




































 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e1                                              Cancer Health Disparities 

RESEARCH 

MicroRNA 204 Mediated Negative 

Regulation of the IGF2R Promotes Breast 

Cancer Progression and is a Potential 

Mechanism Driving Breast Cancer Disparity 
Lourdes M Nogueira1,4, Clare E Burton1, Laurel Black1, Jasmine D Fox6, Kristi L Helke1, Elizabeth Garrett-

Mayer3-5, Dennis K Watson1,4,5, David P Turner1,4,5 and Victoria J Findlay1,4,5* 

Department of 1Pathology & Laboratory Medicine, 2Biochemistry & Molecular Biology, 3Public Health 

Sciences; 4College of Medicine, 5Hollings Cancer Center, Medical University of South Carolina, Charleston, 

SC, USA. 6South Carolina State University, Orangeburg, SC, USA. 

*Corresponding author’s email: findlay@musc.edu 

ABSTRACT 
In the US, African American women have a significantly higher rate of mortality due to breast cancer 

compared to Caucasian American women. Molecular differences in tumor biology exist between racial 

groups; however, their contribution to cancer disparity is not well understood. Our studies have 

identified a race-specific, mechanistic link between microRNA-204 and the IGF2R. The IGF2R is a tumor 

suppressor gene in several cancers including breast cancer and IGF2R levels are found at significantly 

lower levels in African American women with breast cancer when compared to their Caucasian 

counterparts. We observed elevated levels of miR-204 in serum of African American women with breast 

cancer when compared to Caucasian American women and identified IGF2R as a direct target of miR-

204. We show mechanistically that miR-204 mediated inhibition of IGF2R leads to activation of the IGF1R 

signaling pathway resulting in increased proliferation, migration and invasion, processes that are 

required for tumor progression. We developed a unique doxycycline-inducible miR-204 transgenic 

mouse model to define in vivo the oncogenic potential of miR-204 and the mechanism and functional 

consequences of IGF2R loss. We observed a significant increase in tumor growth and increased 

metastasis in these animals when compared to non-transgenic controls. This is the first characterization 

of miR-204 in an in vivo model. These data support a mechanism whereby miR-204 promotes tumor 

aggression through the IGF2-mediated hyperactivation of the IGF1R signaling pathway in response to 

direct negative regulation of the tumor suppressor IGF2R and that this could be a potential mechanism 

promoting breast cancer disparity. 

KEYWORDS: oncogenes, IGF2, breast neoplasms, transgenic mice, IGF1R 

Citation: Nogueira LM et al (2019) MicroRNA 204 Mediated Negative Regulation of the IGF2R Promotes 

Breast Cancer Progression and is a Potential Mechanism Driving Breast Cancer Disparity. Cancer Health 

Disparities 3:e1-e19. doi:10.9777/chd.2019.1016. 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e2                                              Cancer Health Disparities 

RESEARCH 

INTRODUCTION 

Breast cancer (BC) is a worldwide health issue as it 

represents the leading cause of cancer and 

remains the second leading cause of cancer-

related mortality in women. In the US, African 

American (AA) women have a significantly higher 

rate of BC mortality compared to Caucasian 

American (CA) women. Recent studies have 

highlighted the need for understanding the 

molecular basis of cancer disparities as these 

contribute to the observed differences in mortality 

that we observe in hormonally driven cancers 

(Albain et al., 2009).  

The Insulin-like Growth Factor 2 Receptor (IGF2R) 

is a transmembrane receptor that binds Insulin-like 

Growth Factor (IGF-2), resulting in its degradation 

via internalization and transport to lysosomes (Oka 

et al., 1985). Removal of IGF-2 from the 

extracellular environment precludes activation of 

the insulin-like growth factor 1 receptor (IGF1R); 

thus the IGF2R is believed to reduce the mitogenic 

effects of IGF-2. IGF2R is also involved in the 

activation of transforming growth factor beta 

(TGF-β) (Dennis and Rifkin, 1991) and may be a 

high affinity binding receptor for retinoic acid, an 

agent known to have diverse biological effects in 

both embryogenesis and oncogenesis (Kang et al., 

1997). Thus, important homeostatic controls 

regulating cell proliferation and apoptosis would 

be lost with the inactivation of IGF2R, suggesting 

that this receptor normally functions to inhibit 

tumor formation. Indeed, loss of heterozygosity 

(LOH) at the IGF2R locus has been reported in 

breast carcinomas, and somatic missense 

mutations of the remaining allele have altered 

ligand binding (Hu et al., 2006; Iwamoto et al., 

2006; Tsujiuchi et al., 2004). The IGF2R has been 

proposed to be a tumor suppressor gene given its 

antagonist role on cellular growth and evidence of 

LOH and loss-of-function mutations in several 

cancers including breast cancer (Chappell et al., 

1997; Chen et al., 2002; Hankins et al., 1996; Oates 

et al., 1998). More recently, studies have shown 

that reduced IGF2R expression correlates with 

poor patient prognosis in BC patients (Yu et al., 

1996) and that decreased IGF2R expression may 

contribute to BC disparity (Kalla Singh et al., 2010). 

This study shows that circulating IGF2 levels, a 

potent mitogen that signals through the IGF1R, are 

higher in breast tissue from AA women when 

compared to CA women. They further went on to 

show that IGF2R levels were significantly lower in 

AA breast tumor samples, important as IGF2R acts 

as a non-signaling sink for IGF2 thereby 

preventing its pro-survival signaling function. 

Importantly, IGF2 can also signal through the A 

isoform of the insulin receptor (IR-A) in many 

tumor types including breast cancer resulting in 

tumor promoting effects (Frasca et al., 1999; Ulanet 

et al., 2010).  

MicroRNAs (miRNAs) are small non-coding RNAs 

that are generally involved in the negative 

regulation of mRNA through seed sequences 

present within the 3’UTR of protein coding genes. 

They have been studied in mammalian species for 

almost two decades and have been shown to be 

involved in most all cellular processes. Each miRNA 

has multiple targets and each 3’UTR can be 

targeted by multiple miRNAs. Understanding the 

regulation of these small molecules is complex; 

however, great strides have been made in a 

relatively short amount of time.  

It should be noted that controversy surrounds the 

role of miR-204 in breast cancer , with some 

authors reporting miR-204 as a tumor suppressor 

(Imam et al., 2012; Li et al., 2014) and others, 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e3                                              Cancer Health Disparities 

RESEARCH 

including our group, reporting it as an oncogenic 

miRNA or “oncomir” (Findlay et al., 2008). 

MicroRNAs, by their nature, have been shown to 

play many different roles in different cellular 

contexts including both tumor suppressive and 

oncogenic roles. Classic examples of other miRNAs 

that have been shown to have context dependent 

tumor suppressive and oncogenic effects in breast 

cancer include miR-205 and miR-27 (Vimalraj et 

al., 2013). A recent review details the dual nature of 

miR-204 in cancer (Li et al., 2016).  

This study describes a mechanistic link between 

miR-204 and a novel direct target IGF2R. We 

developed a unique inducible miR-204 transgenic 

mouse model to examine for the first time, in an 

intact system, the oncogenic potential of miR-204 

and we show data to support a role for miR-204 

mediated activation of the IGF1R signaling pathway 

and propose that this could be a potential 

biological mechanism driving aggressive tumor 

growth.  

Materials and Methods 

Cell Culture and Reagents 

All cell lines were cultured and maintained at 37°C 

with 5% CO2. MDA-MB-231 and HEK293 cells were 

grown in DMEM media supplemented with 10% 

fetal bovine serum (FBS) and 100 U of 

penicillin/streptomycin (P/S). BT549 cells were 

grown in RPMI media supplemented with 10% FBS 

and 100 U of P/S. MCF10A and MCF12A cells were 

grown in DMEM:F12 (50:50) media supplemented 

with 2mM L-glutamine, 5% horse serum, 10µg/mL 

insulin, 20ng/mL epidermal growth factor (EGF), 

500ng/mL hydrocortisone, and 10µg/mL cholera 

toxin. The MCF10A with (control) and without 

IGF1R stably overexpressed were a kind gift of 

Adrian Lee (University of Pittsburgh, PA). All other 

lines were obtained from ATCC. Ethical approval 

for our work with human breast cancer cell lines 

was not required for our in vitro studies. All tissue 

culture reagents were purchased from Invitrogen 

(Carlsbad, CA). shIGF1R vectors were obtained 

from the Hollings Cancer Center genomics/shRNA 

shared technology resource. The IGF2R construct 

was a kind gift of Lukas Mach (University of 

Natural Resources and Life Sciences, Vienna 

(BOKU)). 

Transgenic Mice 

Animal care and procedures were approved by 

the Institutional Animal Care and Use Committee 

at the Medical University of South Carolina, 

Approval # ARC-2995. 

To generate the tet-regulatable miR-204 

transgenic mice, the 0.5-kb region surrounding 

miR-204 was amplified by PCR from the human 

genome using the following primers: TetO 204F 

5’-gcgcatcgatttggacccaga actattag-3’ and TetO 

204R 5’-gcgca ctagtggacagggtgatggagagg-3’ and 

cloned into the pTetO Splice vector (a kind gift of 

Dr. Tracy Vargo-Gogola, Indiana University School 

of Medicine). The clones were screened for miR-

204 induction and minimal leaky expression by 

transfection into the MCF7 TetO cell line (a kind 

gift of Dr. Tracy Vargo-Gogola, Indiana University 

School of Medicine). The resultant vector was 

confirmed by sequencing and was subsequently 

microinjected into the pronuclei of fertilized FVB/n 

oocytes by the Medical University of South 

Carolina Transgenic Mouse Core, yielding 6 

potential founder lines. Mice were maintained on 

an inbred FVB/n background. Bigenic mice were 

obtained by breeding TetO-204 mice to MTB 

(MMTV-rtTA) mice (a kind gift of Dr. Lewis 

Chodosh, Perelman School of Medicine, University 

of Pennsylvania), which contain the reverse tet 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e4                                              Cancer Health Disparities 

RESEARCH 

transactivator under the control of the MMTV 

promoter (Gunther et al., 2002). The TetO-

204/MTB bigenic mice were bred to MMTV-Neu 

transgenic mice (002376; Jackson Laboratories, Bar 

Harbor, Maine) to obtain trigenic TetO-

204/MTB/MMTV-Neu and control mice. All mice 

were maintained on an FVB/n background. For 

genotyping, PCR amplification of the MTB and 204 

transgenes was performed on genomic DNA 

prepared from tail cuts using the following 

oligonucleotide pairs: for TetO-204, 5’-

cacgaaattgcttctggtggc-3’ and 5’-

tcgaagatgttggggtgttgg-3’; reaction conditions 

were 98°C for 3 minutes followed by 40 cycles of 

98°C for 30 seconds, 62°C for 30 sec., 72°C for 1 

min., followed by a 10 min. extension at 72°C; for 

MTB 5’- TCCAAGGGCATCGGTAAACA-3’ and 5’-

GCATCAAGTCGCTAAAGAAG-3’; reaction 

conditions were 98°C for 3 min. followed by 30 

cycles of 98°C for 30 sec., 58°C for 30 sec, 72°C 

for 30 sec., followed by a 10 min. extension at 

72°C. Neu mice were genotyped following 

protocols supplied by Jackson Laboratories. To 

induce transgene expression, mice were fed 

doxycycline-containing chow (2g/kg ad libitum) for 

the duration of the study.  

Immunohistochemistry 

IHC was performed as described (Guo et al., 2013). 

The Ki67 antibody was used at a 1:200 dilution.  

Quantitative Real Time PCR 

Total RNA from cell lines was extracted using the 

RNeasyPlus Mini Kit (Qiagen; Valencia, CA). qPCR 

was performed on a Roche Light Cycler 480 as 

previously described (Guo et al., 2013). Primer 

sequences and UPL probe numbers are listed in 

Table 1. For microRNA analysis RNA was extracted 

from cell lines using the RNeasyPlus Mini Kit from 

Qiagen (Valencia, CA). 10ng total RNA was reverse 

transcribed using miR-204 specific primers using 

the Applied Biosystems reverse transcription kit as 

per the manufacturer's instructions. Real time PCR 

was performed with 1µl of reverse transcribed cDNA 

using the TaqMan Assay from Applied Biosystems 

as per the manufacturer's instructions on the Roche 

LightCycler 480 (Nutley, NJ). Triplicate reactions 

were run for each sample. The relative expression of 

each gene was quantified on the basis of Ct value 

measured against an internal standard curve for 

each specific set of primers using the software (2nd 

derivative max) provided by the instrument 

manufacturer (Roche, Nutley, NJ). 

Table 1. Primers (forward (F) and reverse (R)) and probes used in the study. 

Primer Name Primer sequence (5’ – 3’) Amplicon Length (nt) Probe # 

IGF2R (F) gagcgatacctctcaagtcaaag 

(R) gtgaggtctccatccgaatatc 

75 4 

IGF1R (F) ttcagcgctgctgatgtg 

(R) aagttcccggctcatggt 

75 7 

PUMA (F) ctgcctcaccttcatcagg 

(R) gcagagcacaggattcacag 

61 79 

NOXA (F) ggagatgcctgggaagaag 

(R) cctgagttgagtagcacactcg 

94 67 

GAPDH (F) agccacatcgctcagacac 

(R) gcccaatacgaccaaatcc 

66 60 

 

 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e5                                              Cancer Health Disparities 

RESEARCH 

Transfection of cell lines 

The cloning of miR-204 into pSuppressor-neo 

vector is already described (Findlay et al., 2008). 

For the generation of clonal stable MCF12A cells 

overexpressing miR-204 (204-1; 204-2), 

pSuppressor-neo vector (Imgenex; San Diego, CA) 

expressing miR-204 was transfected into MCF12A 

cells and stable cells were selected in medium 

containing G418. MCF10A cells were transiently 

transfected with the pSuppressor-neo vector. For 

inhibition studies, cells were transiently transfected 

with antisenseoligoribonucleotides (ASO) specific 

for miR-204 (ASO-204) or scrambled controls (scr). 

Cells were transfected with X-tremeGENETM siRNA 

transfection reagent (Roche, Nutley, NJ). 

Luciferase assays 

The IGF2R 3′UTR luciferase reporter vector 

(pMirTarget) was purchased from Origene 

(Rockville, MD). The sequence complementary to 

the seed of miR-204 was deleted with the primers 

IGF2RmutF 5’-GCTTCTATAACAGAAACTTTCAAGA 

GTTTTTGTGATGGGGGAGAGGG-3’ and 

IGF2RmutR 5’-CCCTCTCCCCCATCACAAAAAC 

TCTTGAAAGTTTCTGTTATAGAAGC-3’ using a 

QuikChange Site-Directed Mutagenesis Kit 

(Stratagene; La Jolla, CA). Mutated sequences 

were validated by sequencing at MWG Operon 

(Huntsville, AL). MCF12A cells were plated at 

50,000 cells per well in a 24-well plate. The 

pMirTarget reporter constructs (0.5μg, firefly 

luciferase) were co-transfected with pRL–TK 

(0.05μg, Renilla luciferase) using XtremeGene HP 

reagent as per the manufacturer’s instructions 

(Roche). Luciferase activity was measured after 48h 

using the dual luciferase reporter assay system 

(Promega, Madison, WI). Firefly luciferase activity 

was normalized to Renilla luciferase activity for 

each transfected well. 

Western blot analysis 

Cell lysate preparation and western blot analysis 

using enhanced chemiluminescence were performed 

as described previously (Findlay et al., 2008). 

Experimental antibodies include IGF2R (Santa Cruz 

Biotechnology, Dallas, TX), IGF1R, IRS-1, p-AKT, AKT, 

p-ERK and ERK, p-IGF1R, p-IRS1 (Cell Signaling 

Technology, Danvers, MA) and p-IR and IR (abcam, 

Cambridge, MA). GAPDH (Santa Cruz 

Biotechnology) was used as a loading control. 

Transwell migration and invasion assay 

Assays were performed as previously described 

(Guo et al., 2013). Images were taken at a 40X 

objective for analysis. 

Statistical analysis 

Sample size for mouse experiments n ≥ 9. For 

statistical testing, two-sided paired (in vitro assays) 

and two-sample (in vivo assays) Student's t-tests 

were performed using Excel (in vitro assays) and 

GraphPad Prism (in vivo assays). p-values are 

reported for each individual experiment. Error bars 

represent standard deviations (SD) of three 

independent experiments unless indicated 

otherwise. Time to event outcomes were assessed 

using Kaplan-Meier curves and distributions 

compared between groups using the Peto-Peto 

test which is less sensitive to late differences than 

the traditional log rank test. For hypothesis testing, 

the alpha level was set at 0.05. 

Results 

miR-204 modulates migration and invasion in non-

transformed and invasive breast cancer cell lines. 

Our group has shown previously that 

overexpression of miR-204 was able to increase 

migration and invasion in the non-invasive breast 

cancer cell line MCF7 (Findlay et al., 2008). 

However, in order to explore this function further, 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e6                                              Cancer Health Disparities 

RESEARCH 

we wanted to assess the role of miR-204 as an 

oncomir in both non-transformed breast cells as 

well as invasive breast cancer cells. A breast cell 

line screen demonstrated that non-transformed 

MCF10A and MCF12A cells had the lowest 

expression levels of miR-204 and the invasive 

breast cancer cell lines MDA-MB-231 and BT549 

had the highest expression levels of miR-204 

(Supplemental Figure 1B). Therefore, we examined 

migration and invasion in non-transformed 

MCF10A and MCF12A breast cell lines in which 

miR-204 had been overexpressed either transiently 

(MCF10A) or stably (MCF12A) (Supplemental Figure 

1D & E). We observed that miR-204 expression 

was able to significantly increase both migration 

and invasion of non-transformed breast cells 

(MCF10A & MCF12A) when overexpressed (Figure 

1A & B). We also examined migration and invasion 

in the invasive breast cancer cell lines MDA-MB-

231 & BT549, in which miR-204 was inhibited 

(Supplemental Figure 1F & G). We observed that 

migration and invasion was inhibited in two 

invasive breast cancer cell lines in which miR-204 

had been suppressed (Figure 1C & D). These data 

lend further support to the proposed oncogenic 

role of miR-204 in breast cancer. We also 

observed that miR-204 increases proliferation in 

the non-invasive MCF10A (Figure 1E) and MCF12A 

(Figure 1F) cells, similar to that observed in MCF7 

cells (Findlay et al., 2008). 

 

Figure 1: miR-204 regulates migration and invasion. Transwell migration (A & C), invasion (B & D) and 

proliferation (E & F) assays of various breast cell lines with either overexpression (A, B, E & F) or inhibition 

(C & D; ASO-204) of miR-204 compared to scrambled (scr) control. MCF10A, MDA-MB-231 and BT549 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e7                                              Cancer Health Disparities 

RESEARCH 

cells were transiently transfected. MCF12A cells were stably transfected. ASO-204 – 

antisenseoligoribonucleotides (miR-204 inhibitors). 

miR-204 is racially disparate and elevated in breast 

cancer 

To further explore potential targets of miR-204 

that may mediate its role as an oncomir in breast 

cancer, we performed a bioinformatical search of 

potential targets in publically available databases 

(Targetscan and miRbase) and identified IGF2R as 

a predicted target, which has been semi-validated 

for miR-204 in human trabecular meshwork (HTM) 

cells (Li et al., 2011). IGF2R is proposed as a tumor 

suppressor and studies have shown that reduced 

IGF2R expression correlates with poor patient 

prognosis in BC patients. Therefore, we wanted to 

explore its role as a direct target of miR-204 in 

breast cancer. To examine whether IGF2R 

expression is repressed by miR-204 through the 

predicted elements, a luciferase reporter construct 

containing the 3′ UTR of IGF2R was transfected 

into breast cancer cells. Cells were co-transfected 

with either miR-204 or an empty vector (EV) 

control. The overexpression of miR-204 led to a 

~30% decrease in luciferase activity when 

compared to EV control (Figure 2A). To show that 

the predicted miR-204 seed sequence within the 

IGF2R 3’UTR was functional we mutated the seed 

sequence of miR-204 in the luciferase reporter 

construct. Co-transfection of cells with the 

mutated luciferase reporter construct (mut 3’UTR) 

and miR-204 did not result in a decrease in 

luciferase activity (Figure 2A) suggesting that miR-

204 directly binds to the predicted site within the 

3’UTR of IGF2R to negatively regulate its 

expression.  

With respect to cancer disparities, a study showed 

significantly higher levels of IGF2R in CA compared 

to AA tumor samples, suggesting that decreased 

IGF2R expression may contribute to BC disparity 

(Kalla Singh et al., 2010). Therefore, we wanted to 

examine whether miR-204 levels differed by AA 

ancestry in BC patients by performing quantitative 

PCR (qPCR) for miR-204 on serum samples. We 

first found that miR-204 levels were elevated in 

high grade when compared to low grade in both 

AA and CA women (Figure 2B). However, it was 

observed that miR-204 levels were significantly 

elevated in AA compared to CA women in the low 

grade cohort of BC patients, but not observed in 

the high grade cohort. We also performed data 

mining in Oncomine for breast cancer using 

TRPM3 as a surrogate marker for miR-204, as (1) 

miR-204 is encoded in the sixth intron of TRPM3, 

(2) the expression of both genes is driven by the 

same promoter, and (3) the expression of both 

genes is positively correlated both in vitro 

(Courboulin et al., 2011; Ying et al., 2013) and in 

vivo (Ding et al., 2015). We found that in this 

dataset that could be examined by race, TRPM3 

levels were higher in AA women when compared 

to CA women with breast cancer. Of interest, this 

dataset showed strikingly decreased levels of 

TRPM3 in women of Asian descent (Figure 2C). 

IGF2R is a direct target of miR-204 in breast cancer 

cells and tissue 

To validate IGF2R as a miR-204 target in breast 

cancer cell lines, miR-204 was overexpressed in 

MCF10A and MCF12A cells by either transient or 

stable transfection. In each case the increased 

expression of miR-204 inhibited endogenous 

IGF2R expression (Figure 2D). mRNA levels of 

IGF2R were assessed by qPCR and analysis 

indicated that the levels of IGF2R mRNA did not 

decrease, which is what we would expect if miR-



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e8                                              Cancer Health Disparities 

RESEARCH 

204 was regulating IGF2R by transcriptional 

degradation. In some cases, we observed an 

increase in IGF2R mRNA transcript levels, 

suggesting that miR-204 regulates IGF2R through 

translational repression (Figure 2E). MDA-MB-231 

and BT549 cells, two invasive breast cancer cell 

lines, were used as a model to inhibit miR-204 

expression. Transfection of antisense 

oligoribonucleotides (ASO) targeted against miR-

204 (ASO 204) in MDA-MB-231 and BT549 cells 

resulted in an increase in IGF2R protein (Figure 2F) 

and mRNA levels (Figure 2G).  

 

Figure 2: miR-204 directly targets IGF2R and is racially disparate in breast cancer. (A) Upper panel: 

Schematic representation of the binding site and complementary seed sequence (upper case bold letters) 

of miR-204 within the 3’UTR of IGF2R. Lower panel: Luciferase activity of breast cells transiently co-

transfected with IGF2R 3’UTR (WT 3’UTR) or mutated IGF2R 3’UTR (mut 3’UTR) and miR-204 (204) or EV 

and Renilla as a control. (B) qPCR analysis of miR-204 expression in serum samples from (n=19) African 

American (AA) and (n=17) Caucasian American (CA) women with either low grade (LG) or high grade (HG) 

breast cancer. (C) TRPM3 mRNA levels in breast cancer patients of Asian, AA and CA race/ethnicity (Bittner 

data set, Oncomine; (Rhodes et al., 2004)). Western blot (D & F) and qPCR (E & G) analysis of IGF2R in 

breast cells either transiently transfected with miR-204 expression vector (MCF10A), or antisense 

oligonucleotides to miR-204 (ASO 204; MDA-MB-231 & BT549) or stably transfected with miR-204 (204-1, 

204-2) or scrambled (scr) control (MCF12A). *p < 0.05 

To examine whether miR-204 regulates IGF2R in 

vivo, we generated a tet-regulatable miR-204 

transgenic (miR-204 Tg) mouse (see Methods). Six 

founder lines were generated and assessed for 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e9                                              Cancer Health Disparities 

RESEARCH 

germline transmission of the transgene and leaky 

expression of miR-204 in the absence of dox. We 

also assessed inducible expression of miR-204 by 

breeding the miR-204 Tg founder mice to mouse 

mammary tumor virus (MMTV)-rtTA (MTB) mice 

that express the reverse tet transactivator (rtTA) in 

the mammary epithelium under the control of the 

mouse MMTV long terminal repeat (Figure 3A) 

(Gunther et al., 2002). Bigenic mice were fed 

mouse chow containing the tet analog doxycycline 

(Dox) ad libitum to induce transgene expression. 

The mice were sacrificed, and the mammary 

glands were extracted and either fresh frozen for 

RNA extraction or fixed and embedded for 

immunohistochemical analysis. qPCR analysis on 

RNA from the dox-fed mice (for 7 days) showed 

that we achieved a 15 - 30 fold increase in 

expression of miR-204 in the miR-204 Tg mice 

when compared to the control non transgenic 

(non Tg) mice (Figure 3B). We also examined the 

mammary tissue for IGF2R expression and 

observed a significant decrease in IGF2R protein 

levels in the miR-204 Tg mice when compared to 

non Tg control mice (Figure 3C), suggesting that 

miR-204 negatively regulates IGF2R in vivo. 

Interestingly, we observed no significant decrease 

in IGF2R mRNA levels when miR-204 was 

overexpressed in vivo (Figure 3D), suggesting that 

miR-204 regulates IGF2R by translational 

repression, similar to that observed in vitro. 

miR-204 transgene expression in the mammary 

epithelium of MMTV-Neu mice increases tumor 

growth and metastasis 

To examine the effects of miR-204 overexpression 

on mammary tumor growth, miR-204 Tg mice 

were bred to the MMTV-Neu mice (see Methods). 

This model was chosen since we have observed a 

significant increase in the expression levels of miR-

204 in tumors derived from these mice when 

compared to mammary tissue from normal ‘non-

tumor’ mice (Supplemental Figure 1C). Mice were 

fed dox chow from 3 weeks of age to induce 

transgene expression in the trigenic mice and to 

control for any effects of dox on mammary 

tumorigenesis and progression in the bigenic 

control groups. Mice were palpated weekly at 5 

months of age to detect tumors, and the age of 

onset and location of the tumor were recorded. 

We found that miR-204 overexpression did not 

affect tumor latency (Supplemental Figure 2A). The 

median time to tumor onset for non Tg mice was 

37.5 weeks (95% CI: 35,47) and for miR-204 Tg 

mice was 39.0 weeks (95% CI: 35,Inf) as 

determined by Kaplan-Meier analysis (p=0.55). 

However, once tumors formed (tumor onset), time 

to sacrifice was shorter in the miR-204 Tg mice 

(2.0 weeks (95%CI: 2, Inf)) than in the non Tg mice 

(5.5 weeks (95% CI: 4, Inf)) (p=0.02) (Figure 3E). 

There was no statistical difference in either 

multiplicity or tumor location between the groups 

(Supplemental Figure 2B).  

Histological examination of the tumors revealed 

differences between the non Tg and miR-204 Tg 

mice (Figure 3F). Tumors from miR-204 Tg mice 

displayed cells arranged in nests and packets with 

increased numbers of pseudo-rosettes 

surrounding blood vessels. These tumors also 

displayed more abundant vasculature, and 

peripherally, the cells appeared more spindloid in 

shape with looser arrangement of cells centrally. 

Altogether, these changes in the miR-204 Tg 

derived tumors are consistent with 

neuroendocrine differentiation. The tumors from 

the non Tg derived mice are arranged in solid 

sheets. Few mitoses are present, and most cells are 

monomorphic with no evidence of differentiation. 

A few apoptotic cells were observed scattered 

throughout the tumors. No major differences were 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e10                                              Cancer Health Disparities 

RESEARCH 

observed in miR-204 expression between the non 

Tg and 204 Tg tumors as expected at the endpoint 

of analysis, as we have previously described that 

this model increases expression of miR-204 during 

tumorigenesis. As the tumors displayed a more 

aggressive phenotype once formed, we assessed 

proliferation by immunostaining with Ki67 (Figure 

3F). Although we observed a trend towards an 

increase in the miR-204 Tg tumors, quantitative 

analysis showed that the observed increase did not 

reach statistical significance (p=0.17) when 

compared to the non Tg controls (Figure 3G). To 

determine whether miR-204 overexpression 

altered tumor metastasis, the number of 

micrometastatic lesions was analyzed in serial 

sections of lungs from tumor bearing mice. We 

observed an increase in the total number of lung 

micrometastases in the miR-204 Tg (27.1 ± 2.0 SD) 

mice when compared to the non Tg (51.9 ± 5.7 

SD) control mice (p<0.001) (Figure 3H). 

 

Figure 3: miR-204 drives aggressive tumor growth in vivo. (A) A schematic of the two constructs used to 

generate bigenic tet-regulatable miR-204 transgenic mice (adapted from (Vargo-Gogola et al., 2006)). (B) 

qPCR analysis of miR-204 transgene expression in mammary glands from control and dox-induced (for 7 

days; 6 week old) mice. (C) Immunohistochemistry of IGF2R in non-transgenic (Non Tg) and miR-204 

bigenic (miR-204 Tg) mice fed dox for 4 days. (D) qPCR analysis of IGF2R levels in RNA extracted from 

glands illustrated in panel C. (E) Time to sacrifice from time of onset in non Tg (black lines) and miR-204 

Tg (red lines) mice. (F) Representative images of H&E and Ki67 IHC. Quantitation of (G) Ki67 and (H) lung 

metastases in non Tg (black circles) and miR-204 Tg (black squares) mice. Bars represent the mean ± SEM. 

Exogenous IGF2R expression inhibits miR-204-

mediated cell migration and invasion  

miRNAs have multiple targets, and therefore, the 

effects observed after miR-204 expression may be 

the result of the decreased IGF2R protein, as well as 

non IGF2R-related miR-204 effects. One way to 

evaluate these possibilities is to examine the 

phenotypes in cells in which a non-targeted IGF2R is 

expressed. To test this possibility, the open reading 

frame (ORF) of IGF2R was transiently transfected into 

MCF10A cells stably infected with miR-204 

(Supplemental Figure 3). As we have previously 

observed, the protein levels of IGF2R were reduced 

in the miR-204 expressing cells. In contrast, a smaller 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e11                                              Cancer Health Disparities 

RESEARCH 

reduction of IGF2R was observed in the cells 

expressing the non-targetable (ORF) form of IGF2R 

(Figure 4A). When we assessed migration and 

invasion in the IGF2R overexpressing cells, we did not 

observe an increase in either migration (Figure 4B) or 

invasion (Figure 4C) when miR-204 was co-

expressed suggesting that miR-204 does increase 

migration and invasion through the negative 

regulation of IGF2R.  

IGF2 stimulates the IGF1R signaling pathway when 

IGF2R is inhibited by miR-204  

IGF2 preferentially binds to the IGF2R; however, it 

is also known to act as an autocrine and paracrine 

regulator of IGF1R, leading to downstream 

activation of the PI3K and MAPK/ERK signaling 

pathways and cell proliferation/survival (Flanigan 

et al., 2013; LeRoith and Roberts, 2003). Therefore, 

to determine whether IGF2 stimulates the IGF1R 

signaling pathway preferentially in the presence of 

miR-204 (or in the absence of IGF2R), we treated 

MCF10A cells expressing miR-204 with IGF2 and 

performed western blot analysis to assess the 

IGF1R signaling pathway (Supplemental Figure 4A-

C). We observed a decrease in IGF2R protein 

expression when control cells were treated with 

IGF2; however, no further decrease in IGF2R 

expression was observed in the miR-204 

expressing cells treated with IGF2 (Figure 4D). 

Importantly, we observed more robust activation 

of the IGF1R signaling pathway upon IGF2 

treatment when miR-204 was overexpressed as 

illustrated by increased phosphorylation of IRS-1, 

an intracellular signaling adaptor protein and the 

main substrate of the IGF1R (Dearth et al., 2007), 

and AKT (Figure 4E). We did not observe increased 

activation of the ERK pathway in 204-expressing 

cells in response to stimulation with IGF2. 

 

Figure 4: miR-204 drives IGF2 mediated activation of the IGF1R signaling pathway. Western blot (A) and 

transwell migration (B) and invasion (C) assays of miR-204 stably infected MCF10A cells transiently 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e12                                              Cancer Health Disparities 

RESEARCH 

transfected with IGF2R or empty vector (EV). Western blot analysis (D & E) of the IGF1R signaling pathway 

and qPCR analysis of PUMA and NOXA (F) in MCF12A cells stably infected with miR-204 or scr control and 

treated with (+) or without (-) 50 nM IGF2 for 5 minutes. 

PUMA (p53 upregulated modulator of apoptosis) 

and NOXA (phorbol-12-myristate-13-acetate-

induced protein 1) are proteins that play a key role 

in apoptotic signaling and have been shown to be 

negatively regulated by IGF1R/IRS-1/AKT signaling 

pathway in response to certain stimuli to increase 

cell survival and proliferation (Bean et al., 2013; 

You et al., 2006). We performed qPCR to assess 

PUMA and NOXA levels in response to IGF2 

stimulation in miR-204 expressing cells. In contrast 

to cells with an intact IGF2R ‘sink’ for IGF2, we 

observe a significant decrease in PUMA and NOXA 

transcripts when stimulated with IGF2 in miR-204 

expressing cells (Figure 4F). 

miR-204 mediates migration through activation of 

the IGF1R signaling pathway 

To determine whether miR-204 mediates its 

functional effects through activation of the IGF1R 

we transiently transfected IGF1R expressing, or 

control, MCF10A cells (Kim et al., 2007) with miR-

204 (Supplemental Figure 4D & E). We observed 

activation of AKT in the IGF1R expressing cells 

alone, but no additional increase when miR-204 

was co-expressed (Figure 5A). As expected, both 

miR-204 and IGF1R expression alone increased 

migration; however, no additional increase in 

migration was observed when they were co-

expressed (Figure 5B), suggesting that IGF1R and 

miR-204 function through the same signaling 

pathway to increase migration. To assess whether 

IGF1R is required for miR-204 mediated increase in 

migration, we inhibited IGF1R expression in 

MCF12A cells with and without miR-204 expression 

with two short hairpins specific to IGF1R (Figure 

5C). As expected, we observed a significant 

decrease in migration when IGF1R was inhibited in 

the MCF12A control cells. However, when miR-204 

was expressed in the presence of the IGF1R 

inhibitor, no increase in migration was observed 

suggesting that IGF1R is required for miR-204 

mediated migration in breast cells (Figure 5D). 

 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e13                                              Cancer Health Disparities 

RESEARCH 

Figure 5: miR-204 mediates migration through activation of the IGF1R signaling pathway. Western blot (A) 

and transwell migration (B) assays of IGF1R stably infected MCF10A cells transiently transfected with miR-

204 or scr control. Western blot (C) and transwell migration (D) assays of MCF12A cells stably infected with 

miR-204 or scr control and transiently transfected with short hairpin constructs to IGF1R (sh #1 & sh #2). 

IGF1R in panel C is shown for both a short (upper panel) and long (lower panel) exposure time. 

DISCUSSION 

miR-204, the miRNA of interest in this proposal, is 

located on chromosome 9q21, a region that is 

reported to be amplified in cancer (Bussemakers et 

al., 1999). There are multiple studies that have 

investigated the role of miR-204 in solid cancers, 

including melanoma, glioma, NSCLC, bladder 

cancer, gastric cancer, head and neck cancer, and 

endometrial cancer. These studies have all 

reported reduced levels of miR-204 in these solid 

cancers (Chung et al., 2012; Lam et al., 2011; 

Schultz et al., 2008; Xia et al., 2014). However, with 

respect to hormonally driven cancers, e.g., 

prostate and breast, the story appears to be more 

complex. Our group and others have shown that 

miR-204 levels are significantly elevated in breast 

cancer samples compared to normal controls 

(Findlay et al., 2008; Mattie et al., 2006). Published 

studies also suggest its role as a tumor suppressor 

in breast cancer (Li et al., 2014). 

More recently, two studies were published by 

independent groups that support the role of miR-

204 acting as an oncogene, or “oncomir”, in 

cancer (Lee et al., 2016; Todorova et al., 2016). The 

first was a study aimed at solving the controversy 

surrounding the seemingly opposing effects of 

miR-204 in breast cancer (Lee et al., 2016). They 

performed genome wide pathway analysis and 

showed definitively that many of the miR-204 

target genes are tumor suppressors. It is this 

characteristic that drives the breast cells towards 

being oncogenic. However, they agree and 

support the idea that context is important, and the 

potential dual activity requires further 

investigation. The second paper, recently 

published, investigated specifically the proposed 

dual role of miR-204 in cancer (Todorova et al., 

2016). This study showed that the genomic 

instability incurred rearrangement could turn 

tumor suppressor miRNAs into pro-oncogenic 

ones, using metastatic prostate cancer as a model 

system. Both studies clearly demonstrate a dual 

role for miR-204 depending on context.  

Furthermore, a study in prostate cancer showed a 

dual role for miR-204 depending additionally on 

the subtype of prostate cancer in which it was 

expressed (Ding et al., 2015). In brief, the authors 

show that in the context of androgen receptor 

positive (AR+) prostate adenocarcinoma, miR-204 

functions as a tumor suppressor. However, in the 

context of androgen receptor negative (AR-) 

neuroendocrine prostate cancer, miR-204 

functions as an oncogene. The dual regulatory role 

of miR-204 in cancer was recently reviewed and 

highlighted the fact that the cell type in which 

miR-204 is being expressed, as well as the make-

up of that cell, are critical to the function of miR-

204 within that cell (Li et al., 2016). More studies 

are required to determine whether the role of 

miR-204 in breast cancer is also dependent upon 

AR expression, an understudied receptor in the 

breast cancer field. Of interest, a study was 

recently published showing a positive correlation 

between AR expression and PDEF in breast cancer 

(Cao et al., 2018). This is important in the 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e14                                              Cancer Health Disparities 

RESEARCH 

discussion of miR-204 as (i) PDEF was one of the 

first identified targets for miR-204 in breast cancer 

(Findlay et al., 2008); and (ii) we observed a 

neuroendocrine pathology in mammary tumors 

derived from our 204 Tg animals and 

neuroendocrine prostate tumors are known to be 

AR negative (Tsai et al., 2017). 

Our studies support the working hypothesis that 

miR-204 mediated inhibition of IGF2R frees IGF2 to 

bind the IGF1R leading to hyperactivation of this 

pathway, resulting in increased proliferation, 

migration and invasion, processes required for 

tumor progression (Figure 6). The generation and 

utility of an in vivo model for miR-204 is a more 

physiologically representative model than cells 

grown in culture. Our development of a unique 

inducible transgenic mouse model has allowed us 

to investigate the oncogenic potential of miR-204 

and furthermore, has provided compelling data to 

help resolve the controversy surrounding the role 

of miR-204 in a cellular context. Histologically, the 

tumors that developed in the miR-204 transgenic 

mice were distinct from the control non-transgenic 

mice. We observed increased vasculature and a 

more spindle-like appearance, indicative of 

neuroendocrine differentiation. This has potential 

interest based on the observation mentioned 

above that miR-204 is specifically expressed and 

functions as on oncomir in neuroendocrine 

prostate cancer. Future studies aimed at 

investigating the potential role of miR-204 in 

driving neuroendocrine differentiation in tumors 

may have implications for both prostate and 

breast cancers. 

 

 

Figure 6: Schematic model of our proposed mechanism for miR-204 mediated tumor progression. In 

normal (low miR-204) cells, IGF2 preferentially binds to the IGF2R where it gets internalized and degraded 

by the lysosomes. Therefore, IGF1R signaling is kept to a minimum. However, in cancer (high miR-204) 

cells, we propose that miR-204 mediated inhibition of IGF2R frees IGF2 to bind the IGF1R leading to 

hyperactivation of this pathway resulting in increased proliferation, migration and invasion, processes 

required for tumor progression.

 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e15                                              Cancer Health Disparities 

RESEARCH 

Reduced IGF2R expression correlates with poor 

patient prognosis in BC patients (Chappell et al., 

1997; Hankins et al., 1996), and a recent study 

showed significantly higher levels of IGF2R in 

Caucasian Americans (CA) compared to African 

American (AA) tumor samples, suggesting that 

decreased IGF2R expression may contribute to BC 

disparity (Kalla Singh et al., 2010). We observed 

elevated miR-204 levels in AA compared to CA 

women; specifically in the low-grade samples. 

Interestingly, loss of IGF2R is an early 

transformational event in breast cancer, occurring 

in the initiation rather than the progression stage 

of carcinogenesis. Therefore, we postulate that 

overexpression of miR-204 may be an early 

initiating event in AA women, leading to the loss of 

IGF2R and more aggressive disease (Figure 6). 

Acknowledgements 

We thank Dr. Tracy Vargo-Gogola (Indiana 

University School of Medicine) for the pTetOSplice 

vector and the MCF7 Tet On cell line, Dr. Lukas 

Mach (University of Natural Resources and Life 

Sciences, Vienna (BOKU)) for the IGF2R construct, 

Dr. Adrian Lee (University of Pittsburgh) for the 

MCF10A/IGF1R cell lines, Dr. Lewis Chodosh 

(University of Pennsylvania) for the MTB mice and 

Drs. Jeffrey Rosen, Suzanne Fuqua, Kent Osbourne 

(Baylor College of Medicine) and Dr. Steve 

Rosenzweig (MUSC) for their scientific expertise 

and guidance throughout the study. 

Conflict of interest 
The authors declare that no competing or conflict of 

interests exist. The funders had no role in study 

design, writing of the manuscript, or decision to 

publish. 

Authors’ contributions 

LMN and JDF performed the luciferase and western 

blot assays. LMN and LB performed the qPCR assays. 

LMN and DPT performed the functional and rescue 

experiments. LMN and CEB performed the in vivo 

experiments. KLH performed the histological analysis 

of the tumors. EGM analyzed and performed 

statistical analysis on the in vivo data. VJF conceived 

of the study and participated in its design and 

coordination, and with DPT and DKW drafted the 

manuscript. All authors read and approved the final 

manuscript. 

Funding 
This work was supported in part by the Transgenic 

Mouse Core Facility, the Genomics/shRNA Shared 

Resource, Hollings Cancer Center, Medical University 

of South Carolina (P30 CA138313) and by the 

Department of Defense Inter-Institutional Training 

Award W81XWH-10-BCRP-IITA.  

REFERENCES 
Albain, K.S., Unger, J.M., Crowley, J.J., Coltman, C.A., Jr., and 

Hershman, D.L. (2009). Racial disparities in cancer survival 

among randomized clinical trials patients of the 

Southwest Oncology Group. J Natl Cancer Inst 101, 984-

992. 

Bean, G.R., Ganesan, Y.T., Dong, Y., Takeda, S., Liu, H., Chan, 

P.M., Huang, Y., Chodosh, L.A., Zambetti, G.P., Hsieh, J.J., 

et al. (2013). PUMA and BIM are required for oncogene 

inactivation-induced apoptosis. Sci Signal 6, ra20. 

Bussemakers, M.J., van Bokhoven, A., Verhaegh, G.W., Smit, 

F.P., Karthaus, H.F., Schalken, J.A., Debruyne, F.M., Ru, N., 

and Isaacs, W.B. (1999). DD3: a new prostate-specific 

gene, highly overexpressed in prostate cancer. Cancer 

Res 59, 5975-5979. 

Cao, L., Li, C., Xu, C., Xiang, G., Liu, F., Liu, X., Jiao, J., Lv, S., 

and Niu, Y. (2018). Clinical significance of PDEF factor 

expression and its relation to androgen receptor in ER(-) 

breast cancer. Histopathology. 

Chappell, S.A., Walsh, T., Walker, R.A., and Shaw, J.A. (1997). 

Loss of heterozygosity at the mannose 6-phosphate 

insulin-like growth factor 2 receptor gene correlates with 

poor differentiation in early breast carcinomas. Br J 

Cancer 76, 1558-1561. 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e16                                              Cancer Health Disparities 

RESEARCH 

Chen, Z., Ge, Y., Landman, N., and Kang, J.X. (2002). 

Decreased expression of the mannose 6-

phosphate/insulin-like growth factor-II receptor 

promotes growth of human breast cancer cells. BMC 

Cancer 2, 18. 

Chung, T.K., Lau, T.S., Cheung, T.H., Yim, S.F., Lo, K.W., Siu, 

N.S., Chan, L.K., Yu, M.Y., Kwong, J., Doran, G., et al. 

(2012). Dysregulation of microRNA-204 mediates 

migration and invasion of endometrial cancer by 

regulating FOXC1. Int J Cancer 130, 1036-1045. 

Courboulin, A., Paulin, R., Giguere, N.J., Saksouk, N., Perreault, 

T., Meloche, J., Paquet, E.R., Biardel, S., Provencher, S., 

Cote, J., et al. (2011). Role for miR-204 in human 

pulmonary arterial hypertension. J Exp Med 208, 535-

548. 

Dearth, R.K., Cui, X., Kim, H.J., Hadsell, D.L., and Lee, A.V. 

(2007). Oncogenic transformation by the signaling 

adaptor proteins insulin receptor substrate (IRS)-1 and 

IRS-2. Cell Cycle 6, 705-713. 

Dennis, P.A., and Rifkin, D.B. (1991). Cellular activation of latent 

transforming growth factor beta requires binding to the 

cation-independent mannose 6-phosphate/insulin-like 

growth factor type II receptor. Proc Natl Acad Sci U S A 

88, 580-584. 

Ding, M., Lin, B., Li, T., Liu, Y., Li, Y., Zhou, X., Miao, M., Gu, J., 

Pan, H., Yang, F., et al. (2015). A dual yet opposite 

growth-regulating function of miR-204 and its target 

XRN1 in prostate adenocarcinoma cells and 

neuroendocrine-like prostate cancer cells. Oncotarget 6, 

7686-7700. 

Findlay, V.J., Turner, D.P., Moussa, O., and Watson, D.K. 

(2008). MicroRNA-mediated inhibition of prostate-

derived Ets factor messenger RNA translation affects 

prostate-derived Ets factor regulatory networks in human 

breast cancer. Cancer Res 68, 8499-8506. 

Flanigan, S.A., Pitts, T.M., Newton, T.P., Kulikowski, G.N., Tan, 

A.C., McManus, M.C., Spreafico, A., Kachaeva, M.I., Selby, 

H.M., Tentler, J.J., et al. (2013). Overcoming IGF1R/IR 

resistance through inhibition of MEK signaling in 

colorectal cancer models. Clin Cancer Res 19, 6219-6229. 

Frasca, F., Pandini, G., Scalia, P., Sciacca, L., Mineo, R., 

Costantino, A., Goldfine, I.D., Belfiore, A., and Vigneri, R. 

(1999). Insulin receptor isoform A, a newly recognized, 

high-affinity insulin-like growth factor II receptor in fetal 

and cancer cells. Mol Cell Biol 19, 3278-3288. 

Gunther, E.J., Belka, G.K., Wertheim, G.B., Wang, J., Hartman, 

J.L., Boxer, R.B., and Chodosh, L.A. (2002). A novel 

doxycycline-inducible system for the transgenic analysis 

of mammary gland biology. FASEB J 16, 283-292. 

Guo, Q.J., Mills, J.N., Bandurraga, S.G., Nogueira, L.M., Mason, 

N.J., Camp, E.R., Larue, A.C., Turner, D.P., and Findlay, 

V.J. (2013). MicroRNA-510 promotes cell and tumor 

growth by targeting peroxiredoxin1 in breast cancer. 

Breast Cancer Res 15, R70. 

Hankins, G.R., De Souza, A.T., Bentley, R.C., Patel, M.R., Marks, 

J.R., Iglehart, J.D., and Jirtle, R.L. (1996). M6P/IGF2 

receptor: a candidate breast tumor suppressor gene. 

Oncogene 12, 2003-2009. 

Hu, C.K., McCall, S., Madden, J., Huang, H., Clough, R., Jirtle, 

R.L., and Anscher, M.S. (2006). Loss of heterozygosity of 

M6P/IGF2R gene is an early event in the development of 

prostate cancer. Prostate Cancer Prostatic Dis 9, 62-67. 

Imam, J.S., Plyler, J.R., Bansal, H., Prajapati, S., Bansal, S., 

Rebeles, J., Chen, H.I., Chang, Y.F., Panneerdoss, S., 

Zoghi, B., et al. (2012). Genomic loss of tumor suppressor 

miRNA-204 promotes cancer cell migration and invasion 

by activating AKT/mTOR/Rac1 signaling and actin 

reorganization. PLoS One 7, e52397. 

Iwamoto, K.S., Yano, S., Barber, C.L., MacPhee, D.G., and 

Tokuoka, S. (2006). A dose-dependent decrease in the 

fraction of cases harboring M6P/IGF2R mutations in 

hepatocellular carcinomas from the atomic bomb 

survivors. Radiat Res 166, 870-876. 

Kalla Singh, S., Tan, Q.W., Brito, C., De Leon, M., and De Leon, 

D. (2010). Insulin-like growth factors I and II receptors in 

the breast cancer survival disparity among African-

American women. Growth Horm IGF Res 20, 245-254. 

Kang, J.X., Li, Y., and Leaf, A. (1997). Mannose-6-

phosphate/insulin-like growth factor-II receptor is a 

receptor for retinoic acid. Proc Natl Acad Sci U S A 94, 

13671-13676. 

Kim, H.J., Litzenburger, B.C., Cui, X., Delgado, D.A., Grabiner, 

B.C., Lin, X., Lewis, M.T., Gottardis, M.M., Wong, T.W., 

Attar, R.M., et al. (2007). Constitutively active type I 

insulin-like growth factor receptor causes transformation 

and xenograft growth of immortalized mammary 

epithelial cells and is accompanied by an epithelial-to-

mesenchymal transition mediated by NF-kappaB and 

snail. Mol Cell Biol 27, 3165-3175. 

Lam, E.K., Wang, X., Shin, V.Y., Zhang, S., Morrison, H., Sun, J., 

Ng, E.K., Yu, J., and Jin, H. (2011). A microRNA 

contribution to aberrant Ras activation in gastric cancer. 

Am J Transl Res 3, 209-218. 

Lee, H., Lee, S., Bae, H., Kang, H.S., and Kim, S.J. (2016). 

Genome-wide identification of target genes for miR-204 

and miR-211 identifies their proliferation stimulatory role 

in breast cancer cells. Sci Rep 6, 25287. 

LeRoith, D., and Roberts, C.T., Jr. (2003). The insulin-like 

growth factor system and cancer. Cancer Lett 195, 127-

137. 

Li, G., Luna, C., Qiu, J., Epstein, D.L., and Gonzalez, P. (2011). 

Role of miR-204 in the regulation of apoptosis, 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e17                                              Cancer Health Disparities 

RESEARCH 

endoplasmic reticulum stress response, and inflammation 

in human trabecular meshwork cells. Invest Ophthalmol 

Vis Sci 52, 2999-3007. 

Li, T., Pan, H., and Li, R. (2016). The dual regulatory role of 

miR-204 in cancer. Tumour Biol 37, 11667-11677. 

Li, W., Jin, X., Zhang, Q., Zhang, G., Deng, X., and Ma, L. 

(2014). Decreased expression of miR-204 is associated 

with poor prognosis in patients with breast cancer. Int J 

Clin Exp Pathol 7, 3287-3292. 

Mattie, M.D., Benz, C.C., Bowers, J., Sensinger, K., Wong, L., 

Scott, G.K., Fedele, V., Ginzinger, D., Getts, R., and Haqq, 

C. (2006). Optimized high-throughput microRNA 

expression profiling provides novel biomarker assessment 

of clinical prostate and breast cancer biopsies. Mol 

Cancer 5, 24. 

Oates, A.J., Schumaker, L.M., Jenkins, S.B., Pearce, A.A., 

DaCosta, S.A., Arun, B., and Ellis, M.J. (1998). The 

mannose 6-phosphate/insulin-like growth factor 2 

receptor (M6P/IGF2R), a putative breast tumor 

suppressor gene. Breast Cancer Res Treat 47, 269-281. 

Oka, Y., Rozek, L.M., and Czech, M.P. (1985). Direct 

demonstration of rapid insulin-like growth factor II 

Receptor internalization and recycling in rat adipocytes. 

Insulin stimulates 125I-insulin-like growth factor II 

degradation by modulating the IGF-II receptor recycling 

process. J Biol Chem 260, 9435-9442. 

Rhodes, D.R., Yu, J., Shanker, K., Deshpande, N., Varambally, 

R., Ghosh, D., Barrette, T., Pandey, A., and Chinnaiyan, 

A.M. (2004). ONCOMINE: a cancer microarray database 

and integrated data-mining platform. Neoplasia 6, 1-6. 

Schultz, J., Lorenz, P., Gross, G., Ibrahim, S., and Kunz, M. 

(2008). MicroRNA let-7b targets important cell cycle 

molecules in malignant melanoma cells and interferes 

with anchorage-independent growth. Cell Res 18, 549-

557. 

Todorova, K., Metodiev, M.V., Metodieva, G., Zasheva, D., 

Mincheff, M., and Hayrabedyan, S. (2016). miR-204 is 

dysregulated in metastatic prostate cancer in vitro. Mol 

Carcinog 55, 131-147. 

Tsai, H.K., Lehrer, J., Alshalalfa, M., Erho, N., Davicioni, E., and 

Lotan, T.L. (2017). Gene expression signatures of 

neuroendocrine prostate cancer and primary small cell 

prostatic carcinoma. BMC Cancer 17, 759. 

Tsujiuchi, T., Sasaki, Y., Oka, Y., Kuniyasu, H., Konishi, Y., and 

Tsutsumi, M. (2004). Alterations of the M6p/Igf2 receptor 

gene in hepatocellular carcinomas induced by N-

nitrosodiethylamine and a choline-deficient L-amino 

acid-defined diet in rats. Mol Carcinog 39, 199-205. 

Ulanet, D.B., Ludwig, D.L., Kahn, C.R., and Hanahan, D. (2010). 

Insulin receptor functionally enhances multistage tumor 

progression and conveys intrinsic resistance to IGF-1R 

targeted therapy. Proc Natl Acad Sci U S A 107, 10791-

10798. 

Vargo-Gogola, T., Heckman, B.M., Gunther, E.J., Chodosh, 

L.A., and Rosen, J.M. (2006). P190-B Rho GTPase-

activating protein overexpression disrupts ductal 

morphogenesis and induces hyperplastic lesions in the 

developing mammary gland. Mol Endocrinol 20, 1391-

1405. 

Vimalraj, S., Miranda, P.J., Ramyakrishna, B., and 

Selvamurugan, N. (2013). Regulation of breast cancer and 

bone metastasis by microRNAs. Dis Markers 35, 369-387. 

Xia, Y., Zhu, Y., Ma, T., Pan, C., Wang, J., He, Z., Li, Z., Qi, X., 

and Chen, Y. (2014). miR-204 functions as a tumor 

suppressor by regulating SIX1 in NSCLC. FEBS Lett 588, 

3703-3712. 

Ying, Z., Li, Y., Wu, J., Zhu, X., Yang, Y., Tian, H., Li, W., Hu, B., 

Cheng, S.Y., and Li, M. (2013). Loss of miR-204 expression 

enhances glioma migration and stem cell-like phenotype. 

Cancer Res 73, 990-999. 

You, H., Pellegrini, M., Tsuchihara, K., Yamamoto, K., Hacker, 

G., Erlacher, M., Villunger, A., and Mak, T.W. (2006). 

FOXO3a-dependent regulation of Puma in response to 

cytokine/growth factor withdrawal. J Exp Med 203, 1657-

1663. 

Yu, H., Levesque, M.A., Khosravi, M.J., Papanastasiou-

Diamandi, A., Clark, G.M., and Diamandis, E.P. (1996). 

Associations between insulin-like growth factors and their 

binding proteins and other prognostic indicators in 

breast cancer. Br J Cancer 74, 1242-1247. 

  

 

  



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e18                                              Cancer Health Disparities 

RESEARCH 

Supplementary Data:  

 

Supplemental Figure 1: Western blot of IGF2R (A) and qPCR analysis of mir-204 expression levels in various 

human breast cell lines (B) and normal and breast cancer mouse tissue (C). qPCR analysis of miR-204 

expression levels in cell lines after either miR-204 overexpression in MCF10A(D)  and MCF12A(E)  cells or 

miR-204 inhibition in MDA-MB-231 (F) and BT549(G) cells. *p < 0.05 

 

Supplemental Figure 2: Time to tumor onset (A) and tumor multiplicity (B) in non Tg (black lines) and miR-

204 Tg (red lines) mice. 



 
 
 
 
 

 

www.companyofscientists.com/index.php/chd                   e19                                              Cancer Health Disparities 

RESEARCH 

 

Supplemental Figure 3: qPCR analysis of (A) IGF2R and (B) mir-204 expression levels in MCF10A cells 

transiently transfected with IGF2R or empty vector (EV) control.  

 

Supplemental Figure 4: qPCR analysis of (A) miR-204, (B) IGF2R and (C) IGF1R expression levels in MCF12A 

cells stably transfected with miR-204 and either untreated or treated with 50nM IGF2 for 5 minutes. qPCR 

analysis of (D) IGF1R and (E) mir-204 expression levels in MCF10A cells stably expressing IGF1R or control 

cells and then transiently transfected with miR-204 or scr control.  

 

 


