Bull 801 Bull. Iraq nat. Hist. Mus. (2025) 18 (4): 801-814. https://doi.org/10.26842/binhm.7.2025.18.4.0801 ORIGINAL ARTICLE DNA BARCODING OF NORTH AFRICAN CATFISH CLARIAS GARIEPINUS (BURCHELL, 1822) (SILURIFORMES, CLARIIDAE) FROM TIGRIS RIVER, IRAQ Hind Dyia Hadi *, Atheer Hussain Ali **and Suhad Hamza Mohammed Ali* *Iraq Natural History Research Center and Museum, University of Baghdad, Baghdad, Iraq **Department of Fisheries and Marine Resources, College of Agriculture, University of Basrah, Basrah, Iraq Corresponding author: suhad.h@nhm.uobaghdad.edu.iq Received: 1 May 2025, Revised: 2 Aug. 2025, Accepted: 5 Aug. 2025, Published:20 December 2025 This work is licensed under a Creative Commons Attribution 4.0 International License ABSTRACT The conservation for biodiversity in Iraqi freshwater environments is important to protecting native species from the environmental impacts of alien species. Clarias gariepinus (Burchell, 1822) (Siluriformes, Clariidae) has been recognized as an alien species in Iraqi water bodies. This study aims to use molecular DNA to identify this catfish and trace its origins using. The DNA sequences of C. gariepinus were done using the mitochondrial DNA cytochrome c oxidase subunit 1 (COI) gene, and a specific primer set. The polymerase chain reaction (PCR) amplification was used to align the COI gene as a barcoding marker. After analysis, the sequences were compared with sequences in the National Center for Biology Information (NCBI) database using BLAST. Molecular analysis and genetic sequence reconstruction revealed that the COI gene is instrumental in the genetic identification of C. gariepinus. The phylogenetic tree indicated a close genetic link between the Iraqi samples and populations from China and North Korea, suggesting that these may represent the closest known lineages to the origin of this species in Iraq. The findings showed that the selected COI gene is a reliable indicator for tracking the origin of alien catfish populations in the Iraqi environment. This study contributes to the development of molecular detection of alien species in Iraq. The accession numbers LC868421 and LC868422 were employed to submit the sequences to the NCBI GenBank database. Keywords: Commercial, Culture, Forward primer, Reproduction, Shwaka. INTRODUCTION North African catfish, Clarias gariepinus (Burchell, 1822), is a freshwater Clariid fish which occupies tropical and subtropical areas (Omitoyin, 2007; Barasa et al., 2014). It is a commercial fish, and commonly cultured in beyond sub-Saharan Africa; This catfish is subjected to variation of physicochemical criteria including human interventions, harsh BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Iraq Natural History Research Center & Museum, University of Baghdad https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home Copyright © Bulletin of the Iraq Natural History Museum Online ISSN: 2311-9799, Print ISSN: 1017-8678 https://doi.org/10.26842/binhm.7.2025.18.4.0801 https://orcid.org/0000-0002-0779-0194 https://orcid.org/0000-0002-2541-968x https://orcid.org/0009-0007-8737-0117 mailto:suhad.h@nhm.uobaghdad.edu.iq https://creativecommons.org/licenses/by/4.0/ https://jnhm.uobaghdad.edu.iq/index.php/BINHM/Home 802 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish ecological environment e.g. temperature and salinity, accordingly it leads to an imbalance in the ecosystem (Chandra Segaran et al., 2023). Their indigenous distribution includes lakes, reservoirs, as well as rivers throughout sub- Saharan Africa, which additionally was imported to South America, Southeast Asia, and Europe (Truter et al., 2023). The distribution of African catfish in Syria is confined to a few warm springs, with a production rate gradually increasing. Semi-intensive culture is prevalent in earthen ponds, whereas intensive culture in cages is restricted to small number of farms located in large reservoirs (FAO, 2025). Iraq is identified to be a member of the regions where this catfish has been introduced (Bartley, 2006; Froese and Pauly, 2024). De Silva et al. (2009) revealed that about 12% of aquaculture productivity consisted of non- native species fish. Nevertheless, increasing anthropogenic activities will make tolerant non-native fish into an invasive species. Singh and Lakra (2011) concluded that in spite of exhibiting appealing cultural traits, typically diminish the availability of native species and invade lakes and rivers, thereby negatively impacting fish biodiversity and aquatic environments. Numerous studies have focused on its growth, reproduction, and physiology due to its high economic value (Nwani et al., 2014). However, there is inadequate research regarding the genetic characteristics about this catfish, particularly its mitochondrial genome (Barasa et al., 2014). DNA analysis is a powerful tool for investigating species' genetic structure (Menezes et al., 2012; Haldar and Nath, 2020). DNA barcoding was introduced as a swift, precise, automated, in addition to being globally accessible technique enabling species identification and differentiation (Hebert et al., 2003). The procedure involves sequencing a short portion of a DNA barcode from an unidentified species; it would be compared with information from a barcode database from recognized species, consequently offering an alternate to morpho-taxonomy approach (Falade et al., 2016). The vertebrate cytochrome c oxidase I (COI) gene shows a phylogenetic signal compared to numerous other genes (Boopathi et al., 2004; Strüder-Kypke and Lynn, 2010). This study aims to use the COI gene to carry out a DNA identification with phylogenetic study of African catfish in Tigris River. MATERIALS AND METHODS Study area: The Shwaka Region is an old residential neighborhood next to Al-Karkh in the Baghdad, situated on both banks of the Tigris River, within coordinates 33°20′16″N, 44°23′15″E. Its location is shown on the map of Iraq (Map 1). Sample collection: A total of two mature North African catfish, Clarias gariepinus, were collected by fishermen using gill nets in June 2024. The samples ranged in length from 550 to 630 mm and in body weight from 470 to 565 g. The fish were transported in a temperature-controlled container with crushed ice to the laboratory of the Iraq Natural History Research Center and Museum, University of Baghdad. 803 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hadi et al. Map (1): Sampling areas. (Designed by ArcGIS Online https://www.arcgis.com/index.html) DNA Extraction: DNA was isolated from two specimens of Clarias gariepinus, using approximately 20 mg of muscle tissue from the right pectoral fin, which was immediately conserved within absolute ethanol (100%) with a DNA extraction kit (addbio/Korea, Cat. no. 10023). Genomic DNA was isolated according to Sambrook et al. (1989) then analyzed by 1% agarose gel electrophoresis, afterwards visualized using a UV transilluminator. The final concentration and purity of DNA extractions were assessed using NanoDrop by analyzing 2 μl of each DNA sample at two wavelengths (260 and 280 nm). Amplification and polymerase chain reaction PCR: A fragment of approximately 455 base pairs was amplified from the 5' region of the COI gene using universal fish primers. The forward primer Fish F1 5’ (CTAGCAGGTGTCTCATCAATTCT) 3’ and the reverse primer Fish R1 5’ (GCTCGGGTGTCTACATCTATTC) 3’ are listed in Table (1). The temperature profile involved the starting denaturation step around 94ºC about 5 minutes, afterwards undergoing 35 cycles of 94ºC for 30 seconds, 52ºC within 30 seconds, then 72ºC for 30 seconds, concluding with a final extension at 72ºC for 5 minutes followed by a hold at 4ºC. The PCR results were analyzed using 1.5% agarose gel electrophoresis at 70 volts throughout 60 minutes. The PCR products were transferred to Macrogen (Korea) for bidirectional sequencing using the Sanger method. 804 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish Table (1): Details of Polymerase Chain Reaction composition Component Component Volume GoTaq Green Master mix 25 μL F primer 2 μL R primer 2 μL Template DNA 4 μL Nuclease-free water 17 μL Total reaction volume 50 μL Data analysis: The sequencing of the PCR products was sent to Macrogen / Korea using the forward and reverse primers. The findings have been analyzed via Bioedit software. Data of a similar organism’s genomes located in the National Center for Biotechnology Information (NCBI) GenBank which had already been studied in numerous countries around the world utilizing the Basic Local Alignment Search Tool (BLAST), were compared through multiple sequence alignment. Sequencing results indicated 97–99% concordance with reference sequences by Molecular Evolutionary Genetics Analysis (MEGA X), and a molecular phylogenetic tree was constructed through Maximum Likelihood (ML) to estimate genetic variation among sequences. The degree of precision of the derived phylogenies was evaluated using the 500 bootstrap replicates (Kumar et al., 2018). RESULTS A total of two mature Clarias gariepinus were identified, following the classification established by Hadi et al. (2024). Order: Siluriformes Family: Clariidae Clarias gariepinus (Burchell, 1822) (Pl. 1). Common names: North African catfish. Synonyms: Silurus gariepinus Burchell, 1822 Macropteronotus charmuth Lacepède, 1803 Clarias capensis Valenciennes, 1840. Plate (1): Lateral view of Clarias gariepinus. The selected gene of C. gariepinus underwent PCR amplification, followed by electrophoresis of the products, which were subsequently visualized using a UV transilluminator. The final amplified product was 455 bp in size for the COI gene. https://www.fishbase.se/summary/FamilySummary.php?ID=139 http://researcharchive.calacademy.org/research/ichthyology/catalog/getref.asp?id=17293 http://researcharchive.calacademy.org/research/ichthyology/catalog/getref.asp?id=17293 805 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hadi et al. Sequencing of the COI gene was conducted to ascertain the genotype of C. gariepinus obtained from Baghdad. The examination of a gene's sequence involves the use of forward and reverse primers, which are essential components of the technique of sequencing. The findings from the nucleotide alignment showed 97 to 98% identity with C. gariepinus sequences in GenBank showing the identities varied from 97% to 98% with C. gariepinus (Tab. 2). Partial cds of the mitochondrial gene COI were matched with the corresponding reference sequence accessible within the Gene Bank at the NCBI. Diagrams (1, 2) exhibited that the partial sequence in addition to the pairwise sequence comparison was performed on the sequenced samples. The current findings revealed a total of 455 base pairs at the 5' end for the COI mtDNA region in two sequenced samples. The optimal phylogenetic tree was derived from partitioned maximum likelihood; the analysis illustrated the genetic relationships among the studied samples, as depicted in Diagram (3), showing two sub-branches. One branch showed that the local sample C1 (C. gariepinus) constituted a sister group to the local sample C2 (C. gariepinus). A genetic affinity was detected between the local samples (C1 and C2) and the reference sequences of C. gariepinus from North Korea (KM261768) and China (NC_027661), derived from the same gene. Another branch shown to be local samples (C1 and C2) exhibited a resemblance to the conventional sequencing of C. gariepinus for the identical gene from Hungary (KT809508.1), Germany (XM_053485204), United Kingdom (PQ197863.1), and Netherlands (XM_053485208.1). Table (2): Sample IDs showing Similarity Searches in Sequence Alignment Reference copy (NCBI data) Scientific Name Country Percentage of Identity % Accession Number for our study Sample ID NC_027661 Clarias gariepinus China 98.72% LC868421 C1 KM261768 Clarias gariepinus North Korea 98.72 % KT809508.1 Clarias gariepinus Hungary 97.19 % XM_053485204 Clarias gariepinus Germany 97.19 % PQ197863.1 Clarias gariepinus United Kingdom 99.08% LC868422 C2 NC_027661 Clarias gariepinus China 99.23 % KM261768.1 Clarias gariepinus North Korea 99.23 % XM_053485208.1 Clarias gariepinus Netherlands 97.19 % 806 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish Diagram (1): Pairwise alignment of partial coding sequences of the cytochrome c oxidase subunit 1 mitochondrial (COI) gene from C. gariepinus (C1) The Query is the specimen sequence, and the subject is the GenBank sequence. 807 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hadi et al. Diagram (2): Pairwise alignment of partial cds, cytochrome c oxidase subunit 1 mitochondrial (COI) gene of Clarias gariepinus (C2) The Query is the specimen sequence, and the subject is the GenBank sequence. 808 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish Diagram (3): Phylogenetic tree of Clarias gariepinus produced using partial sequences of the mitochondrial cytochrome c oxidase subunit I (COI) gene. The tree has been produced via the Maximum Likelihood (ML) method within MEGA X software, with 500 bootstrap replicates to assess node support. Local samples (C1 and C2) show high similarity to reference sequences from C. gariepinus originating from different countries. DISCUSSIONS Advancements in sequencing technology are becoming indispensable in ecology, evolution, and conservation through allowing swift species identification by DNA barcoding while markedly decreasing costs and time; mainly sequencing offers significant opportunities to biologists; it was aligned with developments in computing and sequencing technologies, which allowed for the rapid creation of a library of DNA barcodes applicable to all known species (Page, 2016; Gostel and Kress, 2022). The present study demonstrated that the selected portions of the COI gene were chosen due to their extensive taxonomic representation in nucleotide databases. The COI gene has shown accuracy in studies of genetic variation and geographic distribution across numerous fish species. The findings have revealed that the slow mutation rate of the COI gene designates it as an optimal DNA marker for conducting genetic research (Antoniou and Magoulas, 2014). Many works have exhibited that DNA polymorphism for C. gariepinus is a little high (Galbusera, 1997; Barasa et al., 2014). Registration of C. gariepinus genes in the NCBI GenBank database will highlight the importance of monitoring exotic species in Iraq. The utilization of COI gene sequencing as a molecular marker was designed to provide high correctness and particularity, as prior research had looked at fish phylogeny with the COI gene in mtDNA. In this investigation, the C. gariepinus was caught, classified and identified, depending on its morphological features. In most cases using morphological 809 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hadi et al. characteristics alone in the identification of fauna species is complex, absence of up-to-date taxonomic revisions, new combination and arising synonyms, according to continuous changes in nomenclature rules may prevent accurate identification of exotic species (Rosen and Bailey, 1963; Koutsikos et al., 2017). When utilizing mtDNA sequencing to fix their species differences, molecular data are definitive for identifying the alien species (Schories et al., 2009; Ho et al., 2016). The assessment of species is necessary for preventing biodiversity impairment. A DNA barcoding is considered as powerful tool be in control of the proliferation of invasive species, the observation of freshwater habitat, and helping the rapid identification of alien fish globally. These genetic means improve management efficiency by helping in the reduction of repeated introductions along with the limiting or eradication of non-native fish populations (Agdamar and Tarkan, 2019). According to this study, the phylogenetic tree of the COI gene in Iraqi C. gariepinus samples showed a high degree of genetic similarity to populations in China and North Korea, revealing a common ancestor. Van der Walt et al. (1993) uncovered significant evidence for inheritance with mutations in most cage populations when analyzing the genetic variety in C. gariepinus. Popoola et al. (2014) stated that the gradual elimination of species genetically varied in nature as a result of hatchery-raised fish escaping or fries being released which may make C. gariepinus vulnerable to loss of genetic diversity and variability. Ezilrani and Christopher (2015) found that genetic variation among fish species enhances adaptation to changing environmental conditions, which may arise from spontaneous mutations or migration to genetically distinct populations. The present findings align with the study of Han et al. (2015), who applied the COI gene to characterize catfishes, specifically C. gariepinus in China. The complete mitochondrial genome sequence of C. gariepinus was sequenced using 17 primer pairs. Diyaware et al. (2018) studied the genetic variation regarding wild with farmed populations of C. gariepinus throughout Nigeria to enhance the species via selective breeding; DNA sequencing findings reveal a close genetic link between these strains. Chalermwong et al. (2023) studied the COI, cytochrome b (Cytb) genes, and D-loop sequences of 37 catfish species. The Cytb gene was determined as particularly suitable for differentiating catfish and can be considered a standard region for DNA barcoding due to its greater sequence variability. CONCLUSIONS This study represents the first to genetic investigation of the exotic fish African catfish in Iraqi freshwater ecosystem, with findings documented in the NCBI GenBank, performing as a reference sequence in the NCBI database (ID: LC868421, LC868422). The African catfish, is classified as C. gariepinus. The results confirmed the identity of the specimens as C. gariepinus, an exotic species now established in the different parts of Tigris River. DNA barcoding using the COI gene has demonstrated efficacy as a precise instrument for genetic identification, with the obtained sequences showing high similarity to reference populations 810 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish from China and North Korea, suggesting a possible shared lineage or introduction route. This work might be regarded as a new study on biodiversity and exotic fish species in the Tigris River. The significant expansion of C. gariepinus may pose a threat to indigenous fish species, alter the local ecosystem, and indicate rising levels of pollutants. ACKNOWLEDGMENTS We express our sincere gratitude to Prof. Dr. Hula Younis Fadhil Al-Sadi (College of Science, University of Baghdad) and Dr. Azhar A. Jaffar (Marshes Research Center, University of Thi-Qar) for their invaluable guidance and contributions to the molecular aspects of this study. CONFLICT OF INTEREST STATEMENT "The author has no conflicts of interest to declare". DECLARATION OF EDITORIAL INVOLVEMENT The first and second authors declare that they serve as a member of the Editorial Board of this journal. The manuscript was processed strictly in accordance with the journal’s standard editorial procedures, including assignment to independent peer reviewers and management by an editor with no conflict of interest. The authors had no involvement in the editorial handling or decision-making process. LITEREATURE CITED Agdamar, S. and Tarkan, A. S. 2019. High genetic diversity in an invasive freshwater fish species, Carassius gibelio, suggests establishment success at the frontier between native and invasive ranges. Zoologischer Anzeiger, 283: 192-200. [CrossRef] Antoniou, A. and Magoulas, A. 2014. Application of Mitochondrial DNA in stock identification. In: Steven, X., Cadrin, S. X., Kerr, L. A. and Mariani, S. (Editors). Stock Identification Methods, 2nd ed., Academic Press: Cambridge, p. 257-295. [CrossRef] Barasa, J., Abila, R., Grobler, J., Dangasuk, O., Njahira, M. and Kaunda-Arara, B. 2014. Genetic diversity and gene flow in Clarias gariepinus from Lakes Victoria and Kanyaboli, Kenya. African Journal of Aquatic Science, 39(3): 287-293. [CrossRef] Bartley, D. M. 2006. DIAS. Introduced species in fisheries and aquaculture: information for responsible use and control (CD-ROM). Rome, FAO. [Click here] Boopathi, E., Lenka, N., Prabu, S. K., Fang, J. K., Wilkinson, F., Atchison, M., Giallongo, A. and Avadhani, N. G. 2004. Regulation of murine cytochrome c oxidase Vb gene expression during myogenesis: YY-1 and heterogeneous nuclear ribonucleoprotein D-like protein (JKTBP1) reciprocally regulate transcription activity by physical interaction with the BERF-1/ZBP-89 factor. Journal of Biological Chemistry, 279(34): 35242-35254. [CrossRef] https://doi.org/10.1016/j.jcz.2019.10.002 https://doi.org/10.1016/C2011-0-07625-1 https://doi.org/10.2989/16085914.2014.933734 https://www.fao.org/fishery/docs/CDrom/aquaculture/a0805e/html/dias.htm https://www.jbc.org/article/S0021-9258(20)73101-7/fulltext https://doi.org/10.1074/jbc.M403160200 811 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hadi et al. Chalermwong, P., Panthum, T., Wattanadilokcahtkun, P., Ariyaraphong, N., Thong, T., Srikampa, P., Singchat, W., Ahmad, S. F., Noito, K., Rasoarahona, R., Artem Lisachov, A., Ali1, H., Kraichak, E., Muangmai, F., Chatchaiphan, S., Sriphairoj, K., Hatachote, S., Chaiyes, A., Jantasuriyarat, C Chailertlit, V., Suksavate, W., Sonongbua, J Srimai, W., Payungporn, S., Han, K., Antunes, A., Srisapoome, P., Koga, A., Duengkae, P., Matsuda, Y., Na-Nakorn, U. and Srikulnath, K. 2023. Overcoming taxonomic challenges in DNA barcoding for improvement of identification and preservation of clariid catfish species. Genomics Inform, 21(3): e39. [CrossRef] Chandra Segaran, T., Azra, M. N., Piah, R. M., Lananan, F., Téllez-Isaías, G., Gao, H., Torsabo, D., Kari, Z. A. and Noordin, N. M. 2023. Catfishes: A global review of the literature. Heliyon, 9: e20081. [CrossRef] De Silva, S. S., Nguyen, T. T., Turchini, G. M., Amarasinghe, U. S. and Abery, N. W. 2009. Alien species in aquaculture and biodiversity: a paradox in food production. Ambio: A Journal of the Human Environment, 38(1): 24-28. [CrossRef] Diyaware, M. Y., Suleiman, S. B., Alade, N. K. and Popoola, O. M. 2018. Genetic variability of wild and cultured strains of the African catfish (Clarias gariepinus Burchell, 1822) from North East Nigeria, using Microsatellite Markers. Nigerian Journal of Animal Science and Technology, 1(1): 1-9.[ResearchGate] Ezilrani, P. and Christopher, J. G. 2015. Genetic variation and differentiation in African catfish, Clarias gariepinus, assessed by heterologous microsatellite DNA. Indian Journal of Biotechnology, 14: 388-393. [Click here] Falade, M. O., Opene, A. J. and Benson, O. 2016. DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria. F1000Research, 5: 1268. [Click here] FAO. 2025. Fishery and aquaculture country profiles. In: Fisheries and Aquaculture. [Click here] Froese, R. and Pauly, D. (Eds). 2024. FishBase. World Wide Web electronic publication. version (02/2024). [Click here] Galbusera, P. 1997. The genetic variability of wild and inbred population of the African Catfish Clarias gariepinus (Burchell, 1822). Ph. D. Thesis, K.U. Leuven, Leuven, Belgium, 151pp. Gostel, M. R. and Kress, W. J. 2022. The expanding role of DNA barcodes: Indispensable tools for ecology, evolution, and conservation. Diversity, 14: 213. [CrossRef] https://doi.org/10.5808/gi.23038 https://doi.org/10.1016/j.heliyon.2023.e20081 https://doi.org/10.1579/0044-7447-38.1.24 https://www.researchgate.net/publication/337196455_Genetic_Variability_of_Wild_and_Cultured_Strains_of_the_African_Catfish_Clarias_gariepinus_Burchell_1822_from_North_East_Nigeria_using_Microsatellite_Markers file:///C:/Users/Ichthylogy/Desktop/IJBT%2014(3)%20388-393.pdf https://f1000research.com/articles/5-1268/v1 https://www.fao.org/fishery/en/collection/facp https://www.fao.org/fishery/en/collection/facp https://www.fishbase.se/search.php https://doi.org/10.3390/d14030213 812 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish Hadi, H. D., Baraaj, A. H., Ali, A. H. and Sajet, M. R. 2024. First record of the north African catfish Clarias gariepinus (Burchell, 1822) (Siluriformes, Clariidae) in Tigris River, Iraq. Bulletin of the Iraq Natural History Museum,18(2): 477-485. [CrossRef] Haldar, C. and Nath, S. 2020. DNA barcoding for fish species identification: current status and future prospective. International Journal of Fauna and Biological Studies, 7: 72-75. [Click here] Han, C., Li, Q., Xu, J., Li, X. and Huang, J. 2015. Characterization of Clarias gariepinus mitochondrial genome sequence and a comparative analysis with other catfishes. Biologia, 70(9):1245-1253. [CrossRef] Hebert, P. D., Cywinska, A., Ball, S. L. and DeWaard, J. R. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B: Biological Sciences, 270(1512): 313-321. [CrossRef] Ho, A. L. F. C., Pruett, C. L. and Lin, J. 2016. Phylogeny and biogeography of Poecilia (Cyprinodontiformes: Poeciliinae) across central and South America based on mitochondrial and nuclear DNA markers. Molecular Phylogenetics and Evolution, 101:32-45. [CrossRef] Koutsikos, N., Economou, N. A., Vardakas, L., Kommatas, D. and Zogaris, S. 2017. First confirmed record of an established population of sailfin molly, Poecilia latipinna (Actinopterygii: Cyprinodontiformes: Poeciliidae), in Europe. Acta Ichthyologica et Piscatoria, 47(3): 311-315. [CrossRef] Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6): 1547-1549. [CrossRef] Menezes, M. R., Kumar, G. and Kunal, S. P. 2012. Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D-loop region. Journal of Fish Biology, 80: 2198-2212. [CrossRef] Nwani, C. D., Ifo, C. T., Nwamba, H. O., Ejere, V. C. and Onyishi, G. C. 2014. Oxidative stress and biochemical responses in the tissues of African catfish C. gariepinus juvenile following exposure to primextra herbicide. Drug and Chemical Toxicology, 38(3): 278-285. [CrossRef] Omitoyin, B. O. 2007. Introduction to fish farming in Nigeria. Ibadan University Press Publishing House, University of Ibadan, Nigeria, 90 pp. https://doi.org/10.26842/binhm.7.2024.18.2.0477 https://www.faunajournal.com/archives/2020/vol7issue4/PartB/7-3-14-408.pdf http://dx.doi.org/10.1515/biolog-2015-0145 https://doi.org/10.1098/rspb.2002.2218 https://doi.org/10.1016/j.ympev.2016.04.032 https://doi.org/10.3750/AIEP/02234 https://doi.org/10.1093/molbev/msy096 https://doi.org/10.1111/j.1095-8649.2012.03270.x https://doi.org/10.3109/01480545.2014.947503 813 BULLETIN OF THE IRAQ NATURAL HISTORY MUSEUM Hadi et al. Page, R. D. M. 2016. DNA barcoding and taxonomy: dark taxa and dark texts. Philosophical Transactions of the Royal Society B: Biological Science, 371 (1702): 20150334. [CrossRef] Popoola, O. M., Fasakin, E. A. and Awopetu, J. I. 2014. Genetic variability in cultured and wild populations of Clarias gariepinus (Osteichtlys: Clariidae) using Random Amplified polymorphic DNA (RAPD) marker. Croatian Journal of Fisheries, 72: 5-11. [Click here] Rosen, D. E. and Bailey, R. M. 1963. The poeciliid fishes (Cyprinodontiformes), their structure, zoogeography, and systematics. Bulletin of the American Museum of Natural History, 126(1): 1-176. [Click here] Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, New York, 1659 pp. [Click here] Schories, S., Meyer, M. K. and Schartl, M. 2009. Description of Poecilia (Acanthophacelus) obscura n. sp., (Teleostei: Poeciliidae), a new guppy species from western Trinidad, with remarks on P. wingei and the status of the Endler’s guppy. Zootaxa, 2266: 35-50. [CrossRef] Singh, A. K. and Lakra, W. S. 2011. Risk and benefit assessment of alien fish species of the aquaculture and aquarium trade into India. Reviews in Aquaculture, 3(1): 3-18. [CrossRef] Strüder--Kypke, M. C. and Lynn, D. H. 2010. Comparative analysis of the mitochondrial cytochrome c oxidase subunit I (COI) gene in ciliates (Alveolata, Ciliophora) and evaluation of its suitability as a biodiversity marker. Systematics and Biodiversity, 8(1): 131-148. [CrossRef] Truter, M., Hadfield, K. A. and Smit, N. J. 2023. Chapter Two - Review of the metazoan parasites of the economically and ecologically important African sharptooth catfish Clarias gariepinus in Africa: Current status and novel records. Advances in Parasitology, 119: 65-222. [CrossRef] Van der Walt, L. D., Van der Bank, F. H. and Steyn, G. J. 1993. The suitability of using cryopreservation of spermatozoa for the conservation of genetic diversity in African catfish (Clarias gariepinus). Comparative Biochemistry and Physiology, 106(2): 313-318. [CrossRef] https://doi.org/10.1098/rstb.2015.0334 https://hrcak.srce.hr/119831 http://hdl.handle.net/2246/1123 https://www.cabdirect.org/cabdirect/abstract/19901616061 https://doi.org/10.11646/zootaxa.2266.1.2 https://doi.org/10.1111/j.1753-5131.2010.01039.x https://doi.org/10.1080/14772000903507744 https://doi.org/10.1016/bs.apar.2022.11.001 https://doi.org/10.1016/0300-9629(93)90519-A 814 Bull. Iraq nat. Hist. Mus. 18 (4): 801-814. DNA barcoding of North African catfish Bull. Iraq nat. Hist. Mus. (2025) 18 (4): 801-814. Clarias gariepinus (Burchell, 1822) ترميز الحمض النووي لجري شمال افريقيا Siluriformes, Clariidae) ) العراق ،في نهر دجلة اثير حسين علي ** و سهاد حمزه محمد* ، هند ضياء هادي* جامعة بغداد، بغداد، العراق -*مركز بحوث ومتحف التاريخ الطبيعي العراق ،ةالبصر البصرة،جامعة -كلية الزراعة والبحرية،** قسم الثروة السمكية 20/12/2025، النشر: 5/8/2025القبول: ،2/8/2025املراجعة: ،1/5/2025االستالم: الخالصة ُيعد الحفاظ على التنوع الحيوي في النظم البيئية للمياه العذبة الداخلية في العراق أمًرا بالغ األهمية لحماية األنواع األصلية من التأثيرات البيئية التي تسببها األنواع الغريبة. وقد تم تحديد Clarias gariepinus (Burchell, 1822) (Siluriformes, Clariidae) سمك جري شمال أفريقيا وراثًيا النوع هذا تحديد إلى الدراسة هذه هدفت العراقية. املائية املسطحات في غريب كنوع وتتبع أصله الساللي باستخدام الحمض النووي. ِدَم ْ ْسُتخ ُ مجموعة بادئات خاصة، وتقنية فضال عن ، ( كجين ترميزي COIجين امليتوكوندريا )ا الذي تمت COI(، لتضخيم مقطع جين PCRالتضخيم بواسطة التفاعل التسلسلي للبوليميرا ) .BLASTباستخدام أداة NCBIمواءمته الحًقا مع تسلسالت موجودة في قاعدة بيانات لتحديد النوع COIأن جين ،التحليالت الجزيئية وإعادة بناء الشجرة الوراثية بينت ً ُيعد فعاال وتلك العراقية العينات بين وثيقة جينية إلى وجود عالقة الوراثية الشجرة أشارت وراثًيا، كما من التجمعات هذه تكون أن احتمالية إلى يشير مما الشمالية، وكوريا الصين الى تنتمي التي املحدد COIوأظهرت النتائج أن جين أقرب السالالت املعروفة التي تمثل أصل النوع في العراق. سهم هذه يعد مؤشرا موثوقا لتتبع أصل مجموعات سمك السلور الغريبة في البيئة العراقية ُ . وت النتائج تسجيل تم حيث العراق، في الغريبة لألنواع الجزيئي الرصد نظام تطوير في الدراسة بيانات بـ. NCBI (ID: LC868421, LC868422)كمرجع في قاعدة بنك الجينات الخاص ضمن NCBI.