Bull 689 Bull. Iraq nat. Hist. Mus. (2025) 18 (3): 689-700. https://doi.org/10.26842/binhm.7.2025.18.3.0689 ORIGINAL ARTICLE MORPHOLOGICAL AND MOLECULAR STUDY OF CHEWING LICE INFESTING POULTRY IN BASRAH PROVINCE, IRAQ Zahraa S. Al-Shabibi and Alaa N. Hatem * Department of Biology, College of Education for Pure Sciences, University of Basrah, Basrah, Iraq. Corresponding author: alaa.hatem@uobasrah.edu.iq Received: 22 Feb. 2025, Revised: 24 May 2025, Accepted: 25 May 2025, Published:20 June 2025 This work is licensed under a Creative Commons Attribution 4.0 International License ABSTRACT Birds are exposed to infection by various ectoparasites, including chewing lice (Order: Phthiraptera), which affect nearly all avian species. The present study aimed to diagnose the species of lice parasitizing poultry using morphological traits, and molecular analysis (PCR). Additionally, the study included the construction of a phylogenetic tree of the among the species sequenced on the basis of genetic sequencing by using 18S rRNA. The survey was conducted during the period from November 2023 to October 2024. A total of 300 chickens and pigeons were examined from different locations in Basrah Province. In the study, four species were recorded, and registered in GenBank with the following accession numbers: PQ636457 to Columbicola columbae (Linnaeus,1758), PQ636458 to Campanulotes bidentatus (Scopoli,1763), PQ636459 to Menacanthus stramineus (Nitzsch,1818), and PQ636460 toMenopon gallinae (Linnaeus,1758). Keywords: Birds, Chewing lice, Chicken, Molecular Characterization, Pigeon. INTRODUCTION Birds were among the first animals to be domesticated by humans. They have been used for thousands of years for various purposes, including livestock industry (Alemu et al.,2015). Birds, like other animals, are exposed to infestations by external parasites, such as lice, ticks, and mites (Oliveira et al., 2011). These infections affect bird behavior and physiology due to the activity of the parasites within the tissues or through the secretion of some substances that may be harmful (Wall and Shearer, 1997). The physiological activities of bird bodies are affected by hosts, leading to reduced their nutritional performance (Alemu et al., 2015). Parasitic infections can result in stunted growth and decreased egg production (Saikia et al., 2017). Ectoparasites are also dangerous to birds because can they transmit many pathogens, including bacteria, viruses and fungi, and therefore, transmitting infection to healthy birds (Saif et al., 2003). External parasites cause significant health issues in birds and can even lead to death. Additionally, they may act as addition to being intermediate hosts for endoparasites (Derakhshanar et al., 2006). Poultry are infected with many ectoparasites, the most important BULLETIN OF THE IRAQ NATURAL HISTORYMUSEUM Iraq Natural History Research Center & Museum, University of Baghdad https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home Copyright © Bulletin of the Iraq Natural History Museum Online ISSN: 2311-9799, Print ISSN: 1017-8678 https://doi.org/10.26842/binhm.7.2025.18.3.0689 https://orcid.org/0009-0008-7506-1234 https://orcid.org/0000-0003-0713-9913 mailto:alaa.hatem@uobasrah.edu.iq https://creativecommons.org/licenses/by/4.0/ https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home 690 Bull. Iraq nat. Hist. Mus. 18 (3): 689-700. Morphological and molecular study of which is chewing lice, which attacks chickens, especially prevalent in open farming systems , such as rural farming and poultry farms (Wall, 2007). Lice are the most widespread parasites in birds and are found on different parts of the body, such as the head, chest, wings, and abdomen (Mccrea et al., 2005). They feed by biting feathers and skin, and it completes its life cycle on the host (Wall and Shearer, 1997). Lice are wingless insects, with a body divided into a head, thorax and abdomen, and have legs modified for clinging to feathers (Pickworth and Morishita, 2007). They are equipped with claws and have antennae that are visible or hidden in a groove on the head. The eyes are vestigial or absent (Lehane, 2005). Adult lice typically range in length from 2-3 mm. Among their distinguishing characteristics is that they have a broad, triangular head that is wider than the thorax, and their mouthparts are of the chewing type (Pape and Roza, 2005). Recently, all lice species are classified classified under the order Phthiraptera, which includes four suborders: Ischnocera, Amblycera, Rhyncophthirinae and Anoplura. The old classification included the first three orders (also known as Biting lice or Chewing lice) were grouped under the order Mallophaga (Mullen and Durden, 2019). This study is important because it fills there is a gap in the molecular identification of lice species in Iraq. MATERIALS AND METHODS Study area: Lice samples were collected from 300 birds - 142 domestic chickens Gallus gallus (Linnaeus, 1758), and 158 domestic pigeons Columba livia J. F. Gmelin, 1789 randomly selected from different rural and urban areas of Basrah Province. The study was conducted from November 2023 to October 2024. There are differences in environmental and geographical characteristics among these areas of collection. Some of which are agricultural, and others are residential. Sampling, preservation and Photography of specimens: Specimens were examined visually throughout the year, focusing specific regions regions of the bird’s body such as the head, neck, wings, and perianal area. Lice were collected and preserved in 70% ethyl alcohol. Morphological identification was performed using standard identification keys (Barriga, 1995; Kareem, 2006). Identification was confirmed by the Iraq Natural History Research Center and Museum at the University of Baghdad. Lice were placed in a 10% sodium hydroxide solution. Then washed with distilled water. The specimens were passed through some concentrations of ethyl alcohol, then transferred to xylol. Each specimen was placed on a glass slide, stained with Canada Balsam, and covered with a cover glass. The specimens were examined under a dissecting microscope (Leica Wild M3) and photographed using an advanced imaging system. Molecular study of chewing lice using PCR technology: Molecular identification of lice species was conducted through DNA analysis using the PCR (Polymerase chain reaction). This procedure was carried out at the Iraqi association for medical researches and studies in Baghdad. DNA extraction: Lice specimens were redried by leaving them exposed to room temperature for 24 hours, then ground using a ceramic mortar to obtain a homogeneous powder. After that 18S rRNA was used for DNA amplification; type of primers (forward and reverse) are 691 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Al-Shabibi and Hatem showed in Table (1). The Thermocycler software included steps shown in Table (2), and performed an electrical relay of the products of PCR. Electrophoresis: Electrophoresis of the PCR products was performed after completing the PCR process using a 100bp DNA Ladder and DNA was extracted from 18 samples. The reaction components are as listed in Table (3). Sequence analysis: Samples of PCR products for sequencing the 18S rRNA gene of the selected samples of the lice were sent to Macrogene Company in Korea. The studied segments were aligned and filtered using the Blast program. The sequence segments of each species were registered in the gene bank. RESULTS Morphological study In this study, four species of chewing lice were collected from chickens and pigeons. Two species were found infesting pigeons: Columbicola columbae Linnaeus,1758, and Campanulotes bidentatus (Scopoli,1763). While, the other two species were recorded on chickens: Menacanthus stramineus (Nitzsch,1818) and,Menopon gallinae Linnaeus (1758). Below is a brief morphological description of the above species: 1- Columbicola Columbae Linnaeus,1758: An elongated body, dark gray in colour, found on the wings. The head is rounded anteriorly, and the antennae have five segments. The head has six pairs of hairs laterally, and a pair of hairs ventrally. The mesothorax is partially separated from the back, and has a tuft of hairs laterally, with lower hair density on the metathorax. Abdominal rings are elongated and narrow, and at the end of the abdomen, there are a few hairs of various lengths. Abdominal segments have three long hairs laterally (Pl.1A). 2- Campanulotes bidentatus (Scopoli,1763): A small bodied species, found in various parts of the host’s body. The head is triangular in shape, and rounded anteriorly; the temporal region appears wide. Head with long hairs laterally, and no ventral spine in the front of the head. The maxillary palps and jaws are small and dark in color. The antennae are filiform and composed of five segments, with the basal segment being square. The thorax is separated in the middle, while the middle unites with the back. The abdomen is short and oval, with few hairs, and the segments are separate. The end of the abdomen is irregular in shape (Pl.1 B). 3- Menacanthus stramineus (Nitzsch,1818): A large-bodied species, dark yellow in color, found all over the host’s body. The head is triangular in shape and rounded ventrally. The antennae are club-shaped and hidden inside a cavity. The mandibles consist of four segments. The prothorax is triangular, and the Mesothorax and Metathorax are fused and bear dense hairs. The abdomen is oval with long hairs, but there are short hairs laterally. Abdominal segments have two rows of short hairs and three rows of transverse hairs dorsally (Pl.1C). 4- Menopon gallinae (Linnaeus,1758): A medium sized body, light yellow in color, found on feather blades. The head is triangular dorsally with lateral temporal areas. A small set of hairs 692 Bull. Iraq nat. Hist. Mus. 18 (3): 689-700. Morphological and molecular study is present on the top of the head and three hairs laterally. The antennae are capitate, with four segments partially drawn inward. The mandibles are large and dark. The prothorax is separated from the Mesothorax and Metathorax. Thoracic segments have a set of medium- length hairs. The abdomen consists of seven segments; the fourth is the largest, and has tuft of hairs of varying length dorsally. A pair of long hairs is present laterally, and three rows of fine hairs are at the end (Pl.1 D). Identification key for chewing lice species of pigeons in the current study: 1. Antennae visible and composed of 5 segments; body slender, head longer than wide ………….……………………………………………………………. Columbicola columbae - Antennae not clearly visible; body with oval shape, head equal in length and width …………………………………………………………………..…. Campanulotes bidentatus Identification key of chewing lice species of chickens in the current study: 1. Head with a pair of spines-like ventrally, abdomen densely covered with setae; 12 setae on the dorsal plates of the metathorax and mesothorax………………………. …M. stramineus - Head without spine-like structures, abdomen not densely covered with setae …………………………………………………………………………..…Menopon gallinae Molecular study DNA extraction and amplification: Extracted DNA concentrations ranged from 25to35 μg/μL, with A260/A280 purity ratios between 1.6–1.8. The results of electrophoresis on agarose gel showed successful amplification of the 18S rRNA gene using specialized primers (Pl. 2). Nucleotide sequences of PCR-amplified 18S rRNA fragments were aligned and compared with GenBank reference sequences using BLAST, revealing identity levels between 95% and 100%. The size of the PCR fragments ranged from 300 to 350 base pairs. All lice species were subjected to similarity analysis using the BLAST program, and the 18S rRNA gene sequences of the selected species were documented in GenBank, with an independent accession number assigned to each fragment (Tab. 4). Phylogenetic tree of the species: The results are shown of the phylogenetic tree of the 18S rRNA gene among the lice species in the current study, along with their corresponding species worldwide are presented. Columbicola columbae showed the highest similarity to the Dohuk specimens (MN588094.1), indicating regional genetic homogeneity. The species Campanulotes bidentatus was closely related to the isolate GU569170.1 from Japan. The species Menacanthus stramineus was similar to the isolate MN588078.1 from Duhok, Iraq. The species Menopon gallinae showed similarity to the isolate GU569169.1 from Japan (Diag. 1). 693 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Al-Shabibi and Hatem DISCUSSION The results of the present study witnessed the recorded four species of chewing lice parasitizing local chickens and pigeons in Basrah Province. The species Columbicola Columbae was recorded for the first time in Iraq by Abu Al-Hab (1975). It is characterized by its elongated body and the length of the head. It is also characterized by the presence of transverse bands on the fifth to seventh ventral segments. The antennae are black-gray or brown in colour, consisting of five pieces (Crespo et al., 2012). While Campanulotes bidentatus was recorded for the first time in Iraq by Khalaf (1959). It is characterized by the absence of spine-like appendages at the front of the head, and by filiform antennae consisted of five pieces in both sexes (Kareem, 2006). The species Menacanthus straminus was first recorded in Iraq by Al-Hubaity (1976). It is characterized by containing thorn-like appendages on the ventral side of the head and by the presence of two rows of transverse hairs on the third to seventh ventral rings and the presence of numerous short hairs on the dorsal side of the mesothorax and metathorax (Mani, 1974). The species Menopon gallinae was also recorded for the first time in Iraq by Al-Hubaity (1976); it is characterized by the absence of spine-like appendages at the front of the head and on the base of the jaw texture (Emerson, 1956). Other studies in Iraq related to chewing lice parasitizing birds include those by Al-Mawla and Al-Saffar (2008), Al-Iraqi and Hamad- Ameen (2012), Hatem et al. (2021), and Al-Neema and Al-Hayali (2024). The molecular identification of lice remains inconsistent due to a lack of sufficient information about molecular traits. Morphological similarity does not represent genetic similarity, as it sometimes places the phenotypic characteristics among different species close to each other due to external similarities, making them appear as one species (Brown et al, 2000). DNA extraction techniques and their polymerase reaction method have significantly advanced the accurate identification of species (Wells et al., 2001). In the current study, specialized primers commensurate with the studied species in order to obtain 18S rRNA gene sequences. This contributed to finding congruence in the diagnosis of the studied species. The high matching rates of the genetic sequences of the studied species can indicate their close correlation, as it was shown through the results of alignment of the sequences with the sequences preserved in the gene bank (Xu et al., 2024). A phylogenetic tree was constructed for the studied species. The phylogenetic tree of chewing lice is often constructed via a combination of molecular data, such as DNA sequences and chromosomal variation, and morphological data features, like body shape, hairs, and mouthparts (Xu et al., 2024). Smith (2001) was the first to use a phylogenetic approach to investigate lice relationships, as he used EFl and 18S rRNA nuclear genes to take a molecular approach. This study is consistent with the result of Al-Badrani and Al-Muftti (2023) in the Kurdistan Region, who also used 18S rRNA primers in what was the first molecular study of chewing lice in Iraq. Other Iraqi research on the molecular characterization of biting lice on birds, were the study of Al-Neema and Al-Hayali (2024). Globally, in Vietnam, Najir et al. (2014) 694 Bull. Iraq nat. Hist. Mus. 18 (3): 689-700. Morphological and molecular study conducted molecular identification of seven lice species in ten species of wild birds using the COI gen. In Saudi Arabia, Alajmi et al. (2021) recorded six species of chicken lice using COI gene analysis. Table (1): Type of primers (forward and reverse). Size bpTMSeq.Design primers 2060CF:TGAAACCGCGAAAGGCTCAT R: TACCCGTTACCACCACGGTA 18s rRNA 2060CF:TGTCTCAGTGCAAGCCGAAT R:TCCGGGAGTGGGTAATTTGC 18s rRNA Table (2): PCR reaction components. Components Volume (µl) Master Mix 12.5 Primers Forward 1 Reverse 1 DNA sample 6 Nuclease-Free water 4.5 The total volume of the reaction 25 Table (3): The program for selected gene amplifications. Steps Temperature (°C) Time Cycles Initial Denaturation 95 5 min 1 Denaturation 95 30 sec 30Annealing 57±5 30 sec Extension 72 30 sec Final extension 72 7 min 1 Table (4): Percentage of Match of the Target 18s rRNA Gene. Sequence with the species preserved in the Genebank and Genbank Accession Numbers. Species Accession number of Genbank Number of Species Matching in Genbank Gene name Matching ratio Columbicola columbae PQ636457 MN588094.1 18S rRNA 98.43% Campanulotes bidentatus PQ636458 GU569170.1 18S rRNA 100% Menacanthus stramineus PQ636459 MN588078.1 18S rRNA 99% Menopon gallinae PQ636460 PQ636460 18S rRNA 95% 695 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Al-Shabibi and Hatem Plate (1): The species of chewing lice that recoded in the study: (A) Columbicola columbae, (B) Campanulotes bidentatus, (C) Mencanthus stramineus, (D) Menopon gallinae. Plate (2): Electrophoresis of PCR amplification products for the 18S rRNA gene in the studied species. A B C D 696 Bull. Iraq nat. Hist. Mus. 18 (3): 689-700. Morphological and molecular study Diagram (1): The Phylogenetic tree of the 18S rRNA gene among the species of chewing lice in Basra - southern Iraq. CONCLUSIONS The species of chewing lice found on local chickens differ in morphological characteristics from those found on domestic pigeons. Molecular identification of species is a modern and highly reliable method. Some lice species showed very close genetic relationships based on the sequence of the gene 18S rRNA. ACKNOWLEDGMENTS The authors wish to express their gratitude to all those who assisted in completing this study. In particular, we mention Dr. Razzaq Shalan Augul and Dr. Hanaa H. Al-Saffar at the Iraq Natural History Research Center and Museum, University of Baghdad, for their great help in diagnosing the study specimens. Also, we thank Sadiq Mithal's office in Baghdad for their assistance in photographing the study specimens. CONFLICT OF INTEREST STATMENT “The authors have no conflicts of interest to declare”. LITERATURE CITED Abu-Alhab, J. 1975. Biting lice of chicken and pigeon in Baghdad area. Bulletin Biological Research Center Publication, 4 (10): 3-16. [Click here] Alajmi, R. A., Metwally, D. M., El-Khadragy, M. F., Yehia, H. M., El-Ashram, S., Almusawi, Z. and Abdel-Gaber, R. 2021. Molecular identification of Campanulotes bidentatus Scopoli, 1763 (Phthiraptera, Philopteridae) infecting the domestic pigeon Columba livia from Saudi Arabia. Saudi Journal of Biological Sciences, 28(4): 2613-2617. [Click here] https://agris.fao.org/search/en/providers/123819/records/647360dc2c1d629bc97e538e https://pubmed.ncbi.nlm.nih.gov/33911972/ 697 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Al-Shabibi and Hatem Al-Badrani, M. A. and Al-Muffti, S. A. 2023. Survey and prevalence of lice infestation the pigeons (Columba livia domestica) in Kurdistan Region-Iraq. Rafidain Journal of Science, 32(1): 1-8. [Click here] Alemu, N., Muktar, Y., Kassaye, D. and Hiko, A. 2015. Prevalence of lice and fleas in backyard chickens of Bishoftu Town, Ethiopia. American-Eurasian Journal of Agricultural and Environmental Sciences, 15(11): 2136-2142. [CrossRef] Al-Hubaity, A. 1976. Studies on the parasites of fowl, Gallus domesticus L. in Mosul district, Iraq. M.Sc. thesis, college Science University of Mosul, 213pp. [CrossRef] Al-Iraqi, R. A. and Hamad-Ameen, K. H. 2012. Study of biting chicken lice and its seasonal fluctuation in Erbil Governorate, Iraq. Iraqi Veterinary Medical Sciences, 26: 137- 141. [CrossRef] Alneema, M. S. and Alhayali, N. S. 2024. Molecular identification of Linognathus spp. lice infesting sheep and goats in Mosul city, Iraq. Iraqi Journal of Veterinary Sciences, 38(4): 963-968. [CrossRef] AL-Saffar, T. M. and AL-Mawla, E. D. 2008. Some haematological changes in chickens' infection with ectoparasites in Mosul, Iraq. Journal Veterinary Science, 22(2): 95- 100. [Click here] Barriga, O. O. 1995. Veterinary parasitology. Editora Greyden Press, Columbus, 468pp. [Click here] Brown, J. M., Mc Peek, M. A. and May, M. L. 2000. A phylogenetic perspective on habitat shifts and diversity in the North American Enallagma damselflies. Systematic Biology, 49: 697-712. [ResearchGate] Crespo, J. G., Vickers, N. J. and Goller, F. 2012. Antennal lobe organization in the slender pigeon louse, Columbicola columbae (Phthiraptera: Ischnocera). Arthropod Structure and Development, 41(3): 227-230. [CrossRef] de Oliveira, J. B., Santos, T., Vaughan, C. and Santiago, H. 2011. External parasites of raptors (Falconiformes and Strigiformes): Identification in an exsitu population from Mexico. Revista de Biología Tropical, 59(3): 1257-1264. [CrossRef] Derakhshanar, A., Radfar, M. H. and Taefinasrabadi, N. 2006. A study on parasites of the digestive system and related lesions of pigeons in city of Kerman, Iran. Master thesis, Faculty of Veterinary Medicine, University of Kerman, Iran, 135pp. [Click here] Emerson, K. C. 1956. Mallophaga (Chewing lice) occurring on the domestic chicken, Journal of Kansas Entomological Society, 29 (2): 63-79. [Click here] https://phthiraptera.myspecies.info/node/96751 https://doi.org/10.5829/idosi.aejaes.2015.15.11.10181 DOI:%2010.25271/2014.2.1.110. https://doi.org/10.33899/ijvs.2020.166888 https://doi.org/10.33899/ijvs.2024.149864.3670 https://www.cabidigitallibrary.org/doi/pdf/10.5555/20103019385 https://www.ebay.com/itm/116397267179 https://www.researchgate.net/publication/11263160_A_phylogenetic_perspective_on_habitat_shifts_and_diversity_in_North_American_Enallagma_damselflies https://doi.org/10.1016/j.asd.2012.02.008 https://doi.org/10.15517/rbt.v0i0.3396 https://www.scielo.sa.cr/scielo.php?script=sci_arttext&pid=S0034-77442011000300026 https://www.vin.com/doc/?id=3852498 https://phthiraptera.myspecies.info/sites/phthiraptera.info/files/4417.pdf 698 Bull. Iraq nat. Hist. Mus. 18 (3): 689-700. Morphological and molecular study Hatem, A., Abou Turab, M., Abdul-Zahra, H. K. and Muhammad, M. 2021. A survey of chewing lice of some raptors in southern Iraq, with remarks on prevalence and occurrence. Iraqi Journal of Veterinary Sciences, 35(2): 239-244. [CrossRef] Kareem, D. K. 2006. Systematic study of sucking and chewing lice on some vertebrates with epidemiology of head lice in Basrah province. PhD Thesis. Science College, Basrah University, 195 pp. (In Arabic). [Click here] Khalaf, K. T. 1959. A collection of insects from Iraq. Iraq Natural History Museum Publication, 17:1-27. [Click here] Lehane, M. J. 2005. The biology of blood sucking in insects, published in the United State of America by Cambridge University press, New York, 226: 113-117. [Click here] Mani, M. S. 1974. Modern classification of insects. Satish book enterprise, India, 220pp. [Click here] McCrea, B., Jeffer, J. S., Ernst, R. A. and Gerry, A. C. 2005. Common lice and mites of poultry: Identification and treatment. ANR Publication, 8162: 1-6. [CrossRef] Mullen, G. R. and Durden, L. A. 2019. Medical veterinary entomology. Third edition, Academic Press, 741pp. [CrossRef] Najer, T., Sychra, O., Kounek, F., Papousek, I. and Hung, N. M. 2014. Chewing lice (Phthiraptera: Amblycera and Ischnocera) from wild birds in southern Vietnam, with descriptions of two new species. Zootaxa, 3755(5): 419-433. [Click here] Pape, A. and Roza, L. 2005. Parasite biodiversity and host defenses: Chewing lice and immune response of their avian hosts. Oecologia, 142(2): 169-170. [CrossRef] Pickworth, C. L. and Morishita, O. 2007. Common external parasites poultry: Lice and mites, Factsheet. Veterinary Press Medical University, Ohio, p. 1-4. [Click here] Saif, Y. M., Barnes, H. J., Glisson, J. R., Fadly, A. M., Mc Dougald, C. R. and Swayne, D. E. 2003. Diseases of poultry (11th ed.). Iowa State Press, Blackwell Publishing Co., 34pp. [Click here] Saikia, K., Bhattacharjee, P. C., Sarmah, D. K. and Mushahary, D. 2017. Prevalence of ectoparasitic infestation of pigeon (Columba livia domestica) in Assam, India. Journal of Entomology and Zoology Studies, 5(4): 1286-1288. [Click here] Smith, V. S. 2001. Avian louse phylogeny (Phthiraptera: Ischnocera): a cladistics study based on morphology. Zoological Journal of the Linnean Society, 132 (1): 81-144. [CrossRef] https://doi.org/10.33899/ijvs.2020.126717.1365 https://library.alkafeel.net/dic/elending/ https://pinhm.uobaghdad.edu.iq/index.php/pinhm/article/view/27 https://web.natur.cuni.cz/parasitology/vyuka/LekEnt_CV/The%20Biology%20of%20Blood-Sucking%20in%20Insects.pdf http://www.printsasia.com/book/modern-classification-of-insects-m-s-mani?srsltid=AfmBOooInH3x_Lve7hhSN6p54eA3WCwij323tNfBQ_-97ZEdQZFEVoLl http://dx.doi.org/10.3733/ucanr.8162 https://anrcatalog.ucanr.edu/pdf/8162.pdf https://doi.org/10.1016/C2017-0-00210-0 https://www.gbif.org/dataset/983cd41b-52fc-46b3-a35d-c70f1ea43740 http://dx.doi.org/10.1007/s00442-004-1735-8 https://www.thepoultrysite.com/articles/common-external-parasites-in-poultry-lice-and-mites https://himakahaunhas.files.wordpress.com/2013/03/disease-of-poultry.pdf https://www.entomoljournal.com/archives/?year=2017&vol=5&issue=4&ArticleId=2200 https://doi.org/10.1006/zjls.2000.0264 699 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Al-Shabibi and Hatem Wall, R. 2007. Ectoparasites: Future challenges in a changing world. Veterinary Parasitology, 148 (1): 62-74. [CrossRef] Wall, R. and Shearer, D. 1997. Veterinary Entomology. Arthropod Ectoparasites of Veterinary Importance. Springer Science+Business Media Dordrecht, 439 pp. Wells, J. D., Pape, T. and Sperling, F. A. H. 2001. DNA-based identification and molecular systematics of forensically important Sarcophagidae (Diptera). Journal of Forensic Sciences,46(5): 1098-1102. [CrossRef] Xu, Y., Ma, L., Liu, S., Liang, Y., Liu, Q., He, Z., Tian , L., Duan, Y. , Cai, W., Li, H. and Song, F. 2024. Chromosome-level genome of the poultry shaft louse Menopon gallinae provides insight into the host-switching and adaptive evolution of parasitic lice. GigaScience, 13: giae004. [CrossRef] https://doi.org/10.1016/j.vetpar.2007.05.011 https://doi.org/10.1520/JFS15105J https://doi.org/10.1093/gigascience/giae004 700 Bull. Iraq nat. Hist. Mus. 18 (3): 689-700. Morphological and molecular study Bull. Iraq nat. Hist. Mus. (2025) 18 (3): 689-700. البصرة، محافظة في الدواجن على القارضالتطفل للقمل وجزيئية مظهرية دراسة العراق حاتـم نـاظم ــلء و الصاحب ـبد صكبان زهراء العراق. البصرة، البصرة، جامعة الصرفة، للعلوم التربية كلية الحياة، ـلوم قسم 2025/5/25 النشر: ،2025/5/25 القبول: ،2025/5/24 2025/2/22،الراجعة: اسستلم: اخالصة )رتبة القارض القمل ومنها الختلفة الخارجية الطفيليات من بعدد الطيور تصاب هذه هدفت لذا ا. تقريبب الطيور أنواع جميع ـلى يتطفل والذي ،(Phthiraptera القمل طريق ـن النزلي والحمام الدجاج ـلى تتطفل التي القمل أنواع تشخيص إلى الدراسة إنشاء البحث تضمن كما .PCR تقانة باستخدام الجزيئي والتحليل الظهرية الصفات مقارنة وتمت .18S rRNA باستخدام ا وراثيب تسلسلها تم التي النواع بين تطورية شجرة الجينات. بنك في التوفرة بالبيانات التسلسل بيانات العدد بلغ .2024 الول تشرين 2023إلى الثاني تشرين من الفترة الل الدراسة أجريت أربعة سجلت البصرة. محافظة في مختلفة مواقع من طائر 300 والحمام للدجاج الكلي الضوء تسليط وتم مظهريا، النواع هذه شخصت الدراسة. في القارض القمل من أنواع بواسطة جزيئيا النواع هذه تشخيص تم وكما التشخيصية. الظهرية الصفات أهم ـلى يأتي: وكما محددة انضمام بأرقام GenBank في النواع تسجيل وتم .PCR تقانة للنوع PQ636458 و ،Columbicola columbae (Linnaeus,1758( للنوع PQ636457 للنوع PQ636459و ،Capanulotes bidentatus (Scopoli,1763( للنوع PQ636460و ،Menacanthus stramineus (Nitzsch,1818( .Menapon gallinae (Linnaeus,1758(