Bull 131 Ali et al. Bull. Iraq nat. Hist. Mus. December, (2018) 15 (2): 131-137 MOLECULAR IDENTIFICATION AND PHYLOGENETIC-TREE ANALYSIS OF MONIEZIA SPECIES FROM SHEEP IN AL- DIWANIYAH CITY Mansour Jadaan Ali Monyer Abdulameir Abd Alfatlawi * and Azhar Chafat Karawan Department of Microbiology, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq *Corresponding author: monyerr.abd@qu.edu.iq Received Date: 09 April 2018 Accepted Date:29 May 2018 ABSTRACT The present study was performed to detect the molecular and the phylogenetic identification of species that belonging to the genus of Moniezia Blanchard, 1891 which affected intestines of sheep in Al-Diwaniyah city, Iraq; fifty intestine samples were sought for the infestation of Moniezia spp. from the city slaughterhouse from 1 October to 30 November 2017, this tapeworm was found to infest the intestines of 13 sheep. For morphological identify the genus of this tapeworm, eggs from one gravid proglottid of the thirteen worms were examined, polymerase chain reaction (PCR) and the PCR-product- based sequencing were applied on 4 Moniezia tapeworms targeting a specific region of the 18S rRNA gene. The sequencing has shown 2 species of Moniezia, SP1 and SP2 ,these two species revealed close matching on the phylogenetic tree to an according to the current study findings, Moniezia spp. affect on sheep in the city of Al-Diwaniyah, Iraq, these findings give interesting information about the evolution history of this worm in the studied city. Keywords: Cestoda, Moniezia, PCR, Phylogeny, Sheep. INTRODUCTION The genus of Moniezia are considered as high prevalent worms that infest sheep intestines, the disease conditions by these worms lead to risky-economic crises around the world (Soulsby, 1982; Mazyad and El-Nemr, 2002). The characteristic scolex, neck, and strobili are the highly recognized parts of the worms. Cyclophyllidea and Anoplocephalidae are the order and the family of this genus respectively, each proglottid has repeated sexual parts for better differentiation of these worms; mites are considered the main intermediate hosts for Moniezia species that provide a source of infestation via feeding on grass (Denegri et al., 1998). Monieziasis is the term of illness that is caused by species of Moniezia, for this genus as a tapeworm has limited species such as M. expansa (Rudolphi, 1810), M. benedeni (Moniez 1879) and M. monarda (Ohtori et al., 2015).M. expansa affects sheep (high incidence), cattle, goats, swine, and very rarely human (El-Shazly et al., 2004; Gómez-Puerta, 2008). Young animals appear to be the main targets for the infestation by M. expansa (Wymann, 2008); http://dx.doi.org/10.26842/binhm.7.2018.15.2.0131 132 Molecular identification and phylogenetic-tree several proglottids that have sensory-organ-based anterior-scolexes, neck, and the strobilus are the main parts of this species. According to Brusca and Brusca, (1990), the sensory parts are present along the body of the worm and used for tactile stimulation; metrics of the parasite could be expanded as 8-10 meters in length and 1.5 centimeters in width (Chilton et al., 2007). To study the evolution history of Moniezia species in the city of Diwaniyah, Iraq, the present study was initiated to evaluate the identity matching or mismatching of the city species with global species that belonging to this genus. MATERIALS AND METHODS Intestines from 50 sheep (22 male, 28 female; 20 with age ˂6 months, 18 with age 6 to ˂12 months and 12 with age ˃ 12 months) were examined for the infestation of Moniezia spp. from the city slaughterhouse. To identify the genus of this tapeworm morphologically, eggs from one gravid proglottid of the thirteen worms were examined (Rahif, 1998); sequencing of the polymerase chain reaction (PCR) products were applied on four Moniezia tapeworms targeting a specific region of the 18S rRNA gene (743bp).The protocol of gSYAN DNA Extraction Kit (Gene aid, USA) was followed to extract the genomic DNA from the mature proglottids of the worms. Accu Power TMPCR Pre Mix (Bioneer, Korea) was performed to prepare the master mix using the manufacturer’s instructions. The primers (AY752651.1),F: TGCTACCCGCATGATGTTGT and R: ACACAGTTGGCTGCACTCTT were used in this study. (Wickström et al., 2005). The thermoc c er reaction- ased conditions were 1 c c e of initia denaturation at 5 C for 5min, 30 cycles of (denaturation at 5 C for sec, annea ing at 58 C for sec, and extension at 72 C for 1min), and 1 c c e of fina extension at 72 C for 5min. We had optimized these conditions previously to fulfill the amplification requirements for this study. Electrophoresis was used to separate the PCR products on a 1.5% agarose gel at 100 volts and 80 amp for 1hour; a UV-light-based imager was used to identify these products in the gel. Sequencing was applied on the positive-PCR products (Macrogen Company, Korea) employing AB DNA sequencing system. NCBI Websites and MEGA 6.0 software were utilized to analyze the evolutionary history of the species included in this study. The phylogenetic tree was generated via the use of the Maximum Composite Likelihood method by phylogenetic tree UPGMA method (Saitou and Nei, 1987; Tamura et al., 2013). RESULTS AND DISCUSSION Fifty intestines were examined for the infestation of Moniezia spp. in the city slaughterhouse; this tapeworm was found to infest the intestines of 13 sheep. Genital pore, cirrus sac, vitelline gland, testes, and inter-proglottid gland were noticed on the mature segments of the tapeworm (Pl.1). http://animaldiversity.org/accounts/Moniezia_expansa/#EFF1570A-25A5-48F3-8C4A-D225DDD2AE8C 133 Ali et al. Plate (1): Mature segments of Moniezia spp. (Genital pore, Cirrus sac, Vitelline gland, Testes, Inter-proglottid gland) Polymerase chain reaction (PCR) showed the product amplification at 743bp of the 18S rRNA gene (Pl.2); the PCR-product-based sequencing was applied on 4 Moniezia tapeworms targeting a specific region of the 18S rRNA gene. Plate (2): Agarose-gel-based electrophoresis. (SP 1 and 2 are positive for Moniezia spp. VC 1 and 2 are negative controls, M is the ladder (2000-100bp)) The sequencing has shown 2 species of Moniezia, SP1 (MH298620.1) and SP2 (MH298621.1), these species revealed close matching on the phylogenetic tree to an isolate from China (GU817405.1) (Diag.1). M -VC1 -VC2 SP1 SP2 134 Molecular identification and phylogenetic-tree K R 025526.1 M o n iezia exp an sa iso late F 18S rib o so m al R N A g en e p artial seq u en ce G U 817405.1 M o n iezia exp an sa iso late 2 18S rib o so m al R N A g en e p artial seq u en ce M o n iezia sp 1 18S rib o so m al R N A g en e M o n iezia sp 2 18S rib o so m al R N A g en e G U 817401.1 M o n iezia b en ed en i iso late 1 clo n e 1 18S rib o so m al R N A g en e p artial seq u en ce G U 817404.1 M o n iezia b en ed en i iso late 2 clo n e 2 18S rib o so m al R N A g en e p artial seq u en ce G U 817403.1 M o n iezia b en ed en i iso late 2 clo n e 1 18S rib o so m al R N A g en e p artial seq u en ce G U 817402.1 M o n iezia b en ed en i iso late 1 clo n e 2 18S rib o so m al R N A g en e p artial seq u en ce E F 606904.1 M o n iezia sp . B 1 18S rib o so m al R N A g en e co m p lete seq u en ce A Y 752651.1 M o n iezia sp . L M W -2004 18S rib o so m al R N A g en e co m p lete seq u en ce D ia g r a m (1 ): P h y lo g e n e tic -tre e a n a ly sis re lie d o n 1 8 S -rR N A -g e n e sp e c ific -re g io n se q u e n c in g . T h e se q u e n c in g h a s sh o w n 2 sp e c ie s o f M o n ie zia sp p ., S P 1 (M H 2 9 8 6 2 0 .1 ) a n d S P 2 (M H 2 9 8 6 2 1 .1 ). T h e se tw o sp e c ie s re v e a le d c lo se m a tc h in g o n th e p h y lo g e n e tic tre e to a n iso la te fro m C h in a (G U 8 1 7 4 0 5 .1 ). T h e c o m p a riso n w a s p e rfo rm e d u sin g N C B I-b a se d n u c le o tid e -n u c le o tid e w e b site . 135 Ali et al. According to the present study, the Moniezia spp. were found to be wide-prevalent and caused the infestation in sheep intestine, the morbidity of Moniezia infestation in the current study was 26%, which indicates a risky situation in which the disease caused by these tapeworms may lead to economic crises in Al-Diwaniyah city (Diop et al., 2015). In 2012, the species of this genus were detected in the intestines of camels, and that was according to a study performed by Anisimova (2012), this study was estimated the rate of infestation to be as 32.35% and 15.38% in Al-Diwaniyah and Al-Najaf cities respectively. The present study gives information that agrees partially with Fadl et al. (2011) who showed that the infestation of this tapeworm was 0.9% in sheep of Baghdad sampled regions; the infestation prevalence of these tapeworms may go high during spring and summertime, especially when having high numbers of mites. Identifying the morphology of the five Moniezia tapeworms were performed using a modified Carmen stain in which genital pore, cirrus sac, vitelline gland, testes, and inter- proglottid gland were noticed on the mature segments of the tapeworms, and these results agree with Melhorn (2001). The PCR results showed the amplification of the specific region of the 18S rRNA gene (743bp) in these tapeworms, and this agrees with (Nguyen et al., 2012) who used the same technique; the results of the sequencing identified these tapeworms in the intestine of the tested sheep in the city, and the phylogenetic tree provided information that our species were matched up with a Chinese strain; this matching may indicate a certain relation between our strain and the Chinese one which could be as a result to have come from the same ancestor. According to the current study findings, Moniezia spp. affect sheep in the city of Al- Diwaniyah, Iraq; these findings give interesting information about the evolution history of this worm in the studied city. LITERATURE CITED Anisimova, E. I. and Al-Fatlawi, M. A. A. 2012. Moniezia expansa (Moniex, 1879) in camels (Camelusdromedarius) in central Iraq. Kufa Journal for Medical Veterinary Sciences, 3(2): 111-116. Brusca, R. and Brusca, G. 1990. Invertebrates. Sunderland, M. A.: Sinauer Associates, 636 pp. Chilton, N., O'Callaghan, M., Beveridge, I. and Andrews, R. 2007. Genetic markers to distin- guish Moniezia expansa from M. benedeni. Parasitology Research, 100: 1187. Denegri, G., Bernadina, W., Perez-Serrano, J. and Rodriguez-Caabeiro, F. 1998. Anoplocephalid cestodes of veterinary and medical significance: a review. Folia Parasitologica, 45(1): 1-8. Diop, G., Yanagida, T., Hailemariam, Z., Menkir, S., Nakao, M., Sako, Y., Tidiane Ba, C. and Ito, A. 2015. Genetic characterization of Moniezia species in Senegal and Ethiopia. Parasitology International, 64(5): 256-260. El-Shazly, A. M., Morsy, T. A. and Dawoud, H. A. 2004. Human Monieziasis expansa: the first Egyptian parastic zoonosis. Journal of the Egyptian Society Parasitology, 34 (2): 380–381. http://animaldiversity.org/accounts/Moniezia_expansa/#13B3C0E4-599F-42E3-9F69-D63C2FB8408A 136 Molecular identification and phylogenetic-tree Fadl, S. R., Kalef, D. A. and Abbas, S. M. 2011. Prevalence of parasitic infection in Sheep From different Regions in Baghdad. The Iraqi Journal of Veterinary Medicine, 1:204-209. Gómez-Puerta, D. 2008. Occurrence of Moniezia expansa in dometic pig. Veterinary Parasitology, 33: 191-194. Mazyad, S. A. M. and El-Nemr, H. I. 2002. The endoparasites of sheep and goats, and shepherd in North Sinai Governorate, Egypt. Journal of the Egyptian Society Parasitology, 32(1):119-126. Melhorn, H. 2001. Encyclopedic reference of parasitology. Berlin, Springer,1062 pp. Nguyen, T. D., Le, Q. D., Huynh, V.V., Nguyen, S. T., Nguyen, T. V. and Vu-Khac, H. 2012. The development of PCR methodology for the identification of species of the tapeworm Moniezia from cattle, goats and sheep in central Vietnam. Journal of Helminthology, 86(4): 426-429. Ohtori, M., Aoki, M., and Itagaki, T. 2015. Sequence differences in the internal transcribed spacer 1 and 5.8S ribosomal RNA among three Moniezia species isolated from ruminants in Japan. The Journal of Veterinary Medical Sciences, 77(1): 105-107. Rahif, R. H. 1998. The modification in the preparation of classical Carmen stain and there technique used for staining of Platyhelminthes (Cestodes and Trematod). The Veterinarian, 8(2):1-8. Saitou, N., and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4: 406–25. Soulsby, E. J. L. 1982. Helminths, arthropods and protozoa of domesticated animals. 7th ed. London, BailliereTindall, 329 pp. Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0., Molecular Biology and Evolution, 30: 2725–2729. Wickström, L. M., Haukisalmi, V., Varis, S., Hantula, J. and Henttonen, H. 2005. Molecular Phylogeny and Systematics of Anoplocephaline Cestodes in Rodents and Lagomorphs. Systematic Parasitology, 62(2): 83-99. Wymann, M. N. 2008. Gastrointestinal parasite egg excretion in young calves in periurban livestock production in Mali. Research in Veterinary Science, 84(2):225-231. 137 Ali et al. Bull. Iraq nat. Hist. Mus. December, (2018) 15 (2): 131-137 من االغنام في مدينة Moniezia ونوا الجن أل وءالتحديد الجزيئي وتحليل شجرة النش الديواونية ، منير عبد االمير عبد الفتالوي و ازهار جفات كروان منصور جدعان علي العراق، الديواونية، جامعة القادسية، كلية الطب البيطري، فر االحياء المجهرية 80/90/8902: تاريخ القبول 90/90/8902 :تاريخ االستالم الخالصة ي والجزيئي لديدان االونوا العائدة للجن التحديد النشوئاجريت الدراسة للكشف عن Moniezia Blanchard, 1891 التي تؤثر على امعاء االغنام في مدينة الديواونية ، . العراق معي اغنام للبحث عن االصابة بأونوا هذا الجن في مجزرة المدينة، اذ 05تم استخراج تشخيص المظهري لغرض ال فرداً من االغنام31ذه الديدان الشريطية في امعاء وجدت ه وناضجة بصبغة الكارمن مبينة االشكال صبغت خمسة قطع جسمية. لجن هذه الديدان .التناسلية البالغة لهذه الدودة عند تطبيق تفاعل اونزيم البلمرة المتسلسل ودراسة تعاقب القواعد النتروجينية الربعة ، حيث 16S rRNAالستهداف منطقة خاصة من جين Moniezia ديدان من جن ؛ كما اظهر هذان النوعان SP2و SP1، اظهرت دراسة التعاقب ونوعان من هذا الجن فأن ، استنادا لنتائج الدراسة الحالية، تطابقا متقاربا في شجرة النشوء من عزلة من الصين تعطي هذه النتائج . العراق، تصيب االغنام في مدينة الديواونية .Moniezia sppاونوا .قة الدراسةمعلومات ملفتة لالونتباه عن تأريخ التطور لهذه الدودة في منط