunica; type; vein; vicentini; wall; yellow cache: binhm-366.pdf plain text: binhm-366.txt item: #170 of 297 id: binhm-367 author: Permana, Aang Panji; Pramumijoyo, Subagyo; Akmaluddin, Akmaluddin title: ANALYSIS OF MICROFACIES AND DEPOSITIONAL ENVIRONMENT OF LIMESTONE IN YOSONEGORO AREA, GORONTALO PROVINCE, INDONESIA date: 2019-12-26 words: 3174 flesch: 56 summary: The purpose of the study is to find out facies, standard microfacies and depositional environment on Limboto limestone. Compilation of standard microfacies and paleobathymetry types shows changes in depositional environment from the slope environment to the toe of slope environment. keywords: analysis; area; basin; benthic; carbonate; changes; composition; coral; depositional; depositional environment; depth; environment; flugel; foraminifera; formation; geological; geology; gorontalo; grain; indonesia; interpretation; island; lake; level; limboto; limestone; lower; map; meters; microfacies; middle; mudstone; new; packstone; paleobathymetry; pattern; permana; reef; research; sample; section; sedimentation; size; slope; slope environment; smf; stratigraphy; study; sulawesi; upper; wilson; yosonegoro; zone; الى cache: binhm-367.pdf plain text: binhm-367.txt item: #171 of 297 id: binhm-368 author: Thanh, Phi Truong title: ANALYTICAL RESULTS OF THE STABILITY OF SOME LIMESTONE ISLANDS IN HA LONG BAY, QUANG NINH PROVINCE OF VIETNAM, A WORLD NATURAL HERITAGE date: 2019-12-26 words: 3847 flesch: 64 summary: Due to the impact of regional tectonic activities, the limestone islands in Ha Long bay area were heavily broken, formed fracture systems, developed in the several different directions. The analytical results of this study have important significance for the planning and maintaining the stability of limestone islands in Ha Long bay area. keywords: /85; 2004; analytical; area; bay; block; bray; crack; degrees; determined; development; factor; failure; fault; figure; fracture; ha long; heritage; hoek; island; limestone; location; long; model; natural; nga; orientation; phi; plane; plane failure; potential; results; safety; slope; stability; survey; survey location; tension; thien; truong; vietnam; vietnamese cache: binhm-368.pdf plain text: binhm-368.txt item: #172 of 297 id: binhm-369 author: Popovych, Vasil; Les, Mykhailo; Shuplat, Taras; Bosak, Pavlo; Fitak, Mykhailo; Popovych, Nataliya title: THE EFFECTS OF TEMPERATURE AND MOISTURE STRESS CONTENT ON THE EXTENSIVE CULTIVATION OF THE OYSTER MUSHROOM date: 2019-12-26 words: 6428 flesch: 63 summary: The isolated culture of oyster mushroom fruiting bodies collected in a suburban forest formed the basis of the experiment with inoculation of various types of substrates. Phenological three years’ studies on the growth of oyster mushrooms (2015, 2016, 2017) at the trial plots after overgrowing of log sections of eight species by mycelium confirmed the data of many authors (Bysko et al., 1982,1983),about the beginning of intensive growth of oyster mushroom fruiting bodies after stress caused by a sharp drop in temperatures (4-8 C°).We have calculated the amount of effective temperatures for the development of oyster mushrooms from the day of a sharp drop in temperature and the appearance of primordis presented in Table (2). keywords: aet; air; areas; aspen; autumn; average; beech; bodies; brushwood; bysko; cap; conditions; content; cultivation; cut; cutover; days; dead; dead wood; destruction; development; diameter; different; dry; duration; effective; effects; experiment; extensive; forest; fruiting; growth; hollows; humidity; inoculation; log; log sections; lviv; moisture; moisture stress; mushrooms; mycelium; ostreatus; oyster; oyster mushroom; period; pleurotus; popovych; process; second; sections; species; spring; state; stress; study; study mushroom; stumps; table; temperature; trees; trench; ukraine; use; water; wave; weight; wood; yield cache: binhm-369.pdf plain text: binhm-369.txt item: #173 of 297 id: binhm-370 author: Augul, Razzaq Shalan title: REVISION OF THE FAMILY SPHECIDAE (HYMENOPTERA, APOIDEA) IN IRAQ date: 2019-12-26 words: 4425 flesch: 53 summary: Sphex Linnaeus, 1758 Sphex flavipennis Fabricius, 1793 Synonyms: Ammophila flavipennis Valetta, 1979 Pepsis flavipennis Fabricius, 1804 Pelopaeus flavipennis Stephens, 1829 Sphex bicolor Dahlbom, 1845 Sphex cinereorufocinctus Dahlbom, 1845 Sphex sellae Gribodo, 1873 Materials (2 specimens): Dohuk, Gara Mountain, (2♀♀) 18.vi.2019. ix. 2019; Aziziyah, Al Zelja village, (2♂♂, 6♀♀) 27.ix.2019; Sulaymaniyah province, Kunamasi, (2 ♂♂, 4♀♀) 21.viii.2019. keywords: 1921; 2019; afghanistan; africa; algeria; ammophila; arabia; asia; augul; baghdad; beaumont; bulgaria; dahlbom; distribution; egypt; europe; fabricius; family; france; greece; hymenoptera; india; iran; iraq; israel; italy; jordan; kaddou; kazakhstan; kohl; kyrgyzstan; lepeletier; libya; materials; morice; morocco; oman; portugal; prionyx; province; remark; revision; russia; saudi; sceliphron; smith; spain; species; specimens; sphecidae; sphex; synonyms; syria; tajikistan; tunisia; turkey; turkmenistan; uae; uzbekistan; village; wasps; ♂ ♂ cache: binhm-370.pdf plain text: binhm-370.txt item: #174 of 297 id: binhm-38 author: Idan, Rami M. title: TOTAL ORGANIC CARBON (TOC) PREDICTION FROM RESISTIVITY AND POROSITY LOGS: A CASE STUDY FROM IRAQ date: 2018-10-08 words: 3355 flesch: 72 summary: Key words: Resistivity logs, Southern Iraq, TOC prediction, Zubair Formation, Δt log R. INTRODUCTION A number of logs data have been prepared and predestined to use in determining variations and absolute quantities of TOC. keywords: addition; area; baseline; calculated; carbon; data; diag; diagram; eval; formation; gamma; geochemical; geology; good; idan; interest; intervals; iraq; logs; lom; lower; middle; oil; organic; overlay; packages; parameters; parts; petroleum; porosity; prediction; pyrolysis; rami; ray; reservoir; resistivity; results; rich; rock; shale; sonic; source; south; southern; studies; study; subzone; toc; total; upper; values; zubair; العضوية; المادة; المجسات; على; كمية cache: binhm-38.pdf plain text: binhm-38.txt item: #175 of 297 id: binhm-39 author: Augul, Razzaq Shalan title: TAXONOMIC STUDY OF GENUS CERCERIS LATREILLE, 1802 (HYMENOPTERA, CRABRONIDAE) IN IRAQ date: 2017-07-01 words: 2045 flesch: 58 summary: Key to the collected species of Cerceris Latreille: 1. T: tergite; DE: dorsal enclosure) 202 Taxonomic study of genus Cerceris Latreille LITERATURE CITED Alexander, B.A. and Asis, J.D. 1997.Patterns of nest occupancy and provisioning in Cerceris rufopicta Smith (Hymenoptera: Sphecidae). keywords: arabia; asia; baghdad; bohart; central; cerceris; collected; crabronidae; derwesh; distribution; dorsal; enclosure; erbil; europe; gasteral; genus; hortivaga; hymenoptera; iran; iraq; israel; key; latreille; male; menke; morice; north; panzer; plate; rubida; sabulosa; schmidt; species; sphecidae; study; taxonomic; tergite; wasps cache: binhm-39.pdf plain text: binhm-39.txt item: #176 of 297 id: binhm-40 author: Mohammad, Mohammad K.; Al-Moussawi, Azhar A. title: THE SPOTTED SANDGROUSE, PTEROCLES SENEGALLUS (LINNAEUS, 1771) AS A NEW HOST FOR THE SPIRURID NEMATODE HARTERTIA GALLINARUM (THEILER, 1919) IN IRAQ date: 2017-07-01 words: 2117 flesch: 67 summary: Plate (1): Anterior end of male of Hartertia gallinarum. 209 Mohammad K. Mohammad and Azhar A. Al-Moussawi Plate (2): Head of male of H. gallinarum (lateral view) Plate (3): Tail of male of H. gallinarum 210 The spotted sandgrouse, Pterocles senegallus (Linnaeus, 1771) as a new host Plate (4): Anterior end of female of H. gallinarum Plate (5): Posterior end of female of H. gallinarum 211 Mohammad K. Mohammad and Azhar A. Al-Moussawi LITERATURE CITED Al-Alawy, S.A. 1987. Map (1): Showing the collection sites of host birds from different regions of Iraq. keywords: 1996; alectoris; anterior; azhar; bird; body; chukar; cram; different; distance; extremity; female; gallinarum; hartertia; host; iraq; length; linnaeus; long; males; mohammad; moussawi; nematode; new; papillae; parasites; partridge; present; pterocles; sandgrouse; senegallus; species; spotted; theiler; wide cache: binhm-40.pdf plain text: binhm-40.txt item: #177 of 297 id: binhm-41 author: Al–Saffar, Hanaa H. title: A REVISED CHECKLIST OF THE ROBBER FLY GENERA (DIPTERA, ASILIDAE) FROM IRAQ date: 2017-07-01 words: 2309 flesch: 54 summary: INTRODUCTION Asilidae is one of the most important families of order Diptera and called robber flies which belonging to super family Asiloidea likely originated close to 200 million years ago (Wiegmann et al., 2003). MATERIAS AND METHODS Many specimens of robber flies were collected by sweeping net in various habitats from several regions of Iraq during 2016; also I used the unidentified species that stored in Iraq Natural History Museum. keywords: 2003a; afrotropical; asilidae; available; baghdad; checklist; diptera; distribution; family; flies; fly; geller; genera; genus; ghahari; grimm; hanaa; history; info; insectoid; iraq; janssens; key; khalaf; lavigne; lehr; loew; material; nearctic; neotropical; new; omar; oriental; palearctic; papavero; regions; robber; species; specimens; subfamilies cache: binhm-41.pdf plain text: binhm-41.txt item: #178 of 297 id: binhm-417 author: Permana, Aang Panji; Pramumijoyo, Subagyo; kmaluddin, A title: PALEOBATHYMETRY ANALYSIS OF LIMESTONE IN BONGOMEME REGION BASED ON CONTENT OF BENTHIC FORAMINIFERA FOSSIL, GORONTALO DISTRICT, INDONESIA date: 2020-06-24 words: 3104 flesch: 51 summary: The study aims to discover the species of benthic foraminifera fossils and to determine the paleobathymetry to the studied regions. This research aims to identify the species of benthic foraminifera fossil containing in Bongomeme limestone and to determine the paleobathymetry. keywords: abundance; alveoliniformis; ammomassilina; analysis; area; astrononion; benthic; benthic foraminifera; bongomeme; brady; content; d'orbigny; diagram; discreata; fabum; foraminifera; foraminifera fossils; fossils; geological; germanica; gorontalo; haynesia; indonesia; limestone; location; marine; meters; middle; nonion; ovata; paleobathymetry; paleobathymetry analysis; permana; praeglobobulimina; ramosa; rare; reef; research; results; rhabdammina; saccorhiza; shelf; species; stelligerum; study; table cache: binhm-417.pdf plain text: binhm-417.txt item: #179 of 297 id: binhm-418 author: Jalil, Pshtiwan A.; Ali, Wand K. title: NEW DESCRIPTION OF THE LARVAL STAGE OF LATIPALPIS (PALPILATIS) JOHANIDESI NIEHUIS, 2002 (COLEOPTERA, BUPRESTIDAE) FROM ERBIL PROVINCE, KURDISTAN REGION, IRAQ date: 2020-06-24 words: 2737 flesch: 52 summary: The present study introduced a new description of the last larval instar of the oak tree borer, Latipalpis johanidesi Niehuis, 2002 (Coleoptera, Buprestidae). Labrum around quadrate shaped, anterior margin arcuated inward noticeably, anterolateral corners slightly rounded, lateral lobes absent and outer margins converging posteriorly; both medial and lateral branches of the palatine sclerite well- sclerotized; medial branch bears long apical seta, on the medial part, with two campaniform sensilla and another isolated one located between medial and lateral branches. keywords: abdominal; alexeev; anterior; anterolateral; apical; basal; beetles; branches; buprestidae; bílý; campaniform; coleoptera; corner; dense; description; genus; groove; identification; iraq; jalil; johanidesi; labrum; larval; lateral; latipalpis; long; margin; mature; microsetae; microspinulae; morphological; new; niehuis; palpilatis; plate; posteriorly; prementum; prosternal; prothorax; sclerite; segment; sensilla; sensillum; seta; shape; short; species; specimens; stage; surface; times; volkovitsh; wide cache: binhm-418.pdf plain text: binhm-418.txt item: #180 of 297 id: binhm-419 author: Hadi, Afkar M.; Taher, Ahlam J. title: NEW RECORD OF BRACHYDISTOMUM MICROSCELIS (YAMAGUTI, 1933) (TREMATODA, DICROCOELIIDAE) FROM HOUSE SPARROWPASSER DOMESTICUS BIBLICUS HARTERT, 1904 IN BAGHDAD, IRAQ date: 2020-06-24 words: 2299 flesch: 56 summary: A total of 30 specimens of house sparrow (15 females and 15 males) were collected by netting traps from gardens of some houses in Baghdad city Iraq, from March 2018 to July 2019. Microscopic description (Based on Brachydistomum microscelis specimens): The long body glides narrowly until it is exposed in the ventral sucker that represents the breadth area, curving slightly ventrally, and then the body tapers back to the rounded end. keywords: baghdad; biblicus; birds; bladder; body; brachydistomum; cestodes; city; domesticus; end; gall; genus; hadi; history; house; house sparrow; iraq; length; microscelis; mohammad; museum; natural; new; parasites; passer; record; sparrow; species; specimens; study; sucker; taher; trematoda; university; width; yamaguti cache: binhm-419.pdf plain text: binhm-419.txt item: #181 of 297 id: binhm-42 author: Hadi, Ilaf Hassan title: EFFECT OF HONEY ON SPERM CHARACTERISTICS AND PREGNANCY RATE IN MICE date: 2017-07-01 words: 3604 flesch: 58 summary: The aim of the current study is to demonstrate the effect of honey on the sperms characteristics (sperm concentration, sperm motility, grade of activity and sperm normal morphology) as well as pregnancy rate in mice. RESULTS The results of sperm characteristics (sperm concentration, sperm motility, grade of activity and sperm normal morphology) following in vitro activation and incubation of caudal epididymis region for 30 min using IVF medium with and without 10% honey were observed in table (1).The sperm concentrations (x10 6 sperm/ml) following direct activation with 10% honey-IVF medium showed no significant difference as compared with the honey-free IVF medium. keywords: 1997; 2007; activation; activity; andrology; antioxidant; caudal; characteristics; concentration; control; current; cytoplasmic; dehydrogenase; direct; effect; epididymis; et al; female; fertility; fertilization; fructose; function; glucose; grade; group; hadi; healing; honey; human; ilaf; increase; insemination; ivf; j.a; journal; mahaneem; male; media; medium; menkveld; mice; morphology; motility; normal; parameters; percentage; pregnancy; pregnancy rate; progressive; properties; rate; rats; relationship; reproduction; ros; semen; significant; sorbitol; sperm; sperm motility; spermatogenesis; spermatozoa; study; الفئران; النطف cache: binhm-42.pdf plain text: binhm-42.txt item: #182 of 297 id: binhm-420 author: Al-Meshhdany, Warqaa Yehia; Hassan, Fikrat M. title: FIVE DIATOM SPECIES IDENTIFIED BY USING POTENTIAL APPLICATION OF NEXT GENERATION DNA SEQUENCING date: 2020-06-24 words: 5480 flesch: 48 summary: Another study also observed only 19% of identified diatoms by using molecular analysis while they identified 63 taxa by microscopy (Vasselon et al., 2017). 46 Five diatom species identified Table (5): Relative abundance of diatom species by NGS Taxa Proportion (%) Notes Achnanthidium minutissimum 21.1 keywords: 18s; 18s rrna; 2010; 2013; 2015; 2017; abundance; accession; achnanthidium; algal; analysis; barcoding; base; biological; blast; data; diagram; diatom species; diatoms; dna; ecology; ehrenberg; environmental; epipelic; et al; fistulifera; gene; genebank; generation; gomphonema; hassan; identification; identities; iraq; isolated; korea; kützing; match; mega; meshhdany; methods; minutissimum; molecular; ncbi; neighbor; new; ngs; nitzschia; number; organisms; pcr; phylogenetic; placentula; products; program; pseudonana; pumilum; quality; range; record; river; rrna; rrna gene; samples; saprophila; score; sequence; sequencing; species; specimens; studies; study; table; taxa; thalassiosira; time; total; transition; transvertion; tree; use; veneta; water; ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| cache: binhm-420.pdf plain text: binhm-420.txt item: #183 of 297 id: binhm-421 author: Hamza, Shatha Mohammed; Al-Saadi, Sahar A. A. Malik; Al-Abbawy, Dunya A. Hussain title: A STUDY OF PHYSICAL AND ANATOMICAL CHARACTERISTICS OF THE HEAVY METAL ACCUMULATION OF JUNCUS RIGIDUS DESFONTAINES, 1798 (FAMILY, JUNCACEAE) IN BASRAH PROVINCE, SOUTHEREN OF IRAQ date: 2020-06-24 words: 6545 flesch: 58 summary: Chemical analysis of the heavy metals (Cd, Ni, and Pb) in the roots, culm, and leaves of J. rigidus plant was achieved through HNO3 digestion and the final filtrated mixture was subjected to an atomic spectrophotometer (Phoenix-986, CITY, England). TF reflects the proportion of the heavy metals in the shoot to its roots whereas the BAC explains ratio of the heavy metals in the shoots to the soil (Cui et al., 2007; Li et al., 2007) as the following: BCF = (Concentration Metals) root / (Concentration Metals) soil TF = (Concentration Metals) shoot / (Concentration Metals) root BAC = (Concentration Metals) shoot / (Concentration Metals) soil Anatomical study For the anatomical studies, ten specimens of J. rigidus plants were collected from each station; the permanent sections of roots and culms were ready, the plant parts were cut into 10-15 cm pieces and fixed for 24 hours in formalin-acetic acid and alcohol (FAA) and were preserved in 70% ethyl alcohol, then dehydrated in an ethyl alcohol series. keywords: 2012; accumulate; accumulation; aerenchyma; anatomical; area; bac; basrah; bcf; bundle; cadmium; cells; changes; characteristics; city; concentration; contaminated; control; culm; effects; environmental; epidermis; et al; factor; growth; hamza; hamza et; heavy; heavy metals; high; http://refhub.elsevier.com/s1871-6784(16)32657-7/sbref0480; iraq; j. rigidus; journal; juncus; kg-1; layer; lead; leaves; metals; najeeb; number; observed; parts; pendias; physical; phytoextraction; phytoremediation; plant; polluted; pollution; potential; reduction; regions; results; rigidus; roots; saadi; science; shoots; sites; soil; species; specimens; station; structure; studies; study; tab; table; thickness; tissue; translocation; uptake; vascular; water; xylem; yoon cache: binhm-421.pdf plain text: binhm-421.txt item: #184 of 297 id: binhm-422 author: Mohammed, Hanaa Hussein; Ali, Malik Hassan title: NEW RECORD OF PLEUROBRACHIA PILEUS (O. F. MÜLLER, 1776) (CTENOPHORA, CYDIPPIDA) FROM CORAL REEF, IRAQI MARINE WATERS date: 2020-06-24 words: 3256 flesch: 64 summary: 86 New record of Pleurobrachia pileus The examined materials of P. pileus were conserved in alcohol and placed in the marine collection at the Ocean genome legacy aquatic museum laboratory at the Marine Science Center/ University of Basrah. 88 New record of Pleurobrachia pileus Actually, the prey assemblages found in the stomachs of P. pileus reflects their ambient habitat in the studied area as given in Table (1); similar results were found in other regions (Bamstedt, 1998; Mazlum et al., 2018; Riisgard et al., 2015). keywords: 2003; 2015; ali; arabian; area; basrah; biology; center; coastal; coastal waters; comb; copepods; coral; ctenophora; dehghan; density; et al; fish; group; gulf; ind./; iraq; jellyfish; journal; larvae; marine; mohammed; müller; new; north; p. pileus; pileus; pleurobrachia; pleurobrachia pileus; predation; present; record; reef; results; salman; science; sea; site; species; specimens; studies; study; university; waters; zooplankton; الهائمات cache: binhm-422.pdf plain text: binhm-422.txt item: #185 of 297 id: binhm-423 author: Al-Miamary, Falah A.; Al-Badrani, Omar A.; Al-Juboury, Ali I. title: CALCAREOUS NANNOFOSSILS AND CHEMOSTRATIGRAPHY OF THE EARLY APTIAN OCEANIC ANOXIC EVENT 1A FROM NORTHERN IRAQ date: 2020-06-24 words: 4417 flesch: 54 summary: By the correlation of recorded calcareous nannofossils biozones with regional schemes, it is concluded that the age of studied section is Early Aptian (Diag. 3). MATERIALS AND METHODS Fifteen samples within 400 cm thick of marly limestones, shales and limestones from Barsarin section, northern Iraq (Map 1, Diag. 1), were selected and prepared using the simple smear slide technique for the study of calcareous nannofossils which are studied with a transmitted-light microscope (Optika B-353POL, Italy). keywords: 2004; 2019; age; anoxic; aptian; area; balambo; balambo formation; barsarin; basin; biostratigraphy; black; braarudosphaera; brönnimann; calcareous; calcareous nannofossils; carbon; central; chemostratigraphy; coccolith; content; cretaceous; crisis; data; deflandre; description; diag; diagram; discolithus; early; early aptian; erba; et al; event; evidence; family; formation; genus; geology; górka; iraq; kamptner; late; litterarius; lower; mahanipour; marine; miamary; micrantholithus; micropaleontology; mosul; mutterlose; nannoconus; nannofossils; nannolith; nannoplankton; nielsen; northeastern; northern; oae; occurrences; oceanic; organic; perch; roth; section; shaped; species; study; university; upper; zagros; zone cache: binhm-423.pdf plain text: binhm-423.txt item: #186 of 297 id: binhm-424 author: Ismail, Omar K.; Bartholomew, Aaron title: INCREASED PREFERENCE OF DARKLING BEETLES AKIS SUBTRICOSTATA REDTENBACHER, 1850 AND TRACHYDERMA PHILISTINA REICHE AND SAULCY, 1857 (COLEOPTERA, TENEBRIONIDAE) FOR VEGETATION WITH INCREASING TEMPERATURE date: 2020-06-24 words: 3795 flesch: 58 summary: The microbes within the guts of xerophilous darkling beetles break down dead plant material, so darkling beetles are also important for returning nutrients to desert soils (Ayal, 2007). Darkling beetles (Coleoptera, Tenebrionidae) are abundant, diverse, ecologically-important inhabitants of many arid and semi-arid environments worldwide (De los Santos et al., 2002; Saji and Al Dhaheri, 2011). keywords: 2018; arab; arena; arid; bartholomew; beetles; coleoptera; curtains; darkling; desert; diag; different; emirates; environments; experimental; habitat; high; important; individual; ismail; journal; liu; logistic; moghrabi; parmenter; philistina; preference; preferred; regression; results; shrubs; sides; species; squares; subtricostata; temperatures; tenebrionidae; time; trials; uae; united; vegetated; vegetation; ward; الجانب; النباتي; درجة cache: binhm-424.pdf plain text: binhm-424.txt item: #187 of 297 id: binhm-43 author: Al-Zubaidi, Aqeel Abbas; Mohammad, Mohammad K.; Rasheed, Muaid J. title: THE IMPORTANCE OF GEODIVERSITY ON THE ANIMAL DIVERSITY IN HUWAIZA MARSH AND THE ADJACENT AREAS, SOUTHEASTERN IRAQ date: 2018-07-01 words: 4874 flesch: 66 summary: Mesopotamichthyes sharpeyi, Arabibarbus grypus, Luciobarbus xanthopterus, exotic Coptodon zillii (Gervais, 1848), Bufo viridis(Laurenti,1768), Pelophylax ridibundus (Pallas, 1771), Natrix tessellata, Mauremys caspica (Gmelin, 1774), threatened Rafetus euphraticus Daudin, 1802, Ceryle rudis (Linnaeus, 1758), Egretta spp., nesting sites for Marmaronetta angustriostris (Menetries, 1832) and Aythya nyroca (Güldenstädt, 1770), rare Ardea goliath Cretzschmar, 1827, Endangered A. griseldis, endemic subspecies of Tacypabtus ruficollis iraquensis, Lucinia svecica (Linnaeus, 1758), the rare resident breeders Threskiornis aethiopicus (Latham, 1790), Plegadis falcinellus Linnaeus, 1766 and Platella leucorodia Linnaeus, 1758, endangered Lutrogale perspicillata maxwelli Hayman, 1957, Lutra lutra (Linnaeus, 1758). Fauna: Canis aureus Linnaeus, 1758, Sus scrofa Linnaeus, 1758, Gerbillus mesopotamicus Harrison, 1956, Tatera indica (Hardwicke, 1807), Herpestes javanicus (É. Geoffroy Saint- Hilaire, 1818), Felis chaus furax de Winton, 1898, Nycticorax nycticorax (Linnaeus, 1758), Egretta garzetta (Linnaeus, 1766), Circus aeruginosus (Linnaeus, 1758), Falco tinnunculus Linnaeus, 1758, Porzana porzana (Linnaeus, 1766), Streptopelia turtur (Linnaeus, 1758), Ceryle rudis, Pycnonotus leucogenys (Gray, JE, 1835), Hypocolius ampelinus Bonaparte, 1850, Erithacus rubecola (Linnaeus, 1758), Prinia gracilis Lichtenstein, 1823, Cisticola juncidis (Rafinesque, 1810), Passer domesticus (Linnaeus, 1758), Stenodactylus affinis (Murray, 1884), Natrix tessellata, Mauremys caspica, Rafetus euphraticus, Bufo viridis and Pelophylax ridibundus. keywords: abbas; abiotic; addition; adjacent; alba; alluvial; alzubaidi; anas; animal; aqeel; area; baghdad; banks; bed; birds; bufo; canis; caspica; charadrius; clay; claystone; conglomerate; convention; deposits; dry; dwaireej; east; ecosystem; euphraticus; fan; fauna; flats; forms; geodiversity; gray; habitat; hassan; heckel; heron; history; huwaiza; huwaiza marsh; hyaena; importance; indica; injana; iraq; land; lichtenstein; linnaeus; main; mammals; marsh; marshes; mauremys; meters; minerals; miocene; mohammad; mud; mudstone; museum; natrix; natural; nature; north; pallas; plain; plate; pliocene; quaternary; rafetus; ramsar; reptiles; resources; rivers; rock; sand; sandstone; scopoli; sediments; shallow; silt; soil; southern; species; spp; studied; study; teeb; tigris; type; units; university; vertebrate; water; year; التنوع; الجيولوجي; الحويزة; هور cache: binhm-43.pdf plain text: binhm-43.txt item: #188 of 297 id: binhm-44 author: Taher, Ibrahim Esa; Ami, Sulaiman Naif; Haleem, Raed Abduljabbar; Shareef, Barin Sidqi title: FIRST RECORD OF MYCETOPHAGOUS NEMATODE APHELENCHUS AVENAE IN IRAQ WITH DESCRIPTION AND TESTING THEIR PROPAGATION ON DIFFERENT FUNGUS CULTURE date: 2017-07-01 words: 2220 flesch: 66 summary: Aphelenchus avenae propagation in different fungus culture: Diagram (1) illustrates that after two weeks of incubation A. avenae propagated and increased in number at the huge level on F. graminearum number of nematode reached to (114233) while F. oxysporum was secondly preferred by A. avenae and number of nematodes were (47013). A. avenae is a mycophagous nematode which can't parasitize on higher plant (Barnes et al., 1981), and there is no record of real parasitism, damage or feeding of this nematode on the plant, thus A. avenae is called fungal nematode. keywords: aphelenchus; avenae; bastian; body; control; crown; culture; different; eggs; esa; feeding; female; fungal; fungi; fusarium; graminearum; ibrahim; iraq; ishibashi; length; media; mycetophagous; nematode; number; okada; oxysporum; pda; plant; propagation; record; region; soil; species; stylet; taher; tail; wheat cache: binhm-44.pdf plain text: binhm-44.txt item: #189 of 297 id: binhm-45 author: Abdul-Rassoul, M. S. title: FIRST RECORD OF APOLEPTOMASTIX BICOLORICORNIS (GIRAULT, 1915) (HYMENOPTERA, ENCYRTIDAE), AS PARASITOID OF THE RICE MEALYBUG, BREVENNIA REHI (LINDINGER, 1943) (HEMIPTERA, PSEUDOCOCCIDAE) IN IRAQ date: 2017-07-01 words: 971 flesch: 53 summary: Mus. (2017) 14 (3): 261-265 Apoleptomastix bicoloricornis (Girault, 1915) تسجيل جديد رتبة غشائية االجنحةمن للطفيلي (Hymenoptera, Encyrtidae) في العراق محمد صالح عبد الرسول جامعة بغداد ، بغداد، العراق ،مركز بحوث ومتحف التاريخ الطبيعى 3.5.01033: تأريخ القبول 3.5.0102: تأريخ االستالم الخالصة ,Apoleptomastix bicoloricornis (Giraultالطفيلىالزنبور تم تسجيل تواجد 1915) (Hymenoptera, Encyrtidae) على البق للمرة االولى في العراق متطفلا ,Brevennia rehi (Lindinger, 1943) (Hemiptera الدقيقى للرز، Pseudococcidae) ،مع ذكر ملحظات موجزة لتمييز هذا النوع عن في محافظة بغداد .االنواع القريبة له فى نفس الجنس In this work, we report the first record of Apoleptomastix bicoloricornis parasitizing Brevennia rehi on Echinochloa colona in Baghdad, Iraq. keywords: abdul; apoleptomastix; baghdad; bicoloricornis; brevennia; brown; colona; dark; echinochloa; encyrtidae; female; girault; hayat; hemiptera; history; hymenoptera; iraq; lindinger; mealybug; noyes; parasitoid; rehi; rice cache: binhm-45.pdf plain text: binhm-45.txt item: #190 of 297 id: binhm-46 author: Al-Saadi, Abid Ali J.J.; Rasheed, Rabab A. title: THE OCCURRENCE OF THREE MONOGENEAN PARASITE SPECIES FOR THE FIRST TIME IN IRAQ ON GILLS OF THE COMMON CARP CYPRINUS CARPIO LINNAEUS, 1758 (CYPRINIFORMES, CYPRINIDAE) date: 2016-12-01 words: 2278 flesch: 70 summary: So, more surveys on fish parasites are needed to recognize more species and for increasing the information on the parasitic fauna of freshwater fishes of Iraq. Fish parasites: Pathobiology and production. keywords: abid; ali; bar; carpio; coll; common; cyprinus; dorsal; dzhalilovi; ergens; fishes; freshwater; gills; gyrodactylus; haptor; hooklet; iraq; j.j; length; magnus; marginal; matovi; monogenean; occurrence; parasites; rabab; rasheed; saadi; sci; science; size; species; thesis; time; total; univ; ventral; worms cache: binhm-46.pdf plain text: binhm-46.txt item: #191 of 297 id: binhm-466 author: Budiewi, Ekhlas Abdul Jabbar; Al-Jassany, Radhi F.; Augul, Razzaq Shalan title: REVISION OF THE GENUS SINOXYLON DUFTSCHMID, 1825 (COLEOPTERA, BOSTRICHIDAE) WITH NEW RECORD OF SPECIES IN THE MIDDLE OF IRAQ date: 2020-12-21 words: 2392 flesch: 66 summary: (A, B, C from least to more frequent, sequentially) 130 Revision of the genus Sinoxylon Duftschmid, 1825 Plate (3): Ventral view of abdomen in S. muricatum; (A) Male, (B) Female. During this investigation, there are three species registered: Sinoxylon anale Lesne, 1897; S. ceratoniae (Linnaeus, 1758) and S. muricatum (Olivier, 1790); the last species was re- described as a new record to faunal insects of Iraq. keywords: 1825; abdomen; anale; apical; baghdad; beetles; bostrichidae; budiewi; ceratoniae; coleoptera; color; declivity; dry; duftschmid; elytra; female; fig; genitalia; genus; hairs; insects; iraq; lesne; linnaeus; male; materials; muricatum; olivier; research; revision; shaped; short; sinoxylon; species; specimens; sternite; tergite; trees; twigs; wood; تأريخ cache: binhm-466.pdf plain text: binhm-466.txt item: #192 of 297 id: binhm-467 author: Alqaisi, Amjed Qays; Al-Warid, Harith Saeed; Al-Moussawi, Azhar A. title: MOLECULAR CHARACTERIZATION OF CONTRACAECUM RUDOLPHII HARTWICH, 1964 (NEMATODA: ANISAKIDAE) FROM THE CORMORANT PHALACROCORAX CARBO IN IRAQ date: 2020-12-21 words: 5451 flesch: 57 summary: A (JQ071415) 96.74% with C. rudolphii F(JF424597) G4 (population I) MT308994 97.87% with C. rudolphii B(JQ071394) 97.83% with C. rudolphii B (AJ634783) 96.45% with C. rudolphii A (JQ071415) 96.81% with C. rudolphii F(JF424597) G1 (population II) MT012367 98.55% with C. rudolphii A(JQ071414) 97.83% with C. rudolphii B (AJ634783) 96.46% with C. rudolphii F(JF424597) 144 Molecular characterization of Contracaecum rudolphii G3 (population II) MT012367 98.20% with C. rudolphii A(JQ071414) 97.09% with C. rudolphii B(JQ071394) 96.73% with C. rudolphii F(JF424597) The sequences of ITS-1 for the first population had the highest similarity to ITS-1 sequence of C. rudolphii B, while the sequences of ITS-1 for the second population had the highest similarity to ITS-1 sequence of C. rudolphii A. keywords: accession; adult; alqaisi; anisakidae; baghdad; carbo; central; characterization; contracaecum; contracaecum rudolphii; cormorants; current; different; district; dna; et al; features; female; fish; genbank; genetic; genotypes; hartwich; hbaiel; highest; hosts; identification; iraq; isolates; its-1; journal; lake; larvae; linnaeus; male; mohammad; molecular; morphological; moussawi; mt012367; nematoda; nematodes; number; nycticorax; parasites; parasitology; pcr; phalacrocorax; phylogenetic; population; present; program; province; qar; related; research; results; rudolphii; second; sequences; sex; shamsi; sibling; similarity; species; specimens; studies; study; tab; tarmiyah; thi; tree; university; wildlife cache: binhm-467.pdf plain text: binhm-467.txt item: #193 of 297 id: binhm-468 author: Muhammed, Sarkaut Hussein title: SEASONAL FLUCTUATION OF STINK BUG MUSTHA SPINULOSA (LEFEBVRE, 1831) (HEMIPTERA, PENTATOMIDAE) ON SOME TREES IN ERBIL CITY date: 2020-12-21 words: 3257 flesch: 62 summary: Key words: Fruit trees, Mustha spinulosa, Pentatomidae, Seasonal fluctuation, Stink bug. In Erbil city, many kinds of fruit trees are grown due to the suitability of environmental conditions, such as trees of plum, apricot, apple, olive, almond and pear (RSO, 2008). keywords: adult; almond; apple; apricot; august; average; bug; bugs; city; erbil; fluctuation; forest; fruit; hemiptera; heteroptera; host; humidity; hussein; individuals; insects; iran; iraq; maximum; mean; muhammed; mustha; number; october; olive; pear; pentatomidae; plants; plum; relative; relative humidity; results; rosaceae; sarkaut; seasonal; second; september; species; spinulosa; stink; stink bug; study; table; temperature; trees; university; week cache: binhm-468.pdf plain text: binhm-468.txt item: #194 of 297 id: binhm-469 author: Ahmed, Soran H.; Majeed, Soma I. title: MONITORING OF THE WILD MAMMAL FAUNA IN BAMO MOUNTAIN IN NORTHERN IRAQ (KURDISTAN) FOR THE FIRST TIME USING CAMERA TRAP METHOD AND RAISING AWARENESS FOR ITS CONSERVATION date: 2020-12-21 words: 4279 flesch: 55 summary: Map (1): A map of Bamo Mountain area (Extracted from Google Earth Software) with general landscape, seasonal vegetation and climate; (A) In summer, (B) In winter (Photos by Soran H. Ahmad). Bamo Mountain is situated within the Zagros Mountains in northern Iraq which is a suitable habitat for wild mammals. keywords: 2015; 2016; 2019; abundance; ahmed; area; bamo; bamo mountain; camera; camera trap; conservation; different; distribution; diversity; east; et al; fauna; goat; hunters; hunting; indian; interviews; iran; iraq; kurdistan; leopard; linnaeus; local; majeed; major; mammalian; mammals; minefields; monitoring; mountain; nature; northern; northern iraq; panthera; pardus; period; persian; persian leopard; population; range; recent; red; saxicolor; sheikhly; species; status; study; survey; threats; time; trap; video; wild; wild mammals; wildlife cache: binhm-469.pdf plain text: binhm-469.txt item: #195 of 297 id: binhm-47 author: Hussin, Amer M.; Khudhayer, Yahia Y. title: A COMPARATIVE HISTOLOGICAL STUDY OF THYROID TISSUE IN CARP FISH CYPRINUS CARPSIO AND MICE SWISS ALBICANS date: 2018-10-09 words: 2081 flesch: 70 summary: Accordingly, the study concluded that the metabolism of thyroid fish was of moderate type. Figure (4): Thyroid follicles of mice. keywords: active; amer; arrow; blood; body; building; capsule; carp; cells; colloid; comparative; connective; development; figure; fish; follicles; follicular; gland; h&e; histological; histology; hormones; hussin; iraq; khudhayer; kidney; mice; physiological; samples; small; stain; states; structure; study; thyroid; tissue; veterinary; x400; yahia; دسقٍح cache: binhm-47.pdf plain text: binhm-47.txt item: #196 of 297 id: binhm-470 author: Sa’eed, Najat Ameen; Al-Abide, Naglaa Mustafa; Al- Asi, Aqeel Husein Ali title: COMPARATIVE STUDY OF SEVERAL MORPHOLOGICAL AND REPRODUCTIONAL ASPECTS FOR SOME SPECIES OF THE BELLEVALIA LAPEYROUSE, 1808 AND ORNITHOGALUM LINNAEUS, 1753 (ASPARAGALES, ASPARAGACEAE) IN CENTRAL AND NORTH OF IRAQ date: 2020-12-21 words: 5845 flesch: 61 summary: The shape of the leaf’s base varied between flat in the B. saviczii, B. macrobotrys, B. kurdistanica, B. chrisii, O. brachystachys, O. neurostegium, O. pyrenaicum species; tapered in B. flexuosa, B. longipes and B. paradoxa and obtuse in B. parva. Plate (4): Fruit pedicels of the plant species under study; (1) B. chrisii, (2) B. flexuosa, (3) B. kurdistanica, (4) B. longipes, (5) B. macrobotrys, (6) B. parva, (7) B. paradoxa, (8) B. saviczii, (9) Ornithogalum brachystachys, (10) O. neurostegium, (11) O. pyrenaicum. keywords: acute; apex; asparagaceae; b. chrisii; b. flexuosa; b. kurdistanica; b. longipes; b. macrobotrys; b. parva; bellevalia; biology; boissier; brachystachys; bulbs; capsule; characteristics; chrisii; colour; comparative; elongated; embryos; et al; family; flora; flowers; fruit; genera; genus; green; iraq; journal; lapeyrouse; leaf; leaves; length; longest; morphological; neurostegium; new; ornithogalum; oval; paradoxa; pedicels; plant; plate; pyrenaicum; reproductional; results; saviczii; sa’eed; seeds; shape; similar; species; straight; study; taxonomic; truncate; turkey; university; white; width; yildirim cache: binhm-470.pdf plain text: binhm-470.txt item: #197 of 297 id: binhm-471 author: Zarikian, Noushig title: A CONTRIBUTION TO THE CHECKLIST OF THE JUMPING SPIDERS (ARANEAE: SALTICIDAE) OF ARMENIA date: 2020-12-21 words: 2424 flesch: 64 summary: Heliophanus dubius C. L. Koch, 1835 Materials: 1♀, Kotayk prov., Geghadir, 18.iv.2020. Logunov (1998b) 15 Heliophanus auratus C. L. Koch, 1835 Gegharkunik prov. keywords: 2002; araneae; aranei; armenia; asia; caucasus; checklist; current; distribution; europe; fauna; genus; guseinov; habitats; heliophanus; jumping; koch; kotayk; logunov; materials; pellenes; prov; rocky; salticidae; shirak; simon; species; spiders; study; turkey; walckenaer cache: binhm-471.pdf plain text: binhm-471.txt item: #198 of 297 id: binhm-472 author: Alderawii, Mohammed M.; Alyousuf, Aqeel A.; Hasan, Samir A.; Mohammed, Jasim K.; Jappar, Hussein A.; Paudyal, Sulochana title: AN EVALUATION OF INVASIVE PEST, RED PALM WEEVIL RHYNCHOPHORUS FERRUGINEUS (OLIVIER, 1790) (COLEOPTERA, CURCULIONIDAE) POPULATION IN IRAQ date: 2020-12-21 words: 4766 flesch: 61 summary: INTRODUCTION Red palm weevil (RPW) Rhynchophorus ferrugineus (Olivier, 1790) is considered one of the most destructive invasive pest attacking all types of palms trees including date palms worldwide (Cox, 1993; Faghih, 1996; Misra, 1998;Ju and Ajlan, 2011; Faleiro et al., 2012; Azmi et al., 2017; Manzoor et al., 2020); the first invasion of RPW in the Arabian Peninsula 204 An evaluation of invasive pest, red palm weevil was in UAE during 1985, then spread to other date palms producing countries in this region (Kehat, 1999; El-Mergawy and Ajlan, 2011; Al-Shawaf et al., 2013); causing economic losses reaching $ 25.92 million for eradication protocol of RPW in the 5% infested date palms in the invaded countries in this region (El-Sabea et al., 2009). Red palm weevil is attracted to damaged and undamaged trees, and the severity of damage increased because the RPW-males produce an aggregation pheromone that attracts the female weevil on the infested palms (Gunawardena and Bandarage, 1995), resulting in tree death due to the larval and adult feeding inside the tree trunk; larvae can feed only in soft tissues, such as the palm crown, the top of the trunk and the bases of the petioles (Abraham et al., 1998). keywords: 2016; abraham; adults; agriculture; ajlan; alderawii; arabia; basrah; chemical; coleoptera; control; county; curculionidae; date; date palm; department; et al; evaluation; faleiro; ferrugineus; infestation; infested; insecticides; invasive; invasive pest; iraq; journal; management; map; ministry; monitoring; number; olivier; orchards; palm; palm orchards; palm trees; palm weevil; pest; pheromone; plant; population; program; protection; province; quarantine; red; red palm; results; rhynchophorus; rhynchophorus ferrugineus; rpw; safwan; saudi; science; study; traps; trees; trunk; weevil; weevil rhynchophorus cache: binhm-472.pdf plain text: binhm-472.txt item: #199 of 297 id: binhm-473 author: Al-Sheikhly, Omar F.; Mikkola, Heimo; Mousavi, Seyd B. title: PHARAOH EAGLE OWL BUBO ASCALAPHUS (SAVIGNY, 1809) (STRIGIFORMES, STRIGIDAE), THE “SHROUDED IN MYSTERY” OWL OF IRAQ AND IRAN date: 2020-12-21 words: 4554 flesch: 64 summary: nikolskii 465 394 433 10 430 378 415 10 B. bengalensis 403 376 387 12 391 358 370 10 B. ascalaphus 390 340 367 20 368 325 346.5 20 We have listed from field observations and photos collected from Iraq and Iran several obvious morphological differences between B. ascalaphus and B. b. nikolskii. In the field B. ascalaphus is so small that it can be separated from B. b. nikolskii even without measurements. keywords: 1922; 2012; adult; allouse; area; ascalaphus; b. b.; b. bubo; baghdad; birdlife; birds; breeding; bubo; bubo ascalaphus; bubo bubo; collected; conservation; coverts; eagle; et al; facial; field; foothills; history; identification; international; interpositus; iran; iraq; khaleghizadeh; khuzestan; localities; measurements; mikkola; museum; natural; nikolskii; north; observations; occurrence; omissus; owl; owl bubo; owls; pale; pattern; pharaoh; province; rufous; savigny; sheikhly; small; south; southeastern; species; specimens; status; subspecies; tail; ticehurst; university; vaurie; western; western iran; wing cache: binhm-473.pdf plain text: binhm-473.txt item: #200 of 297 id: binhm-48 author: Hamodie, Modhafer A. title: A VEGETATIONAL STUDY OF THE LOVE CREEK NATURE CENTER BFRR1EN COUNTY, MICHIGAN HISTORICAL, PHYSICAL AND ECOLOGICAL FEATURES date: 2016-12-01 words: 4845 flesch: 70 summary: The dominant herbs in the disturbed areas are ragweed, Ambrosia artemisiifolia L.; Aster pilosus L., the common orchard grass, Dactylis glomerate L.; daisy fleabane, Erigeron annuus (L.) Pers.; wild strawberry Fragaria virginiana Duchesne; evening primrose, Oenothera biennis L.; and Solidago canadensis L. Occasional species were corn cockle, Agrostemma githago L.; bouncing bet, Saponaria officinalis L., butterfly-weed, Asclepias tuberosa L., and wild-bergamot, Monarda fistulosa L. Patches of Epilobium palustre L., were found in moist marginal locations in the disturbed habitats. 122 A vegetational study of the love Creek A few plants from the main disturbed areas were introduced accidentally along some of the nature trails. The marsh and the streamside communities are conspicuously devoid of submerged and floating aquatic plants, except for duckweed, Lemna minor L. which is occasionally present in the marsh. keywords: 1982; acer; americana; area; barnes; berrien; berrien county; botanist; canadensis; center; co.; common; communities; composition; county; creek; creek nature; data; deciduous; density; dept; distance; disturbed; division; dominance; dry; east; eastern; edge; ehrh; forest; fraxinus; frequency; habitat; hamodie; herbaceous; k.koch; liriodendron; loam; love; love creek; marsh; meadow; mean; mesic; method; michigan; michx; middle; modhafer; muhl; nature; nature center; northern; note; nutt; oshtemo; plants; points; portion; property; prunus; quarter; relative; road; rubra; saccharum; sampling; sandy; section; serotine; sides; soil; south; species; springs; stream; strip; study; succession; table; thesis; trees; ulmus; university; unpublished; value; vegetation; virginiana; water; western; woodlot; woods; المركز; بيرين; لوف cache: binhm-48.pdf plain text: binhm-48.txt item: #201 of 297 id: binhm-49 author: Abdul-Rassoul, M. S. title: NEW HOST PLANTS RECORD FOR THE BROWN SOFT SCALE COCCUS HESPERIDUM LINNAEUS, 1758 (HEMIPTERA: COCCIDAE) IN BAGHDAD PROVINCE, IRAQ date: 2016-12-01 words: 1267 flesch: 60 summary: Soft scale insects of Argentina (Homoptera: Coccoidea: Coccidae) Las cochinillasblandas de la República Argentina (Homoptera: Coccoidea: Coccidae). This finding is met with the results of Granara de Willink (1999) who record this scale on D. pinnata in Argentine when he provided a list of C. hesperidum host plant. keywords: abdul; asteraceae; baghdad; ben; brown; citrus; coccidae; coccus; dahlia; dov; hesperidum; homoptera; host; insects; iraq; linnaeus; m.s; myrtaceae; myrtuscommunis; natural; new; pest; pinnata; plants; rassoul; record; scale; soft; species cache: binhm-49.pdf plain text: binhm-49.txt item: #202 of 297 id: binhm-50 author: Aneed, Israa Khalaf; Augul, Razzaq Shalan; Al-Bahadyli, Layla Jabbar Mohammed title: REDESCRIPTION AND SOME POLYMORPHISM NOTES IN WORKERS OFCAMPONOTUS XERXESFOREL, 1904 (HYMENOPTERA: FORMICIDAE; FORMICINAE) date: 2016-12-01 words: 4639 flesch: 60 summary: Wide and semi-triangle in lateral view; middle of dorsal surface convex in lateral view and with three long and erect setae on each side; anterior part of pronotum with depression and narrow dorsally to form neck in association with small area from apex of propleuron. In ventral view, consist from semi-elongated two triangular shaped portions, and separated by median longitudinal line, each portion wide at near coxae, but acuminated or narrowed in anterior parts; propleuron clothed with erect and vary hairs. keywords: alitrunk; aneed; anterior; ants; apex; apical; base; camponotus; collingwood; coxae; district; dorsal; erect; figure; fine; fore; formicidae; frontal; hairs; half; head; history; hymenoptera; iraq; israa; lateral; legs; length; longer; major; margin; narrowed; natural; notes; parts; petiole; plate; polymorphism; posterior; pronotum; propodeum; province; redescription; row; second; segments; semi; setae; setulae; shaped; short; similar; species; specimens; spur; surface; ventral; view; wide; workers; xerxes cache: binhm-50.pdf plain text: binhm-50.txt item: #203 of 297 id: binhm-506 author: Al- Zubaidi, Aqeel A.; Sissakian, Varoujan; Jassim, Hassan K. title: PETROLOGY AND PROVENANCE OF THE NATURAL STONE TOOLS FROM Al-DALMAJ ARCHAEOLOGICAL SITE, MESOPOTAMIAN PLAIN, IRAQ date: 2021-06-20 words: 5760 flesch: 63 summary: Key words: Archeology, Mesopotamia, Neolithic, Rocks, Stone tools. Archaeologists often study the stone tools as lithic https://doi.org/10.26842/binhm.7.2021.16.3.0231 232 Petrology and provenance of the natural stone analysis, whereas Ethno archaeologists study the cultural implications of using and manufacturing of stone tools (Paul and Karen, 2015). keywords: 2006; 2012; addition; age; alzubaidi; ancient; archaeological; archaeological site; areas; baghdad; basalt; beds; channel; chert; city; collected; conglomerate; dalmaj; dalmaj archaeological; deposits; desert; different; dolomitic; et al; exposed; formation; fossiliferous; geological; geology; gravels; hor; human; iraq; jassim; left; limestone; map; mesopotamian; mesopotamian plain; microscope; natural; natural stone; neolithic; northeast; palaeolithic; period; pestle; petrology; plain; plate; polarized; pottery; provenance; quartzite; rhyolite; right; river; rocks; sample; sandstone; scraper; section; sediments; sissakian; site; south; stone; stone tools; studied; study; surrounding; terraces; thin; tigris; tools; turkey; types; university; western; األدوات cache: binhm-506.pdf plain text: binhm-506.txt item: #204 of 297 id: binhm-507 author: Hadi, Afkar M.; Hadi, Hind D.; Jassim, Suhad Y.; Yousif, Noor H. title: THE FALCONS (FALCONIFORMES, FALCONIDAE) VOUCHER COLLECTION IN THE IRAQ NATURAL HISTORY RESEARCH CENTER AND MUSEUM (INHM) date: 2021-06-20 words: 4145 flesch: 68 summary: Recently, Common Kestrel was recorded in Al-Chebaeish, Huwaiza, Al- Hammar and Central Marshes within the geographical range of the Mesopotamian marshes of southern Iraq by Al-Sheikhly and Al-Azawi (2019). A summary of birds recorded in the marshes of southern Iraq, 2005–2008. keywords: azawi; baghdad; biarmicus; biodiversity; birdlife; birds; black; brown; center; cherrug; collection; color; common; conservation; current; et al; falcon; falconidae; falconiformes; female; gray; hadi; history; inhm; international; iraq; kestrel; lanner; lesser; linnaeus; lower; male; marshes; mohammad; museum; natural; naumanni; parts; peregrine; province; road; saker; sheikhly; species; specimens; status; study; table; tail; tinnunculus; voucher; white cache: binhm-507.pdf plain text: binhm-507.txt item: #205 of 297 id: binhm-508 author: Hassan, Feyroz Ramadan title: SURVEY OF PREDATOR AND PARASITOID INSECTS IN DUHOK PROVINCE, KURDISTAN REGION, IRAQ date: 2021-06-20 words: 4882 flesch: 44 summary: (2) Family, Carabidae Latreille, 1802 Subfamily, Carabinae Latreille, 1802 Calosoma sp. Material examined: 1 specimen, Summel District, Summel Center, April 2014 on soil. Subfamily, Scymninae Mulsant, 1846 Scymnus syriacus Marseul, 1868 Material examined: One specimen, Summel District, Summel Center; June 2013 on apricot trees infested with aphid. keywords: 2015; africa; akrawi; algeria; april; arabia; assaf; belgium; bijel; bulgaria; center; china; croatia; cyprus; czech; distribution; district; duhok; egypt; et al; eulecanium; family; fig; france; general; general distribution; germany; ghahari; greece; hassan; host; hungary; hymenoptera; india; insects; iran; iraq; islands; israel; italy; journal; june; latreille; linnaeus; materials; natural; netherlands; new; palearctic; parasitoid; plants; poland; predator; region; republic; romania; russia; saudi; south; spain; species; specimens; summel; survey; switzerland; syria; tomato; trees; tunisia; turkey; turkmenistan; ukraine; uzbekistan cache: binhm-508.pdf plain text: binhm-508.txt item: #206 of 297 id: binhm-51 author: Reshag, Ali F.; Hadi, Ilaf Hassan; Mohammed, Hadaf H. title: MORPHOLOGICAL AND HISTOCHEMICAL STUDY OF HARDERIAN GLAND OF DOMESTIC PIGEON (COLUMBA LIVIA DOMESTICA) date: 2016-12-01 words: 2747 flesch: 64 summary: There were no differences in Harderian gland in both sexes. Key word: Columba, Harderian gland, Histochemical study, Russell bodies, Pigeon. keywords: acid; ali; altunay; anatomy; arrow; aydin; birds; blue; bodies; burns; cells; central; columnar; connective; different; domestic; duck; duct; et al; figure; fowl; gland; harderian; harderian gland; histochemical; histological; histology; journal; kozlu; maxwell; microscopic; morphological; orbital; periodic; pigeon; plasma; positive; red; reshag; results; russell; schiff; secretory; section; structure; study; tissue; veterinary; wight cache: binhm-51.pdf plain text: binhm-51.txt item: #207 of 297 id: binhm-510 author: Najim, Shurooq Abdullah; Al-Fayyadh, Mustafa Jawad title: FIRST RECORD OF OPILIO KAKUNINI SNEGOVAYA, COKENDOLPHER & MOZAFFARIAN, 2018 (ARACHNIDA, OPILIONES, PHALANGIIDAE) FROM IRAQ date: 2021-06-20 words: 1936 flesch: 68 summary: ♦Corresponding author: shurooq.najim@uobasrah.edu.iq Received Date: 06 January 2021, Accepted Date: 20 March 2021, Published Date: 20 Jun 2021 ABSTRACT The species of Opilio kakunini Snegovaya, Cokendolpher & Mozaffarian, 2018 was recorded for the first time in Iraq; as well as to four species belonging to this order which were recorded previously. Digital images of both male and female habitus, genitalia and brief comments are provided regarding the identification of Opilio species in Iraq. keywords: 2018; body; cokendolpher; date; denticles; dorsally; fauna; fayyadh; femur; glans; iraq; kakunini; leg; length; long; male; mozaffarian; najim; opilio; opiliones; pedipalp; phalangiidae; record; region; setae; shape; small; snegovaya; species; specimens; tibia; view cache: binhm-510.pdf plain text: binhm-510.txt item: #208 of 297 id: binhm-511 author: Haloob, Ali; Al-Musawi, Ali H. E.; Adeel, Harb title: SPERGULARIA IRAQENSIS (CARYOPHYLLACEAE), A NEW SPECIES FROM IRAQ date: 2021-06-20 words: 2627 flesch: 71 summary: Interestingly, only S. media in Iraq has 10 stamens, also S. rubra which grows in Turkey has 10 stamens, however, the capsule of S. media longer than 7 mm, as well as, S. rubra has capsules longer than 4 mm which differ from the shorter capsule of S. iraqensis, S. dinandra and S. bocconei which could reach less than 2.5 mm but S. dinandra and S. bocconei have androecium with less than 8 stamens and the stipules of these species are not acuminate which differ from S. iraqensis androecium and stipules (Gorshkova, 1936; Monnier and Ratter, 1964; Ratter, 1967; Ratter, 1980; Dequan and Rabeler, 2001; Townsend et al., 2016). Conservation status There are numbers of threats in the areas where the species grows, the most important of which are grazing, agriculture, tourism, and urban activities, as well as, the geographical range of S. iraqensis restrict to a narrow region estimated to about 2,000 km2. keywords: acuminate; apex; baghdad; bocconei; bracts; brown; capsule; caryophyllaceae; dense; diandra; flora; glabrous; glandular; green; hair; haloob; inflorescence; iraq; iraqensis; leaves; length; light; long; ovate; plant; presl; purple; ratter; rubra; sepals; shorter; species; spergularia; stamens; stipules; vol; white; yellow cache: binhm-511.pdf plain text: binhm-511.txt item: #209 of 297 id: binhm-512 author: Samalehu, Herfien; Idrus, Arifudin; Sukadana, I Gede title: ORE GENESIS AND MINOR ELEMENTS OF OROGENIC GOLD DEPOSIT AT TAMILOUW– HAYA, SERAM ISLAND, INDONESIA date: 2021-06-20 words: 7397 flesch: 55 summary: (2001) revealed that Orogenic gold deposits are related to collision settings and active orogenic belts. Distribution, character, and genesis of gold deposits in metamorphic terranes, In: Hedenquist, J. W., Thompson, J. F. H., Goldfarb, R. J. and Richards, J. P. (eds). keywords: alteration; analysis; area; assemblage; australian; average; banda; chalcopyrite; chemistry; colour; contents; covellite; deposit; detection; eds; edx; elemental; elements; et al; formation; galena; gangue; genesis; geological; geology; goethite; gold; goldfarb; grade; groves; haya; hematite; high; higher; hydrothermal; indonesia; intergrowth; island; late; limit; low; lower; malachite; mapping; marcasite; metamorphic; metamorphosed; micro; mineralization; minerals; minor; minor elements; northern; ore; orogenic; orogenic gold; paragenetic; process; pyrite; pyrrhotite; quartz; ratios; rocks; samalehu; samples; sedimentary; sem; seram; shows; size; skarn; sphalerite; study; subhedral; sulawesi; sulphide; table; tamilouw; temperature; tennantite; tetrahedrite; texture; tjokrosapoetro; tmw; type; veins; wae; wt.%; xrf cache: binhm-512.pdf plain text: binhm-512.txt item: #210 of 297 id: binhm-513 author: Pazilov, Abduvaiet P.; Umarov, Farrukh U. title: ON THE ECOLOGY AND SPECIES DIVERSITY OF THE FRESHWATER GASTROPODS OF SPRINGS IN ANDIJAN REGION, UZBEKISTAN date: 2021-06-20 words: 4616 flesch: 60 summary: Their selection took into account the constant availability of spring water and its richness in hydrobionts. Table (1): Hydrochemical characteristics of spring water in Andijan region. keywords: acuta; alchalik; andijan; andijan region; aquatic; auricularia; bibi; biodiversity; brevicula; bucharica; bulak; central; common; ecological; ecology; fauna; fergana; freshwater; gastropods; genus; hissarica; imam; index; izzatullayev; kukbulak; lacustris; ladacensis; mollusks; ota; pazilov; planorbis; region; russian; seshanba; shirmonbulak; species; springs; starobogatov; study; tangitarensis; uchbulak; umarov; uzbekistan; valley; water; zhadin cache: binhm-513.pdf plain text: binhm-513.txt item: #211 of 297 id: binhm-514 author: Al-Nuaimi, Israa Sabah; Al-Badrani, Omar Ahmed title: CALCAREOUS NANNOFOSSILS BIOSTRATIGRAPHY OF JADDALA FORMATION IN WELL (AJEEL-10), CENTRAL IRAQ date: 2021-06-20 words: 3586 flesch: 59 summary: 353 Al-Nuaimi and Al-Badrani Diagram (3): correlated chart of calcareous nannofossils biozones for studied section 354 Calcareous nannofossils biostratigraphy of Jaddala ACKNOWLEDGMENTS We would like to thank Mosul University, College of Science, Geology Department for supporting the authors by offering laboratory to accomplish this work. Calcareous nannofossils biostratigraphy of Jaddala keywords: aged; alata; badrani; bar; biostratigraphy; biozone; blackites; bramlette; bukry; calcareous; calcareous nannofossils; chiasmolithus; cne; cristata; deflandre; discoaster; early; eocene; et al; family; formation; genus; gigas; hay; helicosphaera; interval; iraq; jaddala; journal; light; lutetian; martini; micron; middle; mohler; nannofossils; nannoplankton; nannotetrina; nielsen; nuaimi; occurrence; perch; photos; plate; polarized; pontosphaera; range; scale; section; significant; sphenolithus; stradner; study; sublodoensis; sullivan; taxa cache: binhm-514.pdf plain text: binhm-514.txt item: #212 of 297 id: binhm-515 author: Waly, Nahed; Moustafa, Heba; Hamdy, Rim; Soliman, Ashraf title: MULTIVARIATE ANALYSIS OF THE STEM ANATOMICAL CHARACTERS OF TERMINALIA L. (COMBRETACEAE) IN EGYPT date: 2021-06-20 words: 7619 flesch: 60 summary: 366 Multivariate analysis of the stem Plate (1): Diagnostic features in Terminalia species; (A) Trichomes in T. brownii; (B) Lenticel in T. muelleri; (C) Druses in T. arjuna; (D) Clustered crystals filling large idioblasts in T. catappa; (E) Tannins in T. laxiflora; (F) Tylosis in T. mantaly. 367 Waly et al. Plate (2): Diagnostic features in Terminalia species; (A-C)intercellular canals lysogenous ducts; (A) 3 ducts in T. myriocarpa; (B)4 ducts in T. arjuna; (C) 5 ducts in T. muelleri; (D)septatefibres(Sf) in T. muelleri; (E) non- septatefibres (nsf) in T. brownii. keywords: 2018; abbreviations; aliform; analysis; anatomical; anatomical characters; anatomy; axial; axial parenchyma; banded; cairo; cells; characters; chebula; cluster; combretaceae; confluent; cortex; crystals; diameter; ducts; egypt; elements; et al; features; fiber; frequency; garden; genus; giza; hamdy; height; indian; journal; key; length; longitudinal; lumina; lysogenous; maximum; mean; moustafa; multivariate; number; paratracheal; parenchyma; pca; phloem; pith; plant; plate; present; quantitative; ray; rays; scanty; secondary; section; septate; sharma; singh; species; stem; studied; study; t. arjuna; t. bellerica; t. bentzoe; t. brownii; t. catappa; t. chebula; t. laxiflora; t. mantaly; t. muelleri; t. myriocarpa; taxonomic; terminalia; terminalia species; thickness; thin; transverse; trichomes; type; uniseriate; van; variation; varied; vasicentric; vessels; wall; walled; waly; way; wood cache: binhm-515.pdf plain text: binhm-515.txt item: #213 of 297 id: binhm-516 author: Al-Yacoub, Ghassan A. Ali; Al-Abbad, Murtatha Y. M.; Kareem, Dhia K. title: REDESCRIPTION OF SCORPIO KRUGLOVI (BIRULA, 1910) (SCORPIONES, SCORPIONIDAE) FROM THI QAR PROVINCE, SOUTH OF IRAQ date: 2021-06-20 words: 2410 flesch: 66 summary: 391 Al-Yacoub et al. Map (1): Showing sample collection site in Thi Qar province, southern of Iraq (Available at: https://www.humanitarianresponse.info/en/operations/iraq/infographic/iraq- thi-qar-governorate-reference-map-2020-en) RESULTS AND DISCUSSION Family: Scorpionidae (latreille, 1802) Scorpio kruglovi (Birula, 1910) Synonyms: Scorpio maurus (Linnaeus, 1758) Type locality and repository: While Ahmed (2015) recorded it as a subspecies, Scorpio maurus kruglovi (Birula, 1910) in Erbil Province, Northern Iraq. Distribution outside Iraq: Kuwait, Saudi Arabia, Iran, Syria, Jordan, Qatar and Turkey (Fet 2000, Navidpour 2019, El-Hennawy 1992 and Talal et al., 2015). keywords: 2015; ahmed; arachnida; azawi; birula; brown; dorsal; et al; fauna; hussen; iraq; kachel; kruglovi; length; male; maurus; metasoma; navidpour; new; pedipalp; plate; province; qar; redescription; review; scorpio; scorpiones; scorpionidae; southern; species; specimens; teeth; thi; tooth; trichobothria; ventral; yacoub cache: binhm-516.pdf plain text: binhm-516.txt item: #214 of 297 id: binhm-52 author: Abdul-Rassoul, M. S.; Mallo, I. M. title: FIRST RECORD OF NIGRA SCALE, PARASAISSETIA NIGRA (NIETNER, 1861) (HEMIPTERA; COCCIDAE) AS A PEST OF FIG TREES IN IRAQ date: 2016-12-01 words: 2059 flesch: 64 summary: The aim of this study was to determine the occurrence of nigra scale, Parasaissetia nigra for the first time on the fig tree in Iraq. The order Coleoptera was represented by the highest number of species (18 species), followed by Hemiptera (10), Acarina (5), Lepidoptera (3), Diptera (1), and Thysanoptera (1) among which 7 were scale insects (Al-Ali, 1977). keywords: abdul; agriculture; april; baghdad; ben; bulletin; coccidae; coccoidea; district; dov; fig; hemiptera; homoptera; hurriyah; i.m; insects; iraq; leaves; m.s; mallo; ministry; nietner; nigra; nigra scale; parasaissetia; parasaissetia nigra; pest; plant; plate; production; rassoul; record; scale; setae; smith; soft; species; trees; world cache: binhm-52.pdf plain text: binhm-52.txt item: #215 of 297 id: binhm-53 author: Haloob, Ali title: A NEW RECORD OF ZIZIPHORA SPECIES (LAMIACEAE) FOR IRAQ date: 2016-12-01 words: 1138 flesch: 65 summary: The morphological characters, habitat and geographical distribution of the species with a key to Ziziphora L. species in Iraq have been provided. 180 A new record of Ziziphora species TAXONOMIC TREATMENT Ziziphora persica Bunge, Labiat. keywords: apex; bracts; bull; capitata; clinopodioides; dense; distribution; figure; flora; iraq; lanceolate; long; new; ovate; persica; rech; record; species; study; subsp; taxa; tenuior; ziziphora cache: binhm-53.pdf plain text: binhm-53.txt item: #216 of 297 id: binhm-54 author: Awadh, Salih Muhammad title: OUTSTANDING UNIVERSAL VALUES OF THE SAWA LAKE AS A WORLD NATURAL HERITAGE date: 2018-10-09 words: 4043 flesch: 57 summary: The physio - chemical characteristic of Sawa Lake water in Samawa city- Iraq. Key words: Sawa Lake; Natural Heritage; outstanding values; chemical process INTRODUCTION The Sawa Lake is a one lake with specific characteristics among Iraqi lakes; it is located about 23 km to the west of Al-Samawah governorate, southern Iraq. keywords: adjacent; aesthetic; algae; area; average; awadh; barrier; beauty; chemical; conservation; criteria; criterion; cultural; development; dissolution; diversity; environment; euphrates; features; figure; fish; formation; geological; geomorphic; groundwater; gypsum; heritage; importance; iraq; lake; land; landforms; level; limestone; masses; muhammad; muslim; natural; natural heritage; outstanding; outstanding universal; physiographic; precipitation; processes; salih; sawa; sawa lake; science; sea; sediments; significant; sites; species; study; surface; total; universal; universal values; values; wall; water; world; على cache: binhm-54.pdf plain text: binhm-54.txt item: #217 of 297 id: binhm-56 author: Aziz, Farhad Hasan; Rasoul, Balqis Haji title: THIRTY TWO ALGAE NEW RECORDS REPORTED IN PONDS AT GWER SUB-DISTRICT, ERBIL -KURDISTAN REGION, IRAQ date: 2018-10-09 words: 3665 flesch: 73 summary: Non-diatom algae were identified with the help of available literature (Smith, 1950; Desikachary, 1959; Prescott, 1970; Lind and Brook, 1980; Bold and Whyne, 1985; Bando et al., 1989; Komarek and Anagnostidis, 2005; John et al., 2011). Acta (Pl. 3, Fig. i1, 2) Vegetative cells capitellate, 7-13µ in diameter, 20 -55 µ long; basal cell elongate; terminal cell obtuse or truncate, Oogonium single, 26-30 µm in diameter, 23-33µm long. keywords: algae; anagnostidis; apical; apices; area; aziz; blue; british; cells; chloroplasts; constricted; diameter; diatoms; district; ellipsoid; end; ends; erbil; farhad; fig; flora; green; gwer; haji; hasan; iraq; john; komarek; kurdistan; kutzing; lavoie; long; margin; new; oedogonium; plane; ponds; rasoul; records; region; rounded; salahaddin; sci; semi; small; solitary; species; spirogyra; straight; striae; study; sub; total; trichomes; u.s.a; university; valves; walls; water; west; wide; الطحالب cache: binhm-56.pdf plain text: binhm-56.txt item: #218 of 297 id: binhm-57 author: Mohammad, Mohammad K. title: IXODIOD TICK FAUNA INFESTING SHEEP AND GOATS IN THE MIDDLE AND SOUTH OF IRAQ date: 2016-07-01 words: 2729 flesch: 69 summary: Tick infestation may leads to infestations with Babesia, Thaleria, Rickettesia and many viral diseases causing severe losses in regard to their meat, milk and skin or even animal's death (Ameen et al., 2012). Table 1: tick fauna structure according to developmental stages of ixodid ticks infestations in sheep and goats. keywords: animals; baghdad; bull; distribution; domestic; et al; fauna; goats; hasson; hist; hyalomma; incidence; infestation; infesting; iraq; ixodid; ixodoidea; j.m; m.k; med; middle; mohammad; mus; nat; province; rates; rhipicephalus; robb; robson; sheep; shubber; south; species; study; ticks; turanicum; university cache: binhm-57.pdf plain text: binhm-57.txt item: #219 of 297 id: binhm-58 author: Aziz, Farhad Hasan; Qadir, Srwa Burhan title: COMMON AND NEW RECORDS OF LICHENS FROM IRAQI KURDISTAN REGION, IRAQ date: 2018-10-09 words: 4620 flesch: 73 summary: Lichens identification and classification: Identification of lichen species have been done as proposed by lichenologists (Hall,1979; Goward et al., 1994; Purvis et al., 1992; Purvis; 2000; Brodo et al., 2001; Aziz, 2004; Aziz, 2005 and Dobson, 2005). 61 Farhad H. Aziz and Srwa B. Qadir Plate (1): New records of lichen species at studied locations. keywords: ach; air; apothecia; area; areoles; aspicilia; aziz; black; brodo; brown; caloplaca; common; convex; dark; diam; diameter; district; dobson; erbil; farhad; flat; flora; governorate; goward; green; grey; hale; humidity; iraq; isidia; kurdistan; lecanora; lichens; light; like; lobes; locations; lower; margins; mountain; nash; new; orange; pale; pertusaria; pl.1; pl.2; pl.3; pl.4; pl.5; plate; prothallus; qadir; records; region; rhizocarpon; salahaddin; smooth; soil; species; spores; srwa; study; surface; thallus; thick; thin; verrucaria; village; white; wide; yellow cache: binhm-58.pdf plain text: binhm-58.txt item: #220 of 297 id: binhm-59 author: Ismail, Muna M.; Naser, Rabab A.; Muhammed, Hanin A. title: STUDY THE EFFECT OF DIFFERENT TYPES OF STRESS ON SOME BLOOD CONSTITUENTS AND PLASMA BIOCHAMICALS IN MALE RATS date: 2016-07-01 words: 2576 flesch: 49 summary: Handling stress group: On the third day of stress the animals anesthetized for blood collection; the results of blood component revealed a significant increase in PCV and a significant decrease in Hb of water deprivation group and starvation group respectively. keywords: adrenal; albumin; animals; axis; biochemical; blood; body; cholesterol; concentration; control; cortisol; decrease; deprivation; different; effect; food; gland; glucose; group; handling; hormone; hypothalamus; increase; ismail; male; overcrowding; parameters; physiology; pituitary; plasma; protein; rats; response; results; significant; starvation; stress; stressor; study; system; threat; total; triglycerides; types; volume; water; water deprivation; الدم cache: binhm-59.pdf plain text: binhm-59.txt item: #221 of 297 id: binhm-60 author: Al-Zubaidi, Aqeel Abbas; Jan, Sadi Kan title: EARTH SURFACE PROCESSES AND LAND FORMS OF SOUTH WEST RAZZAZA LAKE-CENTRAL IRAQ date: 2016-07-01 words: 3915 flesch: 66 summary: الرباعي ، والجروف الصخرية، التعروية، مثل الهضاب الكبيرة والمتوسطة، والتالل -الوحدات التركيبية -1 وحدات حركة -3. الصحراوي، وصخور شبيهة الفطر الوحدات التعروية، مثل البالط -2. On the top of plateau sand sediments trapped by Haloxylon salicornicum to form trapped and shadow dunes in addition to sand sheet, thickness of mentioned sediments up to 1 meter. keywords: addition; aeolian; alluvial; alzubaidi; anthropogenic; aqeel; area; bed; bull; caves; central; claystone; cliffs; depression; desert; dibdibba; dry; earth; ephemeral; fall; fan; flood; formation; forms; geodiversity; geol; gypsum; high; hills; injana; iraq; kan; karbala; lake; land; landforms; limestone; mesas; meters; min; miocene; movement; nest; nfayil; north; origin; plain; plateau; processes; razazza; rock; sabkha; sadi; sand; sandstone; secondary; sediments; shore; sissakian; studied; study; surface; table; tar; thickness; types; units; upper; wadis; water; west; مثل; وحدات cache: binhm-60.pdf plain text: binhm-60.txt item: #222 of 297 id: binhm-61 author: Shaker, Goner A. title: ISOLATION AND IDENTIFICTION OF FUNGI INFECTING ALOE VERA PLANT date: 2016-07-01 words: 2139 flesch: 63 summary: Figure (2): Symptom of necrotic tissue formed on Aloe vera leaves, the spots often are small and enlarge and deepen. Estimation the disease incidence: The disease percentage was reported from surveys, visiting the plant garden and the nurseries cultivated with Aloe vera plants and examined the infected plants twice in onset and the end of the season. keywords: aloe; aloe vera; alternaria; aspergillus; baghdad; cladosporium; control; disease; fungal; fungi; fusarium; goner; herbarum; identification; incidence; infecting; iraq; isolated; isolation; journal; leaf; leaves; medicinal; niger; nigrospora; nurseries; oryzae; oxysporum; pathogenicity; plants; research; results; shaker; similar; solani; spots; symptoms; test; vera cache: binhm-61.pdf plain text: binhm-61.txt item: #223 of 297 id: binhm-618 author: Bannai, Majid; Mohammed Jori, Muna ; Shamsi, Shokoofeh title: MOLECULAR CHARACTERIZATION OF ANISAKID NEMATODES HYSTEROTHYLACIUM SPECIES FROM JAPANESE THREADFIN BREAM NEMIPTERUS JAPONICUS (BLOCH, 1791) (PERCIFORMES, NEMIPERIDAE) FROM IRAQI MARINE WATER FISH date: 2021-12-20 words: 6703 flesch: 52 summary: Besides the most distinguishing characters among Hysterothylacium species based on the differences in length and ratio of digestive tracts of nematodes, viz esophagus length, intestinal caecum, appendage and the ratio of each character to each other, it was noted through the follow-up of the sequence of stillness and the different order of nitrogen bases and electron microscope images that there are clear changes among the species diagnosed in the order of the lips and the installation of folds in the outer wall of the parasite. 407 Bannai et al. Nematode species In the past 30 years, comprehensive studies on marine fish parasites in Iraqi marine waters have been conducted to increase the understanding of the biodiversity of these parasites, based on the morphological structures, which have been limited to the mature stage and are few due to incomplete growth to the adult stage, and because of the abundance of larval stages targeted this group of parasites to show the diversity and genetic variation in the study region. keywords: 2004; 2018; alignment; amoyense; analysis; anisakid; anterior; arabian; area; ascaridoid; bannai; basrah; boring; cephalic; characterization; china; current; cuticle; different; diversity; dna; electron; et al; expect:0.0; extremity; fish; fishes; food; gaps; genbank; genetic; genotype; gulf; guo; host; hysterothylacium; identities; important; infection; information; iraqi; japonicus; journal; larva; length; likelihood; marine; micrograph; molecular; moravec; morphology; morphotypes; mouth; ncbi; nematoda; nematodes; nemipterus; new; opening; organs; parasites; parasitology; perciformes; present; prevalence; query; range; raphidascarididae; rdna; reference; region; results; sbjct; scanning; score; sequence; shamsi; source; species; specimens; stage; strand; studies; study; tctccgacgtgcatgccttccatgtgcgcgtatacgtgagccgcgcagcaagttgcaca; tooth; total; zhang cache: binhm-618.pdf plain text: binhm-618.txt item: #224 of 297 id: binhm-619 author: Mohammed Jihad, Hiba; Badri Ali, Hayder title: NEW RECORD OF THE LAND SNAIL POLYGYRA CEREOLUS (MEGERLE VON MÜHLFELD, 181 8 ) (GASTROPODA, STYLOMMATOPHORA, POLYGYRIDAE) FOR MALACOFAUNA OF IRAQ date: 2021-12-20 words: 1862 flesch: 64 summary: This work is licensed under a Creative Commons Attribution 4.0 International License ABSTRACT In this study, the specimens of land snails Polygyra cereolus (Megerle von Mühlfeldt, 1818) (Gastropoda, Stylommatophora, Polygyridae) are collected between March and April 2021 from gardens and nurseries in Baghdad province, this species was recorded as a new record to Iraq molluscan fauna. Land snails are poorly studied in Iraq; some records of land families, genera, and species of Iraq are available according to (Pallary, 1939; Germain, 1921; Biggs, 1959). keywords: ali; aperture; available; baghdad; cereolus; collected; date; families; family; gastropoda; identification; iraq; jihad; land; lip; megerle; molluscan; new; polygyra; polygyridae; record; seedlings; shell; snail; soil; species; specimens; study; stylommatophora; terrestrial; umbilicus; university; von; بغداد cache: binhm-619.pdf plain text: binhm-619.txt item: #225 of 297 id: binhm-62 author: Hussin, Amer M. title: STUDY ON THE EFFECT OF ROYAL JELLY OF BEES (APIS MELLIFERA) ON THE MORPHOLOGY AND SPERM FUNCTION PARAMETERS IN MICE (SWISS ALBINO) date: 2015-12-01 words: 3101 flesch: 68 summary: In the current study, the results referred to the improvement of sperm motility in the treatment group. This technique for sperm activation is characterized by direct effect of the culture medium on sperm parameters (Fig.1). keywords: 2005; activation; activity; amer; bees; concentration; control; culture; different; direct; effect; eosin; fertility; food; function; grade; groups; head; hussin; increase; iraq; ivf; jelly; journal; lengths; measurement; medium; mice; microscope; mishima; mitochondria; morphology; motility; movement; normal; parameters; present; progressive; r.j; results; royal; royal jelly; significant; sperm; sperm motility; spermatozoa; stain; study; table; tail; technique; treatment; university; التجربة; الدراسة; النطف cache: binhm-62.pdf plain text: binhm-62.txt item: #226 of 297 id: binhm-621 author: S. Majeed, Osama ; J. M. Al-Azawi, Ahmed; R. Nashaat, Muhanned title: IMPACT OF THARTHAR ARM WATER ON COMPOSITION AND DIVERSITY OF COPEPODA IN TIGRIS RIVER, NORTH OF BAGHDAD CITY, IRAQ date: 2021-12-20 words: 7852 flesch: 66 summary: R R R R R R C Ac Ac C C C 27 P. phaleratus (Koch, 1838) R R R R - - A A Ac A - - 28 Thermocyclops hyalinus (Rehberg, 1880) - - - R - R - - - A - A 29 Cyclops sp. A Ac Ac C 30 Cyclops sp. R R R R R R Ac A C C C Ac 31 keywords: 2003; 2010; 2015; 2019; 2020; abbas; abundance; abundant; ac ac; acanthocyclops; aglaodiaptomus; arm; arm water; baghdad; biology; bit; canal; chz; city; confluence; copepoda; cyclops; december; density; diagram; diversity; downstream; ectocyclops; edition; effect; environmental; et al; euphrates; evenness; fimbriatus; halicyclops; highest; immature; impact; increasing; ind./m3; index; invertebrates; iraq; january; journal; koch; lacustris; large; lowest; majeed; minimum; morales; nauplii; number; percentage; r ac; r r; rabee; results; richness; river; salinity; science; shannon; site; species; stages; study; suárez; taxa; temperature; tharthar; tharthar arm; tigris; tigris river; total; upstream; values; variations; water; winter; zooplankton cache: binhm-621.pdf plain text: binhm-621.txt item: #227 of 297 id: binhm-622 author: Zarikian, Noushig title: A SURVEY OF RUNNING CRAB SPIDERS PHILODROMIDAE (ARANEAE) OF ARMENIA date: 2021-12-20 words: 3260 flesch: 63 summary: New spider species of the Harpactea genus from Armenia (Aranei, Dysderidae). This work presents new faunistic records of Philodromidae spiders recently collected plus additional records from the NAS RA Scientific center of hydroecology and Zoology institute collections’ unpublished material. keywords: arachnida; araneae; aranei; armenia; arthropoda; caucasus; crab; current; description; distribution; epigyne; fauna; genus; global; habitat; koch; logunov; material; mikhailov; new; philodromidae; philodromus; province; record; salticidae; selecta; simon; species; specimens; spiders; study; survey; thanatus; walckenaer; yerevan; zarikian; zoology cache: binhm-622.pdf plain text: binhm-622.txt item: #228 of 297 id: binhm-623 author: Gaafar, Ali; Abd El-Ghani, Monier ; El Hadidy, Azza ; Hussein, Ethar title: A MULTIVARIATE MORPHOMETRIC ANALYSIS OF THE GENUS LOTUS L., 1753 (FABACEAE, LOTEAE) FROM EGYPT date: 2021-12-20 words: 9861 flesch: 67 summary: Pedrosia Pedrosia A 2 L. edulis L. L. edu A 5 L. peregrinus L. L. pere Lotus Lotea keywords: 2003; 2006; abbreviations; analysis; arabicus; axes; axis; botany; cairo; calyx; cardinal; characters; classification; cluster; coefficient; components; continuous; creticus; ctu; data; diagram; different; egypt; end; erythrolotus; et al; fabaceae; flora; flowers; gaafar; genus; ground; groups; highest; iii; jensen; journal; kramina; l. l.; leaflet; leguminosae; length; lll; llw; loteae; lotus; lotus l.; lotus species; lower; mean; morphological; morphometric; multivariate; ns ns; number; numerical; pca; pcoa; phenetic; phylogenetic; pod; principal; quantitative; results; seed; shape; significant; similarity; sokal; sokoloff; species; stl; studies; study; style; table; taxa; taxonomic; taxonomy; tetragonolobus; ulw; university; upper; variations; width cache: binhm-623.pdf plain text: binhm-623.txt item: #229 of 297 id: binhm-624 author: Huy Pham, Phong ; Thi Dang, Hoa title: NEW RECORD OF THE GENUS LARRA FABRICIUS, 1793 (HYMENOPTERA, CRABRONIDAE) FROM VIETNAM date: 2021-12-20 words: 3011 flesch: 64 summary: (4-a) Larra polita polita (F. Smith, 1858) (Pl. 4) 539 Pham and Dang Larrada polita F. Smith, 1858: 102, ♀. (4-b) Larra polita luzonensis Rohwer, 1919 (Pl. 5) Larra luzonensis Rohwer, 1919: 10, ♀. keywords: amplipennis; black; body; carbonaria; carina; distance; femur; flagellomeres; fore; genus; hind; interocular; larra; long; luzonensis; malaise; male; mandible; metasomal; noi; pham; plate; polita; pygidial; red; scape; setae; smith; sparse; species; subspecies; surface; tergites; tibia; trap; vertex; vietnam; view cache: binhm-624.pdf plain text: binhm-624.txt item: #230 of 297 id: binhm-625 author: Sh. Abdurasulova, Surayyo; P. Pazilov, Аbduvaeit title: NATURE OF VARIABILITY OF CANDAHARIA LEVANDERI (SIMROTH, 1902) IN THE FERGHANA AND SURKHAN - SHERABAD VALLEYS, UZBEKISTAN date: 2021-12-20 words: 2586 flesch: 59 summary: *Corresponding author e-mail: i.kamronbek2013@mail.ru Received Date: 28 August 2021, Accepted Date: 09 November 2021, Published Date: 20 December2021 This work is licensed under a Creative Commons Attribution 4.0 International License ABSTRACT The variability of Candaharia levanderi (Simroth, 1902)(Gastropoda, Stylommatophora, Parmacellidae) in two biotopes (southern and northern slopes, the Kampirtepa gorges, the Kugitang Tau ridge) has been investigated using polymerase chain reaction (PCR) with the implementation of primers, the 18S DNA of the region is amplified, the variability (sharply differing in color) of two populations of C. levanderi is studied . After studying all the available material, it can be noted that the limits of variability of morphological features of C. levanderi were much wider than those given in the monographs of Likharev and Viktor (1980), Schileyko and Rymzhanov (2013) when describing the species. keywords: abdurasulova; biotopes; body; candaharia; climatic; color; coloration; conditions; dark; dna; gorges; gulistan; kampirtepa; kugitang; landscape; levanderi; mollusks; morphological; namangan; nature; nucleotide; pazilov; population; region; ridge; russian; sherabad; slopes; species; spots; suburbs; surkhan; tau; temperature; terrestrial; uzbekistan; valley; variability; variation; yellow cache: binhm-625.pdf plain text: binhm-625.txt item: #231 of 297 id: binhm-626 author: A. Jalil, Pshtiwan; K. Ali, Wand title: MORPHOLOGY AND MOLECULAR IDENTIFICATION OF THE LARVAL STAGE OF TWO SPECIES FROM THE GENUS CHRYSOBOTHRIS ESCHSCHOLTZ, 1829 (COLEOPTERA, BUPRESTIDAE) date: 2021-12-20 words: 4389 flesch: 54 summary: The current study investigates species limits and relationships among the recognized species occurring within the Erbil Province; mitochondrial cytochrome C oxidase (COX I) molecular analysis confirmed the monophyly of two Chrysobothris species, Ch. affinis (Fabricius, 1794) and Ch. chrysostigma (Linnaeus, 1758). Eventually, differences between Ch. affinis and Ch. chrysostigma, if recognized, will not only yield information that may help in identification of larval stages, but also actually facilitate the timing and placement of insecticides to agree with activity of economically important buprestids and reduce dangerous and overpriced control measures. keywords: 2015; abdominal; affinis; agarose; ali; anterior; apical; asperities; basal; body; branches; buprestidae; bílý; campaniform; characteristics; chrysobothris; chrysostigma; cobos; coleoptera; coxi; dense; dna; electrophoresis; erbil; eschscholtz; fabricius; flattened; gel; gene; genera; genus; groove; group; hansen; identification; inner; iraq; jalil; kurdistan; labrum; larval; length; long; longer; margin; maxillary; medial; microspinulae; molecular; morphological; morphology; plate; primer; pronotal; prosternal; proventriculus; prunus; rounded; sensilla; sensillum; seta; shaped; sharp; short; species; specimens; spiracles; stage; study; thick; thorax; times; trichosensilla; volkovitsh; wide cache: binhm-626.pdf plain text: binhm-626.txt item: #232 of 297 id: binhm-627 author: H. Al-Saffar, Hanaa; Shalan Augul, Razzaq title: SURVEY OF INSECTS IN SOME SOUTHERN IRAQI MARSHES date: 2021-12-19 words: 13299 flesch: 56 summary: Genus, Cybister Curtis, 1827 Synonyms: Alocomerus Brinck, 1945 Cybisteter Bedel, 1880 Gschwendtnerhydrus Brinck, 1945 Megadytoides Brinck, 1945 Meganectes Brinck, 1945 Melanectes Brinck, 1945 Nealocomerus Brinck, 1945 Neocybister Miller, Bergsten & Whiting, 2007 Scaphinectes Ádám, 1993 Trochalus Dejean, 1833 Trogulus Brodie, 1874 Trogus Leach, 1817 Cybister tripunctatus (Olivier, 1795) Synonyms: Cybister szechwanensis Falkenström, 1936 Dytiscus tripunctatus Olivier, 1795 Material examined: 11 specimens; 3 specimens, Maysan Province, Hawizeh Marshes, Umm An-Ni'aaj, 19.vii. 2020; 8 specimens, Thi- Qar Province, Al-Chibayish Marshes, 30.iv.2020. Genus, Hydrovatus Motschulsky, 1853 Synonyms: Hydatonychus Kolbe, 1883 Oxynoptilus Schaum, 1868 Pseudhydrovatus Peschet, 1924 Vathydrus Guignot, 1954 Hydrovatus badeni Sharp, 1882 Material examined: 3 specimens, Thi- Qar Province, Al-Chibayish Marshes, 3.vii.2020. Distribution: Iraq (Abdul-Karim, 1978). keywords: 19.vii.2020; 1919; 1994; 2002; 2005; 2006; 2010; 2012; 2016; 2018; 2019; 3.vii.2021; abdul; abdulhasan; abdulhasan et; adult; aeshna; africa; agabus; agrion; ali; amr; anax; anisoptera; anni'aaj; annotated; apis; aquatic; arabia; armenia; asia; aubé; augul; australia; available; beetles; biodiversity; boudot; brauer; brinck; bulletin; burmeister; calopteryx; catalogue; central; charpentier; checklist; chibayish marshes; china; chironomidae; chironomus; clausnitzer; coleoptera; collection; croatia; crocothemis; cueto; cyprus; darilmaz; des; diplacodes; diptera; distribution; dragonflies; dragonfly; dumont; dytiscidae; dytiscus; east; eastern; ecology; egypt; entomological; entomology; ephemeroptera; erythraea; et al; europe; fabricius; family; fauna; garstecki; gbif; genus; georgia; greece; guignot; gyrinidae; hawizeh; hawizeh marshes; heidari; hemiptera; heteroptera; history; hydroporus; hymenoptera; hájek; india; insects; iran; iraq; iraqi marshes; ischnura; israel; italy; iucn; japan; jordan; journal; kalkman; karim; kayak; kazakhstan; kieffer; kirby; klug; korea; kuwait; laccophilus; larvae; latreille; leach; lepidoptera; libellula; libellulidae; linden; lindenia; linnaeus; marshes; material; maysan; maysan province; meigen; mesovelia; morton; museum; natural; nearctic; new; ni'aaj; nilsson; north; northern; notes; october; odonata; oman; order; oriental; orthetrum; osten; pakistan; palestine; pantala; parapoynx; peninsula; province; ramadan; rambur; records; red; region; research; saffar; salah; saudi; schneider; science; secretariat; selys; sharp; southern; spain; species; specimens; stephens; study; survey; sympetrum; synonyms; syria; taiwan; tajikistan; thiqar; thiqar province; thomson; trithemis; tunisia; turić; turkey; turkmenistan; umm; usa; vander; vespa; vespidae; vietnam; walker; water; western; world; zoology cache: binhm-627.pdf plain text: binhm-627.txt item: #233 of 297 id: binhm-628 author: Saeed Al-Warid, Harith ; Saad Aldhamin, Ahmed; Ahmed Al-Moussawi, Azhar title: ACCUMULATION OF SOME HEAVY METALS IN LARVAE OF CONTRACAECUM SP. AND THEIR HOST TIGRIS CATFISH SILURUS TRIOSTEGUS HECKEL, 1843 IN BAGHDAD, IRAQ date: 2021-12-19 words: 3559 flesch: 59 summary: Checklist of fish hosts of species of Contracaecum Railliet & Henry, 1912 (Nematoda: Ascaridida: Anisakidae) in Iraq. Heavy metal concentrations in fish parasites have been discovered to be quite high, primarily in adult acanthocephalan worms, but also to a lesser extent in the adult cestodes (Aldhamin et al., 2021). keywords: 2010; 2020; accumulation; analysis; anguilla; anisakidae; aquatic; baghdad; cadmium; catfish; concentrations; contracaecum; differences; et al; females; fish; heavy; heavy metals; heckel; host; infection; intensity; intestine; iraq; journal; larvae; lead; levels; linnaeus; liver; mean; metals; mhaisen; moussawi; muscles; natural; nematoda; nematodes; number; parasites; pollution; population; silurus; species; specimens; stage; tigris; tissues; triostegus; warid; water cache: binhm-628.pdf plain text: binhm-628.txt item: #234 of 297 id: binhm-629 author: F. Al-Sheikhly, Omar ; Kryštufek, Boris ; Hutterer, Rainer ; K. Haba, Mukhtar ; A. Fazaa, Nadheer; H. Al-Asady, Ra’ad ; B. Mousavi, Sayed ; Ivajnšič, Danijel ; Lazaro, Javier title: FIRST PHOTOGRAPHIC RECORDS AND NEW DISTRIBUTION RANGE OF THE ENDANGERED LONG-TAILED NESOKIA NESOKIA BUNNII (KHAJURIA, 1981) date: 2021-12-19 words: 4173 flesch: 67 summary: However, it clearly showed the distinctive morphological features of N. bunnii and was sufficient evidence of the species’ persistence in the Mesopotamian marshes of southern Iraq since the last animal had been captured near Bani Mansor in 1977 (Kryštufek et al., 2020). This distinct rodent was known from only five voucher specimens collected at the confluence of Tigris and Euphrates Rivers in southern Iraq while its occurrence in Southwestern Iran had https://doi.org/10.26842/binhm.7.2021.16.4.0635 https://creativecommons.org/licenses/by/4.0/ 636 First photographic records never been reported. keywords: 1990s; 1991; adult; animal; asady; baghdad; basra; bunnii; cage; carcass; central; central marshes; chebaeish; corbet; december; eastern; edhe’am; et al; euphrates; feet; grey; haba; habitat; history; iran; iraq; khajuria; khuzestan; kryštufek; large; live; long; mammals; marshes; mesopotamian; morphological; muridae; museum; musser; n. bunnii; natural; nesokia; nhrcm; photographic; province; qar; qurna; records; reed; rodent; rodentia; sheikhly; sheikhly et; short; southern; southern iraq; southwestern; species; specimens; status; thi; university; world cache: binhm-629.pdf plain text: binhm-629.txt item: #235 of 297 id: binhm-63 author: Mohammad, Mohammad K.; Shubber, Habeeb W. K.; Al-Waaly, Ali B. M. title: INTESTINAL HELMINTH PARASITES OF THE EURASIAN MARSH FROG PELOPHYLAX RIDIBUNDUS (PALLAS, 1771) (AMPHIBIA: RANIDAE) COLLECTED IN AL-DIWANIYA CITY, MIDDLE OF IRAQ date: 2015-12-01 words: 2470 flesch: 63 summary: In Iraq it was recorded in the small intestines of Hyla arborea and Bufo viridis in central and northern Iraq (Al-Barwari and Nassir, 1983; Mohammad et al., 2010). (2007) and Mohammad et al. keywords: 2007; amphibians; baghdad; barwari; bufo; cestode; city; commutata; cosmocerca; cosmocercoides; digenetic; dispar; et al; fig; frog; helminth; intensity; intestinal; iraq; marsh; middle; mohammad; nematode; nematotaenia; north; parasites; pelophylax; rana; ridibundus; saeed; species; toad; trematodes; variabilis; viridis cache: binhm-63.pdf plain text: binhm-63.txt item: #236 of 297 id: binhm-65 author: Al-Barazengy, Ali N.; Salman, Adel O.; Hameed, Farah T. Abdul title: UPDATED LIST OF AMPHIBIANS AND REPTILES IN IRAQ 2014 date: 2015-12-01 words: 3759 flesch: 51 summary: NE Raid Snake, Jan’s Cliff Racer Platyceps ladacensis Perry, 2012 LC Dahl's Whip Snake Platyceps (Coluber) najadum dahlii (Fitzinger 1826) Family: Hydropfiidae LC Hook-nosed Sea Snake, Beaked Sea Snake Enhydrina schistosa (Daudin, 1803) LC Slender Sea Snake, Graceful Small Headed Sea Snake Hydrophis gracilis (Shaw, 1802) keywords: 2014; acanthodactylus; afrasiab; agama; ali; amphibians; amr; anderson; barazengy; biodiversity; blanford; boulenger; bufo; bull; center; coluber; common; conservation; desert; disi; east; eirenis; environment; et al; families; family; fingered; fringe; gecko; genera; green; haas; herpetofauna; history; iraq; iucn; jordan; leviton; linnaeus; list; lizard; mabuya; mediodactylus; middle; museum; natural; nature; new; newt; nosed; olivier; persicus; platyceps; pouyani; pseudepidalea; racer; rana; rastegar; rat; record; reptiles; research; rock; s.r; sand; skink; snake; species; subspecies; time; toad; toed; trachylepis; trapelus; turtle; viridis cache: binhm-65.pdf plain text: binhm-65.txt item: #237 of 297 id: binhm-67 author: Hassan, Wazeer Ali; Taher, Ibrahim Esa; Saido, Khadeeja Ahmed title: ANTAGONISTIC SUCCESSION OF TRICHODERMA AGAINST RHIZOCTONIAL DAMPING- OFF ON TOMATO IN COMPOSTED MEDIA date: 2015-12-01 words: 3344 flesch: 58 summary: Both substrates of mushcom consisted more cellulosic materials of wheat straw and bran thus, become highly preferred and efficiently utilized by Trichoderma due to its ability in higher secretion of chitinase, legninase, hemicellulase and cellulase enzymes (Kaviyarsan and Siva, 2007; Ali et al., 2011). Bio-control mechanisms must be independently operated in any microbial interaction (Joshi et al., 2010). keywords: ali; amendments; antagonistic; application; bio; compost; composted; container; control; damping; data; days; different; disease; effect; et al; fungi; harzianum; hassan; incidence; iraq; litter; loam; media; mushcom; mushroom; occurrence; organic; plant; red; rhizoctonia; rotations; sandy; seeds; singh; soil; solani; species; spp; strains; substrates; subtillus; succession; sugarcane; suppression; tomato; trichoderma; wheat cache: binhm-67.pdf plain text: binhm-67.txt item: #238 of 297 id: binhm-68 author: Jalili, Pariya; Eagderi, Soheil; Nasri, Manouchehr; Mousavi-Sabet, Hamed title: DESCRIPTIVE OSTEOLOGY STUDY OF ALBURNUS AMIRKABIRI (CYPRINIFORMES: CYPRINIDAE), A NEWLY DESCRIBED SPECIES FROM NAMAK LAKE BASIN, CENTRAL OF IRAN date: 2018-10-09 words: 3309 flesch: 57 summary: Since, a complete overview of the osteological characteristic of A. amirkabiri is absent; therefore, this study was 52 Descriptive ostrology of Alburnus amirkabiri conducted to provide a detailed description of its osteological features as a basis for further taxonomic researches of this species. For this purpose, eight specimens of A. amirkabiri were collected from the Qareh Chai River by electrofishing and fixed in 4% buffered formalin after anesthesia. keywords: alburnus; amirkabiri; anterior; atropatenae; bones; canal; centrum; cyprinidae; descriptive; dorsal; dorsally; eagderi; elements; et al; ethmoid; fig.2; figure; fin; fishes; foramen; frontal; genus; infra; iran; jalili; large; lateral; long; middle; orbital; orbitosphenoid; osteological; ostrology; parasphenoid; pointed; posterior; process; prootic; pterotic; rays; region; river; sabet; skeleton; small; species; specimens; sphenotic; study; supraethmoid; unbranched; ventral; view; vomer; wider cache: binhm-68.pdf plain text: binhm-68.txt item: #239 of 297 id: binhm-685 author: Soumya Ranjan Biswal; Bibhu Prasad Panda title: ALLIANCE BETWEEN BARN SWALLOW HIRUNDO RUSTICA LINNAEUS, 1758 AND INDIAN MUSTARD BRASSICA JUNCEA (L.) CZERNAJEW, 1859: A NEW INTUITION IN BIRD-PLANT ECOLOGICAL NETWORKS date: 2022-06-20 words: 4220 flesch: 58 summary: Their diet comprises beetles, ants and different flying insects like bees, wasps, moths and butterflies; barn swallows prefer larger single insects than a group of smaller prey (Ali, 2002). 5 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Biswal and Panda Plate (2): Most abundant species recoded in Indian mustard crop fields; (A) Red Avadavat Amandava amandava, (B) Zitting Cisticola Cisticola juncidis, (C) Scaly-breasted Munia Lonchura punctulata,(D) The phenomenon of hovering of many passerine species on foraging cites have been seen before but particularly Barn Swallow hovering over Indian mustard crop field was recorded for the first time. keywords: 2012; 2015; 2019; agricultural; agronomy; alliance; area; association; avian; barn; barn swallow; behaviour; bhubaneswar; birds; biswal; brassica; bulletin; crop; crop field; diversity; ecological; et al; farm; farmland; feeding; field; food; habitat; height; higher; hirundo; history; hovering; indian; indian mustard; insects; international; iraq; iraq natural; journal; juncea; linnaeus; main; multi; museum; mustard; natural; natural history; observation; ouat; panda; pattern; plant; population; pradhan; reason; research; rustica; species; study; swallow; time; tripathy cache: binhm-685.pdf plain text: binhm-685.txt item: #240 of 297 id: binhm-686 author: Abdul- Qadir Salih Khidhir; Pshtiwan Abdullah Jalil; Wand Khalis Ali title: DESCRIPTION OF THE PREDATOR BUSH CRICKET, SAGA EPHIPPIGERA FISCHER VON WALDHEIM, 1846 (ORTHOPTERA, TETTIGONIIDAE) FROM ERBIL PROVINCE, KURDISTAN REGION- IRAQ date: 2022-06-20 words: 3344 flesch: 55 summary: [CrossRef] Taylan, M. S., Mol, A., Sevgili, H. and Şirin, D. 2019. Maxillae (Pl. 2 H) moderately sclerotized, robust and elongate, pale brown colored except for galea and lacinia which brown colored, cardo small and ovoid shape; stipe big, galea tongue-like, lacinia ended with three teeth, maxillary palp provided with five segmented, and pale brown colored. keywords: 1846; abdomen; agriculture; apex; body; brown; bulletin; bush; characteristics; colored; cricket; department; description; dorsal; dorsal view; end; ephippigera; erbil; female; fischer; fore; history; iraq; iraq natural; kaltenbach; khidhir; kurdistan; lateral; like; long; male; massa; morphological; museum; natural; orthoptera; ovipositor; pale; plant; plate; pls; predator; region; saga; saginae; shaped; species; specimens; study; tettigoniidae; ventral; view; von; waldheim; şirin cache: binhm-686.pdf plain text: binhm-686.txt item: #241 of 297 id: binhm-687 author: Bibhu Prasad Panda; Manas Ranjan Sahoo title: FIRST RECORD OF SPOTTED FLYCATCHER MUSCICAPA STRIATA (PALLAS, 1764) (PASSERIFORMES, MUSCICAPIDAE) FROM ODISHA AND EASTERN GHATS OF INDIA date: 2022-06-20 words: 1395 flesch: 61 summary: On the first day of sighting we misidentified this species as Asian Brown Flycatcher Muscicapa dauurica (Pallas, 1811); but after seeing the photographs, we realised that this is an individual of Spotted Flycatcher M. striata. ♦Corresponding author E-mail: bibhuprasadpanda14@gmail.com Received Date: 24 Dec. 2021, Accepted Date: 03 February 2022, Published Date: 20 June 2022 This work is licensed under a Creative Commons Attribution 4.0 International License ABSTRACT This note reported the first record of Spotted Flycatcher Muscicapa striata (Pallas, 1764) (Passeriformes, Muscicapidae) from the state of Odisha, India. keywords: bird; birdlife; brown; bulletin; count; distribution; eastern; flycatcher; ghats; history; india; international; iraq; muscicapa; museum; natural; odisha; pallas; passeriformes; record; sahoo; species; spotted; striata; western; الهند cache: binhm-687.pdf plain text: binhm-687.txt item: #242 of 297 id: binhm-688 author: Amal Hussein Abdullah; Radhi F. Al-Jassany title: REVISION OF THE GENUS CHLAENIUS BONELLI, 1810 (COLEOPTERA, CARABIDAE), WITH A NEW RECORD SPECIES FROM IRAQ date: 2022-06-20 words: 3735 flesch: 51 summary: Chlaenius syriacus Chaudoir, 1876 Synonyms: Chlaeniellus koenigi (Semenov, 1888) Chlaenius vestitus (Paykull, 1790) Synonyms: Agostenus vestitus (Paykull, 1790) 40 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Revision of the genus Chlaenius Carabus dubius Hoppe, 1796 Carabus marginatus Linnaeus, 1767 Carabus vestitus Paykull, 1790 Chlaeniellus vestitus (Paykull, 1790) Chlaenius coerulescens J.Sahlberg, 1903 Chlaenius distinctus Chaudoir, 1856 Chlaenius oreteus Ragusa, 1881 Chlaenius viridipunctatus Bedel, 1879 World distribution: Iraq (Ali, 1966); Albania, Argentina, Australia, Bulgaria, Costa Rica, France, Germany, Greece, Hungary, Italy, Kazakhstan, Macedonia, Turkey, Spain and India (Löbl and Smetana, 2003); Croatia, Austria, UK, Serbia, Sweden, Switzerland and Russia (GBIF Secretariat, 2021). keywords: abdullah; afghanistan; agriculture; albania; ali; andrewes; argentina; baghdad; basilewsky; beetles; bonelli; bulgaria; bulletin; carabidae; carabus; chaudoir; chlaeniellus; chlaenius; coleoptera; dejean; derwesh; dinodes; distribution; dorsal; duftschmid; elytra; epomis; female; france; gbif; genus; genus chlaenius; gory; ground; grundmann; hamifer; history; history museum; hungary; india; iran; iraq; iraq natural; italy; jassany; jeannel; kuntzen; löbl; motschulsky; museum; ménétriés; natural; natural history; new; panzer; park; pseudochlaeniellus; revision; russia; secretariat; smetana; spain; species; study; subgenus; synonyms; sénectère; tunisia; turkey; university; view; world; world distribution; yellowish cache: binhm-688.pdf plain text: binhm-688.txt item: #243 of 297 id: binhm-689 author: Faris Nejris Hassan; Yaseen Saleh Kareem; Muthanna Younus Mohammed title: SEQUENCE STRATIGRAPHY AND PALEOENVIRONMENT OF AALIJI FORMATION IN BAI HASSAN OIL FIELD IN KIRKUK PROVINCE, NORTHERN IRAQ date: 2022-06-20 words: 4190 flesch: 46 summary: Well. 55 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hassan et al. Plate (2): (A) Planktonic foraminiferal lime wackestone microfacies with micritic matrix and planktonic genus Morozovella with molded pyrite, BH.90, Depth (1250-1252m), 20x.; (B) Planktonic foraminiferal lime wackesone microfacies with micritic mass ground and Rotalia, BH.188, 20x.; (C) Lime mudstone microfacies, BH.52, Depth (1164 m), 20x.; (D) Planktonic foraminiferal lime packstone microfacies with extensive dolomitization BH.52, Depth (1175- 1176m), 20x.; (E) Planktonic foraminiferal lime packstone microfacies with planktonic foraminifera and micritic matrix, BH.188, Depth (1310m), 20x.; (F) Planktonic foraminiferal lime packstone microfacies with Morozovella affected by micritization (red arrow) and cementation (yellow arrow) and biserial (blue arrow), BH.52, Depth (1172-1173m), 40x. 56 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Sequence stratigraphy and paleoenvironment Plate (3): (A) Micritization in Planktonic foraminiferal lime wackestone microfacies (white arrows), BH.52, Depth (1157-1158m), 20x;(B-) Blocky cement in Planktonic foraminiferal lime wackestone microfacies, BH.90, Depth (1248-1249m),20x; (C) Fractures generation (white arrow) and fossils deformation (red arrows) due to mechanical compaction in Planktonic foraminiferal lime packstone microfacies, BH.52, Depth (1172-1173m), 20x; (D) Hummocky stylolite due to chemical compaction (red arrows) and cementation by blocky cement in Planktonic foraminiferal lime wackestone microfacies, BH.52, Depth (1180m), 20x; (E) Deformed planktonic foraminifera with diagenetic features include fracturing due to mechanical compaction (red arrow), cementation (blue arrow), silicification (grey arrow), and precipitation of authigenic minerals of pyrite (yellow arrows) and glauconite (white arrow) in Planktonic foraminiferal lime wackestone microfacies, BH.138, Depth (1604 m), 40x; (F) Benthic foraminifera with a euhedral crystal of dolomite in Planktonic foraminiferal lime wackestone microfacies, BH.138, Depth (1604 m), 40x; (G) Silicification (yellow arrow) and pyritization (red arrow), BH.52,Depth (1153-1154 m), 20x.; (H) Silicification (yellow arrow) and glauconite (white arrow), BH.138, Depth (1604m), 40x. Two microfacies association were distinguished in the studied succession each representing a distinct depositional environment; they include deep sea and deep shelf environments as shown below: Deep shelf environment This environment is represented by two microfacies; planktonic foraminiferal lime wackestone microfacies, and planktonic foraminiferal lime packstone microfacies. keywords: 20x; aaliji; aaliji formation; addition; age; arabian; arrow; association; bathyal; benthonic; bh.138; bh.52; bulletin; carbonate; cretaceous; deep; depositional; depth; environment; field; flooding; foraminifera; foraminiferal lime; formation; geology; glauconite; grains; hassan; history; history museum; hst; iraq; iraq natural; lime; lower; matrix; maximum; mfs; microfacies; middle; morozovella; mudstone; museum; natural; natural history; northern; oil; outer; paleocene; paleoenvironment; planktonic; planktonic foraminiferal; plate; pyrite; red; sb1; sea; sequence; shelf; skeletal; stratigraphy; study; surface; system; tract; tst; university; upper; upward; wackestone; wells cache: binhm-689.pdf plain text: binhm-689.txt item: #244 of 297 id: binhm-69 author: Al-Barazengy, Ali N. title: FIRST OBSERVATIONS ON Phrynocephalus maculatus longicaudatus Haas, 1957 (SQUAMATA: SAURIA: AGAMIDAE) IN IRAQ date: 2015-07-01 words: 1996 flesch: 66 summary: Phrynocephalus maculatus longicaudatus Haas, 1957 diagnosed depending on Haas (1957), Leviton et al. Phrynocephalus maculatus maculatus Anderson, 1872 distributed the Central Plateau of Iran, at elevations from 500-3000 meters east through southern Afghanistan and Baluchistan as far as Nushki, Pakistan, and Phrynocephalus maculatus longicaudatus Haas, 1957 is found along the gulf coast of Saudi Arabia Leviton et al. (1992) and Anderson (1999). keywords: ali; amphibians; anderson; area; barazengy; canon; city; dark; desert; dorsal; east; eastern; haas; head; iraq; lake; longicaudatus; maculatus; muthanna; observations; photographs; phrynocephalus; posterior; province; reptiles; sandy; sawa; scales; south; species; tail; view; west cache: binhm-69.pdf plain text: binhm-69.txt item: #245 of 297 id: binhm-690 author: Hayder M. Al-Rammahi; Mohammad K. Mohammad title: BIRDS OF CONSERVATION CONCERN AT AL-NAJAF DESERT, SOUTHERN DESERT OF IRAQ date: 2022-06-20 words: 8110 flesch: 59 summary: Table (3): Threatened bird species, recording sites, date of observations and number of observed birds in Al-Najaf Desert during 2018-2020 . It is concluded that Al-Najaf desert is a region of top priority area for biodiversity conservation as it hosts large number of threatened bird species. keywords: 2012; 2017; 2018; 2019; abed; abu; accipitridae; accipitriformes; allouse; aquila; arabian; area; august; azawi; bahr; biodiversity; birdlife; birds; breeding; bulletin; bustard; change; chlamydotis; climate; concern; conservation; dam; data; date; decline; depression; desert; distribution; dove; eagle; east; egyptian; endangered; environment; et al; faidhat; falcon; field; grey; habitat; history; history museum; hunting; illegal; international; iraq; iraq natural; iucn; journal; lanius; large; linnaeus; list; local; macqueen; main; marbled; marmaronetta; marshes; migrant; mohammad; museum; museum al; museum birds; najaf; najaf al; najaf desert; natural; natural history; neophron; north; numbers; nummularia; order; percnopterus; population; presence; present; prey; rammahi; range; raptors; rare; red; saker; salim; sheikhly; shrike; sites; southern; species; status; streptopelia; study; table; teal; threats; trapping; trees; valley; vulnerable; vulture; wadi; wadi al; water; wide; winter; world; ziziphus cache: binhm-690.pdf plain text: binhm-690.txt item: #246 of 297 id: binhm-691 author: Rajaa Abdulrazzaq Al Anbagi; Talib Owaid Al-Khesraji title: MORCHELLA CONICA PERS., 1818 (PEZIZALES, MORCHELLACEAE): A NEW RECORD FROM IRAQ date: 2022-06-20 words: 4839 flesch: 57 summary: (accession numbers MN462953 and MN462952), M. importuna M. Kuo, O‘Donnell & T.J. Volk, and M. esculenta (L.) Pers. In: Innis, M. A., Gelfand, D. H., Sninsk, M. J. J. and White, T. J. (eds.), PCR protocols: A guide to methods and applications. keywords: 2012; 2016; accession; al anbagi; analyses; anbagi; biology; black; bodies; bulletin; clade; conica; current; data; different; distribution; dna; edible; elata; esculenta; et al; features; forest; fungal; fungi; genbank; genus; high; history; identification; international; iraq; iraq natural; journal; khesraji; kuo; m. conica; macrofungi; masaphy; molecular; morchella; morchella conica; morchellaceae; morels; morphological; museum; museum al; mushroom; mycologia; natural; new; north; o’donnell; pers; pezizales; phylogenetic; plant; present; research; results; sequences; similarity; soil; species; specimens; studies; study; suliamaniya; tree; true; university; white; النوع cache: binhm-691.pdf plain text: binhm-691.txt item: #247 of 297 id: binhm-692 author: Abduvaeit P. Pazilov; Farrukh U. Umarov title: CONCHOLOGICAL VARIABILITY OF TERRESTRIAL MOLLUSK CHONDRULOPSINA FEDTSCHENKOI (ANCEY, 1886) (GASTROPODA, PULMONATA, ENIDAE) FROM THE ZARAFSHAN RANGE, UZBEKISTAN date: 2022-06-20 words: 3262 flesch: 57 summary: Population variability of conchological traits of Ch. fedtschenkoi were studied from 3 populations of the Zarafshan Range (Urgutsoy Gorge - 39°22'27.6N 106 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Conchological variability of terrestrial mollusk 67°14'23.1E; the vicinity of the Gissarak Reservoir - 39°01'58.3N 67°13'17.7E; Ingichka-Irmak Gorge - 39°12'27.1N 67°20'39.2E). https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home Online ISSN: 2311-9799 Print ISSN: 1017-8678 https://doi.org/10.26842/binhm.7.2022.17.1.0103 https://orcid.org/0000-0002-2587-1377 https://orcid.org/0000-0003-3530-1500 https://creativecommons.org/licenses/by/4.0/ https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home 104 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Conchological variability of terrestrial mollusk keywords: altitude; ancey; aperture; bulletin; central; characters; chondrulopsina; color; conchological; conditions; developed; factors; features; fedtschenkoi; gastropoda; gissarak; gorge; height; history; ingichka; iraq; irmak; level; living; mollusks; museum; natural; pazilov; population; pulmonata; range; reservoir; russian; schileyko; sea; shell; teeth; terrestrial; traits; umarov; university; uzbekistan; variability; vicinity; width; zarafshan cache: binhm-692.pdf plain text: binhm-692.txt item: #248 of 297 id: binhm-693 author: Maysoon Hassan Meshjel title: NEW RECORDS OF GASTROTRICHA FROM THE MAIN OUTFALL DRAIN, SOUTH OF BAGHDAD, IRAQ date: 2022-06-20 words: 3897 flesch: 56 summary: A phylogenetic approach to species delimitation in freshwater Gastrotricha from Sweden. For instance, Brunson (1950, 1949) and Robbins (1965, 1973) constructed an important classification scheme and illustrated keys for identifying freshwater species of North America; d’Hondt (1971) introduced a key that is particularly dedicated to the species of Lepidodermella; Kisielewski (1987) defined the most important features that have to be taken into consideration upon the diagnosis Gastrotricha species based on morphology ; Kisielewski (1990,1991) presented a clarification of the most essential attributes in gastrotrich systematics; Balsamo and Todaro (2002) published illustrated keys for the classification of all known freshwater species worldwide; Kånneby et al. keywords: 1950; 1980; anomalous; april; august; auritum; baghdad; balsamo; biology; body; brunson; bulletin; chaetonotidae; chaetonotus; danovaro; december; density; drain; edmondson; freshwater; furca; gastrotricha; head; highest; history; ichthydium; ind; iraq; iraq natural; kisielewski; kånneby; length; lepidodermella; main; marine; meiofauna; meshjel; months; museum; natural; new; outfall; oxygen; phylum; records; scales; species; spines; squamata; study; todaro; total; worms cache: binhm-693.pdf plain text: binhm-693.txt item: #249 of 297 id: binhm-694 author: Zainab Abid Aun Ali; Hadeel M. Habeeb; Liqaa A. Jazaa title: MORPHOLOGICAL, ANATOMICAL AND CHEMICAL STUDY OF AN EXOTIC PLANT JATROPHA INTEGERRIMA JACQ. 1763 (EUPHORBIACEAE) IN IRAQ date: 2022-06-20 words: 3392 flesch: 55 summary: Plate (1): Jatropha integerrima; (A) Anthers dehiscent within the floral bud, (B) Broken part showing the white latex substance. Plate (2): Different view of Jatropha integerrima leaves; (A1and A2) Leaf with dental blade margin, (B1and B2): Leaf with entire blade margin, (C) Blade apex, (D) Blade base, (E) The two sides of the ovate leaves, (F) The base of main veins of abaxial surface. keywords: 2015; 5.april.2022; acetate; active; ali; alkaloids; analysis; anatomical; apex; blade; bulletin; cells; chemical; compound; current; different; eflora; euphorbiaceae; exotic; extract; female; flavonoids; flowers; gardens; history; integerrima; iraq; jacq; jatropha; jatropha integerrima; journal; leaf; leaves; light; main; margin; methanol; morphological; museum; natural; ovary; pax; petals; phytochemical; plant; plate; presence; qualitative; reagent; red; screening; species; study; tlc; value cache: binhm-694.pdf plain text: binhm-694.txt item: #250 of 297 id: binhm-70 author: Ali, Hussain Zaydan title: GEOSTATISTICAL ANALYSIS AND MAPPING OF OZONE OVER IRAQ date: 2015-07-01 words: 3372 flesch: 53 summary: This study aimed to determine the best method (lowest cross validation error) for interpolating the spatial distribution of ozone data over Iraq. 17 Hussain Zaydan Ali Since a strong spatial dependence between ozone data is observed, the geostatistical algorithms, particularly the ordinary kriging, provide accurate estimates, as cross validation confirmed. keywords: air; analysis; analyst; average; best; concern; cross; data; distance; distribution; error; esri; experimental; fig; function; geostatistical; gis; global; ground; high; hussain; information; interpolation; iraq; january; july; kriging; level; mapping; maps; mean; measured; measurements; methods; model; nugget; omi; ozone; parameters; performance; points; range; resolution; rmse; sample; sill; spatial; spectral; spherical; study; surface; tropospheric; validation; value; variance; variogram; zaydan; ألاوزون cache: binhm-70.pdf plain text: binhm-70.txt item: #251 of 297 id: binhm-71 author: Mohammad, Mohammad K. title: DISTRIBUTION OF IXODID TICKS AMONG DOMESTIC AND WILD ANIMALS IN CENTRAL IRAQ date: 2015-07-01 words: 2869 flesch: 65 summary: In regard to tick species, nine were recorded (table 2), six of them belong to genus Hyalomma namely H. anatolicum Koch, 1844, H. excavatum Koch, 1844, H. turanicum Pomerantsef, 1946, H. scupense Delpy, 1946, H. dromedarii Koch, 1844, H. schulzei Olenev, 1931, H. anatolicum was found to be the most common tick species parasitizing the examined domestic animals and successfully survives in diverse habitats extending from central parts of the Sudan to North Africa, Southern Europe, the Middle East, Russia, China and India, and economically important tick species (Latif et al., 2005; Haque et al., 2011; Jafarbekloo et al., 2014). Distribution of tick species infesting domestic ruminants in borderline of Iran-Afghanistan. keywords: anatolicum; animals; annulatus; asiatic; baghdad; bull; camels; central; distribution; dogs; domestic; donkeys; et al; examined; excavatum; goats; horses; hosts; hyalomma; infestation; iraq; ixodid; koch; leporis; m.k; middle; mohammad; pomerantsef; present; rate; red; results; scupense; sheep; shubber; south; species; study; ticks; turanicum; university; vet; wild cache: binhm-71.pdf plain text: binhm-71.txt item: #252 of 297 id: binhm-72 author: Shaker, Goner A.; Alhamadany, Hany S. title: ISOLATION AND IDENTIFICATION OF FUNGI WHICH INFECT FENNEL Foeniculum vulgare Mill. AND ITS IMPACT AS ANTIFUNGAL AGENT date: 2018-10-10 words: 2688 flesch: 56 summary: The percentage of disease infection No. of diseased plants / No. of all plants 100 5-Assays the efficiency of F. vulgare alcoholic extract as antifungal: Adopted a F. vulgare seeds collected from the previous planting season after cleaned, washed and dried and milled by electric mill and preserved in a sterile polyethylene bags. The results clearly revealed that fennel extract could cause growth inhibition on the four tested fungi, although the rate of inhibition of tested fungi shows that two concentrations 2.5 and 5% were found to be inhibitory to mycelia growth and the rate of inhibition increased generally by increasing the concentration, and 5% concentration was the most effective on the mycelia growth of Alternaria alternata, Rhizoctonia solani, and Phoma herbarum and Fusarium oxysporum, were 1.31, 1.56, 1.13 and 1.65 cm, respectively Fig.1 compared to the treatment of control where the concentration was 0% the rates of fungal growth diameter was 2.4, 9, 2.5 and 2.63 cm, and shown the existence significant differences between mycelia growth rates in the dishes and between concentrations of alcoholic extract of F. vulgare and at P 0.01 and P 0.05, the same results obtained from study (18) indicated the fennel (F. vulgare) seed is a potential source of natural antioxidant of the both water and ethanol seed extracts, and (19) showed that Foeniculum vulgare extract which was the one of the 49 medicinal plants extracts inhibited both fungal growth and production of AFs B1 and G1 producing of Aspergillus parasiticus and intentioned to use this plant as effective antimicrobial to protect foods and feeds from 0 5 10 Jan March May %disease incidence 34 Isolation and Identification of Fungi toxigenic fungus growth and subsequent (AF) Aflatoxin contamination. keywords: activity; alcoholic; alhamadany; alternata; antifungal; antioxidant; aspergillus; baghdad; concentrations; diagnosis; diameter; disease; effectiveness; essential; extract; fennel; foeniculum; food; fungi; fungicides; fusarium; goner; growth; hany; herbarum; identification; incidence; inhibition; isolation; medicinal; mill; mycelia; oils; oxysporum; percentage; phoma; plants; potential; rhizoctonia; sci; seeds; shaker; solani; study; tested; use; vol; vulgare; wilting cache: binhm-72.pdf plain text: binhm-72.txt item: #253 of 297 id: binhm-73 author: Al-Dabbas, Moutaz A.; Ali, Lamyaa Abdulameer; Afaj, Adnan H. title: THE CHEMISTRY OF THE LEAVES OF PLANT Eucalyptus camaldulensis AS ENVIRONMENTAL CONTAMINATION INDICATOR OF SELECTED LOCATIONS AT KIRKUK - IRAQ date: 2015-07-01 words: 4381 flesch: 64 summary: Table 1: Heavy metals concentrations (ppm) in the leaves of plant Eucalyptus camaldulensis for October 2010, and in March 2011, compared with results of other studies. Applying Arc GIS 10 model of heavy metals concentrations on the leaves of plant Eucalyptus camaldulensis for the cumulative effects of both sampling periods October 2010 and March 2011, shows that the concentrations of these pollutants distribute away from the refinery toward the wind direction and the refinery is not the only contamination sources, as in sampling site 4 and site 12 that represent the Chorao Control site and Baba gurgur hotel site respectively Figure 2. keywords: accumulation; acenaphthene; air; anthracene; aromatic; baghdad; benzo; camaldulensis; chemistry; city; college; combustion; compounds; concentrations; contamination; direction; dust; environmental; et al; eucalyptus; eucalyptus camaldulensis; fluoranthene; gis; heavy; heavy metals; high; hydrocarbons; iraq; journal; kirkuk; leaves; march; metals; naphthalene; nickel; october; oil; pahs; periods; plant; plant eucalyptus; pollutants; pollution; polycyclic; ppb; ppm; pyrene; range; refinery; results; road; sampling; science; site; sources; studies; table; total; university; values; vehicle; wind cache: binhm-73.pdf plain text: binhm-73.txt item: #254 of 297 id: binhm-74 author: Al-Moussawi, Azhar Ahmed; Al-Hamdany, Hany Saber title: PARASITIC HELMINTHS OF THE STARLING STURNUS VULGARIS LINNAEUS, 1758 IN BAGHDAD CITY, CENTRAL IRAQ date: 2015-07-01 words: 2099 flesch: 70 summary: In Iraq, many helminthes were isolated from S. vulgaris: the cestode Choanotaenia musculosa by Molan et al. 53 Azhar A. Al-Moussawi & Hany S. Al-Hamdany Examination for stomach contents of S. vulgaris reveals presence of fruits, grain seedlings and arthropods remains (insect: flies, bees, bugs and beetles) which acts as intermediate hosts for D. nasuta and P. crenata (Alicata, 1964; Gubanyi et al.,1993; Anderson, 2000 and Halajian et al., 2011). keywords: abdulabas; arabic; azhar; baghdad; birds; bull; cestode; city; crenata; diplotriaena; dispharynx; goeze; hany; helminths; hist; iraq; moussawi; mus; nasuta; nematode; new; parasitic; parasitol; passerilepis; rudolphi; species; starling; sturnus; vulgaris; wide; yamaguti cache: binhm-74.pdf plain text: binhm-74.txt item: #255 of 297 id: binhm-747 author: Dilnoza F. Zokirova; Fazlitdin Z. Khalimov title: MORPHOMETRIC FEATURES OF THE BEETLE ACINOPUS (ACINOPUS) LAEVIGATUS MENETRIES, 1832 (COLEOPTERA, CARABIDAE) IN THE MOUNTAIN ECOSYSTEMS OF UZBEKISTAN date: 2022-12-20 words: 4198 flesch: 60 summary: Decreases in beetle body size linked to climate change and warming temperatures. Study of the morphometric structure of ground beetle populations of the Barguzin Ridge on the example of Carabus odoratus https://doi.org/10.18470/1992-1098-2010-1-63-75 150 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Morphometric features of the beetle Acinopus barguzinicus (Shil, 1996). keywords: acinopus; altitudinal; beetles; belts; body; body length; body size; bulletin; carabidae; coleoptera; conditions; correlation; differences; different; elytra; features; general; ground; group; head; high; history; iraq; journal; khalimov; laevigatus; length; morphological; morphometric; morphometric parameters; mountain; museum; natural; parameters; parts; populations; pronotum; range; russian; samarkand; significant; size; species; studied; study; sukhodolskaya; total; uzbekistan; variability; variable; variation; width; zarafshan; zokirova cache: binhm-747.pdf plain text: binhm-747.txt item: #256 of 297 id: binhm-748 author: Ahmed Ch. Al-Shamary; Kadhim H. Younis title: STATUS OF COMMERCIAL FISH CATCH IN THE IRAQI MARINE WATERS, ARABIAN GULF date: 2022-12-20 words: 4353 flesch: 60 summary: 164 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Status of commercial fish catch 1998 2000 2002 2004 2006 2008 2010 2012 2014 2016 2018 2020 200 250 300 350 400 N u m b e r o f b o a ts years Diagram (6): Number of fishing boats during 1998-2020. Diagram (5): The percentage of commercial fish families caught. keywords: abood; abundance; ali; arabian; area; bloch; boats; bulletin; catch; changes; commercial; commercial catch; commercial fish; december; diagram; estuary; et al; families; family; fish; fisheries; fishes; fishing; gulf; history; history museum; increase; iraq; iraq natural; iraqi marine; journal; lowest; marine; marine waters; mohamed; monthly; museum; natural; natural history; number; percentage; present; previous; qasim; river; sciaenidae; second; shamary; shatt; species; station; status; study; total; total catch; university; waters; weight; years; younis cache: binhm-748.pdf plain text: binhm-748.txt item: #257 of 297 id: binhm-749 author: Noushig Zarikian title: NEW RECORDS ON SALTICIDAE AND THERIDIIDAE (ARANEAE) SPIDERS FROM ARMENIA date: 2022-12-20 words: 3999 flesch: 57 summary: By this study, the total list of spiders has been enlarged to 249 species, but Armenia is still the poorest among the Caucasus region countries, 176 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM New records on Salticidae and Theridiidae Copyright © Bulletin of the Iraq Natural History Museum neighboring Turkey (145 species of Salticidae and 84 species of Theridiidae) ((Nentwig et al., 2021) and Iran (117 species of Salticidae and 64 species of Theridiidae) (Zamani et al., 2020) regarding spider species richness due to the limited conducted researches of arachno-fauna studies and the insufficient data . The map of Salticidae and Theridiidae species distribution was prepared (Map 1 and 2) using the Simple Mapper online program (Shorthouse, 2010). keywords: abdomen; araneae; aranei; armenia; arthropoda; black; brown; bulletin; caucasus; cephalothorax; copyright; dark; description; distribution; epigyne; eyes; female; genus; habitat; habitus; history; history museum; iraq; iraq natural; jumping; koch; legs; light; logunov; m.a.s.l; marusik; material; median; museum; natural; natural history; new; plate; province; record; salticidae; salticus; selecta; simon; species; spiders; steatoda; theridiidae; walckenaer; white; widespread; world; zarikian; ° e; ° n cache: binhm-749.pdf plain text: binhm-749.txt item: #258 of 297 id: binhm-75 author: Al-Saffar, Hanaa H.; Augul, Razzaq Sh. title: SURVEY OF BRACHYCERA; DIPTERA FROM SEVERAL REGIONS OF IRAQ date: 2015-07-01 words: 3546 flesch: 62 summary: Key word: Brachycera, Diptera, Fauna, Iraq, Survey. INTRODUCTION The Diptera, commonly called true flies or two-winged flies, are a familiar group of insects that includes, among many others, black flies, fruit flies, horse flies, house flies, midges, and mosquitoes. keywords: africa; america; asia; augul; bab; baghdad; black; brachycera; brown; calliphoridae; china; chrysomya; diptera; distribution; egypt; entomology; europe; families; family; fauna; flies; fruit; genus; h. al; insects; iran; iraq; islands; karbala; material; morocco; mouadham; natural; new; north; oriental; palestine; pape; pont; press; province; qaddissya; razzaq; regions; saffar; science; shalan; species; specimens; study; survey; syria; tunisia; turkey; university; world cache: binhm-75.pdf plain text: binhm-75.txt item: #259 of 297 id: binhm-750 author: Ali A. Kareem; Hossein Lotfalizadeh; Ayad Alsendi; Raad Kareem Aljaafari; Sienaa M. Al-Zurfi* title: FIRST RECORD OF TWO PARASITOID WASPS OF THE FAMILY CHALCIDIDAE (HYMENOPTERA) IN IRAQ date: 2022-12-20 words: 2497 flesch: 53 summary: Including these two species recorded in this study, Chalcididae species in Iraq reaches eight. Order Hymenoptera, family Chalcididae. keywords: bouček; brachymeria; bulletin; cameron; chalcididae; chalcidoidea; chalcis; delvare; diptera; et al; fabricius; family; fonscolombei; girault; hind; history; hymenoptera; iran; iraq; iraq natural; karbala; kareem; lepidoptera; lotfalizadeh; masi; museum; myrifex; natural; new; noyes; parasitoid; podagrica; province; record; research; species; specimens; sulzer; university; view; walker; wasps cache: binhm-750.pdf plain text: binhm-750.txt item: #260 of 297 id: binhm-751 author: Arjun M. S; Bibhu Prasad Panda; Satyaranjan Behera title: FIRST RECORD OF THE LARGE-BILLED CROW CORVUS MACRORHYNCHOS WAGLER, 1827 PREDEATING ON THE VULNERABLE INDIAN ROOFED TURTLE PANGSHURA TECTA (GRAY, 1831) IN INDIA date: 2022-12-20 words: 1708 flesch: 64 summary: This is the first report of avian predators like crows preying on Indian roofed turtles. Indian turtles: A field guide. keywords: asia; behaviour; bulletin; corvus; crow; distribution; geoemydidae; gray; history; indian; international; iraq; large; macrorhynchos; museum; natural; odisha; pangshura; predation; record; region; research; river; roofed; roofed turtle; species; turtle; vulnerable; wagler; الهند cache: binhm-751.pdf plain text: binhm-751.txt item: #261 of 297 id: binhm-752 author: Ali A. R. Al-Darwesh; Atheer H. Ali; Hussein A. Saud title: FIRST RECORD OF TWO DIPLECTANID MONOGENOIDS FROM THREE SPARID FISHES IN IRAQI MARINE WATERS date: 2022-12-20 words: 5250 flesch: 55 summary: The occurrence of L. indicus from both R. haffara and R. sarba are considered the new parasite fauna of Iraq, as well as L. haffara considered new host record. were described from Sparoidea in related to host specificity, L. indicus considered that it has one host species (R. sarba), and here it considered has double closely host species (R. sarba and R. haffara); R. haffara considered new host record in the world for L. indicus. keywords: anchor; anterior; arabian; argyrops; bar; body; bulletin; calydiscoides; copulatory; current; curved; darwesh; description; diplectanidae; dorsal; elongate; et al; fig; fishes; forsskål; genera; gulf; haffara; haptor; history; host; indian; indicus; inner; iraq; iraq natural; justine; kritsky; lamellodiscus; length; lobes; long; male; marine; mco; measurements; monogenea; monogenoids; museum; n=10; n=12; n=13; n=2; natural; natural history; new; oliver; outer; parasite; parasitology; pharynx; piece; posterior; protolamellodiscus; record; research; rhabdosargus; sarba; seminal; senilobatus; short; sparidae; species; specimens; spinifer; spp; testis; ventral; waters; width cache: binhm-752.pdf plain text: binhm-752.txt item: #262 of 297 id: binhm-753 author: Zahraa Y. Kadhim title: NEW RECORDS OF FREE-LIVING PROTOZOA (SARCODINA) FROM BAGHDAD CITY, IRAQ date: 2022-12-20 words: 2968 flesch: 49 summary: [CrossRef] Patterson, R. T., Dalby, A., Kumar, A., Henderson, L. A. and Boudreau, R. E. A. 2002. LITERATURE CITED Adl, S. M., Simpson, A. G. B., Lane, C. E., Lukeš, J., Bass, D., Bowser, S., Brown, M. W., Burki, F., Dunthorn, M., Hampl, V., Heiss, A., Hoppenrath, M., Lara, E., Le Gall, L., Lynn, D. H., McManus, H., Mitchell, E. A. D., Mozley-Stanridge, S. E., Parfrey, L. W., Pawlowski, J., Rueckert, S., Shadwick, L., Schoch, C. L., Smirnov, A. and Spiegel, F. W. 2012. keywords: 2004; amoebae; amoebida; arcellinida; area; baghdad; brown; bulletin; centrohelida; city; community; crossref; difflugia; difflugiidae; environmental; et al; free; hartmannellidae; heleopera; history; iraq; journal; kadhim; microbiology; museum; natural; new; pallida; plate; protists; protozoa; raphidiophridae; records; rhaphidiophrys; river; saccamoeba; samples; sampling; sarcodina; smirnov; soil; species; study; taxa; testate; thecamoeba; tigris; urceolata; water cache: binhm-753.pdf plain text: binhm-753.txt item: #263 of 297 id: binhm-754 author: Khayrulla Solijonov; Farrukh U. Umarov title: ECOLOGY OF LEECHES AND GASTROPODS OF THE LOWER AK-BUURA RIVER, FERGANA VALLEY,UZBEKISTAN date: 2022-12-20 words: 7803 flesch: 63 summary: However, the author did not specify which leech species were encountered. The leech samples were identified according to Nesemann and Neubert (1999), Lukin (1976), Govedich et al. (2019), while gastropods species were identified according to Starobogatov (2004), Kruglov (2005) and Izzatullaev (2018). keywords: 1976; 2015; 2018; acronicus; acuta; andijan; annelida; aperture; aquatic; auricularia; biodiversity; biotopes; black; bodies; body; bulletin; buura; buura river; characteristics; cocoons; color; common; dimensions; distribution; ecological; ecology; edges; erpobdella; eyes; family; fauna; fergana; flowing; freshwater; gastropods; hirudinea; history; history museum; index; iraq; iraq natural; izzatullaev; large; leeches; linnaeus; lower; lukin; lymnaea; medium; molluscs; morphology; mud; muddy; museum; natural; natural history; number; octoculata; orientalis; oval; pairs; palearctic; parts; pazilov; physella; phytophile; radix; reproduction; research; river; russian; sanguisuga; shape; shell; size; small; solijonov; species; stagnalis; study; substrate; sucker; surface; umarov; university; uzbekistan; valley; waste; water; whorls; years; yellow cache: binhm-754.pdf plain text: binhm-754.txt item: #264 of 297 id: binhm-755 author: Mohammad Moradi; Ersen Aydın Yağmur; Abolfazl Akbari title: HOTTENTOTTA POOYANI SP. NOV. (SCORPIONES, BUTHIDAE) FROM THE KHUZESTAN PROVINCE, IRAN date: 2022-12-20 words: 3419 flesch: 61 summary: FROM THE KHUZESTAN PROVINCE, IRAN Mohammad Moradi*, Ersen Aydın Yağmur**, Abolfazl Akbari*** and Najmeh Jafari* *University of Zanjan, Department of Biology, Faculty of Sciences, Zanjan, Iran **Alaşehir Vocational School, Manisa Celal Bayar University, Manisa, Turkey ***Razi Vaccine and Serum Research Institute, Karaj, Iran E-mail: ersen.yagmur@gmail.com Received Date: 23 June 2022, Accepted Date: 30 Oct. 2022, Published Date: 20 December 2022 This work is licensed under a Creative Commons Attribution 4.0 International License ABSTRACT A new species, Hottentotta pooyani sp. CONCLUSIONS The new species Hottentotta pooyani sp. nov. is described herein. keywords: bear; birula; bulletin; buthidae; carapace; carinae; coarse; female; fet; finger; genus; granules; history; holotype; hottentotta; hottentotta pooyani; iii; iran; iraq; khoozestanus; khuzestan; kovařík; lateral; moradi; movable; museum; natural; navidpour; new; nov; pooyani; pooyani sp; province; rows; saxinatans; scorpiones; segment; setae; smooth; soleglad; species; surface; ventral; view; yağmur cache: binhm-755.pdf plain text: binhm-755.txt item: #265 of 297 id: binhm-756 author: Trifa Khurshid Malla; Louis Abdulahad Saida title: A SURVEY OF ECTO AND ENDO-PARASITES OF HOUSE MOUSE MUS MUSCULUS LINNAEUS, 1758 OF ERBIL CITY, KURDISTAN REGION, IRAQ date: 2022-12-20 words: 9272 flesch: 60 summary: 68%; Tritrichomonas muris (Grassi,1879)36%; Entamoeba histolytica (Schaudinn,1903) 24%; Entamoeba coli (Grassi,1879)32%; Eimeria sp. 28% and Trypanosoma musculi (Kendall,1906) 2%; and 8 species were helminthes as follows: 4 Cestodes: Rodentolepis nana (von Siebold, 1852) 8%; Hymenolepis diminuta (Rudolphi, 1819)2%; larval stage of Echinococcus granulosus (Batsch, 1786)8%, Cysticercus fasciolaris (Rudolphi, 1808)6%, 4 Nematodes: Aspiculuris tetraptera (Nitzsch, 1821)8%; Syphacia obvelata (Rudolphi, 1802)36%; Syphacia muris (Yamaguti, 1935)2% and Trichuris muris (Schrank, 1788)10%; and 3 species of ectoparasites were diagnosed as follows: the Oriental rat flea Xenopsylla cheopis (Rothschild, 1903)2.0%, the spined rat louse Polyplax spinulosa (Burmeister, 1839)16.0%, and the mite Laelaps nuttalli (Hirst, 1916)4.0%. Table (4) is showing the species of helminthic parasite infections among 50 mice examined in Erbil City. keywords: 1967; 2001; animals; area; baghdad; biology; black; blood; bulletin; city; current; cycle; cysts; differences; different; diminuta; diseases; ecto; ectoparasites; eimeria; endo; entamoeba; erbil; erbil city; females; granulosus; health; hilla; histolytica; history; host; house; house mice; humans; hydatid; hymenolepis; infected; infection; infection rate; intestine; iraq; iraq natural; journal; large; larval; life; liver; males; malla; mice; molan; morshidy; muris; musculi; musculus; museum; nana; natural; nematodes; obvelata; oldham; parasites; parasitic; parasitology; percentage; present; prevalence; protozoa; province; rate; rats; rattus; recorded; rodents; role; saida; significant; small; species; spread; stage; studies; study; survey; syphacia; table; time; total; trypanosoma; university; world; worm; zoonotic cache: binhm-756.pdf plain text: binhm-756.txt item: #266 of 297 id: binhm-757 author: Shwan Khursheed Bashê title: DISTRIBUTION AND PHYLOGENETIC OF FRESHWATER MUSSEL UNIO TIGRIDIS BOURGUIGNAT, 1852 (BIVALVIA, UNIONIDAE) FROM GREATER ZAB RIVER, IRAQ date: 2022-12-20 words: 3763 flesch: 48 summary: The worldwide distribution and diversity of mussels species is to several reasons considering; habitat destruction, degradation, and alteration caused by increasing populations of human, industrialization, and changes in land use in addition to spread of non-native exotic species (Zieritz et al., 2016 - Hamli et al., 2021), enrichment water with nutrients resulting in phytoplankton and macrophyte blooms (Sharip and Zakaria, 2007), and heavy metal concentrations often reach deadly thresholds for freshwater mussels (Nobles and Zhang, 2015). According to the International Union for Conservation of Nature's (IUCN) assessment of the majority of freshwater mussel species (517), 6% extinct, 7% vulnerable, 9% BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Iraq Natural History Research Center & Museum, University of Baghdad https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home Copyright © Bulletin of the Iraq Natural History Museum Online ISSN: 2311-9799-Print ISSN: 1017-8678 https://doi.org/10.26842/binhm.7.2022.17.2.0291 https://orcid.org/0000-0002-9043-8190 mailto:shwan.raman@su.edu.krd https://creativecommons.org/licenses/by/4.0/ https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home 292 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Distribution and phylogenetic of freshwater mussel near threatened, 10% endangered, 13% critically endangered and 37% of least concern(IUCN, 2016). keywords: 2016; available; bashê; biology; bivalves; bivalvia; bogan; bourguignat; bulletin; coi; current; distribution; diversity; dna; et al; evolution; evolutionary; freshwater; freshwater mussel; genbank; greater; hamli; history; identification; iraq; iraq natural; iucn; journal; kimura; klishko; likelihood; lima; lopes; maximum; methods; molecular; mollusca; museum; mussel; natural; parsimony; phylogenetic; present; research; river; sequences; shell; species; study; temperature; tigridis; tree; unionidae; zab cache: binhm-757.pdf plain text: binhm-757.txt item: #267 of 297 id: binhm-758 author: Razzaq Shalan Augul; Hanaa H. Al-Saffar; Haider Naeem Al-Ashbal title: SURVEY AND UPDATING CHECKLIST OF DIPTERAN SPECIES WITH FORENSIC IMPORTANCE date: 2022-12-20 words: 6680 flesch: 52 summary: [Click here] El-Shazly, M. M., Nassar, M. I. and El-Sherief, H. A. 1996. LITERATURE CITED Abdul-Rassoul, M. S., Augul, R. S. and Al-Saffar, H. H. 2009 a. keywords: 1830; 1986; 2010; 2019; 2020; adult; aenescens; africa; albiceps; america; animal; argentina; ashbal; augul; australia; bab; babylon; baghdad; bigot; brauer; bulletin; calliphora; calliphoridae; canicularis; carcasses; checklist; china; chrysomya; city; common; decomposition; desvoidy; different; diptera; distribution; diyala; egypt; enderlein; entomology; et al; fabricius; families; family; fannia; flesh; flies; fly; forensic; forensically; gbif; genus; germany; group; history; history museum; hydrotaea; identification; importance; india; insects; international; iraq; iraq natural; journal; kerbala; kerbala province; key; khalaf; linnaeus; lucilia; m. s.; macquart; madagascar; material; medical; megacephala; meigen; musca; muscidae; muscina; museum; najaf; names; natural; natural history; new; oriental; pape; pont; province; region; research; robineau; rondani; sarcophaga; sarcophagidae; saudi; science; secretariat; sericata; south; species; specimens; stages; studies; study; survey; synonyms; townsend; university; usa; verves; walker; wang; wasit; wiedemann; world cache: binhm-758.pdf plain text: binhm-758.txt item: #268 of 297 id: binhm-77 author: Ali, Basim A. Abd; Ali, Hassan H. title: APPROPRIATENESS OF EUCALYPTUS CAMAL / DULENSIS, CASUARINA EQUISETIFOLIA AND OLEA EUROPAEA TREES IN SHELTERBELT OF AL-ASHRAF NAJAF CITY date: 2015-07-01 words: 2616 flesch: 68 summary: In contrast, trees of Table 1: Differences in tree height and stem diameter of E. camaldulensis trees according to form and distance from water source. Height of tree, stem diameter, crown diameter, and stem girth at location (C) were lower than that of location (A) by 15%, 36%, 34%, and 32% and that of location (B) by 16%, 22%, 22%, and 29%, respectively. Table 2: Differences in main stem height and crown diameter of E. camaldulensis trees according to form and distance from water source. keywords: abd; ali; appropriateness; basim; camaldulensis; casuarina; city; crown; dehnh; diameter; differences; different; distance; dominant; equisetifolia; eucalyptus; europaea; form; girth; growth; hassan; height; iii; iraq; irrigation; location; main; mean; najaf; northern; olea; parameters; plants; plateau; project; range; rows; sand; shelterbelt; soil; source; species; stem; study; trees; variations; water; wind; years; على cache: binhm-77.pdf plain text: binhm-77.txt item: #269 of 297 id: binhm-78 author: Mohamad, Sarbaz I.; Afrasiab, Saman R. title: TWO NEW RECORDS OF DWARF SNAKES OF THE GENUS EIRENIS JAN, (REPTTILIA, COLUBRIDAE) IN IRAQI KURDISTAN (NORTH AND NORTHEASTERN OF IRAQ) WITH ANNOTATED CHECKLIST, FOR THE GENUS EIRENIS IN IRAQ date: 2018-10-10 words: 1638 flesch: 67 summary: The presented paper bring new country records for two Eirenis species and provides an updated annotated list of Eirenis species known up to date from Iraq. In addition summarized list for 9 species of the genus Eirenis Jan in Iraq is also presented. keywords: afrasiab; arbil; baghdad; collection; dark; dorsal; dwarf; east; eirenis; genus; head; hist; iraq; jan; kmnh; kurdistan; length; mohamad; mountain; museum; nasal; natural; new; north; records; saman; sarbaz; scale; snakes; species; specimens; thospitis; university; العراق cache: binhm-78.pdf plain text: binhm-78.txt item: #270 of 297 id: binhm-81 author: Mhaisen, Farah M.; Abdul-Ameer, Kefah N. title: CHECKLISTS OF DIPLOZOID SPECIES (MONOGENEA) FROM FISHES OF IRAQ date: 2018-10-10 words: 7035 flesch: 71 summary: A second survey of fish parasites from Tigris River at Al-Zaafaraniya, south of Baghdad. Infection distribution of fish parasites in Basrah province and pathological effects of Saprolegnia sp. and its susceptibility to some plant extracts. keywords: 2007; abdullah; agric; ali; ameer; arabic; asmar; baghdad; balasem; barbi; barbus; basrah; carpio; checklists; coll; daraji; diplozoid; et al; fauna; fishes; freshwater; furhan; gibson; gussev; heckel; hosts; iraq; jubori; kasimii; kefah; khotenovsky; lake; luteus; macrostomum; mhaisen; monogenea; names; nasiri; nipponicum; paradiplozoon; parasites; parasitic; pavlovskii; posterior; province; pugachev; rahemo; rahman; rasheed; river; saadi; sa’adi; sci; sharpeyi; species; study; synonym; thesis; tigris; time; univ; valid; vorax; waaly; xanthopterus cache: binhm-81.pdf plain text: binhm-81.txt item: #271 of 297 id: binhm-82 author: Abed, Salwan Ali; Altaey, Maysoon M.; Salim, Mudhafar A. title: THE STATUS AND CONSERVATION OF THE VULNERABLE MARBLED TEAL MARMARONETTA ANGUSTIROSTRIS, MENETRIS (AVES-ANSERIFORMES) IN AL-DALMAJ WETLANDS, IRAQ. date: 2018-10-10 words: 2966 flesch: 61 summary: The counts of Marbled Teal in DL-4 Marbled Teal status in DL-5 DL-5 area in general provides good habitat for the occurrence and distribution of the Marbled Teal. The counts of Mar Marbled Teal status in DL-2: Field observation over the period of the survey that covered twelve months in this site, generally show that DL-2 area provide a good habitat for the occurrence and distribution of Marbled Teal as well. keywords: angustirostris; area; august; bird; conservation; count; dalmaj; distribution; field; good; habitat; highest; hor; important; individuals; iraq; lower; lowest; marbled; marbled teal; marmaronetta; months; nature; noticeable; november; number; observations; occurrence; october; period; population; salim; september; species; status; survey; teal; teal occurrence; variation; wetlands cache: binhm-82.pdf plain text: binhm-82.txt item: #272 of 297 id: binhm-830 author: Asmaa Khamis; Rim Hamdy title: PALYNOLOGICAL STUDIES FOR SOME CULTIVATED SPECIES OF PINUS L., 1753 (PINALES, PINACEAE) IN EGYPT date: 2023-06-20 words: 7131 flesch: 60 summary: Nakazawa, F., Suyama, Y., Imura, S. and Motoyama, H. 2018 .Species identification of Pinus pollen found in Belukha Glacier, Russian Altai Mountains, Using a whole- genome amplification method. The new collections of the five species from the Orman Botanic Garden east of Cairo University at Giza, Egypt, were done to provide materials for pollen studies. keywords: addition; analysis; aperture; average; brutia; bulletin; canariensis; cappa; characteristics; characters; cluster; cones; corpus; crossref; data; dendrogram; diploxylonoid; egypt; electron; equatorial; exine; furrow; grains; group; halepensis; hamdy; heigl; history; history museum; identification; iraq; iraq natural; key; khamis; khan; leaves; length; light; like; long; microscopy; monosulcate; morphological; morphology; museum; natural; natural history; p. brutia; p. pinea; palynological; perprolate; pinaceae; pinea; pinus; pinus species; pl1; plant; polar; pollen; pollen grains; pollen length; pollen morphological; prolate; pw1; ratio; related; roxburghii; sacci; saccus; scabrate; sculpture; sem; shape; size; species; studies; study; subsect; taxa; taxonomic; thickness; tree; university; verrucate; view; width; اللقاح cache: binhm-830.pdf plain text: binhm-830.txt item: #273 of 297 id: binhm-831 author: Rania A. Hassan; Rim Hamdy title: COMPARATIVE STUDY ON TRICHOMES TYPES OF WILD SPECIES OF SOLANUM L., 1753 (SOLANALES, SOLANACEAE) IN EGYPT AND ITS TAXONOMIC SIGNIFICANCE date: 2023-06-20 words: 7574 flesch: 55 summary: [CrossRef] Rao, S. R. S. and Ramayya, N. 1977. [Click here] Benitez de Rojas, C. E. and Ferrarotto, S. M. 2009. keywords: 2007; 2017; 2019; abaxial; acute; apex; biology; botany; bulletin; cai; cairo; central; characters; clavate; coagulans; comparative; data; dense; density; diphyllum; egypt; elaeagnifolium; electron; epidermal; et al; flora; foliar; forskalii; genus; glandular; glandular hair; glandular multicellular; glandular trichomes; globular; hairs; hamdy; hassan; head; history; history museum; incanum; international; iraq; journal; kariyat; large; leaf; length; long; microscopy; moderate; mohamed; morphological; morphology; multicellular; multiradiate; museum; natural; natural history; nigrum; non; number; plant; porrect; rays; research; s. nigrum; s.n; schimperianum; sculpture; seithe; sem; short; significance; simple; sinaicum; small; solanaceae; solanum; solanum species; sparse; species; stalk; stellate; structure; studied; study; subgenus; subulate; surface; systematic; tab; taxonomic; trichomes; types; unicellular; unicellular stalk; university; verrucate; villosum; virginianum; wild cache: binhm-831.pdf plain text: binhm-831.txt item: #274 of 297 id: binhm-832 author: Khansaa Rasheed Al-Joboury; Sukeyna Abass Aliwy title: SURVEY WITH REVISED CHECKLIST OF COMPOSITAE IN THE HERBARIUM OF IRAQ NATURAL HISTORY RESEARCH CENTER AND MUSEUM date: 2023-06-20 words: 10411 flesch: 59 summary: L. saligna L., L. sativa L., L. scarioloides Boiss., L. serriola L., L. undulata Ledeb., L. viminea (L.) J.Presl & C.Presl. Bip., 1839 Synonyms: P. blancheana Boiss., 1875 P. damascena Boiss. & Gaill, 1875 P. damascena var. keywords: 2011; 2016; 2019; abdein; achillea; adhaim; aegean; afghanistan; africa; alfaro; algeria; aliwy; america; anthemis; april; arabia; arbil; artemisia; asia; asteraceae; atractylis; august; australia; baghdad; bartolucci; bellis; boiss; bornm; bulletin; bunh; carduus; carlina; carthamus; cass; caucasus; centaurea; center; checklist; cichorium; collected; compositae; coss; cotula; crepis; cynareae; cyprus; dehshiri; desf; distribution; district; diversity; diyala; duhok; edmondson; egypt; eig; eriocephala; europe; examind; fallujah; family; filago; fisch; flora; foetida; forssk; gaertn; garnock; genus; ghazanfar; guss; gymnarrheneae; hand.-mazz; hausskn; heldr; herbarium; history; history museum; holub; india; iran; iraq; iraq natural; italy; jabal; jiménez; joboury; jones; jordan; journal; jozipoor; july; june; khalis; koelpinia; kuwait; lam; lebanon; libya; local; loefl; m.bieb; macaronesia; march; marchjune; material; mediterranean; micrantha; mill; morocco; museum; names; natural; natural history; new; number; osman; pakistan; palestine; pers; picris; plant; portugal; pulicaria; pycnocephalus; rech.f; remark; research; sarsank; saudi; sch.bip; senecio; shaqlawa; sinai; single; sinjar; sonchus; spain; species; specimens; spreng; study; subsp; sudur; survey; synonyms; syria; tajikistan; transcaucasia; tribe; turkey; turkmenia; var; willd; zealand cache: binhm-832.pdf plain text: binhm-832.txt item: #275 of 297 id: binhm-833 author: Huda Sdiq Bilal; Sherwan Tayeb Ahmed title: COMPARATIVE ULTRASTRUCTURAL STUDY OF THE SALIVARY GLANDS OF TWO HEMATOPHAGOUS LEECHES (ANNELIDA, CLITELLATA, ARHYNCHOBDELLIDA) IN IRAQ date: 2023-06-20 words: 3974 flesch: 60 summary: Sulci on the smooth outside surface of the cell were visible, and it appeared as a collection of different-sized cells with system channels interconnecting salivary gland cells to ducts in addition to the thousands of secretory cells. For detecting their feeding organs including salivary glands, four specimens of each species were dissected and then cleaned with distilled water (Ayhan et al., 2021). keywords: 2021; ahmed; annelida; anterior; bilal; biology; blood; body; bulletin; cavity; cells; clitellata; collection; comparative; denticles; different; ducts; erbil; et al; feeding; genus; gland; hematophagous; hirudinea; hirudo; history; history museum; iraq; iraq natural; jaws; journal; leeches; lemke; limnatis; medicinal; minutes; museum; natural; natural history; nilotica; orientalis; paluda; papillae; salivary; salivary gland; sawyer; science; sem; single; size; species; specimens; study; sucker; teeth; tennent; tiny; ultrastructural; university; utevsky; verbana; water cache: binhm-833.pdf plain text: binhm-833.txt item: #276 of 297 id: binhm-834 author: Zainab A. Makawi; Afkar M. Hadi title: IDENTIFICATION OF HARD TICKS FROM BUFFALO BUBALUS BUBALIS (LINNAEUS, 1758) IN IRAQ date: 2023-06-20 words: 3507 flesch: 60 summary: Species of Hard ticks Isolate No. of Males No. of females Total % Hyalomma truncatum 46 30 76 44.18 H. excavatum 16 20 36 20.93 H. anatolicum 18 6 24 13.95 H. marginatum 10 2 12 6.97 H. impeltatum 6 6 12 6.97 H. rufipes 8 0 8 4.65 H. scupense 2 4 6 3.48 H. dromedarii 4 0 4 2.23 Total 104 68 172 426 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Identification of hard ticks from buffalo Plate (1): (A) H. truncatum male, dorsal view [1. (2023) 17 (3): 423-434. https://doi.org/10.26842/binhm.7.2023.17.3.0423 ORIGINAL ARTICLE IDENTIFICATION OF HARD TICKS FROM BUFFALO BUBALUS BUBALIS (LINNAEUS, 1758) IN IRAQ Zainab A. Makawi* and Afkar M. Hadi Iraq Natural History Research Center and Museum, University of Baghdad, Baghdad, Iraq ⃰ Corresponding author: zainab@nhm.uobaghdad.edu.iq Recived Date: 14 Janaury 2023, Accepted Date 13 March 2023, Published Date:20 June 2023 keywords: adanal; anatolicum; animals; apparent; areas; baghdad; basrah; buffalo; buffaloes; bulletin; central; cervical; current; dark; depression; dorsal; dromedarii; excavatum; fields; grooves; h. rufipes; hard; hard ticks; history; hyalomma; identification; impeltatum; infestation; iraq; iraq natural; khan; makawi; male; marginatum; museum; natural; number; plates; present; results; rufipes; scupense; setae; shape; species; specimens; spiracle; study; ticks; total; truncatum; university; veterinary; view cache: binhm-834.pdf plain text: binhm-834.txt item: #277 of 297 id: binhm-835 author: Reham A. Youssef; Wafaa M. Amer; Azza B. Hamed title: GENUS RETAMA RAF., 1838 (FABALES, FABACEAE): TAXONOMIC REVISION IN EGYPT SUPPORTED BY MOLECULAR FINGERPRINTING date: 2023-06-20 words: 8538 flesch: 70 summary: Diagram (4) shows that R. monosperma Form 5 had the longest wings, while R. raetam Form 8 had the shortest wing compared with R. raetam, R. monosperma, and other forms. Also, R. monosperma had the widest wing and R. raetam Form 7 had the narrowest wing, while R. raetam, R. raetam Form 2, R. raetam Form 6 and R. raetam Form 8 were equal in wing width. keywords: 2009; 2013; amer; analysis; apex; apiculate; bands; boiss; boulos; bovei; brown; bulletin; cairo; calyx; characters; consistent; diagram; different; distribution; diversity; egypt; elliptical; et al; fabaceae; features; flora; flower; form; forssk; fruit; genus; genus retama; green; heywood; history; inflorescence; iraq; issr; jafri; keel; leaf; length; long; lygos; macro; mediterranean; molecular; monosperma; monosperma form; morphological; museum; muñoz; natural; olive; peak; populations; primer; purple; r. raetam; raetam; raetam form; raf; retama; retama monosperma; retama raetam; retama raf; retama species; seeds; similarity; sinai; south; spach; species; standard; subsp; syn; taxa; taxonomic; tutin; täckholm; unique; vein; wadi; webb; width; wing; yellow; youssef; zohary cache: binhm-835.pdf plain text: binhm-835.txt item: #278 of 297 id: binhm-836 author: Khayrulla Solijonov; Zuvayd Izzatullaev; Dilfuza Umarova*** title: NEW RECORD OF MALACOPHAGOUS LEECH OF THE GENUS ALBOGLOSSIPHONIA LUKIN, 1976 FROM FERGANA VALLEY, UZBEKISTAN date: 2023-06-20 words: 3104 flesch: 58 summary: ORIGINAL ARTICLE NEW RECORD OF MALACOPHAGOUS LEECH OF THE GENUS ALBOGLOSSIPHONIA LUKIN, 1976 FROM FERGANA VALLEY, UZBEKISTAN Khayrulla Solijonov*♦, Zuvayd Izzatullaev** and Dilfuza Umarova*** *Andijan State University, Andijan City, Republic of Uzbekistan. Hidden shelter-like associations of minute Alboglossiphonia leeches (Hirudinea: Glossiphoniidae) with sedentary animals and molluscs. keywords: 1976; 2022; alboglossiphonia; andijan; annelida; blanchard; body; bolotov; bulletin; city; distribution; district; ecology; et al; eyes; family; fauna; fergana; freshwater; genus; glossiphoniidae; goddard; hirudinea; history; india; iraq; leeches; linnaeus; lukin; malacophagous; museum; natural; nesemann; new; oka; pairs; record; region; rows; russian; solijonov; species; state; study; university; uzbekistan; valley; weberi cache: binhm-836.pdf plain text: binhm-836.txt item: #279 of 297 id: binhm-837 author: Dhanusha Kawalkar; Shirish S. Manchi title: FIRST CONFIRMED BREEDING RECORD OF THE BLYTH’S SWIFT APUS PACIFICUS LEUCONYX (BLYTH, 1845) (APODIFORMES, APODIDAE) IN SOUTHERN PARTS OF NILGIRI REGION OF WESTERN GHATS OF INDIA date: 2023-06-20 words: 4018 flesch: 60 summary: Since Pacific Swift A. p. pacificus is known to be breeding in North-East India (Kirwan et al., 2020) and is similar to Blyth’s Swift, the plumage and morphological differences between the two species is mentioned by Leader (2011). Pacific Swift breeds in Siberia east to Kamchatka and northern Japan; winters in Indonesia, Melanesia, Australia, and possibly northeast India (Kirwan et al., 2020). keywords: 2011; 2012; 2020; ali; anaikatty; apodidae; april; apus; area; bio; birds; blyth; breeding; breeding range; bulletin; cheke; coimbatore; distribution; east; food; ghats; hills; history; identification; india; individuals; iraq; kawalkar; kirwan; known; leader; leuconyx; manchi; march; mean; model; museum; natural; natural history; nilgiri; ornithology; pacific swift; pacificus; possible; precipitation; presence; present; quarter; range; record; region; sdm; southern; southern western; species; status; swift; swift apus; swiftlet; temperature; university; western; western ghats cache: binhm-837.pdf plain text: binhm-837.txt item: #280 of 297 id: binhm-838 author: C. P. Ashwin; P. J. Clince; P. R. Arun title: IMPACT OF LINEAR INFRASTRUCTURE INTRUSIONS ON AVIFAUNA: A REVIEW date: 2023-06-20 words: 8152 flesch: 53 summary: In Spain, Janss recorded higher casualties of Great Bustard Otis tarda Linnaeus, 1758, Little Bustard Tetrax tetrax (Linnaeus, 1758) and Common Crane Grus grus (Linnaeus, 1758) due to power line collisions (Janss, 2000). (1987) observed power lines were the major cause of mortality for Whooping Crane Grus americana (Linnaeus, 1758) and Mallard Anas platyrhynchos Linnaeus, 1758 in south-central Colorado and concluded that power line collisions cause a large number of mortalities in cranes and waterfowl (Brown et al., 1987). keywords: 1995; 2001; 2002; 2003; 2007; 2010; 2015; 2023; alonso; anderson; areas; ashwin; ashwin et; assessment; associated; avian; avifauna; barriers; bevanger; biodiversity; biological; bird; bird mortality; breeding; brown; bulletin; cause; collision; conservation; crane; degradation; different; direct; d’amico; d’amico et; ecology; edge; eds; effective; effects; electricity; electrocution; electromagnetic; emissions; environmental; et al; factors; features; flight; flying; fragmentation; habitat; high; history; impacts; india; infrastructures; international; iraq; j. a.; j. m.; janss; jenkins; jenkins et; journal; landscape; large; lead; linear; linear infrastructures; lines; linnaeus; loss; major; management; mcneil; mcneil et; measures; mitigation; mortality; museum; natural; nocturnal; noise; number; ornithology; physical; planning; poles; populations; positive; power; power lines; railways; raptors; related; research; review; risk; roads; santos; savereno; society; soil; south; spain; species; springer; studies; study; success; traffic; transportation; tryjanowski; urban; vegetation; vehicle; weather; wildlife; wires; wiącek; التحتية; على cache: binhm-838.pdf plain text: binhm-838.txt item: #281 of 297 id: binhm-839 author: Batool K. Habeeb; Harith Saeed Al-Warid title: MORPHOLOGICAL DESCRIPTION OF TWO LEECH SPECIES (ANNELIDA, HIRUDINEA) WHICH USED IN SOME ALTERNATIVE MEDICINE CLINICS IN BAGHDAD PROVINCE, IRAQ date: 2023-06-20 words: 2375 flesch: 54 summary: A few clinics in Iraq utilize medicinal leeches to treat a few diseases. Medicinal leeches: historical use, ecology, genetics and conservation. keywords: 2019; annelida; anterior; anterior sucker; average; baghdad; body; bulletin; clinics; description; dorsal; genus; habeeb; hirudo; history; iraq; iraq natural; journal; leeches; length; mean; medical; medicinal; medicine; morphological; museum; natural; orientalis; posterior; ratio; research; size; species; specimens; study; sucker; trontelj; utevsky; verbana; warid cache: binhm-839.pdf plain text: binhm-839.txt item: #282 of 297 id: binhm-84 author: Al-Barazengy, Ali N. title: FIRST OBSERVATIONS ON PHRYNOCEPHALUS MACULATUS LONGICAUDATUS HAAS, 1957 (SQUAMATA: SAURIA: AGAMIDAE) IN IRAQ date: 2014-12-01 words: 1967 flesch: 65 summary: Discovery of a population of Phrynocephalus maculatus Anderson in Hashemit Kingdom of Jordan. A new locality record of Phrynocephalus maculatus Anderson, 1872, from Jordan [Short Note] keywords: ali; amphibians; anderson; area; barazengy; canon; city; dark; desert; dorsal; east; eastern; haas; head; iraq; lake; longicaudatus; maculatus; muthanna; photographs; phrynocephalus; posterior; province; record; reptiles; sandy; sawa; scales; south; species; tail; view; west cache: binhm-84.pdf plain text: binhm-84.txt item: #283 of 297 id: binhm-840 author: Hind Dyia Hadi; Noor Hussein Yousif title: A COMPARATIVE-MORPHOLOGICAL STUDY OF SKULLS IN TWO SPECIES OF CARNIVOROUS AND HERBIVOROUS MAMMALS date: 2023-06-20 words: 4079 flesch: 56 summary: Some studies utilizing computed tomography (CT) revealed that the bones of the skull consist of nasal bone, maxilla, palate, sphenoid bone, frontal bone, parietal bone, zygomatic bone, temporal bone with bulla tympanum, occipital bone, and mandible matched the results of the current study with wild rabbits whereas found that there is lake bone connection between the base of the skull and the temporal bone, with clearly differentiated occipital and temporal bone (Prebble and Meredith, 2014). CONCLUSIONS From the previous and current studies, it was concluded that the differences there are many dissimilarities due to the difference in species and the identical type as a result of the type of nourishment and the surrounding environment, where we need to know the types of bones in the skull; as well as the differences between the animals studied, where differences were found in terms of protrusion of bone in carnivores and their disappearance in keywords: anatomical; anatomy; animal; bone; bulletin; cape; choudhary; comparative; current; differences; dog; et al; eye; fox; frontal; hadi; hare; head; history; history museum; indian; iraq; iraq natural; jaw; journal; linnaeus; mandible; molars; morphological; museum; nasal; natural; natural history; number; occipital; orbit; palatine; premolars; presence; rabbit; red; red fox; research; singh; skull; species; studies; study; teeth; temporal; terms; veterinary; vulpes; yousif; zygomatic cache: binhm-840.pdf plain text: binhm-840.txt item: #284 of 297 id: binhm-841 author: Ghofran Hussein Sahood; Hanaa H. Al- Saffar; Feryal Bahjat Hermize title: REVISION OF THE GENUS XYLOCOPA LATREILLE, 1802 (HYMENOPTERA, APIDAE) WITH A NEW RECORD OF SPECIES IN IRAQ date: 2023-06-20 words: 3299 flesch: 56 summary: Atlas of the European Bees: genus Xylocopa. © Bulletin of the Iraq Natural History Museum Online ISSN: 2311-9799-Print ISSN: 1017-8678 https://doi.org/10.26842/binhm.7.2023.17.3.0519 https://orcid.org/0009-0008-9382-5023 https://orcid.org/0000-0002-3139-487X https://orcid.org/0000-0002-3951-4194 mailto:ghofran.hussein2104m@coagri.uobaghdad.edu.iq https://creativecommons.org/licenses/by/4.0/ https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home 520 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Revision of the genus Xylocopa Xylocopa Latreille, 1802 characterized by several morphological features that includes: head transvers, ocellar triangle ocelli arranged below the vertex, compound eyes larger in male, labial palp flattened and sheath like; antennae geniculate, three submarginal cells in the forewing, marginal cell of forewing short, submarginal cross veins developed, pterostigma absent, jugal lobe less than one fourth as long vannal lobe (Michener, 2007). keywords: 2018; 2021; adhab; agricultural; apidae; ascher; baghdad; bees; black; brown; bulletin; carpenter; cell; collected; densely; different; distribution; dorsal; frontal; genus; head; history; history museum; hottentotta; hymenoptera; iran; iraq; iraq natural; israel; journal; khalaf; lateral; latreille; linnaeus; lobe; museum; natural; natural history; olivieri; pickering; plant; plate; province; pubescens; punctate; rasmont; research; revision; sahood; setae; smith; species; specimens; study; submarginal; terzo; university; valga; view; xylocopa cache: binhm-841.pdf plain text: binhm-841.txt item: #285 of 297 id: binhm-85 author: Simon, George title: FIRST RECORD OF BOSTRICHUS CAPUCINUS ( L.) ( COLEOPTERA: BOSTRICHIDAE ) IN IRAQ date: 2014-07-01 words: 788 flesch: 68 summary: Before this, parts of leaden roofs at La Rochelle had been noticed not only gnawed but pierced from one side to the other by the larvae of Bostrichus capucinus (Figuier, 1968). Iraq ABSTRACT The species Bostrichus capucinus (L.) (Coleoptera:Bostrichidae) was reported as a new record for Iraq. keywords: beetles; bostrichidae; bostrichus; brown; bull; capucinus; coleoptera; diyala; fisher; george; hairs; iraq; larvae; long; middle; punctate; record; simon; species; wood cache: binhm-85.pdf plain text: binhm-85.txt item: #286 of 297 id: binhm-86 author: Mohammad, Mohammad K. title: THE CURRENT STATUS OF THE VERTEBRATE DIVERSITY IN Al-DALMAJ MARSH, Al-DIWANIYA PROVINCE date: 2014-07-01 words: 2352 flesch: 69 summary: Fig 4: Male Ferruginous duck Aythya nyroca Fig. 5: Hundreds of ferruginous ducks brought from Dalmaj marsh sold at a local market in Baghdad 13 Mohammad K. Mohammad Acrocephalus griseldis: The Basra Reed Warbler is a globally endangered bird (IUCN, 2013). Nature Iraq (2013) counted up to 900 breeding pairs in Dalmaj marsh. keywords: angustirostris; area; author; aythya; baghdad; beds; biodiversity; birds; breeding; bull; city; class; components; conservation; dalmaj; dalmaj marsh; dense; diversity; diwaniya; duck; east; ferruginous; fig; fishes; iraq; iucn; lake; local; mammals; marmaronetta; marsh; marshes; mohammad; nature; nyroca; open; parents; phragmites; plants; province; reed; salim; site; species; terrestrial; typha; vertebrate; water; zilli cache: binhm-86.pdf plain text: binhm-86.txt item: #287 of 297 id: binhm-87 author: Abdul-Rassoul, M. S. title: A NEW HOST RECORD FOR TOMATO LEAF MINER TUTA ABSOLUTA (MEYRICK, 1917) IN BAGHDAD PROVINCE, IRAQ date: 2014-07-01 words: 1197 flesch: 67 summary: The detection of tomato leaf miner, Tuta absoluta on alfalfa, Medicogo sativa reveals that this plant serves as host plant recorded for the first time in Iraq and this result goes with EPPO, 2009; Harizanova et al., 2009; Abdul-Ridha et al., 2012 and Portakaldli et al., 2013, that there is a shift in host plants from the main host Solanaceae to other families particularly the Fabaceae. These were infested by the tomato leaf miner, Tuta absoluta according to its blotch mines, which has a blotch with single line of frass. keywords: abdul; absoluta; alfalfa; baghdad; eppo; gelechiidae; host; iraq; leaf; lepidoptera; meyrick; miner; new; pest; plant; province; rassoul; record; sativa; solanaceae; time; tomato; tuta; tuta absoluta; على cache: binhm-87.pdf plain text: binhm-87.txt item: #288 of 297 id: binhm-88 author: Jan, Saadi K.; Al-Zubaidi, Aqeel A. title: SEDIMENTARY STUDY OF SHIRANISH FORMATION AT HIJRAN SECTION- NORTH IRAQ date: 2014-07-01 words: 1226 flesch: 66 summary: CONCLUSIONS Shiranish Formation at Hijran Section subdivided into four beds: dolostone bed, foraminiferal biomicrite bed, poorly washed biosparite bed and micrite bed. Vertical succession of Shiranish Formation refers to off-shore quite marine environment. keywords: 100x; aqeel; bed; biomicrite; content; diagenetic; dolomite; environment; foraminifera; formation; hijran; iraq; jan; marine; micrite; organic; petrography; planktonic; plate; pores; processes; pyrite; saadi; section; sedimentary; shiranish; study; zubaidi cache: binhm-88.pdf plain text: binhm-88.txt item: #289 of 297 id: binhm-89 author: Al-Moussawi, Azhar A. title: STOMACH NEMATODES OF THE SHOVELER ANAS CLYPEATA LINNAEUS, 1758 (ANSERIFORMES:ANATIDAE) WINTERING IN IRAQ date: 2014-07-01 words: 2255 flesch: 72 summary: In the present study the specimens of A. acutum were more than those of E.uncinatum. The present findings of A. acutum agree with Czaplinski (1962a)who gave the first detailed description of the morphology for A.acutum after the original description of Lundahl 1848. keywords: acutum; amidostomoides; amidostomum; anas; anterior; aquatic; azhar; birds; body; buccal; bull; capsule; clypeata; distance; end; epomidiostomum; female; gizzard; infection; iraq; kavetska; long; moussawi; nematodes; nerve; parasites; present; ring; shoveler; stomach; study; tetrameres; uncinatum; wide; wildlife; worms cache: binhm-89.pdf plain text: binhm-89.txt item: #290 of 297 id: binhm-90 author: Al-Zubaidy, Ali B.; Mhaisen, Furhan T. title: THE FIRST RECORD OF FOUR ISOPODS FROM SOME RED SEA FISHES, YEMENI COASTAL WATERS date: 2014-07-01 words: 6890 flesch: 71 summary: A second survey of fish parasites from Tigris River at Al-Zaafaraniya, south of Baghdad. Infection distribution of fish parasites in Basrah province and pathological effects of Saprolegnia sp. and its susceptibility to some plant extracts. keywords: 2007; abdullah; agric; ali; ameer; arabic; asmar; baghdad; balasem; barbi; barbus; basrah; carpio; checklists; coll; daraji; diplozoid; et al; fauna; fishes; freshwater; furhan; gibson; gussev; heckel; hosts; iraq; jubori; kasimii; kefah; khotenovsky; lake; luteus; macrostomum; mhaisen; monogenea; names; nasiri; niaeemi; nipponicum; paradiplozoon; parasites; parasitic; pavlovskii; posterior; province; pugachev; rahemo; rahman; region; river; saadi; sa’adi; sci; sharpeyi; species; study; synonym; thesis; tigris; time; univ; valid; vorax; xanthopterus cache: binhm-90.pdf plain text: binhm-90.txt item: #291 of 297 id: binhm-92 author: Ali, Basim A. Abd title: VARIATIONS OF WOOD ELEMENTS IN MAIN STEM OF ALBIZIA LEBBECK (L.) BENTH. GROWING IN BAGHDAD CITY, IRAQ date: 2014-07-01 words: 3292 flesch: 67 summary: General trend of relation between these traits and transvers position indicated that these dimensions increase as the distance increases from pith (Zha et al., 2005; Choudhury, et al. 2009; Ohshima et al., 2003), while others referred that variations were non-significant except for fiber-diameter (Pande et al. (2008) tree of Leucanealeucocephala), but Ishiguri, 2009 found that diameter of wood fibers was an almost constant value from pith to bark for the species Paraserianthes falcataria. The width of fiber appeared less than normal width of hard wood fibers. keywords: abc; abd; albizia; ali; anatomical; anti; baghdad; basim; benth; cell; conditions; density; diameter; dimensions; effect; elements; fiber; gravity; heartwood; height; increase; india; iraq; journal; khider; lebbeck; length; level; lewis; maximum; mean; pith; position; properties; radial; range; research; rico; sap; sapwood; significant; species; specific; specific gravity; stem; table; thickness; tree; tropical; value; variations; vessel; wall; width; wood cache: binhm-92.pdf plain text: binhm-92.txt item: #292 of 297 id: binhm-93 author: Majeed, Khansaa Rashed title: MORPHOLOGICAL AND ANATOMICAL STUDY OF ASPHODELUS MICROCARPUS date: 2014-07-01 words: 1635 flesch: 56 summary: Anatomical studies could be an important tool to resolve taxonomic problems of this genus, as anatomical studies showed variation in this study deals with the morphological and the anatomical features of the plant , The morphological characters of the studied plant species were examined externally by the naked eye and their characters were outlined. Asphodelus microcarpus is similar anatomically to Asphodelus aestivus. keywords: aestivus; anatomical; asphodelus; cells; characters; cheese; epidermis; family; features; genus; iraq; khansaa; leaf; leaves; liliaceae; long; lower; majeed; microcarpus; morphological; pantis; perennial; plant; species; stem; studies; study; taxonomic; upper; variation; vascular; white cache: binhm-93.pdf plain text: binhm-93.txt item: #293 of 297 id: binhm-94 author: Al-Saffar, hanaa H. title: SURVEY OF THE GENUS PHYTOMYZA FALLEN,1810 (DIPTERA: AGROMYZIDAE) OF IRAQ date: 2014-07-01 words: 1627 flesch: 68 summary: The paper showed there are four species of this genus during the work: Phytomyza horticola Gourear,1840; Ph. atricornis Meigen, 1838; Ph. rufipes Meigen,1830; Ph. ranunculi (Schrank,1803) Key words: Leaf miners, Agromyzidae, plantshosts, Phytomyza , Iraq fauna INTRODUCTION Agromyzidae is commonly referred to as the leaf –miners, for the feeding habit of larvae, most of which are leaf miners on various plants, some of them are stem borer of galls maker .The Phytomyza atricornis: is widely distributed in but lesser than Ph. horticola. keywords: agromyzidae; april; atricornis; baghdad; brassicae; british; bull; different; diptera; entomol; families; family; genus; hanaa; head; horticola; iraq; kerbala; larvae; leaf; miners; nejif; phytomyza; plants; rufipes; small; soc; species; spencer; survey; vein cache: binhm-94.pdf plain text: binhm-94.txt item: #294 of 297 id: binhm-95 author: Al-Janabi, Muhammad. I. G. title: A DESCRIPTION STUDY OF TWO LOCAL FISH HIMRI CARASOBARBUS LUTEUS (Heckel, 1843)(CYPRINIFORMES: CYPRINIDAE) AND HISHNI LIZA ABU (Heckel, 1843) (MUGILOIDEI : MUGILIDAE) BY BONES STAINING METHOD date: 2014-07-01 words: 1904 flesch: 65 summary: Since clear Histologic differences appeared in these two species, it was intended from this study the possibility of adopting a diagnosis between local fish species by staining bones and tissues. The method of staining bones is one of the means adopted in the study of tissue and bone, and organs too, through which taxonomic studies can be conducted among species of fish as stated by (Potthoff,1984).as well as differences between taxonomic species of fish known and conventional. keywords: 1991; abu; alizarin; baghdad; bones; carasobarbus; clarity; concentration; days; differences; distribution; figure; fish; fishes; formalin; hanken; heckel; himri; iraq; koh; length; liza; local; luteus; solution; species; staining; study; tissue cache: binhm-95.pdf plain text: binhm-95.txt item: #295 of 297 id: binhm-96 author: Al-Asady, Hassan S.; Amin, Abdulbaset M.; Younis, Sara Dasco title: A NEW SPECIES OF GRAPE-VINE LEAFHOPPERS, GENUS ARBORIDIA ZAKHVATKIN, 1946 (HOMOPTERA: CICADELLIDAE) FROM IRAQ date: 2014-07-01 words: 1399 flesch: 63 summary: 2.The presence of subouter apical cell in the forewing. ABSTRACT Among a collection of leafhoppers from Erbil Province in Kurdistan/Iraq, a new species of the genus Arboridia Zakhvatkin, 1946 was designated and described here as a new species to the science. keywords: apex; apical; arboridia; asady; base; brown; cell; cicadellidae; collection; deep; erbil; genus; grape; homoptera; inner; iraq; kurdistan; leafhoppers; like; margin; new; province; small; species; specimens; spots; typhlocybinae; vine; zakhvatkin cache: binhm-96.pdf plain text: binhm-96.txt item: #296 of 297 id: binhm-97 author: Hadi, Afkar M.; Faraj, Azhar A. title: ROLE OF DOMESTIC CATS FELIS CATUS AS RESERVOIR HOSTS OF INTERNAL PARASITES AND PROTOZOA IN BAGHDAD date: 2014-07-01 words: 2062 flesch: 60 summary: واالوالي المعوية في بغداد عينة منها احتوائها على ثمانية انواع من الطفيليات واالوالي المعوية بنسبة 31براز اظهرت :وكانت كمايلي %38.75اصابة كلية Toxocara cati(5%), Ancylostoma tubeforme(3.75%), Capillaria felis(3.75%), Isospora sp.(10%), Cryptosporidium parvum(3.75%), Cryptosporidium muris(6.25%), Toxoplasma gondi(3.75%), Giardia sp.(2.5%). The aim of this study is identification of gastrointestinal parasites and protozoa in cats. keywords: ancylostoma; baghdad; cati; cats; cryptosporidium; different; dogs; domestic; fecal; feces; felis; gastrointestinal; giardia; health; helminthes; house; infected; infection; iraq; medicine; mosul; parasites; parasitology; prevalence; protozoa; public; rate; results; samples; single; species; stray; study; total; toxocara; toxoplasma; toxoplasmosis; university; veterinary; بغداد cache: binhm-97.pdf plain text: binhm-97.txt item: #297 of 297 id: binhm-99 author: Al-Saffar, hanaa H. title: SURVEY OF BRACHYCERA FLIES ON ALFALFA date: 2018-10-13 words: 1559 flesch: 72 summary: The previous records of Brachycera flies of alfalfa in Iraq Derwesh, 1965; El-Haderi et al 1972; Al-Ali 1977 and Al- Saffar 2003, 2011 announced to some flies associated with alfalfa. 2 Survey of Brachycera Flies on Alfalfa MATERIAL AND METHODS Specimens were collected from alfalfa field of several regions of Iraq in period from February to November (2012) by standard sweeping net and collecting leaf miners by bring the infested leaves to laboratory and put them in Petri dishes until the adult impressed. keywords: abu; alfalfa; atherigona; baghdad; brachycera; british; bull; calyptrate; diptera; entomology; families; family; flies; genera; ghraib; hanaa; insects; iraq; march; muscidae; new; november; oklahoma; pont; regions; saffar; sativa; small; species; study; suture; taji; university; wing cache: binhm-99.pdf plain text: binhm-99.txt